U.S. patent application number 13/606020 was filed with the patent office on 2013-02-21 for use of cis-epoxyeicosatrienoic acids and inhibitors of soluble epoxide hydrolase to treat conditions mediated by pbr, cb2, and nk2 receptors.
This patent application is currently assigned to THE REGENTS OF THE UNIVERSITY OF CALIFORNIA. The applicant listed for this patent is Bruce D. Hammock, Ahmet Bora Inceoglu. Invention is credited to Bruce D. Hammock, Ahmet Bora Inceoglu.
Application Number | 20130045172 13/606020 |
Document ID | / |
Family ID | 39512020 |
Filed Date | 2013-02-21 |
United States Patent
Application |
20130045172 |
Kind Code |
A1 |
Hammock; Bruce D. ; et
al. |
February 21, 2013 |
USE OF CIS-EPOXYEICOSATRIENOIC ACIDS AND INHIBITORS OF SOLUBLE
EPOXIDE HYDROLASE TO TREAT CONDITIONS MEDIATED BY PBR, CB2, and NK2
RECEPTORS
Abstract
The invention relates to the discovery that
cis-epoxyeicosatraenoic acids (EETs) bind to and act as agonists of
peripheral benzodiazepine receptor and the cannabinoid CB.sub.2
receptor. The invention provides methods of reducing symptoms of
conditions whose activity is mediated by these receptors, including
inhibiting anxiety, inhibiting the growth of cancer cells
expressing peripheral benzodiazepine receptors, and reducing oxygen
radical damage to cells, by contacting the cells with a
cis-epoxyeicosantrienoic acid, an inhibitor of soluble epoxide
hydrolase (sEH), or both. The invention further provides methods of
inhibiting irritable bowel syndrome by administering to individuals
with inhibiting irritable bowel syndrome a cis-epoxyeicosantrienoic
acid, an inhibitor of soluble epoxide hydrolase (sEH), or both. In
some embodiments, the method comprises administering to the
individual a nucleic acid which inhibits expression of sEH.
Inventors: |
Hammock; Bruce D.; (Davis,
CA) ; Inceoglu; Ahmet Bora; (Davis, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Hammock; Bruce D.
Inceoglu; Ahmet Bora |
Davis
Davis |
CA
CA |
US
US |
|
|
Assignee: |
THE REGENTS OF THE UNIVERSITY OF
CALIFORNIA
Oakland
CA
|
Family ID: |
39512020 |
Appl. No.: |
13/606020 |
Filed: |
September 7, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12518549 |
Oct 27, 2009 |
8263651 |
|
|
PCT/US07/00373 |
Jan 4, 2007 |
|
|
|
13606020 |
|
|
|
|
60875039 |
Dec 15, 2006 |
|
|
|
Current U.S.
Class: |
424/59 ; 435/375;
514/475 |
Current CPC
Class: |
A61P 25/30 20180101;
A61P 17/18 20180101; A61K 31/335 20130101; A61K 31/60 20130101;
A61P 1/00 20180101; A61P 25/18 20180101; A61K 31/365 20130101; A61K
31/202 20130101; A61K 31/192 20130101; A61K 31/336 20130101; A61K
31/17 20130101; A61K 31/415 20130101; A61P 25/00 20180101; A61P
25/08 20180101; A61P 25/32 20180101; A61K 31/336 20130101; A61K
31/415 20130101; A61K 31/365 20130101; A61P 25/22 20180101; A61P
25/36 20180101; A61K 31/60 20130101; A61K 2300/00 20130101; A61K
2300/00 20130101; A61K 2300/00 20130101; A61K 2300/00 20130101;
A61P 35/00 20180101; A61K 31/335 20130101; A61K 31/202 20130101;
A61K 2300/00 20130101; A61K 31/192 20130101; A61K 31/17 20130101;
A61P 17/16 20180101; A61K 2300/00 20130101; A61K 2300/00 20130101;
A61K 2300/00 20130101 |
Class at
Publication: |
424/59 ; 514/475;
435/375 |
International
Class: |
A61K 31/558 20060101
A61K031/558; A61P 25/08 20060101 A61P025/08; A61P 25/30 20060101
A61P025/30; C12N 5/071 20100101 C12N005/071; A61Q 17/04 20060101
A61Q017/04; A61P 1/00 20060101 A61P001/00; C12N 5/09 20100101
C12N005/09; A61P 25/22 20060101 A61P025/22; A61P 17/18 20060101
A61P017/18 |
Claims
1. A method of relieving a condition selected from the group
consisting of anxiety, panic attacks, agitation, status
epilepticus, other forms of epilepsy, symptoms of alcohol or opiate
withdrawal, insomnia, or mania in a subject in need thereof, said
method comprising administering to said subject an effective amount
of an agent or agents selected from the group consisting of a
cis-epoxyeicosantrienoic acid ("EET"), an inhibitor of soluble
epoxide hydrolase ("sEH"), and a combination of an EET and an
inhibitor of sEH, thereby relieving said condition in said
subject.
2-3. (canceled)
4. A method of claim 1, wherein the agent is an inhibitor of
sEH.
5. A method of claim 1, wherein said condition is anxiety.
6. A method of inhibiting growth of cancer cells expressing
peripheral benzodiazepine receptors (PBR) or CB2 receptors, said
method comprising contacting said cells with an effective amount of
an agent or agents selected from the group consisting of a
cis-epoxyeicosantrienoic acid ("EET"), an inhibitor of soluble
epoxide hydrolase ("sEH"), and a combination of an EET and an
inhibitor of sEH, thereby inhibiting the growth of said cancer
cells.
7. A method of claim 6, wherein the cancer cells are glioma
cells.
8. A method of claim 6, wherein the cells are astrocytoma
cells.
9. A method of claim 6, wherein the cells are breast cancer
cells.
10. A method of claim 6, wherein the agent is an EET.
11. A method of claim 6, wherein the EET is selected from the group
consisting of 14,15-EET, and 11,12-EET.
12. A method of claim 6, wherein the agent is an inhibitor of
sEH.
13. A method of claim 6, wherein EET or said inhibitor of sEH, or
both, are contained in a material which releases said EET or said
inhibitor, or both, over time.
14. A method of reducing oxygen radical damage to cells, said
method comprising contacting said cells with an effective amount of
an agent or agents selected from the group consisting of a
cis-epoxyeicosantrienoic acid ("EET"), an inhibitor of soluble
epoxide hydrolase ("sEH"), and a combination of an EET and an
inhibitor of sEH, thereby reducing oxygen radical damage to said
cells.
15. A method of claim 14, wherein the agent is an EET.
16. A method of claim 14, wherein the EET is selected from the
group consisting of 14,15-EET, 8,9-EET and 11,12-EET.
17. A method of claim 14, wherein the agent is an inhibitor of
sEH.
18. A method of claim 14, wherein EET or said inhibitor of sEH, or
both, are administered by applying to the skin a topical
formulation comprising said EET or said inhibitor of sEH or
both.
19. A method of claim 18, wherein said topical formulation further
comprises a sunscreen or sunblock.
20. A method of relieving irritable bowel syndrome (IBS) in a
subject in need thereof, said method comprising administering to
said subject an effective amount of an agent or agents selected
from the group consisting of a cis-epoxyeicosantrienoic acid
("EET"), an inhibitor of soluble epoxide hydrolase ("sEH"), and a
combination of an EET and an inhibitor of sEH, thereby relieving
IBS in said subject.
21-22. (canceled)
23. A method of claim 20, wherein the agent is an inhibitor of sEH.
Description
CROSS-REFERENCES TO RELATED APPLICATIONS
[0001] NOT APPLICABLE.
STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED
RESEARCH AND DEVELOPMENT
[0002] This application claims priority from and benefit of U.S.
Provisional Application Ser. No. ______, Attorney Docket No.
02307O-168800US, filed Dec. 15, 2006, the contents of which are
incorporated herein by reference.
REFERENCE TO A "SEQUENCE LISTING," A TABLE, OR A COMPUTER PROGRAM
LISTING APPENDIX SUBMITTED ON A COMPACT DISK
[0003] NOT APPLICABLE
BACKGROUND OF THE INVENTION
[0004] It would be useful to have additional methods of decreasing
anxiety, inhibiting the proliferation of cancer cells, of reducing
irritable bowel syndrome, and of increasing endogenous neurosteroid
production.
[0005] The present invention fills these and other needs.
BRIEF SUMMARY OF THE INVENTION
[0006] In a first group of embodiments, the invention provide
methods of relieving symptoms of a condition selected from the
group consisting of anxiety, panic attack, agitation, status
epilepticus, other forms of epilepsy, alcohol or opiate withdrawal,
insomnia, or mania in a subject in need thereof, by administering
to the subject an effective amount of an agent or agents selected
from the group consisting of a cis-epoxyeicosantrienoic acid
("EET"), an inhibitor of soluble epoxide hydrolase ("sEH"), and a
combination of an EET and an inhibitor of sEH, thereby relieving
the symptoms of the condition in the subject. In some embodiments,
the agent is an EET. In some embodiments, the EET is selected from
the group consisting of 14,15-BET, 8,9-EET, 11,12-EET or 5,6-EET.
In some embodiments, the agent is an inhibitor of sEH. In some
embodiments, the condition is anxiety.
[0007] In a further group of embodiments, the invention provides
methods of inhibiting growth of cancer cells expressing peripheral
benzodiazepine receptors (PBR) or CB.sub.2 receptors. The methods
comprise contacting said cells with an effective amount of an agent
or agents selected from the group consisting of a
cis-epoxyeicosantrienoic acid ("EET"), an inhibitor of soluble
epoxide hydrolase ("sEH"), and a combination of an EET and an
inhibitor of sEH, thereby inhibiting the growth of the cancer
cells. In some embodiments, the cancer cells are glioma cells. In
some embodiments, the cells are astrocytoma cells. In some
embodiments, the cells are breast cancer cells. In some
embodiments, the agent is an EET. In some embodiments, the EET is
selected from the group consisting of 14,15-EET, and 11,12-BET. In
some embodiments, the agent is an inhibitor of sEH. In some
embodiments, the EET or the inhibitor of sEH, or both, are
contained in a material which releases the EET or the inhibitor, or
both, over time.
[0008] In yet a further group of embodiments, the invention
provides methods of reducing oxygen radical damage to cells. The
methods comprise contacting said cells with an effective amount of
an agent or agents selected from the group consisting of a
cis-epoxyeicosantrienoic acid ("EET"), an inhibitor of soluble
epoxide hydrolase ("sEH"), and a combination of an EET and an
inhibitor of sEH, thereby reducing oxygen radical damage to the
cells. In some embodiments, the agent is an EET. In some
embodiments, the EET is selected from the group consisting of
14,15-BET, 8,9-EET and 11,12-EET. In some embodiments, the agent is
an inhibitor of sEH. In some embodiments, the EET, or said
inhibitor of sEH, or both, are administered by applying to the skin
a topical formulation comprising the EET or the inhibitor of sEH,
or both. In some embodiments, the topical formulation further
comprises a sunscreen or sunblock.
[0009] In still a further group of embodiments, the invention
provides methods of relieving symptoms of irritable bowel syndrome
(IBS) in a subject in need thereof. The method comprises
administering to the subject an effective amount of an agent or
agents selected from the group consisting of a
cis-epoxyeicosantrienoic acid ("EET"), an inhibitor of soluble
epoxide hydrolase ("sEH"), and a combination of an EET and an
inhibitor of sEH, thereby relieving symptoms of IBS in the subject.
In some embodiments, the agent is an EET. In some embodiments, the
EET is selected from the group consisting of 14,15-EET, 8,9-EET,
and 11,12-EET. In some embodiments, the agent is an inhibitor of
sEH.
BRIEF DESCRIPTION OF THE DRAWINGS
[0010] FIG. 1. FIG. 1 is a graph showing the results of in vitro
assays showing that EETs displace the high affinity PBR ligand
[H.sup.3] PK 11195 in a dose dependent manner. X axis: Micromolar
concentration of EETs. Y axis: % Inhibition of binding of [H.sup.3]
PK 11195. Filled diamonds: 5,6-EET. Filled circles: 11,12-EET.
Filled triangles: 14,15-EET. Filled squares: Mixture of
epoxyeicosatrienoic acid methylesters ("EETs-me").
[0011] FIGS. 2A-2D. FIGS. 2A-2D show the results of in vivo assays
showing that sEHI elicited analgesia in rats can be blocked by
steroid synthesis inhibitors. FIG. 2A shows the effect on animals
administered the steroid synthesis inhibitor aminogluthetimide
("AGL"), while FIG. 2B shows the effect of animals administered the
steroid synthesis inhibitor finasteride ("FIN"). FIG. 2C shows that
show that AGL and FIN by themselves have no impact on the baseline
response shown by control animals, which FIG. 2D shows that they do
not they modify the response of animals to LPS administration. For
each of FIGS. 2A-D, the Y axis shows hindpaw thermal withdrawal
latencies ("TWL") of the animals in the study reported in the
Figure as a percentage of TWL prior to any treatment ("Baseline").
The X axis shows the various points in time at which measurements
of TWL were taken. "BL" means starting ("base line") measurement
taken before administration of agents to the animals. FIG. 2A:
Hollow diamonds: animals treated only with lipopolysaccharide
("LPS") (n=16). "X" with vertical line: animals treated with LPS+an
inhibitor of sEH called "AEPU" (n=6). "X": animals treated with LPS
and AGL (n=6). "+" sign: animals treated with AGL, LPS, and AEPU
(n=7). FIG. 2B: Hollow diamonds: animals treated only with LPS
(n=16) (same data as in FIG. 2A). "X" with vertical line: animals
treated with LPS+an inhibitor of sEH called "AEPU" (n=6) (same data
as in FIG. 2A). "X": animals treated with LPS and FIN (n=6). "+"
sign: animals treated with FIN, LPS, and AEPU (n=8). FIG. 2C:
Filled diamonds: control (untreated) animals (n=6). Filled squares:
animals treated with AEPU, but not LPS (n=6). Filled triangles:
animals treated with AGL, but not LPS (n=4). "X": animals treated
with FIN, but not LPS (n=4). FIG. 2D: Filled diamonds: animals
treated only with LPS (n=16) (data as in FIGS. 2A and B). Filled
squares: animals treated with LPS and AGL (n=6). Hollow triangles:
animals treated with LPS and FIN (n=6).
[0012] FIGS. 3A-C. FIGS. 3A-3C are graphs depicting metabolomic
analyses of oxylipids and prostaglandins, revealing that there are
significant differences in animals treated with sEH inhibitors and
with an sEH inhibitor and a steroid synthesis inhibitor. For each
Figure, the Y axis shows a scale in ng/mL for the bars set forth in
the Figure, while the X axis shows the amounts of various
metabolites, as indicated below the axis. (In FIG. 3A, the bar
presenting the results for the metabolite 6-keto-PGF1a for one
group of animals exceeded the scale, as shown by a break in the bar
and the statement of the result in ng/mL about the bar). FIG. 3A.
This graph shows the amounts of the sum of the
vic-dihydroxyeicosatrienoic acids ("DHETs"), the sum of the EETs,
6-keto-PGF1a, PGF2a, and PGE2 in untreated ("naive") animals, in
animals treated with lipopolysaccharide ("LPS"), in animals treated
with LPS and an inhibitor of sEH referred to as AEPU, and in
animals treated with LPS, AEPU, and aminogluthetimide ("AGL") FIG.
3B. This graph shows the relative amounts of the sum of the
metabolite DiHOMEs (diols of linoleate epoxide), the sum of the
metabolites EpOMEs (linoleic acid mono-epoxides) and of the
metabolite thromboxane B.sub.2 ("TxB2") in the four groups of
animals described with regard to FIG. 3A. FIG. 3C. This graph shows
the amounts of the sum of the hydroxyoctadecadienoic acids
("HODEs") and the sum of the hydroxyeicosatetraenoic acids
("HETEs") in the four groups of animals described with regard to
FIG. 3A. All three graphs: bars with lines rising from left to
right (e.g., in FIG. 3A, the "sum of DHETs") present results for
untreated (naive) animals, bars with lines falling from left to
right present results for animals treated with LPS, bars with
cross-hatching present results for the animals treated with LPS and
the sEH inhibitor AEPU, and bars with horizontal lines present the
results for animals treated with LPS, AEPU, and the steroid
synthesis inhibitor aminogluthetimide ("AGL"). The metabolites
chosen for study show the effect on different pathways by which
arachidonic acid is metabolized. .SIGMA.EpOMEs and .SIGMA.DiHOMEs
are indicators of the P450 pathway, HETEs are an indicator of how
much arachidonic acid is going through the 5-lipoxygenase pathway
and 6-keto-PGF.sub.1a, and PGE.sub.2 are indicators of the
arachidonic acid metabolized by the cyclooxygenase pathway.
6-keto-PGF.sub.1a and TXB.sub.2 are stable metabolites of PGI.sub.2
and thromboxane A.sub.2 which have been implicated in increased
risk for stroke and heart attack. HODEs are lipoxygenase-derived
fatty acid metabolites.
[0013] FIG. 4. FIG. 4 is a graph of in vivo data showing that
analgesia induced by the action of sEH inhibitors is not blocked by
steroid receptor antagonists. The Y axis shows hindpaw thermal
withdrawal latencies ("TWL") as a percentage of TWL prior to any
treatment ("Baseline"). The bars on X axis shows the result of
testing using the agent or agents listed below the bar. LPS:
lipopolysaccharide. AEPU: sEH inhibitor. Tamoxifen is an estrogen
receptor antagonist. Mifepristone is a glucocorticoid receptor
antagonist. Nilutamide is an androgen receptor antagonist.
Aminoglutethimide is a general steroid synthesis inhibitor.
Finasteride is a 5 alpha reductase inhibitor that acts as a
specific steroid synthesis inhibitor. The line at the bottom of the
Figure under which is stated "LPS+AEPU+" indicates that the bars
above that line reflect the results of studies in which the animals
were treated with LPS, AEPU, and the antagonist listed over the
line.
[0014] FIG. 5. FIG. 5 is a graph of in vivo data showing that
analgesia induced by the action of sEH inhibitors is blocked by an
antagonist of the cannabinoid receptor CB.sub.2, but not by an
antagonist of the cannabinoid receptor CB.sub.1. The Y axis shows
hindpaw thermal withdrawal latencies ("TWL") as a percentage of TWL
prior to any treatment ("Baseline"). The bars on X axis shows the
result of testing using the agent or agents listed below the bar at
Baseline and two hours post administration of lipopolysaccharide
("LPS"). 950: sEH inhibitor compound 950. AM630: iodopravadoline, a
CB.sub.2 antagonist. AM251:
N-(piperidin-1-yl)-5-(4-iodophenyl)-1-(2,4-dichlorophenyl)-4-methy
1-1H-pyrazole-3-carboxamide, a CB.sub.1 antagonist. + sign: shows
experiment in which agent on corresponding horizontal line is
present. - sign: shows experiment in which agent on corresponding
horizontal line is absent. Line above bar shows error range. First
pair of bars shows control experiment in which LPS is not
administered.
