U.S. patent application number 13/439330 was filed with the patent office on 2013-01-10 for drug carrier and drug carrier kit for inhibiting fibrosis.
This patent application is currently assigned to Nitto Denko Corporation. Invention is credited to Junji Kato, Yoshiro Niitsu, Yasushi Sato.
Application Number | 20130011464 13/439330 |
Document ID | / |
Family ID | 36601829 |
Filed Date | 2013-01-10 |
United States Patent
Application |
20130011464 |
Kind Code |
A2 |
Niitsu; Yoshiro ; et
al. |
January 10, 2013 |
DRUG CARRIER AND DRUG CARRIER KIT FOR INHIBITING FIBROSIS
Abstract
An astrocyte-specific drug carrier containing a retinoid
derivative and/or a vitamin A analog as a constituent; a drug
delivery method with the use of the same; a drug containing the
same; and a therapeutic method with the use of the drug. By binding
a drug carrier to a retinoid derivative such as vitamin A or a
vitamin A analog or encapsulating the same in the drug carrier, a
drug for therapeutic use can be delivered specifically to
astrocytes. As a result, an astrocyte-related disease can be
efficiently and effectively inhibited or prevented while minimizing
side effects. As the drug inhibiting the activity or growth of
astrocytes, for example, a siRNA against HSP47 which is a
collagen-specific molecule chaperone may be encapsulated in the
drug carrier. Thus, the secretion of type I to type IV collagens
can be inhibited at the same time and, in its turn, fibrosis can be
effectively inhibited.
Inventors: |
Niitsu; Yoshiro;
(Sapporo-shi, Hokkaido, JP) ; Kato; Junji;
(Sapporo-shi, Hokkaido, JP) ; Sato; Yasushi;
(Sapporo-shi, Hokkaido, JP) |
Assignee: |
Nitto Denko Corporation
Osaka
JP
567-8680
|
Prior
Publication: |
|
Document Identifier |
Publication Date |
|
US 20120189691 A1 |
July 26, 2012 |
|
|
Family ID: |
36601829 |
Appl. No.: |
13/439330 |
Filed: |
April 4, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11/793736 |
Apr 8, 2008 |
|
|
|
PCT/JP2005/023619 |
Dec 22, 2005 |
|
|
|
13439330 |
Apr 4, 2012 |
|
|
|
Current U.S.
Class: |
424/450 ;
424/400; 514/1.1; 514/19.3; 514/4.3; 514/44A; 514/44R; 514/772;
514/9.5 |
Current CPC
Class: |
A61K 9/14 20130101; A61K
45/06 20130101; A61P 31/14 20180101; A61K 38/1841 20130101; A61P
1/16 20180101; A61K 31/07 20130101; A61K 9/0019 20130101; A61P
11/04 20180101; A61K 31/7088 20130101; A61K 38/1858 20130101; A61P
27/16 20180101; A61P 43/00 20180101; Y10S 514/893 20130101; A61P
35/00 20180101; A61K 47/6911 20170801; Y10T 428/2982 20150115; A61K
9/127 20130101; A61K 38/1833 20130101; A61P 1/18 20180101; A61K
31/07 20130101; A61K 2300/00 20130101; A61K 31/7088 20130101; A61K
2300/00 20130101 |
Class at
Publication: |
424/450 ;
514/772; 424/400; 514/009.5; 514/044.00A; 514/044.00R; 514/001.1;
514/004.3; 514/019.3 |
International
Class: |
A61K 47/10 20060101
A61K047/10; A61K 9/14 20060101 A61K009/14; A61K 38/18 20060101
A61K038/18; A61K 31/713 20060101 A61K031/713; A61P 1/16 20060101
A61P001/16; A61K 38/17 20060101 A61K038/17; A61P 31/14 20060101
A61P031/14; A61P 35/00 20060101 A61P035/00; A61P 1/18 20060101
A61P001/18; A61K 9/127 20060101 A61K009/127; A61K 31/7088 20060101
A61K031/7088 |
Foreign Application Data
Date |
Code |
Application Number |
Dec 22, 2004 |
JP |
2004-382791 |
Claims
1. (canceled)
2. (canceled)
3. (canceled)
4. (canceled)
5. (canceled)
6. (canceled)
7. A medicine comprising (i) a drug carrier comprising a stellate
cell-specific amount of a retinoid and a drug carrier component
other than the retinoid, and (ii) a drug in an amount effective for
controlling the activity or growth of stellate cells.
8. The medicine according to claim 7, wherein the retinoid
comprises vitamin A.
9. The medicine according to claim 7, wherein the retinoid is
contained at 0.2 wt % to 20 wt %.
10. The medicine according to claim 7, wherein the drug carrier is
in a form selected from the group consisting of a polymer micelle,
a liposome, an emulsion, a microsphere, and a nanosphere.
11. (canceled)
12. The medicine according to claim 7, wherein the drug for
controlling the activity or growth of stellate cells is selected
from the group consisting of a TGF.beta. activity inhibitor, a
preparation having HGF activity, an MMP production promoter, a TIMP
production inhibitor, a PPAR.gamma. ligand, an angiotensin activity
inhibitor, a PDGF activity inhibitor, a sodium channel inhibitor,
an apoptosis inducer, and a growth inhibitor.
13. The medicine according to claim 7, wherein the drug for
controlling the activity or growth of stellate cells is selected
from the group consisting of an siRNA, ribozyme, antisense nucleic
acid and DNA/RNA chimera polynucleotide; or a vector expressing
same.
14. The medicine according to claim 13, wherein the drug for
controlling the activity or growth of stellate cells targets
HSP47.
15. A preparation kit for the medicine according to claim 7, the
kit comprising one or more containers containing one or more of the
drug for controlling the activity or growth of stellate cells, the
drug carrier and the retinoid.
16. (canceled)
17. (canceled)
18. (canceled)
Description
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. Ser. No.
11/793,736, filed Apr. 8, 2008, which is a national stage filing
under 35 U.S.C. .sctn.371 of international application
PCT/JP2005/023619, filed Dec. 22, 2005, the disclosures of which
are hereby incorporated by reference.
SEQUENCE LISTING
[0002] The present application is being filed along with a Sequence
Listing in electronic format. The Sequence Listing is provided as a
file entitled KUZU1.sub.--010C1_SEQ.TXT, created Apr. 3, 2012,
which is 4 KB in size. The information in the electronic format of
the Sequence Listing is incorporated herein by reference in its
entirety.
BACKGROUND OF THE INVENTION
[0003] 1. Field of the Invention
[0004] The present invention relates to a drug carrier used in a
drug delivery system (DDS) for stellate cells, a medicine
containing same, and a kit for preparing said medicine and, in
particular, to a medicine and a kit for preparing same wherein an
active ingredient is a drug for controlling the activity or growth
of stellate cells, and especially a drug targeted at an
extracellular matrix constituent molecule secreted by stellate
cells, or at one or more molecules having the function of producing
or secreting an extracellular matrix constituent molecule.
[0005] 2. Description of the Related Art
[0006] Fibrosis of the liver is caused by, though not limited to,
hepatic stellate cells (HSC) being activated as a result of, for
example, viral hepatic disease due to hepatitis B or C virus,
nonalcoholic steatohepatitis, malnutrition-related diabetes,
parasites, infectious diseases such as tuberculosis or syphilis,
intrahepatic congestion due to heart disease, or wound healing of
tissue injury, etc. inside the liver accompanying a disorder in the
passage of bile, etc., and the excessively produced and secreted
extracellular matrix (ECM) such as a plurality of types of collagen
molecules and fibronectin being deposited on interstitial tissue.
The final stage of hepatic fibrosis is hepatic cirrhosis, and since
hepatic failure, hepatocellular carcinoma, etc. are caused, in
order to prevent them and/or inhibit the progress thereof, there is
a desire for the development of a drug carrier and drug carrier kit
for inhibiting at least hepatic fibrosis.
[0007] Furthermore, in the pancreas, chronic pancreatitis develops
as a result of pancreatic fibrosis by the same mechanism as that
for hepatic fibrosis (Madro A et al., Med Sci Monit. 2004 July;
10(7): RA166-70; Jaster R, Mol Cancer. 2004 Oct. 6; 3(1): 26.).
