U.S. patent application number 12/091395 was filed with the patent office on 2013-02-14 for methods for beaming.
This patent application is currently assigned to THE JOHN HOPKINS UNIVERSITY. The applicant listed for this patent is Frank Diehl, Kenneth W. Kinzler, Meng Li, Bert Vogelstein. Invention is credited to Frank Diehl, Kenneth W. Kinzler, Meng Li, Bert Vogelstein.
Application Number | 20130040300 12/091395 |
Document ID | / |
Family ID | 37968413 |
Filed Date | 2013-02-14 |
United States Patent
Application |
20130040300 |
Kind Code |
A9 |
Vogelstein; Bert ; et
al. |
February 14, 2013 |
Methods for Beaming
Abstract
Improvements on the basic method used for BEAMing increase
sensitivity and increase the signal-to-noise ratio. The
improvements have permitted the determination of intrinsic error
rates of various DNA polymerases and have permitted the detection
of rare and subtle mutations in DNA isolated from plasma of cancer
patients.
Inventors: |
Vogelstein; Bert;
(Baltimore, MD) ; Diehl; Frank; (Baltimore,
MD) ; Kinzler; Kenneth W.; (Bel Air, MD) ; Li;
Meng; (Baltimore, MD) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Vogelstein; Bert
Diehl; Frank
Kinzler; Kenneth W.
Li; Meng |
Baltimore
Baltimore
Bel Air
Baltimore |
MD
MD
MD
MD |
US
US
US
US |
|
|
Assignee: |
THE JOHN HOPKINS UNIVERSITY
BALTIMORE
MD
|
Prior
Publication: |
|
Document Identifier |
Publication Date |
|
US 20110059435 A1 |
March 10, 2011 |
|
|
Family ID: |
37968413 |
Appl. No.: |
12/091395 |
Filed: |
October 20, 2006 |
PCT Filed: |
October 20, 2006 |
PCT NO: |
PCT/US2006/041115 PCKC 00 |
371 Date: |
November 24, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60729235 |
Oct 24, 2005 |
|
|
|
Current U.S.
Class: |
435/6.12 |
Current CPC
Class: |
G01R 31/50 20200101;
C12Q 1/6858 20130101; G01R 31/3277 20130101; H02H 1/0015 20130101;
H02H 3/33 20130101; G01R 31/52 20200101; A61P 9/10 20180101; C12Q
1/6858 20130101; C12Q 2565/537 20130101; C12Q 2563/155 20130101;
C12Q 2527/125 20130101 |
Class at
Publication: |
435/6.12 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Claims
1. A method for analyzing nucleotide sequence variations,
comprising: amplifying a region of analyte DNA molecules using a
high fidelity DNA polymerase to form a set of first amplicons;
forming microemulsions comprising said first amplicons and reagent
beads, wherein the reagent beads are bound to a plurality of
molecules of a primer for amplifying the set of first amplicons;
amplifying the first amplicons in the microemulsions, whereby
product beads are formed which are bound to a plurality of copies
of second amplicons; determining a sequence feature of the second
amplicons by single base extension of a primer bound to said second
amplicons using at least two differentially labeled
dideoxyribonucleotides.
2. The method of claim 1 wherein the microemulsions comprise a
thermostable emulsifying agent.
3. The method of claim 1 wherein the high fidelity polymerase has
an error rate of less than 10.sup.-5 errors per basepair per
cycle.
4. The method of claim 1 wherein the high fidelity polymerase has
an error rate of less than 5.times.10.sup.-6 errors per basepair
per cycle.
5. The method of claim 1 wherein the high fidelity polymerase has
an error rate of less than 10.sup.-6 errors per basepair per
cycle.
6. The method of claim 1 wherein the first amplicon is less than or
equal to 300 bp.
7. The method of claim 1 wherein the first amplicon is less than or
equal to 200 bp.
8. The method of claim 1 wherein the first amplicon is less than or
equal to 100 bp.
9. The method of claim 1 wherein the labeled dideoxyribonucleotides
are fluorescent and flow cytometry is used to detect the labeled
dideoxyribonucleotides present on the product beads.
10. The method of claim 1 further comprising the step of discarding
from analysis beads which display two or more differentially
labeled dideoxyribonucleotides extended onto primers bound to
second amplicons bound to the beads.
11. The method of claim 1 wherein the analyte DNA molecules are
obtained from plasma DNA.
12. The method of claim 1 wherein the microemulsions are formed
with a tissue homogenizer.
13. The method of claim 1 wherein the microemulsions are formed
with a mechanical tissue homogenizer.
14. The method of claim 1 wherein the microemulsions are formed
with a rotor-stator tissue homogenizer.
15. The method of claim 1 wherein rolling circle amplification of
the second amplicons is performed prior to the step of
determining.
16. A method for amplifying a region of analyte DNA molecules,
comprising: amplifying a region of analyte DNA molecules using a
high fidelity DNA polymerase to form a set of first amplicons;
forming microemulsions comprising said first amplicons and reagent
beads, wherein the reagent beads are bound to a plurality of
molecules of a primer for amplifying the set of first amplicons;
amplifying the first amplicons in the microemulsions, whereby
product beads are formed which are bound to a plurality of copies
of second amplicons; breaking the microemulsions; amplifying the
second amplicons using rolling circle amplification to form third
amplicons.
17. The method of claim 16 wherein the rolling circle amplification
employs a circularizable probe, said probe comprising a first and a
second region of complementarity with a third and a fourth region
on said second amplicons, wherein said first and second regions are
non-contiguous on said probe, and wherein said third and fourth
regions are non-contiguous on said second amplicons, wherein said
second amplicons comprise a fifth region of 1-30 nucleotides
between said third and fourth regions, wherein upon hybridization
of the circularizable probe to the second amplicons,
template-driven ligation of the ends of the circularizable probe
forms a circle.
18. The method of claim 16 wherein the rolling circle amplification
employs a padlock probe, said probe comprising a first and a second
region of complementarity with a third and a fourth region on said
second amplicons, wherein said first and second regions are
contiguous on said probe, and wherein said third and fourth regions
are contiguous on said second amplicons, wherein upon hybridization
of the padlock probe to the second amplicons, template-driven
ligation of the ends of the padlock probe forms a circle.
19. The method of claim 16 further comprising the step of:
determining a sequence feature of the third amplicons by single
base extension with at least two differentially labeled
dideoxyribonucleotides of a primer bound to said third
amplicons.
20. The method of claim 1 or 16 wherein two high-fidelity
polymerases are used in parallel and compared to ascertain relative
fidelity.
21. The method of claim 1 or 18 wherein the analyte DNA has been
treated with a potential mutagen.
22. The method of claim 1 or 16 wherein the analyte DNA is obtained
from blood, urine, or stool of a cancer patient.
23. The method of claim 1 or 16 wherein the analyte DNA is obtained
from a plasma of a pregnant woman.
24. The method of claim 1 wherein prior to the step of determining,
the product beads are subjected to denaturing conditions whereby
the second amplicons are separated into single strands, and wherein
single strands which are not bound to the product beads are
discarded.
25. The method of claim 18 wherein prior to the step of
determining, the product beads are subjected to denaturing
conditions whereby the third amplicons are separated into single
strands, and wherein single strands which are not bound to the
product beads are discarded.
26. The method of claim 1 or 18 wherein prior to the step of
determining, the product beads are incubated with unlabeled
deoxynucleotides.
27. The method of claim 16 wherein the third amplicons are used as
templates for nucleotide sequencing reactions.
Description
TECHNICAL FIELD OF THE INVENTION
[0001] This invention is related to the area of analytical
biochemistry and diagnostics. In particular, it relates to
detecting subtle and rare differences in nucleic acid
molecules.
BACKGROUND OF THE INVENTION
[0002] The probability of curing cancers, through surgery alone, is
high in those individuals whose primary tumors are detected at a
relatively early stage. Such early detection is therefore one of
the most promising approaches for limiting cancer morbidity and
mortality in the future (1). At present, PAP smears can be used to
detect cervical cancers, mammography can detect breast cancers,
serum PSA levels can signify the presence of prostate cancer, and
colonoscopy and fecal occult blood tests can detect colon cancers
(2). However, problems in sensitivity, specificity, cost or
compliance have complicated widespread implementation of these
tests (3-5). Moreover, methods for the early detection of most
other cancer types are not yet available.
[0003] The discovery of the genetic bases of neoplasia has led to
new approaches to detect tumors non-invasively (6-8). Many of these
approaches rely on the ex vivo detection of mutant forms of the
oncogenes and tumor suppressor genes that are responsible for the
initiation and progression of tumors. This approach was first used
to detect bladder and colon tumors through examination of urine and
stool, respectively (9, 10), and has since been used to detect
several other tumor types (11-14). As the mutant genes are not only
"markers" for cancer, but are the proximate causes of tumor growth
(1), they have major conceptual advantages over conventional
markers such as fecal occult blood or serum PSA. In particular,
conventional markers are not pathogenically involved in the
tumorigenic process and are much less specific for neoplasia than
are mutations.
[0004] The evaluation of patient blood samples for mutant DNA
molecules is a particularly attractive approach as such tests could
detect many different forms of cancers. Additionally, blood can be
easily obtained from patients during routine outpatient visits and
methods for preparing and storing plasma and serum are well-known
and reliable. Accordingly, numerous studies have attempted to
identify abnormal forms or quantities of DNA in plasma or serum (6,
11-15). Unfortunately, the results of many of these studies are
contradictory. Some report high detection rates of cancers, others
very low, despite the use of similar techniques and patient
cohorts. Moreover, several studies have shown that loss of
heterozygosity is routinely detectable in circulating DNA, even in
patients with relatively non-aggressive tumors. To detect loss of
heterozygosity in such samples, the neoplastic cells within a tumor
must contribute more than 50% of the total circulating DNA.
[0005] The prior studies, though promising, lead to several
questions that must be answered to engender confidence in the use
of circulating, abnormal DNA as a biomarker of malignancy. First,
how many copies of a given gene fragment are present in the
circulation in cancer patients? Second, what is the nature of this
DNA, e.g., intact vs. degraded? Third, what fraction of these gene
fragments have an abnormal (e.g., mutant) DNA sequence? And fourth,
how does this fraction vary with stage of disease? To answer these
questions, it is necessary to develop technologies that can
simultaneously quantify the number of normal and mutant DNA
molecules in a given sample, even when the fraction of mutant
molecules is very small. Such sensitive and accurate assays for the
detection and quantification of rare variants among a large excess
of normal sequences have important applications in many areas of
biomedical research. Examples in basic scientific research include
the analysis of replication fidelity in various in vitro systems
and the determination of mutation rates in cells after treatment
with mutagens. Examples in clinical medicine include the
identification of mutations in the blood, urine, or stool of cancer
patients and the identification of fetal DNA sequences in the
plasma of pregnant women.
[0006] We previously described an approach, called BEAMing (beads,
emulsions, amplification, and magnets), which allows the
transformation of a population of DNA fragments into a population
of beads each containing thousands of copies of the identical
sequence. The bead population generated in this fashion has been
shown to accurately represent the initial DNA population. Because
10.sup.8 beads can be generated in a single test tube and analyzed
by standard flow cytometry, this technique has the capacity not
only to identify genetic variations present in the original DNA
population, but also to quantify precisely their number in
comparison to wild-type sequences. In addition to their use for
discovering such rare variants, beads generated through the BEAMing
process provide excellent templates for nucleotide sequencing, for
example, sequencing-by-synthesis. The beads can also be used as
templates for both the high-throughput methods recently described
for this purpose.
[0007] The advantages of having as many copies as possible per bead
for both flow cytometric and sequencing applications are clear. We
estimate that the number of copies per 1-micron bead produced by
BEAMing is 10.sup.4-10.sup.5. There is a need in the art for a
technique that can increase this number by at least two orders of
magnitude.
SUMMARY OF THE INVENTION
[0008] One embodiment of the invention provides a method for
analyzing nucleotide sequence variations. A region of analyte DNA
molecules is amplified using a high fidelity DNA polymerase to form
a set of first amplicons. Microemulsions comprising said first
amplicons and reagent beads are formed. The reagent beads are bound
to a plurality of molecules of a primer for amplifying the set of
first amplicons. The first amplicons are amplified in the
microemulsions. Product beads are thereby formed which are bound to
a plurality of copies of second amplicons. A sequence feature of
the second amplicons is determined by single base extension of a
primer bound to the second amplicons using at least two
differentially labeled dideoxyribonucleotides.
[0009] A second embodiment of the invention provides a method for
amplifying a region of analyte DNA molecules. A region of analyte
DNA molecules is amplified using a high fidelity DNA polymerase to
form a set of first amplicons. Microemulsions comprising said first
amplicons and reagent beads are formed. The reagent beads are bound
to a plurality of molecules of a primer for amplifying the set of
first amplicons. The first amplicons are amplified in the
microemulsions. Product beads are formed which are bound to a
plurality of copies of second amplicons. The microemulsions are
broken. The second amplicons are amplified using rolling circle
amplification to form third amplicons.
[0010] These and other embodiments which will be apparent to those
of skill in the art upon reading the specification provide the art
with methods for analysis, diagnosis, and screening of subtle and
rare nucleic acid differences and the conditions or agents which
cause such differences.
BRIEF DESCRIPTION OF THE DRAWINGS
[0011] FIG. 1. Effect of the PCR amplicon size on plasma DNA
concentration and mutation frequency. (A) The concentration of
total APC fragments (wild-type plus mutant) of various sizes was
determined using digital PCR of plasma DNA from three different
patients (patients 29, 30 and 32). (B) The fraction of mutant APC
fragments was determined by digital sequencing of PCR products.
[0012] FIG. 2. Schematic of the BEAM-based assay. (A) Extended
beads were prepared by modifications of the BEAMing procedure
described in Dressman et al (16) (B) Single base extensions were
performed on the extended beads (gold spheres). Normal DNA
sequences contained a G at the queried position, while mutant
sequences contained an A.
