U.S. patent application number 13/683216 was filed with the patent office on 2013-04-04 for cell culture compositions capable of producing a vegf-binding fusion polypeptide.
This patent application is currently assigned to Regeneron Pharmaceuticals, Inc.. The applicant listed for this patent is Regeneron Pharmaceuticals, Inc.. Invention is credited to Samuel DAVIS, Nicholas J. PAPADOPOULOS, George D. YANCOPOULOS.
Application Number | 20130084635 13/683216 |
Document ID | / |
Family ID | 30447765 |
Filed Date | 2013-04-04 |
United States Patent
Application |
20130084635 |
Kind Code |
A1 |
PAPADOPOULOS; Nicholas J. ;
et al. |
April 4, 2013 |
Cell Culture Compositions Capable of Producing a VEGF-Binding
Fusion Polypeptide
Abstract
The present invention provides cell culture compositions capable
of producing fusion polypeptides that bind vascular endothelial
growth factor (VEGF). The cell culture compositions of the
invention comprise cells which contain an expression vector
comprising a nucleic acid molecule encoding a fusion polypeptide
that binds VEGF. The fusion polypeptides may comprise a VEGF
receptor component having an immunoglobulin-like (Ig) domain 2 of a
first VEGF receptor, an Ig domain 3 of a second VEGF receptor, and
a multimerizing component.
Inventors: |
PAPADOPOULOS; Nicholas J.;
(LaGrangeville, NY) ; DAVIS; Samuel; (New York,
NY) ; YANCOPOULOS; George D.; (Yorktown Heights,
NY) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Regeneron Pharmaceuticals, Inc.; |
Tarrytown |
NY |
US |
|
|
Assignee: |
Regeneron Pharmaceuticals,
Inc.
Tarrytown
NY
|
Family ID: |
30447765 |
Appl. No.: |
13/683216 |
Filed: |
November 21, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13106910 |
May 13, 2011 |
8343737 |
|
|
13683216 |
|
|
|
|
12334927 |
Dec 15, 2008 |
7964377 |
|
|
13106910 |
|
|
|
|
12102648 |
Apr 14, 2008 |
7524499 |
|
|
12334927 |
|
|
|
|
11016097 |
Dec 17, 2004 |
7374757 |
|
|
12102648 |
|
|
|
|
10009852 |
Dec 6, 2001 |
7070959 |
|
|
PCT/US2000/014142 |
May 23, 2000 |
|
|
|
11016097 |
|
|
|
|
60138133 |
Jun 8, 1999 |
|
|
|
Current U.S.
Class: |
435/358 ;
435/252.33; 435/365 |
Current CPC
Class: |
C07K 2319/30 20130101;
C12N 15/10 20130101; C07H 21/04 20130101; C07K 14/71 20130101; C07K
16/22 20130101; C07K 2319/00 20130101; A61P 43/00 20180101; C12N
15/09 20130101; A61K 38/00 20130101; C07K 19/00 20130101 |
Class at
Publication: |
435/358 ;
435/252.33; 435/365 |
International
Class: |
C07K 14/71 20060101
C07K014/71 |
Claims
1. A cell culture composition comprising cells suspended in culture
medium, wherein the cells contain an expression vector comprising a
nucleic acid molecule that encodes the amino acid sequence of
Flt1D2.Flk1D3.Fc.DELTA.C1(a) (SEQ ID NO:12) or
VEGFR1R2-Fc.DELTA.C1(a) (SEQ ID NO:16).
2. The cell culture composition of claim 1, wherein the cells are
selected from the group consisting of bacterial cells, yeast cells,
insect cells and mammalian cells.
3. The cell culture composition of claim 2, wherein the cells are
E. coli cells, COS cells or CHO cells.
4. The cell culture composition of claim 3, wherein the cells are
CHO cells.
5. The cell culture composition of claim 1, wherein the culture
medium is a glutamine-free medium.
6. The cell culture composition of claim 1, wherein the culture
medium contains 5% fetal bovine serum.
7. The cell culture composition of claim 1, wherein the culture
medium has a pH of 7.2.
8. The cell culture composition of claim 1 contained within a
roller bottle.
9. The cell culture composition of claim 1 contained within a
bioreactor.
10. The cell culture composition of claim 9, wherein the bioreactor
is a 5 L bioreactor.
11. The cell culture composition of claim 9, wherein the bioreactor
is a 40 L bioreactor.
12. The cell culture composition of claim 1, wherein the density of
the cells in the culture medium is 4.times.10.sup.6 cells/mL.
Description
[0001] This application is a continuation of U.S. patent
application Ser. No. 13/106,910, filed May 13, 2011, which is a
continuation of U.S. patent application Ser. No. 12/334,927, filed
Dec. 15, 2008, now U.S. Pat. No. 7,964,377, which is a continuation
of U.S. patent application Ser. No. 12/102,648, filed Apr. 14,
2008, now U.S. Pat. No. 7,524,499, which is a divisional of U.S.
patent application Ser. No. 11/016,097, filed Dec. 17, 2004, now
U.S. Pat. No. 7,374,757, which is a divisional of U.S. patent
application Ser. No. 10/009,852, filed Dec. 6, 2001, now U.S. Pat.
No. 7,070,959, which is a national stage application of
International Application No. PCT/US00/14142, filed May 23, 2000,
which claims priority of U.S. Provisional Application No.
60/138,133, filed Jun. 8, 1999. The disclosures of these
publications in their entireties are hereby incorporated by
reference into this application.
INTRODUCTION
[0002] The field of this invention is modified polypeptides with
improved pharmacokinetics. Specifically, the field of this
invention relates to Flt1 receptor polypeptides that have been
modified in such a way as to improve their pharmacokinetic profile.
The field of this invention also relates to methods of making and
using the modified polypeptides including but not limited to using
the modified polypeptides to decrease or inhibit plasma leakage
and/or vascular permeability in a mammal.
BACKGROUND
[0003] The ability of polypeptide ligands to bind to cells and
thereby elicit a phenotypic response such as cell growth, survival,
cell product secretion, or differentiation is often mediated
through transmembrane receptors on the cells. The extracellular
domain of such receptors (i.e. that portion of the receptor that is
displayed on the surface of the cell) is generally the most
distinctive portion of the molecule, as it provides the protein
with its ligand binding characteristic. Binding of a ligand to the
extracellular domain generally results in signal transduction which
transmits a biological signal to intracellular targets. Often, this
signal transduction acts via a catalytic intracellular domain. The
particular array of sequence motifs of this catalytic intracellular
domain determines its access to potential kinase substrates
(Mohammadi, et al., 1990, Mol. Cell. Biol. 11:5068-5078; Fantl, et
al., 1992, Cell 69:413-413). Examples of receptors that transduce
signals via catalytic intracellular domains include the receptor
tyrosine kinases (RTKs) such as the Trk family of receptors which
are generally limited to cells of the nervous system, the cytokine
family of receptors including the tripartate CNTF receptor complex
(Stahl & Yancopoulos, 1994, J. Neurobio. 25:1454-1466) which is
also generally limited to the cells of the nervous system,
G-protein coupled receptors such as the .beta..sub.2-adrenergic
receptor found on, for instance, cardiac muscle cells, and the
multimeric IgE high affinity receptor Fc.epsilon.RI which is
localized, for the most part, on mast cells and basophils (Sutton
& Gould, 1993, Nature 366:421-428).
[0004] All receptors identified so far appear to undergo
dimerization, multimerization, or some related conformational
change following ligand binding (Schlessinger, J., 1988, Trend
Biochem. Sci. 13:443-447; Ullrich & Schlessinger, 1990, Cell
61:203-212; Schlessinger & Ullrich, 1992, Neuron 9:383-391) and
molecular interactions between dimerizing intracellular domains
lead to activation of catalytic function. In some instances, such
as platelet-derived growth factor (PDGF), the ligand is a dimer
that binds two receptor molecules (Hart, et al., 1988, Science,
240:1529-1531; Heldin, 1989, J. Biol. Chem. 264:8905-8912) while,
for example, in the case of epidermal growth factor (EGF), the
ligand is a monomer (Weber, et al., 1984, J. Biol. Chem.
259:14631-14636). In the case of the Fc.epsilon.RI receptor, the
ligand, IgE, exists bound to Fc.epsilon.RI in a monomeric fashion
and only becomes activated when antigen binds to the
IgE/Fc.epsilon.RI complex and cross-links adjacent IgE molecules
(Sutton & Gould, 1993, Nature 366:421-428).
[0005] Often, the tissue distribution of a particular receptor
within higher organisms provides insight into the biological
function of the receptor. The RTKs for some growth and
differentiation factors, such as fibroblast growth factor (FGF),
are widely expressed and therefore appear to play some general role
in tissue growth and maintenance. Members of the Trk RTK family
(Glass & Yancopoulos, 1993, Trends in Cell Biol. 3:262-268) of
receptors are more generally limited to cells of the nervous
system, and the Nerve Growth Factor family consisting of nerve
growth factor (NGF), brain-derived neurotrophic factor (BDNF),
neurotrophin-3 (NT-3) and neurotrophin-4/5 (NT-4/5), which bind the
Trk RTK family receptors, promote the differentiation of diverse
groups of neurons in the brain and periphery (Lindsay, R. M, 1993,
in Neurotrophic Factors, S. E. Loughlin & J. H. Fallon, eds.,
pp. 257-284, San Diego, Calif., Academic Press). Fc.epsilon.RI is
localized to a very limited number of types of cells such as mast
cells and basophils. Mast cells derive from bone marrow pluripotent
hematopoietic stem cell lineage, but complete their maturation in
the tissue following migration from the blood stream (See Janeway
& Travers, 1996, in Immunobiology, 2d. Edition, M. Robertson
& E. Lawrence, eds., pp. 1:3-1:4, Current Biology Ltd., London,
UK, Publisher) and are involved in the allergic response.
[0006] Many studies have demonstrated that the extracellular domain
of a receptor provides the specific ligand binding characteristic.
Furthermore, the cellular environment in which a receptor is
expressed may influence the biological response exhibited upon
binding of a ligand to the receptor. For example, when a neuronal
cell expressing a Trk receptor is exposed to a neurotrophin which
binds to that receptor, neuronal survival and differentiation
results. When the same receptor is expressed by a fibroblast,
exposure to the neurotrophin results in proliferation of the
fibroblast (Glass, et al., 1991, Cell 66:405-413).
[0007] A class of cell-derived dimeric mitogens with selectivity
for vascular endothelial cells has been identified and designated
vascular endothelial cell growth factor (VEGF). VEGF has been
purified from conditioned growth media of rat glioma cells (Conn et
al., 1990, Proc. Natl. Acad. Sci. U.S.A., 87. pp 2628-2632); and
conditioned growth media of bovine pituitary follicle stellate
cells (Ferrara and Henzel, 1989, Biochem. Biophys. Res. Comm., 161,
pp. 851-858; Gozpadorowicz et al., 1989, Proc. Natl. Acad. Sci.
U.S.A., 86, pp. 7311-7315 and conditioned growth medium from human
U937 cells (Connolly, D. T. et al. 1989, Science, 246, pp.
1309-1312). VEGF is a dimer with an apparent molecular mass of
about 46 kDa with each subunit having an apparent molecular mass of
about 23 kDa. VEGF has some structural similarities to platelet
derived growth factor (PDGF), which is a mitogen for connective
tissue cells but not mitogenic for vascular endothelial cells from
large vessels.
[0008] The membrane-bound tyrosine kinase receptor, known as Flt,
was shown to be a VEGF receptor (DeVries, C. et alt, 1992, Science,
255, pp. 989-991). The Flt receptor specifically binds VEGF which
induces mitogenesis. Another form of the VEGF receptor, designated
KDR, is also known to bind VEGF and induce mitogenesis. The partial
cDNA sequence and nearly full length protein sequence of KDR is
known as well (Terman, B. I. et al., 1991 Oncogene 6, pp.
1677-1683; Terman, B. I. et al., 1992 Biochem. Biophys. Res. Comm.
187, pp. 1579-1586).
[0009] Persistent angiogenesis may cause or exacerbate certain
diseases such as psoriasis, rheumatoid arthritis, hemangiomas,
angiofibromas, diabetic retinopathy and neovascular glaucoma. An
inhibitor of VEGF activity would be useful as a treatment for such
diseases and other VEGF-induced pathological angiogenesis and
vascular permeability conditions, such as tumor vascularization.
The present invention relates to a VEGF inhibitor that is based on
the VEGF receptor Flt1.
[0010] Plasma leakage, a key component of inflammation, occurs in a
distinct subset of microvessels. In particular, in most organs
plasma leakage occurs specifically in the venules. Unlike
arterioles and capillaries, venules become leaky in response to
numerous inflammatory mediators including histamine, bradykinin,
and serotonin. One characteristic of inflammation is the plasma
leakage that results from intercellular gaps that form in the
endothelium of venules. Most experimental models of inflammation
indicate that these intercellular gaps occur between the
endothelial cells of postcapillary and collecting venules (Baluk,
P., et al., Am. J. Pathol., 1998, 152:1463-76). It has been shown
that certain lectins may be used to reveal features of focal sites
of plasma leakage, endothelial gaps, and finger-like processes at
endothelial cell borders in inflamed venules (Thurston, G., et al.,
Am. J. Physiol., 1996, 271: H2547-62). In particular, plant lectins
have been used to visualize morphological changes at endothelial
cell borders in inflamed venules of, for example, the rat trachea.
Lectins, such as conconavalin A and ricin, that bind focally to
inflamed venules reveal regions of the subendothelial vessel wall
exposed by gaps that correspond to sites of plasma leakage
(Thurston, G., et al., Am J Physiol., 1996, 271: H2547-62).
[0011] The properties of the microvessels are dynamic. Chronic
inflammatory diseases, for example, are associated with
microvascular remodeling, including angiogenesis and microvessel
enlargement. Microvessels can also remodel by acquiring abnormal
phenotypic properties. In a murine model of chronic airway
inflammation, airway capillaries acquire properties of venules,
including widened vessel diameter, increased immunoreactivity for
von Willebrand factor, and increased immunoreactivity for
P-selectin. In addition, these remodeled vessels leak in response
to inflammatory mediators, whereas vessels in the same position in
the airways of normal mice do not.
[0012] Certain substances have been shown to decrease or inhibit
vascular permeability and/or plasma leakage. For example, mystixins
are synthetic polypeptides that have been reported to inhibit
plasma leakage without blocking endothelial gap formation (Baluk,
P., et al., J. Pharmacol. Exp. Ther., 1998, 284: 693-9). Also, the
beta 2-adrenergic receptor agonist formoterol reduces microvascular
leakage by inhibiting endothelial gap formation (Baluk, P. and
McDonald, D. M., Am. J. Physiol., 1994, 266:L461-8).
[0013] The angiopoietins and members of the vascular endothelial
growth factor (VEGF) family are the only growth factors thought to
be largely specific for vascular endothelial cells. Targeted gene
inactivation studies in mice have shown that VEGF is necessary for
the early stages of vascular development and that Ang-1 is required
for later stages of vascular remodeling.
[0014] U.S. Pat. No. 6,011,003, issued Jan. 4, 2000, in the name of
Metris Therapeutics Limited, discloses an altered, soluble form of
FLT polypeptide being capable of binding to VEGF and thereby
exerting an inhibitory effect thereon, the polypeptide comprising
five or fewer complete immunoglobulin domains.
[0015] U.S. Pat. No. 5,712,380, issued Jan. 27, 1998 and assigned
to Merck & Co., discloses vascular endothelial cell growth
factor (VEGF) inhibitors that are naturally occurring or
recombinantly engineered soluble forms with or without a C-terminal
transmembrane region of the receptor for VEGF.
[0016] Also assigned to Merck & Co. is PCT Publication No. WO
98/13071, published Apr. 2, 1998, which discloses gene therapy
methodology for inhibition of primary tumor growth and metastasis
by gene transfer of a nucleotide sequence encoding a soluble
receptor protein which binds to VEGF.
[0017] PCT Publication No. WO 97/44453, published Nov. 27, 1997, in
the name of Genentech, Inc., discloses novel chimeric VEGF receptor
proteins comprising amino acid sequences derived from the vascular
endothelial growth factor (VEGF) receptors Flt1 and KDR, including
the murine homologue to the human KDR receptor FLK1, wherein said
chimeric VEGF receptor proteins bind to VEGF and antagonize the
endothelial cell proliferative and angiogenic activity thereof.
[0018] PCT Publication No. WO 97/13787, published Apr. 17, 1997, in
the name of Toa Gosei Co., LTD., discloses a low molecular weight
VEGF inhibitor usable in the treatment of diseases accompanied by
neovascularization such as solid tumors. A polypeptide containing
the first immunoglobulin-like domain and the second
immunoglobulin-like domain in the extracellular region of a VEGF
receptor FLT but not containing the sixth immunoglobulin-like
domain and the seventh immunoglobulin-like domain thereof shows a
VEGF inhibitory activity.
[0019] Sharifi, J. et al., 1998, The Quarterly Jour. of Nucl. Med.
42:242-249, disclose that because monoclonal antibodies (MAbs) are
basic, positively charged proteins, and mammalian cells are
negatively charged, the electrostatic interactions between the two
can create higher levels of background binding resulting in low
tumor to normal organ ratios. To overcome this effect, the
investigators attempted to improve MAb clearance by using various
methods such as secondary agents as well as chemical and charge
modifications of the MAb itself.
[0020] Jensen-Pippo, et al., 1996, Pharmaceutical Research
13:102-107, disclose that pegylation of a therapeutic protein,
recombinant human granulocyte colony stimulating factor
(PEG-G-CSF), results in an increase in stability and in retention
of in vivo bioactivity when administered by the intraduodenal
route.
[0021] Tsutsumi, et al., 1997, Thromb Haemost, 77:168-73, disclose
experiments wherein the in vivo thrombopoietic activity of
polyethylene glycol-modified interleukin-6 (MPEG-IL-6), in which
54% of the 14 lysine amino groups of IL-6 were coupled with PEG,
was compared to that of native IL-6.
[0022] Yang, et al., 1995, Cancer 76:687-94, disclose that
conjugation of polyethylene glycol to recombinant human
interleukin-2 (IL-2) results in a compound, polyethylene
glycol-modified IL-2 (PEG-IL-2) that retains the in vitro and in
vivo activity of IL-2, but exhibits a markedly prolonged
circulating half-life.
[0023] R. Duncan and F. Spreafico, Clin. Pharmacokinet., 27:
290-306, 296 (1994) review efforts to improve the plasma half-life
of asparaginase by conjugating polyethylene glycol.
[0024] PCT International Publication No. WO 99/03996 published Jan.
28, 1999 in the name of Regeneron Pharmaceuticals, Inc. and The
Regents of The University of California describes modified human
noggin polypeptides having deletions of regions of basic amino
acids. The modified human noggin polypeptides are described as
retaining biological activity while having reduced affinity for
heparin and superior pharmacokinetics in animal sera as compared to
the unmodified human noggin.
SUMMARY OF THE INVENTION
[0025] The present invention is directed to VEGF antagonists with
improved pharmacokinetic properties. A preferred embodiment is an
isolated nucleic acid molecule encoding a fusion polypeptide
capable of binding a VEGF polypeptide comprising (a) a nucleotide
sequence encoding a VEGF receptor component operatively linked to
(b) a nucleotide sequence encoding a multimerizing component,
wherein the VEGF receptor component is the only VEGF receptor
component of the fusion polypeptide and wherein the nucleotide
sequence of (a) consists essentially of a nucleotide sequence
encoding the amino acid sequence of Ig domain 2 of the
extracellular domain of a first VEGF receptor and a nucleotide
sequence encoding the amino acid sequence of Ig domain 3 of the
extracellular domain of a second VEGF receptor.
[0026] In a further embodiment, the isolated nucleic acid of the
first VEGF receptor is Flt1.
[0027] In a further embodiment, the isolated nucleic acid of the
second VEGF receptor is Flk1.
[0028] In yet another embodiment, the isolated nucleic acid of the
second VEGF receptor is Flt4.
[0029] In another preferred embodiment, the nucleotide sequence
encoding Ig domain 2 of the extracellular domain of the first VEGF
receptor is upstream of the nucleotide sequence encoding Ig domain
3 of the extracellular domain of the second VEGF receptor.
[0030] In still another preferred embodiment, the nucleotide
sequence encoding Ig domain 2 of the extracellular domain of the
first VEGF receptor is downstream of the nucleotide sequence
encoding Ig domain 3 of the extracellular domain of the second VEGF
receptor.
[0031] In a preferred embodiment of the invention, the
multimerizing component comprises an immunoglobulin domain.
[0032] In another embodiment, the immunoglobulin domain is selected
from the group consisting of the Fc domain of IgG, the heavy chain
of IgG, and the light chain of IgG.
[0033] Preferred embodiments include an isolated nucleic acid
molecule comprising a nucleotide sequence encoding a modified Flt1
receptor fusion polypeptide, wherein the coding region of the
nucleic acid molecule consists of a nucleotide sequence selected
from the group consisting of (a) the nucleotide sequence set forth
in FIG. 13A-13D (SEQ ID No:3); (b) the nucleotide sequence set
forth in FIG. 14A-14C (SEQ ID NO:5); (c) the nucleotide sequence
set forth in FIG. 15A-15C (SEQ ID NO:7); (d) the nucleotide
sequence set forth in FIG. 16A-16D (SEQ ID NO:9); (e) the
nucleotide sequence set forth in FIG. 21A-21C (SEQ ID NO:11); (f)
the nucleotide sequence set forth in FIG. 22A-22C (SEQ ID NO:13);
(g) the nucleotide sequence set forth in FIG. 24A-24C; and (SEQ ID
NO:15); and (h) a nucleotide sequence which, as a result of the
degeneracy of the genetic code, differs from the nucleotide
sequence of (a), (b), (c), (d), (e), (f), or (g) and which encodes
a fusion polypeptide molecule having the biological activity of the
modified Flt1 receptor fusion polypeptide.
[0034] In a further embodiment of the invention, a fusion
polypeptide is encoded by the isolated nucleic acid molecules
described above.
[0035] A preferred embodiment is a composition capable of binding a
VEGF molecule to form a nonfunctional complex comprising a multimer
of the fusion polypeptide.
[0036] Also preferred is a composition wherein the multimer is a
dimer.
[0037] In yet another embodiment, the composition is in a
carrier.
[0038] Another embodiment is a vector which comprises the nucleic
acid molecules described above, including an expression vector
comprising the nucleic acid molecules described wherein the nucleic
acid molecule is operatively linked to an expression control
sequence.
[0039] Other included embodiments are a host-vector system for the
production of a fusion polypeptide which comprises the expression
vector, in a suitable host cell; the host-vector system wherein the
suitable host cell is a bacterial cell, yeast cell, insect cell, or
mammalian cell; the host-vector system wherein the suitable host
cell is E. coli; the host-vector system wherein the suitable host
cell is a COS cell; the host-vector system wherein the suitable
host cell is a CHO cell.
[0040] Another embodiment of the invention is a method of producing
a fusion polypeptide which comprises growing cells of the
host-vector system under conditions permitting production of the
fusion polypeptide and recovering the fusion polypeptide so
produced.
[0041] Additional embodiments include a fusion polypeptide encoded
by the nucleic acid sequence set forth in FIG. 10A-10D (SEQ ID
NO:1) or FIG. 24A-24C (SEQ ID NO:15), which has been modified by
acetylation or pegylation wherein the acetylation is accomplished
with at least about a 100 fold molar excess of acetylation reagent
or wherein acetylation is accomplished with a molar excess of
acetylation reagent ranging from at least about a 10 fold molar
excess to about a 100 fold molar excess or wherein the pegylation
is 10K or 20K PEG.
[0042] A preferred embodiment includes a method of decreasing or
inhibiting plasma leakage in a mammal comprising administering to
the mammal the fusion polypeptide described above, including
embodiments wherein the mammal is a human, the fusion polypeptide
is acetylated or the fusion polypeptide is pegylated.
[0043] A further embodiments is a fusion polypeptide which
specifically binds the VEGF receptor ligand VEGF.
[0044] A preferred embodiment of the invention is a method of
blocking blood vessel growth in a human comprising administering an
effective amount of the fusion polypeptide described above.
[0045] Also preferred is a method of inhibiting VEGF receptor
ligand activity in a mammal comprising administering to the mammal
an effective amount of the fusion polypeptide described above.
[0046] Preferred embodiments of these methods are wherein the
mammal is a human.
[0047] Further embodiments of the methods of the invention include
attenuation or prevention of tumor growth in a human; attenuation
or prevention of edema in a human, especially wherein the edema is
brain edema; attenuation or prevention of ascites formation in a
human, especially wherein the ascites is ovarian cancer-associated
ascites.
[0048] Preferred embodiments of the invention include a fusion
polypeptide capable of binding a VEGF polypeptide comprising (a) a
VEGF receptor component operatively linked to (b) a multimerizing
component, wherein the VEGF receptor component is the only VEGF
receptor component in the fusion polypeptide and consists
essentially of the amino acid sequence of Ig domain 2 of the
extracellular domain of a first VEGF receptor and the amino acid
sequence of Ig domain 3 of the extracellular domain of a second
VEGF receptor.
[0049] In a further embodiment of the fusion polypeptide, the first
VEGF receptor is Flt1.
[0050] In yet a further embodiment of the fusion polypeptide, the
second VEGF receptor is Flk1.
[0051] Still another embodiment of the fusion polypeptide is one in
which the second VEGF receptor is Flt4.
[0052] Preferred embodiments include a fusion polypeptide wherein
amino acid sequence of Ig domain 2 of the extracellular domain of
the first VEGF receptor is upstream of the amino acid sequence of
Ig domain 3 of the extracellular domain of the second VEGF receptor
and a fusion polypeptide wherein the amino acid sequence of Ig
domain 2 of the extracellular domain of the first VEGF receptor is
downstream of the amino acid sequence of Ig domain 3 of the
extracellular domain of the second VEGF receptor.
[0053] In yet another embodiment, the fusion polypeptide
multimerizing component comprises an immunoglobulin domain
including an embodiment wherein the immunoglobulin domain is
selected from the group consisting of the Fc domain of IgG, the
heavy chain of IgG, and the light chain of IgG.
[0054] Preferred embodiments include a fusion polypeptide
comprising an amino acid sequence of a modified Flt1 receptor,
wherein the amino acid sequence selected from the group consisting
of (a) the amino acid sequence set forth in FIG. 13A-13D (SEQ ID
NO:4); (b) the amino acid sequence set forth in FIG. 14A-14C (SEQ
ID NO:6); (c) the amino acid sequence set forth in FIG. 15A-15C
(SEQ ID NO:8); (d) the amino acid sequence set forth in FIG.
16A-16D (SEQ ID NO:10); (e) the amino acid sequence set forth in
FIG. 21A-21C (SEQ ID NO:12); (f) the amino acid sequence set forth
in FIG. 22A-22C (SEQ ID NO:14); and (g) the amino acid sequence set
forth in FIG. 24A-24C (SEQ ID NO:16).
[0055] Another preferred embodiment is a method of decreasing or
inhibiting plasma leakage in a mammal comprising administering to
the mammal the fusion polypeptide described above.
[0056] An alternative preferred embodiment is a method of
inhibiting VEGF receptor ligand activity in a mammal comprising
administering to the mammal an effective amount of the fusion
polypeptide described above.
BRIEF DESCRIPTION OF THE FIGURES
[0057] FIG. 1. IEF gel analysis of unmodified and acetylated
Flt1(1-3)-Fc proteins. Unmodified Flt1(1-3)-Fc protein is unable to
enter the gel due to its >9.3 pl, whereas acetylated
Flt1(1-3)-Fc is able to enter the gel and equilibrate at pl
5.2.
[0058] FIG. 2. Binding of unmodified Flt1(1-3).Fc and acetylated
Flt1(1-3)-Fc proteins to MATRIGEL.RTM. coated plates. Unmodified
Flt1(1-3)-Fc proteins binds extensive to extracellular matrix
components in MATRIGEL.RTM., whereas acetylated Flt1(1-3)-Fc does
not bind.
[0059] FIG. 3. Binding of unmodified Flt1(1-3)-Fc, acetylated
Flt1(1-3)-Fc, and pegylated Flt1(1-3)-Fc in a BIACORE.TM.-based
assay. Acetylated (columns 13-16), pegylated (columns 17-20), and
heparin-treated Flt1(1-3)-Fc (columns 21-24) are each able to
completely compete with the BIACORE.TM. chip-bound Flt1(1-3)-Fc for
VEGF binding as compared to control (columns 1-4) and irrelevant
protein (columns 5-8). Unmodified Flt1(1-3)-Fc (columns 5-6)
appears to only partially compete with BIACORE.TM. chip-bound
Flt1(1-3)-Fc for VEGF binding. However, washing the bound samples
with 0.5 M NaCl (columns 7-8) results in a binding profile similar
to the modified forms of Flt1(1-3)-Fc, indicating that the
unmodified protein is exhibiting non-specific binding to the chip
that can be eliminated by the salt wash.
