U.S. patent application number 13/644363 was filed with the patent office on 2013-04-04 for oligomers.
This patent application is currently assigned to ROYAL HOLLOWAY AND BEDFORD NEW COLLEGE. The applicant listed for this patent is Royal Holloway and Bedford New College. Invention is credited to John George Dickson, Jagjeet Kaur Kang.
Application Number | 20130085139 13/644363 |
Document ID | / |
Family ID | 47993177 |
Filed Date | 2013-04-04 |
United States Patent
Application |
20130085139 |
Kind Code |
A1 |
Dickson; John George ; et
al. |
April 4, 2013 |
Oligomers
Abstract
Certain disclosed oligomers induce exon skipping during
processing of myostatin pre-mRNA. The oligomers may be in a vector
or encoded by the vector. The vector is used for inducing exon
skipping during processing of myostatin pre-mRNA. A therapeutically
effective amount of the oligomer may be administered to a subject
patient such that exon skipping during processing of myostatin
pre-mRNA is induced. The administration to a subject may be used in
order to increase or maintain muscle mass, or slowing degeneration
of muscle mass in the subject. The administration to a subject may
ameliorate muscle wasting conditions, such as muscular dystrophy.
Examples of such muscular dystrophies which may be so treated
include Becker's muscular dystrophy, congenital muscular dystrophy,
Duchenne muscular dystrophy, distal muscular dystrophy,
Emery-Dreifuss muscular dystrophy, facioscapulohumeral muscular
dystrophy (FSHD), limb-girdle muscular dystrophy, myotonic muscular
dystrophy, and oculopharyngeal muscular dystrophy
Inventors: |
Dickson; John George;
(London, GB) ; Kang; Jagjeet Kaur; (Surrey,
GB) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Royal Holloway and Bedford New College; |
Surrey |
|
GB |
|
|
Assignee: |
ROYAL HOLLOWAY AND BEDFORD NEW
COLLEGE
SURREY
GB
|
Family ID: |
47993177 |
Appl. No.: |
13/644363 |
Filed: |
October 4, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61543145 |
Oct 4, 2011 |
|
|
|
Current U.S.
Class: |
514/232.5 ;
435/320.1; 514/44A; 536/24.5; 544/81 |
Current CPC
Class: |
A61P 21/00 20180101;
C12N 2310/314 20130101; C12N 2310/3233 20130101; C12N 2320/33
20130101; C12N 15/1136 20130101; C12N 2310/11 20130101; A61K 47/54
20170801; C07H 21/04 20130101; C12N 15/1138 20130101; C12N 2320/31
20130101; C12N 2320/30 20130101; C12N 2310/321 20130101 |
Class at
Publication: |
514/232.5 ;
536/24.5; 544/81; 514/44.A; 435/320.1 |
International
Class: |
A61K 31/5377 20060101
A61K031/5377; C12N 15/85 20060101 C12N015/85; A61K 31/713 20060101
A61K031/713; A61P 21/00 20060101 A61P021/00; C07H 21/04 20060101
C07H021/04; C07D 473/34 20060101 C07D473/34 |
Claims
1. An oligomer for inducing exon skipping during processing of
myostatin pre-mRNA, the oligomer comprising at least 20 contiguous
bases of a base sequence selected from the group consisting of:
TABLE-US-00005 (SEQ ID NO. 1) 1) XCXCGACGGGXCXCAAAXAXAXCCAXAGXX;
(SEQ ID NO. 2) 2) XGXACCGXCXXXCAXAGGXXXGAXGAGXCX; (SEQ ID NO. 3) 3)
CCXGGGXXCAXGXCAAGXXXCAGAGAXCGG; (SEQ ID NO. 4) 4)
CAGCCCAXCXXCXCCXGGXCCXGGGAAGGX; (SEQ ID NO. 5) 5)
XCXXGACGGGXCXGAGAXAXAXCCACAGXX; (SEQ ID NO. 6) 6)
XGXACCGXCXXXCAXGGGXXXGAXGAGXCX; (SEQ ID NO. 7) 7)
CCXGGGCXCAXGXCAAGXXXCAGAGAXCGG; (SEQ ID NO. 8) 8)
XCCACAGXXGGGCXXXXACX; (SEQ ID NO. 9) 9) XCXGAGAXAXAXCCACAGXX; (SEQ
ID NO. 10) 10) XCXXGACGGGXCXGAGAXAX; (SEQ ID NO. 11) 11)
XGAXGAGXCXCAGGAXXXGC; (SEQ ID NO. 12) 12) XXCAXGGGXXXGAXGAGXCX;
(SEQ ID NO. 13) 13) XXGXACCGXCXXXCAXGGGX; (SEQ ID NO. 14) 14)
CAGAGAXCGGAXXCCAGXAX; (SEQ ID NO. 15) 15) XGXCAAGXXXCAGAGAXCGG;
(SEQ ID NO. 16) 16) CCXGGGCXCAXGXCAAGXXX; (SEQ ID NO. 17) 17)
CXGGGAAGGXXACAGCAAGA; (SEQ ID NO. 18) 18) XCXCCXGGXCCXGGGAAGGX; and
(SEQ ID NO. 19) 19) CAGCCCAXCXXCXCCXGGXC,
wherein X is T or U and the oligomer's sequence can vary from the
above sequence at up to two base positions, and wherein the
oligomer can bind to a target site in the myostatin pre-mRNA to
cause exon skipping.
2. The oligomer of claim 1, wherein the oligomer causes an exon
skipping rate of at least 50%.
3. The oligomer of claim 1, wherein the oligomer causes an exon
skipping rate of at least 90%.
4. The oligomer of claim 1, wherein the oligomer is a
phosphorodiamidate morpholino oligonucleotide (PMO) or a
phosphorothioate-linked 2'-O-methyl oligonucleotide (2'OMePS).
5. The oligomer of claim 1, wherein the oligomer is a
phosphorodiamidate morpholino oligonucleotide (PMO).
6. The oligomer of claim 1, wherein the oligomer is between 20 and
40 bases in length.
7. The oligomer of claim 1, wherein the oligomer is about 30 bases
in length.
8. The oligomer of claim 1, wherein the base sequence is selected
from the group consisting of SEQ ID NOS. 1-7.
9. The oligomer of claim 1, wherein the base sequence is selected
from the group consisting of SEQ ID NOS. 1-4.
10. The oligomer of claim 1, wherein the oligomer comprises at
least 25 contiguous bases of the base sequence selected from the
group consisting of SEQ ID NOS. 1-7.
11. The oligomer of claim 1, wherein the oligomer comprises at
least 25 contiguous bases of the base sequence selected from the
group consisting of SEQ ID NOS. 1-4.
12. The oligomer of claim 1, wherein the oligomer is conjugated to
or complexed with a distinct chemical entity.
13. A vector for inducing exon skipping during processing of
myostatin pre-mRNA, the vector encoding an oligomer of claim 1,
wherein when the vector is introduced into a cell, the oligomer is
expressed.
14. A method of inducing exon skipping during processing of
myostatin pre-mRNA in a patient, the method comprising
administering a therapeutically effective amount of the oligomer of
claim 1 or the vector of claim 13 to the patient such that exon
skipping during processing of myostatin pre-mRNA is induced.
15. The method of claim 14, wherein the method is for increasing or
maintain muscle mass, or slowing degeneration of muscle mass in the
patient.
16. The method of claim 14, wherein the method is for ameliorating
muscle wasting conditions.
17. The method of claim 14, wherein the method is for ameliorating
a muscular dystrophy such as Becker's muscular dystrophy,
congenital muscular dystrophy, Duchenne muscular dystrophy, distal
muscular dystrophy, Emery-Dreifuss muscular dystrophy,
facioscapulohumeral muscular dystrophy (FSHD), limb-girdle muscular
dystrophy, myotonic muscular dystrophy and oculopharyngeal muscular
dystrophy.
18. The method of claim 14, wherein the method is for ameliorating
Duchenne muscular dystrophy.
19. The method of claim 18, wherein the method further comprises
administering a therapeutically effective amount of an oligomer
which causes exon skipping in the dystrophin gene and which
ameliorates Duchenne muscular dystrophy.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to oligomers which are capable
of causing exon skipping and, in particular, relates to oligomers
which are capable of causing exon skipping in the myostatin
gene.
BACKGROUND TO THE INVENTION
[0002] A range of strategies have been proposed to enhance muscle
bulk and strength as a treatment for a number of age-related muscle
disorders and various neuromuscular disorders, including muscular
dystrophies. Myostatin, a transforming growth factor-.beta. family
member, also called growth and differentiation factor-8, is a
negative regulator of muscle growth and the myostatin signalling
axis has been a major focus in such strategies. Myostatin null or
hypomorphic animals are significantly larger than wild-type animals
and show a large increase in skeletal muscle mass..sup.1 The first
natural myostatin mutation in humans has also been identified in a
young boy..sup.2 Myostatin blockade, therefore, offers a strategy
for counteracting muscle-wasting conditions including Duchenne
muscular dystrophy..sup.3 Delivery of myostatin-inhibiting genes,
including growth and differentiation factor-associated serum
protein-1 (GASP-1), follistatin-related gene (FLRG),
follistatin-344 (FS) and myostatin propeptide, via adeno-associated
virus,.sup.4-6 lead to an increase in muscle mass in treated
animals, with the greatest increase in FS-treated animals..sup.7
Use of potentially therapeutic antimyostatin-blocking antibodies of
high-binding affinity has proved to be a promising strategy.
