U.S. patent application number 13/584410 was filed with the patent office on 2012-11-29 for modified messenger rna stabilizing sequences for expressing genes in bacterial cells.
This patent application is currently assigned to Novozymes, Inc.. Invention is credited to Gloria Erichsen, Michael Thomas, William Widner.
Application Number | 20120301955 13/584410 |
Document ID | / |
Family ID | 40002822 |
Filed Date | 2012-11-29 |
United States Patent
Application |
20120301955 |
Kind Code |
A1 |
Thomas; Michael ; et
al. |
November 29, 2012 |
Modified messenger RNA stabilizing sequences for expressing genes
in bacterial cells
Abstract
The present invention relates to methods of producing a
polypeptide having biological activity in a bacterial cell,
comprising: (a) cultivating a bacterial host cell in a medium
conducive for production of the polypeptide, wherein the bacterial
host cell comprises a nucleic acid construct comprising a promoter
region operably linked to a polynucleotide sequence encoding the
polypeptide and a modified mRNA processing/stabilizing sequence
located downstream of the promoter region and upstream of the
ribosome binding site of the polynucleotide sequence encoding the
polypeptide, wherein the modified mRNA processing/stabilizing
sequence promotes higher expression of the polynucleotide sequence
compared to an unmodified mRNA processing/stabilizing sequence; and
(b) isolating the polypeptide having biological activity from the
cultivation medium. The present invention also relates to such
modified mRNA processing/stabilizing sequences, nucleic acid
constructs, and bacterial host cells and to methods of obtaining
such bacterial host cells.
Inventors: |
Thomas; Michael; (Davis,
CA) ; Erichsen; Gloria; (Davis, CA) ; Widner;
William; (Davis, CA) |
Assignee: |
Novozymes, Inc.
Davis
CA
|
Family ID: |
40002822 |
Appl. No.: |
13/584410 |
Filed: |
August 13, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12520072 |
Jul 2, 2009 |
8268586 |
|
|
PCT/US2007/088060 |
Dec 19, 2007 |
|
|
|
13584410 |
|
|
|
|
60876894 |
Dec 21, 2006 |
|
|
|
Current U.S.
Class: |
435/320.1 ;
536/24.1 |
Current CPC
Class: |
C07K 14/32 20130101;
C12N 15/75 20130101 |
Class at
Publication: |
435/320.1 ;
536/24.1 |
International
Class: |
C12N 15/113 20100101
C12N015/113; C12N 15/63 20060101 C12N015/63 |
Claims
1. An isolated nucleic acid comprising a modified mRNA
processing/stabilizing sequence, wherein the modified mRNA
processing/stabilizing sequence comprises at least one additional
copy of a Shine-Dalgarno sequence.
2. The isolated nucleic acid of claim 1, wherein the modified mRNA
processing/stabilizing sequence is a cryIIIA mRNA
processing/stabilizing sequence comprising at least one additional
copy of a Shine-Dalgarno sequence.
3. The isolated nucleic acid of claim 1, wherein the modified mRNA
processing/stabilizing sequence is the cryIIIA mRNA
processing/stabilizing sequence of SEQ ID NO: 4 comprising at least
one additional copy of a Shine-Dalgarno sequence.
4. The isolated nucleic acid of claim 1, wherein the modified mRNA
processing/stabilizing sequence is a SP82 mRNA
processing/stabilizing sequence comprising at least one additional
copy of a Shine-Dalgarno sequence.
5. The isolated nucleic acid of claim 1, wherein the modified mRNA
processing/stabilizing sequence is the SP82 mRNA
processing/stabilizing sequence of SEQ ID NO: 5 comprising at least
one additional copy of a Shine-Dalgarno sequence.
6. The isolated nucleic acid of claim 1, wherein the at least one
additional copy of a Shine-Dalgarno sequence comprises the sequence
GGAG.
7. The isolated nucleic acid of claim 1, wherein the at least one
additional copy of a Shine-Dalgarno sequence comprises the sequence
GGAGG.
8. The isolated nucleic acid of claim 1, wherein the at least one
additional copy of a Shine-Dalgarno sequence comprises SEQ ID NO:
1.
9. The isolated nucleic acid of claim 1, wherein the modified mRNA
processing/stabilizing sequence comprises at least two additional
copies of a Shine-Dalgarno sequence.
10. A nucleic acid construct comprising a promoter region operably
linked to the nucleic acid of claim 1 and a polynucleotide encoding
a polypeptide having biological activity, wherein the nucleic acid
of claim 1 is located downstream of the promoter region and
upstream of the ribosome binding site of the polynucleotide
encoding the polypeptide having biological activity.
11. The nucleic acid construct of claim 10, wherein the modified
mRNA processing/stabilizing sequence of the nucleic acid of claim 1
promotes higher expression of the polynucleotide encoding a
polypeptide having biological activity compared to an unmodified
mRNA processing/stabilizing sequence.
12. The nucleic acid construct of claim 10, wherein the modified
mRNA processing/stabilizing sequence is a cryIIIA mRNA
processing/stabilizing sequence comprising at least one additional
copy of a Shine-Dalgarno sequence.
13. The nucleic acid construct of claim 10, wherein the modified
mRNA processing/stabilizing sequence is the cryIIIA mRNA
processing/stabilizing sequence of SEQ ID NO: 4 comprising at least
one additional copy of a Shine-Dalgarno sequence.
