Diagnosis And Treatment Of Multiple Sulfatase Deficiency And Other Sulfatase Deficiencies

von Figura; Kurt ;   et al.

Patent Application Summary

U.S. patent application number 13/528657 was filed with the patent office on 2013-01-31 for diagnosis and treatment of multiple sulfatase deficiency and other sulfatase deficiencies. This patent application is currently assigned to SHIRE HUMAN GENETIC THERAPIES, INC.. The applicant listed for this patent is Andrea Ballabio, Maria Pia Cosma, Thomas Dierks, Michael W. Heartlein, Bernhard Schmidt, Kurt von Figura. Invention is credited to Andrea Ballabio, Maria Pia Cosma, Thomas Dierks, Michael W. Heartlein, Bernhard Schmidt, Kurt von Figura.

Application Number20130028881 13/528657
Document ID /
Family ID32869644
Filed Date2013-01-31

United States Patent Application 20130028881
Kind Code A1
von Figura; Kurt ;   et al. January 31, 2013

DIAGNOSIS AND TREATMENT OF MULTIPLE SULFATASE DEFICIENCY AND OTHER SULFATASE DEFICIENCIES

Abstract

This invention relates to methods and compositions for the diagnosis and treatment of Multiple Sulfatase Deficiency (MSD) as well as other sulfatase deficiencies. More specifically, the invention relates to isolated molecules that modulate post-translational modifications on sulfatases. Such modifications are essential for proper sulfatase function.


Inventors: von Figura; Kurt; (Gottingen, DE) ; Schmidt; Bernhard; (Gottingen, DE) ; Dierks; Thomas; (Gottingen, DE) ; Heartlein; Michael W.; (Boxborough, MA) ; Ballabio; Andrea; (Naples, IT) ; Cosma; Maria Pia; (Naples, IT)
Applicant:
Name City State Country Type

von Figura; Kurt
Schmidt; Bernhard
Dierks; Thomas
Heartlein; Michael W.
Ballabio; Andrea
Cosma; Maria Pia

Gottingen
Gottingen
Gottingen
Boxborough
Naples
Naples

MA

DE
DE
DE
US
IT
IT
Assignee: SHIRE HUMAN GENETIC THERAPIES, INC.
Lexington
MA

Family ID: 32869644
Appl. No.: 13/528657
Filed: June 20, 2012

Related U.S. Patent Documents

Application Number Filing Date Patent Number
10775678 Feb 10, 2004 8227212
13528657
60447747 Feb 11, 2003

Current U.S. Class: 424/94.6 ; 435/196; 435/320.1; 435/325; 435/68.1; 536/23.2
Current CPC Class: C12Y 301/06013 20130101; A61K 2039/53 20130101; C12N 9/0051 20130101; A61P 15/08 20180101; A61P 17/00 20180101; A61P 19/00 20180101; A61P 15/00 20180101; A61P 25/02 20180101; A61K 38/00 20130101; A61K 38/465 20130101; C12N 9/16 20130101; A61K 48/0066 20130101; A61P 3/00 20180101; A61K 38/44 20130101; C12Y 108/99 20130101; A61P 43/00 20180101; C12N 9/0071 20130101; A61P 19/08 20180101; Y02A 50/30 20180101; A61P 25/00 20180101
Class at Publication: 424/94.6 ; 435/196; 536/23.2; 435/320.1; 435/68.1; 435/325
International Class: C12N 9/16 20060101 C12N009/16; C12N 15/85 20060101 C12N015/85; C12P 21/00 20060101 C12P021/00; A61P 17/00 20060101 A61P017/00; A61K 38/46 20060101 A61K038/46; A61P 3/00 20060101 A61P003/00; A61P 25/00 20060101 A61P025/00; A61P 19/00 20060101 A61P019/00; C12N 15/55 20060101 C12N015/55; C12N 5/10 20060101 C12N005/10

Claims



1.-85. (canceled)

86. A composition comprising a sulfatase produced by mammalian cells co-expressing the sulfatase and a formylglycine generating enzyme (FGE), wherein the sulfatase has increased ratio percentage of active sulfatase as compared to a control sulfatase produced by the same mammalian cells in the absence of the FGE.

87. The composition of claim 86, wherein the ratio of active sulfatase to total sulfatase is increased by at least 5% as compared to the control sulfatase produced in the absence of the FGE.

88. The composition of claim 86, wherein the mammalian cells over-express the FGE, over-express the FGE by activating the endogenous FGE, or over-express the FGE by over-expressing an exogenous FGE.

89. A composition comprising a sulfatase produced by mammalian cells with enhanced C.alpha.-formylglycine generating activity relative to wild-type cells, wherein the sulfatase has increased formation of formylglycine on the sulfatase as compared to a control sulfatase produced by the wild-type cells.

90. The composition of claim 89, wherein the mammalian cells comprise an activated endogenous formylglycine generating enzyme (FGE).

91. The composition of claim 89, wherein the mammalian cells comprise an exogenous formylglycine generating enzyme (FGE).

92. The composition of claim 89, wherein the sulfatase is selected from the group consisting of Iduronate 2-Sulfatase, Sulfamidase, N-Acetylgalactosamine 6-Sulfatase, N-Acetylglucosamine 6-Sulfatase, Arylsulfatase A, Arylsulfatase B, Arylsulfatase C, Arylsulfatase D, Arylsulfatase E, Arylsulfatase F, Arylsulfatase G, HSulf-1, HSulf-2, HSulf-3, HSulf-4, HSulf-5, and HSulf-6.

93. A method of treating a sulfatase deficiency in a subject, comprising administering into the subject a pharmaceutical composition comprising a sulfatase produced by mammalian cells co-expressing the sulfatase and a formylglycine generating enzyme (FGE), wherein the sulfatase has increased ratio percentage of active sulfatase as compared to a control sulfatase produced by the same mammalian cells in the absence of the FGE.

94. A method of treating a sulfatase deficiency in a subject, comprising administering into the subject a pharmaceutical composition comprising a sulfatase produced by mammalian cells with enhanced Ca-formylglycine generating activity relative to wild-type cells, wherein the sulfatase has increased formation of formylglycine on the sulfatase as compared to a control sulfatase produced by the wild-type cells.

95. The method of claim 93, wherein the sulfatase deficiency is selected from the group consisting of Mucopolysaccharidosis II (MPS II; Hunter Syndrome), Mucopolysaccharidosis IIIA (MPS IIIA; Sanfilippo Syndrome A), Mucopolysaccharidosis VIII (MPS VIII), Mucopolysaccharidosis IVA (MPS IVA; Morquio Syndrome A), Mucopolysaccharidosis VI (MPS VI; Maroteaux-Lamy Syndrome), Metachromatic Leukodystrophy (MLD), X-linked Recessive Chondrodysplasia Punctata 1, and X-linked Ichthyosis (Steroid Sulfatase Deficiency).

96. A sulfatase-producing cell, the cell co-expresses: (i) a sulfatase, and (ii) a Formylglycine Generating Enzyme (FGE); wherein the cell has increased C.alpha.-formylyglycine generating activity as compared to a wild-type cell resulting in an increased ratio of active sulfatase to total sulfatase produced by the cell.

97. A sulfatase produced by the sulfatase-producing cell of claim 96.

98. A pharmaceutical composition comprising a sulfatase of claim 97.

99. A method of producing activated sulfatase, comprising cultivating the sulfatase-producing cell of claim 96.

100. A polypeptide for preparing a medicament that is for use in treating a sulfatase deficiency, wherein the polypeptide has C.sub..alpha.-formylglycine generating activity and: a) has a sequence selected from the group consisting of SEQ ID NO. 2, 5, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, or amino acids 34-374 of SEQ ID NO. 2; or b) has at least 50% sequence identity with SEQ ID No 2; or c) has one or more conservative amino acid mutations relative to a polypeptide as described in a) or b) above; or d) is a fragment of a polypeptide as described in a) above; e) is a fusion protein of any of a) to d) above.

101. A nucleic acid encoding a polypeptide as described in claim 100 or a vector comprising said nucleic acid.

102. A composition or a kit comprising a polypeptide as described in claim 100 and a sulfatase.

103. A composition or a kit comprising a nucleic acid as described in claim 101.

104. A method comprising modifying a substrate so as to introduce an aldehyde group using a formylglycine generating enzyme (FGE).

105. The method of claim 104, wherein the substrate is a sulfatase comprising the sequence of X--X--X--P--S--R (SEQ ID NO:32).
Description



RELATED APPLICATIONS

[0001] This application is a continuation of prior filed, co-pending application Ser. No. 10/775,678, filed Feb. 10, 2004, which claims priority under 35 U.S.C. .sctn.119(e) from Provisional U.S. Patent Application Ser. No. 60/447,747, filed Feb. 11, 2003, and entitled DIAGNOSIS AND TREATMENT OF MULTIPLE SULFATASE DEFICIENCY AND OTHER SULFATASE DEFICIENCIES. The contents of each application are hereby expressly incorporated by reference.

FIELD OF THE INVENTION

[0002] This invention relates to methods and compositions for the diagnosis and treatment of Multiple Sulfatase Deficiency (MSD) as well as other sulfatase deficiencies. More specifically, the invention relates to isolated molecules that modulate post-translational modifications on sulfatases. Such modifications are essential for proper sulfatase function.

BACKGROUND OF THE INVENTION

[0003] Sulfatases are members of a highly conserved gene family, sharing extensive sequence homology (Franco, B., et al., Cell, 1995, 81:15-25; Parenti, G., et al., Curr. Opin. Gen. Dev., 1997, 7:386-391), a high degree of structural similarity (Bond, C. S., et al., Structure, 1997, 5:277-289; Lukatela, G., et al., Biochemistry, 1998, 37:3654-64), and a unique post-translational modification that is essential for sulfate ester cleavage (Schmidt, B., et al., Cell, 1995, 82:271-278; Selmer, T., et al., Eur. J. Biochem., 1996, 238:341-345). The post-translational modification involves the oxidation of a conserved cysteine (in eukaryotes) or serine (in certain prokaryotes) residue, at C.sub..beta., yielding L-C.sub..alpha.-formylglycine (a.k.a. FGly; 2-amino-3-oxopropanoic acid) in which an aldehyde group replaces the thiomethyl group of the side chain. The aldehyde is an essential part of the catalytic site of the sulfatase and likely acts as an aldehyde hydrate. One of the geminal hydroxyl groups accepts the sulfate during sulfate ester cleavage leading to the formation of a covalently sulfated enzyme intermediate. The other hydroxyl is required for the subsequent elimination of the sulfate and regeneration of the aldehyde group. This modification occurs in the endoplasmic reticulum during, or shortly after, import of the nascent sulfatase polypeptide and is directed by a short linear sequence surrounding the cysteine (or serine) residue to be modified. This highly conserved sequence is hexapeptide L/V-C(S)-X-P-S-R (SEQ ID NO:32), present in the N-terminal region of all eukaryotic sulfatases and most frequently carries a hydroxyl or thiol group on residue X (Dierks, T., et al., Proc. Natl. Acad. Sci. U.S.A., 1997, 94:11963-11968).

[0004] To date thirteen sulfatase genes have been identified in humans. They encode enzymes with different substrate specificity and subcellular localization such as lysosomes, Golgi and ER. Four of these genes, ARSC, ARSD, ARSE, and ARSF, encoding arylsulfatase C, D, E and F, respectively, are located within the same chromosomal region (Xp22.3). They share significant sequence similarity and a nearly identical genomic organization, indicating that they arose from duplication events that occurred recently during evolution (Franco B, et al., Cell, 1995, 81:15-25; Meroni G, et al., Hum Mol Genet, 1996, 5:423-31).

[0005] The importance of sulfatases in human metabolism is underscored by the identification of at least eight human monogenic diseases caused by the deficiency of individual sulfatase activities. Most of these conditions are lysosomal storage disorders in which phenotypic consequences derive from the type and tissue distribution of the stored material. Among them are five different types of mucopolysaccharidoses (MPS types II, IIIA, IIID, IVA, and VI) due to deficiencies of sulfatases acting on the catabolism of glycosaminoglycans (Neufeld and Muenzer, 2001, The mucopolysaccharidoses, In The Metabolic and Molecular Bases of Inherited Disease, C. R. Scriver, A. L. Beaudet, W. S. Sly, D. Valle, B. Childs, K. W. Kinzler and B. Vogelstein, eds. New York: McGraw-Hill, pp. 3421-3452), and metachromatic leukodystrophy (MLD), which is characterized by the storage of sulfolipids in the central and peripheral nervous systems leading to severe and progressive neurologic deterioration. Two additional human diseases are caused by deficiencies of non-lysosomal sulfatases. These include X-linked ichthyosis, a skin disorder due to steroid sulfatase (STS/ARSC) deficiency, and chondrodysplasia punctata, a disorder affecting bone and cartilage due to arylsulfatase E (ARSE) deficiency. Sulfatases are also implicated in drug-induced human malformation syndromes, such as Warfarin embryopathy, caused by inhibition of ARSE activity due to in utero exposure to warfarin during pregnancy.

[0006] In an intriguing human monogenic disorder, multiple sulfatase deficiency (MSD), all sulfatase activities are simultaneously defective. Consequently, the phenotype of this severe multisystemic disease combines the features observed in individual sulfatase deficiencies. Cells from patients with MSD are deficient in sulfatase activities even after transfection with cDNAs encoding human sulfatases, suggesting the presence of a common mechanism required for the activity of all sulfatases (Rommerskirch and von Figura, Proc. Natl. Acad. Sci., USA, 1992, 89:2561-2565). The post-translational modification of sulfatases was found to be defective in one patient with MSD, suggesting that this disorder is caused by a mutation in a gene, or genes, implicated in the cysteine-to-formylglycine conversion machinery (Schmidt, B., et al., Cell, 1995, 82:271-278). In spite of intense biological and medical interest, efforts aimed at the identification of this gene(s) have been hampered by the rarity of MSD patients and consequent lack of suitable familial cases to perform genetic mapping.

SUMMARY OF THE INVENTION

[0007] This invention provides methods and compositions for the diagnosis and treatment of Multiple Sulfatase Deficiency (MIM 272200), and the treatment of other sulfatase deficiencies. More specifically, we have identified a gene that encodes Formylglycine Generating Enzyme (FGE), an enzyme responsible for the unique post-translational modification occurring on sulfatases that is essential for sulfatase function (formation of L-C.sub.a-formylglycine; a.k.a. FGly and/or 2-amino-3-oxopropanoic acid). It has been discovered, unexpectedly, that mutations in the FGE gene lead to the development of Multiple Sulfatase Deficiency (MSD) in subjects. It has also been discovered, unexpectedly, that FGE enhances the activity of sulfatases, including, but not limited to, Iduronate 2-Sulfatase, Sulfamidase, N-Acetylgalactosamine 6-Sulfatase, N-Acetylglucosamine 6-Sulfatase, Arylsulfatase A, Arylsulfatase B, Arylsulfatase C, Arylsulfatase D, Arylsulfatase E, Arylsulfatase F, Arylsulfatase G, HSulf-1, HSulf-2, HSulf-3, HSulf-4, HSulf-5, and HSulf-6. In view of these discoveries, the molecules of the present invention can be used in the diagnosis and treatment of Multiple Sulfatase Deficiency as well as other sulfatase deficiencies.

[0008] Methods for using the molecules of the invention in the diagnosis of Multiple Sulfatase Deficiency, are provided.

[0009] Additionally, methods for using these molecules in vivo or in vitro for the purpose of modulating FGly formation on sulfatases, methods for treating conditions associated with such modification, and compositions useful in the preparation of therapeutic preparations for the treatment of Multiple Sulfatase Deficiency, as well as other sulfatase deficiencies, are also provided.

[0010] The present invention thus involves, in several aspects, polypeptides modulating FGly formation on sulfatases, isolated nucleic acids encoding those polypeptides, functional modifications and variants of the foregoing, useful fragments of the foregoing, as well as therapeutics and diagnostics, research methods, compositions and tools relating thereto.

[0011] According to one aspect of the invention, an isolated nucleic acid molecule selected conditions to a molecule consisting of a nucleotide sequence set forth as SEQ ID NO:1 and which code for a Formylglycine Generating Enzyme (FGE) polypeptide having C.sub..alpha.-formylglycine generating activity, (b) nucleic acid molecules that differ from the nucleic acid molecules of (a) in codon sequence due to the degeneracy of the genetic code, and (c) complements of (a) or (b), is provided. In certain embodiments, the isolated nucleic acid molecule comprises the nucleotide sequence set forth as SEQ ID NO:1. In some embodiments, the isolated nucleic acid molecule consists of the nucleotide sequence set forth as SEQ ID NO:3 or a fragment thereof.

[0012] The invention in another aspect provides an isolated nucleic acid molecule selected from the group consisting of (a) unique fragments of a nucleotide sequence set forth as SEQ ID NO:1, and (b) complements of (a), provided that a unique fragment of (a) includes a sequence of contiguous nucleotides which is not identical to any sequence selected from the sequence group consisting of: (1) sequences identical to SEQ ID NO. 4 and/or nucleotides 20-1141 of SEQ ID NO. 4, and (2) complements of (1). In any of the foregoing embodiments, complements refer to full-length complements.

[0013] In one embodiment, the sequence of contiguous nucleotides is selected from the group consisting of (1) at least two contiguous nucleotides nonidentical to the sequence group, (2) at least three contiguous nucleotides nonidentical to the sequence group, (3) at least four contiguous nucleotides nonidentical to the sequence group, (4) at least five contiguous nucleotides nonidentical to the sequence group, (5) at least six contiguous nucleotides nonidentical to the sequence group, and (6) at least seven contiguous nucleotides nonidentical to the sequence group.

[0014] In another embodiment, the fragment has a size selected from the group consisting of at least: 8 nucleotides, 10 nucleotides, 12 nucleotides, 14 nucleotides, 16 nucleotides, 18 nucleotides, 20, nucleotides, 22 nucleotides, 24 nucleotides, 26 nucleotides, 28 nucleotides, 30 nucleotides, 40 nucleotides, 50 nucleotides, 75 nucleotides, 100 nucleotides, 200 nucleotides, 1000 nucleotides and every integer length therebetween.

[0015] According to another aspect, the invention provides expression vectors, and host cells transformed or transfected with such expression vectors, comprising the nucleic acid molecules described above.

[0016] According to still another aspect, the invention provides cells expressing activated forms of the endogenous FGE gene. In one embodiment, activation of the endogenous FGE gene occurs via homologous recombination.

[0017] According to another aspect of the invention, an isolated polypeptide is provided. The isolated polypeptide is encoded by the foregoing nucleic acid molecules of the invention. In some embodiments, the isolated polypeptide is encoded by the nucleic acid of SEQ ID NO:1, giving rise to a polypeptide having the sequence of SEQ ID NO:2 that has C.sub..alpha.-formylglycine generating activity. In other embodiments, the isolated polypeptide may be a fragment or variant of the foregoing of sufficient length to represent a sequence unique within the human genome, and identifying with a polypeptide that has C.sub..alpha.-formylglycine generating activity, provided that the fragment includes a sequence of contiguous amino acids which is not identical to any sequence encoded for by a nucleic acid sequence having SEQ ID NO. 4. In another embodiment, immunogenic fragments of the polypeptide molecules described above are provided. The immunogenic fragments may or may not have C.sub..alpha.-formylglycine generating activity.

[0018] According to another aspect of the invention, isolated binding polypeptides are provided which selectively bind a polypeptide encoded by the foregoing nucleic acid molecules of the invention. Preferably the isolated binding polypeptides selectively bind a polypeptide which comprises the sequence of SEQ ID NO:2, fragments thereof, or a polypeptide belonging to the family of isolated polypeptides having C.alpha.-formylglycine generating activity described elsewhere herein. In preferred embodiments, the isolated binding polypeptides include antibodies and fragments of antibodies (e.g., Fab, F(ab).sub.2, Fd and antibody fragments which include a CDR3 region which binds selectively to the FGE polypeptide). In certain embodiments, the antibodies are human. In some embodiments, the antibodies are monoclonal antibodies. In one embodiment, the antibodies are polyclonal antisera. In further embodiments, the antibodies are humanized. In yet further embodiments, the antibodies are chimeric.

[0019] According to another aspect of the invention, a family of isolated polypeptides having C.sub..alpha.-formylglycine generating activity, are provided. Each of said polypeptides comprises from amino terminus to carboxyl terminus: (a) an amino-terminal subdomain 1; a subdomain 2; a carboxy-terminal subdomain 3 containing from 35 to 45 amino acids; and wherein subdomain 3 has at least about 75% homology and a length approximately equal to subdomain 3 of a polypeptide selected from the group consisting of SEQ ID NO. 2, 5, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, and 78. In important embodiments, subdomain 2 contains from 120 to 140 amino acids. In further important embodiments, at least 5% of the amino acids of subdomain 2 are Tryptophans. In some embodiments, subdomain 2 has at least about 50% homology to subdomain 2 of a polypeptide selected from the group consisting of SEQ ID NO. 2, 5, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, and 78. In certain embodiments, subdomain 3 of each of the polypeptides has at least between about 80% and about 100% homology to subdomain 3 of a polypeptide selected from the group consisting of SEQ ID NO. 2, 5, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, and 78.

[0020] According to a further aspect of the invention, a method for determining the level of FGE expression in a subject, is provided. The method involves measuring expression of FGE in a test sample from a subject to determine the level of FGE expression in the subject. In certain embodiments, the measured FGE expression in the test sample is compared to FGE expression in a control containing a known level of FGE expression. Expression is defined as FGE mRNA expression, FGE polypeptide expression, or FGE C.sub..alpha.-formylglycine generating activity as defined elsewhere herein. Various methods can be used to measure expression. Preferred embodiments of the invention include PCR and Northern blotting for measuring mRNA expression, FGE monoclonal antibodies or FGE polyclonal antisera as reagents to measure FGE polypeptide expression, as well as methods for measuring FGE C.sub..alpha.-formylglycine generating activity.

[0021] In certain embodiments, test samples such as biopsy samples, and biological fluids such as blood, are used as test samples. FGE expression in a test sample of a subject is compared to FGE expression in control.

[0022] According to another aspect of the invention, a method for identifying an agent useful in modulating generating activity of a molecule, is provided. The method involves (a) contacting a molecule having C.sub..alpha.-formylglycine generating activity with a candidate agent, (b) measuring C.sub..alpha.-formylglycine generating activity of the molecule, and (c) comparing the measured C.sub..alpha.-formylglycine generating activity of the molecule to a control to determine whether the candidate agent modulates C.sub..alpha.-formylglycine generating activity of the molecule, wherein the molecule is a nucleic acid molecule having the nucleotide sequence selected from the group consisting of SEQ ID NO: 1, 3, 4, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, and 80-87, or an expression product thereof (e.g., a peptide having a sequence selected from the group consisting of SEQ ID NO. 2, 5, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, and 78). In certain embodiments, the control is C.sub..alpha.-formylglycine generating activity of the molecule measured in the absence of the candidate agent.

[0023] According to still another aspect of the invention, a method of diagnosing Multiple Sulfatase Deficiency in a subject, is provided. The method involves contacting a biological sample from a subject suspected of having Multiple Sulfatase Deficiency with an agent, said agent specifically binding to a molecule selected from the group consisting of: (i) a FGE nucleic acid molecule having the nucleotide sequence of SEQ ID NO:1, 3, or 4, (ii) an expression product of the nucleic acid molecule of (i), or (iii) a fragment of the expression product of (ii); and measuring the amount of bound agent and determining therefrom if the expression of said nucleic acid molecule or of an expression product thereof is aberrant, aberrant expression being diagnostic of the Multiple Sulfatase Deficiency in the subject.

[0024] According to still another aspect of the invention, a method for diagnosing a condition characterized by aberrant expression of a nucleic acid molecule or an expression product thereof, is provided. The method involves contacting a biological sample from a subject with an agent, wherein said agent specifically binds to said nucleic acid molecule, an expression product thereof, or a fragment of an expression product thereof; and measuring the amount of bound agent and determining therefrom if the expression of said nucleic acid molecule or of an expression product thereof is aberrant, aberrant expression being diagnostic of the condition, wherein the nucleic acid molecule has the nucleotide sequence of SEQ ID NO:1 and the condition is Multiple Sulfatase Deficiency.

[0025] According to another aspect of the invention, a method for determining Multiple Sulfatase Deficiency in a subject characterized by aberrant expression of a nucleic acid molecule or an expression product thereof, is provided. The method involves monitoring a sample from a patient for a parameter selected from the group consisting of (i) a nucleic acid molecule having the nucleotide sequence of SEQ ID NO:1, 3, 4, or a nucleic acid molecule having a sequence derived from the FEG genomic locus, (ii) a polypeptide encoded by the nucleic acid molecule, (iii) a peptide derived from the polypeptide, and (iv) an antibody which selectively binds the polypeptide or peptide, as a determination of Multiple Sulfatase Deficiency in the subject. In some embodiments, the sample is a biological fluid or a tissue as described in any of the foregoing embodiments. In certain embodiments the step of monitoring comprises contacting the sample with a detectable agent selected from the group consisting of (a) an isolated nucleic acid molecule which selectively hybridizes under stringent conditions to the nucleic acid molecule of (i), (b) an antibody which selectively binds the polypeptide of (ii), or the peptide of (iii), and (c) a polypeptide or peptide which binds the antibody of (iv). The antibody, polypeptide, peptide, or nucleic acid can be labeled with a radioactive label or an enzyme. In further embodiments, the method further comprises assaying the sample for the peptide.

[0026] According to another aspect of the invention, a kit is provided. The kit comprises a package containing an agent that selectively binds to any of the foregoing FGE isolated nucleic acids, or expression products thereof, and a control for comparing to a measured value of binding of said agent any of the foregoing FGE isolated nucleic acids or expression products thereof. In some embodiments, the control is a predetermined value for comparing to the measured value. In certain embodiments, the control comprises an epitope of the expression product of any of the foregoing FGE isolated nucleic acids. In one embodiment, the kit further comprises a second agent that selectively binds to a polypeptide selected from the group consisting of Iduronate 2-Sulfatase, Sulfamidase, N-Acetylgalactosamine 6-Sulfatase, N-Acetylglucosamine 6-Sulfatase, Arylsulfatase A, Arylsulfatase B, Arylsulfatase C, Arylsulfatase D, Arylsulfatase E, Arylsulfatase F, Arylsulfatase G, HSulf-1, HSulf-2, HSulf-3, HSulf-4, HSulf-5, and HSulf-6, or a peptide thereof, and a control for comparing to a measured value of binding of said second agent to said polypeptide or peptide thereof.

[0027] According to a further aspect of the invention, a method of treating Multiple Sulfatase Deficiency, is provided. The method involves administering to a subject in need of such treatment an agent that modulates C.sub.a-formylglycine generating activity, in an amount effective to treat Multiple Sulfatase Deficiency in the subject. In some embodiments, the method further comprises co-administering an agent selected from the group consisting of a nucleic acid molecule encoding Iduronate 2-Sulfatase, Sulfamidase, N-Acetylgalactosamine 6-Sulfatase, N-Acetylglucosamine 6-Sulfatase, Arylsulfatase A, Arylsulfatase B, Arylsulfatase C, Arylsulfatase D, Arylsulfatase E, Arylsulfatase F, Arylsulfatase G, HSulf-1, HSulf-2, HSulf-3, HSulf-4, HSulf-5, or HSulf-6, an expression product of the nucleic acid molecule, and a fragment of the expression product of the nucleic acid molecule. In certain embodiments, the agent that modulates C.sub..alpha.-formylglycine generating activity is an isolated nucleic acid molecule of the invention (e.g., a nucleic acid molecule as claimed in claims 1-8, or a nucleic acid having a sequence selected from the group consisting of SEQ ID NO: 1, 3, 4, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, and 80-87). In important embodiments, the agent that modulates C.sub..alpha.-formylglycine generating activity is a peptide of the invention (e.g., a peptide as claimed in claims 11-15, 19, 20, or a peptide having a sequence selected from the group consisting of SEQ ID NO. 2, 5, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, and 78). The agent that modulates C.sub..alpha.-formylglycine generating activity may be produced by a cell expressing an endogenous and/or exogenous FGE nucleic acid molecule. In important embodiments, the endogenous FGE nucleic acid molecule may be activated.

[0028] According to one aspect of the invention, a method for increasing C.sub..alpha.-formylglycine generating activity in a subject, is provided. The method involves administering an isolated FGE nucleic acid molecule of the invention (e.g., a nucleic acid molecule as claimed in claims 1-8, or a nucleic acid having a sequence selected from the group consisting of SEQ ID NO: 1, 3, 4, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, and 80-87), and/or an expression product thereof, to a subject, in an amount effective to increase C.sub..alpha.-formylglycine generating activity in the subject.

[0029] According to one aspect of the invention, a method for treating a subject with Multiple Sulfatase Deficiency, is provided. The method involves administering to a subject in need of such treatment an agent that modulates C.sub..alpha.-formylglycine generating activity, in an amount effective to increase C.sub..alpha.-formylglycine generating activity in the subject. In some embodiments, the agent that modulates C.sub..alpha.-formylglycine generating activity is a sense nucleic acid of the invention (e.g., a nucleic acid molecule as claimed in claims 1-8, or a nucleic acid having a sequence selected from the group consisting of SEQ ID NO: 1, 3, 4, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, and 80-87). In certain embodiments, the agent that modulates C.sub..alpha.-formylglycine generating activity is an isolated polypeptide of the invention (e.g., a polypeptide as claimed in claims 11-15, 19, 20, or a peptide having a sequence selected from the group consisting of SEQ ID NO. 2, 5, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, and 78).

[0030] According to still another aspect of the invention, a method for increasing C.sub..alpha.-formylglycine generating activity in a cell, is provided. The method involves contacting the cell with an isolated nucleic acid molecule of the invention (e.g., a nucleic acid molecule as claimed in claims 1-8, or a nucleic acid having a sequence selected from the group consisting of SEQ ID NO: 1, 3, 4, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, and 80-87), or an expression product thereof, in an amount effective to increase C.sub..alpha.-formylglycine generating activity in the cell. In important embodiments, the method involves activating the endogenous FGE gene to increase C.sub..alpha.-formylglycine generating activity in the cell.

[0031] According to a further aspect of the invention, a pharmaceutical composition is provided. The composition comprises an agent comprising an isolated nucleic acid molecule of the invention (e.g., an isolated nucleic acid molecule as claimed in any one of claims 1-8, an FGE nucleic acid molecule having a sequence selected from the group consisting of SEQ ID NO: 1, 3, 4, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, and 80-87), or an expression product thereof, in a pharmaceutically effective amount to treat Multiple Sulfatase Deficiency, or an expression product thereof, in a pharmaceutically effective amount to treat Multiple Sulfatase Deficiency, and a pharmaceutically acceptable carrier.

[0032] According to one aspect of the invention, a method for identifying a candidate agent useful in the treatment of Multiple Sulfatase Deficiency, is provided. The method involves determining expression of a set of nucleic acid molecules in a cell or tissue under conditions which, in the absence of a candidate agent, permit a first amount of expression of the set of nucleic acid molecules, wherein the set of nucleic acid molecules comprises at least one nucleic acid molecule selected from the group consisting of: (a) nucleic acid molecules which hybridize under stringent conditions to a molecule consisting of a nucleotide sequence set forth as SEQ ID NO:1 and which code for a polypeptide having C.sub..alpha.-formylglycine generating activity (FGE), (b) nucleic acid molecules that differ from the nucleic acid molecules of (a) or (b) in codon sequence due to the degeneracy of the genetic code, (c) a nucleic acid molecule having a sequence selected from the group consisting of SEQ ID NO: 1, 3, 4, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, and 80-87, and (d) complements of (a) or (b) or (c), contacting the cell or tissue with the candidate agent, and detecting a test amount of expression of the set of nucleic acid molecules, wherein an increase in the test amount of expression in the presence of the candidate agent relative to the first amount of expression indicates that the candidate agent is useful in the treatment of the Multiple Sulfatase Deficiency.

[0033] According to a further aspect of the invention, methods for preparing medicaments useful in the treatment of Multiple Sulfatase Deficiency and/or other sulfatase deficiencies, are provided.

[0034] According to still another aspect of the invention, a solid-phase nucleic acid molecule array, is provided. The array consists essentially of a set of nucleic acid molecules, expression products thereof, or fragments (of either the nucleic acid or the polypeptide molecule) thereof, each nucleic acid molecule encoding for a polypeptide selected from the group consisting of SEQ ID NO. 2, 5, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, and 78, Iduronate 2-Sulfatase, Sulfamidase, N-Acetylgalactosamine 6-Sulfatase, N-Acetylglucosamine 6-Sulfatase, Arylsulfatase A, Arylsulfatase B, Arylsulfatase C, Arylsulfatase D, Arylsulfatase E, Arylsulfatase F, Arylsulfatase G, HSulf-1, HSulf-2, HSulf-3, HSulf-4, HSulf-5, and HSulf-6, fixed to a solid substrate. In some embodiments, the solid-phase array further comprises at least one control nucleic acid molecule. In certain embodiments, the set of nucleic acid molecules comprises at least one, at least two, at least three, at least four, or even at least five nucleic acid molecules, each selected from the group consisting of SEQ ID NO. 2, 5, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, and 78, Iduronate 2-Sulfatase, Sulfamidase, N-Acetylgalactosamine 6-Sulfatase, N-Acetylglucosamine 6-Sulfatase, Arylsulfatase A, Arylsulfatase B, Arylsulfatase C, Arylsulfatase D, Arylsulfatase E, Arylsulfatase F, Arylsulfatase G, HSulf-1, HSulf-2, HSulf-3, HSulf-4, HSulf-5, and HSulf-6.

[0035] According to a further aspect of the invention, a method for treating a sulfatase deficiency in a subject, is provided. The method involves administering to a subject in need of such treatment a sulfatase that has been produced according to the invention, in an amount effective to treat the sulfatase deficiency in the subject and the sulfatase deficiency is not Multiple Sulfatase Deficiency. In important embodiments, the sulfatase is produced by a cell that has been contacted with an an agent that modulates C.sub..alpha.-formylglycine generating activity. In certain embodiments, the sulfatase deficiency includes, but is not limited to, Mucopolysaccharidosis II (MPS II; Hunter Syndrome), Mucopolysaccharidosis IIIA (MPS IIIA; Sanfilippo Syndrome A), Mucopolysaccharidosis VIII (MPS VIII), Mucopolysaccharidosis IVA (MPS IVA; Morquio Syndrome A), Mucopolysaccharidosis VI (MPS VI; Maroteaux-Lamy Syndrome), Metachromatic Leukodystrophy (MLD), X-linked Recessive Chondrodysplasia Punctata 1, or X-linked Ichthyosis (Steroid Sulfatase Deficiency). In certain embodiments, the agent that modulates C.sub..alpha.-formylglycine generating activity can be a nucleic acid molecule or peptide of the invention. In one embodiment, the sulfatase and the agent that modulates C.sub..alpha.-formylglycine generating activity are co-expressed in the same cell. The sulfatase and/or the agent that modulates C.sub..alpha.-formylglycine generating activity can be endogenous or exogenous in origin. If endogenous in origin it can be activated (e.g., by insertion of strong promoter and/or other elements at the appropriates places known in the art). If exogenous, its expression can be driven by elements on the expression vector, or it can be targeted to appropriated places within the cell genome that will allow for its enhanced expression (e.g., downstream of a strong promoter).

[0036] According to another aspect of the invention, a pharmaceutical composition, is provided. The composition comprises an agent comprising an isolated nucleic acid molecule of the invention, or an expression product thereof, in a pharmaceutically effective amount to treat a sulfatase deficiency, and a pharmaceutically acceptable carrier.

[0037] According to a still further aspect of the invention, a method for increasing sulfatase activity in a cell, is provided. The method involves contacting a cell expressing a sulfatase with an isolated nucleic acid molecule of of the invention (e.g., an isolated nucleic acid molecule as claimed in any one of claims 1-8, an FGE nucleic acid molecule having a sequence selected from the group consisting of SEQ ID NO: 1, 3, 4, 45; 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, and 80-87), or an expression product thereof (e.g., a polypeptide as claimed in claims 11-15, 19, 20, or a peptide having a sequence selected from the group consisting of SEQ ID NO. 2, 5, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, and 78), in an amount effective to increase sulfatase activity in the cell. The cell may express an endogenous and/or an exogenous sulfatase. In important embodiments, the endogenous sulfatase is activated. In certain embodiments, the sulfatase is Iduronate 2-Sulfatase, Sulfamidase, N-Acetylgalactosamine 6-Sulfatase, N-Acetylglucosamine 6-Sulfatase, Arylsulfatase A, Arylsulfatase B, Arylsulfatase C, Arylsulfatase D, Arylsulfatase E, Arylsulfatase F, Arylsulfatase G, HSulf-1, HSulf-2, HSulf-3, HSulf-4, HSulf-5, and/or HSulf-6. In certain embodiments the cell is a mammalian cell.

[0038] According to another aspect of the invention, a pharmaceutical composition, is provided. The composition comprises a sulfatase that is produced by cell, in a pharmaceutically effective amount to treat a sulfatase deficiency, and a pharmaceutically acceptable carrier, wherein said cell has been contacted with an agent comprising an isolated nucleic acid molecule of the invention (e.g., as claimed in claims 1-8, or a nucleic acid molecule having a sequence selected from the group consisting of SEQ ID NO: 1, 3, 4, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, and 80-87), or an expression product thereof (e.g., a peptide selected from the group consisting of SEQ ID NO. 2, 5, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, and 78).

[0039] According to still another aspect of the invention, an isolated variant allele of a human FGE gene which encodes a variant FGE polypeptide, is provided. The isolated variant allele comprises an amino acid sequence comprising at least one variation in SEQ ID NO:2, wherein the at least one variation comprises: Met1Arg; Met1Val; Leu20Phe; Ser155Pro; Ala177Pro; Cys218Tyr; Arg224Trp; Asn259Ile; Pro266Leu; Ala279Val; Arg327Stop; Cys336Arg; Arg345Cys; Ala348Pro; Arg349Gln; Arg349Trp; Arg349Trp; Ser359Stop; or a combination thereof.

[0040] According to yet another aspect of the invention, an isolated variant human FGE polypeptide, is provided. The isolated variant human FGE polypeptide comprises an amino acid sequence comprising at least one variation in SEQ ID NO:2, wherein the at least one variation comprises: Met1Arg; Met1Val; Leu20Phe; Ser155Pro; Ala177Pro; Cys218Tyr; Arg224Trp; Asn259Ile; Pro266Leu; Ala279Val; Arg327Stop; Cys336Arg; Arg345Cys; Ala348Pro; Arg349Gln; Arg349Trp; Arg349Trp; Ser359Stop; or a combination thereof.

[0041] Antibodies having any of the foregoing variant human FGE polypeptides as an immunogen are also provided. Such antibodies include polyclonal antisera, monoclonal, chimeric, and can also be detectably labeled. A detectable label may comprise a radioactive element, a chemical which fluoresces, or an enzyme.

[0042] According to another aspect of the invention, a sulfatase-producing cell wherein the ratio of active sulfatase to total sulfatase produced by the cell is increased, is provided. The cell comprises: (i) a sulfatase with an increased expression, and (ii) a Formylglycine Generating Enzyme with an increased expression, wherein the ratio of active sulfatase to total sulfatase (i.e., the specific activity of the sulfatase) produced by the cell is increased by at least 5% over the ratio of active sulfatase to total sulfatase produced by the cell in the absence of the Formylglycine Generating Enzyme. In certain embodiments, the ratio of active sulfatase to total sulfatase produced by the cell is increased by at least 10%, 15%, 20%, 50%, 100%, 200%, 500%, 1000%, over the ratio of active sulfatase to total sulfatase produced by the cell in the absence of the Formylglycine Generating Enzyme.

[0043] According to a further aspect of the invention, an improved method for treating a sulfatase deficiency in a subject is provided. The method involves administering to a subject in need of such treatment a sulfatase in an effective amount to treat the sulfatase deficiency in the subject, wherein the sulfatase is contacted with a Formylglycine Generating Enzyme in an amount effective to increase the specific activity of the sulfatase. In an important embodiment, the sulfatase is selected from the group consisting of Iduronate 2-Sulfatase, Sulfamidase, N-Acetylgalactosamine 6-Sulfatase, N-Acetylglucosamine 6-Sulfatase, Arylsulfatase A, Arylsulfatase B, Arylsulfatase C, Arylsulfatase D, Arylsulfatase E, Arylsulfatase F, Arylsulfatase G, HSulf-1, HSulf-2, HSulf-3, HSulf-4, HSulf-5, and HSulf-6. In certain embodiments, the Formylglycine Generating Enzyme is encoded by a nucleic acid molecule as claimed in claims 1-8, or a nucleic acid having a sequence selected from the group consisting of SEQ ID NO: 1, 3, 4, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, and 80-87. In some embodiments, the Formylglycine Generating Enzyme is a peptide as claimed in claims 11-15, 19, 20, or a peptide having a sequence selected from the group consisting of SEQ ID NO. 2, 5, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, and 78.

[0044] These and other objects of the invention will be described in further detail in connection with the detailed description of the invention.

BRIEF DESCRIPTION OF THE SEQUENCES

[0045] SEQ ID NO:1 is the nucleotide sequence of the human FGE cDNA.

[0046] SEQ ID NO:2 is the predicted amino acid sequence of the translation product of human FGE cDNA (SEQ ID NO:1).

[0047] SEQ ID NO:3 is the nucleotide sequence of the human FGE cDNA encoding the polypeptide of SEQ ID NO:2 (i.e., nucleotides 20-1141 of SEQ ID NO:1).

[0048] SEQ ID NO:4 is the nucleotide sequence of GenBank Acc. No. AK075459.

[0049] SEQ ID NO:5 is the predicted amino acid sequence of the translation product of SEQ ID NO:4, an unnamed protein product having GenBank Acc.No. BAC11634.

[0050] SEQ ID NO:6 is the nucleotide sequence of the human Iduronate 2-Sulfatase cDNA (GenBank Acc. No. M58342).

[0051] SEQ ID NO:7 is the predicted amino acid sequence of the translation product of human Iduronate 2-Sulfatase cDNA (SEQ ID NO:6).

[0052] SEQ ID NO:8 is the nucleotide sequence of the human Sulfamidase cDNA (GenBank Acc. No. U30894).

[0053] SEQ ID NO:9 is the predicted amino acid sequence of the translation product of human Sulfamidase cDNA (SEQ ID NO:8).

[0054] SEQ ID NO:10 is the nucleotide sequence of the human N-Acetylgalactosamine 6-Sulfatase cDNA (GenBank Acc. No. U06088).

[0055] SEQ ID NO:11 is the predicted amino acid sequence of the translation product of human N-Acetylgalactosamine 6-Sulfatase cDNA (SEQ ID NO:10).

[0056] SEQ ID NO:12 is the nucleotide sequence of the human N-Acetylglucosamine 6-Sulfatase cDNA (GenBank Acc. No. Z12173).

[0057] SEQ ID NO:13 is the predicted amino acid sequence of the translation product of human N-Acetylglucosamine 6-Sulfatase cDNA (SEQ ID NO:12).

[0058] SEQ ID NO:14 is the nucleotide sequence of the human Arylsulfatase A cDNA (GenBank Acc. No. X52151).

[0059] SEQ ID NO:15 is the predicted amino acid sequence of the translation product of human Arylsulfatase A cDNA (SEQ ID NO:14).

[0060] SEQ ID NO:16 is the nucleotide sequence of the human Arylsulfatase B cDNA (GenBank Acc. No. J05225).

[0061] SEQ ID NO:17 is the predicted amino acid sequence of the translation product of human Arylsulfatase B cDNA (SEQ ID NO:16).

[0062] SEQ ID NO:18 is the nucleotide sequence of the human Arylsulfatase C cDNA (GenBank Acc. No. J04964).

[0063] SEQ ID NO:19 is the predicted amino acid sequence of the translation product of human Arylsulfatase C cDNA (SEQ ID NO:18).

[0064] SEQ ID NO:20 is the nucleotide sequence of the human Arylsulfatase D cDNA (GenBank Acc. No. X83572).

[0065] SEQ ID NO:21 is the predicted amino acid sequence of the translation product of human Arylsulfatase D cDNA (SEQ ID NO:20).

[0066] SEQ ID NO:22 is the nucleotide sequence of the human Arylsulfatase E cDNA (GenBank Acc. No. X83573).

[0067] SEQ ID NO:23 is the predicted amino acid sequence of the translation product of human Arylsulfatase E cDNA (SEQ ID NO:22).

[0068] SEQ ID NO:24 is the nucleotide sequence of the human Arylsulfatase F cDNA (GenBank Acc. No. X97868).

[0069] SEQ ID NO:25 is the predicted amino acid sequence of the translation product of human Arylsulfatase F cDNA (SEQ ID NO:24).

[0070] SEQ ID NO:26 is the nucleotide sequence of the human Arylsulfatase G cDNA (GenBank Acc.No. BC012375).

[0071] SEQ ID NO:27 is the predicted amino acid sequence of the translation product of the human Arylsulfatase G (SEQ ID NO:26).

[0072] SEQ ID NO:28 is the nucleotide sequence of the HSulf-1 cDNA (GenBank Acc.No. AY101175).

[0073] SEQ ID NO:29 is the predicted amino acid sequence of the translation product of HSulf-1 cDNA (SEQ ID NO:28).

[0074] SEQ ID NO:30 is the nucleotide sequence of the HSulf-2 cDNA (GenBank Acc.No. AY 101176).

[0075] SEQ ID NO:31 is the predicted amino acid sequence of the translation product of HSulf-2 cDNA (SEQ ID NO:30).

[0076] SEQ ID NO:32 is the highly conserved hexapeptide L/V-FGly-X-P-S-R present on sulfatases.

[0077] SEQ ID NO:33 is a synthetic FGly formation substrate; its primary sequence is derived from human Arylsulfatase A.

[0078] SEQ ID NO:34 is scrambled oligopeptide PVSLPTRSCAALLTGR.

[0079] SEQ ID NO:35 is Ser69 oligopeptide PVSLSTPSRAALLTGR.

[0080] SEQ ID NO:36 is human FGE-specific primer 1199nc.

[0081] SEQ ID NO:37 is human FGE-specific forward primer 1c.

[0082] SEQ ID NO:38 is human FGE-specific reverse primer 1182c.

[0083] SEQ ID NO:39 is human 5'-FGE-specific primer containing EcoRI site. SEQ ID NO:40 is a HA-specific primer.

[0084] SEQ ID NO:41 is a c-myc -specific primer.

[0085] SEQ ID NO:42 is a RGS-His6-specific primer.

[0086] SEQ ID NO:43 is tryptic oligopeptide SQNTPDSSASNLGFR from a human FGE preparation.

[0087] SEQ ID NO:44 is tryptic oligopeptide MVPIPAGVFTMGTDDPQIK from a human FGE preparation.

[0088] SEQ ID NO:45 is the nucleotide sequence of the human FGE2 paralog (GenBank GI: 24308053).

[0089] SEQ ID NO:46 is the predicted amino acid sequence of the translation product of the human FGE2 paralog (SEQ ID NO:45).

[0090] SEQ ID NO:47 is the nucleotide sequence of the mouse FGE paralog (GenBank GI: 26344956).

[0091] SEQ ID NO:48 is the predicted amino acid sequence of the translation product of the mouse FGE paralog (SEQ ID NO:47).

[0092] SEQ ID NO:49 is the nucleotide sequence of the mouse FGE ortholog (GenBank GI: 22122361).

[0093] SEQ ID NO:50 is the predicted amino acid sequence of the translation product of the mouse FGE ortholog (SEQ ID NO:49).

[0094] SEQ ID NO:51 is the nucleotide sequence of the fruitfly FGE ortholog (GenBank GI: 20130397).

[0095] SEQ ID NO:52 is the predicted amino acid sequence of the translation product of the fruitfly FGE ortholog (SEQ ID NO:51).

[0096] SEQ ID NO:53 is the nucleotide sequence of the mosquito FGE ortholog (GenBank GI: 21289310).

[0097] SEQ ID NO:54 is the predicted amino acid sequence of the translation product of the mosquito FGE ortholog (SEQ ID NO:53).

[0098] SEQ ID NO:55 is the nucleotide sequence of the closely related S. coelicolor FGE ortholog (GenBank GI: 21225812).

[0099] SEQ ID NO:56 is the predicted amino acid sequence of the translation S. coelicolor FGE ortholog (SEQ ID NO:55).

[0100] SEQ ID NO:57 is the nucleotide sequence of the closely related C. ortholog (GenBank GI: 25028125).

[0101] SEQ ID NO:58 is the predicted amino acid sequence of the translation C. efficiens FGE ortholog (SEQ ID NO:57).

[0102] SEQ ID NO:59 is the nucleotide sequence of the N. aromaticivorans (GenBank GI: 23108562).

[0103] SEQ ID NO:60 is the predicted amino acid sequence of the translation N. aromaticivorans FGE ortholog (SEQ ID NO:59).

[0104] SEQ ID NO:61 is the nucleotide sequence of the M. loti FGE ortholog 13474559).

[0105] SEQ ID NO:62 is the predicted amino acid sequence of the translation M. loti FGE ortholog (SEQ ID NO:61).

[0106] SEQ ID NO:63 is the nucleotide sequence of the B. fungorum (GenBank GI: 22988809).

[0107] SEQ ID NO:64 is the predicted amino acid sequence of the translation B. fungorum FGE ortholog (SEQ ID NO:63).

[0108] SEQ ID NO:65 is the nucleotide sequence of the S. meliloti FGE orth GI: 16264068).

[0109] SEQ ID NO:66 is the predicted amino acid sequence of the translation S. meliloti FGE ortholog (SEQ ID NO:65).

[0110] SEQ ID NO:67 is the nucleotide sequence of the Microscilla sp. (GenBank GI: 14518334).

[0111] SEQ ID NO:68 is the predicted amino acid sequence of the translation Microscilla sp. FGE ortholog (SEQ ID NO:67).

[0112] SEQ ID NO:69 is the nucleotide sequence of the P. putida KT2440 (GenBank GI: 26990068).

[0113] SEQ ID NO:70 is the predicted amino acid sequence of the translation P. putida KT2440 FGE ortholog (SEQ ID NO:69).

[0114] SEQ ID NO:71 is the nucleotide sequence of the R. metallidurans (GenBank GI: 22975289).

[0115] SEQ ID NO:72 is the predicted amino acid sequence of the translation R. metallidurans FGE ortholog (SEQ ID NO:71).

[0116] SEQ ID NO:73 is the nucleotide sequence of the P. marinus FGE ortholog (GenBank GI: 23132010).

[0117] SEQ ID NO:74 is the predicted amino acid sequence of the translation product of the P. marinus FGE ortholog (SEQ ID NO:73).

[0118] SEQ ID NO:75 is the nucleotide sequence of the C. crescentus CB15 FGE ortholog (GenBank GI: 16125425).

[0119] SEQ ID NO:76 is the predicted amino acid sequence of the translation product of the C. crescentus CB15 FGE ortholog (SEQ ID NO:75).

[0120] SEQ ID NO:77 is the nucleotide sequence of the M. tuberculosis Ht37Rv FGE ortholog (GenBank GI: 15607852).

[0121] SEQ ID NO:78 is the predicted amino acid sequence of the translation product of the M. tuberculosis Ht37Rv FGE ortholog (SEQ ID NO:77).

[0122] SEQ ID NO:79 is the highly conserved heptapeptide present on subdomain 3 of FGE orthologs and paralogs.

[0123] SEQ ID NO:80 is the nucleotide sequence of FGE ortholog EST fragment having GenBank Acc. No.: CA379852.

[0124] SEQ ID NO:81 is the nucleotide sequence of FGE ortholog EST fragment having GenBank Acc. No.: A1721440.

[0125] SEQ ID NO:82 is the nucleotide sequence of FGE ortholog EST fragment having GenBank Acc. No.: BJ505402.

[0126] SEQ ID NO:83 is the nucleotide sequence of FGE ortholog EST fragment having GenBank Acc. No.: BJ054666.

[0127] SEQ ID NO:84 is the nucleotide sequence of FGE ortholog EST fragment having GenBank Acc. No.: AL892419.

[0128] SEQ ID NO:85 is the nucleotide sequence of FGE ortholog EST fragment having GenBank Acc. No.: CA064079.

[0129] SEQ ID NO:86 is the nucleotide sequence of FGE ortholog EST fragment having GenBank Acc. No.: BF189614.

[0130] SEQ ID NO:87 is the nucleotide sequence of FGE ortholog EST fragment having GenBank Acc. No.: AV609121.

[0131] SEQ ID NO:88 is the nucleotide sequence of the HSulf-3 cDNA.

[0132] SEQ ID NO:89 is the predicted amino acid sequence of the translation product of HSulf-3 cDNA (SEQ ID NO:88).

[0133] SEQ ID NO:90 is the nucleotide sequence of the HSulf-4 cDNA.

[0134] SEQ ID NO:91 is the predicted amino acid sequence of the translation product of HSulf-4 cDNA (SEQ ID NO:90).

[0135] SEQ ID NO:92 is the nucleotide sequence of the HSulf-5 cDNA.

[0136] SEQ ID NO:93 is the predicted amino acid sequence of the translation product of HSulf-5 cDNA (SEQ ID NO:92).

[0137] SEQ ID NO:94 is the nucleotide sequence of the HSulf-6 cDNA.

[0138] SEQ ID NO:95 is the predicted amino acid sequence of the translation product of HSulf-6 cDNA (SEQ ID NO:94).

BRIEF DESCRIPTION OF THE DRAWINGS

[0139] FIG. 1: A MALDI-TOF mass spectra schematic of P23 after incubation in the absence (A) or presence (B) of a soluble extract from bovine testis microsomes.

[0140] FIG. 2: A phylogenetic tree derived from an alignment of human FGE and 21 proteins of the PFAM-DUF323 seed.

[0141] FIG. 3: Organisation of the human and murine FGE gene locus. Exons are shown to scale as boxes and bright boxes (murine locus). The numbers above the intron lines indicate the size of the introns in kilobases.

[0142] FIG. 4: Diagram showing a map of FGE Expression Plasmid pXMG.1.3

[0143] FIG. 5: Bar graph depicting N-Acetylgalactosamine 6-Sulfatase Activity in 36F Cells Transiently Transfected with FGE Expression Plasmid.

[0144] FIG. 6: Bar graph depicting N-Acetylgalactosamine 6-Sulfatase Specific Activity in 36F Cells Transiently Transfected with FGE Expression Plasmid.

[0145] FIG. 7: Bar graph depicting N-Acetylgalactosamine 6-Sulfatase Production in 36F Cells Transiently Transfected with FGE Expression Plasmid.

[0146] FIG. 8: Graph depicting Iduronate 2-Sulfatase Activity in 3006 Cells Transiently Transfected with FGE Expression Plasmid.

[0147] FIG. 9: Depicts a kit embodying features of the present invention.

DETAILED DESCRIPTION OF THE INVENTION

[0148] The invention involves the discovery of the gene that encodes Formylglycine Generating Enzyme (FGE), an enzyme responsible for the unique post-translational modification occurring on sulfatases that is essential for sulfatase function: the formation of L-C.sub..alpha.formylglycine (a.k.a. FGly and/or 2-amino-3-oxopropanoic acid). It has been discovered, unexpectedly, that mutations in the FGE gene lead to the development of Multiple Sulfatase Deficiency (MSD) in subjects. It has also been discovered, unexpectedly, that FGE enhances the activity of sulfatases, including, but not limited to, Iduronate 2-Sulfatase, Sulfamidase, N-Acetylgalactosamine 6-Sulfatase, N-Acetylglucosamine 6-Sulfatase, Arylsulfatase A, Arylsulfatase B, Arylsulfatase C, Arylsulfatase D, Arylsulfatase E, Arylsulfatase F, Arylsulfatase G, HSulf-1, HSulf-2, HSulf-3, HSulf-4, HSulf-5, and HSulf-6, and sulfatases described in U.S. Provisional applications with publication numbers 20030073118, 20030147875, 20030148920, 20030162279, and 20030166283 (the contents of which are expressly incorporated herein). In view of these discoveries, the molecules of the present invention can be used in the diagnosis and/or treatment of Multiple Sulfatase Deficiency, as well as the treatment of other sulfatase deficiencies.

[0149] Methods for using the molecules of the invention in the diagnosis of Multiple Sulfatase Deficiency are provided.

[0150] Additionally, methods for using these molecules in vivo or in vitro for the purpose of modulating FGly formation on sulfatases, methods for treating conditions associated with such modification, and compositions useful in the preparation of therapeutic preparations for the treatment of Multiple Sulfatase Deficiency as well as other sulfatase deficiencies, are also provided.

[0151] The present invention thus involves, in several aspects, polypeptides modulating FGly formation on sulfatases, isolated nucleic acids encoding those polypeptides, functional modifications and variants of the foregoing, useful fragments of the foregoing, as well as therapeutics and diagnostics, research methods, compositions and tools relating thereto.

[0152] "C.sub..alpha.-formylglycine generating activity" refers to the ability of a molecule to form, or enhance the formation of, FGly on a substrate. The substate may be a sulfatase as described elsewhere herein, or a synthetic oligopeptide (see, e.g., SEQ ID NO:33, and the Examples). The substrate preferably contains the conserved hexapeptide of SEQ ID NO:32 [L/V-C(S)-X-P-S-R]. Methods for assaying FGly formation are as described in the art (see, e.g., Dierks, T., et al., Proc. Natl. Acad. Sci. U.S.A., 1997, 94:11963-11968), and elsewhere herein (see, e.g., the Examples). A "molecule," as used herein, embraces both "nucleic acids" and "polypeptides." FGE molecules are capable of forming, or enhancing/increasing formation of, FGly both in vivo and in vitro.

[0153] "Enhancing (or "increasing")" C.sub..alpha.-formylglycine generating activity, as used herein, typically refers to increased expression of FGE and/or its encoded polypeptide. Increased expression refers to increasing (i.e., to a detectable extent) replication, transcription, and/or translation of any of the nucleic acids of the invention (FGE nucleic acids as described elsewhere herein), since upregulation of any of these processes results in concentration/amount increase of the polypeptide encoded by the gene (nucleic acid). Enhancing (or increasing) C.sub..alpha.-formylglycine generating activity also refers to preventing or inhibiting FGE degradation (e.g., via increased ubiquitinization), downregulation, etc., resulting, for example, in increased or stable FGE molecule t.sub.1/2 (half-life) when compared to a control. Downregulation or decreased expression refers to decreased expression of a gene and/or its encoded polypeptide. The upregulation or downregulation of gene expression can be directly determined by detecting an increase or decrease, respectively, in the level of mRNA for the gene (e.g, FGE), or the level of protein expression of the gene-encoded polypeptide, using any suitable means known to the art, such as nucleic acid hybridization or antibody detection methods, respectively, and in comparison to controls. Upregulation or downregulation of FGE gene expression can also be determined indirectly by detecting a change in C.sub..alpha.-formylglycine generating activity.

[0154] "Expression," as used herein, refers to nucleic acid and/or polypeptide expression, as well as to activity of the polypeptide molecule (e.g., C.sub..alpha.-formylglycine generating activity of the molecule).

[0155] One aspect of the invention involves the cloning of a cDNA encoding FGE. FGE according to the invention is an isolated nucleic acid molecule that comprises a nucleic acid molecule of SEQ ID NO:1, and codes for a polypeptide with C.sub..alpha.-formylglycine generating activity. The sequence of the human FGE cDNA is presented as SEQ ID NO:1, and the predicted amino acid sequence of this cDNA's encoded protein product is presented as SEQ ID NO:2.

[0156] As used herein, a subject is a mammal or a non-human mammal. In all embodiments human FGE and human subjects are preferred.

[0157] The invention thus involves in one aspect an isolated FGE polypeptide, the cDNA encoding this polypeptide, functional modifications and variants of the foregoing, useful fragments of the foregoing, as well as diagnostics and therapeutics relating thereto.

[0158] As used herein with respect to nucleic acids, the term "isolated" means: (i) amplified in vitro by, for example, polymerase chain reaction (PCR); (ii) recombinantly produced by cloning; (iii) purified, as by cleavage and gel separation; or (iv) synthesized by, for example, chemical synthesis. An isolated nucleic acid is one which is readily manipulated by recombinant DNA techniques well known in the art. Thus, a nucleotide sequence contained in a vector in which 5' and 3' restriction sites are known or for which polymerase chain reaction (PCR) primer sequences have been disclosed is considered isolated but a nucleic acid sequence existing in its native state in its natural host is not. An isolated nucleic acid may be substantially purified, but need not be. For example, a nucleic acid that is isolated within a cloning or expression vector is not pure in that it may comprise only a tiny percentage of the material in the cell in which it resides. Such a nucleic acid is isolated, however, as the term is used herein because it is readily manipulated by standard techniques known to those of ordinary skill in the art.

[0159] As used herein with respect to polypeptides, the term "isolated" means separated from its native environment in sufficiently pure form so that it can be manipulated or used for any one of the purposes of the invention. Thus, isolated means sufficiently pure to be used (i) to raise and/or isolate antibodies, (ii) as a reagent in an assay, (iii) for sequencing, (iv) as a therapeutic, etc.

[0160] According to the invention, isolated nucleic acid molecules that code for a FGE polypeptide having C.sub..alpha.-formylglycine generating activity include: (a) nucleic acid molecules which hybridize under stringent conditions to a molecule consisting of a nucleic acid of SEQ ID NO:1 and which code for a FGE polypeptide having C.sub..alpha.-formylglycine generating activity, (b) deletions, additions and substitutions of (a) which code for a respective FGE polypeptide having C.sub..alpha.-formylglycine generating activity, (c) nucleic acid molecules that differ from the nucleic acid molecules of (a) or (b) in codon sequence due to the degeneracy of the genetic code, and (d) complements of (a), (b) or (c). "Complements," as used herein, includes "full-length complementary strands or 100% complementary strands of (a), (b) or (c).

[0161] Homologs and alleles of the FGE nucleic acids of the invention also having C.sub..alpha.-formylglycine generating activity are encompassed by the present invention. Homologs, as described herein, include the molecules identified elsewhere herein (see e.g., SEQ ID NOs:4, 5, 45-78, and 80-87) i.e. orthologs and paralogs. Further homologs can be identified following the teachings of the present invention as well as by conventional techniques. Since the FGE homologs described herein all share C.sub..alpha.-formylglycine generating activity, they can be used interchangeably with the human FGE molecule in all aspects of the invention.

[0162] Thus, an aspect of the invention is those nucleic acid sequences which code for FGE polypeptides and which hybridize to a nucleic acid molecule consisting of the coding region of SEQ ID NO:1, under stringent conditions. In an important embodiment, the term "stringent conditions," as used herein, refers to parameters with which the art is familiar. With nucleic acids, hybridization conditions are said to be stringent typically under conditions of low ionic strength and a temperature just below the melting temperature (T.sub.m of the DNA hybrid complex (typically, about 3.degree. C. below the T.sub.m of the hybrid). Higher stringency makes for a more specific correlation between the probe sequence and the target. Stringent conditions used in the hybridization of nucleic acids are well known in the art and may be found in references which compile such methods, e.g. Molecular Cloning: A Laboratory Manual, J. Sambrook, et al., eds., Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989, or Current Protocols in Molecular Biology, F. M. Ausubel, et al., eds., John Wiley & Sons, Inc., New York. An example of "stringent conditions" is hybridization at 65.degree. C. in 6.times.SSC. Another example of stringent conditions is hybridization at 65.degree. C. in hybridization buffer that consists of 3.5.times.SSC, 0.02% Ficoll, 0.02% polyvinyl pyrolidone, 0.02% Bovine Serum Albumin, 2.5 mM NaH.sub.2PO.sub.4[pH7], 0.5% SDS, 2mM EDTA. (SSC is 0.15M sodium chloride/0.15M sodium citrate, pH7; SDS is sodium dodecyl sulphate; and EDTA is ethylenediaminetetracetic acid). After hybridization, the membrane upon which the DNA is transferred is washed at 2.times.SSC at room temperature and then at 0.1.times.SSC/0.1.times. SDS at temperatures up to 68.degree. C. In a further example, an alternative to the use of an aqueous hybridization solution is the use of a formamide hybridization solution. Stringent hybridization conditions can thus be achieved using, for example, a 50% formamide solution and 42.degree. C. There are other conditions, reagents, and so forth which can be used, and would result in a similar degree of stringency. The skilled artisan will be familiar with such conditions, and thus they are not given here. It will be understood, however, that the skilled artisan will be able to manipulate the conditions in a manner to permit the clear identification of homologs and alleles of FGE nucleic acids of the invention. The skilled artisan also is familiar with the methodology for screening cells and libraries for expression of such molecules which then are routinely isolated, followed by isolation of the pertinent nucleic acid molecule and sequencing.

[0163] In general homologs and alleles typically will share at least 40% nucleotide identity and/or at least 50% amino acid identity to SEQ ID NO:1 and SEQ ID NO:2, respectively, in some instances will share at least 50% nucleotide identity and/or at least 65% amino acid identity and in still other instances will share at least 60% nucleotide identity and/or at least 75% amino acid identity. In further instances, homologs and alleles typically will share at least 90%, 95%, or even 99% nucleotide identity and/or at least 95%, 98%, or even 99% amino acid identity to SEQ ID NO:1 and SEQ ID NO:2, respectively. The homology can be calculated using various, publicly available software tools developed by NCBI (Bethesda, Maryland). Exemplary tools include the heuristic algorithm of Altschul SF, et al., (J Mol Biol, 1990, 215:403-410), also known as BLAST. Pairwise and ClustalW alignments (BLOSUM30 matrix setting) as well as Kyte-Doolittle hydropathic analysis can be obtained using public (EMBL, Heidelberg, Germany) and commercial (e.g., the MacVector sequence analysis software from Oxford Molecular Group/enetics Computer Group, Madison, Wis.). Watson-Crick complements of the foregoing nucleic acids also are embraced by the invention.

[0164] In screening for FGE related genes, such as homologs and alleles of FGE, a Southern blot may be performed using the foregoing conditions, together with a radioactive probe. After washing the membrane to which the DNA is finally transferred, the membrane can be placed against X-ray film or a phosphoimager plate to detect the radioactive signal.