However, there are some constraints related to the use of
antimyostatin antibodies that include difficulty in long-term
sustainability, undesirable immune responses, and inhibitory
effects not precisely specific to myostatin in regard to muscle
growth..sup.8,9 Significant increase in skeletal muscle mass was
also observed using adeno-associated virus vectors to deliver a
recombinant myostatin propeptide gene fragment, or by a
retrovirus-based RNA interference system (RNAi)..sup.4,6,10 Both
approaches have safety concerns of possible genotoxicity, due to
uncontrolled vector genome insertion into host chromosomes..sup.11
The RNAi system faces an additional hurdle in terms of effective
delivery of the RNAi molecules into the disease models for clinical
studies..sup.12 RNA-based modulation therapy has the potential to
overcome difficulties encountered by conventional gene therapy
methods. Antisense oligonucleotides (AOs) are capable of
hybridizing to a sense target sequence leading to cleavage of the
RNA:DNA hybrid by RNase H which results in downregulation of gene
transcription..sup.13,14 In an alternative approach,
antisense-mediated modulation of pre-mRNA splicing has been
pioneered by Dominski and Kole..sup.15 In the first experiments,
AOs were aimed at activated cryptic splice sites in the
.beta.-globin (HBB) and cystic fibrosis transmembrane conductance
regulator (CFTR) genes in order to restore normal splicing in
.beta.-thalassemia and cystic fibrosis patients..sup.15-17 The
identification of exon/intron boundaries by the splicing machinery,
and therefore inclusion of the exons into the mRNA, is extensively
thought to depend on exonic splicing enhancer (ESE) motifs..sup.18
By masking these ESE sites with sequence-optimized AOs, the
targeted exons are no longer recognized as exons, and are spliced
out with neighbouring introns. This so-called antisense-induced
exon skipping has already been used clinically to partly correct
the mutated dystrophin and convert the severe Duchenne muscular
dystrophy phenotype into a milder Becker muscular dystrophy
phenotype..sup.19 Clinical trials to determine the safety profile
and the efficacy of single intramuscular doses of two different
chemistries of AOs, 2'-O-methyl phosphorothioate (2'OMePS) AOs and
phosphorodiamidate morpholino oligomers (PMOs) in Duchenne muscular
dystrophy patients have recently been completed..sup.20,21 The
treatments were well tolerated by all the patients and the
injection of AOs induced the production of dystrophin. 2'OMePS AOs,
being negatively charged, are easily delivered in vitro, whereas
PMOs are capable of more sustained effect in vivo due to their
resistance to enzymatic degradation.sup.22 and owing to their
longer sequence, have increased affinity to target..sup.23 When
conjugated with various peptide derivatives, or with dendrimeric
octa-guanidine (so-called Vivo-morpholino), PMOs demonstrate a
significantly increased delivery in the case of dystrophin
skipping..sup.24,25
SUMMARY OF THE INVENTION
[0003] The inventors have adopted the approach of using AOs with
different chemistries, so enhancing their half-lives relative to
RNAi molecules, to investigate the outcome of myostatin knockdown
by exon skipping. Skipping of exon 2 (374 nucleotides) of myostatin
leads to an out-of-phase splicing of exons 1 and 3, and knockdown
of myostatin due to truncation of the Open Reading
[0004] Frame and nonsense-mediated mRNA decay. The data present
here constitute a proof-of-principle that oligonucleotide-mediated
antisense exon skipping leads to a physiologically significant
myostatin knockdown in vitro and in vivo. This type of antisense
treatment could thus form part of an effective strategy to improve
various muscle-wasting conditions, and along with dystrophin rescue
or augmentation, to treat Duchenne muscular dystrophy.
[0005] The present invention relates to oligomers which can bind to
pre-mRNA produced from the myostatin gene and cause exon skipping
during cellular processing of the pre-mRNA.
[0006] The present invention provides an oligomer for inducing exon
skipping during processing of myostatin pre-mRNA, the oligomer
comprising at least 20 contiguous bases of a base sequence selected
from the group consisting of:
TABLE-US-00001 (SEQ ID NO. 1) 1) XCXCGACGGGXCXCAAAXAXAXCCAXAGXX;
(SEQ ID NO. 2) 2) XGXACCGXCXXXCAXAGGXXXGAXGAGXCX; (SEQ ID NO. 3) 3)
CCXGGGXXCAXGXCAAGXXXCAGAGAXCGG; (SEQ ID NO. 4) 4)
CAGCCCAXCXXCXCCXGGXCCXGGGAAGGX; (SEQ ID NO. 5) 5)
XCXXGACGGGXCXGAGAXAXAXCCACAGXX; (SEQ ID NO. 6) 6)
XGXACCGXCXXXCAXGGGXXXGAXGAGXCX; (SEQ ID NO. 7) 7)
CCXGGGCXCAXGXCAAGXXXCAGAGAXCGG; (SEQ ID NO. 8) 8)
XCCACAGXXGGGCXXXXACX; (SEQ ID NO. 9) 9) XCXGAGAXAXAXCCACAGXX; (SEQ
ID NO. 10) 10) XCXXGACGGGXCXGAGAXAX; (SEQ ID NO. 11) 11)
XGAXGAGXCXCAGGAXXXGC; (SEQ ID NO. 12) 12) XXCAXGGGXXXGAXGAGXCX;
(SEQ ID NO. 13) 13) XXGXACCGXCXXXCAXGGGX; (SEQ ID NO. 14) 14)
CAGAGAXCGGAXXCCAGXAX; (SEQ ID NO. 15) 15) XGXCAAGXXXCAGAGAXCGG;
(SEQ ID NO. 16) 16) CCXGGGCXCAXGXCAAGXXX; (SEQ ID NO. 17) 17)
CXGGGAAGGXXACAGCAAGA; (SEQ ID NO. 18) 18) XCXCCXGGXCCXGGGAAGGX; and
(SEQ ID NO. 19) 19) CAGCCCAXCXXCXCCXGGXC,
[0007] wherein X is T or U and the oligomer's base sequence can
vary from the above sequence at up to two base positions, and
wherein the oligomer can bind to a target site in the myostatin
pre-mRNA to cause exon skipping.
[0008] The oligomers described above cause exon skipping in the
myostatin gene. In particular, these oligomers cause exon skipping
of exon two of the myostatin gene, i.e. when the myostatin pre-mRNA
is processed into mRNA, the oligomers stop exon two from being
included in the mRNA.
[0009] Without being restricted to any particular theory, it is
thought that the binding of the oligomers to the myostatin pre-mRNA
interacts with or interferes with the binding of SR proteins to the
exon. SR proteins are involved in the splicing process of adjacent
exons. Therefore, it is thought that interacting or interfering
with the binding of the SR proteins interferes with the splicing
machinery resulting in exon skipping.
[0010] The base "X" in the above base sequences is defined as being
thymine (T) or uracil (U). The presence of either base in the
sequence will still allow the oligomer to bind to the pre-mRNA of
the myostatin gene as it is a complementary sequence. Therefore,
the presence of either base in the oligomer will cause exon
skipping. The base sequence of the oligomer may contain all
thymines, all uracils or a combination of the two. One factor that
can determine whether X is T or U is the chemistry used to produce
the oligomer. For example, if the oligomer is a phosphorodiamidate
morpholino oligonucleotide (PMO), X will be T as this base is used
when producing PMOs. Alternatively, if the oligomer is a
phosphorothioate-linked 2'-O-methyl oligonucleotide (2'OMePS), X
will be U as this base is used when producing 2'OMePSs. Preferably,
the base "X" is only thymine (T).
[0011] The advantage provided by the oligomer is that it causes
exon skipping. Preferably, the oligomer causes an exon skipping
rate of at least 40%, i.e. exon two will be skipped 40% of the
time. More preferably, the oligomer causes an exon skipping rate of
at least 50%, more preferably still, at least 60%, even more
preferably, at least 70%, more preferably still, at least 75%, more
preferably, at least 80%, even more preferably, at least 85%, more
preferably still, at least 90%, even most preferably, at least 95%,
more preferably, at least 98% and even more preferably, at least
about 99%. Exon skipping can be measured by transfection (leashed
or unleashed: concentration between 50 and 500 nM) into cultured
human myoblast cells (e.g., using a transfection reagent such as
Lipofectamine2000.TM.), and evaluation of skipped and unskipped
mRNAs by electrophoretic densitometric analysis of RTPCR reaction
products.
[0012] The oligomer can be any type of oligomer as long as it has
the selected base sequence and can bind to a target site of the
myostatin pre-mRNA to cause exon skipping. For example, the
oligomer can be an oligodeoxyribonucleotide, an
oligoribonucleotide, a phosphorodiamidate morpholino
oligonucleotide (PMO) or a phosphorothioate-linked 2'-O-methyl
oligonucleotide (2'OMePS). Preferably, the oligomer is a PMO or a
2'OMePS. In one embodiment, the oligomer is a PMO. The advantage of
a PMO is that it has excellent safety profiles and appears to have
longer lasting effects in vivo compared to 2'OMePS
oligonucleotides. Preferably, the oligomer is isolated so that it
is free from other compounds or contaminants.
[0013] The base sequence of the oligomer can vary from the selected
sequence at up to two base positions. If the base sequence does
vary at two positions, the oligomer will still be able to bind to
the myostatin pre-mRNA to cause exon skipping. Preferably, the base
sequence of the oligomer varies from the selected sequence at up to
one base position and, more preferably, the base sequence does not
vary from the selected sequence. The less that the base sequence of
the oligomer varies from the selected sequence, the more
efficiently it binds to the target site in order to cause exon
skipping.
[0014] The oligomer is at least 20 bases in length. Preferably, the
oligomer is at least 25 bases in length. In some embodiments, the
oligomer may be at least 28 bases in length or at least 30 bases in
length. Preferably, the oligomer is no more than 40 bases in
length. In some embodiments, the oligomer may be no more than 35
bases in length or no more than 32 bases in length. Preferably, the
oligomer is between 20 and 40 bases in length. More preferably, the
oligomer is between 25 and 35 bases in length. In some embodiments,
the oligomer is between 28 and 32 bases in length, between 29 and
31 bases in length, or about 30 bases in length. It has been found
that an oligomer which is 30 bases in length causes efficient exon
skipping. If the oligomer is longer than 40 bases in length, the
specificity of the binding to the target site may be reduced. If
the oligomer is less than 20 bases in length, the exon skipping
efficiency may be reduced.
[0015] In some embodiments, the oligomer comprises at least 20
contiguous bases of a base sequence selected from the group
consisting of SEQ ID NOS. 1-7, wherein the oligomer's base sequence
can vary from SEQ ID NOS. 1-7 at up to two base positions.
[0016] In other embodiments, the oligomer comprises at least 20
contiguous bases of a base sequence selected from the group
consisting of SEQ ID NOS. 1-4, wherein the oligomer's base sequence
can vary from SEQ ID NOS. 1-4 at up to two base positions.
[0017] In the above embodiments relating to SEQ ID NOS. 1-7 and SEQ
ID NOS. 1-4, the oligomer preferably comprises at least 25
contiguous bases of the base sequences. More preferably, the
oligomer comprises at least 28 contiguous bases of the base
sequences. In some embodiments, the oligomer comprises 30
contiguous bases of the base sequences, i.e. the oligomer comprises
the base sequences of SEQ ID NOS. 1-7 or SEQ ID NOS. 1-4. In the
embodiments described in this paragraph, the oligomer's base
sequence can still vary from SEQ ID NOS. 1-7 or SEQ ID NOS. 1-4 at
up to two base positions.
[0018] The oligomer may be conjugated to or complexed with various
distinct chemical entities. For example, the oligomer may be
conjugated to or complexed with a targeting protein in order to
target the oligomer to, for example, muscle tissue. If the oligomer
is conjugated to an entity, it may be conjugated directly or via a
linker. In one embodiment, a plurality of oligomers may be
conjugated to or complexed with a single entity. For example, the
oligomer may be conjugated to octa-guanidine dendrimers.
Alternatively, an arginine-rich cell penetrating peptide (CPP) can
be conjugated to or complexed with the oligomer. In particular,
(R-Ahx-R).sub.4AhxB can be used, where Ahx is 6-aminohexanoic acid
and B is beta-alanine (Moulton H M et al. (2007) Biochem. Soc.
