U.S. patent application number 13/449095 was filed with the patent office on 2013-03-21 for rna interferases and methods of use thereof.
This patent application is currently assigned to UNIVERSITY OF MEDICINE AND DENTISTRY OF NEW JERSEY. The applicant listed for this patent is Masayori Inouye, Junjie Zhang, Yong Long Zhang. Invention is credited to Masayori Inouye, Junjie Zhang, Yong Long Zhang.
Application Number | 20130071374 13/449095 |
Document ID | / |
Family ID | 33544374 |
Filed Date | 2013-03-21 |
United States Patent
Application |
20130071374 |
Kind Code |
A1 |
Inouye; Masayori ; et
al. |
March 21, 2013 |
RNA Interferases and Methods of Use Thereof
Abstract
The present invention is directed to the discovery of a novel
family of enzymes designated herein as mRNA interferases that
exhibit endoribonuclease activity. The novel finding of the present
inventors, therefore, presents new applications for which mRNA
interferase nucleic and amino acid sequences, and compositions
thereof may be used to advantage. The invention also encompasses
screening methods to identify compounds/agents capable of
modulating mRNA interferase activity and methods for using such
compounds/agents. Also provided is a kit comprising mRNA
interferase nucleic and/or amino acid sequences, mRNA interferase
activity compatible buffers, and instruction materials.
Inventors: |
Inouye; Masayori; (New
Brunswick, NJ) ; Zhang; Junjie; (Edison, NJ) ;
Zhang; Yong Long; (Highland Park, NJ) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Inouye; Masayori
Zhang; Junjie
Zhang; Yong Long |
New Brunswick
Edison
Highland Park |
NJ
NJ
NJ |
US
US
US |
|
|
Assignee: |
UNIVERSITY OF MEDICINE AND
DENTISTRY OF NEW JERSEY
Somerset
NJ
|
Family ID: |
33544374 |
Appl. No.: |
13/449095 |
Filed: |
April 17, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10560303 |
Mar 29, 2007 |
8183011 |
|
|
PCT/US04/18571 |
Jun 14, 2004 |
|
|
|
13449095 |
|
|
|
|
60543693 |
Feb 11, 2004 |
|
|
|
60478515 |
Jun 13, 2003 |
|
|
|
Current U.S.
Class: |
424/94.61 ;
435/199; 435/6.1; 435/91.2; 536/23.2 |
Current CPC
Class: |
A61P 29/00 20180101;
G01N 2800/26 20130101; A61P 37/08 20180101; A61P 37/02 20180101;
A61P 37/06 20180101; C12N 15/70 20130101; A61P 17/06 20180101; C12Q
1/42 20130101; A61K 38/465 20130101; C12P 19/34 20130101; A61P
35/00 20180101; A61P 9/10 20180101; A61P 11/06 20180101; C12Q 1/44
20130101; C12N 9/22 20130101; G01N 2333/922 20130101; A61P 9/00
20180101; A61P 17/00 20180101; A61P 31/04 20180101; A61P 43/00
20180101; A61P 41/00 20180101 |
Class at
Publication: |
424/94.61 ;
435/6.1; 435/199; 435/91.2; 536/23.2 |
International
Class: |
C12N 9/22 20060101
C12N009/22; C12P 19/34 20060101 C12P019/34; A61K 38/46 20060101
A61K038/46; C12Q 1/44 20060101 C12Q001/44 |
Claims
1. A method for detecting an activity of an mRNA interferase or
functional fragment thereof, wherein said activity is
endoribonuclease activity, said method comprising: (a) providing a
nucleic acid sequence encoding said mRNA interferase or a
functional fragment thereof; (b) expressing said nucleic acid
sequence; (c) incubating the expressed nucleic acid sequence of
step (b) with an endoribonuclease substrate; and (d) measuring
cleavage of said substrate, wherein cleavage of said substrate
indicates endoribonuclease activity and provides means to detect
endoribonuclease activity of said mRNA interferase or a functional
fragment thereof.
2. A method for screening to identify an agent capable of
modulating an activity of an mRNA interferase or functional
fragment thereof, wherein said activity is endoribonuclease
activity, said method comprising: (a) providing a nucleic acid
sequence encoding said mRNA interferase or a functional fragment
thereof; (a) expressing said nucleic acid sequence; (b) incubating
the expressed nucleic acid sequence of step (b) with an
endoribonuclease substrate under conditions capable of promoting
endoribonuclease activity; (d) adding at least one agent to
determine if it is capable of modulating endoribonuclease activity
of said mRNA interferase or functional fragment thereof; and (e)
measuring cleavage of said substrate, wherein cleavage of said
substrate indicates endoribonuclease activity and provides means to
detect endoribonuclease activity of said mRNA interferase or a
functional fragment thereof, and wherein a change in an amount of
cleaved substrate in the presence of the at least one agent
identifies an agent capable of modulating an activity of said mRNA
interferase or functional fragment thereof.
3. The method of claim 2, wherein said method is performed in vitro
or in a cell.
4. The method of claim 2, wherein an agent capable of modulating an
endoribonuclease activity of said mRNA interferase or a functional
fragment thereof effectuates an increase in substrate cleavage.
5. The method of claim 2, wherein an agent capable of modulating an
endoribonuclease activity of said mRNA interferase or a functional
fragment thereof effectuates a decrease in substrate cleavage.
6. A method for modulating an activity of an mRNA interferase or
functional fragment thereof, wherein said activity is
endoribonuclease activity, said method comprising: (c) providing a
nucleic acid sequence encoding said mRNA interferase or a
functional fragment thereof; (b) expressing said nucleic acid
sequence; (c) incubating the expressed nucleic acid sequence of
step (b) with an endoribonuclease substrate under conditions
capable of promoting endoribonuclease activity; (d) adding an agent
of claim 2, said agent capable of modulating the endoribonuclease
activity of said mRNA interferase or functional fragment thereof;
and (e) measuring cleavage of said substrate, wherein cleavage of
said substrate indicates endoribonuclease activity and provides
means to detect endoribonuclease activity of said mRNA interferase
or a functional fragment thereof, and wherein a change in an amount
of cleaved substrate in the presence of the agent provides means to
modulate endoribonuclease activity of said mRNA interferase or
functional fragment thereof.
7. A method for detecting an activity of an mRNA interferase or
functional fragment thereof, wherein said activity is
endoribonuclease activity, said method comprising: (a) providing an
amino acid sequence of said mRNA interferase; (b) incubating the
amino acid sequence of step (a) with an endoribonuclease substrate
under conditions capable of promoting endoribonuclease activity;
and (c) measuring cleavage of said substrate, wherein cleavage of
said substrate indicates endoribonuclease activity and provides
means to detect endoribonuclease activity of said mRNA interferase
or a functional fragment thereof.
8. A method for screening to identify an agent capable of
modulating an activity of an mRNA interferase or functional
fragment thereof, wherein said activity is endoribonuclease
activity, said method comprising: (a) providing an amino acid
sequence of said mRNA interferase; (b) incubating the amino acid
sequence of step (a) with an endoribonuclease substrate under
conditions capable of promoting endoribonuclease activity; (c)
adding at least one agent to determine if it is capable of
modulating endoribonuclease activity of said mRNA interferase or
functional fragment thereof; and (d) measuring the cleavage of said
substrate, wherein cleavage of said substrate indicates
endoribonuclease activity and provides means to detect
endoribonuclease activity of said mRNA interferase or a functional
fragment thereof, and wherein a change in an amount of cleaved
substrate in the presence of the at least one agent identifies an
agent capable of modulating an activity of said mRNA interferase or
functional fragment thereof.
9. The method of claim 8, wherein the method is performed in vitro
or in a cell.
10. The method of claim 8, wherein an agent capable of modulating
an endoribonuclease activity of said mRNA interferase or a
functional fragment thereof effectuates an increase in substrate
cleavage.
11. The method of claim 8, wherein an agent capable of modulating
an endoribonuclease activity of said mRNA interferase or a
functional fragment thereof effectuates a decrease in substrate
cleavage.
12. A method for modulating an activity of an mRNA interferase or
functional fragment thereof, wherein said activity is
endoribonuclease activity, said method comprising: (a) providing an
amino acid sequence of said mRNA interferase; (b) incubating the
amino acid sequence of step (a) with an endoribonuclease substrate
under conditions capable of promoting endoribonuclease activity;
(c) adding an agent of claim 8, said agent capable of modulating
the endoribonuclease activity of said mRNA interferase or
functional fragment thereof; and (d) measuring cleavage of said
substrate, wherein cleavage of said substrate indicates
endoribonuclease activity and provides means to detect
endoribonuclease activity of said mRNA interferase or a functional
fragment thereof, and wherein a change in an amount of cleaved
substrate in the presence of the agent provides means to modulate
endoribonuclease activity of said mRNA interferase or functional
fragment thereof.
13. A method for treating a patient with a disorder, said method
comprising administering to said patient a therapeutically
effective amount of a composition comprising at least one nucleic
acid sequence encoding an mRNA interferase or a functional fragment
thereof, and a pharmaceutically acceptable buffer, to alleviate
symptoms of said disorder.
14. The method of claim 13, wherein expression of at least one
nucleic acid sequence of said composition effectuates an increase
in endoribonuclease substrate cleavage, to alleviate symptoms of
said disorder.
15. The method of claim 14, wherein said disorder is a bacterial
infection and said administering said therapeutically effective
amount of a composition to said patient alleviates symptoms of the
bacterial infection by reducing the number of bacteria in said
patient.
16. The method of claim 15, wherein said bacterial infection
comprises at least one antibiotic resistant bacterial strain.
17. The method of claim 14, wherein said disorder is a
hyperproliferative disorder and said administering said
therapeutically effective amount of a composition to said patient
alleviates symptoms of said hyperproliferative disorder by reducing
the number of hyperproliferative disorder cells in said
patient.
18. A method for treating a patient with a disorder, said method
comprising administering to said patient a therapeutically
effective amount of a composition comprising an mRNA interferase or
functional fragment thereof and a pharmaceutically acceptable
buffer, to alleviate symptoms of said disorder.
19. The method of claim 18, wherein the mRNA interferase or
functional fragment thereof of said composition effectuates an
increase in endoribonuclease substrate cleavage, to alleviate
symptoms of said disorder.
20. The method of claim 19, wherein said disorder is a bacterial
infection and said administering said therapeutically effective
amount of a composition to said patient alleviates symptoms of the
bacterial infection by reducing the number of bacteria in said
patient.
21. The method of claim 20, wherein said bacterial infection
comprises at least one antibiotic resistant bacterial strain.
22. The method of claim 19, wherein said disorder is a
hyperproliferative disorder and said administering said
therapeutically effective amount of a composition to said patient
alleviates symptoms of the hyperproliferative disorder by reducing
the number of hyperproliferative cells in said patient.
23. The method of either of claim 17 or 22, wherein said
hyperproliferative disorder is selected from the group consisting
of dysplasias and metaplasias of different tissues, inflammatory
conditions, autoimmune diseases, hyperproliferative skin disorders,
psoriasis, allergy/asthma, atherosclerosis, and restenosis after
angioplastic surgery.
24-32. (canceled)
33. A method for making a plurality of polyribonucleotide
sequences, said method comprising: (a) providing a first and a
second nucleic acid sequence, wherein a region of said first
nucleic acid sequence is complementary to a region of said second
nucleic acid sequence and neither complementary region of said
first or second nucleic acid sequence comprises a sequence
complementary to an mRNA interferase recognition site, and each of
said first and second nucleic acid sequences is phosphorylated at
its 5' terminus; (b) annealing said first and second nucleic acid
sequences via a complementary region of said first and second
nucleic acid sequences to form a double stranded nucleic acid
sequence comprising a complementary region flanked by single
stranded overhangs, wherein each of said single stranded overhangs
comprises at least one sequence complementary to an mRNA
interferase recognition site and said single stranded overhangs are
complementary to each other; (c) ligating annealed first and second
nucleic acid sequences via complementary single stranded overhangs
to form a concatamer comprising a plurality of tandem repeats of
annealed first and second nucleic acid sequences; (d) amplifying
said concatamer using a first primer comprising a T7 promoter and a
region complementary to said first nucleic acid sequence and a
second primer complementary to said second nucleic acid sequence,
wherein said amplifying produces a plurality of concatamers
comprising a T7 promoter; (e) transcribing RNA molecules from said
plurality of concatamers using T7 RNA polymerase, wherein each of
said RNA molecules comprises a plurality of tandem repeats of a
polyribonucleotide sequence flanked by mRNA interferase recognition
sites; and (f) digesting said RNA molecules with an mRNA
interferase capable of cleaving RNA at said interferase recognition
sites, wherein said digesting produces a plurality of said
polyribonucleotide sequences.
34. The method of claim 33, wherein the mRNA recognition sequence
is an ACA sequence and the mRNA interferase is MazF comprising SEQ
ID NO: 2 or a functional fragment thereof; or wherein the mRNA
recognition sequence is a UAX sequence, wherein X is a C, A, or U,
and the mRNA interferase is PemK comprising SEQ ID NO: 4 or a
functional fragment thereof.
35. An isolated nucleic acid sequence which encodes a polypeptide
having sequence and/or structural homology to an mRNA interferase
or a functional fragment thereof, wherein said polypeptide is
capable of exhibiting endoribonuclease activity; an expression
vector comprising said isolated nucleic acid sequence and a cell
comprising said expression vector; an expression vector comprising
said isolated nucleic acid sequence, wherein said nucleic acid
sequence is operably linked to a regulatory sequence, and a cell
comprising said expression vector; a transgenic animal comprising
said isolated nucleic acid sequence, wherein the nucleic acid
sequence is expressed in at least one cell of the transgenic
animal; an isolated amino acid sequence comprising a polypeptide
having sequence and/or structural homology to an mRNA interferase
or a functional fragment thereof, wherein said polypeptide is
capable of exhibiting endoribonuclease activity; an expression
vector encoding said polypeptide and a cell comprising said
expression vector; an expression vector encoding said polypeptide,
wherein expression of said polypeptide is under the control of a
regulatory sequence, and a cell comprising said expression vector;
a transgenic animal expressing said polypeptide, wherein the
polypeptide is expressed in at least one cell of the transgenic
animal; a composition comprising either said isolated nucleic acid
sequence or said polypeptide and a pharmaceutically acceptable
buffer and use of either of said compositions for the treatment of
a patient with a disorder to alleviate symptoms of said disorder;
and a kit comprising said isolated nucleic acid sequence, an
isolated amino acid sequence comprising said polypeptide or a
functional fragment thereof, an mRNA interferase activity
compatible buffer, and instructional materials.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to the field of molecular
biology, and particularly to the discovery of a novel enzymatic
activity. Specifically, the invention pertains to the
identification of a novel family of proteins designated herein as
mRNA Interferases. Exemplary members of the family described herein
include MazF and PemK, and homologs and orthologs thereof. More
specifically, the invention relates to the biochemical
characterization of MazF and PemK polypeptides as endoribonucleases
or mRNA interferases. Also encompassed are analyses of associated
proteins which serve to inhibit activities ascribed to mRNA
interferases. Specifically, a characterization of MazE protein
function and effects thereto on MazF activity and a
characterization of PemI protein function and effects thereto on
PemK activity are described herein. Methods of use for novel mRNA
interferases, such as MazF and PemK, and modulators of MazF and
PemK activity, such as MazE, and PemI, are also provided which are
of utility in research and therapeutic applications.
BACKGROUND OF THE INVENTION
[0002] In Escherichia coli (E. coli), programmed cell death is
mediated through "addiction modules" consisting of two genes, one
of which encodes a stable toxic protein (toxin) and the other
encodes a short-lived antitoxin (Engelberg-Kulka and Glaser, Annu
Rev Microbiol 53, 43-70 (1999)). The toxin and the antitoxin are
coexpressed from an operon and interact with each other to form a
stable complex and their expression is auto-regulated either by the
toxin-antitoxin complex or by the antitoxin alone. When their
co-expression is inhibited by stress conditions, for example, the
antitoxin is degraded by proteases, enabling the toxin to act on
its target. Such genetic systems for bacterial programmed cell
death have been reported in a number of E. coli extrachromosomal
elements for the so-called postsegregational killing effect
(Tsuchimoto et al., J Bacteriol 170, 1461-6 (1988); Roberts and
Helinski, J Bacteriol 174, 8119-32 (1992)). When bacteria lose the
plasmids or other extrachromosomal elements, the cells are
selectively killed because unstable antitoxins are degraded faster
than their cognate stable toxins. Thus, the cells are addicted to
the short-lived antitoxins since their de novo synthesis is
essential for cell survival.
[0003] Among the known addiction modules found on the E. coli
chromosome (Gotfredsen and Gerdes, Mol Microbiol 29, 1065-76
(1998); Mittenhuber, J Mol Microbiol Biotechnol 1, 295-302 (1999)),
the E. coli MazEF system is the first known prokaryotic chromosomal
addiction module (Aizenman et al., Proc Natl Acad Sci USA 93,
6059-63 (1996).). The mazEF module consists of two overlapping
genes mazE and mazF, located downstream of the relA gene. MazF is a
stable toxin, whereas MazE is a labile antitoxin, which is readily
degraded in vivo by an ATP-dependent ClpPA serine protease
(Aizenman et al., Proc Natl Acad Sci USA 93, 6059-63 (1996)). mazEF
expression is negatively regulated by guanosine
3',5'-bispyrophosphate (ppGpp) synthesized by RelA under severe
amino acid starvation (Aizenman et al., Proc Natl Acad Sci USA 93,
6059-63 (1996)). Moreover, mazEF-mediated cell death can be
triggered by several antibiotics, including rifampicin,
chloramphenicol and spectinomycin (Sat et al., J Bacteriol 183,
2041-5 (2001)). Results from in vivo experiments using E. coli
cells have suggested that MazF inhibits both protein synthesis and
DNA replication (Pedersen et al., Mol Microbiol 45, 501-10 (2002)).
Thymineless death has recently been reported to be mediated by the
mazEF module (B. Sat, M. Reches, H. Engelberg-Kulka, J Bacteriol
185, 1803-7 (2003)).
[0004] In E. coli, some extrachromosomal elements are known to
contain addiction modules and cause bacterial programmed cell death
via the so-called postsegregational killing effect. The best
studied extrachromosomal addiction modules include the phd-doc
system on bacteriophage P1 (Lehnherr et al. (1993) J Mol Biol 233,
414-428; Gazit and Sauer. (1999) J Biol Chem 274, 16813-16818;
Magnuson et al. (1996) J Biol Chem 271, 1870548710; Lehnherr and
Yarmolinsky. (1995) Proc Natl Acad Sci USA 92, 32743277), the
ccdA-ccdB system on factor F (Tam and Kline. (1989) J Bacteriol
171, 2353-2360; Bahassi et al. (1999) J Biol Chem 274, 10936-10944;
Afif et al. (2001) Mol Microbiol 41, 73-82; Dao-Thi et al. (2002) J
Biol Chem 277, 3733-3742), the kis-kid system on plasmid R1
(Ruiz-Echevarria et al. (1991) Mol Microbiol 5, 2685-2693;
Hargreaves et al. (2002) Structure (Camb) 10, 1425-1433;
Ruiz-Echevarria et al. (1995) J Mol Biol 247, 568-577;
Santos-Sierra et al. (2003) Plasmid 50, 120-130), and the pemI-pemK
system on plasmid R100 (Tsuchimoto et al. (1992) J Bacteriol 174,
42054211; Tsuchimoto et al. (1988) J Bacteriol 170, 1461-1466;
Tsuchimoto and Ohtsubo. (1993) Mol Gen Genet 237, 81-88; Tsuchimoto
and Ohtsubo. (1989) Mol Gen Genet 215, 463-468). Interestingly, the
E. coli chromosome also contains several addiction module systems,
such as the relBE system (Gotfredsen and Gerdes. (1998) Mol
Microbiol 29, 1065-1076; Christensen et al. (2001) Proc Natl Acad
Sci USA 98, 14328-14333; Christensen and Gerdes. (2003) Mol
Microbiol 48, 1389-1400; Pedersen et al. (2003) Cell 112, 131-140),
the mazEF system (Aizenman et al. (1996) Proc Natl Acad Sci USA 93,
6059-6063; Marianovsky et al. (2001) J Biol Chem 276, 5975-5984;
Kamada et al. (2003) Mol Cell 11, 875-884; Zhang et al. (2003) J
Biol Chem 278, 32300-32306) and the chpB system (Santos Sierra et
al. (1998) FEMS Microbiol Lett 168, 51-58; Masuda et al. (1993) J
Bacteriol 175, 6850-6856; Christensen et al. (2003) J Mol Biol 332,
809-819).
[0005] The cellular effects of toxins associated with addiction
modules have been studied quite extensively. CcdB, the toxin in the
ccdA-ccdB system, interacts with DNA gyrase to block DNA
replication (Bahassi et al. (1999) supra; Kampranis et al. (1999) J
Mol Biol 293, 733-744), and RelE, the toxin in the relBE system
cleaves mRNA in the ribosome A site with high codon-specificity,
but is not able to degrade free RNA (Pedersen et al. (2003) supra).
It was recently demonstrated, however, that the A-site mRNA
cleavage can occur in the absence of RelE (Hayes and Sauer. (2003)
Mol Cell 12, 903-911). The exact mechanism of the A-site mRNA
cleavage, therefore, is still unknown. It has been proposed that
MazF (ChpAK), the toxin encoded by the mazEF system, and ChpBK, the
toxin encoded by chpB system, inhibit translation by a mechanism
very similar to that of RelE in a ribosome-dependent and
codon-specific manner (Christensen et al. (2003) supra). The
present inventors have, however, recently demonstrated that MazF is
a sequence-specific endoribonuclease functional only for
single-stranded RNA, which preferentially cleaves mRNAs at the ACA
sequence in a manner independent of ribosomes and codons, and is,
therefore, functionally distinct from RelE (Zhang et al. (2003) Mol
Cell 12, 913-923).
[0006] The pemI-pemK system and the kis-kid system are involved in
the stable maintenance of two closely related incFII low-copy
plasmids, plasmid R100 (Tsuchimoto et al. (1992) supra; Tsuchimoto
et al. (1988) supra) and plasmid R1 (Ruiz-Echevarria et al. (1991)
supra; Bravo et al. (1987) Mol Gen Genet 210, 101-110),
respectively. These two systems are now known to be identical
(Engelberg-Kulka and Glaser. (1999) supra). It has been
demonstrated that Kid (PemK) inhibits ColE1 plasmid replication
acting at the initiation of DNA synthesis, but does not inhibit P4
DNA replication in vitro (Ruiz-Echevarria et al. (1995) supra). To
date, there is no evidence that Kid (PemK) inhibits chromosomal DNA
replication. Toxin Kid (PemK) and antidote K is (PemI) not only
function in bacteria, but also function efficiently in a wide range
of eukaryotes. Kid (PemK) inhibits proliferation in yeast, Xenopus
laevis and human cells, wherein K is (PemI) abrogates this
inhibition (de la Cueva-Mendez et al. (2003) Embo J 22, 246-251).
It has also been demonstrated that Kid (PemK) triggers apoptosis in
human cells (de la Cueva-Mendez et al. (2003) supra). These results
suggest that there is a common target for Kid (PemK) in both
prokaryotes and eukaryotes.
[0007] The citation of references herein shall not be construed as
an admission that such is prior art to the present invention.
[0008] Other features and advantages of the invention will be
apparent from the detailed description, the drawings, and the
claims.
SUMMARY OF THE INVENTION
[0009] In a first aspect, the present invention relates to the
discovery of a novel family of enzymes, also referred to herein as
"RNA Interferases". As described herein, exemplary
endoribonucleases of the mRNA interferase family include MazF and
PemK, and homologs and orthologs thereof. The invention, therefore,
encompasses endoribonucleases having either sequence and/or
structural homology to either MazF or PemK polypeptides.
[0010] Of note, prior to the discovery of the present invention,
the cellular target(s) of MazF had not been identified. Moreover,
the present invention is also directed to the discovery that PemK
effectively blocks protein synthesis by cleaving cellular mRNAs in
a sequence specific manner. A novel finding of the present
inventors, therefore, presents new applications for which mRNA
interferase (e.g., MazF and/or PemK) nucleic and amino acid
sequences and compositions thereof may be used to advantage. Such
utilities include, but are not limited to, various research and
therapeutic applications as described hereinbelow. Also provided is
a kit comprising mRNA interferase (e.g., MazF and/or PemK) nucleic
and/or amino acid sequences, mRNA interferase activity compatible
buffers, and instruction materials.
[0011] The invention also provides a method for detecting an
activity of an mRNA interferase or functional fragment thereof,
wherein said activity is endoribonuclease activity, said method
comprising: [0012] (a) providing a nucleic acid sequence encoding
said mRNA interferase or a functional fragment thereof; [0013] (b)
expressing the nucleic acid sequence of step (a); [0014] (c)
incubating the expressed nucleic acid sequence of step (b) with an
endoribonuclease substrate; and [0015] (d) measuring cleavage of
said substrate, wherein cleavage of said substrate indicates
endoribonuclease activity and provides means to detect or is a
positive indicator of endoribonuclease activity of an mRNA
interferase or a functional fragment thereof.
[0016] Also encompassed by the present invention is a method for
screening to identify an agent capable of modulating an activity of
an mRNA interferase or functional fragment thereof, wherein said
activity is endoribonuclease activity, said method comprising:
[0017] (a) providing a nucleic acid sequence encoding said mRNA
interferase or a functional fragment thereof; [0018] (b) expressing
the nucleic acid sequence of step (a); [0019] (c) incubating the
expressed nucleic acid sequence of step (b) with an
endoribonuclease substrate under conditions capable of promoting
endoribonuclease activity; [0020] (d) adding at least one agent
potentially capable of modulating endoribonuclease activity of an
mRNA interferase or functional fragment thereof; and [0021] (e)
measuring cleavage of said substrate, wherein cleavage of said
substrate indicates endoribonuclease activity and provides means to
detect endoribonuclease activity or is a positive indicator of an
mRNA interferase or a functional fragment thereof, and wherein a
change in an amount of cleaved substrate in the presence of the at
least one agent capable of modulating endoribonuclease activity of
an mRNA interferase or functional fragment thereof identifies an
agent capable of modulating an activity of an mRNA interferase or
functional fragment thereof. Such methods are performed in vitro or
in a cell.
[0022] Such an agent identified using the methods of the invention,
which is capable of modulating an endoribonuclease activity of an
mRNA interferase or a functional fragment thereof may effectuate
either an increase or a decrease in substrate cleavage. The present
invention also encompasses agents identified using the methods of
the invention.
[0023] In another aspect, a method is presented for modulating an
activity of an mRNA interferase or functional fragment thereof,
wherein said activity is endoribonuclease activity, said method
comprising: [0024] (a) providing a nucleic acid sequence encoding
said mRNA interferase or a functional fragment thereof; [0025] (b)
expressing the nucleic acid sequence of step (a); [0026] (c)
incubating the expressed nucleic acid sequence of step (b) with an
endoribonuclease substrate under conditions capable of promoting
endoribonuclease activity; [0027] (d) adding an agent capable of
modulating the endoribonuclease activity of an mRNA interferase or
functional fragment thereof; and [0028] (e) measuring cleavage of
said substrate, wherein cleavage of said substrate indicates
endoribonuclease activity and provides means to detect
endoribonuclease activity or is a positive indicator of an mRNA
interferase or a functional fragment thereof, and wherein a change
in an amount of cleaved substrate in the presence of the agent
provides means to modulate endoribonuclease activity of an mRNA
interferase or functional fragment thereof.
[0029] Exemplary nucleic acid sequences encoding an mRNA
interferase include, but are not limited to, SEQ ID NO: 1 or 3, and
nucleic acid sequences that encode SEQ ID NO: 2 or 4, and homologs
and orthologs thereof as described herein below. An exemplary
homolog/ortholog thereof is MazF-mt1, comprising a nucleic and
amino acid sequence comprising SEQ ID NO: 69 and 74,
respectively.
[0030] In another embodiment, a method is provided for detecting an
activity of an mRNA interferase or functional fragment thereof,
wherein said activity is endoribonuclease activity, said method
comprising: [0031] (a) providing an amino acid sequence comprising
an mRNA interferase; [0032] (b) incubating the amino acid sequence
of step (a) with an endoribonuclease substrate under conditions
capable of promoting endoribonuclease activity; and [0033] (c)
measuring cleavage of said substrate, wherein cleavage of said
substrate indicates endoribonuclease activity and provides means to
detect or is a positive indicator of endoribonuclease activity of
an mRNA interferase or a functional fragment thereof.
[0034] The present invention also encompasses a method for
screening to identify an agent capable of modulating an activity of
an mRNA interferase or functional fragment thereof, wherein said
activity is endoribonuclease activity, said method comprising:
[0035] (a) providing an amino acid sequence comprising an mRNA
interferase; [0036] (b) incubating the amino acid sequence of step
(a) with an endoribonuclease substrate under conditions capable of
promoting endoribonuclease activity; [0037] (c) adding at least one
agent potentially capable of modulating endoribonuclease activity
of an mRNA interferase or functional fragment thereof; and [0038]
(d) measuring the cleavage of said substrate, wherein cleavage of
said substrate indicates endoribonuclease activity and provides
means to detect endoribonuclease activity of an mRNA interferase or
a functional fragment thereof, and wherein a change in an amount of
cleaved substrate in the presence of the at least one agent
identifies an agent capable of modulating an activity of an mRNA
interferase or functional fragment thereof. Such methods may be
performed, for example, in vitro or in a cell.
[0039] Agents identified using these methods, which are capable of
modulating an endoribonuclease activity of mRNA interferase or a
functional fragment thereof, can effectuate either an increase or a
decrease in substrate cleavage. Such modulatory agents are within
the scope of the invention. It is to be understood that such agents
may, for example, modulate endoribonuclease activity of an mRNA
interferase (e.g., PemK, MazF, or functional and/or structural
homologs or orthologs) by acting on the mRNA interferase (toxin) or
its antitoxin (e.g., PemI, MazE, respectively, or an antitoxin of a
functional and/or structural homolog or ortholog of either), or by
altering the autoregulatory feedback mechanism whereby
toxin-antitoxin complexes downregulate expression of the toxin and
antitoxin genes. An agent capable of altering the autoregulatory
feedback mechanism whereby toxin-antitoxin complexes downregulate
expression of toxin and antitoxin genes could alter the coordinate
regulation of these genes. In an aspect of this embodiment, an
agent that is capable of reducing toxin-antitoxin complex formation
inhibits the effect of antitoxin, which results in increased toxin
activity that eventually leads to cell death. In another aspect, an
agent that is capable of blocking expression of antitoxin and toxin
genes is envisioned, wherein this agent leads to an increase in
toxin levels relative to those of antitoxin due to the stable
nature of the toxins. Such an imbalance also results in cellular
toxicity.
[0040] Accordingly, such agents may be used advantageously for
treating a subject with a bacterial infection, particularly those
with antibiotic resistant strains of bacteria. Such agents are
within the scope of the present invention and may be used alone or
in combination.
[0041] Also provided is a method for modulating an activity of an
mRNA interferase or functional fragment thereof, wherein said
activity is endoribonuclease activity, said method comprising:
[0042] (a) providing an amino acid sequence of an mRNA interferase;
[0043] (b) incubating the amino acid sequence of step (a) with an
endoribonuclease substrate under conditions capable of promoting
endoribonuclease activity; [0044] (c) adding an agent capable of
modulating the endoribonuclease activity of an mRNA interferase or
functional fragment thereof; and [0045] (d) measuring cleavage of
said substrate, wherein cleavage of said substrate indicates
endoribonuclease activity and provides means to detect
endoribonuclease activity or is a positive indicator of an mRNA
interferase or a functional fragment thereof, and wherein a change
in an amount of cleaved substrate in the presence of the agent
provides means to modulate endoribonuclease activity of an mRNA
interferase or functional fragment thereof. Such methods may be
performed, for example, in cell-based assays (in culture or in a
subject such as a non-human animal or a human patient) or in
vitro.
[0046] In accordance with the present invention, exemplary amino
acid sequences comprising an mRNA interferase include, but are not
limited to, SEQ ID NO: 2 or 4, and homologs and orthologs thereof
as described herein below. An exemplary homolog/ortholog thereof is
MazF-mt1, comprising an amino acid sequence of SEQ ID NO: 74.
[0047] The invention also includes a method for detecting an
activity of an mRNA interferase or functional fragment thereof in a
cell, wherein said activity is endoribonuclease activity, said
method comprising: [0048] (a) providing a cell comprising an
expression vector, which vector comprises a nucleic acid sequence
encoding an mRNA interferase, and/or which encodes an amino acid
sequence comprising an mRNA interferase, and which optionally
includes at least one regulatory sequence; [0049] (b) incubating
the cell of step (a) under conditions capable of promoting
endoribonuclease activity of at least one cellular substrate; and
[0050] (c) measuring cleavage of said at least one cellular
substrate, wherein cleavage of said at least one cellular substrate
indicates endoribonuclease activity and provides means to detect
endoribonuclease activity of an mRNA interferase or a functional
fragment thereof in a cell.
[0051] In an aspect, a method for modulating an activity of an mRNA
interferase or functional fragment thereof in a cell is presented,
wherein said activity is endoribonuclease activity, said method
comprising: [0052] (a) providing a cell comprising an expression
vector, which vector comprises a nucleic acid sequence encoding an
mRNA interferase, and/or which encodes an amino acid sequence
comprising an mRNA interferase, and which optionally includes at
least one regulatory sequence; [0053] (b) incubating the cell of
step (a) under conditions capable of promoting endoribonuclease
activity of at least one cellular substrate; [0054] (c) adding an
agent capable of modulating endoribonuclease activity of an mRNA
interferase or functional fragment thereof; and [0055] (d)
measuring cleavage of said at least one cellular substrate, wherein
cleavage of said at least one cellular substrate indicates
endoribonuclease activity and provides means to detect
endoribonuclease activity of an mRNA interferase or a functional
fragment thereof in a cell, and wherein a change in an amount of at
least one cleaved substrate in the presence of the agent provides
means to modulate endoribonuclease activity of an mRNA interferase
or functional fragment thereof.
[0056] Also presented is a method for screening to identify an
agent capable of modulating an activity of an mRNA interferase or
functional fragment thereof in a cell, wherein said activity is
endoribonuclease activity, said method comprising: [0057] (a)
providing a cell comprising an expression vector, which vector
comprises a nucleic acid sequence encoding an mRNA interferase,
and/or which encodes an amino acid sequence comprising an mRNA
interferase, and which optionally includes at least one regulatory
sequence; [0058] (b) incubating the cell of step (a) under
conditions capable of promoting endoribonuclease activity of at
least one cellular substrate; [0059] (c) adding at least one agent
potentially capable of modulating endoribonuclease activity of an
mRNA interferase or functional fragment thereof; and [0060] (d)
measuring cleavage of said at least one cellular substrate, wherein
cleavage of said at least one cellular substrate indicates
endoribonuclease activity and provides means to detect
endoribonuclease activity of an mRNA interferase or a functional
fragment thereof in a cell, and wherein a change in an amount of at
least one cleaved substrate in the presence of the agent identifies
an agent capable of modulating an activity of an mRNA interferase
or functional fragment thereof.
[0061] In accordance with the present invention, a cell comprising
an expression vector which comprises a nucleic acid sequence
encoding an mRNA interferase encompasses nucleic acid sequences
that include, but are not limited to, SEQ ID NO: 1 or 3, and
homologs and orthologs thereof as described herein; and nucleic
acid sequences that encode SEQ ID NO: 2 or 4, and homologs and
orthologs thereof as described herein. An exemplary
homolog/ortholog thereof is MazF-mt1, comprising a nucleic and
amino acid sequence comprising SEQ ID NO: 69 and 74,
respectively.
[0062] Also provided is a composition comprising at least one mRNA
interferase or functional fragment thereof, an mRNA interferase
encoding nucleic acid sequence, and/or an mRNA interferase
modulatory agent identified using the methods of the invention and
a pharmaceutically acceptable buffer.
[0063] In an aspect, a method is presented for treating a patient
with a disorder, said method comprising administering to said
patient a therapeutically effective amount of a composition of the
invention to alleviate symptoms of said disorder. The composition
comprises at least one agent capable of either increasing or
decreasing endoribonuclease substrate cleavage, depending on the
disorder afflicting the patient, to alleviate symptoms of the
disorder.
[0064] Accordingly, the invention includes use of a therapeutically
effective amount of an mRNA interferase or functional fragment
thereof, an mRNA interferase encoding nucleic acid sequence, or an
mRNA interferase modulatory agent in the preparation of a
medicament for use in the treatment of a patient having a disorder
to alleviate symptoms of said disorder. Such medicaments may
further comprise a pharmaceutically acceptable buffer.
[0065] A disorder such as a bacterial infection, for example, is
treatable by administering a composition of the invention
comprising a therapeutically effective amount of at least one
molecule or agent capable of increasing endoribonuclease substrate
cleavage to a patient to alleviate symptoms of the bacterial
infection by reducing the number of bacteria in the patient. Such
methods are used to particular advantage when the bacterial
infection comprises at least one antibiotic resistant bacterial
strain.
[0066] The methods of the invention are also useful for the
treatment of a hyperproliferative disorder, wherein administering a
composition of the invention comprising a therapeutically effective
amount of at least one molecule or agent capable of increasing
endoribonuclease substrate cleavage to a patient alleviates
symptoms of the hyperproliferative disorder by reducing the number
of hyperproliferative cells in the patient. Hyperproliferative
disorders, which are characterized by unregulated cell
proliferation, treatable using the compositions and methods of the
invention include, but are not limited to, dysplasias and
metaplasias of different tissues, inflammatory conditions,
autoimmune diseases, hyperproliferative skin disorders, psoriasis,
allergy/asthma, atherosclerosis, restenosis after angioplastic
surgery, and cancer.
[0067] Also encompassed is a method for treating a patient with a
disorder, said method comprising administering to the patient a
therapeutically effective amount of a composition of the invention,
wherein at least one agent of said composition effectuates a
decrease in endoribonuclease substrate cleavage, to alleviate
symptoms of said disorder.
[0068] Also encompassed is a method for making a polypeptide in a
cell, said method comprising: [0069] (a) transfecting said cell
with a nucleic acid sequence encoding said polypeptide, wherein the
nucleic acid sequence encoding said polypeptide is mutated to
replace mRNA interferase recognition sequences with an alternate
triplet codon, wherein amino acid sequences of said polypeptide
encoded by said mutated nucleic acid sequence are not altered by
said mutating; [0070] (b) transfecting said cell with a nucleic
acid sequence encoding an mRNA interferase, wherein said mRNA
interferase recognizes said mRNA interferase recognition sequences;
and [0071] (c) expressing the nucleic acid sequences of step (a)
and (b) in said cell, wherein expressing the nucleic acid sequences
of step (a) and (b) in said cell provides means to produce the
polypeptide in said cell.
[0072] In accordance with the invention, the nucleic acid sequences
encoding either the polypeptide or the mRNA interferase may be
included in a first and a second expression vector, respectively.
Moreover, the transfecting steps of step (a) and (b) may be
performed separately or simultaneously (e.g., by co-transfection).
As indicated herein above, mutation of the mRNA interferase
recognition sequences in a nucleic acid sequence to a different
triplet sequence or codon does not alter the amino acid sequence of
the polypeptide encoded by the mutated nucleic acid sequence. The
mutation is, therefore, silent with respect to the amino acid
sequence of the encoded polypeptide. The purpose of mutating the
nucleic acid sequence is to dramatically reduce the susceptibility
of the RNA message transcribed therefrom to the endoribonucleolytic
activity of the mRNA interferase in question. Expression of a
nucleic acid of step (b) (e.g., a nucleic acid sequence encoding,
e.g., a PemK polypeptide or functional fragment thereof, or a MazF
polypeptide or functional fragment thereof, or a homolog or
ortholog of either MazF or PemK) reduces or inhibits synthesis of
cellular polypeptides encoded by nucleic acid sequences comprising
the mRNA interferase recognition sequences. Thus, the method
produces a desired polypeptide essentially in the absence of
cellular proteins whose RNA transcripts comprise the mRNA
interferase recognition sequence recognized by the expressed mRNA
interferase. The method, therefore, provides for making a
"purified" polypeptide in a cell. For some applications, the method
further comprises incubating the cell prior to or during step (c)
in media comprising at least one radioactively labeled isotope.
Such applications include, but are not limited to, the generation
of labeled polypeptides for subsequent analyses using nuclear
magnetic resonance (NMR) technology.
[0073] In a particular embodiment, the method for making a
polypeptide in a cell utilizes the mRNA recognition sequence
Adenine-Cytosine-Adenine (ACA) and the mRNA interferase MazF
comprising SEQ ID NO: 2 or a functional fragment thereof. In this
embodiment, expression of a nucleic acid encoding MazF or a
functional fragment thereof reduces or inhibits synthesis of
cellular polypeptides encoded by nucleic acid sequences comprising
ACA sequences.
[0074] In another embodiment, the method for making a polypeptide
in a cell utilizes the mRNA recognition sequence Uracil-Adenine-X
(UAX), wherein X is a Cytosine (C), A, or U, and the mRNA
interferase PemK comprising SEQ ID NO: 4 or a functional fragment
thereof. In this embodiment, expression of a nucleic acid encoding
PemK or a functional fragment thereof reduces or inhibits synthesis
of cellular polypeptides encoded by nucleic acid sequences
comprising UAX sequences.
[0075] In yet another embodiment, the method for making a
polypeptide in a cell utilizes the mRNA recognition sequence
Uracil-Adenine-C (UAC), and the mRNA interferase MazF-mt1
comprising SEQ ID NO: 74 or a functional fragment thereof. In this
embodiment, expression of a nucleic acid encoding MazF-mt1 or a
functional fragment thereof reduces or inhibits synthesis of
cellular polypeptides encoded by nucleic acid sequences comprising
UAC sequences.
[0076] In one aspect of the present invention, a method for making
a polypeptide is presented comprising: [0077] (a) providing a
nucleic acid sequence encoding said polypeptide, wherein the
nucleic acid sequence encoding said polypeptide is mutated to
replace mRNA interferase recognition sequences with an alternate
triplet codon, wherein amino acid sequences of said polypeptide
encoded by said mutated nucleic acid sequence are not altered by
said mutating; [0078] (b) providing a nucleic acid sequence
encoding an mRNA interferase, wherein said mRNA interferase
recognizes said mRNA interferase recognition sequences; and [0079]
(c) expressing the nucleic acid sequences of step (a) and (b),
wherein expressing the nucleic acid sequences of step (a) and (b)
provides means to produce the polypeptide. This method may be
performed in vitro, for example, in a test tube or the like.
Suitable in vitro transcription/translation systems or cell-free
expression systems are known in the art and described herein below.
The mRNA interferase or fragment thereof may optionally be provided
as an expressed protein, rather than in the form of a nucleic acid
sequence requiring expression therefrom.
[0080] In a particular embodiment, the method for making a
polypeptide utilizes the mRNA recognition sequence ACA and the mRNA
interferase MazF comprising SEQ ID NO: 2 or a functional fragment
thereof.
[0081] In an alternative embodiment, the method for making a
polypeptide utilizes the mRNA recognition sequence UAX, wherein X
is a C, A, or U, and the mRNA interferase PemK comprising SEQ ID
NO: 4 or a functional fragment thereof.
[0082] In yet another embodiment, the method for making a
polypeptide utilizes the mRNA recognition sequence UAC, and the
mRNA interferase MazF-mt1 comprising SEQ ID NO: 74 or a functional
fragment thereof.
[0083] The present invention is also directed to a method for
making a plurality of polyribonucleotide sequences using mRNA
interferases of the invention. The method comprises: [0084] (a)
providing a first and a second nucleic acid sequence, wherein a
region of said first nucleic acid sequence is complementary to a
region of said second nucleic acid sequence and neither
complementary region of said first or second nucleic acid sequence
comprises a sequence complementary to an mRNA interferase
recognition site, and each of said first and second nucleic acid
sequences is phosphorylated at its 5' terminus; [0085] (b)
annealing said first and second nucleic acid sequences via a
complementary region of said first and second nucleic acid
sequences to form a double stranded nucleic acid sequence
comprising a complementary region flanked by single stranded
overhangs, wherein each of said single stranded overhangs comprises
at least one sequence complementary to an mRNA interferase
recognition site and said single stranded overhangs are
complementary to each other; [0086] (c) ligating annealed first and
second nucleic acid sequences via complementary single stranded
overhangs to form a concatamer comprising a plurality of tandem
repeats of annealed first and second nucleic acid sequences; [0087]
(d) amplifying said concatamer using a first primer comprising a T7
promoter and a region complementary to said first nucleic acid
sequence and a second primer complementary to said second nucleic
acid sequence, wherein said amplifying produces a plurality of
concatamers comprising a T7 promoter; [0088] (e) transcribing RNA
molecules from said plurality of concatamers using T7 RNA
polymerase, wherein each of said RNA, molecules comprises a
plurality of tandem repeats of a polyribonucleotide sequence
flanked by mRNA interferase recognition sites; and [0089] (f)
digesting said RNA molecules with an mRNA interferase capable of
cleaving RNA at said interferase recognition sites, wherein said
digesting produces a plurality of said polyribonucleotide
sequences.
[0090] In a particular aspect of the method for making a plurality
of polyribonucleotide sequences, the mRNA recognition sequence is
an ACA sequence and the mRNA interferase is MazF comprising SEQ ID
NO: 2 or a functional fragment thereof.
[0091] In another aspect of the method for making a plurality of
polyribonucleotide sequences, the mRNA recognition sequence is a
UAX sequence, wherein X is a C, A, or U, and the mRNA interferase
is PemK comprising SEQ ID NO: 4 or a functional fragment
thereof.
[0092] In yet another aspect of the method for making a plurality
of polyribonucleotide sequences, the mRNA recognition sequence is a
UAC sequence, and the mRNA interferase is MazF-mt1 comprising SEQ
ID NO: 74 or a functional fragment thereof.
