U.S. patent application number 13/584610 was filed with the patent office on 2013-01-17 for biomarkers for predicting response of esophageal cancer patient to chemoradiotherapy.
This patent application is currently assigned to NATIONAL TAIWAN UNIVERSITY. The applicant listed for this patent is Pei-Chun Chen, Shin-Kuang Chen, Yen-Ching Chen, Eric Y. Chuang, Chuhsing K. Hsiao, Liang-Chuan Lai, Jang-Ming Lee, Mong-Hsun Tsai, Pei-Wen Yang. Invention is credited to Pei-Chun Chen, Shin-Kuang Chen, Yen-Ching Chen, Eric Y. Chuang, Chuhsing K. Hsiao, Liang-Chuan Lai, Jang-Ming Lee, Mong-Hsun Tsai, Pei-Wen Yang.
Application Number | 20130017961 13/584610 |
Document ID | / |
Family ID | 43879589 |
Filed Date | 2013-01-17 |
United States Patent
Application |
20130017961 |
Kind Code |
A1 |
Chen; Pei-Chun ; et
al. |
January 17, 2013 |
Biomarkers for predicting response of esophageal cancer patient to
chemoradiotherapy
Abstract
The present invention relates to novel genetic markers
associated with response of a patient with esophageal cancer (ECa)
to chemoradiation therapy, and particularly to methods and kits for
predicting an ECa patient's response to chemoradiation therapy by
genotyping of the markers.
Inventors: |
Chen; Pei-Chun; (Taipei
City, TW) ; Chen; Yen-Ching; (Taipei City, TW)
; Lai; Liang-Chuan; (Taipei City, TW) ; Tsai;
Mong-Hsun; (Taipei City, TW) ; Chen; Shin-Kuang;
(Taipei City, TW) ; Yang; Pei-Wen; (Keelung City,
TW) ; Lee; Jang-Ming; (Taipei City, TW) ;
Chuang; Eric Y.; (Taipei City, TW) ; Hsiao; Chuhsing
K.; (Taipei City, TW) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Chen; Pei-Chun
Chen; Yen-Ching
Lai; Liang-Chuan
Tsai; Mong-Hsun
Chen; Shin-Kuang
Yang; Pei-Wen
Lee; Jang-Ming
Chuang; Eric Y.
Hsiao; Chuhsing K. |
Taipei City
Taipei City
Taipei City
Taipei City
Taipei City
Keelung City
Taipei City
Taipei City
Taipei City |
|
TW
TW
TW
TW
TW
TW
TW
TW
TW |
|
|
Assignee: |
NATIONAL TAIWAN UNIVERSITY
Taipei
TW
|
Family ID: |
43879589 |
Appl. No.: |
13/584610 |
Filed: |
August 13, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12582357 |
Oct 20, 2009 |
8268562 |
|
|
13584610 |
|
|
|
|
Current U.S.
Class: |
506/6 |
Current CPC
Class: |
C12Q 1/6886 20130101;
C12Q 2600/156 20130101; C12Q 2600/106 20130101 |
Class at
Publication: |
506/6 |
International
Class: |
C40B 20/08 20060101
C40B020/08 |
Claims
1. A method of predicting an increased likelihood of response of a
human patient with esophageal cancer to radiochemotherapy and
subsequent esophagectomy, wherein the radiochemotherapy comprises
radiation in conjunction with cisplatin, 5-fluorouracil and/or
paciltaxtel, comprising: obtaining a sample from the human patient
with esophageal cancer; detecting in the sample the presence of a
guanine at the polymorphic position of rs16863886; and predicting
the human patient with the guanine at the polymorphic position of
rs16863886 has an increased likelihood of responding to
radiochemotherapy and subsequent esophagectomy than a subject
without the guanine at the polymorphic position of rs16863886.
2. The method of claim 1, further comprising providing a pair of
primers having the sequence of SEQ ID NOS: 5 and 6, respectively,
to detect the guanine at the polymorphic position of rs16863886.
Description
FIELD OF THE INVENTION
[0001] The present invention generally relates to genetic markers,
and more particularly to single nucleotide polymorphisms associated
with the response of a patient having esophageal cancer to
chemoradiotherapy.
BACKGROUND OF THE INVENTION
[0002] Esophageal cancer (ECa) has become the 6.sup.th leading
cause of cancer death in the world, and its incidence rate
continues to increase worldwide. Unfortunately, most patients with
esophageal cancer have advanced disease at the time of initial
diagnosis and ineligible for curative surgical resection. Recently,
multimodality therapies have been attempted to improve the
resectability of tumors and the long-term survival of patients.
Among them, concurrent chemoradiation therapy (CCRT) in a
neoadjuvant setting followed by esophagogastrectomy has been widely
applied in current clinical practice. However, it is found that
individual variation in response to CCRT exists and is associated
with different treatment outcomes. Patients with a complete
response to CCRT tends to have an increased survival rate, but
survival of patients without an evident response to CCRT may be
compromised due to treatment-related toxicity and delays in
surgical resection. Although studies have focused for biomarkers
associated with the patients' response to chemoradiotherapy (The
pharmacogenomics journal 2009; 9:202-7; Cancer Lett 2008;
260:109-17; and Int J Cancer 2008; 123:826-30), no reliable genetic
markers are currently available.