Trans. 35: 826-8.), or alternatively (RXRRBR).sub.2XB can be
used.sup.26 These entities have been complexed to known dystrophin
exon-skipping oligomers which have shown sustained skipping of
dystrophin exons in vitro and in vivo.
[0019] Alternatively, a range of nanoparticle systems can be used
to deliver the oligomers.sup.74.
[0020] In another aspect, the present invention provides a vector
for inducing exon skipping during processing of myostatin pre-mRNA,
the vector encoding an oligomer of the invention, wherein when the
vector is introduced into a cell (e.g. a human cell), the oligomer
is expressed. For example, it is possible to express antisense
sequences in the form of a gene, which can thus be delivered on a
vector. One way to do this would be to modify the sequence of a U7
snRNA gene to include an antisense sequence according to the
invention. The U7 gene, complete with its own promoter sequences,
can be delivered on an adeno-associated virus (AAV) vector, to
induce bodywide exon skipping. Similar methods to achieve exon
skipping, by using a vector encoding an oligomer of the invention,
would be apparent to one skilled in the art.
[0021] The present invention also provides a pharmaceutical
composition for inducing exon skipping during processing of
myostatin pre-mRNA, the composition comprising an oligomer as
described above or a vector as described above and a
pharmaceutically acceptable carrier, adjuvant or vehicle.
[0022] Pharmaceutical compositions of this invention comprise an
oligomer of the present invention, and pharmaceutically acceptable
salts, esters, salts of such esters, or any other compound which,
upon administration to a subject (e.g. a human), is capable of
providing (directly or indirectly) the biologically active oligomer
thereof, with a pharmaceutically acceptable carrier, adjuvant or
vehicle. Pharmaceutically acceptable carriers, adjuvants and
vehicles that may be used in the pharmaceutical compositions of
this invention include, but are not limited to, ion exchangers,
alumina, aluminum stearate, lecithin, serum proteins, such as human
serum albumin, buffer substances such as phosphates, glycine,
sorbic acid, potassium sorbate, partial glyceride mixtures of
saturated vegetable fatty acids, water, salts or electrolytes, such
as protamine sulfate, disodium hydrogen phosphate, potassium
hydrogen phosphate, sodium chloride, zinc salts, colloidal silica,
magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based
substances, polyethylene glycol, sodium carboxymethylcellulose,
polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers,
polyethylene glycol and wool fat.
[0023] The pharmaceutical compositions of this invention may be
administered orally, parenterally, by inhalation spray, topically,
rectally, nasally, buccally, vaginally, intradermally or via an
implanted reservoir. Oral administration or administration by
injection is preferred. The pharmaceutical compositions of this
invention may contain any conventional non-toxic
pharmaceutically-acceptable carriers, adjuvants or vehicles. The
term parenteral as used herein includes subcutaneous,
intracutaneous, intravenous, intramuscular, intra-articular,
intrasynovial, intrasternal, intrathecal, intralesional and
intracranial injection or infusion techniques. Preferably, the
route of administration is by injection, more preferably, the route
of administration is intramuscular, intravenous or subcutaneous
injection and most preferably, the route of administration is
intravenous or intramuscular injection.
[0024] The pharmaceutical compositions may be in the form of a
sterile injectable preparation, for example, as a sterile
injectable aqueous or oleaginous suspension. This suspension may be
formulated according to techniques known in the art using suitable
dispersing or wetting agents (such as, for example, Tween 80) and
suspending agents. The sterile injectable preparation may also be a
sterile injectable solution or suspension in a non-toxic
parenterally-acceptable diluent or solvent, for example, as a
solution in 1,3-butanediol. Among the acceptable vehicles and
solvents that may be employed are mannitol, water, Ringer's
solution and isotonic sodium chloride solution. In addition,
sterile, fixed oils are conventionally employed as a solvent or
suspending medium. For this purpose, any bland fixed oil may be
employed including synthetic mono- or diglycerides. Fatty acids,
such as oleic acid and its glyceride derivatives are useful in the
preparation of injectables, as are natural pharmaceutically
acceptable oils, such as olive oil or castor oil, especially in
their polyoxyethylated versions. These oil solutions or suspensions
may also contain a long-chain alcohol diluent, dispersant or
similar alcohol.
[0025] The pharmaceutical compositions of this invention may be
orally administered in any orally acceptable dosage form including,
but not limited to, capsules, tablets, and aqueous suspensions and
solutions. In the case of tablets for oral use, carriers which are
commonly used include lactose and corn starch. Lubricating agents,
such as magnesium stearate, are also typically added. For oral
administration in a capsule form, useful diluents include lactose
and dried corn starch. When aqueous suspensions are administered
orally, the active ingredient is combined with emulsifying and
suspending agents. If desired, certain sweetening and/or flavouring
and/or colouring agents may be added.
[0026] The pharmaceutical compositions of this invention may also
be administered in the form of suppositories for rectal
administration. These compositions can be prepared by mixing a
compound of this invention with a suitable non-irritating excipient
which is solid at room temperature but liquid at the rectal
temperature and therefore will melt in the rectum to release the
active components. Such materials include, but are not limited to,
cocoa butter, beeswax and polyethylene glycols.
[0027] Topical administration of the pharmaceutical compositions of
this invention is especially useful when the desired treatment
involves areas or organs readily accessible by topical application.
For application topically to the skin, the pharmaceutical
composition should be formulated with a suitable ointment
containing the active components suspended or dissolved in a
carrier. Carriers for topical administration of the compounds of
this invention include, but are not limited to, mineral oil, liquid
petroleum, white petroleum, propylene glycol, polyoxyethylene
polyoxypropylene compound, emulsifying wax and water.
Alternatively, the pharmaceutical composition can be formulated
with a suitable lotion or cream containing the active compound
suspended or dissolved in a carrier. Suitable carriers include, but
are not limited to, mineral oil, sorbitan monostearate, polysorbate
60, cetyl esters wax, cetearyl alcohol, 2-octyldodecanol, benzyl
alcohol and water. The pharmaceutical compositions of this
invention may also be topically applied to the lower intestinal
tract by rectal suppository formulation or in a suitable enema
formulation. Topically-transdermal patches are also included in
this invention.
[0028] The pharmaceutical compositions of this invention may be
administered by nasal aerosol or inhalation. Such compositions are
prepared according to techniques well-known in the art of
pharmaceutical formulation and may be prepared as solutions in
saline, employing benzyl alcohol or other suitable preservatives,
absorption promoters to enhance bioavailability, fluorocarbons,
and/or other solubilizing or dispersing agents known in the
art.
[0029] The pharmaceutical composition of the invention may also
comprise an additional biologically active agent. For example,
where the composition is for ameliorating Duchenne muscular
dystrophy, the composition may comprise an oligomer for causing
exon skipping in the dystrophin gene. Such oligomers are described,
for example, in U.S. application Ser. No. 12/556,626.
[0030] The oligomers of the invention are for use in therapy and,
in particular, for use in inducing exon skipping during processing
of myostatin pre-mRNA.
[0031] The present invention also provides a method of inducing
exon skipping during processing of myostatin pre-mRNA in a patient
(e.g. a human patient), the method comprising administering a
therapeutically effective amount of the oligomer of the invention
or the vector of the invention to the patient such that exon
skipping during processing of myostatin pre-mRNA is induced.
[0032] In the above method, the oligomers can be used to increase
or maintain muscle mass, or to slow the degeneration of muscle
mass. In particular, musculoskeletal muscle mass can be increased
or maintained, or its degeneration slowed. For example, the method
can be for ameliorating muscle wasting conditions such as
degenerative muscular disorders, including various forms of
muscular dystrophy. Degenerative muscular disorders such as various
forms of muscular dystrophies can actually be fatal at an early age
of mid to late twenties. Muscle wasting conditions that can be
ameliorated using the oligomers include muscular dystrophy such as
Becker's muscular dystrophy, congenital muscular dystrophy,
Duchenne muscular dystrophy, distal muscular dystrophy,
Emery-Dreifuss muscular dystrophy, facioscapulohumeral muscular
dystrophy (FSHD), limb-girdle muscular dystrophy, myotonic muscular
dystrophy and oculopharyngeal muscular dystrophy. In one
embodiment, the method is for ameliorating Duchenne muscular
dystrophy (DMD). Other conditions that could be ameliorated by
myostatin oligomers include cachexia (muscle loss due to for
example, cancer, chronic obstructive pulmonary disease (COPMD) and
HIV/AIDS), sarcopenia (muscle loss due to natural old age), muscle
atrophy (muscle loss in denervating conditions such as motorneuron
disease, and spinal muscular atrophy). In addition, myostatin
knockdown by oligomers and the ensuing increased muscle bulk may
also have the potential to counteract insulin-resistance in
diabetes and obesity-related metabolic syndromes.
[0033] In some embodiments of the invention, another biologically
active agent may also be administered in a therapeutically
effective amount. For example, where the method is for ameliorating
DMD, antisense oligomers for causing exon skipping in the
dystrophin gene may also be administered. Such oligomers are
described, for example, in U.S. application Ser. No.
12/556,626.
DETAILED DESCRIPTION OF THE INVENTION
[0034] The present invention will now be described in detail, by
way of example only, with reference to the accompanying figures in
which:
[0035] FIG. 1: Bioinformatics analysis, design, and evaluation in
C2C12 muscle cells of specific AOs predicted to induce skipping of
myostatin exon 2. (a) Results from three algorithms used to
identify ESE sequences for designing of exon skipping AOs targeting
exon 2 of the mouse myostatin gene. The ESE Finder analysis shows
the location and values above threshold for SR protein-binding
motifs, SF2/ASF, SF2/ASF (BRCA 1), SC35, SRp40, and SRp55 which are
shown as vertical bars above the sequence of exon 2. The Rescue ESE
analysis shows the position of possible exonic splicing enhancer
sites by black horizontal lines parallel to the sequence of exon 2.
The PESX analysis shows the location of ESEs as light gray
horizontal lines, and exon splicing silencers (ESSs) as dark gray
horizontal lines. The bold horizontal laddered black lines
represent the sequence of the 20-mer 2'OMePSs which were obtained
after aligning the outputs from the three algorithms. (b)
Comparison of efficacy of different 2'OMePS oligomers to induce
skipping of exon 2 in myostatin mRNA from C2C12 cell cultures.
