U.S. patent application number 13/636960 was filed with the patent office on 2013-03-28 for bacillus pumilus bilirubin oxidase and applications thereof.
The applicant listed for this patent is Fabien Durand, Nicolas Mano. Invention is credited to Fabien Durand, Nicolas Mano.
Application Number | 20130078662 13/636960 |
Document ID | / |
Family ID | 42335266 |
Filed Date | 2013-03-28 |
United States Patent
Application |
20130078662 |
Kind Code |
A1 |
Mano; Nicolas ; et
al. |
March 28, 2013 |
Bacillus Pumilus Bilirubin Oxidase and Applications Thereof
Abstract
The present invention relates to a novel Bacillus pumilus
bilirubin oxidase, to the method for preparing same and also to the
use thereof in particular for assaying bilirubin and for using
enzymatic biofuel cells.
Inventors: |
Mano; Nicolas; (Talence,
FR) ; Durand; Fabien; (Bordeaux, FR) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Mano; Nicolas
Durand; Fabien |
Talence
Bordeaux |
|
FR
FR |
|
|
Family ID: |
42335266 |
Appl. No.: |
13/636960 |
Filed: |
March 24, 2011 |
PCT Filed: |
March 24, 2011 |
PCT NO: |
PCT/IB11/51258 |
371 Date: |
December 10, 2012 |
Current U.S.
Class: |
435/25 ;
204/290.11; 204/403.14; 429/401; 435/189; 435/252.33; 435/254.23;
435/278; 435/320.1; 536/23.2; 8/102; 8/401 |
Current CPC
Class: |
C12Q 1/26 20130101; C12Y
103/03005 20130101; C12N 9/001 20130101; H01M 8/16 20130101; H01M
4/90 20130101; C12Q 1/005 20130101; Y02E 60/527 20130101; Y02E
60/50 20130101 |
Class at
Publication: |
435/25 ; 435/189;
435/320.1; 435/254.23; 435/252.33; 536/23.2; 8/401; 8/102; 435/278;
204/290.11; 204/403.14; 429/401 |
International
Class: |
C12N 9/00 20060101
C12N009/00 |
Foreign Application Data
Date |
Code |
Application Number |
Mar 24, 2010 |
FR |
1001 167 |
Claims
1. Purified bilirubin oxidase (BOD), charadterized in that it has a
percentage identity of at least 80% with respect to the BOD of
Bacillus pumilus of SEQ ID No. 2, in that it catalyses the reaction
for oxidation of bilirubin to biliverdin and in that it is bound to
four copper atoms.
2. Nucleic acid molecule, characterized in that it codes an BOD
according to claim 1.
3. Nucleic acid molecUle according to claim 2, having a sequence
chosen from SEQ ID NO. 1, SEQ ID No. 5 or SEQ ID No. 7.
4. Expression vector, characterized in that it comprises a nucleic
acid molecule according to claim 2.
5. Host cell expressing a BOD characterized in that it has a
percentage identity of at least 80% with respect to the BOD of
Bacillus pumilus of SEQ ID No. 2, in that it catalyses the reaction
for oxidation of bilirubin to biliverdin and in that it is bound to
four copper atoms and further characterized in that it is
transformed with an expression vector according to claim 4.
6. Method for preparing a BOD characterized in that it has a
percentage identity of at least 80% with respect to the BOD of
Bacillus pumilus of SEQ ID No. 2, in that it catalyses the reaction
for oxidation of bilirubin to biliverdin and in that it is bound to
four copper atoms, comprising the steps of: a) preparing host cells
according to claim 5; b) culturing host cells prepared in step a);
c) lysing said host cells; d) treating the lysate obtained in step
c) by affinity chromatography; e) recovering said purified BOD,
characterized in that said host cell prepared in step a) is an
Escherichia coli BL.sub.21 Star strain transformed with the pFD1
vector and in that said culture carried out in step b) is a
liquid-phase culture, with shaking, under anaerobic conditions for
a period of 20 to 30 h, at a temperature between 20 and 30.degree.
C., during which the BOD expression is induced by adding
isopropyl-.beta.-D-1-thiogalactopyranoside (IPTG).
7. Use of the BOD according to claim 1, for measuring the bilirubin
concentration in a liquid sample.
8. Kit for assaying bilirubin, characterized in that it comprises a
BOD according to claim 1.
9. Method for assaying the bilirubin in solution in a liquid
sample, characterized in that it comprises the following steps: a)
measuring the absorbance at .lamda..sub.max=440 nm of said liquid
sample before enzymatic reaction; b) introducing into said liquid
sample a BOD according to claim 1; c) measuring the absorbance at
.lamda..sub.max=440 nm of said liquid sample after enzymatic
reaction; d) calculating the difference in absorbances measured in
steps a) and c) and comparing with differences in absorbances
measured for standard solutions having a known bilirubin content;
e) determining the bilirubin concentration of said liquid
sample.
10. Use of a BOD according to claim 1, for degrading the bilirubin
present in a sample.
11. Use of the BOD according to claim 1, as a reagent in a
composition for the oxidation dyeing of keratin fibres.
12. Use of the BOD according to claim 1, for treating wood
pulp.
13. Use of the BOD according to claim 1, for discolouring dyes used
in industrial media.
14. BOD electrode comprising a conductive material coated with a
deposit comprising at least one BOD according to claim 1.
15. Bilirubin biosensor, characterized in that it is constituted of
an electrode according to claim 14.
16. Oxygen sensor, characterized in that it is constituted of an
electrode according to claim 14.
17. Enzymatic biofuel cell comprising an anode on which an enzyme
catalysing an oxidation reaction is immobilized and an electrode
according to claim 14 as cathode.
Description
[0001] The present invention relates to a novel bilirubin oxidase,
to the method for preparing same and also to the use thereof in
particular for assaying bilirubin and for the use of enzymatic
biofuel cells using oxygen as fuel.
[0002] Bilirubin oxidase or BOD (E.C. 1.3.3.5.) is an enzyme which
catalyses the reaction for oxidation of bilirubin to
biliverdin:
bilirubin+1/2 O.sub.2.fwdarw.biliverdin+H.sub.2O
[0003] BOD has four sites for binding to copper atoms; these four
copper atoms are necessary for correct activity of the enzyme; it
has in fact been shown that the absence of a copper in the CotA
protein of Bacillus subtilis (a protein with bilirubin oxidase
activity sold, as BOD, by the company Genzyme Diagnostics) is
sufficient to reduce the activity of the enzyme (table 3 of the
article by Durao et al., in J Biol Inorg Chem. 2008 February;
13(2): 183-93).
[0004] Bilirubin is a yellow substance formed in the blood by the
decomposition of haemoglobin; it is one of the main pigments
produced in the liver.
[0005] BOD is of interest for various applications, such as the
assaying of bilirubin, making it possible, for example, to diagnose
excess bilirubin in the blood; it can also be used to prepare
enzymatic biofuel cells where it will capture cathode electrons,
reducing oxygen to water (see the schematic representation of an
enzymatic biofuel cell where the BOD is attached in a redox polymer
to the cathode, in FIG. 1A) or as an oxygen biosensor.
[0006] There are many sources of BOD; this enzyme can be produced
from microorganisms such as those of the Bacillus genus [Bacillus
subtilis, the CotA of which has a bilirubin oxidase activity, see
Sakasegawe et al. 2006 Applied and Environmental Microbiology 72,
No. 1, 972-975; Bacillus licheniformis (U.S. Pat. No. 4,770,997)],
or from mycetes, among which, those of the genus Penicillium
[Penicillium janthinellum (patent application EP 0 295 101)],
Trachyderma (U.S. Pat. No. 4,600,689), Myrothecium (Tanaka et al.
1982 Agric. Biol. Chem. 46, 2499-2503) or else Schizophyllum,
Coprinus, Trametes, Coriolus, Pholiota, Pleurotus, Lenzites or
Fomitopsis (U.S. Pat. No. 4,677,062).
[0007] This enzyme can also be extracted from plants such as of the
type Alfalfa (U.S. Pat. No. 5,624,811), Solanaceae, Musaceae and
Liliaceae (EP 0 140 004) or else Compositae, such as the artichoke
(EP 0 247 846).
[0008] Among these enzymes, the BODs having the most advantageous
enzymatic properties, in particular activity and stability, have
been selected to be marketed; they are Bacillus subtilis CotA
having bilirubin oxidase activity (it is sold as BOD by the company
Genzyme Diagnostics and will subsequently be denoted BOD) and
Myrothecium verrucaria BOD (sold by the companies Sigma-Aldrich and
Amano).
[0009] The inventors have now identified a novel BOD produced by
Bacillus pumilus which is more active and/or more stable than the
commercially available BODs; they have also developed a method for
preparing this novel BOD which is simpler and faster than those
used to date for the other known BODs.
[0010] According to a first subject, the invention relates to the
wild-type BOD of Bacillus pumilus; in particular, the bilirubin
oxidase, in particular the purified bilirubin oxidase (purity
>95%) according to the invention has a percentage identity of at
least 80%, and by order of increasing preference at least 85%, 90%,
95%, 97%, 98% and 99% identity, with respect to the wild-type BOD
of Bacillus pumilus of SEQ ID No. 2; it catalyses the reaction for
oxidation of bilirubin to biliverdin and is bound to four copper
atoms.
[0011] SEQ ID No. 2 corresponds to the wild-type BOD of the
Bacillus pumilus strain SAFR032. By way of example, the present
invention also relates to the wild-type BODs of other Bacillus
pumilus strains, for instance the BOD of the ATCC 7061 strain of
SEQ ID No. 6, which has a percentage identity of 98% with the BOD
of SEQ ID No. 2; the preferred BOD according to the invention is
the wild-type BOD of the Bacillus pumilus strain SAFR032 of SEQ ID
No. 2.
[0012] The identity of a sequence with respect to the sequence of
the wild-type BOD of Bacillus pumilus (SEQ ID No. 2) as reference
sequence is assessed according to the percentage of amino acid
residues which are identical, when the two sequences are aligned,
so as to obtain the maximum correspondence between them.
[0013] Protein sequences predicted from the systematic sequencing
of the Bacillus pumilus genome are described in the UniProt
database (accession number A8FAG9 "Outer Spore Coat Protein A" of
13 Nov. 2007 and accession number B4AIB1 "Spore Coat Protein A" of
23 Sep. 2008); it should be underlined that the information
presented in the UniProt database is predictive and putative, it
does not result from the experimental isolation and
characterization of Bacillus pumilus proteins. In addition, the
indications appearing in this database did not make it possible to
predict any BOD activity for these proteins, since, among the
various CotA characterized to date from the organisms B. subtilis,
B. licheniformis (Koschorreck, K., et al., Cloning and
characterization of a new laccase from Bacillus licheniformis
catalysing dimerization of phenolic acids. Appl Microbiol
Biotechnol, 2008. 79(2): p. 217-24; Koschorreck, K., R. D. Schmid,
and V. B. Urlacher, Improving the functional expression of a
Bacillus licheniformis laccase by random and site-directed
mutagenesis. BMC Biotechnol, 2009. 9: p. 12), B. halodurans, and B.
