U.S. patent application number 13/555589 was filed with the patent office on 2012-12-06 for compositions and methods for sirna inhibition of hif-1 alpha.
This patent application is currently assigned to THE TRUSTEES OF THE UNIVERSITY OF PENNSYLVANIA. Invention is credited to Samuel Jotham Reich, Enrico Maria Surace, Michael J. Tolentino.
Application Number | 20120308645 13/555589 |
Document ID | / |
Family ID | 32312630 |
Filed Date | 2012-12-06 |
United States Patent
Application |
20120308645 |
Kind Code |
A1 |
Reich; Samuel Jotham ; et
al. |
December 6, 2012 |
COMPOSITIONS AND METHODS FOR SIRNA INHIBITION OF HIF-1 ALPHA
Abstract
RNA interference using small interfering RNAs which target HIF-1
alpha mRNA inhibit expression of the HIF-1 alpha gene. As HIF-1
alpha is a transcriptional regulator of VEGF, expression of VEGF is
also inhibited. Control of VEGF production through siRNA-mediated
down-regulation of HIF-1 alpha can be used to inhibit angiogenesis,
in particularly in diseases such as diabetic retinopathy, age
related macular degeneration and many types of cancer.
Inventors: |
Reich; Samuel Jotham; (Miami
Beach, FL) ; Surace; Enrico Maria; (Milan, IT)
; Tolentino; Michael J.; (Lakeland, FL) |
Assignee: |
THE TRUSTEES OF THE UNIVERSITY OF
PENNSYLVANIA
Philadelphia
PA
|
Family ID: |
32312630 |
Appl. No.: |
13/555589 |
Filed: |
July 23, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12630077 |
Dec 3, 2009 |
8236775 |
|
|
13555589 |
|
|
|
|
12359505 |
Jan 26, 2009 |
7645744 |
|
|
12630077 |
|
|
|
|
10699557 |
Oct 31, 2003 |
7521431 |
|
|
12359505 |
|
|
|
|
60423262 |
Nov 1, 2002 |
|
|
|
Current U.S.
Class: |
424/450 ;
424/649; 435/320.1; 435/325; 514/34; 514/44A; 536/24.5 |
Current CPC
Class: |
A61P 3/10 20180101; A61P
29/00 20180101; C12N 2310/318 20130101; C12N 2310/53 20130101; A61P
27/02 20180101; C12N 15/113 20130101; C12N 2310/14 20130101; A61K
38/00 20130101; A61P 15/00 20180101; A61P 17/06 20180101; A61P
35/02 20180101; A61P 9/10 20180101; A61P 35/04 20180101; A61P 9/00
20180101; A61P 27/00 20180101; C12N 2310/111 20130101; A61P 35/00
20180101; A61P 19/02 20180101 |
Class at
Publication: |
424/450 ;
536/24.5; 435/325; 435/320.1; 514/44.A; 424/649; 514/34 |
International
Class: |
A61K 31/713 20060101
A61K031/713; C12N 5/10 20060101 C12N005/10; C12N 15/63 20060101
C12N015/63; A61P 17/06 20060101 A61P017/06; A61K 33/24 20060101
A61K033/24; A61P 35/00 20060101 A61P035/00; A61P 27/02 20060101
A61P027/02; A61P 29/00 20060101 A61P029/00; C12N 15/113 20100101
C12N015/113; A61K 9/127 20060101 A61K009/127 |
Claims
1. An isolated siRNA comprising a sense RNA strand and an antisense
RNA strand, wherein the sense and an antisense RNA strands form an
RNA duplex, and wherein the sense RNA strand comprises a nucleotide
sequence substantially identical to a target sequence of about 19
to about 25 contiguous nucleotides in human HIF-1 alpha mRNA, or an
alternative splice form, mutant or cognate thereof.
2. The siRNA of claim 1, wherein the human HIF-1 alpha mRNA is SEQ
ID NO: 1.
3. The siRNA of claim 1, wherein the cognate of the human HIF-1
alpha mRNA sequence is rat HIF-1 alpha mRNA or mouse HIF-1 alpha
mRNA.
4. The siRNA of claim 1, wherein the sense RNA strand comprises one
RNA molecule, and the antisense RNA strand comprises one RNA
molecule.
5. The siRNA of claim 1, wherein the sense and antisense RNA
strands forming the RNA duplex are covalently linked by a
single-stranded hairpin.
6. The siRNA of claim 1, wherein the siRNA further comprises
non-nucleotide material.
7. The siRNA of claim 1, wherein the siRNA further comprises an
addition, deletion, substitution or alteration of one or more
nucleotides.
8. The siRNA of claim 1, wherein the sense and antisense RNA
strands are stabilized against nuclease degradation.
9. The siRNA of claim 1, further comprising a 3' overhang.
10. The siRNA of claim 9, wherein the 3' overhang comprises from 1
to about 6 nucleotides.
11. The siRNA of claim 9, wherein the 3' overhang comprises about 2
nucleotides.
12. The siRNA of claim 5, wherein the sense RNA strand comprises a
first 3' overhang, and the antisense RNA strand comprises a second
3' overhang.
13. The siRNA of claim 12, wherein the first and second 3'
overhangs separately comprise from 1 to about 6 nucleotides.
14. The siRNA of claim 13, wherein the first 3' overhang comprises
a dinucleotide and the second 3' overhang comprises a
dinucleotide.
15. The siRNA of claim 14, where the dinucleotide comprising the
first and second 3' overhangs is dithymidylic acid (TT) or
diuridylic acid (uu).
16. The siRNA of claim 9, wherein the 3' overhang is stabilized
against nuclease degradation.
17. A retinal pigment epithelial cell comprising the siRNA of claim
1.
18. A recombinant plasmid comprising nucleic acid sequences for
expressing an siRNA comprising a sense RNA strand and an antisense
RNA strand, wherein the sense and an antisense RNA strands form an
RNA duplex, and wherein the sense RNA strand comprises a nucleotide
sequence substantially identical to a target sequence of about 19
to about 25 contiguous nucleotides in human HIF-1 alpha mRNA, or an
alternative splice form, mutant or cognate thereof.
19. The recombinant plasmid of claim 18, wherein the nucleic acid
sequences for expressing the siRNA comprise an inducible or
regulatable promoter.
20. The recombinant plasmid of claim 18, wherein the nucleic acid
sequences for expressing the siRNA comprise a sense RNA strand
coding sequence in operable connection with a polyT termination
sequence under the control of a human U6 RNA promoter, and an
antisense RNA strand coding sequence in operable connection with a
polyT termination sequence under the control of a human U6 RNA
promoter.
21. The recombinant plasmid of claim 20, wherein the plasmid is
pAAVsiRNA.
22. A recombinant viral vector comprising nucleic acid sequences
for expressing an siRNA comprising a sense RNA strand and an
antisense RNA strand, wherein the sense and an antisense RNA
strands form an RNA duplex, and wherein the sense RNA strand
comprises a nucleotide sequence substantially identical to a target
sequence of about 19 to about 25 contiguous nucleotides in human
HIF-1 alpha mRNA, or an alternative splice form, mutant or cognate
thereof.
23. The recombinant viral vector of claim 22, wherein the nucleic
acid sequences for expressing the siRNA comprise an inducible or
regulatable promoter.
24. The recombinant viral vector of claim 22, wherein the nucleic
acid sequences for expressing the siRNA comprise a sense RNA strand
coding sequence in operable connection with a polyT termination
sequence under the control of a human U6 RNA promoter, and an
antisense RNA strand coding sequence in operable connection with a
polyT termination sequence under the control of a human U6 RNA
promoter.
25. The recombinant viral vector of claim 22, wherein the
recombinant viral vector is selected from the group consisting of
an adenoviral vector, an adeno-associated viral vector, a
lentiviral vector, a retroviral vector, and a herpes virus
vector.
26. The recombinant viral vector of claim 22, wherein the
recombinant viral vector is pseudotyped with surface proteins from
vesicular stomatitis virus, rabies virus, Ebola virus, or Mokola
virus.
27. The recombinant viral vector of claim 25, wherein the
recombinant viral vector comprises an adeno-associated viral
vector.
28. A pharmaceutical composition comprising an siRNA and a
pharmaceutically acceptable carrier, wherein the siRNA comprises a
sense RNA strand and an antisense RNA strand, wherein the sense and
an antisense RNA strands form an RNA duplex, and wherein the sense
RNA strand comprises a nucleotide sequence substantially identical
to a target sequence of about 19 to about 25 contiguous nucleotides
in human HIF-1 alpha mRNA, or an alternative splice form, mutant or
cognate thereof.
29. The pharmaceutical composition of claim 28, further comprising
lipofectin, lipofectamine, cellfectin, polycations, or
liposomes.
30. A pharmaceutical composition comprising the plasmid of claim
18, or a physiologically acceptable salt thereof, and a
pharmaceutically acceptable carrier.
31. The pharmaceutical composition of claim 30, further comprising
lipofectin, lipofectamine, cellfectin, polycations, or
liposomes.
32. A pharmaceutical composition comprising the viral vector of
claim 22 and a pharmaceutically acceptable carrier.
33. A method of inhibiting expression of human HIF-1 alpha mRNA, or
an alternative splice form, mutant or cognate thereof, comprising
administering to a subject an effective amount of an siRNA
comprising a sense RNA strand and an antisense RNA strand, wherein
the sense and an antisense RNA strands form an RNA duplex, and
wherein the sense RNA strand comprises a nucleotide sequence
substantially identical to a target sequence of about 19 to about
25 contiguous nucleotides in human HIF-1 alpha mRNA, or an
alternative splice form, mutant or cognate thereof, such that human
HIF-1 alpha mRNA, or an alternative splice form, mutant or cognate
thereof, is degraded.
34. The method of claim 33, wherein the subject is a human
being.
35. The method of claim 33, wherein expression of human HIF-1 alpha
mRNA, or an alternative splice form, mutant or cognate thereof is
inhibited in one or both eyes of the subject.
36. The method of claim 33, wherein expression of human HIF-1 alpha
mRNA, or an alternative splice form, mutant or cognate thereof is
inhibited in retinal pigment epithelial cells of the subject.
37. The method of claim 33, wherein the effective amount of the
siRNA is an amount which provides an intercellular concentration at
or near the neovascularization site of from about 1 nM to about 100
nM.
38. The method of claim 33, wherein the siRNA is administered in
conjunction with a delivery reagent.
39. The method of claim 38, wherein the delivery agent is selected
from the group consisting of lipofectin, lipofectamine, cellfectin,
polycations, and liposomes.
40. The method of claim 39, wherein the delivery agent is a
liposome.
41. The method claim 40, wherein the liposome comprises a ligand
which targets the liposome to cells at or near the site of
angiogenesis.
42. The method of claim 41, wherein the ligand binds to receptors
on tumor cells or vascular endothelial cells.
43. The method of claim 42, wherein the ligand comprises a
monoclonal antibody.
44. The method of claim 40, wherein the liposome is modified with
an opsonization-inhibition moiety.
45. The method of claim 44, wherein the opsonization-inhibiting
moiety comprises a PEG, PPG, or derivatives thereof.
46. The method of claim 33, wherein the siRNA is expressed from a
recombinant plasmid.
47. The method of claim 33, wherein the siRNA is expressed from a
recombinant viral vector.
48. The method of claim 47, wherein the recombinant viral vector
comprises an adenoviral vector, an adeno-associated viral vector, a
lentiviral vector, a retroviral vector, or a herpes virus
vector.
49. The method of claim 48, wherein the recombinant viral vector is
pseudotyped with surface proteins from vesicular stomatitis virus,
rabies virus, Ebola virus, or Mokola virus.
50. The method of claim 47, wherein the recombinant viral vector
comprises an adeno-associated viral vector.
51. The method of claim 33, wherein the siRNA is administered by an
enteral administration route.
52. The method of claim 51, wherein the enteral administration
route is selected from the group consisting of oral, rectal, and
intranasal.
53. The method of claim 33, wherein the siRNA is administered by a
parenteral administration route.
54. The method of claim 53, wherein the parenteral administration
route is selected from the group consisting of intravascular
administration, peri- and intra-tissue administration, subcutaneous
injection or deposition, subcutaneous infusion, intraocular
administration, and direct application at or near the site of
neovascularization.
55. The method of claim 54, wherein the intravascular
administration is selected from the group consisting of intravenous
bolus injection, intravenous infusion, intra-arterial bolus
injection, intra-arterial infusion and catheter instillation into
the vasculature.
56. The method of claim 54, wherein the peri- and intra-tissue
injection comprises peri-tumoral injection or intra-tumoral
injection.
57. The method of claim 54, wherein the intraocular administration
comprises intravitreal, intraretinal, subretinal, subtenon, peri-
and retro-orbital, trans-corneal or trans-scleral
administration.
58. The method of claim 54, wherein the direct application at or
near the site of neovascularization comprises application by
catheter, corneal pellet, eye dropper, suppository, an implant
comprising a porous material, an implant comprising a non-porous
material, or an implant comprising a gelatinous material.
59. The method of claim 54, wherein the site of neovascularization
is in the eye, and the direct application at or near the site of
neovascularization comprises application by an ocular implant.
60. The method of claim 59, wherein the ocular implant is
biodegradable.
61. A method of inhibiting angiogenesis in a subject, comprising
administering to a subject an effective amount of an siRNA
comprising a sense RNA strand and an antisense RNA strand, wherein
the sense and an antisense RNA strands form an RNA duplex, and
wherein the sense RNA strand comprises a nucleotide sequence
substantially identical to a target sequence of about 19 to about
25 contiguous nucleotides in human HIF-1 alpha mRNA, or an
alternative splice form, mutant or cognate thereof.
62. The method of claim 61, wherein the angiogenesis is
pathogenic.
63. The method of claim 61, wherein the angiogenesis is
non-pathogenic.
64. The method of claim 63, wherein the non-pathogenic angiogenesis
is associated with production of fatty tissues or cholesterol
production.
65. The method of claim 63, wherein the non-pathogenic angiogenesis
comprises endometrial neovascularization.
66. The method of claim 61, wherein the angiogenesis is inhibited
in one or both eyes of the subject.
67. A method of treating an angiogenic disease in a subject,
comprising administering to a subject an effective amount of an
siRNA comprising a sense RNA strand and an antisense RNA strand,
wherein the sense and an antisense RNA strands form an RNA duplex,
and wherein the sense RNA strand comprises a nucleotide sequence
substantially identical to a target sequence of about 19 to about
25 contiguous nucleotides in human HIF-1 alpha mRNA, or an
alternative splice form, mutant or cognate thereof, such that
angiogenesis associated with the angiogenic disease is
inhibited.
68. The method of claim 67, wherein the angiogenic disease
comprises a tumor associated with a cancer.
69. The method of claim 68, wherein the cancer is selected from the
group consisting of breast cancer, lung cancer, head and neck
cancer, brain cancer, abdominal cancer, colon cancer, colorectal
cancer, esophagus cancer, gastrointestinal cancer, glioma, liver
cancer, tongue cancer, neuroblastoma, osteosarcoma, ovarian cancer,
pancreatic cancer, prostate cancer, retinoblastoma, Wilm's tumor,
multiple myeloma, skin cancer, lymphoma, and blood cancer.
70. The method of claim 67, wherein the angiogenic disease is
selected from the group consisting of diabetic retinopathy,
age-related macular degeneration, and inflammatory diseases.
71. The method of claim 70, wherein the inflammatory disease is
psoriasis or rheumatoid arthritis.
72. The method of claim 70, wherein the angiogenic disease is
age-related macular degeneration.
73. The method of claim 67, wherein the siRNA is administered in
combination with a pharmaceutical agent for treating the angiogenic
disease, which pharmaceutical agent is different from the
siRNA.
74. The method of claim 73, wherein the angiogenic disease is
cancer, and the pharmaceutical agent comprises a chemotherapeutic
agent.
75. The method of claim 73, wherein the chemotherapeutic agent is
selected from the group consisting of cisplatin, carboplatin,
cyclophosphamide, 5-fluorouracil, adriamycin, daunorubicin, and
tamoxifen.
76. The method of claim 67, wherein the siRNA is administered to a
subject in combination with another therapeutic method designed to
treat the angiogenic disease.
77. The method of claim 76, wherein the angiogenic disease is
cancer, and the siRNA is administered in combination with radiation
therapy, chemotherapy or surgery.
Description
CROSS REFERENCE TO RELATED APPLICATION
[0001] This application claims the benefit of U.S. provisional
patent application Ser. No. 60/423,262, filed on Nov. 1, 2002.
FIELD OF THE INVENTION
[0002] This invention relates to the regulation of gene expression
by siRNA-induced degradation of the transcriptional regulator HIF-1
alpha. In particular, genes in the VEGF mitogenic pathway can be
down-regulated.
BACKGROUND OF THE INVENTION
[0003] Angiogenesis, defined as the growth of new capillary blood
vessels, plays a fundamental role in growth and development. In
mature humans, the ability to initiate an angiogenic response is
present in all tissues, but is held under strict control. A key
regulator of angiogenesis is vascular endothelial growth factor
("VEGF"), also called vascular permeability factor ("VPF").
