U.S. patent application number 13/353209 was filed with the patent office on 2012-12-13 for modulation of apolipoprotein(a) expression.
This patent application is currently assigned to Isis Pharmaceuticals, Inc.. Invention is credited to Rosanne M. Crooke, Mark J. Graham.
Application Number | 20120316219 13/353209 |
Document ID | / |
Family ID | 35883353 |
Filed Date | 2012-12-13 |
United States Patent
Application |
20120316219 |
Kind Code |
A1 |
Crooke; Rosanne M. ; et
al. |
December 13, 2012 |
MODULATION OF APOLIPOPROTEIN(A) EXPRESSION
Abstract
Compounds, compositions and methods are provided for modulating
the expression of apolipoprotein(a). The compositions comprise
oligonucleotides, targeted to nucleic acid encoding
apolipoprotein(a). Methods of using these compounds for modulation
of apolipoprotein(a) expression and for diagnosis and treatment of
disease associated with expression of apolipoprotein(a) are
provided.
Inventors: |
Crooke; Rosanne M.;
(Carlsbad, CA) ; Graham; Mark J.; (San Clemente,
CA) |
Assignee: |
Isis Pharmaceuticals, Inc.
Carlsbad
CA
|
Family ID: |
35883353 |
Appl. No.: |
13/353209 |
Filed: |
January 18, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12765647 |
Apr 22, 2010 |
8138328 |
|
|
13353209 |
|
|
|
|
11830734 |
Jul 30, 2007 |
7741305 |
|
|
12765647 |
|
|
|
|
10684440 |
Oct 15, 2003 |
7259150 |
|
|
11830734 |
|
|
|
|
09923515 |
Aug 7, 2001 |
7227014 |
|
|
10684440 |
|
|
|
|
60475402 |
Jun 2, 2003 |
|
|
|
Current U.S.
Class: |
514/44A ;
435/375; 514/44R; 536/23.5; 536/24.5 |
Current CPC
Class: |
C12N 15/113 20130101;
C12N 2310/341 20130101; A61P 9/10 20180101; A61P 3/06 20180101;
C12N 2310/346 20130101; A61P 3/00 20180101; C12N 2320/30 20130101;
C12N 2310/3341 20130101; A61K 38/00 20130101; C12N 2310/321
20130101; A61P 9/00 20180101; C12N 2310/11 20130101; C12N 2310/315
20130101; C12N 2310/321 20130101; C12N 2310/3525 20130101 |
Class at
Publication: |
514/44.A ;
536/23.5; 536/24.5; 514/44.R; 435/375 |
International
Class: |
C12N 15/12 20060101
C12N015/12; A61K 31/711 20060101 A61K031/711; C12N 5/071 20100101
C12N005/071; A61P 9/10 20060101 A61P009/10; A61P 3/06 20060101
A61P003/06; A61K 31/713 20060101 A61K031/713; C12N 15/113 20100101
C12N015/113; A61P 9/00 20060101 A61P009/00 |
Claims
1. A compound 8 to 80 nucleobases in length targeted to a nucleic
acid molecule encoding apolipoprotein(a), wherein said compound is
at least 70% complementary to said nucleic acid molecule encoding
apolipoprotein(a), and wherein said compound comprises at least an
8 nb sequence selected from any of SEQ ID NOs: 13-22, 24-38,
41-45.
2. The compound of claim 1 comprising 12 to 50 nucleobases in
length.
3. The compound of claim 2 comprising 15 to 30 nucleobases in
length.
4. The compound of claim 1 comprising an oligonucleotide.
5. The compound of claim 4 comprising an antisense
oligonucleotide.
6.-7. (canceled)
8. The compound of claim 4 comprising a chimeric
oligonucleotide.
9. (canceled)
10. The compound of claim 1 having at least 80%, at least 90%, at
least 95%, at least 99% or 100% complementarity with said nucleic
acid molecule encoding apolipoprotein(a).
11.-13. (canceled)
14. The compound of claim 1 having at least one modified
internucleoside linkage, sugar moiety, or nucleobase.
15. The compound of claim 1 having at least one 2'-O-methoxyethyl
sugar moiety.
16. The compound of claim 1 having at least one phosphorothioate
internucleoside linkage.
17. The compound of claim 1 having at least one
5-methylcytosine.
18.-24. (canceled)
25. A method of inhibiting the expression of apolipoprotein(a) in a
cell or tissue comprising contacting said cell or tissue with the
compound of claim 1 so that expression of apolipoprotein(a) is
inhibited.
26.-28. (canceled)
29. A kit or assay device comprising the compound of claim 1.
30. A method of treating an animal having a disease or condition
associated with apolipoprotein(a) comprising administering to said
animal a therapeutically or prophylactically effective amount of
the compound of claim 1 so that expression of apolipoprotein(a) is
inhibited.
31. (canceled)
32. The method of claim 30, wherein the disease or condition is a
cardiovascular disorder, atherosclerosis, hypercholesterolimia,
coronary artery disease or any combination thereof.
33. A method of inhibiting the expression of apolipoprotein(a)
comprising contacting a biological system expressing human
apolipoprotein(a) with a synthetic antisense compound, wherein said
synthetic antisense compound comprises from 15 to 30 nucleobases in
length and has at least 3 mismatches to human plasminogen and
wherein the compound comprises at least an 8 nb sequence selected
from any of SEQ ID NOs: 13-22, 24-38, 41-45.
34. The method of claim 33 wherein the biological system is a
human.
35. (canceled)
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 12/765,647, filed Apr. 22, 2010, which is a continuation of
U.S. patent application Ser. No. 11/830,734, filed Jul. 30, 2007,
now issued as U.S. Pat. No. 7,741,305, which is a continuation of
U.S. patent application Ser. No. 10/684,440, filed Oct. 15, 2003,
now issued as U.S. Pat. No. 7,259,150, which is a
continuation-in-part application of U.S. patent application Ser.
No. 09/923,515, filed Aug. 7, 2001, now issued as U.S. Pat. No.
7,227,014. U.S. patent application Ser. No. 10/684,440 also claims
the benefit of the priority of U.S. provisional patent application
No. 60/475,402, filed Jun. 2, 2003, now expired. Each of these
applications is herein incorporated by reference in their
entirety.
SEQUENCE LISTING
[0002] The present application is being filed along with a Sequence
Listing in electronic format. The Sequence Listing is provided as a
file entitled ISPH0595USC4SEQ.txt, created on Jan. 18, 2012 which
is 72 Kb in size. The information in the electronic format of the
sequence listing is incorporated herein by reference in its
entirety.
BACKGROUND OF THE INVENTION
[0003] The present invention provides compositions and methods for
modulating the expression of Apolipoprotein(a).
[0004] Lipoproteins are globular, micelle-like particles that
consist of a non-polar core of acylglycerols and cholesteryl
esters, surrounded by an amphiphilic coating consisting of protein,
phospholipid and cholesterol. Lipoproteins have been classified
into five broad categories on the basis of their functional and
physical properties: chylomicrons (which transport dietary lipids
from intestine to tissues), very low density lipoproteins (VLDL),
intermediate density lipoproteins (IDL), low density lipoproteins
(LDL), (all of which transport triacylglycerols and cholesterol
from the liver to tissues), and high density lipoproteins (HDL)
(which transport endogenous cholesterol from tissues to the
liver).
[0005] Lipoprotein particles undergo continuous metabolic
processing and have variable properties and compositions.
Lipoprotein densities increase without decreasing particle diameter
because the density of their outer coatings is less than that of
the inner core. The protein components of lipoproteins are known as
apolipoproteins. At least nine apolipoproteins are distributed in
significant amounts among the various human lipoproteins.
[0006] Lipoprotein(a) (also known as Lp(a)) is a cholesterol rich
particle of the pro-atherogenic LDL class. Since Lp(a) is found
only in Old World primates and European hedgehogs, it has been
suggested that it does not play an essential role in lipid and
lipoprotein metabolism. Most studies have shown that high
concentrations of Lp(a) are strongly associated with increased risk
of cardiovascular disease (Rainwater and Kammerer, J. Exp. Zool.,
1998, 282, 54-61). These observations have stimulated numerous
studies in humans and other primates to investigate the factors
that control Lp(a) concentrations and physiological properties
(Rainwater and Kammerer, J. Exp. Zool., 1998, 282, 54-61).
[0007] Lp(a) contains two disulfide-linked distinct proteins,
apolipoprotein(a) (or ApoA) and apolipoprotein B (or ApoB)
(Rainwater and Kammerer, J. Exp. Zool., 1998, 282, 54-61).
Apolipoprotein(a) is a unique apolipoprotein encoded by the LPA
gene which has been shown to exclusively control the physiological
concentrations of Lp(a) (Rainwater and Kammerer, J. Exp. Zool.,
1998, 282, 54-61). It varies in size due to interallelic
differences in the number of tandemly repeated Kringle 4-encoding
5.5 kb sequences in the LPA gene (Rainwater and Kammerer, J. Exp.
Zool., 1998, 282, 54-61).
[0008] Cloning of human apolipoprotein(a) in 1987 revealed homology
to human plasminogen (McLean et al., Nature, 1987, 330, 132-137).
The gene locus LPA encoding apolipoprotein(a) was localized to
chromosome 6q26-27, in close proximity to the homologous gene for
plasminogen (Frank et al., Hum. Genet., 1988, 79, 352-356).
[0009] Transgenic mice expressing human Apolipoprotein(a) were
found to be more susceptible than control mice to the development
of lipid-staining lesions in the aorta. Consequently,
apolipoprotein(a) is co-localized with lipid deposition in the
artery walls (Lawn et al., Nature, 1992, 360, 670-672). As an
extension of these studies, it was established that the major in
vivo action of apolipoprotein(a) is inhibition of conversion of
plasminogen to plasmin which causes decreased activation of latent
transforming growth factor-beta. Since transforming growth
factor-beta is a negative regulator of smooth muscle cell migration
and proliferation, inhibition of plasminogen activation indicates a
possible mechanism for apolipoprotein(a) induction of
atherosclerotic lesions (Grainger et al., Nature, 1994, 370,
460-462).
[0010] Elevated plasma levels of Lp(a), caused by increased
expression of apolipoprotein(a), are associated with increased risk
for atherosclerosis and its manifestations, which include
hypercholesterolemia (Seed et al., N. Engl. J. Med., 1990, 322,
1494-1499), myocardial infarction (Sandkamp et al., Clin. Chem.,
1990, 36, 20-23), and thrombosis (Nowak-Gottl et al., Pediatrics,
1997, 99, E11).
[0011] Moreover, the plasma concentration of Lp(a) is strongly
influenced by heritable factors and is refractory to most drug and
dietary manipulation (Katan and Beynen, Am. J. Epidemiol., 1987,
125, 387-399; Vessby et al., Atherosclerosis, 1982, 44, 61-71.).
Pharmacologic therapy of elevated Lp(a) levels has been only
modestly successful and apheresis remains the most effective
therapeutic modality (Hajjar and Nachman, Annu. Rev. Med., 1996,
47, 423-442).
[0012] Morishita et al. have reported the use of three ribozyme
oligonucleotides against apolipoprotein(a) for inhibition of
apolipoprotein(a) expression in HepG2 cells (Morishita et al.,
Circulation, 1998, 98, 1898-1904).
[0013] U.S. Pat. No. 5,721,138 refers to nucleotide sequences
encoding the human apolipoprotein(a) gene 5'-regulatory region and
isolated nucleotide sequences comprising at least thirty
consecutive complementary nucleotides from human apolipoprotein(a)
from nucleotide position -208 to -1448 (Lawn, 1998).
[0014] To date, investigative and therapeutic strategies aimed at
inhibiting apolipoprotein(a) function have involved the previously
cited use of Lp(a) apheresis and ribozyme oligonucleotides.
Currently no existing drugs are available to specifically lower
lipoprotein(a) levels in humans, and limited models exist in which
to perform drug discovery. Consequently, there remains a long-felt
need for additional agents and methods capable of effectively
modulating, e.g., inhibiting, apolipoprotein(a) function, and
particularly a need for agents capable of safe and efficacious
administration to lower alipoprotein(a) levels in patients at risk
for the development of coronary artery disease.
SUMMARY OF THE INVENTION
[0015] The present invention provides compositions and methods for
modulating the expression of apolipoprotein(a). Such novel
compositions and methods enable research into the pathways of
plasminogen and apolipoprotein(a), as well as other lipid metabolic
processes. Such novel compositions and methods are useful in
assessing the toxicity of chemical and pharmaceutical compounds on
apolipoprotein(a) function, plasminogen or other lipid metabolic
processes. Such novel compositions and methods are useful for drug
discovery for the treatment of cardiovascular conditions, including
myocardial infarction and atherosclerosis, among others.
[0016] In particular, this invention relates to compounds,
particularly oligonucleotide compounds, which, in preferred
embodiments, hybridize with nucleic acid molecules or sequences
encoding apolipoprotein(a). Such compounds are shown herein to
modulate the expression of apolipoprotein(a). Additionally
disclosed are embodiments of oligonucleotide compounds that
hybridize with nucleic acid molecules encoding apolipoprotein(a) in
preference to nucleic acid molecules or sequences encoding
plasminogen.
[0017] The present invention is directed to compounds, especially
nucleic acid and nucleic acid-like oligomers, which are targeted to
a nucleic acid encoding apolipoprotein(a), and which modulate the
expression of apolipoprotein(a). Pharmaceutical and other
compositions comprising the compounds of the invention are also
provided.
[0018] Further provided are methods of screening for modulators of
apolipoprotein(a) and methods of modulating the expression of
apolipoprotein(a) in cells, tissues or animals comprising
contacting said cells, tissues or animals with one or more of the
compounds or compositions of the invention. Methods of treating an
animal, particularly a human, suspected of having or being prone to
a disease or condition associated with expression of
apolipoprotein(a) are also set forth herein. Such methods comprise
administering a therapeutically or prophylactically effective
amount of one or more of the compounds or compositions of the
invention to the person in need of treatment.
DETAILED DESCRIPTION OF THE INVENTION
A. Overview of the Invention
[0019] The present invention employs compounds, preferably
oligonucleotides and similar species, for use in modulating the
function or effect of nucleic acid molecules encoding
apolipoprotein(a). This is accomplished by providing
oligonucleotides which specifically hybridize with one or more
nucleic acid molecules encoding apolipoprotein(a). As used herein,
the terms "target nucleic acid" and "nucleic acid molecule encoding
apolipoprotein(a)" have been used for convenience to encompass DNA
encoding apolipoprotein(a), RNA (including pre-mRNA and mRNA or
portions thereof) transcribed from such DNA, and also cDNA derived
from such RNA. The hybridization of a compound of this invention
with its target nucleic acid is generally referred to as
"antisense". Antisense technology is emerging as an effective means
of reducing the expression of specific gene products and is
uniquely useful in a number of therapeutic, diagnostic and research
applications involving modulation of Apolipoprotein(a)
expression.
[0020] Consequently, the preferred mechanism believed to be
included in the practice of some preferred embodiments of the
invention is referred to herein as "antisense inhibition." Such
antisense inhibition is typically based upon hydrogen bonding-based
hybridization of oligonucleotide strands or segments such that at
least one strand or segment is cleaved, degraded, or otherwise
rendered inoperable. In this regard, it is presently preferred to
target specific nucleic acid molecules and their functions for such
antisense inhibition.
[0021] The functions of DNA to be interfered with can include
replication and transcription. Replication and transcription, for
example, can be from an endogenous cellular template, a vector, a
plasmid construct or otherwise. The functions of RNA to be
interfered with can include functions such as translocation of the
RNA to a site of protein translation, translocation of the RNA to
sites within the cell which are distant from the site of RNA
synthesis, translation of protein from the RNA, splicing of the RNA
to yield one or more RNA species, and catalytic activity or complex
formation involving the RNA which may be engaged in or facilitated
by the RNA. One preferred result of such interference with target
nucleic acid function is modulation of the expression of
apolipoprotein(a). In the context of the present invention,
"modulation" and "modulation of expression" mean either an increase
(stimulation) or a decrease (inhibition) in the amount or levels of
a nucleic acid molecule encoding the gene, e.g., DNA or RNA.
Inhibition is often the preferred form of modulation of expression
and mRNA is often a preferred target nucleic acid.
[0022] In the context of this invention, "hybridization" means the
pairing of complementary strands of oligomeric compounds. In the
present invention, the preferred mechanism of pairing involves
hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed
Hoogsteen hydrogen bonding, between complementary nucleoside or
nucleotide bases (nucleobases) of the strands of oligomeric
compounds. For example, adenine and thymine are complementary
nucleobases that pair through the formation of hydrogen bonds.
Hybridization can occur under varying circumstances.
[0023] An antisense compound is specifically hybridizable when
binding of the compound to the target nucleic acid interferes with
the normal function of the target nucleic acid to cause a loss of
activity, and there is a sufficient degree of complementarity to
avoid non-specific binding of the antisense compound to non-target
nucleic acid sequences under conditions in which specific binding
is desired. Such conditions include, i.e., physiological conditions
in the case of in vivo assays or therapeutic treatment, and
conditions in which assays are performed in the case of in vitro
assays.
[0024] In the present invention the phrase "stringent hybridization
conditions" or "stringent conditions" refers to conditions under
which a compound of the invention will hybridize to its target
sequence, but to a minimal number of other sequences. Stringent
conditions are sequence-dependent and will be different in
different circumstances. In the context of this invention,
"stringent conditions" under which oligomeric compounds hybridize
to a target sequence are determined by the nature and composition
of the oligomeric compounds and the assays in which they are being
investigated.
[0025] "Complementary," as used herein, refers to the capacity for
precise pairing between two nucleobases of an oligomeric compound.
For example, if a nucleobase at a certain position of an
oligonucleotide (an oligomeric compound), is capable of hydrogen
bonding with a nucleobase at a certain position of a target nucleic
acid, said target nucleic acid being a DNA, RNA, or oligonucleotide
molecule, then the position of hydrogen bonding between the
oligonucleotide and the target nucleic acid is considered to be a
complementary position. The oligonucleotide and the further DNA,
RNA, or oligonucleotide molecule are complementary to each other
when a sufficient number of complementary positions in each
molecule are occupied by nucleobases that can hydrogen bond with
each other. Thus, "specifically hybridizable" and "complementary"
are terms which are used to indicate a sufficient degree of precise
pairing or complementarity over a sufficient number of nucleobases
such that stable and specific binding occurs between the
oligonucleotide and a target nucleic acid.
[0026] The sequence of an antisense compound can be, but need not
necessarily be, 100% complementary to that of its target nucleic
acid to be specifically hybridizable. Moreover, an oligonucleotide
may hybridize over one or more segments such that intervening or
adjacent segments are not involved in the hybridization event. In
one embodiment of this invention, the antisense compounds of the
present invention comprise at least 70%, or at least 75%, or at
least 80%, or at least 85% sequence complementarity to a target
region within the target nucleic acid. In other embodiments, the
antisense compounds of the present invention comprise at least 90%
sequence complementarity and even comprise at least 95% or at least
99% sequence complementarity to the target region within the target
nucleic acid sequence to which they are targeted. For example, an
antisense compound in which 18 of 20 nucleobases of the antisense
compound are complementary to a target region, and would therefore
specifically hybridize, would represent 90 percent complementarity.
In this example, the remaining noncomplementary nucleobases may be
clustered or interspersed with complementary nucleobases and need
not be contiguous to each other or to complementary nucleobases. As
such, an antisense compound which is 18 nucleobases in length
having 4 (four) noncomplementary nucleobases which are flanked by
two regions of complete complementarity with the target nucleic
acid would have 77.8% overall complementarity with the target
nucleic acid and would thus fall within the scope of the present
invention. Percent complementarity of an antisense compound with a
region of a target nucleic acid can be determined routinely using
BLAST programs (basic local alignment search tools) and PowerBLAST
programs known in the art (Altschul et al., J. Mol. Biol., 1990,
215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656).
[0027] Percent homology, sequence identity or complementarity, can
be determined by, for example, the Gap program (Wisconsin Sequence
Analysis Package, Version 8 for Unix, Genetics Computer Group,
University Research Park, Madison Wis.), using default settings,
which uses the algorithm of Smith and Waterman (Adv. Appl. Math.,
1981, 2, 482-489). In some preferred embodiments, homology,
sequence identity or complementarity, between the oligomeric and
target is between about 50% to about 60%. In some embodiments,
homology, sequence identity or complementarity, is between about
60% to about 70%. In other embodiments, homology, sequence identity
or complementarity, is between about 70% and about 80%. In still
other embodiments, homology, sequence identity or complementarity,
is between about 80% and about 90%. In yet other embodiments,
homology, sequence identity or complementarity, is about 90%, about
92%, about 94%, about 95%, about 96%, about 97%, about 98%, or
about 99%.
B. Compounds of the Invention
[0028] According to the present invention, "compounds" include
antisense oligomeric compounds, antisense oligonucleotides,
external guide sequence (EGS) oligonucleotides, alternate splicers,
primers, probes, and other oligomeric compounds that hybridize to
at least a portion of the target nucleic acid. As such, these
compounds may be introduced in the form of single-stranded,
double-stranded, partially single-stranded, or circular oligomeric
compounds. Specifically excluded from the definition of "compounds"
herein are ribozymes that contain internal or external "bulges"
that do not hybridize to the target sequence. Once introduced to a
system, the compounds of the invention may elicit the action of one
or more enzymes or structural proteins to effect modification of
the target nucleic acid.
[0029] One non-limiting example of such an enzyme is RNAse H, a
cellular endonuclease which cleaves the RNA strand of an RNA:DNA
duplex. It is known in the art that single-stranded antisense
compounds which are "DNA-like" elicit RNAse H. Activation of RNase
H, therefore, results in cleavage of the RNA target, thereby
greatly enhancing the efficiency of oligonucleotide-mediated
inhibition of gene expression. Similar roles have been postulated
for other ribonucleases such as those in the RNase III and
ribonuclease L family of enzymes.
[0030] While the preferred form of antisense compound is a
single-stranded antisense oligonucleotide, in many species the
introduction of double-stranded structures, such as double-stranded
RNA (dsRNA) molecules, has been shown to induce potent and specific
antisense-mediated reduction of the function of a gene or its
associated gene products. This phenomenon occurs in both plants and
animals and is believed to have an evolutionary connection to viral
defense and transposon silencing.
[0031] The first evidence that dsRNA could lead to gene silencing
in animals came in 1995 from work in the nematode, Caenorhabditis
elegans (Guo and Kempheus, Cell, 1995, 81, 611-620). Montgomery et
al. have shown that the primary interference effects of dsRNA are
posttranscriptional (Montgomery et al., Proc. Natl. Acad. Sci. USA,
1998, 95, 15502-15507). The posttranscriptional antisense mechanism
defined in Caenorhabditis elegans resulting from exposure to
double-stranded RNA (dsRNA) has since been designated RNA
interference (RNAi). This term has been generalized to mean
antisense-mediated gene silencing involving the introduction of
dsRNA leading to the sequence-specific reduction of endogenous
targeted mRNA levels (Fire et al., Nature, 1998, 391, 806-811).
Recently, it has been shown that it is, in fact, the
single-stranded RNA oligomers of antisense polarity of the dsRNAs
that are the potent inducers of RNAi (Tijsterman et al., Science,
2002, 295, 694-697).
[0032] The oligonucleotides of the present invention also include
modified oligonucleotides in which a different base is present at
one or more of the nucleotide positions in the oligonucleotide. For
example, if the first nucleotide is an adenosine, modified
oligonucleotides may be produced which contain thymidine, guanosine
or cytidine at this position. This may be done at any of the
positions of the oligonucleotide. These oligonucleotides are then
tested using the methods described herein to determine their
ability to inhibit expression of apolipoprotein(a) mRNA.
[0033] In the context of this invention, the term "oligomeric
compound" refers to a polymer or oligomer comprising a plurality of
monomeric units. In the context of this invention, the term
"oligonucleotide" refers to an oligomer or polymer of ribonucleic
acid (RNA) or deoxyribonucleic acid (DNA) or mimetics, chimeras,
analogs and homologs thereof. This term includes oligonucleotides
composed of naturally occurring nucleobases, sugars and covalent
internucleoside (backbone) linkages as well as oligonucleotides
having non-naturally occurring portions which function similarly.
Such modified or substituted oligonucleotides are often preferred
over native forms because of desirable properties such as, for
example, enhanced cellular uptake, enhanced affinity for a target
nucleic acid and increased stability in the presence of
nucleases.
[0034] While oligonucleotides are a preferred form of the compounds
of this invention, the present invention comprehends other families
of compounds as well, including but not limited to, oligonucleotide
analogs and mimetics such as those described herein.
[0035] The compounds in accordance with this invention preferably
comprise from about 8 to about 80 nucleobases (i.e. from about 8 to
about 80 linked nucleosides). One of ordinary skill in the art will
appreciate that the invention embodies compounds of 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45,
46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62,
63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79,
or 80 nucleobases in length.
[0036] In one preferred embodiment, the compounds of the invention
are 12 to 50 nucleobases in length. One having ordinary skill in
the art will appreciate that this embodies compounds of 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48,
49, or 50 nucleobases in length.
[0037] In another preferred embodiment, the compounds of the
invention are 15 to 30 nucleobases in length. One having ordinary
skill in the art will appreciate that this embodies compounds of
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30
nucleobases in length.
[0038] In one embodiment, compounds of this invention are
oligonucleotides from about 12 to about 50 nucleobases. In another
embodiment, compounds of this invention comprise from about 15 to
about 30 nucleobases.
[0039] Antisense compounds 8-80 nucleobases in length comprising a
stretch of at least eight (8) consecutive nucleobases selected from
within the illustrative antisense compounds are considered to be
suitable antisense compounds as well.
[0040] Exemplary antisense compounds include oligonucleotide
sequences that comprise at least the 8 consecutive nucleobases from
the 5'-terminus of one of the illustrative preferred antisense
compounds (the remaining nucleobases being a consecutive stretch of
the same oligonucleotide beginning immediately upstream of the
5'-terminus of the antisense compound which is specifically
hybridizable to the target nucleic acid and continuing until the
oligonucleotide contains about 8 to about 80 nucleobases).
Similarly exemplary antisense compounds are represented by
oligonucleotide sequences that comprise at least the 8 consecutive
nucleobases from the 3'-terminus of one of the illustrative
preferred antisense compounds (the remaining nucleobases being a
consecutive stretch of the same oligonucleotide beginning
immediately downstream of the 3'-terminus of the antisense compound
which is specifically hybridizable to the target nucleic acid and
continuing until the oligonucleotide contains about 8 to about 80
nucleobases).
[0041] Exemplary compounds of this invention may be found
identified in the Examples and listed in Table 1. In addition to
oligonucleotide compounds that bind to target sequences of
apolipoprotein(a) in general, there are also exemplified
oligonucleotide compounds of this invention that bind to target
nucleotide sequences of apolipoprotein(a), but do not bind to, or
do not bind preferentially to, sequences of plasminogen due to lack
of homology between the two nucleic acid molecules or sufficient
number of mismatches in the target sequences. These latter
compounds are also useful in various therapeutic methods of this
invention. Examples of antisense compounds to such `mismatched`
target sequences as described above include SEQ ID NO: 12 and SEQ
ID NO: 23 of Table I below. See, also, the discussion of target
regions below.