RT-PCR was performed on 1 .mu.g mRNA from C2C12 cells treated with
12 different 2'OMePS oligomers at 250 nmol/l. Transfections were
performed in duplicates and the nested RT-PCR products were loaded
on 1.2% agarose gel as follow: Tracks 1 and 2: oligomer A1; Tracks
3 and 4: oligomer A2; Tracks 5 and 6: oligomer A3; Tracks 9 and 10:
oligomer B1; Tracks 11 and 12: oligomer B2; Tracks 13 and 14:
oligomer B3; Tracks 15 and 16: oligomer C1; Tracks 17 and 18:
oligomer C2; Tracks 19 and 20: oligomer C3; Tracks 23 and 24:
oligomer D1; Tracks 25 and 26: oligomer D2; Tracks 27 and 28:
oligomer D3; Tracks 7, 8, 21 and 22: controls with transfection
reagent Lipofectamine 2000 alone, but no AO: Size Marker used is
Hyper ladder IV. 2'OMePS, 2'O-methyl phosphorothioate RNA; AO,
antisense oligonucleotide; bp, base pairs; ESE, exonic splicing
enhancer; RT-PCR, reverse transcriptase-PCR.
[0036] FIG. 2: Antisense-induced myostatin exon 2 skipping with
2'OMePS oligomers leads to an increase in C2C12 cell proliferation.
C2C12 cells were treated with a range of 2'OMePS oligomers along
with lipofectamine 2000 (LF2000), and assayed 24 hours later for
cell proliferation by lactic dehydrogenase assay. Treatment with
2'OMePS oligomers A3, B3, and D3 resulted in significant increases
in the number of cells after 24 hours compared to the cultures
treated with only transfection reagent LF2000 but no AO. C3 did not
induce a substantial change. (t-test analysis, n=6; *P<0.05;
**P<0.01). 2'OMePS, 2'O-methyl phosphorothioate RNA.
[0037] FIG. 3: Exon skipping in mouse following intramuscular
injection of 2'OMePS oligomers targeting myostatin exon 2.
Oligomers A2 and B3 (3 nmol) were administered by a single
intramuscular injection into the tibialis anterior (TA) muscles of
mice. Two and four weeks later, muscles were recovered, and RNA
extracted and analyzed for the presence of myostatin exon 2
skipping by RT-PCR. Agarose ethidium bromide gel electrophoresis is
shown for the products of RT-PCR analysis: The upper and lower
bands correspond to the normal exon 1, 2, and 3 product (532 bp)
and the exon 2 skipped product (158 bp), respectively which were
verified by sequencing (data not shown). The faint shadow band of
intermediate migration in some tracks was found upon sequencing to
correspond to a product containing a partial sequence of exon 2 due
to a cryptic 3' splice site 296 nt downstream of the correct one.
Tracks 1 and 2: 14 days control; Tracks 3-5: 14 days A2-treated;
Tracks 6-8: 28 days A2-treated; Tracks 9-11; 14 days B3-treated;
Tracks 12-14: 28 days B3-treated; Tracks 15 and 16: 28 days
control. Densitometric evaluation of the skipped and unskipped
bands showed that after 14 days, A2 gave 25.6% and B3 54.6%
skipping, and after 28 days, A2 gave 48.6% and B3 24.5% skipping.
2'OMePS, 2'O-methyl phosphorothioate RNA; bps, base pairs; nt,
nucleotides; RT-PCR, reverse transcriptase-PCR.
[0038] FIG. 4: Myostatin exon 2 skipping in C2C12 cell culture
following treatment with a range of leashed-PMO lipoplexes. C2C12
cell cultures treated with a range of leashed PMOs in lipoplex form
with LF2000 exhibited skipping of exon 2 in myostatin mRNA. RT-PCR
was performed on 1 .mu.g mRNA from C2C12 cells treated with 250
nmol/l PMOs (designed on the basis of the most effective 2'OMePS
sequences: A3, B3, C3, and D3) over a period of 24 hours.
Transfections were performed in triplicate and RT-PCR products were
loaded on 1.2% agarose gel as follows: Tracks 1-3: PMO-A; Tracks
4-6: PMO-B; Tracks 7-9: PMO C; Tracks 10-12: PMO-D; Tracks 13-15:
LF2000-treated control; bps, base pairs; LP2000, lipofectamine
2000; PMO, phosphorodiamidate morpholino oligomers; RT-PCR, reverse
transcriptase-PCR.
[0039] FIG. 5: Systemic injection of PMO conjugated to
octa-guanidine dendrimer (Vivo-PMO) results in myostatin exon
skipping associated with a significant increase in muscle mass and
myofiber size. Mice were treated with 6 mg/kg of Vivo-PMO-D3 by
five weekly intravenous injections, and muscles harvested for RNA
extraction and immunohistology 10 days later. (a) Weight of soleus
and EDL muscle after treatment. Weights of soleus muscles were
significantly increased (t-test, P<0.034; n=6) whereas weights
of EDL muscles showed no significant change. (b) RT-PCR was carried
out on 1 .mu.g RNA from soleus and EDL muscles and products
resolved on a 1.2% agarose gel. Track 1: Vivo-PMO treated soleus;
Track 2: control soleus; Track 3: Vivo-PMO treated EDL; Track 4:
control EDL. (c) Distribution of myofiber sizes (CSA) in vivo-PMO
treated (black bars) and control (open bars) soleus muscles. (d)
Representative dystrophin immunohistology indicating increased
myofibre CSA in vivo-PMO treated compared to control soleus muscle
cryosections. Bar=500 .mu.m. CSA, cross-sectional area; EDL,
extensor digitorum longus; PMO, phosphorodiamidate morpholino
oligomers; RT-PCR, reverse transcriptase-PCR.
Introduction
[0040] As stated above, the inventors have adopted the approach of
using AOs with different chemistries, so enhancing their half-lives
relative to RNAi molecules, to investigate the outcome of myostatin
knockdown by exon skipping. Skipping of exon 2 (374 nucleotides) of
myostatin was predicted to lead to an out-of-phase splicing of
exons 1 and 3, and knockdown of myostatin due to truncation of the
Open Reading Frame and nonsense-mediated mRNA decay. The data
present below constitute a proof-of principle that
oligonucleotide-mediated antisense exon skipping leads to a
physiologically significant myostatin knockdown in vitro and in
vivo. This type of antisense treatment could thus potentially form
part of an effective strategy to improve various muscle-wasting
conditions, and along with dystrophin rescue or augmentation, to
treat Duchenne muscular dystrophy.
Example 1
Materials and Methods
Bioinformatics Analysis of the Myostatin Gene to Design AOs
Reagents.
[0041] Three different bioinformatics algorithms namely ESE Finder,
PESX, and Rescue ESE were used to design antisense reagents.
Results from the three algorithms were merged to define ESE sites
and used to identify the regions of the myostatin exon 2, which are
expected to be optimal targets for exon skipping antisense
reagents. A set of 12 antisense reagents of 2'O-methyl RNA
(2'OMePS) chemistry were designed to target four different ESE-rich
regions of exon 2 of myostatin (FIG. 1a).
AO Reagents.
[0042] The 12 2'OMePS oligomers tested were obtained from
Eurogentec (SA, Seraing, Belgium). The sequences of the 2'OMePS are
as follows:
TABLE-US-00002 GDF8/A1: TCCACAGTTGGGCTTTTACT GDF8/A2:
TCTGAGATATATCCACAGTT GDF8/A3: TCTTGACGGGTCTGAGATAT GDF8/B1:
TGATGAGTCTCAGGATTTGC GDF8/B2: TTCATGGGTTTGATGAGTCT GDF8/B3:
TTGTACCGTCTTTCATGGGT GDF8/C1: CAGAGATCGGATTCCAGTAT GDF8/C2:
TGTCAAGTTTCAGAGATCGG GDF8/C3: CCTGGGCTCATGTCAAGTTT GDF8/D1:
CTGGGAAGGTTACAGCAAGA GDF8/D2: TCTCCTGGTCCTGGGAAGGT GDF8/D3:
CAGCCCATCTTCTCCTGGTC
[0043] PMOs were designed based on the 2'OMePS sequences. A total
of four PMOs were tested and were obtained from Gene Tools
(Philomath, Oreg.). PMO sequences are as follows:
TABLE-US-00003 Mstn A: TCTTGACGGGTCTGAGATATATCCACAGTT Mstn B:
TGTACCGTCTTTCATGGGTTTGATGAGTCT Mstn C:
CCTGGGCTCATGTCAAGTTTCAGAGATCGG Mstn D:
CAGCCCATCTTCTCCTGGTCCTGGGAAGGT
[0044] PMOs conjugated to octa-guanidine dendrimers (so-called
Vivo-PMOs) were purchased from Gene Tools.
[0045] Cell culture and transfection of C2C12 cells with the
designed antisense reagents. C2C12 mouse myoblasts were maintained
in Dulbecco's modified Eagle's medium (Sigma-Aldrich, Poole, UK)
containing 10% fetal calf serum (Sigma-Aldrich), 4 mmol/l
1-glutamine, 100 U/ml penicillin and 100 .mu.g/ml streptomycin at
37.degree. C. and 8% CO.sub.2. Cells were split every 24 hours to
prevent differentiation. Cells were detached by incubating them
with 0.15% trypsin-phosphate-buffered saline for 1 minute at
37.degree. C., and seeded at a density of 1.5.times.105 cells/well
of a 6-well plate. The antisense reagents of 2'OMePS chemistry were
transfected at 250 nmol/l into C2C12 cells using Lipofectamine 2000
(Invitrogen, Paisley, UK). Controls contained Lipofectamine 2000
but no antisense reagent. PMOs were leashed to complementary
stretches of negatively charged DNA (obtained from MWG, Ebersberg,
Germany) for efficient in vitro delivery,.sup.24 using
Lipofectamine 2000 as transfection reagent. All transfections were
performed in Dulbecco's modified Eagle's medium containing 2 mmol/l
glutamine (without serum and antibiotics) and after 3-4 hours of
transfection, the medium was replaced with full growth medium
containing serum as well as antibiotics. The transfections were
performed in duplicate and the experiment repeated twice.
RT-PCR Analysis of Myostatin Exon Skipping.
[0046] For in vitro experiments, 24 hours after transfection, RNA
was extracted from each well using QIAshredder/RNeasy extraction
kit (Qiagen, Crawley, UK). For in vivo experiments, RNA was
extracted from blocks using TRIzol reagent (Invitrogen, Scotland,
UK). One microgram of RNA was reverse transcribed and resulting
complementary DNA amplified using specific primers obtained from
MWG, using the Genescript kit (Genesys, Camberley, UK). One micro
litre of PCR products obtained was used as a template for nested
PCR. Sequences of the primers and details of the PCR protocols used
are available on request. The products from nested PCR were
separated on 1.2% agarose gel in Tris-borate/EDTA buffer and Hyper
Ladder IV (Bioline, London, UK) was used as the marker.
Densitometric analysis of the agarose gels was carried out using
Gene Tools 3.05 (Syngene, Cambridge, UK) and percentage skipping
expressed as amount of skipped product seen relative to total PCR
products detected.
In Vitro Cell Proliferation Assay.
