U.S. patent application number 13/635018 was filed with the patent office on 2013-01-10 for determining susceptibility to a sudden cardiac event.
This patent application is currently assigned to CARDIODX ,INC.. Invention is credited to John Lincoln Blanchard, Susan Elizabeth Daniels, Michael R. Elashoff, Steven Rosenberg, Amy Jo-Nell Sehnert, James Alan Wingrove.
Application Number | 20130013219 13/635018 |
Document ID | / |
Family ID | 44649625 |
Filed Date | 2013-01-10 |
United States Patent
Application |
20130013219 |
Kind Code |
A1 |
Rosenberg; Steven ; et
al. |
January 10, 2013 |
Determining Susceptibility To A Sudden Cardiac Event
Abstract
Disclosed herein is a method of do terming the likelihood of a
sudden cardiac event, such as an arrythmia, in a subject. Also
disclosed is a method of determining whether a subject is at risk
of a sudden cardiac event arid whether the subject would benefit
from a treatment such as implantation of an ICD.
Inventors: |
Rosenberg; Steven; (Oakland,
CA) ; Elashoff; Michael R.; (Redwood City, CA)
; Blanchard; John Lincoln; (Redwood City, CA) ;
Daniels; Susan Elizabeth; (Mountain View, CA) ;
Wingrove; James Alan; (Sunnyvale, CA) ; Sehnert; Amy
Jo-Nell; (San Francisco, CA) |
Assignee: |
CARDIODX ,INC.
Palo Alto
CA
|
Family ID: |
44649625 |
Appl. No.: |
13/635018 |
Filed: |
March 18, 2011 |
PCT Filed: |
March 18, 2011 |
PCT NO: |
PCT/US2011/029041 |
371 Date: |
September 14, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61315748 |
Mar 19, 2010 |
|
|
|
Current U.S.
Class: |
702/19 ;
435/6.11 |
Current CPC
Class: |
C12Q 1/6883 20130101;
C12Q 2600/156 20130101; C12Q 2600/158 20130101; C12Q 2600/118
20130101; C12Q 2600/172 20130101 |
Class at
Publication: |
702/19 ;
435/6.11 |
International
Class: |
G06F 19/10 20110101
G06F019/10; C12Q 1/68 20060101 C12Q001/68 |
Claims
1. A method for predicting the likelihood of a sudden cardiac event
(SCE) in a subject, comprising: obtaining a first dataset
associated with a sample obtained from the subject, wherein the
first dataset comprises data for a single nucleotide polymorphism
(SNP) marker selected from Table 15; and analyzing the first
dataset to determine the presence or absence of data for the SNP
marker, wherein the presence of the SNP marker data is positively
correlated or negatively correlated with the likelihood of SCE in
the subject.
2. The method of claim 1, wherein the SNP marker is rs17024266.
3. The method of claim 1, wherein the first dataset comprises data
for at least two, three, four, five, six, seven, eight, nine, ten,
eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen,
eighteen, nineteen, twenty or more SNP markers selected from Table
15, and further comprising analyzing the first dataset to determine
the presence or absence of data for the at least two, three, four,
five, six, seven, eight, nine, ten, eleven, twelve, thirteen,
fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty
or more SNP markers selected from Table 15.
4. The method of claim 3, further comprising determining the
likelihood of SCE in the subject according to the relative number
of positively correlated and negatively correlated SNP marker data
present in the first dataset.
5. The method of claim 1, father comprising determining the
likelihood that the subject would benefit from implantation of an
internal cardioverter defibrillator (ICD) based on the
analysis.
6. The method of claim 1, wherein the SCE is a ventricular
arrhythmia.
7. The method of claim 1, wherein the SNP marker comprises at least
one SNP marker selected from the group consisting of: rs17024266,
rs1472929, rs17093751, rs6791277, rs4665719, rs12477891, rs5943590,
rs1018615, and rs10088053.
8. The method of claim 1, wherein the likelihood of SCE in the
subject is increased in the subject compared to a control.
9. The method of claim 8, wherein the control is a second dataset
associated with a control sample, wherein the second dataset
comprises data for a control wild-type marker at a specified locus
rather than the SNP marker at that locus.
10. The method of claim 1, wherein the likelihood of SCE in the
subject is not increased in the subject compared to a control.
11. The method of claim 1, further comprising selecting a
therapeutic regimen based on the analysis.
12. The method of claim 1, wherein the data is genotyping data.
13. The method of claim 1, wherein the method is implemented on one
or more computers.
14. The method of claim 1, wherein the first dataset is obtained
stored on a storage memory.
15. The method of claim 1, wherein obtaining the first dataset
associated with the sample comprises obtaining the sample and
processing the sample to experimentally determine the first
dataset.
16. The method of claim 1, wherein obtaining the first dataset
associated with the sample comprises receiving the first dataset
directly or indirectly from a third party that has processed the
sample to experimentally determine the first dataset.
17. The method of claim 1, wherein the data is obtained from a
nucleotide-based assay.
18. The method of claim 1, wherein the subject is a human
subject.
19. The method of claim 1, further comprising assessing a clinical
factor in the subject; and combining the assessment with the
analysis of the first dataset to predict the likelihood of SCE in
the subject.
20. The method of claim 19, wherein the clinical factor comprises
at least one clinical factor selected from the group consisting of
age, gender, race, implant indication, prior pacing status, ICD
presence, cardiac resynchronization therapy defibrillator (CRT-D)
presence, total number of devices, device type, defibrillation
thresholds performed, number of programming zones, heart failure
(HF) etiology, HF onset, left ventricular ejection fraction (LVEF)
at implant, New York Heart Association (NYHA) class, months from
most recent myocardial infarction (MI) at implant, prior arrhythmia
event in setting of MI or arthroscopic chondral osseous autograft
transplantation (Cor procedure), diabetes status, Blood Urea
Nitrogen (BUN), Cr, renal disease history, rhythm parameters to
determine sinus v. non-sinus, heart rate, QRS duration prior to
implant, left bundle branch block, systolic blood pressure, history
of hypertension, smoking status, pulmonary disease, body mass index
(BMI), family history of sudden cardiac death, B-type natriuretic
peptide (BNP) levels, prior cardiac surgeries, medications,
microvolt-level T-wave alternans (MTWA) result, and inducibility at
electro-physiologic study (EPS).
21. A method for determining the likelihood of SCE in a subject,
comprising: obtaining a sample from the subject, wherein the sample
comprises a SNP marker selected from Table 15; contacting the
sample with a reagent; generating a complex between the reagent and
the SNP marker; detecting the complex to obtain a dataset
associated with the sample, wherein the dataset comprises data for
the SNP marker; and analyzing the dataset to determine the presence
or absence of the SNP marker, wherein the presence of the marker is
positively correlated or negatively correlated with the likelihood
of SCE in the subject.
22. A computer-implemented method for predicting the likelihood of
SCE in a subject, comprising: storing, in a storage memory, a
dataset associated with a first sample obtained from the subject,
wherein the dataset comprises data for a SNP marker selected from
Table 15; and analyzing, by a computer processor, the dataset to
determine the presence or absence of the SNP marker, wherein the
presence of the SNP marker is positively correlated or negatively
correlated with the likelihood of SCE in the subject.
23. A system for predicting the likelihood of SCE in a subject, the
system comprising: a storage memory for storing a dataset
associated with a sample obtained from the subject, wherein the
dataset comprises data for a SNP marker selected from Table 15; and
a processor communicatively coupled to the storage memory for
analyzing the dataset to determine the presence or absence of the
SNP marker, wherein the presence of the SNP marker is positively
correlated or negatively correlated with the likelihood of SCE in
the subject.
24. A computer-readable storage medium storing computer-executable
program code, the program code comprising: program code for storing
a dataset associated with a sample obtained from a subject, wherein
the dataset comprises data for a SNP marker selected from Table 15;
and program code for analyzing the dataset to determine the
presence or absence of the SNP marker, wherein the presence of the
SNP marker is positively correlated or negatively correlated with
the likelihood of SCE in the subject.
25. A kit for use in predicting the likelihood of SCE in a subject,
comprising: a set of reagents comprising a plurality of reagents
for determining from a sample obtained from the subject data for a
SNP marker selected from Table 15; and instructions for using the
plurality of reagents to determine data from the sample.
26. The kit of claim 25, wherein the instructions comprise
instructions for conducting a nucleotide-based assay.
27. A kit for use in predicting the likelihood of SCE in a subject,
comprising: a set of reagents consisting essentially of a plurality
of reagents for determining from a sample obtained from the subject
data for a SNP marker selected from Table 15; and instructions for
using the plurality of reagents to determine data from the
sample.
28. The kit of claim 27, wherein the instructions comprise
instructions for conducting a nucleotide-based assay.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional
Application No. 61/315,748, filed Mar. 19, 2010, the entire
disclosure of which is hereby incorporated by reference in its
entirety for all purposes.
BACKGROUND
[0002] 1. Field
[0003] This application is directed to the areas of bioinformatics
and heart conditions. The teachings relate to diagnosis and
treatment of heart conditions, such as sudden cardiac death.
[0004] 2. Background Material
[0005] Heart failure (HF) affects 5 million Americans, with 550,000
new cases diagnosed and 250,000 deaths each year. Sudden cardiac
events (SCE) due to ventricular arrhythmias (ventricular
tachycardia, VT; and ventricular fibrillation, VF) is a serious and
common problem in the developed world and accounts for half of all
deaths in HF. These arrhythmias may be precipitated by a complex
interaction of environmental, clinical, and genetic factors. While
therapies such as implanted cardioverter defibrillators (ICD) show
benefit in this population, the current measure used to recommend
implant of a primary prevention ICD, low ejection fraction (EF)
<35%, has significant limitations. When using low EF alone as an
indication for ICD, the majority (.about.75%) of patients implanted
never receive life-saving benefit from the device while at the same
time being exposed to the risks and complications of this
expensive, invasive therapy. Furthermore, there is currently no
clinically-accepted measure to identify the even larger population
of patients at risk for SCE with EF >35% who could derive
benefit from an ICD. Genetic markers associated with lethal
ventricular arrhythmias provide an important tool to identify
patients at highest risk who would most benefit from directed ICD
therapy.
[0006] Susceptibility for SCE is multi-factorial. SCE in adults
most often occurs in the setting of coronary artery disease (CAD),
but also occurs in the setting of non-ischemic conditions and other
disorders. Genetic markers associated with the phenotype of VT
and/or VF in a HF population would provide unique insight into an
individual's risk for SCE and is expected to be additive (or at
least complementary) to other anatomic, disease-based clinical
measures currently used to assess this risk.
[0007] The importance of the influence of genetics on this problem
is growing through the following lines of evidence: 1) Family
history of SCE is a well-known important risk factor and the
heritable risk is well established. 2) Genetics of rare inherited
SCE disorders are well described and common variants in these
disease genes are hypothesized to play a potentially important role
outside of families, and 3) recent genome-wide association (GWAS)
studies have identified genetic markers associated with
quantitative traits such as QT interval duration that may influence
SCE risk in the general population.
[0008] Accounting for the underlying genetic pre-disposition for a
lethal arrhythmic event is potentially both distinct and
complementary to other measures used today. Current
risk-stratification methods focus on measurable anatomic features
of the heart (e.g., EF, scar mass, wall motion) and the cardiac
conduction system (e.g., electrophysiologic characteristics) after
the heart is damaged by ischemic or non-ischemic causes. Allelic
variation among multiple interlinked pathways leading to the final
anatomic phenotype may influence a wide-range or a small portion of
the final complex phenotype by altering the initiating triggers,
disease progression, and/or faulty electrical propagation that ends
with SCE.
[0009] Therefore, the embodiments of the present teachings
demonstrate significant progress in identifying markers for the
accurate measurement of SCE risk in subjects along with methods of
their use.
SUMMARY
[0010] Disclosed herein is a method for predicting the likelihood
of a sudden cardiac event (SCE) in a subject, comprising: obtaining
a first dataset associated with a sample obtained from the subject,
wherein the first dataset comprises data for a single nucleotide
polymorphism (SNP) marker selected from Table 15; and analyzing the
first dataset to determine the presence or absence of data for the
SNP marker, wherein the presence of the SNP marker data is
positively correlated or negatively correlated with the likelihood
of SCE in the subject.
[0011] In some aspects, the SNP marker is rs17024266.
[0012] In some aspects, the first dataset comprises data for at
least two, three, four, five, six, seven, eight, nine, ten, eleven,
twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen,
nineteen, twenty or more SNP markers selected from Table 15, and
further comprising analyzing the first dataset to determine the
presence or absence of data for the at least two, three, four,
five, six, seven, eight, nine, ten, eleven, twelve, thirteen,
fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty
or more SNP markers selected from Table 15.
[0013] In some aspects, the method further includes determining the
likelihood of SCE in the subject according to the relative number
of positively correlated and negatively correlated SNP marker data
present in the first dataset.
[0014] In some aspects, the method further includes determining the
likelihood that the subject would benefit from implantation of an
internal cardioverter defibrillator (ICD) based on the analysis. In
some aspects, the SCE is a ventricular arrhythmia.
[0015] In some aspects, the SNP marker comprises at least one SNP
marker selected from the group consisting of: rs17024266,
rs1472929, rs17093751, rs6791277, rs4665719, rs12477891, rs5943590,
rs101861.5, and rs10088053.
[0016] In some aspects, the likelihood of SCE in the subject is
increased in the subject compared to a control. In some aspects,
the control is a second dataset associated with a control sample,
wherein the second dataset comprises data for a control wild-type
marker at a specified locus rather than the SNP marker at that
locus. In some aspects, the likelihood of SCE in the subject is not
increased in the subject compared to a control.
[0017] In some aspects, the method further includes selecting a
therapeutic regimen based on the analysis.
[0018] In some aspects, the data is genotyping data.
[0019] In some aspects, the method is implemented on one or more
computers. In some aspects, the first dataset is obtained stored on
a storage memory. In some aspects, obtaining the first dataset
associated with the sample comprises obtaining the sample and
processing the sample to experimentally determine the first
dataset. In some aspects, obtaining the first dataset associated
with the sample comprises receiving the first dataset directly or
indirectly from a third party that has processed the sample to
experimentally determine the first dataset. In some aspects, the
data is obtained from a nucleotide-based assay.
[0020] In some aspects, the subject is a human subject.
[0021] In some aspects, the method further includes assessing a
clinical factor in the subject; and combining the assessment with
the analysis of the first dataset to predict the likelihood of SCE
in the subject. In some aspects, the clinical factor comprises at
least one clinical factor selected from the group consisting of
age, gender, race, implant indication, prior pacing status, ICD
presence, cardiac resynchronization therapy defibrillator (CRT-D)
presence, total number of devices, device type, defibrillation
thresholds performed, number of programming zones, heart failure
(HF) etiology, HF onset, left ventricular ejection fraction (LVEF)
at implant, New York Heart Association (NYHA) class, months from
most recent myocardial infarction (MI) at implant, prior arrhythmia
event in setting of MI or arthroscopic chondral osseous autograft
transplantation (Cor procedure), diabetes status, Blood Urea
Nitrogen (BUN), Cr, renal disease history, rhythm parameters to
determine sinus v. non-sinus, heart rate, QRS duration prior to
implant, left bundle branch block, systolic blood pressure, history
of hypertension, smoking status, pulmonary disease, body mass index
(BMI), family history of sudden cardiac death, B-type natriuretic
peptide (BNP) levels, prior cardiac surgeries, medications,
microvolt-level T-wave alternans (MTWA) result, and inducibility at
electro-physiologic study (EPS).
[0022] Also described herein is a method for determining the
likelihood of SCE in a subject, comprising: obtaining a sample from
the subject, wherein the sample comprises a SNP marker selected
from Table 15; contacting the sample with a reagent; generating a
complex between the reagent and the SNP marker; detecting the
complex to obtain a dataset associated with the sample, wherein the
dataset comprises data for the SNP marker; and analyzing the
dataset to determine the presence or absence of the SNP marker,
wherein the presence of the marker is positively correlated or
negatively correlated with the likelihood of SCE in the
subject.
[0023] In some aspects, the SNP marker is rs17024266,
[0024] In some aspects, the first dataset comprises data for at
least two, three, four, five, six, seven, eight, nine, ten, eleven,
twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen,
nineteen, twenty or more SNP markers selected from Table 15, and
further comprising analyzing the first dataset to determine the
presence or absence of data for the at least two, three, four,
five, six, seven, eight, nine, ten, eleven, twelve, thirteen,
fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty
or more SNP markers selected from Table 15.
[0025] In some aspects, the method further includes determining the
likelihood of SCE in the subject according to the relative number
of positively correlated and negatively correlated SNP marker data
present in the first dataset.
[0026] In some aspects, the method further includes determining the
likelihood that the subject would benefit from implantation of an
internal cardioverter defibrillator (ICD) based on the analysis. In
some aspects, the SCE is a ventricular arrhythmia.
[0027] In some aspects, the SNP marker comprises at least one SNP
marker selected from the group consisting of: rs17024266,
rs1472929, rs17093751, rs6791277, rs4665719, rs12477891, rs5943590,
rs1018615, and rs10088053.
[0028] In some aspects, the likelihood of SCE in the subject is
increased in the subject compared to a control. In some aspects,
the control is a second dataset associated with a control sample,
wherein the second dataset comprises data for a control wild-type
marker at a specified locus rather than the SNP marker at that
locus. In some aspects, the likelihood of SCE in the subject is not
increased in the subject compared to a control.
[0029] In some aspects, the method further includes selecting a
therapeutic regimen based on the analysis.
[0030] In some aspects, the data is genotyping data.
[0031] In some aspects, the method is implemented on one or more
computers. In some aspects, the data is obtained from a
nucleotide-based assay.
[0032] In some aspects, the subject is a human subject.
[0033] In some aspects, the method further includes assessing a
clinical factor in the subject; and combining the assessment with
the analysis of the first dataset to predict the likelihood of SCE
in the subject. In some aspects, the clinical factor comprises at
least one clinical factor selected from the group consisting of
age, gender, race, implant indication, prior pacing status, ICD
presence, cardiac resynchronization therapy defibrillator (CRT-D)
presence, total number of devices, device type, defibrillation
thresholds performed, number of programming zones, heart failure
(HF) etiology, HF onset, left ventricular ejection fraction (LVEF)
at implant, New York Heart Association (NYHA) class, months from
most recent myocardial infarction (MI) at implant, prior arrhythmia
event in setting of or arthroscopic chondral osseous autograft
transplantation (Cor procedure), diabetes status, Blood Urea
Nitrogen (BUN), Cr, renal disease history, rhythm parameters to
determine sinus v. non-sinus, heart rate, QRS duration prior to
implant, left bundle branch block, systolic blood pressure, history
of hypertension, smoking status, pulmonary disease, body mass index
(BMI), family history of sudden cardiac death, B-type natriuretic
peptide (BNP) levels, prior cardiac surgeries, medications,
microvolt-level T-wave alternans (MTWA) result, and inducibility at
electro-physiologic study (EPS).
[0034] Also described herein is a computer-implemented method for
predicting the likelihood of SCE in a subject, comprising: storing,
in a storage memory, a dataset associated with a first sample
obtained from the subject, wherein the dataset comprises data for a
SNP marker selected from Table 15; and analyzing, by a computer
processor, the dataset to determine the presence or absence of the
SNP marker, wherein the presence of the SNP marker is positively
correlated or negatively correlated with the likelihood of SCE in
the subject.
[0035] In some aspects, the SNP marker is rs17024266,
[0036] In some aspects, the first dataset comprises data for at
least two, three, four, five, six, seven, eight, nine, ten, eleven,
twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen,
nineteen, twenty or more SNP markers selected from Table 15, and
further comprising analyzing the first dataset to determine the
presence or absence of data for the at least two, three, four,
five, six, seven, eight, nine, ten, eleven, twelve, thirteen,
fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty
or more SNP markers selected from Table 15.
[0037] In some aspects, the method further includes determining the
likelihood of SCE in the subject according to the relative number
of positively correlated and negatively correlated SNP marker data
present in the first dataset.
[0038] In some aspects, the method further includes determining the
likelihood that the subject would benefit from implantation of an
internal cardioverter defibrillator (ICD) based on the analysis. In
some aspects, the SCE is a ventricular arrhythmia.
[0039] In some aspects, the SNP marker comprises at least one SNP
marker selected from the group consisting of: rs17024266,
rs1472929, rs17093751, rs6791277, rs4665719, rs12477891, rs5943590,
rs1018615, and rs10088053.
[0040] In some aspects, the likelihood of SCE in the subject is
increased in the subject compared to a control. In some aspects,
the control is a second dataset associated with a control sample,
wherein the second dataset comprises data for a control wild-type
marker at a specified locus rather than the SNP marker at that
locus. In some aspects, the likelihood of SCE in the subject is not
increased in the subject compared to a control.
[0041] In some aspects, the method further includes selecting a
therapeutic regimen based on the analysis.
[0042] In some aspects, the data is genotyping data.
[0043] In some aspects, the method is implemented on one or more
computers. In some aspects, the first dataset is obtained stored on
a storage memory. In some aspects, obtaining the first dataset
associated with the sample comprises obtaining the sample and
processing the sample to experimentally determine the first
dataset. In some aspects, obtaining the first dataset associated
with the sample comprises receiving the first dataset directly or
indirectly from a third party that has processed the sample to
experimentally determine the first dataset. In some aspects, the
data is obtained from a nucleotide-based assay.
[0044] In some aspects, the subject is a human subject.
[0045] In some aspects, the method further includes assessing a
clinical factor in the subject; and combining the assessment with
the analysis of the first dataset to predict the likelihood of SCE
in the subject. In some aspects, the clinical factor comprises at
least one clinical factor selected from the group consisting of
age, gender, race, implant indication, prior pacing status, ICD
presence, cardiac resynchronization therapy defibrillator (CRT-D)
presence, total number of devices, device type, defibrillation
thresholds performed, number of programming zones, heart failure
(HF) etiology, HF onset, left ventricular ejection fraction (LVEF)
at implant, New York Heart Association (NYHA) class, months from
most recent myocardial infarction (MI) at implant, prior arrhythmia
event in setting of MI or arthroscopic chondral osseous autograft
transplantation (Cor procedure), diabetes status, Blood Urea
Nitrogen (BUN), Cr, renal disease history, rhythm parameters to
determine sinus v. non-sinus, heart rate, QRS duration prior to
implant, left bundle branch block, systolic blood pressure, history
of hypertension, smoking status, pulmonary disease, body mass index
(BMI), family history of sudden cardiac death, B-type natriuretic
peptide (BNP) levels, prior cardiac surgeries, medications,
microvolt-level T-wave alternans (MTWA) result, and inducibility at
electro-physiologic study (EPS).
[0046] Also described herein is a system for predicting the
likelihood of SCE in a subject, the system comprising: a storage
memory for storing a dataset associated with a sample obtained from
the subject, wherein the dataset comprises data for a SNP marker
selected from Table 15; and a processor communicatively coupled to
the storage memory for analyzing the dataset to determine the
presence or absence of the SNP marker, wherein the presence of the
SNP marker is positively correlated or negatively correlated with
the likelihood of SCE in the subject.
[0047] In some aspects, the SNP marker is rs17024266.
[0048] In some aspects, the first dataset comprises data for at
least two, three, four, five, six, seven, eight, nine, ten, eleven,
twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen,
nineteen, twenty or more SNP markers selected from Table 15, and
further comprising analyzing the first dataset to determine the
presence or absence of data for the at least two, three, four,
five, six, seven, eight, nine, ten, eleven, twelve, thirteen,
fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty
or more SNP markers selected from Table 15.
[0049] In some aspects, the system further includes determining the
likelihood of SCE in the subject according to the relative number
of positively correlated and negatively correlated SNP marker data
present in the first dataset.
[0050] In some aspects, the system further includes determining the
likelihood that the subject would benefit from implantation of an
internal cardioverter defibrillator (ICD) based on the analysis. In
some aspects, the SCE is a ventricular arrhythmia.
[0051] In some aspects, the SNP marker comprises at least one SNP
marker selected from the group consisting of: rs17024266,
rs1472929, rs17093751, rs6791277, rs4665719, rs12477891, rs5943590,
rs1018615, and rs10088053.
[0052] In some aspects, the likelihood of SCE in the subject is
increased in the subject compared to a control. In some aspects,
the control is a second dataset associated with a control sample,
wherein the second dataset comprises data for a control wild-type
marker at a specified locus rather than the SNP marker at that
locus. In some aspects, the likelihood of SCE in the subject is not
increased in the subject compared to a control.
[0053] In some aspects, the system further includes selecting a
therapeutic regimen based on the analysis.
[0054] In some aspects, the data is genotyping data.
[0055] In some aspects, the first dataset is obtained stored on a
storage memory. In some aspects, obtaining the first dataset
associated with the sample comprises obtaining the sample and
processing the sample to experimentally determine the first
dataset. In some aspects, obtaining the first dataset associated
with the sample comprises receiving the first dataset directly or
indirectly from a third party that has processed the sample to
experimentally determine the first dataset. In some aspects, the
data is obtained from a nucleotide-based assay.
[0056] In some aspects, the subject is a human subject.
[0057] In some aspects, the system further includes assessing a
clinical factor in the subject; and combining the assessment with
the analysis of the first dataset to predict the likelihood of SCE
in the subject. In some aspects, the clinical factor comprises at
least one clinical factor selected from the group consisting of
age, gender, race, implant indication, prior pacing status, ICD
presence, cardiac resynchronization therapy defibrillator (CRT-D)
presence, total number of devices, device type, defibrillation
thresholds performed, number of programming zones, heart failure
(HF) etiology, HF onset, left ventricular ejection fraction (LVEF)
at implant, New York Heart Association (NYHA) class, months from
most recent myocardial infarction (MI) at implant, prior arrhythmia
event in setting of MI or arthroscopic chondral osseous autograft
transplantation (Cor procedure), diabetes status, Blood Urea
Nitrogen (BUN), Cr, renal disease history, rhythm parameters to
determine sinus v. non-sinus, heart rate, QRS duration prior to
implant, left bundle branch block, systolic blood pressure, history
of hypertension, smoking status, pulmonary disease, body mass index
(BMI), family history of sudden cardiac death, B-type natriuretic
peptide (BNP) levels, prior cardiac surgeries, medications,
microvolt-level T-wave alternans (MTWA) result, and inducibility at
electro-physiologic study (EPS).
[0058] Also described herein is a computer-readable storage medium
storing computer executable program code, the program code
comprising: program code for storing a dataset associated with a
sample obtained from a subject, wherein the dataset comprises data
for a SNP marker selected from Table 15; and program code for
analyzing the dataset to determine the presence or absence of the
SNP marker, wherein the presence of the SNP marker is positively
correlated or negatively correlated with the likelihood of SCE in
the subject.
[0059] Also described herein is a kit for use in predicting the
likelihood of SCE in a subject, comprising: a set of reagents
comprising a plurality of reagents for determining from a sample
obtained from the subject data for a SNP marker selected from Table
15; and instructions for using the plurality of reagents to
determine data from the sample. In some aspects, the instructions
comprise instructions for conducting a nucleotide-based assay.
[0060] Also described herein is a kit for use in predicting the
likelihood of SCE in a subject, comprising: a set of reagents
consisting essentially of a plurality of reagents for determining
from a sample obtained from the subject data for a SNP marker
selected from Table 15; and instructions for using the plurality of
reagents to determine data from the sample. In some aspects, the
instructions comprise instructions for conducting a
nucleotide-based assay.
BRIEF DESCRIPTION OF THE DRAWINGS
[0061] FIG. 1 shows that 3.3% of SNPs ailed the applied SNP call
rate based on a cutoff of 95%.
[0062] FIG. 2 is a deFinetti diagram that shows most of the tested
SNPs out of equilibrium have a low SNP call rate <95%.
[0063] FIG. 3 is a cluster diagram of a representative example SNP
(SNP_A-1859379).
[0064] FIG. 4 shows that the non-pseudo-autosomal SNPs on
chromosome X show no such pathology.
[0065] FIG. 5 shows a gender determination plot.
[0066] FIG. 6 shows that subject gender was significantly
associated with VT/VF time-to-event (TTE) in a Kaplan-Meier
plot.
[0067] FIG. 7 is a Kaplan-Meier plot that shows there is no
discernible association of high/low MADIT II score with VT/VF
arrhythmia.
[0068] FIG. 8 shows that the individual components of the MADIT II
score show no significant association, except for the NYHA class,
which shows marginally-significant association.
[0069] FIG. 9 is a Kaplan-Meier plot showing no significant
association of BUN level with VT/VF arrhythmia. FIG. 9 also shows
that creatinine level has no discernible association with VT/VF
arrhythmia.
[0070] FIG. 10 shows at diabetes status does not have a significant
association with VT/VF arrhythmia.
[0071] FIG. 11 shows that primary geneset analyses shows no
statistical significance.
[0072] FIG. 12 shows p-values of the secondary geneset analyses in
the plot with the horizontal dashed-line showing the Bonferroni
adjustment required to achieve significance for 414 tests. Two
genes had significant association: CENPO and ADCY3.
[0073] FIG. 13 is a QQ normal plot that shows the null distribution
from the permutation test fits a normal distribution for the CENPO
gene.
[0074] FIG. 14 is a genotype cluster plot of the top hitting SNP
(SNP_A-2053054) in the GWAS analyses.
[0075] FIG. 15 is a Kaplan-Meier plot showing differential survival
between the different genotypes for SNP_A-2053054.
[0076] FIG. 16 shows a test of the Cox model fit that makes a
proportional odds assumption and a gender plot.
[0077] FIG. 17 is a Manhattan plot showing the p-values for the
SNPs on chromosome 4, which includes the top hitting SNPs. The red
dashed-line at the top represents the conservative Bonferroni level
required for genome-wide significance.
[0078] FIG. 18 is a plot showing the results of calculations for
contiguous blocks and random blocks and for the several block sizes
100, 500, and 1000, and as a function of the percent cutoff. Each
curve approaches 100% on the right. The right side values include
the independent SNPs as well as the random noise.
[0079] FIG. 19 shows an estimated value of between 13% to 26% for
the percentage of independent SNPs identified in the study.
DETAILED DESCRIPTION
[0080] These and other features of the present teachings will
become more apparent from the description herein. While the present
teachings are described in conjunction with various embodiments, it
is not intended that the present teachings be limited to such
embodiments. On the contrary, the present teachings encompass
various alternatives, modifications, and equivalents, as will be
appreciated by those of skill in the art.
[0081] Most of the words used in this specification have the
meaning that would be attributed to those words by one skilled in
the art. Words specifically defined in the specification have the
meaning provided in the context of the present teachings as a
whole, and as are typically understood by those skilled in the art.
In the event that a conflict arises between an art-understood
definition of a word or phrase and a definition of the word or
phrase as specifically taught in this specification, the
specification shall control.
[0082] It must be noted that, as used in the specification and the
appended claims, the singular forms "a," "an," and "the" include
plural referents unless the context clearly dictates otherwise.
[0083] Terms used in the claims and specification are defined as
set forth below unless otherwise specified.
[0084] "Biomarker," "biomarkers," "marker" or "markers" refers to a
sequence characteristic of a particular variant allele (i.e.,
polymorphic site) or wild-type allele. A marker can include any
allele, including wild-types alleles, SNPs, microsatellites,
insertions, deletions, duplications, and translocations. A marker
can also include a peptide encoded by an allele comprising nucleic
acids. A marker in the context of the present teachings
encompasses, without limitation, cytokines, chemokines, growth
factors, proteins, peptides, nucleic acids, oligonucleotides, and
metabolites, together with their related metabolites, mutations,
variants, polymorphisms, modifications, fragments, subunits,
degradation products, elements, and other analytes or
sample-derived measures. Markers can also include mutated proteins,
mutated nucleic acids, variations in copy numbers and/or transcript
variants. Markers also encompass non-blood borne factors and
non-analyte physiological markers of health status, and/or other
factors or markers not measured from samples biological samples
such as bodily fluids), such as clinical parameters and traditional
factors for clinical assessments. Markers can also include any
indices that are calculated and/or created mathematically. Markers
can also include combinations of any one or more of the foregoing
measurements, including temporal trends and differences.
[0085] To "analyze" includes measurement and/or detection of data
associated with a marker (such as, e.g., presence or absence of a
SNP, allele, or constituent expression levels) in the sample (or,
e.g., by obtaining a dataset reporting such measurements, as
described below). In some aspects, an analysis can include
comparing the measurement and/or detection against a measurement
and/or detection in a sample or set of samples from the same
subject or other control subject(s). The markers of the present
teachings can be analyzed by any of various conventional methods
known in the art.
[0086] A "subject" in the context of the present teachings is
generally a mammal. The subject can be a patient. The term "mammal"
as used herein includes but is not limited to a human, non-human
primate, dog, cat, mouse, rat, cow, horse, and pig. Mammals other
than humans can be advantageously used as subjects that represent
animal models of inflammation. A subject can be male or female. A
subject can be one who has been previously diagnosed or identified
as having a sudden cardiac event. A subject can be one who has
already undergone, or is undergoing, a therapeutic intervention for
a sudden cardiac event. A subject can also be one who has not been
previously diagnosed as having a sudden cardiac event; e.g., a
subject can be one who exhibits one or more symptoms or risk
factors for a sudden cardiac event, or a subject who does not
exhibit symptoms or risk factors for a sudden cardiac event, or a
subject who is asymptomatic for a sudden cardiac event.
[0087] A "sample" in the context of the present teachings refers to
any biological sample that is isolated from a subject. A sample can
include, without limitation, a single cell or multiple cells,
fragments of cells, an aliquot of body fluid, whole blood,
platelets, serum, plasma, red blood cells, white blood cells or
leucocytes, endothelial cells, tissue biopsies, synovial fluid,
lymphatic fluid, ascites fluid, and interstitial or extracellular
fluid. The term "sample" also encompasses the fluid in spaces
between cells, including gingival crevicular fluid, bone marrow,
cerebrospinal fluid (CSF), saliva, mucous, sputum, semen, sweat,
urine, or any other bodily fluids. "Blood sample" can refer to
whole blood or any fraction thereof, including blood cells, red
blood cells, white blood cells or leucocytes, platelets, serum and
plasma. Samples can be obtained from a subject by means including
but not limited to venipuncture, excretion, ejaculation, massage,
biopsy, needle aspirate, lavage, scraping, surgical incision, or
intervention or other means known in the art.
[0088] A "dataset" is a set of data (e.g., numerical values)
resulting from evaluation of a sample (or population of samples)
under a desired condition. The values of the dataset can be
obtained, for example, by experimentally obtaining measures from a
sample and constructing a dataset from these measurements; or
alternatively, by obtaining a dataset from a service provider such
as a laboratory, or from a database or a server on which the
dataset has been stored. Similarly, the term "obtaining a dataset
associated with a sample" encompasses obtaining a set of data
determined from at least one sample. Obtaining a dataset
encompasses obtaining a sample, and processing the sample to
experimentally determine the data, e.g., via measuring, PCR,
microarray, one or more primers, one or more probes, antibody
binding, or ELISA. The phrase also encompasses receiving a set of
data, e.g., from a third party that has processed the sample to
experimentally determine the dataset. Additionally, the phrase
encompasses mining data from at least one database or at least one
publication or a combination of databases and publications.
[0089] "Measuring" or "measurement" in the context of the present
teachings refers to determining the presence, absence, quantity,
amount, or effective amount of a substance in a clinical or
subject-derived sample, including the presence, absence, or
concentration levels of such substances, and/or evaluating the
values or categorization of a subject's clinical parameters based
on a control.
[0090] A "prognosis" is a prediction as to the likely outcome of a
disease. Prognostic estimates are useful in, e.g., determining an
appropriate therapeutic regimen for a subject.
[0091] A "nucleotide-based assay" includes a nucleic acid binding
assay capable of detecting a SNP, such as a hybridization assay
that uses nucleic acid sequencing. Other examples of
nucleotide-based assays include single base extensions (see, e.g.,
Kobayashi et al, Mol. Cell. Probes, 9:175-182, 1995); single-strand
conformation polymorphism analysis, as described, e.g, in Orita et
al., Proc. Nat. Acad. Sci. 86, 2766-2770 (1989), allele specific
oligonucleotide hybridization (ASO) (e.g., Stoneking et al., Am. J.
Hum. Genet. 48:70-382, 1991; Saiki et al., Nature 324, 163-166,
1986; EP 235,726; and WO 89/11548); and sequence-specific
amplification or primer extension methods as described in, for
example, WO 93/22456; U.S. Pat. Nos. 5,137,806; 5,595,890;
5,639,611; and U.S. Pat. No. 4,851,331; 5'-nuclease assays, as
described in U.S. Pat. Nos. 5,210,015; 5,487,972; and 5,804,375;
and Holland et al, 1988, Proc. Natl. Acad. Sci. USA 88:7276-7280.
Other examples are described in U.S. Pat. Pub. 20110045469, herein
incorporated by reference.
Markers
[0092] The genome exhibits sequence variability between individuals
at many locations in the genome; in other words, there are many
polymorphic sites in a population. In some instances, reference is
made to different alleles at a polymorphic site without choosing a
reference allele. Alternatively, a reference sequence can be
referred to for a particular polymorphic site. The reference allele
is sometimes referred to as the "wild-type" allele and it usually
is chosen as either the first sequenced allele or as the allele
from a "non-affected" individual (e.g., an individual that does not
display a disease or abnormal phenotype). Alleles that differ from
the reference are referred to as "variant" alleles.
[0093] SNP nomenclature as reported herein refers to the official
Reference SNP (rs) ID identification tag as assigned to each unique
SNP by the National Center for Biotechnological Information (NCBI),
as of the filing date of the instant specification and/or an
application to which the instant specification claims priority.
Further information can be found on the SNP database of the NCBI
website.
[0094] A "haplotype" refers to a segment of a DNA strand that is
characterized by a specific combination of two or more markers
(e.g., alleles) arranged along the segment. In a certain
embodiment, the haplotype can comprise two or more alleles, three
or more alleles, four or more alleles, or five or more alleles. The
term "susceptibility," as described herein, encompasses at least
increased susceptibility. Thus, particular markers and/or
haplotypes of the invention may be characteristic of increased
susceptibility of a sudden cardiac event, as characterized by a
relative risk of greater than one compared to a control. Markers
and/or haplotypes that confer increased susceptibility of a sudden
cardiac event are furthermore considered to be "at-risk," as they
confer an increased risk of disease compared to a control.