[0042] One having skill in the art armed with the exemplary
antisense compounds illustrated herein will be able, without undue
experimentation, to identify further useful antisense
compounds.
C. Targets of the Invention
[0043] "Targeting" an antisense compound to a particular nucleic
acid molecule, in the context of this invention, can be a multistep
process. The process usually begins with the identification of a
target nucleic acid whose function is to be modulated. This target
nucleic acid may be, for example, a cellular gene (or mRNA
transcribed from the gene) whose expression is associated with a
particular disorder or disease state, or a nucleic acid molecule
from an infectious agent. In the present invention, the target
nucleic acid encodes apolipoprotein(a).
[0044] The targeting process usually also includes determination of
at least one target region, segment, or site within the target
nucleic acid for the antisense interaction to occur such that the
desired effect, e.g., modulation of expression, will result. Within
the context of the present invention, the term "region" is defined
as a portion of the target nucleic acid having at least one
identifiable structure, function, or characteristic. Within regions
of target nucleic acids are segments. "Segments" are defined as
smaller or sub-portions of regions within a target nucleic
acid.
[0045] "Sites," as used in the present invention, are defined as
positions within a target nucleic acid. Since, as is known in the
art, the translation initiation codon is typically 5'-AUG (in
transcribed mRNA molecules; 5'-ATG in the corresponding DNA
molecule), the translation initiation codon is also referred to as
the "AUG codon," the "start codon" or the "AUG start codon". A
minority of genes has a translation initiation codon having the RNA
sequence 5'-GUG, 5'-UUG or 5'-CUG; and 5'-AUA, 5'-ACG and 5'-CUG
have been shown to function in vivo. Thus, the terms "translation
initiation codon" and "start codon" can encompass many codon
sequences, even though the initiator amino acid in each instance is
typically methionine (in eukaryotes) or formylmethionine (in
prokaryotes). Eukaryotic and prokaryotic genes may have two or more
alternative start codons, any one of which may be preferentially
utilized for translation initiation in a particular cell type or
tissue, or under a particular set of conditions. In the context of
the invention, "start codon" and "translation initiation codon"
refer to the codon or codons that are used in vivo to initiate
translation of an mRNA transcribed from a gene encoding
apolipoprotein(a), regardless of the sequence(s) of such codons. A
translation termination codon (or "stop codon") of a gene may have
one of three sequences, i.e., 5'-UAA, 5'-UAG and 5'-UGA (the
corresponding DNA sequences are 5'-TAA, 5'-TAG and 5'-TGA,
respectively).
[0046] The terms "start codon region" and "translation initiation
codon region" refer to a portion of such an mRNA or gene that
encompasses from about 25 to about 50 contiguous nucleotides in
either direction (i.e., 5' or 3') from a translation initiation
codon. Similarly, the terms "stop codon region" and "translation
termination codon region" refer to a portion of such an mRNA or
gene that encompasses from about 25 to about 50 contiguous
nucleotides in either direction (i.e., 5' or 3') from a translation
termination codon. Consequently, the "start codon region" (or
"translation initiation codon region") and the "stop codon region"
(or "translation termination codon region") are all regions that
may be targeted effectively with the antisense compounds of the
present invention.
[0047] The open reading frame (ORF) or "coding region," which is
known in the art to refer to the region between the translation
initiation codon and the translation termination codon, is also a
region which may be targeted effectively. Within the context of the
present invention, a preferred region is the intragenic region
encompassing the translation initiation or termination codon of the
open reading frame (ORF) of a gene.
[0048] Another target region includes the 5' untranslated region
(5'UTR), known in the art to refer to the portion of an mRNA in the
5' direction from the translation initiation codon, and thus
including nucleotides between the 5' cap site and the translation
initiation codon of an mRNA (or corresponding nucleotides on the
gene). Still another target region includes the 3' untranslated
region (3'UTR), known in the art to refer to the portion of an mRNA
in the 3' direction from the translation termination codon, and
thus including nucleotides between the translation termination
codon and 3' end of an mRNA (or corresponding nucleotides on the
gene). The 5' cap site of an mRNA comprises an N7-methylated
guanosine residue joined to the 5'-most residue of the mRNA via a
5'-5' triphosphate linkage. The 5' cap region of an mRNA is
considered to include the 5' cap structure itself as well as the
first 50 nucleotides adjacent to the cap site. Another target
region for this invention is the 5' cap region.
[0049] Although some eukaryotic mRNA transcripts are directly
translated, many contain one or more regions, known as "introns,"
which are excised from a transcript before it is translated. The
remaining (and therefore translated) regions are known as "exons"
and are spliced together to form a continuous mRNA sequence. In one
embodiment, targeting splice sites, i.e., intron-exon junctions or
exon-intron junctions, is particularly useful in situations where
aberrant splicing is implicated in disease, or where an
overproduction of a particular splice product is implicated in
disease. An aberrant fusion junction due to rearrangement or
deletion is another embodiment of a target site. mRNA transcripts
produced via the process of splicing of two (or more) mRNAs from
different gene sources are known as "fusion transcripts". Introns
can be effectively targeted using antisense compounds targeted to,
for example, DNA or pre-mRNA.
[0050] Alternative RNA transcripts can be produced from the same
genomic region of DNA. These alternative transcripts are generally
known as "variants". More specifically, "pre-mRNA variants" are
transcripts produced from the same genomic DNA that differ from
other transcripts produced from the same genomic DNA in either
their start or stop position and contain both intronic and exonic
sequence.
[0051] Upon excision of one or more exon or intron regions, or
portions thereof during splicing, pre-mRNA variants produce smaller
"mRNA variants". Consequently, mRNA variants are processed pre-mRNA
variants and each unique pre-mRNA variant must always produce a
unique mRNA variant as a result of splicing. These mRNA variants
are also known as "alternative splice variants". If no splicing of
the pre-mRNA variant occurs then the pre-mRNA variant is identical
to the mRNA variant.
[0052] Variants can be produced through the use of alternative
signals to start or stop transcription. Pre-mRNAs and mRNAs can
possess more that one start codon or stop codon. Variants that
originate from a pre-mRNA or mRNA that use alternative start codons
are known as "alternative start variants" of that pre-mRNA or mRNA.
Those transcripts that use an alternative stop codon are known as
"alternative stop variants" of that pre-mRNA or mRNA. One specific
type of alternative stop variant is the "polyA variant" in which
the multiple transcripts produced result from the alternative
selection of one of the "polyA stop signals" by the transcription
machinery, thereby producing transcripts that terminate at unique
polyA sites. Within the context of the invention, the types of
variants described herein are also embodiments of target nucleic
acids.
[0053] The locations on the target nucleic acid to which the
preferred antisense compounds hybridize are hereinbelow referred to
as "preferred target segments." As used herein the term "preferred
target segment" is defined as at least an 8-nucleobase portion of a
target region to which an active antisense compound is targeted.
While not wishing to be bound by theory, it is presently believed
that these target segments represent portions of the target nucleic
acid that are accessible for hybridization.
[0054] While the specific sequences of certain exemplary target
segments are set forth herein, one of skill in the art will
recognize that these serve to illustrate and describe particular
embodiments within the scope of the present invention. Additional
target segments are readily identifiable by one having ordinary
skill in the art in view of this disclosure.
[0055] Target segments 8-80 nucleobases in length comprising a
stretch of at least eight (8) consecutive nucleobases selected from
within the illustrative preferred target segments are considered to
be suitable for targeting as well.
[0056] Target segments can include DNA or RNA sequences that
comprise at least the 8 consecutive nucleobases from the
5'-terminus of one of the illustrative preferred target segments
(the remaining nucleobases being a consecutive stretch of the same
DNA or RNA beginning immediately upstream of the 5'-terminus of the
target segment and continuing until the DNA or RNA contains about 8
to about 80 nucleobases). Similarly preferred target segments are
represented by DNA or RNA sequences that comprise at least the 8
consecutive nucleobases from the 3'-terminus of one of the
illustrative preferred target segments (the remaining nucleobases
being a consecutive stretch of the same DNA or RNA beginning
immediately downstream of the 3'-terminus of the target segment and
continuing until the DNA or RNA contains about 8 to about 80
nucleobases). One having skill in the art armed with the target
segments illustrated herein will be able, without undue
experimentation, to identify further preferred target segments.
[0057] Once one or more target regions, segments or sites have been
identified, antisense compounds are chosen which are sufficiently
complementary to the target, i.e., hybridize sufficiently well and
with sufficient specificity, to give the desired effect.
[0058] In various embodiments of this invention, the oligomeric
compounds are targeted to regions of the target apollipoprotein(a)
nucleobase sequence (e.g., such as those disclosed in Example 13)
comprising nucleobases 1-50, 51-100, 101-150, 151-200, 201-250,
251-300, 301-350, 351-400, 401-450, 451-500, 501-550, 551-600,
601-650, 651-700, 701-750, 751-800, 801-850, 851-900, 901-950,
951-1000, 1001-1050, 1051-1100, 1101-1150, 1151-1200, 1201-1250,
1251-1300, 1301-1350, 1351-1400, 1401-1450, 1451-1500, 1501-1550,
1551-1600, 1601-1650, 1651-1700, 1701-1750, 1751-1800, 1801-1850,
1851-1900, 1901-1950, 1951-2000, 2001-2050, 2051-2100, 2101-2150,
2151-2200, 2201-2250, 2251-2300, 2301-2350, 2351-2400, 2401-2450,
2451-2500, 2501-2550, 2551-2600, 2601-2650, 2651-2700, 2701-2750,
2751-2800, 2801-2850, 2851-2900, 2901-2950, 2951-3000, 3001-3050,
3051-3100, 3101-3150, 3151-3200, 3201-3250, 3251-3300, 3301-3350,
3351-3400, 3401-3450, 3451-3500, 3501-3550, 3551-3600, 3601-3650,
3751-3700, 3701-3750, 3751-3800, 3801-3850, 3851-3900, 3901-3950,
3951-4000, 4001-4050, 4051-4100, 4101-4150, 4151-4200, 4201-4250,
4251-4300, 4301-4350, 4351-4400, 4401-4450, 4451-4500, 4501-4550,
4551-4600, 4601-4650, 4751-4700, 4701-4750, 4751-4800, 4801-4850,
4851-4900, 4901-4950, or 4951-5000, 5001-5050, 5051-5100,
5101-5150, 5151-5200, 5201-5250, 5251-5300, 5301-5350, 5351-5400,
5401-5450, 5451-5500, 5501-5550, 5551-5600, 5601-5650, 5651-5700,
5701-5750, 5751-5800, 5801-5850, 5851-5900, 5901-5950, 5951-6000,
6001-6050, 6051-6100, 6101-6150, 6151-6200, 6201-6250, 6251-6300,
6301-6350, 6351-6400, 6401-6450, 6451-6500, 6501-6550, 6551-6600,
6601-6650, 6651-6700, 6701-6750, 6751-6800, 6801-6850, 6851-6900,
6901-6950, 6951-7000, 7001-7050, 7051-7100, 7101-7150, 7151-7200,
7201-7250, 7251-7300, 7301-7350, 7351-7400, 7401-7450, 7451-7500,
7501-7550, 7551-7600, 7601-7650, 7651-7700, 7701-7750, 7751-7800,
7801-7850, 7851-7900, 7901-7950, 7951-8000, 8001-8050, 8051-8100,
8101-8150, 8151-8200, 8201-8250, 8251-8300, 8301-8350, 8351-8400,
8401-8450, 8451-8500, 8501-8550, 8551-8600, 8601-8650, 8651-8700,
8701-8750, 8751-8800, 8801-8850, 8851-8900, 8901-8950, 8951-9000,
9001-9050, 9051-9100, 9101-9150, 9151-9200, 9201-9250, 9251-9300,
9301-9350, 9351-9400, 9401-9450, 9451-9500, 9501-9550, 9551-9600,
9601-9650, 9651-9700, 9701-9750, 9751-9800, 9801-9850, 9851-9900,
9901-9950, 9951-10000, 10001-10050, 10051-10100, 10101-10150,
10151-10200, 10201-10250, 10251-10300, 10301-10350, 10351-10400,
10401-10450, 10451-10500, 10501-10550, 10551-10600, 10601-10650,
10651-10700, 10701-10750, 10751-10800, 10801-10850, 10851-10900,
10901-10950, 10951-11000, 11001-11050, 11051-11100, 11101-11150,
11151-11200, 11201-11250, 11251-11300, 11301-11350, 11351-11400,
11401-11450, 11451-11500, 11501-11550, 11551-11600, 11601-11650,
11651-11700, 11701-11750, 11751-11800, 11801-11850, 11851-11900,
11901-11950, 11951-12000, 12001-12050, 12051-12100, 12101-12150,
12151-12200, 12201-12250, 12251-12300, 12301-12350, 12351-12400,
12401-12450, 12451-12500, 12501-12550, 12551-12600, 12601-12650,
12651-12700, 12701-12750, 12751-12800, 12801-12850, 12851-12900,
12901-12950, 12951-13000, 13001-13050, 13051-13100, 13101-13150,
13151-13200, 13201-13250, 13251-13300, 13301-13350, 13351-13400,
13401-13450, 13451-13500, 13501-13550, 13551-13600, 13601-13650,
13651-13700, 13701-13750, 13751-13800, 13801-13850, 13851-13900,
13901-13938, of apolipoprotein(a) or any combination thereof.
[0059] In one embodiment, the oligonucleotide compounds of this
invention are 100% complementary to these sequences or to small
sequences found within each of the above listed sequences. In
another embodiment the oligonucleotide compounds have from at least
3 or 5 mismatches per 20 consecutive nucleobases in individual
nucleobase positions to these target regions. Still other compounds
of the invention are targeted to overlapping regions of the
above-identified portions of the apolipoprotein(a) sequence.
[0060] In still another embodiment, target regions include those
portions of the apolipoprotion(a) sequence that do not overlap with
plasminogen sequences. For example, among such apolipoprotein(a)
target sequences are included those found within the following
nucleobase sequences: 10624-10702, 10963-11036, 11325-11354,
11615-11716, 11985-12038, 12319-12379, 13487-13491, and
13833-13871. As a further example, target sequences of
apolipoprotein(a) that have at least 6 mismatches with the sequence
of plasminogen over at least 20 consecutive nucleotides are
desirable targets for antisense compounds that bind preferentially
to apolipoprotein(a) rather than to plasminogen. Such target
sequences can readily be identified by a BLAST comparison of the
two GenBank sequences of plasminogen (e.g., GenBank Accession No.
NM.sub.--000301) and apolipoprotein(a)(e.g., GenBank Accession No.
NM.sub.--005577.1).
D. Screening and Target Validation
[0061] In a further embodiment, the "preferred target segments"
identified herein may be employed in a screen for additional
compounds that modulate the expression of apolipoprotein(a).
"Modulators" are those compounds that decrease or increase the
expression of a nucleic acid molecule encoding apolipoprotein(a)
and which comprise at least an 8-nucleobase portion that is
complementary to a preferred target segment. The screening method
comprises the steps of contacting a preferred target segment of a
nucleic acid molecule encoding apolipoprotein(a) with one or more
candidate modulators, and selecting for one or more candidate
modulators which decrease or increase the expression of a nucleic
acid molecule encoding apolipoprotein(a). Once it is shown that the
candidate modulator or modulators are capable of modulating (e.g.
either decreasing or increasing) the expression of a nucleic acid
molecule encoding apolipoprotein(a), the modulator may then be
employed in further investigative studies of the function of
apolipoprotein(a), or for use as a research, diagnostic, or
therapeutic agent in accordance with the present invention.
[0062] The preferred target segments of the present invention may
be also be combined with their respective complementary antisense
compounds of the present invention to form stabilized
double-stranded (duplexed) oligonucleotides.
[0063] Such double stranded oligonucleotide moieties have been
shown in the art to modulate target expression and regulate
translation as well as RNA processsing via an antisense mechanism.
Moreover, the double-stranded moieties may be subject to chemical
modifications (Fire et al., Nature, 1998, 391, 806-811; Timmons and
Fire, Nature 1998, 395, 854; Timmons et al., Gene, 2001, 263,
103-112; Tabara et al., Science, 1998, 282, 430-431; Montgomery et
al., Proc. Natl. Acad. Sci. USA, 1998, 95, 15502-15507; Tuschl et
al., Genes Dev., 1999, 13, 3191-3197; Elbashir et al., Nature,
2001, 411, 494-498; Elbashir et al., Genes Dev. 2001, 15, 188-200).
For example, such double-stranded moieties have been shown to
inhibit the target by the classical hybridization of antisense
strand of the duplex to the target, thereby triggering enzymatic
degradation of the target (Tijsterman et al., Science, 2002, 295,
694-697).
[0064] The compounds of the present invention can also be applied
in the areas of drug discovery and target validation. The present
invention comprehends the use of the compounds and preferred target
segments identified herein in drug discovery efforts to elucidate
relationships that exist between apolipoprotein(a) and a disease
state, phenotype, or condition. These methods include detecting or
modulating apolipoprotein(a) comprising contacting a sample,
tissue, cell, or organism with the compounds of the present
invention, measuring the nucleic acid or protein level of
apolipoprotein(a) and/or a related phenotypic or chemical endpoint
at some time after treatment, and optionally comparing the measured
value to a non-treated sample or sample treated with a further
compound of the invention. These methods can also be performed in
parallel or in combination with other experiments to determine the
function of unknown genes for the process of target validation or
to determine the validity of a particular gene product as a target
for treatment or prevention of a particular disease, condition, or
phenotype.
E. Kits, Research Reagents, Diagnostics, and Therapeutics
[0065] The compounds of the present invention can be utilized for
diagnostics, therapeutics, and prophylaxis, and as research
reagents and components of kits. Furthermore, antisense
oligonucleotides, which are able to inhibit gene expression with
exquisite specificity, are often used by those of ordinary skill to
elucidate the function of particular genes or to distinguish
between functions of various members of a biological pathway.
[0066] For use in kits and diagnostics and in various biological
systems, the compounds of the present invention, either alone or in
combination with other compounds or therapeutics, are useful as
tools in differential and/or combinatorial analyses to elucidate
expression patterns of a portion or the entire complement of genes
expressed within cells and tissues.
[0067] As used herein the term "biological system" or "system" is
defined as any organism, cell, cell culture or tissue that
expresses, or is made competent to express products of the LPA
gene. These include, but are not limited to, humans, transgenic
animals, cells, cell cultures, tissues, xenografts, transplants and
combinations thereof.
[0068] As one nonlimiting example, expression patterns within cells
or tissues treated with one or more antisense compounds are
compared to control cells or tissues not treated with antisense
compounds and the patterns produced are analyzed for differential
levels of gene expression as they pertain, for example, to disease
association, signaling pathway, cellular localization, expression
level, size, structure or function of the genes examined. These
analyses can be performed on stimulated or unstimulated cells and
in the presence or absence of other compounds that affect
expression patterns.
[0069] Examples of methods of gene expression analysis known in the
art include DNA arrays or microarrays (Brazma and Vilo, FEBS Lett.,
2000 480, 17-24; Celis, et al., FEBS Lett., 2000 480, 2-16), SAGE
(serial analysis of gene expression)(Madden, et al., Drug Discov.
Today, 2000, 5, 415-425), READS (restriction enzyme amplification
of digested cDNAs) (Prashar and Weissman, Methods Enzymol., 1999,
303, 258-72), TOGA (total gene expression analysis) (Sutcliffe, et
al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 1976-81), protein
arrays and proteomics (Celis, et al., FEBS Lett., 2000, 480, 2-16;
Jungblut, et al., Electrophoresis, 1999, 20, 2100-10), expressed
sequence tag (EST) sequencing (Celis, et al., FEBS Lett., 2000,
480, 2-16; Larsson, et al., J. Biotechnol., 2000, 80, 143-57),
subtractive RNA fingerprinting (SuRF) (Fuchs, et al., Anal.
Biochem., 2000, 286, 91-98; Larson, et al., Cytometry, 2000, 41,
203-208), subtractive cloning, differential display (DD) (Jurecic
and Belmont, Curr. Opin. Microbiol., 2000, 3, 316-21), comparative
genomic hybridization (Carulli, et al., J Cell Biochem. Suppl.,
1998, 31, 286-96), FISH (fluorescent in situ hybridization)
techniques (Going and Gusterson, Eur. J. Cancer, 1999, 35,
1895-904) and mass spectrometry methods (To, Comb. Chem. High
Throughput Screen, 2000, 3, 235-41).
[0070] The compounds of the invention are useful for research and
diagnostics, because these compounds hybridize to nucleic acids
encoding apolipoprotein(a). For example, oligonucleotides that
hybridize with such efficiency and under such conditions as
disclosed herein as to be effective apolipoprotein(a) inhibitors
are effective primers or probes under conditions favoring gene
amplification or detection, respectively. These primers and probes
are useful in methods requiring the specific detection of nucleic
acid molecules encoding apolipoprotein(a) and in the amplification
of said nucleic acid molecules for detection or for use in further
studies of apolipoprotein(a). Hybridization of the antisense
oligonucleotides, particularly the primers and probes, of the
invention with a nucleic acid encoding apolipoprotein(a) can be
detected by means known in the art. Such means may include
conjugation of an enzyme to the oligonucleotide, radiolabelling of
the oligonucleotide, or any other suitable detection means. Kits
using such detection means for detecting the level of
apolipoprotein(a) in a sample may also be prepared.
[0071] The specificity and sensitivity of antisense are also
harnessed by those of skill in the art for therapeutic uses.
Antisense compounds have been employed as therapeutic moieties in
the treatment of disease states in animals, including humans.
Antisense oligonucleotide drugs have been safely and effectively
administered to humans and numerous clinical trials are presently
underway. It is thus established that antisense compounds can be
useful therapeutic modalities that can be configured to be useful
in treatment regimes for the treatment of cells, tissues and
animals, especially humans.
[0072] For therapeutics, an animal, preferably a human, suspected
of having a disease or disorder which can be treated by modulating
the expression of apolipoprotein(a) is treated by administering
antisense compounds in accordance with this invention. For example,
in one non-limiting embodiment, the methods comprise the step of
administering to the animal in need of treatment, a therapeutically
effective amount of a apolipoprotein(a) inhibitor. The
apolipoprotein(a) inhibitors of the present invention effectively
inhibit the activity of the apolipoprotein(a) protein or inhibit
the expression of the apolipoprotein(a) protein. In one embodiment,
the activity or expression of apolipoprotein(a) in an animal is
inhibited by about 10%. Preferably, the activity or expression of
apolipoprotein(a) in an animal is inhibited by about 30%. More
preferably, the activity or expression of apolipoprotein(a) in an
animal is inhibited by 50% or more. Thus, the oligomeric compounds
modulate expression of apolipoprotein(a) mRNA by at least 10%, by
at least 20%, by at least 25%, by at least 30%, by at least 40%, by
at least 50%, by at least 60%, by at least 70%, by at least 75%, by
at least 80%, by at least 85%, by at least 90%, by at least 95%, by
at least 98%, by at least 99%, or by 100%.
[0073] For example, the reduction of the expression of
apolipoprotein(a) may be measured in serum, adipose tissue, liver
or any other body fluid, tissue or organ of the animal. Preferably,
the cells contained within said fluids, tissues or organs being
analyzed contain a nucleic acid molecule encoding apolipoprotein(a)
protein and/or the apolipoprotein(a) protein itself. For example,
apolipoprotein(a) is produced in the liver, and can be found in
normal and atherosclerotic vessel walls.
[0074] The compounds of the invention can be utilized in
pharmaceutical compositions by adding an effective amount of a
compound to a suitable pharmaceutically acceptable diluent or
carrier. Use of the compounds and methods of the invention may also
be useful prophylactically.
F. Modifications
[0075] As is known in the art, a nucleoside is a base-sugar
combination. The base portion of the nucleoside is normally a
heterocyclic base. The two most common classes of such heterocyclic
bases are the purines and the pyrimidines. Nucleotides are
nucleosides that further include a phosphate group covalently
linked to the sugar portion of the nucleoside. For those
nucleosides that include a pentofuranosyl sugar, the phosphate
group can be linked to either the 2', 3' or 5' hydroxyl moiety of
the sugar. In forming oligonucleotides, the phosphate groups
covalently link adjacent nucleosides to one another to form a
linear polymeric compound. In turn, the respective ends of this
linear polymeric compound can be further joined to form a circular
compound, however, linear compounds are generally preferred. In
addition, linear compounds may have internal nucleobase
complementarity and may therefore fold in a manner as to produce a
fully or partially double-stranded compound. Within
oligonucleotides, the phosphate groups are commonly referred to as
forming the internucleoside backbone of the oligonucleotide. The
normal linkage or backbone of RNA and DNA is a 3' to 5'
phosphodiester linkage.
Modified Internucleoside Linkages (Backbones)
[0076] Specific examples of preferred antisense compounds useful in
this invention include oligonucleotides containing modified
backbones or non-natural internucleoside linkages. As defined in
this specification, oligonucleotides having modified backbones
include those that retain a phosphorus atom in the backbone and
those that do not have a phosphorus atom in the backbone. For the
purposes of this specification, and as sometimes referenced in the
art, modified oligonucleotides that do not have a phosphorus atom
in their internucleoside backbone can also be considered to be
oligonucleosides.
[0077] Preferred modified oligonucleotide backbones containing a
phosphorus atom therein include, for example, phosphorothioates,
chiral phosphorothioates, phosphorodithioates, phosphotriesters,
aminoalkylphosphotriesters, methyl and other alkyl phosphonates
including 3'-alkylene phosphonates, 5'-alkylene phosphonates and
chiral phosphonates, phosphinates, phosphoramidates including
3'-amino phosphoramidate and aminoalkylphosphoramidates,
thionophosphoramidates, thionoalkylphosphonates,
thionoalkylphosphotriesters, selenophosphates and boranophosphates
having normal 3'-5' linkages, 2'-5' linked analogs of these, and
those having inverted polarity wherein one or more internucleotide
linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage. Preferred
oligonucleotides having inverted polarity comprise a single 3' to
3' linkage at the 3'-most internucleotide linkage i.e. a single
inverted nucleoside residue which may be abasic (the nucleobase is
missing or has a hydroxyl group in place thereof). Various salts,
mixed salts and free acid forms are also included.
[0078] Representative United States patents that teach the
preparation of the above phosphorus-containing linkages include,
but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863;
4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019;
5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496;
5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306;
5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555;
5,527,899; 5,721,218; 5,672,697 and 5,625,050, certain of which are
commonly owned with this application, and each of which is herein
incorporated by reference.