[0093] The invention is also directed to an isolated nucleic acid
sequence which encodes a polypeptide having sequence and/or
structural homology to either SEQ ID NO: 2 or SEQ ID NO: 4, or a
functional fragment thereof, wherein said polypeptide is capable of
exhibiting endoribonuclease activity. In one embodiment, a
polypeptide having sequence and/or structural homology to SEQ ID
NO: 2 or a functional fragment thereof is a MazF ortholog capable
of exhibiting endoribonuclease activity. Polypeptides capable of
exhibiting endoribonuclease activity include, but are not limited
to, Bacillus halodurans MazF (NP.sub.--244588.1), Staphylococcus
epidermidis MazF (AAG23809.1), Staphylococcus aureus MazF
(NP.sub.--372592.1), Bacillus subtilis MazF (1NE8_A), Neisseria
meningitides MazF (NP.sub.--266040.1), Morganella morgani MazF
(AAC82516.1) and Mycobacterium tuberculosis MazF
(NP.sub.--217317.1).
[0094] In another embodiment, a polypeptide having sequence and/or
structural homology to SEQ ID NO: 4 or a functional fragment
thereof is a PemK homolog or ortholog capable of exhibiting
endoribonuclease activity. Polypeptides capable of exhibiting
endoribonuclease activity include, but are not limited to, the 73
known members of the PemK protein family, which includes MazF
(ChpAK), ChpBK and other PemK-like proteins. The following is a
list of designations for these proteins found in web site
(http://pfam.wusthedu/cgi-bin/getdesc?acc=PF02452): Q9RX98; Q8F5A3;
Q9K6K8; CHPA_ECOLI; Q7NPF9; Q88TP7; Q7WWW1; Q8YS80; Q8DW95; Q82YR2;
Q7X3Y1; Q93S64; Q8PRN1; Q8GFY1; O52205; PEMK_ECOLI Q7N4H2; Q88PS7;
Q8XCF2 CHPB_ECOLI; Q82VU0; Q8UGU5; Q9RWK4; Q9PHH8; Q7TXU4; P71650;
Q7U1Y5; P96295; Q9JWF2; Q9JXI1; Q8E882; Q82VB5; Q8KJS3; Q7NMY4;
Q9KFF7; P96622; Q811T4; Q81VF4; Q8ESK5; Q92DC7; Q8Y8L0; Q97LR0;
Q8XNN7; Q8R861; Q88Z43; O07123; Q83719; Q9F7V5; Q8CRQ1; O05341;
P95840; Q9FCV0; Q837L1; Q93M89; Q991U9; Q82UB5; Q93MT8; YJ91 MYCTU;
Q97MV8; Q7NHW0; Q7NL95; Q8YML2; Q7NHR3; YE95_MYCTU; Q9PCB9; Q8YZW8;
Q7TZ90; P95272; Q8VJR1; Q7U0N2; O53450; O06780; and Q7U1I8.
[0095] Also encompassed by the invention are expression vectors
comprising an isolated nucleic acid sequence which encodes a
polypeptide having sequence and/or structural homology to either
SEQ ID NO: 2 or SEQ ID NO: 4, or a functional fragment thereof,
wherein said polypeptide is capable of exhibiting endoribonuclease
activity. Cells comprising these expression vectors are also
envisioned, as are transgenic animals comprising an isolated
nucleic acid sequence of the invention, wherein a nucleic acid
sequence is expressed in at least one cell of the transgenic
animal.
[0096] In another aspect of the invention, an isolated amino acid
sequence comprising a polypeptide having sequence and/or structural
homology to either SEQ ID NO: 2 or SEQ ID NO: 4, or a functional
fragment thereof, wherein said polypeptide is capable of exhibiting
endoribonuclease activity, is presented. Also included are
expression vectors encoding an amino acid sequence of the
invention, wherein expression of the amino acid sequence is
controlled by regulatory sequences in the expression vector, cells
comprising such expression vectors, and transgenic animals
comprising an amino acid sequence of the invention, wherein the
amino acid sequence is expressed in at least one cell in the
transgenic animal.
[0097] In another aspect of the invention, an isolated nucleic acid
sequence comprising SEQ ID NO: 1 or SEQ ID NO: 3, wherein the
nucleic acid sequence encodes an mRNA interferase or functional
fragment thereof capable of exhibiting endoribonuclease activity is
provided.
[0098] Also described is an expression vector comprising a nucleic
acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3, wherein the nucleic
acid sequence encodes an mRNA interferase or functional fragment
thereof capable of exhibiting endoribonuclease activity, and SEQ ID
NO: 1 or SEQ ID NO: 3 is operably linked to a regulatory sequence.
Moreover, a cell comprising such an expression vector is also
within the scope of the invention.
[0099] In another aspect, a transgenic animal comprising a nucleic
acid sequence comprising SEQ ID NO: 1 or SEQ ID NO: 3, wherein the
nucleic acid sequence encodes an mRNA interferase or functional
fragment thereof capable of exhibiting endoribonuclease activity,
and wherein the nucleic acid sequence is expressed in at least one
cell of the transgenic animal is presented.
[0100] Also provided is an isolated nucleic acid sequence encoding
a polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 4, wherein the
polypeptide is an mRNA interferase or functional fragment thereof,
capable of exhibiting endoribonuclease activity.
[0101] In another aspect, an expression vector is presented
comprising an isolated nucleic acid sequence encoding a polypeptide
comprising SEQ ID NO: 2 or SEQ ID NO: 4, wherein the polypeptide is
an mRNA interferase or functional fragment thereof, capable of
exhibiting endoribonuclease activity, and the nucleic acid sequence
is operably linked to regulatory sequence. Cells comprising such
expression vectors are also encompassed.
[0102] In yet another aspect, a transgenic animal comprising an
isolated nucleic acid sequence encoding a polypeptide comprising
SEQ ID NO: 2 or SEQ ID NO: 4 is presented, wherein the polypeptide
is an mRNA interferase or functional fragment thereof, capable of
exhibiting endoribonuclease activity, and the nucleic acid sequence
is expressed in at least one cell of the transgenic animal
[0103] In an embodiment of the invention, an isolated amino acid
sequence comprising SEQ ID NO: 2 or SEQ ID NO: 4, wherein the amino
acid sequence is an mRNA interferase or functional fragment
thereof, and the mRNA interferase or functional fragment thereof is
capable of exhibiting endoribonuclease activity is provided.
[0104] Also described is an expression vector encoding an isolated
amino acid sequence comprising SEQ ID NO: 2 or SEQ ID NO: 4,
wherein the amino acid sequence is an mRNA interferase or
functional fragment thereof, and the mRNA interferase or functional
fragment thereof is capable of exhibiting endoribonuclease
activity, and expression of the amino acid sequence is controlled
by regulatory sequences in the expression vector. A cell comprising
such an expression vector is also encompassed by the invention.
[0105] In another aspect, a transgenic animal comprising an
isolated polypeptide comprising SEQ ID NO: 2 or SEQ ID NO: 4,
wherein the polypeptide is an mRNA interferase or functional
fragment thereof, capable of exhibiting endoribonuclease activity,
and the polypeptide is expressed in at least one cell in the
transgenic animal is presented.
[0106] The present invention also includes a kit comprising an
isolated nucleic acid sequence comprising SEQ ID NO: 1 or SEQ ID
NO: 3, wherein the nucleic acid sequence encodes an mRNA
interferase or functional fragment thereof; an isolated amino acid
sequence comprising SEQ ID NO: 2 or SEQ ID NO: 4, wherein the amino
acid sequence is an mRNA interferase or functional fragment
thereof; an mRNA interferase activity compatible buffer; and
instructional materials.
[0107] The present invention also encompasses the use of mRNA
interferases of the invention in applications directed to gene
therapy. Cells that are engineered to express a molecule, which is
defective or deficient in a subject (e.g., a human subject), can
also be designed to self destruct via the incorporation of an mRNA
interferase of the invention, the expression of which is controlled
by an inducible regulatory element(s). Incorporation of an
inducible means for the destruction of cells used for gene therapy
applications provides a fail-safe mechanism whereby such cells can
be eliminated after they have conferred beneficial effects to a
subject and/or before they can cause deleterious effects.
BRIEF DESCRIPTION OF THE DRAWINGS
[0108] FIGS. 1A and 1B show cellular proliferation on different
solid media and sequence alignments of different members of the
MazF family of RNA Interferases. FIG. 1A shows growth properties of
E. coli BW25113(.DELTA.araBAD) cells transformed with pBAD-MazF,
pBAD-MazF R29S or pBAD-MazF R86G plasmid, respectively. FIG. 1B
depicts sequence alignments of MazF of Escherichia coli (GenBank
Accession No. NP.sub.--289336.1) with that of Bacillus halodurans
(GenBank Accession No. NP.sub.--244588.1), Staphylococcus
epidermidis (GenBank Accession No. AAG23809.1), Staphylococcus
aureus (GenBank Accession No. NP.sub.--372592.1), Bacillus subtilis
(GenBank Accession No. 1NE8_A), Neisseria meningitides (GenBank
Accession No. NP.sub.--266040.1), Morganella morgani (GenBank
Accession No. AAC82516.1) and Mycobacterium tuberculosis (GenBank
Accession No. NP.sub.--217317.1).
[0109] FIGS. 2A-E show line graphs depicting the effect of MazF on
.sup.35S-Met incorporation (FIG. 2A); on [.alpha.-.sup.32P]dTTP
incorporation (FIG. 2B); and on [.alpha.-.sup.32P]UTP incorporation
(FIG. 2C) in toluene-treated E. coli cells; and the effect of MazF
on .sup.35S-Met incorporation into E. coli cells in vivo (FIG. 2D);
and SDS-PAGE analysis of in vivo protein synthesis after the
induction of MazF (FIG. 2E).
[0110] FIGS. 3A-C show a line trace depicting a densitometric
analysis of polysome profiles (FIG. 3A), which reveals the effect
of MazF on polysome profiles, and show protein gels demonstrating
the effect of MazF(His).sub.6 on prokaryotic (FIG. 3B) and
eukaryotic (FIG. 3C) cell-free protein synthesis.
[0111] FIG. 4A-D show the effects of MazF on mRNA synthesis. FIG.
4A shows toeprinting of the mazG mRNA in the presence of MazF. FIG.
4B shows toeprinting of the mazG mRNA after phenol extraction. FIG.
4C shows an effect of MazE on MazF cleavage of mazG mRNA. FIG. 4D
shows a Northern blot analysis of total cellular mRNA extracted
from E. coli BW25113 cells containing pBAD-MazF at various time
points after the addition of arabinose (as indicated) and probed
with radiolabeled ompA and lpp ORF DNA.
[0112] FIGS. 5A and B show line traces depicting a densitometric
analysis of polysome profiles in the absence (FIG. 5A) and presence
(FIG. 5B) of kasugamycin. The positions of 70, 50 and 30S ribosomes
are indicated.
[0113] FIG. 6 shows a toeprinting analysis depicting the inhibition
of MazF cleavage of the mazG mRNA by ribosomes.
[0114] FIG. 7 shows a toeprinting analysis illustrating the effect
of the GGAG to UUUG mutation of the Shine-Dalgarno sequence of the
mazG mRNA on MazF function.
[0115] FIG. 8 shows a toeprinting analysis revealing the effect of
mutations at the initiation codon of the mazG mRNA on MazF
function.
[0116] FIG. 9 shows a toeprinting analysis depicting the effects of
mutations at the UACAU (U.sub.1A.sub.2C.sub.3A.sub.4U.sub.5)
cleavage sequences on MazF function.
[0117] FIG. 10 shows an acrylamide gel revealing the effect of MazF
and MazE on the cleavage of 16S and 23S rRNA.
[0118] FIG. 11 shows an analysis of purified MazE-MazF(His).sub.6
complex, MazF, and (His).sub.6MazE proteins by tricine SDS-PAGE
separation and visualization by staining with Coomassie brilliant
blue.
[0119] FIGS. 12A and 12B show a native polyacrylamide gel
demonstrating stoichiometric complex formation between
(His).sub.6MazE and MazF.
[0120] FIG. 13 shows a line graph of a protein molecular weight
standard curve which depicts the determined molecular masses of
MazF and the MazE-MazF(His).sub.6 complex.
[0121] FIGS. 14A, 14B, and 14C show EMSA gels depicting binding of
(His).sub.6MazE and/or MazF to the mazEF promoter DNA.
[0122] FIG. 15 shows alignments of the amino acid sequences of MazE
homologs. Sequence alignments of eight MazF, family proteins are
shown.
[0123] FIGS. 16A and 16B show EMSA gels depicting protein-DNA
interactions. As shown in FIGS. 16A and 16B, a MazE N-terminal
domain mediates DNA binding of MazE-MazF(His).sub.6 complex and
(His).sub.6MazE protein, respectively.
[0124] FIG. 17 depicts MazE and truncations thereof and the results
of yeast two-hybrid assays indicating interactions between MazF and
MazE or truncates/fragments thereof.
[0125] FIGS. 18A and 18B show native polyacrylamide gels depicting
protein interactions and EMSA gels depicting protein-DNA
interactions, respectively.
[0126] FIG. 19 depicts an X-ray structure of the MazE-MazF
complex.
[0127] FIGS. 20A and 20B show a nucleic and amino acid sequence of
E. coli MazF.
[0128] FIGS. 21A and 21B show a nucleic and amino acid sequence of
E. coli MazE.
[0129] FIGS. 22A-22H show nucleic acid sequences of orthologs of E.
coli MazF.
[0130] FIGS. 23A-23H show amino acid sequences of orthologs of E.
coli MazF.
[0131] FIGS. 24A-24G show nucleic acid sequences of orthologs of E.
coli MazE.
[0132] FIGS. 25A-25G show amino acid sequences of orthologs of E.
coli MazE.
[0133] FIGS. 26A-C show the effects of PemK on DNA and protein
synthesis. FIGS. 26A and 26B are line graphs depicting the effect
of PemK on (A) DNA and (B) protein synthesis in vivo. FIG. 26C
shows an SDS-PAGE analysis of total cellular proteins following
PemK induction.
[0134] FIGS. 27A-C show autoradiograms of proteins separated by
SDS-PAGE. The results demonstrate the effects of PemK and PemI on
cell-free protein synthesis.
[0135] FIGS. 28A-E show a photograph of a polyacrylamide gel (A) or
autoradiograms of polyacrylamide gels (B-E) that illustrate PemK
mediated endoribonuclease activity.
[0136] FIGS. 29A-B show a photograph of a polyacrylamide sequencing
gel (A) and an autoradiogram of a polyacrylamide gel (B) that
reveal the specificity of PemK mediated endoribonuclease activity
for single stranded RNA.
[0137] FIGS. 30A-D show a Northern blot analysis (A) or
autoradiograms of polyacrylamide gels (B-D) that depict PemK
mediated endonucleolytic activity on various mRNAs in vivo.
[0138] FIGS. 31A and 31B show a nucleic and amino acid sequence of
E. coli PemK.
[0139] FIGS. 32A and 32B show a nucleic and amino acid sequence of
E. coli PemI.
[0140] FIG. 33 shows sequence alignments of PemK, ChpBK and MazF
polypeptides.
[0141] FIG. 34 shows sequence alignments of PemK, ChpBK, MazF and
three PemK-like proteins from Mycobacterium celatum, Pseudomonas
putida KT2440 and Shigella flexneri 2a str. 301.
[0142] FIG. 35 shows a nucleic and amino acid sequence of mature
human eotaxin (SEQ ID NOs: 67 and 68, respectively).
[0143] FIG. 36 is a schematic depicting the pCold I vector.
[0144] FIG. 37 shows an autoradiogram of a polyacrylamide gel
revealing the production of mature human eotaxin in the absence of
background protein synthesis.
[0145] FIGS. 38A-F are micrographs showing the morphology of human
cells induced to express MazF toxin (D-F) and uninduced (A-C).
[0146] FIGS. 39A-B show (A) the amino acid sequence of the
N-terminal extension of the MazF (E24A) mutant expressed with
pET28a and (B) a photograph of a polyacrylamide gel showing a band
corresponding to uncleaved MazF mutant fusion protein (lane 1) and
thrombin cleaved MazF mutant fusion protein (lane 2).
[0147] FIG. 40 shows a primer extension analysis of MazF-mt1 mRNA
interferase activity. FIGS. 41A-B show sequence alignments of (A)
E. coli MazF and its homologs in M. tuberculosis and (B) E. coli
MazF and its homologs in B. subtilis, B. anthracis and S.
aureus.
[0148] FIG. 42 shows an RNA sequence of the mazF open reading frame
(ORF). All ACA sequences are shown in gray, and base changes that
replace ACA sequences without altering the MazF amino acid sequence
encoded therefrom are shown on top of the RNA sequence.
[0149] FIGS. 43A-E show nucleic acid sequences of E. coli MazF
homologs in M. tuberculosis.
[0150] FIGS. 44A-E show amino acid sequences of E. coli MazF
homologs in M. tuberculosis.
[0151] FIGS. 45A-D show nucleic acid sequences of three PemK-like
proteins from Mycobacterium celatum, Pseudomonas putida KT2440 and
Shigella flexneri 2a str. 301 and ChpBK.
[0152] FIGS. 46A-D show amino acid sequences of three PemK-like
proteins from Mycobacterium celatum, Pseudomonas putida KT2440 and
Shigella flexneri 2a str. 301 and ChpBK.
DETAILED DESCRIPTION OF THE INVENTION
[0153] Before the present discovery and methods of use thereof are
described, it is to be understood that this invention is not
limited to particular assay methods, or test compounds and
experimental conditions described, as such methods and compounds
may vary. It is also to be understood that the terminology used
herein is for the purpose of describing particular embodiments
only, and is not intended to be limiting, since the scope of the
present invention will be limited only the appended claims.
[0154] Accordingly, the term "MazF" or "PemK" as used in the
specification and claims refers both to the general class of
endoribonucleases, and to the particular enzyme bearing the
particular name, and is intended to include enzymes having
structural and sequence homology thereto. Likewise, the family of
enzymes encompassed by the present invention is referred to herein
as "RNA Interferases," a novel family identified herein by the
inventors. Moreover, it is intended that the invention extends to
molecules having structural and functional similarity consistent
with their role in the invention.
[0155] Moreover, the term "MazE" or "PemI" as used in the
specification and claims refers both to the general class of MazE
(or MazF modulatory molecules) or PemI (or Pem K modulatory
molecules, and to a particular molecule bearing this name, and is
intended to include MazF, (or MazF modulatory molecules) or PemI
(or PemK modulatory molecules) having structural and/or sequence
homology to SEQ ID NO: 6 or SEQ ID NO: 8. Indeed, it is intended
that the invention extends to molecules having structural and
functional similarity consistent with their role in the
invention.
[0156] Bacterial cell-death and growth inhibition are triggered by
endogenous toxic genes in bacterial genomes in response to certain
stress conditions. MazF is an endogenous toxin which causes
cell-death and is encoded by an operon called "MazEF addiction
module" in Escherichia coli. MazE is a labile antitoxin against
MazF. As described herein, the effects of MazF on DNA, RNA and
protein synthesis were examined in permeabilized cells. Briefly, at
ten minutes after MazF induction, ATP-dependent .sup.35S-methionine
incorporation was completely inhibited, whereas
[.alpha.-.sup.32P]dTTP and [.alpha.-.sup.32P]UTP incorporation were
not, indicating that MazF is a specific inhibitor of protein
synthesis. Moreover, purified MazF inhibited protein synthesis in
both prokaryotic and eukaryotic cell-free systems, and this
inhibition was blocked in the presence of MazE. When analyzed by
sucrose density-gradient centrifugation, MazF induction blocked the
formation of polysomes with a concomitant increase of the 70S
ribosomal fraction, while the 50S and 30S ribosomal fractions were
unaffected by expression of MazF.
[0157] Of note, toeprinting analysis revealed that MazF is a
sequence specific endoribonuclease that recognizes ACA sequences
and functions independently of the ribosome. Moreover, Northern
blot analysis indicated that whole cellular mRNAs were degraded
upon MazF induction. The present inventors have therefore made the
surprising discovery that MazF is the first defined member of a
novel family of endoribonucleases and, in view of its ability to
interfere with the function of cellular mRNA, have designated it
herein an "mRNA interferase". As shown herein, the interferase
function results from the cleavage of mRNA transcripts at a
specific sequence (ACA), which leads to rapid cell growth arrest
and/or cell death. As demonstrated herein, the role of mRNA
interferases has broad implications in normal cellular physiology
and/or distressed cellular physiology induced by conditions of
stress.
[0158] The present inventors have also discovered that purified
PemK, the toxin encoded by the "pemI-pemK addiction module",
inhibits protein synthesis in an E. coli cell-free system, while
the addition of PemI, the antitoxin against PemK, restores protein
synthesis. Additional studies described herein reveal that PemK is
a sequence-specific endoribonuclease that cleaves mRNAs and thereby
inhibits protein synthesis. PemI blocks PemK mediated
endoribonuclease activity and thus restores protein synthesis. PemK
is shown to cleave only single-stranded RNA, preferentially at the
5' or 3' side of the A residue in a "UAX (X is C, A or U)"
recognition site. Upon induction, PemK cleaves cellular mRNAs to
effectively block protein synthesis in E. coli. pemK homologs have
been identified on the genomes of a wide range of bacteria and the
present inventors propose herein that PemK and its homologues form
a novel endoribonuclease family that interferes with mRNA function
by cleaving cellular mRNAs in a sequence-specific manner.
[0159] In order to more clearly set forth the parameters of the
present invention, the following definitions are used:
[0160] The phrase "flanking nucleic acid sequences" refers to those
contiguous nucleic acid sequences that are 5' and 3' to the
endonuclease cleavage site. As used in this specification and the
appended claims, the singular forms "a", "an", and "the" include
plural references unless the context clearly dictates otherwise.
Thus for example, reference to "the method" includes one or more
methods, and/or steps of the type described herein and/or which
will become apparent to those persons skilled in the art upon
reading this disclosure and so forth.
[0161] The term "endonuclease" refers to an enzyme that can cleave
DNA internally.
[0162] The term "endoribonuclease" refers to an enzyme that can
cleave RNA internally.
[0163] The term "complementary" refers to two DNA strands that
exhibit substantial normal base pairing characteristics.
Complementary DNA may, however, contain one or more mismatches.
[0164] The term "hybridization" refers to the hydrogen bonding that
occurs between two complementary DNA strands.
[0165] "Nucleic acid" or a "nucleic acid molecule" as used herein
refers to any DNA or RNA molecule, either single or double stranded
and, if single stranded, the molecule of its complementary sequence
in either linear or circular form. In discussing nucleic acid
molecules, a sequence or structure of a particular nucleic acid
molecule may be described herein according to the normal convention
of providing the sequence in the 5' to 3' direction. With reference
to nucleic acids of the invention, the term "isolated nucleic acid"
is sometimes used. This term, when applied to DNA, refers to a DNA
molecule that is separated from sequences with which it is
immediately contiguous in the naturally occurring genome of the
organism in which it originated. For example, an "isolated nucleic
acid" may comprise a DNA molecule inserted into a vector, such as a
plasmid or virus vector, or integrated into the genomic DNA of a
prokaryotic or eukaryotic cell or host organism.
[0166] When applied to RNA, the term "isolated nucleic acid" refers
primarily to an RNA molecule encoded by an isolated DNA molecule as
defined above. Alternatively, the term may refer to an RNA molecule
that has been sufficiently separated from other nucleic acids with
which it is generally associated in its natural state (i.e., in
cells or tissues). An isolated nucleic acid (either DNA or RNA) may
further represent a molecule produced directly by biological or
synthetic means and separated from other components present during
its production.
[0167] "Natural allelic variants", "mutants" and "derivatives" of
particular sequences of nucleic acids refer to nucleic acid
sequences that are closely related to a particular sequence but
which may possess, either naturally or by design, changes in
sequence or structure. By closely related, it is meant that at
least about 60%, but often, more than 85%, of the nucleotides of
the sequence match over the defined length of the nucleic acid
sequence referred to using a specific SEQ ID NO. Changes or
differences in nucleotide sequence between closely related nucleic
acid sequences may represent nucleotide changes in the sequence
that arise during the course of normal replication or duplication
in nature of the particular nucleic acid sequence. Other changes
may be specifically designed and introduced into the sequence for
specific purposes, such as to change an amino acid codon or
sequence in a regulatory region of the nucleic acid. Such specific
changes may be made in vitro using a variety of mutagenesis
techniques or produced in a host organism placed under particular
selection conditions that induce or select for the changes. Such
sequence variants generated specifically may be referred to as
"mutants" or "derivatives" of the original sequence.
[0168] The terms "percent similarity", "percent identity" and
"percent homology" when referring to a particular sequence are used
as set forth in the University of Wisconsin GCG software program
and are known in the art.
[0169] The present invention also includes active portions,
fragments, derivatives and functional or non-functional mimetics of
MazF polypeptides or proteins of the invention. An "active portion"
of a MazF polypeptide means a peptide that is less than the full
length MazF polypeptide, but which retains measurable biological
activity.
[0170] A "fragment" or "portion" of an mRNA interferase means a
stretch of amino acid residues of at least about five to seven
contiguous amino acids, often at least about seven to nine
contiguous amino acids, typically at least about nine to thirteen
contiguous amino acids and, most preferably, at least about twenty
to thirty or more contiguous amino acids. A "derivative" of an mRNA
interferase or a fragment thereof means a polypeptide modified by
varying the amino acid sequence of the protein, e.g. by
manipulation of the nucleic acid encoding the protein or by
altering the protein itself. Such derivatives of the natural amino
acid sequence may involve insertion, addition, deletion or
substitution of one or more amino acids, and may or may not alter
the essential activity of the original mRNA interferase.
[0171] Different "variants" of an mRNA interferase exist in nature.
These variants may be alleles characterized by differences in the
nucleotide sequences of the gene coding for the protein, or may
involve different RNA processing or post-translational
modifications. The skilled person can produce variants having
single or multiple amino acid substitutions, deletions, additions
or replacements. These variants may include inter alia: (a)
variants in which one or more amino acids residues are substituted
with conservative or non-conservative amino acids, (b) variants in
which one or more amino acids are added to an mRNA interferase, (c)
variants in which one or more amino acids include a substituent
group, and (d) variants in which an mRNA interferase is fused with
another peptide or polypeptide such as a fusion partner, a protein
tag or other chemical moiety, that may confer useful properties to
an mRNA interferase, such as, for example, an epitope for an
antibody, a polyhistidine sequence, a biotin moiety and the like.
Other mRNA interferases of the invention include variants in which
amino acid residues from one species are substituted for the
corresponding residue in another species, either at conserved or
non-conserved positions. In another embodiment, amino acid residues
at non-conserved positions are substituted with conservative or
non-conservative residues. The techniques for obtaining these
variants, including genetic (suppressions, deletions, mutations,
etc.), chemical, and enzymatic techniques are known to a person
having ordinary skill in the art.
[0172] To the extent such allelic variations, analogues, fragments,
derivatives, mutants, and modifications, including alternative
nucleic acid processing forms and alternative post-translational
modification forms result in derivatives of an mRNA interferase
that retain any of the biological properties of the mRNA
interferase, they are included within the scope of this
invention.
[0173] The terms "ortholog" or "homolog" as used herein refer to
nucleases encoded by nucleic acid sequences whose polypeptide
product has greater than 60% identity to a MazF encoding sequence
and/or whose gene products have similar three dimensional structure
and/or biochemical activities of MazF. Exemplary orthologs/homologs
include, without limitation, MazF of Bacillus halodurans (GenBank
Accession No. NP.sub.--244588.1), Staphylococcus epidermidis
(GenBank Accession No. AAG23809.1), Staphylococcus aureus (GenBank
Accession No. NP.sub.--372592.1), Bacillus subtilis (GenBank
Accession No. 1NE8_A), Neisseria meningitides (GenBank Accession
No. NP.sub.--266040.1), Morganella morgani (GenBank Accession No.
AAC82516.1) and Mycobacterium tuberculosis (GenBank Accession No.
NP.sub.--217317.1). See FIGS. 22 and 23. The terms "ortholog" and
"homolog" may be used to refer to orthologs/homologs of a MazF
nucleic or amino acid sequence of any species. Such species
include, but are not limited to, E. coli, Bacillus halodurans,
Staphylococcus epidermidis, Staphylococcus aureus, Bacillus
subtilis, Neisseria meningitides, Morganella morgani, Mycobacterium
tuberculosis, Mus musculus, and Homo sapiens. The use of nucleases
encoded by such orthologs/homologs in the methods of the invention
is contemplated herein.
[0174] The term "ortholog" or "homolog" as used herein also refers
to nucleases encoded by nucleic acid sequences whose polypeptide
product has greater than 60% identity to a PemK encoding sequence
and/or whose gene products have similar three dimensional structure
and/or biochemical activities of PemK. The terms "ortholog" and
"homolog" may be used to refer to orthologs/homologs of a PemK
nucleic or amino acid sequence of any species.
[0175] The use of nucleases encoded by homologs or orthologs of
PemK in the methods of the invention is contemplated herein.
Exemplary homologs and orthologs include, without limitation, the
73 known members of the PemK protein family, which includes MazF
(ChpAK), ChpBK and other PemK-like proteins. The following is a
list of designations for these proteins found in web site
(http://pfam.wustl.edu/cgi-bin/getdesc?acc=PF02452): Q9RX98;
Q8F5A3; Q9K6K8; CHPA_ECOLI; Q7NPF9; Q88TP7; Q7WWW1; Q8YS80; Q8DW95;
Q82YR2; Q7X3Y1; Q93S64; Q8PRN1; Q8GFY1; O52205; PEMK_ECOLI Q7N4H2;
Q88PS7; Q8XCF2 CHPB_ECOLI; Q82VU0; Q8UGU5; Q9RWK4; Q9PHH8; Q7TXU4;
P71650; Q7U1Y5; P96295; Q9JWF2; Q9JXI1; Q8E882; Q82VB5; Q8KJS3;
Q7NMY4; Q9KFF7; P96622; Q811T4; Q81VF4; Q8ESK5; Q92DC7; Q8Y8L0;
Q97LR0; Q8XNN7; Q8R861; Q88Z43; O07123; Q83719; Q9F7V5; Q8CRQ1;
O005341; P95840; Q9FCV0; Q837L1; Q93M89; Q991U9; Q82UB5; Q93MT8;
YJ91_MYCTU; Q97MV8; Q7NHW0; Q7NI95; Q8YML2; Q7NHR3; YE95_MYCTU;
Q9PCB9; Q8YZW8; Q7TZ90; P95272; Q8VJR1; Q7U0N2; O53450; O06780; and
Q7U1I8. See FIGS. 33 and 34.
[0176] Swiss-Protein Number followed by NCBI Number:
[0177] Q9RX98 NP.sub.--294140 Q8F5A3 NP.sub.--711962 Q9K6K8
NP.sub.--244588 CHPA_ECOLI NP.sub.--417262 Q7NPF9 NP.sub.--923042
Q88TP7 NP.sub.--786238 Q7WWW1 NP.sub.--943016 Q8YS80
NP.sub.--487251 Q8DW95 NP.sub.--720642 Q82YR2NP.sub.--816992 Q7X3Y1
NP.sub.--857606 Q93S64 NP.sub.--862570 Q8PRN1 NP.sub.--644713
Q8GFY1AAN87626.052205 AAC82516 PEMK_ECOLI NP.sub.--957647
Q7N4H2NP.sub.--929611 Q88PS7 NP.sub.--742932 Q8XCF2 NP.sub.--290857
CHPB_ECOLI D49339 Q82VU0 NP.sub.--841047 Q8UGU5 NP.sub.--531638
Q9RWK4 AAF10240 Q9PHH8 NP.sub.--061683 Q7TXU4 NP.sub.--856470
P71650 NP.sub.--217317 Q7U1Y5 NP.sub.--854128 P96295 CAB03645
Q9JWF2 NP.sub.--283229 Q9JXI1 AAF42359 Q8E882 NP.sub.--720377
Q82VB5 NP.sub.--841237 Q8KJS3 CAA70141 Q7NMY4 NP.sub.--923577
Q9KFF7 NP.sub.--241388 P96622 NP.sub.--388347 Q811T4
NP.sub.--830134 Q81VF4 NP.sub.--842807 Q8ESK5 NP.sub.--691544
Q92DC7 NP.sub.--470228 Q8Y8L0 NP.sub.--464414 Q97LR0
NP.sub.--347134 Q8XNN7 NP.sub.--561211 Q8R861NP.sub.--623721 Q88Z43
NP.sub.--784302 O07123 CAA70141 Q83719 NP.sub.--814592 Q9F7V5
NP.sub.--765227 Q8CRQ1 AAO05271 O05341 NP.sub.--646809 P95840
BAB95857 Q9FCV0 CAC03499 Q837L1 NP.sub.--814568 Q93M89
NP.sub.--150051 Q82UB5 NP.sub.--841618 Q93MT8 NP.sub.--713024
YJ91MYCTU NP.sub.--216507 Q991U9 NP.sub.--856470 Q97MV8
NP.sub.--346728 Q7NHW0 NP.sub.--925371 Q7N195 NP.sub.--925234
Q8YML2 NP.sub.--488961 Q7NHR3 NP.sub.--925418 YE95_MYCTU CAA17218
Q9PCB9 NP.sub.--299148 Q8YZW8 NP.sub.--484381 Q7TZ90
NP.sub.--855627 P95272 NP.sub.--216458 Q8VJR1 NP.sub.--336589Q7U0N2
NP.sub.--854788 O53450 NP.sub.--216458 O06780 NP.sub.--215173
Q7U1I8 NP.sub.--854336.
[0178] The term "ortholog" or homolog as used herein also refers to
binding partners of nucleases (antitoxins or modulators of
nucleases) encoded by nucleic acid sequences whose polypeptide
product has greater than 60% identity to a MazE encoding sequence
and/or whose gene products have similar three dimensional structure
and/or biochemical activities of MazE. Exemplary orthologs/homologs
include, without limitation, MazE, Deinococcus radiodurans (GenBank
Accession No. NP.sub.--294139); MazE, Bacillus halodurans (GenBank
Accession No. NP.sub.--244587); PemI, plasmid R100 (GenBank
Accession No. NP.sub.--052993); PemI, plasmid R466b (GenBank
Accession No. AAC82515); ChpS, Escherichia coli (GenBank Accession
No. NP.sub.--290856); MazE, Pseudomonas putida KT2440 (GenBank
Accession No. NP.sub.--742931); MazE, Photobacterium profundum
(AAG34554). See FIGS. 24 and 25. The terms "ortholog" and "homolog"
may be used to refer to orthologs/homologs of a MazE nucleic or
amino acid sequence of any species. Such species include, but are
not limited to, E. coli, Deinococcus radiodurans, Bacillus
halodurans, Pseudomonas putida, Photobacterium profundum,
Staphylococcus epidermidis, Staphylococcus aureus, Bacillus
subtilis, Neisseria meningitides, Morganella morgani, Mycobacterium
tuberculosis, Mus musculus, and Homo sapiens. The use of nuclease
modulatory molecules (antitoxin) encoded by such homologs/orthologs
in the methods of the invention is contemplated herein.
[0179] The term "ortholog" or homolog as used herein also refers to
binding partners of nucleases (antitoxins or modulators of
nucleases) encoded by nucleic acid sequences whose polypeptide
product has greater than 60% identity to a PemI encoding sequence
and/or whose gene products have similar three dimensional structure
and/or biochemical activities of PemI. Exemplary orthologs/homologs
of PemI include, without limitation, the known members of the MazE
(antitoxin) protein family, which includes MazE (ChpAI), ChpBI and
other MazE homologues. The terms "ortholog" and "homolog" may be
used to refer to orthologs/homologs of a PemI nucleic or amino acid
sequence of any species. The use of nuclease modulatory molecules
encoded by such homologs in the methods of the invention is
contemplated herein. The use of nuclease modulatory molecules
(antitoxin) encoded by such homologs/orthologs in the methods of
the invention is contemplated herein.
[0180] The term "functional" as used herein implies that the
nucleic or amino acid sequence is functional for the recited assay
or purpose.
[0181] The term "functional fragment" as used herein implies that
the nucleic or amino acid sequence is a portion or subdomain of a
full length polypeptide and is functional for the recited assay or
purpose.
[0182] The phrase "consisting essentially of" when referring to a
particular nucleotide or amino acid means a sequence having the
properties of a given SEQ ID No:. For example, when used in
reference to an amino acid sequence, the phrase includes the
sequence per se and molecular modifications that would not affect
the basic and novel characteristics of the sequence.
[0183] A "replicon" is any genetic element, for example, a plasmid,
cosmid, bacmid, phage or virus, that is capable of replication
largely under its own control. A replicon may be either RNA or DNA
and may be single or double stranded.
[0184] A "vector" is a replicon, such as a plasmid, cosmid, bacmid,
phage or virus, to which another genetic sequence or element
(either DNA or RNA) may be attached so as to bring about the
replication of the attached sequence or element.
[0185] An "expression vector" or "expression operon" refers to a
nucleic acid segment that may possess transcriptional and
translational control sequences, such as promoters, enhancers,
translational start signals (e.g., ATG or AUG codons),
polyadenylation signals, terminators, and the like, and which
facilitate the expression of a polypeptide coding sequence in a
host cell or organism.
[0186] As used herein, the term "operably linked" refers to a
regulatory sequence capable of mediating the expression of a coding
sequence and which are placed in a DNA molecule (e.g., an
expression vector) in an appropriate position relative to the
coding sequence so as to effect expression of the coding sequence.
This same definition is sometimes applied to the arrangement of
coding sequences and transcription control elements (e.g.
promoters, enhancers, and termination elements) in an expression
vector. This definition is also sometimes applied to the
arrangement of nucleic acid sequences of a first and a second
nucleic acid molecule wherein a hybrid nucleic acid molecule is
generated.
[0187] The term "oligonucleotide," as used herein refers to primers
and probes of the present invention, and is defined as a nucleic
acid molecule comprised of two or more ribo- or
deoxyribonucleotides, preferably more than three. The exact size of
the oligonucleotide will depend on various factors and on the
particular application and use of the oligonucleotide.
[0188] The term "probe" as used herein refers to an
oligonucleotide, polynucleotide or nucleic acid, either RNA or DNA,
whether occurring naturally as in a purified restriction enzyme
digest or produced synthetically, which is capable of annealing
with or specifically hybridizing to a nucleic acid with sequences
complementary to the probe. A probe may be either single-stranded
or double-stranded. The exact length of the probe will depend upon
many factors, including temperature, source of probe and use of the
method. For example, for diagnostic applications, depending on the
complexity of the target sequence, the oligonucleotide probe
typically contains 15-25 or more nucleotides, although it may
contain fewer nucleotides. The probes herein are selected to be
"substantially" complementary to different strands of a particular
target nucleic acid sequence. This means that the probes must be
sufficiently complementary so as to be able to "specifically
hybridize" or anneal with their respective target strands under a
set of pre-determined conditions. Therefore, the probe sequence
need not reflect the exact complementary sequence of the target.
For example, a non-complementary nucleotide fragment may be
attached to the 5' or 3' end of the probe, with the remainder of
the probe sequence being complementary to the target strand.
Alternatively, non-complementary bases or longer sequences can be
interspersed into the probe, provided that the probe sequence has
sufficient complementarity with the sequence of the target nucleic
acid to anneal therewith specifically.
[0189] The term "specifically hybridize" refers to the association
between two single-stranded nucleic acid molecules of sufficiently
complementary sequence to permit such hybridization under
pre-determined conditions generally used in the art (sometimes
termed "substantially complementary"). In particular, the term
refers to hybridization of an oligonucleotide with a substantially
complementary sequence contained within a single-stranded DNA or
RNA molecule of the invention, to the substantial exclusion of
hybridization of the oligonucleotide with single-stranded nucleic
acids of non-complementary sequence.
[0190] The term "primer" as used herein refers to an
oligonucleotide, either RNA or DNA, either single-stranded or
double-stranded, either derived from a biological system, generated
by restriction enzyme digestion, or produced synthetically which,
when placed in the proper environment, is able to functionally act
as an initiator of template-dependent nucleic acid synthesis. When
presented with an appropriate nucleic acid template, suitable
nucleoside triphosphate precursors of nucleic acids, a polymerase
enzyme, suitable cofactors and conditions such as a suitable
temperature and pH, the primer may be extended at its 3' terminus
by the addition of nucleotides by the action of a polymerase or
similar activity to yield an primer extension product. The primer
may vary in length depending on the particular conditions and
requirement of the application. For example, in diagnostic
applications, the oligonucleotide primer is typically 15-25 or more
nucleotides in length. The primer must be of sufficient
complementarity to the desired template to prime the synthesis of
the desired extension product, that is, to be able anneal with the
desired template strand in a manner sufficient to provide the 3'
hydroxyl moiety of the primer in appropriate juxtaposition for use
in the initiation of synthesis by a polymerase or similar enzyme.
It is not required that the primer sequence represent an exact
complement of the desired template. For example, a
non-complementary nucleotide sequence may be attached to the 5' end
of an otherwise complementary primer. Alternatively,
non-complementary bases may be interspersed within the
oligonucleotide primer sequence, provided that the primer sequence
has sufficient complementarity with the sequence of the desired
template strand to functionally provide a template-primer complex
for the synthesis of the extension product.
[0191] Primers may be labeled fluorescently with
6-carboxyfluorescein (6-FAM). Alternatively primers may be labeled
with 4,7,2',7'-Tetrachloro-6-carboxyfluorescein (TET). Other
alternative DNA labeling methods are known in the art and are
contemplated to be within the scope of the invention.
[0192] The term "isolated protein" or "isolated and purified
protein" is sometimes used herein. This term refers primarily to a
protein produced by expression of an isolated nucleic acid molecule
of the invention. Alternatively, this term may refer to a protein
that has been sufficiently separated from other proteins with which
it would naturally be associated, so as to exist in "substantially
pure" form. "Isolated" is not meant to exclude artificial or
synthetic mixtures with other compounds or materials, or the
presence of impurities that do not interfere with the fundamental
activity, and that may be present, for example, due to incomplete
purification, addition of stabilizers, or compounding into, for
example, immunogenic preparations or pharmaceutically acceptable
preparations.
[0193] The term "substantially pure" refers to a preparation
comprising at least 50-60% by weight of a given material (e.g.,
nucleic acid, oligonucleotide, protein, etc.). More preferably, the
preparation comprises at least 75% by weight, and most preferably
90-95% by weight of the given compound. Purity is measured by
methods appropriate for the given compound (e.g. chromatographic
methods, agarose or polyacrylamide gel electrophoresis, HPLC
analysis, and the like). "Mature protein" or "mature polypeptide"
shall mean a polypeptide possessing the sequence of the polypeptide
after any processing events that normally occur to the polypeptide
during the course of its genesis, such as proteolytic processing
from a polypeptide precursor. In designating the sequence or
boundaries of a mature protein, the first amino acid of the mature
protein sequence is designated as amino acid residue 1.
[0194] The term "tag", "tag sequence" or "protein tag" refers to a
chemical moiety, either a nucleotide, oligonucleotide,
polynucleotide or an amino acid, peptide or protein or other
chemical, that when added to another sequence, provides additional
utility or confers useful, properties to the sequence, particularly
with regard to methods relating to the detection or isolation of
the sequence. Thus, for example, a homopolymer nucleic acid
sequence or a nucleic acid sequence complementary to a capture
oligonucleotide may be added to a primer or probe sequence to
facilitate the subsequent isolation of an extension product or
hybridized product. In the case of protein tags, histidine residues
(e.g., 4 to 8 consecutive histidine residues) may be added to
either the amino- or carboxy-terminus of a protein to facilitate
protein isolation by chelating metal chromatography. Alternatively,
amino acid sequences, peptides, proteins or fusion partners
representing epitopes or binding determinants reactive with
specific antibody molecules or other molecules (e.g., flag epitope,
c-myc epitope, transmembrane epitope of the influenza A virus
hemaglutinin protein, protein A, cellulose binding domain,
calmodulin binding protein, maltose binding protein, chitin binding
domain, glutathione S-transferase, and the like) may be added to
proteins to facilitate protein isolation by procedures such as
affinity or immunoaffinity chromatography. Chemical tag moieties
include such molecules as biotin, which may be added to either
nucleic acids or proteins and facilitates isolation or detection by
interaction with avidin reagents, and the like. Numerous other tag
moieties are known to, and can be envisioned by, the trained
artisan, and are contemplated to be within the scope of this
definition.
[0195] The terms "transform", "transfect", "transduce", shall refer
to any method or means by which a nucleic acid is introduced into a
cell or host organism and may be used interchangeably to convey the
same meaning. Such methods include, but are not limited to,
transfection, electroporation, microinjection, PEG-fusion and the
like.
[0196] The introduced nucleic acid may or may not be integrated
(covalently linked) into nucleic acid of the recipient cell or
organism. In bacterial, yeast, plant and mammalian cells, for
example, the introduced nucleic acid may be maintained as an
episomal element or independent replicon such as a plasmid.
Alternatively, the introduced nucleic acid may become integrated
into the nucleic acid of the recipient cell or organism and be
stably maintained in that cell or organism and further passed on or
inherited to progeny cells or organisms of the recipient cell or
organism. In other applications, the introduced nucleic acid may
exist in the recipient cell or host organism only transiently.
[0197] A "clone" or "clonal cell population" is a population of
cells derived from a single cell or common ancestor by mitosis.
[0198] A "cell line" is a clone of a primary cell or cell
population that is capable of stable growth in vitro for many
generations.
[0199] The compositions containing the molecules or compounds of
the invention can be administered for prophylactic and/or
therapeutic treatments. In one therapeutic application, for
example, compositions are administered to a patient already
suffering from a hyperproliferative disorder (such as, e.g.,
cancer) in an amount sufficient to cure or at least partially
arrest the symptoms of the disease and its complications. An amount
adequate to accomplish this is defined as a "therapeutically
effective amount or dose." Amounts effective for this use will
depend on the severity of the disease and the weight and general
state of the patient.