[0095] A nucleotide position at which more than one sequence is
possible in a population (either a natural population or a
synthetic population, e.g., a library of synthetic molecules) is
referred to herein as a "polymorphic site." Where a polymorphic
site is a single nucleotide in length, the site is referred to as a
single nucleotide polymorphism ("SNP"). For example, if at a
particular chromosomal location, one member of a population has an
adenine and another member of the population has a thymine at the
same position, then this position is a polymorphic site, and, more
specifically, the polymorphic site is a SNP. Alleles for SNP
markers as referred to herein refer to the bases A, C, or T as they
occur at the polymorphic site in the SNP assay employed. The person
skilled in the art will realize that by assaying or reading the
opposite strand, the complementary allele can in each case be
measured. Thus, Coca polymorphic site containing an A/G
polymorphism, the assay employed may either measure the percentage
or ratio of the two bases possible, i.e., A and G. Alternatively,
by designing an assay that determines the opposite strand on the
DNA template, the percentage or ratio of the complementary bases
T/C can be measured. Quantitatively (for example, in terms of
relative risk), identical results would be obtained from
measurement of either DNA strand (+strand or -strand). Polymorphic
sites can allow for differences in sequences based on
substitutions, insertions or deletions. For example, a polymorphic
microsatellite has multiple small repeats of bases (such as CA
repeats) at a particular site in which the number of repeat lengths
varies in the general population. Each version of the sequence with
respect to the polymorphic site is referred to herein as an
"allele" of the polymorphic site. Thus, in the previous example,
the SNP allows for both an adenine allele and a thymine allele.
[0096] Typically, a reference sequence is referred to for a
particular sequence of interest. Alleles that differ from the
reference are referred to as "variant" alleles. Variants can
include changes that affect a polypeptide, e.g., a polypeptide
encoded by a gene. These sequence differences, when compared to a
reference nucleotide sequence, can include the insertion or
deletion of a single nucleotide, or of more than one nucleotide.
Such sequence differences may result in a frame shift; the change
of at least one nucleotide, may result in a change in the encoded
amino acid; the change of at least one nucleotide, may result in
the generation of a premature stop codon; the deletion of several
nucleotides, may result in a deletion of one or more amino acids
encoded by the nucleotides; the insertion of one or several
nucleotides, such as by unequal recombination or gene conversion,
may result in an interruption of the coding sequence of a reading
frame; duplication of all or a part of a sequence; transposition;
or a rearrangement of a nucleotide sequence, as described in detail
herein. Such sequence changes alter the polypeptide encoded by the
nucleic acid. For example, if the change in the nucleic acid
sequence causes a frame shift, the frame shift can result in a
change in the encoded amino acids, and/or can result in the
generation of a premature stop codon, causing generation of a
truncated polypeptide. Alternatively, a polymorphism associated
with a sudden cardiac event or a susceptibility to a sudden cardiac
event can be a synonymous change in one or more nucleotides (i.e.,
a change that does not result in a change in the amino acid
sequence). Such a polymorphism can, for example, alter splice
sites, affect the stability or transport of mRNA, or otherwise
affect the transcription or translation of an encoded polypeptide.
It can also alter DNA to increase the possibility that structural
changes, such as amplifications or deletions, occur at the somatic
level in tumors. The polypeptide encoded by the reference
nucleotide sequence is the "reference" polypeptide with a
particular reference amino acid sequence, and polypeptides encoded
by variant alleles are referred to as "variant" polypeptides with
variant amino acid sequences.
[0097] A polymorphic microsatellite has multiple small repeats of
bases that are 2-8 nucleotides in length (such as CA repeats) at a
particular site, in which the number of repeat lengths varies in
the general population. An indel is a common form of polymorphism
comprising a small insertion or deletion that is typically only a
few nucleotides long.
[0098] The haplotypes described herein can be a combination of
various genetic markers, e.g., SNPs and microsatellites, having
particular alleles at polymorphic sites. The haplotypes can
comprise a combination of various genetic markers; therefore,
detecting haplotypes can be accomplished by methods known in the
art for detecting sequences at polymorphic sites. For example,
standard techniques for genotyping for the presence of SNPs and/or
microsatellite markers can be used, such as fluorescence-based
techniques (Chen, X. et al., Genome Res. 9(5): 492-98 (1999)), PcR,
LCR, Nested PCR and other techniques for nucleic acid
amplification. These markers and SNPs can be identified in at-risk
haplotypes. Certain methods of identifying relevant markers and
SNPs include the use of linkage disequilibrium (LD) and/or LOD
scores.
[0099] In certain methods described herein, an individual who is
at-risk for a sudden cardiac event is an individual in whom an
at-risk marker or haplotype is identified. In one aspect, the
at-risk marker or haplotype is one that confers a significant
increased risk (or susceptility) of a sudden cardiac event. In one
embodiment, significance associated with a marker or haplotype is
measured by a relative risk. In a further embodiment, the
significance is measured by a percentage. In one embodiment, a
significant increased risk is measured as a relative risk of at
least about 1.2, including but not limited to: 1.2, 1.3, 1.4, 1.5,
1.6, 1.7, 1.8 and 1.9. In a further embodiment, a relative risk of
at least 1.2 is significant. In a further embodiment, a relative
risk of at least about 1.5 is significant. In a further embodiment,
a significant increase in risk is at least about 1.7 is
significant. In a further embodiment, a significant increase in
risk is at least about 20%, including but not limited to about 25%,
30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%,
95% and 98%. In a further embodiment, a significant increase in
risk is at least about 50%.
[0100] Thus, the term "susceptibility to a sudden cardiac event"
indicates an increased risk or susceptility of a sudden cardiac
event, by an amount that is significant, when a certain allele,
marker, SNP or haplotype is present. It is understood however, that
identifying whether an increased risk is medically significant may
also depend on a variety of factors, including the specific
disease, the marker or haplotype, and often, environmental
factors.
[0101] An at-risk marker or haplotype in, or comprising portions of
a gene, or in non-coding regions of the genome, is one where the
marker or haplotype is more frequently present in an individual at
risk for a sudden cardiac event (affected), compared to the
frequency of its presence in a healthy individual (control), and
wherein the presence of the marker or haplotype is indicative of
susceptibility to a sudden cardiac event. As an example of a simple
test for correlation would be a Fisher-exact test on a two by two
table. Given a cohort of chromosomes the two by two table is
constructed out of the number of chromosomes that include both of
the markers or haplotypes, one of the markers or haplotypes but not
the other and neither of the markers or haplotypes.
[0102] In certain aspects of the invention, at-risk marker or
haplotype is an at-risk marker or haplotype within or near a gene,
or in a non-coding region of the genome, that significantly
correlates with a sudden cardiac event. In other aspects, an
at-risk marker or haplotype comprises an at-risk marker or
haplotype within or near a gene, or in a non-coding region of the
genome, that significantly correlates with susceptibility to a
sudden cardiac event.
[0103] Standard techniques for genotyping for the presence of SNPs
and/or microsatellite markers can be used, such as fluorescent
based techniques (Chen, et al., Genome Res. 9, 492 (1999)), PCR,
LCR, Nested PCR and other techniques for nucleic acid
amplification. In a preferred aspect, the method comprises
assessing in an individual the presence or frequency of SNPs and/or
microsatellites in, comprising portions of, a gene, wherein an
excess or higher frequency of the SNPs and/or microsatellites
compared to a healthy control individual is indicative that the
individual is susceptible to a sudden cardiac event. Such SNPs and
markers can form haplotypes that can be used as screening tools.
These markers and SNPs can be identified in at-risk haploptypes.
The presence of an at-risk haplotype is indicative of increased
susceptibility to a sudden cardiac event, and therefore is
indicative of an individual who falls within a target population
for the treatment methods described herein.
Nucleic Acids and Antibodies
[0104] Nucleic Acids, Portions and Variants
[0105] The nucleic acid molecules of the present invention can be
RNA, for example, mRNA, or DNA, such as cDNA and genomic DNA. DNA
molecules can be double-stranded or single-stranded;
single-stranded RNA or DNA can be the coding, or sense, strand or
the non-coding, or antisense strand. The nucleic acid molecule can
include all or a portion of the coding sequence of the gene and can
further comprise additional non-coding sequences such as introns
and non-coding 3' and 5' sequences (including regulator sequences,
for example).
[0106] An "isolated" nucleic acid molecule, as used herein, is one
that is separated from nucleic acids that normally flank the gene
or nucleotide sequence (as in genomic sequences) and/or has been
completely or partially purified from other transcribed sequences
(e.g., as in an RNA library). For example, an isolated nucleic acid
of the invention may be substantially isolated with respect to the
complex cellular milieu in which it naturally occurs, or culture
medium when produced by recombinant techniques, or chemical
precursors or other chemicals when chemically synthesized. In some
instances, the isolated material will form part of a composition
(for example, a crude extract containing other substances), buffer
system or reagent mix. In other circumstances, the material may be
purified to essential homogeneity, for example as determined by
PAGE or column chromatography such as HPLC. Preferably, an isolated
nucleic acid molecule comprises at least about 50, 80 or 90% (on a
molar basis) of all macromolecular species present. With regard to
genomic DNA, the term "isolated" also can refer to nucleic acid
molecules that are separated from the chromosome with which the
genomic DNA is naturally associated. For example, the isolated
nucleic acid molecule can contain less than about 5 kb but not
limited to 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of nucleotides
which flank the nucleic acid molecule in the genomic DNA of the
cell from which the nucleic acid molecule is derived.
[0107] An isolated nucleic acid molecule can include a nucleic acid
molecule or nucleic acid sequence that is synthesized chemically or
by recombinant means. Such isolated nucleic acid molecules are
useful as probes for isolating homologous sequences (e.g., from
other mammalian species), for gene mapping (e.g., by in situ
hybridization with chromosomes), or for detecting expression of the
gene in tissue (e.g., human tissue), such as by Northern or
Southern blot analysis.
[0108] Nucleic acid molecules of the invention can include, for
example, labeling, methylation, internucleotide modifications such
as uncharged linkages (e.g., methyl phosphonates, phosphotriesters,
phosphoamidates, carbamates), charged linkages (e.g.,
phosphorothioates, phosphorodithioates), pendent moieties (e.g.,
polypeptides), intercalators (e.g., acridine, psoralen), chelators,
alkylators, and modified linkages (e.g., alpha anomeric nucleic
acids). Also included are synthetic molecules that mimic nucleic
acid molecules in the ability to bind to a designated sequence via
hydrogen bonding and other chemical interactions. Such molecules
include, for example, those in which peptide linkages substitute
for phosphate linkages in the backbone of the molecule.
[0109] The invention also pertains to nucleic acid molecules that
hybridize under high stringency hybridization conditions, such as
for selective hybridization, to a nucleotide sequence described
herein (e.g., nucleic acid molecules which specifically hybridize
to a nucleotide sequence encoding polypeptides described herein,
and, optionally, have an activity of the polypeptide). In one
aspect, the invention includes variants described herein that
hybridize under high stringency hybridization conditions (e.g., for
selective hybridization) to a nucleotide sequence encoding an amino
acid sequence or a polymorphic variant thereof.
[0110] Such nucleic acid molecules can be detected and/or isolated
by specific hybridization (e.g., under high stringency conditions).
"Stringency conditions" for hybridization is a term of art which
refers to the incubation and wash conditions, e.g., conditions of
temperature and buffer concentration, which permit hybridization of
a particular nucleic acid to a second nucleic acid; the first
nucleic acid may be perfectly (i.e., 100%) complementary to the
second, or the first and second may share some degree of
complementarity which is less than perfect (e.g., 70%, 75%, 85%,
90%, 95%). For example, certain high stringency conditions can be
used which distinguish perfectly complementary nucleic acids from
those of less complementarity, "High stringency conditions,"
"moderate stringency conditions" and "low stringency conditions,"
as well as methods for nucleic acid hybridizations are explained on
pages 2.10.1-2.10.16 and pages 6.3.1-6.3.6 in Current Protocols in
Molecular Biology (Ausubel, F. et al., "Current Protocols in
Molecular Biology", John Wiley & Sons, (1998)), and in Kraus,
M. and Aaronson, S., Methods Enzymol., 200:546-556 (1991),
incorporated herein, by reference.
[0111] The percent homology or identity of two nucleotide or amino
acid sequences can be determined by aligning the sequences for
optimal comparison purposes (e.g., gaps can be introduced in the
sequence of a first sequence for optimal alignment). The
nucleotides or amino acids at corresponding positions are then
compared, and the percent identity between the two sequences is a
function of the number of identical positions shared by the
sequences (i.e., % identity=# of identical positions/total # of
positions .times.100). When a position in one sequence is occupied
by the same nucleotide or amino acid residue as the corresponding
position in the other sequence, then the molecules are homologous
at that position. As used herein, nucleic acid or amino acid
"homology" is equivalent to nucleic acid or amino acid "identity".
In certain aspects, the length of a sequence aligned for comparison
purposes is at least 30%, for example, at least 40%, in certain
aspects at least 60%, and in other aspects at least 70%, 80%, 90%
or 95% of the length of the reference sequence. The actual
comparison of the two sequences can be accomplished by well-known
methods, for example, using a mathematical algorithm. A preferred,
non-limiting example of such a mathematical algorithm is described
in Karlin et al., Proc. Natl. Acad. Sci. USA 90:5873-5877 (1993).
Such an algorithm is incorporated into the NBLAST and XBLAST
programs (version 2.0) as described in Altschul et al., Nucleic
Acids Res. 25:389-3402 (1997). When utilizing BLAST and Gapped
BLAST programs, the default parameters of the respective programs
(e.g., NBLAST) can be used. In one aspect, parameters for sequence
comparison can be set at score=100, word or can be varied (e.g.,
W=5 or W=20).
[0112] The present invention also provides isolated nucleic acid
molecules that contain a fragment or portion that hybridizes under
highly stringent conditions to a nucleotide sequence or the
complement of such a sequence, and also provides isolated nucleic
acid molecules that contain a fragment or portion that hybridizes
under highly stringent conditions to a nucleotide sequence encoding
an amino acid sequence or polymorphic variant thereof. The nucleic
acid fragments of the invention are at least about 15, preferably
at least about 18, 20, 23 or 25 nucleotides, and can be 30, 40, 50,
100, 200 or more nucleotides in length.
[0113] Probes and Primers
[0114] In a related aspect, the nucleic acid fragments of the
invention are used as probes or primers in assays such as those
described herein. "Probes" or "primers" are oligonucleotides that
hybridize in a base-specific manner to a complementary strand of
nucleic acid molecules. Such probes and primers include polypeptide
nucleic acids, as described in Nielsen et al., Science
254:1497-1500 (1991).
[0115] A probe or primer comprises a region of nucleotide sequence
that hybridizes to at least about 15, for example about 20-25, and
in certain aspects about 40, 50 or 75, consecutive nucleotides of a
nucleic acid molecule comprising a contiguous nucleotide sequence
of or polymorphic variant thereof. In other aspects, a probe or
primer comprises 100 or fewer nucleotides, in certain aspects from
6 to 50 nucleotides, for example from 12 to 30 nucleotides. In
other aspects, the probe or primer is at least 70% identical to the
contiguous nucleotide sequence or to the complement of the
contiguous nucleotide sequence, for example at least 80% identical,
in certain aspects at least 90% identical, and in other aspects at
least 95% identical, or even capable of selectively hybridizing to
the contiguous nucleotide sequence or to the complement of the
contiguous nucleotide sequence. Often, the probe or primer further
comprises a label, e.g., radioisotope, fluorescent compound,
enzyme, or enzyme co-factor.
[0116] The nucleic acid molecules of the invention can be
identified and isolated using standard molecular biology techniques
and the sequence information provided herein. For example, nucleic
acid molecules can be amplified and isolated by the polymerase
chain reaction (PCR) using synthetic oligonucleotide primers
designed based on the sequence of a nucleic acid sequence of
interest or the complement of such a sequence, or designed based on
nucleotides based on sequences encoding one or more of the amino
acid sequences provided herein. See generally PCR Technology:
Principles and Applications for DNA Amplification (ed. H. A.
Erlich, Freeman Press, NY, N.Y., 1992); PCR Protocols: A Guide to
Methods and Applications (Eds. Innis et al., Academic Press, San
Diego, Calif., 1990); Manila et al., Nucl. Acids Res. 19: 4967
(1991); Eckert et al., PCR Methods and Applications 1:17 (1991);
PCR (eds. McPherson et al., IRL Press, Oxford); and U.S. Pat. No.
4,683,202. The nucleic acid molecules can be amplified using cDNA,
mRNA or genomic DNA as a template, cloned into an appropriate
vector and characterized by DNA sequence analysis.
[0117] Other suitable amplification methods include the ligase
chain reaction (LCR) (see Wu and Wallace, Genomics 4:560 (1989),
Landegren et al., Science 241:1077 (1988), transcription
amplification (Kwoh et al., Proc. Natl. Acad. Sci. USA 86:1173
(1989)), and self-sustained sequence replication (Guatelli et al.,
Proc. Nat. Acad. Sci, USA 87:1874 (1990)) and nucleic acid based
sequence amplification (NASBA). The tatter two amplification
methods involve isothermal reactions based on isothermal
transcription, which produce both single stranded RNA (ssRNA) and
double stranded DNA (dsDNA) as the amplification products in a
ratio of about 30 or 100 to 1, respectively.
[0118] The amplified DNA can be labeled, for example, radiolabeled,
and used as a probe for screening a cDNA library derived from human
cells, mRNA in zap express, ZIPLOX or other suitable vector.
Corresponding clones can be isolated, DNA can obtained following in
vivo excision, and the cloned insert can be sequenced in either or
both orientations by art recognized methods to identify the correct
reading frame encoding a polypeptide of the appropriate molecular
weight. For example, the direct analysis of the nucleotide sequence
of nucleic acid molecules of the present invention can be
accomplished using well-known methods that are commercially
available. See, for example, Sambrook et al., Molecular Cloning, A
Laboratory Manual (2nd Ed., CSHP, New York 1989); Zyskind et al.,
Recombinant DNA Laboratory Manual, (Acad. Press, 1988)).
Additionally, fluorescence methods are also available for analyzing
nucleic acids (Chen et al., Genome Res. 9, 492 (1999)) and
polypeptides. Using these or similar methods, the polypeptide and
the DNA encoding the polypeptide can be isolated, sequenced and
further characterized.
[0119] The nucleic acid sequences can also be used to compare with
endogenous DNA sequences in patients to identify one or more of the
disorders, and as probes, such as to hybridize and discover related
DNA sequences or to subtract out known sequences from a sample. The
nucleic acid sequences can further be used to derive primers for
genetic fingerprinting. Portions or fragments of the nucleotide
sequences identified herein (and the corresponding complete gene
sequences) can be used in numerous ways, such as polynucleotide
reagents. For example, these sequences can be used to (i) map their
respective genes on a chromosome; and, thus, locate gene regions
associated with genetic disease; (ii) identify an individual from a
minute biological sample (tissue typing); and (iii) aid in forensic
identification of a biological sample. The nucleic acid sequences
can additionally be used as reagents in the screening and/or
diagnostic assays described herein, and can also be included as
components of kits (e.g., reagent kits) for use in the screening
and/or diagnostic assays described herein.
[0120] Kits (e.g., reagent kits) useful in the methods of diagnosis
comprise components useful in any of the methods described herein,
including for example, hybridization probes or primers as described
herein (e.g., labeled probes or primers), reagents for detection of
labeled molecules, restriction enzymes (e.g., for RFLP analysis),
allele-specific oligonucleotides, antibodies which hind to altered
or to non-altered (native) polypeptide, means for amplification of
nucleic acids comprising a nucleic acid or for a portion of, or
means for analyzing the nucleic acid sequence of a nucleic acid or
for analyzing the amino acid sequence of a polypeptide as described
herein, etc. The primers can be designed using portions of the
nucleic acids flanking SNPs that are indicative of a sudden cardiac
event.
[0121] Antibodies
[0122] Polyclonal antibodies and/or monoclonal antibodies that
specifically bind one form of the gene product but not to the other
form of the gene product are also provided. Antibodies are also
provided which bind a portion of either the variant or the
reference gene product that contains the polymorphic site or sites.
The term "antibody" as used herein refers to immunoglobulin
molecules and immunologically active portions of immunoglobulin
molecules, i.e., molecules that contain antigen-binding sites that
specifically bind an antigen. A molecule that specifically binds to
a polypeptide of the invention is a molecule that binds to that
polypeptide or a fragment thereof, but does not substantially bind
other molecules in a sample, e.g., a biological sample, which
naturally contains the polypeptide. Examples of immunologically
active portions of immunoglobulin molecules include F(ab) and
F(ab')2 fragments which can be generated by treating the antibody
with an enzyme such as pepsin. The invention provides polyclonal
and monoclonal antibodies that bind to a polypeptide of the
invention. The term "monoclonal antibody" or "monoclonal antibody
composition," as used herein, refers to a population of antibody
molecules that contain only one species of an antigen binding site
capable of immunoreacting with a particular epitope of a
polypeptide of the invention. A monoclonal antibody composition
thus typically displays a single binding affinity for a particular
polypeptide of the invention with which it immunoreacts.
[0123] Polyclonal antibodies can be prepared by immunizing a
suitable subject with a desired immunogen, e.g., polypeptide of the
invention or a fragment thereof. The antibody titer in the
immunized subject can be monitored over time by standard
techniques, such as with an enzyme linked immunosorbent assay
(ELISA) using immobilized polypeptide. If desired, the antibody
molecules directed against the polypeptide can be isolated from the
mammal (e.g., from the blood) and further purified by well-known
techniques, such as protein A chromatography to obtain the IgG
fraction. At an appropriate time after immunization, e.g., when the
antibody titers are highest, antibody-producing cells can be
obtained from the subject and used to prepare monoclonal antibodies
by standard techniques, such as the hybridoma technique originally
described by Kohler and Milstein, Nature 256:495-497 (1975), the
human cell hybridoma technique (Kozbor et al., Immunol. Today 4: 72
(1983)), the EBV-hybridoma technique (Cole et al., Monoclonal
Antibodies and Cancer Therapy, Alan R. Liss, 1985, pp. 77-96) or
trioma techniques. The technology for producing hybridomas is well
known (see generally Current Protocols in Immunology (1994) Coligan
et al., (eds.) John Wiley & Sons, Inc., New York, N.Y.),
Briefly, an immortal cell line (typically a myeloma) is fused to
lymphocytes (typically splenocytes) from a mammal immunized with an
immunogen as described above, and the culture supernatants of the
resulting hybridoma cells are screened to identify a hybridoma
producing a monoclonal antibody that binds a polypeptide of the
invention.
[0124] Any of the many well-known protocols used for fusing
lymphocytes and immortalized cell lines can be applied for the
purpose of generating a monoclonal antibody to a polypeptide of the
invention (see, e.g., Current Protocols in Immunology, supra;
Galfre et al., Nature 266:55052 (1977); R. H. Kenneth, in
Monoclonal Antibodies; A New Dimension In Biological Analyses,
Plenum Publishing Corp., New York, N.Y. (1980); and Lerner, Yale J.
Biol. Med. 54:387-402 (1981)). Moreover, the ordinarily skilled
worker will appreciate that there are many variations of such
methods that also would be useful.
[0125] Alternative to preparing monoclonal antibody-secreting
hybridomas, a monoclonal antibody to a polypeptide of the invention
can be identified and isolated by screening a recombinant
combinatorial immunoglobulin library (e.g., an antibody phage
display library) with the polypeptide to thereby isolate
immunoglobulin library members that bind the polypeptide. Kits for
generating and screening phage display libraries are commercially
available (e.g., the Pharmacia Recombinant Phage Antibody System,
Catalog No. 27-9400-01; and the Stratagene SurfZAP Phage Display
Kit, Catalog No. 240612). Additionally, examples of methods and
reagents particularly amenable for use in generating and screening
antibody display library can be found in, for example, U.S. Pat.
No. 5,223,409; PCT Publication No. WO 92/18619; PCT Publication No.
WO 91/17271; PCT Publication No. WO 92/20791; PCT Publication No.
WO 92/15679; PCT Publication No. WO 93/01288; PCT Publication No.
WO 92/01047; PCT Publication No. WO 92/09690; PCT Publication No.
WO 90/02809; Fuchs et al., Bio/Technology 9: 1370-1372 (1991); Hay
et al., Hum. Antibod. Hybridomas 3:81-85 (1992); Huse et al.,
Science 246: 1275-1281 (1989); and Griffiths et al., EMBO J.
12:725-734 (1993).
[0126] Additionally, recombinant antibodies, such as chimeric and
humanized monoclonal antibodies, comprising both human and
non-human portions, which can be made using standard recombinant
DNA techniques, are within the scope of the invention. Such
chimeric and humanized monoclonal antibodies can be produced by
recombinant DNA techniques known in the art.
[0127] "Single-chain antibodies" are Fv molecules in which the
heavy and light chain variable regions have been connected by a
flexible linker to form a single polypeptide chain, which forms an
antigen binding region. Single chain antibodies are discussed in
detail in International Patent Application Publication No. WO
88/01649 and U.S. Pat. No. 4,946,778 and No. 5,260,203, the
disclosures of which are incorporated by reference.
[0128] In general, antibodies of the invention (e.g., a monoclonal
antibody) can be used to isolate a polypeptide of the invention by
standard techniques, such as affinity chromatography or
immunoprecipitation. A polypeptide-specific antibody can facilitate
the purification of natural polypeptide from cells and of
recombinantly produced polypeptide expressed in host cells.
Moreover, an antibody specific for a polypeptide of the invention
can be used to detect the polypeptide (e.g., in a cellular lysate,
cell supernatant, or tissue sample) in order to evaluate the
abundance and pattern of expression of the polypeptide, Antibodies
can be used diagnostically to monitor protein levels in tissue as
part of a clinical testing procedure, e.g., to, for example,
determine the efficacy of a given treatment regimen. The antibody
can be coupled to a detectable substance to facilitate its
detection. Examples of detectable substances include various
enzymes, prosthetic groups, fluorescent materials, luminescent
materials, bioluminescent materials, and radioactive materials.
Examples of suitable enzymes include horseradish peroxidase,
alkaline phosphatase, beta-galactosidase, or acetylcholinesterase;
examples of suitable prosthetic group complexes include
streptavidin/biotin and avidin/biotin; examples of suitable
fluorescent materials include umbelliferone, fluorescein,
fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine
fluorescein, dansyl chloride or phycoerythrin; an example of a
luminescent material includes luminol; examples of bioluminescent
materials include luciferase, luciferin, and aequorin, and examples
of suitable radioactive material include 125I, 131I, 35S or 3H.
Detection Assays
[0129] Nucleic acids, probes, primers, and antibodies such as those
described herein can be used in a variety of methods of diagnosis
of a susceptibility to a sudden cardiac event (e.g., an
arrhythmia), as well as in kits (e.g., useful for diagnosis of a
susceptibility to a sudden cardiac event). Similarly, the nucleic
acids, probes, primers, and antibodies described herein can be used
in methods of diagnosis of a protection against a sudden cardiac
event, and also in kits. In one aspect, the kit comprises primers
that can be used to amplify the markers of interest.
[0130] In one aspect of the invention, diagnosis of a
susceptibility to a sudden cardiac event is made by detecting a
polymorphism in a nucleic acid as described herein. The
polymorphism can be a change in a nucleic acid, such as the
insertion or deletion of a single nucleotide, or of more than one
nucleotide, resulting in a frame shift; the change of at least one
nucleotide, resulting in a change in the encoded amino acid; the
change of at least one nucleotide, resulting in the generation of a
premature stop codon; the deletion of several nucleotides,
resulting in a deletion of one or more amino acids encoded by the
nucleotides; the insertion of one or several nucleotides, such as
by unequal recombination or gene conversion, resulting in an
interruption of the coding sequence of the gene; duplication of all
or a part of the gene; transposition of all or a part of the gene;
or rearrangement of all or a part of the gene. More than one such
change may be present in a single gene. Such sequence changes can
cause a difference in the polypeptide encoded by a nucleic acid.
For example, if the difference is a frame shift change, the frame
shift can result in a change in the encoded amino acids, and/or can
result in the generation of a premature stop codon, causing
generation of a truncated polypeptide. Alternatively, a
polymorphism associated with a disease or condition or a
susceptibility to a disease or condition associated with a nucleic
acid can be a synonymous alteration in one or more nucleotides
(i.e., an alteration that does not result in a change in the
polypeptide encoded by a nucleic acid). Such a polymorphism may
alter splicing sites, affect the stability or transport of mRNA, or
otherwise affect the transcription or translation of the gene.
[0131] In some aspects, a nucleotide-based assay is used to detect
a SNP.
[0132] In a method of diagnosing a susceptibility to a sudden
cardiac event, hybridization methods, such as Southern analysis,
Northern analysis, or in situ hybridizations, can be used (see
Current Protocols in Molecular Biology, Ausubel, F. et al., eds,
John Wiley & Sons, including all supplements through 1999). For
example, a biological sample (a "test sample") from a test subject
(the "test individual") of genomic DNA, RNA, or cDNA, is obtained
from an individual (RNA and cDNA can only be used for exonic
markers), such as an individual suspected of having, being
susceptible to or predisposed for, or carrying a defect for, a
sudden cardiac event. The individual can be an adult, child, or
fetus. The test sample can be from any source which contains
genomic DNA, such as a blood sample, sample of amniotic fluid,
sample of cerebrospinal fluid, or tissue sample from skin, muscle,
buccal or conjunctival mucosa, placenta, gastrointestinal tract or
other organs. A test sample of DNA from fetal cells or tissue can
be obtained by appropriate methods, such as by amniocentesis or
chorionic villus sampling. The DNA, RNA, or cDNA sample is then
examined to determine whether a polymorphism in a nucleic acid is
present, and/or to determine which splicing variant(s) encoded by
the nucleic acid is present. The presence of the polymorphism or
splicing variant(s) can be indicated by hybridization of the gene
in the genomic DNA, RNA, or cDNA to a nucleic acid probe, A
"nucleic acid probe," as used herein, can be a DNA probe or an RNA
probe; the nucleic acid probe can contain, for example, at least
one polymorphism in a nucleic acid and/or contain a nucleic acid
encoding a particular splicing variant of a nucleic acid. The probe
can be any of the nucleic acid molecules described above (e.g., the
gene or nucleic acid, a fragment, a vector comprising the gene or
nucleic acid, a probe or primer, etc.).
[0133] To diagnose a susceptibility to a sudden cardiac event, a
hybridization sample can be formed by contacting the test sample
containing a nucleic acid with at least one nucleic acid probe. A
probe for detecting mRNA or genomic DNA can be a labeled nucleic
acid probe capable of hybridizing to mRNA or genomic DNA sequences.
The nucleic acid probe can be, for example, a full-length nucleic
acid molecule, or a portion thereof, such as an oligonucleotide of
at least 15, 30, 50, 100, 250 or 500 nucleotides in length and
sufficient to specifically hybridize under stringent conditions to
appropriate mRNA genomic DNA.
[0134] The hybridization sample is maintained under conditions that
are sufficient to allow specific hybridization of the nucleic acid
probe to a nucleic acid, "Specific hybridization," as used herein,
indicates exact hybridization (e.g., with no mismatches). Specific
hybridization can be performed under high stringency conditions or
moderate stringency conditions, for example, as described above. In
a particularly preferred aspect, the hybridization conditions for
specific hybridization are high stringency.
[0135] Specific hybridization, if present, is then detected using
standard methods. If specific hybridization occurs between the
nucleic acid probe and nucleic acid in the test sample, then the
nucleic acid has the polymorphism, or is the splicing variant, that
is present in the nucleic acid probe. More than one nucleic acid
probe can also be used concurrently in this method. Specific
hybridization of any one of the nucleic acid probes is indicative
of a polymorphism in the nucleic acid, or of the presence of a
particular splicing variant encoding the nucleic acid and can be
diagnostic for a susceptibility to a sudden cardiac event.
[0136] In Northern analysis (see Current Protocols in Molecular
Biology, Ausubel, F. et al., eds., John Wiley & Sons.)
hybridization methods can be used to identify the presence of a
polymorphism or a particular splicing variant, associated with a
susceptibility to a sudden cardiac event or associated with a
decreased susceptibility to a sudden cardiac event. For Northern
analysis, a test sample of RNA is obtained from the individual by
appropriate means. Specific hybridization of a nucleic acid probe
to RNA from the individual is indicative of a polymorphism in a
nucleic acid, or of the presence of a particular splicing variant
encoded by a nucleic acid and is therefore diagnostic for the
susceptibility to a sudden cardiac event. For representative
examples of use of nucleic acid probes, see, for example, U.S. Pat.
Nos. 5,288,611 and 4,851,330, both of which are herein incorporated
by reference.
[0137] Alternatively, a peptide nucleic acid (PNA) probe can be
used instead of a nucleic acid probe in the hybridization methods.
PNA is a DNA mimic having a peptide-like, inorganic backbone, such
as N-(2-aminoethyl) glycine units, with an organic base (A, G, C, T
or U) attached to the glycine nitrogen via a methylene carbonyl
linker (see, for example, Nielsen, P. E. et al., Bioconjugate
Chemistry 5, American Chemical Society, p. 1 (1994). The PNA probe
can be designed to specifically hybridize to a nucleic acid.
Hybridization of the PNA probe to a nucleic acid can be diagnostic
for a susceptibility to a sudden cardiac event.
[0138] In another method of the invention, alteration analysis by
restriction digestion can be used to detect an alteration in the
gene, if the alteration (mutation) or polymorphism in the gene
results in the creation or elimination of a restriction site. A
test sample containing genomic DNA is obtained from the individual.
Polymerase chain reaction (PCR) can be used to amplify a nucleic
acid (and, if necessary, the flanking sequences) in the test sample
of genomic DNA from the test individual. RFLP analysis is conducted
as described (see Current Protocols in Molecular Biology). The
digestion pattern of the relevant DNA fragment indicates the
presence or absence of the alteration or polymorphism in the
nucleic acid, and therefore indicates the presence or absence a
susceptibility to a sudden cardiac event.
[0139] Sequence analysis can also be used to detect specific
polymorphisms in a nucleic acid. A test sample of DNA or RNA is
obtained from the test individual. PCR or other appropriate methods
can be used to amplify the gene or nucleic acid, and/or its
flanking sequences, if desired. The sequence of a nucleic acid, or
a fragment of the nucleic acid, or cDNA, or fragment of the cDNA,
or mRNA, or fragment of the mRNA, is determined, using standard
methods. The sequence of the nucleic acid, nucleic acid fragment,
cDNA, cDNA fragment, mRNA, or mRNA fragment is compared with the
known nucleic acid sequence of the gene or cDNA or mRNA, as
appropriate. The presence of a polymorphism in a nucleic acid
indicates that the individual has a susceptibility to a sudden
cardiac event.
[0140] Allele-specific oligonucleotides can also be used to detect
the presence of a polymorphism in a nucleic acid, through the use
of dot-blot hybridization of amplified oligonucleotides with
allele-specific oligonucleotide (ASO) probes (see, for example,
Saiki, R. et al., Nature 324:163-166 (1986)). An "allele-specific
oligonucleotide" (also referred to herein as an "allele-specific
oligonucleotide probe") is an oligonucleotide of approximately
10-50 base pairs, preferably approximately 15-30 base pairs, that
specifically hybridizes to a nucleic acid, and, in the context of
the instant invention, that contains a polymorphism associated with
a susceptibility to a sudden cardiac event. An allele-specific
oligonucleotide probe that is specific for particular polymorphisms
in a nucleic acid can be prepared, using standard methods (see
Current Protocols in Molecular Biology). To identify polymorphisms
in the gene that are associated with a sudden cardiac event, a test
sample of DNA is Obtained from the individual. PCR can be used to
amplify all or a fragment of a nucleic acid and its flanking
sequences. The DNA containing the amplified nucleic acid (or
fragment of the gene or nucleic acid) is dot-blotted, using
standard methods (see Current Protocols in Molecular Biology), and
the blot is contacted with the oligonucleotide probe. The presence
of specific hybridization of the probe to the amplified nucleic
acid is then detected. Hybridization of an allele-specific
oligonucleotide probe to DNA from the individual is indicative of a
polymorphism in the nucleic acid, and is therefore indicative of
susceptibility to a sudden cardiac event.
[0141] The invention further provides allele-specific
oligonucleotides that hybridize to the reference or variant allele
of a gene or nucleic acid comprising a single nucleotide
polymorphism or to the complement thereof. These oligonucleotides
can be probes or primers.
[0142] An allele-specific primer hybridizes to a site on target DNA
overlapping a polymorphism and only primes amplification of an
allelic form to which the primer exhibits perfect complementarity.
See Gibbs, Nucleic Acid Res. 17, 2427-2448 (1989). This primer is
used in conjunction with a second primer, which hybridizes at a
distal site. Amplification proceeds from the two primers, resulting
in a detectable product, which indicates the particular allelic
form is present. A control is usually performed with a second pair
of primers, one of which shows a single base mismatch at the
polymorphic site and the other of which exhibits perfect
complementarity to a distal site. The single-base mismatch prevents
amplification and no detectable product is formed. The method works
best when the mismatch is included in the 3'-most position of the
oligonucleotide aligned with the polymorphism because this position
is most destabilizing to elongation from the primer (see, e.g., WO
93/22456).
[0143] With the addition of such analogs as locked nucleic acids
(LNAs), the size of primers and probes can be reduced to as few as
8 bases. LNAs are a novel class of bicyclic DNA analogs in which
the 2' and 4' positions in the furanose ring are joined via an
O-methylene (oxy-LNA), S-methylene (thio-LNA), or amino methylene
(amino-LNA) moiety. Common to all of these LNA variants is an
affinity toward complementary nucleic acids, which is by far the
highest reported for a DNA analog. For example, particular all
oxy-LNA nonamers have been shown to have melting temperatures of
64.degree. C. and 74.degree. C. when in complex with complementary
DNA or RNA, respectively, as opposed to 28.degree. C. for both DNA
and RNA for the corresponding DNA nonamer. Substantial increases in
Tm are also obtained when LNA monomers are used in combination with
standard DNA or RNA monomers. For primers and probes, depending on
where the LNA monomers are included (e.g., the 3' end, the 5' end,
or in the middle), the Tm could be increased considerably.