DETAILED DESCRIPTION OF THE INVENTION
Introduction
[0015] The enzyme "soluble epoxide hydrolase" ("sEH") acts on an
important branch of the arachidonic acid pathway degrading
anti-inflammatory and analgesic metabolites.
cis-Epoxyeicosatrienoic acids" ("EETs") are biomediators
synthesized by cytochrome P450 epoxygenases, and are hydrolyzed by
sEH into the corresponding diols, which are pro-inflammatory.
[0016] Surprisingly, it has now been discovered that EETs bind to
the cannabinoid CB.sub.2 receptor, peripheral benzodiazepine
receptor ("PBR"), neurokinin NK.sub.2 receptor, and dopamine
D.sub.3 receptor. The binding data alone did not, however, reveal
whether EETs acted as agonists or antagonists of the biological
functions of the receptors or would block endogenous ligands of the
receptors from reaching them, thereby preventing normal activation
or antagonism of the receptors.
[0017] Surprisingly, the in vivo studies reported herein show that
EETs act as agonists for PBR and for CB.sub.2 receptors. Further,
the in vitro competitive binding assays reported herein show that
EETs displace known high affinity ligands of the PBR and
CB.sub.2.
[0018] The findings reported herein show the pharmacological effect
of increasing EETs in activating PBR activity. Persons of skill
will therefore appreciate that sEHIs, which are known to result in
increased levels of EETs, and EETs themselves, will activate PBR
activity when administered, and are therefore useful for treating
conditions in which modulating (and specifically, increasing) the
activity of PBR reduces or eliminates symptoms. Similarly, the
assays reported herein show the pharmacological effect of
increasing EETs in activating CB.sub.2 activity. Persons of skill
will therefore appreciate and expect that sEHIs, which are known to
result in increased levels of EETs, and EETs themselves, will
activate CB.sub.2 activity when administered, and are therefore
useful for treating conditions in which increasing CB.sub.2
activity reduces or eliminates symptoms.
[0019] The recognition that EETs binds to these molecular receptors
permits the use of EETs (and analogs of EETs that are not
susceptible or are less susceptible to hydrolysis by sEH) to
address conditions for which it was not previously known EETs could
be used. Further, since the administration of inhibitors of sEH
increases the levels of EETs present in the body, inhibitors of sEH
can also be administered, alone or in combination with EETs, to
increase EETs levels and therefore to address these conditions (for
convenience, inhibitors of sEH are sometimes alternatively referred
to herein as "sEHI").
[0020] A selective CB.sub.2 agonist has been shown to prevent the
growth of glioma through a CB.sub.2 dependant mechanism. In
addition CB.sub.2 receptors are known to modulate peripheral
nociceptive transmission. Further, a relationship between cell
proliferation and PBR expression has been observed in human
astrocytomas and breast cancer cell lines and PBR expression is
upregulated in many types of cancer. Similarly, PBR ligands induce
in vitro inhibition of cancer cell proliferation and modulate
steroidogenesis. The activation of PBR receptors reduces
proliferation through several mechanisms, such as that described
Carrier et al., Inhibition of an equilibrative nucleoside
transporter by cannabidiol: A mechanism of cannabinoid
immunosuppression, Proc Natl Acad Sci, 103:7895-7900 (2006).
Further, PBR ligands combined with cytotoxic agents have an
anti-tumor effect in in vivo models. Since the studies reported
herein reveal that EETs are agonists of both the PBR and the CB2
receptors, it is expected that they will work through both
mechanisms to slow or prevent proliferation of glioma, astrocytoma
and breast cancer cells, as well as other cancer cell types in
which PBR expression is upregulated. Accordingly, administration of
EETs, inhibitors of sEH, or both, can be administered to reduce the
rate of growth of glioma cells, astrocytoma cells, and breast
cancer cells, and other malignant tumor cells expressing PBR, and
especially those in which PBR expression is upregulated.
[0021] Further, agonists of PBR are known to act as anxiolytics.
This is presumably because of their ability to increase the acute
synthesis of neurosteroids such as allopregnanolone. sEHI and EETs
are therefore expected to act as anxiolytics to reduce symptoms of
anxiety. Without wishing to be bound by theory, this is expected to
be through modulating the endogenous neurosteroid tone. Since
administration of inhibitors of sEH to an individual increases the
level of EETs in the individual available to bind to the PBR during
the period the inhibitor is present and active in the individual,
inhibitors of sEH are also expected to act as anxiolytics.
Additionally, EETs, inhibitors of sEH, or both should be useful for
other indications in which anxiolytics are useful, including as a
premedication for inducing sedation, anxiolysis or amnesia prior to
certain medical procedures (e.g. endoscopy), as a means for
reducing panic attacks, and states of agitation, as a treatment for
status epilepticus, as adjunctive treatment of other forms of
epilepsy, for reducing symptoms of alcohol and opiate withdrawal,
for reducing insomnia, and for initial management of mania,
together with first line drugs like lithium, valproate or other
antipsychotics.
[0022] Since peripheral benzodiazepine receptors affect the rate of
steroidogenesis, EETs or sEHI, or both, can be administered to
affect the rate of steroidogenesis. In particular, EETs, or sEHI,
or both, can be administered to reduce serum cholesterol levels.
The EETs or sEHI, or both, can be used alone or in conjunction with
one or more statins to augment the effect of the statin or
statins.
[0023] Peripheral benzodiazepine receptors can also be targeted by
EETs to protect cells against oxygen radical damage. PER ligands
are known to decrease UV damage to cells and tissues. Accordingly,
it is expected that inhibitors of sEHI and EETs can be administered
to reduce UV damage and oxygen radical damage to cells. In some
embodiments, EETs or inhibitors of sEH are administered
systemically to protect cells against oxygen radical damage.
Persons of skill are well aware of the potential for skin damage
posed by prolonged exposure of skin to sunlight. In some
embodiments, EETs or inhibitors of sEH are administered topically,
for example by being mixed into a lotion, cream or other base
suitable for topical administration, to reduce UV damage in skin
exposed to sunlight. Conveniently, the cream or other base suitable
for topical administration also contains a sunscreen or sunblock,
such as oxybenzone, avobenzone, a cinnamate, octyl methoxycinnamate
(OMC), ethylhexyl p-methoxycinnamate, a salicylate, octyl
salicylate (OCS), para-aminobenzoic acid (PABA), padimate-O, octyl
dimethyl paba, octocrylene, zinc oxide, titanium dioxide,
benzophenone, or benzophenone-3. Sunscreens and sunblocks typically
work by physically blocking or absorbing UV radiation whereas, as
noted, EETs and inhibitors of sEH reduce UV damage. The two methods
of protecting skin are therefore complementary and the combination
of the two types of agent is expected to have at least additive,
and possibly synergistic, effects in protecting skin. For example,
EETs, inhibitors of sEH, or both can be administered to reduce the
effect of photo-aging (aging of skin because of UV damage) and to
reduce the likelihood of developing skin cancer due to repeated
exposure to UV light. Since exposure to ionizing radiation is also
believed to result in part from damage by oxygen radicals, EETs,
inhibitors of sEH, or both, can be used topically on persons
undergoing radiation therapy, particularly of the head and neck, to
reduce incidental damage to the skin during the exposure to the
radiation.
[0024] Neurokinin A ("NKA") and its receptor NK.sub.2 have a known
role in modulating gastric motility. In contrast to the PBR and
CB.sub.2 receptors, however, where it is activation of the receptor
that results in alleviating symptoms of the conditions listed
above, for the NK.sub.2 receptor it is reducing the activity of the
receptor that is associated with alleviating symptoms
therapeutically useful. For example, an antagonist of NKA activity
is currently in Phase II clinical trials for irritable bowel
syndrome ("IBS"), and the relationship between the activation of
the NK.sub.2 receptor and symptoms of IBS is well established in
the art. The studies reported herein show that EETs displace
ligands from the NK.sub.2 receptor. The ability of EETs to displace
endogenous ligands that would otherwise activate the receptor
results in downregulating NK.sub.2 receptor activity. Thus, EETs
act as antagonists of endogenous NK.sub.2 ligands and can be used
to reduce symptoms of conditions that result from or are aggravated
by, NK.sub.2 receptor activation, including IBS. The administration
of EETs or sEHI, or both, to persons suffering from IBS is
therefore expected to reduce those symptoms.
[0025] The studies in the Examples report the results of both in
vitro and in vivo assays. First, as shown in FIG. 1, an in vitro
assay using the high affinity PBR ligand PK 11195
1-(2-Chlorophenyl-N-methylpropyl)-3-isoquinolinecarboxamide, a
powerful PBR ligand. (See, Langer and Arbilla, Fund Clin Pharmacol
2(3):159-70 (1988)). The 5,6, 11,12, and 14,15 EETs all showed the
ability to completely inhibit the binding of PK11195 at millimolar
concentrations, while an EETs-me mixture inhibited PK11195 binding
at millimolar concentrations in a dose-dependent manner, while a
mixture of EETs-methylesters inhibited PK11195 binding more
potently than any individual EET. The Kd of PK 11195 is 2.7 nM,
while EETs displaced this high affinity ligand with an IC.sub.50 of
4.6 .mu.M for the EET me mixture.
[0026] The in vitro assays showed that EETs bind to PBR, but not
whether EETs act as agonists or as antagonists of the receptor, or
simply block the binding of other ligands which may have one of
these activities. To determine what effect, if any, EETs have on
the PBR, in vivo assays were performed. It is known that peripheral
benzodiazepine receptors affect the rate of steroidogenesis. We
have previously found that inhibitors of sEH have an effect as
analgesics using a well accepted animal model for measuring
analgesia. We hypothesized that sEHI-elicited analgesia was induced
through action on the PBR, and realized we could determine whether
determine whether EETs acted as an agonist of PBR, as an
antagonist, or as neither, by co-administering inhibitors of sEH
and compounds that are inhibitors of steroid synthesis and seeing
if they blocked sEH-elicited analgesia. Steroid synthesis
inhibitors have previously been shown to be antagonists of PBR.
See, e.g., Papadopoulos, et al., Peripheral-type benzodiazepine
receptor in neurosteroid biosynthesis, neuropathology and
neurological disorders, Neuroscience (138), p 749-756 (2006) and da
Silva et al., Involvement of steroids in anti-inflammatory effects
of PK11195 in a murine model of pleurisy. Mediators of Inflammation
(13), p 93-103 (2004).
[0027] In vivo assays were conducted using two different inhibitors
of steroid synthesis. The steroid synthesis inhibitor
aminogluthetimide (AGL), effectively blocks all steroid synthesis
by inhibiting the first enzyme, P450scc, in the steroid synthesis
pathway. When topically administered to rats, AGL completely
blocked the antihyperalgesic action of the sEHI AEPU in the
LPS-elicited inflammatory pain model. See, FIG. 2A. Additionally,
another inhibitor, finasteride, blocks 5.alpha. reductase and stops
the steroid biosynthesis by blocking the conversion of testosterone
to dihydrotestosterone in case of steroids and the conversion of
progesterone to allopregnanolone in case of neurosteroids.
Finasteride also blocked the anti-hyperalgesic activity of AEPU.
See, FIG. 2B. In contrast, however, in vivo assays employing a
non-steroidal estrogen receptor antagonist, tamoxifen, a dual
progesterone/glucocorticoid receptor antagonist, mifepristone, an
androgen receptor antagonist, nilutamide, and an aldosterone
receptor antagonist, spironolactone, showed that these antagonists
did not have any impact on the antihyperalgesic action of AEPU,
indicating that sEHIs and/or EETs do not act through these steroid
receptors. See, FIG. 4.
[0028] In vivo assays were also conducted to determine whether EETs
act to activate or to antagonize CB.sub.2 receptor activity. We
performed in vivo assays using antagonists of both CB.sub.1 and
CB.sub.2, essentially blocking the activity of these receptors, to
determine the contribution of cannabinoid receptor activation to
sEHI attained analgesia. As shown in FIG. 5, a CB.sub.1 antagonist,
AM251
(N-(piperidin-1-yl)-5-(4-iodophenyl)-1-(2,4-dichlorophenyl)-4-methy
1-1H-pyrazole-3-carboxamide, see, e.g., Gatley et al., Eur J
Pharmacol 1996 Jul. 4; 307(3):331-8 (1996)) did not block
sEHI-elicited analgesia, whereas a CB.sub.2 antagonist, AM630
(iodopravadoline, an aminoalkylindole, see, e.g., Pertwee et al.,
Life Sci. 56(23-24):1949-55 (1995)) completely blocked
sEHI-elicited analgesia. These assays established that if CB.sub.2
receptors are blocked by a selective CB.sub.2 antagonist such as
AM630, sEHIs can not elicit analgesia and that CB.sub.2 receptor
activation is required for the analgesic activity of sEHIs. In
contrast, elimination of the activity of CB.sub.1 receptors had no
impact on the analgesic activity of sEHIs.
[0029] Medicaments of EETs can be made which can be administered by
themselves or in conjunction with one or more sEH inhibitors, or a
medicament containing one or more sEH inhibitors can optionally
contain one or more EETs. The EETs can be administered alone, or
concurrently with a sEH inhibitor or following administration of a
sEH inhibitor. It is understood that, like all drugs, sEH
inhibitors have half lives defined by the rate at which they are
metabolized by or excreted from the body, and that the sEH
inhibitor will have a period following administration during which
it will be present in amounts sufficient to be effective. If EETs
administered after an sEH inhibitor are intended to be administered
while the sEH inhibition is still in effect, therefore, it is
desirable that the EETs be administered during the period during
which the inhibitor will be present in amounts to be effective to
delay hydrolysis of the EETs. Typically, in such a situation, the
EET or EETs will be administered within 48 hours of administering
an sEH inhibitor. More preferably, where the effect of the EET or
EETs is intended to be enhanced by the effect of an sEHI, the EET
or EETs are administered within 24 hours of the inhibitor, and even
more preferably within 12 hours. In increasing order of
desirability, the EET or EETs are administered within 10, 8, 6, 4,
2, hours, 1 hour, or one half hour after administration of the
inhibitor. Most preferably, the EET or EETs are administered
concurrently with the inhibitor. In some embodiments, the person
being treated with the EET or EETs does not have one of the
disorders listed above as a condition which the subject being
treated with an sEHI does not have. In some embodiments, the person
being treated with the EET or EETs is not being treated for
atherosclerosis, other inflammatory conditions, or other conditions
in which inhibition of adhesion molecule expression, particularly
on endothelial cells, is desirable.
[0030] In some embodiments, the sEH inhibitor may be a nucleic
acid, such as a small interfering RNA (siRNA) or a micro RNA
(miRNA), which reduces expression of a gene encoding sEH.
Optionally, EETs may be administered in combination with such a
nucleic acid. Typically, a study will determine the time following
administration of the nucleic acid before a decrease is seen in
levels of sEH. The EET or EETs are typically then administered at a
time calculated to be after expression of the nucleic acid has
resulted in a decrease in sEH levels.
Patients Who can Benefit from Use of EETs or sEHI or Both
[0031] In some embodiments of the invention, the person being
treated with EETs, sEHI, or both, does not have hypertension or is
not currently being treated with an anti-hypertension agent that is
an inhibitor of sEH. In some embodiments, the person being treated
does not have inflammation or, if he or she has inflammation, has
not been treated with an sEH inhibitor as an anti-inflammatory
agent. In some preferred embodiments, the person is being treated
for inflammation but by an anti-inflammatory agent, such as a
steroid, that is not an inhibitor of sEH. Whether or not any
particular anti-inflammatory or anti-hypertensive agent is also an
sEH inhibitor can be readily determined by standard assays, such as
those taught in U.S. Pat. No. 5,955,496.
[0032] In some embodiments, the patient's disease or condition is
not caused by an autoimmune disease or a disorder associated with a
T-lymphocyte mediated immune function autoimmune response. In some
embodiments, the patient does not have a pathological condition
selected from type 1 or type 2 diabetes, insulin resistance
syndrome, atherosclerosis, coronary artery disease, angina,
ischemia, ischemic stroke, Raynaud's disease, or renal disease. In
some embodiments, the patient is not a person with diabetes
mellitus whose blood pressure is 130/80 or less, a person with
metabolic syndrome whose blood pressure is less than 130/85, a
person with a triglyceride level over 215 mg/dL, or a person with a
cholesterol level over 200 mg/dL or is a person with one or more of
these conditions who is not taking an inhibitor of sEH. In some
embodiments, the patient does not have an obstructive pulmonary
disease, an interstitial lung disease, or asthma. In some
embodiments, the patient is not also currently being treated with
an inhibitor of one or more enzymes selected from the group
consisting of cyclo-oxygenase ("COX")-1, COX-2, and 5-lipoxygenase
("5-LOX"), or 5-lipoxygenase activating protein ("FLAP"). It is
noted that many people take a daily low dose of aspirin (e.g., 81
mg) to reduce their chance of heart attack, or take an occasional
aspirin to relieve a headache. It is not contemplated that persons
taking low dose aspirin to reduce the risk of heart attack would
ordinarily take that aspirin in combination with an EET or sEHI to
potentiate that effect. It is also not contemplated that persons
taking an occasional aspirin or ibuprofen tablet to relieve a
headache or other episodic minor aches or pain would ordinarily
take that tablet in combination with an EET or sEHI to potentiate
that pain relief, as opposed to persons seeking relief for chronic
pain from arthritis or other conditions requiring significant pain
relief over an extended period. In some embodiments, therefore, the
patient being treated by the methods of the invention may have
taken an inhibitor of COX-1, COX-2, or 5-LOX in low doses, or taken
such an inhibitor on an occasional basis to relieve an occasional
minor ache or pain. In some embodiments, the patient does not have
dilated cardiomyopathy or arrhythmia. In some embodiments, the
patient is not using EETs or sEHI topically for pain relief. In
some embodiments, the patient is not administering EETs or sEHI
topically to the eye to relieve, for example, dry eye syndrome or
intraocular pressure. In some embodiments, the patient does not
have glaucoma or is being treated for glaucoma with agents that do
not also inhibit sEH.
DEFINITIONS
[0033] Units, prefixes, and symbols are denoted in their Systeme
International de Unites (SI) accepted form. Numeric ranges are
inclusive of the numbers defining the range. Unless otherwise
indicated, nucleic acids are written left to right in 5' to 3'
orientation; amino acid sequences are written left to right in
amino to carboxy orientation. The headings provided herein are not
limitations of the various aspects or embodiments of the invention,
which can be had by reference to the specification as a whole.