[0003] There is still a need for a genetic marker that is
predictive of an ECa patient's response to chemoradiotherapy, and
thus helpful in preventing unnecessary treatments and determining
the most appropriate treatment for patients.
BRIEF SUMMARY OF THE INVENTION
[0004] In one aspect, the present invention provides a method of
predicting response of a patient suffering from esophageal cancer
to chemoradiotherapy, which comprises genotyping a test sample from
the patient for a single nucleotide polymorphism (SNP) marker
selected from the group consisting of rs4954256 and rs16863886 and
a combination thereof, wherein the presence of a C allele in
rs4954256, a G allele in rs16863886 or both is indicative of an
increased likelihood of having a complete response to
chemoradiotherapy.
[0005] In another aspect, the present invention provides a kit for
performing the method as described herein comprising one or more
isolated polynucleotides for conducting the genotyping of
rs4954256, rs16863886 or a combination thereof. In one embodiment,
the kit comprises a first set of isolated polynucleotides for
conducting the genotyping of rs16863886. In another embodiment, the
kit comprises a second set of isolated polynucleotides for
conducting the genotyping of rs4954256.
[0006] The various embodiments of the present invention are
described in details below. Other characteristics of the present
invention will be clearly presented by the following detailed
description about the various embodiments and claims.
[0007] It is believed that a person of ordinary knowledge in the
art where the present invention belongs can utilize the present
invention to its broadest scope based on the description herein
with no need of further illustration. Therefore, the following
description should be understood as of demonstrative purpose
instead of limitative in any way to the scope of the present
invention.
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS
[0008] The foregoing summary, as well as the following detailed
description of the invention, will be better understood when read
in conjunction with the appended drawings. For the purpose of
illustrating the invention, there are shown in the drawings
embodiments which are presently preferred. It should be understood,
however, that the invention is not limited to the preferred
embodiments shown.
[0009] In the drawings:
[0010] FIG. 1 shows an overview of the study design for the
examples below.
DETAILED DESCRIPTION OF THE INVENTION
[0011] The present invention features two SNP markers, rs4954256
and rs16863886, identified by a two-stage genome-wide association
study (GWAS), which are significantly associated with a complete
CCRT response of an ECa patient and provide a high level of
prediction accuracy.
[0012] Unless defined otherwise, all technical and scientific terms
used herein have the meaning commonly understood by a person
skilled in the art to which this invention belongs.
[0013] The articles "a" and "an" are used herein to refer to one or
more than one (i.e., at least one) of the grammatical object of the
article.
[0014] As used herein, the term "polynucleotide", "nucleic acid" or
"nucleic acid molecule" refers to a polymer composed of nucleotide
units, including naturally occurring nucleic acids, such as
deoxyribonucleic acid ("DNA") and ribonucleic acid ("RNA") as well
as nucleic acid analogs including those which have non-naturally
occurring nucleotides. Polynucleotide can be synthesized, for
example, using an automated DNA synthesizer. The term "nucleic
acid" or "nucleic acid molecule" typically refers to a large
polynucleotide. It will be understood that when a nucleic acid
fragment is represented by a DNA sequence (i.e., A, T, G, C), this
also includes an RNA sequence (i.e., A, U, G, C) in which "U"
replaces "T."
[0015] As used herein, the term "isolated" with respect to nucleic
acids, such as DNA or RNA, refers to molecules separated from other
DNAs or RNAs, respectively, which are present in the natural source
of the macromolecule. The term isolated as used herein also refers
to a nucleic acid that is substantially free of cellular material,
viral material, or culture medium when produced by recombinant DNA
techniques, or chemical precursors or other chemicals when
chemically synthesized. Moreover, an "isolated nucleic acid" is
meant to include nucleic acid fragments which are not naturally
occurring as fragments and would not be found in the natural
state.
[0016] As used herein, the term "allele" refers to variants of a
nucleotide sequence. A biallelic polymorphism has two forms.
Diploid organisms may be homozygous or heterozygous for an allelic
form.
[0017] As used herein, the term "SNP" refers to single nucleotide
polymorphisms in DNA. SNPs are usually preceded and followed by
highly conserved sequences that vary in less than 1/100 or 1/1000
members of the population. An individual may be homozygous or
heterozygous for an allele at each SNP position. A SNP may, in some
instances, be referred to as a "cSNP" to denote that the nucleotide
sequence containing the SNP is an amino acid "coding" sequence. A
SNP may arise from a substitution of one nucleotide for another at
the polymorphic site. Substitutions can be transitions or
transversions. A transition is the replacement of one purine
nucleotide by another purine nucleotide, or one pyrimidine by
another pyrimidine. A transversion is the replacement of a purine
by a pyrimidine, or vice versa. For example, if at a particular
chromosomal location, one member of a population has an adenine (A)
and another member of the population has a cytosine (C) at the same
position, then this position is a SNP. Alleles for SNP markers as
referred to herein are expressed by the bases A, C, G or T as they
occur at the polymorphic site in the SNP assay employed.
[0018] The nomenclature of SNPs as described herein refers to the
official Reference SNP (rs) ID identification tag as assigned to
each unique SNP by the National Center for Biotechnological
Information (NCBI). The database is assessible to the public at
www.ncbi.nlm.nih.gov/SNP/index.html.
