U.S. patent application number 13/461086 was filed with the patent office on 2012-12-20 for methods for quantifying microrna precursors.
This patent application is currently assigned to THE OHIO STATE UNIVERSITY RESEARCH FOUNDATION. Invention is credited to Thomas D. Schmittigen.
Application Number | 20120322063 13/461086 |
Document ID | / |
Family ID | 37943247 |
Filed Date | 2012-12-20 |
United States Patent
Application |
20120322063 |
Kind Code |
A1 |
Schmittigen; Thomas D. |
December 20, 2012 |
METHODS FOR QUANTIFYING MICRORNA PRECURSORS
Abstract
The present invention is directed to methods, reagents, kits and
compositions for identifying and quantifying microRNA (miRNA)
precursor expression in a biological sample. The method uses
gene-specific primers and reverse transcriptase to convert the
primary miRNA precursors (pri-miRNA) and pre-miRNA precursors
(pre-miRNAs) to cDNA. The method also uses amplification reactions
using gene specific forward and reverse primers that are targeted
to the hairpin sequence of pri- and pre-microRNA precursors to
detect the expression levels of both the pri- and the pre-micoRNAs.
In one embodiment, the amplification reaction is a real-time PCR
wherein the level of PCR amplification products produced is related
to the levels of the microRNA precursors in the biological sample.
In another embodiment, a probe is used to distinguish between
similar isoforms of microRNA precursors. In another embodiment, the
expression levels of a pre-miRNA precursor is calculated by using
primers and amplification reactions that detect the pri-miRNA
together with amplification reactions and primers that detect both
pri- and pre-miRNAs, and calculating the difference.
Inventors: |
Schmittigen; Thomas D.;
(Granville, OH) |
Assignee: |
THE OHIO STATE UNIVERSITY RESEARCH
FOUNDATION
Columbus
OH
|
Family ID: |
37943247 |
Appl. No.: |
13/461086 |
Filed: |
May 1, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11816767 |
Aug 21, 2007 |
8192938 |
|
|
PCT/US06/06800 |
Feb 24, 2006 |
|
|
|
13461086 |
|
|
|
|
60656109 |
Feb 24, 2005 |
|
|
|
Current U.S.
Class: |
435/6.11 ;
435/6.12; 536/24.33 |
Current CPC
Class: |
C12Q 1/68 20130101; C12Q
1/6876 20130101; C12Q 1/68 20130101; C12Q 2525/207 20130101 |
Class at
Publication: |
435/6.11 ;
536/24.33; 435/6.12 |
International
Class: |
C07H 21/04 20060101
C07H021/04; C12Q 1/68 20060101 C12Q001/68 |
Goverment Interests
STATEMENT OF GOVERNMENT SUPPORT
[0002] This invention is supported, at least in part, by Grant No.
CA107435 from the National Institutes of Health, USA. The U.S.
government has certain rights in this invention.
Claims
1-27. (canceled)
28. A kit comprising at least one gene-specific reverse primer
targeted to a first sequence within a hairpin sequence, wherein
said hairpin sequence is shared by both a pri-microRNA precursor
and its corresponding pre-microRNA precursor and the at least one
gene-specific reverse primer binds substantially within the hairpin
sequence.
29. The kit of claim 28, further comprising at least one forward
primer targeted to a second sequence within the hairpin sequence,
wherein the forward and the reverse primer are capable of
amplifying a target nucleotide sequence that comprises a portion of
the hairpin sequence and both primers bind substantially within the
hairpin sequence.
30. The kit of claim 28, wherein the forward primer is targeted to
the 5' end of the hairpin sequence and the reverse primer is
targeted to the 3' end of the hairpin structure
31. The kit of claim 28, further comprising at least one
oligonucleotide probe targeted to a third sequence within the
hairpin sequence, wherein said third sequence lies in between the
first and the second sequences.
32. The kit of claim 31, wherein the probe is a molecular beacon
probe or an exonuclease probe.
33. The kit of claim 32, wherein the exonuclease probe is a TaqMan
probe.
34. A kit for detecting a pre-microRNA precursor in a sample
containing the pre-microRNA precursor and its corresponding
pri-microRNA precursor, wherein said pri-microRNA and pre-microRNA
precursors comprise a common hairpin sequence, the kit comprising:
(a) a first primer targeted to a sequence that is partially
upstream or downstream of the hairpin sequence; and (b) a second
primer targeted to a sequence within the hairpin sequence, wherein
both primers bind substantially within the hairpin sequence.
Description
REFERENCE TO RELATED APPLICATION
[0001] This application claims priority from U.S. Provisional
Application Ser. No. 60/656,109, filed Feb. 24, 2005, the entire
content of which is incorporated herein by reference.
BACKGROUND
[0003] Mature microRNAs.sup.1 (miRNAs) are endogenous, .about.21
nucleotide (nt), non-coding RNAs whose primary function is believed
to be translational repression of protein coding mRNAs. The mature
miRNA is processed from longer precursor molecules by the enzymes
drosha and Dicer. .sup.1 The abbreviations used are: cDNA,
complementary DNA; C. elegans, Caenorhabditis elegans; CLL, chronic
lymphocytic leukemia; LMW, low molecular weight; miRNA, microRNA;
mRNA, messenger RNA; nt, nucleotides; PCR, polymerase chain
reaction; pri-miRNA, primary microRNA precursor; RT-PCR, reverse
transcriptase polymerase chain reaction; Tm, melting
temperature.
[0004] miRNAs have been found in C. elegans, Drosophila, plants,
mice and humans, suggesting an ancient and widespread role for
these non-coding RNAs. To date, over 3,500 miRNAs have been
discovered, including 114 in C. elegans, 332 in humans and 270 in
mice. An algorithm termed miRscan was developed to predict the
number of miRNAs in a genome based upon the phylogenetically
conserved foldback structure of the miRNA. miRscan predicts that
the total number of miRNAs in the human genome to be 200-255, or
about 1% of the predicted genes in humans.
[0005] The founding members of the miRNA class of genes, lin-4 and
let-7, are expressed temporally during development of C. elegans.
In addition to regulating development in C. elegans, miRNAs have
been shown to negatively regulate the proapoptotic gene hid during
Drosophila development. Thus, levels of miRNA or miRNA precursors
in samples taken from C. elegans or Drosophila can be used to
determine the stage of development of these two organisms.
[0006] miRNAs are also associated with various diseases. For
example, two human miRNAs (miR-15a and miR-16) have been mapped to
the region 13q14 that is commonly deleted in chronic lymphocytic
leukemia (CLL). The expression of miR-15a and miR-16 is reduced in
CLL patients with loss of heterozygosity at 13q14.
[0007] Thus, the levels of miRNA and their precursors in samples
taken from a test subject, including human subjects, can be used to
study the role of miRNAs in health and disease and to identify
drugs that modulate miRNA function.
[0008] Most of the miRNA expression data published to date have
used Northern blotting to detect both the mature and pre-miRNA
precursors. Probes designed to hybridize to the mature miRNA detect
the .about.22 nt mature miRNA and the .about.75 nt pre-miRNA
simultaneously on the blot. Primer extension has also been
effectively used to detect the mature miRNA. As tools for
monitoring gene expression, gel based assays (Northern blotting,
primer extension, RNase protection assays, etc.) have
disadvantages, including low throughput and poor sensitivity.
[0009] cDNA microarrays are an alternative to Northern blotting to
quantify miRNAs since microarrays have excellent throughput. For
example, a recent report used cDNA microarrays to monitor the
expression of miRNAs during neuronal development. Microarrays have
other disadvantages including the necessity for high concentrations
of input target for efficient hybridization and signal generation,
poor sensitivity for rare targets and the necessity for post-array
validation using more sensitive assays such as real-time PCR.
[0010] A PCR approach has been used to determine the expression
levels of mature miRNAs. This method, while useful to clone miRNAs,
is impractical for routine gene expression studies since it
involves gel isolation of small RNAs and ligation to linker
oligonucleotides. PCR has also been used to measure the expression
of primary miRNA precursor molecules.
[0011] Because of the short size of miRNAs and the sequence
similarity between miRNA family members, new and different methods
are needed to detect and quantify their expression. Additionally,
it is desirable to analyze the expression levels of miRNA
precursors. For example, miRNA precursor levels can provide an
indirect method of analyzing the expression levels of mature
miRNAs. Studying the differential expression of different miRNA
precursors as compared to the mature miRNA is itself of interest.
For example, certain disease processes may interfere with different
steps during the processing of miRNA precursors.
[0012] Therefore, a need exists for a high throughput method that
allows for the simultaneous analysis of miRNA precursor molecules
and that provides for the analysis of miRNA expression when only
small amounts of starting material are available.
SUMMARY OF THE PRESENT INVENTION
[0013] In general, the invention relates to methods and
compositions for identifying the expression of both pri-microRNA
and pre-microRNA precursors in a sample. The method involves
detection of a portion of the hairpin sequence that is shared by
both the pri-miRNA and the pre-miRNA In a first aspect, the method
uses an initial step where a gene-specific reverse primer is used
to reverse transcribe the targeted portion of the hairpin sequence.
In another aspect, the method uses gene-specific forward and
reverse primers in an amplification reaction to amplify the
targeted portion of the hairpin sequence.
[0014] In another aspect, the invention features a method for
identifying differential expression of hairpin-containing microRNA
precursors in a test sample. The method includes (a) performing an
amplification reaction on the test sample to amplify a target
nucleotide sequence wherein the target nucleotide sequence includes
a portion of the hairpin sequence that is longer than the mature
microRNA sequence, (b) detectably labeling the target nucleotide
sequence, and (c) detecting a difference between the amount of the
detectably labeled target nucleotide sequence present in the test
sample relative to a corresponding control.
[0015] In another aspect, the invention features a method for
detecting a first microRNA precursor in a sample that contains at
least a second microRNA precursor that is an isoform of the first
microRNA precursor so that the first and second microRNA precursors
have hairpin sequences that contain substantially similar primer
portions. The method includes performing an amplification reaction
on the sample to produce a first amplification product, containing
the hairpin sequence of the first microRNA precursor, and a second
amplification product containing the hairpin sequence of the second
microRNA precursor. The amplification reaction is performed using a
forward primer and a reverse primer targeted to the substantially
similar primer portions of the hairpin sequences of the first and
the second microRNA precursors. The method also includes detecting
only the first amplification product using a sequence-specific
detection probe targeted to a sequence that is unique to the
hairpin sequence of the first microRNA precursor, wherein the
unique sequence lies between the substantially similar primer
portions of the hairpin sequences.
BRIEF DESCRIPTION OF THE FIGURES
[0016] FIG. 1. miRNA processing and primer design. miRNAs such as
human miR-18 are transcribed as a (A) large primary precursor
(pri-miRNA) that is processed by the nuclear enzyme Drosha to
produce the (B) putative 62 nt precursor miRNA (pre-miRNA). Both
the pri-miRNA and pre-miRNA contain the hairpin structure. The
underlined portion of the pre-miRNA represents the sequence of the
(C) 22 nt mature miRNA that is processed from the pre-miRNA by the
ribonuclease Dicer. Gray line denotes forward primer; Black line
denotes reverse primer; Dashed line denotes sense primer used along
with the reverse (black) primer to amplify the pri-miRNA only.
[0017] FIG. 2. Amplification of short hairpins by the PCR. HeLa
cell genomic DNA was amplified by the PCR using primers for
miR-124a-2 (lane 1), miR-93-1 (lane 2), let7-d (lane 3), miR-15a
(lane 4), miR-16 (lane 5) and miR-147 (lane 6) and resolved on a
2.2% agarose gel. M, 25 bp DNA ladder.
[0018] FIG. 3. Optimal reverse transcription conditions for small
RNAs. Total RNA was isolated from HCT-116 cells, a fraction of
which was further purified to contain a low molecular weight (LMW)
fraction of <160 nt. One .mu.g of total or LMW RNA was converted
to cDNA using Thermoscript reverse transcriptase and random
hexamers (open bars) or gene specific primers (stripped bars). The
resulting cDNA was amplified by real-time PCR using primers for (A)
let7d, miR-15a or (B) U6 RNA. Mean.+-.SD, triplicate PCRs from a
single cDNA.
[0019] FIG. 4. Real-time PCR of miRNA precursors. Gene specific
primers were designed to the hairpin of the miR-21 and let-7d miRNA
precursors. The cDNA from human cancer cell lines was amplified by
real-time PCR and SYBR.RTM. green detection. (A) Real-time, PCR
plots of HCT-8 cDNA using miR-21 primers (blue plot, C.sub.T=32.8)
and let-7d primers (red plot, C.sub.T=29.7). Also shown are the
signals that were generated from the no template control reactions
(olive plots) and the no reverse transcription control reactions
(purple plots). (B) Dissociation curve generated from the heat
dissociation protocol that followed the real-time PCR shown in (A).
The presence of one peak on the thermal dissociation plot
corresponds to a single amplicon from the PCR. The plot colors in
(B) match those described in (A).
[0020] FIG. 5. Pri-miRNA and pre-miRNA expression in human cancer
cell lines. (A) Total RNA from HeLa cells was converted to cDNA
using gene specific primers as described in Materials and Methods.
The cDNA was amplified by real-time PCR using primers that anneal
to the hairpin present in both the pri-miR-18 and pre-miR-18
(C.sub.T=26.6) or to the pri-miRNA only (C.sub.T=27.6). (B) Total
miR-18 precursor expression (pri-miRNA+pre-miRNA) and individual
expression (pri-miRNA or pre-miRNA) in six cancer cell lines. Mean
of duplicate real-time PCRs from a single cDNA sample.
[0021] FIG. 6. miRNA precursor expression in human cancer cell
lines. The expression of the miRNA precursors for miR-93-1 (A),
miR-147 (B), miR-24-2 (C) and miR-29 (D) in six human tumor cell
lines and Drosophila S2 cells was determined by real-time PCR. Gene
expression is presented relative to U6 RNA. Mean.+-.SD of
triplicate real-time PCRs from a single cDNA sample. *Undectectable
expression.
[0022] FIG. 7. miRNA precursor expression in the human colorectal
cancer cell line HCT-116. The expression of 23 miRNA precursors was
determined in the human colorectal cancer cell line HCT-116 by
real-time PCR. Gene expression is presented relative to U6 RNA.
Mean.+-.SD of triplicate real-time PCRs from a single cDNA sample.
*Undetectable expression.
[0023] FIG. 8. Treeview analysis of real-time PCR data. The
expression of 23 miRNA precursors and U6 RNA was determined in 6
human cancer cell lines by real-time PCR. The relative expression
of each gene (mean of triplicate real-time PCRs from a single cDNA
sample) was determined as described in Materials and Methods. A
median expression value equal to one was designated black. Red
shading indicates increased levels of expression and green shading
represents decreased levels of expression relative to the median.
Gray color, undetectable expression. Data is presented on a
logarithmic scale.
[0024] FIG. 9. Validation of real-time PCR data by Northern
blotting. (A) The precursor expression for miR-29, -21 and -224
relative to U6 RNA was determined by real-time PCR in HL-60, HeLa
and HCT-116 cDNA (mean.+-.SD triplicate RNA isolations/reverse
transcriptions). (B) Northern blot of the .about.22 nt mature miRNA
and the .about.75 nt pre-miRNA in the same cell lines shown in (A).
The blots were stripped and re-probed for U6 RNA. P, pre-miRNA, M,
mature miRNA.
[0025] FIG. 10. Table representing the intra-assay variation from
replicate RNA isolations.
[0026] FIG. 11. Table showing the efficiency of amplification for
miRNA genes using U6 RNA.