[0013] FIG. 3. Processing of flow cytometry data obtained by
BEAMing. (A) Dot plot of forward scatter (FCS) and side scatter
(SCC) signals of beads. (B) Histogram of single beads with regards
to PE signal. Only beads containing extended PCR products had PE
signals, as depicted in FIG. 2B. (C) Dot plot showing the Cy5 and
FITC fluorescence intensity profiles of PE-positive beads. The
beads clustered in three distinct populations colored red, green,
and blue. Sequencing of individual beads sorted from each
population showed that the red and green beads contained
homogeneous wild-type and mutant sequences, respectively, while the
blue beads contained a mixture of wild-type and mutant
sequences.
[0014] FIG. 4. Examples of flow cytometric profiles of beads
generated from plasma DNA. Cy5 and FITC fluorescence intensity
profiles of PE-positive beads from four patients are shown. The
patients, mutations, and fraction of mutant APC fragments are
indicated.
[0015] FIG. 5. Fraction of mutant APC gene fragments in the plasma
of patients with various colorectal tumors (adenomas (Ad) and
Dukes' stage A, B, and D carcinomas). In each mutation analyzed,
DNA from normal lymphoid cells or plasma DNA from healthy donors
were used as controls ("Normal"). The "mutants" observed in assays
with normal cellular DNA represent errors generated during the PCR
process rather than mutations present in the template DNA (see
text). The red lines represent the mean, min, and max values of the
normal controls.
[0016] FIG. 6: Schematic of "BEAMing Up" assay
[0017] FIG. 7: Correlation between the total amount of template DNA
per emulsion PCR and the fraction of emulsions that contain a
single DNA molecule. PIK3CA exon 9, PIK3CA exon 20, and KRAS exon 2
amplicons were amplified from normal lymphozyte DNA and quantified
by a Picogreen assay. Equal amounts of the individual PCR products
were mixed, diluted, and used as templates for the emulsion PCR. To
distinguish single-template beads from multi-template beads
sequence-specific fluorescent probes were hybridized to the beads
after the emulsion PCR.
[0018] FIG. 8: Quantification of different template ratios by
BEAMing. PIK3CA amplicons were mixed with KRAS amplicons in a ratio
of 1:1, 1:10, 1:100, and 1:1000 and used as templates for emulsion
PCR. (A) Examples of flow cytometric profiles. Cy5-labeled KRAS
probes and FAM-labeled PIK3CA probes were hybridized to the beads.
(B) Relationship between input template ratio and bead proportions
generated in PIK3CA and KRAS mixture. (n=2; Slope=1.0; R2=0.9999).
(B). Relationship between input template ratio and bead proportions
generated in Tp53 and PIK3CA mixture (n=2; Slope=1.0;
R2=0.9988).
[0019] FIG. 9: Rolling circle amplification (RCA) on beads. (A).
P53 sequence specific FAM probes were hybridized to detect DNA
bound to magnetic beads (100.times. magnifications) after different
incubation times (B) Relative Fluorescent intensity of FAM probes
hybridized to the beads after RCA.
[0020] FIG. 10: "BEAMing Up" for quantification of mutations in the
presence of excessive amount of wild-type DNA. (A) Example of flow
cytometric profiles for quantification of TP53 codon 273 mutations
in a series of dilutions. (B) Relationship between input mutation
ratio and mutant bead proportions generated in TP53 (n=8;
slope=1.0; R2=0.9998). (C) Example of flow cytometric data for
quantification of PIK3CA A3140G mutation in a series of dilutions.
(D) Relationship between input mutation ratio and mutant bead
proportions generated in PIK3CA (n=8; slope=1.0; R2=0.9998). (E)
Statistic linear relationship between input mutation ratio and
mutant bead proportions generated in kras2. (n=8; slope=1.1;
R2=0.999).
[0021] FIG. 11: Quantification of error rates of commonly used
polymerases for PCR. (A). Example of flow cytometric profiles of
PIK3CA exon 20 A3140G. (B) Comparison of error rate of different
polymerases per cycle at PIK3CA exon 20 A3140 G (n=8-16). (C).
Comparison of the error rate of different polymerases per cycle at
TP53 exon 8 G818A (n=8-16).
TABLES
[0022] Table 1. Primer sequences used for fragment sizing
[0023] Table 2. Primer sequences used for BEAMing
[0024] Table 3. Primer sequences used for single base extension
[0025] Table 4. Quantification of APC gene mutations in plasma.
[0026] Table 5: Mutant genomic sequences analyzed
[0027] Table 6: Primers used for analysis of Tp53
[0028] Table 7: Primers used for analysis of PIK3CA
[0029] Table 8: Primers used for analysis of KRAS2
DETAILED DESCRIPTION OF THE INVENTION
[0030] The inventors have developed methods which improve the
sensitivity of assays for rare and subtle nucleic acid differences.
The assays are called BEAMing assays, and involve amplification of
nucleic acid molecules on beads in microemulsions. One improvement
involves the use of a high fidelity DNA polymerase in a preparatory
amplification reaction. Another improvement involves the use of a
single base extension reaction to determine a sequence feature on
an amplified product of BEAMing. Another improvement involves the
use of a rolling circle amplification to amplify the nucleic acids
bound to beads as a result of BEAMing. Another improvement involves
the use of a single base extension reaction to determine a sequence
feature on an amplified product of BEAMing which has been further
amplified using a rolling circle (isothermal) amplification. These
improvements which can be used singly or in combinations provide
increased sensitivity and/or signal-to-noise ratios.
[0031] High fidelity DNA polymerases which can be used are those
which provide a higher rate of fidelity (lower rate of errors) than
Taq polymerase. Preferably these provide an error rate of less than
10.sup.-5, more preferably an error rate of less than
5.times.10.sup.-6, and even more preferably an error rate of less
than 10.sup.-6. Suitable polymerases include: Phusion.TM. DNA
polymerase (NEB), Taq High Fidelity.TM., and PfuUltra.TM.. These
are used in a thermal cycling polymerase chain reaction, as is
conventional in the art.
[0032] Microemulsions are formed with beads and primers as
previously taught. Because BEAMing requires thermal cycling, an
emulsifier which is thermostable can be used. One such emulsifier
is Abil.RTM. EM90 (Degussa-Goldschmidt Chemical, Hopewell, Va.).
Other such emulsifiers can be used as are known in the art.
[0033] Amplicons can be any size which is efficiently amplified
using polymerase chain reaction. In the case of templates obtained
from serum of cancer patients, amplicons are preferably shorter
than or equal to 300 bp, or shorter than or equal to 200 bp, or
shorter than or equal to 100 bp. Templates from serum of colon
cancer patients are apparently degraded to small sizes. Thus
amplification of a smaller amplicon results in a more efficient and
sensitive detection. The dependence of detection on size is quite
strong as shown in FIG. 1.
[0034] Single base extension reaction with differentially labeled
dideoxynucleotides provides a sensitive means for detecting
sequence features. If upon detection of products, individual beads
are found with multiple, distinct labels, for example, representing
a mutant and a wild type nucleotide, they can be discarded from
further analysis. Multiple, distinct labels in this context
indicates that a bead was present in a microemulsion with two
distinct templates of analyte DNA, rather than the desired single
template, or that an error occurred early in an amplification
reaction in a microemulsion, such that the erroneous and the
correct templates were both amplified.
[0035] One means for detecting a sequence feature on an amplicon
bound to a bead employs a single base extension (SBE) reaction.
This reaction typically employs labeled dideoxynucleotide
triphosphates to ensure that only a single monomer addition occurs.
Dideoxynucleotide triphosphates can be conveniently labeled with
any type of detectable label, including radioactive, fluorescent,
and luminescent moieties. Different labels can be attached to
different dideoxynucleotide triphosphates (ddNTPs) so that
different products can be detected in the same sample. Prior to
addition of all reagents necessary for initiation of the SBE
reaction, unlabeled ddNTPs can be added to block non-specific
extension. Typically at least one unlabeled ddNTP is added at a
concentration five to 40 fold higher than the concentration of the
labeled ddNTPs. Preferably the concentration is at least ten to
twenty times higher. For example, if A is the mutant base and C is
the wild-type base, during the SBE, we can use Rox-ddATP for the
mutant, FITC-ddCTP for the wild type, ddGTP and ddTTP for blocking
the nonspecific extension at the ratio of 1:2-10:20:20. The
unlabeled ddNTPs reduce nonspecific incorporation.
[0036] Another optional step for improving the specificity and/or
sensitivity of the SBE reaction is to denature the double stranded
nucleic acid duplexes attached to the beads prior to the SBE
reaction. For example, the double strands can be heated or treated
with sodium hydroxide. After the separation of the two strands, the
single strands which are not bound to the beads can be separated
from the beads and the bead-bound strands, and the single strands
can be discarded.
[0037] Microemulsions can be formed according to any technique
known in the art. Previously for BEAMing, a magnetic stirring bar
was used to create microemulsions. Other means can also be used,
including, without limitation, tissue homogenizers, whether
mechanical or sonicator-type. Suitable mechanical homogenizers
include rotor-stator type as well as blade type. Tissue
homogenizers appear to form microemulsions of more uniform size
than magnetic stirring bars.
[0038] If desired, yet another step of amplification can be used
after the microemulsions are broken. This step typically employs
isothermal amplification, also known as rolling circle
amplification. In order to generate the rolling circle, a molecular
inversion probe or a padlock probe can be used. They probe may
require filling-in, or not, prior to a template-driven ligation
reaction to generate a circle. If filling-in is required the region
to be filled in will typically be from 1 to 30 nucleotides. The
isothermal amplification can amplify the ultimately detected signal
quite significantly. After isothermal amplification, a sequence
feature can be detected using SBE (single base extension) reaction,
as described above. Alternatively, the nucleotide sequence of the
amplicon on the beads can be determined by any sequencing method
known in the art, including sequencing-by-synthesis.
[0039] Samples which may be used as sources of analyte DNA include
blood, plasma, urine, stool, sputum, tears, saliva, and bone
marrow. Solid tissues can also provide analyte DNA. Samples can be
obtained from cancer patients, from related family members, from
pregnant women, and from neonates. Sources of analyte DNA may be
treated, for example with test agents, and the effects of the test
agents on the analyte DNA can be determined.
[0040] The data described in the examples conclusively demonstrate
that APC gene fragments from the neoplastic cells of colorectal
tumors can be found in the circulation and that the number of such
fragments depends on tumor stage. These results have implications
for both colorectal tumor biology and for practical diagnostic
tests, as discussed below.
[0041] Previous studies have shown that the total DNA concentration
in the plasma of cancer patients is often elevated (19, 20). Our
results support this conclusion only in advanced stage patients, in
that more total APC gene fragments (wild-type plus mutant) were
present in the plasma of patients with Dukes' D cancers than in
those with earlier stage tumors. Our results additionally show that
this "extra" DNA in advanced stage patients is not derived from the
neoplastic cells themselves, as only a minor fraction of the APC
fragments are mutant whereas all the neoplastic cell's APC
fragments are mutant.
[0042] But there are still a large number of mutant DNA fragments
circulating in cancer patients. Assuming that the volume of
distribution of DNA at steady state is similar to that of
oligonucleotides in primates (60-70 ml/kg), an 8% fraction of
mutant molecules among 47,800 fragments per ml plasma (as in Dukes'
D patients) would correspond to 1.6.times.10.sup.7 mutant fragments
present in a 70 kg person at any given time (24). The half-life of
this tumor DNA is estimated at 16 min based on the data obtained
from clearance of fetal DNA in maternal plasma (25). This
translates to .about.6.times.10.sup.8 mutant fragments released
from the tumor each day. For patients with a tumor load of 100 g in
size (.about.3.times.10.sup.10 neoplastic cells), we thereby
estimate that 3.3% of the tumor DNA is fed into the circulation on
a daily basis. For a Dukes' B cancer of 30 g in which 1.3% of the
4000 circulating APC fragments per ml plasma are mutant, the
corresponding estimate is that 0.15% of the tumor DNA is fed into
the circulation each day.
[0043] So what is the source of this mutant DNA and how do mutant
APC gene fragments get into the plasma? Several clues are provided
by our data. The ability to get into the circulation was clearly
not related to tumor size, as the benign tumors we studied were as
large as the cancers (Table 4), yet the former rarely gave rise to
detectable mutant DNA fragments. Similarly, the size of the cancers
was not the critical parameter, as there was no significant
correlation between the tumor load (including metastatic deposits)
and the amount of mutant DNA in the circulation. On the other hand,
the degree of invasion was indeed correlated with the number of
circulating DNA fragments. Those lesions which weren't invasive
(benign tumors) did not commonly feed mutant DNA molecules into the
plasma. As tumors invaded through more layers of the intestinal
wall in Dukes' B vs. Dukes' A tumors, and through the intestine to
distant sites in Dukes' D vs. Dukes' B tumors, the number of
circulating mutant DNA molecules progressively increased (FIG.
5).
[0044] Another clue is provided by the size of the mutant DNA
molecules. The data in FIG. 1 show that mutant sequences are
enriched in small DNA fragments and could not be identified at all
in fragments of 1296 bp.
[0045] Based on these observations, we propose that the mutant DNA
fragments found in the circulation are derived from necrotic
neoplastic cells that had been engulfed by macrophages. As tumors
enlarge and invade, they are more likely to outgrow their blood
supply. Thus invasive tumors generally contain large regions of
necrosis, while benign tumors rarely do (26-29). Necrotic cells are
not thought to release DNA into the extracellular milieu (30).
However, cells that die from necrosis or apoptosis are routinely
phagocytosed by macrophages or other scavenger cells.