Accordingly, the terms defined immediately below are more fully
defined by reference to the specification in its entirety. Terms
not defined herein have their ordinary meaning as understood by a
person of skill in the art.
[0034] "cis-Epoxyeicosatrienoic acids" ("EETs") are biomediators
synthesized by cytochrome P450 epoxygenases. As discussed further
in a separate section below, while the use of unmodified EETs is
the most preferred, derivatives of EETs, such as amides and esters
(both natural and synthetic), EETs analogs, and EETs optical
isomers can all be used in the methods of the invention, both in
pure form and as mixtures of these forms. For convenience of
reference, the term "EETs" as used herein refers to all of these
forms unless otherwise required by context.
[0035] "Epoxide hydrolases" ("EH;" EC 3.3.2.3) are enzymes in the
alpha beta hydrolase fold family that add water to 3-membered
cyclic ethers termed epoxides. The addition of water to the
epoxides results in the corresponding 1,2-diols (Hammock, B. D. et
al., in Comprehensive Toxicology Biotransformation (Elsevier, New
York), pp. 283-305 (1997); Oesch, F. Xenobiotica 3:305-340 (1972)).
Four principal EH's are known: leukotriene epoxide hydrolase,
cholesterol epoxide hydrolase, microsomal EH ("mEH"), and soluble
EH ("sEH," previously called cytosolic EH). The leukotriene EH acts
on leukotriene A4, whereas the cholesterol EH hydrates compounds
related to the 5,6-epoxide of cholesterol. The microsomal epoxide
hydrolase metabolizes monosubstituted, 1,1-disubstituted,
cis-1,2-disubstituted epoxides and epoxides on cyclic systems to
their corresponding diols. Because of its broad substrate
specificity, this enzyme is thought to play a significant role in
ameliorating epoxide toxicity. Reactions of detoxification
typically decrease the hydrophobicity of a compound, resulting in a
more polar and thereby excretable substance.
[0036] "Soluble epoxide hydrolase" ("sEH") is an epoxide hydrolase
which in many cell types converts EETs to dihydroxy derivatives
called dihydroxyeicosatrienoic acids ("DHETs"). The cloning and
sequence of the murine sEH is set forth in Grant et al., J. Biol.
Chem. 268(23):17628-17633 (1993). The cloning, sequence, and
accession numbers of the human sEH sequence are set forth in
Beetham et al., Arch. Biochem. Biophys. 305(1):197-201 (1993). The
amino acid sequence of human sEH is SEQ ID NO.:1, while the nucleic
acid sequence encoding the human sEH is SEQ ID NO.:2. (The sequence
set forth as SEQ ID NO.:2 is the coding portion of the sequence set
forth in the Beetham et al. 1993 paper and in the NCBI Entrez
Nucleotide Browser at accession number L05779, which include the 5'
untranslated region and the 3' untranslated region.) The evolution
and nomenclature of the gene is discussed in Beetham et al., DNA
Cell Biol. 14(1):61-71 (1995). Soluble epoxide hydrolase represents
a single highly conserved gene product with over 90% homology
between rodent and human (Arand et al., FEBS Lett., 338:251-256
(1994)). Soluble EH is only very distantly related to mEH and
hydrates a wide range of epoxides not on cyclic systems. In
contrast to the role played in the degradation of potential toxic
epoxides by mEH, sEH is believed to play a role in the formation or
degradation of endogenous chemical mediators. Unless otherwise
specified, as used herein, the terms "soluble epoxide hydrolase"
and "sEH" refer to human sEH.
[0037] Unless otherwise specified, as used herein, the term "sEH
inhibitor" (also abbreviated as "sEHI") refers to an inhibitor of
human sEH. Preferably, the inhibitor does not also inhibit the
activity of microsomal epoxide hydrolase by more than 25% at
concentrations at which the inhibitor inhibits sEH by at least 50%,
and more preferably does not inhibit mEH by more than 10% at that
concentration. For convenience of reference, unless otherwise
required by context, the term "sEH inhibitor" as used herein
encompasses prodrugs which are metabolized to active inhibitors of
sEH. Further for convenience of reference, and except as otherwise
required by context, reference herein to a compound as an inhibitor
of sEH includes reference to derivatives of that compound (such as
an ester of that compound) that retain activity as an sEH
inhibitor.
[0038] By "physiological conditions" is meant an extracellular
milieu having conditions (e.g., temperature, pH, and osmolarity)
which allows for the sustenance or growth of a cell of
interest.
[0039] "Micro-RNA" ("miRNA") refers to small, noncoding RNAs of
18-25 nt in length that negatively regulate their complementary
mRNAs at the posttranscriptional level in many eukaryotic
organisms. See, e.g., Kurihara and Watanabe, Proc Natl Acad Sci USA
101(34):12753-12758 (2004). Micro-RNA's were first discovered in
the roundworm C. elegans in the early 1990s and are now known in
many species, including humans. As used herein, it refers to
exogenously administered miRNA unless specifically noted or
otherwise required by context.
Neurokinin Receptors
[0040] Neurokinins are a family of regulatory peptides that are
widely distributed throughout the mammalian body where they are
known to act as neurotransmitters in both the central and
peripheral nervous systems. In the periphery, neuroknin receptors
are mostly found in capsaicin-sensitive sensory nerves, which are
now accepted not only to relay information to the central nervous
system, but also to release peptide neurotransmitters from the
efferent terminals; this release can bring about effects in
surrounding tissues. The mammalian tachykinins include substance P
(SP), neurokinin A (NKA) and neurokinin B (NKB) which
preferentially act at three G-protein-linked receptors termed
NK.sub.1, NK.sub.2 and NK.sub.3 respectively, though at high
concentrations they can act at all three receptors. Activation of
the neurokinin receptors can lead to a wide variety of biological
actions such as smooth muscle contraction, vasodilation, secretion,
neurogenic inflammation and activation of the immune system. One of
the known roles of NKA and its receptor NK.sub.2 is in modulating
gastric motility. The Neurokinin NK.sub.2 receptor is being
targeted by several pharmaceutical companies for treatment of
gastrointestinal disorders. For example, the Menarini Group
(Florence, Italy) has a NK.sub.2 antagonist, Nepadutant (a
glycosylated bicyclic peptide) in Phase II clinical trials for
bronchial hyperactivity and irritable bowel syndrome (IBS).
Hyperalgesia is due to sensitization of sensory receptors or
nociceptors. Visceral hyperalgesia has been recognized as the main
pathophysiological event underlying IBS symptoms. The proposed
mechanism of action of this compound is that in animal models of
IBS it corrects colon visceral hyperalgesia.
Cannabinoid Receptors
[0041] Cannabinoids, the active components of Cannabis saliva, and
their derivatives, exert a wide spectrum of central and peripheral
actions, such as analgesia, anticonvulsion, anti-inflammation, and
alleviation of both intraocular pressure and emesis. Two different
cannabinoid receptors have been characterized and cloned from
mammalian tissues, CB.sub.1 and CB.sub.2. CB.sub.1 is expressed
primarily in the central nervous system, whereas CB.sub.2 is
expressed primarily in cells of the immune system and is absent in
neurons of the central nervous system. Cannabinoid agonists
suppress nociceptive transmission and inhibit pain-related behavior
in animal models of acute and persistent nociception.
CB.sub.2-selective agonists fail to elicit centrally mediated
cannabimimetic effects such as hypothermia, catalepsy, and
hypoactivity and are unlikely to be psychoactive or addictive.
Activation of CB.sub.2 on non-neuronal cells in inflamed tissue is
postulated to suppress the release of inflammatory mediators
implicated in nociceptor sensitization. The recent development of
selective agonists and antagonists for CB.sub.2 has provided the
pharmacological tools necessary to evaluate the role of CB.sub.2 in
modulating persistent nociception. CB.sub.2-selective agonists have
recently been shown to induce antinociception in models of acute,
inflammatory, and nerve injury-induced nociception. AM1241, a
CB.sub.2-selective agonist, exhibits 340-fold selectivity for
CB.sub.2 over CB.sub.1. AM1241 also attenuates neuropathic pain
through a CB.sub.2 mechanism that is not dependent upon CB.sub.1.
Another selective CB.sub.2 agonist JWH-133 prevents the growth of
glioma through a CB.sub.2 dependant mechanism.
Peripheral Benzodiazepine Receptors
[0042] Two main functions of peripheral benzodiazepine receptors
("PBR") have been described: a role in steroidogenesis and
modulation of the apoptotic process. With respect to
steroidogenesis, PBR bind cholesterol and mediates its transport
from the outer to the inner mitochondrial membranes. This
translocation is the first and rate limiting step for steroid
synthesis. PBR activation results in an increase in pregnenolone
formation and the synthesis of downstream steroids. PBR are also
involved in human cancer cell proliferation. A relationship between
cell proliferation and PBR expression has been observed in human
astrocytomas and breast cancer cell lines. Similarly, PBR ligands
induce in vitro inhibition of cancer cell proliferation.
[0043] Turning to apoptosis, apoptosis (also referred to as
"programmed cell death") is mainly under the control of
mitochondria; and the mitochondrial permeability transition pore
plays a key role in this regulation. Mitochondrial membrane
permeabilization ("MMP") therefore is a major check-point in the
cascade of biochemical events leading to the induction of
programmed cell death. A number of apoptosis-inducing signals
induce MMP and anti-apoptotic proteins block this alteration. The
loss of mitochondrial membrane integrity leads to a drop of
transmembrane potential and remodeling of mitochondrial
ultra-structure that allow the release of toxic intermembrane
proteins into the cytoplasm such as cytochrome c. These apoptotic
effectors are then responsible for the late events of the cell
death process. The PTP therefore appears to be a multiprotein
complex whose molecular dynamics could be influenced by several
partners. PBR is one of these partners and can therefore be used as
a target in clinical and therapeutic approaches. Numerous
observations indicate that PBR participates in the regulation of
apoptosis: (i) transfection-enforced overexpression of PBR
attenuates apoptosis induced by oxygen radicals or ultraviolet
light, (ii) permeabilized mitochondria release DBI that binds
intact mitochondria and accelerates MMP induction throughout the
cell, (iii) the myxoma poxvirus M11L protein inhibits host cell
apoptosis via a physical and functional interaction with PBR, and
(iv) various PBR ligands with nanomolar affinity for the receptor,
such as Ro-4864 and PK11195, modulate cancer cell response to
apoptosis-inducing signals. PBR ligand-induced enhancement of
apoptosis clearly acts via mitochondrial targeting. PBR ligands
combined with cytotoxic agents have an anti-tumor effect in in vivo
models.
[0044] There is also evidence for a role played by PBR in
regulation of inflammation processes, as various in vivo mouse
models of acute inflammation have shown that PBR ligands inhibit
inflammatory signs of pleurisy, arthritis or lupus erythematosus.
These effects are thought to occur through (i) modulation of the
human natural killer cell activity, (ii) induction of heat shock
protein expression, (iii) modulation of the activity of
monocytes/macrophages and (iv) restoration of the apoptotic process
in auto-immune components. Other functions of PBR include
regulation of ischemia-reperfusion injury via membrane biogenesis,
protection of hematopoietic cells against oxygen radical damage,
lipid fluidity of mitochondria, modulation of bronchomotor tone,
erythroid differentiation, intracellular transport of heme and
porphyrins.
Irritable Bowel Syndrome
[0045] Irritable bowel syndrome, or IBS, is considered one of the
most common reasons people see their doctor in the U.S., accounting
for more than one out of every 10 doctor visits. According to the
National Digestive Diseases Information Clearinghouse, of the
National Institute of Diabetes and Digestive and Kidney Diseases
(NIDDK), IBS is a functional disorder that affects mainly the
bowel. IBS is characterized by over-sensitivity of the nerves and
muscles of the bowel, which typically results in cramping,
bloating, gas, diarrhea, and constipation. In persons with IBS,
symptoms can be triggered by stress, exercise, and hormones, as
well as by foods such as milk products, chocolate, alcohol,
caffeine, carbonated drinks, and fatty foods. Since there is no
cure, patients with IBS are usually treated to relieve symptoms, by
diet changes, medicine such as anti-spasmotics to slow bowel
contractions, and stress relief. One medication, alosetron
(5-methyl-2-[(4-methyl-1H-imidazol-5-yl)methyl]-3,4-dihydro-2H-pyrido[4,3-
-b]indol-1(5H)-one), a 5-HT.sub.4 antagonist used to block
serotonin activity in the intestinal tract, is currently only
approved for use in women with IBS in which diarrhea predominates,
but its use is sharply limited due to potentially serious side
effects on the gastrointestinal tract. A second, tegaserod
(1-{[5-(hydroxymethyl)-1H-indol-3-yl]methylideneamino}-2-pentyl-guanidine-
) is also a serotonin type 4 receptor ("5-HT.sub.4") partial
agonist and is approved for short-term use in women with IBS. Since
EETs bind to a different receptor than do alosetron and tegaserod,
the problems associated with the use of these agents, and with
alosetron in particular, are not expected with the uses and methods
of the present invention.
Inhibitors of Soluble Epoxide Hydrolase
[0046] Scores of sEH inhibitors are known, of a variety of chemical
structures. Derivatives in which the urea, carbamate, or amide
pharmacophore (as used herein, "pharmacophore" refers to the
section of the structure of a ligand that binds to the sEH) is
covalently bound to both an adamantane and to a 12 carbon chain
dodecane are particularly useful as sEH inhibitors. Derivatives
that are metabolically stable are preferred, as they are expected
to have greater activity in vivo. Selective and competitive
inhibition of sEH in vitro by a variety of urea, carbamate, and
amide derivatives is taught, for example, by Morisseau et al.,
Proc. Natl. Acad. Sci. U.S. A, 96:8849-8854 (1999), which provides
substantial guidance on designing urea derivatives that inhibit the
enzyme.
[0047] Derivatives of urea are transition state mimetics that form
a preferred group of sEH inhibitors. Within this group,
N,N'-dodecyl-cyclohexyl urea (DCU), is preferred as an inhibitor,
while N-cyclohexyl-N'-dodecylurea (CDU) is particularly preferred.
Some compounds, such as dicyclohexylcarbodiimide (a lipophilic
diimide), can decompose to an active urea inhibitor such as DCU.
Any particular urea derivative or other compound can be easily
tested for its ability to inhibit sEH by standard assays, such as
those discussed herein. The production and testing of urea and
carbamate derivatives as sEH inhibitors is set forth in detail in,
for example, Morisseau et al., Proc Natl Acad Sci (USA)
96:8849-8854 (1999).
[0048] N-Adamantyl-N'-dodecyl urea ("ADU") is both metabolically
stable and has particularly high activity on sEH. (Both the 1- and
the 2-adamantyl ureas have been tested and have about the same high
activity as an inhibitor of sEH.) Thus, isomers of adamantyl
dodecyl urea are preferred inhibitors. It is further expected that
N,N'-dodecyl-cyclohexyl urea (DCU), and other inhibitors of sEH,
and particularly dodecanoic acid ester derivatives of urea, are
suitable for use in the methods of the invention. Preferred
inhibitors include:
12-(3-Adamantan-1-yl-ureido)dodecanoic acid (AUDA),
##STR00001##
12-(3-Adamantan-1-yl-ureido)dodecanoic acid butyl ester
(AUDA-BE),
##STR00002##
Adamantan-1-yl-3-{5-[2-(2-ethoxyethoxy)ethoxy}pentyl]urea (compound
950, also referred to herein as "AEPU"), and
##STR00003##
[0049] Another preferred group of inhibitors are piperidines. The
following Table sets forth some exemplar piperidines and their
ability to inhibit sEH activity, expressed as the amount needed to
reduce the activity of the enzyme by 50% (expressed as
"IC.sub.50").
TABLE-US-00001 TABLE 1 IC.sub.50 values for selected
alkylpiperidine-based sEH inhibitors ##STR00004## n = 0 n = 1
Compound IC.sub.50 (.mu.M).sup.a Compound IC.sub.50 (.mu.M).sup.a
R: H I 0.30 II 4.2 ##STR00005## 3a 3.8 4.a 3.9 ##STR00006## 3b 0.81
4b 2.6 ##STR00007## 3c 1.2 4c 0.61 ##STR00008## 3d 0.01 4d 0.11
.sup.aAs determined via a kinetic fluorescent assay.
[0050] A number of other sEH inhibitors which can be used in the
methods and compositions of the invention are set forth in co-owned
applications PCT/US2004/010298 and U.S. Published Patent
Application Publication 2005/0026844.
[0051] U.S. Pat. No. 5,955,496 (the '496 patent) also sets forth a
number of sEH inhibitors which can be use in the methods of the
invention. One category of these inhibitors comprises inhibitors
that mimic the substrate for the enzyme. The lipid alkoxides (e.g.,
the 9-methoxide of stearic acid) are an exemplar of this group of
inhibitors. In addition to the inhibitors discussed in the '496
patent, a dozen or more lipid alkoxides have been tested as sEH
inhibitors, including the methyl, ethyl, and propyl alkoxides of
oleic acid (also known as stearic acid alkoxides), linoleic acid,
and arachidonic acid, and all have been found to act as inhibitors
of sEH.
[0052] In another group of embodiments, the '496 patent sets forth
sEH inhibitors that provide alternate substrates for the enzyme
that are turned over slowly. Exemplars of this category of
inhibitors are phenyl glycidols (e.g., S,S-4-nitrophenylglycidol),
and chalcone oxides. The '496 patent notes that suitable chalcone
oxides include 4-phenylchalcone oxide and 4-fluourochalcone oxide.
The phenyl glycidols and chalcone oxides are believed to form
stable acyl enzymes.
[0053] Additional inhibitors of sEH suitable for use in the methods
of the invention are set forth in U.S. Pat. Nos. 6,150,415 (the
'415 patent) and 6,531,506 (the '506 patent). Two preferred classes
of inhibitors of the invention are compounds of Formulas 1 and 2,
as described in the '415 and '506 patents. Means for preparing such
compounds and assaying desired compounds for the ability to inhibit
epoxide hydrolases are also described. The '506 patent, in
particular, teaches scores of inhibitors of Formula 1 and some
twenty inhibitors of Formula 2, which were shown to inhibit human
sEH at concentrations as low as 0.1 .mu.M. Any particular inhibitor
can readily be tested to determine whether it will work in the
methods of the invention by standard assays. Esters and salts of
the various compounds discussed above or in the cited patents, for
example, can be readily tested by these assays for their use in the
methods of the invention.
[0054] As noted above, chalcone oxides can serve as an alternate
substrate for the enzyme. While chalcone oxides have half lives
which depend in part on the particular structure, as a group the
chalcone oxides tend to have relatively short half lives (a drug's
half life is usually defined as the time for the concentration of
the drug to drop to half its original value. See, e.g., Thomas, G.,
Medicinal Chemistry: an introduction, John Wiley & Sons Ltd.