[0047] A proliferation assay using Cell Titer 96 Aqueous One
Solution Cell Proliferation assay (Promega, Madison, Wis.) was
performed, as reported by Cory et al.,.sup.75 on cells transfected
with different 2'OMePS. Briefly, 24 hours after seeding, the growth
media was replaced with serum-free media and cells incubated at
37.degree. C. After 24 hours of subjecting cells to serum-free
media, 15 .mu.l of assay reagent was added to 75 .mu.l cells in a
96-well plate. Plates were read at 490 nm. Statistical analysis on
the data from the proliferation assay was performed using the
individual t-test.
Treatment of Mice with PMOs and Vivo-PMOs.
[0048] For all the in vivo experiments, animals (MF1 or C57B110)
were bought from Harlan (Blacktown, UK) and in-house maintained,
and in vivo experimentation conducted under statutory Home Office
recommendation, regulatory, ethical and licensing procedures and
under the Animals (Scientific Procedures) Act 1986 (project licence
PPL 70/7008). For intramuscular delivery, mice were anaesthetized
and injected with 3 nmol of 2'OMePS (in 25 .mu.l normal saline)
into each of the TA muscles. Control animals were injected with
normal saline. Whole body weights were measured weekly. TAs of
treated and control mice were excised postmortem after 2 weeks
(n=4) and 4 weeks (n=4). Weights were measured and the muscles
frozen in iso-pentane cooled with liquid nitrogen. For the systemic
administration, C57BL10 mice were injected intravenously with 6
mg/kg of Vivo-PMO-D (Gene Tools) diluted in 200 .mu.l of normal
saline, every week for 5 weeks. Weights were measured weekly and
various muscles from treated and control mice were harvested 10
days after the last injection. Cryosectioning was performed at 10
levels through the muscle.
Immunocytochemistry and Morphometry.
[0049] Hematoxylin and eosin staining was used to estimate the
muscles size. For the estimation of fibre size and distribution,
laminin staining was performed. Laminin antibody from Sigma-Aldrich
(Dorset, UK) was used as primary antibody, with biotinylated
anti-rabbit immunoglobulin G (Dako, Glostrup, Denmark) as secondary
antibody. Finally sections were stained with DAB (Vector
Laboratories, Burlingame, Calif.) and slides mounted in DPX (VWR
International, Poole, England) after appropriate washings.
Immunostaining was also carried out with Dystrophin antibody. For
this, H12 Polyclonal Rabbit antibody was used as primary antibody,
and Alexa fluor goat anti-rabbit 568 (fluorescein isothiocyanate)
(Invitrogen, Paisley, Oreg.) was used as secondary antibody. Slides
were mounted in Vectashield mounting medium with DAPI (Vector
Laboratories) after appropriate washings with phosphate-buffered
saline-Tween. CSA of muscle fibres was measured using SigmaScan Pro
5.0.0 (Systat Software, London, UK).
Results
Bioinformatics Analysis and Design of Specific AOs Predicted to
Induce Skipping of Myostatin Exon 2.
[0050] Bioinformatics analysis of exon 2 of myostatin was performed
using three bioinformatics tools, ESE finder,.sup.27,28
PESX,.sup.29,30 and Rescue ESE,.sup.31 to identify and locate ESEs
and exonic splicing suppressor or silencer motifs. The output of
these algorithms is displayed in FIG. 1a. A series of overlapping
AOs were designed and synthesized as 2'OMePSs and PMOs to span
sequences where clusters of ESEs which were predicted by one or
more of the programs coincide.
High Levels of Myostatin Exon 2 Skipping in C2C12 Cell Culture
Following Treatment with a Range of AOs.
[0051] In order to verify the efficiency of these AO target
sequences, C2C12 muscle cell cultures were transfected with the
2'OMePS oligomers, and nested reverse transcriptase-PCR (RT-PCR)
for skipping of myostatin performed on the RNA extracted from
transfected and control cells. A representative horizontal agarose
gel electrophoresis separation of products obtained is shown in
FIG. 1b. The level of skipping produced by each AO at 250 nmol/l
was determined semiquantitatively using densitometric
analysis..sup.31 All of the designed 2'OMePSs were observed to
induce myostatin exon 2 skipping in C2C 12 cultures but at various
levels of relative efficiency. A2 and A3 induced almost 100%
skipping; B3 (74%), C3 (41%), and D3 (48%) also induced a
considerable level of skipping. The nature of putative
antisense-induced PCR exon1-exon3 splicing product was confirmed by
sequencing the products.
Antisense-Induced Myostatin Exon 2 Skipping and Myostatin Knockdown
Leads to an Increase in C2C12 Cell Proliferation.
[0052] In order to verify that AO-mediated myostatin exon 2
skipping and knockdown, lead to a significant biological response,
the autocrine activity of myostatin on C2C12 cell proliferation was
evaluated following treatment of cultures with 2'OMePSs targeting
myostatin exon 2. The cell proliferation assay was based on
determination of lactic dehydrogenase activity of metabolically
active cells. The results of the proliferation assay clearly showed
a remarkable difference in cell proliferation in C2C12 cells
treated with myostatin exon 2 AOs compared to mock-transfected
control cells (FIG. 2). Statistical analysis of the data using
individual paired t-tests showed that oligomers A3 (P=0.0031), B3
(P=0.0055) and D3 (P=0.0115) induced a significant increase in cell
proliferation, as compared to mock transfected control cells.
Oligomer C3 (P=0.0534) did not produce a statistically significant
change.
Demonstration of Exon Skipping in Mouse Following Intramuscular
Injection of 2'OMePS Oligomers Targeting Myostatin Exon 2.
[0053] On the basis of RT-PCR results obtained from the in-vitro
studies, two 2'OMePS oligomers (A2 and B3) were selected to
evaluate their ability to induce efficient exon skipping in vivo.
The 2'OMePS oligomers (3 nmol) were administered by intramuscular
injection into tibialis anterior (TA) muscles of mice. Two and four
weeks after the injections, muscles were recovered, weighed, RNA
extracted and analyzed for the presence of myostatin exon 2
skipping by RT-PCR. Both reagents (A2 and B3) induced significant
level of myostatin exon 2 skipping at either the 2 weeks and 4
weeks time points after a single 2'OMePS oligomer administration
(FIG. 3). Densitometric quantification of full-length and skipped
product bands from the RT-PCR analyses of RNA was performed to
detect which of the two 2'OMePSs tested was the more efficient in
vivo. Oligomer A2 gave 25.6% skipping, and B3 gave 54.6% skipping
at the 2 weeks time point. However, after 4 weeks, A2 gave 48.6%
skipping whereas B3 gave 24.5% skipping.
[0054] Although the skipping of myostatin exon 2 was evident, the
effect was not sufficient to see a significant change in TA muscle
mass (data not shown). From previous work on exon skipping for
dystrophin, it is well established that the intramuscular
injections of naked unconjugated AOs in undamaged muscles are not
very efficient..sup.25
High Levels of Myostatin Exon 2 Skipping in C2C12 Cell Culture
Following Treatment with a Range of PMOs Designed on the Basis of
2'OMePS Data.
[0055] The animal studies above established that exon skipping of
the myostatin gene observed after intramuscular injection of
2'OMePS AOs was insufficient to induce change in TA mass. The PMO
chemistry has been demonstrated to have very high efficiency in
vivo..sup.33 Therefore, PMOs were designed on the basis of most
efficient 2'OMePS AOs (A3, B3, C3, and D3) and initially tested in
vitro. PMOs are uncharged chemicals and do not directly interact
with the polycationic transfection reagent lipofectamine 2000. In
order to enable reasonable transfection efficiency in C2C 12 cells,
PMOs were hybridized to complementary so-called leash
oligonucleotides of natural negatively charged DNA chemistry as
previously described..sup.23,34,35 Nested RT-PCR analysis of mRNA
harvested from C2C12 cells treated with leashed-PMO lipoplexes
demonstrated that exon skipping was induced by all the PMOs
accurate skipping of the targeted exon by both AO chemistries
tested here.
Systemic Injection of PMOs Conjugated to Octa-Guanidine Dendrimer
Resulted in Myostatin Exon Skipping Associated with a Significant
Increase in Muscle Mass and Myofibre Size.
[0056] The conjugation of PMO with octa-guanidine dendrimer
(so-called Vivo-PMOs) significantly increases the delivery and
efficiency of PMO directed against exon 23 of dystrophin compared
to unmodified PMO..sup.25 Therefore, a Vivo-PMO based on the
sequence of the previously tested 2'OMePS oligomer, D3, was
produced to evaluate systemic intravascular treatment regimes. Mice
were treated with 6 mg/kg of Vivo-PMO-D3 by five weekly intravenous
injections, and whole body weight and the mass of TA, soleus, and
extensor digitorum longus (EDL) muscles were recorded 10 days after
the last injection. Among the muscles analyzed in the treated
animals the soleus showed a statistically significant change in
mass (P=0.034) (FIG. 5a). In accordance with this, high levels of
exon skipping of myostatin exon 2 was demonstrated at the
transcript level in soleus (79%), whereas a very low level of
skipping was observed in EDL muscle (9%) (FIG. 5b). Importantly,
the cross-sectional area (CSA) of soleus muscle fibres in treated
animals significantly increased (P<0.0001; mean CSA were
254.+-.5 .mu.m2 for control and 333.+-.3 .mu.m2 for PMO-treated
animals (n=6) with a significant shift on the distribution of CSA
(X2=38.34; df=12) (FIG. 5c, d). No change was observed in the CSA
of EDL muscle.
Discussion
[0057] Although targeting donor splice site, acceptor splice sites
and branch point sequences has successfully led to exon exclusion
including DMD exon skipping.sup.36-38, some studies have proved
that targeting splice sites does not always induce exon skipping
and therefore exclusion of an exon from the pre-mRNA.sup.39 These
contain some consensus sequences common to many other genes;
therefore there lies a possible risk of disrupting the splicing of
non-specific genes.sup.40. Exon splicing enhancers (ESEs) motifs
form the binding sites for SR-protein RNA domains and thus help the
splicing machinery in exon recognition.sup.41. It has been shown
that intraexonic point mutations usually lead to mRNA level of exon
skipping instead of misense or no change in the amino acids.sup.42.
As SR protein binding to ESEs is very crucial for exon exclusion,
blocking the ESEs with Antisense oligonucleotides (AOs) would be
expected to result in exon skipping. Different software like RESCUE
ESE.sup.43,44, ESEFinder.sup.45 and PESX.sup.46 have been widely
used to predict possible ESE sites for different SR domains in
order to assist in designing AOs.sup.40,47,48.