[0004] VEGF is expressed in abnormally high levels in certain
tissues from diseases characterized by aberrant angiogenesis, such
as cancers, diabetic retinopathy, psoriasis, age-related macular
degeneration, rheumatoid arthritis and other inflammatory diseases.
Therefore, agents which selectively decrease the VEGF levels in
these tissues can be used to treat cancer and other angiogenic
diseases.
[0005] Hypoxia-inducible factor 1 (HIF-1) is a heterodimeric
basic-helix-loop-helix-PAS transcription factor consisting of HIF-1
alpha and HIF-1 beta subunits.
[0006] MT-1 alpha expression and HIF-1 transcriptional activity
increase exponentially as cellular oxygen concentration is
decreased. Several dozen target genes that are transactivated by
HIF-1 have been identified, including those encoding
erythropoietin, glucose transporters, glycolytic enzymes, and VEGF.
Semenza G L (1999), Ann. Rev. Cell. Dev. Biol. 15: 551-578.
[0007] Loss of p53 in tumor cells enhances HIF-1 alpha levels and
augments HIF-1-dependent transcriptional activation of VEGF in
response to hypoxia. Forced expression of HIF-1 alpha in
p53-expressing tumor cells increases hypoxia-induced VEGF
expression and augments neovascularization and growth of tumor
xenografts. These results indicate that amplification of normal
HIF-1-dependent responses to hypoxia via loss of p53 function
contributes to the angiogenic switch during tumorigenesis. Ravi R.
et al. (2000), Genes Dev. 14: 34-44.
[0008] RNA interference ("RNAi") is a method of
post-transcriptional gene regulation that is conserved throughout
many eukaryotic organisms. RNAi is induced by short (i.e., <30
nucleotide) double stranded RNA ("dsRNA") molecules which are
present in the cell (Fire A et al. (1998), Nature 391: 806-811).
These short dsRNA molecules, called "short interfering RNA" or
"siRNA," cause the destruction of messenger RNAs ("mRNAs") which
share sequence homology with the siRNA to within one nucleotide
resolution (Elbashir S M et al. (2001), Genes Dev, 15: 188-200). It
is believed that the siRNA and the targeted mRNA bind to an
RNA-induced silencing complex ("RISC"), which cleaves the targeted
mRNA. The siRNA is apparently recycled much like a
multiple-turnover enzyme, with 1 siRNA molecule capable of inducing
cleavage of approximately 1000 mRNA molecules. siRNA-mediated RNAi
is therefore more effective than other currently available
technologies for inhibiting expression of a target gene.
[0009] Elbashir S M et al. (2001), supra, has shown that synthetic
siRNA of 21 and 22 nucleotides in length, and which have short 3'
overhangs, can induce RNAi of target mRNA in a Drosophila cell
lysate. Cultured mammalian cells also exhibit RNAi with synthetic
siRNA (Elbashir S M et al. (2001) Nature, 411: 494-498), and RNAi
induced by synthetic siRNA has recently been shown in living mice
(McCaffrey A P et al. (2002), Nature, 418: 38-39; Xia H et al.
(2002), Nat. Biotech. 20: 1006-1010). The therapeutic potential of
siRNA-mediated RNAi has been demonstrated by several recent in
vitro studies, including the siRNA-directed inhibition of HIV-1
infection (Novina C D et al. (2002), Nat. Med. 8: 681-686) and
reduction of neurotoxic polyglutamine disease protein expression
(Xia H et al. (2002), supra). Therapeutic RNAi has also been
demonstrated in human cancer cells by Alan Gewirtz, as described in
published U.S. patent application US 2002/0173478.
[0010] It has now been found that siRNA-induced RNAi of HIF-1 alpha
results in the destruction of HIF-1 alpha mRNA, with a concomitant
reduction in VEGF expression and inhibition of angiogenesis.
SUMMARY OF THE INVENTION
[0011] The present invention is directed to siRNAs which
specifically target and cause RNAi-induced degradation of mRNA from
the human HIF-1 alpha gene. The siRNA compounds and compositions of
the invention are used to treat cancerous tumors and other
angiogenic diseases and non-pathogenic conditions in which VEGF is
overexpressed in tissues in or near the area of
neovascularization.
[0012] Thus, the invention provides siRNA, and pharmaceutical
compositions thereof, which target HIF-1 alpha mRNA and induce
RNAi-mediated degradation of the targeted mRNA.
[0013] The invention further provides a method of inhibiting
expression of HIF-1 alpha, comprising administering to a subject an
effective amount of an siRNA targeted to HIF-1 alpha mRNA, such
that the HIF-1 alpha mRNA is degraded.
[0014] The invention further provides a method of inhibiting
angiogenesis, comprising administering an effective amount of an
siRNA targeted to HIF-1 alpha mRNA to a subject, such that the
HIF-1 alpha mRNA is degraded and the expression of VEGF is
inhibited.
[0015] The invention further provides a method of treating an
angiogenic disease, comprising administering an effective amount of
an siRNA targeted to HIF-1 alpha mRNA to a subject, such that the
HIF-1 alpha mRNA is degraded and the expression of VEGF is
inhibited.
BRIEF DESCRIPTION OF THE DRAWINGS
[0016] FIG. 1 is a histogram of VEGF concentration, as measured by
VEGF ELISA at OD.sub.450 nanometers, in non-hypoxic ("-") cultured
HEK-293 cells treated with no siRNA ("no"), and in hypoxic ("+")
cultured HEK-293 cells treated with: no siRNA ("no"); nonspecific
siRNA ("EGFP"); or with twenty separate siRNAs targeting human
HIF-1 alpha mRNA ("hHIF1#1-20").
[0017] FIG. 2 is a histogram showing cytotoxicity in non-hypoxic
("-") cultured HEK-293 cells treated with no siRNA ("no"), and in
hypoxic ("+") cultured HEK-293 cells treated with: no siRNA ("no");
nonspecific siRNA ("EGFP"); or with twenty separate siRNAs
targeting human HIF-1 alpha mRNA ("hHIF1#1-20").
[0018] FIG. 3 is a histogram showing the area of choroidal
neovascularization in mm.sup.2, in eyes from control mice
("control") and mice treated with anti-HIF-1 alpha siRNA ("HIF-1
siRNA").
DETAILED DESCRIPTION OF THE INVENTION
[0019] Compositions and methods comprising siRNA targeted to HIF-1
alpha mRNA are advantageously used to inhibit angiogenesis, in
particular for the treatment of angiogenic diseases. The siRNA of
the invention causes RNAi-mediated destruction of the HIF-1 alpha
mRNA. HIF-1 alpha is a transcriptional regulator of VEGF, and the
reduction in HIF-1 alpha mRNA caused by the siRNA of the invention
is correlated with a reduction in VEGF production. Because VEGF is
required for initiating and maintaining angiogenesis, the
siRNA-mediated destruction of HIF-1 alpha slows, stops or reverses
the angiogenic process.
[0020] As used herein, siRNA which is "targeted to the HIF-1 alpha
mRNA" means siRNA in which a first strand of the duplex has the
same nucleotide sequence as a portion of the HIF-1 mRNA sequence.
It is understood that the second strand of the siRNA duplex is
complementary to both the first strand of the siRNA duplex and to
the same portion of the HIF-1 alpha mRNA.
[0021] The invention therefore provides isolated siRNA comprising
short double-stranded RNA from about 17 nucleotides to about 29
nucleotides in length, preferably from about 19 to about 25
nucleotides in length, that are targeted to the target mRNA. The
siRNA comprise a sense RNA strand and a complementary antisense RNA
strand annealed together by standard Watson-Crick base-pairing
interactions (hereinafter "base-paired"). As is described in more
detail below, the sense strand comprises a nucleic acid sequence
which is substantially identical to a target sequence contained
within the target mRNA.
[0022] As used herein, a nucleic acid sequence "substantially
identical" to a target sequence contained within the target mRNA is
a nucleic acid sequence which is identical to the target sequence,
or which differs from the target sequence by one or more
nucleotides. Sense strands of the invention which comprise nucleic
acid sequences substantially identical to a target sequence are
characterized in that siRNA comprising such sense strands induce
RNAi-mediated degradation of mRNA containing the target sequence.
For example, an siRNA of the invention can comprise a sense strand
comprise nucleic acid sequences which differ from a target sequence
by one, two or three or more nucleotides, as long as RNAi-mediated
degradation of the target mRNA is induced by the siRNA.
[0023] The sense and antisense strands of the present siRNA can
comprise two complementary, single-stranded RNA molecules or can
comprise a single molecule in which two complementary portions are
base-paired and are covalently linked by a single-stranded
"hairpin" area. Without wishing to be bound by any theory, it is
believed that the hairpin area of the latter type of siRNA molecule
is cleaved intracellularly by the "Dicer" protein (or its
equivalent) to form an siRNA of two individual base-paired RNA
molecules (see Tuschl, T. (2002), supra). As described below, the
siRNA can also contain alterations, substitutions or modifications
of one or more ribonucleotide bases. For example, the present siRNA
can be altered, substituted or modified to contain one or more
deoxyribonucleotide bases.
[0024] As used herein, "isolated" means synthetic, or altered or
removed from the natural state through human intervention. For
example, an siRNA naturally present in a living animal is not
"isolated," but a synthetic siRNA, or an siRNA partially or
completely separated from the coexisting materials of its natural
state is "isolated." An isolated siRNA can exist in substantially
purified form, or can exist in a non-native environment such as,
for example, a cell into which the siRNA has been delivered.
[0025] As used herein, "target mRNA" means human HIF-1 alpha mRNA,
mutant or alternative splice forms of human HIF-1 alpha mRNA, or
mRNA from cognate HIF-1 alpha genes. A cDNA sequence corresponding
to a human HIF-1 alpha mRNA sequence is given in SEQ ID NO: 1.
[0026] Splice variants of human HIF-1 alpha are known, including
HIF-1 alpha transcript variants 1 (SEQ ID NO: 2) and 2 (SEQ ID NO:
3), as described in GenBank record accession nos. NM.sub.--001530
and NM.sub.--181054, the entire disclosures of which are herein
incorporated by reference. The mRNA transcribed from the human
HIF-1 alpha gene can be analyzed for further alternative splice
forms using techniques well-known in the art. Such techniques
include reverse transcription-polymerase chain reaction (RT-PCR),
northern blotting and in-situ hybridization. Techniques for
analyzing mRNA sequences are described, for example, in Busting S A
(2000), J. Mol. Endocrinol. 25: 169-193, the entire disclosure of
which is herein incorporated by reference. Representative
techniques for identifying alternatively spliced mRNAs are also
described below.
[0027] For example, databases that contain nucleotide sequences
related to a given disease gene can be used to identify
alternatively spliced mRNA. Such databases include GenBank, Embase,
and the Cancer Genome Anatomy Project (CGAP) database. The CGAP
database, for example, contains expressed sequence tags (ESTs) from
various types of human cancers. An mRNA or gene sequence from the
HIF-1 alpha gene can be used to query such a database to determine
whether ESTs representing alternatively spliced mRNAs have been
found for a these genes.
[0028] A technique called "RNAse protection" can also be used to
identify alternatively spliced HIF-1 alpha mRNA. RNAse protection
involves translation of a gene sequence into synthetic RNA, which
is hybridized to RNA derived from other cells; for example, cells
from tissue at or near the site of neovascularization. The
hybridized RNA is then incubated with enzymes that recognize
RNA:RNA hybrid mismatches. Smaller than expected fragments indicate
the presence of alternatively spliced mRNAs. The putative
alternatively spliced mRNAs can be cloned and sequenced by methods
well known to those skilled in the art.
[0029] RT-PCR can also be used to identify alternatively spliced
HIF-1 alpha mRNA. In RT-PCR, mRNA from a tissue is converted into
cDNA by the enzyme reverse transcriptase, using methods well-known
to those of ordinary skill in the art. The entire coding sequence
of the cDNA is then amplified via PCR using a forward primer
located in the 3' untranslated region, and a reverse primer located
in the 5' untranslated region. The amplified products can be
analyzed for alternative splice forms, for example by comparing the
size of the amplified products with the size of the expected
product from normally spliced mRNA, e.g., by agarose gel
electrophoresis. Any change in the size of the amplified product
can indicate alternative splicing.
[0030] The mRNA produced from a mutant HIF-1 alpha gene can also be
readily identified through the techniques described above for
identifying alternative splice forms. As used herein, "mutant"
HIF-1 alpha gene or mRNA includes a HIF-1 alpha gene or mRNA which
differs in sequence from the HIF-1 alpha mRNA sequences set forth
herein. Thus, allelic forms of HIF-1 alpha genes, and the mRNA
produced from them, are considered "mutants" for purposes of this
invention.
[0031] As used herein, a gene or mRNA which is "cognate" to human
HIF-1 alpha is a gene or mRNA from another mammalian species which
is homologous to human HIF-1 alpha. For example, the cognate HIF-1
alpha mRNA from the rat and mouse are described in GenBank record
accession nos. NM.sub.--024359 and NM.sub.--010431, respectively,
the entire disclosure of which is herein incorporated by reference.
The rat HIF-1 alpha mRNA sequence is given in SEQ ID NO: 4, and the
mouse HIF-1 alpha mRNA sequence is given in SEQ ID NO: 5.
[0032] It is understood that human HIF-1 alpha mRNA may contain
target sequences in common with their respective alternative splice
forms, cognates or mutants. A single siRNA comprising such a common
targeting sequence can therefore induce RNAi-mediated degradation
of different RNA types which contain the common targeting
sequence.
[0033] The siRNA of the invention can comprise partially purified
RNA, substantially pure RNA, synthetic RNA, or recombinantly
produced RNA, as well as altered RNA that differs from
naturally-occurring RNA by the addition, deletion, substitution
and/or alteration of one or more nucleotides. Such alterations can
include addition of non-nucleotide material, such as to the end(s)
of the siRNA or to one or more internal nucleotides of the siRNA,
or modifications that make the siRNA resistant to nuclease
digestion, or the substitution of one or more nucleotides in the
siRNA with deoxyribonucleotides.
[0034] One or both strands of the siRNA of the invention can also
comprise a 3' overhang. As used herein, a "3' overhang" refers to
at least one unpaired nucleotide extending from the 3'-end of a
duplexed RNA strand.
[0035] Thus in one embodiment, the siRNA of the invention comprises
at least one 3' overhang of from 1 to about 6 nucleotides (which
includes ribonucleotides or deoxyribonucleotides) in length,
preferably from 1 to about 5 nucleotides in length, more preferably
from 1 to about 4 nucleotides in length, and particularly
preferably from about 2 to about 4 nucleotides in length.
[0036] In the embodiment in which both strands of the siRNA
molecule comprise a 3' overhang, the length of the overhangs can be
the same or different for each strand. In a most preferred
embodiment, the 3' overhang is present on both strands of the
siRNA, and is 2 nucleotides in length. For example, each strand of
the siRNA of the invention can comprise 3' overhangs of
dithymidylic acid ("TT") or diuridylic acid ("uu").
[0037] In order to enhance the stability of the present siRNA, the
3' overhangs can be also stabilized against degradation. In one
embodiment, the overhangs are stabilized by including purine
nucleotides, such as adenosine or guanosine nucleotides.
Alternatively, substitution of pyrimidine nucleotides by modified
analogues, e.g., substitution of uridine nucleotides in the 3'
overhangs with 2'-deoxythymidine, is tolerated and does not affect
the efficiency of RNAi degradation. In particular, the absence of a
2' hydroxyl in the 2'-deoxythymidine significantly enhances the
nuclease resistance of the 3' overhang in tissue culture
medium.
[0038] In certain embodiments, the siRNA of the invention comprises
the sequence AA(N19)TT or NA(N21), where N is any nucleotide. These
siRNA comprise approximately 30-70% G/C, and preferably comprise
approximately 50% G/C. The sequence of the sense siRNA strand
corresponds to (N19)TT or N21 (i.e., positions 3 to 23),
respectively. In the latter case, the 3' end of the sense siRNA is
converted to TT. The rationale for this sequence conversion is to
generate a symmetric duplex with respect to the sequence
composition of the sense and antisense strand 3' overhangs. The
antisense strand is then synthesized as the complement to positions
1 to 21 of the sense strand.
[0039] Because position 1 of the 23-nt sense strand in these
embodiments is not recognized in a sequence-specific manner by the
antisense strand, the 3'-most nucleotide residue of the antisense
strand can be chosen deliberately. However, the penultimate
nucleotide of the antisense strand (complementary to position 2 of
the 23-nt sense strand in either embodiment) is generally
complementary to the targeted sequence.
[0040] In another embodiment, the siRNA of the invention comprises
the sequence NAR(N17)YNN, where R is a purine (e.g., A or G) and Y
is a pyrimidine (e.g., C or U/T). The respective 21-nt sense and
antisense strands of this embodiment therefore generally begin with
a purine nucleotide. Such siRNA can be expressed from pol III
expression vectors without a change in targeting site, as
expression of RNAs from pol III promoters is only believed to be
efficient when the first transcribed nucleotide is a purine.