[0165] Given the teachings herein of a full-length human FGE cDNA clone, other mammalian sequences such as the mouse cDNA clone corresponding to the human FGE gene can be isolated from a cDNA library, using standard colony hybridization techniques.

[0166] The invention also includes degenerate nucleic acids which include alternative codons to those present in the native materials. For example, serine residues are encoded by the codons TCA, AGT, TCC, TCG, TCT and AGC. Thus, it will be apparent to one of ordinary skill in the art that any of the serine-encoding nucleotide triplets may be employed to direct the protein synthesis apparatus, in vitro or in vivo, to incorporate a serine residue into an elongating FGE polypeptide. Similarly, nucleotide sequence triplets which encode other amino acid residues include, but are not limited to: CCA, CCC, CCG and CCT (proline codons); CGA, CGC, CGG, CGT, AGA and AGG (arginine codons); ACA, ACC, ACG and ACT (threonine codons); AAC and AAT (asparagine codons); and ATA, ATC and ATT (isoleucine codons). Other amino acid residues may be encoded similarly by multiple nucleotide sequences. Thus, the invention embraces degenerate nucleic acids that differ from the biologically isolated nucleic acids in codon sequence due to the degeneracy of the genetic code.

[0167] The invention also provides isolated unique fragments of SEQ ID NO:1 or SEQ ID NO:3 or complements of thereof. A unique fragment is one that is a `signature` for the larger nucleic acid. For example, the unique fragment is long enough to assure that its precise sequence is not found in molecules within the human genome outside of the FGE nucleic acids defined above (and human alleles). Those of ordinary skill in the art may apply no more than routine procedures to determine if a fragment is unique within the human genome. Unique fragments, however, exclude fragments completely composed of the nucleotide sequences selected from the group consisting of SEQ ID NO:4, and/or other previously published sequences as of the filing date of this application.

[0168] A fragment which is completely composed of the sequence described in the foregoing GenBank deposits is one which does not include any of the nucleotides unique to the sequences of the invention. Thus, a unique fragment according to the invention must contain a nucleotide sequence other than the exact sequence of those in the GenBank deposits or fragments thereof. The difference may be an addition, deletion or substitution with respect to the GenBank sequence or it may be a sequence wholly separate from the GenBank sequence.

[0169] Unique fragments can be used as probes in Southern and Northern blot assays to identify such nucleic acids, or can be used in amplification assays such as those employing PCR. As known to those skilled in the art, large probes such as 200, 250, 300 or more nucleotides are preferred for certain uses such as Southern and Northern blots, while smaller fragments will be preferred for uses such as PCR. Unique fragments also can be used to produce fusion proteins for generating antibodies or determining binding of the polypeptide fragments, as demonstrated in the Examples, or for generating immunoassay components Likewise, unique fragments can be employed to produce nonfused fragments of the FGE polypeptides, useful, for example, in the preparation of antibodies, immunoassays or therapeutic applications. Unique fragments further can be used as antisense molecules to inhibit the expression of FGE nucleic acids and polypeptides respectively.

[0170] As will be recognized by those skilled in the art, the size of the unique fragment will depend upon its conservancy in the genetic code. Thus, some regions of SEQ ID NO:1 or SEQ ID NO:3 and complements will require longer segments to be unique while others will require only short segments, typically between 12 and 32 nucleotides long (e.g. 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 and 32 bases) or more, up to the entire length of the disclosed sequence. As mentioned above, this disclosure intends to embrace each and every fragment of each sequence, beginning at the first nucleotide, the second nucleotide and so on, up to 8 nucleotides short of the end, and ending anywhere from nucleotide number 8, 9, 10 and so on for each sequence, up to the very last nucleotide, (provided the sequence is unique as described above). Virtually any segment of the region of SEQ ID NO:1 beginning at nucleotide 1 and ending at nucleotide 1180, or SEQ ID NO:3 beginning at nucleotide 1 and ending at nucleotide 1122, or complements thereof, that is 20 or more nucleotides in length will be unique. Those skilled in the art are well versed in methods for selecting such sequences, typically on the basis of the ability of the unique fragment to selectively distinguish the sequence of interest from other sequences in the human genome of the fragment to those on known databases typically is all that is necessary, although in vitro confirmatory hybridization and sequencing analysis may be performed.

[0171] As mentioned above, the invention embraces antisense oligonucleotides that selectively bind to a nucleic acid molecule encoding a FGE polypeptide, to decrease FGE activity.

[0172] As used herein, the term "antisense oligonucleotide" or "antisense" describes an oligonucleotide that is an oligoribonucleotide, oligodeoxyribonucleotide, modified oligoribonucleotide, or modified oligodeoxyribonucleotide which hybridizes under physiological conditions to DNA comprising a particular gene or to an mRNA transcript of that gene and, thereby, inhibits the transcription of that gene and/or the translation of that mRNA. The antisense molecules are designed so as to interfere with transcription or translation of a target gene upon hybridization with the target gene or transcript. Those skilled in the art will recognize that the exact length of the antisense oligonucleotide and its degree of complementarity with its target will depend upon the specific target selected, including the sequence of the target and the particular bases which comprise that sequence. It is preferred that the antisense oligonucleotide be constructed and arranged so as to bind selectively with the target under physiological conditions, i.e., to hybridize substantially more to the target sequence than to any other sequence in the target cell under physiological conditions. Based upon SEQ ID NO:1 or upon allelic or homologous genomic and/or cDNA sequences, one of skill in the art can easily choose and synthesize any of a number of appropriate antisense molecules for use in accordance with the present invention. In order to be sufficiently selective and potent for inhibition, such antisense oligonucleotides should comprise at least 10 and, more preferably, at least 15 consecutive bases which are complementary to the target, although in certain cases modified oligonucleotides as short as 7 bases in length have been used successfully as antisense oligonucleotides (Wagner et al., Nat. Med, 1995, 1(11):1116-1118; Nat. Biotech., 1996, 14:840-844). Most preferably, the antisense oligonucleotides comprise a complementary sequence of 20-30 bases. Although oligonucleotides may be chosen which are antisense to any region of the gene or mRNA transcripts, in preferred embodiments the antisense oligonucleotides correspond to N-terminal or 5' upstream sites such as translation initiation, transcription initiation or promoter sites. In addition, 3' -untranslated regions may be targeted by antisense oligonucleotides. Targeting to mRNA splicing sites has also been used in the art but may be less preferred if alternative mRNA splicing occurs. In addition, the antisense is targeted, preferably, to sites in which mRNA secondary structure is not expected (see, e.g., Sainio et al., Cell Mol. Neurobiol. 14(5):439-457, 1994) and at which proteins are not expected to bind. Finally, although, SEQ ID No:1 discloses a cDNA sequence, one of ordinary skill in the art may easily derive the genomic DNA corresponding to this sequence. Thus, the present invention also provides for antisense oligonucleotides which are complementary to the genomic DNA corresponding to SEQ ID NO:1. Similarly, antisense to allelic or homologous FGE cDNAs and genomic DNAs are enabled without undue experimentation.

[0173] In one set of embodiments, the antisense oligonucleotides of the invention may be composed of "natural" deoxyribonucleotides, ribonucleotides, or any combination thereof. That is, the 5' end of one native nucleotide and the 3' end of another native nucleotide may be covalently linked, as in natural systems, via a phosphodiester internucleoside linkage. These oligonucleotides may be prepared by art recognized methods which may be carried out manually or by an automated synthesizer. They also may be produced recombinantly by vectors.

[0174] In preferred embodiments, however, the antisense oligonucleotides of the invention also may include "modified" oligonucleotides. That is, the oligonucleotides may be modified in a number of ways which do not prevent them from hybridizing to their target but which enhance their stability or targeting or which otherwise enhance their therapeutic effectiveness.

[0175] The term "modified oligonucleotide" as used herein describes an oligonucleotide in which (1) at least two of its nucleotides are covalently linked via a synthetic internucleoside linkage (i.e., a linkage other than a phosphodiester linkage between the 5' end of one nucleotide and the 3' end of another nucleotide) and/or (2) a chemical group not normally associated with nucleic acids has been covalently attached to the oligonucleotide. Preferred synthetic internucleoside linkages are phosphorothioates, alkylphosphonates, phosphorodithioates, phosphate esters, alkylphosphonothioates, phosphoramidates, carbamates, carbonates, phosphate triesters, acetamidates, carboxymethyl esters and peptides.

[0176] The term "modified oligonucleotide" also encompasses oligonucleotides with a covalently modified base and/or sugar. For example, modified oligonucleotides include oligonucleotides having backbone sugars which are covalently attached to low molecular weight organic groups other than a hydroxyl group at the 3' position and other than a phosphate group at the 5' position. Thus modified oligonucleotides may include a 2'43-alkylated ribose group. In addition, modified oligonucleotides may include sugars such as arabinose instead of ribose. The present invention, thus, contemplates pharmaceutical preparations containing modified antisense molecules that are complementary to and hybridizable with, under physiological conditions, nucleic acids encoding FGE polypeptides, together with pharmaceutically acceptable carriers. Antisense oligonucleotides may be administered as part of a pharmaceutical composition. Such a pharmaceutical composition may include the antisense oligonucleotides in combination with any standard physiologically and/or pharmaceutically acceptable carriers which are known in the art. The compositions should be sterile and contain a therapeutically effective amount of the antisense oligonucleotides in a unit of weight or volume suitable for administration to a patient. The term "pharmaceutically acceptable" means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients. The term "physiologically acceptable" refers to a non-toxic material that is compatible with a biological system such as a cell, cell culture, tissue, or organism. The characteristics of the carrier will depend on the route of administration. Physiologically and pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials which are well known in the art.

[0177] The invention also involves methods for increasing C.sub..alpha.-formylglycine generating activity in a cell. In important embodiments, this is accomplished by the use of vectors ("expression vectors" and/or "targeting vectors").

[0178] "Vectors," as used herein, may be any of a number of nucleic acids into which a desired sequence may be inserted by restriction and ligation for transport between different genetic environments or for expression in a host cell. Vectors are typically composed of DNA although RNA vectors are also available. Vectors include, but are not limited to, plasmids, phagemids and virus genomes. A cloning vector is one which is able to replicate in a host cell, and which is further characterized by one or more endonuclease restriction sites at which the vector may be cut in a determinable fashion and into which a desired DNA sequence may be ligated such that the new recombinant vector retains its ability to replicate in the host cell. In the case of plasmids, replication of the desired sequence may occur many times as the plasmid increases in copy number within the host bacterium or just a single time per host before the host reproduces by mitosis. In the case of phage, replication may occur actively during a lytic phase or passively during a lysogenic phase. An "expression vector" is one into which a desired DNA sequence (e.g., the FGE cDNA of SEQ ID NO:3) may be inserted by restriction and ligation such that it is operably joined to regulatory sequences and may be expressed as an RNA transcript. Vectors may further contain one or more marker sequences suitable for use in the identification of cells which have or have not been transformed or transfected with the vector. Markers include, for example, genes encoding proteins which increase or decrease either resistance or sensitivity to antibiotics or other compounds, genes which encode enzymes whose activities are detectable by standard assays known in the art (e.g., .beta.-galactosidase or alkaline phosphatase), and genes which visibly affect the phenotype of transformed or transfected cells, hosts, colonies or plaques (e.g., green fluorescent protein).

[0179] A "targeting vector" is one which typically contains targeting constructs/sequences that are used, for example, to insert a regulatory sequence within an endogenous gene (e.g., within the sequences of an exon and/or intron), within the endogenous gene promoter sequences, or upstream of the endogenous gene promoter sequences. In another example, a targeting vector may contain the gene of interest (e.g., encoded by the cDNA of SEQ ID NO:1) and other sequences necessary for the targeting of the gene to a preferred location in. the genome (e.g., a trascriptionally active location, for example downstream of an enogenous promoter of an unrelated gene). Construction of targeting constructs and vectors are described in detail in U.S. Pat. Nos. 5,641,670 and 6,270,989, and which are expressly incorporated herein by reference.

[0180] Virtually any cells, prokaryotic or eukaryotic, which can be transformed with heterologous DNA or RNA and which can be grown or maintained in culture, may be used in the practice of the invention. Examples include bacterial cells such as Escherichia coli, insect cells, and mammalian cells such as human, mouse, hamster, pig, goat, primate, etc. They may be primary or secondary cell strains (which exhibit a finite number of mean population doublings in culture and are not immortalized) and immortalized cell lines (which exhibit an apparently unlimited lifespan in culture). Primary and secondary cells include, for example, fibroblasts, keratinocytes, epithelial cells (e.g., mammary epithelial cells, intestinal epithelial cells), endothelial cells, glial cells, neural cells, formed elements of the blood (e.g., lymphocytes, bone marrow cells), muscle cells and precursors of these somatic cell types including embryonic stem cells. Where the cells are to be used in gene therapy, primary cells are preferably obtained from the individual to whom the manipulated cells are administered. However, primary cells can be obtained from a donor (other than the recipient) of the same species. Examples of immortalized human cell lines which may be used with the DNA constructs and methods of the present invention include, but are not limited to, HT-1080 cells (ATCC CCL 121), HeLa cells and derivatives of HeLa cells (ATCC CCL 2, 2.1 and 2.2), MCF-7 breast cancer cells (ATCC BTH 22), K-562 leukemia cells (ATCC CCL 243), KB carcinoma cells (ATCC CCL 17), 2780AD ovarian carcinoma cells (Van der Blick, A. M. et al., Cancer Res, 48:5927-5932 (1988), Raji cells (ATCC CCL 86), WiDr colon adenocarcinoma cells (ATCC CCL 218), SW620 colon adenocarcinoma cells (ATCC CCL 227), Jurkat cells (ATCC TIB 152), Namalwa cells (ATCC CRL1432), HL-60 cells (ATCC CCL 240), Daudi cells (ATCC CCL 213), RPMI 8226 cells (ATCC CCL 155), U-937 cells (ATCC CRL 1593), Bowes Melanoma cells (ATCC CRL 9607), WI-38VA13 subline 2R4 cells (ATCC CLL 75.1), and MOLT-4 cells (ATCC CRL 1582), CHO cells, and COS cells, as well as heterohybridoma cells produced by fusion of human cells and cells of another species. Secondary human fibroblast strains, such as WI-38 (ATCC CCL 75) and MRC-5 (ATCC CCL 171) may also be used. Further discussion of the types of cells that may be used in practicing the methods of the present invention are described in U.S. Pat. Nos. 5,641,670 and 6,270,989. Cell-free transcription systems also may be used in lieu of cells.

[0181] The cells of the invention are maintained under conditions, as are known in the art, which result in expression of the FGE protein or functional fragments thereof. Proteins expressed using the methods described may be purified from cell lysates or cell supernatants. Proteins made according to this method can be prepared as a pharmaceutically-useful formulation and delivered to a human or non-human animal by conventional pharmaceutical routes as is known in the art (e.g., oral, intravenous, intramuscular, intranasal, intratracheal or subcutaneous). As described elsewhere herein, the recombinant cells can be immortalized, primary, or secondary cells, preferably human. The use of cells from other species may be desirable in cases where the non-human cells are advantageous for protein production purposes where the non-human FGE produced is useful therapeutically.

[0182] As used herein, a coding sequence and regulatory sequences are said to be "operably" joined when they are covalently linked in such a way as to place the expression or transcription of the coding sequence under the influence or control of the regulatory sequences. If it is desired that the coding sequences be translated into a functional protein, two DNA sequences are said to be operably joined if induction of a promoter in the 5' regulatory sequences results in the transcription of the coding sequence and if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame-shift mutation, (2) interfere with the ability of the promoter region to direct the transcription of the coding sequences, or (3) interfere with the ability of the corresponding RNA transcript to be translated into a protein. Thus, a promoter region would be operably joined to a coding sequence if the promoter region were capable of effecting transcription of that DNA sequence such that the resulting transcript might be translated into the desired protein or polypeptide.

[0183] The precise nature of the regulatory sequences needed for gene expression may vary between species or cell types, but shall in general include, as necessary, 5' non-transcribed and 5' non-translated sequences involved with the initiation of transcription and translation respectively, such as a TATA box, capping sequence, CAAT sequence, and the like. Especially, such 5' non-transcribed regulatory sequences will include a promoter region which includes a promoter sequence for transcriptional control of the operably joined gene. Regulatory sequences may also include enhancer sequences or upstream activator sequences as desired. The vectors of the invention may optionally include 5' leader or signal sequences. The choice and design of an appropriate vector is within the ability and discretion of one of ordinary skill in the art.

[0184] Expression vectors containing all the necessary elements for expression are commercially available and known to those skilled in the art. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, 1989. Cells are genetically engineered by the introduction into the cells of heterologous DNA (RNA) encoding FGE polypeptide or fragment or variant thereof. That heterologous DNA (RNA) is placed under operable control of transcriptional elements to permit the expression of the heterologous DNA in the host cell.

[0185] Preferred systems for mRNA expression in mammalian cells are those such as pRc/CMV (available from Invitrogen, Carlsbad, Calif.) that contain a selectable marker such as a gene that confers G418 resistance (which facilitates the selection of stably transfected cell lines) and the human cytomegalovirus (CMV) enhancer-promoter sequences. Additionally, suitable for expression in primate or canine cell lines is the pCEP4 vector (Invitrogen, Carlsbad, Calif.), which contains an Epstein Barr virus (EBV) origin of replication, facilitating the maintenance of plasmid as a multicopy extrachromosomal element. Another expression vector is the pEF-BOS plasmid containing the promoter of polypeptide Elongation Factor 1a, which stimulates efficiently transcription in vitro. The plasmid is described by Mishizuma and Nagata (Nuc. Acids Res. 18:5322, 1990), and its use in transfection experiments is disclosed by, for example, Demoulin (Mol. Cell. Biol. 16:4710-4716, 1996). Still another preferred expression vector is an adenovirus, described by Stratford-Perricaudet, which is defective for E1 and E3 proteins (J. Clin. Invest. 90:626-630, 1992). The use of the adenovirus as an Adeno.P1A recombinant is disclosed by Warnier et al., in intradermal injection in mice for immunization against P1A (Int. J. Cancer, 67:303-310, 1996).

[0186] The invention also embraces so-called expression kits, which allow the artisan to prepare a desired expression vector or vectors. Such expression kits include at least separate portions of each of the previously discussed coding sequences. Other components may be added, as desired, as long as the previously mentioned sequences, which are required, are included.

[0187] It will also be recognized that the invention embraces the use of the above described, FGE cDNA sequence containing expression vectors, to transfect host cells and cell lines, be these prokaryotic (e.g., Escherichia coli), or eukaryotic (e.g., CHO cells, COS cells, yeast expression systems and recombinant baculovirus expression in insect cells). Especially useful are mammalian cells such as human, mouse, hamster, pig, goat, primate, etc. They may be of a wide variety of tissue types, and include primary cells and immortalized cell lines as described elsewhere herein. Specific examples include HT-1080 cells, CHO cells, dendritic cells, U293 cells, peripheral blood leukocytes, bone marrow stem cells, embryonic stem cells, and insect cells. The invention also permits the construction of FGE gene "knock-outs" in cells and in animals, providing materials for studying certain aspects of FGE activity.

[0188] The invention also provides isolated polypeptides (including whole proteins and partial proteins), encoded by the foregoing FGE nucleic acids, and include the polypeptide of SEQ ID NO:2 and unique fragments thereof. Such polypeptides are useful, for example, alone or as part of fusion proteins to generate antibodies, as components of an immunoassay, etc. Polypeptides can be isolated from biological samples including tissue or cell homogenates, and can also be expressed recombinantly in a variety of prokaryotic and eukaryotic expression systems by constructing an expression vector appropriate to the expression system, introducing the expression vector into the expression system, and isolating the recombinantly expressed protein. Short polypeptides, including antigenic peptides (such as are presented by MHC molecules on the surface of a cell for immune recognition) also can be synthesized chemically using well-established methods of peptide synthesis.

[0189] A unique fragment of a FGE polypeptide, in general, has the features and characteristics of unique fragments as discussed above in connection with nucleic acids. As will be recognized by those skilled in the art, the size of the unique fragment will depend upon factors such as whether the fragment constitutes a portion of a conserved protein domain. Thus, some regions of SEQ ID NO:2 will require longer segments to be unique while others will require only short segments, typically between 5 and 12 amino acids (e.g. 5, 6, 7, 8, 9, 10, 11 and 12 amino acids long or more, including each integer up to the full length, 287 amino acids long).

[0190] Unique fragments of a polypeptide preferably are those fragments which retain a distinct functional capability of the polypeptide. Functional capabilities which can be retained in a unique fragment of a polypeptide include interaction with antibodies, interaction with other polypeptides or fragments thereof, interaction with other molecules, etc. One important activity is the ability to act as a signature for identifying the polypeptide. Those skilled in the art are well versed in methods for selecting unique amino acid sequences, typically on the basis of the ability of the unique fragment to selectively distinguish the sequence of interest from non-family members. A comparison of the sequence of the fragment to those on known databases typically is all that is necessary.

[0191] The invention embraces variants of the FGE polypeptides described above. As used herein, a "variant" of a FGE polypeptide is a polypeptide which contains one or more modifications to the primary amino acid sequence of a FGE polypeptide. Modifications which create a FGE polypeptide variant are typically made to the nucleic acid which encodes the FGE polypeptide, and can include deletions, point mutations, truncations, amino acid substitutions and addition of amino acids or non-amino acid moieties to: 1) reduce or eliminate an activity of a FGE polypeptide; 2) enhance a property of a FGE polypeptide, such as protein stability in an expression system or the stability of protein-ligand binding; 3) provide a novel activity or property to a FGE polypeptide, such as addition of an antigenic epitope or addition of a detectable moiety; or 4) to provide equivalent or better binding to a FGE polypeptide receptor or other molecule. Alternatively, modifications can be made directly to the polypeptide, such as by cleavage, addition of a linker molecule, addition of a detectable moiety, such as biotin, addition of a fatty acid, and the like. Modifications also embrace fusion proteins comprising all or part of the FGE amino acid sequence. One of skill in the art will be familiar with methods for predicting the effect on protein conformation of a change in protein sequence, and can thus "design" a variant FGE polypeptide according to known methods. One example of such a method is described by Dahiyat and Mayo in Science 278:82-87, 1997, whereby proteins can be designed de novo. The method can be applied to a known protein to vary only a portion of the polypeptide sequence. By applying the computational methods of Dahiyat and Mayo, specific variants of the FGE polypeptide can be proposed and tested to determine whether the variant retains a desired conformation.

[0192] Variants can include FGE polypeptides which are modified specifically to alter a feature of the polypeptide unrelated to its physiological activity. For example, cysteine residues can be substituted or deleted to prevent unwanted disulfide linkages. Similarly, certain amino acids can be changed to enhance expression of a FGE polypeptide by eliminating proteolysis by proteases in an expression system (e.g., dibasic amino acid residues in yeast expression systems in which KEX2 protease activity is present).

[0193] Mutations of a nucleic acid which encodes a FGE polypeptide preferably preserve the amino acid reading frame of the coding sequence, and preferably do not create regions in the nucleic acid which are likely to hybridize to form secondary structures, such a hairpins or loops, which can be deleterious to expression of the variant polypeptide.

[0194] Mutations can be made by selecting an amino acid substitution, or by random mutagenesis of a selected site in a nucleic acid which encodes the polypeptide. Variant polypeptides are then expressed and tested for one or more activities to determine which mutation provides a variant polypeptide with the desired properties. Further mutations can be made to variants (or to non-variant FGE polypeptides) which are silent as to the amino acid sequence of the polypeptide, but which provide preferred codons for translation in a particular host, or alter the structure of the mRNA to, for example, enhance stability and/or expression. The preferred codons for translation of a nucleic acid in, e.g., Escherichia coli, mammalian cells, etc. are well known to those of ordinary skill in the art. Still other mutations can be made to the noncoding sequences of a FGE gene or cDNA clone to enhance expression of the polypeptide.

[0195] The skilled artisan will realize that conservative amino acid substitutions may be made in FGE polypeptides to provide functionally equivalent variants of the foregoing polypeptides, i.e, the variants retain the functional capabilities of the FGE polypeptides. As used herein, a "conservative amino acid substitution" refers to an amino acid substitution which does not significantly alter the the tertiary structure and/or activity of the polypeptide. Variants can be prepared according to methods for altering polypeptide sequence known to one of ordinary skill in the art, and include those that are found in references which compile such methods, e.g. Molecular Cloning: A Laboratory Manual, J. Sambrook, et al., eds., Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989, or Current Protocols in Molecular Biology, F. M. Ausubel, et al., eds., John Wiley & Sons, Inc., New York. Exemplary functionally equivalent variants of the FGE polypeptides include conservative amino acid substitutions of SEQ ID NO:2. Conservative substitutions of amino acids include substitutions made amongst amino acids within the following groups: (a) M, I, L, V; (b) F, Y, W; (c) K, R, H; (d) A, G; (e) S, T; (f) Q, N; and (g) E, D.

[0196] Thus functionally equivalent variants of FGE polypeptides, i.e., variants of FGE polypeptides which retain the function of the natural FGE polypeptides, are contemplated by the invention. Conservative amino-acid substitutions in the amino acid sequence of FGE polypeptides to produce functionally equivalent variants of FGE polypeptides typically are made by alteration of a nucleic acid encoding FGE polypeptides (SEQ ID NOs:1, 3). Such substitutions can be made by a variety of methods known to one of ordinary skill in the art. For example, amino acid substitutions may be made by PCR-directed mutation, site-directed mutagenesis according to the method of Kunkel (Kunkel, Proc. Nat. Acad. Sci. U.S.A. 82: 488-492, 1985), or by chemical synthesis of a gene encoding a FGE polypeptide. The activity of functionally equivalent fragments of FGE polypeptides can be tested by cloning the gene encoding the altered FGE polypeptide into a bacterial or mammalian expression vector, introducing the vector into an appropriate host cell, expressing the altered FGE polypeptide, and testing for a functional capability of the FGE polypeptides as disclosed herein (e.g., C.sub..alpha.-formylglycine generating activity, etc.).

[0197] The invention as described herein has a number of uses, some of which are described elsewhere herein. First, the invention permits isolation of FGE polypeptides. A variety of methodologies well-known to the skilled practitioner can be utilized to obtain isolated FGE molecules. The polypeptide may be purified from cells which naturally produce the polypeptide by chromatographic means or immunological recognition. Alternatively, an expression vector may be introduced into cells to cause production of the polypeptide. In another method, mRNA transcripts may be microinjected or otherwise introduced into cells to cause production of the encoded polypeptide. Translation of FGE mRNA in cell-free extracts such as the reticulocyte lysate system also may be used to produce FGE polypeptides. Those skilled in the art also can readily follow known methods for isolating FGE polypeptides. These include, but are not limited to, immunochromatography, HPLC, size-exclusion chromatography, ion-exchange chromatography and immune-affinity chromatography.

[0198] The invention also provides, in certain embodiments, "dominant negative" polypeptides derived from FGE polypeptides. A dominant negative polypeptide is an inactive variant of a protein, which, by interacting with the cellular machinery, displaces an active protein from its interaction with the cellular machinery or competes with the active protein, thereby reducing the effect of the active protein. For example, a dominant negative receptor which binds a ligand but does not transmit a signal in response to binding of the ligand can reduce the biological effect of expression of the ligand Likewise, a dominant negative catalytically-inactive kinase which interacts normally with target proteins but does not phosphorylate the target proteins can reduce phosphorylation of the target proteins in response to a cellular signal. Similarly, a dominant negative transcription factor which binds to a promoter site in the control region of a gene but does not increase gene transcription can reduce the effect of a normal transcription factor by occupying promoter binding sites without increasing transcription.

[0199] The end result of the expression of a dominant negative polypeptide in a cell is a reduction in function of active proteins. One of ordinary skill in the art can assess the potential for a dominant negative variant of a protein, and use standard mutagenesis techniques to create one or more dominant negative variant polypeptides. See, e.g., U.S. Pat. No. 5,580,723 and Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, 1989. The skilled artisan then can test the population of mutagenized polypeptides for diminution in a selected activity and/or for retention of such an activity. Other similar methods for creating and testing dominant negative variants of a protein will be apparent to one of ordinary skill in the art.

[0200] The isolation of the FGE cDNA also makes it possible for the artisan to diagnose a disorder characterized by an aberrant expression of FGE. These methods involve determining expression of the FGE gene, and/or FGE polypeptides derived therefrom. In the former situation, such determinations can be carried out via any standard nucleic acid determination assay, including the polymerase chain reaction, or assaying with labeled hybridization probes as exemplified below. In the latter situation, such determination can be carried out via any standard immunological assay using, for example, antibodies which bind to the secreted FGE protein. A preferred disorder that can be diagnosed according to the invention is Multiple Sulfatase Deficiency.

[0201] The invention also embraces isolated peptide binding agents which, for example, can be antibodies or fragments of antibodies ("binding polypeptides"), having the ability to selectively bind to FGE polypeptides. Antibodies include polyclonal and monoclonal antibodies, prepared according to conventional methodology. In certain embodiments, the invention excludes binding agents (e.g., antibodies) that bind to the polypeptides encoded by the nucleic acids of SEQ ID NO:4.

[0202] Significantly, as is well-known in the art, only a small portion of an antibody molecule, the paratope, is involved in the binding of the antibody to its epitope (see, in general, Clark, W. R. (1986) The Experimental Foundations of Modern Immunology Wiley & Sons, Inc., New York; Roitt, I. (1991) Essential Immunology, 7th Ed., Blackwell Scientific Publications, Oxford). The pFc' and Fc regions, for example, are effectors of the complement cascade but are not involved in antigen binding. An antibody from which the pFc' region has been enzymatically cleaved, or which has been produced without the pFc' region, designated an F(ab').sub.2 fragment, retains both of the antigen binding sites of an intact antibody. Similarly, an antibody from which the Fc region has been enzymatically cleaved, or which has been produced without the Fc region, designated an Fab fragment, retains one of the antigen binding sites of an intact antibody molecule. Proceeding further, Fab fragments consist of a covalently bound antibody light chain and a portion of the antibody heavy chain denoted Fd. The Fd fragments are the major determinant of antibody specificity (a single Fd fragment may be associated with up to ten different light chains without altering antibody specificity) and Fd fragments retain epitope-binding ability in isolation.

[0203] Within the antigen-binding portion of an antibody, as is well-known in the art, there are complementarity determining regions (CDRs), which directly interact with the epitope of the antigen, and framework regions (FRs), which maintain the tertiary structure of the paratope (see, in general, Clark, 1986; Roitt, 1991). In both the heavy chain Fd fragment and the light chain of IgG immunoglobulins, there are four framework regions (FR1 through FR4) separated respectively by three complementarity determining regions (CDR1 through CDR3). The CDRs, and in particular the CDR3 regions, and more particularly the heavy chain CDR3, are largely responsible for antibody specificity.

[0204] It is now well-established in the art that the non-CDR regions of a mammalian antibody may be replaced with similar regions of conspecific or heterospecific antibodies while retaining the epitopic specificity of the original antibody. This is most clearly manifested in the development and use of "humanized" antibodies in which non-human CDRs are covalently joined to human FR and/or Fc/pFc' regions to produce a functional antibody. See, e.g., U.S. Pat. Nos. 4,816,567, 5,225,539, 5,585,089, 5,693,762 and 5,859,205. Thus, for example, PCT International Publication Number WO 92/04381 teaches the production and use of humanized murine RSV antibodies in which at least a portion of the murine FR regions have been replaced by FR regions of human origin. Such antibodies, including fragments of intact antibodies with antigen-binding ability, are often referred to as "chimeric" antibodies.

[0205] Thus, as will be apparent to one of ordinary skill in the art, the present invention also provides for F(ab').sub.2, Fab, Fv and Fd fragments; chimeric antibodies in which the Fc and/or FR and/or CDR1 and/or CDR2 and/or light chain CDR3 regions have been replaced by homologous human or non-human sequences; chimeric F(ab').sub.2 fragment antibodies in which the FR and/or CDR1 and/or CDR2 and/or light chain CDR3 regions have been replaced by homologous human or non-human sequences; chimeric Fab fragment antibodies in which the FR and/or CDR1 and/or CDR2 and/or light chain CDR3 regions have been replaced by homologous human or non-human sequences; and chimeric Fd fragment antibodies in which the FR and/or CDR 1 and/or CDR2 regions have been replaced by homologous human or non-human sequences. The present invention also includes so-called single chain antibodies.

[0206] Thus, the invention involves polypeptides of numerous size and type that bind specifically to FGE polypeptides, and complexes of both FGE polypeptides and their binding partners. These polypeptides may be derived also from sources other than antibody technology. For example, such polypeptide binding agents can be provided by degenerate peptide libraries which can be readily prepared in solution, in immobilized form, as bacterial flagella peptide display libraries or as phage display libraries. Combinatorial libraries also can be synthesized of peptides containing one or more amino acids. Libraries further can be synthesized of peptides and non-peptide synthetic moieties.

[0207] Phage display can be particularly effective in identifying binding peptides useful according to the invention. Briefly, one prepares a phage library (using e.g. m13, fd, or lambda phage), displaying inserts from 4 to about 80 amino acid residues using conventional procedures. The inserts may represent, for example, a completely degenerate or biased array. One then can select phage-bearing inserts which bind to the FGE polypeptide or a complex of FGE and a binding partner. This process can be repeated through several cycles of reselection of phage that bind to the FGE polypeptide or complex. Repeated rounds lead to enrichment of phage bearing particular sequences. DNA sequence analysis can be conducted to identify the sequences of the expressed polypeptides. The minimal linear portion of the sequence that binds to the FGE polypeptide or complex can be determined. One can repeat the procedure using a biased library containing inserts containing part or all of the minimal linear portion plus one or more additional degenerate residues upstream or downstream thereof. Yeast two-hybrid screening methods also may be used to identify polypeptides that bind to the FGE polypeptides. Thus, the FGE polypeptides of the invention, or a fragment thereof, or complexes of FGE and a binding partner can be used to screen peptide libraries, including phage display libraries, to identify and select peptide binding partners of the FGE polypeptides of the invention. Such molecules can be used, as described, for screening assays, for purification protocols, for interfering directly with the functioning of FGE and for other purposes that will be apparent to those of ordinary skill in the art.

[0208] An FGE polypeptide, or a fragment thereof, also can be used to isolate their native binding partners. Isolation of binding partners may be performed according to well-known methods. For example, isolated FGE polypeptides can be attached to a substrate, and then a solution suspected of containing a FGE binding partner may be applied to the substrate. If the binding partner for FGE polypeptides is present in the solution, then it will bind to the substrate-bound FGE polypeptide. The binding partner then may be isolated. Other proteins which are binding partners for FGE, may be isolated by similar methods without" undue experimentation. A preferred binding partner is a sulfatase.

[0209] The invention also provides methods to measure the level of FGE expression in a subject. This can be performed by first obtaining a test sample from the subject. The test sample can be tissue or biological fluid. Tissues include brain, heart, serum, breast, colon, bladder, uterus, prostate, stomach, testis, ovary, pancreas, pituitary gland, adrenal gland, thyroid gland, salivary gland, mammary gland, kidney, liver, intestine, spleen, thymus, blood vessels, bone marrow, trachea, and lung. In certain embodiments, test samples originate from heart and blood vessel tissues, and biological fluids include blood, saliva and urine. Both invasive and non-invasive techniques can be used to obtain such samples and are well documented in the art. At the molecular level both PCR and Northern blotting can be used to determine the level of FGE mRNA using products of this invention described herein, and protocols well known in the art that are found in references which compile such methods. At the protein level, FGE expression can be determined using either polyclonal or monoclonal anti-FGE sera in combination with standard immunological assays. The preferred methods will compare the measured level of FGE expression of the test sample to a control. A control can include a known amount of a nucleic acid probe, a FGE epitope (such as a FGE expression product), or a similar test sample of a subject with a control or `normal` level of FGE expression.

[0210] FGE polypeptides preferably are produced recombinantly, although such polypeptides may be isolated from biological extracts. Recombinantly produced FGE polypeptides include chimeric proteins comprising a fusion of a FGE protein with another polypeptide, e.g., a polypeptide capable of providing or enhancing protein-protein binding, sequence specific nucleic acid binding (such as GAL4), enhancing stability of the FGE polypeptide under assay conditions, or providing a detectable moiety, such as green fluorescent protein. A polypeptide fused to a FGE polypeptide or fragment may also provide means of readily detecting the fusion protein, e.g., by immunological recognition or by fluorescent labeling.

[0211] The invention also is useful in the generation of transgenic non-human animals. As used herein, "transgenic non-human animals" includes non-human animals having one or more exogenous nucleic acid molecules incorporated in germ line cells and/or somatic cells. Thus the transgenic animals include "knockout" animals having a homozygous or heterozygous gene disruption by homologous recombination, animals having episomal or chromosomally incorporated expression vectors, etc. Knockout animals can be prepared by homologous recombination using embryonic stem cells as is well known in the art. The recombination may be facilitated using, for example, the cre/lox system or other recombinase systems known to one of ordinary skill in the art. In certain embodiments, the recombinase system itself is expressed conditionally, for example, in certain tissues or cell types, at certain embryonic or post-embryonic developmental stages, is induced by the addition of a compound which increases or decreases expression, and the like. In general, the conditional expression vectors used in such systems use a variety of promoters which confer the desired gene expression pattern (e.g., temporal or spatial). Conditional promoters also can be operably linked to FGE nucleic acid molecules to increase expression of FGE in a regulated or conditional manner. Trans-acting negative regulators of FGE activity or expression also can be operably linked to a conditional promoter as described above. Such trans-acting regulators include antisense FGE nucleic acids molecules, nucleic acid molecules which encode dominant negative FGE molecules, ribozyme molecules specific for FGE nucleic acids, and the like. The transgenic non-human animals are useful in experiments directed toward testing biochemical or physiological effects of diagnostics or therapeutics for conditions characterized by increased or decreased FGE expression. Other uses will be apparent to one of ordinary skill in the art.

[0212] The invention also contemplates gene therapy. The procedure for performing ex vivo gene therapy is outlined in U.S. Pat. No. 5,399,346 and in exhibits submitted in the file history of that patent, all of which are publicly available documents. In general, it involves introduction in vitro of a functional copy of a gene into a cell(s) of a subject which contains a defective copy of the gene, and returning the genetically engineered cell(s) to the subject. The functional copy of the gene is under operable control of regulatory elements which permit expression of the gene in the genetically engineered cell(s). Numerous transfection and transduction techniques as well as appropriate expression vectors are well known to those of ordinary skill in the art, some of which are described in PCT application W095/00654. In vivo gene therapy using vectors such as adenovirus, retroviruses, herpes virus, and targeted liposomes also is contemplated according to the invention.

[0213] The invention further provides efficient methods of identifying agents or lead compounds for agents active at the level of a FGE or FGE fragment dependent cellular function. In particular, such functions include interaction with other polypeptides or fragments. Generally, the screening methods involve assaying for compounds which interfere with FGE activity (such as C.alpha.-formylglycine generating activity), although compounds which enhance FGE C.sub..alpha.-formylglycine generating activity also can be assayed using the screening methods. Such methods are adaptable to automated, high throughput screening of compounds. Target indications include cellular processes modulated by FGE such as C.sub..alpha.-formylglycine generating activity.

[0214] A wide variety of assays for candidate (pharmacological) agents are provided, including, labeled in vitro protein-ligand binding assays, electrophoretic mobility shift assays, immunoassays, cell-based assays such as two- or three-hybrid screens, expression assays, etc. The transfected nucleic acids can encode, for example, combinatorial peptide libraries or cDNA libraries. Convenient reagents for such assays, e.g., GAL4 fusion proteins, are known in the art. An exemplary cell-based assay involves transfecting a cell with a nucleic acid encoding a FGE polypeptide fused to a GAL4 DNA binding domain and a nucleic acid encoding a reporter gene operably linked to a gene expression regulatory region, such as one or more GAL4 binding sites. Activation of reporter gene transcription occurs when the FGE and reporter fusion polypeptide binds such as to enable transcription of the reporter gene. Agents which modulate a FGE polypeptide mediated cell function are then detected through a change in the expression of reporter gene. Methods for determining changes in the expression of a reporter gene are known in the art.

[0215] FGE fragments used in the methods, when not produced by a transfected nucleic acid are added to an assay mixture as an isolated polypeptide. FGE polypeptides preferably are produced recombinantly, although such polypeptides may be isolated from biological extracts. Recombinantly produced FGE polypeptides include chimeric proteins comprising a fusion of a FGE protein with another polypeptide, e.g., a polypeptide capable of providing or enhancing protein-protein binding, sequence specific nucleic acid binding (such as GAL4), enhancing stability of the FGE polypeptide under assay conditions, or providing a detectable moiety, such as green fluorescent protein or Flag epitope.

[0216] The assay mixture is comprised of a natural intracellular FGE binding target capable of interacting with FGE. While natural FGE binding targets may be used, it is frequently preferred to use portions (e.g., peptides--see e.g., the peptide of SEQ ID NO:33--or nucleic acid fragments) or analogs (i.e., agents which mimic the FGE binding properties of the natural binding target for purposes of the assay) of the FGE binding target so long as the portion or analog provides binding affinity and avidity to the FGE fragment measurable in the assay.

[0217] The assay mixture also comprises a candidate agent. Typically, a plurality of assay mixtures are run in parallel with different agent concentrations to obtain a different response to the various concentrations. Typically, one of these concentrations serves as a negative control, i.e., at zero concentration of agent or at a concentration of agent below the limits of assay detection. Candidate agents encompass numerous chemical classes, although typically they are organic compounds. Preferably, the candidate agents are small organic compounds, i.e., those having a molecular weight of more than 50 yet less than about 2500, preferably less than about 1000 and, more preferably, less than about 500. Candidate agents comprise functional chemical groups necessary for structural interactions with polypeptides and/or nucleic acids, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups and more preferably at least three of the functional chemical groups. The candidate agents can comprise cyclic carbon or heterocyclic structure and/or aromatic or polyaromatic structures substituted with one or more of the above-identified functional groups. Candidate agents also can be biomolecules such as peptides, saccharides, fatty acids, sterols, isoprenoids, purines, pyrimidines, derivatives or structural analogs of the above, or combinations thereof and the like. Where the agent is a nucleic acid, the agent typically is a DNA or RNA molecule, although modified nucleic acids as defined herein are also contemplated.

[0218] Candidate agents are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides, synthetic organic combinatorial libraries, phage display libraries of random peptides, and the like. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural and synthetically produced libraries and compounds can be modified through conventional chemical, physical, and biochemical means. Further, known (pharmacological) agents may be subjected to directed or random chemical modifications such as acylation, alkylation, esterification, amidification, etc. to produce structural analogs of the agents.

[0219] A variety of other reagents also can be included in the mixture. These include reagents such as salts, buffers, neutral proteins (e.g., albumin), detergents, etc. which may be used to facilitate optimal protein-protein and/or protein-nucleic acid binding. Such a reagent may also reduce non-specific or background interactions of the reaction components. Other reagents that improve the efficiency of the assay such as protease, inhibitors, nuclease inhibitors, antimicrobial agents, and the like may also be used.

[0220] The mixture of the foregoing assay materials is incubated under conditions whereby, but for the presence of the candidate agent, the FGE polypeptide specifically binds a cellular binding target, a portion thereof or analog thereof. The order of addition of components, incubation temperature, time of incubation, and other parameters of the assay may be readily determined. Such experimentation merely involves optimization of the assay parameters, not the fundamental composition of the assay. Incubation temperatures typically are between 4.degree. C. and 40.degree. C. Incubation times preferably are minimized to facilitate rapid, high throughput screening, and typically are between 0.1 and 10 hours.

[0221] After incubation, the presence or absence of specific binding between the FGE polypeptide and one or more binding targets is detected by any convenient method available to the user. For cell free binding type assays, a separation step is often used to separate bound from unbound components. The separation step may be accomplished in a variety of ways. Conveniently, at least one of the components is immobilized on a solid substrate, from which the unbound components may be easily separated. The solid substrate can be made of a wide variety of materials and in a wide variety of shapes, e.g., microtiter plate, microbead, dipstick, resin particle, etc. The substrate preferably is chosen to maximum signal to noise ratios, primarily to minimize background binding, as well as for ease of separation and cost.

[0222] Separation may be effected for example, by removing a bead or dipstick from a reservoir, emptying or diluting a reservoir such as a microtiter plate well, rinsing a bead, particle, chromatograpic column or filter with a wash solution or solvent. The separation step preferably includes multiple rinses or washes. For example, when the solid substrate is a microtiter plate, the wells may be washed several times with a washing solution, which typically includes those components of the incubation mixture that do not participate in specific bindings such as salts, buffer, detergent, non-specific protein, etc. Where the solid substrate is a magnetic bead, the beads may be washed one or more times with a washing solution and isolated using a magnet.

[0223] Detection may be effected in any convenient way for cell-based assays such as two-or three-hybrid screens. The transcript resulting from a reporter gene transcription assay of FGE polypeptide interacting with a target molecule typically encodes a directly or indirectly detectable product, e.g., .beta.-galactosidase activity, luciferase activity, and the like. For cell free binding assays, one of the components usually comprises, or is coupled to, a detectable label. A wide variety of labels can be used, such as those that provide direct detection (e.g., radioactivity, luminescence, optical or electron density, etc), or indirect detection (e.g., epitope tag such as the FLAG epitope, enzyme tag such as horseseradish peroxidase, etc.). The label may be bound to a FGE binding partner, or incorporated into the structure of the binding partner.

[0224] A variety of methods may be used to detect the label, depending on the nature of the label and other assay components. For example, the label may be detected while bound to the solid substrate or subsequent to separation from the solid substrate. Labels may be directly detected through optical or electron density, radioactive emissions, nonradiative energy transfers, etc. or indirectly detected with antibody conjugates, streptavidin-biotin conjugates, etc. Methods for detecting the labels are well known in the art.

[0225] The invention provides FGE-specific binding agents, methods of identifying and making such agents, and their use in diagnosis, therapy and pharmaceutical development. For example, FGE-specific pharmacological agents are useful in a variety of diagnostic and therapeutic applications, especially where disease or disease prognosis is associated with altered FGE binding characteristics such as in Multiple Sulfatase Deficiency. Novel FGE-specific binding agents include FGE-specific antibodies, cell surface receptors, and other natural intracellular and extracellular binding agents identified with assays such as two hybrid screens, and non-natural intracellular and extracellular binding agents identified in screens of chemical libraries and the like.

[0226] In general, the specificity of FGE binding to a specific molecule is determined by binding equilibrium constants. Targets which are capable of selectively binding a FGE polypeptide preferably have binding equilibrium constants of at least about 10.sup.7 M.sup.-1 more preferably at least about 10.sup.8 M.sup.-1, and most preferably at least about 10.sup.9 M.sup.-1. A wide variety of cell based and cell free assays may be used to demonstrate FGE-specific binding. Cell based assays include one, two and three hybrid screens, assays in which FGE-mediated transcription is inhibited or increased, etc. Cell free assays include FGE-protein binding assays, immunoassays, etc. Other assays useful for screening agents which bind FGE polypeptides include fluorescence resonance energy transfer (FRET), and electrophoretic mobility shift analysis (EMSA).

[0227] According to another aspect of the invention, a method for identifying an agent useful in modulating C.sub..alpha.-formylglycine generating activity of a molecule of the invention, is provided. The method involves (a) contacting a molecule having C.sub..alpha.-formylglycine generating activity with a candidate agent, (b) measuring C.sub..alpha.-formylglycine generating activity of the molecule, and (c) comparing the measured C.sub..alpha.-formylglycine generating activity of the molecule to a control to determine whether the candidate agent modulates C.sub..alpha.-formylglycine generating activity of the molecule, wherein the molecule is an FGE nucleic acid molecule of the invention, or an expression product thereof. "Contacting" refers to both direct and indirect contacting of a molecule having C.sub..alpha.-formylglycine generating activity with the candidate agent. "Indirect" contacting means that the candidate agent exerts its effects on the C.sub..alpha.-formylglycine generating activity of the molecule via a third agent (e.g., a messenger molecule, a receptor, etc.). In certain embodiments, the control is C.sub..alpha.-formylglycine generating activity of the molecule measured in the absence of the candidate agent. Assaying methods and candidate agents are as described above in the foregoing embodiments with respect to FGE.

[0228] According to still another aspect of the invention, a method of diagnosing a disorder characterized by aberrant expression of a nucleic acid molecule, an expression product thereof, or a fragment of an expression product thereof, is provided. The method involves contacting a biological sample isolated from a subject with an agent that specifically binds to the nucleic acid molecule, an expression product thereof, or a fragment of an expression product thereof, and determining the interaction between the agent and the nucleic acid molecule or the expression product as a determination of the disorder, wherein the nucleic acid molecule is an FGE molecule according to the invention. The disorder is Multiple Sulfatase Deficiency. Mutations in the FGE gene that cause the aberrant expression of FGE molecules result in the following amino acid changes on SEQ ID NO:2: Met1Arg; Met1Val; Leu20Phe; Ser155Pro; Ala177Pro; Cys218Tyr; Arg224Trp; Asn259Ile; Pro266Leu; Ala279Val; Arg327Stop; Cys336Arg; Arg345Cys; Ala348Pro; Arg349Gln; Arg349Trp; Arg349Trp; Ser359Stop; or a combination thereof.

[0229] In the case where the molecule is a nucleic acid molecule, such determinations can be carried out via any standard nucleic acid determination assay, including the polymerase chain reaction, or assaying with labeled hybridization probes as exemplified herein. In the case where the molecule is an expression product of the nucleic acid molecule, or a fragment of an expression product of the nucleic acid molecule, such determination can be carried out via any standard immunological assay using, for example, antibodies which bind to any of the polypeptide expression products.

[0230] "Aberrant expression" refers to decreased expression (underexpression) or increased expression (overexpression) of FGE molecules (nucleic acids and/or polypeptides) in comparison with a control (i.e., expression of the same molecule in a healthy or "normal" subject). A "healthy subject", as used herein, refers to a subject who, according to standard medical standards, does not have or is at risk for developing Multiple Sulfatase Deficiency. Healthy subjects also do not otherwise exhibit symptoms of disease. In other words, such subjects, if examined by a medical professional, would be characterized as healthy and free of symptoms of a Multiple Sulfatase Deficiency. These include features of metachromatic leukodystrophy and of a mucopolysaccharidosis, such as increased amounts of acid mucopolysaccharides in several tissues, mild `gargoylism`, rapid neurologic deterioration, excessive presence of mucopolysaccharide and sulfatide in the urine, increased cerebrospinal fluid protein, and metachromatic degeneration of myelin in peripheral nerves.

[0231] The invention also provides novel kits which could be used to measure the levels of the nucleic acids of the invention, or expression products of the invention.

[0232] In one embodiment, a kit comprises a package containing an agent that selectively binds to any of the foregoing FGE isolated nucleic acids, or expression products thereof, and a control for comparing to a measured value of binding of said agent any of the foregoing FGE isolated nucleic acids or expression products thereof. In some embodiments, the control is a predetermined value for comparing to the measured value. In certain embodiments, the control comprises an epitope of the expression product of any of the foregoing FGE isolated nucleic acids. In one embodiment, the kit further comprises a second agent that selectively binds to a polypeptide selected from the group consisting of Iduronate 2-Sulfatase, Sulfamidase, N-Acetylgalactosamine 6-Sulfatase, N-Acetylglucosamine 6-Sulfatase, Arylsulfatase A, Arylsulfatase B, Arylsulfatase C, Arylsulfatase D, Arylsulfatase E, Arylsulfatase F, Arylsulfatase G, HSulf-1, HSulf-2, HSulf-3, HSulf-4, HSulf-5, and HSulf-6, or a peptide thereof, and a control for comparing to a measured value of binding of said second agent to said polypeptide or peptide thereof.

[0233] In the case of nucleic acid detection, pairs of primers for amplifying a nucleic acid molecule of the invention can be included. The preferred kits would include controls such as known amounts of nucleic acid probes, epitopes (such as Iduronate 2-Sulfatase, Sulfamidase, N-Acetylgalactosamine 6-Sulfatase, N-Acetylglucosamine 6-Sulfatase, Arylsulfatase A, Arylsulfatase B, Arylsulfatase C, Arylsulfatase D, Arylsulfatase E, Arylsulfatase F, Arylsulfatase G, HSulf-1, HSulf-2, HSulf-3, HSulf-4, HSulf-5, and HSulf-6, expression products) or anti-epitope antibodies, as well as instructions or other printed material. In certain embodiments the printed material can characterize risk of developing a sulfatase deficiency condition based upon the outcome of the assay. The reagents may be packaged in containers and/or coated on wells in predetermined amounts, and the kits may include standard materials such as labeled immunological reagents (such as labeled anti-IgG antibodies) and the like. One kit is a packaged polystyrene microtiter plate coated with FGE protein and a container containing labeled anti-human IgG antibodies. A well of the plate is contacted with, for example, a biological fluid, washed and then contacted with the anti-IgG antibody. The label is then detected. A kit embodying features of the present invention, generally designated by the numeral 11, is illustrated in FIG. 25. Kit 11 is comprised of the following major elements: packaging 15, an agent of the invention 17, a control agent 19 and instructions 21. Packaging 15 is a box-like structure for holding a vial (or number of vials) containing an agent of the invention 17, a vial (or number of vials) containing a control agent 19, and instructions 21. Individuals skilled in the art can readily modify packaging 15 to suit individual needs.

[0234] The invention also embraces methods for treating Multiple Sulfatase Deficiency in a subject. The method involves administering to a subject in need of such treatment an agent that modulates C.sub..alpha.-formylglycine generating activity, in an amount effective to increase C.sub..alpha.-formylglycine generating activity in the subject. In some embodiments, the method further comprises co-administering an agent selected from the group consisting of a nucleic acid molecule encoding Iduronate 2-Sulfatase, Sulfamidase, N-Acetylgalactosamine 6-Sulfatase, N-Acetylglucosamine 6-Sulfatase, Arylsulfatase A, Arylsulfatase B, Arylsulfatase C, Arylsulfatase D, Arylsulfatase E, Arylsulfatase F, Arylsulfatase G, HSulf-1, HSulf-2, HSulf-3, HSulf-4, HSulf-5, and HSulf-6, an expression product of the nucleic acid molecule, and/or a fragment of the expression product of the nucleic acid molecule.

[0235] "Agents that modulate expression" of a nucleic acid or a polypeptide, as used herein, are known in the art, and refer to sense and antisense nucleic acids, dominant negative nucleic acids, antibodies to the polypeptides, and the like. Any agents that modulate exression of a molecule (and as described herein, modulate its activity), are useful according to the invention. In certain embodiments, the agent that modulates C.sub..alpha.-formylglycine generating activity is an isolated nucleic acid molecule of the invention (e.g., a nucleic acid of SEQ ID NO.3). In important embodiments, the agent that modulates C.sub..alpha.-formylglycine generating activity is a peptide of the invention (e.g., a peptide of SEQ ID NO.2). In some embodiments, the agent that modulates C.sub..alpha.-formylglycine generating activity is a sense nucleic acid of the invention.

[0236] According to one aspect of the invention, a method for for increasing C.sub..alpha.-formylglycine generating activity in a subject, is provided. The method involves administering an isolated FGE nucleic acid molecule of the invention, and/or an expression product thereof, to a subject, in an amount effective to increase C.sub.a-formylglycine generating activity in the subject.

[0237] According to still another aspect of the invention, a method for increasing C.sub..alpha.-formylglycine generating activity in a cell, is provided. The method involves contacting the cell with an isolated nucleic acid molecule of the invention (e.g., a nucleic acid of SEQ ID NO.1), or an expression product thereof (e.g., a peptide of SEQ ID NO.2), in an amount effective to increase C.sub..alpha.-formylglycine generating activity in the cell. In important embodiments, the method involves activating the endogenous FGE gene to increase C.sub..alpha.-formylglycine generating activity in the cell.

[0238] In any of the foregoing embodiments the nucleic acid may be operatively coupled to a gene expression sequence which directs the expression of the nucleic acid molecule within a eukaryotic cell such as an HT-1080 cell. The "gene expression sequence" is any regulatory nucleotide sequence, such as a promoter sequence or promoter-enhancer combination, which facilitates the efficient transcription and translation of the nucleic acid to which it is operably linked. The gene expression sequence may, for example, be a mammalian or viral promoter, such as a constitutive or inducible promoter. Constitutive mammalian promoters include, but are not limited to, the promoters for the following genes: hypoxanthine phosphoribosyl transferase (HPTR), adenosine deaminase, pyruvate kinase, cc-actin promoter and other constitutive promoters. Exemplary viral promoters which function constitutively in eukaryotic cells include, for example, promoters from the simian virus, papilloma virus, adenovirus, human immunodeficiency virus (HIV), Rous sarcoma virus, cytomegalovirus, the long terminal repeats (LTR) of moloney leukemia virus and other retroviruses, and the thymidine kinase promoter of herpes simplex virus. Other constitutive promoters are known to those of ordinary skill in the art. The promoters useful as gene expression sequences of the invention also include inducible promoters. Inducible promoters are activated in the presence of an inducing agent. For example, the metallothionein promoter is activated to increase transcription and translation in the presence of certain metal ions. Other inducible promoters are known to those of ordinary skill in the art.

[0239] In general, the gene expression sequence shall include, as necessary, 5' non-transcribing and 5' non-translating sequences involved with the initiation of transcription and translation, respectively, such as a TATA box, capping sequence, CAAT sequence, and the like. Especially, such 5' non-transcribing sequences will include a promoter region which includes a promoter sequence for transcriptional control of the operably joined nucleic acid. The gene expression sequences optionally includes enhancer sequences or upstream activator sequences as desired.

[0240] Preferably, any of the FGE nucleic acid molecules of the invention is linked to a gene expression sequence which permits expression of the nucleic acid molecule in a cell of a specific cell lineage, e.g., a neuron. A sequence which permits expression of the nucleic acid molecule in a cell such as a neuron, is one which is selectively active in such a cell type, thereby causing expression of the nucleic acid molecule in these cells. The synapsin-1 promoter, for example, can be used to express any of the foregoing nucleic acid molecules of the invention in a neuron; and the von Willebrand factor gene promoter, for example, can be used to express a nucleic acid molecule in a vascular endothelial cell. Those of ordinary skill in the art will be able to easily identify alternative promoters that are capable of expressing a nucleic acid molecule in any of the preferred cells of the invention.

[0241] The nucleic acid sequence and the gene expression sequence are said to be "operably linked" when they are covalently linked in such a way as to place the transcription and/or translation of the nucleic acid coding sequence (e.g, in the case of FGE, SEQ ID NO. 3) under the influence or control of the gene expression sequence. If it is desired that the nucleic acid sequence be translated into a functional protein, two DNA sequences are said to be operably linked if induction of a promoter in the 5' gene expression sequence results in the transcription of the nucleic acid sequence and if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame-shift mutation, (2) interfere with the ability of the promoter region to direct the transcription of the nucleic acid sequence, and/or (3) interfere with the ability of the corresponding RNA transcript to be translated into a protein. Thus, a gene expression sequence would be operably linked to a nucleic acid sequence if the gene expression sequence were capable of effecting transcription of that nucleic acid sequence such that the resulting transcript might be translated into the desired protein or polypeptide.

[0242] The molecules of the invention can be delivered to the preferred cell types of the invention alone or in association with a vector (see also earlier discussion on vectors). In its broadest sense (and consistent with the description of expression and targeting vectors elsewhere herein), a "vector" is any vehicle capable of facilitating: (1) delivery of a molecule to a target cell and/or (2) uptake of the molecule by a target cell. Preferably, the delivery vectors transport the molecule into the target cell with reduced degradation relative to the extent of degradation that would result in the absence of the vector. Optionally, a "targeting ligand" can be attached to the vector to selectively deliver the vector to a cell which expresses on its surface the cognate receptor for the targeting ligand. In this manner, the vector (containing a nucleic acid or a protein) can be selectively delivered to a neuron. Methodologies for targeting include conjugates, such as those described in U.S. Pat. No. 5,391,723 to Priest. Another example of a well-known targeting vehicle is a liposome. Liposomes are commercially available from Gibco BRL. Numerous methods are published for making targeted liposomes.

[0243] In general, the vectors useful in the invention include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of the nucleic acid sequences of the invention, and additional nucleic acid fragments (e.g., enhancers, promoters) which can be attached to the nucleic acid sequences of the invention. Viral vectors are a preferred type of vector and include, but are not limited to, nucleic acid sequences from the following viruses: adenovirus; adeno-associated virus; retrovirus, such as moloney murine leukemia virus; harvey murine sarcoma virus; murine mammary tumor virus; rouse sarcoma virus; SV40-type viruses; polyoma viruses; Epstein-Ban viruses; papilloma viruses; herpes virus; vaccinia virus; polio virus; and RNA virus such as a retrovirus. One can readily employ other vectors not named but known in the art.

[0244] A particularly preferred virus for certain applications is the adeno-associated virus, a double-stranded. DNA virus. The adeno-associated virus is capable of infecting a wide range of cell types and species and can be engineered to be replication-deficient. It further has advantages, such as heat and lipid solvent stability, high transduction frequencies in cells of diverse lineages, including hematopoietic cells, and lack of superinfection inhibition thus allowing multiple series of transductions. Reportedly, the adeno-associated virus can integrate into human cellular DNA in a site-specific manner, thereby minimizing the possibility of insertional mutagenesis and variability of inserted gene expression. In addition, wild-type adeno-associated virus infections have been followed in tissue culture for greater than 100 passages in the absence of selective pressure, implying that the adeno-associated virus genomic integration is a relatively stable event. The adeno-associated virus can also function in an extrachromosomal fashion.

[0245] In general, other preferred viral vectors are based on non-cytopathic eukaryotic viruses in which non-essential genes have been replaced with the gene of interest. Non-cytopathic viruses include retroviruses, the life cycle of which involves reverse transcription of genomic viral RNA into DNA with subsequent proviral integration into host cellular DNA. Adenoviruses and retroviruses have been approved for human gene therapy trials. In general, the retroviruses are replication-deficient (i.e., capable of directing synthesis of the desired proteins, but incapable of manufacturing an infectious particle). Such genetically altered retroviral expression vectors have general utility for the high-efficiency transduction of genes in vivo. Standard protocols for producing replication-deficient retroviruses (including the steps of incorporation of exogenous genetic material into a plasmid, transfection of a packaging cell lined with plasmid, production of recombinant retroviruses by the packaging cell line, collection of viral particles from tissue culture media, and infection of the target cells with viral particles) are provided in Kriegler, M., "Gene Transfer and Expression, A Laboratory Manual," W.H. Freeman C.O., New York (1990) and Murry, E. J. Ed. "Methods in Molecular Biology," vol. 7, Humana Press, Inc., Cliffton, New Jersey (1991).

[0246] Another preferred retroviral vector is the vector derived from the moloney murine leukemia virus, as described in Nabel, E. G., et al., Science, 1990, 249:1285-1288. These vectors reportedly were effective for the delivery of genes to all three layers of the arterial wall, including the media. Other preferred vectors are disclosed in Flugelman, et al., Circulation, 1992, 85:1110-1117. Additional vectors that are useful for delivering molecules of the invention are described in U.S. Pat. No. 5,674,722 by Mulligan, et. al.

[0247] In addition to the foregoing vectors, other delivery methods may be used to deliver a molecule of the invention to a cell such as a neuron, liver, fibroblast, and/or a vascular endothelial cell, and facilitate uptake thereby.

[0248] A preferred such delivery method of the invention is a colloidal dispersion system. Colloidal dispersion systems include lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. A preferred colloidal system of the invention is a liposome. Liposomes are artificial membrane vessels which are useful as a delivery vector in vivo or in vitro. It has been shown that large unilamellar vessels (LUV), which range in size from 0.2-4.0 .mu.m can encapsulate large macromolecules. RNA, DNA, and intact virions can be encapsulated within the aqueous interior and be delivered to cells in a biologically active form (Fraley, et al., Trends Biochem. Sci., 1981, 6:77). In order for a liposome to be an efficient gene transfer vector, one or more of the following characteristics should be present: (1) encapsulation of the gene of interest at high efficiency with retention of biological activity; (2) preferential and substantial binding to a target cell in comparison to non-target cells; (3) delivery of the aqueous contents of the vesicle to the target cell cytoplasm at high efficiency; and (4) accurate and effective expression of genetic information.

[0249] Liposomes may be targeted to a particular tissue, such as the myocardium or the vascular cell wall, by coupling the liposome to a specific ligand such as a monoclonal antibody, sugar, glycolipid, or protein. Ligands which may be useful for targeting a liposome to the vascular wall include, but are not limited to the viral coat protein of the Hemagglutinating virus of Japan. Additionally, the vector may be coupled to a nuclear targeting peptide, which will direct the nucleic acid to the nucleus of the host cell.

[0250] Liposomes are commercially available from Gibco BRL, for example, as LIPOFECTIN.TM. and LIPOFECTACE.TM., which are formed of cationic lipids such as N-[1-(2,3dioleyloxy)-propyl]-N,N,N-trimethylammonium chloride (DOTMA) and dimethyl dioctadecylammonium bromide (DDAB). Methods for making liposomes are well known in the art and have been described in many publications. Liposomes also have been reviewed by Gregoriadis, G. in Trends in Biotechnology, V. 3, p. 235-241 (1985). Novel liposomes for the intracellular delivery of macromolecules, including nucleic acids, are also described in PCT International application no. PCT/US96/07572 (Publication NO. WO 96/40060, entitled "Intracellular Delivery of Macromolecules").