[0058] Different oligonucleotide sequences of two different
chemistries to target myostatin exon 2 were designed using these
available online tools which showed a promising level of exon
skipping. 2'OMePS chemistry was used for the preliminary tissue
culture studies because of the advantage of cheap and easy
synthesis over some other the PMO chemistry.sup.49,50. RNA from all
the C2C12 cells transfected with twelve different 2'OMePS AO
sequences showed skipped myostatin exon 2 as demonstrated by RT-PCR
along with the full length product. As myostatin has been
established to be a negative regulator of muscle mass growth and
differentiation.sup.51-53, a decrease in its level is expected to
result in enhanced proliferative capacity of muscle
cells.sup.54,55. Therefore, a colorimetric proliferation assay
based on the principle of bioreduction of a tetrazolium compound by
viable cells gives a quantitative measure of living cells present
in a system.sup.56. On performing this assay on cells treated with
four different AOs (one from each of the four sets based on RT PCR
results), it was observed that the cells treated with AO-A3 showed
increased proliferation compared to control cells (p<0.01),
treatment with AOs B3 and D3 also showed an increased cell
proliferation (p<0.05), whereas AO-C3 did not lead to a
significant increase in level of proliferation compared to the
control cells.
[0059] PMO chemistry has high nuclease resistance.sup.57 and it
does not induce RNase H-mediated down-regulation of the mRNA that
it targets.sup.58. Due to uncharged background, however, PMOs
cannot be delivered efficiently across cells using cationic
liposomes and needs to be used at very high
concentrations.sup.59,60. Therefore, an anionic single-stranded
nucleic acid molecule called `leash` was annealed to the PMO in
order to mediate complex formation of PMO with the cationic
transfection reagent.sup.61. Four different 20-mer 2'OMePS AO
sequences were used for design and synthesis of PMOs. PMOs were
30-mers with an overlap of 10 bases between AO-2 and AO-3 of each
of the 2'OMePS AO sets, A(1,2,3), B(1,2,3), C(1,2,3) and D(1,2,3).
All the PMOs linked to their respective leashes resulted in
induction of exon 2 skipping of myostatin mRNA and therefore showed
the feasibility of the approach with two different AO
chemistries.
[0060] A luciferase reporter assay has been used to study the
myostatin inhibition effect of myostatin propeptide as well as that
of myostatin neutralizing antibody JA16 in terms of a decrease in
Smad binding to a TGF-.beta. responsive elements called CAGA
boxes.sup.62-64. A dose-response curve was prepared using different
dilutions of recombinant mouse myostatin using human
rhabdomyosarcoma cell line, A204 transfected with
pGL3-(CAGA).sub.12-luc. When supernatant from C2C12 cells treated
with PMO-D was assayed on the A204 cells transfected with
luciferase reporter containing Smad-binding site (CAGA) and
luminescence was recorded, there was found to be a significant
decrease (p=0.011) in the relative light units (RLU) after 48 hours
in case of supernatant from treated C2C12 cells compared to
supernatant from control C2C12 cells. This indicates a decrease in
the transcriptional activity of endogenous Smad proteins which are
crucial for TGF-.beta.-mediated signal transduction.sup.62
Therefore, inhibition of myostatin by exon skipping results in
reduced biological activity related to modulation of myostatin
pathway. This study thus confirms the reported results for
myostatin blockade using dominant negative ActRIIB in human
myoblasts.sup.65 myostatin-neutralizing antibody, JA16.sup.64 and
myostatin propeptide.sup.63 showing a decrease in Smad2
transcriptional activity and thus antagonizing biological activity.
When the mean RLU values from the reporter assay for PMO-D treated
cells were plotted on the myostatin standard curve, there was found
to be a decrease in myostatin concentration in treated samples
relative to the control cells by 44%. All these results were
evident of skipping of myostatin exon 2 in vitro using two
different chemistries along with modulation of proliferative
capacity as well as alteration of myostatin pathway of AO-treated
cells.
Further Discussion
[0061] It has been well established that myostatin is a negative
regulator of skeletal muscle mass.sup.66 and several approaches
have been used to knockdown this factor to induce an increase in
skeletal muscle growth..sup.67 The use of AOs to induce exon
skipping and thereby knockdown the expression of myostatin presents
several advantages over the other currently used gene therapy
approaches. Firstly, there is no risk of uncontrolled insertion
into the genome with AOs as in case of virus-mediated
approaches..sup.68 Moreover, with an appropriate dosing regimen,
exon skipping levels can be regulated and, if necessary the
treatment can be interrupted. Importantly AOs have not been
reported to produce any toxic effects or immune response so far in
animal models as well as when used in clinical application..sup.69
Here, the inventors show that AOs of 2'OMePS chemistry, designed
using bioinformatics algorithms, resulted in a substantial level of
myostatin exon 2 skipping in vitro. Myostatin being an inhibitor of
myogenic differentiation, controls the proliferation of
myoblasts..sup.70 Therefore, myostatin knockdown is expected to
increase the cell proliferation. The AOs designed were biologically
active and induced an increase in C2C12 cell proliferation. The
efficacy of knockdown by exon skipping in vivo has proved to be
more challenging to establish than in vitro. The efficiency of
myostatin skipping was verified by injecting 2'OMePS
intramuscularly. The intramuscular treatment of a single muscle
induced exon skipping, but did not appear to affect myostatin
activity. This is likely to be due to supply of biologically active
myostatin to the injected muscle by the bloodstream. Moreover, in a
hypothetical clinical approach, the whole body should be treated.
For these reasons, the inventors decided to administer the AOs by
systemic tail vein injection in further experiments. PMO chemistry
was chosen for this experiment due to its better stability compared
to the 2'OMePS and also because PMOs have been reported to have a
longer effect in vivo..sup.71 This is particularly important for
knocking down proteins like myostatin, which do not have a long
half-life like dystrophin. The PMO sequence used for the systemic
administration study induced efficient skipping in vitro. It also
maps in a region totally conserved between mouse and human
myostatin paving the way to test the same PMO for clinical
applications in humans. In order to achieve a reasonable effect in
undamaged muscles, a PMO conjugated to a delivery moiety has to be
used..sup.72 Vivo-PMO is commercially available and has been
reported to be effective in normal healthy mice..sup.25 By
injecting Vivo-PMO, a substantial increase in muscle size and the
change of CSA fibre distribution has been obtained, but only in the
soleus muscle. The differential response in EDL and soleus may be
due in part to a greater amount of ActRIIb being expressed on the
surface of EDL muscle, or because the intrinsic level of myostatin
is greater in fast (myosin type IIb positive) myofibres..sup.4,6
Alternatively, it can be speculated that the dosing regimen used,
which has been reported to be optimal for Vivo-PMO for exon
skipping of dystrophin gene,.sup.25 does not achieve sufficient
skipping of myostatin gene in EDL. In the case of dystrophin
skipping, the half-life of dystrophin protein and mRNA is extremely
long and therefore relatively smaller dosage of AO gives more
sustained exon skipping..sup.73 However, in myostatin skipping, it
is perhaps likely that more frequent redosing is required, to have
a more sustained presence of AOs. This may explain the transient
and weak effect in terms of whole body weight change that was
observed in vivo. Interestingly, only soleus muscle showed a
significant increase in weight and CSA fibre distribution. This is
in compliance with some previously published data showing that
soleus is the most affected muscle following a systemic approach to
knockdown myostatin..sup.4 The results represent a
proof-of-principle that myostatin knockdown can be obtained by
skipping an exon from the transcript by using AOs.
Example 2
[0062] The 30-mer PMO AOs tested above (Mstn-A to Mstn-D) were
designed to target the myostatin gene in mice. Therefore, these
Mstn-A to Mstn-D sequences correspond (are complementary to) to the
Genbank mouse myostatin cDNA/mRNA gene sequence. The corresponding
sequences complementary to the Genbank human myostatin sequences
are as follows with differences between the Genbank mouse and human
underlined:
TABLE-US-00004 Hum Mstn A: TCTCGACGGGTCTCAAATATATCCATAGTT Hum Mstn
B: TGTACCGTCTTTCATAGGTTTGATGAGTCT Hum Mstn C:
CCTGGGTTCATGTCAAGTTTCAGAGATCGG Hum Mstn D:
CAGCCCATCTTCTCCTGGTCCTGGGAAGGT
[0063] The skipping efficiency of these AOs can be tested by
transfection (leashed or unleashed: concentration between 50 and
500 nM) into cultured human myoblast cells (eg using a transfection
reagent such as Lipofectamine2000.TM.), and evaluation of skipped
and unskipped mRNAs by electrophoretic densitometric analysis of
RTPCR reaction products.
REFERENCES
[0064] 1. McPherron, A C, Lawler, A M and Lee, S J (1997).
Regulation of skeletal muscle mass in mice by a new TGF-.beta.
superfamily member. Nature 387: 83-90. [0065] 2. Schuelke, M,
Wagner, K R, Stolz, L E, Hubner, C, Riebel, T, Komen, W et al.
2004). Myostatin mutation associated with gross muscle hypertrophy
in a child. N Engl J Med 350: 2682-2688. [0066] 3. Bogdanovich, S,
Perkins, K J, Krag, T O, Whittemore, L A and Khurana, T S (2005).
Myostatin propeptide-mediated amelioration of dystrophic
pathophysiology. FASEB J 19: 543-549. [0067] 4. Foster, K, Graham,
I R, Otto, A, Foster, H, Trollet, C, Yaworsky, P J et al. (2009).
Adeno-associated virus-8-mediated intravenous transfer of myostatin
propeptide leads to systemic functional improvements of slow but
not fast muscle. Rejuvenation Res 12: 85-94. [0068] 5. Qiao, C, Li,
J, Jiang, J, Zhu, X, Wang, B, Li, J et al. (2008). Myostatin
propeptide gene delivery by adeno-associated virus serotype 8
vectors enhances muscle growth and ameliorates dystrophic
phenotypes in mdx mice. Hum Gene Ther 19: 241-254. [0069] 6.
Foster, K W (2009). Eye evolution: two eyes can be better than one.