14. The nucleic acid construct of claim 10, wherein the modified
mRNA processing/stabilizing sequence is a SP82 mRNA
processing/stabilizing sequence comprising at least one additional
copy of a Shine-Dalgarno sequence.
15. The nucleic acid construct of claim 10, wherein the modified
mRNA processing/stabilizing sequence is the SP82 mRNA
processing/stabilizing sequence of SEQ ID NO: 5 comprising at least
one additional copy of a Shine-Dalgarno sequence.
16. The nucleic acid construct of claim 10, wherein the at least
one additional copy of a Shine-Dalgarno sequence comprises the
sequence GGAG.
17. The nucleic acid construct of claim 10, wherein the at least
one additional copy of a Shine-Dalgarno sequence comprises the
sequence GGAGG.
18. The nucleic acid construct of claim 10, wherein the at least
one additional copy of a Shine-Dalgarno sequence comprises SEQ ID
NO: 1.
19. The nucleic acid construct of claim 10, wherein the modified
mRNA processing/stabilizing sequence comprises at least two
additional copies of a Shine-Dalgarno sequence.
20. A recombinant expression vector comprising the nucleic acid
construct of claim 10.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. patent application
Ser. No. 12/520,072, which is a 35 U.S.C. 371 national application
of PCT/US2007/088060 filed on Dec. 19, 2007, which claims priority
from U.S. provisional application Ser. No. 60/876,894 filed on Dec.
21, 2006. The contents of these applications are fully incorporated
herein by reference.
REFERENCE TO A SEQUENCE LISTING
[0002] This application contains a Sequence Listing in computer
readable form. The computer readable form is incorporated herein by
reference.
REFERENCE TO A DEPOSIT OF BIOLOGICAL MATERIAL
[0003] This application contains a reference to a deposit of
biological material, which deposit is incorporated herein by
reference.
BACKGROUND OF THE INVENTION
[0004] 1. Field of the Invention
[0005] The present invention relates to methods of producing
polypeptides having biological activity in bacterial host cells.
The present invention also relates to isolated modified mRNA
processing/stabilizing sequences and to nucleic acid constructs,
vectors, and host cells comprising the modified mRNA
processing/stabilizing sequences operably linked to promoter
regions for expressing polynucleotide sequences encoding
polypeptides having biological activity.
[0006] 2. Description of the Related Art
[0007] The recombinant production of a native or heterologous
polypeptide having biological activity in a bacterial host cell,
particularly a Bacillus cell, may provide for a more desirable
vehicle for producing the substance in commercially relevant
quantities.
[0008] Recombinant production of a native or heterologous
polypeptide having biological activity is accomplished by
constructing an expression cassette in which the DNA coding for the
polypeptide is placed under the expression control of a promoter,
excised from a regulated gene, suitable for the host cell. The
expression cassette is introduced into the host cell, usually by
plasmid-mediated transformation. Production of the polypeptide is
then achieved by culturing the transformed host cell under inducing
conditions necessary for the proper functioning of the promoter
contained on the expression cassette.
[0009] Translation initiation frequency, codon usage, and RNA
secondary structure are factors that affect mRNA stability in
bacteria (Regnier and Arraiano, 2000, Bioessays 22: 235-244;
Steege, 2000, RNA 6: 1079-1090). In Bacillus subtilis, mRNA
stability is influenced by ribosome stalling at the 5'-untranslated
region. For example, the stability of the Bacillus subtilis
alkaline protease gene (aprE) was found to have a high half-life in
Bacillus subtilis of approximately 25 minutes as a result of the
ribosome binding site (Shine-Dalgarno sequence) present in the gene
leader region (Hambraeus et al., 2002, Microbiology 148:
1795-1803). The complementarity of the Shine-Dalgarno sequences at
the 3'-OH end of the 16S ribosomal RNA determines the affinity
between the ribosomal subunits and the mRNA. The fixation of a
ribosomal subunit to the 5'-UTR has been reported to be an mRNA
stability inducer in Bacillus subtilis (Sharp and Bechhofer, 2003,
J. Bacteriology 173: 4952-4958). The presence of
Shine-Dalgarno-like sequences, referred to as stabilizer sequences,
in the 5'-UTR has been proposed to be one of the causes of high
mRNA stability observed for the cryIIIA gene (Agaisse and Lereclus,
1996, Mol. Microbiol. 20: 633-643). U.S. Pat. Nos. 6,255,076 and
5,955,310 describe the use of the crIIIA mRNA stabilizer sequence
for improved expression of enzymes in Bacillus cells. Daguer et
al., 2005, Letters in Applied Microbiology 41: 221-226, describe
increasing the stability of sacB transcripts improves levansucrase
production in Bacillus subtilis.
[0010] It would be an advantage in the art to provide new methods
for transcript stabilization to improve the level of a polypeptide
expressed by a bacterial host strain.
[0011] The present invention relates to improved methods of
producing a polypeptide having biological activity in a bacterial
host cell.