[0079] Preferred modified oligonucleotide backbones that do not
include a phosphorus atom therein have backbones that are formed by
short chain alkyl or cycloalkyl internucleoside linkages, mixed
heteroatom and alkyl or cycloalkyl internucleoside linkages, or one
or more short chain heteroatomic or heterocyclic internucleoside
linkages. These include those having morpholino linkages (formed in
part from the sugar portion of a nucleoside); siloxane backbones;
sulfide, sulfoxide and sulfone backbones; formacetyl and
thioformacetyl backbones; methylene formacetyl and thioformacetyl
backbones; riboacetyl backbones; alkene containing backbones;
sulfamate backbones; methyleneimino and methylenehydrazino
backbones; sulfonate and sulfonamide backbones; amide backbones;
and others having mixed N, O, S and CH.sub.2 component parts.
[0080] Representative United States patents that teach the
preparation of the above oligonucleosides include, but are not
limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444;
5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938;
5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225;
5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289;
5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608;
5,646,269 and 5,677,439, certain of which are commonly owned with
this application, and each of which is herein incorporated by
reference.
Modified Sugar and Internucleoside Linkages-Mimetics
[0081] In other preferred oligonucleotide mimetics, both the sugar
and the internucleoside linkage (i.e. the backbone), of the
nucleotide units are replaced with novel groups. The nucleobase
units are maintained for hybridization with an appropriate target
nucleic acid. One such compound, an oligonucleotide mimetic that
has been shown to have excellent hybridization properties, is
referred to as a peptide nucleic acid (PNA). In PNA compounds, the
sugar-backbone of an oligonucleotide is replaced with an amide
containing backbone, in particular an aminoethylglycine backbone.
The nucleobases are retained and are bound directly or indirectly
to aza nitrogen atoms of the amide portion of the backbone.
Representative United States patents that teach the preparation of
PNA compounds include, but are not limited to, U.S. Pat. Nos.
5,539,082; 5,714,331; and 5,719,262, each of which is herein
incorporated by reference. Further teaching of PNA compounds can be
found in Nielsen et al., Science, 1991, 254, 1497-1500.
[0082] Preferred embodiments of the invention are oligonucleotides
with phosphorothioate backbones and oligonucleosides with
heteroatom backbones, and in particular
--CH.sub.2--NH--O--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--O--CH.sub.2-- [known as a methylene
(methylimino) or MMI backbone],
--CH.sub.2--O--N(CH.sub.3)--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2-- and
--O--N(CH.sub.3)--CH.sub.2--CH.sub.2-- [wherein the native
phosphodiester backbone is represented as --O--P--O--CH.sub.2--] of
the above referenced U.S. Pat. No. 5,489,677, and the amide
backbones of the above referenced U.S. Pat. No. 5,602,240. Also
preferred are oligonucleotides having morpholino backbone
structures of the above-referenced U.S. Pat. No. 5,034,506.
Modified Sugars
[0083] Modified oligonucleotides may also contain one or more
substituted sugar moieties. Preferred oligonucleotides comprise one
of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-,
S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein
the alkyl, alkenyl and alkynyl may be substituted or unsubstituted
C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10 alkenyl and
alkynyl. Particularly preferred are
O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nOCH.sub.3,
O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3,
O(CH.sub.2).sub.nONH.sub.2, and
O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3].sub.2, where n and m
are from 1 to about 10. Other preferred oligonucleotides comprise
one of the following at the 2' position: C.sub.1 to C.sub.10 lower
alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl,
O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3,
OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2,
N.sub.3, NH.sub.2, heterocycloalkyl, heterocycloalkaryl,
aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving
group, a reporter group, an intercalator, a group for improving the
pharmacokinetic properties of an oligonucleotide, or a group for
improving the pharmacodynamic properties of an oligonucleotide, and
other substituents having similar properties. A preferred
modification includes 2'-methoxyethoxy
(2'-O--CH.sub.2CH.sub.2OCH.sub.3, also known as
2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta,
1995, 78, 486-504) i.e., an alkoxyalkoxy group. A further preferred
modification includes 2'-dimethylaminooxyethoxy, i.e., a
0(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2'-DMAOE,
as described in examples hereinbelow, and
2'-dimethylaminoethoxyethoxy (also known in the art as
2'-O-dimethyl-amino-ethoxy-ethyl or 2'-DMAEOE), i.e.,
2'-O--CH.sub.2--O--CH.sub.2--N(CH.sub.3).sub.2, also described in
examples hereinbelow.
[0084] Other preferred modifications include 2'-methoxy
(2'-O--CH.sub.3), 2'-aminopropoxy
(2'-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2), 2'-allyl
(2'-CH.sub.2--CH.dbd.CH.sub.2), 2'-O-allyl
(2'-O--CH.sub.2--CH.dbd.CH.sub.2) and 2'-fluoro (2'-F). The
2'-modification may be in the arabino (up) position or ribo (down)
position. A preferred 2'-arabino modification is 2'-F. Similar
modifications may also be made at other positions on the
oligonucleotide, particularly the 3' position of the sugar on the
3' terminal nucleotide or in 2'-5' linked oligonucleotides and the
5' position of 5' terminal nucleotide. Oligonucleotides may also
have sugar mimetics such as cyclobutyl moieties in place of the
pentofuranosyl sugar. Representative United States patents that
teach the preparation of such modified sugar structures include,
but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800;
5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785;
5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300;
5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747;
and 5,700,920, certain of which are commonly owned with the instant
application, and each of which is herein incorporated by reference
in its entirety.
[0085] A further preferred modification of the sugar includes
Locked Nucleic Acids (LNAs) in which the 2'-hydroxyl group is
linked to the 3' or 4' carbon atom of the sugar ring, thereby
forming a bicyclic sugar moiety. The linkage is preferably a
methylene (--CH.sub.2--).sub.n group bridging the 2' oxygen atom
and the 4' carbon atom wherein n is 1 or 2. LNAs and preparation
thereof are described in published International Patent Application
Nos. WO 98/39352 and WO 99/14226.
Natural and Modified Nucleobases
[0086] Oligonucleotides may also include nucleobase (often referred
to in the art simply as "base") modifications or substitutions. As
used herein, "unmodified" or "natural" nucleobases include the
purine bases adenine (A) and guanine (G), and the pyrimidine bases
thymine (T), cytosine (C) and uracil (U). Modified nucleobases
include other synthetic and natural nucleobases such as
5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine,
hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives
of adenine and guanine, 2-propyl and other alkyl derivatives of
adenine and guanine, 2-thiouracil, 2-thiothymine and
2-thiocytosine, 5-halouracil and cytosine, 5-propynyl
(--Ca.ident.C--CH.sub.3) uracil and cytosine and other alkynyl
derivatives of pyrimidine bases, 6-azo uracil, cytosine and
thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino,
8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines
and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and
other 5-substituted uracils and cytosines, 7-methylguanine and
7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and
8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine
and 3-deazaadenine. Further modified nucleobases include tricyclic
pyrimidines such as phenoxazine
cytidine(1H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one),
phenothiazine cytidine
(1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps such as a
substituted phenoxazine cytidine (e.g.
9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one),
carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole
cytidine (H-pyrido[3',':4,5]pyrrolo[2,3-d]pyrimidin-2-one).
Modified nucleobases may also include those in which the purine or
pyrimidine base is replaced with other heterocycles, for example
7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
Further nucleobases include those disclosed in U.S. Pat. No.
3,687,808, those disclosed in The Concise Encyclopedia Of Polymer
Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John
Wiley & Sons, 1990, those disclosed by Englisch et al.,
Angewandte Chemie, International Edition, 1991, 30, 613, and those
disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and
Applications, pages 289-302, Crooke, S. T. and Lebleu, B., ed., CRC
Press, 1993. Certain of these nucleobases are particularly useful
for increasing the binding affinity of the compounds of the
invention. These include 5-substituted pyrimidines,
6-azapyrimidines and N-2, N-6 and O-6 substituted purines,
including 2-aminopropyladenine, 5-propynyluracil and
5-propynylcytosine. 5-methylcytosine substitutions have been shown
to increase nucleic acid duplex stability by 0.6-1.2.degree. C. and
are presently preferred base substitutions, even more particularly
when combined with 2'-O-methoxyethyl sugar modifications.
[0087] Representative United States patents that teach the
preparation of certain of the above noted modified nucleobases as
well as other modified nucleobases include, but are not limited to,
the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos.
4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272;
5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540;
5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,830,653;
5,763,588; 6,005,096; and 5,681,941, certain of which are commonly
owned with the instant application, and each of which is herein
incorporated by reference, and U.S. Pat. No. 5,750,692, which is
commonly owned with the instant application and also herein
incorporated by reference.
Conjugates
[0088] Another modification of the oligonucleotides of the
invention involves chemically linking to the oligonucleotide one or
more moieties or conjugates that enhance the activity, cellular
distribution or cellular uptake of the oligonucleotide. These
moieties or conjugates can include conjugate groups covalently
bound to functional groups such as primary or secondary hydroxyl
groups. Conjugate groups of the invention include intercalators,
reporter molecules, polyamines, polyamides, polyethylene glycols,
polyethers, groups that enhance the pharmacodynamic properties of
oligomers, and groups that enhance the pharmacokinetic properties
of oligomers. Typical conjugate groups include cholesterols,
lipids, phospholipids, biotin, phenazine, folate, phenan-thridine,
anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and
dyes. Groups that enhance the pharmacodynamic properties, in the
context of this invention, include groups that improve uptake,
enhance resistance to degradation, and/or strengthen
sequence-specific hybridization with the target nucleic acid.
Groups that enhance the pharmacokinetic properties, in the context
of this invention, include groups that improve uptake,
distribution, metabolism or excretion of the compounds of the
present invention. Representative conjugate groups are disclosed in
International Patent Application No. PCT/US92/09196, filed Oct. 23,
1992, and U.S. Pat. No. 6,287,860, the entire disclosures of which
are incorporated herein by reference. Conjugate moieties include,
but are not limited to, lipid moieties such as a cholesterol
moiety, cholic acid, a thioether, e.g., hexyl-5-tritylthiol, a
thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl
residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or
triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, a
polyamine or a polyethylene glycol chain, or adamantane acetic
acid, a palmityl moiety, or an octadecylamine or
hexylamino-carbonyl-oxycholesterol moiety. Oligonucleotides of the
invention may also be conjugated to active drug substances, for
example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen,
fenbufen, ketoprofen, (S)-(+)-pranoprofen, earprofen,
dansylsarcosine, 2,3,5-triiodo-benzoic acid, flufenamic acid,
folinic acid, a benzothiadiazide, chlorothiazide, a diazepine,
indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an
antidiabetic, an antibacterial or an antibiotic.
Oligonucleotide-drug conjugates and their preparation are described
in U.S. patent application Ser. No. 09/334,130 (filed Jun. 15,
1999), which is incorporated herein by reference in its
entirety.
[0089] Representative United States patents that teach the
preparation of such oligonucleotide conjugates include, but are not
limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105;
5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731;
5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077;
5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735;
4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335;
4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830;
5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536;
5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203,
5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810;
5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923;
5,599,928 and 5,688,941, certain of which are commonly owned with
the instant application, and each of which is herein incorporated
by reference.
Chimeric Compounds
[0090] It is not necessary for all positions in a given compound to
be uniformly modified, and in fact more than one of the
aforementioned modifications may be incorporated in a single
compound or even at a single nucleoside within an
oligonucleotide.
[0091] The present invention also includes antisense compounds that
are chimeric compounds. "Chimeric" antisense compounds or
"chimeras," in the context of this invention, are antisense
compounds, particularly oligonucleotides, which contain two or more
chemically distinct regions, each made up of at least one monomer
unit, i.e., a nucleotide in the case of an oligonucleotide
compound. These oligonucleotides typically contain at least one
region wherein the oligonucleotide is modified so as to confer upon
the oligonucleotide increased resistance to nuclease degradation,
increased cellular uptake, increased stability and/or increased
binding affinity for the target nucleic acid. An additional region
of the oligonucleotide may serve as a substrate for enzymes capable
of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNAse H
is a cellular endonuclease which cleaves the RNA strand of an
RNA:DNA duplex. Activation of RNase H, therefore, results in
cleavage of the RNA target, thereby greatly enhancing the
efficiency of oligonucleotide-mediated inhibition of gene
expression. The cleavage of RNA:RNA hybrids can, in like fashion,
be accomplished through the actions of endoribonucleases, such as
RNAseL which cleaves both cellular and viral RNA. Cleavage of the
RNA target can be routinely detected by gel electrophoresis and, if
necessary, associated nucleic acid hybridization techniques known
in the art.
[0092] Chimeric antisense compounds of the invention may be formed
as composite structures of two or more oligonucleotides, modified
oligonucleotides, oligonucleosides and/or oligonucleotide mimetics
as described above. Such compounds have also been referred to in
the art as hybrids or gapmers. Representative United States patents
that teach the preparation of such hybrid structures include, but
are not limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; 5,220,007;
5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065;
5,652,355; 5,652,356; and 5,700,922, certain of which are commonly
owned with the instant application, and each of which is herein
incorporated by reference in its entirety.
G. Formulations
[0093] The compounds of the invention may also be admixed,
encapsulated, conjugated or otherwise associated with other
molecules, molecule structures or mixtures of compounds, as for
example, liposomes, receptor-targeted molecules, oral, rectal,
topical or other formulations, for assisting in uptake,
distribution and/or absorption. Representative United States
patents that teach the preparation of such uptake, distribution
and/or absorption-assisting formulations include, but are not
limited to, U.S. Pat. Nos. 5,108,921; 5,354,844; 5,416,016;
5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721;
4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170;
5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854;
5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948;
5,580,575; and 5,595,756, each of which is herein incorporated by
reference.
[0094] The antisense compounds of the invention encompass any
pharmaceutically acceptable salts, esters, or salts of such esters,
or any other compound which, upon administration to an animal,
including a human, is capable of providing (directly or indirectly)
the biologically active metabolite or residue thereof.
[0095] The term "pharmaceutically acceptable salts" refers to
physiologically and pharmaceutically acceptable salts of the
compounds of the invention: i.e., salts that retain the desired
biological activity of the parent compound and do not impart
undesired toxicological effects thereto. For oligonucleotides,
preferred examples of pharmaceutically acceptable salts and their
uses are further described in U.S. Pat. No. 6,287,860, which is
incorporated herein in its entirety.
[0096] The present invention also includes pharmaceutical
compositions and formulations that include the antisense compounds
of the invention. The pharmaceutical compositions of the present
invention may be administered in a number of ways depending upon
whether local or systemic treatment is desired and upon the area to
be treated. Administration may be topical (including ophthalmic and
to mucous membranes including vaginal and rectal delivery),
pulmonary, e.g., by inhalation or insufflation of powders or
aerosols, including by nebulizer; intratracheal, intranasal,
epidermal and transdermal), oral or parenteral. Parenteral
administration includes intravenous, intraarterial, subcutaneous,
intraperitoneal or intramuscular injection or infusion; or
intracranial, e.g., intrathecal or intraventricular,
administration. Oligonucleotides with at least one
2'-O-methoxyethyl modification are believed to be particularly
useful for oral administration. Pharmaceutical compositions and
formulations for topical administration may include transdermal
patches, ointments, lotions, creams, gels, drops, suppositories,
sprays, liquids and powders. Conventional pharmaceutical carriers,
aqueous, powder or oily bases, thickeners and the like may be
necessary or desirable. Coated condoms, gloves and the like may
also be useful.
[0097] The pharmaceutical formulations of the present invention,
which may conveniently be presented in unit dosage form, may be
prepared according to conventional techniques well known in the
pharmaceutical industry. Such techniques include the step of
bringing into association the active ingredients with the
pharmaceutical carrier(s) or excipient(s). In general, the
formulations are prepared by uniformly and intimately bringing into
association the active ingredients with liquid carriers or finely
divided solid carriers or both, and then, if necessary, shaping the
product.
[0098] The compositions of the present invention may be formulated
into any of many possible dosage forms such as, but not limited to,
tablets, capsules, gel capsules, liquid syrups, soft gels,
suppositories, and enemas. The compositions of the present
invention may also be formulated as suspensions in aqueous,
non-aqueous or mixed media. Aqueous suspensions may further contain
substances that increase the viscosity of the suspension including,
for example, sodium carboxymethylcellulose, sorbitol and/or
dextran. The suspension may also contain stabilizers.
[0099] Pharmaceutical compositions of the present invention
include, but are not limited to, solutions, emulsions, foams and
liposome-containing formulations. The pharmaceutical compositions
and formulations of the present invention may comprise one or more
penetration enhancers, carriers, excipients or other active or
inactive ingredients.
[0100] Emulsions are typically heterogenous systems of one liquid
dispersed in another in the form of droplets usually exceeding 0.1
.mu.m in diameter. Emulsions may contain additional components in
addition to the dispersed phases, and the active drug that may be
present as a solution in either the aqueous phase, oily phase or
itself as a separate phase. Microemulsions are included as an
embodiment of the present invention. Emulsions and their uses are
well known in the art and are further described in U.S. Pat. No.
6,287,860, which is incorporated herein in its entirety.
[0101] Formulations of the present invention include liposomal
formulations. As used in the present invention, the term "liposome"
means a vesicle composed of amphiphilic lipids arranged in a
spherical bilayer or bilayers. Liposomes are unilamellar or
multilamellar vesicles which have a membrane formed from a
lipophilic material and an aqueous interior that contains the
composition to be delivered. Cationic liposomes are positively
charged liposomes that are believed to interact with negatively
charged DNA molecules to form a stable complex. Liposomes that are
pH-sensitive or negatively-charged are believed to entrap DNA
rather than complex with it. Both cationic and noncationic
liposomes have been used to deliver DNA to cells. Liposomes also
include "sterically stabilized" liposomes, a term which, as used
herein, refers to liposomes comprising one or more specialized
lipids. When incorporated into liposomes, these specialized lipids
result in liposomes with enhanced circulation lifetimes relative to
liposomes lacking such specialized lipids. Examples of sterically
stabilized liposomes are those in which part of the vesicle-forming
lipid portion of the liposome comprises one or more glycolipids or
is derivatized with one or more hydrophilic polymers, such as a
polyethylene glycol (PEG) moiety. Liposomes and their uses are
further described in U.S. Pat. No. 6,287,860, which is incorporated
herein in its entirety.
[0102] The pharmaceutical formulations and compositions of the
present invention may also include surfactants. The use of
surfactants in drug products, formulations and in emulsions is well
known in the art. Surfactants and their uses are further described
in U.S. Pat. No. 6,287,860, which is incorporated herein in its
entirety.
[0103] In one embodiment, the present invention employs various
penetration enhancers to effect the efficient delivery of nucleic
acids, particularly oligonucleotides. In addition to aiding the
diffusion of non-lipophilic drugs across cell membranes,
penetration enhancers also enhance the permeability of lipophilic
drugs. Penetration enhancers may be classified as belonging to one
of five broad categories, i.e., surfactants, fatty acids, bile
salts, chelating agents, and non-chelating non-surfactants.
Penetration enhancers and their uses are further described in U.S.
Pat. No. 6,287,860, which is incorporated herein in its
entirety.
[0104] One of skill in the art will recognize that formulations are
routinely designed according to their intended use, i.e. route of
administration.
[0105] Preferred formulations for topical administration include
those in which the oligonucleotides of the invention are in
admixture with a topical delivery agent such as lipids, liposomes,
fatty acids, fatty acid esters, steroids, chelating agents and
surfactants. Preferred lipids and liposomes include neutral (e.g.
dioleoyl-phosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl
choline DMPC, distearolyphosphatidyl choline) negative (e.g.
dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g.
dioleoyltetramethylaminopropyl DOTAP and dioleoyl-phosphatidyl
ethanolamine DOTMA).
[0106] For topical or other administration, oligonucleotides of the
invention may be encapsulated within liposomes or may form
complexes thereto, in particular to cationic liposomes.
Alternatively, oligonucleotides may be complexed to lipids, in
particular to cationic lipids. Preferred fatty acids and esters,
pharmaceutically acceptable salts thereof, and their uses are
further described in U.S. Pat. No. 6,287,860, which is incorporated
herein in its entirety. Topical formulations are described in
detail in U.S. patent application Ser. No. 09/315,298 filed on May
20, 1999, which is incorporated herein by reference in its
entirety.
[0107] Compositions and formulations for oral administration
include powders or granules, microparticulates, nanoparticulates,
suspensions or solutions in water or non-aqueous media, capsules,
gel capsules, sachets, tablets or minitablets. Thickeners,
flavoring agents, diluents, emulsifiers, dispersing aids or binders
may be desirable. Preferred oral formulations are those in which
oligonucleotides of the invention are administered in conjunction
with one or more penetration enhancers surfactants and chelators.
Preferred surfactants include fatty acids and/or esters or salts
thereof, bile acids and/or salts thereof. Preferred bile
acids/salts and fatty acids and their uses are further described in
U.S. Pat. No. 6,287,860, which is incorporated herein in its
entirety. Also preferred are combinations of penetration enhancers,
for example, fatty acids/salts in combination with bile
acids/salts. A particularly preferred combination is the sodium
salt of lauric acid, capric acid and UDCA. Further penetration
enhancers include polyoxyethylene-9-lauryl ether,
polyoxyethylene-20-cetyl ether. Oligonucleotides of the invention
may be delivered orally, in granular form including sprayed dried
particles, or complexed to form micro or nanoparticles.
Oligonucleotide complexing agents and their uses are further
described in U.S. Pat. No. 6,287,860, which is incorporated herein
in its entirety. Oral formulations for oligonucleotides and their
preparation are described in detail in U.S. Published Patent
Application No. 2003/0040497 (Feb. 27, 2003) and its parent
applications; U.S. Published Patent Application No. 2003/0027780
(Feb. 6, 2003) and its parent applications; and U.S. patent
application Ser. No. 10/071,822, filed Feb. 8, 2002, each of which
is incorporated herein by reference in their entirety.
[0108] Compositions and formulations for parenteral, intrathecal or
intraventricular administration may include sterile aqueous
solutions that may also contain buffers, diluents and other
suitable additives such as, but not limited to, penetration
enhancers, carrier compounds and other pharmaceutically acceptable
carriers or excipients.
[0109] Certain embodiments of the invention provide pharmaceutical
compositions containing one or more oligomeric compounds and one or
more other chemotherapeutic agents that function by a non-antisense
mechanism. Examples of such chemotherapeutic agents include but are
not limited to cancer chemotherapeutic drugs such as daunorubicin,
daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin,
esorubicin, bleomycin, mafosfamide, ifosfamide, cytosine
arabinoside, bis-chloroethyl-nitrosurea, busulfan, mitomycin C,
actinomycin D, mithramycin, prednisone, hydroxyprogesterone,
testosterone, tamoxifen, dacarbazine, procarbazine,
hexamethylmelamine, pentamethylmelamine, mitoxantrone, amsacrine,
chlorambucil, methylcyclohexylnitrosurea, nitrogen mustards,
melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine,
cytarabine, 5-azacytidine, hydroxyurea, deoxycoformycin,
4-hydroxyperoxycyclo-phosphoramide, 5-fluorouracil (5-FU),
5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine,
taxol, vincristine, vinblastine, etoposide (VP-16), trimetrexate,
irinotecan, topotecan, gemcitabine, teniposide, cisplatin and
diethylstilbestrol (DES). When used with the compounds of the
invention, such chemo-therapeutic agents may be used individually
(e.g., 5-FU and oligonucleotide), sequentially (e.g., 5-FU and
oligonucleotide for a period of time followed by MTX and
oligonucleotide), or in combination with one or more other such
chemotherapeutic agents (e.g., 5-FU, MTX and oligonucleotide, or
5-FU, radiotherapy and oligonucleotide). Anti-inflammatory drugs,
including but not limited to nonsteroidal anti-inflammatory drugs
and corticosteroids, and antiviral drugs, including but not limited
to ribivirin, vidarabine, acyclovir and ganciclovir, may also be
combined in compositions of the invention. Combinations of
antisense compounds and other non-antisense drugs are also within
the scope of this invention. Two or more combined compounds may be
used together or sequentially.
[0110] In another related embodiment, compositions of the invention
may contain one or more antisense compounds, particularly
oligonucleotides, targeted to a first nucleic acid and one or more
additional antisense compounds targeted to a second nucleic acid
target. For example, the first target may be a apolipoprotein(a)
target, and the second target may be a region from another
nucleotide sequence. Alternatively, compositions of the invention
may contain two or more antisense compounds targeted to different
regions of the same apolipoprotein(a) nucleic acid target. Numerous
examples of antisense compounds are illustrated herein and others
may be selected from among suitable compounds known in the art. Two
or more combined compounds may be used together or
sequentially.
H. Dosing
[0111] The formulation of therapeutic compositions and their
subsequent administration (dosing) is believed to be within the
skill of those in the art. Dosing is dependent on severity and
responsiveness of the disease state to be treated, with the course
of treatment lasting from several days to several months, or until
a cure is effected or a diminution of the disease state is
achieved. Optimal dosing schedules can be calculated from
measurements of drug accumulation in the body of the patient.
Persons of ordinary skill can easily determine optimum dosages,
dosing methodologies and repetition rates. Optimum dosages may vary
depending on the relative potency of individual oligonucleotides,
and can generally be estimated based on EC.sub.50s found to be
effective in in vitro and in vivo animal models. In general, dosage
is from 0.01 .mu.g to 100 g per kg of body weight, and may be given
once or more daily, weekly, monthly or yearly, or even once every 2
to 20 years. Persons of ordinary skill in the art can easily
estimate repetition rates for dosing based on measured residence
times and concentrations of the drug in bodily fluids or tissues.
Following successful treatment, it may be desirable to have the
patient undergo maintenance therapy to prevent the recurrence of
the disease state, wherein the oligonucleotide is administered in
maintenance doses, ranging from 0.01 .mu.g to 100 g per kg of body
weight, once or more daily, to once every 20 years.
[0112] While the present invention has been described with
specificity in accordance with certain of its preferred
embodiments, the following examples serve only to illustrate the
invention and are not intended to limit the same. Each of the
references, GenBank accession numbers, as well as each application
from which the present application claims priority, and the like
recited in the present application is incorporated herein by
reference in its entirety.