Interestingly, it has been shown that macrophages that engulf
necrotic cells release digested DNA into the medium, while
macrophages that engulf apoptotic cells do not (30). Moreover, the
size of the DNA released from macrophages is small (30). All of
these observations are consistent with a model wherein hypoxia
induces necrosis of tumors, leading to the phagocytosis of tumor
cells and the subsequent release of the digested DNA into the
circulation. As tumors become more aggressive, the degree of this
necrosis increases and the absolute amount of circulating mutant
DNA correspondingly rises. Because necrosis involves the killing
not only of neoplastic cells, but also of surrounding stromal and
inflammatory cells within the tumor, the DNA released from necrotic
regions is likely to contain wild-type DNA sequences as well as
mutant sequences. This may explain the increase in total
(non-mutant) circulating DNA observed in the plasma of patients
with advanced cancers.
[0046] The ability to detect and quantify mutant DNA molecules in
the circulation has obvious clinical importance, and this line of
research has been pursued by several investigators. Our results
inform the field in several ways. First, it is unlikely that
circulating mutant DNA could be used to detect pre-malignant
tumors, based on the fact that we were unable to detect such DNA
even in very large adenomas. Similarly, it is unlikely that loss of
heterozygosity detection or other techniques that require a
majority of the circulating DNA to be derived from neoplastic cells
will allow such detection, as the proportion of mutant DNA
fragments in plasma was small, averaging only 11% of the total DNA
fragments even in large, metastatic cancers. We cannot easily
reconcile our observations with previous data reporting the
presence of large fractions of mutant DNA in the circulation, even
from pre-malignant tumors. However, it is possible that tumors of
organs other than the colon, on which several of the prior reports
were based, behave differently with regards to their contribution
to circulating DNA.
[0047] On the positive side, our data shows that even relatively
early cancers give rise to circulating mutant DNA fragments that
can be detected with sufficiently sensitive and specific assays. In
fact, more than 60% of cancers that had not yet metastasized gave
rise to detectable mutant fragments in plasma. Even Dukes' A
tumors, which are by definition barely invasive, were detectable
with BEAMing-based assays. Virtually all Dukes' A tumors and most
Dukes' B tumors can be cured with conventional surgery alone,
without the need for adjuvant therapies (31).
[0048] In practical terms, plasma-based assays for mutant DNA
fragments are inferior in several ways to more conventional
techniques for early colorectal cancer detection. Colonoscopy is
the gold standard, with sensitivity rates >80% for adenomas and
>90% for cancers (32). In particular, adenomas detected by
colonoscopy can often be removed through the colonoscope,
alleviating the need for surgery. Unfortunately, a variety of
issues limit the widespread applicability of colonoscopy (either
conventional or virtual) to the screening of asymptomatic patients
(3, 5, 33). This has stimulated the development of non-invasive
technologies. One of the most promising of these is the analysis of
fecal DNA for mutations (34). Because of the frequent presence of
mutant DNA molecules in feces from both adenomas and early cancers,
fecal DNA analysis is superior to plasma with regards to
sensitivity. However, plasma-based assays have potential advantages
with regards to ease of implementation and compliance.
[0049] For many tumor types, there are currently no alternative
methods for pre-symptomatic diagnosis, unlike the case with
colorectal cancers. In these other tumor types, the evaluation of
circulating DNA could be particularly useful. Even if such assays
could detect only a fraction of patients with treatable cancers,
much morbidity and mortality could be averted.
[0050] "BEAMing Up" represents an advance for the accurate
detection and quantification of rare genetic variants in a
population of DNA molecules. The approach provides robust signals
and extremely high signal to noise ratios. As tens of millions of
DNA template molecules can easily be analyzed by flow cytometry,
its sensitivity for mutation detection is very high. In fact, its
sensitivity is currently limited not by any intrinsic problem with
the method itself but simply by the error rate of currently
available polymerases used for PCR.
[0051] As the first application of this technology, we have
determined the error rates of four polymerases representing
representative types of commercially available PCR formulations.
One was conventional Thermus aquaticus (Taq) polymerase, the second
was Taq High Fidelity, a blend of Taq DNA Polymerase plus the
proofreading enzyme Pyrococcus species GB-D containing a 3' to 5'
exonuclease activity), the third was PfuUltra, a genetically
engineered mutant of Pyrococcus furiosus (Pfu) DNA polymerase
combined with a proprietary polymerase-enhancing factor, and the
fourth was Phusion, a fusion protein consisting of a double
stranded DNA binding domain and a Pfu-like polymerase.
[0052] It is interesting to try to compare our error determination
results with those that are conventionally used for this purpose.
For example, the supplier of Taq and Taq High Fidelity cloned PCR
products produced by the two enzymes into plasmid vectors, then
transforms bacteria with the plasmids. The mutation frequency was
determined by dividing the total mutations by the total transformed
cells. The error rate was determined by dividing the mutation
frequency by the number of amino acids that can cause phenotypic
changes in the two independent marker genes amplified (130 and 134
for rpsL and lacZ, respectively). The error rates for Taq using
this assay were 4.2.times.10.sup.-5 and 1.9.times.10.sup.-5 epc for
the rpsL and lacZ, respectively. These error rates were similar to
those found we found for Taq (2.3-3.4.times.10.sup.-5 epc), despite
the completely different nature of the sequences queried and the
assays used. Note that the error rates determined by BEAMing are
slight underestimates, as we ignore beads that have resulted from
multi-template amplification (FIG. 8a). Our estimate for the
relative fidelity of Taq High Fidelity was considerably different
than those reported by the manufacturer, 1.3 to 1.7 times more
accurate than Taq in our assays instead of 6 times more
accurate.
[0053] The manufacturer of PfuUltra used a lacI system similar to
that described above, employing cloning of PCR products and
phenotypic evaluation of colonies. They calculated an error rate of
4.3.times.10.sup.-7 for PfuUltra and 1.4.times.10.sup.-6 for
Phusion. The manufacturer of Phusion used the same assay and found
an error rate of 4.4.times.10.sup.-7 epc for Pfhusion but
6.93.times.10.sup.-7 for PfuUltra. We found that both PfuUltra and
Phusion resulted in similar error rates (6.0 and
4.8.times.10.sup.-7, respectively).
[0054] Some important points can be derived from these comparisons.
First, the error rates determined with BEAMing Up are remarkably
similar to those determined by conventional assays despite the huge
differences between the sequences analyzed and the techniques used
to measure mutations. Second, there are advantages to both
approaches. Biological assays with lacZ, lacI, or rpsL provide
averaged estimates of many different types of mutations across
relatively large amplicons. In contrast, BEAMing-based assays
provide error rates at specific positions. General statements about
error rates of polymerases may best be supported either by
conventional biologic assays (or by multiple BEAMing assays
querying different positions of the same amplicon). But in many
biomedical research applications, it is not the generalized error
rate that determines the reliability of the experimental data but
rather the mutation rate at the specific position analyzed. This is
true, for example, in assays wherein specific mutations or
methylation changes are queried in samples from cancer patients.
Since DNA polymerase may have mutational spectrum bias and PCR
noise may preferentially accumulate at hot spots (3, 4, 5), by
including normal DNA as a negative control in BEAMing assays, the
limit of sensitivity of the particular assay is reliably determined
in a way that would be impossible with conventional approaches.
[0055] Finally, it is clear that the technique described here is
considerably simpler and less time consuming than those
historically used for error rate determinations. BEAMing Up
eliminates the need for cloning, bacterial transformation, colony
selection, and confirmation of mutations by sequencing of colonies.
It also eliminates the need for assumptions about the number of
residues that can be mutated to result in a specific phenotype and
thereby provides a more direct measure of mutation frequency. It
should prove useful for many types of experiments wherein the
fidelity of processes related to replication or transcription is
important. It should facilitate the identification of rare
mutations in clinical samples. And because of the much higher
amount of DNA per bead, the technique could be useful for
increasing read length or accuracy of high throughput sequencing
studies using DNA-bound beads as templates.
[0056] The above disclosure generally describes the present
invention. All references disclosed herein are expressly
incorporated by reference. A more complete understanding can be
obtained by reference to the following specific examples which are
provided herein for purposes of illustration only, and are not
intended to limit the scope of the invention.
Example 1
Materials and Methods for Examples 2-5
Sample Collection, DNA Extraction, and Sequencing.
Real-Time PCR
[0057] Primers were designed to generate .about.100 bp amplicons
that included one or more mutation sites. A universal tag
(5'-tcccgcgaaattaatacgac-3') was added to the 5' end of either the
forward or reverse primer used to generate each amplicon. This
universal tag was identical to the one bound to the beads used for
BEAMing. The sequences of these primers are listed in Table 2,
which is published as supporting information on the PNAS web site.
PCR was performed in 50 .mu.l reactions containing 10 .mu.l
5.times. Phusion.TM. HF buffer, 0.2 mM of each dNTP, 1 .mu.M of
each primer, 1/50,000 dilution of SYBR.RTM. green I (Invitrogen),
1.5 U Phusion.TM. DNA polymerase (NEB, Beverly, Mass.), and 15
.mu.A of purified plasma DNA (equivalent to 100 .mu.l plasma) or
genomic DNA purified from normal mononuclear cells of the blood of
healthy volunteers. The amplifications were carried out with an
iCycler PCR detection system (BioRad, Hercules, Calif.). PCR
cycling conditions for all amplicons were as follows: 98.degree. C.
for 1 min; 3 cycles of 98.degree. C. for 10 sec, 70.degree. C. for
10 sec, 72.degree. C. for 10 sec; 3 cycles of 98.degree. C. for 10
sec, 67.degree. C. for 10 sec, 72.degree. C. for 10 sec; 3 cycles
of 98.degree. C. for 10 sec, 64.degree. C. for 10 sec, 72.degree.
C. for 10 sec; 30 cycles of 98.degree. C. for 10 sec, 61.degree. C.
for 10 sec, 72.degree. C. for 10 sec. Each reaction was performed
in duplicate and a calibration curve was generated in each 96 well
plate using various amounts of normal human genomic DNA. The
concentration of PCR products was determined using a PicoGreen.TM.
dsDNA quantification assay (Invitrogen).
BEAMing
[0058] A common oligonucleotide (5'-tcccgcgaaattaatacgac-3') was
synthesized with a dual biotin group at the 5' end and with a six
carbon linker (C6) between the biotin and the other nucleotides
(IDT, Coralville, Iowa). This oligonucleotide was coupled to
streptavidin-coated magnetic beads (MyOne.TM., Dynal, Oslo, Norway)
according to the protocol published previously (16). The
water-in-oil emulsions were prepared by modifications of the method
described by Ghadessy and Holliger (17) using a homogenization
protocol originally described by Bernath et al. (18). For each
emulsion PCR, a 240 .mu.l aliquot of an aqueous PCR mix was added
to 960 .mu.l of 7% (w/v) Abil.RTM. EM90 (Degussa-Goldschmidt
Chemical, Hopewell, Va.) in mineral oil (M3516; Sigma). The aqueous
phase contained 67 mM Tris-HCl pH 8.8, 16.6 mM
(NH.sub.4).sub.2SO.sub.4, 6.7 mM MgCl.sub.2, 10 mM
2-mercaptoethanol, 0.2 mM of each dNTP, 0.05 .mu.M forward primer
(5'-tcccgcgaaattaatacgac-3') and 8 .mu.M reverse primer, 0.2
U/.mu.l Platinum.RTM. Taq polymerase (Invitrogen),
3.times.10.sup.5/.mu.l oligonucleotide-coupled beads and 0.1
pg/.mu.l template DNA. The reverse primers are listed in Table 2,
which is published as supporting information on the PNAS web site.
The water-oil mix was vortexed for 10 sec then emulsified for 50
sec using an Ultra-Turrax.RTM. homogenizer (T25 basic; IKA,
Wilmington, N.C.) with a disposable OnmiTip.TM. (Omni International
Inc., Marietta, Ga.) at the minimum speed. The emulsions were
aliquoted into eight wells of a 96-well PCR plate and cycled under
the following conditions: 94.degree. C. for 2 min; 50 cycles of
94.degree. C. for 10 sec, 58.degree. C. for 15 sec, and 70.degree.
C. for 15 sec. After PCR, the emulsions were pooled into a 15 ml
tube and demulsified through the addition of 10 ml of NX buffer
(100 mM NaCl, 1% Triton X-100, 10 mM Tris-HCl pH 7.5, 1 mM EDTA, 1%
SDS). After vortexing for 10 sec, the beads were pelleted by
centrifugation for 5 min at 4,100 g. The top phase was removed and
the beads were resuspended in 800 .mu.l NX buffer and transferred
to a 1.5 ml tube. The beads were collected using a magnet (MPC-S,
Dynal) and washed with 800 .mu.l wash buffer (20 mM Tris-HCl, pH
8.4, 50 mM KCl). The double-stranded DNA on the beads was converted
to single-stranded DNA by incubation in 800 .mu.l 0.1 M NaOH for 2
min at room temperature. The beads were washed twice with 800 .mu.l
wash buffer using the magnet and finally resuspended in 200 .mu.l
of wash buffer. Single base extension and flow cytometry were
performed as described in supporting information published on the
PNAS web site.
Sample Collection and DNA Extraction
[0059] Tissue samples, matched blood samples and clinical data were
collected by Indivumed from surgical patients of the Israelitic
Hospital and the Clinic Alten Eichen (both in Hamburg, Germany)
following strictly controlled SOP criteria. IRB approval was given
by the Ethical-board of the Physicians Association of Hamburg,
Germany and patients' samples and data were collected after
obtaining informed and written consent. The samples used in the
current study were randomly chosen from those contributing through
this protocol. Shortly before surgery, 18 ml EDTA blood was taken
from a central catheter, chilled to 8.degree. C. immediately, and
transported to the lab within 30 minutes for plasma preparation.