[0041] The siRNA of the invention can be targeted to any stretch of
approximately 19-25 contiguous nucleotides in any of the target
mRNA sequences (the "target sequence"). Techniques for selecting
target sequences for siRNA are given, for example, in Tuschl T et
al., "The siRNA User Guide," revised Oct. 11, 2002, the entire
disclosure of which is herein incorporated by reference. "The siRNA
User Guide" is available on the world wide web at a website
maintained by Dr. Thomas Tuschl, Department of Cellular
Biochemistry, AG 105, Max-Planck-Institute for Biophysical
Chemistry, 37077 Gottingen, Germany, and can be found by accessing
the website of the Max Planck Institute and searching with the
keyword "siRNA." Thus, the sense strand of the present siRNA
comprises a nucleotide sequence identical to any contiguous stretch
of about 19 to about 25 nucleotides in the target mRNA.
[0042] Generally, a target sequence on the target mRNA can be
selected from a given cDNA sequence corresponding to the target
mRNA, preferably beginning 50 to 100 nt downstream (i.e., in the 3'
direction) from the start codon. The target sequence can, however,
be located in the 5' or 3' untranslated regions, or in the region
nearby the start codon. A suitable target sequence in the HIF-1
alpha cDNA sequence is:
TABLE-US-00001 SEQ ID NO: 6 AACTGGACACAGTGTGTTTGA
[0043] Thus, an siRNA of the invention targeting this sequence, and
which has 3' UU overhangs (overhangs shown in bold) is:
TABLE-US-00002 SEQ ID NO: 7 5'-aacuaacuggacacagugugu uu-3' SEQ ID
NO: 8 3'-uu uugauugaccugugucacaca-5'
[0044] An siRNA of the invention targeting this same sequence, but
having 3' TT overhangs on each strand (overhangs shown in bold)
is:
TABLE-US-00003 (SEQ ID NO: 9) 5'-aacuaacuggacacaguguguTT-3' (SEQ ID
NO: 10) 3'-TTuugauugaccugugucacaca-5'
[0045] Exemplary HIF-1 alpha target sequences from which siRNA of
the invention can be derived include those in Table 1 and those
given in SEQ ID NOS: 39-298.
TABLE-US-00004 TABLE 1 HIF-1 Alpha Target Sequences target sequence
SEQ ID NO: AACTAACTGGACACAGTGTGT 11 CGACAAGAAAAAGATAA 12
AAAGATAAGTTCTGAAC 13 AGATAAGTTCTGAACGT 14 GTTCTGAACGTCGAAAA 15
AAGAAAAGTCTCGAGAT 16 GAAAAGTCTCGAGATGC 17 AGTCTCGAGATGCAGCC 18
GTAAAGAATCTGAAGTT 19 GAATCTGAAGTTTTTTA 20 GTTTTTTATGAGCTTGC 21
GGCCTCTGTGATGAGGC 22 CTTCTGGATGCTGGTGA 23 AGCACAGATGAATTGCT 24
AAATGCTTACACACAGAAATG 25 GAAAAAGATAAGTTCTG 26 AAGATAAGTTCTGAACG 27
GATAAGTTCTGAACGTC 28 CGTCGAAAAGAAAAGTC 29 AGAAAAGTCTCGAGATG 30
AAGTCTCGAGATGCAGC 31 GTCTCGAGATGCAGCCA 32 AGAATCTGAAGTTTTTT 33
TCTGAAGTTTTTTATGA 34 TGTGAGTTCGCATCTTG 35 ACTTCTGGATGCTGGTG 36
GATGACATGAAAGCACA 37 GCACAGATGAATTGCTT 38
[0046] The siRNA of the invention can be obtained using a number of
techniques known to those of skill in the art. For example, the
siRNA can be chemically synthesized or recombinantly produced using
methods known in the art, such as the Drosophila in vitro system
described in U.S. published application 2002/0086356 of Tuschl et
al., the entire disclosure of which is herein incorporated by
reference.
[0047] Preferably, the siRNA of the invention are chemically
synthesized using appropriately protected ribonucleoside
phosphoramidites and a conventional DNA/RNA synthesizer. The siRNA
can be synthesized as two separate, complementary RNA molecules, or
as a single RNA molecule with two complementary regions. Commercial
suppliers of synthetic RNA molecules or synthesis reagents include
Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, Colo.,
USA), Pierce Chemical (part of Perbio Science, Rockford, Ill.,
USA), Glen Research (Sterling, Va., USA), ChemGenes (Ashland,
Mass., USA) and Cruachem (Glasgow, UK).
[0048] Alternatively, siRNA can also be expressed from recombinant
circular or linear DNA plasmids using any suitable promoter.
Suitable promoters for expressing siRNA of the invention from a
plasmid include, for example, the U6 or H1 RNA pol III promoter
sequences and the cytomegalovirus promoter. Selection of other
suitable promoters is within the skill in the art. The recombinant
plasmids of the invention can also comprise inducible or
regulatable promoters for expression of the siRNA in a particular
tissue or in a particular intracellular environment.
[0049] The siRNA expressed from recombinant plasmids can either be
isolated from cultured cell expression systems by standard
techniques, or can be expressed intracellularly at or near the area
of neovascularization in vivo. The use of recombinant plasmids to
deliver siRNA of the invention to cells in vivo is discussed in
more detail below.
[0050] The siRNA of the invention can be expressed from a
recombinant plasmid either as two separate, complementary RNA
molecules, or as a single RNA molecule with two complementary
regions.
[0051] Selection of plasmids suitable for expressing siRNA of the
invention, methods for inserting nucleic acid sequences for
expressing the siRNA into the plasmid, and methods of delivering
the recombinant plasmid to the cells of interest are within the
skill in the art. See, for example Tuschl, T. (2002), Nat.
Biotechnol, 20: 446-448; Brummelkamp T R et al. (2002), Science
296: 550-553; Miyagishi M et al. (2002), Nat. Biotechnol. 20:
497-500; Paddison P J et al. (2002), Genes Dev. 16: 948-958; Lee N
S et al. (2002), Nat. Biotechnol. 20: 500-505; and Paul C P et al.
(2002), Nat. Biotechnol. 20: 505-508, the entire disclosures of
which are herein incorporated by reference.
[0052] For example, a plasmid can comprise a sense RNA strand
coding sequence in operable connection with a polyT termination
sequence under the control of a human U6 RNA promoter, and an
antisense RNA strand coding sequence in operable connection with a
polyT termination sequence under the control of a human U6 RNA
promoter.
[0053] As used herein, "in operable connection with a polyT
termination sequence" means that the nucleic acid sequences
encoding the sense or antisense strands are immediately adjacent to
the polyT termination signal in the 5' direction. During
transcription of the sense or antisense sequences from the plasmid,
the polyT termination signals act to terminate transcription.
[0054] As used herein, "under the control" of a promoter means that
the nucleic acid sequences encoding the sense or antisense strands
are located 3' of the promoter, so that the promoter can initiate
transcription of the sense or antisense coding sequences.
[0055] The siRNA of the invention can also be expressed from
recombinant viral vectors intracellularly at or near the area of
neovascularization in vivo. The recombinant viral vectors of the
invention comprise sequences encoding the siRNA of the invention
and any suitable promoter for expressing the siRNA sequences.
Suitable promoters include, for example, the U6 or H1 RNA pol III
promoter sequences and the cytomegalovirus promoter. Selection of
other suitable promoters is within the skill in the art. The
recombinant viral vectors of the invention can also comprise
inducible or regulatable promoters for expression of the siRNA in a
particular tissue or in a particular intracellular environment. The
use of recombinant viral vectors to deliver siRNA of the invention
to cells in vivo is discussed in more detail below.
[0056] The siRNA of the invention can be expressed from a
recombinant viral vector either as two separate, complementary
nucleic acid molecules, or as a single nucleic acid molecule with
two complementary regions.
[0057] Any viral vector capable of accepting the coding sequences
for the siRNA molecule(s) to be expressed can be used, for example
vectors derived from adenovirus (AV); adeno-associated virus (AAV);
retroviruses (e.g. lentiviruses (LV), Rhabdoviruses, murine
leukemia virus); herpes virus, and the like. The tropism of the
viral vectors can also be modified by pseudotyping the vectors with
envelope proteins or other surface antigens from other viruses. For
example, an AAV vector of the invention can be pseudotyped with
surface proteins from vesicular stomatitis virus (VSV), rabies,
Ebola, Mokola, and the like.
[0058] Selection of recombinant viral vectors suitable for use in
the invention, methods for inserting nucleic acid sequences for
expressing the siRNA into the vector, and methods of delivering the
viral vector to the cells of interest are within the skill in the
art. See, for example, Dornburg R (1995), Gene Therap. 2: 301-310;
Eglitis M A (1988), Biotechniques 6: 608-614; Miller A D (1990),
Hum Gene Therap. 1: 5-14; and Anderson W F (1998), Nature 392:
25-30, the entire disclosures of which are herein incorporated by
reference.
[0059] Preferred viral vectors are those derived from AV and AAV.
In a particularly preferred embodiment, the siRNA of the invention
is expressed as two separate, complementary single-stranded RNA
molecules from a recombinant AAV vector comprising, for example,
either the U6 or H1 RNA promoters, or the cytomegalovirus (CMV)
promoter.
[0060] A suitable AV vector for expressing the siRNA of the
invention, a method for constructing the recombinant AV vector, and
a method for delivering the vector into target cells, are described
in Xia H et al. (2002), Nat. Biotech. 20: 1006-1010.
[0061] Suitable AAV vectors for expressing the siRNA of the
invention, methods for constructing the recombinant AAV vector, and
methods for delivering the vectors into target cells are described
in Samulski R et al. (1987), J. Virol. 61: 3096-3101; Fisher K J et
al. (1996), J. Virol., 70: 520-532; Samulski R et al. (1989), J.
Viriol. 63: 3822-3826; U.S. Pat. No. 5,252,479; U.S. Pat. No.
5,139,941; International Patent Application No. WO 94/13788; and
International Patent Application No. WO 93/24641, the entire
disclosures of which are herein incorporated by reference.
[0062] The ability of an siRNA containing a given target sequence
to cause RNAi-mediated degradation of the target mRNA can be
evaluated using standard techniques for measuring the levels of RNA
or protein in cells. For example, siRNA of the invention can be
delivered to cultured cells, and the levels of target mRNA can be
measured by Northern blot or dot blotting techniques, or by
quantitative RT-PCR. Alternatively, the levels of HIF-1 alpha
protein in the cultured cells can be measured by ELISA or Western
blot. A suitable cell culture system for measuring the effect of
the present siRNA on target mRNA or protein levels is described in
Example 1 below.
[0063] The ability of an siRNA to target and cause RNAi-mediated
degradation of HIF-1 alpha mRNA can also be evaluated by measuring
the levels of VEGF mRNA or protein in cultured cells, as a
reduction in HIF-1 alpha expression will also inhibit VEGF
expression.
[0064] For example, 50% confluent 293 human kidney cells can be
incubated with culture medium containing an siRNA (optionally
complexed to a transfection reagent such as Minis Transit TKO
transfection reagent) for 48 hours, followed by ELISA or mRNA
quantification of either HIF-1 alpha or VEGF. Cells incubated with
an siRNA not homologous to the HIF-1 alpha target sequence can be
used as controls.
[0065] RNAi-mediated degradation of target mRNA by an siRNA
containing a given target sequence can also be evaluated with
animal models of neovascularization, such as the retinopathy of
prematurity ("ROP") or choroidal neovascularization ("CNV") mouse
models. For example, areas of neovascularization in an ROP or CNV
mouse can be measured before and after administration of an siRNA.
A reduction in the areas of neovascularization in these models upon
administration of the siRNA indicates the down-regulation of the
target mRNA (see Example 2 below).
[0066] As discussed above, the siRNA of the invention target and
cause the RNAi-mediated degradation of HIF-1 alpha mRNA, or
alternative splice forms, mutants or cognates thereof. Degradation
of the target mRNA by the present siRNA reduces the production of a
functional gene product from the HIF-1 alpha gene. Thus, the
invention provides a method of inhibiting expression of HIF-1 alpha
in a subject, comprising administering an effective amount of an
siRNA of the invention to the subject, such that the target mRNA is
degraded. In the practice of the present methods, it is understood
that more than one siRNA of the invention can be administered
simultaneously to the subject.
[0067] Without wishing to be bound by any theory, the products of
the HIF-1 alpha gene are believed to be involved in the
transcriptional regulation of VEGF. VEGF is in turn required for
initiating and maintaining angiogenesis. Thus, the invention also
provides a method of inhibiting angiogenesis in a subject by the
RNAi-mediated degradation of the target mRNA by an siRNA of the
invention.
[0068] As used herein, a "subject" includes a human being or
non-human animal. Preferably, the subject is a human being.
[0069] As used herein, an "effective amount" of the siRNA is an
amount sufficient to cause RNAi-mediated degradation of the target
mRNA, or an amount sufficient to inhibit angiogenesis in a
subject.
[0070] RNAi-mediated degradation of the target mRNA can be detected
by measuring levels of the target mRNA or protein in the cells of a
subject, using standard techniques for isolating and quantifying
mRNA or protein as described above.
[0071] Inhibition of angiogenesis can be evaluated by directly
measuring the progress of pathogenic or nonpathogenic angiogenesis
in a subject; for example, by observing the size of a
neovascularized area before and after treatment with the siRNA of
the invention. An inhibition of angiogenesis is indicated if the
size of the neovascularized area stays the same or is reduced.
Techniques for observing and measuring the size of neovascularized
areas in a subject are within the skill in the art; for example,
areas of choroid neovascularization can be observed by
ophthalmoscopy.
[0072] Inhibition of angiogenesis can also be inferred through
observing a change or reversal in a pathogenic condition associated
with the angiogenesis. For example, in ARMD, a slowing, halting or
reversal of vision loss indicates an inhibition of angiogenesis in
the choroid. For tumors, a slowing, halting or reversal of tumor
growth, or a slowing or halting of tumor metastasis, indicates an
inhibition of angiogenesis at or near the tumor site. Inhibition of
non-pathogenic angiogenesis can also be inferred from, for example,
fat loss or a reduction in cholesterol levels upon administration
of the siRNA of the invention.
[0073] It is understood that the siRNA of the invention can degrade
the target mRNA (and thus inhibit angiogenesis) in
substoichiometric amounts. Without wishing to be bound by any
theory, it is believed that the siRNA of the invention induces the
RISC to degrade of the target mRNA in a catalytic manner. Thus,
compared to standard anti-angiogenic therapies, significantly less
siRNA needs to be delivered at or near the site of
neovascularization to have a therapeutic effect.
[0074] One skilled in the art can readily determine an effective
amount of the siRNA of the invention to be administered to a given
subject, by taking into account factors such as the size and weight
of the subject; the extent of the neovascularization or disease
penetration; the age, health and sex of the subject; the route of
administration; and whether the administration is regional or
systemic. Generally, an effective amount of the siRNA of the
invention comprises an amount which provides an intercellular
concentration at or near the neovascularization site of from about
1 nanomolar (nM) to about 100 nM, preferably from about 2 nM to
about 50 nM, more preferably from about 2.5 nM to about 10 nM. It
is contemplated that greater or lesser amounts of siRNA can be
administered.
[0075] The present methods can be used to inhibit angiogenesis
which is non-pathogenic; i.e., angiogenesis which results from
normal processes in the subject. Examples of non-pathogenic
angiogenesis include endometrial neovascularization, and processes
involved in the production of fatty tissues or cholesterol. Thus,
the invention provides a method for inhibiting non-pathogenic
angiogenesis, e.g., for controlling weight or promoting fat loss,
for reducing cholesterol levels, or as an abortifacient.
[0076] The present methods can also inhibit angiogenesis which is
associated with an angiogenic disease; i.e., a disease in which
pathogenicity is associated with inappropriate or uncontrolled
angiogenesis. For example, most cancerous solid tumors generate an
adequate blood supply for themselves by inducing angiogenesis in
and around the tumor site. This tumor-induced angiogenesis is often
required for tumor growth, and also allows metastatic cells to
enter the bloodstream.
[0077] Other angiogenic diseases include diabetic retinopathy,
age-related macular degeneration (ARMD), psoriasis, rheumatoid
arthritis and other inflammatory diseases. These diseases are
characterized by the destruction of normal tissue by newly formed
blood vessels in the area of neovascularization. For example, in
ARMD, the choroid is invaded and destroyed by capillaries. The
angiogenesis-driven destruction of the choroid in ARMD eventually
leads to partial or full blindness.
[0078] Preferably, an siRNA of the invention is used to inhibit the
growth or metastasis of solid tumors associated with cancers; for
example breast cancer, lung cancer, head and neck cancer, brain
cancer, abdominal cancer, colon cancer, colorectal cancer,
esophagus cancer, gastrointestinal cancer, glioma, liver cancer,
tongue cancer, neuroblastoma, osteosarcoma, ovarian cancer,
pancreatic cancer, prostate cancer, retinoblastoma, Wilm's tumor,
multiple myeloma; skin cancer (e.g., melanoma), lymphomas and blood
cancer.
[0079] More preferably, an siRNA of the invention is used to
inhibit choroidal neovascularization in age-related macular
degeneration.
