U.S. patent application number 13/568892 was filed with the patent office on 2012-12-13 for nucleic acid detection and quantification by post-hybridization labeling and universal encoding.
This patent application is currently assigned to FIREFLY BIOWORKS, INC.. Invention is credited to Timothy Erps, Daniel C. Pregibon, Isaac Stoner, Andreas Windemuth.
Application Number | 20120316082 13/568892 |
Document ID | / |
Family ID | 45098634 |
Filed Date | 2012-12-13 |
United States Patent
Application |
20120316082 |
Kind Code |
A1 |
Pregibon; Daniel C. ; et
al. |
December 13, 2012 |
NUCLEIC ACID DETECTION AND QUANTIFICATION BY POST-HYBRIDIZATION
LABELING AND UNIVERSAL ENCODING
Abstract
The present invention provides, among other things, methods and
compositions for detecting and quantifying target nucleic acids via
post-hybridization labeling.
Inventors: |
Pregibon; Daniel C.;
(Cambridge, MA) ; Stoner; Isaac; (Cambridge,
MA) ; Windemuth; Andreas; (Belmont, MA) ;
Erps; Timothy; (Salem, MA) |
Assignee: |
FIREFLY BIOWORKS, INC.
Cambridge
MA
|
Family ID: |
45098634 |
Appl. No.: |
13/568892 |
Filed: |
August 7, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
PCT/US11/39531 |
Jun 7, 2011 |
|
|
|
13568892 |
|
|
|
|
61352018 |
Jun 7, 2010 |
|
|
|
61365738 |
Jul 19, 2010 |
|
|
|
61387958 |
Sep 29, 2010 |
|
|
|
Current U.S.
Class: |
506/9 ; 506/16;
536/24.3 |
Current CPC
Class: |
C12Q 1/6888 20130101;
C12Q 1/689 20130101; G01N 21/47 20130101; C12Q 1/6816 20130101;
C12Q 1/6895 20130101; C12Q 1/6809 20130101; C12Q 1/6825 20130101;
C12Q 1/70 20130101; G01N 21/6428 20130101; G01N 33/6803 20130101;
C12Q 1/6813 20130101; C12Q 1/6834 20130101; G01N 15/14 20130101;
C12Q 1/6816 20130101; C12Q 2565/626 20130101; C12Q 1/6813 20130101;
C12Q 2525/161 20130101; C12Q 2525/191 20130101; C12Q 2533/107
20130101; C12Q 1/6834 20130101; C12Q 2525/161 20130101; C12Q
2525/191 20130101; C12Q 2533/107 20130101 |
Class at
Publication: |
506/9 ; 506/16;
536/24.3 |
International
Class: |
C40B 30/04 20060101
C40B030/04; C07H 21/04 20060101 C07H021/04; C40B 40/06 20060101
C40B040/06 |
Claims
1. A substrate comprising at least one region bearing one or more
nucleic acid probes, each nucleic acid probe comprising a capturing
sequence for binding a target nucleic acid and an adjacent adapter
sequence for binding a universal adapter such that binding of both
the target nucleic acid and the universal adapter to a same nucleic
acid probe is detectable via post-hybridization labeling.
2. The substrate of claim 1, wherein the capturing sequence and the
adapter sequence are configured such that the binding of both the
target nucleic acid and the universal adapter on the same nucleic
acid probe permits joining of the target nucleic acid to the
universal adapter.
3. The substrate of claim 2, wherein the capturing sequence and the
adapter sequence are configured such that the binding of both the
target nucleic acid and the universal adapter on the same nucleic
acid probe permits joining of the target nucleic acid to the
universal adapter by enzymatic or chemical coupling.
4. The substrate of claim 1, wherein the substrate is a
particle.
5. The substrate of claim 4, wherein the particle is hydrogel.
6. The substrate of claim 4, wherein the particle comprises one or
more encoding regions.
7. The substrate of claim 6, wherein the one or more encoding
regions are separate from or overlap with the at least one
probe-bearing region by inert regions.
8. A nucleic acid probe comprising a capturing sequence for binding
a target nucleic acid and an adjacent adapter sequence for binding
a universal adapter such that binding of both the target nucleic
acid and the universal adapter to the nucleic acid probe is
detectable via post-hybridization labeling.
9. The nucleic acid probe of claim 8, further comprising a nucleic
acid barcode sequence that allows capture of the nucleic acid probe
at a specific location.
10. The nucleic acid probe of claim 9, wherein the capturing
sequence is designed to be complementary to the 3' end sequence of
a microRNA of interest.
11. A method for detecting the presence and/or abundance of target
nucleic acids in a sample: a. contacting a plurality of nucleic
acid probes with a sample, each nucleic acid probe comprising a
capturing sequence for binding a target nucleic acid and an
adjacent adapter sequence for binding a universal adapter; b.
incubating the plurality of probes and the sample, in the presence
of one or more universal adapters, under conditions that permit
binding of both an individual target nucleic acid and an individual
universal adapter to a same individual nucleic acid probe; c.
carrying out a reaction that allows coupling of the individual
universal adapter to the individual target nucleic acid when
hybridized to the same individual nucleic acid probe; d. detecting
the presence of the one or more universal adapters associated with
the plurality of nucleic acid probes, thereby detecting the
presence of the target nucleic acids in the sample.
12. The method of claim 11, wherein the plurality of nucleic acid
probes are attached to a substrate.
13. The method of claim 11, wherein each nucleic acid probe further
comprises a barcode sequence that allows capture of the nucleic
acid probe at a specific location on a substrate.
14. The method of claim 13, wherein the substrate is a
particle.
15. The method of claim 11, wherein the conditions in step (b)
permit the individual target nucleic acid and the individual
universal adapter bind to the same individual nucleic acid probe at
the same time or sequentially.
16. The method of claim 11, wherein the one or more universal
adapters are labeled by one or more detectable moieties.
17. The method of claim 11, wherein the reaction in step c is an
enzymatic coupling reaction.
18. The method of claim 11, wherein the method further comprises a
step of removing uncoupled universal adapters or target nucleic
acids after the coupling step.
19. The method of claim 11, wherein the detecting step comprises
scanning the plurality of objects using a flow-through device.
20. The method of claim 19, wherein the scanning step is performed
above the melting temperature of the universal adapter but below
the melting temperature of the coupled target-adapter.
21. The method of claim 20, wherein the method does not include a
step of removing uncoupled universal adapters or target nucleic
acids after the coupling step.
22. The method of claim 19, wherein the flow-through device is a
flow cytometer.
23. The method of claim 11, wherein the method further comprises a
step of quantifying the amount of the target nucleic acids.
24. The method of claim 11, wherein the target nucleic acids
comprise microRNA.
25. The method of claim 24, wherein the adapter sequence on the
probe is positioned at the end of the target capture sequence in
such a manner that allows efficient labeling of a mature species
but not precursor species.
26. The method of claim 11, wherein the target nucleic acids
comprise multiple species of nucleic acids and wherein the multiple
species of nucleic acids contain variable nucleotide sequence at
one end and identical nucleotide sequence at the other end.
27. A kit for detecting target nucleic acids comprising: a. a
plurality of nucleic acid probes, wherein each individual nucleic
acid probe comprises a capturing sequence for binding a target
nucleic acid of interest and an adjacent adapter sequence for
binding a universal adapter; and b. one or more universal
adapters.
28. The kit of claim 27, wherein the plurality of nucleic acid
probes are attached to a plurality of substrates.
29. The kit of claim 27, wherein the kit further comprises a
reagent that couples the target nucleic acid and the universal
adapter to each other post-hybridization to a same nucleic acid
probe.
30. The kit of claim 27, wherein the universal adapter is
detectably labeled.
Description
RELATED REFERENCES
[0001] This application is a continuation of International
Application No. PCT/US11/39531, filed Jun. 7, 2011 which claims
priority to U.S. provisional patent application Ser. No.
61/352,018, filed Jun. 7, 2010, Ser. No. 61/365,738, filed Jul. 19,
2010, and Ser. No. 61/387,958, filed Sep. 29, 2010, the entire
contents of which are herein incorporated by reference.
SEQUENCE LISTING
[0002] In accordance with 37 CFR 1.52(e)(5), a Sequence Listing in
the form of a text file (entitled "Sequence Listing.txt," created
on Aug. 6, 2012, and 14 kilobytes in size) is incorporated herein
by reference in its entirety.
BACKGROUND
[0003] The multiplexed detection of biomolecules plays an important
role in clinical diagnostics, discovery, and basic science. This
requires the ability to both encode substrates associated with
specific biomolecule targets, and also to associate a detectable
signal to the biomolecule target being quantified. For multiplexed
assays, it is common to use functionalized substrates, planar or
particle-based, to capture and quantify targets. In the case of
particle-based multiplexed assays, each particle is functionalized
with a probe that captures a specific target, and encoded for
identification during analysis. In order to quantify the amount of
target captured on a particle, a suitable labeling scheme is
typically used to provide a measurable signal associated with the
target. One class of molecules that is particularly challenging to
quantify due to limitations with existing approaches to labeling is
microRNA (miRNA).
[0004] miRNAs are short non-coding RNAs that mediate protein
translation and are known to be dysregulated in diseases including
diabetes, Alzheimer's, and cancer. With greater stability and
predictive value than mRNA, this relatively small class of
biomolecules has become increasingly important in disease diagnosis
and prognosis. However, the sequence homology, wide range of
abundance, and common secondary structures of miRNAs have
complicated efforts to develop accurate, unbiased quantification
techniques. Applications in the discovery and clinical fields
require high-throughput processing, large coding libraries for
multiplexed analysis, and the flexibility to develop custom assays.
Microarray approaches provide high sensitivity and multiplexing
capacity, but their low-throughput, complexity, and fixed design
make them less than ideal for use in a clinical setting. PCR-based
strategies suffer from similar throughput issues, require lengthy
optimization for multiplexing, and are only semi-quantitative.
Existing bead-based systems provide a high sample throughput
(>100 samples per day), but with reduced sensitivity, dynamic
range, and multiplexing capacities. Therefore, there is a need for
improved methods for detecting and quantifying nucleic acids, such
as, miRNA.
[0005] The multiplexed detection of miRNAs, or any other
biomolecules requires the ability to encode a substrate associated
with each. There are two broad classes of technologies used for
multiplexing--planar arrays and suspension (particle-based) arrays,
both of which have application-specific advantages. While planar
arrays rely strictly on positional encoding, suspension arrays have
utilized a great number of encoding schemes that can be classified
as spectrometric, graphical, electronic, or physical.
[0006] Spectrometric encoding encompasses any scheme that relies on
the use of specific wavelengths of light or radiation (including
fluorophores, chromophores, photonic structures, or Raman tags) to
identify a species. Fluorescence-encoded microbeads can be rapidly
processed using conventional flow-cytometry (or on fiber-optic
arrays), making them a popular platform for multiplexing. Most
spectrometric encoding methods rely on the encapsulation of
detectable entities for encoding, which can be very challenging
depending on the substrate used. A more robust and
generally-applicable encoding method is needed to enable rapid,
universal encoding of substrates for multiplexed detection.
SUMMARY
[0007] The present invention provides improved methods and
compositions for highly efficient, multiplexing, robust and
reproducible nucleic acid detection and quantification. The present
invention is, in part, based on the discovery that a
post-hybridization labeling technique can be used with a suitable
flow-through scanning or static imaging system for rapid,
high-performance nucleic acid detection and/or quantification.
Surprisingly, this post-hybridization labeling approach, when used
with a versatile particle encoding method, provides scalable
multiplexing and attomole sensitivity with a simple workflow. As
described in detail below, using this robust platform, miRNA
expression profiling can be accurately analyzed for various cancer
types within three hours using low-input total RNA. Although miRNA
was used as an example, inventive methods and compositions
according to the invention may be used to detect any nucleic acids
(e.g., DNA, RNA) or other types of analytes. Thus, the present
invention represent a significant advance in the field of
multiplexed biomolecule detection and quantification.
[0008] In one aspect, the disclosure in the present application
provides a substrate comprising at least one region bearing one or
more nucleic acid probes, each nucleic acid probe comprising a
capturing sequence for capturing sequence for binding a target
nucleic acid and an adjacent adapter sequence for binding a
universal adapter such that binding of both the target nucleic acid
and the universal adapter to a same nucleic acid probe is
detectable via post-hybridization labeling.
[0009] In one aspect, the disclosure in the present application
provides a nucleic acid probe comprising a capturing sequence for
binding a target nucleic acid and an adjacent adapter sequence for
binding a universal adapter such that binding of both the target
nucleic acid and the universal adapter to the nucleic acid probe is
detectable via post-hybridization labeling.
[0010] In one aspect, the disclosure in the present application
provides a substrate comprising one or more universal encoding
regions, each universal encoding region bearing one or more
single-stranded polynucleotide templates, wherein each template
comprises a stem-loop structure and a predetermined nucleotide
sequence adjacent to the stem-loop structure.
[0011] Among other things, the present invention provides a method
for detecting the presence and/or abundance of target nucleic acids
in a sample. In some embodiments, such a method includes steps of:
contacting a plurality of nucleic acid probes with a sample, each
nucleic acid probe comprising a capturing sequence for binding a
target nucleic acid and an adjacent adapter sequence for binding a
universal adapter; incubating the plurality of probes and the
sample, in the presence of one or more universal adapters, under
conditions that permit binding of both an individual target nucleic
acid and an individual universal adapter to a same individual
nucleic acid probe; carrying out a reaction that allows coupling of
the individual universal adapter to the individual target nucleic
acid when hybridized to the same individual nucleic acid probe; and
detecting the presence of the one or more universal adapters
associated with the plurality of nucleic acid probes, thereby
detecting the presence of the target nucleic acids in the
sample.
[0012] Among other things, the present invention provides a method
of encoding a substrate. In some embodiments, such a method
includes steps of: providing a substrate comprising one or more
encoding regions, each encoding region bearing one or more
single-stranded polynucleotide templates; providing a plurality of
labeled and unlabeled single-stranded encoding adapters, wherein
each individual single-stranded encoding adapter comprises a
sequence designed to specifically bind an individual polynucleotide
template and wherein a labeled single-stranded encoding adapter
comprises a detectable moiety; incubating the substrate with the
plurality of labeled and unlabeled single-stranded encoding
adapters under conditions that allow an individual encoding adapter
to bind its corresponding single-stranded polynucleotide template;
and coupling the individual encoding adapter to its corresponding
polynucleotide template, thereby encoding the substrate.
[0013] Also provided is a kit for detecting target nucleic acids.
In some embodiments, such a kit includes: a plurality of nucleic
acid probes, wherein each individual nucleic acid probe comprises a
capturing sequence for binding a target nucleic acid of interest
and an adjacent adapter sequence for binding a universal adapter;
and one or more universal adapters.
[0014] In this application, the use of "or" means "and/or" unless
stated otherwise. As used in this application, the term "comprise"
and variations of the term, such as "comprising" and "comprises,"
are not intended to exclude other additives, components, integers
or steps. As used in this application, the terms "about" and
"approximately" are used as equivalents. Any numerals used in this
application with or without about/approximately are meant to cover
any normal fluctuations appreciated by one of ordinary skill in the
relevant art. In certain embodiments, the term "approximately" or
"about" refers to a range of values that fall within 25%, 20%, 19%,
18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%,
4%, 3%, 2%, 1%, or less in either direction (greater than or less
than) of the stated reference value unless otherwise stated or
otherwise evident from the context (except where such number would
exceed 100% of a possible value).
[0015] Other features, objects, and advantages of the present
invention are apparent in the detailed description, drawings and
claims that follow. It should be understood, however, that the
detailed description, the drawings, and the claims, while
indicating embodiments of the present invention, are given by way
of illustration only, not limitation. Various changes and
modifications within the scope of the invention will become
apparent to those skilled in the art.
BRIEF DESCRIPTION OF THE FIGURES
[0016] The drawings are for illustration purposes only, not for
limitation.
[0017] FIG. 1 illustrates an exemplary schematic for universal
encoding and functionalization. (a) Hydrogel particles are made to
have several universal encoding regions, each with a stem-loop
structure and unique 4 bp sequence adjacent to the stem-loop, and a
universal anchor in the probe region. In a ligation reaction,
encoding adapters are added at varying ratios of
fluorescently-modified to unmodified in order to achieve a desired
fluorescence level in each region while probes are added with
linker sequence to add functionality to the particle probe region.
(b) An example of two batches of particles with unique code and
probes generated using a universal particle set with varying
ligation adapters.
[0018] FIG. 2 illustrates an exemplary schematic for universal
encoding using multiple fluorophores. Multiple adapter variants may
be used, each with unique emission spectrum, to encode particles or
substrates with more than one color (or otherwise functional
species). The level of each color can be modulated by adjusting the
ratio of each adapter variant to give unique signatures of multiple
fluorescent colors in the coding regions of the particles.
[0019] FIG. 3 illustrates an exemplary schematic of probe-region
functionalization using three-species ligation, two-species
ligation, and chemical modification.
[0020] FIG. 4 illustrates an exemplary schematic showing the use of
polymerase with probe-specific templates to add functionality to
particles or substrates. Universal anchors (in this case there are
two different anchors) are used with linkers that bear a region
specific for one anchor and a probe sequence. Polymerases are used
to extend the anchors along the linker, functionalizing the
particles/substrates in one or multiple regions.
[0021] FIG. 5 illustrates an exemplary schematic of multi-color
scanning with a flow cytometer.
[0022] FIG. 6 illustrates an exemplary schematic of single-color
scanning with a flow-through device.
[0023] FIG. 7 illustrates an exemplary fluorescence scatter plot
for multifunctional particles with a single code region
functionalized with four distinct levels of Cy3 (shows in Channel
2) and Cy5 (Channel 4).
[0024] FIG. 8 shows an exemplary encoded gel particle assay system.
(a) workflow of platform includes (i) hybridization of particles
with target, (ii) incubation of particles with universal labeling
adapter, ligation enzyme, and fluorescent reporter, and (iii)
scanning of particles to determine code identity and amount of
target bound. A typical particle includes a fluorescent barcoded
region and a probe-laden region flanked by two inert sections. The
central-most hole has a fixed value to indicate particle
orientation. (b) Actual PMT fluorescence signatures of 75
flow-aligned particles from a 3-s scan segments. (c) Magnified
signatures of individual particles from (b). Overlaid scans were
acquired on different days and demonstrate reproducibility of
analysis procedure. Scale bar below image is 50 .mu.m.
[0025] FIG. 9 illustrates an exemplary high-throughput flow
alignment device and code design. (a) Image of PDMS focusing
chamber attached to glass slide, with inlets and outlet attached.
Reservoir inlet on the left delivers sheath fluid, while central
pipette tip delivers the particle-bearing fluid. Reservoir outlet
on the right serves as a collection point for particles that have
been scanned. The chamber is mounted on a standard inverted
fluorescence microscope for scanning runs. (b) Images of particles
used to optimize scanner performance. Simple plug particles were
scanned to maximize signal-to-noise ratio (SNR) and frequency
response of detection circuit. Particles with holes of various
areas were used to determine the minimum differences in size
required to distinguish between coding levels. Scale bars are 50
.mu.m. (c) In the final particle design, coding holes were
separated by 8 .mu.m, and the lengths of the holes were 15, 27.5,
and 40 .mu.m for levels 1, 2, and 3, respectively. All holes had a
width of 12 .mu.m.
[0026] FIG. 10 illustrates exemplary post-hybridization miRNA
labeling via ligation to a universal adapter. (a) DNA probes, lined
at their 5' end throughout the probe region of encoded hydrogel
particles, contain a miRNA_specific sequence adjacent to a
universal adapter sequence such that the 3' end of a captured
target would abut the 5' end of a captured adapter oligonucleotide.
The probe is capped with an inverted dT to mitigate incidental
ligation and the adapter has a poly(a) spacer to extend its
biotinylated 3' end away from the hydrogel backbone for efficient
reporting. (b) After particles are hybridized with total RNA, T4
DNA streptavidin-phycoerythrin (SA-PE) is used as a fluorescent
reporter. (c) the assay provides about atomole detection limits,
defined at signal-to-noise=3. (d) single-nucleotide specificity is
provided when synthetic let-7a RNA is spiked at 500 amol with
particles bearing probes for let-7a, b, c, and d.
[0027] FIG. 11 illustrates an exemplary result showing relative
ligation efficiency over time. Error bars represent the standard
deviation taken over measurements from five particles.
[0028] FIG. 12 illustrates an exemplary result showing effect of
universal adapter poly(A) tail length on fluorescence signal when
using biotinylated adapters with a streptavidin-phycoerythrin
reporter. Signals are relative to that measured for a tail length
of 12 bp.
[0029] FIG. 13 illustrates an exemplary direct labeling with
fluorophore-conjugated adapters, which are ligated to the end of
captured targets. Non-ligated adapters can be rinsed away and the
particles are imaged (or scanned in a flow through device).
Fluorescence in the probe-region of the particles is indicative of
the amount of target present.
[0030] FIG. 14 illustrates an exemplary multiplexed detection using
multiple adapters with different fluorescent colors. A given probe
region of a particle may contain several unique probes, with common
or differing adapters sequences. Adapters bearing fluorophores with
unique emission spectra (fluorescent or other) can be ligated to
indicate the capture of multiple targets within a given probe
region. The amount of fluorescence from each fluorophore may be
quantified independently to determine the amount of each target
present.
[0031] FIG. 15 illustrates an exemplary system performance in
12-plex assay. (a) Calibration curves for particle batches, with
background-subtracted signal plotted against spiked target amount.
miR-210, -221, -222 and let-7a were spiked into the same incubation
mixes at the indicated amounts. the remaining seven
naturally-occurring targets (`+` symbols) were spiked into the 27-
and 243-amol trials to validate performance. For all trials, 200 ng
of E. coli total RNA was also spiked in for complexity. Mean COV of
target level is 6.35% when considering target levels greater than 5
amol. Each point represents, on average, 19 particles from a single
run. (b) Specificity of let-7a probe in the presence of sequences
closely related to intended target (see inset box for target set).
We observed a maximum cross-reactivity of only 27%. (c) Cancer
profiling results for four types of human tissue. Error bars
represent standard deviation in triplicate measurements on aliquots
of the same single-patient sample. Amount of total RNA used in
assays is 250 ng, unless otherwise noted.
[0032] FIG. 16 illustrates exemplary results showing limit of
detection calculations and calibration curves for neat samples. (a)
Extrapolation of SNR for determination of limit of detection (LOD).
The LODs of the four calibration targets (see legend) were
calculated by finding the target amount at which the SNR was three.
Regression lines with a mean Pearson coefficient of 0.9965
(excluding miR-222) were used to extrapolate LODs. (b) Calibration
curves for particle batches incubated without spiked E. coli total
RNA. Except for the absence of E. coli RNA, conditions are
identical to those used to construct FIG. 3a. (c) Comparison of
background-subtracted signals from neat and E. coli calibration
measurements. Clustering of points around the identity line (red)
indicates highly specific detection with no noticeable decrease in
binding rates in more complex samples. For all plots, all target
levels (except miSpike) have been adjusted for comparison purposes
by using the background-subtracted signal from the 100-amol miSpike
profiles.
[0033] FIG. 17 illustrates an exemplary dysregulation
classification. A SNR was used to distinguish dysregulated targets
in tissue profiling. The mean and standard deviation of the
log-transformed expression ratio were calculated for each target in
each tissue for the triplicate assays. A SNR of three was chosen as
the threshold for dysregulation. All 20 instances of dysregulation
matched observations in the literature
[0034] FIG. 18 illustrates exemplary results showing coefficient of
variation (COV) of target level as a function of number of
particles analyzed. The COV of the target level for let-7a in the
E. coli calibration scans was seen to stabilize to a nearly
constant value in the 10-15 particle window for the five spike-in
amounts presented above.
[0035] FIG. 19 illustrates a conceptual example of how scanning of
multifunctional particles could be implemented. Standard cytometery
records "events" as instances where the signal from a selected
detector breaks a threshold, recording single beads as single
events, and saving data for each channel. Multifunctional particles
bear functional regions that can be doped with triggering entities
(that cause scatter for instance) and single particles are recorded
as multiple events. By analyzing the shape and time-sequence of
these events, and by appropriately designing particles, one can
reconstruct from this series of events, which ones belong in the
same particle.
[0036] FIG. 20 illustrates exemplary comparison of scanning
fluorescent calibration beads versus multifunctional particles.
Shown is particle design (top), recorded events at each 1 ms
timestamp (middle), and distribution of events per timestamp for
timestamps where at least one event was recorded for calibration
beads and multi-functional particles with two fluorescent regions
(bottom).
[0037] FIG. 21 illustrates exemplary design and use of a standard
set of test particles to assess alignment and consistency of
scan.
[0038] FIG. 22 illustrates exemplary results of a standard set of
test particles to assess alignment and consistency of scan.
[0039] FIG. 23 illustrates exemplary results of nucleic acid
detection using particles with a single, wide fluorescent region to
represent a "barcode" and a narrow probe region.
[0040] FIG. 24 illustrates exemplary results of average scans along
the particle length (averaging over half of the width). The bottom
signal, second lowest signal, second highest signal, and highest
signal correspond to 12.5%, 25%, 50%, and 100% fluorescent ligation
mix solutions, respectively.
[0041] FIG. 25 illustrates examples of a) particle design and
images for each mixture; and b) average scans over 5 particles for
each mixture. (1 .mu.m.about.3.3 px, numbers in legend represent F1
and F2.)
[0042] FIG. 26 illustrates exemplary results of measured
fluorescence versus the adapter amount from each ligation mix.
[0043] FIG. 27 illustrates exemplary general particle design for
universal encoding.
[0044] FIG. 28 illustrates exemplary fluorescent signal obtained in
Barcode 1 region with varying ratios of fluorescent (Cy3) to
non-fluorescent adapter.
[0045] FIG. 29 illustrates exemplary plot of events associated with
barcoded gel particles. Shown on the left is a plot of YEL
fluorescence (used for barcoding) versus RED2 fluorescence (used
for triggering) and on the right YEL fluorescence (used for
barcoding) versus GRN fluorescence (used for orientation).
[0046] FIG. 30 illustrates exemplary demonstration of 25-plex
encoding using 5 unique levels of YEL fluorescence on both Barocode
1 and Barcode 2 regions of encoded particles. These data have been
reconstructed from raw events saved in a FCS file from the Guava
software.
[0047] FIG. 31 illustrates exemplary demonstration of attomole
sensitivity (left), >3 log dynamic range (left), and
single-nucleotide specificity (right) using Firefly BioWorks'
custom assay for microRNA targets. We used Firefly's 3-hour assay
(total RNA to results) to detect dilutions of eleven microRNA
targets spiked into 250 ng of E. coli total RNA, reporting the
average detector signal versus spike-in amount with inter-run COV
(inset). Specificity was assessed by spiking let-7a RNA target
samples containing particles bearing probes for let-7a,7b, 7c, and
7d--each which varied by only one or two nucleotides (right).
[0048] FIG. 32 illustrates exemplary multiplexed isothermal
amplification and capture assay for panel-based pathogen detection.
Fluorescent amplicons generated using reverse transcription
helicase-dependent amplification (RT-HDA) will be captured on
encoded hydrogel particles in a single step. Each particle, bearing
probe regions for three signatures of a given species and
porosity-tuned to exclude helicase penetration, will immediately be
scanned in a microdevice without the need for rinsing. The high
sensitivity of encoded gel particles and two-levels of specificity
(amplification and hybridization) will mitigate false-positive or
negative reads.