HR03, before the BOD of B. pumilus, only that of B. subtilis has
been characterized as a BOD, the others being laccases (enzymes
having a weak tetrapyrrole-oxidizing activity, unlike BODS).
[0014] The percentage identity can be calculated by those skilled
in the art using a sequence comparison computer program such as,
for example, that of the BLAST series (Altschul et al., NAR, 25,
3389-3402). The BLAST programs are implemented on the window of
comparison consisting of the entire SEQ ID No. 2 indicated as
reference sequence.
[0015] A peptide having an amino acid sequence having at least X %
identity with a reference sequence is defined, in the present
invention, as a peptide of which the sequence can include up to
100-X modifications per 100 amino acids of the reference sequence,
while retaining the functional properties of said reference
peptide, in the case in point its bilirubin oxidation enzymatic
activity. For the purpose of the present invention, the term
"modification" includes consecutive or dispersed deletions,
substitutions or insertions of amino acids in the reference
sequence.
[0016] The novel BOD according to the invention has improved
properties compared with the commercially available BODs derived
from Myrothecium verrucaria or Bacillus subtilis.
[0017] In particular, the Bacillus pumilus BOD has better enzymatic
properties (activity, catalytic efficiency k.sub.cat and affinity
of the substrate for the enzyme K.sub.M) with respect to catalysis
of the oxidation of
2,2'-azinobis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS), than
the BODs of Myrothecium verrucaria or of Bacillus subtilis.
[0018] The enzymatic properties can be determined as described in
part 4 of the example which follows.
[0019] Table I below gives the catalytic efficiency k.sub.cat, i.e.
the number of molecules of substrate converted to product per
molecule of enzyme and per unit time, and the Michaelis constant
K.sub.M which represents the affinity of the substrate (ABTS) for
the BODs of B. subtilis and of B. pumilus.
[0020] The enzymatic properties of the BODs of B. pumilus and of B.
subtilis can easily be compared since these two enzymes have very
similar optimal conditions for use: pH between 3 and 4 and
temperature between 75 and 80.degree. C.
TABLE-US-00001 TABLE I Enzymatic properties of the BODs of B.
pumilus and of B. subtilis BOD k.sub.cat (for ABTS) K.sub.M B.
pumilus 391.3 s.sup.-1 31.7 .mu.M B. subtilis 322 s.sup.-1 124
.mu.M
[0021] The enzymatic properties described for the M. verrucaria BOD
by Kataoka et al. (2005, Protein Expression and Purification, 41,
77-83) at pH 6.5 are a k.sub.cat of 115 s.sup.-1 and a K.sub.M of
250 .mu.M. Moreover, Sakurai et al. (2008, Biochemical and
Biophysical Research communication, 371, 416-419) have determined
the specific activity of the M. verrucaria BOD for ABTS, which is
106 U/mg, the specific activity of the BOD according to the
invention itself being 375 U/mg. In addition, the B. pumilus BOD
has very good heat stability and good bilirubin oxidation enzymatic
properties.
[0022] The present invention also relates to a nucleic acid
molecule encoding the BOD according to the invention; it is
preferably a nucleic acid molecule having a sequence chosen from
SEQ ID. No. 1 encoding the wild-type BOD of Bacillus pumilus
SARF-032, SEQ ID No. 5 encoding the wild-type BOD of Bacillus
pumilus ATCC 7061 or else SEQ ID No. 7 which corresponds to the
sequence of the wild-type BOD of Bacillus pumilus SARF-032 which
has been modified in order to improve the expression thereof by the
yeast Pichia pastoris. The nucleic acid molecule encoding the BOD
according to the invention can be cloned into an expression vector,
such as a plasmid, and then used to transform a suitable host, such
as a bacterium, a yeast or else a cell culture.
[0023] The term "expression vector" is intended to mean a vector
which has a region allowing the insertion of a coding nucleotide
sequence between the signals essential for its expression, in
particular a promoter (constitutive or inducible), a
ribosome-binding site, a transcription stop signal and, optionally,
a selectable marker, such as a gene for resistance to an
antibiotic.
[0024] The present invention also relates to an expression vector
comprising said nucleic acid molecule and to a host cell
transformed with said expression vector and expressing a BOD
according to the invention.
[0025] The introduction of the expression vector into the host cell
can be carried out by any method known to those skilled in the art,
in particular by a modification of the membrane permeability of the
host cell, for example in the presence of calcium ions, or by
electroporation. After culture of the host cells transformed so as
to express the BOD according to the invention, said cells can be
recovered by centrifugation, and lysed in order to release the
enzymes, including said BOD according to the invention.
[0026] If Escherichia coli is the host microorganism, the plasmids
which can be used are in particular the plasmids pBluescript,
pUC18, pET, pGEX, pGS, pMAL-c2, or the like.
[0027] According to a preferred method for preparing the BOD
according to the invention, the BOD is expressed by an E. coli
bacterium transformed with a pET2la expression vector encoding an
enzyme joined to a 6HIS tag in the C-terminal position.
[0028] This method, illustrated in the experimental section which
follows (section 3), is advantageous owing to its rapidity and its
simplicity; this is because the induction of the Bacillus pumilus
BOD expression in the E. coli bacterium takes place in 4 to 24
hours, whereas the production of BOD derived from Myrothecium
verrucaria requires induction periods that can reach 5 days
(Kataoka et al. Biochemistry. 2005 May 10; 44(18):7004-12; Kataoka
et al., Biochem Biophys Res Commun. 2008 Jul. 4; 371(3):416-9;
Kataoka et al. K. Protein Expr Purif. 2005 May; 41(1):77-83).
[0029] In addition, the 6HIS tag makes it possible to purify the
Bacillus pumilus BOD by affinity chromatography on a nickel resin
in a single step so as to obtain a pure enzyme; the small size of
the tag (6 amino acids) makes it possible to do away with
eliminating it since it does not significantly disturb the activity
of the enzyme. By way of comparison, the purification of the
Myrothecium verrucaria and B. subtilis BODS which is described,
respectively, in the articles by Kataoka et al. (see above) and
Durao et al. (J Biol Inorg Chem. 2008 February; 13(2):183-93)
require several chromatography steps.
[0030] The rapidity and the simplicity of this method therefore
represent considerable advantages compared with the methods for
preparing enzymes that are currently commercially available.
[0031] Those skilled in the art will select the host cell according
to the expression vector used.
[0032] Preferably, when the pET21a expression vector is used, a
host cell expressing the T7 RNA polymerase, such as the E. coli
strains BL.sub.21 DE3, BL.sub.21-SI, BL.sub.21 pLys, Novablue(DE3)
or BL.sub.21 Star, will be selected. Preferably, the Bacillus
pumilus BOD according to the invention is produced in an
Escherichia coli BL.sub.21 Star strain; the nucleic acid molecule
which encodes it is obtained by PCR with the primers of SEQ ID Nos.
3 and 4 and cloned into the pET2la vector so as to give the
transformed vector pFD1. The BOD thus produced is then purified,
after lysis of the bacteria, by affinity chromatography.
[0033] According to another advantageous variant of the invention,
the BOD according to the invention is produced by the Pichia
pastoris yeast.
[0034] In order to allow the overproduction and the secretion of
the BOD into the culture medium of the Pichia pastoris yeast, the
gene encoding the BOD, in particular chosen from the sequences SEQ
ID No. 1, 5 or 7, preferably SEQ ID No. 7, is introduced by
homologous recombination into the yeast genome, at the level of the
AOX1 gene. For this, the pFD2 plasmid, once linearized by digestion
with the pmel enzyme, is introduced into the yeast by
electroporation, and the positive clones are selected on YPD+agar
medium containing zeocin at 100 .mu.g/ml. A preculture of 200 ml of
YPD medium supplemented with zeocin (100 .mu.g/ml) is inoculated
using an isolated clone on a Petri dish.
[0035] After shaking at 220 rpm `overnight at 30.degree. C., this
pre-culture is then centrifuged for 10 min at 4000 rpm and the
pellet is taken up in 200 ml of sterile water in order to remove
any presence of glucose. After a second centrifugation, a 2 L
culture in MMH medium containing 1 mM of CuSO.sub.4 in a 5 L
Erlenmeyer flask is then inoculated with this pellet. The yeasts
are incubated at 25.degree. C. with shaking (220 rpm) for 2 hours,
before the addition of 0.5% of methanol in order to initiate the
induction. This induction step will be repeated for 5 days in order
to obtain the maximum amount of enzymes.
[0036] In order to implement this method, the following material
can be used, without being limiting in nature: [0037] vector for
expression in Pichia pastoris (pFD2): pPICZa plasmid containing the
DNA sequence encoding the Bacillus pumilus BOD, preferably
optimized (SEQ ID No. 7), in frame with the Saccharomyces
cerevisiae .alpha.-factor secretion factor and containing the
methanol-inducible AOX1 promoter; [0038] Pichia pastoris yeast
strain GS115 used for producing bilirubin oxidase after integration
of the cassette derived from the PFD2 vector containing the AOX1
promoter, the .alpha.-factor signal peptide and the DNA sequence
encoding the Bacillus pumilus BOD; [0039] culture media:
[0040] YPD Rich Medium (for Yeast): [0041] 1% yeast extract [0042]
2% bactopeptone [0043] 2% glucose [0044] pH not adjusted,
autoclaved for 20 min at 120.degree. C.
[0045] MMH Minimum Medium (for Yeast): [0046] 1.34% yeast nitrogen
base [0047] 1% Casamino acid [0048] 0.4% histidine [0049]
4.times.10.sup.-5% biotin [0050] pH not adjusted, autoclaved for 20
min at 120.degree. C.
[0051] LB Rich Medium (for Bacterium): [0052] 10 g/l tryptone
[0053] 5 g/l yeast extract [0054] 5 g/l NaCl [0055] Distilled
H.sub.2O qs 11 [0056] pH not adjusted, autoclaved for 20 min at
120.degree. C.
[0057] The present invention also relates to a method for preparing
a BOD according to the invention, comprising the steps of: [0058]
a) preparing host cells expressing the BOD according to the
invention; [0059] b) culturing the host cells prepared in step a);
[0060] c) lysing the host cells; [0061] d) treating the lysate
obtained in step c) by affinity chromatography; [0062] e)
recovering said purified BOD.
[0063] According to one preferred embodiment, the method according
to the invention is such that: [0064] the Escherichia coli
BL.sub.21 Star strain transformed with the pFD1 vector is prepared
in step a); [0065] the culture carried out in step b) is a
liquid-phase culture, with shaking, under anaerobic conditions for
a period of 4 to 30 h, preferably 24 h, at a temperature between 18
and 37.degree. C., preferably 20.degree. C., during which the BOD
expression is induced by adding
isopropyl-.beta.-D-1-thiogalactopyranoside (IPTG). When the method
is implemented according to these preferred conditions, it allows
the production of the BOD with a short induction time, of about 24
hours; the purification of the BOD is carried out in a single
affinity chromatography step and the BOD thus produced indeed
comprises the four copper atoms necessary for its activity (see
part 5 of the example).