[0019] As used herein, the term "genotype" means the identification
of the alleles present in an individual or a sample. The term
"genotyping" a sample or an individual for a genetic marker may
comprise determination of which allele or alleles an individual
carries for one or more SNPs. For example, a particular nucleotide
in a genome may be an A in some individuals and a C in other
individuals. Those individuals who have an A at the position have
the A allele and those who have a C have the C allele. In a diploid
organism the individual will have two copies of the sequence
containing the polymorphic position. So the individual may have an
A allele and a C allele, or alternatively two copies of the A
allele, or two copies of the C allele. Each allele may be present
at a different frequency in a given population. Those individuals
who have two copies of the C allele are homozygous for the C allele
and the genotype is CC, those individuals who have two copies of
the A allele are homozygous for the A allele and the genotype is
AA, and those individuals who have one copy of each allele are
heterozygous and the genotype is AC.
[0020] As used herein, the terms "chemoradiation therapy,"
"chemoradiotherapy," "chemoirradiation" and "concurrent
chemoradiation therapy (CCRT)" are interchangeable to refer to
combination of chemotherapy and radiotherapy.
[0021] As used herein, the teen "a complete response" to CCRT
refers to complete remission of tumor without measurable symptoms
such as microscopic residual tumor, grossly visible residual tumor,
or progression of tumor.
[0022] As used herein, the term "primer" refers to a specific
oligonucleotide sequence which is complementary to a target
nucleotide sequence and used to hybridize to the target nucleotide
sequence. A primer serves as an initiation point for nucleotide
polymerization catalyzed by either DNA polymerase, RNA polymerase
or reverse transcriptase.
[0023] As used herein, the term "probe" refers to a defined nucleic
acid segment (or nucleotide analog segment, e.g., polynucleotide as
defined herein) which can be used to identify a specific
polynucleotide sequence present in samples, said nucleic acid
segment comprising a nucleotide sequence complementary of the
specific polynucleotide sequence to be identified.
[0024] In one aspect, the present invention provides a method of
predicting response of a patient suffering from esophageal cancer
to chemoradiotherapy comprising genotyping a test sample from the
patient for a SNP marker selected from the group consisting of
rs4954256, rs16863886 and a combination thereof, wherein the
presence of a C allele in rs4954256, a G allele in rs16863886 or
both is indicative of an increased likelihood of having a complete
response to chemoradiotherapy.
[0025] Table 1 shows the naturally occurring nucleotide sequences
(homo sapiens) containing rs4954256 (SEQ ID NO: 1) and the
nucleotide sequences containing rs16863886 (SEQ ID NO: 2), obtained
from the NCBI's database, wherein the nucleotide within the
brackets is the polymorphic nucleotide. It shows that the
polymorphic nucleotide of rs4954256 is located at position 27 of
SEQ ID NO: 1, and the polymorphic nucleotide of s16863886 is
located at position 27 of SEQ ID NO: 2, respectively.
TABLE-US-00001 TABLE 1 SNP nucleotide sequences rs4954256
atattggagagttaacagagaatgcc[C/T]aaaactggaaaaacaaaaacttcaa (SEQ ID
NO: 1) rs16863886
aatggtgtcccttgaaggctatctgt[C/T]tgcttttggataaaatggacagaag (SEQ ID
NO: 2)
[0026] SNP rs4954256 is located on chromosome 2q21.3 in ZRANB3,
which belongs to the SMARCAL1 subfamily. The N-terminal of ZRANB3
contains a helicase followed by a zinc finger related to the Ran G
protein binding proteins. However, the biological function of
ZRANB3 is still unclear. SNP rs16863886 is located on chromosome
2q36.1 between SGPP2 and FARSB. FARSB encodes the phenylalanyl-tRNA
synthetase beta subunit(s), which are regulatory subunits that form
a tetramer with two catalytic alpha subunits. SGPP2 encodes an S1P
(sphingosine-1-phosphate)-specific phosphohydrolase, which
dephosphorylates S1P into Sphingosine. Both SGPP1 and ZRANB3 are
involved in the G-protein function.
[0027] A test sample useful for practicing the method of the
invention can be any biological sample of a patient with esophageal
cancer that contains nucleic acid molecules, including portions of
the gene sequences to be examined As such, the sample can be a
cell, tissue or organ sample, or can be a sample of a biological
material such as blood, milk, tears, saliva, hair, skin, tissue,
and the like. A nucleic acid sample useful for practicing a method
of the invention can be DNA or RNA, particularly genomic DNA or an
amplification product thereof. A specifc example of a test sample
in accordance with the invnetion is a blood sample.
[0028] In one embodiment, the method of the invention is conducted
by genotyping a test sample of a patient with esophageal cancer for
rs4954256 wherein the presence of a C allele in the SNP marker is
indicative of an increased likelihood of having a complete response
to chemoradiotherapy.
[0029] In another embodiment, the method of the invention is
conducted by genotyping a test sample of a patient with esophageal
cancer for rs16863886 wherein the presence of a G allele in the SNP
marker is indicative of an increased likelihood of having a
complete response to chemoradiotherapy.
[0030] In yet another embodiment, the method of the invention is
conducted by genotyping a test sample of a patient with esophageal
cancer for a combination of rs4954256 and rs16863886 wherein the
presence of both a C allele in rs4954256 and a G allele in
rs16863886 is indicative of an increased likelihood of having a
complete response to chemoradiotherapy.