However, effective means for inhibiting the progress of pancreatic
fibrosis or chronic pancreatitis has not yet been found.
[0008] As effective means for inhibiting fibrosis of the liver or
the pancreas, there is a possibility that stellate cells are one of
the important target candidates (Fallowfield J A, Iredale J P,
Expert Opin Ther Targets. 2004 October; 8(5): 423-35; Pinzani M,
Rombouts K. Dig Liver Dis. 2004 April; 36(4): 231-42.). In the
process of fibrosis, stellate cells are activated by cytokine from
Kupffer cells or infiltrating cells and transformed into activated
cells, and there is marked production of extracellular matrix
(ECM). Stellate cells are known as storage cells for vitamin A, and
belong to the myofibroblast family. On the other hand, stellate
cells produce matrix metalloproteinase (MMP), its inhibitory factor
(TIMP), a cytokine such as TGF-.beta. or PDGF, and a growth factor
such as HGF, and play a main role in hepatic fibrosis. Activated
stellate cells increase contractile ability and are involved in the
regulation of blood flow and, furthermore, they increase the
expression of various types of cytokine receptors and become highly
sensitive to cytokine.
[0009] With regard to therapeutic methods for fibrosis that have
been attempted up to the present date, the control of collagen
metabolism, promotion of the collagen degradation system,
inhibition of activation of stellate cells, etc. can be cited. They
include inhibition of TGF.beta. (known as a factor for activating
stellate cells and promoting the production of extracellular matrix
(ECM)) using a truncated TGF.beta. type II receptor (Qi Z et al.,
Proc Natl Acad Sci USA. 1999 Mar. 2; 96(5): 2345-9.), a soluble
TGF.beta. type II receptor (George J et al., Proc Natl Acad Sci
USA. 1999 Oct. 26; 96(22): 12719-24.), HGF (published Japanese
translation 5-503076 of a PCT application; Ueki K et al., Nat Med.
1999 February; 5(2): 226-30.), etc., promotion of the production of
matrix metalloproteinase (MMP) by means of HGF or an MMP
gene-containing vector (Iimuro Y et al., Gastroenterology 2003;
124: 445-458.), inhibition of TIMP, which is an MMP inhibitor, by
means of antisense RNA, etc. (Liu W B et al., World J.
Gastroenterol. 2003 February; 9(2): 316-9), control of the
activation of stellate cells by means of a PPAR.gamma. ligand
(Marra F et al., Gastroenterology. 2000 August; 119(2): 466-78) or
an angiotensin-II type I receptor antagonist (Yoshiji H et al.,
Hepatology. 2001 October; 34 (4 Pt 1): 745-50.), inhibition of the
growth of stellate cells via inhibition of PDGF action by means of
PDGF tyrosine kinase inhibitor, etc. (Liu X J et al., World J.
Gastroenterol. 2002 August; 8(4): 739-45.) and inhibition of the
sodium channel by means of amiloride (Benedetti A et al.,
Gastroenterology. 2001 February; 120(2): 545-56), etc., and
apoptotic induction of stellate cells by means of Compound 861
(Wang L, et al., World J Gastroenterol 2004 October 1; 10(19):
2831-2835), gliotoxin (Orr J G et al., Hepatology. 2004 July;
40(1): 232-42.), etc. However, in all cases, since the specificity
of action and/or the organ specificity are low, there are problems
with the effects and with side effects.
[0010] With regard to collagen protein synthesis, there are many
unclear points with respect to the metabolic route, and a
therapeutic method using a drug that inhibits this has not been
established as a therapeutic method that is efficient and safe
toward a living body in terms of side effects. That is, in a method
in which molecules involved in the production of collagen are
targeted, the specificity for the target cannot be enhanced because
of the diversity of function of the molecules, and the possibility
of causing side effects is high. If collagen, which is the final
product, could be inhibited directly, this would be reasonable as a
common therapeutic method for fibrosis processes, and in order to
do this it would be necessary to control all the various types of
collagen represented by Types I to IV at the same time.
[0011] As effective means for controlling synthesis of various
types of collagen molecules simultaneously without losing
specificity to collagen, a method for controlling the function of
HSP47 can be considered. HSP47 is a collagen-specific molecular
chaperone that is essential for intracellular transport and
molecular maturation, which are common to synthetic processes for
various types of collagen. Therefore, if in stellate cells the
function of HSP47 can be controlled specifically, there is a
possibility of inhibiting hepatic fibrosis, but there are no
reports of such a therapeutic method being attempted.
[0012] The present inventors prepared a ribozyme that specifically
controls the function of HSP47 in a cellular system, and showed
that the production and secretion of collagens can be controlled by
the ribozyme at the same time (Sasaki H. et al. Journal of
Immunology, 2002, 168: 5178-83; Hagiwara S. et al. J Gene Med.
2003, 5: 784-94). In order to specifically control the synthesis of
HSP47, siRNA, which is easier to optimize than ribozyme, can be
employed. The siRNA (small interfering RNAs) used in the present
specification is a general term for double-strand RNA used in RNAi
(RNA interference). RNAi is a phenomenon in which double-strand RNA
(double-strand RNA; dsRNA), which is formed from sense RNA and
antisense RNA and is homologous with a given gene, destroys a
homologous segment of a transcript (mRNA) of the gene. It was
originally exhibited in an experiment using a nematode (Fire A, et
al: Nature (1998) 391: 806-811), and it has been shown that a
similar induction mechanism is present in mammalian cells (Ui-Tei
K, et al: FEBS Lett (2000) 479: 79-82). Furthermore, Elbashir et
al. have shown that a short dsRNA having a length of on the order
of 21 to 23 bp can induce RNAi in a mammalian cell system without
exhibiting cytotoxicity (Elbashir S M, et al: Nature (2001) 411:
494-498). However, in order for the effects of these molecules to
be exhibited effectively, it is necessary to employ a method that
is specific to a target organ. [0013] [Patent Publication 1]
Japanese translation 5-503076 of a PCT application [0014]
[Nonpatent Publication 1] Madro A et al., Med Sci Monit. 2004 July;
10(7): RA166-70 [0015] [Nonpatent Publication 2] Jaster R. Mol
Cancer. 2004 Oct. 6; 3(1): 26 [0016] [Nonpatent Publication 3]
Fallowfield J A, Iredale J P. Expert Opin Ther Targets. 2004
October; 8(5): 423-35 [0017] [Nonpatent Publication 4] Pinzani M,
Rombouts K. Dig Liver Dis. 2004 April; 36(4): 231-42 [0018]
[Nonpatent Publication 5] Qi Z et al., Proc Natl Acad Sci USA. 1999
Mar. 2; 96(5): 2345-9 [0019] [Nonpatent Publication 6] George J et
al., Proc Natl Acad Sci USA. 1999 Oct. 26; 96(22): 12719-24 [0020]
[Nonpatent Publication 7] Ueki K et al., Nat Med. 1999 February;
5(2): 226-30 [0021] [Nonpatent Publication 8] Iimuro Y et al.,
Gastroenterology 2003; 124: 445-458 [0022] [Nonpatent Publication
9] Liu W B et al., World J. Gastroenterol. 2003 February; 9(2):
316-9 [0023] [Nonpatent Publication 10] Marra F et al.,
Gastroenterology. 2000 August; 119(2): 466-78 [0024] [Nonpatent
Publication 11] Yoshiji H et al., Hepatology. 2001 October; 34(4 Pt
1): 745-50 [0025] [Nonpatent Publication 12] Liu X J et al., World
J. Gastroenterol. 2002 August; 8(4): 739-45 [0026] [Nonpatent
Publication 13] Benedetti A et al., Gastroenterology. 2001
February; 120(2): 545-56 [0027] [Nonpatent Publication 14] Wang L
et al., World J Gastroenterol 2004 October 1; 10(19): 2831-2835
[0028] [Nonpatent Publication 15] Orr J G et al., Hepatology. 2004
July; 40(1): 232-42 [0029] [Nonpatent Publication 16] Sasaki H et
al., Journal of Immunology, 2002, 168: 5178-83 [0030] [Nonpatent
Publication 17] Hagiwara S et al., J Gene Med. 2003, 5: 784-94
[0031] [Nonpatent Publication 18] Fire A et al.: Nature (1998) 391:
806-811 [0032] [Nonpatent Publication 19] Ui-Tei K et al.: FEBS
Lett (2000) 479: 79-82 [0033] [Nonpatent Publication 20] Elbashir S
M et al.: Nature (2001) 411: 494-498 [0034] [Nonpatent Publication
21] Yasuhiko Tabata, New Developments in Drug Delivery System DDS
Technology and their Application--Cutting-edge technology for
biomedical research and advanced medical treatment, Medical Do,
ISBN: 4944157932, 2003 [0035] [Nonpatent Publication 22] Mitsuru
Hashida, Drug Delivery Systems--New challenges for drug discovery
and therapy, New Bioscience Series, Kagaku-dojin, ISBN: 4759803858,
1995
SUMMARY OF THE INVENTION
Problems to be Solved by the Invention
[0036] In order to target a tissue and/or an organ, the application
of a drug delivery system (DDS) is one effective means (Yasuhiko
Tabata, New Developments in Drug Delivery System DDS Technology and
their Application--Cutting-edge technology for biomedical research
and advanced medical treatment, Medical Do, ISBN: 4944157932, 2003:
Mitsuru Hashida, Drug Delivery Systems--New challenges for drug
discovery and therapy, New Bioscience Series, Kagaku-dojin, ISBN:
4759803858, 1995). As a drug carrier used in the drug delivery
system (DDS), there are those in which a polymer micelle, a
liposome, a microemulsion, etc. is applied. As a technique for
enhancing the specificity of these carriers toward a target organ,
there are known a technique in which an antibody and/or ligand for
an organ- and/or tissue-specific antigen or receptor is mixed with
or bonded to the carrier, and a technique in which physicochemical
properties of the carrier are utilized, but there is no known
technique for the particular case in which stellate cells are
targeted.
