U.S. patent application number 13/572392 was filed with the patent office on 2013-03-14 for primer and probe for use in detection of mycobacterium kansasii and method for detection of mycobacterium kansasii using the same.
This patent application is currently assigned to Wako Pure Chemical Industries, Ltd.. The applicant listed for this patent is Tomokazu Ishikawa. Invention is credited to Tomokazu Ishikawa.
Application Number | 20130065231 13/572392 |
Document ID | / |
Family ID | 37396643 |
Filed Date | 2013-03-14 |
United States Patent
Application |
20130065231 |
Kind Code |
A1 |
Ishikawa; Tomokazu |
March 14, 2013 |
Primer and Probe for Use In Detection of Mycobacterium Kansasii and
Method for Detection of Mycobacterium Kansasii Using The Same
Abstract
The present invention discloses an oligonucleotide which
comprises a part or the entire sequence of the nucleotide sequence
depicted in SEQ ID NOS: 1-4, or a part or the entire sequence of a
nucleotide sequence complementary to SEQ ID NOS: 1-4, wherein the
oligonucleotide is capable of hybridizing with the nucleotide
sequence of Mycobacterium kansasii; a primer and a probe for
detecting M. kansasii comprising the oligonucleotide; and a method
for detecting M. kansasii using the primer and/or probe. The
methods enable the detection of M. kansasii more rapidly and with
higher accuracy compared with conventional methods performed by
culture. Further, the methods can exclude false positive results
for the diagnosis and can also detect and diagnose M. kansasii with
higher accuracy compared with methods performed by PCR using
conventional primers and/or probes. Still further, the method can
quantify M. kansasii cells.
Inventors: |
Ishikawa; Tomokazu; (Hyogo,
JP) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Ishikawa; Tomokazu |
Hyogo |
|
JP |
|
|
Assignee: |
Wako Pure Chemical Industries,
Ltd.
|
Family ID: |
37396643 |
Appl. No.: |
13/572392 |
Filed: |
August 10, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11920234 |
Nov 13, 2007 |
8242249 |
|
|
PCT/JP2006/309514 |
May 11, 2006 |
|
|
|
13572392 |
|
|
|
|
Current U.S.
Class: |
435/6.11 |
Current CPC
Class: |
G01N 2333/35 20130101;
G01N 33/56922 20130101; C12Q 1/04 20130101; C12Q 1/689
20130101 |
Class at
Publication: |
435/6.11 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; G01N 21/64 20060101 G01N021/64; G01N 21/76 20060101
G01N021/76 |
Foreign Application Data
Date |
Code |
Application Number |
May 13, 2005 |
JP |
2005-141153 |
Claims
1-29. (canceled)
30. A method for detecting Mycobacterium kansasii comprising:
contacting a sample suspected of containing Mycobacterium kansasii
with a primer comprising a first oligonucleotide consisting of 18
to 35 contiguous bases of a nucleotide sequence consisting of SEQ
ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4, or 18 to 35
contiguous bases of the full complement of the nucleotide sequence
consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID
NO: 4; wherein the first oligonucleotide is capable of hybridizing
with a nucleotide sequence of Mycobacterium kansasii gene.
31. The method according to claim 30, wherein the first
oligonucleotide consisting of 18 to 35 contiguous bases of the
nucleotide sequence consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ
ID NO: 3, or SEQ ID NO: 4 or the full complement thereto consists
of one of SEQ ID NOS: 5 to 52, or the full complement thereto.
32. The method according to claim 31, wherein the first
oligonucleotide consists of 18 to 35 contiguous bases of the
nucleotide sequence consisting of SEQ ID NO: 1 or the full
complement thereto, selected from one of SEQ ID NOS: 5 to 12 or the
full complement thereto.
33. The method according to claim 31, wherein the first
oligonucleotide consists of 18 to 35 contiguous bases of the
nucleotide sequence consisting of SEQ ID NO: 2 or the full
complement thereto, selected from one of SEQ ID NOS: 13 to 26 or
the full complement thereto.
34. The method according to claim 31, wherein the first
oligonucleotide consists of 18 to 35 contiguous bases of the
nucleotide sequence consisting of SEQ ID NO: 3 or the full
complement thereto, selected from one of SEQ ID NOS: 27 to 40 or
the full complement thereto.
35. The method according to claim 31, wherein the first
oligonucleotide consists of 18 to 35 contiguous bases of the
nucleotide sequence consisting of SEQ ID NO: 4 or the full
complement thereto, selected from one of SEQ ID NOS: 41 to 52 or
the full complement thereto.
36. The method according to claim 30, further comprising;
performing a nucleic acid amplification reaction using the primer
to make a primer extension product; and detecting the obtained
primer extension product.
37. The method according to claim 36, further comprising:
performing the nucleic acid amplification reaction in the presence
of a probe comprising a second oligonucleotide designed from a
nucleotide sequence consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ
ID NO: 3 or SEQ ID NO: 4, or from the full complement of the
sequence consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or
SEQ ID NO: 4; wherein the second oligonucleotide consists of 10 to
50 contiguous bases of the sequence consisting of SEQ ID NO: 1, SEQ
ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4, or 10 to 50 bases of the
full complement of the sequence consisting of SEQ ID NO: 1, SEQ ID
NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4; wherein the probe is capable
of hybridizing to the obtained primer extension product; and
wherein the probe and the primer hybridize to different positions
of the Mycobacterium kansasii gene.
38. The method according to claim 37, wherein the second
oligonucleotide designed from the nucleotide sequence consisting of
SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4 or the
full complement thereto consists of one of SEQ ID NOS: 53 to 80, or
the full complement thereto.
39. The method according to claim 38, wherein the probe is labeled
with a labeling substance.
40. The method according to claim 39, wherein the labeling
substance is selected from a radioisotope, an enzyme, a fluorescent
substance, a luminescent substance or biotin.
41. The method according to claim 40, wherein the probe is labeled
with a reporter fluorescent dye and with a quencher dye.
42. The method according to claim 41, wherein the 5'-terminal of
the probe is labeled with the reporter fluorescent dye and the
3'-terminal of the probe is labeled with the quencher dye.
43. The method according to claim 30, further comprising:
performing a nucleic acid amplification reaction using the primer
to make a primer extension product; and separating the obtained
primer extension product by electrophoresis.
44. The method according to claim 43, further comprising;
identifying the obtained primer extension product in the obtained
electrophoresis result based upon the expected length of the primer
extension product.
45. The method according to claim 43, further comprising; obtaining
an electrophoretic fraction containing the obtained primer
extension product from the performed electrophoresis; contacting
under hybridization conditions the electrophoretic fraction with a
probe labeled with a labeling substance, wherein the probe
comprises a second oligonucleotide designed from a nucleotide
sequence consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or
SEQ ID NO: 4, or from the full complement of the nucleotide
sequence consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or
SEQ ID NO: 4; wherein the probe has a length of at least 10 to 700
nucleotides and at most a length up to the full length of SEQ ID
NOS: 1 to 4 from which the probe is designed; and wherein the
second oligonucleotide is capable of hybridizing with a nucleotide
sequence of Mycobacterium kansasii gene; to form a hybridized
complex between the primer extension product and the labeled probe;
and detecting a signal derived from the labeled probe associated
with the hybridized complex.
46. The method according to claim 45, wherein the probe comprises
the second oligonucleotide designed from the nucleotide sequence
consisting of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID
NO: 4, or the full complement of the nucleotide sequence consisting
of SEQ ID NO; 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4; or 10
to 50 or 100 to 700 contiguous bases of SEQ ID NO: 1, SEQ ID NO: 2,
SEQ ID NO: 3 or SEQ ID NO: 4, or 10 to 50 or 100 to 700 contiguous
bases of the full complement of the nucleotide sequence consisting
of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4.
47. The method according to claim 46, wherein the probe comprising
the second oligonucleotide designed from the nucleotide sequence
consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID
NO: 4 or the full complement thereto consists of one of SEQ ID NOS:
5 to 80, or the full complement thereto.
48. The method according to claim 45, wherein the labeling
substance is selected from a radioisotope, an enzyme, a fluorescent
substance, a luminescent substance or biotin.
49. The method according to claim 30, wherein the primer is labeled
with a labeling substance, and the method further comprises:
performing a nucleic acid amplification reaction using the labeled
primer to make a labeled primer extension product; and measuring a
signal derived from the labeled primer extension product.
50. The method according to claim 49, wherein the labeling
substance is selected from a radioisotope, an enzyme, a fluorescent
substance, a luminescent substance or biotin.
51. The method according to claim 49, further comprising after
performing the nucleic acid amplification reaction; removing free
labeled primer; and measuring the signal derived from the labeled
primer extension product.
52. The method according to claim 51, wherein the free labeled
primer is removed by removing a supernatant after precipitating the
labeled primer extension product.
53. The method according to claim 51, wherein free labeled primer
is removed by gel chromatography.
54. A method for detecting Mycobacterium kansasii comprising:
contacting under hybridization conditions a sample suspected of
containing Mycobacterium kansasii with a probe labeled with a
labeling substance, wherein the probe comprises an oligonucleotide
designed from a nucleotide sequence consisting of SEQ ID NO: 1, SEQ
ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4, or from the full complement
of the nucleotide sequence consisting of SEQ ID NO: 1, SEQ ID NO:
2, SEQ ID NO: 3 or SEQ ID NO: 4; wherein the probe has a length of
at least 10 to 700 nucleotides and at most a length up to the full
length of SEQ ID NOS: 1 to 4 from which the probe is designed; and
wherein the oligonucleotide is capable of hybridizing with a
nucleotide sequence of Mycobacterium kansasii gene.
55. The method according to claim 54, wherein the probe comprises:
the oligonucleotide consisting of the sequence consisting of SEQ ID
NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4, or the full
complement of the sequence consisting of SEQ ID NO: 1, SEQ ID NO:
2, SEQ ID NO: 3 or SEQ ID NO: 4; or the oligonucleotide consisting
of 10 to 50 or 100 to 700 contiguous bases of the sequence
consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID
NO: 4, or 10 to 50 or 100 to 700 contiguous bases of the full
complement of the sequence consisting of SEQ ID NO: 1, SEQ ID NO:
2, SEQ ID NO: 3 or SEQ ID NO: 4.
56. The method according to claim 55, wherein the oligonucleotide
designed from the nucleotide sequence consisting of SEQ ID NO: 1,
SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4 or the full complement
thereto consists of one of SEQ ID NOS: 5 to 80, or the full
complement thereto.
57. The method according to claim 55, wherein the oligonucleotide
designed from the nucleotide sequence consisting of SEQ ID NO: 1,
SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4 or the full complement
thereto consists of one of SEQ ID NOS: 53 to 79, or the full
complement thereto.
58. The method according to claim 54, wherein the labeling
substance is selected from a radioisotope, an enzyme, a fluorescent
substance, a luminescent substance or biotin.
59. The method according to claim 54, further comprising:
separating free labeled probe from the hybridized complex; and
detecting a signal derived from the labeled probe associated with
the hybridized complex.
Description
RELATED APPLICATIONS
[0001] This is a division of application Ser. No. 11/920,234, filed
Nov. 13, 2007, issued as U.S. Pat. No. 8,242,249, which is a
national stage application of PCT Application No.
PCT/JP2006/309514, filed May 11, 2006, which claims the benefit of
JP 2005-141153, filed May 13, 2005, all of which are incorporated
herein by reference.
TECHNICAL FIELD
[0002] The present invention relates to a method for detecting
and/or identifying M. kansasii (Mycobacterium kansasii, hereinafter
described as M. kansasii) through the use of amplification of
nucleic acid and detection system thereof in clinical laboratory
test.
BACKGROUND ART
[0003] Nontuberculous mycobacterium (NTM) is a gram positive
bacillus having acid-fast characteristics classified into genus
Mycobacterium, and is a sort of acid-fast bacterium other than
tuberculosis complex and Mycobacterium leprae.
[0004] Among nontuberculous mycobacterium, clinically problematic
bacterial strain is known to include Mycobacterium kansasii,
Mycobacterium marinum, Mycobacterium gordonae, Mycobacterium
szulgai, Mycobacterium avium, Mycobacterium intracellulare,
Mycobacterium xenopi, Mycobacterium fortuitum, Mycobacterium
chelonei, Mycobacterium abscessus, and so on. Particularly, the
infectious diseases affected by 2 types of bacteria, M. kansasii
and M. avium complex, accounts 90% or more of the total
nontuberculous mycobacterium diseases.
[0005] In general, the nontuberculous mycobacterium is said to be
harmless to a healthy subject, however, on rare occasions, it may
exert infectivity to human and causes nontuberculous mycobacterium
diseases. Particularly in the immunocompromised subjects such as
AIDS-virus-infected patients, it may be a serious
infection-causative agent. In the past, the nontuberculous
mycobacterium diseases have been rare disorder, however, in recent
years, the incidence of infection demonstrates upward trend, and
therefore, the development of a method for discriminating
tuberculosis bacterium from nontuberculous mycobacterium in a short
period of time has been desired strongly. Moreover, from the fact
that the method for detecting/diagnosing M. avium and M.
intracellulare by nucleic-acid amplification has been approved for
its inclusion in health insurance coverage and then spread rapidly
throughout the country, its diagnostic significance is obviously
great.
[0006] Since most of nontuberculous mycobacteria have a resistance
to antituberucular agents, when the patient is suspected of
acid-fast bacterium infection, the differential diagnosis whether
the disease is tuberculosis or nontuberculous mycobacterium disease
will be quite important to decide on the course of treatment. In
addition, as the method for the treatment of the diseases caused by
nontuberculous mycobacteria may vary for each type of bacterium,
the identification of bacterial species will also be quite
important. However, since nontuberculous mycobacterium disease has
no specific clinical symptom, it is quite difficult to
differentiate tuberculosis from nontuberculous mycobacterium
disease by clinical observation and histopathological
manifestation, moreover, to specify the species of the
nontuberculous mycobacterium. Therefore, the diagnosis whether the
disease is tuberculosis or nontuberculous mycobacterium disease has
to be performed by identification of the infected bacterium.
[0007] In a typical diagnosis, at first, sputum smear is examined.
By this test, only "positive acid-fast bacterium" can be
recognized, and differentiation of tuberculosis bacterium from
nontuberculous mycobacterium cannot be achieved. Therefore, when
the sputum smear examination is positive, bacterial culture
examination by isolation culture on a specified culture medium such
as Ogawa's medium is carried out to differentiate tuberculosis
bacterium from nontuberculous mycobacterium. Further, through
additional biochemical examinations, species of the bacterium is
identified. However, in general, growth of bacterium belonging to
genus Mycobacterium is slow, and takes considerable time for its
culture. Accordingly, in the basic procedures of conventional
method including smear examination and culture examination, it
takes 3 to 4 weeks only for the isolation culture of the bacterium
to obtain diagnostic outcome informing whether the bacterium is
tuberculosis or not. In addition, there is another problem that it
requires additional 2 to 3 weeks to complete various biochemical
tests for the identification of bacterial species.
[0008] In addition, identification of M. kansasii is also performed
by biochemical tests. The principal method of identifying M.
kansasii by biochemical tests utilizes the specific property of
producing pigment when the bacterium is exposed to the light.
However, since some other species belonging to genus Mycobacterium
show the same properties as M. kansasii shows, the identification
of M. kansasii by its coloring property is generally of a
problem.
[0009] In recent years, technology of detecting bacteria on a
genetic level has been developed. For example, a diagnostic
technique utilizing nucleic acid amplification technology such as
polymerase chain reaction (PCR) and the like have been studied as a
useful means. This method has advantages of high sensitivity;
several cells of the bacteria are enough for the detection;
detection can be completed in a short time (in 4 days at the
longest). However, in the usual PCR method, both live cells and
dead cells are detected equally. In addition, as the judgment is
made positive regardless of the size of bacterial count, and since
the number of the bacterium is unknown, diagnosis of infectivity
whether it is positive or not will be provided with uncertainty. In
addition, since the method has a problem that due to too high
sensitivity, the possibility of false positive judgment or the like
tends to be made.
[0010] As to M. kansasii, there is a study reporting that a DNA
probe (pMK1-9) was obtained from genomic library of M. kansasii
(Non-Patent Document 1). This DNA probe (pMK1-9) can form a
complemental hybrid with the DNA of M. kansasii, but this probe can
also form a hybrid with other species of mycobacteria, and is not
specific to M. kansasii.
[0011] Also, there is a study which paid attention to use of
commercially available DNA probe (ACCU-PROBE.TM., GenProbe, San
Diego, Calif.) which can hybridize specifically with pMK1-9 probe
and rRNA gene of M. kansasii for the identification of M. kansasii
(Non-Patent Document 2). However, in this study, it has been
reported that both pMK1-9 probe and commercially available DNA
probe (ACCU-PROBE.TM.) were unable to detect considerable number of
strain types of M. kansasii.
[0012] Further, there is another study in which the commercially
available DNA probe (ACCU-PROBE.TM.) was evaluated for the
detection of M. kansasii (Non-Patent Document 3). The researchers
of this study reported that although the ACCU-PROBE.TM. is 100%
species specific, and does not show any cross reaction with other
species of M. kansasii, only 73% of the species of M. kansasii
could be detected in this experiment.
[0013] There is a report describing that a DNA hybrid forming probe
(p6123) specific to M. kansasii has been purified from a clinical
isolate of M. kansasii (Non-Patent Document 4). The probe (p6123)
was able to hybridize with all the strains of M. kansasii used in
this experiment including a sub-group which did not react with a
DNA probe (pMK1-9) reported by Ross et al. U.S. Pat. No. 5,500,341
(Patent Document 2) has disclosed a M. kansasii-specific
amplification primer purified from p6123 probe.
[0014] Further, B. Boddinghaus et al. have disclosed a
Mycobacterium-specific oligonucleotide purified from 16S rRNA,
which specifically proliferate and hybridize with mycobacterium DNA
(Non-Patent Document 5).
[0015] Moreover, for example, identification of DNA region
effective for detecting M. kansasii has also been studied (for
example, Patent Document 1 and the like), however, the present
situation is that the method of diagnosis specific to M. kansasii
has not been established.
[0016] As described above, the present situation is that the
establishment of a new specific method for detecting nontuberculous
mycobacterium has been desired. [0017] Patent Document 1:
JP-A-11-155589; [0018] Patent Document 2: U.S. Pat. No. 5,500,341;
[0019] Patent Document 3: JP-A-60-281; [0020] Non-Patent Document
1: Z. H. Huang et. al., J. Clin. Microbiol., 1991, 29, p. 2125;
[0021] Non-Patent Document 2: B. C. Ross et al., J. Clin.
Microbiol., 1992, 30, p. 2930; [0022] Non-Patent Document 3:
Tortoli et al., Eur. J. Clin. Microbiol. Infect. Dis., 1994, 13, p.
264; [0023] Non-Patent Document 4: M. Yang et al., J. Clin.
Microbiol., 1993, 31, p. 2769; [0024] Non-Patent Document 5: B.
Boddinghaus et al., J. Clin. Microbiol., 1990, 28, p. 1751; [0025]
Non-Patent Document 6: F. Poly et al., J. Bacteriology, 2004, 186,
14, p. 4781-4795.
DISCLOSURE OF THE INVENTION
Problems to be Solved by the Invention
[0026] The present invention was made in view of the above
described situation, and an object of the present invention is to
provide a new primer for detecting M. kansasii which can exclude
any false positive result for the diagnosis; and to provide a
method for detecting M. kansasii more simply, rapidly and with high
accuracy.
Means for Solving Problems
[0027] The present invention was made for the purpose of solving
the above-described problems, and comprises the following
aspects:
(1) An oligonucleotide comprising a part or the entire sequence of
a nucleotide sequence depicted in SEQ ID NO: 1, SEQ ID NO: 2, SEQ
ID NO: 3 or SEQ ID NO: 4 (wherein A represents adenine, C
represents cytosine, G represents guanine and T represents thymine,
respectively; T at arbitrary position can be replaced by uracil
(U); and hereinafter the same abbreviations will be used) or a part
or the entire sequence of a nucleotide sequence complementary to
the nucleotide sequence, wherein the oligonucleotide is capable of
hybridizing with a nucleotide sequence of M. kansasii gene. (2) A
primer for detecting Mycobacterium kansasii comprising, an
oligonucleotide comprising a part or the entire sequence of a
nucleotide sequence depicted in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID
NO: 3 or SEQ ID NO: 4, or a part or the entire sequence of a
nucleotide sequence complementary to the nucleotide sequence,
wherein the oligonucleotide is capable of hybridizing with a
nucleotide sequence of Mycobacterium kansasii gene. (3) A probe for
detecting Mycobacterium kansasii comprising, an oligonucleotide
comprising a part or the entire sequence of a nucleotide sequence
depicted in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO:
4, or a part or the entire sequence of a nucleotide sequence
complementary to the nucleotide sequence, wherein the
oligonucleotide is capable of hybridizing with a nucleotide
sequence of Mycobacterium kansasii gene. (4) A method for detecting
Mycobacterium kansasii comprising; using an oligonucleotide
comprising a part or the entire sequence of a nucleotide sequence
depicted in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO:
4, or a part or the entire sequence of a nucleotide sequence
complementary to the nucleotide sequence, wherein the
oligonucleotide is capable of hybridizing with a nucleotide
sequence of Mycobacterium kansasii as a primer and/or a probe. (5)
A kit for detecting Mycobacterium kansasii comprising an
oligonucleotide comprising a part or the entire sequence of a
nucleotide sequence depicted in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID
NO: 3 or SEQ ID NO: 4, or a part or the entire sequence of a
nucleotide sequence complementary to a nucleotide sequence, wherein
the oligonucleotide is capable of hybridizing with the nucleotide
sequence of Mycobacterium kansasii gene, as a primer and/or a
probe.
[0028] The present inventors have conducted theoretical and
experimental verification of genetic homology between species with
regard to the established genes of various species including M.
kansasii and other living organisms, and found presence of a
nucleotide sequence in the nucleic acid fragments derived from M.
kansasii obtained by the method using microarray technique, which
hybridizes specifically with a particular region of the gene
sequence of M. kansasii and may be useful for the detection of M.
kansasii.
[0029] And so, on the basis of these findings, the present
inventors have further studied intensively and obtained an
oligonucleotide specific to M. kansasii (the nucleotide sequence
depicted in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO:
4), and found usefulness of these nucleotide sequences for the
detection of M. kansasii. Based on these sequences, a primer and a
probe for detecting M. kansasii have been developed, and using
these primer and probe, a method for detecting M. kansasii has been
established.