[0031] In particular, the patient evaluated for a likelihood of
having a complete response to chemoradiotherapy in accordance with
the method of the invention is a human adult with esophageal
cancer. Typically, the patients are 18 years or older but younger
than 70 years old. In certain embodiments, the patients are older
than 25, 35, 45 or 55 but younger than 70 years old. In addition,
in certain embodiments, the patient as described herein is an Asian
patient, particularly a Chinese or Japanese patient. In certain
embodiments, the patient is a man.
[0032] Numerous methods are known in the art for determining the
nucleotide occurrence for a specific SNP in a sample. Such methods
can utilize one or more oligonucleotide probes or primers,
including, for example, an amplification primer pair that
selectively hybridizes to a target polynucleotide, which
corresponds to one or more SNP positions. Oligonucleotide probes
useful in practicing a method of the invention can include, for
example, an oligonucleotide that is complementary to and spans a
portion of the target polynucleotide, including the position of the
SNP, wherein the presence of a specific nucleotide at the position
(i.e., the SNP) is detected by the presence or absence of selective
hybridization of the probe. Such a method can further include
contacting the target polynucleotide and hybridized oligonucleotide
with an endonuclease, and detecting the presence or absence of a
cleavage product of the probe, depending on whether the nucleotide
occurrence at the SNP site is complementary to the corresponding
nucleotide of the probe.
[0033] An oligonucleotide ligation assay also can be used to
identify a nucleotide occurrence at a polymorphic position, wherein
a pair of probes that selectively hybridize upstream and adjacent
to and downstream and adjacent to the site of the SNP, and wherein
one of the probes includes a terminal nucleotide complementary to a
nucleotide occurrence of the SNP. Where the terminal nucleotide of
the probe is complementary to the nucleotide occurrence, selective
hybridization includes the terminal nucleotide such that, in the
presence of a ligase, the upstream and downstream oligonucleotides
are ligated. As such, the presence or absence of a ligation product
is indicative of the nucleotide occurrence at the SNP site. An
example of this type of assay is the SNPlex System (Applied
Biosystems, Foster City, Calif.).
[0034] An oligonucleotide also can be useful as a primer, for
example, for a primer extension reaction, wherein the product (or
absence of a product) of the extension reaction is indicative of
the nucleotide occurrence. In addition, a primer pair useful for
amplifying a portion of the target polynucleotide including the SNP
site can be useful, wherein the amplification product is examined
to determine the nucleotide occurrence at the SNP site. In this
regard, useful methods include those that are readily adaptable to
a high throughput format, to a multiplex format, or to both. The
primer extension or amplification product can be detected directly
or indirectly and/or can be sequenced using various methods known
in the art. Amplification products which span a SNP can be
sequenced using traditional sequence methodologies such as the
"dideoxy-mediated chain termination method," also known as the
"Sanger Method" and the "chemical degradation method," also known
as the "Maxam-Gilbertmethod."
[0035] Medium to high-throughput systems for analyzing SNPs, known
in the art such as the Mass Array.TM. system (Sequenom, San Diego,
Calif.), the BeadArray.TM. SNP genotyping system (San Diego,
Calif.), Affymetrix GeneChip.RTM. Human Mapping 500K arrays
(Affymetrix, Inc., Santa Clara, Calif.), can be used with the
present invention.
[0036] The SNP detection methods for practicing the present
invention typically utilize selective hybridization. As used
herein, the term "selective hybridization" or the like refers to
hybridization under moderately stringent or highly stringent
conditions so that a nucleotide sequence preferentially associates
with a selected nucleotide sequence over unrelated nucleotide
sequences to a large enough extent to be useful in identifying a
nucleotide occurrence of a SNP. It will be recognized that some
amount of non-specific hybridization is unavoidable, but is
acceptable provide that hybridization to a target nucleotide
sequence is sufficiently selective such that it can be
distinguished over the non-specific hybridization, for example, at
least about 2-fold more selective, generally at least about 3-fold
more selective, usually at least about 5-fold more selective, and
particularly at least about 10-fold more selective, as determined,
for example, by an amount of labeled oligonucleotide that binds to
target nucleic acid molecule as compared to a nucleic acid molecule
other than the target molecule, particularly a substantially
similar (i.e., homologous) nucleic acid molecule other than the
target nucleic acid molecule. Conditions that allow for selective
hybridization can be determined empirically, or can be estimated
based, for example, on the relative GC: AT content of the
hybridizing oligonucleotide and the sequence to which it is to
hybridize, the length of the hybridizing oligonucleotide, and the
number, if any, of mismatches between the oligonucleotide and
sequence to which it is to hybridize (see, for example, Sambrook et
al., 2001, Molecular Cloning: A Laboratory Manual, Third Edition,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; and
Current Protocols in Molecular Biology (Ausubel et al., ed., J.
Wiley & Sons Inc., New York, 1988).
[0037] Generally, stringent conditions are selected to be about
5-30.degree. C. lower than the thermal melting point (T.sub.m) for
the specified sequence at a defined ionic strength and pH.