[0049] FIG. 33 illustrates exemplary proof-of-concept one-pot
assays using standard PCR and isothermal amplification,
demonstrating specificity of amplification and sensitive detection
of .about.11 template copies. We assessed the specificity of
amplification for two targeted regions of .lamda.-phage DNA, using
a one-pot reaction with probes designed against the amplicons
generated by two separate primer sets. Template .lamda.-phage was
spiked into (+) samples at .about.11,000 copies for specificity
tests, though we were also able to detect amplified product with
only .about.11 copies present (right). For specificity against
human genomic DNA, we spiked .about.11,000 copies of human genomic
DNA into the reaction with no .lamda.-phage present.
[0050] FIG. 34 illustrates exemplary amplification primer (left)
and amplicon probe (right) design for multiplexed detection assays.
Forward primers will have a single Cy3 fluorophore. Probes will be
designed to have a T.sub.m than primers and will be 3'
phosphorylated to avoid incidental 3'-extension.
[0051] FIG. 35 illustrates exemplary design of barcoded gel
particles for species-specific amplicon quantification.
DEFINITIONS
[0052] In order for the present invention to be more readily
understood, certain terms are first defined below. Additional
definitions for the following terms and other terms are set forth
throughout the specification.
[0053] In order for the present invention to be more readily
understood, certain terms are first defined below. Additional
definitions for the following terms and other terms are set forth
throughout the specification.
[0054] "Adjacent": As used herein, the term "adjacent" means "next
to," "contiguous," "adjoining," "abutting" or having a common
boundary.
[0055] "Analyte": As used herein, the term "analyte" broadly refers
to any substance to be analyzed, detected, measured, or quantified.
Examples of analytes include, but are not limited to, proteins,
peptides, hormones, haptens, antigens, antibodies, receptors,
enzymes, nucleic acids, polysaccharides, chemicals, polymers,
pathogens, toxins, organic drugs, inorganic drugs, cells, tissues,
microorganisms, viruses, bacteria, fungi, algae, parasites,
allergens, pollutants, and combinations thereof.
[0056] "Associated": As used herein, the terms "associated",
"conjugated", "linked", "attached", "complexed", and "tethered,"
and grammatical equivalents, typically refer to two or more
moieties connected with one another, either directly or indirectly
(e.g., via one or more additional moieties that serve as a linking
agent), to form a structure that is sufficiently stable so that the
moieties remain connected under the conditions in which the
structure is used, e.g., physiological conditions. In some
embodiments, the moieties are attached to one another by one or
more covalent bonds. In some embodiments, the moieties are attached
to one another by a mechanism that involves specific (but
non-covalent) binding (e.g. streptavidin/avidin interactions,
antibody/antigen interactions, etc.). Alternatively or
additionally, a sufficient number of weaker interactions
(non-covalent) can provide sufficient stability for moieties to
remain connected. Exemplary non-covalent interactions include, but
are not limited to, affinity interactions, metal coordination,
physical adsorption, host-guest interactions, hydrophobic
interactions, pi stacking interactions, hydrogen bonding
interactions, van der Waals interactions, magnetic interactions,
electro-static interactions, dipole-dipole interactions, etc.
[0057] "Biomolecules": The term "biomolecules", as used herein,
refers to molecules (e.g., proteins, amino acids, peptides,
polynucleotides, nucleotides, carbohydrates, sugars, lipids,
nucleoproteins, glycoproteins, lipoproteins, steroids, etc.)
whether naturally-occurring or artificially created (e.g., by
synthetic or recombinant methods) that are commonly found in cells
and tissues. Specific classes of biomolecules include, but are not
limited to, enzymes, receptors, neurotransmitters, hormones,
cytokines, cell response modifiers such as growth factors and
chemotactic factors, antibodies, vaccines, haptens, toxins,
interferons, ribozymes, anti-sense agents, plasmids, DNA, and
RNA.
[0058] "Biocompatible": The term "biocompatible", as used herein is
intended to describe materials that do not elicit a substantial
detrimental response in vivo. In some embodiments, a substance is
considered to be "biocompatible" if its addition to cells in vitro
or in vivo results in less than or equal to about 50%, about 45%,
about 40%, about 35%, about 30%, about 25%, about 20%, about 15%,
about 10%, about 5%, or less than about 5% cell death.
[0059] "Biodegradable": As used herein, the term "biodegradable"
refers to substances that are degraded under physiological
conditions. In some embodiments, a biodegradable substance is a
substance that is broken down by cellular machinery. In some
embodiments, a biodegradable substance is a substance that is
broken down by chemical processes.
[0060] "Complement": As used herein, the terms "complement,"
"complementary" and "complementarity," refer to the pairing of
nucleotide sequences according to Watson/Crick pairing rules. For
example, a sequence 5'-GCGGTCCCA-3' has the complementary sequence
of 5'-TGGGACCGC-3'. A complement sequence can also be a sequence of
RNA complementary to the DNA sequence. Certain bases not commonly
found in natural nucleic acids may be included in the complementary
nucleic acids including, but not limited to, inosine,
7-deazaguanine, Locked Nucleic Acids (LNA), and Peptide Nucleic
Acids (PNA). Complementary need not be perfect; stable duplexes may
contain mismatched base pairs, degenerative, or unmatched bases.
Those skilled in the art of nucleic acid technology can determine
duplex stability empirically considering a number of variables
including, for example, the length of the oligonucleotide, base
composition and sequence of the oligonucleotide, ionic strength and
incidence of mismatched base pairs.
[0061] "Contemporaneous" and "non-contemporaneous": As used herein,
the terms "contemporaneous," "contemporaneously," or grammatical
equivalents, mean that multiple events occur or happen at the same
time without a detectable or identifiable sequential order. As used
herein, the terms "non-contemporaneous," "non-contemporaneously,"
or grammatical equivalents, mean that multiple events occur or
happen in a detectable or identifiable sequential order.
[0062] "Crude": As used herein, the term "crude," when used in
connection with a biological sample, refers to a sample which is in
a substantially unrefined state. For example, a crude sample can be
cell lysates or biopsy tissue sample. A crude sample may exist in
solution or as a dry preparation.
[0063] "Encoding region," "coding region," or "barcoded region": As
used herein, the terms "encoding region," "coding region,"
"barcoded region", or grammatical equivalents, refer to a region on
an object or substrate (e.g., particle) that can be used to
identify the object or substrate (e.g., particle). These terms may
be used inter-changeably. Typically, an encoding region of an
object bears graphical and/or optical features associated with the
identity of the object. Such graphical and/or optical features are
also referred to as signature features of the object. In some
embodiments, an encoding region of an object bears spatially
patterned features (e.g., stripes with various shapes and/or
dimensions, or a series of holes with various sizes) that give rise
to variable fluorescent intensities (of one or multiple
wavelengths). In some embodiments, an encoding region of an object
bears various type and/or amount of fluorophores or other
detectable moieties, in various spatial patterns, that give rise to
variable fluorescent signals (e.g., different colors and/or
intensities) in various patterns.
[0064] "Functionalization: As used herein, the term
"functionalization" refers to any process of modifying a material
by bringing physical, chemical or biological characteristics
different from the ones originally found on the material.
Typically, functionalization involves introducing functional groups
to the material. As used herein, functional groups are specific
groups of atoms within molecules that are responsible for the
characteristic chemical reactions of those molecules. As used
herein, functional groups include both chemical (e.g., ester,
carboxylate, alkyl) and biological groups (e.g., adapter, or linker
sequences).
[0065] "Hybridize": As used herein, the term "hybridize" or
"hybridization" refers to a process where two complementary nucleic
acid strands anneal to each other under appropriately stringent
conditions. Oligonucleotides or probes suitable for hybridizations
typically contain 10-100 nucleotides in length (e.g., 18-50, 12-70,
10-30, 10-24, 18-36 nucleotides in length). Nucleic acid
hybridization techniques are well known in the art. See, e.g.,
Sambrook, et al., 1989, Molecular Cloning: A Laboratory Manual,
Second Edition, Cold Spring Harbor Press, Plainview, N.Y. Those
skilled in the art understand how to estimate and adjust the
stringency of hybridization conditions such that sequences having
at least a desired level of complementary will stably hybridize,
while those having lower complementary will not. For examples of
hybridization conditions and parameters, see, e.g., Sambrook, et
al., 1989, Molecular Cloning: A Laboratory Manual, Second Edition,
Cold Spring Harbor Press, Plainview, N.Y.; Ausubel, F. M. et al.
1994, Current Protocols in Molecular Biology. John Wiley &
Sons, Secaucus, N.J.
[0066] "Hydrodynamic diameter": The term "hydrodynamic diameter",
as used herein, generally refers to the effective diameter of a
hydrated molecule (e.g., macromolecules, colloids, or particles) in
solution, corresponding to the diameter of a sphere with equal
mobility in solution. In some embodiments, a hydrodynamic diameter
is used to describe the measured size of particles in solution. In
certain embodiments, hydrodynamic diameter may be determined by
dynamic light scattering size measurement. For example, Zetasizer
Nano ZS instrument (Malvern) can be used to measure the
hydrodynamic diameter of particles as demonstrated in the Example
Section below.
[0067] "Inert region": As used herein, the terms "inert region,"
"inert spacer" or grammatical equivalents, when used in connection
with a region on an object (e.g., particle), refer to a region that
is not detectable above a pre-determined triggering threshold by a
flow-through scanning device such as a flow cytometer. Typically,
an inert region or spacer is a non-functionalized region. For
example, an inert region is a region not loaded with probes or
other detectable moieties.
[0068] "Interrogate": As used herein, the terms "interrogate,"
"interrogating," "interrogation" or grammatical equivalents, refer
to a process of characterizing or examining to obtain data.
[0069] "Labeled": The terms "labeled" and "labeled with a
detectable agent or moiety" are used herein interchangeably to
specify that an entity (e.g., a nucleic acid probe, antibody, etc.)
can be visualized, for example following binding to another entity
(e.g., a nucleic acid, polypeptide, etc.). The detectable agent or
moiety may be selected such that it generates a signal which can be
measured and whose intensity is related to (e.g., proportional to)
the amount of bound entity. A wide variety of systems for labeling
and/or detecting proteins and peptides are known in the art.
Labeled proteins and peptides can be prepared by incorporation of,
or conjugation to, a label that is detectable by spectroscopic,
photochemical, biochemical, immunochemical, electrical, optical,
chemical or other means. A label or labeling moiety may be directly
detectable (i.e., it does not require any further reaction or
manipulation to be detectable, e.g., a fluorophore is directly
detectable) or it may be indirectly detectable (i.e., it is made
detectable through reaction or binding with another entity that is
detectable, e.g., a hapten is detectable by immunostaining after
reaction with an appropriate antibody comprising a reporter such as
a fluorophore). Suitable detectable agents include, but are not
limited to, radionucleotides, fluorophores, chemiluminescent
agents, microparticles, enzymes, colorimetric labels, magnetic
labels, haptens, molecular beacons, aptamer beacons, and the
like.
[0070] "Monodisperse": As used herein, the terms "monodisperse" or
"monosized" refer to a collection of objects that have
substantially the same size and shape when in the context of
particles, and substantially the same mass in the context of
polymers. Conversely, a collection of objects that have an
inconsistent size, shape and mass distribution are called
polydisperse. Monodisperse particles are typically synthesized
through the use of template-based synthesis.
[0071] "Object" or "substrate": As used herein, the terms "object"
and "substrate" are used interchangeably and refer to any discrete
mass. An object or substrate can be a particle, bead, planar
surface, phage, macromolecules, cell, micro-organism, and the
like.
[0072] "Particle": The term "particle," as used herein, refers to a
discrete object. Such object can be of any shape or size.
Composition of particles may vary, depending on applications and
methods of synthesis. Suitable materials include, but are not
limited to, plastics, ceramics, glass, polystyrene, methylstyrene,
acrylic polymers, metal, paramagnetic materials, thoria sol, carbon
graphited, titanium dioxide, latex or cross-linked dextrans such as
Sepharose, cellulose, nylon, cross-linked micelles and teflon. In
some embodiments, particles can be optically or magnetically
detectable. In some embodiments, particles contain fluorescent or
luminescent moieties, or other detectable moieties. In some
embodiments, particles having a diameter of less than 1000
nanometers (nm) are also referred to as nanoparticles.
[0073] "Polynucleotide", "nucleic acid", or "oligonucleotide": The
terms "polynucleotide", "nucleic acid", or "oligonucleotide" refer
to a polymer of nucleotides. The terms "polynucleotide", "nucleic
acid", and "oligonucleotide", may be used interchangeably.
Typically, a polynucleotide comprises at least three nucleotides.
DNAs and RNAs are polynucleotides. The polymer may include natural
nucleosides (i.e., adenosine, thymidine, guanosine, cytidine,
uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and
deoxycytidine), nucleoside analogs (e.g., 2-aminoadenosine,
2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine,
C5-propynylcytidine, C5-propynyluridine, C5-bromouridine,
C5-fluorouridine, C5-iodouridine, C5-methylcytidine,
7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine,
O(6)-methylguanine, and 2-thiocytidine), chemically modified bases,
biologically modified bases (e.g., methylated bases), intercalated
bases, modified sugars (e.g., 2'-fluororibose, ribose,
2'-deoxyribose, arabinose, and hexose), or modified phosphate
groups (e.g., phosphorothioates and 5'-N-phosphoramidite
linkages).
[0074] "Probe": As used herein, the term "probe" refers to a
fragment of DNA or RNA of variable length (e.g., 3-1000 bases
long), which is used to detect the presence of target nucleotide
sequences that are complementary to the sequence in the probe.
Typically, the probe hybridizes to single-stranded nucleic acid
(DNA or RNA) whose base sequence allows probe-target base pairing
due to complementarity between the probe and target.
[0075] "Secondary Structure": As used herein, the term "secondary
structure", when used in connection with a nucleic acid structure,
refers to any structure formed by basepairing interactions within a
single molecule or set of interacting molecules. Exemplary
secondary structures include stem-loop or double helix.
[0076] "Signal": As used herein, the term "signal" refers to a
detectable and/or measurable entity. In certain embodiments, the
signal is detectable by the human eye, e.g., visible. For example,
the signal could be or could relate to intensity and/or wavelength
of color in the visible spectrum. Non-limiting examples of such
signals include colored precipitates and colored soluble products
resulting from a chemical reaction such as an enzymatic reaction.
In certain embodiments, the signal is detectable using an
apparatus. In some embodiments, the signal is generated from a
fluorophore that emits fluorescent light when excited, where the
light is detectable with a fluorescence detector. In some
embodiments, the signal is or relates to light (e.g., visible light
and/or ultraviolet light) that is detectable by a
spectrophotometer. For example, light generated by a
chemiluminescent reaction could be used as a signal. In some
embodiments, the signal is or relates to radiation, e.g., radiation
emitted by radioisotopes, infrared radiation, etc. In certain
embodiments, the signal is a direct or indirect indicator of a
property of a physical entity. For example, a signal could be used
as an indicator of amount and/or concentration of a nucleic acid in
a biological sample and/or in a reaction vessel.
[0077] "Specific": As used herein, the term "specific," when used
in connection with an oligonucleotide primer, refers to an
oligonucleotide or primer, under appropriate hybridization or
washing conditions, is capable of hybridizing to the target of
interest and not substantially hybridizing to nucleic acids which
are not of interest. Higher levels of sequence identity are
preferred and include at least 60%, 65%, 70%, 75%, 80%, 85%, 90%,
95%, 98%, 99%, or 100% sequence identity. In some embodiments, a
specific oligonucleotide or primer contains at least 4, 6, 8, 10,
12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 35, 40, 45, 50, 55, 60, 65,
70, or more bases of sequence identity with a portion of the
nucleic acid to be hybridized or amplified when the oligonucleotide
and the nucleic acid are aligned.
[0078] "Stem-loop": As used herein, the term "stem-loop", when used
in connection with a nucleic acid structure, refers to a structure
caused by an intramolecular base pairing typically occurring in
single-stranded DNA or in RNA. The structure is also known as a
hairpin or hairpin loop. Typically, it occurs when two regions of
the same strand, usually complementary in nucleotide sequence when
read in opposite directions, base-pair to form a double helix that
ends in an unpaired loop, resulting in lollipop-shaped
structure.
[0079] "Substantially": As used herein, the term "substantially"
refers to the qualitative condition of exhibiting total or
near-total extent or degree of a characteristic or property of
interest. One of ordinary skill in the biological arts will
understand that biological and chemical phenomena rarely, if ever,
go to completion and/or proceed to completeness or achieve or avoid
an absolute result. The term "substantially" is therefore used
herein to capture the potential lack of completeness inherent in
many biological and chemical phenomena.
[0080] "Substantially complementary": As used herein, the term
"substantially complementary" refers to two sequences that can
hybridize under stringent hybridization conditions. The skilled
artisan will understand that substantially complementary sequences
need not hybridize along their entire length. In some embodiments,
"stringent hybridization conditions" refer to hybridization
conditions at least as stringent as the following: hybridization in
50% formamide, 5.times.SSC, 50 mM NaH.sub.2PO.sub.4, pH 6.8, 0.5%
SDS, 0.1 mg/mL sonicated salmon sperm DNA, and 5.times.Denhart's
solution at 42.degree. C. overnight; washing with 2.times.SSC, 0.1%
SDS at 45.degree. C.; and washing with 0.2.times.SSC, 0.1% SDS at
45.degree. C. In some embodiments, stringent hybridization
conditions should not allow for hybridization of two nucleic acids
which differ over a stretch of 20 contiguous nucleotides by more
than two bases.
DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS
[0081] The present invention provides, among other things, methods
and compositions for detecting and quantifying target nucleic acids
via post-hybridization labeling. In some embodiments, the present
invention provides a method for detecting the presence and/or
abundance of target nucleic acids in a sample by (a) contacting a
plurality of nucleic acid probes with a sample, each nucleic acid
probe comprising a capturing sequence for binding a target nucleic
acid and an adjacent adapter sequence for binding a universal
adapter; (b) incubating the plurality of probes and the sample, in
the presence of one or more universal adapters, under conditions
that permit binding of both an individual target nucleic acid and
an individual universal adapter to a same individual nucleic acid
probe; (c) carrying out a reaction that allows coupling of the
individual universal adapter to the individual target nucleic acid
when hybridized to the same individual nucleic acid probe; (d)
detecting the presence of the one or more universal adapters
associated with the plurality of nucleic acid probes, thereby
detecting the presence of the target nucleic acids in the sample.
Typically, universal adapters are labeled with detectable moieties
or other labeling groups to facilitate detection. In some
embodiments, the plurality of nucleic acid probes suitable for the
invention are attached to a substrate or object (e.g., microarray,
or particle).
[0082] In addition, it is contemplated that such ligation-based
approach (or other coupling approach) may be used to encode or
otherwise functionalize various objects or substrates (e.g.,
particles). Thus, in some embodiments, the present invention
provides methods and compositions for universal encoding. In
particular embodiments, the present invention provides a method of
encoding an object (e.g., particle) by (a) providing an object or a
substrate (e.g., particle) containing one or more encoding regions
with each encoding region bearing one or more single-stranded
polynucleotide templates; (b) providing a blend of detectably
labeled (e.g., labeled with fluorophores or other detectable
moieties) and unlabeled single-stranded encoding adapters, wherein
each individual encoding adapter contains a sequence designed to
specifically bind a polynucleotide template; (c) incubating the
object with the encoding adapters under conditions that allow
individual encoding adapters to bind their corresponding
polynucleotide templates; and (d) coupling the encoding adapters to
their corresponding polynucleotide templates, thereby encoding the
object or substrate. In some embodiments, by varying the amount of
labeled adapter versus unlabeled adapter (with the same or similar
sequence), it is possible to control the amount of signal generated
(e.g., fluorescence) in each encoding region. Alternatively or
additionally, objects or substrates (e.g., particles) embedded with
nucleic acid anchors in a probe region can be used to attach
desired probes to functionalize the probe region of objects or
substrates (e.g., particles). In this manner, encoding and probe
functionalization can be achieved in a single reaction.
[0083] Thus, inventive methods according to the present invention
enable the production of several batches of objects (e.g.,
particles) with unique codes and probes from a single batch of
objects (e.g., particles) with a universal architecture. For highly
multiplexed assays, this greatly reduces production time and cost
compared to independent synthesis particle batches for each target.
Importantly, particles generated using this method can also be used
with post-hybridization labeling approach for highly effective
nucleic acid (e.g., microRNA) detection and quantification
described herein.
[0084] Various aspects of the invention are described in further
detail in the following subsections. The use of subsections is not
meant to limit the invention. Each subsection may apply to any
aspect of the invention. In this application, the use of "or" means
"and/or" unless stated otherwise.
Nucleic Acid Probes for Post-Hybridization Labeling
[0085] Nucleic acid probes suitable for the present invention are
designed to generate a detectable signal indicating the presence
and capture of nucleic acid targets, e.g., miRNA targets. Thus, in
some embodiments, a nucleic acid probe suitable for the present
invention includes a capturing sequence for binding a target
nucleic acid of interest and an adjacent adapter sequence for
binding a universal adapter. According to the invention, the
capturing sequence and the adapter sequence are configured such
that binding of both the target nucleic acid and the universal
adapter to the nucleic acid probe permits joining of the universal
adapter to the target nucleic acid. In some embodiments, once both
the target nucleic acid and the universal adapter bound to the
nucleic acid probe, the 3' end of the target would abut the 5' end
of the universal adapter. In some embodiments, once both the target
nucleic acid and the universal adapter bound to the nucleic acid
probe, the 5' end of the target would abut the 3' end of the
universal adapter. In some embodiments, the universal adapter may
be joined, linked, attached or coupled to the targeted nucleic acid
by enzymatic or chemical coupling. In some embodiments, a DNA or
RNA ligase is used to link the universal adapter to the target
nucleic acid. In some embodiments, a T4 DNA ligase is used to link
the universal adapter to the target nucleic acid. In some
embodiments, a common, detectable universal adapter can be used to
label multiple targets in a single reaction.
[0086] Capturing Sequence
[0087] In some embodiments, a suitable capturing sequence is
specific to a target nucleic acid (e.g., DNA, mRNA, or microRNA).
The term "specific" when used in connection with a hybridization
probe refers to a sequence that can bind to its target under
stringent conditions but not to other regions.
[0088] For example, a suitable capturing sequence may contain a
sequence substantially complementary to a target sequence on a
target nucleic acid, such as a microRNA. Typically, a capturing
sequence is based on a target-specific nucleotide sequence. In some
embodiments, a capturing sequence may contain a sequence
substantially complementary to a sequence specific to an microRNA
of interest, e.g., microRNAs indicative of certain cancer,
diabetes, Alzheimer's or other diseases including but not limited
to, let-7a, miR-21, miR-29b-2, miR-181b-1, miR-143, miR-145,
miR-146a, miR-210, miR-221, miR-222, miR-10b, miR-15a, miR-16,
miR-17, miR-18a, miR-19a, miR20a, miR-1, miR-29, miR-181, miR372,
miR-373, miR-155, miR-101, miR-195, miR-29, miR-17-3p, miR-92a,
miR-25, miR-223, miR-486, miR-223, mir-375, miR-99b, miR-127,
miR-126, miR-184.
[0089] In some embodiments, a suitable capturing sequence may be
designed to distinguish different variable species of target
nucleic acids. The present invention is particularly useful to
distinguish among multiple species of target nucleic acids with
identical sequences at one end and variable sequences at the other
end. Thus, in some embodiments, a capturing sequence can be
designed to be complementary to a desired variable end nucleotide
sequence. Only the binding of a desired target species will have a
perfectly matching 3' end that abut the 5' end of the adapter
sequence thereby permitting ligation of the adapter to the target.
Therefore, the detection of the universal adapter associated with
the probe indicates the presence of the target nucleic acid with
the desired end variability in the sample. In particular
embodiments, the present invention is used to distinguish a
precursor-microRNA from a mature microRNA. Typically, a
precursor-microRNA and mature microRNA have identical 5' region but
distinct 3' region due to the cleavage of the 3' arm from the
precursor form during the maturation process. In order to
specifically detect a mature microRNA, a capturing sequence may be
designed to be substantially complementary to the sequence at the
3' end of the mature microRNA. Therefore, only the binding of a
correct mature microRNA to the capturing sequence would result in
the perfectly matching 3' end of the microRNA abutting the 5' end
of the adapter sequence permitting ligation of the adapter sequence
to the target sequence.
[0090] In some embodiments, a capturing sequence for nucleic acid
targets contains up to 50 nucleotides (e.g., up to 25, 20, 18, 16,
15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides).
In some embodiments, a capturing sequence is also chosen to ensure
that the melting temperature Tm is between 20-50 C in ligation
buffer.
[0091] Adapter Sequence
[0092] Generally, an adapter sequence can be any sequence and
length. Typically, an adapter sequence and length are designed to
such that (1) the melting temperature is between about 10-20 C in
ligation buffer, (2) the sequence is not significantly
self-complementary in order to avoid formation of hairpin, other
secondary structure or homodimer, and/or (3) complete DNA probes
(with adapter and miRNA sequence) does not form appreciable
hairpins or other secondary structures. In some embodiments, a
suitable adapter sequence contains up to 20 nucleotides (e.g., up
to 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2,
or 1 nucleotides).
[0093] In some embodiments, a suitable nucleic acid probe contains
a 3' cap to prevent or mitigate incidental ligation. Exemplary
suitable 3' caps include, but are not limited to, inverted dT, or
3' phosphates. In some embodiments, a suitable nucleic acid probe
contains a chemical anchor at the 5' or 3' end such that the probe
can be attached to a substrate. Suitable exemplary chemical anchor
groups include, but are not limited to, carboxy groups, amine
groups, thiol groups, biotin, and/or azide groups. In some
embodiments, a suitable probe may contain a particular nucleic acid
sequence for association of the probe with a particular substrate
or a specific location of on a substrate. Typically, such
particular nucleic acid sequence is predetermined to be
complementary to a capturing sequence embedded on a desired
location of a substrate. In some embodiments, the capture of the
nucleic acid probe at a desired location is associated with the
identity of the probe. Therefore, such particular nucleic acid
sequences are also referred to as nucleic acid barcode.
[0094] Suitable probes typically are of a length that is large
enough to hybridize specifically with its target but not so large
as to impede the hybridization process. The size may be dependent
on the desired melting temperature of the target-probe complex or
required specificity of target discrimination. In some embodiments,
suitable probes contains about 10-70 nucleotides (e.g., 10-60,
10-50, 10-40, 10-30, 10-25, 10-20, 15-70, 15-60, 15-50, 15-40,
15-30, 15-25, 20-70, 20-60, 20-50, 20-40, 20-30 nucleotides).
Various methods and softwares available in the art can be used to
design specific probes.
[0095] Nucleic acid probes according to the invention may include
natural nucleosides (i.e., adenosine, thymidine, guanosine,
cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine,
and deoxycytidine), nucleoside analogs (e.g., 2-aminoadenosine,
2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine,
C5-propynylcytidine, C5-propynyluridine, C5-bromouridine,
C5-fluorouridine, C5-iodouridine, C5-methylcytidine,
7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine,
O(6)-methylguanine, and 2-thiocytidine), chemically modified bases,
biologically modified bases (e.g., methylated bases), intercalated
bases, modified sugars (e.g., 2'-fluororibose, ribose,
2'-deoxyribose, arabinose, and hexose), or modified phosphate
groups (e.g., phosphorothioates and 5'-N-phosphoramidite
linkages).