Effect of the Invention
[0030] According to the method for detecting M. kansasii using the
primer and/or probe of the present invention, M. kansasii can be
detected and diagnosed more rapidly and with high accuracy compared
with a conventional bacterium identification method by culture
examination and the like. In addition, by performing the detection
using the method of the present invention, any false positive
result for the diagnosis can be excluded compared with the
diagnosis performed by PCR using a conventional primer and/or a
probe, and as the results, M. kansasii can be detected and
diagnosed with high accuracy. Still further, by the use of the
detection method of the present invention, M. kansasii cell can
also be quantified.
BRIEF DESCRIPTION OF THE DRAWINGS
[0031] FIG. 1 shows a nucleotide sequence of candidate clone 1, and
the position where the designed primer is located is indicated by
an arrow.
[0032] FIG. 2 shows a nucleotide sequence of candidate clone 2, and
the position where the designed primer is located is indicated by
an arrow.
[0033] FIG. 3 shows a nucleotide sequence of candidate clone 3, and
the position where the designed primer is located is indicated by
an arrow.
[0034] FIG. 4 shows a nucleotide sequence of candidate clone 4, and
the position where the designed primer is located is indicated by
an arrow.
[0035] FIG. 5 is a scatter plot produced based on the fluorescent
intensity of Cy3/Cy5, obtained by use of the PCR product produced
using a genome derived from M. kansasii in Experimental Example 1,
a KATS2 sequence of M. kansasii, and a sequence shown as SEQ ID NO:
8 in the description of JP Application No. 2004-129272 (in the
present description, shown as SEQ ID NO: 81).
[0036] FIG. 6 shows the results of electrophoresis obtained in
Example 1.
[0037] In addition, letters given on each lane indicate the results
when the following samples are used:
M4: molecular weight marker (Marker 4); a: Escherichia coli; b:
Mycobacterium tuberculosis; c: Mycobacterium kansasii; d:
Mycobacterium marinum; e: Mycobacterium simiae; f: Mycobacterium
scrofulaceum; g: Mycobacterium gordonae; h: Mycobacterium szulgai;
i: Mycobacterium avium; j: Mycobacterium intracellulare; k:
Mycobacterium gastri; l: Mycobacterium xenopi; m: Mycobacterium
nonchromogenicum; n: Mycobacterium terrae; o: Mycobacterium
triviale; p: Mycobacterium fortuitum; q: Mycobacterium chelonei; r:
Mycobacterium abscessus; s: Mycobacterium peregrinum.
[0038] FIG. 7 shows the results of detection performed by the
real-time PCR in Example 4, which is a standard curve drawn by
plotting Ct value (Y-axis) for the copy number of genome (X-axis,
logarithmic scale) of each DNA sample for PCR.
EXPLANATION OF LETTERS OR NUMERALS
[0039] In FIG. 5, each symbol indicates the following meaning:
(1): Candidate clone judged to have a high specificity for M.
kansasii; (2): The results obtained by use of KAS sequence of M.
kansasii described in JP-A-11-155589; (3): The results obtained by
use of SEQ ID NO: 8 (identical with SEQ ID NO: 81 in this
specification) derived from M. tuberculosis described in the
description of JP Application No. 2004-129272. (a): The line
indicating:
[0040] Cy5/Cy3 ratio of fluorescent intensity .gtoreq.10.0;
(b): The line indicating:
[0041] Cy5/Cy3 ratio of fluorescent intensity .gtoreq.5.0;
(c): The line indicating:
[0042] Cy5/Cy3 ratio of fluorescent intensity .gtoreq.2.0;
(a'): The line indicating:
[0043] Cy3/Cy5 ratio of fluorescent intensity .gtoreq.10.0;
(b'): The line indicating:
[0044] Cy3/Cy5 ratio of fluorescent intensity .gtoreq.5.0;
(c'): The line indicating:
[0045] Cy3/Cy5 ratio of fluorescent intensity .gtoreq.2.0.
BEST MODE FOR CARRYING OUT THE INVENTION
[0046] In the present invention, M. kansasii gene refers to an
arbitral unit of nucleotide sequence (a region) in the entire
genome sequence owned by Mycobacterium kansasii. The entire genome
sequencing of M. kansasii has not been completed yet.
[0047] An oligonucleotide of the present invention includes an
oligonucleotide which comprises a part or the entire sequence of a
nucleotide sequence depicted in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID
NO: 3 or SEQ ID NO: 4 or a part or the entire sequence of a
nucleotide sequence complementary to the nucleotide sequence,
wherein the oligonucleotide is capable of hybridizing with a
nucleotide sequence of M. kansasii gene (hereinafter, optionally
briefly referred to as "the oligonucleotide of the present
invention").
[0048] As to the size of the oligonucleotides of the present
invention, an oligonucleotide having the nucleotide sequence
depicted in SEQ ID NO: 1 has 517 bases; an oligonucleotide having
the nucleotide sequence depicted in SEQ ID NO: 2 has 596 bases; an
oligonucleotide having the nucleotide sequence depicted in SEQ ID
NO: 3 has 636 bases; and an oligonucleotide having the nucleotide
sequence depicted in SEQ ID NO: 4 has 726 bases.
[0049] The oligonucleotide which comprises a part or the entire
sequence of the nucleotide sequence depicted in SEQ ID NO: 1, SEQ
ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4 of the present invention
includes, for example, (1) an oligonucleotide which comprises a
nucleotide sequence sharing homology with the oligonucleotide
sequence depicted in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or
SEQ ID NO: 4 in about 70% or more, preferably about 80% or more,
more preferably about 90% or more, yet more preferably about 95% or
more, or (2) an oligonucleotide which comprises a consecutive 10 or
more of bases, preferably 20 or more of bases among the sequence
depicted in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO:
4, or the like.
[0050] The oligonucleotide which comprises a part of the nucleotide
sequence depicted in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or
SEQ ID NO: 4 include an oligonucleotide which comprises a part or
the entire sequence of the nucleotide sequence depicted in SEQ ID
NO: 5 to 79, and comprises 10 or more of consecutive bases, and the
like.
[0051] A specific example of the oligonucleotide which comprises
the part of the nucleotide sequence depicted in SEQ ID NO: 1
includes, for example, the oligonucleotide which comprises a
sequence selected from the nucleotide sequence depicted in SEQ ID
NO: 5 to 12 or SEQ ID NO: 53 to 56; a specific example of the
oligonucleotide which comprises the part of the nucleotide sequence
depicted in SEQ ID NO: 2 includes the oligonucleotide which
comprises a sequence selected from the nucleotide sequence depicted
in SEQ ID NO: 13 to 26 or SEQ ID NO: 57 to 64; a specific example
of the oligonucleotide which comprises the part of the nucleotide
sequence depicted in SEQ ID NO: 3 includes, for example, the
oligonucleotide one which comprises a sequence selected from the
nucleotide sequence depicted in SEQ ID NO: 27 to 40 or SEQ ID NO:
65 to 72; and a specific example of the oligonucleotide which
comprises the part of the nucleotide sequence depicted in SEQ ID
NO: 4 includes, for example, the oligonucleotide which comprises a
sequence selected from the nucleotide sequence depicted in SEQ ID
NO: 41 to 52 or SEQ ID NO: 73 to 79.
[0052] The oligonucleotide which comprises a part or the entire
sequence of a nucleotide sequence complementary to the nucleotide
sequence depicted in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or
SEQ ID NO: 4 of the present invention includes, for example, an
oligonucleotide which comprises a part or the entire sequence of a
nucleotide sequence being capable of hybridizing with the
oligonucleotide which comprises the nucleotide sequence depicted in
SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4 of the
present invention, and the like.
[0053] The above described oligonucleotide which comprises the part
or the entire sequence of the nucleotide sequence being capable of
hybridizing with the oligonucleotide which comprises the nucleotide
sequence depicted in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or
SEQ ID NO: 4 of the present invention includes, in particular, an
oligonucleotide which comprises a part or the entire sequence of
the nucleotide sequence being capable of hybridizing under a high
stringent condition or under a stringent condition with the
oligonucleotide of the present invention which comprises the
nucleotide sequence depicted in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID
NO: 3 or SEQ ID NO: 4, and the like.
[0054] In this regard, "high stringent condition" means a condition
that, specifically, for example, the hybridization is carried out
in 50% formamide at 42 to 70.degree. C., preferably at 60 to
70.degree. C., and followed by washing in 0.1% sodium dodecyl
sulfate (SDS) at 25 to 70.degree. C. in 0.2 to 2.times.SSC.
[0055] In addition, "stringent condition" means a condition that,
specifically, for example, the hybridization is carried out in
6.times.SSC or the hybridization solution with the equivalent salt
concentration under the temperature of 50 to 70.degree. C. for 16
hours, and then pre-washing, if needed, with 6.times.SSC or the
solution with the equivalent salt concentration, and followed by
washing with 1.times.SSC or the solution with the equivalent salt
concentration and the like.
[0056] An oligonucleotide being capable of hybridizing with the
nucleotide sequence of M. kansasii gene in the present invention
includes an oligonucleotide which comprises a nucleotide sequence
being capable of hybridizing under a high stringent condition or a
stringent condition with the nucleotide sequence of M. kansasii
gene as described above, and the like. The high stringent condition
and the stringent condition are as described above.
[0057] The oligonucleotide which comprises the part of the
nucleotide sequence complementary to the nucleotide sequence
depicted in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO:
4 includes "an oligonucleotide which comprises the part or the
entire sequence of a nucleotide sequence complementary to an
oligonucleotide which comprises the nucleotide sequence depicted in
SEQ ID NO: 5 to 79, and 10 or more of consecutive bases".
[0058] The specific example of the oligonucleotide which comprises
the part of the nucleotide sequence complementary to the nucleotide
sequence depicted in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or
SEQ ID NO: 4 includes an oligonucleotide which comprises the
nucleotide sequence complementary to the nucleotide sequence
selected from the nucleotide sequence depicted in SEQ ID NO: 5 to
79.
[0059] In addition, the oligonucleotide of the present invention
can be either deoxyribonucleic acid (DNA) or ribonucleic acid
(RNA). In the case of ribonucleic acid, it goes without saying that
thymidine residue (T) can be read as uridine (U) residue. In
addition, the DNA comprising uridine residue synthesized by
exchanging T at arbital position by U can be used. Also, the RNA
comprising thymidine residue synthesized by exchanging U at
arbitral position by T can be used. In addition, there can be
deletion, insertion or replacement of one or plural number of
nucleotide, or a modified nucleotide such as inosine (I).
[0060] To obtain the oligonucleotide of the present invention, the
product prepared by chemical synthesis method well known per se can
be used. It is, therefore, possible to obtain an oligonucleotide
with constant quality easily, in large amount at low cost compared
with a cloning method to obtain an oligonucleotide or a
polynucleotide.
[0061] For example, using a DNA synthesizer usually used for DNA
synthesis, an oligonucleotide is synthesized according to the
conventional phosphoamidite method, and purified by the
conventional method of the anion exchange column chromatography.
And thus, an objective oligonucleotide of the present invention can
be obtained.
[0062] Other means of screening an oligonucleotide which complies
with the purpose of the present invention include the subtraction
method as described in FEMS Microbiology Letters 166: 63-70, 1998
or Systematic and Applied Microbiology 24: 109-112, 2001. This is a
methodology of concentrating a candidate sequence by subtracting
nucleotide sequence which reacts with a fragment of genomic DNA
derived form organism species to be differentiated.
[0063] In addition, as described in JP-A-11-155589 (Patent Document
1), an approach through preparing differential display of
amplification products from the target genomic DNA and a genomic
DNA derived from organism species to be differentiated, that is,
the methodology by use of the arbitrarily primed polymerase chain
reaction (AP-PCR) can be considered.
[0064] Further, by use of so called microarray method, the
oligonucleotide of the present invention can also be obtained. That
is, for example, a shotgun clone of M. kansasii genomic DNA is
prepared, and then the purified DNA derived from the shotgun clone
is arrayed onto a slide glass to form a microarray. On the side, a
fluorescently labeled genomic DNA fragment of target M. kansasii
(Label-1) is prepared. On the other hand, a fluorescently labeled
genomic DNA fragment from the organism species to be differentiated
(Label-2) is prepared separately and used for comparative
experiment. That is, the reactivity (binding) of each Label-1 and
Label-2 with the array on the microarray is assayed by competitive
hybridization using Label-1 and Label-2 in the same reaction
system. Hereby, this enables to select candidate sequence group
which reactive more specifically with genomic DNA fragment
(Label-1) from target M. kansasii (for example, Non-Patent Document
6 and the like), and thus the objective oligonucleotide can be
selected. An example of the method of selecting oligonucleotide
using microarray method of the present invention will be described
in detail as follows.
(1) Preparation of Whole Genome Shotgun Library
[0065] The preparation of Whole Genome Shotgun library of M.
kansasii is carried out by the modified method of the Whole Genome
Shotgun method described by Venter et al., Science 2001 Feb. 16;
291 (5507): 1304-1351 as mentioned below.
[0066] Firstly, M. kansasii strain is treated by conventional
procedures (for example, the fracturing treatment of bacterial body
by autoclave treatment and using glass beads and the like), then
extraction and purification of DNA is carried out according to the
conventional procedures. The purified DNA sample obtained is
subjected to DNA fragmentation treatment, for example, treatment
for about 1 to 5 minutes using a nebulizer in the presence of 20%
final concentration of glycerol under 5 kPa to 9 kPa. By this
treatment, the objective size of 500 to 1000 bp fraction can be
recovered efficiently. The fraction obtained is purified using a
commercially available extraction column
[0067] After that, the obtained fraction (DNA fragment) is
incorporated into a vector DNA by ligation according to the
conventional procedures to obtain a recombinant DNA (Whole Genome
Shotgun library from M. kansasii). The vector to be used for this
purpose includes, for example, in the case that the host cell for
subsequent transformation is E. coli, a vector such as pBS (e.g.,
pBSII sk+ vector (Stratagene Corp.)), pQE-TRi plasmid (QIAGEN
Inc.), pBluescript, pET, pGEM-3Z, pGEX and the like. Prior to
ligation, the fragment is optionally blunt ended with DNA
polymerase and the like.
[0068] Next, a suitable host cell is transformed to obtain a
transformant using the obtained recombinant DNA. The host cell to
be used for this purpose includes, for example, E. coli, preferably
JM109, DH5a, TOP10 and the like. As a host cell, in addition to
this, the competent cell having high transduction efficiency for
plasmid and phage DNA can be used. For example, E. coli JM109
Competent Cells (Takara Bio Inc.) and the like are included.
[0069] The transformation can be carried out according to, for
example, the D. M. Morrison's method (Method in Enzymology, 68,
326-331, 1979) and the like. In addition, when a commercially
available competent cell is used, the transformation can be carried
out according to the protocol provided in the product.
[0070] The means for the separation of transformant which has been
introduced with a recombinant DNA into which the target DNA
fragment has been incorporated includes, for example, a method of
using properties of the vector to be used for the transduction. For
example, if the vector containing ampicillin resistance gene is
used, by culturing the transformant on a medium containing
ampicillin and by selecting the grown clone, a library of the
transformant (Whole Genome Shotgun clone of M. kansasii genome)
which has been introduced with a recombinant DNA into which the
target DNA fragment has been transducted can be obtained
easily.
(2) Preparation of Microarray
[0071] The microarray is prepared by the following method.
[0072] That is, DNA is purified from the Whole Genome Shotgun clone
derived from M. kansasii genome obtained in the above described (1)
according to the conventional procedures, and then the DNA is
suspended in the reaction solution for PCR and used as a sample for
PCR. Using a suitable primer (it can be a commercially available
primer, for example, M13 Primer M1 (Takara Bio Inc.) and M13 Primer
RV (Takara Bio Inc.) and the like), the PCR is carried out
according to the conventional procedure, and then the obtained PCR
product is purified. After that, the PCR product is spotted on a
slide glass for microarray; and is irradiated with 150 mJ/cm.sup.2
of UV light to immobilize the PCR product onto the slide glass; and
thus the microarray is produced.
[0073] Also, if needed, using, for example, a DNA sequence specific
to tuberculosis bacterium such as M. tuberculosis (Mycobacterium
tuberculosis: human type tuberculosis bacterium) and the like and a
DNA sequence specific to M. kansasii genome and the like as a
positive control, and using, for example, a DNA derived from E.
coli and the like as a negative control, fragmentation of each DNA;
ligation to vector; transformation of E. coli; DNA amplification by
PCR; immobilization of PCR product onto a slide glass are carried
out equally for each DNA, and prepared respective micro arrays.
(3) Fluorescent Dye Labeling on the Target Genomic DNA
[0074] Differently, genomic DNA extracted and purified from M.
kansasii strain and a comparative DNA (for example, a DNA derived
from tuberculosis bacterium such as bovine type tuberculosis
bacterium and the like) are labeled respectively with Cy3 and Cy5
by indirect labeling method using hexylamino-UTP.
[0075] The process will be explained by taking, for example, a
modified indirect labeling method of a protocol published by DeRisi
Laboratory (www.microarray.org) as an example. In this method,
using aUTP having an amino group, and incorporating it into a
molecule by enzymatic extension reaction, the aUTP-incorporated DNA
chain is produced. Then, the DNA is labeled by binding fluorescent
dye (succinimide body) chemically with the amino group of the
DNA.
[0076] Firstly, the starting material (M. kansasii-derived genomic
DNA and comparative genomic DNA) is denatured by heating according
to the conventional procedure (a commercially available kit such as
BioPrime DNA labeling system (Invitrogen Co.) con be used). In the
next place, after addition of 2 .mu.l DTT, a mixed solution of
dATP/dCTP/dGTP, dTTP, Ha-dUTP and Klenow enzyme, the extension
reaction is carried out at 37.degree. C. for about 3 hours. The
obtained reaction product is placed onto an ultrafiltration column
and centrifuged at 14,000 rpm for about 4 minutes, and the
concentrated solution is recovered in a microtube, and then dried
thoroughly using a centrifugal vacuum drier and the like. After
that, above dried reaction product is added with NaHCO.sub.3 and
mixed, and stand at room temperature for 2 to 3 minutes.
[0077] Separately, a solution of Cy3 (or Cy5) dissolved in DMSO is
prepared (Cy-dye Solution Cy3, Cy-dye Solution Cy5). This Cy-dye
Solution Cy3 is added to the above-described reaction product
obtained by using of comparative genomic DNA, and the Cy-dye
Solution Cy5 is added to the above described reaction product
obtained by using M. kansasii genomic DNA, and each mixture is
incubated (under light shielding) at 40.degree. C. for about 60
minutes. Further, each reaction product is added with 4 M
NH.sub.2OH (prepared just before use) and mixed, and is incubated
(under light shielding) for about 15 minutes to obtain the labeled
product for each genomic DNA. After that, the obtained labeled
product is placed onto an ultrafiltration column and centrifuged at
14,000 rpm for about 4 minutes, and the concentrated solution is
recovered in a microtube, and then dried thoroughly using a
centrifugal vacuum drier.
[0078] The obtained labeled product of each genomic DNA in dry
state is suspended and mixed in a solution with a composition of
final concentrations of 0.04 M Tris-acetate (pH 8.1), 0.1 M
potassium acetate, and 0.03 M magnesium acetate tetrahydrate. The
suspension is heat-treated at 94.degree. C. for 15 minutes, and the
fragmentation product of each labeled genomic DNA with 100 to 300
bases is obtained (Cy3-labeled product, Cy5-labeled product).
[0079] Each Cy3-labeled product and Cy5-labeled product is placed
separately onto an ultrafiltration column and centrifuged at 14,000
rpm for about 4 minutes, and each concentrated solution is
recovered in a microtube, and then dried thoroughly using a
centrifugal vacuum drier.
[0080] To a microtube, 40 .mu.l of salmon sperm DNA (10 mg/ml) and
0.5 .mu.l of a reagent solution prepared by adjusting 5 .mu.l of
formamide to make the total volume of 40 to 50 .mu.l using ArrayHyb
Hybridization buffer (SIGMA) (composition in a case when the slide
glass for the microarray to be used in later is 24.times.55 mm) are
placed, and the above obtained Cy3-labeled product and Cy5-labeled
product are mixed in suspension in the same solution and incubated
at 95.degree. C. for 5 minutes to obtain a solution of Cy3Cy5
labeled product. This solution is kept at 70.degree. C. until it is
used for the microarray hybridization in the following section
(4).
(4) Microarray Hybridization (DNA-DNA Hybridization on an
Array)
[0081] On a microarray (DNA chip) prepared in the above-described
(2), a whole solution of mixture of Cy3Cy5-labeled product prepared
in the above described (3) is placed, and covered with a cover
glass keeping no air bubble inside. The microarray is set on a
Hybri-cassette (a hybridization cassette); placed in a Tupperware
matted with a Kim Towel (Nippon Paper Crecia Co., Ltd.) wetted by
distilled water and closed tightly; and reacted (under light
shielding) at 65.degree. C. for 8 hours or more to allow
hybridization. After hybridization, the microarray is soaked in a
2.times.SSC-0.1% SDS solution together with cover glass at room
temperature, and shake gently in the solution to remove the cover
glass. After sequential washing with 1.times.SSC and 0.03% SDS
solution (60.degree. C.) for 10 minutes, 0.2.times.SSC solution
(42.degree. C.) for 10 minutes and 0.05.times.SSC solution (room
temperature) for 10 minutes, the microarray is transferred quickly
to a new dry rack, and dried immediately by centrifugation at 800
rpm for 5 minutes.
(5) Measurement of Fluorescent Intensity: from Signal Detection to
Quantification
[0082] Using a fluorescence readout scanner, 2-channel fluorescent
intensities of Cy3 and Cy5 on the microarray, on which the
microarray hybridization has been performed as described in above
(4), are measured to obtain fluorescence detection data. The
quantification of fluorescence signal is performed using
commercially available DNA chip expression image analysis software,
and automatic spot recognition, background calculation, and
normalization of fluorescent intensity ratio can be carried out
according to the operation procedure of the software.
[0083] The Cy5 labeled product used for hybridization is the
labeled genome derived from M. kansasii, and the Cy3 labeled
product is the labeled comparative genomic DNA. Therefore, when the
fluorescent intensity of each Cy3 and Cy5 is measured and the
fluorescent intensity of Cy5 is detected stronger, it means that
the subject PCR product on the microarray hybridizes with M.
kansasii, and is judged to have high specificity for M. kansasii.
On the other hand, when the fluorescent intensity of Cy3 is
detected stronger, it means that the subject PCR product on the
microarray hybridizes with the comparative genomic DNA, and in
addition, when the fluorescent intensity of Cy3 and Cy5 are
detected in the same level of intensity, or any fluorescent signal
of both Cy3 and Cy5 is detected, it can be judged that the
specificity for M. kansasii is low.