[0251] In one particular embodiment, the preferred vehicle is a biocompatible micro particle or implant that is suitable for implantation into the mammalian recipient. Exemplary bioerodible implants that are useful in accordance with this method are described in PCT International application no. PCT/US/03307 (Publication No. WO 95/24929, entitled "Polymeric Gene Delivery System", claiming priority to U.S. patent application Ser. No. 213,668, filed Mar. 15, 1994). PCT/US/0307 describes a biocompatible, preferably biodegradable polymeric matrix for containing an exogenous gene under the control of an appropriate promoter. The polymeric matrix is used to achieve sustained release of the exogenous gene in the patient. In accordance with the instant invention, the nucleic acids described herein are encapsulated or dispersed within the biocompatible, preferably biodegradable polymeric matrix disclosed in PCT/US/03307. The polymeric matrix preferably is in the form of a micro particle such as a micro sphere (wherein a nucleic acid is dispersed throughout a solid polymeric matrix) or a microcapsule (wherein a nucleic acid is stored in the core of a polymeric shell). Other forms of the polymeric matrix for containing the nucleic acids of the invention include films, coatings, gels, implants, and stents. The size and composition of the polymeric matrix device is selected to result in favorable release kinetics in the tissue into which the matrix device is implanted. The size of the polymeric matrix devise further is selected according to the method of delivery which is to be used, typically injection into a tissue or administration of a suspension by aerosol into the nasal and/or pulmonary areas. The polymeric matrix composition can be selected to have both favorable degradation rates and also to be formed of a material which is bioadhesive, to further increase the effectiveness of transfer when the devise is administered to a vascular surface. The matrix composition also can be selected not to degrade, but rather, to release by diffusion over an extended period of time.

[0252] Both non-biodegradable and biodegradable polymeric matrices can be used to deliver the nucleic acids of the invention to the subject. Biodegradable matrices are preferred. Such polymers may be natural or synthetic polymers. Synthetic polymers are preferred. The polymer is selected based on the period of time over which release is desired, generally in the order of a few hours to a year or longer. Typically, release over a period ranging from between a few hours and three to twelve months is most desirable. The polymer optionally is in the form of a hydrogel that can absorb up to about 90% of its weight in water and further, optionally is cross-linked with multi-valent ions or other polymers.

[0253] In general, the nucleic acids of the invention are delivered using the bioerodible implant by way of diffusion, or more preferably, by degradation of the polymeric matrix. Exemplary synthetic polymers which can be used to form the biodegradable delivery system include: polyamides, polycarbonates, polyalkylenes, polyalkylene glycols, polyalkylene oxides, polyalkylene terepthalates, polyvinyl alcohols, polyvinyl ethers, polyvinyl esters, poly-vinyl halides, polyvinylpyrrolidone, polyglycolides, polysiloxanes, polyurethanes and co-polymers thereof, alkyl cellulose, hydroxyalkyl celluloses, cellulose ethers, cellulose esters, nitro celluloses, polymers of acrylic and methacrylic esters, methyl cellulose, ethyl cellulose, hydroxypropyl cellulose, hydroxy-propyl methyl cellulose, hydroxybutyl methyl cellulose, cellulose acetate, cellulose propionate, cellulose acetate butyrate, cellulose acetate phthalate, carboxylethyl cellulose, cellulose triacetate, cellulose sulphate sodium salt, poly(methyl methacrylate), poly(ethyl methacrylate), poly(butylmethacrylate), poly(isobutyl methacrylate), poly(hexylmethacrylate), poly(isodecyl methacrylate), poly(lauryl methacrylate), poly(phenyl methacrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), poly(octadecyl acrylate), polyethylene, polypropylene, poly(ethylene glycol), poly(ethylene oxide), poly(ethylene terephthalate), poly(vinyl alcohols), polyvinyl acetate, poly vinyl chloride, polystyrene and polyvinylpyrrolidone.

[0254] Examples of non-biodegradable polymers include ethylene vinyl acetate, poly(meth) acrylic acid, polyamides, copolymers and mixtures thereof.

[0255] Examples of biodegradable polymers include synthetic polymers such as polymers of lactic acid and glycolic acid, polyanhydrides, poly(ortho)esters, polyurethanes, poly(butic acid), poly(valeric acid), and poly(lactide-cocaprolactone), and natural polymers such as alginate and other polysaccharides including dextran and cellulose, collagen, chemical derivatives thereof (substitutions, additions of chemical groups, for example, alkyl, alkylene, hydroxylations, oxidations, and other modifications routinely made by those skilled in the art), albumin and other hydrophilic proteins, zein and other prolamines and hydrophobic proteins, copolymers and mixtures thereof. In general, these materials degrade either by enzymatic hydrolysis or exposure to water in vivo, by surface or bulk erosion.

[0256] Bioadhesive polymers of particular interest include bioerodible hydrogels described by H. S. Sawhney, C. P. Pathak and J. A. Hubell in Macromolecules, 1993, 26, 581-587, the teachings of which are incorporated herein, polyhyaluronic acids, casein, gelatin, glutin, polyanhydrides, polyacrylic acid, alginate, chitosan, poly(methyl methacrylates), poly(ethyl methacrylates), poly(butylmethacrylate), poly(isobutyl methacrylate), poly(hexylmethacrylate), poly(isodecyl methacrylate), poly(lauryl methacrylate), poly(phenyl methacrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), and poly(octadecyl acrylate). Thus, the invention provides a composition of the above-described molecules of the invention for use as a medicament, methods for preparing the medicament and methods for the sustained release of the medicament in vivo.

[0257] Compaction agents also can be used in combination with a vector of the invention. A "compaction agent", as used herein, refers to an agent, such as a histone, that neutralizes the negative charges on the nucleic acid and thereby permits compaction of the nucleic acid into a fine granule. Compaction of the nucleic acid facilitates the uptake of the nucleic acid by the target cell. The compaction agents can be used alone, i.e., to deliver an isolated nucleic acid of the invention in a form that is more efficiently taken up by the cell or, more preferably, in combination with one or more of the above-described vectors.

[0258] Other exemplary compositions that can be used to facilitate uptake by a target cell of the nucleic acids of the invention include calcium phosphate and other chemical mediators of intracellular transport, microinjection compositions, and electroporation.

[0259] The invention embraces methods for increasing sulfatase activity in a cell. Such methods involve contacting a cell expressing a sulfatase with an isolated nucleic acid molecule of of the invention (e.g., an isolated nucleic acid molecule as claimed in any one of claims 1-8, an FGE nucleic acid molecule having a sequence selected from the group consisting of SEQ ID NO: 1, 3, 4, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, and 80-87), or an expression product thereof (e.g., a polypeptide as claimed in claims 11-15, 19, 20, or a peptide having a sequence selected from the group consisting of SEQ ID NO. 2, 5, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, and 78), in an amount effective to increase sulfatase activity in the cell. "Increasing" sulfatase activity, as used herein, refers to increased affinity for, and/or conversion of, the specific substrate for the sulfatase, typically the result of an increase in FGly formation on the sulfatase molecule. In one embodiment, the cell expresses a sulfatase at levels higher than those of wild type cells.

[0260] By "increasing sulfatase activity in a cell" also refers to increasing activity of a sulfatase that is secreted by the cell. The cell may express an endogenous and/or an exogenous sulfatase. Said contacting of the FGE molecule also refers to activating the cells's endogenous FGE gene. In important embodiments, the endogenous sulfatase is activated. In certain embodiments, the sulfatase is Iduronate 2-Sulfatase, Sulfamidase, N-Acetylgalactosamine 6-Sulfatase, N-Acetylglucosamine 6-Sulfatase, Arylsulfatase A, Arylsulfatase B, Arylsulfatase C, Arylsulfatase D, Arylsulfatase E, Arylsulfatase F, Arylsulfatase G, HSulf-1, HSulf-2, HSulf-3, HSulf-4, HSulf-5, and/or HSulf-6. In certain embodiments the cell is a mammalian cell.

[0261] According to another aspect of the invention, a pharmaceutical composition, is provided. The composition comprises a sulfatase that is produced by cell, in a pharmaceutically effective amount to treat a sulfatase deficiency, and a pharmaceutically acceptable carrier, wherein said cell has been contacted with an agent comprising an isolated nucleic acid molecule of the invention (e.g., as claimed in claims 1-8, or a nucleic acid molecule having a sequence selected from the group consisting of SEQ ID NO: 1, 3, 4, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, and 80-87), or an expression product thereof (e.g., a peptide selected from the group consisting of SEQ ID NO. 2, 5, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, and 78). In important embodiments, the sulfatase is expressed at higher levels than normal/control cells.

[0262] The invention also embraces a sulfatase producing cell wherein the ratio of active sulfatase to total sulfatase produced by the cell is increased. The cell comprises: (i) a sulfatase with an increased activity compared to a control, and (ii) a Formylglycine Generating Enzyme with an increased activity compared to a control, wherein the ratio of active sulfatase to total sulfatase produced by the cell is increased by at least 5% over the ratio of active sulfatase to total sulfatase produced by the cell in the absence of the Formylglycine Generating Enzyme. It is known in the art that overexpression of sulfatases can decrease the activity of endogenous sulfatases (Anson et al., Biochem. J., 1993, 294:657-662). Furthermore, only a fraction of the recombinant sulfatases is active. We have discovered, unexpectedly, that increased expression/activity of FGE in a cell with increased expression/activity of a sulfatase results in the production of a sulfatase that is more active. Since the presence of FGly on a sulfatase molecule is associated with sulfatase activity, "active sulfatase" can be quantitated by determining the presence of FGly on the sulfatase cell product using MALDI-TOF mass spectrometry, as described elsewhere herein. The ratio with total sulfatase can then be easily determined.

[0263] The invention also provides methods for the diagnosis and therapy of sulfatase deficiencies. Such disorders include, but are not limited to, Multiple Sulfatase Deficiency, Mucopolysaccharidosis II (MPS II; Hunter Syndrome), Mucopolysaccharidosis IIIA (MPS IIIA; Sanfilippo Syndrome A), Mucopolysaccharidosis VIII (MPS VIII), Mucopolysaccharidosis IVA (MPS IVA; Morquio Syndrome A), Mucopolysaccharidosis VI (MPS VI; Maroteaux-Lamy Syndrome), Metachromatic Leukodystrophy (MLD), X-linked Recessive Chondrodysplasia Punctata 1, and X-linked Ichthyosis (Steroid Sulfatase Deficiency).

[0264] The methods of the invention are useful in both the acute and the prophylactic treatment of any of the foregoing conditions. As used herein, an acute treatment refers to the treatment of subjects having a particular condition. Prophylactic treatment refers to the treatment of subjects at risk of having the condition, but not presently having or experiencing the symptoms of the condition.

[0265] In its broadest sense, the terms "treatment" or "to treat" refer to both acute and prophylactic treatments. If the subject in need of treatment is experiencing a condition (or has or is having a particular condition), then treating the condition refers to ameliorating, reducing or eliminating the condition or one or more symptoms arising from the condition. In some preferred embodiments, treating the condition refers to ameliorating, reducing or eliminating a specific symptom or a specific subset of symptoms associated with the condition. If the subject in need of treatment is one who is at risk of having a condition, then treating the subject refers to reducing the risk of the subject having the condition.

[0266] The mode of administration and dosage of a therapeutic agent of the invention will vary with the particular stage of the condition being treated, the age and physical condition of the subject being treated, the duration of the treatment, the nature of the concurrent therapy (if any), the specific route of administration, and the like factors within the knowledge and expertise of the health practitioner.

[0267] As described herein, the agents of the invention are administered in effective amounts to treat any of the foregoing sulfatase deficiencies. In general, an effective amount is any amount that can cause a beneficial change in a desired tissue of a subject. Preferably, an effective amount is that amount sufficient to cause a favorable phenotypic change in a particular condition such as a lessening, alleviation or elimination of a symptom or of a condition as a whole.

[0268] In general, an effective amount is that amount of a pharmaceutical preparation that alone, or together with further doses, produces the desired response. This may involve only slowing the progression of the condition temporarily, although more preferably, it involves halting the progression of the condition permanently or delaying the onset of or preventing the condition from occurring. This can be monitored by routine methods. Generally, doses of active compounds would be from about 0.01 mg/kg per day to 1000 mg/kg per day. It is expected that doses ranging from 50 .mu.g-500 mg/kg will be suitable, preferably orally and in one or several administrations per day.

[0269] Such amounts will depend, of course, on the particular condition being treated, the severity of the condition, the individual patient parameters including age, physical condition, size and weight, the duration of the treatment, the nature of concurrent therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health practitioner. Lower doses will result from certain forms of administration, such as intravenous administration. In the event that a response in a subject is insufficient at the initial doses applied, higher doses (or effectively higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits. Multiple doses per day are contemplated to achieve appropriate systemic levels of compounds. It is preferred generally that a maximum dose be used, that is, the highest safe dose according to sound medical judgment. It will be understood by those of ordinary skill in the art, however, that a patient may insist upon a lower dose or tolerable dose for medical reasons, psychological reasons or for virtually any other reasons.

[0270] The agents of the invention may be combined, optionally, with a pharmaceutically-acceptable carrier to form a pharmaceutical preparation. The term "pharmaceutically-acceptable carrier" as used herein means one or more compatible solid or liquid fillers, diluents or encapsulating substances which are suitable for administration into a human. The term "carrier" denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application. The components of the pharmaceutical compositions also are capable of being co-mingled with the molecules of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficacy. In some aspects, the pharmaceutical preparations comprise an agent of the invention in an amount effective to treat a disorder.

[0271] The pharmaceutical preparations may contain suitable buffering agents, including: acetic acid in a salt; citric acid in a salt; boric acid in a salt; or phosphoric acid in a salt. The pharmaceutical compositions also may contain, optionally, suitable preservatives, such as: benzalkonium chloride; chlorobutanol; parabens or thimerosal.

[0272] A variety of administration routes are available. The particular mode selected will depend, of course, upon the particular drug selected, the severity of the condition being treated and the dosage required for therapeutic efficacy. The methods of the invention, generally speaking, may be practiced using any mode of administration that is medically acceptable, meaning any mode that produces effective levels of the active compounds without causing clinically unacceptable adverse effects. Such modes of administration include oral, rectal, topical, nasal, intradermal, transdermal, or parenteral routes. The term "parenteral" includes subcutaneous, intravenous, intraomental, intramuscular, or infusion. Intravenous or intramuscular routes are not particularly suitable for long-term therapy and prophylaxis. As an example, pharmaceutical compositions for the acute treatment of subjects having a migraine headache may be formulated in a variety of different ways and for a variety of administration modes including tablets, capsules, powders, suppositories, injections and nasal sprays.

[0273] The pharmaceutical preparations may conveniently be presented in unit dosage form and may be prepared by any of the methods well-known in the art of pharmacy. All methods include the step of bringing the active agent into association with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the active compound into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product.

[0274] Compositions suitable for oral administration may be presented as discrete units, such as capsules, tablets, lozenges, each containing a predetermined amount of the active compound. Other compositions include suspensions in aqueous liquids or non-aqueous liquids such as a syrup, elixir or an emulsion.

[0275] Compositions suitable for parenteral administration conveniently comprise a sterile aqueous preparation of an agent of the invention, which is preferably isotonic with the blood of the recipient. This aqueous preparation may be formulated according to known methods using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation also may be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example, as a solution in 1,3-butane diol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil may be employed including synthetic mono-or di-glycerides. In addition, fatty acids such as oleic acid may be used in the preparation of injectables. Formulations suitable for oral, subcutaneous, intravenous, intramuscular, etc. administrations can be found in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa.

[0276] According to one aspect of the invention, a method for increasing C.sub..alpha.-formylglycine generating activity in a cell, is provided. The method involves contacting the cell with an isolated nucleic acid molecule of the invention (e.g., a nucleic acid of SEQ ID NO.1), or an expression product thereof (e.g., a peptide of SEQ ID NO.2), in an amount effective to increase C.sub..alpha.-formylglycine generating activity in the cell. In important embodiments, the method involves activating the endogenous FGE gene to increase C.sub..alpha.-formylglycine generating activity in the cell. In some embodiments, the contacting is performed under conditions that permit entry of a molecule of the invention into the cell.

[0277] The term "permit entry" of a molecule into a cell according to the invention has the following meanings depending upon the nature of the molecule. For an isolated nucleic acid it is meant to describe entry of the nucleic acid through the cell membrane and into the cell nucleus, where upon the "nucleic acid transgene" can utilize the cell machinery to produce functional polypeptides encoded by the nucleic acid. By "nucleic acid transgene" it is meant to describe all of the nucleic acids of the invention with or without the associated vectors. For a polypeptide, it is meant to describe entry of the polypeptide through the cell membrane and into the cell cytoplasm, and if necessary, utilization of the cell cytoplasmic machinery to functionally modify the polypeptide (e.g., to an active form).

[0278] Various techniques may be employed for introducing nucleic acids of the invention into cells, depending on whether the nucleic acids are introduced in vitro or in vivo in a host. Such techniques include transfection of nucleic acid-CaPO.sub.4 precipitates, transfection of nucleic acids associated with DEAE, transfection with a retrovirus including the nucleic acid of interest, liposome mediated transfection, and the like. For certain uses, it is preferred to target the nucleic acid to particular cells. In such instances, a vehicle used for delivering a nucleic acid of the invention into a cell (e.g., a retrovirus, or other virus; a liposome) can have a targeting molecule attached thereto. For example, a molecule such as an antibody specific for a surface membrane protein on the target cell or a ligand for a receptor on the target cell can be bound to or incorporated within the nucleic acid delivery vehicle. For example, where liposomes are employed to deliver the nucleic acids of the invention, proteins which bind to a surface membrane protein associated with endocytosis may be incorporated into the liposome formulation for targeting and/or to facilitate uptake. Such proteins include capsid proteins or fragments thereof tropic for a particular cell type, antibodies for proteins which undergo internalization in cycling, proteins that target intracellular localization and enhance intracellular half life, and the like. Polymeric delivery systems also have been used successfully to deliver nucleic acids into cells, as is known by those skilled in the art. Such systems even permit oral delivery of nucleic acids.

[0279] Other delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of an agent of the present invention, increasing convenience to the subject and the physician. Many types of release delivery systems are available and known to those of ordinary skill in the art. They include polymer base systems such as poly(lactide-glycolide), copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides. Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S. Pat. No. 5,075,109. Delivery systems also include non-polymer systems that are: lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono- di- and tri-glycerides; hydrogel release systems; sylastic systems; peptide based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and the like. Specific examples include, but are not limited to: (a) erosional systems in which an agent of the invention is contained in a form within a matrix such as those described in U.S. Pat. Nos. 4,452,775, 4,675,189, and 5,736,152, and (b) diffusional systems in which an active component permeates at a controlled rate from a polymer such as described in U.S. Pat. Nos. 3,854,480, 5,133,974 and 5,407,686. In addition, pump-based hardware delivery systems can be used, some of which are adapted for implantation.

[0280] Use of a long-term sustained release implant may be desirable. Long-term release, as used herein, means that the implant is constructed and arranged to deliver therapeutic levels of the active ingredient for at least 30 days, and preferably 60 days. Long-term sustained release implants are well-known to those of ordinary skill in the art and include some of the release systems described above. Specific examples include, but are not limited to, long-term sustained release implants described in U.S. Pat. No. 4,748,024, and Canadian Patent No. 1330939.

[0281] The invention also involves the administration, and in some embodiments co-administration, of agents other than the FGE molecules of the invention that when administered in effective amounts can act cooperatively, additively or synergistically with a molecule of the invention to: (i) modulate C.sub..alpha.-formylglycine generating activity, and (ii) treat any of the conditions in which C.sub..alpha.-formylglycine generating activity of a molecule of the invention is involved (e.g., a sulfatase deficiency including MSD). Agents other than the molecules of the invention include Iduronate 2-Sulfatase, Sulfamidase, N-Acetylgalactosamine 6-Sulfatase, N-Acetylglucosamine 6-Sulfatase, Arylsulfatase A, Arylsulfatase B, Arylsulfatase C, Arylsulfatase D, Arylsulfatase E, Arylsulfatase F, Arylsulfatase G, HSulf-1, HSulf-2, HSulf-3, HSulf-4, HSulf-5, or HSulf-6, (nucleic acids and polypeptides, and/or fragments thereof), and/or combinations thereof.

[0282] "Co-administering," as used herein, refers to administering simultaneously two or more compounds of the invention (e.g., an FGE nucleic acid and/or polypeptide, and an agent known to be beneficial in the treatment of, for example, a sulfatase deficiency--e.g., Iduronate 2-Sulfatase in the treatment of MPSII-), as an admixture in a single composition, or sequentially, close enough in time so that the compounds may exert an additive or even synergistic effect.

[0283] The invention also embraces solid-phase nucleic acid molecule arrays. The array consists essentially of a set of nucleic acid molecules, expression products thereof, or fragments (of either the nucleic acid or the polypeptide molecule) thereof, each nucleic acid molecule selected from the group consisting of FGE, Iduronate 2-Sulfatase, Sulfamidase, N-Acetylgalactosamine 6-Sulfatase, N-Acetylglucosamine 6-Sulfatase, Arylsulfatase A, Arylsulfatase B, Arylsulfatase C, Arylsulfatase D, Arylsulfatase E, Arylsulfatase F, Arylsulfatase G, HSulf-1, HSulf-2, HSulf-3, HSulf-4, HSulf-5, and HSulf-6, fixed to a solid substrate. In some embodiments, the solid-phase array further comprises at least one control nucleic acid molecule. In certain embodiments, the set of nucleic acid molecules comprises at least one, at least two, at least three, at least four, or even at least five nucleic acid molecules, each selected from the group consisting of FGE, Iduronate 2-Sulfatase, Sulfamidase, N-Acetylgalactosamine 6-Sulfatase, N-Acetylglucosamine 6-Sulfatase, Arylsulfatase A, Arylsulfatase B, Arylsulfatase C, Arylsulfatase D, Arylsulfatase E, Arylsulfatase F, Arylsulfatase G, HSulf-1, HSulf-2, HSulf-3, HSulf-4, HSulf-5, and HSulf-6. In preferred embodiments, the set of nucleic acid molecules comprises a maximum number of 100 different nucleic acid molecules. In important embodiments, the set of nucleic acid molecules comprises a maximum number of 10 different nucleic acid molecules.

[0284] According to the invention, standard hybridization techniques of microarray technology are utilized to assess patterns of nucleic acid expression and identify nucleic acid expression. Microarray technology, which is also known by other names including: DNA chip technology, gene chip technology, and solid-phase nucleic acid array technology, is well known to those of ordinary skill in the art and is based on, but not limited to, obtaining an array of identified nucleic acid probes (e.g., molecules described elsewhere herein such as of FGE, Iduronate 2-Sulfatase, Sulfamidase, N-Acetylgalactosamine 6-Sulfatase, N-Acetylglucosamine 6-Sulfatase, Arylsulfatase A, Arylsulfatase B, Arylsulfatase C, Arylsulfatase D, Arylsulfatase E, Arylsulfatase F, Arylsulfatase G, HSulf-1, HSulf-2, HSulf-3, HSulf-4, HSulf-5, and/or HSulf-6) on a fixed substrate, labeling target molecules with reporter molecules (e.g., radioactive, chemiluminescent, or fluorescent tags such as fluorescein, Cye3-dUTP, or Cye5-dUTP), hybridizing target nucleic acids to the probes, and evaluating target-probe hybridization. A probe with a nucleic acid sequence that perfectly matches the target sequence will, in general, result in detection of a stronger reporter-molecule signal than will probes with less perfect matches. Many components and techniques utilized in nucleic acid microarray technology are presented in The Chipping Forecast, Nature Genetics, Vol. 21, January 1999, the entire contents of which is incorporated by reference herein.

[0285] According to the present invention, microarray substrates may include but are not limited to glass, silica, aluminosilicates, borosilicates, metal oxides such as alumina and nickel oxide, various clays, nitrocellulose, or nylon. In all embodiments a glass substrate is preferred. According to the invention, probes are selected from the group of nucleic acids including, but not limited to: DNA, genomic DNA, cDNA, and oligonucleotides; and may be natural or synthetic. Oligonucleotide probes preferably are 20 to 25-mer oligonucleotides and DNA/cDNA probes preferably are 500 to 5000 bases in length, although other lengths may be used. Appropriate probe length may be determined by one of ordinary skill in the art by following art-known procedures. In one embodiment, preferred probes are sets of two or more of the nucleic acid molecules set forth as SEQ ID NOs: 1, 3, 4, 6, 8, 10, and/or 12. Probes may be purified to remove contaminants using standard methods known to those of ordinary skill in the art such as gel filtration or precipitation.

[0286] In one embodiment, the microarray substrate may be coated with a compound to enhance synthesis of the probe on the substrate. Such compounds include, but are not limited to, oligoethylene glycols. In another embodiment, coupling agents or groups on the substrate can be used to covalently link the first nucleotide or olignucleotide to the substrate. These agents or groups may include, but are not limited to: amino, hydroxy, bromo, and carboxy groups. These reactive groups are preferably attached to the substrate through a hydrocarbyl radical such as an alkylene or phenylene divalent radical, one valence position occupied by the chain bonding and the remaining attached to the reactive groups. These hydrocarbyl groups may contain up to about ten carbon atoms, preferably up to about six carbon atoms. Alkylene radicals are usually preferred containing two to four carbon atoms in the principal chain. These and additional details of the process are disclosed, for example, in U.S. Pat. No. 4,458,066, which is incorporated by reference in its entirety.

[0287] In one embodiment, probes are synthesized directly on the substrate in a predetermined grid pattern using methods such as light-directed chemical synthesis, photochemical deprotection, or delivery of nucleotide precursors to the substrate and subsequent probe production.

[0288] In another embodiment, the substrate may be coated with a compound to enhance binding of the probe to the substrate. Such compounds include, but are not limited to: polylysine, amino silanes, amino-reactive silanes (Chipping Forecast, 1999) or chromium (Gwynne and Page, 2000). In this embodiment, presynthesized probes are applied to the substrate in a precise, predetermined volume and grid pattern, utilizing a computer-controlled robot to apply probe to the substrate in a contact-printing manner or in a non-contact manner such as ink jet or piezo-electric delivery. Probes may be covalently linked to the substrate with methods that include, but are not limited to, UV-irradiation. In another embodiment probes are linked to the substrate with heat.

[0289] Targets are nucleic acids selected from the group, including but not limited to: DNA, genomic DNA, cDNA, RNA, mRNA and may be natural or synthetic. In all embodiments, nucleic acid molecules from subjects suspected of developing or having a sulfatase deficiency, are preferred. In certain embodiments of the invention, one or more control nucleic acid molecules are attached to the substrate. Preferably, control nucleic acid molecules allow determination of factors including but not limited to: nucleic acid quality and binding characteristics; reagent quality and effectiveness; hybridization success; and analysis thresholds and success. Control nucleic acids may include, but are not limited to, expression products of genes such as housekeeping genes or fragments thereof.

[0290] To select a set of sulfatase deficiency disease markers, the expression data generated by, for example, microarray analysis of gene expression, is preferably analyzed to determine which genes in different categories of patients (each category of patients being a different sulfatase deficiency disorder), are significantly differentially expressed. The significance of gene expression can be determined using Permax computer software, although any standard statistical package that can discriminate significant differences is expression may be used. Permax performs permutation 2-sample t-tests on large arrays of data. For high dimensional vectors of observations, the Permax software computes t-statistics for each attribute, and assesses significance using the permutation distribution of the maximum and minimum overall attributes. The main use is to determine the attributes (genes) that are the most different between two groups (e.g., control healthy subject and a subject with a particular sulfatase deficiency), measuring "most different" using the value of the t-statistics, and their significance levels.

[0291] Expression of sulfatase deficiency disease related nucleic acid molecules can also be determined using protein measurement methods to determine expression of SEQ ID NOs: 2, e.g., by determining the expression of polypeptides encoded by SEQ ID NOs: 1, and/or 3. Preferred methods of specifically and quantitatively measuring proteins include, but are not limited to: mass spectroscopy-based methods such as surface enhanced laser desorption ionization (SELDI; e.g., Ciphergen ProteinChip System), non-mass spectroscopy-based methods, and immunohistochemistry-based methods such as 2-dimensional gel electrophoresis.

[0292] SELDI methodology may, through procedures known to those of ordinary skill in the art, be used to vaporize microscopic amounts of protein and to create a "fingerprint" of individual proteins, thereby allowing simultaneous measurement of the abundance of many proteins in a single sample. Preferably SELDI-based assays may be utilized to characterize multiple sulfatase deficiency as well as stages of such conditions. Such assays preferably include, but are not limited to the following examples. Gene products discovered by RNA microarrays may be selectively measured by specific (antibody mediated) capture to the SELDI protein disc (e.g., selective SELDI). Gene products discovered by protein screening (e.g., with 2-D gels), may be resolved by "total protein SELDI" optimized to visualize those particular markers of interest from among SEQ ID NOs: 1, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, and/or 28. Predictive models of a specific sulfatase deficiency from SELDI measurement of multiple markers from among SEQ ID NOs: 1, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, and/or 28, may be utilized for the SELDI strategies.

[0293] The use of any of the foregoing microarray methods to determine expression of a sulfatase deficiency disease related nucleic acids can be done with routine methods known to those of ordinary skill in the art and the expression determined by protein measurement methods may be correlated to predetermined levels of a marker used as a prognostic method for selecting treatment strategies for sulfatase deficiency disease patients.

[0294] The invention also embraces a sulfatase-producing cell wherein the ratio of active sulfatase to total sulfatase produced (i.e., the specific activity) by the cell is increased. The cell comprises: (i) a sulfatase with an increased expression, and (ii) a Formylglycine Generating Enzyme with an increased expression, wherein the ratio of active sulfatase to total sulfatase produced by the cell is increased by at least 5% over the ratio of active sulfatase to total sulfatase produced by the cell in the absence of the Formylglycine Generating Enzyme.

[0295] A "sulfatase with an increased expression," as used herein, typically refers to increased expression of a sulfatase and/or its encoded polypeptide compared to a control. Increased expression refers to increasing (i.e., to a detectable extent) replication, transcription, and/or translation of any of the sulfatase nucleic acids (sulfatase nucleic acids of the invention as described elsewhere herein), since upregulation of any of these processes results in concentration/amount increase of the polypeptide encoded by the gene (nucleic acid). This can be accomplished using a number of methods known in the art, also described elsewhere herein, such as transfection of a cell with the sulfatase cDNA, and/or genomic DNA encompassing the sulfatase locus, activating the endogenous sulfatase gene by placing, for example, a strong promoter element upstream of the endogenous sulfatase gene genomic locus using homologous recombination (see, e.g., the gene activation technology described in detail in U.S. Pat. Nos. 5,733,761, 6,270,989, and 6,565,844, all of which are expressly incorporated herein by reference), etc. A typical control would be an identical cell transfected with a vector plasmid(s). Enhancing (or increasing) sulfatase activity also refers to preventing or inhibiting sulfatase degradation (e.g., via increased ubiquitinization), downregulation, etc., resulting, for example, in increased or stable sulfatase molecule t1/2 (half-life) when compared to a control. Downregulation or decreased expression refers to decreased expression of a gene and/or its encoded polypeptide. The upregulation or downregulation of gene expression can be directly determined by detecting an increase or decrease, respectively, in the level of mRNA for the gene (e.g, a sulfatase), or the level of protein expression of the gene-encoded polypeptide, using any suitable means known to the art, such as nucleic acid hybridization or antibody detection methods, respectively, and in comparison to controls. Upregulation or downregulation of sulfatase gene expression can also be determined indirectly by detecting a change in sulfatase activity.

[0296] Similarily, a "Formylglycine Generating Enzyme with an increased expression," as used herein, typically refers to increased expression of an FGE nucleic acid of the invention and/or its encoded polypeptide compared to a control. Increased expression refers to increasing (i.e., to a detectable extent) replication, transcription, and/or translation of any of the FGE nucleic acids of the invention (as described elsewhere herein), since upregulation of any of these processes results in concentration/amount increase of the polypeptide encoded by the gene (nucleic acid). This can be accomplished using the methods described above (for the sulfatases), and elsewhere herein.

[0297] In certain embodiments, the ratio of active sulfatase to total sulfatase produced by the cell is increased by at least 10%, 15%, 20%, 50%, 100%, 200%, 500%, 1000%, over the ratio of active sulfatase to total sulfatase produced by the cell in the absence of the Formylglycine Generating Enzyme.

[0298] The invention further embraces an improved method for treating a sulfatase deficiency in a subject. The method involves administering to a subject in need of such treatment a sulfatase in an effective amount to treat the sulfatase deficiency in the subject, wherein the sulfatase is contacted with a Formylglycine Generating Enzyme in an amount effective to increase the specific activity of the sulfatase. As described elsewhere herein, "specific activity" refers to the ratio of active sulfatase to total sulfatase produced. "Contacted," as used herein, refers to FGE post-translationally modifying the sulfatase as described elsewhere herein. It would be apparent to one of ordinary skill in the art that an FGE can contact a sulfatase and modify it if nucleic acids encoding FGE and a sulfatase are co-expressed in a cell, or even if an isolated FGE polypeptide contacts an isolated sulfatase polypeptide in vivo or in vitro. Even though an isolated FGE polypeptide can be co-administered with an isolated sulfatase polypeptide to a subject to treat a sulfatase deficiency in the subject, it is preferred that the contact between FGE and the sulfatase takes place in vitro prior to administration of the sulfatase to the subject. This improved method of treatment is beneficial to a subject since lower amounts of the sulfatase need to be administered, and/or with less frequency, since the sulfatase is of higher specific activity.

[0299] The invention will be more fully understood by reference to the following examples. These examples, however, are merely intended to illustrate the embodiments of the invention and are not to be construed to limit the scope of the invention.

EXAMPLES

Example 1

Multiple Sulfatase Deficiency is Caused by Mutations in the Gene Encoding the Human C.alpha.-Formylglycine Generating Enzyme (FGE)

Experimental Procedures

Materials and Methods

In Vitro Assay for FGE

[0300] For monitoring the activity of FGE, the N-acetylated and C-amidated 23mer peptide P23 (MTDFYVPVSLCTPSRAALLTGRS) (SEQ ID NO:33) was used as substrate. The conversion of the Cysteine residue in position 11 to FGly was monitored by MALDI-TOF mass spectrometry. A 6 .mu.M stock solution of P23 in 30% acetonitrile and 0.1% trifluoroacetic acid (TFA) was prepared. Under standard conditions 6 pmol of P23 were incubated at 37.degree. C. with up to 10 .mu.l enzyme in a final volume of 30 .mu.l 50 mM Tris/HCl, pH 9.0, containing 67 mM NaCl, 15 .mu.M CaCl.sub.2, 2 mM DTT, and 0.33 mg/ml bovine serum albumin. To stop the enzyme reaction 1.5 .mu.l 10% TFA were added. P23 then was bound to ZipTip C18 (Millipore), washed with 0.1% TFA and eluted in 3 .mu.l 50% acetonitrile, 0.1% TFA. 0.5 .mu.l of the eluate was mixed with 0.5 .mu.l of matrix solution (5 mg/ml a-cyano-4-hydroxy-cinnamic acid (Bruker Daltonics, Billerica, Mass.) in 50% acetonitrile, 0.1% TFA) on a stainless steel target. MALDI-TOF mass spectrometry was performed with a Reflex III (Bruker Daltonics) using reflectron mode and laser energy just above the desorption/ionization threshold. All spectra were averages of 200-300 shots from several spots on the target. The mass axis was calibrated using peptides of molecular masses ranging from 1000 to 3000 Da as external standards. Monoisotopic MR.sup.+ of P23 is 2526.28 and of the FGly containing product 2508.29. Activity (pmol product/h) was calculated on the basis of the peak height of the product divided by the sum of the peak heights of P23 and the product.

Purification of FGE from Bovine Testis

[0301] Bovine testes were obtained from the local slaughter house and stored for up to 20 h on ice. The parenchyme was freed from connective tissue and homogenized in a waring blendor and by three rounds of motor pottering. Preparation of rough microsomes (RM) by cell fractionation of the obtained homogenate was performed as described (Meyer et al., J. Biol. Chem., 2000, 275:14550-14557) with the following modifications. Three differential centrifugation steps, 20 minutes each at 4.degree. C., were performed at 500 g (JA10 rotor), 3000 g (JA10) and 10000 g (JA20). From the last supernatant the RM membranes were sedimented (125000 g, Ti45 rotor, 45 min, 4.degree. C.), homogenized by motor pottering and layered on a sucrose cushion (50 mM Hepes, pH 7.6, 50 mM KAc, 6 mM MgAc.sub.2, 1 mM EDTA, 1.3 M sucrose, 5 mM .beta.-mercaptoethanol). RMs were recovered from the pellet after spinning for 210 minutes at 45000 rpm in a Ti45 rotor at 4.degree. C. Usually 100000-150000 equivalents RM, as defined by Walter and Blobel (Methods Enzymol., 1983, 96:84-93), were obtained from 1 kg of testis tissue. The reticuloplasm, i.e. the luminal content of the RM, was obtained by differential extraction at low concentrations of deoxy Big Chap, as described (Fey et al., J. Biol. Chem., 2001, 276:47021-47028). For FGE purification, 95 ml of reticuloplasm were dialyzed for 20 h at 4.degree. C. against 20 mM Tris/HCl, pH 8.0, 2.5 mM DTT, and cleared by centrifugation at 125000 g for 1 h. 32 ml-aliquots of the cleared reticuloplasm were loaded on a MonoQ HR10/10 column (Amersham Biosciences, Piscataway, N.J.) at room temperature, washed and eluted at 2 ml/min with a linear gradient of 0 to 0.75 M NaCl in 80 ml of the Tris buffer. The fractions containing FGE activity, eluting at 50-165 mM NaCl, of three runs were pooled (42 ml) and mixed with 2 ml of Concanavalin A-Sepharose (Amersham Biosciences) that had been washed with 50 mM Hepes buffer, pH 7.4, containing 0.5 M KCI, 1 mM MgCl.sub.2, 1 mM MnCl.sub.2, 1 mM CaCl.sub.2, and 2.5 mM DTT. After incubation for 16 h at 4.degree. C., the Concanavalin A-Sepharose was collected in a column and washed with 6 ml of the same Hepes buffer. The bound material was eluted by incubating the column for 1 h at room temperature with 6 ml 0.5 M a-methylmannoside in 50 mM Hepes, pH 7.4, 2.5 mM DTT. The elution was repeated with 4 ml of the same eluent. The combined eluates (10 ml) from Concanavalin A-Sepharose were adjusted to pH 8.0 with 0.5 M Tris/HCl, pH 9.0, and mixed with 2 ml of Affigel 10 (Bio-Rad Laboratories, Hercules, Calif.) that had been derivatized with 10 mg of the scrambled peptide (PVSLPTRSCAALLTGR) (SEQ ID NO:34) and washed with buffer A (50 mM Hepes, pH 8.0, containing 0.15 M potassium acetate, 0.125 M sucrose, 1 mM MgCl.sub.2, and 2.5 mM DTT). After incubation for 3 h at 4.degree. C. the affinity matrix was collected in a column. The flow through and a wash fraction with 4 ml of buffer A were collected, combined and mixed with 2 ml of Affigel 10 that had been substituted with 10 mg of the Ser69 peptide (PVSLSTPSRAALLTGR) (SEQ ID NO:35) and washed with buffer A. After incubation overnight at 4.degree. C., the affinity matrix was collected in a column, washed 3 times with 6 ml of buffer B (buffer A containing 2 M NaCl and a mixture of the 20 proteinogenic amino acids, each at 50 mg/ml). The bound material was eluted from the affinity matrix by incubating the Affigel twice for 90 min each with 6 ml buffer B containing 25 mM Ser69 peptide. An aliqout of the eluate was substituted with 1 mg/ml bovine serum albumin, dialyzed against buffer A and analyzed for activity. The remaining part of the activity (11.8 ml) was concentrated in a Vivaspin 500 concentrator (Vivascience AG, Hannover, Germany), and solubilized at 95.degree. C. in Laemmli SDS sample buffer. The polypeptide composition of the starting material and preparations obtained after the chromatographic steps were monitored by SDSPAGE (15% acrylamide, 0.16% bisacrylamide) and staining with SYPRO Ruby (Bio-Rad Laboratories).

Identification of FGE by Mass Spectrometry

[0302] For peptide mass fingerprint analysis the purified polypeptides were in-gel digested with trypsin (Shevchenko et al., Anal. Chem., 1996, 68:850-855), desalted on C18 ZipTip and analyzed by MALDI-TOF mass spectrometry using dihydrobenzoic acid as matrix and two autolytic peptides from trypsin (m/z 842.51 and 2211.10) as internal standards. For tandem mass spectrometry analysis selected peptides were analyzed by MALDI-TOF post-source decay mass spectrometry. Their corresponding doubly charged ions were isolated and fragmented by offline nano-ESI ion trap mass spectrometry (EsquireLC, Bruker Daltonics). The mass spectrometric data were used by Mascot search algorithm for protein identification in the NCBInr protein database and the NCBI EST nucleotide database.

Bioinformatics

[0303] Signal peptides and clevage sites were described with the method of von Heijne (von Heijne, Nucleic Acids Res., 1986, 14:4683-90) implemented in EMBOSS (Rice et al., Trends in Genetics, 2000, 16:276-277). N-glycosylation sites were predicted using the algorithm of Brunak (Gupta and Brunak, Pac. Symp. Biocomput., 2002, 310-22). Functional domains were detected by searching PFAM-Hidden-Markov-Models (version 7.8) (Sonnhammer et al., Nucleic Acids Res., 1998, 26:320-322). To search for FGE homologs, the databases of the National Center for Biotechnology Information (Wheeler et al., Nucleic Acids Res., 2002, 20:13-16) were queried with BLAST (Altschul et al., Nucleic Acids Res., 1997, 25:3389-3402). Sequence similarities were computed using standard tools from EMBOSS. Genomic loci organisation and synteny were determined using the NCBI's human and mouse genome resources and the Human-Mouse Homology Map also form NCBI, Bethesda, Md.).

Cloning of Human FGE cDNA

[0304] Total RNA, prepared from human fibroblasts using the RNEASY.TM. Mini kit (Qiagen, Inc., Valencia, Calif.) was reverse transcribed using the OMNISCRIPT RT.TM. kit (Qiagen, Inc., Valencia, Calif.) and either an oligo(dT) primer or the FGE-specific primer 1199nc (CCAATGTAGGTCAGACACG) (SEQ ID NO:36). The first strand cDNA was amplified by PCR using the forward primer 1c (ACATGGCCCGCGGGAC) (SEQ ID NO:37) and, as reverse primer, either 1199nc or 1182nc (CGACTGCTCCTTGGACTGG) (SEQ ID NO:38). The PCR products were cloned directly into the pCR4-TOPO.TM. vector (Invitrogen Corporation, Carlsbad, Calif.). By sequencing multiple of the cloned PCR products, which had been obtained from various individuals and from independent RT and PCR reactions, the coding sequence of the FGE cDNA was determined (SEQ ID NOs:1 and 3).

Mutation Detection, Genomic Sequencing, Site-Directed Mutagenesis and Northern Blot Analysis

[0305] Standard protocols utilized in this study were essentially as described in Liibke et al. (Nat. Gen., 2001, 28:73-76) and Hansske et al. (J. Clin. Invest., 2002, 109:725-733). Northern blots were hybridized with a cDNA probe covering the entire coding region and a .beta. -actin cDNA probe as a control for RNA loading.

Cell Lines and Cell Culture

[0306] The fibroblasts from MSD patients 1-6 were obtained from E. Christenson (Rigshospitalet Copenhagen), M. Beck (Universitatskinderklinik Mainz), A. KohlschUtter (Universitatskrankenhaus Eppendorf, Hamburg), E. Zammarchi (Meyer Hospital, University of Florence), K. Harzer (Institut fur Hirnforschung, Universitat Tubingen), and A. Fensom (Guy's Hospital, London), respectively. Human skin fibroblasts, HT-1080, BHK21 and CHO cells were maintained at 37.degree. C. under 5% CO2 in Dulbecco's modified Eagle's medium containing 10% fetal calf serum.

Transfection, Indirect Immunofluorescence, Western Blot Analysis and Detection of FGE Activity

[0307] The FGE cDNA was equipped with a 5' EcoRI-site and either a 3' HA-, c-Myc or RGS-His.sub.6-tag sequence, followed by a stop-codon and a HindIII site, by add-on PCR using Pfu polymerase (Stratagene, La Jolla, Calif.) and the following primers: GGAATTCGGGACAACATGGCTGCG (EcoRI) (SEQ ID NO:39), CCCAAGCTTATGC GTAGTCAGGCACATCATACGGATAGTCCATGGTGGGCAGGC(HA)(SEQ ID NO:40), CCCAAGCTTACAGGTCTTCTTCAGAAATCAGCTTTTGTTCGTCCATGGTGGGCAG GC (c-Myc) (SEQ ID NO:41), CCCAAGCTTAGTGATGGTGATGGTGATGCGATC CTCTGTCCATGGTGGGCAGGC (RGS-His.sub.6) (SEQ ID NO:42). The resulting PCR products were cloned as EcoRI/HindIII fragments into pMPSVEH (Artelt et al., Gene, 1988, 68:213-219). The plasmids obtained were transiently transfected into HT-1080, BHK21 and CHO cells, grown on cover slips, using EN-ECTENE.TM. (Qiagen) as transfection reagent. 48 h after transfection the cells were analyzed by indirect immunofluorescence as described previously (Lubke et al., Nat. Gen., 2001, 28:73-76; Hansske et al., J. Clin. Invest., 2002, 109:725-733), using monoclonal IgG1 antibodies against HA (Berkeley Antibody Company, Richmond, Calif.), c-Myc (Santa Cruz Biotechnology, Inc., Santa Cruz, Calif.) or RGS-His (Qiagen) as primary antibodies. The endoplasmic reticulum marker protein protein disulfide isomerase (PDI) was detected with a monoclonal antibody of different subtype (IgG2A, Stressgen Biotech., Victoria BC, Canada). The pimary antibodies werde detected with isotype-specific goat secondary antibodies coupled to CY2 or CY3, respectively (Molecular Probes, Inc., Eugene, Oreg.). Immunofluorescence images were obtained on a Leica TCS Sp2 AOBS laser scan microscope. For Western blot analysis the same monoclonal antibodies and a HRP-conjugated anti-mouse IgG as secondary antibody were used. For determination of FGE activity, the trypsinised cells were washed with phosphate buffered saline containing a mixture of proteinase inhibitors (208 .mu.M 4-(2-aminoethyl)benzene sulfonyl fluoride hydrochloride, 0.16 AM aprotinin, 4.2 .mu.M leupeptin, 7.2 .mu.M bestatin, 3 .mu.M pepstatin A, 2.8 .mu.M E-64), solubilized in 10 mM Tris, pH 8.0, containing 2.5 mM DTT, the proteinase inhibitors and 1% Triton X-100, and cleared by centrifugation at 125,000 g for 1 h. The supernatant was subjected to chromatography on a MonoQ PC 1.6/5 column using the conditions described above. Fractions eluting at 50-200 mM NaCl were pooled, lyophilised and reconstituted in one tenth of the original pool volume prior determination of FGE activity with peptide P23.

Retroviral Transduction

[0308] cDNAs of interest were cloned into the Moloney murine leukemia virus based vector pLPCX and pLNCX2 (BD Biosciences Clontech, Palo Alto, Calif.). The transfection of ecotropic FNX-Eco cells (ATCC, Manassas, Va.) and the transduction of amphotropic RETROPACK.TM. PT67 cells (BD Biosciences Clontech) and human fibroblasts was performed as described (Lubke et al., Nat. Gen., 2001, 28:73-76; Thiel et al., Biochem. J., 2002, 376, 195-201). For some experiments pLPCX-transduced PT67 cells were selected with puromycin prior determination of sulfatase activities.

[0309] Sulfatase Assays

[0310] Activity of ASA, STS and GalNAc6S were determined as described in Rommerskirch and von Figura, Proc. Natl. Acad. Sci., USA, 1992, 89:2561-2565; Glossl and Kresse, Clin. Chim. Acta, 1978, 88:111-119.

Results

A Rapid Peptide Based Assay for FGE Activity

[0311] We had developed an assay for determining FGE activity in microsome extracts using in vitro synthesized [.sup.35S] ASA fragments as substrate. The fragments were added to the assay mixture as ribosome-associated nascent chain complexes. The quantitation of the product included tryptic digestion, separation of the peptides by RP-HPLC and identification and quantitation of the [.sup.35S]-labeled FGly containing tryptic peptide by a combination of chemical derivatization to hydrazones, RP-HPLC separation and liquid scintillation counting (Fey et al., J. Biol. Chem., 2001, 276:47021-47028). For monitoring the enzyme activity during purification, this cumbersome procedure needed to be modified. A synthetic 16mer peptide corresponding to ASA residues 65-80 and containing the sequence motif required for FGly formation inhibited the FGE activity in the in vitro assay. This suggested that peptides such as ASA65-80 may serve as substrates for FGE. We synthesized the 23mer peptide P23 (SEQ ID NO:33), which corresponds to ASA residues 60-80 with an additional N-acetylated methionine and a C-amidated serine residue to protect the N- and C-terminus, respectively. The cysteine and the FGly containing forms of P23 could be identified and quantified by matrix-assisted laser desorption/ionisation time of flight (MALDI-TOF) mass spectrometry. The presence of the FGly residue in position 11 of P23 was verified by MALDI-TOF post source decay mass spectrometry (see Peng et al., J. Mass Spec., 2003, 38:80-86). Incubation of P23 with extracts from microsomes of bovine pancreas or bovine testis converted up to 95% of the peptide into a FGly containing derivative (FIG. 1). Under standard conditions the reaction was proportional to the amount of enzyme and time of incubation as long as less than 50% of the substrate was consumed and the incubation period did not exceed 24 h. The k.sub.m for P23 was 13 nM. The effects of reduced and oxidized glutathione, Ca.sup.2+ and pH were comparable to those seen in the assay using ribosome-associated nascent chain complexes as substrate (Fey et al., J. Biol. Chem., 2001, 276:47021-47028).

Purification of FGE

[0312] For purification of FGE the soluble fraction (reticuloplasm) of bovine testis microsomes served as the starting material. The specific activity of FGE was 10-20 times higher than that in reticuloplasm from bovine pancreas microsomes (Fey et al., J. Biol. Chem., 2001, 276:47021-47028). Purification of FGE was achieved by a combination of four chromatographic steps. The first two steps were chromatography on a MonoQ anion exchanger and on Concanavalin A-Sepharose. At pH 8 the FGE activity bound to MonoQ and was eluted at 50-165 mM NaCl with 60-90% recovery. When this fraction was mixed with Concanavalin A-Sepharose, FGE was bound. 30-40% of the starting activity could be eluted with 0.5 M a-methyl mannoside. The two final purification steps were chromatography on affinity matrices derivatized with 16mer peptides. The first affinity matrix was Affigel 10 substituted with a variant of the ASA65-80 peptide, in which residues Cys69, Pro71 and Arg73, critical for FGly formation, were scrambled (scrambled peptide PVSLPTRSCAALLTGR-SEQ ID NO:34). This peptide did not inhibit FGE activity when added at 10 mM concentration to the in vitro assay and, when immobilized to Affigel 10, did not retain FGE activity. Chromatography on the scrambled peptide affinity matrix removed peptide binding proteins including chaperones of the endoplasmic reticulum. The second affinity matrix was Affigel 10 substituted with a variant of the ASA65-80 peptide, in which the Cys69 was replaced by a serine (Ser69 peptide PVSLSTPSRAALLTGR-SEQ ID NO:35). The Ser69 peptide affinity matrix efficiently bound FGE. The FGE activity could be eluted with either 2 M KSCN or 25 mM Ser69 peptide with 20-40% recovery. Prior to activity determination the KSCN or Ser69 peptide had to be removed by dialysis. The substitution of Cys69 by serine was crucial for the elution of active FGE. Affigel 10 substituted with the wildtype ASA65-80 peptide bound FGE efficiently. However, nearly no activity could be recovered in eluates with chaotropic salts (KSCN, MgCl.sub.2), peptides (ASA65-80 or Ser69 peptide) or buffers with low or high pH. In FIG. 2 the polypeptide pattern of the starting material and of the active fractions obtained after the four chromatographic steps of a typical purification is shown. In the final fraction 5% of the starting FGE activity and 0.0006% of the starting protein were recovered (8333-fold purification).

The Purified 39.5 and 41.5 kDa Polypeptides are Encoded by a Single Gene

[0313] The 39.5 and 41.5 kDa polypeptides in the purified FGE preparation were subjected to peptide mass fingerprint analysis. The mass spectra of the tryptic peptides of the two polypeptides obtained by MALDI-TOF mass spectrometry were largely overlapping, suggesting that the two proteins originate from the same gene. Among the tryptic peptides of both polypeptides two abundant peptides MH.sup.+ 1580.73, SQNTPDSSASNLGFR (SEQ ID NO:43), and MH.sup.+ 2049.91, MVPIPAGVFTMGTDDPQIK-SEQ ID NO:44 plus two methionine oxidations) were found, which matched to the protein encoded by a cDNA with GenBank Acc. No. AK075459 (SEQ ID NO:4). The amino acid sequence of the two peptides was confirmed by MALDI-TOF post source decay spectra and by MS/MS analysis using offline nano-electrospray ionisation (ESI) iontrap mass spectrometry. An EST sequence of the bovine ortholog of the human cDNA covering the C-terminal part of the FGE and matching the sequences of both peptides provided additional sequence information for bovine FGE.

Evolutionary Conservation and Domain Structure of FGE

[0314] The gene for human FGE is encoded by the cDNA of (SEQ ID NOs:1 and/or 3) and located on chromosome 3p26. It spans -105 kb and the coding sequence is distributed over 9 exons. Three orthologs of the human FGE gene are found in mouse (87% identity), Drosophila melanogaster (48% identity), and Anopheles gambiae (47% identity). Orthologous EST sequences are found for 8 further species including cow, pig, Xenopus laevis, Silurana tropicalis, zebra fish, salmon and other fish species (for details see Example 2). The exon-intron structure between the human and the mouse gene is conserved and the mouse gene on chromosome 6E2 is located within a region syntenic to the human chromosome 3p26. The genomes of S. cerevisiae and C. elegans lack FGE homologs. In prokaryotes 12 homologs of human FGE were found. The cDNA for human FGE is predicted to encode a protein of 374 residues (FIG. 3 and SEQ ID NO:2). The protein contains a cleavable signal sequence of 33 residues, which indicates translocation of FGE into the endoplasmic reticulum, and contains a single N-glycosylation site at Asn141. The binding of FGE to concanavalin A suggests that this N-glycosylation site is utilized. Residues 87-367 of FGE are listed in the PFAM protein motif database as a domain of unknown function (PFAM: DUF323). Sequence comparison analysis of human FGE and its eukaryotic orthologs identified in data bases indicates that this domain is composed of three distinct subdomains.

[0315] The N-terminal subdomain (residues 91-154 in human FGE) has a sequence identity of 46% and a similarity of 79% within the four known eukaryotic FGE orthologs. In human FGE, this domain carries the N-glycosylation site at Asn 141, which is conserved in the other orthologs. The middle part of FGE (residues 179-308 in human FGE) is represented by a tryptophan-rich subdomain (12 tryptophans per 129 residues). The identity of the eukaryotic orthologs within this subdomain is 57%, the similarity is 82%. The C-terminal subdomain (residues 327-366 in human FGE) is the most highly conserved sequence within the FGE family. The sequence identity of the human C-terminal subdomain with the eukaryotic orthologs (3 full length sequences and 8 ESTs) is 85%, the similarity 97%. Within the 40 residues of the subdomain 3 four cysteine residues are fully conserved. Three of cysteins are also conserved in the prokaryotic FGE orthologs. The 12 prokaryotic members of the FGE-family (for details see Example 2) share the subdomain structure with eukaryotic FGEs. The boundaries between the three subdomains are more evident in the prokaryotic FGE family due to non-conserved sequences of variable length separating the subdomains from each other. The human and the mouse genome encode two closely related homologs of FGE (SEQ ID NOs:43 and 44, GenBank Acc. No. NM.sub.--015411, in man, and SEQ ID NOs:45 and 46, GenBank Acc. No. AK076022, in mouse). The two paralogs are 86% identical. Their genes are located on syntenic chromosome regions (7q11 in human, 5G1 in mouse). Both paralogs share with the FGE orthologs the subdomain structure and are 35% identical and 47% similar to human FGE. In the third subdomain, which is 100% identical in both homologs, the cysteine containing undecamer sequence of the subdomain 3 is missing.

Expression, Subcellular Localization and Molecular Forms

[0316] A single transcript of 2.1 kb is detectable by Northern blot analysis of total RNA from skin fibroblasts and poly A.sup.+ RNA from heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas. Relative to .beta.-actin RNA the abundance varies by one order of magnitude and is highest in pancreas and kidney and lowest in brain. Various eukaryotic cell lines stably or transiently expressing the cDNA of human FGE or FGE derivatives C-terminally extended by a HA-, Myc- or His.sub.6-tag were assayed for FGE activity and subcellular localization of FGE. Transient expression of tagged and non-tagged FGE increased the FGE activity 1.6-3.9-fold. Stable expression of FGE in PT67 cells increased the activity of FGE about 100-fold. Detection of the tagged FGE form by indirect immunofluorescence in BHK 21, CHO, and HT1080 cells showed a colocalization of the variously tagged FGE forms with proteindisulfide isomerase, a lumenal protein of the endoplasmic reticulum. Western blot analysis of extracts from BHK 21 cells transiently transfected with cDNA encoding tagged forms of FGE showed a single immunoreactive band with an apparent size between 42 to 44 kDa.

The FGE Gene Carries Mutations in MSD

[0317] MSD is caused by a deficiency to generate FGly residues in sulfatases (Schmidt, B., et al., Cell, 1995, 82:271-278). The FGE gene is therefore a candidate gene for MSD. We amplified and sequenced the FGE encoding cDNA of seven MSD patients and found ten different mutations that were confirmed by sequencing the genomic DNA (Table 1).

TABLE-US-00001 TABLE 1 Mutations in MSD patients Effect Mutation on Protein Remarks Patient 1076C > A S359X Truncation of the C-terminal 1* 16 residues IVS3 + 5-8 del Deletion of In-frame deletion of exon 3 1, 2 residues 149-173 979C > T R327X Loss of subdomain 3 2 1045C > T R349W Substitution of a conserved 3, 7 residue in subdomain 3 1046G > A R349Q Substitution of a conserved 4 residue in subdomain 3 1006T > C C336R Substitution of a conserved 4 residue in subdomain 3 836C > T A279V Substitution of a conserved 5 residue in subdomain 2 243delC frameshift and Loss of all three subdomains 5 truncation 661delG frameshift and Loss of the C-terminal third of 6** truncation FGE including subdomain 3 IVS6-1G > A Deletion of In = frame deletion of exon 7 5 residues 231-318 *Patient 1 is the MSD patient Mo. in Schmidt, B., et al., Cell, 1995, 82: 271-278 and Rommerskirch and von Figura, Proc. Natl. Acad. Sci., USA, 1992, 89: 2561-2565. **Patient 6 is the MSD patient reported by Burk et al., J. Pediatr., 1984, 104: 574-578. The other patients represent unpublished cases.

[0318] The first patient was heterozygous for a 1076C>A substitution converting the codon for serine 359 into a stop codon (S359X) and a mutation causing the deletion of the 25 residues 149-173 that are encoded by exon 3 and space the first and the second domain of the protein. Genomic sequencing revealed a deletion of nucleotides +5-8 of the third intron (IVS3+5-8 del) thereby destroying the splice donor site of intron 3. The second patient was heterozygous for the mutation causing the loss of exon 3 (IVS3+5-8 del) and a 979C>T substitution converting the codon for arginine 327 into a stop codon (R327X). The truncated FGE encoded by the 979C>T allele lacks most of subdomain 3. The third patient was homozygous for a 1045C>T substitution replacing the conserved arginine 349 in subdomain 3 by tryptophan (R349W). The fourth patient was heterozygous for two missense mutations replacing conserved residues in the FGE domain: a 1046>T substitution replacing arginine 349 by glutamine (R349Q) and a 1006T>C substitution replacing cysteine 336 by arginine (C336R). The fifth patient was heterozygous for a 836 C>T substitution replacing the conserved alanine 279 by valine (A279V). The second mutation is a single nucleotide deletion (243delC) changing the sequence after proline 81 and causing a translation stop after residue 139. The sixth patient was heterozygous for the deletion of a single nucleotide (661delG) changing the amino acid sequence after residue 220 and introducing a stop codon after residue 266. The second mutation is a splice acceptor site mutation of intron 6 (IVS6-1G>A) causing an in-frame deletion of exon 7 encoding residues 281-318. In the seventh patient the same 1045C>T substitution was found as in the third patient. In addition we detected two polymorphisms in the coding region of 18 FGE alleles from controls and MSD patients. 22% carried a 188G>A substitution, replacing serine 63 by asparagine (S63N) and 28% a silent 1116C>T substitution.

Transduction of MSD Fibroblasts with Wild Type and Mutant FGE cDNA

[0319] In order to confirm the deficiency of FGE as the cause of the inactivity of sulfatases synthesized in MSD, we expressed the FGE cDNA in MSD fibroblasts utilizing retroviral gene transfer. As a control we transduced the retroviral vector without cDNA insert. To monitor the complementation of the metabolic defect the activity of ASA, steroid sulfatase (STS) and N-acetylgalactosamine 6-sulfatase (GaNAc6S) were measured in the transduced fibroblasts prior or after selection. Transduction of the wild type FGE partially restored the catalytic activity of the three sulfatases in two MSD-cell lines (Table '2) and for STS in a third MSD cell line. It should be noted that for ASA and GalNAc6S the restoration was only partial after selection of the fibroblasts reaching 20 to 50% of normal activity. For STS the activity was found to be restored to that in control fibroblasts after selection. Selection increased the activity of ASA and STS by 50 to 80%, which is compatible with the earlier observation that 15 to 50% of the fibroblasts become transduced (Lubke et al., Nat. Gen., 2001, 28:73-76). The sulfatase activities in the MSD fibroblasts transduced with the retroviral vector alone (Table 2) were comparable to those in non-transduced MSD fibroblasts (not shown). Transduction of FGE cDNA carrying the IVS3+5-8del mutation failed to restore the sulfatase activities (Table 2).

TABLE-US-00002 TABLE 2 Complementation of MSD fibroblasts by transduction of wild type or Sulfatase Fibroblasts FGE-insert ASA' STS' GaINAc6S.sup.1 MSD 3.degree. -- 1.9 .+-. 0.2 <3 56.7 .+-. 32 FGE.sup.+ 7.9 13.5 n.d. FGE.sup.++ 12.2 .+-. 0.2 75.2 283 .+-. 42 FGE-IVS3 + 5- 1.8 <3 n.d. 8de1.sup.+ FGE-IVS3 + 5- 2.1 <3 98.5 8del.sup.++ MSD 4.degree. -- 1.1 .+-. 0.3 <3 n.d. FGE.sup.+ 4.7 17.0 n.d. Control 58 .+-. 11 66 .+-. 31 828 .+-. 426 fibroblasts .sup.1The values give the ratio between ASA (mU/mg cell protein), STS (AU/mg cell protein), Ga1NAc6S (AU/mg cell protein) and that of f3-hexosaminidase (U/mg cell protein). For control fibroblasts the mean and the variation of 6-11 cell lines is given. Where indicated the range of two cultures transduced in parallel is given for MSD fibroblasts. .degree.The number of MSD fibroblasts refers to that of the patient in Table 1. .sup.+Activity determination prior to selection. .sup.++Activity determination after selection. n.d.: not determined

Discussion

FGE is a Highly Conserved Glycoprotein of the Endoplasmic Reticulum.

[0320] Purification of FGE from bovine testis yielded two polypeptides of 39.5 and 41.5 kDa which originate from the same gene. The expression of three differently tagged versions of FGE in three different eukaryotic cell lines as a single form suggests that one of the two forms observed in the FGE preparation purified from bovine testis may have been generated by limited proteolysis during purification. The substitution of Cys69 in ASA65-80 peptide by serine was critical for the purification of FGE by affinity chromatography. FGE has a cleavable signal sequence that mediates translocation across the membrane of the endoplasmic reticulum. The greater part of the mature protein (275 residues out of 340) defines a unique domain, which is likely to be composed of three subdomains (see Example 2), for none of the three subdomains homologs exist in proteins with known function. The recognition of the linear FGly modification motif in newly synthesized sulfatase polypeptides (Dierks et al., EMBO J., 1999, 18:2084-2091) could be the function of a FGE subdomain. The catalytic domain could catalyse the FGly formation in several ways. It has been proposed that FGE abstracts electrons from the thiol group of the cysteine and transfers them to an acceptor. The resulting thioaldehyde would spontaneously hydrolyse to FGly and H.sub.2S (Schmidt, B., et al., Cell, 1995, 82:271-278). Alternatively FGE could act as a mixed-function oxygenase (monooxygenase) introducing one atom of 0.sub.2 into the cysteine and the other in H.sub.2O with the help of an electron donor such as FADH.sub.2. The resulting thioaldehyde hydrate derivative of cysteine would spontaneously react to FGly and H.sub.2S. Preliminary experiments with a partially purified FGE preparation showed a critical dependence of the FGly formation on molecular oxygen. This would suggest that FGE acts as a mixed-function oxygenase. The particular high conservation of subdomain 3 and the presence of three fully conserved cysteine residues therein make this subdomain a likely candidate for the catalytic site. It will be interesting to see whether the structural elements mediating the recognition of the FGly motif and the binding of an electron acceptor or electron donor correlate with the domain structure of FGE.

[0321] Recombinant FGE is localized in the endoplasmic reticulum, which is compatible with the proposed site of its action. FGly residues are generated in newly synthesized sulfatases during or shortly after their translocation into the endoplasmic reticulum (Dierks et al., Proc. Natl. Acad. Sci. U.S.A., 1997, 94:11963-11968; Dierks et al., FEBS Lett., 1998, 423:61-65). FGE itself does not contain an ER-retention signal of the KDEL (SEQ ID NO:96) type. Its retention in the endoplasmic reticulum may therefore be mediated by the interaction with other ER proteins. Components of the translocation/N-glycosylation machinery are attractive candidates for such interacting partners.