The blood cells were pelleted for 15 min at 200 g in a
Leucosep.RTM.-tube (Greiner, Frickenhausen, Germany) filled with 15
ml Ficoll-Paque solution. After centrifugation the supernatant
(i.e., plasma) was transferred into 1.5 ml tubes, immediately
frozen, and stored at -80.degree. C. The plasma samples were thawed
at room temperature for 5 min and any remaining debris pelleted at
16,000 g for 5 min. The supernatant was transferred to a new tube
and digested with 500 .mu.g/ml proteinase K (Invitrogen, Carlsbad,
Calif.) in 2.5 mM Tris-HCl, 0.25 mM EDTA pH 7.5, and 1% SDS
overnight. The DNA was extracted twice with phenol-chloroform (VWR,
Cat#IB05174) and precipitated with two volumes ethanol in the
presence of 3.3 M ammonium acetate and 3.3% (v/v) seeDNA.TM. (GE
Healthcare, Piscataway, N.J.). The DNA from 1 ml plasma was
dissolved in 150 .mu.l of 10 mM Tris-HCl, 1 mM EDTA, pH 7.5. Tumor
DNA was purified with the DNeasy tissue kit (Qiagen, Valencia,
Calif.) according to the manufacturer's instructions.
Digital PCR and DNA sequencing
[0060] Digital PCR followed by direct sequencing of PCR products
generated from single template molecules was used to determine the
APC mutation status of the primary colon tumors and to analyze
plasma DNA fragments of different sizes.
[0061] Tumor DNA was diluted in 96 well PCR plates so that one or
two template molecules were contained within each 10 .mu.l
reaction. To obtain a robust and uniform amplification, nested PCR
reactions were performed. The first amplification comprised a 1296
bp region of the APC mutation cluster region (F1
5'-ACGTCATGTGGATCAGCCTATTG-3'; R1 5'-GGTAATTTTGAAGCAGTCTGGGC-3').
The second amplification was split into two separate PCR reactions
(A and B), with each one including half of this region (primers for
A: F2 A 5'-TCTGGACAAAGCAGTAAAACCG-3'; R2 A
5'-CTTGGTGGCATGGTTTGTC-3'; primers for B: F2 B
5'-GCTCAGACACCCAAAAGTCC-3'; R2 B 5'-ACGTGATGACTTTGTTGGCATGGC-3').
The PCR mix contained 1.times.PCR buffer, 1 .mu.M of each
oligonucleotide, 1 mM of each dNTP, 6% DMSO, and 0.05 U/.mu.l
Platinum.RTM. Taq polymerase (Invitrogen). The following
temperature profile was used for the amplification: 94.degree. C.
for 2 min; 3 cycles of 94.degree. C. for 30 s, 67.degree. C. for 30
s, 70.degree. C. for 1 min; 3 cycles of 94.degree. C. for 30 s,
64.degree. C. for 30 s, 70.degree. C. for 1 min, 3 cycles of
94.degree. C. for 30 s, 61.degree. C. for 30 s, 70.degree. C. for 1
min; 50 cycles of 94.degree. C. for 30 s, 61.degree. C. for 30 s,
70.degree. C. for 1 min. One .mu.l of the first amplification was
added to each of the second 10 .mu.l PCR reactions. The second PCR
employed the following cycling conditions: 2 min at 94.degree. C.;
15 cycles of 94.degree. C. for 30 s, 58.degree. C. for 30 s,
70.degree. C. for 1 min. The PCR products were purified using the
AMpure.RTM. PCR purification system (Agencourt, Beverly Mass.) and
sequencing reactions were performed with BigDye.RTM. Terminator
v3.1 (Applied Biosystems, Foster City, Calif.). Sequencing
reactions were resolved on an automated 384 capillary DNA sequencer
(Spectrumedix, State College, Pa.). Data analysis was performed
using the Mutation Explorer.RTM. package (SoftGenetics, State
College, Pa.). Of 12 relatively large adenomas (>1 cm), 11 were
found to contain APC mutations within the region analyzed. Of 34
patients with Dukes' A or B carcinomas, 16 were found to contain
APC gene mutations, and of 10 patients with Dukes' D carcinomas, 6
were found to contain APC gene mutations. Plasma was obtained from
these 33 patients for analysis of circulating DNA, as described in
Results.
[0062] For analysis of the size spectrum of plasma DNA in three
patients with advanced cancers, digital PCR was performed as above
for tumor DNA except that primers yielding amplicons of different
sizes were used (primer sequences are listed in Table 1, which is
published as supporting information on the PNAS web site). The
reaction components and temperature cycling conditions for the
first and second PCR were the same as described above except that
the extension time was cut in half for fragments smaller than 500
bp. Agarose gel electrophoresis of the PCR products from each well
was used to count the total number of APC templates contained in
various dilutions of plasma DNA. These same PCR products were used
in sequencing reactions to determine the number of templates
containing mutant APC sequences, as described above.
Single Base Extension (SBE)
[0063] Single base extension reactions were performed in 80 .mu.l
of 1.times.SBE buffer (150 mM Tris-HCl pH 9.5, 67 mM MgCl.sub.2)
containing 3.times.10.sup.6 magnetic beads from the emulsion PCR,
2.5 .mu.M FITC-labeled ddATP (Perkin-Elmer, Wellesley, Mass.), 3.5
.mu.M Cy5-labeled ddGTP (GE Healthcare), 25 .mu.M of unlabeled
ddCTP and ddUTP (USB, Cleveland, Ohio), 0.3 .mu.M biotinylated
primer, 20 U/.mu.l ThermoSequenase.TM. (GE Healthcare). The primers
used for SBE are listed in Table 3, which is published as
supporting information on the PNAS web site. This composition was
used when the wild-type sequence at the queried position was G and
the mutant sequence was A; appropriate substitutions for the
indicated ddNTPs were made when other bases were queried. Also note
that the streptavidin present on MyOne.TM. beads is denatured
during the emulsion PCR and does not bind biotin thereafter, so the
primer used for SBE only binds to extended PCR products via
hybridization and not to the beads themselves. The reactions were
carried out at 94.degree. C. for 2 min, 65.degree. C. for 1 min,
and 70.degree. C. for 2 min. After the extension reaction, the
beads were recovered by magnetic separation, washed once with 200
.mu.l wash buffer and once with 200 .mu.l wash buffer plus 0.1%
BSA, and then resuspended in 180 .mu.l of binding buffer (5 mM
Tris-HCl pH 7.5, 0.5 mM EDTA, 1 M NaCl). The beads were mixed with
20 .mu.l of 10 .mu.g/ml streptavidin-conjugated phycoerythrin (PE,
Invitrogen) to label the biotin-conjugated primer and incubated at
room temperature for 10 min. The beads were recovered with the
magnet and washed twice with 200 .mu.l wash buffer, then
resuspended in 400 .mu.l wash buffer.
Flow Cytometry
[0064] Beads were analyzed with a LSR II flow cytometer or sorted
with a FACSAria.TM. (both from BD Biosciences, San Jose, Calif.).
The flow rate was typically set at 5000 events per second and a
minimum of 2.times.10.sup.6 events for each bead population was
collected. These events were gated to exclude doublets and other
aggregates. For the calculations of mutant frequency, only single
beads with a PE signal at least 10-fold above the mean background
signal were considered. In selected cases, beads were recovered by
flow sorting and individual beads used in sequencing reactions.
This was accomplished by first diluting the sorted beads in 96 well
PCR plates so that one of every two wells (on average) contained a
bead. The single-stranded DNA bound to each bead was then converted
to double-stranded DNA by a DNA polymerase and released by a
restriction enzyme digest that only cleaved the universal primer
sequence on the beads. The DNA polymerase reaction was performed in
a volume of 2 .mu.l under a layer of mineral oil and contained
1.times.PCR buffer, 1 .mu.M of the reverse oligonucleotide used for
BEAMing, 1 mM of each dNTP and 0.05 U/.mu.l Platinum.RTM. Taq
polymerase. The following temperature profile was used for the Taq
polymerization: 95.degree. C. for 2 min, 58.degree. C. for 15 s,
and 70.degree. C. for 1 min. Three .mu.l of a mix containing 0.5
.mu.l 10.times. buffer 3 (NEB), and 0.04 U/.mu.l Ase I (NEB) was
added to the polymerase reaction and incubated at 37.degree. C. for
30 min. The entire 5 .mu.l reaction was then used as template for a
25 .mu.l PCR reaction. The reaction components were the same as for
the Taq polymerization except that the two primers used for the
emulsion PCR were included (Table 2, which is published as
supporting information on the PNAS web site). The PCR products were
purified with AMpure.RTM. and sequenced, as described above
(Digital PCR and DNA sequencing).
Example 2
Circulating Mutant DNA is Degraded
[0065] We used real-time PCR or digital PCR to determine the number
of total circulating APC genes in 33 patients with colorectal
tumors and ten age-matched donors without any tumor. The number of
APC gene copies was significantly higher in advanced stage patients
(Dukes' D) than in patients with early stage cancers (p<0.0001,
Student's t-Test), consistent with previous studies (19, 20). In
advanced stage patients, the median number of APC gene fragments
per ml plasma was 47,800 while the median number was 3,500 and
4,000 for patients with Dukes' A and Dukes' B cancers, respectively
(Table 4). There was no significant difference between the number
of circulating copies in early stage cancer patients (Duke's A or
B), patients with adenomas (4300 APC fragments/ml plasma) and
normal individuals (3460 APC fragment/ml plasma; range 1150 to 8280
fragments/ml). There also appeared to be little difference between
the number of APC fragments determined by these assays when the
position of the amplicons within APC was varied (data not
shown).
[0066] To determine the size of mutant gene fragments in
circulating DNA, we analyzed plasma DNA from three patients with
advanced colorectal cancers (Dukes' D, metastatic to liver) who
were shown to contain APC gene mutations in their tumors. By
varying the size of the amplicons generated by PCR, it was possible
to determine the number of normal and mutant gene fragments present
in plasma by sequencing PCR products derived from one or a few
template molecules (Digital PCR, as described in Materials and
Methods). The size of the amplicons varied from 100 to 1296 bp and
encompassed the mutation present in each patient. The number of
total APC fragments (wild-type plus mutant) increased by 5 to
20fold as the size of the amplicons decreased from 1296 to 100 bp
(FIG. 1A). The fraction of mutant molecules was strikingly
dependent on size of the amplicon, increasing by more than 100 fold
over the size range tested (FIG. 1B). For example, though APC
fragments of >1296 bp could be identified in the plasma of all
three patients, there were no mutant APC sequences found in
.about.1000 fragments of this size. With very small amplicons
(.about.100 bp), at least 8% of the plasma APC gene fragments were
found to be mutant in all three patients.
[0067] We conclude that the mutant DNA fragments present in the
circulation of cancer patients are degraded compared to the
circulating DNA derived from non-neoplastic cells. This conclusion
is consistent with previous studies of other tumor types (21, 22)
and has important implications for the detection of such mutant
molecules. In particular, small amplicons can be used to enrich for
DNA sequences derived from cancer cells.
Example 3
Development of a Quantitative Assay for Detection of Rare
Mutations
[0068] The results described above were obtained by sequencing
hundreds of PCR products each derived from one or a few DNA
template molecules. In preliminary studies, we found that such
Digital PCR-based techniques were sufficiently sensitive to detect
circulating mutant DNA molecules in patients with advanced cancers,
but not in patients with early stage cancers. To increase the
sensitivity and reliability of these assays, we developed an
extension of BEAMing that allowed us to examine many more template
molecules in a convenient fashion. The approach consists of four
steps: (i) Real-time PCR was used to determine the number of APC
gene fragments in the plasma sample (FIG. 2A, step 1); (ii) BEAMing
was used to convert the amplified plasma DNA into a population of
beads (FIG. 2A step 2-4); (iii) the mutational status of the
extended beads was determined by single base extension (FIG. 2B);
and (iv) flow cytometry was used to simultaneously measure the
FITC, Cy5, and PE signals of individual beads.
[0069] FIG. 3 shows a representative flow cytometry result wherein
the interpretation of the profiles was confirmed experimentally. In
the example shown, a total of 342,573 beads were analyzed by flow
cytometry. The single bead population (295,645) was used for
fluorescence analysis (FIG. 3A). Of these, 30,236 exhibited a PE
signal (FIG. 3B), indicating that they had been extended during the
emulsion PCR. The FITC and Cy5 signals reflected the number of
beads containing mutant or wild-type sequences, respectively. Beads
containing the wild-type DNA sequences (30,186) had high Cy5 but
background FITC signal ("red beads" in FIG. 3C). Beads extended
only with mutant DNA sequences (22) had high FITC signals but
background Cy5 signals ("green beads"). Twenty-eight had both FITC
and Cy5 signals ("blue beads"). Such dual-labeled beads resulted
from either the presence of both a wild-type and mutant template in
the droplet containing the bead or an error in the early cycles of
the emulsion PCR (see below). These dual-labeled beads were
eliminated from analysis, and only homogenously-labeled beads were
considered for the enumeration of mutations. Note that this
conservative analysis strategy results in a slight underestimation
of the fraction of mutations, as it excludes mutants that were
present in droplets that also contained one or more wt fragments.
Beads in each of these three populations were collected by flow
sorting and single beads from the sort were used as templates in
conventional DNA sequencing. All 131 beads subjected to sequencing
analysis showed the expected patterns, with examples illustrated in
FIG. 3C.
Example 4
Limits to the Sensitivity of Assays for Plasma DNA Mutations
[0070] The results described above show that the BEAMing approach
can, in principle, detect a very small fraction of fragments
containing mutant sequences within a much larger pool of fragments
containing wild-type sequence. Because >50 million beads are
used in a single emulsion PCR and flow cytometry can be performed
at speeds of >50,000 beads per sec, the capacity to enumerate
such mutations is not limited by the beads themselves. Instead, two
other features limit the sensitivity. First, there is a finite
number of DNA fragments present in clinical samples. As noted
above, this number ranged from 1,350 to 230,000 fragments per ml in
the patients with tumors (Table 4) and from 1150 to 8280
fragments/ml in control patients. This gives an upper bound to the
sensitivity of the assays. For example, a calculation using the
Poisson distribution shows that if 4000 fragments were analyzed,
the mutation frequency would have to be greater than 1 in 1333
fragments (i.e., 3 divided by the number of total fragments
analyzed) for the assay to achieve 95% sensitivity. A second
limiting feature is the error rates of the polymerases used for
PCR. In our approach, two PCR steps are employed: The first is a
conventional PCR that employs plasma DNA fragments as templates and
the second is an oil-in-water emulsion PCR that uses the initial
PCR products as templates. In the emulsion PCR, errors occurring
during the early rounds of PCR can result in heterogeneous beads
containing both wild-type and mutant sequences. These are easily
eliminated from consideration, as described in FIG. 3C. However,
the errors introduced in the first PCR cannot be eliminated, as
they give rise to beads with homogeneous mutant sequences,
indistinguishable from those resulting from genuine mutations in
the original plasma DNA templates.