Universal Adapter
[0096] According to the invention, a suitable universal adapter
contains a sequence complementary to the adapter sequence of a
corresponding nucleic acid probe such that, once the universal
adapter bound to the nucleic acid probe, the 5' or 3' end of the
adapter abuts the 3' or 5' end of a target nucleic acid,
respectively. Suitable lengths and sequences of a universal adaptor
can be selected using methods well known and documented in the art.
For example a suitable adapter may contain between 1 and 25
nucleotides in length (e.g., 1-20, 1-18, 1-16, 1-14, 1-12, 1-10,
5-20, 5-15, or 5-10 nucleotides).
[0097] Adapters may be DNA, RNA, or any type of nucleic acid
analog. The nucleotides in adapters may be natural nucleosides
(i.e., adenosine, thymidine, guanosine, cytidine, uridine,
deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine),
nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine,
inosine, pyrrolo-pyrimidine, 3-methyl adenosine,
C5-propynylcytidine, C5-propynyluridine, C5-bromouridine,
C5-fluorouridine, C5-iodouridine, C5-methylcytidine,
7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine,
O(6)-methylguanine, and 2-thiocytidine), chemically modified bases,
biologically modified bases (e.g., methylated bases), intercalated
bases, modified sugars (e.g., 2'-fluororibose, ribose,
2'-deoxyribose, arabinose, and hexose), or modified phosphate
groups (e.g., phosphorothioates and 5'-N-phosphoramidite
linkages).
[0098] In some embodiments, a universal adapter is biotinylated. In
some embodiments, a biotinylated universal adapter may be detected
by a streptavidin reporter conjugated to a detectable moiety
including, but not limited to, phycoerythrin, PE-Cy5, PE-Cy5.5,
PE-Cy7, APC, PerCP, quantum dots, fluorophores or other detectable
entities as described herein (see the "Detectable entities" section
below). In some embodiments, a biotinylated universal adapter may
be detected by a streptavidin reporter conjugated to enzyme for
enzymatic signal generation. In some embodiments, a suitable
streptavidin reporter is conjugated to Alkaline Phosphatase,
beta-Galactosidase, horse radish peroxidase, or other enzyme
capable of turning over detectable products. In some embodiments,
enzymatic signal generation permits chemiluminescence,
fluorescence, or chromogenic detection (see the Detectable entities
section). In some embodiments, a universal adapter contains a
nucleotide tail (also referred to as spacer or linker) to extend
the biotin or enzyme group away from the polymer backbone of the
gel matrix to avoid possible steric hindrance. A suitable
nucleotide tail (spacer or linker) may contain various sequences.
In some embodiments, a poly(A) or poly(T) tail is used. In some
embodiments, a suitable nucleotide (such as a poly(A)) tail
contains up to 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 bases.
[0099] In some embodiments, a universal adapter is directly labeled
with fluorophores or other detectable entities (see the "Detectable
moieties" section).
[0100] In some embodiments, multiple universal adapters may be used
to label multiple distinct target nucleic acids in one reaction.
Typically, in such cases, each individual universal adapter is
labeled with distinctively detectable moieties or is detected by
distinct biotin-streptavidin reporter system.
[0101] Exemplary detectable entities suitable for the present
invention are described below.
[0102] Detectable Entities
[0103] Any of a wide variety of detectable agents can be used in
the practice of the present invention. Suitable detectable agents
include, but are not limited to: various ligands, radionuclides;
fluorescent dyes; chemiluminescent agents (such as, for example,
acridinum esters, stabilized dioxetanes, and the like);
bioluminescent agents; spectrally resolvable inorganic fluorescent
semiconductors nanocrystals (i.e., quantum dots); microparticles;
metal nanoparticles (e.g., gold, silver, copper, platinum, etc.);
nanoclusters; paramagnetic metal ions; enzymes; colorimetric labels
(such as, for example, dyes, colloidal gold, and the like); biotin;
dioxigenin; haptens; and proteins for which antisera or monoclonal
antibodies are available.
[0104] In some embodiments, the detectable moiety is biotin. Biotin
can be bound to avidins (such as streptavidin), which are typically
conjugated (directly or indirectly) to other moieties (e.g.,
fluorescent moieties) that are detectable themselves.
[0105] Below are described some non-limiting examples of other
detectable moieties.
[0106] Fluorescent Dyes
[0107] In certain embodiments, a detectable moiety is a fluorescent
dye. Numerous known fluorescent dyes of a wide variety of chemical
structures and physical characteristics are suitable for use in the
practice of the present invention. A fluorescent detectable moiety
can be stimulated by a laser with the emitted light captured by a
detector. The detector can be a charge-coupled device (CCD) or a
confocal microscope, which records its intensity.
[0108] Suitable fluorescent dyes include, but are not limited to,
fluorescein and fluorescein dyes (e.g., fluorescein isothiocyanine
or FITC, naphthofluorescein,
4',5'-dichloro-2',7'-dimethoxyfluorescein, 6-carboxyfluorescein or
FAM, etc.), carbocyanine, merocyanine, styryl dyes, oxonol dyes,
phycoerythrin, erythrosin, eosin, rhodamine dyes (e.g.,
carboxytetramethyl-rhodamine or TAMRA, carboxyrhodamine 6G,
carboxy-X-rhodamine (ROX), lissamine rhodamine B, rhodamine 6G,
rhodamine Green, rhodamine Red, tetramethylrhodamine (TMR), etc.),
coumarin and coumarin dyes (e.g., methoxycoumarin,
dialkylaminocoumarin, hydroxycoumarin, aminomethylcoumarin (AMCA),
etc.), Oregon Green Dyes (e.g., Oregon Green 488, Oregon Green 500,
Oregon Green 514, etc.), Texas Red, Texas Red-X, SPECTRUM RED.TM.,
SPECTRUM GREEN.TM., cyanine dyes (e.g., CY-3.TM., CY-5.TM.,
CY-3.5.TM., CY-5.5.TM., etc.), ALEXA FLUOR.TM. dyes (e.g., ALEXA
FLUOR.TM. 350, ALEXA FLUOR.TM. 488, ALEXA FLUOR.TM. 532, ALEXA
FLUOR.TM. 546, ALEXA FLUOR.TM. 568, ALEXA FLUOR.TM. 594, ALEXA
FLUOR.TM. 633, ALEXA FLUOR.TM. 660, ALEXA FLUOR.TM. 680, etc.),
BODIPY.TM. dyes (e.g., BODIPY.TM. FL, BODIPY.TM. R6G, BODIPY.TM.
TMR, BODIPY.TM. TR, BODIPY.TM. 530/550, BODIPY.TM. 558/568,
BODIPY.TM. 564/570, BODIPY.TM. 576/589, BODIPY.TM. 581/591,
BODIPY.TM. 630/650, BODIPY.TM. 650/665, etc.), IRDyes (e.g., IRD40,
IRD 700, IRD 800, etc.), and the like. For more examples of
suitable fluorescent dyes and methods for coupling fluorescent dyes
to other chemical entities such as proteins and peptides, see, for
example, "The Handbook of Fluorescent Probes and Research
Products", 9th Ed., Molecular Probes, Inc., Eugene, Oreg. Favorable
properties of fluorescent labeling agents include high molar
absorption coefficient, high fluorescence quantum yield, and
photostability. In some embodiments, labeling fluorophores exhibit
absorption and emission wavelengths in the visible (i.e., between
400 and 750 nm) rather than in the ultraviolet range of the
spectrum (i.e., lower than 400 nm).
[0109] A detectable moiety may include more than one chemical
entity such as in fluorescent resonance energy transfer (FRET).
Resonance transfer results an overall enhancement of the emission
intensity. For instance, see Ju et. al. (1995) Proc. Nat'l Acad.
Sci. (USA) 92: 4347, the entire contents of which are herein
incorporated by reference. To achieve resonance energy transfer,
the first fluorescent molecule (the "donor" fluor) absorbs light
and transfers it through the resonance of excited electrons to the
second fluorescent molecule (the "acceptor" fluor). In one
approach, both the donor and acceptor dyes can be linked together
and attached to the oligo primer. Methods to link donor and
acceptor dyes to a nucleic acid have been described previously, for
example, in U.S. Pat. No. 5,945,526 to Lee et al., the entire
contents of which are herein incorporated by reference.
Donor/acceptor pairs of dyes that can be used include, for example,
fluorescein/tetramethylrohdamine, IAEDANS/fluoroescein,
EDANS/DABCYL, fluorescein/fluorescein, BODIPY FL/BODIPY FL, and
Fluorescein/QSY 7 dye. See, e.g., U.S. Pat. No. 5,945,526 to Lee et
al. Many of these dyes also are commercially available, for
instance, from Molecular Probes Inc. (Eugene, Oreg.). Suitable
donor fluorophores include 6-carboxyfluorescein (FAM),
tetrachloro-6-carboxyfluorescein (TET),
2'-chloro-7'-phenyl-1,4-dichloro-6-carboxyfluorescein (VIC), and
the like.
[0110] A suitable detectable moiety can be an intercalating DNA/RNA
dye that have dramatic fluorescent enhancement upon binding to
double-stranded DNA/RNA. Examples of suitable dyes include, but are
not limited to, SYBR.TM. and Pico Green (from Molecular Probes,
Inc. of Eugene, Oreg.), ethidium bromide, propidium iodide,
chromomycin, acridine orange, Hoechst 33258, Toto-1, Yoyo-1, and
DAPI (4',6-diamidino-2-phenylindole hydrochloride). Additional
discussion regarding the use of intercalation dyes is provided by
Zhu et al., Anal. Chem. 66:1941-1948 (1994), which is incorporated
by reference in its entirety.
[0111] Enzymes
[0112] In certain embodiments, a detectable moiety is an enzyme.
Examples of suitable enzymes include, but are not limited to, those
used in an ELISA, e.g., horseradish peroxidase, beta-galactosidase,
luciferase, alkaline phosphatase, etc. Other examples include
beta-glucuronidase, beta-D-glucosidase, urease, glucose oxidase,
etc. An enzyme may be conjugated to a molecule using a linker group
such as a carbodiimide, a diisocyanate, a glutaraldehyde, and the
like.
[0113] Radioactive Isotopes
[0114] In certain embodiments, a detectable moiety is a radioactive
isotope. For example, a molecule may be isotopically-labeled (i.e.,
may contain one or more atoms that have been replaced by an atom
having an atomic mass or mass number different from the atomic mass
or mass number usually found in nature) or an isotope may be
attached to the molecule. Non-limiting examples of isotopes that
can be incorporated into molecules include isotopes of hydrogen,
carbon, fluorine, phosphorous, copper, gallium, yttrium,
technetium, indium, iodine, rhenium, thallium, bismuth, astatine,
samarium, and lutetium (i.e., 3H, 13C, 14C, 18F, 19F, 32P, 35S,
64Cu, 67Cu, 67Ga, 90Y, 99 mTc, 111In, 125I, 123I, 129I, 131I, 135I,
186Re, 187Re, 201Tl, 212Bi, 213Bi, 211At, 153Sm, 177Lu).
[0115] In some embodiments, signal amplification is achieved using
labeled dendrimers as the detectable moiety (see, e.g., Physiol
Genomics 3:93-99, 2000), the entire contents of which are herein
incorporated by reference in their entirety. Fluorescently labeled
dendrimers are available from Genisphere (Montvale, N.J.). These
may be chemically conjugated to the oligonucleotide primers by
methods known in the art.
Substrates
[0116] In some embodiments, a nucleic acid probe suitable for
post-hybridization labeling is attached to a substrate or object.
Suitable substrates or objects may have a planer, spherical or
non-spherical morphologies. Suitable substrates or objects may be
solid, semi-solid, polymer, emulsion, or the like. Suitable
substrates or objects include, but are not limited to, microarrays,
glasses, slides, particles, beads, films, membranes, microspheres
(e.g., glass, polymer, etc.) with exterior or interior surface,
cells including any genetically engineered cells, micro-organisms
(e.g., C. elegans (e.g., engineered nematodes for drug testing),
bacteria, yeast, and/or fungi) including any genetically engineered
micro-organisms.
[0117] For illustration purposes, particles are used in various
embodiments below.
Particles
[0118] Particles suitable for use in accordance with the present
invention can be made of any materials. Suitable particles can be
biocompatible, non-biocompatible. Suitable particles can also be
biodegradable or non-biodegradable.
[0119] Materials
[0120] In some embodiments, particles are made of polymers.
Exemplary polymers include, but are not limited to, poly(arylates),
poly(anhydrides), poly(hydroxy acids), polyesters, poly(ortho
esters), poly(alkylene oxides), polycarbonates, polypropylene
fumerates), poly(caprolactones), polyamides, polyamino acids,
polyacetals, polylactides, polyglycolides, poly(dioxanones),
polyhydroxybutyrate, polyhydroxyvalyrate, poly(vinyl pyrrolidone),
polycyanoacrylates, polyurethanes and polysaccharides. In some
embodiments, polymers of particles include polyethylene glycol
(PEG). In some embodiments, polymers of particles may be formed by
step or chain polymerization. The amount and kind of radical
initiator, e.g., photo-active initiator (e.g., UV or infrared),
thermally-active initiator, or chemical initiator, or the amount of
heat or light employed, may be used to control the rate of reaction
or modify the molecular weight. Where desired, a catalyst may be
used to increase the rate of reaction or modify the molecular
weight. For example, a strong acid may be used as a catalyst for
step polymerization. Trifunctional and other multifunctional
monomers or cross-linking agents may also be used to increase the
cross-link density. For chain polymerizations, the concentration of
a chemical initiator in a mixture of one or more monomers may be
adjusted to manipulate final molecular weight.
[0121] Exemplary methods for making particles are described in U.S.
Pat. No. 7,709,544 and US Application Publication No.: 20080176216,
the entire contents of which are incorporated herein by reference.
For example, processes as discussed can be conducted with any
polymerizable liquid-phase monomer in which shapes of particles
suitable for use in the present invention, can be defined and
polymerized in a single lithography-polymerization step. Exemplary
monomers include Allyl Methacrylate, Benzyl Methylacrylate,
1,3-Butanediol Dimethacrylate, 1,4-Butanediol Dimethacrylate, Butyl
Acrylate, n-Butyl Methacrylate, Diethyleneglycol Diacrylate,
Diethyleneglycol Dimethacrylate, Ethyl Acrylate, Ethyleneglycol
Dimethacrylate, Ethyl Methacrylate, 2-Ethyl Hexyl Acrylate,
1,6-Hexanediol Dimethacrylate, 4-Hydroxybutyl Acrylate,
Hydroxyethyl Acrylate, 2-Hydroxyethyl Methacrylate, 2-Hydroxypropyl
Acrylate, Isobutyl Methacrylate, Lauryl Methacrylate, Methacrylic
Acid, Methyl Acrylate, Methyl Methacrylate, Monoethylene Glycol,
2,2,3,3,4,4,5,5-Octafluoropentyl Acrylate, Pentaerythritol
Triacrylate, Polyethylene Glycol (200) Diacrylate, Polyethylene
Glycol (400) Diacrylate, Polyethylene Glycol (600) Diacrylate,
Polyethylene Glycol (200) Dimethacrylate, Polyethylene Glycol (400)
Dimethacrylate, Polyethylene Glycol (600) Dimethacrylate, Stearyl
Methacrylate, Triethylene Glycol, Triethylene Glycol
Dimethacrylate, 2,2,2-Trifluoroethyl 2-methylacrylate,
Trimethylolpropane Triacrylate, Acrylamide,
N,N,-methylene-bisacryl-amide, Phenyl acrylate, Divinyl benzene,
etc. In certain embodiments, a monomer is characterized by a
polymerization reaction that can be terminated with a termination
species. The terminating species, lithographic illumination, and
monomer constituents are therefore selected in cooperation to
enable making particles suitable for use in the present
invention.
[0122] In some embodiments, particles are hydrogels. In general,
hydrogels comprise a substantially dilute crosslinked network.
Water or other fluids can penetrate in the network forming such a
hydrogel. In some embodiments, hydrogels suitable for use in the
present invention are made of or comprise a hydrophilic polymer.
For example, hydrophilic polymers may comprise anionic groups (e.g.
phosphate group, sulphate group, carboxylate group); cationic
groups (e.g. quaternary amine group); or polar groups (e.g.
hydroxyl group, thiol group, amine group). In some embodiments,
hydrogels are superabsorbent (e.g. they can contain over 99% water)
and possess a degree of flexibility very similar to natural tissue,
due to their significant water content. Both of weight and volume,
hydrogels are fluid in composition and thus exhibit densities to
those of their constituent liquids (e.g., water). The present
invention encompasses the recognition that hydrogels are
particularly useful in some embodiments of the present invention.
Without wishing to be bound to any particular theory, it is
contemplated that hydrogels enable 1) ease of implementation with
detection instruments, in particular, commercially available
instruments without substantial modifications (e.g., flow
cytometers), and 2) ease of incorporation of functional moieties
(e.g., in a single lithography-polymerization step) without
requiring surface functionalization. Due to their bio-friendly
nature, hydrogels have been used extensively in the fields of
tissue engineering, drug delivery, and biomolecule separation.
[0123] Various additional materials and methods can be used to
synthesize particles. In some embodiments, particles may be made of
or comprise one or more polymers. Polymers used in particles may be
natural polymers or unnatural (e.g. synthetic) polymers. In some
embodiments, polymers can be linear or branched polymers. In some
embodiments, polymers can be dendrimers. Polymers may be
homopolymers or copolymers comprising two or more monomers. In
terms of sequence, copolymers may be block copolymers, graft
copolymers, random copolymers, blends, mixtures, and/or adducts of
any of the foregoing and other polymers.
[0124] In some embodiments, particles of the present invention may
be made of or comprise a natural polymer, such as a carbohydrate,
protein, nucleic acid, lipid, etc. In some embodiments, natural
polymers may be synthetically manufactured. Many natural polymers,
such as collagen, hyaluronic acid (HA), and fibrin, which derived
from various components of the mammalian extracellular matrix can
be used in particles of the present invention. Collagen is one of
the main proteins of the mammalian extracellular matrix, while HA
is a polysaccharide that is found in nearly all animal tissues.
Alginate and agarose are polysaccharides that are derived from
marine algae sources. Some advantages of natural polymers include
low toxicity and high biocompatibility.
[0125] In some embodiments, a polymer is a carbohydrate. In some
embodiments, a carbohydrate may be a monosaccharide (i.e. simple
sugar). In some embodiments, a carbohydrate may be a disaccharide,
oligosaccharide, and/or polysaccharide comprising monosaccharides
and/or their derivatives connected by glycosidic bonds, as known in
the art. Although carbohydrates that are of use in the present
invention are typically natural carbohydrates, they may be at least
partially-synthetic. In some embodiments, a carbohydrate is a
derivatized natural carbohydrate.
[0126] In certain embodiments, a carbohydrate is or comprises a
monosaccharide, including but not limited to glucose, fructose,
galactose, ribose, lactose, sucrose, maltose, trehalose, cellbiose,
mannose, xylose, arabinose, glucoronic acid, galactoronic acid,
mannuronic acid, glucosamine, galatosamine, and neuramic acid. In
certain embodiments, a carbohydrate is or comprises a disaccharide,
including but not limited to lactose, sucrose, maltose, trehalose,
and cellobiose. In certain embodiments, a carbohydrate is or
comprises a polysaccharide, including but not limited to hyaluronic
acid (HA), alginate, heparin, agarose, chitosan,
N,O-carboxylmethylchitosan, chitin, cellulose, microcrystalline
cellulose, hydroxypropyl methylcellulose (HPMC), hydroxycellulose
(HC), methylcellulose (MC), pullulan, dextran, cyclodextran,
glycogen, starch, hydroxyethylstarch, carageenan, glycon, amylose,
starch, heparin, konjac, glucommannan, pustulan, curdlan, and
xanthan. In certain embodiments, the carbohydrate is a sugar
alcohol, including but not limited to mannitol, sorbitol, xylitol,
erythritol, maltitol, and lactitol.
[0127] In some embodiments, particles of the present invention may
be made of or comprise synthetic polymers, including, but not
limited to, poly(arylates), poly(anhydrides), poly(hydroxy acids),
poly(alkylene oxides), polypropylene fumerates), polymethacrylates
polyacetals, polyethylenes, polycarbonates (e.g.
poly(1,3-dioxan-2-one)), polyanhydrides (e.g. poly(sebacic
anhydride)), polyhydroxyacids (e.g. poly(.beta.-hydroxyalkanoate)),
polypropylfumarates, polycaprolactones, polyamides (e.g.
polycaprolactam), polyacetals, polyethers, polyesters (e.g.
polylactide, polyglycolide, poly(dioxanones),
polyhydroxybutyrate,), poly(orthoesters), polycyanoacrylates,
polyvinyl alcohols, polyurethanes, polyphosphazenes, polyacrylates,
polymethacrylates, polyureas, polyamines and copolymers thereof.
Exemplary polymers also include polyvalerolactone, poly(sebacic
anhydride), polyethylene glycol, polystyrenes, polyhydroxyvalyrate,
poly(vinyl pyrrolidone) poly(hydroxyethyl methacrylate) (PHEMA),
poly(vinyl alcohol) (PVA), and derivatives and copolymers
thereof.
[0128] In some embodiments, polymers of particles may be formed by
step or chain polymerization. The amount and kind of radical
initiator, e.g., photo-active initiator (e.g., UV or infrared),
thermally-active initiator, or chemical initiator, or the amount of
heat or light employed, may be used to control polymerization rate
or modify molecular weights of resulting polymers. Where desired, a
catalyst may be used to increase the rate of reaction or modify the
molecular weight. For example, a strong acid may be used as a
catalyst for step polymerization. Trifunctional and other
multifunctional monomers or cross-linking agents may also be used
to increase cross-link density of polymers. For chain
polymerizations, the concentration of a chemical initiator in a
mixture of one or more monomers may be adjusted to manipulate final
molecular weight.
[0129] In some embodiments, photocrosslinking methods are utilized
to make polymeric particles in accordance with the present
invention. Photoinitiators produce reactive free radical species
that initiate the crosslinking and/or polymerization of monomers
upon exposure to light. Any photoinitiator may be used in the
crosslinking and/or polymeriation reaction. Photoinitiated
polymerizations and photoinitiators are discussed in detail in
Rabek, Mechanisms of Photophysical Processes and Photochemical
Reactions in Polymers, New York: Wiley & Sons, 1987; Fouassier,
Photoinitiation, Photopolymerization, and Photocuring, Cincinnati,
Ohio: Hanser/Gardner; Fisher et al., 2001, Annu. Rev. Mater. Res.,
31:171. A photoinitiator may be designed to produce free radicals
at any wavelength of light. In certain embodiments, the
photoinitiator is designed to work using UV light (200-500 nm). In
certain embodiments, long UV rays are used. In other embodiments,
short UV rays are used. In some embodiments, a photoinitiator is
designed to work using visible light (400-800 nm). In certain
embodiments, a photoinitiator is designed to work using blue light
(420-500 nm). In some embodiments, the photinitiator is designed to
work using IR light (800-2500 nm). The output of light can be
controlled to provide greater control over the crosslinking and/or
polymerization reaction. Control over polymerization in turn
results in control over characteristics and/or properties of the
resulting hydrogel.
[0130] In some embodiments, particle can be or comprises inorganic
polymer such as silica (SiO.sub.2). In some embodiments, particles
according to the invention are silica-based. For example, silicate
materials may be useful for the present applications due to their
biocompatibility, ease of production and functionalization, and
large surface-to-volume ratio. Silica-based particles such as
porous silica particles, and any modified or hybrid particles can
be of use in accordance with the present invention.
[0131] As well known in the art, silica-based particles may be made
by a variety of methods. Some methods utilize the Stober synthesis
which involves hydrolysis of tetraethoxyorthosilicate (TEOS)
catalyzed by ammonia in water/ethanol mixtures, or variations
thereof. In some embodiments, silica-based particles are
synthesized using known sol-gel chemistry, e.g., by hydrolysis of a
silica precursor or precursors. Silica precursors can be provided
as a solution of a silica precursor and/or a silica precursor
derivative. Hydrolysis can be carried out under alkaline (basic) or
acidic conditions. For example, hydrolysis can be carried out by
addition of ammonium hydroxide to a solution comprising one or more
silica precursor and/or derivatives. Silica precursors are
compounds which under hydrolysis conditions can form silica.
Examples of silica precursors include, but are not limited to,
organosilanes such as, for example, tetraethoxysilane (TEOS),
tetramethoxysilane (TMOS) and the like. In some embodiments, silica
precursor has a functional group. Examples of such silica
precursors includes, but is not limited to,
isocyanatopropyltriethoxysilane (ICPTS),
aminopropyltrimethoxysilane (APTS), mercaptopropyltrimethoxysilane
(MPTS), and the like. In some embodiments, microemulsion procedures
can be used to synthesize particles suitable for use in the present
invention. For example, a water-in-oil emulsion in which water
droplets are dispersed as nanosized liquid entities in a continuous
domain of oil and surfactants and serve as nanoreactors for
nanoparticle synthesis offer a convenient approach.
[0132] In some embodiments, particles may contain detectable
moieties that generate fluorescent, luminescent and/or scatter
signal. In certain embodiments, particles contain quantum dots
(QDs). QDs are bright, fluorescent nanocrystals with physical
dimensions small enough such that the effect of quantum confinement
gives rise to unique optical and electronic properties.
Semiconductor QDs are often composed of atoms from groups II-VI or
III-V in the periodic table, but other compositions are possible.
By varying their size and composition, the emission wavelength can
be tuned (i.e., adjusted in a predictable and controllable manner)
from the blue to the near infrared. QDs generally have a broad
absorption spectrum and a narrow emission spectrum. Thus different
QDs having distinguishable optical properties (e.g., peak emission
wavelength) can be excited using a single source. In general, QDs
are brighter and photostable than most conventional fluorescent
dyes. QDs and methods for their synthesis are well known in the art
(see, e.g., U.S. Pat. Nos. 6,322,901; 6,576,291; and 6,815,064; all
of which are incorporated herein by reference). QDs can be rendered
water soluble by applying coating layers comprising a variety of
different materials (see, e.g., U.S. Pat. Nos. 6,423,551;
6,251,303; 6,319,426; 6,426,513; 6,444,143; and 6,649,138; all of
which are incorporated herein by reference). For example, QDs can
be solubilized using amphiphilic polymers. Exemplary polymers that
have been employed include octylamine-modified low molecular weight
polyacrylic acid, polyethylene-glycol (PEG)-derivatized
phospholipids, polyanhydrides, block copolymers, etc.
[0133] Exemplary QDs suitable for use in accordance with the
present invention in some embodiments, includes ones with a wide
variety of absorption and emission spectra and they are
commercially available, e.g., from Quantum Dot Corp. (Hayward
Calif.; now owned by Invitrogen) or from Evident Technologies
(Troy, N.Y.). For example, QDs having peak emission wavelengths of
approximately 525 nm, approximately 535 nm, approximately 545 nm,
approximately 565 nm, approximately 585 nm, approximately 605 nm,
approximately 655 nm, approximately 705 nm, and approximately 800
nm are available. Thus QDs can have a range of different colors
across the visible portion of the spectrum and in some cases even
beyond.