(West Sussex, England, 2000)). Since the various uses of the
invention contemplate inhibition of sEH over differing periods of
time which can be measured in days, weeks, or months, chalcone
oxides, and other inhibitors which have a half life whose duration
is shorter than the practitioner deems desirable, are preferably
administered in a manner which provides the agent over a period of
time. For example, the inhibitor can be provided in materials that
release the inhibitor slowly. Methods of administration that permit
high local concentrations of an inhibitor over a period of time are
known, and are not limited to use with inhibitors which have short
half lives although, for inhibitors with a relatively short half
life, they are a preferred method of administration.
[0055] In addition to the compounds in Formula 1 of the '506
patent, which interact with the enzyme in a reversible fashion
based on the inhibitor mimicking an enzyme-substrate transition
state or reaction intermediate, one can have compounds that are
irreversible inhibitors of the enzyme. The active structures such
as those in the Tables or Formula 1 of the '506 patent can direct
the inhibitor to the enzyme where a reactive functionality in the
enzyme catalytic site can form a covalent bond with the inhibitor.
One group of molecules which could interact like this would have a
leaving group such as a halogen or tosylate which could be attacked
in an SN2 manner with a lysine or histidine. Alternatively, the
reactive functionality could be an epoxide or Michael acceptor such
as an .alpha./.beta.-unsaturated ester, aldehyde, ketone, ester, or
nitrile.
[0056] Further, in addition to the Formula 1 compounds, active
derivatives can be designed for practicing the invention. For
example, dicyclohexyl thio urea can be oxidized to
dicyclohexylcarbodiimide which, with enzyme or aqueous acid
(physiological saline), will form an active dicyclohexylurea.
Alternatively, the acidic protons on carbamates or ureas can be
replaced with a variety of substituents which, upon oxidation,
hydrolysis or attack by a nucleophile such as glutathione, will
yield the corresponding parent structure. These materials are known
as prodrugs or protoxins (Gilman et al., The Pharmacological Basis
of Therapeutics, 7th Edition, MacMillan Publishing Company, New
York, p. 16 (1985)) Esters, for example, are common prodrugs which
are released to give the corresponding alcohols and acids
enzymatically (Yoshigae et al., Chirality, 9:661-666 (1997)). The
drugs and prodrugs can be chiral for greater specificity. These
derivatives have been extensively used in medicinal and
agricultural chemistry to alter the pharmacological properties of
the compounds such as enhancing water solubility, improving
formulation chemistry, altering tissue targeting, altering volume
of distribution, and altering penetration. They also have been used
to alter toxicology profiles.
[0057] There are many prodrugs possible, but replacement of one or
both of the two active hydrogens in the ureas described here or the
single active hydrogen present in carbamates is particularly
attractive. Such derivatives have been extensively described by
Fukuto and associates. These derivatives have been extensively
described and are commonly used in agricultural and medicinal
chemistry to alter the pharmacological properties of the compounds.
(Black et al., Journal of Agricultural and Food Chemistry,
21(5):747-751 (1973); Fahmy et al, Journal of Agricultural and Food
Chemistry, 26(3):550-556 (1978); Jojima et al., Journal of
Agricultural and Food Chemistry, 31(3):613-620 (1983); and Fahmy et
al., Journal of Agricultural and Food Chemistry, 29(3):567-572
(1981).)
[0058] Such active proinhibitor derivatives are within the scope of
the present invention, and the just-cited references are
incorporated herein by reference. Without being bound by theory, it
is believed that suitable inhibitors of the invention mimic the
enzyme transition state so that there is a stable interaction with
the enzyme catalytic site. The inhibitors appear to form hydrogen
bonds with the nucleophilic carboxylic acid and a polarizing
tyrosine of the catalytic site.
[0059] In some embodiments, the sEH inhibitor used in the methods
taught herein is a "soft drug." Soft drugs are compounds of
biological activity that are rapidly inactivated by enzymes as they
move from a chosen target site. EETs and simple biodegradable
derivatives administered to an area of interest may be considered
to be soft drugs in that they are likely to be enzymatically
degraded by sEH as they diffuse away from the site of interest
following administration. Some sEHI, however, may diffuse or be
transported following administration to regions where their
activity in inhibiting sEH may not be desired. Thus, multiple soft
drugs for treatment have been prepared. These include but are not
limited to carbamates, esters, carbonates and amides placed in the
sEHI, approximately 7.5 angstroms from the carbonyl of the central
pharmacophore. These are highly active sEHI that yield biologically
inactive metabolites by the action of esterase and/or amidase.
Groups such as amides and carbamates on the central pharmacophores
can also be used to increase solubility for applications in which
that is desirable in forming a soft drug. Similarly, easily
metabolized ethers may contribute soft drug properties and also
increase the solubility.
[0060] In some embodiments, sEH inhibition can include the
reduction of the amount of sEH. As used herein, therefore, sEH
inhibitors can therefore encompass nucleic acids that inhibit
expression of a gene encoding sEH. Many methods of reducing the
expression of genes, such as reduction of transcription and siRNA,
are known, and are discussed in more detail below.
[0061] Preferably, the inhibitor inhibits sEH without also
significantly inhibiting microsomal epoxide hydrolase ("mEH").
Preferably, at concentrations of 500 .mu.M, the inhibitor inhibits
sEH activity by at least 50% while not inhibiting mEH activity by
more than 10%. Preferred compounds have an IC.sub.50 (inhibition
potency or, by definition, the concentration of inhibitor which
reduces enzyme activity by 50%) of less than about 500 .mu.M.
Inhibitors with IC.sub.50s of less than 500 .mu.M are preferred,
with IC.sub.50s of less than 100 .mu.M being more preferred and, in
order of increasing preference, an IC50 of 50 .mu.M, 40 .mu.M, 30
.mu.M, 25 .mu.M, 20 .mu.M, 15 .mu.M, 10 .mu.M, 5 .mu.M, 3 .mu.M, 2
.mu.M, 1 .mu.M or even less being still more preferred. Assays for
determining sEH activity are known in the art and described
elsewhere herein.
EETs
[0062] EETs, which are epoxides of arachidonic acid, are known to
be effectors of blood pressure, regulators of inflammation, and
modulators of vascular permeability. Hydrolysis of the epoxides by
sEH diminishes this activity. Inhibition of sEH raises the level of
EETs since the rate at which the EETs are hydrolyzed into
dihydroxyeicosatrienoic acids ("DHETs") is reduced.
[0063] It has long been believed that EETs administered
systemically would be hydrolyzed too quickly by endogenous sEH to
be helpful. For example, in one prior report of EETs
administration, EETs were administered by catheters inserted into
mouse aortas. The EETs were infused continuously during the course
of the experiment because of concerns over the short half life of
the EETs. See, Liao and Zeldin, International Publication WO
01/10438 (hereafter "Liao and Zeldin"). It also was not known
whether endogenous sEH could be inhibited sufficiently in body
tissues to permit administration of exogenous EET to result in
increased levels of EETs over those normally present. Further, it
was thought that EETs, as epoxides, would be too labile to survive
the storage and handling necessary for therapeutic use.
[0064] In studies from the laboratory of the present inventors,
however, it has been shown that systemic administration of EETs in
conjunction with inhibitors of sEH had better results than did
administration of sEH inhibitors alone. EETs were not administered
by themselves in these studies since it was anticipated they would
be degraded too quickly to have a useful effect. Additional studies
from the laboratory of the present inventors have since shown,
however, that administration of EETs by themselves has had
therapeutic effect. Without wishing to be bound by theory, it is
surmised that the exogenous EET overwhelms endogenous sEH, and
allows EETs levels to be increased for a sufficient period of time
to have therapeutic effect. Thus, EETs can be administered without
also administering an sEHI to provide a therapeutic effect.
Moreover, we have found that EETs, if not exposed to acidic
conditions or to sEH are stable and can withstand reasonable
storage, handling and administration.
[0065] In short, sEHI, EETs, or co-administration of sEHIs and of
EETs, can be used in the methods of the present invention. In some
embodiments, one or more EETs are administered to the patient
without also administering an sEHI. In some embodiments, one or
more EETs are administered shortly before or concurrently with
administration of an sEH inhibitor to slow hydrolysis of the EET or
EETs. In some embodiments, one or more EETs are administered after
administration of an sEH inhibitor, but before the level of the
sEHI has diminished below a level effective to slow the hydrolysis
of the EETs.
[0066] EETs useful in the methods of the present invention include
14,15-LET, 8,9-EET and 11,12-EET, and 5,6 EETs. Preferably, the
EETs are administered as the methyl ester, which is more stable.
Persons of skill will recognize that the EETs are regioisomers,
such as 8S,9R- and 14R,15S-EET. 8,9-EET, 11,12-EET, and
14R,15S-EET, are commercially available from, for example,
Sigma-Aldrich (catalog nos. E5516, E5641, and E5766, respectively,
Sigma-Aldrich Corp., St. Louis, Mo.).
[0067] If desired, EETs, analogs, or derivatives that retain
activity can be used in place of or in combination with unmodified
EETs. Liao and Zeldin, supra, define EET analogs as compounds with
structural substitutions or alterations in an EET, and include
structural analogs in which one or more EET olefins are removed or
replaced with acetylene or cyclopropane groups, analogs in which
the epoxide moiety is replaced with oxitane or furan rings and
heteroatom analogs. In other analogs, the epoxide moiety is
replaced with ether, alkoxides, difluorocycloprane, or carbonyl,
while in others, the carboxylic acid moiety is replaced with a
commonly used mimic, such as a nitrogen heterocycle, a sulfonamide,
or another polar functionality. In preferred forms, the analogs or
derivatives are relatively stable as compared to an unmodified EET
because they are more resistant than an unmodified EET to sEH and
to chemical breakdown. "Relatively stable" means the rate of
hydrolysis by sEH is at least 25% less than the hydrolysis of the
unmodified EET in a hydrolysis assay, and more preferably 50% or
more lower than the rate of hydrolysis of an unmodified EET. Liao
and Zeldin show, for example, episulfide and sulfonamide EETs
derivatives. Amide and ester derivatives of EETs and that are
relatively stable are preferred embodiments. In preferred forms,
the analogs or derivatives have the biological activity of the
unmodified EET regioisomer from which it is modified or derived in
binding to the CB2 or peripheral BZD receptor. Whether or not a
particular EET analog or derivative has the biological activity of
the unmodified EET can be readily determined by using it in
standard assays, such as radio-ligand competition assays to measure
binding to the relevant receptor. As mentioned in the Definition
section, above, for convenience of reference, the term "EETs" as
used herein refers to unmodified EETs, and EETs analogs and
derivatives unless otherwise required by context.
[0068] In some embodiments, the EET or EETs are embedded or
otherwise placed in a material that releases the EET over time.
Materials suitable for promoting the slow release of compositions
such as EETs are known in the art. Optionally, one or more sEH
inhibitors may also be placed in the slow release material.
[0069] Conveniently, the EET or EETs can be administered orally.
Since EETs are subject to degradation under acidic conditions, EETs
intended for oral administration can be coated with a coating
resistant to dissolving under acidic conditions, but which dissolve
under the mildly basic conditions present in the intestines.
Suitable coatings, commonly known as "enteric coatings" are widely
used for products, such as aspirin, which cause gastric distress or
which would undergo degradation upon exposure to gastric acid. By
using coatings with an appropriate dissolution profile, the coated
substance can be released in a chosen section of the intestinal
tract. For example, a substance to be released in the colon is
coated with a substance that dissolves at pH 6.5-7, while
substances to be released in the duodenum can be coated with a
coating that dissolves at pH values over 5.5. Such coatings are
commercially available from, for example, Rohm Specialty Acrylics
(Rohm America LLC, Piscataway, N.J.) under the trade name
"Eudragit.RTM.". The choice of the particular enteric coating is
not critical to the practice of the invention.
Assays for Epoxide Hydrolase Activity
[0070] Any of a number of standard assays for determining epoxide
hydrolase activity can be used to determine inhibition of sEH. For
example, suitable assays are described in Gill, et al., Anal
Biochem 131:273-282 (1983); and Borhan, et al., Analytical
Biochemistry 231:188-200 (1995)). Suitable in vitro assays are
described in Zeldin et al., J. Biol. Chem. 268:6402-6407 (1993).
Suitable in vivo assays are described in Zeldin et al., Arch
Biochem Biophys 330:87-96 (1996). Assays for epoxide hydrolase
using both putative natural substrates and surrogate substrates
have been reviewed (see, Hammock, et al. In: Methods in Enzymology,
Volume III, Steroids and Isoprenoids, Part B, (Law, J. H. and H. C.
Rifling, eds. 1985), Academic Press, Orlando, Fla., pp. 303-311 and
Wixtrom et al., In: Biochemical Pharmacology and Toxicology, Vol.
1: Methodological Aspects of Drug Metabolizing Enzymes, (Zakim, D.
and D. A. Vessey, eds. 1985), John Wiley & Sons, Inc., New
York, pp. 1-93. Several spectral based assays exist based on the
reactivity or tendency of the resulting diol product to hydrogen
bond (see, e.g., Wixtrom, supra, and Hammock. Anal. Biochem.
174:291-299 (1985) and Dietze, et al. Anal. Biochem. 216:176-187
(1994)).
[0071] The enzyme also can be detected based on the binding of
specific ligands to the catalytic site which either immobilize the
enzyme or label it with a probe such as dansyl, fluoracein,
luciferase, green fluorescent protein or other reagent. The enzyme
can be assayed by its hydration of EETs, its hydrolysis of an
epoxide to give a colored product as described by Dietze et al.,
1994, supra, or its hydrolysis of a radioactive surrogate substrate
(Borhan et al., 1995, supra). The enzyme also can be detected based
on the generation of fluorescent products following the hydrolysis
of the epoxide. Numerous method of epoxide hydrolase detection have
been described (see, e.g., Wixtrom, supra).
[0072] The assays are normally carried out with a recombinant
enzyme following affinity purification. They can be carried out in
crude tissue homogenates, cell culture or even in vivo, as known in
the art and described in the references cited above.
Other Means of Inhibiting sEH Activity
[0073] Other means of inhibiting sEH activity or gene expression
can also be used in the methods of the invention. For example, a
nucleic acid molecule complementary to at least a portion of the
human sEH gene can be used to inhibit sEH gene expression. Means
for inhibiting gene expression using short RNA molecules, for
example, are known. Among these are short interfering RNA (siRNA),
small temporal RNAs (stRNAs), and micro-RNAs (miRNAs). Short
interfering RNAs silence genes through a mRNA degradation pathway,
while stRNAs and miRNAs are approximately 21 or 22 nt RNAs that are
processed from endogenously encoded hairpin-structured precursors,
and function to silence genes via translational repression. See,
e.g., McManus et al., RNA, 8(6):842-50 (2002); Morris et al.,
Science, 305(5688):1289-92 (2004); He and Hannon, Nat Rev Genet.
5(7):522-31 (2004).
[0074] "RNA interference," a form of post-transcriptional gene
silencing ("PTGS"), describes effects that result from the
introduction of double-stranded RNA into cells (reviewed in Fire,
A. Trends Genet 15:358-363 (1999); Sharp, P. Genes Dev 13:139-141
(1999); Hunter, C. Curr Biol 9:R440-R442 (1999); Baulcombe. D. Curr
Biol 9:R599-R601 (1999); Vaucheret et al. Plant J 16: 651-659
(1998)). RNA interference, commonly referred to as RNAi, offers a
way of specifically inactivating a cloned gene, and is a powerful
tool for investigating gene function.
[0075] The active agent in RNAi is a long double-stranded
(antiparallel duplex) RNA, with one of the strands corresponding or
complementary to the RNA which is to be inhibited. The inhibited
RNA is the target RNA. The long double stranded RNA is chopped into
smaller duplexes of approximately 20 to 25 nucleotide pairs, after
which the mechanism by which the smaller RNAs inhibit expression of
the target is largely unknown at this time. While RNAi was shown
initially to work well in lower eukaryotes, for mammalian cells, it
was thought that RNAi might be suitable only for studies on the
oocyte and the preimplantation embryo.
[0076] In mammalian cells other than these, however, longer RNA
duplexes provoked a response known as "sequence non-specific RNA
interference," characterized by the non-specific inhibition of
protein synthesis.
[0077] Further studies showed this effect to be induced by dsRNA of
greater than about 30 base pairs, apparently due to an interferon
response. It is thought that dsRNA of greater than about 30 base
pairs binds and activates the protein PKR and 2',5'-oligonucleotide
synthetase (2',5'-AS). Activated PKR stalls translation by
phosphorylation of the translation initiation factors eIF2.alpha.,
and activated 2',5'-AS causes mRNA degradation by
2',5'-oligonucleotide-activated ribonuclease L. These responses are
intrinsically sequence-nonspecific to the inducing dsRNA; they also
frequently result in apoptosis, or cell death. Thus, most somatic
mammalian cells undergo apoptosis when exposed to the
concentrations of dsRNA that induce RNAi in lower eukaryotic
cells.
[0078] More recently, it was shown that RNAi would work in human
cells if the RNA strands were provided as pre-sized duplexes of
about 19 nucleotide pairs, and RNAi worked particularly well with
small unpaired 3' extensions on the end of each strand (Elbashir et
al. Nature 411: 494-498 (2001)). In this report, "short interfering
RNA" (siRNA, also referred to as small interfering RNA) were
applied to cultured cells by transfection in oligofectamine
micelles. These RNA duplexes were too short to elicit
sequence-nonspecific responses like apoptosis, yet they efficiently
initiated RNAi. Many laboratories then tested the use of siRNA to
knock out target genes in mammalian cells. The results demonstrated
that siRNA works quite well in most instances.
[0079] For purposes of reducing the activity of sEH, siRNAs to the
gene encoding sEH can be specifically designed using computer
programs. The cloning, sequence, and accession numbers of the human
sEH sequence are set forth in Beetham et al., Arch. Biochem.
Biophys. 305(1):197-201 (1993). The amino acid sequence of human
sEH (SEQ ID NO:1) and the nucleotide sequence encoding that amino
acid sequence (SEQ ID NO.:2) are set forth in U.S. Pat. No.
5,445,956.
[0080] A program, siDESIGN from Dharmacon, Inc. (Lafayette, Colo.),
permits predicting siRNAs for any nucleic acid sequence, and is
available on the World Wide Web at dharmacon.com. Programs for
designing siRNAs are also available from others, including
Genscript (available on the Web at genscript.com/ssl-bin/app/rnai)
and, to academic and non-profit researchers, from the Whitehead
Institute for Biomedical Research on the internet by entering
"http://" followed by
"jura.wi.mit.edu/pubint/http://iona.wi.mit.edu/siRNAext/."
