U.S. patent application number 13/271761 was filed with the patent office on 2013-02-14 for von willebrand factor (vwf) - cleaving protease.
This patent application is currently assigned to Juridical Foundation the Chemo-Sero-Therapeutic Research Institute. The applicant listed for this patent is Takayoshi Hamamoto, Hiroaki Maeda, Noriko Mimura, Tomohiro Nakagaki, Chikateru Nozaki, Kenji SOEJIMA. Invention is credited to Takayoshi Hamamoto, Hiroaki Maeda, Noriko Mimura, Tomohiro Nakagaki, Chikateru Nozaki, Kenji SOEJIMA.
Application Number | 20130041137 13/271761 |
Document ID | / |
Family ID | 27482239 |
Filed Date | 2013-02-14 |
United States Patent
Application |
20130041137 |
Kind Code |
A1 |
SOEJIMA; Kenji ; et
al. |
February 14, 2013 |
von Willebrand Factor (vWF) - Cleaving Protease
Abstract
This invention is intended to isolate and identify a
vWF-specific cleaving protease. The vWF-specific cleaving protease
cleaves a bond between residues Tyr 842 and Met 843 of vWF and
comprises a polypeptide chain having Leu-Leu-Val-Ala-Val (SEQ ID
NO: 1) as a partial sequence, and more preferably comprises a
polypeptide chain having the partial N-terminal amino acid sequence
of a mature protein,
Ala-Ala-Gly-Gly-Ile-Leu-His-Leu-Glu-Leu-Leu-Val-Ala-Val (SEQ ID NO:
2), and having a molecular weight of 105 to 160 kDa in SDS-PAGE
under reducing or non-reducing conditions. Isolation and
identification of this vWF-specific cleaving protease have led to
the possibility of replacement therapy for patients having diseases
resulting from a deficiency of the protease, such as thrombotic
thrombocytopenic purpura.
Inventors: |
SOEJIMA; Kenji;
(Kikuchi-gun, JP) ; Mimura; Noriko; (Kikuchi-gun,
JP) ; Maeda; Hiroaki; (Kikuchi-gun, JP) ;
Nozaki; Chikateru; (Kikuchi-gun, JP) ; Hamamoto;
Takayoshi; (Kumamoto-shi, JP) ; Nakagaki;
Tomohiro; (Kumamoto-shi, JP) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
SOEJIMA; Kenji
Mimura; Noriko
Maeda; Hiroaki
Nozaki; Chikateru
Hamamoto; Takayoshi
Nakagaki; Tomohiro |
Kikuchi-gun
Kikuchi-gun
Kikuchi-gun
Kikuchi-gun
Kumamoto-shi
Kumamoto-shi |
|
JP
JP
JP
JP
JP
JP |
|
|
Assignee: |
Juridical Foundation the
Chemo-Sero-Therapeutic Research Institute
|
Family ID: |
27482239 |
Appl. No.: |
13/271761 |
Filed: |
October 12, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12103899 |
Apr 16, 2008 |
8067221 |
|
|
13271761 |
|
|
|
|
11296294 |
Dec 8, 2005 |
7361748 |
|
|
12103899 |
|
|
|
|
10475538 |
Oct 22, 2003 |
7112666 |
|
|
PCT/JP2002/004141 |
Apr 25, 2002 |
|
|
|
11296294 |
|
|
|
|
Current U.S.
Class: |
530/387.9 |
Current CPC
Class: |
A61P 1/16 20180101; C12N
9/64 20130101; A61P 9/08 20180101; C12N 9/6489 20130101; A61P 17/00
20180101; A61P 9/04 20180101; C12N 9/6421 20130101; A61P 9/10
20180101; C12N 9/50 20130101; A61K 31/711 20130101; A61K 38/00
20130101; A61P 43/00 20180101; A61P 7/02 20180101 |
Class at
Publication: |
530/387.9 |
International
Class: |
C07K 16/40 20060101
C07K016/40 |
Foreign Application Data
Date |
Code |
Application Number |
Apr 25, 2001 |
JP |
JP2001-128342 |
Jul 27, 2001 |
JP |
JP2001-227510 |
Sep 28, 2001 |
JP |
JP2001-302977 |
Jan 25, 2002 |
JP |
JP2002-017596 |
Claims
1. An antibody against a protease comprising a polypeptide chain
having the amino acid sequence Leu-Leu-Val-Ala-Val, wherein the
protease is capable of cleaving a bond between residues Tyr-842 and
Met-843 of von Willebrand factor.
2. The antibody according to claim 1, wherein the antibody inhibits
or neutralizes the activity of a von Willebrand factor cleaving
protease.
3. A pharmaceutical composition or diagnostic agent comprising an
antibody against an isolated protease comprising a polypeptide
chain having the amino acid sequence Leu-Leu-Val-Ala-Val (SEQ ID
NO: 1), wherein the protease is capable of cleaving a bond between
residues Tyr-842 and Met-843 of von Willebrand factor.
Description
[0001] This application is a Divisional Application of U.S. Ser.
No. 12/103,899, filed Apr. 16, 2011, which is a Divisional
Application of U.S. Ser. No. 11/296,294, filed Dec. 8, 2005 Issued
U.S. Pat. No. 7,361,748, issue date Apr. 22, 2008, which is a
Divisional Application of U.S. Ser. No. 10/475,538, filed Oct. 22,
2003, Issued U.S. Pat. No. 7,112,666 issue date Sep. 26, 2006,
which is a 371 application of PCT/JP02/04141, filed Apr. 25, 2002,
which claims priority from Japanese patent applications JP
2001-128342, filed Apr. 25, 2001, JP 2001-227510, filed Jul. 27,
2001, JP 2001-302977, filed Sep. 28, 2001 and JP 2002-017596, filed
Jan. 25, 2002. The entire contents of each of the aforementioned
applications are incorporated herein by reference.
TECHNICAL FIELD
[0002] The present invention relates to a plasma protein related to
the field of medical drugs. More particularly, the present
invention relates to a protease that specifically cleaves von
Willebrand factor (it may be hereafter referred to as "vWF"), which
is associated with blood coagulation. The vWF-cleaving protease of
the present invention enables replacement therapy for patients with
diseases resulting from defects or decreases in this protease, such
as thrombotic thrombocytopenic purpura (it may be hereafter
referred to as "TTP"). In addition, the use thereof as a novel
antiplatelet thrombotic agent is expected.
BACKGROUND ART
[0003] vWF is produced in vascular endothelial cells or
megakaryocytes, and is a blood coagulation factor in which a single
subunit comprising 2,050 amino acid residues (monomers of about 250
kDa) are bound by an S--S bond to form a multimer structure (with a
molecular weight of 500 to 20,000 kDa). The level thereof in the
blood is about 10 .mu.g/ml, and a high-molecular-weight factor
generally has higher specific activity.
[0004] vWF has two major functions as a hemostatic factor. One of
the functions is as a carrier protein wherein vWF binds to the
blood coagulation factor VIII to stabilize it. Another function is
to form platelet plug by adhering and agglomerating platelets on
the vascular endothelial subcellular tissue of a damaged vascular
wall.
[0005] Thrombotic thrombocytopenic purpura is a disease that causes
platelet plug formation in somatic arterioles and blood capillaries
throughout the whole body. In spite of recent advances in medical
technology, the morbidity associated with this disease
approximately tripled from 1971 to 1991. Pathologically, TTP is
considered to result from vascular endothelial cytotoxicity or
vascular platelet aggregation. Immunohistologically, a large amount
of vWFs are recognized in the resulting platelet plugs, and vWF is
considered to play a major role in causing them. A normal or
high-molecular-weight vWF multimer structure is dominant in a TTP
patient, and an unusually large vWF multimer (ULvWFM) or large vWF
multimer (LvWFM) is deduced to play a major role in accelerating
platelet aggregation or microthrombus formation under high shearing
stress. In contrast, vWF was known to degrade at a position between
residues Tyr 842 and Met 843 by the action of vWF-cleaving protease
in the circulating blood of a healthy person under high shearing
stress. Accordingly, TTP is considered to occur in the following
manner. The protease activity in the plasma is lowered for some
reason, and ULvWFM to LvWFM are increased to accelerate platelet
aggregation. This forms platelet plugs in blood vessels.
[0006] Recently, Furlan et al. (Blood, vol. 87, 4223-4234: 1996, JP
Patent Publication (Kohyo) No. 2000-508918) and Tsai et al. (Blood,
vol. 87, 4235-4244: 1996) developed a method for assaying
vWF-specific cleaving protease. In their report, this protease
activity was actually lowered in TTP. The aforementioned authors
reported that this enzyme was metalloprotease in the plasma and
partially purified. However, they have not yet succeeded in the
amino acid sequencing which would specify the protease. There have
been no further developments since then.
DISCLOSURE OF THE INVENTION
[0007] Up to the present, plasmapheresis therapy has been performed
for treating patients who congenitally lack vWF-specific cleaving
protease and patients who had acquired positive antibodies against
this protease. Establishment of replacement therapy using purified
products or a pure substance such as a recombinant gene product of
the aforementioned protease is desired. Familial TTP patients
congenitally lack vWF-specific cleaving protease, and non-familial
TTP is caused by posteriori production of autoantibodies against
the aforementioned protease. Accordingly, replacement therapy for
this protease is preferable for familial TTP patients (plasma
administration is actually performed), and removal of
autoantibodies by plasmapheresis and substitution of this protease
are necessary for non-familial TTP. Further, the use of this
protease as a novel antiplatelet thrombotic agent can also be
expected.
[0008] As mentioned above, however, Furlan et al. (Blood, vol. 87,
4223-4234: 1996, JP Patent Publication (Kohyo) No. 2000-508918) and
Tsai et al. (Blood, vol. 87, 42354244: 1996) have suggested that
the vWF-cleaving protease was metalloprotease in the plasma. It was
reported to be partially purified, and concentrated 1,000- to
10,000-fold from the plasma in terms of its specific activity. Even
under these conditions, there has been no advancement in the
analysis of the properties of this protease, such as the amino acid
sequence of its protein, over the period of roughly 5 years that
has passed since then. No specific biological information has yet
been obtained regarding this protease. As reported by Furlan et
al., the protein of interest is supposed to be gigantic, and there
may be various problems associated therewith. For example,
diversified forms of this protease, such as various interacting
molecules or cofactors, are expected. Based on the complexity of
purification processes, deteriorated capacity of separation by
nonspecific interaction during the purification step, and other
factors, it is deduced to be very difficult to isolate and identify
the protease from a plasma fraction by the purification process
according to Furlan et al.
[0009] Under the above circumstances, the present inventors have
conducted concentrated studies in order to isolate and identify the
vWF-cleaving protease. As a result, they have succeeded in
isolating and purifying the vWF-cleaving protease of interest,
which had not yet been reported. Thus, they have succeeded in
identifying an amino acid sequence of the mature protein and a gene
encoding this amino acid sequence.
[0010] The vWF-cleaving protease of the present invention can
cleave a bond between residues Tyr 842 and Met 843 of vWF.
According to one embodiment, this protease has a molecular weight
of 105 to 160 kDa or 160 to 250 kDa in SDS-PAGE under reducing or
non-reducing conditions. It is comprised of a polypeptide chain
having Leu-Leu-Val-Ala-Val as a partial sequence. More preferably,
it is comprised of a polypeptide chain having the partial
N-terminal amino acid sequence of a mature protein, i.e.,
Ala-Ala-Gly-Gly-Ile-Leu-His-Leu-Glu-Leu-Leu-Val-Ala-Val. It is a
novel substance characterized by the following properties.
1) vWF-Cleaving Activity
[0011] According to the N-terminal sequence analysis of the
cleavage fragment, the protease of the present invention cleaves a
peptide bond between residues Tyr 842 and Met 843.
2) Fractionation by Gel Filtration
[0012] When fractionation is performed by gel filtration
chromatography using FI paste as a starting material, most
activities are collected in a fraction with a molecular weight of
150 to 300 kDa. According to one embodiment of the present
invention, an actually obtained active substance is found to have a
molecular weight of about 105 to 160 kDa in electrophoresis.
Accordingly, the protease of the present invention is a substance
that is likely to form a dimer or the like or to bind to another
molecule or a substance that can be easily degraded or can have a
heterogeneous sugar chain added.
3) Ammonium sulfate precipitation
[0013] For example, when FI paste is used as a starting material, a
large portion of this protease is recovered as a precipitation
fraction from a roughly purified fraction with the use of 33%
saturated ammonium sulfate.
4) SDS-PAGE
[0014] For example, the protease of the present invention derived
from FI paste prepared from pooled human plasma or cryoprecipitate
mainly has a molecular size of about 105 to 160 kDa determined by a
molecular weight marker in SDS-PAGE. Based on the nucleic acid
sequence as shown in SEQ ID NO: 15, when an amino acid sequence
represented by a frame between an atg initiation codon at position
445 and a tga termination codon at position 4726 is expressed by
gene recombination, there are some variations in molecular sizes
depending on a host. However, a molecular size of about 160 to 250
kDa determined by a molecular weight marker is exhibited. This size
is observed in the plasma of healthy humans and in that of some TTP
patients. Several molecular species of this protease are present in
human plasma, caused by the presence of alternative splicing
products (SEQ ID NOs: 16 to 21) recognized at the time of gene
cloning, differences in post-translational modification such as
sugar chain addition, or degradation during purification. Further,
this protease could be partially recovered in an active state after
SDS-PAGE under non-reducing conditions.
5) Analysis of Amino Acid Sequence
[0015] The amino acid sequence of the isolated polypeptide fragment
was analyzed. This presented an example of a polypeptide chain
having a sequence Leu-Leu-Val-Ala-Val (SEQ ID NO:1) as a partial
amino acid sequence and a sequence
Ala-Ala-Gly-Gly-Ile-Leu-His-Leu-Glu-Leu-Leu-Val-Ala-Val (SEQ ID NO:
2) as a N-terminal amino acid sequence of a mature protein.
Further, with current bioinformatics (BIOINFORMATICS: A Practical
Guide to the Analysis of Genes and Proteins, edited by Andreas D.
Baxevanis and B. F. Francis Ouellette), a nucleic acid sequence
encoding the amino acid sequence was highly accurately identified
by searching a database based on the aforementioned partial
sequence. More specifically, the genome database was searched by
the tblastn program. This identified a chromosome clone (AL158826)
that is deduced to encode the protease of the present invention.
Further, clones (AI346761 and AJ011374) that are deduced to be a
part of the protease of interest and a part of the polypeptide to
be encoded by the aforementioned genome were identified through
collation with the Expressed Sequence Tag (EST) database. Based
thereon, the amino acid sequence as shown in SEQ ID NO: 3 or 7 was
identified as an active vWF-cleaving protease site.
[0016] GCT GCA GGC GGC ATC CTA CAC CTG GAG CTG CTG GTG GCC GTG (SEQ
ID NO: 5), a sequence deduced from the genome, and more preferably
CTG CTG GTG GCC GTG (SEQ ID NO: 4), a portion thereof, the
transcriptome of which was confirmed by EST, was obtained. The
obtained nucleotide sequence was analyzed, and motif analysis was
carried out based on the deduced sequence. As a result, it was
found to have a metalloprotease domain as a candidate for the
protease of the present invention. Based on the above findings, it
became possible to disclose a sequence of a polypeptide chain as a
more specific example of the protease. Also, activities of
proteases are generally known to vary depending on, for example,
substitution, deletion, insertion, or introduction of point
mutation into a portion of the amino acid sequence (Blood
coagulation factor VII mutants, Soejima et al., JP Patent
Publication (Kokai) No. 2001-61479 A). Similarly, the protease of
the present invention can be modified by, for example, deletion,
substitution, or addition of one or several amino acids, to prepare
optimized proteases.
[0017] The protease proteins were further mass-produced, and 29
amino acid sequences from the N-terminus were determined. These
amino acid sequences are shown in SEQ ID NO: 8. This result is
substantially the same as the sequence as shown in SEQ ID NO: 3 or
7 deduced by bioinformatics. Only one difference is that the amino
acid 27th in SEQ ID NO: 3 or 7 was Glu while it was Arg according
to the present analysis of the N-terminal sequence. This was
considered to be a gene polymorphism. Thus, this protease was
confirmed to be comprised of a polypeptide chain having the amino
acid sequence as shown in SEQ ID NO: 3 or 7 at its N-terminus as a
mature unit. A gene fragment encoding this protease was then cloned
in the following manner.
[0018] Based on the nucleic acid sequence as shown in SEQ ID NO: 7,
a sense primer (SEQ ID NO: 9) and an antisense primer (SEQ ID NO:
10) were prepared based on the nucleic acid sequence underlined in
FIG. 9, and a gene sandwiched between these primers was amplified.
This fragment was cloned, and the nucleotide sequence was then
confirmed. This fragment was used as a probe for Northern blotting
to analyze the site at which the protease gene was expressed. As a
result, this protease gene was found to be expressed mainly in the
liver. Accordingly, the human liver cDNA library was purchased, and
a gene encoding this protease was identified using a rapid
amplification of cDNA ends (RACE) technique. Based on these
results, in the case of the largest sequence of approximately 5 kb
of mRNA (cDNA) reaching the poly(A) addition site as shown in SEQ
ID NO: 15 was identified.
[0019] Based on the amino acid sequence deduced from this gene
sequence, this protease was deduced to have a preprosequence, and
to belong to the disintegrin and metalloprotease (ADAM) family
having a disintegrin-like domain, a metalloprotease domain, and the
like, and particularly to the ADAM-TS family having a
thrombospondin Type-1 (TSP-1) domain. Finally, including those
having insertion or deletion in a part of the nucleic acid
sequence, isoforms as shown in SEQ ID NOs: 16 to 21 having
sequences as shown in SEQ ID NOs: 3 and 7 at the N-terminuses after
the mature preprosequence has been cleaved were identified. Thus,
the protease of the present invention should cleave vWF between
residues Tyr 842 and Met 843 and should have the
Leu-Leu-Val-Ala-Val (SEQ ID NO: 1) sequence as a partial amino acid
sequence.
[0020] The vWF-cleaving protease of the present invention can be
generally prepared by the following process.
[0021] According to the present invention, a process for assaying
the protease activity is characterized by the possibility of
evaluating activity within a short period of time. According to the
report by Furlan et al. (Blood, vol. 87, 4223-4234: 1996, JP Patent
Publication (Kohyo) No. 2000-508918 A), activity is assayed by
analyzing vWF-cleaving patterns by Western blotting using the
anti-vWF antibody, and thus, it takes time to transfer the protease
to a filter. More specifically, this process requires approximately
at least 45 hours in total, i.e., 24 hours for the enzymatic
reaction with a substrate vWF, 17 hours for electrophoresis, and 3
hours to transfer the protease to a filter, followed by detection
using the anti-vWF antibody. In contrast, the present inventors
completed activity assay in 18 hours in total, i.e., 16 hours for
the enzymatic reaction with a substrate vWF, and 2 hours for
electrophoresis and detection. This indicates that the time
required for the assay can be reduced to one third or less of that
required for the conventional assay. This can also shorten the time
required for the purification process, and in turn can lower the
degree of the protease to be inactivated. Accordingly, purification
efficiency is improved compared with that attained by the method of
Furlan et al., and as a result, the degree of purification is also
enhanced.
[0022] Further, the starting material was examined using the
aforementioned assay system. As a result, it was found that the
protease activity was more concentrated in FI paste than in the
cryoprecipitate that had been reported by Furlan et al. in the
past. FI paste was used as a starting material, and the
aforementioned rapid activity assay systems were combined. This
enabled isolation and identification of the protease of interest.
In a specific embodiment, a purification process combining gel
filtration chromatography with ion exchange chromatography is
employed, and the aforementioned activity assay system is also
combined.
[0023] More specifically, FI paste is solubilized with a buffer,
and the resultant is fractionated by gel filtration chromatography.
The protease activity is fractionated at the elution region with a
molecular weight of 150 to 300 kDa deduced from the size marker of
gel filtration. Thereafter, the resultant is precipitated and
concentrated using 33% saturated ammonium sulfate. This procedure
is repeated three times in total. The active fraction obtained in
the third gel filtration is pooled, and the resultant is subjected
to dialysis at 4.degree. C. overnight with a buffer comprising 50
mM NaCl added to 50 mM Tris-HCl (pH 7.1). Thereafter, the dialysis
product is subjected to anion exchange chromatography (DEAE) and
eluted stepwise with 0.25 M NaCl. The present inventors have
conducted concentrated studies in order to find a process for
isolating and identifying the protease of the present invention. As
a result, they found that, surprisingly, the protease was
recoverable as an active band after non-reducing SDS-PAGE. In order
to achieve further mass production, the purified and concentrated
fraction was applied to the Biophoresis utilizing the principle of
SDS-PAGE. Thus, a fraction having vWF-cleaving activity was
isolated from the electrophoresed fraction. According to the
approximate calculation of the specific activity up to this phase,
purification of about 30,000- to 100,000-fold was achieved. This
procedure was efficiently and rapidly repeated several times, and
thus, about 0.5 .mu.mole of sample that is the current limit of the
analysis of amino acid sequence was obtained. Thus, analysis of
amino acid sequence became feasible. More specifically, a final
step of separation and purification (Biophoresis) based on the
principle of SDS-PAGE is important, and it is based on the findings
as a result of concentrated studies, which had led to the
completion of the present invention.
[0024] According to the report by Furlan et al., specific activity
was improved by as much as about 10,000 times, although the
protease was not substantially isolated or identified. This could
be because of deactivation during purification or the difficulty of
isolating and identifying molecules, which were gigantic proteins
capable of interacting with various other proteins such as the
protease of the present invention by a separation method utilizing
various types of liquid chromatography. Further, the protease
content in the plasma was deduced to be very small, and thus, it
was necessary to await the establishment of the process according
to the present invention. Furthermore, the use of this process
enables the purification of recombinant genes.
[0025] Based on the findings of the present invention, peptides or
proteins prepared from the obtained sequences are determined to be
antigens. With the use thereof, a monoclonal antibody, a polyclonal
antibody, or a humanized antibody thereof can be prepared by
general immunization techniques (Current Protocols in Molecular
Biology, Antibody Engineering: A PRACTICAL APPROACH, edited by J.
McCAFFERTY et al. or ANTIBODY ENGINEERING second edition, edited by
Carl A. K. BORREBAECK). Alternatively, an antibody that binds to
the aforementioned protein can be prepared by antibody-producing
techniques utilizing phage display (Phage Display of Peptides and
Proteins: A Laboratory Manual, edited by Brian K. Kay et al.,
Antibody Engineering: A PRACTICAL APPROACH, edited by J. McCAFFERTY
et al. or ANTIBODY ENGINEERING second edition, edited by Carl A. K.
BORREBAECK). Alternatively, based on these techniques, a
neutralizing antibody acting against the protease activity or a
simple binding antibody can be isolated from a specimen from a TTP
patient who has an autoantibody positive against this protease.
These antibodies can be applied to diagnosis and therapy of
diseases such as TTP.
[0026] Based on the obtained genome or EST sequence, cDNA or a
genomic gene encoding the protease of the present invention can be
cloned by a common technique (Molecular Cloning, 2nd edition).
Further, bioinformatics techniques (BIOINFORMATICS: A Practical
Guide to the Analysis of Genes and Proteins, edited by Andreas D.
Baxevanis and B. F. Francis Ouellette) enable cloning of the
proteins of other animal species that are homologous thereto, and
the resultant gene is fractured by a common technique (for example,
Gene Targeting: A Practical Approach, First Edition, edited by A.
L. Joyner, Teratocarcinomas and embryonic stem cell a practical
approach) to produce TTP-like animal models. In particular, the
identification of the gene sequence encoding the protein derived
from a mouse enables the production of a knockout mouse having this
gene. Thus, a disease mouse model of congenital TTP or the like can
be prepared.
[0027] In accordance with a common technique (for example, J.
Sambrook et al., Molecular Cloning, 2nd edition, or CURRENT
PROTOCOLS IN MOLECULAR BIOLOGY), these genes are incorporated into
a suitable expression vector, the resultant is transformed into a
suitable host cell, and the gene recombinant product of the
protease can be thus prepared. In this case, the gene to be
incorporated is not necessarily the one that encoded the entire
region of the protein. It also includes a partial expression of the
protein as defined by a domain depending on its usage.
[0028] For example, the polynucleotide according to the present
invention is introduced into a host cell using a conventional
technique such as transduction, transfection, or transformation.
The polynucleotide is introduced solely or together with another
polynucleotide. Another polynucleotide is introduced independently,
simultaneously, or in combination with the polynucleotide of the
present invention.
[0029] For example, the polynucleotide of the present invention is
transfected in a host cell, such as a mammalian animal cell, by a
standard technique for simultaneous transfection and selection
using another polynucleotide encoding a selection marker. In this
case, the polynucleotide would be generally stably incorporated in
the genome of the host cell.
[0030] Alternatively, the polynucleotide may be bound to a vector
comprising a selection marker for multiplication in a host. A
vector construct is introduced to a host cell by the aforementioned
technique. In general, a plasmid vector is introduced as DNA of a
precipitate, such as a calcium phosphate precipitate, or a complex
with a charged lipid. Electroporation is also employed for
introducing the polynucleotide into a host. When the vector is a
virus, this virus is packaged in vitro or introduced into a
packaging cell, thereby introducing the packaged virus into a
cell.
[0031] Extensive techniques that are suitable for producing a
polynucleotide and introducing the resulting polynucleotide to a
cell in accordance with this embodiment of the present invention
are known and common in the art. Such techniques are described in
Sambrook et al. (aforementioned), and this document explains a
variety of standard experimental manuals describing the
aforementioned techniques in detail. In respect of this embodiment
of the present invention, the vector is, for example, a plasmid
vector, a single- or double-stranded phage vector, or a single- or
double-stranded RNA or DNA viral vector. Such a vector is
introduced into a cell as a polynucleotide, and preferably as DNA
by a common technique for the introduction of DNA or RNA into a
cell. When the vector is a phage or virus, the vector is preferably
introduced to the cell as a packaged or sealed virus by a known
technique for infection and transduction. A viral vector may be of
a replication-competent or defective type.
[0032] A preferable vector is a vector which expresses the
polynucleotide or polypeptide of the present invention in points.
In general, such a vector comprises a cis-action control region
that is effective for the expression in a host operably bound to
the polynucleotide to be expressed. When a suitable trans-action
factor (for example, a group of proteases involved with the
post-translational processing such as signal peptidase or Furin) is
introduced in a host cell, it is supplied by a host, a
complementary vector, or the vector itself.
[0033] In a preferable embodiment, a vector provides specific
expression. Such specific expression is an inducible one or
realized only in a certain type of cell. Alternatively, it is an
inducible and cell-specific expression. A particularly preferable
inducible vector can induce expression by an easily operable
environmental factor such as temperature or a nutritional additive.
Various vectors suitable for this embodiment including a
construction for the use in prokaryotic and eukaryotic cell hosts
and an inducible expression vector are known, and persons skilled
in the art can commonly use them.
[0034] A genetically engineered host cell can be cultured in
general nutrient medium, and it is modified to be particularly
suitable for activation of promoter, selection of transformant, or
amplification of a gene. In general, it would be obvious to persons
skilled in the art that conventional culture conditions such as
temperature or pH level for host cells selected for the expression
are suitable for the expression of the polypeptide of the
invention.