Mutations in FGE Cause MSD

[0322] We have shown that mutations in the gene encoding FGE cause MSD. FGE also may interact with other components, and defects in genes encoding the latter could equally well cause MSD. In seven MSD patients we indeed found ten different mutations in the FGE gene. All mutations have severe effects on the FGE protein by replacing highly conserved residues in subdomain 3 (three mutations) or subdomain 2 (one mutation) or C-terminal truncations of various lengths (four mutations) or large inframe deletions (two mutations). For two MSD-cell lines and one of the MSD mutations it was shown that transduction of the wild type, but not of the mutant FGE cDNA, partially restores the sulfatase activities. This clearly identifies the FGE gene as the site of mutation and the disease causing nature of the mutation. MSD is both clinically and biochemically heterogenous. A rare neonatal form presenting at birth and developing a hydrocephalus, a common form resembling initially to an infantile metachromatic leukodystrophy and subsequently developing ichthyosis- and mucopolysaccharidosis-like features, and a less frequent mild form in which the clinical features of a mucopolysaccharidosis prevail, have been differentiated. Biochemically it is characteristic that a residual activity of sulfatases can be detected, which for most cases in cultured skin fibroblasts is below 10% of controls (Burch et al., Clin. Genet., 1986, 30:409-15; Basner et al., Pediatr. Res., 1979, 13:1316-1318). However, in some MSD cell lines the activity of selected sulfatases can reach the normal range (Yutaka et al., Clin. Genet., 1981, 20:296-303). Furthermore, the residual activity has been reported to be subject to variations depending on the cell culture conditions and unknown factors. Biochemically, MSD has been classified into two groups. In group I the residual activity of sulfatases is below 15% including that of ASB. In group II the residual activity of sulfatases is higher and particularly that of ASB may reach values of up to 50-100% of control. All patients reported here fall into group I except patient 5, which falls into group II (ASB activity in the control range) of the biochemical phenotype. Based on clinical criteria patients 1 and 6 are neonatal cases, while patients 2-4 and 7 have the common and patient 5 the mucopolysaccharidosis-like form of MSD.

[0323] The phenotypic heterogeneity suggests that the different mutations in MSD patients are associated with different residual activities of FGE. Preliminary data on PT67 cells stably expressing FGE IVS3+5-8del indicate that the in-frame deletion of exon 3 abolishes FGE activity completely. The characterization of the mutations in MSD, of the biochemical properties of the mutant FGE and of the residual content of FGly in sulfatases using a recently developed highly sensitive mass spectrometric method (Peng et al., J. Mass Spec., 2003, 38:80-86) will provide a better understanding of the genotype-phenotype correlation in MSD.

Example 2

[0324] The Human FGE Gene Defines a New Gene Family Modifying Sulfatases which is Conserved from Prokaryotes to Eukaryotes

Bioinformatics

[0325] Signal peptides and cleavage sites were described with the method of von Heijne (Nucleic Acids Res., 1986, 14:4683) implemented in EMBOSS (Rice et al., Trends in Genetics, 2000, 16:276-277), and the method of Nielsen et al. (Protein Engineering, 1997, 10:1-6). N-glycosylation sites were predicted using the algorithm of Brunak (Gupta and Brunak, Pac. Symp. Biocomput., 2002, 310-22).

[0326] Functional domains were detected by searching PFAM-Hidden-Markov-Models (version 7.8) (Sonnhammer et al., Nucleic Acids Res., 1998, 26:320-322). Sequences from the PFAM DUF323 seed were obtained from TrEMBL (Bairoch, A. and Apweiler, R., Nucleic Acids Res., 2000, 28:45-48). Multiple alignments and phylogenetic tree constructions were performed with Clustal W (Thompson, J., et al., Nucleic Acids Res., 1994, 22:4673-4680). For phylogenetic tree computation, gap positions were excluded and multiple substitutions were corrected for. Tree bootstraping was performed to obtain significant results. Trees were visualised using Njplot (Perriere, G. and Gouy, M., Biochimie, 1996, 78:364-369). Alignments were plotted using the pret-typlot command from EMBOSS.

[0327] To search for FGE homologs, the databases NR, NT and EST of the National Center for Biotechnology Information (NCBI) (Wheeler et al., Nucleic Acids Res., 2002, 20:13-16), were queried with BLAST (Altschul et al., Nucleic Acids Res., 1997, 25:3389-3402). For protein sequences, the search was performed using iterative converging Psi-Blast against the current version of the NR database using an expectation value cutoff of 10.sup.-40, and default parameters.

[0328] Convergence was reached after 5 iterations. For nucleotide sequences, the search was performed with Psi-TBlastn: using NR and the protein sequence of human FGE as input, a score matrix for hFGE was built with iterative converging Psi-Blast. This matrix was used as input for blastall to query the nucleotide databses NT and EST. For both steps, an expectation value cutoff of 10.sup.-20 was used.

[0329] Protein secondary structure prediction was done using Psipred (Jones, D., J Mol Biol., 1999, 292:1950-202; McGuffin, L., et al., Bioinformatics, 2000, 16:404-405).

[0330] Similarity scores of the subdomains were computed from alignments using the cons algorithm form EMBOSS with default parameters. The metaalignments were generated by aligning consensus sequences of the FGE-family subgroups. Genomic loci organisation and synteny were determined using the NCBI's human and mouse genome resources at NCBI (Bethesda, Md.) and Softberry's (Mount Kisco, N.Y.) Human-Mouse-Rat Synteny. Bacterial genome sequences were downloaded from the NCBI-FTP-server. The NCBI microbial genome annotation was used to obtain an overview of the genomic loci of bacterial FGE genes.

Results and Discussion

Basic Features and Motifs of Human FGE and Related Proteins

[0331] The human FGE gene (SEQ ID NOs:1, 3) encodes the FGE protein (SEQ ID NO:2) which is predicted to have 374 residues. A cleavage signal between residues 22-33 (Heijne-Score of 15.29) and a hydropathy-score (Kyte, J. and Doolittle, R., J Mol Biol., 1982, 157:105-132) of residues 17-29 between 1.7 and 3.3 indicate that the 33 N-terminal residues are cleaved off after ER-translocation. However with the algorithm of Nielsen et al. (Protein Engineering, 1997, 10:1-6), cleavage of the signal sequence is predicted after residue 34. The protein has a single potential N-glycosylation site at Asn 141.

[0332] A search with the FGE protein sequence against the protein motif database PFAM (Sonnhammer et al., Nucleic Acids Res., 1998, 26:320-322) revealed that residues 87-367 of human FGE can be classified as the protein domain DUF323 ("domain of unknown function", PF03781) with a highly significant expectation value of 7:9*10.sup.-114. The PFAM-seed defining DUF323 consists of 25 protein sequences, of which the majority are hypothetical proteins derived from sequencing data. To analyse the relationship between human FGE and DUF323, a multiple alignment of FGE with the sequences of the DUF323 seed was performed. Based on this, a phylogenetic tree was constructed and bootstraped. Four of the hypothetical sequences (TrEMBL-IDs Q9CK12, Q91761, 094632 and Q9Y405) had such a strong divergence from the other members of the seed that they prevented successful) bootstraping and had to be removed from the set. FIG. 2 shows the bootstraped tree displaying the relationship between human FGE and the remaining 21 DUF323 seed proteins. The tree can be used to subdivide the seed members into two categories: homologs closely related to human FGE and the remaining, less related genes.

[0333] The topmost 7 proteins have a phylogenetic distance between 0.41 and 0.73 to human FGE. They only contain a single domain, DUF323. The homology within this group extends over the whole amino acid sequence, the greater part of which consists of the DUF323 domain. The DUF323 domain is strongly conserved within this group of homologs, while the other 15 proteins of the seed are less related to human FGE (phylogenetic distance between 1.14 and 1.93). Their DUF323 domain diverges considerably from the highly conserved DUF323-domain of the first group (cf. section "Subdomains of FGE and mutations in the FGE gene"). Most of these 15 proteins are hypothetical, six of them have been further investigated. One of them, a serine/threonine kinase (TrEMBL:084147) from C. trachomatis contains other domains in addition to DUF323: an ATP-binding domain and a kinase domain. The sequences from R. sphaeroides (TrEMBL: Q9ALV8) and Pseudomonas sp.(TrEMBL: 052577) encode the protein NirV, a gene cotranscribed with the copper-containing nitrite reductase nirK (Jain, R. and Shapleigh, J., Microbiology, 2001, 147:2505-2515). CarC (TrEMBL: Q9XB56) is an oxygenase involved in the synthesis of a .beta.-lactam antibiotic from E. carotovora (McGowan, S., et al., Mol Microbiol., 1996, 22:415-426; Khaleeli N, T. C., and Busby R W, Biochemistry, 2000, 39:8666-8673). Xy1R (TrEMBL: 031397) and BH0900 (TrEMBL: Q9KEF2) are enhancer binding proteins involved in the regulation of pentose utilisation (Rodionov, D., et al., FEMS Microbiol Lett., 2001, 205:305-314) in bacillaceae and clostridiaceae. The comparison of FGE and DUF323 led to the establishment of a homology threshold differentiating the FGE family from distant DUF323-containing homologs with different functions. The latter include a serine/threonine kinase and XylR, a transcription enhancer as well as FGE, a FGly generating enzyme and CarC, an oxygenase. As discussed in elsewhere herein, FGE might also exert its cysteine modifying function as an oxygenase, suggesting that FGE and non-FGE members of the DUF323 seed may share an oxygenase function.

Homologs of FGE

[0334] The presence of closely related homologs of human FGE in the DUF323 seed directed us to search for homologs of human FGE in NCBI's NR database (Wheeler et al., Nucleic Acids Res., 2002, 20:13-16). The threshold of the search was chosen in such a way that all 6 homologs present in the DUF323 seed and other closely related homologs were obtained without finding the other seed members. This search led to the identification of three FGE orthologs in eukaryotes, 12 orthologs in prokaryotes and two paralogs in man and mouse (Table 3).

TABLE-US-00003 TABLE 3 The FGE gene family in eukaryotes and prokaryotes SEQ ID NOs: NA, AA LENGTH [GI] SPECIES [AA] SUBGROUP 1/3, 2 Homo sapiens 374 El 49, 50 Mus musculus 372f El [22122361] 51, 52 Drosophila melanogaster 336 El [20130397] 53, 54 Anopheles gambiae 290 El [21289310] 47, 48 Mus musculus 308 E2 [26344956] 45, 46 Homo sapiens 301 E2 [24308053] 55, 56 Streptomyces coelicolor 314 PI A3(2) [21225812] 57, 58 Corynebacterium efficiens 334 P1 YS-314 [25028125] 59, 60 Novosphingobium 338 P2 aromaticivorans [23108562] 61, 62 Mesorhizobium loti 372 P2 [13474559] 63, 64 Burkholderia fungorum 416 P2 [22988809] 65, 66 Sinorhizobium meliloti 303 P2 [16264068] 67, 68 Microscilla sp. 354 P2 [14518334] 69, 70 Pseudomonas putida KT2440 291 P2 [26990068] 71, 72 Ralstonia metallidurans 259 P2 [22975289] 73, 74 Prochlorococcus marinus 291 P2 [23132010] 75, 76 Caulobacter crescentus 338 P2 CB 15 [16125425] 77, 78 Mycobacterium tuberculosis 299 P2, Ht37Rv [15607852] GI--GenBank protein identifier NA--nucleic acid AA--amino acids, El--eukaryotic orthologs E2--eukaryotic paralogs P1--closely related prokaryotic orthologs P2--other prokaryotic f--protein sequence mispredicted in GenBank

[0335] Note that the mouse sequence GI 22122361 is predicted in GenBank to encode a protein of 284 aa, although the cDNA sequence NM 145937 encodes for a protein of 372 residues. This misprediction is based on the omission of the first exon of the murine FGE gene. All sequences found in the NR database are from higher eukaryotes or prokaryotes. FGE-homologs were not detected in archaebacteriae or plants. Searches with even lowered thresholds in the fully sequenced genomes of C. elegans and S. cerevisiae and the related ORF databases did not reveal any homologs. A search in the eukaryotic sequences of the NT and EST nucleotide databases led to the identification of 8 additional FGE orthologous ESTs with 3'-terminal cDNA sequence fragments showing a high degree of conservation on the protein level which are not listed in the NR database. These sequences do not encompass the full coding part of the mRNAs and are all from higher eukaryotes (Table 4).

TABLE-US-00004 TABLE 4 FGE ortholog EST fragments in eukaryotes SEQ ID NOs: NA [GB] SPECIES 80 Oncorhynchus mykiss [CA379852] 81 Danio rerio [A1721440] 82 Oryzias latipes [BJ505402] 83 Xenopus laevis [BJ054666] 84 Silurana tropicalis [AL892419] 85 Salmo salar [CA064079] 86 Sus scrota [BF189614] 87 Bos Taurus [AV609121] GB--GenBank Accession No. NA--nucleic acid

[0336] Multiple alignment and construction of a phylogenetic tree (using ClustalW) of the coding sequences from the NR database allowed the definition of four subgroups of homologs: eukaryotic orthologs (human, mouse, mosquito and fruitfly FGE, eukaryotic paralogs (human and mouse FGE paralog), prokaryotic orthologs closely related to FGE (Streptomyces and Corynebacterium and other prokaryotic orthologs (Caulobacter, Pseudomonas, Mycobacterium, Prochlorococcus, Mesorhizobium, Sinorhizobium, Novosphingobium, Ralstonia, Burkholderia, and Microscilla). The eukaryotic orthologs show an overall identity to human FGE of 87% (mouse), 48% (fruitfly) and 47% (anopheles). While FGE orthologs are found in prokaryotes and higher eukaryotes, they are missing in the completely sequenced genomes of lower eukaryotes phylogenetically situated between S. cerevisiae and D. melanogaster. In addition, FGE homologs are absent in the fully sequenced genomes of E. coli and the pufferfish.

[0337] As discussed elsewhere herein, the FGE paralogs found in human and mouse may have a minor FGly-generating activity and contribute to the residual activities of sulfatases found in MSD patients.

Subdomains of FGE

[0338] The members of the FGE gene family have three highly conserved parts/domains (as described elsewhere herein). In addition to the two non-conserved sequences separating the former, they have non-conserved extensions at the N- and C-terminus. The three conserved parts are considered to represent subdomains of the DUF323 domain because they are spaced by non-conserved parts of varying length. The length of the part spacing subdomains 1 and 2 varies between 22 and 29 residues and that spacing subdomains 2 and 3 between 7 to 38 amino acids. The N- and C-terminal non-conserved parts show an even stronger variation in length (N-terminal: 0-90 AA, Cterminal: 0-28 AA). The sequence for the FGE gene from Ralstonia metallidurans is probably incomplete as it lacks the first subdomain.

[0339] To verify the plausibility of defining subdomains of DUF323, we performed a secondary structure prediction of the human FGE protein using Psipred. The hydrophobic ER-signal (residues 1-33) is predicted to contain helix-structures confirming the signal prediction of the von-Heijne algorithm. The N-terminal non-conserved region (aa 34-89) and the spacing region between subdomains 2 and 3 (aa 308-327) contain coiled sections. The region spacing subdomains 1 and 2 contains a coil. The a-helix at aa 65/66 has a low predicition confidence and is probably a prediction artefact. The subdomain boundaries are situated within coils and do not interrupt .alpha.-helices or .beta.-strands. The first subdomain is made up of several .beta.-strands and an .alpha.-helix, the second subdomain contains two .beta.-strands and four .alpha.-helices. The third subdomain has a a-helix region flanked by a sheet a the beginning and the end of the subdomain. In summary, the secondary structure is in agreement with the proposed subdomain structure as the subdomain boundaries are situated within coils and the subdomains contain structural elements .alpha.-helices and (.beta.-strands).

[0340] It should be noted that none of the subdomains exists as an isolated module in sequences listed in databases. Within each of the four subgroups of the FGE family, the subdomains are highly conserved, with the third subdomain showing the highest homology (Table 5). This subdomain shows also the strongest homology across the subgroups.

TABLE-US-00005 TABLE 5 Homology (% similarity) of the FGE family subdomains Subdomain Subfamily Members 1 2 3 El 4 79 82 100 E2 2 90 94 100 P1 2 70 79 95 P2 10 59 79 80 El--eukaryotic orthologs E2--eukaryotic paralogs P1--closely related prokaryotic orthologs P2--other prokaryotic orthologs

[0341] The first subdomain of the FGE-family shows the weakest homology across the subgroups. In the eukaryotic orthologs it carries the N-glycosylation site: at residue Asn 141 in human, at Asn 139 in the mouse and Asn 120 in the fruit fly. In anopheles, no asparagine is found at the residue 130 homologous to D. melanogaster Asn 120. However, a change of two nucleotides would create an N-glycosylation site Asn 130 in anopheles. Therefore, the sequence encompassing residue 130 needs to be resequenced. The second subdomain is rich in tryptophans with 12 Trp in 129 residues of human FGE. Ten of these tryptophans are conserved in the FGE family.

[0342] High conservation of subdomain 3: subdomain 3 between eukaryotic orthologs are 100% similar and 90% identical. The importance of the third subdomain for the function of the protein is underlined by the observation that this subdomain is a hot spot for disease causing mutations in MSD patients. Seven of nine mutations identified in six MSD patients described in Example 1 are located in sequences that encode the 40 residues of subdomain 3. The residues contain four cysteines, three of which are conserved among the pro- and eukaryotic orthologs. The two eukaryotic paralogs show the lowest homology to the other members of the FGE-family, e.g. they lack two of the three conserved cysteines of subdomain 3. Features conserved between subdomain 3 sequences of orthologs and paralogs are the initial RVXXGG(A)S motif (SEQ ID NO:79), a heptamer containing three arginines (residues 19-25 of the subdomain consensus sequence) and the terminal GFR motif. A comparison with the DUF323 domain of the 15 seed sequences that are no close homologs of FGE shows marked sequence differences: the 15 seed sequences have a less conserved first and second subdomain, although the overall subdomain structure is also visible. Subdomain 3, which is strongly conserved in the FGE family, is shorter and has a significantly weaker homology to the eukaryotic subdomain 3 (similarity of about 20%) as compared to the prokaryotic FGE family members (similarity of about 60%). Thus they lack all of the conserved cysteine residues of subdomain 3. The only conserved features are the initial RVXXGG(A)S motif (SEQ ID NO:79) and the terminal GFR motif.

Genomic Organisation of the Human and Murine FGE Gene

[0343] The human FGE gene is located on chromosome 3p26. It encompasses 105 kb and 9 exons for the translated sequence. The murine FGE gene has a length of 80 Kb and is located on chromosome 6E2. The 9 exons of the murine FGE gene have nearly the same size as the human exons (FIG. 3). Major differences between the human and the mouse gene are the lower conservation of the 3'-UTR in exon 9 and the length of exon 9, which is 461 by longer in the murine gene. Segment 6E2 of mouse chromosome 6 is highly syntenic to the human chromosome segment 3p26. Towards the telomere, both the human and the murine FGE loci are flanked by the genes coding for LMCD1, KIAA0212, ITPR1, AXCAM, and IL5RA. In the centromeric direction, both FGE loci are flanked by the loci of CAV3 and OXTR.

Genomic Organisation of the Prokaryotic FGE Genes

[0344] In prokaryotes the sulfatases are classified either as cysteine- or serine-type sulfatases depending on the residue that is converted to FGly in their active center (Miech, C., et al., J Biol Chem., 1998, 273:4835-4837; Dierks, T., et al., J Biol Chem., 1998, 273:25560-25564). In Klebsiella pneumoniae, E. coli and Yersinia pestis, the serine-type sulfatases are part of an operon with AtsB, which encodes a cytosolic protein containing iron-sulfur cluster motifs and is critical for the generation of FGly from serine residues (Marquordt, C., et al., J Biol Chem., 2003, 278:2212-2218; Szameit, C., et al., J Biol Chem., 1999, 274:15375-15381).

[0345] It was therefore of interest to examine whether prokaryotic FGE genes are localized in proximity to cysteine-type sulfatases that are the substrates of FGE. Among the prokaryotic FGE genes shown in Table 3, seven have fully sequenced genomes allowing a neighbourhood analysis of the FGE loci. Indeed, in four of the 7 genomes (C. efficiens: PID 25028125, P. putida: PID 26990068, C. crescentus: PID 16125425 and M. tuberculosis: PID 15607852) a cysteine-type sulfatase is found in direct vicinity of FGE compatible with a cotranscription of FGE and the sulfatase. In two of them (C. efficiens and P. putida), FGE and the sulfatase have even overlapping ORFs, strongly pointing to their coexpression. Furthermore, the genomic neighbourhood of FGE and sulfatase genes in four prokaryotes provides additional evidence for the assumption that the bacterial FGEs are functional orthologs.

[0346] The remaining three organisms do contain cysteine-type sulfatases (S. coelicolor: PID 24413927, M. loti: HD 13476324, S. meliloti: PIDs 16262963, 16263377, 15964702), however, the genes neighbouring FGE in these organisms neither contain a canonical sulfatase signature (Dierks, T., et al., J Biol Chem., 1998, 273:25560-25564) nor a domain that would indicate their function. In these organims the expression of FGE and cysteine-type sulfatases is therefore likely to be regulated in trans.

Conclusions

[0347] The identification of human FGE whose deficiency causes the autosomal-recessively transmitted lysosomal storage disease Multiple Sulfatase Deficiency, allows the definition of a new gene family which comprises FGE orthologs from prokaryotes and eukaryotes as well as an FGE paralog in mouse and man. FGE is not found in the fully sequenced genomes of E. coli, S. cerevisiae, C. elegans and Fugu rubripes. In addition, there is a phylogenetic gap between prokaryotes and higher eukaryotes with FGE lacking in any species phylogenetically situated between prokaryotes and D. melanogaster. However, some of these lower eukaryotes, e.g. C. elegans, have cysteine-type sulfatase genes. This points to the existence of a second FGly generating system acting on cysteine-type sulfatases. This assumption is supported by the observation that E. coli, which lacks FGE, can generate FGly in cysteine-type sulfatases (Dierks, T., et al., J Biol Chem., 1998, 273:25560-25564).

Example 3

[0348] FGE Expression Causes Significant Increases in Sulfatase Activity in Cell Lines that Overexpress a Sulfatase

[0349] We wanted to examine the effects of FGE on cells expressing/overexpressing a sulfatase. To this end, HT-1080 cells expressing human sulfatases Iduronate 2-Sulfatase (I2S) or N-Acetylgalactosamine 6-Sulfatase (GALNS) were transfected in duplicate with either a FGE expression construct, pXMG.1.3 (Table 7 and FIG. 4) or a control plasmid, pXMG.1.2 (FGE in antisense orientation incapable of producing functional FGE, Table 7). Media samples were harvested 24, 48, and 72 hours following a 24 hour post-electroporation medium change. The samples of medium were tested for respective sulfatase activity by activity assay and total sulfatase protein level estimated by ELISA specific for either Iduronate 2-Sulfatase or N-Acetylgalactosamine 6-Sulfatase.

TABLE-US-00006 TABLE 6 Transfected Cell Lines Expressing Sulfatases Used as Substrates for Transfection Cell Strain Plasmid Sulfatase Expressed 36F pXFM4A.1 N-Acetylgalactosamine 6-Sulfatase 3006 pXI2S6 Iduronate 2-Sulfatase

TABLE-US-00007 TABLE 7 FGE and Control Plasmids Used to Transfect Iduronate 2-Sulfatase and N- Acetylgalactosamine 6-Sulfatase Expressing HT-1080 Cells Plasmid Configuration of Major DNA Sequence Elements* pXMG.1.3 (FGE >1.6 kb CMV enhancer/promoter >1.1 kb FGE expression) cDNA>hGH3' untranslated sequence <amp <DHFR cassette < Cdneo cassette (neomycin phosphotransferase) pXMG.1.2 >1.6 kb CMV enhancer/promoter <1.1 kb FGE (control, cDNA<hGH3' untranslated sequence <amp <DHFR FGE reverse cassette < Cdneo cassette (neomycin phosphotransferase) orientation) *> denotes orientation 5' to 3'

Experimental Procedures

Materials and Methods

Transfection of HT-1080 Cells Producing Iduronate 2-Sulfatase and N-Acetylgalactosamine 6-Sulfatase

[0350] HT-1080 cells were harvested to obtain 9-12.times.10.sup.6 cells for each electroporation. Two plasmids were transfected in duplicate: one to be tested (FGE) and a control; in this case the control plasmid contained the FGE cDNA cloned in the reverse orientation with respect to the CMV promoter. Cells were centrifuged at approximately 1000 RPM for 5 minutes. Cells were suspended in 1.times. PBS at 16.times.10.sup.6 cells/mL. To the bottom of electroporation cuvette, 100 .mu.g of plasmid DNA was added, 750 .mu.L of cell suspension (12.times.10.sup.6 cells) was added to the DNA solution in the cuvette. The cells and DNA were mixed gently with a plastic transfer pipette, being careful not to create bubbles. The cells were electroporated at 450 V, 250 .mu.F (BioRad Gene Pulser). The time constant was recorded.

[0351] The electroporated cells were allowed to sit undisturbed for 10-30 minutes. 1.25 mL of DMEM/10% calf serum was then added to each cuvette, mixed, and all the cells transferred to a fresh T75 flask containing 20 mL DMEM/10. After 24 hours, the flask was re-fed with 20 mL DMEM/10 to remove dead cells. 48-72 hours after transfection, media samples were collected and the cells harvested from duplicate T75 flasks.

Medium Preparation

[0352] 1L DMEM/10 (contains: 23 ml of 2 mM L Glutamine, 115 mL calf serum)

[0353] Cells were transfected in media without methotrexate (MTX). 24 hours later cells were re-fed with media containing the appropriate amounts of MTX (36F=1.0 gM MTX, 3006=0.1M MTX). Medium was harvested and cells collected 24, 48, and 72 hours after re-feed.

Activity Assays

[0354] Iduronate 2-Sulfatase (I2S). NAPS Desalting columns (Amersham Pharmacia Biotech AB, Uppsala, Sweden) were equilibrated with Dialysis Buffer (5 mM sodium acetate, 5 mM tris, pH 7.0). I2S-containing sample was applied to the column and allowed to enter the bed. The sample was eluted in 1 mL of Dialysis Buffer. Desalted samples were further diluted to approximately 100 ng/mL 12S in Reaction Buffer (5 mM sodium acetate, 0.5 mg/L BSA, 0.1% Triton X-100, pH 4.5). 10 AL of each 12S sample was added to the top row of a 96-well Fluormetric Plate (Perkin Elmer, Norwalk, Conn.) and pre-incubated for 15 minutes at 37.degree. C. Substrate was prepared by dissolving 4-methyl-umbelliferyl sulfate (Fluka, Buchs, Switzerland) in Substrate Buffer (5 mM sodium acetate, 0.5 mg/mL BSA, pH 4.5) at a final concentration of 1.5 mg/mL. 100 .mu.L of Substrate was added to each well containing 12S sample and the plate was incubated for 1 hour at 37.degree. C. in the dark. After the incubation 190 .mu.L of Stop Buffer (332.5 mM glycine, 207.5 mM sodium carbonate, pH 10.7) was added to each well containing sample. Stock 4-methylumbelliferone (4-MUF, Sigma, St. Louis, Mo.) was prepared as the product standard in reagent grade water to a final concentration of 1 .mu.M. 150 .mu.L of 1 .mu.M 4-MUF Stock and 150 .mu.L Stop Buffer were added to one top row well in the plate. 150 .mu.L of Stop Buffer was added to every remaining well in the 96-well plate. Two fold serial dilutions were made from the top row of each column down to the last row of the plate. The plate was read on a Fusion Universal Microplate Analyzer (Packard, Meriden, Conn.) with an excitation filter wavelength of 330 nm and an emission filter wavelength of 440 nm. A standard curve of .mu.moles of 4-MUF stock versus fluorescence was generated, and unknown samples have their fluorescence extrapolated from this curve. Results are reported as Units/mL where one Unit of activity was equal to 1 .mu.mole of 4-MUF produced per minute at 37.degree. C.

[0355] N-Acetylgalactosamine 6-Sulfatase (GALNS). The GALNS activity assay makes use of the fluorescent substrate, 4-methyl umbel li feryl-.beta.-D-galactopyranosi de-6-sulfate (Toronto Research Chemicals Inc., Catalogue No. M33448). The assay was comprised of two-steps. At the first step, 75 .mu.L of the 1.3 mM substrate prepared in reaction buffer (0.1M sodium acetate, 0.1M sodium chloride, pH 4.3) was incubated for 4 hours at 37.degree. C. with 10 .mu.L of media/protein sample or its corresponding dilutions. The reaction was stopped by the addition of 5 .mu.L of 2M monobasic sodium phosphate to inhibit the GALNS activity. Following the addition of approximately 500 U of .beta.-galactosidase from Aspergillus oryzae (Sigma, Catalogue No. G5160), the reaction mixture was incubated at 37.degree. C. for an additional hour to release the fluorescent moiety of the substrate. The second reaction was stopped by the addition of 910 .mu.L of stop solution (1% glycine, 1% sodium carbonate, pH 10.7). The fluorescence of the resultant mixture was measured by using a measurement wavelength of 359 nm and a reference wavelength of 445 nm with 4-methylumbelliferone (sodium salt from Sigma, Catalogue No. M1508) serving as a reference standard. One unit of the activity corresponds to nmoles of released 4-methylumbelliferone per hour.

Immunoassays (ELISA)

[0356] Iduronate 2-Sulfatase (I2S). A 96-well flat bottom plate was coated with a mouse monoclonal anti-12S antibody diluted to 10 .mu.g/mL in 50 nM sodium bicarbonate pH 9.6 for 1 hour at 37.degree. C. The mouse monoclonal anti-I2S antibody was developed under contract by Maine Biotechnology Services, Inc. (Portland, Me.) to a purified, recombinantly-produced, full-length, human I2S polypeptide using standard hybridoma-producing technology. The plate was washed 3 times with 1.times. PBS containing 0.1% Tween-20 and blocked for 1 hour with 2% BSA in wash buffer at 37.degree. C. Wash buffer with 2% BSA was used to dilute samples and standards. I2S standard was diluted and used from 100 ng/mL to 1.56 ng/mL. After removal of the blocking buffer, samples and standards were applied to the plate and incubated for 1 hour at 37.degree. C. Detecting antibody, horseradish peroxidase-conjugated mouse anti-I2S antibody, was diluted to 0.15 .mu.g/mL in wash buffer with 2% BSA. The plate was washed 3 times, detecting antibody added to the plate, and it was incubated for 30 minutes at 37.degree. C. To develop the plate, TMB substrate (Bio-Rad, Hercules, Calif.) was prepared. The plate was washed 3 times, 100 .mu.L of substrate was added to each well and it was incubated for 15 minutes at 37.degree. C. The reaction was stopped with 2 N sulfuric acid (100 .mu.L/well) and the plate was read on a microtiter plate reader at 450 nm, using 655 nm as the reference wavelength.

[0357] N-Acetylgalactosamine 6-Sulfatase (GALNS). Two mouse monoclonal anti-GALNS antibodies provided the basis of the GALNS ELISA. The mouse monoclonal anti-GALNS antibodies were also developed under contract by Maine Biotechnology Services, Inc. (Portland, Me.) to a purified, recombinantly-produced, full-length, human GALNS polypeptide using standard hybridoma-producing technology. The first antibody, for capture of GALNS was used to coat a F96 MaxiSorp Nunc-Immuno Plate (Nalge Nunc, Catalogue No. 442404) in a coating buffer (50 mM sodium bicarbonate, pH 9.6). After incubation for one hour at 37.degree. C. and washing with a wash buffer, the plate was blocked with blocking buffer (PBS, 0.05% Tween-20, 2% BSA) for one hour at 37.degree. C. Experimental and control samples along with GALNS standards were then loaded onto the plate and further incubated for one hour at 37.degree. C. After washing with a wash buffer, the second, detection antibody conjugated to HRP was applied in blocking buffer followed by 30 minute incubation at 37.degree. C. After washing the plate again, the Bio-Rad TMB substrate reagent was added and incubated for 15 minutes. 2N sulfuric acid was then. added to stop the reaction and results were scored spectrophotometrically by using a Molecular Device plate reader at 450 nm wavelength.

Discussion

Effect of FGE on Sulfatase Activity

[0358] GALNS. An approximately 50-fold increase in total GALNS activity was observed over the control levels (FIG. 5). This level of increased activity was observed with all three medium sampling time points. Moreover, the GALNS activity was accumulated linearly over time with a four-fold increase between 24 and 48 hours and a two-fold increase between the 48 hour and 72 hour timepoints.

[0359] I2S. Although of smaller absolute magnitude, a similar effect was observed for total I2S activity where an approximately 5-fold increase in total 12S activity was observed over the control levels. This level of increased activity was sustained for the duration of the experiment. 12S activity accumulated in the medium linearly over time, similar to the results seen with GALNS (2.3-fold between 24 and 48 hours, and 1.8-fold between 48 and 72 hours).

Effect of FGE on Sulfatase Specific Activity

[0360] GALNS. Expression of FGE in 36F cells enhanced apparent specific activity of GALNS (ratio of enzyme activity to total enzyme estimated by ELISA) by 40-60 fold over the control levels (FIG. 6). The increase in specific activity was sustained over the three time points in the study and appeared to increase over the three days of post-transfection accumulation.

[0361] I2S. A similar effect was seen with I2S, where a 6-7-fold increase in specific activity (3-5 U/mg) was observed over the control values (0.5-0.7 U/mg).

[0362] The ELISA values for both GALNS (FIG. 7) and I2S were not significantly affected by transfection of FGE. This indicates that expression of FGE does not impair translational and secretory pathways involved in sulfatase production.

[0363] In sum, all of these results for both sulfatases indicate that FGE expression dramatically increases sulfatase specific activity in cell lines that overexpress GALNS and I2S.

Co-Expression of FGE (SUMF1) and Other Sulfatase Genes

[0364] To test the effect of FGE (SUMF1) on additional sulfatase activities in normal cells we overexpressed ARSA (SEQ ID NO:14), ARSC (SEQ ID NO:18) and ARSE (SEQ ID NO:22) cDNAs in various cell lines with and without co-transfection of the FGE (SUMF1) cDNA and measured sulfatase activities. Overexpression of sulfatase cDNAs in Cos-7 cells resulted in a moderate increase of sulfatase activity, while a striking synergistic increase (20 to 50 fold) was observed when both a sulfatase gene and the FGE (SUMF1) gene were co-expressed. A similar, albeit lower, effect was observed in three additional cell lines, HepG2, LE293, and U2OS. Simultaneous overexpression of multiple sulfatase cDNAs resulted in a lower increase of each specific sulfatase activity as compared to overexpression of a single sulfatase, indicating the presence of competition of the different sulfatases for the modification machinery.

[0365] To test for functional conservation of the FGE (SUMF1) gene during evolution we overexpressed ARSA, ARSC and ARSE cDNAs in various cell lines with and without co-transfection of the MSD cDNA and measured sulfatase activities. Both the murine and the DroSophila FGE (SUMF1) genes were active on all three human sulfatases, with the Drosophila FGE (SUMF1) being less efficient. These data demonstrate a high degree of functional conservation of FGE (SUMF1) during evolution implicating significant biological importance to cellular function and survival. A similar and consistent, albeit much weaker, effect was observed by using the FGE2 (SUMF2) gene, suggesting that the protein encoded by this gene also has a sulfatase modifying activity. These data demonstrate that the amount of the FGE (SUMF1)-encoded protein is a limiting factor for sulfatase activities, a finding with important implications for the large scale production of active sulfatases to be utilized in enzyme replacement therapy.

Example 4

[0366] Identification of the Gene Mutated in MSD by Means of Functional Complementation using Microcell Mediated Chromosome Transfer.

[0367] In a separate experiment using microcell mediated chromosome transfer by means of functional complementation we confirmed that the gene mutated in MSD is FGE. Our findings provide further insight into a novel biological mechanism affecting an entire family of proteins in distantly related organisms. In addition to identifying the molecular basis of a rare genetic disease, our data further confirms a powerful enhancing effect of the FGE gene product on the activity of sulfatases. The latter finding has direct clinical implications for the therapy of at least eight human diseases caused by sulfatase deficiencies.

The Gene for MSD Maps to Chromosome 3p26

[0368] To identify the chromosomal location of the gene mutated in MSD we attempted to rescue the deficient sulfatase enzymes by functional complementation via microcell mediated chromosome transfer. A panel of human/mouse hybrid cell lines, containing individual normal human chromosomes tagged with the dominant selectable marker HyTK, was used as the source of donor human chromosomes and fused to an immortalized cell line from a patient with MSD. All 22 human autosomes were transferred one by one to the patient cell line and hybrids were selected in hygromycin. Approximately 25 surviving colonies were picked in each of the 22 transfer experiments. These were grown separately and harvested for subsequent enzymatic testing. ArylsulfataseA (ARSA) (SEQ ID NO:15), ArylsulfataseB (ARSB) (SEQ ID NO:17), and ArylsulfataseC (ARSC) (SEQ ID NO:19) activities were tested for each of the approximately 440 clones (20.times.22). This analysis clearly indicated that sulfatase activities of several clones deriving from the chromosome 3 transfer was significantly higher compared to that of all the other clones. A striking variability was observed when analyzing the activities of each individual clone from the chromosome 3 transfer. To verify whether each clone had an intact human chromosome 3 from the donor cell line, we used a panel of 23 chromosome 3 polymorphic genetic markers, evenly distributed along the length of the chromosome and previously selected on the basis of having different alleles between the donor and the patient cell lines. This allowed us to examine for the presence of the donor chromosome and to identify possible loss of specific regions due to incidental chromosomal breakage. Each clone having high enzymatic activity retained the entire chromosome 3 from the donor cell line, whereas clones with low activities appeared to have lost the entire chromosome on the basis of the absence of chromosome 3 alleles from the donor cell line. The latter clones probably retained a small region of the donor chromosome containing the selectable marker gene that enabled them to survive in hygromycin containing medium. These data indicate that a normal human chromosome 3 was able to complement the defect observed in the MSD patient cell line.

[0369] To determine the specific chromosomal region containing the gene responsible for the complementing activity we used Neo-tagged chromosome 3 hybrids which were found to have lost various portions of the chromosome. In addition, we performed irradiated microcell-mediated chromosome transfer of HyTK-tagged human chromosomes 3. One hundred and fifteen chromosome 3 irradiated hybrids were tested for sulfatase activities and genotyped using a panel of 31 polymorphic microsatellite markers spanning the entire chromosome. All clones displaying high enzymatic activities appeared to have retained chromosome 3p26. A higher resolution analysis using additional markers from this region mapped the putative location for the complementing gene between markers D3S3630 and D3S2397.

Identification of the Gene Mutated in MSD

[0370] We investigated genes from the 3p26 genomic region for mutations in MSD patients. Each exon including splice junctions were PCR-amplified and analyzed by direct sequencing. Mutation analysis was performed on twelve unrelated affected individuals; five previously described MSD patients and seven unpublished cases. Several mutations were identified from our MSD cohort in the expressed sequence tag (EST) AK075459 (SEQ ID NOs:4,5), corresponding to a gene of unknown function, strongly suggesting that this was the gene involved in MSD. Each mutation was found to be absent in 100 control individuals, thus excluding the presence of a sequence polymorphism. Additional confirmatory mutation analysis was performed on reverse transcribed patients' RNAs, particularly in those cases in which genomic DNA analysis revealed the presence of a mutation in or near a splice site, possibly affecting splicing. Frameshift, nonsense, splicing, and missense mutations were also identified, suggesting that the disease is caused by a loss of function mechanism, as anticipated for a recessive disorder. This is also consistent with the observation that almost all missense mutations affect amino acids that are highly conserved throughout evolution (see below).

TABLE-US-00008 TABLE 8 Additional MSD Mutations identified nucleotide amino acid Case reference phenotype exon change change 1. BA426 Conary et al, 1988 moderate 3 463T > C S155P 3 463T > C S155P 2. BA428 Burch et al, 1986 severe neonatal 5 661delG frameshift 3. BA431 Zenger et al, 1989 moderate 1 2T > G M1R 2 276delC frameshift 4. BA799 Burk et al, 1981 mild-moderate 3 463T > C S155P 3 463T > C S155P 5. BA806 unpublished severe neonatal 9 1045T > C R349W 6. BA807 Schmidt et al, 1995 unknown 3 c519 + 4delGTAA ex 3 skipping 9 1076C > A S359X 7. BA809 Couchot et al, 1974 mild-moderate 1 1A > G M1V 9 1042G > C A348P 8. BA810 unpublished severe 8 1006T > C C336R 9 1046G > A R349Q 9. BA811 unpublished severe neonatal 3 c519 + 4delGTAA ex 3 skipping 8 979C > T R327X 10. BA815 unpublished moderate 5 c.603 - 6delC ex 6 skipping 6 836C > T A279V 11. BA919 unpublished mild-moderate 9 1033C > T R345C 9 1033C > T R345C 12. BA920 unpublished moderate 5 653G > A C218Y 9 1033C > T R345C

[0371] Mutations were identified in each MSD patient tested, thus excluding locus heterogeneity. No obvious correlation was observed between the types of mutations identified and the severity of the phenotype reported in the patients, suggesting that clinical variability is not caused by allelic heterogeneity. In three instances different patients (case 1 and 4, case 6 and 9, and case 11 and 12 in Table 6) were found to carry the same mutation. Two of these patients (case 11 and 12) originate from the same town in Sicily, suggesting the presence of a founder effect that was indeed confirmed by haplotype analysis. Surprisingly, most patients were found to be compound heterozygotes, carrying different allelic mutations, while only a few were homozygous. Albeit consistent with the absence of consanguinity reported by the parents, this was a somehow unexpected finding for a very rare recessive disorder such as MSD.

The FGE Gene and Protein

[0372] The consensus cDNA sequence of the human FGE (also used interchangeably herein as SUMF1) cDNA (SEQ ID NO:1) was assembled from several expressed sequence tag (EST) clones and partly from the corresponding genomic sequence. The gene contains nine exons and spans approximately 105 kb (see Example 1). Sequence comparison also identified the presence of a FGE gene paralog located on human chromosome 7 that we designated FGE2 (also used interchangeably herein as SUMF2) (SEQ ID NOs: 45, 46).

Functional Complementation of Sulfatase Deficiencies

[0373] Fibroblasts from two patients (case 1 and 12 in Table 8) with MSD in whom we identified mutations of the FGE (SUMF1) gene (cell lines BA426 and BA920) were infected with HSV viruses containing the wild type and two mutated forms of the FGE (SUMF1) cDNA (R327X and .DELTA.ex3). ARSA, ARSB, and ARSC activities were tested 72 hrs after infection. Expression of the wild type FGE (SUMF1) cDNA resulted in functional complementation of all three activities, while mutant FGE (SUMF1) cDNAs did not (Table 9). These data provide conclusive evidence for the identity of FGE (SUMF1) as the MSD gene and they prove the functional relevance of the mutations found in patients. The disease-associated mutations result in sulfatase deficiency, thus demonstrating that FGE (SUMF1) is an essential factor for sulfatase activity.

TABLE-US-00009 TABLE 9 Functional complementation of sulfatase deficiencies Recipient MSD cell line construct ARSA.sup.(1) ARSB.sup.(1) ARSC.sup.(1) BA426 HSV amplicon 24.0 22.5 0.15 SUMF1-Aex3 42.0 23.8 0.29 SUMF1-R327X 33.6 24.2 0.16 SUMF1 119.5 (4.9 x) 37.8 (1.7 x) 0.62(4.1 BA920 HSV amplicon 16.6 11.3 0.15 SUMF1-Aex3 17.2 14.4 0.07 SUMF1-R327X 36.0 13.5 0.13 SUMF1 66.5 (4.0 x) 21.6 (1.9 x) 0.42(2.8 Control 123.7-394.6 50.6-60.7 1.80-1.58 range .sup.(1)enzymatic activities are expressed as nmoles 4-methylumbelliferone iberated mg protein.sup.-1 3 hrs. MSD cell lines BA426 and BA920 were infected with the HSV amplicon alone, and with constructs carrying either mutant or wild-type SUMF1 cDNAs. The increase of single arylsulfatase activities in fibroblasts infected with the wild-type SUMF1 gene, as compared to those of cells infected with the vector alone, is indicated in parentheses. Activities measured in uninfected control fibroblasts are indicated.

Molecular Basis of MSD

[0374] Based on the hypothesis that the disease gene should be able to complement the enzymatic deficiency in a patient cell line, we performed microcell-mediated chromosome transfer to an immortalized cell line from a patient with MSD. This technique has been successfully used for the identification of genes whose predicted function could be assessed in cell lines (e.g. by measuring enzymatic activity or by detecting morphologic features). To address the problem of stochastic variability of enzyme activity we measured the activities of three different sulfatases (ARSA, ARSB and ARSC) in the complementation assay. The results of chromosome transfer clearly indicated mapping of the complementing gene to chromosome 3. Subregional mapping was achieved by generating a radiation hybrid panel for chromosome 3. Individual hybrid clones were characterized both at the genomic level, by typing 31 microsatellite markers displaying different alleles between donor and recipient cell lines, and at the functional level by testing sulfatase activities. The analysis of 130 such hybrids resulted in the mapping of the complementing region to chromosome 3p26.

[0375] Once the critical genomic region was defined, the FGE (SUMF1) gene was also identified by mutation analysis in patients' DNA. Mutations were found in all patients tested, proving that a single gene is involved in MSD. The mutations found were of different types, the majority (e.g. splice site, start site, nonsense, frameshift) putatively result in a loss function of the encoded protein, as expected for a recessive disease. Most missense mutations affect codons corresponding to amino acids that have been highly conserved during evolution, suggesting that also these mutations cause a loss of function. No correlations could be drawn between the type of mutation and the severity of the phenotype, indicating that the latter is due to unrelated factors. Unexpectedly for a rare genetic disease, many patients were found to be compound heterozygotes, carrying two different mutations. However, a founder effect was identified for one mutation originating from a small town in Sicily.

FGE (SUMF1) Gene Function

[0376] The identity of the FGE (SUMF1) gene as the "complementing factor" was demonstrated definitively by rescuing the enzymatic deficiency of four different sulfatases upon expression of exogenous FGE (SUMF1) cDNA, inserted into a viral vector, in two different patient cell lines. In each case a consistent, albeit partial, restoration of all sulfatase activities tested was observed, as compared to control patient cell lines transfected with empty vectors. On average, the increase of enzyme activities ranged between 1.7 to 4.9 fold and reached approximately half of the levels observed in normal cell lines. Enzyme activity correlates with the number of virus particles used in each experiment and with the efficiency of the infection as tested by marker protein (GFP) analysis. In the same experiments vectors containing FGE (SUMF1) cDNAs carrying two of the mutations found in the patients, R327X and Aex3, were used and no significant increase of enzyme activity was observed, thus demonstrating the functional relevance of these mutations.

[0377] As mentioned elsewhere herein, Schmidt et al. first discovered that sulfatases undergo a post-translational modification of a highly conserved cysteine, that is found at the active site of most sulfatases, to C.alpha.-formylglycine. They also showed that this modification was defective in MSD (Schmidt, B., et al., Cell, 1995, 82:271-278). Our mutational and functional data provide strong evidence that FGE (SUMF1) is responsible for this modification.

[0378] The FGE (SUMF1) gene shows an extremely high degree of sequence conservation across all distantly related species analyzed, from bacteria to man. We provide evidence that that the Drosophila homologue of the human FGE (SUMF1) gene is able to activate overexpressed human sulfatases, proving that the observed high level of sequence similarity of the FGE (SUMF1) genes of distantly related species correlates with a striking functional conservation. A notable exception is yeast, which appears to lack the FGE (SUMF1) gene as well as any sulfatase encoding genes, indicating that sulfatase function is not required by this organism and suggesting the presence of a reciprocal influence on the evolution of FGE (SUMF1) and sulfatase genes.

[0379] Interestingly, there are two homologous genes, FGE (SUMF1) and FGE2 (SUMF2), in the genomes of all vertebrates analyzed, including humans. As evident from the phylogenetic tree, the FGE2 (SUMF2) gene appears to have evolved independently from the FGE (SUMF1) gene. In our assays the FGE2 (SUMF2) gene is also able to activate sulfatases, however it does it in a much less efficient manner compared to the FGE (SUMF1) gene. This may account for the residual sulfatase activity found in MSD patients and suggests that a complete sulfatase deficiency would be lethal. At the moment we cannot rule out the possibility that the FGE2 (SUMF2) gene has an additional, yet unknown, function.

Impact on the Therapy of Diseases Due to Sulfatase Deficiencies

[0380] A strong increase, up to 50 fold, of sulfatase activities was observed in cells overexpressing FGE (SUMF1) cDNA together with either ARSA, ARSC, or ARSE cDNAs, compared to cells overexpressing single sulfatases alone. In all cell lines a significant synergic effect was found, indicating that FGE (SUMF1) is a limiting factor for sulfatase activity. However, variability was observed among different sulfatases, possibly due to different affinity of the FGE (SUMF1)-encoded protein with the various sulfatases. Variability was also observed between different cell lines which may have different levels of endogenous formylglycine generating enzyme. Consistent with these observations, we found that the expression of the MSD gene varies among different tissues, with significantly high levels in kidney and liver. This may have important implications as tissues with low FGE (SUMF1) gene expression levels may be less capable of effectively modifying exogenously delivered sulfatase proteins (see below). Together these data suggest that the function of the FGE (SUMF1) gene has evolved to achieve a dual regulatory system, with each sulfatase being controlled by both an individual mechanism, responsible for the mRNA levels of each structural sulfatase gene, and a common mechanism shared by all sulfatases. In addition, FGE2 (SUMF2) provides partial redundancy for sulfatase modification.

[0381] These data have profound implications for the mass production of active sulfatases to be utilized in enzyme replacement therapy. Enzyme replacement studies have been reported on animal models of sulfatase deficiencies, such as a feline model of mucopolysaccharidosis VI, and proved to be effective in preventing and curing several symptoms. Therapeutic trials in humans are currently being performed for two congenital disorders due to sulfatase deficiencies, MPSII (Hunter syndrome) and MPSVI (Maroteaux-Lamy syndrome) and will soon be extended to a large number of patients.

Example 5

[0382] Enzyme Replacement Therapy with FGE-Activated GALNS for Morquio Disease MPS IVA

[0383] The primary cause of skeletal pathology in Morquio patients is keratan sulfate (KS) accumulation in epiphyseal disk (growth plate) chondrocytes due to deficiency of the lysosomal sulfatase, GALNS. The primary objective of in vivo research studies was to determine whether intravenously (IV) administered FGE-activated GALNS was able to penetrate chondrocytes of the growth plate as well as other appropriate cell types in normal mice. Notwithstanding a general lack of skeletal abnormalities, a GALNS deficient mouse model (Morquio Knock-In--MKI, S. Tomatsu, St. Louis University, MO) was also used to demonstrate in vivo biochemical activity of repeatedly administered FGE-activated GALNS. The lack of skeletal pathology in mouse models reflects the fact that skeletal KS is either greatly reduced or absent in rodents (Venn G, & Mason R M., Biochem J., 1985, 228:443-450). These mice did, however, demonstrate detectable accumulation of GAG and other cellular abnormalities in various organs and tissues. Therefore, the overall objective of the studies was to demonstrate that FGE-activated GALNS penetrates into the growth plate (biodistribution study) and show functional GALNS enzyme activity directed towards removal of accumulated GAG in affected tissues (pharmacodynamic study).

[0384] The results of these studies demonstrated that IV injected FGE-activated GALNS was internalized by chondrocytes of the growth plate, albeit at relatively low levels compared to other tissues. In addition, FGE-activated GALNS injection over the course of 16 weeks in MKI mice effectively cleared accumulated GAG and reduced lysosomal biomarker staining in all soft tissues examined. In sum, the experiments successfully demonstrated GALNS delivery to growth plate chondrocytes and demonstrated biochemical activity in terms of GAG clearance in multiple tissues.

Biodistribution Study

[0385] Four-week-old ICR (normal) mice were given a single IV injection of 5 mg/kg FGE-activated GALNS. Liver, femur (bone), heart, kidney and spleen were collected two hours after injection and prepared for histological examination. A monoclonal anti-human GALNS antibody was used to detect the presence of injected GALNS in the various tissues. GALNS was detected in all tissues examined as compared to the vehicle controls. Moreover, GALNS was readily observed in all tissues examined using a horseradish-peroxidase reporter system, with the exception of bone. Demonstration of GALNS uptake in the growth plate required the use of a more sensitive fluorescein-isothiocyanate (FITC) reporter system and indicates that although GALNS penetrates the growth plate, it is less readily available to growth plate chondrocytes than to cells of soft tissues. Notwithstanding the requirement of a more sensitive fluorescent detection method, GALNS delivery to bone growth plate chondrocytes was observed in all growth plate sections examined as compared to the vehicle controls.

Pharmacodynamic Study in MKI Mice

[0386] Four-week-old MKI or wild-type mice were given weekly IV injections (n=8 per group) through 20 weeks of age. Each weekly injection consisted of either 2 mg/kg FGE-activated GALNS or vehicle control (no injection for wild-type mice). All mice were sacrificed for histological examination at 20 weeks of age and stained using the following methods: hematoxylin and eosin for cellular morphology, alcian blue for detection of GAGs.

[0387] Clearance of accumulated GAG was demonstrated by reduced or absent alcian blue staining in all soft tissues examined (liver, heart, kidney and spleen). This was observed only in the GALNS injected mice. Although the growth plate in the MKI mice functioned normally as evidenced by normal skeletal morphology, there were more subtle cellular abnormalities observed (including vacuolization of chondrocytes without apparent pathological effect). The vacuolized chondrocytes of the hypertrophic and proliferating zones of the growth plate were unaffected by GALNS administration. This was in contrast to the chondrocytes in the calcification zone of the growth plate where a reduction of vacuolization was observed in GALNS injected mice. The vacuolization of chondrocytes and accumulation of presumed non-KS GAG in the growth plate in MKI mice was, in general, surprising and unexpected due to the known lack of KS in the growth plate of mice. These particular observations likely reflect the fact that, in the knock-in mice, high levels of mutant GALNS are present (as opposed to knock-out mice where there is no residual mutant GALNS, no growth plate chondrocyte vacuolization and no GAG accumulation-Tomatsu S. et al., Human Molecular Genetics, 2003, 12:3349-3358). The vacuolization phenomenon in the growth plate may be indicative of a secondary effect on a subset of cells expressing mutant GALNS. Nonetheless, enzyme injection over the course of 16 weeks demonstrated strong evidence of multiple tissue FGE-activated GALNS delivery and in vivo enzymatic activity.

DETAILED DESCRIPTION OF THE DRAWINGS

[0388] FIG. 1: MALDI-TOF mass spectra of P23 after incubation in the absence (A) or presence (B) of a soluble extract from bovine testis microsomes. 6 pmol of P23 were incubated under standard conditions for 10 min at 37.degree. C. in the absence or presence of 1 .mu.l microsomal extract. The samples were prepared for MALDI-TOF mass spectrometry as described in Experimental Procedures. The monoisotopic masses MH.sup.+ of P23 (2526.28) and its FGly derivative (2508.29) are indicated.

[0389] FIG. 2: Phylogenetic tree derived from an alignment of human FGE and 21 proteins of the PFAM-DUF323 seed. The numbers at the branches indicate phylogenetic distance. The proteins are designated by their TrEMBL ID number and the species name. hFGE--human FGE. Upper right: scale of the phylogenetic distances. A asterisk indicates that the gene has been further investigated. The top seven genes are part of the FGE gene family.

[0390] FIG. 3: Organisation of the human and murine FGE gene locus. Exons are shown to scale as dark boxes (human locus) and bright boxes (murine locus). The bar in the lower right corner shows the scale. The lines between the exons show the introns (not to scale). The numbers above the intron lines indicate the size of the introns in kilobases.

[0391] FIG. 4: Diagram showing a map of FGE Expression Plasmid pXMG.1.3

[0392] FIG. 5: Bar graph depicting N-Acetylgalactosamine 6-Sulfatase Activity in 36F Cells Transiently Transfected with FGE Expression Plasmid. Cells were transfected with either a control plasmid, pXMG.1.2, with the FGE cDNA in the reverse oreintation, or a FGE expression plasmid, pXMG.1.3 in media without methotrexate (MTX). 24 hours later cells were re-fed with media containing 1.0 .mu.M MTX. Medium was harvested and cells collected 24, 48, and 72 hours after re-feed. N-Acetylgalactosamine 6-Sulfatase activity was determined by activity assay. Each value shown is the average of two separate transfections with standard deviations indicated by error bars.

[0393] FIG. 6: Bar graph depicting N-Acetylgalactosamine 6-Sulfatase Specific Activity in 36F Cells Transiently Transfected with FGE Expression Plasmid. Cells were transfected with either a control plasmid, pXMG.1.2, with the FGE cDNA in the reverse oreintation, or a FGE expression plasmid, pXMG.1.3 in media without methotrexate (MTX). 24 hours later cells were re-fed with media containing 1.0 .mu.M MTX. Medium was harvested and cells collected 24, 48, and 72 hours after re-feed. N-Acetylgalactosamine 6-Sulfatase specific activity was determined by activity assay and ELISA and is represented as a ratio of N-Acetylgalactosamine 6-Sulfatase activity per mg of ELISA-reactive N-Acetylgalactosamine 6-Sulfatase. Each value shown is the average of two separate transfections.

[0394] FIG. 7: Bar graph depicting N-Acetylgalactosamine 6-Sulfatase Production in 36F Cells Transiently Transfected with FGE Expression Plasmid. Cells were transfected with either a control plasmid, pXMG.1.2, with the FGE cDNA in the reverse oreintation, or a FGE expression plasmid, pXMG.1.3 in media without methotrexate (MTX). 24 hours later cells were re-fed with media containing 1.0 tM MTX. Medium was harvested and cells collected 24, 48, and 72 hours after re-feed. N-Acetylgalactosamine 6-Sulfatase total protein was determined by ELISA. Each value shown is the average of two separate transfections with standard deviations indicated by error bars.

[0395] FIG. 8: Graph depicting Iduronate 2-Sulfatase Activity in 3006 Cells Transiently Transfected with FGE Expression Plasmid. Cells were transfected with either a control plasmid, pXMG.1.2, with the FGE cDNA in the reverse oreintation, or a FGE expression plasmid, pXMG.1.3 in media without methotrexate (MTX). 24 hours later cells were re-fed with media containing 0.1 .mu.M MTX. Medium was harvested and cells collected 24, 48, and 72 hours after re-feed. Iduronate 2-Sulfatase activity was determined by activity assay. Each value shown is the average of two separate transfections.

[0396] FIG. 9: Depicts a kit embodying features of the present invention.

EQUIVALENTS

[0397] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

[0398] All references disclosed herein are incorporated by reference in their entirety. What is claimed is presented below and is followed by a Sequence Listing.