Alternatively, stringent conditions are selected to be about
5-15.degree. C. lower than the T.sub.m for the specified sequence
at a defined ionic strength and pH. For example, stringent
hybridization conditions will be those in which the salt
concentration is less than about 1.0 M sodium (or other salts) ion,
typically about 0.01 to about 1 M sodium ion concentration at about
pH 7.0 to about pH 8.3 and the temperature is at least about
25.degree. C. for short probes (e.g., 10 to 50 nucleotides) and at
least about 55.degree. C. for long probes (e.g., greater than 50
nucleotides). An exemplary non-stringent or low stringency
condition for a long probe (e.g., greater than 50 nucleotides)
would comprise a buffer of 20 mM Tris, pH 8.5, 50 mM KCl, and 2 mM
MgCl.sub.2, and a reaction temperature of 25.degree. C.
[0038] According to the invention, the method as described herein
can be used to determine if a patient with esophageal cancer
exhibits an increased likelihood of having a complete response to
chemoradiotherapy based on the genotype(s) of rs4954256 and/or
rs16863886. As demonstrated in the examples below, each of a C
allele in rs4954256 and a G allele in rs16863886 is a protective
allele which is more frequently present in a population of patients
having a complete response to chemoradiotherapy compared to a
population of patients that do not have a complete response to
chemoradiotherapy, and therefore the presence of a C allele in
rs4954256 or a G allele in rs16863886 indicates that the patients
has an increased possibility of having a complete response to
chemoradiotherapy. Particularly, a patient exhibits a greater
possibility (e.g. at least 1.5-, 2.0-, 2.5-, 3.0-, 3.5-, 4.0-,
4.5-, or 5.0-fold risk) of having a complete response as the number
of a C allele in rs4954256 or a G allele in rs16863886 increases.
More particularly, a patient exhibits an about 4.54-fold chance of
complete chemoradiotherapy response as the number of the C allele
in rs4954256 increases, and an about 3.84-fold chance of complete
chemoradiotherapy response as the number of the G allele
increases.
[0039] Isolated polynucleotides, serving as primers or probes, for
example, can be used to perform the genotyping for the SNPs in
accordance with the invnetion, which can readily be dtermined using
the information regarding SNPs and associated nucleic acid
sequences provided herein. A number of computer progeams such as
SeqTool Document v1.0 (IBMS, Taiwan) can be used to rapidly obtain
optimal primer/probe sets. In one specific example, a first pair of
primers is used to perform the genotyping of rs4954256 which have
SEQ ID NOS: 3 and 4, respectively. In another specific example, a
second pair of isolated polynucleotides is used to perform the
genotyping of rs16863886 which have SEQ ID NOS: 5 and 6,
respectively. Table 2 shows the sequences of the primers.
TABLE-US-00002 TABLE 2 Primers nucleotide sequences rs4954256
forward primer 5'-ACGTTGGATGTCTACCGTTTCCCGTATCTC-3' (SEQ ID NO: 3)
reverse primer 3'-ACGTTGGATGCCATATTGGAGAGTTAACAG-5' (SEQ ID NO: 4)
rs16863886 forward primer 5'-ACGTTGGATGCTGCTTAAGGCAATGGTGTC-3' (SEQ
ID NO: 5) reverse primer 3'-ACGTTGGATGTTACTTTGGCCCTTCTGTCC-5' (SEQ
ID NO: 6)
[0040] In another aspect, the invention also provides a kit for
performing the method as described herein comprising one or more
isolated polynucleotides for conducting the genotyping of
rs4954256, rs16863886 or a combination thereof. Particularly, the
isolated polynucleotides are used as primers or probes for
conducting the genotyping of the SNPs in accordance with the
invention.
[0041] In some embodiments, the kits are PCR kits. In one example,
the PCR kit includes the following: (a) primers used to amplify a
SNP as describe herein; and (b) buffers and enzymes including DNA
polymerase.
[0042] In some embodiments, the kits are microarray kits. The kits
generally comprise probes attached to a solid support surface. The
probes may be labeled with a detectable label. In a specific
embodiment, the probes are specific for a SNP as described herein.
The kits may also comprise hybridization reagents and/or reagents
necessary for detecting a signal produced when a probe hybridizes
to a target nucleic acid sequence. Generally, the materials and
reagents for the microarray kits are in one or more containers.
Each component of the kit is generally in its own a suitable
container.
[0043] Primers or probes can readily be designed and synthesized by
one of skill in the art for the nucleic acid region of interest. It
will be appreciated that suitable primers or probes to be used with
the invention can be designed using any suitable method.
[0044] A primer or probe is typically at least about 8 nucleotides
in length. In one embodiment, a primer or a probe is at least about
10 nucleotides in length. In a specific embodiment, a primer or a
probe is at least about 12 nucleotides in length. In another
specific embodiment, a primer or probe is at least about 16, 17,
18, 19, 20, 21, 22, 23, 24 or 25 nucleotides in length. While the
maximal length of a probe can be as long as the target sequence to
be detected, depending on the type of assay in which it is
employed, it is typically less than about 50, 60, 65, or 70
nucleotides in length. In the case of a primer, it is typically
less than about 30 nucleotides in length. In a specific embodiment,
a primer or a probe is within the length of about 18 and about 28
nucleotides. However, in other embodiments, such as nucleic acid
arrays and other embodiments in which probes are affixed to a
substrate, the probes can be longer, such as on the order of 30-70,
75, 80, 90, 100, or more nucleotides in length.