[0035] A wide variety of expression vectors can be used for
expressing the polypeptide of the present invention. Examples of
these vectors include chromosome, episome, and virus-derived
vectors. These vectors are derived from bacterial plasmid,
bacteriophage, yeast episome, yeast chromosome element, or viruses
such as baculovirus, papovavirus such as simian virus 40 (SV40),
vaccinia virus, adenovirus, fowlpox virus, pseudorabies virus, or
retrovirus. A vector derived from a combination of the
aforementioned, for example, a vector derived from plasmid and
bacteriophage gene element, more specifically, a cosmid or
phagemid, may also be used. They are used for the expression in
accordance with this embodiment of the present invention. In
general, since polypeptides were expressed in hosts, any vector
that is suitable for maintaining, multiplying, or expressing a
polynucleotide can be used for the expression according to the
aforementioned embodiment. A suitable DNA sequence is inserted into
a vector by various conventional techniques. In general, a DNA
sequence for expression is bound to an expression vector by
cleavage of a DNA sequence and an expression vector having 1 or
more restriction endonucleases, and a restriction fragment is then
bound together using T4 DNA ligase. Restriction and ligation
techniques that can be used for the above purpose are known and
common to persons skilled in the art. With regard thereto, Sambrook
et al. (aforementioned) very precisely describe another suitable
method for constructing an expression vector utilizing another
technique known and common to persons skilled in the art.
[0036] A DNA sequence in the expression vector is operably bound
to, for example, a suitable expression-regulating sequence
including a promoter to orient the mRNA transcription. A few
examples of known representative promoters are the phage lambda PI,
promoter, E. coli lac, trp, trc, and tac promoters, SV40 early and
late promoters, and the retrovirus LTR promoter. Many promoters
that are not described are suitable for the use according to the
embodiment of the present invention, known, and more easily used as
described in the examples of the present invention. In general, an
expression construct comprises a ribosome binding site for
translation in a transcription initiation or termination site or a
transcribed domain. The coding region of the mature transcript that
was expressed by the construct comprises the initiation AUG at the
initiation and termination codons located substantially at the
terminus of polypeptide to be translated. In addition, the
construct comprises a regulator region that regulates and induces
the expression. In general, such a region is activated through the
regulation of the repressor binding site, transcription of an
enhancer, or the like in accordance with various conventional
methods.
[0037] Vectors for multiplication and expression include selection
markers. Such markers are suitable for multiplication, or they
comprise additional markers for the above-stated purpose. The
expression vector preferably comprises one or more selection marker
genes to provide phenotypic traits for the purpose of selecting the
transformed host cell. A preferable marker includes dihydrofolate
reductase- or neomycin-resistance with regard to eukaryotic cell
culture. It has tetracycline- or ampicillin-resistance with regard
to E. coli and other bacterial cultures. A suitable vector
comprising a DNA sequence and a suitable promoter or regulatory
sequence as described herein are introduced to a suitable host by
various suitable known techniques for the expression of the
polypeptide of interest.
[0038] Representative examples of suitable hosts include: bacterial
cells such as E. coli, Streptomyces, and Salmonella typhimurium;
fungal cells such as a yeast cell; insect cells such as drosophila
S2 and Spodoptera Sf9 cells; and adhesive or floating animal or
plant cells such as CHO, COS, Bowes melanoma cells, and SP2/0.
Various hosts for expression constructs are known, and persons
skilled in the art can easily select a host for expressing
polypeptides in accordance with this embodiment based on the
disclosure of the present invention.
[0039] More specifically, the present invention includes a
recombinant construct, such as an expression construct comprising
one or more sequences as mentioned above. The construct is a
vector, such as a plasmid or viral vector comprising the sequence
of the present invention inserted therein. The sequence is inserted
in a positive or negative direction. In a preferable specific
example thereof, the construct further has a regulatory sequence
comprising a promoter or the like that is operably bound to the
sequence. Various suitable vectors and promoters are known to
persons skilled in the art, and there are many commercially
available vectors that are suitably used in the present
invention.
[0040] Commercially available vectors are exemplified below.
Vectors that are preferably used for bacteria are pQE70, pQE60, and
pQE-9 (Qiagen); pBS vector, PhageScript vector, Bluescript vector,
pNH8A, pNH16a, pNH18A, and pNH46A (Stratagene); and ptrc99a,
pKK223-3, pKK233-3, pDR540, and pRIT5 (Pharmacia). Examples of
preferable eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXT1, and
pSG (Stratagene) and pSVK3, pBPV, pMSG, and pSVL (Pharmacia). These
vectors are commercially available for persons skilled in the art
to be used in accordance with the embodiment of the present
invention, and they are merely a list of known vectors. For
example, other plasmids or vectors suitable for introducing,
maintaining, multiplying, or expressing the polynucleotide or
polypeptide of the present invention can also be used in hosts in
accordance with this embodiment of the present invention.
[0041] A promoter region can be selected from a gene of interest
using a vector comprising, for example, a candidate promoter
fragment, i.e., a reporter transcription unit lacking a promoter
region such as a chloramphenicol acetyl transferase (CAT)
transcription unit located downstream of restriction sites for
introducing promoter-containing fragments. As known to the public,
the introduction of the promoter-containing fragment into the
vector at the restriction site located upstream of the cat gene
generates CAT activity that can be detected by standard CAT assay.
A vector that is suitable for this purpose is known and readily
available. Examples of such vectors are pKK232-8 and pCM7.
Accordingly, the promoter for expressing the polynucleotide of the
present invention includes not only a readily available known
promoter but also a promoter that can be readily obtained using a
reporter gene in accordance with the aforementioned technique.
[0042] Among them, according to the present invention, examples of
known bacterial promoters that are suitably used to express
polynucleotides and polypeptides are E. coli lad and lacZ
promoters, T3 and T7 promoters, gpt promoter, lambda PR and PL
promoters, and trp and trc promoters. Examples of suitable known
eukaryotic promoters include the Cytomegalovirus (CMV) immediate
promoter, the HSV thymidine kinase promoter, early and late SV40
promoters, a retrovirus LTR promoter such as the Rous sarcoma virus
(RoSV) promoter, and a metallothionein promoter such as the
metallothionein-I promoter.
[0043] Selection of a vector and a promoter suitable for expression
in a host cell is a known technique. Techniques necessary for the
construction of expression vectors, introduction of a vector in a
host cell, and expression in a host are common in the art. The
present invention also relates to a host cell having the
aforementioned construct. A host cell can be a higher eukaryotic
cell such as a mammalian animal cell, a lower eukaryotic cell such
as a yeast cell, or a prokaryotic cell such as a bacterial
cell.
[0044] The construct can be introduced in a host cell by calcium
phosphate transfection, DEAE-dextran-mediated transfection,
cationic lipid-mediated transfection, electroporation,
transduction, infection, or other methods. These methods are
described in a variety of standard laboratory manuals, such as a
book by Sambrook et al.
[0045] The construct in a host cell can be used by a conventional
method, and it produces a gene product encoded by a recombinant
sequence. Alternatively, a partial polypeptide of the present
invention can be synthesized using a general peptide synthesizer. A
mature protein can be expressed under the control of a suitable
promoter in a mammalian animal, yeast, bacterial, or other cell.
Also, such a protein can be produced in a cell-free translation
system with the use of RNA derived from the DNA construct of the
present invention. Suitable cloning and expression vectors for
prokaryotic and eukaryotic hosts are described in Sambrook et al
(aforementioned).
[0046] In general, a recombinant expression vector comprises: a
replication origin; a promoter derived from a highly expressed gene
to orient the transcription of a downstream structural sequence;
and a selection marker for bringing the cell into contact with a
vector and isolating the vector-containing, cell. A suitable
promoter can be induced from a gene encoding glycolytic enzymes
such as 3-phosphoglycerate kinase (PGK), .alpha.-factor, acid
phosphatase, and heat shock protein. A selection marker includes E.
coli ampicillin-resistant gene and S. cerevisiae trp1 gene.
[0047] Transcription of DNA encoding the polypeptide of the present
invention using a higher eukaryotic cell may be enhanced by
inserting an enhancer sequence in a vector. The enhancer is
generally a cis-acting element for DNA for enhancing the promoter
transcription activity in the predetermined host cell. Examples of
an enhancer include the SV40 enhancer, the Cytomegalovirus early
promoter/enhancer, the polyoma enhancer behind the replication
origin, the .beta.-actin enhancer, and the adenovirus enhancer.
[0048] The polynucleotide of the present invention encoding a
heterologous structural sequence of the polypeptide of the present
invention is generally inserted in a vector by standard techniques
in such a manner that it is operably bound to the expression
promoter. The transcription initiation site of the polypeptide is
suitably located at the 5' site of the ribosome binding site. The
ribosome binding site is 5' relative to AUG that initiates the
translation of a polypeptide to be expressed. In general, an
initiation codon starts from AUG and another open reading frame
located between the ribosome binding site and initiation AUG is not
present. The termination codon is generally present at the terminus
of the polypeptide, and the adenylation signal and the terminator
are suitably located at the 3' end of the transcription region.
[0049] Regarding the secretion of the translated protein in the ER
lumen, in the cytoplasm, or to the extracellular environment, a
suitable secretion signal is incorporated in the expressed
polypeptide. The signal may be endogenous or heterologous to the
polypeptide.
[0050] Further, a prosequence subsequent to the signal sequence may
be endogenous or heterologous (e.g., a preprosequence of another
metal loprotease).
[0051] The polypeptide is expressed in a modified form such as a
fusion protein, and it includes not only a secretion signal but
also an additional heterologous functional region. Accordingly, an
additional amino acid, especially a charged amino acid region, or
the like, is added to the polypeptide to improve stability and
storage stability in the host cell during purification or
subsequent operation and storage. Alternatively, a given region may
be added to the polypeptide to accelerate the purification. This
type of region may be removed before the final preparation of
polypeptides. Induction of secretion or excretion, stability
improvement, or facilitation of purification with the addition of a
peptide portion to the polypeptide is a technique common and known
in the art.
[0052] Examples of prokaryotic hosts that are suitable for
multiplying, maintaining, or expressing the polynucleotide or
polypeptide of the present invention include E. coli, Bacillus
subtilis, and Salmonella typhimurium. Various types of Pseudomonas,
Streptomyces, and Staphylococcus are suitable hosts in this
respect. Furthermore, various other types of hosts known to persons
skilled in the art can be also used. Representative examples of
expression vectors that are useful for bacterial applications
include, but are not limited to, the replication origin of bacteria
derived from commercially available plasmid including a selectable
marker and a gene element of a known cloning vector pBR322 (ATCC
37017). Examples of such commercially available vectors include
pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1
(Promega Biotec, Madison, Wis., USA). These pBR322 (main chain)
sections are combined with a suitable promoter and structural
sequences to be expressed.
[0053] Host cells are suitably transformed and multiplied to the
optimal cell concentration. Thereafter, the selected promoter is
induced by a suitable means (e.g., temperature shifting or chemical
inducer), and cells are further cultured. Typically, cells are
collected by centrifugation and fractured by a physical or chemical
means. The resulting crude extract is further purified. Microbial
cells used for the protein expression can be fractured by any
convenient means selected from a freezing-thawing cycle,
ultrasonication, mechanical fracture, and the use of a cytolytic
agent. These methods are known to persons skilled in the art.
[0054] Various cell lines for mammalian animal cell culture can be
also used for the expression. An example of a cell line for
mammalian animal expression includes a monkey kidney fibroblast
COS-6 cell described in Gluzrnan et al., Cell 23: 175 (1981).
Examples of other cells that are capable of expressing compatible
vectors include C127, 3T3, CHO, HeLa, human kidney 293, and BHK
cells. Further, a floating myeloma cell line such as SP2/0 can be
also used.
[0055] A mammalian animal expression vector comprises a replication
origin, a suitable promoter and enhancer, a necessary ribosome
binding site, a polyadenylation site, splice donor and acceptor
sites, a transcription termination sequence, and a 5' franking
untranscribed sequence necessary for expression. DNA sequences
derived from the SV40 splice site and the SV40 polyadenylation site
arc used for the non-transformed or transcribed gene element of
interest. An example thereof is a CAG expression vector (H. Niwa et
al. Gene, 108, 193-199 (1991)).
[0056] Based on the gene sequence of the above protease, a probe,
primer, or antisense is designed by a common technique. The
antisense technique can be used for controlling gene expression by
the use of antisense DNA or RNA or the formation of a triple helix.
This technique is described in, for example, Okano, J., Neurochem.,
56: 560 (1991); OLIGODEOXYNUCLEOTIDES AS ANTISENSE INHIBITORS OF
GENE EXPRESSION, CRC Press, Boca Raton, Fla. (1988). The triple
helix formation is examined in, for example, Lee et al., Nucleic
Acids Research 6: 3073 (1979); Cooney et al., Science 241: 456
(1988); and Dervan et al., Science 251: 1360 (1991). The method is
based on the polynucleotide bond with complementary DNA or RNA.
This enables the gene diagnosis or gene therapy.
[0057] For example, cells obtained from a patient are subjected to
ex vivo genetic engineering using a polynucleotide such as
polypeptide-encoding DNA or RNA. The resulting cells are then
supplied to patients who should be treated with polypeptides. For
example, cells can be subjected to ex vivo genetic engineering
using a retrovirus plasmid vector comprising RNA encoding the
polypeptide of the present invention. Such a technique is known in
the art, and the use thereof in the present invention is obvious
according to the description given herein. Similarly, cells are
subjected to in vitro genetic engineering in accordance with a
conventional process in respect of in vivo polypeptide expression.
For example, the polynucleotide of the present invention is
genetically engineered for expression in the replication-deficient
retrovirus vector as mentioned above. Subsequently, the retrovirus
expression construct is isolated, introduced to a packaging cell,
and transduced using a retrovirus plasmid vector comprising RNA
encoding the polypeptide of the present invention. Thus, the
packaging cell produces infectious viral particles having a control
gene. These producer cells are subjected to in vitro genetic
engineering and then administered to patients to allow polypeptides
to be expressed in vivo. This administration method and other
methods for administering polypeptides according to the present
invention would be clearly understood by persons skilled in the art
based on the teaching of the present invention.
[0058] Examples of the aforementioned retrovirus, from which the
retrovirus plasmid vector is derived, include, but are not limited
to, Moloney murine leukemia virus, spleen necrosis virus, Rous
sarcoma virus, Harvey sarcoma virus, avian leukosis virus, gibbon
leukemia virus, human immunodeficiency virus, myeloproliferative
sarcoma virus, and mammary tumor virus. This type of vector
comprises one or more promoters to express polypeptides. Examples
of suitable promoters that can be used include, but are not limited
to, retrovirus LTR, SV40 promoter, CMV promoter described in Miller
et al., Biotechniques 7: 980-990 (1989), and other promoters (e.g.,
cell promoters such as a eukaryotic cell promoter including, but
not limited to, histone, RNA polymerase III, and .beta.-actin
promoter). Examples of other viral promoters that can be used
include, but are not limited to, adenovirus promoter, thymidine
kinase (TK) promoter, and B19 Parvovirus promoter. Persons skilled
in the art can readily select a suitable promoter based on the
teaching of the present invention.
[0059] A nucleic acid sequence that encodes the polypeptide of the
present invention is under the control of a suitable promoter.
Examples of suitable promoters that can be used include, but are
not limited to, adenovirus promoter such as adenovirus major late
promoter, heterologous promoter such as CMV promoter, respiratory
syncytial virus (RSV) promoter, inducible promoter such as MMT
promoter or metallothionein promoter, heat shock promoter, albumin
promoter, ApoAI promoter, human globin promoter, viral thymidine
kinase promoter such as herpes simplex thymidine kinase promoter,
retrovirus LTR including the aforementioned modified retrovirus
LTR, .beta.-actin promoter, and human growth hormone promoter. A
promoter may be of a native type that controls the gene encoding
polypeptides. A retrovirus plasmid vector is used to transduce the
packaging cell line to form a producer cell line.
[0060] Examples of packaging cells to be transfected include, but
are not limited to, PE501, PA317, Y-2, Y-AM, PA12, T19-14X,
VT-19-17-H2, YCRE, YCRIP, GP+E-86, GP+envAm12, and the DAN cell
line described in Miller, Human Gene Therapy 1: pp. 5-14
(1990).
[0061] A vector is transduced in a packaging cell by a means known
in the art. Examples of such means include, but are not limited to,
electroporation, the use of a liposome, and CaPO.sub.4
precipitation. Alternatively, a retrovirus plasmid vector is sealed
in a liposome or bound to a lipid to be administered to a host. A
producer cell line produces infectious retrovirus vector particles
comprising nucleic acid sequences encoding polypeptides. Such
retrovirus vector particles are used to transduce eukaryotic cells
in vitro or in vivo.
[0062] The transduced eukaryotic cells express nucleic acid
sequences encoding polypeptides. Examples of eukaryotic cells that
may be transduced include, but are not limited to, germinal stem
cells, embryonal carcinoma cells, hematopoietic stem cells, hepatic
cells, fibroblasts, sarcoblasts, keratinocytes, endothelial cells,
and bronchial epithelial cells.
[0063] The protease of the present invention, an antibody against
this protease, an antagonist of this protease, an inhibitor, an
agonist, an activity modifier, or the like can be diluted with
physiological saline, buffer, or the like to prepare a formulation.
Thus, a pharmaceutical composition can be obtained. The pH value of
the formulation is preferably between acidulous and neutral: close
to the pH level of body fluid. The lower limit thereof is
preferably between 5.0 and 6.4, and the upper limit is preferably
between 6.4 and 7.4. Alternatively, the formulation can be provided
in a state that allows storage for a long period of time, e.g., in
a lyophilized state. In such a case, the formulation can be used by
being dissolved in water, physiological saline, butler, or the like
at a desired concentration level at the time of use.
[0064] The formulation of the present invention may comprise a
pharmacologically acceptable additive, such as a carrier,
excipient, or diluent that is commonly used for pharmaceuticals, a
stabilizer, or pharmaceutically necessary ingredients. Examples of
a stabilizer include monosaccharides such as glucose, disaccharides
such as saccharose and maltose, sugar alcohols such as mannitol and
sorbitol, neutral salts such as sodium chloride, amino acids such
as glycine, nonionic surfactants such as polyethylene glycol,
polyoxyethylene and polyoxypropylene copolymers (Pluronic),
polyoxyethylene sorbitan fatty acid ester (Tween), and human
albumin. Addition thereof in amounts of about 1 to 10 w/v % is
preferable.
[0065] An effective amount of the pharmaceutical composition of the
present invention can be administered by, for example, intravenous
injection, intramascular injection, or hypodermic injection in one
or several separate dosages. The dosage varies depending on
symptom, age, body weight, or other factors, and it is preferably
0.001 mg to 100 mg per dose.
[0066] Also, sense or antisense DNA encoding the protease of the
present invention can be similarly prepared in a formulation to
obtain a pharmaceutical composition.
[0067] Further, the present invention includes methods for
inhibiting platelet plug formation involved with heart infarction
or brain infarction, methods for inhibiting arteriosclerosis,
methods for preventing restenosis, reembolization, or infarction
involved with PTCA, methods for preventing reembolization involved
with PTCR, and methods for preventing platelet plug formation
caused by HUS or O-157 through the administration of the peptide,
protein, and DNA of the present invention. Furthermore, the present
invention includes the use of the peptide, protein, and DNA of the
present invention in the production of pharmaceuticals for
inhibiting platelet plug formation involved with heart infarction
or brain infarction, pharmaceuticals for inhibiting
arteriosclerosis, pharmaceuticals for preventing restenosis,
reembolization, or infarction involved with PICA, pharmaceuticals
for preventing reembolization involved with PTCR, and
pharmaceuticals for preventing platelet plug formation caused by
HUS or O-157.
[0068] The peptide or protein of the present invention is used as a
leading substance for amino acid modification. This enables the
preparation of a molecule having activity that is different from
that of the protease of the present invention. An example thereof
is a variant molecule that can be obtained by preparing an
antagonist, which is obtained by preparing a variant deactivated
through amino acid substitution between an amino acid residue
located around the active center in the metalloprotease domain and
another amino acid, separating a molecule recognition site from a
catalytic site, or varying one or both of these sites.
[0069] The use of an evaluation system for the vWF-cleaving
activity described herein enables the production of an
antagonist/agonist. For example, an effective antagonist can be a
small organic molecule, a peptide, or a polypeptide. An example
thereof is an antibody that is bound to the polypeptide of the
present invention, thereby inhibiting or eliminating its
activity.
[0070] Similarly, the use of the aforementioned evaluation system
for vWF-cleaving activity enables the screening for a compound that
is capable of cleaving vWF. In such a case, the cleaving activity
of the test compound may be evaluated using the aforementioned
evaluation system.
BRIEF DESCRIPTION OF THE DRAWINGS
[0071] FIG. 1 is a diagram showing the vWF multimer structure and
the point cleaved by the vWF-cleaving protease.
[0072] FIG. 2 is a photograph showing the result of vWF multimer
analysis (agarose electrophoresis).
[0073] FIG. 3 is a photograph showing the result of SDS-PAGE (5%
gel) for analyzing the caving activity of each plasma fraction
under reducing conditions.
[0074] FIG. 4 is a photograph showing the result of SDS-PAGE (5%
gel) for analyzing the solubilized sample of fraction 1 (F1) paste
under non-reducing conditions.
[0075] FIG. 5 is a photograph showing the result of analyzing
vWF-cleaving protease fractions after being subjected to gel
filtration chromatography three times using the solubilized sample
of F1 paste as a starting material. FIG. 5A is a chart showing gel
filtration chromatography, FIG. 5B shows the result of SDS-PAGE on
fractions under non-reducing conditions, and FIG. 5C shows the
results of SDS-PAGE on vWF-cleaving activity under reducing
conditions.
[0076] FIG. 6 is a photograph showing the results of analyzing
vWF-cleaving protease fractions in which the fraction collected by
gel filtration chromatography is purified by DEAE anion exchange
chromatography. FIG. 6A is a chart showing gel filtration
chromatography, FIG. 6B shows the result of SDS-PAGE (8% gel) on
elution fractions under non-reducing conditions, and FIG. 6C shows
the results of SDS-PAGE on vWF-cleaving activity under reducing
conditions. In FIG. 6C, three bands indicate an intact vWF molecule
(remaining uncleaved), a vWF cleavage fragment, and a vWF cleavage
fragment, respectively, as in FIG. 5C.
[0077] FIG. 7 is a photograph showing an electrophoresed fragment
obtained when the vWF-cleaving protease fraction purified and
concentrated by DEAF anion exchange chromatography is further
purified by Biophoresis-based SDS-PAGE (non-reducing
conditions).
[0078] FIG. 8 is a photograph showing the result of electrophoresis
on a fraction obtained by further purifying a vWF-cleaving protease
fraction by Biophoresis-based SDS-PAGE for analyzing vWF-cleaving
protease activity and SDS-PAGE on active fractions under reducing
conditions. FIG. 8A shows the results of SDS-PAGE for analyzing
vWF-cleaving protease activity under non-reducing conditions, and
FIG. 8B shows the results of SDS-PAGE for analyzing active
fractions under reducing conditions.
[0079] FIG. 9 relates to the identification of the vWF-cleaving
protease gene, which is a diagram showing primers used for
amplifying the gene fragment for a Northern blot probe.
[0080] FIG. 10 relates to the identification of the vWF-cleaving
protease gene, which is a photograph showing Northern blot
autoradiography. FIG. 10A shows the results obtained when the
protease-encoding gene is used as a probe, and FIG. 10B shows the
results obtained when a .beta.-actin probe (RNA control) is
used.
[0081] FIG. 11 relates to the identification of the vWF-cleaving
protease gene, and is a diagram showing the locations and the
sequences of the primers used in the RACE experiments.
[0082] FIG. 12 is a diagram showing the locations of primers
designed for cloning full-length cDNA.
[0083] FIG. 13 is a diagram showing a process for constructing a
vector containing full-length cDNA.
[0084] FIG. 14 is a photograph showing the expression in various
cell lines (Western blotting under reducing conditions using
anti-FLAG antibody, where the mock is prepared by inversely
inserting a gene in an expression vector). In FIG. 14, each lane
shows the results using the indicated sample.
Lane 1: Mock (host: 293 cell) Lane 2: vWF-cleaving protease,
cDNA+FLAG (host: 293 cell) Lane 3: Mock (host: HepG2 cell) Lane 4:
vWF-cleaving protease, cDNA+FLAG (host: HepG2 cell) Lane 5: Mock
(host: Hela cell) Lane 6: vWF-cleaving protease, cDNA+FLAG (host:
Hela cell)
[0085] FIG. 15 is a photograph showing the activity assay of
recombinant expression protease (analysis of vWF-cleavage by
SDS-PAGE under non-reducing conditions, where the mock is prepared
by inversely inserting a gene in an expression vector). In FIG. 15,
each lane shows the results using the indicated sample.
Lane 1: Mock (host: Hela cell) Lane 2: Supernatant in which
vWF-cleaving protease was expressed (host: Hela a cell) Lane 3:
Mock (host: HepG2 cell) Lane 4: Supernatant in which vWF-cleaving
protease was expressed (host: HepG2 cell) Lane 5: Mock (host: 293
cell) Lane 6: Supernatant in which vWF-cleaving protease was
expressed (host: 293 cell) Lane 7: Mock (host: BHK cell) Lane 8:
Supernatant in which vWF-cleaving protease was expressed (host: BHK
cell) Lane 9: Mock (host: COS cell) Lane 10: Supernatant in which
v-cleaving protease was expressed (host: COS cell) Lane 11: Mock
(host: CHO cell) Lane 12: Supernatant in which vWF-cleaving
protease was expressed (host: CHO cell)
[0086] FIG. 16 is a photograph showing the result of Western
blotting using an antibody established against the protease of the
present invention, wherein Western blotting is carried out for
various antiserums using the 293 cell as a host and a recombinant
vWF-cleaving protease. In FIG. 16, each lane shows the results
obtained with the use of the indicated sample.
Lane 1: Mouse antiserum (prepared by administering purified
protein) Lane 2: Rabbit antiserum (prepared by hypodermically
administering an expression vector to a rabbit) Lane 3: Untreated
rabbit antiserum Lane 4: Rabbit antiserum (prepared by
administering KLH-conjugated partial synthetic peptide)
[0087] FIG. 17 is a photograph showing the result of Western
blotting using an antibody established against the protease of the
present invention, wherein various samples derived from human
plasma and recombinant expression units are detected using rabbit
antiserum obtained by administering full-length cDNA of
vWF-cleaving protease. In FIG. 17, each lane shows the results
obtained with the use of the indicated sample.
Lane 1: Partially purified sample derived from human plasma
cryoprecipitate Lane 2: Purified vWF-cleaving protease derived from
human plasma Lane 3: Gel-filtrated FI paste sample obtained from
pooled human plasma Lane 4: Recombinant vWF-cleaving protease
(host: 293 cell) Lane 5: Recombinant vWF-cleaving protease (host:
Hela cell)
[0088] FIG. 18 is a photograph showing the result of Western
blotting using an antibody established against the protease of the
present invention, wherein rabbit antiserum obtained by immunizing
a rabbit with a partially synthesized peptide of the vWF-cleaving
protease is used to confirm the vWF-cleaving protease in healthy
human plasma and that in the plasma and gene recombinant
vWF-cleaving protease of a TTP patient. In FIG. 18, each lane shows
the results obtained with the use of the indicated sample.