[0066] It is also possible to produce a BOD in the presence of
denaturing agents such as urea, guanidinium chloride, SDS, triton,
etc., the BOD thus produced will then be devoid of copper and may
be activated by adding copper ions.
[0067] The invention also relates to the use of the Bacillus
pumilus BOD according to the invention for assaying bilirubin in
solution, i.e. measuring the bilirubin concentration in a sample,
in particular a biological sample.
[0068] The term "biological sample" is intended to mean a
biological fluid, such as blood, serum, lymph, bile, urine,
cerebrospinal fluid, sweat, etc.
[0069] The presence of bilirubin in the organism is normal, it
comes from the degradation of haemoglobin and approximately 200 to
230 mg of bilirubin are formed per day in a healthy adult. In an
individual in good health, the bilirubin is taken up by the liver
and then degraded; its concentration should not therefore exceed
certain thresholds, and the assaying of bilirubin is useful for
detecting pathological conditions such as: [0070] cases of
substantial haemolysis: congenital or acquired haemolytic anaemia,
drug-related, toxic or infectious haemolysis, transfusion
accidents, etc.; [0071] insufficient hepatic uptakes or
conjugations: Gilbert disease, Criggler-Najjar disease, the taking
of rifampicin (antitubercular antibiotic); [0072] hepatic and
biliary conditions: the various types of hepatitis (viral, toxic,
drug-related), the various types of cirrhosis, rare metabolic
abnormalities (Rotor's disease, Dubin-Johnson disease); [0073]
biliary conditions; [0074] biliary lithiasis; [0075] pancreatitis;
[0076] pancreatic or bile duct cancer.
[0077] The present invention thus relates to the use of the BOD
according to the present invention for measuring the bilirubin
concentration in a liquid sample, in particular a biological
sample.
[0078] According to a first variant, the principle of the assaying
of bilirubin with BOD is based on measuring the change in colour of
the sample caused by the degradation of the bilirubin.
[0079] Bilirubin exhibits a light absorption peak (.lamda..sub.max)
at 440 nm; when it is enzymatically degraded by a BOD, the
absorbance at .lamda..sub.max of the sample in which it is present
decreases; this decrease makes it possible to quantify the
bilirubin initially present in the sample by comparison with the
decrease in absorbance at 440 nm of calibration solutions
containing known bilirubin contents measured under the same
experimental conditions.
[0080] The present invention also relates to a kit for assaying
bilirubin in solution, characterized in that it comprises a BOD
according to the invention.
[0081] Typically, the assaying kit also contains the reagents
necessary for carrying out the bilirubin assay test, in particular:
[0082] the buffers; [0083] the standard solutions of bilirubin for
producing calibration curves, and [0084] the set of instructions
necessary for carrying out the assay.
[0085] The present invention also relates to a method for assaying
the bilirubin in solution in a liquid sample, characterized in that
it comprises the following steps: [0086] a) measuring the
absorbance at .lamda..sub.max=440 nm of said liquid sample before
enzymatic reaction; [0087] b) introducing a BOD according to the
invention into said liquid sample; [0088] c) measuring the
absorbance at .lamda..sub.max=440 nm of said liquid sample after
enzymatic reaction; [0089] d) calculating the difference in
absorbances measured in steps a) and c) and comparing this
difference with differences in absorbances measured for standard
solutions having a known bilirubin content; [0090] e) determining
the initial concentration of bilirubin of said liquid sample.
[0091] According to another variant, the assaying of the bilirubin
in a liquid sample is carried out by means of an electrochemical
method which uses an electrode including the BOD according to the
invention. Thus, the present invention also relates to BOD
electrodes comprising a conductive material, such as a conductive
metal, in particular platinum, copper, silver, aluminium, gold or
steel, or carbon, for instance vitreous carbon, carbon fibres,
fibres of carbon nanotubes or alternatively which are made of
diamond, etc., said conductive material being coated with a deposit
comprising at least one BOD according to the invention, it also
being possible for said deposit to comprise a redox polymer in
order to improve the electrical conduction between the enzyme and
the electrode and also the stability of the system.
[0092] The redox polymer can, for example, be chosen from
ferrocene-based, osmium-based and ruthenium-based polymers and
conducting polymers such as, for example, polypyrrole and
polyanaline.
[0093] The methods for immobilizing the BOD on said conductive
material can be chosen from the conventional methods available to
those skilled in the art, which comprise, in particular, embedding
of the BOD in a polymer matrix, adsorption of the BOD at the
surface of the polymer membrane, attachment by covalent bonding,
electrodeposition (Gao et al., Chem. Int. ED. 2002, 41, No. 5,
810-813) or else the technique described in United States patent
application US 2009/0053582. According to one embodiment variant,
the BOD electrode on which the BOD is immobilized is also coated
with a membrane which prevents the detachment of said enzyme from
the electrode. According to the applications envisaged, said
membrane can be constituted of nafion, of cellulose or of any other
biocompatible material, i.e. material compatible with a
physiological environment.
[0094] The present invention thus also relates to a bilirubin
biosensor constituted of a BOD electrode according to the
invention. Generally, a biosensor consists of an electrode on which
a bioreceptor capable of recognizing a biological target is
immobilized; the binding of the biological target to the
bioreceptor results in physicochemical modifications of the
membrane and the production of an electrical signal by an
electro-chemical (amperometric, potentiometric, conductometric,
etc.) transducer joined to the electrode. In the present case, the
biosensor is a BOD according to the invention and the biological
target is bilirubin.
[0095] The present invention also relates to a method for assaying
bilirubin in solution in a liquid sample with a bilirubin biosensor
according to the invention. According to one variant of use of the
bilirubin biosensor, the latter is implanted under the skin of an
individual and makes it possible to record the bilirubin
concentration in the blood of said individual.
[0096] The present invention also relates to an oxygen sensor
constituted of an electrode according to the invention. The BOD
electrode according to the invention can also be advantageously
used as a cathode in an enzymatic biofuel cell; FIG. 1A represents
schematically the operating principle for an enzymatic biofuel
cell. The enzymatic biofuel cells according to the invention are
devices comprising a BOD electrode as a cathode and an anode where
a substrate oxidation reaction takes place (catalysed by the
"enzyme X"); by way of illustration, the substrate may be glucose
and the "enzyme X" glucose oxidase; such a cell is of particular
interest when the biofuel cell is implanted in an individual for a
medical application. The substrate can also be chosen, for example,
from nitrites, nitrates, sulphides, urates, ascorbates, glutamates,
pyruvates, lactates, cellulose, etc., if an application in
depollution is envisaged; the choice of the enzyme will then be
made according to the substrate to be degraded; by way of example,
the following enzymes can be used, the type of substrate that they
can degrade is mentioned between parentheses: glucose oxidase
(glucose or any sugars that are oxidized by this enzyme), lactate
oxidase (lactate), pyruvate oxidase (pyruvate), alcohol oxidase
(alcohol), cholesterol oxidase (cholesterol), glutamate oxidase
(glutamate), pyranose oxidase (pyranose), choline oxidase
(choline), cellobiose dehydrogenase (celloboise), glucose
dehydrogenase (glucose or any sugars that are oxidized by this
enzyme), pyranose dehydrogenase (pyranose), fructose dehydrogenase
(fructose), aldehyde oxidase (aldehyde), gluconolactone oxidase
(gluconolactone), alcohol dehydrogenase (alcohol), ascorbate
oxidase (oxygen or ascorbate) or else sulphide dioxygenase
(sulphide). The concomitant oxidation and reduction process at the
electrodes of the biofuel cell produces an electric current.
[0097] FIG. 1B illustrates more specifically a glucose-based
enzymatic biofuel cell; such an enzymatic biofuel cell consists of
two electrodes modified by the immobilization of enzymes. A glucose
oxidase (GOx) is attached to the anode (1) by means of a conducting
polymer "I" and a bilirubin oxidase (BOD) is attached to the
cathode (2) by means of a conducting polymer "II". In operating
mode, at the anode, the electrons are transferred from the glucose
present in the physiological fluid to the GOx, then from the GOx to
the conducting polymer "I" and from the conducting polymer "I" to
the anode. At the cathode, the electrons are transferred from the
cathode to the conducting polymer "II", then to the BOD and,
finally, from the BOD to the oxygen present in the physiological
fluid.
[0098] It should be noted that a biofuel cell can also optionally
operate by modifying the electrodes with their respective enzymes
and adding soluble mediators, such as ferrocenemethanol for the
anode and potassium ferricyanide for the cathode, and adding, as
appropriate, a membrane separating the anode and the cathode.
[0099] According to another aspect, the present invention relates
to the use of a BOD according to the invention for degrading the
bilirubin present in a sample, in particular a biological sample.
This is because the presence of bilirubin in a sample is capable of
distorting the detection of other substances (such as blood glucose
or blood cholesterol) in particular when these other substances are
detected by a colorimetric method.
[0100] Generally, the BODS according to the invention have many
industrial applications, in particular in the textile and paper
industries and in the food sector, in order, for example, to
improve the stability and/or the quality of foods, such as
beverages, or else foods containing vegetable oils, by
deoxygenation.
[0101] More specifically, the BODS can be used for applications
related to depollution; by way of example, mention may be made of
the discoloration or the detoxification of wastewater and the
degradation of xenobiotics; as organic synthesis reactants; for the
preparation of antimicrobial compositions; for the production of
articles made of wood and of cartons which have been detoxified or
else for the production of detergent (Morozova at al. Biochemistry
(Mosc.) 2007 October; 72(10):1136-50) and for the discoloration of
dyes used in industrial media.
[0102] The BOD according to the invention can also be used for
dimerizing phenolic acid (Koschorreck, K., et al. 2008. Appl
Microbiol Biotechnol (2008) 79:217-224) and thus is of interest in
the synthesis of pigments and dyes used in textile and food
applications (R. Mustafa et al. Food Research International. Volume
38, Issues 8-9, October-November 2005, pages 995-1000); this
dimerization reaction can also be used for the preparation of
antioxidant compounds, for instance ferulic acid dimers
(Garcia-Conesa M T, et al. Redox Rep. 1997 Oct-December;
3(5-6):319-23).
[0103] The BOD according to the invention can also be used as a
reactant in a composition for the oxidation dyeing of keratin
fibres, such as a hair-dyeing composition, comprising, in a medium
suitable for dyeing, at least one oxidation base, a BOD according
to the invention and, optionally, a donor for said BOD (such as a
substrate, for instance bilirubin). The various ingredients, other
than the BOD, that can be used in said composition are described in
international application WO 99/15138; by way of example, the
oxidation base(s) can be chosen from para-phenylene-diamines,
double bases, para-aminophenols, ortho-aminophenols and
heterocyclic oxidation bases.