[0080] For treating angiogenic diseases, the siRNA of the invention
can administered to a subject in combination with a pharmaceutical
agent which is different from the present siRNA. Alternatively, the
siRNA of the invention can be administered to a subject in
combination with another therapeutic method designed to treat the
angiogenic disease. For example, the siRNA of the invention can be
administered in combination with therapeutic methods currently
employed for treating cancer or preventing tumor metastasis (e.g.,
radiation therapy, chemotherapy, and surgery). For treating tumors,
the siRNA of the invention is preferably administered to a subject
in combination with radiation therapy, or in combination with
chemotherapeutic agents such as cisplatin, carboplatin,
cyclophosphamide, 5-fluorouracil, adriamycin, daunorubicin or
tamoxifen.
[0081] In the present methods, the present siRNA can be
administered to the subject either as naked siRNA, in conjunction
with a delivery reagent, or as a recombinant plasmid or viral
vector which expresses the siRNA.
[0082] Suitable delivery reagents for administration in conjunction
with the present siRNA include the Mirus Transit TKO lipophilic
reagent; lipofectin; lipofectamine; cellfectin; or polycations
(e.g., polylysine), or liposomes. A preferred delivery reagent is a
liposome.
[0083] Liposomes can aid in the delivery of the siRNA to a
particular tissue, such as retinal or tumor tissue, and can also
increase the blood half-life of the siRNA. Liposomes suitable for
use in the invention are formed from standard vesicle-forming
lipids, which generally include neutral or negatively charged
phospholipids and a sterol, such as cholesterol. The selection of
lipids is generally guided by consideration of factors such as the
desired liposome size and half-life of the liposomes in the blood
stream. A variety of methods are known for preparing liposomes, for
example as described in Szoka et al. (1980), Ann. Rev. Biophys.
Bioeng. 9: 467; and U.S. Pat. Nos. 4,235,871, 4,501,728, 4,837,028,
and 5,019,369, the entire disclosures of which are herein
incorporated by reference.
[0084] Preferably, the liposomes encapsulating the present siRNA
comprise a ligand molecule that can target the liposome to a
particular cell or tissue at or near the site of angiogenesis.
Ligands which bind to receptors prevalent in tumor or vascular
endothelial cells, such as monoclonal antibodies that bind to tumor
antigens or endothelial cell surface antigens, are preferred.
[0085] Particularly preferably, the liposomes encapsulating the
present siRNA are modified so as to avoid clearance by the
mononuclear macrophage and reticuloendothelial systems, for example
by having opsonization-inhibition moieties bound to the surface of
the structure. In one embodiment, a liposome of the invention can
comprise both opsonization-inhibition moieties and a ligand.
[0086] Opsonization-inhibiting moieties for use in preparing the
liposomes of the invention are typically large hydrophilic polymers
that are bound to the liposome membrane. As used herein, an
opsonization inhibiting moiety is "bound" to a liposome membrane
when it is chemically or physically attached to the membrane, e.g.,
by the intercalation of a lipid-soluble anchor into the membrane
itself, or by binding directly to active groups of membrane lipids.
These opsonization-inhibiting hydrophilic polymers form a
protective surface layer which significantly decreases the uptake
of the liposomes by the macrophage-monocyte system ("MMS") and
reticuloendothelial system ("RES"); e.g., as described in U.S. Pat.
No. 4,920,016, the entire disclosure of which is herein
incorporated by reference. Liposomes modified with
opsonization-inhibition moieties thus remain in the circulation
much longer than unmodified liposomes. For this reason, such
liposomes are sometimes called "stealth" liposomes.
[0087] Stealth liposomes are known to accumulate in tissues fed by
porous or "leaky" microvasculature. Thus, target tissue
characterized by such microvasculature defects, for example solid
tumors, will efficiently accumulate these liposomes; see Gabizon,
et al. (1988), P.N.A.S., USA, 18: 6949-53. In addition, the reduced
uptake by the RES lowers the toxicity of stealth liposomes by
preventing significant accumulation in the liver and spleen. Thus,
liposomes of the invention that are modified with
opsonization-inhibition moieties can deliver the present siRNA to
tumor cells.
[0088] Opsonization inhibiting moieties suitable for modifying
liposomes are preferably water-soluble polymers with a
number-average molecular weight from about 500 to about 40,000
daltons, and more preferably from about 2,000 to about 20,000
daltons. Such polymers include polyethylene glycol (PEG) or
polypropylene glycol (PPG) derivatives; e.g., methoxy PEG or PPG,
and PEG or PPG stearate; synthetic polymers such as polyacrylamide
or poly N-vinyl pyrrolidone; linear, branched, or dendrimeric
polyamidoamines; polyacrylic acids; polyalcohols, e.g.,
polyvinylalcohol and polyxylitol to which carboxylic or amino
groups are chemically linked, as well as gangliosides, such as
ganglioside GM.sub.1. Copolymers of PEG, methoxy PEG, or methoxy
PPG, or derivatives thereof, are also suitable. In addition, the
opsonization inhibiting polymer can be a block copolymer of PEG and
either a polyamino acid, polysaccharide, polyamidoamine,
polyethyleneamine, or polynucleotide. The opsonization inhibiting
polymers can also be natural polysaccharides containing amino acids
or carboxylic acids, e.g., galacturonic acid, glucuronic acid,
mannuronic acid, hyaluronic acid, pectic acid, neuraminic acid,
alginic acid, carrageenan; aminated polysaccharides or
oligosaccharides (linear or branched); or carboxylated
polysaccharides or oligosaccharides, e.g., reacted with derivatives
of carbonic acids with resultant linking of carboxylic groups.
[0089] Preferably, the opsonization-inhibiting moiety is a PEG,
PPG, or derivatives thereof. Liposomes modified with PEG or
PEG-derivatives are sometimes called "PEGylated liposomes."
[0090] The opsonization inhibiting moiety can be bound to the
liposome membrane by any one of numerous well-known techniques. For
example, an N-hydroxysuccinimide ester of PEG can be bound to a
phosphatidyl-ethanolamine lipid-soluble anchor, and then bound to a
membrane. Similarly, a dextran polymer can be derivatized with a
stearylamine lipid-soluble anchor via reductive amination using
Na(CN)BH.sub.3 and a solvent mixture such as tetrahydrofuran and
water in a 30:12 ratio at 60.degree. C.
[0091] Recombinant plasmids which express siRNA of the invention
are discussed above. Such recombinant plasmids can also be
administered to a subject directly or in conjunction with a
suitable delivery reagent, including the Minis Transit LT1
lipophilic reagent; lipofectin; lipofectamine; cellfectin;
polycations (e.g., polylysine) or liposomes. Recombinant viral
vectors which express siRNA of the invention are also discussed
above, and methods for delivering such vectors to an area of
neovascularization in a subject are within the skill in the
art.
[0092] The siRNA of the invention can be administered to the
subject by any means suitable for delivering the siRNA to the cells
of the tissue at or near the area of neovascularization. For
example, the siRNA can be administered by gene gun,
electroporation, or by other suitable parenteral or enteral
administration routes.
[0093] Suitable enteral administration routes include oral, rectal,
or intranasal delivery.
[0094] Suitable parenteral administration routes include
intravascular administration (e.g. intravenous bolus injection,
intravenous infusion, intra-arterial bolus injection,
intra-arterial infusion and catheter instillation into the
vasculature); peri- and intra-tissue administration (e.g.,
peri-tumoral and intra-tumoral injection, intra-retinal injection
or subretinal injection); subcutaneous injection or deposition
including subcutaneous infusion (such as by osmotic pumps); direct
(e.g., topical) application to the area at or near the site of
neovascularization, for example by a catheter or other placement
device (e.g., a corneal pellet or a suppository, eye-dropper, or an
implant comprising a porous, non-porous, or gelatinous material);
and inhalation. Suitable placement devices include the ocular
implants described in U.S. Pat. Nos. 5,902,598 and 6,375,972, and
the biodegradable ocular implants described in U.S. Pat. No.
6,331,313, the entire disclosures of which are herein incorporated
by reference. Such ocular implants are available from Control
Delivery Systems, Inc. (Watertown, Mass.) and Oculex
Pharmaceuticals, Inc. (Sunnyvale, Calif.).
[0095] In a preferred embodiment, injections or infusions of the
siRNA are given at or near the site of neovascularization. For
example, the siRNA of the invention can be delivered to retinal
pigment epithelial cells in the eye. Preferably, the siRNA is
administered topically to the eye, e.g. in liquid or gel form to
the lower eye lid or conjunctival cul-de-sac, as is within the
skill in the art (see, e.g., Acheampong A A et al, 2002, Drug
Metabol. and Disposition 30: 421-429, the entire disclosure of
which is herein incorporated by reference).
[0096] Typically, the siRNA of the invention is administered
topically to the eye in volumes of from about 5 microliters to
about 75 microliters, for example from about 7 microliters to about
50 microliters, preferably from about 10 microliters to about 30
microliters. The siRNA of the invention is highly soluble in
aqueous solutions. It is understood that topical instillation in
the eye of siRNA in volumes greater than 75 microliters can result
in loss of siRNA from the eye through spillage and drainage. Thus,
it is preferable to administer a high concentration of siRNA (e.g.,
100-1000 nM) by topical instillation to the eye in volumes of from
about 5 microliters to about 75 microliters.
[0097] A particularly preferred parenteral administration route is
intraocular administration. It is understood that intraocular
administration of the present siRNA can be accomplished by
injection or direct (e.g., topical) administration to the eye, as
long as the administration route allows the siRNA to enter the eye.
In addition to the topical routes of administration to the eye
described above, suitable intraocular routes of administration
include intravitreal, intraretinal, subretinal, subtenon, peri- and
retro-orbital, trans-corneal and trans-scleral administration. Such
intraocular administration routes are within the skill in the art;
see, e.g., and Acheampong A A et al, 2002, supra; and Bennett et
al. (1996), Hum. Gene Ther. 7: 1763-1769 and Ambati J et al., 2002,
Progress in Retinal and Eye Res. 21: 145-151, the entire
disclosures of which are herein incorporated by reference.
[0098] The siRNA of the invention can be administered in a single
dose or in multiple doses. Where the administration of the siRNA of
the invention is by infusion, the infusion can be a single
sustained dose or can be delivered by multiple infusions. Injection
of the siRNA directly into the tissue is at or near the site of
neovascularization preferred. Multiple injections of the siRNA into
the tissue at or near the site of neovascularization are
particularly preferred.
[0099] One skilled in the art can also readily determine an
appropriate dosage regimen for administering the siRNA of the
invention to a given subject. For example, the siRNA can be
administered to the subject once, such as by a single injection or
deposition at or near the neovascularization site. Alternatively,
the siRNA can be administered to a subject multiple times daily or
weekly. For example, the siRNA can be administered to a subject
once weekly for a period of from about three to about twenty-eight
weeks, more preferably from about seven to about ten weeks. In a
preferred dosage regimen, the siRNA is injected at or near the site
of neovascularization (e.g., intravitreally) once a week for seven
weeks. It is understood that periodic administrations of the siRNA
of the invention for an indefinite length of time may be necessary
for subjects suffering from a chronic neovascularization disease,
such as wet ARMD or diabetic retinopathy.
[0100] Where a dosage regimen comprises multiple administrations,
it is understood that the effective amount of siRNA administered to
the subject can comprise the total amount of siRNA administered
over the entire dosage regimen.
[0101] The siRNA of the invention are preferably formulated as
pharmaceutical compositions prior to administering to a subject,
according to techniques known in the art. Pharmaceutical
compositions of the present invention are characterized as being at
least sterile and pyrogen-free. As used herein, "pharmaceutical
formulations" include formulations for human and veterinary use.
Methods for preparing pharmaceutical compositions of the invention
are within the skill in the art, for example as described in
Remington's Pharmaceutical Science, 17th ed., Mack Publishing
Company, Easton, Pa. (1985), the entire disclosure of which is
herein incorporated by reference.
[0102] The present pharmaceutical formulations comprise an siRNA of
the invention (e.g., 0.1 to 90% by weight), or a physiologically
acceptable salt thereof, mixed with a physiologically acceptable
carrier medium. Preferred physiologically acceptable carrier media
are water, buffered water, saline solutions (e.g., normal saline or
balanced saline solutions such as Hank's or Earle's balanced salt
solutions), 0.4% saline, 0.3% glycine, hyaluronic acid and the
like.
[0103] Pharmaceutical compositions of the invention can also
comprise conventional pharmaceutical excipients and/or additives.
Suitable pharmaceutical excipients include stabilizers,
antioxidants, osmolality adjusting agents, buffers, and pH
adjusting agents. Suitable additives include physiologically
biocompatible buffers (e.g., tromethamine hydrochloride), additions
of chelants (such as, for example, DTPA or DTPA-bisamide) or
calcium chelate complexes (as for example calcium DTPA,
CaNaDTPA-bisamide), or, optionally, additions of calcium or sodium
salts (for example, calcium chloride, calcium ascorbate, calcium
gluconate or calcium lactate). Pharmaceutical compositions of the
invention can be packaged for use in liquid form, or can be
lyophilized.
[0104] For topical administration to the eye, conventional
intraocular delivery reagents can be used. For example,
pharmaceutical compositions of the invention for topical
intraocular delivery can comprise saline solutions as described
above, corneal penetration enhancers, insoluble particles,
petrolatum or other gel-based ointments, polymers which undergo a
viscosity increase upon instillation in the eye, or mucoadhesive
polymers. Preferably, the intraocular delivery reagent increases
corneal penetration, or prolongs preocular retention of the siRNA
through viscosity effects or by establishing physicochemical
interactions with the mucin layer covering the corneal
epithelium.
[0105] Suitable insoluble particles for topical intraocular
delivery include the calcium phosphate particles described in U.S.
Pat. No. 6,355,271 of Bell et al., the entire disclosure of which
is herein incorporated by reference. Suitable polymers which
undergo a viscosity increase upon instillation in the eye include
polyethylenepolyoxypropylene block copolymers such as poloxamer 407
(e.g., at a concentration of 25%), cellulose acetophthalate (e.g.,
at a concentration of 30%), or a low-acetyl gellan gum such as
Geirite.RTM. (available from CP Kelco, Wilmington, Del.). Suitable
mucoadhesive polymers include hydrocolloids with multiple
hydrophilic functional groups such as carboxyl, hydroxyl, amide
and/or sulfate groups; for example, hydroxypropylcellulose,
polyacrylic acid, high-molecular weight polyethylene glycols (e.g.,
>200,000 number average molecular weight), dextrans, hyaluronic
acid, polygalacturonic acid, and xylocan. Suitable corneal
penetration enhancers include cyclodextrins, benzalkonium chloride,
polyoxyethylene glycol lauryl ether (e.g., Brij.RTM. 35),
polyoxyethylene glycol stearyl ether (e.g., Brij.RTM. 78),
polyoxyethylene glycol oleyl ether (e.g., Brij.RTM. 98), ethylene
diamine tetraacetic acid (EDTA), digitonin, sodium taurocholate,
saponins and polyoxyethylated castor oil such as Cremaphor EL.
[0106] For solid compositions, conventional nontoxic solid carriers
can be used; for example, pharmaceutical grades of mannitol,
lactose, starch, magnesium stearate, sodium saccharin, talcum,
cellulose, glucose, sucrose, magnesium carbonate, and the like.
[0107] For example, a solid pharmaceutical composition for oral
administration can comprise any of the carriers and excipients
listed above and 10-95%, preferably 25%-75%, of one or more siRNA
of the invention. A pharmaceutical composition for aerosol
(inhalational) administration can comprise 0.01-20% by weight,
preferably 1%-10% by weight, of one or more siRNA of the invention
encapsulated in a liposome as described above, and propellant. A
carrier can also be included as desired; e.g., lecithin for
intranasal delivery.
[0108] The invention will now be illustrated with the following
non-limiting examples. The animal experiments described below were
performed using the University of Pennsylvania institutional
guidelines for the care and use of animals in research.
Example 1
Inhibition of Human VEGF Expression in Cultured Human Embryonic
Kidney Cells with Anti-HIF-1 Alpha siRNAs
[0109] Human embryonic kidney 293 (HEK-293) cells were cultured in
24 well plates at 37.degree. C. with 5% CO.sub.2 overnight, in
standard growth medium. Transfections were performed the following
day on experimental and control cells, when the cells were
approximately 50% confluent. The experimental cells were
transfected with 25 nM human HIF-1 alpha siRNA mixed in calcium
phosphate reagent. Control cells were treated with transfection
reagent lacking siRNA, or with 25 nM nonspecific siRNA (EGFP1
siRNA) in calcium phosphate transfection reagent. For the
experimental cells, twenty different siRNAs targeted to human HIF-1
alpha mRNA were tested. These anti-HIF-1 alpha siRNAs contained the
targeting sequences listed in Table 2, and all siRNAs contained 3'
TT overhangs on each strand. The "sample #" listed in Table 2
corresponds to the experimental cell sample as indicated in FIGS. 1
and 2.