[0081] For example, using the program available from the Whitehead
Institute, the following sEH target sequences and siRNA sequences
can be generated:
TABLE-US-00002 1) (SEQ ID NO: 3) Target: CAGTGTTCATTGGCCATGACTGG
(SEQ ID NO: 4) Sense-siRNA: 5'-GUGUUCAUUGGCCAUGACUTT-3' (SEQ ID NO:
5) Antisense-siRNA: 5'-AGUCAUGGCCAAUGAACACTT-3' 2) (SEQ ID NO: 6)
Target: GAAAGGCTATGGAGAGTCATCTG (SEQ ID NO: 7) Sense-siRNA:
5'-AAGGCUAUGGAGAGUCAUCTT-3' (SEQ ID NO: 8) Antisense-siRNA:
5'-GAUGACUCUCCAUAGCCUUTT-3' 3) (SEQ ID NO: 9) Target
AAAGGCTATGGAGAGTCATCTGC (SEQ ID NO: 10) Sense-siRNA:
5'-AGGCUAUGGAGAGUCAUCUTT-3' (SEQ ID NO: 11) Antisense-siRNA:
5'-AGAUGACUCUCCAUAGCCUTT-3' 4) (SEQ ID NO: 12) Target:
CAAGCAGTGTTCATTGGCCATGA (SEQ ID NO: 13 Sense-siRNA:
5'-AGCAGUGUUCAUUGGCCAUTT-3' (SEQ ID NO: 14 Antisense-siRNA:
5'-AUGGCCAAUGAACACUGCUTT-3' 5) (SEQ ID NO: 15) Target:
CAGCACATGGAGGACTGGATTCC (SEQ ID NO: 16) Sense-siRNA:
5'-GCACAUGGAGGACUGGAUUTT-3' (SEQ ID NO: 17) Antisense-siRNA:
5'-AAUCCAGUCCUCCAUGUGCTT-3'
[0082] Alternatively, siRNA can be generated using kits which
generate siRNA from the gene. For example, the "Dicer siRNA
Generation" kit (catalog number T510001, Gene Therapy Systems,
Inc., San Diego, Calif.) uses the recombinant human enzyme "dicer"
in vitro to cleave long double stranded RNA into 22 bp siRNAs. By
having a mixture of siRNAs, the kit permits a high degree of
success in generating siRNAs that will reduce expression of the
target gene. Similarly, the Silencer.TM. siRNA Cocktail Kit (RNase
III) (catalog no. 1625, Ambion, Inc., Austin, Tex.) generates a
mixture of siRNAs from dsRNA using RNase III instead of dicer. Like
dicer, RNase III cleaves dsRNA into 12-30 bp dsRNA fragments with 2
to 3 nucleotide 3' overhangs, and 5'-phosphate and 3'-hydroxyl
termini. According to the manufacturer, dsRNA is produced using T7
RNA polymerase, and reaction and purification components included
in the kit. The dsRNA is then digested by RNase III to create a
population of siRNAs. The kit includes reagents to synthesize long
dsRNAs by in vitro transcription and to digest those dsRNAs into
siRNA-like molecules using RNase III. The manufacturer indicates
that the user need only supply a DNA template with opposing T7
phage polymerase promoters or two separate templates with promoters
on opposite ends of the region to be transcribed.
[0083] The siRNAs can also be expressed from vectors. Typically,
such vectors are administered in conjunction with a second vector
encoding the corresponding complementary strand. Once expressed,
the two strands anneal to each other and form the functional double
stranded siRNA. One exemplar vector suitable for use in the
invention is pSuper, available from OligoEngine, Inc. (Seattle,
Wash.). In some embodiments, the vector contains two promoters, one
positioned downstream of the first and in antiparallel orientation.
The first promoter is transcribed in one direction, and the second
in the direction antiparallel to the first, resulting in expression
of the complementary strands. In yet another set of embodiments,
the promoter is followed by a first segment encoding the first
strand, and a second segment encoding the second strand. The second
strand is complementary to the palindrome of the first strand.
Between the first and the second strands is a section of RNA
serving as a linker (sometimes called a "spacer") to permit the
second strand to bend around and anneal to the first strand, in a
configuration known as a "hairpin."
[0084] The formation of hairpin RNAs, including use of linker
sections, is well known in the art. Typically, an siRNA expression
cassette is employed, using a Polymerase III promoter such as human
U6, mouse U6, or human H1. The coding sequence is typically a
19-nucleotide sense siRNA sequence linked to its reverse
complementary antisense siRNA sequence by a short spacer.
Nine-nucleotide spacers are typical, although other spacers can be
designed. For example, the Ambion website indicates that its
scientists have had success with the spacer TTCAAGAGA (SEQ ID
NO:18). Further, 5-6 T's are often added to the 3' end of the
oligonucleotide to serve as a termination site for Polymerase III.
See also, Yu et al., Mol Ther 7(2):228-36 (2003); Matsukura et al.,
Nucleic Acids Res 31(15):e77 (2003).
[0085] As an example, the siRNA targets identified above can be
targeted by hairpin siRNA as follows. To attack the same targets by
short hairpin RNAs, produced by a vector (permanent RNAi effect),
sense and antisense strand can be put in a row with a loop forming
sequence in between and suitable sequences for an adequate
expression vector to both ends of the sequence. The following are
non-limiting examples of hairpin sequences that can be cloned into
the pSuper vector:
TABLE-US-00003 1) Target: (SEQ ID NO: 19) CAGTGTTCATTGGCCATGACTGG
Sense strand: (SEQ ID NO: 20) 5'-GATCCCCGTGTTCATTGGCCATGACTTTCAA
GAGAAGTCATGGCCAATGAACACTTTTT-3' Antisense strand: (SEQ ID NO: 21)
5'-AGCTAAAAAGTGTTCATTGGCCATGACTTCTCTT GAAAGTCATGGCCAATGAACACGGG-3'
2) Target: (SEQ ID NO: 22) GAAAGGCTATGGAGAGTCATCTG Sense strand:
(SEQ ID NO: 23) 5'-GATCCCCAAGGCTATGGAGAGTCATCTTCAAGAGAGA
TGACTCTCCATAGCCTTTTTTT-3' Antisense strand: (SEQ ID NO: 24)
5'-AGCTAAAAAAAGGCTATGGAGAGTCATCTCTCTTGAA GATGACTCTCCATAGCCTTGGG-3'
3) Target: (SEQ ID NO: 25) AAAGGCTATGGAGAGTCATCTGC Sense strand:
(SEQ ID NO: 26) 5'-GATCCCCAGGCTATGGAGAGTCATCTTTCAAGAGAAG
ATGACTCTCCATAGCCTTTTTT-3' Antisense strand: (SEQ ID NO: 27)
5'-AGCTAAAAAAGGCTATGGAGAGTCATCATCTCTTGAAAGATGACTCT CCATAGCCTGGG-3'
4) Target: (SEQ ID NO: 28) CAAGCAGTGTTCATTGGCCATGA Sense strand:
(SEQ ID NO: 29) 5'-GATCCCCAGCAGTGTTCATTGGCCATTTCAAGAGAATG
GCCAATGAACACTGCTTTTTT-3' Antisense strand: (SEQ ID NO: 30)
5'-AGCTAAAAAAGCAGTGTTCATTGGCCATTCTCTTGAAATG GCCAATGAACACTGCTGGG-3'
5) Target: (SEQ ID NO: 31) CAGCACATGGAGGACTGGATTCC Sense strand
(SEQ ID NO: 32) 5'-GATCCCCGCACATGGAGGACTGGATTTTCAAGAGAAATC
CAGTCCTCCATGTGCTTTTT-3' Antisense strand: (SEQ ID NO: 33)
5'-AGCTAAAAAGCACATGGAGGACTGGATTTCTCTTGAAAA
TCCAGTCCTCCATGTGCGGG-3'
[0086] In addition to siRNAs, other means are known in the art for
inhibiting the expression of antisense molecules, ribozymes, and
the like are well known to those of skill in the art. The nucleic
acid molecule can be a DNA probe, a riboprobe, a peptide nucleic
acid probe, a phosphorothioate probe, or a 2'-O methyl probe.
[0087] Generally, to assure specific hybridization, the antisense
sequence is substantially complementary to the target sequence. In
certain embodiments, the antisense sequence is exactly
complementary to the target sequence. The antisense polynucleotides
may also include, however, nucleotide substitutions, additions,
deletions, transitions, transpositions, or modifications, or other
nucleic acid sequences or non-nucleic acid moieties so long as
specific binding to the relevant target sequence corresponding to
the sEH gene is retained as a functional property of the
polynucleotide. In one embodiment, the antisense molecules form a
triple helix-containing, or "triplex" nucleic acid. Triple helix
formation results in inhibition of gene expression by, for example,
preventing transcription of the target gene (see, e.g., Cheng et
al., 1988, J. Biol. Chem. 263:15110; Ferrin and Camerini-Otero,
1991, Science 354:1494; Ramdas et al., 1989, J. Biol. Chem.
264:17395; Strobel et al., 1991, Science 254:1639; and Rigas et
al., 1986, Proc. Natl. Acad. Sci. U.S.A. 83:9591)
[0088] Antisense molecules can be designed by methods known in the
art. For example, Integrated DNA Technologies (Coralville, Iowa)
makes available a program on the internet which can be found by
entering http://, followed by
biotools.idtdna.com/antisense/AntiSense.aspx, which will provide
appropriate antisense sequences for nucleic acid sequences up to
10,000 nucleotides in length. Using this program with the sEH gene
provides the following exemplar sequences:
TABLE-US-00004 (SEQ ID NO: 34) 1) UGUCCAGUGCCCACAGUCCU (SEQ ID NO:
35) 2) UUCCCACCUGACACGACUCU (SEQ ID NO: 36) 3) GUUCAGCCUCAGCCACUCCU
(SEQ ID NO: 37) 4) AGUCCUCCCGCUUCACAGA (SEQ ID NO: 38) 5)
GCCCACUUCCAGUUCCUUUCC
[0089] In another embodiment, ribozymes can be designed to cleave
the mRNA at a desired position. (See, e.g., Cech, 1995,
Biotechnology 13:323; and Edgington, 1992, Biotechnology 10:256 and
Hu et al., PCT Publication WO 94/03596).
[0090] The antisense nucleic acids (DNA, RNA, modified, analogues,
and the like) can be made using any suitable method for producing a
nucleic acid, such as the chemical synthesis and recombinant
methods disclosed herein and known to one of skill in the art. In
one embodiment, for example, antisense RNA molecules of the
invention may be prepared by de novo chemical synthesis or by
cloning. For example, an antisense RNA can be made by inserting
(ligating) a sEH gene sequence in reverse orientation operably
linked to a promoter in a vector (e.g., plasmid). Provided that the
promoter and, preferably termination and polyadenylation signals,
are properly positioned, the strand of the inserted sequence
corresponding to the noncoding strand will be transcribed and act
as an antisense oligonucleotide of the invention.
[0091] It will be appreciated that the oligonucleotides can be made
using nonstandard bases (e.g., other than adenine, cytidine,
guanine, thymine, and uridine) or nonstandard backbone structures
to provides desirable properties (e.g., increased
nuclease-resistance, tighter-binding, stability or a desired Tm).
Techniques for rendering oligonucleotides nuclease-resistant
include those described in PCT Publication WO 94/12633. A wide
variety of useful modified oligonucleotides may be produced,
including oligonucleotides having a peptide-nucleic acid (PNA)
backbone (Nielsen et al., 1991, Science 254:1497) or incorporating
2'-O-methyl ribonucleotides, phosphorothioate nucleotides, methyl
phosphonate nucleotides, phosphotriester nucleotides,
phosphorothioate nucleotides, phosphoramidates.
[0092] Proteins have been described that have the ability to
translocate desired nucleic acids across a cell membrane.
Typically, such proteins have amphiphilic or hydrophobic
subsequences that have the ability to act as membrane-translocating
carriers. For example, homeodomain proteins have the ability to
translocate across cell membranes. The shortest internalizable
peptide of a homeodomain protein, Antennapedia, was found to be the
third helix of the protein, from amino acid position 43 to 58 (see,
e.g., Prochiantz, Current Opinion in Neurobiology 6:629-634 (1996).
Another subsequence, the h (hydrophobic) domain of signal peptides,
was found to have similar cell membrane translocation
characteristics (see, e.g., Lin et al., J. Biol. Chem.
270:14255-14258 (1995)). Such subsequences can be used to
translocate oligonucleotides across a cell membrane.
Oligonucleotides can be conveniently derivatized with such
sequences. For example, a linker can be used to link the
oligonucleotides and the translocation sequence. Any suitable
linker can be used, e.g., a peptide linker or any other suitable
chemical linker.
[0093] More recently, it has been discovered that siRNAs can be
introduced into mammals without eliciting an immune response by
encapsulating them in nanoparticles of cyclodextrin. Information on
this method can be found by entering "www." followed by
"nature.com/news/2005/050418/full/050418-6.html."
[0094] In another method, the nucleic acid is introduced directly
into superficial layers of the skin or into muscle cells by a jet
of compressed gas or the like. Methods for administering naked
polynucleotides are well known and are taught, for example, in U.S.
Pat. No. 5,830,877 and International Publication Nos. WO 99/52483
and 94/21797. Devices for accelerating particles into body tissues
using compressed gases are described in, for example, U.S. Pat.
Nos. 6,592,545, 6,475,181, and 6,328,714. The nucleic acid may be
lyophilized and may be complexed, for example, with polysaccharides
to form a particle of appropriate size and mass for acceleration
into tissue. Conveniently, the nucleic acid can be placed on a gold
bead or other particle which provides suitable mass or other
characteristics. Use of gold beads to carry nucleic acids into body
tissues is taught in, for example, U.S. Pat. Nos. 4,945,050 and
6,194,389.
[0095] The nucleic acid can also be introduced into the body in a
virus modified to serve as a vehicle without causing pathogenicity.
The virus can be, for example, adenovirus, fowlpox virus or
vaccinia virus.
[0096] miRNAs and siRNAs differ in several ways: miRNA derive from
points in the genome different from previously recognized genes,
while siRNAs derive from mRNA, viruses or transposons, miRNA
derives from hairpin structures, while siRNA derives from longer
duplexed RNA, miRNA is conserved among related organisms, while
siRNA usually is not, and miRNA silences loci other than that from
which it derives, while siRNA silences the loci from which it
arises. Interestingly, miRNAs tend not to exhibit perfect
complementarity to the mRNA whose expression they inhibit. See,
McManus et al., supra. See also, Cheng et al., Nucleic Acids Res.
33(4):1290-7 (2005); Robins and Padgett, Proc Natl Acad Sci USA.
102(10:4006-9 (2005); Brennecke et al., PLoS Biol. 3(3):e85 (2005).
Methods of designing miRNAs are known. See, e.g., Zeng et al.,
Methods Enzymol. 392:371-80 (2005); Krol et al., J Biol Chem.
279(40):42230-9 (2004); Ying and Lin, Biochem Biophys Res Commun.
326(3):515-20 (2005).
Therapeutic Administration
[0097] EETs and inhibitors of sEH can be prepared and administered
in a wide variety of oral, parenteral and aerosol formulations. In
some preferred forms, compounds for use in the methods of the
present invention can be administered by injection, that is,
intravenously, intramuscularly, intracutaneously, subcutaneously,
intraduodenally, or intraperitoneally, while in others, they are
administered orally. The sEH inhibitor or EETs, or both, can also
be administered by inhalation. Additionally, the sEH inhibitors, or
EETs, or both, can be administered transdermally. Accordingly, the
methods of the invention permit administration of pharmaceutical
compositions comprising a pharmaceutically acceptable carrier or
excipient and either a selected inhibitor or a pharmaceutically
acceptable salt of the inhibitor.
[0098] For preparing pharmaceutical compositions from sEH
inhibitors, or EETs, or both, pharmaceutically acceptable carriers
can be either solid or liquid. Solid form preparations include
powders, tablets, pills, capsules, cachets, suppositories, and
dispersible granules. A solid carrier can be one or more substances
which may also act as diluents, flavoring agents, binders,
preservatives, tablet disintegrating agents, or an encapsulating
material.
[0099] In powders, the carrier is a finely divided solid which is
in a mixture with the finely divided active component. In tablets,
the active component is mixed with the carrier having the necessary
binding properties in suitable proportions and compacted in the
shape and size desired. The powders and tablets preferably contain
from 5% or 10% to 70% of the active compound. Suitable carriers are
magnesium carbonate, magnesium stearate, talc, sugar, lactose,
pectin, dextrin, starch, gelatin, tragacanth, methylcellulose,
sodium carboxymethylcellulose, a low melting wax, cocoa butter, and
the like. The term "preparation" is intended to include the
formulation of the active compound with encapsulating material as a
carrier providing a capsule in which the active component with or
without other carriers, is surrounded by a carrier, which is thus
in association with it. Similarly, cachets and lozenges are
included. Tablets, powders, capsules, pills, cachets, and lozenges
can be used as solid dosage forms suitable for oral
administration.
[0100] For preparing suppositories, a low melting wax, such as a
mixture of fatty acid glycerides or cocoa butter, is first melted
and the active component is dispersed homogeneously therein, as by
stirring. The molten homogeneous mixture is then poured into
convenient sized molds, allowed to cool, and thereby to
solidify.
[0101] Liquid form preparations include solutions, suspensions, and
emulsions, for example, water or water/propylene glycol solutions.
For parenteral injection, liquid preparations can be formulated in
solution in aqueous polyethylene glycol solution. Transdermal
administration can be performed using suitable carriers. If
desired, apparatuses designed to facilitate transdermal delivery
can be employed. Suitable carriers and apparatuses are well known
in the art, as exemplified by U.S. Pat. Nos. 6,635,274, 6,623,457,
6,562,004, and 6,274,166.
[0102] Aqueous solutions suitable for oral use can be prepared by
dissolving the active component in water and adding suitable
colorants, flavors, stabilizers, and thickening agents as desired.
Aqueous suspensions suitable for oral use can be made by dispersing
the finely divided active component in water with viscous material,
such as natural or synthetic gums, resins, methylcellulose, sodium
carboxymethylcellulose, and other well-known suspending agents.
[0103] Also included are solid form preparations which are intended
to be converted, shortly before use, to liquid form preparations
for oral administration. Such liquid forms include solutions,
suspensions, and emulsions. These preparations may contain, in
addition to the active component, colorants, flavors, stabilizers,
buffers, artificial and natural sweeteners, dispersants,
thickeners, solubilizing agents, and the like.
[0104] The pharmaceutical preparation is preferably in unit dosage
form. In such form the preparation is subdivided into unit doses
containing appropriate quantities of the active component. The unit
dosage form can be a packaged preparation, the package containing
discrete quantities of preparation, such as packeted tablets,
capsules, and powders in vials or ampoules. Also, the unit dosage
form can be a capsule, tablet, cachet, or lozenge itself, or it can
be the appropriate number of any of these in packaged form.