[0060] FIG. 4. Binding of unmodified Flt1(1-3)-Fc, acetylated
Flt1(1-3)-Fc, and pegylated Flt1(1-3)-Fc to VEGF in an ELISA-based
assay. Both pegylated and acetylated Flt1(1-3)-Fc proteins bind to
VEGF with affinities approaching that of unmodified
Flt1(1-3)-Fc.
[0061] FIG. 5. Pharmacokinetic profiles of unmodified Flt1(1-3)-Fc,
acetylated Flt1(1-3)-Fc, and pegylated Flt1(1-3)-Fc. Balb/c mice
(23-28 g) were injected subcutaneously with 4 mg/kg of unmodified,
acetylated, or pegylated Flt1(1-3)-Fc. The mice were tail bled at
1, 2, 4, 6, 24 hours, 2 days, and 3 days after injection of protein
and the sera were assayed in a standard ELISA-based assay designed
to detect Flt1(1-3)-Fc protein. The T.sub.max for all of the
Flt1(1-3)-Fc proteins was between the 6 hour and 24 hour time
points. The C.sub.max for the different proteins was as follows:
Unmodified: 0.06 .mu.g/ml-0.15 .mu.g/ml; acetylated: 1.5
.mu.g/ml-4.0 .mu.g/ml; and pegylated: approximately 5 .mu.g/ml.
[0062] FIG. 6A-6B. IEF gel analysis of unmodified and
step-acetylated Flt1 (1-3)-Fc proteins. Unmodified Flt1(1-3)-Fc
protein is unable to enter the gel due to its >9.3 pl, whereas
most of the step-acetylated Flt1(1-3)-Fc samples (30-100 fold
excess samples) were able to migrate into the gel and equilibrate
at pls ranging between 4.55-8.43, depending on the degree of
acetylation.
[0063] FIG. 7. Binding of unmodified Flt1(1-3)-Fc and
step-acetylated Flt1(1-3)-Fc proteins to MATRIGEL.RTM. coated
plates. As with the irrelevant control protein, rTie2-Fc,
step-acetylated Flt1(1-3)-Fc (20 and 30 fold excess samples) does
not exhibit any binding to the MATRIGEL.RTM. coated plate, whereas
the non-acetylated Flt1(1-3)-Fc protein exhibits significant
binding. The 10 fold excess sample shows reduced binding, but the
degree of acetylation is not enough to completely block binding to
extracellular matrix components.
[0064] FIG. 8. Binding of unmodified Flt1(1-3)-Fc and
step-acetylated Flt1(1-3)-Fc in a BIACORE.TM.-based assay. At a
sub-stoichiometric ratio (0.5 .mu.g/ml of either unmodified
Flt1(1-3) or step-acetylated Flt1(1-3)-Fc vs. 0.2 .mu.g/ml VEGF),
there is not enough Flt1(1-3)-Fc (either unmodified or
step-acetylated) in the solution to completely bind the VEGF. At
1.0 .mu.g/ml, which approximates a 1:1 stoichiometric ratio, the
both unmodified and step-acetylated Flt1(1-3)-Fc are better able to
compete for VEGF binding, but there is still insufficient
Flt1(1-3)-Fc protein (either unmodified or step-acetylated) to
completely saturate the available VEGF. However, at 5.0 .mu.g/ml,
which is several times greater than a 1:1 stoichiometnc ratio, both
the Flt1 (1-3)-Fc and the step-acetylated Flt1(1-3)-Fc proteins are
able to saturate the VEGF, regardless of the degree of
acetylation.
[0065] FIG. 9. Pharmacokinetic profiles of unmodified Flt1(1-3)-Fc
and step-acetylated Flt1(1-3)-Fc. Balb/c mice (23-28 g) were
injected subcutaneously with 4 mg/kg of unmodified or 10, 20, 40,
60 and 100 fold excess samples of step-acetylated Flt1(1-3)-Fc (3
mice for unmodified, 10, 20 and fold excess samples and 2 mice for
60 and 100 fold excess samples). The mice were tail bled at 1, 2,
4, 6, 24 hours, 2 days and 3 days after injection. The sera were
assayed in an ELISA-based assay designed to detect Flt1(1-3)-Fc.
The T.sub.max for all of the Flt1(1-3)-Fc proteins tested was at
the 6 hour time point but the C.sub.max was as follows: Unmodified
Flt1(1-3)-Fc: 0.06 .mu.g/ml; 10 fold excess sample: -0.7 .mu.g/ml,
20 fold excess sample -2 .mu.g/ml, 40 fold excess sample -4
.mu.g/ml, 60 fold excess sample -2 .mu.g/ml, 100 fold excess sample
-1 .mu.g/ml.
[0066] FIG. 10A-10D. Nucleic acid (SEQ ID NO:1) and deduced amino
acid sequence (SEQ ID NO:2) of Flt1(1-3)-Fc.
[0067] FIG. 11. Schematic diagram of the structure of Flt1.
[0068] FIGS. 12A and 12B. Hydrophilicity analysis of the amino acid
sequences of Ig domain 2 and Ig domain 3 of Flt1.
[0069] FIG. 13A-13D. Nucleic acid (SEQ ID NO:3) and deduced amino
acid sequence (SEQ ID NO:4) of Mut1:Flt1 (1-3.sub..DELTA.B)-Fc.
[0070] FIG. 14A-14 C. Nucleic acid (SEQ ID NO:5) and deduced amino
acid sequence (SEQ ID NO:6) of Mut2:Flt1 (2-3.sub..DELTA.B)-Fc.
[0071] FIG. 15A-15C. Nucleic acid (SEQ ID NO:7) and deduced amino
acid sequence (SEQ ID NO:8) of Mut3:Flt1 (2-3)-Fc.
[0072] FIG. 16A-16D. Nucleic acid (SEQ ID NO:9) and deduced amino
acid sequence (SEQ ID NO:10) of Mut4:Flt1(1-3.sub.R->N)-Fc.
[0073] FIG. 17. Binding of unmodified Flt1(1-3)-Fc, basic region
deletion mutant Flt1(1-3)-Fc, and Flt1(1-3).sub.R->N mutant
proteins in a BIACORE.TM.-based assay. At the sub-stoichiometric
ratio (0.25 .mu.g/ml Flt1(1-3)-Fc of unmodified, acetylated or
genetically modified samples vs. 01. .mu.g/ml VEGF), there is
insufficient Flt1(1-3)-Fc protein to block binding of VEGF to the
Flt1(1-3)-Fc immobilized on the BIACORE.TM. chip. At 0.5 .mu.g/ml
of unmodified, acetylated or genetically modified Flt1(1-3)-Fc
proteins, the stoichiometric ratio approximates 1:1 and there is an
increased ability to block VEGF binding to the BIACORE.TM. chip. At
1.0 .mu.g/ml of unmodified, acetylated or genetically modified
Flt1(1-3)-Fc proteins, which is approximately a 10:1 stoichiometric
ratio, the Flt1(1-3)-Fc proteins are able to block binding of VEGF
to the BIACORE.TM. chip, but they are not equivalent. Unmodified,
acetylated, and Mut1:Flt1(1-3.sub..DELTA.B)-Fc are essentially
equal in their ability to block VEGF binding, whereas
Mut4:Flt1(1-3.sub.R->N)-Fc is somewhat less efficient at
blocking binding.
[0074] FIG. 18. Binding of unmodified Flt1(1-3)-Fc,
Mut1:Flt1(1-3.sub..DELTA.B)-Fc, Mut2:Flt1(2-3.sub..DELTA.B)-Fc, and
Flt1(2-3) mutant proteins to MATRIGEL.RTM. coated plates.
Unmodified Flt1(1-3)-Fc protein binds avidly to these wells, the
Mut3:Flt1(2-3)-Fc protein binds somewhat more weakly, the
Mut1:Flt1(1-3.sub..DELTA.B)-Fc protein binds more weakly still, and
the Mut2:Flt1(2-3.sub..DELTA.B)-Fc protein shows the best profile,
binding more weakly than any of the other mutant proteins. The
Mut4:Flt1(1-3.sub.R->N)-Fc glycosylation mutant protein shows
only marginal benefit on the MATRIGEL.RTM. assay.
[0075] FIG. 19. Binding of unmodified Flt1(1-3)-Fc,
Mut1:Flt1(1-3.sub..DELTA.B)-Fc, Mut2:Flt1(2-3.sub..DELTA.B)-Fc, and
Flt1(2-3) mutant proteins in an ELISA-based assay. At the
concentrations tested, unmodified Flt1(1-3)-Fc,
Mut1:Flt1(1-3.sub..DELTA.B)-Fc, Mut2:Flt1(2-3.sub..DELTA.B)-Fc, and
Flt1(2-3) mutant proteins bind VEGF similarly.
[0076] FIG. 20. Pharmacokinetic profiles of unmodified
Flt1(1-3)-Fc, Mut1:Flt1(1-3.sub..DELTA.B)-Fc, Mut2:
Flt1(2-3.sub..DELTA.B)-Fc, and Flt1(2-3) mutant proteins, the
C.sub.max for these reagents was as follows: Unmodified
Flt1(1-3)-Fc -0.15 .mu.g/ml; 40 fold molar excess acetylated
Flt1(1-3)-Fc -1.5 .mu.g/ml; and Mut1:Flt1(1-3.sub..DELTA.B)-Fc -0.7
.mu.g/ml.
[0077] FIG. 21A-21C. Nucleotide (SEQ ID NO:11) and deduced amino
acid sequence (SEQ ID NO:12) of the modified Flt1 receptor termed
Flt1D2.Flk1D3.Fc.DELTA.C1(a).
[0078] FIG. 22A-22C. Nucleotide (SEQ ID NO:13) and deduced amino
acid sequence (SEQ ID NO:14) of the modified Flt1 receptor termed
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a).
[0079] FIG. 23. Extracellular Matrix (ECM) Assay. The results of
this assay demonstrate that the Flt1D2.Flk1D3.Fc.DELTA.C1(a) and
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a) proteins are considerably less
sticky to the ECM as compared to the Flt1(1-3)-Fc protein.
[0080] FIG. 24A-24C. Nucleotide (SEQ ID NO:15) and deduced amino
acid sequence (SEQ ID NO:16) of the modified Flt1 receptor termed
VEGFR1R2-Fc.DELTA.C1(a).
[0081] FIG. 25A-25C. Phosphorylation assay. At a 1.5 molar excess
of either Flt1(1-3)-Fc, Flt1(1-3)-Fc (A40) or transient
Flt1D2Flk1D3.Fc.DELTA.C1(a) there is complete blockage of receptor
stimulation by these three modified Flt1 receptors as compared to
control media challenge. In contrast, transient
Flt1D2VEGFR3D3.Fc.DELTA.C1(a) does not show significant blockage at
this molar excess, as compared with VEGF positive control
challenge. Similar results are seen in FIG. 25B, where the modified
Flt receptors are in a 3-fold molar excess to VEGF165 ligand. In
FIG. 25C, where the modified Flt1 receptors are in a 6-fold molar
excess to VEGF165 ligand, transient Flt1D2VEGFR3D3.Fc.DELTA.C1(a)
can now be shown to be partially blocking VEGF165-induced
stimulation of cell-surface receptors.
[0082] FIG. 26A-26B. Phosphorylation assay. Detection by Western
blot of tyrosine phosphorylated VEGFR2 (Flk1) by VEGF165 ligand
stimulation shows that cell-surface receptors are not
phosphorylated by challenge samples which have VEGF165 preincubated
with 1 and 2 fold molar excess (FIG. 26A) or 3 and 4 fold molar
excess (FIG. 26B) of either transient Flt1D2Flk1D3.Fc.DELTA.C1(a),
stable Flt1D2Flk1D3.Fc.DELTA.C1(a), or transient
VEGFR1R2-Fc.DELTA.C1(a). At all modified Flt1 receptor
concentrations tested there is complete binding of VEGF165 ligand
during the preincubation, resulting in no detectable stimulation of
cell-surface receptors by unbound VEGF165 as compared to control
media challenge.
[0083] FIG. 27. MG/R2Cell proliferation assay. The following
modified Flt receptors Flt1(1-3)-Fc, Flt1D2.Flk1D3.Fc.DELTA.C1(a)
and Flt1D2.VEGFR3D3.Fc.DELTA.C1(a), plus an irrelevant receptor
termed Tie2-Fc as a negative control, were titrated from 40 nM to
20 pM and incubated on the cells for 1 hr at 37.degree. C. Human
recombinant VEGF165 in defined media was then added to all the
wells at a concentration of 1.56 nM. The negative control receptor
Tie2-Fc does not block VEGF165-induced cell proliferation at any
concentration whereas Flt1D2.Flk1D3.Fc.DELTA.C1(a) blocks 1.56 nM
VEGF165 with a half maximal dose of 0.8 nM. Flt1(1-3)-Fc and
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a) are less effective in blocking
VEGF165 in this assay with a half maximal dose of .about.2 nM,
VEGF165 alone gives a reading of 1.2 absorbance units and the
background is 0.38 absorbance units.
[0084] FIG. 28. BIACORE.TM. analysis of Binding Stoichiometry.
Binding stoichiometry was calculated as a molar ratio of bound
VEGF165 to the immobilized Flt1D2Flk1D3.Fc.DELTA.C1(a) or
VEGFR1R2-Fc.DELTA.C1(a), using the conversion factor of 1000 RU
equivalent to 1 ng/ml. The results indicated binding stoichiometry
of one VEGF165 dimeric molecule per one Flt1D2Flk1D3.Fc.DELTA.C1(a)
or VEGFR1R2-Fc C1(a) molecule.
[0085] FIGS. 29-30. Size Exclusion Chromatography Stoichiometry.
Flt1D2Flk1D3.Fc.DELTA.C1(a) or VEGFR11R2-Fc.DELTA.C1(a) at a
concentration of 1 nM (estimated to be 1000 times higher than the
KD of the Flt1D2Flk1D3.Fc.DELTA.C1(a) or
VEGFR1R2-Fc.DELTA.C1(a)/VEGF165 interaction) were mixed with varied
concentrations of VEGF165. After incubation, concentrations of the
free Flt1D2Flk1D3.Fc.DELTA.C1(a) in solution were measured. The
data shows that the addition of 1 nM VEGF165 into the
Flt1D2Flk1D3.Fc.DELTA.C1(a) solution completely blocks
Flt1D2Flk1D3.Fc.DELTA.C1(a) binding to the VEGF165 surface. This
result suggested the binding stoichiometry of one VEGF165 molecule
per one Flt1D2Flk1D3.Fc.DELTA.C1(a) molecule.
[0086] FIG. 31. Size Exclusion Chromatography (SEC) under native
conditions. Peak #1 represents the
Flt1D2Flk1D3.Fc.DELTA.C1(a)/VEGF165 complex and peak #2 represents
unbound VEGF165. Fractions eluted between 1.1 and 1.2 ml were
combined and guanidinium hydrochloride (GuHCl) was added to a final
concentration 4.5 M to dissociate the complex.
[0087] FIG. 32. Size Exclusion Chromatography (SEC) under
dissociative conditions. To separate the components of the
receptor-ligand complex and to determine their molar ratio, 50
.mu.l of dissociated complex was loaded onto a SUPEROSE.TM. 12 PC
3.2/30 equilibrated in 6 M GuHCl and eluted. Peak #1 represents
Flt1D2Flk1D3.Fc.DELTA.C1(a) and peak #2 represents VEGF165.
[0088] FIGS. 33-35. Size Exclusion Chromatography (SEC) with
On-Line Light Scattering. Size exclusion chromatography column with
a MiniDawn on-line light scattering detector (Wyatt Technology,
Santa Barbara, Calif.) and refractive index (R1) detectors
(Shimadzu, Kyoto, Japan) was used to determine the molecular weight
(MW) of the receptor-ligand complex. As shown in FIG. 33, the
elution profile shows two peaks. Peak #1 represents the
receptor-ligand complex and peak #2 represents the unbound VEGF165.
MW was calculated from LS and RI signals. The same procedure was
used to determine MW of the individual components of the
receptor-ligand complex. The results of these determinations are as
follows: MW of the Flt1D2Flk1D3.Fc.DELTA.C1(a)/VEGF165 complex at
the peak position is 157 300 (FIG. 33), the MW of VEGF165 at the
peak position is 44 390 (FIG. 34) and the MW of R1R2 at the peak is
113 300 (FIG. 35).
[0089] FIG. 36. Peptide mapping and glycosylation analysis. The
disulfide structures and glycosylation sites in
Flt1D2.Flk1D3.Fc.DELTA.C1(a) (SEQ ID NO:12) were determined by a
peptide mapping method. There are a total of ten cysteines in
Flt1D2.Flk1D3.Fc.DELTA.C1(a): six of them belong to the Fc region.
Cys27 is disulfide bonded to Cys76. Cys121 is disulfide bonded to
Cys182. The first two cysteines in the Fc region (Cys211 and
Cys214) form an intermolecular disulfide bond with the same two
cysteines in another Fc chain. However, it can not be determined
whether disulfide bonding is occurring between same cysteines
(Cys211 to Cys211, for example) or between Cys211 and Cys214.
Cys216 is disulfide bonded to Cys306. Cys352 is disulfide bonded to
Cys410. There are five possible N-linked glycosylation sites in
Flt1D2.Flk1D3.Fc.DELTA.C1(a) (SEQ ID NO:12) and are found to be
glycosylated to varying degrees. Complete glycosylation is observed
at Asn33, Asn193, and Asn282. Partial glycosylation is observed on
Asn65 and Asn120. Sites of glycosylation are highlighted by
underline in the figure.
[0090] FIG. 37. Pharmacokinetics of Flt1 (1-3)-Fc (A40),
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and VEGFR1R2-Fc.DELTA.C1(a). Balb/c
mice were injected subcutaneously with 4 mg/kg of Flt1(1-3)-Fc
(A40), CHO transiently expressed Flt1D2.Flk1D3. Fc.DELTA.C1(a), CHO
stably expressed Flt1D2.Flk1D3.Fc.DELTA.C1(a), and CHO transiently
expressed VEGFR1R2-Fc.DELTA.C1(a). The mice were tail bled at 1, 2,
4, 6, 24 hrs, 2 days, 3 days and 6 days after injection. The sera
were assayed in an ELISA designed to detect Flt1 (1-3)-Fc (A40),
Flt1D2.Flk1D3.Fc.DELTA.C1(a) or VEGFR1R2-Fc.DELTA.C1(a). The
T.sub.max for Flt1 (1-3)-Fc (A40) was at 6 hrs while the T.sub.max
for the transient and stable Flt1D2.Flk1D3.Fc.DELTA.C1(a) and the
transient VEGFR1R2-Fc.DELTA.C1(a) was 24 hrs. The C.sub.max for
Flt1(1-3)-Fc (A40) was 8 .mu.g/ml. For both transients
(Flt1D2.Flk1D3.Fc.DELTA.C1(a) and VEGFR1R2-Fc.DELTA.C1(a)) the
C.sub.max was 18 .mu.g/ml and the C.sub.max for the stable
VEGFR1R2-Fc.DELTA.C1(a) was 30 .mu.g/ml.
[0091] FIG. 38. Pharmacokinetics of Flt1(1-3)-Fc (A40),
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and Flt1D2.VEGFR3D3.Fc.DELTA.C1(a).
Balb/c mice were injected subcutaneously with 4 mg/kg of
Flt1(1-3)-Fc (A40), CHO transiently expressed
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and CHO transiently expressed
Flt1D2,VEGFR3D3.Fc.DELTA.C1(a). The mice were tail bled at 1, 2, 5,
6, 7, 8, 12, 15 and 20 days after injection. The sera were assayed
in an ELISA designed to detect Flt1(1-3)-Fc,
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and Flt D2.VEGFR3D3.Fc.DELTA.C1(a).
Flt1(1-3)-Fc (A40) could no longer be detected in the serum after
day 5 whereas Flt1D2.Flk1D3.Fc.DELTA.C1(a) and
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a) were detectable for 15 days or
more.
[0092] FIG. 39. The Ability of Flt1D2.Flk1D3.Fc.DELTA.C1(a) to
Inhibit HT-1080 Fibrosarcoma Tumor Growth In Vivo, Every other day
or 2 times per week treatment of SCID mice with
Flt1D2.Flk1D3.Fc.DELTA.C1(a) at 25 mg/Kg significantly decreases
the growth of subcutaneous HT-1080 fibrosarcoma tumors.
[0093] FIG. 40. The Ability of Flt1D2.Flk1D3.Fc.DELTA.C1(a) to
Inhibit C6 Glioma Tumor Growth In Vivo. Every other day or 2 times
a week treatment of SCID mice with Flt1D2,Flk1D3.Fc.DELTA.C1(a)
significantly decreases the growth of subcutaneous C6 glioma tumors
at doses as low as 2.5 mg/Kg.
[0094] FIG. 41. VEGF-Induced Uterine Hyperpermeability, Pregnant
mare's serum gonadotrophin (PMSG) injected subcutaneously (5 IU) to
induce ovulation in prepubertal female rats results in a surge of
estradiol after 2 days which in turn causes an induction of VEGF in
the uterus. This induction results in hyperpermeability of the
uterus and an increase in uterine wet. Subcutaneous injection of
Flt1(1-3)-Fc (A40), Flt1D2.Flk1D3.Fc.DELTA.C1(a) and
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a) at 25 mg/kg at 1 hr after PMSG
injection results in about a 50% inhibition of the increase in
uterine wet weight.
[0095] FIGS. 42A-42B. Assessment of Corpus Luteum Angiogenesis
Using Progesterone as a Readout. PMSG was injected subcutaneously
(5 IU) to induce ovulation in prepubertal female rats, resulting in
a fully functioning corpus luteum containing a dense network of
blood vessels that secretes progesterone into the blood stream to
prepare the uterus for implantation. The induction of angiogenesis
in the corpus luteum requires VEGF. Resting levels of progesterone
are about 5 ng/ml and can be induced to 25-40 ng/ml after PMSG.
Subcutaneous injection of Flt1(1-3)-Fc (A40) or
Flt1D2.Flk1D3.Fc.DELTA.C1(a) at 25 mg/kg or 5 mg/kg at 1 hr after
PMSG injection resulted in a complete inhibition of the
progesterone induction on day 4.
DETAILED DESCRIPTION OF THE INVENTION
[0096] It has been a long standing problem in the art to produce a
receptor based VEGF antagonist that has a pharmacokinetic profile
that is appropriate for consideration of the antagonist as a
therapeutic candidate. Applicants describe herein, for the first
time, a chimeric polypeptide molecule, capable of antagonizing VEGF
activity, that exhibits improved pharmacokinetic properties as
compared to other known receptor-based VEGF antagonists. The
chimeric polypeptide molecules described herein thus provide for
the first time appropriate molecules for use in therapies in which
antagonism of VEGF is a desired result.
[0097] The present invention provides for novel chimeric
polypeptide molecules formed by fusing a modified extracellular
ligand binding domain of the Flt1 receptor to the Fc region of
IgG.
[0098] The extracellular ligand binding domain is defined as the
portion of a receptor that, in its native conformation in the cell
membrane, is oriented extracellularly where it can contact with its
cognate ligand. The extracellular ligand binding domain does not
include the hydrophobic amino acids associated with the receptor's
transmembrane domain or any amino acids associated with the
receptor's intracellular domain. Generally, the intracellular or
cytoplasmic domain of a receptor is usually composed of positively
charged or polar amino acids (i.e. lysine, arginine, histidine,
glutamic acid, aspartic acid). The preceding 15-30, predominantly
hydrophobic or apolar amino acids (i.e. leucine, valine,
isoleucine, and phenylalanine) comprise the transmembrane domain.
The extracellular domain comprises the amino acids that precede the
hydrophobic transmembrane stretch of amino acids. Usually the
transmembrane domain is flanked by positively charged or polar
amino acids such as lysine or arginine. von Heijne has published
detailed rules that are commonly referred to by skilled artisans
when determining which amino acids of a given receptor belong to
the extracellular, transmembrane, or intracellular domains (See von
Heijne, 1995, BioEssays 17:25-30). Alternatively, websites on the
Internet have become available to provide protein chemists with
information about making predictions about protein domains.
[0099] The present invention provides for the construction of
nucleic acid molecules encoding chimeric polypeptide molecules that
are inserted into a vector that is able to express the chimeric
polypeptide molecules when introduced into an appropriate host
cell. Appropriate host cells include, but are not limited to,
bacterial cells, yeast cells, insect cells, and mammalian cells.
Any of the methods known to one skilled in the art for the
insertion of DNA fragments into a vector may be used to construct
expression vectors encoding the chimeric polypeptide molecules
under control of transcriptional/translational control signals.
These methods may include in vitro recombinant DNA and synthetic
techniques and in vivo recombinations (genetic recombination) (See
Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold
Spring Harbor Laboratory; Current Protocols in Molecular Biology,
Eds. Ausubel, et al., Greene Publ. Assoc., Wiley-Interscience, NY).
Expression of nucleic acid molecules encoding the chimeric
polypeptide molecules may be regulated by a second nucleic acid
sequence so that the chimeric polypeptide molecule is expressed in
a host transformed with the recombinant DNA molecule. For example,
expression of the chimeric polypeptide molecules described herein
may be controlled by any promoter/enhancer element known in the
art. Promoters which may be used to control expression of the
chimeric polypeptide molecules include, but are not limited to, the
long terminal repeat as described in Squinto et al., (1991, Cell
65:1-20); the SV40 early promoter region (Bernoist and Chambon,
1981, Nature 290:304-310), the CMV promoter, the M-MuLV 5' terminal
repeat the promoter contained in the 3' long terminal repeat of
Rous sarcoma virus (Yamamoto, et al., 1980, Cell 22:787-797), the
herpes thymidine kinase promoter (Wagner et al., 1981, Proc. Natl.
Acad. Sci. U.S.A. 78:144-1445), the regulatory sequences of the
metallothionine gene (Brinster et al., 1982, Nature 296:39-42);
prokaryotic expression vectors such as the .beta.-lactamase
promoter (Villa-Kamaroff, et al., 1978, Proc. Natl. Acad. Sci.
U.S.A. 75:3727-3731), or the tac promoter (DeBoer, et al., 1983,
Proc. Natl. Acad. Sci. U.S.A. 80:21-25, see also "Useful proteins
from recombinant bacteria" in Scientific American, 1980,
242:74-94); promoter elements from yeast or other fungi such as the
Gal 4 promoter, the ADH (alcohol dehydrogenase) promoter, PGK
(phosphoglycerol kinase) promoter, alkaline phosphatase promoter,
and the following animal transcriptional control regions, which
exhibit tissue specificity and have been utilized in transgenic
animals: elastase I gene control region which is active in
pancreatic acinar cells (Swift et al., 1984, Cell 38:639-646;
Ornitz et al., 1986, Cold Spring Harbor Symp. Quant. Biol.
50:399-409; MacDonald, 1987, Hepatology 7:425-515); insulin gene
control region which is active in pancreatic beta cells (Hanahan,
1985, Nature 315:115-122), immunoglobulin gene control region which
is active in lymphoid cells (Grosschedl et al., 1984, Cell
38:647-658; Adames et al., 1985, Nature 318:533-538; Alexander et
al., 1987, Mol. Cell. Biol. 7:1436-1444), mouse mammary tumor virus
control region which is active in testicular, breast, lymphoid and
mast cells (Leder et al., 1986, Cell 45:485-495), albumin gene
control region which is active in liver (Pinkert et al., 1987,
Genes and Devel. 1:268-276), alpha-fetoprotein gene control region
which is active in liver (Krumlauf et al., 1985, Mol. Cell. Biol.
5:1639-1648; Hammer et al., 1987, Science 235:53-58); alpha
1-antitrypsin gene control region which is active in the liver
(Kelsey et al., 1987, Genes and Devel. 1:161-171), beta-globin gene
control region which is active in myeloid cells (Mogram et al.,
1985, Nature 315:338-340; Kollias et al., 1986, Cell 46:89-94);
myelin basic protein gene control region which is active in
oligodendrocyte cells in the brain (Readhead et al., 1987, Cell
48:703-712); myosin light chain-2 gene control region which is
active in skeletal muscle (Shani, 1985, Nature 314:283-286), and
gonadotropic releasing hormone gene control region which is active
in the hypothalamus (Mason et al., 1986, Science
234:1372-1378).