TABLE-US-00005 TABLE 2 Target Sequences for Anti-HIF-1 Alpha siRNAs
Tested in HEK-293 Cells SEQ Sample Target Sequence ID NO: #
AACTAGCCGAGGAAGAACTAT 76 1 AACTGTCATATATAACACCAA 117 2
AATTACGTTGTGAGTGGTATT 122 3 AAACGCCAAAGCCACTTCGAA 161 4
AAAGTTCACCTGAGCCTAATA 177 5 AAGTTCACCTGAGCCTAATAG 180 6
AAAGCACAGTTACAGTATTCC 200 7 AAGCACAGTTACAGTATTCCA 201 8
AAAAGACCGTATGGAAGACAT 212 9 AACTACTAGTGCCACATCATC 222 10
AAAGTCGGACAGCCTCACCAA 223 11 AAGTCGGACAGCCTCACCAAA 224 12
AACGTGTTATCTGTCGCTTTG 237 13 AAGCAGTAGGAATTGGAACAT 255 14
AATGGATGAAAGTGGATTACC 274 15 AATGTGAGTTCGCATCTTGAT 40 16
AAGATGACATGAAAGCACAGA 44 17 AACTGGACACAGTGTGTTTGA 56 18
AAATTCCTTTAGATAGCAAGA 93 19 AAACCGGTTGAATCTTCAGAT 127 20
[0110] At four hours post-transfection, hypoxia was induced in
control and experimental HEK-293 cells with desferrioxamine at a
final concentration of 200 micromolar. At 48 hours post
transfection, the cell culture medium was removed from all wells
and a human VEGF ELISA (R & D systems, Minneapolis, Minn.) was
performed as described in the Quantikine human VEGF ELISA protocol.
ELISA results were read on an AD340 plate reader (Beckman Coulter),
and are given in FIG. 1.
[0111] As can be seen from FIG. 1, human VEGF protein was
upregulated in HEK-293 cells by the desferrioxamine-mediated
induction of hypoxia. The hypoxia-induced increase in VEGF protein
was reduced in cells transfected with the human anti-HIF-1 alpha
siRNAs. Transfections of hypoxic cells with non-specific siRNA
(EGFP siRNA) or mock transfection without siRNA had no effect on
VEGF protein levels. The anti-HIF-1 alpha siRNAs hHIF1#12, hHIF1#13
and hHIF1#16 reduced VEGF protein expression to levels approaching
that of non-hypoxic HEK-293 cells. Anti-HIF-1 alpha siRNA hHIF1#11
reduced VEGF protein expression to below that of non-hypoxic
HEK-293 cells.
[0112] After the cell culture medium was removed from the control
and experimental cells, a cytotoxicity assay was performed as
follows. Complete growth medium containing 10% AlamarBlue
(Biosource, Camarillo, Calif.) was added to each well, and the
cells were incubated at 37.degree. C. with 5% CO.sub.2 for 3 hours.
Cell proliferation was measured by detecting the color change of
medium containing AlamarBlue resulting from cell metabolic
activity. Cytotoxicity assay results were read on an AD340 plate
reader (Beckman Coulter) and are given in FIG. 2. As can be seen
from FIG. 2, none of the twenty anti-HIF-1 alpha siRNAs tested
showed significant cytotoxicity in the HEK-293 cells.
[0113] After the cytotoxicity assay was performed, the growth
medium in each well was completely removed, and RNA extractions
from the HEK-293 cells were performed with the RNAqueous RNA
isolation kit (Ambion, Austin, Tex.) according to the
manufacturer's instructions. The levels of human HIF-1 alpha and
VEGF mRNA in the cells were measured by quantitative reverse
transcription-polymerase chain reaction (RT-PCR), using the level
of human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA as
an internal standard.
[0114] The RT-PCR study showed that hypoxia increased the mRNA
levels of human VEGF relative to VEGF mRNA expression in
non-hypoxic cells. The VEGF mRNA levels in hypoxic cells were
reduced by transfection with anti-HIF-1 alpha siRNAs. Transfection
of hypoxic cells with non-specific siRNA (EGFP siRNA) or mock
transfection with no siRNA did not reduce VEGF mRNA levels. Thus,
the introduction of anti-HIF-1 alpha siRNAs into the HIK-293 cells
induced the destruction of the VEGF mRNA, as compared to cells
transfected with non-specific siRNA or no siRNA. The destruction of
VEGF mRNA induced by the anti-HIF-1 alpha siRNAs correlated with
the reduction in VEGF protein production shown in FIG. 1.
Example 2
In Vivo Inhibition of Angiogenesis with Anti-HIF-1 Alpha siRNA in a
Mouse Model of Choroidal Neovascularization
[0115] Adult (8-15 week old) female C57Bl/6 mice (n=7) were
anesthetized with avertin (2,2,2-tribromoethanol) and their pupils
were dilated with 1% tropicamide. Laser photocoagulation was
performed bilaterally using a diode laser photocoagulator (IRIS
Medical, Mountain View, Calif.) and a slit lamp system with a cover
slip as a contact lens. Laser photocoagulation (140 mW; 75 micron
spot size; 0.1 s duration) was applied to the 9, 12 and 3 o'clock
positions in both eyes at 2 to 3 disk diameters from the optic
nerve. Since the rupture of Bruch's membrane is necessary to create
significant choroidal neovascularization (CNV), bubble formation at
the time of photocoagulation was used as an indication of the
rupture of Bruch's membrane. Laser burns that did not induce a
rupture in Bruch's membrane were excluded from the study.
[0116] Immediately after laser treatment, an siRNA targeted to
mouse HIF-1 alpha mRNA was delivered to both eyes of each animal in
the test group by intravitreal injection. Control animals received
intravitreal injection of carrier only.
[0117] The target sequence of the mouse anti-HIF-1 alpha mRNA was
AACTAACTGGACACAGTGTGT (SEQ ID NO: 297), and the siRNA used was:
TABLE-US-00006 (SEQ ID NO: 298) 5'-cuaacuggacacaguguguTT-3' (SEQ ID
NO: 299) 3' TTgauugaccugugucacaca5'
[0118] Twelve days after laser photocoagulation, the animals were
perfused with high molecular weight dextran-fluorescein (Molecular
Probes, Eugene, Oreg.) to label the retinal/choroidal vasculature,
and the eyes were harvested. The area of each CNV was measured in
choroidal flat mount preparations.
[0119] To prepare choroidal flat mounts, the anterior chamber was
removed and the retina was extracted with the vitreous, leaving the
eyecup. Relaxing incisions were made on the eye cup and the choroid
was flattened onto a slide. Using a Leica DMR microscope (Wetzlar,
Germany) equipped with epifluorescence illumination, a masked
investigator identified lesions in the dextran-fluorescein-perfused
flat mount preparations as circular fluorescent (fluorescein
positive) areas corresponding to the area previously exposed to the
laser light. Images of the lesions were captured using a black and
white Hamamatsu CCD camera (Hamamatsu Photonics, Bridgewater, N.J.)
coupled to a Apple Macintosh G4 computer (Cupertino, Calif.)
equipped with OpenLab 2.2 software. Images for calibration were
obtained from a slide with a grating of known size. The
hyperfluorescent fluorescein-dextran labeled blood vessels within
the area of the laser burn were selected as "region of interest"
(ROI) using Openlab software, and this software was used to
calculate the area (.mu.m.sup.2) occupied by the white pixels in
the ROIs. The ROIs were selected after collecting the images under
identical integration settings by using the Openlab "magic wand"
tool to identify pixels in the laser burn site at a range of
2000-4090 intensity units, as defined within the Openlab software.
The intensity units which were selected represented levels measured
in normal fluorescein-perfused vasculature. For reference, the
intensity of background, non-fluorescent areas was <450
intensity units.
[0120] The ROIs were generally well-circumscribed by a region
lacking fluorescence. After measuring the areas of CNV, images were
colorized in Openlab by applying an intensity ramp at 515
nanometers (the wavelength at which the image data were captured),
using the "apply wavelength" function in the Openlab software. This
intensity ramp was applied to all of the pixels in the image, and
made the whitest pixels the brightest green color. The images were
then exported to Adobe Photoshop software for presentation
purposes. Situations in which there was no evidence of a laser burn
after bright field analysis of choroidal flatmounts were
excluded.
[0121] Statistical analysis of the results was performed using a
one-tailed distribution, two sample unequal variance Student's
t-test. There was a statistically significant reduction in the CNV
area (P=0.000354) between the anti-HIF-1 alpha siRNA treated
animals and the control lasered animals, indicating a substantial
reduction in angiogenesis in the animals receiving the anti-HIF-1
alpha siRNA. The results are presented in FIG. 3.
Sequence CWU 1
1
29912964DNAHomo sapiens 1ggccgtccct ggcggcggag atggcggcga
cagcggcgga ggctgtgacc tctggctctg 60gagagccccg ggaggaggct ggagccctcg
gccccgcctg gcatgaatcc cagttgcgca 120gttatagctt cccgactagg
cccattccgc gtctgagtca gagcgacccc cgggcagagg 180agcttattga
gaatgaggag cctgtggtgc tgaccgacac aaatcttgtg tatcctgccc
240tgaaatggga ccttgaatac ctgcaagaga atattggcaa tggagacttc
tctgtgtaca 300gtgccagcac ccacaagttc ttgtactatg atgagaagaa
gatggccaat ttccagaact 360ttaagccgag gtccaacagg gaagaaatga
aatttcatga gttcgttgag aaactgcagg 420atatacagca gcgaggaggg
gaagagaggt tgtatctgca gcaaacgctc aatgacactg 480tgggcgggaa
gattgtcatg gacttcttag gttttaactg gaactggatt aataagcaac
540agggaaagcg tggctggggg cagcttacct ctaacctgct gctcattggc
atggaaggaa 600atgtgacacc tgctcactat gatgagcagc agaacttttt
tgctcagata aaaggttaca 660aacgatgcat cttattccct ccggatcagt
tcgagtgcct ctacccatac cctgttcatc 720acccatgtga cagacagagc
caggtggact ttgacaatcc cgactacgag aggttcccta 780atttccaaaa
tgtggttggt tacgaaacag tggttggccc tggtgatgtt ctttacatcc
840caatgtactg gtggcatcac atagagtcat tactaaatgg ggggattacc
atcactgtga 900acttctggta taagggggct cccaccccta agagaattga
atatcctctc aaagctcatc 960agaaagtggc cataatgaga aacattgaga
agatgcttgg agaggccttg gggaacccac 1020aagaggtggg gcccttgttg
aacacaatga tcaagggccg gtacaactag cctgccaggg 1080gtcaaggcct
cctgccaggt gactgctatc ccgtccacac cgcttcattg atgaggacag
1140gagactccaa gcgctagtat tgcacgctgc acttaatgga ctggactctt
gccatggccc 1200aggagtcagg tgtttggagc gaggcagggc agttggcact
ccactcctat ttggagggac 1260ttcataccct tgcctcttgt gccccagcac
cttctctctc tgccccccgc ctaaagtcct 1320gcattcagtg tgtggagtcc
cagcttttgg ttgtcatcat gtctgtgtgt atgttagtct 1380gtcaacttcg
gaatgtgtgc gtgtgtgtgc atgcacacgc atgtatgtat ctgttccctg
1440ttccttctgg gtcaggctgt cacttccggc tctcggccct atctcctgca
acctcagtgc 1500ctcagcctga gagagagatg agatgctctt ggactcccca
ctgcatctgg gctgcagggc 1560cagagctagt ctgaccatta ggtcagtctg
cctcctgaca gtttttgcgt agtcaagctc 1620taggcggtat gggaatggct
accgggactc taatggggtg aaagagaggg gaggcttgcc 1680tttgagagcc
tatatagcct tcctgtgaga gaggattaga tagggttcca actgggccta
1740caagctcaag ccatacataa aaggaccttg ggacataaga accaatgatt
gtgcataagt 1800tctaaattag agacacatat agtttctctc tttcagcacc
agctcttgcc cctatgctgg 1860gtaccaaggg agttctccta gctgtggctt
ctctaggttc taggggtgca agcctctgtg 1920tgtttgtttg tgtgtgtctg
tgtgtgcgta tccacactag gggtgcaagc ctctgggtgt 1980gtgtgtgtgt
gtgcgtgcgt gtgtgtgtgt gtgtccgtgt gtgtgtgtgt gtgtccacac
2040tggccagcct ccctacttac caaggttctc cactgcttac cttttccagt
gggacagtac 2100agtgtgagcc cccgggaagt actgcctgac ctatcctaag
cttttacact tggattttag 2160ccatcatatg ttggccaggt ttcactgcag
cctgcccgag gctaactggc tagagcctcc 2220aggccctatg atgctccctg
cccaggccat atcctttatt cctgctgagc ttcctggctg 2280aatagatgaa
atggggtcaa gcccaggcag ctcattcact atctgtgatc cacctcaggg
2340cacgggcaaa cacataggct tgcgtcttaa agccagctcc tctgccagac
cccgttgtaa 2400tgtgccacaa caccctcaat agtcagggca actggtggag
catggaagtc gaatttcctt 2460ttctgttagg agctactcct gggaacccct
ctcagggctg cagcttacag gtgggcagct 2520gtgattgcac aacttgaagg
gccatcattc acatctattc agtgggagtg gggtccctgg 2580gattgggcag
tgtggtggcc ctgtgtctcc tcacctctgc tcctgtcttc atcaccttct
2640ctctggaagg gaagaggagt tggaaggtct ctggttttct tttctttttt
tttttttgcc 2700aaaggtttac ttccagcatc tgagctctgg ctctcacccc
tgaagctcag ttatagtgca 2760ctgatgaact gagaggatgc gtgtggatgt
gtgtgcatgc ctgagtgcgt tttttgggga 2820ggggtgttta tttttagtac
cccattctgg ggttctctga tgcagtgtgg atgtgaagat 2880atggtacctt
ctcaagtgta gctctttcaa atatagtcaa tgctgggaaa aaaaaaaaaa
2940aaaaaaaaaa aaaaaaaaaa aaaa 296423958DNAHomo sapiens 2gtgctgcctc
gtctgagggg acaggaggat caccctcttc gtcgcttcgg ccagtgtgtc 60gggctgggcc
ctgacaagcc acctgaggag aggctcggag ccgggcccgg accccggcga
120ttgccgcccg cttctctcta gtctcacgag gggtttcccg cctcgcaccc
ccacctctgg 180acttgccttt ccttctcttc tccgcgtgtg gagggagcca
gcgcttaggc cggagcgagc 240ctgggggccg cccgccgtga agacatcgcg
gggaccgatt caccatggag ggcgccggcg 300gcgcgaacga caagaaaaag
ataagttctg aacgtcgaaa agaaaagtct cgagatgcag 360ccagatctcg
gcgaagtaaa gaatctgaag ttttttatga gcttgctcat cagttgccac
420ttccacataa tgtgagttcg catcttgata aggcctctgt gatgaggctt
accatcagct 480atttgcgtgt gaggaaactt ctggatgctg gtgatttgga
tattgaagat gacatgaaag 540cacagatgaa ttgcttttat ttgaaagcct
tggatggttt tgttatggtt ctcacagatg 600atggtgacat gatttacatt
tctgataatg tgaacaaata catgggatta actcagtttg 660aactaactgg
acacagtgtg tttgatttta ctcatccatg tgaccatgag gaaatgagag
720aaatgcttac acacagaaat ggccttgtga aaaagggtaa agaacaaaac
acacagcgaa 780gcttttttct cagaatgaag tgtaccctaa ctagccgagg
aagaactatg aacataaagt 840ctgcaacatg gaaggtattg cactgcacag