SUMMARY OF THE INVENTION
[0012] The present invention relates to methods of producing a
polypeptide having biological activity in a bacterial host cell,
comprising: (a) cultivating a bacterial host cell in a medium
conducive for production of the polypeptide having biological
activity, wherein the bacterial host cell comprises a nucleic acid
construct comprising a promoter region operably linked to a
polynucleotide sequence encoding the polypeptide having biological
activity and a modified mRNA processing/stabilizing sequence
located downstream of the promoter region and upstream of the
ribosome binding site (RBS) of the polynucleotide sequence encoding
the polypeptide having biological activity, wherein the modified
mRNA processing/stabilizing sequence promotes higher expression of
the polynucleotide sequence compared to an unmodified mRNA
processing/stabilizing sequence; and (b) isolating the polypeptide
having biological activity from the cultivation medium.
[0013] The present invention also relates to bacterial host cells
comprising a nucleic acid construct that comprises a promoter
region operably linked to a polynucleotide sequence encoding a
polypeptide having biological activity and a modified mRNA
processing/stabilizing sequence located downstream of the promoter
region and upstream of the ribosome binding site of the
polynucleotide sequence encoding the polypeptide having biological
activity, wherein the modified mRNA processing/stabilizing sequence
promotes higher expression of the polynucleotide sequence compared
to an unmodified mRNA processing/stabilizing sequence.
[0014] The present invention also relates to methods of obtaining a
bacterial host cell, comprising introducing into a bacterial cell a
nucleic acid construct comprising a promoter region operably linked
to a polynucleotide sequence encoding a polypeptide having
biological activity and a modified mRNA processing/stabilizing
sequence located downstream of the promoter region and upstream of
the ribosome binding site of the polynucleotide sequence encoding
the polypeptide having biological activity, wherein the modified
mRNA processing/stabilizing sequence promotes higher expression of
the polynucleotide sequence compared to an unmodified mRNA
processing/stabilizing sequence.
[0015] The present invention also relates to modified mRNA
processing/stabilizing sequences.
[0016] The present invention also relates to nucleic acid
constructs comprising a promoter region operably linked to a
polynucleotide sequence encoding a polypeptide having biological
activity and a modified mRNA processing/stabilizing sequence
located downstream of the promoter region and upstream of the
ribosome binding site of the polynucleotide sequence encoding the
polypeptide having biological activity, wherein the modified mRNA
processing/stabilizing sequence promotes higher expression of the
polynucleotide sequence compared to an unmodified mRNA
processing/stabilizing sequence.
[0017] The present invention further relates to methods of
producing a selectable marker-free mutant of a bacterial host cell,
comprising deleting a selectable marker gene of the bacterial host
cell, wherein the bacterial cell comprises a nucleic acid construct
comprising a promoter region operably linked to a polynucleotide
sequence encoding a polypeptide having biological activity and a
modified mRNA processing/stabilizing sequence located downstream of
the promoter region and upstream of the ribosome binding site of
the polynucleotide sequence encoding the polypeptide having
biological activity, wherein the modified mRNA
processing/stabilizing sequence promotes higher expression of the
polynucleotide sequence compared to an unmodified mRNA
processing/stabilizing sequence.
BRIEF DESCRIPTION OF THE FIGURES
[0018] FIG. 1 shows a schematic diagram of unprocessed mRNAs and
the position of various modified mRNA processing/stabilizing
Shine-Dalgarno (S-D) sequences in relation to a gene being
expressed, the endogenous ribosome binding site (RBS) of the gene,
and the transcription terminator sequence (stem-loop). "Wild-type"
depicts the unmodified mRNA processing/stabilizing sequence.
"Modified 1" is the modified version of the mRNA
processing/stabilizing sequence that is described in Example 5.
"Modified 2, 3, and 4" are various modified mRNA
processing/stabilizing sequences. "Modified 2" contains one extra
Shine-Dalgarno sequence, similar to "Modified 1" except the extra
Shine-Dalgarno sequence is in a different location. "Modified 3 and
4" contain yet additional Shine-Dalgarno sequences located at
different locations. All of the additional Shine-Dalgarno sequences
are located between the gene's endogenous RBS and the 5' end of the
unprocessed mRNA.
[0019] FIG. 2 shows a restriction map of pGME079.
[0020] FIG. 3 shows a restriction map of pNBT48.
[0021] FIG. 4 shows a restriction map of pNBT55.
[0022] FIG. 5 shows a restriction map of pNBT56.
[0023] FIG. 6 shows relative Bacillus clausii alkaline protease
(AprH) activity in shake flasks obtained from Bacillus subtilis
strains BW198 (P.sub.amyQ/cryIIIA stab/aprH expression cassette)
and BW199 (P.sub.amyQ/mod. cryIIIA stab/aprH expression
cassette).
[0024] FIG. 7 shows a restriction map of pGME085.
[0025] FIG. 8 shows a restriction map of pGME080.
[0026] FIG. 9 shows relative Bacillus clausii alkaline protease
(AprH) activity in shake flasks obtained from Bacillus subtilis
strains GME200 (wild-type P.sub.cryIIIA/cryIIIA stab/aprH
expression cassette), GME201 (P.sub.consensus cryIIIA/cryIIIA
stab/aprH expression cassette), GME202 (P.sub.cryIIIA/mod. cryIIIA
stab/aprH expression cassette), and GME203 (P.sub.consensus
cryIIIA/mod. cryIIIA stab/aprH expression cassette).
[0027] FIG. 10 shows a restriction map of pMDT131.
[0028] FIG. 11 shows a restriction map of pMDT159.