Means for Solving the Problems
[0037] The present invention relates to a drug carrier and a drug
carrier kit that enable a diagnostic and/or therapeutic drug to be
specifically transported to stellate cells. The drug carrier in the
present invention may be in any of polymer micelle, liposome,
emulsion, microsphere, and nanosphere form, and by bonding thereto
or including therein vitamin A (VA), a retinoid derivative such as,
for example, tretinoin, adapalene, or retinol palmitate, or a
vitamin A analogue such as, for example, Fenretinide (4-HPR), a
therapeutic drug can be transported specifically to hepatic
stellate cells. Furthermore, by preparing one in which the drug
carrier includes one molecule or a plurality of molecules selected
from TGF.beta. activity inhibitors such as a truncated TGF.beta.
type II receptor and a soluble TGF.beta. type II receptor, growth
factor preparations such as HGF, MMP production promoters such as
an MMP gene-containing adenovirus vector, a cell activation
inhibitors and/or growth inhibitors including a PPAR.gamma.-ligand,
an angiotensin-II type I receptor antagonist, a PDGF tyrosine
kinase inhibitor, and a sodium channel inhibitor such as amiloride,
and apoptosis inducers such as compound 861 and gliotoxin, and by
orally, or parenterally, for example, intravenously or
intraperitoneally administering it to a patient having a risk of
fibrosis or fibrosis symptoms, or patients having various
fibrosis-related disorders such as, for example, hepatic cirrhosis,
hepatic failure, liver cancer, or chronic pancreatitis, the
activation of stellate cells can be suppressed, and fibrosis and/or
fibrosis-related disease conditions can be prevented, inhibited, or
improved. Alternatively, or in addition thereto, by using the drug
carrier which encloses therein a ribozyme, an antisense RNA, or an
siRNA that specifically inhibits HSP47, which is a
collagen-specific molecular chaperone, or TIMP, which is an MMP
inhibitor, secretion of type I to IV collagens can be inhibited
simultaneously, and as a result fibrogenesis can be inhibited
effectively.
[0038] Therefore, the present invention relates to a stellate
cell-specific drug carrier having a retinoid derivative and/or a
vitamin A analogue as a component.
[0039] Furthermore, the present invention relates to the drug
carrier wherein the retinoid derivative includes vitamin A.
[0040] Moreover, the present invention relates to the drug carrier
wherein the retinoid derivative and/or the vitamin A analogue are
contained at 0.2 to 20 wt %.
[0041] Furthermore, the present invention relates to the drug
carrier wherein it is in any one of polymer micelle, liposome,
emulsion, microsphere, and nanosphere form.
[0042] Moreover, the present invention relates to a medicine for
treating a stellate cell-related disorder, the medicine including
the drug carrier and a drug for controlling the activity or growth
of stellate cells.
[0043] Furthermore, the present invention relates to the medicine
wherein the disorder is selected from the group consisting of
hepatitis, hepatic fibrosis, hepatic cirrhosis, liver cancer,
pancreatitis, pancreatic fibrosis, pancreatic cancer, vocal cord
scarring, vocal cord mucosal fibrosis, and laryngeal fibrosis.
[0044] Moreover, the present invention relates to the medicine
wherein the drug for controlling the activity or growth of stellate
cells is selected from the group consisting of a TGF.beta. activity
inhibitor, a preparation having HGF activity, an MMP production
promoter, a TIMP production inhibitor, a PPAR.gamma. ligand, an
angiotensin activity inhibitor, a PDGF activity inhibitor, a sodium
channel inhibitor, an apoptosis inducer, and an siRNA, ribozyme,
antisense nucleic acid, or DNA/RNA chimera polynucleotide, or a
vector expressing same, that targets an extracellular matrix
constituent molecule produced by stellate cells or one or more
molecules having the function of producing or secreting the
extracellular matrix constituent molecule.
[0045] Furthermore, the present invention relates to the medicine
wherein the molecule having the function of producing or secreting
the extracellular matrix constituent molecule is HSP47.
[0046] Moreover, the present invention relates to the medicine
wherein the drug and the drug carrier are mixed at a place of
medical treatment or in the vicinity thereof.
[0047] Furthermore, the present invention relates to a preparation
kit for the medicine, the kit including one or more containers
containing one or more of the drug for controlling the activity or
growth of stellate cells, a drug carrier constituent, and a
retinoid derivative and/or a vitamin A analogue.
[0048] Moreover, the present invention relates to a method for
treating a stellate cell-related disorder, the method including
administering an effective amount of the medicine to a subject in
need thereof.
[0049] Furthermore, the present invention relates to the method
wherein the disorder is selected from the group consisting of
hepatitis, hepatic fibrosis, hepatic cirrhosis, liver cancer,
pancreatitis, pancreatic fibrosis, pancreatic cancer, vocal cord
scarring, vocal cord mucosal fibrosis, and laryngeal fibrosis.
[0050] Moreover, the present invention relates to the method
wherein the medicine is parenterally administered.
[0051] Furthermore, the present invention relates to use of the
drug carrier in the production of a medicine for treating a
stellate cell-related disorder.
[0052] Moreover, the present invention relates to a drug delivery
method for stellate cells utilizing the drug carrier.
[0053] Furthermore, the present invention also relates to a drug
carrier for inhibiting fibrosis that includes a retinoid derivative
and/or a vitamin A analogue as a component and transports a drug
for controlling the activity or growth of stellate cells
specifically to stellate cells, the drug carrier for inhibiting
fibrosis wherein the retinoid derivative includes vitamin A, the
drug carrier for inhibiting fibrosis wherein the retinoid
derivative and/or the vitamin A analogue are contained at 0.2% to
20%, the drug carrier for inhibiting fibrosis wherein it is in any
one of polymer micelle, liposome, emulsion, microsphere, and
nanosphere form, the drug carrier for inhibiting fibrosis wherein
the drug for controlling the activity or growth of stellate cells
includes one or more drugs selected from a TGF.beta. activity
inhibitor, a preparation having HGF activity, an MMP production
promoter, a TIMP production inhibitor, a PPAR.gamma. ligand, an
angiotensin activity inhibitor, a PDGF activity inhibitor, a sodium
channel inhibitor, and an apoptosis inducer, the drug carrier for
inhibiting fibrosis wherein the drug for controlling the activity
or growth of stellate cells includes an siRNA, a ribozyme, or an
antisense RNA, or a vector expressing same, that targets an
extracellular matrix constituent molecule produced by stellate
cells, or that targets one or more molecules having the function of
producing or secreting the extracellular matrix constituent
molecule, and the drug carrier for inhibiting fibrosis wherein the
molecule having the function of producing or secreting the
extracellular matrix constituent molecule is HSP47.