[0045] In one example, the kit of the invention comprises a first
set of isolated polynucleotides for identifying the polymorphic
nucleotide at rs4954256. Specifically, the isolated polynucleotides
are primers having SEQ ID NOS: 3 and 4, respectively. In another
example, the kit of the invention comprises a second set of
isolated polynucleotides for identifying the polymorphic nucleotide
at rs16863886. Specifically, the isolated polynucleotides are
primers having SEQ ID NOS: 5 and 6, respectively. In yet another
example, the kit of the invention comprises both a first set and a
second set of isolated polynucleotides as above described.
[0046] According to the invnetion, the kit may furhter contain
other agents used to detect the genetic polymorphisms such as (1)
reagents for purifying nucleic acids; (2) dNTPs, optionally with
one or more uniquely labeled dNTPs; (3) post synthesis labeling
reagents, such as chemically active derivatives of fluorescent
dyes; (4) enzymes, such as reverse transcriptases, DNA polymerases,
and the like; (5) various buffer mediums, e.g., hybridization and
washing buffers; (6) labeled probe purification reagents and
components, like spin columns, etc.; and (7) signal generation and
detection reagents, e.g., streptavidin-alkaline phosphatase
conjugate and the like.
[0047] In some examples, the kit of the invention further comprises
instructions for detecting the SNPs and evaluating the results.
Specifically, the instructions describes that the presence of a C
allele in rs4954256 or a G allele in rs16863886 as a result of the
genotyping is indicative of an increased possibility of having a
complete response to chemoradiotherapy. More specifically, the
instructions describes that a patient evaluated exhibits an about
4.54-fold chance of complete chemoradiotherapy response as the
number of the C allele in rs4954256 increases, and an about
3.84-fold chance of complete chemoradiotherapy response as the
number of the G allele increases.
[0048] The various embodiments of the present invention are
described in details below. Other characteristics of the present
invention will be clearly presented by the following detailed
description about the various embodiments and claims.
EXAMPLE 1
Patient Population and Therapy
[0049] This study included ninety (90) ECa patients, males younger
than 70 years, who received neoadjuvant CCRT followed by
esophagectomy at the National Taiwan University Hospital. Informed
consent was obtained from each subject and this study was approved
by the institutional review board at National Taiwan University
Hospital. Peripheral blood samples were drawn for each patient
before surgery and chemoirradiation. Peripheral white blood cells
were isolated and stored for further examination.
[0050] CCRT was conducted using the cisplatin-based regimen (6
mg/m.sup.2 on day 1 and day 5 each week) plus 5-fluorouracil (225
mg/m.sup.2 per day) and/or paclitaxel (35 mg/m.sup.2 on day 1 and
day 4 each week) with concomitant 4000 cGy of irradiation. The
neoadjuvant irradiation was delivered using a standard
antero-posterior/postero-anterior field technique. Four to six
weeks after CCRT, esophagectomy and esophageal reconstruction with
gastric or colonic interposition was performed for patients with
resectable tumors and acceptable surgical risk according to
cardiopulmonary function, nutritional status and general
performance status.
[0051] Based on the pathologic evaluation of the surgical specimen,
patients receiving CCRT were then categorized into two groups,
complete responders for which pathologically complete remission was
observed, and poor responders for which grossly visible residual
tumor and/or progression of tumor was observed. Table 3 summarizes
the clinical characteristics of the 90 patents.
TABLE-US-00003 TABLE 3 Total Patients (n = 90) Complete responders
Poor responders (n = 44) (n = 46) Age (years) mean 55.20 54.87 SD
7.2836 8.2263 Cigarette smoking Yes 32 31 No 7 6 Missing 5 9
Alcohol consumption Yes 32 31 No 7 6 Missing 5 9 Betel nut chewing
Yes 13 12 No 26 25 Missing 5 9
EXAMPLE 2
Two-Stage Genome-Wide Association Study (GWAS)
[0052] A two-stage GWAS was performed to identify markers for
predicting CCRT response in ECa patients. FIG. 1 shows an overview
of the study design.
[0053] Stage 1
[0054] About 30% of the study population was included in Stage 1 as
recommended in Nat Genet 2006; 38:209-13. Therefore, 15 patients
each were randomly drawn from the CCRT complete responders (n=44)
and poor responders (n=46), respectively. Table 4 summarizes the
clinical characteristics of the 30 patients and those of remaining
60 patients.
TABLE-US-00004 TABLE 4 Patients in Stage 1 Remaining patients (n =
30) (n = 60) Complete Poor Complete Poor responders responders
responders responders (n = 15) (n = 15) (n = 29) (n = 31) Age
(years) mean 55.67 54.6 54.97 55 SD 6.2526 7.8944 7.8580 8.5049
Cigarette smoking Yes 11 10 21 21 No 2 3 5 3 Missing 2 2 3 7
Alcohol consumption Yes 11 10 21 21 No 2 3 5 3 Missing 2 2 3 7
Betel nut chewing Yes 4 5 9 7 No 9 8 17 17 Missing 2 2 3 7
[0055] Genomic DNA extracted from blood samples were isolated by
proteinase K-phenol-chloroform extraction following standard
protocols with 0.5% SDS and 200 .mu.g/ml proteinase K. Total
genomic DNA (250 ng) was digested with a restriction enzyme (Nsp I
or Sty I) and ligated to adaptors that recognize the cohesive four
base-pair (bp) overhangs. All fragments resulting from restriction
enzyme digestion, regardless of size, were substrates for adaptor
ligation. A generic primer that recognizes the adaptor sequence was
used to amplify adaptor-ligated DNA fragments. PCR conditions had
been optimized to preferentially amplify fragments in the 200 to
1,100 bp size range. The amplified DNA was then fragmented,
labeled, and hybridized to GeneChip.RTM. Human Mapping 500K arrays
(Affymetrix, Inc., Santa Clara, Calif.). After 16 hours of
hybridization at 49.degree. C., the arrays were washed by Fluidics
Station 450 and scanned by GeneChip Scanner 3000.