[0071] The fraction of mutant molecules present after the first PCR
equals the product of the mutation rate of the polymerase and the
number of cycles carried out. BEAMing provides a quantitative way
to determine the error rate of any polymerase used in PCR, without
requiring cloning in bacterial vectors (Li et al., unpublished
data). Of 19 different base changes evaluated in normal DNA, the
error rates with the polymerase used in the current study averaged
3.0.times.10.sup.-7 mutations/bp/PCR cycle and ranged from
1.7.times.10.sup.-7 to 6.5.times.10.sup.-7 mutations/bp/PCR cycle,
depending on the mutation site assessed. As a result, we only
scored plasma samples as positive for mutations if their frequency
in the sample was significantly higher than the maximum error rate
of polymerase found experimentally (i.e., 1.95.times.10.sup.-5
after 30 cycles). As a result of the relatively low error rate with
the polymerase used, it was the number of molecules present in the
original plasma sample, rather than the polymerase error rate per
se, that limited sensitivity.
[0072] These issues suggest that the sensitivity of assays for
circulating mutant DNA could be increased in the future by (i) the
development of new or modified polymerases with reduced error rates
and (ii) the use of more plasma per assay (i.e., more template
molecules).
Example 5
Quantification of Mutant APC Fragments in Plasma from Patients with
Colorectal Tumors
[0073] Based on the principles derived from the experiments
described above, we determined whether fragments of tumor DNA could
be detected in patients with colorectal tumors of various types. We
selected APC gene mutations for this assessment, as >85% of
colorectal tumors contain mutations of this gene, irrespective of
tumor stage (23). Mutations in the mutation cluster region were
evaluated by sequencing of DNA purified from the tumors of 56
patients. Mutations were observed in 33 of these patients (59%),
and as expected, the proportion of tumors with these mutations did
not differ significantly among tumors of various stages (see
Materials and Methods).
[0074] A BEAMing assay was then designed for each of the mutations
identified in the 33 tumors and applied to the DNA purified from
the plasma of the corresponding patients (Table 4). In each case,
DNA from normal lymphocytes or plasma from patients without cancer
were used as negative controls. DNA from the tumors of the 33
patients was used as positive controls. All six patients with
advanced lesions (Dukes' D, defined as having at least one distant
metastatic lesion) were found to contain mutant DNA fragments in
their plasma. Among 16 patients harboring cancers with a favorable
prognosis (Dukes' A or B, defined as having no lymph node
involvement and no distant metastases), ten (63%) were found to
contain mutant DNA fragments in their plasma. In contrast, among 11
patients with large, benign tumors (adenomas), only 1 patient's
plasma was found to contain mutant DNA fragments. Representative
flow cytometric results are shown in FIG. 4 and summarized in Table
4.
[0075] The fraction of mutant molecules found in the plasma of the
17 cases with detectable mutations also varied according to tumor
stage (p<0.0001, Fisher Exact test). In the advanced cases
(Dukes' D), an average of 11.1% (range 1.9% to 27%) of the total
APC gene fragments were mutant. In patients without metastases
(Dukes' B), an average of 0.9% (range 0.03% to 1.75%) of the plasma
APC gene fragments were mutant. In patients with lower stage tumors
(Dukes' A), the fraction was even lower, averaging 0.04% (range
0.01% to 0.12%). And in the one patient with a benign tumor, only
0.02% of the plasma DNA fragments were mutant. The median fraction
of positive beads found in the control DNA samples from patients
without cancer was 0.0009% (range 0.003% to 0.0005%).
[0076] Table 4 also lists the concentration of total APC fragments
(wild-type plus mutant) in these patients' plasma. There was no
direct relationship between the concentration of total APC
fragments and the mutational load. Though patients with advanced
cancers tended to have higher concentrations of total APC fragments
than the other patients, this increase was not due to DNA from
neoplastic cells. Furthermore, no correlation was found between
tumor burden (volume of primary tumor plus metastatic sites) and
either the concentration of APC fragments or percentage of mutant
APC fragments in the circulation.
Example 6
Overview
[0077] The approach described here entails four major steps (FIG.
5).
[0078] Step 1. PCR amplification from DNA samples.
[0079] Step 2. BEAMing. Oil-in-water (w/o) emulsions are formed in
which single DNA molecules within each aqueous compartment are
amplified and bound to beads.
[0080] Step 3, Filling gaps. A padlock (6) or circularizable probe
(7, 8) was hybridized to the sequences on the beads. A 0-30 bp gap
was filled in with a polymerase and the ends ligated.
[0081] Step 4. Rolling circle amplification. Sequences to be
queried on the beads are further amplified through rolling circle
amplification.
[0082] Step 5. Single base extension. Fluorescently-labeled dideoxy
nucleotide terminators are used to distinguish beads containing
sequences that diverge at positions of interest.
[0083] Step 6. Flow cytometry. The population of beads is analyzed
to determine the proportions containing each sequence of
interest.
Materials and Methods for Examples 6-9:
Amplification of Human Genomic DNA
[0084] Phusion.TM. DNA polymerase (NEB) was used for the initial
amplification of genomic DNA unless otherwise indicated in the
text. Primers were designed to generate amplicons of 100 bp. A
universal tag (5'-tcccgcgaaattaatacgac-3'), the sequence of which
was identical to the one coated on the beads used for BEAMing, was
added to the 5' end of the forward or reverse primer. PCR was
performed in 50 ul reactions containing 10 .mu.l 5.times.
Phusion.TM. HF buffer, 0.2 mM of each dNTP, 1 .mu.M of each primer,
1.5 U Phusion.TM. DNA polymerase (NEB), and 15 .mu.l purified cell
line DNA. PCR cycling conditions were as follows: 98.degree. C. for
1 min; 3 cycles of 98.degree. C. for 10 sec, 70.degree. C. for 10
sec, 72.degree. C. for 10 sec; 3 cycles of 98.degree. C. for 10
sec, 67.degree. C. for 10 sec, 72.degree. C. for 10 sec; 3 cycles
of 98.degree. C. for 10 sec, 64.degree. C. for 10 sec, 72.degree.
C. for 10 sec; 30 cycles of 98.degree. C. for 10 sec, 61.degree. C.
for 10 sec, 72.degree. C. for 10 sec. The amount of PCR product was
quantified by using a PicoGreen.TM. dsDNA quantification kit
(Invitrogen).
[0085] BEAMing
[0086] An oligonucleotide labeled at its 5' end with a dual biotin
group was coupled to streptavidin-coated 1 micron magnetic beads
(Dynal MyOne.TM.) as described in Dressman et al. A 240 ul PCR
mixture was prepared and added to 960 .mu.l of 7% (w/v) Abil.RTM.
EM90 (Degussa AG) in mineral oil (Sigma). The PCR mixture contained
67 mM Tris-HCl pH 8.8, 16.6 mM (NH4).sub.2SO4, 6.7 mM MgCl2, 10 mM
2-mercaptoethanol, 0.2 mM of each dNTP, 0:05 .mu.M of forward
primer identical in sequence to the universal tag described above,
8 .mu.M reverse primer, 0.2 U/.mu.l Platinum.RTM. Taq polymerase
(Invitrogen), 10.times.108 oligonucleotide coupled beads and
.about.20 pg template DNA. The water-oil mixture was vortexed for
10 sec at maximum speed (Vortex Genie 2) and then emulsified for 50
sec using an Ultra-Turrax homogenizer (T25) with a disposable
OmniTip (Omni International, Inc.) at the minimum speed. The
emulsions were transferred to a 96 well PCR plate, using 100
ul/well. The PCR cycling conditions were 94.degree. C. for 2 min;
50 cycles of 94.degree. C. for 10 sec, 58.degree. C. for 15 sec,
and 70.degree. C. for 15 sec. After PCR, the emulsion was broken in
10 ml NX-SDS buffer (100 mM NaCl, 1% Triton X-100, 10 mM Tris-HCl
pH 7.5, 1 mM EDTA, 1% SDS) by centrifugation for 5 min at 4,500 g.
The beads were then incubated with 0.1 M NaOH for 2 min to remove
the non-biotinylated strand of the PCR product, collected with a
magnet, and resuspended in 1.times.PCR buffer.
[0087] Rolling Circle Amplification on the Beads
[0088] A padlock probe (100 nM) was hybridized to .about.10.sup.7
beads in 2.times.SSC, 20% formamide and 0.5 ug/ul sonicated salmon
sperm DNA at 37.degree. C. for 15 minutes. Probe was ligated in 10
U/.sup..mu.1 T4 DNA ligase (NEB), 10 mM Tris-acetate pH 7.5, 10 mM
MgAc2, 250 mM NaCl, 1 mM ATP and 0.2 ug/ul BSA at 37.degree. C. for
15 min. Beads were then resuspended in 100 ul of 1.times..phi.29
DNA polymerase reaction buffer (NEB), 0.1 ug/ul BSA and 0.3 mM dNTP
mixture containing 1 U/ul Phi29 DNA polymerase (NEB) and incubated
at 37.degree. C. from 5 min to 6 hr.
[0089] Gap-Filling Rolling Circle Amplification on the Beads
[0090] A circularizable probe (150 nM) was hybridized to
.about.10.sup.7 beads in Ampligase 1.times. Ampligase reaction
buffer (Epicentre) at 55.degree. C. for 15 min. Then, 50 uM dNTP
(USB), 0.05 U/ul Stoffel fragment DNA (Applied Biosystems) and 1
U/ul Ampligase were added and extension plus ligation performed at
55.degree. C. for 30 min. Beads were then resuspended in 100 ul of
1.times..phi.29 DNA polymerase reaction buffer (NEB), 0.1 ug/ul BSA
and 0.3 mM dNTP mixture containing 1 U/ul Phi29 DNA polymerase
(NEB) and incubated at 37.degree. C. for 1 hr unless indicated
otherwise in the text.
[0091] Detection of Amplified DNA on Beads
[0092] To detect the presence of amplified sequences on beads, a
fluorescein-labeled oligonucleotide complementary to the sequences
amplified during the RCA was hybridized to the beads in SBE buffer
(150 mM Tris-HCl pH 9.5, 67 mM MgCl2, 5% formamide) at 50.degree.
C. for 15 minutes.
[0093] To detect specific genetic mutations on the amplified DNA
attached to beads, single base extensions (SBE) were performed in
150 ul SBE buffer containing 10.sup.7 beads, a 250 nM Cy5-labeled
SBE primer, 5 .mu.M FITC-labeled ddNTP (Perkin-Elmer), 0.25 .mu.M
Rox-labeled ddNTP (Perkin-Elmer), 10 uM of each unlabeled ddNTP
(USB), and 0.4 U/.mu.l ThermoSequenase.TM. (GE Healthcare) at
50.degree. C. for 15 min. Beads were then resuspended in 200 ul 10
mM Tris, pH 7.5, 1 mM EDTA, pH 7.5.
[0094] Flow Cytometry
[0095] Beads were analyzed with a LSR II flow cytometer and data
were analyzed with FACSDiva.TM. software (BD Biosciences). The flow
rate was typically set at 5000-10,000 events per second. Events
were gated to exclude doublets and aggregates. For the calculations
of mutant frequency, only single beads exhibiting hybridization to
the SBE primer were considered.
Example 7
BEAMing
[0096] As part of the optimization process required for the success
of the experiments described below, we identified conditions that
produced relatively uniform aqueous droplets within the
water-in-oil emulsion used for BEAMing. Using compartments of
average 3 microns, we determined the relationship between the
concentration of DNA templates and the fraction of beads that were
produced from single templates. When there were two or more DNA
templates within an aqueous droplet, beads containing more than one
homogeneous DNA sequence were produced. With dilute DNA samples,
very few beads would be expected to contain any DNA template, and
most beads would therefore be "negative", i.e., not be extended. As
shown in FIG. 7, increasing DNA concentrations resulted in
progressively greater fractions of multi-template beads, as
expected. The fraction of single-template beads was maximal at
.about.30 pg of template per emulsion PCR. At this concentration,
12% of the beads were single template, 9% were double-template, and
the remaining 79% of the beads were negative. In subsequent
experiments, we therefore used 20 to 40 pg of template DNA per
reaction.
[0097] Another way to assess the quality of the beads produced by
BEAMing and their single-template nature was through mixing
experiments. For this purpose, templates containing KRAS2 and
PIK3CA templates were mixed at various ratios and the proportion of
beads containing either KRAS22 or PIK3CA extensions was measured by
flow cytometry following BEAMing. If single templates were
sufficient to generate robust PCR extension products on beads, then
there should be a linear relationship between the ratio of input
molecules and the ratio of beads containing one or the other type
of template. Conversely, if more than one template molecule was
required for extension on beads, or if a large fraction of aqueous
compartments contained more than one template molecule, then this
ratio would be skewed. For example, when the proportion of PIK3CA
template molecules was low, there would be very few beads that
contained a PIK3CA extension product that did not also contain a
KRAS2 extension product. As shown in FIGS. 8a and 8b, the results
of this mixing experiment clearly demonstrated a linear
relationship between input template ratio and bead proportions
generated, even at ratios as low as 1:1000 (R2=0.999, Slope=1.0). A
similar linear relationship was found when an independent
experiment was performed using a mixture of p53 and KRAS2 templates
(FIG. 8C, R2=0.998, Slope=1.0).