[0200] As used herein, the term "cancer" refers to an abnormal
growth of tissue resulting from uncontrolled progressive
multiplication of cells. Examples of cancers that can be treated
according to a method of the present invention include, without
limitation, sarcomas, blastomas, and carcinomas such as:
fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic
sarcoma, chordoma, angiosarcoma, endotheliosarcoma,
lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma,
mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma,
colon carcinoma, colorectal cancer, gastic cancer, pancreatic
cancer, breast cancer, meningeal carcinomatosis (which is most
commonly associated with disseminated breast or lung cancer),
ovarian cancer, prostate cancer, squamous cell carcinoma, basal
cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous
gland carcinoma, papillary carcinoma, papillary adenocarcinomas,
cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma,
renal cell carcinoma, hepatoma, liver metastases, bile duct
carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, thyroid
carcinoma such as anaplastic thyroid cancer, Wilms' tumor, cervical
cancer, testicular cancer, lung carcinoma such as small cell lung
carcinoma and non-small cell lung carcinoma, bladder carcinoma,
epithelial carcinoma, glioma, astrocytoma, medulloblastoma,
craniopharyngioma, ependymoma, pinealoma, hemangioblastoma,
acoustic neuroma, oligodendroglioma, meningioma, melanoma,
neuroblastoma, and retinoblastoma.
[0201] Examples of hematologic malignancies that can be treated
according to a method of the present invention include: acute
myeloid leukemia (AML), chronic myeloid leukemia (CML), acute
lymphocytic leukemia (ALL), chronic lymphocytic leukemia (CLL),
multiple myeloma, non-Hodgkin's lymphoma (NHL), Hodgkin's disease
and lymphoma (HD), prolymphocytic leukemia (PLL), and
myelodysplastic syndrome (MDS).
[0202] An "immune response" signifies any reaction produced by an
antigen, such as a protein antigen, in a host having a functioning
immune system. Immune responses may be either humoral, involving
production of immunoglobulins or antibodies, or cellular, involving
various types of B and T lymphocytes, dendritic cells, macrophages,
antigen presenting cells and the like, or both. Immune responses
may also involve the production or elaboration of various effector
molecules such as cytokines, lymphokines and the like. Immune
responses may be measured both in in vitro and in various cellular
or animal systems.
[0203] An "antibody" or "antibody molecule" is any immunoglobulin,
including antibodies and fragments thereof, that binds to a
specific antigen. The term includes polyclonal, monoclonal,
chimeric, and bispecific antibodies. As used herein, antibody or
antibody molecule contemplates both an intact immunoglobulin
molecule and an immunologically active portion of an immunoglobulin
molecule such as those portions known in the art as Fab, Fab',
F(ab')2 and F(v).
[0204] The term "cellular substrate" refers to a molecule in a cell
which is an enzymatic target of an enzyme or family of related
enzymes. With regard to mRNA interferases, "cellular substrates"
include polyribonucleotides in a cell, which are expressed from
endogenous or exogenous nucleic acid sequences.
[0205] As used herein, the phrase "under conditions that promote
endoribonuclease activity" includes any condition in a cell (in
cell culture or in vivo) or in vitro (in a test tube or other
similar vessel) wherein an mRNA interferase of the invention
exhibits endoribonuclease activity. Such conditions are described
in the Examples presented herein. Similarly, an "mRNA interferase
compatible buffer" is a buffer wherein an mRNA interferase of the
invention exhibits endoribonuclease activity.
[0206] The term "mRNA interferase modulatory agent" as used herein
refers to an agent that is capable of modulating (e.g., increasing
or decreasing) the endoribonuclease activity of an mRNA
interferase. Methods for screening/identifying such agents are
presented herein below. Exemplary endogenous mRNA interferase
modulatory agents include MazE (which inhibits MazF activity) and
PemI (which inhibits PemK activity). Functional fragments of MazE
and PemI, which are capable of inhibiting MazF and PemK activity,
respectively, are also described herein.
[0207] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
any methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the present
invention, the preferred methods and materials are now described.
All publications mentioned herein are incorporated herein by
reference to disclose and described the methods and/or materials in
connection with which the publications are cited.
[0208] I. Preparation of mRNA Interferase-Encoding Nucleic Acid
Molecules and mRNA Interferases
[0209] Nucleic Acid Molecules
[0210] Nucleic acid molecules encoding an endoribonuclease of the
invention (e.g., MazF or PemK) may be prepared by two general
methods: (1) Synthesis from appropriate nucleotide triphosphates;
or (2) Isolation from biological sources. Both methods utilize
protocols well known in the art.
[0211] The availability of nucleotide sequence information, such as
a full length cDNA of SEQ ID NOs: 1 or 3 (See FIGS. 20A and 31A),
enables preparation of an isolated nucleic acid molecule of the
invention by oligonucleotide synthesis. Synthetic oligonucleotides
may be prepared by the phosphoramidite method employed in the
Applied Biosystems 380A DNA Synthesizer or similar devices. The
resultant construct may be purified according to methods known in
the art, such as high performance liquid chromatography (HPLC).
Long, double-stranded polynucleotides, such as a DNA molecule of
the present invention, must be synthesized in stages, due to the
size limitations inherent in current oligonucleotide synthetic
methods. Synthetic DNA molecule constructed by such means may then
be cloned and amplified in an appropriate vector. Nucleic acid
sequences encoding an mRNA interferase may be isolated from
appropriate biological sources using methods known in the art. In a
preferred embodiment, a cDNA clone is isolated from a cDNA
expression library of bacterial origin. In an alternative
embodiment, utilizing the sequence information provided by the cDNA
sequence, genomic clones encoding an mRNA interferase may be
isolated. Alternatively, cDNA or genomic clones having homology to
an mRNA interferase may be isolated from other species, using
oligonucleotide probes corresponding to predetermined sequences
within the mRNA interferase gene.
[0212] In accordance with the present invention, nucleic acids
having the appropriate level of sequence homology with the protein
coding region of either SEQ ID NOs: 1 or 3 may be identified by
using hybridization and washing conditions of appropriate
stringency. For example, hybridizations may be performed using a
hybridization solution comprising: 5.times.SSC, 5.times.Denhardt's
reagent, 0.5-1.0% SDS, 100 micrograms/ml denatured, fragmented
salmon sperm DNA, 0.05% sodium pyrophosphate and up to 50%
formamide. Hybridization is generally performed at 37-42.degree. C.
for at least six hours. Following hybridization, filters are washed
as follows: (1) 5 minutes at room temperature in 2.times.SSC and
0.5-1% SDS; (2) 15 minutes at room temperature in 2.times.SSC and
0.1% SDS; (3) 30 minutes-1 hour at 37.degree. C. in 1.times.SSC and
1% SDS; (4) 2 hours at 42-65.degree. C. in 1.times.SSC and 1% SDS,
changing the solution every 30 minutes.
[0213] One common formula for calculating the stringency conditions
required to achieve hybridization between nucleic acid molecules of
a specified sequence homology is (Sambrook et al., 1989):
T.sub.m=81.5.degree. C. 16.6 Log [Na+]+0.41(% G+C)-0.63 (%
formamide)-600/#bp in duplex
[0214] As an illustration of the above formula, using [Na+]=[0.368]
and 50% formamide, with GC content of 42% and an average probe size
of 200 bases, the T.sub.m is 57.degree. C. The T.sub.m of a DNA
duplex decreases by 1-1.5.degree. C. with every 1% decrease in
homology. Thus, targets with greater than about 75% sequence
identity would be observed using a hybridization temperature of
42.degree. C. Such a sequence would be considered substantially
homologous to the nucleic acid sequence of the present
invention.
[0215] As can be seen from the above, the stringency of the
hybridization and wash depend primarily on the salt concentration
and temperature of the solutions. In general, to maximize the rate
of annealing of the two nucleic acid molecules, the hybridization
is usually carried out at 20-25.degree. C. below the calculated
T.sub.m of the hybrid. Wash conditions should be as stringent as
possible for the degree of identity of the probe for the target. In
general, wash conditions are selected to be approximately
12-20.degree. C. below the T.sub.m of the hybrid. In regards to the
nucleic acids of the current invention, a moderate stringency
hybridization is defined as hybridization in 6.times.SSC,
5.times.Denhardt's solution, 0.5% SDS and 100 micrograms/ml
denatured salmon sperm DNA at 42.degree. C. and wash in 2.times.SSC
and 0.5% SDS at 55.degree. C. for 15 minutes. A high stringency
hybridization is defined as hybridization in 6.times.SSC,
5.times.Denhardt's solution, 0.5% SDS and 100 micrograms/ml
denatured salmon sperm DNA at 42.degree. C. and wash in 1.times.SSC
and 0.5% SDS at 65.degree. C. for 15 minutes. A very high
stringency hybridization is defined as hybridization in
6.times.SSC, 5.times.Denhardt's solution, 0.5% SDS and 100
micrograms/ml denatured salmon sperm DNA at 42.degree. C. and wash
in 0.1.times.SSC and 0.5% SDS at 65.degree. C. for 15 minutes.
[0216] Nucleic acids of the present invention may be maintained as
DNA in any convenient cloning vector. In a preferred embodiment,
clones are maintained in a plasmid cloning/expression vector, such
as pBluescript (Stratagene, La Jolla, Calif.), which is propagated
in a suitable E. coli host cell. Genomic clones of the invention
encoding an mRNA interferase gene may be maintained in lambda phage
FIX II (Stratagene).
[0217] mRNA interferase-encoding nucleic acid molecules of the
invention include cDNA, genomic DNA, RNA, and fragments thereof
which may be single- or double-stranded. Thus, this invention
provides oligonucleotides (sense or antisense strands of DNA or
RNA) having sequences capable of hybridizing with at least one
sequence of a nucleic acid molecule of the present invention, such
as selected segments of a cDNA of either SEQ ID NO: 1 or 3. Such
oligonucleotides are useful as probes for detecting or isolating
mRNA interferase genes.
[0218] It will be appreciated by persons skilled in the art that
variants (e.g., allelic variants) of these sequences exist in
bacterial populations and/or species, and must be taken into
account when designing and/or utilizing oligonucleotides of the
invention. Accordingly, it is within the scope of the present
invention to encompass such variants, with respect to the mRNA
interferase sequences disclosed herein or the oligonucleotides
targeted to specific locations on the respective genes or RNA
transcripts. With respect to the inclusion of such variants, the
term "natural allelic variants" is used herein to refer to various
specific nucleotide sequences and variants thereof that would occur
in a given DNA population. Genetic polymorphisms giving rise to
conservative or neutral amino acid substitutions in the encoded
protein are examples of such variants. Additionally, the term
"substantially complementary" refers to oligonucleotide sequences
that may not be perfectly matched to a target sequence, but the
mismatches do not materially affect the ability of the
oligonucleotide to hybridize with its target sequence under the
conditions described.
[0219] Thus, the coding sequence may be that shown in, for example,
SEQ ID NO: 1 or 3, or it may be a mutant, variant, derivative or
allele of either of these sequences. The sequence may differ from
that shown by a change which is one or more of addition, insertion,
deletion and substitution of one or more nucleotides of the
sequence shown. Changes to a nucleotide sequence may result in an
amino acid change at the protein level, or not, as determined by
the genetic code.
[0220] Thus, nucleic acid according to the present invention may
include a sequence different from the sequence shown in SEQ ID NO:
1 or 3, but which encodes a polypeptide with the same amino acid
sequence.
[0221] On the other hand, the encoded polypeptide may comprise an
amino acid sequence which differs by one or more amino acid
residues from the amino acid sequence shown in either SEQ ID NO: 2
or 4. See FIGS. 20B and 31B. Nucleic acid encoding a polypeptide
which is an amino acid sequence mutant, variant, derivative or
allele of the sequence shown in SEQ ID NO: 2 or 4 is further
provided by the present invention. Nucleic acid encoding such a
polypeptide may show greater than 60% identity with the coding
sequence shown in SEQ ID NO: 1 or 3, greater than about 70%
identity, greater than about 80% identity, greater than about 90%
identity or greater than about 95% identity.
[0222] The present invention provides a method of obtaining a
nucleic acid of interest, the method including hybridization of a
probe having part or all of the sequence shown in either SEQ ID NO:
1 or 3, or a complementary sequence thereto, to target nucleic
acid. Successful hybridization leads to isolation of nucleic acid
which has hybridized to the probe, which may involve one or more
steps of polymerase chain reaction (PCR) amplification.
[0223] Such oligonucleotide probes or primers, as well as the
full-length sequence (and mutants, alleles, variants, and
derivatives) are useful in screening a test sample containing
nucleic acid for the presence of alleles, mutants or variants of an
mRNA interferase, the probes hybridizing with a target sequence
from a sample obtained from a cell, tissue, or organism being
tested. The conditions of the hybridization can be controlled to
minimize non-specific binding. Preferably stringent to moderately
stringent hybridization conditions are used. The skilled person is
readily able to design such probes, label them and devise suitable
conditions for hybridization reactions, assisted by textbooks such
as Sambrook et al (1989) and Ausubel et al (1992).
[0224] In some preferred embodiments, oligonucleotides according to
the present invention that are fragments of the sequences shown in
either SEQ ID NO: 1 or 3, or any allele associated with
endoribonuclease activity, are at least about 10 nucleotides in
length, more preferably at least 15 nucleotides in length, more
preferably at least about 20 nucleotides in length. Such fragments
themselves individually represent aspects of the present invention.
Fragments and other oligonucleotides may be used as primers or
probes as discussed but may also be generated (e.g. by PCR) in
methods concerned with determining the presence in a test sample of
a sequence encoding a homolog or ortholog of an mRNA
interferase.
[0225] B. Proteins
[0226] MazF is the first nuclease identified which cleaves RNA with
high specificity at a specific nucleic acid sequence (i.e., ACA).
PemK is the first nuclease identified which cleaves RNA with high
specificity at a specific nucleic acid sequence (i.e., UAX, wherein
X is C, A, or U). A full-length mRNA interferase protein of the
present invention (e.g., MazF or PemK) may be prepared in a variety
of ways, according to known methods. The protein may be purified
from appropriate sources. This is not, however, a preferred method
due to the low amount of protein likely to be present in a given
cell type at any time. The availability of nucleic acid molecules
encoding MazF and PemK enables production of either of these
proteins using in vitro expression methods known in the art. For
example, a cDNA or gene may be cloned into an appropriate in vitro
transcription vector, such as pSP64 or pSP65 for in vitro
transcription, followed by cell-free translation in a suitable
cell-free translation system, such as wheat germ or rabbit
reticulocyte lysates. In vitro transcription and translation
systems are commercially available, e.g., from Promega Biotech,
Madison, Wis. or BRL, Rockville, Md.
[0227] Alternatively, according to a preferred embodiment, larger
quantities of an mRNA interferase may be produced by expression in
a suitable prokaryotic or eukaryotic system. For example, part or
all of a DNA molecule, such as a cDNA of SEQ ID NO: 1 or 3, may be
inserted into a plasmid vector adapted for expression in a
bacterial cell, such as E. coli. Such vectors comprise regulatory
elements necessary for expression of the DNA in a host cell (e.g.
E. coli) positioned in such a manner as to permit expression of the
DNA in the host cell. Such regulatory elements required for
expression include promoter sequences, transcription initiation
sequences and, optionally, enhancer sequences.
[0228] An mRNA interferase produced by gene expression in a
recombinant prokaryotic or eukaryotic system may be purified
according to methods known in the art. In a preferred embodiment, a
commercially available expression/secretion system can be used,
whereby the recombinant protein is expressed and thereafter
secreted from the host cell, to be easily purified from the
surrounding medium. If expression/secretion vectors are not used,
an alternative approach involves purifying the recombinant protein
by affinity separation, such as by immunological interaction with
antibodies that bind specifically to the recombinant protein or
nickel columns for isolation of recombinant proteins tagged with
6-8 histidine residues at their N-terminus or C-terminus.
Alternative tags may comprise the FLAG epitope or the hemagglutinin
epitope. Such methods are commonly used by skilled
practitioners.
[0229] mRNA interferases of the invention, prepared by the
aforementioned methods, may be analyzed according to standard
procedures. For example, such proteins may be subjected to amino
acid sequence analysis, according to known methods.
[0230] Polypeptides which are amino acid sequence variants,
alleles, derivatives or mutants are also provided by the present
invention. A polypeptide which is a variant, allele, derivative, or
mutant may have an amino acid sequence that differs from that given
in SEQ ID NO: 2 by one or more of addition, substitution, deletion
and insertion of one or more amino acids. Preferred such
polypeptides have MazF function, that is to say have one or more of
the following properties: ability to cleave ACA sequences in RNA;
immunological cross-reactivity with an antibody reactive with the
polypeptide for which the sequence is given in SEQ ID NO: 2;
sharing an epitope with the polypeptide for which the sequence is
given in SEQ ID NO: 2 (as determined for example by immunological
cross-reactivity between the two polypeptides.
[0231] Alternatively, a polypeptide which is a variant, allele,
derivative, or mutant may have an amino acid sequence that differs
from that given in SEQ ID NO: 4 by one or more of addition,
substitution, deletion and insertion of one or more amino acids.
Preferred such polypeptides have PemK function, that is to say have
one or more of the following properties: ability to cleave UAX
sequences (wherein X is C, A, or U) in RNA; immunological
cross-reactivity with an antibody reactive with the polypeptide for
which the sequence is given in SEQ ID NO: 4; sharing an epitope
with the polypeptide for which the sequence is given in SEQ ID NO:
4 (as determined for example by immunological cross-reactivity
between the two polypeptides.
[0232] A polypeptide which is an amino acid sequence variant,
allele, derivative or mutant of the amino acid sequence shown in
SEQ ID NO: 2 or 4 may comprise an amino acid sequence which shares
greater than about 35% sequence identity with the sequence shown,
greater than about 40%, greater than about 50%, greater than about
60%, greater than about 70%, greater than about 80%, greater than
about 90% or greater than about 95%. Particular amino acid sequence
variants may differ from that shown in SEQ ID NO: 2 or 4 by
insertion, addition, substitution or deletion of 1 amino acid, 2,
3, 4, 5-10, 10-20, 20-30, 30-40, 40-50, 50-100, 100-150, or more
than 150 amino acids. For amino acid "homology", this may be
understood to be identity or similarity (according to the
established principles of amino acid similarity, e.g., as
determined using the algorithm GAP (Genetics Computer Group,
Madison, Wis.). GAP uses the Needleman and Wunsch algorithm to
align two complete sequences that maximizes the number of matches
and minimizes the number of gaps. Generally, the default parameters
are used, with a gap creation penalty-12 and gap extension
penalty=4. Use of GAP may be preferred but other algorithms may be
used including without limitation, BLAST (Altschul et al. (1990 J.
Mol. Biol. 215:405-410); FASTA (Pearson and Lipman (1998) PNAS USA
85:2444-2448) or the Smith Waterman algorithm (Smith and Waterman
(1981) J. Mol. Biol. 147:195-197) generally employing default
parameters. Use of either of the terms "homology" and "homologous"
herein does not imply any necessary evolutionary relationship
between the compared sequences. The terms are used similarly to the
phrase "homologous recombination", i.e., the terms merely require
that the two nucleotide sequences are sufficiently similar to
recombine under appropriate conditions.
[0233] A polypeptide according to the present invention may be used
in screening for molecules which affect or modulate its activity or
function. Such molecules may be useful for research purposes.
[0234] The present invention also provides antibodies capable of
immunospecifically binding to proteins of the invention. Polyclonal
antibodies directed toward an mRNA interferase (e.g., MazF or PemK)
may be prepared according to standard methods. In a preferred
embodiment, monoclonal antibodies are prepared, which react
immunospecifically with various epitopes of an mRNA interferase.
Monoclonal antibodies may be prepared according to general methods
of Kohler and Milstein, following standard protocols. Polyclonal or
monoclonal antibodies that immunospecifically interact with an mRNA
interferase can be utilized for identifying and purifying such
proteins. For example, antibodies may be utilized for affinity
separation of proteins with which they immunospecifically interact.
Antibodies may also be used to immunoprecipitate proteins from a
sample containing a mixture of proteins and other biological
molecules. Other uses of anti-mRNA interferase antibodies are
described below.
[0235] Antibodies according to the present invention may be
modified in a number of ways. Indeed the term "antibody" should be
construed as covering any binding substance having a binding domain
with the required specificity. Thus, the invention covers antibody
fragments, derivatives, functional equivalents and homologues of
antibodies, including synthetic molecules and molecules whose shape
mimics that of an antibody enabling it to bind an antigen or
epitope.
[0236] Exemplary antibody fragments, capable of binding an antigen
or other binding partner, are Fab fragment consisting of the VL,
VII, Cl and CH1 domains; the Fd fragment consisting of the VII and
CH1 domains; the Fv fragment consisting of the VL and VII domains
of a single arm of an antibody; the dAb fragment which consists of
a VII domain; isolated CDR regions and F(ab')2 fragments, a
bivalent fragment including two Fab fragments linked by a
disulphide bridge at the hinge region. Single chain Fv fragments
are also included.
[0237] II. Uses of mRNA Interferase-Encoding Nucleic Acids, mRNA
Interferases and Antibodies Thereto
[0238] MazF and PemK, for example, are RNA endonucleases which may
be used to advantage to reduce or inhibit protein synthesis in a
cell, tissue, or organism. Moreover, an mRNA interferase of the
invention may be specifically targeted to a particular tissue or
tissues in a subject so as to specifically reduce or inhibit
protein synthesis in the targeted tissue(s). For some applications,
it is advantageous to target specific RNA transcripts for
endonucleolytic cleavage by MazF. Such sequences may comprise an
elevated frequency of ACA sequences and, therefore, are native
preferred targets for MazF activity. Alternatively, RNA transcripts
may be targeted for MazF cleavage by altering a MazF polypeptide to
specifically or preferentially bind and/or cleave the transcript(s)
targeted for cleavage. Alternatively, it may be advantageous to
target specific RNA transcripts for endonucleolytic cleavage by
PemK. Such sequences may comprise an elevated frequency of UAX
sequences (wherein X is a C, A, U) and, therefore, are native
preferred targets for PemK activity. Alternatively, RNA transcripts
may be targeted for PemK cleavage by altering a PemK polypeptide to
specifically or preferentially bind and/or cleave the transcript(s)
targeted for cleavage.
[0239] Specifically, mRNA interferase molecules (such as MazF and
PemK) and compositions of the invention may be used to advantage to
treat a patient with a hyperproliferative disorder. Such disorders
include, without limitation, dysplasias and metaplasias of
different tissues, inflammatory conditions, autoimmune diseases,
hyperproliferative skin disorders, psoriasis, allergy/asthma,
atherosclerosis, restenosis after angioplastic surgery, and cancer.
mRNA interferase molecules (such as MazF and PemK) and compositions
of the invention may also be used to advantage to treat a patient
with a bacterial infection.
[0240] Additionally, mRNA interferase nucleic acids, proteins and
antibodies thereto, according to this invention, may be used as a
research tool to identify other proteins that are intimately
involved in RNA recognition and cleavage reactions.
[0241] A. mRNA Interferase-Encoding Nucleic Acids
[0242] MazF- and PemK-encoding nucleic acids may be used for a
variety of purposes in accordance with the present invention. MazF-
and PemK-encoding DNA, RNA, or fragments thereof may be used as
probes to detect the presence of and/or expression of genes
encoding MazF-like and PemK-like proteins. Methods in which MazF-
and PemK-encoding nucleic acids may be utilized as probes for such
assays include, but are not limited to: (1) in situ hybridization;
(2) Southern hybridization (3) northern hybridization; and (4)
assorted amplification reactions such as PCR.
[0243] mRNA interferase-encoding nucleic acids of the invention may
also be utilized as probes to identify related genes from other
bacterial, plant, or animal species. As is well known in the art,
hybridization stringencies may be adjusted to allow hybridization
Of nucleic acid probes with complementary sequences of varying
degrees of homology. Thus, MazF- and PemK-encoding nucleic acids
may be used to advantage to identify and characterize other genes
of varying degrees of relation to MazF and/or PemK, thereby
enabling further characterization of RNA degradative systems.
Additionally, they may be used to identify genes encoding proteins
that interact with MazF and/or PemK (e.g., by the "interaction
trap" technique), which should further accelerate identification of
the components involved in RNA cleavage.
[0244] Nucleic acid molecules, or fragments thereof, encoding MazF
or PemK may also be utilized to control the production of MazF or
PemK, thereby regulating the amount of protein available to
participate in RNA cleavage reactions. Alterations in the
physiological amount of MazF or PemK protein may dramatically
affect the activity of other protein factors involved in RNA
cleavage.
[0245] B. mRNA Interferases and Antibodies Thereto
[0246] Purified mRNA interferases, such as isolated MazF or PemK
proteins, or fragments thereof, produced via expression of MazF or
PemK encoding nucleic acids of the present invention may be used to
produce polyclonal or monoclonal antibodies which also may serve as
sensitive detection reagents for the presence and accumulation of
MazF (or complexes containing MazF) or PemK (or complexes
containing PemK) in bacterial cells. Recombinant techniques enable
expression of fusion proteins containing part or all of the MazF or
PemK protein. The full length protein or fragments of the protein
may be used to advantage to generate an array of monoclonal
antibodies specific for various epitopes of the protein, thereby
providing even greater sensitivity for detection of the protein in
cells.
[0247] Polyclonal or monoclonal antibodies immunologically specific
for an mRNA interferase (e.g., MazF or PemK) may be used in a
variety of assays designed to detect and quantitate the protein.
Such assays include, but are not limited to: (1) flow cytometric
analysis; (2) immunochemical localization of an mRNA interferase
in, for example, bacterial cells; and (3) immunoblot analysis
(e.g., dot blot, Western blot) of extracts from various cells.
Additionally, as described above, anti-MazF and anti-PemK
antibodies, for example, can be used for purification of MazF and
orthologs thereof or PemK and orthologs thereof (e.g., affinity
column purification, immunoprecipitation).
[0248] mRNA interferases, such as MazF or PemK protein, may also be
used to advantage to reduce or inhibit protein synthesis in a cell,
tissue, or organism, as discussed above.
[0249] From the foregoing discussion, it can be seen that mRNA
interferase-encoding nucleic acids, mRNA interferase expressing
vectors, and anti-mRNA interferase antibodies of the invention can
be used to produce large quantities of mRNA interferase protein,
detect mRNA interferase gene expression and alter mRNA interferase
accumulation for purposes of assessing the genetic and protein
interactions involved in the RNA cleavage.
[0250] The present inventors have made the surprising discovery
that stable toxin MazF derived from bacteria is an
endoribonuclease. As described herein, MazF has been designated the
first member of a novel family of enzymes referred to as "RNA
Interferases". Moreover, it is proposed that MazF exemplifies this
new family of "RNA Interferases". Of note, prior to the discovery
of the present invention, the cellular target(s) of MazF had not
been identified. As shown herein, MazF functions as a highly
sequence-specific endoribonuclease, which cleaves cellular mRNAs at
ACA sites. Such activity may effectuate a partial or total
inhibition of protein synthesis in a cell. The predicted frequency
of an ACA sequence in an RNA transcript is one in 64, based on
standard calculations predicated on an equal probability that any
one of the four nucleotides will be incorporated at each one of the
three nucleotide positions. It is to be understood that some RNA
transcripts comprise a lower or higher frequency of ACA sequences
as compared to the predicted frequency. Accordingly, the
sensitivity of a specific RNA transcript or a family of related RNA
transcripts to cleavage by a MazF endoribonuclease is dependent
upon the frequency of ACA sequences or MazF target sequences in the
transcript. Moreover, one of ordinary skill in the art could
predict, based on the sequence of an RNA transcript, the
sensitivity of the transcript to MazF mediated cleavage.
[0251] The present inventors have also discovered that PemK is a
member of the novel family of enzymes designated herein as "RNA
Interferases". As shown herein, PemK functions as a highly
sequence-specific endoribonuclease, which cleaves cellular mRNAs at
UAX sites, wherein X is a C, A, or U. Such activity may effectuate
a partial or total inhibition of protein synthesis in a cell. The
predicted frequency of a UAX site, wherein X is a C, A, or U
sequence in an RNA transcript is three in 64, based on standard
calculations predicated on an equal probability that any one of the
four nucleotides will be incorporated at each one of the three
nucleotide positions. It is to be understood that some RNA
transcripts comprise a lower or higher frequency of UAX sequences
as compared to the predicted frequency. Accordingly, the
sensitivity of a specific RNA transcript or a family of related RNA
transcripts to cleavage by a PemK endoribonuclease is dependent
upon the frequency of UAX sequences (wherein X is a C, A, or U) or
PemK target sequences in the transcript. Moreover, one of ordinary
skill in the art could predict, based on the sequence of an RNA
transcript, the sensitivity of the transcript to PemK mediated
cleavage.
[0252] The novel findings of the present inventors, therefore,
present new applications for which mRNA interferase (e.g., MazF and
PemK) nucleic and amino acid sequences and compositions thereof may
be used to advantage. Such utilities include, but are not limited
to, various research and therapeutic applications as described
herein. Also provided is a kit comprising MazF and PemK nucleic
and/or amino acid sequences, MazF and/or PemK-activity compatible
buffers, and instruction materials.
[0253] III. Preparation of mRNA Interferase Inhibitor-Encoding
Nucleic Acid Molecules and mRNA Interferase Inhibitor Proteins
[0254] MazE- and PemI-encoding nucleic acid molecules and MazE and
PemI polypeptides, and functional fragments thereof, are generated
essentially as described above for MazF- and PemK-encoding nucleic
acid sequences and MazF and PemK polypeptides. In accordance with
the present invention, a nucleic acid sequence encoding MazE
protein and comprising SEQ ID NO: 5 is provided. See FIG. 21A. Also
provided is an amino acid sequence comprising SEQ ID NO: 6 and
functional fragments thereof. See FIG. 21B. Accordingly, a nucleic
acid sequence encoding PemI protein and comprising SEQ ID NO: 7 is
provided. See FIG. 32A. Also provided is an amino acid sequence
comprising SEQ ID NO: 8 and functional fragments thereof. See FIG.
32B.
[0255] IV. Uses of mRNA Interferase Inhibitor-Encoding Nucleic
Acids and mRNA Interferase Inhibitor Proteins
[0256] MazE polypeptides encoded by SEQ ID NO: 5, nucleic acid
sequences encoding MazE polypeptides comprising SEQ ID NO: 6 and
functional fragments thereof, and MazE polypeptides comprising SEQ
ID NO: 6 and functional fragments thereof are encompassed by the
invention. As described herein, MazE polypeptides and functional
fragments thereof exhibit the ability to modulate MazF activity.
See Example III and summary below.
[0257] Briefly, and as demonstrated herein, the binding of purified
(His).sub.6MazE to mazEF promoter DNA was enhanced by MazF.
Site-directed mutations at conserved amino acid residues (K7A, R8A,
S12A and R16A) in the N-terminal region of MazE disrupted the
DNA-binding ability of both (His).sub.6MazE and the
MazE-MazF(His).sub.6 complex, suggesting that MazE binds to mazEF
promoter DNA through the N-terminal domain. In solution, the ratio
of MazE to MazF(His).sub.6 in the MazE-MazF(His).sub.6 complex is
about 1:2. Since both MazE and MazF(His).sub.6 exist as homodimers,
the MazE-MazF(His).sub.6 complex (76.9 kDa) is predicted to consist
of one MazE dimer and two MazF(His).sub.6 dimers. The interaction
between MazE and MazF was also characterized using the yeast
two-hybrid system. It was found that the region from residue 38 to
75 of MazE was required for binding to MazF. Site-directed
mutagenesis at this region revealed that Leu55 and Leu58 play an
important role in MazE-MazF complex formation but not in
MazE-binding to the mazEF promoter DNA. The present results
demonstrate that MazE is composed of two domains, an N-terminal
DNA-binding domain and a C-terminal MazF interacting domain.
[0258] Thus, in one embodiment, MazE polypeptides and MazE
functional fragments of the invention inhibit MazF activity. In a
particular aspect, MazE polypeptides or MazE functional fragments
of the invention inhibit MazF endoribonuclease activity or
effectuate a decrease in endoribonuclease activity. Indeed, MazE
and functional fragments thereof are the first molecules
characterized by the present invention and demonstrated herein to
be capable of effectuating a decrease in endoribonuclease activity
and thereby effectuating a decrease in endoribonuclease substrate
cleavage. Exemplary MazE functional fragments capable of
effectuating a decrease in endoribonuclease substrate cleavage
include, but are not limited to, a C-terminal MazF interacting
domain. In a specific embodiment, a C-terminal MazF interacting
domain comprises a region from residue 38 to 75 of MazE. As
described herein, critical residues identified in this region
include Leu55 and Leu58. In another embodiment, a C-terminal MazF
interacting domain comprises an Hp-Box of a MazE molecule and
critical residues identified therein.
[0259] In a particular aspect of the invention, two C-terminal
peptides of MazE can be chemically synthesized, one with T54-K77
(24 amino acid residues; TLAELVNDITPENLHENIDWGEPK; SEQ ID NO: 9)
and the other with N60-K77 (18 a.a. residues; NDITPENLHENIDWGEPK;
SEQ ID NO: 10). These peptides are expected to form stable
inhibitory complexes with the MazF dimer on the basis of the X-ray
structure of the MazE-MazF complex. The former peptide contains
both helix 2 and the C-terminal acidic tail, while the latter
peptide lacks helix 2. These peptides will be examined for their
abilities to inhibit the mRNA interferase activity of MazF using a
synthetic 30-base RNA (5'-UAAGAAGGAGAUAUACAUAUGAAUCAAAUC-3'; SEQ ID
NO: 11) as a substrate. Their inhibitory activities will be
compared with the intact MazE as a control.
[0260] In another embodiment, MazE polypeptides and MazE functional
fragments of the invention enhance or increase MazF activity. In a
particular aspect, MazF, polypeptides or MazE functional fragments
of the invention enhance MazF endoribonuclease activity or
effectuate an increase in endoribonuclease activity. Indeed, MazE
polypeptide mutants and functional fragments thereof are the first
molecules characterized by the present invention to be capable of
effectuating an increase in endoribonuclease activity and thereby
effectuating an increase in endoribonuclease substrate cleavage.
Exemplary MazE polypeptides capable of effectuating an increase in
endoribonuclease substrate cleavage include, but are not limited
to, a MazE polypeptide comprising mutations in a C-terminal MazF
interacting domain, a region from MazE residue 38 to 75, an Hp-box,
or at Leu55 or Leu 58 (or homologous positions thereof), wherein
such a mutation(s) reduces or inhibits the ability of MazE to bind
to MazF. Exemplary MazE fragments capable of effectuating an
increase in endoribonuclease substrate cleavage include, but are
not limited to, a MazE fragment comprising a mutation(s) that
reduces or inhibits the ability of the MazF, fragment to bind MazF.
Such MazE fragments comprising such mutations include, but are not
limited to, a C-terminal MazF interacting domain or a region from
residue 38 to 75 of MazE. Exemplary mutations in residues known to
reduce or inhibit the ability of a MazE fragment to bind MazF
include mutations at Leu55 and Leu58. Such MazE mutant polypeptides
and fragments may be referred to herein as having dominant negative
activity. In general, dominant negative polypeptides serve to
reduce or inhibit the activity of the corresponding wild type
polypeptide because they are still capable of binding to and,
therefore, competing for substrates and/or interacting proteins or
molecules, but are at least partially impaired with respect to wild
type function.
[0261] PemI polypeptides encoded by SEQ ID NO: 7, nucleic acid
sequences encoding PemI polypeptides comprising SEQ ID NO: 8 and
functional fragments thereof, and PemI polypeptides comprising SEQ
ID NO: 8 and functional fragments thereof are also encompassed by
the invention. As described herein, PemI polypeptides and
functional fragments thereof exhibit the ability to modulate PemK
activity. Exemplary PemI functional fragments capable of modulating
PemI activity and, by extension, that of PemK, include the
N-terminal DNA binding domain and the C-terminal PemK interacting
domain. See Example IV herein below.
[0262] Thus, in one embodiment, PemI polypeptides and PemI
functional fragments of the invention inhibit PemK activity. In a
particular aspect, PemI polypeptides or PemI functional fragments
of the invention inhibit PemK endoribonuclease activity or
effectuate a decrease in endoribonuclease activity. Indeed, PemI
and functional fragments thereof are the first molecules
characterized by the present invention and demonstrated herein to
be capable of effectuating a decrease in endoribonuclease activity
and thereby effectuating a decrease in endoribonuclease substrate
cleavage.
[0263] In another embodiment, a mutated form or derivative of a
PemI polypeptide or a fragment thereof which is capable of
inhibiting PemI activity is envisioned. Such PemI mutant
polypeptides and fragments may be referred to herein as having
dominant negative activity. In general, dominant negative
polypeptides serve to reduce or inhibit the activity of the
corresponding wild type polypeptide because they are still capable
of binding to and, therefore, competing for substrates and/or
interacting proteins or molecules, but are at least partially
impaired with respect to wild type function. Since PemI normally
binds to PemK, thereby inhibiting its toxic effects, prevention of
PemI-mediated inhibition of PemK serves to release PemK from this
negative regulation. Inhibiting PemI activity, therefore, leads to
an increase in PemK activity.
[0264] C. General Methods for Identifying Compounds Capable of
Modulating MazF Activity
[0265] A structure of the Escherichia coli chromosomal MazE/MazF
addiction module has been determined to a 1.7 .ANG. resolution
(Kamada et al., Mol Cell 11, 875-884 (2003)). As described herein,
addiction modules consist of stable toxin and unstable antidote
proteins that govern bacterial cell death. MazE (antidote) and MazF
(toxin) form a linear heterohexamer composed of alternating toxin
and antidote homodimers (MazF.sub.2-MazE.sub.2-MazF.sub.2). Kamada
et al. show that the MazE homodimer contains a .beta. barrel from
which two extended C termini project that interact with flanking
MazF homodimers. Such interactions resemble those of the
plasmid-encoded toxins CcdB and Kid. The MazE/MazF heterohexamer
structure documents that the mechanism of antidote-toxin
recognition is common to both chromosomal and plasmid-borne
addiction modules, and provides general molecular insights into
toxin function, antidote degradation in the absence of toxin, and
promoter DNA binding by antidote/toxin complexes.
[0266] Based on information presented herein, suitable peptide
targets in MazE include, but are not limited to, those residues and
regions listed below. Suitable peptide targets in MazE include the
N-box, the highly conserved N-terminal region in MazE from residue
7 to 18 which mediates DNA-binding, and critical residues therein.
Critical residues in the N-box of MazE include K7A, R8A, S12A and
R16A, mutation of which disrupts the DNA-binding ability of both
MazE and the MazE-MazFcomplex. The Hp-Box, the conserved C-terminal
region in MazE from residue 53 to 64, which is rich in hydrophobic
residues, is also a suitable target for peptide-based therapeutics.
The Hp-box region is involved in the seemingly most stable
interface between MazE and MazF. The side-chains of hydrophobic
amino acid residues (Leu55, Leu58, Val59 and Ile62) in the Hp-box
interact with a cluster of hydrophobic residues in the MazF
homodimer.
[0267] Based on information presented herein, suitable peptide
targets in MazF include, but are not limited to, those residues and
regions listed below. Suitable peptide targets in MazF include
R29S, N40D, T52K, Q77H, R86G, I110N, E24A and K79A residues and
small peptides encompassing these critical residues (e.g. 5-10
residue peptides comprising these residues and flanking residues
thereof).
[0268] In one embodiment of the invention, the crystal structure of
the 2:4 MazE/MazF complex (Kamada et al., supra), structural
components thereof, and interfaces identified between MazE and MazF
are used as targets in a virtual ligand screening procedure that
seeks to identify, via computer docking methods, candidate
compounds from a vast compound library which bind with high
affinity to the target site.
[0269] In another embodiment, the structural information of the
MazF/MazF complex (Kamada et al., supra), components thereof; and
interfaces identified between MazE and MazF are used to design
compounds predicted to bind to MazF and/or MazE/MazF interfaces,
and such compounds are tested for high affinity binding.
[0270] In specific embodiments, candidate compounds and "designed
compounds" are selected which modulate binding of MazF to RNA. Such
compounds may either enhance or inhibit binding of MazF to RNA.
Such compounds may, in turn, effectuate an increase or a decrease
in substrate (i.e., RNA) cleavage. Compounds derived or obtained
from either approach scoring the highest in the docking procedure
are then tested in cell based and cell-free assays (described
below) to determine their efficacy in modulating MazF activity.
[0271] Any compounds which show efficacy in biological assays may
then be co-crystallized with MazF to identify the binding site. In
a further embodiment of the invention, candidate compounds able to
bind MazF are modified by methods known in the art to further
improve specific characteristics, e.g., to increase efficacy and/or
specificity and/or solubility. Selected compounds exhibiting the
most desired characteristics are designated lead compounds, and
further tested in, for example, animal models of hyperproliferative
disorders to measure their efficacy.
[0272] D. General Methods for Identifying Compounds Capable of
Modulating PemK Activity
[0273] Based on information presented herein, suitable peptide
targets in PemI include, but are not limited to, those residues and
regions listed below. Suitable peptide targets in PemI include
regions conserved among members of the PemI family of
polypeptides.
[0274] Based on information presented herein, suitable peptide
targets in PemK include, but are not limited to, those residues and
regions listed below. The conserved loop between (3 strands S1 and
S2 (designated the S1-S2 loop) and residues therein are suitable
peptide targets. See FIGS. 33 and 34 for amino acid sequence
alignment of conserved regions and amino acid sequences
therein.
[0275] In one embodiment of the invention, the crystal structure of
the 2:4 MazE/MazF complex (Kamada et al., supra), structural
components thereof, and interfaces identified between MazE and MazF
can be applied to the examination of PemI/PemK complexes.
Accordingly, such extrapolations can be used to identify targets in
a virtual ligand screening procedure that seeks to identify, via
computer docking methods, candidate compounds from a vast compound
library which bind with high affinity to the target site.
[0276] In another embodiment, the structural information of the
MazE/MazF complex (Kamada et al., supra), components thereof, and
interfaces identified between MazE and MazF can be applied to the
examination of PemI/PemK complexes. Accordingly, such
extrapolations can be used to design compounds predicted to bind to
PemK and/or PemI/PemK interfaces, and such compounds can be tested
for high affinity binding.
[0277] In specific embodiments, candidate compounds and "designed
compounds" are selected which modulate binding of PemK to RNA. Such
compounds may either enhance or inhibit binding of PemK to RNA.
Such compounds may, in turn, effectuate an increase or a decrease
in substrate (i.e., RNA) cleavage. Compounds derived or obtained
from either approach scoring the highest in the docking procedure
are subsequently tested in cell-based and cell-free assays
(described below) to determine their efficacy in modulating PemK
activity.
[0278] Any compounds which show efficacy in biological assays may
then be co-crystallized with PemK to identify the binding site(s).
In a further embodiment of the invention, candidate compounds able
to bind PemK are modified by methods known in the art to further
improve specific characteristics, e.g., to increase efficacy and/or
specificity and/or solubility. Selected compounds exhibiting the
most desired characteristics are designated lead compounds, and
further tested in, for example, animal models of hyperproliferative
disorders to measure their efficacy.
[0279] Virtual Ligand Screening Via Flexible Docking Technology
[0280] Current docking and screening methodologies can select small
sets of likely lead candidate ligands from large libraries of
compounds using a specific protein structure. Such methods are
described, for example, in Abagyan and Totrov (2001) Current
Opinion Chemical Biology 5:375-382, herein specifically
incorporated by reference in its entirety.
[0281] Virtual ligand screening (VLS) based on high-throughput
flexible docking is useful for designing and identifying compounds
able to bind to a specific protein structure. VLS can be used to
virtually sample a large number of chemical molecules without
synthesizing and experimentally testing each one. Generally, the
methods start with polypeptide modeling which uses a selected
protein structure derived by conventional means, e.g., X-ray
crystallography, NMR, homology modeling. A set of compounds and/or
molecular fragments are then docked into the selected binding site
using any one of the existing docking programs, such as for
example, MCDOCK (Liu et al. (1999) J. Comput. Aided Mol. Des.
13:435-451), SEED (Majeux et al. (1999) Proteins 37:88-105; DARWIN
(Taylor et al. (2000) Proteins 41:173-191; MM (David et al. (2001)
J. Comput. Aided Mol. Des. 15:157-171. Compounds are scored as
ligands, and a list of candidate compounds predicted to possess the
highest binding affinities generated for further in vitro and in
vivo testing and/or chemical modification.
[0282] In one approach of VLS, molecules are "built" into a
selected binding pocket prior to chemical generation. A large
number of programs are designed to "grow" ligands atom-by-atom
[see, for example, GENSTAR (Pearlman et al. L (1993) J. Comput.
Chem. 14:1184), LEGEND (Nishibata et al. (1993) J. Med. Chem.
36:2921-2928), MCDNLG (Rotstein et al. (1993) J. Comput-Aided Mol.
Des. 7:23-43), CONCEPTS (Gehlhaar et al. (1995) J. Med. Chem
38:466-472] or fragment-by-fragment [see, for example, GROUPBUILD
(Rotsein et al. (1993) J. Med. Chem. 36:1700-1710), SPROUT (Gillet
et al. (1993) J. Comput. Aided Mol. Des. 7:127-153), LUDI (Bohm
(1992) J. Comput. Aided Mol. Des. 6:61-78), BUILDER (Roe (1995) J.
Comput. Aided Mol. Des. 9:269-282), and SMOG (DeWitte et al. (1996)
J. Am. Chem. Soc. 118:11733-11744].
[0283] Methods for scoring ligands for a particular protein are
known which allow discrimination between the small number of
molecules able to bind the protein structure and the large number
of non-binders. See, for example, Agagyan et al. (2001) supra, for
a report on the growing number of successful ligands identified via
virtual ligand docking and screening methodologies.
[0284] For example, Nishibata et al. (1993) J. Med. Chem
36:2921-2928, describe the ability of a structure construction
program to generate inhibitory molecules based on the
three-dimension-structure of the active site of a molecule,
dihydrofolate reductase. The program was able to predict molecules
having a similar structure to four known inhibitors of the enzyme,
providing strong support that new lead compounds can be obtained
with knowledge of the target three dimensional structure.
Similarly, Gillet et al. (1993) J. Computer Aided Mol. Design
7:127-153 describe structure generation through artificial
intelligence techniques based on steric constrains (SPROUT).
[0285] Agents Identified by the Screening Methods of the
Invention
[0286] The invention provides methods for identifying agents (e.g.,
candidate compounds or test compounds) that bind with high affinity
to mRNA interferases (e.g., MazF or PemK) or mRNA interferase
inhibitors, (e.g., MazE or PemI). Agents identified by the
screening method of the invention are useful as candidate
anti-hyperproliferative disorder and anti-bacterial
therapeutics.