[0054] Moreover, the present invention relates to a drug carrier
kit for inhibiting fibrosis that includes one or more containers
containing one or more of a drug for controlling the activity or
growth of stellate cells, a drug carrier constituent, and a
retinoid derivative and/or a vitamin A analogue, the drug carrier
kit for inhibiting fibrosis wherein the retinoid derivative
includes vitamin A, the drug carrier kit for inhibiting fibrosis
wherein the retinoid derivative and/or the vitamin A analogue are
contained at 0.2% to 20%, the drug carrier kit for inhibiting
fibrosis wherein it is in any one of polymer micelle, liposome,
emulsion, microsphere, and nanosphere form, the drug carrier kit
for inhibiting fibrosis wherein the drug for controlling the
activity or growth of stellate cells includes one or more drugs
selected from a TGF.beta. activity inhibitor, a preparation having
HGF activity, an MMP production promoter, a TIMP production
inhibitor, a PPAR.gamma. ligand, an angiotensin activity inhibitor,
a PDGF activity inhibitor, a sodium channel inhibitor, and an
apoptosis inducer, the drug carrier kit for inhibiting fibrosis
wherein the drug for controlling the activity or growth of stellate
cells includes an siRNA, a ribozyme, or an antisense RNA, or a
vector expressing same, that targets an extracellular matrix
constituent molecule secreted by stellate cells, or that targets
one or more molecules having the function of producing or secreting
the extracellular matrix constituent molecule, and the drug carrier
kit for inhibiting fibrosis wherein the molecule having the
function of producing or secreting the extracellular matrix
constituent molecule is HSP47.
Effects of the Invention
[0055] By the use of the drug carrier and the drug carrier kit of
the present invention that enable a diagnostic and/or therapeutic
drug to be transported specifically to stellate cells as effective
means for preventing, suppressing, or improving fibrosis and/or
various types of fibrosis-related disorders, innovative therapeutic
effects such as shown by Examples can be provided. That is, since
the drug carrier and the drug carrier kit of the present invention
specifically target stellate cells, clinical conditions that
develop mainly due to stellate cells such as, for example,
fibrosis, can be inhibited efficiently and effectively while
minimizing side effects.
BRIEF DESCRIPTION OF THE DRAWINGS
[0056] FIG. 1 A diagram showing a protocol with respect to
assessment of the effect of gp46-siRNA in vitro using NRK cells,
and determination of optimal sequence, timing, and
concentration.
[0057] FIG. 2 A photographic diagram showing the result of western
blotting of gp46 and actin (24 hour culturing, examination of
optimal sequence).
[0058] FIG. 3 A photographic diagram showing the result of western
blotting of gp46 and actin (24 hour culturing, examination of
optimal concentration).
[0059] FIG. 4 A photographic diagram showing the result of western
blotting of gp46 and actin (concentration 50 nM, examination of
optimal culturing time).
[0060] FIG. 5 A diagram showing a protocol for evaluating
inhibition of expression of collagen by gp46-siRNA in NRK
cells.
[0061] FIG. 6 A graph showing inhibition of collagen synthesis by
siRNA.
[0062] FIG. 7 A photographic diagram showing HSC-specific siRNA
transfection.
[0063] FIG. 8 A photographic diagram for evaluating HSC-specific
siRNA transfection percentage.
[0064] FIG. 9 A photographic diagram for evaluating inhibition of
expression of gp46 by siRNA.
[0065] FIG. 10 A photographic diagram showing azan staining of rat
liver to which DMN had been administered.
[0066] FIG. 11 A diagram showing an LC rat treatment protocol.
[0067] FIG. 12 A photographic diagram showing azan staining of LC
rat liver to which VA-Lip-gp46siRNA had been administered.
[0068] FIG. 13 A diagram showing a method for extracting a stained
portion by means of NIH Image (6 positions being randomly taken
from an azan-stained image).
[0069] FIG. 14 A graph showing the ratio by area occupied by
fibrotic portions in liver histology (Collagen ratio by area,
%).
[0070] FIG. 15 A graph showing the amount of hydroxyproline in
hepatic tissue.
[0071] FIG. 16 A graph showing a survival curve for hepatic
cirrhosis rat to which VA-Lip-gp46siRNA had been intraportally
administered.
[0072] FIG. 17 A photographic diagram showing azan staining of
hepatic tissue of hepatic cirrhosis rat to which VA-Lip-gp46siRNA
had been intraportally administered.
[0073] FIG. 18 A graph showing a survival curve for hepatic
cirrhosis rat to which VA-Lip-gp46siRNA had been intraportally
administered.
[0074] FIG. 19 A photographic diagram showing azan staining of
hepatic tissue of hepatic cirrhosis rat to which VA-Lip-gp46siRNA
had been intraportally administered.
[0075] FIG. 20 A graph showing a survival curve for hepatic
cirrhosis rat to which VA-Lip-gp46siRNA had been intravenously
administered.
[0076] FIG. 21 A graph showing a survival curve for hepatic
cirrhosis rat to which VA-Lip-gp46siRNA had been intravenously
administered.
[0077] FIG. 22 A photographic diagram showing azan staining of
hepatic tissue of hepatic cirrhosis rat to which VA-Lip-gp46siRNA
had been intravenously administered.
[0078] FIG. 23 A diagram showing improvement of VA-Lip-gp46siRNA
transfection efficiency by RBP.
[0079] FIG. 24 A diagram showing inhibition of VA-Lip-gp46siRNA
transfection by anti-RBP antibody.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
[0080] The retinoid derivative and/or vitamin A analogue in the
present invention includes vitamin A as well as a retinoid
derivative or vitamin A analogue in a state in which it is
dissolved in or mixed with a medium that can dissolve or retain
it.
[0081] Any retinoid derivative and/or vitamin A analogue may be
used in the present invention as long as it is actively accumulated
by stellate cells; examples of the retinoid derivative include, but
are not limited to, tretinoin, adapalene, retinol palmitate, and in
particular vitamin A, retinoic acid, and examples of the vitamin A
analogue include, but are not limited to, Fenretinide (4-HPR). The
present invention utilizes the property of stellate cells to
positively incorporate a retinoid derivative and/or a vitamin A
analogue, and by using the retinoid derivative and/or vitamin A
analogue as a drug carrier or by bonding to or being included in
another drug carrier component, a desired material or body is
transported specifically to stellate cells.
[0082] The drug carrier of the present invention therefore may
contain a drug carrier component other than the retinoid derivative
and/or vitamin A analogue. Such a component is not particularly
limited, and any component known in the fields of medicine and
pharmacy may be used, but it is preferable for it to be capable of
including the retinoid derivative and/or vitamin A analogue or
bonding thereto. Examples of such a component include a lipid, for
example, a phospholipid such as glycerophospholipid, a sphingolipid
such as sphingomyelin, a sterol such as cholesterol, a vegetable
oil such as soybean oil or poppy seed oil, mineral oil, and a
lecithin such as egg-yolk lecithin, but the examples are not
limited thereto. Among them, those that can form a liposome are
preferable, for example, natural phospholipids such as lecithin,
semisynthetic phospholipids such as dimyristoylphosphatidylcholine
(DMPC), dipalmitoylphosphatidylcholine (DPPC), and
distearoylphosphatidylcholine (DSPC), and cholesterol.
[0083] Furthermore, the drug carrier of the present invention may
contain a substance that improves incorporation into stellate
cells, for example, retinol-binding protein (RBP).