[0084] It should be noted that if a positive control (for example,
specific DNA fragment for M. tuberculosis, specific DNA fragment
for M. kansasii and the like) and a negative control (for example,
DNA fragment derived from E. coli and the like) are spotted on the
microarray, the tendency of the fluorescent intensity obtained by
measuring fluorescent intensity of Cy3Cy5 of each spot can be
utilized as a standard for the evaluation of data produced in the
scanning fluorescence measurement.
[0085] In addition, for the purpose of screening a candidate
sequence for use in detecting M. kansasii specifically, based on
the Cy3/Cy5 fluorescent intensity ratio (Ratio) detected on the DNA
chip scatter plot is made, and analysis is carried out as
follows:
[0086] In the analysis, among the positive control sequences used,
the value of the Cy3/Cy5 Ratio of the DNA fragment specific to M.
kansasii will be a useful standard value for the evaluation of
specificity. That is, among the candidates which have been
screened, the clones which provide significantly specific signal
for M. kansasii (i.e. fluorescent intensity of Cy5 is strong) as
the result of the analysis of Cy3/Cy5 Ratio value, and yet provide
a large value of the Ratio compared with the positive control of
specific spot to M. kansasii is selected.
[0087] Further, determination of the nucleotide sequence of the
obtained candidate clone can be carried out according to the
conventional procedures using equipment such as, for example, ABI
PRISM310 capillary sequencer (Applied Biosystems).
[0088] A primer for the detecting M. kansasii in the present
invention includes the primer that comprises an oligonucleotide
which comprises a part or the entire sequence of the nucleotide
sequence depicted in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or
SEQ ID NO: 4 or a part or the entire sequence of a nucleotide
sequence complementary to the nucleotide sequence, wherein the
oligonucleotide is capable of hybridizing with a nucleotide
sequence of M. kansasii gene (hereinafter, optionally referred to
as the primer of the present invention).
[0089] In addition, in compliance with the conditions of PCR,
nucleotide hybridization and the like, the primer of the present
invention can be used by selecting an appropriate length in a
proper region in consideration of dissociation temperature (Tm
value) and the like from the oligonucleotides which comprises a
part or the entire sequence of the nucleotide sequence depicted in
SEQ ID NO: 1 to 4, or a part or the entire sequence of a nucleotide
sequence complementary to the nucleotide sequence. Preferably, the
length of primer is 10 to 50 bases which are considered necessary
base number for retaining specificity as a primer, more preferably
10 to 35 bases, yet more preferably 18 to 25 bases.
[0090] As to the method of designing primer, the primer can be
designed using software commonly used for designing primer such as,
for example, a web tool for primer design, Primer 3 (Whitehead
Institute for Biomedical Research) and the like.
[0091] A specific example of the oligonucleotide to be used for the
primer of the present invention (the oligonucleotide of the present
invention) which comprises the part or the entire sequence of the
nucleotide sequence depicted in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID
NO: 3 or SEQ ID NO: 4, or the part or the entire sequence of the
nucleotide sequence complementary to the nucleotide sequence,
wherein the oligonucleotide is capable of hybridizing with the
nucleotide sequence of M. kansasii gene is the same as described in
the above explanation of the oligonucleotide of the present
invention.
[0092] Specific examples of such primer include, for example, the
primer that comprises an oligonucleotide which comprises a part or
the entire sequence of the nucleotide sequence depicted in SEQ ID
NO: 5 to 52 or a part or the entire sequence of a nucleotide
sequence complementary to the nucleotide sequence, wherein the
oligonucleotide is capable of hybridizing with the nucleotide
sequence of M. kansasii gene.
[0093] A more preferable example of the primer of the present
invention includes the one which comprises a sequence selected from
a nucleotide sequence depicted in SEQ ID NO: 5 to 52 or the one
which comprises a nucleotide sequence complementary to the
nucleotide sequence selected from the nucleotide sequence depicted
in SEQ ID NO: 5 to 52. Among them, a primer which comprises a
sequence selected from the nucleotide sequence depicted in SEQ ID
NO: 5, 6, 13 to 16, 27 to 30, and 41 to 44 or a nucleotide sequence
complementary to the nucleotide sequence selected from the
nucleotide sequence depicted in SEQ ID NO: 5, 6, 13 to 16, 27 to
30, and 41 to 44 is included.
[0094] It should be noted that the primer having a nucleotide
sequence depicted in SEQ ID NO: 5 to 12 is designed based on the
nucleotide sequence depicted in SEQ ID NO: 1. The primer having a
nucleotide sequence depicted in SEQ ID NO: 13 to 26 is designed
based on the nucleotide sequence depicted in SEQ ID NO: 2. The
primer having a nucleotide sequence depicted in SEQ ID NO: 27 to 40
is designed based on the nucleotide sequence depicted in SEQ ID NO:
3. The primer having a nucleotide sequence depicted in SEQ ID NO:
41 to 52 is designed based on the nucleotide sequence depicted in
SEQ ID NO: 4.
[0095] In FIG. 1, in the nucleotide sequence depicted in SEQ ID NO:
1, the location of the primer having nucleotide sequence depicted
in SEQ ID NO: 5 and 6 is each indicated as 1c_plate1_Fw1 and
1c_plate1_Rv1 by arrow.
[0096] In FIG. 2, in the nucleotide sequence depicted in SEQ ID NO:
2, the location of the primer having nucleotide sequence depicted
in SEQ ID NO: 13, 14, 15 and 16 is each indicated as 6c_plate1_Fw1,
6c_plate1_Rv1, 6c_plate1_Fw2 and 6c_plate1_Rv2 by arrow.
[0097] In FIG. 3, in the nucleotide sequence depicted in SEQ ID NO:
3, the location of the primer having nucleotide sequence depicted
in SEQ ID NO: 27, 28, 29 and 30 is each indicated as 8d_plate1_Fw1,
8d_plate1_Rv1, 8d_plate1_Fw2 and 8d_plate1_Rv2 by arrow.
[0098] In FIG. 4, in the nucleotide sequence depicted in SEQ ID NO:
4, the location of the primer having nucleotide sequence depicted
in SEQ ID NO: 41, 42, 43 and 44 is each indicated as 9c_plate1_Fw1,
9c_plate1_Rv1, 9c_plate1_Fw2 and 9c_plate1_Rv2 by arrow.
[0099] In addition, in the nucleotide sequence depicted in SEQ ID
NO: 1, the location of the primer having the nucleotide sequence
depicted in SEQ ID NO: 7 to 12 is each indicated as follows:
SEQ ID NO: 7 (1c_plate1_Fw3): base No. 33 to 51; SEQ ID NO: 8
(1c_plate1_Fw4): base No. 212 to 231; SEQ ID NO: 9 (1c_plate1_Fw5):
base No. 315 to 334; SEQ ID NO: 10 (1c_plate1_Rv3): base No. 185 to
204; SEQ ID NO: 11 (1c_plate1_Rv4): base No. 411 to 430; SEQ ID NO:
12 (1c_plate1_Rv5): base No. 461 to 481.
[0100] In the nucleotide sequence depicted in SEQ ID NO: 2, the
location of the primer having the nucleotide sequence depicted in
SEQ ID NO: 17 to 26 is each indicated as follows:
SEQ ID NO: 17 (6c_plate1_Fw3): base No. 4 to 21; SEQ ID NO: 18
(6c_plate1_Fw4): base No. 48 to 67; SEQ ID NO: 19 (6c_plate1_Fw5):
base No. 229 to 247; SEQ ID NO: 20 (6c_plate1_Fw6): base No. 279 to
296; SEQ ID NO: 21 (6c_plate1_Fw7): base No. 380 to 399; SEQ ID NO:
22 (6c_plate1_Rv3): base No. 166 to 184; SEQ ID NO: 23
(6c_plate1_Rv4): base No. 195 to 214; SEQ ID NO: 24
(6c_plate1_Rv5): base No. 368 to 387; SEQ ID NO: 25
(6c_plate1_Rv6): base No. 428 to 445; SEQ ID NO: 26
(6c_plate1_Rv7): base No. 523 to 542.
[0101] In the nucleotide sequence depicted in SEQ ID NO: 3, the
location of the primer having the nucleotide sequence depicted in
SEQ ID NO: 31 to 40 is each indicated as follows:
SEQ ID NO: 31 (8d_plate1_Fw3): base No. 5 to 22; SEQ ID NO: 32
(8d_plate1_Fw4): base No. 54 to 72; SEQ ID NO: 33 (8d_plate1_Fw5):
base No. 207 to 226; SEQ ID NO: 34 (8d_plate1_Fw6): base No. 289 to
308; SEQ ID NO: 35 (8d_plate1_Fw7): base No. 472 to 490; SEQ ID NO:
36 (8d_plate1_Rv3): base No. 151 to 169; SEQ ID NO: 37
(8d_plate1_Rv4): base No. 220 to 239; SEQ ID NO: 38
(8d_plate1_Rv5): base No. 335 to 353; SEQ ID NO: 39
(8d_plate1_Rv6): base No. 408 to 427; SEQ ID NO: 40
(8d_plate1_Rv7): base No. 616 to 635.
[0102] In the nucleotide sequence depicted in SEQ ID NO: 4, the
location of the primer having the nucleotide sequence depicted in
SEQ ID NO: 45 to 52 is each indicated as follows:
SEQ ID NO: 45 (9c_plate1_Fw3): base No. 17 to 36; SEQ ID NO: 46
(9c_plate1_Fw4): base No. 117 to 135; SEQ ID NO: 47
(9c_plate1_Fw5): base No. 405 to 424; SEQ ID NO: 48
(9c_plate1_Fw6): base No. 492 to 512; SEQ ID NO: 49
(9c_plate1_Rv3): base No. 182 to 201; SEQ ID NO: 50
(9c_plate1_Rv4): base No. 263 to 281; SEQ ID NO: 51
(9c_plate1_Rv5): base No. 528 to 547; SEQ ID NO: 52
(9c_plate1_Rv6): base No. 654 to 673.
[0103] It should be noted that in the above description, the name
of the primer denominated in the present invention is shown in
parenthesis next to SEQ ID NO.
[0104] The method of obtaining the primer of the present invention
is as described in the method of obtaining a nucleotide of the
present invention.
[0105] In addition, the primer of the present invention can be
labeled with a labeling substance.
[0106] The labeling substance to be used for labeling the primer of
the present invention can be used any of the well known labeling
substances such as a radioisotope, an enzyme, a fluorescent
substance, a luminescent substance, biotin and the like.
[0107] For example, the radioisotope such as .sup.32P, .sup.33P,
.sup.35S and the like, the enzyme such as alkaline phosphatase,
horseradish peroxydase and the like, the fluorescent substance such
as cyanine dye group of Cy3, Cy5 (Amersham Biosciences),
fluorescein and the like, the luminescent substance such as
chemoluminescent reagent including acridinium ester and the like
are included.
[0108] When the primer of the present invention is labeled with
radioisotope, a method of labeling by incorporation of a
radioisotope-labeled nucleotide into the primer at the time when
the primer is synthesized, or a method of labeling with
radioisotope after the primer is synthesized or the like are
included. Specifically, a frequently-used random primer method,
nick-translation method, 5'-terminal labeling method using T4
polynucleotide kinase, 3'-terminal labeling method using terminal
deoxynucleotidyl transferase and RNA labeling method are
included.
[0109] When the primer of the present invention is labeled with an
enzyme, the conventional technique in this field of direct labeling
method by which the primer to be labeled is directly linked
covalently with an enzyme molecule such as alkaline phosphatase,
horseradish peroxidase or the like can be employed.
[0110] When the primer of the present invention is labeled with
fluorescent substance, for example, the fluorescently-labeled
nucleotide can be incorporated into the primer by conventional
labeling technique in this field. In addition, by a method of
replacing a sequence with a nucleotide having a linker arm as a
member of a oligonucleotide (See, for example, Nucleic Acids Res.,
1986, vol. 14, p. 6115), the nucleotide can also be labeled with
the fluorescent substance. In that case, there can also be a method
that a uridine having a linker arm on 5-position is synthesized
chemically from a deoxyuridine by a synthetic method disclosed in
JP-A-1985-500717 and then a fluorescent substance is introduced
into the above-described oligonucleotide.
[0111] In the methods of labeling with a luminescent substance and
with biotin, the labeling can be carried out according to the
conventional technique of luminescent-labeling or biotin-labeling
of nucleotide usually conducted in this field.
[0112] A probe for detecting M. kansasii in the present invention
includes the probe that comprises an oligonucleotide which
comprises a part or the entire sequence of the nucleotide sequence
depicted in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO:
4, or a part or the entire sequence of a nucleotide sequence
complementary to the nucleotide sequence, wherein the
oligonucleotide is capable of hybridizing with the nucleotide
sequence of M. kansasii gene (hereinafter, optionally referred to
as the probe of the present invention).
[0113] A specific example of the oligonucleotide to be used for the
probe of the present invention (the oligonucleotide of the present
invention) which comprises the part or the entire sequence of the
nucleotide sequence depicted in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID
NO: 3 or SEQ ID NO: 4, or the part or the entire sequence of the
nucleotide sequence complementary to the nucleotide sequence,
wherein the nucleotide is capable of hybridizing with the
nucleotide sequence of M. kansasii gene is the same as described in
the above explanation of the oligonucleotide of the present
invention.
[0114] In compliance with the conditions of PCR, nucleotide
hybridization and the like, the probe of the present invention can
be used by selecting an appropriate length in a proper region in
calculation of dissociation temperature (Tm value) and the like
from the oligonucleotide which comprises a part or the entire
sequence of the nucleotide sequence depicted in SEQ ID NO: 1 to 4,
or a part or the entire sequence of a nucleotide sequence
complementary to the nucleotide sequence. It is desirable to design
the probe in consideration of the base number necessary for
retaining specificity as a probe if the probe is intended to have
sufficient specificity.
[0115] For example, the probe to be used for nucleotide
hybridization method (for example, Southern hybridization and the
like) includes a probe having the base length of 10 to 700 bases,
preferably 100 to 600 bases and further preferably 200 to 500
bases.
[0116] In addition, for example, the probe to be used for the
real-time PCR system (for example, TaqMan.TM. method, Molecular
Beacon method and the like) includes the one having the base length
of 10 to 50 bases, preferably 15 to 40 bases and further preferably
20 to 30 bases.
[0117] Specific example of such probe include, for example, the one
selected from the probe that comprises an oligonucleotide which
comprises a part or the entire sequence of the nucleotide sequence
depicted in SEQ ID NO: 5 to 79 or a part or the entire sequence of
a sequence complementary to the nucleotide sequence, wherein the
oligonucleotide is capable of hybridizing with the nucleotide
sequence of M. kansasii gene.
[0118] A preferable example of the probe of the present invention
includes the one which comprises a sequence selected from the
nucleotide sequence depicted in SEQ ID NO: 5 to 79. Among them, the
probe which comprises a sequence selected from nucleotide sequence
depicted in SEQ ID NO: 5, 6, 13 to 16, 27 to 30, 41 to 44, 53, 57
to 59, 65 to 67, 73 to 75 are preferable. Particularly, the probe
which comprises a sequence selected from the nucleotide sequence
depicted in SEQ ID NO: 53, 57 to 59, 65 to 67, 73 to 75 are
preferable.
[0119] It should be noted that the nucleotide sequence depicted in
SEQ ID NO: 53 to 79 is the one to be amplified by the PCR using the
primer of the present invention. The combination of a forward
primer and a reverse primer, and SEQ ID NO of the nucleotide to be
amplified by the PCR using these primers are shown collectively in
Table 1. The table shows that, for example, the nucleotide sequence
depicted in SEQ ID NO: 53 is a sequence which is amplified by the
PCR using an oligonucleotide with nucleotide sequence depicted in
SEQ ID NO: 5 as a forward primer and an oligonucleotide with
nucleotide sequence depicted in SEQ ID NO: 6 as a reverse
primer.
TABLE-US-00001 TABLE 1 Forward Reverse Amplified primer primer
sequence 5 6 53 7 10 54 8 11 55 9 12 56 13 14 57 15 16 58 13 16 59
17 22 60 18 23 61 19 24 62 20 25 63 21 26 64 27 28 65 29 30 66 27
30 67 31 36 68 32 37 69 33 38 70 34 39 71 35 40 72 41 42 73 43 44
74 41 44 75 45 49 76 46 50 77 47 51 78 48 52 79
[0120] The method of obtaining the probe of the present invention
is as described in the method of obtaining a nucleotide of the
present invention.
[0121] The probe of the present invention can be labeled with a
labeling substance.
[0122] The labeling substance to be used for labeling the probe of
the present invention can be used any of the well known labeling
substances such as radioisotope and enzyme, fluorescent substance,
luminescent substance, biotin and the like.
[0123] A specific example of the labeling substance and the
labeling method to be used for labeling the probe of the present
invention are as described in the explanation of labeling method of
the primer of the present invention.
[0124] The labeled probe to be used in the real-time PCR method as
described later includes the probe of the present invention labeled
with a labeling substance usually used in the real-time detection
method. For example, the labeled probe of the present invention in
which the 5'-terminal is labeled with a reporter fluorescent
substance (carboxyfluorescein (FAM), hexachlorofluorescein (HEX),
tetrachlorofluorescein (TET) and the like) and the 3'-terminal is
labeled with a quencher dye (for example, a fluorescent substance
such as carboxytetramethylrhodamine (TAMRA), nonfluorescent
substance such as Black Hole Quencher dye (BHQ) and
4-((4-(dimethylamino) phenyl)azo)benzoic acid (DABCYL) is
included.
[0125] The sample to be used for detecting M. kansasii involved in
the present invention includes clinical specimen such as sputum,
blood, pharyngeal mucosa, gastric juice, bronchial washing fluid,
transbronchial specimen, puncture fluid such as pleural effusion
and pus. In addition, the sample can be cultured bacterial body
isolated from a specimen, nucleic acid isolated and purified from
such bacterial body, or nucleic acid amplified by a nucleic acid
amplification detection system and the like.
[0126] To extract and purify DNA from the above-described samples,
the extraction and purification can be carried out according to the
conventional procedures usually used for the extraction of
acid-fast bacterium (tuberculosis bacterium) DNA from a material
specimen.
[0127] In the case when the bacterial body is used as a sample, for
example, the method of disrupting membrane structure of
tuberculosis bacterium by treating the bacterial body with protein
denaturing agent, for example, surface activating agent such as
SDS, guanidine thiocyanate (GTC) and the like and the method of
physical disruption of the bacterial body using glass beads and the
like are included.
[0128] In the case when the expectorated sputum is used as a
sample, in compliance with the recommendation from Center for
Disease Control and Prevention (CDC), homogenization of the
specimen material can be carried out, as pretreatment, by NALC
(N-acetyl-L-cysteine)-NaOH method (Kent P T, Kubica G P, Pubric
Health Mycobacteriology, A Guide for the Level III Laboratory,
U.S.Department of Health and Human Services, Public Health Service,
Center for Disease Control, Atlanta, U.S.A., 1985, p. 31-55).
[0129] After that, by the general method for the preparation of DNA
(phenol-chloroform extraction method, ethanol precipitation method
and the like, as described in Rapid and simple method for
purification of nucleic acids, J. Clin. Microbiol., 1990, March;
28(3), 495-503, Boom R, Sol C J, Salimans M M, Jansen C L,
Wertheim-van Dillen P M, van der Noordaa J), extraction and
purification of DNA can be carried out.
[0130] Taking the case that the cultured bacterial body isolated
from specimen is used as a sample as an example, colonies on the
Ogawa's medium is recovered; suspended in sterile distilled water;
centrifuged to collect bacterial body; the bacterial body is
resuspended in distilled water and autoclaved; after disruption
treatment (physical disruption using glass beads and the like), the
disrupted bacterial body is further centrifuged to recover
supernatant fluid. The DNA can be extracted and purified from the
obtained supernatant fluid. As to the extraction of DNA, as various
kits are commercially available, such kit can be utilized for this
purpose, or the extraction can be carried out according to the
conventional procedures in this field (for example, the
phenol-chloroform extraction method, a method of precipitation
using ethanol, propanol and the like). For example, using an
ion-exchange resin type DNA extraction and purification kit
Genomic-tip (QIAGEN GmbH) and the like, the extraction and
purification of the DNA can be performed.
[0131] The detection method of M. kansasii involved in the present
invention includes, for example:
(A) A method using an oligonucleotide (the oligonucleotide of the
present invention) which comprises a part or the entire sequence of
the nucleotide sequence depicted in SEQ ID NO: 1, SEQ ID NO: 2, SEQ
ID NO: 3 or SEQ ID NO: 4, or a part or the entire sequence of a
nucleotide sequence complementary to the nucleotide sequence,
wherein the oligonucleotide is capable of hybridizing with the
nucleotide sequence of Mycobacterium kansasii gene; (B) A method
using a labeled oligonucleotide of the present invention as a
labeled probe. Each method will be explained below.
(A) A Method Using the Oligonucleotide of the Present Invention as
a Primer
[0132] As the method (A), "a method in which, the nucleic acid
amplification reaction is performed using the primer of the present
invention, and using a nucleic acid in a sample as a template, and
the obtained primer extension product is detected" is included.
Specifically, for example, a method in which, using the primer of
the present invention, the primer is hybridized with a nucleic acid
in the sample, then the nucleic acid amplification by DNA
polymerase and the like [for example, PCR; Patent Document 3, LAMP
(Loop-mediated Isothermal Amplification) method (Tsugunori Notomi
et al., Nucleic Acid Res., 28, e63, 2000), ICAN (Isothermal and
Chimeric primer-initiated Amplification of Nucleic acids) method
(Clinical Pathology, 51(11), 1061-1067, 2003, November), LCR
(ligase chain reaction) method (JP-A-4-211399), SDA (strand
displacement amplification) method (JP-A-8-19394)] is carried out
to achieve primer extension is included. And, by this method, the
sequence of the specific region of the nucleotide sequence of M.
kansasii gene can be amplified, and thus M. kansasii can be
detected by measuring the obtained primer extension product.
[0133] The specific example of the primer of the present invention
to be used in the PCR is as described above.