gccacattca cgtatatgat accaacagta 900accaacctca gtgtgggtat
aagaaaccac ctatgacctg cttggtgctg atttgtgaac 960ccattcctca
cccatcaaat attgaaattc ctttagatag caagactttc ctcagtcgac
1020acagcctgga tatgaaattt tcttattgtg atgaaagaat taccgaattg
atgggatatg 1080agccagaaga acttttaggc cgctcaattt atgaatatta
tcatgctttg gactctgatc 1140atctgaccaa aactcatcat gatatgttta
ctaaaggaca agtcaccaca ggacagtaca 1200ggatgcttgc caaaagaggt
ggatatgtct gggttgaaac tcaagcaact gtcatatata 1260acaccaagaa
ttctcaacca cagtgcattg tatgtgtgaa ttacgttgtg agtggtatta
1320ttcagcacga cttgattttc tcccttcaac aaacagaatg tgtccttaaa
ccggttgaat 1380cttcagatat gaaaatgact cagctattca ccaaagttga
atcagaagat acaagtagcc 1440tctttgacaa acttaagaag gaacctgatg
ctttaacttt gctggcccca gccgctggag 1500acacaatcat atctttagat
tttggcagca acgacacaga aactgatgac cagcaacttg 1560aggaagtacc
attatataat gatgtaatgc tcccctcacc caacgaaaaa ttacagaata
1620taaatttggc aatgtctcca ttacccaccg ctgaaacgcc aaagccactt
cgaagtagtg 1680ctgaccctgc actcaatcaa gaagttgcat taaaattaga
accaaatcca gagtcactgg 1740aactttcttt taccatgccc cagattcagg
atcagacacc tagtccttcc gatggaagca 1800ctagacaaag ttcacctgag
cctaatagtc ccagtgaata ttgtttttat gtggatagtg 1860atatggtcaa
tgaattcaag ttggaattgg tagaaaaact ttttgctgaa gacacagaag
1920caaagaaccc attttctact caggacacag atttagactt ggagatgtta
gctccctata 1980tcccaatgga tgatgacttc cagttacgtt ccttcgatca
gttgtcacca ttagaaagca 2040gttccgcaag ccctgaaagc gcaagtcctc
aaagcacagt tacagtattc cagcagactc 2100aaatacaaga acctactgct
aatgccacca ctaccactgc caccactgat gaattaaaaa 2160cagtgacaaa
agaccgtatg gaagacatta aaatattgat tgcatctcca tctcctaccc
2220acatacataa agaaactact agtgccacat catcaccata tagagatact
caaagtcgga 2280cagcctcacc aaacagagca ggaaaaggag tcatagaaca
gacagaaaaa tctcatccaa 2340gaagccctaa cgtgttatct gtcgctttga
gtcaaagaac tacagttcct gaggaagaac 2400taaatccaaa gatactagct
ttgcagaatg ctcagagaaa gcgaaaaatg gaacatgatg 2460gttcactttt
tcaagcagta ggaattggaa cattattaca gcagccagac gatcatgcag
2520ctactacatc actttcttgg aaacgtgtaa aaggatgcaa atctagtgaa
cagaatggaa 2580tggagcaaaa gacaattatt ttaataccct ctgatttagc
atgtagactg ctggggcaat 2640caatggatga aagtggatta ccacagctga
ccagttatga ttgtgaagtt aatgctccta 2700tacaaggcag cagaaaccta
ctgcagggtg aagaattact cagagctttg gatcaagtta 2760actgagcttt
ttcttaattt cattcctttt tttggacact ggtggctcac tacctaaagc
2820agtctattta tattttctac atctaatttt agaagcctgg ctacaatact
gcacaaactt 2880ggttagttca atttttgatc ccctttctac ttaatttaca
ttaatgctct tttttagtat 2940gttctttaat gctggatcac agacagctca
ttttctcagt tttttggtat ttaaaccatt 3000gcattgcagt agcatcattt
taaaaaatgc acctttttat ttatttattt ttggctaggg 3060agtttatccc
tttttcgaat tatttttaag aagatgccaa tataattttt gtaagaaggc
3120agtaaccttt catcatgatc ataggcagtt gaaaaatttt tacacctttt
ttttcacatt 3180ttacataaat aataatgctt tgccagcagt acgtggtagc
cacaattgca caatatattt 3240tcttaaaaaa taccagcagt tactcatgga
atatattctg cgtttataaa actagttttt 3300aagaagaaat tttttttggc
ctatgaaatt gttaaacctg gaacatgaca ttgttaatca 3360tataataatg
attcttaaat gctgtatggt ttattattta aatgggtaaa gccatttaca
3420taatatagaa agatatgcat atatctagaa ggtatgtggc atttatttgg
ataaaattct 3480caattcagag aaatcatctg atgtttctat agtcactttg
ccagctcaaa agaaaacaat 3540accctatgta gttgtggaag tttatgctaa
tattgtgtaa ctgatattaa acctaaatgt 3600tctgcctacc ctgttggtat
aaagatattt tgagcagact gtaaacaaga aaaaaaaaat 3660catgcattct
tagcaaaatt gcctagtatg ttaatttgct caaaatacaa tgtttgattt
3720tatgcacttt gtcgctatta acatcctttt tttcatgtag atttcaataa
ttgagtaatt 3780ttagaagcat tattttagga atatatagtt gtcacagtaa
atatcttgtt ttttctatgt 3840acattgtaca aatttttcat tccttttgct
ctttgtggtt ggatctaaca ctaactgtat 3900tgttttgtta catcaaataa
acatcttctg tggaccagga aaaaaaaaaa aaaaaaaa 395833812DNAHomo sapiens
3gtgctgcctc gtctgagggg acaggaggat caccctcttc gtcgcttcgg ccagtgtgtc
60gggctgggcc ctgacaagcc acctgaggag aggctcggag ccgggcccgg accccggcga
120ttgccgcccg cttctctcta gtctcacgag gggtttcccg cctcgcaccc
ccacctctgg 180acttgccttt ccttctcttc tccgcgtgtg gagggagcca
gcgcttaggc cggagcgagc 240ctgggggccg cccgccgtga agacatcgcg
gggaccgatt caccatggag ggcgccggcg 300gcgcgaacga caagaaaaag
ataagttctg aacgtcgaaa agaaaagtct cgagatgcag 360ccagatctcg
gcgaagtaaa gaatctgaag ttttttatga gcttgctcat cagttgccac
420ttccacataa tgtgagttcg catcttgata aggcctctgt gatgaggctt
accatcagct 480atttgcgtgt gaggaaactt ctggatgctg gtgatttgga
tattgaagat gacatgaaag 540cacagatgaa ttgcttttat ttgaaagcct
tggatggttt tgttatggtt ctcacagatg 600atggtgacat gatttacatt
tctgataatg tgaacaaata catgggatta actcagtttg 660aactaactgg
acacagtgtg tttgatttta ctcatccatg tgaccatgag gaaatgagag
720aaatgcttac acacagaaat ggccttgtga aaaagggtaa agaacaaaac
acacagcgaa 780gcttttttct cagaatgaag tgtaccctaa ctagccgagg
aagaactatg aacataaagt 840ctgcaacatg gaaggtattg cactgcacag
gccacattca cgtatatgat accaacagta 900accaacctca gtgtgggtat
aagaaaccac ctatgacctg cttggtgctg atttgtgaac 960ccattcctca
cccatcaaat attgaaattc ctttagatag caagactttc ctcagtcgac
1020acagcctgga tatgaaattt tcttattgtg atgaaagaat taccgaattg
atgggatatg 1080agccagaaga acttttaggc cgctcaattt atgaatatta
tcatgctttg gactctgatc 1140atctgaccaa aactcatcat gatatgttta
ctaaaggaca agtcaccaca ggacagtaca 1200ggatgcttgc caaaagaggt
ggatatgtct gggttgaaac tcaagcaact gtcatatata 1260acaccaagaa
ttctcaacca cagtgcattg tatgtgtgaa ttacgttgtg agtggtatta
1320ttcagcacga cttgattttc tcccttcaac aaacagaatg tgtccttaaa
ccggttgaat 1380cttcagatat gaaaatgact cagctattca ccaaagttga
atcagaagat acaagtagcc 1440tctttgacaa acttaagaag gaacctgatg
ctttaacttt gctggcccca gccgctggag 1500acacaatcat atctttagat
tttggcagca acgacacaga aactgatgac cagcaacttg 1560aggaagtacc
attatataat gatgtaatgc tcccctcacc caacgaaaaa ttacagaata
1620taaatttggc aatgtctcca ttacccaccg ctgaaacgcc aaagccactt
cgaagtagtg 1680ctgaccctgc actcaatcaa gaagttgcat taaaattaga
accaaatcca gagtcactgg 1740aactttcttt taccatgccc cagattcagg
atcagacacc tagtccttcc gatggaagca 1800ctagacaaag ttcacctgag
cctaatagtc ccagtgaata ttgtttttat gtggatagtg 1860atatggtcaa
tgaattcaag ttggaattgg tagaaaaact ttttgctgaa gacacagaag
1920caaagaaccc attttctact caggacacag atttagactt ggagatgtta
gctccctata 1980tcccaatgga tgatgacttc cagttacgtt ccttcgatca
gttgtcacca ttagaaagca 2040gttccgcaag ccctgaaagc gcaagtcctc
aaagcacagt tacagtattc cagcagactc 2100aaatacaaga acctactgct
aatgccacca ctaccactgc caccactgat gaattaaaaa 2160cagtgacaaa
agaccgtatg gaagacatta aaatattgat tgcatctcca tctcctaccc
2220acatacataa agaaactact agtgccacat catcaccata tagagatact
caaagtcgga 2280cagcctcacc aaacagagca ggaaaaggag tcatagaaca
gacagaaaaa tctcatccaa 2340gaagccctaa cgtgttatct gtcgctttga
gtcaaagaac tacagttcct gaggaagaac 2400taaatccaaa gatactagct
ttgcagaatg ctcagagaaa gcgaaaaatg gaacatgatg 2460gttcactttt
tcaagcagta ggaattattt agcatgtaga ctgctggggc aatcaatgga
2520tgaaagtgga ttaccacagc tgaccagtta tgattgtgaa gttaatgctc
ctatacaagg 2580cagcagaaac ctactgcagg gtgaagaatt actcagagct
ttggatcaag ttaactgagc 2640tttttcttaa tttcattcct ttttttggac
actggtggct cactacctaa agcagtctat 2700ttatattttc tacatctaat
tttagaagcc tggctacaat actgcacaaa cttggttagt 2760tcaatttttg
atcccctttc tacttaattt acattaatgc tcttttttag tatgttcttt
2820aatgctggat cacagacagc tcattttctc agttttttgg tatttaaacc
attgcattgc 2880agtagcatca ttttaaaaaa tgcacctttt tatttattta
tttttggcta gggagtttat 2940ccctttttcg aattattttt aagaagatgc
caatataatt tttgtaagaa ggcagtaacc 3000tttcatcatg atcataggca
gttgaaaaat ttttacacct tttttttcac attttacata 3060aataataatg
ctttgccagc agtacgtggt agccacaatt gcacaatata ttttcttaaa
3120aaataccagc agttactcat ggaatatatt ctgcgtttat aaaactagtt
tttaagaaga 3180aatttttttt ggcctatgaa attgttaaac ctggaacatg
acattgttaa tcatataata 3240atgattctta aatgctgtat ggtttattat
ttaaatgggt aaagccattt acataatata 3300gaaagatatg catatatcta
gaaggtatgt ggcatttatt tggataaaat tctcaattca 3360gagaaatcat
ctgatgtttc tatagtcact ttgccagctc aaaagaaaac aataccctat
3420gtagttgtgg aagtttatgc taatattgtg taactgatat taaacctaaa
tgttctgcct 3480accctgttgg tataaagata ttttgagcag actgtaaaca
agaaaaaaaa aatcatgcat 3540tcttagcaaa attgcctagt atgttaattt
gctcaaaata caatgtttga ttttatgcac 3600tttgtcgcta ttaacatcct
ttttttcatg tagatttcaa taattgagta attttagaag 3660cattatttta
ggaatatata gttgtcacag taaatatctt gttttttcta tgtacattgt
3720acaaattttt cattcctttt gctctttgtg gttggatcta acactaactg
tattgttttg 3780ttacatcaaa taaacatctt ctgtggacca gg
381243718DNARattus norvegicus 4gacaccgcgg gcaccgattc gccatggagg
gcgccggcgg cgagaacgag aagaaaaata 60ggatgagttc cgaacgtcga aaagaaaagt
ctagggatgc agcacgatct cggcgaagca 120aagagtctga agttttttat
gagcttgctc atcagttgcc acttccccac aacgtgagct 180cccatcttga
taaagcttct gttatgaggc tcaccatcag ttacttacgt gtgaggaaac
240ttctaggtgc tggtgatctt gacattgaag atgaaatgaa agcacagatg
aactgctttt 300atctgaaagc cctggatggc tttgttatgg tgctaacaga
tgatggtgac atgatttaca 360tttctgataa cgtgaacaaa tacatggggt
tgactcagtt tgaactaact ggacacagtg 420tgtttgattt tacccatcca
tgtgaccatg aggaaatgag agaaatgctt acacacagaa 480atggcccagt
gagaaagggg aaagaacaaa acacgcagcg aagctttttt ctcagaatga
540aatgtaccct aacaagccgg gggaggacga tgaacatcaa gtcagcaacg
tggaaggtgc 600tgcactgcac aggccacatt catgtgtatg ataccagcag
taaccagccg cagtgtggct 660acaagaaacc gcctatgacg tgcttggtgc
tgatttgtga acccattcct catccatcaa 720acattgaaat tcctttagac
agcaagacat ttctcagtcg acacagcctc gatatgaaat 780tttcttactg
tgatgaaagg attactgagt tgatgggtta tgagccagaa gaacttttgg
840gccgttcaat ttatgaatat tatcatgctt tggactctga tcatctgacc
aaaactcatc 900atgacatgtt tactaaagga caagtcacca caggacagta
caggatgctt gcaaaaagag 960gtggatatgt ctgggttgag actcaagcaa
ctgttatata taatacgaag aactctcagc 1020cacagtgcat tgtgtgtgtg
aattatgttg taagtggtat tattcagcac gacttgattt 1080tctcccttca
acaaacagaa tctgtcctca aaccagttga atcttcagat atgaaaatga
1140cccagctgtt cactaaagtg gaatctgagg acacgagctg cctcttcgac
aagcttaaga 1200aagagcccga tgccctgact ctgctagctc cagcggctgg
ggacacgatc atatcactgg 1260acttcggcag cgatgacacg gaaactgaag
accaacaact tgaagatgtc ccgttgtaca 1320atgatgtaat gttcccctct
tctaatgaga aattaaatat aaatctggca atgtctccat 1380tacctgcctc
tgaaactcca aagccacttc gaagtagtgc tgatcctgca ctgaatcaag
1440aggttgcatt gaagttagag tcaagcccag agtcactggg actttctttt
accatgcccc 1500agattcaaga tcagccagca agtccttctg atggaagcac
tagacaaagc tcacctgagc 1560ctaacagtcc cagtgagtac tgctttgatg
tggacagcga tatggtcaat gtattcaagt 1620tggaactggt ggaaaaactg
tttgctgaag acacagaagc gaagaatcca ttttcagctc 1680aggacactga
tttagacttg gaaatgctgg ctccctatat cccaatggat gatgatttcc
1740agttacgttc ctttgatcag ttgtcaccat tagagagcaa ttctccaagc
cctccgagtg 1800tgagcacagt tacaggattc cagcagaccc agttacagaa
acctaccatc actgtcactg 1860ccaccgcaac tgccaccact gatgaatcaa
aagcagtgac gaaggacaat atagaagaca 1920ttaaaatact gattgcatct
ccaccttcta cccaagtacc tcaagaaatg accactgcta 1980aggcatcagc
atacagtggt actcacagtc ggacagcctc accagacaga gcaggaaaga
2040gagtcataga aaaaacagac aaagctcatc caaggagcct taacctatct
gtcactttga 2100atcaaagaaa tactgttcct gaagaagaat taaacccaaa
gacaatagct ttgcagaatg 2160ctcagaggaa gcgaaaaatg gaacatgatg
gctccctttt tcaagcagca ggaattggaa 2220cgttactgca gcaaccaggt
gaccgtgccc ctactatgtc gctttcttgg aaacgagtga 2280aaggatacat
atctagtgaa caggatggaa tggagcagaa gacaattttt ttaataccct
2340ctgatttagc atgtagactg ctggggcagt caatggatga gagtggatta
ccacagctga 2400ccagttacga ttgtgaagtt aatgctccca tacaaggcag
cagaaaccta ctgcagggtg 2460aagaattact cagagctttg gatcaagtta
actgagcttt tcctaatctc attcctttga 2520ttgttaattt ttgtgttcag
ttgttgttgt tgtctgtggg gtttcgtttc tgttggttgt 2580tttggacact
ggtggctcag cagtctattt atattttcta tatctcattt agaggcctgg
2640ctacagtact gcaccaactc agatagttta gtttgggccc cttcctcctt
cattttcact 2700gatgctcttt ttaccatgtc cttcgaatgc cagatcacag
cacattcaca gctccccagc 2760atttcaccaa tgcattgctg tagtgtcgtt
taaaatgcac ctttttattt atttattttt 2820ggtgagggag tttgtccctt
attgaattat ttttaatgaa atgccaatat aattttttaa 2880gaaggcagta
aatcttcatc atgatgatag gcagttgaaa attttttact catttttttc
2940atgttttaca tgaaaataat gctttgccag cagtacatgg tagccacaat
tgcacaatat 3000attttcttaa aaataccagc agttactcat gcatatattc
tgcatttata aaactagttt 3060ttaagaagaa actttttttg gcctatggaa
ttgttaagcc tggatcatga tgctgttgat 3120cttataatga ttcttaaact
gtatggtttc tttatatggg taaagccatt tacatgatat 3180agagagatat
gcttatatct ggaaggtata tggcatttat ttggataaaa ttctcaattg
3240agaagttatc tggtgtttct ttactttacc ggctcaaaag aaaacagtcc
ctatgtagtt 3300gtggaagctt atgctaatat tgtgtaattg atattaaaca
ttaaatgttc tgcctatcct 3360gttggtataa agacattttg agcatactgt
aaacaaaaaa atcatgcatt gttagtaaaa 3420ttgcctagta tgttaatttg
ttgaaaatac gatgtttggt tttatgcact ttgtcgctat 3480taacatcctt
tttttcatat agatttcaat aattgagtaa ttttagaagc attattttag
3540aaatatagag ttgtcatagt aaacatcttg tttttttttc tttttttcta
tgtacattgt 3600ataaattttt cattcccttg ctctttgtag ttgggtctaa
cactaactgt actgttttgt 3660tatatcaaat aaacatcttc tgtggaccag
gaaaaaaaaa aaaaaaaaaa aaaaaaaa 371853973DNAMus musculus 5cgcgaggact
gtcctcgccg ccgtcgcggg cagtgtctag ccaggccttg acaagctagc 60cggaggagcg
cctaggaacc cgagccggag ctcagcgagc gcagcctgca cgcccgcctc
120gcgtcccggg ggggtcccgc ctcccacccc gcctctggac ttgtctcttt
ccccgcgcgc 180gcggacagag ccggcgttta ggcccgagcg agcccggggg