[0134] In certain embodiments, optically detectable particles are
or comprise metal particles. Metals of use include, but are not
limited to, gold, silver, iron, cobalt, zinc, cadmium, nickel,
gadolinium, chromium, copper, manganese, palladium, tin, and alloys
thereof. Oxides of any of these metals can be used.
[0135] Certain metal particles, referred to as plasmon resonant
particles, exhibit the well known phenomenon of plasmon resonance.
The features of the spectrum of a plasmon resonant particle (e.g.,
peak wavelength) depend on a number of factors, including the
particle's material composition, the shape and size of the
particle, the refractive index or dielectric properties of the
surrounding medium, and the presence of other particles in the
vicinity. Selection of particular particle shapes, sizes, and
compositions makes it possible to produce particles with a wide
range of distinguishable optically detectable properties thus
allowing for concurrent detection of multiple analytes by using
particles with different properties such as peak scattering
wavelength.
[0136] Magnetic properties of particles can be used in accordance
with the present invention. Particles in some embodiments are or
comprise magnetic particles, that is, magnetically responsive
particles that contain one or more metals or oxides or hydroxides
thereof. Magnetic particles may comprise one or more ferrimagnetic,
ferromagnetic, paramagnetic, and/or superparamagnetic materials.
Useful particles may be made entirely or in part of one or more
materials selected from the group consisting of: iron, cobalt,
nickel, niobium, magnetic iron oxides, hydroxides such as maghemite
(.gamma.-Fe.sub.2O.sub.3), magnetite (Fe.sub.3O.sub.4), feroxyhyte
(FeO(OH)), double oxides or hydroxides of two- or three-valent iron
with two- or three-valent other metal ions such as those from the
first row of transition metals such as Co(II), Mn(II), Cu(II),
Ni(II), Cr(III), Gd(III), Dy(III), Sm(III), mixtures of the
afore-mentioned oxides or hydroxides, and mixtures of any of the
foregoing. See, e.g., U.S. Pat. No. 5,916,539 (incorporated herein
by reference) for suitable synthesis methods for certain of these
particles. Additional materials that may be used in magnetic
particles include yttrium, europium, and vanadium.
[0137] Size and Shape
[0138] In general, particles suitable for the present invention can
be of any size. In some embodiments, suitable particles have a
greatest dimension (e.g. diameter) of less than 1000 micrometers
(.mu.m). In some embodiments, suitable particles have a greatest
dimension of less than 500 .mu.m. In some embodiments, suitable
particles have a greatest dimension of less than about 250 .mu.m.
In some embodiments, suitable particles have a greatest dimension
(e.g. diameter) of less than about 200 .mu.m, about 150 .mu.m,
about 100 .mu.m, about 90 .mu.m, about 80 .mu.m, about 70 .mu.m,
about 60 .mu.m, about 50 .mu.m, about 40 .mu.m, about 30 .mu.m,
about 20 .mu.m, or about 10 .mu.m. In some embodiments, suitable
particles have a greatest dimension of less than 1000 nm. In some
embodiments, suitable particles have a greatest dimension of less
than 500 nm. In some embodiments, suitable particles have a
greatest dimension of less than about 250 nm. In some embodiments,
a greatest dimension is a hydrodynamic diameter.
[0139] Suitable particles can have a variety of different shapes
including, but not limited to, spheres, oblate spheroids,
cylinders, ovals, ellipses, shells, cubes, cuboids, cones,
pyramids, rods (e.g., cylinders or elongated structures having a
square or rectangular cross-section), tetrapods (particles having
four leg-like appendages), triangles, prisms, etc. In some
embodiments, particles are rod-shaped. In some embodiments,
particles are bar-shaped. In some embodiments, particles are
bead-shaped. In some embodiments, particles are column-shaped. In
some embodiments, particles are ribbon or chain-like. In some
embodiments, particles can be of any geometry or symmetry. For
example, planar, circular, rounded, tubular, ring-shaped,
tetrahedral, hexagonal, octagonal particles, particles of other
regular geometries, and/or particles of irregular geometries can
also be used in the present invention. Additional suitable
particles with various sizes and shapes are disclosed in U.S. Pat.
No. 7,709,544 and U.S. Pat. No. 7,947,487 and can be used in the
present invention, which are incorporated herein by reference.
[0140] Particles may have various aspect ratios of their
dimensions, such as length/width, length/thickness, etc. Particles,
in some embodiments, can have at least one dimension, such as
length, that is longer than another dimension, such as width.
According to the present invention, particles having at least one
aspect ratio greater than one may be particularly useful in
flow-through scanning (e.g., in a flow cytometer) to facilitate
their self-alignment. In some embodiments, particles may have at
least one aspect ratio of at least 1.5:1, at least 2:1, at least
2.5:1, at least 3:1, at least 5:1, at least 10:1, at least 15:1, or
even greater.
[0141] It is often desirable to use a population of particles that
is relatively uniform in terms of size, shape, and/or composition
so that each particle has similar properties. In some embodiments,
a population of particles with homogeneity with diameters (e.g.,
hydrodynamic diameters) are used. As used herein, a population of
particles with homogeneity with diameters (e.g., hydrodynamic
diameters) refers to a population of particles with at least about
80%, at least about 90%, or at least about 95% of particles with a
diameter (e.g., hydrodynamic diameter) that falls within 5%, 10%,
or 20% of the average diameter (e.g., hydrodynamic diameter). In
some embodiments, the average diameter (e.g., hydrodynamic
diameter) of a population of particles with homogeneity with
diameters (e.g., hydrodynamic diameters) ranges as discussed above.
In some embodiments, a population of particles with homogeneity
with diameters (e.g., hydrodynamic diameters) refers to a
population of particles that has a polydispersity index less than
0.2, 0.1, 0.05, 0.01, or 0.005. For example, polydispersity index
of particles used in accordance with the present invention is in a
range of about 0.005 to about 0.1. Without wishing to be bound by
any theory, it is contemplated that particles with homogeneity
(e.g., with respect to particle size) may have higher repeatability
and can produce more accuracy in the present application. In some
embodiments, a population of particles may be heterogeneous with
respect to size, shape, and/or composition.
[0142] Particles can be solid or hollow and can comprise one or
more layers (e.g., nanoshells, nanorings, etc.). Particles may have
a core/shell structure, wherein the core(s) and shell(s) can be
made of different materials. Particles may comprise gradient or
homogeneous alloys. Particles may be composite particles made of
two or more materials, of which one, more than one, or all of the
materials possesses magnetic properties, electrically detectable
properties, and/or optically detectable properties.
[0143] Particles may have a coating layer. Use of a biocompatible
coating layer can be advantageous, e.g., if the particles contain
materials that are toxic to cells. Suitable coating materials
include, but are not limited to, natural proteins such as bovine
serum albumin (BSA), biocompatible hydrophilic polymers such as
polyethylene glycol (PEG) or a PEG derivative, phospholipid-(PEG),
silica, lipids, polymers, carbohydrates such as dextran, other
nanoparticles that can be associated with inventive nanoparticles
etc. Coatings may be applied or assembled in a variety of ways such
as by dipping, using a layer-by-layer technique, by self-assembly,
conjugation, etc. Self-assembly refers to a process of spontaneous
assembly of a higher order structure that relies on the natural
attraction of the components of the higher order structure (e.g.,
molecules) for each other. It typically occurs through random
movements of the molecules and formation of bonds based on size,
shape, composition, or chemical properties. In some embodiments,
particles with coating are also referred to as functionalized
particles or surface treated particles.
[0144] In certain embodiments of the invention, a particle is
porous, by which is meant that the particle contains holes or
channels, which are typically small compared with the size of a
particle. For example a particle may be a porous silica particle,
e.g., a porous silica nanoparticle or may have a coating of porous
silica. Particles may have pores ranging from about 1 nm to about
200 nm in diameter, e.g., between about 1 nm and 50 nm in diameter.
Between about 10% and 95% of the volume of a particle may consist
of voids within the pores or channels.
[0145] In some embodiments, particles may optionally comprise one
or more dispersion media, surfactants, release-retarding
ingredients, or other pharmaceutically acceptable excipient. In
some embodiments, particles may optionally comprise one or more
plasticizers or additives.
[0146] In various embodiments, particles described herein may have
at least one region bearing one or more probes described herein. In
some embodiments, particles may have at least one encoded region.
In some embodiments, particles have at least one encoded region and
at least one region bearing one or more probes. Such regions can be
discrete regions of substrates (objects) including particles used
in accordance with the present invention. Each region, in some
embodiments, can be optionally functionalized. In various
embodiments, particles described herein may bear an indicator for
orientation (e.g., indicating coding region first followed by probe
region or vice versa).
Functionalization
[0147] Various methods known in the art (e.g., as discussed in U.S.
Pat. No. 7,709,544 and U.S. Pat. No. 7,947,487) and provided in the
present application are useful for functionalization of substrates
or objects (e.g., particles) described herein.
[0148] Various functional moieties or groups may be introduced to
the surface of the substrates that produce selected functionality
(e.g., to capture encoding adapters, probes or target nucleic
acids). Such functional moieties can be chemically attached to the
surface, e.g., by covalent incorporation, or can be physically
attached thereto or entrapped therein.
[0149] In some embodiments, at least a portion of a substrate is
made from a monomer. Such a monomer can be used alone or in
combination with copolymerized species to provide a selected
functionality in the resulting substrate. For example, a functional
moiety can be provided as a monomer or a part of a monomer that are
polymerized, for example, by a lithography-polymerization step of
particle synthesis (see, U.S. Pat. No. 7,709,544 and U.S. Pat. No.
7,947,487 for details).
[0150] It is not intended that the present invention be limited to
a particular coding scheme. A signature for encoding can be a
visually detectable feature such as, for example, color, apparent
size, or visibility (i.e. simply whether or not the particle is
visible under particular conditions).
[0151] In many embodiments, graphical signatures and/or optically
detectable signatures are particularly useful in the present
invention. In various embodiments of the present invention,
graphically encoding as discussed in U.S. Pat. No. 7,947,487 and
encoding (e.g., universal encoding) as disclosed herein are
used.
[0152] In some embodiments, a graphical signature for encoding is
or comprises one or more spatially patterned features. In some
embodiments, spatially patterned features include a plurality of
open and closed coding elements. Coding elements can be arranged in
a two-dimensional grid. Coding elements can also have non-uniform
shapes or sizes. In certain embodiments, spatially patterned
features further include an orientation indicator.
[0153] Additionally or alternatively, an optical signature can be
used in accordance with the present invention. In some embodiments,
an optical signature for encoding is or comprises a feature of an
absorption, emission, reflection, refraction, interference,
diffraction, dispersion, scattering, or any combination
thereof.
[0154] In some embodiments, an optical signature is intrinsic to
functionalized substrates in accordance with the present invention.
In some embodiments, an optical signature is introduced to
functionalized substrates. Such introduction can be done before,
with or after contacting with a sample, generating a signal from
such contacting, and/or detecting such a signal.
[0155] To give but one example, a functionalized substrate may
carry a functional moiety that is not itself detectable, but upon
further interaction with and/or modification by other moieties can
become detectable. In some embodiments, such a functional moiety
can be a functional group or moiety to facilitate association
between a substrate and other entities.
[0156] Thus, additionally or alternatively, substrate surface is
functionalized to introduce chemical functional moieties that are
designed to facilitate association between a substrate and other
entities (e.g., probes, encoding agents, etc.). Suitable functional
moieties can be introduced to a surface of substrates by covalent
attachment. In some embodiments, coupling agents can be used with
various substrates for functionalization. Exemplary coupling agents
may include bifunctional, tri-functional, and higher functional
coupling agents, which are well known in the art, such as
MeSiCl.sub.3, dioctylphthalate, polyethylene-glycol (PEG), etc. In
some embodiments, substrates are functionalized by covalent
attachment of streptavidin onto their surface via a
heterobifunctional cross-linker with a polyethylene-glycol (PEG)
spacer arm. A variety of functionalization methods are known in the
art and can be used to practice the present invention.
[0157] In some embodiments, a substrate surface is functionalized
by introducing capturing or anchor oligonucleotides to facilitate
capturing and immobilization of individual nucleic acid molecules
such as single-stranded polynucleotide templates, encoding adapters
or probes. In some embodiments, capturing or anchor
oligonucleotides can contain sequences complementary to a universal
sequence present on nucleic acid template molecules. Exemplary
capturing or anchor oligonucleotides can contain various numbers of
nucleotides. For example, suitable oligonucleotides may contain
1-50 nucleotides (e.g., 3-40, 3-30, 3-20, 30-15, 3-10, 6-40, 6-30,
6-20, 6-10, 8-30, 8-20, 8-15, 10-30, 10-20, 10-15 nucleotides). In
some embodiments, suitable oligonucleotides may contain 1, 2, 3, 6,
8, 10, 12, 14, 16, 18, 20, 25, 30, 35, 40, 45, or 50 nucleotides.
Various methods are known in the art for design and synthesize
suitable capturing or anchor oligonucleotides and such methods are
well within skills of ordinary artisan.
[0158] In some embodiments, capturing or anchor oligonucleotides
may be separately synthesized and attached to a substrate surface
for use, e.g. as disclosed by Lund et al. Nucleic Adds Research,
16: 10861-10880 (1988); Albretsen et al, Anal. Biochem., 189: 40-50
(1990); Wolf et al, Nucleic Acids Research, 15: 2911-2926 (1987);
or Ghosh et al, Nucleic Acids Research, 15: 5353-5372 (1987).
[0159] In some embodiments, the attachment is covalent in nature.
In further embodiments, the covalent binding of the capturing or
anchor oligonucleotides and nucleic acid template(s) to the
substrate is induced by a crosslinking agent such as for example
1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC),
succinic anhydride, phenyldiisothiocyanate or maleic anhydride, or
a hetero-bifunctional crosslinker such as for example
m-maleimidobenzoyl-N-hydroxysuccinimide ester (MBS),
N-succinimidyl[4-iodoacethyl]aminobenzoate (SIAB), Succinimidyl
4-[N-maleimidomethyl]cyclohexane-1-carboxylate (SMCC),
N-y-maleimidobutyryloxy-succinimide ester (GMBS),
Succinimidyl-4-[p-maleimidophenyl]butyrate (SMPB) and the sulfo
(water-soluble) corresponding compounds.
[0160] In some embodiments, functionalized substrates bearing
chemical groups or capturing or anchor oligonucleotides are used
for universal encoding and/or probe region functionalization.
[0161] Universal Encoding
[0162] Universal encoding enables the production of functionalized
substrates with a universal architecture, which can be further
encoded to generate subgroups of substrates with distinct barcode
giving rise to distinct identity. For highly multiplexed assays,
this greatly reduces production time and cost compared to
independent synthesis of subpopulations of substrates for each
target.
[0163] In some embodiments, a functionalized substrate comprises
one or more universal encoding regions. Such encoding regions may
be separated by inert or nonfunctionalized regions. Typically, each
universal encoding region bearing one or more templates for
capturing encoding adapters by covalent link via the functional
groups or by hybridization and/or ligation to a capturing or anchor
oligonucleotides on the functionalized surface. In some
embodiments, a template is or comprises a single-stranded
polynucleotide. For example, such a single-stranded polynucleotide
can include a predetermined nucleotide sequence that specifically
bind a desired encoding adapter. In some embodiments, a template
further include a stem-loop structure (i.e., a hairpin structure).
Predetermined nucleotide sequences, in certain embodiments, may be
adjacent to stem-loop structures to facilitate ligation between the
template and the encoding adapter. In such embodiments, an encoding
adapter that binds the template typically does not form a secondary
structure. In some embodiments, a single stranded template does not
forms a hairpin structure, while an encoding adapter does.
[0164] In general, a predetermined nucleotide sequence with any
base combinations or lengths can be used in accordance with the
present invention. In some embodiments, a predetermined nucleotide
sequence has a length of 1, 2, 3 bases or more. In some
embodiments, a predetermined nucleotide sequence has a length of or
more than 4 bases, 5 bases, 6 bases, 7 bases, 8 bases, 9 bases, 10
bases, 11 base, 12 bases, 13 bases, 14 bases, 15 bases, 20 bases,
25 bases or 30 bases. In some embodiments, a predetermined
nucleotide sequence has a length in a range of any two values
above. The length of predetermined nucleotide sequences can be the
same for one substrate or can vary from each other.
[0165] In some embodiments, single-stranded polynucleotide
templates can be used to capture encoding adapters. Suitable
encoding adapters may be DNA, RNA, or any type of nucleic acid
analog. In many embodiments, an encoding adapter is or comprises a
single-stranded polynucleotide. In some embodiments, an encoding
adapter comprises a nucleotide sequence that is complementary to
the predetermined sequence of a corresponding template. Typically,
an encoding adapter contains up to 30, 25, 20, 18, 16, 15, 14, 13,
12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides.
[0166] In some embodiments, encoding adapters, once bound to the
template, can be joined to the template by T4 DNA ligase or via
other enzymatic or chemical coupling.
[0167] Encoding adapters can be labeled or unlabeled. In some
embodiments, encoding adapters is labeled with a detectable moiety
(e.g., an optically detectable moiety). Various detectable moieties
may be used including fluorophores, chromophores, radioisotopes,
quantum dots, nanoparticles and/or intercalating DNA/RNA dyes.
Additional examples of detectable moieties are described in the
Detectable Moieties section above.
[0168] In various embodiments, encoding adapters used in accordance
with the present invention is a blend of labeled and unlabeled
encoding adapters. In some embodiments, the labeled and unlabeled
encoding adapters have the same or similar sequences and bind the
same templates. In some embodiments, by varying the amount of
labeled encoding adapters versus unlabeled encoding adapter, it is
possible to control the amount of signal generated (e.g.
fluorescence) in a region to achieve desired level. In some
embodiments, a lock sequence can be used to selectively dictate
which adapters will bind and be ligated to each hairpin probe
region. In this way, several stripes of independently addressable
hairpin probe regions can be used for encoding.
[0169] In some embodiments, a signal of at least one labeled
encoding adapter is used to determine the orientation of the
substrate. In some embodiments, a signal of at least one labeled
encoding adapter is used to normalized detectable signals form
other labeled encoding adapters.
[0170] It is possible to use multiple colors (or emission
wavelengths in general) when implementing the universal encoding
scheme described herein. This may be accomplished by using blends
of universal adapters modified with varying species, such as
fluorophores, with unique emission spectra. Depending on the amount
of each adapter added to the ligation mix, varying amounts will be
ligated to the templates embedded in the particles, allowing levels
of multiple "colors" to be adjusted in each encoding region. In one
example, two fluorophores can be used to generate two-color codes
on particles/substrates as shown below, but more colors can easily
be used.
[0171] In some embodiments, fluorescence in each coding region can
be distinguishable at multiple levels, e.g., up to 10-20 levels
(e.g., up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, or 20 levels). For example, when three encoding regions
are used and 10 levels are distinguishable for each, it would allow
up to 1000 (10.times.10.times.10) unique codes. Additionally or
alternatively, multiple signals (e.g., different fluorescent
colors) can be used for encoding. In some embodiments, each
encoding region has one signal distinct from each other. In some
embodiments, substrates and encoding adapters can be designed such
that at least one encoding region of the substrates is attached
with one or more kinds of encoding adapters generating multiple
signals. In some embodiments, each encoding region has multiple
signals and by varying the amount of encoding adapters, a desired
signal ratio can be achieved for encoding.
[0172] Probe Region Functionalization
[0173] A substrate used in accordance with the present invention
can comprise one or more probe-bearing regions in addition to
encoding regions. Two typical schematics for universal encoding and
probe functionalization are represented in FIG. 1 and FIG. 2.
[0174] In some embodiments, each probe region bears anchors for
attaching probes of interest via, e.g., ligation-based approach.
Ligation can be performed with three species (anchor, linker, and
probe) or two species (hairpin anchor and probe). A schematic of
probe-region functionalization using three-species ligation,
two-species ligation, and chemical modification is depicted in FIG.
3.
[0175] In some embodiments, probe region functionalization includes
chemical modification, such as the use of peptide chemistry to
attach aminated probes to carboxylated substrates using
carbodiimide chemistry. Detailed exemplary methods for
functionalization are shown in the Examples section below.
[0176] Desired probes specific for target nucleic acids may be
designed using various methods known in the art. In some
embodiments, desired probes for probe region functionalization
include nucleic acid probes for post-hybridization labeling
described herein.
[0177] In some embodiments, probe regions and encoding regions are
separated from one another by inert regions. In some embodiments,
one or more probe-bearing regions and one or more encoding regions
overlap with each other. In some embodiments, an encoding and
probe-bearing region can be the same region.
[0178] In some embodiments, different detectable signals (e.g.,
different fluorescent colors) may be used for encoding regions and
probe-bearing regions. In some embodiments, same type of detectable
signals are used, in particular, when encoding regions and
probe-bearing regions are separated from each other.
[0179] For two-species functionalization, it is possible to use
linear anchors and adapters that have hairpins. The adapter and
anchor species may be designed to have minimal hairpin formation in
ligation conditions or vary tightly bound hairpins. Detectable
moieties for encoding may include fluorophores, chromophores,
radioactive species, magnetic species, quantum dots, conductive
materials, etc. Any number of coding regions may be used, and they
need not be stripes. Any number of colors or otherwise
distinguishable signals may be included in each encoding region.
This approach may be used with other substrates including beads,
planar surfaces, gel pads, etc. The substrates may be solid,
polymer, emulsions, etc.
[0180] In addition to ligation based approach, inventive methods
for universal encoding and/or functionalization can be implemented
with other enzymes including ligases, polymerases, among others.
For example, although T4 DNA ligase was used in the experiments
described below, it is possible to use other enzymes to join
oligonucleotides together. Other possible enzymes include, but are
not limited to, other DNA ligases, RNA ligases, polymerases, etc.
In a slightly different approach, polymerases can also be used to
extend oligonucleotides, using a desired nucleic acid template, as
means of adding nucleic acid probes for functionalization or
labeled species for encoding or detection (FIG. 4). Using this
approach or ligation-based approaches, multiple probe regions can
be added to a single particle when multiple probe "anchors" are
used.
Target Nucleic Acids
[0181] Methods and compositions described herein may be used to
detect any target nucleic acids. In general, target nucleic acids
may be any form of DNA, RNA, or any combination thereof. In certain
embodiments of the present invention, a target nucleic acid may be
or contain a portion of a gene, a regulatory sequence, genomic DNA,
cDNA, RNA including mRNA, rRNA, microRNA, or any combination
thereof.
[0182] A target nucleic acid, in various embodiments, can be one
that is found in a biological organism including, for example, a
microorganism or infectious agent, or any naturally occurring,
bioengineered or synthesized component thereof.
[0183] According to the present invention, provided compositions
and methodologies are particularly useful in quantifying transcript
(e.g., primary transcripts, mRNA, etc.) nucleic acids. In some
embodiments, provided methods herein are used to detect and/or
quantify miRNAs. miRNAs can be found in genomes of humans, animals,
plants and viruses. According to the present invention, a target
nucleic acid, in some embodiments, can be or comprise one or more
miRNAs that is/are generated from endogenous hairpin-shaped
transcripts. In some embodiments, a target nucleic acid can be or
comprise one or more miRNAs that is/are transcribed as long primary
transcripts (pri-microRNAs), for example, by RNA polymerase II
enzyme in animals. There are total 1424 human miRNA genes currently
listed in the miRNA database
(http://microrna.sanger.ac.uk/sequences/ftp.shtml), which is
equivalent to almost 3% of protein-coding genes. Many miRNAs are
thought to be important in the regulation of gene expression.
Typically, microRNAs are produced in precursor form and then
processed to mature form by typically cleaving the 3' arm of the
precursor stem-loop structure. Therefore, a precursor microRNA and
a mature microRNA have identical 5' end but distinct 3' end.
Selective end-labeling can be used to detect mature microRNA
species without detection of precursor species by designing a
capturing sequence complementary to the 3' end sequence. An example
of selective end-labeling is described in the examples section.
[0184] Any of a variety of biological samples may be suitable for
use with methods disclosed herein. Generally, any biological
samples containing nucleic acids (e.g., cells, tissue, etc.) may be
used. Types of biological samples include, but are not limited to,
cells, tissue, whole blood, plasma, serum, urine, stool, saliva,
cord blood, chorionic villus samples amniotic fluid, and
transcervical lavage fluid. Tissue biopsies of any type may also be
used. Cell cultures of any of the afore-mentioned biological
samples may also be used in accordance with inventive methods, for
example, chorionic villus cultures, amniotic fluid and/or amniocyte
cultures, blood cell cultures (e.g., lymphocyte cultures), etc. In
some embodiments, biological specimens comprise diseased cells such
cancer or tumor cells.
[0185] Thus, a typical biological sample suitable for the present
invention contain heterogeneous nucleic acids. In some embodiments,
a biological sample contains a mixture of nucleic acids from
different cell types (e.g., normal cells and diseased cells such as
tumor cells). In some embodiments, a biological sample (e.g.,
blood, serum or plasma) contains a mixture of maternal nucleic
acids and fetal nucleic acids.
[0186] In some embodiments, the present invention is used to detect
target nucleic acids that are present in low abundance or as rare
events in a biological sample. In some embodiments, target nucleic
acids that may be detected by an inventive method of the present
invention are present at a concentration ranging from 0.1
amol-10,000 amol. In some embodiments, the target nucleic acids are
present at a concentration below 10,000 amol, below 5,000 amol,
below 1,000 amol, below 800 amol, below 600 amol, below 400 amol,
below 200 amol, below 100 amol, below 50 amol, below 40 amol, below
30 amol, below 20 amol, below 10 amol, or below 1 amol. In some
embodiments, the amount of target nucleic acids detected by an
inventive method of the present invention represents less than 1%
(e.g., less than 0.5%, 0.1%, 0.01%, 0.001%, 0.0001%) of the total
nucleic acids in a biological sample. In some embodiments, the
amount of target nucleic acids detected by an inventive method of
the present invention represents less than 1% (e.g., less than
0.5%, 0.1%, 0.01%, 0.001%, 0.0001%) of the total nucleic acids in a
biological sample. In some embodiments, the amount of target
nucleic acids detected by an inventive method of the present
invention represents less than 1 out of a million of the total
nucleic acids in a biological sample. In some embodiments, the
amount of target nucleic acids detected by an inventive method of
the present invention represents less than 1 out of 10 million of
the total nucleic acids in a biological sample. The target nucleic
acids may be detected in crude sample or may be detected as
isolated or purified sample.
Scanning and Quantification
[0187] Substrates or objects described herein may be characterized
using various methods. In particular, various methods involving
flow-through scanning and/or static imaging can be used to detect
substrates bound with target nucleic acids and/or to determine
amount of the target nucleic acids. Typically, target nucleic acids
attached to substrates are determined based on detection of
signals. According to the present invention, signals "indicative
of" a target nucleic acid are typically associated with the
identity of substrates or locations on substrates to which the
target nucleic acid is attached. For example, signals emanate from
one or more detectably labeled probes or targets that becomes
associated with signals indicative of one or more encoding regions
of the substrates bearing the probes or targets.