[0029] FIG. 12 shows a restriction map of pMDT160.
[0030] FIG. 13 shows a restriction map of pHyGe203.
[0031] FIG. 14 shows a restriction map of pHyGe205.
[0032] FIG. 15 shows a restriction map of pHyGe201.
[0033] FIG. 16 shows a restriction map of pHyGe206.
[0034] FIG. 17 shows the effect of triple tandem promoter variants
on Bacillus clausii alkaline protease (AprH) production in Bacillus
licheniformis strains HyGe210 and HyGe211.
[0035] FIG. 18 shows a restriction map of pKK223-3.
[0036] FIG. 19 shows a restriction map of pNBT51.
[0037] FIG. 20 shows a restriction map of pNBT52.
[0038] FIG. 21 shows a restriction map of pNBT53.
[0039] FIG. 22 shows a restriction map of pNBT54.
[0040] FIG. 23 shows a restriction map of pNBT35.
[0041] FIG. 24 shows a restriction map of pNBT30.
[0042] FIG. 25 shows a restriction map of pNBT31.
[0043] FIG. 26 shows a restriction map of pNBT36.
[0044] FIG. 27 shows a restriction map of pMDT100.
[0045] FIG. 28 shows a restriction map of pMDT174.
[0046] FIG. 29 shows the relative protease activity of Bacillus
subtilis strains MDT134 and MDT135.
DEFINITIONS
[0047] Messenger RNA (mRNA) processing/stabilizing sequence: The
term "mRNA processing/stabilizing sequence" is defined herein as a
sequence located downstream of a promoter region and upstream of
the translation initiation site (i.e., ribosome binding site; RBS)
of a polynucleotide encoding a polypeptide having biological
activity to which the promoter region is operably linked such that
all mRNAs synthesized from the promoter region may be processed to
generate mRNA transcripts with a stabilizer sequence at the 5' end
of the transcripts. The presence of such a stabilizer sequence at
the 5' end of the mRNA transcripts increases their half-life
(Agaisse and Lereclus, 1994, supra, Hue et al., 1995, Journal of
Bacteriology 177: 3465-3471). The mRNA processing/stabilizing
sequence is complementary to the 3' extremity of bacterial 16S
ribosomal RNA. In a preferred aspect, the mRNA
processing/stabilizing sequence generates essentially single-size
transcripts with a stabilizing sequence at the 5' end of the
transcripts. The mRNA processing/stabilizing sequence is preferably
one that is complementary to the 3' extremity of a bacterial 16S
ribosomal RNA. See, for example, U.S. Pat. Nos. 6,255,076 and
5,955,310.
[0048] Shine-Dalgarno sequence: The term "Shine-Dalgarno sequence"
is defined herein as a nucleotide sequence in a messenger RNA
molecule to which a ribosome will bind. Such a sequence is
complementary to the 3' end of a bacterial 16S ribosomal RNA.
[0049] In a preferred aspect, the Shine-Dalgarno sequence comprises
the sequence GGAG. In another preferred aspect, the Shine-Dalgarno
sequence comprises the sequence GGAGG. In another preferred aspect,
the Shine-Dalgarno sequence comprises the sequence AGAAAGGAGG (SEQ
ID NO: 1). In another preferred aspect, the Shine-Dalgarno sequence
comprises the sequence AGAAAGGAGGTGATCCAGCCGCACC (SEQ ID NO: 2). In
another preferred aspect, the Shine-Dalgarno sequence comprises the
sequence TAGAAAGGAGGTGATCCAGCCGCACCTT (SEQ ID NO: 3).
[0050] Unmodified mRNA processing/stabilizing sequence: The term
"unmodified mRNA processing/stabilizing sequence" is defined herein
as a wild-type polynucleotide comprising a mRNA
processing/stabilizing sequence(s).
[0051] Modified mRNA processing/stabilizing sequence: The term
"modified mRNA processing/stabilizing sequence" is defined herein
as a mRNA stabilizing sequence that has been recombinantly modified
to comprise at least one additional copy of a Shine-Dalgarno
sequence, wherein the modified mRNA processing/stabilizing sequence
promotes higher expression of a polynucleotide sequence compared to
an unmodified mRNA processing/stabilizing sequence.
[0052] Promoter: The term "promoter" is defined herein as a DNA
sequence that binds RNA polymerase and directs the polymerase to
the correct downstream transcriptional start site of a
polynucleotide encoding a polypeptide having biological activity to
initiate transcription. RNA polymerase effectively catalyzes the
assembly of messenger RNA complementary to the appropriate DNA
strand of the coding region. The term "promoter" will also be
understood to include the 5' non-coding region (between promoter
and translation start) for translation after transcription into
mRNA, cis-acting transcription control elements such as enhancers,
and/or other nucleotide sequences capable of interacting with
transcription factors. The promoter can be a wild-type, variant,
hybrid, or consensus promoter.
[0053] Promoter region: The term "promoter region" is defined
herein as a nucleotide sequence comprising one or more (several)
promoter sequences, e.g., tandem triple promoter.
[0054] Promoter variant: The term "promoter variant" is defined
herein as a promoter having a nucleotide sequence comprising a
substitution, deletion, and/or insertion of one or more (several)
nucleotides of a parent promoter, wherein the mutant promoter has
more or less promoter activity than the corresponding parent
promoter. The term "promoter variant" will also encompass natural
variants and in vitro generated variants obtained using methods
well known in the art such as classical mutagenesis, site-directed
mutagenesis, and DNA shuffling.