ccgccggccg ggaagacaac 240gcgggcaccg attcgccatg gagggcgccg
gcggcgagaa cgagaagaaa aagatgagtt 300ctgaacgtcg aaaagaaaag
tctagagatg cagcaagatc tcggcgaagc aaagagtctg 360aagtttttta
tgagcttgct catcagttgc cacttcccca caatgtgagc tcacatcttg
420ataaagcttc
tgttatgagg ctcaccatca gttatttacg tgtgagaaaa cttctggatg
480ccggtggtct agacagtgaa gatgagatga aggcacagat ggactgtttt
tatctgaaag 540ccctagatgg ctttgtgatg gtgctaacag atgacggcga
catggtttac atttctgata 600acgtgaacaa atacatgggg ttaactcagt
ttgaactaac tggacacagt gtgtttgatt 660ttactcatcc atgtgaccat
gaggaaatga gagaaatgct tacacacaga aatggcccag 720tgagaaaagg
gaaagaacta aacacacagc ggagcttttt tctcagaatg aagtgcaccc
780taacaagccg ggggaggacg atgaacatca agtcagcaac gtggaaggtg
cttcactgca 840cgggccatat tcatgtctat gataccaaca gtaaccaacc
tcagtgtggg tacaagaaac 900cacccatgac gtgcttggtg ctgatttgtg
aacccattcc tcatccgtca aatattgaaa 960ttcctttaga tagcaagaca
tttctcagtc gacacagcct cgatatgaaa ttttcttact 1020gtgatgaaag
aattactgag ttgatgggtt atgagccgga agaacttttg ggccgctcaa
1080tttatgaata ttatcatgct ttggattctg atcatctgac caaaactcac
catgatatgt 1140ttactaaagg acaagtcacc acaggacagt acaggatgct
tgccaaaaga ggtggatatg 1200tctgggttga aactcaagca actgtcatat
ataatacgaa gaactcccag ccacagtgca 1260ttgtgtgtgt gaattatgtt
gtaagtggta ttattcagca cgacttgatt ttctcccttc 1320aacaaacaga
atctgtgctc aaaccagttg aatcttcaga tatgaagatg actcagctgt
1380tcaccaaagt tgaatcagag gatacaagct gcctttttga taagcttaag
aaggagcctg 1440atgctctcac tctgctggct ccagctgccg gcgacaccat
catctctctg gattttggca 1500gcgatgacac agaaactgaa gatcaacaac
ttgaagatgt tccattatat aatgatgtaa 1560tgtttccctc ttctaatgaa
aaattaaata taaacctggc aatgtctcct ttaccttcat 1620cggaaactcc
aaagccactt cgaagtagtg ctgatcctgc actgaatcaa gaggttgcat
1680taaaattaga atcaagtcca gagtcactgg gactttcttt taccatgccc
cagattcaag 1740atcagccagc aagtccttct gatggaagca ctagacaaag
ttcacctgag agacttcttc 1800aggaaaacgt aaacactcct aacttttccc
agcctaacag tcccagtgaa tattgctttg 1860atgtggatag cgatatggtc
aatgtattca agttggaact ggtggaaaaa ctgtttgctg 1920aagacacaga
ggcaaagaat ccattttcaa ctcaggacac tgatttagat ttggagatgc
1980tggctcccta tatcccaatg gatgatgatt tccagttacg ttcctttgat
cagttgtcac 2040cattagagag caattctcca agccctccaa gtatgagcac
agttactggg ttccagcaga 2100cccagttaca gaaacctacc atcactgcca
ctgccaccac aactgccacc actgatgaat 2160caaaaacaga gacgaaggac
aataaagaag atattaaaat actgattgca tctccatctt 2220ctacccaagt
acctcaagaa acgaccactg ctaaggcatc agcatacagt ggcactcaca
2280gtcggacagc ctcaccagac agagcaggaa agagagtcat agaacagaca
gacaaagctc 2340atccaaggag ccttaagctg tctgccactt tgaatcaaag
aaatactgtt cctgaggaag 2400aattaaaccc aaagacaata gcttcgcaga
atgctcagag gaagcgaaaa atggaacatg 2460atggctccct ttttcaagca
gcaggaattg gaacattatt gcagcaacca ggtgactgtg 2520cacctactat
gtcactttcc tggaaacgag tgaaaggatt catatctagt gaacagaatg
2580gaacggagca aaagactatt attttaatac cctccgattt agcatgcaga
ctgctggggc 2640agtcaatgga tgagagtgga ttaccacagc tgaccagtta
cgattgtgaa gttaatgctc 2700ccatacaagg cagcagaaac ctactgcagg
gtgaagaatt actcagagct ttggatcaag 2760ttaactgagc gtttcctaat
ctcattcctt ttgattgtta atgtttttgt tcagttgttg 2820ttgtttgttg
ggtttttgtt tctgttggtt atttttggac actggtggct cagcagtcta
2880tttatatttt ctatatctaa ttttagaagc ctggctacaa tactgcacaa
actcagatag 2940tttagttttc atcccctttc tacttaattt tcattaatgc
tctttttaat atgttctttt 3000aatgccagat cacagcacat tcacagctcc
tcagcatttc accattgcat tgctgtagtg 3060tcatttaaaa tgcacctttt
tatttattta tttttggtga gggagtttgt cccttattga 3120attattttta
atgaaatgcc aatataattt tttaagaaag cagtaaattc tcatcatgat
3180cataggcagt tgaaaacttt ttactcattt ttttcatgtt ttacatgaaa
ataatgcttt 3240gtcagcagta catggtagcc acaattgcac aatatatttt
ctttaaaaaa ccagcagtta 3300ctcatgcaat atattctgca tttataaaac
tagtttttaa gaaatttttt ttggcctatg 3360gaattgttaa gcctggatca
tgaagcgttg atcttataat gattcttaaa ctgtatggtt 3420tctttatatg
ggtaaagcca tttacatgat ataaagaaat atgcttatat ctggaaggta
3480tgtggcattt atttggataa aattctcaat tcagagaagt tatctggtgt
ttcttgactt 3540taccaactca aaacagtccc tctgtagttg tggaagctta
tgctaatatt gtgtaattga 3600ttatgaaaca taaatgttct gcccaccctg
ttggtataaa gacattttga gcatactgta 3660aacaaacaaa caaaaaatca
tgctttgtta gtaaaattgc ctagtatgtt gatttgttga 3720aaatatgatg
tttggtttta tgcactttgt cgctattaac atcctttttt catatagatt
3780tcaataagtg agtaatttta gaagcattat tttaggaata tagagttgtc
atagtaaaca 3840tcttgttttt tctatgtaca ctgtataaat ttttcgttcc
cttgctcttt gtggttgggt 3900ctaacactaa ctgtactgtt ttgttatatc
aaataaacat cttctgtgga ccaggaaaaa 3960aaaaaaaaaa aaa
3973621DNAArtificial Sequencetarget sequence 6aactggacac agtgtgtttg
a 21723RNAArtificial SequencesiRNA sense strand 7aacuaacugg
acacagugug uuu 23823RNAArtificial SequencesiRNA antisense strand
8acacacugug uccaguuagu uuu 23923DNAArtificial SequencesiRNA sense
strand 9aacuaacugg acacagugug utt 231023DNAArtificial SequencesiRNA
antisense strand 10acacacugug uccaguuagu utt 231121DNAArtificial
Sequencetarget sequence 11aactaactgg acacagtgtg t
211217DNAArtificial Sequencetarget sequence 12cgacaagaaa aagataa
171317DNAArtificial Sequencetarget sequence 13aaagataagt tctgaac
171417DNAArtificial Sequencetarget sequence 14agataagttc tgaacgt
171517DNAArtificial Sequencetarget sequence 15gttctgaacg tcgaaaa
171617DNAArtificial Sequencetarget sequence 16aagaaaagtc tcgagat
171717DNAArtificial Sequencetarget sequence 17gaaaagtctc gagatgc
171817DNAArtificial Sequencetarget sequence 18agtctcgaga tgcagcc
171917DNAArtificial Sequencetarget sequence 19gtaaagaatc tgaagtt
172017DNAArtificial Sequencetarget sequence 20gaatctgaag tttttta
172117DNAArtificial Sequencetarget sequence 21gttttttatg agcttgc
172217DNAArtificial Sequencetarget sequence 22ggcctctgtg atgaggc
172317DNAArtificial Sequencetarget sequence 23cttctggatg ctggtga
172417DNAArtificial Sequencetarget sequence 24agcacagatg aattgct
172521DNAArtificial Sequencetarget sequence 25aaatgcttac acacagaaat
g 212617DNAArtificial Sequencetarget sequence 26gaaaaagata agttctg
172717DNAArtificial Sequencetarget sequence 27aagataagtt ctgaacg
172817DNAArtificial Sequencetarget sequence 28gataagttct gaacgtc
172917DNAArtificial Sequencetarget sequence 29cgtcgaaaag aaaagtc
173017DNAArtificial Sequencetarget sequence 30agaaaagtct cgagatg
173117DNAArtificial Sequencetarget sequence 31aagtctcgag atgcagc
173217DNAArtificial Sequencetarget sequence 32gtctcgagat gcagcca
173317DNAArtificial Sequencetarget sequence 33agaatctgaa gtttttt
173417DNAArtificial Sequencetarget sequence 34tctgaagttt tttatga
173517DNAArtificial Sequencetarget sequence 35tgtgagttcg catcttg
173617DNAArtificial Sequencetarget sequence 36acttctggat gctggtg
173717DNAArtificial Sequencetarget sequence 37gatgacatga aagcaca
173817DNAArtificial Sequencetarget sequence 38gcacagatga attgctt
173921DNAArtificial Sequencetarget sequence 39aagtttttta tgagcttgct
c 214021DNAArtificial Sequencetarget sequence 40aagtttttta
tgagcttgct c 214121DNAArtificial Sequencetarget sequence
41aaggcctctg tgatgaggct t 214221DNAArtificial Sequencetarget
sequence 42aaacttctgg atgctggtga t 214321DNAArtificial
Sequencetarget sequence 43aacttctgga tgctggtgat t
214421DNAArtificial Sequencetarget sequence 44aagatgacat gaaagcacag
a 214521DNAArtificial Sequencetarget sequence 45aaagcacaga
tgaattgctt t 214621DNAArtificial Sequencetarget sequence
46aagcacagat gaattgcttt t 214721DNAArtificial Sequencetarget
sequence 47aattgctttt atttgaaagc c 214821DNAArtificial
Sequencetarget sequence 48aaagccttgg atggttttgt t
214921DNAArtificial Sequencetarget sequence 49aagccttgga tggttttgtt
a 215021DNAArtificial Sequencetarget sequence 50aatgtgaaca
aatacatggg a 215121DNAArtificial Sequencetarget sequence
51aacaaataca tgggattaac t 215221DNAArtificial Sequencetarget
sequence 52aaatacatgg gattaactca g 215321DNAArtificial
Sequencetarget sequence 53aaatacatgg gattaactca g
215421DNAArtificial Sequencetarget sequence 54aactcagttt gaactaactg
g 215521DNAArtificial Sequencetarget sequence 55aactaactgg
acacagtgtg t 215621DNAArtificial Sequencetarget sequence
56aactggacac agtgtgtttg a 215721DNAArtificial Sequencetarget
sequence 57aaatgagaga aatgcttaca c 215821DNAArtificial
Sequencetarget sequence 58aatgagagaa atgcttacac a
215921DNAArtificial Sequencetarget sequence 59aaatgcttac acacagaaat
g 216021DNAArtificial Sequencetarget sequence 60aatgcttaca
cacagaaatg g 216121DNAArtificial Sequencetarget sequence
61aaatggcctt gtgaaaaagg g 216221DNAArtificial Sequencetarget
sequence 62aatggccttg tgaaaaaggg t 216321DNAArtificial
Sequencetarget sequence 63aaaaagggta aagaacaaaa c
216421DNAArtificial Sequencetarget sequence 64aaaagggtaa agaacaaaac
a 216521DNAArtificial Sequencetarget sequence 65aaagggtaaa
gaacaaaaca c 216621DNAArtificial Sequencetarget sequence
66aagggtaaag aacaaaacac a 216721DNAArtificial Sequencetarget
sequence 67aaagaacaaa acacacagcg a 216821DNAArtificial
Sequencetarget sequence 68aagaacaaaa cacacagcga a
216921DNAArtificial Sequencetarget sequence 69aacaaaacac acagcgaagc
t 217021DNAArtificial Sequencetarget sequence 70aacaaaacac
acagcgaagc t 217121DNAArtificial Sequencetarget sequence
71aaacacacag cgaagctttt t 217221DNAArtificial Sequencetarget
sequence 72aacacacagc gaagcttttt t 217321DNAArtificial
Sequencetarget sequence 73aagctttttt ctcagaatga a
217421DNAArtificial Sequencetarget sequence 74aatgaagtgt accctaacta
g 217521DNAArtificial Sequencetarget sequence 75aagtgtaccc
taactagccg a 217621DNAArtificial Sequencetarget sequence
76aactagccga ggaagaacta t 217721DNAArtificial Sequencetarget
sequence 77aagaactatg aacataaagt c 217821DNAArtificial
Sequencetarget sequence 78aactatgaac ataaagtctg c
217921DNAArtificial Sequencetarget sequence 79aacataaagt ctgcaacatg
g 218021DNAArtificial Sequencetarget sequence 80aaagtctgca
acatggaagg t 218121DNAArtificial Sequencetarget sequence
81aagtctgcaa catggaaggt a 218221DNAArtificial Sequencetarget
sequence 82aacatggaag gtattgcact g 218321DNAArtificial
Sequencetarget sequence 83aaggtattgc actgcacagg c
218421DNAArtificial Sequencetarget sequence 84aacagtaacc aacctcagtg
t 218521DNAArtificial Sequencetarget sequence 85aaccaacctc
agtgtgggta t 218621DNAArtificial Sequencetarget sequence
86aacctcagtg tgggtataag a 218721DNAArtificial Sequencetarget
sequence 87aagaaaccac ctatgacctg c 218821DNAArtificial
Sequencetarget sequence 88aagaaaccac ctatgacctg c
218921DNAArtificial Sequencetarget sequence 89aaccacctat gacctgcttg
g 219021DNAArtificial Sequencetarget sequence 90aacccattcc
tcacccatca a 219121DNAArtificial Sequencetarget sequence
91aaatattgaa attcctttag a 219221DNAArtificial Sequencetarget
sequence 92aatattgaaa ttcctttaga t 219321DNAArtificial
Sequencetarget sequence 93aaattccttt agatagcaag a
219421DNAArtificial Sequencetarget sequence 94aattccttta gatagcaaga
c 219521DNAArtificial Sequencetarget sequence 95aagactttcc
tcagtcgaca c 219621DNAArtificial Sequencetarget sequence
96aaattttctt attgtgatga a 219721DNAArtificial Sequencetarget
sequence 97aattttctta ttgtgatgaa a 219821DNAArtificial
Sequencetarget sequence 98aaagaattac cgaattgatg g
219921DNAArtificial Sequencetarget sequence 99aattaccgaa ttgatgggat
a 2110021DNAArtificial Sequencetarget sequence 100aattaccgaa
ttgatgggat a 2110121DNAArtificial Sequencetarget sequence
101aagaactttt aggccgctca a 2110221DNAArtificial Sequencetarget
sequence 102aacttttagg ccgctcaatt t 2110321DNAArtificial
Sequencetarget sequence 103aatttatgaa tattatcatg c
2110421DNAArtificial Sequencetarget sequence 104aatattatca
tgctttggac t 2110521DNAArtificial Sequencetarget sequence
105aaaactcatc atgatatgtt t 2110621DNAArtificial Sequencetarget
sequence 106aaactcatca tgatatgttt a 2110721DNAArtificial
Sequencetarget sequence 107aactcatcat gatatgttta c
2110821DNAArtificial Sequencetarget sequence 108aaaggacaag
tcaccacagg a 2110921DNAArtificial Sequencetarget sequence
109aaggacaagt caccacagga c 2111021DNAArtificial Sequencetarget
sequence 110aagtcaccac aggacagtac a 2111121DNAArtificial
Sequencetarget sequence 111aaaagaggtg gatatgtctg g
2111221DNAArtificial Sequencetarget sequence 112aaagaggtgg
atatgtctgg g 2111321DNAArtificial Sequencetarget sequence
113aagaggtgga tatgtctggg t 2111421DNAArtificial Sequencetarget
sequence 114aaactcaagc aactgtcata t 2111521DNAArtificial
Sequencetarget sequence 115aactcaagca actgtcatat a
2111621DNAArtificial Sequencetarget sequence 116aagcaactgt
catatataac a 2111721DNAArtificial Sequencetarget sequence
117aactgtcata tataacacca a 2111821DNAArtificial Sequencetarget
sequence 118aacaccaaga attctcaacc a 2111921DNAArtificial
Sequencetarget sequence 119aagaattctc aaccacagtg c
2112021DNAArtificial Sequencetarget sequence 120aattctcaac
cacagtgcat t
2112121DNAArtificial Sequencetarget sequence 121aaccacagtg
cattgtatgt g 2112221DNAArtificial Sequencetarget sequence
122aattacgttg tgagtggtat t 2112321DNAArtificial Sequencetarget
sequence 123aacaaacaga atgtgtcctt a 2112421DNAArtificial
Sequencetarget sequence 124aaacagaatg tgtccttaaa c