[0027] FIG. 12. Primer and TaqMan.RTM. probe sequences to let-7
miRNA isoforms. (A) The sequences of the miRNA precursors for the
members of the human let-7 family of miRNA isoforms. Line above
sequence, sequence of the mature miRNA; Dashed underlined,
sequences of the forward PCR primers; Boxed, sequences of the
reverse PCR primers; Bold: priming sequences that differ among
isoforms. Also shown are sequences of the human let-7 family mature
miRNAs. (B) The sequence of the TaqMan.RTM. MGB probe is
double-underlined. Sequences are in the 5' to 3' direction.
[0028] FIG. 13. Real-time PCR of miRNA precursor isoforms. The
sequences of six miRNA precursor isoforms (let-7a-1, let-7a-2,
let-7a-3, let-7f-1, let-7f-2 and let-7d) were cloned into plasmids.
Real-time PCR was attempted on seven different reactions (in
triplicate) containing each plasmid and primers specific to each
isoform. Each reaction contained the TaqMan.RTM. MGB probe for
let-7d. Only the reaction containing the let-7d plasmid gave a
detectable signal (A). Following the real-time PCR, a portion of
each reaction was run on an agarose gel to demonstrate that PCR had
occurred in each reaction (B). NTC, No template control. M, 100 bp
DNA ladder.
[0029] FIG. 14. Heatmap of miRNA precursor expression in 32 human
cancer cell lines. The names of the 32 cancer cell lines are listed
on the top of the figure. The names of the miRNAs that were
profiled in the cancer cell lines are listed to the right of the
figure. The relative expression of each gene was determined by
real-time PCR; data are presented as .DELTA.CT. Unsupervised
hierarchical clustering was performed using PCR primers to 201
miRNA precursors. Data were unfiltered prior to clustering. A
median expression value equal to one was designated black; red
increased expression; green, reduced expression; gray, undetectable
expression. (B) Dendrogram of clustering analysis.
[0030] FIG. 15. PCR Primers used to amplify the human miRNAs
precursors. p, primers to miRNA primary precursor sequence. All
other primers hybridize to hairpin present in both the primary
precursor and precursor miRNA.
DETAILED DESCRIPTION OF THE INVENTION
[0031] The present invention provides methods and compositions for
the analysis of microRNA precursor expression and will now be
described with reference to more detailed examples. The examples
illustrate how a person skilled in the art can make and use the
invention, and are described here to provide enablement and best
mode of the invention without imposing limitations that are not
recited in the claims.
[0032] All publications, patent applications, patents, internet web
pages and other references mentioned herein are expressly
incorporated by reference in their entirety. When the definitions
of terms in incorporated references appear to differ from the
definitions provided in the present teachings, the definitions
provided in the present teachings shall control.
[0033] Unless otherwise indicated, all numbers expressing
quantities of ingredients, reaction conditions, and so forth used
in the specification and claims are to be understood as being
modified in all instances by the term "about." Accordingly, unless
indicated to the contrary, the numerical parameters set forth in
the following specification and attached claims are approximations
that may vary depending upon the desired properties sought to be
obtained by the present invention. At the very least, and not as an
attempt to limit the application of the doctrine of equivalents to
the scope of the claims, each numerical parameter should be
construed in light of the number of significant digits and ordinary
rounding approaches.
[0034] Notwithstanding that the numerical ranges and parameters
setting forth the broad scope of the invention are approximations,
the numerical values set forth in the specific examples are
reported as precisely as possible. Any numerical value, however,
inherently contains certain errors necessarily resulting from the
standard deviation found in their respective testing measurements.
Every numerical range given throughout this specification will
include every narrower numerical range that falls within such
broader numerical range, as if such narrower numerical ranges were
all expressly written herein.
[0035] The following introduction is useful for understanding the
terms used in this description. Without being bound to the
following theory and with reference to FIG. 1, it is believed that
miRNAs are encoded by genes that are transcribed into single or
clustered miRNA precursors. These miRNA precursors are converted to
mature forms of miRNAs through a stepwise processing, as depicted
in FIG. 1. It is believed that the processing first generates (A) a
large .about.70 nucleotide (nt) primary precursor, referred to
herein as a "pri-miRNA," that is then processed by the nuclear
enzyme Drosha to produce (B) a putative .about.62 nt precursor,
referred to herein as a "pre-miRNA." Both the pri-miRNA and
pre-miRNA contain a characteristic hairpin structure. The
underlined portion of the pre-miRNA sequence in FIG. 1 represents
the sequence of (C) the .about.22 nt mature miRNA that is processed
from the pre-miRNA by the ribonuclease Dicer. Thus the term
"pri-microRNA" refers to molecule A, "pre-miRNA" refers to molecule
B, "mature miRNA" refers to molecule C, and "miRNA precursor(s)"
refers to both pri- and pre-miRNAs (i.e. molecules A and B), as
shown in FIG. 1.
[0036] Still referring to FIG. 1, both the pri-miRNA and pre-miRNA
molecules have a "hairpin sequence," which is an oligonucleotide
sequence having a first half which is at least partially
complementary to a second half thereof, thereby causing the halves
to fold onto themselves, forming a "hairpin structure." The hairpin
structure is typically made of a "stem" part, which consists of the
complementary or partially complementary sequences, and a "loop"
part, which is a region located between the two complementary
strands of the stem, as depicted in FIG. 1.
[0037] Provided herein are methods and kits for detecting the
expression levels of both the pri- and the pre-miRNA precursor in a
test sample using gene-specific primers targeted to a portion of
the hairpin sequence shared by both the pri- and the pre-miRNA
precursors. The term "target nucleotide sequence" or "target
nucleotide" as used herein, refers to the polynucleotide sequence
that is sought to be detected, i.e. the sequence that is targeted
by the gene-specific primers of the present invention. The target
nucleotide sequence, as used herein, comprises a portion of the
hairpin sequence which is shared by both the pri- and the pre-miRNA
precursors and may comprise the entire hairpin sequence.
Alternative, the target nucleotide sequence may comprise only a
portion of the hairpin sequence which portion is substantially
longer than the mature miRNA sequence and is typically about 70
nucleotides long. In either case, the target nucleotide sequence
may include a few nucleotides beyond the hairpin sequence, so long
as the target nucleotide sequence is shared by the pri- and
pre-miRNA precursors. Target nucleotide sequence is intended to
include DNA (e.g., cDNA or genomic DNA), RNA, analogs of the DNA or
RNA generated using nucleotide analogs, and derivatives, fragments
and homologs thereof.
[0038] The methods described generally employ a two step approach.
First, the target nucleotide sequence of the miRNA precursors is
reverse transcribed into cDNA using a gene-specific reverse primer
and a thermostable reverse transcriptase. Second, the target
nucleotide sequence cDNA is amplified and detected, thereby
simultaneously detecting the expression levels of both the pri- and
the pre-miRNA molecules in the test sample. Alternatively, the
methods may be applied directly on genomic DNA without the need for
reverse transcription.
[0039] In some embodiments, the target nucleotide sequence cDNA
acts as a template in an amplification reaction. Amplification
products are then detected using detection probes. As used herein,
the term "amplifying" or "amplification reaction" refers to any
means by which at least a part of a target polynucleotide, target
polynucleotide surrogate, or combinations thereof, is reproduced,
typically in a template-dependent manner, including without
limitation, a broad range of techniques for amplifying nucleic acid
sequences, either linearly or exponentially. Exemplary means for
performing an amplifying step include PCR, primer extension, ligase
chain reaction (LCR), ligase detection reaction (LDR), ligation
followed by Q-replicase amplification, strand displacement
amplification (SDA), hyperbranched strand displacement
amplification, multiple displacement amplification (MDA), nucleic
acid strand-based amplification (NASBA), two-step multiplexed
amplifications, rolling circle amplification (RCA), in vitro
transcription using a forward primer containing a promoter sequence
for RNA polymerase and the like, including multiplex versions or
combinations thereof. Descriptions of such techniques can be found
in, among other places, Sambrook et al. Molecular Cloning, 3rd
Edition; Ausbel et al.; PCR Primer: A Laboratory Manual,
Diffenbach, Ed., Cold Spring Harbor Press (1995); The Electronic
Protocol Book, Chang Bioscience (2002), Msuih et al., J. Clin.
Micro. 34:501-07 (1996); The Nucleic Acid Protocols Handbook, R.
Rapley, ed., Humana Press, Totowa, N.J. (2002); Abramson et al.,
Curr Opin Biotechnol. 1993 February; 4(1):41-7, U.S. Pat. No.
6,027,998; U.S. Pat. No. 6,605,451, Barany et al., PCT Publication
No. WO 97/31256; Wenz et al., PCT Publication No. WO 01/92579; Day
et al., Genomics, 29(1): 152-162 (1995), Ehrlich et al., Science
252:1643-50 (1991); Innis et al., PCR Protocols: A Guide to Methods
and Applications, Academic Press (1990); Favis et al., Nature
Biotechnology 18:561-64 (2000); and Rabenau et al., Infection
28:97-102 (2000); Belgrader, Barany, and Lubin, Development of a
Multiplex Ligation Detection Reaction DNA Typing Assay, Sixth
International Symposium on Human Identification, 1995 (available on
the world wide web at:
promega.com/geneticidproc/ussymp6proc/blegrad.html); LCR Kit
Instruction Manual, Cat. #200520, Rev. #050002, Stratagene, 2002;
Barany, Proc. Natl. Acad. Sci. USA 88:188-93 (1991); Bi and
Sambrook, Nucl. Acids Res. 25:2924-2951 (1997); Zirvi et al., Nucl.
Acid Res. 27:e40i-viii (1999); Dean et al., Proc Natl Acad Sci USA
99:5261-66 (2002); Barany and Gelfand, Gene 109:1-11 (1991); Walker
et al., Nucl. Acid Res. 20:1691-96 (1992); Polstra et al., BMC Inf.
Dis. 2:18-(2002); Lage et al., Genome Res. 2003 February;
13(2):294-307, and Landegren et al., Science 241:1077-80 (1988),
Demidov, V., Expert Rev Mol Diagn. 2002 November; 2(6):542-8., Cook
et al., J Microbiol Methods. 2003 May; 53(2):165-74, Schweitzer et
al., Curr Opin Biotechnol. 2001 February; 12(1):21-7, U.S. Pat. No.
5,830,711, U.S. Pat. No. 6,027,889, U.S. Pat. No. 5,686,243,
Published P.C.T. Application WO0056927A3, and Published P.C.T.
Application WO9803673A1. In some embodiments, newly-formed nucleic
acid duplexes are not initially denatured, but are used in their
double-stranded form in one or more subsequent steps. An extension
reaction is an amplifying technique that comprises elongating a
gene-specific primer that is annealed to a template and extended in
the 5' to 3' direction using an amplifying means such as a
polymerase and/or reverse transcriptase. According to some
embodiments, with appropriate buffers, salts, pH, temperature, and
nucleotide triphosphates, including analogs thereof, i.e., under
appropriate conditions, a polymerase incorporates nucleotides
complementary to the template strand starting at the 3'-end of an
annealed linker probe, to generate a complementary strand. In some
embodiments, the polymerase used for extension lacks or
substantially lacks 5' exonuclease activity. In some embodiments of
the present teachings, unconventional nucleotide bases can be
introduced into the amplification reaction products and the
products treated by enzymatic (e.g., glycosylases) and/or
physical-chemical means in order to render the product incapable of
acting as a template for subsequent amplifications. In some
embodiments, uracil can be included as a nucleobase in the reaction
mixture, thereby allowing for subsequent reactions to decontaminate
carryover of previous uracil-containing products by the use of
uracil-N-glycosylase (see for example Published P.C.T. Application
WO9201814A2). In some embodiments of the present teachings, any of
a variety of techniques can be employed prior to amplification in
order to facilitate amplification success, as described for example
in Radstrom et al., Mol Biotechnol. 2004 February; 26(2):13346. In
some embodiments, amplification can be achieved in a self-contained
integrated approach comprising sample preparation and detection, as
described for example in U.S. Pat. Nos. 6,153,425 and 6,649,378.
Reversibly modified enzymes, for example but not limited to those
described in U.S. Pat. No. 5,773,258, are also within the scope of
the disclosed teachings. The present teachings also contemplate
various uracil-based decontamination strategies, wherein for
example uracil can be incorporated into an amplification reaction,
and subsequent carry-over products removed with various glycosylase
treatments (see for example U.S. Pat. No. 5,536,649, and U.S.
Provisional Application 60/584,682 to Andersen et al.). Those in
the art will understand that any protein with the desired enzymatic
activity can be used in the disclosed methods and kits.
Descriptions of DNA polymerases, including reverse transcriptases,
uracil N-glycosylase, and the like, can be found in, among other
places, Twyman, Advanced Molecular Biology, BIOS Scientific
Publishers, 1999; Enzyme Resource Guide, rev. 092298, Promega,
1998; Sambrook and Russell; Sambrook et al.; Lehninger; PCR: The
Basics; and Stoflet E S, Koeberl D D, Sarkar G, Sommer S S, Genomic
amplification with transcript sequencing, Science 239(4839):491-4
(1988).
[0040] In some embodiments, detector probes are used to detect
amplified target nucleotides. As used herein, the term "detector
probe" refers to a molecule used in an amplification reaction,
typically for quantitative or real-time PCR analysis, as well as
end-point analysis. Such detector probes can be used to monitor the
amplification of the target polynucleotide. In some embodiments,
detector probes present in an amplification reaction are suitable
for monitoring the amount of amplicon(s) produced as a function of
time. Such detector probes include, but are not limited to, the
5'-exonuclease assay (TaqMan.RTM. probes described herein (see also
U.S. Pat. No. 5,538,848) various stem-loop molecular beacons (see
e.g., U.S. Pat. Nos. 6,103,476 and 5,925,517 and Tyagi and Kramer,
1996, Nature Biotechnology 14:303-308), stemless or linear beacons
(see, e.g., WO 99/21881), PNA Molecular Beacons.RTM. (see, e.g.,
U.S. Pat. Nos. 6,355,421 and 6,593,091), linear PNA beacons (see,
e.g., Kubista et al., 2001, SPIE 4264:53-58), non-FRET probes (see,
e.g., U.S. Pat. No. 6,150,097), Sunrise.RTM./Amplifluor.RTM. probes
(U.S. Pat. No. 6,548,250), stem-loop and duplex Scorpion.TM. probes
(Solinas et al., 2001, Nucleic Acids Research 29:E96 and U.S. Pat.
No. 6,589,743), bulge loop probes (U.S. Pat. No. 6,590,091), pseudo
knot probes (U.S. Pat. No. 6,589,250), cyclicons (U.S. Pat. No.
6,383,752), MGB Eclipse.TM. probe (Epoch Biosciences), hairpin
probes (U.S. Pat. No. 6,596,490), peptide nucleic acid (PNA)
light-up probes, self-assembled nanoparticle probes, and
ferrocene-modified probes described, for example, in U.S. Pat. No.
6,485,901; Mhlanga et al., 2001, Methods 25:463-471; Whitcombe et
al., 1999, Nature Biotechnology. 17:804-807; Isacsson et al., 2000,
Molecular Cell Probes. 14:321-328; Svanvik et al., 2000, Anal
Biochem. 281:26-35; Wolffs et al., 2001, Biotechniques 766:769-771;
Tsourkas et al., 2002, Nucleic Acids Research. 30:4208-4215;
Riccelli et al., 2002, Nucleic Acids Research 30:4088-4093; Zhang
et al., 2002 Shanghai. 34:329-332; Maxwell et al., 2002, J. Am.
Chem. Soc. 124:9606-9612; Broude et al., 2002, Trends Biotechnol.