[0134] Preferably, a forward primer includes an oligonucleotide
which comprises a part or the entire sequence of the nucleotide
sequence depicted in SEQ ID NO: 5, 7 to 9, 13, 15, 17 to 21, 27,
29, 31 to 35, 41, 43, 45 to 48 or a part or the entire sequence of
a nucleotide sequence complementary to the nucleotide sequence,
wherein the oligonucleotide is capable of hybridizing with the
nucleotide sequence of M. kansasii gene, and a reverse primer
includes an oligonucleotide which comprises a part or the entire
sequence of the nucleotide sequence depicted in SEQ ID NO: 6, 10 to
12, 14, 16, 22 to 26, 28, 30, 36 to 40, 42, 44, 49 to 52 or a part
or the entire sequence of a nucleotide sequence complementary to
the nucleotide sequence, wherein the oligonucleotide is capable of
hybridizing with the nucleotide sequence of M. kansasii gene
[0135] More preferably, the forward primer includes the one which
comprises a sequence selected from the nucleotide sequence depicted
in SEQ ID NO: 5, 7 to 9, 13, 15, 17 to 21, 27, 29, 31 to 35, 41,
43, 45 to 48, and the reverse primer includes the one which
comprises a sequence selected from the nucleotide sequence depicted
in SEQ ID NO: 5, 10 to 12, 14, 16, 22 to 26, 28, 30, 36 to 40, 42,
44, 49 to 52.
[0136] Still preferably, the forward primer includes the one which
comprises a sequence selected from the nucleotide sequence depicted
in SEQ ID NO: 5, 13, 15, 27, 29, 41, 43, and the reverse primer
includes the one which comprises a sequence selected from the
nucleotide sequence depicted in SEQ ID NO: 6, 14, 16, 28, 30, 42,
44.
[0137] The preferable combination of the forward primer and the
reverse primer includes the combination as described above in Table
1.
[0138] Among them, a particularly preferable combination of the
forward primer and the reverse primer includes:
(1) A combination in which the forward primer is an oligonucleotide
comprising the nucleotide sequence depicted in SEQ ID NO: 5 and the
reverse primer is an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 6; (2) A combination in which the
forward primer is an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 13 and the reverse primer is an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 14; (3) A combination in which the forward primer is an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 15 and the reverse primer is an oligonucleotide comprising
the nucleotide sequence depicted in SEQ ID NO: 16; (4) A
combination in which the forward primer is an oligonucleotide
comprising the nucleotide sequence depicted in SEQ ID NO: 13 and
the reverse primer is an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 16; (5) A combination in which the
forward primer is an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 27 and the reverse primer is an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 28; (6) A combination in which the forward primer is an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 29 and the reverse primer is an oligonucleotide comprising
the nucleotide sequence depicted in SEQ ID NO: 30; (7) A
combination in which the forward primer is an oligonucleotide
comprising the nucleotide sequence depicted in SEQ ID NO: 27 and
the reverse primer is an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 30; (8) A combination in which the
forward primer is an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 41 and the reverse primer is an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 42; (9) A combination in which the forward primer is an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 43 and the reverse primer is an oligonucleotide comprising
the nucleotide sequence depicted in SEQ ID NO: 44; (10) A
combination in which the forward primer is an oligonucleotide
comprising the nucleotide sequence depicted in SEQ ID NO: 41 and
the reverse primer is an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 44.
[0139] Conditions, operation method and the like of the PCR by
using the above-described primer can be in accordance with the
conventional routine procedures usually used in this field.
[0140] A method of determining the primer extension product
includes, (A-1) a method in which the determination is performed
based on the results of electrophoresis of the primer extension
product obtained by the polymerase chain reaction, (A-2) a method
in which the determination is performed by the real-time PCR
method, and (A-3) a method in which the determination is performed
by measuring the signal derived from the primer extension product
obtained by the polymerase chain reaction using a labeled
primer.
[0141] Each method will be explained in the followings.
(A-1) A Method in which the Determination is Performed Based on the
Results of Electrophoresis of the Primer Extension Product Obtained
by the Polymerase Chain Reaction
[0142] This method includes, for example, "a method for detecting
M. kansasii which comprises the following process:
(i) performing PCR using as a primer an oligonucleotide comprising
a part or the entire sequence of the nucleotide sequence depicted
in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4, or a
part or the entire sequence of a nucleotide sequence complementary
to the nucleotide sequence, wherein the oligonucleotide is capable
of hybridizing with the nucleotide sequence of M. kansasii gene
(the primer of the present invention), and using a nucleic acid in
the sample as a template is carried out; (ii) performing
electrophoresis of the primer extension product obtained in above
(i), and detecting M. kansasii on the basis of the obtained
result".
[0143] A method for detecting M. kansasii from the results of
electrophoresis includes, for example, (A-1-1) a method in which
the determination is made by confirming a fraction of the primer
extension product having objective size (number of base pair),
(A-1-2) a method in which the determination is made by
hybridization using a labeled probe, and the like.
[0144] Conditions, operation method and the like of the
electrophoresis can be worked out according to the conventional
procedures usually performed in this field.
(A-1-1) A Method in which the Determination is Made by Confirming a
Fraction of the Primer Extension Product with Intended Number of
Base Pair
[0145] As to the above described method in which the determination
is made by confirming a fraction of the primer extension product
having objective size (number of base pair), for example, at first
the PCR is carried out, then the obtained primer extension product
is subjected to the electrophoresis. Size (number of base pair) of
the amplification product is estimated in advance from both the
forward primer and the reverse primer to be used for the PCR, and
based on that, the confirmation of whether or not the obtained
fraction of electrophoresis corresponds to the estimated size of
the amplification product can be carried out by the conventional
procedures. A detection method based on the characteristic size of
the amplification product measured, for example, by such a way that
the type of nucleic acid is visualized by staining with ethidium
bromide and the like, is included.
[0146] A specific determination method according to the method of
(A-1-1) includes, for example, the following methods:
(1) A method in which, after performing PCR using an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 5 as a forward primer and an oligonucleotide comprising the
nucleotide sequence depicted in SEQ ID NO: 6 as a reverse primer,
the obtained primer extension product is subjected to
electrophoresis, and the one in which a fraction of 167 base pairs
or a fraction of an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 56 is confirmed is determined to be
positive. (2) A method in which, after performing PCR using an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 7 as a forward primer and an oligonucleotide comprising the
nucleotide sequence depicted in SEQ ID NO: 10 as a reverse primer,
the obtained primer extension product is subjected to
electrophoresis, and the one in which a fraction of an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 54 is confirmed is determined to be positive. (3) A method
in which, after performing PCR using an oligonucleotide comprising
the nucleotide sequence depicted in SEQ ID NO: 8 as a forward
primer and an oligonucleotide comprising the nucleotide sequence
depicted in SEQ ID NO: 11 as a reverse primer, the obtained primer
extension product is subjected to electrophoresis, and the one in
which a fraction of an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 55 is confirmed is determined to be
positive. (4) A method in which, after performing PCR using an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 9 as a forward primer and an oligonucleotide comprising the
nucleotide sequence depicted in SEQ ID NO: 12 as a reverse primer,
the obtained primer extension product is subjected to
electrophoresis, and the one in which a fraction of an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 56 is confirmed is determined to be positive. (5) A method
in which, after performing PCR using an oligonucleotide comprising
the nucleotide sequence depicted in SEQ ID NO: 13 as a forward
primer and an oligonucleotide comprising the nucleotide sequence
depicted in SEQ ID NO: 14 as a reverse primer, the obtained primer
extension product is subjected to electrophoresis, and the one in
which a fraction of 216 base pair or a fraction of an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 57 is confirmed is determined to be positive. (6) A method
in which, after performing PCR using an oligonucleotide comprising
the nucleotide sequence depicted in SEQ ID NO: 15 as a forward
primer and an oligonucleotide comprising the nucleotide sequence
depicted in SEQ ID NO: 16 as a reverse primer, the obtained primer
extension product is subjected to electrophoresis, and the one in
which a fraction of 168 base pair or a fraction of an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 58 is confirmed is determined to be positive. (7) A method
in which, after performing PCR using an oligonucleotide comprising
the nucleotide sequence depicted in SEQ ID NO: 13 as a forward
primer and an oligonucleotide comprising the nucleotide sequence
depicted in SEQ ID NO: 16 as a reverse primer, the obtained primer
extension product is subjected to electrophoresis, and the one in
which a fraction of 336 base pair or a fraction of an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 59 is confirmed is determined to be positive. (8) A method
in which, after performing PCR using an oligonucleotide comprising
the nucleotide sequence depicted in SEQ ID NO: 17 as a forward
primer and an oligonucleotide comprising the nucleotide sequence
depicted in SEQ ID NO: 22 as a reverse primer, the obtained primer
extension product is subjected to electrophoresis, and the one in
which a fraction of an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 60 is confirmed is determined to be
positive. (9) A method in which, after performing PCR using an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 18 as a forward primer and an oligonucleotide comprising the
nucleotide sequence depicted in SEQ ID NO: 23 as a reverse primer,
the obtained primer extension product is subjected to
electrophoresis, and the one in which a fraction of an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 61 is confirmed is determined to be positive. (10) A method
in which, after performing PCR using an oligonucleotide comprising
the nucleotide sequence depicted in SEQ ID NO: 19 as a forward
primer and an oligonucleotide comprising the nucleotide sequence
depicted in SEQ ID NO: 24 as a reverse primer, the obtained primer
extension product is subjected to electrophoresis, and the one in
which a fraction of an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 62 is confirmed is determined to be
positive. (11) A method in which, after performing PCR using an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 20 as a forward primer and an oligonucleotide comprising the
nucleotide sequence depicted in SEQ ID NO: 25 as a reverse primer,
the obtained primer extension product is subjected to
electrophoresis, and the one in which a fraction of an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 63 is confirmed is determined to be positive. (12) A method
in which, after performing PCR using an oligonucleotide comprising
the nucleotide sequence depicted in SEQ ID NO: 21 as a forward
primer and an oligonucleotide comprising the nucleotide sequence
depicted in SEQ ID NO: 26 as a reverse primer, the obtained primer
extension product is subjected to electrophoresis, and the one in
which a fraction of an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 64 is confirmed is determined to be
positive. (13) A method in which, after performing PCR using an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 27 as a forward primer and an oligonucleotide comprising the
nucleotide sequence depicted in SEQ ID NO: 28 as a reverse primer,
the obtained primer extension product is subjected to
electrophoresis, and the one in which a fraction of 156 base pair
or a fraction of an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 65 is confirmed is determined to be
positive. (14) A method in which, after performing PCR using an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 29 as a forward primer and an oligonucleotide comprising the
nucleotide sequence depicted in SEQ ID NO: 30 as a reverse primer,
the obtained primer extension product is subjected to
electrophoresis, and the one in which a fraction of 156 base pair
or a fraction of an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 66 is confirmed is determined to be
positive. (15) A method in which, after performing PCR using an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 27 as a forward primer and an oligonucleotide comprising the
nucleotide sequence depicted in SEQ ID NO: 30 as a reverse primer,
the obtained primer extension product is subjected to
electrophoresis, and the one in which a fraction of 358 base pair
or a fraction of an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 67 is confirmed is determined to be
positive. (16) A method in which, after performing PCR using an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 31 as a forward primer and an oligonucleotide comprising the
nucleotide sequence depicted in SEQ ID NO: 36 as a reverse primer,
the obtained primer extension product is subjected to
electrophoresis, and the one in which a fraction of an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 68 is confirmed is determined to be positive. (17) A method
in which, after performing PCR using an oligonucleotide comprising
the nucleotide sequence depicted in SEQ ID NO: 32 as a forward
primer and an oligonucleotide comprising the nucleotide sequence
depicted in SEQ ID NO: 37 as a reverse primer, the obtained primer
extension product is subjected to electrophoresis, and the one in
which a fraction of an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 69 is confirmed is determined to be
positive. (18) A method in which, after performing PCR using an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 33 as a forward primer and an oligonucleotide comprising the
nucleotide sequence depicted in SEQ ID NO: 38 as a reverse primer,
the obtained primer extension product is subjected to
electrophoresis, and the one in which a fraction of an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 70 is confirmed is determined to be positive. (19) A method
in which, after performing PCR using an oligonucleotide comprising
the nucleotide sequence depicted in SEQ ID NO: 34 as a forward
primer and an oligonucleotide comprising the nucleotide sequence
depicted in SEQ ID NO: 39 as a reverse primer, the obtained primer
extension product is subjected to electrophoresis, and the one in
which a fraction of an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 71 is confirmed is determined to be
positive. (20) A method in which, after performing PCR using an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 35 as a forward primer and an oligonucleotide comprising the
nucleotide sequence depicted in SEQ ID NO: 40 as a reverse primer,
the obtained primer extension product is subjected to
electrophoresis, and the one in which a fraction of an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 72 is confirmed is determined to be positive. (21) A method
in which, after performing PCR using an oligonucleotide comprising
the nucleotide sequence depicted in SEQ ID NO: 41 as a forward
primer and an oligonucleotide comprising the nucleotide sequence
depicted in SEQ ID NO: 42 as a reverse primer, the obtained primer
extension product is subjected to electrophoresis, and the one in
which a fraction of 163 base pair or a fraction of an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 73 is confirmed is determined to be positive. (22) A method
in which, after performing PCR using an oligonucleotide comprising
the nucleotide sequence depicted in SEQ ID NO: 43 as a forward
primer and an oligonucleotide comprising the nucleotide sequence
depicted in SEQ ID NO: 44 as a reverse primer, the obtained primer
extension product is subjected to electrophoresis, and the one in
which a fraction of 158 base pair or a fraction of an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 74 is confirmed is determined to be positive. (23) A method
in which, after performing PCR using an oligonucleotide comprising
the nucleotide sequence depicted in SEQ ID NO: 41 as a forward
primer and an oligonucleotide comprising the nucleotide sequence
depicted in SEQ ID NO: 44 as a reverse primer, the obtained primer
extension product is subjected to electrophoresis, and the one in
which a fraction of 387 base pair or a fraction of an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 75 is confirmed is determined to be positive. (24) A method
in which, after performing PCR using an oligonucleotide comprising
the nucleotide sequence depicted in SEQ ID NO: 45 as a forward
primer and an oligonucleotide comprising the nucleotide sequence
depicted in SEQ ID NO: 49 as a reverse primer, the obtained primer
extension product is subjected to electrophoresis, and the one in
which a fraction of an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 76 is confirmed is determined to be
positive. (25) A method in which, after performing PCR using an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 46 as a forward primer and an oligonucleotide comprising the
nucleotide sequence depicted in SEQ ID NO: 50 as a reverse primer,
the obtained primer extension product is subjected to
electrophoresis, and the one in which a fraction of an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 77 is confirmed is determined to be positive. (26) A method
in which, after performing PCR using an oligonucleotide comprising
the nucleotide sequence depicted in SEQ ID NO: 47 as a forward
primer and an oligonucleotide comprising the nucleotide sequence
depicted in SEQ ID NO: 51 as a reverse primer, the obtained primer
extension product is subjected to electrophoresis, and the one in
which a fraction of an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 78 is confirmed is determined to be
positive. (27) A method in which, after performing PCR using an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 48 as a forward primer and an oligonucleotide comprising the
nucleotide sequence depicted in SEQ ID NO: 52 as a reverse primer,
the obtained primer extension product is subjected to
electrophoresis, and the one in which a fraction of an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 79 is confirmed is determined to be positive.
[0147] Among those described above, the methods of (1), (5) to (7),
(13) to (15), (21) to (23) are preferable.
(A-1-2) A Method in which the Determination is Made by
Hybridization Using a Labeled Probe
[0148] A method in which the determination is made by hybridization
using a labeled probe includes, for example, a method in which,
after electrophoresis, the obtained electrophoretic fraction is
subjected to hybridization with a labeled probe prepared by
labeling a probe of the present invention with a labeling
substance, and the one which has been confirmed the presence of a
fraction hybridized with the aforementioned labeled probe by
detecting the signal derived form the aforementioned labeled probe
is determined to be positive.
[0149] Specific examples of the probe to be used and the labeling
substance of the probe and a labeling method of the probe are as
described above.
[0150] A specific determination method according to the method of
(A-1-2) includes, for example, the following methods:
(1) A method in which, after performing the PCR using an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 5 as a forward primer and an oligonucleotide comprising the
nucleotide sequence depicted in SEQ ID NO: 6 as a reverse primer,
the obtained primer extension product is subjected to
electrophoresis, and then an electrophoretic fraction obtained is
tested for hybridization with a labeled probe prepared by labeling
an oligonucleotide which comprises a part or the entire sequence of
the nucleotide sequence depicted in SEQ ID NO: 53 with a labeling
substance, and the one which is confirmed the presence of a
fraction hybridized with aforementioned labeled probe by detecting
the signal derived from the aforementioned labeled probe is
determined to be positive. (2) A method in which, after performing
PCR using an oligonucleotide comprising the nucleotide sequence
depicted in SEQ ID NO: 7 as a forward primer and an oligonucleotide
comprising the nucleotide sequence depicted in SEQ ID NO: 10 as a
reverse primer, the obtained primer extension product is subjected
to electrophoresis, and then hybridization with a labeled probe
prepared by labeling an oligonucleotide which comprises a part or
the entire sequence of the nucleotide sequence depicted in SEQ ID
NO: 54 with a labeling substance is examined, and the one which is
confirmed the presence of a fraction hybridized with aforementioned
labeled probe by detecting the signal derived from the
aforementioned labeled probe is determined to be positive. (3) A
method in which, after performing PCR using an oligonucleotide
comprising the nucleotide sequence depicted in SEQ ID NO: 8 as a
forward primer and an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 11 as a reverse primer, the
obtained primer extension product is subjected to electrophoresis,
and then hybridization with a labeled probe prepared by labeling an
oligonucleotide which comprises a part or the entire sequence of
the nucleotide sequence depicted in SEQ ID NO: 55 with a labeling
substance is examined, and the one which is confirmed the presence
of a fraction hybridized with aforementioned labeled probe by
detecting the signal derived from the aforementioned labeled probe
is determined to be positive. (4) A method in which, after
performing PCR using an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 9 as a forward primer and an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 12 as a reverse primer, the obtained primer extension
product is subjected to electrophoresis, and then hybridization
with a labeled probe prepared by labeling an oligonucleotide which
comprises a part or the entire sequence of the nucleotide sequence
depicted in SEQ ID NO: 56 with a labeling substance is examined,
and the one which is confirmed the presence of a fraction
hybridized with aforementioned labeled probe by detecting the
signal derived from the aforementioned labeled probe is determined
to be positive. (5) A method in which, after performing PCR using
an oligonucleotide comprising the nucleotide sequence depicted in
SEQ ID NO: 13 as a forward primer and an oligonucleotide comprising
the nucleotide sequence depicted in SEQ ID NO: 14 as a reverse
primer, the obtained primer extension product is subjected to
electrophoresis, and then hybridization with a labeled probe
prepared by labeling an oligonucleotide which comprises a part or
the entire sequence of the nucleotide sequence depicted in SEQ ID
NO: 57 with a labeling substance is examined, and the one which is
confirmed the presence of a fraction hybridized with aforementioned
labeled probe by detecting the signal derived from the
aforementioned labeled probe is determined to be positive. (6) A
method in which, after performing PCR using an oligonucleotide
comprising the nucleotide sequence depicted in SEQ ID NO: 15 as a
forward primer and an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 16 as a reverse primer, the
obtained primer extension product is subjected to electrophoresis,
and then hybridization with a labeled probe prepared by labeling an
oligonucleotide which comprises a part or the entire sequence of
the nucleotide sequence depicted in SEQ ID NO: 58 with a labeling
substance is examined, and the one which is confirmed the presence
of a fraction hybridized with aforementioned labeled probe by
detecting the signal derived from the aforementioned labeled probe
is determined to be positive. (7) A method in which, after
performing PCR using an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 13 as a forward primer and an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 16 as a reverse primer, the obtained primer extension
product is subjected to electrophoresis, and then hybridization
with a labeled probe prepared by labeling an oligonucleotide which
comprises a part or the entire sequence of the nucleotide sequence
depicted in SEQ ID NO: 59 with a labeling substance is examined,
and the one which is confirmed the presence of a fraction
hybridized with aforementioned labeled probe by detecting the
signal derived from the aforementioned labeled probe is determined
to be positive. (8) A method in which, after performing PCR using
an oligonucleotide comprising the nucleotide sequence depicted in
SEQ ID NO: 17 as a forward primer and an oligonucleotide comprising
the nucleotide sequence depicted in SEQ ID NO: 22 as a reverse
primer, the obtained primer extension product is subjected to
electrophoresis, and then hybridization with a labeled probe
prepared by labeling an oligonucleotide which comprises a part or
the entire sequence of the nucleotide sequence depicted in SEQ ID
NO: 60 with a labeling substance is examined, and the one which is
confirmed the presence of a fraction hybridized with aforementioned
labeled probe by detecting the signal derived from the
aforementioned labeled probe is determined to be positive. (9) A
method in which, after performing PCR using an oligonucleotide
comprising the nucleotide sequence depicted in SEQ ID NO: 18 as a
forward primer and an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 23 as a reverse primer, the
obtained primer extension product is subjected to electrophoresis,
and then hybridization with a labeled probe prepared by labeling an
oligonucleotide which comprises a part or the entire sequence of
the nucleotide sequence depicted in SEQ ID NO: 61 with a labeling
substance is examined, and the one which is confirmed the presence
of a fraction hybridized with aforementioned labeled probe by
detecting the signal derived from the aforementioned labeled probe
is determined to be positive. (10) A method in which, after
performing PCR using an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 19 as a forward primer and an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 24 as a reverse primer, the obtained primer extension
product is subjected to electrophoresis, and then hybridization