[0105] The term "unit dosage form", as used in the specification,
refers to physically discrete units suitable as unitary dosages for
human subjects and animals, each unit containing a predetermined
quantity of active material calculated to produce the desired
pharmaceutical effect in association with the required
pharmaceutical diluent, carrier or vehicle. The specifications for
the novel unit dosage forms of this invention are dictated by and
directly dependent on (a) the unique characteristics of the active
material and the particular effect to be achieved and (b) the
limitations inherent in the art of compounding such an active
material for use in humans and animals, as disclosed in detail in
this specification, these being features of the present
invention.
[0106] A therapeutically effective amount of the sEH inhibitor, or
EETs, or both, is employed in inhibiting cardiac arrhythmia or
inhibiting or reversing cardiac hypertrophy or dilated
cardiomyopathy. The dosage of the specific compound for treatment
depends on many factors that are well known to those skilled in the
art. They include for example, the route of administration and the
potency of the particular compound. An exemplary dose is from about
0.001 .mu.M/kg to about 100 mg/kg body weight of the mammal.
[0107] EETs are unstable in acidic conditions, and can be converted
to DHETs. To avoid conversion of orally administered EETs to DHETs
under the acidic conditions present in the stomach, EETs can be
administered intravenously, by injection, or by aerosol. EETs
intended for oral administration can be encapsulated in a coating
that protects the EETs during passage through the stomach. For
example, the EETs can be provided with a so-called "enteric"
coating, such as those used for some brands of aspirin, or embedded
in a formulation. Such enteric coatings and formulations are well
known in the art. In some formulations, the EETs, or a combination
of the EETs and an sEH inhibitor are embedded in a slow-release
formulation to facilitate administration of the agents over
time.
[0108] In another set of embodiments, an sEH inhibitor, one or more
EETs, or both an sEH inhibitor and an EET are administered by
delivery to the nose or to the lung. Intranasal and pulmonary
delivery are considered to be ways drugs can be rapidly introduced
into an organism. Devices for delivering drugs intranasally or to
the lungs are well known in the art. The devices typically deliver
either an aerosol of an therapeutically active agent in a solution,
or a dry powder of the agent. To aid in providing reproducible
dosages of the agent, dry powder formulations often include
substantial amounts of excipients, such as polysaccharides, as
bulking agents.
[0109] Detailed information about the delivery of therapeutically
active agents in the form of aerosols or as powders is available in
the art. For example, the Center for Drug Evaluation and Research
("CDER") of the U.S. Food and Drug Administration provides detailed
guidance in a publication entitled: "Guidance for Industry: Nasal
Spray and Inhalation Solution, Suspension, and Spray Drug
Products--Chemistry, Manufacturing, and Controls Documentation"
(Office of Training and Communications, Division of Drug
Information, CDER, FDA, July 2002). This guidance is available in
written form from CDER, or can be found on-line by entering
"http://www." followed by "fda.gov/cder/guidance/4234fnl.htm". The
FDA has also made detailed draft guidance available on dry powder
inhalers and metered dose inhalers. See, Metered Dose Inhaler (MDI)
and Dry Powder Inhaler (DPI) Drug Products--Chemistry,
Manufacturing, and Controls Documentation, 63 Fed. Reg. 64270,
(November 1998). A number of inhalers are commercially available,
for example, to administer albuterol to asthma patients, and can be
used instead in the methods of the present invention to administer
the sEH inhibitor, EET, or a combination of the two agents to
subjects in need thereof.
[0110] In some aspects of the invention, the sEH inhibitor, EET, or
combination thereof, is dissolved or suspended in a suitable
solvent, such as water, ethanol, or saline, and administered by
nebulization. A nebulizer produces an aerosol of fine particles by
breaking a fluid into fine droplets and dispersing them into a
flowing stream of gas. Medical nebulizers are designed to convert
water or aqueous solutions or colloidal suspensions to aerosols of
fine, inhalable droplets that can enter the lungs of a patient
during inhalation and deposit on the surface of the respiratory
airways. Typical pneumatic (compressed gas) medical nebulizers
develop approximately 15 to 30 microliters of aerosol per liter of
gas in finely divided droplets with volume or mass median diameters
in the respirable range of 2 to 4 micrometers. Predominantly, water
or saline solutions are used with low solute concentrations,
typically ranging from 1.0 to 5.0 mg/mL.
[0111] Nebulizers for delivering an aerosolized solution to the
lungs are commercially available from a number of sources,
including the AERx.TM. (Aradigm Corp., Hayward, Calif.) and the
Acorn II.RTM. (Vital Signs Inc., Totowa, N.J.).
[0112] Metered dose inhalers are also known and available. Breath
actuated inhalers typically contain a pressurized propellant and
provide a metered dose automatically when the patient's inspiratory
effort either moves a mechanical lever or the detected flow rises
above a preset threshold, as detected by a hot wire anemometer.
See, for example, U.S. Pat. Nos. 3,187,748; 3,565,070; 3,814,297;
3,826,413; 4,592,348; 4,648,393; 4,803,978; and 4,896,832.
[0113] The formulations may also be delivered using a dry powder
inhaler (DPI), i.e., an inhaler device that utilizes the patient's
inhaled breath as a vehicle to transport the dry powder drug to the
lungs. Such devices are described in, for example, U.S. Pat. Nos.
5,458,135; 5,740,794; and 5,785,049. When administered using a
device of this type, the powder is contained in a receptacle having
a puncturable lid or other access surface, preferably a blister
package or cartridge, where the receptacle may contain a single
dosage unit or multiple dosage units.
[0114] Other dry powder dispersion devices for pulmonary
administration of dry powders include those described in Newell,
European Patent No. EP 129985; in Hodson, European Patent No. EP
472598, in Cocozza, European Patent No. EP 467172, and in Lloyd,
U.S. Pat. Nos. 5,522,385; 4,668,281; 4,667,668; and 4,805,811. Dry
powders may also be delivered using a pressurized, metered dose
inhaler (MDI) containing a solution or suspension of drug in a
pharmaceutically inert liquid propellant, e.g., a
chlorofluorocarbon or fluorocarbon, as described in U.S. Pat. Nos.
5,320,094 and 5,672,581.
[0115] Without further elaboration, it is believed that one skilled
in the art can, using the preceding description, practice the
present invention to its fullest extent.
EXAMPLES
Example 1
[0116] Inflammatory pain model: The nociception response was
measured using the hind paw withdrawal latency test modified after
Hargreaves at al., Pain, 32(1):77-88 (1988). Male Sprague-Dowley
rats weighing 240-260 g, are individually housed at UC Davis Animal
Resource Facility under standard conditions with free access to
food and water, and maintained for at least 1 week before the
experiments. On the day of the experiments, the animals' basal
response is measured and then compounds are topically administered
preceding an injection with 10 ug of endotoxin
(1Lipopolysaccharide, "LPS", Sigma-Aldrich, St. Louis, Mo.).
Nociceptive response is then measured at 120 minutes post-LPS
injection. Compounds are formulated by dissolving them in ethanol
and mixing with cream in a ratio of 1:8. Eight animals per group
are used. A dose response curve is obtained by administering
increasing concentrations of EETs and measuring nociceptive
response.
Example 2
[0117] To determine the cellular receptors for EETs, in vitro
bioassays were conducted using human receptors. From 150 available
human receptors, 47 were selected on the basis of behavioral
observations of animals when EETs were administered to them. These
47 selected human molecular receptors were screened using
radio-ligand competition assays to identify potential receptors for
EETs. The biological outcome of impacting these receptors was
compared with the observed behavior to include each receptor into
the screen. Based on the results of initial screening, efforts were
focused on individual receptors, which were screened with each of
the four regio-isomers of EETs. Several receptors and EET isomers
were ruled out as not exhibiting activity.
Receptor Binding Experiments.
[0118] Standard radio-ligand binding competition experiments were
conducted on 47 human receptors using a final concentration of 10
.mu.M. Percent inhibition of a known potent agonist was reported.
The threshold for defining a "positive" hit was set as 25%
inhibition of binding. Receptors which were inhibited by more than
25% in the first screen were further investigated by conducting the
binding experiments using individual isomers of EETs.
Example 3
[0119] Bioassays. When animals are treated with lipopolysaccharide
(LPS), they show a drastic reduction in their withdrawal latencies
in pain response assays. The pain response, however, was restored
towards the baseline levels with the application of increasing
concentrations of EETs (doses 50,200 and 300 mg/kg).
[0120] Analgesic effect of EETs. LPS treatment produces
hyperalgesia by reducing the baseline withdrawal latency by two
fold. Animals topically administered EETs display significantly
less hyperalgesia and their nociceptive response remains at the
baseline level.
Receptor Binding Assays
[0121] As noted in the preceding Examples, first round screens were
conducted using 47 human receptors. The receptors were expressed in
recombinant mammalian cells. Only the receptors that were
significantly inhibited by 10 pM of EETs are reported. Related
receptor subtypes, however, are also included in Table 2 to
emphasize specificity of EETs to the labeled receptors. In a second
round of screens, the receptors that gave positive hits in the
first round were selected and screened against each of the four
regioisomers of EETs. This experiment was done with 3 .mu.M of EETs
to increase the stringency of the screen. The results are
summarized in Table 3. The activity observed on Dopamine D3
receptor was lost in the second round. However significant
inhibition of peripheral benzodiazepine receptors was observed with
three of the four isomers of EETs (Table 2). Additionally 5,6-EET
remained to have the same level of activity on Cannabinoid CB2 and
Neurokinin NK2 receptors. Tables 2 and 3 present the early data we
developed, while Table 4 presents more complete data.
TABLE-US-00005 TABLE 2 Screening of human receptors against a
mixture of EETs. % Inhibition IC50 of Control Ref Receptor Specific
Binding Reference Compound (M) BZD (peripheral) 78 PK11195 2.70E-09
BZD (central) 12 diazepam 1.00E-08 Cannabinoid CB1 13 CPS6940
1.00E-09 Cannabinoid C62 26 WIN55212-2 7.60E-09 Dopamine D1 20
SCH23390 4.80E-10 Dopamine D2S 16 (+)butaclamol 4.40E-09 Dopamine
D3 47 (+)butaelamol 8.90E-09 Neurokinin NK1 12 [Sar9,Met(02)11]-SP
2.20E-10 Neurokinin NK2 32 [Nie10]-NKA(4-10) 9.30E-09 Neurokinin
NK3 1 SB 222200 1.00E-08
TABLE-US-00006 TABLE 3 Second round of screening using individual
EET isomers on receptors that were significantly inhibited by a
mixture of EETs in first screen. % Inhibition Test of Control IC50
Com- Specific Reference Ref Receptor pound Binding Compound (M) BZD
(peripheral) 5,6-EET 27 PK11195 2.5E-09 BZD (peripheral) 8,9-EET 11
PK11196 2.5E-09 BZD (peripheral) 11,12-EET 28 PK11195 2.5E-09 BZD
(peripheral) 14,15-EET 45 PK11195 2.5E-09 Cannabinoid CB2 5,6-EET
25 WINS5212-2 2.7E-09 Cannabinoid CB2 8,9-EET -2 WING5212-2 2.7E-09
Cannabinoid CB2 11,12-EET 3 WINS5212-2 2.7E-09 Cannabinoid CB2
14,15-EET 5 WIN55212-2 2.7E-09 Dopamine D3 5,6-EET 18 (+)butaclamol
8.7E-09 Dopamine D3 8,9-EET 9 (+)butaclamol 8.7E-09 Dopamine D3
11,12-EET 6 (+)butaclamol 8.7E-09 Dopamine D3 14,15-EET 10
(+)butaclamol 8.7E-09 Neurokinin NK2 5,6-EET 25 [Nle10]- 9.7E-09
NKA(4.10) Neurokinin NK2 8,9-EET 10 [Nle101- 9.7E-09 NKA(4-10)
Neurokinin NK.sub.2 11,12-EET 1 [Nle10]- 9.7E-09 NKA(4-10)
Neurokinin NK.sub.2 14,15-EET 8 [Nle10]- 9.7E-09 NKA(4-10)
TABLE-US-00007 TABLE 4 Interaction of EETs with selected cellular
receptors Peripheral Central CB.sub.1 CB.sub.2 NK.sub.1 NK.sub.2
NK.sub.3 benzodiazepine benzodiazepine D.sub.3 EET-me mixture
(.mu.M) >100 19 >100 14 >100 4.6 >100 30 5,6 EET-me
(.mu.M) NT 20 NT 36 NT 12 NT >100 8,9 EET-me (.mu.M) NT >100
NT >100 NT >100 NT >100 11,12 EET-me (.mu.M) NT >100 NT
>100 NT 140 NT >100 14,15 EET-me (.mu.M) NT >100 NT
>100 NT 12 NT >100 Binding assays were conducted by CEREP
according to standardized procedures. A mixture of regioisomers of
EETs were initially screened broadly for displacing ability of high
affinity ligands. In a second round the IC.sub.50 of the mixture
and the individual isomers were determined. Reference compounds and
their affinities (M) for respective receptors from left to right
were CP 55940 (1.00E-09), WIN 55212-2 (7.60E-09), [Sar9,
Met(O2)11]-SP (2.20E-0), [N1e10]-NKA(4-10) (9.30E-9), SB 222200
(1.00E-8), PK 11195 (2.70E-9), Diazepam (1.0E-08), (+) butaclamol
(8.90E-09). NT: not tested.
Example 4
Receptor Binding Assays
[0122] Receptor binding experiments were contracted to CEREP
(Redmond, Wash.). Compounds with encrypted identities were mailed
to CEREP. Standard radio-ligand binding competition experiments
were conducted initially on 47 receptors using a final
concentration of 10 .mu.M. Percent inhibition of a known potent
agonist was reported. The threshold for a positive hit was set as
25% inhibition of binding by CEREP. Receptors which were inhibited
at more than 25% in the first screen were further investigated by
conducting the binding experiments using individual isomers of
EETs.
(i) PBR Binding Assays.
[0123] For the peripheral benzodiazepine assay, the procedure of Le
Fur et al. (Life Sci. 33: 449-457 (1983)) was followed. Briefly,
male Sprague-Dawley rats (200 g, Charles River Laboratories, Inc.,
Wilmington, Mass.) were sacrificed and hearts were excised. The
ventricular tissue was homogenized (1:4 w/v) in cold sucrose (0.25
M), Tris HCl (5 mM, MgCl.sub.2 (1 mM) buffer at pH 7.4. The
homogenates were then filtered through a double layer of cheese
cloth and centrifuged at 1,000.times.g for 10 minutes. The
supernatant was recentrifuged at 40,000.times.g for 30 minutes. The
resulting pellet was resuspended in the incubation buffer. The
binding assays were performed in 50 mM Tris HCl, MgCl.sub.2 10 mM
buffer pH 7.5 in a final volume of 1 ml containing 0.2 mg of
cardiac membrane protein and the radioactive ligand, [.sup.3H] PK
11195
(1-(2-chlorophenyl)-N-methyl-N-(1-methylpropyl)-1-isoquinoline
carboxamide, a powerful PBR ligand) and increasing concentrations
of EETs. After 15 minutes at 25.degree. C., the membranes were
filtered over GF/C filters (Whatman Inc., Florham Park, N.J.)
followed by 3.times.5 ml washes with cold buffer. Specific binding
(95% of total binding for both ligands) was defined as the amount
of radioactivity displaced by 1 .mu.M unlabelled RO5-4864
(4'-chlorodiazepam), a ligand known to bind PBR. The radioactivity
in the filters was measured with a scintillation counter.
Equilibrium thermodynamic parameters of binding were determined
utilizing classical thermodynamic equations.
(ii) CB2 Binding Assays
[0124] For CB2 binding assays, recombinant human receptor protein
was expressed in Chinese Hamster Ovary (CHO) cells. The binding of
the synthetic cannabinoid receptor agonist [.sup.3H] WIN 55212-2
((4,5-dihydro-2-methyl-4(4-morpholinylmethyl)-1-(1-naphthalenylcarbonyl)--
6H-pyrrolo[3,2,1ij]quinolin-6-one) to cell membranes was determined
by incubation of the ligand (0.8 nM) for 2 hours at 37.degree. C.
with cells in the cell culture buffer according to Munro et al.
(Nature, 365:61-65 (1993)). EETs were added in increasing
concentrations in parallel. The membranes were then filtered over
GF/C filters (Whatman), followed by 3.times.5 ml washes with cold
buffer. Specific binding (95% of total binding for both ligands)
was defined as the amount of radioactivity displaced by 5 .mu.M of
unlabelled WIN 55212-2.
Example 5
Behavioral Nociceptive Testing
[0125] Behavioral nociceptive testing was conducted by assessing
thermal hindpaw withdrawal latencies ("TWL") using a commercial
Hargreaves (Hargreaves et al., A new and sensitive method for
measuring thermal nociception in cutaneous hyperalgesia. Pain
32:77-88 (1988)) apparatus (IITC Life Science Inc., Woodland Hills,
Calif.). Male Sprague-Dawley rats weighing 240-250 g, were
individually housed at the UC Davis Animal Resource Facility under
standard conditions with free access to food and water, and
maintained for at least 1 week before the experiments. On the day
of the experiment, the rats were transferred to a quiet room,
acclimated for 1 h, and their baseline responses measured. In pilot
experiments, the intensity of the thermal stimulus was set to
produce a baseline TWL of 7-8 s. Following baseline measurements,
rats were first treated with 200 .mu.l of vehicle or
compound-formulated cream by topical application to one hind paw.
Compounds (including sEHI, steroid synthesis inhibitors, steroid
receptor antagonists, and cannabinoid receptor antagonists, as
shown in the Figure legends) were formulated by dissolving them in
ethanol and mixing with Vanicream.RTM. (Pharmaceutical Specialties,
Inc., Rochester, Minn.) in a ratio of 1:9. The cream was thoroughly
massaged across the entire hind paw surface over a 2 min period.
After 1.5 hours rats were treated with 200 .mu.l of sEHI formulated
cream. Within 10 min of sEHI application, lipopolysaccharide
("LPS", 10 .mu.g in 50 .mu.l 0.9% NaCl) was injected subcutaneously
into the plantar surface of the treated paw. Immediately following
LPS injection, animals were placed in acrylic chambers on a glass
platform maintained at a temperature of 30.+-.1.degree. C. for
TWL-measurement. During TWL measurement, a beam of radiant heat was
focused onto the mid-portion of the plantar surface of the treated
hind paw until the rat moved its stimulated hindpaw abruptly away
from the heat stimulus. The duration of heat application necessary
to elicit a withdrawal was designated as TWL. A maximum stimulus
duration of 22 s was imposed to prevent tissue damage. Five TWL
measurements were taken at 3-4 min interstimulus intervals for each
of the time points following treatment. The three median TWLs were
averaged for each animal at each time point.