20:249-56; Huang et al., 2002, Chem Res. Toxicol. 15:118-126; and
Yu et al., 2001, J. Am. Chem. Soc 14:11155-11161. Detector probes
can also comprise quenchers, including without limitation black
hole quenchers (Biosearch), Iowa Black (IDT), QSY quencher
(Molecular Probes), and Dabsyl and Dabcel sulfonate/carboxylate
Quenchers (Epoch). Detector probes can also comprise two probes,
wherein for example a fluor is on one probe, and a quencher is on
the other probe, wherein hybridization of the two probes together
on a target quenches the signal, or wherein hybridization on the
target alters the signal signature via a change in fluorescence.
Detector probes can also comprise sulfonate derivatives of
fluorescenin dyes with SO.sub.3 instead of the carboxylate group,
phosphoramidite forms of fluorescein, phosphoramidite forms of CY 5
(commercially available for example from Amersham). In some
embodiments, interchelating labels are used such as ethidium
bromide, SYBR.RTM. Green I (Molecular Probes), and PicoGreen.RTM.
(Molecular Probes), thereby allowing visualization in real-time, or
end point, of an amplification product in the absence of a detector
probe. In some embodiments, real-time visualization can comprise
both an intercalating detector probe and a sequence-based detector
probe can be employed. In some embodiments, the detector probe is
at least partially quenched when not hybridized to a complementary
sequence in the amplification reaction, and is at least partially
unquenched when hybridized to a complementary sequence in the
amplification reaction. In some embodiments, probes further
comprise various modifications such as a minor groove binder (see
for example U.S. Pat. No. 6,486,308) to further provide desirable
thermodynamic characteristics.
[0041] In some embodiments, the target nucleotide cDNA can be
detected using a variety of hybridization techniques. As used
herein, the term "hybridization" refers to the complementary
base-pairing interaction of one nucleic acid with another nucleic
acid that results in formation of a duplex, triplex, or other
higher-ordered structure, and is used herein interchangeably with
"annealing." Typically, the primary interaction is base specific,
e.g., A/T and G/C, by Watson/Crick and Hoogsteen-type hydrogen
bonding. Base-stacking and hydrophobic interactions can also
contribute to duplex stability. Conditions for hybridizing detector
probes and primers to complementary and substantially complementary
target sequences are well known, e.g., as described in Nucleic Acid
Hybridization, A Practical Approach, B. Hames and S. Higgins, eds.,
IRL Press, Washington, D.C. (1985) and J. Wetmur and N. Davidson,
Mol. Biol. 31:349 et seq. (1968). In general, whether such
annealing takes place is influenced by, among other things, the
length of the polynucleotides and the complementary sequence, the
pH, the temperature, the presence of mono- and divalent cations,
the proportion of G and C nucleotides in the hybridizing region,
the viscosity of the medium, and the presence of denaturants. Such
variables influence the time required for hybridization. Thus, the
preferred annealing conditions will depend upon the particular
application. Such conditions, however, can be routinely determined
by the person of ordinary skill in the art without undue
experimentation. It will be appreciated that complementarity need
not be perfect; there can be a small number of base pair mismatches
that will minimally interfere with hybridization between the target
sequence and the single stranded nucleic acids of the present
teachings. However, if the number of base pair mismatches is so
great that no hybridization can occur under minimally stringent
conditions then the sequence is generally not a complementary
target sequence. Thus, complementarity herein is meant that the
probes or primers are sufficiently complementary to the target
sequence to hybridize under the selected reaction conditions to
achieve the ends of the present teachings. Novel hybridization
techniques, such as bead-based flow cytometry (described for
example in Lu J, et al., MicroRNA expression profiles classify
human cancers, Nature. 2005 Jun. 9; 435(7043):834-8) are also
contemplated by the present teachings.
[0042] In some embodiments, the 3' gene-specific primer can be used
in an extension reaction. As used herein, the term "extension
reaction" refers to an elongation reaction in which the 3'
gene-specific primer is extended to form an extension reaction
product comprising a strand complementary to the target
polynucleotide. In some embodiments, the target polynucleotide is a
portion of the hairpin sequence common to both a pri- and a
pre-miRNA molecule and the extension reaction is a reverse
transcription reaction comprising a reverse transcriptase. In some
embodiments, the extension reaction is a reverse transcription
reaction comprising a polymerase derived from a Eubacteria. In some
embodiments, the extension reaction can comprise rTth polymerase.
It will be appreciated that the use of polymerases that also
comprise reverse transcription properties can allow for some
embodiments of the present teachings to comprise a first reverse
transcription reaction followed thereafter by an amplification
reaction, thereby allowing for the consolidation of two reactions
in essentially a single reaction. In some embodiments, the
consolidation of the extension reaction and a subsequent
amplification reaction is further contemplated by the present
teachings.
[0043] As used herein, the term "detection" refers to any of a
variety of ways of determining the presence and/or quantity and/or
identity of a target polynucleoteide. In some embodiments employing
a donor moiety and signal moiety, one may use certain
energy-transfer fluorescent dyes. Certain nonlimiting exemplary
pairs of donors (donor moieties) and acceptors (signal moieties)
are illustrated, e.g., in U.S. Pat. Nos. 5,863,727; 5,800,996; and
5,945,526. Use of some combinations of a donor and an acceptor have
been called FRET (Fluorescent Resonance Energy Transfer). In some
embodiments, fluorophores that can be used as signaling probes
include, but are not limited to, rhodamine, cyanine 3 (Cy 3),
cyanine 5 (Cy 5), fluorescein, Texas Red (Molecular Probes) and the
group Vic.TM., Liz.TM., Tamra.TM., 5-Fam.TM., 6-Fam.TM. (all
available from Applied Biosystems, Foster City, Calif.). In some
embodiments, the amount of detector probe that gives a fluorescent
signal in response to an excited light typically relates to the
amount of nucleic acid produced in the amplification reaction.
Thus, in some embodiments, the amount of fluorescent signal is
related to the amount of product created in the amplification
reaction. In such embodiments, one can therefore measure the amount
of amplification product by measuring the intensity of the
fluorescent signal from the fluorescent indicator. According to
some embodiments, one can employ an internal standard to quantify
the amplification product indicated by the fluorescent signal. See,
e.g., U.S. Pat. No. 5,736,333. Devices have been developed that can
perform a thermal cycling reaction with compositions containing a
fluorescent indicator, emit a light beam of a specified wavelength,
read the intensity of the fluorescent dye, and display the
intensity of fluorescence after each cycle. Devices comprising a
thermal cycler, light beam emitter, and a fluorescent signal
detector, have been described, e.g., in U.S. Pat. Nos. 5,928,907;
6,015,674; and 6,174,670, and include, but are not limited to the
ABI Prism.RTM. 7700 Sequence Detection System the ABI GeneAmp.RTM.
Sequence Detection System series (all available from Applied
Biosystems, Foster City, Calif.), or the LightCycler.RTM. (Roche
Diagnositcs, Indianapolis, Ind.) In some embodiments, each of these
functions can be performed by separate devices. In some
embodiments, combined thermal cycling and fluorescence detecting
devices can be used for precise quantification of target nucleic
acid sequences in samples. In some embodiments, fluorescent signals
can be detected and displayed during and/or after one or more
thermal cycles, thus permitting monitoring of amplification
products as the reactions occur in "real time." In some
embodiments, one can use the amount of amplification product and
number of amplification cycles to calculate how much of the target
nucleic acid sequence was in the sample prior to amplification. In
some embodiments, one could simply monitor the amount of
amplification product after a predetermined number of cycles
sufficient to indicate the presence of the target nucleic acid
sequence in the sample. One skilled in the art can easily
determine, for any given sample type, primer sequence, and reaction
condition, how many cycles are sufficient to determine the presence
of a given target polynucleotide. As used herein, determining the
presence of a target can comprise identifying it, as well as
optionally quantifying it.
[0044] In some embodiments, different detector probes may
distinguish between different target polynucleoteides. A
non-limiting example of such a probe is a 5'-nuclease fluorescent
probe, such as a TaqMan.RTM. probe molecule, wherein a fluorescent
molecule is attached to a fluorescence-quenching molecule through
an oligonucleotide link element. In some embodiments, the
oligonucleotide link element of the 5'-nuclease fluorescent probe
binds to a specific sequence of an identifying portion or its
complement. In some embodiments, different 5'-nuclease fluorescent
probes, each fluorescing at different wavelengths, can distinguish
between different amplification products within the same
amplification reaction. For example, in some embodiments, one could
use two different 5'-nuclease fluorescent probes that fluoresce at
two different wavelengths (WL.sub.A and WL.sub.B) and that are
specific to two different hairpin sequences of two different
extension reaction products (A' and B', respectively).
Amplification product A' is formed if target nucleic acid sequence
A is in the sample, and amplification product B' is formed if
target nucleic acid sequence B is in the sample. In some
embodiments, amplification product A' and/or B' may form even if
the appropriate target nucleic acid sequence is not in the sample,
but such occurs to a measurably lesser extent than when the
appropriate target nucleic acid sequence is in the sample. After
amplification, one can determine which specific target nucleic acid
sequences are present in the sample based on the wavelength of
signal detected and their intensity. Thus, if an appropriate
detectable signal value of only wavelength WL.sub.A is detected,
one would know that the sample includes target nucleic acid
sequence A, but not target nucleic acid sequence B. If an
appropriate detectable signal value of both wavelengths WL.sub.A
and WL.sub.B are detected, one would know that the sample includes
both target nucleic acid sequence A and target nucleic acid
sequence B. In some embodiments, detection can occur through any of
a variety of mobility dependent analytical techniques based on
differential rates of migration between different analyte species.
Exemplary mobility-dependent analysis techniques include
electrophoresis, chromatography, mass spectroscopy, sedimentation,
e.g., gradient centrifugation, field-flow fractionation,
multi-stage extraction techniques, and the like. In some
embodiments, mobility probes can be hybridized to amplification
products, and the identity of the target polynucleotide determined
via a mobility dependent analysis technique of the eluted mobility
probes, as described for example in Published P.C.T. Application
WO04/46344 to Rosenblum et al., and WO01/92579 to Wenz et al. In
some embodiments, detection can be achieved by various microarrays
and related software such as the Applied Biosystems Array System
with the Applied Biosystems 1700 Chemiluminescent Microarray
Analyzer and other commercially available array systems available
from Affymetrix, Agilent, Illumina, and Amersham Biosciences, among
others (see also Gerry et al., J. Mol. Biol. 292:251-62, 1999; De
Bellis et al., Minerva Biotec 14:247-52, 2002; and Stears et al.,
Nat. Med. 9:14045, including supplements, 2003). It will also be
appreciated that detection can comprise reporter groups that are
incorporated into the reaction products, either as part of labeled
primers or due to the incorporation of labeled dNTPs during an
amplification, or attached to reaction products, for example but
not limited to, via hybridization tag complements comprising
reporter groups or via linker arms that are integral or attached to
reaction products. Detection of unlabeled reaction products, for
example using mass spectrometry, is also within the scope of the
current teachings.
[0045] The term "corresponding" as used herein refers to a specific
relationship between the elements to which the term refers. Some
non-limiting examples of corresponding include: a gene-specific
forward or reverse primer can correspond with a target
polynucleotide, and vice versa. A detector probe can correspond
with a particular region of a target polynucleotide and vice versa.
In some cases, the corresponding elements can be complementary. In
some cases, the corresponding elements are not complementary to
each other, but one element can be complementary to the complement
of another element. The term corresponding is also used when
referring to the pri-miRNA and the pre-miRNA molecules that belong
to one miR gene.
[0046] The term "sample" as used herein refers to any sample that
contains the target nucleotide sequence and can be obtained from
any organism known to contain miRNA encoding genes. In certain
examples, the sample is obtained from a mammal, such as a human or
mouse. In other embodiments, the sample is derived from other
organisms, such as a plant, C. elegans or drosophila. It will be
appreciated that the target nucleotide sequence can be isolated
from samples using any of a variety of procedures known in the
art.
[0047] The term "pair of primers targeted to" a target nucleotide
sequence refers to forward and reverse primers that can anneal to
either end of the target nucleotide sequence. It is appreciated by
those skilled in the art that a forward (or sense) primer can
usually directly hybridize to a first primer portion located at the
5' end of the target nucleotide sequence, while a reverse (or
anti-sense) primer can hybridize to the complement of the second
primer portion located at the 3' end of the target nucleotide
sequence.
[0048] The term "upstream" as used herein takes on its customary
meaning in molecular biology, and refers to the location of a
region of a polynucleotide that is on the 5' side of a "downstream"
region. Correspondingly, the term "downstream" refers to the
location of a region of a polynucleotide that is on the 3' side of
an "upstream" region.
In the presented examples,
[0049] detection of hairpin-containing miRNA precursor levels is
achieved by (a) converting the pri- and pre-miRNA precursors to
cDNA using a gene-specific reverse primer and a reverse
transcriptase, and (b) amplifying and detecting a portion of the
hairpin sequence common to the pri- and pre-miRNA precursors. In
each amplification reaction, the forward and reverse primers are
targeted to amplify a substantial portion of the hairpin sequence.
In one example, the forward primer is targeted to a sequence
located at the 5' end of the hairpin structure and the reverse
primer is targeted to a sequence located at the 3' end of the
hairpin structure.
[0050] Appropriate primers can be designed using the following
criteria. Both forward and reverse primers are designed to be
located within or substantially within the hairpin sequence of the
miRNA precursors (FIG. 1). The pre-miRNA sequences are predicted
based upon the fold-back structure. Sequences of known precursor
miRNA precursor species are available on the miRNA registry
(http://www.sanger.ac.uk/Software/Rfam/mirna/index.shtml)
(Griffiths-Jones, S., The micro-RNA Registry. Nucleic Acids Res,
2004. 32(1): p. D109-11.) An extension of about 4 nucleotides is
allowed for each primer over the presumed 5' or 3' termini of the
pre-miRNA. It is understood, however, that different length primers
can be used as long as the target nucleotide amplified by the
primers is shared between the pri- and the pre-miRNA precursors.
Since the hairpin is contained within both the pri-miRNA and the
pre-miRNA, primers designed to the hairpin simultaneously amplify
both RNAs. Primers are designed with a maximal T.sub.m difference
between both primers of .ltoreq.2.degree. C. and an optimal primer
length between 16-24 nucleotides for primers composed of the
identical chemical composition of natural DNA. The primers have a
Tm range of 48-62.degree. C., preferably 49-59.degree. C., and more
preferably 55-59.degree. C. Suitable primers for quantifying levels
of certain precursor miRNAs in test samples obtained from human
subjects include, but are not limited to, the primers shown in
Table 1.
[0051] In one example, the method uses gene-specific primers and a
thermostable reverse transcriptase to convert the hairpin of the
miRNA precursors to cDNA. The cDNA is subsequently amplified using
real-time PCR with SYBR.RTM. green detection.
[0052] Amplification reactions such as PCR, RT-PCR and real-time
PCR are well known in the art. Briefly, in PCR, two primer
sequences are prepared which are complementary to regions on
opposite complementary strands of, for example, a target nucleic
acid. An excess of deoxynucleoside triphosphates (dNTPs) are added
to a reaction mixture along with a DNA polymerase, e.g., Taq
polymerase. If the target sequence is present in a sample, the
primers will bind to the target and the polymerase will cause the
primers to be extended by adding on nucleotides. Each nucleotide
incorporated results in the generation of a molecule of the
targeted nucleic acid. By raising and lowering the temperature of
the reaction mixture, the extended primers will dissociate from the
nucleic acid template to form amplification products, excess
primers will bind to the targeted nucleic acid and to the
amplification products and the process is repeated.