Lane 1: Gel-filtrated FI paste sample obtained from pooled human
plasma Lane 2: Normal human plasma 1 Lane 3: Normal human plasma 2
Lane 4: Normal human plasma 3 Lane 5: TTP patients plasma 1 Lane 6:
TTP patients plasma 2 Lane 7: Recombinant vWF-cleaving protease
(host: 293 cell) Lane 8: Recombinant vWF-cleaving protease (host:
Hela cell)
[0089] FIG. 19 is a diagram showing the result of ELISA using an
antibody prepared against the vWF-cleaving protease.
[0090] FIG. 20 is a photograph showing the result of SDS-PAGE
(silver staining) analyzing each fraction of affinity purified
vWF-cleaving protease using an antibody under reducing conditions.
In FIG. 20, each lane shows the results obtained with the use of
the indicated sample.
Lane 1: Applied culture supernatant (diluted 10-fold) Lane 2:
Passed-through fraction Lane 3: Washed fraction Lane 4: Elution
fraction
[0091] FIG. 21 is a photograph showing the results of evaluating
neutralizing activity using an antibody (SDS-PAGE for analyzing
vWF-cleaving activity under non-reducing conditions). In FIG. 21,
each lane shows the results obtained with the use of the indicated
sample.
Lane 1: vWF-cleaving protease solution: normal rabbit serum=1:1
Lane 2: vWF-cleaving protease solution normal rabbit serum (diluted
5-fold)=1:1 Lane 3: vWF-cleaving protease solution:
peptide-immunized rabbit serum=1:1 Lane 4: vWF-cleaving protease
solution: peptide-immunized rabbit serum (diluted 5-fold)=1:1 Lane
5: vWF-cleaving protease solution: recombinant protein-immunized
rabbit serum=1:1 Lane 6: vWF-cleaving protease solution:
recombinant protein-immunized rabbit serum (diluted 5-fold)=1:1
Lane 7: vWF-cleaving protease solution: 10 mM EDTA=1:1 Lane 8:
vWF-cleaving protease solution: buffer only=1:1 Lane 9: buffer
(without vWF-cleaving protease): buffer=1:1
[0092] FIG. 22 is a diagram showing the construction of an
expression vector for a molecular species lacking a C-terminal
domain.
BEST MODES FOR CARRYING OUT THE INVENTION
[0093] The present invention is hereafter described in detail with
reference to the following examples, although it is not limited to
these examples.
Example 1
Preparation of vWF
[0094] A plasma cryoprecipitation (2g) was dissolved in 20 ml of
buffer (0.01% Tween-80/50 mM Tris-HCl/100 mM NaCl, pH 7.4), and the
resultant was subjected to gel filtration using a Sephacryl S-500
HR Column (2.6.times.90 cm, Amersham Pharmacia) to prepare vWF.
Fractions were recovered at a flow rate of 2 ml/min in amounts of 6
ml each, vWF was analyzed by Western blotting using a
peroxidase-labeled rabbit anti-human vWF antibody (DAKO), and
high-molecular-weight vWF fractions were pooled. The pooled
fractions were subjected to multimer analysis using agarose
electrophoresis as described below.
[0095] As shown in FIG. 1, vWF originally has a multimer structure
in which vWF monomer molecules are polymerized with each other at
their N-terminuses or at their C-terminuses, and vWF is subjected
to partial hydrolysis by the vWF-specific cleaving protease. As a
result of the analysis, as shown in FIG. 2, the purified vWF
exhibited a multimer pattern based on agarose electrophoresis
approximately equivalent to that in the plasma of a healthy person
(the ladder in the drawing shows the electrophoresis pattern of vWF
having a multimer structure, and the upper portion indicates vWF
with advanced polymerization). This can prepare vWF comprising
substantially no impurities that degrade it, and this fraction was
used as a substrate when assaying the vWF-cleaving activity as
described below.
Example 2
vWF-Cleaving Reaction
[0096] vWF-cleaving activity was assayed as follows. A sample
comprising 10 mM barium chloride (final concentration) was
pre-incubated at 37.degree. C. for 5 minutes to activate protease.
A buffer (15 to 20 ml, 1.5 M urea/5 mM Tris-HCl, pH 8.0) was placed
in a 50 ml Falcon Tube. Subsequently, a membrane filter (0.025
.mu.m. Millipore) was floated therein, and 100 .mu.l of activated
sample prepared by mixing with 50 .mu.l of vWF substrate solution
was added. The resultant was allowed to stand in an incubator
(37.degree. C.) overnight and recovered from the filter on the next
day. The recovered sample was evaluated based on the vWF cleavage
pattern as described below in the "SDS-PAGE" section.
SDS-PAGE
[0097] SDS-5% polyacrylamide gel was autologously prepared and
used. An SDS electrophoresis buffer (2 in the presence or absence
of a reducing agent, i.e., 2-mercaptoethanol) was added to 10 .mu.l
of the sample described in the "vWF-cleaving activity assay"
section, and the resultant was boiled for 3 minutes to prepare an
electrophoresis sample. The gel was subjected to electrophoresis at
30 mA for 1 hour and then stained with the Gel Code Blue Stain
Reagent (PIERCE) utilizing CBB staining. As shown in FIG. 1,
activity is evaluated based on the development of a cleavage
fragment and the presence or absence of fragments remaining
uncleaved under reducing or non-reducing conditions. This is more
specifically described in Example 3 and FIG. 3 below.
Multimer Analysis Utilizing Agarose Electrophoresis
Preparation of Gel, Electrophoresis
[0098] Low gelling temperature agarose (Type VII, Sigma) was added
to 375 mM Tris-HCl (pH 6.8) until a concentration of 1.4% was
reached, followed by heating in a microwave oven to completely
dissolve the gel. Thereafter, 0.1% SDS was added, and the resultant
was maintained at 56.degree. C. The resultant was made to flow into
a gel mold and solidified by cooling at 4.degree. C. overnight
(running gel). The next day, high gelling temperate agarose
(SeaKem) was mixed with 375 mM Tris-HCl (pH 6.8) until a
concentration of 0.8% was reached, and dissolved by boiling in a
microwave oven. Thereafter, the resultant was maintained at
56.degree. C. (stacking gel). The gel prepared on the previous day
was cleaved, leaving a 10-cm fraction from the end uncleaved. The
aforementioned gel was made to flow into the cleaved portion, and
the gel was made to keep flowing at 4.degree. C. for at least 3
hours, followed by solidification. Pyronin Y was added to the
sample described in the "vWF cleaving activity assay" section
above, and the gel was prepared under non-reducing conditions
without boiling. The gel was subjected to electrophoresis at 10 mA
for at least 24 hours using an SDS-PAGE buffer.
Western Blotting
[0099] After the electrophoresis, the gel was immersed in a
transcription buffer (0.005% SDS, 50 mM phosphate buffer, pH 7.4)
for 10 minutes, and the resultant was transferred to a
nitrocellulose membrane using a transcription apparatus at
4.degree. C. at 0.5 A overnight. Blocking was performed using a
blotting solution (5% skim milk, PBS) for 30 minutes, and the gel
was then allowed to react for at least 6 hours with the
peroxidase-labeled rabbit anti-human vWF antibody (DAKO), which was
diluted 1,000-fold with the blotting solution. Thereafter, the gel
was washed three times with the blotting solution and once with
PBS, and color was developed using Konica Immunostain HRP-1000
(Konica), which was a substrate reaction solution for peroxidase.
The purified vWF analyzed in this assay was found to have been
undegraded, but was sufficiently usable as a substrate in the
present invention (FIG. 2).
Example 3
Preparation of vWF-Cleaving Protease
[0100] Plasma was subjected to ethanol fractionation developed by
Cohn. A protease having high vWF-cleaving activity (one with high
specific activity) when protein levels in four fractions (i.e.,
starting plasma, cryoprecipitate, fraction I (FI) supernatant, and
a paste) are made equivalent to each other was selected. As shown
in FIG. 3, the protease activity was highest in the FI paste. The
N-terminal sequence of this cleavage fragment was analyzed, and as
a result, activity derived from the cryoprecipitate and the FI
paste were found to cleave the peptide bond between residues Tyr
842 and Met 843. Thus, the FI paste was determined to be a main
starting material for purification thereafter.
Solubilization of FI Paste
[0101] The FI paste was fractionated in fractions of 12g each and
then cryopreserved. The paste was allowed to melt at 4.degree. C.
the day before its use. The next day, 120 ml of solubilizing buffer
(0.05% azide, 50 mM Tris-HCl (pH 7.4), 100 mM NaCl) was added at 10
mg/ml, and the mixture was stirred at 37.degree. C. for 2 hours.
The product was centrifuged at 10,000 rpm for 10 minutes, and the
supernatant was then recovered, followed by filtration with a
prefilter, a 5.0 .mu.m filter, and a 0.8 um filter in that order.
The resultant was determined to be a solubilized sample. FIG. 4
shows the result of SDS-PAGE of the solubilized sample.
Gel Filtration Chromatography of vWF-Cleaving Protease
[0102] The solubilized FI paste was applied to a Sephacryl S-300 HR
Column (5.times.90 cm, Amersham Pharmacia) to conduct the first gel
filtration. A buffer comprising 0.05% azide, 50 mM Tris-HCl (pH
7.4), and 100 mM NaCl (hereinafter referred to as an "elution
buffer"), which was the same as the solubilizing buffer, was used.
The flow rate was 5 ml/min, fractionation was initiated at 600 ml
after the sample application, and fractions were recovered in
amounts of 10 ml each. Fractions were subjected to the vWF-cleaving
reaction, and their activities were then analyzed by SDS-PAGE.
Fractions that exhibited protease activity were pooled, and a small
amount of saturated ammonium sulfate was gradually added dropwide
thereto until a final concentration of 33% saturation was reached.
The mixture was further allowed to stand at 4.degree. C. overnight.
The next day, the product was centrifuged at 10,000 rpm for 10
minutes, and an active fraction of interest was recovered as a
precipitate. The procedures comprising solubilization, gel
filtration, and ammonium sulfate precipitation were performed for 5
batches and the resultant was cryopreserved at -20.degree. C.
[0103] The ammonium sulfate precipitates (2 to 3 batches) obtained
by the first gel filtration were dissolved in 50 ml of elution
buffer, and passed through the Sephacryl S-300 HR Column
(5.times.90 cm) in the same manner as in the first gel filtration
to perform the second gel filtration. The elution buffer,
conditions, operations, and the like were the same as those in the
first gel filtration. Fractions were subjected to the vWF-cleaving
reaction, and their activities were then analyzed by SDS-PAGE.
Fractions with activity were pooled, and ammonium sulfate
precipitation was similarly performed. These procedures were
repeated two times.
[0104] The ammonium sulfate precipitates (2 batches) obtained by
the second gel filtration were dissolved in 50 ml of elution
buffer, and applied to the Sephacryl S-300 HR Column (5.times.90
cm) in the same manner as in the first and the second gel
filtration to perform the third gel filtration. The elution buffer,
conditions, operations, and the like were the same as those in the
first and the second gel filtration. Fractions were subjected to
the vWF-cleaving reaction, and their activities were then analyzed
by SDS-PAGE, followed by pooling. FIG. 5 shows SDS-PAGE for
analyzing these fractions and that for analyzing vWF-cleaving
activity. Based on the patterns of gel filtration and the data
showing activity, the protease of the present invention was found
to be eluted in the region between fraction 37 and fraction 47.
Based on a separately conducted elution experiment for
high-molecular-weight gel filtration marker (Amersham Pharmacia),
this site of elution was deduced to have a molecular weight
equivalent to 150 to 300 kDa. In this phase, considerable amounts
of impurities were still present.
[0105] DEAE Anion Exchange Chromatography
[0106] The pooled fraction obtained by three gel filtration
operations was subjected to dialysis overnight with a buffer
comprising 50 mM Tris-HCl and 50 mM NaCl (pH 7.1). After the
dialysis, anion exchange chromatography was performed using a 5 ml
HiTrap DEAE-Sepharose Fast Flow Column (Pharmacia) to conduct
further purification and concentration. Equilibrating and washing
were performed using a buffer comprising 50 mM Tris-HCl (pH 7.1),
and elution was performed using 0.25 M NaCl. The flow rate was 5
ml/min, and 5 fractions of 5 ml each were recovered and pooled.
FIG. 6 shows the results of SDS-PAGE for analyzing elution
fractions and those for analyzing vWF-cleaving activity. Based on
SDS-PAGE for activity assay, the protease of the present invention
having vWF-cleaving activity was considerably effectively
concentrated in the elution fraction.
Fractionation Utilizing SDS-PAGE
[0107] The sample (5 ml) purified and concentrated by DEAE anion
exchange chromatography was further concentrated to 0.5 ml using
Centricon (molecular weight cut off: 10,000 Da, Amicon). The
protease of the present invention was isolated by Biophoresis III
(Atto Corporation) utilizing SDS-PAGE. In accordance with the
Laemmli method (Nature, vol. 227, 680-685, 1970), a buffer for
electrophoresis tanks was prepared, and developed with 8%
polyacrylamide gel to recover the electrophoresis fraction. FIG. 7
shows the result of SDS-PAGE for analyzing the recovered fractions.
The buffer used for recovery was comprised of 50 mM Tris-HCl and
10% glycerol (pH 8.8). As is apparent from FIG. 7, this process
according to the present invention has a high ability to produce
separation. FIG. 8 shows the results of analyzing activity of a
fraction further purified by electrophoresis and the results of
SDS-PAGE for analyzing active fractions. The protease of the
present invention can be recovered as an active molecule even after
SDS-PAGE. When the activity of this protease in the plasma is
determined to be 1 in terms of specific activity, a degree of
purification of 30,000- to 100,000-fold was deduced to be achieved
based on the average protein content in the plasma (60 mg/ml).
Example 4
Partial Amino Acid Sequencing
[0108] The partial amino acid sequence of the isolated protease was
determined. This protease, which was isolated using Biophoresis,
was transferred to a PVDF membrane after SDS-PAGE by a conventional
technique, air-dried, and then subjected to analysis using the
automated protein sequencer (model 492; PE Applied Biosystems). As
a result, the vWF-cleaving protease of the present invention
isolated under the above conditions was found to comprise a
polypeptide chain having a molecular weight of 105 to 160 kDa in
SDS-PAGE under reducing conditions. This protease was also found to
have, as a partial sequence, Leu-Leu-Val-Ala-Val (SEQ ID NO: 1),
and preferably
Ala-Ala-Gly-Gly-Ile-Leu-His-Leu-Glu-Leu-Leu-Val-Ala-Val (SEQ ID NO:
2).
Deduction of Isolated Protease Utilizing Bioinformatics
[0109] At present, bioinformatics enables the deduction of full
nucleotide sequences encoding a polypeptide without substantial
gene cloning through collation with information in the database
accumulated in the past (BIOINFORMATICS: A Practical Guide to the
Analysis of Genes and Proteins, edited by Andreas D. Baxevanis and
B. F. Francis Ouellette). Based on the partial amino acid
sequencing by the aforementioned process
(Ala-Ala-Gly-Gly-Ile-Leu-His-Leu-Glu-Leu-Leu-Val-Ala-Val (SEQ ID
NO: 2)), the database was searched by the tblastn program. As a
result, a chromosome clone (AL158826) that was deduced to encode
the protease of the present invention was identified by genomic
database search. Further, a part of the protease of interest as the
expressed sequence tag (EST) and a clone that was deduced to be a
part of the polypeptide encoded by the aforementioned genome
(AI346761 and AJ011374) were identified. The amino acid sequence as
shown in SEQ ID NO: 3 or 7 was deduced based thereon to be an
active vWF-cleaving protease site.
Example 5
Gene Identification
[0110] Synthesis of all the following synthetic primers was
performed by Greiner Japan Co. Ltd. by request. Further, reagents
used for gene recombination were those manufactured by TAKARA.
TOYOBO, and New England Biolabs unless otherwise specified.
Preparation of a Gene Fragment as a Northern Blotting Probe
[0111] A sense primer (SEQ ID NO: 9) and an antisense primer (SEQ
ID NO: 10) were prepared. PCR was carried out using Universal
QUICK-Clone.TM. cDNA (Clontech), which was a mixture of cDNA
derived from normal human tissue, as a template and TaKaRa LA Taq
with GC rich buffer. A gene sandwiched between these primers was
amplified, and the amplified fragment was cloned using a TOPO TA
Cloning.TM. kit (Invitrogen). DNAs having the nucleotide sequence
as shown in SEQ ID NO: 6 were isolated from several clones.
[0112] A vector portion was removed from this cloned DNA by EcoRI
digestion, separated and purified by agarose electrophoresis, and
the resultant was determined to be a template for preparing probes
for Northern blotting.
Northern Blotting
[0113] The gene fragment prepared above was employed as a template
to prepare a radioactive probe using [.alpha.-.sup.32P]dCTP
(Amersham Pharmacia) and a BcaBEST.TM. labeling kit (TAKARA).
Hybridization was carried out using the Human 12-lane Multiple
Tissue Northern Blots.TM. (Clontech) filter in accordance with the
method described in Molecular Cloning 2.sup.nd Edition, pp.
9.52-9.55. Detection was carried out by autoradiography. As shown
in FIG. 10, mRNA encoding the protease was expressed mainly in the
liver. The size of this mRNA was found to be more than 4.4 kb.
Isolation and Identification of Gene Encoding the Protease
[0114] As a result of Northern blotting, mRNA was found to be
expressed mainly in the liver. Thus, the protease gene of the
present invention was isolated and identified in accordance with
the RACE technique using normal human liver-derived poly A.sup.+
RNA and MARATHON-READY.TM. cDNA (Clontech), which is a premade full
length cDNA library of adaptor-ligated ds cDNA ready for use.
[0115] More specifically, the first PCR was carried out as 5' RACE
using normal human liver-derived MARATHON-READY.TM. cDNA, which is
a premade full length cDNA library of adaptor-ligated ds cDNA ready
for use, in accordance with the product's manual and using the AP-1
primer attached to the kit and antisense primers (SEQ ID NOs: 11 to
13) arbitrarily selected from the group of Gene Specific Primers
(GSP) excluding the primer 1 located in the uppermost stream as
shown in FIG. 11. Nested PCR (the second PCR) was then carried out
using the AP-2 primer located in the inside thereof and the
antisense primer located in the inside of the primer used for the
first PCR as shown in FIG. 11. Thereafter, TA cloning was carried
out. Genes were prepared from the developed colonies in accordance
with a conventional technique (Molecular Cloning 2.sup.nd Edition,
pp. 1.25-1.28), and nucleic acid sequences were decoded using an
automatic DNA sequencer. The primer used for sequencing was the
primer used for PCR or a primer located in the inside thereof.
Further, the primer was designed based on the sequence determined
after serial decoding.
[0116] 3' RACE was started from normal human liver-derived poly
A.sup.+ RNA using the 3'-Full RACE Core Set (TAKARA), and reverse
transcription was carried out in accordance with the attached
manual using the attached oligo dT primer. The band amplified by
PCR using the sense primer (SEQ ID NO:14) located at "primer 2" in
FIG. 11 and the attached oligo dT primer was separated by agarose
electrophoresis and extracted, followed by TA cloning. Genes were
prepared from the developed colonies, and nucleic acid sequences
were decoded using an automatic DNA sequencer. A primer used for
sequencing was designed based on the sequence determined after
serial decoding.
Example 6
Preparation of a Vector Comprising Full-Length cDNA 1
[0117] cDNA encoding the protein was subjected to one-stage PCR by,
for example, using a sense primer 1 (SEQ ID NO: 22) comprising an
XhoI restriction site and an initiation codon and an antisense
primer 2 (SEQ ID NO: 23) comprising an SalI restriction site and a
termination codon (see FIG. 12), using the aforementioned normal
human liver-derived MARATHON-READY.TM. cDNA, which is a premade
full length cDNA library of adaptor-ligated ds cDNA ready for use,
as a template and the TaKaRa LA Taq with GC rich buffer, followed
by the aforementioned TA cloning. Thereafter, the full length of
the product was confirmed using an automatic DNA sequencer.
Example 7
Preparation of a Vector Comprising Full-Length cDNA 2
[0118] Restriction sites AccI and AvrII that cleaved cDNA only at
one point on the inner sequence of the cDNA (SEQ ID NO: 15)
encoding the protein were found. With the use thereof, full-length
cDNA was divided into three fragments as shown in FIG. 12. A
fragment 1 sandwiched between the sense primer 1 (SEQ ID NO: 22)
and the antisense primer 3 (SEQ ID NO: 24), a fragment 2 sandwiched
between the sense primer 4 (SEQ ID NO: 25) and the antisense primer
5 (SEQ ID NO: 26), and a fragment 3 sandwiched between the sense
primer 6 (SEQ ID NO: 27) and the antisense primer 2 (SEQ ID NO: 23)
were provided, respectively, in each of the above three fragments.
Each fragment was subjected to PCR using the aforementioned normal
human liver-derived Marathon-Ready.TM. cDNA as a template and
TaKaRa LA Taq with GC rich buffer, followed by the aforementioned
TA cloning. The full length of the product was confirmed using an
automatic DNA sequencer. Further, the pCR 2.1 vector included in
the aforementioned TA cloning kit was subjected to self ligation,
the ligation product was cleaved with XhoI/HindIII, ligated to a
linker comprising XhoI/AccI/AvrII/HindIII (prepared by annealing
the synthetic DNA as shown in SEQ ID NO: 28 or 29), and the three
aforementioned fragments were sequentially ligated in a
conventional manner to bind them. Thus, cDNA comprising the entire
region was prepared (see FIG. 13).
Example 8
Preparation of an Expression Vector Comprising Full-Length cDNA: an
Animal Cell Host
[0119] DNA obtained in Example 6 or 7 was digested with restriction
enzymes XhoI/SalI, ligated to, for example the SalI site in the
pCAG vector (Nivea, H. et al., Gene, vol. 108, 193-199), and the
direction of the insertion and the full-length sequence were
confirmed using an automatic DNA sequencer.
Example 9
Transfection of an Expression Vector Comprising Full-Length cDNA
into an Animal Cell
[0120] The animal cell expression vector prepared in Example 8 was
transfected in the following manner using the 293 cell (human
embryonic kidney cell line), the Hela cell, and the HepG2 cell. At
the outset, cells were disseminated at 1 to 3.times.10.sup.5 cells
per 35 mm dish 24 hours before the transfection. The next day, 2
.mu.l of polyamine transfection reagent, TransIT (TAKARA), per
.mu.g of the expression vector, were added to 100 .mu.l of a
serum-free medium such as Opti-MEM to prepare a complex with DNA in
accordance with the instructions included with the reagent.
Thereafter, the complex was added dropwise to the various types of
previously prepared cells, and the resultants were incubated for 2
to 8 hours, followed by medium exchange. The medium was further
exchanged three days later with the selective medium to which G418
had been added. Thereafter, medium was exchanged every three days
to produce a stably expressed strain. An example thereof is shown
in FIG. 14 as a temporarily expressed strain comprising an FLAG
epitope tag at its C-terminus. Detection was carried out by Western
blotting using the anti-FLAG-M2 antibody (Kodack) and staining with
anti-mouse Ig-alkaline phosphatase-labeled antibody system. The
recombinant strain expressed using cDNA as shown in this example
exhibited a molecular size of about 250 kDa under reducing
conditions. This molecular size was also found in the plasma of a
healthy human (FIG. 18, Example 14 below). Several different
molecular species of this protease are found to be present in the
human plasma, which could be caused by the presence of the
alternative splicing products (SEQ ID NOs: 6 to 21) observed at the
time of gene cloning, difference in post-translational modification
such as sugar chain addition, or degradation during purification
(described in Example 14 and in FIG. 17 of the present invention
and Gerritsen et al., Blood, vol. 98, 1654-1661 (2001)).
[0121] Subsequently, the vWF-cleaving activity of the recombinant
strain was confirmed by the method described in Example 2 (FIG.
15). As a result, the human plasma-derived protease and the gene
recombinant product of the present invention were found to exhibit
the same vWF-cleaving activities.
Example 10
Preparation of an Expression Vector Comprising Partial cDNA: an E.
coli Host
[0122] Partial cDNA encoding the metalloprotease domain of the
protein was subjected to PCR using a sense primer comprising an
NcoI restriction site and an initiation codon (SEQ ID NO: 30) and
an antisense primer comprising an HindIII restriction site and a
termination codon (SEQ ID NO: 31), the aforementioned normal human
liver-derived MARATHON-READY.TM. cDNA, which is a premade full
length cDNA library of adaptor-ligated ds cDNA ready for use, or
the cDNA obtained in Example 6 or 7 as a template, and the TaKaRa
LA Taq with GC rich buffer. The PCR product was then digested with
NcoI/HindIII, ligated to the NcoI/HindIII digest of an E. coli
expression vector such as pUT1 (Soejima et al. J. Biochem. Tokyo,
vol. 130, 269-277 (2001)), and transformed to the E. coli competent
cell JM 109 by a conventional technique. Several clones were
collected from the formed colony group, and genes were prepared
therefrom. Thereafter, the resulting genes were confirmed to be the
genes encoding the polypeptide, wherein the nucleic acid sequence
of the insertion site of the plasmid vector was equivalent to SEQ
ID NO: 32 or substantially represented by SEQ ID NO: 33, using an
automatic DNA sequencer.
Example 11
Expression of Partial cDNA-Containing Expression Vector in E.
coli
[0123] An E. coli host with the expression vector constructed in
Example 10 introduced therein was precultured in 200 ml of LB
medium comprising 50 .mu.g/ml ampicillin at 30.degree. C.
overnight. The resultant was sowed in a fermenter comprising 8
liters of LB medium, and culture was conducted at 30.degree. C.
until the turbidity at 600 nm became 0.2 to 0.5. Thereafter,
isopropyl-1-thio-.beta.-D-galactopyranoside was added to a final
concentration of 1 mM, and the mixture was further cultured
overnight to induce the metalloprotease domain of the protein to be
expressed. The cultured E. coli were collected using a centrifuge
(4.degree. C. for 30 minutes).
[0124] Subsequently, the collected E. coli pellet was resuspended
in distilled water, and lysozyme (final concentration: 0.6 mg/ml)
was added thereto. The mixture was stirred at room temperature for
30 minutes, allowed to stand at 4.degree. C. overnight, and cells
were then destroyed. After the ultrasonication, centrifugation was
carried out using a centrifuge (4.degree. C. for 20 minutes), and
the pellet was recovered. The recovered pellet was resuspended in a
buffer comprising 50 mM Tris, 10 mM EDTA, and 1% Triton X-100 (pH
8.0). These procedures of centrifugation, ultrasonication, and
resuspension were repeated several times, and the pellet was then
resuspended in distilled water. Similarly, procedures of
centrifugation, ultrasonication, and resuspension were repeated
several times to recover an inclusion body. This inclusion body was
used as an antigen when producing an antibody.