[0104] The BOD according to the invention can advantageously be
used for treating wood pulp for its action on lignin degradation
and/or for producing a paper which has a better wet strength (see
international application WO 00/68500).
[0105] In addition to the above arrangements, the invention also
comprises other arrangements which will emerge from the description
that follows, which refer to exemplary embodiments of the present
invention, and also to the appended figures in which:
FIGURES
[0106] FIG. 1A represents schematically the operating principle for
an enzymatic biofuel cell; FIG. 1B represents a glucose-based
enzymatic biofuel cell.
[0107] FIG. 2 represents the plasmid map of the pFD1 vector.
[0108] FIG. 3 is a graph illustrating the specific activity, in
U/mg, of the Bacillus pumilus BOD as a function of the ABTS
concentration at 37.degree. C.
[0109] FIG. 4 is a graphic representation of the Michaelis-Menten
equation (k.sub.55 in s.sup.-1 as a function of the unconjugated
bilirubin concentration) for the Bacillus pumilus BOD at 37.degree.
C.
[0110] FIG. 5 represents the catalytic activity for oxidation of
conjugated bilirubin by the Bacillus pumilus BOD at 37.degree. C.
in a 50 mM citrate/phosphate buffer, pH 4.8.
[0111] FIG. 6 represents the catalytic activity for oxidation of
syringaldazine (SGZ) by the Bacillus pumilus BOD at 37.degree. C.
in a 50 mM citrate/phosphate buffer, pH 6.2.
[0112] FIG. 7 represents the catalytic activity for oxidation of
DMP by the Bacillus pumilus BOD at 37.degree. C. in a 50 mM
citrate/phosphate buffer, pH 6.8.
[0113] FIG. 8 represents the relative activity of the Bacillus
pumilus BOD with respect to various substrates as a function of the
pH.
[0114] FIGS. 9A and 9B are graphs representing the stability as a
function of pH of the Bacillus pumilus BOD on ABTS oxidation at
4.degree. C.
[0115] FIG. 10 is a histogram representing ABTS oxidation as
relative activity by the Bacillus pumilus BOD as a function of
temperature.
[0116] FIGS. 11A and 11B represent graphically the stability
(expressed as specific activity and as relative activity on ABTS
oxidation) of the Bacillus pumilus BOD as a function of enzyme
incubation time at 80.degree. C.
[0117] FIGS. 12A and 12B represent graphically the activity
(expressed as specific activity and as relative activity on ABTS
oxidation) of the Bacillus pumilus BOD as a function of urea
concentration at 25.degree. C. or 37.degree. C. in a 100 mM
citrate/phosphate buffer, pH 3.
[0118] FIG. 13 represents the relative activity of the oxidation of
SGZ by the Bacillus pumilus BOD as a function of NaCl
concentration.
[0119] FIG. 14 represents the discoloration of RBBR at 80
mg.l.sup.-1 by the Bacillus pumilus BOD at 37.degree. C. in a 50 mM
potassium phosphate buffer, pH 6, in the presence or absence of 10
.mu.M ABTS.
EXAMPLE
[0120] 1. Materials
[0121] 1.1 Escherichia coli Bacterial Strains
[0122] DH.sub.5.alpha.: supE44, .DELTA.lacU169, (.PHI.80 lacZDM15),
hsdR17, recA1, endA1, gyrA96, thi-1, relA1 (Hanahan, 1983).
[0123] This strain is used to amplify plasmids during the steps for
constructing the protein expression vectors.
[0124] BL.sub.21 Star: F-ompT hsdSB(rB-, mB-) gal dcm rnel31 (DE3)
(Invitrogen).
[0125] This strain is used to produce the Bacillus pumilus BOD in
Erlenmeyer flasks.
[0126] This strain is then transformed with the pFD1 plasmid which
contains the DNA sequence encoding the Bacillus pumilus BOD under
the control of the T7 promoter in the pET2la vector.
[0127] 1.2 Vector
[0128] pFD1: pET2la plasmid containing the nucleic acid sequence
SEQ ID No. 1 encoding the Bacillus pumilus BOD cloned in-frame with
the 6.times.His tag in the C-terminal position.
[0129] The plasmid map of the pFD1 vector is represented in FIG.
2.
[0130] 1.3 Culture Medium
[0131] LB Rich Medium:
[0132] 10 g/l tryptone
[0133] 5 g/l yeast extract
[0134] 5 g/l NaCl
[0135] Distilled H.sub.2O qs 1 L
[0136] pH not adjusted, autoclaved for 50 min at 1 bar.
[0137] 2. Genetic Engineering Techniques
[0138] 2.1 Transformation of Supercompetent Bacteria
[0139] Supercompetent DH.sub.5.alpha. bacteria are prepared using
the SEM method (Simple and Efficient Method) according to the
protocol described by Inoue et al. (Inoue et al. 1990, Gene
96:23-28).
[0140] 2.2 DNA Preparation
[0141] A plasmid DNA purification kit (Quiagen) is used for the DNA
preparations in small and large amounts.
[0142] 2.3 Double-Stranded DNA Sequencing
[0143] The double-stranded DNA is sequenced. The sequencing
reactions are carried out with the BigDye Terminator v1.1 or v3.1
sequencing kit. The reagent contains the 4 ddNTPs with various
fluorescent labels (BigDye Terminators), the AmpliTaq DNA
polymerase, and all the other components necessary for the
reaction. The extension products should be purified before being
passed through an ABI 3130x1 sequencer, in order to remove the
unincorporated labels, the salts and the other contaminants.
[0144] 2.4 Construction of the BOD Expression Vector
[0145] The PCR is carried out with the Phusion HF DNA polymerase on
the genomic DNA of the Bacillus pumilus bacterium, strain SAFR-032.
The two oligodeoxyribo-nucleotides, complementary to the 3' and 5'
ends of the DNA sequence of the gene encoding the Bacillus pumilus
BOD (SEQ ID No. 3 and 4) will be used as primers for the DNA
synthesis.
[0146] The amplified product and also the pET21a plasmid are then
treated with the two restriction enzymes BamHl and Xhol, the
recognition sequences of which have been introduced into the sense
oligonucleotide for BamHl and the antisense oligonucleotide for
Xhol, respectively denoted SEQ ID No. 3 and 4. The digestion
products are gel-purified with the "Nucleospin.RTM." kit
(NucleoSpin.RTM. Extract II, Clontech Laboratories, Inc.) and the
BOD gene is then ligated into the plasmid by coincubation with T4
DNA ligase at 37.degree. C. overnight. The newly formed plasmids
are then selected and amplified by transformation of DH5.alpha.
bacteria on a plate containing ampicillin.
TABLE-US-00002 TABLE II List of primers used Primer name Sequence
SEQ ID No. B. pumilus_S_BamH1 CATGGATCCATGAACCTAGAAAAATTTGTTGACGAG
3 B. pumilus_AS_Xhol TACCTCGAGAATAATATCCATCGGCCTCATCATGTC 4
[0147] 3. Production, Purification and Characterization of the
Bacillus pumilus Bilirubin Oxidase Enzyme
[0148] 3.1 Production of Wild-Type BOD Enzymes
[0149] The BOD enzyme is produced in the E. coli BL.sub.21 star
strain by the pET21a recombinant plasmid carrying the sequence
encoding wild-type BOD. A 50 ml preculture of LB medium
supplemented with ampicillin (150 mg/l) (LBA) and 0.25 mM
CuSO.sub.4 is inoculated with a clone isolated on an LB agar plate
supplemented with ampicillin (100 mg/l), and left shaking, at 220
rpm, overnight at 37.degree. C. Two litres of LBA medium containing
0.25 mM CuSO.sub.4, in a 5 L Erlenmeyer flask, are then inoculated
at 1/100.sup.th. The latter is incubated at 37.degree. C. with
shaking (220 rpm) until an OD.sub.600 nm of between 0.8 and 1
OD.sub.600 nm/ml is obtained. The culture is then induced with 200
.mu.M of IPTG and left shaking (180-220 rpm) at 25.degree. C. for 4
hours. The cells are then transferred into a sterile 2 L Schott
bottle containing a magnetic bar, so as to continue, for 20 hours,
the culture and the protein induction with shaking under anaerobic
conditions in order to increase the incorporation of copper into
the bacteria. The cells harvested by centrifugation (4000 g,
4.degree. C.) are washed in water and stored at -20.degree. C. It
is important to emphasize that the induction of the expression of
this BOD in the E. coli bacterium is carried out in only 24 hours;
this represents a considerable advantage compared with the
protocols for induction of the commercial enzymes currently
available. This is because the production of BODS derived from
Myrothecium verrucaria can require induction periods of up to 5
days.
[0150] 3.2 Purification of Wild-Type BOD Enzymes
[0151] 3.2.1 Rupture of Cells and Treatment with DNase I
[0152] The cell pellet, derived from two litres of culture, is
taken up in 40 ml of 50 mM sodium phosphate buffer containing 500
mM NaCl and 20 mM imidazole, pH 7.6, and sonicated 10 times at a
sonication power of 40 W for 3 minutes by cycle of a second of
ultrasound and a second of interruption. The sample obtained,
called crude extract, is supplemented with a final concentration of
2 mM of MgCl.sub.2 and treated for 30 minutes at ambient
temperature with DNase I (1 U/ml of crude extract). The insoluble
cell debris is then removed from the crude extract by
centrifugation for 60 minutes at 20 000 g.
[0153] 3.2.2 Affinity Chromatography on Nickel Column
[0154] The sonication supernatant filtered through a 0.22 .mu.m
filter and diluted to an OD.sub.280 nm of 10 is injected onto a
HisPrep FF 16/10 affinity column (GC Healthcare.RTM.), coupled to
the AKTA purifier system (GC Healthcare.RTM.), equilibrated in a 50
mM sodium phosphate buffer containing 500 mM NaCl and 20 mM
imidazole, pH 7.6. The elution is carried out with a gradient of 5%
to 30% of a 50 mM sodium phosphate buffer containing 500 mM NaCl
and 1M imidazole, pH 7.6, at a flow rate of 1 ml/min. The fractions
containing the BOD protein are identified by means of an ABTS
activity test and are combined, concentrated and desalified with a
50 mM sodium phosphate buffer, pH 7.6, by centrifugation on an
Amicon YM10 membrane. At this stage, the BOD protein is pure and
can be stored at -20.degree. C. in soluble form.
[0155] Here again, by comparing with the commercially available BOD
purification methods, the clear advantage resulting from the use of
this protein can be emphasized. This is because a single
purification step is necessary in order to obtain a pure enzyme, as
opposed to the succession of chromatographies (size exclusion,
anion or cation exchange, hydrophobic, etc.) essential for the
commercial BODs.