with a labeled probe prepared by labeling an oligonucleotide which
comprises a part or the entire sequence of the nucleotide sequence
depicted in SEQ ID NO: 62 with a labeling substance is examined,
and the one which is confirmed the presence of a fraction
hybridized with aforementioned labeled probe by detecting the
signal derived from the aforementioned labeled probe is determined
to be positive. (11) A method in which, after performing PCR using
an oligonucleotide comprising the nucleotide sequence depicted in
SEQ ID NO: 20 as a forward primer and an oligonucleotide comprising
the nucleotide sequence depicted in SEQ ID NO: 25 as a reverse
primer, the obtained primer extension product is subjected to
electrophoresis, and then hybridization with a labeled probe
prepared by labeling an oligonucleotide which comprises a part or
the entire sequence of the nucleotide sequence depicted in SEQ ID
NO: 63 with a labeling substance is examined, and the one which is
confirmed the presence of a fraction hybridized with aforementioned
labeled probe by detecting the signal derived from the
aforementioned labeled probe is determined to be positive. (12) A
method in which, after performing PCR using an oligonucleotide
comprising the nucleotide sequence depicted in SEQ ID NO: 21 as a
forward primer and an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 26 as a reverse primer, the
obtained primer extension product is subjected to electrophoresis,
and then hybridization with a labeled probe prepared by labeling an
oligonucleotide which comprises a part or the entire sequence of
the nucleotide sequence depicted in SEQ ID NO: 64 with a labeling
substance is examined, and the one which is confirmed the presence
of a fraction hybridized with aforementioned labeled probe by
detecting the signal derived from the aforementioned labeled probe
is determined to be positive. (13) A method in which, after
performing PCR using an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 27 as a forward primer and an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 28 as a reverse primer, the obtained primer extension
product is subjected to electrophoresis, and then hybridization
with a labeled probe prepared by labeling an oligonucleotide which
comprises a part or the entire sequence of the nucleotide sequence
depicted in SEQ ID NO: 65 with a labeling substance is examined,
and the one which is confirmed the presence of a fraction
hybridized with aforementioned labeled probe by detecting the
signal derived from the aforementioned labeled probe is determined
to be positive. (14) A method in which, after performing PCR using
an oligonucleotide comprising the nucleotide sequence depicted in
SEQ ID NO: 29 as a forward primer and an oligonucleotide comprising
the nucleotide sequence depicted in SEQ ID NO: 30 as a reverse
primer, the obtained primer extension product is subjected to
electrophoresis, and then hybridization with a labeled probe
prepared by labeling an oligonucleotide which comprises a part or
the entire sequence of the nucleotide sequence depicted in SEQ ID
NO: 66 with a labeling substance is examined, and the one which is
confirmed the presence of a fraction hybridized with aforementioned
labeled probe by detecting the signal derived from the
aforementioned labeled probe is determined to be positive. (15) A
method in which, after performing PCR using an oligonucleotide
comprising the nucleotide sequence depicted in SEQ ID NO: 27 as a
forward primer and an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 30 as a reverse primer, the
obtained primer extension product is subjected to electrophoresis,
and then hybridization with a labeled probe prepared by labeling an
oligonucleotide which comprises a part or the entire sequence of
the nucleotide sequence depicted in SEQ ID NO: 67 with a labeling
substance is examined, and the one which is confirmed the presence
of a fraction hybridized with aforementioned labeled probe by
detecting the signal derived from the aforementioned labeled probe
is determined to be positive. (16) A method in which, after
performing PCR using an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 31 as a forward primer and an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 36 as a reverse primer, the obtained primer extension
product is subjected to electrophoresis, and then hybridization
with a labeled probe prepared by labeling an oligonucleotide which
comprises a part or the entire sequence of the nucleotide sequence
depicted in SEQ ID NO: 68 with a labeling substance is examined,
and the one which is confirmed the presence of a fraction
hybridized with aforementioned labeled probe by detecting the
signal derived from the aforementioned labeled probe is determined
to be positive. (17) A method in which, after performing PCR using
an oligonucleotide comprising the nucleotide sequence depicted in
SEQ ID NO: 32 as a forward primer and an oligonucleotide comprising
the nucleotide sequence depicted in SEQ ID NO: 37 as a reverse
primer, the obtained primer extension product is subjected to
electrophoresis, and then hybridization with a labeled probe
prepared by labeling an oligonucleotide which comprises a part or
the entire sequence of the nucleotide sequence depicted in SEQ ID
NO: 69 with a labeling substance is examined, and the one which is
confirmed the presence of a fraction hybridized with aforementioned
labeled probe by detecting the signal derived from the
aforementioned labeled probe is determined to be positive. (18) A
method in which, after performing PCR using an oligonucleotide
comprising the nucleotide sequence depicted in SEQ ID NO: 33 as a
forward primer and an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 38 as a reverse primer, the
obtained primer extension product is subjected to electrophoresis,
and then hybridization with a labeled probe prepared by labeling an
oligonucleotide which comprises a part or the entire sequence of
the nucleotide sequence depicted in SEQ ID NO: 70 with a labeling
substance is examined, and the one which is confirmed the presence
of a fraction hybridized with aforementioned labeled probe by
detecting the signal derived from the aforementioned labeled probe
is determined to be positive. (19) A method in which, after
performing PCR using an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 34 as a forward primer and an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 39 as a reverse primer, the obtained primer extension
product is subjected to electrophoresis, and then hybridization
with a labeled probe prepared by labeling an oligonucleotide which
comprises a part or the entire sequence of the nucleotide sequence
depicted in SEQ ID NO: 71 with a labeling substance is examined,
and the one which is confirmed the presence of a fraction
hybridized with aforementioned labeled probe by detecting the
signal derived from the aforementioned labeled probe is determined
to be positive. (20) A method in which, after performing PCR using
an oligonucleotide comprising the nucleotide sequence depicted in
SEQ ID NO: 35 as a forward primer and an oligonucleotide comprising
the nucleotide sequence depicted in SEQ ID NO: 40 as a reverse
primer, the obtained primer extension product is subjected to
electrophoresis, and then hybridization with a labeled probe
prepared by labeling an oligonucleotide which comprises a part or
the entire sequence of the nucleotide sequence depicted in SEQ ID
NO: 72 with a labeling substance is examined, and the one which is
confirmed the presence of a fraction hybridized with aforementioned
labeled probe by detecting the signal derived from the
aforementioned labeled probe is determined to be positive. (21) A
method in which, after performing PCR using an oligonucleotide
comprising the nucleotide sequence depicted in SEQ ID NO: 41 as a
forward primer and an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 42 as a reverse primer, the
obtained primer extension product is subjected to electrophoresis,
and then hybridization with a labeled probe prepared by labeling an
oligonucleotide which comprises a part or the entire sequence of
the nucleotide sequence depicted in SEQ ID NO: 73 with a labeling
substance is examined, and the one which is confirmed the presence
of a fraction hybridized with aforementioned labeled probe by
detecting the signal derived from the aforementioned labeled probe
is determined to be positive. (22) A method in which, after
performing PCR using an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 43 as a forward primer and an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 44 as a reverse primer, the obtained primer extension
product is subjected to electrophoresis, and then hybridization
with a labeled probe prepared by labeling an oligonucleotide which
comprises a part or the entire sequence of the nucleotide sequence
depicted in SEQ ID NO: 74 with a labeling substance is examined,
and the one which is confirmed the presence of a fraction
hybridized with aforementioned labeled probe by detecting the
signal derived from the aforementioned labeled probe is determined
to be positive. (23) A method in which, after performing PCR using
an oligonucleotide comprising the nucleotide sequence depicted in
SEQ ID NO: 41 as a forward primer and an oligonucleotide comprising
the nucleotide sequence depicted in SEQ ID NO: 44 as a reverse
primer, the obtained primer extension product is subjected to
electrophoresis, and then hybridization with a labeled probe
prepared by labeling an oligonucleotide which comprises a part or
the entire sequence of the nucleotide sequence depicted in SEQ ID
NO: 75 with a labeling substance is examined, and the one which is
confirmed the presence of a fraction
hybridized with aforementioned labeled probe by detecting the
signal derived from the aforementioned labeled probe is determined
to be positive. (24) A method in which, after performing PCR using
an oligonucleotide comprising the nucleotide sequence depicted in
SEQ ID NO: 45 as a forward primer and an oligonucleotide comprising
the nucleotide sequence depicted in SEQ ID NO: 49 as a reverse
primer, the obtained primer extension product is subjected to
electrophoresis, and then hybridization with a labeled probe
prepared by labeling an oligonucleotide which comprises a part or
the entire sequence of the nucleotide sequence depicted in SEQ ID
NO: 76 with a labeling substance is examined, and the one which is
confirmed the presence of a fraction hybridized with aforementioned
labeled probe by detecting the signal derived from the
aforementioned labeled probe is determined to be positive. (25) A
method in which, after performing PCR using an oligonucleotide
comprising the nucleotide sequence depicted in SEQ ID NO: 46 as a
forward primer and an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 50 as a reverse primer, the
obtained primer extension product is subjected to electrophoresis,
and then hybridization with a labeled probe prepared by labeling an
oligonucleotide which comprises a part or the entire sequence of
the nucleotide sequence depicted in SEQ ID NO: 77 with a labeling
substance is examined, and the one which is confirmed the presence
of a fraction hybridized with aforementioned labeled probe by
detecting the signal derived from the aforementioned labeled probe
is determined to be positive. (26) A method in which, after
performing PCR using an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 47 as a forward primer and an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 51 as a reverse primer, the obtained primer extension
product is subjected to electrophoresis, and then hybridization
with a labeled probe prepared by labeling an oligonucleotide which
comprises a part or the entire sequence of the nucleotide sequence
depicted in SEQ ID NO: 78 with a labeling substance is examined,
and the one which is confirmed the presence of a fraction
hybridized with aforementioned labeled probe by detecting the
signal derived from the aforementioned labeled probe is determined
to be positive. (27) A method in which, after performing PCR using
an oligonucleotide comprising the nucleotide sequence depicted in
SEQ ID NO: 48 as a forward primer and an oligonucleotide comprising
the nucleotide sequence depicted in SEQ ID NO: 52 as a reverse
primer, the obtained primer extension product is subjected to
electrophoresis, and then hybridization with a labeled probe
prepared by labeling an oligonucleotide which comprises a part or
the entire sequence of the nucleotide sequence depicted in SEQ ID
NO: 79 with a labeling substance is examined, and the one which is
confirmed the presence of a fraction hybridized with aforementioned
labeled probe by detecting the signal derived from the
aforementioned labeled probe is determined to be positive.
[0151] Among those described above, the methods of (1), (5) to (7),
(13) to (15), (21) to (23) are preferable.
[0152] Taking, for example, a case that M. kansasii is detected by
the method (the method of above (1) of (A-1-1)) in which, after
performing PCR using an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 5 as a forward primer and an
oligonucleotide comprising the nucleotide sequence depicted in SEQ
ID NO: 6 as a reverse primer and followed by electrophoresis, the
primer extension product having objective number of base pair is
confirmed as an example, the detailed method for detecting M.
kansasii involved in the present invention is as follows:
[0153] Firstly, according to the above described method, the
purified DNA sample is prepared from a specimen to be tested for
the presence of M. kansasii. Separately, by the method described
above, an oligonucleotide comprising the nucleotide sequence
depicted in SEQ ID NO: 5 (hereinafter, represented as
1c_plate1_Fw1) and an oligonucleotide comprising the nucleotide
sequence depicted in SEQ ID NO: 6 (hereinafter, represented as
1c_plate1_Rv1) are synthesized from the nucleotide of in the
present invention by phosphoamidite method using a DNA
synthesizer.
[0154] A 10 mM Tris-HCl buffer (pH 8.9) containing 1c_plate1_Fw1
and 1c_plate1_Rv1, 1.0 to 4.0 mM MgCl.sub.2, 80 mM KCl, 500
.mu.g/ml BSA, 0.1% sodium cholate, 0.005 to 0.2% polyoxyethylene
octylphenyl ether, each 0.1 to 0.6 mM of dATP, dCTP, dGTP and dTTP,
and 10 to 80 unit/ml of Taq DNA polymerase is prepared and used as
a reaction solution for PCR.
[0155] The purified DNA is added to the reaction solution for PCR,
and using this solution as a sample for PCR, 20 to 40 cycles of the
PCR is carried out by the DNA Thermal Cycler. The reaction solution
after PCR is subjected to a 1.5% agarose gel electrophoresis. In
the next place, after staining the gel with ethidium bromide, the
fluorescent signal generated by UV ray is detected. Also, the
molecular weight marker is electrophoresed in the same time in
parallel with the reaction solution, and the length of the detected
DNA fragment is calculated by comparing the relative mobility. In
the PCR using the 1c_plate1_Fw1 as a forward primer and the
1c_plate1_Rv1 as a reverse primer, it is anticipated that the DNA
fragment with 167 base pair (SEQ ID NO: 53) in the nucleotide
sequence of M. kansasii will be replicated. Consequently, the one
which is confirmed the presence of fluorescent band of 167 base
pair can be determined to be positive.
(A-2) A Method by Real-Time PCR
[0156] In the method for detecting M. kansasii of the present
invention, the real-time amplification system (see, for example,
U.S. Pat. Nos. 5,210,015 and 5,538,848) can also be utilized.
[0157] An example of the detection system by the real-time
amplification system includes, for example, the real-time PCR
detection system.
[0158] Various real-time PCR detection methods, for example,
TaqMan.TM. real-time PCR method (see, for example, U.S. Pat. No.
5,538,848), MGB Eclipse Probe System method (see, for example, U.S.
Pat. No. 5,801,155), Molecular Beacons Probe Technology method
(see, for example, U.S. Pat. No. 5,925,517), LUX Fluorogenic Primer
method (Invitrogen Corporation), Quenching probe-PCR (QP) method
(see, for example, U.S. Pat. No. 6,492,121) and the like can be
utilized for the method for detecting M. kansasii of the present
invention.
[0159] More specifically, by the real-time PCR method using a probe
in which the 5'-terminal is labeled, for example, with a
fluorescent dye (reporter) such as FAM and the 3'-terminal is
labeled, for example, with a quencher dye such as TAMRA (see, for
example, U.S. Pat. No. 5,538,848), a minute quantity of target DNA
can be detected with high sensitivity and quantitatively.
[0160] That is, using an oligonucleotide which comprises a part or
the entire sequence of the nucleotide sequence depicted in SEQ ID
NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4, or a part or the
entire sequence of a nucleotide sequence complementary to the
nucleotide sequence, wherein the oligonucleotide is capable of
hybridizing with the nucleotide sequence of M. kansasii gene as a
primer (the primer of the present invention), and using a labeled
oligonucleotide which is labeled with a reporter fluorescent dye on
the 5'-terminal and with quencher dye on the 3'-terminal as a
labeled probe, and which comprises a part or the entire sequence of
the nucleotide sequence depicted in SEQ ID NO: 1, SEQ ID NO: 2, SEQ
ID NO: 3 or SEQ ID NO: 4, or a part or the entire sequence of a
nucleotide sequence complementary to the nucleotide sequence,
wherein the oligonucleotide is capable of hybridizing with the
nucleotide sequence of M. kansasii gene (the oligonucleotide of the
present invention), the PCR is carried out for the nucleic acid in
a sample as a template, and then the fluorescent signal released
from aforementioned labeled probe is detected.
[0161] The principle of the above described real-time PCR is as
follows.
[0162] That is, an oligonucleotide which is labeled with a
fluorescent dye (reporter) on the 5'-terminal and with a quencher
dye on the 3'-terminal, and is capable of hybridizing with a
particular region of the objective gene is utilized. The reporter
fluorescence of the aforementioned probe is suppressed by the
quencher dye in the ordinary condition. Under the state that the
fluorescent probe is hybridized completely with the objective gene,
the PCR is performed from outside of the hybrid using DNA
polymerase. In accordance with the progress of the extension
reaction by DNA polymerase, the 5'-terminal of the fluorescent
probe is hydrolyzed by its exonuclease activity to release the
fluorescent dye and generate fluorescence. In the real-time PCR
method, by monitoring this fluorescent signal in real time, the
initial quantity of template DNA can be quantified correctly.
[0163] The probe to be used for the labeled probe which is labeled
with a fluorescent dye (reporter) on the 5'-terminal and with a
quencher dye on the 3'-terminal and is used for the real-time PCR
detection system of the present invention can be the above
described probe of the present invention. Practically, a probe
having a nucleotide sequence of amplification product obtained from
the real-time PCR by the combination of forward primer and reverse
primer, or a probe having a nucleotide sequence designed further
from the above sequence can be used. For example, the probe to be
used when the real-time PCR is carried out using the primers of SEQ
ID NO: 5 and SEQ ID NO: 6 includes a nucleotide having an expected
amplified nucleotide sequence of SEQ ID NO: 53 by the real-time
PCR, or an oligonucleotide having a sequence designed from the
nucleotide sequence of SEQ ID NO: 53 (for example, SEQ ID NO:
80).
[0164] In addition, the reporter fluorescent substance to be used
for labeling the 5'-terminal includes FAM, HEX, TET, Cy5, VIC and
the like, however, among them, FAM is preferable. The quencher dye
to be used for labeling the 3'-terminal includes a fluorescent
substance such as TAMRA and a nonfluorescent substance such as BHQ
(e.g., BHQ2) and DABCYL, however, among them, TAMRA is
preferable.
[0165] The forward primer and the reverse primer to be used for the
real-time PCR detection system involved in the present invention
include the ones used in the above-described PCR, and the specific
examples of preferable primer and preferable combination are also
as described above.
[0166] The other deoxyribonucleoside triphosphate (dATP, dCTP,
dGTP, dTTP), the reagent such as DNA polymerase and the like to be
used for the real-time PCR detection system can be the same as used
in the usual real-time PCR, and the procedure of the real-time PCR,
except for using the primer and the probe of the present invention,
can be carried out according to the common protocol of the
real-time PCR.
[0167] An example of the method for detecting M. kansasii by the
real-time PCR detection system of the present invention is
explained as follows.
[0168] Firstly, according to the method described above, a purified
DNA sample is obtained from a specimen to be tested for M.
kansasii. Separately, the oligonucleotides having the nucleotide
sequence depicted in SEQ ID NO: 5 (1c_plate1_Fw1) and SEQ ID NO: 6
(1c_plate1_Rv1) are synthesized by the phosphoamidite method using
a DNA synthesizer.
[0169] In addition, from the nucleotide sequence depicted in SEQ ID
No: 53 to be amplified by the PCR using 1c_plate1_Fw1 and
1c_plate1_Rv1 as primers, a sequence to be used as a probe (e.g.,
SEQ ID No: 80) is designed, and an oligonucleotide of this sequence
is synthesized. The 5'-terminal of this oligonucleotide is labeled
with a reporter dye of FAM, and 3'-terminal is labeled with a
reporter quencher of TAMRA by the conventional procedures, and thus
a fluorescence labeled probe is obtained.
[0170] Using the above prepared 1c_plate1_Fw1 as a forward primer
and the 1c_plate1_Rv1 as a reverse primer, the real-time PCR is
carried out, for example, as follows.
[0171] That is, a 10 mM Tris-HCl buffer (pH 8.9) containing each 1
.mu.M of primer 1c_plate1_Fw1 and primer 1c_plate1_Rv1, 100 to 1000
nM fluorescence-labeled probe, 1.0 to 4.0 mM MgCl.sub.2, 80 mM KCl,
500 .mu.g/ml BSA, 0.1% sodium cholate, 0.005 to 0.2% TritonX-100,
each 0.2 mM of dATP, dCTP, dGTP and dTTP, and 10 to 80 unit/ml of
Taq DNA polymerase is prepared and used as a reaction solution. To
20 .mu.l of the reaction solution 1 ng of purified DNA sample is
added and used as a sample for PCR. This sample for PCR is placed
in each well of a 96-well reaction plate, and the real-time PCR is
carried out using appropriate real-time PCR detection equipment and
the like. The reaction is repeated 30 to 50 cycles, and at every
cycle, the fluorescent intensity of the reporter dye is
measured.
[0172] In the determination of M. kansasii, when the fluorescent
signal of the reporter dye is observed, the sample can be
determined to be M. kansasii positive.
[0173] In addition, in the real-time PCR method, as a standard
curve can be made up, the number of genomic DNA (copy number) of M.
kansasii in the sample can be determined. In addition, as this
number is proportional to the number of M. kansasii cell, the
number of M. kansasii cell in the sample can also be determined.
The preparation of the standard curve can be carried out according
to the conventional procedure commonly performed in the real-time
PCR method. For example, using M. kansasii genomic DNA sample of
known copy number as a standard, a dilution series of concentration
(copy number) of the DNA sample for PCR is prepared. In the next
place, using each of the dilution series of the DNA sample for PCR,
the real-time PCR is carried out according to the above described
method, and the fluorescent intensity of the reporter dye is
measured. For each of the dilution series of the DNA sample for
PCR, the measured value of the fluorescent intensity (Rn, y-axis)
is plotted for each cycle number of PCR (x-axis) to make up an
amplification curve. After that, an Rn part where the fluorescent
intensity amplifies exponentially is selected, and a threshold line
(Th) is drawn. The crossing point of the Th with an amplification
curve of each DNA sample for PCR is defined as threshold cycle
(Ct). After that, the Ct value (y-axis) is plotted for the
logarithmic value of the copy number of each used DNA sample for
PCR (x-axis), and an approximated curve obtained for each Ct can be
used as a standard curve.
[0174] For the quantitative determination of the number of the
genomic DNA (copy number) of M. kansasii in the sample, at first,
the DNA is isolated and purified from the specimen to be tested for
M. kansasii, and the real-time PCR of the obtained DNA sample is
carried out, and an amplification curve is made up by the same
manner. The Ct value at the point of crossing the Th drawn at the
time of preparing the standard curve by the obtained amplification
curve is obtained. By fitting the Ct value to the standard curve,
the quantity (copy number) of genomic DNA of M. kansasii in the
sample can be obtained.
[0175] In addition, the present invention can be applied in the
nucleic acid amplification step with a detection method using RNA
transcription product. For example, NASBA (nucleic acid sequence
based amplification) method (JP Patent No. 2650159), 3SR
(self-sustained sequence replication) method (JP-B-7-114718), TAS
(transcription based amplification system) method (JP-A-2-500565:
International publication no. WO 88/10315), TMA (transcription
mediated amplification) method (JP-A-11-46778) and the like are
included. Among them, the constant temperature nucleic acid
amplification methods utilizing a concerted mode of action of
reverse transcriptase and RNA polymerase (a reaction condition
which allows the reverse transcriptase and the RNA polymerase act
as concertedly) is suitable for the automation of the determination
system.
(A-3) A Method in which the Determination is Performed by Measuring
the Signal Derived from the Primer Extension Product Obtained by
the Polymerase Chain Reaction Using a Labeled Primer
[0176] In this method, such a method is included in which, using a
labeled primer prepared by labeling the primer of the present
invention according to the above described method, the PCR is
carried out for the nucleic acid in the sample as a template, and
then the signal derived from the obtained primer extension product
is measured, and when the signal derived form the primer is
detected in the obtained primer extension product, the sample is
determined to be M. kansasii positive. The forward primer and the
reverse primer to be used in this method include the ones used in
the above described PCR method, and the specific examples of
preferable primer and preferable combination are also as described
above.
[0177] In the case of the above-described method, after PCR is
carried out; free labeled primer is removed; the signal derived
from the primer extension product is measured; and when the signal
is detected, the sample can be determined to be M. kansasii
positive.
[0178] In the method of removing free labeled primer, such a method
is included in which after the primer extension product in the
reaction mixture obtained by the PCR is precipitated by the
conventional procedure of nucleic acid precipitation (ethanol
precipitation method, a precipitation method using isopropanol and
the like), the supernatant solution containing nonprecipitating
free labeled primer is removed and the like.
[0179] In addition, a method of separating the primer extension
product from free labeled primer in the reaction mixture obtained
by PCR by treating with gel chromatography under suitable
conditions or by electrophoresis under suitable conditions is also
included.