Sequence CWU 1

1

9611180DNAHomo sapiensCDS(20)..(1141) 1acatggcccg cgggacaac atg gct gcg ccc gca cta ggg ctg gtg tgt gga 52 Met Ala Ala Pro Ala Leu Gly Leu Val Cys Gly 1 5 10cgt tgc cct gag ctg ggt ctc gtc ctc ttg ctg ctg ctg ctc tcg ctg 100Arg Cys Pro Glu Leu Gly Leu Val Leu Leu Leu Leu Leu Leu Ser Leu 15 20 25ctg tgt gga gcg gca ggg agc cag gag gcc ggg acc ggt gcg ggc gcg 148Leu Cys Gly Ala Ala Gly Ser Gln Glu Ala Gly Thr Gly Ala Gly Ala 30 35 40ggg tcc ctt gcg ggt tct tgc ggc tgc ggc acg ccc cag cgg cct ggc 196Gly Ser Leu Ala Gly Ser Cys Gly Cys Gly Thr Pro Gln Arg Pro Gly 45 50 55gcc cat ggc agt tcg gca gcc gct cac cga tac tcg cgg gag gct aac 244Ala His Gly Ser Ser Ala Ala Ala His Arg Tyr Ser Arg Glu Ala Asn60 65 70 75gct ccg ggc ccc gta ccc gga gag cgg caa ctc gcg cac tca aag atg 292Ala Pro Gly Pro Val Pro Gly Glu Arg Gln Leu Ala His Ser Lys Met 80 85 90gtc ccc atc cct gct gga gta ttt aca atg ggc aca gat gat cct cag 340Val Pro Ile Pro Ala Gly Val Phe Thr Met Gly Thr Asp Asp Pro Gln 95 100 105ata aag cag gat ggg gaa gca cct gcg agg aga gtt act att gat gcc 388Ile Lys Gln Asp Gly Glu Ala Pro Ala Arg Arg Val Thr Ile Asp Ala 110 115 120ttt tac atg gat gcc tat gaa gtc agt aat act gaa ttt gag aag ttt 436Phe Tyr Met Asp Ala Tyr Glu Val Ser Asn Thr Glu Phe Glu Lys Phe 125 130 135gtg aac tca act ggc tat ttg aca gag gct gag aag ttt ggc gac tcc 484Val Asn Ser Thr Gly Tyr Leu Thr Glu Ala Glu Lys Phe Gly Asp Ser140 145 150 155ttt gtc ttt gaa ggc atg ttg agt gag caa gtg aag acc aat att caa 532Phe Val Phe Glu Gly Met Leu Ser Glu Gln Val Lys Thr Asn Ile Gln 160 165 170cag gca gtt gca gct gct ccc tgg tgg tta cct gtg aaa ggc gct aac 580Gln Ala Val Ala Ala Ala Pro Trp Trp Leu Pro Val Lys Gly Ala Asn 175 180 185tgg aga cac cca gaa ggg cct gac tct act att ctg cac agg ccg gat 628Trp Arg His Pro Glu Gly Pro Asp Ser Thr Ile Leu His Arg Pro Asp 190 195 200cat cca gtt ctc cat gtg tcc tgg aat gat gcg gtt gcc tac tgc act 676His Pro Val Leu His Val Ser Trp Asn Asp Ala Val Ala Tyr Cys Thr 205 210 215tgg gca ggg aag cgg ctg ccc acg gaa gct gag tgg gaa tac agc tgt 724Trp Ala Gly Lys Arg Leu Pro Thr Glu Ala Glu Trp Glu Tyr Ser Cys220 225 230 235cga gga ggc ctg cat aat aga ctt ttc ccc tgg ggc aac aaa ctg cag 772Arg Gly Gly Leu His Asn Arg Leu Phe Pro Trp Gly Asn Lys Leu Gln 240 245 250ccc aaa ggc cag cat tat gcc aac att tgg cag ggc gag ttt ccg gtg 820Pro Lys Gly Gln His Tyr Ala Asn Ile Trp Gln Gly Glu Phe Pro Val 255 260 265acc aac act ggt gag gat ggc ttc caa gga act gcg cct gtt gat gcc 868Thr Asn Thr Gly Glu Asp Gly Phe Gln Gly Thr Ala Pro Val Asp Ala 270 275 280ttc cct ccc aat ggt tat ggc tta tac aac ata gtg ggg aac gca tgg 916Phe Pro Pro Asn Gly Tyr Gly Leu Tyr Asn Ile Val Gly Asn Ala Trp 285 290 295gaa tgg act tca gac tgg tgg act gtt cat cat tct gtt gaa gaa acg 964Glu Trp Thr Ser Asp Trp Trp Thr Val His His Ser Val Glu Glu Thr300 305 310 315ctt aac cca aaa ggt ccc cct tct ggg aaa gac cga gtg aag aaa ggt 1012Leu Asn Pro Lys Gly Pro Pro Ser Gly Lys Asp Arg Val Lys Lys Gly 320 325 330gga tcc tac atg tgc cat agg tct tat tgt tac agg tat cgc tgt gct 1060Gly Ser Tyr Met Cys His Arg Ser Tyr Cys Tyr Arg Tyr Arg Cys Ala 335 340 345gct cgg agc cag aac aca cct gat agc tct gct tcg aat ctg gga ttc 1108Ala Arg Ser Gln Asn Thr Pro Asp Ser Ser Ala Ser Asn Leu Gly Phe 350 355 360cgc tgt gca gcc gac cgc ctg ccc acc atg gac tgacaaccaa gggtagtctt 1161Arg Cys Ala Ala Asp Arg Leu Pro Thr Met Asp 365 370ccccagtcca aggagcagt 11802374PRTHomo sapiens 2Met Ala Ala Pro Ala Leu Gly Leu Val Cys Gly Arg Cys Pro Glu Leu1 5 10 15Gly Leu Val Leu Leu Leu Leu Leu Leu Ser Leu Leu Cys Gly Ala Ala 20 25 30Gly Ser Gln Glu Ala Gly Thr Gly Ala Gly Ala Gly Ser Leu Ala Gly 35 40 45Ser Cys Gly Cys Gly Thr Pro Gln Arg Pro Gly Ala His Gly Ser Ser 50 55 60Ala Ala Ala His Arg Tyr Ser Arg Glu Ala Asn Ala Pro Gly Pro Val65 70 75 80Pro Gly Glu Arg Gln Leu Ala His Ser Lys Met Val Pro Ile Pro Ala 85 90 95Gly Val Phe Thr Met Gly Thr Asp Asp Pro Gln Ile Lys Gln Asp Gly 100 105 110Glu Ala Pro Ala Arg Arg Val Thr Ile Asp Ala Phe Tyr Met Asp Ala 115 120 125Tyr Glu Val Ser Asn Thr Glu Phe Glu Lys Phe Val Asn Ser Thr Gly 130 135 140Tyr Leu Thr Glu Ala Glu Lys Phe Gly Asp Ser Phe Val Phe Glu Gly145 150 155 160Met Leu Ser Glu Gln Val Lys Thr Asn Ile Gln Gln Ala Val Ala Ala 165 170 175Ala Pro Trp Trp Leu Pro Val Lys Gly Ala Asn Trp Arg His Pro Glu 180 185 190Gly Pro Asp Ser Thr Ile Leu His Arg Pro Asp His Pro Val Leu His 195 200 205Val Ser Trp Asn Asp Ala Val Ala Tyr Cys Thr Trp Ala Gly Lys Arg 210 215 220Leu Pro Thr Glu Ala Glu Trp Glu Tyr Ser Cys Arg Gly Gly Leu His225 230 235 240Asn Arg Leu Phe Pro Trp Gly Asn Lys Leu Gln Pro Lys Gly Gln His 245 250 255Tyr Ala Asn Ile Trp Gln Gly Glu Phe Pro Val Thr Asn Thr Gly Glu 260 265 270Asp Gly Phe Gln Gly Thr Ala Pro Val Asp Ala Phe Pro Pro Asn Gly 275 280 285Tyr Gly Leu Tyr Asn Ile Val Gly Asn Ala Trp Glu Trp Thr Ser Asp 290 295 300Trp Trp Thr Val His His Ser Val Glu Glu Thr Leu Asn Pro Lys Gly305 310 315 320Pro Pro Ser Gly Lys Asp Arg Val Lys Lys Gly Gly Ser Tyr Met Cys 325 330 335His Arg Ser Tyr Cys Tyr Arg Tyr Arg Cys Ala Ala Arg Ser Gln Asn 340 345 350Thr Pro Asp Ser Ser Ala Ser Asn Leu Gly Phe Arg Cys Ala Ala Asp 355 360 365Arg Leu Pro Thr Met Asp 37031122DNAHomo sapiens 3atggctgcgc ccgcactagg gctggtgtgt ggacgttgcc ctgagctggg tctcgtcctc 60ttgctgctgc tgctctcgct gctgtgtgga gcggcaggga gccaggaggc cgggaccggt 120gcgggcgcgg ggtcccttgc gggttcttgc ggctgcggca cgccccagcg gcctggcgcc 180catggcagtt cggcagccgc tcaccgatac tcgcgggagg ctaacgctcc gggccccgta 240cccggagagc ggcaactcgc gcactcaaag atggtcccca tccctgctgg agtatttaca 300atgggcacag atgatcctca gataaagcag gatggggaag cacctgcgag gagagttact 360attgatgcct tttacatgga tgcctatgaa gtcagtaata ctgaatttga gaagtttgtg 420aactcaactg gctatttgac agaggctgag aagtttggcg actcctttgt ctttgaaggc 480atgttgagtg agcaagtgaa gaccaatatt caacaggcag ttgcagctgc tccctggtgg 540ttacctgtga aaggcgctaa ctggagacac ccagaagggc ctgactctac tattctgcac 600aggccggatc atccagttct ccatgtgtcc tggaatgatg cggttgccta ctgcacttgg 660gcagggaagc ggctgcccac ggaagctgag tgggaataca gctgtcgagg aggcctgcat 720aatagacttt tcccctgggg caacaaactg cagcccaaag gccagcatta tgccaacatt 780tggcagggcg agtttccggt gaccaacact ggtgaggatg gcttccaagg aactgcgcct 840gttgatgcct tccctcccaa tggttatggc ttatacaaca tagtggggaa cgcatgggaa 900tggacttcag actggtggac tgttcatcat tctgttgaag aaacgcttaa cccaaaaggt 960cccccttctg ggaaagaccg agtgaagaaa ggtggatcct acatgtgcca taggtcttat 1020tgttacaggt atcgctgtgc tgctcggagc cagaacacac ctgatagctc tgcttcgaat 1080ctgggattcc gctgtgcagc cgaccgcctg cccaccatgg ac 112242130DNAHomo sapiens 4acatggcccg cgggacaaca tggctgcgcc cgcactaggg ctggtgtgtg gacgttgccc 60tgagctgggt ctcgtcctct tgctgctgct gctctcgctg ctgtgtggag cggcagggag 120ccaggaggcc gggaccggtg cgggcgcggg gtcccttgcg ggttcttgcg gctgcggcac 180gccccagcgg cctggcgccc atggcagttc ggcagccgct caccgatact cgcgggaggc 240taacgctccg ggccccgtac ccggagagcg gcaactcgcg cactcaaaga tggtccccat 300ccctgctgga gtatttacaa tgggcacaga tgatcctcag ataaagcagg atggggaagc 360acctgcgagg agagttacta ttgatgccct ttacatggat gcctatgaag tcagtaatac 420tgaatttgag aagtttgtga actcaactgg ctatttgaca gaggctgaga agtttggcga 480ctcctttgtc tttgaaggca tgttgagtga gcaagtgaag accaatattc aacaggcagt 540tgcagctgct ccctggtggt tacctgtgaa aggcgctaac tggagacacc cagaagggcc 600tgactctact attctgcaca ggccggatca tccagttctc catgtgtcct ggaatgatgc 660ggttgcctac tgcacttggg cagggaagcg gctgcccacg gaagctgagt gggaatacag 720ctgtcgagga ggcctgcata atagactttt cccctggggc aacaaactgc agcccaaagg 780ccagcattat gccaacattt ggcagggcga ttttccggtg accaacactg gtgaggatgg 840cttccaagga actgcgcctg ttgatgcctt ccctcccaat ggttatggct tatacaacat 900agtggggaac gcatgggaat ggacttcaga ctggtggact gttcatcatt ctgttgaaga 960aacgcttaac ccaaaaggtc ccccttctgg gaaagaccga gtgaagaaag gtggatccta 1020catgtgccat aggtcttatt gttacaggta tcgctgtgct gctcggagcc agaacacacc 1080tgatagctct gcttcgaatc tgggattccg ctgtgcagcc gaccgcctgc ccaccatgga 1140ctgacaacca agggtagtct tccccagtcc aaggagcagt cgtgtctgac ctacattggg 1200ctttcctcag aactttgaac gatcccatgc aaagaattcc caccctgagg tgggttacat 1260acctgcccaa tggccaaagg aaccgccttg tgagaccaaa ttgctgacct gggtcagtgc 1320atgtgcttta tggtgtggtg catctttgga gatcatcacc atattttact tttgagagtc 1380tttaaagagg aaggggagtg gagggaaccc tgagctaggc ttcaggaggc ccgcatccta 1440cgcaggctct gccacagggg ttagacccca ggtccgacgc ttgaccttcc tgggcctcaa 1500gtgccctccc ctatcaaatg aaggaatgga cagcatgacc tctgggtgtc tctccaactc 1560accagttcta aaaagggtat cagattctat tgtgacttca tagaatttat gatagattat 1620tttttagcta ttttttccat gtgtgaacct tgagtgatac taatcatgta aagtaagagt 1680tctcttatgt attatgttcg gaagaggggt gtggtgactc ctttatattc gtactgcact 1740ttgtttttcc aaggaaatca gtgtctttta cgttgttatg atgaatccca catggggccg 1800gtgatggtat gctgaagttc agccgttgaa cacataggaa tgtctgtggg gtgactctac 1860tgtgctttat cttttaacat taagtgcctt tggttcagag gggcagtcat aagctctgtt 1920tccccctctc cccaaagcct tcagcgaacg tgaaatgtgc gctaaacggg gaaacctgtt 1980taattctaga tatagggaaa aaggaacgag gaccttgaat gagctatatt cagggtatcc 2040ggtattttgt aatagggaat aggaaacctt gttggctgtg gaatatccga tgctttgaat 2100catgcactgt gttgaataaa cgtatctgct 21305374PRTHomo sapiens 5Met Ala Ala Pro Ala Leu Gly Leu Val Cys Gly Arg Cys Pro Glu Leu1 5 10 15Gly Leu Val Leu Leu Leu Leu Leu Leu Ser Leu Leu Cys Gly Ala Ala 20 25 30Gly Ser Gln Glu Ala Gly Thr Gly Ala Gly Ala Gly Ser Leu Ala Gly 35 40 45Ser Cys Gly Cys Gly Thr Pro Gln Arg Pro Gly Ala His Gly Ser Ser 50 55 60Ala Ala Ala His Arg Tyr Ser Arg Glu Ala Asn Ala Pro Gly Pro Val65 70 75 80Pro Gly Glu Arg Gln Leu Ala His Ser Lys Met Val Pro Ile Pro Ala 85 90 95Gly Val Phe Thr Met Gly Thr Asp Asp Pro Gln Ile Lys Gln Asp Gly 100 105 110Glu Ala Pro Ala Arg Arg Val Thr Ile Asp Ala Leu Tyr Met Asp Ala 115 120 125Tyr Glu Val Ser Asn Thr Glu Phe Glu Lys Phe Val Asn Ser Thr Gly 130 135 140Tyr Leu Thr Glu Ala Glu Lys Phe Gly Asp Ser Phe Val Phe Glu Gly145 150 155 160Met Leu Ser Glu Gln Val Lys Thr Asn Ile Gln Gln Ala Val Ala Ala 165 170 175Ala Pro Trp Trp Leu Pro Val Lys Gly Ala Asn Trp Arg His Pro Glu 180 185 190Gly Pro Asp Ser Thr Ile Leu His Arg Pro Asp His Pro Val Leu His 195 200 205Val Ser Trp Asn Asp Ala Val Ala Tyr Cys Thr Trp Ala Gly Lys Arg 210 215 220Leu Pro Thr Glu Ala Glu Trp Glu Tyr Ser Cys Arg Gly Gly Leu His225 230 235 240Asn Arg Leu Phe Pro Trp Gly Asn Lys Leu Gln Pro Lys Gly Gln His 245 250 255Tyr Ala Asn Ile Trp Gln Gly Asp Phe Pro Val Thr Asn Thr Gly Glu 260 265 270Asp Gly Phe Gln Gly Thr Ala Pro Val Asp Ala Phe Pro Pro Asn Gly 275 280 285Tyr Gly Leu Tyr Asn Ile Val Gly Asn Ala Trp Glu Trp Thr Ser Asp 290 295 300Trp Trp Thr Val His His Ser Val Glu Glu Thr Leu Asn Pro Lys Gly305 310 315 320Pro Pro Ser Gly Lys Asp Arg Val Lys Lys Gly Gly Ser Tyr Met Cys 325 330 335His Arg Ser Tyr Cys Tyr Arg Tyr Arg Cys Ala Ala Arg Ser Gln Asn 340 345 350Thr Pro Asp Ser Ser Ala Ser Asn Leu Gly Phe Arg Cys Ala Ala Asp 355 360 365Arg Leu Pro Thr Met Asp 37062297DNAHomo sapiens 6cggctgtgtt gcgcagtctt catgggttcc cgacgaggag gtctctgtgg ctgcggcggc 60tgctaactgc gccacctgct gcagcctgtc cccgccgctc tgaagcggcc gcgtcgaagc 120cgaaatgccg ccaccccgga ccggccgagg ccttctctgg ctgggtctgg ttctgagctc 180cgtctgcgtc gccctcggat ccgaaacgca ggccaactcg accacagatg ctctgaacgt 240tcttctcatc atcgtggatg acctgcgccc ctccctgggc tgttatgggg ataagctggt 300gaggtcccca aatattgacc aactggcatc ccacagcctc ctcttccaga atgcctttgc 360gcagcaagca gtgtgcgccc cgagccgcgt ttctttcctc actggcagga gacctgacac 420cacccgcctg tacgacttca actcctactg gagggtgcac gctggaaact tctccaccat 480cccccagtac ttcaaggaga atggctatgt gaccatgtcg gtgggaaaag tctttcaccc 540tgggatatct tctaaccata ccgatgattc tccgtatagc tggtcttttc caccttatca 600tccttcctct gagaagtatg aaaacactaa gacatgtcga gggccagatg gagaactcca 660tgccaacctg ctttgccctg tggatgtgct ggatgttccc gagggcacct tgcctgacaa 720acagagcact gagcaagcca tacagttgtt ggaaaagatg aaaacgtcag ccagtccttt 780cttcctggcc gttgggtatc ataagccaca catccccttc agatacccca aggaatttca 840gaagttgtat cccttggaga acatcaccct ggcccccgat cccgaggtcc ctgatggcct 900accccctgtg gcctacaacc cctggatgga catcaggcaa cgggaagacg tccaagcctt 960aaacatcagt gtgccgtatg gtccaattcc tgtggacttt cagcggaaaa tccgccagag 1020ctactttgcc tctgtgtcat atttggatac acaggtcggc cgcctcttga gtgctttgga 1080cgatcttcag ctggccaaca gcaccatcat tgcatttacc tcggatcatg ggtgggctct 1140aggtgaacat ggagaatggg ccaaatacag caattttgat gttgctaccc atgttcccct 1200gatattctat gttcctggaa ggacggcttc acttccggag gcaggcgaga agcttttccc 1260ttacctcgac ccttttgatt ccgcctcaca gttgatggag ccaggcaggc aatccatgga 1320ccttgtggaa cttgtgtctc tttttcccac gctggctgga cttgcaggac tgcaggttcc 1380acctcgctgc cccgttcctt catttcacgt tgagctgtgc agagaaggca agaaccttct 1440gaagcatttt cgattccgtg acttggaaga ggatccgtac ctccctggta atccccgtga 1500actgattgcc tatagccagt atccccggcc ttcagacatc cctcagtgga attctgacaa 1560gccgagttta aaagatataa agatcatggg ctattccata cgcaccatag actataggta 1620tactgtgtgg gttggcttca atcctgatga atttctagct aacttttctg acatccatgc 1680aggggaactg tattttgtgg attctgaccc attgcaggat cacaatatgt ataatgattc 1740ccaaggtgga gatcttttcc agttgttgat gccttgagtt ttgccaacca tggatggcaa 1800atgtgatgtg ctcccttcca gctggtgaga ggaggagtta gagctggtcg ttttgtgatt 1860acccataata ttggaagcag cctgagggct agttaatcca aacatgcatc aacaatttgg 1920cctgagaata tgtaacagcc aaaccttttc gtttagtctt tattaaaatt tataattggt 1980aattggacca gttttttttt taatttccct ctttttaaaa cagttacggc ttatttactg 2040aataaataca aagcaaacaa actcaagtta tgtcatacct ttggatacga agaccataca 2100taataaccaa acataacatt atacacaaag aatactttca ttatttgtgg aatttagtgc 2160atttcaaaaa gtaatcatat atcaaactag gcaccacact aagttcctga ttattttgtt 2220tataatttaa taatatatct tatgagccct atatattcaa aatattatgt taacatgtaa 2280tccatgtttc tttttcc 22977550PRTHomo sapiens 7Met Pro Pro Pro Arg Thr Gly Arg Gly Leu Leu Trp Leu Gly Leu Val1 5 10 15Leu Ser Ser Val Cys Val Ala Leu Gly Ser Glu Thr Gln Ala Asn Ser 20 25 30Thr Thr Asp Ala Leu Asn Val Leu Leu Ile Ile Val Asp Asp Leu Arg 35 40 45Pro Ser Leu Gly Cys Tyr Gly Asp Lys Leu Val Arg Ser Pro Asn Ile 50 55 60Asp Gln Leu Ala Ser His Ser Leu Leu Phe Gln Asn Ala Phe Ala Gln65 70 75 80Gln Ala Val Cys Ala Pro Ser Arg Val Ser Phe Leu Thr Gly Arg Arg 85 90 95Pro Asp Thr Thr Arg Leu Tyr Asp Phe Asn Ser Tyr Trp Arg Val His 100 105 110Ala Gly Asn Phe Ser Thr Ile Pro Gln Tyr Phe Lys Glu Asn Gly Tyr 115 120 125Val Thr Met Ser Val Gly Lys Val Phe His Pro Gly Ile Ser Ser Asn 130 135 140His Thr Asp Asp Ser Pro Tyr Ser Trp Ser Phe Pro Pro Tyr His Pro145 150 155 160Ser Ser

Glu Lys Tyr Glu Asn Thr Lys Thr Cys Arg Gly Pro Asp Gly 165 170 175Glu Leu His Ala Asn Leu Leu Cys Pro Val Asp Val Leu Asp Val Pro 180 185 190Glu Gly Thr Leu Pro Asp Lys Gln Ser Thr Glu Gln Ala Ile Gln Leu 195 200 205Leu Glu Lys Met Lys Thr Ser Ala Ser Pro Phe Phe Leu Ala Val Gly 210 215 220Tyr His Lys Pro His Ile Pro Phe Arg Tyr Pro Lys Glu Phe Gln Lys225 230 235 240Leu Tyr Pro Leu Glu Asn Ile Thr Leu Ala Pro Asp Pro Glu Val Pro 245 250 255Asp Gly Leu Pro Pro Val Ala Tyr Asn Pro Trp Met Asp Ile Arg Gln 260 265 270Arg Glu Asp Val Gln Ala Leu Asn Ile Ser Val Pro Tyr Gly Pro Ile 275 280 285Pro Val Asp Phe Gln Arg Lys Ile Arg Gln Ser Tyr Phe Ala Ser Val 290 295 300Ser Tyr Leu Asp Thr Gln Val Gly Arg Leu Leu Ser Ala Leu Asp Asp305 310 315 320Leu Gln Leu Ala Asn Ser Thr Ile Ile Ala Phe Thr Ser Asp His Gly 325 330 335Trp Ala Leu Gly Glu His Gly Glu Trp Ala Lys Tyr Ser Asn Phe Asp 340 345 350Val Ala Thr His Val Pro Leu Ile Phe Tyr Val Pro Gly Arg Thr Ala 355 360 365Ser Leu Pro Glu Ala Gly Glu Lys Leu Phe Pro Tyr Leu Asp Pro Phe 370 375 380Asp Ser Ala Ser Gln Leu Met Glu Pro Gly Arg Gln Ser Met Asp Leu385 390 395 400Val Glu Leu Val Ser Leu Phe Pro Thr Leu Ala Gly Leu Ala Gly Leu 405 410 415Gln Val Pro Pro Arg Cys Pro Val Pro Ser Phe His Val Glu Leu Cys 420 425 430Arg Glu Gly Lys Asn Leu Leu Lys His Phe Arg Phe Arg Asp Leu Glu 435 440 445Glu Asp Pro Tyr Leu Pro Gly Asn Pro Arg Glu Leu Ile Ala Tyr Ser 450 455 460Gln Tyr Pro Arg Pro Ser Asp Ile Pro Gln Trp Asn Ser Asp Lys Pro465 470 475 480Ser Leu Lys Asp Ile Lys Ile Met Gly Tyr Ser Ile Arg Thr Ile Asp 485 490 495Tyr Arg Tyr Thr Val Trp Val Gly Phe Asn Pro Asp Glu Phe Leu Ala 500 505 510Asn Phe Ser Asp Ile His Ala Gly Glu Leu Tyr Phe Val Asp Ser Asp 515 520 525Pro Leu Gln Asp His Asn Met Tyr Asn Asp Ser Gln Gly Gly Asp Leu 530 535 540Phe Gln Leu Leu Met Pro545 55082657DNAHomo sapiens 8gaattccggg ccatgagctg ccccgtgccc gcctgctgcg cgctgctgct agtcctgggg 60ctctgccggg cgcgtccccg gaacgcactg ctgctcctcg cggatgacgg aggctttgag 120agtggcgcgt acaacaacag cgccatcgcc accccgcacc tggacgcctt ggcccgccgc 180agcctcctct ttcgcaatgc cttcacctcg gtcagcagct gctctcccag ccgcgccagc 240ctcctcactg gcctgcccca gcatcagaat gggatgtacg ggctgcacca ggacgtgcac 300cacttcaact ccttcgacaa ggtgcggagc ctgccgctgc tgctcagcca agctggtgtg 360cgcacaggca tcatcgggaa gaagcacgtg gggccggaga ccgtgtaccc gtttgacttt 420gcgtacacgg aggagaatgg ctccgtcctc caggtggggc ggaacatcac tagaattaag 480ctgctcgtcc ggaaattcct gcagactcag gatgaccggc ctttcttcct ctacgtcgcc 540ttccacgacc cccaccgctg tgggcactcc cagccccagt acggaacctt ctgtgagaag 600tttggcaacg gagagagcgg catgggtcgt atcccagact ggacccccca ggcctacgac 660ccactggacg tgctggtgcc ttacttcgtc cccaacaccc cggcagcccg agccgacctg 720gccgctcagt acaccaccgt cggccgcatg gaccaaggag ttggactggt gctccaggag 780ctgcgtgacg ccggtgtcct gaacgacaca ctggtgatct tcacgtccga caacgggatc 840cccttcccca gcggcaggac caacctgtac tggccgggca ctgctgaacc cttactggtg 900tcatccccgg agcacccaaa acgctggggc caagtcagcg aggcctacgt gagcctccta 960gacctcacgc ccaccatctt ggattggttc tcgatcccgt accccagcta cgccatcttt 1020ggctcgaaga ccatccacct cactggccgg tccctcctgc cggcgctgga ggccgagccc 1080ctctgggcca ccgtctttgg cagccagagc caccacgagg tcaccatgtc ctaccccatg 1140cgctccgtgc agcaccggca cttccgcctc gtgcacaacc tcaacttcaa gatgcccttt 1200cccatcgacc aggacttcta cgtctcaccc accttccagg acctcctgaa ccgcaccaca 1260gctggtcagc ccacgggctg gtacaaggac ctccgtcatt actactaccg ggcgcgctgg 1320gagctctacg accggagccg ggacccccac gagacccaga acctggccac cgacccgcgc 1380tttgctcagc ttctggagat gcttcgggac cagctggcca agtggcagtg ggagacccac 1440gacccctggg tgtgcgcccc cgacggcgtc ctggaggaga agctctctcc ccagtgccag 1500cccctccaca atgagctgtg accatcccag gaggcctgtg cacacatccc aggcatgtcc 1560cagacacatc ccacacgtgt ccgtgtggcc ggccagcctg gggagtagtg gcaacagccc 1620ttccgtccac actcccatcc aaggagggtt cttccttcct gtggggtcac tcttgccatt 1680gcctggaggg ggaccagagc atgtgaccag agcatgtgcc cagcccctcc accaccaggg 1740gcactgccgt catggcaggg gacacagttg tccttgtgtc tgaaccatgt cccagcacgg 1800gaattctaga catacgtggt ctgcggacag ggcagcgccc ccagcccatg acaagggagt 1860cttgttttct ggcttggttt ggggacctgc aaatgggagg cctgaggccc tcttcaggct 1920ttggcagcca cagatacttc tgaacccttc acagagagca ggcaggggct tcggtgccgc 1980gtgggcagta cgcaggtccc accgacactc acctgggagc acggcgcctg gctcttacca 2040gcgtctggcc tagaggaagc ctttgagcga cctttgggca ggtttctgct tcttctgttt 2100tgcccatggt caagtccctg ttccccaggc aggtttcagc tgattggcag caggctccct 2160gagtgatgag cttgaacctg tggtgtttct gggcagaagc ttatcttttt tgagagtgtc 2220cgaagatgaa ggcatggcga tgcccgtcct ctggcttggg ttaattcttc ggtgacactg 2280gcattgctgg gtggtgatgc ccgtcctctg gcttgggtta attcttcggt gacactggcg 2340ttgctgggtg gcaatgcccg tcctctggct tgggttaatt cttcggtgac actggcgttg 2400ctgggtggcg atgcccgtcc tctggcttgg gttaattctt ggatgacgtc ggcgttgctg 2460ggagaatgtg ccgttcctgc cctgcctcca cccacctcgg gagcagaagc ccggcctgga 2520cacccctcgg cctggacacc cctcgaagga gagggcgctt ccttgagtag gtgggctccc 2580cttgcccttc cctccctatc actccatact ggggtgggct ggaggaggcc acaggccagc 2640tattgtaaaa gcttttt 26579502PRTHomo sapiens 9Met Ser Cys Pro Val Pro Ala Cys Cys Ala Leu Leu Leu Val Leu Gly1 5 10 15Leu Cys Arg Ala Arg Pro Arg Asn Ala Leu Leu Leu Leu Ala Asp Asp 20 25 30Gly Gly Phe Glu Ser Gly Ala Tyr Asn Asn Ser Ala Ile Ala Thr Pro 35 40 45His Leu Asp Ala Leu Ala Arg Arg Ser Leu Leu Phe Arg Asn Ala Phe 50 55 60Thr Ser Val Ser Ser Cys Ser Pro Ser Arg Ala Ser Leu Leu Thr Gly65 70 75 80Leu Pro Gln His Gln Asn Gly Met Tyr Gly Leu His Gln Asp Val His 85 90 95His Phe Asn Ser Phe Asp Lys Val Arg Ser Leu Pro Leu Leu Leu Ser 100 105 110Gln Ala Gly Val Arg Thr Gly Ile Ile Gly Lys Lys His Val Gly Pro 115 120 125Glu Thr Val Tyr Pro Phe Asp Phe Ala Tyr Thr Glu Glu Asn Gly Ser 130 135 140Val Leu Gln Val Gly Arg Asn Ile Thr Arg Ile Lys Leu Leu Val Arg145 150 155 160Lys Phe Leu Gln Thr Gln Asp Asp Arg Pro Phe Phe Leu Tyr Val Ala 165 170 175Phe His Asp Pro His Arg Cys Gly His Ser Gln Pro Gln Tyr Gly Thr 180 185 190Phe Cys Glu Lys Phe Gly Asn Gly Glu Ser Gly Met Gly Arg Ile Pro 195 200 205Asp Trp Thr Pro Gln Ala Tyr Asp Pro Leu Asp Val Leu Val Pro Tyr 210 215 220Phe Val Pro Asn Thr Pro Ala Ala Arg Ala Asp Leu Ala Ala Gln Tyr225 230 235 240Thr Thr Val Gly Arg Met Asp Gln Gly Val Gly Leu Val Leu Gln Glu 245 250 255Leu Arg Asp Ala Gly Val Leu Asn Asp Thr Leu Val Ile Phe Thr Ser 260 265 270Asp Asn Gly Ile Pro Phe Pro Ser Gly Arg Thr Asn Leu Tyr Trp Pro 275 280 285Gly Thr Ala Glu Pro Leu Leu Val Ser Ser Pro Glu His Pro Lys Arg 290 295 300Trp Gly Gln Val Ser Glu Ala Tyr Val Ser Leu Leu Asp Leu Thr Pro305 310 315 320Thr Ile Leu Asp Trp Phe Ser Ile Pro Tyr Pro Ser Tyr Ala Ile Phe 325 330 335Gly Ser Lys Thr Ile His Leu Thr Gly Arg Ser Leu Leu Pro Ala Leu 340 345 350Glu Ala Glu Pro Leu Trp Ala Thr Val Phe Gly Ser Gln Ser His His 355 360 365Glu Val Thr Met Ser Tyr Pro Met Arg Ser Val Gln His Arg His Phe 370 375 380Arg Leu Val His Asn Leu Asn Phe Lys Met Pro Phe Pro Ile Asp Gln385 390 395 400Asp Phe Tyr Val Ser Pro Thr Phe Gln Asp Leu Leu Asn Arg Thr Thr 405 410 415Ala Gly Gln Pro Thr Gly Trp Tyr Lys Asp Leu Arg His Tyr Tyr Tyr 420 425 430Arg Ala Arg Trp Glu Leu Tyr Asp Arg Ser Arg Asp Pro His Glu Thr 435 440 445Gln Asn Leu Ala Thr Asp Pro Arg Phe Ala Gln Leu Leu Glu Met Leu 450 455 460Arg Asp Gln Leu Ala Lys Trp Gln Trp Glu Thr His Asp Pro Trp Val465 470 475 480Cys Ala Pro Asp Gly Val Leu Glu Glu Lys Leu Ser Pro Gln Cys Gln 485 490 495Pro Leu His Asn Glu Leu 500101014DNAHomo sapiens 10cgtgcctgta atcccagcag ctactcactc aggaggctga ggcaggagaa tctcttgaac 60ccggaaggca gaggttgcag tgagccaaga tcgcgccact gaactccagc ctgggtgaca 120gagtgagact gtctcagaac agcaacaaca aaatgcccgc tgctgctggg tccagaagag 180cttgaataac tgcatgttct ttttctcaat tttcatttcc cagaactggg cacctccggg 240ctgtgaaaag ttagggaagt gtctgacacc tccagaatcc attcccaaga agtgcctctg 300gtcccactag cacctgcgca gactcaggcc aggcctagaa tctccagttg gccctgcaag 360tgcctggagg aaggatggct ctggcctcgg tcctccccca accctgccca agccagacag 420acagcacctg cagacgcagg gggactgcac aattccacct gcccaggacc tgaccctggc 480gtgtgcttgg ccctcctcct cgcccacggc gcctcagatt tcaggaccct cctcctcgcc 540cacggcgcct cagacctcag gaccctgccg tctcacgcct ttgtgaaccc caaatatctg 600agaccagtct cagtttattt tgccaaggtt aaggatgcac ctgtgacagc ctcaggaggt 660cctgacaaca ggtgcccgag gtggctgggg atacagtttg cctttataca tcttagggag 720acacaagatc agtatgtgta tggcgtacat tggttcagtc agccttccac tgaatacacg 780attgagtctg gcccagtgaa tccgcatttt tatgtaaaca gtaagggaac ggggcaatca 840tataagcgtt tgtctcaggg gagccccaga gggatgactt ccagttccgt ctgtcctttg 900tccacaagga atttccctgg gcgctaatta tgagggaggc gtgtagcttc ttatcattgt 960agctatgtta tttagaaata aaacgggagg caggtttgcc taattcccag gttg 101411522PRTHomo sapiens 11Met Ala Ala Val Val Ala Ala Thr Arg Trp Trp Gln Leu Leu Leu Val1 5 10 15Leu Ser Ala Ala Gly Met Gly Ala Ser Gly Ala Pro Gln Pro Pro Asn 20 25 30Ile Leu Leu Leu Leu Met Asp Asp Met Gly Trp Gly Asp Leu Gly Val 35 40 45Tyr Gly Glu Pro Ser Arg Glu Thr Pro Asn Leu Asp Arg Met Ala Ala 50 55 60Glu Gly Leu Leu Phe Pro Asn Phe Tyr Ser Ala Asn Pro Leu Cys Ser65 70 75 80Pro Ser Arg Ala Ala Leu Leu Thr Gly Arg Leu Pro Ile Arg Asn Gly 85 90 95Phe Tyr Thr Thr Asn Ala His Ala Arg Asn Ala Tyr Thr Pro Gln Glu 100 105 110Ile Val Gly Gly Ile Pro Asp Ser Glu Gln Leu Leu Pro Glu Leu Leu 115 120 125Lys Lys Ala Gly Tyr Val Ser Lys Ile Val Gly Lys Trp His Leu Gly 130 135 140His Arg Pro Gln Phe His Pro Leu Lys His Gly Phe Asp Glu Trp Phe145 150 155 160Gly Ser Pro Asn Cys His Phe Gly Pro Tyr Asp Asn Lys Ala Arg Pro 165 170 175Asn Ile Pro Val Tyr Arg Asp Trp Glu Met Val Gly Arg Tyr Tyr Glu 180 185 190Glu Phe Pro Ile Asn Leu Lys Thr Gly Glu Ala Asn Leu Thr Gln Ile 195 200 205Tyr Leu Gln Glu Ala Leu Asp Phe Ile Lys Arg Gln Ala Arg His His 210 215 220Pro Phe Phe Leu Tyr Trp Ala Val Asp Ala Thr His Ala Pro Val Tyr225 230 235 240Ala Ser Lys Pro Phe Leu Gly Thr Ser Gln Arg Gly Arg Tyr Gly Asp 245 250 255Ala Val Arg Glu Ile Asp Asp Ser Ile Gly Lys Ile Leu Glu Leu Leu 260 265 270Gln Asp Leu His Val Ala Asp Asn Thr Phe Val Phe Phe Thr Ser Asp 275 280 285Asn Gly Ala Ala Leu Ile Ser Ala Pro Glu Gln Gly Gly Ser Asn Gly 290 295 300Pro Phe Leu Cys Gly Lys Gln Thr Thr Phe Glu Gly Gly Met Arg Glu305 310 315 320Pro Ala Leu Ala Trp Trp Pro Gly His Val Thr Ala Gly Gln Val Ser 325 330 335His Gln Leu Gly Ser Ile Met Asp Leu Phe Thr Thr Ser Leu Ala Leu 340 345 350Ala Gly Leu Thr Pro Pro Ser Asp Arg Ala Ile Asp Gly Leu Asn Leu 355 360 365Leu Pro Thr Leu Leu Gln Gly Arg Leu Met Asp Arg Pro Ile Phe Tyr 370 375 380Tyr Arg Gly Asp Thr Leu Met Ala Ala Thr Leu Gly Gln His Lys Ala385 390 395 400His Phe Trp Thr Trp Thr Asn Ser Trp Glu Asn Phe Arg Gln Gly Ile 405 410 415Asp Phe Cys Pro Gly Gln Asn Val Ser Gly Val Thr Thr His Asn Leu 420 425 430Glu Asp His Thr Lys Leu Pro Leu Ile Phe His Leu Gly Arg Asp Pro 435 440 445Gly Glu Arg Phe Pro Leu Ser Phe Ala Ser Ala Glu Tyr Gln Glu Ala 450 455 460Leu Ser Arg Ile Thr Ser Val Val Gln Gln His Gln Glu Ala Leu Val465 470 475 480Pro Ala Gln Pro Gln Leu Asn Val Cys Asn Trp Ala Val Met Asn Trp 485 490 495Ala Pro Pro Gly Cys Glu Lys Leu Gly Lys Cys Leu Thr Pro Pro Glu 500 505 510Ser Ile Pro Lys Lys Cys Leu Trp Ser His 515 520122379DNAHomo sapiens 12ggaattccgg tcggcctctc gcccttcagc tacctgtgcg tccctccgtc ccgtcccgtc 60ccggggtcac cccggagcct gtccgctatg cggctcctgc ctctagcccc aggtcggctc 120cggcggggca gcccccgcca cctgccctcc tgcagcccag cgctgctact gctggtgctg 180ggcggctgcc tgggggtctt cggggtggct gcgggaaccc ggaggcccaa cgtggtgctg 240ctcctcacgg acgaccagga cgaagtgctc ggcggcatga caccactaaa gaaaaccaaa 300gctctcatcg gagagatggg gatgactttt tccagtgctt atgtgccaag tgctctctgc 360tgccccagca gagccagtat cctgacagga aagtacccac ataatcatca cgttgtgaac 420aacactctgg aggggaactg cagtagtaag tcctggcaga agatccaaga accaaatact 480ttcccagcaa ttctcagatc aatgtgtggt tatcagacct tttttgcagg gaaatattta 540aatgagtacg gagccccaga tgcaggtgga ctagaacacg ttcctctggg ttggagttac 600tggtatgcct tggaaaagaa ttctaagtat tataattaca ccctgtctat caatgggaag 660gcacggaagc atggtgaaaa ctatagtgtg gactacctga cagatgtttt ggctaatgtc 720tccttggact ttctggacta caagtccaac tttgagccct tcttcatgat gatcgccact 780ccagcgcctc attcgccttg gacagctgca cctcagtacc agaaggcttt ccagaatgtc 840tttgcaccaa gaaacaagaa cttcaacatc catggaacga acaagcactg gttaattagg 900caagccaaga ctccaatgac taattcttca atacagtttt tagataatgc atttaggaaa 960aggtggcaaa ctctcctctc agttgatgac cttgtggaga aactggtcaa gaggctggag 1020ttcactgggg agctcaacaa cacttacatc ttctatacct cagacaatgg ctatcacaca 1080ggacagtttt ccttgccaat agacaagaga cagctgtatg agtttgatat caaagttcca 1140ctgttggttc gaggacctgg gatcaaacca aatcagacaa gcaagatgct ggttgccaac 1200attgacttgg gtcctactat tttggacatt gctggctacg acctaaataa gacacagatg 1260gatgggatgt ccttattgcc cattttgaga ggtgccagta acttgacctg gcgatcagat 1320gtcctggtgg aataccaagg agaaggccgt aacgtcactg acccaacatg cccttccctg 1380agtcctggcg tatctcaatg cttcccagac tgtgtatgtg aagatgctta taacaatacc 1440tatgcctgtg tgaggacaat gtcagcattg tggaatttgc agtattgcga gtttgatgac 1500caggaggtgt ttgtagaagt ctataatctg actgcagacc cagaccagat cactaacatt 1560gctaaaacca tagacccaga gcttttagga aagatgaact atcggttaat gatgttacag 1620tcctgttctg ggccaacctg tcgcactcca ggggtttttg accccggata caggtttgac 1680ccccgtctca tgttcagcaa tcgcggcagt gtcaggactc gaagattttc caaacatctt 1740ctgtagcgac ctcacacagc ctctgcagat ggatccctgc acgcctcttt ctgatgaagt 1800gattgtagta ggtgtctgta gctagtcttc aagaccacac ctggaagagt ttctgggctg 1860gctttaagtc ctgtttgaaa aagcaaccca gtcagctgac ttcctcgtgc aatgtgttaa 1920actgtgaact ctgcccatgt gtcaggagtg gctgtctctg gtctcttcct ttagctgaca 1980aggacactcc tgaggtcttt gttctcactg tatttttttt atcctggggc cacagttctt 2040gattattcct cttgtggtta aagactgaat ttgtaaaccc attcagataa atggcagtac 2100tttaggacac acacaaacac acagatacac cttttgatat gtaagcttga cctaaagtca 2160aaggacctgt gtagcatttc agattgagca cttcactatc aaaaatacta acatcacatg 2220gcttgaagag taaccatcag agctgaatca tccaagtaag aacaagtacc attgttgatt 2280gataagtaga gatacatttt ttatgatgtt catcacagtg tggtaaggtt gcaaattcaa 2340aacatgtcac ccaagctctg ttcatgtttt tgtgaattc 237913552PRTHomo sapiens 13Met Arg Leu Leu Pro Leu Ala Pro Gly Arg Leu Arg Arg Gly Ser Pro1 5 10 15Arg His Leu Pro Ser Cys Ser Pro Ala Leu Leu Leu Leu Val Leu Gly 20 25 30Gly Cys Leu Gly Val Phe Gly

Val Ala Ala Gly Thr Arg Arg Pro Asn 35 40 45Val Val Leu Leu Leu Thr Asp Asp Gln Asp Glu Val Leu Gly Gly Met 50 55 60Thr Pro Leu Lys Lys Thr Lys Ala Leu Ile Gly Glu Met Gly Met Thr65 70 75 80Phe Ser Ser Ala Tyr Val Pro Ser Ala Leu Cys Cys Pro Ser Arg Ala 85 90 95Ser Ile Leu Thr Gly Lys Tyr Pro His Asn His His Val Val Asn Asn 100 105 110Thr Leu Glu Gly Asn Cys Ser Ser Lys Ser Trp Gln Lys Ile Gln Glu 115 120 125Pro Asn Thr Phe Pro Ala Ile Leu Arg Ser Met Cys Gly Tyr Gln Thr 130 135 140Phe Phe Ala Gly Lys Tyr Leu Asn Glu Tyr Gly Ala Pro Asp Ala Gly145 150 155 160Gly Leu Glu His Val Pro Leu Gly Trp Ser Tyr Trp Tyr Ala Leu Glu 165 170 175Lys Asn Ser Lys Tyr Tyr Asn Tyr Thr Leu Ser Ile Asn Gly Lys Ala 180 185 190Arg Lys His Gly Glu Asn Tyr Ser Val Asp Tyr Leu Thr Asp Val Leu 195 200 205Ala Asn Val Ser Leu Asp Phe Leu Asp Tyr Lys Ser Asn Phe Glu Pro 210 215 220Phe Phe Met Met Ile Ala Thr Pro Ala Pro His Ser Pro Trp Thr Ala225 230 235 240Ala Pro Gln Tyr Gln Lys Ala Phe Gln Asn Val Phe Ala Pro Arg Asn 245 250 255Lys Asn Phe Asn Ile His Gly Thr Asn Lys His Trp Leu Ile Arg Gln 260 265 270Ala Lys Thr Pro Met Thr Asn Ser Ser Ile Gln Phe Leu Asp Asn Ala 275 280 285Phe Arg Lys Arg Trp Gln Thr Leu Leu Ser Val Asp Asp Leu Val Glu 290 295 300Lys Leu Val Lys Arg Leu Glu Phe Thr Gly Glu Leu Asn Asn Thr Tyr305 310 315 320Ile Phe Tyr Thr Ser Asp Asn Gly Tyr His Thr Gly Gln Phe Ser Leu 325 330 335Pro Ile Asp Lys Arg Gln Leu Tyr Glu Phe Asp Ile Lys Val Pro Leu 340 345 350Leu Val Arg Gly Pro Gly Ile Lys Pro Asn Gln Thr Ser Lys Met Leu 355 360 365Val Ala Asn Ile Asp Leu Gly Pro Thr Ile Leu Asp Ile Ala Gly Tyr 370 375 380Asp Leu Asn Lys Thr Gln Met Asp Gly Met Ser Leu Leu Pro Ile Leu385 390 395 400Arg Gly Ala Ser Asn Leu Thr Trp Arg Ser Asp Val Leu Val Glu Tyr 405 410 415Gln Gly Glu Gly Arg Asn Val Thr Asp Pro Thr Cys Pro Ser Leu Ser 420 425 430Pro Gly Val Ser Gln Cys Phe Pro Asp Cys Val Cys Glu Asp Ala Tyr 435 440 445Asn Asn Thr Tyr Ala Cys Val Arg Thr Met Ser Ala Leu Trp Asn Leu 450 455 460Gln Tyr Cys Glu Phe Asp Asp Gln Glu Val Phe Val Glu Val Tyr Asn465 470 475 480Leu Thr Ala Asp Pro Asp Gln Ile Thr Asn Ile Ala Lys Thr Ile Asp 485 490 495Pro Glu Leu Leu Gly Lys Met Asn Tyr Arg Leu Met Met Leu Gln Ser 500 505 510Cys Ser Gly Pro Thr Cys Arg Thr Pro Gly Val Phe Asp Pro Gly Tyr 515 520 525Arg Phe Asp Pro Arg Leu Met Phe Ser Asn Arg Gly Ser Val Arg Thr 530 535 540Arg Arg Phe Ser Lys His Leu Leu545 550142022DNAHomo sapiens 14ccggtaccgg ctcctcctgg gctccctcta gcgccttccc cccggcccga ctgcctggtc 60agcgccaagt gacttacgcc cccgaccctg agcccggacc gctaggcgag gaggatcaga 120tctccgctcg agaatctgaa ggtgccctgg tcctggagga gttccgtccc agccctgcgg 180tctcccggta ctgctcgccc cggccctctg gagcttcagg aggcggccgt cagggtcggg 240gagtatttgg gtccggggtc tcagggaagg gcggcgcctg ggtctgcggt atcggaaaga 300gcctgctgga gccaagtagc cctccctctc ttgggacaga cccctcggtc ccatgtccat 360gggggcaccg cggtccctcc tcctggccct ggctgctggc ctggccgttg cccgtccgcc 420caacatcgtg ctgatctttg ccgacgacct cggctatggg gacctgggct gctatgggca 480ccccagctct accactccca acctggacca gctggcggcg ggagggctgc ggttcacaga 540cttctacgtg cctgtgtctc tgtgcacacc ctctagggcc gccctcctga ccggccggct 600cccggttcgg atgggcatgt accctggcgt cctggtgccc agctcccggg ggggcctgcc 660cctggaggag gtgaccgtgg ccgaagtcct ggctgcccga ggctacctca caggaatggc 720cggcaagtgg caccttgggg tggggcctga gggggccttc ctgccccccc atcagggctt 780ccatcgattt ctaggcatcc cgtactccca cgaccagggc ccctgccaga acctgacctg 840cttcccgccg gccactcctt gcgacggtgg ctgtgaccag ggcctggtcc ccatcccact 900gttggccaac ctgtccgtgg aggcgcagcc cccctggctg cccggactag aggcccgcta 960catggctttc gcccatgacc tcatggccga cgcccagcgc caggatcgcc ccttcttcct 1020gtactatgcc tctcaccaca cccactaccc tcagttcagt gggcagagct ttgcagagcg 1080ttcaggccgc gggccatttg gggactccct gatggagctg gatgcagctg tggggaccct 1140gatgacagcc ataggggacc tggggctgct tgaagagacg ctggtcatct tcactgcaga 1200caatggacct gagaccatgc gtatgtcccg aggcggctgc tccggtctct tgcggtgtgg 1260aaagggaacg acctacgagg gcggtgtccg agagcctgcc ttggccttct ggccaggtca 1320tatcgctccc ggcgtgaccc acgagctggc cagctccctg gacctgctgc ctaccctggc 1380agccctggct ggggccccac tgcccaatgt caccttggat ggctttgacc tcagccccct 1440gctgctgggc acaggcaaga gccctcggca gtctctcttc ttctacccgt cctacccaga 1500cgaggtccgt ggggtttttg ctgtgcggac tggaaagtac aaggctcact tcttcaccca 1560gggctctgcc cacagtgata ccactgcaga ccctgcctgc cacgcctcca gctctctgac 1620tgctcatgag cccccgctgc tctatgacct gtccaaggac cctggtgaga actacaacct 1680gctggggggt gtggccgggg ccaccccaga ggtgctgcaa gccctgaaac agcttcagct 1740gctcaaggcc cagttagacg cagctgtgac cttcggcccc agccaggtgg cccggggcga 1800ggaccccgcc ctgcagatct gctgtcatcc tggctgcacc ccccgcccag cttgctgcca 1860ttgcccagat ccccatgcct gagggcccct cggctggcct gggcatgtga tggctcctca 1920ctgggagcct gtgggggagg ctcaggtgtc tggagggggt ttgtgcctga taacgtaata 1980acaccagtgg agacttgcac atctgaaaaa aaaaaaaaaa aa 202215507PRTHomo sapiens 15Met Gly Ala Pro Arg Ser Leu Leu Leu Ala Leu Ala Ala Gly Leu Ala1 5 10 15Val Ala Arg Pro Pro Asn Ile Val Leu Ile Phe Ala Asp Asp Leu Gly 20 25 30Tyr Gly Asp Leu Gly Cys Tyr Gly His Pro Ser Ser Thr Thr Pro Asn 35 40 45Leu Asp Gln Leu Ala Ala Gly Gly Leu Arg Phe Thr Asp Phe Tyr Val 50 55 60Pro Val Ser Leu Cys Thr Pro Ser Arg Ala Ala Leu Leu Thr Gly Arg65 70 75 80Leu Pro Val Arg Met Gly Met Tyr Pro Gly Val Leu Val Pro Ser Ser 85 90 95Arg Gly Gly Leu Pro Leu Glu Glu Val Thr Val Ala Glu Val Leu Ala 100 105 110Ala Arg Gly Tyr Leu Thr Gly Met Ala Gly Lys Trp His Leu Gly Val 115 120 125Gly Pro Glu Gly Ala Phe Leu Pro Pro His Gln Gly Phe His Arg Phe 130 135 140Leu Gly Ile Pro Tyr Ser His Asp Gln Gly Pro Cys Gln Asn Leu Thr145 150 155 160Cys Phe Pro Pro Ala Thr Pro Cys Asp Gly Gly Cys Asp Gln Gly Leu 165 170 175Val Pro Ile Pro Leu Leu Ala Asn Leu Ser Val Glu Ala Gln Pro Pro 180 185 190Trp Leu Pro Gly Leu Glu Ala Arg Tyr Met Ala Phe Ala His Asp Leu 195 200 205Met Ala Asp Ala Gln Arg Gln Asp Arg Pro Phe Phe Leu Tyr Tyr Ala 210 215 220Ser His His Thr His Tyr Pro Gln Phe Ser Gly Gln Ser Phe Ala Glu225 230 235 240Arg Ser Gly Arg Gly Pro Phe Gly Asp Ser Leu Met Glu Leu Asp Ala 245 250 255Ala Val Gly Thr Leu Met Thr Ala Ile Gly Asp Leu Gly Leu Leu Glu 260 265 270Glu Thr Leu Val Ile Phe Thr Ala Asp Asn Gly Pro Glu Thr Met Arg 275 280 285Met Ser Arg Gly Gly Cys Ser Gly Leu Leu Arg Cys Gly Lys Gly Thr 290 295 300Thr Tyr Glu Gly Gly Val Arg Glu Pro Ala Leu Ala Phe Trp Pro Gly305 310 315 320His Ile Ala Pro Gly Val Thr His Glu Leu Ala Ser Ser Leu Asp Leu 325 330 335Leu Pro Thr Leu Ala Ala Leu Ala Gly Ala Pro Leu Pro Asn Val Thr 340 345 350Leu Asp Gly Phe Asp Leu Ser Pro Leu Leu Leu Gly Thr Gly Lys Ser 355 360 365Pro Arg Gln Ser Leu Phe Phe Tyr Pro Ser Tyr Pro Asp Glu Val Arg 370 375 380Gly Val Phe Ala Val Arg Thr Gly Lys Tyr Lys Ala His Phe Phe Thr385 390 395 400Gln Gly Ser Ala His Ser Asp Thr Thr Ala Asp Pro Ala Cys His Ala 405 410 415Ser Ser Ser Leu Thr Ala His Glu Pro Pro Leu Leu Tyr Asp Leu Ser 420 425 430Lys Asp Pro Gly Glu Asn Tyr Asn Leu Leu Gly Gly Val Ala Gly Ala 435 440 445Thr Pro Glu Val Leu Gln Ala Leu Lys Gln Leu Gln Leu Leu Lys Ala 450 455 460Gln Leu Asp Ala Ala Val Thr Phe Gly Pro Ser Gln Val Ala Arg Gly465 470 475 480Glu Asp Pro Ala Leu Gln Ile Cys Cys His Pro Gly Cys Thr Pro Arg 485 490 495Pro Ala Cys Cys His Cys Pro Asp Pro His Ala 500 505162228DNAHomo sapiens 16acaaggatgg gtccgcgcgg cgcggcgagc ttgccccgag gccccggacc tcggcggctg 60ctcctccccg tcgtcctccc gctgctgctg ctgctgttgt tggcgccgcc gggctcgggc 120gccggggcca gccggccgcc ccacctggtc ttcttgctgg cagacgacct aggctggaac 180gacgtcggct tccacggctc ccgcatccgc acgccgcacc tggacgcgct ggcggccggc 240ggggtgctcc tggacaacta ctacacgcag ccgctgtgca cgccgtcgcg gagccagctg 300ctcactggcc gctaccagat ccgtacaggt ttacagcacc aaataatctg gccctgtcag 360cccagctgtg ttcctctgga tgaaaaactc ctgccccagc tcctaaaaga agcaggttat 420actacccata tggtcggaaa atggcacctg ggaatgtacc ggaaagaatg ccttccaacc 480cgccgaggat ttgataccta ctttggatat ctcctgggta gtgaagatta ttattcccat 540gaacgctgta cattaattga cgctctgaat gtcacacgat gtgctcttga ttttcgagat 600ggcgaagaag ttgcaacagg atataaaaat atgtattcaa caaacatatt caccaaaagg 660gctatagccc tcataactaa ccatccacca gagaagcctc tgtttctcta ccttgctctc 720cagtctgtgc atgagcccct tcaggtccct gaggaatact tgaagccata tgactttatc 780caagacaaga acaggcatca ctatgcagga atggtgtccc ttatggatga agcagtagga 840aatgtcactg cagctttaaa aagcagtggg ctctggaaca acacggtgtt catcttttct 900acagataacg gagggcagac tttggcaggg ggtaataact ggccccttcg aggaagaaaa 960tggagcctgt gggaaggagg cgtccgaggg gtgggctttg tggcaagccc cttgctgaag 1020cagaagggcg tgaagaaccg ggagctcatc cacatctctg actggctgcc aacactcgtg 1080aagctggcca ggggacacac caatggcaca aagcctctgg atggcttcga cgtgtggaaa 1140accatcagtg aaggaagccc atcccccaga attgagctgc tgcataatat tgacccaaac 1200ttcgtggact cttcaccgtg tcccaggaac agcatggctc cagcaaagga tgactcttct 1260cttccagaat attcagcctt taacacatct gtccatgctg caattagaca tggaaattgg 1320aaactcctca cgggctaccc aggctgtggt tactggttcc ctccaccgtc tcaatacaat 1380gtttctgaga taccctcatc agacccacca accaagaccc tctggctctt tgatattgat 1440cgggaccctg aagaaagaca tgacctgtcc agagaatatc ctcacatcgt cacaaagctc 1500ctgtcccgcc tacagttcta ccataaacac tcagtccccg tgtacttccc tgcacaggac 1560ccccgctgtg atcccaaggc cactggggtg tggggccctt ggatgtagga tttcagggag 1620gctagaaaac ctttcaattg gaagttggac ctcaggcctt ttctcacgac tcttgtctca 1680tttgttatcc caacctgggt tcacttggcc cttctcttgc tcttaaacca caccgaggtg 1740tctaatttca acccctaatg catttaagaa gctgataaaa tctgcaacac tcctgctgtt 1800ggctggagca tgtgtctaga ggtgggggtg gctgggttta tccccctttc ctaagccttg 1860ggacagctgg gaacttaact tgaaatagga agttctcact gaatcctgga ggctggaaca 1920gctggctctt ttagactcac aagtcagacg ttcgattccc ctctgccaat agccagtttt 1980attggagtga atcacatttc ttacgcaaat gaagggagca gacagtgatt aatggttctg 2040ttggccaagg cttctccctg tcggtgaagg atcatgttca ggcactccaa gtgaaccacc 2100cctcttggtt caccccttac tcacttatct catcacagag cataaggccc attttgttgt 2160tcaggtcaac agcaaaatgg cctgcaccat gactgtggct tttaaaataa agaaatgtgt 2220ttttatcg 222817533PRTHomo sapiens 17Met Gly Pro Arg Gly Ala Ala Ser Leu Pro Arg Gly Pro Gly Pro Arg1 5 10 15Arg Leu Leu Leu Pro Val Val Leu Pro Leu Leu Leu Leu Leu Leu Leu 20 25 30Ala Pro Pro Gly Ser Gly Ala Gly Ala Ser Arg Pro Pro His Leu Val 35 40 45Phe Leu Leu Ala Asp Asp Leu Gly Trp Asn Asp Val Gly Phe His Gly 50 55 60Ser Arg Ile Arg Thr Pro His Leu Asp Ala Leu Ala Ala Gly Gly Val65 70 75 80Leu Leu Asp Asn Tyr Tyr Thr Gln Pro Leu Cys Thr Pro Ser Arg Ser 85 90 95Gln Leu Leu Thr Gly Arg Tyr Gln Ile Arg Thr Gly Leu Gln His Gln 100 105 110Ile Ile Trp Pro Cys Gln Pro Ser Cys Val Pro Leu Asp Glu Lys Leu 115 120 125Leu Pro Gln Leu Leu Lys Glu Ala Gly Tyr Thr Thr His Met Val Gly 130 135 140Lys Trp His Leu Gly Met Tyr Arg Lys Glu Cys Leu Pro Thr Arg Arg145 150 155 160Gly Phe Asp Thr Tyr Phe Gly Tyr Leu Leu Gly Ser Glu Asp Tyr Tyr 165 170 175Ser His Glu Arg Cys Thr Leu Ile Asp Ala Leu Asn Val Thr Arg Cys 180 185 190Ala Leu Asp Phe Arg Asp Gly Glu Glu Val Ala Thr Gly Tyr Lys Asn 195 200 205Met Tyr Ser Thr Asn Ile Phe Thr Lys Arg Ala Ile Ala Leu Ile Thr 210 215 220Asn His Pro Pro Glu Lys Pro Leu Phe Leu Tyr Leu Ala Leu Gln Ser225 230 235 240Val His Glu Pro Leu Gln Val Pro Glu Glu Tyr Leu Lys Pro Tyr Asp 245 250 255Phe Ile Gln Asp Lys Asn Arg His His Tyr Ala Gly Met Val Ser Leu 260 265 270Met Asp Glu Ala Val Gly Asn Val Thr Ala Ala Leu Lys Ser Ser Gly 275 280 285Leu Trp Asn Asn Thr Val Phe Ile Phe Ser Thr Asp Asn Gly Gly Gln 290 295 300Thr Leu Ala Gly Gly Asn Asn Trp Pro Leu Arg Gly Arg Lys Trp Ser305 310 315 320Leu Trp Glu Gly Gly Val Arg Gly Val Gly Phe Val Ala Ser Pro Leu 325 330 335Leu Lys Gln Lys Gly Val Lys Asn Arg Glu Leu Ile His Ile Ser Asp 340 345 350Trp Leu Pro Thr Leu Val Lys Leu Ala Arg Gly His Thr Asn Gly Thr 355 360 365Lys Pro Leu Asp Gly Phe Asp Val Trp Lys Thr Ile Ser Glu Gly Ser 370 375 380Pro Ser Pro Arg Ile Glu Leu Leu His Asn Ile Asp Pro Asn Phe Val385 390 395 400Asp Ser Ser Pro Cys Pro Arg Asn Ser Met Ala Pro Ala Lys Asp Asp 405 410 415Ser Ser Leu Pro Glu Tyr Ser Ala Phe Asn Thr Ser Val His Ala Ala 420 425 430Ile Arg His Gly Asn Trp Lys Leu Leu Thr Gly Tyr Pro Gly Cys Gly 435 440 445Tyr Trp Phe Pro Pro Pro Ser Gln Tyr Asn Val Ser Glu Ile Pro Ser 450 455 460Ser Asp Pro Pro Thr Lys Thr Leu Trp Leu Phe Asp Ile Asp Arg Asp465 470 475 480Pro Glu Glu Arg His Asp Leu Ser Arg Glu Tyr Pro His Ile Val Thr 485 490 495Lys Leu Leu Ser Arg Leu Gln Phe Tyr His Lys His Ser Val Pro Val 500 505 510Tyr Phe Pro Ala Gln Asp Pro Arg Cys Asp Pro Lys Ala Thr Gly Val 515 520 525Trp Gly Pro Trp Met 530182401DNAHomo sapiens 18gcctccagca gctgacggga cccagctgta gtgaggttgc agtgattgag taggattggc 60ctgcttcaaa gcagaggttt ctcatgggaa tatgcttatt aaactcccac tggtgcagaa 120accatgaaca gaggatgaac aagtgaagtt gcaatctcct ccatcacagc tcagttcccc 180aacaacagga tcacaagctg gagatgcctt taaggaagat gaagatccct ttcctcctac 240tgttctttct gtgggaagcc gagagccacg cagcatcaag gccgaacatc atcctggtga 300tggctgacga cctcggcatt ggagatcctg ggtgctatgg gaacaaaact atcaggactc 360ccaatatcga ccggttggcc agtgggggag tgaaactcac tcagcacctg gcagcatcac 420cgctgtgcac accaagcagg gcagccttca tgactggccg gtaccctgtc cgatcaggaa 480tggcatcttg gtcccgcact ggagttttcc tcttcacagc ctcttcggga ggacttccca 540ccgatgagat tacctttgct aagcttctga aggatcaagg ttattcaaca gcactgatag 600ggaaatggca ccttgggatg agctgtcaca gcaagactga cttctgtcac caccctttac 660atcacggctt caattatttc tatgggatct ctttgaccaa tctgagagac tgcaagcccg 720gagagggcag tgtcttcacc acgggcttca agaggctggt cttcctcccc ctgcagatcg 780tcggggtcac cctccttacc cttgctgcac tcaattgtct ggggctactc cacgtgcctc 840taggcgtttt tttcagcctt ctcttcctag cagccctaat cctgaccctt ttcttgggct 900tccttcatta cttccggccc ctgaactgct tcatgatgag gaactacgag atcattcagc 960agcccatgtc ctatgacaat ctcacccaga ggctaacggt ggaggcggcc cagttcatac 1020agcggaacac tgagactccg ttcctgcttg tcttgtccta cctccacgtg cacacagccc 1080tgttctccag caaagacttt gctggcaaaa gtcaacacgg agtctacggg gatgctgttg 1140aggaaatgga ctggagtgtg gggcagatct tgaaccttct ggatgagctg agattggcta