[0287] Examples of agents, candidate compounds or test compounds
include, but are not limited to, nucleic acids (e.g., DNA and RNA),
carbohydrates, lipids, proteins, peptides, peptidomimetics, small
molecules and other drugs. Agents can be obtained using any of the
numerous approaches in combinatorial library methods known in the
art, including: biological libraries; spatially addressable
parallel solid phase or solution phase libraries; synthetic library
methods requiring deconvolution; the "one-bead one-compound"
library method; and synthetic library methods using affinity
chromatography selection. The biological library approach is
limited to peptide libraries, while the other four approaches are
applicable to peptide, non-peptide oligomer or small molecule
libraries of compounds (Lam (1997) Anticancer Drug Des. 12:145;
U.S. Pat. No. 5,738,996; and U.S. Pat. No. 5,807,683, each of which
is incorporated herein in its entirety by reference).
[0288] Examples of methods for the synthesis of molecular libraries
can be found in the art, for example in: DeWitt et al. (1993) Proc.
Natl. Acad. Sci. USA 90:6909; Erb et al. (1994) Proc. Natl. Acad.
Sci. USA 91:11422; Zuckermann et al. (1994) J. Med. Chem. 37:2678;
Cho et al. (1993) Science 261:1303; Carrell et al. (1994) Angew.
Chem. Int. Ed. Engl. 33:2059; Carell et al. (1994) Angew. Chem.
Int. Ed. Engl. 33:2061; and Gallop et al. (1994) J. Med. Chem.
37:1233, each of which is incorporated herein in its entirety by
reference.
[0289] Libraries of compounds may be presented, e.g., presented in
solution (e.g., Houghten (1992) Bio/Techniques 13:412-421), or on
beads (Lam (1991) Nature 354:82-84), chips (Fodor (1993) Nature
364:555-556), bacteria (U.S. Pat. No. 5,223,409), spores (U.S. Pat.
Nos. 5,571,698; 5,403,484; and 5,223,409), plasmids (Cull et al.
(1992) Proc. Natl. Acad. Sci. USA 89:1865-1869) or phage (Scott and
Smith (19900 Science 249:386-390; Devlin (1990) Science
249:404-406; Cwirla et al. (1990) Proc. Natl. Acad. Sci. USA
87:6378-6382; and Felici (1991) J. Mol. Biol. 222:301-310), each of
which is incorporated herein in its entirety by reference.
[0290] Screening Assays
[0291] Small molecules identified through the above described
virtual ligand docking and screening methodologies are further
tested in in vitro and in vivo assays. In one embodiment, agents
that interact with (i.e., bind to) an mRNA interferase, such as
MazF or PemK, or mRNA interferase inhibitors, such as MazF, or
PemI, are identified in a cell-based assay system. For the purposes
of clarity and brevity, the remainder of these assays is described
with regard to MazF and MazF fragments, but it is to be understood
that such assays/methods are also applicable to other mRNA
interferases and fragments thereof, such as MazE and MazE
fragments, PemK and PemK fragments, and PemI and PemI
fragments.
[0292] In accordance with this embodiment, cells expressing a MazF
or a functional fragment thereof, are contacted with a candidate
compound or a control compound and the ability of the candidate
compound to interact with MazF is determined. If desired, this
assay may be used to screen a plurality (e.g. a library) of
candidate compounds. The cell, for example, can be of prokaryotic
origin (e.g., E. coli) or eukaryotic origin (e.g., yeast or
mammalian). Further, the cells can express MazF or a fragment
thereof endogenously or be genetically engineered to express MazF
or a MazF fragment. In certain instances, MazF or a MazF fragment
is labeled, for example with a radioactive label (such as .sup.32P,
.sup.35S or .sup.125I) or a fluorescent label (such as fluorescein
isothiocyanate, rhodamine, phycoerythrin, phycocyanin,
allophycocyanin, o-phthaldehyde or fluorescamine) to enable
detection of an interaction between MazF and a candidate compound.
The ability of the candidate compound to bind to MazF can be
determined by methods known to those of skill in the art. For
example, the interaction between a candidate compound and MazF can
be determined by flow cytometry, a scintillation assay,
immunoprecipitation or western blot analysis.
[0293] In another embodiment, agents that interact with (i.e., bind
to) MazF, or a relevant fragment thereof, are identified in a
cell-free assay system. In accordance with this embodiment, a
native or recombinant MazF or fragment thereof is contacted with a
candidate compound or a control compound and the ability of the
candidate compound to interact with MazF is determined. If desired,
this assay may be used to screen a plurality (e.g. a library) of
candidate compounds. In one embodiment, MazF or fragment thereof is
first immobilized, by, for example, contacting with, for example,
an immobilized antibody which specifically recognizes and binds it,
or by contacting a purified preparation of MazF or fragment
thereof, with a surface designed to bind proteins. MazF or a
fragment thereof may be partially or completely purified (e.g.,
partially or completely free of other polypeptides) or part of a
cell lysate. Further, MazF or a fragment thereof may be a fusion
protein comprising MazF or a biologically active portion thereof,
and a domain such as glutathionine-S-transferase. Alternatively,
MazF or a fragment thereof can be biotinylated using techniques
well known to those of skill in the art (e.g., biotinylation kit,
Pierce Chemicals; Rockford, Ill.). The ability of the candidate
compound to interact with MazF can be determined by methods known
to those of skill in the art.
[0294] In another embodiment, agents that modulate the MazF
activity are identified in an animal model. Examples of suitable
animals include, but are not limited to, mice, rats, rabbits,
monkeys, guinea pigs, dogs and cats. Preferably, the animal used
represents a model of a hyperproliferative disorder. In accordance
with this embodiment, the test compound or a control compound is
administered (e.g., orally, rectally or parenterally such as
intraperitoneally or intravenously) to a suitable animal and the
effect on the level of activity is determined.
[0295] E. Therapeutic Uses of Agents Able to Bind mRNA Interferases
or mRNA Interferase Inhibitors
[0296] The invention provides for treatment of hyperproliferative
disorders by administration of a therapeutic compound identified
using the above-described methods. Such compounds include, but are
not limited to proteins, peptides, protein or peptide derivatives
or analogs, antibodies, nucleic acids, and small molecules.
[0297] The invention provides methods for treating patients
afflicted with a hyperproliferative disorder comprising
administering to a subject an effective amount of a compound
identified by the method of the invention. In a preferred aspect,
the compound is substantially purified (e.g., substantially free
from substances that limit its effect or produce undesired
side-effects). The subject is preferably an animal, including but
not limited to animals such as cows, pigs, horses, chickens, cats,
dogs, etc., and is preferably a mammal, and most preferably human.
In a specific embodiment, a non-human mammal is the subject.
[0298] Formulations and methods of administration that can be
employed when the compound comprises a nucleic acid are described
above; additional appropriate formulations and routes of
administration are described below.
[0299] Various delivery systems are known and can be used to
administer a compound of the invention, e.g., encapsulation in
liposomes, microparticles, microcapsules, recombinant cells capable
of expressing the compound, receptor-mediated endocytosis (see,
e.g., Wu and Wu (1987) J. Biol. Chem. 262:4429-4432), and
construction of a nucleic acid as part of a retroviral or other
vector. Methods of introduction can be enteral or parenteral and
include but are not limited to intradermal, intramuscular,
intraperitoneal, intravenous, subcutaneous, intranasal, epidural,
and oral routes. The compounds may be administered by any
convenient route, for example by infusion or bolus injection, by
absorption through epithelial or mucocutaneous linings (e.g., oral
mucosa, rectal and intestinal mucosa, etc.) and may be administered
together with other biologically active agents. Administration can
be systemic or local. In addition, it may be desirable to introduce
the pharmaceutical compositions of the invention into the central
nervous system by any suitable route, including intraventricular
and intrathecal injection; intraventricular injection may be
facilitated by an intraventricular catheter, for example, attached
to a reservoir, such as an Ommaya reservoir. Pulmonary
administration can also be employed, e.g., by use of an inhaler or
nebulizer, and formulation with an aerosolizing agent.
[0300] In a specific embodiment, it may be desirable to administer
the pharmaceutical compositions of the invention locally, e.g., by
local infusion during surgery, topical application, e.g., by
injection, by means of a catheter, or by means of an implant, said
implant being of a porous, non-porous, or gelatinous material,
including membranes, such as sialastic membranes, or fibers. In one
embodiment, administration can be by direct injection into CSF or
at the site of a tumor, for example, in CNS tissue.
[0301] In another embodiment, the compound can be delivered in a
vesicle, in particular a liposome (see Langer (1990) Science
249:1527-1533; Treat et al., in Liposomes in the Therapy of
Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.),
Liss, New York, pp. 353-365 (1989); Lopez-Berestein, ibid., pp.
317-327; see generally ibid.)
[0302] In yet another embodiment, the compound can be delivered in
a controlled release system. In one embodiment, a pump may be used
(see Langer, supra; Sefton (1987) CRC Crit. Ref. Biomed. Eng.
14:201; Buchwald et al. (1980) Surgery 88:507; Saudek et al., 1989,
N. Engl. J. Med. 321:574). In another embodiment, polymeric
materials can be used (see Medical Applications of Controlled
Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Fla.
(1974); Controlled Drug Bioavailability, Drug Product Design and
Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger
and Peppas, J., 1983, Macromol. Sci. Rev. Macromol. Chem. 23:61;
see also Levy et al. (1985) Science 228:190; During et al. (1989)
Ann. Neurol. 25:351; Howard et al. (1989) J. Neurosurg. 71:105). In
yet another embodiment, a controlled release system can be placed
in proximity of the therapeutic target, i.e., a target tissue or
tumor, thus requiring only a fraction of the systemic dose (see,
e.g., Goodson, in Medical Applications of Controlled Release,
supra, vol. 2, pp. 115-138 (1984)). Other controlled release
systems are discussed in the review by Langer (1990, Science
249:1527-1533).
[0303] F. Pharmaceutical Compositions
[0304] The present invention also provides pharmaceutical
compositions. Such compositions comprise a therapeutically
effective amount of an agent, and a pharmaceutically acceptable
carrier. In a particular embodiment, the term "pharmaceutically
acceptable" means approved by a regulatory agency of the federal or
a state government or listed in the U.S. Pharmacopeia or other
generally recognized pharmacopeia for use in animals, and more
particularly in humans. The term "carrier" refers to a diluent,
adjuvant, excipient, or vehicle with which the therapeutic is
administered. Such pharmaceutical carriers can be sterile liquids,
such as water and oils, including those of petroleum, animal,
vegetable or synthetic origin, such as peanut oil, soybean oil,
mineral oil, sesame oil and the like. Water is a preferred carrier
when the pharmaceutical composition is administered intravenously.
Saline solutions and aqueous dextrose and glycerol solutions can
also be employed as liquid carriers, particularly for injectable
solutions.
[0305] Suitable pharmaceutical excipients include starch, glucose,
lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel,
sodium stearate, glycerol monostearate, talc, sodium chloride,
dried skim milk, glycerol, propylene, glycol, water, ethanol and
the like. The composition, if desired, can also contain minor
amounts of wetting or emulsifying agents, or pH buffering agents.
These compositions can take the form of solutions, suspensions,
emulsion, tablets, pills, capsules, powders, sustained-release
formulations and the like. The composition can be formulated as a
suppository, with traditional binders and carriers such as
triglycerides. Oral formulation can include standard carriers such
as pharmaceutical grades of mannitol, lactose, starch, magnesium
stearate, sodium saccharine, cellulose, magnesium carbonate, etc.
Examples of suitable pharmaceutical carriers are described in
"Remington's Pharmaceutical Sciences" by E. W. Martin, incorporated
in its entirety by reference herein. Such compositions will contain
a therapeutically effective amount of the compound, preferably in
purified form, together with a suitable amount of carrier so as to
provide the form for proper administration to the subject. The
formulation should suit the mode of administration.
[0306] In a preferred embodiment, the composition is formulated in
accordance with routine procedures as a pharmaceutical composition
adapted for intravenous administration to human beings. Typically,
compositions for intravenous administration are solutions in
sterile isotonic aqueous buffer. Where necessary, the composition
may also include a solubilizing agent and a local anesthetic such
as lidocaine to ease pain at the site of the injection. Generally,
the ingredients are supplied either separately or mixed together in
unit dosage form, for example, as a dry lyophilized powder or water
free concentrate in a hermetically sealed container such as an
ampoule or sachette indicating the quantity of active agent. Where
the composition is to be administered by infusion, it can be
dispensed with an infusion bottle containing sterile pharmaceutical
grade water or saline. Where the composition is administered by
injection, an ampoule of sterile water for injection or saline can
be provided so that the ingredients may be mixed prior to
administration.
[0307] The compounds of the invention can be formulated as neutral
or salt forms. Pharmaceutically acceptable salts include those
formed with free amino groups such as those derived from
hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and
those formed with free carboxyl groups such as those derived from
sodium, potassium, ammonium, calcium, ferric hydroxides,
isopropylamine, triethylamine, 2-ethylamino ethanol, histidine,
procaine, etc
[0308] The amount of the compound of the invention which will be
effective in the treatment of a hyperproliferative disorder (e.g.,
cancer) can be determined by standard clinical techniques based on
the present description. In addition, in vitro assays may
optionally be employed to help identify optimal dosage ranges. The
precise dose to be employed in the formulation will also depend on
the route of administration, and the seriousness of the disease or
disorder, and should be decided according to the judgment of the
practitioner and each subject's circumstances. However, suitable
dosage ranges for intravenous administration are generally about
20-500 micrograms of active compound per kilogram body weight.
Suitable dosage ranges for intranasal administration are generally
about 0.01 pg/kg body weight to 1 mg/kg body weight. Suppositories
generally contain active ingredient in the range of 0.5% to 10% by
weight; oral formulations preferably contain 10% to 95% active
ingredient. Effective doses may be extrapolated from dose-response
curves derived from in vitro or animal model test systems.
[0309] Nucleic Acids
[0310] The invention provides methods of identifying agents capable
of binding an mRNA interferase (e.g., MazF or PemK) to effectuate
an increase in the riboendonucleolytic activity of the mRNA
interferase. Accordingly, the invention encompasses administration
of a nucleic acid encoding a peptide or protein activator of an
mRNA interferase or an ortholog thereof, as well as antisense
sequences or catalytic RNAs capable of interfering with the
expression of an endogenous inhibitor of an mRNA interferase (e.g.,
MazE or PemI) or an ortholog thereof.
[0311] In one embodiment, a nucleic acid comprising a sequence
encoding a peptide or protein capable of competitively binding to
an mRNA interferase is administered. Any suitable methods for
administering a nucleic acid sequence available in the art can be
used according to the present invention.
[0312] Methods for administering and expressing a nucleic acid
sequence are generally known in the area of gene therapy. For
general reviews of the methods of gene therapy, see Goldspiel et
al. (1993) Clinical Pharmacy 12:488-505; Wu and Wu (1991)
Biotherapy 3:87-95; Tolstoshev (1993) Ann. Rev. Pharmacol. Toxicol.
32:573-596; Mulligan (1993) Science 260:926-932; and Morgan and
Anderson (1993) Ann. Rev. Biochem. 62:191-217; May (1993) TIBTECH
11(5): 155-215. Methods commonly known in the art of recombinant
DNA technology which can be used in the present invention are
described in Ausubel et al. (eds.), 1993, Current Protocols in
Molecular Biology, John Wiley & Sons, NY; and Kriegler (1990)
Gene Transfer and Expression, A Laboratory Manual, Stockton Press,
NY.
[0313] In a particular aspect, the compound comprises a nucleic
acid encoding a peptide or protein capable of binding an mRNA
interferase to effectuate an increase in the riboendonucleolytic
activity of the mRNA interferase, such nucleic acid being part of
an expression vector that expresses the peptide or protein in a
suitable host. In particular, such a nucleic acid has a promoter
operably linked to the coding region, said promoter being inducible
or constitutive (and, optionally, tissue-specific). In another
particular embodiment, a nucleic acid molecule is used in which the
coding sequences and any other desired sequences are flanked by
regions that promote homologous recombination at a desired site in
the genome, thus providing for intrachromosomal expression of the
nucleic acid (Koller and Smithies (1989) Proc. Natl. Acad. Sci. USA
86:8932-8935; Zijlstra et al. (1989) Nature 342:435-438).
[0314] Delivery of the nucleic acid into a subject may be direct,
in which case the subject is directly exposed to the nucleic acid
or nucleic acid-carrying vector; this approach is known as in vivo
gene therapy. Alternatively, delivery of the nucleic acid into the
subject may be indirect, in which case cells are first transformed
with the nucleic acid in vitro and then transplanted into the
subject, known as "ex vivo gene therapy".
[0315] In another embodiment, the nucleic acid is directly
administered in vivo, where it is expressed to produce the encoded
product. This can be accomplished by any of numerous methods known
in the art, e.g., by constructing it as part of an appropriate
nucleic acid expression vector and administering it so that it
becomes intracellular, e.g., by infection using a defective or
attenuated retroviral or other viral vector (see U.S. Pat. No.
4,980,286); by direct injection of naked DNA; by use of
microparticle bombardment (e.g., a gene gun; Biolistic, Dupont); by
coating with lipids, cell-surface receptors or transfecting agents;
by encapsulation in liposomes, microparticles or microcapsules; by
administering it in linkage to a peptide which is known to enter
the nucleus; or by administering it in linkage to a ligand subject
to receptor-mediated endocytosis (see, e.g., Wu and Wu, 1987, J.
Biol. Chem. 262:4429-4432), which can be used to target cell types
specifically expressing the receptors.
[0316] In another embodiment, a nucleic acid-ligand complex can be
formed in which the ligand comprises a fusogenic viral peptide to
disrupt endosomes, allowing the nucleic acid to avoid lysosomal
degradation. In yet another embodiment, the nucleic acid can be
targeted in vivo for cell specific uptake and expression, by
targeting a specific receptor (see, e.g., PCT Publications WO
92/06180 dated Apr. 16, 1992 (Wu et al.); WO 92/22635 dated Dec.
23, 1992 (Wilson et al.); WO92/20316 dated Nov. 26, 1992 (Findeis
et al.); WO93/14188 dated Jul. 22, 1993 (Clarke et al.), WO
93/20221 dated Oct. 14, 1993 (Young)). Alternatively, the nucleic
acid can be introduced intracellularly and incorporated within host
cell DNA for expression, by homologous recombination (Koller and
Smithies, 1989, Proc. Natl. Acad. Sci. USA 86:8932-8935; Zijlstra
et al. (1989) Nature 342:435-438).
[0317] In a further embodiment, a retroviral vector can be used
(see Miller et al. (1993) Meth. Enzymol. 217:581-599). These
retroviral vectors have been modified to delete retroviral
sequences that are not necessary for packaging of the viral genome
and integration into host cell DNA. The nucleic acid encoding an
mRNA interferase to be used in gene therapy is cloned into the
vector, which facilitates delivery of the gene into a subject. More
detail about retroviral vectors can be found in Boesen et al.
(1994) Biotherapy 6:291-302, which describes the use of a
retroviral vector to deliver the mdr1 gene to hematopoietic stem
cells in order to make the stem cells more resistant to
chemotherapy. Other references illustrating the use of retroviral
vectors in gene therapy are: Clowes et al. (1994) J. Clin. Invest.
93:644-651; Kiem et al. (1994) Blood 83:1467-1473; Salmons and
Gunzberg (1993) Human Gene Therapy 4:129-141; and Grossman and
Wilson (1993) Curr. Opin. in Genetics and Devel. 3:110-114.
[0318] Adenoviruses may also be used effectively in gene therapy.
Adenoviruses are especially attractive vehicles for delivering
genes to respiratory epithelia. Adenoviruses naturally infect
respiratory epithelia where they cause a mild disease. Other
targets for adenovirus-based delivery systems are liver, the
central nervous system, endothelial cells, and muscle. Adenoviruses
have the advantage of being capable of infecting non-dividing
cells. Kozarsky and Wilson (1993) Current Opinion in Genetics and
Development 3:499-503 present a review of adenovirus-based gene
therapy. Bout et al. (1994) Human Gene Therapy 5:3-10 demonstrated
the use of adenovirus vectors to transfer genes to the respiratory
epithelia of rhesus monkeys. Other instances of the use of
adenoviruses in gene therapy can be found in Rosenfeld et al.
(1991) Science 252:431-434; Rosenfeld et al. (1992) Cell
68:143-155; Mastrangeli et al. (1993) J. Clin. Invest. 91:225-234;
PCT Publication WO94/12649; and Wang, et al. (1995) Gene Therapy
2:775-783. Adeno-associated virus (AAV) has also been proposed for
use in gene therapy (Walsh et al. (1993) Proc. Soc. Exp. Biol. Med.
204:289-300; U.S. Pat. No. 5,436,146).
[0319] Another suitable approach to gene therapy involves
transferring a gene to cells in tissue culture by such methods as
electroporation, lipofection, calcium phosphate mediated
transfection, or viral infection. Usually, the method of transfer
includes the transfer of a selectable marker to the cells. The
cells are then placed under selection to isolate those cells that
have taken up and are expressing the transferred gene. Those cells
are then delivered to a subject.
[0320] In this embodiment, the nucleic acid is introduced into a
cell prior to administration in vivo of the resulting recombinant
cell. Such introduction can be carried out by any method known in
the art, including but not limited to transfection,
electroporation, microinjection, infection with a viral or
bacteriophage vector containing the nucleic acid sequences, cell
fusion, chromosome-mediated gene transfer, microcell-mediated gene
transfer, spheroplast fusion, etc. Numerous techniques are known in
the art for the introduction of foreign genes into cells (see,
e.g., Loeffler and Behr (1993) Meth. Enzymol. 217:599-618; Cohen et
al. (1993) Meth. Enzymol. 217:618-644; Cline (1985) Pharmac. Ther.
29:69-92) and may be used in accordance with the present invention,
provided that the necessary developmental and physiological
functions of the recipient cells are not disrupted. The technique
should provide for the stable transfer of the nucleic acid to the
cell, so that the nucleic acid is expressible by the cell and
preferably heritable and expressible by its cell progeny.
[0321] The resulting recombinant cells can be delivered to a
subject by various methods known in the art. In a preferred
embodiment, epithelial cells are injected, e.g., subcutaneously. In
another embodiment, recombinant skin cells may be applied as a skin
graft onto the subject; recombinant blood cells (e.g.,
hematopoietic stem or progenitor cells) are preferably administered
intravenously. The amount of cells envisioned for use depends on
the desired effect, the condition of the subject, etc., and can be
determined by one skilled in the art.
[0322] Cells into which a nucleic acid can be introduced for
purposes of gene therapy encompass any desired, available cell
type, and include but are not limited to neuronal cells, glial
cells (e.g., oligodendrocytes or astrocytes), epithelial cells,
endothelial cells, keratinocytes, fibroblasts, muscle cells,
hepatocytes; blood cells such as T lymphocytes, B lymphocytes,
monocytes, macrophages, neutrophils, eosinophils, megakaryocytes,
granulocytes; various stem or progenitor cells, in particular
hematopoietic stem or progenitor cells, e.g., as obtained from bone
marrow, umbilical cord blood, peripheral blood or fetal liver. In a
preferred embodiment, the cell used for gene therapy is autologous
to the subject that is treated.
[0323] In another embodiment, the nucleic acid to be introduced for
purposes of gene therapy may comprise an inducible promoter
operably linked to the coding region, such that expression of the
nucleic acid is controllable by adjusting the concentration of an
appropriate inducer of transcription.
[0324] Direct injection of a DNA coding for a peptide or protein
capable of binding to an mRNA interferase or an agent capable of
interfering with the expression of an endogenous inhibitor of an
mRNA interferase (e.g., MazE or PemI, or an ortholog thereof) may
also be performed according to, for example, the techniques
described in U.S. Pat. No. 5,589,466. These techniques involve the
injection of "naked DNA", i.e., isolated DNA molecules in the
absence of liposomes, cells, or any other material besides a
suitable carrier. The injection of DNA encoding a protein and
operably linked to a suitable promoter results in the production of
the protein in cells near the site of injection.
[0325] G. Kits
[0326] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the pharmaceutical compositions of the invention.
Optionally associated with such container(s) can be a notice in the
form prescribed by a governmental agency regulating the
manufacture, use or sale of pharmaceuticals or biological products,
which notice reflects (a) approval by the agency of manufacture,
use or sale for human administration, (b) directions for use, or
both.
[0327] The following examples are put forth so as to provide those
of ordinary skill in the art with a complete disclosure and
description of how to make and use the assay, screening, and
therapeutic methods of the invention, and are not intended to limit
the scope of what the inventors regard as their invention. Efforts
have been made to ensure accuracy with respect to numbers used
(e.g., amounts, temperature, etc.) but some experimental errors and
deviations should be accounted for. Unless indicated otherwise,
parts are parts by weight, molecular weight is average molecular
weight, temperature is in degrees Centigrade, and pressure is at or
near atmospheric.
[0328] The following protocols are provided to facilitate the
practice of the present invention.
Example I
[0329] As described herein, E. coli cells permeabilized by toluene
treatment were used to demonstrate that MazF inhibits translation,
but not RNA synthesis or DNA replication. Moreover, MazF was shown
to cleave mRNA specifically between A and C residues at ACA
sequences in a manner independent of ribosomes. Thus, the present
invention demonstrates that MazF interferes with mRNA function by
cleaving it at specific sites. Accordingly, the present inventors
have discovered that MazF is a novel endoribonuclease and have
designated it herein an "mRNA interferase".
[0330] Methods and Materials
[0331] Strains and Plasmids. E. coli BL21(DE3), BW25113 (Datsenko
and Wanner, Proc Natl Acad Sci USA 97, 6640-5 (2000)) and MRE600
(Swaney et al., Antimicrob Agents Chemother 42, 3251-5 (1998)) were
used. Plasmid pET-21 cc-MazEF was constructed from pET-21 cc
(Novagen), which was modified to express both MazE and
MazF(His).sub.6 under the control of a T7 promoter. The
Shine-Dalgarno (SD) sequence, however, was derived from the mazEF
operon. Plasmid pET-28a-MazE was constructed using pET-28a
(Novagen) to express (His).sub.6MazE. pBAD-MazF was constructed
using pBAD (Guzman et al., J Bacteriol 177, 4121-30 (1995)) to
tightly regulate mazF expression following addition of arabinose
(0.2%).
[0332] Assay of Protein, DNA and RNA Synthesis in Toluene-Treated
Cells.
[0333] A 50-ml culture of E. coli BW25113 containing pBAD-MazF
plasmid was grown at 37.degree. C. in glycerol-M9 medium. When the
OD.sub.600 of the culture reached 0.6, arabinose was added to a
final concentration of 0.2%. After incubation at 37.degree. C. for
10 minutes, the cells were treated with 1% toluene (Halegoua et
al., Eur J Biochem 69, 163-7 (1976)). Using toluene-treated cells,
protein synthesis was carried out with .sup.35S-methionine as
described previously (Halegoua et al., J Bacteriol 126, 183-91
(1976)). The toluene-treated cells were washed once with 0.05 M
potassium phosphate buffer (pH 7.4) at room temperature, and then
resuspended in the same buffer to examine DNA synthesis using
[.alpha.-.sup.32P]dTTP as described previously (Moses and
Richardson, Proc Natl Acad Sci USA 67, 674-81 (1970)). For assaying
RNA synthesis, the toluene-treated cells were washed once with 0.05
M Tris-HCl buffer (pH 7.5) at room temperature, and then
resuspended into the same buffer to measure [.alpha.-.sup.32P]UTP
incorporation into RNA as described previously (Peterson et al., J
Bacteriol 107, 585-8 (1971)).
[0334] Assay of In Vivo Protein Synthesis.
[0335] E. coli BW25113 cells containing pBAD-MazF were grown in
glycerol-M9 medium. When the OD.sub.600 of the culture reached 0.6,
the culture was divided into two equal parts. To one part,
arabinose was added to a final concentration of 0.2%, and to the
second part, water was added. At different time intervals as
indicated in FIG. 2D, 1 ml of the culture was removed to a test
tube containing 2 .mu.Ci .sup.35S-methionine, and the mixture was
incubated for 1 min at 37.degree. C. 50 .mu.l of the reaction
mixture was then applied to a filter paper disk (Whatman 3 mm, 2.3
cm diameter). Filters were treated in 5% TCA solution as described
previously (Hirashima and Inouye, Nature 242, 405-7 (1973)) and
radioactivity was quantitated using a liquid scintillation counter.
The remaining 500 .mu.l of the reaction mixture was put into a
chilled test tube containing 25 .mu.l of 100% TCA solution and 100
.mu.g/ml non-radioactive methionine. The mixture was incubated in
an ice bath for 60 minutes. The pellets were collected following
centrifugation and dissolved in 50 .mu.l SDS-PAGE loading buffer by
incubating the mixture in a boiling water bath for 30 minutes.
After removing insoluble materials, the supernatant (10 .mu.l) was
analyzed by SDS-PAGE.
[0336] Purification of MazF(His).sub.6 and (His).sub.6MazE
Proteins.
[0337] MazF(His).sub.6 tagged at the C-terminal end was purified
from strain BL21(DE3) carrying pET-21 cc-MazEF. The complex of
MazF(His).sub.6 and MazE was first purified on Ni-NTA resin. After
dissociating MazE from MazF(His).sub.6 in 6M guanidine-HCl,
MazF(His).sub.6 was re-purified over Ni-NTA resin and refolded by
step-step dialysis. (His).sub.6MazE tagged at the N-terminal end
was purified from strain BL21(DE3) carrying pET-28a-MazE.
[0338] Effect of MazF on Protein Synthesis in Prokaryotic and
Eukaryotic Cell Free Systems.
[0339] Prokaryotic cell-free protein synthesis was carried out with
the E. coli T7 S30 extract system (Promega). The reaction mixture
consisted of 10 .mu.l of S30 premix, 7.5 .mu.l of S30 extract and
2.5 .mu.l of an amino acid mixture (1 mM each of all amino acids
but methionine), 1 .mu.l of .sup.35S-methionine, and different
amounts of MazF(His).sub.6 and (His).sub.6MazE in a final volume of
24 .mu.l. The reaction mixture was incubated for 10 min at
37.degree. C. and the assay initiated by adding 1 .mu.l of
pET-11a-MazG plasmid-DNA (0.16 .mu.g/.mu.l) (Zhang and Inouye, J
Bacteriol 184, 5323-9 (2002)). The reaction was performed for 1 h
at 37.degree. C., and proteins were precipitated with acetone and
analyzed by SDS-PAGE. Eukaryotic cell-free protein synthesis was
carried out with the rabbit reticulocyte lysates system TNT.RTM. T7
Quick for PCR DNA (Promega). A DNA fragment encoding a human
protein under the control of a T7 promoter was used as template for
mRNA transcription. The reaction was performed for 1 h at
37.degree. C., and proteins were precipitated with acetone and
analyzed by SDS-PAGE.
[0340] Polysome Profiles.
[0341] An overnight culture of E. coli BW25113 containing pBAD-MazF
plasmid was diluted 50 times in fresh glycerol-M9 medium. After 5 h
incubation at 37.degree. C., arabinose was added to a final
concentration of 0.2%. After MazF was induced for 10 minutes,
chloramphenicol was added to a final concentration of 100 .mu.g/ml.
The cell pellets were collected by centrifugation and resuspended
in 1 ml of 10 mM Tris-HCl (pH 7.8) containing 10 mM MgCl.sub.2, 60
mM NH.sub.4Cl, 1 mM DTT and 1 mg/ml lysozyme. After freezing and
thawing two times using liquid nitrogen, the lysates were
centrifuged at 24,000 rpm for 20 minutes in a Beckman TLA 100.3
rotor. The supernatant (300 .mu.l) was loaded onto a 5 to 40%
sucrose gradient for polysome profiling. A similar experiment was
carried out without the addition of arabinose. Ribosome patterns
were detected by OD.sub.280 and the gradient was run from left
(40%) to right (5%). Kasugamycin was added to a final concentration
of 500 .mu.g/ml where indicated.
[0342] Preparation of E. coli 70S Ribosomes.
[0343] 70S ribosomes were prepared from E. coli MRE 600 as
described previously (Aoki et al., Antimicrob Agents Chemother 46,
1080-5 (2002); Du and Babitzke, J Biol Chem 273, 20494-503 (1998);
Hesterkamp et al., J Biol Chem 272, 21865-71 (1997)) with minor
modification. Bacterial cells (2 g) were suspended in buffer A [10
mM Tris-HCl (pH 7.4) containing 10 mM MgCl.sub.2, 60 mM NH.sub.4Cl
and 6 mM 2-mercaptoethanol]. Cells were lysed using a French Press.
After incubation with RNase-free DNase (30 min at 0.degree. C.),
cell debris was removed by two rounds of centrifugation at 30,000
rpm for 30 min at 4.degree. C. in a Beckman 50Ti rotor. The
supernatant (the top three-fourths) was then layered over an equal
volume of 1.1 M sucrose in buffer B (buffer A containing 0.5 M
NH.sub.4Cl) and centrifuged at 45,000 rpm for 15 h at 4.degree. C.
in a Beckman 50Ti rotor. After washing with buffer A, the ribosome
pellets were resuspended in buffer A and applied to a linear 10 to
30% (wt/vol) sucrose gradient prepared in buffer A, and centrifuged
at -20,000-rpm for 15 h at 4.degree. C. in a Beckman SW40Ti rotor.
Gradients were fractionated and the 70S ribosome fractions were
pooled and pelleted at 45,000 rpm for 20 h at 4.degree. C. in a
Beckman 50Ti rotor. The 70S ribosome pellets were resuspended in
buffer A and stored at -80.degree. C.
[0344] Primer Extension Inhibition (Toeprinting) Assays.
[0345] Toeprinting was carried out as described previously (Moll
and Blasi, Biochem Biophys Res Commun 297, 1021-1026 (2002)) with
minor modification. The mixture for primer-template annealing
containing the maze mRNA and .sup.32P-end-labeled DNA primer
complementary to bases 65 to 85 of the mazG mRNA was incubated at
65.degree. C. for 5 minutes, and then cooled slowly to room
temperature. The ribosome-binding mixture contained 2 .mu.l of
10.times. buffer [100 mM Tris-HCl (pH 7.8) containing 100 mM
MgCl.sub.2, 600 mM NH.sub.4Cl and 10 mM DTT], different amounts of
MazF(His).sub.6, 0.375 mM dNTP, 0.5 .mu.M 70S ribosomal subunits,
2.5 .mu.M tRNA.sup.fMet and 2 .mu.l of the annealing mixture in a
final volume of 20 .mu.l. The final mRNA concentration was 0.05
.mu.M. This ribosome-binding mixture was incubated at 37.degree. C.
for 10 minutes, and then reverse transcriptase (2 U) was added.
cDNA synthesis was carried out at 37.degree. C. for 15 minutes. The
reaction was terminated by adding 12 .mu.l of the sequencing
loading buffer. The sample was incubated at 90.degree. C. for 5
minutes prior to electrophoresis on a 6% polyacrylamide sequencing
gel. The mazG mRNA was synthesized in vitro from a 173-bp DNA
fragment containing a T7 promoter using T7 RNA polymerase. The DNA
fragment consisting of T7 promoter and the mazG mRNA from +1 to
+153 was obtained by PCR amplification using pET-11a-MazG plasmid
as DNA template.
[0346] Toeprinting of the mazG mRNA after Phenol Extraction.
[0347] The experiment was carried out in the same way as described
above except that 70S ribosomes and tRNA.sup.fMet were omitted. The
reaction mixtures were phenol-extracted to remove proteins before
primer extension.
[0348] Construction of Mutant Plasmids.
[0349] Site-directed mutagenesis was performed with pET-11a-MazG
plasmid as DNA template. The mutations were confirmed by DNA
sequence analysis.
[0350] RNA Isolation and Northern Blot Analysis.
[0351] E. coli BW25113 containing pBAD-MazF were grown at
37.degree. C. in glycerol-M9 medium. When the OD.sub.600 value
reached 0.8, arabinose was added to a final concentration of 0.2%.
The samples were removed at different intervals as indicated in
FIG. 4D. Total RNA was isolated using the hot-phenol method as
described previously (Sarmientos et al., Cell 32, 1337-46 (1983)).
Northern blot analysis was carried out as described previously
(Baker and Mackie, Mol Microbiol 47, 75-88 (2003)).
[0352] Specific Methodological Details Pertaining to Drawings
[0353] As shown in FIG. 1A, MazF expression has a toxic effect on
cells. E. coli BW25113(.DELTA.araBAD) cells were transformed with
pBAD-MazF, pBAD-MazF R29S or pBAD-MazF R86G plasmid, respectively.
The cells were spread on glycerol-M9 plates with and without
arabinose (0.2%) and the inoculated plates were incubated at
37.degree. C. for 24 h. FIG. 1B shows sequence alignments of MazF
of Escherichia coli (NP.sub.--289336.1) with that of Bacillus
halodurans (NP.sub.--244588.1), Staphylococcus epidermidis
(AAG23809.1), Staphylococcus aureus (NP.sub.--372592.1), Bacillus
subtilis (1NE8_A), Neisseria meningitides (NP.sub.--266040.1),
Morganella morgani (AAC82516.1) and Mycobacterium tuberculosis
(NP.sub.--217317.1).
[0354] FIG. 2A reveals the effect of MazF expression on
.sup.35S-Met incorporation in toluene-treated cells. Specifically,
E. coli BW25113 cells containing pBAD-MazF were grown at 37.degree.
C. in glycerol-M9 medium. When the OD.sub.600 of the culture
reached 0.6, arabinose was added to a final concentration of 0.2%.
After incubation at 37.degree. C. for 10 minutes, the cells were
treated with toluene (Halegoua et al., J Bacteriol 126, 183-91
(1976)). Using toluene-treated cells, protein synthesis was carried
out with .sup.35S-methionine as described previously (Halegoua et
al., Eur J Biochem 69, 163-7 (1976)). FIG. 2B shows the effect of
MazF on [.alpha.-.sup.32P]dTTP incorporation in toluene-treated
cells (Moses and Richardson, Proc Natl Acad Sci USA 67, 674-81
(1970)). FIG. 2C shows the effect of MazF on [.alpha.-.sup.32]UTP
incorporation in toluene-treated cells (Peterson et al., J
Bacteriol 107, 585-8 (1971)). FIG. 2D reveals the effect of MazF on
.sup.35S-Met incorporation in vivo. .sup.35S-Met incorporation into
E. coli BW25113 cells containing pBAD-MazF was measured at various
time points after MazF induction as indicated. FIG. 2E shows an
SDS-PAGE analysis of in vivo protein synthesis after the induction
of MazF. The cultures used in FIG. 2E are the same as those shown
in FIG. 2D.
[0355] FIG. 3A shows the effect of MazF on polysome profiles.
Ribosome patterns were detected by OD.sub.260 and the gradient was
run from left (40%) to right (5%). The position of 70, 50 and 30S
ribosomes are indicated. FIG. 3B illustrates the effect of
MazF(His).sub.6 on prokaryotic cell-free protein synthesis using an
E. coli T7 S30 extract system (Promega). Lane C, without
MazF(His).sub.6; lanes 1 to 5: 77, 154, 231, 308 and 384 nM
MazF(His).sub.6 were added, respectively; lanes 6 to 10: 384 nM
MazF(His).sub.6 and the ratios of (His).sub.6MazE to
MazF(His).sub.6 were 0.1, 0.2, 0.4, 0.8 and 1.2, respectively. FIG.
3C reveals the effect of MazF(His).sub.6 on eukaryotic cell-free
protein synthesis using a rabbit reticulocyte lysate system
TNT.RTM. T7 Quick for PCR DNA (Promega). Lane 1, without
(His).sub.6MazE and MazF(His).sub.6; lane 2, with 0.66 .mu.M
MazF(His).sub.6; and lane 3, with 0.9 .mu.M (His).sub.6MazE and
0.66 .mu.M MazF(His).sub.6, the ratio of (His).sub.6MazE to
MazF(His).sub.6 was 1.2:1.
[0356] FIG. 4A shows toeprinting of the mazG mRNA in the presence
of MazF. The mRNAs were synthesized in vitro from a 173-bp DNA
fragment containing a T7 promoter using T7 RNA polymerase. The DNA
fragment (T7 promoter and the mazG mRNA from +1 to +153) was
obtained by PCR amplification using pET-11a-MazG plasmid DNA. Lane
1, without MazF(His).sub.6 and 70S ribosome; lane 2, with 2.6 .mu.M
MazF(His).sub.6 and no 70S ribosome; lane 3, with 0.5 .mu.M 70S
ribosome and no MazF(His).sub.6 and lanes 4 to 8, with 0.5 .mu.M
70S ribosome and 0.35 .mu.M, 0.7 .mu.M, 1.4 .mu.M, 2.1 .mu.M and
2.6 .mu.M MazF(His).sub.6, respectively. FIG. 4B reveals
toeprinting of the mazG mRNA after phenol extraction. The
experiment was performed in the same manner as described in lane 1
and lane 2 of FIG. 4A, except that reaction products were phenol
extracted to remove proteins before primer extension. Lane 1,
without MazF(His).sub.6 and lane 2, with 2.6 .mu.M MazF(His).sub.6.
FIG. 4C illustrates the effect of MazE on MazF cleavage of mazG
mRNA. Lane 1, without MazF(His).sub.6 and (His).sub.6MazE; lane 2,
with 8.8 .mu.M (His).sub.6MazE; lane 3, with 2.2 .mu.M
MazF(His).sub.6 and lanes 4 to 7, with 2.2 .mu.M MazF(His).sub.6
and the ratios of (His).sub.6MazE to MazF(His).sub.6 were 0.25,
0.4, 0.8 and 1.0, respectively. FIG. 4D shows the effect of MazF on
cellular mRNAs in vivo. Total cellular RNA was extracted from E.
coli BW25113 cells containing pBAD-MazF at various time points
after the addition of arabinose (as indicated) and subjected to
Northern blot analysis using radiolabeled ompA and lpp ORF DNA as
probes.
[0357] FIG. 5 demonstrates the effect of kasugamycin on polysome
profile. Experiments were carried out as described above. Ribosome
patterns were detected by OD.sub.260 and the gradient was run from
left (40%) to right (5%). The positions of 70, 50 and 30S ribosomes
are indicated.
[0358] FIG. 6 shows the inhibition of MazF cleavage of the mazG
mRNA by ribosomes. The reaction was carried out as described above.
Lane 1, without MazF(His).sub.6 and 70S ribosomes; lane 2, with 2.6
.mu.M MazF(His).sub.6 but no 70S ribosomes; lane 3, with 0.5 .mu.M
70S ribosomes but no MazF(His).sub.6; lane 4, mazG mRNA and 70S
ribosomes were incubated at 37.degree. C. for 10 minutes and 2.2
.mu.M MazF(His).sub.6 was then added to the mixture for another 10
minutes at 37.degree. C. prior to primer extension; lane 5, 70S
ribosomes and MazF(His).sub.6 were first mixed and incubated at
37.degree. C. for 10 minutes before addition of the mazG mRNA and
an additional 10 minute incubation at 37.degree. C. followed by
primer extension; lane 6, after the mazG mRNA and MazF(His).sub.6
were mixed and incubated at 37.degree. C. for 10 minutes, 70S
ribosomes were added to the mixture, which was incubated at
37.degree. C. for another 10 minutes before primer extension. FL,
the full-length mazG mRNA; TP(s), a paused site due to a secondary
structure; TP(F), the toeprint site due to MazF cleavage; and
TP(r), the toeprint site due to ribosome binding to the mazG
mRNA
[0359] FIG. 7 illustrates the effect of the GGAG to UUUG mutation
of the Shine-Dalgarno sequence of the mazG mRNA on MazF function.
The reaction was carried out as described above. Lanes 1 to 4, with
wild-type mazG mRNA; lanes 5 to 8, with a mutant mazG mRNA having
the GGAG to UUUG mutation at the Shine-Dalgarno sequence. Lanes 1
and 5, without MazF(His).sub.6 and 70S ribosomes; lanes 2 and 6,
with 2.6 .mu.M MazF(His).sub.6 but without 70S ribosomes; lanes 3
and 7, with 0.5 .mu.M 70S ribosomes but without MazF(His).sub.6 and
lanes 4 and 8, with 0.5 .mu.M 70S ribosomes plus 2.2 .mu.M
MazF(His).sub.6. Notations of the markers at the left-hand side are
the same as in FIG. 6.
[0360] FIG. 8 shows the effect of mutations at the initiation codon
of the mazG mRNA on MazF function. The reaction was carried out as
described above. Lanes 1 to 4, with the wild-type mazG mRNA; lanes
5 to 8, with a mutant mazG mRNA whose initiation codon was changed
to GUG; lanes 9 to 12, with a mutant mazG mRNA whose initiation
codon was changed to AGG. Lanes 1, 5 and 9, without MazF(His).sub.6
and 70S ribosomes; lanes 2, 6 and 10, with 2.6 .mu.M
MazF(His).sub.6 but without 70S ribosomes; lanes 3, 7 and 11, with
0.5 .mu.M 70S ribosomes but without MazF(His).sub.6; and lanes 4, 8
and 12, with 0.5 .mu.M 70S ribosomes plus 2.2 .mu.M
MazF(His).sub.6. Notations of the markers at the left-hand side are
the same as in FIG. 6.
[0361] FIG. 9 reveals the effects of mutations at the UACAU
(U.sub.1A.sub.2C.sub.3A.sub.4U.sub.5) cleavage sequences on MazF
function. The reaction mixture was carried out as described above.
Lanes 1 and 2 are with wild-type mazG mRNA as a control. All the
mutations are indicated by the arrow. Lanes 1, 3, 5, 7, 9, 11, 13,
15, 17, 19, 21, 23, 25, 27, 29 and 31, without MazF(His).sub.6;
lanes 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 and
32, with 2.6 .mu.M MazF(His).sub.6. Notations of the markers at the
left-hand side are the same as in FIG. 6.
[0362] FIG. 10 shows the effect of MazF and MazE on the cleavage of
16S and 23S rRNA. The reaction was carried out in 10 mM Tris-HCl
(pH 7.8) containing 10 mM MgCl.sub.2, 60 mM NH.sub.4Cl, 1 mM DTT,
0.5 .mu.l human placenta RNase inhibitor (Roche), 5.6 .mu.M
MazF(His).sub.6 and/or 17.6 .mu.M (His).sub.6MazF and in a total
volume of 10 .mu.l. After incubating at 37.degree. C. for 10
minutes, 2 .mu.l of loading buffer was added to stop the reaction.