[0053] Although amplification and analysis of the PCR products can
be performed sequentially, in "real-time" PCR assays, amplification
and analysis occur simultaneously. DNA dyes or fluorescent probes
can be added to the PCR mixture before amplification and used to
analyze PCR products during amplification. Sample analysis occurs
concurrently with amplification in the same tube within the same
instrument. This combined approach decreases sample handling, saves
time, and greatly reduces the risk of product contamination for
subsequent reactions, as there is no need to remove the samples
from their closed containers for further analysis. See, for
example, U.S. Pat. No. 6,174,670, incorporated herein by
reference.
[0054] The differences in various real-time PCR protocols rests in
methods for generating a fluorescence signal with the amplification
product. Many different probes are available for monitoring PCR.
Although not sequence specific, double stranded DNA (dsDNA)
specific dyes can be used in any amplification without the need for
probe synthesis. Such dyes include ethidium bromide and SYBR.RTM.
Green I. With dsDNA dyes, product specificity can be increased by
analysis of melting curves or by acquiring fluorescence at a high
temperature where nonspecific products have melted. See, for
example, Ririe K M, Rasmussen R P and C T Wittwer, Product
differentiation by analysis of DNA melting curves during the
polymerase chain reaction, Anal. Biochem. 245-154-160 (1997);
Morrison T B, J&J Weis and C T Wittwer, Quantification of low
copy transcripts by continuous SYBR.RTM. Green I monitoring during
amplification, BioTechniques 24:954-962 (1998).
[0055] Oligonucleotide probes can also be covalently labeled with
fluorescent molecules. For example, hairpin probes (Molecular
Beacons.RTM.) and exonuclease probes (TaqMan.RTM.) are dual-labeled
oligonucleotides that can be monitored during PCR. Another example
is the TaqMan.RTM. minor groove binder probe. These probes depend
on fluorescence quenching of a fluorophore by a quencher on the
same oligonucleotide. Fluorescence increases when hybridization or
exonuclease hydrolysis occurs.
[0056] Molecular beacons have a hairpin structure wherein the
quencher dye and reporter dye are in intimate contact with each
other at the end of the stem of the hairpin. Upon hybridization
with a complementary sequence, the loop of the hairpin structure
becomes double stranded and forces the quencher and reporter dye
apart, thus generating a fluorescent signal. Tyagi et al. reported
use of the non-fluorescent quencher dyes including the dabcyl
(4-{[4-(dimethylamino)phenyl]diazenyl}benzoyl moiety, absorbance
max=453 nm) used in combination with fluorescent reporter dyes of
widely varying emission wavelength (475-615 nm). See Tyagi S, Bratu
D P, Kramer F R, Multicolor molecular beacons for allele
discrimination, Nat Biotechnol. 1:49-53 (1998).
[0057] Another format for "real-time" PCR uses DNA probes which are
referred to as "5'-nuclease" (or TaqMan.RTM.) probes (Lee et al.,
Nucl. Acid Res. 21:3761-3766 (1993)). These fluorogenic probes are
typically prepared with the quencher at the 3' terminus of a single
DNA strand and the fluorophore at the 5' terminus. During each PCR
cycle, the 5'-nuclease activity of Taq DNA polymerase cleaves the
DNA strand, thereby separating the fluorophore from the quencher
and releasing the fluorescent signal. The 5'-nuclease assay
requires that the probe be hybridized to the template strand during
the primer extension step (60-65.degree. C.). It is also possible
to effect simultaneous "real-time" detection of more than one
polynucleotide sequence in the same assay, using more than one
fluorophore/quencher pair.
[0058] The TaqMan.RTM. minor groove binder (MGB) assay utilizes a
hydrolysis probe that has a fluorophore on one end of the probe.
The fluorophore may be one of the following chemicals: TAMRA, TET,
JOE, VIC or NED. The other end of the probe has the TaqMan.RTM.
minor groove binder/quencher. The hydrolysis probe (TaqMan.RTM.
MGB) assay takes advantage of the 5'-nuclease ability of DNA
polymerase to hydrolyze the fluorophore and minor groove binder
from the probe to produce a signal. The hydrolysis probe methods
offer an additional degree of specificity. Methods of preparing
such probes are described in U.S. Pat. Nos. 5,801,155; 6,790,945;
6,699,975, and 6,653,473, all of which are incorporated herein in
their entirety. The use of the TaqMan.RTM. minor groove binder
probe is especially appealing in the present invention because the
presence of the minor groove binder increases the Tm of the probes
and allows for the design of shorter probes that are beneficial for
the detection of miRNA precursors since there is only a small
region in between the sense and antisense primer.
[0059] In real-time PCR, reagents generate a fluorescence signal
proportional to the number of amplicons produced by the PCR
process. Real-time PCR is based upon the principle that, the more
template initially present, the fewer number of cycles are
necessary to reach exponential phase where the fluorescence signal
rises above the background signal. This point, called the threshold
cycle (C.sub.T), occurs during the exponential phase and is
proportional to the initial template concentration. Thus a standard
curve can be generated with gene copy numbers as a function of the
threshold cycle to permit quantification of unknown samples without
any post-amplification sample processing.
[0060] In "real-time quantitative" PCR, the accumulation of
amplification products is measured continuously in both standard
dilutions of target RNA and samples containing unknown amounts of
target RNA. A standard curve is constructed by correlating initial
template concentration in the standard samples with the number of
PCR cycles (Ct) necessary to produce a specific threshold
concentration of product. In the test samples, target PCR product
accumulation is measured after the same C.sub.T, which allows
interpolation of target DNA concentration from the standard curve.
Another method, often referred to as "relative quantitative PCR,"
determines the relative concentrations of specific nucleic
acids.
[0061] In one example of the present invention, a real-time
quantitative PCR assay is used to monitor the expression of miRNA
precursors. The method comprises amplifying the targeted hairpin
sequence of the miRNA precursor species through a plurality of
amplification cycles in the presence of the fluorescent entity,
measuring fluorescence intensity of the fluorescent entity at each
of the plurality of amplification cycles to produce a fluorescent
value for each cycle related to the quantity of the miRNA precursor
species present at each cycle, obtaining a score from each of a
plurality of tests, each of the plurality of tests using the
fluorescence values to generate the score, and using the scores to
ascertain whether the miRNA precursor species is present in the
sample and to quantity the miRNA precursor in the test sample. The
levels of the miRNA precursor species can be quantified in
comparison with an internal standard, for example, levels of a
synthetic miRNA precursor of the identical sequence. As described
above, the methods for quantitative PCR and variations thereof are
well known to those of ordinary skill in the art.
[0062] In another example, real-time PCR is used to determine the
amount of pre-miRNA precursors only. This method uses a second set
of primers, e.g. the reverse primer to the hairpin structure (black
primer, FIG. 1) and a new forward primer designed to anneal to a
sequence upstream of the hairpin sequence (dashed primer, FIG. 1).
In this method, PCR using the hairpin primers (gray/black, FIG. 1)
amplifies the pri-miRNA+pre-miRNA, and PCR using the upstream
primer along with the reverse hairpin primer (dashed/black, FIG. 1)
amplifies only the pri-miRNA. The amount of pre-miRNA is then
calculated using the following equation:
pre-miRNA=.sub.2--C.sub.T.sup.(pri-miRNA+pre-miRNA)-2.sup.-C.sub.T.sup.pr-
i-miRNA. (FIG. 5).
[0063] In another example, TaqMan.RTM. minor groove binder probes
are used to discriminate nearly identical members of a family of
miRNA isoforms. (FIGS. 12, 13)
[0064] In another example, the assay is adapted and expanded to
include primers to some 200 human miRNA precursors. (FIG. 15). In
this example, miRNA precursor expression is profiled in 32 human
cell lines from lung, breast, colorectal, hematologic, prostate,
pancreatic and head and neck cancers.
[0065] The invention may also comprise one or more kits to perform
any of the methods described herein. In one embodiment the kit
comprises one or more primer pairs that target the hairpin region
of one or more precursor miRNAs. In another embodiment, the kit may
further comprise a hairpin specific primer and/or a gene specific
primer that targets a region in the primary miRNA that is
substantially upstream or downstream of the hairpin sequence. In
another embodiment, the kit may comprise, alone or in combination
with other regents, a gene-specific reverse primer to a sequence
within the hairpin structure to be used to reverse transcribe the
hairpin sequence of miRNA precursor to cDNA. In a non-limiting
example, primers, enzymes for reverse transcription, and enzymes
for amplification may be included in the kit. The kits may also
comprise agents for RNA isolation, purification of amplification
products, labels, etc.
[0066] The components of the kits may be packaged either in aqueous
media or in lyophilized form. The suitable container means of the
kits will generally include at least one vial, test tube, flask,
bottle, syringe or other container means, into which a component
may be placed, and preferably, suitably aliquoted. Where there are
more than one component in the kit, the kit also will generally
contain a second, third or other additional container into which
the additional components may be separately placed. However,
various combinations of components may be comprised in a vial. The
kits of the present invention may also include a means for
containing the reagent containers in close confinement for
commercial sale. Such containers may include injection or
blow-molded plastic containers into which the desired vials are
retained.
[0067] While the present teachings have been described in terms of
the following examples, those skilled in the art will readily
understand that numerous variations and modifications of these
examples are possible without undue experimentation. All such
variations and modifications are within the scope of the current
teachings. Aspects of the present teachings may be further
understood in light of the following examples, which should not be
construed as limiting the scope of the claims in any way.
Example 1
Quantification of miRNA Precursors In Human Cancer Cell Lines
Materials and Methods
[0068] Cell Lines and Tissue Culture.
[0069] The following human tumor cell lines were obtained from
American Type Culture Collection (Manassas, Va.). K-562 (chronic
myelogenous leukemia), HL-60 (promyelocytic leukemia), LNCaP
(prostate cancer), HeLa (cervical adenocarcinoma), HCT-8
(colorectal cancer) and HCT-116 (colorectal cancer). S2 Drosophila
cells were purchased from Invitrogen (Carlsbad, Calif.). All cancer
cell lines were cultured in a humidified atmosphere of 95% air, 5%
CO.sub.2 using RPMI 1640 or other suitable media and 10% fetal
bovine serum. S2 cells were cultured at room temperature according
to Invitrogen's protocol.
[0070] RNA, DNA Extraction and Reverse Transcription.
[0071] Total RNA was extracted from the cultured cells using TRIZOL
(Invitrogen, Carlsbad, Calif.) per the manufacturer's protocol. The
concentration of total RNA was quantified by the absorbance at 260
nm. Total RNA was briefly exposed to RNAase-free DNAase I as
previously described by Calin, G. A., et al., Frequent deletions
and down-regulation of micro-RNA genes miR15 and miR16 at 13q14 in
chronic lymphocytic leukemia. Proc Natl Acad Sci USA, 2002. 99(24):
p. 15524-9. RNA was reverse transcribed to cDNA using either random
hexamers or gene specific primers and Thermoscript, thermostable
reverse transcriptase (Invitrogen). A 1 .mu.g aliquote of DNase
treated total RNA (10.5 .mu.l total volume) was incubated with 1.5
.mu.l of a cocktail containing 10 .mu.M of each of the antisense
primers listed in Table 1. The reaction was heated to 80.degree. C.
for 5 min to denature the RNA, then incubated for 5 min at
60.degree. C. to anneal the primers. The reactions were cooled to
room temperature and the remaining reagents (5.times. buffer,
dNTPs, DTT, RNase inhibitor, Thermoscript) were added as specified
in the Thermoscript protocol and the reaction proceeded for 45 min
at 60.degree. C. Finally, the reverse transcriptase was inactivated
by a 5 min incubation at 85.degree. C. For the random hexamer
primed cDNA, RNA plus 0.25 .mu.l of random primers (Invitrogen) was
denatured at 80.degree. C. for 5 min and cooled to room temperature
for 10 min to allow the hexamers to anneal. The additional reagents
were then added and the reaction proceeded as described above. The
minus reverse transcription controls were treated identically as
described above except the reactions lacked Thermoscript and
primers. Genomic DNA was isolated from HeLa cells as previously
described in Sharma, R. C., A. J. Murphy, M. G. DeWald, and R. T.
Schimke, A rapid procedure for isolation of RNA-free genomic DNA
from mammalian cells. Biotechniques, 1993. 14(2): p. 176-8.
[0072] Gene Expression in Low Molecular Weight RNA Fraction.
[0073] Total RNA was isolated from HCT-116 cells using Trizol.
Seven hundred .mu.g of total RNA was loaded to the Midi RNA
isolation column (Qiagen, Valencia, Calif.). Isolation of low
molecular weight (LMW) RNA (approximately 160 nt and less) was
achieved following the manufacturer's protocol, including eluting
the LMW RNA using buffer QRW2 (750 mM NaCl, 50 mM MOPS, pH 7.0, 15%
(v/v) ethanol). Total and LMW RNA were resolved on a denaturing 15%
polyacrylamide gel to validate the isolation. One .mu.g of the LMW
and total RNA was reverse transcribed to cDNA using Thermoscript
and random hexmers or gene specific primers as described above. The
cDNA was assayed by real-time PCR using primers for six different
miRNA genes and U6 RNA.
[0074] Northern Blotting.
[0075] Northern blotting was performed as previously reported in
Lau, N. C., et al., An abundant class of tiny RNAs with probable
regulatory roles in Caenorhabditis elegans. Science, 2001.
294(5543): p. 858-62. Briefly, total RNA (30 .mu.g) was resolved on
15% polyacrylamide urea gels and transferred to Genescreen Plus
membranes (Perkin Elmer, Boston, Mass.). Oligonucleotides
complementary to the mature miRNA were end-labeled with [.gamma.
.sup.32P] ATP and T4 kinase. The membranes were incubated with
labeled probe (1.5.times.10.sup.6 c.p.m./ml hybridization buffer)
prior to visualization using phosphorimaging. Blots were stripped
once and re-probed using an oligonucleotide complementary to U6
RNA.
[0076] Primer Design, PCR and Validation.
[0077] All primers were designed using Primer Express version 2.0
(Applied Biosystems, Foster City, Calif.). The following criteria
were used during the primer design. Both sense and antisense
primers were designed to be located within the hairpin sequence of
the miRNA precursors (FIG. 1). The pre-miRNA sequences are
predicted based upon the fold-back structure (described in
Griffiths-Jones, S., The microRNA Registry. Nucleic Acids Res,
2004. 32(1): p. D109-11; and Ambros, V., et al., A uniform system
for microRNA annotation. Rna, 2003. 9(3): p. 277-279). Mapping the
5' and 3' cleavage sites of miR-30a demonstrated that the termini
of pre-miR-30a are identical to those of mature 30a and 30a* (see
Lee, Y., et al., The nuclear RNase III Drosha initiates microRNA
processing. Nature, 2003. 425(6956): p. 415-9). It was presumed
here that all pre-miRNAs are processed from the pri-miRNA in this
manner. A maximal extension of about 4 nt was allowed for each
primer over the presumed 5' or 3' termini of the pre-miRNA. Since
the hairpin is contained within both the pri-miRNA and the
pre-miRNA, primers designed to the hairpin simultaneously amplify
both RNAs. We use the term `miRNA precursors` here to be inclusive
of both the pri-miRNA and the pre-miRNA. Primers were designed with
a maximal T.sub.m difference between both primers of 2.degree. C.
and a primer length between 18-24 nts. An ideal Tm of 55-59.degree.
C. was selected for the primers, however due to size constraints,
some primers were designed with a T.sub.m that was below 55.degree.
C. The T.sub.m range of all the pre-miRNA primers was 49-59.degree.
C., and the median Tm was 56.degree. C. (Table 3). Additional
criteria included no 3' GC clamps, and a minimal amplicon size of
about 55 bp.
[0078] PCR amplicons were validated using gel electrophoresis (2.2%
agarose or 15% polyacrylamide) and by the presence of one peak on
the thermal dissociation curve generated by the thermal denaturing
protocol that followed each real-time PCR run (see Schmittgen, T.