Curr Biol 19: R208-R210. [0070] 7. Haidet, A M, Rizo, L, Handy, C,
Umapathi, P, Eagle, A, Shilling, C et al. (2008). Long-term
enhancement of skeletal muscle mass and strength by single gene
administration of myostatin inhibitors. Proc Natl Acad Sci USA 105:
4318-4322. [0071] 8. Wagner, K R, Fleckenstein, J L, Amato, A A,
Barohn, R J, Bushby, K, Escolar, D M et al. (2008). A phase
I/IItrial of MYO-029 in adult subjects with muscular dystrophy. Ann
Neurol 63: 561-571. [0072] 9. Whittemore, L A, Song, K, Li, X,
Aghajanian, J, Davies, M, Girgenrath, S et al. (2003). Inhibition
of myostatin in adult mice increases skeletal muscle mass and
strength. Biochem Biophys Res Commun 300: 965-971. [0073] 10. Yang,
Z, Zhang, J, Cong, H, Huang, Z, Sun, L, Liu, C et al. (2008). A
retrovirus-based system to stably silence GDF-8 expression and
enhance myogenic differentiation in human rhabdomyosarcoma cells. J
Gene Med 10: 825-833. [0074] 11. Dumonceaux, J, Marie, S, Beley, C,
Trollet, C, Vignaud, A, Ferry, A et al. (2010). Combination of
myostatin pathway interference and dystrophin rescue enhances
tetanic and specific force in dystrophic mdx mice. Mol Ther 18:
881-887. [0075] 12. Weinstein, S and Peer, D (2010). RNAi
nanomedicines: challenges and opportunities within the immune
system. Nanotechnology 21: 232001. [0076] 13. Hausen, P and Stein,
H (1970). Ribonuclease H. An enzyme degrading the RNA moiety of
DNA-RNA hybrids. Eur J Biochem 14: 278-283. [0077] 14. Zamecnik, P
C and Stephenson, ML (1978). Inhibition of Rous sarcoma virus
replication and cell transformation by a specific
oligodeoxynucleotide. Proc Natl Acad Sci USA 75: 280-284. [0078]
15. Dominski, Z and Kole, R (1993). Restoration of correct splicing
in thalassemic premRNA by antisense oligonucleotides. Proc Natl
Acad Sci USA 90: 8673-8677. [0079] 16. Friedman, K J, Kole, J,
Cohn, J A, Knowles, M R, Silverman, L M and Kole, R (1999).
Correction of aberrant splicing of the cystic fibrosis
transmembrane conductance regulator (CFTR) gene by antisense
oligonucleotides. J Biol Chem 274: 36193-36199. [0080] 17.
Sierakowska, H, Sambade, M J, Agrawal, S and Kole, R (1996). Repair
of thalassemic human .beta.-globin mRNA in mammalian cells by
antisense oligonucleotides. Proc Natl Acad Sci USA 93: 12840-12844.
[0081] 18. Dunckley, M G, Manoharan, M, Villiet, P, Eperon, I C and
Dickson, G (1998). Modification of splicing in the dystrophin gene
in cultured Mdx muscle cells by antisense oligoribonucleotides. Hum
Mol Genet 7: 1083-1090. [0082] 19. Cartegni, L, Chew, S L and
Krainer, A R (2002). Listening to silence and understanding
nonsense: exonic mutations that affect splicing. Nat Rev Genet 3:
285-298. [0083] 20. Kinali, M, Arechavala-Gomeza, V, Feng, L,
Cirak, S, Hunt, D, Adkin, C et al. (2009). Local restoration of
dystrophin expression with the morpholino oligomer AVI-4658 in
Duchenne muscular dystrophy: a single-blind, placebo-controlled,
dose-escalation, proof-of-concept study. Lancet Neurol 8: 918-928.
[0084] 21. van Deutekom, J C, Janson, A A, Ginjaar, I B,
Frankhuizen, W S, Aartsma-Rus, A, Bremmer-Bout, M et al. (2007).
Local dystrophin restoration with antisense oligonucleotide PRO051.
N Engl J Med 357: 2677-2686. [0085] 22. Hudziak, R M, Barofsky, E,
Barofsky, D F, Weller, D L, Huang, S B and Weller, D D (1996).
Resistance of morpholino phosphorodiamidate oligomers to enzymatic
degradation. Antisense Nucleic Acid Drug Dev 6: 267-272. [0086] 23.
Popplewell, L J, Trollet, C, Dickson, G and Graham, I R (2009).
Design of phosphorodiamidate morpholino oligomers (PMOs) for the
induction of exon skipping of the human DMD gene. Mol Ther 17:
554-561. [0087] 24. Gebski, B L, Errington, S J, Johnsen, R D,
Fletcher, S and Wilton, S D (2005). Terminal antisense
oligonucleotide modifications can enhance induced exon skipping.
Neuromuscul Disord 15: 622-629. [0088] 25. Wu, B, Li, Y, Morcos, P
A, Doran, T J, Lu, P and Lu, Q L (2009). Octa-guanidine morpholino
restores dystrophin expression in cardiac and skeletal muscles and
ameliorates pathology in dystrophic mdx mice. Mol Ther 17: 864-871.
[0089] 26. Jearawiriyapaisarn, N., Moulton, H. M., Sazani, P.,
Kole, R. & Willis, M. S. (2010). Long-term improvement in mdx
cardiomyopathy after therapy with peptide-conjugated morpholino
oligomers. Cardiovasc Res 85, 444-453 [0090] 27. Cartegni, L, Wang,
J, Zhu, Z, Zhang, M Q and Krainer, A R (2003). ESEfinder: A web
resource to identify exonic splicing enhancers. Nucleic Acids Res
31: 3568-3571. [0091] 28. Smith, P J, Zhang, C, Wang, J, Chew, S L,
Zhang, M Q and Krainer, A R (2006). An increased specificity score
matrix for the prediction of SF2/ASF-specific exonic splicing
enhancers. Hum Mol Genet 15: 2490-2508. [0092] 29. Zhang, X H and
Chasin, L A (2004). Computational definition of sequence motifs
governing constitutive exon splicing. Genes Dev 18: 1241-1250.
[0093] 30. Zhang, X H, Leslie, C S and Chasin, L A (2005).
Computational searches for splicing signals. Methods 37: 292-305.
[0094] 31. Fairbrother, W G, Yeh, R F, Sharp, P A and Burge, C B
(2002). Predictive identification of exonic splicing enhancers in
human genes. Science 297: 1007-1013. [0095] 32. Spitali, P,
Heemskerk, H, Vossen, R H, Ferlini, A, den Dunnen, J T, 't Hoen, P
A et al. (2010). Accurate quantification of dystrophin mRNA and
exon skipping levels in Duchenne Muscular Dystrophy. Lab Invest 90:
1396-1402. [0096] 33. Alter, J, Lou, F, Rabinowitz, A, Yin, H,
Rosenfeld, J, Wilton, S D et al. (2006). Systemic delivery of
morpholino oligonucleotide restores dystrophin expression bodywide
and improves dystrophic pathology. Nat Med 12: 175-177. [0097] 34.
Popplewell, L J, Adkin, C, Arechavala-Gomeza, V, Aartsma-Rus, A, de
Winter, C L, Wilton, S D et al. (2010). Comparative analysis of
antisense oligonucleotide sequences targeting exon 53 of the human
DMD gene: Implications for future clinical trials. Neuromuscul
Disord 20: 102-110. [0098] 35. Gebski, B L, Mann, C J, Fletcher, S
and Wilton, S D (2003). Morpholino antisense oligonucleotide
induced dystrophin exon 23 skipping in mdx mouse muscle. Hum Mol
Genet 12: 1801-1811. [0099] 36. Graham, I. R., Hill, V. J.,
Manoharan, M., Inamati, G. B. & Dickson, G. (2004). Towards a
therapeutic inhibition of dystrophin exon 23 splicing in mdx mouse
muscle induced by antisense oligoribonucleotides (splicomers):
target sequence optimisation using oligonucleotide arrays. Journal
of Gene Medicine 6: 1149-1158. [0100] 37. Wilton, S. D. &
Fletcher, S. (2005). Antisense oligonucleotides in the treatment of
Duchenne muscular dystrophy: Where are we now? Neuromuscul Disord
15: 399-402. [0101] 38. Wilton, S. D., Mann, C. J., Honeyman, K.,
McClorey, G. & Fletcher, S. (2002). Improved antisense
oligonucleotide induced exon skipping in the mdx mouse model of
muscular dystrophy. Journal of Gene Medicine 4: 644-654. [0102] 39.
Wilton, S. D., McClorey, G., Moulton, H. M., Iversen, P. L. &
Fletcher, S. (2006). Antisense oligonucleotide-induced exon
skipping restores dystrophin expression in vitro in a canine model
of DMD. Gene Therapy 13: 1373-1381 [0103] 40. Aartsma-Rus, A.,
Heemskerk, H., de Winter, C., van Putten, M., Janson, A.,
Verschuuren, J., den Dunnen, J., van Deutekom, J. & van Ommen,
G. J. (2009). Antisense-Mediated Exon Skipping for Duchenne
Muscular Dystrophy. Human Gene Therapy 20: 660-661. [0104] 41.
Stojdl, D. F. & Bell, J. C. (1999). SR protein kinases: the
splice of life. Biochemistry and Cell Biology-Biochimie Et Biologie
Cellulaire 77: 293-298. [0105] 42. Krainer, A. R. & Cartegni,
L. (2002). Disruption of an SF2/ASF-dependent exonic splicing
enhancer in SMN2 causes spinal muscular atrophy in the absence of
SMN1. Nature Genetics 30, 377-384. [0106] 43. Burge, C. B.,
Fairbrother, W. G., Yeh, R. F. & Sharp, P. A. (2002).
Predictive identification of exonic splicing enhancers in human
genes. Science 297: 1007-1013. [0107] 44. Burge, C. B.,
Fairbrother, W. G., Yeo, G. W., Yeh, R., Goldstein, P., Mawson, M.
& Sharp, P. A. (2004). RESCUE-ESE identifies candidate exonic
splicing enhancers in vertebrate exons. Nucleic Acids Research 32:
W187-W190. [0108] 45. Krainer, A. R., Cartegni, L., Wang, J. H.,
Zhu, Z. W. & Zhang, M. Q. (2003). ESEfinder: a web resource to
identify exonic splicing enhancers. Nucleic Acids Research 31:
3568-3571. [0109] 46. Chasin, L. A. & Zhang, X. H. F. (2004).
Computational definition of sequence motifs governing constitutive
exon splicing. Genes & Development 18, 1241-1250 [0110] 47. van
Deutekom, J., Aartsma-Rus, A., Bremmer-Bout, M., Janson, A., den
Dunnen, J. & van Ommen, G. J. (2002). Antisense-mediated exon
skipping as a gene correction therapy for Duchenne muscular
dystrophy. Journal of the Neurological Sciences 199: S75-S76.
[0111] 48. van Deutekom, J. C. & van Ommen, G. J. (2003).
Advances in Duchenne muscular dystrophy gene therapy. Nat Rev Genet
4: 774-783 [0112] 49. Agrawal, S. (1999). Importance of nucleotide
sequence and chemical modifications of antisense oligonucleotides.
Biochim Biophys Acta 1489: 53-68. [0113] 50. Sazani, P., Vacek, M.