[0144] In another aspect, arrays of oligonucleotide probes that are
complementary to target nucleic acid sequence segments from an
individual can be used to identify polymorphisms in a nucleic acid.
For example, in one aspect, an oligonucleotide array can be used.
Oligonucleotide arrays typically comprise a plurality of different
oligonucleotide probes that are coupled to a surface of a substrate
in different known locations. These oligonucleotide arrays have
been generally described in the art, for example, U.S. Pat. No.
5,143,854 and PCT patent publication Nos. WO 90/15070 and 92/10092.
These arrays can generally be produced using mechanical synthesis
methods or light directed synthesis methods that incorporate a
combination of photolithographic methods and solid phase
oligonucleotide synthesis methods. See Fodor et al., Science
251:767-777 (1991), Pirrung et at, U.S. Pat. No. 5,143,854 (see
also PCT Application No. WO 90/15070) and Fodor et al., PCT
Publication No. WO 92/10092 and U.S. Pat. No. 5,424,186, the entire
teachings of which are incorporated by reference herein, Techniques
for the synthesis of these arrays using mechanical synthesis
methods are described in, e.g., U.S. Pat. No. 5,384,261; the entire
teachings are incorporated by reference herein. In another example,
linear arrays can be utilized.
[0145] Once an oligonucleotide array is prepared, a nucleic acid of
interest is hybridized with the array and scanned for
polymorphisms. Hybridization and scanning are generally carried out
by methods described herein and also in, e.g., published PCT
Application Nos. WO 92/10092 and WO 95/11995, and U.S. Pat. No.
5,424,186, the entire teachings of which are incorporated by
reference herein. In brief a target nucleic acid sequence that
includes one or more previously identified polymorphic markers is
amplified by well-known amplification techniques, e.g., PCR.
Typically, this involves the use of primer sequences that are
complementary to the two strands of the target sequence both
upstream and downstream from the polymorphism. Asymmetric PCR
techniques may also be used. Amplified target, generally
incorporating a label, is then hybridized with the array under
appropriate conditions. Upon completion of hybridization and
washing of the array, the array is scanned to determine the
position on the array to which the target sequence hybridizes. The
hybridization data obtained from the scan is typically in the form
of fluorescence intensities as a function of location on the
array.
[0146] Although primarily described in terms of a single detection
block, e.g., for detecting a single polymorphism, arrays can
include multiple detection blocks, and thus be capable of analyzing
multiple, specific polymorphisms. In alternative aspects, it will
generally be understood that detection blocks may be grouped within
a single array or in multiple, separate arrays so that varying,
optimal conditions may be used during the hybridization of the
target to the array. For example, it may often be desirable to
provide for the detection of those polymorphisms that fall within
G-C rich stretches of a genomic sequence, separately from those
falling in A-T rich segments. This allows for the separate
optimization of hybridization conditions for each situation.
[0147] Additional uses of oligonucleotide arrays for polymorphism
detection can be found, for example, in U.S. Pat. Nos. 5,858,659
and 5,837,832, the entire teachings of which are incorporated by
reference herein. Other methods of nucleic acid analysis can be
used to detect polymorphisms in a sudden cardiac event gene or
variants encoded by a sudden cardiac event-associated gene.
Representative methods include direct manual sequencing (Church and
Gilbert, Proc. Natl. Acad. Sci. USA 81:1991-1995 (1988); Sanger, F.
et al., Proc. Natl. Acad. Sci, USA 74:5463-5467 (1977); Beavis et
al., U.S. Pat. No. 5,288,644); automated fluorescent sequencing;
single-stranded conformation polymorphism assays (SSCP); clamped
denaturing gel electrophoresis (CDGE); denaturing gradient gel
electrophoresis (DGGE) (Sheffield, V. C. et al., Proc. Natl. Acad.
Sci. USA 86:232-236 (1989)), mobility shift analysis (Orita, M. et
al., Proc. Natl. Acad. Sci, USA 86:2766-2770 (1989)), restriction
enzyme analysis (Haven et Cell 15:25 (1978); Geever, et al., Proc.
Natl. Acad. Sci. USA 78:5081 (1980); heteroduplex analysis;
chemical mismatch cleavage (CMC) (Cotton et al., Proc, Natl. Acad.
Sci. USA 85:4397-4401 (1985)); RNase protection assays (Myers, R.
M. et al., Science 230:1242 (1985)); use of polypeptides which
recognize nucleotide mismatches, such as E. coli mutS protein;
allele-specific PCR, for example.
[0148] In one aspect of the invention, diagnosis of a
susceptibility to a sudden cardiac event, can also be made by
expression analysis by quantitative PCR (kinetic thermal cycling).
This technique, utilizing TaqMan assays, can assess the presence of
an alteration in the expression or composition of the polypeptide
encoded by a nucleic acid or splicing variants encoded by a nucleic
acid. TaqMan probes can also be used to allow the identification of
polymorphisms and whether a patient is homozygous or heterozygous.
Further, the expression of the variants can be quantified as
physically or functionally different.
[0149] In another aspect of the invention, diagnosis of a
susceptibility to a sudden cardiac event can be made by examining
expression and/or composition of a polypeptide, by a variety of
methods, including enzyme linked immunosorbent assays (ELISAs),
Western blots, immunoprecipitations and immunofluorescence. A test
sample from an individual is assessed for the presence of an
alteration in the expression and/or an alteration in composition of
the polypeptide encoded by a nucleic acid, or for the presence of a
particular variant encoded by a nucleic acid. An alteration in
expression of a polypeptide encoded by a nucleic acid can be, for
example, an alteration in the quantitative polypeptide expression
(i.e., the amount of polypeptide produced); an alteration in the
composition of a polypeptide encoded by a nucleic acid is an
alteration in the qualitative polypeptide expression (e.g.,
expression of an altered polypeptide or of a different splicing
variant). In a preferred aspect, diagnosis of a susceptibility to a
sudden cardiac event can be made by detecting a particular splicing
variant encoded by that nucleic acid, or a particular pattern of
splicing variants.
[0150] Both such alterations (quantitative and qualitative) can
also be present. The term "alteration" in the polypeptide
expression or composition, as used herein, refers to an alteration
in expression or composition in a test sample, as compared with the
expression or composition of polypeptide by a nucleic acid in a
control sample. A control sample is a sample that corresponds to
the test sample (e.g., is from the same type of cells), and is from
an individual who is not affected by a susceptibility to a sudden
cardiac event. An alteration in the expression or composition of
the polypeptide in the test sample, as compared with the control
sample, is indicative of a susceptibility to a sudden cardiac
event. Similarly, the presence of one or more different splicing
variants in the test sample, or the presence of significantly
different amounts of different splicing variants in the test
sample, as compared with the control sample, is indicative of a
susceptibility to a sudden cardiac event. Various means of
examining expression or composition of the polypeptide encoded by a
nucleic acid can be used, including: spectroscopy, colorimetry,
electrophoresis, isoelectric focusing, and immunoassays (e.g.,
David et al., U.S. Pat. No. 4,376,110) such as immunoblotting (see
also Current Protocols in Molecular Biology, particularly Chapter
10). For example, in one aspect, an antibody capable of binding to
the polypeptide (e.g., as described above), preferably an antibody
with a detectable label, can be used. Antibodies can be polyclonal,
or more preferably, monoclonal. An intact antibody, or a fragment
thereof (e.g., Fab or F(ab')2) can be used. The term "labeled,"
with regard to the probe or antibody, is intended to encompass
direct labeling of the probe or antibody by coupling (i.e.,
physically linking) a detectable substance to the probe or
antibody, as well as indirect labeling of the probe or antibody by
reactivity with another reagent that is directly labeled. Examples
of indirect labeling include detection of a primary antibody using
a fluorescently labeled secondary antibody and end-labeling a DNA
probe with biotin such that it can be detected with fluorescently
labeled streptavidin.
[0151] Western blotting analysis, using an antibody as described
above that specifically binds to a polypeptide encoded by an
altered nucleic acid or an antibody that specifically binds to a
polypeptide encoded by a non-altered nucleic acid, or an antibody
that specifically binds to a particular splicing variant encoded by
a nucleic acid, can be used to identify the presence in a test
sample of a particular splicing variant or of a polypeptide encoded
by a polymorphic or altered nucleic acid, or the absence in a test
sample of a particular splicing variant or of a polypeptide encoded
by a non-polymorphic or non-altered nucleic acid. The presence of a
polypeptide encoded by a polymorphic or altered nucleic acid, or
the absence of a polypeptide encoded by a non-polymorphic or
non-altered nucleic acid, is diagnostic for a susceptibility to a
sudden cardiac event, as is the presence (or absence) of particular
splicing variants encoded by the nucleic acid.
[0152] In one aspect of this method, the level or amount of
polypeptide encoded by a nucleic acid in a test sample is compared
with the level or amount of the polypeptide encoded by the nucleic
acid in a control sample. A level or amount of the polypeptide in
the test sample that is higher or tower than the level or amount of
the polypeptide in the control sample, such that the difference is
statistically significant, is indicative of an alteration in the
expression of the polypeptide encoded by the nucleic acid, and is
diagnostic for a susceptibility to a sudden cardiac event.
Alternatively, the composition of the polypeptide encoded by a
nucleic acid in a test sample is compared with the composition of
the polypeptide encoded by the nucleic acid in a control sample
(e.g., the presence of different splicing variants). A difference
in the composition of the polypeptide in the test sample, as
compared with the composition of the polypeptide in the control
sample, is diagnostic for a susceptibility to a sudden cardiac
event. In another aspect, both the level or amount and the
composition of the polypeptide can be assessed in the test sample
and in the control sample. A difference in the amount or level of
the polypeptide in the test sample, compared to the control sample;
a difference in composition in the test sample, compared to the
control sample; or both a difference in the amount or level, and a
difference in the composition, is indicative of a susceptibility to
a sudden cardiac event.
[0153] The same methods can conversely be used to identify the
presence of a difference when compared to a control (disease)
sample. A difference from the control can be indicative of a
protective allele against a sudden cardiac event.
[0154] In addition, one of skill will also understand that the
above described methods can also generally be used to detect
markers that do not include a polyporphism.
Diagnostic and Genetic Tests and Methods
[0155] As described herein, certain markers and haplotypes
comprising such markers are found to be useful for determination of
susceptibility to a sudden cardiac event--i.e., they are found to
be useful for diagnosing a susceptibility to a sudden cardiac
event. Examples of methods for determining which markers are
particularly useful in the determination of susceptibility to a
sudden cardiac event are described in more detail in the Examples
section below. Particular markers and haplotypes can be found more
frequently in individuals with a sudden cardiac event than in
individuals without a sudden cardiac event. Therefore, these
markers and haplotypes can have predictive value for detecting a
sudden cardiac event, or a susceptibility to a sudden cardiac
event, in an individual. The haplotypes and markers described
herein can be, in some cases, a combination of various genetic
markers, e.g., SNPs and microsatellites. Therefore, detecting
haplotypes can be accomplished by methods known in the art and/or
described herein for detecting sequences at polymorphic sites.
Furthermore, correlation between certain haplotypes or sets of
markers and disease phenotype can be verified using standard
techniques. A representative example of a simple test for
correlation would be a Fisher-exact test on a two by two table.
[0156] The knowledge about a genetic variant that confers a risk of
developing a sudden cardiac event offers the opportunity to apply a
genetic-test to distinguish between individuals with increased risk
of developing the disease (i.e., carriers of the at-risk variant)
and those with decreased risk of developing the disease (i.e.,
carriers of the protective variant). The core values of genetic
testing, for individuals belonging to both of the above mentioned
groups, are the possibilities of being able to diagnose the disease
at an early stage and provide information to the clinician about
prognosis/aggressiveness of the disease in order to be able to
apply the most appropriate treatment. For example, the application
of a genetic test for a sudden cardiac event can provide an
opportunity for the detection of the disease at an earlier stage
which may lead to the application of therapeutic measures at an
earlier stage, and thus can minimize the deleterious effects of the
symptoms and serious health consequences conferred by a sudden
cardiac event.
[0157] Also described herein is a method for predicting the
likelihood of a sudden cardiac event in a subject comprising a
plurality of SNPs. In some aspects, the subject's genome comprises
a plurality of SNPs shown in Table 15. In some aspects, the method
includes weighting each positively correlated SNP and each
negatively correlated SNP in Table 15 equally and predicting the
likelihood of a sudden cardiac event based on the relative number
of positively correlated and negatively correlated SNPs present in
the subject. For example, if the subject comprises a greater number
of positively correlated SNPs than negatively correlated SNPs then
the subject has an increased likelihood of experiencing a sudden
cardiac event.
Clinical Factors
[0158] In some embodiments, one or more clinical factors in a
subject can be assessed. In some embodiments, assessment of one or
more clinical factors in a subject can be combined with a marker
analysis in the subject to identify risk and/or susceptibility of
SCE in the subject.
[0159] Various clinical factors are generally known to one of
ordinary skill in the art to be associated with sudden cardiac
events. In some embodiments, clinical factors known to one of
ordinary skill in the art to be associated with a sudden cardiac
event, such as an arrhythmia, can include age, gender, race,
implant indication, prior pacing status, ICD presence, cardiac
resynchronization therapy defibrillator (CRT-D) presence, total
number of devices, device type, defibrillation thresholds
performed, number of programming zones, heart failure (HF)
etiology, HF onset, left ventricular ejection fraction (LVEF) at
implant, New York Heart Association (NYHA) class, months from most
recent myocardial infarction (MI) at implant, prior arrhythmia
event in setting of MI or arthroscopic chondral osseous autograft
transplantation (Cor procedure), diabetes status, Blood Urea
Nitrogen (BUN), Cr, renal disease history, rhythm parameters to
determine sinus v. non-sinus, heart rate, QRS duration prior to
implant, left bundle branch block, systolic blood pressure, history
of hypertension, smoking status, pulmonary disease, body mass index
(BMI), family history of sudden cardiac death, B-type natriuretic
peptide (BNP) levels, prior cardiac surgeries, medications,
microvolt-level T-wave alternans (MTWA) result, and/or inducibility
at electro-physiologic study (EPS).
[0160] See "A comparison of antiarrhythmic-drug therapy with
implantable defibrillators in patients resuscitated from near-fatal
ventricular arrhythmias. The Antiarrhythmics versus Implantable
Defibrillators (AVID) Investigators." N Engl J Med 1997;
337:1576-83; Bardy G H, Lee K L, Mark D B, et al. Amiodarone or an
implantable cardioverter-defibrillator for congestive heart
failure. N Engl J Med 2005; 352:225-37; Buxton A L, Lee K L, Fisher
J D, Josephson M E, Prystowsky E N, Hafley G. A randomized study of
the prevention of sudden death in patients with coronary artery
disease. Multicenter Unsustained Tachycardia Trial Investigators. N
Engl J Med 1999; 341:1882-90; Moss A J, Zareba W, Hall W J et al.
Prophylactic implantation of a defibrillator in patients with
myocardial infarction and reduced ejection fraction. N J Med 2002;
346:877-83; Kraaier K, Verhorst P M, van Dessel P F, Wilde A A,
Scholten M F. Towards a better risk stratification for sudden
cardiac death in patients with structural heart disease. Neth Heart
J 2009; 17:101-6; Patel J B, Koplan B A. ICD Implantation in
Patients With Ischemic Left Ventricular Dysfunction. Curr Treat
Options Cardiovasc Med 2009; 11:3-9; Buxton A E, Lee K L, Hafley G
E, et al. Limitations of ejection fraction for prediction of sudden
death risk in patients with coronary artery disease: lessons from
the MUSTT study. J Am Coll Cardiol 2007; 50: 1150-7; Cygankiewicz
I, Gillespie J, Zareba W et al. Predictors of long-term mortality
in Multicenter Automatic Defibrillator Implantation Trial II (MADIT
II) patients with implantable cardioverter-defibrillators. Heart
Rhythm 2009; 6:468-73; Levy W C, Lee K L, Hellkamp A S et al.
Maximizing survival benefit with primary prevention implantable
cardioverter-defibrillator therapy in a heart failure population.
Circulation 2009; 120:835-42; Levy W C, Mozaffarian D, Linker D T
et al. The Seattle Heart. Failure Model: prediction of survival in
heart failure. Circulation 2006; 113:1424-33; Vazquez R,
Bayes-Genis A, Cygankiewicz I et at. The MUSIC Risk score: a simple
method for predicting mortality in ambulatory patients with chronic
heart failure. Eur Heart J 2009; 30:1088-96; Chow T, Kereiakes D J,
Onufer et al. Does microvolt T-wave alternans testing predict
ventricular tachyarrhythmias in patients with ischemic
cardiomyopathy and prophylactic defibrillators? The MASTER
(Microvolt T Wave Alternans Testing for Risk Stratification of
Post-Myocardial Infarction Patients) trial. J Am Coll Cardiol 2008;
52:1607-15; Costantini O, Hohnloser S H, Kirk M M et al. The ABCD
(Alternans Before Cardioverter Defibrillator) Trial: strategies
using I-wave alternans to improve efficiency of sudden cardiac
death prevention. J Am Coll Cardiol 2009; 53:471-9; Blangy H,
Sadoul N, Dousset B et al. Serum BNP, hs-C-reactive protein,
procollagen to assess the risk of ventricular tachycardia in ICD
recipients after myocardial infarction. Europace 2007; 9:724-9;
Verma A, Kilicaslan F, Martin D O et al. Preimplantation B-type
natriuretic peptide concentration is an independent predictor of
future appropriate implantable defibrillator therapies. Heart 2006;
92:190-5; Wazni O M, Martin D O, Marrouche N F et al. Plasma B-type
natriuretic peptide levels predict postoperative atrial
fibrillation in patients undergoing cardiac surgery. Circulation
2004; 110:124-7; Dekker L R, Bezzina C R, Henriques J P et al.
Familial sudden death is an important risk factor for primary
ventricular fibrillation: a case-control study in acute myocardial
infarction patients. Circulation 2006; 114:1140-5; Jouven X, Desnos
M, Guerot C, Ducimetiere P. Predicting sudden death in the
population: the Paris Prospective Study I. Circulation 1999;
99:1978-83; Brodine W N, Tung R T, Lee J K et al. Effects of
beta-blockers on implantable cardioverter defibrillator therapy and
survival in the patients with ischemic cardiomyopathy (from the
Multicenter Automatic Defibrillator Implantation Trial-II), Am J
Cardiol 2005; 96:691-5; Coleman C I, Kluger J, Bhavnani S et al.
Association between statin use and mortality in patients with
implantable cardioverter-defibrillators and left ventricular
systolic dysfunction. Heart Rhythm 2008; 5:507-10.
[0161] All of the above cited references are herein incorporated by
reference in their entirety for all purposes.
Linkage Disequilibrium and Informative Gene Groups
[0162] Linkage disequilibrium refers to co-inheritance of two
alleles at frequencies greater than would be expected from the
separate frequencies of occurrence of each allele in a given
control population. The expected frequency of occurrence of two
alleles that are inherited independently is the frequency of the
first allele multiplied by the frequency of the second allele.
Alleles that co-occur at greater than expected frequencies are then
said to be in "linkage disequilibrium." The cause of linkage
disequilibrium is often unclear. It can be due to selection for
certain allele combinations or to recent admixture of genetically
heterogeneous populations. In addition, in the case of markers that
are very tightly linked to a disease gene, an association of an
allele (or group of linked alleles) with the disease gene is
expected if the disease mutation occurred in the recent past, so
that sufficient time has not elapsed for equilibrium to be achieved
through recombination events in the specific chromosomal region.
When referring to allelic patterns that are comprised of more than
one allele, a first allelic pattern is in linkage disequilibrium
with a second allelic pattern if all the alleles that comprise the
first allelic pattern are in linkage disequilibrium with at least
one of the alleles of the second allelic pattern.
[0163] In addition to the allelic patterns described above, as
described herein, one of skill in the art can readily identify
other alleles (including polymorphisms and mutations) that are in
linkage disequilibrium with an allele associated with a disease or
disorder. For example, a nucleic acid sample from a first group of
subjects without a particular disorder can be collected, as well as
DNA from a second group of subjects with the disorder. The nucleic
acid sample can then be compared to identify those alleles that are
over-represented in the second group as compared with the first
group, wherein such alleles are presumably associated with a
disorder. Alternatively, alleles that are in linkage disequilibrium
with an allele that is associated with the disorder can be
identified, for example, by genotyping a large population and
performing statistical analysis to determine which alleles appear
more commonly together than expected. Preferably the group is
chosen to be comprised of genetically related individuals.
Genetically related individuals include individuals from the same
race, the same ethnic group, or even the same family. As the degree
of genetic relatedness between a control group and a test group
increases, so does the predictive value of polymorphic alleles
which are ever more distantly linked to a disease-causing allele.
This is because less evolutionary time has passed to allow
polymorphisms that are linked along a chromosome in a founder
population to redistribute through genetic cross-over events. Thus
race-specific, ethnic-specific, and even family-specific diagnostic
genotyping assays can be developed to allow for the detection of
disease alleles which arose at ever more recent times in human
evolution, e.g., after divergence of the major human races, after
the separation of human populations into distinct ethnic groups,
and even within the recent history of a particular family line.
[0164] Linkage disequilibrium between two polymorphic markers or
between one polymorphic marker and a disease-associated gene or
mutation is a meta-stable state. Absent selective pressure or the
sporadic linked reoccurrence of the underlying mutational events,
the polymorphisms will eventually become disassociated by
chromosomal recombination events and will thereby reach linkage
equilibrium through the course of human evolution. Thus, the
likelihood of finding a polymorphic allele in linkage
disequilibrium with a disease or condition may increase with
changes in at least two factors: decreasing physical distance
between the polymorphic marker and the disease-causing mutation,
and decreasing number of meiotic generations available for the
dissociation of the linked pair. Consideration of the latter factor
suggests that, the more closely related two individuals are, the
more likely they will share a common parental chromosome or
chromosomal region containing the linked polymorphisms and the less
likely that this linked pair will have become unlinked through
meiotic cross-over events occurring each generation. As a result,
the more closely related two individuals are, the more likely it is
that widely spaced polymorphisms may be co-inherited. Thus, for
individuals related by common race, ethnicity or family, the
reliability of ever more distantly spaced polymorphic loci can be
relied upon as an indicator of inheritance of a linked
disease-causing mutation.
[0165] In addition to the specific, exemplary markers or haplotypes
identified in this application by name, accession number, SNP
Reference number, or sequence, included within the scope of the
invention are all operable markers and haplotypes and methods for
their use to determine susceptibility to a SCE using numerical
values of variant sequences having at least 90% or at least 95% or
at least 97% or greater identity to the exemplified marker
nucleotide sequences or haplotype nucleotide sequences or that
encode proteins having sequences with at least 90% or at least 95%
or at least 97% or greater identity to those encoded by the
exemplified markers or haplotypes. The percentage of sequence
identity may be determined using algorithms well known to those of
ordinary skill in the art, including, BLASTn, and BLASTp, as
described in Stephen F. Altschul et al., J. Mol. Biol. 215:403-410
(1990) and available at the National Center for Biotechnology
information website maintained by the National Institutes of
Health.
[0166] In accordance with an embodiment of the present invention,
all operable markers or haplotypes and methods for their use in
determining susceptibility to a SCE now known or later discovered
to be highly correlated with the expression of an exemplary marker
or haplotype can be used in addition to or in lieu of that
exemplary marker or haplotype. Such highly correlated markers or
haplotypes are contemplated to be within the literal scope of the
claimed invention(s) or alternatively encompassed as equivalents to
the exemplary markers or haplotypes. Identification of markers or
haplotypes having numerical values that are highly correlated to
those of the exemplary markers or haplotypes, and their use as a
component for determining susceptibility to SCE is well within the
level of ordinary skill in the art.
Computer Implementation
[0167] In one embodiment, a computer comprises at least one
processor coupled to a chipset. Also coupled to the chipset are a
memory, a storage device, a keyboard, a graphics adapter, a
pointing device, and a network adapter. A display is coupled to the
graphics adapter. In one embodiment, the functionality of the
chipset is provided by a memory controller hub and an I/O
controller hub. In another embodiment, the memory is coupled
directly to the processor instead of the chipset.
[0168] The storage device is any device capable of holding data,
like a hard drive, compact disk read-only memory (CD-ROM), DVD, or
a solid-state memory device. The memory holds instructions and data
used by the processor. The pointing device may be a mouse, track
ball, or other type of pointing device, and is used in combination
with the keyboard to input data into the computer system. The
graphics adapter displays images and other information on the
display. The network adapter couples the computer system to a local
or wide area network.
[0169] As is known in the art, a computer can have different and/or
other components than those described previously. In addition, the
computer can lack certain components. Moreover, the storage device
can be local and/or remote from the computer (such as embodied
within a storage area network (SAN)).
[0170] As is known in the art, the computer is adapted to execute
computer program modules for providing functionality described
herein. As used herein, the term "module" refers to computer
program logic utilized to provide the specified functionality.
Thus, a module can be implemented in hardware, firmware, and/or
software. In one embodiment, program modules are stored on the
storage device, loaded into the memory, and executed by the
processor.
[0171] Embodiments of the entities described herein can include
other and/or different modules than the ones described here. In
addition, the functionality attributed to the modules can be
performed by other or different modules in other embodiments.
Moreover, this description occasionally omits the term "module" for
purposes of clarity and convenience.
Methods of Therapy
[0172] In another embodiment, methods can be employed for the
treatment of a sudden cardiac event in subjects shown to be
susceptible to SCEs through use of e.g., diagnostic methods
disclosed herein. The term "treatment" as used herein, refers not
only to ameliorating symptoms associated with a sudden cardiac
event, but also preventing or delaying the onset of a sudden
cardiac event; lessening the severity or frequency of symptoms of a
sudden cardiac event; and/or also lessening the need for
concomitant therapy with other drugs that ameliorate symptoms
associated with a sudden cardiac event. In one aspect, the
individual to be treated is an individual who is susceptible (at an
increased risk) for a sudden cardiac event.
[0173] In some embodiments, methods can be employed for the
treatment of other diseases or conditions associated with a sudden
cardiac event. A therapeutic agent can be used both in methods of
treatment of a sudden cardiac event, as well as in methods of
treatment of other diseases or conditions associated with a sudden
cardiac event.
[0174] In one embodiment, the methods of treatment can utilize
implantation of a cardioverter defibrillator (ICD). The methods of
treatment (prophylactic and/or therapeutic) can also utilize a
therapeutic agent. The therapeutic agent(s) are administered in a
therapeutically effective amount (i.e., an amount that is
sufficient for "treatment," as described above). The amount which
will be therapeutically effective in the treatment of a particular
individual's disorder or condition will depend on the symptoms and
severity of the disease, and can be determined by standard clinical
techniques. In addition, in vitro or in vivo assays may optionally
be employed to help identify optimal dosage ranges. The precise
dose to be employed in the formulation will also depend on the
route of administration, and the seriousness of the disease or
disorder, and should be decided according to the judgment of a
practitioner and each patient's circumstances. Effective doses may
be extrapolated from dose response curves derived from in vitro or
animal model test systems.
Pharmaceutical Compositions
[0175] Methods for treatment of a sudden cardiac event in subjects
shown to be susceptible to SCEs through use of the diagnostic
methods are also encompassed. Said methods include administering a
therapeutically-effective amount of therapeutic agent. A
therapeutic agent can be formulated in pharmaceutical compositions.
These compositions can comprise, in addition to one or more of the
therapeutic agents, a pharmaceutically-acceptable excipient,
carrier, buffer, stabilizer or other materials well known to those
skilled in the art. Such materials should be non-toxic and should
not interfere with the efficacy of the active ingredient. The
precise nature of the carrier or other material can depend on the
route of administration, e.g. oral, intravenous, cutaneous or
subcutaneous, nasal, intramuscular, intraperitoneal routes.
[0176] Pharmaceutical compositions for oral administration can be
in tablet, capsule, powder or liquid form. A tablet can include a
solid carrier such as gelatin or an adjuvant. Liquid pharmaceutical
compositions generally include a liquid carrier such as water,
petroleum, animal or vegetable oils, mineral oil or synthetic oil.
Physiological saline solution, dextrose or other saccharide
solution or glycols such as ethylene glycol, propylene glycol or
polyethylene glycol can be included.
[0177] For intravenous, cutaneous or subcutaneous injection, or
injection at the site of affliction, the active ingredient will be
in the form of a parenterally acceptable aqueous solution which is
pyrogen-free and has suitable pH, isotonicity and stability, Those
of relevant skill in the art are well able to prepare suitable
solutions using, for example, isotonic vehicles such as Sodium
Chloride injection, Ringer's Injection, Lactated Ringer's
Injection. Preservatives, stabilisers, buffers, antioxidants and/or
other additives can be included, as required.
[0178] Whether it is a polypeptide, antibody, nucleic acid, small
molecule or other pharmaceutically useful compound that is to be
given to an individual, administration is preferably in a
"therapeutically effective amount" or "prophylactically effective
amount" (as the case can be, although prophylaxis can be considered
therapy), this being sufficient to show benefit to the individual.
The actual amount administered, and rate and time-course of
administration, will depend on the nature and severity of protein
aggregation disease being treated. Prescription of treatment, e.g.
decisions on dosage etc, is within the responsibility of general
practitioners and other medical doctors, and typically takes
account of the disorder to be treated, the condition of the
individual patient, the site of the method of administration and
other factors known to practitioners. Examples of the techniques
and protocols mentioned above can be found in Remington's
Pharmaceutical Sciences, 16th edition, Osol, A. (ed), 1980.
[0179] A composition can be administered alone or in combination
with other treatments, either simultaneously or sequentially
dependent upon the condition to be treated.
EXAMPLES
[0180] Below are examples of specific embodiments of the invention.
The examples are offered for illustrative purposes only, and are
not intended to limit the scope of the present invention in any
way. Efforts have been made to ensure accuracy with respect to
numbers used (e.g., amounts, temperatures, etc.), but some
experimental error and deviation should, of course, be allowed
for.
[0181] The practice of embodiments of the invention will employ,
unless otherwise indicated, conventional methods of protein
chemistry, biochemistry, recombinant DNA techniques and
pharmacology, within the skill of the art. Such techniques are
explained fully in the literature. See, e.g., T. E. Creighton,
Proteins: Structures and Molecular Properties (W.H. Freeman and
Company, 1993); A. L. Lehninger, Biochemistry (Worth Publishers,
Inc., current addition); Sambrook et al., Molecular Cloning: A
Laboratory Manual (2nd Edition, 1989); Methods in Enzymology (S.
Colowick and N. Kaplan eds., Academic Press, Inc.); Remington's
Pharmaceutical Sciences, 18th Edition (Easton, Pa.: Mack Publishing
Company, 1990); Carey and Sundberg Advanced Organic Chemistry
3.sup.rd Ed (Plenum Press) Vols A and B (1992).
Example 1
Data and Quality Control (QC)
[0182] Subjects enrolled in the multicenter Diagnostic
Investigation of Sudden Cardiac Event Risk (DISCERN) trial
(ClinicalTrials.gov website ref. no. NCT00500708) served as the
starting population for this study.
[0183] Data Collection and Reporting
[0184] Clinical Data
[0185] Clinical data came from the locked DISCERN DI data report
exported from the DISCERN electronic case report form (eCRF) for
n=680 experimental subjects. All subjects provided informed written
consent for study participation under the DISCERN protocol approved
by the Institutional Review Boards (IRBs) at the enrolling
institutions. Clinical data were obtained through a combination of
subject interview and abstraction from medical records and entered
into the DISCERN electronic case report form (eCRF). Data
monitoring (source data verification) was completed for .about.300
control subjects per the clinical monitoring plan. The clinical
data is described in more detail below.
[0186] Event Data
[0187] For subjects who received device therapies (anti-tachycardia
pacing (ATP) or shock), internal electrograms (IEGMs) were
collected for adjudication of the event and categorization of the
underlying treated rhythm. In the absence of retrievable IEGMs,
clinical reports describing device therapies were used to
adjudicate the event. All final event categories were determined by
concordance of at least two independent, blinded readers or
committee review. Event class, subject class, and event dates were
provided for this analysis.
[0188] Biologic Samples
[0189] Blood samples for DNA isolation were drawn at enrollment,
frozen and shipped/stored at CardioDx. A subset of the subjects had
DNA extracted by an outside vendor (Gentris) and stored frozen at
CardioDx.
[0190] DNA Samples
[0191] Genomic DNA was isolated from whole blood using an automated
approach on the Hamilton Star (DNAdvance DNA Isolation Kit,
Agencourt). The DNA was diluted to a concentration of 50 ng/.mu.l
and 1.2 ug was provided to the vendor, Expression Analysis (Durham,
N.C.), for application on the Affymetrix human whole-genome 6.0 SNP
array, Genotypes were determined based on array results provided by
the vendor and the final experimental dataset determined.
[0192] The data QC was performed in two parts: the clinical data
and the genotype data.
[0193] Clinical Data QC
[0194] At the analysis stage several inconsistencies were found
over time, e.g., several samples had gender mismatches between the
clinical and genetic information and several samples had primary
prevention status inconsistencies. Samples with unresolved
inconsistencies were deleted from further consideration. In order
to reduce population structure only Caucasian subjects were chosen.
A set of 658 subjects with complete genetic and clinical data were
selected for further analysis, after excluding the inconsistent
samples.
[0195] Genotype Data QC
[0196] The genotype data was generated by Expression Analysis
(Durham, N.C.) using the Affymetrix SNP 6.0 platform as noted
above. There were 667 DISCERN samples plus 8 identical controls.
The SNP 6.0 platform contains genotype assays for 909,622 SNPs and
946,000 CNVs.
[0197] The genotypes were generated with the Birdseed algorithm
version 2 by Expression Analysis and made available along with the
cell files. For each sample the Birdseed output files contains for
each SNP the genotype call, a confidence value for the genotype,
and intensity values for each of the A and B alleles.
[0198] Three filters were applied.
[0199] Call Rates
[0200] A genotype is declared a NoCall when the confidence value is
over the 0.1 threshold so a SNP assay fails when a NoCall is
declared.
[0201] For a given sample, the sample call rate is the proportion
of all SNPs successfully genotyped for that sample. For a given
SNP, the SNP call rate is the proportion of all samples
successfully genotyped for that SNP. The analysis plan imposes a
passing sample call rate threshold of 80% and a passing SNP call
rate of 95%.
[0202] The sample call rates and SNP call rates were calculated.
One DISCERN sample had a call rate <80% and was excluded from
further analysis (according to the analysis plan threshold).
[0203] The 8 replicated control samples had sample call rates
0.90<CR<0.95. The control sample was a pooled sample of males
and females. This resulted in some mis-genotype clustering, as
described below.
[0204] One DISCERN sample had a sample call rate=0.93 but the 665
(98.5%) DISCERN samples have sample call rate CR >0.95, which is
within Affymetrix expectations.
[0205] SNP call rates were calculated and a cutoff of 95% imposed
resulting in 30,391 SNPs (3.3%), which is within Affymetrix
expectations (FIG. 1).
[0206] Minor Allele Frequencies
[0207] The minor allele frequency was calculated for each SNP, a
cutoff of 1% was imposed, with the result that 137,583 SNPs (15.1%)
failed this cutoff. This was a large fraction of SNPs on the chip,
but most of these SNPs have higher minor allele frequency in
non-Caucasian populations. The minor allele frequencies obtained
from the cohort were highly correlated (Pearson correlation=0.974)
with the Caucasian minor-allele frequencies as reported by
Affymetrix from the Caucasian HapMap sample set.
[0208] Hardy-Weinberg Equilibrium
[0209] Hardy-Weinberg equilibrium (HWE) was calculated with an
exact test for all autosomal and pseudo-autosomal SNPs. For
non-pseudo-autosomal SNPs on chromosome X a modified chi-square
test was used. This test combines the standard equilibrium model
for females but includes the male genotypes, which are hemizygous,
in the allele frequency estimates. SNPs on chromosome Y and
mitochondria SNPs are hemizygous and were excluded. In the
deFinetti diagram most of the SNPs out of equilibrium have a low
SNP call rate <95% and were cut from further consideration (FIG.
2).
[0210] Among the remaining SNPs out of equilibrium with MAF>1,
virtually no heterozygotes were a subset with mis-clustering likely
due to the pooled replicate samples. This is evident from the
deFinetti diagram at the bottom right and left corners (FIG. 2).
The set of 8 replicates had an intermediate cluster that was
declared heterozygotic by the clustering algorithm. In this case
the true heterozygotes were declared minor allele homozygotes and
equilibrium failed. The cluster diagram in FIG. 3 shows a
representative example (SNP_A-1859379).
[0211] FIG. 4 shows that the non-pseudo-autosomal SNPs on
chromosome X show no such pathology. The 89 SNPs with HWE p-value
<1e-100 that show the worst disequilibrium were excluded.
[0212] Passing SNPs
[0213] The passing SNPs are those that survived the three filters:
call rate, minor allele frequency, and HWE. The number of SNPs
passing for further analysis was 748,158 out of a total of 909,622
SNPs on the chip.
[0214] Gender Determination
[0215] Only females can be heterozygotic at non-pseudoautosomal
SNPs on chromosome X. Thus sample gender was inferred from the
presence or absence of heterozygote genotypes non-pseudoautosomal
SNPs on chromosome X. A female will have heterozygotic loci and
males will not. From the plot (FIG. 5) one sample (on the lower
left in green) was marked as female but lacks heterozygote loci and
was inferred to be mate. The 8 samples (in the upper left corner in
red) marked unknown are in an intermediate position (FIG. 5). These
were the 8 replicated control samples that were pooled samples of
males and females. This explains their intermediate position and
illustrates that pooled samples result in incorrect genotypes.
[0216] Concordance
[0217] It was intended that the 8 replicated control samples would
allow a concordance estimate of the genotype data set. The
concordance of the replicate samples was 85.6%. This corresponds
closely to that expected from their average sample call rate of
92.0%, which assuming random miscalls, gave an expect concordance
of 92%*92%=86.6% The pooled nature of the control samples resulted
in low call rates compared to the typical samples and so the
controls are not completely representative of the typical samples.