[0055] Tandem promoter: The term "tandem promoter" is defined
herein as two or more promoter sequences each of which is operably
linked to a coding sequence and mediates the transcription of the
coding sequence into mRNA.
[0056] Hybrid promoter: The term "hybrid promoter" is defined
herein as parts of two or more promoters that are fused together to
generate a sequence that is a fusion of the two or more promoters,
which when operably linked to a coding sequence of a polynucleotide
encoding a polypeptide having biological activity mediates the
transcription of the coding sequence into mRNA.
[0057] Isolated polypeptide: The term "isolated polypeptide" as
used herein refers to a polypeptide that is isolated from a source.
In a preferred aspect, the polypeptide is at least 1% pure,
preferably at least 5% pure, more preferably at least 10% pure,
more preferably at least 20% pure, more preferably at least 40%
pure, more preferably at least 60% pure, even more preferably at
least 80% pure, and most preferably at least 90% pure, as
determined by SDS-PAGE.
[0058] Substantially pure polypeptide: The term "substantially pure
polypeptide" denotes herein a polypeptide preparation that contains
at most 10%, preferably at most 8%, more preferably at most 6%,
more preferably at most 5%, more preferably at most 4%, more
preferably at most 3%, even more preferably at most 2%, most
preferably at most 1%, and even most preferably at most 0.5% by
weight of other polypeptide material with which it is natively or
recombinantly associated. It is, therefore, preferred that the
substantially pure polypeptide is at least 92% pure, preferably at
least 94% pure, more preferably at least 95% pure, more preferably
at least 96% pure, more preferably at least 96% pure, more
preferably at least 97% pure, more preferably at least 98% pure,
even more preferably at least 99%, most preferably at least 99.5%
pure, and even most preferably 100% pure by weight of the total
polypeptide material present in the preparation. The polypeptides
of the present invention are preferably in a substantially pure
form, i.e., that the polypeptide preparation is essentially free of
other polypeptide material with which it is natively or
recombinantly associated. This can be accomplished, for example, by
preparing the polypeptide by well-known recombinant methods or by
classical purification methods.
[0059] Isolated polynucleotide: The term "isolated polynucleotide"
as used herein refers to a polynucleotide that is isolated from a
source. In a preferred aspect, the polynucleotide is at least 1%
pure, preferably at least 5% pure, more preferably at least 10%
pure, more preferably at least 20% pure, more preferably at least
40% pure, more preferably at least 60% pure, even more preferably
at least 80% pure, and most preferably at least 90% pure, as
determined by agarose electrophoresis.
[0060] Substantially pure polynucleotide: The term "substantially
pure polynucleotide" as used herein refers to a polynucleotide
preparation free of other extraneous or unwanted nucleotides and in
a form suitable for use within genetically engineered protein
production systems. Thus, a substantially pure polynucleotide
contains at most 10%, preferably at most 8%, more preferably at
most 6%, more preferably at most 5%, more preferably at most 4%,
more preferably at most 3%, even more preferably at most 2%, most
preferably at most 1%, and even most preferably at most 0.5% by
weight of other polynucleotide material with which it is natively
or recombinantly associated. A substantially pure polynucleotide
may, however, include naturally occurring 5' and 3' untranslated
regions, such as promoters and terminators. It is preferred that
the substantially pure polynucleotide is at least 90% pure,
preferably at least 92% pure, more preferably at least 94% pure,
more preferably at least 95% pure, more preferably at least 96%
pure, more preferably at least 97% pure, even more preferably at
least 98% pure, most preferably at least 99%, and even most
preferably at least 99.5% pure by weight. The polynucleotides of
the present invention are preferably in a substantially pure form,
i.e., that the polynucleotide preparation is essentially free of
other polynucleotide material with which it is natively or
recombinantly associated. The polynucleotides may be of genomic,
cDNA, RNA, semisynthetic, synthetic origin, or any combinations
thereof.
[0061] Nucleic acid construct: The term "nucleic acid construct" as
used herein refers to a nucleic acid molecule, either single- or
double-stranded, which is isolated from a naturally occurring gene
or which is modified to contain segments of nucleic acids in a
manner that would not otherwise exist in nature or which is
synthetic. The term nucleic acid construct is synonymous with the
term "expression cassette" when the nucleic acid construct contains
the control sequences required for expression of a coding sequence
of the present invention.
[0062] Control sequences: The term "control sequences" is defined
herein to include all components necessary for the expression of a
polynucleotide encoding a polypeptide of the present invention.
Each control sequence may be native or foreign to the nucleotide
sequence encoding the polypeptide or native or foreign to each
other. Such control sequences include, but are not limited to, a
leader, polyadenylation sequence, propeptide sequence, promoter,
signal peptide sequence, and transcription terminator. At a
minimum, the control sequences include a promoter, and
transcriptional and translational stop signals. The control
sequences may be provided with linkers for the purpose of
introducing specific restriction sites facilitating ligation of the
control sequences with the coding region of the nucleotide sequence
encoding a polypeptide.