[0084] The bonding or inclusion of the retinoid derivative and/or
vitamin A analogue with the drug carrier of the present invention
may also be carried out by bonding or including the retinoid
derivative and/or vitamin A analogue with another component of the
drug carrier by chemical and/or physical methods. Alternatively,
bonding or inclusion of the retinoid derivative and/or vitamin A
analogue with the drug carrier of the present invention may also be
carried out by mixing the retinoid derivative and/or vitamin A
analogue having formation-affinity and basic components of the drug
carrier, into the drug carrier components during preparation of the
drug carrier. The amount of retinoid derivative and/or vitamin A
analogue bonded to or included in the drug carrier of the present
invention may be 0.01% to 100% as a ratio by weight relative to the
drug carrier components, preferably 0.2% to 20%, and more
preferably 1% to 5%.
[0085] The drug carrier of the present invention may be in any form
as long as a desired material or body can be transported to target
stellate cells, and examples of the form include, but are not
limited to, polymer micelle, liposome, emulsion, microsphere, and
nanosphere. Furthermore, the drug carrier of the present invention
may include in its interior the substance that is to be
transported, be attached to the exterior of the substance that is
to be transported, or be mixed with the substance that is to be
transported as long as the retinoid derivative and/or vitamin A
analogue included therein is at least partially exposed on the
exterior of the preparation before it reaches the stellate cells at
the latest.
[0086] The drug carrier of the present invention specifically
targets stellate cells and enables a desired effect such as, for
example, inhibition or prevention of fibrosis to be exhibited with
the maximum effect and minimum side effects by efficiently
transporting to stellate cells a desired material or body such as,
for example, a drug for controlling the activity or growth of
stellate cells. The material or body that the present drug carrier
delivers is not particularly limited, but it preferably has a size
that enables physical movement in a living body from an
administration site to the liver, pancreas, etc., where stellate
cells are present. The drug carrier of the present invention
therefore can transport not only a material such as an atom, a
molecule, a compound, a protein, or a nucleic acid but also a body
such as a vector, a virus particle, a cell, a drug release system
constituted from one or more elements, or a micromachine. The
material or body preferably has the property of exerting some
effect on stellate cells, and examples thereof include one that
labels stellate cells and one that controls the activity or growth
of stellate cells.
[0087] Therefore, in one embodiment of the present invention, it is
a `drug for controlling the activity or growth of stellate cells`
that the drug carrier delivers. This may be any drug that directly
or indirectly inhibits the physicochemical actions of stellate
cells involved in the promotion of fibrosis, and examples thereof
include, but are not limited to, TGF.beta. activity inhibitors such
as a truncated TGF.beta. type II receptor and a soluble TGF.beta.
type II receptor, growth factor preparations such as HGF and
expression vectors therefor, MMP production promoters such as an
MMP gene-containing adenovirus vector, TIMP production inhibitors
such as an antisense TIMP nucleic acid, a PPAR.gamma. ligand, cell
activation inhibitors and/or cell growth inhibitors such as an
angiotensin activity inhibitor, a PDGF activity inhibitor, and a
sodium channel inhibitor, and also apoptosis inducers such as
compound 861 and gliotoxin, adiponectin (JP, A, 2002-363094), and a
compound having Rho kinase inhibitory activity such as
(+)-trans-4-(1-aminoethyl)-1-(4-pyridylcarbamoyl)cyclohexane (WO
00/64478). Furthermore, the `drug for controlling the activity or
growth of stellate cells` in the present invention may be any drug
that directly or indirectly promotes the physicochemical actions of
stellate cells directly or indirectly involved in the inhibition of
fibrosis, and examples thereof include, but are not limited to, a
drug for promoting a collagen degradation system, e.g., MMP
production promoters such as an MMP expression vector, HGF, and
drugs having HGF-like activity such as HGF analogues and expression
vectors therefor.
[0088] Other examples of the `drug for controlling the activity or
growth of stellate cells` in the present invention include a drug
for controlling the metabolism of an extracellular matrix such as
collagen, for example, a substance having an effect in inhibiting
the expression of a target molecule, such as siRNA, ribozyme, and
antisense nucleic acid (including RNA, DNA, PNA, and a composite
thereof), a substance having a dominant negative effect, and
vectors expressing same, that target, for example, an extracellular
matrix constituent molecule produced by stellate cells or target
one or more molecules that have the function of producing or
secreting the extracellular matrix constituent molecule.
[0089] The siRNA is a double-strand RNA having a sequence specific
to a target molecule such as an mRNA, and promotes degradation of
the target molecule, thus inhibiting expression of a material
formed thereby such as, for example, a protein (RNA interference).
Since the principle was published by Fire et al. (Nature, 391:
806-811, 1998), a wide range of research has been carried out into
the optimization of siRNA, and a person skilled in the art is
familiar with such techniques. Furthermore, materials other than
siRNA that cause RNA interference or another gene expression
inhibition reaction have been intensively investigated, and there
are currently a large number of such materials.
[0090] For example, JP, A, 2003-219893 describes a double-strand
polynucleotide formed from RNA and DNA that inhibits the expression
of a target gene. This polynucleotide may be a DNA/RNA hybrid in
which one of two strands is DNA and the other is RNA, or a DNA/RNA
chimera in which one portion of the same strand is DNA and the
other portion is RNA. Such a polynucleotide is preferably formed
from 19 to 25 nucleotides, more preferably 19 to 23 nucleotides,
and yet more preferably 19 to 21 nucleotides; in the case of the
DNA/RNA hybrid, it is preferable that the sense strand is DNA and
the antisense strand is RNA, and in the case of the DNA/RNA
chimera, it is preferable that one portion on the upstream side of
the double-strand polynucleotide is RNA. Such a polynucleotide may
be prepared so as to have any sequence in accordance with a
chemical synthetic method known per se.
[0091] With regard to the target molecule, for example, a molecule
that can inhibit the secretion of all extracellular matrix
constituent molecules together is preferable, and examples of such
a molecule include, but are not limited to, HSP47. HSP47 or a
homologous gene sequence thereof is disclosed as, for example,
GenBank accession No. AB010273 (human), X60676 (mouse), or M69246
(rat, gp46).
[0092] Preferred examples of the material that is transported by
the drug carrier of the present invention include an siRNA, a
DNA/RNA hybrid or chimera polynucleotide, and an antisense nucleic
acid, that targets HSP47.
[0093] Examples of a material that is delivered by the drug carrier
of the present invention include a drug for inhibiting fibrosis
such as, for example, G-CSF (WO 2005/082402), a thrombomodulin-like
protein (JP, A, 2002-371006), and keratan sulfate oligosaccharide
(JP, A, 11-269076).
[0094] The material or body that is delivered by the drug carrier
of the present invention may or may not be labeled. Labeling is
useful at the testing and research level in particular since the
feasibility of transport or an increase or decrease in stellate
cells can be monitored. A label may be selected from those known to
a person skilled in the art; for example, any radioactive isotope,
a material that can bond to a material to be labeled (e.g. an
antibody), a fluorescent material, a fluorophore, a
chemiluminescent material, and an enzyme.
[0095] The present invention also relates to a medicine for
treating a stellate cell-related disorder, the medicine containing
the drug carrier and the drug for controlling the activity or
growth of stellate cells, and relates to the use of the drug
carrier in the production of a medicine for treating a stellate
cell-related disorder. The stellate cell-related disorder referred
to here means a disorder in which stellate cells are directly or
indirectly involved in the process of the disorder, that is, the
onset, exacerbation, improvement, remission, cure, etc. of the
disorder, and examples thereof include hepatic disorders such as
hepatitis, in particular chronic hepatitis, hepatic fibrosis,
hepatic cirrhosis, and liver cancer, and pancreatic disorders such
as pancreatitis, in particular chronic pancreatitis, pancreatic
fibrosis, and pancreatic cancer. Furthermore, according to recent
reports, since stellate cells are present in the vocal cord (e.g.
Fuja T J et al., Cell Tissue Res. 2005; 322(3): 417-24), the
above-mentioned disorders include disorders of the vocal cord and
larynx such as vocal cord scarring, vocal cord mucosal fibrosis,
and laryngeal fibrosis.
[0096] In the medicine of the present invention, the drug carrier
may include a drug in its interior, be attached to the exterior of
a drug-containing substance, or be mixed with a drug as long as the
retinoid derivative and/or vitamin A analogue included in the drag
carrier is at least partially exposed on the exterior of the
preparation before it reaches the stellate cells at the latest.