Example 6
[0126] Fatty acids and lipid signaling: Lipid molecules are
ubiquitous messengers that are known to participate in
intracellular signaling, cell to cell communication and serve as
neurotransmitters. Lipid messengers also regulate specific
physiologic functions, one of which is the transmission of noxious
sensory information (pain) in the periphery and the central nervous
system. A significant aspect of the role of lipids in neuronal
function is their ability to modify the functional responses of ion
channels, synaptic transmission and cellular signaling cascades
through which neuronal cell function is modified to meet
physiologic demand (Sang, N. Neuroscientist 12:425-434 (2006);
Chen, C. et al., Prostaglandins & Other Lipid Mediators
77:65-76 (2005)). Analysis of alterations in the type, amount and
organization of lipids can provide critical information leading to
the understanding of mechanism of action of each molecule, the
early diagnosis of disease, identification of the mechanisms
underlying the disease process itself and also can potentially
provide an indication of efficacy of specific treatment regimes.
For example it has recently become clear that, despite previous
thinking, the kinetic characteristics of ion channels are
intimately related to their dynamic interactions with their
surrounding lipids and electric field-induced changes in
protein-lipid interactions (De Petrocellis, L. et al., Life
Sciences 77:1651-1666 (2005)). Thus, the lipid environment is now
recognized as a direct modifier of the functional outcome of a
transmitted electrical signal.
[0127] The arachidonic acid (AA) cascade is a relatively well
exploited biological path with many therapeutic opportunities, only
a limited number of which are taken advantage of. Moreover, there
is evidence of the existence of parallel homologous cascades of
other fatty acids, particularly a linoleic acid (LA) cascade.
Although direct action of AA on various ionic currents has been
demonstrated (Ordway, R. W. et al., Science 244:1176-1179 (1989))
the released AA is quickly converted to downstream metabolites by
prostaglandin synthases, lipoxygenases and cytochrome P450 enzymes
in a tissue- and context-dependent manner (Roman, R. Metabolites of
Arachidonic Acid in the Control of Cardiovascular Function
Physiological Reviews 82:131-185 (2002); Capdevila, J. et al.,
FASEB Journal 6:731-736 (1992); McGiff, J. C. Annual Review of
Pharmacology and Toxicology 31:339-369 (1991)). Eicosanoids, the
arachidonic acid-derived lipid mediators, are composed of several
classes that include leukotrienes (LT), prostaglandins (PG),
thromboxanes (TX), and hydroxy, epoxy and oxo-fatty acids. These
eicosanoids are formed by various cells and most are thought to act
locally (McGiff, J. C. Annual Review of Pharmacology and Toxicology
31:339-369 (1991); Imig, J. Clinical Science (London) 111:21-34
(2006)). Their biological roles include control of vascular tone,
platelet aggregation, renal function, hypersensitivity and
inflammation; thus, they are of great physiological importance. LA
mono-epoxides (EpOMEs) and diols (DiHOMEs) also have many
biological activities. For example, they induce vasodilatation and
thus appear to regulate blood pressure (Ishizaki, T. et al., Am J
Physiol 268:123-128 (1995)), may protect organisms from infectious
diseases (Hayakawa, M. et al., Biochem Biophys Res Commun
137:424-430 (1986)), and may have a role in multiple-organ failure
associated with severe burns, acute trauma, and respiratory
distress syndrome (Hayakawa, M. et al., Biochem Int 21:573-579
(1990); Ozawa, T. et al., Am Rev Respir Dis 137:535-540 (1988);
Kosaka, K. et al., Mol Cell Biochem 139:141-148 (1994)). EpOMEs may
be endogenous chemical mediators regulating vascular permeability
(Hennig, B. et al., Metabolism 49:1006-1013 (2000)).
[0128] Epoxy fatty acids and sEH: One of the metabolic fates of AA
is the oxidation to EETs by cytochrome P450 epoxygenases. A
multitude of interesting biological activities are found to be
associated with the EETs using in vitro systems (Campbell, W. et
al., Circulation Research 78:415-423 (1996)). Although EETs other
than the 5,6-isomer are quite stable chemically, they are quickly
degraded enzymatically with the sEH accounting in many cases for
much of the metabolism. This rapid degradation has so far made it
difficult to associate biological effects with the administration
of EETs and other lipid epoxides particularly in vivo. Soluble
epoxide hydrolase (sEH, EC 3.3.2.3), a .alpha./.beta. fold
hydrolytic enzyme that primarily hydrolyzes epoxides on acyclic
systems, is the major enzyme that biodegrades EETs. By inhibiting
sEH to increase the residence time of EETs, recently it has become
clear that major roles of the EETs include but are not limited to
modulation of blood pressure and modulation of inflammatory
cascades (Spector, A. et al., Progress in Lipid Research 43:55-90
(2004); Node, K. et al., Science 285:1276-1279 (1999)). There are a
number of other biological effects associated with the EETs,
including neurohormone release, modulation of ion channel activity,
cell proliferation, G-protein signaling and a variety of effects
associated with modulation of NF.kappa.B (Spector, A. et al.,
Progress in Lipid Research 43:55-90 (2004); Node, K. et al.,
Science 285:1276-1279 (1999); Fleming, I. Hypertension 47:629-633
(2006); Feletou, M. et al., Arteriosclerosis, Thrombosis, and
Vascular Biology 26:1215-1225 (2006)).
[0129] We have demonstrated a role of the EETs as modulated by sEH
inhibitors (sEHIs) in reducing inflammatory pain (Inceoglu, B. et
al., Life Sciences 79:2311-2319 (2006)). The array of biological
effects observed with sEH inhibition illustrates the power of
modulating the degradation of chemical mediators. Many of these
biological effects can be modulated by sEHIs but presumably also by
the natural eicosanoids and their mimics, all of which offer
therapeutic potential. EETs and possibly other epoxy fatty acids
are clearly regulatory molecules. By way of metabolic profiling of
oxylipids and prostanoids, work in our laboratory has shown that
blocking the COX and sEH branches simultaneously results in a
synergistic decrease in prostaglandin production, and thus
inflammation and pain, when a lipopolysaccharide (LPS)-elicited
acute inflammatory model is used (Schmelzer, K. et al., Proc Natl
Acad Sci USA 103:13646-13651 (2006) ("Schmelzer PNAS 2006");
Schmelzer, K. et al., Proc Natl Acad Sci USA 102:9772-9777 (2005)).
Inhibition of sEH or COX 2 results in clear increases in EET
concentrations. Our data implies that at least some of the effects
of COX-2 inhibitors may be through an increase in EETs (Schmelzer
PNAS 2006).
[0130] Steroidogenesis, AA, EETs, StAR and the peripheral
benzodiazepine receptor: Steroid hormones are synthesized in
steroidogenic cells of the adrenal, ovary, testis, placenta, and
brain and are required for reproductive function and homeostasis.
Acute steroidogenesis, regulated by trophic hormone stimulation,
occurs on the order of minutes and is initiated by the mobilization
and delivery of the substrate for all steroid hormone biosynthesis,
cholesterol, from the outer to the inner mitochondrial membrane
where it is metabolized to pregnenolone by the cytochrome P450
cholesterol side chain cleavage enzyme, P450scc (Payne, A. H. et
al., Overview of Steroidogenic Enzymes in the Pathway from
Cholesterol to Active Steroid Hormones, pp 947-970 (2004)).
[0131] The essential role of arachidonic acid (AA) in trophic
hormone-stimulated steroidogenesis has been demonstrated starting
in the early 1980s (Lin, T. Life Sciences 36:1255-1264 (1985) ("Lin
1985")). Various authors have suggested COX and LOX metabolites of
AA were involved in the process (Lin 1985; Dix, C. J. et al., The
Biochemical Journal 219:529-537 (1984); Mercure, F. et al., General
and Comparative Endocrinology 102:130-140 (1996); Campbell, W. B.
et al., Journal Of Steroid Biochemistry 24:865-870 (1986)).
Stimulatory effects of the P450 branch, the epoxygenase products,
on steroidogenesis were also reported in bovine adrenal cells early
on (Nishimura, M. et al., Prostaglandins 38:413-430 (1989)). In
human granulosa cells, low concentrations of EETs were reported to
stimulate estradiol secretion (Van Voorhis, B. J. et al., J Clin
Endocrinol Metab 76:1555-1559 (1993)). Recently, D. M. Stocco's
group reported the identification of EETs as one of the factors
that stimulate StAR (steroidogenic acute regulatory protein)
expression and steroidogenesis (Wang, X. et al., The involvement of
epoxygenase metabolites of arachidonic acid in cAMP-stimulated
steroidogenesis and steroidogenic acute regulatory protein gene
expression, pp 871-878 (2006)). StAR protein is one of the
candidate proteins proposed as essential for steroidogenesis,
possessing all the necessary characteristics of the acute regulator
(Clark, B. J. et al., Characterization of the steroidogenic acute
regulatory protein (StAR), pp 28314-28322 (1994)). The acute
response to hormonal stimulation has an absolute requirement for de
novo protein synthesis (Davis, W. W. et al., The Inhibitory Site Of
Cycloheximide In The Pathway Of Steroid Biosynthesis, pp 5153-5157
(1968); Garren, L. D. et al., Studies on the Role of Protein
Synthesis in the Regulation of Corticosterone Production by
Adrenocorticotropic Hormone in vivo, pp 1443-1450 (1965)).
Inhibition of protein synthesis blocks hormone-induced steroid
synthesis by blocking the delivery of cholesterol to the inner
mitochondrial membrane (Farkash, Y. et al., Endocrinology
118:1353-1365 (1986)). Since activation of StAR protein expression
is rapid and temporally related to steroid synthesis, the mRNA and
protein quantities of StAR are good indicators of
steroidogenesis.
[0132] Although a large body of literature exists on the actions of
AA and its metabolites on steroid synthesis in the steroidogenic
tissues, acute steroidogenesis in the nervous system is much less
known but thought to proceed in parallel to that in steroidogenic
cells (Furukawa, A. et al., Steroidogenic Acute Regulatory Protein
(StAR) Transcripts Constitutively Expressed in the Adult Rat
Central Nervous System: Colocalization of StAR, Cytochrome P-450SCC
(GYP XIA1), and 3beta-Hydroxysteroid Dehydrogenase in the Rat
Brain, pp 2231-2238 (1998)). In this regard, we have evidence that
inhibition of sEH impacts steroidogenesis, presumably in the
nervous tissues and that sEHI elicited analgesia is through acute
modulation of steroidogenesis.
[0133] Another steroidogenesis regulating protein is the peripheral
benzodiazepine receptor (PBR). As the biological roles of the PBR
are emerging, the regulation of steroidogenesis among these roles
(regulation of cellular proliferation, apoptosis, immunomodulation,
porphyrin transport and heme biosynthesis) seems to predominate
(Gavish, M. et al., Receptor Pharmacological Reviews 51:629-650
(1999); Papadopoulos, V. L. et al., Neuroscience 138:749-756
(2006)). Ligand binding to PBR results in the stimulation of
mitochondrial pregnenolone formation (Mukhin, A. G. et al.,
Mitochondrial Benzodiazepine Receptors Regulate Steroid
Biosynthesis, pp 9813-9816 (1989)). In addition, potent PBR ligands
block inflammation profoundly in several distinct animal models of
chronic inflammation (Torres, S. R. et al., European Journal of
Pharmacology 408:199-211 (2000); Bressana, E. et al., Life Sciences
72:2591-2601 (2003)). Several inhibitors of steroid synthesizing
enzymes can block the effects of PBR ligands (da Silva, M. et al.,
Mediators of Inflammation 13:93-103 (2004); Farges, R. et al., Life
Sciences 74:1387-1395 (2004)).
[0134] Indeed Farges et al. showed that the P450scc inhibitor
aminoglutethimide blocks the anti-inflammatory effects of PBR
ligands in vivo (Farges, R. et al., Life Sciences 74:1387-1395
(2004)). The current proposed mode of action for this activity is
that PBR complex, which includes StAR protein, VDAC (voltage
dependent anion channel 1), PAP7, PKARI.alpha. (cAMP-dependent
protein kinase) and DBI (diazepam binding inhibitor) proteins,
regulates steroid biosynthesis by facilitating the import of
cholesterol from the outer to the inner mitochondrial membrane and
that its acute modulation increases steroid and/or neurosteroid
synthesis (Liu, J. et al., Protein-Protein Interactions Mediate
Mitochondrial Cholesterol Transport and Steroid Biosynthesis, pp
38879-38893 (2006)). The import of cholesterol has long been
recognized as the first and the rate limiting step in
steroidogenesis (Papadopoulos, V. L. et al., Neuroscience
138:749-756 (2006); Bose, H. S. et al., Nature 417:87-91 (2002)).
Both StAR and PBR proteins seem to be indispensable elements of the
steroidogenic machinery and they function in a coordinated manner
to transfer cholesterol into mitochondria (Hauet, T. et al.,
Peripheral-Type Benzodiazepine Receptor-Mediated Action of
Steroidogenic Acute Regulatory Protein on Cholesterol Entry into
Leydig Cell Mitochondria, pp 540-554 (2005); Stocco, D. M. et al.,
Multiple Signaling Pathways Regulating Steroidogenesis and
Steroidogenic Acute Regulatory Protein Expression: More Complicated
than We Thought, pp 2647-2659 (2005)). In addition, Hauet et al.
proposed that PBR activation is required for StAR expression.
[0135] Cholesterol upon entering mitochondria is potentially
directed to the synthesis of specific steroids in each tissue,
which is dictated by the presence and activity of steroid
synthesizing enzymes in a particular tissue. In fact, the
differential expression and distribution of these enzymes is
proposed to control the non-acute endogenous steroid tone. A change
in the endogenous steroid tone through acute steroidogenesis may
result with several favorable physiological outcomes including
anxiolysis and analgesia, primarily through the actions of
neurosteroids on GABAA conductance in the nervous tissue (Verleye,
M. et al., Pharmacology Biochemistry and Behavior 82:712-720
(2005); Sanna, E. et al., The Journal of Neuroscience 24:6521-6530
(2004)). Neurosteroids 3.alpha.,5.alpha.-THPROG and
3.alpha.,5.alpha.-THDOC, for example are known to bind to and
modulate GABAA channels which are inhibitory in nature and display
anxiolytic, analgesic, anticonvulsant, sedative, hypnotic and
anaesthetic properties (Belelli, D. et al., Nature Reviews
Neuroscience 6:565-575 (2005)).
[0136] One of the most intriguing findings in respect to the role
of EETs in inflammation was that EETs, through inhibiting
NF.kappa.B, are anti-inflammatory (Node, K. et al., Science
285:1276-1279 (1999)). This also holds true in vivo in rats
although EETs are algesic in the absence of inflammatory pain
(Inceoglu, B. et al., Life Sciences 79:2311-2319 (2006)). As noted
elsewhere herein, we found that EETs can displace high affinity
radioligands from a number of cellular receptors previously not
known to be associated with EETs, two of which are the
mitochondrial or peripheral benzodiazepine receptor (PBR) and the
CB2 receptor. Epoxy fatty acids and their increase in concentration
or half life by way of sEH inhibition causes a favorable shift in
the endogenous steroid tone through modulation of PBR and StAR,
ultimately impacting GABAA channels and this is at least one of the
mechanisms responsible for the observed powerful anti-inflammatory
and/or analgesic effect of EETs and sEH inhibitors.
[0137] Pain, and neuropathy: Upon nerve damage the pro-inflammatory
cytokines, specifically TNF-.alpha. is up regulated in surrounding
tissues of nerves including the Schwann cells, mast cells and
resident macrophages (Myers, R. R. et al., Drug Discovery Today
11:8-20 (2006)). This increase leads to a pathological process of
progressive nerve degeneration which was recognized as early as
1850. Wallerian degeneration is highly correlated with the
development of neuropathic pain (Stoll, G. et al., Journal of the
Peripheral Nervous System 7:13-27 (2002)). Following nerve injury,
nonresident macrophages in response to secreted chemotactic signals
invade the injury site (Sommer, C. et al., Neuroscience Letters
270:25-28 (1999); Zelenka, M. et al., Pain 116:257-263 (2005)).
This invasion and the process of nerve degeneration are temporally
related to the peak periods of hyperalgesia in neuropathic pain
(Shubayev, V. I. et al., A spatial and temporal co-localization
study in painful neuropathy, pp 28-36 (2002)). Further migration of
immune cells through the endothelium follows chemotactic signals
that are released by injured nerves (Wagner, R. et al.,
Neuroscience 73:625-629 (1996)). Activated macrophages secrete
components of the complement cascade, coagulation factors,
proteases, hydrolases, interferons, TNF-.alpha. and other cytokines
(Zelenka, M. et al., Pain 116:257-263 (2005)). Local TNF-.alpha.
causes spontaneous electrophysiological activity in surviving
nociceptive nerve fibers contributing to pain (Wagner, R. et al.,
Neuroreport 7:2897-2901 (1996)). Interestingly, the potential role
of arachidonic acid metabolites have not systematically been
investigated in the pathophysiology of neuropathic pain despite the
fact that COX-2 inhibitors are quite effective in animal models of
nerve injury (Bingham, S. et al., Journal of Pharmacology and
Experimental Therapeutics 312:1161-1169 (2005); Ma, W. et al.,
Brain Research 937:94-99 (2002)). Moreover most animals studies
that tested COX-2 inhibitors on neuropathic pain when the drug was
given before or shortly following nerve injury showed encouraging
results (Bingham, S. et al., Journal of Pharmacology and
Experimental Therapeutics 312:1161-1169 (2005); De Vry, J. et al.,
European J Pharmacology 491:137-148 (2004)). Our limited
mechanistic understanding of the pathways involved in neuropathic
pain is clearly paralleled in the treatment of this condition.
Currently, no single treatment options without significant side
effects exist for neuropathic pain. A combination of
pharmacological agents that block or attenuate the propagation of
inflammation and potent analgesics are usually prescribed albeit
with variable success (Gilron, I. et al., Canadian Med Assn J
175:265-275 (2006)).
[0138] The arachidonate cascade is the target for a significant
fraction of the pharmaceuticals on the market and includes such
NSAID drugs as salicylic acid, ibuprofen, naproxen, and celecoxib.
We have found that sEHIs are more potent at reducing inflammatory
eicosanoids in plasma than any of the above drugs (Schmelzer PNAS
2006). More importantly, NSAIDs shift arachidonic acid from one
inflammatory cascade to another. In contrast, sEHI shift the blood
eicosanoid profile from one propagating and expanding a pain
response to one resolving pain toward a healthy state.