Example 12
Isolation of Homologous Gene of Other Animal Species
[0125] The nucleic acid sequence as shown in SEQ ID NO: 15 was used
as a probe, and a homology search was conducted using the BLASTN
program at the GenomeNet WWW server (http://www.genome.ad.jp/). As
a result, chromosome clones AC091762 and AC090008 that were mapped
at mouse chromosome 10 were obtained. Based on these sequences, a
mouse homolog of the protease of the present invention as shown in
SEQ ID NO: 34 was deduced. A new primer was designed from this
sequence, and Northern blot analysis was conducted by the technique
used in isolating and identifying the gene encoding the human
vWF-cleaving protease. Thus, the occurrence of the specific
expression in the liver was observed as with the case of humans.
Further, normal mouse liver-derived poly A+ RNA and
MARATHON-READY.TM. cDNA (Clontech) which is a premade full length
cDNA library of adaptor-ligated ds cDNA ready for use, were used to
isolate and identify the protease gene of the present invention by
the RACE technique as in the case of humans. As a result, the mouse
homologous gene sequences of the protease as shown in SEQ ID NOs:
35 and 36 were determined.
[0126] Based on the thus determined mouse homologous partial
sequence, the Exon/Intron structure on the 5' side of the
aforementioned mouse chromosome 10 was determined. In accordance
with a conventional technique (e.g., Gene Targeting: A Practical
Approach First Edition, edited by A. L. Joyner, Teratocarcinomas
and embryonic stem cell a practical approach), a targeting vector
for knock-out (knock-in) mice can be prepared based thereon. This
enabled the production of mutated mice. Further, this protein can
be subjected to recombinant expression by a conventional
technique.
Example 13
Production of an Antibody and Construction of a Detection System
for the Present Protease Using the Antibody
[0127] In accordance with a conventional technique (e.g., Current
Protocols in Molecular Biology: Chapter 11 immunology, Antibody
Engineering: A PRACTICAL APPROACH, edited by J. McCAFFERTY et al.
or ANTIBODY ENGINEERING second edition, edited by Carl A. K.
BORREBAECK), an expression vector was administered to a mouse or
rat. This expression vector comprises a substance prepared by
optionally binding an antigen protein partially purified from human
plasma or a synthetic peptide having a partial amino acid sequence
thereof (e.g., a C-terminal peptide sequence
Phe-Ser-Pro-Ala-Pro-Gln-Pro-Arg-Arg-Leu-Leu-Pro-Gly-Pro-Gln-Glu--
Asn-Ser-Val-Gln-Ser-Ser (SEQ ID NO: 37), which was one isoform of
the protease of the present invention) to an optimal carrier
substance such as KLH (Cys was added to, for example, the N- or
C-terminus to facilitate KLH addition), the aforementioned gene
recombinant protein, or a gene encoding this protein. Thus, a
monoclonal antibody-expressing hybridoma was established, and a
polyclonal antibody (antiserum) was produced.
[0128] Subsequently, the antibodies prepared by the various
aforementioned techniques were used to detect the protease of the
present invention by Western blotting in accordance with a
conventional technique (e.g., Current Protocols in Molecular
Biology: Chapter 10 analysis of proteins, Chapter 11 immunology).
More specifically, the culture supernatant of the recombinant
unit-expressing 293 cell obtained in the procedure as described in
Example 9 was subjected to SDS-PAGE under non-reducing conditions,
transferred to a PVDF membrane, and confirmed using mouse or rabbit
antiserum to confirm the expression of the genetically recombinant
unit (FIG. 16). As a result, a band that was deduced to be derived
from the protease of the present invention was found in a molecular
size range of 160 to 250 kDa. Subsequently, the protease of the
present invention was detected using starting plasma or the like
and a recombinant unit under non-reducing conditions. As a result,
a band was found in 105 to 160 kDa or 160 to 250 kDa (FIG. 17).
Also, a band derived from a similar recombinant unit was detected
in a monoclonal antibody established by immunizing a recombinant
protein (clone No. CPHSWH-10).
[0129] Further, the C-terminal peptide sequence
Phe-Ser-Pro-Ala-Pro-Gln-Pro-Arg-Arg-Leu-Leu-Pro-Gly-Pro-Gln-Glu-Asn-Ser-V-
al-Gln-Ser-Ser (SEQ ID NO: 37), which was one isoform of the
protease of the present invention, was bound to KLH. The resultant
was used as an immunogen to obtain a peptide antibody. With the use
thereof, the protease of the present invention was detected from
the plasma of healthy persons, plasma of TTP patients, or a culture
supernatant of the recombinant unit under reducing conditions. As a
result, a band of approximately 250 kDa that was deduced to be a
signal derived from the protease of the present invention was
found, although it was not clear based on plasma derived from some
TTP patients (FIG. 18).
[0130] Furthermore, enzyme immunoassay (ELISA) constructed by
combining the obtained antibodies enabled the preparation of a
calibration curve that is concentration-dependent at the culture
supernatant level of the recombinant protein (FIG. 19). An example
of ELISA is as follows. The obtained mouse anti-vWF-cleaving
protease antibody was immobilized on the Maxisorp plate (Nunc), and
1/1, 1/2, and 1/4 diluents of the culture supernatant of the
vWF-cleaving protease-temporarily expressing 293 cells were allowed
to react in amounts of 100 .mu.l/well (Mock supernatant as "0").
The plate was subjected to reaction, for example, at 37.degree. C.
for 1 hour, and then washed with 0.05% Tween 20/TBS. Thereafter,
the 100-fold diluted rabbit anti-vWF-cleaving protease antibody was
allowed to react in amounts of 100 .mu.l/well, for example, at
37.degree. C. for 1 hour, and the plate was washed with 0.05% Tween
20/TBS. The 1,000-fold diluted peroxidase-labeled anti-rabbit Ig
antibody (BioRad) was then allowed to react in amounts of 100
.mu.l/well, for example, at 37.degree. C. for 1 hour, and the plate
was washed with 0.05% Tween 20/TBS. Thereafter, color was developed
for a given period of time using a coloring substrate TMBZ, the
reaction was terminated using 1M sulfuric acid as a termination
liquid, and the absorbance at 450 nm was assayed. The application
thereof enabled the quantification of the protease of the present
invention in a variety of specimens.
Example 14
Purification of the Protease Using an Antibody
[0131] The obtained antibody was bound to a suitable immobilization
carrier to prepare an affinity column, and the resulting column was
used to purify the protease of the present invention. The affinity
column was prepared by immobilizing an antibody using Cellulofine
for NHS activation (Chisso Corporation) in accordance with the
included instructions. The thus prepared swollen carrier (about 1
ml) was used to apply the culture supernatant in which the
recombinant gene had been expressed in the 293 cell of the protease
as described in Example 9. Thereafter, the column was washed with
50 mM Tris-HCl and 0.1M NaCl (pH 7.5, hereafter referred to as
"TBS"), and elution was carried out using a urea-containing 0.1M
glycine buffer (pH 3). The eluted fraction was neutralized with 1M
Tris-HCl (pH 8.5) and then dialyzed against TBS. FIG. 20 shows the
results of SDS-PAGE analysis of the resulting purified protease.
Also, the resulting purified fraction was found to have
vWF-cleaving activity. The cleavage point of the vWF fragmented by
this recombinant protease was found to be the position between
residues Tyr 842 and Met 843 based on the analysis of the
N-terminal amino acid sequence of the fragment. Also established
were clones (e.g. Clone Nos. CPHSWH-7.2 and 10) that could be
similarly subjected to purification with the use of the monoclonal
antibody prepared by the method as described in Example 13.
[0132] Subsequently, the partial amino acid sequence of the
purified protease was determined. In accordance with a conventional
technique, the protease was subjected to SDS-PAGE, transferred to a
PVDF membrane, air-dried, and then subjected to analysis using an
automated protein sequencer (model 492; PE Applied Biosystems). As
a result, the protease was found to comprise the first five amino
acids of SEQ ID NO: 2 as a partial N-terminal sequence. This
sequence was congruous with the N-terminal sequence of the mature
unit of the protease of the present invention that was deduced from
the genetic construction.
Example 15
Neutralization of the Protease Activity Using an Antibody
[0133] Activity of the aforementioned rabbit polyclonal antibody to
neutralize the vWF-cleaving protease was evaluated. Normal rabbit
serum, rabbit antiserum comprising the C-terminal peptide sequence,
Phe-Ser-Pro-Ala-Pro-Gln-Pro-Arg-Arg-Leu-Leu-Pro-Gly-Pro-Gln-Glu-Asn-Ser-V-
al-Gln-Ser-Ser (SEQ ID NO:37) bound to KLH as an immunogen, and
antiserum, the immunity of which had been induced by the protein
expressed by the expression vector as shown in Example 7 or 8, were
respectively allowed to pre-react at 37.degree. C. for 1 hour with
1 to 10 of gene recombinant vWF-cleaving protease (approximated by
the Bradford technique) at a volume ratio of 1:1. Alternatively, a
5-fold diluted antiserum was allowed to pre-react under the above
conditions with the protease at a volume ratio of 1:1. Thereafter,
vWF-cleaving activity was evaluated by the method described above.
As a result, it was found that antiserum, which had activity of
inhibiting the protease of the present invention, were prepared by
immunizing the protein (FIG. 21). (antagonist activity) (a
metalloprotease inhibitor, i.e., EDTA, was determined to be a
control). This indicates the possibility of constructing an
acquired TTP patient-like model having a positive autoantibody
against vWF-cleaving protease as well as the simple possibility of
producing a neutralizing antibody.
Example 16
Construction of C-Terminus Deleted Modification Unit
[0134] Based on the strategy shown in FIG. 22, the full-length
vWF-cleaving protease gene cloning vector (pCR 2.1 vWFCP) obtained
in Example 6 or 7 was used to add a variant lacking domains located
in a position following the C-terminus (T1135stop, W1016stop,
W897stop, T581stop, and Q449stop: each numerical value indicates
the number of amino acid residues between Met encoded by the
initiation codon AGT and the termination codon, and indicates a
site comprising the FLAG epitope (DNA sequence:
gactacaaggacgatgacgataagtga (SEQ ID NO: 47) and amino acid
sequence: Asp Tyr Lys Asp Asp Asp Asp Lys (SEQ ID NO: 48)). Primers
used herein are as follows. "S" indicates a sense primer, and "AS"
indicates an antisense primer. Genes Stu I-S (SEQ ID NO: 38), Acc
I-S (SEQ ID NO: 39), Avr II-S (SEQ ID NO: 40), Q449stop-AS (SEQ ID
NO: 41), T581stop-AS (SEQ ID NO: 42), W897stop-AS (SEQ ID NO: 43),
W1016stop-AS (SEQ ID NO: 44), T1135stop-AS (SEQ ID NO: 45), and
full-length-AS (SEQ ID NO: 46) were prepared and incorporated in
the pCAG expression vector in accordance with the method as used in
Examples 8 and 9. This expression vector was introduced in the Hela
cell. The primer pair shown at the bottom of the restriction map in
the upper portion of FIG. 22 was used to obtain PCR fragments (A)
to (F). Each PCR fragment was ligated to pCR 2.1 vWFCP. Further,
the resultant was digested with StuI/SalI, and fragments (A) and
(B) were digested with StuI/SalI and then ligated. These fragments
were further digested with AccI, and fragment (C) was also digested
with AccI, followed by ligation. The ligation product was digested
with AvrII/SalI, and fragments (D), (E), and (F) were also digested
with AvrII/SalI, followed by ligation. As a result, a variant
lacking a region between the C-terminus and the position W897 was
found to have activity, although it was the result of qualitative
analysis. Such a way of approach enables the identification of
various functional domains. The design of molecules comprising
these domains and having no protease activity is considered to
realize the design of antagonists or agonists.
INDUSTRIAL APPLICABILITY
[0135] The findings of the present invention have led to the
possibility of replacement therapy for patients having diseases
resulting from deficiency of a protease, such as thrombotic
thrombocytopenic purpura. This also realizes the establishment of
methods for gene cloning and efficient purification from serum or
plasma. In particular, the information provided by the present
invention enables gene recombination based on the obtained
nucleotide sequence and stable production and provision of the
protease according to the present invention, which have been
heretofore difficult to achieve. Also, these can be applied to
replacement therapy for TTP patients, inhibition of platelet plug
formation involved with heart infarction or brain infarction,
inhibition of arteriosclerosis, prevention of restenosis,
reembolization, or infarction involved with PICA, prevention of
reembolization involved with PTCR, and prevention of platelet plug
formation caused by HUS or O-157. Diagnosis and therapy utilizing
the gene encoding the protease of the present invention or an
antibody thereagainst can be realized.
[0136] All publications cited herein are incorporated herein in
their entirety. A person skilled in the art would easily understand
that various modifications and changes of the present invention are
feasible within the technical idea and the scope of the invention
as disclosed in the attached claims. The present invention is
intended to include such modifications and changes.
Sequence CWU 1
1
4815PRTHomo sapiens 1Leu Leu Val Ala Val1 5214PRTHomo sapiens 2Ala
Ala Gly Gly Ile Leu His Leu Glu Leu Leu Val Ala Val1 5
103161PRTHomo sapiens 3Ala Ala Gly Gly Ile Leu His Leu Glu Leu Leu
Val Ala Val Gly1 5 10 15Pro Asp Val Phe Gln Ala His Gln Lys Asp Thr
Glu Arg Tyr Val 20 25 30Leu Thr Asn Leu Asn Ile Gly Ala Glu Leu Leu
Arg Asp Pro Ser 35 40 45Leu Gly Ala Gln Phe Arg Val His Leu Val Lys
Met Val Ile Leu 50 55 60Thr Glu Pro Glu Gly Ala Pro Asn Ile Thr Ala
Asn Leu Thr Ser 65 70 75Ser Leu Leu Ser Val Cys Gly Trp Ser Gln Thr
Ile Asn Pro Glu 80 85 90Asp Asp Thr Asp Pro Gly His Ala Asp Leu Val
Leu Tyr Ile Thr 95 100 105Arg Phe Asp Leu Glu Leu Pro Asp Gly Asn
Arg Gln Val Arg Gly 110 115 120Val Thr Gln Leu Gly Gly Ala Cys Ser
Pro Thr Trp Ser Cys Leu 125 130 135Ile Thr Glu Asp Thr Gly Phe Asp
Leu Gly Val Thr Ile Ala His 140 145 150Glu Ile Gly His Ser Phe Gly
Leu Glu His Asp 155 160415DNAHomo sapiens 4ctgctggtgg ccgtg
15542DNAHomo sapiens 5gctgcaggcg gcatcctaca cctggagctg ctggtggccg
tg 426483DNAHomo sapiens 6gctgcaggcg gcatcctaca cctggagctg
ctggtggccg tgggccccga tgtcttccag 60gctcaccaga aggacacaga gcgctatgtg
ctcaccaacc tcaacatcgg ggcagaactg 120cttcgggacc cgtccctggg
ggctcagttt cgggtgcacc tggtgaagat ggtcattctg 180acagagcctg
agggtgctcc aaatatcaca gcaaacctca cctcgtccct gctgagcgtc
240tgtgggtgga gccagaccat caaccctgag gacgacacgg atcctggcca
tgctgacctg 300gtcctctata tcactaggtt tgacctggag ttgcctgatg
gtaaccggca ggtgcggggc 360gtcacccagc tgggcggtgc ctgctcccca
acctggagct gcctcattac cgaggacact 420ggcttcgacc tgggagtcac
cattgcccat gagattgggc acagcttcgg cctggagcac 480gac 4837161PRTHomo
sapiens 7gct gca ggc ggc atc cta cac ctg gag ctg ctg gtg gcc gtg
ggc 45Ala Ala Gly Gly Ile Leu His Leu Glu Leu Leu Val Ala Val Gly1
5 10 15ccc gat gtc ttc cag gct cac cag aag gac aca gag cgc tat gtg
90Pro Asp Val Phe Gln Ala His Gln Lys Asp Thr Glu Arg Tyr Val 20 25
30ctc acc aac ctc aac atc ggg gca gaa ctg ctt cgg gac ccg tcc
135Leu Thr Asn Leu Asn Ile Gly Ala Glu Leu Leu Arg Asp Pro Ser 35
40 45ctg ggg gct cag ttt cgg gtg cac ctg gtg aag atg gtc att ctg
180Leu Gly Ala Gln Phe Arg Val His Leu Val Lys Met Val Ile Leu 50
55 60aca gag cct gag ggt gct cca aat atc aca gca aac ctc acc tcg
225Thr Glu Pro Glu Gly Ala Pro Asn Ile Thr Ala Asn Leu Thr Ser 65
70 75tcc ctg ctg agc gtc tgt ggg tgg agc cag acc atc aac cct gag
270Ser Leu Leu Ser Val Cys Gly Trp Ser Gln Thr Ile Asn Pro Glu 80
85 90gac gac acg gat cct ggc cat gct gac ctg gtc ctc tat atc act
315Asp Asp Thr Asp Pro Gly His Ala Asp Leu Val Leu Tyr Ile Thr 95
100 105agg ttt gac ctg gag ttg cct gat ggt aac cgg cag gtg cgg ggc
360Arg Phe Asp Leu Glu Leu Pro Asp Gly Asn Arg Gln Val Arg Gly 110
115 120gtc acc cag ctg ggc ggt gcc tgc tcc cca acc tgg agc tgc ctc
405Val Thr Gln Leu Gly Gly Ala Cys Ser Pro Thr Trp Ser Cys Leu 125
130 135att acc gag gac act ggc ttc gac ctg gga gtc acc att gcc cat
450Ile Thr Glu Asp Thr Gly Phe Asp Leu Gly Val Thr Ile Ala His 140
145 150gag att ggg cac agc ttc ggc ctg gag cac gac 483Glu Ile Gly
His Ser Phe Gly Leu Glu His Asp 155 160829PRTHomo sapiens 8Ala Ala
Gly Gly Ile Leu His Leu Glu Leu Leu Val Ala Val Gly1 5 10 15Pro Asp
Val Phe Gln Ala His Gln Lys Asp Thr Arg Arg Tyr 20 25 930DNAHomo
sapiens 9gctgcaggcg gcatcctaca cctggagctg 301021DNAHomo sapiens
10cccaatctca tgggcaatgg t 211121DNAHomo sapiens 11cccaatctca
tgggcaatgg t 211230DNAHomo sapiens 12ccgatgttga ggttggtgag
cacatagcgc 301320DNAHomo sapiens 13gtgtcgtcct cagggttgat
201421DNAHomo sapiens 14accattgccc atgagattgg g 21154950DNAHomo
sapiens 15aaccacgatg tctttggcac agcctctcat ctgtcagatg ggagcgggga
ccccggagag 60ggagtcagcc gaggtcctgg cattccttgt gaacccccgt ctgtgggttt
ctggtccagt 120gtcccttctc cagattagat ggcttaggcc tcctctaagg
gggtgggcgt gcacatccgg 180agagctgtct ggtgtgcagg actgggctgc
aggttaccct gaactgcaac catcttagag 240caaggcccag cttgcagcag
gaggagctgc aggccgccca ccctagccac ggcccctgcc 300ctggcaggaa
gcttccaaga gtaaacactg cctaatcgtc ccgcccagta gtgagcaggc
360ctgtcccatt ccatactgac cagattccca gtcaccaagg ccccctctca
ctccgctcca 420ctcctcgggc tggctctcct gaggatgcac cagcgtcacc
cccgggcaag atgccctccc 480ctctgtgtgg ccggaatcct tgcctgtggc
tttctcctgg gctgctgggg accctcccat 540ttccagcaga gttgtcttca
ggctttggag ccacaggccg tgtcttctta cttgagccct 600ggtgctccct
taaaaggccg ccctccttcc cctggcttcc agaggcagag gcagaggcag
660aggcgggctg caggcggcat cctacacctg gagctgctgg tggccgtggg
ccccgatgtc 720ttccaggctc accaggagga cacagagcgc tatgtgctca