Therefore, depending on the route of administration or manner in
which the drug is released, the medicine may be covered with an
appropriate material, such as, for example, an enteric coating or a
material that disintegrates over time, or may be incorporated into
an appropriate drug release system.
[0097] The medicine of the present invention may be administered
via various types of route including oral and parenteral routes;
examples thereof include, but are not limited to, oral,
intravenous, intramuscular, subcutaneous, local, rectal,
intraarterial, intraportal, intraventricular, transmucosal,
percutaneous, intranasal, intraperitoneal, intrapulmonary, and
intrauterine routes, and the medicine may be prepared in a form
appropriate for each administration route. Such a form and a
preparation method may employ any known form and method as
appropriate (e.g. `Hyoujun Yakuzaigaku` (Standard Pharmaceutics),
Ed. Y. Watanabe et al., Nankodo, 2003, etc.).
[0098] Examples of forms suitable for oral administration include,
but are not limited to, powder, granule, tablet, capsule, liquid,
suspension, emulsion, gel, and syrup, and examples of forms
suitable for parenteral administration include injections such as
injectable solution, injectable suspension, injectable emulsion,
and an on-site preparation type injection. The formulation for
parenteral administration may be in the form of an aqueous or
nonaqueous isotonic sterile solution or suspension.
[0099] The drug carrier or the medicine of the present invention
may be supplied in any configuration, but from the viewpoint of
storage stability, it is preferably provided in a configuration
that allows on-site preparation, for example, in a configuration
that allows a doctor and/or a pharmacist, a nurse, or another
paramedic to prepare it at the place of medical treatment or in the
vicinity thereof. In this case, the drug carrier or the medicine of
the present invention is provided as one or more containers
containing at least one essential component therefor, and is
prepared prior to use, for example, within 24 hours, preferably
within 3 hours, and more preferably immediately prior to use. When
carrying out the preparation, a reagent, a solvent, preparation
equipment, etc. that are normally available at a place of
preparation may be used as appropriate.
[0100] The present invention therefore includes a drug carrier or
medicine preparation kit containing one or more containers
containing one or more of a drug carrier constituent, a retinoid
derivative and/or a vitamin A analogue, and/or a drug, and also
includes an essential component for the drug carrier or the
medicine provided in the form of such a kit. The kit of the present
invention may contain, in addition to those described above, a
description, etc. in which a preparation method or an
administration method for the drug carrier and the medicine of the
present invention is described. Furthermore, the kit of the present
invention may contain all components for completing the drug
carrier or the medicine of the present invention but need not
necessarily contain all of the components. The kit of the present
invention therefore need not contain a reagent or a solvent that is
normally available at a place of medical treatment, an experimental
facility, etc. such as, for example, sterile water, saline, or a
glucose solution.
[0101] The present invention further relates to a method for
treating a stellate cell-related disorder, the method including
administering an effective amount of the medicine to a subject in
need thereof. The effective amount referred to here is an amount
that suppresses onset of the target disorder, reduces symptoms
thereof, or prevents progression thereof, and is preferably an
amount that prevents onset of the target disorder or cures the
target disorder. It is also preferably an amount that does not
cause an adverse effect that exceeds the benefit from
administration. Such an amount may be determined as appropriate by
an in vitro test using cultured cells, etc. or by a test in a model
animal such as a mouse, a rat, a dog, or a pig, and such test
methods are well known to a person skilled in the art.
[0102] The dosage of a medicine administered by the method of the
present invention depends on the type of drug used or the type of
retinoid derivative and/or vitamin A analogue and, for example,
when an siRNA for HSP47 is used as the drug, the weight of the drug
is, for example, 0.01 to 45 mg/kg/day, preferably 0.1 to 30
mg/kg/day, more preferably 1 to 20 mg/kg/day, and most preferably 4
to 6 mg/kg/day. When vitamin A is used as the retinoid derivative
and/or vitamin A analogue, vitamin A is typically administered at a
dosage of 10 to 20 mg/kg/day. The retinoid derivative and/or
vitamin A analogue contained in the drug carrier and the dosage of
the drug used in the method of the present invention are either
known to a person skilled in the art or are determined as
appropriate by the above-mentioned test, etc.
[0103] A specific dosage of a medicine administered in the method
of the present invention can be determined while taking into
consideration various conditions of a subject that requires
treatment, for example, the severity of symptoms, general health
conditions of the subject, age, weight, sex of the subject, diet,
the timing and frequency of administration, a medicine used in
combination, responsiveness to treatment, and compliance with
treatment, and it might be different from the above-mentioned
typical dosage, but in such a case, these methods are still
included in the scope of the present invention.
[0104] With regard to the administration route, there are various
routes including both oral and parenteral routes such as, for
example, oral, intravenous, intramuscular, subcutaneous, local,
rectal, intraarterial, intraportal, intraventricular, transmucosal,
percutaneous, intranasal, intraperitoneal, intrapulmonary, and
intrauterine routes.
[0105] The frequency of administration depends on the properties of
the medicine used and the above-mentioned conditions of the subject
and may be, for example, a plurality of times a day (i.e. 2, 3, 4,
5, or more times per day), once a day, every few days (i.e. every
2, 3, 4, 5, 6, or 7 days, etc.), once a week, or once every few
weeks (i.e. once every 2, 3, or 4 weeks, etc.).
[0106] In the method of the present invention, the term `subject`
means any living individual, preferably an animal, more preferably
a mammal, and yet more preferably a human individual. In the
present invention, the subject may be healthy or affected with some
disorder, and in the case of treatment of a disorder being
intended, the subject typically means a subject affected with the
disorder or having a risk of being affected.
[0107] Furthermore, the term `treatment` includes all types of
medically acceptable prophylactic and/or therapeutic intervention
for the purpose of the cure, temporary remission, prevention, etc.
of a disorder. For example, when the disorder is hepatic fibrosis,
the term `treatment` includes medically acceptable intervention for
various purposes including delaying or halting the progression of
fibrosis, regression or disappearance of lesions, prevention of the
onset of fibrosis, or prevention of recurrence.
[0108] The present invention also relates to a method for
delivering a drug to stellate cells using the drug carrier. This
method includes, but is not limited to, a step of supporting a
substance to be delivered on the drug carrier, and a step of
administering or adding the drug carrier carrying the substance to
be delivered to a stellate cell-containing living body or medium,
such as, for example, a culture medium. These steps may be achieved
as appropriate in accordance with any known method, the method
described in the present specification, etc. This delivery method
may be combined with another delivery method, for example, another
delivery method in which an organ where stellate cells are present
is the target, etc.
EXAMPLES
[0109] The Examples below are only intended to explain the present
invention, and the scope of the present invention is not limited by
specific numeric values and procedures shown in the Examples.
Example 1
Preparation of siRNA for gp46
[0110] Among optimal sequences for siRNA recognition in targeting a
base sequence of HSP47, which is a common molecular chaperone for
collagens (types I to IV), Sequences A and B were prepared in
accordance with an siRNA oligo design program by iGENE
Therapeutics, Inc. Sequence C was prepared by searching on the
Internet using the siRNA Target Finder
(http://www.ambion.com/techlib/misc/siRNA_finder.html) from Ambion,
Inc. and selecting 19 base sequences that would become a target for
rat gp46 (human HSP47 homologue, GenBank Accession No. M69246).
When carrying out the design, care was taken in 1) starting at 75
to 100 bases downstream from the initiation codon, 2) positioning
the first AA dimer, and 3) making sure that the GC content was 30%
to 70%. In this example, siRNAs having the sequences below were
prepared. TABLE-US-00001 A: GUUCCACCAUAAGAUGGUAGACAAC (25 base
forward direction strand siRNA starting at 757th in the sequence,
SEQ ID NO: 1) B: CCACAAGUUUUAUAUCCAAUCUAGC (25 base forward
direction strand siRNA starting at 1626th in the sequence, SEQ ID
NO: 2) C: GAAACCUGUAGAGGCCGCA (19 base forward direction strand
siRNA starting at 64th in the sequence, SEQ ID NO: 3)
Example 2
Inhibition of gp46 Expression by Prepared siRNA
[0111] Normal rat kidney cells (NRK cells), which had rat gp46 and
were fibroblasts producing collagen, were transfected with 0.1 nM
to 50 nM siRNA and cultured for 12 to 48 hours (FIG. 1). The amount
of expression of gp46 was checked by the western blot method (FIGS.