[0100] Thus, according to the invention, expression vectors capable
of being replicated in a bacterial or eukaryotic host comprising
chimeric polypeptide molecule-encoding nucleic acid as described
herein, are used to transfect the host and thereby direct
expression of such nucleic acids to produce the chimeric
polypeptide molecules, which may then be recovered in a
biologically active form. As used herein, a biologically active
form includes a form capable of binding to VEGF.
[0101] Expression vectors containing the chimeric nucleic acid
molecules described herein can be identified by three general
approaches: (a) DNA-DNA hybridization, (b) presence or absence of
"marker" gene functions, and (c) expression of inserted sequences.
In the first approach, the presence of a foreign gene inserted in
an expression vector can be detected by DNA-DNA hybridization using
probes comprising sequences that are homologous to the inserted
chimeric polypeptide molecule sequences. In the second approach,
the recombinant vector/host system can be identified and selected
based upon the presence or absence of certain "marker" gene
functions (e.g., thymidine kinase activity, resistance to
antibiotics, transformation phenotype, occlusion body formation in
baculovirus, etc.) caused by the insertion of foreign genes in the
vector. For example, if the chimeric polypeptide molecule DNA
sequence is inserted within the marker gene sequence of the vector,
recombinants containing the insert can be identified by the absence
of the marker gene function. In the third approach, recombinant
expression vectors can be identified by assaying the foreign gene
product expressed by the recombinant. Such assays can be based, for
example, on the physical or functional properties of the chimeric
polypeptide molecules.
[0102] Cells of the present invention may transiently or,
preferably, constitutively and permanently express the chimeric
polypeptide molecules.
[0103] The chimeric polypeptide molecules may be purified by any
technique which allows for the subsequent formation of a stable,
biologically active chimeric polypeptide molecule. For example, and
not by way of limitation, the factors may be recovered from cells
either as soluble proteins or as inclusion bodies, from which they
may be extracted quantitatively by 8 M guanidinium hydrochloride
and dialysis (see, for example, Builder, et al., U.S. Pat. No.
5,663,304). In order to further purify the factors, conventional
ion exchange chromatography, hydrophobic interaction
chromatography, reverse phase chromatography or gel filtration may
be used.
[0104] In one embodiment of the invention, the nucleotide sequence
encoding the first component is upstream of the nucleotide sequence
encoding the second component. In another embodiment of the
invention, the nucleotide sequence encoding the first component is
downstream of the nucleotide sequence encoding the second
component. Further embodiments of the invention may be prepared in
which the order of the first, second and third fusion polypeptide
components are rearranged. For example, if the nucleotide sequence
encoding the first component is designated 1, the nucleotide
sequence encoding the second component is designated 2, and the
nucleotide sequence of the third component is designated 3, then
the order of the components in the isolated nucleic acid of the
invention as read from 5' to 3' may be any of the following six
combinations: 1, 2, 3; 1, 3, 2; 2, 1, 3; 2, 3, 1; 3, 1, 2; or 3, 2,
1.
[0105] The present invention also has diagnostic and therapeutic
utilities. In particular embodiments of the invention, methods of
detecting aberrancies in the function or expression of the chimeric
polypeptide molecules described herein may be used in the diagnosis
of disorders. In other embodiments, manipulation of the chimeric
polypeptide molecules or agonists or antagonists which bind the
chimeric polypeptide molecules may be used in the treatment of
diseases. In further embodiments, the chimeric polypeptide molecule
is utilized as an agent to block the binding of a binding agent to
its target.
[0106] By way of example, but not limitation, the method of the
invention may be useful in treating clinical conditions that are
characterized by vascular permeability, edema or inflammation such
as brain edema associated with injury, stroke or tumor; edema
associated with inflammatory disorders such as psoriasis or
arthritis, including rheumatoid arthritis; asthma; generalized
edema associated with burns; ascites and pleural effusion
associated with tumors, inflammation or trauma; chronic airway
inflammation; capillary leak syndrome; sepsis; kidney disease
associated with increased leakage of protein; and eye disorders
such as age related macular degeneration and diabetic
retinopathy.
[0107] An amino acid sequence analysis of Flt1(1-3)-Fc revealed the
presence of an unusually high number (46) of the basic amino acid
residue lysine. An IEF analysis of Flt1(1-3)-Fc showed that this
protein has pl greater than 9.3, confirming the prediction that the
protein is very basic. It was hypothesized that the basic nature of
Flt1(1-3)-Fc protein was causing it to bind to extracellular matrix
components and that this interaction might be the cause of the
extremely short detectable circulating serum half-life exhibited by
Flt1(1-3)-Fc when injected into mice. In order to test this
hypothesis, Flt1(1-3)-Fc protein was acetylated at the lysine
residues to reduce the basic charge. Acetylated Flt1 (1-3)-Fc was
then tested in the assays described infra.
[0108] The following examples are offered by way of illustration
and not by way of limitation.
EXAMPLES
Example 1
Expression of Flt1(1-3)-Fc Protein in CHO K1 Cells
[0109] Using standard molecular biology techniques (see e.g.,
Molecular Cloning, A Laboratory Manual (Sambrook, et al., Cold
Spring Harbor Laboratory), Current Protocols in Molecular Biology
(Eds. Ausubel, et al., Greene Publ. Assoc., Wiley-Interscience,
NY), the gene encoding Flt1(1-3)-Fc was inserted into the
expression vector pEE14.1 (Lonza Biologics, plc) at a multiple
cloning site downstream of the CMV promoter. CHO K1 cells were
transfected with the pEE14.1/Flt1 (1-3)-Fc DNA construct using
lipofectamine (Gaithersburg, Md.). The transfected CHO K1 cells
were grown in glutamine-free DMEM (JRH, Kansas City, Mo.)
containing 25 .mu.M methionine sulfoximine (MSX) from Sigma inc.,
St. Louis, Mo., and high recombinant protein expressors were
obtained by screening the CHO K1 cell supernatants from over 100
hand-picked colony isolates using a standard immunoassay which
captures and detects human Fc. The selected hand-picked clone was
amplified in the presence of 100 .mu.M MSX followed by a second
round of screening of the amplified clones. The highest producing
clone had a specific productivity of recombinant Flt1(1-3)-Fc
protein of 55 pg/cell/day.
[0110] The selected clone was expanded in 225 cm.sup.2 T-flasks
(Corning, Acton, Mass.) and then into 8.5 L roller bottles
(Corning, Acton, Mass.) using the cell culture media described
supra. Cells were removed from the roller bottles by standard
trypsinization and put into 3.5 L of suspension medium. The
suspension medium is comprised of glutamine-free ISCHO medium
(Irvine Scientific, Santa Ana, Calif.) containing 5% fetal bovine
serum (FBS from HYCLONE.TM. Labs, Logan, Utah), 100 .mu.M MSX and
GS supplement (JRH Scientific, Kansas City, Mo.) in a 5 L Celligen
bioreactor (New Brunswick Scientific, New Brunswick, N.J.) at a
density of 0.3.times.10.sup.6 cells/mL. After the cells reached a
density of 3.6.times.10.sup.6/mL and were adapted to suspension
they were transferred to a 60 L bioreactor (ABEC, Allentown, Pa.)
at a density of 0.5.times.10.sup.6 cells/mL in 20 L of ISCHO medium
with 5% fetal bovine serum. After two days an additional 20 L of
ISCHO+5% fetal bovine serum was added to the bioreactor. The cells
were allowed to grow for an additional two days reaching a final
density of 3.1.times.10.sup.6 cells/mL, and a final Flt1 (1-3)-Fc
concentration at harvest was 95 mg/L. At harvest the cells were
removed by tangential flow filtration using 0.45 .mu.m Prostak
Filters (Millipore, Inc., Bedford, Mass.).
Example 2
Purification of Flt1(1-3)-Fc Protein Obtained from CHO K1 Cells
[0111] Flt1(1-3)-Fc protein was initially purified by affinity
chromatography. A Protein A column was used to bind, with high
specificity, the Fc portion of the molecule. This affinity-purified
protein was then concentrated and passed over a SEC column. The
protein was then eluted into the formulation buffer. The following
describes these procedures in detail.
[0112] Materials and Methods.
[0113] All chemicals were obtained from J. T. Baker, Phillipsburg,
N.J. with the exception of PBS, which was obtained as a 10.times.
concentrate from Life Technologies, Gaithersburg, Md. Protein A
Fast Flow and SUPERDEX.TM.200 preparation grade resins were
obtained from Pharmacia, Piscataway, N.J. Equipment and membranes
for protein concentration were obtained from Millipore, Bedford,
Mass.
[0114] Approximately 40 L of 0.45 .mu.m-filtered CHO conditioned
media containing Flt1(1-3)-Fc protein was applied to a 290 mL
Protein A Fast Flow column (10 cm diameter) that had been
equilibrated with PBS. The column was washed with PBS containing
350 mM NaCl and 0.02% CHAPS and the bound protein was eluted with
20 mM Citric Acid containing 10 mM Na.sub.2 HPO.sub.4. The single
peak in the elution was collected and its pH was raised to
neutrality with 1 M NaOH. The eluate fractions was concentrated to
approximately 9 mg/mL using 10K regenerated cellulose membranes by
both tangential flow filtration and by stirred cell concentration.
To remove aggregates and other contaminants, the concentrated
protein was applied to a column packed with SUPERDEX.TM.200
preparation grade resin (10 cm.times.55 cm) and run in PBS
containing 5% glycerol. The main peak fractions were pooled,
sterile filtered, aliquoted and stored at -80.degree. C.
Example 3
Acetylation of Flt1(1-3)-Fc Protein
[0115] Two milligrams of Flt1(1-3)-Fc protein were acetylated as
described in the instruction manual provided with the
sulfo-NHS-acetate modification kit (Pierce Chemical Co., Rockford,
Ill., Cat.#26777).
Example 4
Characterization of Acetylated Flt1(1-3)-Fc Protein
[0116] IEF Analysis:
[0117] Flt1(1-3)-Fc and acetylated Flt1(1-3)-Fc were analyzed by
standard IEF analysis. As shown in FIG. 1, Flt1(1-3)-Fc protein is
not able to migrate into the gel and therefore must have a pl
greater than 9.3, the highest pl in the standard. However,
acetylated Flt1 (1-3)-Fc is able to migrate into the gel and
equilibrate at a pl of approximately 5.2. This result demonstrates
that acetylation reduces the net positive charge of the protein and
therefore its pl considerably.
[0118] Binding to Extracellular Matrix Components.
[0119] To test for binding to extracellular matrix components,
Flt1(1-3)-Fc and acetylated Flt1(1-3)-Fc where tested in an assay
designed to mimic the interaction with extracellular matrix
components. In this assay, 96-well tissue culture plates are coated
with MATRIGEL.RTM. (Biocoat MATRIGEL.RTM. matrix thin layer 96 well
plate, Catalog #40607, Becton Dickinson Labware, Bedford, Mass.).
The plates are incubated with varying concentrations of either
Flt1(1-3)-Fc, acetylated Flt1(1-3)-Fc, or rTie2-Fc (an irrelevant
control) protein are added to the wells. The plates are incubated
for 1-2 hours at either room temperature or 37.degree. C. degrees
and then detection of bound proteins is accomplished by adding a
secondary alkaline phosphatase-conjugated anti-human Fc antibody to
the wells. Finally, alkaline phosphatase substrate is added to the
wells and optical density is measured. FIG. 2 shows the results of
this assay. Like the irrelevant control protein rTie2-Fc,
acetylated Flt1(1-3)-Fc does not exhibit any binding to the
MATRIGEL.RTM. coated plate, whereas the non-acetylated Flt1(1-3)-Fc
protein exhibits significant binding. This result indicates that
acetylation of basic amino acid residues is an effective way to
interfere with the charge interactions that exist between
positively charged proteins and the negatively charged
extracellular matrix components they are exposed to in vivo.
Example 5
Pegylation of Flt1(1-3)-Fc Protein
[0120] Although pegylation (polyethylene glycol--PEG) of proteins
has been shown to increase their in vivo potency by enhancing
stability and bioavailability while minimizing immunogenicity (see
references cited supra), it is counter-intuitive that pegylating
molecules that are too large to be filtered by the kidney glomeruli
would improve their pharmacokinetic properties. Without being bound
by theory, Applicants postulated that pegylation of the
Flt1(1-3)-Fc molecules could improve the pharmacokinetic
properties, possibly not by altering the positive charge or by
decreasing the pl of Flt1(1-3)-Fc, but rather by physically
shielding the positive charges from interacting with the
extracellular matrix. Applicants decided to attempt to improve the
pharmacokinetic properties of Flt1(1-3)-Fc molecules by attaching
strands of 20K PEGs as described infra.
[0121] Materials and Methods.
[0122] Purified Flt1(1-3)-Fc derived from CHO cells (see supra) was
used in the following pegylation experiments. Functionalized PEGs
were obtained from Shearwater Polymers, Huntsville, Ala.; Bicine
from Sigma, St Louis, Mo.; SUPEROSE.TM.6 column from Pharmacia,
Piscataway, N.J.; PBS as a 10.times. concentrate from Life
Technologies, Gaithersburg, Md.; Glycerol from J. T. Baker,
Phillipsburg, N.J.; and Bis-Tris precast gels from Novex,
Calif.
[0123] 20K PEG strands functionalized with amine-specific terminal
moieties were used in small-scale reaction studies that were set-up
to evaluate different reaction conditions in which the PEG:protein
stoichiometry was varied. Based on these reactions and the analyses
of samples on standard SDS-PAGE, Flt1(1-3)-Fc at a concentration of
1.5 mg/mL was reacted at pH 8.1 with 20K SPA-PEG (PEG succinimidyl
propionate) molecules at a PEG-to-Flt1(1-3)-Fc monomer molar ratio
of 1:6. The reaction was allowed to proceed at 8.degree. C.
overnight. For initial purification, the reaction products were
applied to a 10 mm.times.30 cm SUPEROSE.TM.6 column equilibrated
with PBS containing 5% Glycerol. The column appeared to separate
pegylated Flt1(1-3)-Fc molecules based on the extent of pegylation.
Fractions corresponding to what appeared to be primarily
mono-pegylated and di-pegylated dimeric Flt1(1-3)-Fc, as judged by
banding patterns on reducing and non-reducing SDS-PAGE gels were
pooled. The protein concentration was determined by measuring
absorbance at 280 nm. The pegylated Flt1(1-3)-Fc protein was
sterile filtered, aliquoted and stored at -40.degree. C.
Example 6
Binding of Unmodified, Acetylated, and Pegylated Flt1(1-3)-Fc in a
BIACORE.TM.-Based Assay
[0124] Unmodified, acetylated, and pegylated Flt1(1-3)-Fc proteins
were tested in a BIACORE.TM.-based assay to evaluate their ability
to bind to the Flt1 ligand, VEGF. In this assay, unmodified
Flt1(1-3)-Fc protein was immobilized on the surface of a
BIACORE.TM. chip (see BIACORE.TM. Instruction Manual, Pharmacia,
Inc., Piscataway, N.J., for standard procedures) and a sample
containing 0.2 .mu.g/ml VEGF and either unmodified Flt1(1-3)-Fc,
acetylated Flt1(1-3)-Fc or pegylated Flt1(1-3)-Fc (each at 25
.mu.g/ml) was passed over the Flt1(1-3)-Fc-coated chip. To minimize
the effects of non-specific binding, the bound samples were washed
with a 0.5 M NaCl wash. In one sample, unmodified Flt1(1-3)-Fc was
mixed with heparin. Heparin is a negatively charged molecule and
the Flt1(1-3)-Fc protein is a positively charged molecule, so when
the two molecules are mixed together, they should interact through
their respective charges. This essentially neutralizes
Flt1(1-3)-Fc's inherent positive charge making the molecule behave
as if it has been chemically or genetically modified so as to
reduce its charge and its tendency to bind via charge interactions.
As shown in FIG. 3, acetylated (columns 13-16), pegylated (columns
17-20), and heparin-treated Flt1(1-3)-Fc (columns 21-24) are each
able to completely compete with the BIACORE.TM. chip-bound
Flt1(1-3)-Fc for VEGF binding as compared to control (columns 1-4)
and irrelevant protein (columns 5-8). Unmodified Flt1(1-3)-Fc
(columns 5-6) appeared to only partially compete with BIACORE.TM.
chip-bound Flt1(1-3)-Fc for VEGF binding. However, washing the
bound samples with 0.5 M NaCl (columns 7-8) resulted in a binding
profile similar to the modified forms of Flt1(1-3)-Fc, indicating
that the unmodified protein was exhibiting non-specific binding to
the chip that could be eliminated by the salt wash.
Example 7
Binding of Unmodified, Acetylated, and Pegylated Flt1(1-3)-Fc in an
ELISA-Based Assay
[0125] Unmodified, acetylated, and pegylated Flt1(1-3)-Fc proteins
were tested in a standard ELISA-based assay to evaluate their
ability to bind the Flt1 receptor ligand VEGF. As shown in FIG. 4,
both pegylated and acetylated Flt1(1-3)-Fc proteins are capable of
binding to VEGF, demonstrating that modifying the protein either by
pegylation or acetylation does not destroy its ability to bind its
ligand.
Example 8
Pharmacokinetic Analysis of Unmodified Flt1(1-3)-Fc, Acetylated
Flt1(1-3)-Fc, and Pegylated Flt1(1-3)-Fc
[0126] In vivo experiments were designed to assess the
pharmacokinetic profiles of unmodified Flt1(1-3)-Fc, acetylated
Flt1(1-3)-Fc, and pegylated Flt1(1-3)-Fc protein. Balb/c mice
(23-28 g; 3 mice/group) were injected subcutaneously with 4 mg/kg
of unmodified, acetylated, or pegylated Flt1(1-3)-Fc. The mice were
tail bled at 1, 2, 4, 6, 24 hours, 2 days, and 3 days after
injection of protein. The sera were assayed in a standard
ELISA-based assay designed to detect Flt1(1-3)-Fc protein. Briefly,
the assay involves coating an ELISA plate with VEGF, binding the
unmodified, acetylated, or pegylated Flt1(1-3)-Fc-containing sera,
and reporting with an anti-Fc antibody linked to alkaline
phosphatase. As shown in FIG. 5, the T.sub.max for all of the
Flt1(1-3)-Fc proteins was between the 6 hour and 24 hour time
points. The C.sub.max for the different proteins was as follows:
Unmodified: 0.06 .mu./ml-0.15 .mu.g/ml; acetylated: 1.5 .mu.g/ml
-4.0 .mu.g/ml; and pegylated: approximately 5 .mu.g/ml.
Example 9
Step-Acetylation of Flt1(1-3)-Fc
[0127] To determine what minimal amount of acetylation is necessary
to eliminate binding to extracellular matrix components, an
experiment was designed that acetylated the Flt1 (1-3)-Fc protein
in a step-wise fashion by using increasing amounts of molar excess
of acetylation reagent in the acetylation reaction mixture. The
range of molar excess was as follows: 0, 10, 20, 30, 40, 50, 60,
70, 80, 90, and 100 moles of acetylation reagent per 1 mole of
Flt1(1-3)-Fc monomer. The reactions were performed as detailed in
the instruction manual provided with the sulfo-NHS-Acetate
modification kit (Pierce Chemical Co., Rockford, Ill.,
Cat.#26777).
Example 10
Characterization of Step-Acetylated Flt1(1-3)-Fc
[0128] IEF Analysis
[0129] Unmodified Flt1(1-3)-Fc and step-acetylated Flt1(1-3)-Fc
proteins were analyzed by standard IEF analysis. As shown in FIG.
6A-6B, unmodified Flt1(1-3)-Fc protein was not able to migrate into
the gel due to its extremely high pl (greater than 9.3). However,
most of the step-acetylated Flt1(1-3)-Fc samples (30-100 fold molar
excess samples) were able to migrate into the gel and equilibrate
at pls ranging between 4.55-8.43, depending on the degree of
acetylation of the protein. This result demonstrates that
acetylation can change the positive charge of the protein in a
dose-dependent manner and that reduction of the pl can be
controlled by controlling the degree of acetylation.
[0130] Binding of Step-Acetylated Flt1(1-3)-Fc to Extracellular
Matrix Components.
[0131] To test for binding to extracellular matrix components,
Flt1(1-3)-Fc and step-acetylated Flt1(1-3)-Fc where tested in the
above-described assay designed to mimic the interaction with
extracellular matrix components. Varying concentrations of either
unmodified Flt1(1-3)-Fc, step-acetylated Flt1(1-3)-Fc (10, 20, and
30 fold molar excess samples), or rTie2-Fc (an irrelevant control)
protein were added to the wells. The plates were incubated for 1-2
hours at room temperature or 37.degree. C. and then detection of
bound proteins was accomplished by adding a secondary alkaline
phosphatase-conjugated anti-human Fc antibody to the wells.
Alkaline phosphatase substrate was subsequently added to the wells
and optical density measured. FIG. 7 shows the results of this
assay. Like the irrelevant control protein rTie2-Fc,
step-acetylated Flt1(1-3)-Fc (20 and 30 fold molar excess samples)
did not exhibit any significant binding to the MATRIGEL.RTM. coated
plate, whereas the non-acetylated Flt1(1-3)-Fc protein exhibited
significant binding. The binding is saturable, indicating that the
Flt1(1-3)-Fc protein may be binding to specific sites, rather than
a more general charge-mediated interaction that might not be
saturable. The 10 fold molar excess sample showed reduced binding,
but the degree of acetylation was not enough to completely block
binding to extracellular matrix components. The 20 fold molar
excess and higher samples displayed no detectable binding, despite
the fact that by IEF analysis (FIGS. 6A and 6B) the lower molar
excess samples still had a large net positive charge. This result
demonstrates that it is not necessary to completely acetylate all
available basic amino acids in order to eliminate binding to
extracellular matrix components.
[0132] Binding of Step-Acetylated Flt1 (1-3)-Fc in a
BIACORE.TM.-Based Assay.
[0133] Unmodified and step-acetylated Flt1(1-3)-Fc proteins where
tested in a BIACORE.TM.-based assay to evaluate their ability to
bind to the Flt1 ligand, VEGF. In this assay, unmodified
Flt1(1-3)-Fc protein (0.5, 1.0, or 5.0 .mu.g/ml) was immobilized on
the surface of a BIACORE.TM. chip (see BIACORE.TM. Instruction
Manual, Pharmacia, Inc., Piscataway, N.J., for standard procedures)
and a solution containing 0.2 .mu.g/ml VEGF and either unmodified
Flt1(1-3)-Fc (at either 0.5, 1.0, or 5.0 .mu.g/ml) or 10 different
step-acetylated Flt1(1-3)-Fc samples (at 0.5, 1.0, or 5.0 .mu.g/ml
each) were passed over the Flt1(1-3)-Fc-coated chip. As shown in
FIG. 8, at a sub-stoichiometric ratio (0.5 .mu.g/ml of either
unmodified Flt1(1-3) or step-acetylated Flt1(1-3)-Fc vs. 0.2
.mu.g/ml VEGF), there is not enough Flt1(1-3)-Fc (either unmodified
or step-acetylated) in the solution to completely bind the VEGF. At
1.0 .mu.g/ml, which approximates a 1:1 stoichiometric ratio, both
unmodified and step-acetylated Flt1(1-3)-Fc are better able to
compete for VEGF binding, but there is still insufficient
Flt1(1-3)-Fc protein (either unmodified or step-acetylated) to
completely bind the available VEGF. However, at 5.0 .mu.g/ml, which
is several times greater than a 1:1 stoichiometric ratio, both the
Flt1 (1-3)-Fc and the step-acetylated Flt1(1-3)-Fc proteins are
able to bind the VEGF, regardless of the degree of acetylation.
This clearly demonstrates that acetylation does not alter
Flt1(1-3)-Fc's ability to bind VEGF.
[0134] Pharmacokinetic Analysis of Step-Acetylated
Flt1(1-3)-Fc.
[0135] In vivo experiments were designed to assess the
pharmacokinetic profiles of unmodified Flt1(1-3)-Fc and
step-acetylated Flt1(1-3)-Fc protein. Balb/c mice (23-28 g) were
injected subcutaneously with 4 mg/kg of unmodified or 10, 20, 40,
60 and 100 fold molar excess samples of step-acetylated
Flt1(1-3)-Fc (3 mice for unmodified, 10, 20 and 40 fold molar
excess samples and 2 mice for 60 and 100 fold molar excess
samples). The mice were tail bled at 1, 2, 4, 6, 24 hours, 2 days
and 3 days after injection. The sera were assayed in an ELISA-based
assay designed to detect Flt1(1-3)-Fc (described supra). FIG. 9
details the results of this study. The T.sub.max for all of the
Flt1(1-3)-Fc proteins tested was at the 6 hour time point but the
C.sub.max was as follows: Unmodified Flt1(1-3)-Fc: 0.06 .mu.g/ml;
10 fold molar excess sample: -0.7 .mu.g/ml, 20 fold molar excess
sample -2 .mu.g/ml, 40 fold molar excess sample -4 .mu.g/ml, 60
fold molar excess sample -2 .mu.g/ml, 100 fold molar excess sample
-1 .mu.g/ml. This results demonstrates that acetylation or
pegylation of Flt1(1-3)-Fc significantly improves its
pharmacokinetic profile.
Example 11
Construction of Flt1(1-3)-Fc Basic Region Deletion Mutant
Designated Mut1: Flt1(1-3.sub..DELTA.B)-Fc
[0136] Based on the observation that acetylated Flt1(1-3)-Fc, which
has a pl below 6, has much better pharmacokinetics than the highly
positive unmodified Flt1(1-3)-Fc (pl >9.3), it was asked whether
the difference in pharmacokinetics could be attributed to the net
charge of the protein, which made it stick to negatively charged
extracellular matrix components, or whether there were perhaps
specific locations on the surface of the Flt1(1-3)-Fc protein that
constituted specific binding sites for extracellular matrix
components. For example, many proteins are known to have heparin
binding sites, often consisting of a cluster of basic residues.
Sometimes these residues are found in a cluster on the primary
sequence of the protein; some of the literature has identified
"consensus sequences" for such heparin binding sites (see for
example Hileman, et al., 1998, Bioessays 20(2):156-67). In other
cases, the known crystal structure of a protein reveals a cluster
of positively charged residues on the surface of a protein, but the
residues come from different regions of the primary sequence and
are only brought together when the protein folds into its tertiary
structure. Thus it is difficult to deduce whether an isolated amino
acid residue forms part of a cluster of basic residues on the
surface of the protein. However, if there is a cluster of
positively charged amino acid residues in the primary sequence, it
is not unreasonable to surmise that the residues are spatially
close to one another and might therefore be part of an
extracellular matrix component binding site. Flt1 receptor has been
studied extensively and various domains have been described (see
for example Tanaka et al., 1997, Jpn. J. Cancer Res. 88:867-876).
Referring to the nucleic acid and amino acid sequence set forth in
FIG. 10A-10D of this application, one can identify the signal
sequence for secretion which is located at the beginning of the
sequence and extends to the glycine coded for by nucleotides 76-78.
The mature protein begins with Ser-Lys-Leu-Lys, starting at
nucleotide 79 of the nucleic acid sequence. Flt1 Ig domain 1
extends from nucleotide 79 to 393, ending with the amino acids
Ser-Asp-Thr. Flt1 Ig domain 2 extends from nucleotide 394 to 687
(encoding Gly-Arg-Pro to Asn-Thr-Ile), and Flt1 Ig domain 3 extends
from nucleotides 688 to 996 (encoding Ile-Asp-Val to Asp-Lys-Ala).
There is a bridging amino acid sequence, Gly-Pro-Gly, encoded by
nucleotides 997-1005, followed by the nucleotide sequence encoding
human Fc (nucleotides 1006-1701 or amino acids Glu-Pro-Lys to
Pro-Gly-Lys-stop).
[0137] A more detailed analysis of the Flt1 amino acid sequence
reveals that there is a cluster, namely, amino acid residues
272-281 (KNKRASVRR) of FIG. 10A-10D, in which 6 out of 10 amino
acid residues are basic. This sequence is located in Flt1 Ig domain
3 of the receptor (see FIG. 11), which is not itself essential for
binding of VEGF ligand, but which confers a higher affinity binding
to ligand. An alignment of the sequence of Ig domain 3 with that of
Ig domain 2 reveals that in this region, there is very poor
alignment between the two Ig domains, and that there are about 10
additional amino acids in Ig domain 3. An analysis of the
hydrophilicity profiles (MACVECTOR.TM. computer software) of these
two domains clearly indicates the presence of a hydrophilic region
in the protein (FIG. 12A-12B). These observations raised the
possibility that the actual three dimensional conformation of Flt1
Ig domain 3 allowed for some type of protrusion that is not in Flt1
Ig domain 2. To test this hypothesis, the 10 additional amino acids
were deleted and the resulting protein was tested to see whether
the deletion would affect the pharmacokinetics favorably without
seriously compromising the affinity of the receptor for VEGF. This
DNA construct, which was constructed using standard molecular
biology techniques (see e.g., Molecular Cloning, A Laboratory
Manual (Sambrook, et al., Cold Spring Harbor Laboratory), Current
Protocols in Molecular Biology (Eds. Ausubel, et al., Greene Publ.