ccaacctcaa catcggggca 780gaactgcttc gggacccgtc cctgggggct
cagtttcggg tgcacctggt gaagatggtc 840attctgacag agcctgaggg
tgctccaaat atcacagcca acctcacctc gtccctgctg 900agcgtctgtg
ggtggagcca gaccatcaac cctgaggacg acacggatcc tggccatgct
960gacctggtcc tctatatcac taggtttgac ctggagttgc ctgatggtaa
ccggcaggtg 1020cggggcgtca cccagctggg cggtgcctgc tccccaacct
ggagctgcct cattaccgag 1080gacactggct tcgacctggg agtcaccatt
gcccatgaga ttgggcacag cttcggcctg 1140gagcacgacg gcgcgcccgg
cagcggctgc ggccccagcg gacacgtgat ggcttcggac 1200ggcgccgcgc
cccgcgccgg cctcgcctgg tccccctgca gccgccggca gctgctgagc
1260ctgctcagcg caggacgggc gcgctgcgtg tgggacccgc cgcggcctca
acccgggtcc 1320gcggggcacc cgccggatgc gcagcctggc ctctactaca
gcgccaacga gcagtgccgc 1380gtggccttcg gccccaaggc tgtcgcctgc
accttcgcca gggagcacct ggatatgtgc 1440caggccctct cctgccacac
agacccgctg gaccaaagca gctgcagccg cctcctcgtt 1500cctctcctgg
atgggacaga atgtggcgtg gagaagtggt gctccaaggg tcgctgccgc
1560tccctggtgg agctgacccc catagcagca gtgcatgggc gctggtctag
ctggggtccc 1620cgaagtcctt gctcccgctc ctgcggagga ggtgtggtca
ccaggaggcg gcagtgcaac 1680aaccccagac ctgcctttgg ggggcgtgca
tgtgttggtg ctgacctcca ggccgagatg 1740tgcaacactc aggcctgcga
gaagacccag ctggagttca tgtcgcaaca gtgcgccagg 1800accgacggcc
agccgctgcg ctcctcccct ggcggcgcct ccttctacca ctggggtgct
1860gctgtaccac acagccaagg ggatgctctg tgcagacaca tgtgccgggc
cattggcgag 1920agcttcatca tgaagcgtgg agacagcttc ctcgatggga
cccggtgtat gccaagtggc 1980ccccgggagg acgggaccct gagcctgtgt
gtgtcgggca gctgcaggac atttggctgt 2040gatggtagga tggactccca
gcaggtatgg gacaggtgcc aggtgtgtgg tggggacaac 2100agcacgtgca
gcccacggaa gggctctttc acagctggca gagcgagaga atatgtcacg
2160tttctgacag ttacccccaa cctgaccagt gtctacattg ccaaccacag
gcctctcttc 2220acacacttgg cggtgaggat cggagggcgc tatgtcgtgg
ctgggaagat gagcatctcc 2280cctaacacca cctacccctc cctcctggag
gatggtcgtg tcgagtacag agtggccctc 2340accgaggacc ggctgccccg
cctggaggag atccgcatct ggggacccct ccaggaagat 2400gctgacatcc
aggtttacag gcggtatggc gaggagtatg gcaacctcac ccgcccagac
2460atcaccttca cctacttcca gcctaagcca cggcaggcct gggtgtgggc
cgctgtgcgt 2520gggccctgct cggtgagctg tggggcaggg ctgcgctggg
taaactacag ctgcctggac 2580caggccagga aggagttggt ggagactgtc
cagtgccaag ggagccagca gccaccagcg 2640tggccagagg cctgcgtgct
cgaaccctgc cctccctact gggcggtggg agacttcggc 2700ccatgcagcg
cctcctgtgg gggcggcctg cgggagcggc cagtgcgctg cgtggaggcc
2760cagggcagcc tcctgaagac attgccccca gcccggtgca gagcaggggc
ccagcagcca 2820gctgtggcgc tggaaacctg caacccccag ccctgccctg
ccaggtggga ggtgtcagag 2880cccagctcat gcacatcagc tggtggagca
ggcctggcct tggagaacga gacctgtgtg 2940ccaggggcag atggcctgga
ggctccagtg actgaggggc ctggctccgt agatgagaag 3000ctgcctgccc
ctgagccctg tgtcgggatg tcatgtcctc caggctgggg ccatctggat
3060gccacctctg caggggagaa ggctccctcc ccatggggca gcatcaggac
gggggctcaa 3120gctgcacacg tgtggacccc tgcggcaggg tcgtgctccg
tctcctgcgg gcgaggtctg 3180atggagctgc gtttcctgtg catggactct
gccctcaggg tgcctgtcca ggaagagctg 3240tgtggcctgg caagcaagcc
tgggagccgg cgggaggtct gccaggctgt cccgtgccct 3300gctcggtggc
agtacaagct ggcggcctgc agcgtgagct gtgggagagg ggtcgtgcgg
3360aggatcctgt attgtgcccg ggcccatggg gaggacgatg gtgaggagat
cctgttggac 3420acccagtgcc aggggctgcc tcgcccggaa ccccaggagg
cctgcagcct ggagccctgc 3480ccacctaggt ggaaagtcat gtcccttggc
ccatgttcgg ccagctgtgg ccttggcact 3540gctagacgct cggtggcctg
tgtgcagctc gaccaaggcc aggacgtgga ggtggacgag 3600gcggcctgtg
cggcgctggt gcggcccgag gccagtgtcc cctgtctcat tgccgactgc
3660acctaccgct ggcatgttgg cacctggatg gagtgctctg tttcctgtgg
ggatggcatc 3720cagcgccggc gtgacacctg cctcggaccc caggcccagg
cgcctgtgcc agctgatttc 3780tgccagcact tgcccaagcc ggtgactgtg
cgtggctgct gggctgggcc ctgtgtggga 3840cagggtacgc ccagcctggt
gccccacgaa gaagccgctg ctccaggacg gaccacagcc 3900acccctgctg
gtgcctccct ggagtggtcc caggcccggg gcctgctctt ctccccggct
3960ccccagcctc ggcggctcct gcccgggccc caggaaaact cagtgcagtc
cagtgcctgt 4020ggcaggcagc accttgagcc aacaggaacc attgacatgc
gaggcccagg gcaggcagac 4080tgtgcagtgg ccattgggcg gcccctcggg
gaggtggtga ccctccgcgt ccttgagagt 4140tctctcaact gcagtgcggg
ggacatgttg ctgctttggg gccggctcac ctggaggaag 4200atgtgcagga
agctgttgga catgactttc agctccaaga ccaacacgct ggtggtgagg
4260cagcgctgcg ggcggccagg aggtggggtg ctgctgcggt atgggagcca
gcttgctcct 4320gaaaccttct acagagaatg tgacatgcag ctctttgggc
cctggggtga aatcgtgagc 4380ccctcgctga gtccagccac gagtaatgca
gggggctgcc ggctcttcat taatgtggct 4440ccgcacgcac ggattgccat
ccatgccctg gccaccaaca tgggcgctgg gaccgaggga 4500gccaatgcca
gctacatctt gatccgggac acccacagct tgaggaccac agcgttccat
4560gggcagcagg tgctctactg ggagtcagag agcagccagg ctgagatgga
gttcagcgag 4620ggcttcctga aggctcaggc cagcctgcgg ggccagtact
ggaccctcca atcatgggta 4680ccggagatgc aggaccctca gtcctggaag
ggaaaggaag gaacctgagg gtcattgaac 4740atttgttccg tgtctggcca
gccctggagg gttgacccct ggtctcagtg ctttccaatt 4800cgaacttttt
ccaatcttag gtatctactt tagagtcttc tccaatgtcc aaaaggctag
4860ggggttggag gtggggactc tggaaaagca gcccccattt cctcgggtac
caataaataa 4920aacatgcagg ccaaaaaaaa aaaaaaaaaa 4950161353PRTHomo
sapiens 16gct gca ggc ggc atc cta cac ctg gag ctg ctg gtg gcc gtg
ggc 45Ala Ala Gly Gly Ile Leu His Leu Glu Leu Leu Val Ala Val Gly1
5 10 15ccc gat gtc ttc cag gct cac cag gag gac aca gag cgc tat gtg
90Pro Asp Val Phe Gln Ala His Gln Glu Asp Thr Glu Arg Tyr Val 20 25
30ctc acc aac ctc aac atc ggg gca gaa ctg ctt cgg gac ccg tcc
135Leu Thr Asn Leu Asn Ile Gly Ala Glu Leu Leu Arg Asp Pro Ser 35
40 45ctg ggg gct cag ttt cgg gtg cac ctg gtg aag atg gtc att ctg
180Leu Gly Ala Gln Phe Arg Val His Leu Val Lys Met Val Ile Leu 50
55 60aca gag cct gag ggt gct cca aat atc aca gcc aac ctc acc tcg
225Thr Glu Pro Glu Gly Ala Pro Asn Ile Thr Ala Asn Leu Thr Ser 65
70 75tcc ctg ctg agc gtc tgt ggg tgg agc cag acc atc aac cct gag
270Ser Leu Leu Ser Val Cys Gly Trp Ser Gln Thr Ile Asn Pro Glu 80
85 90gac gac acg gat cct ggc cat gct gac ctg gtc ctc tat atc act
315Asp Asp Thr Asp Pro Gly His Ala Asp Leu Val Leu Tyr Ile Thr 95
100 105agg ttt gac ctg gag ttg cct gat ggt aac cgg cag gtg cgg ggc
360Arg Phe Asp Leu Glu Leu Pro Asp Gly Asn Arg Gln Val Arg Gly 110
115 120gtc acc cag ctg ggc ggt gcc tgc tcc cca acc tgg agc tgc ctc
405Val Thr Gln Leu Gly Gly Ala Cys Ser Pro Thr Trp Ser Cys Leu 125
130 135att acc gag gac act ggc ttc gac ctg gga gtc acc att gcc cat
450Ile Thr Glu Asp Thr Gly Phe Asp Leu Gly Val Thr Ile Ala His 140
145 150gag att ggg cac agc ttc ggc ctg gag cac gac ggc gcg ccc ggc
495Glu Ile Gly His Ser Phe Gly Leu Glu His Asp Gly Ala Pro Gly 155
160 165agc ggc tgc ggc ccc agc gga cac gtg atg gct tcg gac ggc gcc
540Ser Gly Cys Gly Pro Ser Gly His Val Met Ala Ser Asp Gly Ala 170
175 180gcg ccc cgc gcc ggc ctc gcc tgg tcc ccc tgc agc cgc cgg cag
585Ala Pro Arg Ala Gly Leu Ala Trp Ser Pro Cys Ser Arg Arg Gln 185
190 195ctg ctg agc ctg ctc agc gca gga cgg gcg cgc tgc gtg tgg gac
630Leu Leu Ser Leu Leu Ser Ala Gly Arg Ala Arg Cys Val Trp Asp 200
205 210ccg ccg cgg cct caa ccc ggg tcc gcg ggg cac ccg ccg gat gcg
675Pro Pro Arg Pro Gln Pro Gly Ser Ala Gly His Pro Pro Asp Ala 215
220 225cag cct ggc ctc tac tac agc gcc aac gag cag tgc cgc gtg gcc
720Gln Pro Gly Leu Tyr Tyr Ser Ala Asn Glu Gln Cys Arg Val Ala 230
235 240ttc ggc ccc aag gct gtc gcc tgc acc ttc gcc agg gag cac ctg
765Phe Gly Pro Lys Ala Val Ala Cys Thr Phe Ala Arg Glu His Leu 245
250 255gat atg tgc cag gcc ctc tcc tgc cac aca gac ccg ctg gac caa
810Asp Met Cys Gln Ala Leu Ser Cys His Thr Asp Pro Leu Asp Gln 260
265 270agc agc tgc agc cgc ctc ctc gtt cct ctc ctg gat ggg aca gaa
855Ser Ser Cys Ser Arg Leu Leu Val Pro Leu Leu Asp Gly Thr Glu 275
280 285tgt ggc gtg gag aag tgg tgc tcc aag ggt cgc tgc cgc tcc ctg
900Cys Gly Val Glu Lys Trp Cys Ser Lys Gly Arg Cys Arg Ser Leu 290
295 300gtg gag ctg acc ccc ata gca gca gtg cat ggg cgc tgg tct agc
945Val Glu Leu Thr Pro Ile Ala Ala Val His Gly Arg Trp Ser Ser 305
310 315tgg ggt ccc cga agt cct tgc tcc cgc tcc tgc gga gga ggt gtg
990Trp Gly Pro Arg Ser Pro Cys Ser Arg Ser Cys Gly Gly Gly Val 320
325 330gtc acc agg agg cgg cag tgc aac aac ccc aga cct gcc ttt ggg
1035Val Thr Arg Arg Arg Gln Cys Asn Asn Pro Arg Pro Ala Phe Gly 335
340 345ggg cgt gca tgt gtt ggt gct gac ctc cag gcc gag atg tgc aac
1080Gly Arg Ala Cys Val Gly Ala Asp Leu Gln Ala Glu Met Cys Asn 350
355 360act cag gcc tgc gag aag acc cag ctg gag ttc atg tcg caa cag
1125Thr Gln Ala Cys Glu Lys Thr Gln Leu Glu Phe Met Ser Gln Gln 365
370 375tgc gcc agg acc gac ggc cag ccg ctg cgc tcc tcc cct ggc ggc
1170Cys Ala Arg Thr Asp Gly Gln Pro Leu Arg Ser Ser Pro Gly Gly 380
385 390gcc tcc ttc tac cac tgg ggt gct gct gta cca cac agc caa ggg
1215Ala Ser Phe Tyr His Trp Gly Ala Ala Val Pro His Ser Gln Gly 395
400 405gat gct ctg tgc aga cac atg tgc cgg gcc att ggc gag agc ttc
1260Asp Ala Leu Cys Arg His Met Cys Arg Ala Ile Gly Glu Ser Phe 410
415 420atc atg aag cgt gga gac agc ttc ctc gat ggg acc cgg tgt atg
1305Ile Met Lys Arg Gly Asp Ser Phe Leu Asp Gly Thr Arg Cys Met 425
430 435cca agt ggc ccc cgg gag gac ggg acc ctg agc ctg tgt gtg tcg
1350Pro Ser Gly Pro Arg Glu Asp Gly Thr Leu Ser Leu Cys Val Ser 440
445 450ggc agc tgc agg aca ttt ggc tgt gat ggt agg atg gac tcc cag
1395Gly Ser Cys Arg Thr Phe Gly Cys Asp Gly Arg Met Asp Ser Gln 455
460 465cag gta tgg gac agg tgc cag gtg tgt ggt ggg gac aac agc acg
1440Gln Val Trp Asp Arg Cys Gln Val Cys Gly Gly Asp Asn Ser Thr 470
475 480tgc agc cca cgg aag ggc tct ttc aca gct ggc aga gcg aga gaa
1485Cys Ser Pro Arg Lys Gly Ser Phe Thr Ala Gly Arg Ala Arg Glu 485
490 495tat gtc acg ttt ctg aca gtt acc ccc aac ctg acc agt gtc tac
1530Tyr Val Thr Phe Leu Thr Val Thr Pro Asn Leu Thr Ser Val Tyr 500
505 510att gcc aac cac agg cct ctc ttc aca cac ttg gcg gtg agg atc
1575Ile Ala Asn His Arg Pro Leu Phe Thr His Leu Ala Val Arg Ile 515
520 525gga ggg cgc tat gtc gtg gct ggg aag atg agc atc tcc cct aac
1620Gly Gly Arg Tyr Val Val Ala Gly Lys Met Ser Ile Ser Pro Asn 530
535 540acc acc tac ccc tcc ctc ctg gag gat ggt cgt gtc gag tac aga
1665Thr Thr Tyr Pro Ser Leu Leu Glu Asp Gly Arg Val
Glu Tyr Arg 545 550 555gtg gcc ctc acc gag gac cgg ctg ccc cgc ctg
gag gag atc cgc 1710Val Ala Leu Thr Glu Asp Arg Leu Pro Arg Leu Glu
Glu Ile Arg 560 565 570atc tgg gga ccc ctc cag gaa gat gct gac atc
cag gtt tac agg 1755Ile Trp Gly Pro Leu Gln Glu Asp Ala Asp Ile Gln
Val Tyr Arg 575 580 585cgg tat ggc gag gag tat ggc aac ctc acc cgc
cca gac atc acc 1800Arg Tyr Gly Glu Glu Tyr Gly Asn Leu Thr Arg Pro
Asp Ile Thr 590 595 600ttc acc tac ttc cag cct aag cca cgg cag gcc
tgg gtg tgg gcc 1845Phe Thr Tyr Phe Gln Pro Lys Pro Arg Gln Ala Trp
Val Trp Ala 605 610 615gct gtg cgt ggg ccc tgc tcg gtg agc tgt ggg
gca ggg ctg cgc 1890Ala Val Arg Gly Pro Cys Ser Val Ser Cys Gly Ala
Gly Leu Arg 620 625 630tgg gta aac tac agc tgc ctg gac cag gcc agg
aag gag ttg gtg 1935Trp Val Asn Tyr Ser Cys Leu Asp Gln Ala Arg Lys
Glu Leu Val 635 640 645gag act gtc cag tgc caa ggg agc cag cag cca
cca gcg tgg cca 1980Glu Thr Val Gln Cys Gln Gly Ser Gln Gln Pro Pro
Ala Trp Pro 650 655 660gag gcc tgc gtg ctc gaa ccc tgc cct ccc tac
tgg gcg gtg gga 2025Glu Ala Cys Val Leu Glu Pro Cys Pro Pro Tyr Trp
Ala Val Gly 665 670 675gac ttc ggc cca tgc agc gcc tcc tgt ggg ggc
ggc ctg cgg gag 2070Asp Phe Gly Pro Cys Ser Ala Ser Cys Gly Gly Gly
Leu Arg Glu 680 685 690cgg cca gtg cgc tgc gtg gag gcc cag ggc agc
ctc ctg aag aca 2115Arg Pro Val Arg Cys Val Glu Ala Gln Gly Ser Leu
Leu Lys Thr 695 700 705ttg ccc cca gcc cgg tgc aga gca ggg gcc cag
cag cca gct gtg 2160Leu Pro Pro Ala Arg Cys Arg Ala Gly Ala Gln Gln
Pro Ala Val 710 715 720gcg ctg gaa acc tgc aac ccc cag ccc tgc cct
gcc agg tgg gag 2205Ala Leu Glu Thr Cys Asn Pro Gln Pro Cys Pro Ala
Arg Trp Glu 725 730 735gtg tca gag ccc agc tca tgc aca tca gct ggt
gga gca ggc ctg 2250Val Ser Glu Pro Ser Ser Cys Thr Ser Ala Gly Gly
Ala Gly Leu 740 745 750gcc ttg gag aac gag acc tgt gtg cca ggg gca
gat ggc ctg gag 2295Ala Leu Glu Asn Glu Thr Cys Val Pro Gly Ala Asp
Gly Leu Glu 755 760 765gct cca gtg act gag ggg cct ggc tcc gta gat
gag aag ctg cct 2340Ala Pro Val Thr Glu Gly Pro Gly Ser Val Asp Glu
Lys Leu Pro 770 775 780gcc cct gag ccc tgt gtc ggg atg tca tgt cct
cca ggc tgg ggc 2385Ala Pro Glu Pro Cys Val Gly Met Ser Cys Pro Pro
Gly Trp Gly 785 790 795cat ctg gat gcc acc tct gca ggg gag aag gct
ccc tcc cca tgg 2430His Leu Asp Ala Thr Ser Ala Gly Glu Lys Ala Pro
Ser Pro Trp 800 805 810ggc agc atc agg acg ggg gct caa gct gca cac
gtg tgg acc cct 2475Gly Ser Ile Arg Thr Gly Ala Gln Ala Ala His Val
Trp Thr Pro 815 820 825gcg gca ggg tcg tgc tcc gtc tcc tgc ggg cga
ggt ctg atg gag 2520Ala Ala Gly Ser Cys Ser Val Ser Cys Gly Arg Gly
Leu Met Glu 830 835 840ctg cgt ttc ctg tgc atg gac tct gcc ctc agg
gtg cct gtc cag 2565Leu Arg Phe Leu Cys Met Asp Ser Ala Leu Arg Val
Pro Val Gln 845 850 855gaa gag ctg tgt ggc ctg gca agc aag cct ggg
agc cgg cgg gag 2610Glu Glu Leu Cys Gly Leu Ala Ser Lys Pro Gly Ser
Arg Arg Glu 860 865 870gtc tgc cag gct gtc ccg tgc cct gct cgg tgg
cag tac aag ctg 2655Val Cys Gln Ala Val Pro Cys Pro Ala Arg Trp Gln
Tyr Lys Leu 875 880 885gcg gcc tgc agc gtg agc tgt ggg aga ggg gtc
gtg cgg agg atc 2700Ala Ala Cys Ser Val Ser Cys Gly Arg Gly Val Val
Arg Arg Ile 890 895 900ctg tat tgt gcc cgg gcc cat ggg gag gac gat
ggt gag gag atc 2745Leu Tyr Cys Ala Arg Ala His Gly Glu Asp Asp Gly
Glu Glu Ile 905 910 915ctg ttg gac acc cag tgc cag ggg ctg cct cgc
ccg gaa ccc cag 2790Leu Leu Asp Thr Gln Cys Gln Gly Leu Pro Arg Pro
Glu Pro Gln 920 925 930gag gcc tgc agc ctg gag ccc tgc cca cct agg
tgg aaa gtc atg 2835Glu Ala Cys Ser Leu Glu Pro Cys Pro Pro Arg Trp
Lys Val Met 935 940 945tcc ctt ggc cca tgt tcg gcc agc tgt ggc ctt
ggc act gct aga 2880Ser Leu Gly Pro Cys Ser Ala Ser Cys Gly Leu Gly
Thr Ala Arg 950 955 960cgc tcg gtg gcc tgt gtg cag ctc gac caa ggc
cag gac gtg gag 2925Arg Ser Val Ala Cys Val Gln Leu Asp Gln Gly Gln
Asp Val Glu 965 970 975gtg gac gag gcg gcc tgt gcg gcg ctg gtg cgg
ccc gag gcc agt 2970Val Asp Glu Ala Ala Cys Ala Ala Leu Val Arg Pro
Glu Ala Ser 980 985 990gtc ccc tgt ctc att gcc gac tgc acc tac cgc
tgg cat gtt ggc 3015Val Pro Cys Leu Ile Ala Asp Cys Thr Tyr Arg Trp
His Val Gly 995 1000 1005acc tgg atg gag tgc tct gtt tcc tgt ggg
gat ggc atc cag cgc 3060Thr Trp Met Glu Cys Ser Val Ser Cys Gly Asp
Gly Ile Gln Arg 1010 1015 1020cgg cgt gac acc tgc ctc gga ccc cag
gcc cag gcg cct gtg cca 3105Arg Arg Asp Thr Cys Leu Gly Pro Gln Ala
Gln Ala Pro Val Pro 1025 1030 1035gct gat ttc tgc cag cac ttg ccc
aag ccg gtg act gtg cgt ggc 3150Ala Asp Phe Cys Gln His Leu Pro Lys
Pro Val Thr Val Arg Gly 1040 1045 1050tgc tgg gct ggg ccc tgt gtg
gga cag ggt acg ccc agc ctg gtg 3195Cys Trp Ala Gly Pro Cys Val Gly
Gln Gly Thr Pro Ser Leu Val 1055 1060 1065ccc cac gaa gaa gcc gct
gct cca gga cgg acc aca gcc acc cct 3240Pro His Glu Glu Ala Ala Ala
Pro Gly Arg Thr Thr Ala Thr Pro 1070 1075 1080gct ggt gcc tcc ctg
gag tgg tcc cag gcc cgg ggc ctg ctc ttc 3285Ala Gly Ala Ser Leu Glu
Trp Ser Gln Ala Arg Gly Leu Leu Phe 1085 1090 1095tcc ccg gct ccc
cag cct cgg cgg ctc ctg ccc ggg ccc cag gaa 3330Ser Pro Ala Pro Gln
Pro Arg Arg Leu Leu Pro Gly Pro Gln Glu 1100 1105 1110aac tca gtg
cag tcc agt gcc tgt ggc agg cag cac ctt gag cca 3375Asn Ser Val Gln
Ser Ser Ala Cys Gly Arg Gln His Leu Glu Pro 1115 1120 1125aca gga
acc att gac atg cga ggc cca ggg cag gca gac tgt gca 3420Thr Gly Thr
Ile Asp Met Arg Gly Pro Gly Gln Ala Asp Cys Ala 1130 1135 1140gtg
gcc att ggg cgg ccc ctc ggg gag gtg gtg acc ctc cgc gtc 3465Val Ala
Ile Gly Arg Pro Leu Gly Glu Val Val Thr Leu Arg Val 1145 1150
1155ctt gag agt tct ctc aac tgc agt gcg ggg gac atg ttg ctg ctt
3510Leu Glu Ser Ser Leu Asn Cys Ser Ala Gly Asp Met Leu Leu Leu
1160 1165 1170tgg ggc cgg ctc acc tgg agg aag atg tgc agg aag ctg
ttg gac 3555Trp Gly Arg Leu Thr Trp Arg Lys Met Cys Arg Lys Leu Leu
Asp 1175 1180 1185atg act ttc agc tcc aag acc aac acg ctg gtg gtg
agg cag cgc 3600Met Thr Phe Ser Ser Lys Thr Asn Thr Leu Val Val Arg
Gln Arg 1190 1195 1200tgc ggg cgg cca gga ggt ggg gtg ctg ctg cgg
tat ggg agc cag 3645Cys Gly Arg Pro Gly Gly Gly Val Leu Leu Arg Tyr
Gly Ser Gln 1205 1210 1215ctt gct cct gaa acc ttc tac aga gaa tgt
gac atg cag ctc ttt 3690Leu Ala Pro Glu Thr Phe Tyr Arg Glu Cys Asp
Met Gln Leu Phe 1220 1225 1230ggg ccc tgg ggt gaa atc gtg agc ccc
tcg ctg agt cca gcc acg 3735Gly Pro Trp Gly Glu Ile Val Ser Pro Ser
Leu Ser Pro Ala Thr 1235 1240 1245agt aat gca ggg ggc tgc cgg ctc
ttc att aat gtg gct ccg cac 3780Ser Asn Ala Gly Gly Cys Arg Leu Phe
Ile Asn Val Ala Pro His 1250 1255 1260gca cgg att gcc atc cat gcc
ctg gcc acc aac atg ggc gct ggg 3825Ala Arg Ile Ala Ile His Ala Leu
Ala Thr Asn Met Gly Ala Gly 1265 1270 1275acc gag gga gcc aat gcc
agc tac atc ttg atc cgg gac acc cac 3870Thr Glu Gly Ala Asn Ala Ser
Tyr Ile Leu Ile Arg Asp Thr His 1280 1285 1290agc ttg agg acc aca
gcg ttc cat ggg cag cag gtg ctc tac tgg 3915Ser Leu Arg Thr Thr Ala
Phe His Gly Gln Gln Val Leu Tyr Trp 1295 1300 1305gag tca gag agc
agc cag gct gag atg gag ttc agc gag ggc ttc 3960Glu Ser Glu Ser Ser
Gln Ala Glu Met Glu Phe Ser Glu Gly Phe 1310 1315 1320ctg aag gct
cag gcc agc ctg cgg ggc cag tac tgg acc ctc caa 4005Leu Lys Ala Gln
Ala Ser Leu Arg Gly Gln Tyr Trp Thr Leu Gln 1325 1330 1335tca tgg
gta ccg gag atg cag gac cct cag tcc tgg aag gga aag 4050Ser Trp Val
Pro Glu Met Gln Asp Pro Gln Ser Trp Lys Gly Lys 1340 1345 1350gaa
gga acc 4059Glu Gly Thr 171297PRTHomo sapiens 17gct gca ggc ggc atc
cta cac ctg gag ctg ctg gtg gcc gtg ggc 45Ala Ala Gly Gly Ile Leu
His Leu Glu Leu Leu Val Ala Val Gly1 5 10 15ccc gat gtc ttc cag gct
cac cag gag gac aca gag cgc tat gtg 90Pro Asp Val Phe Gln Ala His
Gln Glu Asp Thr Glu Arg Tyr Val 20 25 30ctc acc aac ctc aac atc ggg
gca gaa ctg ctt cgg gac ccg tcc 135Leu Thr Asn Leu Asn Ile Gly Ala
Glu Leu Leu Arg Asp Pro Ser 35 40 45ctg ggg gct cag ttt cgg gtg cac
ctg gtg aag atg gtc att ctg 180Leu Gly Ala Gln Phe Arg Val His Leu
Val Lys Met Val Ile Leu 50 55 60aca gag cct gag ggt gct cca aat atc
aca gcc aac ctc acc tcg 225Thr Glu Pro Glu Gly Ala Pro Asn Ile Thr
Ala Asn Leu Thr Ser 65 70 75tcc ctg ctg agc gtc tgt ggg tgg agc cag
acc atc aac cct gag 270Ser Leu Leu Ser Val Cys Gly Trp Ser Gln Thr
Ile Asn Pro Glu 80 85 90gac gac acg gat cct ggc cat gct gac ctg gtc