2 to 4, upper band corresponding to gp46, lower band corresponding
to actin control). All of the siRNAs inhibited the expression of
gp46 protein remarkably compared with a vehicle (FIG. 2). In the
experiment below, siRNA Sequence A, which showed the strongest
effect, was used. Inhibition by siRNA was concentration dependent
(FIG. 3); protein expression by gp46 was about 90% inhibited by 50
nM siRNA at 48 hours (FIG. 4).
Example 3
Inhibition of Collagen Synthesis by Prepared siRNA
[0112] In order to examine the amount of collagen synthesized,
.sup.3H-proline was added to the culture supernatant of rat
fibroblasts (NRK cells) under the above-mentioned conditions (siRNA
concentration 50 mM, time 48 hours), and after transfection the
amount of .sup.3H in secreted protein was examined (FIG. 5). The
amount of collagen synthesized was calculated from the ratio of
protein secreted in the supernatant to protein degraded by
collagenase when culturing gp46siRNA-transfected fibroblasts in the
presence of .sup.3H-proline in accordance with a report by
Peterkofsky et al. (Peterkofsky et al., Biochemistry. 1971 Mar. 16;
10(6): 988-94). collagen .times. .times. synthesis .times. .times.
ratio = collagenase .times. - .times. sensitive .times. .times.
fraction .times. 100 ( 5.4 .times. collatenase .times. - .times.
insensitive .times. .times. fraction + collagenase .times. -
.times. sensitive .times. .times. fraction ) [ Equation .times.
.times. 1 ] ##EQU1##
[0113] The collagen synthesis ratio in rat fibroblasts decreased by
about 40% compared with a Control group (FIG. 6).
Example 4
Specific Transfection of Nucleic Acid into Hepatic Stellate Cells
(HSC)
[0114] An emulsion (VA-Lip-GFP) was prepared by mixing GFP
expression plasmid and liposome-encapsulated VA formed by mixing
10% VA and liposome, and after it was intraportally administered to
a rat, hepatic tissue was collected and fixed. The emulsion was
prepared by supposing that the amount of plasma for a 200 g rat was
about 10 mL, and setting the concentrations of VA and GFP in portal
blood at 10 .mu.M. Specifically, 25 mg of all-trans-retinol (VA)
was first dissolved in 87 .mu.L of DMSO thus to give a 100 mM stock
solution. 1 .mu.L of this VA stock solution was mixed with 10 .mu.L
of lipofectamine and 179 .mu.L of PBS, 10 .mu.g of GFP expression
plasmid was further added thereto to give a total of 200 .mu.L, and
the mixture was vortexed for 3 minutes to give VA-Lip-GFP. The
abdomen of an SD rat was opened, and the VA-Lip-GFP was slowly
injected into a peripheral portal vein. 48 hours after the
injection, hepatic tissue was harvested. Since compared with other
hepatic cells intermediate filament desmin is specifically
expressed in hepatic stellate cells (HSC), when fixed hepatic
tissue was stained with Alexa Fluor 568-labeled anti-desmin
antibody, and a fluorescence double image with GFP was examined, it
was confirmed that GFP was expressed within the hepatic stellate
cells (HSC) (FIG. 7). For untreated controls and a group to which
the GFP expression plasmid vector alone was administered,
expression in rat hepatic stellate cells was not observed, but in a
group to which VA-Lip-GFP was administered, expression of GFP was
observed specifically in stellate cells.
Example 5
Quantitative Analysis of Nucleic Acid Transfection Rate
[0115] In the same manner as in Example 4, except that FITC-labeled
gp46siRNA was used instead of the GFP expression plasmid, an
emulsion (VA-Lip-gp46siRNA (FITC)) containing VA-encapsulated
liposome and FITC-labeled gp46siRNA was prepared, and intraportally
administered to an SD rat (10 .mu.g as the amount of siRNA/200
.mu.L). 48 hours after administration hepatic tissue was harvested,
.alpha.SMA (smooth muscle actin), which compared with other hepatic
cells is expressed specifically in HSC, was stained with Alexa
Fluor 568-labeled anti-.alpha.SMA antibody, cell nuclei were
stained with DAPI, and a fluorescence image was examined by a
confocal laser scanning microscope (LSM). As shown on the left-hand
side of FIG. 8, in a group to which VA-Lip-gp46siRNA (FITC) was
administered, a large number of cells emitting both green
fluorescence due to FITC and red fluorescence due to Alexa Fluor
568 were observed, and when a quantitative analysis was carried out
by NIH Image (the number of cells was counted by selecting any 10
fields from a .times.1000 fluorescence microscope photograph), the
transfection efficiency was 77.6% (average of 10 fields). On the
other hand, in a group to which Lip-gp46siRNA (FITC) containing no
VA was administered, the transfection efficiency was a low value of
14.0% and, moreover, transfection into cells other than stellate
cells was observed at 3.0% (right-hand side of FIG. 8). It has been
found from the results above that the transfection efficiency into
stellate cells is increased remarkably by including VA.
Example 6
Inhibition of Expression of gp46 by VA-Lip-gp46siRNA
[0116] With regard to another section of the tissue harvested in
Example 5, gp46 was stained with Alexa Fluor 568-labeled anti-HSP47
antibody and cell nuclei were stained with DAPI, and a fluorescence
image was examined by a confocal laser scanning microscope. As
shown in FIG. 9, it was observed that in a group to which
VA-Lip-gp46siRNA was administered, expression of gp46, which can be
observed as a red fluorescence (right-hand side in the figure), was
markedly reduced compared with a control group to which was
administered VA-Lip-random siRNA containing random siRNA, which was
not specific to gp46 (left-hand side in the figure). The expression
inhibition rate relative to an average of 6 fields of the control
group was 75%, which was extremely high, when the number of
gp46-negative cells was examined by selecting any 10 fields from a
.times.1000 fluorescence microscope photograph using NIH Image in
the same manner as in Example 7.
Example 7
Treatment of LC Rat (Intraportal Administration 1)
[0117] In accordance with a report by Jezequel et al. (Jezequel A M
et al., J. Hepatol. 1987 October; 5(2): 174-81), an LC model rat
was prepared using Dimethylnitrosamine (DMN) (FIG. 10).
Specifically, a 1 mL/kg dose of 1% Dimethylnitrosamine (DMN)
(intraperitoneal administration) was administered to a 5 week-old
SD rat (male) 3 straight days per week. As already reported, an
increase in fiber was observed from the 2nd week, and in the 4th
week this was accompanied by the findings of marked fibrosis,
destruction of hepatic lobule structure, and formation of
regenerative nodules being observed (FIG. 11). Then, by the same
method as in Example 4, an emulsion (VA-Lip-gp46siRNA) was prepared
by formulating gp46siRNA as a liposome and mixing with 10% VA, and
was administered. Administration of VA-Lip-gp46siRNA was started in
the 3rd week, by which time sufficient fibrosis was observed, and
evaluation was carried out in the 4th and 5th weeks. Since it was
confirmed by Example 2 that the effects were observed for up to 48
hours in vitro, administration was carried out twice a week (FIG.
11). The amount administered was determined in accordance with a
report in which siRNA was directly injected (McCaffery et al.,
Nature. 2002 Jul. 4; 418(6893): 38-9), and was 40 .mu.g as the
total amount of siRNA. From azan staining of the liver after
administration of siRNA, in the 4th week there was no apparent
difference between a group to which saline had been administered, a
group to which siRNA (random) had been administered, and a group to
which siRNA (gp46) had been administered, but in the 5th week a
decrease in the amount of fiber was observed for the group to which
gp46siRNA had been administered (FIG. 12). In order to
quantitatively analyze the amount of fiber, an unstained portion
was extracted using NIH Image, its area was measured (FIG. 13), and
a significant decrease in the area of collagen was observed for the
group to which gp46siRNA had been administered (FIG. 14).