[0063] Operably linked: The term "operably linked" denotes herein a
configuration in which a control sequence is placed at an
appropriate position relative to the coding sequence of the
polynucleotide sequence such that the control sequence directs the
expression of the coding sequence of a polypeptide.
[0064] Coding sequence: When used herein the term "coding sequence"
means a nucleotide sequence, which directly specifies the amino
acid sequence of its protein product. The boundaries of the coding
sequence are generally determined by an open reading frame, which
usually begins with the ATG start codon or alternative start codons
such as GTG and TTG and ends with a stop codon such as TAA, TAG,
and TGA. The coding sequence may be a DNA, cDNA, synthetic, or
recombinant nucleotide sequence.
[0065] Expression: The term "expression" includes any step involved
in the production of the polypeptide including, but not limited to,
transcription, post-transcriptional modification, translation,
post-translational modification, and secretion.
[0066] Expression vector: The term "expression vector" is defined
herein as a linear or circular DNA molecule that comprises a
polynucleotide encoding a polypeptide of the present invention and
is operably linked to additional nucleotides that provide for its
expression.
[0067] Host cell: The term "host cell", as used herein, includes
any cell type that is susceptible to transformation, transfection,
transduction, conjugation, and the like with a nucleic acid
construct or expression vector.
DETAILED DESCRIPTION OF THE INVENTION
[0068] The present invention relates to methods of producing a
polypeptide having biological activity in a bacterial host cell,
comprising: (a) cultivating a bacterial host cell in a medium
conducive for production of the polypeptide having biological
activity, wherein the bacterial host cell comprises a nucleic acid
construct comprising a promoter region operably linked to a
polynucleotide sequence encoding the polypeptide having biological
activity and a modified mRNA processing/stabilizing sequence
located downstream of the promoter region and upstream of the
ribosome binding site of the polynucleotide sequence encoding the
polypeptide having biological activity, wherein the modified mRNA
processing/stabilizing sequence promotes higher expression of the
polynucleotide sequence compared to an unmodified mRNA
processing/stabilizing sequence; and (b) isolating the polypeptide
having biological activity from the cultivation medium.
[0069] An advantage of the present invention is that fewer copies
of an expression cassette need to be introduced into the host
chromosome in order to obtain saturating levels of mRNA, thus
significantly reducing the length of time required to construct a
production strain. Also, the present invention allows higher levels
of gene expression in situations where current technology is
insufficient to generate saturating levels of mRNA.
[0070] In a preferred aspect, the modified mRNA
processing/stabilizing sequence promotes higher expression of a
polynucleotide sequence compared to an unmodified mRNA
processing/stabilizing sequence of at least 15%, preferably at
least 25%, more preferably at least 50%, more preferably at least
75%, more preferably at least 100%, more preferably at least 150%,
more preferably at least 200%, more preferably at least 250%, even
more preferably at least 300%, most preferably at least 400%, and
even most preferably at least 500%.
Messenger RNA (mRNA) Processing/Stabilizing Sequences
[0071] The present invention also relates to modified mRNA
processing/stabilizing sequences. Any mRNA processing/stabilizing
sequence(s) may be used as a parent(s) to construct a modified mRNA
processing/stabilizing sequence of the present invention.
[0072] A modified mRNA processing/stabilizing sequence of the
present invention comprises at least one additional Shine-Dalgarno
sequence providing enhanced protection of the mRNA to which it is
linked, thereby, resulting in even higher levels of gene expression
in comparison to constructs that utilize the wild-type mRNA
stabilizing sequence. The at least one additional Shine-Dalgarno
sequence may be a duplicate of the Shine-Dalgarno sequence
naturally associated or native to the mRNA processing/stabilizing
sequence or may be obtained from a different mRNA
processing/stabilizing sequence. FIG. 1 shows a schematic diagram
of unprocessed mRNAs and the position of various modified mRNA
processing/stabilizing sequences in relation to the gene being
expressed, the endogenous ribosome binding site (RBS), and the
transcription terminator sequence (stem-loop).
[0073] In a preferred aspect, the modified mRNA
processing/stabilizing sequence comprises at least two
Shine-Dalgarno sequences. In another preferred aspect, the modified
mRNA processing/stabilizing sequence comprises at least three
Shine-Dalgarno sequences. In another preferred aspect, the modified
mRNA processing/stabilizing sequence comprises at least four
Shine-Dalgarno sequences. In another preferred aspect, the modified
mRNA processing/stabilizing sequence comprises at least five
Shine-Dalgarno sequences.
[0074] In another preferred aspect, a Shine-Dalgarno sequence
comprising the modified mRNA processing/stabilizing sequence is at
least 4 bp. In another preferred aspect, a Shine-Dalgarno sequence
comprising the modified mRNA processing/stabilizing sequence is at
least 5 bp. In another preferred aspect, a Shine-Dalgarno sequence
comprising the modified mRNA processing/stabilizing sequence is at
least 10 bp. In another preferred aspect, a Shine-Dalgarno sequence
comprising the modified mRNA processing/stabilizing sequence is at
least 15 bp. In another preferred aspect, a Shine-Dalgarno sequence
comprising the modified mRNA processing/stabilizing sequence is at
least 20 bp. In another preferred aspect, a Shine-Dalgarno sequence
comprising the modified mRNA processing/stabilizing sequence is at
least 25 bp. In another preferred aspect, a Shine-Dalgarno sequence
comprising the modified mRNA processing/stabilizing sequence is at
least 30 bp.