Example 8
Rolling Circle Amplification on Beads Produced by Beaming
[0098] To increase the amount of extended DNA on the beads, we
investigated a variety of approaches to rolling circle
amplification using extended PCR products on beads as templates.
The most successful of these procedures is schematically shown in
FIG. 6 detailed in the Methods section. A padlock or circularizable
probe, with ends complementary to two non-adjacent sequences on the
beads, was first annealed to the bead-bound DNA. The 0-30 bp
intervening sequence was then filled in with a polymerase and the
ends ligated. Because the 3' end of the PCR product attached to the
beads was close to the padlocked oligo (9), the 3' end could be
used as primer in a rolling circle amplification with .phi.29
polymerase. Rolling circle amplification continued linearly for at
least 6 hours, and the DNA attached to the beads could be easily
visualized in a fluorescence microscope following hybridization
with sequence-specific FAM probe (FIG. 9a). If any of the enzymatic
steps shown in FIG. 9a were eliminated, no increased signals on
beads was observed (data not shown).
[0099] In addition to the increased signal per bead shown in FIG.
9a, the signal to noise ratio obtained upon analysis of beads was
also increased. To assess the SNR, we used a fluorescein-labeled
oligonucleotide complementary to the original PCR product strand
attached to the beads. After hybridization to the original beads
produced by BEAMing, the average signal intensity was 25-fold
higher than that observed on beads that had been produced by
BEAMing with an unrelated template, yielding a SNR of 25:1.
Following RCA, the SNR increased to more than 9000-fold (FIG. 9b).
Based on the relative signals obtained, we estimated that the
length of DNA strands attached to the beads had increased from 100
bases to 40,000 bases by RCA. The reason for the SNR increase is
because the background fluorescence signal following hybridization
to beads without a complementary PCR product is due to
autofluorescence plus non-specific binding of the probe to the
beads. This background fluorescence signal is not increased much by
RCA, while the specific hybridization signal is dramatically
increased.
[0100] To ensure that the amplification procedure described in FIG.
9 (henceforth termed BEAMing Up) faithfully copied the sequences
present on the original beads, we performed emulsion PCR using
templates representing mixtures of wt and mutant DNA p53 sequences.
The mutations were located in a region of the PCR product that was
filled in by polymerase after annealing to the circularizable probe
(FIG. 6). Flow cytometric data from this experiment are shown in
FIG. 10a and graphed in FIG. 10b. From these data, it is clear that
the fraction of beads containing mutant p53 sequences was
proportional to the fraction of mutant p53 template molecules used
for BEAMing. This was true over a very broad range of input
fractions (R2=0.9998, slope=1.0). Similarly linear relationships
between input fractions and bead fractions were found with
independent emulsion PCR/RCA experiments using mutants of PIK3CA
and KRAS (FIGS. 10c, d, e).
Example 9
Error Rates of Polymerases Commonly Used for PCR
[0101] Examination of FIG. 10a shows that there were some beads
that contained homogeneous mutant p53 sequences even when the
template used to produce them was normal human genomic DNA (panel
showing 0% mutations). These apparent mutations were caused by
errors during the initial PCR used to generate the templates for
BEAMing. PCR errors introduced during the emulsion PCR or RCA steps
would not result in "mutant" beads, as such beads would be
classified as multi-template beads and therefore not included in
the analysis. However, errors during the initial PCR used to
generate templates would be indistinguishable from mutations
occurring in vivo: droplets containing such single mutant molecules
would give rise to beads containing homogeneous mutant sequences.
Accordingly, we suspected that the procedures described here could
be used to directly assess the error rates of polymerases commonly
used for PCR.
[0102] To determine error rates, we amplified exon 20 of the PIK3CA
gene from genomic DNA from a normal individual with four different
polymerases representing each of the major classes commercially
available: Platinum Taq (Invitrogen), Platinum Taq High Fidelity
(Invitrogen), PfuUltra Hotstart (Stratagene), and Phusion (NEB) DNA
polymerase. Multiple PCR reactions were carried out according to
manufacturers' recommendations. Thirty cycles were performed with
each polymerase and real-time PCR showed that the PCR products were
still increasing exponentially at this time point. Equivalent
amounts of DNA were produced from each polymerase under the
conditions used, and 20 pg of DNA was used for each BEAMing Up
reaction.
[0103] The results of these comparisons are shown in the flow
cytometric profiles illustrated in FIG. 11a and statistically
graphed in FIG. 11b. Taq had the highest error rate (3.4.times.10-5
errors per by per cycle) and the error rate of Taq High Fidelity
was just slightly less (FIG. 11b). In contrast, PfuUltra and
Phusion polymerases had dramatically lower error rates (4.5 and
5.5.times.10.sup.-7, respectively). Comparison of the errors
generated through amplification of a completely different genomic
DNA sequence (p53 exon 8) revealed qualitatively similar results
(FIG. 11C). Through the absolute error rates with all four enzymes
were slightly lower than found with the PIK3CA exon 20 amplicon,
the relative error rates of Phusion and PfuUltra were at least
18-fold lower than the other two enzymes with both amplicons.
REFERENCES
[0104] The disclosure of each reference cited is expressly
incorporated herein.
REFERENCES
[0105] 1. Vogelstein, B. & Kinzler, K. W. (2004) Nat Med 10,
789-99. [0106] 2. Smith, R. A., Cokkinides, V. & Eyre, H. J.
(2005) CA Cancer J Clin 55, 31-44; quiz 55-6. [0107] 3. Breen, N.
& Meissner, H. I. (2005) Annu Rev Public Health 26, 561-82.
[0108] 4. Ransohoff, D. F. (2005) Nat Rev Cancer 5, 142-9. [0109]
5. Kaplan, R. M. (2005) Recent Results Cancer Res 166, 315-34.
[0110] 6. Sidransky, D. (2002) Nat Rev Cancer 2, 210-9. [0111] 7.
Verma, M. & Srivastava, S. (2003) Recent Results Cancer Res
163, 72-84; discussion 264-6. [0112] 8. Jaffer, F. A. &
Weissleder, R. (2005) Jama 293, 855-62. [0113] 9. Sidransky, D.,
Von Eschenbach, A., Tsai, Y. C., Jones, P., Summerhayes, I.,
Marshall, F., Paul, M., Green, P., Hamilton, S. R., Frost, P. &
et al. (1991) Science 252, 706-9. [0114] 10. Sidransky, D., Tokino,
T., Hamilton, S. R., Kinzler, K. W., Levin, B., Frost, P. &
Vogelstein, B. (1992) Science 256, 102-5. [0115] 11. Burchill, S.
A. & Selby, P. J. (2000) J Pathol 190, 6-14. [0116] 12. Goessl,
C. (2003) Expert Rev Mol Diagn 3, 431-42. [0117] 13. Lotze, M. T.,
Wang, E., Marincola, F. M., Hanna, N., Bugelski, P. J., Burns, C.
A., Coukos, G., Damle, N., Godfrey, T. E., Howell, W. M., Panelli,
M. C., Perricone, M. A., Petricoin, E. F., Sauter, G.,
Scheibenbogen, C., Shivers, S. C., Taylor, D. L., Weinstein, J. N.
& Whiteside, T. L. (2005) J Immunother 28, 79-119. [0118] 14.
Bremnes, R. M., Sirera, R. & Camps, C. (2005) Lung Cancer 49,
1-12. [0119] 15. Muller, H. M. & Widschwendter, M. (2003)
Expert Rev Mol Diagn 3, 443-58. [0120] 16. Dressman, D., Yan, H.,
Traverso, G., Kinzler, K. W. & Vogelstein, B. (2003) Proc Natl
Acad Sci USA 100, 8817-22. [0121] 17. Ghadessy, F. J. &
Holliger, P. (2004) Protein Eng Des Sel 17, 201-4. [0122] 18.
Bernath, K., Hai, M., Mastrobattista, E., Griffiths, A. D.,
Magdassi, S. & Tawfik, D. S. (2004) Anal Biochem 325, 151-7.
[0123] 19. Leon, S. A., Shapiro, B., Sklaroff, D. M. & Yaros,
M. J. (1977) Cancer Res 37, 646-50. [0124] 20. Sozzi, G., Conte,
D., Mariani, L., La Vullo, S., Roz, L., Lombardo, C., Pierotti, M.
A. & Tavecchio, L. (2001) Cancer Res 61, 4675-8. [0125] 21.
Giacona, M. B., Ruben, G. C., Iczkowski, K. A., Roos, T. B.,
Porter, D. M. & Sorenson, G. D. (1998) Pancreas 17, 89-97.
[0126] 22. Jahr, S., Hentze, H., Englisch, S., Hardt, D.,
Fackelmayer, F. O., Hesch, R. D. & Knippers, R. (2001) Cancer
Res 61, 1659-65. [0127] 23. Kinzler, K. W. & Vogelstein, B.
(1996) Cell 87, 159-170. [0128] 24. Yu, R. Z., Geary, R. S.,
Monteith, D. K., Matson, J., Truong, L., Fitchett, J. & Levin,
A. A. (2004) J Pharm Sci 93, 48-59. [0129] 25. Lo, Y. M., Zhang,
J., Leung, T. N., Lau, T. K., Chang, A. M. & Hjelm, N. M.
(1999) Am Hum Genet. 64, 218-24. [0130] 26. Thomlinson, R. H. &
Gray, L. H. (1955) Br J Cancer 9, 539-49. [0131] 27. Cerar, A.,
Zidar, N. & Vodopivec, B. (2004) Pathol Res Pract 200, 657-62.
[0132] 28. Chen, S., Yu, L., Jiang, C., Zhao, Y., Sun, D., Li, S.,
Liao, G., Chen, Y., Fu, Q., Tao, Q., Ye, D., Hu, P., Khawli, L. A.,
Taylor, C. R., Epstein, A. L. & Ju, D. W. (2005) J Clin Oncol
23, 1538-47. [0133] 29. Leek, R. D., Landers, R. J., Harris, A. L.
& Lewis, C. E. (1999) Br J Cancer 79, 991-5. [0134] 30. Choi,
J. J., Reich, C. F., 3rd & Pisetsky, D. S. (2005) Immunology
115, 55-62. [0135] 31. Meyerhardt, J. A. & Mayer, R. J. (2005)
N Engl J Med 352, 476-87. [0136] 32. Winawer, S., Faivre, J.,
Selby, J., Bertaro, L., Chen, T. H., Kroborg, O., Levin, B.,
Mandel, J., O'Morain, C., Richards, M., Rennert, G., Russo, A.,
Saito, H., Semigfnovsky, B., Wong, B. & Smith, R. (2005) Am
Oncol 16, 31-3. [0137] 33. Lieberman, D. A. & Atkin, W. (2004)
Aliment Pharmacol Ther 19 Suppl 1, 71-6. [0138] 34. Ahlquist, D. A.
& Shuber, A. P. (2002) Clin Chim Acta 315, 157-68.
REFERENCES FOR EXAMPLES 5-9
[0138] [0139] 1. Shendure J et al. Accurate Multiplex Polony
Sequencing of an Evolved Bacterial Genome. Science. 5741, 1728-1732
(2005). [0140] 2. Margulies M et al. Genome sequencing in
microfabricated high-density picolitre reactors. Nature. 437,
376-380 (2005). [0141] 3. Khrapko K et al. Mitochondrial mutational
spectra in human cells and tissues. Proc. Natl. Acad. Sci. 94,
13798-13803 (1997). [0142] 4. Andre P, Kim A, Khrapko K &
Thilly W G. Fidelity and mutational spectrum of Pfu DNA polymerase
on a human mitochondrial DNA sequence. Genome Res. 7, 843-852
(1997). [0143] 5. Muniappan B P & Thilly W G. The DNA
Polymerase .beta. Replication Error Spectrum in the Adenomatous
Polyposis Coli Gene Contains Human Colon Tumor Mutational Hotspots.
Cancer Res. 62, 3271-3275 (2002). [0144] 6. Nilsson M et al.
Padlock probes: Circularizing oligonucleotides for localized DNA
detection. Science. 265, 2085-2088 (1994). [0145] 7. Lizardi P M et
al. Mutation detection and single-molecule counting using
isothermal rolling-circle amplification. Nat. Genet. 19, 225-232
(1998). [0146] 8. Hardenbol P et al. Multiplexed genotyping with
sequence-tagged molecular inversion probes. Nat. Biotechnol. 21,
673-678 (2003). [0147] 9. Larsson C et al. In situ genotyping
individual DNA molecules by target-primed rolling-circle
amplification of padlock probes. Nature Meth. 1, 227-232
(2004).