[0156] 3.2.3 Characterization of Wild-Type BOD Enzymes
[0157] 3.2.3.1 Molecular Weight Determination
[0158] The analysis of the weight of the whole protein was carried
out on the LCQ Deca XP mass spectrometer coupled upstream of a nano
liquid chromatography apparatus fitted with a C4 desalting and
pre-concentrating column (.mu.-Precolumn.TM. Cartridge; Acclaim
PepMap 300; internal o 300 .mu.m.times.5 m; LC Packings Dionex) and
of a C4 analytical column (C4 PepMap 300; internal o 75
.mu.m.times.5 cm; LC Packings Dionex). A weight of 61005.91 Da was
obtained for the BOD, i.e. a difference of 130.4 Da compared with
the theoretical weight of the protein; the theoretical weight is
calculated for the protein truncated at the N-terminal methionine,
a difference of only 0.80 Da is found, which demonstrates cleavage
of this amino acid in the bacterium during the protein maturation
process.
[0159] 3.2.3.2 Concentration Measurement
[0160] The enzyme concentration of a solution is calculated
according to the Bradford technique using BSA as standard
(Bradford, anal. Biochimie 72:248, 1976).
[0161] 3.2.3.3 Enzymatic Assay
[0162] The enzymatic assays are carried out using a Varian
spectrophotometer in a 0.1M citrate/phosphate buffer at 37.degree.
C. in a volume of 3 ml, with the oxidation of ABTS being followed
at 420 nm as a function of time (.epsilon..sub.420 nm=36 mM.sup.-1
cm.sup.-1). The specific activity of the enzyme is expressed in
pmol of ABTS oxidized per minute and per mg of protein. The
standard ABTS concentration used is 1 mM. The enzyme is diluted so
as to measure a slope between 0.05 and 0.3 OD.sub.420 nm/min.
[0163] 4. Techniques for Studying the Enzymatic Oroperties of the
Wild-Type Bacillus pumilus BOD Enzyme
[0164] 4.1 Determination of the Kinetic (k.sub.cat) and Michaelis
(K.sub.M) Constants in the Stationary State
[0165] 4.1.1 The Substrate is
2,2'-azinobis(3-ethylbenzothiazoline-6-sulphonic Acid) (ABTS)
[0166] The experiments are carried out at 37.degree. C. on a Varian
spectrophotometer in a 0.1 M citrate/phosphate buffer, pH 3. The
ABTS concentration varies in the test from 0 to 5 mM. The test is
triggered by adding enzyme. The experimental points are analysed by
nonlinear regression according to the Michaelis-Menten model using
the Sigma-plot 6.0 software according to the equation below:
Michaelis-Menten model: k.sub.ss=k.sub.cat*[S]/(K.sub.M+[S])
[0167] Results:
k.sub.cat=391.3 s.sup.-1 and K.sub.M=31.7 .mu.M.
[0168] FIG. 3 illustrates graphically the specific activity, in
U/mg, of the Bacillus pumilus BOD as a function of ABTS
concentration.
[0169] By way of comparison, the homologous CotA protein of
Bacillus subtilis exhibits, with respect to ABTS under the same
optimal activity conditions, a k.sub.cat of 322 s.sup.-1 for a
K.sub.M of 124 .mu.M (Martins et al., 2008. J Biol Inorg Chem,
13:183-193).
[0170] 4.1.2 The Substrate is Unconjugated Bilirubin
[0171] The experiments are carried out at 37.degree. C. in a Varian
spectrophotometer in a 50 mM sodium phosphate buffer, pH 7. The
bilirubin concentration varies in the test from 0 to 60 .mu.M. The
test, triggered by the addition of enzyme, consists in following
the oxidation of the bilirubin at 450 nm by colorimetric change
(.epsilon..sub.450 nm=32 mM.sup.-1 cm.sup.-1). The experimental
points are analysed by nonlinear regression according to the
Michaelis-Menten model using the Sigma-plot 6.0 software according
to the equation below:
Michaelis-Menten model: k.sub.ss=k.sub.cat*[S]/(K.sub.M+[S])
[0172] Results:
k.sub.cat=70 s.sup.-1 and K.sub.M=22 .mu.M.
[0173] FIG. 4 is the graphic representation of the Michaelis-Menten
equation (k.sub.ss in s.sup.-1 as a function of unconjugated
bilirubin concentration) for the Bacillus pumilus BOD.
[0174] 4.1.3 The Substrate is Conjugated Bilirubin
[0175] The experiments are carried out at 37.degree. C. on a Varian
spectrophotometer in a 50 mM sodium phosphate buffer, pH 4.8. The
bilirubin concentration varies in the test from 0 to 150 .mu.M. The
test, triggered by adding enzyme, consists in following the
oxidation of the conjugated bilirubin at 440 nm by colorimetric
change (.epsilon..sub.440 nm=25 mM.sup.-1 cm.sup.-1). The
experimental points are analysed by nonlinear regression according
to the Michaelis-Menten model using the Sigma-plot 6.0 software
according to the equation below:
Michaelis-Menten model: k.sub.ss=k.sub.cat*[S]/(K.sub.M+[S])
[0176] Results:
k.sub.cat=66.8 s.sup.-1 and K.sub.M=35.1 .mu.M.
[0177] FIG. 5 represents the catalytic activity for oxidation of
the conjugated bilirubin by the Bacillus pumilus BOD at 37.degree.
C. in a 50 mM citrate/phosphate buffer, pH 4.8.
[0178] 4.1.4 The Substrate is Syringaldazine (SGZ)
[0179] The experiments are carried out at 37.degree. C. on a Varian
spectrophotometer in a 50 mM citrate/phosphate buffer, pH 6.2. The
SGZ concentration, diluted in methanol, varies in the test from 0
to 300 .mu.M. The test, triggered by adding the enzyme, consists in
following the oxidation of the SGZ at 530 nm by coloroimetric
change (.epsilon..sub.530 nm=64 mM.sup.-1 cm.sup.-1). The
experimental points are analysed by nonlinear regression according
to the Michaelis-Menten model with competitive inhibition, using
the Sigma-plot 6.0 software according to the equation below:
[0180] Michaelis-Menten model with competitive inhibition:
k.sub.ss=k.sub.cat*[S]/(K.sub.M+[S]+[S].sup.2/K.sub.i)
[0181] Results:
k.sub.cat=116.1; K.sub.M=45.6 .mu.M and K.sub.i=82.9 .mu.M.
[0182] FIG. 6 represents the catalytic activity for oxidation of
syringaldazine by the Bacillus pumilus BOD at 37.degree. C. in a 50
mM citrate/phosphate buffer, pH 6.2.
[0183] 4.1.5 The Substrate is 2,6-dimethoxyphenol (DMP)
[0184] The experiments are carried out at 37.degree. C. on a Varian
spectrophotometer in a 50 mM sodium phosphate buffer, pH 6.8. The
2,6-dimethoxyphenol concentration varies in the test from 0 to 4000
uM. The test, triggered by adding the enzyme, consists in following
the oxidation of the DMP at 468 nm by coloroimetric change
(.epsilon..sub.468 nm=14.8 mM.sup.-1 cm.sup.-1). The experimental
points are analysed by nonlinear regression according to the
Michaelis-Menten model using the Sigma-plot 6.0 software according
to the equation below:
Michaelis-Menten model: k.sub.ss=k.sub.cat*[S]/(K.sub.M+[S])
[0185] Results:
k.sub.ss=57.3 s.sup.-1 and K.sub.M=822 .mu.M.
[0186] FIG. 7 represents the catalytic activity for oxidation of
DMP by the Bacillus pumilus BOD at 37.degree. C. in a 50 mM
citrate/phosphate buffer, pH 6.8.
[0187] 4.2 Study as a Function of pH
[0188] 4.2.1 Activity as a Function of pH
[0189] 4.2.1.1 ABTS
[0190] The study of the variation in the reaction rate constant as
a function of pH is carried out on a pH range of from 3 to 7 in a
0.1 M citrate/phosphate buffer, using 1 mM ABTS as substrate. The
experiments are carried out at 37.degree. C. using a Varian
spectrophotometer. The activity is followed by oxidation of the
ABTS resulting in a colorimetric change measured at 420 nm. The
test is triggered by adding enzyme.
[0191] The results of the oxidation of ABTS, as a function of pH,
by the Bacillus pumilus BOD are represented as relative activity on
the graph of FIG. 8.
[0192] 4.2.1.2 Unconjugated Bilirubin
[0193] The study of the variation in the reaction rate constant as
a function of pH is carried out on a pH range of from 7 to 8.5 in a
0.2 M tris-HCl buffer, using 30 .mu.M unconjugated bilirubin as
substrate. The experiments are carried out at 37.degree. C. using a
Varian spectrophotometer. The activity is followed by oxidation of
the bilirubin resulting in a colorimetric change measured at 450 nm
(.epsilon..sub.450 nm=32 mM.sup.-1 cm.sup.-1). The test is
triggered by adding enzyme.
[0194] The results of the oxidation of unconjugated bilirubin, as a
function of pH, by the Bacillus pumilus BOD are represented as
relative activity on the graph of FIG. 8.
[0195] 4.2.1.3 Conjugated Bilirubin
[0196] The study of the variation in the reaction rate constant as
a function of pH is carried out on a pH range of from 3 to 7 in a
0.1 M citrate/phosphate buffer, using 100 .mu.M conjugated
bilirubin as substrate. The experiments are carried out at
37.degree. C. using a Varian spectrophotometer. The activity is
followed by oxidation of the conjugated bilirubin resulting in a
colorimetric change measured at 440 nm. The test is triggered by
adding enzyme.
[0197] The results of the oxidation of conjugated bilirubin, as a
function of pH, by the Bacillus pumilus BOD are represented as
relative activity on the graph of FIG. 8.
[0198] 4.2.1.4 Syringaldazine (SGZ)
[0199] The study of the variation in the reaction rate constant as
a function of pH is carried out on a pH range of from 3 to 7.5 in a
0.1 M citrate/phosphate buffer, using 22 .mu.M syringaldazine as
substrate. The experiments are carried out at 37.degree. C. using a
Varian spectrophotometer. The activity is followed by oxidation of
the syringaldazine resulting in a colorimetric change measured at
530 nm. The test is triggered by adding enzyme.
[0200] The results of the oxidation of syringaldazine, as a
function of pH, by the Bacillus pumilus BOD are represented as
relative activity on the graph of FIG. 8.
[0201] 4.2.1.5 2,6-Dimethoxyphenol (DMP)
[0202] The study of the variation in the reaction rate constant as
a function of pH is carried out on a pH range of from 3 to 7.5 in a
0.1 M citrate/phosphate buffer, using 1 mM DMP as substrate. The
experiments are carried out at 37.degree. C. using a Varian
spectrophotometer. The activity is followed by oxidation of the DMP
resulting in a colorimetric change measured at 468 nm. The test is
triggered by adding enzyme.
[0203] The results of the oxidation of DMP, as a function of pH, by
the Bacillus pumilus BOD are represented as relative activity on
the graph of FIG. 8.