[0188] In some embodiments, signals indicative of target nucleic
acids are generally distinguishable from signals indicative of
identity of substrates. In some embodiments, probes or universal
adapters specific for a target nucleic acid and encoding adapters
for coding regions are labeled with distinctively detectable
signals. For example, probes or universal adapters specific for the
target nucleic acid may be labeled with fluorescent moieties that
have a different emission spectrum (i.e., color and wavelength)
than that of the fluorescent moieties with which the coding regions
are labeled. Thus, in some embodiments, substrates (e.g.,
particles) of the present invention can be scanned using a
multi-scanning system involving more than one excitation sources
and detectors (see FIG. 5).
[0189] In some embodiments, single-color scanning is used. Signals
indicative of separate "code" and "probe" regions are used to
identify substrates (e.g., particles) and capture targets,
respectively. Using particles as examples, as described in detail
below, signal patterns from the code regions (e.g., bearing holes,
stripes, encoding adapters and/or combination thereof) of a
particle serve as the basis for a graphical multiplexing barcode to
identify the probe(s) in a particular particle. In some
embodiments, unlike traditional bead-based systems that use optical
encoding of spheres, an arrangement in which particles have
multiple distinct regions makes single-color scanning possible,
with only one excitation source and one detector required. In some
embodiments, particles can bear graphical features (e.g., stripes,
holes, or the like) with variable fluorescent intensities (of one
or multiple wavelengths), optical properties, dimensions, etc (see
FIG. 6).
[0190] Particles are used as examples to illustrate the scanning
and quantification process in more detail below. However, methods
described herein may be used with various other types of substrates
or objects.
[0191] Interrogating Particles
[0192] In some embodiments, the present invention provides a method
for characterizing multifunctional objects (e.g., particles)
including one or more steps of (a) interrogating a plurality of
objects (e.g., particles), wherein each individual object (e.g.,
particle) containing one or more interrogation regions detectable
as a sequence of events; (b) recording multiple events, wherein
each individual event corresponds to each individual interrogation
region detectable above a pre-determined triggering threshold; (c)
grouping the recorded multiple events, and (d) characterizing the
plurality of objects based on the grouped events.
[0193] In some embodiments, particles are interrogated using image
analysis in either static or flow-through settings. For
high-throughput applications, it is desirable to scan the particles
rapidly, preferably using existing commercial equipment. For
example, flow cytometers are particularly useful for flow-through
analysis of fluorescently labeled beads and particles, providing
means for particle alignment, precise illumination, and accurate
quantification of fluorescence emission. In some embodiments,
encoded multifunctional particles are designed such that they can
be scanned using commercially-available or custom designed
flow-through device, such as, flow cytometers.
[0194] In some embodiments, particles suitable for flow-through
scanning are engineered to mimic a series of cells (e.g., 2, 3, 4,
5, or more) that flow past an interrogation zone. In particular
embodiments, outer regions (e.g., both end regions) of suitable
particles are coding regions while one or more inner regions
contain probes where the target is captured. Each coding region and
probe region can be interrogated separately (e.g., sequentially or
non-contemporaneously) and each region is also referred to as an
interrogation region. In particular embodiments, rod-shaped
particles that bear multiple interrogation regions are recorded as
"events" using standard cytometery signal processing. By analyzing
the sequence and time-proximity of such events, one can infer which
ones belong in the same particle. These events can then be analyzed
to decode the particle and quantify target bound to the probe
region. Signal quantification can be achieved using fluorescence,
light scattering, luminescence, etc.
[0195] Typically, raw signal is obtained from the cytometer
detectors (or signal processing boards) using standard cytometery
software. The signal can then be processed using custom software to
import standard flow cytometery (FCS) files and reconstruct the
events into particles and corresponding probe and coding
regions.
[0196] Various flow-cytometery and other flow-through reading
devices may be used in accordance with the present invention,
including various commercially available flow-cytometers and
customly designed devices. Exemplary suitable flow cytometers
include, but are not limited to, Millipore Guava 8HT, Guava 5HT,
Accuri C6, BD FACSCalibur, and among other cytometers.
[0197] Multiple-Event Particles
[0198] As a non-limiting example, when a particle travels through a
cytometer's flow cell, it is excited with an illumination spot
while detectors are used to monitor several parameters including
forward scatter and side scatter of the illumination, and various
wavelengths of emitted light. By setting a threshold on one of
these parameters in a triggering channel, a user can define the
instances that the cytometer software will record as events. If the
signal from the detector in the triggering channel increases beyond
the threshold level set by the user, the cytometery hardware and
software will start to record an event--measuring the maximum
signal height and integrated area from each detector while the
triggering signal remains above the threshold. Events are typically
reported with the height and area observed in each channel, along
with the event width and a time-stamp of when the event
occurred.
[0199] Typically, a single particle or bead is recorded as a single
event. However, in many embodiments, particles according to the
invention (e.g., rod-shaped particles) with multiple functional
regions can be read as a sequence of distinct events. This is
accomplished by using particles that have functional regions (for
example: fluorescent) separated by inert regions (for example: non
fluorescent). By incorporating threshold-triggering entities in the
functional regions of the particles, but not in the inert regions,
typical cytometery signal processing software records the
functional regions as discrete events. This can be accomplished
using entities that cause scatter or fluorescence. Such entities
could include microparticles, nanoparticles, reflective monomers,
metallic materials, fluorescently-labeled monomers, quantum dots,
fluorescent dyes, carbon nanotubes, liquid crystals, and various
detectable entities described herein.
[0200] An example is provided in the Examples section to illustrate
how this approach works and the distinction from standard
cytometery (Example 9). A example of particle scanning using a
particular flow cytometery is provided in Example 10.
[0201] Data Analysis
[0202] For data analysis, an algorithm can be written to group
events into particles, orients the particles, normalizes
fluorescence against a standard if desired, and quantifies the
fluorescence, scatter, or event width in each code and probe
region. The corresponding code for each particle can then be given
a confidence level, and those that were not called with a
pre-defined level of confidence can be excluded from the analysis.
The fluorescence in the probe region can then be used to determine
the amount of target present in the sample analyzed. This system
can be easily automated using software that performed analysis
during or after scanning.
[0203] Grouping of Events
[0204] In some embodiments, events are grouped based on spatial and
temporal-proximity. In some embodiments, events are grouped based
on patterns of measured properties for each event.
[0205] Typically, each event recorded by the cytometer is given a
timestamp with a pre-determined resolution of, e.g., 1 ms, based on
the flow rate in each cytometery. For example, as particles
typically move at rates of .about.1 m/s through the flow cell, the
interrogation of a particle that is 200 .mu.m long is expected to
last .about.0.2 ms. As such, it can be expected that the two events
recorded from a single multifunctional particle would appear in the
same timestamp.
[0206] In some embodiments, calibration beads are scanned fairly
randomly throughout the course of data acquisition. Typically, at
least one event is recorded for calibration beads. The
multifunctional particles, on the other hand, typically show
clustering of 2 or 4 events per timestamp, which lends very well to
the theory that each particle is being read as two events. In
addition, it can be clearly seen from the plots of event vs. time
that during each timestamp, there is a high- and low-level
fluorescence reading. The particles were designed to have one
bright and one dim region of fluorescence in the FL-2 channel,
which also gives support to the theory that each particle is being
read as two discrete events. This approach can be applied to three
or more events per particle as well. Each region/event can vary in
terms of fluorescence level, forward or side scatter, and
width.
[0207] It is possible to incorporate distinct levels of multiple
fluorophores into each code region of the multifunctional
particles. As a proof-of-concept, we used rod-shaped particles,
200.times.35.times.30 .mu.m, with a single 60 .mu.m code region on
one end. The code region was labeled using four distinct levels of
Cy3 and Cy5 fluorescent dyes. Particles were analyzed using the
Accuri C6 cytometer with a flow rate of 100 .mu.l/min, a core size
of 40 .mu.m, and a threshold of 5000 on FL4. The results are shown
in FIG. 7.
[0208] The plot in FIG. 7 shows that it is possible to create a
distinct fluorescent fingerprint in each code region of
multifunctional particles. Each cluster of data points represents a
distinct code.
[0209] Reading of Raw Signal
[0210] In some embodiments, interrogating multifunctional particles
in standard flow cytometers is to acquire signal from the cytometer
detectors before it is processed into events by the machine's
firmware and use custom software to identify, orient, and analyze
particles scans.
[0211] In some embodiments, raw data files (e.g., 20 million
points/scan) produced by the scanning process are analyzed with a
custom written MATLAB algorithm designed to isolate individual
particle signatures, identify the code displayed by each particle,
and quantify the amount of target bound. The algorithm processed
scans of 50-.mu.l samples in under 5 s, making the approach
suitable for high-throughput applications. In the initial filter
step, the algorithm excised portions of the scan that exceeded a
threshold voltage and then interrogated each removed segment for
characteristics that identified it as a particle signature. Using
specific properties of the fluorescent code region as reference
points, a high-confidence estimate of the velocity of each particle
was determined and utilized to pinpoint trough locations for the
five coding holes. The orientation of the particle (i.e., probe- or
code-first) was established using the fixed-value "3" hole that
bordered the inert buffer region. After an initial code identity
was calculated from the trough depths, a secondary review was
conducted by measuring the standard deviation in trough depths of
holes designated to be of the same level and corrective action was
taken if necessary. In the final decoding step, a confidence score
was calculated for the particle by computing the linearity of the
correlation between trough depth and assigned level. A particle
decoding event was rejected if its Pearson coefficient fell below
0.97.
[0212] In order to calculate the amount of target bound, the
measured particle velocity was used to infer the location of the
center of the probe region. Briefly, a search window was used to
investigate the scan in this region, seeking to identify a local
maximum that could be correlated to a target-binding event. If a
maximum was found, the position of the search window along the scan
profile was adjusted until the two endpoints were sufficiently
close in signal amplitude, thereby selecting a nearly symmetrical
portion of the maximum over which to average for quantification
purposes. In the cases in which a maximum was not found, the
original estimate of probe center was used to calculate a mean
signal without a search window. To calculate the background for a
given probe sequence and incubation condition, particles from the
same synthesis batch were incubated in the presence of, e.g., only
100 amol of miSpike target according to the procedure described
above. This method provided a measure of the probe-dependent
background that arose from the PEG scaffold and the universal
adapter used in the labeling process. Also, upon calculation of all
code identities and target levels, a particle would be rejected
from consideration if its target level was more than one
inter-quartile range above the third quartile or below the first
quartile of the data set consisting of target levels associated
with the probe in question.
[0213] Various examples of particle scanning and quantification are
provided in the Examples section. Additional scanning and
quantification methods are described in International Application
entitled "Scanning Multifunctional Particles," filed on even date,
the disclosure of which is incorporated herewith in its
entirety.
Other Embodiments
[0214] There are several variations and alternate approaches to the
embodiments described above. Although rod-shaped particles are used
as examples described here, the present invention may be used to
scan objects or particles with many other morphologies as well. For
instance, particles may be anisotropic, have a head on one side,
include rounded shapes, have holes in them, etc. In some
embodiments, the present invention may be used to scan a variety of
multifunctional entities including long nucleic acids, DNA origami,
self-assembled structures, biological organisms, string-like
objects, ribbon-like objects, etc. Furthermore, any combination of
information recorded by the cytometer for each event, including
height, area, width, or any combination thereof can be used for
encoding or target quantification.
[0215] Other commercially-available instruments are capable of
reading particles with multiple functional regions and can be used
to practice the present invention. One example is an instrument
capable of measuring changes in electrical conductance, or
electrical resistance of a fluidic channel such as a Coulter
Counter. The resulting current or voltage generated by a particle
by a detector in such systems can be used to characterize particle
size, shape, chemical composition, or surface properties.
Additionally, laser-scanning cytometry (LSC), which allows high
resolution visualization of particles in flow, may be used to
identify the identifier regions and probe regions on particles with
several functionalized regions. Such LSC systems are commercially
available from companies such as CompuCyte. There also exist
commercial cytometers that image cells/particles as they pass (eg.
Amnis ImageStream). These can be used with suitable
image-processing software to decode particles and quantify target.
In addition, it may be possible to use non-fluorescent means of
quantification such as surface-plasmon resonance or radiation.
Applications
[0216] The present invention has many applications, including, but
not limited to, diagnosis and prognosis of diseases, disorders or
conditions based on detection or quantification of a target nucleic
acid (e.g., microRNA, DNA or mRNA) in a biological sample.
[0217] Those of ordinary skill reading the present disclosure, will
appreciate its broad applicability. For example, the present
invention can be used to diagnose or prognose a variety of diseases
including, but not limited to, cancer (e.g., lung cancer, breast
cancer, stomach cancer, pancreatic cancer, lymphoma, leukemia,
colon cancer, liver cancer, etc.), diabetes, neurodegenerative
diseases (e.g., Alzheimer's), infectious diseases, genetic
diseases.
[0218] Representative bacterial infectious agents which can be
detected and/or determined by the present invention include, but
are not limited to, Escherichia coli, Salmonella, Shigella,
Klebsiella, Pseudomonas, Listeria monocytogenes, Mycobacterium
tuberculosis, Mycobacterium aviumintracellulare, Yersinia,
Francisella, Pasteurella, Brucella, Clostridia, Bordetella
pertussis, Bacteroides, Staphylococcus aureus, Streptococcus
pneumonia, B-Hemolytic strep., Corynebacteria, Legionella,
Mycoplasma, Ureaplasma, Chlamydia, Neisseria gonorrhea, Neisseria
meningitides, Hemophilus influenza, Enterococcus faecalis, Proteus
vulgaris, Proteus mirabilis, Helicobacter pylori, Treponema
palladium, Borrelia burgdorferi, Borrelia recurrentis, Rickettsial
pathogens, Nocardia, and Acitnomycetes.
[0219] Representative fungal infectious agents which can be
detected and/or determined by the present invention include, but
are not limited to, Cryptococcus neoformans, Blastomyces
dermatitidis, Histoplasma capsulatum, Coccidioides immitis,
Paracoccidioides brasiliensis, Candida albicans, Aspergillus
fumigautus, Phycomycetes (Rhizopus), Sporothrix schenckii,
Chromomycosis, and Maduromycosis.
[0220] Representative viral infectious agents which can be detected
and/or determined by the present invention include, but are not
limited to, human immunodeficiency virus, human T-cell
lymphocytotrophic virus, hepatitis viruses (e.g., Hepatitis B Virus
and Hepatitis C Virus), Epstein-Barr Virus, cytomegalovirus, human
papillomaviruses, orthomyxo viruses, paramyxo viruses,
adenoviruses, corona viruses, rhabdo viruses, polio viruses, toga
viruses, bunya viruses, arena viruses, rubella viruses, and reo
viruses.
[0221] Representative parasitic agents which can be detected and/or
determined by the present invention include, but are not limited
to, Plasmodium falciparum, Plasmodium malaria, Plasmodium vivax,
Plasmodium ovale, Onchoverva volvulus, Leishmania, Trypanosoma
spp., Schistosoma spp., Entamoeba histolytica, Cryptosporidum,
Giardia spp., Trichimonas spp., Balatidium coli, Wuchereria
bancrofti, Toxoplasma spp., Enterobius vermicularis, Ascaris
lumbricoides, Trichuris trichiura, Dracunculus medinesis,
trematodes, Diphyllobothrium latum, Taenia spp., Pneumocystis
carinii, and Necator americanis.
[0222] The present invention can also be useful for detection
and/or determination of drug resistance by infectious agents. For
example, vancomycin-resistant Enterococcus faecium,
methicillin-resistant Staphylococcus aureus, penicillin-resistant
Streptococcus pneumoniae, multi-drug resistant Mycobacterium
tuberculosis, and AZT-resistant human immunodeficiency virus can be
identified with the present invention.
[0223] Genetic diseases can also be detected and/or determined by
the process of the present invention. This can be carried out by
prenatal or post-natal screening for chromosomal and genetic
aberrations or for genetic diseases. Examples of detectable genetic
diseases include, but are not limited to: 21 hydroxylase
deficiency, cystic fibrosis, Fragile X Syndrome, Turner Syndrome,
Duchenne Muscular Dystrophy, Down Syndrome or other trisomies,
heart disease, single gene diseases, HLA typing, phenylketonuria,
sickle cell anemia, Tay-Sachs Disease, thalassemia, Klinefelter
Syndrome, Huntington Disease, autoimmune diseases, lipidosis,
obesity defects, hemophilia, inborn errors of metabolism, and
diabetes.
[0224] Cancers which can be detected and/or determined by the
process of the present invention generally involve oncogenes, tumor
suppressor genes, or genes involved in DNA amplification,
replication, recombination, or repair. Examples of these include,
but are not limited to: BRCA1 gene, p53 gene, APC gene, Her2/Neu
amplification, Bcr/Abl, K-ras gene, and human papillomavirus Types
16 and 18. Various aspects of the present invention can be used to
identify amplifications, large deletions as well as point mutations
and small deletions/insertions of the above genes in the following
common human cancers: leukemia, colon cancer, breast cancer, lung
cancer, prostate cancer, brain tumors, central nervous system
tumors, bladder tumors, melanomas, liver cancer, osteosarcoma and
other bone cancers, testicular and ovarian carcinomas, head and
neck tumors, and cervical neoplasms.
[0225] In the area of environmental monitoring, the present
invention can be used, for example, for detection, identification,
and monitoring of pathogenic and indigenous microorganisms in
natural and engineered ecosystems and microcosms such as in
municipal waste water purification systems and water reservoirs or
in polluted areas undergoing bioremediation. It is also possible to
detect plasmids containing genes that can metabolize xenobiotics,
to monitor specific target microorganisms in population dynamic
studies, or either to detect, identify, or monitor genetically
modified microorganisms in the environment and in industrial
plants.
[0226] The present invention can also be used in a variety of
forensic areas, including, for example, for human identification
for military personnel and criminal investigation, paternity
testing and family relation analysis, HLA compatibility typing, and
screening blood, sperm, or transplantation organs for
contamination.
[0227] In the food and feed industry, the present invention has a
wide variety of applications. For example, it can be used for
identification and characterization of production organisms such as
yeast for production of beer, wine, cheese, yoghurt, bread, etc.
Another area of use is with regard to quality control and
certification of products and processes (e.g., livestock,
pasteurization, and meat processing) for contaminants. Other uses
include the characterization of plants, bulbs, and seeds for
breeding purposes, identification of the presence of plant-specific
pathogens, and detection and identification of veterinary
infections.
EXAMPLES
Example 1
Particles Synthesis
[0228] This example demonstrates that various particles can be
synthesized for use according to the present invention. Exemplary
methods are described in detail below.
[0229] Exemplary particle batches were synthesized in 38-.mu.m tall
polydimethylsiloxane (PDMS) microfluidic channels with the
stop-flow lithography method. For the 12-plex study, code and inert
buffer regions were polymerized from monomer solutions with 35%
(v/v) poly(ethylene glycol) diacrylate (MW=700 g/mol) (PEG-DA 700),
20% poly(ethylene glycol) (MW=200 g/mol) (PEG 200), 40% 3.times.
Tris-EDTA (TE) buffer (pH 8.0), and 5% Darocur 1173 photoinitiator.
1.times.TE and rhodamine-acrylate (1 mg/ml) were added to code
monomer to give final concentrations of 9.4% and 0.6%,
respectively. 1.times.TE and blue food coloring were added to
buffer monomer to give final concentrations of 8.0% and 2.0%,
respectively. Food coloring was used to visualize stream widths.
Probe regions were polymerized from a different monomer solution
that was added to acrydite-modified DNA probe sequences (Integrated
DNA Technologies, IDT) suspended in 1.times.TE to give the desired
final concentration of probe, 18% (v/v) PEG-DA 700, 36% PEG 200,
and 4.5% Darocur; the remaining balance consisted of
3.times.TE.
[0230] In an effort to coarsely rate-match the binding of the
targets used in this exemplary study, we incorporated the probe
sequences at different concentrations in the particles (Table 1).
As the characteristic time for target depletion scales with the
inverse square root of probe concentration, a doubling of the
binding rate for a given target will require a 4.times. increase in
the amount of probe incorporated in a probe region of fixed size.
In this exemplary study all rates were adjusted to match that of
let-7a binding. Without being bound to any particular theory, it is
contemplated that higher sensitivities and shorter assays could
have been achieved by loading probe at maximum concentration. In
this particular case, the goal was to develop a 12-plex assay with
broad dynamic range and .about.1 amol sensitivity for all
targets.
TABLE-US-00001 TABLE 1 Exemplary particle codes and probe
information for batches synthesized for 12-plex study. Final
composition (v/v) of PEG-DA 700, PEG 200, and Darocur 1173
photoinitiator in prepolymer stream for probe were fixed at 18, 36,
and 4.5%, respectively. Hairpin melting temperatures are listed in
descending order, as calculated for the DNA-RNA duplex by IDT's
OligoCalc application for the incubation conditions used in this
exemplary study. For each miRNA, the relative binding rate was
calculated using the average of target signals from 30-and 60-min
incubations with 500 amol of target and ligation labeling. Short
incubations were chosen to ensure the system had not reached
equilibrium. Quoted probe concentrations refer to prepolymer stream
composition. Approximately 11% of the probe in the prepolymer
stream was covalently incorporated into the particles (Pregibon, D.
C. et al., Anal. Chem. 81, 4873-4881 (2009)). ##STR00001##
[0231] Code, buffer, and probe prepolymer solutions were loaded
into four-inlet microfluidic synthesis channels using modified
pipette tips (Biosciences) as delivery chambers and forcing
pressures of 4.5 psi. Hydrogel microparticles
(250.times.70.times.35 .mu.m) were simultaneously synthesized,
encoded, and functionalized at rates up to 16,000 per hour with
100-ms UV exposures (Lumen 200 at 75% setting, Prior Scientific)
controlled by a shutter system (Uniblitz, Vincent Associates)
interfaced with a custom-written Python automation script. Stream
widths were adjusted such that code and probe regions spanned 140
and 40 .mu.m, respectively, of the length of the particles. Buffer
regions accounted for the remaining 70 .mu.m of the length. We also
showed that the same particle dimensions can easily accommodate two
probe strips, with no loss in performance upon incubation,
labeling, and scanning.
[0232] Following polymerization, particles were flushed down the
synthesis channel and collected in a 1.7-ml Eppendorf tube
containing 950 .mu.l of TET (1.times.TE with 0.05% (v/v) Tween-20
surfactant (Sigma Aldrich)). Tween was added to prevent particle
aggregation. Particles were next suspended in 200 .mu.l of PEG 200
for 5 min and then rinsed with 700 .mu.l of TET. This washing
sequence was used to rinse the particles of unreacted PEG-DA,
probe, and rhodamine. The wash sequence was repeated two more times
and involved manual aspiration of supernatant facilitated by
centrifugal separation of the dense particles. Particles were
stored in TET at final concentrations of .about.12.5
particles/.mu.l in a refrigerator (4.degree. C.).
Example 2
miRNA Incubation Experiments
[0233] This Example demonstrates typical sample incubation steps
suitable for use in the present invention.
[0234] For all exemplary incubations studied, particles
synthesized, for example, by the methods described in Example 1,
were brought to room temperature prior to use, and each incubation
was carried out in a total volume of 50 .mu.l in a 0.65-ml
Eppendorf tube with a final salt concentration of 350 mM NaCl and
all twelve types of particle present (.about.360
particles/incubation tube). For calibration and specificity
studies, a hybridization buffer (TET with assay-specific NaCl
molarity) was first added to the Eppendorf tube, followed by all
relevant target sequences (IDT) diluted in a mixture of 1.times.TE
with 500 mM NaCl. Tween was excluded from the dilution buffer to
prevent inaccuracies in pipetting steps that can arise from
surfactant-induced changes in wettability. Depending on the assay
type, either 1 .mu.l of TET or 1 .mu.l of E. coli total RNA (200
ng/.mu.l) was introduced. For tissue profiling studies,
hybridization buffer was added directly to a tube containing either
2.5 or 1.0 .mu.l of previously frozen extracted total RNA (one
individual per tissue type; stored at 100 ng/.mu.l). Primary pair
samples consisted of total RNA isolated from primary tumor and its
adjacent normal tissue. Total RNA for all tissues was isolated by
TRIzol purification; integrity of isolation was confirmed by
checking for intact 18S and 28S ribosomal RNA. Lung sample
(BioChain) was obtained from 50-year-old male with poorly
differentiated squamous cell carcinoma. Breast sample (BioChain)
was obtained from 53-year-old female with moderately differentiated
invasive lobular carcinoma. Stomach sample (BioChain) was obtained
from 70-year-old female with poorly differentiated adenocarcinoma.
Pancreas sample (BioServe) was obtained from 65-year-old female
with well-differentiated acina cell carcinoma. For all exemplary
assays, 1 .mu.l of miSpike (IDT) appropriately diluted in
1.times.TE with 500 mM NaCl was also introduced to give a total
amount of 100 amol of the synthetic sequence to measure consistency
of scanning/labeling and for quantification purposes. Prior to the
addition of particles, incubation mixtures were heated to
95.degree. C. for 5 min in a Multi-therm shaker (Biomega) and then
brought back to room temperature over a 7 min period. A previously
prepared master mix of particles (18 per .mu.l) was thoroughly
vortexed for 1 min, and 20 .mu.l (.about.30 particles of each probe
type) was introduced to each incubation tube. Incubation with
target was carried out at 55.degree. C. for 90 min in a thermomixer
(Quantifoil Rio) with a mixing speed of 1800 rpm.
[0235] Following hybridization with target, samples were rinsed
three times with a solution of 500 .mu.l TET containing 50 mM NaCl.
Supernatant was manually aspirated from the tube following
centrifugal separation of the particles. All but 50 .mu.l of
solution was aspirated after the third rinse. Next, 245 .mu.l of a
previously prepared ligation master mix (100 .mu.l 10.times.
NEBuffer 2, 875 .mu.l TET, 25 .mu.l of XXXATPcarrier, 250 pmol of
ATP, 40 pmol of universal adapter, and 800 U of T4 DNA ligase) was
added to the tube. The mixture was placed in the Multi-therm shaker
at 21.5.degree. C. for 30 min with a mixing speed of 1500 rpm.
Following ligation, an identical three-rinse cycle was performed.
Streptavidin-r-phycoerythrin reporter (SA-PE, 1 mg/ml) was diluted
1:50 in TET and added to obtain a final dilution of 1:500. Samples
were incubated in the Multi-therm unit at 21.5.degree. C. for 45
min. After another three-rinse cycle, particles were additionally
rinsed in 500 .mu.l of PTET (5.times.TE with 25% (v/v) PEG 400 and
0.05% Tween-20), and then suspended in a final volume of 50 .mu.l
PTET for scanning Prior to use, all PTET was sonicated for 5 min to
eliminate aggregations of polymer.
Example 3
Detection Using Multifunctional Particles
[0236] In this Example, hydrogel particles were use. The synthesis
of chemically geometrically complex hydrogel microparticles can be
carried out using the flow lithography technique explained in
detail in U.S. Pat. No. 7,709,544.
[0237] By polymerizing across laminar co-flowing streams of
monomer, multifunctional particles with distinct chemical regions
can be rapidly (>10.sup.4/hr) produced with high degrees of
reproducibility. Separate "code" and "probe" regions are used to
identify particles and capture targets, respectively. The
bulk-immobilization of probe molecules in the bio-inert, PEG-based
gel scaffolds provides solution-like capture kinetics and high
degrees of both specificity and sensitivity, leading to significant
advantages over surface-based immobilization strategies employed in
microarrays and existing particle systems. Patterns of
unpolymerized holes in the code portion of the particle serve as
the basis for a graphical multiplexing barcode to identify the
probe(s) in a particular particle. Unlike bead-based systems that
use optical encoding of spheres, an arrangement in which particles
have multiple distinct regions makes single-color scanning
possible, with only one excitation source and one detector required
(FIG. 8a). Furthermore, the coding library can easily be expanded
to accommodate high levels of multiplexing or parallel processing
of samples. Other methods for encoding these particles can also be
implemented as discussed above; for instance, the particles can
bear stripes with variable fluorescent intensities (of one or
multiple wavelengths), optical properties, dimensions, etc.