Thus the concordance of the controls is a low estimate of the true
concordance of the data set. The average sample call rate excluding
the failed sample and replicate samples is 99.2%. From this a
concordance of 99.2%*99.2%=98.4% for the passing samples was
estimated.
[0218] Clinical Data
[0219] Clinical data for each subject contains the categories:
[0220] age
[0221] gender
[0222] diabetes status
[0223] renal function
[0224] heart status
[0225] medications
[0226] The heart status fields were:
[0227] ejection fraction
[0228] NYHA class
[0229] sinus rhythm status
[0230] conduction problems
[0231] MI history
[0232] ECG measurements
[0233] The NYHA class status were not recorded for each
subject.
[0234] Case Status and Time-to-Event
[0235] For each subject in the study, the time interval from the
date of implant to the end of observation of the subject was called
the total observation time of the subject. The phenotype of central
interest in this study was ventricular tachycardia and fibrillation
(VT/VF). Each subject had an event history recorded by their
implant device. An expert panel adjudicated all potential events
for each subject deciding in each case if a VT/VF event had
occurred and recording the time. Each subject with an adjudicated
VT/VF event was declared a case and the time interval from the date
of implant to the first adjudicated event was called the
tune-to-event. For subjects that are not cases their time-to-event
measure was the same as the total Observation time. A subject that
was not a case and had a total observation time of at least two
years was called a control. Secondary prevention subjects have had
a VT/VF event before implant surgery took place so they were
classed as cases, but have no time-to-event measure.
[0236] Clinical Risk Factors for VT/VF
[0237] In this section the clinical covariates as risk factors for
VT/VF is considered. It was also important to determine which
clinical factors may be confounders for the genetic risk factor
analysis performed in the sections below.
[0238] Statistical Model
[0239] We used a Cox proportional hazards model to test association
of clinical covariates to VT/VF time-to-event data.
Time-to-event.about.clinical covariates
where non-cases were censored.
[0240] Gender
[0241] Subject gender was significantly associated with VT/VF
time-to-event (TTE). This can be seen with the Kaplan-Meier plot of
FIG. 6. This shows that the female subjects in the study survive
longer than the males. This imbalance is also easily seen from the
barplot of FIG. 7.
[0242] MADIT II Scores
[0243] The MADIT II score is the sum of five components: MADIT II
score=non-sinus rhythm+age>65+NYHA class>2 (heart failure
severity)+BUN level>28 (renal function)+diabetes.
[0244] The MADIT II score has known relation to patient survival
from all causes. The Kaplan-Meier plot shows that there is no
discernible association of high/low MADIT II score with VT/VF
arrhythmia (FIG. 7).
[0245] Several components of the MADIT II score had incomplete
data. The NYHA class was not recorded at time of implant for 34% of
subjects. Of these, 14% had NYHA class recorded during follow-up
and this was used. Another 10% were being prescribed loop
diuretics, which was taken to indicate NYHA class >2, For the
remaining 10% of subjects the NYHA class was imputed with a
recursive partitioning algorithm.
[0246] The BUN level was not recorded for 21% of subjects. The
missing values were imputed with a recursive partitioning
algorithm. Missing BUN level measurements are correlated with good
renal function, so in this case the attending physician may not
have seen a need to order a BUN level test.
[0247] The individual components of the MADIT II score also showed
no significant association, except for the NYHA class, which showed
marginally significant association (FIG. 8).
[0248] The presence of ventricular conduction blocks versus no
conduction block (left ventricular or otherwise) showed marginally
significant association with VT/VF arrhythmia (FIG. 8). Age,
ejection fraction, and ischemia showed no significant association
(FIG. 8). The QRS interval, which has known genetic connections to
arrhythmias, showed no significant association (FIG. 8).
[0249] Kidney Function
[0250] The blood urea nitrogen level (BUN) is an indicator of
kidney function, where high BUN level indicates renal
insufficiency. The Kaplan-Meier plot in FIG. 9 shows no significant
association of BUN level with VT/VF arrhythmia. Creatinine level is
also an indicator of kidney function and had no discernible
association with VT/VF arrhythmia (FIG. 9).
[0251] Diabetes
[0252] Diabetes status did not have a significant association with
VT/VF arrhythmia (FIG. 10).
Example 2
Geneset Analysis
[0253] A geneset as used in this example is any collection of
genes, such as genes in a pathway, whose combined action is
expected to have association with a phenotype of interest. In the
present study, we had SNP-based genotypes and connected SNPs to
genes to carry out a geneset analysis. To do this we collected the
SNPs near the genes of a geneset. Each gene had a number of
annotated SNPs based on the distance of the SNP to the gene
footprint or within overlapping LD bins. Thus each geneset resulted
in a SNPset SNPs near the genes of the geneset. When a large SNPset
contains only a few SNPs with actual association the
signal-to-noise ratio may be too small to detect an association
without more subjects. The strategy adopted to solve this was to
choose a limited number of SNPs (e.g., from 10 to 100) for each
gene in a geneset, rather than make all the SNPs available for each
gene, which can result in very large SNPsets.
[0254] Genesets
[0255] The following genesets were compiled and contain a total of
414 genes TABLE 1-12):
TABLE-US-00001 1. Excitation-Contraction Coupling (Table 1) (50) 2.
Ion Channel genes (Table 2) (43) 3. Ca++ handling and Ca++
dependent functions (Table 3) (38) 4. Recently discovered loci
(Table 4) (8) 5. Gap junction and desmosomes (Table 5) (10) 6.
GPCRs and membrane receptors other (Table 6) (11) 7. Transcription
factors (Table 7) (13) 8. Cytoskeletal and giant sarcomere proteins
(Table 8) (19) 9. Renin-Angiotensin-Aldosterone system (Table 9)
(5) 10. Mitochondrial/metabolic functions (Table 10) (17) 11.
Cardiac Calcium genes (Table 11) (160) 12. Other genes (Table 12)
(123) 13. Arrhythmia genes (Table 13) (304)
[0256] Association Model
[0257] This statistical model is the same survival model as above
with the addition of the gender covariate, which was seen to be
associated with the VT/VF arrhythmia phenotype. That is, the Cox
proportional hazards model.
Time-to-event.about.gender.about.gender+{geneset genotype derived
data}
where non-cases are censored. The "geneset genotype derived data"
were derived from the genotypes of the SNPs of a geneset by one of
the several methods described below.
[0258] Minor Allele Count (MAC)
[0259] For each subject, we counted the number of minor alleles
(MAC) among the SNPs of a geneset and checked this for association
with VT/VF arrhythmia. In this case, the "geneset genotype derived
data" were the minor allele counts for each subject. In this case
we checked for association of the geneset with the survival
model
Time-to-event.about.gender+MAC
where non-cases are censored.
[0260] Signed Sum of Minor Alleles (SSUM)
[0261] This method is the same as above except we added minor
alleles when protective and subtracted when deleterious. That is,
each SNP of the geneset was checked individually for association
with the model
Time-to-event.about.gender+additive(genotype)
where non-cases are censored. We say the minor allele is protective
when the association results in fewer arrhythmias. And that the
minor allele is deleterious when the association results in more
arrhythmias. The signed-sum of minor alleles (SSUM) is
SSUM=(sum of protective minor alleles)-(sum of deleterious minor
alleles)
In this case we checked for association of the geneset with the
survival model
Time-to-event.about.gender+SSUM
where non-cases are censored.
[0262] Partial Least Squares (PLS)
[0263] In this method, we extracted the component of the genotype
data that correlated with the case/control status of the subjects
using the partial least squares (PLS) method. See "The pls package:
principle components and partial least squares regression in R",
B-H Mevik and R. Wehrens, J. of Statistical Software, January 2007,
vol 18, Issue 2. We checked this for association with VT/VF a
arrhythmia with the Cox proportional hazards model adjusted for
gender
Time-to-event.about.gender+PLS component
where non-cases are censored.
[0264] Permutation Testing
[0265] Permutation testing is used for determining the p-values for
all of the above geneset methods as the null distribution (the
distribution of non-association) was unknown. This is
computationally intensive, but in some situations there are
alternatives, as illustrated in the examples below.
[0266] Primary Geneset Analyses
[0267] For each geneset with 10 SNPs per gene and all three methods
were run with 10,000 permutations to determine p-values. As can be
seen in the plot of FIG. 11, no result achieved statistical
significance for any of the methods used.
[0268] Secondary Geneset Analyses
[0269] Each of the 414 genes were tested individually with 10 SNPs
per gene with the PLS method and 1,000 permutations. The genes with
the smallest p-values were run again with 50,000 permutations to
obtain a more precise p-value estimation. The resulting p-values
are shown in the plot with the horizontal dashed-line showing the
Bonferroni adjustment required to achieve significance for 414
tests (FIG. 12). Two genes had significant association: CENPO and
ADCY3. These genes are next to each other on the genome and
possibly these associations are due to the same SNPs.
[0270] P-Value Calculations
[0271] Precise estimates of small p-values require more
permutations (by the inverse square law.) An alternative is to fit
a normal distribution on the null distribution (given by the
permutation results) and calculate a z-score and a p-value. For the
CENPO gene the QQ normal plot shows the null distribution from the
permutation test fits a normal distribution (FIG. 13). A standard
z-score calculation yields a p-value of 9.0e-6 with an adjusted
p-value
adjusted p-value=414*9.0e-6=0.0037
Example 3
Genome-Wide Association Study (GWAS) Analysis
[0272] In the GWAS, or genome-wide association study, each SNP was
tested individually for association with the VT/VF phenotype.
[0273] Statistical Model of Association
[0274] For each SNP, we tested if there is an association of
time-to-event with genotype using the Cox proportional hazards
model
Time-to-event.about.gender+additive(genotype)
where non-cases are censored. The gender term is included as it is
a possible confounder. This was the same as in the geneset analysis
(above). Fitting this model to the data for a particular SNP yields
a log hazard ratio and a p-value. The hazard ratio represents the
differential hazard rate of having VT/VF arrhythmia from having one
genotype versus another for this particular SNP. The p-value
indicates the probability that this hazard ratio value occurred
just by random (due to random sampling of the subjects in the study
assuming the SNP is not associated with arrhythmia.) When the
p-value is very small then it is inferred that the SNP is
associated with arrhythmia. The results for all passing SNPs and
for ischemic subjects only are shown in Table 14. The column
definitions for Table 14 are shown below.
TABLE-US-00002 TABLE 14 Column Definitions pid probeset ID (Affy
SNP ID) coef log odds ratio of the genotype association stderr
standard error of the log odds ratio pval p-value of the genotype
association with time-to-event data pval_holm Holm correction of
the p-value pval_bonf Bonfferoni correction of the p-value pval_fdr
FDR (false discovery rate) for this size p-value p_nc proportion of
NoCalls for this SNP maf minor allele frequency of this SNP hwe
Hardy_Weinburg equilibrium p-value of this SNP chr chromosome
containing the SNP position genomic position of the SNP rsid refSNP
ID npa_x chrom X non-pseudoautosomal odds_ratio odds ratio isc_coef
ischemic subset log odds ratio isc_stderr ischemic subset standard
error isc_pval ischemic subset p-value isc_pval_holm ischemic
subset Holm correction of the p-value isc_pval_fdr ischemic subset
FDR nyc_pval pvalue of genotype association with NYHA class ef_pval
pvalue of genotype association with ejection fraction isc_nyc_pval
pvalue of genotype association with NYHA class for ischemic
subjects only isc_ef_pval pvalue of genotype association with
ejection fraction for ischemic subjects only
[0275] From the adjusted p-value column (pval_holm) it is apparent
that there is no single SNP with genome-wide significance. However,
if a less conservative adjustment is made, the false discovery rate
column (fdr) showed the top ten SNPs may have a Use discovery rate
of 27% suggesting there is a true positive there. See next
section.
[0276] Multiple Testing Adjustment
[0277] The p-value adjustment to account for multiple testing was
performed with the Holm method and is given in the pval_holm column
of Table 14. For the top hit, this is the same as the Bonferroni
adjustment, which amounts to multiplying the p-value by 748,158
(the number of SNPs tested).
Adjusted p-value=7.96e-08*7.48e+5=0.060
[0278] This was not significant at the genome-wide level. But the
number of SNPs (.about.748 k) represents a conservative
multiplication factor as all the SNPs are not independent, that is,
their genotypes are correlated (as many SNPs cluster around genes
and share LD bins.) We estimated the effective number of tests with
a modified Gao method (see the next section). This method estimated
that .about.13% to 20% of the SNPs represent independent tests for
a multiplication factor of .about.748,000*0.15=112,000 to
.about.748,000*0.26=194,000. Using this range of multiplication
factors gives:
[0279] Adjusted p-value from
7.96e-08*1.12e+5=0.009
to
7.96e-08*1.94e+5=0.015
[0280] So the top hit (SNP_A-2053054) attained genome-wide
significance using the less conservative multiple testing
adjustment. But the next most significant hit only attained a level
of 0.17 and was not significant at the genome level.
[0281] Genotype Cluster Plot
[0282] The genotype cluster plot of the top hitting SNP
(SNP_A-2053054) is shown in FIG. 14.
[0283] Kaplan-Meier Plot
[0284] The Kaplan-Meier plot in FIG. 15 shows the differential
survival between the different genotypes for SNP_A-2053054.
[0285] Proportional Odds Assumption
[0286] The Cox model fit makes a proportional odds assumption,
which was tested in the plot of FIG. 16. When the two groups, cases
and censored, are vertical shifts of each other then the
proportional odds assumption holds very well, as in this case. The
gender plot shows similar results (FIG. 16).
Manhattan Plot
[0287] The Manhattan plot of FIG. 17 shows the p-values for the
SNPs on chromosome 4, which includes the top hitting SNPs. The red
dashed-line at the top represents the conservative Bonferroni level
required for genome-wide significance.
[0288] Effective Number of Tests
[0289] Briefly, the SNPs were partitioned into blocks of SNPs
contiguous along the genome, for k=100, 500, and 1000. For each
block of SNPs we formed the genotype matrix for the 658 passing
samples. With this matrix we obtained the correlation matrix of SNP
to SNP correlations. We obtained the list of singular values
(eigenvalues) using the singular value decomposition (SVD) of the
correlation matrix. The effective number of independent tests of a
block of SNPs was the number of the largest singular values
surpassing a fix proportion, given by a percent cutoff, of the
total sum of singular values. The total effective number of tests
was estimated by summing the values obtained from each block. To
calibrate the method, a similar calculation was done with a random
selection of SNP blocks that mirror the sizes of the contiguous SNP
blocks. The plot in FIG. 18 shows the results of these calculations
for contiguous blocks and random blocks and for the several block
sizes 100, 500, and 1000, and as a function of the percent cutoff.
Each curve approaches 100% on the right. The right side values
include the independent SNPs as well as the random noise.
[0290] The random block results should represent the situation when
the SNPs are nearly independent, as random SNPs are typically far
from each other along the genome. But from the graph (FIG. 19) we
see the curves for the random blocks have rather low values (e.g.,
not above 80%). We calibrated the contiguous block values by taking
their proportion with respect to the random block values (divided
the contiguous block values by the random block values for each
cutoff value). From the following plot (FIG. 19) we estimated a
value of anywhere from 13% to 26% for the percentage of independent
SNPs.
Example 4
Analysis of Genes Located Near SNPs
[0291] The sympathetic and parasympathetic systems innervate the
heart and are involved in controlling heart rate. In response to
physical or mental stress, the sympathetic system is activated and
norepinephrine (NE) is released. The released NE binds to
beta-adrenergic receptors located on myocytes resulting in
increased contractility. Compromised innervation of the heart by
the sympathetic nervous system may be proarrhythmogenic and may
lead to heart failure. Imaging studies have shown that aberrant
sympathetic innervation is present in patients with Brugada's
syndrome, a condition that leads to life-threatening ventricular
tachyarrhythmias despite patients having what appear to be
structurally normal hearts.sup.1. In addition, mutations in the
myocytic de-polarization/re-polarization pathways and contractile
proteins have also been shown to be proarrhythmogenic.sup.2,3.
[0292] We conducted a study (see Examples above) to identify
genetic defects that are associated with increased firing rates of
implantable cardiac defibrillator (ICD's); increased firing rates
are indicative of increased susceptibility to arrhythmic events.
The study investigated the association of .about.750,000 genetic
markers (or single nucleotide polymorphisms, SNPs) for association
with increased firing rates in a heart failure population in which
all patients had an ICD. Using a false-discovery rated (FDR)
cut-off, we identified 124 SNPs (Table 15) with an FDR less than
50%; these were derived from analyzing both the entire population
as well as a subset of patients with ischemic heart failure. The
124 SNPs mapped to 68 distinct loci; 1 locus had no clear
association with a nearby gene, 40 loci mapped to a single gene, 24
loci to two genes, and 3 loci mapped to 3 genes (Table 15). The
SNPs shown in Table 15 are referred to by their Reference SNP ID,
e.g. rs709932, as found on the NCBI SNP website on Mar. 17, 2010.
For example, a query for rs12082124 on the NCBI SNP website on Mar.
17, 2010 returns the following information: rs 12082124 [Homo
sapiens]GCAAAGGTAGAAAAACTCCTGAATTT[A/G]AAAGCACTAAACTAGGAGTCA GGCT
(SEQ ID NO:1).
[0293] In order to better understand the biology of these top
candidates, we used publically available data to further annotate
the genes near the significant SNPs, in regards to their
biologically function and pathways. Of the 69 clusters, 31 had
genes (shown in BOLD below, also in Table 16) associated with them
that were judged to have biologically relevant annotation based on
the known biology around arrythmias.
[0294] Genes Involved in Neurogenesis and Cytoskeletal
Rearrangement
[0295] Developmental defects can lead to improper neurogenesis and
defective innervation. A number of the top SNPs are near genes that
may be either involved in proper neuronal targeting and pathfinding
(UNC5C).sup.4, organization of the cytoskeleton in the growth cone
(ARPC3, FRMD3, TANC2, TCP10L2).sup.5-7, and transcriptional
regulation of neural development (ZFHX3, ID4).sup.8,9.
Interestingly, SNPs near ZFHX3 have recently been associated with
increased likelihood of atrial fibrillation.sup.10,11. PALLD
encodes a cytoskeletal protein that is required for organizing the
actin cytoskeleton.sup.12. Knock-down of PPIA (cyclophilin A) in
U2OS cells has been shown to disrupt F-actin structure.
Biochemically PPIA bids N-WASP, which functions in the nucleation
of actin via the Arp2/3 complex.sup.13.
[0296] MYLIP binds to the myosin regulatory light chain, which in
turn protein regulates the activity of the actomyosin complex.
Overexpression of MYLIP cDNA in PC12 cells has been shown to
abrogate neurite outgrowth induced by nerve growth factor
(NGF).sup.14. SEMA6D, a semaphorin, has been shown to inhibit
axonal extension of nerve growth factor differentiated PC12 cells,
and also may a play a role in cardiac morphogenesis.sup.15,16.
[0297] Genes Involved in Vesicle Transport and Vesicle Function
[0298] Vesicle transport in neurons is required for delivery of
neurotransmitters such as norepinephrine (NE) to the synapse for
subsequent release. Dynein is a complex of proteins which forms a
molecular motor which moves vesicles along a molecular track
composed of tubulin. DYNLR132 encodes one of the dynein light
chains.sup.17. ACTR10 is a component of dynactin, a complex that
binds to dynein and aids in bidirectional intracellular organelle
transport.sup.18. NRSN2 is a neuronal protein that is found in the
membranes of small vesicles and may play a role in vesicle
transport.sup.19. STX18, a syntaxin, has been shown to be involved
in membrane trafficking between the ER and Giolgi.sup.20. ARL4C, an
ADP-ribosylation factor, might modulate intracellular vesicular
transport via interaction with microtubules.sup.21. SLC9A7 is
expressed predominantly in the trans-Golgi network, and interacts
with cytoskeletal components such as vimentin.sup.22.
[0299] Neuronal Adhesion
[0300] Adhesion molecules are required for the proper alignment of
neurons and myocytes at the neuromuscular junction. CNTNAP2 is a
member of the neurexin family which functions in the vertebrate
nervous system as cell adhesion molecules and receptors, and may
play a role in differentiation of the axon into distinct functional
subdomains.sup.23. NRXN1 is a neurexin which is involved in
neuronal cell adhesion.sup.24. LRRC7 is a protein that is found in
the postsynaptic density in neurons and may function as a synaptic
adhesion molecule.sup.25. PCDH15 and PCDH9 are both members of the
cadherin superfamily, which encode integral membrane proteins that
mediate calcium-dependent cell-cell adhesion.sup.26. LSAMP is a
selective homophilic adhesion molecule that guides the development
of specific patterns of neuronal connections.sup.27. FYN is a
well-characterized protein-tyrosine kinase which has been
implicated in cell growth and survival. Recently FYN has been shown
to negatively regulate synapse formation through inhibition of
PTPRT, preventing its association with neuroligins.sup.28.
[0301] Beta-Adrenergic Receptor Signaling and Modulation
[0302] Once released from the neuron into the synaptic cleft, NE
binds to beta-adrenergic receptors to promote depolarization, and
is also actively transported back into the neuron. UTRN is a
protein that is located at the neuromuscular synapse and
myotendinous junctions, where it participates in post-synaptic
membrane maintenance and acetylcholine receptor clustering; as such
is may play a role in the proper positioning of beta-AR's.sup.29.
ADCY3, an adenylate cyclase, has been shown to be stimulated by
beta-adrenergic agonists and may play a role in beta-adrenergic
signaling.sup.30.
[0303] Upon binding by INE, beta-ARs are subjected to clathirin-pit
mediated endocytosis as a mechanism to down-regulate NE signaling.
ACVR1 biochemically interacts with AP2B1, one of the two large
chain components of the assembly protein complex 2; AP2B1 has been
shown to interact with beta-adrenergic receptors during
endocytosis.sup.31,32. ITSN2 is thought to regulate the formation
of clathrin-coated vesicles and may play a role linking coated
vesicles to the cytoskeleton through the Arp2/3 complex.sup.33,34.
ST13, a protein that interacts with Hsp70, has been shown to play a
role in the internalization of G protein coupled receptors (GPCRs);
as such it might play a role in the internalization of
beta-adrenergic receptors.sup.35.
[0304] NE is internalized back into the neuron through the sodium
transporter SLC6A2. CACNA1D may form a molecular complex with
SCL6A2 through its interaction with STX1A, a syntaxin that
interacts with both proteins.sup.31.
[0305] Depolarization and Muscle Contraction.
[0306] CACNA1D is a component of a L-type voltage-dependent calcium
channel, mutations in which are proarrhythmogenic.sup.36. It has
been shown that the activity of Ca2+ channels can be regulated by
agents that disrupt or stabilize the cytoskeleton.sup.37. Sadeghi
et al have shown that both dystrophin and alpha-actinin colocalize
with the L-type Ca2+ channel in mouse cardiac myocytes and to
modulate channel function.
[0307] UTRN interacts with a number of components of the
dystrophin-associated protein complex (DGC), which consists of
dystrophin and several integral and peripheral membrane proteins,
including dystroglycans, sarcoglycans, syntrophins and alpha- and
beta-dystrobrevin. In the neuron, the DPC participates in
macromolecular assemblies that anchor receptors to specialized
sites within the membrane.sup.39. SGCZ is part of the sarcoglycan
complex, which is a component of the dystrophin-associated
glycoprotein complex (DGC), which bridges the inner cytoskeleton
and the extra-cellular matrix.sup.39. MAST4, a microtubule
associated serine/threonine kinase, may play a role in the DPC
complex as an ortholog, MAST2, interacts with the syntrophin
SNTB2.sup.31. Interestingly, all 4 orthologs (MAST1, 2, 3 and 4)
bind to PTEN, a protein that negatively regulates intracellular
levels of phosphatidylinositol-3,4,5-trisphosphate in cells and
thus may play a role in Ca++ signaling in the heart.sup.31.
APPENDIX A
[0308] Genes with Annotation by Homology
[0309] TANC1--TANC2
[0310] 65% identical; neither protein has good literature
annotation, however biochemically TANC1 interacts with:
[0311] SPTAN1--alpha spectrin
[0312] GRIN2B glutamate receptor, ionotropic, p value 0.000335
[0313] DLGAP1--discs, large (Drosophila) homolog-associated protein
1 (p value 0.00749, just missed 50% FDR cut-off)
[0314] ACTB--actin B
[0315] TCP10--TCP10L2
[0316] 96% identical; neither protein has good literature
annotation, however biochemically TCP10 interacts with:
[0317] PARD6A, PARD6B--involved in controlling neural migration
[0318] MAST2--MAST4
[0319] 66% identical; all paralogs (MAST 1, 2, 3) bind PTEN,
involved in Ca++ signaling; MAST2 also binds:
[0320] SNTB2--syntrophin, beta 2
[0321] DYNLL1--dynein, light chain, LC8-type 1
[0322] While the invention has been particularly shown and
described with reference to a preferred embodiment and various
alternate embodiments, it will be understood by persons skilled in
the relevant art that various changes in form and details can be
made therein without departing from the spirit and scope of the
invention.
[0323] All references, issued patents and patent applications cited
within the body of the instant specification are hereby
incorporated by reference in their entirety, for all purposes.
TABLE-US-00003 TABLE 1 Mutated or associated Ensembl Gene Start
Position End Position Transcript with Human SCD ID Ver 42
Chromosome Name (bp) (bp) count HGNC Symbol Gene Name disorders
ENSG00000159251 15 32869724 32875181 1 ACTC1 actin, x alpha,
cardiac muscle ENSG00000072110 14 68410793 68515747 1 ACTN1
actinin, alpha 1 ENSG00000184160 4 3738094 3740051 ADRA2C
adrenergic, alpha-2C-, receptor ENSG00000043591 10 115793796
115796657 2 ADRB1 adrenergic, beta-1-, receptor ENSG00000169252 5
148185001 148188447 1 ADRB2 adrenergic, beta-2-, receptor, surface
ENSG00000188778 8 37939673 37943341 1 ADRB3 adrenergic, beta-3-,
receptor ENSG00000173020 11 66790507 66810602 1 ADRBK1 adrenergic,
beta, receptor kinase 1 ENSG00000100077 22 24290946 24449916 ADRBK2
adrenergic, beta, receptor kinase 2 ADD AKAP10 A kinase (PRKA)
anchor protein 10 ENSG00000170776 15 83578821 84093590 3 AKAP13 A
kinase (PRKA) anchor protein 13 ENSG00000151320 14 31868274
32372018 1 AKAP6 A kinase (PRKA) anchor protein 6 ENSG00000127914 7
91408128 91577925 6 AKAP9 A kinase x (PRKA) anchor protein (yotiao)
9 ENSG00000198363 8 62578374 62789681 11 ASPH aspartate beta-
hydroxylase; junctin included ENSG00000196296 16 28797310 28823331
1 ATP2A1 ATPase, Ca++ transporting, cardiac muscle, fast twitch 1
ENSG00000174437 12 109203815 109273278 3 ATP2A2 ATPase, Ca++
transporting, cardiac muscle, slow twitch 2 ENSG00000151067 12
2094650 2670626 5 CACNA1C calcium x channel, voltage- dependent, L
type, alpha 1C subunit ENSG00000157388 3 53503723 53821112 2
CACNA1D calcium channel, voltage- dependent, L type, alpha 1D
subunit ENSG00000153956 7 81417354 81910967 3 CACNA2D1 calcium
channel, voltage- dependent, alpha 2/delta subunit 1
ENSG00000007402 3 50375237 50516032 2 CACNA2D2 calcium channel,
voltage- dependent, alpha 2/delta subunit 2 ENSG00000157445 3
54131733 55083622 1 CACNA2D3 calcium channel, voltage- dependent,
alpha 2/delta 3 subunit ENSG00000165995 10 18469612 18870797 9
CACNB2 calcium channel, voltage- dependent, beta 2 subunit
ENSG00000167535 12 47498779 47508991 1 CACNB3 calcium channel,
voltage- dependent, beta 3 subunit ENSG00000145349 4 114593022
114902177 4 CAMK2D calcium/ calmodulin- dependent protein kinase
(CaM kinase) II delta ENSG00000077549 1 19537857 19684594 5 CAPZB
Capping protein (actin filament) muscle Z- line, beta
ENSG00000118729 1 116044151 116112925 1 CASQ2 calsequestrin x 2
(cardiac muscle) ENSG00000119782 2 24126075 24140055 4 FKBP1B FK506
binding protein 1B, 12.6 kDa ENSG00000114353 3 50239173 50271775 3
GNAI2 guanine nucleotide binding protein (G protein), alpha
inhibiting activity polypeptide 2 ENSG00000111664 12 6820713
6826819 2 GNB3 guanine nucleotide binding protein (G protein), beta
polypeptide 3 ENSG00000134571 11 47309527 47330806 1 MYBPC3 myosin
x binding protein C, cardiac ENSG00000197616 14 22921038 22946665 2
MYH6 myosin, heavy polypeptide 6, cardiac muscle, alpha (cardio-
myopathy, hypertrophic 1) ENSG00000092054 14 22951789 22974690 2
MYH7 myosin, x heavy polypeptide 7, cardiac muscle, beta
ENSG00000111245 12 109833009 109842766 1 MYL2 myosin, x light
polypeptide 2, regulatory, cardiac, slow ENSG00000160808 3 46874371
46879938 1 MYL3 myosin, x light polypeptide 3, alkali; ventricular,
skeletal, slow PDE4A phospho- diesterase 4A ENSG00000113448 5
58305622 59320301 5 PDE4D phospho- diesterase 4D, cAMP- specific
(phospho- diesterase E3 dunce homolog, Drosophila) ENSG00000198523
6 118976154 118988586 1 PLN phospholamban x ENSG00000072062 19
14063509 14089559 2 PRKACA protein kinase, cAMP- dependent,
catalytic, alpha ENSG00000114302 3 48762099 48860274 2 PRKAR2A
protein kinase, cAMP- dependent, regulatory, type II, alpha
ENSG00000198626 1 235272128 236063911 3 RYR2 ryanodine x receptor 2
(cardiac) ENSG00000136450 17 53437651 53439593 2 SFRS1 splicing