M. & Kole, R. (2002). Short-term and long-term modulation of
gene expression by antisense therapeutics. Curr Opin Biotechnol 13:
468-472. [0114] 51. Grobet, L., Martin, L. J., Poncelet, D.,
Pirottin, D., Brouwers, B., Riquet, J., Schoeberlein, A., Dunner,
S., Menissier, F., Massabanda, J., Fries, R., Hanset, R. &
Georges, M. (1997). A deletion in the bovine myostatin gene causes
the double-muscled phenotype in cattle. Nat Genet 17: 71-74. [0115]
52. McPherron, A. C. & Lee, S. J. (1997). Double muscling in
cattle due to mutations in the myostatin gene. Proc Natl Acad Sci U
S A 94: 12457-12461. [0116] 53. Szabo, G., Dallmann, G., Muller,
G., Patthy, L., Soller, M. & Varga, L. (1998). A deletion in
the myostatin gene causes the compact (Cmpt) hypermuscular mutation
in mice. Mamm Genome 9: 671-672. [0117] 54. Thomas, M., Langley,
B., Berry, C., Sharma, M., Kirk, S., Bass, J. & Kambadur, R.
(2000). Myostatin, a negative regulator of muscle growth, functions
by inhibiting myoblast proliferation. J Biol Chem 275: 40235-40243.
[0118] 55. Zhu, X., Hadhazy, M., Wehling, M., Tidball, J. G. &
McNally, E. M. (2000). Dominant negative myostatin produces
hypertrophy without hyperplasia in muscle. FEBS Lett 474: 71-75.
[0119] 56. Berridge, M. V. & Tan, A. S. (1993).
Characterization of the cellular reduction of
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT):
subcellular localization, substrate dependence, and involvement of
mitochondrial electron transport in MTT reduction. Arch Biochem
Biophys 303: 474-482. [0120] 57. Summerton, J., Stein, D., Huang,
S. B., Matthews, P., Weller, D. & Partridge, M. (1997).
Morpholino and phosphorothioate antisense oligomers compared in
cell-free and in-cell systems. Antisense Nucleic Acid Drug Dev 7:
63-70. [0121] 58. Hudziak, R. M., Barofsky, E., Barofsky, D. F.,
Weller, D. L., Huang, S. B. & Weller, D. D. (1996). Resistance
of morpholino phosphorodiamidate oligomers to enzymatic
degradation. Antisense Nucleic Acid Drug Dev 6: 267-272. [0122] 59.
Sazani, P., Kang, S. H., Maier, M. A., Wei, C., Dillman, J.,
Summerton, J., Manoharan, M. & Kole, R. (2001). Nuclear
antisense effects of neutral, anionic and cationic oligonucleotide
analogs. Nucleic Acids Res 29: 3965-3974. [0123] 60. Suwanmanee,
T., Sierakowska, H., Lacerra, G., Svasti, S., Kirby, S., Walsh, C.
E., Fucharoen, S. & Kole, R. (2002). Restoration of human
beta-globin gene expression in murine and human IVS2-654
thalassemic erythroid cells by free uptake of antisense
oligonucleotides. Mol Pharmacol 62: 545-553. [0124] 61. Gebski, B.
L., Mann, C. J., Fletcher, S. & Wilton, S. D. (2003).
Morpholino antisense oligonucleotide induced dystrophin exon 23
skipping in mdx mouse muscle. Hum Mol Genet 12: 1801-1811. [0125]
62. Dennler, S., Itoh, S., Vivien, D., ten Dijke, P., Huet, S.
& Gauthier, J. M. (1998). Direct binding of Smad3 and Smad4 to
critical TGF beta-inducible elements in the promoter of human
plasminogen activator inhibitor-type 1 gene. EMBO J 17: 3091 3100.
[0126] 63. Thies, R. S., Chen, T., Davies, M. V., Tomkinson, K. N.,
Pearson, A. A., Shakey, Q. A. & Wolfman, N. M. (2001). GDF-8
propeptide binds to GDF-8 and antagonizes biological activity by
inhibiting GDF-8 receptor binding. Growth Factors 18:251-259.
[0127] 64. Whittemore, L. A., Song, K., Li, X., Aghajanian, J.,
Davies, M., Girgenrath, S., Hill, J. J., Jalenak, M., Kelley, P.,
Knight, A., Maylor, R., O'Hara, D., Pearson, A., Quazi, A.,
Ryerson, S., Tan, X. Y., Tomkinson, K. N., Veldman, G. M., Widom,
A., Wright, J. F., Wudyka, S., Zhao, L. & Wolfman, N. M. (2003)
Inhibition of myostatin in adult mice increases skeletal muscle
mass and strength. Biochem Biophys Res Commun 300, 965-971. [0128]
65. Fakhfakh, R., Michaud, A. & Tremblay, J. P. (2011).
Blocking the myostatin signal with a dominant negative receptor
improves the success of human myoblast transplantation in
dystrophic mice. Mol Ther 19: 204-210. [0129] 66. Carnac, G,
Ricaud, S, Vernus, B and Bonnieu, A (2006). Myostatin: biology and
clinical relevance. Mini Rev Med Chem 6: 765-770. [0130] 67. Patel,
K and Amthor, H (2005). The function of Myostatin and strategies of
Myostatin blockade-new hope for therapies aimed at promoting growth
of skeletal muscle. Neuromuscul Disord 15: 117-126. [0131] 68.
Amantana, A and Iversen, P L (2005). Pharmacokinetics and
biodistribution of phosphorodiamidate morpholino antisense
oligomers. Curr Opin Pharmacol 5: 550-555. [0132] 69. Arora, V,
Devi, G R and Iversen, P L (2004). Neutrally charged
phosphorodiamidate morpholino antisense oligomers: uptake, efficacy
and pharmacokinetics. Curr Pharm Biotechnol 5: 431-439. [0133] 70.
Langley, B, Thomas, M, Bishop, A, Sharma, M, Gilmour, S and
Kambadur, R (2002). Myostatin inhibits myoblast differentiation by
down-regulating MyoD expression.
J Biol Chem 277: 49831-49840. [0134] 71. Iversen, P L (2001).
Phosphorodiamidate morpholino oligomers: favorable properties for
sequence-specific gene inactivation. Curr Opin Mol Ther 3: 235-238.
[0135] 72. Morcos, P A, Li, Y and Jiang, S (2008).
Vivo-Morpholinos: a non-peptide transporter delivers
[0136] Morpholinos into a wide array of mouse tissues.
BioTechniques 45: 613-4,616,618 passim. [0137] 73. Ghahramani Seno,
M M, Graham, I R, Athanasopoulos, T, Trollet, C, Pohlschmidt, M,
Crompton, M R et al. (2008). RNAi-mediated knockdown of dystrophin
expression in adult mice does not lead to overt muscular dystrophy
pathology. Hum Mol Genet 17: 2622-2632. [0138] 74 Paola Rimessi P,
et al. Cationic PMMA Nanoparticles Bind and Deliver Antisense
Oligoribonucleotides Allowing Restoration of Dystrophin Expression
in the mdx Mouse. Molecular Therapy (2009) 17 5, 820-827
doi:10.1038/mt.2009.8) [0139] 75. Cory, A H, Owen, T C, Barltrop, J
A and Cory, J G (1991). Use of an aqueous soluble
tetrazolium/formazan assay for cell growth assays in culture.
Cancer Commun 3: 207-212.
Sequence CWU 1
1
36130DNAArtificial Sequencesynthetic sequence 1ncncgacggg
ncncaaanan anccanagnn 30230DNAArtificial Sequencesynthetic sequence
2ngnaccgncn nncanaggnn ngangagncn 30330DNAArtificial
Sequencesynthetic sequence 3ccngggnnca ngncaagnnn cagagancgg
30430DNAArtificial Sequencesynthetic sequence 4cagcccancn
ncnccnggnc cngggaaggn 30530DNAArtificial Sequencesynthetic sequence
5ncnngacggg ncngaganan anccacagnn 30630DNAArtificial
Sequencesynthetic sequence 6ngnaccgncn nncangggnn ngangagncn
30730DNAArtificial Sequencesynthetic sequence 7ccngggcnca
ngncaagnnn cagagancgg 30820DNAArtificial Sequencesynthetic sequence
8nccacagnng ggcnnnnacn 20920DNAArtificial Sequencesynthetic
sequence 9ncngaganan anccacagnn 201020DNAArtificial
Sequencesynthetic sequence 10ncnngacggg ncngaganan
201120DNAArtificial Sequencesynthetic sequence 11ngangagncn
caggannngc 201220DNAArtificial Sequencesynthetic sequence
12nncangggnn ngangagncn 201320DNAArtificial Sequencesynthetic
sequence 13nngnaccgnc nnncangggn 201420DNAArtificial
Sequencesynthetic sequence 14cagagancgg annccagnan
201520DNAArtificial Sequencesynthetic sequence 15ngncaagnnn
cagagancgg 201620DNAArtificial Sequencesynthetic sequence
16ccngggcnca ngncaagnnn 201720DNAArtificial Sequencesynthetic
sequence 17cngggaaggn nacagcaaga 201820DNAArtificial
Sequencesynthetic sequence 18ncnccnggnc cngggaaggn
201920DNAArtificial Sequencesynthetic sequence 19cagcccancn
ncnccnggnc 202020DNAHomo sapiensexon(1)...(20)myostatin exon 2
20tccacagttg ggcttttact 202120DNAHomo
sapiensexon(1)...(20)myostatin exon 2 21tctgagatat atccacagtt
202220DNAHomo sapiensexon(1)...(20)myostatin exon 2 22tcttgacggg
tctgagatat 202320DNAHomo sapiensexon(1)...(20)myostatin exon 2
23tgatgagtct caggatttgc 202420DNAHomo
sapiensexon(1)...(20)myostatin exon 2 24ttcatgggtt tgatgagtct
202520DNAHomo sapiensexon(1)...(20)myostatin exon 2 25ttgtaccgtc
tttcatgggt 202620DNAHomo sapiensexon(1)...(20)myostatin exon 2
26cagagatcgg attccagtat 202720DNAHomo
sapiensexon(1)...(20)myostatin exon 2 27tgtcaagttt cagagatcgg
202820DNAHomo sapiensexon(1)...(20)myostatin exon 2 28cctgggctca
tgtcaagttt 202920DNAHomo sapiensexon(1)...(20)myostatin exon 2
29ctgggaaggt tacagcaaga 203020DNAHomo
sapiensexon(1)...(20)myostatin exon 2 30tctcctggtc ctgggaaggt
203120DNAHomo sapiensexon(1)...(20)myostatin exon 2 31cagcccatct
tctcctggtc 203230DNAHomo sapiensexon(1)...(30)myostatin exon 2
32tcttgacggg tctgagatat atccacagtt 303330DNAHomo
sapiensexon(1)...(30)myostatin exon 2 33tgtaccgtct ttcatgggtt
tgatgagtct 303430DNAHomo sapiensexon(1)...(30)myostatin exon 2
34cctgggctca tgtcaagttt cagagatcgg 303530DNAHomo
sapiensexon(1)...(30)myostatin exon 2 35cagcccatct tctcctggtc
ctgggaaggt 303614PRTArtificial Sequencesynthetic sequence 36Arg Xaa
Arg Arg Ala Arg Arg Xaa Arg Arg Ala Arg Xaa Ala1 5 10
* * * * *