[0075] The modified mRNA processing/stabilizing sequence can be
constructed (1) by placing one or more (several) Shine-Delgarno
sequences, in addition to a Shine-Delgarno/mRNA stabilization
sequence that is already present, between the transcription start
site of the gene of interest and the gene's RBS, or (2) by placing
two or more (several) Shine-Delgarno sequences between the
transcription start site of the gene of interest and the gene's
RBS, where the gene does not already contain a Shine-Delgarno/mRNA
stabilization sequence in addition to the existing RBS. The
modified mRNA processing/stabilizing sequence can be constructed
from Shine-Delgarno sequences distinct from the gene. Each of the
Shine-Delgarno sequences of the modified mRNA
processing/stabilizing sequence may be the same sequence or a
combination of one or more (several) different sequences. For
example, as described herein, an extra Shine-Delgarno sequence is
placed midway between the already existing Shine-Delgarno/mRNA
stabilizing sequence and the RBS. Because the RBS is itself usually
also a Shine-Delgarno sequence, there are, therefore, a minimum of
three Shine-Delgarno sequences present on the unprocessed mRNA. The
first two (starting from the 5' end) confer mRNA stability and the
third (the RBS) directs translation of the mRNA.
[0076] In a preferred aspect, the parent mRNA
processing/stabilizing sequence is the Bacillus thuringiensis
cryIIIA mRNA processing/stabilizing sequence disclosed in WO
94/25612 and Agaisse and Lereclus, 1994, Molecular Microbiology 13:
97-107, or portions thereof that retain the mRNA
processing/stabilizing function.
[0077] In another preferred aspect, the parent mRNA
processing/stabilizing sequence is the Bacillus subtilis SP82 mRNA
processing/stabilizing sequence disclosed in Hue et al., 1995,
supra, or portions thereof that retain the mRNA
processing/stabilizing function.
[0078] In a more preferred aspect, the cryIIIA mRNA
processing/stabilizing sequence is SEQ ID NO: 4, or a portion
thereof that retains the mRNA stabilizing function of SEQ ID NO:
4.
[0079] In another more preferred aspect, the SP82 mRNA
processing/stabilizing sequence is SEQ ID NO: 5, or a portion
thereof that retains the mRNA stabilizing function of SEQ ID NO:
5.
[0080] In a preferred aspect, the modified mRNA
processing/stabilizing sequence is SEQ ID NO: 6, or a portion
thereof that retains the mRNA stabilizing function of SEQ ID NO:
6.
[0081] The modified mRNA processing/stabilizing sequence is
preferably located downstream of the promoter region and upstream
of the gene's ribosome binding site. However, the modified mRNA
processing/stabilizing sequence can be located downstream of any
promoter comprising the promoter region and upstream of the
ribosome binding site of the polynucleotide sequence encoding the
polypeptide having biological activity. Furthermore, the modified
mRNA processing/stabilizing sequence can be located downstream of
each of the promoters comprising the promoter region and upstream
of the ribosome binding site of the polynucleotide sequence
encoding the polypeptide having biological activity. The parent of
the modified mRNA processing/stabilizing sequence or sequences may
be foreign to one or more (several) of the promoters of the
promoter region.
Polynucleotides Encoding Polypeptides Having Biological
Activity
[0082] A polypeptide having biological activity encoded by a
polynucleotide introduced into a bacterial host cell may be any
polypeptide of interest. The term "polypeptide" is not meant herein
to refer to a specific length of the encoded product and,
therefore, encompasses peptides, oligopeptides, and proteins. The
polypeptide may be native or heterologous (foreign) to the
bacterial host cell. The term "heterologous polypeptide" is defined
herein as a polypeptide that is not native to the host cell; a
native polypeptide in which structural modifications have been made
to alter the native polypeptide, e.g., the protein sequence of a
native polypeptide; or a native polypeptide whose expression is
quantitatively altered as a result of a manipulation of the DNA
encoding the polypeptide by recombinant DNA techniques, e.g., a
stronger promoter. The polypeptide may be an engineered variant of
any polypeptide.
[0083] In a preferred aspect, the polypeptide is an antibody,
antigen, antimicrobial peptide, enzyme, growth factor, hormone,
immunodilator, neurotransmitter, receptor, reporter protein,
structural protein, and transcription factor.
[0084] In a more preferred aspect, the polypeptide is an
oxidoreductase, transferase, hydrolase, lyase, isomerase, or
ligase. In a most preferred aspect, the polypeptide is an
acetylxylan esterase, alpha-glucosidase, aminopeptidase, amylase,
carbohydrase, carboxypeptidase, catalase, cellobiohydrolase,
cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase,
deoxyribonuclease, endoglucanase, esterase, ferulic acid esterase,
alpha-galactosidase, beta-galactosidase, glucoamylase,
glucocerebrosidase, alpha-glucosidase, beta-glucosidase, invertase,
laccase, lipase, mannosidase, mutanase, oxidase, pectinolytic
enzyme, peroxidase, phospholipase, phytase, polyphenoloxidase,
proteolytic enzyme, ribonuclease, transglutaminase, urokinase, or
xylanase.
[0085] In another preferred aspect, the polypeptide is an albumin,
collagen, tropoelastin, elastin, or gelatin.