1200atgataccct catctacttc acatcggacc agggagcaca tgtagaggag gtgtcttcca 1260aaggagaaat tcatggcgga agtaatggga tctataaagg aggaaaagca aacaactggg 1320aaggaggtat ccgggttcca ggcatccttc gttggcccag ggtgatacag gctggccaga 1380agattgatga gcccactagc aacatggaca tatttcctac agtagccaag ctggctggag 1440ctcccttgcc tgaggacagg atcattgatg gacgtgatct gatgcccctg cttgaaggaa 1500aaagccaacg ctccgatcat gagtttctct tccattactg caacgcctac ttaaatgctg 1560tgcgctggca ccctcagaac agcacatcca tctggaaggc ctttttcttc acccccaact 1620tcaaccccgt gggttccaac ggatgctttg ccacacacgt gtgcttctgt ttcgggagtt 1680atgtcaccca tcacgaccca cctttactct ttgatatttc caaagatccc agagagagaa 1740acccactaac tccagcatcc gagccccggt tttatgaaat cctcaaagtc atgcaggaag 1800ctgcggacag acacacccag accctgccag aggtgcccga tcagttttca tggaacaact 1860ttctttggaa gccctggctt cagctgtgct gtccttccac cggcctgtct tgccagtgtg 1920atagagaaaa acaggataag agactgagcc gctagcagcg cctggggacc agacagacgc 1980atgtggcaaa gctcaccatc ttcactacaa acacgcctga gagtggcact ggggaaacat 2040aactccatct acaccttgga tttggactga ttctccattt tatcacctga aggcttgggc 2100cagagctcaa cagctactca actggagggg tgagggggat aaggtctgta gtatacagac 2160aggaagatgg taggtttatg ccttctgtgg ccagagtctt ggactcatgg aaatagaatg 2220aatagagggg cattcacaag gcacaccagt gcaagcagat gacaaaaagg tgcagaaggc 2280aatcttaaaa cagaaaggtg caggaggtac cttaactcac ccctcagcaa atacctatgt 2340caacagtata agttaccatt tactctataa tctgcagtga tgcaataacc agcataataa 2400a 240119583PRTHomo sapiens 19Met Pro Leu Arg Lys Met Lys Ile Pro Phe Leu Leu Leu Phe Phe Leu1 5 10 15Trp Glu Ala Glu Ser His Ala Ala Ser Arg Pro Asn Ile Ile Leu Val 20 25 30Met Ala Asp Asp Leu Gly Ile Gly Asp Pro Gly Cys Tyr Gly Asn Lys 35 40 45Thr Ile Arg Thr Pro Asn Ile Asp Arg Leu Ala Ser Gly Gly Val Lys 50 55 60Leu Thr Gln His Leu Ala Ala Ser Pro Leu Cys Thr Pro Ser Arg Ala65 70 75 80Ala Phe Met Thr Gly Arg Tyr Pro Val Arg Ser Gly Met Ala Ser Trp 85 90 95Ser Arg Thr Gly Val Phe Leu Phe Thr Ala Ser Ser Gly Gly Leu Pro 100 105 110Thr Asp Glu Ile Thr Phe Ala Lys Leu Leu Lys Asp Gln Gly Tyr Ser 115 120 125Thr Ala Leu Ile Gly Lys Trp His Leu Gly Met Ser Cys His Ser Lys 130 135 140Thr Asp Phe Cys His His Pro Leu His His Gly Phe Asn Tyr Phe Tyr145 150 155 160Gly Ile Ser Leu Thr Asn Leu Arg Asp Cys Lys Pro Gly Glu Gly Ser 165 170 175Val Phe Thr Thr Gly Phe Lys Arg Leu Val Phe Leu Pro Leu Gln Ile 180 185 190Val Gly Val Thr Leu Leu Thr Leu Ala Ala Leu Asn Cys Leu Gly Leu 195 200 205Leu His Val Pro Leu Gly Val Phe Phe Ser Leu Leu Phe Leu Ala Ala 210 215 220Leu Ile Leu Thr Leu Phe Leu Gly Phe Leu His Tyr Phe Arg Pro Leu225 230 235 240Asn Cys Phe Met Met Arg Asn Tyr Glu Ile Ile Gln Gln Pro Met Ser 245 250 255Tyr Asp Asn Leu Thr Gln Arg Leu Thr Val Glu Ala Ala Gln Phe Ile 260 265 270Gln Arg Asn Thr Glu Thr Pro Phe Leu Leu Val Leu Ser Tyr Leu His 275 280 285Val His Thr Ala Leu Phe Ser Ser Lys Asp Phe Ala Gly Lys Ser Gln 290 295 300His Gly Val Tyr Gly Asp Ala Val Glu Glu Met Asp Trp Ser Val Gly305 310 315 320Gln Ile Leu Asn Leu Leu Asp Glu Leu Arg Leu Ala Asn Asp Thr Leu 325 330 335Ile Tyr Phe Thr Ser Asp Gln Gly Ala His Val Glu Glu Val Ser Ser 340 345 350Lys Gly Glu Ile His Gly Gly Ser Asn Gly Ile Tyr Lys Gly Gly Lys 355 360 365Ala Asn Asn Trp Glu Gly Gly Ile Arg Val Pro Gly Ile Leu Arg Trp 370 375 380Pro Arg Val Ile Gln Ala Gly Gln Lys Ile Asp Glu Pro Thr Ser Asn385 390 395 400Met Asp Ile Phe Pro Thr Val Ala Lys Leu Ala Gly Ala Pro Leu Pro 405 410 415Glu Asp Arg Ile Ile Asp Gly Arg Asp Leu Met Pro Leu Leu Glu Gly 420 425 430Lys Ser Gln Arg Ser Asp His Glu Phe Leu Phe His Tyr Cys Asn Ala 435 440 445Tyr Leu Asn Ala Val Arg Trp His Pro Gln Asn Ser Thr Ser Ile Trp 450 455 460Lys Ala Phe Phe Phe Thr Pro Asn Phe Asn Pro Val Gly Ser Asn Gly465 470 475 480Cys Phe Ala Thr His Val Cys Phe Cys Phe Gly Ser Tyr Val Thr His 485 490 495His Asp Pro Pro Leu Leu Phe Asp Ile Ser Lys Asp Pro Arg Glu Arg 500 505 510Asn Pro Leu Thr Pro Ala Ser Glu Pro Arg Phe Tyr Glu Ile Leu Lys 515 520 525Val Met Gln Glu Ala Ala Asp Arg His Thr Gln Thr Leu Pro Glu Val 530 535 540Pro Asp Gln Phe Ser Trp Asn Asn Phe Leu Trp Lys Pro Trp Leu Gln545 550 555 560Leu Cys Cys Pro Ser Thr Gly Leu Ser Cys Gln Cys Asp Arg Glu Lys 565 570 575Gln Asp Lys Arg Leu Ser Arg 580201945DNAHomo sapiens 20ggaagccttg gcactagcgg cgcccgggcg cggagtgcgc agggcaaggt cctgcgctct 60gggccagcgc tcggccatgc gatccgccgc gcggagggga cgcgccgcgc ccgccgccag 120ggactctttg ccggtgctac tgtttttatg cttgcttctg aagacgtgtg aacctaaaac 180tgcaaatgcc tttaaaccaa atatcctact gatcatggcg gatgatctag gcactgggga 240tctcggttgc tacgggaaca atacactgag aacgccgaat attgaccagc ttgcagagga 300aggtgtgagg ctcactcagc acctggcggc cgccccgctc tgcaccccaa gccgagctgc 360attcctcaca gggagacatt ccttcagatc aggcatggac gccagcaatg gataccgggc 420ccttcagtgg aacgcaggct caggtggact ccctgagaac gaaaccactt ttgcaagaat 480cttgcagcag catggctatg caaccggcct cataggaaaa tggcaccagg gtgtgaattg 540tgcatcccgc ggggatcact gccaccaccc cctgaaccac ggatttgact atttctacgg 600catgcccttc acgctcacaa acgactgtga cccaggcagg ccccccgaag tggacgccgc 660cctgagggcg cagctctggg gttacaccca gttcctggcg ctggggattc tcaccctggc 720tgccggccag acctgcggtt tcttctctgt ctccgcgaga gcagtcaccg gcatggccgg 780cgtgggctgc ctgtttttca tctcttggta ctcctccttc gggtttgtgc gacgctggaa 840ctgtatcctg atgagaaacc atgacgtcac ggagcaaccc atggttctgg agaaaacagc 900gagtcttatg ctaaaggaag ctgtttccta tattgaaaga cacaagcatg ggccatttct 960cctcttcctt tctttgctgc atgtgcacat tccccttgtg accacgagtg cattcctggg 1020gaaaagtcag catggcttat atggtgataa tgtggaggag atggactggc tcataggtaa 1080ggttcttaat gccatcgaag acaatggttt aaagaactca acattcacgt atttcacctc 1140tgaccatgga ggacatttag aggcaagaga tggacacagc cagttagggg gatggaacgg 1200aatttacaaa ggtgggaagg gcatgggagg atgggaaggt gggatccgag tgcccgggat 1260cttccactgg ccgggggtgc tcccggccgg ccgagtgatt ggagagccca cgagcctgat 1320ggacgtgttc cctactgtgg tccagctggt gggtggcgag gtgccccagg acagggtgat 1380tgatggccac agcctggtac ccttgctgca gggagctgag gcacgctcgg cacatgagtt 1440cctgtttcat tactgtgggc agcatcttca cgcagcacgc tggcaccaga aggacagtgg 1500aagcgtctgg aaggttcatt acacgacccc gcagttccac cccgaggagc ggggcctgct 1560aacggccgag gcgtctgccc atgctgaatg gggaggcgtg acccatcaca gacccccttt 1620gctctttgac ctctccaggg acccctccga ggcacggccc ctgacccccg actccgagcc 1680cctgtaccac gccgtgatag caagggtagg tgccgcggtg tcggagcatc ggcagaccct 1740gagtcctgtg ccccagcagt tttccatgag caacatcctg tggaagccgt ggctgcagcc 1800gtgctgcgga catttcccgt tctgttcatg ccacgaggat ggggatggca ccccctgaat 1860gccaggactg tgagagagga tccaggagag cctgactgcg ttgcaaacaa aattctccaa 1920gcttggttct atcttcagtc cggaa 194521593PRTHomo sapiens 21Met Arg Ser Ala Ala Arg Arg Gly Arg Ala Ala Pro Ala Ala Arg Asp1 5 10 15Ser Leu Pro Val Leu Leu Phe Leu Cys Leu Leu Leu Lys Thr Cys Glu 20 25 30Pro Lys Thr Ala Asn Ala Phe Lys Pro Asn Ile Leu Leu Ile Met Ala 35 40 45Asp Asp Leu Gly Thr Gly Asp Leu Gly Cys Tyr Gly Asn Asn Thr Leu 50 55 60Arg Thr Pro Asn Ile Asp Gln Leu Ala Glu Glu Gly Val Arg Leu Thr65 70 75 80Gln His Leu Ala Ala Ala Pro Leu Cys Thr Pro Ser Arg Ala Ala Phe 85 90 95Leu Thr Gly Arg His Ser Phe Arg Ser Gly Met Asp Ala Ser Asn Gly 100 105 110Tyr Arg Ala Leu Gln Trp Asn Ala Gly Ser Gly Gly Leu Pro Glu Asn 115 120 125Glu Thr Thr Phe Ala Arg Ile Leu Gln Gln His Gly Tyr Ala Thr Gly 130 135 140Leu Ile Gly Lys Trp His Gln Gly Val Asn Cys Ala Ser Arg Gly Asp145 150 155 160His Cys His His Pro Leu Asn His Gly Phe Asp Tyr Phe Tyr Gly Met 165 170 175Pro Phe Thr Leu Thr Asn Asp Cys Asp Pro Gly Arg Pro Pro Glu Val 180 185 190Asp Ala Ala Leu Arg Ala Gln Leu Trp Gly Tyr Thr Gln Phe Leu Ala 195 200 205Leu Gly Ile Leu Thr Leu Ala Ala Gly Gln Thr Cys Gly Phe Phe Ser 210 215 220Val Ser Ala Arg Ala Val Thr Gly Met Ala Gly Val Gly Cys Leu Phe225 230 235 240Phe Ile Ser Trp Tyr Ser Ser Phe Gly Phe Val Arg Arg Trp Asn Cys 245 250 255Ile Leu Met Arg Asn His Asp Val Thr Glu Gln Pro Met Val Leu Glu 260 265 270Lys Thr Ala Ser Leu Met Leu Lys Glu Ala Val Ser Tyr Ile Glu Arg 275 280 285His Lys His Gly Pro Phe Leu Leu Phe Leu Ser Leu Leu His Val His 290 295 300Ile Pro Leu Val Thr Thr Ser Ala Phe Leu Gly Lys Ser Gln His Gly305 310 315 320Leu Tyr Gly Asp Asn Val Glu Glu Met Asp Trp Leu Ile Gly Lys Val 325 330 335Leu Asn Ala Ile Glu Asp Asn Gly Leu Lys Asn Ser Thr Phe Thr Tyr 340 345 350Phe Thr Ser Asp His Gly Gly His Leu Glu Ala Arg Asp Gly His Ser 355 360 365Gln Leu Gly Gly Trp Asn Gly Ile Tyr Lys Gly Gly Lys Gly Met Gly 370 375 380Gly Trp Glu Gly Gly Ile Arg Val Pro Gly Ile Phe His Trp Pro Gly385 390 395 400Val Leu Pro Ala Gly Arg Val Ile Gly Glu Pro Thr Ser Leu Met Asp 405 410 415Val Phe Pro Thr Val Val Gln Leu Val Gly Gly Glu Val Pro Gln Asp 420 425 430Arg Val Ile Asp Gly His Ser Leu Val Pro Leu Leu Gln Gly Ala Glu 435 440 445Ala Arg Ser Ala His Glu Phe Leu Phe His Tyr Cys Gly Gln His Leu 450 455 460His Ala Ala Arg Trp His Gln Lys Asp Ser Gly Ser Val Trp Lys Val465 470 475 480His Tyr Thr Thr Pro Gln Phe His Pro Glu Glu Arg Gly Leu Leu Thr 485 490 495Ala Glu Ala Ser Ala His Ala Glu Trp Gly Gly Val Thr His His Arg 500 505 510Pro Pro Leu Leu Phe Asp Leu Ser Arg Asp Pro Ser Glu Ala Arg Pro 515 520 525Leu Thr Pro Asp Ser Glu Pro Leu Tyr His Ala Val Ile Ala Arg Val 530 535 540Gly Ala Ala Val Ser Glu His Arg Gln Thr Leu Ser Pro Val Pro Gln545 550 555 560Gln Phe Ser Met Ser Asn Ile Leu Trp Lys Pro Trp Leu Gln Pro Cys 565 570 575Cys Gly His Phe Pro Phe Cys Ser Cys His Glu Asp Gly Asp Gly Thr 580 585 590Pro221858DNAHomo sapiens 22ccttcctctt cttgatcggg gattcaggaa ggagcccagg agcagaggaa gtagagagag 60agacaacatg ttacatctgc accattcttg tttgtgtttc aggagctggc tgccagcgat 120gctcgctgta ctgctaagtt tggcaccatc agcttccagc gacatttccg cctcccgacc 180gaacatcctt cttctgatgg cggacgacct tggcattggg gacattggct gctatggcaa 240caacaccatg aggactccga atattgaccg ccttgcagag gacggcgtga agctgaccca 300acacatctct gccgcatctt tgtgcacccc aagcagagcc gccttcctca cgggcagata 360ccctgtgcga tcagggatgg tttccagcat tggttaccgt gttcttcagt ggaccggagc 420atctggaggt cttccaacaa atgagacaac ttttgcaaaa atactgaaag agaaaggcta 480tgccactgga ctcattggaa aatggcatct gggtctcaac tgtgagtcag ccagtgatca 540ttgccaccac cctctccatc atggctttga gcatttctac ggaatgcctt tctccttgat 600gggtgattgc gcccgctggg aactctcaga gaagcgtgtc aacctggaac aaaaactcaa 660cttcctcttc caagtcctgg ccttggttgc cctcacactg gtagcaggga agctcacaca 720cctgataccc gtctcgtgga tgccggtcat ctggtcagcc ctttcggccg tcctcctcct 780cgcaagctcc tattttgtgg gtgctctgat tgtccatgcc gattgctttc tgatgagaaa 840ccacaccatc acggagcagc ccatgtgctt ccaaagaacg acacccctta ttctgcagga 900ggttgcgtcc tttctcaaaa ggaataagca tgggcctttc ctcctctttg tttcctttct 960acacgttcac atccctctta tcactatgga gaacttcctc gggaagagtc tccacgggct 1020gtatggggac aacgtagagg agatggactg gatggtagga cggatccttg acactttgga 1080cgtggagggt ttgagcaaca gcaccctcat ttattttacg tcggatcacg gcggttccct 1140agagaatcaa cttggaaaca cccagtatgg tggctggaat ggaatttata aaggtgggaa 1200gggcatggga ggatgggaag gtgggatccg cgtgcccggg atcttccgct ggcccggggt 1260gctcccggcc ggccgagtga ttggcgagcc cacgagtctg atggacgtgt tccccaccgt 1320ggtccggctg gcgggcggcg aggtgcccca ggacagagtg attgacggcc aagaccttct 1380gcccttgctc ctggggacag cccaacactc agaccacgag ttcctgatgc attattgtga 1440gaggtttctg cacgcagcca ggtggcatca acgggacaga ggaacaatgt ggaaagtcca 1500ctttgtgacg cctgtgttcc agccagaggg agccggtgcc tgctatggaa gaaaggtctg 1560cccgtgcttt ggggaaaaag tagtccacca cgatccacct ttgctctttg acctctcaag 1620agacccttct gagacccaca tcctcacacc agcctcagag cccgtgttct atcaggtgat 1680ggaacgagtc cagcaggcgg tgtgggaaca ccagcggaca ctcagcccag ttcctctgca 1740gctggacagg ctgggcaaca tctggagacc gtggctgcag ccctgctgtg gcccgttccc 1800cctctgctgg tgccttaggg aagatgaccc acaataaatg tctgcagtga aaagctgg 185823589PRTHomo sapiens 23Met Leu His Leu His His Ser Cys Leu Cys Phe Arg Ser Trp Leu Pro1 5 10 15Ala Met Leu Ala Val Leu Leu Ser Leu Ala Pro Ser Ala Ser Ser Asp 20 25 30Ile Ser Ala Ser Arg Pro Asn Ile Leu Leu Leu Met Ala Asp Asp Leu 35 40 45Gly Ile Gly Asp Ile Gly Cys Tyr Gly Asn Asn Thr Met Arg Thr Pro 50 55 60Asn Ile Asp Arg Leu Ala Glu Asp Gly Val Lys Leu Thr Gln His Ile65 70 75 80Ser Ala Ala Ser Leu Cys Thr Pro Ser Arg Ala Ala Phe Leu Thr Gly 85 90 95Arg Tyr Pro Val Arg Ser Gly Met Val Ser Ser Ile Gly Tyr Arg Val 100 105 110Leu Gln Trp Thr Gly Ala Ser Gly Gly Leu Pro Thr Asn Glu Thr Thr 115 120 125Phe Ala Lys Ile Leu Lys Glu Lys Gly Tyr Ala Thr Gly Leu Ile Gly 130 135 140Lys Trp His Leu Gly Leu Asn Cys Glu Ser Ala Ser Asp His Cys His145 150 155 160His Pro Leu His His Gly Phe Glu His Phe Tyr Gly Met Pro Phe Ser 165 170 175Leu Met Gly Asp Cys Ala Arg Trp Glu Leu Ser Glu Lys Arg Val Asn 180 185 190Leu Glu Gln Lys Leu Asn Phe Leu Phe Gln Val Leu Ala Leu Val Ala 195 200 205Leu Thr Leu Val Ala Gly Lys Leu Thr His Leu Ile Pro Val Ser Trp 210 215 220Met Pro Val Ile Trp Ser Ala Leu Ser Ala Val Leu Leu Leu Ala Ser225 230 235 240Ser Tyr Phe Val Gly Ala Leu Ile Val His Ala Asp Cys Phe Leu Met 245 250 255Arg Asn His Thr Ile Thr Glu Gln Pro Met Cys Phe Gln Arg Thr Thr 260 265 270Pro Leu Ile Leu Gln Glu Val Ala Ser Phe Leu Lys Arg Asn Lys His 275 280 285Gly Pro Phe Leu Leu Phe Val Ser Phe Leu His Val His Ile Pro Leu 290 295 300Ile Thr Met Glu Asn Phe Leu Gly Lys Ser Leu His Gly Leu Tyr Gly305 310 315 320Asp Asn Val Glu Glu Met Asp Trp Met Val Gly Arg Ile Leu Asp Thr 325 330 335Leu Asp Val Glu Gly Leu Ser Asn Ser Thr Leu Ile Tyr Phe Thr Ser 340 345 350Asp His Gly Gly Ser Leu Glu Asn Gln Leu Gly Asn Thr Gln Tyr Gly 355 360 365Gly Trp Asn Gly Ile Tyr Lys Gly Gly Lys Gly Met Gly Gly Trp Glu 370 375 380Gly Gly Ile Arg Val Pro Gly Ile Phe Arg Trp Pro Gly Val Leu Pro385 390 395 400Ala Gly Arg Val Ile Gly Glu Pro Thr Ser Leu Met Asp Val Phe Pro 405 410 415Thr Val Val Arg Leu Ala Gly Gly Glu Val Pro Gln Asp Arg Val Ile 420 425 430Asp Gly Gln Asp Leu Leu Pro Leu Leu Leu Gly Thr Ala Gln His Ser 435 440

445Asp His Glu Phe Leu Met His Tyr Cys Glu Arg Phe Leu His Ala Ala 450 455 460Arg Trp His Gln Arg Asp Arg Gly Thr Met Trp Lys Val His Phe Val465 470 475 480Thr Pro Val Phe Gln Pro Glu Gly Ala Gly Ala Cys Tyr Gly Arg Lys 485 490 495Val Cys Pro Cys Phe Gly Glu Lys Val Val His His Asp Pro Pro Leu 500 505 510Leu Phe Asp Leu Ser Arg Asp Pro Ser Glu Thr His Ile Leu Thr Pro 515 520 525Ala Ser Glu Pro Val Phe Tyr Gln Val Met Glu Arg Val Gln Gln Ala 530 535 540Val Trp Glu His Gln Arg Thr Leu Ser Pro Val Pro Leu Gln Leu Asp545 550 555 560Arg Leu Gly Asn Ile Trp Arg Pro Trp Leu Gln Pro Cys Cys Gly Pro 565 570 575Phe Pro Leu Cys Trp Cys Leu Arg Glu Asp Asp Pro Gln 580 585241996DNAHomo sapiens 24gggttctgct cctagacatt agagagataa tacggctgat agacaacaag aaggtattcc 60aagctgcaca atgaggccca ggagaccgtt ggtcttcatg tctttggtgt gtgcactctt 120gaacacatgg ccagggcaca cagggtgcat gacgacaagg cctaatattg tcctaatcat 180ggttgatgac ctgggtattg gagatctggg ctgctacggc aatgacacca tgaggacgcc 240tcacatcgac cgccttgcca gggaaggcgt gcgactgact cagcacatct ctgccgcctc 300cctctgcagc ccaagccggt ccgcgttctt gacgggaaga taccccatcc gatcaggtat 360ggtttctagt ggtaatagac gtgtcatcca aaatcttgca gtccccgcag gcctccctct 420taatgagaca acacttgcag ccttgctaaa gaagcaagga tacagcacgg ggcttatagg 480caaatggcac caaggcttga actgcgactc ccgaagtgac cagtgccacc atccatataa 540ttatgggttt gactactact atggcatgcc gttcactctc gttgacagct gctggccgga 600cccctctcgt aacacggaat tagcctttga gagtcagctc tggctctgtg tgcagctagt 660tgccattgcc atcctcaccc taacctttgg gaagctgagc ggctgggtct ctgttccctg 720gctcctgatc ttctccatga ttctgtttat tttcctcttg ggctatgctt ggttctccag 780ccacacgtcc cctttatact gggactgcct cctcatgcgg gggcacgaga tcacggagca 840gcccatgaag gctgaacgag ctggatccat tatggtgaag gaagcgattt cctttttaga 900aaggcacagt aaggaaactt tccttctctt tttctccttt cttcacgtgc acacacctct 960ccccaccacg gacgatttca ctggcaccag caagcatggc ttgtatgggg ataatgtgga 1020agagatggac tccatggtgg gcaagattct tgatgctatc gatgattttg gcctaaggaa 1080caacaccctt gtctacttta catcagatca cggagggcat ttggaagcta ggcgagggca 1140tgcccaactt ggtggatgga atggaatata caaaggtgga aaaggcatgg ggggctggga 1200aggtggaatc cgcgtcccag gaattgtccg atggcctgga aaggtaccag ctggacggtt 1260gattaaggaa cctacaagtt taatggatat tttaccaact gtcgcatcag tgtcaggagg 1320aagtctccct caggacaggg tcattgacgg ccgagacctc atgcccttgc tgcagggcaa 1380cgtcaggcac tcggagcatg aatttctttt ccactactgt ggctcctacc tgcacgccgt 1440gcggtggatc cccaaggacg acagtgggtc agtttggaag gctcactatg tgaccccggt 1500attccagcca ccagcttctg gtggctgcta tgtcacctca ttatgcagat gtttcggaga 1560acaggttacc taccacaacc cccctctgct cttcgatctc tccagggacc cctcagagtc 1620cacacccctg acacctgcca cagagcccct ctatgatttt gtgattaaaa aggtggccaa 1680cgccctgaag gaacaccagg aaaccatcgt gcctgtgacc taccaactct cagaactgaa 1740tcagggcagg acgtggctga agccttgctg tggggtgttc ccattttgtc tgtgtgacaa 1800ggaagaggaa gtctctcagc ctcggggtcc taacgagaag agataattac aatcaggcta 1860ccagaggaag cctttggtcc taacgagaag agataattac aatcaggcta ccaaaggaag 1920cactaacttt ggtgctttca agttggcaag gagtgcattt aatagtcaat aaattcatct 1980accattccag attatt 199625591PRTHomo sapiens 25Met Arg Pro Arg Arg Pro Leu Val Phe Met Ser Leu Val Cys Ala Leu1 5 10 15Leu Asn Thr Trp Pro Gly His Thr Gly Cys Met Thr Thr Arg Pro Asn 20 25 30Ile Val Leu Ile Met Val Asp Asp Leu Gly Ile Gly Asp Leu Gly Cys 35 40 45Tyr Gly Asn Asp Thr Met Arg Thr Pro His Ile Asp Arg Leu Ala Arg 50 55 60Glu Gly Val Arg Leu Thr Gln His Ile Ser Ala Ala Ser Leu Cys Ser65 70 75 80Pro Ser Arg Ser Ala Phe Leu Thr Gly Arg Tyr Pro Ile Arg Ser Gly 85 90 95Met Val Ser Ser Gly Asn Arg Arg Val Ile Gln Asn Leu Ala Val Pro 100 105 110Ala Gly Leu Pro Leu Asn Glu Thr Thr Leu Ala Ala Leu Leu Lys Lys 115 120 125Gln Gly Tyr Ser Thr Gly Leu Ile Gly Lys Trp His Gln Gly Leu Asn 130 135 140Cys Asp Ser Arg Ser Asp Gln Cys His His Pro Tyr Asn Tyr Gly Phe145 150 155 160Asp Tyr Tyr Tyr Gly Met Pro Phe Thr Leu Val Asp Ser Cys Trp Pro 165 170 175Asp Pro Ser Arg Asn Thr Glu Leu Ala Phe Glu Ser Gln Leu Trp Leu 180 185 190Cys Val Gln Leu Val Ala Ile Ala Ile Leu Thr Leu Thr Phe Gly Lys 195 200 205Leu Ser Gly Trp Val Ser Val Pro Trp Leu Leu Ile Phe Ser Met Ile 210 215 220Leu Phe Ile Phe Leu Leu Gly Tyr Ala Trp Phe Ser Ser His Thr Ser225 230 235 240Pro Leu Tyr Trp Asp Cys Leu Leu Met Arg Gly His Glu Ile Thr Glu 245 250 255Gln Pro Met Lys Ala Glu Arg Ala Gly Ser Ile Met Val Lys Glu Ala 260 265 270Ile Ser Phe Leu Glu Arg His Ser Lys Glu Thr Phe Leu Leu Phe Phe 275 280 285Ser Phe Leu His Val His Thr Pro Leu Pro Thr Thr Asp Asp Phe Thr 290 295 300Gly Thr Ser Lys His Gly Leu Tyr Gly Asp Asn Val Glu Glu Met Asp305 310 315 320Ser Met Val Gly Lys Ile Leu Asp Ala Ile Asp Asp Phe Gly Leu Arg 325 330 335Asn Asn Thr Leu Val Tyr Phe Thr Ser Asp His Gly Gly His Leu Glu 340 345 350Ala Arg Arg Gly His Ala Gln Leu Gly Gly Trp Asn Gly Ile Tyr Lys 355 360 365Gly Gly Lys Gly Met Gly Gly Trp Glu Gly Gly Ile Arg Val Pro Gly 370 375 380Ile Val Arg Trp Pro Gly Lys Val Pro Ala Gly Arg Leu Ile Lys Glu385 390 395 400Pro Thr Ser Leu Met Asp Ile Leu Pro Thr Val Ala Ser Val Ser Gly 405 410 415Gly Ser Leu Pro Gln Asp Arg Val Ile Asp Gly Arg Asp Leu Met Pro 420 425 430Leu Leu Gln Gly Asn Val Arg His Ser Glu His Glu Phe Leu Phe His 435 440 445Tyr Cys Gly Ser Tyr Leu His Ala Val Arg Trp Ile Pro Lys Asp Asp 450 455 460Ser Gly Ser Val Trp Lys Ala His Tyr Val Thr Pro Val Phe Gln Pro465 470 475 480Pro Ala Ser Gly Gly Cys Tyr Val Thr Ser Leu Cys Arg Cys Phe Gly 485 490 495Glu Gln Val Thr Tyr His Asn Pro Pro Leu Leu Phe Asp Leu Ser Arg 500 505 510Asp Pro Ser Glu Ser Thr Pro Leu Thr Pro Ala Thr Glu Pro Leu Tyr 515 520 525Asp Phe Val Ile Lys Lys Val Ala Asn Ala Leu Lys Glu His Gln Glu 530 535 540Thr Ile Val Pro Val Thr Tyr Gln Leu Ser Glu Leu Asn Gln Gly Arg545 550 555 560Thr Trp Leu Lys Pro Cys Cys Gly Val Phe Pro Phe Cys Leu Cys Asp 565 570 575Lys Glu Glu Glu Val Ser Gln Pro Arg Gly Pro Asn Glu Lys Arg 580 585 590261578DNAHomo sapiens 26atgggctggc tttttctaaa ggttttgttg gcgggagtga gtttctcagg atttctttat 60cctcttgtgg atttttgcat cagtgggaaa acaagaggac agaagccaaa ctttgtgatt 120attttggccg atgacatggg gtggggtgac ctgggagcaa actgggcaga aacaaaggac 180actgccaacc ttgataagat ggcttcggag ggaatgaggt ttgtggattt ccatgcagct 240gcctccacct gctcaccctc ccgggcttcc ttgctcaccg gccggcttgg ccttcgcaat 300ggagtcacac gcaactttgc agtcacttct gtgggaggcc ttccgctcaa cgagaccacc 360ttggcagagg tgctgcagca ggcgggttac gtcactggga taataggcaa atggcatctt 420ggacaccacg gctcttatca ccccaacttc cgtggttttg attactactt tggaatccca 480tatagccatg atatgggctg tactgatact ccaggctaca accaccctcc ttgtccagcg 540tgtccacagg gtgatggacc atcaaggaac cttcaaagag actgttacac tgacgtggcc 600ctccctcttt atgaaaacct caacattgtg gagcagccgg tgaacttgag cagccttgcc 660cagaagtatg ctgagaaagc aacccagttc atccagcgtg caagcaccag cgggaggccc 720ttcctgctct atgtggctct ggcccacatg cacgtgccct tacctgtgac tcagctacca 780gcagcgccac ggggcagaag cctgtatggt gcagggctct gggagatgga cagtctggtg 840ggccagatca aggacaaagt tgaccacaca gtgaaggaaa acacattcct ctggtttaca 900ggagacaatg gcccgtgggc tcagaagtgt gagctagcgg gcagtgtggg tcccttcact 960ggattttggc aaactcgtca agggggaagt ccagccaagc agacgacctg ggaaggaggg 1020caccgggtcc cagcactggc ttactggcct ggcagagttc cagttaatgt caccagcact 1080gccttgttaa gcgtgctgga catttttcca actgtggtag ccctggccca ggccagctta 1140cctcaaggac ggcgctttga tggtgtggac gtctccgagg tgctctttgg ccggtcacag 1200cctgggcaca gggtgctgtt ccaccccaac agcggggcag ctggagagtt tggagccctg 1260cagactgtcc gcctggagcg ttacaaggcc ttctacatta ccggtggagc cagggcgtgt 1320gatgggagca cggggcctga gctgcagcat aagtttcctc tgattttcaa cctggaagac 1380gataccgcag aagctgtgcc cctagaaaga ggtggtgcgg agtaccaggc tgtgctgccc 1440gaggtcagaa aggttcttgc agacgtcctc caagacattg ccaacgacaa catctccagc 1500gcagattaca ctcaggaccc ttcagtaact ccctgctgta atccctacca aattgcctgc 1560cgctgtcaag ccgcataa 157827525PRTHomo sapiens 27Met Gly Trp Leu Phe Leu Lys Val Leu Leu Ala Gly Val Ser Phe Ser1 5 10 15Gly Phe Leu Tyr Pro Leu Val Asp Phe Cys Ile Ser Gly Lys Thr Arg 20 25 30Gly Gln Lys Pro Asn Phe Val Ile Ile Leu Ala Asp Asp Met Gly Trp 35 40 45Gly Asp Leu Gly Ala Asn Trp Ala Glu Thr Lys Asp Thr Ala Asn Leu 50 55 60Asp Lys Met Ala Ser Glu Gly Met Arg Phe Val Asp Phe His Ala Ala65 70 75 80Ala Ser Thr Cys Ser Pro Ser Arg Ala Ser Leu Leu Thr Gly Arg Leu 85 90 95Gly Leu Arg Asn Gly Val Thr Arg Asn Phe Ala Val Thr Ser Val Gly 100 105 110Gly Leu Pro Leu Asn Glu Thr Thr Leu Ala Glu Val Leu Gln Gln Ala 115 120 125Gly Tyr Val Thr Gly Ile Ile Gly Lys Trp His Leu Gly His His Gly 130 135 140Ser Tyr His Pro Asn Phe Arg Gly Phe Asp Tyr Tyr Phe Gly Ile Pro145 150 155 160Tyr Ser His Asp Met Gly Cys Thr Asp Thr Pro Gly Tyr Asn His Pro 165 170 175Pro Cys Pro Ala Cys Pro Gln Gly Asp Gly Pro Ser Arg Asn Leu Gln 180 185 190Arg Asp Cys Tyr Thr Asp Val Ala Leu Pro Leu Tyr Glu Asn Leu Asn 195 200 205Ile Val Glu Gln Pro Val Asn Leu Ser Ser Leu Ala Gln Lys Tyr Ala 210 215 220Glu Lys Ala Thr Gln Phe Ile Gln Arg Ala Ser Thr Ser Gly Arg Pro225 230 235 240Phe Leu Leu Tyr Val Ala Leu Ala His Met His Val Pro Leu Pro Val 245 250 255Thr Gln Leu Pro Ala Ala Pro Arg Gly Arg Ser Leu Tyr Gly Ala Gly 260 265 270Leu Trp Glu Met Asp Ser Leu Val Gly Gln Ile Lys Asp Lys Val Asp 275 280 285His Thr Val Lys Glu Asn Thr Phe Leu Trp Phe Thr Gly Asp Asn Gly 290 295 300Pro Trp Ala Gln Lys Cys Glu Leu Ala Gly Ser Val Gly Pro Phe Thr305 310 315 320Gly Phe Trp Gln Thr Arg Gln Gly Gly Ser Pro Ala Lys Gln Thr Thr 325 330 335Trp Glu Gly Gly His Arg Val Pro Ala Leu Ala Tyr Trp Pro Gly Arg 340 345 350Val Pro Val Asn Val Thr Ser Thr Ala Leu Leu Ser Val Leu Asp Ile 355 360 365Phe Pro Thr Val Val Ala Leu Ala Gln Ala Ser Leu Pro Gln Gly Arg 370 375 380Arg Phe Asp Gly Val Asp Val Ser Glu Val Leu Phe Gly Arg Ser Gln385 390 395 400Pro Gly His Arg Val Leu Phe His Pro Asn Ser Gly Ala Ala Gly Glu 405 410 415Phe Gly Ala Leu Gln Thr Val Arg Leu Glu Arg Tyr Lys Ala Phe Tyr 420 425 430Ile Thr Gly Gly Ala Arg Ala Cys Asp Gly Ser Thr Gly Pro Glu Leu 435 440 445Gln His Lys Phe Pro Leu Ile Phe Asn Leu Glu Asp Asp Thr Ala Glu 450 455 460Ala Val Pro Leu Glu Arg Gly Gly Ala Glu Tyr Gln Ala Val Leu Pro465 470 475 480Glu Val Arg Lys Val Leu Ala Asp Val Leu Gln Asp Ile Ala Asn Asp 485 490 495Asn Ile Ser Ser Ala Asp Tyr Thr Gln Asp Pro Ser Val Thr Pro Cys 500 505 510Cys Asn Pro Tyr Gln Ile Ala Cys Arg Cys Gln Ala Ala 515 520 525284669DNAHomo sapiens 28cgcagaccgt cgctaatgaa tcttggggcc ggtgtcgggc cggggcggct tgatcggcaa 60ctaggaaacc ccaggcgcag aggccaggag cgagggcagc gaggatcaga ggccaggcct 120tcccggctgc cggcgctcct cggaggtcag ggcagatgag gaacatgact ctcccccttc 180ggaggaggaa ggaagtcccg ctgccacctt atctctgctc ctctgcctcc tccctgttcc 240cagagctttt tctctagaga agattttgaa ggcggctttt gtgctgacgg ccacccacca 300tcatctaaag aagataaact tggcaaatga catgcaggtt cttcaaggca gaataattgc 360agaaaatctt caaaggaccc tatctgcaga tgttctgaat acctctgaga atagagattg 420attattcaac caggatacct aattcaagaa ctccagaaat caggagacgg agacattttg 480tcagttttgc aacattggac caaatacaat gaagtattct tgctgtgctc tggttttggc 540tgtcctgggc acagaattgc tgggaagcct ctgttcgact gtcagatccc cgaggttcag 600aggacggata cagcaggaac gaaaaaacat ccgacccaac attattcttg tgcttaccga 660tgatcaagat gtggagctgg ggtccctgca agtcatgaac aaaacgagaa agattatgga 720acatgggggg gccaccttca tcaatgcctt tgtgactaca cccatgtgct gcccgtcacg 780gtcctccatg ctcaccggga agtatgtgca caatcacaat gtctacacca acaacgagaa 840ctgctcttcc ccctcgtggc aggccatgca tgagcctcgg acttttgctg tatatcttaa 900caacactggc tacagaacag ccttttttgg aaaatacctc aatgaatata atggcagcta 960catcccccct gggtggcgag aatggcttgg attaatcaag aattctcgct tctataatta 1020cactgtttgt cgcaatggca tcaaagaaaa gcatggattt gattatgcaa aggactactt 1080cacagactta atcactaacg agagcattaa ttacttcaaa atgtctaaga gaatgtatcc 1140ccataggccc gttatgatgg tgatcagcca cgctgcgccc cacggccccg aggactcagc 1200cccacagttt tctaaactgt accccaatgc ttcccaacac ataactccta gttataacta 1260tgcaccaaat atggataaac actggattat gcagtacaca ggaccaatgc tgcccatcca 1320catggaattt acaaacattc tacagcgcaa aaggctccag actttgatgt cagtggatga 1380ttctgtggag aggctgtata acatgctcgt ggagacgggg gagctggaga atacttacat 1440catttacacc gccgaccatg gttaccatat tgggcagttt ggactggtca aggggaaatc 1500catgccatat gactttgata ttcgtgtgcc tttttttatt cgtggtccaa gtgtagaacc 1560aggatcaata gtcccacaga tcgttctcaa cattgacttg gcccccacga tcctggatat 1620tgctgggctc gacacacctc ctgatgtgga cggcaagtct gtcctcaaac ttctggaccc 1680agaaaagcca ggtaacaggt ttcgaacaaa caagaaggcc aaaatttggc gtgatacatt 1740cctagtggaa agaggcaaat ttctacgtaa gaaggaagaa tccagcaaga atatccaaca 1800gtcaaatcac ttgcccaaat atgaacgggt caaagaacta tgccagcagg ccaggtacca 1860gacagcctgt gaacaaccgg ggcagaagtg gcaatgcatt gaggatacat ctggcaagct 1920tcgaattcac aagtgtaaag gacccagtga cctgctcaca gtccggcaga gcacgcggaa 1980cctctacgct cgcggcttcc atgacaaaga caaagagtgc agttgtaggg agtctggtta 2040ccgtgccagc agaagccaaa gaaagagtca acggcaattc ttgagaaacc aggggactcc 2100aaagtacaag cccagatttg tccatactcg gcagacacgt tccttgtccg tcgaatttga 2160aggtgaaata tatgacataa atctggaaga agaagaagaa ttgcaagtgt tgcaaccaag 2220aaacattgct aagcgtcatg atgaaggcca caaggggcca agagatctcc aggcttccag 2280tggtggcaac aggggcagga tgctggcaga tagcagcaac gccgtgggcc cacctaccac 2340tgtccgagtg acacacaagt gttttattct tcccaatgac tctatccatt gtgagagaga 2400actgtaccaa tcggccagag cgtggaagga ccataaggca tacattgaca aagagattga 2460agctctgcaa gataaaatta agaatttaag agaagtgaga ggacatctga agagaaggaa 2520gcctgaggaa tgtagctgca gtaaacaaag ctattacaat aaagagaaag gtgtaaaaaa 2580gcaagagaaa ttaaagagcc atcttcaccc attcaaggag gctgctcagg aagtagatag 2640caaactgcaa cttttcaagg agaacaaccg taggaggaag aaggagagga aggagaagag 2700acggcagagg aagggggaag agtgcagcct gcctggcctc acttgcttca cgcatgacaa 2760caaccactgg cagacagccc cgttctggaa cctgggatct ttctgtgctt gcacgagttc 2820taacaataac acctactggt gtttgcgtac agttaatgag acgcataatt ttcttttctg 2880tgagtttgct actggctttt tggagtattt tgatatgaat acagatcctt atcagctcac 2940aaatacagtg cacacggtag aacgaggcat tttgaatcag ctacacgtac aactaatgga 3000gctcagaagc tgtcaaggat ataagcagtg caacccaaga cctaagaatc ttgatgttgg 3060aaataaagat ggaggaagct atgacctaca cagaggacag ttatgggatg gatgggaagg 3120ttaatcagcc ccgtctcact gcagacatca actggcaagg cctagaggag ctacacagtg 3180tgaatgaaaa catctatgag tacagacaaa actacagact tagtctggtg gactggacta 3240attacttgaa ggatttagat agagtatttg cactgctgaa gagtcactat gagcaaaata 3300aaacaaataa gactcaaact gctcaaagtg acgggttctt ggttgtctct gctgagcacg 3360ctgtgtcaat ggagatggcc tctgctgact cagatgaaga cccaaggcat aaggttggga 3420aaacacctca tttgaccttg ccagctgacc ttcaaaccct gcatttgaac cgaccaacat 3480taagtccaga gagtaaactt gaatggaata acgacattcc agaagttaat catttgaatt 3540ctgaacactg gagaaaaacc gaaaaatgga cggggcatga agagactaat catctggaaa 3600ccgatttcag tggcgatggc atgacagagc tagagctcgg

gcccagcccc aggctgcagc 3660ccattcacag gcacccgaaa gaacttcccc agtatggtgg tcctggaaag gacatttttg 3720aagatcaact atatcttcct gtgcattccg atggaatttc agttcatcag atgttcacca 3780tggccaccgc agaacaccga agtaattcca gcatagcggg gaagatgttg accaaggtgg 3840agaagaatca cgaaaaggag aagtcacagc acctagaagg cagcacctcc tcttcactct 3900cctctgatta gatgaaactg ttaccttacc ctaaacacag tatttctttt taactttttt 3960atttgtaaac taataaaggt aatcacagcc accaacattc caagctaccc tgggtacctt 4020tgtgcagtag aagctagtga gcatgtgagc aagcggtgtg cacacggaga ctcatcgtta 4080taatttacta tctgccaaga gtagaaagaa aggctgggga tatttgggtt ggcttggttt 4140tgattttttg cttgtttgtt tgttttgtac taaaacagta ttatcttttg aatatcgtag 4200ggacataagt atatacatgt tatccaatca agatggctag aatggtgcct ttctgagtgt 4260ctaaaacttg acacccctgg taaatctttc aacacacttc cactgcctgc gtaatgaagt 4320tttgattcat ttttaaccac tggaattttt caatgccgtc attttcagtt agatgatttt 4380gcactttgag attaaaatgc catgtctatt tgattagtct tattttttta tttttacagg 4440cttatcagtc tcactgttgg ctgtcattgt gacaaagtca aataaacccc caaggacgac 4500acacagtatg gatcacatat tgtttgacat taagcttttg ccagaaaatg ttgcatgtgt 4560tttacctcga cttgctaaaa tcgattagca gaaaggcatg gctaataatg ttggtggtga 4620aaataaataa ataagtaaat gaaaaaaaaa aaaaaaaaaa aaaaaaaaa 466929871PRTHomo sapiens 29Met Lys Tyr Ser Cys Cys Ala Leu Val Leu Ala Val Leu Gly Thr Glu1 5 10 15Leu Leu Gly Ser Leu Cys Ser Thr Val Arg Ser Pro Arg Phe Arg Gly 20 25 30Arg Ile Gln Gln Glu Arg Lys Asn Ile Arg Pro Asn Ile Ile Leu Val 35 40 45Leu Thr Asp Asp Gln Asp Val Glu Leu Gly Ser Leu Gln Val Met Asn 50 55 60Lys Thr Arg Lys Ile Met Glu His Gly Gly Ala Thr Phe Ile Asn Ala65 70 75 80Phe Val Thr Thr Pro Met Cys Cys Pro Ser Arg Ser Ser Met Leu Thr 85 90 95Gly Lys Tyr Val His Asn His Asn Val Tyr Thr Asn Asn Glu Asn Cys 100 105 110Ser Ser Pro Ser Trp Gln Ala Met His Glu Pro Arg Thr Phe Ala Val 115 120 125Tyr Leu Asn Asn Thr Gly Tyr Arg Thr Ala Phe Phe Gly Lys Tyr Leu 130 135 140Asn Glu Tyr Asn Gly Ser Tyr Ile Pro Pro Gly Trp Arg Glu Trp Leu145 150 155 160Gly Leu Ile Lys Asn Ser Arg Phe Tyr Asn Tyr Thr Val Cys Arg Asn 165 170 175Gly Ile Lys Glu Lys His Gly Phe Asp Tyr Ala Lys Asp Tyr Phe Thr 180 185 190Asp Leu Ile Thr Asn Glu Ser Ile Asn Tyr Phe Lys Met Ser Lys Arg 195 200 205Met Tyr Pro His Arg Pro Val Met Met Val Ile Ser His Ala Ala Pro 210 215 220His Gly Pro Glu Asp Ser Ala Pro Gln Phe Ser Lys Leu Tyr Pro Asn225 230 235 240Ala Ser Gln His Ile Thr Pro Ser Tyr Asn Tyr Ala Pro Asn Met Asp 245 250 255Lys His Trp Ile Met Gln Tyr Thr Gly Pro Met Leu Pro Ile His Met 260 265 270Glu Phe Thr Asn Ile Leu Gln Arg Lys Arg Leu Gln Thr Leu Met Ser 275 280 285Val Asp Asp Ser Val Glu Arg Leu Tyr Asn Met Leu Val Glu Thr Gly 290 295 300Glu Leu Glu Asn Thr Tyr Ile Ile Tyr Thr Ala Asp His Gly Tyr His305 310 315 320Ile Gly Gln Phe Gly Leu Val Lys Gly Lys Ser Met Pro Tyr Asp Phe 325 330 335Asp Ile Arg Val Pro Phe Phe Ile Arg Gly Pro Ser Val Glu Pro Gly 340 345 350Ser Ile Val Pro Gln Ile Val Leu Asn Ile Asp Leu Ala Pro Thr Ile 355 360 365Leu Asp Ile Ala Gly Leu Asp Thr Pro Pro Asp Val Asp Gly Lys Ser 370 375 380Val Leu Lys Leu Leu Asp Pro Glu Lys Pro Gly Asn Arg Phe Arg Thr385 390 395 400Asn Lys Lys Ala Lys Ile Trp Arg Asp Thr Phe Leu Val Glu Arg Gly 405 410 415Lys Phe Leu Arg Lys Lys Glu Glu Ser Ser Lys Asn Ile Gln Gln Ser 420 425 430Asn His Leu Pro Lys Tyr Glu Arg Val Lys Glu Leu Cys Gln Gln Ala 435 440 445Arg Tyr Gln Thr Ala Cys Glu Gln Pro Gly Gln Lys Trp Gln Cys Ile 450 455 460Glu Asp Thr Ser Gly Lys Leu Arg Ile His Lys Cys Lys Gly Pro Ser465 470 475 480Asp Leu Leu Thr Val Arg Gln Ser Thr Arg Asn Leu Tyr Ala Arg Gly 485 490 495Phe His Asp Lys Asp Lys Glu Cys Ser Cys Arg Glu Ser Gly Tyr Arg 500 505 510Ala Ser Arg Ser Gln Arg Lys Ser Gln Arg Gln Phe Leu Arg Asn Gln 515 520 525Gly Thr Pro Lys Tyr Lys Pro Arg Phe Val His Thr Arg Gln Thr Arg 530 535 540Ser Leu Ser Val Glu Phe Glu Gly Glu Ile Tyr Asp Ile Asn Leu Glu545 550 555 560Glu Glu Glu Glu Leu Gln Val Leu Gln Pro Arg Asn Ile Ala Lys Arg 565 570 575His Asp Glu Gly His Lys Gly Pro Arg Asp Leu Gln Ala Ser Ser Gly 580 585 590Gly Asn Arg Gly Arg Met Leu Ala Asp Ser Ser Asn Ala Val Gly Pro 595 600 605Pro Thr Thr Val Arg Val Thr His Lys Cys Phe Ile Leu Pro Asn Asp 610 615 620Ser Ile His Cys Glu Arg Glu Leu Tyr Gln Ser Ala Arg Ala Trp Lys625 630 635 640Asp His Lys Ala Tyr Ile Asp Lys Glu Ile Glu Ala Leu Gln Asp Lys 645 650 655Ile Lys Asn Leu Arg Glu Val Arg Gly His Leu Lys Arg Arg Lys Pro 660 665 670Glu Glu Cys Ser Cys Ser Lys Gln Ser Tyr Tyr Asn Lys Glu Lys Gly 675 680 685Val Lys Lys Gln Glu Lys Leu Lys Ser His Leu His Pro Phe Lys Glu 690 695 700Ala Ala Gln Glu Val Asp Ser Lys Leu Gln Leu Phe Lys Glu Asn Asn705 710 715 720Arg Arg Arg Lys Lys Glu Arg Lys Glu Lys Arg Arg Gln Arg Lys Gly 725 730 735Glu Glu Cys Ser Leu Pro Gly Leu Thr Cys Phe Thr His Asp Asn Asn 740 745 750His Trp Gln Thr Ala Pro Phe Trp Asn Leu Gly Ser Phe Cys Ala Cys 755 760 765Thr Ser Ser Asn Asn Asn Thr Tyr Trp Cys Leu Arg Thr Val Asn Glu 770 775 780Thr His Asn Phe Leu Phe Cys Glu Phe Ala Thr Gly Phe Leu Glu Tyr785 790 795 800Phe Asp Met Asn Thr Asp Pro Tyr Gln Leu Thr Asn Thr Val His Thr 805 810 815Val Glu Arg Gly Ile Leu Asn Gln Leu His Val Gln Leu Met Glu Leu 820 825 830Arg Ser Cys Gln Gly Tyr Lys Gln Cys Asn Pro Arg Pro Lys Asn Leu 835 840 845Asp Val Gly Asn Lys Asp Gly Gly Ser Tyr Asp Leu His Arg Gly Gln 850 855 860Leu Trp Asp Gly Trp Glu Gly865 870304279DNAHomo sapiens 30gggccatttc tggacaacag ctgctatttt cacttgagcc caagttaatt tctcggggag 60ttctcgggcg cgcacaggca gctcggtttg ccctgcgatt gagctgcggg tcgcggccgg 120cgccggcctc tccaatggca aatgtgtgtg gctggaggcg agcgcgaggc tttcggcaaa 180ggcagtcgag tgtttgcaga ccggggcgag tcctgtgaaa gcagataaaa gaaaacattt 240attaacgtgt cattacgagg ggagcgcccg gccggggctg tcgcactccc cgcggaacat 300ttggctccct ccagctccta gagaggagaa gaagaaagcg gaaaagaggc agattcacgt 360cgtttccagc caagtggacc tgatcgatgg ccctcctgaa tttatcacga tatttgattt 420attagcgatg ccccctggtt tgtgtgttac gcacacacac gtgcacacaa ggctctggct 480cgcttccctc cctcgtttcc agctcctggg cgaatcccac atctgtttca actctccgcc 540gagggcgagc aggagcgaga gtgtgtcgaa tctgcgagtg aagagggacg agggaaaaga 600aacaaagcca cagacgcaac ttgagactcc cgcatcccaa aagaagcacc agatcagcaa 660aaaaagaaga tgggcccccc gagcctcgtg ctgtgcttgc tgtccgcaac tgtgttctcc 720ctgctgggtg gaagctcggc cttcctgtcg caccaccgcc tgaaaggcag gtttcagagg 780gaccgcagga acatccgccc caacatcatc ctggtgctga cggacgacca ggatgtggag 840ctgggttcca tgcaggtgat gaacaagacc cggcgcatca tggagcaggg cggggcgcac 900ttcatcaacg ccttcgtgac cacacccatg tgctgcccct cacgctcctc catcctcacc 960ggcaagtacg tccacaacca caacacctac accaacaatg agaactgctc ctcgccctcc 1020tggcaggcac agcacgagag ccgcaccttt gccgtgtacc tcaatagcac tggctaccgg 1080acagctttct tcgggaagta tcttaatgaa tacaacggct cctacgtgcc acccggctgg 1140aaggagtggg tcggactcct taaaaactcc cgcttttata actacacgct gtgtcggaac 1200ggggtgaaag agaagcacgg ctccgactac tccaaggatt acctcacaga cctcatcacc 1260aatgacagcg tgagcttctt ccgcacgtcc aagaagatgt acccgcacag gccagtcctc 1320atggtcatca gccatgcagc cccccacggc cctgaggatt cagccccaca atattcacgc 1380ctcttcccaa acgcatctca gcacatcacg ccgagctaca actacgcgcc caacccggac 1440aaacactgga tcatgcgcta cacggggccc atgaagccca tccacatgga attcaccaac 1500atgctccagc ggaagcgctt gcagaccctc atgtcggtgg acgactccat ggagacgatt 1560tacaacatgc tggttgagac gggcgagctg gacaacacgt acatcgtata caccgccgac 1620cacggttacc acatcggcca gtttggcctg gtgaaaggga aatccatgcc atatgagttt 1680gacatcaggg tcccgttcta cgtgaggggc cccaacgtgg aagccggctg tctgaatccc 1740cacatcgtcc tcaacattga cctggccccc accatcctgg acattgcagg cctggacata 1800cctgcggata tggacgggaa atccatcctc aagctgctgg acacggagcg gccggtgaat 1860cggtttcact tgaaaaagaa gatgagggtc tggcgggact ccttcttggt ggagagaggc 1920aagctgctac acaagagaga caatgacaag gtggacgccc aggaggagaa ctttctgccc 1980aagtaccagc gtgtgaagga cctgtgtcag cgtgctgagt accagacggc gtgtgagcag 2040ctgggacaga agtggcagtg tgtggaggac gccacgggga agctgaagct gcataagtgc 2100aagggcccca tgcggctggg cggcagcaga gccctctcca acctcgtgcc caagtactac 2160gggcagggca gcgaggcctg cacctgtgac agcggggact acaagctcag cctggccgga 2220cgccggaaaa aactcttcaa gaagaagtac aaggccagct atgtccgcag tcgctccatc 2280cgctcagtgg ccatcgaggt ggacggcagg gtgtaccacg taggcctggg tgatgccgcc 2340cagccccgaa acctcaccaa gcggcactgg ccaggggccc ctgaggacca agatgacaag 2400gatggtgggg acttcagtgg cactggaggc cttcccgact actcagccgc caaccccatt 2460aaagtgacac atcggtgcta catcctagag aacgacacag tccagtgtga cctggacctg 2520tacaagtccc tgcaggcctg gaaagaccac aagctgcaca tcgaccacga gattgaaacc 2580ctgcagaaca aaattaagaa cctgagggaa gtccgaggtc acctgaagaa aaagcggcca 2640gaagaatgtg actgtcacaa aatcagctac cacacccagc acaaaggccg cctcaagcac 2700agaggctcca gtctgcatcc tttcaggaag ggcctgcaag agaaggacaa ggtgtggctg 2760ttgcgggagc agaagcgcaa gaagaaactc cgcaagctgc tcaagcgcct gcagaacaac 2820gacacgtgca gcatgccagg cctcacgtgc ttcacccacg acaaccagca ctggcagacg 2880gcgcctttct ggacactggg gcctttctgt gcctgcacca gcgccaacaa taacacgtac 2940tggtgcatga ggaccatcaa tgagactcac aatttcctct tctgtgaatt tgcaactggc 3000ttcctagagt actttgatct caacacagac ccctaccagc tgatgaatgc agtgaacaca 3060ctggacaggg atgtcctcaa ccagctacac gtacagctca tggagctgag gagctgcaag 3120ggttacaagc agtgtaaccc ccggactcga aacatggacc tgggacttaa agatggagga 3180agctatgagc aatacaggca gtttcagcgt cgaaagtggc cagaaatgaa gagaccttct 3240tccaaatcac tgggacaact gtgggaaggc tgggaaggtt aagaaacaac agaggtggac 3300ctccaaaaac atagaggcat cacctgactg cacaggcaat gaaaaaccat gtgggtgatt 3360tccagcagac ctgtgctatt ggccaggagg cctgagaaag caagcacgca ctctcagtca 3420acatgacaga ttctggagga taaccagcag gagcagagat aacttcagga agtccatttt 3480tgcccctgct tttgctttgg attatacctc accagctgca caaaatgcat tttttcgtat 3540caaaaagtca ccactaaccc tcccccagaa gctcacaaag gaaaacggag agagcgagcg 3600agagagattt ccttggaaat ttctcccaag ggcgaaagtc attggaattt ttaaatcata 3660ggggaaaagc agtcctgttc taaatcctct tattcttttg gtttgtcaca aagaaggaac 3720taagaagcag gacagaggca acgtggagag gctgaaaaca gtgcagagac gtttgacaat 3780gagtcagtag cacaaaagag atgacattta cctagcatat aaaccctggt tgcctctgaa 3840gaaactgcct tcattgtata tatgtgacta tttacatgta atcaacatgg gaacttttag 3900gggaacctaa taagaaatcc caattttcag gagtggtggt gtcaataaac gctctgtggc 3960cagtgtaaaa gaaaaaaaaa aaaaattgtg gacatttctg ttcctgtcca gataccattt 4020ctcctagtat ttctttgtta tgtcccagaa ctgatgtttt ttttttaagg tactgaaaag 4080aaatgaagtt gatgtatgtc ccaagttttg atgaaactgt atttgtaaaa aaaattttgt 4140agtttaagta ttgtcataca gtgttcaaaa ccccagccaa tgaccagcag ttggtatgaa 4200gaacctttga cattttgtaa aaggccattt cttggggaaa aaaaaaaaaa aaaaaaaaaa 4260aaaaaaaaaa aaaaaaaaa 427931870PRTHomo sapiens 31Met Gly Pro Pro Ser Leu Val Leu Cys Leu Leu Ser Ala Thr Val Phe1 5 10 15Ser Leu Leu Gly Gly Ser Ser Ala Phe Leu Ser His His Arg Leu Lys 20 25 30Gly Arg Phe Gln Arg Asp Arg Arg Asn Ile Arg Pro Asn Ile Ile Leu 35 40 45Val Leu Thr Asp Asp Gln Asp Val Glu Leu Gly Ser Met Gln Val Met 50 55 60Asn Lys Thr Arg Arg Ile Met Glu Gln Gly Gly Ala His Phe Ile Asn65 70 75 80Ala Phe Val Thr Thr Pro Met Cys Cys Pro Ser Arg Ser Ser Ile Leu 85 90 95Thr Gly Lys Tyr Val His Asn His Asn Thr Tyr Thr Asn Asn Glu Asn 100 105 110Cys Ser Ser Pro Ser Trp Gln Ala Gln His Glu Ser Arg Thr Phe Ala 115 120 125Val Tyr Leu Asn Ser Thr Gly Tyr Arg Thr Ala Phe Phe Gly Lys Tyr 130 135 140Leu Asn Glu Tyr Asn Gly Ser Tyr Val Pro Pro Gly Trp Lys Glu Trp145 150 155 160Val Gly Leu Leu Lys Asn Ser Arg Phe Tyr Asn Tyr Thr Leu Cys Arg 165 170 175Asn Gly Val Lys Glu Lys His Gly Ser Asp Tyr Ser Lys Asp Tyr Leu 180 185 190Thr Asp Leu Ile Thr Asn Asp Ser Val Ser Phe Phe Arg Thr Ser Lys 195 200 205Lys Met Tyr Pro His Arg Pro Val Leu Met Val Ile Ser His Ala Ala 210 215 220Pro His Gly Pro Glu Asp Ser Ala Pro Gln Tyr Ser Arg Leu Phe Pro225 230 235 240Asn Ala Ser Gln His Ile Thr Pro Ser Tyr Asn Tyr Ala Pro Asn Pro 245 250 255Asp Lys His Trp Ile Met Arg Tyr Thr Gly Pro Met Lys Pro Ile His 260 265 270Met Glu Phe Thr Asn Met Leu Gln Arg Lys Arg Leu Gln Thr Leu Met 275 280 285Ser Val Asp Asp Ser Met Glu Thr Ile Tyr Asn Met Leu Val Glu Thr 290 295 300Gly Glu Leu Asp Asn Thr Tyr Ile Val Tyr Thr Ala Asp His Gly Tyr305 310 315 320His Ile Gly Gln Phe Gly Leu Val Lys Gly Lys Ser Met Pro Tyr Glu 325 330 335Phe Asp Ile Arg Val Pro Phe Tyr Val Arg Gly Pro Asn Val Glu Ala 340 345 350Gly Cys Leu Asn Pro His Ile Val Leu Asn Ile Asp Leu Ala Pro Thr 355 360 365Ile Leu Asp Ile Ala Gly Leu Asp Ile Pro Ala Asp Met Asp Gly Lys 370 375 380Ser Ile Leu Lys Leu Leu Asp Thr Glu Arg Pro Val Asn Arg Phe His385 390 395 400Leu Lys Lys Lys Met Arg Val Trp Arg Asp Ser Phe Leu Val Glu Arg 405 410 415Gly Lys Leu Leu His Lys Arg Asp Asn Asp Lys Val Asp Ala Gln Glu 420 425 430Glu Asn Phe Leu Pro Lys Tyr Gln Arg Val Lys Asp Leu Cys Gln Arg 435 440 445Ala Glu Tyr Gln Thr Ala Cys Glu Gln Leu Gly Gln Lys Trp Gln Cys 450 455 460Val Glu Asp Ala Thr Gly Lys Leu Lys Leu His Lys Cys Lys Gly Pro465 470 475 480Met Arg Leu Gly Gly Ser Arg Ala Leu Ser Asn Leu Val Pro Lys Tyr 485 490 495Tyr Gly Gln Gly Ser Glu Ala Cys Thr Cys Asp Ser Gly Asp Tyr Lys 500 505 510Leu Ser Leu Ala Gly Arg Arg Lys Lys Leu Phe Lys Lys Lys Tyr Lys 515 520 525Ala Ser Tyr Val Arg Ser Arg Ser Ile Arg Ser Val Ala Ile Glu Val 530 535 540Asp Gly Arg Val Tyr His Val Gly Leu Gly Asp Ala Ala Gln Pro Arg545 550 555 560Asn Leu Thr Lys Arg His Trp Pro Gly Ala Pro Glu Asp Gln Asp Asp 565 570 575Lys Asp Gly Gly Asp Phe Ser Gly Thr Gly Gly Leu Pro Asp Tyr Ser 580 585 590Ala Ala Asn Pro Ile Lys Val Thr His Arg Cys Tyr Ile Leu Glu Asn 595 600 605Asp Thr Val Gln Cys Asp Leu Asp Leu Tyr Lys Ser Leu Gln Ala Trp 610 615 620Lys Asp His Lys Leu His Ile Asp His Glu Ile Glu Thr Leu Gln Asn625 630 635 640Lys Ile Lys Asn Leu Arg Glu Val Arg Gly His Leu Lys Lys Lys Arg 645 650 655Pro Glu Glu Cys Asp Cys His Lys Ile Ser Tyr His Thr Gln His Lys 660 665 670Gly Arg Leu Lys His Arg Gly Ser Ser Leu His Pro Phe Arg Lys Gly 675 680 685Leu Gln Glu Lys Asp Lys Val Trp Leu Leu Arg Glu Gln Lys Arg Lys 690 695 700Lys Lys Leu Arg Lys Leu Leu Lys Arg Leu Gln Asn Asn Asp Thr Cys705