[0204] 4.2.2 Stability as a Function of pH
[0205] The stability as a function of pH, of the wild-type BOD, is
determined by dilution of the enzyme, purified to homogeneity, in a
mixed buffer ranging from pH 3 to 9 at ambient temperature. This
mixed buffer is composed of 120 mM Tris, 30 mM imidazole and 30 mM
acetic acid, the ionic strength of which is adjusted to 190 mM with
NaCl. Various samples are taken as a function of time.
[0206] The residual activity is measured at 4.degree. C. using a
Varian spectrophotometer, in a 0.1 M citrate/phosphate buffer, pH
3, containing 1 mM ABTS.
[0207] The results of specific activity and of relative activity of
the oxidation of ABTS as a function of pH at 4.degree. C. are
represented in the graphs of FIGS. 9A and 9B.
[0208] 4.3 Study as a Function of the Temperature
[0209] 4.3.1 Activity as a Function of Temperature
[0210] The study of the variation in the reaction rate constant as
a function of temperature is carried out in a 0.1 M
citrate/phosphate buffer, pH 3, in the presence of 1 mM of
ABTS.
[0211] The temperature ranges from 10 to 85.degree. C. The activity
is followed on a temperature-regulated Varian Cary UV Biomelt
spectrophotometer. The test is triggered by adding enzyme.
[0212] FIG. 10 is a histogram representing the relative activity of
the Bacillus pumilus BOD as a function of temperature on ABTS
oxidation.
[0213] 4.3.2 Stability of the Enzyme as a Function of
Temperature
[0214] The enzyme is preincubated at a concentration of 10 mg/ml in
a dry bath at 80.degree. C. 2 .mu.l samples are taken and the
enzyme is diluted in a 50 mM sodium phosphate buffer, pH 7.6, so as
to adjust the enzyme concentration for the activity test. The
residual activity of the enzyme incubated at 80.degree. C. is
determined using a Varian spectrophotometer, in a 0.1
citrate/phosphate buffer, pH 3, at 37.degree. C., in the presence
of 1 mM of ABTS. The test is triggered by adding enzyme.
[0215] FIGS. 11A and 11B represent graphically the stability
(expressed as specific activity and as relative activity on ABTS
oxidation) of the Bacillus pumilus BOD as a function of enzyme
incubation time at 80.degree. C.
[0216] 4.4 Study of the Activity as a Function of the Presence of
Urea
[0217] The protocol described above in point 4.1.1 was reproduced
in the presence of a urea concentration ranging between 0 and 6
M.
[0218] FIGS. 12A and 12B represent graphically the activity
(expressed as specific activity and as relative activity on ABTS
oxidation) of the Bacillus pumilus BOD as a function of urea
concentration at 25.degree. C. and at 37.degree. C.
[0219] At 25.degree. C., an activating effect of the urea on the
BOD is clearly observed. This effect could be due to a slight
conformational modification of the active site of the enzyme that
would be responsible for better enzymatic efficiency; this
phenomenon, which is known, has already been described for other
proteins (see Hong-Jie Zhang et al. Biochemical and Biophysical
Research Communications 238, 382-386 (1997) and Fan et al. Biochem.
J. (1996) 315, 97-102). At 37.degree. C., this effect is not found.
It is possible to put forward the hypothesis that the combined
effect of the temperature and of the urea results in too great a
modification of the active site, consequently leading to a decrease
in the performance levels of the enzyme.
[0220] 4.5 Study of the Activity as a Function of the Presence of
NaCl
[0221] The experiments are carried out at 37.degree. C. on a Varian
spectrophotometer in a 50 mM citrate/phosphate buffer, pH 6.2, with
increasing concentrations of NaCl, from 0 mM to 1000 mM. The
concentration of SGZ, diluted in methanol, is fixed in the test at
50 .mu.M. The test, triggered by adding enzyme, consists in
following the oxidation of the SGZ at 530 nm by colorimetric change
(.epsilon..sub.530 nm=64 mM .sup.1-.cm .sup.-1) .
[0222] FIG. 13 represents the relative activity of SGZ oxidation by
the Bacillus pumilus BOD as a function of NaCl concentration.
[0223] 4.6 Study of the Activity as a Function of the Presence of
DTT or of EDTA
[0224] The experiments are carried out at 37.degree. C. on a Varian
spectrophotometer in a 50 mM citrate/phosphate buffer, pH 6.2, with
increasing concentrations of DTT, from 0 mM to 50 .mu.M, or else of
EDTA, from 0 to 125 mM. The concentration of SGZ, diluted in
methanol, is fixed in the test at 50 .mu.M. The test, triggered by
adding enzyme, consists in following the oxidation of the SGZ at
530 nm by colorimetric change (.epsilon..sub.530 nm-64
mM.sup.-1.cm.sup.-1). Table III below collates the results
obtained, presented in relative activity form.
TABLE-US-00003 TABLE III Compound Concentration (mM) Relative
activity (%) EDTA 0 100 .+-. 0 0.1 97 .+-. 1 1 99 .+-. 5 10 95 .+-.
1 25 98 .+-. 3 50 99 .+-. 4 75 95 .+-. 2 100 95 .+-. 1 125 89 .+-.
3 DTT 0 100 .+-. 0 0.001 99 .+-. 4 0.005 93 .+-. 2 0.01 93 .+-. 4
0.015 94 .+-. 3 0.03 85 .+-. 1 0.05 81 .+-. 4
[0225] 4.7 Study of the Remazol Brilliant Blue R (RBBR)
Discoloration Activity
[0226] Like many other laccases and bilirubin oxidases, the
Bacillus pumilus BOD has a discolouring activity on dyes used in
the textile industry. Remazol Brilliant Blue R (RBBR) was selected
as an example, and the discoloration thereof is measured over time
in the presence or absence of a mediator such as ABTS. The
experiments are carried out at 37.degree. C. on a Varian
spectrophotometer, in a 50 mM potassium phosphate buffer, pH 6, in
the absence or presence of ABTS at 3 ml. The RBBR concentration is
fixed at 80 mg.l.sup.-1 in each tank. The test, triggered by adding
10 .mu.g of enzyme, consists in following, over time, the
discoloration of the RBBR dye at 593 nm.
[0227] FIG. 13 represents the discoloration of RBBR by the Bacillus
pumilus BOD at 3.33 .mu.g.ml.sup.-1 at 37.degree. C. in a 50 mM
potassium phosphate buffer, pH 6, in the absence or presence of
ABTS at 10 .mu.M.
[0228] 5. Verification of the Presence of the Four Coppers of the
Bacillus pumilus Bilirubin Oxidase
[0229] The presence of the 4 coppers is determined by means of a
bioquinoline assay using a calibration range for copper
concentration in order to measure the molar concentration of copper
(Felsenfeld, G. 1960. Arch. Biochem. Biophys., 87, 247-251;
Griffiths et al. 1961, J. Biol. Chem., 236, 1850-1856); the results
are given in Table III.
[0230] Each measurement, based on a colorimetric assay at 546 nm,
is carried out in duplicate.
[0231] This techniques makes it possible to show the presence of
15.3 .mu.M of copper for a BOD protein sample at 3.75 .mu.M, i.e. a
ratio of 4.08, and clearly confirms the presence of the four copper
ions associated with the enzyme.
[0232] Finally, in order to confirm the presence of the 4 coppers
in the BOD protein, an elemental analysis on the coppers of the
protein was carried out by atomic absorption. The results clearly
confirmed the presence of 4 coppers per protein.
TABLE-US-00004 TABLE IV Experimental protocol for the bioquinoline
assay necessary for assaying the copper of the BOD. Copper
Imidazole solution buffer Biquinoline Copper (solu- (solu- (solu-
Total concentration tion 2) tion 1) tion 3) volume in the sample
Sample (.mu.l) (.mu.l) (.mu.l) (.mu.l) (.mu.M) 1 0 1200 1800 3000 0
2 0 1200 1800 3000 0 3 120 1080 1800 3000 12.59 4 120 1080 1800
3000 12.59 5 240 960 1800 3000 25.18 6 240 960 1800 3000 25.18 7