EXAMPLES
Example 1
Synthesis of Nucleoside Phosphoramidites
[0113] The following compounds, including amidites and their
intermediates were prepared as described in U.S. Pat. No. 6,426,220
and published International Patent Application No. WO 02/36743;
5'-O-Dimethoxytrityl-thymidine intermediate for 5-methyl dC
amidite, 5'-O-Dimethoxytrityl-2'-deoxy-5-methylcytidine
intermediate for 5-methyl-dC amidite,
5'-O-Dimethoxytrityl-2'-deoxy-N4-benzoyl-5-methylcytidine
penultimate intermediate for 5-methyl dC amidite,
[5'-O-(4,4'-Dimethoxytriphenylmethyl)-2'-deoxy-N.sup.4-benzoyl-5-methylcy-
tidin-3'-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite
(5-methyl dC amidite), 2'-Fluorodeoxyadenosine,
2'-Fluorodeoxyguanosine, 2'-Fluorouridine, 2'-Fluorodeoxycytidine,
2'-O-(2-Methoxyethyl) modified amidites,
2'-O-(2-methoxyethyl)-5-methyluridine intermediate,
5'-O-DMT-2'-O-(2-methoxyethyl)-5-methyluridine penultimate
intermediate,
[5'-O-(4,4'-Dimethoxytriphenylmethyl)-2',O-(2-methoxyethyl)-5-methyluridi-
n-3',O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite (MOE T
amidite),
5'-O-Dimethoxytrityl-2'-O-(2-methoxyethyl)-5-methylcytidine
intermediate,
5'-O-dimethoxytrityl-2'-O-(2-methoxyethyl)-N.sup.4-benzoyl-5-methyl-cytid-
ine penultimate intermediate,
[5'-O-(4,4'-Dimethoxytriphenylmethyl)-2'-O-(2-methoxyethyl)-N.sup.4-benzo-
yl-5-methylcytidin-3'-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite
(MOE 5-Me-C amidite),
[5'-O(4,4'-Dimethoxytriphenylmethyl)-2'-O-(2-methoxyethyl)-N.sup.6-benzoy-
ladenosin-3'-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite (MOE
A amdite),
[5'-O-(4,4'-Dimethoxytriphenylmethyl)-2'-O-(2-methoxyethyl)-N.su-
p.4-isobutyrylguanosin-3'-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidit-
e (MOE G amidite), 2'-O-(Aminooxyethyl) nucleoside amidites and
2'-O-(dimethylaminooxyethyl) nucleoside amidites,
2'-(Dimethylaminooxyethoxy) nucleoside amidites,
5'-O-tert-Butyldiphenylsilyl-O.sup.2-2'-anhydro-5-methyluridine,
5'-O-tert-Butyldiphenylsilyl-2'-O-(2-hydroxyethyl)-5-methyluridine,
2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methyluridine,
5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy)ethyl]-5-methyluri-
dine, 5'-O-tert-Butyldiphenylsilyl-2'-O--[N,N
dimethylaminooxyethyl]-5-methyluridine,
2'-O-(dimethylaminooxyethyl)-5-methyluridine,
5'-O-DMT-2'-O-(dimethylaminooxyethyl)-5-methyluridine,
5'-O-DMT-2'-O-(2-N,N-dimethylaminooxyethyl)-5-methyluridine-3'-[(2-cyanoe-
thyl)-N,N-diisopropylphosphoramidite], 2'-(Aminooxyethoxy)
nucleoside amidites,
N2-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(-
4,4'-dimethoxytrityl)guanosine-3'-[(2-cyanoethyl)-N,N-diisopropylphosphora-
midite], 2'-dimethylaminoethoxyethoxy (2'-DMAEOE) nucleoside
amidites, 2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl]-5-methyl
uridine,
5'-O-dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)-ethyl)]-5-methyl
uridine and
5'-O-Dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)-ethyl)]-5-methyl
uridine-3'-O-(cyanoethyl-N,N-diisopropyl)phosphoramidite.
Example 2
Oligonucleotide and Oligonucleoside Synthesis
[0114] The antisense compounds used in accordance with this
invention may be conveniently and routinely made through the
well-known technique of solid phase synthesis. Equipment for such
synthesis is sold by several vendors, including, for example,
Applied Biosystems (Foster City, Calif.). Any other means for such
synthesis known in the art may additionally or alternatively be
employed. It is well known to use similar techniques to prepare
oligonucleotides such as the phosphorothioates and alkylated
derivatives.
[0115] Oligonucleotides: Unsubstituted and substituted
phosphodiester (P.dbd.O) oligonucleotides are synthesized on an
automated DNA synthesizer (Applied Biosystems model 394) using
standard phosphoramidite chemistry with oxidation by iodine.
[0116] Phosphorothioates (P.dbd.S) are synthesized similar to
phosphodiester oligonucleotides with the following exceptions:
thiation was effected by utilizing a 10% w/v solution of
3,H-1,2-benzodithiole-3-one 1,1-dioxide in acetonitrile for the
oxidation of the phosphite linkages. The thiation reaction step
time was increased to 180 sec and preceded by the normal capping
step. After cleavage from the CPG column and deblocking in
concentrated ammonium hydroxide at 55.degree. C. (12-16 hr), the
oligonucleotides were recovered by precipitating with >3 volumes
of ethanol from a 1M NH.sub.4OAc solution. Phosphinate
oligonucleotides are prepared as described in U.S. Pat. No.
5,508,270, herein incorporated by reference.
[0117] Alkyl phosphonate oligonucleotides are prepared as described
in U.S. Pat. No. 4,469,863, herein incorporated by reference.
[0118] 3'-Deoxy-3'-methylene phosphonate oligonucleotides are
prepared as described in U.S. Pat. No. 5,610,289 or 5,625,050,
herein incorporated by reference.
[0119] Phosphoramidite oligonucleotides are prepared as described
in U.S. Pat. No. 5,256,775 or 5,366,878, herein incorporated by
reference.
[0120] Alkylphosphonothioate oligonucleotides are prepared as
described in published International patent application Nos.
PCT/US94/00902 and PCT/US93/06976 (published as WO 94/17093 and WO
94/02499, respectively), herein incorporated by reference.
[0121] 3'-Deoxy-3'-amino phosphoramidate oligonucleotides are
prepared as described in U.S. Pat. No. 5,476,925, herein
incorporated by reference.
[0122] Phosphotriester oligonucleotides are prepared as described
in U.S. Pat. No. 5,023,243, herein incorporated by reference.
[0123] Borano phosphate oligonucleotides are prepared as described
in U.S. Pat. Nos. 5,130,302 and 5,177,198, both herein incorporated
by reference.
[0124] Oligonucleosides: Methylenemethylimino linked
oligonucleosides, also identified as MMI linked oligonucleosides,
methylenedimethylhydrazo linked oligonucleosides, also identified
as MDH linked oligonucleosides, and methylenecarbonylamino linked
oligonucleosides, also identified as amide-3 linked
oligonucleosides, and methyleneaminocarbonyl linked
oligonucleosides, also identified as amide-4 linked
oligonucleosides, as well as mixed backbone compounds having, for
instance, alternating MMI and P.dbd.O or P.dbd.S linkages are
prepared as described in U.S. Pat. Nos. 5,378,825, 5,386,023,
5,489,677, 5,602,240 and 5,610,289, all of which are herein
incorporated by reference.
[0125] Formacetal and thioformacetal linked oligonucleosides are
prepared as described in U.S. Pat. Nos. 5,264,562 and 5,264,564,
herein incorporated by reference.
[0126] Ethylene oxide linked oligonucleosides are prepared as
described in U.S. Pat. No. 5,223,618, herein incorporated by
reference.
Example 3
RNA Synthesis
[0127] In general, RNA synthesis chemistry is based on the
selective incorporation of various protecting groups at strategic
intermediary reactions. Although one of ordinary skill in the art
will understand the use of protecting groups in organic synthesis,
a useful class of protecting groups includes silyl ethers. In
particular bulky silyl ethers are used to protect the 5'-hydroxyl
in combination with an acid-labile orthoester protecting group on
the 2'-hydroxyl. This set of protecting groups is then used with
standard solid-phase synthesis technology. It is important to
lastly remove the acid labile orthoester protecting group after all
other synthetic steps. Moreover, the early use of the silyl
protecting groups during synthesis ensures facile removal when
desired, without undesired deprotection of 2' hydroxyl.
[0128] Following this procedure for the sequential protection of
the 5'-hydroxyl in combination with protection of the 2'-hydroxyl
by protecting groups that are differentially removed and are
differentially chemically labile, RNA oligonucleotides were
synthesized.
[0129] RNA oligonucleotides are synthesized in a stepwise fashion.
Each nucleotide is added sequentially (3'- to 5'-direction) to a
solid support-bound oligonucleotide. The first nucleoside at the
3'-end of the chain is covalently attached to a solid support. The
nucleotide precursor, a ribonucleoside phosphoramidite, and
activator are added, coupling the second base onto the 5'-end of
the first nucleoside. The support is washed and any unreacted
5'-hydroxyl groups are capped with acetic anhydride to yield
5'-acetyl moieties. The linkage is then oxidized to the more stable
and ultimately desired P(V) linkage. At the end of the nucleotide
addition cycle, the 5'-silyl group is cleaved with fluoride. The
cycle is repeated for each subsequent nucleotide.
[0130] Following synthesis, the methyl protecting groups on the
phosphates are cleaved in 30 minutes utilizing 1 M
disodium-2-carbamoyl-2-cyanoethylene-1,1-dithiolate trihydrate
(S.sub.2Na.sub.2) in DMF. The deprotection solution is washed from
the solid support-bound oligonucleotide using water. The support is
then treated with 40% methylamine in water for 10 minutes at
55.degree. C. This releases the RNA oligonucleotides into solution,
deprotects the exocyclic amines, and modifies the 2'-groups. The
oligonucleotides can be analyzed by anion exchange HPLC at this
stage.
[0131] The 2'-orthoester groups are the last protecting groups to
be removed. The ethylene glycol monoacetate orthoester protecting
group developed by Dharmacon Research, Inc. (Lafayette, Colo.), is
one example of a useful orthoester protecting group that has the
following important properties. It is stable to the conditions of
nucleoside phosphoramidite synthesis and oligonucleotide synthesis.
However, after oligonucleotide synthesis the oligonucleotide is
treated with methylamine, which not only cleaves the
oligonucleotide from the solid support but also removes the acetyl
groups from the orthoesters. The resulting 2-ethyl-hydroxyl
substituents on the orthoester are less electron withdrawing than
the acetylated precursor. As a result, the modified orthoester
becomes more labile to acid-catalyzed hydrolysis. Specifically, the
rate of cleavage is approximately 10 times faster after the acetyl
groups are removed. Therefore, this orthoester possesses sufficient
stability in order to be compatible with oligonucleotide synthesis
and yet, when subsequently modified, permits deprotection to be
carried out under relatively mild aqueous conditions compatible
with the final RNA oligonucleotide product.
[0132] Additionally, methods of RNA synthesis are well known in the
art (Scaringe, S. A. Ph.D. Thesis, University of Colorado, 1996;
Scaringe, S. A., et al., J. Am. Chem. Soc., 1998, 120, 11820-11821;
Matteucci, M. D. and Caruthers, M. H. J. Am. Chem. Soc., 1981, 103,
3185-3191; Beaucage, S. L. and Caruthers, M. H. Tetrahedron Lett.,
1981, 22, 1859-1862; Dahl, B. J., et al., Acta Chem. Scand., 1990,
44, 639-641; Reddy, M. P., et al., Tetrahedrom Lett., 1994, 25,
4311-4314; Wincott, F. et al., Nucleic Acids Res., 1995, 23,
2677-2684; Griffin, B. E., et al., Tetrahedron, 1967, 23,
2301-2313; Griffin, B. E., et al., Tetrahedron, 1967, 23,
2315-2331).
[0133] RNA antisense compounds (RNA oligonucleotides) of the
present invention can be synthesized by the methods herein or
purchased from Dharmacon Research, Inc (Lafayette, Colo.). Once
synthesized, complementary RNA antisense compounds can then be
annealed by methods known in the art to form double stranded
(duplexed) antisense compounds. For example, duplexes can be formed
by combining 30 .mu.l of each of the complementary strands of RNA
oligonucleotides (50 .mu.M RNA oligonucleotide solution) and 15 ml
of 5.times. annealing buffer (100 mM potassium acetate, 30 mM
HEPES-KOH pH 7.4, 2 mM magnesium acetate) followed by heating for 1
minute at 90.degree. C., then 1 hour at 37.degree. C. The resulting
duplexed antisense compounds can be used in kits, assays, screens,
or other methods to investigate the role of a target nucleic
acid.
Example 4
Synthesis of Chimeric Oligonucleotides
[0134] Chimeric oligonucleotides, oligonucleosides or mixed
oligonucleotides/oligonucleosides of the invention can be of
several different types. These include a first type wherein the
"gap" segment of linked nucleosides is positioned between 5' and 3'
"wing" segments of linked nucleosides and a second "open end" type
wherein the "gap" segment is located at either the 3' or the 5'
terminus of the oligomeric compound. Oligonucleotides of the first
type are also known in the art as "gapmers" or gapped
oligonucleotides. Oligonucleotides of the second type are also
known in the art as "hemimers" or "wingmers".
[0135] [2'-O-Me]-[2'-deoxy]--[2'-O-Me] Chimeric Phosphorothioate
Oligonucleotides
[0136] Chimeric oligonucleotides having 2'-O-alkyl phosphorothioate
and 2'-deoxy phosphorothioate oligonucleotide segments are
synthesized using an Applied Biosystems automated DNA synthesizer
Model 394, as above. Oligonucleotides are synthesized using the
automated synthesizer and
2'-deoxy-5'-dimethoxytrityl-3'-O-phosphoramidite for the DNA
portion and 5'-dimethoxytrityl-2'-O-methyl-3'-O-phosphoramidite for
5' and 3' wings. The standard synthesis cycle is modified by
incorporating coupling steps with increased reaction times for the
5'-dimethoxytrityl-2'-O-methyl-3'-O-phosphoramidite. The fully
protected oligonucleotide is cleaved from the support and
deprotected in concentrated ammonia (NH.sub.4OH) for 12-16 hr at
55.degree. C. The deprotected oligo is then recovered by an
appropriate method (precipitation, column chromatography, volume
reduced in vacuo and analyzed spectrophotometrically for yield and
for purity by capillary electrophoresis and by mass
spectrometry.
[0137] [2'-O-(2-Methoxyethyl)]-[2'-deoxy]--[2'-O-(Methoxyethyl)]
Chimeric Phosphorothioate Oligonucleotides
[0138] [2'-O-(2-methoxyethyl)]--[2'-deoxy]-[2'-O-(methoxyethyl)]
chimeric phosphorothioate oligonucleotides were prepared as per the
procedure above for the 2'-O-methyl chimeric oligonucleotide, with
the substitution of 2'-O-(methoxyethyl) amidites for the
2'-O-methyl amidites.
[0139] [2'-O-(2-Methoxyethyl)Phosphodiester]-[2'-deoxy
Phosphorothioate]-[2'-O-(2-Methoxyethyl) Phosphodiester] Chimeric
Oligonucleotides
[0140] [2'-O-(2-methoxyethyl phosphodiester]-[2'-deoxy
phosphorothioate]-[2'-O-(methoxyethyl) phosphodiester] chimeric
oligonucleotides are prepared as per the above procedure for the
2'-O-methyl chimeric oligonucleotide with the substitution of
2'-O-(methoxyethyl) amidites for the 2'-O-methyl amidites,
oxidation with iodine to generate the phosphodiester
internucleotide linkages within the wing portions of the chimeric
structures and sulfurization utilizing 3,H-1,2 benzodithiole-3-one
1,1 dioxide (Beaucage Reagent) to generate the phosphorothioate
internucleotide linkages for the center gap.
[0141] Other chimeric oligonucleotides, chimeric oligonucleosides
and mixed chimeric oligonucleotides/oligonucleosides are
synthesized according to U.S. Pat. No. 5,623,065, herein
incorporated by reference.
Example 5
Design and Screening of Duplexed Antisense Compounds Targeting
Apolipoprotein(a)
[0142] In accordance with the present invention, a series of
nucleic acid duplexes comprising the antisense compounds of the
present invention and their complements can be designed to target
apolipoprotein(a). The nucleobase sequence of the antisense strand
of the duplex comprises at least an 8-nucleobase portion of an
oligonucleotide in Table 1. The ends of the strands may be modified
by the addition of one or more natural or modified nucleobases to
form an overhang. The sense strand of the dsRNA is then designed
and synthesized as the complement of the antisense strand and may
also contain modifications or additions to either terminus. For
example, in one embodiment, both strands of the dsRNA duplex would
be complementary over the central nucleobases, each having
overhangs at one or both termini.
[0143] For example, a duplex comprising an antisense strand having
the sequence CGAGAGGCGGACGGGACCG (SEQ ID NO: 74) and having a
two-nucleobase overhang of deoxythymidine(dT) would have the
following structure:
##STR00001##
[0144] RNA strands of the duplex can be synthesized by methods
disclosed herein or purchased from Dharmacon Research Inc.,
(Lafayette, Colo.). Once synthesized, the complementary strands are
annealed. The single strands are aliquoted and diluted to a
concentration of 50 .mu.M. Once diluted, 30 .mu.L of each strand is
combined with 15 .mu.L of a 5.times. solution of annealing buffer.
The final concentration of said buffer is 100 mM potassium acetate,
30 mM HEPES-KOH pH 7.4, and 2 mM magnesium acetate. The final
volume is 75 .mu.L. This solution is incubated for 1 minute at
90.degree. C. and then centrifuged for 15 seconds. The tube is
allowed to sit for 1 hour at 37.degree. C. at which time the dsRNA
duplexes are used in experimentation. The final concentration of
the dsRNA duplex is 20 .mu.M. This solution can be stored frozen
(-20.degree. C.) and freeze-thawed up to 5 times.
[0145] Once prepared, the duplexed antisense compounds are
evaluated for their ability to modulate apolipoprotein(a)
expression.
[0146] When cells reached 80% confluency, they are treated with
duplexed antisense compounds of the invention. For cells grown in
96-well plates, wells are washed once with 200 .mu.L OPTI-MEM-1
reduced-serum medium (Gibco BRL) and then treated with 130 .mu.L of
OPTI-MEM-1 containing 12 .mu.g/mL LIPOFECTIN reagent (Gibco BRL)
and the desired duplex antisense compound at a final concentration
of 200 nM. After 5 hours of treatment, the medium is replaced with
fresh medium. Cells are harvested 16 hours after treatment, at
which time RNA is isolated and target reduction measured by
RT-PCR.
Example 6
Oligonucleotide Isolation
[0147] After cleavage from the controlled pore glass solid support
and deblocking in concentrated ammonium hydroxide at 55.degree. C.
for 12-16 hours, the oligonucleotides or oligonucleosides are
recovered by precipitation out of 1 M NH.sub.4OAc with >3
volumes of ethanol. Synthesized oligonucleotides were analyzed by
electrospray mass spectroscopy (molecular weight determination) and
by capillary gel electrophoresis and judged to be at least 70%
full-length material. The relative amounts of phosphorothioate and
phosphodiester linkages obtained in the synthesis were determined
by the ratio of correct molecular weight relative to the -16 amu
product (+/-32 +/-48). For some studies oligonucleotides were
purified by HPLC, as described by Chiang et al., J. Biol. Chem.
1991, 266, 18162-18171. Results obtained with HPLC-purified
material were similar to those obtained with non-HPLC purified
material.
Example 7
Oligonucleotide Synthesis--96 Well Plate Format
[0148] Oligonucleotides were synthesized via solid phase P(III)
phosphoramidite chemistry on an automated synthesizer capable of
assembling 96 sequences simultaneously in a 96-well format.
Phosphodiester internucleotide linkages were afforded by oxidation
with aqueous iodine. Phosphorothioate internucleotide linkages were
generated by sulfurization utilizing 3,H-1,2 benzodithiole-3-one
1,1 dioxide (Beaucage Reagent) in anhydrous acetonitrile. Standard
base-protected beta-cyanoethyl-diiso-propyl phosphoramidites were
purchased from commercial vendors (e.g. PE-Applied Biosystems,
Foster City, Calif., or Pharmacia, Piscataway, N.J.). Non-standard
nucleosides are synthesized as per standard or patented methods.
They are utilized as base protected beta-cyanoethyldiisopropyl
phosphoramidites.
[0149] Oligonucleotides were cleaved from support and deprotected
with concentrated NH.sub.4OH at elevated temperature (55-60.degree.
C.) for 12-16 hours and the released product then dried in vacuo.
The dried product was then re-suspended in sterile water to afford
a master plate from which all analytical and test plate samples are
then diluted utilizing robotic pipettors.
Example 8
[0150] Oligonucleotide Analysis--96-Well Plate Format
[0151] The concentration of oligonucleotide in each well was
assessed by dilution of samples and UV absorption spectroscopy. The
full-length integrity of the individual products was evaluated by
capillary electrophoresis (CE) in either the 96-well format
(Beckman P/ACE.TM. MDQ instrument) or, for individually prepared
samples, on a commercial CE apparatus (e.g., Beckman P/ACE.TM. 5000
instrument, ABI 270). Base and backbone composition was confirmed
by mass analysis of the compounds utilizing electrospray-mass
spectroscopy. All assay test plates were diluted from the master
plate using single and multi-channel robotic pipettors. Plates were
judged to be acceptable if at least 85% of the compounds on the
plate were at least 85% full length.
Example 9
Cell Culture and Oligonucleotide Treatment
[0152] The effects of antisense compounds on target nucleic acid
expression are tested in any of a variety of cell types, provided
that the target nucleic acid is present at measurable levels. This
can be routinely determined using, for example, PCR or Northern
blot analysis. The following cell types are provided for
illustrative purposes, but other cell types can be routinely used,
provided that the target is expressed in the cell type chosen. This
can be readily determined by methods routine in the art, for
example Northern blot analysis, ribonuclease protection assays, or
RT-PCR.
T-24 Cells:
[0153] The human transitional cell bladder carcinoma cell line T-24
was obtained from the American Type Culture Collection (ATCC)
(Manassas, Va.). T-24 cells were routinely cultured in complete
McCoy's 5A basal media (Invitrogen Corporation, Carlsbad, Calif.)
supplemented with 10% fetal calf serum (Invitrogen Corporation,
Carlsbad, Calif.), penicillin 100 units per mL, and streptomycin
100 .mu.g/mL (Invitrogen Corporation, Carlsbad, Calif.). Cells were
routinely passaged by trypsinization and dilution when they reached
90% confluence. Cells were seeded into 96-well plates
(Falcon-Primaria #353872) at a density of 7000 cells/well for use
in RT-PCR analysis.
[0154] For Northern blotting or other analysis, cells may be seeded
onto 100 mm or other standard tissue culture plates and treated
similarly, using appropriate volumes of medium and
oligonucleotide.
A549 Cells:
[0155] The human lung carcinoma cell line A549 was obtained from
the American Type Culture Collection (ATCC) (Manassas, Va.). A549
cells were routinely cultured in DMEM basal media (Invitrogen
Corporation, Carlsbad, Calif.) supplemented with 10% fetal calf
serum (Invitrogen Corporation, Carlsbad, Calif.), penicillin 100
units per mL, and streptomycin 100 .mu.g/mL (Invitrogen
Corporation, Carlsbad, Calif.). Cells were routinely passaged by
trypsinization and dilution when they reached 90% confluence.
NHDF Cells:
[0156] Human neonatal dermal fibroblasts (NHDFs) were obtained from
the Clonetics Corporation (Walkersville, Md.). NHDFs were routinely
maintained in Fibroblast Growth Medium (Clonetics Corporation,
Walkersville, Md.) supplemented as recommended by the supplier.
Cells were maintained for up to 10 passages as recommended by the
supplier.
HEK Cells:
[0157] Human embryonic keratinocytes (HEK) were obtained from the
Clonetics Corporation (Walkersville, Md.). HEKs were routinely
maintained in Keratinocyte Growth Medium (Clonetics Corporation,
Walkersville, Md.) formulated as recommended by the supplier. Cells
were routinely maintained for up to 10 passages as recommended by
the supplier.
Treatment with Antisense Compounds:
[0158] When cells reached 65-75% confluency, they were treated with
oligonucleotide. For cells grown in 96-well plates, wells were
washed once with 100 .mu.L OPTI-MEM.TM.-1 reduced-serum medium
(Invitrogen Corporation, Carlsbad, Calif.) and then treated with
130 .mu.L of OPTI-MEM.TM.-1 medium containing 3.75 .mu.g/mL
LIPOFECTIN.TM. reagent (Invitrogen Corporation, Carlsbad, Calif.)
and the desired concentration of oligonucleotide. Cells are treated
and data are obtained in triplicate. After 4-7 hours of treatment
at 37.degree. C., the medium was replaced with fresh medium. Cells
were harvested 16-24 hours after oligonucleotide treatment.
[0159] The concentration of oligonucleotide used varies from cell
line to cell line. To determine the optimal oligonucleotide
concentration for a particular cell line, the cells are treated
with a positive control oligonucleotide at a range of
concentrations. For human cells the positive control
oligonucleotide is selected from either ISIS 13920
(TCCGTCATCGCTCCTCAGGG, SEQ ID NO: 1) which is targeted to human
H-ras, or ISIS 18078, (GTGCGCGCGAGCCCGAAATC, SEQ ID NO: 2) which is
targeted to human Jun-N-terminal kinase-2 (JNK2). Both controls are
2'-O-methoxyethyl gapmers (2'-O-methoxyethyls shown in bold) with a
phosphorothioate backbone. For mouse or rat cells the positive
control oligonucleotide is ISIS 15770, ATGCATTCTGCCCCCAAGGA, SEQ ID
NO: 3, a 2'-O-methoxyethyl gapmer (2'-O-methoxyethyls shown in
bold) with a phosphorothioate backbone which is targeted to both
mouse and rat c-raf. The concentration of positive control
oligonucleotide that results in 80% inhibition of c-H-ras (for ISIS
13920), JNK2 (for ISIS 18078) or c-raf (for ISIS 15770) mRNA is
then utilized as the screening concentration for new
oligonucleotides in subsequent experiments for that cell line. If
80% inhibition is not achieved, the lowest concentration of
positive control oligonucleotide that results in 60% inhibition of
c-H-ras, JNK2 or c-raf mRNA is then utilized as the oligonucleotide
screening concentration in subsequent experiments for that cell
line. If 60% inhibition is not achieved, that particular cell line
is deemed as unsuitable for oligonucleotide transfection
experiments. The concentrations of antisense oligonucleotides used
herein are from 50 nM to 300 nM.
Example 10
Analysis of Oligonucleotide Inhibition of Apolipoprotein(a)
Expression
[0160] Antisense modulation of apolipoprotein(a) expression can be
assayed in a variety of ways known in the art. For example,
apolipoprotein(a) mRNA levels can be quantitated by, e.g., Northern
blot analysis, competitive polymerase chain reaction (PCR), or
real-time PCR (RT-PCR). Real-time quantitative PCR is presently
preferred. RNA analysis can be performed on total cellular RNA or
poly(A)+ mRNA. The preferred method of RNA analysis of the present
invention is the use of total cellular RNA as described in other
examples herein. Methods of RNA isolation are well known in the
art. Northern blot analysis is also routine in the art. Real-time
quantitative (PCR) can be conveniently accomplished using the
commercially available ABI PRISM.TM. 7600, 7700, or 7900 Sequence
Detection System, available from PE-Applied Biosystems, Foster
City, Calif. and used according to manufacturer's instructions.
[0161] Protein levels of apolipoprotein(a) can be quantitated in a
variety of ways well known in the art, such as immunoprecipitation,
Western blot analysis (immunoblotting), enzyme-linked immunosorbent
assay (ELISA) or fluorescence-activated cell sorting (FACS).
Antibodies directed to apolipoprotein(a) can be identified and
obtained from a variety of sources, such as the MSRS catalog of
antibodies (Aerie Corporation, Birmingham, Mich.), or can be
prepared via conventional monoclonal or polyclonal antibody
generation methods well known in the art.