(B) A Method Using the Labeled Oligonucleotide of the Present
Invention as a Labeled Probe
[0180] Further, in the method for detecting M. kansasii of the
present invention, an oligonucleotide which comprises a part or the
entire sequence of the nucleotide sequence depicted in SEQ ID NO:
1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4, or a part or the
entire sequence of a nucleotide sequence complementary to the
nucleotide sequence, wherein the oligonucleotide is capable of
hybridizing with the nucleotide sequence of M. kansasii gene (the
oligonucleotide of the present invention) is labeled with a
labeling substance, and using this labeled oligonucleotide as a
labeled probe, the aforementioned labeled probe is allowed to
hybridize with the nucleic acid in the sample, and after removal of
the free labeled probe, the signal derived from the hybridized
complex is detected.
[0181] Specifically, the method includes, for example:
(B-1) a detection method in which using the oligonucleotide of the
present invention immobilized on the solid carrier as a trapping
probe, hybridization with nucleic acid in the sample is carried out
to immobilize the nucleic acid derived from M. kansasii on the
solid phase (see, for example, JP-A-62-265999); (B-2) a method of
so called "sandwich assay" in which using the trapping probe of
(B-1) and the labeled probe prepared by labeling the probe of the
present invention, hybridization with nucleic acid in the sample is
carried out to form a complex of the trapping probe and the nucleic
acid from M. kansasii and the labeled probe, then the signal
derived from the labeled probe is determined (see, for example,
JP-A-58-40099); and (B-3) a method in which using the
biotin-labeled probe of the present invention, hybridization with
nucleic acid in the sample is carried out, and then the nucleic
acid derived from M. kansasii in the sample is trapped by avidin
immobilized carrier, and the like.
[0182] It should be noted that as the reagent used for the method
for detecting M. kansasii of the present invention, the reagent
usually used in this field, for example, buffering agent,
stabilizer, preservatives and the like which neither inhibit the
stability of the coexisting reagent and the like nor inhibit PCR
and hybridization reaction can be used. In addition, the
concentration of the reagent can be selected as appropriate from
the range of concentration usually used in this field.
[0183] Specific example of buffer solution includes all the buffer
solutions usually used for performing PCR and hybridization
reaction in this field, for example, Tris buffer, phosphate buffer,
veronal buffer, borate buffer, good buffer and the like; and the pH
of the buffer solution is not particularly limited, but generally a
range between pH 5 to pH 9 is preferable.
[0184] In addition, if need arises, the nucleic acid synthetase
(DNA polymerase, RNA polymerase, reverse transcriptase and the
like), the substrate corresponding to the enzyme (dNTP, rNTP and
the like), and additionally, the double strand intercalator
(ethidium bromide, SYBR.TM. Green and the like), and alternatively,
the signal detection substance such as FAM and TAMRA can be
used.
[0185] A kit for detecting M. kansasii involved in the present
invention includes "a kit for detecting M. kansasii comprising an
oligonucleotide comprising a part or the entire sequence of the
nucleotide sequence depicted in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID
NO: 3 or SEQ ID NO: 4, or a part or the entire sequence of a
nucleotide sequence complementary to the nucleotide sequence,
wherein the oligonucleotide is capable of hybridizing with the
nucleotide sequence of M. kansasii gene as a primer (the primer of
the present invention) and/or a probe (the probe of the present
invention)". The primer can be the one which is labeled with a
labeling substance. The specific example of the labeling substance
is as described above.
[0186] The kit comprising the primer of the present invention also
comprises a composition containing a pair of forward primer and
reverse primer. Preferable embodiments are as follows:
(1) A kit comprising a forward primer of an oligonucleotide which
comprises a part or the entire sequence of the nucleotide sequence
depicted in SEQ ID NO: 5, or a part or the entire sequence of a
nucleotide sequence complementary to the nucleotide sequence,
wherein the oligonucleotide is capable of hybridizing with the
nucleotide sequence of M. kansasii gene; and a reverse primer of an
oligonucleotide which comprises a part or the entire sequence of
the nucleotide sequence depicted in SEQ ID NO: 6 or a part or the
entire sequence of a nucleotide sequence complementary to the
nucleotide sequence and is capable of hybridizing with the
nucleotide sequence of M. kansasii gene as the constituent reagent.
(2) A kit comprising a forward primer of an oligonucleotide which
comprises a part or the entire sequence of the nucleotide sequence
depicted in SEQ ID NO: 13, or a part or the entire sequence of a
nucleotide sequence complementary to the nucleotide sequence,
wherein the oligonucleotide is capable of hybridizing with the
nucleotide sequence of M. kansasii gene; and a reverse primer of an
oligonucleotide which comprises a part or the entire sequence of
the nucleotide sequence depicted in SEQ ID NO: 14, or a part or the
entire sequence of a nucleotide sequence complementary to the
nucleotide sequence and is capable of hybridizing with the
nucleotide sequence of M. kansasii gene as the constituent reagent.
(3) A kit comprising a forward primer of an oligonucleotide which
comprises a part or the entire sequence of the nucleotide sequence
depicted in SEQ ID NO: 15, or a part or the entire sequence of a
nucleotide sequence complementary to the nucleotide sequence,
wherein the oligonucleotide is capable of hybridizing with the
nucleotide sequence of M. kansasii gene; and a reverse primer of an
oligonucleotide which comprises a part or the entire sequence of
the nucleotide sequence depicted in SEQ ID NO: 16, or a part or the
entire sequence of a nucleotide sequence complementary to the
nucleotide sequence and is capable of hybridizing with the
nucleotide sequence of M. kansasii gene as the constituent reagent.
(4) A kit comprising a forward primer of an oligonucleotide which
comprises a part or the entire sequence of the nucleotide sequence
depicted in SEQ ID NO: 13, or a part or the entire sequence of a
nucleotide sequence complementary to the nucleotide sequence,
wherein the oligonucleotide is capable of hybridizing with the
nucleotide sequence of M. kansasii gene; and a reverse primer of an
oligonucleotide which comprises a part or the entire sequence of
the nucleotide sequence depicted in SEQ ID NO: 16, or a part or the
entire sequence of a nucleotide sequence complementary to the
nucleotide sequence and is capable of hybridizing with the
nucleotide sequence of M. kansasii gene as the constituent reagent.
(5) A kit comprising a forward primer of an oligonucleotide which
comprises a part or the entire sequence of the nucleotide sequence
depicted in SEQ ID NO: 27, or a part or the entire sequence of a
nucleotide sequence complementary to the nucleotide sequence,
wherein the oligonucleotide is capable of hybridizing with the
nucleotide sequence of M. kansasii gene; and a reverse primer of an
oligonucleotide which comprises a part or the entire sequence of
the nucleotide sequence depicted in SEQ ID NO: 28, or a part or the
entire sequence of a nucleotide sequence complementary to the
nucleotide sequence and is capable of hybridizing with the
nucleotide sequence of M. kansasii gene as the constituent reagent.
(6) A kit comprising a forward primer of an oligonucleotide which
comprises a part or the entire sequence of the nucleotide sequence
depicted in SEQ ID NO: 29, or a part or the entire sequence of a
nucleotide sequence complementary to the nucleotide sequence,
wherein the oligonucleotide is capable of hybridizing with the
nucleotide sequence of M. kansasii gene; and a reverse primer of an
oligonucleotide which comprises a part or the entire sequence of
the nucleotide sequence depicted in SEQ ID NO: 30, or a part or the
entire sequence of a nucleotide sequence complementary to the
nucleotide sequence and is capable of hybridizing with the
nucleotide sequence of M. kansasii gene as the constituent reagent.
(7) A kit comprising a forward primer of an oligonucleotide which
comprises a part or the entire sequence of the nucleotide sequence
depicted in SEQ ID NO: 27, or a part or the entire sequence of a
nucleotide sequence complementary to the nucleotide sequence,
wherein the oligonucleotide is capable of hybridizing with the
nucleotide sequence of M. kansasii gene; and a reverse primer of an
oligonucleotide which comprises a part or the entire sequence of
the nucleotide sequence depicted in SEQ ID NO: 30, or a part or the
entire sequence of a nucleotide sequence complementary to the
nucleotide sequence and is capable of hybridizing with the
nucleotide sequence of M. kansasii gene as the constituent reagent.
(8) A kit comprising a forward primer of an oligonucleotide which
comprises a part or the entire sequence of the nucleotide sequence
depicted in SEQ ID NO: 41, or a part or the entire sequence of a
nucleotide sequence complementary to the nucleotide sequence,
wherein the oligonucleotide is capable of hybridizing with the
nucleotide sequence of M. kansasii gene; and a reverse primer of an
oligonucleotide which comprises a part or the entire sequence of
the nucleotide sequence depicted in SEQ ID NO: 42, or a part or the
entire sequence of a nucleotide sequence complementary to the
nucleotide sequence and is capable of hybridizing with the
nucleotide sequence of M. kansasii gene as the constituent reagent.
(9) A kit comprising a forward primer of an oligonucleotide which
comprises a part or the entire sequence of the nucleotide sequence
depicted in SEQ ID NO: 43, or a part or the entire sequence of a
nucleotide sequence complementary to the nucleotide sequence,
wherein the oligonucleotide is capable of hybridizing with the
nucleotide sequence of M. kansasii gene; and a reverse primer of an
oligonucleotide which comprises a part or the entire sequence of
the nucleotide sequence depicted in SEQ ID NO: 44, or a part or the
entire sequence of a nucleotide sequence complementary to the
nucleotide sequence and is capable of hybridizing with the
nucleotide sequence of M. kansasii gene as the constituent reagent.
(10) A kit comprising a forward primer of an oligonucleotide which
comprises a part or the entire sequence of the nucleotide sequence
depicted in SEQ ID NO: 41, or a part or the entire sequence of a
nucleotide sequence complementary to the nucleotide sequence,
wherein the oligonucleotide is capable of hybridizing with the
nucleotide sequence of M. kansasii gene; and a reverse primer of an
oligonucleotide which comprises a part or the entire sequence of
the nucleotide sequence depicted in SEQ ID NO: 44, or a part or the
entire sequence of a nucleotide sequence complementary to the
nucleotide sequence and is capable of hybridizing with the
nucleotide sequence of M. kansasii gene as the constituent
reagent.
[0187] In the above-described kit, further, the oligonucleotide of
the present invention labeled with a labeling substance can be
contained as a labeled probe.
[0188] Furthermore, "a kit for detecting M. kansasii comprising the
oligonucleotide of the present invention as a probe" is included.
The aforementioned probe can be the one labeled with a labeling
substance.
[0189] The preferable embodiments and the specific examples of the
constituent reagent composing these kits are as described
above.
[0190] It should be noted that the kit for detecting M. kansasii of
the present invention can comprise, for example, buffering agent,
stabilizer, preservatives and the like which neither inhibit the
stability of the coexisting reagent and the like nor inhibit the
PCR and the hybridization reaction. In addition, the concentrations
of the reagents can be selected as appropriate from the range of
concentration usually used in this field.
[0191] The specific example of buffer solution includes all the
buffer solutions usually used for performing the PCR and the
hybridization reaction in this field, for example, Tris buffer,
phosphate buffer, veronal buffer, borate buffer, good buffer and
the like, and the pH is not particularly limited, but generally a
range between pH 5 to pH 9 is preferable.
[0192] In addition, if need arises, the nucleic acid synthetase
(DNA polymerase, RNA polymerase, reverse transcriptase and the
like), the substrate corresponding to the enzyme (dNTP, rNTP and
the like), and additionally, the double strand intercalator
(ethidium bromide, SYBR.TM. Green and the like), and alternatively,
the signal detection substance such as FAM and TAMRA can be
included.
[0193] Hereinafter, the present invention will be further explained
in detail by referring to the following Examples, but the scope of
the present invention should not be limited thereto.
[0194] It should be noted that all bacteria used in Examples are
clinical isolates, and their bacterial strain has already been
differentiated by the colony morphology and the conventional
various biochemical tests on the cultured bacterium.
EXAMPLES
Experimental Example 1
Selection of Clone Derived from M. Kansasii Genome
(1) Preparation of DNA Sample
[0195] Firstly, colonies of M. kansasii (Mycobacterium kansasii)
cultured on the Ogawa's medium are collected and suspended in
purified water and autoclaved (at 120.degree. C. under 2
atmospheres for 20 minutes), and by way of disruption treatment
(physical disruption using 2 mm diameter of glass beads) followed
by centrifugation, the supernatant solution was obtained. From the
supernatant solution obtained, extraction and purification of DNA
was carried out using an ion-exchange resin type DNA extraction and
purification kit, Genomic-tip (manufactured by QIAGEN GmbH), and
obtained genomic DNA derived from M. kansasii.
[0196] The purified DNA obtained was adjusted to give final
concentration of 400 ng/.mu.l (in 10 mM Tris-HCl buffer, pH 8.9),
and used as a DNA sample.
[0197] Separately, using a specific sequence of KATS2 for M.
kansasii as described in JP-A-11-155589 and a specific sequence of
M. tuberculosis (Mycobacterium tuberculosis: human type
tuberculosis bacterium) designated as SEQ ID NO: 8 in the
description of JP-A-2004-129272 (in the present description, shown
as SEQ ID NO: 81) as positive control, and using purified DNA
derived from E. coli prepared according to the conventional
procedure of extraction and purification of E. coli DNA as a
negative control, DNA samples were prepared in the same manner as
described above, and used similarly for the following
treatment.
(2) Preparation of Whole Genome Shotgun Library
[0198] Using a 24 .mu.g of the DNA sample obtained in (1) above as
a material, the Whole Genome Shotgun library was made up by the
following method (a modified Whole Genome Shotgun method, modified
from the method described in Venter et al., Science 2001 Feb. 16;
291 (5507): 1304-1351).
[0199] The DNA sample was treated using a nebulizer (manufactured
by Invitrogen) in the presence of 20% final concentration of
glycerol under the pressure of 5 kPa to 9 kPa for about 10 minutes
to fractionate the DNA, and the fraction with objective size of 500
to 1,000 bp was recovered efficiently. The fraction obtained was
purified using an extraction column (manufactured by QIAGEN
GmbH).
[0200] In the next place, using the DNA Blunting Kit manufactured
by Takara Bio Inc. and through the use of 5' .fwdarw.3' polymerase
activity and 3' .fwdarw.5' exonuclease activity of T4 DNA
Polymerase, the terminal of obtained DNA was blunted. This
blunt-ended DNA was subjected to ligation reaction with the
blunt-ended pBSII sk+ vector (Stratagene), and a recombinant DNA of
the pBSII sk+ vector (amp.sup.r) incorporated with the DNA fragment
was prepared.
[0201] Transformation of E. coli JM109 Competent Cells (Takara Bio
Inc.) was carried out using the recombinant DNA obtained above
according to a protocol of the product. The transformant obtained
above was cultured in a plate on LB-agarose medium containing 100
.mu.g/ml ampicillin, 0.2 mM IPTG and 40 .mu.g/ml X-Gal, and white
colonies were picked up, and thus a library of transformant (Whole
Genome Shotgun clone of M. kansasii genome) which has been
introduced with the recombinant DNA incorporated with the objective
DNA fragment was obtained.
(3) Preparation of Microarray
[0202] Using the Whole Genome Shotgun clone of M. kansasii genome
obtained in (2) above, the PCR was carried out by the following
method, and the probe material for fixing on a slide glass was
prepared.
[0203] A 10 mM Tris-HCl buffer solution (pH 8.9) containing 1 .mu.M
each of M13 Primer M1 (Takara Bio Inc.) and M13 Primer RV (Takara
Bio Inc.), 1.5 mM MgCl.sub.2, 80 mM KCl, 500 .mu.g/ml BSA, 0.1%
sodium cholate, 0.1% Triton X-100 (product name of polyoxyethylene
octylphenyl ether, Rohm and Haas Co.), 0.2 mM each of dATP, dCTP,
dGTP and dTTP, and 40 unit/ml of Taq DNA polymerase (Nippon Gene
Co.) was prepared and used as a reaction solution for PCR.
[0204] The DNA was purified from the Whole Genome Shotgun clone of
M. kansasii genome obtained in (1) above according to the
conventional procedure, and added to suspend in 20 .mu.l of the
reaction solution for PCR; and using this suspension as a sample
for PCR (act as a template), 30 cycles of PCR was carried out under
the following conditions using the DNA Thermal Cycler (DNA Engine
PTC200; MJ Research Inc.).
[0205] The reaction conditions of the PCR:
Heat denaturation: 94.degree. C. for 0.5 minutes; Annealing:
55.degree. C. for 1 minute; Polymerization reaction: 75.degree. C.
for 0.5 minutes.
[0206] The obtained PCR product was purified, and then mixed with
an immobilization buffer (final concentration: 3.times.SSC).
[0207] Using a typing instrument (GTMAS Stamp II; Nippon Laser
& Electronics); the final concentration of the PCR product to
be spotted was adjusted to give 300 ng/.mu.l; the humidity in the
instrument was set to 55%; the PCR product obtained was spotted
(the spot diameter: 150 to 250 .mu.m) on a slide glass (CMT
GAPS-II; Corning Inc.). The spot-completed slide glass was
transferred to a UV cross linker (UV Stratalinker 1800; Stratagene
Co.), and was irradiated with 150 mJ/cm.sup.2 of UV light to fix
the PCR product (the objective DNA) on the slide glass, and thus
the microarray was prepared.
(4) Fluorescent Labeling of the Target Genomic DNA and Microarray
Hybridization
i) Fluorescent Labeling of the Target Genomic DNA
[0208] Firstly, using BioPrime DNA labeling system (Invitrogen
Co.), 2 .mu.g of each genomic DNA derived from M. kansasii
(ATCC12478) and a comparative genomic DNA (bovine type tuberculosis
bacterium, ATCC19274) were each mixed with 20 .mu.l of random
primer solution contained in the product, and heat denaturation
treatment was carried out (95.degree. C. for 5 minutes).
[0209] After that, to each heat treated mixture, 2 .mu.l of 0.1 M
DTT, 2 .mu.l of the mixed solution of dATP/dCTP/dGTP (each 5 mM),
0.8 .mu.l of 2.5 mM dTTP, 1.6 .mu.l of 5 mM Ha-dUTP and 1 .mu.l of
Klenow enzyme (40 U/.mu.l) were added and adjusted to give the
final volume 50 .mu.l with sterile deionized water, and then the
extension reaction was carried out at 37.degree. C. for 3 hours. An
ultrafiltration column Microcon YM-30 (Millipore Co.) was set to
the attached 1.5 ml tube, and then the above-described reaction
product was placed on the column and centrifuged at 14,000 rpm for
4 minutes. The concentrated solution was recovered in a microtube
and dried thoroughly using a centrifugal vacuum drier (CentriVap
concentrator; Labconco Co.).
[0210] The dried reaction product obtained was added with 10 .mu.l
of 50 mM NaHCO.sub.3 and mixed, then left at room temperature for 2
to 3 minutes.
[0211] Separately, 1 mg of each Cy3 (Amersham Biosciences) and Cy5
(Amersham Biosciences) was dissolved separately in 105 .mu.l of
DMSO. A 10 .mu.l of the Cy-dye Solution Cy3 was added to the above
reaction product obtained using comparative genome (bovine type
tuberculosis bacterium) and 10 .mu.l of the Cy-dye Solution Cy5 was
added to the above reaction product obtained using M. kansasii
genome, and each reaction mixture was incubated (under light
shielding) at 40.degree. C. for 60 minutes.
[0212] Further, each above reaction product was added with 10 .mu.l
of 4 M NH.sub.2OH (prepared just before use) and mixed, and is
incubated (under light shielding) for 15 minutes to obtain the
respective labeled product, namely, Cy3 labeled comparative genomic
DNA (bovine type tuberculosis bacterium) and Cy5 labeled M.
kansasii genomic DNA were obtained.
[0213] An ultrafiltration column Microcon YM-30 (Millipore Co.) was
set to the attached 1.5 ml tube, and then the above obtained
labeled product of genomic DNA was placed on the column and
centrifuged at 14,000 rpm for 4 minutes. The concentrated solution
was recovered in a microtube and dried thoroughly using a
centrifugal vacuum drier (CentriVap concentrator; Labconco
Co.).
ii) Fragmentation Process of Labeled Product
[0214] To the labeled product of genomic DNA in dry state obtained
in i) of (4) above, a 40 .mu.l of a solution with a composition of
final concentrations of 0.04 M Tris-acetate (pH 8.1), 0.1 M
potassium acetate, and 0.03 M magnesium acetate tetrahydrate was
added and mixed in suspension. The suspension is heat-treated at
94.degree. C. for 15 minutes, and the fragmentation product of each
labeled genomic DNA with 100 to 300 bases was obtained.
[0215] The labeling efficiency (base/dye) was checked using BcaBEST
DNA Polymerase (Takara Bio Inc.) and rBst DNA Polymerase (EPICENTRE
Biotechnologies), and confirmed that one molecule of dye was
incorporated into about 20 bases of the comparative (bovine type
tuberculosis bacterium) genomic DNA, and one molecule of dye was
incorporated into about 10 bases of the M. kansasii genomic
DNA.
[0216] Each solution of Cy3-labeled product and Cy5-labeled product
was placed separately onto an ultrafiltration column Microcon YM-30
(Millipore Co.) and centrifuged at 14,000 rpm for 4 minutes, and
each concentrated solution is recovered in a microtube, and then
dried thoroughly using a centrifugal vacuum drier (CentriVap
concentrator; Labconco Co.). In the next place, to a microtube, the
following reagents (in the case when the slide glass for the
microarray to be used later is 24.times.55 mm) were added, and the
above obtained Cy3-labeled product and Cy5-labeled product were
mixed in suspension in the same solution.
[0217] ArrayHyb Hybridization buffer (SIGMA); 40 .mu.l
[0218] salmon sperm DNA (10 mg/ml); 0.5 .mu.l
[0219] formamide; 5 .mu.l
[0220] Total 40 to 50 .mu.l
[0221] After mixing in suspension, the mixture was incubated at
95.degree. C. for 5 minutes, and kept at 70.degree. C. until use
for hybridization.
iii) Microarray Hybridization
[0222] On a microarray (DNA chip) prepared in the above-described
(3), the whole solution of mixture of Cy3-labeled product and
Cy5-labeled product obtained in the above-described ii) of (4) was
placed, and covered with a cover glass keeping no air bubble
remained inside. The microarray was set on a Hybri-cassette; placed
in a Tupperware matted with a Kim Towel (Nippon Paper Crecia Co.,
Ltd.) wetted with distilled water and closed tightly; and reacted
(under light shielding) at 65.degree. C. for 8 hours or more to
allow hybridization. After hybridization, the microarray was soaked
in a 2.times.SSC-0.1% SDS solution together with cover glass at
room temperature, and shook gently in the solution to remove the
cover glass. After sequential washing with 1.times.SSC and 0.03%
SDS solution (60.degree. C.) for 10 minutes, 0.2.times.SSC solution
(42.degree. C.) for 10 minutes and 0.05.times.SSC solution (room
temperature) for 10 minutes, the microarray was transferred quickly
to a new dry rack, and dried immediately by centrifugation at 800
rpm for 5 minutes.