D., et al., Quantitative reverse transcription-polymerase chain
reaction to study mRNA decay: comparison of endpoint and real-time
methods. Anal Biochem, 2000. 285(2): p. 194-204). The sequences of
the miRNA precursor amplicons were determined by subcloning the PCR
product generated by amplifying HeLa cell cDNA into TOPO TA cloning
vectors (Invitrogen) per the manufacturer's protocol. Plasmid
purification and automated DNA sequencing of the plasmids were
performed using standard techniques.
TABLE-US-00001 TABLE 1 PCR Primers used to amplify human miRNAs
precursors. Tm primers (Forward/ Gene Forward primer (5' -k 3')
Reverse primer (5' -> 3') Rev) U6 CTCGCTTCGGCAGCACA
AACGCTTCACGAATTTGCGT 59/59 let-7d AACGCTTCACGAATTTGCGT
AAGGCAGCAGGTCGTATAGT 55/53 miR-15a GTAGCAGCACATAATGGTTTGTG
GCAGCACAATATGGCCTG 56/55 miR-16 GCAGCACGTAAATATTGGCGT
CAGCAGCACAGTTAAATACTGGAG 59/57 miR-18 TAAGGTGCATCTAGTGCAGATAG
GAAGGAGCACTTAGGGCAGT 53/55 miR-20 GCACTAAAGTGCTTATAGTGCAG
GTACTTTAAGTGCTCATAATGCA 53/51 miR-21 GCTTATCAGACTGATGTTGACTG
CAGCCCATCGACTGGTG 53/55 miR-24-2 CTCCCGTGCCTACTGAGCT
CCCTGTTCCTGCTGAACTGAG 57/59 miR-28 GGAGCTCACAGTCTATTGAGTTACC
CCTCCAGGAGCTCACAATCT 56/56 miR-29 ATGACTGATTTCTTTTGGTG
ATAACCGATTTCAGATGGTG 49/51 miR-30a GTAAACATCCTCGACTGGAAGCT
GCTGCAAACATCCGACTGAA 58/58 miR-30d GTTGTTGTAAACATCCCCGAC
GCAGCAAACATCTGACTGAAAG 56/56 miR-33 TGTGGTGCATTGTAGTTGCA
CTGTGATGCACTGTGGAAAC 56/54 miR-92-1 TCTACACAGGTTGGGATCGG
CGGGACAAGTGCAATACCATA 57/57 miR-93-1 AAGTGCTGTTCGTGCAGG
CTCGGGAAGTGCTAGCTCA 55/55 miR-101 GCCCTGGCTCAGTTATC ACA
GCCATCCTTCAGTTATCACAGTA 57/55 miR-105-1 CAAATGCTCAGACTCCTGTGGT
GCACATGCTCAAACATCCGT 58/58 miR-107 CAGCTTCTTTACAGTGTTGCCT
GATAGCCCTGTACAATGCTGC 56/56 miR-124a- TCCGTGTTCACAGCGGAC
CATTCACCGCGTGCCTTA 58/58 miR-147 CTAAAGACAACATTTCTGCACAC
ATCTAGCAGAAGCATTTCCAC 53/53 miR-216 TGGCTTAATCTCAGCTGGCA
TGAGGGCTAGGAAATTGCTCT 58/58 miR-219 TCCTGATTGTCCAAACGCAA
GGGACGTCCAGACTCAACTCTC 59/59 miR-220 CCACACCGTATCTGACACTTT
CAGACCGCATCATGAACAC 54/54 miR-224 GGCTTTCAAGTCACTAGTGGTTC
CTTTGTAGTCACTAGGGCACCA 56/56
[0079] Real-Time Quantitative PCR.
[0080] Real-time quantitative PCR was performed using standard
protocols on an Applied Biosystem's 7900HT Sequence Detection
System. Briefly 5 .mu.A of a 1/100 dilution of cDNA in water was
added to 12.5 .mu.A of the 2.times.SYBR.RTM. green PCR master mix
(Applied Biosystems), 800 nM of each primer and water to 25 .mu.l.
The reactions were amplified for 15 sec at 95.degree. C. and 1 min
at 60.degree. C. for 40 cycles. The thermal denaturation protocol
was run at the end of the PCR to determine the number of products
that were present in the reaction. All reactions were run in
triplicate and included no template and no reverse transcription
controls for each gene. The cycle number at which the reaction
crossed an arbitrarily-placed threshold (C.sub.T) was determined
for each gene and the relative amount of each miRNA to U6 RNA was
described using the equation 2.sup.-.DELTA.C.sub.T where
.DELTA.C.sub.T=(C.sub.TmiRNA-C.sub.TU6RNA) (See Livak, K. J. and T.
D. Schmittgen, Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.
Methods, 2001. 25(4): p. 402-8.) Relative gene expression was
multiplied by 10.sup.6 in order to simplify the presentation of the
data.
[0081] Calculation of PCR Efficiency.
[0082] PCR efficiency was determined as previously described in
Mygind, T., et al., Determination of PCR efficiency in chelex-100
purified clinical samples and comparison of real-time quantitative
PCR and conventional PCR for detection of Chlamydia pneumoniae. BMC
Microbiol, 2002. 2(1): p. 17, from the equation
N=N.sub.0.times.E.sup.n, where N is the number of amplified
molecules, N.sub.0 is the initial number of molecules, n is the
number of PCR cycles and E is the efficiency, which is ideally 2.
When the equation is of the form
n=-(1/logE).times.logN.sub.0+(logN/logE), a plot of log copy number
versus C.sub.T yields a straight line with a slope=-(1/log E). To
experimentally determine PCR efficiency, 10-fold dilutions of HeLa
cell genomic DNA were diluted over 4-logs. The diluted genomic DNA
was amplified by real-time PCR using the identical conditions
established for the gene expression analysis. Plots were made of
the log of the template concentration versus the C.sub.T and the
PCR efficiency was calculated from the slope of the line using the
equation described above. Actual concentration of template is not
needed when determining the efficiency as it depends only upon the
slope of the line.
[0083] Treeview Analysis of PCR Data.
[0084] The expression of each miRNA relative to U6 RNA was
converted to pseudocolors and plotted using the Treeview cluster
analysis as previously reported in Dittmer, D. P., Transcription
Profile of Kaposi's Sarcoma-associated Herpesvirus in Primary
Kaposi's Sarcoma Lesions as Determined by Real-Time PCR Arrays.
Cancer Res, 2003. 63(9): p. 2010-5; Fakhari, F. D. and D. P.
Dittmer, Charting latency transcripts in Kaposi's
sarcoma-associated herpesvirus by whole-genome real-time
quantitative PCR. J Virol, 2002. 76(12): p. 6213-23; Eisen, M. B.,
et al., Cluster analysis and display of genome-wide expression
patterns. Proc Natl Acad Sci USA, 1998. 95(25): p. 14863-8).
Expression that had a value equal to 1 was designated black,
expression that was greater than 1 was designated red and
expression that was less than one was designated as green. Genes
with undetectable expression were designated as gray.
Results
[0085] Validation of PCR Primers.
[0086] To amplify the miRNA precursors, PCR primers were designed
to anneal to the hairpin (FIG. 1). Amplification of short hairpins
by the PCR could present a challenge because of the competition
between annealing of the primer and reformation of the hairpin.
Primers were designed to 23 different pre-miRNA genes using the
criteria described in Materials and Methods. Shown in FIG. 2 are
the products from amplifying HeLa cell genomic DNA using six of the
miRNA precursor primers. All six reactions produced amplicons of
the expected size with no additional products. All of the primer
pairs listed in Table 3 met the criteria of one peak on the thermal
dissociation curve and a single band of the correct size on either
agarose or polyacrylamide gels. As a further validation, the
amplicon from pre-miR-147 was subcloned and sequenced. Comparison
of the sequence data verified that 100% of the new sequence was
amplified. These results demonstrate our ability to successfully
amplify short hairpins using the PCR.
[0087] Validation of Reverse Transcription Conditions.
[0088] Our initial attempts to reverse transcribe total RNA used
random hexamer priming. Real-time PCR of the resulting cDNA using
the primers listed in Table 1 produced varied PCR signals in the
cell lines tested, i.e., miRNA precursors were expressed at high,
intermediate and low levels (data not shown). It later occurred to
us that it may be very difficult to prime the pre-miRNA with random
hexamers. This is because pre-miRNAs are very short (<80 nt) and
the stoichiometry of primer annealing should be much less than that
of a primer binding to a larger RNA such as mRNA. Furthermore, a
competition exists between the annealing of the random primers to
the pre-miRNA and hairpin formation, which is compounded by the low
temperatures (25.degree. C.) at which random primers are typically
annealed. We hypothesized that the PCR signal generated from
amplifying cDNA primed with random hexamers was due to amplifying
the much longer pri-miRNA and not the pre-miRNA.
[0089] To test this hypothesis, a LMW RNA fraction was isolated
from total RNA. The LMW RNA fraction contains RNA<160 nt and
should separate the pre-miRNA (-75 nt) from the larger pri-miRNA.
Denaturing polyacrylamide gel electrophoresis verified that
RNA<160 nt was recovered in the LMW fraction (not shown). Both
the LMW and total RNA was primed with random hexamers or gene
specific primers and reverse transcribed using the Thermoscript
reverse transcriptase.
[0090] In order to determine the effectiveness of priming the
reverse transcriptions, real-time PCR was performed on the cDNA
using primers for two miRNAs (let7d and miR-15a) as well as U6 RNA.
Total RNA primed with random hexamers produced less cDNA compared
to total RNA primed with gene specific primers (FIG. 3). More LMW
RNA was converted to cDNA when primed with gene specific primers
compared to random hexamers (FIG. 3). Even for the 106 nt U6 RNA
that does not contain any hairpins, higher yields of cDNA were
achieved using the gene-specific priming compared with random
hexamers (FIG. 3B). We conclude that reverse transcription proceeds
through secondary structure such as hairpins if priming occurs at
some point upstream of the hairpin. However, to prime short RNA
molecules, in particular small RNAs containing hairpins,
gene-specific primers and not random primers should be used.
[0091] Intra-Assay Variation.
[0092] To evaluate the intra-assay variation of the real-time PCR
assay, flasks of HeLa, HCT-116 and HL-60 cells were cultured in
triplicate. Total RNA was isolated from the cultures. A 1 .mu.g
aliquot of the total RNA was converted to cDNA as described in
Materials and Methods. The relative expression of the precursors
for miR-18, -107 and -29 were determined using the real-time PCR
assay. The mean, standard deviation and coefficient of variation
from the triplicate RNA isolations/reverse transcription are shown
in FIG. 10. The coefficient of variation among the different genes
and cell lines was quite low, ranging from 1.8 to 34.5%.
[0093] Real-Time PCR of miRNA Precursors.
[0094] An important issue for quantitative PCR is that the
efficiency of amplification for each gene in the study (including
the internal control) should be very similar and be close to the
ideal value of 2. Although amplicon lengths were very similar and
all the miRNA genes contained the hairpin, large differences in the
T.sub.m existed among the primers (Table 1). PCR efficiency was
determined on the U6 RNA as well as six miRNA genes, two with a low
T.sub.m (49-53.degree. C.), two with an intermediate T.sub.m
(55-56.degree. C.) and two with a higher T.sub.m (58-59.degree.
C.). The efficiency of all seven genes was very similar and was
close to the ideal value of 2 (FIG. 11). There was no trend of
altered efficiency with T.sub.m in these genes.
[0095] The cDNA of K-562, HL-60, LNCaP, HeLa, HCT-8, HCT-116 and
Drosophila S2 cells were amplified by the PCR using primers for 23
miRNA precursors. Moderate to strong PCR signals were generated
when cDNA was used as a template for most of the miRNA precursor
primers. PCR amplicons were not generated from the S2 cDNA, or in
the no template or no reverse transcription controls. In the cases
where expression of the miRNA genes was very low
(C.sub.T.gtoreq.35), the primers were validated on HeLa cell
genomic DNA. This was done in order to determine if the weak signal
generated by amplifying cDNA was due to the primers not working or
to the lack of template in the cDNA (i.e. the gene was not
expressed).
[0096] The reproducibility of real-time PCR tends to become worse
when very low copies of template are amplified. For this reason,
the following criteria were used to calculate the mean relative
gene expression and to distinguish between low and undetectable
expression. If three out of three PCRs were above the threshold
after 40 cycles and the thermal dissociation profiles of all three
reactions matched, the C.sub.T of all three plots was used in the
relative expression calculation. If two out of three PCRs were
above the threshold after 40 cycles and the thermal dissociation
plots of the two reactions matched, then the PCR that was below
threshold was discarded and the mean of the remaining two was used
in the relative expression calculation. If only one or no PCRs out
of three were above threshold after 40 cycles, then the expression
of the gene was classified as `undetectable`.
[0097] Representative real-time amplification plots of the
pre-miRNA are shown in FIG. 4. Shown are the PCR plots for miR-21
and let-7d in HCT-8 cDNA (FIG. 4A). Strong signals were generated
for both genes when cDNA template was amplified but not on the no
template or no reverse transcription controls. The thermal
dissociation curves generated at the end of the real-time PCR run
demonstrate that the miR-21 and let-7d primers amplified a single
product that was different from the products generated on the
negative controls (FIG. 4B). FIG. 4 demonstrates how the
dissociation curves may be used to distinguish true PCR amplicons
from the noise that is often generated by amplifying no template
controls or low copies of template.
[0098] miRNA Precursor Expression in Human Cancer Cell Lines.
[0099] The relative expression of 23 miRNA precursors was
determined in six human cancer cells lines. Expression data on four
miRNA precursor genes are shown in FIG. 6. The expression of
miR-93-1 in the HCT-116 colorectal cancer cell line was 50-fold
higher than in the HCT-8 colorectal cancer cell line (FIG. 6A).
miR-24-2 was expressed at relatively constant levels in all of the
cell lines except in Hela cells which expressed between 5 to
10-fold higher levels (FIG. 6C). The colorectal cancer cell lines
and HeLa cells expressed higher levels of miR-29 and miR-147
compared to the blood cancers and prostate cancer cell lines (FIGS.
6B and D). The expression of the 23 miRNA precursors varied within
a particular cell type such as HCT-116 (FIG. 7). The difference in
expression of the miRNA precursors varied over 4,000-fold within
this cell line. miR-21 had the highest level of expression and
miR-30a, the lowest level of expression. The expression of four
miRNAs (miR-20, -28, -33 and -216) was undetectable expression in
HCT-116 cells.
[0100] The relative expression of the miRNA precursors was
presented using the Treeview algorithm (FIG. 8). This allowed
visualization of large amounts of data in a single FIGURE. The
relative gene expression values were multiplied by 10.sup.6. Median
expression was set equal to the value of one and was indicated by
the color black (FIG. 8). Increased (red), decreased (green) and no
expression (gray) were plotted relative to the median value.
Although some exceptions existed, miRNA precursor expression across
the cell lines were more or less similar (i.e. expression was
either high, intermediate, low or undectectable in each of the six
cell lines). This type of analysis allows for the easy
identification of individual genes with very different expression
within the group. For example HCT-116 and HeLa cells expressed much
higher levels of miR-21 than the other cell lines and miR-224 was
undetectable only in HL-60 cells.
[0101] Validation of Real-Time PCR Results with Northern
Blotting.