TABLE-US-00001 [0147] TABLE 1 Primer sequences used for fragment
sizing Patient Target Size, No. Use region, nt bp Forward primer,
5'-3' Reverse primer, 5'- 3' 29 1st PCR 3853-3952 100
GATGAAATAGGATGTAATCAGACGAC CTTCAGCTGACCTAGTTCCAATC 3853-4006 154
GATGAAATAGGATGTAATCAGACGAC TGCTGGATTTGGTTCTAGGG 3853-4049 195
GATGAAATAGGATGTAATCAGACGAC TTGTGCCTGGCTGATTCTG 3853-4155 296
GATGAAATAGGATGTAATCAGACGAC GCTAAACATGAGTGGGGTCTC 3853-4249 397
GATGAAATAGGATGTAATCAGACGAC TGCCACTTACCATTCCACTG 3510-4805 1296
ACGTCATGTGGATCAGCCTATTG GGTAATTTTGAAGCAGTCTGGGC 2nd PCR 3861-3952
92 GGATGTAATCAGACGACACAGG CTTCAGCTGACCTAGTTCCAATC Sequencing
CAGACGACACAGGAAGCAGAT 30 1st PCR 4002-4094 93 CAGCAGACTGCAGGGTTCTAG
CCACTTTTGGAGGGAGATTTC 4002-4146 145 CAGCAGACTGCAGGGTTCTAG
ATGAGTGGGGTCTCCTGAAC 4002-4206 205 CAGCAGACTGCAGGGTTCTAG
CTGGCAATCGAACGACTCTC 4002-4299 298 CAGCAGACTGCAGGGTTCTAG
CTTGGTGGCATGGTTTGTC 4002-4411 410 CAGCAGACTGCAGGGTTCTAG
TGCAGCTTGCTTAGGTCCAC 3510-4805 1296 ACGTCATGTGGATCAGCCTATTG
GGTAATTTTGAAGCAGTCTGGGC 2nd PCR 4010-4094 85
TGCAGGGTTCTAGTTTATCTTCAG CCACTTTTGGAGGGAGATTTC Sequencing
GGTTCTAGTTTATCTTCAGAATCAGC 32 1st PCR 4401-4501 99
TAAGCAAGCTGCAGTAAATGC AAAATCCATCTGGAGTACTTTCC 4401-4544 142
TAAGCAAGCTGCAGTAAATGC ATGGCTCATCGAGGCTCAG 4401-4687 285
TAAGCAAGCTGCAGTAAATGC GGTCCTTTTCAGAATCAATAGTTTT 4401-4875 473
TAAGCAAGCTGCAGTAAATGC TGCAACCTGTTTTGTGATGG 3510-4805 1296
ACGTCATGTGGATCAGCCTATTG GGTAATTTTGAAGCAGTCTGGGC 2nd PCR 4413-4501
89 GCAGTAAATGCTGCAGTTCAGAG AAAATCCATCTGGAGTACTTTCC Sequencing
TTCAGAGGGTCCAGGTTCTTC
TABLE-US-00002 TABLE 2 Primer sequences used for BEAMing Target
Size, region, nt bp Real-time PCR primer, 5'-3' Emulsion PCR
primer, 5'-3' 3791-3890 100 FWD TAGAAGATACTCCAATATGTTTTTCAAG
TCCAATATGTTTTTCAAGATGTAGTTC REV Tag-TCTGCTTCCTGTGTCGTCTG
TCCCGCGAAATTAATACGAC 3853-3952 100 FWD
Tag-GATGAAATAGGATGTAATCAGACGAC TCCCGCGAAATTAATACGAC REV
CTTCAGCTGACCTAGTTCCAATC CTTCAGCTGACCTAGTTCCAATC 3870-3977 108 FWD
Tag-TCAGACGACACAGGAAGCAG TTCGCTCACAGGATCTTCAG REV
ACTGCTGGAACTTCGCTCAC TCCCGCGAAATTAATACGAC 3952-4046 95 FWD
GATCCTGTGAGCGAAGTTCC AGCGAAGTTCCAGCAGTGTC REV
Tag-TGCCTGGCTGATTCTGAAG TCCCGCGAAATTAATACGAC 4002-4094 93 FWD
CAGCAGACTGCAGGGTTCTAG TGCAGGGTTCTAGTTTATCTTCAG REV
Tag-CCACTTTTGGAGGGAGATTTC TCCCGCGAAATTAATACGAC 4063-4155 93 FWD
Tag-TCTTCAGGAGCGAAATCTCC ATGAGTGGGGTCTCCTGAAC REV
GCTAAACATGAGTGGGGTCTC TCCCGCGAAATTAATACGAC 4085-4189 104 FWD
CCAAAAGTGGTGCTCAGACA GCTCAGACACCCAAAAGTCC REV
Tag-CAAAACTATCAAGTGAACTGACAGAAG TCCCGCGAAATTAATACGAC 4137-4239 103
FWD Tag-GACCCCACTCATGTTTAGCAG CCACTGCATGGTTCACTCTG REV
CATTCCACTGCATGGTTCAC TCCCGCGAAATTAATACGAC 4153-4248 96 FWD
AGATGTACTTCTGTCAGTTCACTTGAT CTTCTGTCAGTTCACTTGATAGTTTTG REV
Tag-GCCACTTACCATTCCACTGC TCCCGCGAAATTAATACGAC 4235-4332 98 FWD
Tag-CCATGCAGTGGAATGGTAAG AGGTGTTTTACTTCTGCTTGGTG REV
GGTGGAGGTGTTTTACTTCTGC TCCCGCGAAATTAATACGAC 4225-4322 98 FWD
CCATGCAGTGGAATGGTAAG TGGCATTATAAGCCCCAGTG REV
Tag-GGTGGAGGTGTTTTACTTCTGC TCCCGCGAAATTAATACGAC 4276-4380 105 FWD
GCCCTGGACAAACCATGC GACAAACCATGCCACCAAG REV
Tag-AGCAGTAGGTGCTTTATTTTTAGG TCCCGCGAAATTAATACGAC 4361-4455 95 FWD
Tag-AAAATAAAGCACCTACTGCTGAAAAG GGAAGAACCTGGACCCTCTG REV
AGCATCTGGAAGAACCTGGAC TCCCGCGAAATTAATACGAC 4413-4514 102 FWD
AGTAAATGCTGCAGTTCAGAGG CTGCAGTTCAGAGGGTCCAG REV
Tag-CTGGATGAACAAGAAAATCCATC TCCCGCGAAATTAATACGAC 4610-4710 101 FWD
CAGAATCAGAGCAGCCTAAAGAA GCAGCCTAAAGAATCAAATGAAA REV
Tag-ATCATCATCTGAATCATCTAATAGGTC TCCCGCGAAATTAATACGAC
TABLE-US-00003 TABLE 3 Primer sequences used for single base
extension Target normal mutant region, nt Patient No. Single base
extension primer, 5'-3' base base 3791-3890 3, 6
ATGTAGTTCATTATCATCTTTGTCATCAGCTGAAGAT G T 3853-3952 19
GACCTAGTTCCAATCTTTTCTTTTATTTCTGCTATTT G A 3870-3977 13, 29, 14, 18
CACAGGATCTTCAGCTGACCTAGTTCCAATCTTTT C A 3952-4046 24
GCACCCTAGAACCAAATCCAGCAGACTG C T 4002-4094 33
ATCAGCCAGGCACAAAGCTGTTGAATTTT C T 30 CAGCCAGGCACAAAGCTGTTGAATTTTCTT
C A 5 CAGCCAGGCACAAAGCTGTTGAATTTTCTT C G 4063-4155 23, 25
CATAGTGTTCAGGTGGACTTTTGGGTGTCT G A 4085-4189 4
TGAACACTATGTTCAGGAGACCCCACTCA T A 31 CAGGAGACCCCACTCATGTTTAGCAGATG
T A 4137-4239 12 ACGGAGCTGGCAATCGAACGACTCT C A 4153-4248 9
GTCGTTCGATTGCCAGCTCCGTT C T 4235-4332 27
GGTTTGTCCAGGGCTATCTGGAAGATCAC T G 4225-4322 2, 7
CCAGTGATCTTCCAGATAGCCCTGGA C T 4276-4380 22
GCAGAAGTAAAACACCTCCACCACCTCCT C T 8 CACCACCTCCTCAAACAGCTCAAACC A T
1, 21, 17, 11 CCACCTCCTCAAACAGCTCAAACCAAG C T 4361-4455 20
TGCAGCATTTACTGCAGCTTGCTTAGGTC C A 4413-4514 32
GAGGGTCCAGGTTCTTCCAGATGCTGATACTTTATTA C T 15, 26
CCAGGTTCTTCCAGATGCTGATACTTTATTACATTT T G 16
CAGATGCTGATACTTTATTACATTTTGCCACAGAA A G 4610-4710 28, 10
CAAATGAAAACCAAGAGAAAGAGGCAGAAAAAA C A
TABLE-US-00004 TABLE 4 Quantification of APC mutations in plasma
Sex/ # Age Dukes' Stage Diameter of Mutation identified in
Fragments/ Fragments % Mutant No. (Yr) Site (TNM-Stage) lesion (cm)
primary tumor (codon) ml plasma analysed fragments 1 M/50 Ascending
colon Adenoma 3.0 C4348T (1450) 2600 2350 0.002% 2 M/67 Descending
colon Adenoma 2.5 C4285T (1429) 5080 5080 0.001% 3 M/54 Rectum
Adenoma 4.0 G3856T (1286) 4150 4150 0.002% 4 F/82 Rectum Adenoma
3.0 4147-4148insA (1383) 1350 1350 0.001% 5 F/85 Rectum Adenoma 1.0
C4067G (1356) 4260 4260 0.001% 6 F/71 Ascending colon Adenoma 4.0
G3856T (1286) 4150 4150 0.001% 7 M/68 Cecum Adenoma 6.5 C4285T
(1429) 4760 4760 0.003% 8 M/93 Ascending colon Adenoma 0.8 A4345T
(1449) 4320 4320 0.001% 9 F/78 Ascending colon Adenoma 3.0 C4216T
(1406) 28570 28570 0.001% 10 F/59 Sigmoid colon Adenoma 5.0
4666-4667insA (1544) 2160 2160 0.002% 11 F/73 Ascending colon
Adenoma 5.0 C4348T (1460) 8000 8000 0.02% Median/Mean 4300/6300
0.02%* Mutant plasma samples per samples 1/11 (9%) analysed 12 F/81
Sigmoid colon A (T2N0M0) 4.0 G4189T (1397) 7900 12000 0.01% 13 F/75
Sigmoid colon A (T2N0M0) 2.5 3927-3931del AAAGA (1309) 2160 2160
0.001% 14 M/60 Sigmoid colon A (T2N0M0) 3.0 3927-3931del AAAGA
(1309) 4600 6900 0.04% 15 M/79 Right colic flexure A (T2N0M0) 3.0
4470delT (1490) 4600 3696 0.03% 16 M/70 Ileococal A (T2N0M0) 2.6
4481delA (1494) 6200 3105 0.07% 17 F/68 Ascending colon A (T2N0M0)
3.5 C4348T (1450) 2170 2170 0.001% 18 F/66 Sigmoid colon A (T1N0M0)
2.5 3927-3931del AAAGA (1309) 1920 1920 0.001% 19 M/68 Rectum A
(T2N0M0) 6.6 G3907T (1303) 2300 1170 0.12% Median/Mean 3500/4000
0.04%/0.04%* Mutant plasma samples per samples 5/8 (63%) analysed
20 F/65 Cecum B (T3N0M0) 3.5 G4396T (1466) 5300 5300 0.002% 21 M/71
Sigmoid colon B (T3N0M0) 3.0 C4349T (1450) 2100 1863 0.19% 22 M/37
Descending colon B (T4N0M0) 10.0 C4330T (1444) 5400 4887 1.28% 23
M/64 Sigmoid colon B (T3N0M0) 6.5 C4099T (1367) 3810 3810 0.001% 24
M/72 Sigmoid colon B (T3N0M0) 3.0 C4012T (1318) 4800 4800 0.03% 25
F/82 Hepatic flexure B (T3N0M0) 4.0 C4099T (1367) 3840 3840 1.46%
26 M/83 Ascending colon B (T3N0M0) 6.0 4470delT (1490) 1600 1404
1.75% 27 M/61 Sigmoid colon B (T3N0M0) 4.0 4260-4261delCA (1420)
4200 4200 0.001% Median/Mean 4000/3900 1.28%/0.94%* Mutant plasma
samples per samples 5/8 (63%) analysed 28 F/83 Ascending colon D
(T3N2M1) 5.0 4668-4867insA (1544) 230000 24857 5.6% 29 M/55 Sigmoid
colon D (T4N0M1) 3.0 G3925T (1309) 69600 1636 27.4% 30 F/33
Descending colon D (T4N1M1) 5.0 C4067A (1356) 18000 491 10.5% 31
M/64 Sigmoid colon D (T3N2M1) 6.0 T4161A (1387) 26000 975 1.9% 32
M/56 Rectum D (T3N2M1) 3.0 4468-4469delCA (1490) 103200 1187 18.9%
33 F/60 Rectum D (T3N2M1) 4.0 4069-4080insT (1354) 8400 850 2.0%
Median/Mean 47800/75900 8.05%/11.05%* Mutant plasma samples per
samples 6/6 (100%) analysed *Calculated only for samples in which
mutant frequency was significantly higher than in control samples,
i.e., >0.003%.