Assoc., Wiley-Interscience, NY) in the mammalian expression vector
pMT21 (Genetics Institute, Inc., Cambridge, Mass.), is referred to
as Mut1:Flt1(1-3.sub..DELTA.B)-Fc. The
Mut1:Flt1(1-3.sub..DELTA.B)-Fc construct was derived from
Flt1(1-3)-Fc by deletion of nucleotides 814-843 (set forth in FIG.
10A-10D), which deletes the highly basic 10-amino acid residue
sequence Lys-Asn-Lys-Arg-Ala-Ser-Val-Arg-Arg-Arg from Flt1 Ig
domain 3.
[0138] The final DNA construct was sequence-verified using an ABI
373A DNA sequencer and Taq Dideoxy Terminator Cycle Sequencing Kit
(Applied Biosystems, Inc., Foster City, Calif.). The sequence of
Mut1:Flt1(1-3.sub..DELTA.B)-Fc is set forth in FIG. 13A-13D.
Example 12
Construction of Flt1(1-3)-Fc Basic Region Deletion Mutant
Designated Mut2:Flt1(2-3.sub..DELTA.B)-Fc
[0139] A second deletion mutant construct, designated
Mut2:Flt1(2-3)-Fc, was derived from the
Mut1:Flt1(1-3.sub..DELTA.B)-Fc construct by deletion of Flt1 Ig
domain I encoded by nucleotides 79-393 (see FIG. 10A-10D); for
convenience, nucleotides 73-78 (TCA GGT) were changed to TCC GGA.
This introduced a restriction site (BspE1) without altering the
associated amino acid sequence, Ser-Gly. This DNA construct, which
was constructed using standard molecular biology techniques (see
e.g., Molecular Cloning, A Laboratory Manual (Sambrook, et al.,
Cold Spring Harbor Laboratory), Current Protocols in Molecular
Biology (Eds. Ausubel, et al., Greene Publ. Assoc.,
Wiley-interscience, NY)) in the mammalian expression vector pMT21
(Genetics institute, Inc., Cambridge, Mass.), was also
sequence-verified using an ABI 373A DNA sequencer and Taq Dideoxy
Terminator Cycle Sequencing Kit (Applied Biosystems, Inc., Foster
City, Calif.). The sequence of Mut2:Flt1(2-3.sub..DELTA.B)-Fc is
set forth in FIG. 14A-14C.
Example 13
Construction of Flt1(1-3)-Fc Deletion Mutant Designated
Mut3:Flt1(2-3)-Fc
[0140] A third deletion mutate construct, designated
Mut3:Flt1(2-3)-Fc, was constructed the same way as the
Mut2:Flt1(2-3.sub..DELTA.B)-FC construct, except that Flt1 Ig
domain 3 was left intact (the basic region amino acids were not
deleted). The construct was constructed using standard molecular
biology techniques and the final construct was sequence-verified as
described supra. The sequence of Mut3:Flt1(2-3)-Fc is set forth in
FIG. 15A-15C.
Example 14
Construction of Flt(1-3)-Fc Basic Region N-Glycosylation Mutant
Designated Mut4:Flt1(1-3.sub.R->N)-Fc
[0141] A final construct was made in which a N-glycosylation site
was introduced into the middle of the basic region of Flt1 Ig
domain 3. This construct was designated
Mut4:Flt1(1-3.sub.R->N)-Fc and was made by changing nucleotides
824-825 from GA to AC, consequently changing the coded Arg residue
(AGA) into an Asn residue (AAC) (see FIG. 10A-10D). The resulting
amino acid sequence is therefore changed from Arg-Ala-Ser to
Asn-Ala-Ser, which matches the canonical signal (Asn-Xxx-Ser/Thr)
for the addition of a N-glycosylation site at the Asn residue. The
sequence of Mut4: Flt1(1-3.sub.R->N)-Fc is set forth in FIG.
16A-16D.
Example 15
Characterization of Acetylated Flt1(1-3)-Fc,
Mut1:Flt1(1-3.sub..DELTA.B)-Fc, and Mut4:Flt1(1-3S.sub.R->N)-Fc
Mutants
[0142] Binding to Extracellular Matrix Components.
[0143] To determine whether the three modified proteins were more
or less likely to have improved pharmacokinetic properties,
MATRIGEL.RTM. coated 96-well dishes (as described supra) were
incubated with varying concentrations of the mutant proteins and
detected with anti-human Fc/alkaline-phosphatase conjugated
antibodies. As shown in FIG. 18, this experiment showed that while
the unmodified Flt1(1-3)-Fc protein could bind avidly to these
wells, the Mut3:Flt1(2-3)-Fc protein bound somewhat more weakly,
the Mut1:Flt1(1-3.sub..DELTA.B)-Fc protein bound more weakly still,
and the Mut2:Flt1(2-3.sub..DELTA.B)-Fc protein showed the best
profile, binding more weakly than any of the other mutant proteins.
The Mut4:Flt1(1-3,r>,j-Fc glycosylation mutant protein showed
only marginal benefit on the MATRIGEL.RTM. assay. These results
confirm the hypothesis that a linear sequence of positive amino
acids can be deleted from the primary sequence resulting in a
decrease in charge interaction with extracellular matrix
components.
[0144] Binding of Mut1:Flt1(1-3.sub..DELTA.B)-Fc and
Mut4:Flt1(1-3.sub.R->N)-Fc in a BIACORE.TM.-Based Assay.
[0145] Unmodified and acetylated Flt1(1-3)-Fc and genetically
modified Mut1:Flt1(1-3.sub..DELTA.B)-Fc and
Mut4:Flt1(1-3.sub.R->N)-Fc proteins where tested in a
BIACORE.TM.-based assay to evaluate their ability to bind to the
Flt1 ligand, VEGF. In this assay, unmodified Flt1(1-3)-Fc protein
(0.25, 0.5, or 1.0 .mu.g/ml) was immobilized on the surface of a
BIACORE.TM. chip (see BIACORE.TM. Instruction Manual, Pharmacia,
Inc., Piscataway, N.J., for standard procedures) and a solution
containing 0.1 .mu.g/ml VEGF and either purified or COS cell
supernatant containing unmodified Flt1(1-3)-Fc (at approximately
(0.25, 0.5, or 1.0 .mu.g/ml), purified acetylated Flt1(1-3)-Fc (at
(0.25, 0.5, or 1.0 .mu.g/ml), COS cell supernatant containing
Mut1:Flt1(1-3.sub..DELTA.B)-Fc (at approximately (0.25, 0.5, or 1.0
.mu.g/ml), or COS cell supernatant containing
Mut4:Flt1(1-3.sub.R->N)-Fc (at approximately (0.25, 0.5, or 1.0
.mu.g/ml) were passed over the Flt1(1-3)-Fc-coated chip. As shown
in FIG. 17, at the sub-stoichiometric ratio (0.25 .mu.g/ml Flt1
(1-3)-Fc of unmodified, acetylated or genetically modified samples
vs. 0.1 .mu.g/ml VEGF), there is insufficient Flt1(1-3)-Fc protein
to block binding of VEGF to the Flt1(1-3)-Fc immobilized on the
BIACORE.TM. chip. At 0.5 .mu.g/ml of unmodified, acetylated or
genetically modified Flt1(1-3)-Fc proteins, the stoichiometric
ratio approximates 1:1 and there is an increased ability to block
VEGF binding to the BIACORE.TM. chip. At 1.0 .mu.g/ml of
unmodified, acetylated or genetically modified Flt1(1-3)-Fc
proteins, which is approximately a 10:1 stoichiometric ratio, the
Flt1(1-3)-Fc proteins are able to block binding of VEGF to the
BIACORE.TM. chip, but they are not equivalent. Unmodified,
acetylated, and Mut1:Flt1(1-3.sub..DELTA.B)-Fc are essentially
equal in their ability to block VEGF binding, whereas
Mut4:Flt1(1-3.sub.R->N)-Fc is somewhat less efficient at
blocking binding. These results confirm the hypothesis that it is
possible to reduce the non-specific binding of a positively charged
molecule by genetically removing a linear sequence of predominantly
negatively charged amino acids.
[0146] Binding of Mut1:Flt1(1-3.sub..DELTA.B)-Fc,
Mut2:Flt1(2-3.sub..DELTA.B)-Fc, Mut3:Flt1(2-3)-Fc and in an
ELISA-Based Assay.
[0147] To determine whether the three mutant proteins could bind
the Flt1 ligand VEGF, binding experiments were done in which
96-well plates coated with VEGF were incubated with varying
concentrations of the respective mutant protein, and after washing,
the amount bound was detected by incubating with an alkaline
phosphatase conjugated anti-human Fc antibody and quantitated
colorimetrically by the addition of an appropriate alkaline
phosphatase substrate. As shown in FIG. 19, this experiment showed
that all the mutant proteins could bind VEGF similarly, at the
concentrations tested.
Example 16
Pharmacokinetic Analysis of Acetylated Flt1(1-3)-Fc,
Mut1:Flt1(1-3.sub..DELTA.B)-Fc, and Unmodified Flt1(1-3)-Fc
[0148] In vivo experiments were designed to assess the
pharmacokinetic profiles of unmodified Flt1(1-3)-Fc,
Mut1:Flt1(1-3.sub..DELTA.B)-Fc, and 40 fold molar excess acetylated
Flt1(1-3)-Fc protein. Balb/c mice (25-30 g) were injected
subcutaneously with 4 mg/kg of unmodified Flt1(1-3)-Fc, 40 fold
molar excess acetylated Flt1(1-3)-Fc, and
Mut1:Flt1(1-3.sub..DELTA.B)-Fc proteins (4 mice each). These mice
were tail bled at 1, 2, 4, 6, 24 hours, 2 days, 3 days, and 5 days
after injection. The sera were assayed in an ELISA designed to
detect Flt1(1-3)-Fc protein which involves coating an ELISA plate
with VEGF, binding the Flt1 (1-3)-Fc and reporting with an anti-Fc
antibody linked to alkaline phosphatase. As shown in FIG. 20, the
C.sub.max for these reagents was as follows: Unmodified
Flt1(1-3)-Fc -0.15 .mu.g/ml; fold molar excess acetylated
Flt1(1-3)-Fc -1.5 .mu.g/ml; and Mut1:Flt1(1-3.sub..DELTA.B)-Fc -0.7
.mu.g/ml.
Example 17
Modified Flt1 Receptor Vector Construction
[0149] The rationale for constructing modified versions of the Flt1
receptor (also known as VEGFR1) was based on the observation that
the protein sequence of Flt1 was highly basic, and was therefore
likely to stick to extracellular matrix (ECM). The highly basic
nature of Flt1 probably explains why unmodified Flt1(1-3)-Fc
(described supra) has poor pharmacokinetics that make it difficult
to use as a therapeutic agent. As described supra, the chemically
modified form of 40 fold molar excess acetylated Flt1(1-3)-Fc,
hereinafter termed A40, exhibited a greatly improved
pharmacokinetic (PK) profile over the non-acetylated Flt1(1-3)-Fc.
Therefore, attempts were made to engineer DNA molecules that could
be used to recombinantly express modified forms of a Flt1 receptor
molecule that would possess the improved PK profile exhibited by
A40 and still maintain the ability to bind tightly to VEGF.
[0150] It is known in the literature that the first Ig domain of
Flt1 (which has a net charge of +5 at neutral pH) is not essential
for tight binding to VEGF, so this domain was deleted. The third Ig
domain (having a net charge of +11) is not essential for binding,
but confers higher affinity for VEGF than the second Ig domain, so
instead of deleting it entirely, it was replaced with the
equivalent domains of the Flt1 receptor relatives Flk1 (also known
as VEGFR2) and Flt4 (also known as VEGFR3). These chimeric
molecules (denoted R1R2 (Flt1.D2.Flk1D3.Fc.DELTA.C1(a) and
VEGFR1R2-Fc.DELTA.C1(a)) and R1R3 (Flt D2.VEGFR3D3-Fc.DELTA.C1(a)
and VEGFR1R3-Fc.DELTA.C1(a)) respectively, wherein R1 and Flt1D2=Ig
domain 2 of Flt1 (VEGFR1); R2 and Flk1D3=Ig domain 3 of Flk1
(VEGFR2); and R3 and VEGFR3D3=Ig domain 3 of Flt4 (VEGFR3)) were
much less sticky to ECM, as judged by an in vitro ECM binding assay
as described infra, had greatly improved PK as described infra. In
addition, these molecules were able to bind VEGF tightly as
described infra and block phosphorylation of the native Flk1
receptor expressed in endothelial cells as described infra.
[0151] Construction of the Expression Plasmid
pFlt1D2.Flk1D3.Fc.DELTA.C1(a).
[0152] Expression plasmids pMT21.Flt1(1-3).Fc (6519 bp) and
pMT21.Flk-1(1-3).Fc (5230 bp) are plasmids that encode ampicillin
resistance and Fc-tagged versions of Ig domains 1-3 of human Flt1
and human Flk1, respectively. These plasmids were used to construct
a DNA fragment consisting of a fusion of Ig domain 2 of Flt1 with
Ig domain 3 of Flk1, using PCR amplification of the respective Ig
domains followed by further rounds of PCR to achieve fusion of the
two domains into a single fragment. For Ig domain 2 of Flt1, the 5'
and 3' amplification primers were as follows:
TABLE-US-00001 5': bsp/flt1D2 (SEQ ID NO: 18)
(5'-GACTAGCAGTCCGGAGGTAGACCTTTCGTAGAGATG-3') 3': Flt1D2-Flk1D3.as
(SEQ ID NO: 19) (5'-CGGACTCAGAACCACATCTATGATTGTATTGGT-3')
[0153] The 5' amplification primer encodes a BspE1 restriction
enzyme site upstream of Ig domain 2 of Flt1, defined by the amino
acid sequence GRPFVEM (SEQ ID NO:20) (corresponding to amino acids
27-33 of FIG. 21A-21C). The 3' primer encodes the reverse
complement of the 3' end of Flt1 Ig domain 2 fused directly to the
5' beginning of Flk1 Ig domain 3, with the fusion point defined as
TIID (SEQ ID NO:37) of Flt1 (corresponding to amino acids 123-126
of FIG. 21A-21C) and continuing into VVLS (SEQ ID NO:38)
(corresponding to amino acids 127-130 of FIG. 21A-21C) of Flk1.
[0154] For Ig domain 3 of Flk1, the 5' and 3' amplification primers
were as follows:
TABLE-US-00002 5': Flt1D2-Flk1D3.s (SEQ ID NO: 21)
(5'-ACAATCATAGATGTGGTTCTGAGTCCGTCTCATGG-3') 3': Flk1D3/apa/srf.as
(SEQ ID NO: 22) (5'-GATAATGCCCGGGCCCTTTTCATGGACCCTGACAA ATG-3')
[0155] The 5' amplification primer encodes the end of Flt1 Ig
domain 2 fused directly to the beginning of Flk1 Ig domain 3, as
described above. The 3' amplification primer encodes the end of
Flk1 Ig domain 3, defined by the amino acids VRVHEK (SEQ ID NO:23)
(corresponding to amino acids 223-228 of FIG. 21A-21C), followed by
a bridging sequence that includes a recognition sequence for the
restriction enzyme Srf1, and encodes the amino acids GPG. The
bridging sequence corresponds to amino acids 229-231 of FIG.
21A-21C.
[0156] After a round of PCR amplification to produce the individual
domains, the products were combined in a tube and subjected to a
further round of PCR with the primers bsp/flt1D2 and
Flk1D3/apa/srf.as (described supra) to produce the fusion product.
This PCR product was subsequently digested with the restriction
enzymes BspEI and SmaI and the resulting 614 bp fragment was
subcloned into the BspEI to SrfI restriction sites of the vector
pMT21/.DELTA.B2.Fc, to create the plasmid pMT21/Flt1D2.Flk1D3.Fc.
The nucleotide sequence of the Flt1D2-Flk1D3 gene fusion insert was
verified by standard sequence analysis. This plasmid was then
digested with the restriction enzymes EcoRI and SrfI and the
resulting 702 bp fragment was transferred into the EcoRI to SrfI
restriction sites of the plasmid pFlt1(1-3)B2-Fc.DELTA.C1(a) to
produce the plasmid pFlt1D2.Flk1D3.Fc.DELTA.C1(a). The complete DNA
and deduced amino acid sequences of the
Flt1D2.Flk1D3.Fc.DELTA.C1(a) chimeric molecule is set forth in FIG.
21A-21C.
[0157] Construction of the Expression Plasmid
pFlt1D2VEGFR3D3Fc.DELTA.C1(a).
[0158] The expression plasmid pMT21.Flt1(1-3).Fc (6519 bp) encodes
ampicillin resistance and an Fc-tagged version of Ig domains 1-3 of
human Flt1 receptor. This plasmid was used to produce a DNA
fragment containing Ig domain 2 of Flt1 by PCR. RNA from the cell
line HEL921.7 was used to produce Ig domain 3 of Flk1, using
standard RT-PCR methodology. A further round of PCR amplification
was used to achieve fusion of the two Ig domains into a single
fused fragment. For Ig domain 2 of Flt1, the 5' and 3'
amplification primers were as follows:
TABLE-US-00003 5': bsp/flt1D2 (SEQ ID NO: 24)
(5'-GACTAGCAGTCCGGAGGTAGACCTTTCGTAGAGATG-3') 3': Flt1D2.VEGFR3D3.as
(SEQ ID NO: 25) (TTCCTGGGCAACAGCTGGATATCTATGATTGTA TTGGT)
[0159] The 5' amplification primer encodes a BspE1 restriction site
upstream of Ig domain 2 of Flt1, defined by the amino acid sequence
GRPFVEM (SEQ ID NO:20) (corresponding to amino acids 27-33 of FIG.
22A-22C). The 3' amplification primer encodes the reverse
complement of the end of Flt1 Ig domain 2 fused directly to the
beginning of VEGFR3 Ig domain 3, with the fusion point defined as
TIID (SEQ ID NO:37) of Flt1 (corresponding to amino acids 123-126
of FIG. 22A-22C) and continuing into IQLL (SEQ ID NO:26) of VEGFR3
(corresponding to amino acids 127-130 of FIG. 22A-22C).
[0160] For Ig domain 3 of VEGFR3, the 5' and 3' primers used for
RT-PCR were as follows:
TABLE-US-00004 5': R3D3.s (SEQ ID NO: 27)
(ATCCAGCTGTTGCCCAGGAAGTCGCTGGAGCTGCTGGTA 3': R3D3.as (SEQ ID NO:
28) (ATTTTCATGCACAATGACCTCGGTGCTCTCCCGAAATCG)
[0161] Both the 5' and 3' amplification primers match the sequence
of VEGFR3. The 296 bp amplification product of this RT-PCR reaction
was isolated by standard techniques and subjected to a second round
of PCR to add suitable sequences to allow for fusion of the Flt1D2
with the Flk1D3 domains and fusion of the Flk1D3 and Fc domains via
a GPG bridge (see below). The amplification primers were as
follows:
TABLE-US-00005 5': Flt1D2.VEGFR3D3.s (SEQ ID NO: 29)
(TCATAGATATCCAGCTGTTGCCCAGGAAGTCGCTGGAG) 3': VEGFR3D3/srf.as (SEQ
ID NO: 30) (GATAATGCCCGGGCCATTTTCATGCACAATGACCTCGGT)
[0162] The 5' amplification primer encodes the 3' end of Flt1 Ig
domain 2 fused directly to the beginning (5' end) of VEGFR3 Ig
domain 3, as described above. The 3' amplification primer encodes
the 3' end of VEGFR3 Ig domain 3, defined by the amino acids VIVHEN
(SEQ ID NO:31) (corresponding to amino acids 221-226 of FIG.
22A-22C), followed by a bridging sequence that includes a
recognition sequence for Srf1, and encodes the amino acids GPG. The
bridging sequence corresponds to amino acids 227-229 of FIG.
22A-22C.
[0163] After one round (for Flt1 Ig domain 2) or two rounds (for
Flt4 Ig domain 3) of PCR to produce the individual Ig domains, the
PCR products were combined in a tube and subjected to a further
round of PCR amplification with the amplification primers
bsp/flt1D2 and VEGFR3D3/srf.as described supra, to produce the
fusion product. This PCR product was subsequently digested with the
restriction enzymes BspEI and SmaI and the resulting 625 bp
fragment was subcloned into the BspEI to SrfI restriction sites of
the vector pMT21/Flt1.DELTA.B2.Fc (described supra), to create the
plasmid pMT21/Flt1D2.VEGFR3D3.Fc. The sequence of the
Flt1D2-VEGFR3D3 gene fusion insert was verified by standard
sequence analysis. This plasmid was then digested with the
restriction enzymes EcoRI and SrfI and the resulting 693 bp
fragment was subcloned into the EcoRI to SrfI restriction sites of
the plasmid pFlt1(1-3).DELTA.B2-Fc.DELTA.C1(a) to produce the
plasmid designated pFlt1D2.VEGFR3D3.Fc.DELTA.C1(a). The complete
DNA deduced amino acid sequence of the
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a) chimeric molecule is set forth in
FIG. 22A-22C.
Example 18
Extracellular Matrix Binding (ECM) Binding Assay
[0164] ECM-coated plates (Becton Dickinson catalog #35-4607) were
rehydrated with warm DME supplemented with glutamine (2 mM), 100 U
penicillin, 100 U streptomycin, and 10% BCS for at least 1 hr
before adding samples. The plates were then incubated for 1 hr at
room temperature with varying concentrations of Flt1D2.Flk1D3.
Fc.DELTA.C1(a) and Flt1D2.VEGFR3D3.Fc.DELTA.C1(a) starting at 10 nM
with subsequent 2-fold dilutions in PBS plus 10% BCS. The plates
were then washed 3 times with PBS plus 0.1% Triton-X and incubated
with alkaline phosphatase-conjugated anti-human Fc antibody
(Promega, 1:4000 in PBS plus 10% BCS) for 1 hr at room temperature.
The plates were then washed 4 times with PBS 0.1% Triton-X and
alkaline phosphatase buffer/pNPP solution (Sigma) was added for
color development. Plates were read at I=405-570 nm. The results of
this experiment are shown in FIG. 23 and demonstrate that the
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and Flt1D2,VEGFR3D3.Fc.DELTA.C1(a)
proteins are considerably less sticky to the ECM as compared to the
Flt1(1-3)-Fc protein.
Example 19
Transient Expression of pFlt1D2.Flk1D3.Fc.DELTA.C1(a) in CHO-K1
(E1A) Cells
[0165] A large scale (2 L) culture of E. coli DH10B cells carrying
the pFlt1D2,Flk1D3,Fc.DELTA.C1(a) plasmid described supra in
Example 17 was grown overnight in Terrific Broth (TB) plus 100
.mu.g/ml ampicillin. The next day, the plasmid DNA was extracted
using a QIAgen ENDOFREE.TM. Megaprep kit following the
manufacturer's protocol. The concentration of the purified plasmid
DNA was determined by standard techniques using a UV
spectrophotometer and fluororometer. The plasmid DNA was verified
by standard restriction enzyme digestion of aliquots using the
restriction enzymes EcoRI plus NotI and AseI. All restriction
enzyme digest fragments corresponded to the predicted sizes when
analyzed on a 1% agarose gel.
[0166] Forty 15 cm petri plates were seeded with CHO-K1/E1A cells
at a density of 4.times.10.sup.6 cells/plate. Plating media was
Gibco Ham's F-12 supplemented with 10% HYCLONE.TM. Fetal Bovine
Serum (FBS), 100 U penicillin/100 U streptomycin and glutamine (2
mM). The following day each plate of cells was transfected with 6
.mu.g of the pFlt1D2.Flk1D3.Fc.DELTA.C1(a) plasmid DNA using Gibco
Optimem and Gibco Lipofectamine in 12 ml volume, following the
manufacturer's protocol. Four hours after adding the transfection
mix to the cells, 12 ml/plate of Optimem supplemented with 10% FBS
was added. Plates were incubated at 37.degree. C. in a 5% CO.sub.2
incubator overnight. The following day the media was removed from
each plate and 25 ml expression media (Gibco CHO-S-SFM II
supplemented with glutamine (2 mM) and 1 mM sodium butyrate) was
added. The plates were incubated at 37.degree. C. for 3 days. After
3 days of incubation, the media was aspirated from each plate and
centrifuged at 400 rpm in a swinging bucket rotor to pellet cells.
The supernatant was decanted into sterile 1 L bottles and
purification of the expressed protein was performed as described
infra.
Example 20
Construction pVEGFR1R2-Fc.DELTA.C1(a) Expression Vector
[0167] The pVEGFR1R2.Fc.DELTA.C1(a) expression plasmid was
constructed by insertion of DNA encoding amino acids SDT
(corresponding to amino acids 27-29 of FIG. 24A-24C) between
Flt1d2-Flk1d3-Fc.DELTA.C1(a) amino acids 26 and 27 of FIG. 21A-21C
(GG) and removal of DNA encoding amino acids GPG corresponding to
amino acids 229-231. The SOT amino acid sequence is native to the
Flt1 receptor and was added back in to decrease the likelihood of
heterogeneous N-terminal processing. The GPG (bridging sequence)
was removed so that the Flt1 and Flk1 Ig domains were fused
directly to one another. The complete DNA and deduced amino acid
sequences of the pVEGFR1R2,Fc.DELTA.C1(a) chimeric molecule is set
forth in FIG. 24A-24C.
Example 21
Cell Culture Process Used to Produce Modified Flt1 Receptors
[0168] Cell Culture Process Used to Produce
Flt1D2.Flk1D3.Fc.DELTA.C1(a).
[0169] The process for production of Flt1D2Flk1D3.Fc.DELTA.C1(a)
protein using the expression plasmid pFlt1D2,Flk1D3.Fc.DELTA.C1(a)
described supra in Example 1 involves suspension culture of
recombinant Chinese hamster ovary (CHO K1/E1A) cells which
constitutively express the protein product. The cells are grown in
bioreactors and the protein product is isolated and purified by
affinity and size exclusion chromatography. The process is provided
in greater detail below.
[0170] Cell Expansion.
[0171] Two confluent T-225 cm.sup.2 flasks containing the
Flt1D2,Flk1D3.Fc.DELTA.C1(a) expressing cell line were expanded by
passaging cells into eight T-225 cm.sup.2 flasks in medium
(GMEM+10% serum, GIBCO) and incubated at 37.degree. C. and 5%
CO.sub.2. When the flasks approached confluence (approximately 3 to
4 days) the cells were detached using trypsin. Fresh medium was
added to protect the cells from further exposure to the trypsin.
The cells were centrifuged and resuspended in fresh medium then
transferred to eight 850 cm.sup.2 roller bottles and incubated at
37.degree. C. and 5% CO.sub.2 until confluent.
[0172] Suspension Culture in Bioreactors.
[0173] Cells grown in roller bottles were trypsinized to detach
them from the surface and washed with suspension culture medium.
The cells are aseptically transferred to a 5 L bioreactor (New
Brunswick Celligen Plus) where the cells are grown in 3.5 L of
suspension culture. The suspension culture medium was a
glutamine-free low glucose modification of IS-CHO (Irvine
Scientific) to which 5% fetal bovine serum (HYCLONE.TM.), GS
supplement (Life Technologies) and 25 .mu.M methionine sulfoximine
(Sigma) was added. The pH was controlled at 7.2 by addition of
carbon dioxide to the inlet gas or by addition of a liquid solution
of sodium carbonate to the bioreactor. Dissolved oxygen level was
maintained at 30% of saturation by addition of oxygen or nitrogen
to the inlet gas and temperature controlled at 37.degree. C. When a
density of 4.times.10.sup.6 cells/mL was reached the cells were
transferred to a 40 L bioreactor containing the same medium and
setpoints for controlling the bioreactor. The temperature setpoint
was reduced to 34.degree. C. to slow cell growth and increase the
relative rate of protein expression.
[0174] Cell Culture Process Used to Produce
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a).
[0175] The same methodologies as described supra for
Flt1D2.Flk1D3.Fc.DELTA.C1(a) were used to produce Flt1D2. VEGFR3D3.
Fc C1(a).
Example 22
Harvest and Purification of Modified Flt1 Receptors
[0176] Harvest and Purification of
Flt1D2.Flk1D2.Fc.DELTA.C1(a).