The sample was analyzed on a 3.5% acrylamide gel. Lane 1, without
MazF(His).sub.6; lane 2, with 5.2 .mu.M MazF(His).sub.6; lane 3,
with 17.6 .mu.M (His).sub.6MazF; and lane 4, with 5.2 .mu.M
MazF(His).sub.6 and 17.6 .mu.M (His).sub.6MazE. The positions of
23S and 16S rRNA and tRNA are indicated by the arrows.
[0363] Results
[0364] The mazF gene was cloned into an arabinose inducible pBAD
plasmid (Guzman et al., J Bacteriol 177, 4121-30 (1995)). E. coli
BW25113 carrying pBAD-MazF did not grow on a glycerol-M9 plate in
the presence of arabinose (0.2%) (See FIG. 1A). The arabinose
sensitivity was eliminated (FIG. 1A) when either Arg29 or Arg86,
highly conserved residues among MazF homologues, was replaced with
Ser or Gly, respectively (FIG. 1B). This result indicated that the
cell growth inhibition observed was due to the presence of
wild-type MazF. In liquid medium, cell viability was reduced by
10.sup.4 after the addition of arabinose for a period of 5
minutes.
[0365] To identify the cellular function inhibited by MazF, a
cell-free system prepared from E. coli BW25113 carrying pBAD-MazF
permeabilized by toluene treatment was used (Halegoua et al., J
Bacteriol 126, 183-91 (1976); Halegoua et al., Eur J Biochem 69,
163-7 (1976). ATP-dependent .sup.35S-methionine incorporation was
completely inhibited when cells were preincubated for 10 minutes in
the presence of arabinose before toluene treatment (FIG. 2A). The
incorporation of [.alpha.-.sup.32P]dTTP (Moses and Richardson, Proc
Natl Acad Sci USA 67, 674-81 (1970)) (FIG. 2B) and
[.alpha.-.sup.32P]UTP (Peterson et al., J Bacteriol 107, 585-8
(1971)) (FIG. 2C), however, was not affected under similar
conditions. These results demonstrated that MazF inhibits protein
synthesis, but not DNA replication or RNA synthesis. The in vivo
incorporation of .sup.35S-methionine (Hirashima and Inouye, Nature
242, 405-7 (1973) was dramatically inhibited after the addition of
arabinose using cells not treated with toluene (FIG. 2D). SDS-PAGE
analysis of total cellular protein synthesis at different time
points after arabinose addition (FIG. 2E) showed that MazF is a
general inhibitor of protein synthesis, which affects essentially
all cellular proteins. Interestingly, the synthesis of larger
proteins was more susceptible to MazF toxicity than that of smaller
proteins.
[0366] Analysis of the polysome pattern of E. coli BW25113 cells
carrying pBAD-MazF cells was performed by sucrose density gradient
after 10 minutes of arabinose induction. As shown in FIG. 3A, the
polysomes completely disappeared in such cells, with a concomitant
increase of the 70S ribosomal fraction and no significant change in
either the 30S or the 50S ribosomal fraction. A similar change in
the polysome pattern was observed when cells were treated, with
kasugamycin, an antibiotic that inhibits translation initiation
(FIG. 5). These findings suggest that MazF causes the release of
ribosomes from mRNA either by inhibiting translation initiation or
by degrading mRNA.
[0367] The effect of purified MazF(His).sub.6 on the synthesis of a
candidate protein, MazG, was also examined in an E. coli cell-free
RNA/protein synthesis system. MazF(His).sub.6 was purified from
cells co-expressing both MazE and MazF(His).sub.6. The synthesis of
MazG (30 kD) (Hirashima and Inouye, Nature 242, 405-7 (1973)) from
plasmid pET-11a-MazG was carried out at 37.degree. C. for 1 hr
using an E. coli T7 S30 extract system (Promega) in the absence and
presence of increasing concentrations of MazF(His).sub.6 (FIG. 3B).
MazG synthesis was completely blocked at MazF(His).sub.6
concentrations above 231 nM. The effect of MazE antitoxin on this
observed MazF-mediated inhibition of MazG synthesis was also
assessed in parallel. Interestingly, the co-addition of the
antitoxin (His).sub.6MazE rescued MazG synthesis in a
dose-dependent manner (FIG. 3B). MazF(His).sub.6 was also able to
inhibit eukaryotic cell-free protein synthesis (FIG. 3C, lane 2),
which was also recovered upon co-addition of (His).sub.6MazE (lane
3).
[0368] Since MazF inhibited MazG synthesis (FIG. 3B), an analysis
of the timing of inhibition was executed. To determine if the
inhibition affected the translation initiation step, toeprinting
(TP) techniques were utilized using 70S ribosomes and the mazG mRNA
(Moll and Blasi, Biochem Biophys Res Commun 297, 1021-1026 (2002)).
Toeprinting of the mazG mRNA alone yielded the full-length band
(FL) and band TP(s) presumably due to a secondary structure at the
5' end of the mazG mRNA (FIG. 4A, lane 1). In the presence of 70S
ribosomes, the toeprinting band [TP(r)] downstream of the
initiation codon was detected (lane 3). When MazF(His).sub.6 was
added together with 70S ribosomes, a new band TP(F) appeared, which
corresponded to the region between the Shine-Dalgarno (SD) sequence
and the initiation codon (lanes 4-8). With increasing
MazF(His).sub.6 concentrations, the TP(r) band intensities were
gradually reduced, and at 3.75 .mu.M MazF(His).sub.6, the TP(r)
band almost completely disappeared (lane 7).
[0369] Surprisingly, the TP(F) band was detected even in the
absence of 70S ribosomes (lane 2), indicating that MazF was able to
bind to the mRNA independent of 70S ribosomes or alternatively that
MazF is an endoribonuclease cleaving between A and C residues (FIG.
4A).
[0370] To differentiate between these possibilities, the mazG mRNA
was incubated with MazF(His).sub.6, phenol-extracted to remove
protein, and used for primer extension as shown in FIG. 4B. The
TP(F) band was also observed even after phenol extraction (lane 2),
indicating that MazF(His).sub.6 indeed cleaved the mazG mRNA. The
cleavage of the mazG mRNA was again blocked when MazE was co-added
(FIG. 4C, lanes 4-7). Note that (His).sub.6MazE alone had no
detectable effect on the mRNA (lane 2). This result indicated that
the antitoxic effect of MazE was due to an inhibition of MazF
endoribonuclease activity. The addition of 70S ribosomes before
MazF(His).sub.6 inhibited mRNA cleavage by MazF(His).sub.6 probably
because the SD sequence and the ACA sequence in the mazG mRNA are
closely located (FIG. 6). In contrast, the toxic function of RelE
requires ribosomes (Pedersen et al., supra, (2003)).
[0371] Table T shows the MazF cleavage sequences in different mRNA
transcripts examined. [0372] The conserved cleavage sequences are
underlined.
TABLE-US-00001 [0372] Gene Name Sequence yeeW A A T G A T G A C A C
T G G A A G G T C G T T G A C A T T G A T G G EnvZ A T C T C G A A
C A C G C A G C C lacZ T C G T T T T A C A C C C T T G A
[0373] (YeeW first line: SEQ ID NO: 84; YeeW second line: SEQ ID
NO: 90; EnvZ: SEQ ID NO: 91; lacZ: SEQ ID NO: 92) In order to
determine the specificity of MazF cleavage, the mazG-mRNA SD
sequence was mutated from GGAG to UUUG, and the AUG initiation
codon to GUG or AGG. None of these mutations affected mazG mRNA
cleavage by MazF(His).sub.6 (FIGS. 7 and 8). When mRNA for yeeW,
envZ and lacZ were used as substrates, each was cleaved at the
expected ACA sequences in the mRNA transcripts independent of the
SD sequence and the initiation codon (Table I). In these mRNAs, the
ACA sequences are flanked by G, A or T at the 5' end and by C or T
at the 3' end. In view of this finding, a mazG mRNA having the
UACAU sequence at the cleavage site was mutated such that the U
residues at the 5' and 3' ends were mutated to G, A, or C. None of
these mutations had any effect on the cleavage (FIG. 9). However,
when the central ACA sequence was changed to GCA, CCA, TCA; AGA,
ATA, AAA; ACC, ACG or ACT, no cleavage was observed (FIG. 9),
indicating that MazF is a highly sequence specific endoribonuclease
recognizing the ACA sequence.
[0374] In summary, the above results indicate that MazF functions
as a highly sequence-specific endoribonuclease, which cleaves
cellular mRNAs at ACA sites and thereby blocks whole protein
synthesis in the cell (FIG. 2E). To further test this finding,
Northern blot analysis was performed using total cellular RNA
extracted at different time intervals (Baker and Mackie, Mol
Microbial 47, 75-88 (2003); Sarmientos et al., Cell 32, 1337-46
(1983)) after arabinose induction of MazF. Both ompA and lpp mRNAs
were degraded (FIG. 4C). The observed differences in the half-lives
of these two mRNAs correlated with the total number of ACA
sequences present in the mRNA and to the mRNA length. The 322 bp
lpp mRNA (Nakamura and Inouye, Cell 18, 1109-17 (1979)), for
example, has only one ACA sequence, while the 1229 bp ompA mRNA
(Movva et al., J Mol Biol 143, 317-28 (1980)) has twenty-one ACA
sequences. This correlation suggests that longer mRNAs may be more
sensitive than smaller mRNAs to cleavage mediated by MazF.
[0375] Interestingly, within the mazF ORF there are a total of nine
ACA sequences, four of which are clustered in the middle of the
ORF, suggesting that mazF expression may be negatively
autoregulated by its own gene product. It should also be noted that
MazF(His).sub.6 was capable of cleaving 16S and 23S rRNA to smaller
fragments, but not in the presence of (His).sub.6MazE (FIG.
10).
[0376] In conclusion, MazF is a novel endoribonuclease which
specifically inhibits mRNA function by cleaving at the unique
triplet sequence, ACA. Because of its ability to interfere with
mRNA function, this category of endoribonuclease is designated
herein as an "mRNA interferase". As underscored by the results
presented herein, additional mRNA interferases having different
sequence specificities are likely to exist.
[0377] In addition to the newly discovered category of
endoribonucleases, there are several other mechanisms known to
effect interference of mRNA function. One such mechanism involves
micRNA (mRNA-interfering-complementary RNA), which was originally
characterized as an RNA repressor for specific gene expression in
E. coli (Mizuno et al, Proc Natl Acad Sci USA 81, 1966-70 (1984)).
More recently, similar RNA elements have been discovered in
eukaryotes as miRNA (Zeng and Cullen, Rna 9, 112-23 (2003) and
siRNA (Billy et al., Proc Natl Acad Sci USA 98, 14428-33 (2001)).
The intriguing possibility exists that this new mechanism of
disrupting mRNA function by mRNA interferases, as demonstrated for
E. coli in the present study, may also pertain to eukaryotes. This
would have numerous implications for the cellular physiology of
many, if not all, living organisms. Furthermore, highly
sequence-specific mRNA interferases may be used as therapeutic
tools for treating human diseases, as well as biochemical tools for
structural studies of RNA. Notably, the crystal structure of the
2:4 MazE/MazF complex was recently published (Kamada et al., Mol
Cell 11, 875-884 (2003)). The information garnered from the crystal
structure may assist in the determination of how MazF specifically
recognizes an ACA sequence and cleaves it.
Example II
[0378] Of note, prior to the discovery of the present invention,
the cellular target(s) of MazF had not been identified. As shown
herein, MazF functions as a highly sequence-specific
endoribonuclease, which cleaves cellular mRNAs at ACA sites. Such
activity may effectuate a partial or total inhibition of protein
synthesis in a cell. The predicted frequency of an ACA sequence in
an RNA transcript is one in 64, based on standard calculations
predicated on an equal probability that any one of the four
nucleotides will be incorporated at each one of the three
nucleotide positions. It is to be understood that some RNA
transcripts comprise a lower or higher frequency of ACA sequences
as compared to the predicted frequency. Accordingly, the
sensitivity of a specific RNA transcript or a family of related RNA
transcripts to cleavage by a MazF endoribonuclease is dependent
upon the frequency of ACA sequences or MazF target sequences in the
transcript. Moreover, one of ordinary skill in the art could
predict, based on the sequence of an RNA transcript, the
sensitivity of the transcript to MazF mediated cleavage.
Example III
[0379] As described above, programmed cell death is proposed to be
mediated in E. coli through "addiction module" systems, each of
which consists of a pair of genes encoding a stable toxin and an
unstable antitoxin which are co-expressed. Their expression is
auto-regulated either by a toxin/antitoxin complex or by antitoxin
alone. When co-expression is inhibited, the antitoxin is rapidly
degraded by protease, enabling the toxin to act on its target. In
E. coli, extrachromosomal elements are the main genetic system for
bacterial programmed cell death. The most studied extrachromosomal
addiction modules are the phd-doc on bacteriophage P1 (Lehnherr et
al. (1993) J Mol Biol 233, 414-428; Lehnherr and Yarmolinsky (1995)
Proc Natl Acad Sci USA 92, 3274-3277; Magnuson and Yarmolinsky
(1998) J Bacteriol 180, 6342-6351; Gazit and Sauer (1999) J Biol
Chem 274, 16813-16818; Gazit and Sauer (1999) J Biol Chem 274,
2652-2657), the ccdA-ccdB on factor F (Tam and Kline (1989) J
Bacteriol 171, 2353-2360; Van Melderen et al. (1994) Mol Microbiol
11, 1151-1157; Bahassi et al. (1999) J Biol Chem 274, 10936-10944;
Loris et al. (1999) J Mol Biol 285, 1667-1677; Afif et al. (2001)
Mol Microbiol 41, 73-82; Dao-Thi et al. (2002) J Biol Chem 277,
3733-3742; Van Melderen (2002) Int J Med Microbiol 291, 537-544),
and the pemI-pemK on plasmid R100 (Tsuchimoto et al. (1988) J
Bacteriol 170, 1461-1466; Tsuchimoto and Ohtsubo. (1989) Mol Gen
Genet 215, 463-468; Tsuchimoto et al. (1992) J Bacterial 174,
4205-4211; Tsuchimoto and Ohtsubo. (1993) Mol Gen Genet 237, 81-88.
Interestingly, the E. coli chromosome also contains several
addiction module systems, such as the relBE system and the mazEF
system, which are described hereinabove.
[0380] The mazEF system, which consists of two adjacent genes, mazE
and mazF, is located downstream from the relA gene on the E. coli
chromosome. Sequence analysis revealed that they are partly
homologous to the pemI and pemK genes on plasmid pR100 (Masuda et
al. (1993) J Bacteriol 175, 6850-6856). As described above, the
mazEF system exhibits properties of an addiction module: MazF is
toxic and MazE is antitoxic; MazF is stable, while MazE is a labile
protein degraded in vivo by the ATP dependent ClpPA serine protease
(Aizenman et al. (1996) supra); MazE and MazF are coexpressed and
interact with each other to form a complex; and the expression of
mazEF is negatively auto-regulated by MazE and the MazF-MazF
complex (Marianovsky et al. (2001) J Biol Chem 276, 5975-5984). As
described hereinabove, mazEF-mediated cell death can be triggered
by extreme amino acid starvation and thymine starvation (Sat et al.
(2003) supra), by toxic protein Doc (Hazan et al. (2001) J
Bacteriol 183, 2046-2050), and by some antibiotics that are general
inhibitors of transcription and/or translation, such as rifampicin,
choramphenicol, and spectinomycin) (Sat et al. (2001) supra).
[0381] As described hereinbelow, the interactions between MazE,
MazF, and the mazEF promoter DNA were investigated to identify the
functional domains in MazF, responsible for binding to the mazEF
promoter DNA and for interacting with MazF. It is demonstrated that
MazE has a DNA-binding domain in its N-terminal region, and that
the region from residue 38 to 75 in MazE is required for binding to
MazF, of which Leu55 and Leu58 residues are essential. The data
presented herein also suggest that the MazE-MazF complex in
solution can comprise one MazE dimer and two MazF dimers.
[0382] Methods and Materials
[0383] Reagents and Enzymes--
[0384] Nucleotides, ampicillin and kanamycin were from Sigma. The
restriction enzymes and DNA modifying enzymes used for cloning were
from New England
[0385] Biolabs. Pfu DNA polymerase was from Stratagene. The
radioactive nucleotides were from Amersham Pharmacia Biotech.
[0386] Constructions of Plasmid--
[0387] The mazEF gene (including its Shine-Dalgarno sequence
region) was amplified by PCR using E. coli genomic DNA as template,
and cloned into the XbaI-NheI sites of pET11a, creating the plasmid
pET11a-EF. The mazEF gene (including its Shine-Dalgarno sequence
region) was amplified by PCR, and cloned into the XbaI-XhoI sites
of pET21 cc to create an in-frame translation with a (His).sub.6
tag at the MazF C-terminus. The plasmid was designated as pET21
cc-EF(His).sub.6. The mazE gene was amplified by PCR and cloned
into the NdeI-Hind III sites of pET28a. This plasmid was designated
as pET28a-(His).sub.6E. MazE was expressed as a fusion with an
N-terminal (His).sub.6 tag (designated (His).sub.6MazE) followed by
a thrombin cleavage site. The full-length mazE gene and various
N-terminal and C-terminal deletion constructs of the mazE gene (See
FIG. 17), were generated by PCR and cloned into EcoRI-PstI sites of
pGAD-C1 vector to create in-frame translation fusions with the Gal4
transcriptional activation domain. These plasmids were designated
as pGAD-MazE, pGAD-MazE.DELTA.(1-13), pGAD-MazE.DELTA.(1-24),
pGAD-MazE.DELTA.(1-37), pGAD-MazR.DELTA.(1-46), pGAD
MazR.DELTA.(68-82) and pGAD-MazE.DELTA.(76-82).
[0388] The full-length mazF gene and various N-terminal and
C-terminal deletion constructs of the mazF gene were generated by
PCR and cloned into EcoRI-BglII sites of pGBD-C1 vector to create
in-frame translation fusions with the Gal4 DNA binding domain.
These plasmids were designated as pGBD-MazF,
pGBD-MazF.DELTA.(1-14), pGBD-MazF.DELTA.(1-25),
pGBD-MazF.DELTA.(72-111) and pGBD-MazF.DELTA.(97-111).
[0389] Protein Purification--
[0390] pET11a-EF was introduced into E. coli BL21(DE3) strain. The
coexpression of MazE and MazF was induced for 4 h in the presence
of 1 mM isopropyl-.beta.-thiogalactopyranoside (IPTG). The cells
were harvested by centrifugation and lysed using a French press.
The cell lysate was maintained at 37.degree. C. for 30 minutes to
degrade MazE maximally, and cell debris and unlysed cells were
pelleted by centrifugation 8,000.times.g for 10 minutes followed by
ultracentrifugation at 10,000.times.g for 1 hour to remove membrane
and insoluble fractions. MazF was subsequently purified by ammonium
sulfate fractionation, gel filtration on Sephadex G-100 column,
DEAE-Sepharose and hydroxyapatite column chromatography. The
fractions containing MazF protein were pooled and concentrated.
MazF was further purified by gel filtration with a Superdux.TM. 200
column (Pharmacia Biotech).
[0391] For purification of (His).sub.6MazE, pET28a-(His).sub.6E was
introduced into E. coli BL21(DE3) strain, and (His).sub.6MazE
expression was induced with 1 mM IPTG for 4 hours. (His).sub.6MazE
protein was immediately purified by Ni-NTA (QIAGEN) affinity
chromatography.
[0392] pET21 cc-EF(His).sub.6 was also introduced into E. coli
BL21(DE3) strain. Coexpression of MazE and MazF(His).sub.6 was
induced in the presence of 1 mM IPTG for 4 hours. The
MazE-MazF(His).sub.6 complex was immediately purified by Ni-NTA
(QIAGEN) affinity chromatography, and further purified by gel
filtration. To purify MazF(His).sub.6 from the purified
MazE-MazF(His).sub.6 complex, MazE in the purified
MazE-MazF(His).sub.6 complex was dissociated from MazF(His).sub.6
in 6M guanidine-HCl. MazF(His).sub.6 was retrapped by Ni-NTA resin
(QIAGEN) and refolded by step-wise dialysis. The yield of refolding
is approximately 80%. The biochemical activity of MazF(His).sub.6
was determined with E. coli T7 S30 extract system (Promega) for the
protein synthesis inhibition.
[0393] Electrophoretic Mobility Shift Assays (EMSA)--
[0394] Two single-stranded oligonucleotides
5'-GCTCGTATCTACAATGTAGATTGATATATACTGTATCTACATATGATAGC-3' (SEQ ID
NO: 12) and
3'-CGAGCATAGATGTTACATCTAACTATATATGACATAGATGTATACTATCG-5' (SEQ ID
NO: 13) were synthesized and annealed to generate the 50-bp
double-stranded DNA containing the mazEF promoter sequence. The
50-bp DNA fragment was end-labeled by T4 polynucleotide kinase with
[.gamma.-.sup.32P]ATP and used to detect the protein-DNA binding by
EMSA. Binding reactions (20 .mu.l) were carried out at 4.degree. C.
for 30 minutes with purified proteins, 2 .mu.l 100 .mu.g/ml
poly(dI-dC) and 2 .mu.l labeled DNA fragment in the binding buffer
[50 mM Tris-HCl (pH 7.5), 5 mM MgCl.sub.2, 1 mM dithiotheritol and
5% glycerol]. Electrophoresis was performed in TAE buffer at 100 V
in 6% native polyacrylamide gel. After electrophoresis, the gel was
dried and then exposed to X-ray film.
[0395] Native PAGE--
[0396] Different amounts of (His).sub.6MazE and MazF were mixed in
binding buffer [50 mM Tris-HCl (pH 7.5), 5 mM MgCl.sub.2, 1 mM
dithiotheritol and 5% glycerol] at 4.degree. C. for 30 minutes, and
then 2.times. loading solution [40 mM Tris-HCl (pH7.5), 80 mM
.beta.-mercaptoethanol, 0.08% bromophenol blue and 8% glycerol] was
added to the mixtures before loading on a native gel. The
composition of the stacking gel was 5% acrylamide-bis(29:1) in 62.5
mM Tris-HCl (pH 7.5), and the composition of the separation gel was
10% acrylamide-bis (29:1) in 187.5 mM Tris-HCl (pH8.9). The running
buffer contained 82.6 mM Tris-HCl (pH 9.4) and 33 mM glycine.
Electrophoresis was performed at constant voltage (150 V) at
4.degree. C. Protein bands were visualized by Coomassie brilliant
blue.
[0397] Resolution of Low Molecular Weight Proteins by Tricine
SDS-PAGE--
[0398] Tricine SDS-PAGE was carried out according to the method
described previously (Schagger and von Jagow, G. (1987) Anal
Biochem 166, 368-379) with some modifications as following:
stacking gel, 5% acrylamide-bis(48:1.5) in 0.75 M Tris-HCl (pH
8.45) and 0.075% SDS; spacer gel, 10% acrylamide-bis(48:1.5) in 1.0
M Tris-HCl (pH 8.45) and 0.1% SDS; resolving gel: 16.5%
acrylamide-bis(48:1.5) in 1.0 M Tris-HCl (pH 8.45) and 0.1% SDS.
The anode running buffer was 0.2 M Tris-HCl (pH 8.9), and the
cathode running buffer was 0.1 M Tris base, 0.1 M tricine and 0.1%
SDS. After running the gel at constant current (20 mAmp) at room
temperature, protein bands were visualized by Coomassie brilliant
blue.
[0399] Assays of MazE-MazF Interaction in the Yeast Two-Hybrid
System--
[0400] The yeast two-hybrid reporter strain PJ69-4A [MATa trp1-901
leu2-3,112 ura3-52 his3-200 gal4 gal80LYS2::GAL1-HIS3 GAL2-ADE2
met::GAL7-lacZ] and vectors pGAD-C1 and pGBD-C1 were was used for
two-hybrid assays (James et al. (1996) Genetics 144, 1425-1436). In
order to localize the MazF-binding region in MazE, a series of N-
and C-terminal deletions of the mazE gene were constructed in
pGAD-C1, and cotransformed with the pGBD-MazF plasmid into the
PJ69-4A cells. See FIG. 17. In order to localize the MazE-binding
region in MazF proteins, a series of N- and C-terminal deletions of
the mazF gene were constructed in pGBD-C1, and cotransformed with
the pGAD-MazE plasmid into the PJ69-4A cells. Assays of the
interactions were performed by monitoring growth of cotransformants
on synthetic dropout (SD) minimal medium (Clontech) lacking Trp,
Leu, His and adenine (Ade). The medium was supplemented with 1 mM
3-amino-1,2,4-triazole (3-AT) and incubated at 30.degree. C. for 5
days.
[0401] Specific Methodological Details Pertaining to Drawings
[0402] In FIG. 11, the lanes were loaded as follows: Lane 1,
protein molecular weight markers; lane 2, MazE-MazF(His).sub.6
complex; lane 3, MazF; and lane 4, (His).sub.6MazE.
[0403] In FIGS. 12A and 12B, (His).sub.6MazE and MazF were mixed at
the indicated molar ratios. The mixtures were incubated for 30
minutes at 4.degree. C., and then subjected to native PAGE. The gel
corresponding to the band of the complex was excised and incubated
in reducing buffer [20 mM Tris-HCl (pH 7.5), 100 mM NaCl and 50 mM
.beta.-ME] for 30 minutes at room temperature and subjected to 15%
SDS-PAGE for second dimensional electrophoresis. (His).sub.6MazE
and MazF in the complex were separated as shown in the gels in the
lower panel. Relative protein amounts in each lane were determined
by densitometry with (His).sub.6MazE and MazF as controls. In FIG.
12A, different amounts of (His).sub.6MazE were added to 20-.mu.l of
a 2 .mu.M MazF solution. Lanes 1-5, the (His).sub.6MazE:MazF ratios
are 1:1, 2:1, 4:1, 6:1 and 8:1, respectively. In FIG. 12B,
different amounts of MazF were added to 20-.mu.l of a 2 .mu.M
(His).sub.6MazE solution. Lanes 1-5, the (His).sub.6MazE:MazF
ratios are 1:1, 1:2, 1:4, 1:6 and 1:8, respectively. The upper
panels in FIG. 12A and FIG. 12B show the results of native PAGE.
The position of the (His).sub.6MazE-MazF complex is indicated by an
arrow a. The lower panels in FIG. 12A and FIG. 12B show the results
of SDS-PAGE for the second dimensional electrophoresis. Purified
(His).sub.6MazE (40 pmol) and MazF (40 pmol) were applied to the
first and the second lanes as controls.
[0404] In FIG. 13, the molecular masses of MazF and the
MazF-MazF(His).sub.6 complex were determined by gel filtration with
a Superdex 200 column. The protein molecular weight standard curve
includes Thyroglobulin (669 kDa), Apoferritin (443 kDa),
.beta.-Amylase (200 kDa), BSA (66 kDa), Ovalbumin (45 kDa) and
Carbonic Anhydrase (29 kDa). The vertical arrows on the standard
curve indicate the positions of MazF and the MazE-MazF(His).sub.6
complex.
[0405] In FIGS. 14A, 14B, and 14C, a 50-bp [.sup.32P]-labeled DNA
fragment containing the mazEF promoter region was incubated with
increasing concentrations of (His).sub.6MazE (FIG. 14A), with
increasing concentrations of MazF (FIG. 14B), or with increasing
concentrations of both (His).sub.6MazE and MazF at the constant
(His).sub.6MazE/MazF ratio of 1:2 (FIG. 14C).
[0406] In FIG. 15, the ClustalW program was used for alignment
analysis. Identical residues among eight different proteins are
shown by black boxes. Similar residues are indicated by gray boxes.
Gaps (indicated by dashes) are introduced to optimize the
alignment. The sequences are: MazF, in Deinococcus radiodurans
(GenBank Accession No. NP.sub.--294139); MazE in Bacillus
halodurans (GenBank Accession No. NP.sub.--244587); PemI on plasmid
R100 (GenBank Accession No. NP.sub.--052993); PemI on plasmid R466b
(GenBank Accession No. AAC82515); MazE in Escherichia coli (GenBank
Accession No. NP.sub.--289337); ChpB in Escherichia coli (GenBank
Accession No. NP.sub.--290856); MazE in Pseudomonas putida KT2440
(GenBank Accession No. NP.sub.--742931); MazE in Photobacterium
profundum (GenBank Accession No. AAG34554). The numbers correspond
to amino acid residue position.
[0407] In FIGS. 16A and 16B, DNA binding of the proteins was
determined by EMSA with a 50-bp [.sup.32P]-labeled DNA fragment
containing the mazEF promoter region. In FIG. 16A, the DNA fragment
was incubated with 1 .mu.M of each complex as indicated in a
20-.mu.l mixture at 4.degree. C. for 30 minutes. Lane 1, control
without protein; lane 2, MazE-MazF(His).sub.6 complex; lane 3,
MazE(K7A)-MazF(His).sub.6 complex; lane 4,
MazE(R8A)-MazF(His).sub.6 complex; lane 5,
MazE(S12A)-MazF(His).sub.6 complex; lane 6,
MazE(R16A)-MazE(His).sub.6 complex; lane 7,
MazE(I43N)-MazF(His).sub.6 complex; and lane 8,
MazE(E57Q)-MazF(His).sub.6 complex. In FIG. 16B, the DNA fragment
was incubated with 4 .mu.M (His).sub.6MazE or (His).sub.6MazE
mutant as indicated in a 20-.mu.l mixture at 4.degree. C. for 30
minutes. Lane 1, control without protein; lane 2, wild-type
(His).sub.6MazE protein; lane 3, (His).sub.6MazE(K7A) mutant; lane
4, (His).sub.6MazE(R8A) mutant; lane 5, (His).sub.6MazE(S12A)
mutant; and lane 6, (His).sub.6MazE(R16A) mutant.
[0408] In FIG. 17, the full-length mazE gene and the truncated mazE
genes were constructed in pGAD-C1. Numbers refer to the amino acid
positions in MazE. The plasmids were cotransformed with pGBD-MazF
into yeast PJ69-4A cells. Protein-protein interactions were tested
on SD medium (Clontech) plates containing 1 mM 3-AT in the absence
of Trp, Leu, His and Ade. +, indicates visible colonies formed in 5
days; -, indicates no visible colonies formed in 5 days.
[0409] In FIG. 18A, interactions between MazF and (His).sub.6MazE
or (His).sub.6MazE mutants were determined by native PAGE. Lane 1,
wild-type (His).sub.6MazE; lane 2, MazF; lane 3, wild-type
(His).sub.6MazE and MazF; lane 4, (His).sub.6MazE L55A/L58A mutant
and MazF; lane 5, (His).sub.6MazE R48A mutant and MazF; lane 6,
(His).sub.6MazF E57Q mutant and MazF; and lane 7, (His).sub.6MazE
F53A mutant and MazF.
[0410] In FIG. 18B, interactions between MazF and (His).sub.6MazE
or (His).sub.6MazE L55A/L58A mutant were determined by EMSA with
the 50-bp [.sup.32P]-labeled DNA fragment containing the mazEF
promoter region. Lane 1, control without protein; lane 2, 4 .mu.M
wild-type (His).sub.6MazE; lane 3, 4 .mu.M (His).sub.6MazE
L55A/L58A mutant; lane 4, 2 .mu.M wild-type (His).sub.6MazF, and 4
.mu.M MazF; and lane 5, 2 .mu.M (His).sub.6MazE L55A/L58A mutant
and 4 .mu.M MazF.
[0411] In FIG. 19, which depicts an X-ray structure of the
MazE-MazF complex, conserved amino acid residues essential for MazE
function(s) are indicated. Only a portion of the
MazF.sub.2-MazE.sub.2-MazF.sub.2 complex is shown, in which one
MazE molecule (blue) is interacting with two MazF molecules of the
MazF homodimer (purple and red). In the MazE molecule, the N-box
and the Hp-box are shown in green and yellow, respectively.
Positions of Lys7, Arg8, Ser12 and Arg16 in the N-box and Leu55 and
Leu58 in the Hp-box are shown. As shown herein, these substitution
mutations which resulted in the loss of MazE function(s).
[0412] Results
[0413] MazE and MazE can Form a Complex in a 1:2 Ratio--
[0414] Tricine SDS-PAGE patterns of purified MazE-MazF(His).sub.6,
MazF and (His).sub.6MazE are shown in FIG. 11, lanes 2, 3 and 4,
respectively. The sizes of (His).sub.6MazE and MazF agree with
theoretical molecular weights of 11.4 kDa and 12.0 kDa,
respectively (FIG. 11, lanes 3 and 4). The MazE-MazF(His).sub.6
complex was separated into 9.3 kDa MazE and 13.2 kDa
MazF(His).sub.6 (FIG. 11, lane 2), and the ratio of MazF(His).sub.6
to MazE was determined to be approximately two (2) using a
densitometer.
[0415] When (His).sub.6MazE and MazF were mixed together and the
mixture was subjected to native PAGE, a new band appeared at a
position a near the top of the gel (position a in FIG. 12). The gel
corresponding to the new band was cut out and incubated in a
reducing buffer [20 mM Tris-HCl (pH 7.5), 100 mM NaCl and 50 mM
.beta.-ME] for 30 minutes at room temperature, and then the gel was
placed on the top of SDS-PAGE gel to run a second dimensional
electrophoresis to analyze the protein components. After staining
the gel with Coomassie brilliant blue, two bands corresponding to
(His).sub.6MazE and MazF were observed, while (His).sub.6MazE moved
slower than MazF on the SDS-PAGE. These results demonstrated that
the new band was complex comprising (His).sub.6MazE and MazF. When
the gel cut from the native PAGE was not treated in the reducing
buffer, three protein bands were observed after it was subjected to
the SDS-PAGE, (His).sub.6MazE, MazF and the MazF dimer (data not
shown). Three bands appeared for the purified MazF on the native
PAGE, but only one peak was observed when the purified MazF protein
was assayed by HPLC (data not shown).
[0416] Additional experiments were performed to determine if the
ratio of (His).sub.6MazE to MazF in the complex was stable. As
shown in FIG. 12A, different amounts of (His).sub.6Maze were added
to identical solutions containing a constant concentration of MazF
(2 .mu.M) to generate a series of solutions in which the
(His).sub.6MazE:MazF ratios varied from 1:1, to 2:1, to 4:1, to
6:1, to 8:1. As shown in FIG. 12B, different amounts of MazF were
also added to identical solutions containing a constant
concentration of (His).sub.6MazE (2 .mu.M) to generate a series of
solutions in which the (His).sub.6MazE:MazF ratio was 1:1, 1:2,
1:4, 1:6 and 1:8. The above mixtures were incubated for 30 minutes
at 4.degree. C. and analyzed by native PAGE. The gel corresponding
to the new band (at position a) was cut out and incubated in the
reducing buffer for 30 minutes at room temperature and subjected to
15% SDS-PAGE. The second dimensional gel was stained with Coomassie
brilliant blue to detect protein bands. Relative protein amounts in
each lane were determined by densitometer using purified
(His).sub.6MazE and MazF as controls. The ratios of MazF to
(His).sub.6MazE in the complex were maintained almost constant at
1.8 when (His).sub.6MazE or MazF was added in excess in the
mixtures (FIG. 12). As mentioned above, the MazE-MazF(His).sub.6
complex was separated to MazE and MazF(His).sub.6 by tricine
SDS-PAGE, and the ratio of MazF(His).sub.6 to MazE was
approximately 2 (FIG. 11, lane 2). The molecular masses of the
purified MazE-MazF(His).sub.6 complex and MazF were determined to
be 76.9 kDa and 27.1 kDa by gel filtration with a Superdux.TM. 200
column (Pharmacia Biotech) (FIG. 13). MazF(His).sub.6 was purified
from the MazE-MazF(His).sub.6 complex. MazF(His).sub.6 was able to
inhibit the protein synthesis in an E. coli cell-free system (E.
coli T7 S30 extract system, Promega), and the protein synthesis was
rescued by the co-addition of (His).sub.6MazE (data not shown). The
molecular mass of MazF(His).sub.6 was determined to be 28.3 kDa
with light scattering, suggesting MazF(His).sub.6 exists as dimer.
The structure of MazE has been demonstrated as a dimer (Lah et al.
(2003) J Biol Chem 278, 14101-14111). Therefore, the
MazE-MazF(His).sub.6 complex (76.9 kDa) may consist of one MazE
dimer (predicted to be around 18.6 kDa as the MazE molecular weight
is 9.3 kDa) and two MazF(His).sub.6 dimers (56.6 kDa).
[0417] MazF Enhances MazE Binding to the mazEF Promoter--
[0418] The 50-bp mazEF promoter fragment was prepared as described
herein and end-labeled by T4 polynucleotide kinase with
[.gamma.-.sup.32P]ATP. Using electrophoretic mobility shift assays
(EMSA), (His).sub.6MazE, MazF and MazE-MazF(His).sub.6 complex were
tested separately for their ability to bind to the mazEF promoter
DNA fragment. (His).sub.6MazE was able to shift the mazEF promoter
fragment at a concentration of 2 .mu.M or higher (FIG. 14A, lane
7). At 0.4 to 1.0 .mu.M (His).sub.6MazE, no discrete
mobility-shifted bands were observed, although the signals of the
DNA fragment started to smear upward (FIG. 14A, lanes 3-6),
indicating that some unstable (His).sub.6MazE-DNA complexes were
formed at these concentrations. At 2 to 20 .mu.M (His).sub.6MazE,
discrete mobility-shifted complexes were observed, which moved more
slowly at higher concentrations of (His).sub.6MazE (FIG. 14A, lanes
7-12), suggesting that the number of (His).sub.6MazE molecules
bound to the DNA fragment increased at higher MazE, concentrations.
It is possible that there are more than one (His).sub.6MazE binding
sites in the 50-bp mazEF promoter fragment.
[0419] In contrast, MazF protein could not bind to the 50-bp mazEF
promoter DNA even at a concentration of 20 .mu.M (FIG. 14B).
Increasing amounts of both (His).sub.6MazE and MazF proteins were
added with a constant (His).sub.6MazE/MazF ratio of 1:2. Compared
with (His).sub.6MazE alone, MazF significantly enhances
(His).sub.6MazE, binding to the mazEF promoter. Under these
conditions, the 50-bp mazEF promoter fragment was shifted at a
(His).sub.6MazE concentration of as low as 0.2 .mu.M (FIG. 14C),
and supershifting was observed at higher concentrations of the
(His).sub.6MazE-MazF complex, which indicates that more
(His).sub.6MazE-MazF complexes bind to the DNA fragment at higher
concentrations, demonstrating there are multiple binding sites for
the (His).sub.6MazE-MazF complex in the mazEF promoter.
[0420] Conserved Amino Acid Sequences in MazE Homologs--
[0421] MazE homologs were identified by BLAST search, and their
amino acid sequence alignments are shown in FIG. 15. Although
generally MazE is not highly conserved in bacteria, there are
conserved regions in MazE homologs. First, the N-terminal region of
MazE is more conserved than other regions in MazE. MazE is an
acidic protein with a pI of 4.7, but there are a few conserved
basic residues (K7, R8 and R16) in its N-terminal region,
designated the N-box (FIG. 15). Since MazE is able to bind the
mazEF promoter DNA, the N-box may be responsible for the DNA
binding. Secondly, there is a conserved C-terminal region, named
the Hp-box (FIG. 15), which contains several conserved hydrophobic
residues.
[0422] The N-Box of MazE is Responsible for the DNA-Binding of Both
MazE and the MazE-MazF Complex--
[0423] Various site-directed mutations were constructed in the mazE
gene in the pET21 cc-EF(His).sub.6 plasmid, converting the
conserved amino acid residues in the N-box to Ala. The complexes
formed by MazE mutant proteins and MazF(His).sub.6 were purified.
These complexes were tested for their ability to bind to the mazEF
promoter by EMSA respectively. As shown in FIG. 16A, the complexes
formed by MazE mutants with a mutation in the N-box (K7A, R8A, S12A
or R16A) and MazF(His).sub.6 were unable to bind to the mazEF
promoter DNA (FIG. 16A, lanes 3, 4, 5 and 6). The substitution
mutations on the conserved amino acids outside the N-box, however,
such as MazE I43N and E57Q, did not affect the DNA binding capacity
of complex comprising such mutated proteins (FIG. 16A, lanes 7 and
8, respectively). Additional substitution mutations were also
constructed in the mazE gene in the pET28a-(His).sub.6E plasmid.
All of the (His).sub.6MazE mutants with a substitution mutation in
the N-box (K7A, R8A, S12A and R16A) lost their DNA-binding ability
(FIG. 16B, lanes 3, 4, 5 and 6, respectively), while the wild-type
(His).sub.6MazE, retained the ability to bind to the mazEF promoter
(FIG. 16B, lane 2). In contrast, the (His).sub.6MazE mutants with a
substitution mutation outside the N-box (R48A, F53A, L55A/L58A and
E57Q) were able to bind the mazEF promoter DNA (data not shown).
These results indicate that the DNA-binding ability of the
MazE-MazF complex is due to MazE protein in the complex, and that
the N-box is responsible for the DNA binding of MazE.
[0424] Interaction Between MazE and MazF--
[0425] Yeast two-hybrid assays were performed to examine the
interaction between MazE and MazF. In order to demonstrate which
region of MazE, is required for its interaction with MazF, the
full-length mazE gene and various N-terminal and C-terminal
deletion constructs of the mazE gene were generated by PCR (see
FIG. 17) and cloned into the EcoRI-PstI sites of pGAD-C1 vector to
create in-frame translation fusions with the Gal4 transcriptional
activation domain, and then each of these plasmids was
cotransformed with the pGBD-MazF plasmid into PJ69-4A yeast cells.
The cotransformants harboring pGAD-MazE, pGAD-MazE.DELTA.(1-13),
pGAD-MazE.DELTA.(1-24), pGAD-MazE.DELTA.(1-37) or
pGAD-MazE.DELTA.(76-82) with pGBD-MazF were able to grow on a
synthetic medium (SD medium, Clontech) lacking Trp, Leu, His and
Ade, while the cotransformants harboring pGAD-MazE.DELTA.(1-46) or
pGAD-MazE.DELTA.(68-82) with pGBD-MazF were not able to grow. These
data demonstrated that the full length MazE, MazE.DELTA.(1-13),
MazE.DELTA.(1-24), MazE.DELTA.(1-37) and MazE.DELTA.(76-82) were
capable of interacting with MazF, while the further N-terminal
deletion mutant MazE/(1-46) and the further C-terminal deletion
mutant MazE.DELTA.(68-82) was not. These results indicate that the
region from residue 38 to 75 of MazE, is responsible for the
interaction with MazF.
[0426] A series of truncation mutations from the N- and C-terminal
ends of MazF were constructed in pGBD-C1 and cotransformed with
pGAD-MazE into PJ69-4A cells. All of these cotransformed yeast
cells were unable to grow on a complete synthetic medium in the
absence of Trp, Leu, His, and Ade, indicating that all of these
MazF mutants were unable to interact with MazE. Therefore both N-
and C-terminal regions of MazF may be involved in the interaction
with MazE, or the deletion mutations generated disrupt a structural
conformation of MazF favorable to interaction with MazE.
[0427] Site-directed mutations were also created on plasmid
pET28a-(His).sub.6E to construct (His).sub.6MazE R48A, F53A,
L55A/L58A and E57Q mutants. The complex formations with these
(His).sub.6MazE mutants and MazF were examined by native PAGE. As
shown in FIG. 18A, (His).sub.6MazE mutants R48A, F53A and E57Q were
able to form complexes with MazF (FIG. 18A, lanes 5, 6 and 7,
respectively), while the (His).sub.6MazE L55A/L58A mutant was not
(FIG. 18A, lane 4). EMSA were utilized to demonstrate that both the
wild-type (His).sub.6MazE and (His).sub.6MazE L55A/L58A mutant were
capable of binding to the mazEF promoter DNA (FIG. 18B, lanes 2 and
3, respectively). When MazF was added, the wild-type
(His).sub.6MazF was able to interact with MazF to form a complex
resulting in a supershifted band near the top of the gel (FIG. 18B,
lane 4), as compared to the lane with wild-type (His).sub.6MazE
alone (FIG. 18B, lane 2). The addition of MazF to (His).sub.6MazE
L55A/L58A did not, however, result in the appearance of a
supershifted species of the DNA fragment, confirming that the
(His).sub.6MazE L55A/L58A mutant cannot interact with MazF to form
a complex.
[0428] Discussion
[0429] The mazEF addiction system in E. coli consists of two genes,
mazE and mazF, encoding labile antitoxin MazF, and stable toxin
MazF, respectively. The toxic effect of MazF is activated by ppGpp,
the signal produced by RelA protein in response to amino acid
starvation (Aizenman et al. (1996) supra), by certain antibiotics
(Sat et al. (2001) supra), and by the toxic protein Doc (Hazan et
al. (2001) supra). Under these circumstances, the degradation of
labile MazE results in the appearance of free stable MazF, which
can exert a toxic effect on the cell. The regulation of MazE
cellular concentration is, therefore, a major determinant of cell
death. In brief, by forming a complex with MazF, MazE inhibits its
toxic effect. Moreover, MazE is also involved in the autoregulation
of mazEF expression by binding to the mazEF promoter (Marianovsky
et al. (2001) supra). As shown herein, MazE comprises at least two
functional domains: a DNA-binding domain and a MazF-binding
domain.
[0430] The fusion protein (His).sub.6MazE is capable of interacting
with MazF and binding to the mazEF promoter. MazF(His).sub.6, like
MazF, forms a dimer and inhibits in vitro protein synthesis, and
such inhibition of protein synthesis is rescued by co-addition of
(His).sub.6MazE (data not shown). Thus, the His-tagged fusion
proteins appear to exhibit similar functional activity as compared
to that of the wild type MazE and MazF in vitro. Using highly
purified (His).sub.6MazE and MazF, (His).sub.6MazE was demonstrated
to be capable of binding to the mazEF promoter by itself, an
interaction which was enhanced by the addition of MazF. Indeed,
MazF enhanced (His).sub.6MazE-binding to the mazEF promoter DNA by
more than ten-fold. At higher concentrations of either
(His).sub.6MazE or (His).sub.6MazE-MazF complex, supershifted
complexes comprising the mazEF promoter DNA were observed in the
electrophoretic mobility shift assays, indicating that both
(His).sub.6MazE and the (His).sub.6MazE-MazF complex have more than
one binding site on the mazEF promoter DNA. Notably, a previous
study suggested that there may be three MazE-binding sides in the
mazEF promoter region (Lah et al. (2003) J Biol Chem 278,
14101-14111). It is interesting to note that the bands observed by
EMSA were not shifted in a step-wise manner.