factor, arginine/ serine-rich 1 (splicing factor 2, alternate
splicing factor) ENSG00000183023 2 40192790 40534188 5 SLC8A1
solute carrier family 8 (sodium/ calcium exchanger), member 1
ENSG00000118160 19 52623735 52666934 1 SLC8A2 solute carrier family
8 (sodium- calcium exchanger), member 2 ENSG00000090020 1 27297893
27366059 4 SLC9A1 solute carrier family 9 (sodium/ hydrogen
exchanger), member 1 (antiporter, Na+/H+, amiloride sensitive)
ENSG00000170290 11 107083319 107087992 1 SLN sarcolipin
ENSG00000136842 9 99303742 99403357 2 TMOD1 tropomodulin 1
ENSG00000114854 3 52460158 52463098 1 TNNC1 troponin C x type 1
(slow) ENSG00000129991 19 60355014 60360496 1 TNNI3 troponin I x
type 3 (cardiac) ENSG00000118194 1 199594759 199613431 10 TNNT2
troponin T x type 2 (cardiac) ENSG00000140416 15 61121891 61151164
7 TPM1 tropomyosin 1 x (alpha) ENSG00000186439 6 123579183
123999937 5 TRDN triadin Ion Ensembl Gene Disease Other (handling
or structural or EG ID Ver 42 Groupings LOE Organelle dependence)
function coupling ENSG00000159251 HCM, found in myofilament 1 DCM
discovery HF v ctrl ENSG00000072110 myofilament 1 ENSG00000184160
Epi/NE signaling, 1 low MAF sympathetic in whites ENSG00000043591
Epi/NE signaling, 1 sympathetic ENSG00000169252 found in Epi/NE
signaling, 1 discovery sympathetic HF v ctrl ENSG00000188778 least
Epi/NE signaling, 1 described sympathetic ENSG00000173020
phosphorylation 1 ENSG00000100077 phosphorylation 1 ADD
localization 1 of PKA ENSG00000170776 found in phosphorylation 1
discovery HF v ctrl ENSG00000151320 found in phosphorylation 1
discovery HF v ctrl ENSG00000127914 LQT11 phosphorylation 1
ENSG00000198363 transmembrane SR Ca++ 1 calsequestrin; colocalizes
with the RYR and triadin ENSG00000196296 SR Ca++ transmembrane 1
protein ENSG00000174437 SR Ca++ transmembrane 1 protein
ENSG00000151067 LQT8 found in cell Ca++ 1 discovery membrane HF v
ctrl ENSG00000157388 found in cell Ca++ 1 discovery membrane HF v
ctrl; Subunit of L-type calcium channel ENSG00000153956 found in
cell Ca++ 1 discovery membrane HF v ctrl; Subunit: of L-type
calcium channel ENSG00000007402 found in cell Ca++ 1 discovery
membrane HF v ctrl; Subunit of L-type calcium channel
ENSG00000157445 found in cell Ca++ 1 discovery membrane HF v ctrl;
Subunit of L-type calcium channel ENSG00000165995 found in cell
Ca++ 1 discovery membrane HF v ctrl; Subunit of L-type calcium
channel ENSG00000167535 found in cell Ca++ 1 discovery membrane HF
v ctrl; Subunit of L-type calcium channel ENSG00000145349 Ca++
phosphorylation, 1 KEY ENSG00000077549 myofilament 1
ENSG00000118729 CPVT, found in SR Ca++ 1 recessive discovery HF v
ctrl ENSG00000119782 assoc SR Ca++ 1 with RYR ENSG00000114353
somatic 1 mutation and VT ENSG00000111664 1 ENSG00000134571 HCM
myofilament 1 ENSG00000197616 found in myofilament 1 discovery HF v
ctrl ENSG00000092054 HCM, myofilament 1 DCM ENSG00000111245 HCM
myofilament 1 ENSG00000160808 HCM myofilament 1 interacts 1 with
AKAP6 ENSG00000113448 found in SR Ca++ 1 discovery HF v ctrl; assoc
with RYR ENSG00000198523 DCM Found in SR Ca++ 1 QTGEN and QTSCD
ENSG00000072062 CONFIRM Ca++ phosphorylation, 1 THIS KEY IS PKA
ENSG00000114302 Ca++ phosphorylation, 1 KEY ENSG00000198626 CPVT
found in SR Ca++ 1 (exons 1- discovery 28, 37- HF v ctrl; 50, 75,
assoc 83-105) with lower SCA risk (AHA abstract) ENSG00000136450
regulates splicing 1 splicing of CAMK2D; deficiency causes severe
EC coupling defects ENSG00000183023 cell Na+/Ca++ membrane 1
membrane ion exchanger ENSG00000118160 cell Na+/Ca++ membrane 1
membrane ion exchanger ENSG00000090020 Na+/H+ membrane 1 ion
exchanger ENSG00000170290 interact SR 1 with PLN and ATP2A1
ENSG00000136842 found in myofilament 1 discovery HF v ctrl
ENSG00000114854 HCM Ca++ myofilament 1 ENSG00000129991 HCM
myofilament 1 ENSG00000118194 HCM, myofilament 1 DCM
ENSG00000140416 HCM found in myofilament 1 discovery HF v ctrl
ENSG00000186439 found in SR 1 discovery HF v ctrl; colocalizes with
the RYR and junctin; skel m and cardiac isoforms
TABLE-US-00004 TABLE 2 Mutated or associated with Ensembl Start End
Human Ion (handling Gene ID Chromosome Position Position Transcript
HGNC SCD Disease or ion Ver 42 Name (bp) (bp) count Symbol Gene
Name disorders Groupings Other LOE Organelle dependence) structural
channels ENSG00000130037 12 5023346 5026210 1 KCNA5 potassium x A
fib antiarrhythmic K+ ion channel 2 voltage- drug gated sensitivity
channel, shaker- related subfamily, member 5 ENSG00000175548 12
36996824 37001523 1 ALG10B asparagine- acquired ion channel 2
linked LQTS glycosylation 10 homolog B (yeast, alpha-1,2-
glucosyltransferase) (KCR1) ENSG00000166257 11 123005107 1.23E+08 1
SCN3B sodium x Brugada Leu10Pro Na+ ion channel 2 channel, voltage-
gated, type III, beta ENSG00000175538 11 73843536 73856186 1 KCNE3
potassium x Brugada found in K+ ion channel 2 voltage- Syndrome
discovery gated HF v ctrl; channel, lsk- hyperkalemic related
periodic family, paralysis member 3 ADD GPD1L glycerol-3- x
Brugada, site Na+ 2 phosphate SIDS homologous dehydrogenase to the
1-Like cardiac sodium channel SCN5A; Barry London ENSG00000105711
19 40213374 40223192 1 SCN1B sodium x Brugadas Na+ ion channel 2
channel, and voltage- conduction gated, type I, defect beta
ENSG00000069431 12 21845245 21985434 4 ABCC9 ATP-binding x DCM
found in K+ receptor cassette, discovery sub-family C HF v ctrl;
(CFTR/MRP), assoc with member 9 K(ATP) channels ENSG00000053918 11
2422797 2826915 4 KCNQ1 potassium x LQT1 found in K+ ion channel 2
voltage- QTSCD gated and channel, QTGEN; KQT-like found in
subfamily, discovery member 1 HF v ctrl ENSG00000177098 11
117509302 1.18E+08 1 SCN4B sodium x LQT10 Na+ ion channel 2
channel, voltage- gated, type IV, beta ENSG00000055118 7 150272982
1.5E+08 3 KCNH2 potassium x LQT2 found in K+ ion channel 2 voltage-
QTSCD gated and channel, QTGEN subfamily H (eag-related), member 2
ENSG00000183873 3 38564558 38666167 2 SCN5A sodium x LQT3, found in
Na+ ion channel 2 channel, Brugadas QTSCD voltage- syndrome and
gated, type QTGEN V, alpha and assoc (long QT with SCA syndrome 3)
risk (AHA abstract) ENSG00000180509 21 34740858 34806443 1 KCNE1
potassium x LQT5 found in K+ ion channel 2 voltage- QTGEN; gated
found in channel, lsk- discovery related HF v ctrl family, member 1
ENSG00000159197 21 34658193 34665307 1 KCNE2 potassium x LQT6 K+
ion channel 2 voltage- gated channel, lsk- related family, member 2
ENSG00000123700 17 65677271 65687755 1 KCNJ2 potassium x LQT7, CPVT
found in K+ ion channel 2 inwardly- QTSCD; rectifying found in
channel, discovery subfamily J, HF v ctrl, member 2 and assoc with
SCA risk (AHA abstract) ENSG00000187486 11 17365042 17366214 1
KCNJ11 potassium x neonatal K+ ion channel 2 inwardly- diabetes,
rectifying hyperinsuline channel, mic subfamily J, member 11
ENSG00000169432 2 166763060 1.67E+08 2 SCN9A sodium x pain found in
neuroendocrine, Na+ ion channel 2 channel, syndromes, discovery
smooth m voltage- seizure HF v ctrl gated, type disorders IX, alpha
ADD SCN10A x PR interval, new Na+ ion channel 2 VF findings AHA
ENSG00000138622 15 71400988 71448230 1 HCN4 hyperpolarization x
SSS, K+ ion channel 2 activated Brugadas cyclic nucleotide- gated
potassium channel 4 ADD DPP6 x VF (A. Wilde) ncodes a K+ putative
component of the transient outward current ENSG00000164588 5
45297730 45731977 1 HCN1 hyperpolarization found in K+ ion channel
2 activated discovery cyclic HF v ctrl nucleotide- gated potassium
channel 1 ENSG00000169282 3 157321095 1.58E+08 10 KCNAB1 potassium
found in K+ ion channel 2 voltage- discovery gated HF v ctrl
channel, shaker- related subfamily, beta member 1 ENSG00000069424 1
5974113 6083840 8 KCNAB2 potassium found in K+ ion channel 2
voltage- discovery gated HF v ctrl channel, shaker- related
subfamily, beta member 2 ENSG00000120457 11 128266517 1.28E+08 1
KCNJ5 potassium found in K+ ion channel 2 inwardly- discovery
rectifying HF v ctrl channel, subfamily J, member 5 ENSG00000135750
1 231816373 2.32E+08 3 KCNK1 potassium found in K+ ion channel 2
channel, discovery subfamily K, HF v ctrl member 1 ENSG00000182450
11 63815770 63828817 1 KCNK4 potassium found in K+ ion channel 2
channel, discovery subfamily K, HF v ctrl member 4 ENSG00000171385
1 112114807 1.12E+08 3 KCND3 potassium found in K+ ion channel 2
voltage- discovery gated HF v ctrl; channel, repolarization
Shal-related subfamily, member 3 ENSG00000120049 10 103575721
1.04E+08 12 KCNIP2 Kv channel ko mice K+ ion channel 2 interacting
arrhythmias; protein 2 lto ENSG00000184408 7 119701923 1.2E+08 1
KCND2 potassium repolarization K+ ion channel 2 voltage- gated
channel, Shal-related subfamily, member 2 ENSG00000143105 1
110861396 1.11E+08 2 KCNA10 potassium very little K+ ion channel 2
voltage- known gated channel, shaker- related subfamily, member 10
ENSG00000074201 11 77004847 77026495 1 CLNS1A chloride Cl- ion
channel 2 channel, nucleotide- sensitive, 1A ENSG00000099822 19
540893 568157 1 HCN2 hyperpolarization K+ ion channel 2 activated
cyclic nucleotide- gated potassium channel 2 ENSG00000182255 11
29988341 29995064 1 KCNA4 potassium K+ ion channel 2 voltage- gated
channel, shaker- related subfamily, member 4 ENSG00000151079 12
4789372 4791132 3 KCNA6 potassium K+ ion channel 2 voltage-
gated channel, shaker- related subfamily, member 6 ENSG00000170049
17 7765902 7773478 2 KCNAB3 potassium K+ ion channel 2 voltage-
gated channel, shaker- related subfamily, beta member 3
ENSG00000158445 20 47418353 47532591 1 KCNB1 potassium K+ ion
channel 2 voltage- gated channel, Shab-related subfamily, member 1
ENSG00000176076 X 108753585 1.09E+08 2 KCNE1L KCNE1-like K+ ion
channel 2 ENSG00000152049 2 223625171 2.24E+08 1 KCNE4 potassium K+
ion channel 2 voltage- gated channel, lsk- related family, member 4
ENSG00000184185 17 21220292 21260983 1 KCNJ12 potassium K+ ion
channel 2 inwardly- rectifying channel, subfamily J, member 12
ENSG00000162989 2 155263339 1.55E+08 1 KCNJ3 potassium K+ ion
channel 2 inwardly- rectifying channel, subfamily J, member 3
ENSG00000168135 22 37152278 37181149 1 KCNJ4 potassium K+ ion
channel 2 inwardly- rectifying channel, subfamily J, member 4
ENSG00000121361 12 21809156 21819014 1 KCNJ8 potassium K+ ion
channel 2 inwardly- rectifying channel, subfamily J, member 8
ENSG00000171303 2 26769123 26806207 1 KCNK3 potassium K+ ion
channel 2 channel, subfamily K, member 3 ENSG00000099337 19
43502322 43511480 1 KCNK6 potassium K+ ion channel 2 channel,
subfamily K, member 6
TABLE-US-00005 TABLE 3 Mutated or associated Ensembl Start End with
Human Ion (handling structural Gene ID Chromosome Position Position
Transcript HGNC Gene SCD Disease Other or or EC Ver 42 Name (bp)
(bp) count Symbol Name disorders Groupings LOE Organelle
dependence) function coupling ENSG00000163399 1 116717359 116754301
4 ATP1A1 ATPase, role in ATPase Na+/K+ calcium transporting,
signaling alpha 1 during polypeptide cardiac contraction
ENSG00000018625 1 158352172 158379996 2 ATP1A2 ATPase, role in
ATPase Na+/K+ calcium transporting, signaling alpha 2 during (+)
cardiac polypeptide contraction ENSG00000196296 16 28797310
28823331 1 ATP2A1 ATPase, SR Ca++ transmembrane 1 Ca++ protein
transporting, cardiac muscle, fast twitch 1 ENSG00000174437 12
109203815 109273278 3 ATP2A2 ATPase, SR Ca++ transmembrane 1 Ca++
protein transporting, cardiac muscle, slow twitch 2 ENSG00000151067
12 2094650 2670626 5 CACNA1C calcium x LQT8 found in cell Ca++ 1
channel, discovery membrane voltage- HF v dependent, L ctrl type,
alpha 1C subunit ENSG00000157388 3 53503723 53821112 2 CACNA1D
calcium found in cell Ca++ 1 channel, discovery membrane voltage-
HF v dependent, L ctrl; type, Subunit alpha of L-type 1D calcium
subunit channel ENSG00000198216 1 179648918 180037339 6 CACNA1E
calcium neuron, Ca++ channel, kidney, voltage- retina, dependent,
spleen, alpha islet cells 1E subunit ENSG00000006283 17 45993820
46059541 6 CACNA1G calcium found in Ca++ channel, discovery
voltage- HF v dependent, ctrl; alpha subunit 1G of t-type subunit
calcium channel, SA node cells ENSG00000196557 16 1143739 1211772 2
CACNA1H calcium Ca++ channel, voltage- dependent, alpha 1H subunit
ENSG00000153956 7 81417354 81910967 3 CACNA2D1 calcium found in
Ca++ 1 channel, discovery voltage- HF v dependent, ctrl; alpha
Subunit 2/delta of L-type subunit 1 calcium channel ENSG00000007402
3 50375237 50516032 2 CACNA2D2 calcium found in Ca++ 1 channel,
discovery voltage- HF v dependent, ctrl; alpha Subunit 2/delta of
L-type subunit 2 calcium channel ENSG00000157445 3 54131733
55083622 1 CACNA2D3 calcium found in cell Ca++ 1 channel, discovery
membrane voltage- HF v dependent, ctrl; alpha Subunit 2/delta 3 of
L-type subunit calcium channel ENSG00000151062 12 1771384 1898131 2
CACNA2D4 calcium Ca++ channel, voltage- dependent, alpha 2/delta
subunit 4 ENSG00000067191 17 34583232 34607427 2 CACNB1 calcium
Ca++ channel, voltage- dependent, beta 1 subunit ENSG00000165995 10
18469612 18870797 9 CACNB2 calcium found in Ca++ 1 channel,
discovery voltage- HF v dependent, ctrl; beta 2 Subunit subunit of
L-type calcium channel ENSG00000167535 12 47498779 47508991 1
CACNB3 calcium found in Ca++ 1 channel, discovery voltage- HF v
dependent, ctrl; beta 3 Subunit subunit of L-type calcium channel
ENSG00000182389 2 S 152663771 1 CACNB4 calcium Ca++ channel,
voltage- dependent, beta 4 subunit ENSG00000198668 14 89933120
89944158 CALM1 calmodulin 1 (phosphorylase kinase, delta)
ENSG00000143933 2 47240736 47257140 1 CALM2 calmodulin 2
(phosphorylase kinase, delta) ENSG00000160014 19 51796352 51805878
1 CALM3 calmodulin 3 (phosphorylase kinase, delta) ENSG00000145349
4 114593022 114902177 4 CAMK2D calcium/ Ca++ phosphorylation, 1
calmodulin- KEY dependent protein kinase (CaM kinase) II delta
ENSG00000108509 17 4812017 4831671 5 CAMTA2 calmodulin binding
transcription activator 2 ENSG00000147044 X 41259131 41667660 8
CASK calcium/ calmodulin- dependent serine protein kinase (MAGUK
family) ENSG00000118729 1 116044151 116112925 1 CASQ2 calsequestrin
2 x CPVT, found in SR Ca++ 1 (cardiac recessive discovery muscle)
HF v ctrl ENSG00000119782 2 24126075 24140055 4 FKBP1B FK506 assoc
SR Ca++ 1 binding with RYR protein 1B, 12.6 kDa ENSG00000172399 4
120276469 120328383 1 MYOZ2 myozenin 2 Calsarcin 1; calcineurin-
interacting protein ENSG00000113448 5 58305622 59320301 5 PDE4D
phosphodiesterase found in SR Ca++ 1 4D, discovery cAMP- HF v
specific ctrl; (phosphodiesterase assoc E3 with RYR dunce homolog,
Drosophila) ENSG00000198523 6 118976154 118988586 1 PLN
phospholamban x DCM Found in SR Ca++ 1 QTGEN and QTSCD
ENSG00000138814 4 102163610 102487376 1 PPP3CA protein found in
phosphatase 3 discovery (formerly HF v 2B), ctrl catalytic subunit,
alpha isoform (calcineurin A alpha) ENSG00000114302 3 48762099
48860274 2 PRKAR2A protein Ca++ phosphorylation, 1 kinase, KEY
cAMP- dependent, regulatory, type II, alpha ENSG00000154229 17
61729388 62237324 1 PRKCA protein found in kinase discovery C, HF v
alpha ctrl; fundamental regulator of cardiac contractility and
Ca(2+) handling in myocytes ENSG00000166501 16 23754823 24139358 2
PRKCB1 protein found in kinase discovery C, beta 1 HF v ctrl
ENSG00000198626 1 235272128 236063911 3 RYR2 ryanodine x CPVT found
in SR Ca++ 1 receptor 2 (exons 1-28, discovery (cardiac) 37-50, HF
v 75, 83-105) ctrl; assoc with
lower SCA risk (AHA abstract) ENSG00000136450 17 53437651 53439593
2 SFRS1 splicing regulates splicing 1 factor, splicing arginine/ of
serine- CAMK2D; rich 1 deficiency (splicing causes factor severe 2,
EC alternate coupling splicing defects factor) ENSG00000183023 2
40192790 40534188 5 SLC8A1 solute cell Na+/Ca++ membrane 1 carrier
membrane ion family 8 exchanger (sodium/ calcium exchanger), member
1 ENSG00000118160 19 52623735 52666934 1 SLC8A2 solute cell
Na+/Ca++ membrane 1 carrier membrane ion family 8 exchanger
(sodium- calcium exchanger), member 2 ENSG00000170290 11 107083319
107087992 1 SLN sarcolipin interact SR 1 with PLN and ATP2A1
ENSG00000186439 6 123579183 123999937 5 TRDN triadin found in SR 1
discovery HF v ctrl; colocalizes with the RYR and junctin; skel m
and cardiac isoforms
TABLE-US-00006 TABLE 4 Mutated or Ensembl Start End associated Gene
ID Chromosome Position Position Transcript HGNC Gene with Human Ver
42 Name (bp) (bp) count Symbol Name SCD disorders ENSG00000182533 3
8750253 8763451 2 CAV3 caveolin 3 x ENSG00000089250 12 116135362
116283965 3 NOS1 nitric oxide synthase 1 (neuronal) ENSG00000143153
1 167341559 167368584 3 ATP1B1 ATPase, Na+/K+ transporting, beta 1
polypeptide ADD LITAF ADD GINS3 ENSG00000198929 1 160306190
160604868 1 NOS1AP nitric oxide synthase 1 (neuronal) adaptor
protein ADD 9p21 markers 4p25 markers Ensembl Ion (handling Gene ID
Disease Other or Ver 42 Groupings LOE Organelle dependence)
structural ENSG00000182533 LQT9, HCM, assoc caveolae variants alter
SIDS with late Na+ dystrophin, current LGMD ENSG00000089250 found
in discovery HF v ctrl ENSG00000143153 found in Na+/K+ ATPase
discovery HF v ctrl; found in QTSCD ADD found in QTGEN and QTSCD
ADD found in QTGEN and QTSCD; Roden zfish ENSG00000198929 QTSCD,
QTGEN, SCD, found in discovery HF v ctrl ADD
TABLE-US-00007 TABLE 5 Ensembl Start End Gene ID Chromosome
Position Position Transcript HGNC Ver 42 Name (bp) (bp) count
Symbol Gene Name 17 37164412 37196476 1 JUP junction plakoglobin
ENSG00000134755 18 26900005 26936375 2 DSC2 desmocollin 3 DSG2
desmoglein ENSG00000096696 6 7486869 7531945 1 DSP desmoplakin
ENSG00000057294 12 32834954 32941041 2 PKP2 plakophilin 2
ENSG00000152661 6 121798487 121812571 1 GJA1 gap junction protein,
alpha 1, 43 kDa (connexin 43) ENSG00000143140 1 145695517 145712066
2 GJA5 gap junction protein, alpha 5, 40 kDa (connexin 40)
ENSG00000182963 17 40237146 40263707 1 GJA7 gap junction protein,
alpha 7, 45 kDa (connexin 45) ENSG00000169562 X 70351769 70362091 3
GJB1 gap junction protein, beta 1, 32 kDa (connexin 32, Charcot-
Marie-Tooth neuropathy, X-linked) ENSG00000149596 20 42173749
42249632 2 JPH2 junctophilin 2 Mutated or Ion Ensembl associated
(handling Gene ID with Human Disease Other or Ver 42 SCD disorders
Groupings LOE Organelle dependence) structural x ARVC found in
desmosomes discovery HF v ctrl; adhering junctions, the desmosomes
and the intermediate junctions ENSG00000134755 x ARVC desmosomes x
ARVC desmosomes ENSG00000096696 x ARVC desmosomes ENSG00000057294 x
ARVC desmosomes ENSG00000152661 gap junction ENSG00000143140 gap
junction ENSG00000182963 gap junction ENSG00000169562 gap junction
ENSG00000149596 junctional complex
TABLE-US-00008 TABLE 6 Ensembl Mutated or Ion (handling structural
Gene ID Chromosome Start Position End Position Transcript HGNC Gene
associated with Human Disease Other or or Ver 42 Name (bp) (bp)
count Symbol Name SCD disorders Groupings LOE Organelle dependence)
function ENSG00000163485 1 201326405 201403156 4 ADORA1 adenosine
activates GPCR A1 adenosine receptor receptors; contractility
ENSG00000128271 22 23153537 23168309 2 ADORA2A adenosine activates
GPCR A2a adenosine receptor receptors; contractility
ENSG00000170425 17 15788956 15819935 1 ADORA2B adenosine activates
GPCR A2b adenosine receptor receptors; contractility
ENSG00000121933 1 111827493 111908107 6 ADORA3 adenosine activates
GPCR A3 adenosine receptor receptors; contractility ENSG00000120907
8 26661584 26778839 12 ADRA1A adrenergic, found in symp NS Epi/NE
GPCR alpha-1A-, discovery receptor HF v ctrl ENSG00000170214 5
159276318 159332595 1 ADRA1B adrenergic, symp NS Epi/NE GPCR
alpha-1B-, receptor ENSG00000171873 20 4149329 4177659 1 ADRA1D
adrenergic, symp NS Epi/NE GPCR alpha-1D-, receptor ENSG00000150594
10 112826911 112830655 2 ADRA2A adrenergic, symp NS Epi/NE GPCR
alpha-2A-, receptor ENSG00000181210 2 96202419 96203762 ADRA2B
adrenergic, symp NS Epi/NE GPCR alpha-2B-, receptor ENSG00000133019
1 237859012 238145373 2 CHRM3 cholinergic Cardiac?? Ach signaling,
receptor, parasymp muscarinic 3 ENSG00000103546 16 54248057
54296685 3 SLC6A2 solute Norepi carrier transporter family 6
(neurotransmitter transporter, noradrenalin), member 2
TABLE-US-00009 TABLE 7 Mutated or associated Ion Ensembl Start End
Tran- with Human (handling structural tran- Gene ID Chromosome
Position Position script HGNC SCD Disease Other or or EC ion
scription Ver 42 Name (bp) (bp) count Symbol Gene Name disorders
Groupings LOE Organelle dependence) function coupling channels
factors ENSG00000068305 15 97923712 98074131 3 MEF2A MADS box x
CAD, MI found in nucleus 4 transcription discovery enhancer HF v
factor 2, ctrl: polypeptide A Topol (myocyte gene enhancer factor
2A) ENSG00000129170 11 19160154 19180177 1 CSRP3 cysteine and x
DCM, HCM involved glycine-rich in protein 3 myogenesis (cardiac LIM
protein) ADD PITX2 x AF ENSG00000183072 5 172591744 172594868 1
NKX2-5 NK2 x ASD, nucleus 4 transcription conduction factor
related, defect, and locus 5 other CHD (Drosophila) ENSG00000089225
12 113276119 113330630 3 TBX5 T-box 5 x ASD nucleus 4
ENSG00000105866 7 21434214 21520674 1 SP4 Sp4 mouse nucleus 4
transcription model factor SCD/VF ENSG00000180733 8 48812794
48813235 1 CEBPD CCAAT/ enhancer binding protein (C/EBP), delta
ENSG00000136574 8 11599122 11654920 3 GATA4 GATA nucleus 4 binding
protein 4 ENSG00000108840 17 39509647 39556540 2 HDAC5 histone
nucleus 4 deacetylase 5 ENSG00000081189 5 88051922 88214818 2 MEF2C
MADS box nucleus 4 transcription enhancer factor 2, polypeptide C
(myocyte enhancer factor 2C) ENSG00000101096 20 49441083 49592665 2
NFATC2 nuclear factor nucleus 4 of activated T-cells, cytoplasmic,
calcineurin- dependent 2 ENSG00000171786 1 158603481 158609262 1
NHLH1 nescient helix nucleus 4 loop helix 1 ENSG00000108064 10
59814788 59828987 2 TFAM transcription factor A, mitochondrial
TABLE-US-00010 TABLE 8 Mutated or Ensembl associated Ion Gene ID
Chromosome Start Position End Position Transcript HGNC with Human
SCD Disease (handling or structural or Ver 42 Name (bp) (bp) count
Symbol Gene Name disorders Groupings Other LOE Organelle
dependence) function ENSG00000145362 4 114190319 114524334 4 ANK2
ankyrin 2, x LQT4 assoc with peripheral neuronal lower SCA membrane
risk (AHA abstract) ADD LDB3 x DCM, non- Cypher/ZASP, compaction
cytoskeletal assembly; interacts with MYOZ ENSG00000168028 3
39423208 39429034 1 RPSA ribosomal x ARVC Laminin cytoskeletal
protein SA receptor (LAMR1) ENSG00000198947 X 31047257 33267479 15
DMD dystrophin x DCM, cytoskeletal (muscular- muscular dystrophy,
dystrophy Duchenne and Becker types) ENSG00000160789 1 154318993
154376504 9 LMNA lamin A/C x DCM cytoskeletal ENSG00000101400 20
31459424 31495359 1 SNTA1 syntrophin, x LQT12 cytoskeletal alpha 1
(dystrophin- associated protein A1, 59 kDa, acidic component)
ENSG00000155657 2 179099985 179380394 12 TTN titin x HCM, DCM,
sarcomere muscular dystrophy ENSG00000148677 10 92661833 92671013 1
ANKRD1 ankyrin repeat CARP, sarcomere domain 1 colocalized (cardiac
with titin muscle) ENSG00000115414 2 215933409 216009041 10 FN1
fibronectin 1 found in ECM, discovery connective HF v ctrl
ENSG00000170624 5 155686334 156125623 1 SGCD sarcoglycan, found in
cytoskeletal delta (35 kDa discovery dystrophin- HF v ctrl
associated glycoprotein) ENSG00000151150 10 61458165 61819494 6
ANK3 ankyrin 3, found in peripheral node of discovery membrane
Ranvier HF v ctrl; (ankyrin G) associates with SCN5A
ENSG00000134769 18 30327279 30725341 6 DTNA dystrobrevin, found in
cytoskeletal alpha discovery HF v ctrl; component of the
dystrophin- associated protein complex (DPC) ENSG00000137076 9
35687336 35722369 6 TLN1 talin 1 found in cytoskeletal discovery HF
v ctrl; links vinculin to the integrins, and, thus, the
cytoskeleton to extracellular matrix (ECM) receptors
ENSG00000154358 1 226462454 226633198 9 OBSCN obscurin, obscurin
sarcomere cytoskeletal and titin calmodulin and coassemble
titin-interacting during RhoGEF myofibrillogenesis ENSG00000175084
2 219991343 219999705 2 DES desmin cytoskeletal ENSG00000172164 8
121619297 121893264 1 SNTB1 syntrophin, cytoskeletal beta 1
(dystrophin- associated protein A1, 59 kDa, basic component 1)
ENSG00000168807 16 67778533 67892379 2 SNTB2 syntrophin,
cytoskeletal beta 2 (dystrophin- associated protein A1, 59 kDa,
basic component 2) ENSG00000173991 17 35073966 35076326 1 TCAP
titin-cap sarcomere (telethonin) ENSG00000035403 10 75427878
75549924 2 VCL vinculin cytoskeletal
TABLE-US-00011 TABLE 9 Start End Ensembl Gene ID Chromosome
Position Position Transcript HGNC Ver 42 Name (bp) (bp) count
Symbol Gene Name ENSG00000135744 1 228904892 228916666 1 AGT
angiotensinogen (serpin peptidase inhibitor, clade A, member 8)
ENSG00000151623 4 149219370 149582973 4 NR3C2 nuclear receptor
subfamily 3, group C, member 2 ENSG00000092009 14 24044552 24047311
2 CMA1 chymase 1, mast cell ENSG00000159640 17 58908166 58938721 2
ACE angiotensin I converting enzyme (peptidyl- dipeptidase A) 1
ENSG00000144891 3 149898355 149943478 1 AGTR1 angiotensin II
receptor, type 1 Mutated or associated with Ensembl Gene ID Human
SCD Disease Other structural or Ver 42 disorders Groupings LOE
Organelle function ENSG00000135744 CAD, AF, found in neurohormonal
HTN discovery HF v ctrl ENSG00000151623 found in aldosterone
discovery receptor HF v ctrl ENSG00000092009 works neurohormonal
like ACE in heart ENSG00000159640 neurohormonal ENSG00000144891
neurohormonal
TABLE-US-00012 TABLE 10 Mutated or associated Ensembl Start End
with Human Ion Gene ID Ver Chromosome Position Position Transcript
HGNC SCD Disease (handling or structural or 42 Name (bp) (bp) count
Symbol Gene Name disorders Groupings Other LOE Organelle
dependence) function ENSG00000106617 7 150884960 151204728 1 PRKAG2
protein kinase, x HCM found in AMP-activated, discovery HF v gamma
2 non- ctrl; metabolic catalytic stress-sensing subunit protein
kinase; critical role in regulating cellular glucose and fatty acid
metabolic pathways ENSG00000074582 2 219231772 219236399 1 BCS1L
BCS1-like x mitochondrial mitochondria (yeast) complex III
deficiency ENSG00000014919 10 101461591 101482413 2 COX15 COX15 x
infantile HCM homolog, cytochrome c oxidase assembly protein
(yeast) ENSG00000110536 11 47543464 47562690 3 NDUFS3 NADH x Leigh
mitochondria dehydrogenase syndrome (ubiquinone) Fe--S protein 3,
30 kDa (NADH- coenzyme Q reductase) ENSG00000073578 5 271356 309815
3 SDHA succinate x Leigh mitochondria dehydrogenase syndrome
complex, subunit A, flavoprotein (Fp) ENSG00000148290 9 135208431
135213182 1 SURF1 surfeit 1 x Leigh mitochondria assembly syndrome
factor for COX ENSG00000164258 5 52892226 53014925 2 NDUFS4 NADH
found in mitochondria dehydrogenase discovery HF v (ubiquinone)
ctrl Fe--S protein 4, 18 kDa (NADH- coenzyme Q reductase)
ENSG00000006695 17 13913444 14052712 1 COX10 COX10 found in
mitochondria homolog, discovery HF v cytochrome c ctrl; rs2230355
oxidase assembly protein, heme A: farnesyltransferase (yeast)
ENSG00000179142 8 143988983 143996261 1 CYP11B2 cytochrome
mitochondria P450, family 11, subfamily B, polypeptide 2
ENSG00000091140 7 107318847 107347645 1 DLD dihydrolipoamide
dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-
oxo-glutarate complex, branched chain keto acid dehydrogenase
complex) ENSG00000115286 19 1334883 1346583 3 NDUFS7 NADH
mitochondria dehydrogenase (ubiquinone) Fe--S protein 7, 20 kDa
(NADH- coenzyme Q reductase) ENSG00000110717 11 67554670 67560686 1
NDUFS8 NADH mitochondria dehydrogenase (ubiquinone) Fe--S protein
8, 23 kDa (NADH- coenzyme Q reductase) ENSG00000167792 11 67130974
67136581 1 NDUFV1 NADH mitochondria dehydrogenase (ubiquinone)
flavoprotein 1, 51 kDa ENSG00000131828 X 19271968 19289724 5 PDHA1
pyruvate mitochondria multienzyme dehydrogenase (lipoamide) alpha 1
ENSG00000151729 4 186301392 186305418 1 SLC25A4 solute carrier
mitochondria family 25 (mitochondrial carrier; adenine nucleotide
translocator), member 4 ENSG00000112096 6 160020138 160034343 3
SOD2 superoxide mitochondria dismutase 2, mitochondrial
ENSG00000073905 5 133335506 133368723 1 VDAC1 voltage- mitochondria
dependent anion channel 1
TABLE-US-00013 TABLE 11 current Gene Symbol set notes ADCY1 brain,
CNS adenylate cyclase ADCY2 adenylate cyclase ADCY3 adenylate
cyclase ADCY4 adenylate cyclase ADCY5 adenylate cyclase ADCY6
adenylate cyclase ADCY7 adenylate cyclase ADCY8 adenylate cyclase
ADCY9 adenylate cyclase ADRA1A 6 ADRA1B 6 ADRA1D 6 ADRB1 1 ADRB2 1
ADRB3 1 ANXA6 annexin ARRB1 arrestin ARRB2 arrestin ATP1A1 3 ATP1A2
3 ATP1A4 Na/K ATPase ATP1B1 Na/K ATPase ATP1B2 Na/K ATPase ATP1B3
Na/K ATPase ATP2A1 1 ATP2A2 1, 3 ATP2A3 ATP2B1 ATP2B2 ATP2B3
CACNA1A 1, 3 CACNA1B CACNA1C 1, 3 CACNA1D 1, 3 CACNA1E CACNA1S
CACNB1 3 CACNB2 3 CACNB3 3 CACNB4 3 CALM1 3 CALM2 3 CALM3 3 CALR
calreticulin CAMK1 CAMK2A CAMK2B CAMK2D 1, 3 CAMK2G CAMK4 CAMTA2 3
CASQ1 no set skel m CASQ2 1, 3 CASK 3 CHRM1 CHRM2 CHRM3 6 CHRM4
CHRM5 FKBP1B 3 FXYD2 GJA1 5 gap junction GJA12 gap junction GJA4
gap junction GJA5 5 gap junction GJA7 5 gap junction GJB1 5 gap
junction GJB2 gap junction GJB3 gap junction GJB4 gap junction GJB5
gap junction GJB6 gap junction GNA11 G protein GNAI2 1 G protein
GNAI3 G protein GNAO1 G protein GNAQ G protein GNAZ G protein GNB1
G protein GNB2 G protein GNB3 1 G protein GNB4 G protein GNB5 G
protein GNG12 G protein GNG13 G protein GNG2 G protein GNG3 G
protein GNG4 G protein GNG5 G protein GNG7 G protein GNGT1 G
protein GRK4 G prot receptor kinase GRK5 G prot receptor kinase
GRK6 G prot receptor kinase ITPR1 no set CNS ITPR2 no set found in
our HF v discovery ITPR3 KCNB1 2 KCNJ3 2 KCNJ5 2 MGC11266 MYCBP 1
MYOZ2 3 NME7 PDE4D 3 PEA15 PKIA protein kinase PKIB protein kinase
PKIG protein kinase PLCB3 phospholipase C PLN 1, 3 PPP3CA 3 PRKACA
1, 3 protein kinases PRKACB protein kinases PRKAR1A protein kinases
PRKAR1B protein kinases PRKAR2A 1, 3 protein kinases PRKAR2B
protein kinases PRKCA 3 protein kinases PRKCB1 3 protein kinases
PRKCD protein kinases PRKCE protein kinases PRKCG protein kinases
PRKCH protein kinases PRKCQ protein kinases PRKCZ protein kinases
PRKD1 protein kinases RGS1 regulator of G prot signaling RGS10
regulator of G prot signaling RGS11 regulator of G prot signaling
RGS14 regulator of G prot signaling RGS16 regulator of G prot
signaling RGS17 regulator of G prot signaling RGS18 regulator of G
prot signaling RGS19 regulator of G prot signaling RGS2 regulator
of G prot signaling RGS20 regulator of G prot signaling RGS3
regulator of G prot signaling RGS4 regulator of G prot signaling
RGS5 regulator of G prot signaling RGS6 regulator of G prot
signaling RGS7 regulator of G prot signaling RGS9 regulator of G
prot signaling RYR1 no set skel m RYR2 1, 3 RYR3 SARA1 SFN
stratifin SFRS1 3 SLC8A1 1, 3 SLC8A2 1, 3 SLC8A3 SLC9A1 1 SLN 3
TRDN 3 USP5 YWHAB brain MONOOXYGENASE ACTIVATION PROTEIN YWHAH
brain MONOOXYGENASE ACTIVATION PROTEIN YWHAQ T cells MONOOXYGENASE
ACTIVATION PROTEIN YWHAQ /// MIB1
TABLE-US-00014 TABLE 12 Mutated or associated Ensembl Chromo- Start
End with Human Ion Gene ID Ver some Position Position Transcript
HGNC SCD Disease Other (handling or structural or 42 Name (bp) (bp)
count Symbol Gene Name disorders Groupings LOE Organelle
dependence) function ENSG00000158022 1 26250382 26266711 1 TRIM63
tripartite motif- ? containing 63 NOT FOUND SERPINE1 serpin
peptidase ? inhibitor, clade E (nexin, plasminogen activator
inhibitor type 1), member 1 NOT FOUND GP1BB glycoprotein lb ?