[0102] Northern blotting is currently the established method to
monitor miRNA expression. In order to validate our real-time PCR
data, Northern blotting was performed on the total RNA from three
different cells lines using probes for miR-29, -21 and -224. miRNAs
were selected that demonstrated high expression by our PCR assay
and that had diverse expression among the cell lines. The trend in
expression between the mature miRNAs as detected by Northern
blotting and the miRNA precursors as detected by PCR was identical
(FIG. 9). The pre-miRNA was visible by Northern blotting only for
miR-21 (HeLa and HCT-116) and miR-224 (HeLa). While strong
amplification was generated on miR-29 (HCT-116), no pre-miRNA band
was visible by Northern blotting. We were unable to detect any
miRNA (mature or precursor) using a probe for miR-220. While
Northern blots were attempted using probes for only four miRNAs,
the lower limit of detection by Northern blotting was a relative
expression value of 0.25.times.10.sup.6 by the PCR assay. This
suggests that most of the miRNAs labeled as green in FIG. 8 would
be undetectable by Northern blotting in our hands and substantiates
the enhanced sensitivity of the PCR compared to Northern
blotting.
Discussion.
[0103] As an alternative to Northern blotting, we developed a
real-time PCR assay to quantify the expression of the miRNA
precursors. The short hairpins of 23 of 29 genes attempted were
successfully converted to cDNA and amplified using standard
real-time PCR methods. For this reason we believe that the assay
may be expanded to include most of the human miRNA precursors and
could eventually include all of the predicted human miRNA genes
once discovered. This assay should easily be adaptable to other
organisms such as plants, C. elegans and Drosophila. The Applied
Biosystems 7900HT sequence detection system used here was equipped
with a 96-well block. This instrument is adaptable to a 384-well
block that would increase the assay throughput by 4-fold.
Therefore, the assay described here could rival the throughput of
microarrays and could be advantageous compared to microarrays due
to the increased sensitivity of the PCR. Sensitive PCR assays
coupled with methods to capture individual cells such as
laser-assisted microdissection can be used to study the cell-type
regulation/expression of miRNAs in individual cell types.
[0104] Presentation of quantitative PCR data using red/green
pseudocolors is a relatively recent phenomena. The only
investigator to our knowledge to organize real-time PCR data in
such a manner is Dittmer during the development of a genome-wide
assay for all of the open reading frames of the Kaposi's sarcoma
herpesvirus. It is practical to generate and present gene
expression data in this manner only if the number of genes of
interest in relatively small (<500). However if the number of
genes is relatively small (such as miRNAs) then presentation of
real-time PCR data in this manner accomplishes the same result as
microarrays, including (i) high throughput analysis of gene
expression and (ii) presentation of large amounts of data as
pseudocolors to visualize differences in expression levels.
[0105] Pre-miRNA is processed to the .about.22 nt mature miRNA by
Dicer-like enzymes in all species in which miRNAs have been
identified. The method described here provides quantitative data on
the miRNA precursors only and not on the mature miRNA. Using a
transcriptional fusion of the let-7 promoter to gfp, it was shown
that let-7 is temporally regulated by transcription and not by
processing of the pre-miRNA or stability of the mature miRNA. In
CLL patients and cancer cell lines, 23 of 60 samples showed the
.about.70 nt miR-15a precursor that was not found in any normal
tissues except bone marrow. The expression of Dicer was relatively
constant in these patients, suggesting inefficient processing of
the miRNAs in some CLL patients that was not related to Dicer
expression. The precursors of 26 miRNAs were equally expressed in
non-cancerous and cancerous colorectal tissue from patients.
However, the expression of mature miR-143 and -145 (but not the
other 24 miRNAs) was greatly reduced in cancerous tissue compared
to non-cancerous tissue, again suggesting altered processing for
specific miRNAs in human disease.
[0106] We demonstrate here that the expression of three miRNA
precursors measured by the PCR assay (miR-21, -29 and -224)
paralleled the expression of the mature miRNAs from Northern blots.
In order to fully characterize the expression of large numbers of
miRNAs, it may be necessary to quantify both the mature and miRNA
precursors using sensitive assays such as the PCR. A major
challenge in measuring the mature miRNA using RT-PCR is the small
size of the mature miRNA (.about.22 nt). There may be situations
(such as in normal development) in which processing or stability of
the miRNA is not regulated and the expression of the miRNA
precursors reflect the levels of the active, mature miRNA. There
may exist other circumstances (such as in human disease), where
alterations in miRNA biogenesis produce levels of mature miRNA that
are very different than the pre-miRNA. In the former situation,
sensitive PCR assays such as the one described here, could be used
to measure the miRNA precursor as a means to predict the levels of
mature miRNA, while in the latter situation, sensitive assays will
be necessary to measure the mature miRNA.
Example 2
Quantification of Pre-miRNA
[0107] The materials and methods are as described in Example 1.
Briefly, PCR using the hairpin primers (FIG. 1) amplifies both the
pri-miRNA and pre-miRNA. To amplify only the pri-miRNA, the
antisense primer to the hairpin is used along with a new sense
primer that is designed to anneal to a sequence upstream of the
hairpin sequence of the pri-miRNA (FIG. 1). PCR using the hairpin
primers (gray/black, FIG. 1) amplifies the pri-miRNA+pre-miRNA and
PCR using the upstream primer along with the antisense hairpin
primer (dashed/black, FIG. 1) amplifies only the pri-miRNA. The
amount of pre-miRNA is then calculated using the equation:
pre-miRNA=2.sup.-C.sub.T.sup.(pri-miRNA+pre-miRNA)-2.sup.-C.sub.T.sup.pr-
i-miRNA.
[0108] Quantification of pri-miRNA and pre-miRNA.
[0109] All of the miRNA primers were designed to anneal to the
hairpin of the miRNA precursors (FIG. 1). A sense primer (5'
GGGCTTTAAAGTGCAGGG 3') was designed to the pri-miR-18 (dashed, FIG.
1). This primer along with the antisense primer for miR-18 was used
to amplify the pri-miR18. Real-time PCR was performed on the cDNA
from the six cancer cell lines using primers for the miR-18
precursors and the pri-miR-18.
[0110] The C.sub.T generated from the miR-18 precursors was
slightly lower than the C.sub.T for the pri-miR-18 (FIG. 5A).
Differences in one C.sub.T unit in real-time PCR data are typical
when detecting a 2-fold difference in template. The amount of
pre-miRNA was calculated as described in Materials and Methods for
Example 1. The relative amounts of pre-miR-18, pri-miR-18 and total
precursors (pri-miR-18+pre-miR-18) were determined in each of the
six cancer cell lines (FIG. 5B). While more of the miR-18
precursors were expressed in K562 cells, the relative amounts of
pri-miR-18 and pre-miR-18 are approximately equal in all six cell
lines. This demonstrates that each pri-miRNA is processed to one
pre-miRNA molecule and shows that there is no regulation of Drosha
processing for miR-18 in these cell lines.
Example 3
Use of Taqman.RTM. MGB Probes to Distinguish miRNA Isoforms
[0111] Many of the discovered human miRNA genes are grouped in
families of two or more nearly identical isoforms. The largest of
the human families include let-7 (14 members) and miR-30 (6
members). miRNA isoform families may be one of two types. The first
type is when the mature miRNAs have nearly identical sequences,
usually differing by 1-3 nt. These families are designated with a
letter (e.g. let-7b and let-7c). The second designation is for
miRNA genes that produce the identical mature miRNA from a slightly
different precursor gene (e.g. let-7a-1 and let-7a-2). These are
designated with a number implying that both genes, let-7a-1 and
let-7a-2, produce the identical mature miRNA (let-7a). Each isoform
is usually located on different chromosomes. There is more sequence
diversity in the precursor gene compared to the mature miRNA. For
example, while miR-30c-1 and -30c-2 produce the identical mature
miRNA, their precursor genes are only 79% identical. The greatest
degree of sequence variation on the precursor miRNAs lies in the
loop portion of the hairpin.
[0112] It is desirable to be able to detect and quantify the
expression of only one specific isoform in samples that contain
many members of a family of isoforms, e.g. the let-7 family
members. To this send, an aspect of the current invention involves
designing TaqMan.RTM. MGB probes to the loop portion of the miRNA
precursor so as to allow discrimination of individual members of a
family of miRNA isoforms. The following example illustrates such a
method.
[0113] Part A of FIG. 12 shows the sequences of 11 members of the
human let-7 microRNA family. The red and blue sequences depict the
sequences of the forward and reverse primers, respectively for each
gene. The sequences colored in yellow differ slightly (primer
binding sites only are shown). The sequences in black that lie in
between the red and blue primers are the potential sequences to
which the TaqMan.RTM. probes may be designed to bind to. The
purpose of the TaqMan.RTM. probe is to allow the PCR product to be
detected by the real-time PCR instrument's fluorescent detector.
Two things must happen in order for the TaqMan.RTM. probes to
fluoresce, PCR must occur and the PCR enzyme must cleave the probe.
In order for the TaqMan.RTM. probes to fluorescence, the probe must
bind to 100% of the DNA sequence that lies in between the two
primers.
[0114] TaqMan.RTM. probes are typically designed with a Tm that is
10.degree. C. higher than that of the primers. As shown in FIG. 12,
the space in between the primer annealing sites is very short
(-15-20 bp). The presence of the MGB allows the design of short
TaqMan.RTM. probes with Tms ranging from 61-68.degree..
[0115] A TaqMan.RTM. MGB probe was designed to anneal to the loop
portion of the miRNA precursor. The probe targeted the human let-7d
sequence 6FAM-ATT TTG CCC ACA AGG A-MGBNFQ (double underlined
sequence, FIG. 12B). This probe binds to the reverse complementary
sequence in the human let-7d gene that lies in between the red and
blue primer sequences. Performing PCR on DNA that contains the
human let-7d sequence using the gene specific primers for let-7d
and the TaqMan.RTM. probe fluoresces and will be detectable.
[0116] To demonstrate the specificity of detection for the let-7d
TaqMan.RTM. MGB probe, the sequences of six miRNA isoforms
(let-7a-1, let-7a-2, let-7a-3, let-7f-1, let-7f-2 and let-7d) were
cloned into plasmids using PCR and TOPO TA cloning. The identity of
the sequences was verified by DNA sequencing. Real-time PCR was
preformed using gene specific primers to each of the six let-7
isoform plasmids as well as a no template control. The TaqMan.RTM.
MGB probe for let-7d was included in each of the PCRs. The results
show that only the PCR with the let-7d plasmid was detected (FIG.
13A). To demonstrate that amplification of template occurred in
each reaction, a sample of each reaction was run on an agarose gel
(FIG. 13B). Therefore while amplification occurred in each of the
six reactions, only the PCR with the TaqMan.RTM. MBG probe detected
the amplicon. This demonstrates the specificity of the detection of
TaqMan.RTM. MGB probes when similar sequences are amplified.
Example 4
Expansion of miRNA Precursor PCR Assay
[0117] The total number of miRNA precursor assays was expanded to
include 201 of the known human miRNAs as of the date of this
application. To demonstrate the usefulness of the assay, the
expression of 201 miRNAs were screened on samples of RNA from
various human tissues (colon, pancreas, ovary, lung and brain). The
primers used are presented in FIG. 15 and the results of the
analysis is presented in FIG. 14.
Materials and Methods
[0118] Cell Lines, Tissues and Tissue Culture.
[0119] The following human tumor cell lines were used: K-562
(chronic myelogenous leukemia), HL-60 (promyeolocytic leukemia),
Daudi and Ramos (Burkitt lymphoma), Jurkat (T-cell leukemia);
LNCaP, PC3, PPC-1, DU145 and TSU-PR1 (prostate); SCC17A, SCC17B,
SCCD12, SCC10B and SCC5 (head & neck squamous cell carcinoma);
MDA231, T47D, SKBR3, MDA361 and MCF7 (breast cancer); SW620, HCT8,
HCT116, HT29 and HCT15 (colorectal carcinoma); Pane1 and Hs 766T
(pancreatic); H23, H522, HOP62, A549 and H719 (lung cancer); RH30,
RH3, CW9019, SMS-CTR and RD2 (rhabdomyosarcoma) and SK-Hep1,
PLC/PRF5, SNU387, SNU449 and H719 (liver cancer). Cells were
obtained from American Type Culture Collection (Manassas, Va., USA)
or were obtained from various laboratories. Cancer cell lines were
cultured in a humidified atmosphere of 95% air, 5% CO2 using RPMI
1640 or other suitable media and 10% fetal bovine serum. Total RNA
from normal human liver and skeletal muscle tissue was purchased
from Ambion (Austin, Tex.). Hepatocellular carcinoma tumors were
received from Dr. Lewis Roberts, Mayo Clinic, Rochester, Minn.
[0120] Primers and TaqMan.RTM. MGB Probes.
[0121] Primers were designed to all of the known human miRNAs as of
December, 2004. These 222 miRNA genes include 38 families of
isoforms. Many of the miRNA isoforms differed by only 1-3 bp in the
primer binding sequence (FIG. 12). If the difference in sequence
occurred towards the 5' end of the primer, then the same pair of
primers was used to amplify both isoforms. If the sequence
difference occurred towards the 3' end of the primer or there were
multiple differences, then a unique pair of primers was designed to
each isoform. Although we refer to the expression of 222 miRNA
precursors, in actuality, primers were designed to and data are
presented on 201 miRNA precursors since several isoforms were
amplified by the same pair of primers.
[0122] Primers were designed to the primary precursor molecule for
several miRNAs. These are designated by the letter "P" in FIG. 15.
Primers were designed to the primary precursor if we were unable to
successfully design primers to the hairpin-containing precursor.
Unsuccessful primer design was defined as either an inability to
amplify genomic DNA or detection of multiple products using
SYBR.RTM. green. The later example could be alleviated using
TaqMan.RTM. probes. In addition, some primers were designed to the
primary precursors of miRNA isoforms. Primers were designed using
Primer Express version 2.0 (Applied Biosystems, Foster City,
Calif.) using the criteria previously described in EXAMPLE 1.
TaqMan.RTM. MGB probes were designed using Primer Express software.
Probes were designed to have a 5' FAM and a MGB at the 3' end.
TaqMan.RTM. MGB probes were synthesized by Applied Biosystems.
Sequences of the TaqMan.RTM. MGB probes are listed in Table 2.
Primers were validated on human genomic DNA (Roche), mouse genomic
DNA, cDNA synthesized from Universal Human Reference RNA
(Stratagene) and no template control reactions.
TABLE-US-00002 TABLE 2 TaqMan .RTM. MGB probes to members of let-7
family of isoforms. Tm Gene Sequence (5' -> 3') (.degree. C.)
let-7a-1 5'-FAM-CACCCACCACTGG-MGB 3' 61.degree. let-7a-3
5'-FAM-CTCTGCCCTGCTATG-MGB 3' 67.degree. let-7b
5'-FAM-AGTGATGTTGCCCC-MGB 3' 65.degree. let-7c
5'-FAM-AGTTACACCCTGGGA-MGB 3' 62.degree. let-7d
5'-FAM-ATTTTGCCCACAAGGA-MGB 3' 67.degree. let-7e
5'-FAM-ACACCCAAGGAGATC-MGB 3' 67.degree. let-7f-1
5'-FAM-TTACCCTGTTCAGGAG-MGB 3' 63.degree. let-7f-2
5'-FAM-TACCCCATCTTGGAG-MGB 3' 63.degree. let-7g
5'-FAM-TACCACCCGGTACAGGA-MGB 3' 68.degree. let-7i
5'-FAM-ATTGCCCGCTGTGGA-MGB 3' 67.degree.
[0123] RNA Extraction, DNA Extraction and Reverse
Transcription.
[0124] cDNA was synthesized from total RNA using gene specific
primers as described in EXAMPLE 1. The gene specific primers
included a mixture of each of the antisense primers to all of the
miRNAs and U6 RNA listed in the FIG. 15. Following an 80.degree. C.
denaturation step and 60.degree. C. annealing, the cDNA was reacted
for 45 min at 60.degree. C. as described in EXAMPLE 1. Genomic DNA
from NIH 3T3 mouse fibroblasts was isolated as described in Sharma,
R. C., et al., A rapid procedure for isolation of RNA-free genomic
DNA from mammalian cells. Biotechniques 1993. 14(2):176-8.