2112521DNAArtificial Sequencetarget sequence 125aacagaatgt
gtccttaaac c 2112620DNAArtificial Sequencetarget sequence
126atgtgtcctt aaaccggttg 2012721DNAArtificial Sequencetarget
sequence 127aaaccggttg aatcttcaga t 2112821DNAArtificial
Sequencetarget sequence 128aaccggttga atcttcagat a
2112921DNAArtificial Sequencetarget sequence 129aatcttcaga
tatgaaaatg a 2113021DNAArtificial Sequencetarget sequence
130aaaatgactc agctattcac c 2113121DNAArtificial Sequencetarget
sequence 131aaatgactca gctattcacc a 2113221DNAArtificial
Sequencetarget sequence 132aatgactcag ctattcacca a
2113321DNAArtificial Sequencetarget sequence 133aaagttgaat
cagaagatac a 2113421DNAArtificial Sequencetarget sequence
134aagttgaatc agaagataca a 2113521DNAArtificial Sequencetarget
sequence 135aatcagaaga tacaagtagc c 2113621DNAArtificial
Sequencetarget sequence 136aagatacaag tagcctcttt g
2113721DNAArtificial Sequencetarget sequence 137aagtagcctc
tttgacaaac t 2113821DNAArtificial Sequencetarget sequence
138aaacttaaga aggaacctga t 2113921DNAArtificial Sequencetarget
sequence 139aacttaagaa ggaacctgat g 2114021DNAArtificial
Sequencetarget sequence 140aagaaggaac ctgatgcttt a
2114121DNAArtificial Sequencetarget sequence 141aaggaacctg
atgctttaac t 2114221DNAArtificial Sequencetarget sequence
142aacctgatgc tttaactttg c 2114321DNAArtificial Sequencetarget
sequence 143aactttgctg gccccagccg c 2114421DNAArtificial
Sequencetarget sequence 144aatcatatct ttagattttg g
2114521DNAArtificial Sequencetarget sequence 145aacgacacag
aaactgatga c 2114621DNAArtificial Sequencetarget sequence
146aaactgatga ccagcaactt g 2114721DNAArtificial Sequencetarget
sequence 147aactgatgac cagcaacttg a 2114821DNAArtificial
Sequencetarget sequence 148aacttgagga agtaccatta t
2114921DNAArtificial Sequencetarget sequence 149aagtaccatt
atataatgat g 2115021DNAArtificial Sequencetarget sequence
150aatgatgtaa tgctcccctc a 2115121DNAArtificial Sequencetarget
sequence 151aatgctcccc tcacccaacg a 2115221DNAArtificial
Sequencetarget sequence 152aacgaaaaat tacagaatat a
2115321DNAArtificial Sequencetarget sequence 153aaaaattaca
gaatataaat t 2115421DNAArtificial Sequencetarget sequence
154aaaattacag aatataaatt t 2115521DNAArtificial Sequencetarget
sequence 155aaattacaga atataaattt g 2115621DNAArtificial
Sequencetarget sequence 156aattacagaa tataaatttg g
2115721DNAArtificial Sequencetarget sequence 157aatataaatt
tggcaatgtc t 2115821DNAArtificial Sequencetarget sequence
158aaatttggca atgtctccat t 2115921DNAArtificial Sequencetarget
sequence 159aatttggcaa tgtctccatt a 2116021DNAArtificial
Sequencetarget sequence 160aatgtctcca ttacccaccg c
2116121DNAArtificial Sequencetarget sequence 161aaacgccaaa
gccacttcga a 2116221DNAArtificial Sequencetarget sequence
162aacgccaaag ccacttcgaa g 2116321DNAArtificial Sequencetarget
sequence 163aaagccactt cgaagtagtg c 2116421DNAArtificial
Sequencetarget sequence 164aagccacttc gaagtagtgc t
2116521DNAArtificial Sequencetarget sequence 165aagtagtgct
gaccctgcac t 2116621DNAArtificial Sequencetarget sequence
166aatcaagaag ttgcattaaa a 2116721DNAArtificial Sequencetarget
sequence 167aagaagttgc attaaaatta g 2116821DNAArtificial
Sequencetarget sequence 168aagttgcatt aaaattagaa c
2116921DNAArtificial Sequencetarget sequence 169aaaattagaa
ccaaatccag a 2117021DNAArtificial Sequencetarget sequence
170aaattagaac caaatccaga g 2117121DNAArtificial Sequencetarget
sequence 171aattagaacc aaatccagag t 2117221DNAArtificial
Sequencetarget sequence 172aaccaaatcc agagtcactg g
2117321DNAArtificial Sequencetarget sequence 173aaatccagag
tcactggaac t 2117421DNAArtificial Sequencetarget sequence
174aatccagagt cactggaact t 2117521DNAArtificial Sequencetarget
sequence 175aactttcttt taccatgccc c 2117621DNAArtificial
Sequencetarget sequence 176aagcactaga caaagttcac c
2117721DNAArtificial Sequencetarget sequence 177aaagttcacc
tgagcctaat a 2117821DNAArtificial Sequencetarget sequence
178aagttcacct gagcctaata g 2117921DNAArtificial Sequencetarget
sequence 179aatagtccca gtgaatattg t 2118021DNAArtificial
Sequencetarget sequence 180aatattgttt ttatgtggat a
2118121DNAArtificial Sequencetarget sequence 181aatgaattca
agttggaatt g 2118221DNAArtificial Sequencetarget sequence
182aattcaagtt ggaattggta g 2118321DNAArtificial Sequencetarget
sequence 183aagttggaat tggtagaaaa a 2118421DNAArtificial
Sequencetarget sequence 184aattggtaga aaaacttttt g
2118521DNAArtificial Sequencetarget sequence 185aaaacttttt
gctgaagaca c 2118621DNAArtificial Sequencetarget sequence
186aaactttttg ctgaagacac a 2118721DNAArtificial Sequencetarget
sequence 187aactttttgc tgaagacaca g 2118821DNAArtificial
Sequencetarget sequence 188aagacacaga agcaaagaac c
2118921DNAArtificial Sequencetarget sequence 189aagcaaagaa
cccattttct a 2119021DNAArtificial Sequencetarget sequence
190aaagaaccca ttttctactc a 2119121DNAArtificial Sequencetarget
sequence 191aagaacccat tttctactca g 2119221DNAArtificial
Sequencetarget sequence 192aacccatttt ctactcagga c
2119321DNAArtificial Sequencetarget sequence 193aatggatgat
gacttccagt t 2119421DNAArtificial Sequencetarget sequence
194aaagcagttc cgcaagccct g 2119521DNAArtificial Sequencetarget
sequence 195aagcagttcc gcaagccctg a 2119621DNAArtificial
Sequencetarget sequence 196aagccctgaa agcgcaagtc c
2119721DNAArtificial Sequencetarget sequence 197aaagcgcaag
tcctcaaagc a 2119821DNAArtificial Sequencetarget sequence
198aagcgcaagt cctcaaagca c 2119921DNAArtificial Sequencetarget
sequence 199aagtcctcaa agcacagtta c 2120021DNAArtificial
Sequencetarget sequence 200aaagcacagt tacagtattc c
2120121DNAArtificial Sequencetarget sequence 201aagcacagtt
acagtattcc a 2120221DNAArtificial Sequencetarget sequence
202aaatacaaga acctactgct a 2120321DNAArtificial Sequencetarget
sequence 203aatacaagaa cctactgcta a 2120421DNAArtificial
Sequencetarget sequence 204aagaacctac tgctaatgcc a
2120521DNAArtificial Sequencetarget sequence 205aacctactgc
taatgccacc a 2120621DNAArtificial Sequencetarget sequence
206aatgccacca ctaccactgc c 2120721DNAArtificial Sequencetarget
sequence 207aattaaaaac agtgacaaaa g 2120821DNAArtificial
Sequencetarget sequence 208aaaaacagtg acaaaagacc g
2120921DNAArtificial Sequencetarget sequence 209aaaacagtga
caaaagaccg t 2121021DNAArtificial Sequencetarget sequence
210aaacagtgac aaaagaccgt a 2121121DNAArtificial Sequencetarget
sequence 211aacagtgaca aaagaccgta t 2121221DNAArtificial
Sequencetarget sequence 212aaaagaccgt atggaagaca t
2121321DNAArtificial Sequencetarget sequence 213aaagaccgta
tggaagacat t 2121421DNAArtificial Sequencetarget sequence
214aagaccgtat ggaagacatt a 2121521DNAArtificial Sequencetarget
sequence 215aagacattaa aatattgatt g 2121621DNAArtificial
Sequencetarget sequence 216aaaatattga ttgcatctcc a
2121721DNAArtificial Sequencetarget sequence 217aaatattgat
tgcatctcca t 2121821DNAArtificial Sequencetarget sequence
218aatattgatt gcatctccat c 2121921DNAArtificial Sequencetarget
sequence 219aaagaaacta ctagtgccac a 2122021DNAArtificial
Sequencetarget sequence 220aagaaactac tagtgccaca t
2122121DNAArtificial Sequencetarget sequence 221aaactactag
tgccacatca t 2122221DNAArtificial Sequencetarget sequence
222aactactagt gccacatcat c 2122321DNAArtificial Sequencetarget
sequence 223aaagtcggac agcctcacca a 2122421DNAArtificial
Sequencetarget sequence 224aagtcggaca gcctcaccaa a
2122521DNAArtificial Sequencetarget sequence 225aaacagagca
ggaaaaggag t 2122621DNAArtificial Sequencetarget sequence
226aacagagcag gaaaaggagt c 2122721DNAArtificial Sequencetarget
sequence 227aaaaggagtc atagaacaga c 2122821DNAArtificial
Sequencetarget sequence 228aaaggagtca tagaacagac a
2122921DNAArtificial Sequencetarget sequence 229aaggagtcat
agaacagaca g 2123021DNAArtificial Sequencetarget sequence
230aacagacaga aaaatctcat c 2123121DNAArtificial Sequencetarget
sequence 231aaaaatctca tccaagaagc c 2123221DNAArtificial
Sequencetarget sequence 232aaaatctcat ccaagaagcc c
2123321DNAArtificial Sequencetarget sequence 233aaatctcatc
caagaagccc t 2123421DNAArtificial Sequencetarget sequence
234aatctcatcc aagaagccct a 2123521DNAArtificial Sequencetarget
sequence 235aagaagccct aacgtgttat c 2123621DNAArtificial
Sequencetarget sequence 236aagccctaac gtgttatctg t
2123721DNAArtificial Sequencetarget sequence 237aacgtgttat
ctgtcgcttt g 2123821DNAArtificial Sequencetarget sequence
238aaagaactac agttcctgag g 2123921DNAArtificial Sequencetarget
sequence 239aagaactaca gttcctgagg a 2124021DNAArtificial
Sequencetarget sequence 240aactacagtt cctgaggaag a
2124121DNAArtificial Sequencetarget sequence 241aagaactaaa
tccaaagata c 2124221DNAArtificial Sequencetarget sequence
242aactaaatcc aaagatacta g 2124321DNAArtificial Sequencetarget
sequence 243aaatccaaag atactagctt t 2124421DNAArtificial
Sequencetarget sequence 244aatccaaaga tactagcttt g
2124521DNAArtificial Sequencetarget sequence 245aaagatacta
gctttgcaga a 2124621DNAArtificial Sequencetarget sequence
246aagatactag ctttgcagaa t 2124721DNAArtificial Sequencetarget
sequence 247aatgctcaga gaaagcgaaa a 2124821DNAArtificial
Sequencetarget sequence 248aaagcgaaaa atggaacatg a
2124921DNAArtificial Sequencetarget sequence 249aagcgaaaaa
tggaacatga t 2125021DNAArtificial Sequencetarget sequence
250aaaaatggaa catgatggtt c 2125121DNAArtificial Sequencetarget
sequence 251aaaatggaac atgatggttc a 2125221DNAArtificial
Sequencetarget sequence 252aaatggaaca tgatggttca c
2125321DNAArtificial Sequencetarget sequence 253aatggaacat
gatggttcac t 2125421DNAArtificial Sequencetarget sequence
254aacatgatgg ttcacttttt c 2125521DNAArtificial Sequencetarget
sequence 255aagcagtagg aattggaaca t 2125621DNAArtificial
Sequencetarget sequence 256aattggaaca ttattacagc a
2125721DNAArtificial Sequencetarget sequence 257aacattatta
cagcagccag a 2125821DNAArtificial Sequencetarget sequence
258aaacgtgtaa aaggatgcaa a 2125921DNAArtificial Sequencetarget
sequence 259aacgtgtaaa aggatgcaaa t 2126021DNAArtificial
Sequencetarget sequence 260aaaaggatgc aaatctagtg a
2126121DNAArtificial Sequencetarget sequence 261aaaggatgca
aatctagtga a 2126221DNAArtificial Sequencetarget sequence
262aaggatgcaa atctagtgaa c 2126321DNAArtificial Sequencetarget
sequence 263aaatctagtg aacagaatgg a 2126421DNAArtificial
Sequencetarget sequence 264aatctagtga acagaatgga a
2126521DNAArtificial Sequencetarget sequence 265aacagaatgg
aatggagcaa a 2126621DNAArtificial Sequencetarget sequence
266aatggaatgg agcaaaagac a 2126721DNAArtificial Sequencetarget
sequence 267aatggagcaa aagacaatta t 2126821DNAArtificial
Sequencetarget sequence 268aaaagacaat tattttaata c
2126921DNAArtificial Sequencetarget sequence 269aaagacaatt
attttaatac c 2127021DNAArtificial Sequencetarget sequence
270aagacaatta ttttaatacc c 2127121DNAArtificial
Sequencetarget sequence 271aattatttta ataccctctg a
2127221DNAArtificial Sequencetarget sequence 272aataccctct
gatttagcat g 2127321DNAArtificial Sequencetarget sequence
273aatcaatgga tgaaagtgga t 2127421DNAArtificial Sequencetarget
sequence 274aatggatgaa agtggattac c 2127521DNAArtificial
Sequencetarget sequence 275aaagtggatt accacagctg a
2127621DNAArtificial Sequencetarget sequence 276aagtggatta
ccacagctga c 2127721DNAArtificial Sequencetarget sequence
277catcagttgc cacttccaca t 2127821DNAArtificial Sequencetarget
sequence 278cttggatggt tttgttatgg t 2127921DNAArtificial
Sequencetarget sequence 279atgggattaa ctcagtttga a
2128021DNAArtificial Sequencetarget sequence 280gtctgcaaca
tggaaggtat t 2128121DNAArtificial Sequencetarget sequence
281cattcctcac ccatcaaata t 2128221DNAArtificial Sequencetarget
sequence 282aggccgctca atttatgaat a 2128321DNAArtificial
Sequencetarget sequence 283tcatatataa caccaagaat t
2128421DNAArtificial Sequencetarget sequence 284tgtccttaaa
ccggttgaat c 2128521DNAArtificial Sequencetarget sequence
285agcctctttg acaaacttaa g 2128621DNAArtificial Sequencetarget
sequence 286atgaccagca acttgaggaa g 2128721DNAArtificial
Sequencetarget sequence 287cattacccac cgctgaaacg c
2128821DNAArtificial Sequencetarget sequence 288agattcagga
tcagacacct a 2128921DNAArtificial Sequencetarget sequence
289atagtgatat ggtcaatgaa t 2129021DNAArtificial Sequencetarget
sequence 290acacagattt agacttggag a 2129121DNAArtificial
Sequencetarget sequence 291cacagttaca gtattccagc a
2129221DNAArtificial Sequencetarget sequence 292attgattgca
tctccatctc c 2129321DNAArtificial Sequencetarget sequence
293atactagctt tgcagaatgc t 2129421DNAArtificial Sequencetarget
sequence 294attattacag cagccagacg a 2129521DNAArtificial
Sequencetarget sequence 295acaattattt taataccctc t
2129621DNAArtificial Sequencetarget sequence 296accagttatg
attgtgaagt t 2129721DNAArtificial Sequencetarget sequence
297aactaactgg acacagtgtg t 2129821DNAArtificial SequencesiRNA sense
strand 298cuaacuggac acagugugut t 2129921DNAArtificial
SequencesiRNA antisense strand 299acacacugug uccaguuagt t 21
* * * * *