(platelet), beta polypeptide ENSG00000169564 2 70168090 70169766 1
PCBP1 poly(rC) binding ? protein 1 ENS000000168610 17 37718869
37794039 5 STAT3 signal transducer acute phase and activator of
response transcription 3 (acute-phase response factor)
ENSG00000169418 1 151917737 151933092 2 NPR1 natriuretic peptide
ANP receptor receptor A/guanylate cyclase A (atrionatriuretic
peptide receptor A) ENSG00000130522 19 18252251 18253294 1 JUND jun
D proto- broad AP1 oncogene functions, transcription non- factor
cardiac ENSG00000164305 4 185785845 185807623 2 CASP3 caspase 3,
apoptosis apoptosis-related cysteine peptidase ENSG00000064012 2
201806426 201860677 9 CASP8 caspase 8, apoptosis apoptosis-related
cysteine peptidase ENSG00000002330 11 63793878 63808740 1 BAD
BCL2-antagonist apoptosis of cell death ENSG00000087088 19 54149929
54156864 5 BAX BCL2-associated apoptosis X protein ENSG00000188389
2 242440711 242449731 2 PDCD1 programmed cell autoimmune apoptosis
death 1 DCM, mice ENSG00000171552 20 29715916 29774366 4 BCL2L1
BCL2-like 1 apoptosis ENSG00000120937 1 11840108 11841575 2 NPPB
natriuretic peptide BNP precursor B ENSG00000108691 17 29606409
29608329 1 CCL2 chemokine (C-C chemokines motif) ligand 2
ENSG00000161570 17 31222613 31231490 1 CCL5 chemokine (C-C
chemokines motif) ligand 5 ENSG00000131187 3 5 176761747 1.77E+08
F12 coagulation factor clotting XII (Hageman factor)
ENSG00000124491 2 6 6089317 6265901 F13A1 coagulation factor found
in clotting XIII, A1 discovery polypeptide HF v ctrl
ENSG00000180210 3 11 46697331 46717631 F2 coagulation factor
clotting II (thrombin) ENSG00000117525 2 1 94767369 94779944 F3
coagulation factor clotting III (thromboplastin, tissue factor)
ENSG00000198734 3 1 167750028 1.68E+08 F5 coagulation factor
clotting V (proaccelerin, labile factor) ENSG00000057593 2 13
112808106 1.13E+08 F7 coagulation factor clotting VII (serum
prothrombin conversion accelerator) ENSG00000171564 1 4 155703596
1.56E+08 FGB fibrinogen beta clotting chain ENSG00000108821 17
45616456 45633992 1 COL1A1 collagen, type I, collagens alpha 1
ENSG00000168542 2 189547344 189585717 2 COL3A1 collagen, type III,
collagens alpha 1 (Ehlers- Danios syndrome type IV, autosomal
dominant) ENSG00000171497 4 159849730 159864002 1 PPID
peptidylprolyl cyclophilin isomerase D (cyclophilin D)
ENSG00000204490 6 31651314 31654092 1 TNF tumor necrosis cytokine
factor (TNF superfamily, member 2) ENSG00000150281 16 30815429
30822381 1 CTF1 cardiotrophin 1 induces cytokine. growth myocyte
factor hypertrophy, signals through gp130 ENSG00000117594 1
207926133 207974918 3 HSD11B1 hydroxysteroid dehydrogenase
(11-beta) dehydrogenase 1 ENSG00000142871 1 85819005 85822233 2
CYR61 cysteine-rich, ECM signaling angiogenic inducer, 61
ENSG00000140564 15 89212889 89227691 1 FURIN furin (paired basic
enzyme amino acid cleaving enzyme) ENSG00000177000 4 1 11768367
11788702 MTHFR 5,10- homocysteinuria enzyme
methylenetetrahydrofolate reductase (NADPH) ENSG00000146070 6
46779897 46811389 2 PLA2G7 phospholipase A2. role in CAD Lp- enzyme
group VII (platelet- PLA2 activating factor acetylhydrolase,
plasma) ENSG00000088832 20 1297625 1321806 4 FKBP1A FK506 binding
FKBP1 FK506BP protein 1A, 12 kDa B more important ENSG00000152413 5
78707505 78788599 2 HOMER1 homer homolog 1 enriched CNS glutamate
(Drosophila) at binding protein excitatory synapses ENSG00000138685
4 123967313 124038840 1 FGF2 fibroblast growth found in growth
factor factor 2 (basic) discovery HF v ctrl ENSG00000177885 17
70825753 70913384 2 GRB2 growth factor growth factor receptor-bound
protein 2 ENSG00000017427 12 101313809 101398471 2 IGF1
insulin-like growth growth factor factor 1 (somatomedin C)
ENSG00000170962 11 103283131 103540317 1 PDGFD platelet derived
growth factor growth factor D ENSG00000112715 6 43845924 43862202 8
VEGFA vascular growth factor endothelial growth factor A
ENSG00000136238 7 6380651 6410120 2 RAC1 ras-related C3 found in
GTP binding botulinum toxin discovery protein substrate 1 (rho HF v
family, small GTP ctrl; binding protein possibly Rac1) involved in
hypertrophic response ENSG00000109971 11 122433411 122438054 1
HSPA8 heat shock 70 kDa heat shock protein 8 proteins
ENSG00000004776 19 40937336 40939799 1 HSPB6 heat shock heat shock
protein, alpha- proteins crystallin-related, B6 ENSG00000109846 11
111284560 111287704 1 CRYAB crystallin, alpha B x desmin heat shock
related proteins myopatht, cataracts ENSG00000148926 11 10283172
10285491 1 ADM adrenomedullin hormone ENSG00000172270 19 462896
534492 3 BSG basigin (Ok blood immunoglobulin group)
ENSG00000132693 1 157948703 157951003 5 CRP C-reactive protein,
inflammation pentraxin-related ENSG00000164171 1 5 52321014
52423805 ITGA2 integrin, alpha 2 integrins (CD49B, alpha 2 subunit
of VLA-2 receptor) ENSG00000147166 X 70438309 70441946 1 ITGB1BP2
integrin beta 1 integrins binding protein (melusin) 2
ENSG00000056345 1 17 42686207 42745076 ITGB3 integrin, beta 3
integrins (platelet glycoprotein IIIa, antigen CD61)
ENSG00000111537 12 66834816 66839790 1 IFNG interferon, gamma
interferon ENSG00000137462 4 154842102 154846301 1 TLR2 toll-like
receptor 2 interleukin-like receptor ENSG00000136634 1 205007570
205012462 1 IL10 interleukin 10 interleukins ENSG00000125538 2
113303808 113310827 1 IL1B interleukin 1, beta interleukins
ENSG00000113520 5 132037272 132046267 4 IL4 interleukin 4
interleukins ENSG00000136244 7 22732028 22738091 1 IL6 interleukin
6 interleukins (interferon, beta 2) ENSG00000134352 5 55266680
55326529 8 IL6ST interleukin 6 signal interleukins transducer
(gp130, oncostatin M receptor) ENSG00000109572 4 170778297
170878731 2 CLCN3 chloride channel 3 expressed Cl- ion channel in
brain and neurons NOT FOUND CLNS1B chloride channel, not in Cl- ion
channel nucleotide- OMIM sensitive, 1B ENSG00000144285 2 166553919
166638395 3 SCN1A sodium channel, x generalized neuron, skel m Na+
ion channel voltage-gated, epilepsy with type I, alpha febrile
seizures, myoclonic epilesy ENSG00000151704 11 128213125 128242478
2 KCNJ1 potassium x Bartter kidney K+ ion channel
inwardly-rectifying syndrome channel, subfamily J, member 1
ENSG00000111262 12 4890806 4892293 1 KCNA1 potassium voltage-
myokymia
skel m K+ ion channel gated channel, (rippling of shaker-related
muscles) and subfamily, member episodic 1 (episodic ataxia ataxia
with myokymia) ENSG00000149575 11 117538729 117552546 1 SCN2B
sodium channel, neurons Na+ ion channel voltage-gated, type II,
beta ENSG00000153253 2 165652286 165768799 4 SCN3A sodium channel,
neuron, skel m Na+ ion channel voltage-gated, type III, alpha
ENSG00000007314 17 59369646 59404010 1 SCN4A sodium channel, x
hyperkalemic skel m Na+ ion channel voltage-gated, periodic type
IV, alpha paralysis, myotonias, myasthenia ENSG00000082701 3
121028238 121295954 2 GSK3B glycogen synthase kinase kinase 3 beta
ENSG00000096968 9 4975245 5118183 1 JAK2 Janus kinase 2 (a kinase
protein tyrosine kinase) ENSG00000142208 14 104306734 104333125 1
AKT1 v-akt murine found in kinase thymoma viral discovery oncogene
HF v homolog 1 ctrl ENSG00000115641 2 105343717 105421392 4 FHL2
four and a half LIM not LIM protein domains 2 essential for cardiac
development and function ENSG00000005893 X 119446367 119487189 3
LAMP2 lysosomal- x HCM, Danon lysosomal associated disease membrane
membrane protein 2 protein ENSG00000065559 17 11864866 11987865 1
MAP2K4 mitogen-activated MAPKs protein kinase kinase 4
ENSG00000095015 5 56147216 56225472 1 MAP3K1 mitogen-activated
MAPKs protein kinase kinase kinase 1 ENSG00000197442 6 136919878
137155349 3 MAP3K5 mitogen-activated MAPKs protein kinase kinase
kinase 5 ENSG00000100030 22 20446873 20551730 1 MAPK1
mitogen-activated MAPKs protein kinase 1 ENSG00000112062 6 36103551
36186513 3 MAPK14 mitogen-activated MAPKs protein kinase 14
ENSG00000196611 11 102165861 102174099 1 MMP1 matrix MMPs
metallopeptidase 1 (interstitial collagenase) ENSG00000137745 11
102318937 102331672 2 MMP13 matrix MMPs metallopeptidase 13
(collagenase 3) ENSG00000157227 14 22375676 22385088 1 MMP14 matrix
found in MMPs metallopeptidase discovery 14 (membrane- HF v
inserted) ctrl ENSG00000087245 16 54070589 54098101 1 MMP2 matrix
MMPs metallopeptidase 2 (gelatinase A, 72 kDa gelatinase, 72 kDa
type IV collagenase) ENSG00000149968 11 102211738 102219552 1 MMP3
matrix MMPs metallopeptidase 3 (stromelysin 1, progelatinase)
ENSG00000100985 20 44070954 44078607 1 MMP9 matrix MMPs
metallopeptidase 9 (gelatinase B, 92 kDa gelatinase, 92 kDa type IV
collagenase) ENSG00000080815 14 72672915 72756862 4 PSEN1
presenilin 1 x DCM, multi-function (Alzheimer Alzheimer's disease
3) ENSG00000137808 15 67094125 67136516 2 NOX5 NADPH oxidase,
functions NADPH oxidase EF-hand calcium as a binding domain 5 H+
channel in a Ca(2+)- dependent manner ENSG00000182687 17 71582479
71585168 1 GALR2 galanin receptor 2 neuropeptide ENSG00000139133 12
34066483 34072501 1 ALG10A asparagine-linked not in NCBI or
glycosylation 10 OMIM homolog (yeast, alpha-1,2-
glucosyltransferase) ENSG00000158125 2 31410691 31491117 2 XDH
xanthine x xanthanurias oxidative dehydrogenase metabolism
ENSG00000172531 11 66922228 66925978 3 PPP1CA protein phosphatases
phosphatase 1, catalytic subunit, alpha isoform ENSG00000135447 12
53257439 53268723 2 PPP1R1A protein phosphatases phosphatase 1,
regulatory (inhibitor) subunit 1A ENSG00000108819 17 45567695
45582873 1 PPP1R9B protein phosphatases phosphatase 1, regulatory
subunit 9B, spinophilin ENSG00000156475 5 145949265 146415783 2
PPP2R2B protein phosphatases phosphatase 2 (formerly 2A),
regulatory subunit B (PR 52), beta isoform ENSG00000073711 3
137167257 137349423 2 PPP2R3A protein phosphatases phosphatase 2
(formerly 2A), regulatory subunit B'', alpha ENSG00000188386 9
103393718 103397104 2 PPP3R2 protein phosphatases phosphatase 3
(formerly 2B), regulatory subunit B, beta isoform ENSG00000180817
10 71632592 71663196 2 PPA1 pyrophosphatase phosphatases
(inorganic) 1 ENSG00000179295 12 111340919 111432099 1 PTPN11
protein tyrosine x HCM, phosphatases phosphatase, non- Noonan syndr
receptor type 11 (Noonan syndrome 1) ENSG00000112293 6 24536384
24597829 2 GPLD1 glycosylphosphatidylinositol phospholipase
specific phospholipase D1 ENSG00000135047 9 89530254 89536127 3
CTSL cathepsin L implicated in protease pathologic processes
including myofibril necrosis in myopathies and in MI
ENSG00000150995 3 4510136 4863432 4 ITPR1 inositol 1,4,5- CNS
receptor triphosphate receptor, type 1 ENSG00000123104 12 26381609
26877347 2 ITPR2 inositol 1,4,5- found in receptor triphosphate
discovery receptor, type 2 HF v ctrl ENSG00000113594 5 38510823
38631253 1 LIFR leukemia inhibitory found in receptor factor
receptor discovery alpha HF v ctrl ENSG00000138095 2 43968391
44076648 3 LRPPRC leucine-rich PPR- x Leigh regulatory motif
containing syndrome protein ENSG00000135486 12 52960755 52965297 2
HNRPA1 heterogeneous ribonucleoprotein nuclear ribonucleoprotein A1
ENSG00000165119 9 85772818 85785339 8 HNRPK heterogeneous
ribonucleoprotein nuclear ribonucleoprotein K ENSG00000133216 1
22910045 23114405 4 EPHB2 EPH receptor B2 RTK ENSG00000118785 4
89115890 89123592 3 SPP1 secreted involved secreted protein
phosphoprotein 1 in the (osteopontin, bone regulation sialoprotein
I, early of T-lymphocyte cardiac activation 1) remodeling
ENSG00000175387 18 43618435 43711221 2 SMAD2 SMAD family signaling
member 2 ENSG00000166949 15 65145249 65274586 1 SMAD3 SMAD family
found in signaling member 3 discovery HF v ctrl; signaling TGFbeta
ENSG00000141646 18 46810611 46860142 1 SMAD4 SMAD family signaling
member 4 ENSG00000164056 4 124537406 124544357 1 SPRY1 sprouty
homolog signaling 1, antagonist of FGF signaling (Drosophila)
ENSG00000166068 15 36331808 36433526 1 SPRED1 sprouty-related,
signaling EVH1 domain containing 1 ENSG00000104936 19 50965579
50977469 6 DMPK dystrophia x myotonic skel m, brain
myotonica-protein dystrophy kinase ENSG00000196218 19 43616180
43770012 5 RYR1 ryanodine receptor skeletal m 1 (skeletal)
ENSG00000143318 1 158426970 158438300 2 CASQ1 calsequestrin 1
skeletal m (fast-twitch, skeletal muscle) ENSG00000161547 17
72241796 72244837 3 SFRS2 splicing factor, splicing factor
arginine/serine- rich 2 ENSG00000105329 19 46528254 46551628 1
TGFB1 transforming TGFbeta growth factor, beta 1 (Camurati-
Engelmann disease) ENSG00000102265 X 47326634 47331132 4 TIMP1 TIMP
TIMPs metallopeptidase inhibitor 1 ENSG00000035862 17 74360658
74433067 1 TIMP2 TIMP TIMPs metallopeptidase inhibitor 2
ENSG00000100234 22 31526802 31589025 2 TIMP3 TIMP TIMPs
metallopeptidase inhibitor 3 (Sorsby fundus dystrophy,
pseudoinflammatory) ENSG00000157150 3 12169578 12175851 1 TIMP4
TIMP TIMPs metallopeptidase inhibitor 4 ENSG00000109320 4 103641518
103757506 1 NFKB1 nuclear factor of CAD, transcription kappa light
inflammation factor
polypeptide gene enhancer in B- cells 1 (p105) ENSG00000049247 1
7825731 7836161 3 UTS2 urotensin 2 secreted vasoactive protein
peptide with vasoactive properties; altered expression in HF
ENSG00000078401 6 12398582 12405413 1 EDN1 endothelin 1
vasoconstrictor peptide ENSG00000106125 7 30917993 30931656 3 AQP1
aquaporin 1 water channel (Colton blood group) ENSG00000145740 5
68425839 68462648 2 SLC30A5 solute carrier involved zinc
transporter family 30 (zinc in transporter), maintenance member 5
of the cells involved in the cardiac conduction system
TABLE-US-00015 TABLE 13 Chromo- Start End Ensembl Gene ID some
Position Position Transcript HGNC Ver 42 Name (bp) (bp) count
Symbol Gene Name ENSG00000002330 11 63793878 63808740 1 BAD
BCL2-antagonist of cell death ENSG00000004776 19 40937336 40939799
1 HSPB6 heat shock protein, alpha-crystallin-related, B6
ENSG00000005893 X 119446367 119487189 3 LAMP2 lysosomal-associated
membrane protein 2 ENSG00000006283 17 45993820 46059541 6 CACNA1G
calcium channel, voltage-dependent, alpha 1G subunit
ENSG00000006695 17 13913444 14052712 1 COX10 COX10 homolog,
cytochrome c oxidase assembly protein, heme A: farnesyltransferase
(yeast) ENSG00000007314 17 59369646 59404010 1 SCN4A sodium
channel, voltage-gated, type IV, alpha ENSG00000007402 3 50375237
50516032 2 CACNA2D2 calcium channel, voltage-dependent, alpha
2/delta subunit 2 ENSG00000014919 10 101461591 101482413 2 COX15
COX15 homolog, cytochrome c oxidase assembly protein (yeast)
ENSG00000017427 12 101313809 101398471 2 IGF1 insulin-like growth
factor 1 (somatomedin C) ENSG00000018625 1 158352172 158379996 2
ATP1A2 ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide
ENSG00000035403 10 75427878 75549924 2 VCL vinculin ENSG00000035862
17 74360658 74433067 1 TIMP2 TIMP metallopeptidase inhibitor 2
ENSG00000043591 10 115793796 115796657 2 ADRB1 adrenergic, beta-1-,
receptor ENSG00000049247 1 7825731 7836161 3 UTS2 urotensin 2
ENSG00000053918 11 2422797 2826915 4 KCNQ1 potassium voltage-gated
channel, KQT-like subfamily, member 1 ENSG00000055118 7 150272982
150306121 3 KCNH2 potassium voltage-gated channel, subfamily H
(eag-related), member 2 ENSG00000056345 1 17 42686207 42745076
ITGB3 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)
ENSG00000057294 12 32834954 32941041 2 PKP2 plakophilin 2
ENSG00000057593 2 13 112808106 112822996 F7 coagulation factor VII
(serum prothrombin conversion accelerator) ENSG00000064012 2
201806426 201860677 9 CASP8 caspase 8, apoptosis-related cysteine
peptidase ENSG00000065559 17 11864866 11987865 1 MAP2K4
mitogen-activated protein kinase kinase 4 ENSG00000067191 17
34583232 34607427 2 CACNB1 calcium channel, voltage-dependent, beta
1 subunit ENSG00000068305 15 97923712 98074131 3 MEF2A MADS box
transcription enhancer factor 2, polypeptide A (myocyte enhancer
factor 2A) ENSG00000069424 1 5974113 6083840 8 KCNAB2 potassium
voltage-gated channel, shaker-related subfamily, beta member 2
ENSG00000069431 12 21845245 21985434 4 ABCC9 ATP-binding cassette,
sub-family C (CFTR/MRP), member 9 ENSG00000072062 19 14063509
14089559 2 PRKACA protein kinase, cAMP-dependent, catalytic, alpha
ENSG00000072110 14 68410793 68515747 1 ACTN1 actinin, alpha 1
ENSG00000073578 5 271356 309815 3 SDHA succinate dehydrogenase
complex, subunit A, flavoprotein (Fp) ENSG00000073711 3 137167257
137349423 2 PPP2R3A protein phosphatase 2 (formerly 2A), regulatory
subunit B", alpha ENSG00000073905 5 133335506 133368723 1 VDAC1
voltage-dependent anion channel 1 ENSG00000074201 11 77004847
77026495 1 CLNS1A chloride channel, nucleotide-sensitive, 1A
ENSG00000074582 2 219231772 219236399 1 BCS1L BCS1-like (yeast)
ENSG00000077549 1 19537857 19684594 5 CAPZB Capping protein (actin
filament) muscle Z-line, beta ENSG00000078401 6 12398582 12405413 1
EDN1 endothelin 1 ENSG00000080815 14 72672915 72756862 4 PSEN1
presenilin 1 (Alzheimer disease 3) ENSG00000081189 5 88051922
88214818 2 MEF2C MADS box transcription enhancer factor 2,
polypeptide C (myocyte enhancer factor 2C) ENSG00000082701 3
121028238 121295954 2 GSK3B glycogen synthase kinase 3 beta
ENSG00000087088 19 54149929 54156864 5 BAX BCL2-associated X
protein ENSG00000087245 16 54070589 54098101 1 MMP2 matrix
metallopeptidase 2 (gelatinase A, 72 kDa gelatinase, 72 kDa type IV
collagenase) ENSG00000088832 20 1297625 1321806 4 FKBP1A FK506
binding protein 1A, 12 kDa ENSG00000089225 12 113276119 113330630 3
TBX5 T-box 5 ENSG00000089250 12 116135362 116283965 3 NOS1 nitric
oxide synthase 1 (neuronal) ENSG00000090020 1 27297893 27366059 4
SLC9A1 solute carrier family 9 (sodium/hydrogen exchanger), member
1 (antiporter, Na+/H+, amiloride sensitive) ENSG00000091140 7
107318847 107347645 1 DLD dihydrolipoamide dehydrogenase (E3
component of pyruvate dehydrogenase complex, 2-oxo-glutarate
complex, branched chain keto acid dehydrogenase complex)
ENSG00000092009 14 24044552 24047311 2 CMA1 chymase 1, mast cell
ENSG00000092054 14 22951789 22974690 2 MYH7 myosin, heavy
polypeptide 7, cardiac muscle, beta ENSG00000095015 5 56147216
56225472 1 MAP3K1 mitogen-activated protein kinase kinase kinase 1
ENSG00000096696 6 7486869 7531945 1 DSP desmoplakin ENSG00000096968
9 4975245 5118183 1 JAK2 Janus kinase 2 (a protein tyrosine kinase)
ENSG00000099337 19 43502322 43511480 1 KCNK6 potassium channel,
subfamily K, member 6 ENSG00000099822 19 540893 568157 1 HCN2
hyperpolarization activated cyclic nucleotide-gated potassium
channel 2 ENSG00000100030 22 20446873 20551730 1 MAPK1
mitogen-activated protein kinase 1 ENSG00000100077 22 24290946
24449916 1 ADRBK2 adrenergic, beta, receptor kinase 2
ENSG00000100234 22 31526802 31589025 2 TIMP3 TIMP metallopeptidase
inhibitor 3 (Sorsby fundus dystrophy, pseudoinflammatory)
ENSG00000100985 20 44070954 44078607 1 MMP9 matrix metallopeptidase
9 (gelatinase B, 92 kDa gelatinase, 92 kDa type IV collagenase)
ENSG00000101096 20 49441083 49592665 2 NFATC2 nuclear factor of
activated T-cells, cytoplasmic, calcineurin-dependent 2
ENSG00000101400 20 31459424 31495359 1 SNTA1 syntrophin, alpha 1
(dystrophin-associated protein A1, 59 kDa, acidic component)
ENSG00000102265 X 47326634 47331132 4 TIMP1 TIMP metallopeptidase
inhibitor 1 ENSG00000103546 16 54248057 54296685 3 SLC6A2 solute
carrier family 6 (neurotransmitter transporter, noradrenalin),
member 2 ENSG00000104936 19 50965579 50977469 6 DMPK dystrophia
myotonica-protein kinase ENSG00000105329 19 46528254 46551628 1
TGFB1 transforming growth factor, beta 1 (Camurati-Engelmann
disease) ENSG00000105711 19 40213374 40223192 1 SCN1B sodium
channel, voltage-gated, type I, beta ENSG00000105866 7 21434214
21520674 1 SP4 Sp4 transcription factor ENSG00000106125 7 30917993
30931656 3 AQP1 aquaporin 1 (Colton blood group) ENSG00000106617 7
150884960 151204728 1 PRKAG2 protein kinase, AMP-activated, gamma 2
non-catalytic subunit ENSG00000108064 10 59814788 59828987 2 TFAM
transcription factor A, mitochondrial ENSG00000108509 17 4812017
4831671 5 CAMTA2 calmodulin binding transcription activator 2
ENSG00000108691 17 29606409 29608329 1 CCL2 chemokine (C-C motif)
ligand 2 ENSG00000108819 17 45567695 45582873 1 PPP1R9B protein
phosphatase 1, regulatory subunit 9B, spinophilin ENSG00000108821
17 45616456 45633992 1 COL1A1 collagen, type I, alpha 1
ENSG00000108840 17 39509647 39556540 2 HDAC5 histone deacetylase 5
ENSG00000109320 4 103641518 103757506 1 NFKB1 nuclear factor of
kappa light polypeptide gene enhancer in B-cells 1 (p105)
ENSG00000109572 4 170778297 170878731 2 CLCN3 chloride channel 3
ENSG00000109846 11 111284560 111287704 1 CRYAB crystallin, alpha B
ENSG00000109971 11 122433411 122438054 1 HSPA8 heat shock 70 kDa
protein 8 ENSG00000110536 11 47543464 47562690 3 NDUFS3 NADH
dehydrogenase (ubiquinone) Fe--S protein 3, 30 kDa (NADH-coenzyme Q
reductase) ENSG00000110717 11 67554670 67560686 1 NDUFS8 NADH
dehydrogenase (ubiquinone) Fe--S protein 8, 23 kDa (NADH-coenzyme Q
reductase) ENSG00000111245 12 109833009 109842766 1 MYL2 myosin,
light polypeptide 2, regulatory, cardiac, slow ENSG00000111262 12
4890806 4892293 1 KCNA1 potassium voltage-gated channel,
shaker-related subfamily, member 1 (episodic ataxia with myokymia)
ENSG00000111537 12 66834816 66839790 1 IFNG interferon, gamma
ENSG00000111664 12 6820713 6826819 2 GNB3 guanine nucleotide
binding protein (G protein), beta polypeptide 3 ENSG00000112062 6
36103551 36186513 3 MAPK14 mitogen-activated protein kinase 14
ENSG00000112096 6 160020138 160034343 3 SOD2 superoxide dismutase
2, mitochondrial ENSG00000112293 6 24536384 24597829 2 GPLD1
glycosylphosphatidylinositol specific phospholipase D1
ENSG00000112715 6 43845924 43862202 8 VEGFA vascular endothelial
growth factor A ENSG00000113448 5 58305622 59320301 5 PDE4D
phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce
homolog, Drosophila) ENSG00000113520 5 132037272 132046267 4 IL4
interleukin 4 ENSG00000113594 5 38510823 38631253 1 LIFR leukemia
inhibitory factor receptor alpha ENSG00000114302 3 48762099
48860274 2 PRKAR2A protein kinase, cAMP-dependent, regulatory, type
II, alpha ENSG00000114353 3 50239173 50271775 3 GNAI2 guanine
nucleotide binding protein (G protein), alpha inhibiting activity
polypeptide 2 ENSG00000114854 3 52460158 52463098 1 TNNC1 troponin
C type 1 (slow) ENSG00000115286 19 1334883 1346583 3 NDUFS7 NADH
dehydrogenase(ubiquinone) Fe--S protein 7, 20 kDa (NADH-coenzyme Q
reductase) ENSG00000115414 2 215933409 216009041 10 FN1 fibronectin
1 ENSG00000115641 2 105343717 105421392 4 FHL2 four and a half LIM
domains 2 ENSG00000117525 2 1 94767369 94779944 F3 coagulation
factor III (thromboplastin, tissue factor) ENSG00000117594 1
207926133 207974918 3 HSD11B1 hydroxysteroid (11-beta)
dehydrogenase 1 ENSG00000118160 19 52623735 52666934 1 SLC8A2
solute carrier family 8 (sodium-calcium exchanger), member 2
ENSG00000118194 1 199594759 199613431 10 TNNT2 troponin T type 2
(cardiac) ENSG00000118729 1 116044151 116112925 1 CASQ2
calsequestrin 2 (cardiac muscle) ENSG00000118785 4 89115890
89123592 3 SPP1 secreted phosphoprotein 1 (osteopontin, bone
sialoprotein I, early T-lymphocyte activation 1) ENSG00000119782 2
24126075 24140055 4 FKBP1B FK506 binding protein 1B, 12.6 kDa
ENSG00000120049 10 103575721 103593667 12 KCNIP2 Kv channel
interacting protein 2 ENSG00000120457 11 128266517 128293159 1
KCNJ5 potassium inwardly-rectifying channel, subfamily J, member 5
ENSG00000120907 8 26661584 26778839 12 ADRA1A adrenergic,
alpha-1A-, receptor ENSG00000120937 1 11840108 11841575 2 NPPB
natriuretic peptide precursor B ENSG00000121361 12 21809156
21819014 1 KCNJ8 potassium inwardly-rectifying channel, subfamily
J, member 8 ENSG00000121933 1 111827493 111908107 6 ADORA3
adenosine A3 receptor ENSG00000123104 12 26381609 26877347 2 ITPR2
inositol 1,4,5-triphosphate receptor, type 2 ENSG00000123700 17
65677271 65687755 1 KCNJ2 potassium inwardly-rectifying channel,
subfamily J, member 2 ENSG00000124491 2 6 6089317 6265901 F13A1
coagulation factor XIII, A1 polypeptide ENSG00000125538 2 113303808
113310827 1 IL1B interleukin 1, beta ENSG00000127914 7 91408128
91577925 6 AKAP9 A kinase (PRKA) anchor protein (yotiao) 9
ENSG00000128271 22 23153537 23168309 2 ADORA2A adenosine A2a
receptor ENSG00000129170 11 19160154 19180177 1 CSRP3 cysteine and
glycine-rich protein 3 (cardiac LIM protein) ENSG00000129991 19
60355014 60360496 1 TNNI3 troponin I type 3 (cardiac)
ENSG00000130037 12 5023346 5026210 1 KCNA5 potassium
voltage-gated
channel, shaker-related subfamily, member 5 ENSG00000130522 19
18252251 18253294 1 JUND jun D proto-oncogene ENSG00000131187 3 5
176761747 176769183 F12 coagulation factor XII (Hageman factor)
ENSG00000131828 X 19271968 19289724 5 PDHA1 pyruvate dehydrogenase
(lipoamide) alpha 1 ENSG00000132693 1 157948703 157951003 5 CRP
C-reactive protein, pentraxin-related ENSG00000133019 1 237859012
238145373 2 CHRM3 cholinergic receptor, muscarinic 3
ENSG00000133216 1 22910045 23114405 4 EPHB2 EPH receptor B2
ENSG00000134352 5 55266680 55326529 8 IL6ST interleukin 6 signal
transducer (gp130, oncostatin M receptor) ENSG00000134571 11
47309527 47330806 1 MYBPC3 myosin binding protein C, cardiac
ENSG00000134755 18 26900005 26936375 2 DSC2 desmocollin 3
ENSG00000134769 18 30327279 30725341 6 DTNA dystrobrevin, alpha
ENSG00000135047 9 89530254 89536127 3 CTSL cathepsin L
ENSG00000135447 12 53257439 53268723 2 PPP1R1A protein phosphatase
1, regulatory (inhibitor) subunit 1A ENSG00000135486 12 52960755
52965297 2 HNRPA1 heterogeneous nuclear ribonucleoprotein A1
ENSG00000135744 1 228904892 228916666 1 AGT angiotensinogen (serpin
peptidase inhibitor, clade A, member 8) ENSG00000135750 1 231816373
231874881 3 KCNK1 potassium channel, subfamily K, member 1
ENSG00000136238 7 6380651 6410120 2 RAC1 ras-related C3 botulinum
toxin substrate 1 (rho family, small GTP binding protein Rac1)
ENSG00000136244 7 22732028 22738091 1 IL6 interleukin 6
(interferon, beta 2) ENSG00000136450 17 53437651 53439593 2 SFRS1
splicing factor, arginine/serine-rich 1 (splicing factor 2,
alternate splicing factor) ENSG00000136574 8 11599122 11654920 3
GATA4 GATA binding protein 4 ENSG00000136634 1 205007570 205012462
1 IL10 interleukin 10 ENSG00000136842 9 99303742 99403357 2 TMOD1
tropomodulin 1 ENSG00000137076 9 35687336 35722369 6 TLN1 talin 1
ENSG00000137462 4 154842102 154846301 1 TLR2 toll-like receptor 2
ENSG00000137745 11 102318937 102331672 2 MMP13 matrix
metallopeptidase 13 (collagenase 3) ENSG00000137808 15 67094125
67136516 2 NOX5 NADPH oxidase, EF-hand calcium binding domain 5
ENSG00000138095 2 43968391 44076648 3 LRPPRC leucine-rich PPR-motif
containing ENSG00000138622 15 71400988 71448230 1 HCN4
hyperpolarization activated cyclic nucleotide-gated potassium
channel 4 ENSG00000138685 4 123967313 124038840 1 FGF2 fibroblast
growth factor 2 (basic) ENSG00000138814 4 102163610 102487376 1
PPP3CA protein phosphatase 3 (formerly 2B), catalytic subunit,
alpha isoform (calcineurin A alpha) ENSG00000139133 12 34066483
34072501 1 ALG10A asparagine-linked glycosylation 10 homolog
(yeast, alpha-1,2-glucosyltransferase) ENSG00000140416 15 61121891
61151164 7 TPM1 tropomyosin 1 (alpha) ENSG00000140564 15 89212889
89227691 1 FURIN furin (paired basic amino acid cleaving enzyme)
ENSG00000141646 18 46810611 46860142 1 SMAD4 SMAD family member 4
ENSG00000142208 14 104306734 104333125 1 AKT1 v-akt murine thymoma
viral oncogene homolog 1 ENSG00000142871 1 85819005 85822233 2
CYR61 cysteine-rich, angiogenic inducer, 61 ENSG00000143105 1
110861396 110862983 2 KCNA10 potassium voltage-gated channel,
shaker-related subfamily, member 10 ENSG00000143140 1 145695517
145712066 2 GJA5 gap junction protein, alpha 5, 40 kDa (connexin
40) ENSG00000143153 1 167341559 167368584 3 ATP1B1 ATPase, Na+/K+
transporting, beta 1 polypeptide ENSG00000143318 1 158426970
158438300 2 CASQ1 calsequestrin 1 (fast-twitch, skeletal muscle)
ENSG00000143933 2 47240736 47257140 1 CALM2 calmodulin 2
(phosphorylase kinase, delta) ENSG00000144285 2 166553919 166638395
3 SCN1A sodium channel, voltage-gated, type I, alpha
ENSG00000144891 3 149898355 149943478 1 AGTR1 angiotensin II
receptor, type 1 ENSG00000145349 4 114593022 114902177 4 CAMK2D
calcium/calmodulin-dependent protein kinase (CaM kinase) II delta
ENSG00000145362 4 114190319 114524334 4 ANK2 ankyrin 2, neuronal
ENSG00000145740 5 68425839 68462648 2 SLC30A5 solute carrier family
30 (zinc transporter), member 5 ENSG00000146070 6 46779897 46811389
2 PLA2G7 phospholipase A2, group VII (platelet-activating factor
acetylhydrolase, plasma) ENSG00000147044 X 41259131 41667660 8 CASK
calcium/calmodulin-dependent serine protein kinase (MAGUK family)
ENSG00000147166 X 70438309 70441946 1 ITGB1BP2 integrin beta 1
binding protein (melusin) 2 ENSG00000148290 9 135208431 135213182 1
SURF1 surfeit 1 ENSG00000148677 10 92661833 92671013 1 ANKRD1