360 840 1800 3000 37.77 8 360 840 1800 3000 37.77 9 480 720 1800
3000 50.36 10 480 720 1800 3000 50.36 11 600 600 1800 3000 62.95 12
600 600 1800 3000 62.95 BOD_1 450 750 1800 3000 15.7 (3.75 .mu.m)
BOD_2 450 750 1800 3000 15.3 (3.75 .mu.M)
Sequence CWU 1
1
611593DNABacillus pumilusCDS(1)..(1593) 1atg gct agc atg act ggt
gga cag caa atg ggt cgc gga tcc atg aac 48Met Ala Ser Met Thr Gly
Gly Gln Gln Met Gly Arg Gly Ser Met Asn 1 5 10 15 cta gaa aaa ttt
gtt gac gag ctg cca att cca gaa gtt gcg gag ccc 96Leu Glu Lys Phe
Val Asp Glu Leu Pro Ile Pro Glu Val Ala Glu Pro 20 25 30 gtc aaa
aag aac cca aga caa aca tat tat gaa atc gct atg gag gag 144Val Lys
Lys Asn Pro Arg Gln Thr Tyr Tyr Glu Ile Ala Met Glu Glu 35 40 45
gta ttt cta aaa gtt cat aga gac ctg ccc cca acc aaa cta tgg acc
192Val Phe Leu Lys Val His Arg Asp Leu Pro Pro Thr Lys Leu Trp Thr
50 55 60 tat aat ggc agt ttg cct ggt cca acc att cat gca aat cga
aat gaa 240Tyr Asn Gly Ser Leu Pro Gly Pro Thr Ile His Ala Asn Arg
Asn Glu 65 70 75 80 aaa gtt aaa gtg aaa tgg atg aac aaa ttg cca ctt
aaa cat ttt cta 288Lys Val Lys Val Lys Trp Met Asn Lys Leu Pro Leu
Lys His Phe Leu 85 90 95 ccg gtc gat cac acg att cac gaa ggc cat
cat gat gaa cca gaa gtc 336Pro Val Asp His Thr Ile His Glu Gly His
His Asp Glu Pro Glu Val 100 105 110 aag acc gtc gtt cat tta cat ggc
ggc gtc aca cca gca agc agt gac 384Lys Thr Val Val His Leu His Gly
Gly Val Thr Pro Ala Ser Ser Asp 115 120 125 ggc tat cca gag gct tgg
ttt tca cga gac ttt gaa gca acc ggc ccc 432Gly Tyr Pro Glu Ala Trp
Phe Ser Arg Asp Phe Glu Ala Thr Gly Pro 130 135 140 ttc ttt gaa cgg
gaa gtg tac gaa tac cca aat cat cag caa gcc tgc 480Phe Phe Glu Arg
Glu Val Tyr Glu Tyr Pro Asn His Gln Gln Ala Cys 145 150 155 160 aca
ttg tgg tat cac gat cat gcg atg gca ttg aca cga tta aat gtg 528Thr
Leu Trp Tyr His Asp His Ala Met Ala Leu Thr Arg Leu Asn Val 165 170
175 tac gcc gga tta gct gga ttt tat ttg atc tca gat gcg ttt gaa aaa
576Tyr Ala Gly Leu Ala Gly Phe Tyr Leu Ile Ser Asp Ala Phe Glu Lys
180 185 190 tca cta gaa tta ccg aag gat gag tat gat att ccg cta atg
atc atg 624Ser Leu Glu Leu Pro Lys Asp Glu Tyr Asp Ile Pro Leu Met
Ile Met 195 200 205 gac cgt acg ttt caa gag gat ggc gcg ctg ttt tat
cca agc aga cca 672Asp Arg Thr Phe Gln Glu Asp Gly Ala Leu Phe Tyr
Pro Ser Arg Pro 210 215 220 aac aac acg cca gaa gac agt gat cta cca
gat ccg tct atc gtg ccc 720Asn Asn Thr Pro Glu Asp Ser Asp Leu Pro
Asp Pro Ser Ile Val Pro 225 230 235 240 ttc ttt tgc gga gaa acc att
ttg gtc aat gga aaa gta tgg cca tat 768Phe Phe Cys Gly Glu Thr Ile
Leu Val Asn Gly Lys Val Trp Pro Tyr 245 250 255 tta gaa gta gaa cca
cga aaa tac cgt ttt cgt att tta aat gcg tct 816Leu Glu Val Glu Pro
Arg Lys Tyr Arg Phe Arg Ile Leu Asn Ala Ser 260 265 270 aat aca aga
act tac gag ctg cat cta gac aac gat gcg acg att ttg 864Asn Thr Arg
Thr Tyr Glu Leu His Leu Asp Asn Asp Ala Thr Ile Leu 275 280 285 caa
att gga tct gat ggc ggc ttt tta cca aga cct gtt cac cat caa 912Gln
Ile Gly Ser Asp Gly Gly Phe Leu Pro Arg Pro Val His His Gln 290 295
300 tcc ttt acc att gct cct gct gaa cga ttt gat gtg atc att gat ttt
960Ser Phe Thr Ile Ala Pro Ala Glu Arg Phe Asp Val Ile Ile Asp Phe
305 310 315 320 tca gct tac gaa aac aaa acg atc acc ctt aaa aat aaa
gct ggc tgc 1008Ser Ala Tyr Glu Asn Lys Thr Ile Thr Leu Lys Asn Lys
Ala Gly Cys 325 330 335 gga cag gaa gta aat cct gaa aca gat gcc aac
atc atg caa ttt aaa 1056Gly Gln Glu Val Asn Pro Glu Thr Asp Ala Asn
Ile Met Gln Phe Lys 340 345 350 gtc aca cgt cca cta aaa ggg aga gca
cct aaa aca tta cgg cct ata 1104Val Thr Arg Pro Leu Lys Gly Arg Ala
Pro Lys Thr Leu Arg Pro Ile 355 360 365 ttc aaa ccg ctt cca cca ctt
cga cct agt cgc gct gat caa gag cgt 1152Phe Lys Pro Leu Pro Pro Leu
Arg Pro Ser Arg Ala Asp Gln Glu Arg 370 375 380 acg ctc act ctt act
ggt aca cag gat aaa tac ggt cgc cct att tta 1200Thr Leu Thr Leu Thr
Gly Thr Gln Asp Lys Tyr Gly Arg Pro Ile Leu 385 390 395 400 ttg ctt
gat aac cat ttt tgg aat gac cct gtc acg gaa aat cct cgg 1248Leu Leu
Asp Asn His Phe Trp Asn Asp Pro Val Thr Glu Asn Pro Arg 405 410 415
ctt ggc agt gta gag gtt tgg tcc atc gtc aat cca aca agg ggc aca
1296Leu Gly Ser Val Glu Val Trp Ser Ile Val Asn Pro Thr Arg Gly Thr
420 425 430 cat ccc att cat tta cat ctt gtt caa ttt agg gtg ata gac
aga aga 1344His Pro Ile His Leu His Leu Val Gln Phe Arg Val Ile Asp
Arg Arg 435 440 445 cca ttt gat aca gag gtc tat caa tcg aca ggg gac
att gtg tat aca 1392Pro Phe Asp Thr Glu Val Tyr Gln Ser Thr Gly Asp
Ile Val Tyr Thr 450 455 460 gga ccg aac gaa gcc cct cct tta cat gaa
caa ggc tac aag gac acc 1440Gly Pro Asn Glu Ala Pro Pro Leu His Glu
Gln Gly Tyr Lys Asp Thr 465 470 475 480 att caa gcg cat gcc ggt gaa
gtc att cga atc att gct cgc ttt gtt 1488Ile Gln Ala His Ala Gly Glu
Val Ile Arg Ile Ile Ala Arg Phe Val 485 490 495 cca tac agc ggc agg
tac gtg tgg cat tgt cat ata tta gag cac gag 1536Pro Tyr Ser Gly Arg
Tyr Val Trp His Cys His Ile Leu Glu His Glu 500 505 510 gat tat gac
atg atg agg ccg atg gat att att ctc gag cac cac cac 1584Asp Tyr Asp
Met Met Arg Pro Met Asp Ile Ile Leu Glu His His His 515 520 525 cac
cac cac 1593His His His 530 2531PRTBacillus pumilus 2Met Ala Ser
Met Thr Gly Gly Gln Gln Met Gly Arg Gly Ser Met Asn 1 5 10 15 Leu
Glu Lys Phe Val Asp Glu Leu Pro Ile Pro Glu Val Ala Glu Pro 20 25
30 Val Lys Lys Asn Pro Arg Gln Thr Tyr Tyr Glu Ile Ala Met Glu Glu
35 40 45 Val Phe Leu Lys Val His Arg Asp Leu Pro Pro Thr Lys Leu
Trp Thr 50 55 60 Tyr Asn Gly Ser Leu Pro Gly Pro Thr Ile His Ala
Asn Arg Asn Glu 65 70 75 80 Lys Val Lys Val Lys Trp Met Asn Lys Leu
Pro Leu Lys His Phe Leu 85 90 95 Pro Val Asp His Thr Ile His Glu
Gly His His Asp Glu Pro Glu Val 100 105 110 Lys Thr Val Val His Leu
His Gly Gly Val Thr Pro Ala Ser Ser Asp 115 120 125 Gly Tyr Pro Glu
Ala Trp Phe Ser Arg Asp Phe Glu Ala Thr Gly Pro 130 135 140 Phe Phe
Glu Arg Glu Val Tyr Glu Tyr Pro Asn His Gln Gln Ala Cys 145 150 155
160 Thr Leu Trp Tyr His Asp His Ala Met Ala Leu Thr Arg Leu Asn Val
165 170 175 Tyr Ala Gly Leu Ala Gly Phe Tyr Leu Ile Ser Asp Ala Phe
Glu Lys 180 185 190 Ser Leu Glu Leu Pro Lys Asp Glu Tyr Asp Ile Pro
Leu Met Ile Met 195 200 205 Asp Arg Thr Phe Gln Glu Asp Gly Ala Leu
Phe Tyr Pro Ser Arg Pro 210 215 220 Asn Asn Thr Pro Glu Asp Ser Asp
Leu Pro Asp Pro Ser Ile Val Pro 225 230 235 240 Phe Phe Cys Gly Glu
Thr Ile Leu Val Asn Gly Lys Val Trp Pro Tyr 245 250 255 Leu Glu Val
Glu Pro Arg Lys Tyr Arg Phe Arg Ile Leu Asn Ala Ser 260 265 270 Asn
Thr Arg Thr Tyr Glu Leu His Leu Asp Asn Asp Ala Thr Ile Leu 275 280
285 Gln Ile Gly Ser Asp Gly Gly Phe Leu Pro Arg Pro Val His His Gln
290 295 300 Ser Phe Thr Ile Ala Pro Ala Glu Arg Phe Asp Val Ile Ile
Asp Phe 305 310 315 320 Ser Ala Tyr Glu Asn Lys Thr Ile Thr Leu Lys
Asn Lys Ala Gly Cys 325 330 335 Gly Gln Glu Val Asn Pro Glu Thr Asp
Ala Asn Ile Met Gln Phe Lys 340 345 350 Val Thr Arg Pro Leu Lys Gly
Arg Ala Pro Lys Thr Leu Arg Pro Ile 355 360 365 Phe Lys Pro Leu Pro
Pro Leu Arg Pro Ser Arg Ala Asp Gln Glu Arg 370 375 380 Thr Leu Thr
Leu Thr Gly Thr Gln Asp Lys Tyr Gly Arg Pro Ile Leu 385 390 395 400
Leu Leu Asp Asn His Phe Trp Asn Asp Pro Val Thr Glu Asn Pro Arg 405
410 415 Leu Gly Ser Val Glu Val Trp Ser Ile Val Asn Pro Thr Arg Gly
Thr 420 425 430 His Pro Ile His Leu His Leu Val Gln Phe Arg Val Ile
Asp Arg Arg 435 440 445 Pro Phe Asp Thr Glu Val Tyr Gln Ser Thr Gly
Asp Ile Val Tyr Thr 450 455 460 Gly Pro Asn Glu Ala Pro Pro Leu His
Glu Gln Gly Tyr Lys Asp Thr 465 470 475 480 Ile Gln Ala His Ala Gly