ctc tat atc act 315Asp Asp Thr Asp Pro Gly His Ala Asp Leu Val Leu
Tyr Ile Thr 95 100 105agg ttt gac ctg gag ttg cct gat ggt aac cgg
cag gtg cgg ggc 360Arg Phe Asp Leu Glu Leu Pro Asp Gly Asn Arg Gln
Val Arg Gly 110 115 120gtc acc cag ctg ggc ggt gcc tgc tcc cca acc
tgg agc tgc ctc 405Val Thr Gln Leu Gly Gly Ala Cys Ser Pro Thr Trp
Ser Cys Leu 125 130 135att acc gag gac act ggc ttc gac ctg gga gtc
acc att gcc cat 450Ile Thr Glu Asp Thr Gly Phe Asp Leu Gly Val Thr
Ile Ala His 140 145 150gag att ggg cac agc ttc ggc ctg gag cac gac
ggc gcg ccc ggc 495Glu Ile Gly His Ser Phe Gly Leu Glu His Asp Gly
Ala Pro Gly 155 160 165agc ggc tgc ggc ccc agc gga cac gtg atg gct
tcg gac ggc gcc 540Ser Gly Cys Gly Pro Ser Gly His Val Met Ala Ser
Asp Gly Ala 170 175 180gcg ccc cgc gcc ggc ctc gcc tgg tcc ccc tgc
agc cgc cgg cag 585Ala Pro Arg Ala Gly Leu Ala Trp Ser Pro Cys Ser
Arg Arg Gln 185 190 195ctg ctg agc ctg ctc agc gca gga cgg gcg cgc
tgc gtg tgg gac 630Leu Leu Ser Leu Leu Ser Ala Gly Arg Ala Arg Cys
Val Trp Asp 200 205 210ccg ccg cgg cct caa ccc ggg tcc gcg ggg cac
ccg ccg gat gcg 675Pro Pro Arg Pro Gln Pro Gly Ser Ala Gly His Pro
Pro Asp Ala 215 220 225cag cct ggc ctc tac tac agc gcc aac gag cag
tgc cgc gtg gcc 720Gln Pro Gly Leu Tyr Tyr Ser Ala Asn Glu Gln Cys
Arg Val Ala 230 235 240ttc ggc ccc aag gct gtc gcc tgc acc ttc gcc
agg gag cac ctg 765Phe Gly Pro Lys Ala Val Ala Cys Thr Phe Ala Arg
Glu His Leu 245 250 255gat atg tgc cag gcc ctc tcc tgc cac aca gac
ccg ctg gac caa 810Asp Met Cys Gln Ala Leu Ser Cys His Thr Asp Pro
Leu Asp Gln 260 265 270 agc agc tgc agc cgc ctc ctc gtt cct ctc ctg
gat ggg aca gaa 855Ser Ser Cys Ser Arg Leu Leu Val Pro Leu Leu Asp
Gly Thr Glu 275 280 285tgt ggc gtg gag aag tgg tgc tcc aag ggt cgc
tgc cgc tcc ctg 900Cys Gly Val Glu Lys Trp Cys Ser Lys Gly Arg Cys
Arg Ser Leu 290 295 300gtg gag ctg acc ccc ata gca gca gtg cat ggg
cgc tgg tct agc 945Val Glu Leu Thr Pro Ile Ala Ala Val His Gly Arg
Trp Ser Ser 305 310 315tgg ggt ccc cga agt cct tgc tcc cgc tcc tgc
gga gga ggt gtg 990Trp Gly Pro Arg Ser Pro Cys Ser Arg Ser Cys Gly
Gly Gly Val 320 325 330gtc acc agg agg cgg cag tgc aac aac ccc aga
cct gcc ttt ggg 1035Val Thr Arg Arg Arg Gln Cys Asn Asn Pro Arg Pro
Ala Phe Gly 335 340 345ggg cgt gca tgt gtt ggt gct gac ctc cag gcc
gag atg tgc aac 1080Gly Arg Ala Cys Val Gly Ala Asp Leu Gln Ala Glu
Met Cys Asn 350 355 360act cag gcc tgc gag aag acc cag ctg gag ttc
atg tcg caa cag 1125Thr Gln Ala Cys Glu Lys Thr Gln Leu Glu Phe Met
Ser Gln Gln 365 370 375tgc gcc agg acc gac ggc cag ccg ctg cgc tcc
tcc cct ggc ggc 1170Cys Ala Arg Thr Asp Gly Gln Pro Leu Arg Ser Ser
Pro Gly Gly 380 385 390gcc tcc ttc tac cac tgg ggt gct gct gta cca
cac agc caa ggg 1215Ala Ser Phe Tyr His Trp Gly Ala Ala Val Pro His
Ser Gln Gly 395 400 405gat gct ctg tgc aga cac atg tgc cgg gcc att
ggc gag agc ttc 1260Asp Ala Leu Cys Arg His Met Cys Arg Ala Ile Gly
Glu Ser Phe 410 415 420atc atg aag cgt gga gac agc ttc ctc gat ggg
acc cgg tgt atg 1305Ile Met Lys Arg Gly Asp Ser Phe Leu Asp Gly Thr
Arg Cys Met 425 430 435cca agt ggc ccc cgg gag gac ggg acc ctg agc
ctg tgt gtg tcg 1350Pro Ser Gly Pro Arg Glu Asp Gly Thr Leu Ser Leu
Cys Val Ser 440 445 450ggc agc tgc agg aca ttt ggc tgt gat ggt agg
atg gac tcc cag 1395Gly Ser Cys Arg Thr Phe Gly Cys Asp Gly Arg Met
Asp Ser Gln 455 460 465cag gta tgg gac agg tgc cag gtg tgt ggt ggg
gac aac agc acg 1440Gln Val Trp Asp Arg Cys Gln Val Cys Gly Gly Asp
Asn Ser Thr 470 475 480tgc agc cca cgg aag ggc tct ttc aca gct ggc
aga gcg aga gaa 1485Cys Ser Pro Arg Lys Gly Ser Phe Thr Ala Gly Arg
Ala Arg Glu 485 490 495tat gtc acg ttt ctg aca gtt acc ccc aac ctg
acc agt gtc tac 1530Tyr Val Thr Phe Leu Thr Val Thr Pro Asn Leu Thr
Ser Val Tyr 500 505 510att gcc aac cac agg cct ctc ttc aca cac ttg
gcg gtg agg atc 1575Ile Ala Asn His Arg Pro Leu Phe Thr His Leu Ala
Val Arg Ile 515 520 525gga ggg cgc tat gtc gtg gct ggg aag atg agc
atc tcc cct aac 1620Gly Gly Arg Tyr Val Val Ala Gly Lys Met Ser Ile
Ser Pro Asn 530 535 540acc acc tac ccc tcc ctc ctg gag gat ggt cgt
gtc gag tac aga 1665Thr Thr Tyr Pro Ser Leu Leu Glu Asp Gly Arg Val
Glu Tyr Arg 545 550 555gtg gcc ctc acc gag gac cgg ctg ccc cgc ctg
gag gag atc cgc 1710Val Ala Leu Thr Glu Asp Arg Leu Pro Arg Leu Glu
Glu Ile Arg 560 565 570atc tgg gga ccc ctc cag gaa gat gct gac atc
cag gtt tac agg 1755Ile Trp Gly Pro Leu Gln Glu Asp Ala Asp Ile Gln
Val Tyr Arg 575 580 585cgg tat ggc gag gag tat ggc aac ctc acc cgc
cca gac atc acc 1800Arg Tyr Gly Glu Glu Tyr Gly Asn Leu Thr Arg Pro
Asp Ile Thr 590 595 600ttc acc tac ttc cag cct aag cca cgg cag gcc
tgg gtg tgg gcc 1845Phe Thr Tyr Phe Gln Pro Lys Pro Arg Gln Ala Trp
Val Trp Ala 605 610 615gct gtg cgt ggg ccc tgc tcg gtg agc tgt ggg
gca ggg ctg
cgc 1890Ala Val Arg Gly Pro Cys Ser Val Ser Cys Gly Ala Gly Leu Arg
620 625 630tgg gta aac tac agc tgc ctg gac cag gcc agg aag gag ttg
gtg 1935Trp Val Asn Tyr Ser Cys Leu Asp Gln Ala Arg Lys Glu Leu Val
635 640 645gag act gtc cag tgc caa ggg agc cag cag cca cca gcg tgg
cca 1980Glu Thr Val Gln Cys Gln Gly Ser Gln Gln Pro Pro Ala Trp Pro
650 655 660gag gcc tgc gtg ctc gaa ccc tgc cct ccc tac tgg gcg gtg
gga 2025Glu Ala Cys Val Leu Glu Pro Cys Pro Pro Tyr Trp Ala Val Gly
665 670 675gac ttc ggc cca tgc agc gcc tcc tgt ggg ggc ggc ctg cgg
gag 2070Asp Phe Gly Pro Cys Ser Ala Ser Cys Gly Gly Gly Leu Arg Glu
680 685 690cgg cca gtg cgc tgc gtg gag gcc cag ggc agc ctc ctg aag
aca 2115Arg Pro Val Arg Cys Val Glu Ala Gln Gly Ser Leu Leu Lys Thr
695 700 705ttg ccc cca gcc cgg tgc aga gca ggg gcc cag cag cca gct
gtg 2160Leu Pro Pro Ala Arg Cys Arg Ala Gly Ala Gln Gln Pro Ala Val
710 715 720gcg ctg gaa acc tgc aac ccc cag ccc tgc cct gcc agg tgg
gag 2205Ala Leu Glu Thr Cys Asn Pro Gln Pro Cys Pro Ala Arg Trp Glu
725 730 735gtg tca gag ccc agc tca tgc aca tca gct ggt gga gca ggc
ctg 2250Val Ser Glu Pro Ser Ser Cys Thr Ser Ala Gly Gly Ala Gly Leu
740 745 750gcc ttg gag aac gag acc tgt gtg cca ggg gca gat ggc ctg
gag 2295Ala Leu Glu Asn Glu Thr Cys Val Pro Gly Ala Asp Gly Leu Glu
755 760 765gct cca gtg act gag ggg cct ggc tcc gta gat gag aag ctg
cct 2340Ala Pro Val Thr Glu Gly Pro Gly Ser Val Asp Glu Lys Leu Pro
770 775 780gcc cct gag ccc tgt gtc ggg atg tca tgt cct cca ggc tgg
ggc 2385Ala Pro Glu Pro Cys Val Gly Met Ser Cys Pro Pro Gly Trp Gly
785 790 795cat ctg gat gcc acc tct gca ggg gag aag gct ccc tcc cca
tgg 2430His Leu Asp Ala Thr Ser Ala Gly Glu Lys Ala Pro Ser Pro Trp
800 805 810ggc agc atc agg acg ggg gct caa gct gca cac gtg tgg acc
cct 2475Gly Ser Ile Arg Thr Gly Ala Gln Ala Ala His Val Trp Thr Pro
815 820 825gcg gca ggg tcg tgc tcc gtc tcc tgc ggg cga ggt ctg atg
gag 2520Ala Ala Gly Ser Cys Ser Val Ser Cys Gly Arg Gly Leu Met Glu
830 835 840ctg cgt ttc ctg tgc atg gac tct gcc ctc agg gtg cct gtc
cag 2565Leu Arg Phe Leu Cys Met Asp Ser Ala Leu Arg Val Pro Val Gln
845 850 855gaa gag ctg tgt ggc ctg gca agc aag cct ggg agc cgg cgg
gag 2610Glu Glu Leu Cys Gly Leu Ala Ser Lys Pro Gly Ser Arg Arg Glu
860 865 870gtc tgc cag gct gtc ccg tgc cct gct cgg tgg cag tac aag
ctg 2655Val Cys Gln Ala Val Pro Cys Pro Ala Arg Trp Gln Tyr Lys Leu
875 880 885gcg gcc tgc agc gtg agc tgt ggg aga ggg gtc gtg cgg agg
atc 2700Ala Ala Cys Ser Val Ser Cys Gly Arg Gly Val Val Arg Arg Ile
890 895 900ctg tat tgt gcc cgg gcc cat ggg gag gac gat ggt gag gag
atc 2745Leu Tyr Cys Ala Arg Ala His Gly Glu Asp Asp Gly Glu Glu Ile
905 910 915ctg ttg gac acc cag tgc cag ggg ctg cct cgc ccg gaa ccc
cag 2790Leu Leu Asp Thr Gln Cys Gln Gly Leu Pro Arg Pro Glu Pro Gln
920 925 930gag gcc tgc agc ctg gag ccc tgc cca cct agg tgg aaa gtc
atg 2835Glu Ala Cys Ser Leu Glu Pro Cys Pro Pro Arg Trp Lys Val Met
935 940 945tcc ctt ggc cca tgt tcg gcc agc tgt ggc ctt ggc act gct
aga 2880Ser Leu Gly Pro Cys Ser Ala Ser Cys Gly Leu Gly Thr Ala Arg
950 955 960cgc tcg gtg gcc tgt gtg cag ctc gac caa ggc cag gac gtg
gag 2925Arg Ser Val Ala Cys Val Gln Leu Asp Gln Gly Gln Asp Val Glu
965 970 975gtg gac gag gcg gcc tgt gcg gcg ctg gtg cgg ccc gag gcc
agt 2970Val Asp Glu Ala Ala Cys Ala Ala Leu Val Arg Pro Glu Ala Ser
980 985 990gtc ccc tgt ctc att gcc gac tgc acc tac cgc tgg cat gtt
ggc 3015Val Pro Cys Leu Ile Ala Asp Cys Thr Tyr Arg Trp His Val Gly
995 1000 1005acc tgg atg gag tgc tct gtt tcc tgt ggg gat ggc atc
cag cgc 3060Thr Trp Met Glu Cys Ser Val Ser Cys Gly Asp Gly Ile Gln
Arg 1010 1015 1020cgg cgt gac acc tgc ctc gga ccc cag gcc cag gcg
cct gtg cca 3105Arg Arg Asp Thr Cys Leu Gly Pro Gln Ala Gln Ala Pro
Val Pro 1025 1030 1035gct gat ttc tgc cag cac ttg ccc aag ccg gtg
act gtg cgt ggc 3150Ala Asp Phe Cys Gln His Leu Pro Lys Pro Val Thr
Val Arg Gly 1040 1045 1050tgc tgg gct ggg ccc tgt gtg gga cag ggt
gcc tgt ggc agg cag 3195Cys Trp Ala Gly Pro Cys Val Gly Gln Gly Ala
Cys Gly Arg Gln 1055 1060 1065cac ctt gag cca aca gga acc att gac
atg cga ggc cca ggg cag 3240His Leu Glu Pro Thr Gly Thr Ile Asp Met
Arg Gly Pro Gly Gln 1070 1075 1080gca gac tgt gca gtg gcc att ggg
cgg ccc ctc ggg gag gtg gtg 3285Ala Asp Cys Ala Val Ala Ile Gly Arg
Pro Leu Gly Glu Val Val 1085 1090 1095acc ctc cgc gtc ctt gag agt
tct ctc aac tgc agt gcg ggg gac 3330Thr Leu Arg Val Leu Glu Ser Ser
Leu Asn Cys Ser Ala Gly Asp 1100 1105 1110atg ttg ctg ctt tgg ggc
cgg ctc acc tgg agg aag atg tgc agg 3375Met Leu Leu Leu Trp Gly Arg
Leu Thr Trp Arg Lys Met Cys Arg 1115 1120 1125aag ctg ttg gac atg
act ttc agc tcc aag acc aac acg ctg gtg 3420Lys Leu Leu Asp Met Thr
Phe Ser Ser Lys Thr Asn Thr Leu Val 1130 1135 1140gtg agg cag cgc
tgc ggg cgg cca gga ggt ggg gtg ctg ctg cgg 3465Val Arg Gln Arg Cys
Gly Arg Pro Gly Gly Gly Val Leu Leu Arg 1145 1150 1155tat ggg agc
cag ctt gct cct gaa acc ttc tac aga gaa tgt gac 3510Tyr Gly Ser Gln
Leu Ala Pro Glu Thr Phe Tyr Arg Glu Cys Asp 1160 1165 1170atg cag
ctc ttt ggg ccc tgg ggt gaa atc gtg agc ccc tcg ctg 3555Met Gln Leu
Phe Gly Pro Trp Gly Glu Ile Val Ser Pro Ser Leu 1175 1180 1185agt
cca gcc acg agt aat gca ggg ggc tgc cgg ctc ttc att aat 3600Ser Pro
Ala Thr Ser Asn Ala Gly Gly Cys Arg Leu Phe Ile Asn 1190 1195
1200gtg gct ccg cac gca cgg att gcc atc cat gcc ctg gcc acc aac
3645Val Ala Pro His Ala Arg Ile Ala Ile His Ala Leu Ala Thr Asn
1205 1210 1215atg ggc gct ggg acc gag gga gcc aat gcc agc tac atc
ttg atc 3690Met Gly Ala Gly Thr Glu Gly Ala Asn Ala Ser Tyr Ile Leu
Ile 1220 1225 1230cgg gac acc cac agc ttg agg acc aca gcg ttc cat
ggg cag cag 3735Arg Asp Thr His Ser Leu Arg Thr Thr Ala Phe His Gly
Gln Gln 1235 1240 1245gtg ctc tac tgg gag tca gag agc agc cag gct
gag atg gag ttc 3780Val Leu Tyr Trp Glu Ser Glu Ser Ser Gln Ala Glu
Met Glu Phe 1250 1255 1260agc gag ggc ttc ctg aag gct cag gcc agc
ctg cgg ggc cag tac 3825Ser Glu Gly Phe Leu Lys Ala Gln Ala Ser Leu
Arg Gly Gln Tyr 1265 1270 1275tgg acc ctc caa tca tgg gta ccg gag
atg cag gac cct cag tcc 3870Trp Thr Leu Gln Ser Trp Val Pro Glu Met
Gln Asp Pro Gln Ser 1280 1285 1290tgg aag gga aag gaa gga acc
3891Trp Lys Gly Lys Glu Gly Thr 1295181378PRTHomo sapiens 18gct gca
ggc ggc atc cta cac ctg gag ctg ctg gtg gcc gtg ggc 45Ala Ala Gly
Gly Ile Leu His Leu Glu Leu Leu Val Ala Val Gly1 5 10 15ccc gat gtc
ttc cag gct cac cag gag gac aca gag cgc tat gtg 90Pro Asp Val Phe
Gln Ala His Gln Glu Asp Thr Glu Arg Tyr Val 20 25 30ctc acc aac ctc
aac atc ggg gca gaa ctg ctt cgg gac ccg tcc 135Leu Thr Asn Leu Asn
Ile Gly Ala Glu Leu Leu Arg Asp Pro Ser 35 40 45ctg ggg gct cag ttt
cgg gtg cac ctg gtg aag atg gtc att ctg 180Leu Gly Ala Gln Phe Arg
Val His Leu Val Lys Met Val Ile Leu 50 55 60aca gag cct gag ggt gct
cca aat atc aca gcc aac ctc acc tcg 225Thr Glu Pro Glu Gly Ala Pro
Asn Ile Thr Ala Asn Leu Thr Ser 65 70 75tcc ctg ctg agc gtc tgt ggg
tgg agc cag acc atc aac cct gag 270Ser Leu Leu Ser Val Cys Gly Trp
Ser Gln Thr Ile Asn Pro Glu 80 85 90gac gac acg gat cct ggc cat gct
gac ctg gtc ctc tat atc act 315Asp Asp Thr Asp Pro Gly His Ala Asp
Leu Val Leu Tyr Ile Thr 95 100 105agg ttt gac ctg gag ttg cct gat
ggt aac cgg cag gtg cgg ggc 360Arg Phe Asp Leu Glu Leu Pro Asp Gly
Asn Arg Gln Val Arg Gly 110 115 120gtc acc cag ctg ggc ggt gcc tgc
tcc cca acc tgg agc tgc ctc 405Val Thr Gln Leu Gly Gly Ala Cys Ser
Pro Thr Trp Ser Cys Leu 125 130 135att acc gag gac act ggc ttc gac
ctg gga gtc acc att gcc cat 450Ile Thr Glu Asp Thr Gly Phe Asp Leu
Gly Val Thr Ile Ala His 140 145 150gag att ggg cac agc ttc ggc ctg
gag cac gac ggc gcg ccc ggc 495Glu Ile Gly His Ser Phe Gly Leu Glu
His Asp Gly Ala Pro Gly 155 160 165agc ggc tgc ggc ccc agc gga cac
gtg atg gct tcg gac ggc gcc 540Ser Gly Cys Gly Pro Ser Gly His Val
Met Ala Ser Asp Gly Ala 170 175 180gcg ccc cgc gcc ggc ctc gcc tgg
tcc ccc tgc agc cgc cgg cag 585Ala Pro Arg Ala Gly Leu Ala Trp Ser
Pro Cys Ser Arg Arg Gln 185 190 195ctg ctg agc ctg ctc agg acg ggc
gcg ctg cgt gtg gga ccc gcc 630Leu Leu Ser Leu Leu Arg Thr Gly Ala
Leu Arg Val Gly Pro Ala 200 205 210gcg gcc tca acc cgg gtc cgc ggg
gca ccc gcc gga tgc gca gcc 675Ala Ala Ser Thr Arg Val Arg Gly Ala
Pro Ala Gly Cys Ala Ala 215 220 225tgg cct cta cta cag cgc caa cga
gca gtg ccg cgt ggc ctt cgg 720Trp Pro Leu Leu Gln Arg Gln Arg Ala
Val Pro Arg Gly Leu Arg 230 235 240ccc caa ggc tgt cgc ctg cac ctt
cgc cag gga gca cct ggt gag 765Pro Gln Gly Cys Arg Leu His Leu Arg
Gln Gly Ala Pro Gly Glu 245 250 255tct gcc ggc ggt ggc ctg gga ttg
gct gtg agg tcc ctc cgc atc 810Ser Ala Gly Gly Gly Leu Gly Leu Ala
Val Arg Ser Leu Arg Ile 260 265 270acc cag ctc acg tcc ccc caa acg
tgc atg gat atg tgc cag gcc 855Thr Gln Leu Thr Ser Pro Gln Thr Cys
Met Asp Met Cys Gln Ala 275 280 285 ctc tcc tgc cac aca gac ccg ctg
gac caa agc agc tgc agc cgc 900Leu Ser Cys His Thr Asp Pro Leu Asp
Gln Ser Ser Cys Ser Arg 290 295 300ctc ctc gtt cct ctc ctg gat ggg
aca gaa tgt ggc gtg gag aag 945Leu Leu Val Pro Leu Leu Asp Gly Thr
Glu Cys Gly Val Glu Lys 305 310 315tgg tgc tcc aag ggt cgc tgc cgc
tcc ctg gtg gag ctg acc ccc 990Trp Cys Ser Lys Gly Arg Cys Arg Ser
Leu Val Glu Leu Thr Pro 320 325 330ata gca gca gtg cat ggg cgc tgg
tct agc tgg ggt ccc cga agt 1035Ile Ala Ala Val His Gly Arg Trp Ser
Ser Trp Gly Pro Arg Ser 335 340 345cct tgc tcc cgc tcc tgc gga gga
ggt gtg gtc acc agg agg cgg 1080Pro Cys Ser Arg Ser Cys Gly Gly Gly
Val Val Thr Arg Arg Arg 350 355 360cag tgc aac aac ccc aga cct gcc
ttt ggg ggg cgt gca tgt gtt 1125Gln Cys Asn Asn Pro Arg Pro Ala Phe
Gly Gly Arg Ala Cys Val 365 370 375ggt gct gac ctc cag gcc gag atg
tgc aac act cag gcc tgc gag 1170Gly Ala Asp Leu Gln Ala Glu Met Cys
Asn Thr Gln Ala Cys Glu 380 385 390aag acc cag ctg gag ttc atg tcg
caa cag tgc gcc agg acc gac 1215Lys Thr Gln Leu Glu Phe Met Ser Gln
Gln Cys Ala Arg Thr Asp 395 400 405ggc cag ccg ctg cgc tcc tcc cct
ggc ggc gcc tcc ttc tac cac 1260Gly Gln Pro Leu Arg Ser Ser Pro Gly
Gly Ala Ser Phe Tyr His 410 415 420tgg ggt gct gct gta cca cac agc
caa ggg gat gct ctg tgc aga 1305Trp Gly Ala Ala Val Pro His Ser Gln
Gly Asp Ala Leu Cys Arg 425 430 435cac atg tgc cgg gcc att ggc gag
agc ttc atc atg aag cgt gga 1350His Met Cys Arg Ala Ile Gly Glu Ser
Phe Ile Met Lys Arg Gly 440 445 450gac agc ttc ctc gat ggg acc cgg
tgt atg cca agt ggc ccc cgg 1395Asp Ser Phe Leu Asp Gly Thr Arg Cys
Met Pro Ser Gly Pro Arg 455 460 465gag gac ggg acc ctg agc ctg tgt
gtg tcg ggc agc tgc agg aca 1440Glu Asp Gly Thr Leu Ser Leu Cys Val
Ser Gly Ser Cys Arg Thr 470 475 480ttt ggc tgt gat ggt agg atg gac
tcc cag cag gta tgg gac agg 1485Phe Gly Cys Asp Gly Arg Met Asp Ser
Gln Gln Val Trp Asp Arg 485 490 495tgc cag gtg tgt ggt ggg gac aac
agc acg tgc agc cca cgg aag 1530Cys Gln Val Cys Gly Gly Asp Asn Ser
Thr Cys Ser Pro Arg Lys 500 505 510ggc tct ttc aca gct ggc aga gcg
aga gaa tat gtc acg ttt ctg 1575Gly Ser Phe Thr Ala Gly Arg Ala Arg
Glu Tyr Val Thr Phe Leu 515 520 525aca gtt acc ccc aac ctg acc agt
gtc tac att gcc aac cac agg 1620Thr Val Thr Pro Asn Leu Thr Ser Val
Tyr Ile Ala Asn His Arg 530 535 540cct ctc ttc aca cac ttg gcg gtg
agg atc gga ggg cgc tat gtc 1665Pro Leu Phe Thr His Leu Ala Val Arg
Ile Gly Gly Arg Tyr Val 545 550 555gtg gct ggg aag atg agc atc tcc
cct aac acc acc tac ccc tcc 1710Val Ala Gly Lys Met Ser Ile Ser Pro
Asn Thr Thr Tyr Pro Ser 560 565 570ctc ctg gag gat ggt cgt gtc gag
tac aga gtg gcc ctc acc gag 1755Leu Leu Glu Asp Gly Arg Val Glu Tyr
Arg Val Ala Leu Thr Glu 575 580 585gac cgg ctg ccc cgc ctg gag gag
atc cgc atc tgg gga ccc ctc 1800Asp Arg Leu Pro Arg Leu Glu Glu Ile
Arg Ile Trp Gly Pro Leu 590 595 600cag gaa gat gct gac atc cag gtt
tac agg cgg tat ggc gag gag 1845Gln Glu Asp Ala Asp Ile Gln Val Tyr
Arg Arg Tyr Gly Glu Glu 605 610 615tat ggc aac ctc acc cgc cca gac
atc acc ttc acc tac ttc cag 1890Tyr Gly Asn Leu Thr Arg Pro Asp Ile
Thr Phe Thr Tyr Phe Gln 620 625 630cct aag cca cgg cag gcc tgg gtg
tgg gcc gct gtg cgt ggg ccc 1935Pro Lys Pro Arg Gln Ala Trp Val Trp
Ala Ala Val Arg Gly Pro 635 640 645tgc tcg gtg agc tgt ggg gca ggg
ctg cgc tgg gta aac tac agc 1980Cys Ser Val Ser Cys Gly Ala Gly Leu
Arg Trp Val Asn Tyr Ser 650 655 660tgc ctg gac cag gcc agg aag gag
ttg gtg gag act gtc cag tgc 2025Cys Leu Asp Gln Ala Arg Lys Glu Leu
Val Glu Thr Val Gln Cys 665 670 675caa ggg agc cag cag cca cca gcg
tgg cca gag gcc tgc gtg ctc 2070Gln Gly Ser Gln Gln Pro Pro Ala Trp
Pro Glu Ala Cys Val Leu 680 685 690gaa ccc tgc cct ccc tac tgg gcg
gtg gga gac ttc ggc cca tgc 2115Glu Pro Cys Pro Pro Tyr Trp Ala Val
Gly Asp Phe Gly Pro Cys 695 700 705agc gcc tcc tgt ggg ggc ggc ctg
cgg gag cgg cca gtg cgc tgc 2160Ser Ala Ser Cys Gly Gly Gly Leu Arg
Glu Arg Pro Val Arg Cys 710 715 720gtg gag gcc cag ggc agc ctc ctg
aag aca ttg ccc cca gcc cgg 2205Val Glu Ala Gln Gly Ser Leu Leu Lys
Thr Leu Pro Pro Ala Arg 725 730 735tgc aga gca ggg gcc cag cag cca
gct gtg gcg ctg gaa acc tgc 2250Cys Arg Ala Gly Ala Gln Gln Pro Ala
Val Ala Leu Glu Thr Cys 740 745
750aac ccc cag ccc tgc cct gcc agg tgg gag gtg tca gag ccc agc
2295Asn Pro Gln Pro Cys Pro Ala Arg Trp Glu Val Ser Glu Pro Ser 755
760 765tca tgc aca tca gct ggt gga gca ggc ctg gcc ttg gag aac gag
2340Ser Cys Thr Ser Ala Gly Gly Ala Gly Leu Ala Leu Glu Asn Glu 770
775 780acc tgt gtg cca ggg gca gat ggc ctg gag gct cca gtg act gag