ankyrin repeat domain 1 (cardiac muscle) ENSG00000148926 11
10283172 10285491 1 ADM adrenomedullin ENSG00000149575 11 117538729
117552546 1 SCN2B sodium channel, voltage-gated, type II, beta
ENSG00000149596 20 42173749 42249632 2 JPH2 junctophilin 2
ENSG00000149968 11 102211738 102219552 1 MMP3 matrix
metallopeptidase 3 (stromelysin 1, progelatinase) ENSG00000150281
16 30815429 30822381 1 CTF1 cardiotrophin 1 ENSG00000150594 10
112826911 112830655 2 ADRA2A adrenergic, alpha-2A-, receptor
ENSG00000150995 3 4510136 4863432 4 ITPR1 inositol
1,4,5-triphosphate receptor, type 1 ENSG00000151062 12 1771384
1898131 2 CACNA2D4 calcium channel, voltage-dependent, alpha
2/delta subunit 4 ENSG00000151067 12 2094650 2670626 5 CACNA1C
calcium channel, voltage-dependent, L type, alpha 1C subunit
ENSG00000151079 12 4789372 4791132 3 KCNA6 potassium voltage-gated
channel, shaker-related subfamily, member 6 ENSG00000151150 10
61458165 61819494 6 ANK3 ankyrin 3, node of Ranvier (ankyrin G)
ENSG00000151320 14 31868274 32372018 1 AKAP6 A kinase (PRKA) anchor
protein 6 ENSG00000151623 4 149219370 149582973 4 NR3C2 nuclear
receptor subfamily 3, group C, member 2 ENSG00000151704 11
128213125 128242478 2 KCNJ1 potassium inwardly-rectifying channel,
subfamily J, member 1 ENSG00000151729 4 186301392 186305418 1
SLC25A4 solute carrier family 25 (mitochondrial carrier; adenine
nucleotide translocator), member 4 ENSG00000152049 2 223625171
223626872 1 KCNE4 potassium voltage-gated channel, lsk-related
family, member 4 ENSG00000152413 5 78707505 78788599 2 HOMER1 homer
homolog 1 (Drosophila) ENSG00000152661 6 121798487 121812571 1 GJA1
gap junction protein, alpha 1, 43 kDa (connexin 43) ENSG00000153253
2 165652286 165768799 4 SCN3A sodium channel, voltage-gated, type
III, alpha ENSG00000153956 7 81417354 81910967 3 CACNA2D1 calcium
channel, voltage-dependent, alpha 2/delta subunit 1 ENSG00000154229
17 61729388 62237324 1 PRKCA protein kinase C, alpha
ENSG00000154358 1 226462454 226633198 9 OBSCN obscurin,
cytoskeletal calmodulin and titin-interacting RhoGEF
ENSG00000155657 2 179099985 179380394 12 TTN titin ENSG00000156475
5 145949265 146415783 2 PPP2R2B protein phosphatase 2 (formerly
2A), regulatory subunit B (PR 52), beta isoform ENSG00000157150 3
12169578 12175851 1 TIMP4 TIMP metallopeptidase inhibitor 4
ENSG00000157227 14 22375676 22385088 1 MMP14 matrix
metallopeptidase 14 (membrane-inserted) ENSG00000157388 3 53503723
53821112 2 CACNA1D calcium channel, voltage-dependent, L type,
alpha 1D subunit ENSG00000157445 3 54131733 55083622 1 CACNA2D3
calcium channel, voltage-dependent, alpha 2/delta 3 subunit
ENSG00000158022 1 26250382 26266711 1 TRIM63 tripartite
motif-containing 63 ENSG00000158125 2 31410691 31491117 2 XDH
xanthine dehydrogenase ENSG00000158445 20 47418353 47532591 1 KCNB1
potassium voltage-gated channel, Shab-related subfamily, member 1
ENSG00000159197 21 34658193 34665307 1 KCNE2 potassium
voltage-gated channel, lsk-related family, member 2 ENSG00000159251
15 32869724 32875181 1 ACTC1 actin, alpha, cardiac muscle
ENSG00000159640 17 58908166 58938721 2 ACE angiotensin I converting
enzyme (peptidyl-dipeptidase A) 1 ENSG00000160014 19 51796352
51805878 1 CALM3 calmodulin 3 (phosphorylase kinase, delta)
ENSG00000160789 1 154318993 154376504 9 LMNA lamin A/C
ENSG00000160808 3 46874371 46879938 1 MYL3 myosin, light
polypeptide 3, alkali; ventricular, skeletal, slow ENSG00000161547
17 72241796 72244837 3 SFRS2 splicing factor, arginine/serine-rich
2 ENSG00000161570 17 31222613 31231490 1 CCL5 chemokine (C-C motif)
ligand 5 ENSG00000162989 2 155263339 155421260 1 KCNJ3 potassium
inwardly-rectifying channel, subfamily J, member 3 ENSG00000163399
1 116717359 116754301 4 ATP1A1 ATPase, Na+/K+ transporting, alpha 1
polypeptide ENSG00000163485 1 201326405 201403156 4 ADORA1
adenosine A1 receptor ENSG00000164056 4 124537406 124544357 1 SPRY1
sprouty homolog 1, antagonist of FGF signaling (Drosophila)
ENSG00000164171 1 5 52321014 52423805 ITGA2 integrin, alpha 2
(CD49B, alpha 2 subunit of VLA-2 receptor) ENSG00000164258 5
52892226 53014925 2 NDUFS4 NADH dehydrogenase (ubiquinone) Fe--S
protein 4, 18 kDa (NADH-coenzyme Q reductase) ENSG00000164305 4
185785845 185807623 2 CASP3 caspase 3, apoptosis-related cysteine
peptidase ENSG00000164588 5 45297730 45731977 1 HCN1
hyperpolarization activated cyclic nucleotide- gated potassium
channel 1 ENSG00000165119 9 85772818 85785339 8 HNRPK heterogeneous
nuclear ribonucleoprotein K ENSG00000165995 10 18469612 18870797 9
CACNB2 calcium channel, voltage-dependent, beta 2 subunit
ENSG00000166068 15 36331808 36433526 1 SPRED1 sprouty-related, EVH1
domain containing 1 ENSG00000166257 11 123005107 123030165 1 SCN3B
sodium channel, voltage-gated, type III, beta ENSG00000166501 16
23754823 24139358 2 PRKCB1 protein kinase C, beta 1 ENSG00000166949
15 65145249 65274586 1 SMAD3 SMAD family member 3 ENSG00000167535
12 47498779 47508991 1 CACNB3 calcium channel, voltage-dependent,
beta 3 subunit ENSG00000167792 11 67130974 67136581 1 NDUFV1 NADH
dehydrogenase (ubiquinone) flavoprotein 1, 51 kDa ENSG00000168028 3
39423208 39429034 1 RPSA ribosomal protein SA (LAMR1)
ENSG00000168135 22 37152278 37181149 1 KCNJ4 potassium
inwardly-rectifying channel, subfamily J, member 4 ENSG00000168542
2 189547344 189585717 2 COL3A1 collagen, type III, alpha 1
(Ehlers-Danlos syndrome type IV, autosomal dominant)
ENSG00000168610 17 37718869 37794039 5 STAT3 signal transducer and
activator of transcription 3 (acute-phase response factor)
ENSG00000168807 16 67778533 67892379 2 SNTB2 syntrophin, beta 2
(dystrophin-associated protein A1, 59 kDa, basic component 2)
ENSG00000169252 5 148185001 148188447 1 ADRB2 adrenergic, beta-2-,
receptor, surface ENSG00000169282 3 157321095 157739237 10 KCNAB1
potassium voltage-gated channel, shaker-related subfamily, beta
member 1 ENSG00000169418 1 151917737 151933092 2 NPR1 natriuretic
peptide receptor A/guanylate cyclase A (atrionatriuretic peptide
receptor A) ENSG00000169432 2 166763060 166876560 2 SCN9A sodium
channel, voltage-gated, type IX, alpha ENSG00000169562 X 70351769
70362091 3 GJB1 gap junction protein, beta 1, 32 kDa (connexin 32,
Charcot-Marie-Tooth neuropathy, X-linked) ENSG00000169564 2
70168090 70169766 1 PCBP1 poly(rC) binding protein 1
ENSG00000170049 17 7765902 7773478 2 KCNAB3 potassium voltage-gated
channel, shaker-related subfamily, beta member 3 ENSG00000170214 5
159276318 159332595 1 ADRA1B adrenergic, alpha-1B-, receptor
ENSG00000170290 11 107083319 107087992 1 SLN sarcolipin
ENSG00000170425 17 15788956 15819935 1 ADORA2B adenosine A2b
receptor ENSG00000170624 5 155686334 156125623 1 SGCD sarcoglycan,
delta (35 kDa dystrophin- associated glycoprotein) ENSG00000170776
15 83578821 84093590 3 AKAP13 A kinase (PRKA) anchor
protein 13 ENSG00000170962 11 103283131 103540317 1 PDGFD platelet
derived growth factor D ENSG00000171303 2 26769123 26806207 1 KCNK3
potassium channel, subfamily K, member 3 ENSG00000171385 1
112114807 112333300 3 KCND3 potassium voltage-gated channel,
Shal-related subfamily, member 3 ENSG00000171497 4 159849730
159864002 1 PPID peptidylprolyl isomerase D (cyclophilin D)
ENSG00000171552 20 29715916 29774366 4 BCL2L1 BCL2-like 1
ENSG00000171564 1 4 155703596 155711683 FGB fibrinogen beta chain
ENSG00000171786 1 158603481 158609262 1 NHLH1 nescient helix loop
helix 1 ENSG00000171873 20 4149329 4177659 1 ADRA1D adrenergic,
alpha-1D-, receptor ENSG00000172164 8 121619297 121893264 1 SNTB1
syntrophin, beta 1 (dystrophin-associated protein A1, 59 kDa, basic
component 1) ENSG00000172270 19 462896 534492 3 BSG basigin (Ok
blood group) ENSG00000172399 4 120276469 120328383 1 MYOZ2 myozenin
2 ENSG00000172531 11 66922228 66925978 3 PPP1CA protein phosphatase
1, catalytic subunit, alpha isoform ENSG00000173020 11 66790507
66810602 1 ADRBK1 adrenergic, beta, receptor kinase 1
ENSG00000173801 17 37164412 37196476 1 JUP junction plakoglobin
ENSG00000173991 17 35073966 35076326 1 TCAP titin-cap (telethonin)
ENSG00000174437 12 109203815 109273278 3 ATP2A2 ATPase, Ca++
transporting, cardiac muscle, slow twitch 2 ENSG00000175084 2
219991343 219999705 2 DES desmin ENSG00000175387 18 43618435
43711221 2 SMAD2 SMAD family member 2 ENSG00000175538 11 73843536
73856186 1 KCNE3 potassium voltage-gated channel, lsk-related
family, member 3 ENSG00000175548 12 36996824 37001523 1 ALG10B
asparagine-linked glycosylation 10 homolog B (yeast,
alpha-1,2-glucosyltransferase) (KCR1) ENSG00000176076 X 108753585
108755057 2 KCNE1L KCNE1-like ENSG00000177000 4 1 11768367 11788702
MTHFR 5,10-methylenetetrahydrofolate reductase (NADPH)
ENSG00000177098 11 117509302 117528747 1 SCN4B sodium channel,
voltage-gated, type IV, beta ENSG00000177885 17 70825753 70913384 2
GRB2 growth factor receptor-bound protein 2 ENSG00000179142 8
143988983 143996261 1 CYP11B2 cytochrome P450, family 11, subfamily
B, polypeptide 2 ENSG00000179295 12 111340919 111432099 1 PTPN11
protein tyrosine phosphatase, non-receptor type 11 (Noonan syndrome
1) ENSG00000180210 3 11 46697331 46717631 F2 coagulation factor II
(thrombin) ENSG00000180509 21 34740858 34806443 1 KCNE1 potassium
voltage-gated channel, lsk-related family, member 1 ENSG00000180733
8 48812794 48813235 1 CEBPD CCAAT/enhancer binding protein (C/EBP),
delta ENSG00000180817 10 71632592 71663196 2 PPA1 pyrophosphatase
(inorganic) 1 ENSG00000181210 2 96202419 96203762 ADRA2B
adrenergic, alpha-2B-, receptor ENSG00000182255 11 29988341
29995064 1 KCNA4 potassium voltage-gated channel, shaker-related
subfamily, member 4 ENSG00000182389 2 S 152663771 1 CACNB4 calcium
channel, voltage-dependent, beta 4 subunit ENSG00000182450 11
63815770 63828817 1 KCNK4 potassium channel, subfamily K, member 4
ENSG00000182533 3 8750253 8763451 2 CAV3 caveolin 3 ENSG00000182687
17 71582479 71585168 1 GALR2 galanin receptor 2 ENSG00000182963 17
40237146 40263707 1 GJA7 gap junction protein, alpha 7, 45 kDa
(connexin 45) ENSG00000183023 2 40192790 40534188 5 SLC8A1 solute
carrier family 8 (sodium/calcium exchanger), member 1
ENSG00000183072 5 172591744 172594868 1 NKX2-5 NK2 transcription
factor related, locus 5 (Drosophila) ENSG00000183873 3 38564558
38666167 2 SCN5A sodium channel, voltage-gated, type V, alpha (long
QT syndrome 3) ENSG00000184160 4 3738094 3740051 ADRA2C adrenergic,
alpha-2C-, receptor ENSG00000184185 17 21220292 21260983 1 KCNJ12
potassium inwardly-rectifying channel, subfamily J, member 12
ENSG00000184408 7 119701923 120175148 1 KCND2 potassium
voltage-gated channel, Shal-related subfamily, member 2
ENSG00000186439 6 123579183 123999937 5 TRDN triadin
ENSG00000187486 11 17365042 17366214 1 KCNJ11 potassium
inwardly-rectifying channel, subfamily J, member 11 ENSG00000188386
9 103393718 103397104 2 PPP3R2 protein phosphatase 3 (formerly 2B),
regulatory subunit B, beta isoform ENSG00000188389 2 242440711
242449731 2 PDCD1 programmed cell death 1 ENSG00000188778 8
37939673 37943341 1 ADRB3 adrenergic, beta-3-, receptor
ENSG00000196218 19 43616180 43770012 5 RYR1 ryanodine receptor 1
(skeletal) ENSG00000196296 16 28797310 28823331 1 ATP2A1 ATPase,
Ca++ transporting, cardiac muscle, fast twitch 1 ENSG00000196557 16
1143739 1211772 2 CACNA1H calcium channel, voltage-dependent, alpha
1H subunit ENSG00000196611 11 102165861 102174099 1 MMP1 matrix
metallopeptidase 1 (interstitial collagenase) ENSG00000197442 6
136919878 137155349 3 MAP3K5 mitogen-activated protein kinase
kinase kinase 5 ENSG00000197616 14 22921038 22946665 2 MYH6 myosin,
heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy,
hypertrophic 1) ENSG00000198216 1 179648918 180037339 6 CACNA1E
calcium channel, voltage-dependent, alpha 1E subunit
ENSG00000198363 8 62578374 62789681 11 ASPH aspartate
beta-hydroxylase ENSG00000198523 6 118976154 118988586 1 PLN
phospholamban ENSG00000198626 1 235272128 236063911 3 RYR2
ryanodine receptor 2 (cardiac) ENSG00000198668 14 89933120 89944158
CALM1 calmodulin 1 (phosphorylase kinase, delta) ENSG00000198734 3
1 167750028 167822450 F5 coagulation factor V (proaccelerin, labile
factor) ENSG00000198929 1 160306190 160604868 1 NOS1AP nitric oxide
synthase 1 (neuronal) adaptor protein ENSG00000198947 X 31047257
33267479 15 DMD dystrophin (muscular dystrophy, Duchenne and Becker
types) ENSG00000204490 6 31651314 31654092 1 TNF tumor necrosis
factor (TNF superfamily, member 2) NOT FOUND CLNS1B chloride
channel, nucleotide-sensitive, 1B NOT FOUND GP1BB glycoprotein Ib
(platelet), beta polypeptide NOT FOUND SERPINE1 serpin peptidase
inhibitor, clade E (nexin, plasminogen activator inhibitor type 1),
member 1
TABLE-US-00016 TABLE 14 pid coef stderr pval pval_holm pval_bonf
pval_fdr p_nc maf hwe SNP_A- -0.9697 0.1806 7.96e-08 0.0596 0.0596
0.0596 0.00304 0.0343 0.00511 2053054 SNP_A- -0.3608 0.07674
2.58e-06 1 1 0.241 0.0228 0.241 0.215 8370399 SNP_A- 0.9792 0.2108
3.4e-06 1 1 0.273 0 0.038 1 8631553 SNP_A- 0.5797 0.1339 1.49e-05 1
1 0.451 0.00456 0.111 0.233 8285583 SNP_A- -0.5908 0.137 1.62e-05 1
1 0.451 0 0.112 0.844 1854346 SNP_A- -0.9818 0.2343 2.79e-05 1 1
0.461 0.00152 0.0104 0.961 8647043 SNP_A- 0.542 0.1316 3.84e-05 1 1
0.465 0.00456 0.143 0.109 2183445 SNP_A- 0.7006 0.1763 7.1e-05 1 1
0.539 0.0365 0.0536 0.699 8530310 SNP_A- -0.6793 0.1741 9.56e-05 1
1 0.563 0.00304 0.0655 1 8456423 SNP_A- 0.6486 0.1592 4.63e-05 1 1
0.487 0.00304 0.0716 0.133 8596066 SNP_A- 0.5127 0.1291 7.14e-05 1
1 0.539 0 0.138 1 8582554 SNP_A- -0.7061 0.1478 1.76e-06 1 1 0.241
0.00456 0.074 0.773 1967375 SNP_A- -1.429 0.2992 1.77e-06 1 1 0.241
0.00152 0.0145 1 8366760 SNP_A- 0.7065 0.147 1.54e-06 1 1 0.241
0.00456 0.0756 0.78 8478064 SNP_A- -0.8792 0.1859 2.27e-06 1 1
0.241 0.0258 0.0484 0.39 8349850 SNP_A- -0.4554 0.1244 0.000251 1 1
0.669 0.0167 0.237 0.277 8544970 SNP_A- 0.628 0.1608 9.41e-05 1 1
0.563 0 0.0714 0.132 1988493 SNP_A- 0.4471 0.1256 0.000371 1 1 0.69
0.00912 0.243 0.523 4265535 SNP_A- -0.4396 0.1239 0.000388 1 1 0.69
0 0.248 0.835 2080370 SNP_A- -0.4396 0.1239 0.000388 1 1 0.69 0
0.248 0.835 2092022 SNP_A- -0.3714 0.1048 0.000392 1 1 0.69 0.0076
0.252 0.0487 2202302 SNP_A- 0.4378 0.1234 0.000388 1 1 0.69 0.0182
0.254 0.678 1959929 SNP_A- -0.4403 0.1239 0.00038 1 1 0.69 0.0076
0.249 0.676 8668446 SNP_A- 0.4396 0.1239 0.000388 1 1 0.69 0.00304
0.248 0.835 8417654 SNP_A- 0.3838 0.09517 5.51e-05 1 1 0.494 0
0.366 0.675 8386477 SNP_A- -0.4256 0.1234 0.000562 1 1 0.722 0
0.247 0.916 1985257 SNP_A- 0.4256 0.1234 0.000562 1 1 0.722 0.00304
0.246 0.753 1896426 SNP_A- -0.7528 0.1626 3.64e-06 1 1 0.273 0.0167
0.0672 0.76 4272029 SNP_A- -0.9908 0.2372 2.96e-05 1 1 0.461 0
0.0274 1 2168866 SNP_A- -0.978 0.2373 3.76e-05 1 1 0.465 0 0.0281 1
1787940 SNP_A- -0.8545 0.2022 2.38e-05 1 1 0.461 0 0.0327 0.147
4224892 SNP_A- 0.5037 0.1061 2.06e-06 1 1 0.241 0 0.239 0.52
8470071 SNP_A- -0.4588 0.1025 7.62e-06 1 1 0.368 0 0.34 0.794
1803248 SNP_A- -0.4563 0.1015 6.93e-06 1 1 0.368 0 0.305 0.311
8565161 SNP_A- 1.103 0.2468 7.84e-06 1 1 0.368 0.0137 0.0247 0.324
8351277 SNP_A- -0.4254 0.1234 0.000564 1 1 0.722 0.00152 0.247 1
8668443 SNP_A- 1.008 0.3107 0.00118 1 1 0.81 0 0.0137 1 8421072
SNP_A- -0.3582 0.1046 0.000613 1 1 0.723 0.00152 0.254 0.0507
1842166 SNP_A- -0.4625 0.1223 0.000156 1 1 0.601 0.00152 0.15 0.879
4220021 SNP_A- 1.211 0.2522 1.56e-06 1 1 0.241 0.00456 0.0137 0.112
8299340 SNP_A- -0.853 0.2267 0.000168 1 1 0.614 0 0.0304 1 2152929
SNP_A- 0.7088 0.1825 0.000103 1 1 0.565 0 0.0479 1 1953240 SNP_A-
-0.8963 0.3249 0.00581 1 1 0.869 0.00608 0.0122 1 2002771 SNP_A-
0.2738 0.09666 0.00461 1 1 0.869 0 0.362 0.152 2047393 SNP_A-
-1.058 0.2454 1.63e-05 1 1 0.451 0.00152 0.0251 0.338 8672704
SNP_A- 0.4334 0.1028 2.47e-05 1 1 0.461 0.00152 0.423 0.381 8677651
SNP_A- -0.9755 0.233 2.84e-05 1 1 0.461 0 0.0236 0.0457 8493887
SNP_A- 0.4167 0.1014 3.98e-05 1 1 0.465 0 0.305 0.854 8490285
SNP_A- -0.9344 0.2193 2.04e-05 1 1 0.461 0.0213 0.0179 1.77e-05
2166983 SNP_A- 0.7738 0.1917 5.42e-05 1 1 0.494 0.00152 0.035 0.184
8658724 SNP_A- 0.4345 0.09654 6.77e-06 1 1 0.368 0.0304 0.416 0.745
8378831 SNP_A- -1 0.233 1.76e-05 1 1 0.451 0 0.0289 1 8296527
SNP_A- -1.181 0.3525 0.000805 1 1 0.757 0 0.0114 1 1972641 SNP_A-
-1.447 0.3273 9.84e-06 1 1 0.388 0 0.0114 1 8405569 SNP_A- 0.4402
0.1223 0.000318 1 1 0.67 0 0.15 1 2171537 SNP_A- 0.3237 0.1167
0.00553 1 1 0.869 0 0.185 1 4252168 SNP_A- 0.7064 0.2536 0.00535 1
1 0.869 0.0106 0.0276 1 8453740 SNP_A- -0.5536 0.1363 4.89e-05 1 1
0.487 0 0.207 0.906 4252121 SNP_A- 0.6841 0.1562 1.18e-05 1 1 0.42
0.0152 0.0633 1 2000347 SNP_A- 0.5262 0.1163 6e-06 1 1 0.368
0.00304 0.168 0.674 8510071 SNP_A- -0.4241 0.1166 0.000277 1 1 0.67
0 0.171 0.585 2083150 SNP_A- -0.4241 0.1166 0.000277 1 1 0.67 0
0.171 0.585 4235811 SNP_A- 0.3994 0.1084 0.00023 1 1 0.669 0.00304
0.351 0.494 8485648 SNP_A- -0.3243 0.08004 5.08e-05 1 1 0.487
0.0137 0.204 0.426 8356840 SNP_A- -0.4403 0.124 0.000382 1 1 0.69
0.0076 0.145 0.434 1834789 SNP_A- -0.5352 0.1198 7.87e-06 1 1 0.368
0.00152 0.164 0.669 8642499 SNP_A- 0.6073 0.1951 0.00185 1 1 0.812
0 0.0509 0.403 4205314 SNP_A- -0.4182 0.09718 1.68e-05 1 1 0.451
0.00152 0.413 0.748 2152506 SNP_A- -0.445 0.1347 0.000955 1 1 0.791
0.00152 0.112 0.844 8432970 SNP_A- -0.4461 0.1087 4.09e-05 1 1
0.469 0 0.209 0.558 8548394 SNP_A- -0.4188 0.09738 1.7e-05 1 1
0.451 0.00456 0.408 0.628 8681923 SNP_A- 0.535 0.1252 1.93e-05 1 1
0.461 0.0122 0.147 1 8630612 SNP_A- 0.6276 0.1442 1.34e-05 1 1
0.451 0 0.0775 0.58 4204345 SNP_A- -0.4092 0.09948 3.9e-05 1 1
0.465 0.0304 0.433 0.126 8398578 SNP_A- 0.4769 0.1082 1.05e-05 1 1
0.391 0 0.21 0.35 2243420 SNP_A- 0.4061 0.09686 2.76e-05 1 1 0.461
0 0.412 0.872 2052179 SNP_A- 0.4061 0.09686 2.76e-05 1 1 0.461 0
0.412 0.872 2059271 SNP_A- 0.6998 0.1682 3.16e-05 1 1 0.465 0.00152
0.0548 1 2206221 SNP_A- -0.404 0.09763 3.51e-05 1 1 0.465 0.00456
0.412 0.519 2262428 SNP_A- 0.3975 0.09696 4.14e-05 1 1 0.469
0.00304 0.412 0.809 1864375 SNP_A- -0.6269 0.1487 2.5e-05 1 1 0.461
0 0.189 1 1976890 SNP_A- 0.4365 0.1053 3.38e-05 1 1 0.465 0.00152
0.368 0.801 4287784 SNP_A- -0.4373 0.1052 3.22e-05 1 1 0.465
0.00304 0.37 0.867 1942320 SNP_A- 0.4885 0.1176 3.24e-05 1 1 0.465
0 0.185 0.605 8456608 SNP_A- 0.4549 0.1055 1.61e-05 1 1 0.451
0.0289 0.354 0.00562 8627377 SNP_A- 0.4048 0.09589 2.43e-05 1 1
0.461 0 0.408 0.687 8366937 SNP_A- -0.435 0.1055 3.71e-05 1 1 0.465
0 0.367 0.737 4273665 SNP_A- -0.468 0.1163 5.68e-05 1 1 0.494 0
0.281 0.7 4195397 SNP_A- -0.4406 0.09967 9.85e-06 1 1 0.388 0 0.486
0.938 2113673 AFFX- -0.4406 0.09967 9.85e-06 1 1 0.388 0 0.486
0.938 SNP_6891433 SNP_A- -1.072 0.2663 5.66e-05 1 1 0.494 0.0365
0.0142 1 1965187 SNP_A- -0.4025 0.09841 4.32e-05 1 1 0.482 0 0.467
0.938 1985390 SNP_A- 0.4147 0.1009 3.97e-05 1 1 0.465 0.0365 0.386
0.0189 2199372 SNP_A- -0.48 0.1162 3.61e-05 1 1 0.465 0.00152 0.167
0.483 2223920 SNP_A- -0.4278 0.1048 4.45e-05 1 1 0.487 0.0076 0.364
0.673 2075251 SNP_A- 0.4713 0.1161 4.95e-05 1 1 0.487 0 0.289 0.849
1965505 SNP_A- 0.4148 0.09835 2.47e-05 1 1 0.461 0.00608 0.393
0.461 8603804 SNP_A- -0.4013 0.09899 5.05e-05 1 1 0.487 0.0228
0.399 0.25 1962473 SNP_A- -0.387 0.1251 0.00198 1 1 0.823 0.0243
0.154 0.0684 8613839 SNP_A- -0.5053 0.1647 0.00215 1 1 0.835 0
0.0631 0.738 1957079 SNP_A- -0.7168 0.2356 0.00235 1 1 0.836
0.00912 0.0284 1 8432286 SNP_A- 0.4313 0.1071 5.64e-05 1 1 0.494 0
0.267 0.842 4288330 SNP_A- 0.4313 0.1071 5.64e-05 1 1 0.494 0.00304
0.266 0.92 4300393 SNP_A- -0.7276 0.1762 3.63e-05 1 1 0.465 0.00152
0.0609 1 8407616 SNP_A- -0.4113 0.1012 4.78e-05 1 1 0.487 0 0.271
0.139 1949138 SNP_A- -0.4552 0.1087 2.84e-05 1 1 0.461 0.00152
0.193 1 1908453 SNP_A- 0.4069 0.09902 3.97e-05 1 1 0.465 0.00152
0.464 0.875 8596473 SNP_A- 0.4498 0.1073 2.78e-05 1 1 0.461 0 0.177
0.143 2031097 SNP_A- 0.2804 0.09888 0.00457 1 1 0.869 0.0076 0.371
0.616 2144434 SNP_A- 0.2941 0.1179 0.0126 1 1 0.91 0 0.182 0.896
2110070 SNP_A- -0.4243 0.1048 5.18e-05 1 1 0.49 0 0.393 1 1902860
SNP_A- 0.7181 0.1707 2.58e-05 1 1 0.461 0 0.054 0.713 1868624
SNP_A- 0.3953 0.09746 4.99e-05 1 1 0.487 0.00152 0.396 0.684
2153320 SNP_A- -1.088 0.2551 1.99e-05 1 1 0.461 0.00608 0.0222 1
8569796 SNP_A- -0.4345 0.1066 4.56e-05 1 1 0.487 0.00152 0.193
0.167 8352538 SNP_A- 1.203 0.2895 3.23e-05 1 1 0.465 0.0334 0.0118
1 8479123 SNP_A- -0.5304 0.1269 2.92e-05 1 1 0.461 0.0122 0.142
0.872 8582717 SNP_A- 0.4471 0.1079 3.42e-05 1 1 0.465 0 0.255 0.918
8660563 SNP_A- -1.249 0.2979 2.73e-05 1 1 0.461 0 0.0122 1 8532464
SNP_A- 0.4107 0.1012 4.93e-05 1 1 0.487 0 0.421 0.0163 8611802
SNP_A- -0.6448 0.2793 0.0209 1 1 0.936 0.00304 0.0244 1 8669637
SNP_A- -0.4387 0.1023 1.81e-05 1 1 0.451 0.0137 0.442 0.0466
8662057 SNP_A- -0.3694 0.2244 0.0997 1 1 0.966 0.00152 0.0457 1
1925576 SNP_A- 0.397 0.09854 5.6e-05 1 1 0.494 0.00456 0.485 0.815
8399794 SNP_A- 0.9333 0.2289 4.56e-05 1 1 0.487 0 0.0228 0.287
2054062 pid chr position rsid npa_x odds_ratio isc_coef isc_stderr
isc_pval SNP_A- 4 96760067 rs17024266 FALSE 0.379 -1.064 0.2031
1.623e-07 2053054 SNP_A- X 28977674 rs5943590 TRUE 0.697 -0.4079
0.08998 5.801e-06 8370399 SNP_A- 1 155572157 rs1018615 FALSE 2.66
1.209 0.2724 9.096e-06 8631553 SNP_A- 9 82910311 rs953188 FALSE
1.79 0.77 0.1563 8.399e-07 8285583 SNP_A- 9 82948468 rs997020 FALSE
0.554 -0.7411 0.1622 4.897e-06 1854346 SNP_A- X 107557678 rs7060905
TRUE 0.375 -1.119 0.2371 2.371e-06 8647043 SNP_A- 9 82911335
rs10867699 FALSE 1.72 0.7339 0.1583 3.568e-06 2183445 SNP_A- 3
149836430 rs275697 FALSE 2.01 0.9483 0.208 5.121e-06 8530310 SNP_A-
13 94515499 rs4148536 FALSE 0.507 -0.9382 0.1922 1.057e-06 8456423
SNP_A- 6 166836302 rs12524741 FALSE 1.91 0.7753 0.177 1.183e-05
8596066 SNP_A- 9 82979213 rs2809841 FALSE 1.67 0.6885 0.1568
1.121e-05 8582554 SNP_A- 2 235029590 rs1876715 FALSE 0.494 -0.6633
0.1716 0.0001107 1967375 SNP_A- 3 21227105 rs6791277 FALSE 0.24
-1.356 0.3478 9.608e-05 8366760 SNP_A- 2 235017645 rs1472929 FALSE
2.03 0.6691 0.1703 8.551e-05 8478064 SNP_A- 2 51881093 rs12477891
FALSE 0.415 -0.8571 0.2251 0.0001402 8349850 SNP_A- 1 217912907
rs1856326 FALSE 0.634 -0.7402 0.1607 4.092e-06 8544970 SNP_A- 6
166837330 rs6934309 FALSE 1.87 0.7769 0.1769 1.127e-05 1988493
SNP_A- 1 217916196 rs10779374 FALSE 1.56 0.7625 0.1636 3.15e-06
4265535 SNP_A- 1 217910815 rs11118383 FALSE 0.644 -0.7397 0.1609
4.264e-06 2080370 SNP_A- 1 217912636 rs1856327 FALSE 0.644 -0.7397
0.1609 4.264e-06 2092022 SNP_A- 6 167521338 rs2345970 FALSE 0.69
-0.5864 0.126 3.252e-06 2202302 SNP_A- 1 217905980 rs10863478 FALSE
1.55 0.7527 0.1602 2.622e-06 1959929 SNP_A- 1 217914460 rs10495133
FALSE 0.644 -0.7407 0.1609 4.153e-06 8668446 SNP_A- 1 217914398
rs10779373 FALSE 1.55 0.7397 0.1609 4.264e-06 8417654 SNP_A- 6
112042375 rs6926543 FALSE 1.47 0.4776 0.1113 1.763e-05 8386477
SNP_A- 1 217909214 rs1416000 FALSE 0.653 -0.7397 0.1609 4.264e-06
1985257 SNP_A- 1 217907040 rs10779368 FALSE 1.53 0.7397 0.1609
4.264e-06 1896426 SNP_A- 8 62928256 rs10088053 FALSE 0.471 -0.7385
0.1964 0.0001702 4272029 SNP_A- 3 21196407 rs7648626 FALSE 0.371
-1.112 0.2628 2.346e-05 2168866 SNP_A- 3 21196353 rs6550568 FALSE
0.376 -1.112 0.2628 2.346e-05 1787940 SNP_A- 4 96755517 rs17024261
FALSE 0.425 -0.9477 0.2272 3.032e-05 4224892 SNP_A- 2 24871364
rs4665719 FALSE 1.65 0.473 0.1298 0.0002435 8470071 SNP_A- 4
169962988 rs7654189 FALSE 0.632 -0.49 0.1238 7.572e-05 1803248
SNP_A- 1 71125458 rs1409981 FALSE 0.634 -0.4879 0.1235 7.781e-05
8565161 SNP_A- 1 69458450 rs12082124 FALSE 3.01 1.19 0.3058
0.0001003 8351277 SNP_A- 1 217909523 rs1415282 FALSE 0.654 -0.7141
0.1595 7.577e-06 8668443 SNP_A- 2 158389887 rs16842126 FALSE 2.74
1.853 0.3679 4.727e-07 8421072 SNP_A- -- 785 rs3119588 FALSE 0.699
-0.5566 0.1256 9.402e-06 1842166 SNP_A- 6 19002215 rs6917825 FALSE
0.63 -0.601 0.1399 1.731e-05 4220021 SNP_A- 14 57375098 rs17093751
FALSE 3.36 1.187 0.346 0.0006033 8299340 SNP_A- 4 141044042
rs17050999 FALSE 0.426 -1.181 0.2762 1.901e-05 2152929 SNP_A- 15
44672449 rs1400412 FALSE 2.03 0.9163 0.2187 2.803e-05 1953240
SNP_A- 12 56765747 rs2720185 FALSE 0.408 -1.571 0.3346 2.653e-06
2002771 SNP_A- 4 88103790 rs12651081 FALSE 1.31 0.5367 0.117
4.469e-06 2047393 SNP_A- 9 1801657 rs10963396 FALSE 0.347 -1.186
0.3023 8.737e-05 8672704 SNP_A- 14 96141802 rs234605 FALSE 1.54
0.466 0.1215 0.000126 8677651 SNP_A- 20 35327104 rs7267965 FALSE
0.377 -1.158 0.2886 6.028e-05 8493887 SNP_A- 7 70213501 rs886739
FALSE 1.52 0.4687 0.1197 9.031e-05 8490285 SNP_A- 5 65966059
rs16895353 FALSE 0.393 -0.9253 0.2447 0.000156 2166983 SNP_A- 4
96861645 rs6814329 FALSE 2.17 0.827 0.2143 0.0001138 8658724 SNP_A-
2 24950456 rs7567997 FALSE 1.54 0.4135 0.1141 0.0002896 8378831
SNP_A- 5 7917532 rs16879248 FALSE 0.368 -0.9826 0.2622 0.0001785
8296527 SNP_A- 3 53797359 rs3774598 FALSE 0.307 -1.725 0.3979
1.455e-05 1972641 SNP_A- 6 144656559 rs7740792 FALSE 0.235 -1.668
0.4594 0.0002812 8405569 SNP_A- 6 18969221 rs4716312 FALSE 1.55
0.5844 0.1386 2.485e-05 2171537 SNP_A- 4 88076615 rs1447993 FALSE
1.38 0.5764 0.13 9.33e-06 4252168 SNP_A- 4 82273150 rs11723204
FALSE 2.03 1.222 0.2749 8.701e-06 8453740 SNP_A- 2 12593877
rs13013085 FALSE 0.575 -0.6388 0.1705 0.0001788 4252121 SNP_A- 10
45286428 rs901683 FALSE 1.98 0.6551 0.179 0.0002523 2000347 SNP_A-
4 4871714 rs4689946 FALSE 1.69 0.4842 0.1424 0.0006735 8510071
SNP_A- 16 10680908 rs10221110 FALSE 0.654 -0.5663 0.1355 2.916e-05
2083150 SNP_A- 16 10680325 rs2719715 FALSE 0.654 -0.5663 0.1355
2.916e-05 4235811 SNP_A- 22 47541093 rs13056461 FALSE 1.49 0.56
0.1348 3.277e-05 8485648 SNP_A- X 29021974 rs2651175 TRUE 0.723
-0.3479 0.09383 0.0002087 8356840 SNP_A- 6 18969437 rs1360771 FALSE
0.644 -0.5896 0.1413 3.013e-05 1834789 SNP_A- 16 78483602
rs13330604 FALSE 0.586 -0.4704 0.1449 0.001172 8642499 SNP_A- 17
58504151 rs8072580 FALSE 1.84 0.9418 0.218 1.551e-05 4205314 SNP_A-
2 24984411 rs6733224 FALSE 0.658 -0.4139 0.1146 0.0003063 2152506
SNP_A- 16 10677661 rs12925749 FALSE 0.641 -0.6552 0.1533 1.919e-05
8432970 SNP_A- 13 65929499 rs10507737 FALSE 0.64 -0.4704 0.129
0.0002645 8548394 SNP_A- 2 24956950 rs2033653 FALSE 0.658 -0.4105
0.115 0.0003578 8681923 SNP_A- 8 14079214 rs7840084 FALSE 1.71
0.5533 0.155 0.0003575 8630612 SNP_A- 2 235015475 rs6743014 FALSE
1.87 0.5722 0.167 0.0006123 4204345 SNP_A- 2 24983966 rs10200566
FALSE 0.664 -0.4164 0.1166 0.0003531 8398578 SNP_A- 2 24592914
rs1545255 FALSE 1.61 0.3977 0.1293 0.002098 2243420 SNP_A- 2
24984046 rs10198275 FALSE 1.5 0.3973 0.1141 0.0004973 2052179
SNP_A- 2 24984820 rs6545814 FALSE 1.5 0.3973 0.1141 0.0004973
2059271 SNP_A- 14 57374152 rs2145489 FALSE 2.01 0.7099 0.2014
0.0004234 2206221 SNP_A- 2 24972389 rs6545800 FALSE 0.668 -0.3916
0.1148 0.0006473 2262428 SNP_A- 2 24985490 rs11900505 FALSE 1.49
0.3967 0.1141 0.0005097 1864375 SNP_A- 4 39424918 rs10517528 FALSE
0.534 -0.5733 0.1719 0.000854 1976890 SNP_A- 19 61792033 rs741252
FALSE 1.55 0.4229 0.1272 0.0008836 4287784 SNP_A- 19 61784980
rs11084454 FALSE 0.646 -0.4229 0.1272 0.0008836 1942320 SNP_A- 3
117233816 rs9821040 FALSE 1.63 0.4632 0.1398 0.0009233 8456608
SNP_A- 6 16165496 rs4716037 FALSE 1.58 0.4057 0.1269 0.001384
8627377 SNP_A- 2 24953832 rs2384058 FALSE 1.5 0.369 0.1132 0.001118
8366937 SNP_A- 19 61787066 rs4801343 FALSE 0.647 -0.4207 0.1275
0.00967 4273665 SNP_A- 16 72446965 rs10500575 FALSE 0.626 -0.4723
0.1394 0.0007026 4195397 SNP_A- 19 18034603 rs372889 FALSE 0.644
-0.3285 0.1168 0.004928 2113673 AFFX- 19 18034603 rs372889 FALSE
0.644 -0.3285 0.1168 0.004928 SNP_6891433 SNP_A- 2 144498321
rs16823406 FALSE 0.342 -1.045 0.3117 0.0007962 1965187 SNP_A- 6
22469455 rs1205925 FALSE 0.669 -0.3886 0.1202 0.001221 1985390
SNP_A- 2 24989124 rs2384061 FALSE 1.51 0.3669 0.1176 0.00181
2199372 SNP_A- 4 4864223 rs1907991 FALSE 0.619 -0.4423 0.1429
0.001974 2223920 SNP_A- 19 61777581 rs10421285 FALSE 0.652 -0.4085
0.1265 0.001248 2075251 SNP_A- 2 157099822 rs2568816 FALSE 1.6
0.421 0.133 0.001545 1965505 SNP_A- 2 24933274 rs11675457 FALSE
1.51 0.3513 0.1165 0.00257 8603804 SNP_A- 2 24961701 rs1865689
FALSE 0.669 -0.3667 0.1163 0.001615 1962473 SNP_A- 20 273102
rs6084145 FALSE 0.679 -0.5859 0.1409 3.215e-05 8613839 SNP_A- 2
214668085 rs11900000 FALSE 0.603 -0.8506 0.204 3.041e-05 1957079
SNP_A- 6 119479680 rs794258 FALSE 0.488 -1.115 0.2676 3.078e-05
8432286 SNP_A- 4 169929444 rs7679982 FALSE 1.54 0.4141 0.1324
0.001761 4288330 SNP_A- 4 169928846 rs17708289 FALSE 1.54 0.4141
0.1324 0.001761 4300393 SNP_A- 9 85325008 rs17086403 FALSE 0.483
-0.6386 0.2157 0.003067 8407616 SNP_A- 2 24546313 rs2165738 FALSE
0.663 -0.3713 0.1233 0.00259 1949138 SNP_A- 12 9369404 rs7302181
FALSE 0.634 -0.3906 0.136 0.004073 1908453 SNP_A- 4 169963645
rs11726774 FALSE 1.5 0.3411 0.119 0.004151 8596473 SNP_A- 12
9422322 rs10492108 FALSE 1.57 0.3767 0.1343 0.005041 2031097 SNP_A-