Example 11
Design of Phenotypic Assays and In Vivo Studies for the Use of
Apolipoprotein(a) Inhibitors
Phenotypic Assays
[0162] Once apolipoprotein(a) inhibitors have been identified by
the methods disclosed herein, the compounds are further
investigated in one or more phenotypic assays, each having
measurable endpoints predictive of efficacy in the treatment of a
particular disease state or condition. Phenotypic assays, kits and
reagents for their use are well known to those skilled in the art
and are herein used to investigate the role and/or association of
apolipoprotein(a) in health and disease. Representative phenotypic
assays, which can be purchased from any one of several commercial
vendors, include those for determining cell viability,
cytotoxicity, proliferation or cell survival (Molecular Probes,
Eugene, Oreg.; PerkinElmer, Boston, Mass.), protein-based assays
including enzymatic assays (Panvera, LLC, Madison, Wis.; BD
Biosciences, Franklin Lakes, N.J.; Oncogene Research Products, San
Diego, Calif.), cell regulation, signal transduction, inflammation,
oxidative processes and apoptosis (Assay Designs Inc., Ann Arbor,
Mich.), triglyceride accumulation (Sigma-Aldrich, St. Louis, Mo.),
angiogenesis assays, tube formation assays, cytokine and hormone
assays and metabolic assays (Chemicon International Inc., Temecula,
Calif.; Amersham Biosciences, Piscataway, N.J.).
[0163] In one non-limiting example, cells determined to be
appropriate for a particular phenotypic assay (i.e., MCF-7 cells
selected for breast cancer studies; adipocytes for obesity studies)
are treated with apolipoprotein(a) inhibitors identified from the
in vitro studies as well as control compounds at optimal
concentrations which are determined by the methods described above.
At the end of the treatment period, treated and untreated cells are
analyzed by one or more methods specific for the assay to determine
phenotypic outcomes and endpoints.
[0164] Phenotypic endpoints include changes in cell morphology over
time or treatment dose as well as changes in levels of cellular
components such as proteins, lipids, nucleic acids, hormones,
saccharides or metals. Measurements of cellular status, which
include pH, stage of the cell cycle, intake or excretion of
biological indicators by the cell, are also endpoints of
interest.
[0165] Analysis of the genotype of the cell (measurement of the
expression of one or more of the genes of the cell) after treatment
is also used as an indicator of the efficacy or potency of the
apolipoprotein(a) inhibitors. Hallmark genes, or those genes
suspected to be associated with a specific disease state,
condition, or phenotype, are measured in both treated and untreated
cells.
[0166] The cells subjected to the phenotypic assays described
herein derive from in vitro cultures or from tissues or fluids
isolated from living organisms, both human and non-human. In
certain embodiments, a tissue and its constituent cells comprise,
but are not limited to, blood (e.g., hematopoietic cells, such as
human hematopoietic progenitor cells, human hematopoietic stem
cells, CD34.sup.+ cells CD4.sup.+ cells), lymphocytes and other
blood lineage cells, bone marrow, brain, stem cells, blood vessel,
liver, lung, bone, breast, cartilage, cervix, colon, cornea,
embryonic, endometrium, endothelial, epithelial, esophagus, facia,
fibroblast, follicular, ganglion cells, glial cells, goblet cells,
kidney, lymph node, muscle, neuron, ovaries, pancreas, peripheral
blood, prostate, skin, skin, small intestine, spleen, stomach,
testes and fetal tissue. In other embodiments, a fluid and its
constituent cells comprise, but is not limited to, blood, urine,
synovial fluid, lymphatic fluid and cerebro-spinal fluid. The
phenotypic assays may also be performed on tissues treated with
apolipoprotein(a) inhibitors ex vivo.
In Vivo Studies
[0167] The individual subjects of the in vivo studies described
herein are warm-blooded vertebrate animals, including humans.
[0168] The clinical trial is subjected to rigorous controls to
ensure that individuals are not unnecessarily put at risk and that
they are fully informed about their role in the study.
[0169] To account for the psychological effects of receiving
treatments, volunteers are randomly given placebo or
apolipoprotein(a) inhibitor. Furthermore, to prevent the doctors
from being biased in treatments, they are not informed as to
whether the medication they are administering is a
apolipoprotein(a) inhibitor or a placebo. Using this randomization
approach, each volunteer has the same chance of being given either
the new treatment or the placebo.
[0170] Volunteers receive either the apolipoprotein(a) inhibitor or
placebo for eight week period with biological parameters associated
with the indicated disease state or condition being measured at the
beginning (baseline measurements before any treatment), end (after
the final treatment), and at regular intervals during the study
period. Such measurements include the levels of nucleic acid
molecules encoding apolipoprotein(a) or apolipoprotein(a) protein
levels in body fluids, tissues or organs compared to pre-treatment
levels. Other measurements include, but are not limited to, indices
of the disease state or condition being treated, body weight, blood
pressure, serum titers of pharmacologic indicators of disease or
toxicity as well as ADME (absorption, distribution, metabolism and
excretion) measurements.
[0171] Information recorded for each patient includes age (years),
gender, height (cm), family history of disease state or condition
(yes/no), motivation rating (some/moderate/great) and number and
type of previous treatment regimens for the indicated disease or
condition.
[0172] Volunteers taking part in this study are healthy adults (age
18 to 65 years) and roughly an equal number of males and females
participate in the study. Volunteers with certain characteristics
are equally distributed for placebo and apolipoprotein(a) inhibitor
treatment. In general, the volunteers treated with placebo have
little or no response to treatment, whereas the volunteers treated
with the apolipoprotein(a) inhibitor show positive trends in their
disease state or condition index at the conclusion of the
study.
Example 12
RNA Isolation
[0173] Poly(A)+ mRNA Isolation
[0174] Poly(A)+ mRNA was isolated according to Miura et al., (Clin.
Chem., 1996, 42, 1758-1764). Other methods for poly(A)+ mRNA
isolation are routine in the art. Briefly, for cells grown on
96-well plates, growth medium was removed from the cells and each
well was washed with 200 .mu.L cold PBS. 60 .mu.L lysis buffer (10
mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM
vanadyl-ribonucleoside complex) was added to each well, the plate
was gently agitated and then incubated at room temperature for five
minutes. 55 .mu.L of lysate was transferred to Oligo d(T) coated
96-well plates (AGCT Inc., Irvine Calif.). Plates were incubated
for 60 minutes at room temperature, washed 3 times with 200 .mu.L
of wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3 M NaCl).
After the final wash, the plate was blotted on paper towels to
remove excess wash buffer and then air-dried for 5 minutes. 60
.mu.L of elution buffer (5 mM Tris-HCl pH 7.6), preheated to
70.degree. C., was added to each well, the plate was incubated on a
90.degree. C. hot plate for 5 minutes, and the eluate was then
transferred to a fresh 96-well plate.
[0175] Cells grown on 100 mm or other standard plates may be
treated similarly, using appropriate volumes of all solutions.
Total RNA Isolation
[0176] Total RNA was isolated using an RNEASY 96.TM. kit and
buffers purchased from Qiagen Inc. (Valencia, Calif.) following the
manufacturer's recommended procedures. Briefly, for cells grown on
96-well plates, growth medium was removed from the cells and each
well was washed with 200 .mu.L cold PBS. 150 .mu.L Buffer RLT was
added to each well and the plate vigorously agitated for 20
seconds. 150 .mu.L of 70% ethanol was then added to each well and
the contents mixed by pipetting three times up and down. The
samples were then transferred to the RNEASY 96.TM. well plate
attached to a QIAVAC.TM. manifold fitted with a waste collection
tray and attached to a vacuum source. Vacuum was applied for 1
minute. 500 .mu.L of Buffer RW1 was added to each well of the
RNEASY96.TM. plate and incubated for 15 minutes and the vacuum was
again applied for 1 minute. An additional 500 .mu.L of Buffer RW1
was added to each well of the RNEASY 96.TM. plate and the vacuum
was applied for 2 minutes. 1 mL of Buffer RPE was then added to
each well of the RNEASY 96.TM. plate and the vacuum applied for a
period of 90 seconds. The Buffer RPE wash was then repeated and the
vacuum was applied for an additional 3 minutes. The plate was then
removed from the QIAVAC.TM. manifold and blotted dry on paper
towels. The plate was then re-attached to the QIAVAC.TM. manifold
fitted with a collection tube rack containing 1.2 mL collection
tubes. RNA was then eluted by pipetting 140 .mu.L of RNAse free
water into each well, incubating 1 minute, and then applying the
vacuum for 3 minutes.
[0177] The repetitive pipetting and elution steps may be automated
using a QIAGEN Bio-Robot 9604 instrument (Qiagen, Inc., Valencia
Calif.). Essentially, after lysing of the cells on the culture
plate, the plate is transferred to the robot deck where the
pipetting, DNase treatment and elution steps are carried out.
Example 13
[0178] Real-Time Quantitative PCR Analysis of Apolipoprotein(a)
mRNA Levels
[0179] Quantitation of apolipoprotein(a) mRNA levels was
accomplished by real-time quantitative PCR using the ABI PRISM.TM.
7600, 7700, or 7900 Sequence Detection System (PE-Applied
Biosystems, Foster City, Calif.) according to manufacturer's
instructions. This is a closed-tube, non-gel-based, fluorescence
detection system which allows high-throughput quantitation of
polymerase chain reaction (PCR) products in real-time. As opposed
to standard PCR in which amplification products are quantitated
after the PCR is completed, products in real-time quantitative PCR
are quantitated as they accumulate. This is accomplished by
including in the PCR reaction an oligonucleotide probe that anneals
specifically between the forward and reverse PCR primers, and
contains two fluorescent dyes. A reporter dye (e.g., FAM or JOE,
obtained from either PE-Applied Biosystems, Foster City, Calif.,
Operon Technologies Inc., Alameda, Calif. or Integrated DNA
Technologies Inc., Coralville, Iowa) is attached to the 5' end of
the probe and a quencher dye (e.g., TAMRA, obtained from either
PE-Applied Biosystems, Foster City, Calif., Operon Technologies
Inc., Alameda, Calif. or Integrated DNA Technologies Inc.,
Coralville, Iowa) is attached to the 3' end of the probe. When the
probe and dyes are intact, reporter dye emission is quenched by the
proximity of the 3' quencher dye. During amplification, annealing
of the probe to the target sequence creates a substrate that can be
cleaved by the 5'-exonuclease activity of Taq polymerase. During
the extension phase of the PCR amplification cycle, cleavage of the
probe by Taq polymerase releases the reporter dye from the
remainder of the probe (and hence from the quencher moiety) and a
sequence-specific fluorescent signal is generated. With each cycle,
additional reporter dye molecules are cleaved from their respective
probes, and the fluorescence intensity is monitored at regular
intervals by laser optics built into the ABI PRISM.TM. Sequence
Detection System. In each assay, a series of parallel reactions
containing serial dilutions of mRNA from untreated control samples
generates a standard curve that is used to quantitate the percent
inhibition after antisense oligonucleotide treatment of test
samples.
[0180] Prior to quantitative PCR analysis, primer-probe sets
specific to the target gene being measured are evaluated for their
ability to be "multiplexed" with a GAPDH amplification reaction. In
multiplexing, both the target gene and the internal standard gene
GAPDH are amplified concurrently in a single sample. In this
analysis, mRNA isolated from untreated cells is serially diluted.
Each dilution is amplified in the presence of primer-probe sets
specific for GAPDH only, target gene only ("single-plexing"), or
both (multiplexing). Following PCR amplification, standard curves
of GAPDH and target mRNA signal as a function of dilution are
generated from both the single-plexed and multiplexed samples. If
both the slope and correlation coefficient of the GAPDH and target
signals generated from the multiplexed samples fall within 10% of
their corresponding values generated from the single-plexed
samples, the primer-probe set specific for that target is deemed
multiplexable. Other methods of PCR are also known in the art.
[0181] PCR reagents were obtained from Invitrogen Corporation,
(Carlsbad, Calif.). RT-PCR reactions were carried out by adding 20
.mu.L PCR cocktail (2.5.times.PCR buffer minus MgCl.sub.2, 6.6 mM
MgCl.sub.2, 375 .mu.M each of dATP, dCTP, dCTP and dGTP, 375 nM
each of forward primer and reverse primer, 125 nM of probe, 4 Units
RNAse inhibitor, 1.25 Units of PLATINUM.RTM. Taq reagent, 5 Units
MuLV reverse transcriptase, and 2.5.times.ROX dye) to 96-well
plates containing 30 .mu.L total RNA solution (20-200 ng). The RT
reaction was carried out by incubation for 30 minutes at 48.degree.
C.
[0182] Following a 10 minute incubation at 95.degree. C. to
activate the PLATINUM.RTM. Taq reagent, 40 cycles of a two-step PCR
protocol were carried out: 95.degree. C. for 15 seconds
(denaturation) followed by 60.degree. C. for 1.5 minutes
(annealing/extension).
[0183] Gene target quantities obtained by real time RT-PCR are
normalized using either the expression level of GAPDH, a gene whose
expression is constant, or by quantifying total RNA using
RiboGreen.TM. reagent (Molecular Probes, Inc. Eugene, Oreg.). GAPDH
expression is quantified by real time RT-PCR, by being run
simultaneously with the target, multiplexing, or separately. Total
RNA is quantified using RiboGreen.TM. RNA quantification reagent
(Molecular Probes, Inc. Eugene, Oreg.). Methods of RNA
quantification by RiboGreen.TM. reagent are taught in Jones, L. J.,
et al, (Analytical Biochemistry, 1998, 265, 368-374).
[0184] In this assay, 170 .mu.L of RiboGreen.TM. working reagent
(RiboGreen.TM. reagent diluted 1:350 in 10 mM Tris-HCl, 1 mM EDTA,
pH 7.5) is pipetted into a 96-well plate containing 30 pit
purified, cellular RNA. The plate is read in a CytoFluor.TM. 4000
apparatus (PE Applied Biosystems) with excitation at 485 nm and
emission at 530 nm.
[0185] Probes and primers to human apolipoprotein(a) were designed
to hybridize to a human apolipoprotein(a) sequence, using published
sequence information (GenBank accession number NM.sub.--005577.1,
incorporated herein as SEQ ID NO: 4). For human apolipoprotein(a)
the PCR primers were:
forward primer: CAGCTCCTTATTGTTATACGAGGGA (SEQ ID NO: 5) reverse
primer: TGCGTCTGAGCATTGCGT (SEQ ID NO: 6) and the PCR probe was:
FAM-CCCGGTGTCAGGTGGGAGTACTGC-TAMRA (SEQ ID NO: 7) where FAM is the
fluorescent dye and TAMRA is the quencher dye. For human GAPDH the
PCR primers were: forward primer: GAAGGTGAAGGTCGGAGTC(SEQ ID NO: 8)
reverse primer: GAAGATGGTGATGGGATTTC (SEQ ID NO: 9) and the PCR
probe was: 5' JOE-CAAGCTTCCCGTTCTCAGCC-TAMRA 3' (SEQ ID NO: 10)
where JOE is the fluorescent reporter dye and TAMRA is the quencher
dye.
Example 14
[0186] Northern Blot Analysis of Apolipoprotein(a) mRNA Levels
[0187] Eighteen hours after antisense treatment, cell monolayers
were washed twice with cold PBS and lysed in 1 mL RNAZOL.TM.
reagent(TEL-TEST "B" Inc., Friendswood, Tex.). Total RNA was
prepared following manufacturer's recommended protocols. Twenty
micrograms of total RNA was fractionated by electrophoresis through
1.2% agarose gels containing 1.1% formaldehyde using a MOPS buffer
system (AMRESCO, Inc. Solon, Ohio). RNA was transferred from the
gel to HYBOND.TM.-N+ nylon membranes (Amersham Pharmacia Biotech,
Piscataway, N.J.) by overnight capillary transfer using a
Northern/Southern Transfer buffer system (TEL-TEST "B" Inc.,
Friendswood, Tex.). RNA transfer was confirmed by UV visualization.
Membranes were fixed by UV cross-linking using a STRATALINKER.TM.
UV Crosslinker 2400 apparatus (Stratagene, Inc, La Jolla, Calif.)
and then probed using QUICKHYB.TM. hybridization solution
(Stratagene, La Jolla, Calif.) using manufacturer's recommendations
for stringent conditions.
[0188] To detect human apolipoprotein(a), a human apolipoprotein(a)
specific probe was prepared by PCR using the forward primer
CAGCTCCTTATTGTTATACGAGGGA (SEQ ID NO: 5) and the reverse primer
TGCGTCTGAGCATTGCGT (SEQ ID NO: 6). To normalize for variations in
loading and transfer efficiency membranes were stripped and probed
for human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA
(Clontech, Palo Alto, Calif.).
[0189] Hybridized membranes were visualized and quantitated using a
PHOSPHORIMAGER.TM. apparatus and IMAGEQUANT.TM. Software V3.3
(Molecular Dynamics, Sunnyvale, Calif.). Data was normalized to
GAPDH levels in untreated controls.
Example 15
Antisense Inhibition of Human Apolipoprotein(a) Expression by
Chimeric Phosphorothioate Oligonucleotides Having 2'-MOE Wings and
a Deoxy Gap
[0190] In accordance with the present invention, a series of
antisense compounds was designed to target different regions of the
human apolipoprotein(a) RNA, using published sequences (GenBank
accession number NM.sub.--005577.1, incorporated herein as SEQ ID
NO: 4). The compounds are shown in Table 1. "Target site" indicates
the first (5'-most) nucleotide number on the particular target
sequence to which the compound binds. All compounds in Table 1 are
chimeric oligonucleotides ("gapmers") 20 nucleotides in length,
composed of a central "gap" region consisting of ten
2'-deoxynucleotides, which is flanked on both sides (5' and 3'
directions) by five-nucleotide "wings". The wings are composed of
2'-methoxyethyl (2'-MOE) nucleotides. The internucleoside
(backbone) linkages are phosphorothioate (P.dbd.S) throughout the
oligonucleotide. All cytidine residues are 5-methylcytidines.
[0191] Apolipoprotein(a) is found in humans, nonhuman primates and
the European hedgehog, but not in common laboratory animals such as
rats and mice. Transgenic mice which express human
apolipoprotein(a) have been engineered (Chiesa et al., J. Biol.
Chem., 1992, 267, 24369-24374). The use of primary hepatocytes
prepared from human apolipoprotein(a) transgenic mice circumvents
the issue of variability when testing antisense oligonucleotide
activity in primary human hepatocytes. Accordingly, primary mouse
hepatocytes prepared from the human apolipoprotein(a) transgenic
mice were used to investigate the effects of antisense
oligonucleotides on human apolipoprotein(a) expression. The human
apolipoprotein(a) transgenic mice were obtained from Dr. Robert
Pitas and Dr. Matthias Schneider in the Gladstone Institute at the
University of California, San Francisco. Primary hepatocytes were
isolated from these mice and were cultured in DMEM, high glucose
(Invitrogen Corporation, Carlsbad, Calif.) supplemented with 10%
fetal bovine serum, (Invitrogen Corporation, Carlsbad, Calif.), 100
units per mL penicillin/100 .mu.g/mL streptomycin (Invitrogen
Corporation, Carlsbad, Calif.). For treatment with oligonucleotide,
cells were washed once with serum-free DMEM and subsequently
transfected with a dose of 150 nM of antisense oligonucleotide
using LIPOFECTIN reagent (Invitrogen Corporation, Carlsbad, Calif.)
as described in other examples herein. The compounds were analyzed
for their effect on human apolipoprotein(a) mRNA levels by
quantitative real-time PCR as described in other examples herein.
Gene target quantities obtained by real time RT-PCR were normalized
using mouse GAPDH. For mouse GAPDH the PCR primers were:
forward primer: GGCAAATTCAACGGCACAGT(SEQ ID NO: 71) reverse primer:
GGGTCTCGCTCCTGGAAGAT(SEQ ID NO: 72) and the PCR probe was: 5'
JOE-AAGGCCGAGAATGGGAAGCTTGTCATC-- TAMRA 3' (SEQ ID NO: 73) where
JOE is the fluorescent reporter dye and TAMRA is the quencher
dye.
[0192] Data are averages from three experiments in which primary
transgenic mouse hepatocytes were treated with the antisense
oligonucleotides of the present invention.
TABLE-US-00001 TABLE 1 Inhibition of human apolipoprotein(a) mRNA
levels by chimeric phosphorothioate oligonucleotides having 2'-MOE
wings and a deoxy gap TARGET SEQ SEQ ID TARGET % ID ISIS # REGION
NO SITE SEQUENCE INHIB NO 144367 Coding 4 174 ggcaggtccttcctgtgaca
53 11 144368 Coding 4 352 tctgcgtctgagcattgcgt 87 12 144369 Coding
4 522 aagcttggcaggttcttcct 0 13 144370 Coding 4 1743
tcggaggcgcgacggcagtc 40 14 144371 Coding 4 2768
cggaggcgcgacggcagtcc 0 15 144372 Coding 4 2910 ggcaggttcttcctgtgaca
65 16 144373 Coding 4 3371 ataacaataaggagctgcca 50 17 144374 Coding
4 4972 gaccaagcttggcaggttct 62 18 144375 Coding 4 5080
taacaataaggagctgccac 36 19 144376 Coding 4 5315
tgaccaagcttggcaggttc 25 20 144377 Coding 4 5825
ttctgcgtctgagcattgcg 38 21 144378 Coding 4 6447
aacaataaggagctgccaca 29 22 144379 Coding 4 7155
acctgacaccgggatccctc 79 23 144380 Coding 4 7185
ctgagcattgcgtcaggttg 16 24 144381 Coding 4 8463
agtagttcatgatcaagcca 71 25 144382 Coding 4 8915
gacggcagtcccttctgcgt 34 26 144383 Coding 4 9066
ggcaggttcttccagtgaca 5 27 144384 Coding 4 10787
tgaccaagcttggcaagttc 31 28 144385 Coding 4 11238
tataacaccaaggactaatc 9 29 144386 Coding 4 11261
ccatctgacattgggatcca 66 30 144387 Coding 4 11461
tgtggtgtcatagaggacca 36 31 144388 Coding 4 11823
atgggatcctccgatgccaa 55 32 144389 Coding 4 11894
acaccaagggcgaatctcag 58 33 144390 Coding 4 11957
ttctgtcactggacatcgtg 59 34 144391 Coding 4 12255
cacacggatcggttgtgtaa 58 35 144392 Coding 4 12461
acatgtccttcctgtgacag 51 36 144393 Coding 4 12699
cagaaggaggccctaggctt 33 37 144394 Coding 4 13354
ctggcggtgaccatgtagtc 52 38 144395 3'UTR 4 13711
tctaagtaggttgatgcttc 68 39 144396 3'UTR 4 13731
tccttacccacgtttcagct 70 40 144397 3'UTR 4 13780
ggaacagtgtcttcgtttga 63 41 144398 3'UTR 4 13801
gtttggcatagctggtagct 44 42 144399 3'UTR 4 13841
accttaaaagcttatacaca 57 43 144400 3'UTR 4 13861
atacagaatttgtcagtcag 21 44 144401 3'UTR 4 13881
gtcatagctatgacacctta 46 45
[0193] As shown in Table 1, SEQ ID NOs 11, 12, 14, 16, 17, 18, 19,
21, 23, 25, 30, 31, 32, 33, 34, 35, 36, 38, 39, 40, 41, 42, 43 and
45 demonstrated at least 35% inhibition of human apolipoprotein(a)
expression in this assay and are therefore preferred. More
preferred are SEQ ID NOs 23, 12 and 40. The target regions to which
these preferred sequences are complementary are herein referred to
as "preferred target segments" and are therefore preferred for
targeting by compounds of the present invention. These preferred
target segments are shown in Table 2. These sequences are shown to
contain thymine (T) but one of skill in the art will appreciate
that thymine (T) is generally replaced by uracil (U) in RNA
sequences. The sequences represent the reverse complement of the
preferred antisense compounds shown in Table 1. "Target site"
indicates the first (5'-most) nucleotide number on the particular
target nucleic acid to which the oligonucleotide binds. Also shown
in Table 2 is the species in which each of the preferred target
segments was found.
TABLE-US-00002 TABLE 2 Sequence and position of preferred target
segments identified in apolipoprotein(a). TARGET REV SITE SEQ
TARGET COMP OF SEQ ID ID NO SITE SEQUENCE SEQ ID ACTIVE IN ID NO
57364 4 174 tgtcacaggaaggacctgcc 11 H. sapiens 46 57365 4 352
acgcaatgctcagacgcaga 12 H. sapiens 47 57367 4 1743
gactgccgtcgcgcctccga 14 H. sapiens 48 57369 4 2910
tgtcacaggaagaacctgcc 16 H. sapiens 49 57370 4 3371
tggcagctccttattgttat 17 H. sapiens 50 57371 4 4972
agaacctgccaagcttggtc 18 H. sapiens 51 57372 4 5080
gtggcagctccttattgtta 19 H. sapiens 52 57374 4 5825
cgcaatgctcagacgcagaa 21 H. sapiens 53 57376 4 7155
gagggatcccggtgtcaggt 23 H. sapiens 54 57378 4 8463
tggcttgatcatgaactact 25 H. sapiens 55 57383 4 11261
tggatcccaatgtcagatgg 30 H. sapiens 56 57384 4 11461
tggtcctctatgacaccaca 31 H. sapiens 57 57385 4 11823
ttggcatcggaggatcccat 32 H. sapiens 58 57386 4 11894
ctgagattcgcccttggtgt 33 H. sapiens 59 57387 4 11957
cacgatgtccagtgacagaa 34 H. sapiens 60 57388 4 12255
ttacacaaccgatccgtgtg 35 H. sapiens 61 57389 4 12461
ctgtcacaggaaggacatgt 36 H. sapiens 62 57391 4 13354
gactacatggtcaccgccag 38 H. sapiens 63 57392 4 13711
gaagcatcaacctacttaga 39 H. sapiens 64 57393 4 13731
agctgaaacgtgggtaagga 40 H. sapiens 65 57394 4 13780
tcaaacgaagacactgttcc 41 H. sapiens 66 57395 4 13801
agctaccagctatgccaaac 42 H. sapiens 67 57396 4 13841
tgtgtataagcttttaaggt 43 H. sapiens 68 57398 4 13881
taaggtgtcatagctatgac 45 H. sapiens 69
[0194] As these "preferred target segments" have been found by
experimentation to be open to, and accessible for, hybridization
with the antisense compounds of the present invention, one of skill
in the art will recognize or be able to ascertain, using no more
than routine experimentation, further embodiments of the invention
that encompass other compounds that specifically hybridize to these
preferred target segments and consequently inhibit the expression
of apolipoprotein(a).
[0195] According to the present invention, antisense compounds
include antisense oligomeric compounds, antisense oligonucleotides,
external guide sequence (EGS) oligonucleotides, alternate splicers,
primers, probes, and other short oligomeric compounds that
hybridize to at least a portion of the target nucleic acid.