[0238] In addition to bearing a code, particles also bear a probe
region where targets are captured for quantification. The probes
typically consist of species of biomolecules that bind specifically
to a target of interest. For nucleic acid detection, probes
typically consist of DNA oligonucleoties. A suitable DNA probe
design and labeling methodology can be employed for a
post-hybridization labeling method that accommodates operation of a
gel particle scanning system for high-throughput multiplexed miRNA
quantification. In the discussion below, particle synthesis,
incubation, and scanning steps are described in detail for miRNA
quantification, but this is provided as one example only, and it is
to be recognized that such techniques are applicable to nucleic
acids in general and are herein contemplated.
[0239] It is possible to use encoded particles with a
post-hybridization labeling scheme and a suitable scanner, e.g., a
slit-scan system, to perform rapid, multiplexed analysis of nucleic
acids (FIG. 8b and c).
[0240] In some embodiments, particles are designed to be scanned
rapidly in a flow-through system such that the fluorescent signal
obtained along each particle is integrated across the particle
width by the detector. The particles each have a fluorescent
code-region, bearing a series of holes that are used to identify
the particle, negative control regions, and at least one probe
region where targets are captured and labeled. The sizes of the
holes in the code region determine the depths of the fluorescence
troughs in the signature and thus indicate the particle identity.
We optimized the particle architecture and hole design (FIG. 9) to
find that four distinguishable coding levels (0-3) could be
obtained for 70-.mu.m wide particles, leading to 192 possible codes
for a five-bar particle (FIG. 8c). Multiplexing capacity could
easily be augmented to >10.sup.5 by adding more bars, using
multiple fluorescent levels for the code region, or incorporating
multiple probes on each particle. We developed and trained a
decoding algorithm written in MATLAB to accurately decode particles
and quantify targets. Any suitable decoding technique can be
employed. In the example algorithm, particle orientation (code- or
probe-first) and velocity are determined to analyze the coding
holes and establish a first estimate of code identity. A revised
assignment is calculated by checking the consistency among holes
identified as the same level, and a decoding confidence score is
then computed and used to accept or reject particles. This method
typically provides a decoding accuracy of .about.98%, with only
.about.10% score-based rejection at throughputs up to 20
particles/s.
Example 4
Post-Hybridization Labeling
[0241] To generate a detectable signal indicating the presence and
capture of nucleic acid targets, an exemplary post-hybridization
ligation-based methodology is provided and demonstrated in this
Example and Example 5 for labeling.
[0242] Such a post-hybridization method can be used to
fluorescently label bound selected targets, e.g., miRNA targets.
Existing approaches rely on the bulk-labeling of RNA using chemical
or enzymatic means. These methods may suffer from high cost, the
need for small-RNA purification and clean-up, sequence bias due to
secondary structure, or complicated, time-consuming protocols.
Here, we provide, for example, a two-step method to efficiently
label targets after hybridization in about one hour.
[0243] Experimentally, we used T4 DNA ligase to link a universal
oligonucleotide adapter to the 3' end of targets captured on
gel-embedded DNA probes that act as a ligation templates (FIG. 10).
As such, we can use a common, universal adapter to label multiple
targets in a single reaction. The labeling process requires only a
few simple steps. First, particles are hybridized with the sample,
in this case total RNA, to capture appropriate targets in the
particle probe regions. After excess sample is rinsed away, a
ligation mix is added that includes the appropriate enzymes, all
important co-factors (such as ATP), and a common biotinylated
adapter. After a short reaction (typically 5-60 min) at room
temperature, a low-salt buffer is used to rinse away any unreacted
adapter. After rinsing away unreacted adapter, the particles are
incubated with phycoerythrin-conjugated streptavidin reporter
(SA-PE) to provide fluorescence. After another rinse, the particles
can then be analyzed. More importantly, this labeling method was
very efficient, had no minimal input RNA requirement, and showed no
sequence bias for the targets used in this exemplary study
(Examples 4 and 5). For each new miRNA target species, we
incorporated a target-specific sequence into the universal probe
template; complex modification and customization were not
necessary.
[0244] In this arrangement, the adapter sequence was designed to
minimize probe hairpin formation, which could retard target
hybridization, and provide an adapter-probe melting temperature
T.sub.m that was .about.10-20.degree. C. in ligation buffer.
Although we used a reduced salt buffer during the rinse, the
dehybridization of unreacted adapter can be accomplished using any
condition that destabilizes nucleic acid interactions (low salt,
high temperature, additives such as DMSO, PEG, or glycerol, etc.).
Typically, we use SA-PE reporter to achieve maximum fluorescent
signal. In addition or alternatively, a ligation-based labeling can
be performed with adapters that are directly labeled with
fluorophores or other reporting entities. Without being bound to
any particular theory, it would be appreciated that this reduces
the time and complexity of the assay. The process can be used, with
appropriate probe and adapter design, to ligate adapters to the 3'
end of DNA or RNA species containing a 3' OH, or at the 5' end of
these species containing a 5' phosphorylation.
Example 5
Optimization and Variations of Ligation-Based Labeling
[0245] In various embodiments, several aspects of the labeling
technique described in the present invention were optimized,
including probe/adapter design, reagent concentrations, rinse
buffer salt content, ligation time, and ligation temperature. We
show here the effects of ligation time and adapter tail length on
labeling efficiency. The nucleic acid probes, targets, and adapters
(all received from Integrated DNA Technologies, IDT) are given in
the table below.
TABLE-US-00002 TABLE 2 Nucleic acid probes and targets used in
optimization studies. Sequence in bold represents universal
adapter-specific sequences, sequence in regular represents
target-specific sequences, and sequence underlined represents
poly(A) tails. Oligo Name: Sequence/Modifications: let-7a probe,
DNA /5Acryd/GATATATTTTAAACTATACAACCTACTACCTCA/3InvdT/ (SEQ ID NO:
13) let-7a target, RNA 5'-UGAGGUAGUAGGUUGUAUAGUU-3' (SEQ ID NO: 14)
UA10-Cy3, DNA /5Phos/TAAAATATAT/3Cy3/ (SEQ ID NO: 15) UA10-bio, DNA
/5Phos/TAAAATATAT/3Bio/ [poly(A) = 0] (SEQ ID NO: 16)
/5Phos/TAAAATATATAAA/3Bio/ [poly(A) = 3] (SEQ ID NO: 17)
/5Phos/TAAAATATATAAAAAA/3Bio/ [poly(A) = 6] (SEQ ID NO: 18)
/5Phos/TAAAATATATAAAAAAAAAAAA/3Bio/ [poly(A) = 12] (SEQ ID NO:
19)
[0246] Adapter/Probe Design
[0247] Exemplary probes described above were designed to include a
miRNA-specific region and an adapter-specific region, such that
when bound, the 3' end of the miRNA target would abut the 5' end of
the adapter. We chose to label the 3' end of miRNA targets because
it has been demonstrated that when using a DNA template, the action
of T4 DNA ligase in joining DNA to RNA molecules proceeds several
orders of magnitude more rapidly at the 3' end of RNA versus the 5'
end (Bullard, D. R. et al., Biochem J 398, 135-144 (2006)). The
adapter sequence and length were chosen such that (1) the melting
temperature was between 10-20 C in ligation buffer, (2) the
sequence was not significantly self-complementary in order to avoid
adapter hairpin or homodimer formation, and (3) complete DNA probes
(with adapter and miRNA sequences) did not show appreciable
hairpins for the miRNAs investigated.
[0248] Ligation Time
[0249] We performed studies to determine the minimum ligation time
needed for our labeling assay, using let-7a as a model system.
Particles bearing a let-7a DNA probe region were incubated with 5
fmol synthetic let-7a RNA at 55 C for 110 min. Particles were
rinsed three times with phosphate buffered saline containing 0.05%
Tween-20 (PBST, pH 7.4, Fluka) and incubated with 250 l of a
ligation mix containing 200 U T4 DNA ligase, 40 nM Cy3-modified
adapter (UA10-Cy3), and 0.05% Tween-20 in T4 DNA ligation buffer
(NEB) for 10, 30, or 90 min at 16 C. After ligation, particles were
rinsed three times in TE containing 0.025 M NaCl, deposited on a
glass slide, and imaged using a CMOS camera (Imaging Source). We
measured the fluorescence intensity in the probe region of each
particle, subtracting the background fluorescence to get a target
signal, which indicated ligation efficiency. The results are shown
in FIG. 11.
[0250] We calculated the relative efficiency by normalizing each
signal by that obtained for the 90 min sample. As can be seen in
FIG. 11, ligation is >95% complete even after a short 10-min
reaction. For the experiments described in this work, we chose to
use a ligation time of 30 min to ensure nearly complete
ligation.
[0251] Tail Length for Biotinylated Adapters
[0252] The reporter streptavidin-phycoerythrin (SA-PE) is a large
protein structure that has a radius of gyration on the order of
.about.10-15 nm. As such, when using biotinylated adapters with the
SA-PE reporter, we found that it was beneficial to extend the
biotin group away from the polymer backbone of the gel matrix. To
do this, we used a poly(A) tail at the 3' end of the adapter and
investigated the effect of tail length on target signal.
[0253] In this experiment, we used the same let-7a particles as in
the previous section. We incubated with 50 amol let-7a miRNA for 60
min at 50 C. The particles were rinsed three times in PBST, and
divided into four separate tubes. Particles in each tube were
incubated for 30 min at room temperature with ligation mix
containing 200 U T4 DNA ligase, and 40 nM UA10-bio (with either a
0, 3, 6, or 12 bp poly(A) tail), in 1.times. T4 DNA ligation buffer
(NEB) with 0.05% Tween-20. After ligation, particles were rinsed
three times in TE containing 0.05 M NaCl and 0.05% Tween-20.
Particles were deposited on a glass slide and imaged using an
EB-CCD camera. The target signals were compared to determine the
effect of poly(A) tail length, as shown in FIG. 12.
[0254] As can be seen in FIG. 12, the length of the poly(A) tail
has a large effect on target signal obtained. From zero to 12 bp,
the signal increases .about.5.times. but seems to level off at that
point. For the experiments described in some examples, we chose to
use universal adapters with poly(A) tail lengths of 12 bp.
[0255] In various embodiments, a wide range of alternative
techniques and systems to those described above can be successfully
employed. Examples of such are provided here.
[0256] Direct Adapter-Based Labeling Using Fluorophore-Conjugated
Adapters
[0257] Instead of using a technique in which biotinylated adapters
are ligated and later reported with streptavidin-conjugated
fluorophores, fluorophores can be used directly. When ligating to
the 3' end of hybridized targets, the universal adapters will have
desired a fluorophore incorporated, preferably at the 3' end or on
one of the internal nucleotides. As illustrated in Example 13, this
method eliminates one step in the process, making it more simple
and rapid.
[0258] Multiplexed Detection Using Adapters with Different
Fluorophores
[0259] For some applications, it can be important to detect
multiple nucleic acid species in a common region. When the probes
are not separated in distinct regions of a particle or substrate,
it is possible to perform multiplexed detection using adapters
modified with fluorophores that have unique emission spectra. For
example, three probes that each have a unique adapter probe
sequence can be used in one region with adapters modified with 3
unique fluorophores. An example of this is shown in FIG. 14.
[0260] Alternately, for some applications it can be important to
detect variability at the end of a target (e.g., targets with
nucleotides cropped from one end). In this case, a similar probe
can be used, but multiple adapters (preferably with different
fluorohpores) are used that extended a different number of
nucleotides into the target probe region. Ligation would only occur
if the target/adapter ends perfectly abut, thus the target end
sequence(s) can be determined by measuring the levels of each
fluorophore used for the various adapters. Alternately, adapters
bearing the same fluorophore may be used with two separate
quantification steps run in parallel (with two samples) or series
(same sample but two ligation steps).
[0261] In the case of both labeling and universal encoding,
ligation can be achieved at the 5' or 3' end of the adapters,
especially when all species involved are DNA. When using DNA
Ligase, it is known that ligation is much more efficient at the 3'
end of RNA targets (i.e., the 5' end of the DNA adapter). Adapters
may be DNA, RNA, or any type of nucleic acid analog. The
nucleotides in the adapters or probes may be modified as locked
nucleic acids, or otherwise.
[0262] Use of Other Functional Adapters
[0263] Fluorophores were employed for encoding and labeling in the
experiments described above, but it is understood that other types
of functional species can also be used, including but not limited
to: chromophores, radioactive species, magnetic materials, quantum
dots, etc. It is also understood that universal encoding can be
achieved using an adapter bearing an intermediary species (eg.
biotin), and functionalization (eg. fluorescence) can be added in
an additional step. Adapters can have fluorophres at the end of
their structure or along their backbone (eg. fluorescent
nucleotides). Another approach is to use intercalating DNA/RNA dyes
(like PicoGreen, YOYO-1, etc) to introduce fluorescence in
universal encoding or labeling. These may be used in conjunction
with enzymes like exonuclease that will selectively degrade nucleic
acid species that are not protected from digestion. In this
scenario, adapters with longer sequences or more secondary
structure will lead to brighter signals from the intercalating
dyes. In a different scenario, adapters may also bear specific
nucleic acid sequences (tags) that can be targeted in subsequent
processing to add fluorescence (e.g., using fluorophore-conjugated
complementary oligonucleotides).
[0264] Rinse-Free Labeling
[0265] It is possible to use the ligation-based labeling technique
for analysis of particles without rinsing. In one example, ligation
is carried out at a lower temperature (e.g., below the melting
temperature, Tm, of the adapter) than scanning/analysis (which can
be done above the Tm of the adapter). The melting temperature of
the adapter can be adjusted via sequence, salt concentration,
locked nucleic acids, etc to denature from the probe template at
temperatures below, near, or above the temperature used when
analyzing particles. Ligation and scanning can be performed right
at or slightly above the Tm of the adapter--this still allows
ligation (likely with decreased efficiency) with minimal residual
adapter bound to the probes during analysis.
Example 6
Particle Scanning
[0266] Typical scanning methods suitable for use in the present
invention are described in this Example.
[0267] Focusing devices (35 .mu.m in height) with two inlets, one
outlet, four side streams, and a 125-.mu.m wide detection region
were mounted on a Zeiss Axio Observer microscope equipped with a
Zeiss Plan Neofluar 20.times. objective (NA 0.50) (FIG. 9a)
(Chapin, S. C., et al., Lab Chip 9, 3100-3109 (2009)). A
chrome-coated soda-lime glass mask (Advance Reproductions) was
fitted into an iris slider bar and inserted into the field stop of
the microscope to limit the beam spot of a 100-mW, 532-nm laser
(Dragon Lasers) to a thin excitation window of 4.times.90 .mu.m in
the scanning plane. Prior to each scanning session, laser alignment
was calibrated with a power meter (Newport, Model 1815-C). Using
images captured from a Clara Interline CCD camera (Andor
Technology), the excitation window was oriented such that its long
dimension was aligned perpendicular to the flow direction
approximately 750 .mu.m from the exit port of the device. A
switching box on the side port of the microscope was used to
alternate between the CCD and a photomultiplier tube (PMT,
Hamamatsu H7422-40) used to record fluorescence signatures of
passing particles.
[0268] PTET was injected from a reservoir input to serve as a
focusing sheath stream. For each trial, particle-bearing fluid was
aspirated into a modified pipette tip using a syringe connected to
the tip via Tygon tubing. The tip was inserted into the appropriate
PDMS inlet port and a pressure of 8 psi was used to drive the flow
of both fluids. A typical scan of 50 .mu.l of particle-bearing
fluid lasted .about.30 s and used less than 25 .mu.l of sheath
fluid. Particle throughputs ranged from 5-25 per second, depending
on the number of particles used in the assay. Devices were able to
be used more than 50 times without degradation. Following each
scan, a rinse solution of 30 .mu.l 1.times.TE was flowed through
the particle inlet to flush out stranded particles and thereby
reduce inter-run contamination. Additionally, the loading tip was
rinsed in ethanol and water so that it could be reused. With manual
loading from Eppendorf tubes, eight samples could be scanned and
analyzed in 30 min, leading to a projected throughput of .about.125
samples per 8-h workday. In future applications of this technology,
automation of the particle-loading and rinsing processes using
well-plates and a computerized liquid handling system will greatly
augment efficiency (>500 samples/day).
[0269] The output current of the PMT was conditioned using a
homemade amplifier with a low-pass filter, and the resulting
voltage signal was captured at a rate of 600 kHz by a digital
acquisition (DAQ) board (USB-6251, National Instruments). A Python
script was written to convert each scan to a binary text file for
off-line analysis. Single-chemistry particles with fluorescent
rhodamine incorporated throughout were scanned to optimize the
performance of the scanning system, leading to a combination of
amplifier gain (22), cutoff frequency (100 kHz), slit width (4
.mu.m), and PMT control voltage (0.300 V) that produced the highest
signal-to-noise ratio (SNR) and frequency response possible.
Furthermore, by scanning particles with various barcode designs, it
was observed that a minimum spacing of 8 .mu.m was required between
holes to prevent mechanical deformations of the soft hydrogels
during flow alignment. The four-level code design was employed
based on studies that systematically varied the size of the holes
to determine effects on trough depth in scan profiles (FIG. 9b and
c).
Example 7
Data Analysis
[0270] Typical data analysis in accordance with the present
invention are described in this Example.
[0271] Raw data files (20 million points/scan) produced by the
scanning process were analyzed with a custom written MATLAB
algorithm designed to isolate individual particle signatures,
identify the code displayed by each particle, and quantify the
amount of target bound. The algorithm processed scans of 50-.mu.l
samples in under 5 s, making the approach suitable for
high-throughput applications. In the initial filter step, the
algorithm excised portions of the scan that exceeded a threshold
voltage and then interrogated each removed segment for
characteristics that identified it as a particle signature. Using
specific properties of the fluorescent code region as reference
points, a high-confidence estimate of the velocity of each particle
was determined and utilized to pinpoint trough locations for the
five coding holes. The orientation of the particle (i.e., probe- or
code-first) was established using the fixed-value "3" hole that
bordered the inert buffer region. After an initial code identity
was calculated from the trough depths, a secondary review was
conducted by measuring the standard deviation in trough depths of
holes designated to be of the same level and corrective action was
taken if necessary. In the final decoding step, a confidence score
was calculated for the particle by computing the linearity of the
correlation between trough depth and assigned level. A particle
decoding event was rejected if its Pearson coefficient fell below
0.97.
[0272] In order to calculate the amount of target bound, the
measured particle velocity was used to infer the location of the
center of the probe region. Briefly, a search window was used to
investigate the scan in this region, seeking to identify a local
maximum that could be correlated to a target-binding event. If a
maximum was found, the position of the search window along the scan
profile was adjusted until the two endpoints were sufficiently
close in signal amplitude, thereby selecting a nearly symmetrical
portion of the maximum over which to average for quantification
purposes. In the cases in which a maximum was not found, the
original estimate of probe center was used to calculate a mean
signal without a search window. To calculate the background for a
given probe sequence and incubation condition, particles from the
same synthesis batch were incubated in the presence of only 100
amol of miSpike target according to the procedure described above.
This method provided a measure of the probe-dependent background
that arose from the PEG scaffold and the universal adapter used in
the labeling process. Also, upon calculation of all code identities
and target levels, a particle would be rejected from consideration
if its target level was more than one inter-quartile range above
the third quartile or below the first quartile of the data set
consisting of target levels associated with the probe in question.
This measure was taken as further protection against incorrect code
assignments and inter-run contamination.
[0273] For calibration and profiling studies, mean
background-subtracted signals were computed for each target at each
incubation condition. For inter-run comparisons of calibration
data, signals were normalized by background-subtracted miSpike
amplitude, with the null (0 amol) samples providing the reference
100-amol miSpike value for both neat and E. coli investigations.
miSpike target values displayed on the calibration curves (FIG. 15
and FIG. 16) were not adjusted to this reference in order to
demonstrate the repeatability of the labeling and scanning process.
For profiling studies, the background-subtracted miSpike signal
from the first scan of each healthy tissue type was used as the
reference for analysis of that tissue. Signals from a given
profiling scan were further normalized by the RNU6B amount in that
scan to facilitate direct quantitative comparisons that were
independent of total RNA amount. Repeat runs of tissue assays were
conducted at least one day after the original. For each calculated
expression ratio, the healthy and tumor samples were assayed and
scanned in the same set of experiments for consistency. We required
at least 2 amol of target to be detectable in a tissue of a given
disease state in order to calculate an expression ratio. As we only
used a single patient sample for each tissue type, we implemented a
threshold approach to determine dysregulation. For each target in
each tissue, the three log-transformed expression ratios from the
three separate trials were used to calculate an SNR, by dividing
the mean of the set by the standard deviation. Targets with SNRs
above 3 were considered to be dysregulated. It should be noted that
all 20 instances of dysregulation were able to be correlated to
observations from the literature regarding the expression profiles
of either mature miRNA (16 of 20) or miRNA precursors (4 of
20).
Example 8
miRNA Profiling
[0274] The experiment described in this example demonstrates that
compositions and methods provided in the present invention may be
use for various applications (e.g., miRNA profiling).
[0275] Experimentally, this technique was proven by an
investigation into the dynamic range, sensitivity, and specificity
of the platform in the context of a 12-plex assay featuring ten
clinically relevant miRNA targets. Because of its relative
invariance across tissue types and disease states, RNU6B was used
as an internal control for normalization purposes. We also used 100
amol of miSpike (a synthetic 21-mer) as an external control to
validate the consistency of the labeling and scanning processes. We
synthesized twelve batches of single-probe particles for this
study. To compensate for discrepancies in target hybridization
rates, we implemented a coarse rate-matching by tuning the probe
concentration for each target using previously determined scaling
laws (Table 1). To fully demonstrate the versatility of the
scanner, five separate codes were correlated to particles of each
probe type, thereby simulating a 60-plex assay.
[0276] To further assess the sensitivity and dynamic range of our
system, we simultaneously spiked four of the twelve targets into
50-.mu.l incubation mixes at amounts ranging from 1 to 2187 amol.
We observed a linear detector response over four logs, with
sub-attomole sensitivity achieved for three of the four targets and
strong agreement between neat samples and those spiked with 200 ng
of E. coli total RNA to add complexity (FIG. 15 and FIG. 16). By
comparison, existing bead-based approaches have a 200-amol limit of
detection and only one log of range. To assess specificity, we
performed assays with let-7a particles and four members of the
let-7 family spiked separately at 200 amol into samples containing
200 ng E. coli total RNA. Scans revealed a maximum cross-reactivity
of 27% (FIG. 15b), which is lower than other systems (microarray
.about.50%) and can be dramatically improved with lower
hybridization salt concentrations (FIG. 17) These assays were very
reproducible, with intra- and inter-run COV's of 2-7% (Table 3).
Due to limitations in detection and particle preparation, it is
common for users of current bead-based systems to employ 4,500
copies of each type of bead in an assay for high-confidence
estimates of target level. By contrast, we found it sufficient to
analyze only 10-15 hydrogel particles for each probe type (FIG.
18).
TABLE-US-00003 TABLE 3 Intra-run COVs in target level for E. coli
calibration curve. All entries are percentages with each statistic
calculated using 19 particles on average. miR-222 exhibited a limit
of detection over 1 amol. Inter-run COV in background-subtracted
miSpike signal (100 amol) for the nine represented scan sets was
6.84%. 1 3 5 9 27 81 243 729 2187 Target amol amol amol amol amol
amol amol amol amol miR- 59.45 29.22 10.88 10.93 1.81 5.91 1.39
5.85 1.93 210 miR- 36.71 9.95 21.80 18.41 4.11 7.20 2.79 6.81 2.01
221 miR- -- 5.96 16.10 15.62 4.85 5.25 3.26 5.93 3.27 222 let-7a
87.99 19.18 26.77 18.83 5.20 5.83 3.13 5.53 2.93
[0277] As a further validation of the platform, we performed
expression profiling across tumor and adjacent normal tissue for
several cancer types. As anticipated, we observed the dysregulation
of several miRNA targets in all of the diseases investigated (FIG.
15c, Table 4, and Table 5). Although we used 250 ng of total RNA
for these samples, similar results were obtained for lung samples
using only 100 ng, suggesting that less input RNA would be
sufficient. With a total assay time of only 3 h, the profiling is
more efficient than microarray approaches (.about.24 h) and
exhibits sensitivity and reproducibility far superior to that of
existing bead-based methods.
TABLE-US-00004 TABLE 4 Mean target amounts and inter-run COVs in
target amount for 250-ng tissue profiling replicates. Top number in
each entry is mean amount for replicate trials (amol); bottom
number in parentheses is the inter-run COV (%). Amounts were
determined by comparison to the background-subtracted 100-amol
miSpike signal from each run. Replicate assays were conducted on
different days to rigorously test reproducibility. Each statistic
was calculated using 16 particles on average. Entry spots lacking
data indicate that target was not present above the 2 amol cutoff.
miR- miR- miR- miR- miR- miR- miR- miR- miR- let-7a 21 29b-2 181b-1
143 145 146a 210 221 222 RNU6B Lung 594.81 1498.8 68.36 7.02 85.61
162.88 77.02 -- 7.21 8.13 57.16 Tumor (3.18) 5 (10.52) (21.45)
(10.55) (6.05) (8.28) -- (8.09) (8.22) (7.46) (10.57) Lung 368.08
141.70 31.80 2.69 59.79 189.07 6.95 -- -- 6.45 10.84 Healthy
(13.97) (12.10) (8.43) (18.61) (10.54) (8.98) (12.61) -- -- (12.33)
(10.65) Breast 1094.1 808.08 65.88 3.71 32.48 73.53 9.26 -- -- 2.29
116.88 Tumor 9 (9.96) (9.99) (5.01) (7.48) (11.20) (4.75) -- --
(16.14) (0.19) (6.82) Breast 912.95 302.39 32.87 2.65 59.01 149.06
12.90 -- -- 10.20 78.55 Healthy (6.30) (5.81) (25.08) (6.96) (8.52)
(9.57) (5.89) -- -- (2.59) (3.05) Stomach 270.64 561.87 68.78 2.28
169.45 388.39 29.66 -- 2.93 14.15 175.69 Tumor (8.96) (13.76)
(19.21) (11.03) (3.99) (9.16) (2.89) -- (22.98) (8.16) (8.52)
Stomach 258.28 204.24 73.44 -- 186.39 597.31 3.33 -- -- 7.83 78.45
Healthy (4.62) (24.90) (1.78) -- (16.68) (17.91) (10.20) -- --
(5.76) (9.26) Pancreas 44.96 14.96 9.95 -- 5.43 22.63 -- -- -- --
9.49 Tumor (2.62) (12.21) (17.82) -- (58.64) (11.60) -- -- -- --
(8.23) Pancreas 98.10 18.21 14.85 -- 6.79 10.88 -- -- -- -- 10.33
Healthy (2.64) (48.23) (11.77) -- (27.57) (7.42) -- -- -- --
(7.81)
TABLE-US-00005 TABLE 5 Log-transformed expression ratios for 250-ng
assays. Top number in each entry is the mean of the log-transformed
ratios of tumor amount-to-healthy amount of the indicated target in
the specified tissue over three trials; bottom number in
parentheses is the standard deviation. Entry spots in red indicate
dysregulation. Entry spots lacking data indicate that the ratio was
not calculated. miR- miR- miR- miR- miR- miR- miR- let-7a 21 29b-2
143 145 146a 181b-1 222 Lung -0.5119 0.3020 -0.3911 -0.5670 -0.7870
0.3232 -0.3066 -0.6210 (0.0161) (0.0245) (0.0225) (0.0364) (0.0450)
(0.0127) (0.0194) (0.0364) Breast -0.0942 0.2532 0.1378 -0.4318
-0.4801 -0.3168 -0.0266 -0.8253 (0.0349) (0.0416) (0.0777) (0.0137)
(0.0194) (0.0433) (0.0529) (0.0591) Stomach -0.3310 0.0966 -0.3844
-0.3877 -0.5336 0.6007 0.3294 -0.0935 (0.0747) (0.0031) (0.1547)
(0.0107) (0.0252) (0.0282) (0.3374) (0.0716) Pancreas -0.3023
-0.0198 -0.1402 -0.1251 0.3534 -- -- 0.1785 (0.0345) (0.1183)
(0.0778) (0.2381) (0.1019) -- -- (0.1382)
[0278] This high-performance nucleic acid profiling system and
platform is therefore shown to employ a versatile scanning and
labeling methodology that enables the use of graphically-encoded
hydrogel microparticles. The system's unprecedented combination of
sensitivity, flexibility, and throughput offer exciting
possibilities for discovery and clinical applications, particularly
in the quantification of low-abundance miRNA and other biomolecules
in readily-accessible media like serum.