[0177] The product protein was aseptically harvested from the
bioreactor while retaining cells using Millipore Prostak
tangential-flow filtration modules and a low-shear mechanical pump
(Fristam). Fresh medium was added to the bioreactor to replace that
removed during the harvest filtration, Approximately 40 L of
harvest filtrate was then loaded onto a 400 mL column containing
Protein A SEPHAROSE.TM. resin (Amersham Pharmacia). After loading
the resin was washed with buffer containing 10 mM sodium phosphate,
500 mM sodium chloride, pH 7.2 to remove any unbound contaminating
proteins. Flt1D2.Flk1D3.Fc.DELTA.C1(a) protein was eluted with a pH
3.0 citrate buffer. The eluted protein was neutralized by addition
of Tris base and frozen at -20.degree. C.
[0178] Several frozen lots of Flt1D2.Flk1D3Fc.DELTA.C1(a) protein
from the Protein A step above were thawed, pooled and concentrated
using a Millipore 30 kD nominal molecular weight cutoff (NMWCO)
tangential flow filtration membrane. The protein was transferred to
a stirred cell concentrator (Millipore) and further concentrated to
30 mg/mL using a 30 kD NMWCO membrane. The concentrated protein was
loaded onto a size exclusion column packed with SUPERDEX.TM.200
resin (Amersham Pharmacia) that was equilibrated with phosphate
buffered saline plus 5% glycerol. The same buffer was used to run
the column. The fractions corresponding to
Flt1D2.Flk1D3.Fc.DELTA.C1(a) dimer were pooled, sterile filtered
through a 0.22 micron filter, aliquoted and frozen.
[0179] Harvest and Purification of
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a).
[0180] The same methodologies as described supra for
Flt1D2.Flk1D3.Fc.DELTA.C1(a) were used to harvest and purify
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a).
Example 23
Phosphorylation Assay for Transiently Expressed VEGFR2
[0181] Primary human umbilical vein endothelial cells (HUVECs),
passage 4-6, were starved for 2 hrs in serum-free DME high glucose
media. Samples containing 40 ng/ml (1 nM) human VEGF165, which is a
ligand for the VEGF receptors Flt1. Flk1 and Flt4(VEGFR3) were
prepared and were preincubated for 1 hr at room temperature with
varying amounts of the modified Flt1 receptors Flt1(1-3)-Fc, Flt1
(1-3)-Fc (A40), Flt1D2Flk1D3,Fc.DELTA.C1(a) and
Flt1D2VEGFR3D3.Fc.DELTA.C1(a) in serum-free DME-high glucose media
containing 0.1% BSA. Cells were challenged for 5 minutes with the
samples prepared above +/-VEGF165, followed by whole cell lysis
using complete lysis buffer. Cell lysates were immunoprecipitated
with an antibody directed against the C-terminus of VEGFR2
receptor. The immunoprecipitated lysates were loaded onto 4-12%
SDS-PAGE Novex gel and then transferred to PVDF membrane using
standard transfer methodologies. Detection of phosphorylated VEGFR2
was done by immunoblotting with the anti-phospho Tyrosine mAb
called 4G10 (UBI) and developed using ECL-reagent (Amersham). FIGS.
25A-25C and 26A-26B show the results of this experiment. FIG.
25A-25C reveals that detection by Western blot of tyrosine
phosphorylated VEGFR2 (Flk1) by VEGF165 ligand stimulation shows
that cell-surface receptors are phosphorylated to varying levels
depending on which modified Flt1 receptor is used during the
preincubations with VEGF. As is seen in FIG. 25A, at a 1.5 molar
excess of either Flt1 (1-3)-Fc, Flt1(1-3)-Fc (A40) or transient
Flt1D2Flk1D3.Fc.DELTA.C1(a) there is complete blockage of receptor
stimulation by these three modified Flt1 receptors as compared to
control media challenge. In contrast, transient
Flt1D2VEGFR3D3.Fc.DELTA.C1(a) does not show significant blockage at
this molar excess, as compared with VEGF positive control
challenge. Similar results are seen in FIG. 25B, where the modified
Flt receptors are in a 3-fold molar excess to VEGF165 ligand. In
FIG. 25C, where the modified Flt1 receptors are in a 6-fold molar
excess to VEGF165 ligand, transient Flt1D2VEGFR3D3.Fc.DELTA.C1(a)
can now be shown to be partially blocking VEGF165-induced
stimulation of cell-surface receptors.
[0182] In FIG. 26A-26B, detection by Western blot of tyrosine
phosphorylated VEGFR2(Flk1) by VEGF165 ligand stimulation shows
that cell-surface receptors are not phosphorylated by challenge
samples which have VEGF165 preincubated with 1 and 2 fold molar
excess (FIG. 26A) or 3 and 4 fold molar excess (FIG. 26B) of either
transient Flt1D2Flk1D3.Fc.DELTA.C1(a), stable
Flt1D2Flk1D3.Fc.DELTA.C1(a), or transient VEGFR1R2-Fc.DELTA.C1(a).
At all modified Flt1 receptor concentrations tested there is
complete binding of VEGF165 ligand during the preincubation,
resulting in no detectable stimulation of cell-surface receptors by
unbound VEGF165 as compared to control media challenge.
Example 24
Cell Proliferation Bioassay
[0183] The test cell population is MG87 cells that have been stably
transfected with a expression plasmid that contains a DNA insert
encoding the VEGFR2 (Flk1) extracellular domain fused to the TrkB
intracellular kinase domain, thus producing a chimeric molecule.
The reason the TrkB intracellular kinase domain was used rather
than the native VEGFR2(Flk1) intracellular kinase domain is that
the intracellular kinase domain of VEGFR2(Flk1) does not cause a
strong proliferative response when stimulated by VEGF165 in these
cells. It is known that MG87 cells containing full length TrkB
receptor give a robust proliferative response when stimulated with
BDNF, so the TrkB intracellular kinase domain was engineered to
replace the intracellular kinase domain of VEGFR2(Flk1) to take
advantage of this proliferative response capability.
[0184] Five thousand cells/well were plated in a 96 well plate and
allowed to settle for 2 hrs at 37.degree. C. The following modified
Flt receptors Flt1(1-3)-Fc, Flt1D2.Flk1D3.Fc.DELTA.C1(a) and
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a), plus an irrelevant receptor termed
Tie2-Fc as a negative control, were titrated from 40 nM to 20 .mu.M
and incubated on the cells for 1 hr at 37.degree. C. Human
recombinant VEGF165 in defined media was then added to all the
wells at a concentration of 1.56 nM. The plates were incubated for
72 hrs at 37.degree. C. and then MTS (Owen's reagent, Promega)
added and the plates were incubated for an additional for 4 hrs.
Finally, the plates were read on a spectrophotometer at 450/570 nm.
The results of this experiment are shown in FIG. 27. The control
receptor Tie2-Fc does not block VEGF165-induced cell proliferation
at any concentration whereas Flt1D2.Flk1D3.Fc.DELTA.C1(a) blocks
1.56 nM VEGF165 with a half maximal dose of 0.8 nM. Flt1(1-3)-Fc
and Flt1D2.VEGFR3D3,Fc.DELTA.C1(a) are less effective in blocking
VEGF165 in this assay with a half maximal dose of -2 nM. VEGF165
alone gives a reading of 1.2 absorbance units and the background is
0.38 absorbance units.
Example 25
Binding Stoichiometry of Modified Flt Receptors to VEGF165
[0185] BIACORE.TM. Analysis.
[0186] The stoichiometry of Flt1D2Flk1D3.Fc.DELTA.C1(a) and
VEGFR1R2-Fc.DELTA.C1(a) interaction with human VEGF165 was
determined by measuring either the level of VEGF saturation binding
to the Flt1D2Flk1D3.Fc.DELTA.C1(a) or VEGFR1R2-Fc.DELTA.C1(a)
surfaces or measuring concentration of VEGF165 needed to completely
prevent binding of Flt1D2Flk1D3.Fc.DELTA.C1(a) or
VEGFR11R2-Fc.DELTA.C1(a) to VEGF BIACORE.TM. chip surface.
[0187] Modified Flt receptors Flt1D2Flk1D3.Fc.DELTA.C1(a) and
VEGFR1R2-Fc.DELTA.C1(a), were captured with an anti-Fc specific
antibody that was first immobilized on a BIACORE.TM. chip using
amine-coupling chemistry. A blank antibody surface was used as a
negative control. VEGF165 was injected at a concentration of 1 nM,
10 nM, and 50 nM over the Flt1D2Flk1D3.Fc.DELTA.C1(a) and
VEGFR1R2-Fc.DELTA.C1(a) surfaces at 10 .mu.l/min for one hour. A
real-time binding signal was recorded and saturation binding was
achieved at the end of each injection. Binding stoichiometry was
calculated as a molar ratio of bound VEGF165 to the immobilized
Flt1D2Flk1D3.Fc.DELTA.C1(a) or VEGFR1R2-Fc.DELTA.C1(a), using the
conversion factor of 1000 RU equivalent to 1 ng/ml. The results
indicated binding stoichiometry of one VEGF165 dimeric molecule per
one Flt1D2Flk1D3.Fc.DELTA.C1(a) or VEGFR1R2-Fc.DELTA.C1(a) molecule
(FIG. 28).
[0188] In solution, Flt1D2Flk1D3.Fc.DELTA.C1(a) or
VEGFR1R2-Fc.DELTA.C1(a) at a concentration of 1 nM (estimated to be
1000 times higher than the KD of the Flt1D2Flk1D3.Fc.DELTA.C1(a) or
VEGFR1R2-Fc.DELTA.C1(a)/VEGF165 interaction) were mixed with varied
concentrations of VEGF165. After one hour incubation,
concentrations of the free Flt1D2Flk1D3.Fc.DELTA.C1(a) in solution
were measured as a binding signal to an amine-coupled VEGF165
surface. A calibration curve was used to convert the
Flt1D2Flk1D3.Fc.DELTA.C1(a) BIACORE.TM. binding signal to its molar
concentration. The data showed that the addition of 1 nM VEGF165
into the Flt1D2Flk1D3.Fc.DELTA.C1(a) solution completely blocked
Flt1D2Flk1D3.Fc.DELTA.C1(a) binding to the VEGF165 surface. This
result suggested the binding stoichiometry of one VEGF165 molecule
per one Flt1D2Flk1D3.Fc.DELTA.C1(a) molecule (FIG. 29 and FIG. 30).
When the concentration of Flt1D2Flk1D3.Fc.DELTA.C1(a) was plotted
as a function of added concentration of VEGF165, the slope of the
linear portion was -1.06 for Flt1D2Flk1D3.Fc.DELTA.C1(a) and -1.07
for VEGFR1R2-Fc.DELTA.C1(a). The magnitude of the slope, very close
to negative one, was indicative that one molecule of VEGF165 bound
to one molecule of either Flt1D2Flk1D3.Fc.DELTA.C1(a) or
VEGFR1R2-Fc.DELTA.C1(a).
[0189] Size Exclusion Chromatography.
[0190] Flt1D2Flk1D3.Fc.DELTA.C1(a) was mixed with a 3-fold excess
of VEGF165 and the receptor-ligand complex was purified using a
Pharmacia SUPEROSE.TM.6 size exclusion chromatography column. The
receptor-ligand complex was then incubated in a buffer containing 6
M guanidine hydrochloride in order to dissociate it into its
component proteins. Flt1D2Flk1D3.Fc.DELTA.C1(a) was separated from
VEGF165 using SUPEROSE.TM.6 size exclusion chromatography column
run in 6 M guanidium chloride. In order to determine complex
stoichiometry, several injections of Flt1D2Flk1D3.Fc.DELTA.C1(a)
and VEGF165 were made and peak height or peak integrated intensity
was plotted as a function of the concentration of injected protein.
The calibration was done under condition identical to one used in
separating components of Flt1D2Flk1D3.Fc.DELTA.C1(a)VEGF complex.
Quantification of the Flt1D2Flk1D3.Fc.DELTA.C1(a)/VEGF complex
composition was based on the calibration curves. The results of
this experiment are set forth in FIG. 28, which shows the ratio of
VEGF165 to Flt1D2Flk1D3.Fc.DELTA.C1(a) in a complex to be 1:1.
Example 26
Determination of the Binding Stoichiometry of
Flt1D2Flk1D3.Fc.DELTA.C1(a)/VEGF165 Complex by Size Exclusion
Chromatography
[0191] Flt1D2Flk1D3.Fc.DELTA.C1(a)/VEGF165 Complex Preparation.
[0192] VEGF165 (concentration=3.61 mg/ml) was mixed with CHO cell
transiently expressed Flt1D2.Flk1D3.Fc.DELTA.C1(a)
(concentration=0.9 mg/ml) in molar ratio of 3:1
(VEGF165:Flt1D2.Flk1D3.Fc.DELTA.C1(a)) and incubated overnight at
4.degree. C.
[0193] Size Exclusion Chromatography (SEC) under Native
Conditions.
[0194] To separate the complex from excess of unbound VEGF165, 50
.mu.l of the complex was loaded on a Pharmacia SUPEROSE.TM.12 PC
3.2/30 which was equilibrated in PBS buffer. The sample was eluted
with the same buffer at flow rate 40 .mu.l/min. at room
temperature. The results of this SEC are shown in FIG. 31. Peak #1
represents the complex and peak #2 represents unbound VEGF165.
Fractions eluted between 1.1 and 1.2 ml were combined and
guanidinium hydrochloride (GuHCl)was added to a final concentration
4.5 M to dissociate the complex.
[0195] Size Exclusion Chromatography (SEC) under Dissociative
Conditions.
[0196] To separate the components of the receptor-ligand complex
and to determine their molar ratio, 50 .mu.l of dissociated complex
as described supra was loaded onto a SUPEROSE.TM. 12 PC 3.2/30
equilibrated in 6 M GuHCl and eluted with the same solution at a
flow rate 40 .mu.l/min at room temperature. The results of this SEC
are shown in FIG. 32. Peak #1 represents
Flt1D2Flk1D3.Fc.DELTA.C1(a) and peak #2 represents VEGF165.
[0197] Calculation of Flt1D2Flk1D3.Fc.DELTA.C1(a):VEGF165 Complex
Stoichiometry.
[0198] The stoichiometry of the receptor-ligand complex was
determined from the peak area or the peak height of the components.
Concentrations of VEGF165 and Flt1D2Flk1D3.Fc.DELTA.C1(a)
corresponding to the peak height or peak area, respectively, were
obtained from the standard curves for VEGF165 and Flt
D2Flk1D3.Fc.DELTA.C1(a). To obtain a standard curve, four different
concentrations (0.04 mg/ml-0.3 mg/ml) of either component were
injected onto a Pharmacia SUPEROSE.TM. 12 PC 3.2/30 column
equilibrated in 6 M guanidinium chloride and eluted with the same
solution at flow rate 40 .mu.l/min at room temperature. The
standard curve was obtained by plotting peak area or peak height vs
protein concentration. The molar ratio of
VEGF165:Flt1D2Flk1D3.Fc.DELTA.C1(a) determined from the peak area
of the components was 1.16. The molar ratio of
VEGF165:Flt1D2Flk1D3. Fc.DELTA.C1(a) determined from the peak
height of the components was 1.10.
Example 27
Determination of the Stoichiometry of the
Flt1D2Flk1D3.Fc.DELTA.C1(a)/VEGF165 Complex by Size Exclusion
Chromatography with On-Line Light Scattering
[0199] Complex Preparation.
[0200] VEGF165 was mixed with CHO transiently expressed
Flt1D2.Flk1D3.Fc.DELTA.C1(a) protein in molar ratio of 3:1
(VEGF165:Flt11D2Flk1D3.Fc.DELTA.C1(a)) and incubated overnight at
4.degree. C.
[0201] Size Exclusion Chromatography (SEC) with On-Line Light
Scattering.
[0202] Size exclusion chromatography column with a MiniDawn on-line
light scattering detector (Wyatt Technology, Santa Barbara, Calif.)
and refractive index (R1) detectors (Shimadzu, Kyoto, Japan) was
used to determine the molecular weight (MW) of the receptor-ligand
complex. Samples were injected onto a SUPEROSE.TM. 12 HR 10/30
column (Pharmacia) equilibrated in PBS buffer and eluted with the
same buffer at flow rate 0.5 ml/min, at room temperature. As shown
in FIG. 33, the elution profile shows two peaks. Peak #1 represents
the receptor-ligand complex and peak #2 represents the unbound
VEGF165. MW was calculated from LS and RI signals. The same
procedure was used to determine MW of the individual components of
the receptor-ligand complex. The results of these determinations
are as follows: MW of the Flt1D2Flk1D3.Fc.DELTA.C1(a)/VEGF165
complex at the peak position is 157 300 (FIG. 33), the MW of
VEGF165 at the peak position is 44 390 (FIG. 34) and the MW of R1R2
at the peak is 113 300 (FIG. 35).
[0203] These data indicated that the stoichiometry of the
Flt1D2Flk1D3.Fc.DELTA.C1(a)/VEGF complex is 1:1 as its corresponds
to the sum of molecular weights for Flt1D2Flk1D3.Fc.DELTA.C1(a) and
VEGF165. Importantly, this method conclusively proved that the
Flt1D2Flk1D3.Fc.DELTA.C1(a)/VEGF165 complex was indeed composed of
only one molecule of VEGF165 ligand and only one molecule of the
Flt1D2Flk1D3.Fc.DELTA.C1(a).
Example 28
Peptide Mapping of Flt1D2.Flk1D3.Fc.DELTA.C1(a)
[0204] The disulfide structures and glycosylation sites in
Flt1D2.Flk1D3.Fc.DELTA.C1(a) were determined by a peptide mapping
method. In this method, the protein was first cleaved with trypsin.
Tryptic fragments were analyzed and identified by HPLC coupled with
mass spectrometry, in addition to an N-terminal sequencing
technique. Reduction of the tryptic digest was employed to help
identify disulfide-bond-containing fragments. Treatment of the
tryptic digest with PNGase F (Glyko, Novato, Calif.) was employed
to help identify fragments with N-linked glycosylation sites. The
results are summarized in the accompanying FIG. 36.
[0205] There are a total of ten cysteines in
Flt1D2.Flk1D3.Fc.DELTA.C1(a); six of them belong to the Fc region.
Cys27 has been confirmed to be disulfide bonded to Cys76. Cys121 is
confirmed to be disulfide bonded to Cys182. The first two cysteines
in the Fc region (Cys211 and Cys214) form an intermolecular
disulfide bond with the same two cysteines in another Fc chain.
However, because these two cysteines can not be separated
enzymatically from each other, it can not be determined whether
disulfide bonding is occurring between same cysteines (Cys211 to
Cys211, for example) or between Cys211 and Cys214. Cys216 is
confirmed to be disulfide bonded to Cys306. Cys352 is confirmed to
be disulfide bonded to Cys410.
[0206] There are five possible N-linked glycosylation sites in
Flt1D2.Flk1D3,Fc.DELTA.C1(a). All five of them are found to be
glycosylated to varying degrees. Complete glycosylation was
observed at Asn33 (amino acid sequence NIT), Asn193 (amino acid
sequence NST), and Asn282 (amino acid sequence NST). In addition,
partial glycosylation is observed on Asn65 and Asn120, Sites of
glycosylation are highlighted by underline in the FIG. 36.
Example 29
Pharmacokinetic Analysis of Modified Flt Receptors
[0207] Pharmacokinetic analysis of Flt1(1-3)-Fc (A40), Flt1D2.Flk1
D3, Fc.DELTA.C1(a) and VEGFR1R2-Fc.DELTA.C1(a).
[0208] Balb/c mice (25-30 g) were injected subcutaneously with 4
mg/kg of Flt1(1-3)-Fc (A40), CHO transiently expressed
Flt1D2.Flk1D3.Fc.DELTA.C1(a), CHO stably expressed
Flt1D2.Flk1D3.Fc.DELTA.C1(a), and CHO transiently expressed
VEGFR1R2-Fc.DELTA.C1(a). The mice were tail bled at 1, 2, 4, 6, 24
hrs, 2 days, 3 days and 6 days after injection. The sera were
assayed in an ELISA designed to detect Flt1 (1-3)-Fc (A40),
Flt1D2.Flk1D3.Fc.DELTA.C1(a) or VEGFR1R2-Fc.DELTA.C1(a). The ELISA
involves coating an ELISA plate with VEGF165, binding the detect
Flt1(1-3)-Fc (A40), Flt1D2.Flk1D3.Fc.DELTA.C1(a) or
VEGFR1R2-Fc.DELTA.C1(a) and reporting with an anti-Fc antibody
linked to horse radish peroxidase. The results of this experiments
are shown in FIG. 37. The T.sub.max for Flt1(1-3)-Fc (A40) was at 6
hrs while the T.sub.max for the transient and stable
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and the transient
VEGFR1R2-Fc.DELTA.C1(a) was 24 hrs. The C.sub.max for Flt1(1-3)-Fc
(A40) was 8 .mu.g/ml. For both transients (Flt1D2.Flk1D3.
Fc.DELTA.C1(a) and VEGFR1R2-Fc.DELTA.C1(a)) the C.sub.max was 18
.mu.g/ml and the C.sub.max for the stable VEGFR1R2-Fc.DELTA.C1(a)
was 30 .mu.g/ml.
[0209] Pharmacokinetic Analysis of Flt1(1-3)-Fc (A40),
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a).
[0210] Balb/c mice (25-30 g) were injected subcutaneously with 4
mg/kg of Flt1(1-3)-Fc (A40), CHO transiently expressed
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and CHO transiently expressed
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a). The mice were tail bled at 1, 2, 5,
6, 7, 8, 12, 15 and 20 days after injection. The sera were assayed
in an ELISA designed to detect Flt1(1-3)-Fc,
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and Flt1D2.VEGFR3D3.Fc.DELTA.C1(a).
The ELISA involves coating an ELISA plate with VEGF 165, binding
the Flt1(1-3)-Fc, Flt1D2.Flk1D3.Fc.DELTA.C1(a) or
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a) and reporting with an anti-Fc
antibody linked to horse radish peroxidase. Flt1(1-3)-Fc (A40)
could no longer be detected in the serum after day 5 whereas,
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and Flt1D2.VEGFR3D3.Fc.DELTA.C1(a)
were detectable for 15 days or more. The results of this experiment
are shown in FIG. 38.
Example 30
Evaluation of the Ability of Flt1D2.Flk1D3.Fc.DELTA.C1(a) to
Inhibit Tumor Growth In Vivo
[0211] To evaluate the ability of Flt1D2.Flk1D3.Fc.DELTA.C1(a) to
inhibit tumor growth in vivo a model in which tumor cell
suspensions are implanted subcutaneously on the right flank of male
severe combined immunodeficiency (SCID) mice was employed. Two cell
lines, the human HT-1080 fibrosarcoma cell line (ATCC accession no.
CCL-121) and the rat C6 glioma cell line (ATCC accession no.
CCL-107), each of which exhibit distinctly different morphologies
and growth characteristics, were used in the assay. The first dose
of Flt1D2.Flk1D3.Fc.DELTA.C1(a) (at 25 mg/Kg or as indicated in
FIGS. 39 and 40) was given on the day of tumor implantation.
Animals subsequently received subcutaneous injections of Flt1
(1-3)-Fc (A40), Flt1D2.Flk1D3.Fc.DELTA.C1(a) or vehicle either
every other day (EOD) or two times per week (2.times./wk) for a
period of 2 weeks. After 2 weeks, animals were perfused with
fixative, tumors were removed and samples were blinded. Tumor
volume was determined by measuring the length and width of visible
subcutaneous tumors. Both of Flt1(1-3)-Fc (A40) and
Flt1D2.Flk1D3.Fc.DELTA.C1(a) significantly reduced the growth of
tumors formed by HT-1080 and C6 cells. The results of these
experiments are shown in FIG. 39 and FIG. 40.
Example 31
The Effect of VEGF165 and Modified Flt Receptors in Female
Reproductive System
[0212] The stereotypic pattern of vascular remodeling which occur
in the uterus and ovary over the course of the reproductive cycle
has been well characterized, making these tissues particularly well
suited to the study of mechanisms which regulate angiogenesis,
vascular remodeling and vascular regression. Indeed, in situ
hybridization studies in the reproductive tissues provided the
first clear evidence that VEGF acts as a mediator of physiological
angiogenesis in mature rodents, as well as humans and non-human
primates (Phillips et al., 1990; Ravindranath et al., 1992; Shweiki
et al., 1993; Kamat et al., 1995). As cyclic angiogenesis and
vascular remodeling are prominent features of the normal ovary and
uterus, it is not surprising that abnormal blood vessel growth
and/or vascular dysfunction have been found to characterize many
pathological conditions which affect these organs. Furthermore,
these pathogenic vascular abnormalities are thought to be caused or
perpetuated by the dysregulated expression of one or more
angiogenic or anti-angiogenic factors, most prominently VEGF.
[0213] For example, abnormal angiogenesis is characteristic of
polycystic ovary disease, endometriosis and endometrial carcinoma,
and in each case VEGF is over expressed in the affected tissue
(Kamat et al., 1995; Shifren et al., 1996; Guidi et al., 1996;
Donnez et al., 1998). Overexpression of VEGF is also thought to
play a pathogenic role in the establishment of systemic vascular
hyperpermeability in ovarian hyperstimulation syndrome (McClure et
al., 1994; Levin et al., 1998) and preeclampsia (Baker et al.,
1995; Sharkey et al., 1996). In addition, VEGF has been implicated
as the permeability factor responsible for the production of
ascites associated with ovarian carcinoma and other tumors (Senger
et al., 1983; Boocock et al., 1995). Agents which effectively
neutralize the biological actions of VEGF can reasonably be
anticipated to be of therapeutic benefit in the above and related
conditions.
[0214] Angiogenesis and vascular remodeling are also hallmarks of
blastocyst implantation and placental development (Findlay, 1986).
VEGF is strongly expressed both in the maternal decidua and in
embryonic trophoblasts, where it is thought to first stimulate
expansion and hyperpermeability of the uterine vasculature during
the peri-implantation period and subsequently mediate formation of
both the maternal and embryonic components of the placental
vasculature (Shweiki et al., 1993; Cullinan-Bove and Koos, 1993;
Chakraborty et al., 1995; Das et al., 1997). VEGF is also required
for luteal angiogenesis and associated progesterone secretion
necessary to prepare the uterus for implantation (Ferrara et al.,
1998). Thus, agents which inhibit the biological actions of VEGF
may prove to be useful as contraceptive agents (by preventing
implantation), or as an abortifacients in the early stages of
gestation. The latter application might find particular use as a
non-surgical intervention for the termination of ectopic
pregnancies.
[0215] While the expression of VEGF receptors is largely confined
to the vascular endothelium in normal reproductive tissues, Flt1 is
also expressed by trophoblasts in the placenta in both humans and
animals (Clark et al., 1996; He et al., 1999) where it has been
proposed to play a role in trophoblast invasion. Interestingly,
both Flt1 and KDR (Flk1) are expressed by choriocarcinoma cell line
BeWo (Chamock-Jones et al., 1994), and VEGF has been shown to
promote DNA synthesis and tyrosine phosphorylation of MAP kinase in
these cells. Furthermore, primary and metastatic ovarian carcinomas
not only to express high levels of VEGF, but--in addition to the
vascular endothelium--the tumor cells themselves express KDR and/or
Flt1 (Boocock et al., 1995). These findings suggest that VEGF may
not only be critically involved in the generation and maintenance
of tumor vasculature, but that at least in some tumors of
reproductive origin VEGF may subserve an autocrine role, directly
supporting the survival and proliferation of the tumor cells. Thus
agents which block the actions of VEGF may have particularly
beneficial applications to the treatment of tumors of reproductive
origin.
[0216] Assessment of VEGF-Induced Uterine Hyperpermeability.
[0217] Pregnant mare's serum gonadotrophin (PMSG) was injected
subcutaneously (5 IU) to induce ovulation in prepubertal female
rats. This results in a surge of estradiol after 2 days which in
turn causes an induction of VEGF in the uterus. It is reported that
this induction results in hyperpermeability of the uterus and an
increase in uterine wet weight 6 hrs. later and, therefore, could
potentially be blocked by the modified Flt receptors Flt1(1-3)-Fc
(A40), Flt1D2.Flk1D3.Fc.DELTA.C1(a) and
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a). In this in vivo model, the normal
weight of the rat uterus is about 50 mg and this can be induced to
300-350 mg by PMSG. Desiccation of the tissue reveals that this is
all water weight. Subcutaneous injection of Flt1(1-3)-Fc (A40),
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and Flt1D2.VEGFR3D3.Fc.DELTA.C1(a) at
25 mg/kg at 1 hr after PMSG injection results in about a 50%
inhibition of the increase in uterine wet weight. Increasing the
dose of modified Flt receptor does not further reduce the increase
in wet weight suggesting that there is a VEGF-independent component
to this model. The results of this experiment are shown in FIG.