Example 16
Western Blot Analysis of Apolipoprotein(a) Protein Levels
[0196] Western blot analysis (immunoblot analysis) is carried out
using standard methods. Cells are harvested 16-20 h after
oligonucleotide treatment, washed once with PBS, suspended in
Laemmli buffer (100 .mu.l/well), boiled for 5 minutes and loaded on
a 16% SDS-PAGE gel. Gels are run for 1.5 hours at 150 V, and
transferred to membrane for western blotting. Appropriate primary
antibody directed to apolipoprotein(a) is used, with a radiolabeled
or fluorescently labeled secondary antibody directed against the
primary antibody species. Bands are visualized using a
PHOSPHORIMAGER.TM. apparatus (Molecular Dynamics, Sunnyvale
Calif.).
Example 17
Antisense Inhibition of Human Apolipoprotein(a) in Transgenic
Primary Mouse Hepatocytes: Dose Response
[0197] In accordance with the present invention, antisense
oligonucleotides identified as having good activity based on the
results in Example 15 were further investigated in dose-response
studies. Primary hepatocytes from human apolipoprotein(a)
transgenic mice were treated with 10, 50, 150 or 300 nM of ISIS
144396 (SEQ ID NO: 40), ISIS 144368 (SEQ ID NO: 12), ISIS 144379
(SEQ ID NO: 23) or ISIS 113529 (CTCTTACTGTGCTGTGGACA, SEQ ID NO:
70). ISIS 113529 was used as a scrambled control oligonucleotide
and is a chimeric oligonucleotides ("gapmers") 20 nucleotides in
length, composed of a central "gap" region consisting of ten
2'-deoxynucleotides, which is flanked on both sides (5' and 3'
directions) by five-nucleotide "wings". The wings are composed of
2'-methoxyethyl (2'-MOE)nucleotides. The internucleoside (backbone)
linkages are phosphorothioate (P.dbd.S) throughout the
oligonucleotide. All cytidine residues are 5-methylcytidines.
[0198] Following 24 hours of exposure to antisense
oligonucleotides, target mRNA expression levels were evaluated by
quantitative real-time PCR as described in other examples herein.
The results are the average of 4 experiments for apolipoprotein(a)
antisense oligonucleotides and the average of 12 experiments for
the control oligonucleotide. The data are expressed as percent
inhibition of apolipoprotein(a) expression relative to untreated
controls and are shown in Table 3.
TABLE-US-00003 TABLE 3 Antisense inhibition of human
apolipoprotein(a) in transgenic primary mouse hepatocytes: dose
response % Inhibition of transgenic human lipoprotein(a) ISIS #
Oligonucleotide dose 144396 144368 144379 113529 10 nM 0 11 55 N.D.
50 nM 0 26 73 N.D. 150 nM 0 58 85 N.D. 300 nM 9 62 89 0
[0199] These data demonstrate that the oligonucleotides of the
present invention are able to inhibit the expression of human
apolipoprotein(a) in a dose-dependent fashion.
Example 18
Oil Red O Stain:
[0200] Hepatic steatosis, or clearing of lipids from the liver, is
assessed by routine histological analysis of frozen liver tissue
sections stained with oil red 0 stain, which is commonly used to
visualize lipid deposits, and counterstained with hematoxylin and
eosin, to visualize nuclei and cytoplasm, respectively.
Example 19
Animal Models
[0201] In addition to human systems, which express apolipoprotein
(a), biological systems of other mammals are also available for
studies of expression products of the LPA gene as well as for
studies of the Lp(a) particles and their role in physiologic
processes.
[0202] Transgenic mice which express human apolipoprotein(a) have
been engineered (Chiesa et al., J. Biol. Chem., 1992, 267,
24369-24374) and are used as an animal model for the investigation
of the in vivo activity of the oligonucleotides of this invention.
Although transgenic mice expressing human apolipoprotein(a) exist,
they fail to assemble Lp(a) particles because of the inability of
human apolipoprotein(a) to associate with mouse apolipoprotein B.
When mice expressing human apolipoprotein(a) are bred to mice
expressing human apolipoprotein B, the Lp(a) particle is
efficiently assembled (Callow et al., Proc. Natl. Acad. Sci. USA,
1994, 91, 2130-2134). Accordingly mice expressing both human
apolipoprotein(a) and human apolipoprotein B transgenes are used
for animal model studies in which the secretion of the Lp(a)
particle is evaluated.
[0203] Where additional genetic alterations are necessary, mice
with either a single human transgene (human apolipoprotein(a) or
human apolipoprotein B) or both human transgenes (human
apolipoprotein(a) and human apolipoprotein B) are bred to mice with
a desired genetic mutation. The offspring with the desired
combination of transgene(s) and genetic mutation(s) is selected for
use as an animal model. In one nonlimiting example, mice expressing
both human apolipoprotein(a) and human apolipoprotein B are bred to
mice with a mutation in the leptin gene, yielding offspring
producing human Lp(a) particles in an ob/ob model of obesity and
diabetes.
ob/ob Mice
[0204] Leptin is a hormone produced by fat that regulates appetite.
Deficiencies in this hormone in both humans and non-human animals
leads to obesity. ob/ob mice have a mutation in the leptin gene
which results in obesity and hyperglycemia. As such, these mice are
a useful model for the investigation of obesity and treatments
designed to reduce obesity.
[0205] Seven-week old male C57Bl/6J-Lep ob/ob mice (Jackson
Laboratory, Bar Harbor, Me.) are fed a diet with a fat content of
10-15% and are subcutaneously injected with oligonucleotides of the
present invention or a control oligonucleotide at a dose of 5, 10
or 25 mg/kg two times per week for 4 weeks. Saline-injected animals
and leptin wildtype littermates (i.e. lean littermates) serve as
controls. After the treatment period, mice are sacrificed and
target levels are evaluated in liver, brown adipose tissue (BAT)
and white adipose tissue (WAT). RNA isolation and target mRNA
expression level quantitation are performed as described by other
examples herein.
[0206] To assess the physiological effects resulting from antisense
inhibition of target apolipoprotein(a) mRNA, the ob/ob mice that
receive antisense oligonucleotide treatment are further evaluated
at the end of the treatment period for serum lipids, serum
apolipoproteins, serum free fatty acids, serum cholesterol (CHOL),
liver triglycerides, and fat tissue triglycerides. Serum components
are measured on routine clinical diagnostic instruments. Tissue
triglycerides are extracted using an acetone extraction technique
known in the art, and subsequently measured by ELISA. The presence
of the Lp(a) particle in the serum is measured using a commercially
available ELISA kit (ALerCHEK Inc., Portland, Me.). Hepatic
steatosis, or clearing of lipids from the liver, is assessed by
measuring the liver triglyceride content. Hepatic steatosis is also
assessed by routine histological analysis of frozen liver tissue
sections stained with oil red 0 stain, which is commonly used to
visualize lipid deposits, and counterstained with hematoxylin and
eosin, to visualize nuclei and cytoplasm, respectively.
[0207] The effects of apolipoprotein(a) inhibition on glucose and
insulin metabolism are also evaluated in the ob/ob mice treated
with antisense oligonucleotides of this invention. Plasma glucose
is measured at the start of the antisense oligonucleotide treatment
and after 2 weeks and 4 weeks of treatment. Plasma insulin is
similarly at the beginning to of the treatment, and following 2
weeks and 4 weeks of treatment. Glucose and insulin tolerance tests
are also administered in fed and fasted mice. Mice receive
intraperitoneal injections of either glucose or insulin, and the
blood glucose and insulin levels are measured before the insulin or
glucose challenge and at 15, 20 or 30 minute intervals for up to 3
hours.
[0208] To assess the metabolic rate of ob/ob mice treated with
antisense oligonucleotides of this invention, the respiratory
quotient and oxygen consumption of the mice are also measured.
[0209] The ob/ob mice that received antisense oligonucleotide
treatment are further evaluated at the end of the treatment period
for the effects of apolipoprotein(a) inhibition on the expression
of genes that participate in lipid metabolism, cholesoterol
biosynthesis, fatty acid oxidation, fatty acid storage,
gluconeogenesis and glucose metabolism. These genes include, but
are not limited to, HMG-CoA reductase, acetyl-CoA carboxylase 1 and
acetyl-CoA carboxylase 2, carnitine palmitoyltransferase I and
glycogen phosphorylase, glucose-6-phosphatase and
phosphoenolpyruvate carboxykinase 1, lipoprotein lipase and hormone
sensitive lipase. mRNA levels in liver and white and brown adipose
tissue are quantitated by real-time PCR as described in other
examples herein, employing primer-probe sets that were generated
using published sequences of each gene of interest.
db/db Mice
[0210] A deficiency in the leptin hormone receptor mice also
results in obesity and hyperglycemia. These mice are referred to as
db/db mice and, like the ob/ob mice, are used as a mouse model of
obesity.
[0211] Seven-week old male C57Bl/6J-Lepr db/db mice (Jackson
Laboratory, Bar Harbor, Me.) are fed a diet with a fat content of
15-20% and are subcutaneously injected with oligonucleotides of
this invention or a control oligonucleotide at a dose of 5, 10 or
25 mg/kg two times per week for 4 weeks. Saline-injected animals
and leptin receptor wildtype littermates (i.e. lean littermates)
serve as controls. After the treatment period, mice are sacrificed
and apolipoprotein(a) levels are evaluated in liver, brown adipose
tissue (BAT) and white adipose tissue (WAT). RNA isolation and
apolipoprotein(a) mRNA expression level quantitation are performed
as described by other examples herein.
[0212] After the treatment period, mice are sacrificed and
apolipoprotein(a) levels are evaluated in liver, brown adipose
tissue (BAT) and white adipose tissue (WAT). RNA isolation and
apolipoprotein(a) mRNA expression level quantitation are performed
as described by other examples herein.
[0213] To assess the physiological effects resulting from antisense
inhibition of apolipoprotein(a) mRNA, the db/db mice that receive
antisense oligonucleotide treatment are further evaluated at the
end of the treatment period for serum lipids, serum apolipoproeins,
serum free fatty acids, serum cholesterol (CHOL), liver
triglycerides, and fat tissue triglycerides. Serum components are
measured on routine clinical diagnostic instruments. Tissue
triglycerides are extracted using an acetone extraction technique
known in the art, and subsequently measured by ELISA. The presence
of the Lp(a) particle in the serum is measured using a commercially
available ELISA kit (ALerCHEK Inc., Portland, Me.). Hepatic
steatosis, or clearing of lipids from the liver, are assessed by
measuring the liver triglyceride content. Hepatic steatosis is also
assessed by routine histological analysis of frozen liver tissue
sections stained with oil red 0 stain, which is commonly used to
visualize lipid deposits, and counterstained with hematoxylin and
eosin, to visualize nuclei and cytoplasm, respectively.
[0214] The effects of apolipoprotein(a) inhibition on glucose and
insulin metabolism are also evaluated in the db/db mice treated
with antisense oligonucleotides. Plasma glucose is measured at the
start of the antisense oligonucleotide treatment and after 2 weeks
and 4 weeks of treatment. Plasma insulin is similarly at the
beginning to of the treatment, and following 2 weeks and 4 weeks of
treatment. Glucose and insulin tolerance tests are also
administered in fed and fasted mice. Mice receive intraperitoneal
injections of either glucose or insulin, and the blood glucose
levels are measured before the insulin or glucose challenge and 15,
30, 60, 90 and 120 minutes following the injection.
[0215] To assess the metabolic rate of db/db mice treated with
antisense oligonucleotides, the respiratory quotient and oxygen
consumption of the mice are also measured.
[0216] The db/db mice that received antisense oligonucleotide
treatment are further evaluated at the end of the treatment period
for the effects of apolipoprotein(a) inhibition on the expression
of genes that participate in lipid metabolism, cholesoterol
biosynthesis, fatty acid oxidation, fatty acid storage,
gluconeogenesis and glucose metabolism. These genes include, but
are not limited to, HMG-CoA reductase, acetyl-CoA carboxylase 1 and
acetyl-CoA carboxylase 2, carnitine palmitoyltransferase I and
glycogen phosphorylase, glucose-6-phosphatase and
phosphoenolpyruvate carboxykinase 1, lipoprotein lipase and hormone
sensitive lipase. mRNA levels in liver and white and brown adipose
tissue are quantitated by real-time PCR as described in other
examples herein, employing primer-probe sets that were generated
using published sequences of each gene of interest.
Lean Mice
[0217] C57Bl/6 mice are maintained on a standard rodent diet and
are used as control (lean) animals. Seven-week old male C57Bl/6
mice are fed a diet with a fat content of 4% and are subcutaneously
injected with oligonucleotides of this invention or control
oligonucleotide at a dose of 5, 10 or 25 mg/kg two times per week
for 4 weeks. Saline-injected animals serve as a control. After the
treatment period, mice are sacrificed and apolipoprotein(a) levels
are evaluated in liver, brown adipose tissue (BAT) and white
adipose tissue (WAT). RNA isolation and apolipoprotein(a) mRNA
expression level quantitation are performed as described by other
examples herein.
[0218] To assess the physiological effects resulting from antisense
inhibition of apolipoprotein(a) mRNA, the lean mice that receive
antisense oligonucleotide treatment are further evaluated at the
end of the treatment period for serum lipids, serum free fatty
acids, serum cholesterol (CHOL), liver triglycerides, and fat
tissue triglycerides. Serum components are measured on routine
clinical diagnostic instruments. Tissue triglycerides are extracted
using an acetone extraction technique known in the art, and
subsequently measured by ELISA. The presence of the Lp(a) particle
in the serum is measured using a commercially available ELISA kit
(ALerCHEK Inc., Portland, Me.). Hepatic steatosis, i.e., clearing
of lipids from the liver, is assessed by measuring the liver
triglyceride content. Hepatic steatosis is also assessed by routine
histological analysis of frozen liver tissue sections stained with
oil red 0 stain, which is commonly used to visualize lipid
deposits, and counterstained with hematoxylin and eosin, to
visualize nuclei and cytoplasm, respectively.
[0219] The effects of apolipoprotein(a) inhibition on glucose and
insulin metabolism are also evaluated in the lean mice treated with
antisense oligonucleotides of this invention. Plasma glucose is
measured at the start of the antisense oligonucleotide treatment
and after 2 weeks and 4 weeks of treatment. Plasma insulin is
similarly at the beginning to of the treatment, and following 2
weeks and 4 weeks of treatment. Glucose and insulin tolerance tests
are also administered in fed and fasted mice. Mice receive
intraperitoneal injections of either glucose or insulin, and the
blood glucose levels are measured before the insulin or glucose
challenge and 15, 30, 60, 90 and 120 minutes following the
injection.
[0220] To assess the metabolic rate of lean mice treated with
antisense oligonucleotides of this invention, the respiratory
quotient and oxygen consumption of the mice can also be
measured.
[0221] The lean mice that received antisense oligonucleotide
treatment are further evaluated at the end of the treatment period
for the effects of apolipoprotein(a) inhibition on the expression
of genes that participate in lipid metabolism, cholesoterol
biosynthesis, fatty acid oxidation, fatty acid storage,
gluconeogenesis and glucose metabolism. These genes include, but
are not limited to, HMG-CoA reductase, acetyl-CoA carboxylase 1 and
acetyl-CoA carboxylase 2, carnitine palmitoyltransferase 1 and
glycogen phosphorylase, glucose-6-phosphatase and
phosphoenolpyruvate carboxykinase 1, lipoprotein lipase and hormone
sensitive lipase. mRNA levels in liver and white and brown adipose
tissue are quantitated by real-time PCR as described in other
examples herein, employing primer-probe sets that were generated
using published sequences of each gene of interest.
Sequence CWU 1
1
73120DNAArtificial SequenceAntisense Oligonucleotide 1tccgtcatcg
ctcctcaggg 20220DNAArtificial SequenceAntisense Oligonucleotide
2gtgcgcgcga gcccgaaatc 20320DNAArtificial SequenceAntisense
Oligonucleotide 3atgcattctg cccccaagga 20413938DNAHomo
sapiensCDS(46)...(13692) 4ctgggattgg gacacacttt ctggacactg
ctggccagtc ccaaa atg gaa cat aag 57 Met Glu His Lys 1gaa gtg gtt
ctt cta ctt ctt tta ttt ctg aaa tca gca gca cct gag 105Glu Val Val
Leu Leu Leu Leu Leu Phe Leu Lys Ser Ala Ala Pro Glu5 10 15 20caa
agc cat gtg gtc cag gat tgc tac cat ggt gat gga cag agt tat 153Gln
Ser His Val Val Gln Asp Cys Tyr His Gly Asp Gly Gln Ser Tyr 25 30
35cga ggc acg tac tcc acc act gtc aca gga agg acc tgc caa gct tgg
201Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ala Trp
40 45 50tca tct atg aca cca cat caa cat aat agg acc aca gaa aac tac
cca 249Ser Ser Met Thr Pro His Gln His Asn Arg Thr Thr Glu Asn Tyr
Pro 55 60 65aat gct ggc ttg atc atg aac tac tgc agg aat cca gat gct
gtg gca 297Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg Asn Pro Asp Ala
Val Ala 70 75 80gct cct tat tgt tat acg agg gat ccc ggt gtc agg tgg
gag tac tgc 345Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Gly Val Arg Trp
Glu Tyr Cys85 90 95 100aac ctg acg caa tgc tca gac gca gaa ggg act
gcc gtc gcg cct ccg 393Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly Thr
Ala Val Ala Pro Pro 105 110 115act gtt acc ccg gtt cca agc cta gag
gct cct tcc gaa caa gca ccg 441Thr Val Thr Pro Val Pro Ser Leu Glu
Ala Pro Ser Glu Gln Ala Pro 120 125 130act gag caa agg cct ggg gtg
cag gag tgc tac cat ggt aat gga cag 489Thr Glu Gln Arg Pro Gly Val
Gln Glu Cys Tyr His Gly Asn Gly Gln 135 140 145agt tat cga ggc aca
tac tcc acc act gtc aca gga aga acc tgc caa 537Ser Tyr Arg Gly Thr
Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln 150 155 160gct tgg tca
tct atg aca cca cac tcg cat agt cgg acc cca gaa tac 585Ala Trp Ser
Ser Met Thr Pro His Ser His Ser Arg Thr Pro Glu Tyr165 170 175
180tac cca aat gct ggc ttg atc atg aac tac tgc agg aat cca gat gct
633Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg Asn Pro Asp Ala
185 190 195gtg gca gct cct tat tgt tat acg agg gat ccc ggt gtc agg
tgg gag 681Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Gly Val Arg
Trp Glu 200 205 210tac tgc aac ctg acg caa tgc tca gac gca gaa ggg
act gcc gtc gcg 729Tyr Cys Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly
Thr Ala Val Ala 215 220 225cct ccg act gtt acc ccg gtt cca agc cta
gag gct cct tcc gaa caa 777Pro Pro Thr Val Thr Pro Val Pro Ser Leu
Glu Ala Pro Ser Glu Gln 230 235 240gca ccg act gag caa agg cct ggg
gtg cag gag tgc tac cat ggt aat 825Ala Pro Thr Glu Gln Arg Pro Gly
Val Gln Glu Cys Tyr His Gly Asn245 250 255 260gga cag agt tat cga
ggc aca tac tcc acc act gtc aca gga aga acc 873Gly Gln Ser Tyr Arg
Gly Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr 265 270 275tgc caa gct
tgg tca tct atg aca cca cac tcg cat agt cgg acc cca 921Cys Gln Ala
Trp Ser Ser Met Thr Pro His Ser His Ser Arg Thr Pro 280 285 290gaa
tac tac cca aat gct ggc ttg atc atg aac tac tgc agg aat cca 969Glu
Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg Asn Pro 295 300
305gat gct gtg gca gct cct tat tgt tat acg agg gat ccc ggt gtc agg
1017Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Gly Val Arg
310 315 320tgg gag tac tgc aac ctg acg caa tgc tca gac gca gaa ggg
act gcc 1065Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly
Thr Ala325 330 335 340gtc gcg cct ccg act gtt acc ccg gtt cca agc
cta gag gct cct tcc 1113Val Ala Pro Pro Thr Val Thr Pro Val Pro Ser
Leu Glu Ala Pro Ser 345 350 355gaa caa gca ccg act gag caa agg cct
ggg gtg cag gag tgc tac cat 1161Glu Gln Ala Pro Thr Glu Gln Arg Pro
Gly Val Gln Glu Cys Tyr His 360 365 370ggt aat gga cag agt tat cga
ggc aca tac tcc acc act gtc aca gga 1209Gly Asn Gly Gln Ser Tyr Arg
Gly Thr Tyr Ser Thr Thr Val Thr Gly 375 380 385aga acc tgc caa gct
tgg tca tct atg aca cca cac tcg cat agt cgg 1257Arg Thr Cys Gln Ala
Trp Ser Ser Met Thr Pro His Ser His Ser Arg 390 395 400acc cca gaa
tac tac cca aat gct ggc ttg atc atg aac tac tgc agg 1305Thr Pro Glu
Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg405 410 415
420aat cca gat gct gtg gca gct cct tat tgt tat acg agg gat ccc ggt
1353Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Gly
425 430 435gtc agg tgg gag tac tgc aac ctg acg caa tgc tca gac gca
gaa ggg 1401Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser Asp Ala
Glu Gly 440 445 450act gcc gtc gcg cct ccg act gtt acc ccg gtt cca
agc cta gag gct 1449Thr Ala Val Ala Pro Pro Thr Val Thr Pro Val Pro
Ser Leu Glu Ala 455 460 465cct tcc gaa caa gca ccg act gag caa agg
cct ggg gtg cag gag tgc 1497Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg
Pro Gly Val Gln Glu Cys 470 475 480tac cat ggt aat gga cag agt tat
cga ggc aca tac tcc acc act gtc 1545Tyr His Gly Asn Gly Gln Ser Tyr
Arg Gly Thr Tyr Ser Thr Thr Val485 490 495 500aca gga aga acc tgc
caa gct tgg tca tct atg aca cca cac tcg cat 1593Thr Gly Arg Thr Cys