[0431] The site-directed mutations in the conserved N-box of MazE
(K7A, R8A, S12A and R16A) disrupted the DNA-binding ability of both
(His).sub.6MazE and the MazE-MazF(His).sub.6 complex (FIG. 16),
suggesting that MazE is responsible for the DNA-binding ability of
the MazE-MazF(His).sub.6 complex, and that the highly conserved
N-terminal region in MazE is the DNA-binding domain.
[0432] Yeast two-hybrid assays were performed to identify the
region(s) responsible for MazE-MazE interactions. It was found that
the region from residue 38 to 75 in the carboxy terminus of MazF,
was required for binding to MazF. Of note, there is a conserved
C-terminal region in MazE named the Hp-box, which is rich in
hydrophobic residues. Mutations in the MazE Hp-box at the conserved
amino acids of Leu55 and Leu58 (L55A/L58A) disrupted the
interaction between (His).sub.6MazE and MazF. Yeast two-hybrid
experiments also indicated that the entire structure of MazF
protein may be required for its interaction with MazE, since
deletions from either the N- or C-terminal end of MazF disrupted
the interaction between MazE and MazF.
[0433] The molecular mass of the MazE-MazF(His).sub.6 complex was
determined to be 76.9 kDa by gel filtration. When the purified
MazE-MazF(His).sub.6 complex was subjected to tricine SDS-PAGE, the
ratio of MazE, to MazF(His).sub.6 was found to be approximately 1:2
(FIG. 11, lane 2). Even in the presence of excess amounts of
(His).sub.6MazE or MazF, the ratio of (His).sub.6MazE to MazF in
the (His).sub.6MazE-MazF complex was stably maintained at around
1:1.8 (FIG. 12). Since both MazE (Lah et al. (2003) supra) and
MazF(His).sub.6 exist as dimers, the MazE-MazF(His).sub.6 complex
(76.9 kDa) may consist of one MazE dimer (predicted to be around
18.6 kDa as the molecular weight of MazE is 9.3 kDa) and two
MazF(His).sub.6 dimers (predicted to be around 56.6 kDa as the
molecular mass of MazF(His).sub.6 dimer is 28.3 kDa).
[0434] As described above, the crystal structure of the MazE-MazF
complex was determined by Kamada et al ((2003) supra). The crystal
structure of the MazE-MazF complex corroborated the results set
forth herein in several aspects, including: 1) the finding that
MazE and MazF form a 2:4 heterohexamer, consisting of alternating
MazF and MazE homodimers (MazF.sub.2-MazE.sub.2-MazF.sub.2). It is
important to note that the 2:4 stoichiometric complex formation
between MazE and MazF appears to be very stable, since the ratio
between (His).sub.6MazE and MazF in the (His).sub.6MazE-MazF
complex was found irrespective of which protein was added in large
excess (FIG. 12). 2) The C-terminal region of MazE interacts with
MazF homodimer in the structure of MazE-MazF complex. The Hp-box
region identified in this study is involved in the seemingly most
stable interface between MazE and MazF (FIG. 19). 3) Based on the
similarity between MazE and other addiction module antidotes and
the distribution of the basic regions on the electrostatic surfaces
of MazE and MazF, Kamada et al ((2003) supra) proposed that Lys7
and Arg8 in MazE serve as the primary DNA anchoring sites in the
MazE-MazF complex. As demonstrated herein, the DNA-binding
abilities of (His).sub.6MazE and the MazE-MazF(His).sub.6 complex
were disrupted not only by the site-directed mutations at Lys7 and
Arg8 but also by mutations at other conserved amino acid residues
(Ser12 and Arg16) in the N-box (FIG. 19). It is possible that,
since MazE exists as a dimer, the two N-boxes in the MazE dimer may
be involved together in DNA-binding.
Example IV
[0435] As shown herein, purified PemK, the toxin encoded by the
"pemI-pemK addiction module", inhibits protein synthesis in an E.
coli cell-free system, while the addition of PemI, the antitoxin
against PemK, restores protein synthesis. Further studies reveal
that PemK is a sequence-specific endoribonuclease that cleaves
mRNAs to inhibit protein synthesis, while PemI blocks the
endoribonuclease activity of PemK. As described herein, PemK
cleaves single-stranded RNA preferentially at the 5' or 3' side of
the A nucleotide in "UAX" sequences, wherein X is C, A or U. Upon
induction, PemK cleaves cellular mRNAs to effectively block protein
synthesis in E. coli. Thus, the present invention demonstrates that
PemK interferes with mRNA function by cleaving it at specific
sites. Accordingly, the present inventors have discovered that PemK
is a novel endoribonuclease and have designated it herein an "mRNA
interferase". pemK homologues have been identified on the genomes
of a wide range of bacteria. It is proposed that PemK and its
homologues form a novel endoribonuclease family that interferes
with mRNA function by cleaving cellular mRNAs in a
sequence-specific manner. See also FIGS. 33 and 34.
[0436] Methods and Materials
[0437] Strains and Plasmids:
[0438] E. coli BL21(DE3) and BW25113 cells were used as described
herein. The pemIK gene was amplified by PCR with plasmid R100 as
template, and cloned into the NdeI-XhoI sites of pET21 cc (Novagen)
to create an in-frame translation with a (His).sub.6 tag at the
PemK C-terminus. The plasmid was designated pET21 cc-IK(His).sub.6.
The pentyl gene was cloned into the NdeI-BamHI sites of pET28a
(Novagen), creating plasmid pET28a-(His).sub.6I. PemI was expressed
as a fusion with an N-terminal (His).sub.6 tag followed by a
thrombin cleavage site, named (His).sub.6PemI. The pemK gene was
cloned into pBAD (Guzman et al. (1995) J Bacteriol 177, 4121-4130),
creating plasmid pBAD-K. E. coli mazG gene was cloned into
NdeI-BamHI sites of pET11a (New England Biolabs), creating plasmid
pET11a-MazG. The mazG gene was cloned into a pINIII vector (Nakano
et al. (1987) J Virol 61, 302-307), creating plasmid pIN-MazG. E.
coli era gene was cloned into the ScaI-XhoI sites of pET28a,
creating plasmid pET28a-Era. The era gene was also cloned into
pINIII vector to create plasmid pIN-Era.
[0439] Protein Purification:
[0440] For purification of (His).sub.6PemI, pET28a-(His).sub.6I was
introduced into E. coli BL21(DE3) strain, and (His).sub.6PemI
expression was induced with 1 mM IPTG for 4 h. (His).sub.6PemI
protein was purified using Ni-NTA (QIAGEN). pET21 cc-IK(His).sub.6
was also introduced into the E. coli BL21(DE3) strain. The
coexpression of PemI and PemK(His).sub.6 was induced in the
presence of 1 mM IPTG for 4 h. The PemI-PemK(His).sub.6 complex was
purified using Ni-NTA (QIAGEN). To purify PemK(His).sub.6 from the
purified PemI-PemK(His).sub.6 complex, the PemI-PemK(His).sub.6
complex was dissociated in 5 M guanidine-HCl to release PemI from
PemK(His).sub.6. PemK(His).sub.6 was retrapped on Ni-NTA resin
(QIAGEN), and then eluted and refolded by step-wise dialysis.
[0441] Assays of Protein and DNA Synthesis In Vivo:
[0442] E. coli BW25113 cells containing pBAD-K were grown in
modified M9 medium with 0.5% glycerol (no glucose) and an amino
acid mixture (1 mM each) without methionine. When the OD.sub.600 of
the culture reached 0.6, arabinose was added to a final
concentration of 0.2% to induce PemK expression. Cell cultures (1
ml) were taken at the time points indicated and mixed with 5 .mu.Ci
[.sup.35S]-methionine (for protein synthesis analysis) or 2 .mu.Ci
methyl-.sup.3H-thymidine (for DNA synthesis analysis). After 1
minute incorporation time at 37.degree. C., the rates of DNA
replication and protein synthesis were determined as described
previously (Pedersen et al. (2002) Mol Microbiol 45, 501510). To
prepare the samples for SDS-PAGE analysis of the total cellular
protein synthesis, [.sup.35S]-methionine incorporation reaction
mixture (500 .mu.l) was removed at the time points indicated and
added to a chilled test tube containing 25 .mu.l of 100% TCA
solution and 100 .mu.g/ml non-radioactive methionine. Cell pellets
were collected by centrifugation and subjected to SDS-PAGE followed
by autoradiography.
[0443] Primer Extension Analysis:
[0444] A DNA fragment containing a T7 promoter and the mazG gene
was obtained by PCR amplification with T7 primer
(5'-AGATCTCGATCCCGCA AATTAAT-3') (SEQ ID NO: 14) and primer G6
(5'-TTAGAGATCAATTTCCTGCCGTTTTAC-3') (SEQ ID NO: 15) with
pET11a-MazG as a template. Another DNA fragment comprising a T7
promoter and the era gene was obtained by PCR amplification with
the same T7 primer above and primer E5 (5'TTAAAGATCGTCAACGTAACCG-3)
(SEQ ID-NO: 16) with pET28a-Era as template. The mazG mRNA and era
mRNA were prepared from these two DNA fragments, respectively,
using the T7 large-scale transcription kit (Promega). RNA
substrates were partially digested with PemK(His).sub.6 at
37.degree. C. for 15 min. The digestion reaction mixture (20 .mu.l)
contained 4 .mu.g RNA substrate, 0.2 .mu.g PemK(His).sub.6, 1 .mu.l
RNase inhibitor, 20 mM Tris-HCl (pH 8.0), 100 mM NaCl and 1 mM DTT.
Partial digestion products were purified with the RNAeasy column
(QIGENE) to remove PemK(His).sub.6 protein. The primers G1
(5'-TGCTCTTTATCCCACGGGCAGC-3') (SEQ ID NO: 17), G2
(5'-GCCCAGTTCACCGCGAAGATC GTC-3') (SEQ ID NO: 18), G3
(5'-GGTTTTGATTTGCTCCCAACGGGCAAG-3') (SEQ ID NO: 19), G4
(5'-CATTTCCT CCTCCAGTTTAGCCTGGTC-3') (SEQ ID NO: 20), and G5
(5'-TTGCCAGACTTCTTCCATTGTTTCG AG-3') (SEQ ID NO: 21) were used for
primer extension analyses of the mazG RNA; the primers E1
(5'-GATCCCCACAATGCGGTGACGAGT-3') (SEQ ID NO: 22), E2
(5'-CACGTTGTCCACTTTGTTCACC GC-3') (SEQ ID NO: 23), E3
(5'-CAGTTCAGCGCCGAGGAAACGCAT-3') (SEQ ID NO: 24), and E4
(5'-GCGTTCGTCG TCGGCCCAACCGGA-3') (SEQ ID NO: 25) were used for
primer extension analyses of the era RNA. The primers were
5'-labeled with [.gamma.-.sup.32P]ATP using T4 polynucleotide
kinase. Primer extension reactions were performed at 42.degree. C.
for 1 hr. Control experiments were performed using the same
conditions except that PemK(His).sub.6 was not added to the
digestion reaction mixture. The primer extension product was
analyzed on a 6% sequencing gel on which it was run alongside the
DNA sequencing ladder prepared with the same primer.
[0445] Cleavage of Synthesized RNA by PemK:
[0446] The 30-base RNA 5'-UAAGAAGGAGAUA UACAUAUGAAUCAAAUC-3' (SEQ
ID NO: 11), antisense RNA 5'-GAUUUGAUUCAUAUGUAUAU CUCCUUCUUA-3'
(SEQ ID NO: 26), and the complementary DNA 5'-GATTTGATTCATATGTATATC
TCCTTCTTA-3' (SEQ ID NO: 27) were commercially synthesized. The
30-base RNA was 5'-end labeled with [.gamma.-.sup.32P]ATP using T4
polynucleotide kinase and used as a substrate for PemK(His).sub.6.
The cleavage products of the 30-base RNA were applied to a 20%
sequencing gel (with 7M Urea) along with an RNA ladder, which was
prepared by partial alkaline hydrolysis of the 5'-end labeled
30-base RNA as described previously (Smith and Roth. (1992) J Biol
Chem 267, 15071-15079). The effects of the RNA-RNA duplex and
RNA-DNA duplex formation on the PemK-mediated RNA cleavage were
determined as described previously (Zhang et al. (2003) supra).
[0447] Northern Blot and Primer Extension Analyses of the PemK
Effects on mRNAs In Vivo:
[0448] pIN-MazG plasmid and pIN-Era plasmid were transformed into
E. coli BW25113 cells comprising pBAD-K, creating the
BW25113/pBAD-K/pIN-MazG and BW25113/pBAD-K/pIN-Era strains,
respectively. Cells were grown at 37.degree. C. in LB medium
containing ampicillin (50 .mu.g/ml) and chloramphenicol (20
.mu.g/ml). When the OD.sub.600 value reached 0.4, IPTG was added to
a final concentration of 1 mM to induce the synthesis of the mazG
or era mRNA. After another 30 minute incubation at 37.degree. C.,
arabinose was added to a final concentration of 0.2% to induce the
expression of PemK. The samples were removed at different time
intervals after the induction of PemK. Total cellular RNA was
isolated using the hot-phenol method as described previously
(Sarmientos et al. (1983) Cell 32, 1337-1346). The DNA fragment
containing the full-length ORF of the mazG or era gene was used to
prepare each of the radioactively labeled probes, which were used
in Northern blot analyses. Primer extension analysis was performed
with primer G2 (for the mazG mRNA) or E1 (for the era mRNA). To
detect the lpp mRNA, total cellular RNA was extracted from E. coli
BW25113/pBAD-K at various time points, after the addition of
arabinose and subjected to Northern blot analysis using the
radiolabeled lpp ORF DNA fragment as a probe. The primer extension
analysis of the lpp mRNA was performed with primer lpp-C
(5'-AGAATGTGCGCC ATTTTTCACT-3') (SEQ ID NO: 28).
[0449] Specific Methodological Details Pertaining to Drawings
[0450] FIG. 26. Effects of PemK on DNA and protein synthesis in
vivo. (A) Effect of PemK on DNA synthesis. E. coli BW25113 cells
containing pBAD-K were grown at 37.degree. C. in M9 medium with
glycerol as a carbon source. When the OD.sub.600 of the culture
reached 0.6, arabinose was added to a final concentration of 0.2%
to induce PemK expression. The rates of DNA replication were
measured by detecting the methyl-.sup.3H-thymidine incorporation at
various time points after the induction of PemK as described in
Materials and Methods. (B) Effect of PemK on protein synthesis. The
rates of protein synthesis were measured by detecting the
[.sup.35S]-methionine incorporation at various time points after
the induction of PemK as described in Materials and Methods. (C)
SDS-PAGE analysis of the total cellular protein synthesis after the
induction of PemK. Cell culture (1 ml) was taken at the time point
after the induction of PemK as indicated and mixed with 5 .mu.Ci
[.sup.35S]-methionine. After 1 minute of incorporation at
37.degree. C., the [.sup.35S]-methionine incorporation reaction
mixture (500 .mu.l) was placed in a chilled test tube containing 25
.mu.l of 100% TCA solution and 100 .mu.g/ml non-radioactive
methionine. Cell pellets were collected by centrifugation and
subjected to SDS-PAGE followed by autoradiography. The band
indicated with an arrow is PemK.
[0451] FIG. 27. Effects of PemK and PemI on the cell-free protein
synthesis. (A) Inhibition of cell-free protein synthesis by PemK.
Protein synthesis was performed at 37.degree. C. for 1 hr in the E.
coli T7 S30 extract system (Promega). MazG was expressed from
pET11a-MazG, and (His).sub.6Era was expressed from plasmid
pET28a-Era. Lane 1, control without the addition of PemK; lanes 2
to 5, 0.125, 0.25, 0.5, and 1 .mu.g PemK(His).sub.6 were added,
respectively. (B) Release of PemK-mediated inhibition of protein
synthesis in the cell-free system by PemI. Lane 1, control without
the addition of PemK(His).sub.6; lane 2, with 1 .mu.g
PemK(His).sub.6; lanes 3 to 5, 0.5, 1, 2 .mu.g (His).sub.6PemI were
added together with 1 .mu.g PemK(His).sub.6, respectively. (C)
Effect of preincubation of the cell-free system with PemK on
protein synthesis. The cell-free system was preincubated with or
without PemK(His).sub.6 for 15 minutes at 37.degree. C. before the
addition of pET28a-Era plasmid. The protein synthesis was
perpetuated for another 1 hr incubation at 37.degree. C. Reaction
products were analyzed by SDS-PAGE followed by autoradiography.
Lane 1, control preincubated without PemK(His).sub.6; lane 2,
preincubated with 1 .mu.g PemK(His).sub.6 followed by adding
pET28a-Era plasmid; lane 3, preincubated with 1 .mu.g
PemK(His).sub.6 followed by adding pET28a-Era plasmid and 1 .mu.g
(His).sub.6PemI together; lane 4, preincubated with 1 .mu.g
PemK(His).sub.6 and 1 .mu.g (His).sub.6PemI together followed by
the addition of pET28a-Era plasmid.
[0452] FIG. 28. Endoribonuclease activity of PemK. (A) Cleavage of
the mazG mRNA by PemK and the inhibitory effect of PemI on the
PemK-mediated RNA cleavage. Lane 1, control, the mazG mRNA alone;
lane 2, the mazG mRNA (1.5 .mu.g) incubated with 0.2 .mu.g
PemK(His).sub.6; lanes 3 to 6, the mazG mRNA (1.5 .mu.g) incubated
with 0.2 .mu.g PemK(His).sub.6 together with 0.05, 0.1, 0.2 and 0.4
.mu.g (His).sub.6PemI, respectively; lane 7, the mazG mRNA (1.5
.mu.g) incubated with 0.4 .mu.g (His).sub.6PemI. The reactions were
performed at 37.degree. C. for 15 minutes, and the reaction
products were analyzed by 3.5% native PAGE with TAE buffer. (B),
(C), (D) and (E), primer extension analyses of PemK cleavage sites
in the mazG mRNA and the era mRNA. Primer extension experiments
were performed as described in Materials and Methods. Each primer
extension product was analyzed on a 6% sequencing gel running
alongside a DNA sequencing ladder prepared with the same primer.
The RNA sequences complementary to the DNA sequence ladders around
the PemK(His).sub.6 cleavage sites are shown at the right-hand
side, and the cleavage sites are shown by arrows. Shown in this
figure are the PemK(His).sub.6 cleavage sites in the mazG mRNA
detected with primers G1 (B) and G2 (C), and the PemK(His).sub.6
cleavage sites in the era mRNA detected with primers E1 (D) and E4
(E).
[0453] FIG. 29. Inhibition of PemK endoribonuclease activity by
RNA/RNA formation. A 30 base RNA was synthesized with the identical
sequence around a PemK(His).sub.6 cleavage site in the mazG mRNA
(Table II, row 2). (A) PemK cleavage sites on the 30-base RNA. The
30-base RNA was 5'-end labeled with [.gamma.-.sup.32P]-ATP using T4
polynucleotide kinase, and then incubated with PemK(His).sub.6 at
37.degree. C. for 15 minutes. The cleavage products were analyzed
on a 20% sequencing gel. Lane 1,5'-end [.gamma.-.sup.32P]-labeled
11-base RNA size maker; lane 2, RNA ladder prepared from the 5'-end
[.sup.32P]-labeled 30-base RNA by partial alkaline hydrolysis as
described previously (Smith and Roth. (1992) J Biol Chem 267,
15071-15079); lane 3,5'-end [.sup.32P]-labeled 30-base RNA
untreated by PemK(His).sub.6; and lane 4, the cleavage products of
the 5'-end [.sup.32P]-labeled 30-base RNA by PemK(His).sub.6. The
size of each band in lanes 1 and 4 is shown with the number of its
total nucleotides. (B) The effects of RNA-RNA duplex formation on
the endoribonuclease activity of PemK. Lane 1, the
[.sup.32P]-labeled 30-base RNA alone (1 pmol); lane 2, the
[.sup.32P]-labeled 30-base RNA (1 pmol) was incubated with 0.2
.mu.g PemK(His).sub.6 at 37.degree. C. for 15 minutes; lanes 3 to
7, the [.sup.32P]-labeled 30-base RNA (1 pmol) was annealed with
its 30-base antisense RNA in different ratios as indicated, and
then incubated with 0.2 .mu.g PemK(His).sub.6 at 37.degree. C. for
15 minutes. The reaction products were analyzed by 15% PAGE
followed by autoradiography.
[0454] FIG. 30. Northern blot and primer extension analyses of the
effects of PemK on various mRNAs in vivo. (A) Northern blot
analyses of the effects of PemK on mazG, era and lpp mRNAs in vivo.
The mazG mRNA and the era mRNA were produced respectively from
pIN-MazG and pIN-Era in the presence of 1 mM IPTG for 30 minutes
before the addition of arabinose (to a final concentration of 0.2%)
to induce PemK expression. The lpp mRNA was transcribed from the E.
coli chromosome. Total cellular RNA was extracted at various time
points as indicated after the induction of PemK and used for
Northern blot analysis. The control experiments were carried out
under the same condition without the induction of PemK. (B), (C)
and (D) Primer extension analyses of PemK cleavage sites in the
mazG, era and lpp mRNAs in vivo. Total cellular RNA was extracted
at each time point as indicated and used for the primer extension
experiments. Primer extension products were analyzed on a 6%
sequencing gel running alongside a DNA sequencing ladder prepared
with the same primer. The RNA sequences complementary to the DNA
sequence ladders around the PemK cleavage sites are shown at the
right-hand side, and the cleavage sites are indicated by arrows.
Shown are in vivo PemK cleavage sites in the mazG mRNA detected
with primer G2 (B), in the era mRNA detected with primer E1 (C),
and in the lpp mRNA detected with primer lpp-C (D).
[0455] Results
[0456] The Effects of PemK on DNA and Protein Syntheses In
Vivo:
[0457] The pemK gene was cloned into the pBAD vector (Guzman et al.
(1995) J Bacteriol 177, 4121-4130) creating plasmid pBAD-K, which
was transformed into E. coli BW25113. The expression of PemK in
BW25113/pBAD-K was induced by the addition of arabinose to a final
concentration of 0.2%. After the induction of PemK, the rates of
DNA replication and protein synthesis were measured at various time
points as indicated in FIGS. 26A and B, respectively. Both DNA
replication and protein synthesis were affected by the induction of
PemK, but DNA replication was inhibited to a significantly lesser
degree than protein synthesis. Protein synthesis was rapidly
reduced by approximately 50% at 10 minutes after the induction of
PemK, while it took about 100 minutes for similar inhibition of DNA
replication. As shown in FIG. 26C, SDS-PAGE analysis of total
cellular protein synthesis at different time points after the
induction of PemK indicates that PemK is a general inhibitor of
cellular protein synthesis. After the induction of PemK, the
intensity of a band (indicated by an arrow) increased from 0 to 30
minutes and then decreased. On the basis of its molecular mass and
kinetics of induction, this band represents the induced PemK
protein.
[0458] PemK Inhibits Protein Synthesis in a Cell-Free System:
[0459] PemK(His).sub.6 (C-terminally tagged) was purified from E.
coli strain BL21(DE3)/pET21 cc-IK(His).sub.6 co-expressing both
PemI and PemK(His).sub.6 as described in Methods and Materials.
(His).sub.6PemI (N-terminally tagged) was purified from E. coli
strain BL21(DE3)/pET28a-(His).sub.6I. PemK(His).sub.6 and
(His).sub.6PemI are referred to as PemK and PemI, respectively in
the following in vitro experiments. In order to determine if PemK
inhibits protein synthesis, the effects of purified PemK on the
synthesis of MazG and (His).sub.6Era in an E. coli cell-free
RNA/protein synthesis system were examined. The synthesis of MazG
from plasmid pET11a-MazG and the synthesis of (His).sub.6Era from
plasmid pET28a-Era were carried out at 37.degree. C. for 1 hr using
the E. coli T7 S30 extract system (Promega) in the absence of PemK
(FIG. 27A, lane 1) or in the presence of increasing amounts of PemK
(FIG. 27A, lanes 2 to 5). Both MazG and (His).sub.6Era synthesis
were blocked by PemK in a dose-dependent manner (FIG. 27A). These
results demonstrate that PemK inhibits protein synthesis,
consistent with the PemK-mediated inhibition of protein synthesis
observed in vivo (FIGS. 26B and 26C). The delayed PemK-mediated
inhibition of DNA replication observed in vivo (FIG. 26A) is thus
speculated to be due to a secondary effect of the inhibition of
cellular protein synthesis. Interestingly, the addition of the
antitoxin PemI blocked the PemK-mediated inhibition of protein
synthesis and restored MazG and (His).sub.6Era synthesis in a
PemI-dose-dependent manner (FIG. 27B). It should be noted that
pre-incubation of the E. coli cell-free system with PemK for 15
minutes at 37.degree. C. did not have a significant adverse effect
on (His).sub.6Era synthesis, if PemI was added together with the
plasmid DNA after the 15 minute pre-incubation (compare lanes 1 and
3 in FIG. 27C). In the absence of PemI, however, no protein was
produced (FIG. 27C, lane 2). Notably, (His).sub.6Era synthesis was
restored regardless of whether PemI was added after the 15 minute
pre-incubation with PemK (FIG. 27C, lane 3) or it was added
together with PemK during the 15 minute pre-incubation (FIG. 27C,
lane 4). These results suggest that the primary target of PemK is
mRNA, and not tRNA, ribosomes and any other factors that are
required for protein synthesis in a cell-free system.
[0460] Endoribonuclease Activity of PemK:
[0461] A DNA fragment comprising a T7 promoter and the mazG gene
was obtained by PCR amplification using the plasmid pET11a-MazG as
a template as described in Methods and Materials. Similarly another
DNA fragment containing a T7 promoter and the era gene was obtained
using the plasmid pET28a-Era as a template. The mazG mRNA and the
era mRNA were then prepared from these two DNA fragments
respectively using the T7 large-scale transcription kit (Promega).
The mazG mRNA was digested into smaller fragments after incubation
with PemK at 37.degree. C. for 15 minutes (FIG. 28A, lane 2), while
the addition of PemI inhibited the cleavage of mazG mRNA in a
dose-dependent manner (FIG. 28A, lanes 3 to 6). PemI alone had no
effect on the mazG mRNA (FIG. 28A, lane 7). A similar result was
obtained with the era mRNA as a substrate. These results
demonstrate that PemK is an endoribonuclease that cleaves mRNA to
inhibit protein synthesis, and that Penal functions as an antitoxin
to block the endoribonuclease activity of PemK.
[0462] The finding that the digestion products of mazG mRNA cleaved
by PemK form distinct bands on a 3.5% polyacrylamide gel (FIG. 28A)
indicates that PemK cleaves RNA at specific sites. The mazG mRNA
was partially digested by PemK and then subjected to primer
extension using five different oligodeoxyribonucleotide primers, G1
to G5, as described in Materials and Methods. A number of specific
cleavage sites along the mazG mRNA were detected on a 6% sequence
gel as compared to controls treated in parallel, but without PemK
treatment. Partially digested era mRNA by PemK was also subjected
to primer extension using four different primers, E1 to E4, as
described in Materials and Methods to detect the PemK cleavage
sites along the era mRNA. To determine the exact sequence around
the PemK cleavage sites, each primer extension product was analyzed
on a 6% sequencing gel with the DNA sequencing ladder prepared with
the same primer (FIG. 28B to E).
[0463] Table II shows mRNA sequences around the PemK cleavage
sites. The mRNA sequences around PemK cleavage sites (indicated by
arrows) in the mazG mRNA (from pET11a-MazG),
[0464] the era mRNA (from pET28a-Era) and the lpp mRNA (from E.
coli chromosomal DNA, see FIG. 30D) are shown. The conserved UA
dinucleotides are shown in bold. The numbers show the positions of
the nucleotides in mRNA taking the A residue in the initiation
codon AUG as +1.
TABLE-US-00002 Gene Names Primer mRNA sequences around the cleavage
sites mazG G1 (-27) U U U U A A C U U U.dwnarw.A A G A A G G A G A
(-8) (-14) A A G G A G A U A U .dwnarw.A C A U A U G A A T (+306)
G2 (+112)G A A G A A A C C U A.dwnarw.C G A A G U G C U (+131) G3
(+196)G U G G U G U U U U .dwnarw.A C G C G C A A A U (+215)
(+234)C U U U G A C U U U.dwnarw.A A U G A U A U U U (+253) (+240)C
U U U A A U G A U.dwnarw.A U U U G C G C U G (+259) (+290)C G C A U
G U U U U.dwnarw.G C U G A U A G U U (+309) G4 (+523)G A G G U G A
U G U A.dwnarw.C G A A G C G C G (+542) G5 (+597)U G C C A C G G U
U.dwnarw.A A U C U G G C U C (+616) (+684)A G U G G A G C G
U.dwnarw.A U U G U U G C C G (+703) era E1 (+10) G A T A A A A G U
U.dwnarw.A C U G C G G A U U (+29) E2 (+144)G G G G A U C C A
U.dwnarw.A C U G A A G G C G (+163) (+169) C A G G C G A U C
U.dwnarw.A C G U C G A U A C (+188) E3 (+509) G U A A G C A U C
U.dwnarw.A C C U G A A G C G (+528) (+541) C C G G A A G A U
U.dwnarw.A C A U C A C C G A (+560) E4 (+625)G A A C U G C C G U
A.dwnarw.C U C C G U G A C (+644) (+676)C G C G G U G G U
U.dwnarw.A U G A C A U C A A (+695) lpp IppC (+210)C A A C A U G G
C U.dwnarw.A C T A A A T A C C (+229)
[0465] Table II shows the sequences around the major cleavage sites
in the mazG mRNA, the era mRNA and the lpp mRNA (see FIG. 30D for
the lpp mRNA), as determined by the primer extension experiments.
These findings reveal that a UA dinucleotide is common in all but
one cleavage site, and that the primary cleavages occur at the 5'
or 3' side of the A residue in the UAX (X is C, A or U) sequence,
with only one exception in which the cleavage occurs between U and
G residues in the UGC sequence (Table II, row 7). The UAC sequence
appears in 11 out of the 18 cleavage sites determined.
[0466] A 30-base RNA substrate was designed on the basis of the
sequence around one PemK cleavage site in the mazG mRNA that
comprises a UAC sequence (Table II, row 2). The RNA was labeled at
the 5' end with [.gamma.-.sup.32P]ATP using T4 polynucleotide
kinase. In the primer extension experiment using the full-length
mazG mRNA, the UAC sequence was cleaved only at the 5' side of the
A residue (FIG. 28B). The 30-base RNA, however, was cleaved equally
well at either 5' side or 3' side of the A residue (nucleotide 15
in the 30 base RNA) in the UAC sequence (FIG. 29A). On a 15% native
PAGE, the cleavage products from the 30-base RNA migrated as a
single band (FIG. 29B, lane 2). When the antisense RNA was annealed
with the 30-base RNA substrate in different ratios before the
addition of PemK, it blocked the RNA cleavage in a dose-dependent
manner (FIG. 29B, lanes 3 to 7). A similar result was obtained when
the 30-base RNA substrate formed a duplex with its complementary
DNA. These results indicate that the PemK cleavage sites in the
30-base RNA substrate are protected in the RNA-RNA and RNA-DNA
duplexes. It can, therefore, be concluded that PemK is a
sequence-specific endoribonuclease for single-stranded RNA.
[0467] In Vivo mRNA Cleavage Upon the Induction of PemK:
[0468] To examine the effect of PemK on mRNAs in vivo, Northern
blot and primer extension analyses were performed with total
cellular RNA extracted at different time points after the induction
of PemK as described in Methods and Materials. The 16S and 23S
rRNAs were stable against PemK in vivo, as no significant changes
were observed in their band intensities as revealed by
visualization on 1% agarose gels of total cellular RNA samples
during a 60 minute period after the induction of PemK. This
indicates that in vivo both 16S and 23S rRNA are well protected
from PemK cleavage. FIG. 30A shows the Northern blot analyses of
the mazG, era and lpp mRNAs at the various time points with or
without the induction of PemK. The mazG mRNA and the era mRNA were
produced respectively from pIN-MazG and pIN-Era in the presence of
1 mM IPTG for 30 minutes before the addition of arabinose (the
final concentration of 0.2%) to induce PemK expression. The lpp
mRNA was transcribed from the E. coli chromosome. All three of
these mRNAs were degraded after 10 minutes of induction of PemK
expression, while no changes were observed during a 60 minute
incubation without the induction of PemK (FIG. 30A). In comparison
with the mazG and lpp mRNAs, the era mRNA was mostly converted to a
smaller distinct band, which was comparatively stable during the 60
minute induction of PemK. The nature of this stable mRNA cleavage
product is unknown.
[0469] Primer extension experiments were also performed to
determine the PemK cleavage sites in mRNAs in vivo. One cleavage
site for each mRNA is shown in FIGS. 30B, C, and D for mazG, era
and lpp, respectively. In all cases, a band appeared at 10 minutes
after the induction of PemK (lane 2 in FIGS. 30B, C and D), whose
intensity further increased during the 60 minute induction of PemK
(lanes 2 to 6). Of note, the band was barely detectable at 0
minutes (lane 1), clearly demonstrating that the observed cleavages
were caused by the induction of PemK. Both the mazG and lpp mRNAs
were cleaved between the A and C residues in the UAC sequence,
while the era mRNA was cleaved between the U and A residues. The
mazG mRNA was cleaved at the identical site in vivo and in vitro
(compare FIG. 28C and FIG. 30B). The in vivo cleavage of the era
mRNA also occurred at the same site as detected in vitro with use
of the same primer (compare FIG. 28D and FIG. 30C). The cleaved UAC
sequences in the mazG and the era mRNAs are in the reading frame of
both ORFs, encoding Tyr41 in MazG and Tyr7 in Era, while the
cleaved UAC sequence in the lpp mRNA is between two adjacent
codons, GCU for Ala73 and ACU for Thr74. In vivo mRNA cleavage by
PemK was very specific as no other cleavage events were detected,
as shown in FIGS. 30B, C and D. Therefore, unlike RelE which
stimulates codon-specific mRNA cleavage at the A site on ribosomes
(Pedersen et al. (2003) Cell 112, 131-140; Hayes and Sauer. (2003)
Mol Cell 12, 903-911), PemK is a sequence-specific endoribonuclease
capable of inhibiting protein synthesis by cleaving mRNA in a
manner independent of ribosomes and codon-reading.
[0470] Conclusion
[0471] The present invention is directed, in part, to the novel
discovery that PemK, the toxin encoded by the pemI-pemK addiction
module, is a sequence-specific endoribonuclease. Both in vitro and
in vivo studies demonstrate that PemK inhibits protein synthesis by
cleaving mRNAs at specific sites. Purified PemK inhibits protein
synthesis in an E. coli cell-free system, while the addition of
PemI is able to block the inhibitory effect of PemK and restore
protein synthesis. Furthermore, it is demonstrated herein that
mRNAs are degraded by PemK, and that the PemK mediated mRNA
cleavage is inhibited by PemI. PemI, therefore, functions as an
antitoxin that inhibits the endoribonuclease activity of PemK by
forming a complex with PemK. With respect to endoribonuclease
activity, PemI-PemK complexes are inactive.
[0472] PemK is shown herein to be highly specific for
single-stranded RNA, as PemK mediated RNA cleavage is blocked when
an RNA substrate is annealed to its antisense RNA or complementary
DNA to form an RNA-RNA or RNA-DNA duplex. The present results also
demonstrate that PemK cleaves preferentially at the 5' or 3' side
of the A residue in UAX (X is C, A or U) sequences. The results
presented herein also reveal that RNA cleavage by PemK is
independent of ribosomes, which is distinctly different from RelE,
the toxin encoded by the relBE addiction module. RelE is not able
to cleave free RNA but stimulates mRNA cleavage at the ribosome A
site with high codon-specificity (Christensen and Gerdes. (2003)
Mol Microbiol 48, 1389-1400; Pedersen et al. (2003) Cell 112,
131-140; Hayes and Sauer. (2003) Mol Cell 12, 903-911).
[0473] In a previous study on the kis-kid system, which is an
addiction module identical to the pemI-pemK system, it has been
reported that Kid (PemK) inhibits in vitro ColE1 replication at the
initiation stage but has no significant effect on P4 DNA
replication. DnaB has been proposed as the target for the
inhibitory action of Kid (PemK) (Ruiz-Echevarria et al. (1995) J
Mol Biol 247, 568-577). There is, however, no data to support the
interaction between Kid (PemK) and DnaB. It is interesting to note
that ColE1 replication is initiated by RNA II and inhibited by RNA
I (Cesareni et al. (1991) Trends Genet 7, 230-235; Davison. (1984)
Gene 28, 1-15), while P4 DNA replication is mainly regulated by
.alpha. protein (Briani et al. (2001) Plasmid 45, 1-17). RNases
involved in the metabolism of RNA I and RNA II are expected to play
a key role in the control of the ColE1 plasmid replication (Jung
and Lee. (1995) Mol Biol Rep 22, 195-200). RNA II contains several
UAC sequences, two of which exist in the loop regions of the first
and second stem-loop structure (Tomizawa and Itoh. (1982) Cell 31,
575-583; Tomizawa. (1984) Cell 38, 861-870). The inhibition of
ColE1 DNA replication by Kid (PemK), therefore, is likely due to
degradation of RNA II by its endoribonuclease activity.
Furthermore, the fact that Kid (PemK), a toxin in bacteria,
inhibits the growth of various eukaryotic cells (de la Cueva-Mendez
et al. (2003) Embo J 22, 246-251) can be readily explained by
virtue of its endoribonuclease activity against cellular mRNAs
rather than by its interaction with DnaB.
[0474] PemK homologues have been identified in a wide range of
bacteria. MazF (ChpAK) and ChpBK are the two PemK-like proteins in
E. coli (Santos Sierra et al. (1998) FEMS Microbiol Lett 168,
51-58; Masuda et al. (1993) J Bacteriol 175, 6850-6856; Christensen
et al. (2003) J Mol Biol 332, 809-819). MazF (ChpAK), the toxin
encoded by the mazEF addiction module is 25% identical to PemK;
ChpBK, the toxin encoded by the chpB addiction module is 41%
identical to PemK. Notably, MazF (ChpAK) and ChpBK are known to
inhibit translation by cleaving mRNAs in a manner similar to RelE
(Christensen et al. (2003) supra). The present inventors have
recently demonstrated, however, that MazF is an endoribonuclease
that acts independently of ribosomes and inhibits protein synthesis
by cleaving single-stranded mRNA at specific sequences (Zhang et
al. (2003) Mol Cell 12, 913-923). MazF preferentially cleaves mRNA
between A and C residues at the ACA sequence (Zhang et al. (2003)
supra).
[0475] The crystal structure of Kid (PemK) protein has been
determined as a homodimer (Hargreaves et al. (2002) Structure
(Camb) 10, 1425-1433; Hargreaves et al. (2002) Acta Crystallogr D
Biol Crystallogr 58, 355-358). Although the structure of MazF has
not been determined, Kamada et al (2003) have reported the crystal
structure of the MazE-MazF complex (MazF2-MazE2-MazF2), which was
formed by two MazF homodimers and one MazE homodimer.
Interestingly, the structure of the Kid (PemK) homodimer and that
of the MazF homodimer in the MazE-MazF complex are similar. The
conserved loops between (3 strands S1 and S2 (termed the S1-S2
loops) in the MazE-bound MazF homodimer, however, project into
solvent and are mostly disordered, while the two corresponding
loops are in a "closed" conformation in the Kid (PemK) homodimer
(Kamada et al. (2003) Mol Cell 11, 875-884). The S1-S2 loops in the
structure of the Kid (PemK) homodimer form a cavity-like structure
covering a basic surface and a conserved hydrophobic pocket. The
conserved hydrophobic pocket plays an essential role in the
recognition of MazE in the MazE-MazF complex formation (Kamada et
al. (2003) supra). The present inventors have proposed that the
highly negatively charged C-terminal extension of MazE may mimic
single-stranded RNA, which binds between the S1-S2 loops in the
MazF homodimer (Zhang et al. (2003) supra). PemI is envisioned to
bind to PemK in a very similar manner to block the endoribonuclease
activity of PemK.
[0476] Both PemK and MazF have been characterized by the present
inventors as sequence-specific endoribonucleases for
single-stranded RNA, however, their physiological function appears
to be distinct from other known endoribonucleases such as RNase E,
A and T1. PemK and MazF function as general protein synthesis
inhibitors by interfering with the function of cellular mRNAs. It
is well known that the small RNAs, such as micRNA
(mRNA-interfering-complementary RNA) (Mizuno et al. (1984) Proc
Natl Acad Sci USA 81, 1966-1970), miRNA (Ambros. (2001) Cell 107,
823-826) and siRNA (Billy et al. (2001) Proc Natl. Acad Sci USA 98,
14428-14433), interfere with the function of the specific target
RNAs. The ribozyme also acts on the target RNA specifically and
interferes with its function (Puerta-Fernandez et al. (2003) FEMS
Microbiol Rev 27, 75-97). The present inventors propose that PemK
and PemK homologues (including MazF) form a novel endoribonuclease
family with a new mRNA-interfering mechanism that effects cleavage
of mRNAs at specific sequences. As such, they have been designated
herein as "mRNA interferases". As reported previously, Kid (PemK)
triggers apoptosis in human cancer cells, while K is (PemI)
inhibits the toxic effect of Kid (PemK) (de la Cueva-Mendez et al.
(2003) supra). This new regulatable mRNA-interfering system may,
therefore, be useful for therapeutic intervention (e.g., gene
therapy) of human disease.
Example V
[0477] As shown herein, PemK functions as a highly
sequence-specific endoribonuclease, which cleaves cellular mRNAs at
UAX sequences, wherein X is C, A or U. Such activity may effectuate
a partial or total inhibition of protein synthesis in a cell. The
predicted frequency of an UAX sequence in an RNA transcript
(wherein X is C, A, U) is three in 64, based on standard
calculations predicated on an equal probability that any one of the
four nucleotides will be incorporated at each one of the first two
nucleotide positions and any one of the three indicated nucleotides
will be incorporated into the third nucleotide position. It is to
be understood that some RNA transcripts comprise a lower or higher
frequency of UAX sequences as compared to the predicted frequency.
Accordingly, the sensitivity of a specific RNA transcript or a
family of related RNA transcripts to cleavage by a PemK
endoribonuclease is dependent upon the frequency of UAX sequences
or PemK target sequences in the transcript. Moreover, one of
ordinary skill in the art could predict, based on the sequence of
an RNA transcript, the sensitivity of the transcript to PemK
mediated cleavage.
Example VI
[0478] RNA interferases, in general, and specific RNA interferases
of the present invention may also be used to advantage as
components of in vivo and in vitro protein production systems,
wherein background (non-specific) protein production is
dramatically reduced or eliminated so as to generate a
"single-protein" synthesizing system. Proteins expressed using a
"single-protein" synthesizing system are essentially free of
contaminating proteins and are, therefore, useful for applications
wherein "pure" protein preparations are advantageous or necessary.
Such applications include, but are not limited to nuclear magnetic
resonance (NMR) analysis of a protein without purification and
other structural determinations of proteins, including those
involving membrane proteins. With regard to structural analyses of
membrane proteins, membrane protein preparations generated using a
method of the present invention are well suited for protocols
involving solid state NMR. In a preferred aspect, a method of the
present invention can be used to advantage to exclusively label a
specific membrane protein with radioactive isotope in a cellular
context. The labeled membrane protein is subsequently incorporated
via endogenous cellular machinery into an appropriate cellular
membrane wherein it is readily detected by virtue of its label.
[0479] In order to construct a single-protein synthesizing system
for either in vivo or in vitro applications, the system is
pretreated with an mRNA interferase (e.g., PemK and/or MazF) which
cleaves endogenous mRNAs to block protein synthesis from these
mRNAs. To effect such pretreatment in vivo, a regulatable gene for
an mRNA interferase is introduced into a cell or tissue and its
expression induced. Methods for introducing and expressing
exogenous genes into cells and/or tissues are described herein
above and known in the art. To effect mRNA interferase pretreatment
in vitro, a purified mRNA interferase is added to an in vitro
translation system. Various in vitro translation systems are known
in the art and consist of, but are not limited to, extracts derived
from rabbit reticulocytes, wheat germ and E. coli. For production
of a "single protein" in either of these in vivo or in vitro
systems, a genetic construct encoding the desired protein is
engineered to transcribe an mRNA from which all of the mRNA
interferase-target sequences have been removed. This procedure
generates an mRNA which is not susceptible to the endonuclease
activity of the mRNA interferase added to the "single protein"
expression system. Such an engineered mRNA transcript of the
invention may be referred to herein as an "interferase resistant
mRNA". Expression of an interferase resistant mRNA is carried out
by inducing its expression from, for example, an engineered
construct. The interferase resistant mRNA is translated into
protein, essentially in the absence of translation of any other
proteins that are susceptible to the activity of the mRNA
interferase, thus producing, in essence, a single protein sample.
This approach can be applied to either prokaryotic or eukaryotic
systems.
[0480] It is to be understood that treatment with an mRNA
interferase can also be rendered concomitantly with the
expression/induction or addition of an interferase resistant mRNA.
Such an approach may be used in conjunction with either in vitro or
in vivo (cell-based) systems of the invention directed to single
protein synthesis.
[0481] Cell-Based Expression Systems:
[0482] In that MazF is a sequence specific (ACA) endoribonuclease,
functional only for single-stranded RNA (Zhang et al. 2003, supra),
a cell-based "single-protein" synthesizing system was developed to
exemplify the utility of MazF in such applications.
[0483] Accordingly, a single protein synthesizing system was
developed to synthesize mature human eotaxin in bacterial cells. To
achieve this end, a novel nucleic acid sequence that encodes the
wild type eotaxin amino acid sequence was synthesized. RNA
molecules transcribed from this novel nucleic acid sequence are
devoid of ACA sequences. See FIG. 35; SEQ ID NOs: 30-31 (nucleic
and amino acid sequences of mature human eotaxin, respectively).