[0056] Fisher's exact test was used to investigate the association
between individual SNP and the CCRT response. Based on the two
criteria (1) at least three continuous SNPs with a p-value<0.001
in a confined genomic region; and (2) the most significant SNP
within this region (Prostate 2006; 66:1556-64), twenty-six (26)
candidate SNPs were obtained in Stage 1.
[0057] Stage 2
[0058] Genotypes of the 26 candidate SNPs were further verified for
all 90 patients using the MassARRAY system from Sequenom (San
Diego, USA) according to the iPLEX protocol. The assay was based
upon the annealing of a primer adjacent to the polymorphic site of
interest. PCR-primers and extension-primers were designed using the
software SeqTool Document v1.0 (IBMS, Taiwan). The addition of a
DNA polymerase, plus a cocktail mixture of nucleotides and
terminators, allowed extension of the primer through the
polymorphic site, and generated a unique mass product. The
resultant mass of the primer extension product was then analyzed by
using the MassARRAY TyperAnalyzer v3.3 software (Sequenom) to
determine the sequence of the nucleotides at the polymorphic site.
The primers were designed for two SNPs, rs4954256 and rs16863886
for PCR amplification as follows:
5'-ACGTTGGATGTCTACCGTTTCCCGTATCTC-3' (SEQ ID NO: 3) and
3'-ACGTTGGATGCCATATTGGAGAGTTAACAG-5' (SEQ ID NO: 4) for rs4954256;
5'-ACGTTGGATGCTGCTTAAGGCAATGGTGTC-3' (SEQ ID NO: 5) and
3'-ACGTTGGATGTTACTTTGGCCCTTCTGTCC-5' (SEQ ID NO: 6) for rs16863886.
For these two SNPs, the following PCR conditions were used: 0.5 mM
of each primer, 200 mM dNTP, 2.5 units of Taq polymerase, a
standard polymerase buffer supplied with enzyme (1.5 mM MgCl2), and
150 ng of genomic DNA. The total volume of the PCR mix was 25 ml.
The PCR temperature program was: 95.degree. C. denaturation for 5
min; 35 cycles of 1 min each at 95.degree. C., 1.75 min at
55.degree. C., and 1.75 min at 72.degree. C.; and a final extension
run at 72.degree. C. for 10 min. The PCR products were run on a 6%
agarose gel at 50 W for 30 min.
[0059] Classification of SNPs was manually determined by the
MassARRAY TyperAnalyzer v3.3 software (Sequenom, San Diego, USA).
Independent Fisher's exact tests were performed for the remaining
60 samples (in addition to the 30 samples in Stage 1). No
significant differences were observed between these two populations
(data not shown). Therefore, data from all 90 samples were pooled
to gain higher statistical power in stage 2. The mean ages were not
significantly different between complete and poor responders in
both stage 1 and 2 (data not shown). In addition, none of the
clinical characteristics, including cigarette smoking, alcohol
consumption, and betel nut chewing, were significantly different
between complete and poor responders, and thus were not included in
further analyses (data not shown). Genotypes of the 30 patients in
stage 1 were verified by Sequenom data; and 8 SNPs with high
replication error or low call rate were excluded for further
analysis. Samples in stage 2 were consisted of the 30 patients and
the remained 60 patients.
[0060] Further, a Bonferroni correction was used in Stage 2 in
order to address the issue of multiple testing. After correction,
results of the additive models showed that two SNPs, rs4954256 and
rs16863886, were significantly associated with the CCRT response
(rs4954256: OR=3.84, 95% CI=1.56-9.43,p-value=0.002; rs16863886:
OR=4.54, 95% CI=1.81-11.40, p-value=9.times.10.sup.-4). Table 5
lists statistic data of the 18 candidate SNPs in Stages 1 and
2.
TABLE-US-00005 TABLE 5 stage 1* stage 2** (n = 90) (n = 30)
MAF.sup..sctn. Minor Complete Poor SNP location gene allele
p-value.sup..sctn..sctn. responders responders
p-value.sup..sctn..sctn. OR (95% CI).sup. rs12713098 2p16.3 XRXN1 A
7.64 .times. 10.sup.-5 0.500 0.3667 0.092 1.66 (0.87-3.17)
rs4954256 2q21.3 ZRANB3 C 3.85 .times. 10.sup.-5 0.2841 0.0930
0.002 3.84 (1.56-9.43) rs16863886 2q36.1 intergenic G 4.75 .times.
10.sup.-7 0.2841 0.0870 9 .times. 10.sup.-4 4.54 (1.81-11.40)
rs4284824 2q37.1 INPP5D C 5.35 .times. 10.sup.-5 0.3182 0.4651
0.062 0.54 (0.29-1.01) rs4697204 4p15.31 intergenic G 1.02 .times.