Gln Ala Trp Ser Ser Met Thr Pro His Ser His 505 510 515agt cgg acc
cca gaa tac tac cca aat gct ggc ttg atc atg aac tac 1641Ser Arg Thr
Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr 520 525 530tgc
agg aat cca gat gct gtg gca gct cct tat tgt tat acg agg gat 1689Cys
Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp 535 540
545ccc ggt gtc agg tgg gag tac tgc aac ctg acg caa tgc tca gac gca
1737Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser Asp Ala
550 555 560gaa ggg act gcc gtc gcg cct ccg act gtt acc ccg gtt cca
agc cta 1785Glu Gly Thr Ala Val Ala Pro Pro Thr Val Thr Pro Val Pro
Ser Leu565 570 575 580gag gct cct tcc gaa caa gca ccg act gag caa
agg cct ggg gtg cag 1833Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln
Arg Pro Gly Val Gln 585 590 595gag tgc tac cat ggt aat gga cag agt
tat cga ggc aca tac tcc acc 1881Glu Cys Tyr His Gly Asn Gly Gln Ser
Tyr Arg Gly Thr Tyr Ser Thr 600 605 610act gtc aca gga aga acc tgc
caa gct tgg tca tct atg aca cca cac 1929Thr Val Thr Gly Arg Thr Cys
Gln Ala Trp Ser Ser Met Thr Pro His 615 620 625tcg cat agt cgg acc
cca gaa tac tac cca aat gct ggc ttg atc atg 1977Ser His Ser Arg Thr
Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met 630 635 640aac tac tgc
agg aat cca gat gct gtg gca gct cct tat tgt tat acg 2025Asn Tyr Cys
Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr645 650 655
660agg gat ccc ggt gtc agg tgg gag tac tgc aac ctg acg caa tgc tca
2073Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser
665 670 675gac gca gaa ggg act gcc gtc gcg cct ccg act gtt acc ccg
gtt cca 2121Asp Ala Glu Gly Thr Ala Val Ala Pro Pro Thr Val Thr Pro
Val Pro 680 685 690agc cta gag gct cct tcc gaa caa gca ccg act gag
caa agg cct ggg 2169Ser Leu Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu
Gln Arg Pro Gly 695 700 705gtg cag gag tgc tac cat ggt aat gga cag
agt tat cga ggc aca tac 2217Val Gln Glu Cys Tyr His Gly Asn Gly Gln
Ser Tyr Arg Gly Thr Tyr 710 715 720tcc acc act gtc aca gga aga acc
tgc caa gct tgg tca tct atg aca 2265Ser Thr Thr Val Thr Gly Arg Thr
Cys Gln Ala Trp Ser Ser Met Thr725 730 735 740cca cac tcg cat agt
cgg acc cca gaa tac tac cca aat gct ggc ttg 2313Pro His Ser His Ser
Arg Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu 745 750 755atc atg aac
tac tgc agg aat cca gat gct gtg gca gct cct tat tgt 2361Ile Met Asn
Tyr Cys Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys 760 765 770tat
acg agg gat ccc ggt gtc agg tgg gag tac tgc aac ctg acg caa 2409Tyr
Thr Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln 775 780
785tgc tca gac gca gaa ggg act gcc gtc gcg cct ccg act gtt acc ccg
2457Cys Ser Asp Ala Glu Gly Thr Ala Val Ala Pro Pro Thr Val Thr Pro
790 795 800gtt cca agc cta gag gct cct tcc gaa caa gca ccg act gag
caa agg 2505Val Pro Ser Leu Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu
Gln Arg805 810 815 820cct ggg gtg cag gag tgc tac cat ggt aat gga
cag agt tat cga ggc 2553Pro Gly Val Gln Glu Cys Tyr His Gly Asn Gly
Gln Ser Tyr Arg Gly 825 830 835aca tac tcc acc act gtc aca gga aga
acc tgc caa gct tgg tca tct 2601Thr Tyr Ser Thr Thr Val Thr Gly Arg
Thr Cys Gln Ala Trp Ser Ser 840 845 850atg aca cca cac tcg cat agt
cgg acc cca gaa tac tac cca aat gct 2649Met Thr Pro His Ser His Ser
Arg Thr Pro Glu Tyr Tyr Pro Asn Ala 855 860 865ggc ttg atc atg aac
tac tgc agg aat cca gat gct gtg gca gct cct 2697Gly Leu Ile Met Asn
Tyr Cys Arg Asn Pro Asp Ala Val Ala Ala Pro 870 875 880tat tgt tat
acg agg gat ccc ggt gtc agg tgg gag tac tgc aac ctg 2745Tyr Cys Tyr
Thr Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu885 890 895
900acg caa tgc tca gac gca gaa ggg act gcc gtc gcg cct ccg act gtt
2793Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala Val Ala Pro Pro Thr Val
905 910 915acc ccg gtt cca agc cta gag gct cct tcc gaa caa gca ccg
act gag 2841Thr Pro Val Pro Ser Leu Glu Ala Pro Ser Glu Gln Ala Pro
Thr Glu 920 925 930caa agg cct ggg gtg cag gag tgc tac cat ggt aat
gga cag agt tat 2889Gln Arg Pro Gly Val Gln Glu Cys Tyr His Gly Asn
Gly Gln Ser Tyr 935 940 945cga ggc aca tac tcc acc act gtc aca gga
aga acc tgc caa gct tgg 2937Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly
Arg Thr Cys Gln Ala Trp 950 955 960tca tct atg aca cca cac tcg cat
agt cgg acc cca gaa tac tac cca 2985Ser Ser Met Thr Pro His Ser His
Ser Arg Thr Pro Glu Tyr Tyr Pro965 970 975 980aat gct ggc ttg atc
atg aac tac tgc agg aat cca gat gct gtg gca 3033Asn Ala Gly Leu Ile
Met Asn Tyr Cys Arg Asn Pro Asp Ala Val Ala 985 990 995gct cct tat
tgt tat acg agg gat ccc ggt gtc agg tgg gag tac tgc 3081Ala Pro Tyr
Cys Tyr Thr Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys 1000 1005
1010aac ctg acg caa tgc tca gac gca gaa ggg act gcc gtc gcg cct ccg
3129Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala Val Ala Pro Pro
1015 1020 1025act gtt acc ccg gtt cca agc cta gag gct cct tcc gaa
caa gca ccg 3177Thr Val Thr Pro Val Pro Ser Leu Glu Ala Pro Ser Glu
Gln Ala Pro 1030 1035 1040act gag caa agg cct ggg gtg cag gag tgc
tac cat ggt aat gga cag 3225Thr Glu Gln Arg Pro Gly Val Gln Glu Cys
Tyr His Gly Asn Gly Gln1045 1050 1055 1060agt tat cga ggc aca tac
tcc acc act gtc aca gga aga acc tgc caa 3273Ser Tyr Arg Gly Thr Tyr
Ser Thr Thr Val Thr Gly Arg Thr Cys Gln 1065 1070 1075gct tgg tca
tct atg aca cca cac tcg cat agt cgg acc cca gaa tac 3321Ala Trp Ser
Ser Met Thr Pro His Ser His Ser Arg Thr Pro Glu Tyr 1080 1085
1090tac cca aat gct ggc ttg atc atg aac tac tgc agg aat cca gat gct
3369Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg Asn Pro Asp Ala
1095 1100 1105gtg gca gct cct tat tgt tat acg agg gat ccc ggt gtc
agg tgg gag 3417Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Gly Val
Arg Trp Glu 1110 1115 1120tac tgc aac ctg acg caa tgc tca gac gca
gaa ggg act gcc gtc gcg 3465Tyr Cys Asn Leu Thr Gln Cys Ser Asp Ala
Glu Gly Thr Ala Val Ala1125 1130 1135 1140cct ccg act gtt acc ccg
gtt cca agc cta gag gct cct tcc gaa caa 3513Pro Pro Thr Val Thr Pro
Val Pro Ser Leu Glu Ala Pro Ser Glu Gln 1145 1150 1155gca ccg act
gag caa agg cct ggg gtg cag gag tgc tac cat ggt aat 3561Ala Pro Thr
Glu Gln Arg Pro Gly Val Gln Glu Cys Tyr His Gly Asn 1160 1165
1170gga cag agt tat cga ggc aca tac tcc acc act gtc aca gga aga acc
3609Gly Gln Ser Tyr Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr
1175 1180 1185tgc caa gct tgg tca tct atg aca cca cac tcg cat agt
cgg acc cca 3657Cys Gln Ala Trp Ser Ser Met Thr Pro His Ser His Ser
Arg Thr Pro 1190 1195 1200gaa tac tac cca aat gct ggc ttg atc atg
aac tac tgc agg aat cca 3705Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met
Asn Tyr Cys Arg Asn Pro1205 1210 1215 1220gat gct gtg gca gct cct
tat tgt tat acg agg gat ccc ggt gtc agg 3753Asp Ala Val Ala Ala Pro
Tyr Cys Tyr Thr Arg Asp Pro Gly Val Arg 1225 1230 1235tgg gag tac
tgc aac ctg acg caa tgc tca gac gca gaa ggg act gcc 3801Trp Glu Tyr
Cys Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala 1240 1245
1250gtc gcg cct ccg act gtt acc ccg gtt cca agc cta gag gct cct tcc
3849Val Ala Pro Pro Thr Val Thr Pro Val Pro Ser Leu Glu Ala Pro Ser
1255 1260 1265gaa caa gca ccg act gag caa agg cct ggg gtg cag gag
tgc tac cat 3897Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly Val Gln Glu
Cys Tyr His 1270 1275 1280ggt aat gga cag agt tat cga ggc aca tac
tcc acc act gtc aca gga 3945Gly Asn Gly Gln Ser Tyr Arg Gly Thr Tyr
Ser Thr Thr Val Thr Gly1285 1290 1295 1300aga acc tgc caa gct tgg
tca tct atg aca cca cac tcg cat agt cgg 3993Arg Thr Cys Gln Ala Trp
Ser Ser Met Thr Pro His Ser His Ser Arg 1305 1310 1315acc cca gaa
tac tac cca aat gct ggc ttg atc atg aac tac tgc agg 4041Thr Pro Glu
Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg 1320 1325
1330aat cca gat gct gtg gca gct cct tat tgt tat acg agg gat ccc ggt
4089Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Gly
1335 1340 1345gtc agg tgg gag tac tgc aac ctg acg caa tgc tca gac
gca gaa ggg 4137Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser Asp
Ala Glu Gly 1350 1355 1360act gcc gtc gcg cct ccg act gtt acc ccg
gtt cca agc cta gag gct 4185Thr Ala Val Ala Pro Pro Thr Val Thr Pro
Val Pro Ser Leu Glu Ala1365 1370 1375 1380cct tcc gaa caa gca ccg
act gag caa agg cct ggg gtg cag gag tgc 4233Pro Ser Glu Gln Ala Pro
Thr Glu Gln Arg Pro Gly Val Gln Glu Cys 1385 1390 1395tac cat ggt
aat gga cag agt tat cga ggc aca tac tcc acc act gtc 4281Tyr His Gly
Asn Gly Gln Ser Tyr Arg Gly Thr Tyr Ser Thr Thr Val 1400 1405
1410aca gga aga acc tgc caa gct tgg tca tct atg aca cca cac tcg cat
4329Thr Gly Arg Thr Cys Gln Ala Trp Ser Ser Met Thr Pro His Ser His
1415 1420 1425agt cgg acc cca gaa tac tac cca aat gct ggc ttg atc
atg aac tac 4377Ser Arg Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile
Met Asn Tyr 1430 1435 1440tgc agg aat cca gat gct gtg gca gct cct
tat tgt tat acg agg gat 4425Cys Arg Asn Pro Asp Ala Val Ala Ala Pro
Tyr Cys Tyr Thr Arg Asp1445 1450 1455 1460ccc ggt gtc agg tgg gag
tac tgc aac ctg acg caa tgc tca gac gca 4473Pro Gly Val Arg Trp Glu
Tyr Cys Asn Leu Thr Gln Cys Ser Asp Ala 1465 1470 1475gaa ggg act
gcc gtc gcg cct ccg act gtt acc ccg gtt cca agc cta 4521Glu Gly Thr
Ala Val
Ala Pro Pro Thr Val Thr Pro Val Pro Ser Leu 1480 1485 1490gag gct
cct tcc gaa caa gca ccg act gag caa agg cct ggg gtg cag 4569Glu Ala
Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly Val Gln 1495 1500
1505gag tgc tac cat ggt aat gga cag agt tat cga ggc aca tac tcc acc
4617Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly Thr Tyr Ser Thr
1510 1515 1520act gtc aca gga aga acc tgc caa gct tgg tca tct atg
aca cca cac 4665Thr Val Thr Gly Arg Thr Cys Gln Ala Trp Ser Ser Met
Thr Pro His1525 1530 1535 1540tcg cat agt cgg acc cca gaa tac tac
cca aat gct ggc ttg atc atg 4713Ser His Ser Arg Thr Pro Glu Tyr Tyr
Pro Asn Ala Gly Leu Ile Met 1545 1550 1555aac tac tgc agg aat cca
gat gct gtg gca gct cct tat tgt tat acg 4761Asn Tyr Cys Arg Asn Pro
Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr 1560 1565 1570agg gat ccc
ggt gtc agg tgg gag tac tgc aac ctg acg caa tgc tca 4809Arg Asp Pro
Gly Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser 1575 1580
1585gac gca gaa ggg act gcc gtc gcg cct ccg act gtt acc ccg gtt cca
4857Asp Ala Glu Gly Thr Ala Val Ala Pro Pro Thr Val Thr Pro Val Pro
1590 1595 1600agc cta gag gct cct tcc gaa caa gca ccg act gag caa
agg cct ggg 4905Ser Leu Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln
Arg Pro Gly1605 1610 1615 1620gtg cag gag tgc tac cat ggt aat gga
cag agt tat cga ggc aca tac 4953Val Gln Glu Cys Tyr His Gly Asn Gly
Gln Ser Tyr Arg Gly Thr Tyr 1625 1630 1635tcc acc act gtc aca gga
aga acc tgc caa gct tgg tca tct atg aca 5001Ser Thr Thr Val Thr Gly
Arg Thr Cys Gln Ala Trp Ser Ser Met Thr 1640 1645 1650cca cac tcg
cat agt cgg acc cca gaa tac tac cca aat gct ggc ttg 5049Pro His Ser
His Ser Arg Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu 1655 1660
1665atc atg aac tac tgc agg aat cca gat gct gtg gca gct cct tat tgt
5097Ile Met Asn Tyr Cys Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys
1670 1675 1680tat acg agg gat ccc ggt gtc agg tgg gag tac tgc aac
ctg acg caa 5145Tyr Thr Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys Asn
Leu Thr Gln1685 1690 1695 1700tgc tca gac gca gaa ggg act gcc gtc
gcg cct ccg act gtt acc ccg 5193Cys Ser Asp Ala Glu Gly Thr Ala Val
Ala Pro Pro Thr Val Thr Pro 1705 1710 1715gtt cca agc cta gag gct
cct tcc gaa caa gca ccg act gag caa agg 5241Val Pro Ser Leu Glu Ala
Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg 1720 1725 1730cct ggg gtg
cag gag tgc tac cat ggt aat gga cag agt tat cga ggc 5289Pro Gly Val
Gln Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly 1735 1740
1745aca tac tcc acc act gtc aca gga aga acc tgc caa gct tgg tca tct
5337Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ala Trp Ser Ser
1750 1755 1760atg aca cca cac tcg cat agt cgg acc cca gaa tac tac
cca aat gct 5385Met Thr Pro His Ser His Ser Arg Thr Pro Glu Tyr Tyr
Pro Asn Ala1765 1770 1775 1780ggc ttg atc atg aac tac tgc agg aat
cca gat gct gtg gca gct cct 5433Gly Leu Ile Met Asn Tyr Cys Arg Asn
Pro Asp Ala Val Ala Ala Pro 1785 1790 1795tat tgt tat acg agg gat
ccc ggt gtc agg tgg gag tac tgc aac ctg 5481Tyr Cys Tyr Thr Arg Asp
Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu 1800 1805 1810acg caa tgc
tca gac gca gaa ggg act gcc gtc gcg cct ccg act gtt 5529Thr Gln Cys
Ser Asp Ala Glu Gly Thr Ala Val Ala Pro Pro Thr Val 1815 1820
1825acc ccg gtt cca agc cta gag gct cct tcc gaa caa gca ccg act gag
5577Thr Pro Val Pro Ser Leu Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu
1830 1835 1840caa agg cct ggg gtg cag gag tgc tac cat ggt aat gga
cag agt tat 5625Gln Arg Pro Gly Val Gln Glu Cys Tyr His Gly Asn Gly
Gln Ser Tyr1845 1850 1855 1860cga ggc aca tac tcc acc act gtc aca
gga aga acc tgc caa gct tgg 5673Arg Gly Thr Tyr Ser Thr Thr Val Thr
Gly Arg Thr Cys Gln Ala Trp 1865 1870 1875tca tct atg aca cca cac
tcg cat agt cgg acc cca gaa tac tac cca 5721Ser Ser Met Thr Pro His
Ser His Ser Arg Thr Pro Glu Tyr Tyr Pro 1880 1885 1890aat gct ggc
ttg atc atg aac tac tgc agg aat cca gat gct gtg gca 5769Asn Ala Gly
Leu Ile Met Asn Tyr Cys Arg Asn Pro Asp Ala Val Ala 1895 1900
1905gct cct tat tgt tat acg agg gat ccc ggt gtc agg tgg gag tac tgc
5817Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys
1910 1915 1920aac ctg acg caa tgc tca gac gca gaa ggg act gcc gtc
gcg cct ccg 5865Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala Val
Ala Pro Pro1925 1930 1935 1940act gtt acc ccg gtt cca agc cta gag
gct cct tcc gaa caa gca ccg 5913Thr Val Thr Pro Val Pro Ser Leu Glu
Ala Pro Ser Glu Gln Ala Pro 1945 1950 1955act gag caa agg cct ggg
gtg cag gag tgc tac cat ggt aat gga cag 5961Thr Glu Gln Arg Pro Gly
Val Gln Glu Cys Tyr His Gly Asn Gly Gln 1960 1965 1970agt tat cga
ggc aca tac tcc acc act gtc aca gga aga acc tgc caa 6009Ser Tyr Arg
Gly Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln 1975 1980
1985gct tgg tca tct atg aca cca cac tcg cat agt cgg acc cca gaa tac
6057Ala Trp Ser Ser Met Thr Pro His Ser His Ser Arg Thr Pro Glu Tyr
1990 1995 2000tac cca aat gct ggc ttg atc atg aac tac tgc agg aat
cca gat gct 6105Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg Asn
Pro Asp Ala2005 2010 2015 2020gtg gca gct cct tat tgt tat acg agg
gat ccc ggt gtc agg tgg gag 6153Val Ala Ala Pro Tyr Cys Tyr Thr Arg
Asp Pro Gly Val Arg Trp Glu 2025 2030 2035tac tgc aac ctg acg caa
tgc tca gac gca gaa ggg act gcc gtc gcg 6201Tyr Cys Asn Leu Thr Gln
Cys Ser Asp Ala Glu Gly Thr Ala Val Ala 2040 2045 2050cct ccg act
gtt acc ccg gtt cca agc cta gag gct cct tcc gaa caa 6249Pro Pro Thr
Val Thr Pro Val Pro Ser Leu Glu Ala Pro Ser Glu Gln 2055 2060
2065gca ccg act gag caa agg cct ggg gtg cag gag tgc tac cat ggt aat
6297Ala Pro Thr Glu Gln Arg Pro Gly Val Gln Glu Cys Tyr His Gly Asn
2070 2075 2080gga cag agt tat cga ggc aca tac tcc acc act gtc aca
gga aga acc 6345Gly Gln Ser Tyr Arg Gly Thr Tyr Ser Thr Thr Val Thr
Gly Arg Thr2085 2090 2095 2100tgc caa gct tgg tca tct atg aca cca
cac tcg cat agt cgg acc cca 6393Cys Gln Ala Trp Ser Ser Met Thr Pro
His Ser His Ser Arg Thr Pro 2105 2110 2115gaa tac tac cca aat gct
ggc ttg atc atg aac tac tgc agg aat cca 6441Glu Tyr Tyr Pro Asn Ala
Gly Leu Ile Met Asn Tyr Cys Arg Asn Pro 2120 2125 2130gat gct gtg
gca gct cct tat tgt tat acg agg gat ccc ggt gtc agg 6489Asp Ala Val
Ala Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Gly Val Arg 2135 2140
2145tgg gag tac tgc aac ctg acg caa tgc tca gac gca gaa ggg act gcc
6537Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala
2150 2155 2160gtc gcg cct ccg act gtt acc ccg gtt cca agc cta gag
gct cct tcc 6585Val Ala Pro Pro Thr Val Thr Pro Val Pro Ser Leu Glu
Ala Pro Ser2165 2170 2175 2180gaa caa gca ccg act gag caa agg cct
ggg gtg cag gag tgc tac cat 6633Glu Gln Ala Pro Thr Glu Gln Arg Pro
Gly Val Gln Glu Cys Tyr His 2185 2190 2195ggt aat gga cag agt tat
cga ggc aca tac tcc acc act gtc aca gga 6681Gly Asn Gly Gln Ser Tyr
Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly 2200 2205 2210aga acc tgc
caa gct tgg tca tct atg aca cca cac tcg cat agt cgg 6729Arg Thr Cys
Gln Ala Trp Ser Ser Met Thr Pro His Ser His Ser Arg 2215 2220
2225acc cca gaa tac tac cca aat gct ggc ttg atc atg aac tac tgc agg
6777Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg
2230 2235 2240aat cca gat gct gtg gca gct cct tat tgt tat acg agg
gat ccc ggt 6825Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr Arg
Asp Pro Gly2245 2250 2255 2260gtc agg tgg gag tac tgc aac ctg acg
caa tgc tca gac gca gaa ggg 6873Val Arg Trp Glu Tyr Cys Asn Leu Thr
Gln Cys Ser Asp Ala Glu Gly 2265 2270 2275act gcc gtc gcg cct ccg
act gtt acc ccg gtt cca agc cta gag gct 6921Thr Ala Val Ala Pro Pro
Thr Val Thr Pro Val Pro Ser Leu Glu Ala 2280 2285 2290cct tcc gaa
caa gca ccg act gag caa agg cct ggg gtg cag gag tgc 6969Pro Ser Glu
Gln Ala Pro Thr Glu Gln Arg Pro Gly Val Gln Glu Cys 2295 2300
2305tac cat ggt aat gga cag agt tat cga ggc aca tac tcc acc act gtc
7017Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly Thr Tyr Ser Thr Thr Val
2310 2315 2320aca gga aga acc tgc caa gct tgg tca tct atg aca cca
cac tcg cat 7065Thr Gly Arg Thr Cys Gln Ala Trp Ser Ser Met Thr Pro
His Ser His2325 2330 2335 2340agt cgg acc cca gaa tac tac cca aat
gct ggc ttg atc atg aac tac 7113Ser Arg Thr Pro Glu Tyr Tyr Pro Asn
Ala Gly Leu Ile Met Asn Tyr 2345 2350 2355tgc agg aat cca gat gct
gtg gca gct cct tat tgt tat acg agg gat 7161Cys Arg Asn Pro Asp Ala
Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp 2360 2365 2370ccc ggt gtc
agg tgg gag tac tgc aac ctg acg caa tgc tca gac gca 7209Pro Gly Val
Arg Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser Asp Ala 2375 2380
2385gaa ggg act gcc gtc gcg cct ccg act gtt acc ccg gtt cca agc cta
7257Glu Gly Thr Ala Val Ala Pro Pro Thr Val Thr Pro Val Pro Ser Leu
2390 2395 2400gag gct cct tcc gaa caa gca ccg act gag caa agg cct
ggg gtg cag 7305Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg Pro
Gly Val Gln2405 2410 2415 2420gag tgc tac cat ggt aat gga cag agt
tat cga ggc aca tac tcc acc 7353Glu Cys Tyr His Gly Asn Gly Gln Ser
Tyr Arg Gly Thr Tyr Ser Thr 2425 2430 2435act gtc aca gga aga acc
tgc caa gct tgg tca tct atg aca cca cac 7401Thr Val Thr Gly Arg Thr
Cys Gln Ala Trp Ser Ser Met Thr Pro His 2440 2445 2450tcg cat agt
cgg acc cca gaa tac tac cca aat gct ggc ttg atc atg 7449Ser His Ser
Arg Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met 2455 2460
2465aac tac tgc agg aat cca gat gct gtg gca gct cct tat tgt tat acg
7497Asn Tyr Cys Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr
2470 2475 2480agg gat ccc ggt gtc agg tgg gag tac tgc aac ctg acg
caa tgc tca 7545Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu Thr
Gln Cys Ser2485 2490 2495 2500gac gca gaa ggg act gcc gtc gcg cct
ccg act gtt acc ccg gtt cca 7593Asp Ala Glu Gly Thr Ala Val Ala Pro
Pro Thr Val Thr Pro Val Pro 2505 2510 2515agc cta gag gct cct tcc
gaa caa gca ccg act gag caa agg cct ggg 7641Ser Leu Glu Ala Pro Ser
Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly 2520 2525 2530gtg cag gag
tgc tac cat ggt aat gga cag agt tat cga ggc aca tac 7689Val Gln Glu
Cys Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly Thr Tyr 2535 2540
2545tcc acc act gtc aca gga aga acc tgc caa gct tgg tca tct atg aca
7737Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ala Trp Ser Ser Met Thr
2550 2555 2560cca cac tcg cat agt cgg acc cca gaa tac tac cca aat
gct ggc ttg 7785Pro His Ser His Ser Arg Thr Pro Glu Tyr Tyr Pro Asn
Ala Gly Leu2565 2570 2575 2580atc atg aac tac tgc agg aat cca gat
gct gtg gca gct cct tat tgt 7833Ile Met Asn Tyr Cys Arg Asn Pro Asp
Ala Val Ala Ala Pro Tyr Cys 2585 2590 2595tat acg agg gat ccc ggt
gtc agg tgg gag tac tgc aac ctg acg caa 7881Tyr Thr Arg Asp Pro Gly
Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln 2600 2605 2610tgc tca gac
gca gaa ggg act gcc gtc gcg cct ccg act gtt acc ccg 7929Cys Ser Asp
Ala Glu Gly Thr Ala Val Ala Pro Pro Thr Val Thr Pro 2615 2620
2625gtt cca agc cta gag gct cct tcc gaa caa gca ccg act gag cag agg
7977Val Pro Ser Leu Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg
2630 2635 2640cct ggg gtg cag gag tgc tac cac ggt aat gga cag agt
tat cga ggc 8025Pro Gly Val Gln Glu Cys Tyr His Gly Asn Gly Gln Ser
Tyr Arg Gly2645 2650 2655 2660aca tac tcc acc act gtc act gga aga
acc tgc caa gct tgg tca tct 8073Thr Tyr Ser Thr Thr Val Thr Gly Arg
Thr Cys Gln Ala Trp Ser Ser 2665 2670 2675atg aca cca cac tcg cat
agt cgg acc cca gaa tac tac cca aat gct 8121Met Thr Pro His Ser His
Ser Arg Thr Pro Glu Tyr Tyr Pro Asn Ala 2680 2685 2690ggc ttg atc
atg aac tac tgc agg aat cca gat gct gtg gca gct cct 8169Gly Leu Ile
Met Asn Tyr Cys Arg Asn Pro Asp Ala Val Ala Ala Pro 2695 2700
2705tat tgt tat acg agg gat ccc ggt gtc agg tgg gag tac tgc aac ctg
8217Tyr Cys Tyr Thr Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu
2710 2715 2720acg caa tgc tca gac gca gaa ggg act gcc gtc gcg cct
ccg act gtt 8265Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala Val Ala Pro
Pro Thr Val2725 2730 2735 2740acc ccg gtt cca agc cta gag gct cct
tcc gaa caa gca ccg act gag 8313Thr Pro Val Pro Ser Leu Glu Ala Pro
Ser Glu Gln Ala Pro Thr Glu 2745 2750 2755caa agg cct ggg gtg cag
gag tgc tac cat ggt aat gga cag agt tat 8361Gln Arg Pro Gly Val Gln
Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr 2760 2765 2770cga ggc aca
tac tcc acc act gtc aca gga aga acc tgc caa gct tgg 8409Arg Gly Thr
Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ala Trp 2775 2780
2785tca tct atg aca cca cac tcg cat agt cgg acc cca gaa tac tac cca
8457Ser Ser Met Thr Pro His Ser His Ser Arg Thr Pro Glu Tyr Tyr Pro
2790 2795 2800aat gct ggc ttg atc atg aac tac tgc agg aat cca gat
gct gtg gca 8505Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg Asn Pro Asp
Ala Val Ala2805 2810 2815 2820gct cct tat tgt tat acg agg gat ccc
ggt gtc agg tgg gag tac tgc 8553Ala Pro Tyr Cys Tyr Thr Arg Asp Pro
Gly Val Arg Trp Glu Tyr Cys 2825 2830 2835aac ctg acg caa tgc tca
gac gca gaa ggg act gcc gtc gcg cct ccg 8601Asn Leu Thr Gln Cys Ser
Asp Ala Glu Gly Thr Ala Val Ala Pro Pro 2840 2845 2850act gtt acc
ccg gtt cca agc cta gag gct cct tcc gaa caa gca ccg 8649Thr Val Thr
Pro Val Pro Ser Leu Glu Ala Pro Ser Glu Gln Ala Pro 2855 2860
2865act gag caa agg cct ggg gtg cag gag tgc tac cat ggt aat gga cag
8697Thr Glu Gln Arg Pro Gly Val Gln Glu Cys Tyr His Gly Asn Gly Gln
2870 2875 2880agt tat cga ggc aca tac tcc acc act gtc aca gga aga
acc tgc caa 8745Ser Tyr Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly Arg
Thr Cys Gln2885 2890 2895 2900gct tgg tca tct atg aca cca cac tcg
cat agt cgg acc cca gaa tac 8793Ala Trp Ser Ser Met Thr Pro His Ser
His Ser Arg Thr Pro Glu Tyr 2905 2910 2915tac cca aat gct ggc ttg
atc atg aac tac tgc agg aat cca gat gct 8841Tyr Pro Asn Ala Gly Leu
Ile Met Asn Tyr Cys Arg Asn Pro Asp Ala 2920 2925 2930gtg gca gct
cct tat tgt tat acg agg gat ccc ggt gtc agg tgg gag 8889Val Ala Ala
Pro Tyr Cys Tyr Thr Arg Asp Pro Gly Val Arg Trp Glu 2935 2940
2945tac tgc aac ctg acg caa tgc tca gac gca gaa ggg act gcc gtc gcg
8937Tyr Cys Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala Val Ala
2950 2955 2960cct ccg act gtt acc ccg gtt cca agc cta gag gct cct
tcc gaa caa 8985Pro Pro Thr Val Thr Pro Val Pro Ser Leu Glu Ala Pro
Ser Glu Gln2965 2970 2975 2980gca ccg act gag cag agg cct ggg gtg
cag gag tgc tac cac ggt aat 9033Ala Pro Thr Glu Gln Arg Pro Gly Val
Gln Glu Cys Tyr His Gly Asn 2985 2990 2995gga cag agt tat cga ggc
aca tac tcc acc act gtc act gga aga acc 9081Gly Gln Ser Tyr Arg Gly
Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr 3000
3005 3010tgc caa gct tgg tca tct atg aca cca cac tcg cat agt cgg
acc cca 9129Cys Gln Ala Trp Ser Ser Met Thr Pro His Ser His Ser Arg
Thr Pro 3015 3020 3025gaa tac tac cca aat gct ggc ttg atc atg aac
tac tgc agg aat cca 9177Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn
Tyr Cys Arg Asn Pro 3030 3035 3040gat gct gtg gca gct cct tat tgt
tat acg agg gat ccc ggt gtc agg 9225Asp Ala Val Ala Ala Pro Tyr Cys
Tyr Thr Arg Asp Pro Gly Val Arg3045 3050 3055 3060tgg gag tac tgc
aac ctg acg caa tgc tca gac gca gaa ggg act gcc 9273Trp Glu Tyr Cys
Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala 3065 3070 3075gtc
gcg cct ccg act gtt acc ccg gtt cca agc cta gag gct cct tcc 9321Val
Ala Pro Pro Thr Val Thr Pro Val Pro Ser Leu Glu Ala Pro Ser 3080
3085 3090gaa caa gca ccg act gag cag agg cct ggg gtg cag gag tgc
tac cac 9369Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly Val Gln Glu Cys
Tyr His 3095 3100 3105ggt aat gga cag agt tat cga ggc aca tac tcc
acc act gtc act gga 9417Gly Asn Gly Gln Ser Tyr Arg Gly Thr Tyr Ser
Thr Thr Val Thr Gly 3110 3115 3120aga acc tgc caa gct tgg tca tct
atg aca cca cac tcg cat agt cgg 9465Arg Thr Cys Gln Ala Trp Ser Ser
Met Thr Pro His Ser His Ser Arg3125 3130 3135 3140acc cca gaa tac
tac cca aat gct ggc ttg atc atg aac tac tgc agg 9513Thr Pro Glu Tyr
Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg 3145 3150 3155aat
cca gat gct gtg gca gct cct tat tgt tat acg agg gat ccc ggt 9561Asn
Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Gly 3160
3165 3170gtc agg tgg gag tac tgc aac ctg acg caa tgc tca gac gca
gaa ggg 9609Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser Asp Ala
Glu Gly 3175 3180 3185act gcc gtc gcg cct ccg act gtt acc ccg gtt
cca agc cta gag gct 9657Thr Ala Val Ala Pro Pro Thr Val Thr Pro Val
Pro Ser Leu Glu Ala 3190 3195 3200cct tcc gaa caa gca ccg act gag
cag agg cct ggg gtg cag gag tgc 9705Pro Ser Glu Gln Ala Pro Thr Glu
Gln Arg Pro Gly Val Gln Glu Cys3205 3210 3215 3220tac cac ggt aat
gga cag agt tat cga ggc aca tac tcc acc act gtc 9753Tyr His Gly Asn
Gly Gln Ser Tyr Arg Gly Thr Tyr Ser Thr Thr Val 3225 3230 3235act
gga aga acc tgc caa gct tgg tca tct atg aca cca cac tcg cat 9801Thr
Gly Arg Thr Cys Gln Ala Trp Ser Ser Met Thr Pro His Ser His 3240
3245 3250agt cgg acc cca gaa tac tac cca aat gct ggc ttg atc atg
aac tac 9849Ser Arg Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met
Asn Tyr 3255 3260 3265tgc agg aat cca gat gct gtg gca gct cct tat
tgt tat acg agg gat 9897Cys Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr
Cys Tyr Thr Arg Asp 3270 3275 3280ccc ggt gtc agg tgg gag tac tgc
aac ctg acg caa tgc tca gac gca 9945Pro Gly Val Arg Trp Glu Tyr Cys
Asn Leu Thr Gln Cys Ser Asp Ala3285 3290 3295 3300gaa ggg act gcc
gtc gcg cct ccg act gtt acc ccg gtt cca agc cta 9993Glu Gly Thr Ala
Val Ala Pro Pro Thr Val Thr Pro Val Pro Ser Leu 3305 3310 3315gag
gct cct tcc gaa caa gca ccg act gag cag agg cct ggg gtg cag
10041Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly Val
Gln 3320 3325 3330gag tgc tac cac ggt aat gga cag agt tat cga ggc
aca tac tcc acc 10089Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr Arg
Gly Thr Tyr Ser Thr 3335 3340 3345act gtc act gga aga acc tgc caa
gct tgg tca tct atg aca cca cac 10137Thr Val Thr Gly Arg Thr Cys
Gln Ala Trp Ser Ser Met Thr Pro His 3350 3355 3360tcg cat agt cgg
acc cca gaa tac tac cca aat gct ggc ttg atc atg 10185Ser His Ser
Arg Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met3365 3370 3375
3380aac tac tgc agg aat cca gat cct gtg gca gcc cct tat tgt tat acg
10233Asn Tyr Cys Arg Asn Pro Asp Pro Val Ala Ala Pro Tyr Cys Tyr
Thr 3385 3390 3395agg gat ccc agt gtc agg tgg gag tac tgc aac ctg
aca caa tgc tca 10281Arg Asp Pro Ser Val Arg Trp Glu Tyr Cys Asn
Leu Thr Gln Cys Ser 3400 3405 3410gac gca gaa ggg act gcc gtc gcg
cct cca act att acc ccg att cca 10329Asp Ala Glu Gly Thr Ala Val
Ala Pro Pro Thr Ile Thr Pro Ile Pro 3415 3420 3425agc cta gag gct
cct tct gaa caa gca cca act gag caa agg cct ggg 10377Ser Leu Glu
Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly 3430 3435
3440gtg cag gag tgc tac cac gga aat gga cag agt tat caa ggc aca tac
10425Val Gln Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr Gln Gly Thr
Tyr3445 3450 3455 3460ttc att act gtc aca gga aga acc tgc caa gct
tgg tca tct atg aca 10473Phe Ile Thr Val Thr Gly Arg Thr Cys Gln
Ala Trp Ser Ser Met Thr 3465 3470 3475cca cac tcg cat agt cgg acc
cca gca tac tac cca aat gct ggc ttg 10521Pro His Ser His Ser Arg
Thr Pro Ala Tyr Tyr Pro Asn Ala Gly Leu 3480 3485 3490atc aag aac
tac tgc cga aat cca gat cct gtg gca gcc cct tgg tgt 10569Ile Lys
Asn Tyr Cys Arg Asn Pro Asp Pro Val Ala Ala Pro Trp Cys 3495 3500
3505tat aca aca gat ccc agt gtc agg tgg gag tac tgc aac ctg aca cga
10617Tyr Thr Thr Asp Pro Ser Val Arg Trp Glu Tyr Cys Asn Leu Thr
Arg 3510 3515 3520tgc tca gat gca gaa tgg act gcc ttc gtc cct ccg
aat gtt att ctg 10665Cys Ser Asp Ala Glu Trp Thr Ala Phe Val Pro
Pro Asn Val Ile Leu3525 3530 3535 3540gct cca agc cta gag gct ttt
ttt gaa caa gca ctg act gag gaa acc 10713Ala Pro Ser Leu Glu Ala
Phe Phe Glu Gln Ala Leu Thr Glu Glu Thr 3545 3550 3555ccc ggg gta
cag gac tgc tac tac cat tat gga cag agt tac cga ggc 10761Pro Gly
Val Gln Asp Cys Tyr Tyr His Tyr Gly Gln Ser Tyr Arg Gly 3560 3565
3570aca tac tcc acc act gtc aca gga aga act tgc caa gct tgg tca tct
10809Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ala Trp Ser
Ser 3575 3580 3585atg aca cca cac cag cat agt cgg acc cca gaa aac
tac cca aat gct 10857Met Thr Pro His Gln His Ser Arg Thr Pro Glu
Asn Tyr Pro Asn Ala 3590 3595 3600ggc ctg acc agg aac tac tgc agg
aat cca gat gct gag att cgc cct 10905Gly Leu Thr Arg Asn Tyr Cys
Arg Asn Pro Asp Ala Glu Ile Arg Pro3605 3610 3615 3620tgg tgt tac
acc atg gat ccc agt gtc agg tgg gag tac tgc aac ctg 10953Trp Cys
Tyr Thr Met Asp Pro Ser Val Arg Trp Glu Tyr Cys Asn Leu 3625 3630
3635aca caa tgc ctg gtg aca gaa tca agt gtc ctt gca act ctc acg gtg
11001Thr Gln Cys Leu Val Thr Glu Ser Ser Val Leu Ala Thr Leu Thr
Val 3640 3645 3650gtc cca gat cca agc aca gag gct tct tct gaa gaa
gca cca acg gag 11049Val Pro Asp Pro Ser Thr Glu Ala Ser Ser Glu
Glu Ala Pro Thr Glu 3655 3660 3665caa agc ccc ggg gtc cag gat tgc
tac cat ggt gat gga cag agt tat 11097Gln Ser Pro Gly Val Gln Asp
Cys Tyr His Gly Asp Gly Gln Ser Tyr 3670 3675 3680cga ggc tca ttc
tct acc act gtc aca gga agg aca tgt cag tct tgg 11145Arg Gly Ser
Phe Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ser Trp3685 3690 3695
3700tcc tct atg aca cca cac tgg cat cag agg aca aca gaa tat tat cca
11193Ser Ser Met Thr Pro His Trp His Gln Arg Thr Thr Glu Tyr Tyr
Pro 3705 3710 3715aat ggt ggc ctg acc agg aac tac tgc agg aat cca
gat gct gag att 11241Asn Gly Gly Leu Thr Arg Asn Tyr Cys Arg Asn
Pro Asp Ala Glu Ile 3720 3725 3730agt cct tgg tgt tat acc atg gat
ccc aat gtc aga tgg gag tac tgc 11289Ser Pro Trp Cys Tyr Thr Met
Asp Pro Asn Val Arg Trp Glu Tyr Cys 3735 3740 3745aac ctg aca caa
tgt cca gtg aca gaa tca agt gtc ctt gcg acg tcc 11337Asn Leu Thr
Gln Cys Pro Val Thr Glu Ser Ser Val Leu Ala Thr Ser 3750 3755
3760acg gct gtt tct gaa caa gca cca acg gag caa agc ccc aca gtc cag
11385Thr Ala Val Ser Glu Gln Ala Pro Thr Glu Gln Ser Pro Thr Val
Gln3765 3770 3775 3780gac tgc tac cat ggt gat gga cag agt tat cga
ggc tca ttc tcc acc 11433Asp Cys Tyr His Gly Asp Gly Gln Ser Tyr
Arg Gly Ser Phe Ser Thr 3785 3790 3795act gtt aca gga agg aca tgt
cag tct tgg tcc tct atg aca cca cac 11481Thr Val Thr Gly Arg Thr
Cys Gln Ser Trp Ser Ser Met Thr Pro His 3800 3805 3810tgg cat cag
aga acc aca gaa tac tac cca aat ggt ggc ctg acc agg 11529Trp His
Gln Arg Thr Thr Glu Tyr Tyr Pro Asn Gly Gly Leu Thr Arg 3815 3820
3825aac tac tgc agg aat cca gat gct gag att cgc cct tgg tgt tat acc
11577Asn Tyr Cys Arg Asn Pro Asp Ala Glu Ile Arg Pro Trp Cys Tyr
Thr 3830 3835 3840atg gat ccc agt gtc aga tgg gag tac tgc aac ctg
acg caa tgt cca 11625Met Asp Pro Ser Val Arg Trp Glu Tyr Cys Asn
Leu Thr Gln Cys Pro3845 3850 3855 3860gtg atg gaa tca act ctc ctc
aca act ccc acg gtg gtc cca gtt cca 11673Val Met Glu Ser Thr Leu
Leu Thr Thr Pro Thr Val Val Pro Val Pro 3865 3870 3875agc aca gag
ctt cct tct gaa gaa gca cca act gaa aac agc act ggg 11721Ser Thr
Glu Leu Pro Ser Glu Glu Ala Pro Thr Glu Asn Ser Thr Gly 3880 3885
3890gtc cag gac tgc tac cga ggt gat gga cag agt tat cga ggc aca ctc
11769Val Gln Asp Cys Tyr Arg Gly Asp Gly Gln Ser Tyr Arg Gly Thr
Leu 3895 3900 3905tcc acc act atc aca gga aga aca tgt cag tct tgg
tcg tct atg aca 11817Ser Thr Thr Ile Thr Gly Arg Thr Cys Gln Ser
Trp Ser Ser Met Thr 3910 3915 3920cca cat tgg cat cgg agg atc cca
tta tac tat cca aat gct ggc ctg 11865Pro His Trp His Arg Arg Ile
Pro Leu Tyr Tyr Pro Asn Ala Gly Leu3925 3930 3935 3940acc agg aac
tac tgc agg aat cca gat gct gag att cgc cct tgg tgt 11913Thr Arg
Asn Tyr Cys Arg Asn Pro Asp Ala Glu Ile Arg Pro Trp Cys 3945 3950
3955tac acc atg gat ccc agt gtc agg tgg gag tac tgc aac ctg aca cga
11961Tyr Thr Met Asp Pro Ser Val Arg Trp Glu Tyr Cys Asn Leu Thr
Arg 3960 3965 3970tgt cca gtg aca gaa tcg agt gtc ctc aca act ccc
aca gtg gcc ccg 12009Cys Pro Val Thr Glu Ser Ser Val Leu Thr Thr
Pro Thr Val Ala Pro 3975 3980 3985gtt cca agc aca gag gct cct tct
gaa caa gca cca cct gag aaa agc 12057Val Pro Ser Thr Glu Ala Pro
Ser Glu Gln Ala Pro Pro Glu Lys Ser 3990 3995 4000cct gtg gtc cag
gat tgc tac cat ggt gat gga cgg agt tat cga ggc 12105Pro Val Val
Gln Asp Cys Tyr His Gly Asp Gly Arg Ser Tyr Arg Gly4005 4010 4015
4020ata tcc tcc acc act gtc aca gga agg acc tgt caa tct tgg tca tct
12153Ile Ser Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ser Trp Ser
Ser 4025 4030 4035atg ata cca cac tgg cat cag agg acc cca gaa aac
tac cca aat gct 12201Met Ile Pro His Trp His Gln Arg Thr Pro Glu
Asn Tyr Pro Asn Ala 4040 4045 4050ggc ctg acc gag aac tac tgc agg
aat cca gat tct ggg aaa caa ccc 12249Gly Leu Thr Glu Asn Tyr Cys
Arg Asn Pro Asp Ser Gly Lys Gln Pro 4055 4060 4065tgg tgt tac aca
acc gat ccg tgt gtg agg tgg gag tac tgc aat ctg 12297Trp Cys Tyr
Thr Thr Asp Pro Cys Val Arg Trp Glu Tyr Cys Asn Leu 4070 4075
4080aca caa tgc tca gaa aca gaa tca ggt gtc cta gag act ccc act gtt
12345Thr Gln Cys Ser Glu Thr Glu Ser Gly Val Leu Glu Thr Pro Thr
Val4085 4090 4095 4100gtt cca gtt cca agc atg gag gct cat tct gaa
gca gca cca act gag 12393Val Pro Val Pro Ser Met Glu Ala His Ser
Glu Ala Ala Pro Thr Glu 4105 4110 4115caa acc cct gtg gtc cgg cag
tgc tac cat ggt aat ggc cag agt tat 12441Gln Thr Pro Val Val Arg
Gln Cys Tyr His Gly Asn Gly Gln Ser Tyr 4120 4125 4130cga ggc aca
ttc tcc acc act gtc aca gga agg aca tgt caa tct tgg 12489Arg Gly
Thr Phe Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ser Trp 4135 4140
4145tca tcc atg aca cca cac cgg cat cag agg acc cca gaa aac tac cca
12537Ser Ser Met Thr Pro His Arg His Gln Arg Thr Pro Glu Asn Tyr
Pro 4150 4155 4160aat gat ggc ctg aca atg aac tac tgc agg aat cca
gat gcc gat aca 12585Asn Asp Gly Leu Thr Met Asn Tyr Cys Arg Asn
Pro Asp Ala Asp Thr4165 4170 4175 4180ggc cct tgg tgt ttt acc atg
gac ccc agc atc agg tgg gag tac tgc 12633Gly Pro Trp Cys Phe Thr
Met Asp Pro Ser Ile Arg Trp Glu Tyr Cys 4185 4190 4195aac ctg acg
cga tgc tca gac aca gaa ggg act gtg gtc gct cct ccg 12681Asn Leu
Thr Arg Cys Ser Asp Thr Glu Gly Thr Val Val Ala Pro Pro 4200 4205
4210act gtc atc cag gtt cca agc cta ggg cct cct tct gaa caa gac tgt
12729Thr Val Ile Gln Val Pro Ser Leu Gly Pro Pro Ser Glu Gln Asp
Cys 4215 4220 4225atg ttt ggg aat ggg aaa gga tac cgg ggc aag aag
gca acc act gtt 12777Met Phe Gly Asn Gly Lys Gly Tyr Arg Gly Lys
Lys Ala Thr Thr Val 4230 4235 4240act ggg acg cca tgc cag gaa tgg
gct gcc cag gag ccc cat aga cac 12825Thr Gly Thr Pro Cys Gln Glu
Trp Ala Ala Gln Glu Pro His Arg His4245 4250 4255 4260agc acg ttc
att cca ggg aca aat aaa tgg gca ggt ctg gaa aaa aat 12873Ser Thr
Phe Ile Pro Gly Thr Asn Lys Trp Ala Gly Leu Glu Lys Asn 4265 4270
4275tac tgc cgt aac cct gat ggt gac atc aat ggt ccc tgg tgc tac aca
12921Tyr Cys Arg Asn Pro Asp Gly Asp Ile Asn Gly Pro Trp Cys Tyr
Thr 4280 4285 4290atg aat cca aga aaa ctt ttt gac tac tgt gat atc
cct ctc tgt gca 12969Met Asn Pro Arg Lys Leu Phe Asp Tyr Cys Asp
Ile Pro Leu Cys Ala 4295 4300 4305tcc tct tca ttt gat tgt ggg aag
cct caa gtg gag ccg aag aaa tgt 13017Ser Ser Ser Phe Asp Cys Gly
Lys Pro Gln Val Glu Pro Lys Lys Cys 4310 4315 4320cct gga agc att
gta ggg ggg tgt gtg gcc cac cca cat tcc tgg ccc 13065Pro Gly Ser
Ile Val Gly Gly Cys Val Ala His Pro His Ser Trp Pro4325 4330 4335
4340tgg caa gtc agt ctc aga aca agg ttt gga aag cac ttc tgt gga ggc
13113Trp Gln Val Ser Leu Arg Thr Arg Phe Gly Lys His Phe Cys Gly
Gly 4345 4350 4355acc tta ata tcc cca gag tgg gtg ctg act gct gct
cac tgc ttg aag 13161Thr Leu Ile Ser Pro Glu Trp Val Leu Thr Ala
Ala His Cys Leu Lys 4360 4365 4370aag tcc tca agg cct tca tcc tac
aag gtc atc ctg ggt gca cac caa 13209Lys Ser Ser Arg Pro Ser Ser
Tyr Lys Val Ile Leu Gly Ala His Gln 4375 4380 4385gaa gtg aac ctc
gaa tct cat gtt cag gaa ata gaa gtg tct agg ctg 13257Glu Val Asn
Leu Glu Ser His Val Gln Glu Ile Glu Val Ser Arg Leu 4390 4395
4400ttc ttg gag ccc aca caa gca gat att gcc ttg cta aag cta agc agg
13305Phe Leu Glu Pro Thr Gln Ala Asp Ile Ala Leu Leu Lys Leu Ser
Arg4405 4410 4415 4420cct gcc gtc atc act gac aaa gta atg cca gct
tgt ctg cca tcc cca 13353Pro Ala Val Ile Thr Asp Lys Val Met Pro
Ala Cys Leu Pro Ser Pro 4425 4430 4435gac tac atg gtc acc gcc agg
act gaa tgt tac atc act ggc tgg gga 13401Asp Tyr Met Val Thr Ala
Arg Thr Glu Cys Tyr Ile Thr Gly Trp Gly 4440 4445 4450gaa acc caa
ggt acc ttt ggg act ggc ctt ctc aag gaa gcc cag ctc 13449Glu Thr
Gln Gly Thr Phe Gly Thr Gly Leu Leu Lys Glu Ala Gln Leu 4455 4460
4465ctt gtt att gag aat gaa gtg tgc aat cac tat aag tat att tgt gct
13497Leu Val Ile Glu Asn Glu Val Cys Asn His Tyr Lys Tyr Ile Cys
Ala 4470 4475 4480gag cat ttg gcc aga ggc act gac agt tgc cag ggt
gac agt gga ggg 13545Glu His Leu Ala Arg Gly Thr Asp Ser Cys Gln
Gly Asp Ser Gly Gly4485 4490 4495 4500cct ctg gtt tgc ttc gag aag
gac aaa tac att tta caa gga gtc act 13593Pro Leu Val Cys Phe Glu
Lys Asp Lys Tyr Ile Leu Gln Gly Val Thr 4505 4510 4515tct tgg ggt
ctt ggc tgt gca cgc ccc aat aag cct ggt gtc tat gct 13641Ser Trp
Gly Leu Gly Cys Ala Arg Pro Asn Lys Pro Gly Val Tyr Ala 4520 4525
4530cgt gtt tca agg ttt gtt
act tgg att gag gga atg atg aga aat aat 13689Arg Val Ser Arg Phe
Val Thr Trp Ile Glu Gly Met Met Arg Asn Asn 4535 4540 4545taa
ttggacggga gacagagtga agcatcaacc tacttagaag ctgaaacgtg
13742ggtaaggatt tagcatgctg gaaataatag acagcaatca aacgaagaca
ctgttcccag 13802ctaccagcta tgccaaacct tggcattttt ggtatttttg
tgtataagct tttaaggtct 13862gactgacaaa ttctgtatta aggtgtcata
gctatgacat ttgttaaaaa taaactctgc 13922acttattttg atttga
13938525DNAArtificial SequencePCR Primer 5cagctcctta ttgttatacg
aggga 25618DNAArtificial SequencePCR Primer 6tgcgtctgag cattgcgt
18724DNAArtificial SequencePCR Probe 7cccggtgtca ggtgggagta ctgc
24819DNAArtificial SequencePCR Primer 8gaaggtgaag gtcggagtc
19920DNAArtificial SequencePCR Primer 9gaagatggtg atgggatttc
201020DNAArtificial SequencePCR Probe 10caagcttccc gttctcagcc
201120DNAArtificial SequenceAntisense Oligonucleotide 11ggcaggtcct
tcctgtgaca 201220DNAArtificial SequenceAntisense Oligonucleotide
12tctgcgtctg agcattgcgt 201320DNAArtificial SequenceAntisense
Oligonucleotide 13aagcttggca ggttcttcct 201420DNAArtificial
SequenceAntisense Oligonucleotide 14tcggaggcgc gacggcagtc
201520DNAArtificial SequenceAntisense Oligonucleotide 15cggaggcgcg
acggcagtcc 201620DNAArtificial SequenceAntisense Oligonucleotide
16ggcaggttct tcctgtgaca 201720DNAArtificial SequenceAntisense
Oligonucleotide 17ataacaataa ggagctgcca 201820DNAArtificial
SequenceAntisense Oligonucleotide 18gaccaagctt ggcaggttct
201920DNAArtificial SequenceAntisense Oligonucleotide 19taacaataag
gagctgccac 202020DNAArtificial SequenceAntisense Oligonucleotide
20tgaccaagct tggcaggttc 202120DNAArtificial SequenceAntisense
Oligonucleotide 21ttctgcgtct gagcattgcg 202220DNAArtificial
SequenceAntisense Oligonucleotide 22aacaataagg agctgccaca
202320DNAArtificial SequenceAntisense Oligonucleotide 23acctgacacc
gggatccctc 202420DNAArtificial SequenceAntisense Oligonucleotide
24ctgagcattg cgtcaggttg 202520DNAArtificial SequenceAntisense
Oligonucleotide 25agtagttcat gatcaagcca 202620DNAArtificial
SequenceAntisense Oligonucleotide 26gacggcagtc ccttctgcgt
202720DNAArtificial SequenceAntisense Oligonucleotide 27ggcaggttct
tccagtgaca 202820DNAArtificial SequenceAntisense Oligonucleotide
28tgaccaagct tggcaagttc 202920DNAArtificial SequenceAntisense
Oligonucleotide 29tataacacca aggactaatc 203020DNAArtificial
SequenceAntisense Oligonucleotide 30ccatctgaca ttgggatcca
203120DNAArtificial SequenceAntisense Oligonucleotide 31tgtggtgtca
tagaggacca 203220DNAArtificial SequenceAntisense Oligonucleotide
32atgggatcct ccgatgccaa 203320DNAArtificial SequenceAntisense
Oligonucleotide 33acaccaaggg cgaatctcag 203420DNAArtificial
SequenceAntisense Oligonucleotide 34ttctgtcact ggacatcgtg
203520DNAArtificial SequenceAntisense Oligonucleotide 35cacacggatc
ggttgtgtaa 203620DNAArtificial SequenceAntisense Oligonucleotide
36acatgtcctt cctgtgacag 203720DNAArtificial SequenceAntisense
Oligonucleotide 37cagaaggagg ccctaggctt 203820DNAArtificial
SequenceAntisense Oligonucleotide 38ctggcggtga ccatgtagtc
203920DNAArtificial SequenceAntisense Oligonucleotide 39tctaagtagg
ttgatgcttc 204020DNAArtificial SequenceAntisense Oligonucleotide
40tccttaccca cgtttcagct 204120DNAArtificial SequenceAntisense
Oligonucleotide 41ggaacagtgt cttcgtttga 204220DNAArtificial
SequenceAntisense Oligonucleotide 42gtttggcata gctggtagct
204320DNAArtificial SequenceAntisense Oligonucleotide 43accttaaaag
cttatacaca 204420DNAArtificial SequenceAntisense Oligonucleotide
44atacagaatt tgtcagtcag 204520DNAArtificial SequenceAntisense
Oligonucleotide 45gtcatagcta tgacacctta 204620DNAHomo sapiens
46tgtcacagga aggacctgcc 204720DNAHomo sapiens 47acgcaatgct
cagacgcaga 204820DNAHomo sapiens 48gactgccgtc gcgcctccga
204920DNAHomo sapiens 49tgtcacagga agaacctgcc 205020DNAHomo sapiens
50tggcagctcc ttattgttat 205120DNAHomo sapiens 51agaacctgcc
aagcttggtc 205220DNAHomo sapiens 52gtggcagctc cttattgtta
205320DNAHomo sapiens 53cgcaatgctc agacgcagaa 205420DNAHomo sapiens
54gagggatccc ggtgtcaggt 205520DNAHomo sapiens 55tggcttgatc
atgaactact 205620DNAHomo sapiens 56tggatcccaa tgtcagatgg
205720DNAHomo sapiens 57tggtcctcta tgacaccaca 205820DNAHomo sapiens
58ttggcatcgg aggatcccat 205920DNAHomo sapiens 59ctgagattcg
cccttggtgt 206020DNAHomo sapiens 60cacgatgtcc agtgacagaa
206120DNAHomo sapiens 61ttacacaacc gatccgtgtg 206220DNAHomo sapiens
62ctgtcacagg aaggacatgt 206320DNAHomo sapiens 63gactacatgg
tcaccgccag 206420DNAHomo sapiens 64gaagcatcaa cctacttaga
206520DNAHomo sapiens 65agctgaaacg tgggtaagga 206620DNAHomo sapiens
66tcaaacgaag acactgttcc 206720DNAHomo sapiens 67agctaccagc
tatgccaaac 206820DNAHomo sapiens 68tgtgtataag cttttaaggt
206920DNAHomo sapiens 69taaggtgtca tagctatgac 207020DNAArtificial
SequenceAntisense Oligonucleotide 70ctcttactgt gctgtggaca
207120DNAArtificial SequencePCR Primer 71ggcaaattca acggcacagt
207220DNAArtificial SequencePCR Primer 72gggtctcgct cctggaagat
207327DNAArtificial SequencePCR Probe 73aaggccgaga atgggaagct
tgtcatc 27
* * * * *