TABLE-US-00005 TABLE 5 Mutant genomic sequences analyzed Source of
genomic Nucleotide DNA Amino acid change change Colon cancer Tp53
exon 8 H273R CGT to CAT cell line Co3 Colon cancer PIK3CA exon 20
CAT to CGT cell line Co38 H1047R Colon cancer KRAS2 exon 2 G12D GGT
to GAT cell line Co4
TABLE-US-00006 TABLE 6 Primers used for analysis of p53 Tp53 1st
PCR 5'-ATCCTGAGTAGTGGTAATCTACTGG-3' forward primer Tp53 1st PCR 5'-
reverse primer TCCCGCGAAATTAATACGACTTGCGGAGAT TCTCTTCCTC-3' Tp53
emulsion 5'TGGTAATCTACTGGGACGGAAC-3' PCR forward primer Tp53
padlock 5'-Phosphate- probe GTGTTTGTGCCTGTCTTCCTTTTACGACGG
CTCTGCCTCCTGCCTGCTTCTTCGTGCCTC GTTCTCGTGTAGACTGGGACGGAACAGC-3' Tp53
hybridization 5'-FAM-GCT TTG AGG TGC GTG TTT probe GTG CC-3' Tp53
SBE primer 5'-Cy5-CCCGAACA GCTTTGAGGT GC-3'
TABLE-US-00007 TABLE 7 Primers used for analysis of PIK3CA PIK3CA
exon 20 5'- 1st PCR TCCCGCGAAATTAATACGACGCCTTAG forward primer
ATAAAACTGAGCAAGAG-3' PIK3CA exon 20 5'-GGAAGATCCAATCCATTTTTG-3' 1st
PCR reverse primer PIK3CA exon 20 5'-CAATCCATTTTTGTTGTCCAG-3'
emulsion PCR reverse primer PIK3CA exon 20 5'-Phosphate- padlock
probe ATTTGTTTCATGAAATACTTCCTTTTACG ACGGCTCTGCCTCCTGCCTGCTTCTTC
GTGCCTCGTTCTCGTGTAGATTGTTGTC CAGCCAC-3' PIK3CA exon 20 5'-FAM- TTG
TTG TCC AGC CAC hybridization CAT GA-3' primer PIK3CA exon 20 SBE
5'-Cy5- TTG TTG TCC AGC CAC primer CAT GA-3' PIK3CA exon 9 5'- 1st
PCR TCCCGCGAAATTAATACGACTGACAAA forward primer GAACAGCTCAAAGC-3'
PIK3CA exon 9 1st 5'-TCCATTTTAGCACTTACCTGTGAC-3' PCR reverse primer
PIK3CA exon 9 5'-CTTACCTGTGACTCCATAGAAAATC-3' emulsion PCR reverse
primer PIK3CA exon 9 5'-Biotin- hybridization
CCTGTGACTCCATAGAAAATCTTTCTCC primer TGCT-3'
TABLE-US-00008 TABLE 8 Primers used for analysis of KRAS2 KRAS2
exon 2 5'- 1st PCR TCCCGCGAAATTAATACGACTGACTGAATA forward primer
TAAACTTGTGGTAGTTG-3' KRAS2 exon 2 5'-CATATTCGTCCACAAAATGATTC-3' 1st
PCR reverse primer KRAS2 exon 2 5'-AATGATTCTGAATTAGCTGTATCGTC-3'
emulsion PCR reversed primer KRAS2 exon 2 5'-Phosphate- padlock
probe GCTCCAACTACCACATTCCTTTTACGACGG CTCTGCCTCCTGCCTGCTCTTCGTGCTCTC
GTTCTCGTGTAGACGGCACTCTTGCCTAC- 3' KRAS2 exon 2 5'-Cy5- GGC ACT CTT
GCC TAC SBE primer GCC AC-3'
Sequence CWU 1
1
146126DNAHomo sapiens 1gatgaaatag gatgtaatca gacgac 26226DNAHomo
sapiens 2gatgaaatag gatgtaatca gacgac 26326DNAHomo sapiens
3gatgaaatag gatgtaatca gacgac 26426DNAHomo sapiens 4gatgaaatag
gatgtaatca gacgac 26526DNAHomo sapiens 5gatgaaatag gatgtaatca
gacgac 26623DNAHomo sapiens 6acgtcatgtg gatcagccta ttg 23722DNAHomo
sapiens 7ggatgtaatc agacgacaca gg 22821DNAHomo sapiens 8cagacgacac
aggaagcaga t 21921DNAHomo sapiens 9cagcagactg cagggttcta g
211021DNAHomo sapiens 10cagcagactg cagggttcta g 211121DNAHomo
sapiens 11cagcagactg cagggttcta g 211221DNAHomo sapiens
12cagcagactg cagggttcta g 211321DNAHomo sapiens 13cagcagactg
cagggttcta g 211423DNAHomo sapiens 14acgtcatgtg gatcagccta ttg
231524DNAHomo sapiens 15tgcagggttc tagtttatct tcag 241626DNAHomo
sapiens 16ggttctagtt tatcttcaga atcagc 261721DNAHomo sapiens
17taagcaagct gcagtaaatg c 211821DNAHomo sapiens 18taagcaagct
gcagtaaatg c 211921DNAHomo sapiens 19taagcaagct gcagtaaatg c
212021DNAHomo sapiens 20taagcaagct gcagtaaatg c 212123DNAHomo
sapiens 21acgtcatgtg gatcagccta ttg 232223DNAHomo sapiens
22gcagtaaatg ctgcagttca gag 232321DNAHomo sapiens 23ttcagagggt
ccaggttctt c 212423DNAHomo sapiens 24cttcagctga cctagttcca atc
232520DNAHomo sapiens 25tgctggattt ggttctaggg 202619DNAHomo sapiens
26ttgtgcctgg ctgattctg 192721DNAHomo sapiens 27gctaaacatg
agtggggtct c 212820DNAHomo sapiens 28tgccacttac cattccactg
202923DNAHomo sapiens 29ggtaattttg aagcagtctg ggc 233023DNAHomo
sapiens 30cttcagctga cctagttcca atc 233121DNAHomo sapiens
31ccacttttgg agggagattt c 213220DNAHomo sapiens 32atgagtgggg
tctcctgaac 203320DNAHomo sapiens 33ctggcaatcg aacgactctc
203419DNAHomo sapiens 34cttggtggca tggtttgtc 193520DNAHomo sapiens
35tgcagcttgc ttaggtccac 203623DNAHomo sapiens 36ggtaattttg
aagcagtctg ggc 233721DNAHomo sapiens 37ccacttttgg agggagattt c
213823DNAHomo sapiens 38aaaatccatc tggagtactt tcc 233919DNAHomo
sapiens 39atggctcatc gaggctcag 194025DNAHomo sapiens 40ggtccttttc
agaatcaata gtttt 254120DNAHomo sapiens 41tgcaacctgt tttgtgatgg
204223DNAHomo sapiens 42ggtaattttg aagcagtctg ggc 234323DNAHomo
sapiens 43aaaatccatc tggagtactt tcc 234428DNAHomo sapiens
44tagaagatac tccaatatgt ttttcaag 284520DNAHomo sapiens 45tctgcttcct
gtgtcgtctg 204626DNAHomo sapiens 46gatgaaatag gatgtaatca gacgac
264723DNAHomo sapiens 47cttcagctga cctagttcca atc 234820DNAHomo
sapiens 48tcagacgaca caggaagcag 204920DNAHomo sapiens 49actgctggaa
cttcgctcac 205020DNAHomo sapiens 50gatcctgtga gcgaagttcc
205119DNAHomo sapiens 51tgcctggctg attctgaag 195221DNAHomo sapiens
52cagcagactg cagggttcta g 215321DNAHomo sapiens 53ccacttttgg
agggagattt c 215420DNAHomo sapiens 54tcttcaggag cgaaatctcc
205521DNAHomo sapiens 55gctaaacatg agtggggtct c 215620DNAHomo
sapiens 56ccaaaagtgg tgctcagaca 205727DNAHomo sapiens 57caaaactatc
aagtgaactg acagaag 275821DNAHomo sapiens 58gaccccactc atgtttagca g
215920DNAHomo sapiens 59cattccactg catggttcac 206027DNAHomo sapiens
60agatgtactt ctgtcagttc acttgat 276120DNAHomo sapiens 61gccacttacc
attccactgc 206220DNAHomo sapiens 62ccatgcagtg gaatggtaag
206322DNAHomo sapiens 63ggtggaggtg ttttacttct gc 226420DNAHomo
sapiens 64ccatgcagtg gaatggtaag 206522DNAHomo sapiens 65ggtggaggtg
ttttacttct gc 226618DNAHomo sapiens 66gccctggaca aaccatgc
186724DNAHomo sapiens 67agcagtaggt gctttatttt tagg 246826DNAHomo
sapiens 68aaaataaagc acctactgct gaaaag 266921DNAHomo sapiens
69agcatctgga agaacctgga c 217022DNAHomo sapiens 70agtaaatgct
gcagttcaga gg 227123DNAHomo sapiens 71ctggatgaac aagaaaatcc atc
237223DNAHomo sapiens 72cagaatcaga gcagcctaaa gaa 237327DNAHomo
sapiens 73atcatcatct gaatcatcta ataggtc 277427DNAHomo sapiens
74tccaatatgt ttttcaagat gtagttc 277520DNAHomo sapiens 75tcccgcgaaa
ttaatacgac 207620DNAHomo sapiens 76tcccgcgaaa ttaatacgac
207723DNAHomo sapiens 77cttcagctga cctagttcca atc 237820DNAHomo
sapiens 78ttcgctcaca ggatcttcag 207920DNAHomo sapiens 79tcccgcgaaa
ttaatacgac 208020DNAHomo sapiens 80agcgaagttc cagcagtgtc
208120DNAHomo sapiens 81tcccgcgaaa ttaatacgac 208224DNAHomo sapiens
82tgcagggttc tagtttatct tcag 248320DNAHomo sapiens 83tcccgcgaaa
ttaatacgac 208420DNAHomo sapiens 84atgagtgggg tctcctgaac
208520DNAHomo sapiens 85tcccgcgaaa ttaatacgac 208620DNAHomo sapiens
86gctcagacac ccaaaagtcc 208720DNAHomo sapiens 87tcccgcgaaa
ttaatacgac 208820DNAHomo sapiens 88ccactgcatg gttcactctg
208920DNAHomo sapiens 89tcccgcgaaa ttaatacgac 209027DNAHomo sapiens
90cttctgtcag ttcacttgat agttttg 279120DNAHomo sapiens 91tcccgcgaaa
ttaatacgac 209223DNAHomo sapiens 92aggtgtttta cttctgcttg gtg
239320DNAHomo sapiens 93tcccgcgaaa ttaatacgac 209420DNAHomo sapiens
94tggcattata agccccagtg 209520DNAHomo sapiens 95tcccgcgaaa
ttaatacgac 209619DNAHomo sapiens 96gacaaaccat gccaccaag
199720DNAHomo sapiens 97tcccgcgaaa ttaatacgac 209820DNAHomo sapiens
98ggaagaacct ggaccctctg 209920DNAHomo sapiens 99tcccgcgaaa
ttaatacgac 2010020DNAHomo sapiens 100ctgcagttca gagggtccag
2010120DNAHomo sapiens 101tcccgcgaaa ttaatacgac 2010223DNAHomo
sapiens 102gcagcctaaa gaatcaaatg aaa 2310320DNAHomo sapiens
103tcccgcgaaa ttaatacgac 2010437DNAHomo sapiens 104atgtagttca
ttatcatctt tgtcatcagc tgaagat 3710537DNAHomo sapiens 105gacctagttc
caatcttttc ttttatttct gctattt 3710635DNAHomo sapiens 106cacaggatct
tcagctgacc tagttccaat ctttt 3510728DNAHomo sapiens 107gcaccctaga
accaaatcca gcagactg 2810829DNAHomo sapiens 108atcagccagg cacaaagctg
ttgaatttt 2910930DNAHomo sapiens 109cagccaggca caaagctgtt
gaattttctt 3011030DNAHomo sapiens 110cagccaggca caaagctgtt
gaattttctt 3011130DNAHomo sapiens 111catagtgttc aggtggactt
ttgggtgtct 3011229DNAHomo sapiens 112tgaacactat gttcaggaga
ccccactca 2911329DNAHomo sapiens 113caggagaccc cactcatgtt tagcagatg
2911425DNAHomo sapiens 114acggagctgg caatcgaacg actct
2511523DNAHomo sapiens 115gtcgttcgat tgccagctcc gtt 2311629DNAHomo
sapiens 116ggtttgtcca gggctatctg gaagatcac 2911726DNAHomo sapiens
117ccagtgatct tccagatagc cctgga 2611829DNAHomo sapiens
118gcagaagtaa aacacctcca ccacctcct 2911926DNAHomo sapiens
119caccacctcc tcaaacagct caaacc 2612027DNAHomo sapiens
120ccacctcctc aaacagctca aaccaag 2712129DNAHomo sapiens
121tgcagcattt actgcagctt gcttaggtc 2912237DNAHomo sapiens
122gagggtccag gttcttccag atgctgatac tttatta 3712336DNAHomo sapiens
123ccaggttctt ccagatgctg atactttatt acattt 3612435DNAHomo sapiens
124cagatgctga tactttatta cattttgcca cagaa 3512533DNAHomo sapiens
125caaatgaaaa ccaagagaaa gaggcagaaa aaa 3312625DNAHomo sapiens
126atcctgagta gtggtaatct actgg 2512740DNAHomo sapiens 127tcccgcgaaa
ttaatacgac ttgcggagat tctcttcctc 4012822DNAHomo sapiens
128tggtaatcta ctgggacgga ac 2212988DNAHomo sapiens 129gtgtttgtgc
ctgtcttcct tttacgacgg ctctgcctcc tgcctgcttc ttcgtgcctc 60gttctcgtgt
agactgggac ggaacagc 8813023DNAHomo sapiens 130gctttgaggt gcgtgtttgt
gcc 2313120DNAHomo sapiens 131cccgaacagc tttgaggtgc 2013244DNAHomo
sapiens 132tcccgcgaaa ttaatacgac gccttagata aaactgagca agag
4413321DNAHomo sapiens 133ggaagatcca atccattttt g 2113421DNAHomo
sapiens 134caatccattt ttgttgtcca g 2113591DNAHomo sapiens
135atttgtttca tgaaatactt ccttttacga cggctctgcc tcctgcctgc
ttcttcgtgc 60ctcgttctcg tgtagattgt tgtccagcca c 9113620DNAHomo
sapiens 136ttgttgtcca gccaccatga 2013720DNAHomo sapiens
137ttgttgtcca gccaccatga 2013841DNAHomo sapiens 138tcccgcgaaa
ttaatacgac tgacaaagaa cagctcaaag c 4113924DNAHomo sapiens
139tccattttag cacttacctg tgac 2414025DNAHomo sapiens 140cttacctgtg
actccataga aaatc 2514132DNAHomo sapiens 141cctgtgactc catagaaaat
ctttctcctg ct 3214247DNAHomo sapiens 142tcccgcgaaa ttaatacgac
tgactgaata taaacttgtg gtagttg 4714323DNAHomo sapiens 143catattcgtc
cacaaaatga ttc 2314426DNAHomo sapiens 144aatgattctg aattagctgt
atcgtc 2614589DNAHomo sapiens 145gctccaacta ccacattcct tttacgacgg
ctctgcctcc tgcctgctct tcgtgctctc 60gttctcgtgt agacggcact cttgcctac
8914620DNAHomo sapiens 146ggcactcttg cctacgccac 20
* * * * *