10.sup.-4 0.4886 0.3256 0.032 1.98 (1.05-3.74) rs1876266 4p16.1
intergenic V 1.70 .times. 10.sup.-4 0.3068 0.1413 0.012 2.88
(1.30-6.37) rs1440971 7q32.1 intergenic C 1.73 .times. 10.sup.-5
0.2045 0.1047 0.093 1.99 (0.88-4.54) rs1630140 9q22.2 intergenic C
1.31 .times. 10.sup.-4 0.1364 0.3023 0.010 0.32 (0.14-0.74)
rs1805740 12p31.13 PHC1 C 6.31 .times. 10.sup.-4 0.2955 0.2093
0.224 1.53 (0.78-3.00) rs4240039 Xp11.4 intergenic G 7.97 .times.
10.sup.-4 0.1364 0.2558 0.057 0.68 (0.39-1.17) rs4830776 Xp22.2
intergenic C 1.23 .times. 10.sup.-4 0.2045 0.3571 0.028 0.68
(0.42-1.10) rs5937044 Xq13.1 intergenic A 1.61 .times. 10.sup.-5
0.2954 0.2791 0.868 1.04 (0.65-1.66) rs927142 Xq21.31 intergenic G
1.55 .times. 10.sup.-5 0.5 0.444 1 1.12 (0.73-1.85) rs5990542
Xq21.33 intergenic C 1.31 .times. 10.sup.-4 0.5227 0.4286 0.226
1.21 (0.79-1.85) rs5910842 Xq24 intergenic A 3.56 .times. 10.sup.-7
0.5 0.3043 0.010 1.41 (0.92-2.15) rs10521750 Xq25 intergenic C 1.91
.times. 10.sup.-6 0.5682 0.3810 0.015 1.46 (0.95-2.25) rs5951775
Xq27.3 intergenic T 1.68 .times. 10.sup.-5 0.1591 0.0698 0.095 1.59
(0.78-3.24) rs1202918 Xq28 intergenic A 4.53 .times. 10.sup.-5
0.5114 0.3478 0.035 1.41 (0.92-2.15) .sup..sctn.MAF denotes the
minor allele frequency. .sup..sctn..sctn.p-values were obtained
from Fisher's exact test. *p-values were calculated based on data
from 30 patients using microarrays. **Results in stage 2 were
calculated based on all 90 samples examined by mass spectrometry.
.sup. OR denotes odds ratio and was calculated using the additive
model.
[0061] In addition to Fisher's exact test, Cochran-Armitage trend
test was performed to confirm that rs4954256 (p-value=0.002) and
rs16863886 (p-value=6.times.10.sup.-4) were significantly
associated with the CCRT response as the minor allele number
increased. SNP rs16863886 is significantly associated with a
4.54-fold risk of complete CCRT response [95% confidence interval
(CI)=1.81-11.40] as the number of minor allele increased; and SNP
rs4954256 is associated with a 3.84-fold risk of complete CCRT
response (95% CI=1.56-9.43). In addition, based on the additive
model, the Leave-On-Out Cross Validation (LOOCV) accuracy for
predicting the CCRT response was 64.37% for rs4954256 (56 out of 87
patients) and 68.89% for rs16863886 (62 out of 90 patients).
Combining both SNPs together increased the prediction accuracy to
72.4% (63 out of 87 patients). The sensitivity (correctly
predicting the nonresponders) and specificity (correctly predicting
the responders) of this study was 70% and 75%, respectively. The
positive prediction value was 71% and negative prediction value was
73%. The regression coefficients of rs4954256 and rs16863886 were
1.3572 and 1.5745 respectively, indicating that the probability of
a complete CCRT response increased as the number of minor alleles
increased. These results demonstrated that rs4954256 and rs16863886
were strongly associated with CCRT response in ECa patients and can
be utilized in predicting CCRT responses.
[0062] This is the first two-stage GWAS to identify SNPs with a
high accuracy for predicting the CCRT response in treating ECa. Two
SNPs, rs4954256 and rs16863886, were found significantly associated
with a complete CCRT response (as the minor allele number
increased) and provided a high level of prediction accuracy
(72.41%). Such germline polymorphisms determined from blood samples
do not change over time. They are very stable, in contrast to
somatic mutations obtained from tumor tissue, which change as the
disease progresses. The use of the two SNPs according to the
invention is helpful in predicting an ECa patient's the response to
CCRT and then determining the most appropriate treatment for the
patient based on the result of the prediction.
Sequence CWU 1
1
6152DNAHomo sapiens 1atattggaga gttaacagag aatgccyaaa actggaaaaa
caaaaacttc aa 52252DNAHomo sapiens 2aatggtgtcc cttgaaggct
atctgtytgc ttttggataa aatggacaga ag 52330DNAArtificial
Sequenceprimer 3acgttggatg tctaccgttt cccgtatctc 30430DNAArtificial
Sequenceprimer 4gacaattgag aggttatacc gtaggttgca 30530DNAArtificial
Sequenceprimer 5acgttggatg ctgcttaagg caatggtgtc 30630DNAArtificial
Sequenceprimer 6cctgtcttcc cggtttcatt gtaggttgca 30
* * * * *
References