Glu Val Ile Arg Ile Ile Ala Arg Phe Val 485 490 495 Pro Tyr Ser Gly
Arg Tyr Val Trp His Cys His Ile Leu Glu His Glu 500 505 510 Asp Tyr
Asp Met Met Arg Pro Met Asp Ile Ile Leu Glu His His His 515 520 525
His His His 530 336DNABacillus pumilus 3catggatcca tgaacctaga
aaaatttgtt gacgag 36436DNABacillus pumilus 4tacctcgaga ataatatcca
tcggcctcat catgtc 3651530DNABacillus pumilusCDS(1)..(1530) 5atg aac
cta gaa aaa ttt gtt gac gag ctg cca att cca gaa gtt gcg 48Met Asn
Leu Glu Lys Phe Val Asp Glu Leu Pro Ile Pro Glu Val Ala 1 5 10 15
aag ccc gtc aaa aag aac cca aaa caa acg tat tat gaa atc gct atg
96Lys Pro Val Lys Lys Asn Pro Lys Gln Thr Tyr Tyr Glu Ile Ala Met
20 25 30 gag gag gta ttt cta aaa gtt cat aga gat ctg ccc cca acc
aag cta 144Glu Glu Val Phe Leu Lys Val His Arg Asp Leu Pro Pro Thr
Lys Leu 35 40 45 tgg acc tat aat ggc agt ttg cct ggt cca acc att
cat gcg aat cga 192Trp Thr Tyr Asn Gly Ser Leu Pro Gly Pro Thr Ile
His Ala Asn Arg 50 55 60 aat gaa aaa gtc aaa gtg aaa tgg atg aac
aaa ttg cca ctt aag cat 240Asn Glu Lys Val Lys Val Lys Trp Met Asn
Lys Leu Pro Leu Lys His 65 70 75 80 ttt cta ccg gtc gat cac acc att
cac gaa ggc cat cat gat gaa cca 288Phe Leu Pro Val Asp His Thr Ile
His Glu Gly His His Asp Glu Pro 85 90 95 gaa gtt aaa acc gtc gtt
cat tta cat ggt ggc gtc aca cca gca agc 336Glu Val Lys Thr Val Val
His Leu His Gly Gly Val Thr Pro Ala Ser 100 105 110 agt gat ggc tat
cca gag gct tgg ttt tca cga gac ttt gaa gca acc 384Ser Asp Gly Tyr
Pro Glu Ala Trp Phe Ser Arg Asp Phe Glu Ala Thr 115 120 125 ggc ccc
ttc ttt gaa cgg gag gtg tac gaa tac cca aat cat cag caa 432Gly Pro
Phe Phe Glu Arg Glu Val Tyr Glu Tyr Pro Asn His Gln Gln 130 135 140
gcc tgc aca ttg tgg tat cac gat cat gcg atg gca ttg aca cga tta
480Ala Cys Thr Leu Trp Tyr His Asp His Ala Met Ala Leu Thr Arg Leu
145 150 155 160 aat gtg tat gcc ggc tta gct gga ttt tat ttg atc tca
gat gcg ttt 528Asn Val Tyr Ala Gly Leu Ala Gly Phe Tyr Leu Ile Ser
Asp Ala Phe 165 170 175 gaa aag tcg cta gaa tta ccg aag ggt gag tat
gat att ccg cta atg 576Glu Lys Ser Leu Glu Leu Pro Lys Gly Glu Tyr
Asp Ile Pro Leu Met 180 185 190 atc atg gac cgt acg ttt cag gag gat
ggc gca ctg ttt tat cca agc 624Ile Met Asp Arg Thr Phe Gln Glu Asp
Gly Ala Leu Phe Tyr Pro Ser 195 200 205 agg cca aac aac aca cca gaa
gac agt gac ata cca gat ccg tct atc 672Arg Pro Asn Asn Thr Pro Glu
Asp Ser Asp Ile Pro Asp Pro Ser Ile 210 215 220 gtg cct ttc ttt tgc
gga gaa acc att ttg gtc aat gga aaa gta tgg 720Val Pro Phe Phe Cys
Gly Glu Thr Ile Leu Val Asn Gly Lys Val Trp 225 230 235 240 ccg tat
tta gaa gta gag ccg cga aaa tat cgt ttt cgt att tta aat 768Pro Tyr
Leu Glu Val Glu Pro Arg Lys Tyr Arg Phe Arg Ile Leu Asn 245 250 255
gct tcc aat aca aga act tac gag ctg cat cta gac aac gat gcg acg
816Ala Ser Asn Thr Arg Thr Tyr Glu Leu His Leu Asp Asn Asp Ala Thr
260 265 270 att ttg caa att gga tct gat ggc ggc ttt tta cca aga cct
gtt cac 864Ile Leu Gln Ile Gly Ser Asp Gly Gly Phe Leu Pro Arg Pro
Val His 275 280 285 cat caa tcc ttt agc att gct cct gct gaa cga ttt
gat gtc atc atc 912His Gln Ser Phe Ser Ile Ala Pro Ala Glu Arg Phe
Asp Val Ile Ile 290 295 300 gat ttt tca gct tac gaa aac aaa acg atc
acc ctt aaa aat aaa gcc 960Asp Phe Ser Ala Tyr Glu Asn Lys Thr Ile
Thr Leu Lys Asn Lys Ala 305 310 315 320 ggc tgc gga cag gaa gta aat
cct gaa aca gat gca aac atc atg caa 1008Gly Cys Gly Gln Glu Val Asn
Pro Glu Thr Asp Ala Asn Ile Met Gln 325 330 335 ttt aaa gtc act cga
ccg cta aaa ggg aga gca cct aaa aca tta cgg 1056Phe Lys Val Thr Arg
Pro Leu Lys Gly Arg Ala Pro Lys Thr Leu Arg 340 345 350 cct att ttc
aaa ccg ctt cca cca ctt cgg cct tgt cga gct gat aaa 1104Pro Ile Phe
Lys Pro Leu Pro Pro Leu Arg Pro Cys Arg Ala Asp Lys 355 360 365 gag
cgt acg ctc act ctt acc ggt aca cag gat aaa tac ggc cgt cct 1152Glu
Arg Thr Leu Thr Leu Thr Gly Thr Gln Asp Lys Tyr Gly Arg Pro 370 375
380 att tta ttg cta gat aac caa ttt tgg aat gac cct gtc acg gaa aat
1200Ile Leu Leu Leu Asp Asn Gln Phe Trp Asn Asp Pro Val Thr Glu Asn
385 390 395 400 cct cgt ctt ggc agt gtg gag gtt tgg tct atc gtc aat
cca aca agg 1248Pro Arg Leu Gly Ser Val Glu Val Trp Ser Ile Val Asn
Pro Thr Arg 405 410 415 ggc aca cat cct att cat tta cac ctt gtt caa
ttc aga gtg ata gac 1296Gly Thr His Pro Ile His Leu His Leu Val Gln
Phe Arg Val Ile Asp 420 425 430 aga aga cca ttt gat act gag gtc tat
caa tcg aca ggg gac att gtg 1344Arg Arg Pro Phe Asp Thr Glu Val Tyr
Gln Ser Thr Gly Asp Ile Val 435 440 445 tat aca gga cca aac gaa gca
cct ccc tta cat gaa caa ggc tac aag 1392Tyr Thr Gly Pro Asn Glu Ala
Pro Pro Leu His Glu Gln Gly Tyr Lys 450 455 460 gac acc att caa gcg
cat gcc ggt gaa gtc att cgg atc atc gct cgc
1440Asp Thr Ile Gln Ala His Ala Gly Glu Val Ile Arg Ile Ile Ala Arg
465 470 475 480 ttt gtt cca tac agc ggc agg tat gtg tgg cat tgt cat
ata tta gag 1488Phe Val Pro Tyr Ser Gly Arg Tyr Val Trp His Cys His
Ile Leu Glu 485 490 495 cac gag gat tat gac atg atg cgg ccg atg gat
atc atc cag 1530His Glu Asp Tyr Asp Met Met Arg Pro Met Asp Ile Ile
Gln 500 505 510 6510PRTBacillus pumilus 6Met Asn Leu Glu Lys Phe
Val Asp Glu Leu Pro Ile Pro Glu Val Ala 1 5 10 15 Lys Pro Val Lys
Lys Asn Pro Lys Gln Thr Tyr Tyr Glu Ile Ala Met 20 25 30 Glu Glu
Val Phe Leu Lys Val His Arg Asp Leu Pro Pro Thr Lys Leu 35 40 45
Trp Thr Tyr Asn Gly Ser Leu Pro Gly Pro Thr Ile His Ala Asn Arg 50
55 60 Asn Glu Lys Val Lys Val Lys Trp Met Asn Lys Leu Pro Leu Lys
His 65 70 75 80 Phe Leu Pro Val Asp His Thr Ile His Glu Gly His His
Asp Glu Pro 85 90 95 Glu Val Lys Thr Val Val His Leu His Gly Gly
Val Thr Pro Ala Ser 100 105 110 Ser Asp Gly Tyr Pro Glu Ala Trp Phe
Ser Arg Asp Phe Glu Ala Thr 115 120 125 Gly Pro Phe Phe Glu Arg Glu
Val Tyr Glu Tyr Pro Asn His Gln Gln 130 135 140 Ala Cys Thr Leu Trp
Tyr His Asp His Ala Met Ala Leu Thr Arg Leu 145 150 155 160 Asn Val
Tyr Ala Gly Leu Ala Gly Phe Tyr Leu Ile Ser Asp Ala Phe 165 170 175
Glu Lys Ser Leu Glu Leu Pro Lys Gly Glu Tyr Asp Ile Pro Leu Met 180
185 190 Ile Met Asp Arg Thr Phe Gln Glu Asp Gly Ala Leu Phe Tyr Pro
Ser 195 200 205 Arg Pro Asn Asn Thr Pro Glu Asp Ser Asp Ile Pro Asp
Pro Ser Ile 210 215 220 Val Pro Phe Phe Cys Gly Glu Thr Ile Leu Val
Asn Gly Lys Val Trp 225 230 235 240 Pro Tyr Leu Glu Val Glu Pro Arg
Lys Tyr Arg Phe Arg Ile Leu Asn 245 250 255 Ala Ser Asn Thr Arg Thr
Tyr Glu Leu His Leu Asp Asn Asp Ala Thr 260 265 270 Ile Leu Gln Ile
Gly Ser Asp Gly Gly Phe Leu Pro Arg Pro Val His 275 280 285 His Gln
Ser Phe Ser Ile Ala Pro Ala Glu Arg Phe Asp Val Ile Ile 290 295 300
Asp Phe Ser Ala Tyr Glu Asn Lys Thr Ile Thr Leu Lys Asn Lys Ala 305
310 315 320 Gly Cys Gly Gln Glu Val Asn Pro Glu Thr Asp Ala Asn Ile
Met Gln 325 330 335 Phe Lys Val Thr Arg Pro Leu Lys Gly Arg Ala Pro
Lys Thr Leu Arg 340 345 350 Pro Ile Phe Lys Pro Leu Pro Pro Leu Arg
Pro Cys Arg Ala Asp Lys 355 360 365 Glu Arg Thr Leu Thr Leu Thr Gly
Thr Gln Asp Lys Tyr Gly Arg Pro 370 375 380 Ile Leu Leu Leu Asp Asn
Gln Phe Trp Asn Asp Pro Val Thr Glu Asn 385 390 395 400 Pro Arg Leu
Gly Ser Val Glu Val Trp Ser Ile Val Asn Pro Thr Arg 405 410 415 Gly
Thr His Pro Ile His Leu His Leu Val Gln Phe Arg Val Ile Asp 420 425
430 Arg Arg Pro Phe Asp Thr Glu Val Tyr Gln Ser Thr Gly Asp Ile Val
435 440 445 Tyr Thr Gly Pro Asn Glu Ala Pro Pro Leu His Glu Gln Gly
Tyr Lys 450 455 460 Asp Thr Ile Gln Ala His Ala Gly Glu Val Ile Arg
Ile Ile Ala Arg 465 470 475 480 Phe Val Pro Tyr Ser Gly Arg Tyr Val
Trp His Cys His Ile Leu Glu 485 490 495 His Glu Asp Tyr Asp Met Met
Arg Pro Met Asp Ile Ile Gln 500 505 510
* * * * *