This novel nucleic acid sequence encoding mature human eotaxin was
cloned into a cold-shock vector (pCOLDI), which expresses proteins
when in the presence of IPTG induced by incubation at low
temperature. See FIG. 36. A significant advantage of this
expression system is a low background of non-specific protein
expression.
[0484] It is to be understood that nucleic acid sequences encoding
polypeptides of interest can be generated using a variety of
approaches. Such approaches include: designing and generating a
synthetic nucleic acid sequence capable of encoding a polypeptide
of interest, wherein the nucleic acid sequence is devoid of ACA
sequences; and isolating a nucleic acid sequence capable of
encoding the polypeptide of interest and mutating each ACA sequence
therein to an alternate triplet sequence, wherein such mutations
are silent with regard to altering the amino acid sequence encoded
therefrom.
[0485] Methods and Materials
[0486] Cold Shock Induction with pCold I Vector:
[0487] Since the pCold I vector comprises a lac operator, 1 mM IPTG
is added to induce expression of genes controlled by this
regulatory element. For some proteins, induction at 15.degree. C.
after the cells reach mid-log phase (OD.sub.600=0.4-0.7) is
preferred to achieve improved folding of the protein. To determine
conditions best suited to optimal protein yield, samples are
removed at different time intervals following induction and
evaluated by SDS-PAGE analysis. .quadrature.In general, cells are
maintained in LB medium while expression induced, but when it is
desirable to label a protein with a radioactive isotope, for
example, .sup.15N or .sup.13C labeling, M9 or MJ9 medium is
used.
[0488] The nucleotide sequence from the SD site to the multiple
cloning site of the pCold I vector is shown herein below. The
expressed protein comprises a 15-residue removable sequence at the
N-terminus, consisting of a downstream box (DB), which is a
translation enhancing cis-element, a His.sub.6 tag and a factor Xa
site followed by the multiple cloning sites.
TABLE-US-00003 SD GAGG Sequences downstream of SD (SEQ ID NO: 29)
TAAT CC DB (SEQ ID NO: 30) ATGAATC AAGTG His.sub.6 (SEQ ID NO: 31)
CATCATCATCATCATCAT factor Xa site (SEQ ID NO: 32) ATCGAAGGTAGG
multiple cloning site (SEQ ID NO: 33) CATATGGAGCTCGGTACCCTCGAG
GGATCC NdeI SacI KpnI XhoI BamHI GAATTCAAGCTTGTCGACCTGCAGTCTAGA
EcoRI .quadrature.HindIII SalI PstI XbaI
[0489] For constructing pCold(SP)eotaxin (also referred to herein
as pSPSeotaxin), two ACA sequences indicated above in bold,
italicized font are changed to ATA to remove recognition sites for
MazF interferase.
[0490] It should be appreciated that the method of the present
invention can be used with any expression vector or expression
vector system (e.g., the pET vector). The pCold I vector is
presented as an exemplary vector and the above example is not
intended to limit the scope of the invention.
[0491] Specific Methodological Details Pertaining to Drawings
[0492] FIG. 37. E. coli BL21(DE3) comprising pACYCmazF or BL21(DE3)
comprising pACYCmazF and pCold(SP)eotaxin were grown in M9-glucose
medium containing appropriate antibiotics. When the OD.sub.600 of
the culture reached 0.5, the culture was shifted to 15.degree. C.
for 15 minutes and 1 mM IPTG was added to the culture. At the
indicated time intervals, 1 ml of culture was removed and added to
a test tube containing 10 .mu.Ci .sup.35S-methionine. After
incubation for 15 minutes (pulse), 0.2 ml of 50 mg/ml methionine
was added and incubated for 5 minutes (chase). The labeled cells
were washed with M9-glucose medium and suspended in 100 .mu.l of
SDS-PAGE loading buffer. 10 .mu.l of each sample was analyzed by
SDS-PAGE followed by autoradiography.
[0493] Results
[0494] pCOLDI comprising a novel nucleic acid sequence encoding
mature human eotaxin was used as a template. See FIG. 36. The
resultant plasmid was designated pCold(SP)eotaxin. Plasmid
pACYCmazF comprising a mazF gene under the control of a T7 promoter
was used for inducing expression of MazF. E. coli BL21(DE3) cells
comprising either pACYCmazF alone or pACYCmazF and pCold(SP)eotaxin
were grown in M9-glucose medium containing appropriate antibiotics.
When the OD.sub.600 of the culture reached 0.5, the culture was
shifted to 15.degree. C. for 15 minutes and 1 mM of IPTG was added
to the culture. At the indicated time intervals, 1 ml of culture
was added to a test tube containing 10 .mu.Ci .sup.35S-methionine.
After a 15 minute incubation in the presence of label (pulse), 0.2
ml of 50 mg/ml methionine was added and the culture incubated for 5
minutes (chase). The labeled cells were washed with M9-glucose
medium and suspended in 100 .mu.l of SDS-PAGE loading buffer. 10
.mu.l of each sample was analyzed by SDS-PAGE followed by
autoradiography. Expression of the mazF gene inhibited the protein
synthesis in BL21(DE3) cells, as reported previously (Tharig et al.
2003, supra). Synthesis of mature human eotaxin, however, which is
encoded by an mRNA which does not comprise an ACA sequence, was not
inhibited by mazF expression. See FIG. 37. This result demonstrates
that large quantities of a single protein can be obtained using the
single-protein production method of the present invention.
[0495] Of note, parallel experiments have also been performed
wherein. E. coli BL21(DE3) cells comprising only pCold(SP)eotaxin
were grown in M9-glucose medium containing appropriate antibiotics.
Such experiments reveal the effect of MazF expression in this
system. When cells carrying pCold(SP)eotaxin were cold-shocked in
the absence of MazF induction, a large number of background E. coli
proteins were also produced together with human eotaxin. As
described herein above, when MazF is induced together with eotaxin,
the cellular protein background is dramatically reduced. After 3
hours of MazF induction, background protein synthesis is almost
completely eliminated, creating cells which are able to continue to
produce only a single protein, namely human eotaxin.
[0496] The production of eotaxin lasts for at least 72 hours and
the rate of eotaxin production is unchanged during the first 36
hours, indicating that the protein-synthesizing capacity of the
cells is unaffected by MazF expression for almost 3 days. This
demonstrates that ribosomes, tRNAs, all the other cellular
components required for protein synthesis are not affected by MazF
induction. These results also imply that energy metabolism and
nucleotide synthesis, as well as amino acid biosynthesis, are
largely unaffected by MazF expression.
[0497] It is also noteworthy that during the 72-hour incubation of
the cell culture wherein MazF expression is induced, the OD.sub.600
(0.5) did not increase, indicating that cell growth after MazF
induction is completely inhibited, while the cells maintain full
protein synthesis capacity. In the absence of MazF induction,
however, the OD.sub.600 increases from 0.5 to 1.2 during the
72-hour incubation at 15.degree. C. as evidenced by the production
of background cellular proteins.
[0498] In order to determine the production levels of eotaxin in
the above expression system, the same amount of the culture is
isolated and analyzed by SDS-PAGE. At 36 hr after cold shock, a
clearly detectable, stained eotaxin band is evident and accounts
for approximately 5% of total cellular protein. These results were
obtained using M9 minimum medium as described above. The use of M9
medium is important for isotopic-enrichment of proteins with
.sup.13C-glucose and .sup.15N--NH.sub.4Cl. If it is, however,
desirable to produce unlabeled proteins in a large quantity, a rich
medium such as L-broth (LB) medium can alternatively be used.
Indeed, the present inventors have found that eotaxin production
can be as high as 20% of the total cellular protein or 40 mg/l of
culture (1 g from 25 liter culture) in cultures incubated in LB
medium. It is important to note that eotaxin produced in cells
incubated in either M9 or LB medium is completely soluble and no
inclusion forms are formed.
[0499] As indicated herein above, cell mass does not increase
during the incubation period because cell growth is completely
inhibited during the cold-shock incubation. The cellular machinery
is, therefore, exclusively dedicated to the production of a cloned
gene in a pCold vector upon cold shock in the present single
protein production (SPP) system. Therefore, upon MazF induction, a
cell culture can be concentrated to a degree not consistent with
maintained viability under conditions wherein cell growth occurs.
Indeed, the present inventors have determined that exponentially
growing cultures can be concentrated at least 4 fold (OD.sub.600
from 0.7 to 2.8) without affecting the yield of the cloned gene
product. This means that one can use only 25% of the medium used
for normal cultures wherein cell growth occurs. In other words, 1 g
of human eotaxin can potentially be produced using only 6.5 liters
of LB medium. This is a particularly relevant advantage of the SPP
system of the present invention because this feature dramatically
reduces the cost involved in expressing large amounts of proteins
or isotope-enriched proteins for NMR structural study.
[0500] Cell-Free Expression Systems:
[0501] Extracts from rabbit reticulocytes, wheat germ and E. coli
comprise the most frequently used cell-free translation systems.
All are prepared as crude extracts which comprise the
macromolecular components (70S or 80S ribosomes, tRNAs,
aminoacyl-tRNA synthetases, initiation, elongation and termination
factors, etc.) necessary for translation of exogenous RNA. Each
extract is generally supplemented with amino acids, energy sources
(ATP, GTP), energy regenerating systems (creatine phosphate and
creatine phosphokinase for eukaryotic systems, and phosphoenol
pyruvate and pyruvate kinase for the E. coli lysate), and other
co-factors (Mg.sup.2+, K.sup.+, etc.) to ensure efficient
translation.
[0502] The genetic material used (e.g., RNA or DNA) determines
which of the two approaches to in vitro protein synthesis is of
utility. Standard translation systems, such as reticulocyte
lysates, use RNA as a template, whereas "coupled" and "linked"
systems utilize DNA templates which are transcribed into RNA, which
is subsequently translated.
[0503] Rabbit Reticulocyte Lysate:
[0504] Rabbit reticulocyte lysate is an efficient in vitro
eukaryotic protein synthesis system used for translation of
exogenous RNAs (either natural or engineered). Reticulocytes are
highly specialized enucleated cells whose in vivo function is
primarily directed to the synthesis of hemoglobin, which comprises
more than 90% of the protein synthesized by reticulocytes. These
immature red cells possess all of the necessary machinery to
produce large quantities of globin protein, including sufficient
globin mRNA and components of the cellular translation system (as
detailed herein above and known in the art). The endogenous globin
mRNA can be eliminated by incubation with Ca.sup.2+-dependent
micrococcal nuclease, which is later inactivated by chelation of
the Ca.sup.2+ by EGTA. Such nuclease-treated lysates exhibit low
background and efficient utilization of exogenous RNAs at even low
concentrations. Exogenous proteins are synthesized at a rate close
to that observed in intact reticulocyte cells. Either untreated or
treated reticulocyte lysates may be used for the synthesis of
larger proteins from either capped or uncapped RNAs (eukaryotic or
viral).
[0505] Wheat Germ Extract:
[0506] In that wheat germ extract has minimal background
incorporation due to low levels of endogenous mRNA, it is a
convenient alternative to rabbit reticulocyte extracts. Wheat germ
extract efficiently translates exogenous RNA from a variety of
different organisms, including those derived from viruses, yeast,
higher plants, and mammals. It is a preferred system in which to
translate RNA containing small fragments of double-stranded RNA or
oxidized thiols, which inhibit rabbit reticulocyte lysate.
[0507] Capped or Uncapped RNA Templates:
[0508] Both reticulocyte lysate and wheat germ extract are
effective systems for translating in vitro transcribed RNA or RNA
isolated from cells or tissue. The presence of a 5' cap structure
may enhance translational activity when using RNA synthesized in
vitro. Translation by wheat germ extracts is generally more
cap-dependent than translation by reticulocyte lysate extracts. If
determined to be desirable, RNA capping can be achieved by
subcloning the coding sequence into a prokaryotic vector, which can
be expressed directly from a DNA template in an E. coli cell-free
system.
[0509] In standard translation reactions, purified RNA is used as a
template for translation. "Linked" and "coupled" systems, on the
other hand, use DNA as a template. RNA is transcribed from the DNA
and subsequently translated without any purification. Such systems
typically require template DNA with a prokaryotic phage polymerase
promoter (T7, T3, or SP6). An RNA polymerase (e.g., that of a
prokaryotic phage) transcribes the DNA into RNA, and eukaryotic or
prokaryotic extracts translate the RNA into protein. DNA templates
for transcription:translation reactions may be cloned into plasmid
vectors or generated by PCR. The "linked" system is a two-step
reaction, involving transcription using a bacteriophage polymerase
and subsequent translation in a rabbit reticulocyte or wheat germ
lysate. The transcription and translation reactions may be
performed separately or may be coupled.
[0510] E. coli Extracts:
[0511] Unlike eukaryotic systems in which transcription and
translation occur sequentially, transcription and translation occur
simultaneously in E. coli cells. In vitro E. coli translation
systems, therefore, involve a one-step reaction. During
transcription, the 5' end of the RNA becomes available for
ribosomal binding, and undergoes translation while its 3' end is
still being transcribed. The early binding of ribosomes to the RNA
maintains transcript stability and promotes efficient translation.
Thus, bacterial translation systems are well suited for expeditious
expression of either prokaryotic or eukaryotic gene products. In a
preferred embodiment, a Shine-Dalgarno ribosome binding site is
included upstream of the initiator codon of a DNA template used in
order to promote high protein yield and optimal initiation
fidelity. Capping of eukaryotic RNA is not required in E. coli
translation systems.
[0512] E. coli extracts also confer additional benefits in that
cross-reactivity or other problems associated with endogenous
proteins in eukaryotic lysates are reduced or eliminated. Moreover,
the E. coli S30 extract system enables expression from DNA vectors
comprising natural E. coli promoter sequences (such as lac or tac).
E. coli cell-free systems consist of a crude extract rich in
endogenous mRNA. To prepare the extract for use in
transcription/translation, it is incubated to effect translation of
the endogenous mRNA, which is subsequently degraded. The resultant
low levels of endogenous mRNA in such prepared lysates enable
identification of the exogenous synthesized product.
[0513] Eukaryotic Translation Signals:
[0514] Some significant differences exist between prokaryotic and
eukaryotic mRNA transcripts that should be taken into
consideration. Eukaryotic mRNAs are usually characterized by two
post-transcriptional modifications: a 5'-7 methyl-GTP cap and a 3'
poly(A) tail. Both of these modifications contribute to the
stability of the mRNA by preventing premature degradation. The 5'
cap structure also enhances the translation of mRNA by promoting
binding to the eukaryotic ribosome and ensuring recognition of the
proper AUG initiator codon. The consensus sequence, or "Kozak"
sequence, is generally considered the strongest ribosomal binding
signal in eukaryotic mRNA. For efficient translational initiation,
the key elements are the G residue at the +1 position and the A
residue at the -3 position of the Kozak sequence. An mRNA that
lacks a Kozak consensus sequence may be translated efficiently in
eukaryotic cell-free systems, if it comprises a moderately long
5'-untranslated region (UTR) that lacks stable secondary
structure.
[0515] Prokaryotic Translation Signals:
[0516] The ribosome is guided to the AUG initiation site by a
purine-rich region referred to as the Shine-Dalgarno (SD) sequence
in bacteria. This sequence is complementary to the 3' end of the
16S rRNA in the 30S ribosomal subunit. The SD region, which is
located upstream of the initiation AUG codon, comprises a consensus
sequence known in the art. Specific mRNAs vary considerably in the
number of nucleotides that complement the anti-Shine-Dalgarno
sequence of 16S rRNA, ranging from as few as 2 to 9 or more. The
position of the ribosome binding site (RBS) in relation to the AUG
initiator is very important for efficiency of translation (usually
from -6 to -10 relative to the A of the initiation site).
Example VII
[0517] The present invention also encompasses a method for
producing large quantities of small single-stranded RNA, which
method involves simple biochemical procedures. Development of this
method enables the production of large quantities of siRNA or
miRNA, for example, which does not require expensive chemical
synthetic procedures.
[0518] Briefly, RNA comprising a plurality of a short identical
sequence, which is tandemly repeated in the RNA, is synthesized
using T7 RNA polymerase. The tandemly-repeated sequences in the RNA
are separated by a triplet sequence which can be specifically
cleaved by an mRNA interferase of the invention, such as MazF
(which cleaves specifically at ACA sequences) or PemK (which
cleaves specifically at, for example, UAC sequences). Subsequent
treatment of an RNA comprising tandemly-repeated sequences
separated by an interferase recognition sequence (i.e., a specific
triplet sequence) with an mRNA interferase which recognizes the
incorporated sites will thus yield identical small RNAs.
Experimental Approach
[0519] The production of a 21mer,
TABLE-US-00004 (SEQ ID NO: 34) CAGGAGAUACCUCAAUGAUCA
Step 1: Synthesis of the Following Two 21 mer DNA Fragments
(5'-Ends are Phosphorylated)
TABLE-US-00005 [0520] (SEQ ID NO: 35) 11 21 1 10
5'p-CTCAATGATCACAGGAGATAC-3' (SEQ ID NO: 36)
3'-TCCTCTATGGAGTTACTAGTG-p 5'
Step 2: Ligation to Obtain Multimers
[0521] Step 3: PCR with the Following Two Primers
TABLE-US-00006 (SEQ ID NO: 37) 1 12 #1 5'-(T7
promoter)-GGGACAGGAGATACCT-3' (SEQ ID NO: 38) #2
3'-TGTCCTCTATGGAGTTACTAGTG-5'
Step 4: RNA Production with T7 RNA Polymerase Using the DNA
Fragment from (Step 3) Step 5: MazF Treatment of the RNA Products
from Reaction (Step 4) and Purification of the 21 Mer Product.
[0522] For some applications, it may be advantageous to use
His-tagged T7 RNA polymerase and/or MazF to enable their removal
from the reaction mixture using a nickel column.
[0523] A skilled artisan will appreciate that the presence of an
ACA triplet in the nucleic acid sequence of a desired RNA sequence
precludes use of MazF as the interferase for digesting the RNA.
Under such circumstances, PemK, which is specific for UAC (U or A)
triplet sequences, for example, may be used instead of MazF. In
short, an analysis of the RNA sequence in question should be
rendered to determine what, if any, recognition sites for known RNA
interferases are present. Such an analysis is useful for assessing
which RNA interferase(s) is of utility for applications involving a
particular RNA.
[0524] The present invention, therefore, describes a method for
producing large quantities of high quality small RNAs (e.g., siRNA
or miRNA) that uses straightforward biochemical means. As such, the
method provides a cost effective substitute for expensive and
technically challenging protocols involving chemical synthesis of
small RNAs.
Example VIII
[0525] Induction of Cell Death by an mRNA Interferase:
[0526] When induced, MazF and PemK cleave cellular mRNAs in a
sequence-specific manner and effectively inhibit protein synthesis,
leading to cell growth inhibition and cell death. It has been
demonstrated that PemK (Kid) expression inhibits cell proliferation
in yeast, Xenopus laevis and human cells. The co-expression of PemI
(Kis) in these cells restores cellular proliferation, thereby
releasing cells from the inhibitory effects of PemK (de la
Cueva-Mendez et al., 2003, supra). As described herein below, the
effects of MazF induction on human cells are examined. Although the
T-Rex system (Invitrogen) was used to control induction of MazF in
this example, a skilled artisan would appreciate that any inducible
expression system may be used in the context of the present
invention. The choice of the inducible system is based on several
experimental considerations, including, but not limited to, the
cell type in which the induction is effected, the level of
expression desired, and the kinetics of induction.
[0527] Plasmids and Cell Lines:
[0528] The E. coli mazF gene is cloned into the pcDNA4/TO vector
(Invitrogen) under the control of a tetracycline operator TetO2,
creating plasmid pcDNA4/TO-MazF. The pcDNA4/TO-MazF plasmid is
transformed into the T-Rex-293 cells (Invitrogen), creating the
T-Rex 293/MazF cell line, in which the expression of MazF is
induced by the addition of tetracycline. The E. coli mazE gene is
cloned into the pcDNA3 vector, creating plasmid pcDNA3-MazE. The
pcDNA3-MazE is transformed into the T-Rex 293/MazF cells, creating
the T-Rex 293/MazF/MazE cell line.
[0529] The Toxic Effect of MazF on Human Cells:
[0530] MazF expression is induced in the T-Rex 293/MazF cells in
the presence of tetracycline. At the various time points, dead
cells in the cell population are counted by staining with a
cellular viability dye comprised of Trypan Blue solution (0.4%)
(Sigma). The control experiment is performed in parallel under the
same conditions, but in the absence of tetracycline. As shown in
FIG. 38, the cellular morphology of T-Rex 293/MazF cells induced to
express MazF is dramatically altered by the first day of MazF
induction as compared to that of control (uninduced) cells.
Notably, about 50% of those cells induced to express MazF are dead
by the fifth day, and 80% of induced cells are dead by the seventh
day (FIG. 38). These results demonstrate that MazF is toxic to
human cells.
[0531] The present invention encompasses the use of any suitable
mRNA interferase whose expression is responsive to or controlled by
an inducible regulatory element(s). Suitable mRNA interferases
include those capable of mediating toxic effects when expressed in
a cellular context. In a particular embodiment, the cell in which
an mRNA interferase is expressed is a mammalian cell. Exemplary
mRNA interferases of the invention include orthologs and homologs
of E. coli MazF.
[0532] Accordingly, the present invention also encompasses the use
of mRNA interferases of the invention in applications directed to
gene therapy. Cells that are engineered to express a' molecule,
which is defective or deficient in a subject (e.g., a human
subject), can also be designed to self destruct via the
incorporation of an mRNA interferase of the invention, the
expression of which is controlled by an inducible regulatory
element(s). Incorporation of an inducible means for the destruction
of cells used for gene therapy applications provides a fail-safe
mechanism whereby such cells can be eliminated after they have
conferred beneficial effects to a subject and/or before they can
cause deleterious effects.
Example IX
[0533] Generation of a MazFmutants:
[0534] A MazF mutant (E24A) has been generated in which the
glutamic acid (Glu) at position 24 is substituted with an alanine
(Ala). As a result of the mutation, the mRNA interferase activity
as measured with a synthetic substrate is reduced approximately 10
fold. This reduction in MazF activity is important for a variety of
reasons. First, as a result of the mutation, the toxicity to a host
cell in which the MazF (E24A) mutant is expressed is significantly
reduced. Reduced toxicity enables increased production levels of
the MazF mutant in a cell. When using, for example, the pET 28a
system, a reasonably high production of MazF has been achieved
(approximately 15 mg/l after purification). This high level of
expression is important for obtaining a reasonable amount of MazF,
which may be doubly labeled with .sup.15N and .sup.13C for NMR
structural determination. Second, the low mRNA interferase activity
of the mutant MazF is important for determining the RNA interacting
sites on the MazF dimer, which can be assessed by adding a
substrate RNA to the .sup.15N, .sup.13C-labeled MazF sample. Third,
since the mutant MazF retains mRNA interferase activity, the
structure of the mutant MazF is likely to be similar to the
three-dimensional structure of the wild-type MazF dimer, and its
structure complexed with RNA is expected to provide insights into
the molecular mechanism for the MazF mRNA interferase function.
[0535] The expression of the mutant MazF is carried out with pET
28a so that the product contains an N-terminal 20 residue extension
(FIG. 39A), which contains the His-tag and a thrombin cleavage
site. The N-terminal extension can be cleaved from the fusion
protein as shown in FIG. 39B. The arrow in FIG. 39A indicates the
thrombin cleavage site. To cleave the full length MazF(E24A) fusion
protein, 0.04 units of thrombin is added to 10 .mu.g Ni-NTA
purified (His).sub.6MazF(E24A) and incubated at 4.degree. C. for 8
hr. The cleaved N-terminal fragment is removed using a Ni-NTA
column. FIG. 39 shows the successful cleavage and isolation of
cleaved MazF fusion protein (lane 1, purified
(His).sub.6MazF(E24A); lane 2, (His).sub.6MazF(E24A) after thrombin
cleavage). Heteronuclear single quantum coherence (HSQC) spectra
before and after the removal of the N-terminal extension reveal
that the protein is stable for over a week at room temperature.
[0536] In addition, a MazF mutant in which Arg 29 is replaced with
Ala has been generated. This (R29A) mutant was also found to be
less toxic than wild type MazF, thus enabling its overexpression.
Purified .sup.15N-labeled MazF (R29A) has, for example, been
produced at a level of 10 mg/L. This mutant also produced an
excellent HSQC spectrum.
Example X
Identification and Characterization of MazF Homologs from
Pathogenic Bacteria
[0537] Identification and characterization of MazF Homologs from
Mycobacterium tuberculosis (M. tuberculosis):
[0538] Tuberculosis (TB) is a chronically infectious disease that
causes more than 2 million deaths every year. It is likely one of
the oldest human diseases and is caused by M. tuberculosis. The
present inventors have identified a gene (rv2801c) on the M.
tuberculosis chromosome, which encodes a protein that is highly
homologous to E. coli MazF. Specifically, the present inventors
have cloned the rv2801c gene and determined that it encodes a
protein of 118 amino acid residues having 40% identity to E. coli
MazF. See FIG. 41A. This M. tuberculosis MazF gene (designated
herein as MazF-mt1) has been cloned into pBAD; expression of
MazF-mt1 from the pBAD vector in response to arabinose induction is
toxic in E. coli. Of note, the cell colony-forming units (CFU) are
decreased by about 10.sup.4 fold after 60 minutes of MazF-mt1
induction. MazF-mt1 has also been cloned into pET28a and a
(His).sub.6-tagged MazF-mt1 has been successfully expressed and
purified on a Ni-NTA column.
[0539] As shown in FIG. 40, MazF-mt1 exhibits specificity for
cleaving RNA at UAC sequences, a similar specificity to that of
PemK. MazF-mt1 is, therefore, a bona fide member of the mRNA
interferase family of proteins. In brief, era mRNA was synthesized
by T7 RNA polymerase and the cleavage reaction was carried out as
described herein above. The primer extension and the DNA ladder are
obtained using the same primer. The MazF-mt1 cleavage sites are
indicated by arrowheads.
[0540] In addition to the MazF-mt1 gene, the present inventors have
also identified four additional MazF homologs encoded by the M.
tuberculosis chromosome, genomic designations for which are
Rv0456A, Rv1991C, Rv0659C and Rv1942C. See FIG. 41B. As shown by
the sequence alignment of these genes with MazF, each of these
sequences is homologous to E. coli MazF and has, therefore, been
identified as an M. tuberculosis MazF homolog. MazF homologs
encoded by Rv1991c, Rv0456a, Rv0659c and Rv1942c protein are
designated MazF-mt2, -mt3, -mt4 and -mt5, respectively. Nucleic and
amino acid sequences of MazF-mt1, -mt2, -mt3, -mt4 and -mt5 are
shown in FIGS. 43A-E and 44A-E.
[0541] The genes encoding MazF-mt2, 3, 4 and 5 will be cloned into
pBAD vector and their effects on E. coli cell growth examined upon
induction of their expression in the presence of arabinose as
described herein above for MazF-mt1. In vivo mRNA cleavage
following induction of the M. tuberculosis MazF homologs will also
be assessed as described in detail herein above, using Northern
blot and primer extension analysis. The in vitro and in vivo
protein synthesis will also be examined in the presence of M.
tuberculosis MazF homologs.
[0542] Each of the five M. tuberculosis MazF genes will also be
cloned into the mycobacterial expression vector pMIP12 (Picardeau
et al. (2003) FEMS Microbiol Lett 229, 277-281) to enable their
expression in Mycobacterium smegmatis (a model nonpathogenic,
fast-growing species of the genus Mycobacterium) to test their
toxic effects in this bacterium under different growth conditions.
It is particularly interesting to elucidate how the genes for
MazF-mt are regulated in M. tuberculosis. The pathogenesis of
tuberculosis depends on the formation of lung granulomas, which are
also the site of the organism's persistence in a non-growing state,
brought about by oxygen and nutrient limitation. Understanding the
physiology of the bacteria in this latent state is crucial to
improving diagnosis and treatment of this devastating disease. DNA
microarray analysis of M. tuberculosis genes will be performed
under different growth conditions to determine how MazF-mt genes
are regulated in response to, such conditions.
[0543] The redundancy of bacterial toxin-antitoxin pairs suggests
that they play an important role in cellular physiology. A variety
of growth conditions have been explored to examine the in vitro
conditions that induce expression of the genes encoding these
molecules. A number of studies have suggested that one of the
conditions for induction of mazF depends upon ppGppp and the
stringent response. For example, one of the earliest observations
was that a mutant mazEF null E. coli did not die after ppGppp
levels were artificially increased (Aizenman et al., 1996, supra).
The M. tuberculosis relA gene, encoding the ppGpp synthetase, has
been cloned and characterized and shown to play a role in long-term
survival in vitro (Primm et al., 2000, J Bacteriol 182, 4889-4898).
These workers showed increased ppGpp(p) levels in all of the
conditions listed below. To extend these findings to investigate
the transcriptional response of MazF homologs to varied growth
conditions, RNA will be prepared from virulent M. tuberculosis
(strain H37Rv) subjected to the set of conditions listed, below,
and quantitative polymerase chain reaction (Q-PCR) will be used to
evaluate the transcriptional response of the MazF homologs.
[0544] Growth Conditions
[0545] Stationary phase: H37Rv cells are grown in normal
mycobacterial medium (Middlebrook 7H9 supplemented with 0.2%
dextrose, 0.2% glycerol, 0.5% BSA fraction V and 0.1% Tween 80).
After reaching an OD.sub.600 (M. tuberculosis has a doubling time
of approximately 24 hrs), a 3 day in stationary phase follows,
after which total RNA is prepared from the cells. The control for
this experiment is RNA from cells in the mid-logarithmic phase of
growth.
Azide: H3'7Rv cells in mid-logarithmic growth are split into two
cultures; one of which is treated with 5 mM sodium azide for 2 hr.
Carbon starvation: H37 Rv cells in early to mid-logarithmic phase
are washed and resuspended in 7H9 medium without a carbon source
for 24 hr. Amino acid downshift: H37Rv are grown to mid-logarithmic
phase in 7H9 medium, supplemented with 20 amino acids. The cultures
are washed extensively in amino acid-free medium, split into two
cultures and fresh medium, one with amino acids and one without,
for 24 hours. Amino acid starvation: E. coli cells when treated
with serine hydroxymate, are starved for the amino acid L-serine,
and have been shown to induce the expression of mazEF locus
(Christensen et al., 2003, supra). M. tuberculosis showed no
increase in ppGpp(p) when treated with serine hydroxymate
suggesting that this species may be insensitive to the toxic
effects of this amino acid analog (Primm et al., 2000, supra).
Amino acid analogs with characterized toxic effects will be tested
for the ability to induce the MazF-mt homologues. Antibiotic
treatment: Antibiotics known to affect protein synthesis
(streptomycin) and RNA transcription (rifampin) in M. tuberculosis,
are tested for the ability to induce the MazF homologues in
H37Rv.
[0546] M. tuberculosis lies in a state of latency in about
one-third of the world's population, sealed within granulomatous
lesions, presumably without access to nutrients or oxygen (Flynn
and Chan, 2001, Annu Rev Immunol 19, 93-129). Reactivation of
disease occurs when the immune system of the host is somehow
compromised (by, e.g., HIV status, poor nutrition, etc).
Alarmingly, an increasing number of latent cases among HIV-ridden
regions of the world are also multi-drug resistant and therefore
difficult or impossible to treat. Understanding the mechanism for
harnessing these endogenous mechanisms of direct bacterial growth
control, therefore, holds great promise for developing novel
therapies for this devastating disease. Accordingly, determining
the role of endogenous MazF-mt genes in both latent and
activated/reactivated states will offer insights useful for the
design and/or identification of alternative therapeutic agents.
[0547] The present inventors have also utilized BLAST searches to
reveal that MazF homologs exist in many prokaryotic organisms,
including other pathogens such as S. aureus and B. anthracis. See
FIG. 41. Specifically, the present inventors have identified MV1993
as a MazF homolog (MazF-sa1) in S. aureus. See FIG. 41B. S. aureus
is a gram-positive bacterium that is the most common gram-positive
pathogen causing nosocomial infection at hospitals. E. coli MazF
and MazF-sa1 exhibit 25% identity and 44% similarity.
[0548] In addition, MazF homologues are also identified in B.
anthracis and B. subtilis. See FIG. 41B. E. coli Mazes' and its
homolog in B. subtilis (MazF-bs1) exhibit 32% identity and 48%
similarity. E. coli MazF and its homolog in B. anthracis (MazF-ba1)
exhibit 32% identity and 48% similarity. B. anthracis and B.
subtilis are both gram-positive bacteria. There are only seven
amino acid substitutions between MazF-bs1 and MazF-ba1. The
differences in amino acid sequence and position are shown in FIG.
41B and are elaborated here, as indicated by the single letter
abbreviation for the residue present in the MazF-bs1 gene first,
then the numerical position, then the single letter abbreviation
for the residue present in the MazF-ba1 (A42V, R66K, D97E, E98V,
D101I, K102R and A112G). Nucleic and amino acid sequences of MazF
(Pem-like) homologs in S. aureus, B. subtilis, B. anthracis, and E.
coli ChpBK are shown in FIGS. 45A-D and 46A-D.
Example XI
Optimization of the SPP System in E. coli
[0549] The E. coli SPP system of the present invention may be
optimized for the expression of different proteins by varying,
among other experimental parameters, various growth conditions. A
skilled artisan would appreciate that the goals to be achieved in
this regard pertain to: (a) prolonged maintenance of a cell's
protein synthesizing capability after MazF induction; (b) reduction
or elimination of background cellular protein synthesis; and (c)
increased expression levels of a desired protein. It will also be
appreciated that the SPP system of the present invention may
involve the expression of mRNA interferases other than MazF.
Co-expression of factors, which may assist expression and/or
stability of products, may also be considered in the context of the
SPP system to achieve improved or optimal expression levels of a
polypeptide of choice.
[0550] The present inventors have varied a number of culture
conditions following MazF induction to optimize for production of a
protein of interest. Although these experiments are designed to
optimize expression of the human eotaxin gene, the principles are
equally well applied to the expression of other proteins. To begin,
the eotaxin gene was synthesized using preferred codons for E.
coli, but eliminating all ACA sequences in the gene. The synthetic
gene was cloned into pColdI vector to enable eotaxin expression
following induction by cold shock or temperature downshift to
15.degree. C. Using this eotaxin system, conditions are varied to
prolong the synthesis of eotaxin after the induction of MazF as
described below.
[0551] The present inventors have determined that MazF induction at
37.degree. C. followed by eotaxin induction at 15.degree. C.
significantly affects eotaxin production. Specifically, a
comparison of MazF induction at 15.degree. C. with MazF induction
at 37.degree. C. revealed that MazF induction at a higher
temperature substantially reduces background due to general
cellular protein synthesis. This finding was evidenced by the near
absence of detectable protein bands corresponding to expression of
cellular proteins. Under these experimental conditions, however,
eotaxin synthesis is also significantly reduced. At higher
temperatures, MazF may cause damage to the cells due to, for
example, increased susceptibility of ribosomes/tRNAs to
ribonuclease activity of MazF at higher temperatures; and/or
decreased stability of other cellular components, which are
required for protein synthesis, nucleotide and amino acid
biosynthesis, and energy production, at 37.degree. C. Since these
factors cannot be produced in the cells after MazF induction, their
loss or reduction would lead to reduction in eotaxin production
capacity.
[0552] In order to optimize protein expression, a number of
experimental parameters can be varied, including those described
below. It is to be understood that the following conditions are
described with regard to MazF and eotaxin, but are applicable to
other combinations of mRNA interferase and desired polypeptide. E.
coli BL21(DE3) carrying both pACYCmazF and pCold(SP)eotaxin are
cultured in M9 minimum medium (15-ml culture each) at 37.degree. C.
to mid-log phase (OD.sub.600=0.5 to 0.8). Then, MazF induction is
carried out at five different temperatures; 37, 30, 25, 20 and
15.degree. C. After 10 minutes of pre-incubation at these different
temperatures, 1 mM IPTG is added to induce MazF for 5, 10 and 15
minutes. Cultures are then maintained at 15.degree. C. for eotaxin
induction. The cells are labeled with .sup.35S-methionine for 15
minutes at 0, 0.5, 1, 2, 4, 8, 12, 24, 36, 48, 72 and 96 hr after
cold shock. The SDS-PAGE analysis of total cellular proteins
reveals the preferred conditions for the SPP system in terms of
background cellular protein synthesis, the rate of eotaxin
production, and the duration of eotaxin production. For this
determination and similar assessments for other polypeptides, the
actual amount of eotaxin or other polypeptide produced at each time
point is estimated by Coomassie blue staining.
[0553] The activity of intracellular proteases, such as Lon and
ClpP, may also contribute to protein accumulation and stability. It
has been shown, for example, that mutations in clpP and lon (single
or double mutations) significantly reduce the degradation of
cellular proteins in E. coli strains (Kandror et al., 1994, Proc
Natl Acad Sci USA 94, 4978-4981). In keeping with these findings,
the SPP system may be improved by constructing strains harboring
these mutations (lon, clpP and lon-clpP) by transducing these
mutations into BL21(DE3) cells by P1 transduction. Accordingly, an
examination of polypeptide accumulation in BL21(DE3) cells, wherein
one or more of these protease genes has been deleted, may reveal
improved protein yield at 3-4 days after the eotaxin induction in
the SPP system. In this fashion, particular conditions for the E.
coli SPP system can be established to achieve the highest
production of eotaxin with the lowest background of the cellular
protein synthesis. Moreover, as described herein above, such an
experimental approach is equally well applied to other SPP systems
wherein a different mRNA interferase and polypeptide are
utilized.
[0554] Another strategy for reducing levels of background cellular
protein synthesis is to increase the production of MazF. This may
be achieved by eliminating ACA sequences in the mazF gene, which
may lead to degradation of MazF transcripts. Surprisingly, there
are a total of nine ACA sequences in the mazF ORF which encodes a
111-residue protein. This frequency of ACA sequences is unusually
high with respect to a predicted frequency based on random chance.
These ACA sequences may play a role in MazF autoregulation, whereby
MazF cleaves its own mRNA at these ACA sites, and thereby results
in significant reduction of MazF protein production. On the basis
of these considerations, removal of some or all of the ACA
sequences in the mazF ORF is envisioned. See FIG. 42. Of note, the
proposed base changes therein do not alter the amino acid sequence
of MazF. To begin, the first 6 residues in the N-terminal half of
MazF are altered using a PCR-based approach and the resultant gene
designated mazFa. Independently, the three ACA sequences in the
C-terminal half are altered, together with a change of the codon
encoding Leu99 from UUA to CUG, which is a more preferred codon for
leucine in E. coli. The resultant gene is designated mazFb. A
combination of both mazFa and mazFb mutations serves to create
mazFa,b in which all ACA sequences are removed.
[0555] Using the wild-type mazF, mazFa (-6ACA), mazFb (-3ACA) and
mazFab (-9ACA), the effects of ACA removal from MazF can be
determined in the SPP system. Experimentally, the wild-type mazF
gene in pACYC mazF is replaced with mazFa, mazFb or mazFab. Using
these four plasmids, it is possible to examine how effectively the
removal of the ACA sequences from mazF reduces background protein
synthesis.
[0556] To achieve a higher yield of a protein using the SPP system,
the use of a rich media such as LB, rather than M9 medium, may be
preferred. Therefore, experimental parameters are varied to
optimize conditions for growth in LB medium. Various growth
conditions can be optimized for culturing in LB media as described
herein above. Such conditions include, but are not limited to,
optimal temperature for MazF induction, the optimal time period for
MazF induction, optimal temperature for eotaxin production, and
optimal incubation time to maximize eotaxin production. Although
these experiments are described as they pertain to eotaxin
production as a model system, the optimal conditions for the
highest yield of a different protein may vary. For each target
protein, therefore, minor experimental changes may be required to
achieve optimal expression levels. Other growth media, known to
those skilled in the art, may also be used in conjunction with the
SPP system and expression therein optimized as described herein
above for M9 and LB media.
[0557] As described herein above, the present inventors have
identified another mRNA interferase called PemK from plasmid R100
which cleaves mRNAs at UAC/A/U sequences. See Example IV. A number
of other mRNA interferases have also been identified, including
ChpBK from E. coli, five different mRNA interferases from M.
tuberculosis and one from Bacillus anthracis. All of the above
listed mRNA interferases are potential candidates that may be used
advantageously to improve the SPP system. Upon characterization of
their RNA-cleavage specificities, their effectiveness in the SPP
system will be determined and compared to that of MazF. Since these
mRNA interferases are expected to have different RNA cleavage
specificities, they may be more effective in reducing background
cellular protein synthesis and may cause less cellular damage than
MazF. These mRNA interferases are useful tools not only for
development of the SPP system in E. coli, but also for the
development of SPP systems in other organisms, including yeast.
[0558] The E. coli SPP system described herein utilizes pColdI
vectors, which induce protein production at low temperatures.
Protein production at low temperatures is beneficial for many
proteins, since they are frequently folded more efficiently and are
stable at lower temperatures. Nevertheless, co-expression of
molecular chaperones may further improve the yield of properly
folded proteins in the SPP system. For this purpose, the gene for a
cold-shock molecular chaperone known as trigger factor (Kandror and
Goldberg, 1997, supra) has been cloned for use in the SPP system of
the present invention. Since trigger factor is thought to assist
protein folding at low temperatures, the effect of co-expression of
trigger factor on expression of a desired protein may be used to
advantage in the SPP system. The genes for trigger factor, as well
as GroEL and GroES (heat shock molecular chaperones) will also be
cloned into the pColdI vector to examine the protein yield and the
effect on the solubility of expressed proteins.
[0559] While certain of the preferred embodiments of the present
invention have been described and specifically exemplified above,
it is not intended that the invention be limited to such
embodiments. Various modifications may be made thereto without
departing from the scope and spirit of the present invention, as
set forth in the following claims.