41.
[0218] Assessment of Corpus Luteum Angiogenesis Using Progesterone
as a Readout.
[0219] Pregnant mare's serum gonadotrophin (PMSG) is injected
subcutaneously (5 IU) to induce ovulation in prepubertal female
rats. This results in a fully functioning corpus luteum containing
a dense network of blood vessels after 4 days that allows for the
secretion of progesterone into the blood stream in order to prepare
the uterus for implantation. The induction of angiogenesis in the
corpus luteum requires VEGF; therefore, blocking VEGF would result
in a lack of new blood vessels and thus a lack of progesterone
secreted into the blood stream. In this in vivo model, resting
levels of progesterone are about 5 ng/ml and this can be induced to
a level of 25-40 ng/ml after PMSG. Subcutaneous injection of
Flt1(1-3)-Fc (A40) or Flt1D2.Flk1D3.Fc.DELTA.C1(a) at 25 mg/kg or 5
mg/kg at 1 hr after PMSG injection results in a complete inhibition
of the progesterone induction on day 4. The results of this
experiment are shown in FIG. 42A-42B.
Example 33
Pharmacokinetic Analysis of Flt1(1-3)-Fc (A40) and Pegylated
Flt1(1-3)-Fc
[0220] Flt1(1-3)-Fc was PEGylated with either 10 kD PEG or 20 kD
PEG and tested in balb/c mice for their pharmacokinetic profile.
Both PEGylated forms of Flt1(1-3)-Fc were found to have much better
PK profiles than Flt1(1-3)-Fc (A40), with the T.sub.max occurring
at 24 hrs for the PEGylated molecules as opposed to 6 hrs for
Flt1(1-3)-Fc (A40).
Example 34
VEGF165 ELISA to Test Affinity of Modified Flt1 Receptor
Variants
[0221] Ten pM of VEGF165 was incubated overnight at room
temperature with modified Flt1 receptor variants ranging from 160
pM to 0.1 pM. The modified Flt1 receptor variants used in this
experiment were Flt1(1-3)-Fc, Flt1(1-3)-Fc (A40), transiently
expressed Flt1D2Flk1D3.Fc.DELTA.C1(a), transiently expressed
Flt1D2VEFGFR3D3-Fc.DELTA.C1(a), FIt1-(1-3.sub.NAS)-Fc,
Flt1(1-3.sub.R->C)-Fc and Tie2-Fc. Flt1(1-3.sub.NAS)-Fc is a
modified version of Flt1(1-3)-Fc in which the highly basic amino
acid sequence KNKRASVRRR (SEQ ID NO:32) is replaced by NASVNGSR
(SEQ ID NO:33), resulting in the incorporation of two new
glycosylation sites and a net reduction of five positive charges,
both with the purpose of reducing the unfavorable effects of this
sequence on PK. Flt1(1-3.sub.R->C)-Fc is a modification in which
a single arginine (R) residue within the same basic amino acid
sequence is changed to a cysteine (C) (KNKRASVRRR (SEQ ID
NO:36)->KNKCASVRRR (SEQ ID NO:34)) to allow for pegylation at
that residue, which could then shield the basic region from
exerting its unfavorable effects on PK. After incubation the
solution was transferred to a plate containing a capture antibody
for VEGF165 (R&D). The amount of free VEGF165 was then
determined using an antibody to report free VEGF165. This showed
that the modified Flt1 receptor variant with the highest affinity
for VEGF165 (determined as the lowest amount of free VEGF165) was
Flt1D2Flk1D3.Fc.DELTA.C1(a), followed by Flt1(1-3)-Fc and
Flt1(1-3)-Fc (A40) and then by Flt1(1-3.sub.R->C)-Fc,
Flt1(1-3.sub.NAS)-Fc and Flt1D2VEFGFR3D3-Fc.DELTA.C1(a). Tie2Fc has
no affinity for VEGF165.
Sequence CWU 1
1
3811704DNAHomo sapiensCDS(1)...(1701) 1atg gtc agc tac tgg gac acc
ggg gtc ctg ctg tgc gcg ctg ctc agc 48Met Val Ser Tyr Trp Asp Thr
Gly Val Leu Leu Cys Ala Leu Leu Ser1 5 10 15tgt ctg ctt ctc aca gga
tct agt tca ggt tca aaa tta aaa gat cct 96Cys Leu Leu Leu Thr Gly
Ser Ser Ser Gly Ser Lys Leu Lys Asp Pro 20 25 30gaa ctg agt tta aaa
ggc acc cag cac atc atg caa gca ggc cag aca 144Glu Leu Ser Leu Lys
Gly Thr Gln His Ile Met Gln Ala Gly Gln Thr 35 40 45ctg cat ctc caa
tgc agg ggg gaa gca gcc cat aaa tgg tct ttg cct 192Leu His Leu Gln
Cys Arg Gly Glu Ala Ala His Lys Trp Ser Leu Pro 50 55 60gaa atg gtg
agt aag gaa agc gaa agg ctg agc ata act aaa tct gcc 240Glu Met Val
Ser Lys Glu Ser Glu Arg Leu Ser Ile Thr Lys Ser Ala65 70 75 80tgt
gga aga aat ggc aaa caa ttc tgc agt act tta acc ttg aac aca 288Cys
Gly Arg Asn Gly Lys Gln Phe Cys Ser Thr Leu Thr Leu Asn Thr 85 90
95gct caa gca aac cac act ggc ttc tac agc tgc aaa tat cta gct gta
336Ala Gln Ala Asn His Thr Gly Phe Tyr Ser Cys Lys Tyr Leu Ala Val
100 105 110cct act tca aag aag aag gaa aca gaa tct gca atc tat ata
ttt att 384Pro Thr Ser Lys Lys Lys Glu Thr Glu Ser Ala Ile Tyr Ile
Phe Ile 115 120 125agt gat aca ggt aga cct ttc gta gag atg tac agt
gaa atc ccc gaa 432Ser Asp Thr Gly Arg Pro Phe Val Glu Met Tyr Ser
Glu Ile Pro Glu 130 135 140att ata cac atg act gaa gga agg gag ctc
gtc att ccc tgc cgg gtt 480Ile Ile His Met Thr Glu Gly Arg Glu Leu
Val Ile Pro Cys Arg Val145 150 155 160acg tca cct aac atc act gtt
act tta aaa aag ttt cca ctt gac act 528Thr Ser Pro Asn Ile Thr Val
Thr Leu Lys Lys Phe Pro Leu Asp Thr 165 170 175ttg atc cct gat gga
aaa cgc ata atc tgg gac agt aga aag ggc ttc 576Leu Ile Pro Asp Gly
Lys Arg Ile Ile Trp Asp Ser Arg Lys Gly Phe 180 185 190atc ata tca
aat gca acg tac aaa gaa ata ggg ctt ctg acc tgt gaa 624Ile Ile Ser
Asn Ala Thr Tyr Lys Glu Ile Gly Leu Leu Thr Cys Glu 195 200 205gca
aca gtc aat ggg cat ttg tat aag aca aac tat ctc aca cat cga 672Ala
Thr Val Asn Gly His Leu Tyr Lys Thr Asn Tyr Leu Thr His Arg 210 215
220caa acc aat aca atc ata gat gtc caa ata agc aca cca cgc cca gtc
720Gln Thr Asn Thr Ile Ile Asp Val Gln Ile Ser Thr Pro Arg Pro
Val225 230 235 240aaa tta ctt aga ggc cat act ctt gtc ctc aat tgt
act gct acc act 768Lys Leu Leu Arg Gly His Thr Leu Val Leu Asn Cys
Thr Ala Thr Thr 245 250 255ccc ttg aac acg aga gtt caa atg acc tgg
agt tac cct gat gaa aaa 816Pro Leu Asn Thr Arg Val Gln Met Thr Trp
Ser Tyr Pro Asp Glu Lys 260 265 270aat aag aga gct tcc gta agg cga
cga att gac caa agc aat tcc cat 864Asn Lys Arg Ala Ser Val Arg Arg
Arg Ile Asp Gln Ser Asn Ser His 275 280 285gcc aac ata ttc tac agt
gtt ctt act att gac aaa atg cag aac aaa 912Ala Asn Ile Phe Tyr Ser
Val Leu Thr Ile Asp Lys Met Gln Asn Lys 290 295 300gac aaa gga ctt
tat act tgt cgt gta agg agt gga cca tca ttc aaa 960Asp Lys Gly Leu
Tyr Thr Cys Arg Val Arg Ser Gly Pro Ser Phe Lys305 310 315 320tct
gtt aac acc tca gtg cat ata tat gat aaa gca ggc ccg ggc gag 1008Ser
Val Asn Thr Ser Val His Ile Tyr Asp Lys Ala Gly Pro Gly Glu 325 330
335ccc aaa tct tgt gac aaa act cac aca tgc cca ccg tgc cca gca cct
1056Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro
340 345 350gaa ctc ctg ggg gga ccg tca gtc ttc ctc ttc ccc cca aaa
ccc aag 1104Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys
Pro Lys 355 360 365gac acc ctc atg atc tcc cgg acc cct gag gtc aca
tgc gtg gtg gtg 1152Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr
Cys Val Val Val 370 375 380gac gtg agc cac gaa gac cct gag gtc aag
ttc aac tgg tac gtg gac 1200Asp Val Ser His Glu Asp Pro Glu Val Lys
Phe Asn Trp Tyr Val Asp385 390 395 400ggc gtg gag gtg cat aat gcc
aag aca aag ccg cgg gag gag cag tac 1248Gly Val Glu Val His Asn Ala
Lys Thr Lys Pro Arg Glu Glu Gln Tyr 405 410 415aac agc acg tac cgt
gtg gtc agc gtc ctc acc gtc ctg cac cag gac 1296Asn Ser Thr Tyr Arg
Val Val Ser Val Leu Thr Val Leu His Gln Asp 420 425 430tgg ctg aat
ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc ctc 1344Trp Leu Asn
Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu 435 440 445cca
gcc ccc atc gag aaa acc atc tcc aaa gcc aaa ggg cag ccc cga 1392Pro
Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg 450 455
460gaa cca cag gtg tac acc ctg ccc cca tcc cgg gat gag ctg acc aag
1440Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr
Lys465 470 475 480aac cag gtc agc ctg acc tgc ctg gtc aaa ggc ttc
tat ccc agc gac 1488Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe
Tyr Pro Ser Asp 485 490 495atc gcc gtg gag tgg gag agc aat ggg cag
ccg gag aac aac tac aag 1536Ile Ala Val Glu Trp Glu Ser Asn Gly Gln
Pro Glu Asn Asn Tyr Lys 500 505 510acc acg cct ccc gtg ctg gac tcc
gac ggc tcc ttc ttc ctc tac agc 1584Thr Thr Pro Pro Val Leu Asp Ser
Asp Gly Ser Phe Phe Leu Tyr Ser 515 520 525aag ctc acc gtg gac aag
agc agg tgg cag cag ggg aac gtc ttc tca 1632Lys Leu Thr Val Asp Lys
Ser Arg Trp Gln Gln Gly Asn Val Phe Ser 530 535 540tgc tcc gtg atg
cat gag gct ctg cac aac cac tac acg cag aag agc 1680Cys Ser Val Met
His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser545 550 555 560ctc
tcc ctg tct ccg ggt aaa tga 1704Leu Ser Leu Ser Pro Gly Lys
5652567PRTHomo sapiens 2Met Val Ser Tyr Trp Asp Thr Gly Val Leu Leu
Cys Ala Leu Leu Ser 1 5 10 15Cys Leu Leu Leu Thr Gly Ser Ser Ser
Gly Ser Lys Leu Lys Asp Pro 20 25 30Glu Leu Ser Leu Lys Gly Thr Gln
His Ile Met Gln Ala Gly Gln Thr 35 40 45Leu His Leu Gln Cys Arg Gly
Glu Ala Ala His Lys Trp Ser Leu Pro 50 55 60Glu Met Val Ser Lys Glu
Ser Glu Arg Leu Ser Ile Thr Lys Ser Ala65 70 75 80Cys Gly Arg Asn
Gly Lys Gln Phe Cys Ser Thr Leu Thr Leu Asn Thr 85 90 95Ala Gln Ala
Asn His Thr Gly Phe Tyr Ser Cys Lys Tyr Leu Ala Val 100 105 110Pro
Thr Ser Lys Lys Lys Glu Thr Glu Ser Ala Ile Tyr Ile Phe Ile 115 120
125Ser Asp Thr Gly Arg Pro Phe Val Glu Met Tyr Ser Glu Ile Pro Glu
130 135 140Ile Ile His Met Thr Glu Gly Arg Glu Leu Val Ile Pro Cys
Arg Val145 150 155 160Thr Ser Pro Asn Ile Thr Val Thr Leu Lys Lys
Phe Pro Leu Asp Thr 165 170 175Leu Ile Pro Asp Gly Lys Arg Ile Ile
Trp Asp Ser Arg Lys Gly Phe 180 185 190Ile Ile Ser Asn Ala Thr Tyr
Lys Glu Ile Gly Leu Leu Thr Cys Glu 195 200 205Ala Thr Val Asn Gly
His Leu Tyr Lys Thr Asn Tyr Leu Thr His Arg 210 215 220Gln Thr Asn
Thr Ile Ile Asp Val Gln Ile Ser Thr Pro Arg Pro Val225 230 235
240Lys Leu Leu Arg Gly His Thr Leu Val Leu Asn Cys Thr Ala Thr Thr
245 250 255Pro Leu Asn Thr Arg Val Gln Met Thr Trp Ser Tyr Pro Asp
Glu Lys 260 265 270Asn Lys Arg Ala Ser Val Arg Arg Arg Ile Asp Gln
Ser Asn Ser His 275 280 285Ala Asn Ile Phe Tyr Ser Val Leu Thr Ile
Asp Lys Met Gln Asn Lys 290 295 300Asp Lys Gly Leu Tyr Thr Cys Arg
Val Arg Ser Gly Pro Ser Phe Lys305 310 315 320Ser Val Asn Thr Ser
Val His Ile Tyr Asp Lys Ala Gly Pro Gly Glu 325 330 335Pro Lys Ser
Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro 340 345 350Glu
Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys 355 360
365Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val
370 375 380Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr
Val Asp385 390 395 400Gly Val Glu Val His Asn Ala Lys Thr Lys Pro
Arg Glu Glu Gln Tyr 405 410 415Asn Ser Thr Tyr Arg Val Val Ser Val
Leu Thr Val Leu His Gln Asp 420 425 430Trp Leu Asn Gly Lys Glu Tyr
Lys Cys Lys Val Ser Asn Lys Ala Leu 435 440 445Pro Ala Pro Ile Glu
Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg 450 455 460Glu Pro Gln
Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys465 470 475
480Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp
485 490 495Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn
Tyr Lys 500 505 510Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe
Phe Leu Tyr Ser 515 520 525Lys Leu Thr Val Asp Lys Ser Arg Trp Gln
Gln Gly Asn Val Phe Ser 530 535 540Cys Ser Val Met His Glu Ala Leu
His Asn His Tyr Thr Gln Lys Ser545 550 555 560Leu Ser Leu Ser Pro
Gly Lys 56531674DNAHomo sapiensCDS(1)...(1671) 3atg gtc agc tac tgg
gac acc ggg gtc ctg ctg tgc gcg ctg ctc agc 48Met Val Ser Tyr Trp
Asp Thr Gly Val Leu Leu Cys Ala Leu Leu Ser 1 5 10 15tgt ctg ctt
ctc aca gga tct agt tca ggt tca aaa tta aaa gat cct 96Cys Leu Leu
Leu Thr Gly Ser Ser Ser Gly Ser Lys Leu Lys Asp Pro 20 25 30gaa ctg
agt tta aaa ggc acc cag cac atc atg caa gca ggc cag aca 144Glu Leu
Ser Leu Lys Gly Thr Gln His Ile Met Gln Ala Gly Gln Thr 35 40 45ctg
cat ctc caa tgc agg ggg gaa gca gcc cat aaa tgg tct ttg cct 192Leu
His Leu Gln Cys Arg Gly Glu Ala Ala His Lys Trp Ser Leu Pro 50 55
60gaa atg gtg agt aag gaa agc gaa agg ctg agc ata act aaa tct gcc
240Glu Met Val Ser Lys Glu Ser Glu Arg Leu Ser Ile Thr Lys Ser Ala
65 70 75 80tgt gga aga aat ggc aaa caa ttc tgc agt act tta acc ttg
aac aca 288Cys Gly Arg Asn Gly Lys Gln Phe Cys Ser Thr Leu Thr Leu
Asn Thr 85 90 95gct caa gca aac cac act ggc ttc tac agc tgc aaa tat
cta gct gta 336Ala Gln Ala Asn His Thr Gly Phe Tyr Ser Cys Lys Tyr
Leu Ala Val 100 105 110cct act tca aag aag aag gaa aca gaa tct gca
atc tat ata ttt att 384Pro Thr Ser Lys Lys Lys Glu Thr Glu Ser Ala
Ile Tyr Ile Phe Ile 115 120 125agt gat aca ggt aga cct ttc gta gag
atg tac agt gaa atc ccc gaa 432Ser Asp Thr Gly Arg Pro Phe Val Glu
Met Tyr Ser Glu Ile Pro Glu 130 135 140att ata cac atg act gaa gga
agg gag ctc gtc att ccc tgc cgg gtt 480Ile Ile His Met Thr Glu Gly
Arg Glu Leu Val Ile Pro Cys Arg Val145 150 155 160acg tca cct aac
atc act gtt act tta aaa aag ttt cca ctt gac act 528Thr Ser Pro Asn
Ile Thr Val Thr Leu Lys Lys Phe Pro Leu Asp Thr 165 170 175ttg atc
cct gat gga aaa cgc ata atc tgg gac agt aga aag ggc ttc 576Leu Ile
Pro Asp Gly Lys Arg Ile Ile Trp Asp Ser Arg Lys Gly Phe 180 185
190atc ata tca aat gca acg tac aaa gaa ata ggg ctt ctg acc tgt gaa
624Ile Ile Ser Asn Ala Thr Tyr Lys Glu Ile Gly Leu Leu Thr Cys Glu
195 200 205gca aca gtc aat ggg cat ttg tat aag aca aac tat ctc aca
cat cga 672Ala Thr Val Asn Gly His Leu Tyr Lys Thr Asn Tyr Leu Thr
His Arg 210 215 220caa acc aat aca atc ata gat gtc caa ata agc aca
cca cgc cca gtc 720Gln Thr Asn Thr Ile Ile Asp Val Gln Ile Ser Thr
Pro Arg Pro Val225 230 235 240aaa tta ctt aga ggc cat act ctt gtc
ctc aat tgt act gct acc act 768Lys Leu Leu Arg Gly His Thr Leu Val
Leu Asn Cys Thr Ala Thr Thr 245 250 255ccc ttg aac acg aga gtt caa
atg acc tgg agt tac cct gat gaa att 816Pro Leu Asn Thr Arg Val Gln
Met Thr Trp Ser Tyr Pro Asp Glu Ile 260 265 270gac caa agc aat tcc
cat gcc aac ata ttc tac agt gtt ctt act att 864Asp Gln Ser Asn Ser
His Ala Asn Ile Phe Tyr Ser Val Leu Thr Ile 275 280 285gac aaa atg
cag aac aaa gac aaa gga ctt tat act tgt cgt gta agg 912Asp Lys Met
Gln Asn Lys Asp Lys Gly Leu Tyr Thr Cys Arg Val Arg 290 295 300agt
gga cca tca ttc aaa tct gtt aac acc tca gtg cat ata tat gat 960Ser
Gly Pro Ser Phe Lys Ser Val Asn Thr Ser Val His Ile Tyr Asp305 310
315 320aaa gca ggc ccg ggc gag ccc aaa tct tgt gac aaa act cac aca
tgc 1008Lys Ala Gly Pro Gly Glu Pro Lys Ser Cys Asp Lys Thr His Thr
Cys 325 330 335cca ccg tgc cca gca cct gaa ctc ctg ggg gga ccg tca
gtc ttc ctc 1056Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser
Val Phe Leu 340 345 350ttc ccc cca aaa ccc aag gac acc ctc atg atc
tcc cgg acc cct gag 1104Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile
Ser Arg Thr Pro Glu 355 360 365gtc aca tgc gtg gtg gtg gac gtg agc
cac gaa gac cct gag gtc aag 1152Val Thr Cys Val Val Val Asp Val Ser
His Glu Asp Pro Glu Val Lys 370 375 380ttc aac tgg tac gtg gac ggc
gtg gag gtg cat aat gcc aag aca aag 1200Phe Asn Trp Tyr Val Asp Gly
Val Glu Val His Asn Ala Lys Thr Lys385 390 395 400ccg cgg gag gag
cag tac aac agc acg tac cgt gtg gtc agc gtc ctc 1248Pro Arg Glu Glu
Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu 405 410 415acc gtc
ctg cac cag gac tgg ctg aat ggc aag gag tac aag tgc aag 1296Thr Val
Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 420 425
430gtc tcc aac aaa gcc ctc cca gcc ccc atc gag aaa acc atc tcc aaa
1344Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys
435 440 445gcc aaa ggg cag ccc cga gaa cca cag gtg tac acc ctg ccc
cca tcc 1392Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro
Pro Ser 450 455 460cgg gat gag ctg acc aag aac cag gtc agc ctg acc
tgc ctg gtc aaa 1440Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr
Cys Leu Val Lys465 470 475 480ggc ttc tat ccc agc gac atc gcc gtg
gag tgg gag agc aat ggg cag 1488Gly Phe Tyr Pro Ser Asp Ile Ala Val
Glu Trp Glu Ser Asn Gly Gln 485 490 495ccg gag aac aac tac aag acc
acg cct ccc gtg ctg gac tcc gac ggc 1536Pro Glu Asn Asn Tyr Lys Thr
Thr Pro Pro Val Leu Asp Ser Asp Gly 500 505 510tcc ttc ttc ctc tac
agc aag ctc acc gtg gac aag agc agg tgg cag 1584Ser Phe Phe Leu Tyr
Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln 515 520 525cag ggg aac
gtc ttc tca tgc tcc gtg atg cat gag gct ctg cac aac 1632Gln Gly Asn
Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 530 535 540cac
tac acg cag aag agc ctc tcc ctg tct ccg ggt aaa tga 1674His Tyr Thr
Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys545 550 5554557PRTHomo
sapiens 4Met Val Ser Tyr Trp Asp Thr Gly Val Leu Leu Cys Ala Leu
Leu Ser 1 5 10 15Cys Leu Leu Leu Thr Gly Ser Ser Ser Gly Ser Lys
Leu Lys Asp Pro 20 25 30Glu Leu Ser Leu Lys Gly Thr Gln His Ile Met
Gln Ala Gly Gln Thr 35 40 45Leu His Leu Gln Cys Arg Gly Glu Ala Ala
His Lys Trp Ser Leu Pro 50 55 60Glu Met Val Ser Lys Glu Ser Glu Arg
Leu Ser Ile Thr Lys Ser Ala65 70 75 80Cys Gly Arg Asn Gly
Lys Gln Phe Cys Ser Thr Leu Thr Leu Asn Thr 85 90 95Ala Gln Ala Asn
His Thr Gly Phe Tyr Ser Cys Lys Tyr Leu Ala Val 100 105 110Pro Thr
Ser Lys Lys Lys Glu Thr Glu Ser Ala Ile Tyr Ile Phe Ile 115 120
125Ser Asp Thr Gly Arg Pro Phe Val Glu Met Tyr Ser Glu Ile Pro Glu
130 135 140Ile Ile His Met Thr Glu Gly Arg Glu Leu Val Ile Pro Cys
Arg Val145 150 155 160Thr Ser Pro Asn Ile Thr Val Thr Leu Lys Lys
Phe Pro Leu Asp Thr 165 170 175Leu Ile Pro Asp Gly Lys Arg Ile Ile
Trp Asp Ser Arg Lys Gly Phe 180 185 190Ile Ile Ser Asn Ala Thr Tyr
Lys Glu Ile Gly Leu Leu Thr Cys Glu 195 200 205Ala Thr Val Asn Gly
His Leu Tyr Lys Thr Asn Tyr Leu Thr His Arg 210 215 220Gln Thr Asn
Thr Ile Ile Asp Val Gln Ile Ser Thr Pro Arg Pro Val225 230 235
240Lys Leu Leu Arg Gly His Thr Leu Val Leu Asn Cys Thr Ala Thr Thr
245 250 255Pro Leu Asn Thr Arg Val Gln Met Thr Trp Ser Tyr Pro Asp
Glu Ile 260 265 270Asp Gln Ser Asn Ser His Ala Asn Ile Phe Tyr Ser
Val Leu Thr Ile 275 280 285Asp Lys Met Gln Asn Lys Asp Lys Gly Leu
Tyr Thr Cys Arg Val Arg 290 295 300Ser Gly Pro Ser Phe Lys Ser Val
Asn Thr Ser Val His Ile Tyr Asp305 310 315 320Lys Ala Gly Pro Gly
Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys 325 330 335Pro Pro Cys
Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu 340 345 350Phe
Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu 355 360
365Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys
370 375 380Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys
Thr Lys385 390 395 400Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg
Val Val Ser Val Leu 405 410 415Thr Val Leu His Gln Asp Trp Leu Asn
Gly Lys Glu Tyr Lys Cys Lys 420 425 430Val Ser Asn Lys Ala Leu Pro
Ala Pro Ile Glu Lys Thr Ile Ser Lys 435 440 445Ala Lys Gly Gln Pro
Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser 450 455 460Arg Asp Glu
Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys465 470 475
480Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln
485 490 495Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser
Asp Gly 500 505 510Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys
Ser Arg Trp Gln 515 520 525Gln Gly Asn Val Phe Ser Cys Ser Val Met
His Glu Ala Leu His Asn 530 535 540His Tyr Thr Gln Lys Ser Leu Ser
Leu Ser Pro Gly Lys545 550 55551359DNAHomo sapiensCDS(1)...(1356)
5atg gtc agc tac tgg gac acc ggg gtc ctg ctg tgc gcg ctg ctc agc
48Met Val Ser Tyr Trp Asp Thr Gly Val Leu Leu Cys Ala Leu Leu Ser 1
5 10 15tgt ctg ctt ctc aca gga tct agt tcc gga ggt aga cct ttc gta
gag 96Cys Leu Leu Leu Thr Gly Ser Ser Ser Gly Gly Arg Pro Phe Val
Glu 20 25 30atg tac agt gaa atc ccc gaa att ata cac atg act gaa gga
agg gag 144Met Tyr Ser Glu Ile Pro Glu Ile Ile His Met Thr Glu Gly
Arg Glu 35 40 45ctc gtc att ccc tgc cgg gtt acg tca cct aac atc act
gtt act tta 192Leu Val Ile Pro Cys Arg Val Thr Ser Pro Asn Ile Thr
Val Thr Leu 50 55 60aaa aag ttt cca ctt gac act ttg atc cct gat gga
aaa cgc ata atc 240Lys Lys Phe Pro Leu Asp Thr Leu Ile Pro Asp Gly
Lys Arg Ile Ile 65 70 75 80tgg gac agt aga aag ggc ttc atc ata tca
aat gca acg tac aaa gaa 288Trp Asp Ser Arg Lys Gly Phe Ile Ile Ser
Asn Ala Thr Tyr Lys Glu 85 90 95ata ggg ctt ctg acc tgt gaa gca aca
gtc aat ggg cat ttg tat aag 336Ile Gly Leu Leu Thr Cys Glu Ala Thr
Val Asn Gly His Leu Tyr Lys 100 105 110aca aac tat ctc aca cat cga
caa acc aat aca atc ata gat gtc caa 384Thr Asn Tyr Leu Thr His Arg
Gln Thr Asn Thr Ile Ile Asp Val Gln 115 120 125ata agc aca cca cgc
cca gtc aaa tta ctt aga ggc cat act ctt gtc 432Ile Ser Thr Pro Arg
Pro Val Lys Leu Leu Arg Gly His Thr Leu Val 130 135 140ctc aat tgt
act gct acc act ccc ttg aac acg aga gtt caa atg acc 480Leu Asn Cys
Thr Ala Thr Thr Pro Leu Asn Thr Arg Val Gln Met Thr145 150 155
160tgg agt tac cct gat gaa att gac caa agc aat tcc cat gcc aac ata
528Trp Ser Tyr Pro Asp Glu Ile Asp Gln Ser Asn Ser His Ala Asn Ile
165 170 175ttc tac agt gtt ctt act att gac aaa atg cag aac aaa gac
aaa gga 576Phe Tyr Ser Val Leu Thr Ile Asp Lys Met Gln Asn Lys Asp
Lys Gly 180 185 190ctt tat act tgt cgt gta agg agt gga cca tca ttc
aaa tct gtt aac 624Leu Tyr Thr Cys Arg Val Arg Ser Gly Pro Ser Phe
Lys Ser Val Asn 195 200 205acc tca gtg cat ata tat gat aaa gca ggc