2385Thr Cys Val Pro Gly Ala Asp Gly Leu Glu Ala Pro Val Thr Glu 785
790 795ggg cct ggc tcc gta gat gag aag ctg cct gcc cct gag ccc tgt
2430Gly Pro Gly Ser Val Asp Glu Lys Leu Pro Ala Pro Glu Pro Cys 800
805 810gtc ggg atg tca tgt cct cca ggc tgg ggc cat ctg gat gcc acc
2475Val Gly Met Ser Cys Pro Pro Gly Trp Gly His Leu Asp Ala Thr 815
820 825tct gca ggg gag aag gct ccc tcc cca tgg ggc agc atc agg acg
2520Ser Ala Gly Glu Lys Ala Pro Ser Pro Trp Gly Ser Ile Arg Thr 830
835 840ggg gct caa gct gca cac gtg tgg acc cct gcg gca ggg tcg tgc
2565Gly Ala Gln Ala Ala His Val Trp Thr Pro Ala Ala Gly Ser Cys 845
850 855tcc gtc tcc tgc ggg cga ggt ctg atg gag ctg cgt ttc ctg tgc
2610Ser Val Ser Cys Gly Arg Gly Leu Met Glu Leu Arg Phe Leu Cys 860
865 870atg gac tct gcc ctc agg gtg cct gtc cag gaa gag ctg tgt ggc
2655Met Asp Ser Ala Leu Arg Val Pro Val Gln Glu Glu Leu Cys Gly 875
880 885ctg gca agc aag cct ggg agc cgg cgg gag gtc tgc cag gct gtc
2700Leu Ala Ser Lys Pro Gly Ser Arg Arg Glu Val Cys Gln Ala Val 890
895 900ccg tgc cct gct cgg tgg cag tac aag ctg gcg gcc tgc agc gtg
2745Pro Cys Pro Ala Arg Trp Gln Tyr Lys Leu Ala Ala Cys Ser Val 905
910 915agc tgt ggg aga ggg gtc gtg cgg agg atc ctg tat tgt gcc cgg
2790Ser Cys Gly Arg Gly Val Val Arg Arg Ile Leu Tyr Cys Ala Arg 920
925 930gcc cat ggg gag gac gat ggt gag gag atc ctg ttg gac acc cag
2835Ala His Gly Glu Asp Asp Gly Glu Glu Ile Leu Leu Asp Thr Gln 935
940 945tgc cag ggg ctg cct cgc ccg gaa ccc cag gag gcc tgc agc ctg
2880Cys Gln Gly Leu Pro Arg Pro Glu Pro Gln Glu Ala Cys Ser Leu 950
955 960gag ccc tgc cca cct agg tgg aaa gtc atg tcc ctt ggc cca tgt
2925Glu Pro Cys Pro Pro Arg Trp Lys Val Met Ser Leu Gly Pro Cys 965
970 975tcg gcc agc tgt ggc ctt ggc act gct aga cgc tcg gtg gcc tgt
2970Ser Ala Ser Cys Gly Leu Gly Thr Ala Arg Arg Ser Val Ala Cys 980
985 990gtg cag ctc gac caa ggc cag gac gtg gag gtg gac gag gcg gcc
3015Val Gln Leu Asp Gln Gly Gln Asp Val Glu Val Asp Glu Ala Ala 995
1000 1005tgt gcg gcg ctg gtg cgg ccc gag gcc agt gtc ccc tgt ctc
att 3060Cys Ala Ala Leu Val Arg Pro Glu Ala Ser Val Pro Cys Leu Ile
1010 1015 1020gcc gac tgc acc tac cgc tgg cat gtt ggc acc tgg atg
gag tgc 3105Ala Asp Cys Thr Tyr Arg Trp His Val Gly Thr Trp Met Glu
Cys 1025 1030 1035tct gtt tcc tgt ggg gat ggc atc cag cgc cgg cgt
gac acc tgc 3150Ser Val Ser Cys Gly Asp Gly Ile Gln Arg Arg Arg Asp
Thr Cys 1040 1045 1050ctc gga ccc cag gcc cag gcg cct gtg cca gct
gat ttc tgc cag 3195Leu Gly Pro Gln Ala Gln Ala Pro Val Pro Ala Asp
Phe Cys Gln 1055 1060 1065cac ttg ccc aag ccg gtg act gtg cgt ggc
tgc tgg gct ggg ccc 3240His Leu Pro Lys Pro Val Thr Val Arg Gly Cys
Trp Ala Gly Pro 1070 1075 1080tgt gtg gga cag ggt acg ccc agc ctg
gtg ccc cac gaa gaa gcc 3285Cys Val Gly Gln Gly Thr Pro Ser Leu Val
Pro His Glu Glu Ala 1085 1090 1095gct gct cca gga cgg acc aca gcc
acc cct gct ggt gcc tcc ctg 3330Ala Ala Pro Gly Arg Thr Thr Ala Thr
Pro Ala Gly Ala Ser Leu 1100 1105 1110gag tgg tcc cag gcc cgg ggc
ctg ctc ttc tcc ccg gct ccc cag 3375Glu Trp Ser Gln Ala Arg Gly Leu
Leu Phe Ser Pro Ala Pro Gln 1115 1120 1125cct cgg cgg ctc ctg ccc
ggg ccc cag gaa aac tca gtg cag tcc 3420Pro Arg Arg Leu Leu Pro Gly
Pro Gln Glu Asn Ser Val Gln Ser 1130 1135 1140agt gcc tgt ggc agg
cag cac ctt gag cca aca gga acc att gac 3465Ser Ala Cys Gly Arg Gln
His Leu Glu Pro Thr Gly Thr Ile Asp 1145 1150 1155atg cga ggc cca
ggg cag gca gac tgt gca gtg gcc att ggg cgg 3510Met Arg Gly Pro Gly
Gln Ala Asp Cys Ala Val Ala Ile Gly Arg 1160 1165 1170ccc ctc ggg
gag gtg gtg acc ctc cgc gtc ctt gag agt tct ctc 3555Pro Leu Gly Glu
Val Val Thr Leu Arg Val Leu Glu Ser Ser Leu 1175 1180 1185aac tgc
agt gcg ggg gac atg ttg ctg ctt tgg ggc cgg ctc acc 3600Asn Cys Ser
Ala Gly Asp Met Leu Leu Leu Trp Gly Arg Leu Thr 1190 1195 1200tgg
agg aag atg tgc agg aag ctg ttg gac atg act ttc agc tcc 3645Trp Arg
Lys Met Cys Arg Lys Leu Leu Asp Met Thr Phe Ser Ser 1205 1210
1215aag acc aac acg ctg gtg gtg agg cag cgc tgc ggg cgg cca gga
3690Lys Thr Asn Thr Leu Val Val Arg Gln Arg Cys Gly Arg Pro Gly
1220 1225 1230ggt ggg gtg ctg ctg cgg tat ggg agc cag ctt gct cct
gaa acc 3735Gly Gly Val Leu Leu Arg Tyr Gly Ser Gln Leu Ala Pro Glu
Thr 1235 1240 1245ttc tac aga gaa tgt gac atg cag ctc ttt ggg ccc
tgg ggt gaa 3780Phe Tyr Arg Glu Cys Asp Met Gln Leu Phe Gly Pro Trp
Gly Glu 1250 1255 1260atc gtg agc ccc tcg ctg agt cca gcc acg agt
aat gca ggg ggc 3825Ile Val Ser Pro Ser Leu Ser Pro Ala Thr Ser Asn
Ala Gly Gly 1265 1270 1275tgc cgg ctc ttc att aat gtg gct ccg cac
gca cgg att gcc atc 3870Cys Arg Leu Phe Ile Asn Val Ala Pro His Ala
Arg Ile Ala Ile 1280 1285 1290cat gcc ctg gcc acc aac atg ggc gct
ggg acc gag gga gcc aat 3915His Ala Leu Ala Thr Asn Met Gly Ala Gly
Thr Glu Gly Ala Asn 1295 1300 1305gcc agc tac atc ttg atc cgg gac
acc cac agc ttg agg acc aca 3960Ala Ser Tyr Ile Leu Ile Arg Asp Thr
His Ser Leu Arg Thr Thr 1310 1315 1320gcg ttc cat ggg cag cag gtg
ctc tac tgg gag tca gag agc agc 4005Ala Phe His Gly Gln Gln Val Leu
Tyr Trp Glu Ser Glu Ser Ser 1325 1330 1335cag gct gag atg gag ttc
agc gag ggc ttc ctg aag gct cag gcc 4050Gln Ala Glu Met Glu Phe Ser
Glu Gly Phe Leu Lys Ala Gln Ala 1340 1345 1350agc ctg cgg ggc cag
tac tgg acc ctc caa tca tgg gta ccg gag 4095Ser Leu Arg Gly Gln Tyr
Trp Thr Leu Gln Ser Trp Val Pro Glu 1355 1360 1365atg cag gac cct
cag tcc tgg aag gga aag gaa gga acc 4134Met Gln Asp Pro Gln Ser Trp
Lys Gly Lys Glu Gly Thr 1370 1375191322PRTHomo sapiens 19gct gca
ggc ggc atc cta cac ctg gag ctg ctg gtg gcc gtg ggc 45Ala Ala Gly
Gly Ile Leu His Leu Glu Leu Leu Val Ala Val Gly1 5 10 15ccc gat gtc
ttc cag gct cac cag gag gac aca gag cgc tat gtg 90Pro Asp Val Phe
Gln Ala His Gln Glu Asp Thr Glu Arg Tyr Val 20 25 30ctc acc aac ctc
aac atc ggg gca gaa ctg ctt cgg gac ccg tcc 135Leu Thr Asn Leu Asn
Ile Gly Ala Glu Leu Leu Arg Asp Pro Ser 35 40 45ctg ggg gct cag ttt
cgg gtg cac ctg gtg aag atg gtc att ctg 180Leu Gly Ala Gln Phe Arg
Val His Leu Val Lys Met Val Ile Leu 50 55 60aca gag cct gag ggt gct
cca aat atc aca gcc aac ctc acc tcg 225Thr Glu Pro Glu Gly Ala Pro
Asn Ile Thr Ala Asn Leu Thr Ser 65 70 75tcc ctg ctg agc gtc tgt ggg
tgg agc cag acc atc aac cct gag 270Ser Leu Leu Ser Val Cys Gly Trp
Ser Gln Thr Ile Asn Pro Glu 80 85 90gac gac acg gat cct ggc cat gct
gac ctg gtc ctc tat atc act 315Asp Asp Thr Asp Pro Gly His Ala Asp
Leu Val Leu Tyr Ile Thr 95 100 105agg ttt gac ctg gag ttg cct gat
ggt aac cgg cag gtg cgg ggc 360Arg Phe Asp Leu Glu Leu Pro Asp Gly
Asn Arg Gln Val Arg Gly 110 115 120gtc acc cag ctg ggc ggt gcc tgc
tcc cca acc tgg agc tgc ctc 405Val Thr Gln Leu Gly Gly Ala Cys Ser
Pro Thr Trp Ser Cys Leu 125 130 135att acc gag gac act ggc ttc gac
ctg gga gtc acc att gcc cat 450Ile Thr Glu Asp Thr Gly Phe Asp Leu
Gly Val Thr Ile Ala His 140 145 150gag att ggg cac agc ttc ggc ctg
gag cac gac ggc gcg ccc ggc 495Glu Ile Gly His Ser Phe Gly Leu Glu
His Asp Gly Ala Pro Gly 155 160 165agc ggc tgc ggc ccc agc gga cac
gtg atg gct tcg gac ggc gcc 540Ser Gly Cys Gly Pro Ser Gly His Val
Met Ala Ser Asp Gly Ala 170 175 180gcg ccc cgc gcc ggc ctc gcc tgg
tcc ccc tgc agc cgc cgg cag 585Ala Pro Arg Ala Gly Leu Ala Trp Ser
Pro Cys Ser Arg Arg Gln 185 190 195ctg ctg agc ctg ctc agg acg ggc
gcg ctg cgt gtg gga ccc gcc 630Leu Leu Ser Leu Leu Arg Thr Gly Ala
Leu Arg Val Gly Pro Ala 200 205 210gcg gcc tca acc cgg gtc cgc ggg
gca ccc gcc gga tgc gca gcc 675Ala Ala Ser Thr Arg Val Arg Gly Ala
Pro Ala Gly Cys Ala Ala 215 220 225tgg cct cta cta cag cgc caa cga
gca gtg ccg cgt ggc ctt cgg 720Trp Pro Leu Leu Gln Arg Gln Arg Ala
Val Pro Arg Gly Leu Arg 230 235 240ccc caa ggc tgt cgc ctg cac ctt
cgc cag gga gca cct ggt gag 765Pro Gln Gly Cys Arg Leu His Leu Arg
Gln Gly Ala Pro Gly Glu 245 250 255tct gcc ggc ggt ggc ctg gga ttg
gct gtg agg tcc ctc cgc atc 810Ser Ala Gly Gly Gly Leu Gly Leu Ala
Val Arg Ser Leu Arg Ile 260 265 270acc cag ctc acg tcc ccc caa acg
tgc atg gat atg tgc cag gcc 855 Thr Gln Leu Thr Ser Pro Gln Thr Cys
Met Asp Met Cys Gln Ala 275 280 285ctc tcc tgc cac aca gac ccg ctg
gac caa agc agc tgc agc cgc 900Leu Ser Cys His Thr Asp Pro Leu Asp
Gln Ser Ser Cys Ser Arg 290 295 300ctc ctc gtt cct ctc ctg gat ggg
aca gaa tgt ggc gtg gag aag 945Leu Leu Val Pro Leu Leu Asp Gly Thr
Glu Cys Gly Val Glu Lys 305 310 315tgg tgc tcc aag ggt cgc tgc cgc
tcc ctg gtg gag ctg acc ccc 990Trp Cys Ser Lys Gly Arg Cys Arg Ser
Leu Val Glu Leu Thr Pro 320 325 330ata gca gca gtg cat ggg cgc tgg
tct agc tgg ggt ccc cga agt 1035Ile Ala Ala Val His Gly Arg Trp Ser
Ser Trp Gly Pro Arg Ser 335 340 345cct tgc tcc cgc tcc tgc gga gga
ggt gtg gtc acc agg agg cgg 1080Pro Cys Ser Arg Ser Cys Gly Gly Gly
Val Val Thr Arg Arg Arg 350 355 360cag tgc aac aac ccc aga cct gcc
ttt ggg ggg cgt gca tgt gtt 1125Gln Cys Asn Asn Pro Arg Pro Ala Phe
Gly Gly Arg Ala Cys Val 365 370 375ggt gct gac ctc cag gcc gag atg
tgc aac act cag gcc tgc gag 1170Gly Ala Asp Leu Gln Ala Glu Met Cys
Asn Thr Gln Ala Cys Glu 380 385 390aag acc cag ctg gag ttc atg tcg
caa cag tgc gcc agg acc gac 1215Lys Thr Gln Leu Glu Phe Met Ser Gln
Gln Cys Ala Arg Thr Asp 395 400 405ggc cag ccg ctg cgc tcc tcc cct
ggc ggc gcc tcc ttc tac cac 1260Gly Gln Pro Leu Arg Ser Ser Pro Gly
Gly Ala Ser Phe Tyr His 410 415 420tgg ggt gct gct gta cca cac agc
caa ggg gat gct ctg tgc aga 1305Trp Gly Ala Ala Val Pro His Ser Gln
Gly Asp Ala Leu Cys Arg 425 430 435cac atg tgc cgg gcc att ggc gag
agc ttc atc atg aag cgt gga 1350His Met Cys Arg Ala Ile Gly Glu Ser
Phe Ile Met Lys Arg Gly 440 445 450gac agc ttc ctc gat ggg acc cgg
tgt atg cca agt ggc ccc cgg 1395Asp Ser Phe Leu Asp Gly Thr Arg Cys
Met Pro Ser Gly Pro Arg 455 460 465gag gac ggg acc ctg agc ctg tgt
gtg tcg ggc agc tgc agg aca 1440Glu Asp Gly Thr Leu Ser Leu Cys Val
Ser Gly Ser Cys Arg Thr 470 475 480ttt ggc tgt gat ggt agg atg gac
tcc cag cag gta tgg gac agg 1485Phe Gly Cys Asp Gly Arg Met Asp Ser
Gln Gln Val Trp Asp Arg 485 490 495tgc cag gtg tgt ggt ggg gac aac
agc acg tgc agc cca cgg aag 1530Cys Gln Val Cys Gly Gly Asp Asn Ser
Thr Cys Ser Pro Arg Lys 500 505 510ggc tct ttc aca gct ggc aga gcg
aga gaa tat gtc acg ttt ctg 1575Gly Ser Phe Thr Ala Gly Arg Ala Arg
Glu Tyr Val Thr Phe Leu 515 520 525aca gtt acc ccc aac ctg acc agt
gtc tac att gcc aac cac agg 1620Thr Val Thr Pro Asn Leu Thr Ser Val
Tyr Ile Ala Asn His Arg 530 535 540cct ctc ttc aca cac ttg gcg gtg
agg atc gga ggg cgc tat gtc 1665Pro Leu Phe Thr His Leu Ala Val Arg
Ile Gly Gly Arg Tyr Val 545 550 555gtg gct ggg aag atg agc atc tcc
cct aac acc acc tac ccc tcc 1710Val Ala Gly Lys Met Ser Ile Ser Pro
Asn Thr Thr Tyr Pro Ser 560 565 570ctc ctg gag gat ggt cgt gtc gag
tac aga gtg gcc ctc acc gag 1755Leu Leu Glu Asp Gly Arg Val Glu Tyr
Arg Val Ala Leu Thr Glu 575 580 585gac cgg ctg ccc cgc ctg gag gag
atc cgc atc tgg gga ccc ctc 1800Asp Arg Leu Pro Arg Leu Glu Glu Ile
Arg Ile Trp Gly Pro Leu 590 595 600cag gaa gat gct gac atc cag gtt
tac agg cgg tat ggc gag gag 1845Gln Glu Asp Ala Asp Ile Gln Val Tyr
Arg Arg Tyr Gly Glu Glu 605 610 615tat ggc aac ctc acc cgc cca gac
atc acc ttc acc tac ttc cag 1890Tyr Gly Asn Leu Thr Arg Pro Asp Ile
Thr Phe Thr Tyr Phe Gln 620 625 630cct aag cca cgg cag gcc tgg gtg
tgg gcc gct gtg cgt ggg ccc 1935Pro Lys Pro Arg Gln Ala Trp Val Trp
Ala Ala Val Arg Gly Pro 635 640 645tgc tcg gtg agc tgt ggg gca ggg
ctg cgc tgg gta aac tac agc 1980Cys Ser Val Ser Cys Gly Ala Gly Leu
Arg Trp Val Asn Tyr Ser 650 655 660tgc ctg gac cag gcc agg aag gag
ttg gtg gag act gtc cag tgc 2025Cys Leu Asp Gln Ala Arg Lys Glu Leu
Val Glu Thr Val Gln Cys 665 670 675caa ggg agc cag cag cca cca gcg
tgg cca gag gcc tgc gtg ctc 2070Gln Gly Ser Gln Gln Pro Pro Ala Trp
Pro Glu Ala Cys Val Leu 680 685 690gaa ccc tgc cct ccc tac tgg gcg
gtg gga gac ttc ggc cca tgc 2115Glu Pro Cys Pro Pro Tyr Trp Ala Val
Gly Asp Phe Gly Pro Cys 695 700 705agc gcc tcc tgt ggg ggc ggc ctg
cgg gag cgg cca gtg cgc tgc 2160Ser Ala Ser Cys Gly Gly Gly Leu Arg
Glu Arg Pro Val Arg Cys 710 715 720gtg gag gcc cag ggc agc ctc ctg
aag aca ttg ccc cca gcc cgg 2205Val Glu Ala Gln Gly Ser Leu Leu Lys
Thr Leu Pro Pro Ala Arg 725 730 735tgc aga gca ggg gcc cag cag cca
gct gtg gcg ctg gaa acc tgc 2250Cys Arg Ala Gly Ala Gln Gln Pro Ala
Val Ala Leu Glu Thr Cys 740 745 750aac ccc cag ccc tgc cct gcc agg
tgg gag gtg tca gag ccc agc 2295Asn Pro Gln Pro Cys Pro Ala Arg Trp
Glu Val Ser Glu Pro Ser 755 760 765tca tgc aca tca gct ggt gga gca
ggc ctg gcc ttg gag aac gag 2340Ser Cys Thr Ser Ala Gly Gly Ala Gly
Leu Ala Leu Glu Asn Glu 770 775 780acc tgt gtg cca ggg gca gat ggc
ctg gag gct cca gtg act gag 2385Thr Cys Val Pro Gly Ala Asp Gly Leu
Glu Ala Pro Val Thr Glu 785 790 795ggg cct ggc tcc gta gat gag
aag ctg cct gcc cct gag ccc tgt 2430Gly Pro Gly Ser Val Asp Glu Lys
Leu Pro Ala Pro Glu Pro Cys 800 805 810gtc ggg atg tca tgt cct cca
ggc tgg ggc cat ctg gat gcc acc 2475Val Gly Met Ser Cys Pro Pro Gly
Trp Gly His Leu Asp Ala Thr 815 820 825tct gca ggg gag aag gct ccc
tcc cca tgg ggc agc atc agg acg 2520Ser Ala Gly Glu Lys Ala Pro Ser
Pro Trp Gly Ser Ile Arg Thr 830 835 840ggg gct caa gct gca cac gtg
tgg acc cct gcg gca ggg tcg tgc 2565Gly Ala Gln Ala Ala His Val Trp
Thr Pro Ala Ala Gly Ser Cys 845 850 855tcc gtc tcc tgc ggg cga ggt
ctg atg gag ctg cgt ttc ctg tgc 2610Ser Val Ser Cys Gly Arg Gly Leu
Met Glu Leu Arg Phe Leu Cys 860 865 870atg gac tct gcc ctc agg gtg
cct gtc cag gaa gag ctg tgt ggc 2655Met Asp Ser Ala Leu Arg Val Pro
Val Gln Glu Glu Leu Cys Gly 875 880 885ctg gca agc aag cct ggg agc
cgg cgg gag gtc tgc cag gct gtc 2700Leu Ala Ser Lys Pro Gly Ser Arg
Arg Glu Val Cys Gln Ala Val 890 895 900ccg tgc cct gct cgg tgg cag
tac aag ctg gcg gcc tgc agc gtg 2745Pro Cys Pro Ala Arg Trp Gln Tyr
Lys Leu Ala Ala Cys Ser Val 905 910 915agc tgt ggg aga ggg gtc gtg
cgg agg atc ctg tat tgt gcc cgg 2790Ser Cys Gly Arg Gly Val Val Arg
Arg Ile Leu Tyr Cys Ala Arg 920 925 930gcc cat ggg gag gac gat ggt
gag gag atc ctg ttg gac acc cag 2835Ala His Gly Glu Asp Asp Gly Glu
Glu Ile Leu Leu Asp Thr Gln 935 940 945tgc cag ggg ctg cct cgc ccg
gaa ccc cag gag gcc tgc agc ctg 2880Cys Gln Gly Leu Pro Arg Pro Glu
Pro Gln Glu Ala Cys Ser Leu 950 955 960gag ccc tgc cca cct agg tgg
aaa gtc atg tcc ctt ggc cca tgt 2925Glu Pro Cys Pro Pro Arg Trp Lys
Val Met Ser Leu Gly Pro Cys 965 970 975tcg gcc agc tgt ggc ctt ggc
act gct aga cgc tcg gtg gcc tgt 2970Ser Ala Ser Cys Gly Leu Gly Thr
Ala Arg Arg Ser Val Ala Cys 980 985 990gtg cag ctc gac caa ggc cag
gac gtg gag gtg gac gag gcg gcc 3015Val Gln Leu Asp Gln Gly Gln Asp
Val Glu Val Asp Glu Ala Ala 995 1000 1005tgt gcg gcg ctg gtg cgg
ccc gag gcc agt gtc ccc tgt ctc att 3060Cys Ala Ala Leu Val Arg Pro
Glu Ala Ser Val Pro Cys Leu Ile 1010 1015 1020gcc gac tgc acc tac
cgc tgg cat gtt ggc acc tgg atg gag tgc 3105Ala Asp Cys Thr Tyr Arg
Trp His Val Gly Thr Trp Met Glu Cys 1025 1030 1035tct gtt tcc tgt
ggg gat ggc atc cag cgc cgg cgt gac acc tgc 3150Ser Val Ser Cys Gly
Asp Gly Ile Gln Arg Arg Arg Asp Thr Cys 1040 1045 1050ctc gga ccc
cag gcc cag gcg cct gtg cca gct gat ttc tgc cag 3195Leu Gly Pro Gln
Ala Gln Ala Pro Val Pro Ala Asp Phe Cys Gln 1055 1060 1065cac ttg
ccc aag ccg gtg act gtg cgt ggc tgc tgg gct ggg ccc 3240His Leu Pro
Lys Pro Val Thr Val Arg Gly Cys Trp Ala Gly Pro 1070 1075 1080tgt
gtg gga cag ggt gcc tgt ggc agg cag cac ctt gag cca aca 3285Cys Val
Gly Gln Gly Ala Cys Gly Arg Gln His Leu Glu Pro Thr 1085 1090
1095gga acc att gac atg cga ggc cca ggg cag gca gac tgt gca gtg
3330Gly Thr Ile Asp Met Arg Gly Pro Gly Gln Ala Asp Cys Ala Val
1100 1105 1110gcc att ggg cgg ccc ctc ggg gag gtg gtg acc ctc cgc
gtc ctt 3375Ala Ile Gly Arg Pro Leu Gly Glu Val Val Thr Leu Arg Val
Leu 1115 1120 1125gag agt tct ctc aac tgc agt gcg ggg gac atg ttg
ctg ctt tgg 3420Glu Ser Ser Leu Asn Cys Ser Ala Gly Asp Met Leu Leu
Leu Trp 1130 1135 1140ggc cgg ctc acc tgg agg aag atg tgc agg aag
ctg ttg gac atg 3465Gly Arg Leu Thr Trp Arg Lys Met Cys Arg Lys Leu
Leu Asp Met 1145 1150 1155act ttc agc tcc aag acc aac acg ctg gtg
gtg agg cag cgc tgc 3510Thr Phe Ser Ser Lys Thr Asn Thr Leu Val Val
Arg Gln Arg Cys 1160 1165 1170ggg cgg cca gga ggt ggg gtg ctg ctg
cgg tat ggg agc cag ctt 3555Gly Arg Pro Gly Gly Gly Val Leu Leu Arg
Tyr Gly Ser Gln Leu 1175 1180 1185gct cct gaa acc ttc tac aga gaa
tgt gac atg cag ctc ttt ggg 3600Ala Pro Glu Thr Phe Tyr Arg Glu Cys
Asp Met Gln Leu Phe Gly 1190 1195 1200ccc tgg ggt gaa atc gtg agc
ccc tcg ctg agt cca gcc acg agt 3645Pro Trp Gly Glu Ile Val Ser Pro
Ser Leu Ser Pro Ala Thr Ser 1205 1210 1215aat gca ggg ggc tgc cgg
ctc ttc att aat gtg gct ccg cac gca 3690Asn Ala Gly Gly Cys Arg Leu
Phe Ile Asn Val Ala Pro His Ala 1220 1225 1230cgg att gcc atc cat
gcc ctg gcc acc aac atg ggc gct ggg acc 3735Arg Ile Ala Ile His Ala
Leu Ala Thr Asn Met Gly Ala Gly Thr 1235 1240 1245gag gga gcc aat
gcc agc tac atc ttg atc cgg gac acc cac agc 3780Glu Gly Ala Asn Ala
Ser Tyr Ile Leu Ile Arg Asp Thr His Ser 1250 1255 1260ttg agg acc
aca gcg ttc cat ggg cag cag gtg ctc tac tgg gag 3825Leu Arg Thr Thr
Ala Phe His Gly Gln Gln Val Leu Tyr Trp Glu 1265 1270 1275tca gag
agc agc cag gct gag atg gag ttc agc gag ggc ttc ctg 3870Ser Glu Ser
Ser Gln Ala Glu Met Glu Phe Ser Glu Gly Phe Leu 1280 1285 1290aag
gct cag gcc agc ctg cgg ggc cag tac tgg acc ctc caa tca 3915Lys Ala
Gln Ala Ser Leu Arg Gly Gln Tyr Trp Thr Leu Gln Ser 1295 1300
1305tgg gta ccg gag atg cag gac cct cag tcc tgg aag gga aag gaa
3960Trp Val Pro Glu Met Gln Asp Pro Gln Ser Trp Lys Gly Lys Glu
1310 1315 1320gga acc 3966Gly Thr20312PRTHomo sapiens 20gct gca ggc
ggc atc cta cac ctg gag ctg ctg gtg gcc gtg ggc 45Ala Ala Gly Gly
Ile Leu His Leu Glu Leu Leu Val Ala Val Gly1 5 10 15ccc gat gtc ttc
cag gct cac cag gag gac aca gag cgc tat gtg 90Pro Asp Val Phe Gln
Ala His Gln Glu Asp Thr Glu Arg Tyr Val 20 25 30ctc acc aac ctc aac
atc ggg gca gaa ctg ctt cgg gac ccg tcc 135Leu Thr Asn Leu Asn Ile
Gly Ala Glu Leu Leu Arg Asp Pro Ser 35 40 45ctg ggg gct cag ttt cgg
gtg cac ctg gtg aag atg gtc att ctg 180Leu Gly Ala Gln Phe Arg Val
His Leu Val Lys Met Val Ile Leu 50 55 60aca gag cct gag ggt gct cca