[0139] sEHIs and EETs are antinociceptive and analgesic in
inflammatory pain models: Inhibition of sEH has been shown to
result in a multitude of beneficial effects. One of these
intriguing effects is that sEHIs protect mice from LPS elicited
acute inflammation (Schmelzer, K. et al., Proc Natl Acad Sci USA
102:9772-9777 (2005)). LPS induced mortality, systemic hypotension,
and histologically evaluated tissue injuries were substantially
diminished by administration of urea-based, small-molecule
inhibitors of sEH to mice. Moreover, sEH inhibitors decreased
plasma levels of proinflammatory cytokines and nitric oxide
metabolites while promoting the formation of lipoxins, thus
supporting inflammatory resolution. These data suggest that sEHIs
have therapeutic efficacy in the treatment and management of acute
inflammatory diseases. The sEHI dependant reduction of prostanoid
production in this model also suggests that inhibition of sEH may
attenuate inflammatory pain. This is confirmed by using two
distinct inflammatory pain models where we showed that inhibitors
of sEH are antihyperalgesic.
[0140] Hyperalgesia in the LPS-elicited pain model was induced by
intraplantar LPS injection and sEH inhibitors were delivered
topically. We found that urea based sEHIs can successfully be
delivered through the transdermal route. The maximal biological
effect of sEHI AEPU also corresponds to the maximum plasma
concentration and that sEH inhibitors effectively attenuate thermal
hyperalgesia and mechanical allodynia in rats treated with LPS. In
addition, we show that epoxydized arachidonic acid metabolites,
EETs, are also effective in attenuating thermal hyperalgesia in
this model. In parallel with the observed biological activity,
metabolic analysis of oxylipids showed that inhibition of sEH
resulted in a decrease in PGD2 levels and sEH generated degradation
products of linoleic and arachidonic acid metabolites with a
concomitant increase in epoxides of linoleic acid.
[0141] Using a second distinct inflammatory model, hyperalgesia was
induced by intraplantar injection of 2% carrageenan (CAR) and sEH
inhibitors were again delivered topically 20 hours post CAR
injection. The sEHI AUDA-be blocked CAR induced local thermal
hyperalgesia effectively. AUDA-be not only had a prophylactic
effect in the LPS model, but was also effective therapeutically in
reversing thermal hyperalgesia. These data show that inhibition of
sEH may become a viable therapeutic strategy to attain
analgesia.
EETs Act on PBR.
[0142] Although inhibition of sEH will decrease pain the mechanism
of action of this effect is largely unknown. A current hypothesis
is that inhibition of sEH leads to increased stability, hence
residence time of natural EETs and that EETs are responsible for
the observed biological activity. Therefore we subjected a mixture
of regioisomers of EETs to a standard receptor screening using high
affinity radioligands. This assay was conducted by a contract
research organization (CEREP). We selected a subset of 48 cellular
receptors based on the behaviors of the sEH knockout mice and sEHI
treated rats. Four of these receptors were inhibited by EETs with
micromolar affinities.
[0143] sEHI Elicited Analgesia is Blocked by Inhibition of
Steroid/Neurosteroid Synthesis
[0144] Based on the functions of PBR, we hypothesized that the
interaction of EETs with this receptor may cause an increase in
steroid production in the periphery and neurosteroid production in
the brain. We used pharmacological inhibitors of steroid synthesis
to test this hypothesis. Specifically, aminogluthetimide (AGL),
effectively blocks all steroid synthesis by inhibiting the first
enzyme, P450scc, in the steroid synthesis pathway. When topically
administered to rats, AGL completely blocked the antihyperalgesic
action of sEHI AEPU in the LPS-elicited inflammatory pain model. We
selected AEPU for these tests because AEPU is less likely to be an
EET mimic than are some other sEHI, in particular AUDA-be, because
of its structural properties (i.e. the polyglycol secondary
pharmacophore). Additionally, another inhibitor, finasteride,
blocks 5.alpha. reductase and stops the steroid biosynthesis by
blocking the conversion of testosterone to dihydrotestosterone in
the case of steroids and the conversion of progesterone to
allopregnanolone in the case of neurosteroids. Finasteride also
blocked the anti-hyperalgesic activity of AEPU. In contrast,
however, a non-steroidal estrogen receptor antagonist, tamoxifen, a
dual progesterone/glucocorticoid receptor antagonist, mifepristone,
an androgen receptor antagonist, nilutamide, and an aldosterone
receptor antagonist, spironolactone, did not have any impact on the
antihyperalgesic action of AEPU, indicating that sEHIs and/or EETs
are not acting through these steroid receptors.
[0145] As shown in FIG. 3, oxylipin analysis from animals in these
tests showed that the PGE2 levels did not correlate well with the
LPS elicited thermal hyperalgesia bioassay in animals treated with
steroid synthesis inhibitor+sEHI. For example PGE2 levels were
significantly lower in animals that received AGL+LPS+AEPU than in
animals treated with AEPU+LPS or LPS only, whereas these animals
were clearly hyperalgesic despite the administration of AEPU. See,
FIG. 3. This means that inhibition of sEH is not only effective
against inflammatory pain but also effective in other types of pain
that are not necessarily modulated by prostanoid levels. Indeed,
non-inflammatory types of pain are known to be not well addressed
by COX inhibitors. The levels of EETs and DHETs, however,
correlated well with the nociceptive end result. AGL significantly
reduced levels of EETs and increased levels of DHETs in
AGL+AEPU-administered animals compared to AEPU-administered
animals, indicating that EETs are responsible for the
anti-hyperalgesic activity.
[0146] It is understood that the examples and embodiments described
herein are for illustrative purposes only and that various
modifications or changes in light thereof will be suggested to
persons skilled in the art and are to be included within the spirit
and purview of this application and scope of the appended claims.
All publications, patents, and patent applications cited herein are
hereby incorporated by reference in their entirety for all
purposes.
Sequence CWU 1
1
381554PRTHomo sapienshuman soluble epoxide hydrolase (sEH) 1Met Thr
Leu Arg Gly Ala Val Phe Asp Leu Asp Gly Val Leu Ala Leu1 5 10 15
Pro Ala Val Phe Gly Val Leu Gly Arg Thr Glu Glu Ala Leu Ala Leu 20
25 30 Pro Arg Gly Leu Leu Asn Asp Ala Phe Gln Lys Gly Gly Pro Glu
Gly 35 40 45 Ala Thr Thr Arg Leu Met Lys Gly Glu Ile Thr Leu Ser
Gln Trp Ile 50 55 60 Pro Leu Met Glu Glu Asn Cys Arg Lys Cys Ser
Glu Thr Ala Lys Val65 70 75 80 Cys Leu Pro Lys Asn Phe Ser Ile Lys
Glu Ile Phe Asp Lys Ala Ile 85 90 95 Ser Ala Arg Lys Ile Asn Arg
Pro Met Leu Gln Ala Ala Leu Met Leu 100 105 110 Arg Lys Lys Gly Phe
Thr Thr Ala Ile Leu Thr Asn Thr Trp Leu Asp 115 120 125 Asp Arg Ala
Glu Arg Asp Gly Leu Ala Gln Leu Met Cys Glu Leu Lys 130 135 140 Met
His Phe Asp Phe Leu Ile Glu Ser Cys Gln Val Gly Met Val Lys145 150
155 160 Pro Glu Pro Gln Ile Tyr Lys Phe Leu Leu Asp Thr Leu Lys Ala
Ser 165 170 175 Pro Ser Glu Val Val Phe Leu Asp Asp Ile Gly Ala Asn
Leu Lys Pro 180 185 190 Ala Arg Asp Leu Gly Met Val Thr Ile Leu Val
Gln Asp Thr Asp Thr 195 200 205 Ala Leu Lys Glu Leu Glu Lys Val Thr
Gly Ile Gln Leu Leu Asn Thr 210 215 220 Pro Ala Pro Leu Pro Thr Ser
Cys Asn Pro Ser Asp Met Ser His Gly225 230 235 240 Tyr Val Thr Val
Lys Pro Arg Val Arg Leu His Phe Val Glu Leu Gly 245 250 255 Trp Pro
Ala Val Cys Leu Cys His Gly Phe Pro Glu Ser Trp Tyr Ser 260 265 270
Trp Arg Tyr Gln Ile Pro Ala Leu Ala Gln Ala Gly Tyr Arg Val Leu 275
280 285 Ala Met Asp Met Lys Gly Tyr Gly Glu Ser Ser Ala Pro Pro Glu
Ile 290 295 300 Glu Glu Tyr Cys Met Glu Val Leu Cys Lys Glu Met Val
Thr Phe Leu305 310 315 320 Asp Lys Leu Gly Leu Ser Gln Ala Val Phe
Ile Gly His Asp Trp Gly 325 330 335 Gly Met Leu Val Trp Tyr Met Ala
Leu Phe Tyr Pro Glu Arg Val Arg 340 345 350 Ala Val Ala Ser Leu Asn
Thr Pro Phe Ile Pro Ala Asn Pro Asn Met 355 360 365 Ser Pro Leu Glu
Ser Ile Lys Ala Asn Pro Val Phe Asp Tyr Gln Leu 370 375 380 Tyr Phe
Gln Glu Pro Gly Val Ala Glu Ala Glu Leu Glu Gln Asn Leu385 390 395
400 Ser Arg Thr Phe Lys Ser Leu Phe Arg Ala Ser Asp Glu Ser Val Leu
405 410 415 Ser Met His Lys Val Cys Glu Ala Gly Gly Leu Phe Val Asn
Ser Pro 420 425 430 Glu Glu Pro Ser Leu Ser Arg Met Val Thr Glu Glu
Glu Ile Gln Phe 435 440 445 Tyr Val Gln Gln Phe Lys Lys Ser Gly Phe
Arg Gly Pro Leu Asn Trp 450 455 460 Tyr Arg Asn Met Glu Arg Asn Trp
Lys Trp Ala Cys Lys Ser Leu Gly465 470 475 480 Arg Lys Ile Leu Ile
Pro Ala Leu Met Val Thr Ala Glu Lys Asp Phe 485 490 495 Val Leu Val
Pro Gln Met Ser Gln His Met Glu Asp Trp Ile Pro His 500 505 510 Leu
Lys Arg Gly His Ile Glu Asp Cys Gly His Trp Thr Gln Met Asp 515 520
525 Lys Pro Thr Glu Val Asn Gln Ile Leu Ile Lys Trp Leu Asp Ser Asp
530 535 540 Ala Arg Asn Pro Pro Val Val Ser Lys Met545 550
22101DNAHomo sapienspolynucleotide encoding human soluble epoxide
hydrolase (sEH) 2ggcacgagct ctctctctct ctctctctct ctctcgccgc
catgacgctg cgcggcgccg 60tcttcgacct tgacggggtg ctggcgctgc cagcggtgtt
cggcgtcctc ggccgcacgg 120aggaggccct ggcgctgccc agaggacttc
tgaatgatgc tttccagaaa gggggaccag 180agggtgccac tacccggctt
atgaaaggag agatcacact ttcccagtgg ataccactca 240tggaagaaaa
ctgcaggaag tgctccgaga ccgctaaagt ctgcctcccc aagaatttct
300ccataaaaga aatctttgac aaggcgattt cagccagaaa gatcaaccgc
cccatgctcc 360aggcagctct catgctcagg aagaaaggat tcactactgc
catcctcacc aacacctggc 420tggacgaccg tgctgagaga gatggcctgg
cccagctgat gtgtgagctg aagatgcact 480ttgacttcct gatagagtcg
tgtcaggtgg gaatggtcaa acctgaacct cagatctaca 540agtttctgct
ggacaccctg aaggccagcc ccagtgaggt cgtttttttg gatgacatcg
600gggctaatct gaagccagcc cgtgacttgg gaatggtcac catcctggtc
caggacactg 660acacggccct gaaagaactg gagaaagtga ccggaatcca
gcttctcaat accccggccc 720ctctgccgac ctcttgcaat ccaagtgaca
tgagccatgg gtacgtgaca gtaaagccca 780gggtccgtct gcattttgtg
gagctgggct ggcctgctgt gtgcctctgc catggatttc 840ccgagagttg
gtattcttgg aggtaccaga tccctgctct ggcccaggca ggttaccggg
900tcctagctat ggacatgaaa ggctatggag agtcatctgc tcctcccgaa
atagaagaat 960attgcatgga agtgttatgt aaggagatgg taaccttcct
ggataaactg ggcctctctc 1020aagcagtgtt cattggccat gactggggtg
gcatgctggt gtggtacatg gctctcttct 1080accccgagag agtgagggcg
gtggccagtt tgaatactcc cttcatacca gcaaatccca 1140acatgtcccc
tttggagagt atcaaagcca acccagtatt tgattaccag ctctacttcc
1200aagaaccagg agtggctgag gctgaactgg aacagaacct gagtcggact
ttcaaaagcc 1260tcttcagagc aagcgatgag agtgttttat ccatgcataa
agtctgtgaa gcgggaggac 1320tttttgtaaa tagcccagaa gagcccagcc
tcagcaggat ggtcactgag gaggaaatcc 1380agttctatgt gcagcagttc
aagaagtctg gtttcagagg tcctctaaac tggtaccgaa 1440acatggaaag
gaactggaag tgggcttgca aaagcttggg acggaagatc ctgattccgg
1500ccctgatggt cacggcggag aaggacttcg tgctcgttcc tcagatgtcc
cagcacatgg 1560aggactggat tccccacctg aaaaggggac acattgagga
ctgtgggcac tggacacaga 1620tggacaagcc aaccgaggtg aatcagatcc
tcattaagtg gctggattct gatgcccgga 1680acccaccggt ggtctcaaag
atgtagaacg cagcgtagtg cccacgctca gcaggtgtgc 1740catccttcca
cctgctgggg caccattctt agtatacaga ggtggcctta cacacatctt
1800gcatggatgg cagcattgtt ctgaaggggt ttgcagaaaa aaaagatttt
ctttacataa 1860agtgaatcaa atttgacatt attttagatc ccagagaaat
caggtgtgat tagttctcca 1920ggcatgaatg catcgtccct ttatctgtaa
gaacccttag tgtcctgtag ggggacagaa 1980tggggtggcc aggtggtgat
ttctctttga ccaatgcata gtttggcaga aaaatcagcc 2040gttcatttag
aagaatctta gcagagattg ggatgcctta ctcaataaag ctaagatgac 2100t
2101323DNAArtificial Sequencesynthetic sEH target sequence
3cagtgttcat tggccatgac tgg 23421DNAArtificial Sequencesynthetic sEH
sense siRNA 4guguucauug gccaugacut t 21521DNAArtificial
Sequencesynthetic sEH antisense siRNA 5agucauggcc aaugaacact t
21623DNAArtificial Sequencesynthetic sEH target sequence
6gaaaggctat ggagagtcat ctg 23721DNAArtificial Sequencesynthetic sEH
sense siRNA 7aaggcuaugg agagucauct t 21821DNAArtificial
Sequencesynthetic sEH antisense siRNA 8gaugacucuc cauagccuut t
21923DNAArtificial Sequencesynthetic sEH target sequence
9aaaggctatg gagagtcatc tgc 231021DNAArtificial Sequencesynthetic
sEH sense siRNA 10aggcuaugga gagucaucut t 211121DNAArtificial
Sequencesynthetic sEH antisense siRNA 11agaugacucu ccauagccut t
211223DNAArtificial Sequencesynthetic sEH target sequence
12caagcagtgt tcattggcca tga 231321DNAArtificial Sequencesynthetic
sEH sense siRNA 13agcaguguuc auuggccaut t 211421DNAArtificial
Sequencesynthetic sEH antisense siRNA 14auggccaaug aacacugcut t
211523DNAArtificial Sequencesynthetic sEH target sequence
15cagcacatgg aggactggat tcc 231621DNAArtificial Sequencesynthetic
sEH sense siRNA 16gcacauggag gacuggauut t 211721DNAArtificial
Sequencesynthetic sEH antisense siRNA 17aauccagucc uccaugugct t
21189DNAArtificial Sequencesynthetic spacer sequence 18ttcaagaga
91923DNAArtificial Sequencesynthetic siRNA target sequence
19cagtgttcat tggccatgac tgg 232059DNAArtificial Sequencesynthetic
sense siRNA hairpin sequence 20gatccccgtg ttcattggcc atgactttca
agagaagtca tggccaatga acacttttt 592159DNAArtificial
Sequencesynthetic antisense siRNA hairpin sequence 21agctaaaaag
tgttcattgg ccatgacttc tcttgaaagt catggccaat gaacacggg
592223DNAArtificial Sequencesynthetic siRNA target sequence
22gaaaggctat ggagagtcat ctg 232359DNAArtificial Sequencesynthetic
sense siRNA hairpin sequence 23gatccccaag gctatggaga gtcatcttca
agagagatga ctctccatag ccttttttt 592459DNAArtificial
Sequencesynthetic antisense siRNA hairpin sequence 24agctaaaaaa
aggctatgga gagtcatctc tcttgaagat gactctccat agccttggg
592523DNAArtificial Sequencesynthetic siRNA target sequence
25aaaggctatg gagagtcatc tgc 232659DNAArtificial Sequencesynthetic
sense siRNA hairpin sequence 26gatccccagg ctatggagag tcatctttca
agagaagatg actctccata gcctttttt 592759DNAArtificial
Sequencesynthetic antisense siRNA hairpin sequence 27agctaaaaaa
ggctatggag agtcatcatc tcttgaaaga tgactctcca tagcctggg
592823DNAArtificial Sequencesynthetic siRNA target sequence
28caagcagtgt tcattggcca tga 232959DNAArtificial Sequencesynthetic
sense siRNA hairpin sequence 29gatccccagc agtgttcatt ggccatttca
agagaatggc caatgaacac tgctttttt 593059DNAArtificial
Sequencesynthetic antisense siRNA hairpin sequence 30agctaaaaaa
gcagtgttca ttggccattc tcttgaaatg gccaatgaac actgctggg
593123DNAArtificial Sequencesynthetic siRNA target sequence
31cagcacatgg aggactggat tcc 233259DNAArtificial Sequencesynthetic
sense siRNA hairpin sequence 32gatccccgca catggaggac tggattttca
agagaaatcc agtcctccat gtgcttttt 593359DNAArtificial
Sequencesynthetic antisense siRNA hairpin sequence 33agctaaaaag
cacatggagg actggatttc tcttgaaaat ccagtcctcc atgtgcggg
593420RNAArtificial Sequencesynthetic antisense sEH sequence
34uguccagugc ccacaguccu 203520RNAArtificial Sequencesynthetic
antisense sEH sequence 35uucccaccug acacgacucu 203620RNAArtificial
Sequencesynthetic antisense sEH sequence 36guucagccuc agccacuccu
203719RNAArtificial Sequencesynthetic antisense sEH sequence
37aguccucccg cuucacaga 193821RNAArtificial Sequencesynthetic
antisense sEH sequence 38gcccacuucc aguuccuuuc c 21
* * * * *
References