ccg ggc gag ccc aaa tct 672Thr Ser Val His Ile Tyr Asp Lys Ala Gly
Pro Gly Glu Pro Lys Ser 210 215 220tgt gac aaa act cac aca tgc cca
ccg tgc cca gca cct gaa ctc ctg 720Cys Asp Lys Thr His Thr Cys Pro
Pro Cys Pro Ala Pro Glu Leu Leu225 230 235 240ggg gga ccg tca gtc
ttc ctc ttc ccc cca aaa ccc aag gac acc ctc 768Gly Gly Pro Ser Val
Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 245 250 255atg atc tcc
cgg acc cct gag gtc aca tgc gtg gtg gtg gac gtg agc 816Met Ile Ser
Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 260 265 270cac
gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 864His
Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 275 280
285gtg cat aat gcc aag aca aag ccg cgg gag gag cag tac aac agc acg
912Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr
290 295 300tac cgt gtg gtc agc gtc ctc acc gtc ctg cac cag gac tgg
ctg aat 960Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp
Leu Asn305 310 315 320ggc aag gag tac aag tgc aag gtc tcc aac aaa
gcc ctc cca gcc ccc 1008Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys
Ala Leu Pro Ala Pro 325 330 335atc gag aaa acc atc tcc aaa gcc aaa
ggg cag ccc cga gaa cca cag 1056Ile Glu Lys Thr Ile Ser Lys Ala Lys
Gly Gln Pro Arg Glu Pro Gln 340 345 350gtg tac acc ctg ccc cca tcc
cgg gat gag ctg acc aag aac cag gtc 1104Val Tyr Thr Leu Pro Pro Ser
Arg Asp Glu Leu Thr Lys Asn Gln Val 355 360 365agc ctg acc tgc ctg
gtc aaa ggc ttc tat ccc agc gac atc gcc gtg 1152Ser Leu Thr Cys Leu
Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val 370 375 380gag tgg gag
agc aat ggg cag ccg gag aac aac tac aag acc acg cct 1200Glu Trp Glu
Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro385 390 395
400ccc gtg ctg gac tcc gac ggc tcc ttc ttc ctc tac agc aag ctc acc
1248Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr
405 410 415gtg gac aag agc agg tgg cag cag ggg aac gtc ttc tca tgc
tcc gtg 1296Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys
Ser Val 420 425 430atg cat gag gct ctg cac aac cac tac acg cag aag
agc ctc tcc ctg 1344Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys
Ser Leu Ser Leu 435 440 445tct ccg ggt aaa tga 1359Ser Pro Gly Lys
4506452PRTHomo sapiens 6Met Val Ser Tyr Trp Asp Thr Gly Val Leu Leu
Cys Ala Leu Leu Ser 1 5 10 15Cys Leu Leu Leu Thr Gly Ser Ser Ser
Gly Gly Arg Pro Phe Val Glu 20 25 30Met Tyr Ser Glu Ile Pro Glu Ile
Ile His Met Thr Glu Gly Arg Glu 35 40 45Leu Val Ile Pro Cys Arg Val
Thr Ser Pro Asn Ile Thr Val Thr Leu 50 55 60Lys Lys Phe Pro Leu Asp
Thr Leu Ile Pro Asp Gly Lys Arg Ile Ile65 70 75 80Trp Asp Ser Arg
Lys Gly Phe Ile Ile Ser Asn Ala Thr Tyr Lys Glu 85 90 95Ile Gly Leu
Leu Thr Cys Glu Ala Thr Val Asn Gly His Leu Tyr Lys 100 105 110Thr
Asn Tyr Leu Thr His Arg Gln Thr Asn Thr Ile Ile Asp Val Gln 115 120
125Ile Ser Thr Pro Arg Pro Val Lys Leu Leu Arg Gly His Thr Leu Val
130 135 140Leu Asn Cys Thr Ala Thr Thr Pro Leu Asn Thr Arg Val Gln
Met Thr145 150 155 160Trp Ser Tyr Pro Asp Glu Ile Asp Gln Ser Asn
Ser His Ala Asn Ile 165 170 175Phe Tyr Ser Val Leu Thr Ile Asp Lys
Met Gln Asn Lys Asp Lys Gly 180 185 190Leu Tyr Thr Cys Arg Val Arg
Ser Gly Pro Ser Phe Lys Ser Val Asn 195 200 205Thr Ser Val His Ile
Tyr Asp Lys Ala Gly Pro Gly Glu Pro Lys Ser 210 215 220Cys Asp Lys
Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu225 230 235
240Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu
245 250 255Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp
Val Ser 260 265 270His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val
Asp Gly Val Glu 275 280 285Val His Asn Ala Lys Thr Lys Pro Arg Glu
Glu Gln Tyr Asn Ser Thr 290 295 300Tyr Arg Val Val Ser Val Leu Thr
Val Leu His Gln Asp Trp Leu Asn305 310 315 320Gly Lys Glu Tyr Lys
Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 325 330 335Ile Glu Lys
Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln 340 345 350Val
Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val 355 360
365Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val
370 375 380Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr
Thr Pro385 390 395 400Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu
Tyr Ser Lys Leu Thr 405 410 415Val Asp Lys Ser Arg Trp Gln Gln Gly
Asn Val Phe Ser Cys Ser Val 420 425 430Met His Glu Ala Leu His Asn
His Tyr Thr Gln Lys Ser Leu Ser Leu 435 440 445Ser Pro Gly Lys
45071389DNAHomo sapiensCDS(1)...(1386) 7atg gtc agc tac tgg gac acc
ggg gtc ctg ctg tgc gcg ctg ctc agc 48Met Val Ser Tyr Trp Asp Thr
Gly Val Leu Leu Cys Ala Leu Leu Ser 1 5 10 15tgt ctg ctt ctc aca
gga tct agt tcc gga ggt aga cct ttc gta gag 96Cys Leu Leu Leu Thr
Gly Ser Ser Ser Gly Gly Arg Pro Phe Val Glu 20 25 30atg tac agt gaa
atc ccc gaa att ata cac atg act gaa gga agg gag 144Met Tyr Ser Glu
Ile Pro Glu Ile Ile His Met Thr Glu Gly Arg Glu 35 40 45ctc gtc att
ccc tgc cgg gtt acg tca cct aac atc act gtt act tta 192Leu Val Ile
Pro Cys Arg Val Thr Ser Pro Asn Ile Thr Val Thr Leu 50 55 60aaa aag
ttt cca ctt gac act ttg atc cct gat gga aaa cgc ata atc 240Lys Lys
Phe Pro Leu Asp Thr Leu Ile Pro Asp Gly Lys Arg Ile Ile 65 70 75
80tgg gac agt aga aag ggc ttc atc ata tca aat gca acg tac aaa gaa
288Trp Asp Ser Arg Lys Gly Phe Ile Ile Ser Asn Ala Thr Tyr Lys Glu
85 90 95ata ggg ctt ctg acc tgt gaa gca aca gtc aat ggg cat ttg tat
aag 336Ile Gly Leu Leu Thr Cys Glu Ala Thr Val Asn Gly His Leu Tyr
Lys 100 105 110aca aac tat ctc aca cat cga caa acc aat aca atc ata
gat gtc caa 384Thr Asn Tyr Leu Thr His Arg Gln Thr Asn Thr Ile Ile
Asp Val Gln 115 120 125ata agc aca cca cgc cca gtc aaa tta ctt aga
ggc cat act ctt gtc 432Ile Ser Thr Pro Arg Pro Val Lys Leu Leu Arg
Gly His Thr Leu Val 130 135 140ctc aat tgt act gct acc act ccc ttg
aac acg aga gtt caa atg acc 480Leu Asn Cys Thr Ala Thr Thr Pro Leu
Asn Thr Arg Val Gln Met Thr145 150 155 160tgg agt tac cct gat gaa
aaa aat aag aga gct tcc gta agg cga cga 528Trp Ser Tyr Pro Asp Glu
Lys Asn Lys Arg Ala Ser Val Arg Arg Arg 165 170 175att gac caa agc
aat tcc cat gcc aac ata ttc tac agt gtt ctt act 576Ile Asp Gln Ser
Asn Ser His Ala Asn Ile Phe Tyr Ser Val Leu Thr 180 185 190att gac
aaa atg cag aac aaa gac aaa gga ctt tat act tgt cgt gta 624Ile Asp
Lys Met Gln Asn Lys Asp Lys Gly Leu Tyr Thr Cys Arg Val 195 200
205agg agt gga cca tca ttc aaa tct gtt aac acc tca gtg cat ata tat
672Arg Ser Gly Pro Ser Phe Lys Ser Val Asn Thr Ser Val His Ile Tyr
210 215 220gat aaa gca ggc ccg ggc gag ccc aaa tct tgt gac aaa act
cac aca 720Asp Lys Ala Gly Pro Gly Glu Pro Lys Ser Cys Asp Lys Thr
His Thr225 230 235 240tgc cca ccg tgc cca gca cct gaa ctc ctg ggg
gga ccg tca gtc ttc 768Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly
Gly Pro Ser Val Phe 245 250 255ctc ttc ccc cca aaa ccc aag gac acc
ctc atg atc tcc cgg acc cct 816Leu Phe Pro Pro Lys Pro Lys Asp Thr
Leu Met Ile Ser Arg Thr Pro 260 265 270gag gtc aca tgc gtg gtg gtg
gac gtg agc cac gaa gac cct gag gtc 864Glu Val Thr Cys Val Val Val
Asp Val Ser His Glu Asp Pro Glu Val 275 280 285aag ttc aac tgg tac
gtg gac ggc gtg gag gtg cat aat gcc aag aca 912Lys Phe Asn Trp Tyr
Val Asp Gly Val Glu Val His Asn Ala Lys Thr 290 295 300aag ccg cgg
gag gag cag tac aac agc acg tac cgt gtg gtc agc gtc 960Lys Pro Arg
Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val305 310 315
320ctc acc gtc ctg cac cag gac tgg ctg aat ggc aag gag tac aag tgc
1008Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys
325 330 335aag gtc tcc aac aaa gcc ctc cca gcc ccc atc gag aaa acc
atc tcc 1056Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr
Ile Ser 340 345 350aaa gcc aaa ggg cag ccc cga gaa cca cag gtg tac
acc ctg ccc cca 1104Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr
Thr Leu Pro Pro 355 360 365tcc cgg gat gag ctg acc aag aac cag gtc
agc ctg acc tgc ctg gtc 1152Ser Arg Asp Glu Leu Thr Lys Asn Gln Val
Ser Leu Thr Cys Leu Val 370 375 380aaa ggc ttc tat ccc agc gac atc
gcc gtg gag tgg gag agc aat ggg 1200Lys Gly Phe Tyr Pro Ser Asp Ile
Ala Val Glu Trp Glu Ser Asn Gly385 390 395 400cag ccg gag aac aac
tac aag acc acg cct ccc gtg ctg gac tcc gac 1248Gln Pro Glu Asn Asn
Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp 405 410 415ggc tcc ttc
ttc ctc tac agc aag ctc acc gtg gac aag agc agg tgg 1296Gly Ser Phe
Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp 420 425 430cag
cag ggg aac gtc ttc tca tgc tcc gtg atg cat gag gct ctg cac 1344Gln
Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His 435 440
445aac cac tac acg cag aag agc ctc tcc ctg tct ccg ggt aaa 1386Asn
His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 450 455 460tga
13898462PRTHomo sapiens 8Met Val Ser Tyr Trp Asp Thr Gly Val Leu
Leu Cys Ala Leu Leu Ser 1 5 10 15Cys Leu Leu Leu Thr Gly Ser Ser
Ser Gly Gly Arg Pro Phe Val Glu 20 25 30Met Tyr Ser Glu Ile Pro Glu
Ile Ile His Met Thr Glu Gly Arg Glu 35 40
45Leu Val Ile Pro Cys Arg Val Thr Ser Pro Asn Ile Thr Val Thr Leu
50 55 60Lys Lys Phe Pro Leu Asp Thr Leu Ile Pro Asp Gly Lys Arg Ile
Ile65 70 75 80Trp Asp Ser Arg Lys Gly Phe Ile Ile Ser Asn Ala Thr
Tyr Lys Glu 85 90 95Ile Gly Leu Leu Thr Cys Glu Ala Thr Val Asn Gly
His Leu Tyr Lys 100 105 110Thr Asn Tyr Leu Thr His Arg Gln Thr Asn
Thr Ile Ile Asp Val Gln 115 120 125Ile Ser Thr Pro Arg Pro Val Lys
Leu Leu Arg Gly His Thr Leu Val 130 135 140Leu Asn Cys Thr Ala Thr
Thr Pro Leu Asn Thr Arg Val Gln Met Thr145 150 155 160Trp Ser Tyr
Pro Asp Glu Lys Asn Lys Arg Ala Ser Val Arg Arg Arg 165 170 175Ile
Asp Gln Ser Asn Ser His Ala Asn Ile Phe Tyr Ser Val Leu Thr 180 185
190Ile Asp Lys Met Gln Asn Lys Asp Lys Gly Leu Tyr Thr Cys Arg Val
195 200 205Arg Ser Gly Pro Ser Phe Lys Ser Val Asn Thr Ser Val His
Ile Tyr 210 215 220Asp Lys Ala Gly Pro Gly Glu Pro Lys Ser Cys Asp
Lys Thr His Thr225 230 235 240Cys Pro Pro Cys Pro Ala Pro Glu Leu
Leu Gly Gly Pro Ser Val Phe 245 250 255Leu Phe Pro Pro Lys Pro Lys
Asp Thr Leu Met Ile Ser Arg Thr Pro 260 265 270Glu Val Thr Cys Val
Val Val Asp Val Ser His Glu Asp Pro Glu Val 275 280 285Lys Phe Asn
Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr 290 295 300Lys
Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val305 310
315 320Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys
Cys 325 330 335Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys
Thr Ile Ser 340 345 350Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val
Tyr Thr Leu Pro Pro 355 360 365Ser Arg Asp Glu Leu Thr Lys Asn Gln
Val Ser Leu Thr Cys Leu Val 370 375 380Lys Gly Phe Tyr Pro Ser Asp
Ile Ala Val Glu Trp Glu Ser Asn Gly385 390 395 400Gln Pro Glu Asn
Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp 405 410 415Gly Ser
Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp 420 425
430Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His
435 440 445Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys
450 455 46091704DNAHomo sapiensCDS(1)...(1701) 9atg gtc agc tac tgg
gac acc ggg gtc ctg ctg tgc gcg ctg ctc agc 48Met Val Ser Tyr Trp
Asp Thr Gly Val Leu Leu Cys Ala Leu Leu Ser 1 5 10 15tgt ctg ctt
ctc aca gga tct agt tca ggt tca aaa tta aaa gat cct 96Cys Leu Leu
Leu Thr Gly Ser Ser Ser Gly Ser Lys Leu Lys Asp Pro 20 25 30gaa ctg
agt tta aaa ggc acc cag cac atc atg caa gca ggc cag aca 144Glu Leu
Ser Leu Lys Gly Thr Gln His Ile Met Gln Ala Gly Gln Thr 35 40 45ctg
cat ctc caa tgc agg ggg gaa gca gcc cat aaa tgg tct ttg cct 192Leu
His Leu Gln Cys Arg Gly Glu Ala Ala His Lys Trp Ser Leu Pro 50 55
60gaa atg gtg agt aag gaa agc gaa agg ctg agc ata act aaa tct gcc
240Glu Met Val Ser Lys Glu Ser Glu Arg Leu Ser Ile Thr Lys Ser Ala
65 70 75 80tgt gga aga aat ggc aaa caa ttc tgc agt act tta acc ttg
aac aca 288Cys Gly Arg Asn Gly Lys Gln Phe Cys Ser Thr Leu Thr Leu
Asn Thr 85 90 95gct caa gca aac cac act ggc ttc tac agc tgc aaa tat
cta gct gta 336Ala Gln Ala Asn His Thr Gly Phe Tyr Ser Cys Lys Tyr
Leu Ala Val 100 105 110cct act tca aag aag aag gaa aca gaa tct gca
atc tat ata ttt att 384Pro Thr Ser Lys Lys Lys Glu Thr Glu Ser Ala
Ile Tyr Ile Phe Ile 115 120 125agt gat aca ggt aga cct ttc gta gag
atg tac agt gaa atc ccc gaa 432Ser Asp Thr Gly Arg Pro Phe Val Glu
Met Tyr Ser Glu Ile Pro Glu 130 135 140att ata cac atg act gaa gga
agg gag ctc gtc att ccc tgc cgg gtt 480Ile Ile His Met Thr Glu Gly
Arg Glu Leu Val Ile Pro Cys Arg Val145 150 155 160acg tca cct aac
atc act gtt act tta aaa aag ttt cca ctt gac act 528Thr Ser Pro Asn
Ile Thr Val Thr Leu Lys Lys Phe Pro Leu Asp Thr 165 170 175ttg atc
cct gat gga aaa cgc ata atc tgg gac agt aga aag ggc ttc 576Leu Ile
Pro Asp Gly Lys Arg Ile Ile Trp Asp Ser Arg Lys Gly Phe 180 185
190atc ata tca aat gca acg tac aaa gaa ata ggg ctt ctg acc tgt gaa
624Ile Ile Ser Asn Ala Thr Tyr Lys Glu Ile Gly Leu Leu Thr Cys Glu
195 200 205gca aca gtc aat ggg cat ttg tat aag aca aac tat ctc aca
cat cga 672Ala Thr Val Asn Gly His Leu Tyr Lys Thr Asn Tyr Leu Thr
His Arg 210 215 220caa acc aat aca atc ata gat gtc caa ata agc aca
cca cgc cca gtc 720Gln Thr Asn Thr Ile Ile Asp Val Gln Ile Ser Thr
Pro Arg Pro Val225 230 235 240aaa tta ctt aga ggc cat act ctt gtc
ctc aat tgt act gct acc act 768Lys Leu Leu Arg Gly His Thr Leu Val
Leu Asn Cys Thr Ala Thr Thr 245 250 255ccc ttg aac acg aga gtt caa
atg acc tgg agt tac cct gat gaa aaa 816Pro Leu Asn Thr Arg Val Gln
Met Thr Trp Ser Tyr Pro Asp Glu Lys 260 265 270aat aag aac gct tcc
gta agg cga cga att gac caa agc aat tcc cat 864Asn Lys Asn Ala Ser
Val Arg Arg Arg Ile Asp Gln Ser Asn Ser His 275 280 285gcc aac ata
ttc tac agt gtt ctt act att gac aaa atg cag aac aaa 912Ala Asn Ile
Phe Tyr Ser Val Leu Thr Ile Asp Lys Met Gln Asn Lys 290 295 300gac
aaa gga ctt tat act tgt cgt gta agg agt gga cca tca ttc aaa 960Asp
Lys Gly Leu Tyr Thr Cys Arg Val Arg Ser Gly Pro Ser Phe Lys305 310
315 320tct gtt aac acc tca gtg cat ata tat gat aaa gca ggc ccg ggc
gag 1008Ser Val Asn Thr Ser Val His Ile Tyr Asp Lys Ala Gly Pro Gly
Glu 325 330 335ccc aaa tct tgt gac aaa act cac aca tgc cca ccg tgc
cca gca cct 1056Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys
Pro Ala Pro 340 345 350gaa ctc ctg ggg gga ccg tca gtc ttc ctc ttc
ccc cca aaa ccc aag 1104Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe
Pro Pro Lys Pro Lys 355 360 365gac acc ctc atg atc tcc cgg acc cct
gag gtc aca tgc gtg gtg gtg 1152Asp Thr Leu Met Ile Ser Arg Thr Pro
Glu Val Thr Cys Val Val Val 370 375 380gac gtg agc cac gaa gac cct
gag gtc aag ttc aac tgg tac gtg gac 1200Asp Val Ser His Glu Asp Pro
Glu Val Lys Phe Asn Trp Tyr Val Asp385 390 395 400ggc gtg gag gtg
cat aat gcc aag aca aag ccg cgg gag gag cag tac 1248Gly Val Glu Val
His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr 405 410 415aac agc
acg tac cgt gtg gtc agc gtc ctc acc gtc ctg cac cag gac 1296Asn Ser
Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp 420 425
430tgg ctg aat ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc ctc
1344Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu
435 440 445cca gcc ccc atc gag aaa acc atc tcc aaa gcc aaa ggg cag
ccc cga 1392Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln
Pro Arg 450 455 460gaa cca cag gtg tac acc ctg ccc cca tcc cgg gat
gag ctg acc aag 1440Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp
Glu Leu Thr Lys465 470 475 480aac cag gtc agc ctg acc tgc ctg gtc
aaa ggc ttc tat ccc agc gac 1488Asn Gln Val Ser Leu Thr Cys Leu Val
Lys Gly Phe Tyr Pro Ser Asp 485 490 495atc gcc gtg gag tgg gag agc
aat ggg cag ccg gag aac aac tac aag 1536Ile Ala Val Glu Trp Glu Ser
Asn Gly Gln Pro Glu Asn Asn Tyr Lys 500 505 510acc acg cct ccc gtg
ctg gac tcc gac ggc tcc ttc ttc ctc tac agc 1584Thr Thr Pro Pro Val
Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser 515 520 525aag ctc acc
gtg gac aag agc agg tgg cag cag ggg aac gtc ttc tca 1632Lys Leu Thr
Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser 530 535 540tgc
tcc gtg atg cat gag gct ctg cac aac cac tac acg cag aag agc 1680Cys
Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser545 550
555 560ctc tcc ctg tct ccg ggt aaa tga 1704Leu Ser Leu Ser Pro Gly
Lys 56510567PRTHomo sapiens 10Met Val Ser Tyr Trp Asp Thr Gly Val
Leu Leu Cys Ala Leu Leu Ser 1 5 10 15Cys Leu Leu Leu Thr Gly Ser
Ser Ser Gly Ser Lys Leu Lys Asp Pro 20 25 30Glu Leu Ser Leu Lys Gly
Thr Gln His Ile Met Gln Ala Gly Gln Thr 35 40 45Leu His Leu Gln Cys
Arg Gly Glu Ala Ala His Lys Trp Ser Leu Pro 50 55 60Glu Met Val Ser
Lys Glu Ser Glu Arg Leu Ser Ile Thr Lys Ser Ala65 70 75 80Cys Gly
Arg Asn Gly Lys Gln Phe Cys Ser Thr Leu Thr Leu Asn Thr 85 90 95Ala
Gln Ala Asn His Thr Gly Phe Tyr Ser Cys Lys Tyr Leu Ala Val 100 105
110Pro Thr Ser Lys Lys Lys Glu Thr Glu Ser Ala Ile Tyr Ile Phe Ile
115 120 125Ser Asp Thr Gly Arg Pro Phe Val Glu Met Tyr Ser Glu Ile
Pro Glu 130 135 140Ile Ile His Met Thr Glu Gly Arg Glu Leu Val Ile
Pro Cys Arg Val145 150 155 160Thr Ser Pro Asn Ile Thr Val Thr Leu
Lys Lys Phe Pro Leu Asp Thr 165 170 175Leu Ile Pro Asp Gly Lys Arg
Ile Ile Trp Asp Ser Arg Lys Gly Phe 180 185 190Ile Ile Ser Asn Ala
Thr Tyr Lys Glu Ile Gly Leu Leu Thr Cys Glu 195 200 205Ala Thr Val
Asn Gly His Leu Tyr Lys Thr Asn Tyr Leu Thr His Arg 210 215 220Gln
Thr Asn Thr Ile Ile Asp Val Gln Ile Ser Thr Pro Arg Pro Val225 230
235 240Lys Leu Leu Arg Gly His Thr Leu Val Leu Asn Cys Thr Ala Thr
Thr 245 250 255Pro Leu Asn Thr Arg Val Gln Met Thr Trp Ser Tyr Pro
Asp Glu Lys 260 265 270Asn Lys Asn Ala Ser Val Arg Arg Arg Ile Asp
Gln Ser Asn Ser His 275 280 285Ala Asn Ile Phe Tyr Ser Val Leu Thr
Ile Asp Lys Met Gln Asn Lys 290 295 300Asp Lys Gly Leu Tyr Thr Cys
Arg Val Arg Ser Gly Pro Ser Phe Lys305 310 315 320Ser Val Asn Thr
Ser Val His Ile Tyr Asp Lys Ala Gly Pro Gly Glu 325 330 335Pro Lys
Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro 340 345
350Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys
355 360 365Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val
Val Val 370 375 380Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn
Trp Tyr Val Asp385 390 395 400Gly Val Glu Val His Asn Ala Lys Thr
Lys Pro Arg Glu Glu Gln Tyr 405 410 415Asn Ser Thr Tyr Arg Val Val
Ser Val Leu Thr Val Leu His Gln Asp 420 425 430Trp Leu Asn Gly Lys
Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu 435 440 445Pro Ala Pro
Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg 450 455 460Glu
Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys465 470
475 480Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser
Asp 485 490 495Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn
Asn Tyr Lys 500 505 510Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser
Phe Phe Leu Tyr Ser 515 520 525Lys Leu Thr Val Asp Lys Ser Arg Trp
Gln Gln Gly Asn Val Phe Ser 530 535 540Cys Ser Val Met His Glu Ala
Leu His Asn His Tyr Thr Gln Lys Ser545 550 555 560Leu Ser Leu Ser
Pro Gly Lys 565111453DNAHomo sapiensCDS(69)...(1442) 11aagcttgggc
tgcaggtcga tcgactctag aggatcgatc cccgggcgag ctcgaattcg 60caaccacc
atg gtc agc tac tgg gac acc ggg gtc ctg ctg tgc gcg ctg 110 Met Val
Ser Tyr Trp Asp Thr Gly Val Leu Leu Cys Ala Leu 1 5 10ctc agc tgt
ctg ctt ctc aca gga tct agt tcc gga ggt aga cct ttc 158Leu Ser Cys
Leu Leu Leu Thr Gly Ser Ser Ser Gly Gly Arg Pro Phe 15 20 25 30gta
gag atg tac agt gaa atc ccc gaa att ata cac atg act gaa gga 206Val
Glu Met Tyr Ser Glu Ile Pro Glu Ile Ile His Met Thr Glu Gly 35 40
45agg gag ctc gtc att ccc tgc cgg gtt acg tca cct aac atc act gtt
254Arg Glu Leu Val Ile Pro Cys Arg Val Thr Ser Pro Asn Ile Thr Val
50 55 60act tta aaa aag ttt cca ctt gac act ttg atc cct gat gga aaa
cgc 302Thr Leu Lys Lys Phe Pro Leu Asp Thr Leu Ile Pro Asp Gly Lys
Arg 65 70 75ata atc tgg gac agt aga aag ggc ttc atc ata tca aat gca
acg tac 350Ile Ile Trp Asp Ser Arg Lys Gly Phe Ile Ile Ser Asn Ala
Thr Tyr 80 85 90aaa gaa ata ggg ctt ctg acc tgt gaa gca aca gtc aat
ggg cat ttg 398Lys Glu Ile Gly Leu Leu Thr Cys Glu Ala Thr Val Asn
Gly His Leu 95 100 105 110tat aag aca aac tat ctc aca cat cga caa
acc aat aca atc ata gat 446Tyr Lys Thr Asn Tyr Leu Thr His Arg Gln
Thr Asn Thr Ile Ile Asp 115 120 125gtg gtt ctg agt ccg tct cat gga
att gaa cta tct gtt gga gaa aag 494Val Val Leu Ser Pro Ser His Gly
Ile Glu Leu Ser Val Gly Glu Lys 130 135 140ctt gtc tta aat tgt aca
gca aga act gaa cta aat gtg ggg att gac 542Leu Val Leu Asn Cys Thr
Ala Arg Thr Glu Leu Asn Val Gly Ile Asp 145 150 155ttc aac tgg gaa
tac cct tct tcg aag cat cag cat aag aaa ctt gta 590Phe Asn Trp Glu
Tyr Pro Ser Ser Lys His Gln His Lys Lys Leu Val 160 165 170aac cga
gac cta aaa acc cag tct ggg agt gag atg aag aaa ttt ttg 638Asn Arg
Asp Leu Lys Thr Gln Ser Gly Ser Glu Met Lys Lys Phe Leu175 180 185
190agc acc tta act ata gat ggt gta acc cgg agt gac caa gga ttg tac
686Ser Thr Leu Thr Ile Asp Gly Val Thr Arg Ser Asp Gln Gly Leu Tyr
195 200 205acc tgt gca gca tcc agt ggg ctg atg acc aag aag aac agc
aca ttt 734Thr Cys Ala Ala Ser Ser Gly Leu Met Thr Lys Lys Asn Ser