(5) Measurement of Fluorescent Intensity: from Signal Detection to
Quantification
[0223] Using a fluorescence readout scanner (Protein Array Scanner;
Nippon Laser & Electronics), the fluorescent intensity on the
microarray obtained in above iii) of (4) was measured, and obtained
fluorescence detection data on 2 channel fluorescent intensity of
Cy3 and Cy5. The quantification of fluorescent signal was performed
using the DNASIS.TM.-Array (DNA chip expression image analysis
software; Hitachi Software Engineering Co.), and according to the
operation procedure of the software, automatic spot recognition,
background calculation, and normalization of fluorescent intensity
ratio were carried out. In addition, by establishing a threshold
limit line of reliability, and avoiding the value lower than this
line, the reliable normalized fluorescent intensity ratio was
obtained.
[0224] It should be noted that the positive control (the specific
DNA fragment for M. tuberculosis and the fragment of KATS2 sequence
of M. kansasii) and the negative control (the DNA fragment derived
from E. coli) had been spotted on the microarray.
[0225] In addition, for the purpose of screening a candidate
sequence of use in detecting M. kansasii specifically, based on the
Cy3/Cy5 fluorescent intensity ratio (Ratio) detected on the DNA
chip, the scatter plot analysis was carried out. The results are
shown in FIG. 5.
[0226] By way of comparison, the KATS2 sequence of M. kansasii
described in JP-A-1999-155589 and the sequence depicted in SEQ ID
NO: 8 (SEQ ID NO: 81 in this specification) derived from M.
tuberculosis described in the description of JP-A-2004-129272 were
treated in the same way, and the fluorescent intensity of Cy3 and
Cy5 were determined The results are shown collectively in FIG.
5.
[0227] In FIG. 5, the entire scatter plot and the enlarged view of
a part where spots are concentrated (encircled by dotted line) are
shown. The scatter plot is shown on a double logarithmic chart, as
a plot of the fluorescent intensity of Cy5 on the vertical axis for
the fluorescent intensity of Cy3 on the horizontal axis. In FIG. 5,
the spots other than (2) and (3) show the results when the PCR
product on each microarray was used; the spot encircled as (2)
shows the results when the KAS sequence of M. kansasii described in
JP-A-11-155589 was used; and the spot encircled as (3) shows the
results when the nucleotide sequence depicted in SEQ ID NO: 8 (SEQ
ID NO: 81 in this specification) derived from M. tuberculosis
described in the description of JP Application No. 2004-129272 was
used.
[0228] In addition, each line on FIG. 5 has the following
meaning.
(a): The line indicating:
[0229] Cy5/Cy3 ratio of fluorescent intensity .gtoreq.10.
(b): The line indicating:
[0230] Cy5/Cy3 ratio of fluorescent intensity .gtoreq.5.0;
(c): The line indicating:
[0231] Cy5/Cy3 ratio of fluorescent intensity .gtoreq.2.0;
(a'): The line indicating:
[0232] Cy3/Cy5 ratio of fluorescent intensity .gtoreq.10.0;
(b'): The line indicating:
[0233] Cy3/Cy5 ratio of fluorescent intensity .gtoreq.5.0;
(c'): The line indicating:
[0234] Cy3/Cy5 ratio of fluorescent intensity .gtoreq.2.0.
[0235] That is, the spot locating at upper position than the line
(a) indicates that the fluorescent intensity of Cy5 is 10 times or
more greater compared with that of Cy3; the spot locating at upper
position than the line (b) indicates that the fluorescent intensity
of Cy5 is 5 to 10 times greater compared with that of Cy3; and the
spot locating at upper position than the line (c) indicates that
the fluorescent intensity of Cy5 is 2 to 5 times greater compared
with that of Cy3. In addition, the spot locating at lower position
than the line (a') indicates that the fluorescent intensity of Cy3
is 10 times or more great compared with that of Cy5; the spot
locating at lower position than the line (b') indicates that the
fluorescent intensity of Cy3 is 5 to 10 times greater compared with
that of Cy5; and the spot locating at lower position than the line
(c') indicates that the fluorescent intensity of Cy3 is 2 to 5
times greater compared with that of Cy5.
[0236] As is clear from FIG. 5, the spot (3) locating in between
the line (b') and the line (a') indicates that the fluorescent
intensity of Cy3 is 5 to 10 times greater compared with that of
Cy5, and this spot can be recognized as being hybridized with the
genomic DNA of bovine type M. tuberculosis. On the other hand, the
spot (2) locating in between the line (c) and the line (b)
indicates that the fluorescent intensity of Cy5 is 2 to 5 times
greater compared with that of Cy3, and this spot can be recognized
as being hybridized with the genomic DNA of M. kansasii.
[0237] It should be noted that in the case when the genomic DNA of
E. coli is used as a control, the fluorescent intensity ratio of
Cy5/Cy3 was around 1, and the spot on the scatter plot was locating
at a very low position, and therefore the spot is not shown in FIG.
5.
[0238] Here, in FIG. 5, among the screen-detected PCR product of
microarray, the 8 spots encircled as (1) (it seems that only 5
spots exist, but actually 8 spots exist because some spots are
overlapped) were detected greater fluorescent intensity of Cy5 than
(2), and from the fact described above the specificity of (1) for
M. kansasii was judged as higher than that of (2) (the KATS2
sequence of M. kansasii described in JP-A-11-155589). Thus, these 8
clones were selected as the candidate clone.
(6) Determination of Nucleotide Sequence of the Candidate Clone
[0239] The nucleotide sequence of the 8 candidate clones selected
in the above (5) was carried out by the method described below.
[0240] That is, using the Big Dye Terminator kit (Applied
Biosystems), the sequence analysis was carried out by the following
procedures according to the protocol of the product.
[0241] The candidate DNA (the candidate clone); 2 .mu.l (100
ng)
[0242] M13 Primer M1; 1 .mu.l (5 pmol)
[0243] Premix; 8 .mu.l
[0244] To the above mixture, sterile deionized water was added to
make the total volume 20 .mu.l, and then 30 cycles of the
sequencing reaction under the following reaction conditions were
carried out using the DNA Thermal Cycler (DNA Engine PTC200, MJ
Research Inc.):
96.degree. C. for 2 min.fwdarw.(96.degree. C. for 10
sec..fwdarw.50.degree. C. for 5 sec..fwdarw.60.degree. C. for 4
min).times.25.fwdarw.4.degree. C.
[0245] The sequencing reaction product obtained was purified using
a gel filtration column (QIAGEN GmbH), and then using a sequencer
(BaseStation, MJ Research Inc.) the sequence mapping of all the
candidate sequence was carried out according to the operation
manual provided for the sequencer.
[0246] The data obtained were searched from the data base (NCBI
Blast) and found that all of the 8 candidate clones were
unregistered new sequences on the data base. This can supposedly be
attributed to the fact that M. kansasii is an organism species with
undeciphered genome sequence.
Example 1
Evaluation of the Specificity of the Candidate Clone for M.
Kansasii
[0247] The 8 candidate clones obtained in Experimental Example 1
were evaluated by performing agarose gel electrophoresis detection
experiment in combination with the PCR amplification system for
their availability for the M. kansasii specific detection system
using nucleic acid amplification detection system.
(1) the Synthesis of the Primer for PCR
[0248] Firstly, based on the result of sequence analysis of the
candidate clone 1, the primer sequence for the PCR amplification
detection was designed using a web tool for primer design, Primer 3
(Whitehead Institute for Biomedical Research). Using the designed
"CGGCCATTGTTCTACAGTCT" (SEQ ID NO: 5; hereinafter referred to as
1c_plate1_Fw1) and "TAGAGATCCATCGCTTTGGT" (SEQ ID NO: 6;
hereinafter referred to as 1c_plate1_Rv1), the PCR was carried out
as described below. The designed oligonucleotide was synthesized by
the phosphoamidite method using the ABI 392 DNA synthesizer
(Applied Biosystems Inc.). The synthetic procedures were performed
in accordance with the manual provided by ABI, and the deprotection
of various types of oligonucleotide was performed by heating the
ammonia solution of oligonucleotide at 55.degree. C. for overnight.
In the next place, the synthesized oligonucleotide was purified by
the anion-exchange column chromatography using the Pharmacia
FPLC.
[0249] It should be noted that the nucleotide sequence obtained
from the result of sequence analysis of the candidate clone 1 is
the sequence depicted in SEQ ID NO: 1.
(2) Preparation of Sample
[0250] Using the following bacteria, the extraction and
purification of DNA were carried out by the method described below,
and DNA samples were obtained. All bacteria used were clinical
isolates, and their bacterial strain had already been
differentiated by the colony morphology and the conventional
various biochemical tests on the cultured bacterium.
a: Escherichia coli; b: Mycobacterium tuberculosis; c:
Mycobacterium kansasii; d: Mycobacterium marinum; e: Mycobacterium
simiae; f: Mycobacterium scrofulaceum; g: Mycobacterium gordonae;
h: Mycobacterium szulgai; i: Mycobacterium avium; j: Mycobacterium
intracellulare; k: Mycobacterium gastri; l: Mycobacterium xenopi;
m: Mycobacterium nonchromogenicum; n: Mycobacterium terrae; o:
Mycobacterium triviale; p: Mycobacterium fortuitum; q:
Mycobacterium chelonei; r: Mycobacterium abscessus; s:
Mycobacterium peregrinum.
[0251] Firstly, as to the genus Mycobacterium bacteria, colonies
grown on the Ogawa's medium were collected and suspended in
purified water and autoclaved (at 120.degree. C. under 2
atmospheres for 20 minutes), and by way of disruption treatment
(physical disruption using 2 mm diameter of glass beads) followed
by centrifugation, the supernatant solution was obtained. From the
supernatant solution obtained, the extraction and purification of
DNA were carried out using an ion-exchange resin type DNA
extraction and purification kit Genomic-tip (QIAGEN GmbH). As to E.
coli, according to the conventional procedure of E. coli DNA
extraction method, extraction and purification of DNA were carried
out.
[0252] The purified DNA obtained was adjusted to give final
concentration of 1 ng/.mu.l (10 mM Tris-HCl buffer, pH 8.9), and
used as a DNA sample.
(3) PCR
[0253] The PCR was carried out as follows using the primer
sequences of 1c_plate1_Fw1 and 1c_plate1_Rv1 which were designed
and synthesized by the above described method based on the
nucleotide sequence (SEQ ID NO: 1) of the candidate clone. It
should be noted that, the locating position of each primer on the
nucleotide sequence of the candidate clone 1 was as shown in FIG.
1.
[0254] A 10 mM Tris-HCl buffer solution (pH 8.9) containing 1 .mu.M
each of the primer 1c_plate1_Fw1 and the primer 1c_plate1_Rv1, 1.5
mM MgCl.sub.2, 80 mM KCl, 500 .mu.g/ml BSA, 0.1% sodium cholate,
0.1% Triton X-100 (product name of polyoxyethylene octylphenyl
ether; Rohm and Haas Co.), 0.2 mM each of dATP, dCTP, dGTP and
dTTP, and 40 unit/ml of Taq DNA polymerase (Nippon Gene Co.) was
prepared and used as a reaction solution for PCR.
[0255] A 20 .mu.l of the reaction solution for PCR was added with 1
ng of the DNA sample, and using this solution as a sample for PCR,
30 cycles of PCR were carried out under the following condition
using the DNA Thermal Cycler (DNA Engine PTC200; MJ Research
Inc.).
The reaction conditions of the PCR: Heat denaturation: 94.degree.
C. for 0.5 minutes; Annealing: 55.degree. C. for 1 minute;
Polymerization reaction: 75.degree. C. for 0.5 minutes.
(4) Electrophoresis
[0256] A 5 .mu.l of the reaction solution obtained after the PCR in
(3) above was electrophoresed on a 1.5% agarose gel. Conditions of
the electrophoresis were constant voltage of 100 V for 30 minutes.
The operating procedure and other conditions were in accordance
with the general method described in Bio Experiment Illustrated,
vol. 2, p53-63, by Hiroki Nakayama (Shujunsha Co., Ltd.). In the
next place, after staining the gel with ethidium bromide, the
UV-light induced fluorescent signal was detected using a UV sample
photographic device FAS-III System (Toyobo Co., Ltd.). Also, the
molecular weight marker was electrophoresed simultaneously in
parallel with the reaction solution, and thereby, the length of the
detected DNA fragment was calculated by comparing the relative
mobility. In this regard, the X174/HaeIII digest (Marker 4; Nippon
Gene Co., Ltd.) was used as the molecular weight marker.
[0257] The obtained results of electrophoresis are shown in FIG.
6.
[0258] In FIG. 6, letters given on each lane indicates the results
when the following samples were used:
M4: molecular weight marker (Marker 4); a: Escherichia coli; b:
Mycobacterium tuberculosis; c: Mycobacterium kansasii; d:
Mycobacterium marinum; e: Mycobacterium simiae; f: Mycobacterium
scrofulaceum; g: Mycobacterium gordonae; h: Mycobacterium szulgai;
i: Mycobacterium avium; j: Mycobacterium intracellulare; k:
Mycobacterium gastri; l: Mycobacterium xenopi; m: Mycobacterium
nonchromogenicum; n: Mycobacterium terrae; o: Mycobacterium
triviale; p: Mycobacterium fortuitum; q: Mycobacterium chelonei; r:
Mycobacterium abscessus; s: Mycobacterium peregrinum.
[0259] By the PCR using forward primer 1c_plate1_Fw1 and reverse
primer 1c_plate1_Rv1, DNA fragment with 167 base pair (SEQ ID NO:
53) in the candidate sequence 1 which is locating in the M.
kansasii genome was expected to be replicated. Therefore, the one
of which the fluorescent band of 167 base pair was confirmed was
determined to be positive.
[0260] As is clear from the results shown in FIG. 6, in the PCR
performed using the primer 1c_plate1_Fw1 and the primer
1c_plate1_Rv1 of the present invention, only when M. kansasii was
used as a sample (c), the fluorescent band of 167 base pair was
confirmed, and the sample could be determined to be positive.
Contrary to this, when the other Mycobacterium bacteria and the
bacterium belonging to other genus such as E. coli were used as a
sample (a, b, d-s), the corresponding fluorescent band was not
confirmed, and all the sample could be determined to be
negative.
[0261] From the results obtained above, it can be proved that the
candidate clone 1 is an oligonucleotide which comprises the
nucleotide sequence specific to M. kansasii and by performing the
PCR using the primer designed based on this sequence, M. kansasii
can be detected specifically. In addition, as the detection by
nucleic acid amplification such as PCR can be expected to be highly
sensitive, isolation of bacterium is not necessary and the clinical
specimen can be used directly for the detection. In consequence,
the detection of M. kansasii, which used to take several weeks by
the conventional method in which the bacterial cultivation is
necessary before detection is carried out, can be finished within a
day at the longest.
Example 2
Detection of M. Kansasii Using the Primer of the Present Invention
1
[0262] As to the candidate clone 2 obtained in (6) of Experimental
Example 1, based on the nucleotide sequence thereof, 6c_plate1_Fw1
(SEQ ID NO: 13) as a forward primer and 6c_plate1_Rv1 (SEQ ID NO:
14) as a reverse primer were designed and synthesized by the same
method as described in (1) of Example 1. Using the same samples and
reagents, and by the same method as described in (2) to (4) of
Example 1, the PCR and the electrophoresis were carried out.
[0263] In addition, the nucleotide sequence of the candidate clone
2 obtained from the result of sequence analysis was the one
depicted in SEQ ID NO: 2, and the location of each designed primer
on the nucleotide sequence of the candidate clone 2 was as shown in
FIG. 2.
[0264] By the PCR using forward primer 6c_plate1_Fw1 and reverse
primer 6c_plate1_Rv1, DNA fragment with 216 base pair (SEQ ID NO:
57) in the candidate sequence 2 which is locating in the M.
kansasii genome was expected to be replicated. Therefore, the one
of which the fluorescent band of 216 base pair was confirmed was
determined to be positive.
[0265] In consequence, only when M. kansasii was used as a sample
(c), the fluorescent band of 216 base pair was confirmed, and the
sample could be determined to be positive. Contrary to this, when
the other Mycobacterium bacteria and the bacterium belonging to
other genus such as E. coli were used as a sample (a, b, d-s), the
corresponding fluorescent band was not confirmed, and all the
sample could be determined to be negative.
[0266] From the results obtained above, it can be proved that the
candidate clone 2 is also an oligonucleotide which comprises the
nucleotide sequence specific to M. kansasii and by performing the
PCR using the primer designed according to this sequence, M.
kansasii can be detected specifically.
Example 3
Detection of M. Kansasii Using the Primer of the Present Invention
2
[0267] As to the candidate clone 3 to 8 obtained in (6) of
Experimental Example 1, based on the nucleotide sequence thereof,
the primer was designed and synthesized by the same method as
described in (1) of Example 1. Using the same samples and reagents,
and by the same method as described in (2) to (4) of Example 1
except for using the synthesized primers, the PCR and the
electrophoresis were carried out.
[0268] In consequence, taking the specificity for M. kansasii into
consideration, the candidate sequences 3 and 4 have high
specificity for M. kansasii, and were found to have efficacy for
the determination.
[0269] In addition, the nucleotide sequence of the candidate clone
3 obtained from the result of sequence analysis was the one
depicted in SEQ ID NO: 3, and the location of each designed primer
on the nucleotide sequence of the candidate clone 3 was as shown in
FIG. 3.
[0270] Also, the nucleotide sequence of the candidate clone 4
obtained from the result of sequence analysis was the one depicted
in SEQ ID NO: 4, and the location of each designed primer on the
nucleotide sequence of the candidate clone 4 was as shown in FIG.
4.
Example 4
Detection of M. Kansasii by the Real-Time PCR System
(1) Synthesis of the PCR Primer for the Detection of M.
Kansasii
[0271] Using the same equipment and by the same procedure as
described in (1) of Example 1, the oligonucleotides of
1c_plate1_Fw1 (SEQ ID NO: 5) and 1c_plate1_Rv1 (SEQ ID NO: 6) were
synthesized.
(2) Preparation of the Probe for the Detection of M. Kansasii
[0272] From the nucleotide sequence depicted in SEQ ID No: 53 (167
base pair) to be amplified by the PCR using 1c_plate1_Fw1 and
1c_plate1_Rv1 as primers, a sequence to be used as a probe
"ACTCAATGCCCTTCGATCCCGGCGAAC" was designed, and an oligonucleotide
comprising this sequence was synthesized (hereinafter, referred to
as KAN1c_F1R1_FAMTAM; SEQ ID No: 80). The 5'-terminal of this
oligonucleotide was labeled with a reporter dye of FAM and the
3'-terminal was labeled with a reporter quencher of TAMRA, and thus
a labeled oligonucleotide probe (TaqMan.TM. Fluorescent Probe;
Applied Biosystems Japan) was obtained.
(3) Preparation of the DNA Sample for PCR
[0273] Absorbance of the DNA sample prepared from M. kansasii
specimen in (1) of Experimental Example 1 was measured to determine
the quantity of the DNA in the sample. The quantity of the DNA
(copy number of the genome) in the sample was determined by
comparing the obtained quantity of DNA with the known quantity of
the genomic DNA of M. kansasii. A 10.sup.8 copy/.mu.l of the
genomic DNA was obtained.
[0274] In the next place, the dilution series of the DNA sample of
10.sup.5, 10.sup.4, 10.sup.3, 10.sup.2, 10, 5 and 2 copy/.mu.l was
prepared using 10 mM Tris-HCl buffer, pH 8.9, and used as a DNA
sample for PCR.
(4) Real-Time PCR
[0275] Using the 1c_plate1_Fw1 prepared in the above described (1)
as the forward primer and the 1c_plate1_Rv1 prepared in the above
described (1) as the reverse primer, the real-time PCR was carried
out as follows.
[0276] That is, a 10 mM Tris-HCl buffer solution (pH 8.9)
containing 1 .mu.M each of the primer 1c_plate1_Fw1 and the primer
1c_plate1_Rv1, 195 nM of the fluorescence labeled probe
KAN1c_F1R1_FAMTAM prepared in the above (2), 1.5 mM MgCl.sub.2, 80
mM KCl, 500 .mu.g/ml BSA, 0.1% sodium cholate, 0.1% Triton X-100
(product name of polyoxyethylene octylphenyl ether; Rohm and Haas
Co.), 0.2 mM each of dATP, dCTP, dGTP and dTTP, and 40 unit/ml of
Taq DNA polymerase (Nippon Gene Co.) was prepared and used as a
reaction solution.
[0277] To 20 .mu.l of the reaction solution 1 .mu.l of each
dilution series of DNA sample was added and used as a sample for
PCR. This sample for PCR was placed in each well of a 96-well
reaction plate (MicroAmp Optical 96-well Reaction Plate; Applied
Biosystems Japan Ltd.), and the real-time PCR was carried out using
a dedicated thermal cycler/detector for the TaqMan.TM. PCR (ABI
7500, Applied Biosystems Japan Ltd.). The reaction was repeated 50
cycles of a reaction cycle composed of heating at 95.degree. C. for
10 minutes, followed by heating at 95.degree. C. for 15 seconds and
60.degree. C. for 1 minute, and in every cycle, the fluorescent
intensity of reporter dye was measured. In addition, the
fluorescent intensity was measured and digitalized using the
thermal cycler and using the provided function of digitalizing the
relative fluorescent intensity ratio of every one of 96-well
reaction plate.
(5) Results
[0278] From the data obtained, a standard curve was made up
according to the conventional procedure commonly performed in the
real-time PCR method.
[0279] That is, as for each of the DNA sample for PCR, the
fluorescent intensity of reporter dye (Rn, y-axis) was plotted for
each cycle number of PCR (x-axis) to make up an amplification
curve. After that, an Rn part where the fluorescent intensity
amplifies exponentially was selected, and a threshold line (Th) was
drawn. The crossing point of the Th with the fluorescent intensity
of each DNA sample for PCR was defined as threshold cycle (Ct).
After that, the Ct value (y-axis) was plotted for the copy number
of the genome of each used DNA sample for PCR (x-axis), and an
approximated curve obtained for each Ct was used as a standard
curve. The standard curve obtained was shown in FIG. 7.
y=-3.348x+32.61
R.sup.2=0.995
[0280] From the fact that the fluorescent signal was detected by
PCR as described above, it is confirmed that M. kansasii can be
detected by conducting the real-time PCR, using the oligonucleotide
of the present invention for the PCR as a primer, and by designing
a labeled probe based on the sequence of the region to be
amplified.