710 715 720Ser Met Pro Gly Leu Thr Cys Phe Thr His Asp Asn Gln His Trp Gln 725 730 735Thr Ala Pro Phe Trp Thr Leu Gly Pro Phe Cys Ala Cys Thr Ser Ala 740 745 750Asn Asn Asn Thr Tyr Trp Cys Met Arg Thr Ile Asn Glu Thr His Asn 755 760 765Phe Leu Phe Cys Glu Phe Ala Thr Gly Phe Leu Glu Tyr Phe Asp Leu 770 775 780Asn Thr Asp Pro Tyr Gln Leu Met Asn Ala Val Asn Thr Leu Asp Arg785 790 795 800Asp Val Leu Asn Gln Leu His Val Gln Leu Met Glu Leu Arg Ser Cys 805 810 815Lys Gly Tyr Lys Gln Cys Asn Pro Arg Thr Arg Asn Met Asp Leu Gly 820 825 830Leu Lys Asp Gly Gly Ser Tyr Glu Gln Tyr Arg Gln Phe Gln Arg Arg 835 840 845Lys Trp Pro Glu Met Lys Arg Pro Ser Ser Lys Ser Leu Gly Gln Leu 850 855 860Trp Glu Gly Trp Glu Gly865 870326PRTArtificial SequenceConsensus sequence 32Xaa Xaa Xaa Pro Ser Arg1 53323PRTArtificial SequenceSequence derived from human Arylsulfatase A 33Met Thr Asp Phe Tyr Val Pro Val Ser Leu Cys Thr Pro Ser Arg Ala1 5 10 15Ala Leu Leu Thr Gly Arg Ser 203416PRTArtificial Sequencea variant of the ASA65-80 peptide, in which residues Cys69, Pro71 and Arg73, critical for FGly formation, were scrambled 34Pro Val Ser Leu Pro Thr Arg Ser Cys Ala Ala Leu Leu Thr Gly Arg1 5 10 153516PRTArtificial Sequencea variant of the ASA65-80 peptide, in which the Cys69 was replaced by a Serine 35Pro Val Ser Leu Ser Thr Pro Ser Arg Ala Ala Leu Leu Thr Gly Arg1 5 10 153619DNAArtificial Sequencehuman FGE-specific PCR primer 36ccaatgtagg tcagacacg 193716DNAArtificial Sequencehuman FGE-specific PCR primer 37acatggcccg cgggac 163819DNAArtificial Sequencehuman FGE-specific PCR primer 38cgactgctcc ttggactgg 193924DNAArtificial Sequencehuman FGE-specific PCR primer 39ggaattcggg acaacatggc tgcg 244054DNAArtificial SequenceHA-specific primer 40cccaagctta tgcgtagtca ggcacatcat acggatagtc catggtgggc aggc 544157DNAArtificial Sequencec-myc -specific primer 41cccaagctta caggtcttct tcagaaatca gcttttgttc gtccatggtg ggcaggc 574254DNAArtificial SequenceRGS-His6 - specific primer 42cccaagctta gtgatggtga tggtgatgcg atcctctgtc catggtgggc aggc 544315PRTArtificial Sequencetryptic oligopeptide from a human FGE preparation 43Ser Gln Asn Thr Pro Asp Ser Ser Ala Ser Asn Leu Gly Phe Arg1 5 10 154419PRTArtificial Sequencetryptic oligopeptide from a human FGE preparation 44Met Val Pro Ile Pro Ala Gly Val Phe Thr Met Gly Thr Asp Asp Pro1 5 10 15Gln Ile Lys45906DNAHomo sapiens 45atggcccggc atgggttacc gctgctgccc ctgctgtcgc tcctggtcgg cgcgtggctc 60aagctaggaa atggacaggc tactagcatg gtccaactgc agggtgggag attcctgatg 120ggaacaaatt ctccagacag cagagatggt gaagggcctg tgcgggaggc gacagtgaaa 180ccctttgcca tcgacatatt tcctgtcacc aacaaagatt tcagggattt tgtcagggag 240aaaaagtatc ggacagaagc tgagatgttt ggatggagct ttgtctttga ggactttgtc 300tctgatgagc tgagaaacaa agccacccag ccaatgaagt ctgtactctg gtggcttcca 360gtggaaaagg cattttggag gcagcctgca ggtcctggct ctggcatccg agagagactg 420gagcacccag tgttacacgt gagctggaat gacgcccgtg cctactgtgc ttggcgggga 480aaacgactgc ccacggagga agagtgggag tttgccgccc gagggggctt gaagggtcaa 540gtttacccat gggggaactg gttccagcca aaccgcacca acctgtggca gggaaagttc 600cccaagggag acaaagctga ggatggcttc catggagtct ccccagtgaa tgctttcccc 660gcccagaaca actacgggct ctatgacctc ctggggaacg tgtgggagtg gacagcatca 720ccgtaccagg ctgctgagca ggacatgcgc gtcctccggg gggcatcctg gatcgacaca 780gctgatggct ctgccaatca ccgggcccgg gtcaccacca ggatgggcaa cactccagat 840tcagcctcag acaacctcgg tttccgctgt gctgcagacg caggccggcc gccaggggag 900ctgtaa 90646301PRTHomo sapiens 46Met Ala Arg His Gly Leu Pro Leu Leu Pro Leu Leu Ser Leu Leu Val1 5 10 15Gly Ala Trp Leu Lys Leu Gly Asn Gly Gln Ala Thr Ser Met Val Gln 20 25 30Leu Gln Gly Gly Arg Phe Leu Met Gly Thr Asn Ser Pro Asp Ser Arg 35 40 45Asp Gly Glu Gly Pro Val Arg Glu Ala Thr Val Lys Pro Phe Ala Ile 50 55 60Asp Ile Phe Pro Val Thr Asn Lys Asp Phe Arg Asp Phe Val Arg Glu65 70 75 80Lys Lys Tyr Arg Thr Glu Ala Glu Met Phe Gly Trp Ser Phe Val Phe 85 90 95Glu Asp Phe Val Ser Asp Glu Leu Arg Asn Lys Ala Thr Gln Pro Met 100 105 110Lys Ser Val Leu Trp Trp Leu Pro Val Glu Lys Ala Phe Trp Arg Gln 115 120 125Pro Ala Gly Pro Gly Ser Gly Ile Arg Glu Arg Leu Glu His Pro Val 130 135 140Leu His Val Ser Trp Asn Asp Ala Arg Ala Tyr Cys Ala Trp Arg Gly145 150 155 160Lys Arg Leu Pro Thr Glu Glu Glu Trp Glu Phe Ala Ala Arg Gly Gly 165 170 175Leu Lys Gly Gln Val Tyr Pro Trp Gly Asn Trp Phe Gln Pro Asn Arg 180 185 190Thr Asn Leu Trp Gln Gly Lys Phe Pro Lys Gly Asp Lys Ala Glu Asp 195 200 205Gly Phe His Gly Val Ser Pro Val Asn Ala Phe Pro Ala Gln Asn Asn 210 215 220Tyr Gly Leu Tyr Asp Leu Leu Gly Asn Val Trp Glu Trp Thr Ala Ser225 230 235 240Pro Tyr Gln Ala Ala Glu Gln Asp Met Arg Val Leu Arg Gly Ala Ser 245 250 255Trp Ile Asp Thr Ala Asp Gly Ser Ala Asn His Arg Ala Arg Val Thr 260 265 270Thr Arg Met Gly Asn Thr Pro Asp Ser Ala Ser Asp Asn Leu Gly Phe 275 280 285Arg Cys Ala Ala Asp Ala Gly Arg Pro Pro Gly Glu Leu 290 295 30047927DNAMus musculus 47atgcgctctg agttctggtt ccccagcatg ggttccttgc tccctccggt gttgctgctg 60aggctcctgt cctgccccag gcttcagcta ggacatgccc aggatcctgc catggtgcat 120ctgccaggtg gccggtttct gatggggaca gacgctccag atggcagaga cggtgaaggg 180cctgcccggg aagtgacagt aaaacccttt gccatcgaca tatttccagt caccaataaa 240gacttcaggg agtttgtcag ggagaagaag taccagactg aagccgaggc attcgggtgg 300agcttcgtct ttgaggattt tgtctcccct gagctcagaa agcaagaaaa tctgatgccg 360gctgttcact ggtggcagcc agtgccaaag gcattttgga ggcagcctgc aggtcccggc 420tctggcatcc gagagaaact ggagcttccc gtggtacacg tgagctggaa cgacgctggt 480gcttactgcg catggcgggg gagacgcttg cccacagaag aggagtggga gtttgcagcc 540cgagggggct tgaagggtca ggtttatcca tgggggaacc ggttccagcc aaaccgcacc 600aacttatggc agggaaagtt ccccaaaggt gacaaagctg aagatggttt tcatggactg 660tcaccagtga acgctttccc cccacagaac aactacggac tgtatgacct catgggcaat 720gtgtgggagt ggacagcgtc cacataccaa cctgctggcc aggacatgcg tgtcctccgg 780ggggcatcat ggatcgacac cgcagacggc tctgctaatc acagggctcg ggtcaccacc 840aggatgggaa acactccaga ctcagcctca gacaacctgg gcttccgctg cgcctccagt 900gcaggccgac cgaaggagga cctgtga 92748308PRTMus musculus 48Met Arg Ser Glu Phe Trp Phe Pro Ser Met Gly Ser Leu Leu Pro Pro1 5 10 15Val Leu Leu Leu Arg Leu Leu Ser Cys Pro Arg Leu Gln Leu Gly His 20 25 30Ala Gln Asp Pro Ala Met Val His Leu Pro Gly Gly Arg Phe Leu Met 35 40 45Gly Thr Asp Ala Pro Asp Gly Arg Asp Gly Glu Gly Pro Ala Arg Glu 50 55 60Val Thr Val Lys Pro Phe Ala Ile Asp Ile Phe Pro Val Thr Asn Lys65 70 75 80Asp Phe Arg Glu Phe Val Arg Glu Lys Lys Tyr Gln Thr Glu Ala Glu 85 90 95Ala Phe Gly Trp Ser Phe Val Phe Glu Asp Phe Val Ser Pro Glu Leu 100 105 110Arg Lys Gln Glu Asn Leu Met Pro Ala Val His Trp Trp Gln Pro Val 115 120 125Pro Lys Ala Phe Trp Arg Gln Pro Ala Gly Pro Gly Ser Gly Ile Arg 130 135 140Glu Lys Leu Glu Leu Pro Val Val His Val Ser Trp Asn Asp Ala Gly145 150 155 160Ala Tyr Cys Ala Trp Arg Gly Arg Arg Leu Pro Thr Glu Glu Glu Trp 165 170 175Glu Phe Ala Ala Arg Gly Gly Leu Lys Gly Gln Val Tyr Pro Trp Gly 180 185 190Asn Arg Phe Gln Pro Asn Arg Thr Asn Leu Trp Gln Gly Lys Phe Pro 195 200 205Lys Gly Asp Lys Ala Glu Asp Gly Phe His Gly Leu Ser Pro Val Asn 210 215 220Ala Phe Pro Pro Gln Asn Asn Tyr Gly Leu Tyr Asp Leu Met Gly Asn225 230 235 240Val Trp Glu Trp Thr Ala Ser Thr Tyr Gln Pro Ala Gly Gln Asp Met 245 250 255Arg Val Leu Arg Gly Ala Ser Trp Ile Asp Thr Ala Asp Gly Ser Ala 260 265 270Asn His Arg Ala Arg Val Thr Thr Arg Met Gly Asn Thr Pro Asp Ser 275 280 285Ala Ser Asp Asn Leu Gly Phe Arg Cys Ala Ser Ser Ala Gly Arg Pro 290 295 300Lys Glu Asp Leu30549855DNAMus musculus 49atggtcccca ttcctgctgg agtattcaca atgggcactg atgatcctca gatcaggcag 60gatggagaag cccctgccag gagagtcact gttgatggct tttacatgga cgcctatgaa 120gtcagcaatg cggattttga gaagtttgtg aactcgactg gctatttgac agaggctgag 180aagtttggag actctttcgt ctttgaaggc atgttgagcg agcaagtgaa aacgcatatc 240caccaggcag ttgcagctgc tccatggtgg ttgcctgtca agggagctaa ttggagacac 300ccagagggtc cggactccag tattctgcac aggtcaaatc atccggttct ccatgtttcc 360tggaacgatg ctgttgccta ctgcacatgg gcgggcaaga ggttgcctac tgaggcagag 420tgggaataca gctgtagagg aggcctgcag aacaggcttt tcccctgggg caacaaactg 480cagcccaaag gacagcatta tgccaacatc tggcagggca agtttcctgt gagcaacact 540ggcgaggatg gcttccaagg aactgccccc gttgatgcct ttcctcccaa tggctatggc 600ttatacaaca tagtggggaa tgtgtgggag tggacctcag actggtggac tgttcaccat 660tctgttgagg aaacgttcaa cccaaagggt cccacttctg ggaaagaccg agtgaagaag 720ggtggatcct acatgtgcca taagtcctat tgctataggt accgctgtgc agctcgaagc 780cagaacacac cagatagctc tgcatccaac ctgggattcc gatgtgcagc cgaccacctg 840cccaccgcag actga 85550284PRTMus musculus 50Met Val Pro Ile Pro Ala Gly Val Phe Thr Met Gly Thr Asp Asp Pro1 5 10 15Gln Ile Arg Gln Asp Gly Glu Ala Pro Ala Arg Arg Val Thr Val Asp 20 25 30Gly Phe Tyr Met Asp Ala Tyr Glu Val Ser Asn Ala Asp Phe Glu Lys 35 40 45Phe Val Asn Ser Thr Gly Tyr Leu Thr Glu Ala Glu Lys Phe Gly Asp 50 55 60Ser Phe Val Phe Glu Gly Met Leu Ser Glu Gln Val Lys Thr His Ile65 70 75 80His Gln Ala Val Ala Ala Ala Pro Trp Trp Leu Pro Val Lys Gly Ala 85 90 95Asn Trp Arg His Pro Glu Gly Pro Asp Ser Ser Ile Leu His Arg Ser 100 105 110Asn His Pro Val Leu His Val Ser Trp Asn Asp Ala Val Ala Tyr Cys 115 120 125Thr Trp Ala Gly Lys Arg Leu Pro Thr Glu Ala Glu Trp Glu Tyr Ser 130 135 140Cys Arg Gly Gly Leu Gln Asn Arg Leu Phe Pro Trp Gly Asn Lys Leu145 150 155 160Gln Pro Lys Gly Gln His Tyr Ala Asn Ile Trp Gln Gly Lys Phe Pro 165 170 175Val Ser Asn Thr Gly Glu Asp Gly Phe Gln Gly Thr Ala Pro Val Asp 180 185 190Ala Phe Pro Pro Asn Gly Tyr Gly Leu Tyr Asn Ile Val Gly Asn Val 195 200 205Trp Glu Trp Thr Ser Asp Trp Trp Thr Val His His Ser Val Glu Glu 210 215 220Thr Phe Asn Pro Lys Gly Pro Thr Ser Gly Lys Asp Arg Val Lys Lys225 230 235 240Gly Gly Ser Tyr Met Cys His Lys Ser Tyr Cys Tyr Arg Tyr Arg Cys 245 250 255Ala Ala Arg Ser Gln Asn Thr Pro Asp Ser Ser Ala Ser Asn Leu Gly 260 265 270Phe Arg Cys Ala Ala Asp His Leu Pro Thr Ala Asp 275 280511011DNADrosophila melanogaster 51atgacaacaa ttatattagt cctctttatt tggatagttt tattcaatga cgtatccagc 60gactgtggct gccaaaagct cgaccggaag gccccggata tgccgtccat ttccggacaa 120gtgtgccagc aacgagcaca gggtgcacac agccactacc gggattacta tggcgaactg 180gagccaaata ttgcggacat gtcactgctt ccgggaggca cggtttacat gggtactgac 240aaaccgcact ttccggccga ccgcgaggct ccggaacggc aggtgaagct gaatgacttc 300tacatcgaca agtatgaggt ttccaacgaa gcctttgcga agtttgttct gcacactaac 360tacaccacgg aggctgagcg atatggcgac agttttctgt ttaagagcct tttgagccca 420ttggagcaga agaacctaga ggacttccga gtggcgagcg ctgtctggtg gtacaaagtg 480gccggcgtga actggcgaca tccaaatggc gtggacagcg atatagacca cttaggccga 540cacccggtag tgcacgtatc gtggcgcgac gctgtggagt actgtaagtg ggccggcaag 600cggttgccca gcgaggcgga gtgggaggcg gcttgcaggg gcggcaagga gcgcaaactg 660tttccctggg gcaacaagct gatgccaagg aatgaacatt ggctgaacat ctggcaggga 720gactttcccg atggcaacct ggctgaagat gggtttgagt acaccagccc cgtggatgcc 780ttccgacaga atatttacga cctgcacaac atggtgggca acgtctggga gtggacggca 840gatctgtggg acgtaaatga cgttagcgat aatccaaatc gggtcaagaa gggcggttct 900tatctgtgtc acaagtccta ctgctacagg tacaggtgcg cggcacgctc gcagaacaca 960gaagacagtt cagccggtaa cctgggtttt cggtgcgcca agaatgcgtg a 101152336PRTDrosophila melanogaster 52Met Thr Thr Ile Ile Leu Val Leu Phe Ile Trp Ile Val Leu Phe Asn1 5 10 15Asp Val Ser Ser Asp Cys Gly Cys Gln Lys Leu Asp Arg Lys Ala Pro 20 25 30Asp Met Pro Ser Ile Ser Gly Gln Val Cys Gln Gln Arg Ala Gln Gly 35 40 45Ala His Ser His Tyr Arg Asp Tyr Tyr Gly Glu Leu Glu Pro Asn Ile 50 55 60Ala Asp Met Ser Leu Leu Pro Gly Gly Thr Val Tyr Met Gly Thr Asp65 70 75 80Lys Pro His Phe Pro Ala Asp Arg Glu Ala Pro Glu Arg Gln Val Lys 85 90 95Leu Asn Asp Phe Tyr Ile Asp Lys Tyr Glu Val Ser Asn Glu Ala Phe 100 105 110Ala Lys Phe Val Leu His Thr Asn Tyr Thr Thr Glu Ala Glu Arg Tyr 115 120 125Gly Asp Ser Phe Leu Phe Lys Ser Leu Leu Ser Pro Leu Glu Gln Lys 130 135 140Asn Leu Glu Asp Phe Arg Val Ala Ser Ala Val Trp Trp Tyr Lys Val145 150 155 160Ala Gly Val Asn Trp Arg His Pro Asn Gly Val Asp Ser Asp Ile Asp 165 170 175His Leu Gly Arg His Pro Val Val His Val Ser Trp Arg Asp Ala Val 180 185 190Glu Tyr Cys Lys Trp Ala Gly Lys Arg Leu Pro Ser Glu Ala Glu Trp 195 200 205Glu Ala Ala Cys Arg Gly Gly Lys Glu Arg Lys Leu Phe Pro Trp Gly 210 215 220Asn Lys Leu Met Pro Arg Asn Glu His Trp Leu Asn Ile Trp Gln Gly225 230 235 240Asp Phe Pro Asp Gly Asn Leu Ala Glu Asp Gly Phe Glu Tyr Thr Ser 245 250 255Pro Val Asp Ala Phe Arg Gln Asn Ile Tyr Asp Leu His Asn Met Val 260 265 270Gly Asn Val Trp Glu Trp Thr Ala Asp Leu Trp Asp Val Asn Asp Val 275 280 285Ser Asp Asn Pro Asn Arg Val Lys Lys Gly Gly Ser Tyr Leu Cys His 290 295 300Lys Ser Tyr Cys Tyr Arg Tyr Arg Cys Ala Ala Arg Ser Gln Asn Thr305 310 315 320Glu Asp Ser Ser Ala Gly Asn Leu Gly Phe Arg Cys Ala Lys Asn Ala 325 330 33553870DNAAnopheles gambiae 53ccggagagct tgctcgatct ggtggaacat tccaagcggt tcgaagacat gagccttatc 60ccaggaggtg aatatgtaat cggcacaaat gaacctatct tcgtcaagga tcgcgaatca 120ccggcccggc ccgcgacgat ccgcgacttt tacctcgacc agtacgaagt ctccaacgca 180cagttcaagg cattcgtcga ccagacgggc tacgtcacgg aggcggaaaa gtttggcgac 240agcttcgtct tccagcagct gctcagcgaa ccggtgcgcc agcagtacga agatttccgc 300gtggcggcgg cgccctggtg gtacaaggta cgtggagcct cctggcagca tccggaaggt 360gatgtgtcac gtgatataag cgaccgattg gaccatccgg tggtgcacgt gtcctggaac 420gatgcggtcg cgtactgcgc ctggaaaggg aagcgcctgc cgacggaagc ggaatgggaa 480gcggcctgcc ggggcggtcg caagcagaag ctgttcccct ggggtaacaa gctgatgccg 540aaggagcagc acatgatgaa catatggcag ggcgagttcc cggacagcaa tctgaaggag 600gatggctacg agaccacctg cccggtgacg tccttccgcc agaacccgtt cgagctgtac 660aacatcgttg gcaacgtgtg ggagtggacg gcggatcttt gggacgcgaa ggatgcggcc 720atcgagcgca agccgggcag cgatccaccg aatcgggtga aaaagggtgg ctcatacctg 780tgtcacgaat cgtactgcta tcgctatcgc

tgtgcggctc gatcgcagaa caccgaggac 840agttcggcgg gcaatctggg cttccggtgc 87054290PRTAnopheles gambiae 54Pro Glu Ser Leu Leu Asp Leu Val Glu His Ser Lys Arg Phe Glu Asp1 5 10 15Met Ser Leu Ile Pro Gly Gly Glu Tyr Val Ile Gly Thr Asn Glu Pro 20 25 30Ile Phe Val Lys Asp Arg Glu Ser Pro Ala Arg Pro Ala Thr Ile Arg 35 40 45Asp Phe Tyr Leu Asp Gln Tyr Glu Val Ser Asn Ala Gln Phe Lys Ala 50 55 60Phe Val Asp Gln Thr Gly Tyr Val Thr Glu Ala Glu Lys Phe Gly Asp65 70 75 80Ser Phe Val Phe Gln Gln Leu Leu Ser Glu Pro Val Arg Gln Gln Tyr 85 90 95Glu Asp Phe Arg Val Ala Ala Ala Pro Trp Trp Tyr Lys Val Arg Gly 100 105 110Ala Ser Trp Gln His Pro Glu Gly Asp Val Ser Arg Asp Ile Ser Asp 115 120 125Arg Leu Asp His Pro Val Val His Val Ser Trp Asn Asp Ala Val Ala 130 135 140Tyr Cys Ala Trp Lys Gly Lys Arg Leu Pro Thr Glu Ala Glu Trp Glu145 150 155 160Ala Ala Cys Arg Gly Gly Arg Lys Gln Lys Leu Phe Pro Trp Gly Asn 165 170 175Lys Leu Met Pro Lys Glu Gln His Met Met Asn Ile Trp Gln Gly Glu 180 185 190Phe Pro Asp Ser Asn Leu Lys Glu Asp Gly Tyr Glu Thr Thr Cys Pro 195 200 205Val Thr Ser Phe Arg Gln Asn Pro Phe Glu Leu Tyr Asn Ile Val Gly 210 215 220Asn Val Trp Glu Trp Thr Ala Asp Leu Trp Asp Ala Lys Asp Ala Ala225 230 235 240Ile Glu Arg Lys Pro Gly Ser Asp Pro Pro Asn Arg Val Lys Lys Gly 245 250 255Gly Ser Tyr Leu Cys His Glu Ser Tyr Cys Tyr Arg Tyr Arg Cys Ala 260 265 270Ala Arg Ser Gln Asn Thr Glu Asp Ser Ser Ala Gly Asn Leu Gly Phe 275 280 285Arg Cys 29055945DNAStreptomyces coelicolor 55gtggccgtgg ccgccccgtc ccccgcggcc gccgcggagc cggggcccgc cgcccgtccg 60cgctcgaccc gcggacaggt gcgcctgccg ggcggtgagt tcgcgatggg ggacgccttc 120ggggagggat atccggccga cggcgagaca cccgtgcaca cggtgcgcct gcggcccttc 180cacatcgacg agaccgccgt caccaacgcc cggttcgccg ccttcgtcaa ggcgaccggc 240catgtgaccg acgccgaacg cttcggctcc tcggccgtct tccacctggt cgtcgccgcc 300ccggacgccg acgtcctcgg cagcgccgcc ggcgccccct ggtggatcaa cgtgcggggc 360gcccactggc gccgccccga gggcgcccgc tccgacatca ccggccggcc gaaccatccg 420gtcgtccacg tctcctggaa cgatgccacc gcctacgcgc ggtgggccgg caagcgcctg 480cccaccgagg ccgaatggga gtacgccgcc cgcgggggac tggccggccg ccgctacgcc 540tggggcgacg agctgacccc gggcggccgg tggcgctgca acatctggca gggccgcttc 600ccgcacgtca acacggccga ggacgggcac ctgagcaccg caccggtcaa gtcctaccgg 660cccaacggcc acggcctgtg gaacaccgcg ggcaacgtgt gggaatggtg ctccgactgg 720ttctcgccca cctactacgc cgaatcaccc accgtcgacc cgcacggccc cgggaccggg 780gcggcacggg tgctgcgcgg cggctcctac ctgtgccacg actcctactg caaccgctac 840cgggtcgccg cccgctcctc caacaccccg gactcctcgt ccggcaacct cggattccgc 900tgcgccaacg acgcggacct cacgtccgga tcagccgctg agtga 94556314PRTStreptomyces coelicolor 56Met Ala Val Ala Ala Pro Ser Pro Ala Ala Ala Ala Glu Pro Gly Pro1 5 10 15Ala Ala Arg Pro Arg Ser Thr Arg Gly Gln Val Arg Leu Pro Gly Gly 20 25 30Glu Phe Ala Met Gly Asp Ala Phe Gly Glu Gly Tyr Pro Ala Asp Gly 35 40 45Glu Thr Pro Val His Thr Val Arg Leu Arg Pro Phe His Ile Asp Glu 50 55 60Thr Ala Val Thr Asn Ala Arg Phe Ala Ala Phe Val Lys Ala Thr Gly65 70 75 80His Val Thr Asp Ala Glu Arg Phe Gly Ser Ser Ala Val Phe His Leu 85 90 95Val Val Ala Ala Pro Asp Ala Asp Val Leu Gly Ser Ala Ala Gly Ala 100 105 110Pro Trp Trp Ile Asn Val Arg Gly Ala His Trp Arg Arg Pro Glu Gly 115 120 125Ala Arg Ser Asp Ile Thr Gly Arg Pro Asn His Pro Val Val His Val 130 135 140Ser Trp Asn Asp Ala Thr Ala Tyr Ala Arg Trp Ala Gly Lys Arg Leu145 150 155 160Pro Thr Glu Ala Glu Trp Glu Tyr Ala Ala Arg Gly Gly Leu Ala Gly 165 170 175Arg Arg Tyr Ala Trp Gly Asp Glu Leu Thr Pro Gly Gly Arg Trp Arg 180 185 190Cys Asn Ile Trp Gln Gly Arg Phe Pro His Val Asn Thr Ala Glu Asp 195 200 205Gly His Leu Ser Thr Ala Pro Val Lys Ser Tyr Arg Pro Asn Gly His 210 215 220Gly Leu Trp Asn Thr Ala Gly Asn Val Trp Glu Trp Cys Ser Asp Trp225 230 235 240Phe Ser Pro Thr Tyr Tyr Ala Glu Ser Pro Thr Val Asp Pro His Gly 245 250 255Pro Gly Thr Gly Ala Ala Arg Val Leu Arg Gly Gly Ser Tyr Leu Cys 260 265 270His Asp Ser Tyr Cys Asn Arg Tyr Arg Val Ala Ala Arg Ser Ser Asn 275 280 285Thr Pro Asp Ser Ser Ser Gly Asn Leu Gly Phe Arg Cys Ala Asn Asp 290 295 300Ala Asp Leu Thr Ser Gly Ser Ala Ala Glu305 310571005DNACorynebacterium efficiens 57gtggttcgcc atcgactggg ccaccggccc tgcacactga ggattacgtc catgagtaac 60tgctgctccc cgtcaagcgc acaatggcgt accactaccc gggatttatc agatcctgtc 120aatcccacca ctccatgcaa cccggaacaa tcccgcgatg ctgtgacact gccgggtgga 180gctttccaca tgggcgatca tcacggggag gggtacccgg cggacgggga ggggccagta 240catgaggttc acctcgcccc cttcggcatt aatgtcacca cggtcacgaa tgccgagttc 300ggacgattta ttgaagccac agggtatacg acgacagcgg aacgctacgg tgtctcggct 360gtattctacg cagcgttcca agggcaacgc gctgacattc ttcgccaggt tcccggcgtg 420ccctggtggc tggcggtcaa gggtgcgaac tggcagcgtc ccaacggccc cggatccacc 480ctggacgggc ttgaggacca ccccgtcgtt cacgtttcct gggatgatgc cgttgcctac 540tgcacctggg ctggcggtcg tctgcccacc gaagccgagt gggaatacgc cgcccggggt 600ggactgcagg gcgcacgata tgcctggggg gataacctcg ccctagacgg gaggtggaac 660tgcaatatct ggcagggggg cttccccatg gagaacaccg ccgcggatgg ttacctcacc 720actgcaccgg tgaagaccta cacgcccaat ggatacggtc tgtggcagat ggcagggaat 780gtatgggaat ggtgccagga ctggtttgat gcggagtact actcccgtgc ttcctccatc 840aacccgcggg gaccggatac cggtgcgcgc cgggtgatgc gcggaggctc gtatctctgc 900catgattcct actgcaacag ataccgggtg gccgcccgca attcgaacac cccggattcc 960acctcgggga ataccggttt ccggtgcgtt ttcgatagtc cttga 100558334PRTCorynebacterium efficiens 58Met Val Arg His Arg Leu Gly His Arg Pro Cys Thr Leu Arg Ile Thr1 5 10 15Ser Met Ser Asn Cys Cys Ser Pro Ser Ser Ala Gln Trp Arg Thr Thr 20 25 30Thr Arg Asp Leu Ser Asp Pro Val Asn Pro Thr Thr Pro Cys Asn Pro 35 40 45Glu Gln Ser Arg Asp Ala Val Thr Leu Pro Gly Gly Ala Phe His Met 50 55 60Gly Asp His His Gly Glu Gly Tyr Pro Ala Asp Gly Glu Gly Pro Val65 70 75 80His Glu Val His Leu Ala Pro Phe Gly Ile Asn Val Thr Thr Val Thr 85 90 95Asn Ala Glu Phe Gly Arg Phe Ile Glu Ala Thr Gly Tyr Thr Thr Thr 100 105 110Ala Glu Arg Tyr Gly Val Ser Ala Val Phe Tyr Ala Ala Phe Gln Gly 115 120 125Gln Arg Ala Asp Ile Leu Arg Gln Val Pro Gly Val Pro Trp Trp Leu 130 135 140Ala Val Lys Gly Ala Asn Trp Gln Arg Pro Asn Gly Pro Gly Ser Thr145 150 155 160Leu Asp Gly Leu Glu Asp His Pro Val Val His Val Ser Trp Asp Asp 165 170 175Ala Val Ala Tyr Cys Thr Trp Ala Gly Gly Arg Leu Pro Thr Glu Ala 180 185 190Glu Trp Glu Tyr Ala Ala Arg Gly Gly Leu Gln Gly Ala Arg Tyr Ala 195 200 205Trp Gly Asp Asn Leu Ala Leu Asp Gly Arg Trp Asn Cys Asn Ile Trp 210 215 220Gln Gly Gly Phe Pro Met Glu Asn Thr Ala Ala Asp Gly Tyr Leu Thr225 230 235 240Thr Ala Pro Val Lys Thr Tyr Thr Pro Asn Gly Tyr Gly Leu Trp Gln 245 250 255Met Ala Gly Asn Val Trp Glu Trp Cys Gln Asp Trp Phe Asp Ala Glu 260 265 270Tyr Tyr Ser Arg Ala Ser Ser Ile Asn Pro Arg Gly Pro Asp Thr Gly 275 280 285Ala Arg Arg Val Met Arg Gly Gly Ser Tyr Leu Cys His Asp Ser Tyr 290 295 300Cys Asn Arg Tyr Arg Val Ala Ala Arg Asn Ser Asn Thr Pro Asp Ser305 310 315 320Thr Ser Gly Asn Thr Gly Phe Arg Cys Val Phe Asp Ser Pro 325 330591017DNANovosphingobium aromaticivorans 59atggcgcaac cattccgatc gacggcggcc agtcgtacaa gtattgaacg ccatctcgaa 60cccaattgca ggagcacgtc gcgaatggtc gaacgccccg gcatgcgcct gatcgaaggc 120ggcactttca ccatgggctc ggaagccttc tacccggagg aagcgccgct tcgccgggtg 180aaggtagaca gcttctggat cgatgaagcg ccggtgacga acgcacagtt cgccgcattc 240gtggaggcca cgggatacgt cactgtggcc gagatcgagc cggatcccaa ggactacccc 300ggcatgctcc cgggcatgga ccgcgcggga tcgctggtgt tccagaaaac agcagggccg 360gtcgacatgg cggatgcgtc caactggtgg cactttacct ttggcgcctg ctggaagcat 420ccacttggac cgggcagttc catcgatggg atcgaggacc atcccgtcgt tcacgtcgcc 480tatgccgatg ccgaggccta tgccaaatgg gcgggcaagg atctgccgac cgaagccgag 540ttcgaatatg ctgcgcgcgg cgggttggac ggttccgaat tttcctgggg agacgaactc 600gcacctgaag gccggatgat ggccaactac tggcaaggcc tgtttccctt cgccaaccag 660tgcctcgatg gctgggaacg gacatcgccc gtccgcaact tcccgcccaa cggctatggt 720ctttacgaca tgatcgggaa cacgtgggag tggacctgcg attggtgggc cgacaagccg 780ctgactccgc aaaggaaatc ggcatgctgc gcgatcagca atccgcgcgg cggcaagctc 840aaggacagct tcgacccgtc gcaacccgca atgcgcatcg gccggaaggt cataaagggc 900ggttcgcacc tgtgtgcggc caattactgc cagcgctatc gccccgcagc acgccatcct 960gaaatggttg ataccgcgac gacgcacatc ggcttcaggt gtgtggtgcg gccctga 101760338PRTNovosphingobium aromaticivorans 60Met Ala Gln Pro Phe Arg Ser Thr Ala Ala Ser Arg Thr Ser Ile Glu1 5 10 15Arg His Leu Glu Pro Asn Cys Arg Ser Thr Ser Arg Met Val Glu Arg 20 25 30Pro Gly Met Arg Leu Ile Glu Gly Gly Thr Phe Thr Met Gly Ser Glu 35 40 45Ala Phe Tyr Pro Glu Glu Ala Pro Leu Arg Arg Val Lys Val Asp Ser 50 55 60Phe Trp Ile Asp Glu Ala Pro Val Thr Asn Ala Gln Phe Ala Ala Phe65 70 75 80Val Glu Ala Thr Gly Tyr Val Thr Val Ala Glu Ile Glu Pro Asp Pro 85 90 95Lys Asp Tyr Pro Gly Met Leu Pro Gly Met Asp Arg Ala Gly Ser Leu 100 105 110Val Phe Gln Lys Thr Ala Gly Pro Val Asp Met Ala Asp Ala Ser Asn 115 120 125Trp Trp His Phe Thr Phe Gly Ala Cys Trp Lys His Pro Leu Gly Pro 130 135 140Gly Ser Ser Ile Asp Gly Ile Glu Asp His Pro Val Val His Val Ala145 150 155 160Tyr Ala Asp Ala Glu Ala Tyr Ala Lys Trp Ala Gly Lys Asp Leu Pro 165 170 175Thr Glu Ala Glu Phe Glu Tyr Ala Ala Arg Gly Gly Leu Asp Gly Ser 180 185 190Glu Phe Ser Trp Gly Asp Glu Leu Ala Pro Glu Gly Arg Met Met Ala 195 200 205Asn Tyr Trp Gln Gly Leu Phe Pro Phe Ala Asn Gln Cys Leu Asp Gly 210 215 220Trp Glu Arg Thr Ser Pro Val Arg Asn Phe Pro Pro Asn Gly Tyr Gly225 230 235 240Leu Tyr Asp Met Ile Gly Asn Thr Trp Glu Trp Thr Cys Asp Trp Trp 245 250 255Ala Asp Lys Pro Leu Thr Pro Gln Arg Lys Ser Ala Cys Cys Ala Ile 260 265 270Ser Asn Pro Arg Gly Gly Lys Leu Lys Asp Ser Phe Asp Pro Ser Gln 275 280 285Pro Ala Met Arg Ile Gly Arg Lys Val Ile Lys Gly Gly Ser His Leu 290 295 300Cys Ala Ala Asn Tyr Cys Gln Arg Tyr Arg Pro Ala Ala Arg His Pro305 310 315 320Glu Met Val Asp Thr Ala Thr Thr His Ile Gly Phe Arg Cys Val Val 325 330 335Arg Pro611119DNAMesorhizobium loti 61atgggcccac gaggtcgagg tcaaaaaccg catgaaaggc gacgcggtca tgttcgacat 60tgccgggaag ttctagccga tagcgggtgg gcggctgatg gagatgagca cgccgtgtca 120tttcgggatc tttcgatgaa cgcccctgcc gaagtcttcg agcgcgctgc agccgaacgg 180tcgtaccccg gaatggtctg gatccccggc ggtaccttcc tgatgggctc agacaaccac 240tatccggagg aggcaccggc ccaccgggtc agggtcgacg gcttctggat ggacaaattc 300accgtctcca accgcgactt cgaacgcttc gttgcggcga caggacatgt cactcttgcc 360gagaaacccg ccaatcccga cgactatccc ggtgccttac ccgatctgct ggctccgtcc 420tcgatgatgt tcaggaagcc ggccggccct gtcgaccttg gcaatcacta caattggtgg 480gtctatgtcc gcggcgccaa ctggcgccat ccacgcgggc cggcaagtac aatcaagaag 540gttgcagatc atccggtcgt gcatgtggcc tacgaggatg tcgtggccta tgccaactgg 600gcaggcaagg aacttcccac cgaggccgag tgggaattcg cggcgcgagg cggcctcgat 660gccgccgaat acgtctgggg caacgagctt acgccggccg ggaagcacat ggccaacatc 720tggcaaggag actttcccta ccggaatact gtcgacgacg gttacgaata tacggcccca 780gtaggctcgt tcccggccaa cgactacggt ctctacgaca tggccggcaa tgtctggcaa 840tggacgaccg actggtacca ggaccacaag gcgatcgaca gcccgtgctg caccgctgtc 900aatccgcgtg gcggccatcg cgaagcgagc tatgacaccc ggctacctga cgttaagatc 960cctcgcaagg tcaccaaggg tggctcccat ctgtgcgcgc cgaactactg tcggcgctac 1020cggcccgcgg cgcgaatggc gcaacccgtc gacactgcaa tctcccatct cggctttcgc 1080tgcatcgtgc gaaggaaaat ggaattgaac gcgcagtaa 111962372PRTMesorhizobium loti 62Met Gly Pro Arg Gly Arg Gly Gln Lys Pro His Glu Arg Arg Arg Gly1 5 10 15His Val Arg His Cys Arg Glu Val Leu Ala Asp Ser Gly Trp Ala Ala 20 25 30Asp Gly Asp Glu His Ala Val Ser Phe Arg Asp Leu Ser Met Asn Ala 35 40 45Pro Ala Glu Val Phe Glu Arg Ala Ala Ala Glu Arg Ser Tyr Pro Gly 50 55 60Met Val Trp Ile Pro Gly Gly Thr Phe Leu Met Gly Ser Asp Asn His65 70 75 80Tyr Pro Glu Glu Ala Pro Ala His Arg Val Arg Val Asp Gly Phe Trp 85 90 95Met Asp Lys Phe Thr Val Ser Asn Arg Asp Phe Glu Arg Phe Val Ala 100 105 110Ala Thr Gly His Val Thr Leu Ala Glu Lys Pro Ala Asn Pro Asp Asp 115 120 125Tyr Pro Gly Ala Leu Pro Asp Leu Leu Ala Pro Ser Ser Met Met Phe 130 135 140Arg Lys Pro Ala Gly Pro Val Asp Leu Gly Asn His Tyr Asn Trp Trp145 150 155 160Val Tyr Val Arg Gly Ala Asn Trp Arg His Pro Arg Gly Pro Ala Ser 165 170 175Thr Ile Lys Lys Val Ala Asp His Pro Val Val His Val Ala Tyr Glu 180 185 190Asp Val Val Ala Tyr Ala Asn Trp Ala Gly Lys Glu Leu Pro Thr Glu 195 200 205Ala Glu Trp Glu Phe Ala Ala Arg Gly Gly Leu Asp Ala Ala Glu Tyr 210 215 220Val Trp Gly Asn Glu Leu Thr Pro Ala Gly Lys His Met Ala Asn Ile225 230 235 240Trp Gln Gly Asp Phe Pro Tyr Arg Asn Thr Val Asp Asp Gly Tyr Glu 245 250 255Tyr Thr Ala Pro Val Gly Ser Phe Pro Ala Asn Asp Tyr Gly Leu Tyr 260 265 270Asp Met Ala Gly Asn Val Trp Gln Trp Thr Thr Asp Trp Tyr Gln Asp 275 280 285His Lys Ala Ile Asp Ser Pro Cys Cys Thr Ala Val Asn Pro Arg Gly 290 295 300Gly His Arg Glu Ala Ser Tyr Asp Thr Arg Leu Pro Asp Val Lys Ile305 310 315 320Pro Arg Lys Val Thr Lys Gly Gly Ser His Leu Cys Ala Pro Asn Tyr 325 330 335Cys Arg Arg Tyr Arg Pro Ala Ala Arg Met Ala Gln Pro Val Asp Thr 340 345 350Ala Ile Ser His Leu Gly Phe Arg Cys Ile Val Arg Arg Lys Met Glu 355 360 365Leu Asn Ala Gln 370631251DNABurkholderia fungorum 63atgaagagtg aaagagatcg agagcccgca aagtcgtccc gctcgaacgg gtcggtcgca 60gcaacccaaa cgcgcgccgg tcgcgtgcgc aaactaatgt tgtggggcgc cctgctcgtc 120atactgcccg cctgtgtcgg cgccgcggtc agttgggcct tcacgccgca cgcacccgct 180cacccgcaaa tcgttttcgg cgacggcacg catggtccgc tcggcatggc gtgggtgccc 240ggcggccagt tcctcatggg cagcgacgcc aaacaggcgc aaccgaacga acgccccgcg 300cacaaggtca aggtgcacgg cttctggatg gaccgccatc acgtgaccaa cgccgaattc 360cgccgcttcg tcgaagcgac cggctacgtc accacggccg agaagaaacc cgactgggag 420accctgaaag tccagttgcc gcccggcacg ccgcgcccgc ccgagagcgc gatggtggcg 480ggtgcaatgg tgttcgtcgg caccagccgt cccgtgccgc tagacgacta ttcgcagtgg

540tggcgctatg tgcctggcgc taactggcgt catccagccg ggcctgagag caacatcatc 600ggtaaagatg atcaccccgt ggttcaagtg tcctacgaag atgcgcaggc ttatgcgaaa 660tgggccggca agcgtctgcc gaccgaagcc gaatgggaat tcgccgcgcg cggcggcctc 720gaacaggcca cgtatgcgtg gggcgatcag ttctctccca acggcaaaca gatggccaac 780gtctggcagg gccagcagcc gcagtctttc cccgttgtca acccgaaagc gggtggcgcg 840ctcggtacaa gtccggtggg tactttcccg gccaacggct acggcctttc cgacatgacc 900ggcaacgcct ggcagtgggt tgccgactgg tatcgcgcgg atcagttcag gcgtgaggcg 960gtaagcacca gcgcgatcga caatccggtg ggcccgagcg agtcgtggga ccccgcagac 1020cagggcgtgc ccgtcaacgc gcccaagcgt gtcacacgcg gcggttcgtt cctctgcaac 1080gaaatctatt gcctgagcta ccggcccagc gcgagacgcg gcaccgatcc ctacaacagc 1140atgtcgcatc tgggcttccg gctggtgatg gacgaagaca cctggaaaga agccggtgct 1200cgccaggctt cggcgaaagc tgccggcgcg cctggaaccc ctggcggcta g 125164416PRTBurkholderia fungorum 64Met Lys Ser Glu Arg Asp Arg Glu Pro Ala Lys Ser Ser Arg Ser Asn1 5 10 15Gly Ser Val Ala Ala Thr Gln Thr Arg Ala Gly Arg Val Arg Lys Leu 20 25 30Met Leu Trp Gly Ala Leu Leu Val Ile Leu Pro Ala Cys Val Gly Ala 35 40 45Ala Val Ser Trp Ala Phe Thr Pro His Ala Pro Ala His Pro Gln Ile 50 55 60Val Phe Gly Asp Gly Thr His Gly Pro Leu Gly Met Ala Trp Val Pro65 70 75 80Gly Gly Gln Phe Leu Met Gly Ser Asp Ala Lys Gln Ala Gln Pro Asn 85 90 95Glu Arg Pro Ala His Lys Val Lys Val His Gly Phe Trp Met Asp Arg 100 105 110His His Val Thr Asn Ala Glu Phe Arg Arg Phe Val Glu Ala Thr Gly 115 120 125Tyr Val Thr Thr Ala Glu Lys Lys Pro Asp Trp Glu Thr Leu Lys Val 130 135 140Gln Leu Pro Pro Gly Thr Pro Arg Pro Pro Glu Ser Ala Met Val Ala145 150 155 160Gly Ala Met Val Phe Val Gly Thr Ser Arg Pro Val Pro Leu Asp Asp 165 170 175Tyr Ser Gln Trp Trp Arg Tyr Val Pro Gly Ala Asn Trp Arg His Pro 180 185 190Ala Gly Pro Glu Ser Asn Ile Ile Gly Lys Asp Asp His Pro Val Val 195 200 205Gln Val Ser Tyr Glu Asp Ala Gln Ala Tyr Ala Lys Trp Ala Gly Lys 210 215 220Arg Leu Pro Thr Glu Ala Glu Trp Glu Phe Ala Ala Arg Gly Gly Leu225 230 235 240Glu Gln Ala Thr Tyr Ala Trp Gly Asp Gln Phe Ser Pro Asn Gly Lys 245 250 255Gln Met Ala Asn Val Trp Gln Gly Gln Gln Pro Gln Ser Phe Pro Val 260 265 270Val Asn Pro Lys Ala Gly Gly Ala Leu Gly Thr Ser Pro Val Gly Thr 275 280 285Phe Pro Ala Asn Gly Tyr Gly Leu Ser Asp Met Thr Gly Asn Ala Trp 290 295 300Gln Trp Val Ala Asp Trp Tyr Arg Ala Asp Gln Phe Arg Arg Glu Ala305 310 315 320Val Ser Thr Ser Ala Ile Asp Asn Pro Val Gly Pro Ser Glu Ser Trp 325 330 335Asp Pro Ala Asp Gln Gly Val Pro Val Asn Ala Pro Lys Arg Val Thr 340 345 350Arg Gly Gly Ser Phe Leu Cys Asn Glu Ile Tyr Cys Leu Ser Tyr Arg 355 360 365Pro Ser Ala Arg Arg Gly Thr Asp Pro Tyr Asn Ser Met Ser His Leu 370 375 380Gly Phe Arg Leu Val Met Asp Glu Asp Thr Trp Lys Glu Ala Gly Ala385 390 395 400Arg Gln Ala Ser Ala Lys Ala Ala Gly Ala Pro Gly Thr Pro Gly Gly 405 410 41565912DNASinorhizobium meliloti 65atggtctggg ttcccggagc gaccttcatg atggggtcga acgaccatta cccggaggaa 60gcgcccgtgc atccggtaac cgtcgacgga ttctggatcg atgtgacacc ggtaacgaac 120cgccagtttc tcgaattcgt aaatgcgacg gggcatgtga ccttcgcgga aagaaagccg 180cgcgccgaag actatccggg cgctccgcca tccaatctaa gggccggttc gctcgtcttc 240acacccccga agcgaccgct gcagggaacg gatatatcgc agtggtggat attcacgctg 300ggtgccaact ggcggcaccc gctcgggcgc aagagcagca tcggagcgat tctggatcat 360ccggtcgtcc atgtcgctta cagcgacgca aaggcctatg ccgaatgggc cggcaaggac 420ctcccgaccg agaccgagtg ggagctggcg gcccgcggcg gcctcgatgg ggctgaattt 480tcctggggcg gcgagcttgc gccgggcgga aatcacatgg ccaatacttg gcagggaagt 540tttccggtcg agaattctat ggacgatggt ttcgcgcgaa catcgccggt cagattttac 600ccgccgaacg gctacggcct ctacgacatg atcggcaatg tgtgggagtg gaccacggat 660tactggtccg tgcgccaccc ggaagcggcc gccaagcctt gctgcattcc gagcaatccc 720cgcaatgccg atgccgatgc gagtatcgat ccggcggcga gcgtgaaagt tccgcgccgg 780gtgctcaagg gtggatcgca tctctgcgcg ccgaactact gccggcggta ccgccctgcg 840gcgaggcacg cccaggaaat cgacacgacg accagccatg tcggtttccg atgtgtcagg 900cgcgttcgat aa 91266303PRTSinorhizobium meliloti 66Met Val Trp Val Pro Gly Ala Thr Phe Met Met Gly Ser Asn Asp His1 5 10 15Tyr Pro Glu Glu Ala Pro Val His Pro Val Thr Val Asp Gly Phe Trp 20 25 30Ile Asp Val Thr Pro Val Thr Asn Arg Gln Phe Leu Glu Phe Val Asn 35 40 45Ala Thr Gly His Val Thr Phe Ala Glu Arg Lys Pro Arg Ala Glu Asp 50 55 60Tyr Pro Gly Ala Pro Pro Ser Asn Leu Arg Ala Gly Ser Leu Val Phe65 70 75 80Thr Pro Pro Lys Arg Pro Leu Gln Gly Thr Asp Ile Ser Gln Trp Trp 85 90 95Ile Phe Thr Leu Gly Ala Asn Trp Arg His Pro Leu Gly Arg Lys Ser 100 105 110Ser Ile Gly Ala Ile Leu Asp His Pro Val Val His Val Ala Tyr Ser 115 120 125Asp Ala Lys Ala Tyr Ala Glu Trp Ala Gly Lys Asp Leu Pro Thr Glu 130 135 140Thr Glu Trp Glu Leu Ala Ala Arg Gly Gly Leu Asp Gly Ala Glu Phe145 150 155 160Ser Trp Gly Gly Glu Leu Ala Pro Gly Gly Asn His Met Ala Asn Thr 165 170 175Trp Gln Gly Ser Phe Pro Val Glu Asn Ser Met Asp Asp Gly Phe Ala 180 185 190Arg Thr Ser Pro Val Arg Phe Tyr Pro Pro Asn Gly Tyr Gly Leu Tyr 195 200 205Asp Met Ile Gly Asn Val Trp Glu Trp Thr Thr Asp Tyr Trp Ser Val 210 215 220Arg His Pro Glu Ala Ala Ala Lys Pro Cys Cys Ile Pro Ser Asn Pro225 230 235 240Arg Asn Ala Asp Ala Asp Ala Ser Ile Asp Pro Ala Ala Ser Val Lys 245 250 255Val Pro Arg Arg Val Leu Lys Gly Gly Ser His Leu Cys Ala Pro Asn 260 265 270Tyr Cys Arg Arg Tyr Arg Pro Ala Ala Arg His Ala Gln Glu Ile Asp 275 280 285Thr Thr Thr Ser His Val Gly Phe Arg Cys Val Arg Arg Val Arg 290 295 300671065DNAMicroscilla sp. 67atgaaataca tttttttagt tcttttctta tgggccttga cccgatgtac cggaaagtat 60gaggacaaga gagtggaaac tgatacttcc agaccaaaag ccgaagcgtc agatataaaa 120gttcccgaag gaatggctta tattcccgcg ggccagtaca tgatgggagg taaatcagac 180caggcttata aggatgaata tccccgccat aacgtgaagg tttcggcttt ttatatggac 240cttacagaag tgaccaatgc ggagtttaag cggtttgtag acgaaacggg ctacgtgacc 300attgctgaga aagatattga ctgggaagag ttaaagtctc aggtgccaca gggtaccccg 360aagcctcctg attctgtgct tcaggcaggt tcactggttt tcaagcagac agatgaaccc 420gtttctctcc aggattattc acagtggtgg gaatggacta tcggagccaa ctggcgaaat 480ccggagggtc caggtagtac gattgaggat cgtatggatc atccggtggt acacgtttcc 540tttgaagatg tccaagcgta tgcggattgg gccggtaagc gcctgcctac tgaggcagaa 600tgggaatggg ccgccatggg aggccaaaat gacgtgaaat atccatgggg aaatgaatcg 660gtcgaacaag catccgataa agcaaacttt tggcagggga attttccaca tcaaaactat 720gccctcgatg gattcgaacg caccgcccct gtacgctcct tcccagcgaa tgggtacggc 780ctatatgata tggctggcaa tgtgtgggaa tggtgccagg ataagtatga tgtcaatgct 840tatgaaagct ataagcaaaa aggactgaca gaagacccca cgggttctga gcactacaac 900gaccctaggg aaccgtatac tcctaagcat gtgatcagag ggggttcttt cctatgcaat 960gacagctact gtagtgggta tcgtgtttca cgtcgtatga gttccagtag agattcaggt 1020tttaatcata cgggattcag gtgtgtgaaa gatgtaaatg gatag 106568354PRTMicroscilla sp. 68Met Lys Tyr Ile Phe Leu Val Leu Phe Leu Trp Ala Leu Thr Arg Cys1 5 10 15Thr Gly Lys Tyr Glu Asp Lys Arg Val Glu Thr Asp Thr Ser Arg Pro 20 25 30Lys Ala Glu Ala Ser Asp Ile Lys Val Pro Glu Gly Met Ala Tyr Ile 35 40 45Pro Ala Gly Gln Tyr Met Met Gly Gly Lys Ser Asp Gln Ala Tyr Lys 50 55 60Asp Glu Tyr Pro Arg His Asn Val Lys Val Ser Ala Phe Tyr Met Asp65 70 75 80Leu Thr Glu Val Thr Asn Ala Glu Phe Lys Arg Phe Val Asp Glu Thr 85 90 95Gly Tyr Val Thr Ile Ala Glu Lys Asp Ile Asp Trp Glu Glu Leu Lys 100 105 110Ser Gln Val Pro Gln Gly Thr Pro Lys Pro Pro Asp Ser Val Leu Gln 115 120 125Ala Gly Ser Leu Val Phe Lys Gln Thr Asp Glu Pro Val Ser Leu Gln 130 135 140Asp Tyr Ser Gln Trp Trp Glu Trp Thr Ile Gly Ala Asn Trp Arg Asn145 150 155 160Pro Glu Gly Pro Gly Ser Thr Ile Glu Asp Arg Met Asp His Pro Val 165 170 175Val His Val Ser Phe Glu Asp Val Gln Ala Tyr Ala Asp Trp Ala Gly 180 185 190Lys Arg Leu Pro Thr Glu Ala Glu Trp Glu Trp Ala Ala Met Gly Gly 195 200 205Gln Asn Asp Val Lys Tyr Pro Trp Gly Asn Glu Ser Val Glu Gln Ala 210 215 220Ser Asp Lys Ala Asn Phe Trp Gln Gly Asn Phe Pro His Gln Asn Tyr225 230 235 240Ala Leu Asp Gly Phe Glu Arg Thr Ala Pro Val Arg Ser Phe Pro Ala 245 250 255Asn Gly Tyr Gly Leu Tyr Asp Met Ala Gly Asn Val Trp Glu Trp Cys 260 265 270Gln Asp Lys Tyr Asp Val Asn Ala Tyr Glu Ser Tyr Lys Gln Lys Gly 275 280 285Leu Thr Glu Asp Pro Thr Gly Ser Glu His Tyr Asn Asp Pro Arg Glu 290 295 300Pro Tyr Thr Pro Lys His Val Ile Arg Gly Gly Ser Phe Leu Cys Asn305 310 315 320Asp Ser Tyr Cys Ser Gly Tyr Arg Val Ser Arg Arg Met Ser Ser Ser 325 330 335Arg Asp Ser Gly Phe Asn His Thr Gly Phe Arg Cys Val Lys Asp Val 340 345 350Asn Gly69876DNAPseudomonas putida KT2440 69atggtgcacg tgccgggcgg cgagttcagc tttggttcaa gccgctttta cgacgaagaa 60ggcccgcctc accccgccaa ggtgtccggc ttctggattg acgtgcatcc ggtcaccaac 120gcccagttcg cgcgcttcgt caaggccacg gggtatgtca cccatgccga gcgcggtacc 180cgtgtcgagg acgaccctgc cctgcccgac gcgctgcgga taccgggtgc gatggtgttt 240catcagggtg cggacgtgct cggccccggc tggcagttcg tgcccggcgc caactggcga 300cacccgcaag ggccgggcag cagcctggcc gggctggaca accatccggt ggtgcagatc 360gccctggaag atgcccaggc ctatgcccgc tgggcaggcc gcgaactgcc cagcgaggcg 420cagctggaat acgccatgcg cggcggcctg accgatgccg acttcagctg gggtaccacc 480gagcagccca agggcaagct catggccaat acctggcagg gtcagttccc ttatcgcaat 540gcggcgaagg atggttttac cggtacatcg cccgtgggtt gcttcccggc caacggcttt 600ggcctgttcg atgccggcgg caatgtctgg gagctgactc gcacgggcta tcggccaggc 660catgacgcac agcgcgacgc caagctcgac ccctcaggcc cggccctgag tgacagcttc 720gacccggcag accccggcgt gccggtggcg gtaatcaaag gcggctcgca cctgtgttcg 780gcggaccgct gcatgcgcta ccgcccctcg gcacgccagc cgcagccggt gttcatgacg 840acctcgcacg tgggtttcag aacgattcgg caatga 87670291PRTPseudomonas putida KT2440 70Met Val His Val Pro Gly Gly Glu Phe Ser Phe Gly Ser Ser Arg Phe1 5 10 15Tyr Asp Glu Glu Gly Pro Pro His Pro Ala Lys Val Ser Gly Phe Trp 20 25 30Ile Asp Val His Pro Val Thr Asn Ala Gln Phe Ala Arg Phe Val Lys 35 40 45Ala Thr Gly Tyr Val Thr His Ala Glu Arg Gly Thr Arg Val Glu Asp 50 55 60Asp Pro Ala Leu Pro Asp Ala Leu Arg Ile Pro Gly Ala Met Val Phe65 70 75 80His Gln Gly Ala Asp Val Leu Gly Pro Gly Trp Gln Phe Val Pro Gly 85 90 95Ala Asn Trp Arg His Pro Gln Gly Pro Gly Ser Ser Leu Ala Gly Leu 100 105 110Asp Asn His Pro Val Val Gln Ile Ala Leu Glu Asp Ala Gln Ala Tyr 115 120 125Ala Arg Trp Ala Gly Arg Glu Leu Pro Ser Glu Ala Gln Leu Glu Tyr 130 135 140Ala Met Arg Gly Gly Leu Thr Asp Ala Asp Phe Ser Trp Gly Thr Thr145 150 155 160Glu Gln Pro Lys Gly Lys Leu Met Ala Asn Thr Trp Gln Gly Gln Phe 165 170 175Pro Tyr Arg Asn Ala Ala Lys Asp Gly Phe Thr Gly Thr Ser Pro Val 180 185 190Gly Cys Phe Pro Ala Asn Gly Phe Gly Leu Phe Asp Ala Gly Gly Asn 195 200 205Val Trp Glu Leu Thr Arg Thr Gly Tyr Arg Pro Gly His Asp Ala Gln 210 215 220Arg Asp Ala Lys Leu Asp Pro Ser Gly Pro Ala Leu Ser Asp Ser Phe225 230 235 240Asp Pro Ala Asp Pro Gly Val Pro Val Ala Val Ile Lys Gly Gly Ser 245 250 255His Leu Cys Ser Ala Asp Arg Cys Met Arg Tyr Arg Pro Ser Ala Arg 260 265 270Gln Pro Gln Pro Val Phe Met Thr Thr Ser His Val Gly Phe Arg Thr 275 280 285Ile Arg Gln 29071780DNARalstonia metallidurans 71atggtcgcgg gcgggatggt gttcgtcggc accaacagcc cggtgccgct gcgcgaatac 60tggcgctggt ggcgcttcgt acctggcgcg gactggcgtc acccgaccgg cccgggcagt 120tccatcgaag gcaaggacaa tcatcccgtc gtgcaggtct cgtatgaaga cgcgcaggcg 180tacgccaagt gggccggcaa gcgtctgccc accgaggccg agtgggagtt tgccgcccgt 240ggcggcctgg agcaggccac ctacgcctgg ggtgacaagt tcgcgccgga tggccggcag 300atggcgaatg tctggcaggg ccagcaggtg cagccgttcc cggtggtcag cgccaaggcg 360ggcggcgcgg ctggcaccag tgctgtcggc acgttcccgg gcaatggcta tgggctctat 420gacatgaccg gcaacgcctg gcagtgggtg gccgactggt atcgcgcgga ccagttccgc 480cgcgaagcca cggtggcggc agtgctgcag aatccgaccg gcccggccga ttcgtgggac 540ccgaccgaac ctggcgtgcc ggtgtcggcg cccaagcggg tcacgcgcgg tggctcgttc 600ctctgcaacg aggacttctg cctcagctac cgcccgagtg cccggcgcgg taccgacccg 660tacaccagca tgtcgcacct aggcttccgg ctcgtgatgg atgacgcccg ttgggcagaa 720gttcgcaagc agccagccgt ggcaatggcc gcgggcgggc agcagaacgt gcagaaataa 78072259PRTRalstonia metallidurans 72Met Val Ala Gly Gly Met Val Phe Val Gly Thr Asn Ser Pro Val Pro1 5 10 15Leu Arg Glu Tyr Trp Arg Trp Trp Arg Phe Val Pro Gly Ala Asp Trp 20 25 30Arg His Pro Thr Gly Pro Gly Ser Ser Ile Glu Gly Lys Asp Asn His 35 40 45Pro Val Val Gln Val Ser Tyr Glu Asp Ala Gln Ala Tyr Ala Lys Trp 50 55 60Ala Gly Lys Arg Leu Pro Thr Glu Ala Glu Trp Glu Phe Ala Ala Arg65 70 75 80Gly Gly Leu Glu Gln Ala Thr Tyr Ala Trp Gly Asp Lys Phe Ala Pro 85 90 95Asp Gly Arg Gln Met Ala Asn Val Trp Gln Gly Gln Gln Val Gln Pro 100 105 110Phe Pro Val Val Ser Ala Lys Ala Gly Gly Ala Ala Gly Thr Ser Ala 115 120 125Val Gly Thr Phe Pro Gly Asn Gly Tyr Gly Leu Tyr Asp Met Thr Gly 130 135 140Asn Ala Trp Gln Trp Val Ala Asp Trp Tyr Arg Ala Asp Gln Phe Arg145 150 155 160Arg Glu Ala Thr Val Ala Ala Val Leu Gln Asn Pro Thr Gly Pro Ala 165 170 175Asp Ser Trp Asp Pro Thr Glu Pro Gly Val Pro Val Ser Ala Pro Lys 180 185 190Arg Val Thr Arg Gly Gly Ser Phe Leu Cys Asn Glu Asp Phe Cys Leu 195 200 205Ser Tyr Arg Pro Ser Ala Arg Arg Gly Thr Asp Pro Tyr Thr Ser Met 210 215 220Ser His Leu Gly Phe Arg Leu Val Met Asp Asp Ala Arg Trp Ala Glu225 230 235 240Val Arg Lys Gln Pro Ala Val Ala Met Ala Ala Gly Gly Gln Gln Asn 245 250 255Val Gln Lys73876DNAProchlorococcus marinus 73gtgaccacat ctttgccagt agagatggta accatccccg cagggctcta tcgagttggc 60tgtgatcgct gctatccgga tggttcagtt cgctgctatc cggaggaaac acccgcgcga 120gaagtgcagc ttgactcatt ccagatcgac gtagggccag tcaccaatgc ccagttccga 180gctttcgtta gcgccacgca gcatctcaca gtctcggagc taccacctga tccaacgctc 240tatcccgatc tagcgcccga ggaacgcatc cctgaatcag ttgtctttca accgcctcca 300gcaacggtgg atcgcagcaa acccttgagc tggtggaccc tcatggctgg ggctgattgg 360cgtcatcccc aaggacccga aagcacgatc gatggccttg atgatcaccc tgtcgtgcat 420gtcgcctatg ccgacgccat cgcctatgcc cattgggctg gcaagcgtct cccctctgct 480gaagagtggg