Example 9
Scanning of Multiple-Event Particles
[0279] An example of how our approach is distinguished from
standard cytometery is shown in FIG. 19 below. In this example, the
functional regions of multifunctional particles can be loaded with
entities that cause scatter of the illumination, which in turn
triggers the cytometer to record an event.
[0280] We show a particle architecture that has two encoding
regions and a single probe region where target is captured. The two
code regions have varying levels of fluorophores embedded to give
distinct signatures of fluorescence in the three fluorescence
channels. One code regions is intentionally wider than the other in
order to indicate particle orientation. The target could be labeled
with a fluorophore that preferentially appears in a single
fluorescence channel, as shown. In this example, each particle
would be reported as 3 events. Of these three, the first and last
would give code information while the second event would be used
for target quantification. In this manner, the code and captured
target are quantified non-contemporaneously.
[0281] We performed preliminary experiments to demonstrate the
implementation of this methodology. We synthesized multifunctional
particles that were .about.200.times.35.times.30 .mu.m with two
fluorescent regions (30 .mu.m and 60 .mu.m, each dyed with Cy5 and
Cy3 fluorescent dyes) flanking a broad inert region. The particles
were run through an Accuri C6 cytometer with a flow rate of 100
.mu.l/min and a core size of 40 .mu.m. The threshold was set at
100,000 on FL4-H (which detects Cy5).
[0282] Each event recorded by the cytometer is given a timestamp
with a resolution of 1 ms. As particles typically move at rates of
.about.1 m/s through the flow cell, the interrogation of a particle
that is 200 .mu.m long is expected to last .about.0.2 ms. As such,
it can be expected that the two events recorded from a single
multifunctional particle would appear in the same timestamp. To
show that each particle was being read as two separate events, we
plotted a histogram showing the count of timestamps that had a
given number of events. We would expect the number of events per
timestamp to be even for our particles (2 events for a single
particle, 4 events for two particles, etc.), and both odd and even
for regular particles. As a control, we also ran standard Accuri
8-peak calibration beads, with a typical spherical shape. The
results are shown in FIG. 20.
[0283] As can be seen, the calibration beads are scanned fairly
randomly throughout the course of data acquisition, giving a range
from 1-4 beads/timestamp. The multifunctional particles, on the
other hand, show clustering of 2 or 4 events per timestamp, which
lends very well to the theory that each particle is being read as
two events. In addition, it can be clearly seen from the plots of
event vs. time that during each timestamp, there is a high- and
low-level fluorescence reading. The particles were designed to have
one bright and one dim region of fluorescence in the FL-2 channel,
which also gives support to the theory that each particle is being
read as two discrete events. This approach can be applied to three
or more events per particle as well. Each region/event can vary in
terms of fluorescence level, forward or side scatter, and
width.
[0284] In some cases, it is useful to incorporate distinct levels
of multiple fluorophores into each code region of the
multifunctional particles. As a proof-of-concept, we used
rod-shaped particles, 200.times.35.times.30 .mu.m, with a single 60
.mu.m code region on one end. The code region was labeled using
four distinct levels of Cy3 and Cy5 fluorescent dyes. Particles
were analyzed using the Accuri C6 cytometer with a flow rate of 100
.mu.l/min, a core size of 40 .mu.m, and a threshold of 5000 on FL4.
The results are shown in FIG. 7 below.
[0285] The plot in FIG. 7 shows that it is possible to create a
distinct fluorescent fingerprint in each code region of
multifunctional particles. Each cluster of data points represents a
distinct code.
[0286] For data analysis using this approach, an algorithm will be
needed that groups events into particles, orients the particles,
normalizes fluorescence against a standard if desired, and
quantifies the fluorescence, scatter, or event width in each code
and probe region. The corresponding code for each particle can then
be given a confidence level, and those that were not called with a
pre-defined level of confidence can be excluded from the analysis.
The fluorescence in the probe region can then be used to determine
the amount of target present in the sample analyzed. This system
can be easily automated using software that performed analysis
during or after scanning.
Example 10
Reading of Raw Signal
[0287] This Example demonstrates interrogating multifunctional
particles in standard flow cytometers. In some embodiments,
interrogation is performed to acquire signal from a cytometer
detector before it is processed into events by the machine's
firmware and use custom software to identify, orient, and analyze
particles scans. We performed proof-of-concept scanning of
particles in this manner, using three separate cytometers from
Partec, Accuri (C6), and Millipore (Guava).
[0288] To gather raw data, we used the leads (Partec and Millipore)
or QC pin (Accuri) from a single PMT in each cytometer, connected
them through a simple circuit (often just a single resistor), and
measured the voltage using a standard data acquisition (DAQ) board
(National Instruments NIDAQ-USB6250). A custom script written in
Python was used to communicate with the DAQ board, allowing the
user to input how many samples to acquire and at what frequency.
Samples were taken at rates ranging from 60 kHz to 1 MHz. After
acquisition, the data were stored in a single file.
[0289] For analysis, we applied Fast-Fourier-Transform-based
filtering to isolate the desired frequency response for each scan.
Then, particles were identified in each sample by setting a
threshold. If the signal was found to be above the threshold for a
predefined number of samples, the region of interest and its
flanking data points were stored as a single particle scan. Design
features built in to each particle were used to identify code and
probe regions. In addition, each signal could be normalized by a
given feature on each particle. Our barcodes in this example
consisted of series of stripes along the particle that had varying
levels of fluorescence.
[0290] We used a standard set of test particles to assess alignment
and consistency of particle-to-particle scan in three commercial
cytometers. We synthesized rod-shaped fluorescent particles bearing
three distinct regions. Static image scans from regular
fluorescence microscopy were compared to those acquired from the
raw scans obtained from a single PMT of each machine. After
applying FFT-based filtering to isolate the desired frequency
response for each machine, the signal from each particle identified
was scaled (x-axis only) to compensate for variations in speed and
plotted along a common x-axis. Typical results are shown in FIG. 21
and FIG. 22 with overlain particle scans and distribution of event
width (which inversely correlates with particle speed).
[0291] As can be seen, all three cytometers were capable of
scanning multifunctional particles with varying levels of accuracy
compared to the static scans. Notably, the Guava instrument showed
very good reproducibility, but had rounded features, most likely
due to a large laser spot size (.about.25 .mu.m) compared to the
dimension of each feature. The Accuri showed fairly reproducible
scanning but a significant amount of noise. The Partec showed
considerable variability in scan intensity, likely due to a laser
spot size that did not span the entire flow cell--most likely,
particle brightness was dependent on where the particle was
positioned in the flow cell cross-section.
[0292] Nucleic Acid Detection We performed nucleic acid detection
using particles with a single, wide fluorescent region to represent
a "barcode" and a narrow probe region flanked by two inert regions.
We detected microRNA let-7a spiked in at a level of 1 fmol into a
50 .mu.l reaction with hybridization for 90 min at 55 C. Bound
target was labeled with streptavidin-phycoerythrin and particles
were scanned using the Millipore Guava. The level of fluorescence
in the probe region of the particle indicated how much target was
present in the assay. The results are shown in FIG. 23.
[0293] Again, the results were reproducible but showed rounding of
signal at the interfaces between various particle regions. For the
highest sensitivity, our assay would benefit from green (532 nm)
laser excitation.
Example 11
Discrimination of Mature microRNA Targets from Precursors
[0294] According to the present invention, probes can be designed
for labeling. This Example demonstrates detecting microRNAs using
selective end-labeling to detect mature microRNA species without
detection of precursor species.
[0295] We used a mature microRNA, the entire sequence of which is
contained in one end of their precursor (3' or 5' depending on the
exact microRNA species). If labeling is performed on the end common
to both mature and precursor, both species are labeled and
quantified. To selectively detect mature species, labeling can be
accomplished on the opposite end of the mature species, the end
sequence which is contained internally on the precursor. In the
way, mature species can be detected without detection of the
precursor.
[0296] To demonstrate the detection of only mature microRNA
species, synthetic miR-143 mature and its precursor were used. The
mature sequence for miR-143 appears on the 3' end of the precursor.
The sequences for these species are given below in Table 6.
TABLE-US-00006 TABLE 6 Sequences for mature and precursor miR-143
species. The mature sequence is underlined in the precursor
sequence. miR-143 Species Sequence Mature
5'-UGAGAUGAAGCACUGUAGCUC-3' (SEQ ID NO: 20) Precursor
5'-GGUGCAGUGCUGCAUCUCUGGUCAGUUG GGAGUCUGAGAUGAAGCACUGUAGCUC-3' (SEQ
ID NO: 21)
[0297] Two batches of particles were used for this study--one
contained miR-143 probe designed for labeling the 3' end of the
target and the second contained a miR-143 probe designed for
labeling the 5' end of the target. The probe and adapter sequences
used in this study are shown in the tables below.
TABLE-US-00007 TABLE 7 Probe designs for labeling the 3' or 5' end
of mature miR-143 species. The sequence for mature miR-143 is
underlined in each probe sequence, and the remaining sequence is
designed to capture the designated adapter for labeling. Probe
(Target Label End) Sequence Probe 1 (3' End):
5'acryl-GATATATTTTAGAGCTACAGTG CTTCATCTCA-3' (SEQ ID NO: 22) Probe
2 (5' End): 5'acryl-GAGCTACAGTGCTTCATCTCAA TTTATATTT-3' (SEQ ID NO:
23)
TABLE-US-00008 TABLE 8 Adapter sequences for 3' and 5' labeling.
Adapter 1 has a 5' phosphate group and 3' biotinylation, while
Adapter 2 has a 5' biotinylation. Adapter (Target Label End) Type
Sequence Adapter 1 (3' End): DNA
5'phos-TAAAATATATAAAAAAAAAAAA-3'bio (SEQ ID NO: 24) Adapter 2 (5'
End): RNA 5'biotin-AAAAAAAAAUAUAAU (SEQ ID NO: 25)
[0298] Probes 1 and 2 were designed to label bound target on the 3'
or 5' end of mature miR-143, respectively. For 3' labeling, a DNA
adapter was used while for 5' labeling, an RNA adapter was used.
These provided the most efficient ligation for the designated end
of the RNA target.
[0299] Particles were incubated, in a buffer containing 0.5M NaCl
in TE, for 90 minutes at 55 C with either 500 amols mature miR-143,
500 amols miR-143 precursor, or no miR-143 target. After
hybridization, particles were washed in TE containing 0.05M NaCl.
For particles bearing Probe #1, a ligation was performed with T4
DNA ligase at concentration of 0.8 U/ul and Adapter 1 at 40 nM. For
particles bearing Probe #2, a ligation was performed with T4 RNA
Ligase 2 at a concentration of 0.02 U/ul and Adapter 2 at 40
nM.
[0300] After 30 minute ligation at room temperature, particles were
rinsed with TE containing 0.05M NaCl, and incubated with
streptavidin-phycoerythrin reporter diluted to 2 ug/ml for 30
minutes at room temperature. After reporter conjugation, the
particles were imaged using fluorescence microscopy. The
signal-to-noise ratio, calculated as the average signal divided by
the standard deviation of the signal from the negative control
sample, was calculated for each miRNA species and labeling format.
The results are shown in the table below:
TABLE-US-00009 TABLE 9 Typical results from labeling experiment
using 3' and 5' labeling formats for mature and precursor miR-143
species. The signal-to-noise (SNR) represents the average
fluorescence intensity signal divided by the standard deviation of
the negative control signal. Labeling Format miR-143 Species SNR
Probe/Adapter #1 (3') mature 75.9 precursor 33.9 Probe/Adapter #2
(5') mature 21.6 precursor ND
[0301] As can be seen, when Probe #1 is used with DNA ligase (Dnal)
and Adapter #1, both mature and precursor miR-143 show detectable
signal, although the precursor is at a much lower level. When using
RNA ligase 2 (Rnal2) with Adapter #2, mature miR-143 is the only
target that is effectively labeled, while the precursor species is
not detected (ND) above SNR=3. This shows effective discrimination
for the detection of mature miRNA detection over precursor species
when labeling the 5' end of the target.
Example 12
Two-Strip Encoding with Probe Functionalization
[0302] This example demonstrated that compositions described herein
may be synthesized and functionalized for encoding, in particular,
universal encoding.
[0303] Using stop-flow lithography as described in U.S. Pat. No.
7,709,554, the contents of which is incorporated herein by
reference, we initially synthesized rectangular particles bearing a
stem-loop encoding probe (SEQ ID NO:26)
(/5Acryd/AATAAACACGGGAATAACCC, IDT, incorporated at 10 uM),
negative control region, probe anchor (SEQ ID NO:27)
(/5Acryd/GATATATTTT, IDT, incorporated at 50 uM), and a second
negative control region. Particles were
.about.120.times.60.times.35 um and each of the 4 strips was
.about.30 um thick. Particles were incubated with varying ratios of
fluorescently-labeled encoding adapter (SEQ ID NO:28)
(5'-Phos-GTGTTTATAA-Cy3, IDT) to unlabeled adapter (SEQ ID NO:29)
(5'-Phos-GTGTTTATAA-invdT, IDT). Each ligation mix contained
NEBuffer #2 with 250 nM ATP, 200 U T4 DNA Ligase (all from New
England Biosciences), and a total of 40 nM encoding adapters.
Ligation was carried out for 30 min at room temperature, with
mixing at 1500 rpm on a thermomixer. Afterward, particles were
rinsed 3.times. with TE buffer containing 50 mM NaCl and 0.05%
Tween-20. Particles were imaged on a Nikon Ti-S microscope using a
20.times. objective, NA=0.5, and a CCD Camera (Imaging Source).
Scans of fluorescent intensity were plotted along the particle
length and the fluorescent signals were measured and averaged for
five particles in each sample. Typical results are shown in FIG.
24.
[0304] Data demonstrates that the labeling worked, but the
relationship of fluorescence vs. adapter ratio was not linear. This
implies a difference in hybridization or ligation rates between the
fluorescent and non-fluorescent adapters used. Unfortunately, the
images at the 100% level were saturated, so it is difficult to use
all 4 data points for comparison. Raw and scaled data are shown in
Table 10:
TABLE-US-00010 RAW DATA Sig SD COV Normalized Sig 100% 240.00 0.25
0.00 100% 1.00 50% 201.63 2.07 0.01 50% 0.84 25% 140.43 3.55 0.03
25% 0.59 12.50% 92.07 2.45 0.03 12.50% 0.38
[0305] Furthermore, we used universal particles, synthesized using
the stop-flow lithography process described above, bearing two
encoding regions (with hairpin anchors) and a probe region (with
linear anchor). Particles were .about.180 um long, 35 um wide, and
.about.25 um thick with 4 regions--UCode1 (synthesized at .about.10
uM), UCode2 (at .about.10 uM), inert, and UAnchor (at .about.50
uM). DNA sequences used in this study are as follows (as ordered
from Integrated DNA Technologies, 5-'3'):
TABLE-US-00011 (SEQ ID NO: 30) UCode1 Probe = 5'Acryd/AAT AAA CAC
GGG AAT AAC CC (SEQ ID NO: 31) UCode2 Probe = /5Acryd/AAT AAT GTG
CCC AAT AAG GG (SEQ ID NO: 32) UCode 1 Adapter Cy3 = /5Phos/GTG TTT
AAT A/3Cy3Sp/ (SEQ ID NO: 33) UCode 1 Adapter invdT = /5Phos/GTG
TTT AAT A/3InvdT/ (SEQ ID NO: 34) UCode 2 Adapter Cy3 = /5Phos/CAC
ATT ATT A/Cy3Sp/ (SEQ ID NO: 35) UCode 2 Adapter invdT = /5Phos/CAC
ATT ATT A/3InvdT/
[0306] After particles were synthesized and rinsed, we prepared
Ligation Master Mixes, each with 250 nM ATP (NEB), 200 U T4 DNA
Ligase (NEB), 0.05% Tween-20 (Sigma), and DNA Adapter (given below)
in a total of 500 ul NEBuffer #2 (NEB):
[0307] F1: 80 nM UCode Adapter 1 Cy3
[0308] N1: 80 nM UCode Adapter 1 invdT
[0309] F2: 80 nM UCode Adapter 2 Cy3
[0310] N2: 80 nM UCode Adapter 2 invdT
[0311] In a 96-well, 1.2 um filter-bottom plate (Millipore), we
added mixes of the ligation mixtures as listed in Table 11.
TABLE-US-00012 F1 (ul) N1 (ul) F2 (ul) N2 (ul) W1: 1, 1 100 0 100 0
W2: 1, 0 100 0 0 100 W3: 0, 1 0 100 100 0 W4: 1, 0.25 100 0 25 75
W5: 0.25, 1 25 75 100 0 W6: 0.25, 0.25 25 75 25 75 W7: 0.25, 0 25
75 0 100 W8: 0, 0.25 0 100 25 75
[0312] We then added 10 ul of particles to each well (.about.200
particles) and put the plate on mixer, and mixed at 1500 rpm for 30
min at room temp. We then used a filter unit to pull off excess
buffer and rinse 2.times. with 200 ul TE buffer with 0.05% Tween-20
(TET). For imaging, we added 60 ul of TET to each well, mixed for
30 sec and then pipetted 35 ul from each well onto a glass slide.
Each sample was sandwiched with an 18.times.18 mm coverslip. We
image particles with Nikon Ti-U microscope with Imaging Source CCD
camera with brightness=30, gain=600, exposure=0.412 sec, gamma=150.
After imaging 5 particles per sample, w used ImageJ to orient and
crop images, and plugged data into Excel for analysis. The raw data
from the analysis are shown in Table 12 below, the ratios
representing the amount of fluorescent adapter used (where
1=100%):
TABLE-US-00013 ratio 1 P1 SD1 COV ratio 2 P2 SD2 COV 1.00 85.71
2.26 0.03 1.00 78.86 1.98 0.03 1.00 83.45 3.85 0.05 0.00 2.55 0.64
0.25 0.00 1.42 0.25 0.18 1.00 77.96 4.22 0.05 1.00 85.32 3.55 0.04
0.25 46.14 1.25 0.03 0.25 47.38 4.11 0.09 1.00 73.94 5.52 0.07 0.25
48.98 2.40 0.05 0.25 47.86 0.87 0.02 0.25 48.51 0.87 0.02 0.00 1.20
0.66 0.55 0.00 0.31 0.56 1.80 0.25 46.86 0.77 0.02
[0313] Shown below (FIG. 25 a and b) is a schematic of the particle
design, sample fluorescent images from each ligation reaction, and
average scans across particles.
[0314] A plot of the measured fluorescence versus the adapter
amount from each ligation mix are shown in FIG. 26, where "Code 1"
and "Code 2" represent the average signal in the first and second
code region, respectively. The encoding worked well. More
importantly, the encoding was specific; the signal for each code
region seemed to be independent of the other. As observed in the
above experiments, the fluorescent level of each code region was
not linear with respect to the amount of fluorescent adapter. The
signals were very reproducible, especially at the 25% fluorescent
adapter levels.
Example 13
Universal Encoding Using Template Functionalization
[0315] In this example, universal particles were made, bearing
several polynucleotide templates for encoding.
[0316] As an example, particles were designed such that there were
three active regions separated by two inert regions, and they can
be scanned by a commercial cytometer. The DNA templates with
acrylate modification (denoted 5'acry) used for encoding are listed
below in Table 13:
TABLE-US-00014 Template name: Sequence UC1
5'acry-AATAAACACGGGAATAACCC-3' (SEQ ID NO: 36) UC2
5'acry-AATAATGTGCCCAATAAGGG-3' (SEQ ID NO: 37) UC3
5'acry-AATAACTCTGGGAATAACCC-3' (SEQ ID NO: 38)
[0317] These templates were used with particles of the design
illustrated in FIG. 27. Hydrogel particles, consisting of
poly(ethylene glycol), with this design were made using flow
lithography as discussed above. The particles were made with
monomers containing the following concentrations of polynucleotide
templates as listed in Table 14.
TABLE-US-00015 Barcode 1 Inert Probe Inert Barcode 2 UC1 50 uM NA
NA NA NA UC2 2.5 uM NA 0.5 uM NA 2.5 uM UC3 NA NA NA NA 50 uM
[0318] For use in a flow cytometer, the UC2 template is
functionalized with a Cy5 modified adapter in order to trigger
events in the RED2 channel. For barcoding, the UC1 and UC3
templates are functionalized with blends of adapters (Cy3 modified,
FAM-6 modified, or non-fluorescent) in order to achieve distinct
levels of fluorescence in the YEL channel of the cytometer for
barcoding and distinct levels of fluorescence in the GRN channel
for orientation. The sequences of the adapters used are given in
Table 15 below:
TABLE-US-00016 Adapter Name Sequence (5'-3') UC1-A-Cy3
5'phos-GTGTTTATTA-Cy3 (SEQ ID NO: 39) UC1-A-NF 5'phos-GTGTTTATTA
(SEQ ID NO: 40) UC1-A-FAM6 5'phos-GTGTTTATTA-FAM6 (SEQ ID NO: 41)
UC2-Cy5 5'phos-CACATTATTA-Cy5 (SEQ ID NO: 42) UC3-A-Cy3
5'phos-AGAGTTATTA-Cy3 (SEQ ID NO: 43) UC3-A-NF 5'phos-AGAGTTATTA
(SEQ ID NO: 44) UC3-A-FAM6 5'phos-AGAGTTATTA-FAM6 (SEQ ID NO:
45)
[0319] The number of distinguishable fluorescence levels in each
barcode region depends on the accuracy of encoding, and performance
characteristics of the cytometer being used. To determine the
proper code dilutions to maximize multiplexing on a given flow
cytometer, several blends of fluorescent and non-fluorescent
adapters may be tested for a given encoding template. Several
ratios of fluorescent to non-fluorescent adapters were explored by
logarithmically varying the ratio between fluorescent and
non-fluorescent and ligating multiple batches of particles a curve
was generated as seen in FIG. 28. Template functionalization via
ligation with adapters was carried out simultaneously for all
templates for one hour at room temperature using 0.8 U T4 DNA
ligase per ul, 40 nM total adapter for each encoding template
(fluorescent or non-fluorescent).
[0320] Several dilutions of UC1-A-Cy3 in UC1-A-NF were used to
functionalize universal particles in order to develop a titration
curve for the fluorescence obtained. The curve in FIG. 28 shows the
log(fluorescence) obtained using ratios of Cy3:NF adapter ranging
from 0:1 to 1:1. This curve was obtained using YEL fluorescence
measurements from a Guava easyCyte 6HT.
[0321] Using this methodology, titration curves were made for the
UC1 and UC3 templates with Cy3 modified and non-fluorescent
adapters. Typical results, showing log(fluorescence), are given in
Table 16 below.
TABLE-US-00017 Barcode 1 Barcode 2 Ratio 1/Ratio Corrected
Intensity COV Ratio 1/Ratio Corrected Intensity COV 0 0 -0.79
17.40% 0 0 -0.8 10.80% 256 0.0039063 -0.78 17.00% 256 0.00390625
-0.81 8.70% 128 0.0078125 -0.74 20.40% 128 0.0078125 -0.78 11.60%
64 0.015625 -0.63 13.30% 64 0.015625 -0.74 10.20% 32 0.03125 -0.52
12.60% 32 0.03125 -0.69 11.70% 16 0.0625 -0.33 10.80% 16 0.0625
-0.6 10.00% 8 0.125 -0.1 10.00% 8 0.125 -0.44 9.00% 4 0.25 0.15
10.90% 4 0.25 -0.25 9.20% 2 0.5 0.43 10.90% 2 0.5 0.01 9.20% 1 1
0.69 12.90% 1 1 0.28 11.40%
[0322] Dilutions used for encoding were selected such that the
expected fluorescence levels had very little chance of overlap with
an adjacent dilution, given the expected coefficient of variation
(COV) in the signals measured here. In order to obtain 5 levels for
each barcode regions, the following dilutions of non-fluorescent to
Cy3-modified adapters in Table 17 were used:
TABLE-US-00018 Adapter Log (intensity) NF:Cy3 Barcode 1 -0.79 0
-0.42 21 -0.05 6.7 0.32 2.5 0.69 1 Barcode 2 -0.80 0 -0.53 17.7
-0.26 4.1 0.01 2 0.28 1
[0323] With the possibility of generating 5 distinct levels of
fluorescence in each Barcode 1 and Barcode 2, a total of 25 unique
combinations can be obtained. These dilutions were tested with the
universal particles synthesized in this Example. To differentiate
the two coding regions, a higher level of green (FAM-6) was added
to the dilution series for Barcode 2. The fluorescent adapter for
UC2 was also included in the functionalization to generate signal
in RED2 which was used to trigger events on the cytometer.
Particles were functionalized via simultaneous ligation with blends
of adapters for UC1, UC2, and UC3 such that the total concentration
of adapter for a given adapter was 40 nM. Reactions were carried
out at room temperature for 1 hour with 0.8 U/ul of T4 DNA ligase
present. Particles were rinsed in TE buffer and scanned using a
Guava 6HT.
Example 14
Scanning Multi-Event Particles with Commercial Cytometers
[0324] In this example, universal particles made in Example 12 was
used for scanning using commercial cytometers. A Millipore Guave
easyCyte 6HT-2L as an exemplary cytometer can be used for
scanning.