[0125] Real-Time PCR.
[0126] The expression of the miRNA precursors was determined using
real-time quantitative PCR as described in EXAMPLE 1 with several
modifications. Three .mu.l of a master mix containing all of the
reaction components except the primers was dispensed into a
384-well real-time PCR reaction plate (Applied Biosystems) using a
12-channel repeating pipette (Model EDP3-Plus, Rainin Instruments,
Woburn, Mass., USA). The master mix contained 0.5 .mu.l of
10.times.PCR buffer, 0.7 .mu.l of 25 mM MgCl2, 0.1 .mu.l of 12.5 mM
dNTPs, 0.01 .mu.l UNG, 0.025 .mu.l Amplitaq Gold DNA polymerase,
0.5 .mu.l of dilute cDNA (1:50) and water to 3 .mu.l. All of the
PCR reagents were from the SYBR.RTM. green core reagent kit
(Applied Biosystems). A 2 .mu.M solution of each pair of primers
listed in FIG. 15 was stored in 12-well PCR strip tubes. Two .mu.l
of each primer was dispensed into duplicate wells of the 384-well
plate using the 12-channel repeating pipette. Everything was
identical for the TaqMan.RTM. assays except the TaqMan.RTM. core
reagent kit (Applied Biosystems) and 200 nM of the TaqMan.RTM. MGB
primers were used. Each miRNA listed in FIGS. 15 and U6 RNA was
assayed in duplicate in the 384-well reaction plate. Real-time PCR
was performed on an Applied Biosystems 7900HT real-time PCR
instrument equipped with a 384-well reaction block. PCR was
performed for 15 seconds at 95.degree. and one minute at 60.degree.
C. for 40 cycles followed by the thermal denaturation protocol.
TaqMan@ and SYBR.RTM. green assays may be run simultaneously on the
7900HT real-time instrument. The expression of each miRNA relative
to U6 RNA was determined using the 2-.DELTA.CT method. To simplify
the presentation of the data, the relative expression values were
multiplied by 105.
[0127] Validation of miRNA Precursor Primers, SYBR.RTM. Green.
[0128] Each pair of primers listed in FIG. 15 was validated on
human genomic DNA, cDNA synthesized from Universal Human Reference
RNA, mouse genomic DNA and no template control reactions. All of
the primers listed in FIG. 15 worked successfully on human genomic
DNA (not shown). Successful amplification was defined by the
presence of a single dissociation peak on the thermal melting
curve. For those reactions that produced multiple dissociation
peaks, a new pair of primers were designed to the primary precursor
miRNA. These primers are listed with the designation "p", e.g.
miR-9-1(p) (FIG. 15). Many of the miRNA genes that required priming
of the primary precursor were miRNA genes with known isoforms (e.g.
miR-9-1, -19b-1, -106a). About 70% of the human primers
successfully amplified mouse genomic DNA (FIG. 15). The ability of
primers to amplify both between human and mouse miRNA genes is
likely due to the similarity in sequence among these genes. Human
miRNA primers were not tested on mouse cDNA.
[0129] miRNA Precursor Expression Profiling in Cancer Cell
Lines.
[0130] The expression of 222 miRNA precursors was profiled in 32
commonly used cell lines of lung, breast, head & neck,
colorectal, prostate, pancreatic and hematopoietic cancers. Gene
expression data was normalized to U6 RNA. U6 was validated as an
internal control by comparing its expression levels in each of the
cell lines. U6 RNA was consistently expressed in each of the 32
cell lines, thus U6 RNA is an acceptable internal control for
quantitative PCR in these cell lines.
[0131] The relative expression was determined for each of the 222
miRNA precursors. The relative expression for all 222 miRNA
precursors was clustered using unsupervised hierarchical clustering
and presented as a heatmap (FIG. 14). Unsupervised hierarchical was
performed on the data presented as .DELTA. CT. The heatmap and
dendrogram demonstrate that most of the cell lines clustered into
their respective tissues from which each cell line was ostensibly
derived (FIG. 14). Five of five hematopoietic and head & neck
cell lines and two of two pancreatic cell lines produced unique
clusters. Four of five lung and colorectal cell lines produced
unique clusters as well. The breast cancer and prostate cancer cell
lines tended to cluster together with 4 of 5 of the prostate cell
lines forming a cluster (along with one breast cancer cell line)
and 3 of 5 breast plus one prostate forming another cluster (FIG.
14B).
[0132] Full details of the presented EXAMPLE 4 is provided in
Jiang, J, Lee, E J, Gusev Y and Schmittgen T, Real-time expression
profiling of microRNA precursors in human cancer cell lines,
Nucleic Acid Research, 33(17):5394-5403 (2005), the contents of
which are incorporated herein by reference.
Sequence CWU 1
1
470162RNAHomo sapiens 1uaaggugcau cuagugcaga uagugaauga gauuagcauc
uacugcccua agugcuccuu 60cu 62222RNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 2uaaggugcau cuagugcaga ua
22383RNAHomo sapiens 3cggggugagg uaguagguug ugugguuuca gggcagugau
guugccccuc ggaagauaac 60uauacaaccu acugccuucc cug 83487RNAHomo
sapiens 4ucagagugag guaguagauu guauaguugu gggguaguga uuuuacccug
uucaggagau 60aacuauacaa ucuauugccu ucccuga 87583RNAHomo sapiens
5ugugggauga gguaguagau uguauaguuu uagggucaua ccccaucuug gagauaacua
60uacagucuac ugucuuuccc acg 83680RNAHomo sapiens 6ugggaugagg
uaguagguug uauaguuuua gggucacacc caccacuggg agauaacuau 60acaaucuacu
gucuuuccua 80772RNAHomo sapiens 7agguugaggu aguagguugu auaguuuaga
auuacaucaa gggagauaac uguacagccu 60ccuagcuuuc cu 72874RNAHomo
sapiens 8gggugaggua guagguugua uaguuugggg cucugcccug cuaugggaua
acuauacaau 60cuacugucuu uccu 74984RNAHomo sapiens 9gcauccgggu
ugagguagua gguuguaugg uuuagaguua cacccuggga guuaacugua 60caaccuucua
gcuuuccuug gagc 841079RNAHomo sapiens 10cccgggcuga gguaggaggu
uguauaguug aggaggacac ccaaggagau cacuauacgg 60ccuccuagcu uuccccagg
791187RNAHomo sapiens 11ccuaggaaga gguaguaggu ugcauaguuu uagggcaggg
auuuugccca caaggaggua 60acuauacgac cugcugccuu ucuuagg 871284RNAHomo
sapiens 12aggcugaggu aguaguuugu acaguuugag ggucuaugau accacccggu
acaggagaua 60acuguacagg ccacugccuu gcca 841384RNAHomo sapiens
13cuggcugagg uaguaguuug ugcuguuggu cggguuguga cauugcccgc uguggagaua
60acugcgcaag cuacugccuu gcua 841422RNAHomo sapiens 14ugagguagua
gguugugugg uu 221522RNAHomo sapiens 15ugagguagua gguuguaugg uu
221621RNAHomo sapiens 16agagguagua gguugcauag u 211721RNAHomo
sapiens 17ugagguagga gguuguauag u 211822RNAHomo sapiens
18ugagguagua gguuguauag uu 221922RNAHomo sapiens 19ugagguagua
gauuguauag uu 222021RNAHomo sapiens 20ugagguagua guuuguacag u
212119RNAHomo sapiens 21ugagguagua guuugugcu 192217DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
22ctcgcttcgg cagcaca 172320DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 23aacgcttcac gaatttgcgt
202423DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 24aaacatactt ctttatatgc cca 232525DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
25tacatacttc tttacattcc atagc 252625DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
26acatacttct ttatgtaccc atatg 252725DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
27tacatacttc tttacattcc atagc 252823DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
28tggaagacta gtgattttgt tgt 232922DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 29agactgtgat ttgttgtcga tt
223023DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 30tggaagacta gtgattttgt tgt 233121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
31agactgggat ttgttgttga g 213223DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 32tggaagacta gtgattttgt tgt
233320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 33ggctgtgact tgttgtcgta 203418DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
34ggaggctgcg tggaagag 183516DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 35cgtgaggccg gctttc
163619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 36ctggagtctg gcaagagga 193722DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
37agtctttcat tctcacacgc tc 223817DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 38cagcggcact ggctaag
173917DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 39gctcgcacgc agaagtt 174023DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
40taccctgtag atccgaattt gtg 234124DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 41attcccctag atacgaattt
gtga 244221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 42cagcacataa tggtttgtgg a 214318DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
43gcagcacaat atggcctg 184421DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 44agcacatcat ggtttacatg c
214523DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 45ctagagcagc aaataatgat tcg 234621DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
46gcagcacgta aatattggcg t 214724DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 47cagcagcaca gttaatactg
gaga 244821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 48gcacgtaaat attggcgtag t 214922DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
49aagcagcaca gtaatattgg tg 225023DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 50gcaggaaaaa agagaacatc acc
235116DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 51tggcttcccg aggcag 165223DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
52taaggtgcat ctagtgcaga tag 235320DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 53gaaggagcac ttagggcagt
205420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 54ccaataattc aagccaagca 205521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
55caggcagatt ctacatcgac a 215617DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 56cctgtcgccc aatcaaa
175721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 57caacctgtgt agaaaggggt t 215821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
58ggcacttcca gtactcttgg a 215922DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 59gtgtgttcac acagacgtag ga
226023DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 60gcactaaagt gcttatagtg cag 236123DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
61gtactttaag tgctcataat gca 236223DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 62gcttatcaga ctgatgttga ctg
236317DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 63cagcccatcg actggtg 176417DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
64agcaacatgc cctgctc 176521DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 65tctgtcacct tccagatgat g
216617DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 66ctggggttcc tggggat 176720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
67tggtaatccc tggcaatgtg 206819DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 68aagcccagtg tgtgcagac
196918DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 69accacggttt ctggagga 187019DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
70ctcccgtgcc tactgagct 197121DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 71ccctgttcct gctgaactga g
217218DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 72tgagaggcgg agacttgg 187320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
73tcagaccgag acaagtgcaa 207424DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 74ttcaagtaat ccaggatagg ctgt
247522DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 75tgcaagtaac caagaatagg cc 227624DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
76ttcaagtaat ccaggatagg ctgt 247721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
77caagtaatgg agaacaggct g 217818DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 78gcagggctta gctgcttg
187919DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 79ggcggaactt agccactgt 198025DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
80ggagctcaca gtctattgag ttacc 258120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
81cctccaggag ctcacaatct 208220DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 82atgactgatt tcttttggtg
208320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 83ataaccgatt tcagatggtg 208420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
84tggtttcata tggtggttta 208520DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 85ataaccgatt tcagatggtg
208623DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 86gtaaacatcc tcgactggaa gct 238720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
87gctgcaaaca tccgactgaa 208821DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 88aggttaaccc aacagaaggc t
218918DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 89ccttgaagtc cgaggcag 189017DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
90cctcactgcg tctccgt 179117DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 91cctgtgggca caaacct
179224DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 92catgtaaaca tcctacactc agct 249318DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
93atccacctcc cagccaat 189419DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 94gtgaatgctg tgcctgttc
199523DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 95gcctctgtat actattcttg cca 239624DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
96tgtgtaaaca tcctacactc tcag 249720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
97gagtaaacaa ccctctccca 209818DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 98cagtggtcag gggctgat
189921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 99ggagtggaga ctgttccttc t 2110019DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
100gactgccaac cccatccta 1910120DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 101cctcagaaac aaacacggga
2010221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 102gttgttgtaa acatccccga c 2110322DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
103gcagcaaaca tctgactgaa ag 2210420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
104gctgaagatg atgactggca 2010518DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 105ctccactccg ggacagaa
1810620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 106tgagtgtgtt ttccctccct 2010717DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
107gccatggctg ctgtcag 1710823DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 108gcacattact aagttgcatg ttg
2310924DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 109tatcacacac actaaattgc attg 2411020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
110tgtggtgcat tgtagttgca 2011120DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 111ctgtgatgca ctgtggaaac
2011221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 112tggcagtgtc ttagctggtt g 2111323DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
113ggcagtatac ttgctgattg ctt 2311423DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
114gcagtgtcat tagctgattg tac 2311521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
115gatggcagtg gagttagtga t 2111624DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 116gcagtgtagt tagctgattg
ctaa 2411718DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
117cctggccgtg tggttagt 1811820DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 118tctacacagg ttgggatcgg
2011921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 119cgggacaagt gcaataccat a 2112020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
120atgcgtatct ccagcactca 2012117DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 121ccacccgaca acagcaa
1712219DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 122aagtgctgtt cgtgcaggt 1912319DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
123ctcgggaagt gctagctca 1912423DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 124ggcactcaat aaatgtctgt tga
2312521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 125tgctcaataa atacccgttg a 2112617DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
126agagagcccg caccagt 1712718DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 127cttgaggagg agcaggct
1812824DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 128ggtagtaagt tgtattgttg tggg 2412924DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
129tatagttatc ttctaattgg ggcc 2413022DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
130taaacccgta gatccgatct tg 2213119DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
131ccacagacac gagcttgtg 1913218DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 132cccacccgta gaaccgac
1813320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 133ccacagacac gagcttgtgt 2013420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
134aacccgtaga tccgaacttg 2013524DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 135tacctataga tacaagcttg
tgcg 2413620DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 136gccctggctc agttatcaca
2013723DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 137gccatccttc agttatcaca gta 2313820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
138ttttcggtta tcatggtacc 2013925DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 139ccttcagtta tcacagtact
gtacc 2514020DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 140gcttctttac agtgctgcct
2014121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 141ttcatagccc tgtacaatgc t 2114222DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
142caaatgctca gactcctgtg gt 2214320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
143gcacatgctc aaacatccgt 2014420DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 144ctgcatggat ctgtgaggac
2014520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 145agcagctcaa aagcatcaac 2014625DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
146taaagtgctg acagtgcaga tagtg 2514719DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
147caagtaccca cagtgcggt 1914822DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 148cagcttcttt acagtgttgc ct
2214921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 149gatagccctg tacaatgctg c 2115022DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
150ggatttttag gggcattatg ac 2215118DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
151gagggacttt caggggca 1815221DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 152ggagtgtgac aatggtgttt g
2115322DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 153tttagtgtga taatggcgtt tg 2215418DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
154tccgtgttca cagcggac 1815518DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 155cattcaccgc gtgcctta
1815620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 156gtccctgaga ccctttaacc 2015719DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
157aacctcacct gtgaccctg 1915820DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 158gtccctgaga ccctaacttg
2015918DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 159agcctaaccc gtggattt 1816020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
160gtccctgaga ccctaacttg 2016120DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 161aagagcctga cttgtgatgt
2016221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 162tattactttt ggtacgcgct g 2116321DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
163gcgcattatt actcacggta c 2116420DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 164agcctgctga agctcagagg
2016519DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 165gccaagctca gacggatcc 1916617DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
166tggattcggg gccgtag 1716722DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 167aaagagaccg gttcactgtg ag
2216816DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 168ggaagggggg ccgata 1616922DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
169aaagagaccg gttcactgtg ag 2217018DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
170ctttttgcgg tctgggct 1817119DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 171gctttttggg gtaagggct
1917216DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 172tgagtgggcc agggac 1617317DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
173gcaatgctga ggaggca 1717422DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 174cctgttgcac tactataggc cg
2217521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 175tgccctttta acattgcact g 2117621DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
176aaccgtggct ttcgattgtt a 2117723DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 177cgaccatggc tgtagactgt
tac 2317822DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 178gagctggtaa aatggaacca aa 2217919DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
179acagctggtt gaaggggac 1918019DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 180ctggtcaaac ggaaccaag
1918119DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 181acagctggtt gaaggggac 1918220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
182gtgactggtt gaccagaggg 2018319DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 183ggtgactagg tggcccaca
1918424DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 184ctatggcttt ttattcctat gtga 2418517DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
185cacggctcca atcccta 1718619DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 186gcttctcgct tccctatga
1918716DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 187tccgaacctg gtccca 1618823DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
188ggactccatt tgttttgatg atg 2318923DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
189agactcattt gagacgatga tgg 2319019DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
190gtgacgggta ttcttgggt 1919122DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 191gactacgcgt attcttaagc aa
2219220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 192cagctggtgt tgtgaatcag 2019320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
193accctggtgt cgtgaaatag 2019422DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 194ttctacagtg cacgtgtctc ca
2219517DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 195tactccaaca gggccgc 1719623DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
196cagtggtttt accctatggt agg 2319721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
197cgtggttcta ccctgtggta g 2119823DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 198gtccatcttc cagtacagtg
ttg 2319922DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 199agccatcttt accagacagt gt 2220018DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
200ttggagcagg agtcagga 1820116DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 201cgccgaggaa gatggt
1620219DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 202tgaggtgcag tgctgcatc 1920324DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
203gctacagtgc ttcatctcag actc 2420422DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
204gctgggatat catcatatac tg 2220524DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
205cggactagta catcatctat actg 2420620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
206ggatgcagaa gagaactcca 2020718DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 207cctcatcctg tgagccag
1820820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 208ttgagaactg aattccatgg 2020922DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