Furthermore, in order to evaluate the degree of fibrosis using
another measure, the amount of hydroxyproline, which is an
indicator for fibrosis, was quantitatively measured by a standard
method. Specifically, after 20 mg of freeze-dried hepatic tissue
was hydrolyzed with HCl for 24 hours, the reaction liquid was
centrifuged, and the supernatant was treated with a reagent such as
Ehrlich's solution and centrifuged. The supernatant was recovered,
and the amount of hydroxyproline in the hepatic tissue was measured
by measuring the absorbance at 560 nm (Hepatology 1998 November;
vol. 28: 1247-1252). As shown in FIG. 15, in the group to which
gp46siRNA had been administered, the amount of hydroxyproline
became very small.
Example 8
Treatment of LC Rat (Intraportal Administration 2)
[0118] Furthermore, in order to examine a change in the survival
rate by administration of the medicine of the present invention, in
accordance with a method by Qi Z et al. (Proc Natl Acad Sci USA.
1999 Mar. 2; 96(5): 2345-9.), an LC model rat was prepared using
Dimethylnitrosamine (DMN) in an amount that was increased by 20%
over the normal amount. In this model, a total of 4 intraportal
administrations were carried out in the 1st and 2nd weeks.
Administration details were: PBS, Lip-gp46siRNA, VA-Lip-random
siRNA, and VA-Lip-gp46siRNA (n=7 for each group). After the 3rd
week, all of the controls (the group to which PBS had been
administered, the group to which VA-Lip-random siRNA had been
administered, and the group to which Lip-gp46siRNA had been
administered) were dead, but 6 out of 7 survived for the group to
which VA-Lip-gp46siRNA had been administered (FIG. 16).
Furthermore, in azan staining of the liver on the 21st day, an
apparent decrease in the amount of fiber was observed for the group
to which gp46siRNA had been administered (FIG. 17).
Example 9
Treatment of LC Rat (Intraportal Administration 3)
[0119] In another experiment, intraportal administration was
carried out from the 3rd week for LC model rats (1% DMN 1 mg/kg
intraperitoneally administered 3 times a week) prepared in
accordance with the method by Qi Z et al. and a method by Ueki T et
al. (Nat Med. 1999 February; 5(2): 226-30), as shown in the table
below (n=6 for each group). PBS was added to each substance to be
administered so as to make a total volume of 200 .mu.L, and the
frequency of administration was once a week. TABLE-US-00002 TABLE 1
Treatment Content of group administration Dosage 9-1 VA VA 200 nmol
9-2 Lip-gp46siRNA liposome 100 nmol, gp46siRNA 20 .mu.g 9-3
VA-Lip-random siRNA VA 200 nmol, liposome 100 nmol, random- siRNA
20 .mu.g 9-4 VA-Lip-gp46siRNA VA 200 nmol, liposome 100 nmol,
gp46siRNA 20 .mu.g
[0120] From the results, in the groups other than the group to
which the medicine of the present invention had been administered
(treatment group 9-4), all 6 rats were dead by the 45th day after
starting administration of DMN, but in the group to which the
medicine of the present invention had been administered, all of the
individuals apart from one case, which was dead on the 36th day,
survived for more than 70 days after starting administration of DMN
(FIG. 18). For the dead individuals, the amount of hepatic fiber
was quantitatively analyzed based on the area of collagen in the
same manner as in Example 7, and the increase in the amount of
hepatic fiber was remarkably inhibited by administration of
VA-Lip-gp46siRNA (FIG. 19).
Example 10
Treatment of LC Rat (Intravenous Administration)
[0121] Intravenous administration was carried out from the 3rd week
for LC model rats (1% DMN 1 .mu.g/BW (g) intraperitoneally
administered 3 times a week) prepared in the same manner as in
Example 9, as shown in the table below (n=6 for each group). PBS
was added to each substance to be administered so as to make a
total volume of 200 .mu.L. The administration period was up to
death except that it was up to the 7th week for Group 10-4 and the
6th week for Group 10-10. TABLE-US-00003 TABLE 2 Treatment Content
of Dosage Frequency of group administration administration 10-1 VA
VA 200 nmol Twice a week 10-2 Lip-gp46siRNA liposome 100 nmol,
gp46siRNA 100 .mu.g 10-3 VA-Lip-random VA 200 nmol, liposome 100
siRNA nmol, random-siRNA 100 .mu.g 10-4 VA-Lip- VA 200 nmol,
liposome 100 gp46siRNA nmol, gp46siRNA 100 .mu.g 10-5 PBS 200 .mu.L
Three times a week 10-6 VA VA 200 nmol 10-7 VA-Lip VA 200 nmol,
liposome 100 nmol 10-8 Lip-gp46siRNA liposome 100 nmol, gp46siRNA
150 .mu.g 10-9 VA-Lip-random VA 200 nmol, liposome 100 siRNA nmol,
random-siRNA 150 .mu.g 10-10 VA-Lip- VA 200 nmol, liposome 100
gp46siRNA nmol, gp46siRNA 150 .mu.g
[0122] From the results, in the groups other than the groups to
which the medicine of the present invention had been administered
(treatment groups 10-4 and 10-10), all 6 rats were dead by the 45th
day after starting administration of DMN, but in the groups to
which the medicine of the present invention had been administered,
all of the individuals, apart from a case in which two rats were
dead on the 45th day in treatment group 10-4, survived for more
than 70 days after starting administration of DMN (FIGS. 20 and
21). For the dead individuals, the amount of hepatic fiber was
quantitatively analyzed in the same manner as in Example 7, and the
increase in the amount of hepatic fiber was remarkably inhibited by
administration of VA-Lip-gp46siRNA (FIG. 22).
[0123] The above-mentioned results show that the medicine of the
present invention is extremely effective for the prevention and
treatment of fibrosis, in which stellate cells are involved.
Example 11
Improvement of Results by RBP (Retinol-Binding Protein)
[0124] The influence of RBP on VA-Lip-gp46siRNA transfection
efficiency was examined using LI90, which is a cell line derived
from human hepatic stellate cells. 100 nM of VA-Lip-gp46siRNA
(FITC) prepared in Example 5, together with various concentrations
(i.e. 0, 0.1, 0.5, 1, 2, 4, or 10%) of FBS (fetal bovine serum),
were added to LI90 during culturing and incubated for 48 hours, a
fluorescence image was observed by LSM, and the amount of siRNA
incorporated into individual cells was quantitatively analyzed by
FACS. FBS contained about 0.7 mg/dL of RBP. As shown in FIG. 23,
FBS (RBP) gave a concentration-dependent increase in the amount of
siRNA transfection. Subsequently, 100 nM of VA-Lip-gp46siRNA (FITC)
and 4% FBS, together with 10 .mu.g (21.476 nmol) of anti-RBP
antibody, were added to LI90 during culturing, and the siRNA
transfection efficiency was evaluated in the same manner. As shown
in FIG. 24, the increase in the amount of transfection by RBP was
markedly decreased by the addition of anti-RBP antibody. The
above-mentioned results show that RBP is effective in further
enhancing transfection of the medicine of the present
invention.
SEQUENCE LISTING
<160> 3
<210> 1
<211> 25
<212> RNA
<213> Artificial Sequence
<220>
<223> siRNA for rat gp46
<400> 1
guuccaccau aagaugguag acaac 25
<210> 2
<211> 25
<212> RNA
<213> Artificial Sequence
<220>
<223> siRNA for rat gp46
<400> 2
ccacaaguuu uauauccaau cuagc 25
<210> 3
<211> 19
<212> RNA
<213> Artificial Sequence
<220>
<223> siRNA for rat gp46
<400> 3
gaaaccugua gaggccgca 19
Sequence CWU 1
1
3 1 25 RNA Artificial Sequence siRNA for rat gp46 1 guuccaccau
aagaugguag acaac 25 2 25 RNA Artificial Sequence siRNA for rat gp46
2 ccacaaguuu uauauccaau cuagc 25 3 19 RNA Artificial Sequence siRNA
for rat gp46 3 gaaaccugua gaggccgca 19
* * * * *
References