Sequence CWU 1
1
1201336DNAE. coli 1atggtaagcc gatacgtacc cgatatgggc gatctgattt
gggttgattt tgacccgaca 60aaaggtagcg agcaagctgg acatcgtcca gctgttgtcc
tgagtccttt catgtacaac 120aacaaaacag gtatgtgtct gtgtgttcct
tgtacaacgc aatcaaaagg atatccgttc 180gaagttgttt tatccggtca
ggaacgtgat ggcgtagcgt tagctgatca ggtaaaaagt 240atcgcctggc
gggcaagagg agcaacgaag aaaggaacag ttgccccaga ggaattacaa
300ctcattaaag ccaaaattaa cgtactgatt gggtag 3362111PRTE. coli 2Met
Val Ser Arg Tyr Val Pro Asp Met Gly Asp Leu Ile Trp Val Asp1 5 10
15 Phe Asp Pro Thr Lys Gly Ser Glu Gln Ala Gly His Arg Pro Ala Val
20 25 30 Val Leu Ser Pro Phe Met Tyr Asn Asn Lys Thr Gly Met Cys
Leu Cys 35 40 45 Val Pro Cys Thr Thr Gln Ser Lys Gly Tyr Pro Phe
Glu Val Val Leu 50 55 60 Ser Gly Gln Glu Arg Asp Gly Val Ala Leu
Ala Asp Gln Val Lys Ser65 70 75 80 Ile Ala Trp Arg Ala Arg Gly Ala
Thr Lys Lys Gly Thr Val Ala Pro 85 90 95 Glu Glu Leu Gln Leu Ile
Lys Ala Lys Ile Asn Val Leu Ile Gly 100 105 110 3333DNAE. coli
3atggaaagag gggaaatctg gcttgtctcg cttgatccta ccgcaggtca tgagcagcag
60ggaacgcggc cggtgctgat tgtcacaccg gcggccttta atcgcgtgac ccgcctgcct
120gttgttgtgc ccgtaaccag cggaggcaat tttgcccgca ctgccggctt
tgcggtgtcg 180ttggatggtg ttggcatacg taccacaggt gttgtacgtt
gcgatcaacc ccggacaatt 240gatatgaaag cacggggcgg aaaacgactc
gaacgggttc cggagactat catgaacgaa 300gttcttggcc gcctgtccac
tattctgact tga 3334110PRTE. coli 4Met Glu Arg Gly Glu Ile Trp Leu
Val Ser Leu Asp Pro Thr Ala Gly1 5 10 15 His Glu Gln Gln Gly Thr
Arg Pro Val Leu Ile Val Thr Pro Ala Ala 20 25 30 Phe Asn Arg Val
Thr Arg Leu Pro Val Val Val Pro Val Thr Ser Gly 35 40 45 Gly Asn
Phe Ala Arg Thr Ala Gly Phe Ala Val Ser Leu Asp Gly Val 50 55 60
Gly Ile Arg Thr Thr Gly Val Val Arg Cys Asp Gln Pro Arg Thr Ile65
70 75 80 Asp Met Lys Ala Arg Gly Gly Lys Arg Leu Glu Arg Val Pro
Glu Thr 85 90 95 Ile Met Asn Glu Val Leu Gly Arg Leu Ser Thr Ile
Leu Thr 100 105 110 5249DNAE. coli 5atgatccaca gtagcgtaaa
gcgttgggga aattcaccgg cggtgcggat cccggctacg 60ttaatgcagg cgctcaatct
gaatattgat gatgaagtga agattgacct ggtggatggc 120aaattaatta
ttgagccagt gcgtaaagag cccgtattta cgcttgctga actggtcaac
180gacatcacgc cggaaaacct ccacgagaat atcgactggg gagagccgaa
agataaggaa 240gtctggtaa 249682PRTE. coli 6Met Ile His Ser Ser Val
Lys Arg Trp Gly Asn Ser Pro Ala Val Arg1 5 10 15 Ile Pro Ala Thr
Leu Met Gln Ala Leu Asn Leu Asn Ile Asp Asp Glu 20 25 30 Val Lys
Ile Asp Leu Val Asp Gly Lys Leu Ile Ile Glu Pro Val Arg 35 40 45
Lys Glu Pro Val Phe Thr Leu Ala Glu Leu Val Asn Asp Ile Thr Pro 50
55 60 Glu Asn Leu His Glu Asn Ile Asp Trp Gly Glu Pro Lys Asp Lys
Glu65 70 75 80 Val Trp7258DNAE. coli 7atgcatacca cccgactgaa
gagggttggc ggctcagtta tgctgaccgt cccaccggca 60ctgctgaatg cgctgtctct
gggcacagat aatgaagttg gcatggtcat tgataatggc 120cggctgattg
ttgagccgta cagacgcccg caatattcac tggctgagct actggcacag
180tgtgatccga atgctgaaat atcagctgaa gaacgagaat ggctggatgc
accggcgact 240ggtcaggagg aaatctga 258885PRTE. coli 8Met His Thr Thr
Arg Leu Lys Arg Val Gly Gly Ser Val Met Leu Thr1 5 10 15 Val Pro
Pro Ala Leu Leu Asn Ala Leu Ser Leu Gly Thr Asp Asn Glu 20 25 30
Val Gly Met Val Ile Asp Asn Gly Arg Leu Ile Val Glu Pro Tyr Arg 35
40 45 Arg Pro Gln Tyr Ser Leu Ala Glu Leu Leu Ala Gln Cys Asp Pro
Asn 50 55 60 Ala Glu Ile Ser Ala Glu Glu Arg Glu Trp Leu Asp Ala
Pro Ala Thr65 70 75 80 Gly Gln Glu Glu Ile 85 924PRTArtificial
SequenceT54 to K77 fragment of E. coli MazE 9Thr Leu Ala Glu Leu
Val Asn Asp Ile Thr Pro Glu Asn Leu His Glu1 5 10 15 Asn Ile Asp
Trp Gly Glu Pro Lys 20 1018PRTArtificial SequenceN60 to K77
fragment of E. coli MazE 10Asn Asp Ile Thr Pro Glu Asn Leu His Glu
Asn Ile Asp Trp Gly Glu1 5 10 15 Pro Lys1130RNAArtificial
Sequencesynthetic RNA substrate 11uaagaaggag auauacauau gaaucaaauc
301250DNAArtificial Sequencesingle stranded oligonucleotide
12gctcgtatct acaatgtaga ttgatatata ctgtatctac atatgatagc
501350DNAArtificial Sequencesingle stranded oligonucleotide
13cgagcataga tgttacatct aactatatat gacatagatg tatactatcg
501423DNAArtificial Sequencesynthetic oligonucleotide 14agatctcgat
cccgcaaatt aat 231527DNAArtificial SequenceDNA primer 15ttagagatca
atttcctgcc gttttac 271622DNAArtificial SequenceDNA primer
16ttaaagatcg tcaacgtaac cg 221722DNAArtificial SequenceDNA primer
17tgctctttat cccacgggca gc 221824DNAArtificial SequenceDNA primer
18gcccagttca ccgcgaagat cgtc 241927DNAArtificial SequenceDNA primer
19ggttttgatt tgctcccaac gggcaag 272027DNAArtificial SequenceDNA
primer 20catttcctcc tccagtttag cctggtc 272127DNAArtificial
SequenceDNA primer 21ttgccagact tcttccattg tttcgag
272224DNAArtificial SequenceDNA primer 22gatccccaca atgcggtgac gagt
242324DNAArtificial SequenceDNA primer 23cacgttgtcc actttgttca ccgc
242424DNAArtificial SequenceDNA primer 24cagttcagcg ccgaggaaac gcat
242524DNAArtificial SequenceDNA primer 25gcgttcgtcg tcggcccaac cgga
242630RNAArtificial Sequenceantisense RNA 26gauuugauuc auauguauau
cuccuucuua 302730DNAArtificial Sequencecomplementary DNA
27gatttgattc atatgtatat ctccttctta 302822DNAArtificial SequenceDNA
primer 28agaatgtgcg ccatttttca ct 22299DNAArtificial SequenceDNA
fragment from pCold I vector 29taatacacc 93015DNAArtificial
Sequencesynthetic oligonucleotide 30atgaatcaca aagtg
153118DNAArtificial SequenceDNA fragment from pCold I vector
31catcatcatc atcatcat 183212DNAArtificial SequenceDNA fragment from
pCold I vector 32atcgaaggta gg 123360DNAArtificial Sequencemultiple
cloning site 33catatggagc tcggtaccct cgagggatcc gaattcaagc
ttgtcgacct gcagtctaga 603421DNAArtificial SequenceDNA primer
34caggagauac cucaaugauc a 213521DNAArtificial SequenceDNA primer
35ctcaatgatc acaggagata c 213621DNAArtificial SequenceDNA primer
36tcctctatgg agttactagt g 213716DNAArtificial SequenceDNA primer
37gggacaggag atacct 163823DNAArtificial SequenceDNA primer
38tgtcctctat ggagttacta gtg 2339330DNABacillus halodurans
39atgccagtac cggatagagg gaatcttgtt tatgtagact ttaacccaca atcgggtcat
60gaccaagccg ggacacgacc ggctattgtt ttgtccccta aattatttaa taaaaacaca
120ggttttgcgg tggtttgtcc aattaccaga caacaaaaag gttatccttt
tgaaatagaa 180ataccaccgg ggttacctat tgaaggggtt attcttactg
accaagtaaa aagtctggat 240tggagagcaa gaaactttca cattaaagga
caagcaccag aggaaactgt tactgattgt 300ttacaactta ttcatacatt
tttatcttaa 33040363DNAStaphylococcus epidermidis 40atgattagaa
gaggagatgt ttatttagcg gatttatcac cagttcaagg gtctgaacaa 60gggggagtaa
gacctgtagt tatcattcaa aatgatactg gtaataaata tagtccaact
120gtaattgtag ctgcgattac tgatgggatt aataaagcga aaataccaac
ccacgtagaa 180attgaaaaga aaaagtataa attagacaaa gattcagtta
ttcttcttga acaaattaga 240acactagata aaaagcgttt aaaagaaaaa
ttaacatttt tatcagagag taaaatgata 300gaggttgata atgccttaga
tattagtttg ggattaaata actttgatca tcataaatct 360taa
36341411DNAStaphylococcus aureus 41atgattagac gaggagatgt ttatttagca
gatttatcac cagtacaggg atctgaacaa 60gggggagtca gacctgtagt cataattcaa
aatgatactg gtaataaata tagtcctaca 120gttattgttg cggcaataac
tggtaggatt aataaagcga aaataccgac acatgtagag 180attgaaaaga
aaaagtataa gttggataaa gactcagtta tattattaga acaaattcgt
240acacttgata aaaaacgatt gaaagaaaaa ctgacgtact tatccgatga
taaaatgaaa 300gaagtagata atgcactaat gattagttta gggctgaatg
cagtagctca accagaaaaa 360ttaggcgtct attatatgta tttttcagag
ataaataaaa tattgatata a 41142351DNABacillus subtilis 42ttgattgtga
aacgcggcga tgtttatttt gctgatttat ctcctgttgt tggctcagag 60caaggcgggg
tgcgcccggt tttagtgatc caaaatgaca tcggaaatcg cttcagccca
120actgctattg ttgcagccat aacagcacaa atacagaaag cgaaattacc
aacccacgtc 180gaaatcgatg caaaacgcta cggttttgaa agagattccg
ttattttgct ggagcaaatt 240cggacgattg acaagcaaag gttaacggat
aagattactc atctggatga tgaaatgatg 300gataaggttg atgaagcctt
acaaatcagt ttggcactca ttgattttta g 35143324DNANeisseria
meningitides 43atggatatgg tagtacgcgg cggaatctat ctggtctcct
tagacccgac cgtaggaagc 60gaaatcaaaa agacacgtcc ttgtgtcgta gtctctcctc
ctgaaataca caactatctc 120aagactgtgc tgatcgttcc catgacgagc
ggaagccgtc ctgccccgtt ccgcgtcaat 180gtccgctttc aggataaaga
cggtttgctt ttgcccgaac agattagggc tgtggataaa 240gccggattgg
tcaaacatct tggcaattta gacaacagta cggctgaaaa actgtttgca
300gtattgcagg agatgtttgc ctga 32444366DNAMorganella morgani
44atgcgccggc ggctggtcag gaggaaatct gacatggaaa gaggggaaat ctggcttgtc
60tcgcttgacc ctaccgcagg tcatgagcag cagggaacgc ggccggtact gattgtcacg
120ccggctgctt ttaaccgcgt gacccgcctg cctgttgttg tgcccgtgac
cagcggaggt 180aattttgccc gcacagcagg ctttgctgtg tcgcttgacg
gcgccggcat acgtaccacc 240ggcgttgtgc gttgcgatca accccggacg
atcgatatga aagcccgcgg cggcaaacga 300ctcgaacggg tgccagagac
tatcatggac gacgttcttg gccgtctggc caccatcctg 360acctga
36645321DNAMycobacterium tuberculosis 45gtggtgattc ggggagcggt
ctacagggtc gacttcggcg atgcgaagcg aggccacgag 60caacgcgggc ggcgctacgc
cgtggtcatc agccccggct cgatgccgtg gagtgtagta 120accgtggtgc
cgacgtcgac aagcgcccaa cctgcggttt tccgaccaga gctggaagtc
180atgggaacaa agacacggtt cctggtggat cagatccgga cgatcggcat
cgtctatgtg 240cacggcgatc cggtcgacta tctggaccgt gaccaaatgg
ccaaggtgga acacgccgtg 300gcacgatacc ttggtctgtg a
32146109PRTBacillus halodurans 46Met Pro Val Pro Asp Arg Gly Asn
Leu Val Tyr Val Asp Phe Asn Pro1 5 10 15 Gln Ser Gly His Asp Gln
Ala Gly Thr Arg Pro Ala Ile Val Leu Ser 20 25 30 Pro Lys Leu Phe
Asn Lys Asn Thr Gly Phe Ala Val Val Cys Pro Ile 35 40 45 Thr Arg
Gln Gln Lys Gly Tyr Pro Phe Glu Ile Glu Ile Pro Pro Gly 50 55 60
Leu Pro Ile Glu Gly Val Ile Leu Thr Asp Gln Val Lys Ser Leu Asp65
70 75 80 Trp Arg Ala Arg Asn Phe His Ile Lys Gly Gln Ala Pro Glu
Glu Thr 85 90 95 Val Thr Asp Cys Leu Gln Leu Ile His Thr Phe Leu
Ser 100 105 47120PRTStaphylococcus epidermidis 47Met Ile Arg Arg
Gly Asp Val Tyr Leu Ala Asp Leu Ser Pro Val Gln1 5 10 15 Gly Ser
Glu Gln Gly Gly Val Arg Pro Val Val Ile Ile Gln Asn Asp 20 25 30
Thr Gly Asn Lys Tyr Ser Pro Thr Val Ile Val Ala Ala Ile Thr Asp 35
40 45 Gly Ile Asn Lys Ala Lys Ile Pro Thr His Val Glu Ile Glu Lys
Lys 50 55 60 Lys Tyr Lys Leu Asp Lys Asp Ser Val Ile Leu Leu Glu
Gln Ile Arg65 70 75 80 Thr Leu Asp Lys Lys Arg Leu Lys Glu Lys Leu
Thr Phe Leu Ser Glu 85 90 95 Ser Lys Met Ile Glu Val Asp Asn Ala
Leu Asp Ile Ser Leu Gly Leu 100 105 110 Asn Asn Phe Asp His His Lys
Ser 115 120 48136PRTStaphylococcus aureus 48Met Ile Arg Arg Gly Asp
Val Tyr Leu Ala Asp Leu Ser Pro Val Gln1 5 10 15 Gly Ser Glu Gln
Gly Gly Val Arg Pro Val Val Ile Ile Gln Asn Asp 20 25 30 Thr Gly
Asn Lys Tyr Ser Pro Thr Val Ile Val Ala Ala Ile Thr Gly 35 40 45
Arg Ile Asn Lys Ala Lys Ile Pro Thr His Val Glu Ile Glu Lys Lys 50
55 60 Lys Tyr Lys Leu Asp Lys Asp Ser Val Ile Leu Leu Glu Gln Ile
Arg65 70 75 80 Thr Leu Asp Lys Lys Arg Leu Lys Glu Lys Leu Thr Tyr
Leu Ser Asp 85 90 95 Asp Lys Met Lys Glu Val Asp Asn Ala Leu Met
Ile Ser Leu Gly Leu 100 105 110 Asn Ala Val Ala Gln Pro Glu Lys Leu
Gly Val Tyr Tyr Met Tyr Phe 115 120 125 Ser Glu Ile Asn Lys Ile Leu
Ile 130 135 49116PRTBacillus subtilis 49Met Ile Val Lys Arg Gly Asp
Val Tyr Phe Ala Asp Leu Ser Pro Val1 5 10 15 Val Gly Ser Glu Gln
Gly Gly Val Arg Pro Val Leu Val Ile Gln Asn 20 25 30 Asp Ile Gly
Asn Arg Phe Ser Pro Thr Ala Ile Val Ala Ala Ile Thr 35 40 45 Ala
Gln Ile Gln Lys Ala Lys Leu Pro Thr His Val Glu Ile Asp Ala 50 55
60 Lys Arg Tyr Gly Phe Glu Arg Asp Ser Val Ile Leu Leu Glu Gln
Ile65 70 75 80 Arg Thr Ile Asp Lys Gln Arg Leu Thr Asp Lys Ile Thr
His Leu Asp 85 90 95 Asp Glu Met Met Asp Lys Val Asp Glu Ala Leu
Gln Ile Ser Leu Ala 100 105 110 Leu Ile Asp Phe 115
50115PRTNeisseria meningitides 50Met Tyr Ile Pro Asp Lys Gly Asp
Ile Phe His Leu Asn Phe Asp Pro1 5 10 15 Ser Ser Gly Lys Glu Ile
Lys Gly Gly Arg Phe Ala Leu Ala Leu Ser 20 25 30 Pro Lys Ala Phe
Asn Arg Ala Thr Gly Leu Val Phe Ala Cys Pro Ile 35 40 45 Ser Gln
Gly Asn Ala Ala Ala Ala Arg Ser Ser Gly Met Ile Ser Thr 50 55 60
Leu Leu Gly Ala Gly Thr Glu Thr Gln Gly Asn Val His Cys His Gln65
70 75 80 Leu Lys Ser Leu Asp Trp Gln Ile Arg Lys Ala Ser Phe Lys
Glu Thr 85 90 95 Val Pro Asp Tyr Val Leu Asp Asp Val Leu Ala Arg
Ile Gly Ala Val 100 105 110 Leu Phe Asp 115 51121PRTMorganella
morgani 51Met Arg Arg Arg Leu Val Arg Arg Lys Ser Asp Met Glu Arg
Gly Glu1 5 10 15 Ile Trp Leu Val Ser Leu Asp Pro Thr Ala Gly His
Glu Gln Gln Gly 20 25 30 Thr Arg Pro Val Leu Ile Val Thr Pro Ala
Ala Phe Asn Arg Val Thr 35 40 45 Arg Leu Pro Val Val Val Pro Val
Thr Ser Gly Gly Asn Phe Ala Arg 50 55 60 Thr Ala Gly Phe Ala Val
Ser Leu Asp Gly Ala Gly Ile Arg Thr Thr65 70 75 80 Gly Val Val Arg
Cys Asp Gln Pro Arg Thr Ile Asp Met Lys Ala Arg 85 90 95 Gly Gly
Lys Arg Leu Glu Arg Val Pro Glu Thr Ile Met Asp Asp Val 100 105 110
Leu Gly Arg Leu Ala Thr Ile Leu Thr 115 120 52118PRTMycobacterium
tuberculosis 52Met Met Arg Arg Gly Glu Ile Trp Gln Val Asp Leu Asp
Pro Ala Arg1 5 10 15 Gly Ser Glu Ala Asn Asn Gln Arg Pro Ala Val
Val Val Ser Asn Asp 20 25 30 Arg Ala Asn Ala Thr Ala Thr Arg
Leu
Gly Arg Gly Val Ile Thr Val 35 40 45 Val Pro Val Thr Ser Asn Ile
Ala Lys Val Tyr Pro Phe Gln Val Leu 50 55 60 Leu Ser Ala Thr Thr
Thr Gly Leu Gln Val Asp Cys Lys Ala Gln Ala65 70 75 80 Glu Gln Ile
Arg Ser Ile Ala Thr Glu Arg Leu Leu Arg Pro Ile Gly 85 90 95 Arg
Val Ser Ala Ala Glu Leu Ala Gln Leu Asp Glu Ala Leu Lys Leu 100 105
110 His Leu Asp Leu Trp Ser 115 53243DNADeinococcus radiodurans
53atgacgagtc aaattcagaa atggggcaac agcctcgcgc tccgcattcc caaagctctg
60gcgcagcagg tgggactgac gcagagttca gaagtggagc tgcttcttca ggacggtcag
120attgtcatcc ggccagttcc tgctcggcag tacgatctcg ccgcgctgct
ggccgaaatg 180acacctgaaa atctgcatgg ggaaacagac tggggcgcac
tggaaggacg cgaggaatgg 240taa 24354246DNABacillus halodurans
54gtgacactca tgactactat acaaaagtgg ggaaatagtt tagctgttcg tattccgaac
60cattatgcta aacatattaa cgttacgcaa ggatctgaaa ttgaactaag cttagggagt
120gatcaaacga ttattttaaa gcctaaaaaa agaaagccaa cattagagga
attagtggca 180aaaatcactc ctgaaaacag acataacgaa attgatttcg
ggagaacagg aaaggaattg 240ttgtaa 24655258DNAE. coli Plasmid R100
55atgcatacca cccgactgaa gagggttggc ggctcagtta tgctgaccgt cccaccggca
60ctgctgaatg cgctgtctct gggcacagat aatgaagttg gcatggtcat tgataatggc
120cggctgattg ttgagccgta cagacgcccg caatattcac tggctgagct
actggcacag 180tgtgatccga atgctgaaat atcagctgaa gaacgagaat
ggctggatgc accggcgact 240ggtcaggagg aaatctga 25856294DNAE. coli
Plasmid R466b 56atgttatatt taaatataac ttttatggag ggaaaaatgc
ataccactcg actgaagaag 60gttggcggct cagtcatgct gaccgtccca ccggcactgc
tgaatgcgct gtcgctgggt 120acagataatg aagttggcat ggtcattgat
aatggccggc tgattgtgga gccgcacaga 180cgcccgcagt attcactggc
tgagctgttg gcacagtgcg atccgaacgc tgaaatctcg 240gcagaagaac
gtgaatggct ggatgcgccg gcggctggtc aggaggaaat ctga
29457258DNAEscherichia coli 57gtgcagatgc gtattaccat aaaaagatgg
gggaacagtg caggtatggt cattcccaat 60atcgtaatga aagaacttaa cttacagccg
gggcagagcg tggaagtgca ggtgagcaac 120aaccaactga ttctgacacc
catctccagg cgctactcgc ttgatgaact gctggcacag 180tgtgacatga
acgccgcgga acttagcgag caggatgtct ggggtaaatc cacccctgcg
240ggtgacgaaa tatggtaa 25858255DNAPseudomonas putida 58atgcagatca
agattcaaca gtggggcaac agcgccgcga tccgcttgcc cgccgcagta 60ctcaagcaga
tgcgcctcgg tgtcggctcc accctgagcc ttgacacaac gggtgagacg
120atggtgctca aacccgtcag gtcgaaaccc aagtacaccc ttgaggaact
gatggcccag 180tgtgacctga gtgcaccgga gccagaggac atggccgact
ggaatgccat gcgcccagtg 240gggcgtgaag tgtga 25559260DNAPhotobacterium
profundum 59gtgcaatgag aactcagata agaaagatcg gtaactcact tggttcaatt
attcctgcca 60cttttattcg tcagcttgaa ctggcagagg gcgcagaaat tgatgttaaa
acggttgatg 120gaaaaattgt gattgagcca attagaaaaa tgaaaaaacg
tttcccattc agtgagcgtg 180aattactaag tggattggat gcacacactg
ctcatgctga cgaactggtt gtaatttcta 240cccaggagct aggcgaataa
2606080PRTDeinococcus radiodurans 60Met Thr Ser Gln Ile Gln Lys Trp
Gly Asn Ser Leu Ala Leu Arg Ile1 5 10 15 Pro Lys Ala Leu Ala Gln
Gln Val Gly Leu Thr Gln Ser Ser Glu Val 20 25 30 Glu Leu Leu Leu
Gln Asp Gly Gln Ile Val Ile Arg Pro Val Pro Ala 35 40 45 Arg Gln
Tyr Asp Leu Ala Ala Leu Leu Ala Glu Met Thr Pro Glu Asn 50 55 60
Leu His Gly Glu Thr Asp Trp Gly Ala Leu Glu Gly Arg Glu Glu Trp65
70 75 80 6181PRTBacillus halodurans 61Met Thr Leu Met Thr Thr Ile
Gln Lys Trp Gly Asn Ser Leu Ala Val1 5 10 15 Arg Ile Pro Asn His
Tyr Ala Lys His Ile Asn Val Thr Gln Gly Ser 20 25 30 Glu Ile Glu
Leu Ser Leu Gly Ser Asp Gln Thr Ile Ile Leu Lys Pro 35 40 45 Lys
Lys Arg Lys Pro Thr Leu Glu Glu Leu Val Ala Lys Ile Thr Pro 50 55
60 Glu Asn Arg His Asn Glu Ile Asp Phe Gly Arg Thr Gly Lys Glu
Leu65 70 75 80 Leu6285PRTE. coli PemI plasmid R100 62Met His Thr
Thr Arg Leu Lys Arg Val Gly Gly Ser Val Met Leu Thr1 5 10 15 Val
Pro Pro Ala Leu Leu Asn Ala Leu Ser Leu Gly Thr Asp Asn Glu 20 25
30 Val Gly Met Val Ile Asp Asn Gly Arg Leu Ile Val Glu Pro Tyr Arg
35 40 45 Arg Pro Gln Tyr Ser Leu Ala Glu Leu Leu Ala Gln Cys Asp
Pro Asn 50 55 60 Ala Glu Ile Ser Ala Glu Glu Arg Glu Trp Leu Asp
Ala Pro Ala Thr65 70 75 80 Gly Gln Glu Glu Ile 85 6397PRTE. coli
PemI plasmid R466b 63Met Leu Tyr Leu Asn Ile Thr Phe Met Glu Gly
Lys Met His Thr Thr1 5 10 15 Arg Leu Lys Lys Val Gly Gly Ser Val
Met Leu Thr Val Pro Pro Ala 20 25 30 Leu Leu Asn Ala Leu Ser Leu
Gly Thr Asp Asn Glu Val Gly Met Val 35 40 45 Ile Asp Asn Gly Arg
Leu Ile Val Glu Pro His Arg Arg Pro Gln Tyr 50 55 60 Ser Leu Ala
Glu Leu Leu Ala Gln Cys Asp Pro Asn Ala Glu Ile Ser65 70 75 80 Ala
Glu Glu Arg Glu Trp Leu Asp Ala Pro Ala Ala Gly Gln Glu Glu 85 90
95 Ile6485PRTEscherichia coli 64Met Gln Met Arg Ile Thr Ile Lys Arg
Trp Gly Asn Ser Ala Gly Met1 5 10 15 Val Ile Pro Asn Ile Val Met
Lys Glu Leu Asn Leu Gln Pro Gly Gln 20 25 30 Ser Val Glu Ala Gln
Val Ser Asn Asn Gln Leu Ile Leu Thr Pro Ile 35 40 45 Ser Arg Arg
Tyr Ser Leu Asp Glu Leu Leu Ala Gln Cys Asp Met Asn 50 55 60 Ala
Ala Glu Leu Ser Glu Gln Asp Val Trp Gly Lys Ser Thr Pro Ala65 70 75
80 Gly Asp Glu Ile Trp 85 6584PRTPseudomonas putida 65Met Gln Ile
Lys Ile Gln Gln Trp Gly Asn Ser Ala Ala Ile Arg Leu1 5 10 15 Pro
Ala Ala Val Leu Lys Gln Met Arg Leu Gly Val Gly Ser Thr Leu 20 25
30 Ser Leu Asp Thr Thr Gly Glu Thr Met Val Leu Lys Pro Val Arg Ser
35 40 45 Lys Pro Lys Tyr Thr Leu Glu Glu Leu Met Ala Gln Cys Asp
Leu Ser 50 55 60 Ala Pro Glu Pro Glu Asp Met Ala Asp Trp Asn Ala
Met Arg Pro Val65 70 75 80 Gly Arg Glu Val6685PRTPhotobacterium
profundum 66Ala Met Arg Thr Gln Ile Arg Lys Ile Gly Asn Ser Leu Gly
Ser Ile1 5 10 15 Ile Pro Ala Thr Phe Ile Arg Gln Leu Glu Leu Ala
Glu Gly Ala Glu 20 25 30 Ile Asp Val Lys Thr Val Asp Gly Lys Ile
Val Ile Glu Pro Ile Arg 35 40 45 Lys Met Lys Lys Arg Phe Pro Phe
Ser Glu Arg Glu Leu Leu Ser Gly 50 55 60 Leu Asp Ala His Thr Ala
His Ala Asp Glu Leu Val Val Ile Ser Thr65 70 75 80 Gln Glu Leu Gly
Glu 85 67228DNAHomo sapiens 67atgggtccag catctgttcc gactacctgt
tgctttaacc tggcgaaccg caaaattccg 60ctgcagcgcc tggaaagcta tcgccgtatt
acctctggca aatgcccgca gaaagcggtg 120atctttaaaa ccaaactggc
gaaagatatt tgcgcggatc cgaaaaaaaa atgggtgcag 180gattctatga
aatatctgga tcagaaatct ccgaccccga aaccgtaa 2286873PRTHomo sapiens
68Gly Pro Ala Ser Pro Thr Thr Cys Cys Phe Asn Leu Ala Asn Arg Lys1
5 10 15 Ile Pro Leu Gln Arg Leu Glu Ser Tyr Arg Arg Ile Thr Ser Gly
Lys 20 25 30 Cys Pro Gln Lys Ala Val Ile Phe Lys Thr Lys Leu Ala
Lys Asp Ile 35 40 45 Cys Ala Asp Pro Lys Lys Lys Trp Val Gln Asp
Ser Met Lys Tyr Leu 50 55 60 Asp Gln Lys Ser Pro Thr Pro Lys Pro65
70 69357DNAMycobacterium tuberculosis 69gtgatgcgcc gcggtgagat
ttggcaggtc gatctcgacc ccgctcgagg tagcgaagcg 60aacaaccagc gccccgccgt
cgtcgtcagc aacgaccggg ccaacgcgac cgccacgcgt 120cttgggcgcg
gcgtcatcac cgtcgtgccg gtgacgagca acatcgccaa ggtctatccg
180tttcaggtgt tgttgtcggc caccactact ggtctccagg tcgactgcaa
ggcgcaggcc 240gagcaaatca gatcgattgc taccgagcgg ttgctccggc
caatcggccg agtttcagcc 300gccgaacttg cccagctcga tgaggctttg
aaactgcatc tcgacttatg gtcgtag 35770282DNAMycobacterium tuberculosis
70atgctgcgcg gtgagatctg gcaggtcgac ctggatccgg cccgcggcag cgcggcaaat
60atgcggcggc cagcggtaat tgtcagcaac gacagggcca acgctgccgc gatacgtctc
120gaccgaggcg tggtgccggt tgtcccggtt accagcaaca ccgaaaaggt
ccccattcca 180ggtgttgttg ccggcagcga gcggtggcct ggccgtcgat
tcgaaggcgc aggcccagca 240ggttggatcc gtcgctgcgc aacgtctccc
ctgccgagct ga 28271345DNAMycobacterium tuberculosis 71gtggtgatta
gtcgtgccga gatctactgg gctgacctcg ggccgccatc aggcagtcag 60ccggcgaagc
gccgcccggt gctcgtaatc cagtcagatc cgtacaacgc aagtcgcctt
120gccactgtga tcgcagcggt gatcacgtcc aatacggcgc tggcggcaat
gcccggcaac 180gtgttcttgc ccgcgaccac aacgcgactg ccacgtgact
cggtcgtcaa cgtcacggcg 240attgtcacgc tcaacaagac tgacctcacc
gaccgagttg gggaggtgcc agcgagcttg 300atgcacgagg ttgaccgagg
acttcgtcgc gtactggacc tttga 34572309DNAMycobacterium tuberculosis
72atgcggcgcg gtgaattgtg gtttgccgcc acacctggtg gtgacagacc agtacttgtc
60cttaccagag atccggtggc agaccgcatc ggcgcggtcg ttgtggtggc cctaacccgc
120acccgccgag gcctggtgtc ggaattggag ctcacggccg tcgaaaaccg
tgttccgagc 180gactgcgtcg tcaacttcga caacattcat acgttgccac
gcaccgcatt ccgacgccgc 240atcacccggc tgtccccggc ccgcctgcac
gaagcctgtc aaacactccg ggcgagcacg 300gggtgttga
30973330DNAMycobacterium tuberculosis 73gtgaccgcac ttccggcgcg
cggagaggtg tggtggtgtg agatggctga gatcggtcgg 60cgaccagtcg tcgtgctgtc
gcgcgatgcc gcgatccctc ggctgcgacg cgcacttgtc 120gcgccctgca
ccacgaccat ccgagggcta gccagtgagg ttgttcttga acccggttcc
180gacccgatcc cgcgccgttc cgcggtgaat ttggactcag tcgaaagtgt
ctcggtcgcg 240gtattggtga atcggcttgg ccgcctcgcc gacatccgga
tgcgcgccat ctgcacggcc 300ctcgaggtcg ccgtcgattg ctctcgatga
33074118PRTMycobacterium tuberculosis 74Met Met Arg Arg Gly Glu Ile
Trp Gln Val Asp Leu Asp Pro Ala Arg1 5 10 15 Gly Ser Glu Ala Asn
Asn Gln Arg Pro Ala Val Val Val Ser Asn Asp 20 25 30 Arg Ala Asn
Ala Thr Ala Thr Arg Leu Gly Arg Gly Val Ile Thr Val 35 40 45 Val
Pro Val Thr Ser Asn Ile Ala Lys Val Tyr Pro Phe Gln Val Leu 50 55
60 Leu Ser Ala Thr Thr Thr Gly Leu Gln Val Asp Cys Lys Ala Gln
Ala65 70 75 80 Glu Gln Ile Arg Ser Ile Ala Thr Glu Arg Leu Leu Arg
Pro Ile Gly 85 90 95 Arg Val Ser Ala Ala Glu Leu Ala Gln Leu Asp
Glu Ala Leu Lys Leu 100 105 110 His Leu Asp Leu Trp Ser 115
7593PRTMycobacterium tuberculosis 75Met Leu Arg Gly Glu Ile Trp Gln
Val Asp Leu Asp Pro Ala Arg Gly1 5 10 15 Ser Ala Ala Asn Met Arg
Arg Pro Ala Val Ile Val Ser Asn Asp Arg 20 25 30 Ala Asn Ala Ala
Ala Ile Arg Leu Asp Arg Gly Val Val Pro Val Val 35 40 45 Pro Val
Thr Ser Asn Thr Glu Lys Val Pro Ile Pro Gly Val Val Ala 50 55 60
Gly Ser Glu Arg Trp Pro Gly Arg Arg Phe Glu Gly Ala Gly Pro Ala65
70 75 80 Gly Trp Ile Arg Arg Cys Ala Thr Ser Pro Leu Pro Ser 85 90
76114PRTMycobacterium tuberculosis 76Met Val Ile Ser Arg Ala Glu
Ile Tyr Trp Ala Asp Leu Gly Pro Pro1 5 10 15 Ser Gly Ser Gln Pro
Ala Lys Arg Arg Pro Val Leu Val Ile Gln Ser 20 25 30 Asp Pro Tyr
Asn Ala Ser Arg Leu Ala Thr Val Ile Ala Ala Val Ile 35 40 45 Thr
Ser Asn Thr Ala Leu Ala Ala Met Pro Gly Asn Val Phe Leu Pro 50 55
60 Ala Thr Thr Thr Arg Leu Pro Arg Asp Ser Val Val Asn Val Thr
Ala65 70 75 80 Ile Val Thr Leu Asn Lys Thr Asp Leu Thr Asp Arg Val
Gly Glu Val 85 90 95 Pro Ala Ser Leu Met His Glu Val Asp Arg Gly
Leu Arg Arg Val Leu 100 105 110 Asp Leu77102PRTMycobacterium
tuberculosis 77Met Arg Arg Gly Glu Leu Trp Phe Ala Ala Thr Pro Gly
Gly Asp Arg1 5 10 15 Pro Val Leu Val Leu Thr Arg Asp Pro Val Ala
Asp Arg Ile Gly Ala 20 25 30 Val Val Val Val Ala Leu Thr Arg Thr
Arg Arg Gly Leu Val Ser Glu 35 40 45 Leu Glu Leu Thr Ala Val Glu
Asn Arg Val Pro Ser Asp Cys Val Val 50 55 60 Asn Phe Asp Asn Ile
His Thr Leu Pro Arg Thr Ala Phe Arg Arg Arg65 70 75 80 Ile Thr Arg
Leu Ser Pro Ala Arg Leu His Glu Ala Cys Gln Thr Leu 85 90 95 Arg
Ala Ser Thr Gly Cys 100 78109PRTMycobacterium tuberculosis 78Met
Thr Ala Leu Pro Ala Arg Gly Glu Val Trp Trp Cys Glu Met Ala1 5 10
15 Glu Ile Gly Arg Arg Pro Val Val Val Leu Ser Arg Asp Ala Ala Ile
20 25 30 Pro Arg Leu Arg Arg Ala Leu Val Ala Pro Cys Thr Thr Thr
Ile Arg 35 40 45 Gly Leu Ala Ser Glu Val Val Leu Glu Pro Gly Ser
Asp Pro Ile Pro 50 55 60 Arg Arg Ser Ala Val Asn Leu Asp Ser Val
Glu Ser Val Ser Val Ala65 70 75 80 Val Leu Val Asn Arg Leu Gly Arg
Leu Ala Asp Ile Arg Met Arg Ala 85 90 95 Ile Cys Thr Ala Leu Glu
Val Ala Val Asp Cys Ser Arg 100 105 79351DNABacillus anthracis
79ttgattgtaa aacgcggcga cgtgtatttt gcagaccttt ccccagttgt tggttctgag
60caaggaggtg ttcgtccggt tcttgtcatt caaaatgaca tcggaaatcg ttttagtcca
120acggtgattg tagcggctat tactgcacag attcaaaaag cgaaattacc
cactcatgtg 180gaaattgatg cgaaaaagta cggttttgag agagattctg
ttattttact tgagcagatt 240cgaacaatcg ataagcagcg cttaacggac
aaaatcactc acttagatga agtgatgatg 300attcgtgtag atgaagcgct
acaaattagt ttaggactaa tagattttta a 35180116PRTBacillus anthracis
80Met Ile Val Lys Arg Gly Asp Val Tyr Phe Ala Asp Leu Ser Pro Val1
5 10 15 Val Gly Ser Glu Gln Gly Gly Val Arg Pro Val Leu Val Ile Gln
Asn 20 25 30 Asp Ile Gly Asn Arg Phe Ser Pro Thr Val Ile Val Ala
Ala Ile Thr 35 40 45 Ala Gln Ile Gln Lys Ala Lys Leu Pro Thr His
Val Glu Ile Asp Ala 50 55 60 Lys Lys Tyr Gly Phe Glu Arg Asp Ser
Val Ile Leu Leu Glu Gln Ile65 70 75 80 Arg Thr Ile Asp Lys Gln Arg
Leu Thr Asp Lys Ile Thr His Leu Asp 85 90 95 Glu Val Met Met Ile
Arg Val Asp Glu Ala Leu Gln Ile Ser Leu Gly 100 105 110 Leu Ile Asp
Phe 115 81348DNAPseudomonas putida 81gtgaaacggt tgaaattcgc
caggggtgat attgttcgcg tcaacctgga cccaacagtc 60gggcgggaac agcagggctc
cggccgacct gcactggtac ttactccggc tgcgttcaat 120gcttcaggcc
tggctgtaat catcccgatc actcaaggtg gggatttcgc gaggcatgcg
180ggtttcgctg tcacgctcag cggtgcgggc acgcagactc agggggtgat
gctttgcaac 240caggtgcgca cagtcgacct tgaagcacga tttgccaagc
gcatagagtc ggtgcctgaa 300gctgtcatcc tggatgcact ggcgcgtgtg
caaaccctat tcgattaa 34882345DNAMycobacterium celatum 82tgaattgctc
tgacggaacg cggcgacatc tacatcgttt cgcttgaccc gacgtcggga 60catgagcaga
gcggcacgcg cccagtattg gtcgtgtccc cgggcgcgtt taatcgcctg
120acgaaaacac cggtcgtgct acctataaca cgcggcggga actttgcccg
aacggcaggg 180ttcgctgtct cgctgaccga tgcgggtact cgcaccgccg
gcgtaatacg ctgcgatcag 240cctcgctcga ttgatatccg cgcccgtaaa
ggccgcaagg ttgaacgtgt gccgtctggg 300gttcttgacg aagcgttggc
caagctcgcc acgatcttga cttga 34583366DNAShigella flexneri 2a str.
301 83atggtaaagg cacggacgcc acatcgtggt gagatctggt attttaaccc
tgatccggtt 60gccgggcatg aacttcaggg gccacattat tgcattgtgg taacggacaa
aaaactcaac 120aatgttttaa aagttgctat gtgctgcccg atttcaacag
gggcaaatgc agcacgttcc 180acaggggtga cggtgaacgt cctcccccgt
gatacgcaaa ccggtaacct gcatggcgtt 240gtactttgtc accagctaaa
agccgtcgat cttattgccc gtggcgctaa atttcatacc 300gttgccgatg
aaaaattgat tagtgaagtt atcagtaaac tggtgaattt aatcgaccca 360caataa
36684351DNAE. coli 84atggtaaaga aaagtgaatt tgaacgggga gacattgtgc
tggttggctt tgatccagca 60agcggccatg aacagcaagg tgctggtcga cctgcgcttg
tgctctccgt tcaagccttt 120aatcaactgg gaatgacgct ggtggccccc
attacgcagg gcggaaattt tgcccgttat 180gccggattta gcgttccttt
acattgcgaa gaaggcgatg tgcacggcgt ggtgctggtg 240aatcaggtgc
ggatgatgga tctacacgcc cggctggcaa agcgtattgg tctggctgcg
300gatgaggtgg tggaagaggc gttattacgc ttgcaggcgg tggtggaata a
35185115PRTPseudomonas putida 85Met Lys Arg Leu Lys Phe Ala Arg Gly
Asp Ile Val Arg Val Asn Leu1 5 10 15 Asp Pro Thr Val Gly Arg Glu
Gln Gln Gly Ser Gly Arg Pro Ala Leu 20 25 30 Val Leu Thr Pro Ala
Ala Phe Asn Ala Ser Gly Leu Ala Val Ile Ile 35 40 45 Pro Ile Thr
Gln Gly Gly Asp Phe Ala Arg His Ala Gly Phe Ala Val 50 55 60 Thr
Leu Ser Gly Ala Gly Thr Gln Thr Gln Gly Val Met Leu Cys Asn65 70 75
80 Gln Val Arg Thr Val Asp Leu Glu Ala Arg Phe Ala Lys Arg Ile Glu
85 90 95 Ser Val Pro Glu Ala Val Ile Leu Asp Ala Leu Ala Arg Val
Gln Thr 100 105 110 Leu Phe Asp 115 86111PRTMycobacterium celatum
86Met Thr Glu Arg Gly Asp Ile Tyr Ile Val Ser Leu Asp Pro Thr Ser1
5 10 15 Gly His Glu Gln Ser Gly Thr Arg Pro Val Leu Val Val Ser Pro
Gly 20 25 30 Ala Phe Asn Arg Leu Thr Lys Thr Pro Val Val Leu Pro
Ile Thr Arg 35 40 45 Gly Gly Asn Phe Ala Arg Thr Ala Gly Phe Ala
Val Ser Leu Thr Asp 50 55 60 Ala Gly Thr Arg Thr Ala Gly Val Ile
Arg Cys Asp Gln Pro Arg Ser65 70 75 80 Ile Asp Ile Arg Ala Arg Lys
Gly Arg Lys Val Glu Arg Val Pro Ser 85 90 95 Gly Val Leu Asp Glu
Ala Leu Ala Lys Leu Ala Thr Ile Leu Thr 100 105 110
87121PRTShigella flexneri 2a str. 301 87Met Val Lys Ala Arg Thr Pro
His Arg Gly Glu Ile Trp Tyr Phe Asn1 5 10 15 Pro Asp Pro Val Ala
Gly His Glu Leu Gln Gly Pro His Tyr Cys Ile 20 25 30 Val Val Thr
Asp Lys Lys Leu Asn Asn Val Leu Lys Val Ala Met Cys 35 40 45 Cys
Pro Ile Ser Thr Gly Ala Asn Ala Ala Arg Ser Thr Gly Val Thr 50 55
60 Val Asn Val Leu Pro Arg Asp Thr Gln Thr Gly Asn Leu His Gly
Val65 70 75 80 Val Leu Cys His Gln Leu Lys Ala Val Asp Leu Ile Ala
Arg Gly Ala 85 90 95 Lys Phe His Thr Val Ala Asp Glu Lys Leu Ile
Ser Glu Val Ile Ser 100 105 110 Lys Leu Val Asn Leu Ile Asp Pro Gln
115 120 88116PRTE. coli 88Met Val Lys Lys Ser Glu Phe Glu Arg Gly
Asp Ile Val Leu Val Gly1 5 10 15 Phe Asp Pro Ala Ser Gly His Glu
Gln Gln Gly Ala Gly Arg Pro Ala 20 25 30 Leu Val Leu Ser Val Gln
Ala Phe Asn Gln Leu Gly Met Thr Leu Val 35 40 45 Ala Pro Ile Thr
Gln Gly Gly Asn Phe Ala Arg Tyr Ala Gly Phe Ser 50 55 60 Val Pro
Leu His Cys Glu Glu Gly Asp Val His Gly Val Val Leu Val65 70 75 80
Asn Gln Val Arg Met Met Asp Leu His Ala Arg Leu Ala Lys Arg Ile 85
90 95 Gly Leu Ala Ala Asp Glu Val Val Glu Glu Ala Leu Leu Arg Leu
Gln 100 105 110 Ala Val Val Glu 115 8917DNAArtificial
Sequencesynthetic oligonucleotide 89aatgatgaca ctggaag
179017DNAArtificial Sequencesynthetic oligonucleotide 90gtcgttgaca
ttgatgg 179117DNAArtificial Sequencesynthetic oligonucleotide
91atctcgaaca cgcagcc 179217DNAArtificial Sequencesynthetic
oligonucleotide 92tcgttttaca cccttga 179324RNAArtificial
Sequencesynthetic RNA substrate 93cuuuaagaag gagauauaca uaug
249423RNAArtificial Sequencesynthetic RNA substrate 94uugaagaaac
cuacgaaguc gug 239524RNAArtificial Sequencesynthetic RNA substrate
95auaaaaguua cugcggauuu auug 249625RNAArtificial Sequencesynthetic
RNA substrate 96aacgcggugg uuaugacauc aacgg 259725RNAArtificial
Sequencesynthetic RNA substrate 97aggagauaua cauaugaauc aaauc
259826RNAArtificial Sequencesynthetic RNA substrate 98cgauaaaagu
uacugcggau uuauug 269924RNAArtificial Sequencesynthetic RNA
substrate 99ggacaacaug gcuacuaaau accg 2410020PRTArtificial
Sequencesynthetic peptide tag 100Met Gly Ser Ser His His His His
His His Ser Ser Gly Leu Val Pro1 5 10 15 Arg Gly Ser His 20
10141DNAArtificial Sequencesynthetic combined DNA/RNA substrate
101aucuaccuga agcgacucau cacttcccgg aagauuacau c 41102336RNAE. coli
102augguaagcc gauacguacc cgauaugggc gaucugauuu ggguugauuu
ugacccgaca 60aaagguagcg agcaagcugg acaucgucca gcuguugucc ugaguccuuu
cauguacaac 120aacaaaacag guaugugucu guguguuccu uguacaacgc
aaucaaaagg auauccguuc 180gaaguuguuu uauccgguca ggaacgugau
ggcguagcgu uagcugauca gguaaaaagu 240aucgccuggc gggcaagagg
agcaacgaag aaaggaacag uugccccaga ggaauuacaa 300cucauuaaag
ccaaaauuaa cguacugauu ggguag 33610320RNAArtificial
Sequencesynthetic RNA substrate 103uuuuaacuuu aagaaggaga
2010420DNAArtificial Sequencesynthetic combined DNA/RNA substrate
104aaggagauau acauaugaat 2010520RNAArtificial Sequencesynthetic RNA
substrate 105gaagaaaccu acgaagugcu 2010620RNAArtificial
Sequencesynthetic RNA substrate 106gugguguuuu acgcgcaaau
2010720RNAArtificial Sequencesynthetic RNA substrate 107cuuugacuuu
aaugauauuu 2010820RNAArtificial Sequencesynthetic RNA substrate
108cuuuaaugau auuugcgcug 2010920RNAArtificial Sequencesynthetic RNA
substrate 109cgcauguuuu gcugauaguu 2011020RNAArtificial
Sequencesynthetic RNA substrate 110gaggugaugu acgaagcgcg
2011120RNAArtificial Sequencesynthetic RNA substrate 111ugccacgguu
aaucuggcuc 2011220RNAArtificial Sequencesynthetic RNA substrate
112aguggagcgu auuguugccg 2011320DNAArtificial Sequencesynthetic
combined DNA/RNA substrate 113gataaaaguu acugcggauu
2011420RNAArtificial Sequencesynthetic RNA substrate 114ggggauccau
acugaaggcg 2011520RNAArtificial Sequencesynthetic RNA substrate
115caggcgaucu acgucgauac 2011620RNAArtificial Sequencesynthetic RNA
substrate 116guaagcaucu accugaagcg 2011720RNAArtificial
Sequencesynthetic RNA substrate 117ccggaagauu acaucaccga
2011820RNAArtificial Sequencesynthetic RNA substrate 118gaacugccgu
acuccgugac 2011920RNAArtificial Sequencesynthetic RNA substrate
119cgcggugguu augacaucaa 2012020DNAArtificial Sequencesynthetic
combined DNA/RNA substrate 120caacauggcu actaaatacc 20
* * * * *
References