209gctgaagaac tgaatttcag ag 2221023DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
210ctaaagacaa catttctgca cac 2321121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
211atctagcaga agcatttcca c 2121221DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 212gaggaagaca gcacgtttgg t
2121316DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 213aaaggcgcag cgacgt 1621422DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
214tctgtctaag tcacccaatc tc 2221520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
215tctattcttc cctcccactc 2021619DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 216ctggctccgt gtcttcact
1921716DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 217agcacagccc ccgtcc 1621821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
218gtctcccaac ccttgtacca g 2121918DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 219tgtcccccag gcctgtac
1822021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 220ctcgaggagc tcacagtcta g 2122120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
221gtcctcaagg agcttcagtc 2022221DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 222gcccaggttc tgtgatacac t
2122319DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 223cccaagttct gtcatgcac 1922423DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
224catttttgtg atctgcagct agt 2322523DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
225tcacttttgt gactatgcaa ctg 2322620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
226taggttatcc gtgttgcctt 2022723DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 227aataggtcaa ccgtgtatga
ttc 2322822DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 228gttaatgcta atcgtgatag gg
2222924DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 229gctaatatgt aggagtcagt tgga 2423019DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
230aacattcaac gctgtcggt 1923120DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 231cagtcaacgg tcagtggttt
2023219DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 232aacattcaac gctgtcggt 1923321DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
233ttgcattcat tgttcagtga g 2123421DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 234tttggcaatg gtagaactca c
2123521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 235gttggcaagt ctagaaccac c 2123622DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
236gtatggcact ggtagaattc ac 2223719DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
237tatggccctt cggtaattc 1923820DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 238cttatcactt ttccagccca
2023920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 239ccttatcagt tctccgtcca 2024020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
240ggagagaaag gcagttcctg 2024118DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 241ggaccagagg aaagccag
1824220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 242cacccatcat attcttccca 2024322DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
243gacattcaca tgcttcaggt ag 2224419DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
244ctcgggctac aacacagga 1924519DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 245gctgcaacac aagacacga
1924620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 246ccatatgtcg tgccaagaga 2024720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
247cacatgcaca agagagcaag 2024825DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 248gtgatatgtt tgatatatta
ggttg 2524924DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 249ggaatatgtt tgatatatag ttgg
2425018DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 250gcaacggaat cccaaaag 1825117DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
251gacgaaatcc aagcgca 1725221DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 252ctgacctatg aattgacagc c
2125319DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 253tgacctatgg aattggcag 1925417DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
254gtctttgcgg gcgagat 1725520DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 255aactgggact ttgtaggcca
2025620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 256tgtaacagca actccatgtg 2025720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
257taacagcatc tccactggaa 2025819DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 258ggagtctttg ttgcccaca
1925916DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 259ggctcagccc ctcctc 1626022DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
260taggtagttt catgttgttg gg 2226119DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
261atcgggtggt ttaatgttg 1926217DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 262taccacccgg tacagga
1726320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 263cagtttcttg ttgccgagtt 2026415DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
264attgcccgct gtgga 1526517DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 265aggcagtgtc gtgctgt
1726618DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 266ctgtgccggg tagagagg 1826718DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
267atgctgggtg gagaaggt 1826817DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 268ggtccagagg ggagata
1726924DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 269tttattctat agagaagaag gaaa 2427018DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
270gtggtggttt ccttggct 1827120DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 271ggtggtggaa aatgacactc
2027219DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 272ggaggctttt cctgaggac 1927320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
273ccctagtgtg caaaacctgt 2027417DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 274caccggatgg acagaca
1727517DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 275cggtccagct ctccagt 1727617DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
276ttccacagca gcccctg 1727718DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 277gatgtgcctc ggtggtgt
1827820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 278catcttactg ggcagcattg 2027924DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
279gtcatcatta ccaggcagta ttag 2428020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
280ctcgtcttac ccagcagtgt 2028124DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 281gtcatcatta ccaggcagta
ttag 2428222DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 282tccagtggtt cttaacagtt ca
2228323DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 283ggtctagtgg tcctaaacat ttc 2328420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
284ccctttgtca tcctatgcct 2028517DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 285gtccctttgc cttccca
1728618DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 286ccttcattcc accggagt 1828723DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
287gaacttcact ccactgaaat ctg 2328821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
288acatgcttct ttatatcccc a 2128923DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 289aaaccacaca cttccttaca
ttc 2329017DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 290agcttttggc ccgggtt 1729121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
291ccaacaagct ttttgctcgt c 2129217DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 292cctgcccacc gcacact
1729317DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 293agccgctgtc acacgca 1729419DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
294cctttgtcat ccttcgcct 1929517DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 295cccctttgct gtccctg
1729621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 296caccttggct ctagactgct t 2129720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
297gccgtgactg gagactgtta 2029820DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 298gaacattcaa cgctgtcggt
2029921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 299gtacaatcaa cggtcgatgg t 2130021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
300tctgcctgtc tacacttgct g 2130119DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 301tgactgcctg tctgtgcct
1930224DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 302atgacctatg aattgacaga caat 2430322DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
303ttggcctaaa gaaatgacag ac 2230420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
304tggcttaatc tcagctggca 2030521DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 305tgagggctag gaaattgctc t
2130623DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 306gatactgcat caggaactga ttg 2330721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
307ggcaatgcat taggaactga t 2130822DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 308gtgcttgatc taaccatgtg gt
2230920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 309gtgcttgacg gaaccatgtt 2031020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
310tcctgattgt ccaaacgcaa 2031122DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 311gggacgtcca gactcaactc tc
2231221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 312ccacaccgta tctgacactt t 2131319DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
313cagaccgcat catgaacac 1931424DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 314cctggcatac aatgtagatt tctg
2431522DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 315aaacccagca gacaatgtag ct 2231618DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
316ccccagaagg caaaggat 1831722DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 317ctctctcagg acactgaagc ag
2231822DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 318ccgtgtattt gacaagctga gt 2231922DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
319tggggtattt gacaaactga ca 2232023DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
320ggctttcaag tcactagtgg ttc 2332122DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
321ctttgtagtc actagggcac ca 2232217DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
322ccccccctca atcctgt 1732318DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 323ggagagcctc cacccaac
1832417DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 324accaccatcg tgcggta 1732517DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
325gtttggatgg ctgggct 1732623DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 326gctctgactt tattgcacta ctg
2332723DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 327gctttgacaa tactattgca ctg 2332823DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
328ccacttaaac gtggatgtac ttg 2332920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
329tcaccaaaac atggaagcac 2033023DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 330caactttaac atggaagtgc
ttt 2333125DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 331cctactaaaa catggaagca cttac
2533220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 332gctttaacat gggggtacct 2033320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
333tcaccaaaac atggaagcac 2033423DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 334tctactttaa catggaggca
ctt 2333520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 335tcaccaaaac atggaagcac 2033617DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
336cgccttctct tcccggt 1733717DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 337ttcgccctct caaccca
1733819DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 338ctaagccagg gattgtggg 1933916DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
339ctttaccccg ggtggg 1634017DNAArtificial SequenceDescription
of
Artificial Sequence Synthetic primer 340agaggtggtc cgtggcg
1734121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 341gaggtcgacc gtgtaatgtg c 2134220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
342cattgctgtc tctcttcgca 2034317DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 343tggggctttc ttcccag
1734423DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 344cctagtaggt gtccagtaag tgt 2334522DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
345gataggaggt cctcaataaa ca 2234618DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
346cgggactccc atcaagaa 1834719DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 347ctggaagctg aagctgcat
1934819DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 348gaggggctca gggagaaag 1934917DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
349ggacggaagg gcagaga 1735020DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 350ctgggcctgt gtcttaggct
2035117DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 351tgcaggccgt gtgcttt 1735219DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
352gagctgaaag cactcccaa 1935321DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 353cacactcttg atgttccagg a
2135423DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 354gtcaagagca ataacgaaaa atg 2335521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
355gaggtcagga gcaataatga a 2135620DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 356acggcttcat acaggagttg
2035720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 357ggcatcatat aggagctgga 2035822DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
358ccaacaatat cctggtgctg ag 2235922DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
359caacaaaatc actgatgctg ga 2236019DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
360tccctgtcct ccaggagct 1936117DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 361tctgtcgtcg aggcgct
1736223DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 362ataaagcaat gagactgatt gtc 2336323DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
363ggctataaag taactgagac gga 2336421DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
364gtgctatctg tgattgaggg a 2136517DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 365cgggtgcgat ttctgtg
1736620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 366ctgactccta gtccagggct 2036718DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
367ctccagaccc ctcgttca 1836820DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 368gcatgcctgc ctctctgttg
2036916DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 369tgcccaggca gctgca 1637023DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
370cttatcagaa tctccagggg tac 2337120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
371gcaaatcaga atcacacctg 2037222DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 372ctgttgctaa tatgcaactc tg
2237320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 373caccattgct aaagtgcaat 2037425DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
374ggtggatatt ccttctatgt ttatg 2537522DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
375aacgtggaat ttcctctatg tt 2237622DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
376ggagatcgac cgtgttatat tc 2237725DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
377gaaaagatca accatgtatt attcg 2537821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
378ggtcacgtct ctgcagttac a 2137917DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 379accaggttcc accccag
1738019DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 380tcaaactgtg ggggcactt 1938119DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
381acactcaaaa gatggcggc 1938222DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 382gcctcaaatg tggagcacta tt
2238320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 383tcaaatgtcg cagcactttc 2038418DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
384ctcaaaatgg gggcgctt 1838520DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 385caccccaaaa tcgaagcact
2038620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 386gccctcaagg agctcacagt 2038720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
387caccccctgg gaagaaattt 2038816DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 388acgagcccct cgcaca
1638917DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 389cctcacgcga gccgaac 1739024DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
390ggtagattct ccttctatga gtac 2439119DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
391acgtggattt tcctctatg 1939218DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 392gagcagaggt tgcccttg
1839321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 393acaaaagttg cctttgtgtg a 2139420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
394ctcctgactc caggtcctgt 2039520DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 395gccttctgac tccaagtcca
2039623DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 396agagatggta gactatggaa cgt 2339723DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
397gtggaccatg ttacataggt cag 2339821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
398gatggttgac catagaacat g 2139923DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 399gatgtggacc atattacata
cga 2340017DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 400agcgaggttg ccctttg 1740122DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
401acagagagct tgcccttgta ta 2240221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
402gaagttgttc gtggtggatt c 2140322DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 403aagtgttgtc cgtgaatgat tc
2240423DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 404cagatcagaa ggtgattgtg gct 2340520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
405ttctgaccag gcagtgctgt 2040625DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 406caattcctag acaatatgta
taatg 2540723DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 407gtcattccta gaaattgttc ata
2340819DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 408tcctgactcc aggtcctgt 1940919DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
409ggccttctga ctccaagtc 1941017DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 410tgaggggcag agagcga
1741117DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 411gaggggcctc agaccga 1741222DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
412agcagcaatt catgttttga ag 2241317DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
413gcagcgcctc acgtttt 1741421DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 414atgacacgat cactcccgtt g
2141517DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 415gggcggacac gacattc 1741625DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
416aggtagtagg ttgtatagtt ttagg 2541725DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
417taggaaagac agtagattgt atagt 2541820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
418cctggatgtt ctcttcactg 2041920DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 419gcctggatgc agacttttct
2042026DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 420gaggtagtag gttgtatagt ttagaa
2642119DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 421aaagctagga ggctgtaca 1942220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
422ttccagccat tgtgactgca 2042320DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 423ctcaccatgt tgtttagtgc
2042424DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 424gaggtagtag gttgtatagt ttgg 2442526DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
425ggaaagacag tagattgtat agttat 2642620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
426accaagaccg actgcccttt 2042720DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 427ctctgtccac cgcagatatt
2042821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 428tgaggtagta ggttgtgtgg t 2142921DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
429ggaaggcagt aggttgtata g 2143016DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 430cctcccgcag tgcaag
1643118DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 431catggggtcg tgtcactg 1843223DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
432ttgaggtagt aggttgtatg gtt 2343322DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
433ggaaagctag aaggttgtac ag 2243420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
434ttggaggagc tgactgaaga 2043519DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 435aagaattcct cgacggctc
1943621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 436aggttgcata gttttagggc a 2143720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
437aaggcagcag gtcgtatagt 2043821DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 438gccaagtaga agaccagcaa g
2143921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 439caaggaaaca ggttatcggt g 2144024DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
440gaggtaggag gttgtatagt tgag 2444121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
441gaaagctagg aggccgtata g 2144217DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 442ctgtctgtct gtctgtc
1744319DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 443agaaaagagc ccggctctt 1944423DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
444gattgtatag ttgtggggta gtg 2344522DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
445gggaaggcaa tagattgtat ag 2244620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
446tgtactttcc attccagaag 2044720DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 447taatgcagca agtctactcc
2044825DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 448ggtagtagat tgtatagttt taggg
2544924DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 449gggaaagaca gtagactgta tagt 2445020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
450tgaagatgga cactggtgct 2045120DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 451cagtcggaga
agaagtgtac
2045225DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 452gtagtagttt gtacagtttg agggt
2545318DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 453ggcagtggcc tgtacagt 1845418DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
454agcgctccgt ttcctttt 1845516DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 455ccccacttgg cagctg
1645617DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 456tgtgctgttg gtcgggt 1745718DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
457gcagtagctt gcgcagtt 1845817DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 458cgaggaagga cggagga
1745918DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 459gctgagcatc accagcac 1846023DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
460gtagcagcac ataatggttt gtg 2346124DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
461cagcagcaca gttaaatact ggag 2446218DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
462gggctttaaa gtgcaggg 1846313DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 463cacccaccac tgg
1346415DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 464ctctgccctg ctatg 1546514DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
465agtgatgttg cccc 1446615DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 466agttacaccc tggga
1546716DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 467attttgccca caagga 1646815DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
468acacccaagg agatc 1546916DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 469ttaccctgtt caggag
1647015DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 470taccccatct tggag 15
* * * * *
References