Thr Phe 210 215 220gtc agg gtc cat gaa aag ggc ccg ggc gac aaa act
cac aca tgc cca 782Val Arg Val His Glu Lys Gly Pro Gly Asp Lys Thr
His Thr Cys Pro 225 230 235ccg tgc cca gca cct gaa ctc ctg ggg gga
ccg tca gtc ttc ctc ttc 830Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly
Pro Ser Val Phe Leu Phe 240 245 250ccc cca aaa ccc aag gac acc ctc
atg atc tcc cgg acc cct gag gtc 878Pro Pro Lys Pro Lys Asp Thr Leu
Met Ile Ser Arg Thr Pro Glu Val255 260 265 270aca tgc gtg gtg gtg
gac gtg agc cac gaa gac cct gag gtc aag ttc 926Thr Cys Val Val Val
Asp Val Ser His Glu Asp Pro Glu Val Lys Phe 275 280 285aac tgg tac
gtg gac ggc gtg gag gtg cat aat gcc aag aca aag ccg 974Asn Trp Tyr
Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro 290 295 300cgg
gag gag cag tac aac agc acg tac cgt gtg gtc agc gtc ctc acc 1022Arg
Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr 305 310
315gtc ctg cac cag gac tgg ctg aat ggc aag gag tac aag tgc aag gtc
1070Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val
320 325 330tcc aac aaa gcc ctc cca gcc ccc atc gag aaa acc atc tcc
aaa gcc 1118Ser Asn Lys Ala Leu
Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala335 340 345 350aaa ggg
cag ccc cga gaa cca cag gtg tac acc ctg ccc cca tcc cgg 1166Lys Gly
Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg 355 360
365gat gag ctg acc aag aac cag gtc agc ctg acc tgc ctg gtc aaa ggc
1214Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly
370 375 380ttc tat ccc agc gac atc gcc gtg gag tgg gag agc aat ggg
cag ccg 1262Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly
Gln Pro 385 390 395gag aac aac tac aag acc acg cct ccc gtg ctg gac
tcc gac ggc tcc 1310Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp
Ser Asp Gly Ser 400 405 410ttc ttc ctc tat agc aag ctc acc gtg gac
aag agc agg tgg cag cag 1358Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp
Lys Ser Arg Trp Gln Gln415 420 425 430ggg aac gtc ttc tca tgc tcc
gtg atg cat gag gct ctg cac aac cac 1406Gly Asn Val Phe Ser Cys Ser
Val Met His Glu Ala Leu His Asn His 435 440 445tac acg cag aag agc
ctc tcc ctg tct ccg ggt aaa tgagcggccg 1452Tyr Thr Gln Lys Ser Leu
Ser Leu Ser Pro Gly Lys 450 455c 145312458PRTHomo sapiens 12Met Val
Ser Tyr Trp Asp Thr Gly Val Leu Leu Cys Ala Leu Leu Ser 1 5 10
15Cys Leu Leu Leu Thr Gly Ser Ser Ser Gly Gly Arg Pro Phe Val Glu
20 25 30Met Tyr Ser Glu Ile Pro Glu Ile Ile His Met Thr Glu Gly Arg
Glu 35 40 45Leu Val Ile Pro Cys Arg Val Thr Ser Pro Asn Ile Thr Val
Thr Leu 50 55 60Lys Lys Phe Pro Leu Asp Thr Leu Ile Pro Asp Gly Lys
Arg Ile Ile65 70 75 80Trp Asp Ser Arg Lys Gly Phe Ile Ile Ser Asn
Ala Thr Tyr Lys Glu 85 90 95Ile Gly Leu Leu Thr Cys Glu Ala Thr Val
Asn Gly His Leu Tyr Lys 100 105 110Thr Asn Tyr Leu Thr His Arg Gln
Thr Asn Thr Ile Ile Asp Val Val 115 120 125Leu Ser Pro Ser His Gly
Ile Glu Leu Ser Val Gly Glu Lys Leu Val 130 135 140Leu Asn Cys Thr
Ala Arg Thr Glu Leu Asn Val Gly Ile Asp Phe Asn145 150 155 160Trp
Glu Tyr Pro Ser Ser Lys His Gln His Lys Lys Leu Val Asn Arg 165 170
175Asp Leu Lys Thr Gln Ser Gly Ser Glu Met Lys Lys Phe Leu Ser Thr
180 185 190Leu Thr Ile Asp Gly Val Thr Arg Ser Asp Gln Gly Leu Tyr
Thr Cys 195 200 205Ala Ala Ser Ser Gly Leu Met Thr Lys Lys Asn Ser
Thr Phe Val Arg 210 215 220Val His Glu Lys Gly Pro Gly Asp Lys Thr
His Thr Cys Pro Pro Cys225 230 235 240Pro Ala Pro Glu Leu Leu Gly
Gly Pro Ser Val Phe Leu Phe Pro Pro 245 250 255Lys Pro Lys Asp Thr
Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys 260 265 270Val Val Val
Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp 275 280 285Tyr
Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu 290 295
300Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val
Leu305 310 315 320His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys
Lys Val Ser Asn 325 330 335Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr
Ile Ser Lys Ala Lys Gly 340 345 350Gln Pro Arg Glu Pro Gln Val Tyr
Thr Leu Pro Pro Ser Arg Asp Glu 355 360 365Leu Thr Lys Asn Gln Val
Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr 370 375 380Pro Ser Asp Ile
Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn385 390 395 400Asn
Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe 405 410
415Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn
420 425 430Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His
Tyr Thr 435 440 445Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 450
455131444DNAHomo sapiensCDS(69)...(1433) 13aagcttgggc tgcaggtcga
tcgactctag aggatcgatc cccgggcgag ctcgaattcg 60caaccacc atg gtc agc
tac tgg gac acc ggg gtc ctg ctg tgc gcg ctg 110 Met Val Ser Tyr Trp
Asp Thr Gly Val Leu Leu Cys Ala Leu 1 5 10ctc agc tgt ctg ctt ctc
aca gga tct agt tcc gga ggt aga cct ttc 158Leu Ser Cys Leu Leu Leu
Thr Gly Ser Ser Ser Gly Gly Arg Pro Phe15 20 25 30gta gag atg tac
agt gaa atc ccc gaa att ata cac atg act gaa gga 206Val Glu Met Tyr
Ser Glu Ile Pro Glu Ile Ile His Met Thr Glu Gly 35 40 45agg gag ctc
gtc att ccc tgc cgg gtt acg tca cct aac atc act gtt 254Arg Glu Leu
Val Ile Pro Cys Arg Val Thr Ser Pro Asn Ile Thr Val 50 55 60act tta
aaa aag ttt cca ctt gac act ttg atc cct gat gga aaa cgc 302Thr Leu
Lys Lys Phe Pro Leu Asp Thr Leu Ile Pro Asp Gly Lys Arg 65 70 75ata
atc tgg gac agt aga aag ggc ttc atc ata tca aat gca acg tac 350Ile
Ile Trp Asp Ser Arg Lys Gly Phe Ile Ile Ser Asn Ala Thr Tyr 80 85
90aaa gaa ata ggg ctt ctg acc tgt gaa gca aca gtc aat ggg cat ttg
398Lys Glu Ile Gly Leu Leu Thr Cys Glu Ala Thr Val Asn Gly His
Leu95 100 105 110tat aag aca aac tat ctc aca cat cga caa acc aat
aca atc ata gat 446Tyr Lys Thr Asn Tyr Leu Thr His Arg Gln Thr Asn
Thr Ile Ile Asp 115 120 125atc cag ctg ttg ccc agg aag tcg ctg gag
ctg ctg gta ggg gag aag 494Ile Gln Leu Leu Pro Arg Lys Ser Leu Glu
Leu Leu Val Gly Glu Lys 130 135 140ctg gtc ctc aac tgc acc gtg tgg
gct gag ttt aac tca ggt gtc acc 542Leu Val Leu Asn Cys Thr Val Trp
Ala Glu Phe Asn Ser Gly Val Thr 145 150 155ttt gac tgg gac tac cca
ggg aag cag gca gag cgg ggt aag tgg gtg 590Phe Asp Trp Asp Tyr Pro
Gly Lys Gln Ala Glu Arg Gly Lys Trp Val 160 165 170ccc gag cga cgc
tcc caa cag acc cac aca gaa ctc tcc agc atc ctg 638Pro Glu Arg Arg
Ser Gln Gln Thr His Thr Glu Leu Ser Ser Ile Leu175 180 185 190acc
atc cac aac gtc agc cag cac gac ctg ggc tcg tat gtg tgc aag 686Thr
Ile His Asn Val Ser Gln His Asp Leu Gly Ser Tyr Val Cys Lys 195 200
205gcc aac aac ggc atc cag cga ttt cgg gag agc acc gag gtc att gtg
734Ala Asn Asn Gly Ile Gln Arg Phe Arg Glu Ser Thr Glu Val Ile Val
210 215 220cat gaa aat ggc ccg ggc gac aaa act cac aca tgc cca ccg
tgc cca 782His Glu Asn Gly Pro Gly Asp Lys Thr His Thr Cys Pro Pro
Cys Pro 225 230 235gca cct gaa ctc ctg ggg gga ccg tca gtc ttc ctc
ttc ccc cca aaa 830Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu
Phe Pro Pro Lys 240 245 250ccc aag gac acc ctc atg atc tcc cgg acc
cct gag gtc aca tgc gtg 878Pro Lys Asp Thr Leu Met Ile Ser Arg Thr
Pro Glu Val Thr Cys Val255 260 265 270gtg gtg gac gtg agc cac gaa
gac cct gag gtc aag ttc aac tgg tac 926Val Val Asp Val Ser His Glu
Asp Pro Glu Val Lys Phe Asn Trp Tyr 275 280 285gtg gac ggc gtg gag
gtg cat aat gcc aag aca aag ccg cgg gag gag 974Val Asp Gly Val Glu
Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu 290 295 300cag tac aac
agc acg tac cgt gtg gtc agc gtc ctc acc gtc ctg cac 1022Gln Tyr Asn
Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His 305 310 315cag
gac tgg ctg aat ggc aag gag tac aag tgc aag gtc tcc aac aaa 1070Gln
Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys 320 325
330gcc ctc cca gcc ccc atc gag aaa acc atc tcc aaa gcc aaa ggg cag
1118Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly
Gln335 340 345 350ccc cga gaa cca cag gtg tac acc ctg ccc cca tcc
cgg gat gag ctg 1166Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser
Arg Asp Glu Leu 355 360 365acc aag aac cag gtc agc ctg acc tgc ctg
gtc aaa ggc ttc tat ccc 1214Thr Lys Asn Gln Val Ser Leu Thr Cys Leu
Val Lys Gly Phe Tyr Pro 370 375 380agc gac atc gcc gtg gag tgg gag
agc aat ggg cag ccg gag aac aac 1262Ser Asp Ile Ala Val Glu Trp Glu
Ser Asn Gly Gln Pro Glu Asn Asn 385 390 395tac aag acc acg cct ccc
gtg ctg gac tcc gac ggc tcc ttc ttc ctc 1310Tyr Lys Thr Thr Pro Pro
Val Leu Asp Ser Asp Gly Ser Phe Phe Leu 400 405 410tat agc aag ctc
acc gtg gac aag agc agg tgg cag cag ggg aac gtc 1358Tyr Ser Lys Leu
Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val415 420 425 430ttc
tca tgc tcc gtg atg cat gag gct ctg cac aac cac tac acg cag 1406Phe
Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln 435 440
445aag agc ctc tcc ctg tct ccg ggt aaa tgagcggccg c 1444Lys Ser Leu
Ser Leu Ser Pro Gly Lys 450 45514455PRTHomo sapiens 14Met Val Ser
Tyr Trp Asp Thr Gly Val Leu Leu Cys Ala Leu Leu Ser1 5 10 15Cys Leu
Leu Leu Thr Gly Ser Ser Ser Gly Gly Arg Pro Phe Val Glu 20 25 30Met
Tyr Ser Glu Ile Pro Glu Ile Ile His Met Thr Glu Gly Arg Glu 35 40
45Leu Val Ile Pro Cys Arg Val Thr Ser Pro Asn Ile Thr Val Thr Leu
50 55 60Lys Lys Phe Pro Leu Asp Thr Leu Ile Pro Asp Gly Lys Arg Ile
Ile65 70 75 80Trp Asp Ser Arg Lys Gly Phe Ile Ile Ser Asn Ala Thr
Tyr Lys Glu 85 90 95Ile Gly Leu Leu Thr Cys Glu Ala Thr Val Asn Gly
His Leu Tyr Lys 100 105 110Thr Asn Tyr Leu Thr His Arg Gln Thr Asn
Thr Ile Ile Asp Ile Gln 115 120 125Leu Leu Pro Arg Lys Ser Leu Glu
Leu Leu Val Gly Glu Lys Leu Val 130 135 140Leu Asn Cys Thr Val Trp
Ala Glu Phe Asn Ser Gly Val Thr Phe Asp145 150 155 160Trp Asp Tyr
Pro Gly Lys Gln Ala Glu Arg Gly Lys Trp Val Pro Glu 165 170 175Arg
Arg Ser Gln Gln Thr His Thr Glu Leu Ser Ser Ile Leu Thr Ile 180 185
190His Asn Val Ser Gln His Asp Leu Gly Ser Tyr Val Cys Lys Ala Asn
195 200 205Asn Gly Ile Gln Arg Phe Arg Glu Ser Thr Glu Val Ile Val
His Glu 210 215 220Asn Gly Pro Gly Asp Lys Thr His Thr Cys Pro Pro
Cys Pro Ala Pro225 230 235 240Glu Leu Leu Gly Gly Pro Ser Val Phe
Leu Phe Pro Pro Lys Pro Lys 245 250 255Asp Thr Leu Met Ile Ser Arg
Thr Pro Glu Val Thr Cys Val Val Val 260 265 270Asp Val Ser His Glu
Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp 275 280 285Gly Val Glu
Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr 290 295 300Asn
Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp305 310
315 320Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala
Leu 325 330 335Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly
Gln Pro Arg 340 345 350Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg
Asp Glu Leu Thr Lys 355 360 365Asn Gln Val Ser Leu Thr Cys Leu Val
Lys Gly Phe Tyr Pro Ser Asp 370 375 380Ile Ala Val Glu Trp Glu Ser
Asn Gly Gln Pro Glu Asn Asn Tyr Lys385 390 395 400Thr Thr Pro Pro
Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser 405 410 415Lys Leu
Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser 420 425
430Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser
435 440 445Leu Ser Leu Ser Pro Gly Lys 450 455151377DNAHomo
sapiensCDS(1)...(1374) 15atg gtc agc tac tgg gac acc ggg gtc ctg
ctg tgc gcg ctg ctc agc 48Met Val Ser Tyr Trp Asp Thr Gly Val Leu
Leu Cys Ala Leu Leu Ser1 5 10 15tgt ctg ctt ctc aca gga tct agt tcc
gga agt gat acc ggt aga cct 96Cys Leu Leu Leu Thr Gly Ser Ser Ser
Gly Ser Asp Thr Gly Arg Pro 20 25 30ttc gta gag atg tac agt gaa atc
ccc gaa att ata cac atg act gaa 144Phe Val Glu Met Tyr Ser Glu Ile
Pro Glu Ile Ile His Met Thr Glu 35 40 45gga agg gag ctc gtc att ccc
tgc cgg gtt acg tca cct aac atc act 192Gly Arg Glu Leu Val Ile Pro
Cys Arg Val Thr Ser Pro Asn Ile Thr 50 55 60gtt act tta aaa aag ttt
cca ctt gac act ttg atc cct gat gga aaa 240Val Thr Leu Lys Lys Phe
Pro Leu Asp Thr Leu Ile Pro Asp Gly Lys65 70 75 80cgc ata atc tgg
gac agt aga aag ggc ttc atc ata tca aat gca acg 288Arg Ile Ile Trp
Asp Ser Arg Lys Gly Phe Ile Ile Ser Asn Ala Thr 85 90 95tac aaa gaa
ata ggg ctt ctg acc tgt gaa gca aca gtc aat ggg cat 336Tyr Lys Glu
Ile Gly Leu Leu Thr Cys Glu Ala Thr Val Asn Gly His 100 105 110ttg
tat aag aca aac tat ctc aca cat cga caa acc aat aca atc ata 384Leu
Tyr Lys Thr Asn Tyr Leu Thr His Arg Gln Thr Asn Thr Ile Ile 115 120
125gat gtg gtt ctg agt ccg tct cat gga att gaa cta tct gtt gga gaa
432Asp Val Val Leu Ser Pro Ser His Gly Ile Glu Leu Ser Val Gly Glu
130 135 140aag ctt gtc tta aat tgt aca gca aga act gaa cta aat gtg
ggg att 480Lys Leu Val Leu Asn Cys Thr Ala Arg Thr Glu Leu Asn Val
Gly Ile145 150 155 160gac ttc aac tgg gaa tac cct tct tcg aag cat
cag cat aag aaa ctt 528Asp Phe Asn Trp Glu Tyr Pro Ser Ser Lys His
Gln His Lys Lys Leu 165 170 175gta aac cga gac cta aaa acc cag tct
ggg agt gag atg aag aaa ttt 576Val Asn Arg Asp Leu Lys Thr Gln Ser
Gly Ser Glu Met Lys Lys Phe 180 185 190ttg agc acc tta act ata gat
ggt gta acc cgg agt gac caa gga ttg 624Leu Ser Thr Leu Thr Ile Asp
Gly Val Thr Arg Ser Asp Gln Gly Leu 195 200 205tac acc tgt gca gca
tcc agt ggg ctg atg acc aag aag aac agc aca 672Tyr Thr Cys Ala Ala
Ser Ser Gly Leu Met Thr Lys Lys Asn Ser Thr 210 215 220ttt gtc agg
gtc cat gaa aag gac aaa act cac aca tgc cca ccg tgc 720Phe Val Arg
Val His Glu Lys Asp Lys Thr His Thr Cys Pro Pro Cys225 230 235
240cca gca cct gaa ctc ctg ggg gga ccg tca gtc ttc ctc ttc ccc cca
768Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro
245 250 255aaa ccc aag gac acc ctc atg atc tcc cgg acc cct gag gtc
aca tgc 816Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val
Thr Cys 260 265 270gtg gtg gtg gac gtg agc cac gaa gac cct gag gtc
aag ttc aac tgg 864Val Val Val Asp Val Ser His Glu Asp Pro Glu Val
Lys Phe Asn Trp 275 280 285tac gtg gac ggc gtg gag gtg cat aat gcc
aag aca aag ccg cgg gag 912Tyr Val Asp Gly Val Glu Val His Asn Ala
Lys Thr Lys Pro Arg Glu 290 295 300gag cag tac aac agc acg tac cgt
gtg gtc agc gtc ctc acc gtc ctg 960Glu Gln Tyr Asn Ser Thr Tyr Arg
Val Val Ser Val Leu Thr Val Leu305 310 315 320cac cag gac tgg ctg
aat ggc aag gag tac aag tgc aag gtc tcc aac 1008His Gln Asp Trp Leu
Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn 325 330 335aaa gcc ctc
cca gcc ccc atc gag aaa acc atc tcc aaa gcc aaa ggg 1056Lys Ala Leu
Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly 340 345 350cag
ccc cga gaa cca cag gtg tac acc ctg ccc cca tcc cgg gat gag 1104Gln
Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu 355 360
365ctg acc aag aac cag gtc agc ctg acc tgc ctg gtc aaa ggc
ttc tat 1152Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly
Phe Tyr 370 375 380ccc agc gac atc gcc gtg gag tgg gag agc aat ggg
cag ccg gag aac 1200Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly
Gln Pro Glu Asn385 390 395 400aac tac aag acc acg cct ccc gtg ctg
gac tcc gac ggc tcc ttc ttc 1248Asn Tyr Lys Thr Thr Pro Pro Val Leu
Asp Ser Asp Gly Ser Phe Phe 405 410 415ctc tac agc aag ctc acc gtg
gac aag agc agg tgg cag cag ggg aac 1296Leu Tyr Ser Lys Leu Thr Val
Asp Lys Ser Arg Trp Gln Gln Gly Asn 420 425 430gtc ttc tca tgc tcc
gtg atg cat gag gct ctg cac aac cac tac acg 1344Val Phe Ser Cys Ser
Val Met His Glu Ala Leu His Asn His Tyr Thr 435 440 445cag aag agc
ctc tcc ctg tct ccg ggt aaa tga 1377Gln Lys Ser Leu Ser Leu Ser Pro
Gly Lys 450 45516458PRTHomo sapiens 16Met Val Ser Tyr Trp Asp Thr
Gly Val Leu Leu Cys Ala Leu Leu Ser1 5 10 15Cys Leu Leu Leu Thr Gly
Ser Ser Ser Gly Ser Asp Thr Gly Arg Pro 20 25 30Phe Val Glu Met Tyr
Ser Glu Ile Pro Glu Ile Ile His Met Thr Glu 35 40 45Gly Arg Glu Leu
Val Ile Pro Cys Arg Val Thr Ser Pro Asn Ile Thr 50 55 60Val Thr Leu
Lys Lys Phe Pro Leu Asp Thr Leu Ile Pro Asp Gly Lys65 70 75 80Arg
Ile Ile Trp Asp Ser Arg Lys Gly Phe Ile Ile Ser Asn Ala Thr 85 90
95Tyr Lys Glu Ile Gly Leu Leu Thr Cys Glu Ala Thr Val Asn Gly His
100 105 110Leu Tyr Lys Thr Asn Tyr Leu Thr His Arg Gln Thr Asn Thr
Ile Ile 115 120 125Asp Val Val Leu Ser Pro Ser His Gly Ile Glu Leu
Ser Val Gly Glu 130 135 140Lys Leu Val Leu Asn Cys Thr Ala Arg Thr
Glu Leu Asn Val Gly Ile145 150 155 160Asp Phe Asn Trp Glu Tyr Pro
Ser Ser Lys His Gln His Lys Lys Leu 165 170 175Val Asn Arg Asp Leu
Lys Thr Gln Ser Gly Ser Glu Met Lys Lys Phe 180 185 190Leu Ser Thr
Leu Thr Ile Asp Gly Val Thr Arg Ser Asp Gln Gly Leu 195 200 205Tyr
Thr Cys Ala Ala Ser Ser Gly Leu Met Thr Lys Lys Asn Ser Thr 210 215
220Phe Val Arg Val His Glu Lys Asp Lys Thr His Thr Cys Pro Pro
Cys225 230 235 240Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe
Leu Phe Pro Pro 245 250 255Lys Pro Lys Asp Thr Leu Met Ile Ser Arg
Thr Pro Glu Val Thr Cys 260 265 270Val Val Val Asp Val Ser His Glu
Asp Pro Glu Val Lys Phe Asn Trp 275 280 285Tyr Val Asp Gly Val Glu
Val His Asn Ala Lys Thr Lys Pro Arg Glu 290 295 300Glu Gln Tyr Asn
Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu305 310 315 320His
Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn 325 330
335Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly
340 345 350Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg
Asp Glu 355 360 365Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val
Lys Gly Phe Tyr 370 375 380Pro Ser Asp Ile Ala Val Glu Trp Glu Ser
Asn Gly Gln Pro Glu Asn385 390 395 400Asn Tyr Lys Thr Thr Pro Pro
Val Leu Asp Ser Asp Gly Ser Phe Phe 405 410 415Leu Tyr Ser Lys Leu
Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn 420 425 430Val Phe Ser
Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr 435 440 445Gln
Lys Ser Leu Ser Leu Ser Pro Gly Lys 450 45517430PRTHomo sapiens
17Gly Arg Pro Phe Val Glu Met Tyr Ser Glu Ile Pro Glu Ile Ile His 1
5 10 15Met Thr Glu Gly Arg Glu Leu Val Ile Pro Cys Arg Val Thr Ser
Pro 20 25 30Asn Ile Thr Val Thr Leu Lys Lys Phe Pro Leu Asp Thr Leu
Ile Pro 35 40 45Asp Gly Lys Arg Ile Ile Trp Asp Ser Arg Lys Gly Phe
Ile Ile Ser 50 55 60Asn Ala Thr Tyr Lys Glu Ile Gly Leu Leu Thr Cys
Glu Ala Thr Val65 70 75 80Asn Gly His Leu Tyr Lys Thr Asn Tyr Leu
Thr His Arg Gln Thr Asn 85 90 95Thr Ile Ile Asp Val Val Leu Ser Pro
Ser His Gly Ile Glu Leu Ser 100 105 110Val Gly Glu Lys Leu Val Leu
Asn Cys Thr Ala Arg Thr Glu Leu Asn 115 120 125Val Gly Ile Asp Phe
Asn Trp Glu Tyr Pro Ser Ser Lys His Gln His 130 135 140Lys Lys Leu
Val Asn Arg Asp Leu Lys Thr Gln Ser Gly Ser Glu Met145 150 155
160Lys Lys Phe Leu Ser Thr Leu Thr Ile Asp Gly Val Thr Arg Ser Asp
165 170 175Gln Gly Leu Tyr Thr Cys Ala Ala Ser Ser Gly Leu Met Thr
Lys Lys 180 185 190Asn Ser Thr Phe Val Arg Val His Glu Lys Gly Pro
Gly Asp Lys Thr 195 200 205His Thr Cys Pro Pro Cys Pro Ala Pro Glu
Leu Leu Gly Gly Pro Ser 210 215 220Val Phe Leu Phe Pro Pro Lys Pro
Lys Asp Thr Leu Met Ile Ser Arg225 230 235 240Thr Pro Glu Val Thr
Cys Val Val Val Asp Val Ser His Glu Asp Pro 245 250 255Glu Val Lys
Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala 260 265 270Lys
Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val 275 280
285Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr
290 295 300Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu
Lys Thr305 310 315 320Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro
Gln Val Tyr Thr Leu 325 330 335Pro Pro Ser Arg Asp Glu Leu Thr Lys
Asn Gln Val Ser Leu Thr Cys 340 345 350Leu Val Lys Gly Phe Tyr Pro
Ser Asp Ile Ala Val Glu Trp Glu Ser 355 360 365Asn Gly Gln Pro Glu
Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp 370 375 380Ser Asp Gly
Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser385 390 395
400Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala
405 410 415Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Pro Gly Lys
420 425 4301836DNAArtificial Sequenceprimer 18gactagcagt ccggaggtag
acctttcgta gagatg 361933DNAArtificial Sequenceprimer 19cggactcaga
accacatcta tgattgtatt ggt 33207PRTHomo sapiens 20Gly Arg Pro Phe
Val Glu Met1 52135DNAArtificial Sequenceprimer 21acaatcatag
atgtggttct gagtccgtct catgg 352238DNAArtificial Sequenceprimer
22gataatgccc gggccctttt catggaccct gacaaatg 38236PRTHomo sapiens
23Val Arg Val His Glu Lys1 52436DNAArtificial Sequenceprimer
24gactagcagt ccggaggtag acctttcgta gagatg 362538DNAArtificial
Sequenceprimer 25ttcctgggca acagctggat atctatgatt gtattggt
38264PRTHomo sapiens 26Ile Gln Leu Leu12739DNAArtificial
Sequenceprimer 27atccagctgt tgcccaggaa gtcgctggag ctgctggta
392839DNAArtificial Sequenceprimer 28attttcatgc acaatgacct
cggtgctctc ccgaaatcg 392938DNAArtificial Sequenceprimer
29tcatagatat ccagctgttg cccaggaagt cgctggag 383039DNAArtificial
Sequenceprimer 30gataatgccc gggccatttt catgcacaat gacctcggt
39316PRTHomo sapiens 31Val Ile Val His Glu Asn1 53210PRTArtificial
Sequencemodified Flt1 receptor 32Lys Asn Lys Arg Ala Ser Val Arg
Arg Arg1 5 10338PRTArtificial Sequencemodified Flt1 receptor 33Asn
Ala Ser Val Asn Gly Ser Arg1 53410PRTArtificial Sequencemodified
Flt1 receptor 34Lys Asn Lys Cys Ala Ser Val Arg Arg Arg1 5
10354PRTHomo sapiens 35Ser Lys Leu Lys1369PRTHomo sapiens 36Lys Asn
Lys Arg Ala Ser Val Arg Arg1 5374PRTHomo sapiens 37Thr Ile Ile
Asp1384PRTHomo sapiens 38Val Val Leu Ser1
* * * * *