aagtagccgc ccgcgggggt cttgtcgatg cccaatacgc ctgggggaat 540gaactcactc ccaataaccg ctggatggcg aacatctggc aaggtccttt cccttggcac 600aacgaggagc tagacggctg gttctggacc tcgcccgttg gcagctttcc tgccaacggc 660tatggactct tggatgtttg cggcaatgtg tgggaatgga ccaactctgt ttatcccgtg 720gcgtcaggcc accaggaacg gcgaactatc aaaggcggat cgtttctctg cgcagataat 780tactgcgtac gttatcgacc ctctgcacta caaggccaga cagtagacac tgccacctgt 840cacatgggct ttcgctgtgc aaaaggaggg ccttga 87674291PRTProchlorococcus marinus 74Met Thr Thr Ser Leu Pro Val Glu Met Val Thr Ile Pro Ala Gly Leu1 5 10 15Tyr Arg Val Gly Cys Asp Arg Cys Tyr Pro Asp Gly Ser Val Arg Cys 20 25 30Tyr Pro Glu Glu Thr Pro Ala Arg Glu Val Gln Leu Asp Ser Phe Gln 35 40 45Ile Asp Val Gly Pro Val Thr Asn Ala Gln Phe Arg Ala Phe Val Ser 50 55 60Ala Thr Gln His Leu Thr Val Ser Glu Leu Pro Pro Asp Pro Thr Leu65 70 75 80Tyr Pro Asp Leu Ala Pro Glu Glu Arg Ile Pro Glu Ser Val Val Phe 85 90 95Gln Pro Pro Pro Ala Thr Val Asp Arg Ser Lys Pro Leu Ser Trp Trp 100 105 110Thr Leu Met Ala Gly Ala Asp Trp Arg His Pro Gln Gly Pro Glu Ser 115 120 125Thr Ile Asp Gly Leu Asp Asp His Pro Val Val His Val Ala Tyr Ala 130 135 140Asp Ala Ile Ala Tyr Ala His Trp Ala Gly Lys Arg Leu Pro Ser Ala145 150 155 160Glu Glu Trp Glu Val Ala Ala Arg Gly Gly Leu Val Asp Ala Gln Tyr 165 170 175Ala Trp Gly Asn Glu Leu Thr Pro Asn Asn Arg Trp Met Ala Asn Ile 180 185 190Trp Gln Gly Pro Phe Pro Trp His Asn Glu Glu Leu Asp Gly Trp Phe 195 200 205Trp Thr Ser Pro Val Gly Ser Phe Pro Ala Asn Gly Tyr Gly Leu Leu 210 215 220Asp Val Cys Gly Asn Val Trp Glu Trp Thr Asn Ser Val Tyr Pro Val225 230 235 240Ala Ser Gly His Gln Glu Arg Arg Thr Ile Lys Gly Gly Ser Phe Leu 245 250 255Cys Ala Asp Asn Tyr Cys Val Arg Tyr Arg Pro Ser Ala Leu Gln Gly 260 265 270Gln Thr Val Asp Thr Ala Thr Cys His Met Gly Phe Arg Cys Ala Lys 275 280 285Gly Gly Pro 290751017DNACaulobacter crescentus CB15 75ttgggaaaac tgacggcgct tcccgtcctg atgcttctgg cgctggccgg ctgcggccag 60ccggcgccca aggcttgcct ggcggacctg ccggttccag atccccagaa ccgcacggcg 120ggtatggttc ggctggcggg cggcgacttc cagatgggcg ctgcgccgct gcgtccggag 180gagggaccgc cccagacggt cacggtcccg ccgttctgga tcgatcagac agaggtcacc 240aacgccgcct tcgcgcggtt cgtcgaggcc acgggttatc gcaccgtggc cgagcgaccg 300ctcgaccccg cgcgctacgc ccacgtaccg gcggcgcagc ggcgtccggc ctcgctcgtc 360ttcgtggggg cgaagggggc gaggtcggac gatccttccc aatggtggca ggtgatcccc 420ggcgccgact ggcggcatcc cgaaggtccc ggctcgaaca tccggggcag ggacgcctgg 480ccggtggtgc atatcgcgtg ggaggacgcc atggcctacg cccgctggct gggccgtgac 540ctgcccacag aggccgaatg ggagtacgcc gcgcgcggcg ggctggttgg caagcgctac 600acctggggcg accaggctca ggatcctgca aagccgcgcg ccaatacttg gcaaggcgtg 660ttcccggccc aggaccttgg caatgacggc ttcaaggcca agcccgcgcc ggtcggctgc 720ttcccgccca acggctatgg cctgcgcgac atggccggca atgtctggga gtggacccgc 780gactggttca agccgggcct ggatccggtc agcgtcctcg aaaccggcgg gccgcccgag 840gcccgcgcgc tggatcccga ggacccgaac acgcccaagc acgtcgtgaa gggcggttcg 900ttcctgtgcg ccgacgacta ctgcttccgc tatcgacctg cggcgcgaac gccggggccg 960ccggacagcg gcgcatcgca tgtcggtttc cgcaccgtgc tccgcgccga gcgctga 101776338PRTCaulobacter crescentus CB15 76Met Gly Lys Leu Thr Ala Leu Pro Val Leu Met Leu Leu Ala Leu Ala1 5 10 15Gly Cys Gly Gln Pro Ala Pro Lys Ala Cys Leu Ala Asp Leu Pro Val 20 25 30Pro Asp Pro Gln Asn Arg Thr Ala Gly Met Val Arg Leu Ala Gly Gly 35 40 45Asp Phe Gln Met Gly Ala Ala Pro Leu Arg Pro Glu Glu Gly Pro Pro 50 55 60Gln Thr Val Thr Val Pro Pro Phe Trp Ile Asp Gln Thr Glu Val Thr65 70 75 80Asn Ala Ala Phe Ala Arg Phe Val Glu Ala Thr Gly Tyr Arg Thr Val 85 90 95Ala Glu Arg Pro Leu Asp Pro Ala Arg Tyr Ala His Val Pro Ala Ala 100 105 110Gln Arg Arg Pro Ala Ser Leu Val Phe Val Gly Ala Lys Gly Ala Arg 115 120 125Ser Asp Asp Pro Ser Gln Trp Trp Gln Val Ile Pro Gly Ala Asp Trp 130 135 140Arg His Pro Glu Gly Pro Gly Ser Asn Ile Arg Gly Arg Asp Ala Trp145 150 155 160Pro Val Val His Ile Ala Trp Glu Asp Ala Met Ala Tyr Ala Arg Trp 165 170 175Leu Gly Arg Asp Leu Pro Thr Glu Ala Glu Trp Glu Tyr Ala Ala Arg 180 185 190Gly Gly Leu Val Gly Lys Arg Tyr Thr Trp Gly Asp Gln Ala Gln Asp 195 200 205Pro Ala Lys Pro Arg Ala Asn Thr Trp Gln Gly Val Phe Pro Ala Gln 210 215 220Asp Leu Gly Asn Asp Gly Phe Lys Ala Lys Pro Ala Pro Val Gly Cys225 230 235 240Phe Pro Pro Asn Gly Tyr Gly Leu Arg Asp Met Ala Gly Asn Val Trp 245 250 255Glu Trp Thr Arg Asp Trp Phe Lys Pro Gly Leu Asp Pro Val Ser Val 260 265 270Leu Glu Thr Gly Gly Pro Pro Glu Ala Arg Ala Leu Asp Pro Glu Asp 275 280 285Pro Asn Thr Pro Lys His Val Val Lys Gly Gly Ser Phe Leu Cys Ala 290 295 300Asp Asp Tyr Cys Phe Arg Tyr Arg Pro Ala Ala Arg Thr Pro Gly Pro305 310 315 320Pro Asp Ser Gly Ala Ser His Val Gly Phe Arg Thr Val Leu Arg Ala 325 330 335Glu Arg77900DNAMycobacterium tuberculosis H37Rv 77gtgctgaccg agttggttga cctgcccggc ggatcgttcc gcatgggctc gacgcgcttc 60taccccgaag aagcgccgat tcataccgtg accgtgcgcg cctttgcggt agagcgacac 120ccggtgacca acgcgcaatt tgccgaattc gtctccgcga caggctatgt gacggttgca 180gaacaacccc ttgaccccgg gctctaccca ggagtggacg cagcagacct gtgtcccggt 240gcgatggtgt tttgtccgac ggccgggccg gtcgacctgc gtgactggcg gcaatggtgg 300gactgggtac ctggcgcctg ctggcgccat ccgtttggcc gggacagcga tatcgccgac 360cgagccggcc acccggtcgt acaggtggcc tatccggacg ccgtggccta cgcacgatgg 420gctggtcgac gcctaccgac cgaggccgag tgggagtacg cggcccgtgg cggaaccacg 480gcaacctatg cgtggggcga ccaggagaag ccggggggca tgctcatggc gaacacctgg 540cagggccggt ttccttaccg caacgacggt gcattgggct gggtgggaac ctccccggtg 600ggcaggtttc cggccaacgg gtttggcttg ctcgacatga tcggaaacgt ttgggagtgg 660accaccaccg agttctatcc acaccatcgc atcgatccac cctcgacggc ctgctgcgca 720ccggtcaagc tcgctacagc cgccgacccg acgatcagcc agaccctcaa gggcggctcg 780cacctgtgcg cgccggagta ctgccaccgc taccgcccgg cggcgcgctc gccgcagtcg 840caggacaccg cgaccaccca tatcgggttc cggtgcgtgg ccgacccggt gtccgggtag 90078299PRTMycobacterium tuberculosis H37Rv 78Met Leu Thr Glu Leu Val Asp Leu Pro Gly Gly Ser Phe Arg Met Gly1 5 10 15Ser Thr Arg Phe Tyr Pro Glu Glu Ala Pro Ile His Thr Val Thr Val 20 25 30Arg Ala Phe Ala Val Glu Arg His Pro Val Thr Asn Ala Gln Phe Ala 35 40 45Glu Phe Val Ser Ala Thr Gly Tyr Val Thr Val Ala Glu Gln Pro Leu 50 55 60Asp Pro Gly Leu Tyr Pro Gly Val Asp Ala Ala Asp Leu Cys Pro Gly65 70 75 80Ala Met Val Phe Cys Pro Thr Ala Gly Pro Val Asp Leu Arg Asp Trp 85 90 95Arg Gln Trp Trp Asp Trp Val Pro Gly Ala Cys Trp Arg His Pro Phe 100 105 110Gly Arg Asp Ser Asp Ile Ala Asp Arg Ala Gly His Pro Val Val Gln 115 120 125Val Ala Tyr Pro Asp Ala Val Ala Tyr Ala Arg Trp Ala Gly Arg Arg 130 135 140Leu Pro Thr Glu Ala Glu Trp Glu Tyr Ala Ala Arg Gly Gly Thr Thr145 150 155 160Ala Thr Tyr Ala Trp Gly Asp Gln Glu Lys Pro Gly Gly Met Leu Met 165 170 175Ala Asn Thr Trp Gln Gly Arg Phe Pro Tyr Arg Asn Asp Gly Ala Leu 180 185 190Gly Trp Val Gly Thr Ser Pro Val Gly Arg Phe Pro Ala Asn Gly Phe 195 200 205Gly Leu Leu Asp Met Ile Gly Asn Val Trp Glu Trp Thr Thr Thr Glu 210 215 220Phe Tyr Pro His His Arg Ile Asp Pro Pro Ser Thr Ala Cys Cys Ala225 230 235 240Pro Val Lys Leu Ala Thr Ala Ala Asp Pro Thr Ile Ser Gln Thr Leu 245 250 255Lys Gly Gly Ser His Leu Cys Ala Pro Glu Tyr Cys His Arg Tyr Arg 260 265 270Pro Ala Ala Arg Ser Pro Gln Ser Gln Asp Thr Ala Thr Thr His Ile 275 280 285Gly Phe Arg Cys Val Ala Asp Pro Val Ser Gly 290 295797PRTArtificial Sequenceconserved domain in prokaryotes and prokaryotes 79Arg Val Xaa Xaa Gly Xaa Ser1 580630DNAOncorhynchus mykiss 80tcaggtggct gctgccccct ggtggttgcc tgtcagagga gcagactgga ggcaccctga 60gggccccgac tccagcatca cagacaggct ggaccaccct gtgctgcatg tgtcatggca 120ggacgctgtg gcctactgct cctgggccta caagagacta cccacagagg ctgagtggga 180gtacgcctgc agagggggcc tacaggagag actttacccg tgggggaaca aactgaaacc 240taaaggacag cactacgcca acctctggca gggaaagttc cccacacaca actcagaaga 300ggacgggtac actaaaacct caccagtgaa gtcatttcct gcaaatggct atggcctgta 360caacatggta gggaatgcat gggagtggac atctgactgg tggactgtac accacaccac 420agatgaacag cacaacccgg caggtccacc atcaggcaca gaccgagtga agaaaggagg 480ctcctacatg tgccataagt catactgtta caggtacagg tgtgcagcac ggagtcagaa 540cacccctgac agctctgcct ctaacctagg gttccgctgt gtctcccagg agcagccgta 600acctttcacc ctcgaccctg acatgggtag 63081655DNADanio reriomisc_feature590n is a, c, g, or t 81caaatggttt tatttacata aaaaaatcct cttagtttga agtgtaagac agtgagatta 60gtgatgtttg aggttatgga tcaacatcag aggcgcagcg gaagcccaag ttcgaggctg 120aactgtccgg tgtgttctga ctgcgagcgg cacacctgta tctgtagcag taagacttgt 180ggcacatgta ggatcctcct ttcttgactc tgtctgtccc tgattctggt ccctttgggt 240taaacttgtc ttctgcagtg tgatgcacag tccaccagtc tgccgtccac tcccacgcat 300ttcccaccat gtcatacagg ccaaagccat tgggaggaaa agacatcacc ggggatgtgt 360tggcatagcc gtcctctgca gtgttgtgat tagggaaatc tccctgccac aggttagcat 420agtgctgccc tcttggcatt aatttatttc cccatgggta catcctgtcc tgtagtcctc 480ctctacaggc caactcccat tcagcttctg taggaagtct gcgtttggcc cattgacagt 540acgcccgtgc atcatcccat gaaacatgca gagcagggtg attcattctn gtgtgtatgg 600ttgaatctgg tcctttctgg tgtctncagt ctgcaccttt cactggtgac cacca 65582773DNAOryzias latipesmisc_feature690n is a, c, g, or t 82tctccttttt tccataaata acattagagt ccttacattc tgcctttaca tacattgtca 60gagacagtac aaaaaatctg cctttgtaaa attagagtta caaaaatata ttttagattt 120gacttcttca gaattgtcgg tggcagcaaa agaatcggat tgatctcatg acaagagcgt 180gagccagaag ttcttggatc aaactgattt ggttctgtca tcgtttctgt tcagcagcac 240agcgaaaacc aagattggaa gcggagctgt ctggagtgtt ttggcttcga gcagcacatc 300tgtacctgta acaataagac ttgtggcaca tgtacgagcc tcctttcttc accttatctg 360tgcctgacgg aggacccgtt gggttgtgct gatggtctgt tgtgtggtgc acgctccacc 420agtctgaggt ccactcccat gcgttcccca ccatgtcata cagaccaaaa gcattgcctg 480ggaaggacat caccggggag gttttagtgt agccatcctc tgcagagttg tgtgctggga 540attccccctg ccagaggttg gcgtaatgct gtccctttgg gtttagcttg tttccccagg 600ggtagagtct gtccttcagg ccgcccctgc aggcaacctc ccactctgcc tcagtgggaa 660gtctcttgtt gacccaggag cagtaagccn aggcatcatt cccagaaacc tgaacgacgg 720atgatccatc ctgtctgtga tgttggagtc tggancttca gggtgcttcc agt 77383566DNAXenopus laevismisc_feature6n is a, c, g, or t 83atatgnaact aaaggtaatg taattggaat gatggatttc acaaggnctg agagttccct 60attgctcctg cttgtcgtgt nacaggtcac ggagccggcg ccacacagcg aaatcccagg 120ttggaggccg agctgtcggg tgtattctga cttcgagcag cacagcgata cctgtagcaa 180taggactcat ggcacatgta ggagcctcct ttcttcactc tatcatttcc cgtagaaggt 240cctttcgggt tgtgaacctc atctgctgta tgatgagtgt cccaccaatc agatgtccac 300tcccaagcat ttcccaccat gttatataga ccataaccat tggctgggaa agcagttaca 360ggtgaagtct gcacataacc atcctctcca gtgttttggg ttggaaaatc cccctgccag 420acattcgcat aatgttgtcc ctttggttcc agcttgttcc cccatggaaa aatcctgttc 480tcaagtcccc cgcggcaggc gtattcccac tcagcttcag ttggaaggcg tttacctgcc 540caggtgcaga aagcagaagc atcatt 56684647DNASilurana tropicalis 84gccgcttttt tttttttttt tttttttttt catcacaaaa ataattttat taataaaata 60ggattttgtg ttcattctta ttatgaagga caaggaatgt cattgaaatt tttgttttca 120caaggtcttg ggagttcctt cctgctcagg tcattttgca gtggtcacgg agccgacgcc 180acgcagcgga atcccaggtt agaggccgag ctgtcaggtg tattctgact tcgagcagca 240cagcgatacc tgtagcagta ggactcatgg cacatgtatg agcctccttt tttcaccttg 300tcttttcccg taaaaggacc tttcgggttg taagtctcat ctgctgtatg atgagtgtcc 360caccaatcgg atgtccactc ccaagcattt cccaccatgt tatataggct ataaccattg 420gctgggaaag cggttacagg tgaagtctgc acatagccgt cctctccagt gttttgggtt 480ggaaattccc cctgccagac attcgcataa tgttctccct ttggttccag cttgttcccc 540cacggaaaaa gcctgttctc aagtccccca cgggaggcat attcccactc agcttctgtc 600ggaaggcgct tacccgccca ggtgcagaag gcagaagcat cgttcca 64785636DNASalmo salar 85atagacattt tttaaatatt ttacaacaaa atatattcca taaatatcca catgtcatgc 60ggtaatcctg catttcatga agaacactga catcactggc tgtatgaaga ggtgcacttg 120atttgtttcg cctggcgggc aagataggca gagttagcac cctagactag agccaatggc 180gaatggtaca aaaagggaaa agtcagacta cccatgtcag ggtcaagggt aaaaggttac 240ggctgctcct gggagacaca gcggaaccct aggttagagg cagagctgtc aggggtgttc 300tgactccgtg ctgcacacct gtacctgtaa cagtatgact tatggcacat gtaggagcct 360cctttcttca ctcggtctgt gcctgatggt ggacctgccg ggttgtgccg ttcatctgtg 420gtgtggtgta cagtccacca gtcagatgtc cactcccatg cattccctac catgttgtac 480aggccatagc catttgcagg aaatgacttc actggtgagg ttttggtgta cccgtcctct 540tctgagttgt gtgtggggaa ctttccctgc cagaggttgg cgtagtgctg tcctttaggt 600ttcagtttgt tcccccacgg gtaaagtctg tcctgt 63686415DNASus scrofa 86agtttcctgt gaccaacacc ggagaggatg gcttccgagg aactgcgcct gttgatgcct 60ttcctcccaa tggttatggc ctttacaata tagtagggaa cgcctgggaa tggacctcag 120actggtggac cattcaccat gctgctgaag aaacaattaa cccatcaagt tcttcctgct 180gcaccgaata acagagccgc cactacgtga tgaaagcaga gaaaggcccc ccttctggga 240aagaccgggt gaagaaaggg ggatcctata tgtgccataa gtcctactgc tacaggtacc 300gctgtgctgc tcgaagccag aacacgccgg acagctcggc ttcaaatctg gggttccgct 360gtgcagctga ccaccagccc accacaggct gagtcaggaa gagtcttccc gaatc 41587595DNABos taurus 87ccacgcgtcc gggggcaaca aactgcagcc gaaaggccag cattatagcc aacatcttgg 60caaggcgagt ttcctgtgac caacaccggg gaggacggct tccgagggac cgcgcctgtt 120gacgcctttc ctcccaatgg ttattggctt atacaatata gtagggaacg cctgggagtg 180gacttcagac tggtggactg ttcaccattc tgctgaagaa acgattaacc caaaaggccc 240cccttctggg aaagaccggg tgaagaaagg tggatcctac atgtgccata aatcctattg 300ctacaggtat cgctgtgctg ctcgaagcca gaacacaccc gacagctctg cttcgaatct 360gggattccgt tgtgcagctg accacctgcc caccacaggc taagagccaa aaagagcctt 420cccgaacccg agaagtcgtg tctactctgc acgcggcttc cctcagaagg ctgaacaacc 480tgctgtgaag aattcccacc ccaaggtggg ttacatacct tgcccagtgg ccaaaggacc 540tatggcaaga ccaaattgct gagctgatca gcatgtgcgc tttattgggg gatgg 595881611DNAHomo sapiensCDS(1)..(1608) 88atg cta ctg ctg tgg gtg tcg gtg gtc gca gcc ttg gcg ctg gcg gta 48Met Leu Leu Leu Trp Val Ser Val Val Ala Ala Leu Ala Leu Ala Val1 5 10 15ctg gcc ccc gga gca ggg gag cag agg cgg aga gca gcc aaa gcg ccc 96Leu Ala Pro Gly Ala Gly Glu Gln Arg Arg Arg Ala Ala Lys Ala Pro 20 25 30aat gtg gtg ctg gtc gtg agc gac tcc ttc gat gga agg tta aca ttt 144Asn Val Val Leu Val Val Ser Asp Ser Phe Asp Gly Arg Leu Thr Phe 35 40 45cat cca gga agt cag gta gtg aaa ctt cct ttt atc aac ttt atg aag 192His Pro Gly Ser Gln Val Val Lys Leu Pro Phe Ile Asn Phe Met Lys 50 55 60aca cgt ggg act tcc ttt ctg aat gcc tac aca aac tct cca att tgt 240Thr Arg Gly Thr Ser Phe Leu Asn Ala Tyr Thr Asn Ser Pro Ile Cys65 70 75 80tgc cca tca cgc gca gca atg tgg agt ggc ctc ttc act cac tta aca 288Cys Pro Ser Arg Ala Ala Met Trp Ser Gly Leu Phe Thr His Leu Thr 85 90 95gaa tct tgg aat aat ttt aag ggt cta gat cca aat tat aca aca tgg 336Glu Ser Trp Asn Asn Phe Lys Gly Leu Asp Pro Asn Tyr Thr Thr Trp 100 105 110atg gat gtc atg gag agg cat ggc tac cga aca cag aaa ttt ggg aaa 384Met Asp Val Met Glu Arg His Gly Tyr Arg Thr Gln Lys Phe Gly Lys 115 120 125ctg gac tat act tca gga cat cac tcc att agt aat cgt gtg gaa gcg 432Leu Asp Tyr Thr Ser Gly His His Ser Ile Ser Asn Arg Val Glu Ala 130 135 140tgg aca aga gat gtt

gct ttc tta ctc aga caa gaa ggc agg ccc atg 480Trp Thr Arg Asp Val Ala Phe Leu Leu Arg Gln Glu Gly Arg Pro Met145 150 155 160gtt aat ctt atc cgt aac agg act aaa gtc aga gtg atg gaa agg gat 528Val Asn Leu Ile Arg Asn Arg Thr Lys Val Arg Val Met Glu Arg Asp 165 170 175tgg cag aat aca gac aaa gca gta aac tgg tta aga aag gaa gca att 576Trp Gln Asn Thr Asp Lys Ala Val Asn Trp Leu Arg Lys Glu Ala Ile 180 185 190aat tac act gaa cca ttt gtt att tac ttg gga tta aat tta cca cac 624Asn Tyr Thr Glu Pro Phe Val Ile Tyr Leu Gly Leu Asn Leu Pro His 195 200 205cct tac cct tca cca tct tct gga gaa aat ttt gga tct tca aca ttt 672Pro Tyr Pro Ser Pro Ser Ser Gly Glu Asn Phe Gly Ser Ser Thr Phe 210 215 220cac aca tct ctt tat tgg ctt gaa aaa gtg tct cat gat gcc atc aaa 720His Thr Ser Leu Tyr Trp Leu Glu Lys Val Ser His Asp Ala Ile Lys225 230 235 240atc cca aag tgg tca cct ttg tca gaa atg cac cct gta gat tat tac 768Ile Pro Lys Trp Ser Pro Leu Ser Glu Met His Pro Val Asp Tyr Tyr 245 250 255tct tct tat aca aaa aac tgc act gga aga ttt aca aaa aaa gaa att 816Ser Ser Tyr Thr Lys Asn Cys Thr Gly Arg Phe Thr Lys Lys Glu Ile 260 265 270aag aat att aga gca ttt tat tat gct atg tgt gct gag aca gat gcc 864Lys Asn Ile Arg Ala Phe Tyr Tyr Ala Met Cys Ala Glu Thr Asp Ala 275 280 285atg ctt ggt gaa att att ttg gcc ctt cat caa tta gat ctt ctt cag 912Met Leu Gly Glu Ile Ile Leu Ala Leu His Gln Leu Asp Leu Leu Gln 290 295 300aaa act att gtc ata tac tcc tca gac cat gga gag ctg gcc atg gaa 960Lys Thr Ile Val Ile Tyr Ser Ser Asp His Gly Glu Leu Ala Met Glu305 310 315 320cat cga cag ttt tat aaa atg agc atg tac gag gct agt gca cat gtt 1008His Arg Gln Phe Tyr Lys Met Ser Met Tyr Glu Ala Ser Ala His Val 325 330 335ccg ctt ttg atg atg gga cca gga att aaa gcc ggc cta caa gta tca 1056Pro Leu Leu Met Met Gly Pro Gly Ile Lys Ala Gly Leu Gln Val Ser 340 345 350aat gtg gtt tct ctt gtg gat att tac cct acc atg ctt gat att gct 1104Asn Val Val Ser Leu Val Asp Ile Tyr Pro Thr Met Leu Asp Ile Ala 355 360 365gga att cct ctg cct cag aac ctg agt gga tac tct ttg ttg ccg tta 1152Gly Ile Pro Leu Pro Gln Asn Leu Ser Gly Tyr Ser Leu Leu Pro Leu 370 375 380tca tca gaa aca ttt aag aat gaa cat aaa gtc aaa aac ctg cat cca 1200Ser Ser Glu Thr Phe Lys Asn Glu His Lys Val Lys Asn Leu His Pro385 390 395 400ccc tgg att ctg agt gaa ttc cat gga tgt aat gtg aat gcc tcc acc 1248Pro Trp Ile Leu Ser Glu Phe His Gly Cys Asn Val Asn Ala Ser Thr 405 410 415tac atg ctt cga act aac cac tgg aaa tat ata gcc tat tcg gat ggt 1296Tyr Met Leu Arg Thr Asn His Trp Lys Tyr Ile Ala Tyr Ser Asp Gly 420 425 430gca tca ata ttg cct caa ctc ttt gat ctt tcc tcg gat cca gat gaa 1344Ala Ser Ile Leu Pro Gln Leu Phe Asp Leu Ser Ser Asp Pro Asp Glu 435 440 445tta aca aat gtt gct gta aaa ttt cca gaa att act tat tct ttg gat 1392Leu Thr Asn Val Ala Val Lys Phe Pro Glu Ile Thr Tyr Ser Leu Asp 450 455 460cag aag ctt cat tcc att ata aac tac cct aaa gtt tct gct tct gtc 1440Gln Lys Leu His Ser Ile Ile Asn Tyr Pro Lys Val Ser Ala Ser Val465 470 475 480cac cag tat aat aaa gag cag ttt atc aag tgg aaa caa agt ata gga 1488His Gln Tyr Asn Lys Glu Gln Phe Ile Lys Trp Lys Gln Ser Ile Gly 485 490 495cag aat tat tca aac gtt ata gca aat ctt agg tgg cac caa gac tgg 1536Gln Asn Tyr Ser Asn Val Ile Ala Asn Leu Arg Trp His Gln Asp Trp 500 505 510cag aag gaa cca agg aag tat gaa aat gca att gat cag tgg ctt aaa 1584Gln Lys Glu Pro Arg Lys Tyr Glu Asn Ala Ile Asp Gln Trp Leu Lys 515 520 525acc cat atg aat cca aga gca gtt tga 1611Thr His Met Asn Pro Arg Ala Val 530 53589536PRTHomo sapiens 89Met Leu Leu Leu Trp Val Ser Val Val Ala Ala Leu Ala Leu Ala Val1 5 10 15Leu Ala Pro Gly Ala Gly Glu Gln Arg Arg Arg Ala Ala Lys Ala Pro 20 25 30Asn Val Val Leu Val Val Ser Asp Ser Phe Asp Gly Arg Leu Thr Phe 35 40 45His Pro Gly Ser Gln Val Val Lys Leu Pro Phe Ile Asn Phe Met Lys 50 55 60Thr Arg Gly Thr Ser Phe Leu Asn Ala Tyr Thr Asn Ser Pro Ile Cys65 70 75 80Cys Pro Ser Arg Ala Ala Met Trp Ser Gly Leu Phe Thr His Leu Thr 85 90 95Glu Ser Trp Asn Asn Phe Lys Gly Leu Asp Pro Asn Tyr Thr Thr Trp 100 105 110Met Asp Val Met Glu Arg His Gly Tyr Arg Thr Gln Lys Phe Gly Lys 115 120 125Leu Asp Tyr Thr Ser Gly His His Ser Ile Ser Asn Arg Val Glu Ala 130 135 140Trp Thr Arg Asp Val Ala Phe Leu Leu Arg Gln Glu Gly Arg Pro Met145 150 155 160Val Asn Leu Ile Arg Asn Arg Thr Lys Val Arg Val Met Glu Arg Asp 165 170 175Trp Gln Asn Thr Asp Lys Ala Val Asn Trp Leu Arg Lys Glu Ala Ile 180 185 190Asn Tyr Thr Glu Pro Phe Val Ile Tyr Leu Gly Leu Asn Leu Pro His 195 200 205Pro Tyr Pro Ser Pro Ser Ser Gly Glu Asn Phe Gly Ser Ser Thr Phe 210 215 220His Thr Ser Leu Tyr Trp Leu Glu Lys Val Ser His Asp Ala Ile Lys225 230 235 240Ile Pro Lys Trp Ser Pro Leu Ser Glu Met His Pro Val Asp Tyr Tyr 245 250 255Ser Ser Tyr Thr Lys Asn Cys Thr Gly Arg Phe Thr Lys Lys Glu Ile 260 265 270Lys Asn Ile Arg Ala Phe Tyr Tyr Ala Met Cys Ala Glu Thr Asp Ala 275 280 285Met Leu Gly Glu Ile Ile Leu Ala Leu His Gln Leu Asp Leu Leu Gln 290 295 300Lys Thr Ile Val Ile Tyr Ser Ser Asp His Gly Glu Leu Ala Met Glu305 310 315 320His Arg Gln Phe Tyr Lys Met Ser Met Tyr Glu Ala Ser Ala His Val 325 330 335Pro Leu Leu Met Met Gly Pro Gly Ile Lys Ala Gly Leu Gln Val Ser 340 345 350Asn Val Val Ser Leu Val Asp Ile Tyr Pro Thr Met Leu Asp Ile Ala 355 360 365Gly Ile Pro Leu Pro Gln Asn Leu Ser Gly Tyr Ser Leu Leu Pro Leu 370 375 380Ser Ser Glu Thr Phe Lys Asn Glu His Lys Val Lys Asn Leu His Pro385 390 395 400Pro Trp Ile Leu Ser Glu Phe His Gly Cys Asn Val Asn Ala Ser Thr 405 410 415Tyr Met Leu Arg Thr Asn His Trp Lys Tyr Ile Ala Tyr Ser Asp Gly 420 425 430Ala Ser Ile Leu Pro Gln Leu Phe Asp Leu Ser Ser Asp Pro Asp Glu 435 440 445Leu Thr Asn Val Ala Val Lys Phe Pro Glu Ile Thr Tyr Ser Leu Asp 450 455 460Gln Lys Leu His Ser Ile Ile Asn Tyr Pro Lys Val Ser Ala Ser Val465 470 475 480His Gln Tyr Asn Lys Glu Gln Phe Ile Lys Trp Lys Gln Ser Ile Gly 485 490 495Gln Asn Tyr Ser Asn Val Ile Ala Asn Leu Arg Trp His Gln Asp Trp 500 505 510Gln Lys Glu Pro Arg Lys Tyr Glu Asn Ala Ile Asp Gln Trp Leu Lys 515 520 525Thr His Met Asn Pro Arg Ala Val 530 535901722DNAHomo sapiensCDS(1)..(1719) 90atg ggg gcg ctg gca gga ttc tgg atc ctc tgc ctc ctc act tat ggt 48Met Gly Ala Leu Ala Gly Phe Trp Ile Leu Cys Leu Leu Thr Tyr Gly1 5 10 15tac ctg tcc tgg ggc cag gcc tta gaa gag gag gaa gaa ggg gcc tta 96Tyr Leu Ser Trp Gly Gln Ala Leu Glu Glu Glu Glu Glu Gly Ala Leu 20 25 30cta gct caa gct gga gag aaa cta gag ccc agc aca act tcc acc tcc 144Leu Ala Gln Ala Gly Glu Lys Leu Glu Pro Ser Thr Thr Ser Thr Ser 35 40 45cag ccc cat ctc att ttc atc cta gcg gat gat cag gga ttt aga gat 192Gln Pro His Leu Ile Phe Ile Leu Ala Asp Asp Gln Gly Phe Arg Asp 50 55 60gtg ggt tac cac gga tct gag att aaa aca cct act ctt gac aag ctc 240Val Gly Tyr His Gly Ser Glu Ile Lys Thr Pro Thr Leu Asp Lys Leu65 70 75 80gct gcc gaa gga gtt aaa ctg gag aac tac tat gtc cag cct att tgc 288Ala Ala Glu Gly Val Lys Leu Glu Asn Tyr Tyr Val Gln Pro Ile Cys 85 90 95aca cca tcc agg agt cag ttt att act gga aag tat cag ata cac acc 336Thr Pro Ser Arg Ser Gln Phe Ile Thr Gly Lys Tyr Gln Ile His Thr 100 105 110gga ctt caa cat tct atc ata aga cct acc caa ccc aac tgt tta cct 384Gly Leu Gln His Ser Ile Ile Arg Pro Thr Gln Pro Asn Cys Leu Pro 115 120 125ctg gac aat gcc acc cta cct cag aaa ctg aag gag gtt gga tat tca 432Leu Asp Asn Ala Thr Leu Pro Gln Lys Leu Lys Glu Val Gly Tyr Ser 130 135 140acg cat atg gtc gga aaa tgg cac ttg ggt ttt tac aga aaa gaa tgc 480Thr His Met Val Gly Lys Trp His Leu Gly Phe Tyr Arg Lys Glu Cys145 150 155 160atg ccc acc aga aga gga ttt gat acc ttt ttt ggt tcc ctt ttg gga 528Met Pro Thr Arg Arg Gly Phe Asp Thr Phe Phe Gly Ser Leu Leu Gly 165 170 175agt ggg gat tac tat aca cac tac aaa tgt gac agt cct ggg atg tgt 576Ser Gly Asp Tyr Tyr Thr His Tyr Lys Cys Asp Ser Pro Gly Met Cys 180 185 190ggc tat gac ttg tat gaa aac gac aat gct gcc tgg gac tat gac aat 624Gly Tyr Asp Leu Tyr Glu Asn Asp Asn Ala Ala Trp Asp Tyr Asp Asn 195 200 205ggc ata tac tcc aca cag atg tac act cag aga gta cag caa atc tta 672Gly Ile Tyr Ser Thr Gln Met Tyr Thr Gln Arg Val Gln Gln Ile Leu 210 215 220gct tcc cat aac ccc aca aag cct ata ttt tta tat att gcc tat caa 720Ala Ser His Asn Pro Thr Lys Pro Ile Phe Leu Tyr Ile Ala Tyr Gln225 230 235 240gct gtt cat tca cca ctg caa gct cct ggc agg tat ttc gaa cac tac 768Ala Val His Ser Pro Leu Gln Ala Pro Gly Arg Tyr Phe Glu His Tyr 245 250 255cga tcc att atc aac ata aac agg agg aga tat gct gcc atg ctt tcc 816Arg Ser Ile Ile Asn Ile Asn Arg Arg Arg Tyr Ala Ala Met Leu Ser 260 265 270tgc tta gat gaa gca atc aac aac gtg aca ttg gct cta aag act tat 864Cys Leu Asp Glu Ala Ile Asn Asn Val Thr Leu Ala Leu Lys Thr Tyr 275 280 285ggt ttc tat aac aac agc att atc att tac tct tca gat aat ggt ggc 912Gly Phe Tyr Asn Asn Ser Ile Ile Ile Tyr Ser Ser Asp Asn Gly Gly 290 295 300cag cct acg gca gga ggg agt aac tgg cct ctc aga ggt agc aaa gga 960Gln Pro Thr Ala Gly Gly Ser Asn Trp Pro Leu Arg Gly Ser Lys Gly305 310 315 320aca tat tgg gaa gga ggg atc cgg gct gta ggc ttt gtg cat agc cca 1008Thr Tyr Trp Glu Gly Gly Ile Arg Ala Val Gly Phe Val His Ser Pro 325 330 335ctt ctg aaa aac aag gga aca gtg tgt aag gaa ctt gtg cac atc act 1056Leu Leu Lys Asn Lys Gly Thr Val Cys Lys Glu Leu Val His Ile Thr 340 345 350gac tgg tac ccc act ctc att tca ctg gct gaa gga cag att gat gag 1104Asp Trp Tyr Pro Thr Leu Ile Ser Leu Ala Glu Gly Gln Ile Asp Glu 355 360 365gac att caa cta gat ggc tat gat atc tgg gag acc ata agt gag ggt 1152Asp Ile Gln Leu Asp Gly Tyr Asp Ile Trp Glu Thr Ile Ser Glu Gly 370 375 380ctt cgc tca ccc cga gta gat att ttg cat aac att gac ccc ata tac 1200Leu Arg Ser Pro Arg Val Asp Ile Leu His Asn Ile Asp Pro Ile Tyr385 390 395 400acc aag gca aaa aat ggc tcc tgg gca gca ggc tat ggg atc tgg aac 1248Thr Lys Ala Lys Asn Gly Ser Trp Ala Ala Gly Tyr Gly Ile Trp Asn 405 410 415act gca atc cag tca gcc atc aga gtg cag cac tgg aaa ttg ctt aca 1296Thr Ala Ile Gln Ser Ala Ile Arg Val Gln His Trp Lys Leu Leu Thr 420 425 430gga aat cct ggc tac agc gac tgg gtc ccc cct cag tct ttc agc aac 1344Gly Asn Pro Gly Tyr Ser Asp Trp Val Pro Pro Gln Ser Phe Ser Asn 435 440 445ctg gga ccg aac cgg tgg cac aat gaa cgg atc acc ttg tca act ggc 1392Leu Gly Pro Asn Arg Trp His Asn Glu Arg Ile Thr Leu Ser Thr Gly 450 455 460aaa agt gta tgg ctt ttc aac atc aca gcc gac cca tat gag agg gtg 1440Lys Ser Val Trp Leu Phe Asn Ile Thr Ala Asp Pro Tyr Glu Arg Val465 470 475 480gac cta tct aac agg tat cca gga atc gtg aag aag ctc cta cgg agg 1488Asp Leu Ser Asn Arg Tyr Pro Gly Ile Val Lys Lys Leu Leu Arg Arg 485 490 495ctc tca cag ttc aac aaa act gca gtg ccg gtc agg tat ccc ccc aaa 1536Leu Ser Gln Phe Asn Lys Thr Ala Val Pro Val Arg Tyr Pro Pro Lys 500 505 510gac ccc aga agt aac cct agg ctc aat gga ggg gtc tgg gga cca tgg 1584Asp Pro Arg Ser Asn Pro Arg Leu Asn Gly Gly Val Trp Gly Pro Trp 515 520 525tat aaa gag gaa acc aag aaa aag aag cca agc aaa aat cag gct gag 1632Tyr Lys Glu Glu Thr Lys Lys Lys Lys Pro Ser Lys Asn Gln Ala Glu 530 535 540aaa aag caa aag aaa agc aaa aaa aag aag aag aaa cag cag aaa gca 1680Lys Lys Gln Lys Lys Ser Lys Lys Lys Lys Lys Lys Gln Gln Lys Ala545 550 555 560gtc tca ggt tca act tgc cat tca ggt gtt act tgt gga taa 1722Val Ser Gly Ser Thr Cys His Ser Gly Val Thr Cys Gly 565 57091573PRTHomo sapiens 91Met Gly Ala Leu Ala Gly Phe Trp Ile Leu Cys Leu Leu Thr Tyr Gly1 5 10 15Tyr Leu Ser Trp Gly Gln Ala Leu Glu Glu Glu Glu Glu Gly Ala Leu 20 25 30Leu Ala Gln Ala Gly Glu Lys Leu Glu Pro Ser Thr Thr Ser Thr Ser 35 40 45Gln Pro His Leu Ile Phe Ile Leu Ala Asp Asp Gln Gly Phe Arg Asp 50 55 60Val Gly Tyr His Gly Ser Glu Ile Lys Thr Pro Thr Leu Asp Lys Leu65 70 75 80Ala Ala Glu Gly Val Lys Leu Glu Asn Tyr Tyr Val Gln Pro Ile Cys 85 90 95Thr Pro Ser Arg Ser Gln Phe Ile Thr Gly Lys Tyr Gln Ile His Thr 100 105 110Gly Leu Gln His Ser Ile Ile Arg Pro Thr Gln Pro Asn Cys Leu Pro 115 120 125Leu Asp Asn Ala Thr Leu Pro Gln Lys Leu Lys Glu Val Gly Tyr Ser 130 135 140Thr His Met Val Gly Lys Trp His Leu Gly Phe Tyr Arg Lys Glu Cys145 150 155 160Met Pro Thr Arg Arg Gly Phe Asp Thr Phe Phe Gly Ser Leu Leu Gly 165 170 175Ser Gly Asp Tyr Tyr Thr His Tyr Lys Cys Asp Ser Pro Gly Met Cys 180 185 190Gly Tyr Asp Leu Tyr Glu Asn Asp Asn Ala Ala Trp Asp Tyr Asp Asn 195 200 205Gly Ile Tyr Ser Thr Gln Met Tyr Thr Gln Arg Val Gln Gln Ile Leu 210 215 220Ala Ser His Asn Pro Thr Lys Pro Ile Phe Leu Tyr Ile Ala Tyr Gln225 230 235 240Ala Val His Ser Pro Leu Gln Ala Pro Gly Arg Tyr Phe Glu His Tyr 245 250 255Arg Ser Ile Ile Asn Ile Asn Arg Arg Arg Tyr Ala Ala Met Leu Ser 260 265 270Cys Leu Asp Glu Ala Ile Asn Asn Val Thr Leu Ala Leu Lys Thr Tyr 275 280 285Gly Phe Tyr Asn Asn Ser Ile Ile Ile Tyr Ser Ser Asp Asn Gly Gly 290 295 300Gln Pro Thr Ala Gly Gly Ser Asn Trp Pro Leu Arg Gly Ser Lys Gly305 310 315 320Thr Tyr Trp Glu Gly Gly Ile Arg Ala Val Gly Phe Val His Ser Pro 325 330 335Leu Leu Lys Asn Lys Gly Thr Val Cys Lys Glu Leu Val His Ile Thr 340 345 350Asp Trp Tyr Pro Thr Leu Ile Ser Leu Ala Glu Gly Gln Ile Asp Glu 355 360 365Asp Ile Gln Leu Asp Gly Tyr Asp Ile Trp Glu Thr Ile Ser

Glu Gly 370 375 380Leu Arg Ser Pro Arg Val Asp Ile Leu His Asn Ile Asp Pro Ile Tyr385 390 395 400Thr Lys Ala Lys Asn Gly Ser Trp Ala Ala Gly Tyr Gly Ile Trp Asn 405 410 415Thr Ala Ile Gln Ser Ala Ile Arg Val Gln His Trp Lys Leu Leu Thr 420 425 430Gly Asn Pro Gly Tyr Ser Asp Trp Val Pro Pro Gln Ser Phe Ser Asn 435 440 445Leu Gly Pro Asn Arg Trp His Asn Glu Arg Ile Thr Leu Ser Thr Gly 450 455 460Lys Ser Val Trp Leu Phe Asn Ile Thr Ala Asp Pro Tyr Glu Arg Val465 470 475 480Asp Leu Ser Asn Arg Tyr Pro Gly Ile Val Lys Lys Leu Leu Arg Arg 485 490 495Leu Ser Gln Phe Asn Lys Thr Ala Val Pro Val Arg Tyr Pro Pro Lys 500 505 510Asp Pro Arg Ser Asn Pro Arg Leu Asn Gly Gly Val Trp Gly Pro Trp 515 520 525Tyr Lys Glu Glu Thr Lys Lys Lys Lys Pro Ser Lys Asn Gln Ala Glu 530 535 540Lys Lys Gln Lys Lys Ser Lys Lys Lys Lys Lys Lys Gln Gln Lys Ala545 550 555 560Val Ser Gly Ser Thr Cys His Ser Gly Val Thr Cys Gly 565 570921710DNAHomo sapiensCDS(1)..(1707) 92atg cac acc ctc act ggc ttc tcc ctg gtc agc ctg ctc agc ttc ggc 48Met His Thr Leu Thr Gly Phe Ser Leu Val Ser Leu Leu Ser Phe Gly1 5 10 15tac ctg tcc tgg gac tgg gcc aag ccg agc ttc gtg gcc gac ggg ccc 96Tyr Leu Ser Trp Asp Trp Ala Lys Pro Ser Phe Val Ala Asp Gly Pro 20 25 30ggg gag gct ggc gag cag ccc tcg gcc gct ccg ccc cag cct ccc cac 144Gly Glu Ala Gly Glu Gln Pro Ser Ala Ala Pro Pro Gln Pro Pro His 35 40 45atc atc ttc atc ctc acg gac gac caa ggc tac cac gac gtg ggc tac 192Ile Ile Phe Ile Leu Thr Asp Asp Gln Gly Tyr His Asp Val Gly Tyr 50 55 60cat ggt tca gat atc gag acc cct acg ctg gac agg ctg gcg gcc aag 240His Gly Ser Asp Ile Glu Thr Pro Thr Leu Asp Arg Leu Ala Ala Lys65 70 75 80ggg gtc aag ttg gag aat tat tac atc cag ccc atc tgc acg cct tcg 288Gly Val Lys Leu Glu Asn Tyr Tyr Ile Gln Pro Ile Cys Thr Pro Ser 85 90 95cgg agc cag ctc ctc act ggc agg tac cag atc cac aca gga ctc cag 336Arg Ser Gln Leu Leu Thr Gly Arg Tyr Gln Ile His Thr Gly Leu Gln 100 105 110cat tcc atc atc cgc cca cag cag ccc aac tgc ctg ccc ctg gac cag 384His Ser Ile Ile Arg Pro Gln Gln Pro Asn Cys Leu Pro Leu Asp Gln 115 120 125gtg aca ctg cca cag aag ctg cag gag gca ggt tat tcc acc cat atg 432Val Thr Leu Pro Gln Lys Leu Gln Glu Ala Gly Tyr Ser Thr His Met 130 135 140gtg ggc aag tgg cac ctg ggc ttc tac cgg aag gag tgt ctg ccc acc 480Val Gly Lys Trp His Leu Gly Phe Tyr Arg Lys Glu Cys Leu Pro Thr145 150 155 160cgt cgg ggc ttc gac acc ttc ctg ggc tcg ctc acg ggc aat gtg gac 528Arg Arg Gly Phe Asp Thr Phe Leu Gly Ser Leu Thr Gly Asn Val Asp 165 170 175tat tac acc tat gac aac tgt gat ggc cca ggc gtg tgc ggc ttc gac 576Tyr Tyr Thr Tyr Asp Asn Cys Asp Gly Pro Gly Val Cys Gly Phe Asp 180 185 190ctg cac gag ggt gag aat gtg gcc tgg ggg ctc agc ggc cag tac tcc 624Leu His Glu Gly Glu Asn Val Ala Trp Gly Leu Ser Gly Gln Tyr Ser 195 200 205act atg ctt tac gcc cag cgc gcc agc cat atc ctg gcc agc cac agc 672Thr Met Leu Tyr Ala Gln Arg Ala Ser His Ile Leu Ala Ser His Ser 210 215 220cct cag cgt ccc ctc ttc ctc tat gtg gcc ttc cag gca gta cac aca 720Pro Gln Arg Pro Leu Phe Leu Tyr Val Ala Phe Gln Ala Val His Thr225 230 235 240ccc ctg cag tcc cct cgt gag tac ctg tac cgc tac cgc acc atg ggc 768Pro Leu Gln Ser Pro Arg Glu Tyr Leu Tyr Arg Tyr Arg Thr Met Gly 245 250 255aat gtg gcc cgg cgg aag tac gcg gcc atg gtg acc tgc atg gat gag 816Asn Val Ala Arg Arg Lys Tyr Ala Ala Met Val Thr Cys Met Asp Glu 260 265 270gct gtg cgc aac atc acc tgg gcc ctc aag cgc tac ggt ttc tac aac 864Ala Val Arg Asn Ile Thr Trp Ala Leu Lys Arg Tyr Gly Phe Tyr Asn 275 280 285aac agt gtc atc atc ttc tcc agt gac aat ggt ggc cag act ttc tcg 912Asn Ser Val Ile Ile Phe Ser Ser Asp Asn Gly Gly Gln Thr Phe Ser 290 295 300ggg ggc agc aac tgg ccg ctc cga gga cgc aag ggc act tat tgg gaa 960Gly Gly Ser Asn Trp Pro Leu Arg Gly Arg Lys Gly Thr Tyr Trp Glu305 310 315 320ggt ggc gtg cgg ggc cta ggc ttt gtc cac agt ccc ctg ctc aag cga 1008Gly Gly Val Arg Gly Leu Gly Phe Val His Ser Pro Leu Leu Lys Arg 325 330 335aag caa cgg aca agc cgg gca ctg atg cac atc act gac tgg tac ccg 1056Lys Gln Arg Thr Ser Arg Ala Leu Met His Ile Thr Asp Trp Tyr Pro 340 345 350acc ctg gtg ggt ctg gca ggt ggt acc acc tca gca gcc gat ggg cta 1104Thr Leu Val Gly Leu Ala Gly Gly Thr Thr Ser Ala Ala Asp Gly Leu 355 360 365gat ggc tac gac gtg tgg ccg gcc atc agc gag ggc cgg gcc tca cca 1152Asp Gly Tyr Asp Val Trp Pro Ala Ile Ser Glu Gly Arg Ala Ser Pro 370 375 380cgc acg gag atc ctg cac aac att gac cca ctc tac aac cat gcc cag 1200Arg Thr Glu Ile Leu His Asn Ile Asp Pro Leu Tyr Asn His Ala Gln385 390 395 400cat ggc tcc ctg gag ggc ggc ttt ggc atc tgg aac acc gcc gtg cag 1248His Gly Ser Leu Glu Gly Gly Phe Gly Ile Trp Asn Thr Ala Val Gln 405 410 415gct gcc atc cgc gtg ggt gag tgg aag ctg ctg aca gga gac ccc ggc 1296Ala Ala Ile Arg Val Gly Glu Trp Lys Leu Leu Thr Gly Asp Pro Gly 420 425 430tat ggc gat tgg atc cca ccg cag aca ctg gcc acc ttc ccg ggt agc 1344Tyr Gly Asp Trp Ile Pro Pro Gln Thr Leu Ala Thr Phe Pro Gly Ser 435 440 445tgg tgg aac ctg gaa cga atg gcc agt gtc cgc cag gcc gtg tgg ctc 1392Trp Trp Asn Leu Glu Arg Met Ala Ser Val Arg Gln Ala Val Trp Leu 450 455 460ttc aac atc agt gct gac cct tat gaa cgg gag gac ctg gct ggc cag 1440Phe Asn Ile Ser Ala Asp Pro Tyr Glu Arg Glu Asp Leu Ala Gly Gln465 470 475 480cgg cct gat gtg gtc cgc acc ctg ctg gct cgc ctg gcc gaa tat aac 1488Arg Pro Asp Val Val Arg Thr Leu Leu Ala Arg Leu Ala Glu Tyr Asn 485 490 495cgc aca gcc atc ccg gta cgc tac cca gct gag aac ccc cgg gct cat 1536Arg Thr Ala Ile Pro Val Arg Tyr Pro Ala Glu Asn Pro Arg Ala His 500 505 510cct gac ttt aat ggg ggt gct tgg ggg ccc tgg gcc agt gat gag gaa 1584Pro Asp Phe Asn Gly Gly Ala Trp Gly Pro Trp Ala Ser Asp Glu Glu 515 520 525gag gag gaa gag gaa ggg agg gct cga agc ttc tcc cgg ggt cgt cgc 1632Glu Glu Glu Glu Glu Gly Arg Ala Arg Ser Phe Ser Arg Gly Arg Arg 530 535 540aag aaa aaa tgc aag att tgc aag ctt cga tcc ttt ttc cgt aaa ctc 1680Lys Lys Lys Cys Lys Ile Cys Lys Leu Arg Ser Phe Phe Arg Lys Leu545 550 555 560aac acc agg cta atg tcc caa cgg atc tga 1710Asn Thr Arg Leu Met Ser Gln Arg Ile 56593569PRTHomo sapiens 93Met His Thr Leu Thr Gly Phe Ser Leu Val Ser Leu Leu Ser Phe Gly1 5 10 15Tyr Leu Ser Trp Asp Trp Ala Lys Pro Ser Phe Val Ala Asp Gly Pro 20 25 30Gly Glu Ala Gly Glu Gln Pro Ser Ala Ala Pro Pro Gln Pro Pro His 35 40 45Ile Ile Phe Ile Leu Thr Asp Asp Gln Gly Tyr His Asp Val Gly Tyr 50 55 60His Gly Ser Asp Ile Glu Thr Pro Thr Leu Asp Arg Leu Ala Ala Lys65 70 75 80Gly Val Lys Leu Glu Asn Tyr Tyr Ile Gln Pro Ile Cys Thr Pro Ser 85 90 95Arg Ser Gln Leu Leu Thr Gly Arg Tyr Gln Ile His Thr Gly Leu Gln 100 105 110His Ser Ile Ile Arg Pro Gln Gln Pro Asn Cys Leu Pro Leu Asp Gln 115 120 125Val Thr Leu Pro Gln Lys Leu Gln Glu Ala Gly Tyr Ser Thr His Met 130 135 140Val Gly Lys Trp His Leu Gly Phe Tyr Arg Lys Glu Cys Leu Pro Thr145 150 155 160Arg Arg Gly Phe Asp Thr Phe Leu Gly Ser Leu Thr Gly Asn Val Asp 165 170 175Tyr Tyr Thr Tyr Asp Asn Cys Asp Gly Pro Gly Val Cys Gly Phe Asp 180 185 190Leu His Glu Gly Glu Asn Val Ala Trp Gly Leu Ser Gly Gln Tyr Ser 195 200 205Thr Met Leu Tyr Ala Gln Arg Ala Ser His Ile Leu Ala Ser His Ser 210 215 220Pro Gln Arg Pro Leu Phe Leu Tyr Val Ala Phe Gln Ala Val His Thr225 230 235 240Pro Leu Gln Ser Pro Arg Glu Tyr Leu Tyr Arg Tyr Arg Thr Met Gly 245 250 255Asn Val Ala Arg Arg Lys Tyr Ala Ala Met Val Thr Cys Met Asp Glu 260 265 270Ala Val Arg Asn Ile Thr Trp Ala Leu Lys Arg Tyr Gly Phe Tyr Asn 275 280 285Asn Ser Val Ile Ile Phe Ser Ser Asp Asn Gly Gly Gln Thr Phe Ser 290 295 300Gly Gly Ser Asn Trp Pro Leu Arg Gly Arg Lys Gly Thr Tyr Trp Glu305 310 315 320Gly Gly Val Arg Gly Leu Gly Phe Val His Ser Pro Leu Leu Lys Arg 325 330 335Lys Gln Arg Thr Ser Arg Ala Leu Met His Ile Thr Asp Trp Tyr Pro 340 345 350Thr Leu Val Gly Leu Ala Gly Gly Thr Thr Ser Ala Ala Asp Gly Leu 355 360 365Asp Gly Tyr Asp Val Trp Pro Ala Ile Ser Glu Gly Arg Ala Ser Pro 370 375 380Arg Thr Glu Ile Leu His Asn Ile Asp Pro Leu Tyr Asn His Ala Gln385 390 395 400His Gly Ser Leu Glu Gly Gly Phe Gly Ile Trp Asn Thr Ala Val Gln 405 410 415Ala Ala Ile Arg Val Gly Glu Trp Lys Leu Leu Thr Gly Asp Pro Gly 420 425 430Tyr Gly Asp Trp Ile Pro Pro Gln Thr Leu Ala Thr Phe Pro Gly Ser 435 440 445Trp Trp Asn Leu Glu Arg Met Ala Ser Val Arg Gln Ala Val Trp Leu 450 455 460Phe Asn Ile Ser Ala Asp Pro Tyr Glu Arg Glu Asp Leu Ala Gly Gln465 470 475 480Arg Pro Asp Val Val Arg Thr Leu Leu Ala Arg Leu Ala Glu Tyr Asn 485 490 495Arg Thr Ala Ile Pro Val Arg Tyr Pro Ala Glu Asn Pro Arg Ala His 500 505 510Pro Asp Phe Asn Gly Gly Ala Trp Gly Pro Trp Ala Ser Asp Glu Glu 515 520 525Glu Glu Glu Glu Glu Gly Arg Ala Arg Ser Phe Ser Arg Gly Arg Arg 530 535 540Lys Lys Lys Cys Lys Ile Cys Lys Leu Arg Ser Phe Phe Arg Lys Leu545 550 555 560Asn Thr Arg Leu Met Ser Gln Arg Ile 565942067DNAHomo sapiensCDS(1)..(2064) 94atg cta att tca gga aga gaa gag aac caa ata gac ata tcc aag acc 48Met Leu Ile Ser Gly Arg Glu Glu Asn Gln Ile Asp Ile Ser Lys Thr1 5 10 15aca gag gta gat tgt ttt gtg gtt gaa tta gga agt cta cac aat cct 96Thr Glu Val Asp Cys Phe Val Val Glu Leu Gly Ser Leu His Asn Pro 20 25 30aca cgg aac cca cag cga att ttc acc aag cac gtg gcc acc aag tca 144Thr Arg Asn Pro Gln Arg Ile Phe Thr Lys His Val Ala Thr Lys Ser 35 40 45tcc agc tcc aaa tgt cag ctg gac caa ggt gga aaa agc ctg gtc cag 192Ser Ser Ser Lys Cys Gln Leu Asp Gln Gly Gly Lys Ser Leu Val Gln 50 55 60tgc att tta ccc aga tct tca aag ctc ctc tca ccc ttg tgt ctc ccc 240Cys Ile Leu Pro Arg Ser Ser Lys Leu Leu Ser Pro Leu Cys Leu Pro65 70 75 80cat ccg tgt gga gct tta ctt ctg tat aga tcc tca gga atc gcc tct 288His Pro Cys Gly Ala Leu Leu Leu Tyr Arg Ser Ser Gly Ile Ala Ser 85 90 95gct ctt gct gcc ttt aca gac tcc ctc tct agg agc tgc tgg ctg tca 336Ala Leu Ala Ala Phe Thr Asp Ser Leu Ser Arg Ser Cys Trp Leu Ser 100 105 110gtg tcc ctg tgc tgt ttg ttt tgc ggt gtt gat ggc aca ttt atg aca 384Val Ser Leu Cys Cys Leu Phe Cys Gly Val Asp Gly Thr Phe Met Thr 115 120 125aga aac gcc aga ccc aac att gtc ctg ctg atg gca gat gac ctt gga 432Arg Asn Ala Arg Pro Asn Ile Val Leu Leu Met Ala Asp Asp Leu Gly 130 135 140gtg ggg gat ttg tgc tgc tac ggt aat aac tca gtg agc aca cct aat 480Val Gly Asp Leu Cys Cys Tyr Gly Asn Asn Ser Val Ser Thr Pro Asn145 150 155 160att gac cgc ctg gca agt gaa gga gtg agg ctt acc cag cat ctc gca 528Ile Asp Arg Leu Ala Ser Glu Gly Val Arg Leu Thr Gln His Leu Ala 165 170 175gct gct tcc atg tgc acc cca agt cgg gct gcc ttc ctg acc ggc cgg 576Ala Ala Ser Met Cys Thr Pro Ser Arg Ala Ala Phe Leu Thr Gly Arg 180 185 190tac ccc atc aga tca ggg atg gtg tct gcc tac aac ctg aac cgt gcc 624Tyr Pro Ile Arg Ser Gly Met Val Ser Ala Tyr Asn Leu Asn Arg Ala 195 200 205ttc acg tgg ctt ggt ggg tca ggt ggt ctt ccc acc aat gaa acg act 672Phe Thr Trp Leu Gly Gly Ser Gly Gly Leu Pro Thr Asn Glu Thr Thr 210 215 220ttt gcc aag ctg ctg cag cac cgt ggc tac cgc acg gga ctc ata ggc 720Phe Ala Lys Leu Leu Gln His Arg Gly Tyr Arg Thr Gly Leu Ile Gly225 230 235 240aaa tgg cac ctg ggt ttg agc tgc gcc tct cgg aat gat cac tgt tac 768Lys Trp His Leu Gly Leu Ser Cys Ala Ser Arg Asn Asp His Cys Tyr 245 250 255cac ccg ctc aac cat ggt ttt cac tac ttt tac ggg gtg cct ttt gga 816His Pro Leu Asn His Gly Phe His Tyr Phe Tyr Gly Val Pro Phe Gly 260 265 270ctt tta agc gac tgc cag gca tcc aag aca cca gaa ctg cac cgc tgg 864Leu Leu Ser Asp Cys Gln Ala Ser Lys Thr Pro Glu Leu His Arg Trp 275 280 285ctc agg atc aaa ctg tgg atc tcc acg gta gcc ctt gcc ctg gtt cct 912Leu Arg Ile Lys Leu Trp Ile Ser Thr Val Ala Leu Ala Leu Val Pro 290 295 300ttt ctg ctt ctc att ccc aag ttc gcc cgc tgg ttc tca gtg cca tgg 960Phe Leu Leu Leu Ile Pro Lys Phe Ala Arg Trp Phe Ser Val Pro Trp305 310 315 320aag gtc atc ttt gtc ttt gct ctc ctc gcc ttt ctg ttt ttc act tcc 1008Lys Val Ile Phe Val Phe Ala Leu Leu Ala Phe Leu Phe Phe Thr Ser 325 330 335tgg tac tct agt tat gga ttt act cga cgt tgg aat tgc atc ctt atg 1056Trp Tyr Ser Ser Tyr Gly Phe Thr Arg Arg Trp Asn Cys Ile Leu Met 340 345 350agg aac cat gaa att atc cag cag cca atg aaa gag gag aaa gta gct 1104Arg Asn His Glu Ile Ile Gln Gln Pro Met Lys Glu Glu Lys Val Ala 355 360 365tcc ctc atg ctg aag gag gca ctt gct ttc att gaa agg tac aaa agg 1152Ser Leu Met Leu Lys Glu Ala Leu Ala Phe Ile Glu Arg Tyr Lys Arg 370 375 380gaa cct ttt ctc ctc ttt ttt tcc ttc ctg cac gta cat act cca ctc 1200Glu Pro Phe Leu Leu Phe Phe Ser Phe Leu His Val His Thr Pro Leu385 390 395 400atc tcc aaa aag aag ttt gtt ggg cgc agt aaa tat ggc agg tat ggg 1248Ile Ser Lys Lys Lys Phe Val Gly Arg Ser Lys Tyr Gly Arg Tyr Gly 405 410 415gac aat gta gaa gaa atg gat tgg atg gtg ggt aaa atc ctg gat gcc 1296Asp Asn Val Glu Glu Met Asp Trp Met Val Gly Lys Ile Leu Asp Ala 420 425 430ctg gac cag gag cgc ctg gcc aac cac acc ttg gtg tac ttc acc tct 1344Leu Asp Gln Glu Arg Leu Ala Asn His Thr Leu Val Tyr Phe Thr Ser 435 440 445gac aac ggg ggc cac ctg gag ccc ctg gac ggg gct gtt cag ctg ggt 1392Asp Asn Gly Gly His Leu Glu Pro Leu Asp Gly Ala Val Gln Leu Gly 450 455 460ggc tgg aac ggg atc tac aaa ggt ggc aaa gga atg gga gga tgg gaa 1440Gly Trp Asn Gly Ile Tyr Lys Gly Gly Lys Gly Met Gly Gly Trp Glu465 470 475 480gga ggt atc cgt gtg cca ggg ata ttc cgg tgg ccg tca gtc ttg gag 1488Gly Gly Ile Arg

Val Pro Gly Ile Phe Arg Trp Pro Ser Val Leu Glu 485 490 495gct ggg aga gtg atc aat gag ccc acc agc tta atg gac atc tat ccg 1536Ala Gly Arg Val Ile Asn Glu Pro Thr Ser Leu Met Asp Ile Tyr Pro 500 505 510acg ctg tct tat ata ggc gga ggg atc ttg tcc cag gac aga gtg att 1584Thr Leu Ser Tyr Ile Gly Gly Gly Ile Leu Ser Gln Asp Arg Val Ile 515 520 525gac ggc cag aac cta atg ccc ctg ctg gaa gga agg gcg tcc cac tcc 1632Asp Gly Gln Asn Leu Met Pro Leu Leu Glu Gly Arg Ala Ser His Ser 530 535 540gac cac gag ttc ctc ttc cac tac tgt ggg gtc tat ctg cac acg gtc 1680Asp His Glu Phe Leu Phe His Tyr Cys Gly Val Tyr Leu His Thr Val545 550 555 560agg tgg cat cag aag gac tgt gca act gtg tgg aaa gct cat tat gtg 1728Arg Trp His Gln Lys Asp Cys Ala Thr Val Trp Lys Ala His Tyr Val 565 570 575act cct aaa ttc tac cct gaa gga aca ggt gcc tgc tat ggg agt gga 1776Thr Pro Lys Phe Tyr Pro Glu Gly Thr Gly Ala Cys Tyr Gly Ser Gly 580 585 590ata tgt tca tgt tcg ggg gat gta acc tac cac gac cca cca ctc ctc 1824Ile Cys Ser Cys Ser Gly Asp Val Thr Tyr His Asp Pro Pro Leu Leu 595 600 605ttt gac atc tca aga gac cct tca gaa gcc ctt cca ctg aac cct gac 1872Phe Asp Ile Ser Arg Asp Pro Ser Glu Ala Leu Pro Leu Asn Pro Asp 610 615 620aat gag cca tta ttt gac tcc gtg atc aaa aag atg gag gca gcc ata 1920Asn Glu Pro Leu Phe Asp Ser Val Ile Lys Lys Met Glu Ala Ala Ile625 630 635 640aga gag cat cgt agg aca cta aca cct gtc cca cag cag ttc tct gtg 1968Arg Glu His Arg Arg Thr Leu Thr Pro Val Pro Gln Gln Phe Ser Val 645 650 655ttc aac aca att tgg aaa cca tgg ctg cag cct tgc tgt ggg acc ttc 2016Phe Asn Thr Ile Trp Lys Pro Trp Leu Gln Pro Cys Cys Gly Thr Phe 660 665 670ccc ttc tgt ggg tgt gac aag gaa gat gac atc ctt ccc atg gct ccc 2064Pro Phe Cys Gly Cys Asp Lys Glu Asp Asp Ile Leu Pro Met Ala Pro 675 680 685tga 206795688PRTHomo sapiens 95Met Leu Ile Ser Gly Arg Glu Glu Asn Gln Ile Asp Ile Ser Lys Thr1 5 10 15Thr Glu Val Asp Cys Phe Val Val Glu Leu Gly Ser Leu His Asn Pro 20 25 30Thr Arg Asn Pro Gln Arg Ile Phe Thr Lys His Val Ala Thr Lys Ser 35 40 45Ser Ser Ser Lys Cys Gln Leu Asp Gln Gly Gly Lys Ser Leu Val Gln 50 55 60Cys Ile Leu Pro Arg Ser Ser Lys Leu Leu Ser Pro Leu Cys Leu Pro65 70 75 80His Pro Cys Gly Ala Leu Leu Leu Tyr Arg Ser Ser Gly Ile Ala Ser 85 90 95Ala Leu Ala Ala Phe Thr Asp Ser Leu Ser Arg Ser Cys Trp Leu Ser 100 105 110Val Ser Leu Cys Cys Leu Phe Cys Gly Val Asp Gly Thr Phe Met Thr 115 120 125Arg Asn Ala Arg Pro Asn Ile Val Leu Leu Met Ala Asp Asp Leu Gly 130 135 140Val Gly Asp Leu Cys Cys Tyr Gly Asn Asn Ser Val Ser Thr Pro Asn145 150 155 160Ile Asp Arg Leu Ala Ser Glu Gly Val Arg Leu Thr Gln His Leu Ala 165 170 175Ala Ala Ser Met Cys Thr Pro Ser Arg Ala Ala Phe Leu Thr Gly Arg 180 185 190Tyr Pro Ile Arg Ser Gly Met Val Ser Ala Tyr Asn Leu Asn Arg Ala 195 200 205Phe Thr Trp Leu Gly Gly Ser Gly Gly Leu Pro Thr Asn Glu Thr Thr 210 215 220Phe Ala Lys Leu Leu Gln His Arg Gly Tyr Arg Thr Gly Leu Ile Gly225 230 235 240Lys Trp His Leu Gly Leu Ser Cys Ala Ser Arg Asn Asp His Cys Tyr 245 250 255His Pro Leu Asn His Gly Phe His Tyr Phe Tyr Gly Val Pro Phe Gly 260 265 270Leu Leu Ser Asp Cys Gln Ala Ser Lys Thr Pro Glu Leu His Arg Trp 275 280 285Leu Arg Ile Lys Leu Trp Ile Ser Thr Val Ala Leu Ala Leu Val Pro 290 295 300Phe Leu Leu Leu Ile Pro Lys Phe Ala Arg Trp Phe Ser Val Pro Trp305 310 315 320Lys Val Ile Phe Val Phe Ala Leu Leu Ala Phe Leu Phe Phe Thr Ser 325 330 335Trp Tyr Ser Ser Tyr Gly Phe Thr Arg Arg Trp Asn Cys Ile Leu Met 340 345 350Arg Asn His Glu Ile Ile Gln Gln Pro Met Lys Glu Glu Lys Val Ala 355 360 365Ser Leu Met Leu Lys Glu Ala Leu Ala Phe Ile Glu Arg Tyr Lys Arg 370 375 380Glu Pro Phe Leu Leu Phe Phe Ser Phe Leu His Val His Thr Pro Leu385 390 395 400Ile Ser Lys Lys Lys Phe Val Gly Arg Ser Lys Tyr Gly Arg Tyr Gly 405 410 415Asp Asn Val Glu Glu Met Asp Trp Met Val Gly Lys Ile Leu Asp Ala 420 425 430Leu Asp Gln Glu Arg Leu Ala Asn His Thr Leu Val Tyr Phe Thr Ser 435 440 445Asp Asn Gly Gly His Leu Glu Pro Leu Asp Gly Ala Val Gln Leu Gly 450 455 460Gly Trp Asn Gly Ile Tyr Lys Gly Gly Lys Gly Met Gly Gly Trp Glu465 470 475 480Gly Gly Ile Arg Val Pro Gly Ile Phe Arg Trp Pro Ser Val Leu Glu 485 490 495Ala Gly Arg Val Ile Asn Glu Pro Thr Ser Leu Met Asp Ile Tyr Pro 500 505 510Thr Leu Ser Tyr Ile Gly Gly Gly Ile Leu Ser Gln Asp Arg Val Ile 515 520 525Asp Gly Gln Asn Leu Met Pro Leu Leu Glu Gly Arg Ala Ser His Ser 530 535 540Asp His Glu Phe Leu Phe His Tyr Cys Gly Val Tyr Leu His Thr Val545 550 555 560Arg Trp His Gln Lys Asp Cys Ala Thr Val Trp Lys Ala His Tyr Val 565 570 575Thr Pro Lys Phe Tyr Pro Glu Gly Thr Gly Ala Cys Tyr Gly Ser Gly 580 585 590Ile Cys Ser Cys Ser Gly Asp Val Thr Tyr His Asp Pro Pro Leu Leu 595 600 605Phe Asp Ile Ser Arg Asp Pro Ser Glu Ala Leu Pro Leu Asn Pro Asp 610 615 620Asn Glu Pro Leu Phe Asp Ser Val Ile Lys Lys Met Glu Ala Ala Ile625 630 635 640Arg Glu His Arg Arg Thr Leu Thr Pro Val Pro Gln Gln Phe Ser Val 645 650 655Phe Asn Thr Ile Trp Lys Pro Trp Leu Gln Pro Cys Cys Gly Thr Phe 660 665 670Pro Phe Cys Gly Cys Asp Lys Glu Asp Asp Ile Leu Pro Met Ala Pro 675 680 685964PRTHomo sapiens 96Lys Asp Glu Leu1

* * * * *


uspto.report is an independent third-party trademark research tool that is not affiliated, endorsed, or sponsored by the United States Patent and Trademark Office (USPTO) or any other governmental organization. The information provided by uspto.report is based on publicly available data at the time of writing and is intended for informational purposes only.

While we strive to provide accurate and up-to-date information, we do not guarantee the accuracy, completeness, reliability, or suitability of the information displayed on this site. The use of this site is at your own risk. Any reliance you place on such information is therefore strictly at your own risk.

All official trademark data, including owner information, should be verified by visiting the official USPTO website at www.uspto.gov. This site is not intended to replace professional legal advice and should not be used as a substitute for consulting with a legal professional who is knowledgeable about trademark law.

© 2024 USPTO.report | Privacy Policy | Resources | RSS Feed of Trademarks | Trademark Filings Twitter Feed