11 107222310 rs11212408 FALSE 1.32 0.4963 0.1197 3.373e-05 2144434
SNP_A- 4 88082794 rs6836128 FALSE 1.34 0.5552 0.1311 2.29e-05
2110070 SNP_A- 6 22406678 rs849877 FALSE 0.654 -0.3612 0.1238
0.003525 1902860 SNP_A- 14 57497859 rs17094008 FALSE 2.05 0.5926
0.2163 0.006142 1868624 SNP_A- 2 24954596 rs2033655 FALSE 1.48
0.3292 0.115 0.004194 2153320 SNP_A- 9 1826746 rs10116883 FALSE
0.337 -0.9396 0.3517 0.007552 8569796 SNP_A- 12 9422128 rs11050596
FALSE 0.648 -0.366 0.1329 0.005877 8352538 SNP_A- 3 7805879
rs7641662 FALSE 3.33 0.9576 0.3673 0.009134 8479123 SNP_A- 12
96773971 rs12825850 FALSE 0.588 -0.3971 0.1574 0.01166 8582717
SNP_A- 20 42750069 rs7262172 FALSE 1.56 0.3304 0.1331 0.01303
8660563 SNP_A- 14 57272128 rs1092014 FALSE 0.287 -1.017 0.4186
0.01513 8532464 SNP_A- 10 54716153 rs10824983 FALSE 1.51 0.3222
0.121 0.007762 8611802 SNP_A- 6 161410210 rs3757020 FALSE 0.525
-1.186 0.2839 2.934e-05 8669637 SNP_A- 4 169924575 rs869396 FALSE
0.645 -0.2639 0.1221 0.03075
8662057 SNP_A- 6 5665825 rs1977059 FALSE 0.691 -1.006 0.2381
2.376e-05 1925576 SNP_A- 7 147516396 rs17170877 FALSE 1.49 0.3014
0.12 0.01202 8399794 SNP_A- 14 57309830 rs1956681 FALSE 2.54 0.7331
0.3155 0.02015 2054062 pid isc_pval_holm isc_pval_fdr nyc_pval
ef_pval isc_nyc_pval isc_ef_pval SNP_A- 0.121426 0.121426 0.597
0.432 0.399 0.938 2053054 SNP_A- 1 0.206669 0.354 0.0728 0.534
0.0157 8370399 SNP_A- 1 0.270544 0.743 0.344 0.649 0.577 8631553
SNP_A- 0.628374 0.18575 0.687 0.334 0.908 0.531 8285583 SNP_A- 1
0.191565 0.519 0.229 0.879 0.591 1854346 SNP_A- 1 0.18575 0.975
0.488 0.801 0.922 8647043 SNP_A- 1 0.18575 0.654 0.226 0.912 0.614
2183445 SNP_A- 1 0.191565 0.257 0.119 0.399 0.0158 8530310 SNP_A-
0.790797 0.18575 0.488 0.405 0.975 0.297 8456423 SNP_A- 1 0.305196
0.733 0.222 0.344 0.17 8596066 SNP_A- 1 0.301132 0.9 0.0338 0.976
0.0847 8582554 SNP_A- 1 0.607431 0.155 0.561 0.97 0.634 1967375
SNP_A- 1 0.607431 0.193 0.177 0.142 0.0889 8366760 SNP_A- 1
0.607431 0.295 0.625 0.742 0.69 8478064 SNP_A- 1 0.611853 0.324
0.642 0.167 0.928 8349850 SNP_A- 1 0.18575 0.0448 0.499 0.133 0.395
8544970 SNP_A- 1 0.301132 0.812 0.258 0.344 0.21 1988493 SNP_A- 1
0.18575 0.0516 0.438 0.135 0.354 4265535 SNP_A- 1 0.18575 0.0382
0.486 0.097 0.339 2080370 SNP_A- 1 0.18575 0.0382 0.486 0.097 0.339
2092022 SNP_A- 1 0.18575 0.452 0.706 0.45 0.0339 2202302 SNP_A- 1
0.18575 0.0826 0.678 0.136 0.424 1959929 SNP_A- 1 0.18575 0.0366
0.577 0.0889 0.431 8668446 SNP_A- 1 0.18575 0.0382 0.486 0.097
0.339 8417654 SNP_A- 1 0.399696 0.753 0.474 0.825 0.59 8386477
SNP_A- 1 0.18575 0.0457 0.496 0.097 0.339 1985257 SNP_A- 1 0.18575
0.0457 0.496 0.097 0.339 1896426 SNP_A- 1 0.63668 0.43 0.622 0.826
0.0316 4272029 SNP_A- 1 0.455799 0.632 0.493 0.123 0.548 2168866
SNP_A- 1 0.455799 0.504 0.358 0.123 0.548 1787940 SNP_A- 1 0.479754
0.519 0.194 0.377 0.562 4224892 SNP_A- 1 0.722157 0.347 0.666 0.241
0.635 8470071 SNP_A- 1 0.607431 0.276 0.643 0.157 0.45 1803248
SNP_A- 1 0.607431 0.935 0.995 0.842 0.8 8565161 SNP_A- 1 0.607431
0.615 0.493 0.895 0.371 8351277 SNP_A- 1 0.257671 0.0466 0.522
0.0817 0.356 8668443 SNP_A- 0.353652 0.176826 0.94 0.00712 0.329
0.00302 8421072 SNP_A- 1 0.270544 0.306 0.737 0.275 0.0325 1842166
SNP_A- 1 0.399696 0.369 0.045 0.0699 0.298 4220021 SNP_A- 1
0.767302 0.218 0.5 0.231 0.434 8299340 SNP_A- 1 0.410203 0.444
0.605 0.418 0.885 2152929 SNP_A- 1 0.479754 0.537 0.955 0.854 0.833
1953240 SNP_A- 1 0.18575 0.774 0.463 0.372 0.244 2002771 SNP_A- 1
0.18575 0.651 0.402 0.678 0.267 2047393 SNP_A- 1 0.607431 0.236
0.649 0.983 0.983 8672704 SNP_A- 1 0.607431 0.959 0.39 0.774 0.701
8677651 SNP_A- 1 0.607431 0.619 0.773 0.304 0.95 8493887 SNP_A- 1
0.607431 0.142 0.206 0.462 0.31 8490285 SNP_A- 1 0.630877 0.286
0.568 0.514 0.348 2166983 SNP_A- 1 0.607431 0.66 0.381 0.419 0.594
8658724 SNP_A- 1 0.734952 0.338 0.838 0.194 0.911 8378831 SNP_A- 1
0.655907 0.141 0.336 0.503 0.571 8296527 SNP_A- 1 0.362855 0.249
0.28 0.0678 0.316 1972641 SNP_A- 1 0.734952 0.792 0.583 0.718 0.601
8405569 SNP_A- 1 0.464791 0.539 0.0568 0.086 0.318 2171537 SNP_A- 1
0.270544 0.286 0.0101 0.203 0.0122 4252168 SNP_A- 1 0.270544 0.743
0.262 0.766 0.0178 8453740 SNP_A- 1 0.655907 0.53 0.516 0.915 0.541
4252121 SNP_A- 1 0.725998 0.0703 0.794 0.148 0.561 2000347 SNP_A- 1
0.778751 0.175 0.821 0.372 0.927 8510071 SNP_A- 1 0.479754 0.0313
0.395 0.17 0.261 2083150 SNP_A- 1 0.479754 0.0313 0.395 0.17 0.261
4235811 SNP_A- 1 0.490341 0.727 0.293 0.485 0.612 8485648 SNP_A- 1
0.677226 0.346 0.164 0.9 0.0206 8356840 SNP_A- 1 0.479754 0.552
0.0448 0.104 0.308 1834789 SNP_A- 1 0.811523 0.756 0.0781 0.822
0.19 8642499 SNP_A- 1 0.374319 0.558 0.254 0.947 0.61 4205314
SNP_A- 1 0.744268 0.523 0.888 0.464 0.838 2152506 SNP_A- 1 0.410203
0.023 0.591 0.422 0.52 8432970 SNP_A- 1 0.73431 0.634 0.19 0.619
0.156 8548394 SNP_A- 1 0.754805 0.614 0.922 0.484 0.815 8681923
SNP_A- 1 0.754805 0.315 0.904 0.48 0.877 8630612 SNP_A- 1 0.767302
0.186 0.656 0.983 0.662 4204345 SNP_A- 1 0.754805 0.305 0.379 0.246
0.444 8398578 SNP_A- 1 0.835697 0.333 0.861 0.318 0.921 2243420
SNP_A- 1 0.767302 0.442 0.763 0.374 0.691 2052179 SNP_A- 1 0.767302
0.442 0.763 0.374 0.691 2059271 SNP_A- 1 0.767302 0.51 0.186 0.591
0.248 2206221 SNP_A- 1 0.767302 0.542 0.631 0.449 0.72 2262428
SNP_A- 1 0.767302 0.441 0.762 0.344 0.678 1864375 SNP_A- 1 0.792807
0.933 0.563 0.19 0.607 1976890 SNP_A- 1 0.797762 0.00187 0.994
0.00157 0.958 4287784 SNP_A- 1 0.797762 0.00233 0.949 0.00157 0.958
1942320 SNP_A- 1 0.801006 0.0636 0.195 0.0765 0.521 8456608 SNP_A-
1 0.820371 0.874 0.944 0.858 0.822 8627377 SNP_A- 1 0.811523 0.526
0.936 0.326 0.939 8366937 SNP_A- 1 0.811057 0.00155 0.955 0.00123
0.993 4273665 SNP_A- 1 0.78573 0.493 0.786 0.864 0.306 4195397
SNP_A- 1 0.891826 0.337 0.316 0.178 0.615 2113673 AFFX- 1 0.891826
0.337 0.316 0.178 0.615 SNP_6891433 SNP_A- 1 0.787986 0.0782 0.978
0.193 0.989 1965187 SNP_A- 1 0.816056 0.72 0.408 0.946 0.909
1985390 SNP_A- 1 0.833383 0.742 0.753 0.648 0.845 2199372 SNP_A- 1
0.833383 0.195 0.93 0.415 0.972 2223920 SNP_A- 1 0.816056 0.00154
0.922 0.000753 0.978 2075251 SNP_A- 1 0.820675 0.759 0.78 0.708
0.524 1965505 SNP_A- 1 0.850285 0.63 0.948 0.688 0.991 8603804
SNP_A- 1 0.82615 0.46 0.72 0.579 0.756 1962473 SNP_A- 1 0.490341
0.276 0.386 0.155 0.502 8613839 SNP_A- 1 0.479754 0.586 0.96 0.234
0.228 1957079 SNP_A- 1 0.479754 0.267 0.21 0.832 0.059 8432286
SNP_A- 1 0.830132 0.457 0.847 0.252 0.588 4288330 SNP_A- 1 0.830132
0.457 0.847 0.252 0.588 4300393 SNP_A- 1 0.860641 0.0717 0.255
0.102 0.382 8407616 SNP_A- 1 0.850285 0.846 0.142 0.626 0.359
1949138 SNP_A- 1 0.885676 0.931 0.335 0.547 0.625 1908453 SNP_A- 1
0.885676 0.816 0.887 0.933 0.84 8596473 SNP_A- 1 0.891826 0.672
0.706 0.552 0.863 2031097 SNP_A- 1 0.494809 0.166 0.669 0.056 0.754
2144434 SNP_A- 1 0.455799 0.236 0.00806 0.173 0.0119 2110070 SNP_A-
1 0.876162 0.478 0.246 0.748 0.279 1902860 SNP_A- 1 0.906124 0.34
0.535 0.331 0.0634 1868624 SNP_A- 1 0.886006 0.465 0.748 0.481
0.875 2153320 SNP_A- 1 0.922488 0.189 0.509 0.549 0.732 8569796
SNP_A- 1 0.902609 0.84 0.727 0.285 0.644 8352538 SNP_A- 1 0.92824
0.209 0.312 0.158 0.518 8479123 SNP_A- 1 0.937909 0.101 0.465
0.0801 0.279 8582717 SNP_A- 1 0.940195 0.728 0.375 0.38 0.362
8660563 SNP_A- 1 0.947838 0.347 0.362 0.952 0.408 8532464 SNP_A- 1
0.922717 0.56 0.686 0.233 0.763 8611802 SNP_A- 1 0.479754 0.707
0.403 0.153 0.831
8669637 SNP_A- 1 0.964806 0.606 0.88 0.881 0.961 8662057 SNP_A- 1
0.455799 0.304 0.268 0.913 0.213 1925576 SNP_A- 1 0.939565 0.244
0.342 0.564 0.167 8399794 SNP_A- 1 0.955841 0.677 0.401 0.14 0.199
2054062
TABLE-US-00017 TABLE 15 isc_pval dbSNP ID Genes near locus Cluster
Chr Position MAF pval pval_fdr isc_pval fdr Correlation rs12082124
DEPDC1, LRRC7, 1 1 69458450 0.0247 7.84e-06 0.368 0.0001003 0.607
Positive rs1409981 PTGER3 2 1 71125458 0.305 6.93e-06 0.368
7.78e-05 0.607 Negative rs1018615 ETV3, FCRL5, 3 1 155572157 0.038
3.4e-06 0.273 9.1e-06 0.271 Positive rs1856326 SLC30A10 4 1
217912907 0.237 0.00025 0.669 4.09e-06 0.186 Negative rs10779374
SLC30A10 4 1 217916196 0.243 0.00037 0.69 3.15e-06 0.186 Positive
rs10495133 SLC30A10 4 1 217914460 0.249 0.00038 0.69 4.15e-06 0.186
Negative rs10863478 SLC30A10 4 1 217905980 0.254 0.00039 0.69
2.62e-06 0.186 Positive rs11118383 SLC30A10 4 1 217910815 0.248
0.00039 0.69 4.26e-06 0.186 Negative rs1856327 SLC30A10 4 1
217912636 0.248 0.00039 0.69 4.26e-06 0.186 Negative rs10779373
SLC30A10 4 1 217914398 0.248 0.00039 0.69 4.26e-06 0.186 Positive
rs10779368 SLC30A10 4 1 217907040 0.246 0.00056 0.722 4.26e-06
0.186 Positive rs1416000 SLC30A10 4 1 217909214 0.247 0.00056 0.722
4.26e-06 0.186 Negative rs1415282 SLC30A10 4 1 217909523 0.247
0.00056 0.722 7.58e-06 0.258 Negative rs13013085 ST13, TRIB2, 5 2
12593877 0.207 4.89e-05 0.487 0.0001788 0.656 Negative rs1545255
ITSN2, NCOA1, 6 2 24592914 0.21 1.05e-05 0.391 0.002098 0.836
Positive rs2165738 ITSN2, NCOA1, 6 2 24546313 0.271 4.78e-05 0.487
0.00259 0.850 Negative rs4665719 CENPO, ADCY3 7 2 24871364 0.239
2.06e-06 0.241 0.0002435 0.722 Positive rs7567997 CENPO, ADCY3 7 2
24950456 0.416 6.77e-06 0.368 0.0002896 0.735 Positive rs6733224
CENPO, ADCY3 7 2 24984411 0.413 1.68e-05 0.451 0.0003063 0.744
Negative rs2033653 CENPO, ADCY3 7 2 24956950 0.408 1.7e-05 0.451
0.0003578 0.755 Negative rs2384058 CENPO, ADCY3 7 2 24953832 0.408
2.43e-05 0.461 0.001118 0.812 Positive rs11675457 CENPO, ADCY3 7 2
24933274 0.393 2.47e-05 0.461 0.00257 0.850 Positive rs10198275
CENPO, ADCY3 7 2 24984046 0.412 2.76e-05 0.461 0.0004973 0.767
Positive rs6545814 CENPO, ADCY3 7 2 24984820 0.412 2.76e-05 0.461
0.0004973 0.767 Positive rs6545800 CENPO, ADCY3 7 2 24972389 0.412
3.51e-05 0.465 0.0006473 0.767 Negative rs10200566 CENPO, ADCY3 7 2
24983966 0.433 3.9e-05 0.465 0.0003531 0.755 Negative rs2384061
CENPO, ADCY3 7 2 24989124 0.386 3.97e-05 0.465 0.00181 0.833
Positive rs11900505 CENPO, ADCY3 7 2 24985490 0.412 4.14e-05 0.469
0.0005097 0.767 Positive rs2033655 CENPO, ADCY3 7 2 24954596 0.396
4.99e-05 0.487 0.004194 0.886 Positive rs1865689 CENPO, ADCY3 7 2
24961701 0.399 5.05e-05 0.487 0.001615 0.826 Negative rs12477891
ASB3, NRXN1, 8 2 51881093 0.0484 2.27e-06 0.241 0.0001402 0.612
Negative rs16823406 GTDC1 9 2 144498321 0.0142 5.66e-05 0.494
0.0007962 0.788 Negative rs2568816 GPD2 10 2 157099822 0.289
4.95e-05 0.487 0.001545 0.821 Positive rs16842126 ACVR1 11 2
158389887 0.0137 0.00118 0.81 4.73e-07 0.177 Positive rs11900000
SPAG16 12 2 214668085 0.0631 0.00215 0.835 3.04e-05 0.480 Negative
rs1472929 ARL4C, SPP2, 13 2 235017645 0.0756 1.54e-06 0.241
8.55e-05 0.607 Positive rs1876715 ARL4C, SPP2, 13 2 235029590 0.074
1.76e-06 0.241 0.0001107 0.607 Negative rs6743014 ARL4C, SPP2, 13 2
235015475 0.0775 1.34e-05 0.451 0.0006123 0.767 Positive rs7641662
GRM7, LMCD1, 14 3 7805879 0.0118 3.23e-05 0.465 0.009134 0.928
Positive rs6791277 SGOL1, VENTXP7, ZNF385D 15 3 21227105 0.0145
1.77e-06 0.241 9.61e-05 0.607 Negative rs7648626 SGOL1, VENTXP7,
ZNF385D 15 3 21196407 0.0274 2.96e-05 0.461 2.35e-05 0.456 Negative
rs6550568 SGOL1, VENTXP7, ZNF385D 15 3 21196353 0.0281 3.76e-05
0.465 2.35e-05 0.456 Negative rs3774598 CACNA1D 16 3 53797359
0.0114 0.00081 0.757 1.46e-05 0.363 Negative rs9821040 LSAMP 17 3
117233816 0.185 3.24e-05 0.465 0.0009233 0.801 Positive rs275697
AGTR1 18 3 149836430 0.0536 7.1e-05 0.539 5.12e-06 0.192 Positive
rs4689946 MSX1, STX18, 19 4 4871714 0.168 6e-06 0.368 0.0006735
0.779 Positive rs1907991 MSX1, STX18, 19 4 4864223 0.167 3.61e-05
0.465 0.001974 0.833 Negative rs10517528 UBE2K 20 4 39424918 0.189
2.5e-05 0.461 0.000854 0.793 Negative rs11723204 PRKG2 21 4
82273150 0.0276 0.00535 0.869 8.7e-06 0.271 Positive rs12651081
AFF1 22 4 88103790 0.362 0.00461 0.869 4.47e-06 0.186 Positive
rs1447993 AFF1 22 4 88076615 0.185 0.00553 0.869 9.33e-06 0.271
Positive rs6836128 AFF1 22 4 88082794 0.182 0.0126 0.91 2.29e-05
0.456 Positive rs17024266 PDHA2, UNC5C, 23 4 96760067 0.0343
7.96e-08 0.0596 1.62e-07 0.121 Negative rs17024261 PDHA2, UNC5C, 23
4 96755517 0.0327 2.38e-05 0.461 3.03e-05 0.480 Negative rs6814329
PDHA2, UNC5C, 23 4 96861645 0.035 5.42e-05 0.494 0.0001138 0.607
Positive rs17050999 MAML3, SCOC, 24 4 141044042 0.0304 0.00017
0.614 1.9e-05 0.410 Negative rs7654189 PALLD 25 4 169962988 0.34
7.62e-06 0.368 7.57e-05 0.607 Negative rs869396 PALLD 25 4
169924575 0.442 1.81e-05 0.451 0.03075 0.965 Negative rs11726774
PALLD 25 4 169963645 0.464 3.97e-05 0.465 0.004151 0.886 Positive
rs17708289 PALLD 25 4 169928846 0.266 5.64e-05 0.494 0.001761 0.830
Positive rs7679982 PALLD 25 4 169929444 0.267 5.64e-05 0.494
0.001761 0.830 Positive rs16879248 FASTKD3, 26 5 7917532 0.0289
1.76e-05 0.451 0.0001785 0.656 Negative rs16895353 CD180, MAST4,
PPIA, 27 5 65966059 0.0179 2.04e-05 0.461 0.000156 0.631 Negative
rs1977059 FARS2, 28 6 5665825 0.0457 0.0997 0.966 2.38e-05 0.456
Negative rs4716037 ARPC3, MYLIP, 29 6 16165496 0.354 1.61e-05 0.451
0.001384 0.820 Positive rs6917825 ID4, RNF144B, RPL21P28, 30 6
19002215 0.15 0.00016 0.601 1.73e-05 0.400 Negative rs4716312 ID4,
RNF144B, RPL21P28, 30 6 18969221 0.15 0.00032 0.67 2.49e-05 0.465
Positive rs1360771 ID4, RNF144B, RPL21P28, 30 6 18969437 0.145
0.00038 0.69 3.01e-05 0.480 Negative rs849877 HDGFL1, PRL, 31 6
22406678 0.393 5.18e-05 0.49 0.003525 0.876 Negative rs1205925
HDGFL1, PRL, 31 6 22469455 0.467 4.32e-05 0.482 0.001221 0.816
Negative rs6926543 FYN 32 6 112042375 0.366 5.51e-05 0.494 1.76e-05
0.400 Positive rs794258 FAM184A 33 6 119479680 0.0284 0.00235 0.836
3.08e-05 0.480 Negative rs7740792 UTRN 34 6 144656559 0.0114
9.84e-06 0.388 0.0002812 0.735 Negative rs3757020 MAP3K4 35 6
161410210 0.0244 0.0209 0.936 2.93e-05 0.480 Negative rs12524741
RPS6KA2 36 6 166836302 0.0716 4.63e-05 0.487 1.18e-05 0.305
Positive rs6934309 RPS6KA2 36 6 166837330 0.0714 9.41e-05 0.563
1.13e-05 0.301 Positive rs2345970 TCP10L2, UNC93A, 37 6 167521338
0.252 0.00039 0.69 3.25e-06 0.186 Negative rs886739 AUTS2, WBSCR17,
38 7 70213501 0.305 3.98e-05 0.465 9.03e-05 0.607 Positive
rs17170877 CNTNAP2 39 7 147516396 0.485 5.6e-05 0.494 0.01202 0.940
Positive rs7840084 SGCZ, 40 8 14079214 0.147 1.93e-05 0.461
0.0003575 0.755 Positive rs10088053 ASPH, NKAIN3, 41 8 62928256
0.0672 3.64e-06 0.273 0.0001702 0.637 Negative rs10963396 SMARCA2
42 9 1801657 0.0251 1.63e-05 0.451 8.74e-05 0.607 Negative
rs10116883 SMARCA2 42 9 1826746 0.0222 1.99e-05 0.461 0.007552
0.922 Negative rs953188 TLE1 43 9 82910311 0.111 1.49e-05 0.451
8.4e-07 0.186 Positive rs997020 TLE1 43 9 82948468 0.112 1.62e-05
0.451 4.9e-06 0.192 Negative rs10867699 TLE1 43 9 82911335 0.143
3.84e-05 0.465 3.57e-06 0.186 Positive rs2809841 TLE1 43 9 82979213
0.138 7.14e-05 0.539 1.12e-05 0.301 Positive rs17086403 FRMD3 44 9
85325008 0.0609 3.63e-05 0.465 0.003067 0.861 Negative rs901683
MARCH8 45 10 45286428 0.0633 1.18e-05 0.42 0.0002523 0.726 Positive
rs10824983 PCDH15, PRKRIR, 46 10 54716153 0.421 4.93e-05 0.487
0.007762 0.923 Positive rs11212408 SLC35F2 47 11 107222310 0.371
0.00457 0.869 3.37e-05 0.495 Positive rs10492108 DDX12 48 12
9422322 0.177 2.78e-05 0.461 0.005041 0.892 Positive rs7302181
DDX12 48 12 9369404 0.193 2.84e-05 0.461 0.004073 0.886 Negative
rs11050596 DDX12 48 12 9422128 0.193 4.56e-05 0.487 0.005877 0.903
Negative rs2720185 LRIG3, XRCC6BP1, 49 12 56765747 0.0122 0.00581
0.869 2.65e-06 0.186 Negative rs12825850 SLC9A7 50 12 96773971
0.142 2.92e-05 0.461 0.01166 0.938 Negative rs10507737 PCDH9 51 13
65929499 0.209 4.09e-05 0.469 0.0002645 0.734 Negative rs4148536
ABCC4 52 13 94515499 0.0655 9.56e-05 0.563 1.06e-06 0.186 Negative
rs17093751 ACTR10, SLC35F4, 53 14 57375098 0.0137 1.56e-06 0.241
0.0006033 0.767 Positive rs17094008 ACTR10, SLC35F4, 53 14 57497859
0.054 2.58e-05 0.461 0.006142 0.906 Positive rs1092014 ACTR10,
SLC35F4, 53 14 57272128 0.0122 2.73e-05 0.461 0.01513 0.948
Negative rs2145489 ACTR10, SLC35F4, 53 14 57374152 0.0548 3.16e-05
0.465 0.0004234 0.767 Positive rs1956681 ACTR10, SLC35F4, 53 14
57309830 0.0228 4.56e-05 0.487 0.02015 0.956 Positive rs234605
PAPOLA, VRK1, 54 14 96141802 0.423 2.47e-05 0.461 0.000126 0.607
Positive rs1400412 SEMA6D 55 15 44672449 0.0479 0.0001 0.565
2.8e-05 0.480 Positive rs2719715 TEKT5 56 16 10680325 0.171 0.00028
0.67 2.92e-05 0.480 Negative rs10221110 TEKT5 56 16 10680908 0.171
0.00028 0.67 2.92e-05 0.480 Negative rs12925749 TEKT5 56 16
10677661 0.112 0.00096 0.791 1.92e-05 0.410 Negative rs10500575
RPSA, ZFHX3, 57 16 72446965 0.281 5.68e-05 0.494 0.0007026 0.786
Negative rs13330604 DYNLRB2 58 16 78483602 0.164 7.87e-06 0.368
0.001172 0.812 Negative rs8072580 TANC2 59 17 58504151 0.0509
0.00185 0.812 1.55e-05 0.374 Positive rs372889 IL12RB1 60 19
18034603 0.486 9.85e-06 0.388 0.004928 0.892 Negative rs10421285
ZNF470, ZNF71 61 19 61777581 0.364 4.45e-05 0.487 0.001248 0.816
Negative rs11084454 ZNF470, ZNF71 61 19 61784980 0.37 3.22e-05
0.465 0.0008836 0.798 Negative rs741252 ZNF470, ZNF71, 61 19
61792033 0.368 3.38e-05 0.465 0.0008836 0.798 Positive rs4801343
ZNF470, ZNF71, 61 19 61787066 0.367 3.71e-05 0.465 0.000967 0.811
Negative rs6084145 NRSN2, SOX12, 62 20 273102 0.154 0.00198 0.823
3.22e-05 0.490 Negative rs7267965 MANBAL, 63 20 35327104 0.0236
2.84e-05 0.461 6.03e-05 0.607 Negative rs7262172 --, ADA, WISP2, 64
20 42750069 0.255 3.42e-05 0.465 0.01303 0.940 Positive rs13056461
C22orf34, FAM19A5, 65 22 47541093 0.351 0.00023 0.669 3.28e-05
0.490 Positive rs3119588 ? 66 -- 785 0.254 0.00061 0.723 9.4e-06
0.271 Negative rs5943590 IL1RAPL1, 67 X 28977674 0.241 2.58e-06
0.241 5.8e-06 0.207 Negative rs2651175 IL1RAPL1 67 X 29021974 0.204
5.08e-05 0.487 0.0002087 0.677 Negative rs7060905 COL4A6 68 X
107557678 0.0104 2.79e-05 0.461 2.37e-06 0.186 Negative
TABLE-US-00018 TABLE 16 Gene Symbol Cluster Description LRRC7 1
leucine rich repeat containing 7 ST13 5 suppression of
tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)
ITSN2 6 intersectin 2 ADCY3 7 adenylate cyclase 3 NRXN1 8 neurexin
1 ACVR1 11 activin A receptor ARL4C 13 ADP-ribosylation factor-like
4C CACNA1D 16 calcium channel LSAMP 17 limbic system-associated
membrane protein STX18 19 syntaxin 18 UNC5C 23 unc-5 homolog C (C.
elegans) PALLD 25 palladin MAST4 27 microtubule associated
serine/threonine kinase family member 4 PPIA 27 peptidylprolyl
isomerase A (cyclophilin A) ARPC3 29 actin related protein 2/3
complex MYLIP 29 myosin regulatory light chain interacting protein
ID4 30 inhibitor of DNA binding 4 FYN 32 FYN oncogene related to
SRC UTRN 34 utrophin MAP3K4 35 mitogen-activated protein kinase
kinase kinase 4 TCP10L2 37 t-complex 10-like 2 (mouse) CNTNAP2 39
contactin associated protein-like 2 SGCZ 40 sarcoglycan zeta FRMD3
44 FERM domain containing 3 PCDH15 46 protocadherin 15 SLC9A7 50
solute carrier family 9 (sodium/hydrogen exchanger) PCDH9 51
protocadherin 9 ACTR10 53 actin-related protein 10 homolog (S.
cerevisiae) SEMA6D 55 sema domain ZFHX3 57 zinc finger homeobox 3
DYNLRB2 58 dynein TANC2 59 tetratricopeptide repeat NRSN2 62
neurensin 2
REFERENCES
[0324] 1. Wichter T, Matheja P, Eckardt L, Kies P, Schafers K,
Schulze-Bahr E, Haverkamp W, Borggrefe M, Schober O, Breithardt G,
Schafers M. Cardiac autonomic dysfunction in Brugada syndrome.
Circulation. 2002; 105(6):702-706. [0325] 2. Shah S H, Pitt G S.
Genetics of cardiac repolarization. Nat Genet, 2009; 41(4):388-389.
[0326] 3. Alcalai R, Seidman J G, Seidman C E. Genetic basis of
hypertrophic cardiomyopathy: from bench to the clinics. J
Cardiovasc Electrophysiol. 2008; 19(1):104-110. [0327] 4. Leonardo
E D, Hinck L, Masu M, Keino-Masu K, Ackerman S L, Tessier-Lavigne
M. Vertebrate homologues of C. elegans UNC-5 are candidate netrin
receptors. Nature. 1997; 386027):833-838. [0328] 5. Korobova F,
Svitkina T. Arp2/3 complex is important for filopodia formation,
growth cone motility, and neuritogenesis in neuronal cells. Mol
Biol Cell, 2008; 19(4):1561-1574. [0329] 6. Ni X, Ji C, Cao G,
Cheng H, Guo L, Gu S, Ying K, Zhao R C, Mao Y. Molecular cloning
and characterization of the protein 4.10 gene, a novel member of
the protein 4.1 family with focal expression in ovary. J Hum Genet.
2003; 48(2):101-106. [0330] 7. Wingrove J. Unpublished Data. 2010,
see Appendix A [0331] 8. Miura Y, Tam Ido A, Morinaga T, Hashimoto
T, Tamaoki Cloning and characterization of an ATBF1 isoform that
expresses in a neuronal differentiation-dependent manner. J Biol
Chem. 1995; 270(45):26840-26848. [0332] 9. Gomez Del Pulgar
Valdes-Mora F, Bandres E, Perez-Palacios R, Espina C, Cejas P,
Garcia-Cabezas M A, Nistal M, Casado E, Gonzalez-Baron M,
Garcia-Foncillas J, Lacal J C. Cdc42 is highly expressed in
colorectal adenocarcinoma and downregulates ID4 through an
epigenetic mechanism. Int J Oncol. 2008; 33(1):185-193. [0333] 10.
Benjamin E J, Rice K M, Arking D E, Pfeufer A, van Noord C, Smith A
V, Schnabel R B, Bis J C, Boerwinkie E, Sinner M F, Dehghan A,
Lubitz S A, D'Agostino R B, Sr., Lumley T, Ehret G B, Heeringa J,
Aspelund T, Newton-Cheh C, Larson M G, Marciante K D, Soliman E Z,
Rivadeneira F, Wang T J, Eiriksdottir G, Levy D, Psaty B M, Li M,
Chamberlain A M, Hofman A, Vasan R S, Harris T B, Rotter J I, Kao W
H, Agarwal S K, Stricker B H, Wang K, Launer L J, Smith N L,
Chakravarti A, Uitterlinden A G, Wolf P A, Sotoodehnia N, Kottgen
A, van Duijn C M, Meitinger T, Mueller M, Perz S, Steinbeck G,
Wichmann H E, Lunetta K L, Heckbert S R, Gudnason V, Alonso A, Kaab
S, Ellinor P T, Witteman J C. Variants in ZFHX3 are associated with
atrial fibrillation in individuals of European ancestry, Nat.
Genet. 2009; 41(8):879-881. [0334] 11. Gudbjartsson D F, Holm H,
Gretarsdottir S, Thorleifsson G, Walters G B, Thorgeirsson G,
Gulcher J, Mathiesen E B, Njolstad I, Nyrnes A, Wilsgaard T, Hald E
M, Hveem K, Stoltenberg C, Kucera G, Stubblefield T, Carter S,
Roden D, Ng M C, Baum L, So W Y, Wong K S, Chan J C, Gieger C,
Wichmann H E, Gschwendtner A, Dichgans M, Kuhlenbaumer G, Berger K,
Ringelstein E B, Bevan S, Markus H S, Kostulas K, Hillert J,
Sveinbjornsdottir S, Valdimarsson E M, Lochen M L, Ma R C, Darbar
D, Kong A, Arnar D O, Thorsteinsdottir U, Stefansson K. A sequence
variant in ZFHX3 on 16q22 associates with atrial fibrillation and
ischemic stroke. Nat Genet. 2009; 41(8):876-878. [0335] 12.
Boukhelifa M, Moza M, Johansson T, Rachlin A, Parast M, Huttelmaier
S, Roy P, Jockusch B M, Carpen O, Karlsson R, Otey C A. The
proline-rich protein palladin is a binding partner for profilin.
FEBS J. 2006; 273(1):26-33. [0336] 13. Calhoun C C, Lu Y C, Song J,
Chiu R. Knockdown endogenous CypA with siRNA U2OS cells results in
disruption of F-actin structure and alters tumor phenotype. Mol
Cell Biochem, 2009; 320(1-2):35-43. [0337] 14. Olsson P A, Korhonen
L, Mercer E A, Lindholm D. MIR is a novel ERM-like protein that
interacts with myosin regulatory light chain and inhibits neurite
outgrowth. J Biol. Chem. 1999; 274(51):36288-36292. [0338] 15. Qu
X, Wei H, Zhai Y, Que H, Chen Q, Tang F, Wu Y, Xing G, Zhu Y, Liu
S, Fan M, He F. Identification, characterization, and functional
study of the two novel human members of the semaphorin gene family,
J Biol Chem. 2002; 277(38):35574-35585. [0339] 16. Toyofuku T,
Zhang H, Kumanogoh A, Takegahara N, Suto F, Kamei J, Aoki K, Yabuki
M, Hori M, Fujisawa H, Kikutani H. Dual roles of Sema6D in cardiac
morphogenesis through region-specific association of its receptor,
Plexin-A1, with off-track and vascular endothelial growth factor
receptor type 2. Genes Dev. 2004; 18(4):435-447. [0340] 17. Susalka
S J, Nikulina K, Salata M W, Vaughan P S, King S M, Vaughan K T,
Pfister K K. The roadblock light chain binds a novel region of the
cytoplasmic Dynein intermediate chain. J Biol Chem.
2002277(36):32939-32946. [0341] 18. Eckley D M, Schroer T A.
Interactions between the evolutionarily conserved, actin-related
protein, Arp11, actin, and Arp1. Mol Biol Cell. 2003;
14(7):2645-2654. [0342] 19. Nakanishi K, Ida M, Suzuki H, Kitano C,
Yamamoto A, Mari N, Araki M, Taketani S. Molecular characterization
of a transport vesicle protein Neurensin-2, a homologue of
Neurensin-1, expressed in neural cells. Brain Res. 2006;
1081(1):1-8. [0343] 20. Hatsuzawa K, Hirose H, Tani K, Yamamoto A,
Scheller R H, Tagaya M. Syntaxin 18, a SNAP receptor that functions
in the endoplasmic reticulum, intermediate compartment, and
cis-Golgi vesicle trafficking. J Biol Chem. 2000;
275(18):13713-13720. [0344] 21. Wei S M, Xie C G, Abe Y, Cai J T.
ADP-ribosylation factor like 7 (ARL7) interacts with alpha-tublin
and modulates intracellular vesicular transport. Biochem Biophys
Res Commun. 2009; 384(3):352-356, [0345] 22. Kagami. T, Chen S,
Memar P, Choi M, Foster L J, Numata M. Identification and
biochemical characterization of the SLC9A7 interactome. Mol Membr
Biol. 2008; 25(5):436-447. [0346] 23. Poliak S, Gollan L, Martinez
R, Custer A, Einheber S, Salzer J L, Trimmer J S, Shrager P, Peles
E. Caspr2, a new member of the neurexin superfamily, is localized
at the juxtaparanodes of myelinated axons and associates with K+
channels. Neuron. 1999; 24(4):1037-1047. [0347] 24. Nguyen T,
Sudhof T C. Binding properties of neuroligin 1 and neurexin 1beta
reveal function as heterophilic cell adhesion molecules. J Biol
Chem. 1997; 27241):26032-26039. [0348] 25. Walikonis R S, Oguni A,
Khorosheva E M, Jeng C J, Asuncion F J, Kennedy M B. Densin-180
forms a ternary complex with the (alpha)-subunit of
Ca2+/calmodulin-dependent protein kinase II and (alpha)-actinin. J
Neurosci. 2001; 21(2):423-433, [0349] 26. Sano K, Tanihara H,
Heimark R L, Obata S, Davidson M, St John T, Taketani S, Suzuki S.
Protocadherins: a large family of cadherin-related molecules in
central nervous system. EMBO J. 1993; 12(6):2249-2256, [0350] 27.
Pimenta A F, Fischer I, Levitt P. cDNA cloning and structural
analysis of the human limbic-system-associated membrane protein
(LAW). Gene. 1996; 170(2):189-195. [0351] 28. Lim S H, Kwon S K,
Lee M K, Moon J, Jeong D G, Park E, Kim S J, Park B C, Lee S C, Ryu
S E, Yu D Y, Chung B H, Kim F, Myung P K, Lee J R. Synapse
formation regulated by protein tyrosine phosphatase receptor T
through interaction with cell adhesion molecules and Fyn. EMBO J.
2009; 28(22):3564-3578. [0352] 29. Marangi P A, Wieland S T, Fuhrer
C. Laminin-1 redistributes postsynaptic proteins and requires
rapsyn, tyrosine phosphorylation, and Src and Fyn to stably cluster
acetylcholine receptors. J Cell Biol. 2002; 157(5):883-895. [0353]
30. Wayman G A, Impey S, Storm D R. Ca2+ inhibition of type III
adenylyl cyclase in vivo. J Biol Chem. 1995; 270(37):21480-21486.
[0354] 31. Barrios-Rodiles M, Brown K R, Ozdamar B, Bose R, Liu Z,
Donovan R S, Shinjo F, Liu Y, Dembowy J, Taylor I W, Luga V, Przulj
N, Robinson M, Suzuki H, Hayashizaki Y, Jurisica I, Wrana J L.
High-throughput mapping of a dynamic signaling network in mammalian
cells. Science. 2005; 307(5715):1621-1625. [0355] 32. Laporte S A,
Oakley R H, Zhang J, Holt J A, Ferguson S S, Caron M G, Barak L S.
The beta2-adrenergic receptor/betaarrestin complex recruits the
clathrin adaptor AP-2 during endocytosis. Proc Natl Acad Sci USA.
1999; 96(7):3712-3717, [0356] 33. Pucharcos C, Estivill X, de la
Luna S. Intersectin 2, a new multinodular protein involved in
clathrin-mediated endocytosis, FEBS Lett. 2000; 478(1-2):43-51.
[0357] 34. Seifert M, Ampofo C, Mehraein Y, Reichrath J, Welter C.
Expression analysis of human intersectin 2 gene (ITSN2) minor
splice variants showing differential expression in normal human
brain. Oncol Rep. 2007; 17(5):1207-1211. [0358] 35. Fan G H, Yang
W, Sai J, Richmond A. Hsc/Hsp70 interacting protein (hip)
associates with CXCR2 and regulates the receptor signaling and
trafficking. J Biol Chem. 2002; 277(8):6590-6597, [0359] 36.
Antzelevitch C, Pollevick G D, Cordeiro J M, Casis O, Sanguinetti M
C, Aizawa Y, Guerchicoff A, Pfeiffer R, Oliva A, Wollnik B, Gelber
P, Bonaros E P, Jr., Burashnikov E, Wu Y, Sargent J D, Schickel S,
Oberheiden R, Bhatia A, Hsu L F, Haissaguerre M, Schimpf R,
Borggrefe M, Wolpert C. Loss-of-function mutations in the cardiac
calcium channel underlie a new clinical entity characterized by
ST-segment elevation, short QT intervals, and sudden cardiac death.
Circulation. 2007; 115(4):442-449. [0360] 37. Nakamura M, Sunagawa
M, Kosugi T, Sperelakis N. Actin filament disruption inhibits
L-type Ca(2+) channel current in cultured vascular smooth muscle
cells. Am J Physiol Cell Physiol. 2000; 279(2):C480-487, [0361] 38.
Sadeghi A, Doyle A D, Johnson B D, Regulation of the cardiac L-type
Ca2+ channel by the actin-binding proteins alpha-actinin and
dystrophin. Am J Physiol Cell Physiol. 2002; 282(6):C1502-1511.
[0362] 39. Waite A, Tinsley C L, Locke M, Blake D J. The
neurobiology of the dystrophin-associated glycoprotein complex. Ann
Med. 2009; 41(5):344-359.
* * * * *