[0325] Here, particles were scanned on a cytometer using RED
fluorescence to trigger events, yellow fluorescence to encode
particles, and green fluorescence to orient particles. As
discussed, particles represented in FIG. 27 are comprised of three
active regions (denoted Barcode 1, Probe and Barcode 2), separated
by two inert regions. All three active regions contain a
Cy5-modified nucleic acid to trigger events in the RED2 channel of
a Guava easyCyte cytometer. The level of Cy5 in the probe region
was intentionally made to be approximately one half that in the
barcoding regions. The two barcode regions contain varying levels
of Cy3-modified oligonucleotides. The levels of Cy3 in each barcode
region, detected in the YEL channel of the Guava cytometer, are
used to give the particle a unique encoding signature. In addition,
a FAME-modified oligonucleotide is incorporated in the barcoding
regions, with a higher level in Barcode 1, in order to provide a
means of orientation. A mixture containing 25 different particle
barcodes, with 5 unique levels of Cy3 fluorescence in Barcode 1 and
5 unique levels in Barcode 2, were used to demonstrate
proof-of-concept.
[0326] A threshold of 500 set on the RED2 channel with the Guava
6HT was sufficient to allow identification of all three regions of
the particle. Hundreds of particles, at a concentration of
approximately 20 per microliter in TE buffer, were scanned at 0.6
microliters per second. The events associated with the particles,
plotted on YEL (barcoding color) versus RED2 (trigger color) are
shown in FIG. 29, along with YEL versus GRN (for orientation). The
probe region of the particle appears in the lower left hand side of
the plot, with lower levels of green (FAM-6.TM.) and yellow
(Cy3.TM.). The two coding regions of the particles show up as bands
on the upper right hand corner of the plot. A total of ten bands
can be discerned on the plot, comprising of five codes on the
Barcode 1 region of the particle and five codes on the Barcode 2
region. The raw values represented on these plots are then exported
into a FCS file for further analysis. All events exported in the
CSV are store in temporal sequence.
[0327] Custom software was used to analyze the events exported from
the Guava software and reconstruct them, based on patterns in the
RED2 and GRN fluorescence. The software sorts through the sequence
of events to assess whether three subsequent events fit the
expected patterns for RED2 and GRN fluorescence. If the pattern is
fit, the events are grouped as a particle and can be analyzed for
barcode in YEL fluorescence and oriented by GRN fluorescence. After
reconstruction, a more coherent plot can be composed using the
level of yellow intensity (Cy3.TM.) on Barcode 1 vs. that of
Barcode 2 (designated code 1 and code 2, respectively). This plot
is shown in FIG. 30. Ellipses are used to identify clusters of
particles that are associated with each of the 25 barcodes present.
As can be seen, the five levels of fluorescence in Barcode 1 (code
1) and Barcode 2 (code 2) can be readily distinguished.
[0328] In addition to determining the barcode, the custom software
also quantifies the fluorescence associated with captured target in
the probe region of the particle, the information of which is
stored as the second of the three events associated with a
particle. When using a reporting fluorophore that can be detected
in the YEL channel, the level of YEL fluorescence in this region
indicates the quantity of target present.
Example 15
Development of One-Spot Isothermal Nucleic Acid Amplification
Assays
[0329] This example further illustrates using encoded particles in
accordance with the present invention in various applications, such
as nucleic acid amplification assays. As previously demonstrated,
we has developed various compositions and methods, providing (1)
sub-attomole sensitivity, (2) single-nucleotide specificity, (3)
rapid scanning, (4) a virtually unlimited encoding density, and (5)
low cost. For example, the high performance of our assay is shown
for microRNA targets in above Examples, and FIG. 31. The simplicity
of our particle synthesis, one-pot assay, and single-color
detection described herein enables a new class of low-cost
diagnostic tools.
[0330] In this project, we will use encoded hydrogel particle assay
to develop a point-of-care system that (1) can perform accurate
panel-based tests on DNA or RNA from >10 pathogens at once, (2)
uses a one-pot, isothermal assay that is rapid and easy to use, and
(3) utilizes low-cost disposable cartridges in a hand-held device.
We are developing one-pot assays in which we amplify specific
genomic targets of pathogens, hybridize the amplicons to barcoded
gel particles, and quantify the bound amplicons in a single closed
tube, with a single user intervention (sample loading). Multiple
species-specific targets will be amplified using isothermal,
helicase-dependent amplification (HDA). Fluorescently-labeled
amplicons will be free to diffuse into the encoded hydrogel
particles and hybridize to their complementary nucleic acid probes
embedded throughout (FIG. 32). The flexibility of our innovative
microfabrication process allows us to precisely tune the pore size
or particles to exclude helicase enzymes (.about.4.5 nm), which
would unwind bound targets. Due to this advantage, the whole
process can be carried out without user intervention. After <1
hour, particles will be scanned rapidly in a flow-through channel
using fluorescence to read the barcode of each particle and
quantify the corresponding targets. It is our intention to make the
system cartridge-based with disposable units that can be interfaced
with a portable analysis unit.
[0331] We further developed one-pot assays as described in various
embodiments above, using standard PCR and has recently begun to
investigate isothermal assays for the purpose of this project. We
used .lamda.-phage DNA as a model system for assay development.
First, we designed Tm-matched primers against 2 target regions of
lambda with a cross-check against human genomic DNA to avoid
non-specific amplification. The amplicons were designed to be
.about.60 bp in length. Probes were designed to target each
amplicon, containing the complementary sequence excluding the
binding site for the forward primer. We performed one-pot assays
using both standard PCR and isothermal amplification (FIG. 33).
[0332] For each assay, we prepared PCR mixes containing a single
primer set (forward primer labeled with Cy3), .about.50 encoded gel
particles with two spatially-separated probes regions for the
amplicons, and either .lamda.-phage DNA or human genomic DNA. Using
both standard PCR and isothermal amplification, we were able to
show specific amplification and hybridization for each amplicon
generated and no non-specific amplification of human genomic DNA.
We performed a serial dilution of .lamda.-phage from 11,000-11
copies per reaction. Using primer set #1, we were able to detect
.about.11 copies of template in our preliminary studies using a
one-pot assay with standard PCR. Although sensitivity has not been
assessed for the isothermal reaction, the signals observed on
particles after 60-min reaction were stronger than those obtained
from standard PCR after 40 cycles.
[0333] Design of Amplification Primers and DNA Detection Probes
[0334] For any pathogen, it is necessary to identify genomic
targets that are both specific to the pathogen, and conserved over
strains. We will build on the work of others developing PCR-based
assays for the four pathogens of interest. Targets for genomic HIV
RNA include: the pol-integrase region and the env and gag genes.
Targets used for PCR-based identification of for typhoid bacterium
genome include the tyv, flag, viaB, and ratA genes. Conserved
regions for the malarial parasite genome include the 18s rRNA gene
and the circumsporozoite (CS) gene. For dengue virus, Gurukumar et
al. targeted a conserved region in the 3'UTR of the viral genome.
Initially, our experiments are designed to target similar regions
for these pathogens.
[0335] For multiplexed isothermal amplification, it is necessary to
design compatible primer sets that (1) have similar melting
temperatures, (2) do not form hetero-dimers, and (3) specifically
and efficiently amplify the targets identified for each pathogen
species. Because we are developing a "one-pot" assay where the
particles are present in the amplification reaction, we have
additional considerations including (1) avoiding 3'-extension of
the DNA probes embedded in the particle probe-regions, and (2)
keeping amplicons small (<100 bp) for rapid diffusion into our
particles where they will hybridize. In approaching this challenge,
we will learn from an extensive body of literature for primer
design in multiplexed amplification.
[0336] As shown in FIG. 34, primers will be designed to have
melting temperatures near 55.degree. C., be .about.20 bp in length,
and provide amplicons .about.60 bp in size. The forward primers
will contain a single Cy3 label for fluorescence detection. For
each of the pathogen species, we will design several sets of
primers that meet the aforementioned requirements. Primer design
will be accomplished as follows:
[0337] First, potential primers sets will be identified for the
species of interest (dengue, typhoid, malaria, and HIV as well as
.lamda.-phage and MS2 controls) for commonly-targeted, conserved
genomic regions using a primer-design program like Primer3.
[0338] Second, each potential primer identified will be assessed
for species-specificity via BLAST search.
[0339] Third, a script will be written in MATLAB to assess
dimer-formation with all other primers (using nearest neighbor
calculations), and to identify a total of 30 primer sets (5 for
each of the four pathogens and two controls) that meet all
requirements.
[0340] Optimization of Helicase-Dependent Amplification (HDA) for
DNA Detection.
[0341] To maximize the probability of success in developing a
working isothermal amplification technique, we will begin with
commercially available kits and standard protocols, using
.lamda.-phage as a model system. We will use the IsoAmp.RTM. kit
(New England Biosciences) to perform isothermal amplification on
5000 copies of .lamda.-phage spiked into human genomic DNA as a
model system. We will optimize several parameters including (1)
primer concentrations (from 0.1 .mu.M-10 .mu.M), (2) primer length
(from 20-26 bp), (3) amplification temperature (from 50-65 C), and
(4) reaction time (from 10-120 min). The efficiency and yield of
the isothermal reaction will be assessed and compared to the yield
of a standard 30-cycle PCR reaction that utilizes the same primers
and target regions. Polyacrylamide Gel Electrophoresis (PAGE) will
be used to make this qualitative comparison, with target band
intensity as the standardized metric.
[0342] After optimizing reaction conditions, the primer sets for
the other DNA species (P. falciparum, and S. tyhpi) will be
interrogated for efficiency and specificity. Again, we will assess
amplification efficiency for each primer set by quantifying the
amount of target produced in 10, 30, and 90 min isothermal
amplification (via PAGE). Specificity will be assessed by
performing PCR with a primer set for a given species using human
genomic DNA spiked with .about.5000 copies of genomic species for
all other species. Specific robust reactions will show
amplification of only the target sequence. Of the 5 primer sets
designed for each species, we will use the three most efficient
sets that show good specificity.
[0343] The three primer sets for each species will be used in a
multiplexed amplification assay with one target present at a time.
For multiplexed reactions, target amplification will be
accomplished using a fluorescent forward primer, as shown in FIG.
34. For each reaction, the amplification product will be quantified
using a 30 min incubation with barcoded gel particles bearing
probes for each amplicon (FIG. 35). The DNA probes for each
particle will be designed to span the reverse primer and internal
region, and will be 3' capped to avoid extension as shown in FIG.
35. This design will allow for one-pot amplification/capture in
subsequent studies.
[0344] Ideally, the fluorescent signals observed on the particles
would be consistent over the 3 amplicons generated for each
species. If significant differences in amplification/capture
efficiency are observed for the multiplexed amplification, several
reaction conditions will be varied in order to normalize the amount
of amplicon captured on each particle probe region. First, the
relative amounts of primers can be adjusted accordingly to alter
the reaction kinetics. Second, primer length can be adjusted in
order to change binding efficiency--this will likely affect the
primer Tm and increase nonspecific amplification, and is therefore
not desirable. Third, we have demonstrated that the rate of capture
can be adjusted in a very predictable manner by changing the
concentration of probe in each region of the particles.
[0345] After normalizing quantified signal for each species, we
will perform one-pot assays where amplification and hybridization
are completed in the same reaction. We will determine the effects
that the particles have on the sensitivity and specificity of the
primer sets. Iterative optimization of primer and probe sequences
may be necessary, along with reaction temperature and duration. In
the case of multiplexed, one-pot assays, we will image particles in
both static (microscopy) and flow-through modes. We will monitor
and compare sensitivity and reproducibility of the two
approaches--these will be important considerations when designing
the integrated system proposed in Example 17.
[0346] Reverse Transcription of Pathogen Genomic Material.
[0347] While the genomic DNA of P. falciparum and S. typhi can be
directly amplified, the detection of HIV-1 and dengue virus, both
ssRNA viruses, will require reverse transcription of genomic RNA to
cDNA for amplification and analysis. This requires the addition of
a reverse transcriptase enzyme into the isothermal amplification
reaction. Reverse transcription has been successfully coupled with
Helicase-Dependent Amplification, and isothermal RT-HAD kits are
available commercially (IsoAmp.RTM., NE Biolabs). This is the same
kit being used in the previous studies.
[0348] We will start with a standard recommended protocol for RNA
reverse transcription and cDNA amplification, using Phage MS2 as a
model system for optimization. Using the 5 primer sets originally
identified for Phage MS2, we will perform a similar optimization as
done for DNA amplification. Once optimized, we will assess primer
sets for the pathogen RNA targets, again quantifying amplification
efficiency and specificity. Using the 3 best primer sets for each
RNA species, we will perform a multiplex amplification for each.
Again, amplicons will be quantified using encoded gel particles in
both static and flow-through modes.
[0349] Optimization of One-Pot Assay for Multiplexed Pathogen DNA
or RNA Detection.
[0350] Having independently optimized both multiplexed detection of
DNA targets and RNA targets, we will combine these assays, and
optimize for performance and speed. Using a human genomic DNA
background, we will spike genomic material from each pathogen into
samples at concentrations ranging from 1-100,000 copies. We will
investigate and optimize primer concentrations, enzyme
concentration, assay duration, and assay temperature. We will
evaluate the performance of the assay for each pathogen, measuring
specificity, limit of detection, and sensitivity at 100
copies/r.times.n. It is our goal to demonstrate 95% sensitivity for
all pathogens at 100 copies/r.times.n with an assay time of 60
min.
[0351] Although the use of isothermal amplification with a one-step
amplification/hybridization reaction capable of detecting both DNA
and RNA species in a single sample is ideal, there are several
alternative approaches which are perhaps less attractive, but more
likely for success.
[0352] For example, if Helicase-Dependent Amplification (HDA) does
not prove effective, several other isothermal methods will be
investigated including Loop-Mediated Isothermal Amplification
(LAMP), Strand-Displacement Amplification (SDA), and Nucleic Acid
Sequence-Based Amplification (NASBA). Importantly, a NASBA-based
assay has previously been approved by the FDA for the detection of
HIV-1 and so would serve as an obvious next choice for RNA
detection. Alternatively, standard PCR may be used. In fact,
microfluidic methods for PCR amplification are becoming very common
so the use of this technique would not be out of the question.
Also, if the detection of RNA pathogens (which required reverse
transcription) and DNA pathogens in the same tube gives rise to
insurmountable complications, these assays can be separated into
two distinct tests.
[0353] In some embodiments, as an alternative approach to one-pot
assays, two-step amplification/hybridization can be use in
accordance with the present invention. If the particles interfere
in any way with the amplification process, it may be necessary to
perform amplification and hybridization separately. Envisioning a
cartridge-based system in which this technology can be implemented,
this assay can still be accomplished on-chip but will require
slightly more sophisticated liquid handling. Although this is not
the ideal situation, it is manageable and can feasibly meet the
needs of diagnostics in the developing world.
Example 16
Validation of One-Pot Assay for Multiplexed Pathogen Detection
[0354] After developing a one-pot assay for the multiplexed
detection of pathogens in Example 15, we will validate it using
clinically-relevant samples and benchmark it against
pathogen-specific assays developed for quantitative PCR, the
current gold standard for nucleic-acid based pathogen diagnostics.
This objective will be important in demonstrating the clinical
utility of this assay.
[0355] We will obtain a representative set of clinically-relevant
samples from several collaborators. Without being bound to any
particular theory, it is believed that the samples we obtain will
be well-preserved. This is especially important for RNA detection
as RNA is rapidly degraded by RNase activity. If the available
sample volume permits, we will perform quality control via DNA/RNA
sizing with an Agilent Bioanalyzer. Another assumption is that
these samples will be representative of the samples that would be
obtained in the field when our technology is deployed. Ideally, the
samples would span a broad range of pathogen load, and states of
patients' immunologic response.
[0356] There are several stages in the validation of our assay.
Initially, we will investigate various methods for purifying
nucleic acids from whole blood and determine compatibility with our
assay for each pathogen. This will be important in determining
which purification technologies could be integrated with our
platform after this initial research project is completed. We will
ideally be able to select one isolation technique that performs
well for all pathogens, and use it for all validation tests. We
will purify nucleic acids from the clinical samples (blood or
plasma) provided by our collaborators and test the samples using
our one-pot test and also commercially-available pathogen qPCR
kits. This will allow a direct benchmark of our assay against the
current state-of-the art. Details for each part of the validation
process are given below.
[0357] Assessment of Nucleic Acid Purification Techniques.
[0358] There are several methods for extracting nucleic acids from
whole blood, plasma, or serum. Most of the kits are specific for
either RNA or DNA, though a few kits can be used to extract both.
We will investigate several commercially-available kits
including:
[0359] DNA Extraction:
[0360] QIAamp Blood DNA Mini Extraction Kit (QIAGEN), Genomic DNA
Extraction Kit (Bioneer), Extract-N-Amp Blood PCR Kits (Sigma).
[0361] RNA Extraction:
[0362] QIAmp Viral RNA Mini Extraction Kit (QIAGEN), Viral RNA
Extraction Kit (Bioneer).
[0363] Simultaneous Extraction of DNA and RNA:
[0364] QIAamp MinElute Virus Spin Kit, QIAamp UltraSens Virus Kit,
NucleoSpin Virus Kit (Macherey-Nagel).
[0365] Clearly, the optimal mode for multiplexed assays is the use
of a single extraction method for parallel isolation of pathogen
DNA and RNA. We will devote a significant amount of effort into
identifying and optimizing a method for dual nucleic acid
extraction that functions well with our one-pot assay. To assess
compatibility, we will use well-characterized clinical samples
containing each pathogen and perform extraction with each of the
kits. The samples will subsequently be assessed with our one-pot
assay and also validated using qPCR kits specifically designed for
each pathogen.
[0366] Assay on Clinical Samples with Direct Comparison to
qPCR.
[0367] Nucleic acids from clinical samples (at least 30 for each
pathogen type) will be purified using the optimal method determined
in the previous section. We will perform a one-pot, multiplexed
assay for the detection of pathogens in each sample and compare our
results to qPCR assays specifically designed for each pathogen. For
three of the four pathogens being investigated, there are several
qPCR kits available. At the time we reach this objective, we will
select the kit that has shown best performance and has received
certification for diagnostic testing: [0368] Dengue: Primer Design,
Ltd. and Genome Diagnostics [0369] Malaria: Primer Design, Ltd.,
AccuPower, and Genome Diagnostics [0370] HIV-1: Primer Design,
Ltd., and Genome Diagnostics [0371] Typhoid: To our knowledge,
there is no commercially-available qPCR assay for S. tyhpi. There
is a multiplex PCR-based approach by Kumar et al. that will be used
in place of qPCR if no test has been developed by the time we reach
this objective of the project.
[0372] For relative comparison of sensitivity, we will also make
serial dilutions of a representative sample for each pathogen type
and analyze them using both our assay and the qPCR standard. A
strong correlation of our assay results with the state-of-the art
is important for validation. If our assay performs less desirably
than expected, we will troubleshoot the assay by re-evaluating the
regions targeted, primer design, and assay conditions. We will work
closely with our collaborators for guidance in resolving any
issues.
Example 17
Development of a Proof-of-Concept Integrated System
[0373] After successfully developing an assay, it is important to
begin conceptualizing methods for the assay to be implemented on
chip. For this reason, we will explore methods for performing
one-pot assay and analyzing particles in a single chamber. This
will require the development of an integrated system capable of
precise temperature control with capabilities for fluorescence
imaging for static particle analysis or rapid signal acquisition
for flow-through analysis. This system will allow periodic analysis
of the particles to assess the progress of reaction. As a
significant improvement over end-point analysis, we believe that
this method of analysis can be calibrated to provide precise
quantitative analysis of pathogen load. In this Example, we aim to
develop an integrated system to perform rapid, one-pot assays with
the ability to accurately quantify pathogen nucleic acids.
[0374] As the simplest initial approach, we will use a
commercially-available temperature-controlled cell perfusion
chamber with static imaging on a microscope. We will perform
several studies to evaluate the use of a one-pot chamber reaction
for pathogen detection and also assess the feasibility of
performing quantitative analysis with periodic image analysis.
After successful implementation, we will integrate the heated flow
chamber into a stand alone device with an LED illumination source
and a CCD camera to acquire images. This represents an important
step toward developing a cartridge-based system that would
ultimately be deployed in developing countries. More details on the
specific activities for this objective are given below.
[0375] One-Pot Assays in a Heated Flow Cell.
[0376] We will use a commercially-available heated flow cell,
similar to those sold by Bioptechs. These flow cells feature (1)
customizable channel design, (2) multiple interfaces for sample
introduction, (3) precise temperature control with +/-0.2.degree.
C. stability, and (4) a standard design for mounting on any
microscope. Initially, we will utilize a simple rectangular flow
chamber for assay and analysis. We will premix the reaction mixture
to include the sample of interest, isothermal amplification
reagents, and .about.50 particles for each of the four pathogens
and two controls. The device will be pre-heated to the isothermal
amplification temperature (.about.55.degree. C.) and the reaction
mixture will be introduced into the reaction chamber. Using a
standard inverted microscope with a 5.times. objective (for large
field of view), single excitation color, and single detection
color, particles will be imaged throughout the course of
amplification, likely every 5 minutes. Each image will be analyzed
to estimate the amount each amplicon generated, based on
probe-region fluorescence. After 60 min reaction, this dynamic data
will be used to estimate the amount of template initially present.
For a proof-of-concept, we will use the two controls, .lamda.-phage
DNA and Phage MS2, in order to characterize system performance and
ability to provide quantitative data.
[0377] Design and Construction of an Integrated Assay/Scanning
System.
[0378] After successful implementation of a microscope-based
system, we will integrate the flow cell into a custom optical
system. We will utilize a homogeneous LED illumination, a
low-magnification lens, and a CCD chip. The LED array, CCD, and
heated flow cell will be interfaced with a laptop computer for
control, image acquisition, and analysis. The unit will be
thoroughly tested, and results will be compared to those obtained
previously in this project. We will re-evaluate the sensitivity and
specificity of detection for each pathogen using this setup. We
will also investigate the quantitative dynamic range of the system
by spiking in targets from 1-1M copies. We take measures to ensure
that performance is not compromised in an integrated system.
[0379] All literature and similar material cited in this
application, including, patents, patent applications, articles,
books, treatises, dissertations and web pages, regardless of the
format of such literature and similar materials, are expressly
incorporated by reference in their entirety. In the event that one
or more of the incorporated literature and similar materials
differs from or contradicts this application, including defined
terms, term usage, described techniques, or the like, this
application controls.
[0380] The section headings used herein are for organizational
purposes only and are not to be construed as limiting the subject
matter described in any way.
Other Embodiments and Equivalents
[0381] While the present disclosures have been described in
conjunction with various embodiments and examples, it is not
intended that they be limited to such embodiments or examples. On
the contrary, the disclosures encompass various alternatives,
modifications, and equivalents, as will be appreciated by those of
skill in the art. Accordingly, the descriptions, methods and
diagrams of should not be read as limited to the described order of
elements unless stated to that effect.
[0382] Although this disclosure has described and illustrated
certain embodiments, it is to be understood that the disclosure is
not restricted to those particular embodiments. Rather, the
disclosure includes all embodiments that are functional and/or
equivalents of the specific embodiments and features that have been
described and illustrated.
Sequence CWU 1
1
45134DNAArtificial Sequenceprobe sequence for let-7a 1gatatatttt
aaactataca acctactacc tcat 34234DNAArtificial Sequenceprobe
sequence for miR-21 2gatatatttt atcaacatca gtctgataag ctat
34335DNAArtificial Sequenceprobe sequence fof miR-29b-2 3gatatatttt
aaacactgat ttcaaatggt gctat 35435DNAArtificial Sequenceprobe
sequence for miR-18ab-1 4gatatatttt aacccaccga cagcaatgaa tgttt
35533DNAArtificial Sequenceprobe sequence for miR-143 5gatatatttt
agagctacag tgcttcatct cat 33635DNAArtificial Sequenceprobe sequence
for miR-145 6gatatatttt aagggattcc tgggaaaact ggact
35734DNAArtificial Sequenceprobe sequence for miR-146a 7gatatatttt
aaacccatgg aattcagttc tcat 34834DNAArtificial Sequenceprobe
sequence for miR-210 8gatatatttt atcagccgct gtcacacgca cagt
34935DNAArtificial Sequenceprobe sequence for miR-221 9gatatatttt
agaaacccag cagacaatgt agctt 351033DNAArtificial Sequenceprobe
sequence for miR-222 10gatatatttt aacccagtag ccagatgtag ctt
331133DNAArtificial Sequenceprobe sequence for miSpike 11gatatatttt
aagaccgctc cgccatcctg agt 331254DNAArtificial Sequenceprobe
sequence for RNU6B 12gatatatttt aaaaaatatg gaacgcttca cgaatttgcg
tgtcatcctt gcgt 541334DNAArtificial Sequencelet-7a probe
13gatatatttt aaactataca acctactacc tcat 341422RNAArtificial
Sequencelet-7a target 14ugagguagua gguuguauag uu
221510DNAArtificial SequenceUA10-Cy3 15taaaatatat
101610DNAArtificial SequenceUA10-bio 16taaaatatat
101713DNAArtificial SequenceUA10-bio 17taaaatatat aaa
131816DNAArtificial SequenceUA10-bio 18taaaatatat aaaaaa
161922DNAArtificial SequenceUA10-bio 19taaaatatat aaaaaaaaaa aa
222021RNAArtificial SequenceSequences for mature miR-143
20ugagaugaag cacuguagcu c 212155RNAArtificial SequenceSequences for
precursor miR-143 21ggugcagugc ugcaucucug gucaguuggg agucugagau
gaagcacugu agcuc 552232DNAArtificial Sequenceprobe for labeling the
3' end of mature miR-143 22gatatatttt agagctacag tgcttcatct ca
322331DNAArtificial Sequenceprobe for labeling the 5' end of mature
miR-143 23gagctacagt gcttcatctc aatttatatt t 312422DNAArtificial
Sequenceadapter sequence for 3' labeling 24taaaatatat aaaaaaaaaa aa
222515RNAArtificial Sequenceadapter sequence for 5' labeling
25aaaaaaaaau auaau 152620DNAArtificial Sequencestem-loop encoding
probe 26aataaacacg ggaataaccc 202710DNAArtificial Sequenceprobe
anchor 27gatatatttt 102810DNAArtificial
Sequencefluorescently-labeled encoding adapter 28gtgtttataa
102911DNAArtificial Sequenceunlabeled adapter 29gtgtttataa t
113020DNAArtificial SequenceUCode1 probe 30aataaacacg ggaataaccc
203120DNAArtificial SequenceUCode2 probe 31aataatgtgc ccaataaggg
203210DNAArtificial SequenceUCode 1 adapter Cy3 32gtgtttatta
103311DNAArtificial SequenceUCode 1 adapter invdT 33gtgtttatta t
113410DNAArtificial SequenceUCode 2 adapter Cy3 34cacattatta
103511DNAArtificial SequenceUCode 2 adapter invdT 35cacattatta t
113620DNAArtificial SequenceUC1 36aataaacacg ggaataaccc
203720DNAArtificial SequenceUS2 37aataatgtgc ccaataaggg
203820DNAArtificial SequenceUC3 38aataactctg ggaataaccc
203910DNAArtificial SequenceUC1-A-Cy3 39gtgtttatta
104010DNAArtificial SequenceUC1-A-NF 40gtgtttatta
104110DNAArtificial SequenceUC1-A-FAM6 41gtgtttatta
104210DNAArtificial SequenceUC2-Cy5 42cacattatta
104310DNAArtificial SequenceUC3-A-Cy3 43agagttatta
104410DNAArtificial SequenceUC3-A-NF 44agagttatta
104510DNAArtificial SequenceUC3-A-FAM6 45agagttatta 10
* * * * *
References