[0281] In addition, it was also confirmed that since the standard
curve can be made up, the quantitative determination of M. kansasii
is possible by the real-time PCR using the primer and the probe of
the present invention. Further, it can be understood from FIG. 7
that the real-time PCR method using the primer and the probe of the
present invention can detect M. kansasii even under the condition
that only 2 copies of the genomic DNA of M. kansasii is present as
the initial quantity.
[0282] Furthermore, when the real-time PCR method is utilized,
since the fluorescent intensity is monitored in real time, the
quantitative determination of initial quantity of the template DNA
can be performed more accurately, and the method is considered to
be effective for detecting M. kansasii.
INDUSTRIAL APPLICABILITY
[0283] The method for detecting Mycobacterium kansasii using the
primer and/or probe of the present invention enables the detection
of M. kansasii more rapidly and with higher accuracy compared with
a conventional bacterium identification method performed by culture
examination on a bacterium. Further, the method for detecting M.
kansasii of the present invention can exclude any false positive
result for the diagnosis and can also detect and diagnose M.
kansasii with higher accuracy compared with a diagnosis method
performed by PCR using a conventional primer and/or probe. Still
further, the method for detecting M. kansasii of the present
invention can quantify the M. kansasii cell.
Sequence CWU 1
1
811517DNAMycobacterium kansasii 1ccgcgtcgtg ccccttaccg acaagaccat
cggccatctg cacgtctacc tcgacgagtt 60ccacccgaac atcaccaaac tgcccgcgag
acggccattg ttctacagtc tgcatcgcgg 120gcgacctgcc gaactgtccg
ctgacacggt cgccgccgtg ctcaagcagg ccgccgaatc 180cgcgcgtact
caatgccctt cgatcccggc gaacatccac tgtcacctgc tgcggaagac
240caaagcgatg gatctctacc agcagggcat cccgctaccg atcatcatgc
gcctcctcgg 300ccacgaaaac gcttccacca cagcagcttt ctatgccttt
gcaaccctgg acatgatgcg 360tcaagcgatc aacgccgcca cccccgcgat
caacaccgcg gccaccgagc cactcaccga 420agaccaactc caaaccctct
acagtctgcg ataaccgcct gaaacgttaa gccgagaaat 480ccgccagcac
cccccacgag cgcaggacat ctccgca 5172596DNAMycobacterium kansasii
2attgatccgt tgtcccgcac tggcgctcgt cggctccggc gagggcggtg agccgatacg
60tcaattcaac gtattcgccc gacaggccgg cgggccggtg accgctcgga tgttcactac
120cgacgaaggc gccgacaccc attgccagct cggcaacctg acgtcgtcga
atgccgtcac 180tatggattgg ctcgaagaca ccctcaactc ggattgatcg
ttgcgccgct tcaattcacc 240gcgttttgct tgccgcctgg ccggcgcttc
gcaccacgct gcggaagaac tccatccgcg 300cggtgaccag atcgtcggcc
aagtccaggg cagcgtcgac aacggtcttg cgtcgtgact 360cgtcggggag
aacggaatcg atctgatcga cgaacttgcg gacggcctcg atggcctttt
420tgcggccggt ttccaccgat tcgagcacct cgtcggaaag ttcggcccag
cgtggctcgg 480ccttctgcgg cgtctctgtc atgatgtcaa ctccctgaac
tctatcgggc ttatactcga 540ccggcgtacg ccgcaaactt cggcgattgc
cgacgctgat gaagttacga ctgtcg 5963636DNAMycobacterium kansasii
3cagcgttggc ttcccggtcc ttggcgtggg cgaacaagat gtcccagaac ggcgtgaaac
60cctccaggta cgcattgccg ctctgggtga tcaatgccgt cacccgctcc ggtgtccggc
120tcgcgatccg cagcccgatg ggtgctccgt agtcctggat gtagagcgca
aagcgctgca 180ggccgagctt gtccacgagg ccttcgacga tctcggtcag
attgtcgaag ctatagcgga 240actcgtcgac cgacggtgcg gccgaattgc
cgaagccgat gtaatcggga gccaccaggt 300agtactcgtc ggagagcgcg
gcgatgagat tgcggaacat atgcgagctg gtggggaagc 360cgtgcagcag
gagcaaagcc gggtttcgcg gattgccggc ctcccggaag tacacctcca
420agccgttgat ggacgtagtc cggtgccggg tgtcgaaggt agtcattgcg
gtttcctttc 480ggtgatggtc gggtgccggt cgggagaacg agcgttctca
cggctggttg tagtctagag 540aacgatcgtt cttagcgcaa ggagggaatg
ccatgaccga aggcgaggac cgggataatg 600tgctcgccgc agccgatagg
ttgttcaatg accgcg 6364726DNAMycobacterium kansasii 4tacggctgct
caaccagaat gagcatctgg gtatcgcgcc gacgcgtaac tgtgggttcg 60accacgcgcg
cagtcagatc atcggccgga tcgatgccga ttccgttgtt gacacggatt
120gggtcgagac gattcgccag tgttttcaag actccgccat cgacgcggtc
accggcccgg 180tccactatta cgacattccg ctgcgtgggc cgatattcag
aatcgaccgc atggtccgcc 240gcaacctgca tcgcacggca accgatcaac
ggttcctctt gggcgccaac atggcaatcc 300ggacctcggc gtggcaggcg
gtacgtcatc tcacgcagct ggatctggaa gaccgactcc 360acgaagacat
cgatcttgca ctgacactgt tcaagaataa tttcgagatc gcatacgaat
420ccacgatggt ggtgggcgcg tctggccgcc gggtggaatg ctcaccgctc
gacttttttc 480gctacgcgac gcgttatacc aggacgacaa aggcgcacgg
cgtcaagagt cgttcggcac 540gtataacgat tgccgttctc atgctgggat
atgtgccggt ccgaacactg cggttctttt 600atgacgccga gaacaatcgg
ttcacgcgca agcgctccgg gacgggcggc ggaacgaaat 660cgaccgacta
ctgaggggcg atccgcgagt caatcgaagc accctttgct ttgtagcagg 720gacaac
726520DNAArtificial Sequenceoligonucleotide primer 5cggccattgt
tctacagtct 20620DNAArtificial Sequenceoligonucleotide primer
6tagagatcca tcgctttggt 20719DNAArtificial Sequenceoligonucleotide
primer 7gccatctgca cgtctacct 19820DNAArtificial
Sequenceoligonucleotide primer 8aacatccact gtcacctgct
20920DNAArtificial Sequenceoligonucleotide primer 9ccaccacagc
agctttctat 201020DNAArtificial Sequenceoligonucleotide primer
10atcgaagggc attgagtacg 201120DNAArtificial Sequenceoligonucleotide
primer 11gagttggtct tcggtgagtg 201221DNAArtificial
Sequenceoligonucleotide primer 12gatttctcgg cttaacgttt c
211320DNAArtificial Sequenceoligonucleotide primer 13atgttcacta
ccgacgaagg 201418DNAArtificial Sequenceoligonucleotide primer
14gacttggccg acgatctg 181518DNAArtificial Sequenceoligonucleotide
primer 15gctgcggaag aactccat 181618DNAArtificial
Sequenceoligonucleotide primer 16ctcgaatcgg tggaaacc
181718DNAArtificial Sequenceoligonucleotide primer 17gatccgttgt
cccgcact 181820DNAArtificial Sequenceoligonucleotide primer
18gtgagccgat acgtcaattc 201919DNAArtificial Sequenceoligonucleotide
primer 19cttcaattca ccgcgtttt 192018DNAArtificial
Sequenceoligonucleotide primer 20ctgcggaaga actccatc
182120DNAArtificial Sequenceoligonucleotide primer 21gatctgatcg
acgaacttgc 202219DNAArtificial Sequenceoligonucleotide primer
22catagtgacg gcattcgac 192320DNAArtificial Sequenceoligonucleotide
primer 23atccgagttg agggtgtctt 202420DNAArtificial
Sequenceoligonucleotide primer 24atcagatcga ttccgttctc
202518DNAArtificial Sequenceoligonucleotide primer 25ctcgaatcgg
tggaaacc 182620DNAArtificial Sequenceoligonucleotide primer
26ggtcgagtat aagcccgata 202718DNAArtificial Sequenceoligonucleotide
primer 27gtgatcaatg ccgtcacc 182820DNAArtificial
Sequenceoligonucleotide primer 28gttccgctat agcttcgaca
202920DNAArtificial Sequenceoligonucleotide primer 29gagccaccag
gtagtactcg 203020DNAArtificial Sequenceoligonucleotide primer
30accggactac gtccatcaac 203118DNAArtificial Sequenceoligonucleotide
primer 31gttggcttcc cggtcctt 183219DNAArtificial
Sequenceoligonucleotide primer 32gtgaaaccct ccaggtacg
193320DNAArtificial Sequenceoligonucleotide primer 33acgatctcgg
tcagattgtc 203420DNAArtificial Sequenceoligonucleotide primer
34gagccaccag gtagtactcg 203519DNAArtificial Sequenceoligonucleotide
primer 35tttcctttcg gtgatggtc 193619DNAArtificial
Sequenceoligonucleotide primer 36gcgctctaca tccaggact
193720DNAArtificial Sequenceoligonucleotide primer 37ccgctatagc
ttcgacaatc 203819DNAArtificial Sequenceoligonucleotide primer
38caccagctcg catatgttc 193920DNAArtificial Sequenceoligonucleotide
primer 39aacggcttgg aggtgtactt 204020DNAArtificial
Sequenceoligonucleotide primer 40gcggtcattg aacaacctat
204119DNAArtificial Sequenceoligonucleotide primer 41cccggtccac
tattacgac 194219DNAArtificial Sequenceoligonucleotide primer
42ctgcgtgaga tgacgtacc 194320DNAArtificial Sequenceoligonucleotide
primer 43gagatcgcat acgaatccac 204420DNAArtificial
Sequenceoligonucleotide primer 44atgagaacgg caatcgttat
204520DNAArtificial Sequenceoligonucleotide primer 45gaatgagcat
ctgggtatcg 204619DNAArtificial Sequenceoligonucleotide primer
46gattgggtcg agacgattc 194720DNAArtificial Sequenceoligonucleotide
primer 47gagatcgcat acgaatccac 204821DNAArtificial
Sequenceoligonucleotide primer 48cgttatacca ggacgacaaa g
214920DNAArtificial Sequenceoligonucleotide primer 49gcggaatgtc
gtaatagtgg 205019DNAArtificial Sequenceoligonucleotide primer
50caagaggaac cgttgatcg 195120DNAArtificial Sequenceoligonucleotide
primer 51gttatacgtg ccgaacgact 205220DNAArtificial
Sequenceoligonucleotide primer 52cagtagtcgg tcgatttcgt
2053167DNAArtificial Sequenceoligonucleotide probe 53cggccattgt
tctacagtct gcatcgcggg cgacctgccg aactgtccgc tgacacggtc 60gccgccgtgc
tcaagcaggc cgccgaatcc gcgcgtactc aatgcccttc gatcccggcg
120aacatccact gtcacctgct gcggaagacc aaagcgatgg atctcta
16754172DNAArtificial Sequenceoligonucleotide probe 54gccatctgca
cgtctacctc gacgagttcc acccgaacat caccaaactg cccgcgagac 60ggccattgtt
ctacagtctg catcgcgggc gacctgccga actgtccgct gacacggtcg
120ccgccgtgct caagcaggcc gccgaatccg cgcgtactca atgcccttcg at
17255219DNAArtificial Sequenceoligonucleotide probe 55aacatccact
gtcacctgct gcggaagacc aaagcgatgg atctctacca gcagggcatc 60ccgctaccga
tcatcatgcg cctcctcggc cacgaaaacg cttccaccac agcagctttc
120tatgcctttg caaccctgga catgatgcgt caagcgatca acgccgccac
ccccgcgatc 180aacaccgcgg ccaccgagcc actcaccgaa gaccaactc
21956167DNAArtificial Sequenceoligonucleotide probe 56ccaccacagc
agctttctat gcctttgcaa ccctggacat gatgcgtcaa gcgatcaacg 60ccgccacccc
cgcgatcaac accgcggcca ccgagccact caccgaagac caactccaaa
120ccctctacag tctgcgataa ccgcctgaaa cgttaagccg agaaatc
16757216DNAArtificial Sequenceoligonucleotide probe 57atgttcacta
ccgacgaagg cgccgacacc cattgccagc tcggcaacct gacgtcgtcg 60aatgccgtca
ctatggattg gctcgaagac accctcaact cggattgatc gttgcgccgc
120ttcaattcac cgcgttttgc ttgccgcctg gccggcgctt cgcaccacgc
tgcggaagaa 180ctccatccgc gcggtgacca gatcgtcggc caagtc
21658168DNAArtificial Sequenceoligonucleotide probe 58gctgcggaag
aactccatcc gcgcggtgac cagatcgtcg gccaagtcca gggcagcgtc 60gacaacggtc
ttgcgtcgtg actcgtcggg gagaacggaa tcgatctgat cgacgaactt
120gcggacggcc tcgatggcct ttttgcggcc ggtttccacc gattcgag
16859336DNAArtificial Sequenceoligonucleotide probe 59atgttcacta
ccgacgaagg cgccgacacc cattgccagc tcggcaacct gacgtcgtcg 60aatgccgtca
ctatggattg gctcgaagac accctcaact cggattgatc gttgcgccgc
120ttcaattcac cgcgttttgc ttgccgcctg gccggcgctt cgcaccacgc
tgcggaagaa 180ctccatccgc gcggtgacca gatcgtcggc caagtccagg
gcagcgtcga caacggtctt 240gcgtcgtgac tcgtcgggga gaacggaatc
gatctgatcg acgaacttgc ggacggcctc 300gatggccttt ttgcggccgg
tttccaccga ttcgag 33660181DNAArtificial Sequenceoligonucleotide
probe 60gatccgttgt cccgcactgg cgctcgtcgg ctccggcgag ggcggtgagc
cgatacgtca 60attcaacgta ttcgcccgac aggccggcgg gccggtgacc gctcggatgt
tcactaccga 120cgaaggcgcc gacacccatt gccagctcgg caacctgacg
tcgtcgaatg ccgtcactat 180g 18161167DNAArtificial
Sequenceoligonucleotide probe 61gtgagccgat acgtcaattc aacgtattcg
cccgacaggc cggcgggccg gtgaccgctc 60ggatgttcac taccgacgaa ggcgccgaca
cccattgcca gctcggcaac ctgacgtcgt 120cgaatgccgt cactatggat
tggctcgaag acaccctcaa ctcggat 16762159DNAArtificial
Sequenceoligonucleotide probe 62cttcaattca ccgcgttttg cttgccgcct
ggccggcgct tcgcaccacg ctgcggaaga 60actccatccg cgcggtgacc agatcgtcgg
ccaagtccag ggcagcgtcg acaacggtct 120tgcgtcgtga ctcgtcgggg
agaacggaat cgatctgat 15963167DNAArtificial Sequenceoligonucleotide
probe 63ctgcggaaga actccatccg cgcggtgacc agatcgtcgg ccaagtccag
ggcagcgtcg 60acaacggtct tgcgtcgtga ctcgtcgggg agaacggaat cgatctgatc
gacgaacttg 120cggacggcct cgatggcctt tttgcggccg gtttccaccg attcgag
16764163DNAArtificial Sequenceoligonucleotide probe 64gatctgatcg
acgaacttgc ggacggcctc gatggccttt ttgcggccgg tttccaccga 60ttcgagcacc
tcgtcggaaa gttcggccca gcgtggctcg gccttctgcg gcgtctctgt
120catgatgtca actccctgaa ctctatcggg cttatactcg acc
16365156DNAArtificial Sequenceoligonucleotide probe 65gtgatcaatg
ccgtcacccg ctccggtgtc cggctcgcga tccgcagccc gatgggtgct 60ccgtagtcct
ggatgtagag cgcaaagcgc tgcaggccga gcttgtccac gaggccttcg
120acgatctcgg tcagattgtc gaagctatag cggaac 15666156DNAArtificial
Sequenceoligonucleotide probe 66gagccaccag gtagtactcg tcggagagcg
cggcgatgag attgcggaac atatgcgagc 60tggtggggaa gccgtgcagc aggagcaaag
ccgggtttcg cggattgccg gcctcccgga 120agtacacctc caagccgttg
atggacgtag tccggt 15667358DNAArtificial Sequenceoligonucleotide
probe 67ccggctcgcg atccgcagcc cgatgggtgc tccgtagtcc tggatgtaga
gcgcaaagcg 60ctgcaggccg agcttgtcca cgaggccttc gacgatctcg gtcagattgt
cgaagctata 120gcggaactcg tcgaccgacg gtgcggccga attgccgaag
ccgatgtaat cgggagccac 180caggtagtac tcgtcggaga gcgcggcgat
gagattgcgg aacatatgcg agctggtggg 240gaagccgtgc agcaggagca
aagccgggtt tcgcggattg ccggcctccc ggaagtacac 300ctccaagccg
ttgatggacg tagtccggtg ccgggtgtcg aaggtagtca ttgcggtt
35868165DNAArtificial Sequenceoligonucleotide probe 68gttggcttcc
cggtccttgg cgtgggcgaa caagatgtcc cagaacggcg tgaaaccctc 60caggtacgca
ttgccgctct gggtgatcaa tgccgtcacc cgctccggtg tccggctcgc
120gatccgcagc ccgatgggtg ctccgtagtc ctggatgtag agcgc
16569186DNAArtificial Sequenceoligonucleotide probe 69gtgaaaccct
ccaggtacgc attgccgctc tgggtgatca atgccgtcac ccgctccggt 60gtccggctcg
cgatccgcag cccgatgggt gctccgtagt cctggatgta gagcgcaaag
120cgctgcaggc cgagcttgtc cacgaggcct tcgacgatct cggtcagatt
gtcgaagcta 180tagcgg 18670147DNAArtificial Sequenceoligonucleotide
probe 70acgatctcgg tcagattgtc gaagctatag cggaactcgt cgaccgacgg
tgcggccgaa 60ttgccgaagc cgatgtaatc gggagccacc aggtagtact cgtcggagag
cgcggcgatg 120agattgcgga acatatgcga gctggtg 14771139DNAArtificial
Sequenceoligonucleotide probe 71gagccaccag gtagtactcg tcggagagcg
cggcgatgag attgcggaac atatgcgagc 60tggtggggaa gccgtgcagc aggagcaaag
ccgggtttcg cggattgccg gcctcccgga 120agtacacctc caagccgtt
13972164DNAArtificial Sequenceoligonucleotide probe 72tttcctttcg
gtgatggtcg ggtgccggtc gggagaacga gcgttctcac ggctggttgt 60agtctagaga
acgatcgttc ttagcgcaag gagggaatgc catgaccgaa ggcgaggacc
120gggataatgt gctcgccgca gccgataggt tgttcaatga ccgc
16473163DNAArtificial Sequenceoligonucleotide probe 73cccggtccac
tattacgaca ttccgctgcg tgggccgata ttcagaatcg accgcatggt 60ccgccgcaac
ctgcatcgca cggcaaccga tcaacggttc ctcttgggcg ccaacatggc
120aatccggacc tcggcgtggc aggcggtacg tcatctcacg cag
16374158DNAArtificial Sequenceoligonucleotide probe 74gagatcgcat
acgaatccac gatggtggtg ggcgcgtctg gccgccgggt ggaatgctca 60ccgctcgact
tttttcgcta cgcgacgcgt tataccagga cgacaaaggc gcacggcgtc
120aagagtcgtt cggcacgtat aacgattgcc gttctcat 15875387DNAArtificial
Sequenceoligonucleotide probe 75gggccgatat tcagaatcga ccgcatggtc
cgccgcaacc tgcatcgcac ggcaaccgat 60caacggttcc tcttgggcgc caacatggca
atccggacct cggcgtggca ggcggtacgt 120catctcacgc agctggatct
ggaagaccga ctccacgaag acatcgatct tgcactgaca 180ctgttcaaga
ataatttcga gatcgcatac gaatccacga tggtggtggg cgcgtctggc
240cgccgggtgg aatgctcacc gctcgacttt tttcgctacg cgacgcgtta
taccaggacg 300acaaaggcgc acggcgtcaa gagtcgttcg gcacgtataa
cgattgccgt tctcatgctg 360ggatatgtgc cggtccgaac actgcgg
38776185DNAArtificial Sequenceoligonucleotide probe 76gaatgagcat
ctgggtatcg cgccgacgcg taactgtggg ttcgaccacg cgcgcagtca 60gatcatcggc
cggatcgatg ccgattccgt tgttgacacg gattgggtcg agacgattcg
120ccagtgtttt caagactccg ccatcgacgc ggtcaccggc ccggtccact
attacgacat 180tccgc 18577165DNAArtificial Sequenceoligonucleotide
probe 77gattgggtcg agacgattcg ccagtgtttt caagactccg ccatcgacgc
ggtcaccggc 60ccggtccact attacgacat tccgctgcgt gggccgatat tcagaatcga
ccgcatggtc 120cgccgcaacc tgcatcgcac ggcaaccgat caacggttcc tcttg
16578143DNAArtificial Sequenceoligonucleotide probe 78gagatcgcat
acgaatccac gatggtggtg ggcgcgtctg gccgccgggt ggaatgctca 60ccgctcgact
tttttcgcta cgcgacgcgt tataccagga cgacaaaggc gcacggcgtc
120aagagtcgtt cggcacgtat aac 14379182DNAArtificial
Sequenceoligonucleotide probe 79cgttatacca
ggacgacaaa ggcgcacggc gtcaagagtc gttcggcacg tataacgatt 60gccgttctca
tgctgggata tgtgccggtc cgaacactgc ggttctttta tgacgccgag
120aacaatcggt tcacgcgcaa gcgctccggg acgggcggcg gaacgaaatc
gaccgactac 180tg 1828027DNAArtificial Sequenceoligonucleotide probe
80actcaatgcc cttcgatccc ggcgaac 2781324DNAMycobacterium
tuberculosis 81cgtactcgac ctgaaagacg ttatccacca tacggatagg
ggatctcagt acacatcgat 60ccggttcagc gagcggctcg ccgaggcagg catccaaccg
tcggtcggag cggtcggaag 120ctcctatgac aatgcactag ccgagacgat
caacggccta tacaagaccg agctgatcaa 180acccggcaag ccctggcggt
ccatcgagga tgtcgagttg gccaccgcgc gctgggtcga 240ctggttcaac
catcgccgcc tctaccagta ctgcggcgac gtcccgccgg tcgaactcga
300ggctgcctac tacgctcaac gcca 324
* * * * *