aat atc aca gcc aac ctc acc tcg 225Thr Glu Pro Glu Gly Ala Pro Asn
Ile Thr Ala Asn Leu Thr Ser 65 70 75tcc ctg ctg agc gtc tgt ggg tgg
agc cag acc atc aac cct gag 270Ser Leu Leu Ser Val Cys Gly Trp Ser
Gln Thr Ile Asn Pro Glu 80 85 90gac gac acg gat cct ggc cat gct gac
ctg gtc ctc tat atc act 315Asp Asp Thr Asp Pro Gly His Ala Asp Leu
Val Leu Tyr Ile Thr 95 100 105agg ttt gac ctg gag ttg cct gat ggt
aac cgg cag gtg cgg ggc 360Arg Phe Asp Leu Glu Leu Pro Asp Gly Asn
Arg Gln Val Arg Gly 110 115 120gtc acc cag ctg ggc ggt gcc tgc tcc
cca acc tgg agc tgc ctc 405Val Thr Gln Leu Gly Gly Ala Cys Ser Pro
Thr Trp Ser Cys Leu 125 130 135att acc gag gac act ggc ttc gac ctg
gga gtc acc att gcc cat 450Ile Thr Glu Asp Thr Gly Phe Asp Leu Gly
Val Thr Ile Ala His 140 145 150gag att ggg cac agc ttc ggc ctg gag
cac gac ggc gcg ccc ggc 495Glu Ile Gly His Ser Phe Gly Leu Glu His
Asp Gly Ala Pro Gly 155 160 165agc ggc tgc ggc ccc agc gga cac gtg
atg gct tcg gac ggc gcc 540Ser Gly Cys Gly Pro Ser Gly His Val Met
Ala Ser Asp Gly Ala 170 175 180gcg ccc cgc gcc ggc ctc gcc tgg tcc
ccc tgc agc cgc cgg cag 585Ala Pro Arg Ala Gly Leu Ala Trp Ser Pro
Cys Ser Arg Arg Gln 185 190 195ctg ctg agc ctg ctc agg acg ggc gcg
ctg cgt gtg gga ccc gcc 630Leu Leu Ser Leu Leu Arg Thr Gly Ala Leu
Arg Val Gly Pro Ala 200 205 210gcg gcc tca acc cgg gtc cgc ggg gca
ccc gcc gga tgc gca gcc 675Ala Ala Ser Thr Arg Val Arg Gly Ala Pro
Ala Gly Cys Ala Ala 215 220 225tgg cct cta cta cag cgc caa cga gca
gtg ccg cgt ggc ctt cgg 720Trp Pro Leu Leu Gln Arg Gln Arg Ala Val
Pro Arg Gly Leu Arg 230 235 240ccc caa ggc tgt cgc ctg cac ctt cgc
cag gga gca cct gga tat 765Pro Gln Gly Cys Arg Leu His Leu Arg Gln
Gly Ala Pro Gly Tyr 245 250 255gtg cca ggc cct ctc ctg cca cac aga
ccc gct gga cca aag cag 810Val Pro Gly Pro Leu Leu Pro His Arg Pro
Ala Gly Pro Lys Gln 260 265 270ctg cag ccg cct cct cgt tcc tct cct
gga tgg gac aga atg tgg 855Leu Gln Pro Pro Pro Arg Ser Ser Pro Gly
Trp Asp Arg Met Trp 275 280 285cgt gga gaa gtg gtg ctc caa ggg tcg
ctg ccg ctc cct ggt gga 900Arg Gly Glu Val Val Leu Gln Gly Ser Leu
Pro Leu Pro Gly Gly 290 295 300gct gac ccc cat agc agc agt gca tgg
gcg ctg gtc 936Ala Asp Pro His Ser Ser Ser Ala Trp Ala Leu Val 305
31021270PRTHomo sapiens 21gct gca ggc ggc atc cta cac ctg gag ctg
ctg gtg gcc gtg ggc 45Ala Ala Gly Gly Ile Leu His Leu Glu Leu Leu
Val Ala Val Gly1 5 10 15ccc gat gtc ttc cag gct cac cag gag gac aca
gag cgc tat gtg 90Pro Asp Val Phe Gln Ala His Gln Glu Asp Thr Glu
Arg Tyr Val 20 25 30ctc acc aac ctc aac atc ggg gca gaa ctg ctt cgg
gac ccg tcc 135Leu Thr Asn Leu Asn Ile Gly Ala Glu Leu Leu Arg Asp
Pro Ser 35 40 45ctg ggg gct cag ttt cgg gtg cac ctg gtg aag atg gtc
att ctg 180Leu Gly Ala Gln Phe Arg Val His Leu Val Lys Met Val Ile
Leu 50 55 60aca gag cct gag ggt gct cca aat atc aca gcc aac ctc acc
tcg 225Thr Glu Pro Glu Gly Ala Pro Asn Ile Thr Ala Asn Leu Thr Ser
65 70 75tcc ctg ctg agc gtc tgt ggg tgg agc cag acc atc aac cct gag
270Ser Leu Leu Ser Val Cys Gly Trp Ser Gln Thr Ile Asn Pro Glu 80
85 90gac gac acg gat cct ggc cat gct gac ctg gtc ctc tat atc act
315Asp Asp Thr Asp Pro Gly His Ala Asp Leu Val Leu Tyr Ile Thr 95
100 105agg ttt gac ctg gag ttg cct gat ggt aac cgg cag gtg cgg ggc
360Arg Phe Asp Leu Glu Leu Pro Asp Gly Asn Arg Gln Val Arg Gly 110
115 120gtc acc cag ctg ggc ggt gcc tgc tcc cca acc tgg agc tgc ctc
405Val Thr Gln Leu Gly Gly Ala Cys Ser Pro Thr Trp Ser Cys Leu 125
130 135att acc gag gac act ggc ttc gac ctg gga gtc acc att gcc cat
450Ile Thr Glu Asp Thr Gly Phe Asp Leu Gly Val Thr Ile Ala His 140
145 150gag att ggg cac agc ttc ggc ctg gag cac gac ggc gcg ccc ggc
495Glu Ile Gly His Ser Phe Gly Leu Glu His Asp Gly Ala Pro Gly 155
160 165agc ggc tgc ggc ccc agc gga cac gtg atg gct tcg gac ggc gcc
540Ser Gly Cys Gly Pro Ser Gly His Val Met Ala Ser Asp Gly Ala 170
175 180gcg ccc cgc gcc ggc ctc gcc tgg tcc ccc tgc agc cgc cgg cag
585Ala Pro Arg Ala Gly Leu Ala Trp Ser Pro Cys Ser Arg Arg Gln 185
190 195ctg ctg agc ctg ctc aga ccc gtc cct ccg tcg ccg ctc cct ctg
630Leu Leu Ser Leu Leu Arg Pro Val Pro Pro Ser Pro Leu Pro Leu 200
205 210ctg gcc acc cac ctc tgc gcc ggc agg agc ctt agt ctt ggt ccc
675Leu Ala Thr His Leu Cys Ala Gly Arg Ser Leu Ser Leu Gly Pro 215
220 225agc caa gag ccg gct cct ggt ggg ggg cgc ggg ccg aga act cct
720Ser Gln Glu Pro Ala Pro Gly Gly Gly Arg Gly Pro Arg Thr Pro 230
235 240gtt ccc act cac aaa agg cca cgc ttc caa acg ctt cca tcc tcg
765Val Pro Thr His Lys Arg Pro Arg Phe Gln Thr Leu Pro Ser Ser 245
250 255tgc cca ctc ctc cgt ccc gcc tcc tcc cgg tgt aca ccc cgg gac
810Cys Pro Leu Leu Arg Pro Ala Ser Ser Arg Cys Thr Pro Arg Asp 260
265 2702243DNAHomo sapiens 22ggactcgagc caccaatgca ccagcgtcac
ccccgggcaa gat 432345DNAHomo sapiens 23tccgtcgact cattatcagg
ttccttcctt tcccttccag gactg 452430DNAHomo sapiens 24ggttggcaat
gtagacactg gtcaggttgg 302530DNAHomo sapiens 25ccaacctgac cagtgtctac
attgccaacc 302630DNAHomo sapiens 26ctttccacct aggtgggcag ggctccaggc
302730DNAHomo sapiens 27gcctggagcc ctgcccacct aggtggaaag
302833DNAHomo sapiens 28tcgagaaaaa gtctacgggg gcctaggttt tta
332933DNAHomo sapiens 29agcttaaaaa cctaggcccc cgtagacttt ttc
333030DNAHomo sapiens 30tcggccatgg ccgcaggcgg catcctacac
303128DNAHomo sapiens 31ggcaagctta tcagcggggc gcggcgcc
2832564DNAHomo sapiens 32ccatggccgc aggcggcatc ctacacctgg
agctgctggt ggccgtgggc cccgatgtct 60tccaggctca ccaggaggac acagagcgct
atgtgctcac caacctcaac atcggggcag 120aactgcttcg ggacccgtcc
ctgggggctc agtttcgggt gcacctggtg aagatggtca 180ttctgacaga
gcctgagggt gctccaaata tcacagccaa cctcacctcg tccctgctga
240gcgtctgtgg gtggagccag accatcaacc ctgaggacga cacggatcct
ggccatgctg 300acctggtcct ctatatcact aggtttgacc tggagttgcc
tgatggtaac cggcaggtgc 360ggggcgtcac ccagctgggc ggtgcctgct
ccccaacctg gagctgcctc attaccgagg 420acactggctt cgacctggga
gtcaccattg cccatgagat tgggcacagc ttcggcctgg 480agcacgacgg
cgcgcccggc agcggctgcg gccccagcgg acacgtgatg gcttcggacg
540gcgccgcgcc ccgctgataa gctt 56433184PRTHomo sapiens 33Met Ala Ala
Gly Gly Ile Leu His Leu Glu Leu Leu Val Ala Val1 5 10 15Gly Pro Asp
Val Phe Gln Ala His Gln Glu Asp Thr Glu Arg Tyr 20 25 30Val Leu Thr
Asn Leu Asn Ile Gly Ala Glu Leu Leu Arg Asp Pro 35 40 45Ser Leu Gly
Ala Gln Phe Arg Val His Leu Val Lys Met Val Ile 50 55 60Leu Thr Glu
Pro Glu Gly Ala Pro Asn Ile Thr Ala Asn Leu Thr 65 70 75Ser Ser Leu
Leu Ser Val Cys Gly Trp Ser Gln Thr Ile Asn Pro 80 85 90Glu Asp Asp
Thr Asp Pro Gly His Ala Asp Leu Val Leu Tyr Ile 95 100 105Thr Arg
Phe Asp Leu Glu Leu Pro Asp Gly Asn Arg Gln Val Arg 110 115 120Gly
Val Thr Gln Leu Gly Gly Ala Cys Ser Pro Thr Trp Ser Cys 125 130
135Leu Ile Thr Glu Asp Thr Gly Phe Asp Leu Gly Val Thr Ile Ala 140
145 150His Glu Ile Gly His Ser Phe Gly Leu Glu His Asp Gly Ala Pro
155 160 165Gly Ser Gly Cys Gly Pro Ser Gly His Val Met Ala Ser Asp
Gly 170 175 180Ala Ala Pro Arg342529DNAMus musculus 34atgagccagc
tttgcctgtg gttgacgtgc cagccttgtt atgctgtcag 50tgtcagagga atcctcactg
gtgccatctt cattctgggc tgctgggggc 100tctctgactt ccagaagagt
cttcttcaag atctggagcc caaggatgtg 150tcttcttact ttggccacca
tgctgctcca ttcacaggcc atcctccctc 200tcacctccag agactgagac
ggagaaggac tttggaggac attctgcacc 250tggaactcct ggtagctgtg
ggccccgatg tttcccgggc tcatcaggag 300gacacagaac gctacgtgct
cactaatctc aatatcgggt cagaactgtt 350gagaaaccca tccctgggag
tccagttcca ggtgcacctg gtgaagctaa 400tcaccctctc tgactcagag
agtactccga atatcacggc caacatcacc 450tcatccttga tgagcgtctg
cgagtggagc cagacgatca acccccacga 500tgacagggat ccaagtcacg
ctgacctgat tctctatatc accagcaacg 550tggctggtgc cactgtcctt
gtgattcatt
ttctcttatc aaggtttgac 600ctggagttgc ctgatggcaa ccagcaggtt
cggggtgtca cccagctggg 650aggtgcctgc tccctttcct ggagttgcct
tatcactgag gatactggct 700ttgacctggg ggtcaccatc gcccatgaga
ttgggcacag cttcgggctg 750gaccatgatg gtgctccagg tagtggcagc
acctgcaagg ccagtggcca 800cgtgatggcg gctgatggcg caacacctac
tggagggacc ctggagtggt 850ctgcctgcag ccaaaggcag ttgcagcacc
tactcagcac agggcaaatg 900cactgcttcc aggacccacc tgggctgcag
tcaggactta cacggcacca 950gctgatggca cagcctggcc tctactacag
tgcagatgat cagtgccgtg 1000tggctttcgg ttctggggct gtcgcctgca
ccttctccag ggagggtctg 1050aacacagcac tcagtggtcc ttccaccttg
atcctgtccg cagacccctg 1100ccagaagtcc tggatggctc ctgaagctct
caaattctcc ttctccacca 1150aatccgacat ctggtctctg ggctgcatca
ttctagacat ggccacttgc 1200tccttcctga acgacacaga agccatgcaa
ctgcggaagg ccatccgcca 1250tcatccaggc agcctgaagc ccatcctgaa
aaccatggag gagaagcaaa 1300tccctggtac agatgtctac tatttgcttc
tgcccttcat gttgcatatc 1350aacccctccg atcgactggc aatcaaggat
gtgatgcaag tcaccttcat 1400gagcaactcc ttcaaaagct cctctgttgc
gctgaatatg cagcggcaga 1450aggtccccat cttcatcact gacgtgctgc
ttgaaggcaa catggccaac 1500atcttaggtg atggcagctg gctgtgtgct
tcctttgtga acgacagcag 1550gcactgtgac tcagggattg gctcgcagag
acttgggttt gattttcagt 1600cagtctcttg gacagagcac cctctgaaag
atgtcatgca gaatttctcc 1650agtcgaccag aggtccagct cagagccatt
aacaagttgt tgacaatgcc 1700agaggaccag ctagcactgg caaaggaccc
agaagctgag atcccaagga 1750gcagtttgat catctccttc ctgatggata
ccttgcggag ccatcctaac 1800tctgaaaggc ttgttaatgt ggtctacaac
gtgcttgcca ttatttccag 1850ccaaggacag atctcagaag agctggaaga
ggaggggttg tttcagcttg 1900cccaagagaa cctggagcac ttccaagagg
acagggacat ctgcctctct 1950atcctgagcc tgctctggtc cctcctggta
gatgttgtca ctgtggacaa 2000agagcccttg gagcagctct ctggcatggt
cacctgggtg ctggctactc 2050atccggagga cgtggaaata gcagaggctg
gctgtgcggt gctctggctg 2100ctgtccttgt tgggctgcat aaaggagagt
cagtttgagc aggtggtagt 2150gctgctcctg agaagcatcc agctgtgccc
tggcagagta ctgctggtga 2200acaatgcatt ccgtggcttg gccagcctcg
caaaggtgtc cggcccaccc 2250tcacagttag agccaaatga ctgggtatcc
agccccagcc cccttttgtg 2300gaatcagaga cttcactatg tgaacaagca
aaagctgttc atgcctctgt 2350gggtgctgag gcaagagcac cctcattact
gctgtgctaa tgaccctaca 2400tcagagcaca tccaggcagt actaagtgga
ctaaatgggt ttgaaaagaa 2450gcacagttgt gtggaatctt gtgtggaatg
tggctgcagg cagcaggaga 2500agaatagagg aggagcccca gggatttga
2529352514DNAMus musculus 35aggaagctcc caagagtaaa cactgcctga
tgtcccgccc agccagcaag 50tgaacattgc acactaacca gaatcccagt cactagggct
cctgtccggc 100catcaactgc cttttctaaa gatgagccag ctttgcctgt
ggttgacgtg 150ccagccttgt tatgctgtca gtgtcagagg aatcctcact
ggtgccatct 200tcattctggg ctgctggggg ctctctgact tccagaagag
tcttcttcaa 250gatctggagc ccaaggatgt gtcttcttac tttggccacc
atgctgctcc 300attcacaggc catcctccct ctcacctcca gagactgaga
cggagaagga 350ctttggagga cattctgcac ctggaactcc tggtagctgt
gggccccgat 400gtttcccggg ctcatcagga ggacacagaa cgctacgtgc
tcactaatct 450caatatcggg tcagaactgt tgagaaaccc atccctggga
gtccagttcc 500aggtgcacct ggtgaagcta atcaccctct ctgactcaga
gagtactccg 550aatatcacgg ccaacatcac ctcatccttg atgagcgtct
gcgagtggag 600ccagacgatc aacccccacg atgacaggga tccaagtcac
gctgacctga 650ttctctatat caccaggttt gacctggagt tgcctgatgg
caaccagcag 700gttcggggtg tcacccagct gggaggtgcc tgctcccttt
cctggagttg 750ccttatcact gaggatactg gctttgacct gggggtcacc
atcgcccatg 800agattgggca cagcttcggg ctggaccatg atggtgctcc
aggtagtggc 850agcacctgca aggccagtgg ccacgtgatg gcggctgatg
gcgcaacacc 900tactggaggg accctggagt ggtctgcctg cagccaaagg
cagttgcagc 950acctactcag cacagggcag atgcactgct tccaggaccc
acctgggctg 1000cagtcaggac ttacacggca ccagctgatg gcacagcctg
gcctctacta 1050cagtgcagat gatcagtgcc gtgtggcttt cggttctggg
gctgtcgcct 1100gcaccttctc cagggagggt ctggatgtat gccaggccct
gtcctgccac 1150acagaccccc tggaccaaag cagctgcagc cgcctccttg
ttcctctcct 1200ggatgggaca ggatgtggtg tggagaagtg gtgctccaag
gctcgctgtc 1250gctccctagc tgagctggct cctgtggctg cagtacatgg
acactggtct 1300agctggggcc cccatagtcc ctgctcccga tcctgtggag
gaggtgtgat 1350taccaggagg cggtggtgca acaaccccag gcctgcattt
gggggacgtg 1400catgtgtggg tgaagacctc caggctaaga tgtgcaacac
gcaggcttgt 1450gagaagactc agctggagtt catgtccgag cagtgtgccc
agacagacag 1500acaaccactg caactttccc aaggcactgc ctccttctac
cactgggatg 1550ctgctgtgca gtatagtcaa ggagataccc tgtgcagaca
catgtgctgg 1600gctgttggag aaagcttcat tgtcagccgt ggggacaggt
tcctagatgg 1650gacccgttgt gtgccaagtg gtccccagga tgatgggacc
ctaagcctct 1700gtttgttggg cagctgcagg acctttggct gtgatggcag
gatggactcc 1750cagaaggttt gggatgcgtg ccaggtgtgt ggaggagaca
acagcacctg 1800cagctcacgg aatggttctt tcacagctgg gagagccaga
gaatatgtca 1850cgttcctgat tgttactccc aacatgacca acgcacacat
tgtcaaccgc 1900aggcctctct tcacacactt ggcggtgagg atccagggcc
actacattgt 1950ggcagggaag actagcatct cacccaacac cacctaccct
tcccttctgg 2000aggactaccg tgtggaatac agagtgactc tcactgagga
ccagctgccc 2050cacttagagg agattcacat ccggggaccc gtccgggatg
acattgagat 2100tcaggtgtac agacgatatg gaggagaata tggggatctt
acacacccag 2150acatcacctt ttcctacttt caactgaagc agcaggcagc
ctgggtatgg 2200accgctaagc gtggaccctg ctcagtgagc tgtggggcag
ggctgcgctg 2250ggtgacctac agctgccagg atcaagctca agacaagtgg
gtaaagaacg 2300cccagtgcca agggagccca cagccacctg catggcaaga
gccttgtgtc 2350tctgccccct gctccccata ttgggtagct ggggacttca
gcccatgtag 2400cgtgtcttgt ggcgggggcc ttcgggagcg gtcactgcgc
tgtgtagaga 2450cccaagatgg cttcttaaag acactgccac ctgcccggtg
cagagcagta 2500gcccagcagc cagc 2514363512DNAMus musculus
36aggaagctcc caagagtaaa cactgcctga tgtcccgccc agccagcaag
50tgaacattgc acactaacca gaatcccagt cactagggct cctgtccggc
100catcaactgc cttttctaaa gatgagccag ctttgcctgt ggttgacgtg
150ccagccttgt tatgctgtca gtgtcagagg aatcctcact ggtgccatct
200tcattctggg ctgctggggg ctctctgact tccagaagag tcttcttcaa
250gatctggagc ccaaggatgt gtcttcttac tttggccacc atgctgctcc
300attcacaggc catcctccct ctcacctcca gagactgaga cggagaagga
350ctttggagga cattctgcac ctggaactcc tggtagctgt gggccccgat
400gtttcccggg ctcatcagga ggacacagaa cgctacgtgc tcactaatct
450caatatcggg tcagaactgt tgagaaaccc atccctggga gtccagttcc
500aggtgcacct ggtgaagcta atcaccctct ctgactcaga gagtactccg
550aatatcacgg ccaacatcac ctcatccttg atgagcgtct gcgagtggag
600ccagacgatc aacccccacg atgacaggga tccaagtcac gctgacctga
650ttctctatat caccaggttt gacctggagt tgcctgatgg caaccagcag
700gttcggggtg tcacccagct gggaggtgcc tgctcccttt cctggagttg
750ccttatcact gaggatactg gctttgacct gggggtcacc atcgcccatg
800agattgggca cagcttcggg ctggaccatg atggtgctcc aggtagtggc
850agcacctgca aggccagtgg ccacgtgatg gcggctgacg gcgcaacacc
900cactggaggg accctggagt ggtctgcctg cagccaaagg cagttgcagc
950acctactcag cacagggcaa atgcactgct tccaggaccc acctgggctg
1000cagtcaggac ttacacggca ccagctgatg gcacagcctg gcctctacta
1050cagtgcagat gatcagtgcc gtgtggcttt cggttctggg gctgtcgcct
1100gcaccttctc cagggagggt ctggatgtat gccaggccct gtcctgccac
1150acagacccct tggaccaaag cagctgcagc cgcctccttg ttcctctcct
1200ggatgggaca gaatgtggtg tggagaagtg gtgctccaag gctcgctgtc
1250gctccctagc tgagctggct cctgtggctg cagtacatgg acactggtct
1300agctggggcc cccatagtcc ctgctcccga tcctgtggag gaggtgtgat
1350taccaggagg cggtggtgca acaaccccag gcctgcattt gggggacgtg
1400catgtgtggg tgaagacctc caggctaaga tgtgcaacac gcaggcttgt
1450gagaagactc agctggagtt catgtccgag cagtgtgccc agacagacag
1500acaaccactg caactttccc aaggcactgc ctccttctac cactgggatg
1550ctgctgtgca gtatagtcaa ggagataccc tgtgcagaca catgtgctgg
1600gctgttggag aaagcttcat tgtcagccgt ggggacaggt tcctagatgg
1650gacccgttgt gtgccaagtg gtcctcagga tgatgggacc ctaagcctct
1700gtttgttggg cagctgcagg acctttggct gtgatggcag gatggactcc
1750cagaaggttt gggatgcgtg ccaggtgtgt ggaggagaca acagcacctg
1800cagctcacgg aatggttctt tcacagctgg gagagccaga gaatatgtca
1850cgttcctgat tgttactccc aacatgacca acgcacacat tgtcaaccgc
1900aggcctctct tcacacactt ggcggtgagg atccagggcc actacattgt
1950ggcagggaag actagcatct cacccaacac cacctaccct tcccttctgg
2000aggactaccg tgtggaatac agagtgactc tcactgagga ccagctgccc
2050cacttagagg agattcacat ccggggaccc gtccgggatg acattgagat
2100tcaggtgtac agacgatatg gaggagaata tggggatctt acacacccag
2150acatcacctt ttcctacttt caactgaagc agcaggcagc ctgggtatgg
2200accgctaagc gtggaccctg ctcagtgagc tgtggggcag ggctgcgctg
2250ggtgacctac agctgccagg atcaagctca agacaagtgg gtaaagaacg
2300cccagtgcca agggagccca cagccacctg catggcaaga gccttgtgtc
2350tctgccccct gctccccata ttgggtagct ggggacttca gcccatgtag
2400cgtgtcttgt ggcgggggcc ttcgggagcg gtcactgcgc tgtgtagaga
2450cccaagatgg cttcttaaag acactgccac ctgcccggtg cagagcagta
2500gcccagcagc cagcagcaga agtggaaaac tgcaactccc agccctgtcc
2550caccaggtgg gaggtgtcag accctggccc ttgcatgcca tctgcctgtg
2600aggcaggtct ggactcaagg aatgtgacat gtgtgtccag ggcgggtgac
2650ccggagaagc cagaaactgc aggcccctgc cgcaccgacg agatgtcagc
2700tatgctggag ccctgctcca ggagcctgtg ttctccaggc ttgggtcagg
2750tggacaacac catgtctctg ggcgaggagg ctccatcccc ggtgggcagt
2800gacaagccag gggctcaggc tgagcatgtg tggacccctc tggtggggct
2850gtgctccatc tcttgtggga gaggtctgaa ggaactgtat ttcctgtgca
2900tggattctgt cctcaaaatg cctgtccagg aagagctatg cggcttggct
2950agtaagcccc caagccggtg ggaggtctgc agggctcgcc cctgtcctgc
3000tcggtgggag actcaagtct tggcaccgtg cccggtgacc tgtggtgggg
3050ggcgagtgcc actgtctgtt cgttgtgtgc agctagaccg tggccacccg
3100atatctgtac ctcactccaa gtgctcgcca gtgcctaagc caggctcctt
3150cgaggactgc agccctgagc cttgtcctgc tagggcacta gtgtgggaag
3200ccgcccccac attcgccgtc acaagatggc gctgacatcc tgtgttctaa
3250gttggtaaac aaataatctg cgcatgagcc aagggtattt acgactactt
3300gtactctgtt tttcccgtga acgtcagctc ggccatgggc tgcagccaat
3350cagggagtga tgcgtcctag gcaattgttg ttctctttta aatagaaggg
3400gtttcgtttt tctctttttc ttgcttctta cactctggcc ccaaaaagat
3450gtaagcaata aagctttgcc gtaggaaaaa aaaaaaaaaa ggatccggta
3500cctctagatc ag 35123722PRTHomo sapiens 37Phe Ser Pro Ala Pro Gln
Pro Arg Arg Leu Leu Pro Gly Pro Gln 1 5 10 15Glu Asn Ser Val Gln
Ser Ser 203830DNAHomo sapiens 38atgtgcaaca ctcaggcctg cgagaagacc
303930DNAHomo sapiens 39ccaacctgac cagtgtctac attgccaacc
304021DNAHomo sapiens 40ctggagccct gcccacctag g 214162DNAHomo
sapiens 41gccgtcgact cttatcactt atcgtcatcg tccttgtagt cttgcgacat
gaactccagc 60tg 624262DNAHomo sapiens 42gccgtcgact cttatcactt
atcgtcatcg tccttgtagt ccaggttggg ggtaactgtc 60ag 624362DNAHomo
sapiens 43gccgtcgact cttatcactt atcgtcatcg tccttgtagt ccacgtgtgc
agcttgagcc 60cc 624462DNAHomo sapiens 44gccgtcgact cttatcactt
atcgtcatcg tccttgtagt ccctaggtgg gcagggctcc 60ag 624562DNAHomo
sapiens 45gccgtcgact cttatcactt atcgtcatcg tccttgtagt caccctgtcc
cacacagggc 60cc 624660DNAHomo sapiens 46tccaagcttg tcgactctta
tcacttatcg tcatcgtcct tgtagtcggt tccttccttt 604727DNAArtificial
SequenceDescription of Artificial SequenceSynthetic DNA
47gactacaagg acgatgacga taagtga 27488PRTArtificial
SequenceDescription of Artificial SequenceSynthetic 48Asp Tyr Lys
Asp Asp Asp Asp Lys1 5
* * * * *
References