[0086] In another preferred aspect, the polypeptide is a hybrid
polypeptide, which comprises a combination of partial or complete
polypeptide sequences obtained from at least two different
polypeptides wherein one or more (several) may be heterologous to
the bacterial host cell.
[0087] In another preferred aspect, the polypeptide is a fused
polypeptide in which another polypeptide is fused at the N-terminus
or the C-terminus of the polypeptide or fragment thereof. A fused
polypeptide is produced by fusing a nucleotide sequence (or a
portion thereof) encoding one polypeptide to a nucleotide sequence
(or a portion thereof) encoding another polypeptide. Techniques for
producing fusion polypeptides are known in the art, and include,
ligating the coding sequences encoding the polypeptides so that
they are in frame and expression of the fused polypeptide is under
control of the same promoter(s) and terminator.
[0088] A polynucleotide encoding a polypeptide of interest may be
obtained from any prokaryotic, eukaryotic, or other source. For
purposes of the present invention, the term "obtained from" as used
herein in connection with a given source shall mean that the
polypeptide is produced by the source or by a cell in which a gene
from the source has been inserted.
[0089] The techniques used to isolate or clone a polynucleotide
encoding a polypeptide of interest are known in the art and include
isolation from genomic DNA, preparation from cDNA, or a combination
thereof. The cloning of the polynucleotide of interest from such
genomic DNA can be effected, e.g., by using the well known
polymerase chain reaction (PCR). See, for example, Innis et al.,
1990, PCR Protocols: A Guide to Methods and Application, Academic
Press, New York. The cloning procedures may involve excision and
isolation of a desired nucleic acid fragment comprising the
polynucleotide encoding the polypeptide, insertion of the fragment
into a vector molecule, and incorporation of the recombinant vector
into a bacterial host cell where multiple copies or clones of the
polynucleotide will be replicated. The DNA may be of genomic, cDNA,
RNA, semisynthetic, synthetic origin, or any combinations
thereof.
[0090] A polynucleotide encoding a polypeptide of interest may be
manipulated in a variety of ways to provide for expression of the
polynucleotide in a suitable bacterial host cell. The construction
of nucleic acid constructs and recombinant expression vectors for
the polynucleotide encoding a polypeptide of interest can be
carried out as described herein for the expression of a polypeptide
having biological activity.
Nucleic Acid Constructs
[0091] The present invention also relates to nucleic acid
constructs comprising a promoter region operably linked to a
polynucleotide sequence encoding a polypeptide having biological
activity and a modified mRNA processing/stabilizing sequence
located downstream of the promoter region and upstream of the
ribosome binding site of the polynucleotide sequence encoding the
polypeptide having biological activity.
[0092] The construction of a nucleic acid construct comprising a
promoter region operably linked to a polynucleotide sequence
encoding a polypeptide having biological activity and a modified
mRNA processing/stabilizing sequence of the present invention,
which is located downstream of the promoter region and upstream of
the ribosome binding site of the polynucleotide sequence, may be
accomplished by modifying the polynucleotide sequence using methods
well known in the art to operably link the promoter region and the
modified mRNA processing/stabilizing sequence, as well as other
control sequences, to the polynucleotide, inserting the construct
into a vector, and introducing the vector into the bacterial cell's
chromosome by homologous recombination or into the bacterial cell
as an extrachromosomal autonomously replicating element, e.g.,
plasmid.
[0093] Each control sequence may be native or foreign to the
polynucleotide sequence encoding the polypeptide having biological
activity and may be foreign to each other. Such control sequences
include, but are not limited to, a leader, a promoter region, a
signal sequence, and a transcription terminator. At a minimum, the
control sequences include a promoter region, and transcriptional
and translational stop signals. The control sequences may be
provided with linkers for the purpose of introducing specific
restriction sites facilitating ligation of the control sequences
with the coding region of the polynucleotide sequence encoding a
polypeptide having biological activity.
[0094] Promoter Region.
[0095] The promoter region may comprise a single promoter or a
combination of promoters. Where the promoter region comprises a
combination of promoters, the promoters are preferably in tandem. A
promoter of the promoter region can be any promoter that can
initiate transcription of a polynucleotide encoding a polypeptide
having biological activity in a bacterial host cell of interest.
The promoter may be native, foreign, or a combination thereof, to
the nucleotide sequence encoding a polypeptide having biological
activity. Such a promoter can be obtained from genes directing
synthesis of extracellular or intracellular polypeptides having
biological activity either homologous or heterologous to the
bacterial host cell.
[0096] In a preferred aspect, the promoter region comprises a
promoter obtained from a bacterial source. In a more preferred
aspect, the promoter region comprises a promoter obtained from a
Gram positive bacterium. In another more preferred aspect, the
promoter region comprises a promoter obtained from a Gram negative
bacterium. Gram positive bacteria include, but not limited to,
Bacillus, Streptococcus, Streptomyces, Staphylococcus,
Enterococcus, Lactobacillus, Lactococcus, Clostridium, Geobacillus,
and Oceanobacillus. Gram negative bacteria include, but not limited
to, E. coli, Pseudomonas, Salmonella, Campylobacter, Helicobacter,
Flavobacterium, Fusobacterium, Ilyobacter, Neisseria, and
Ureaplasma.
[0097] In a most preferred aspect, the promoter region comprises a
promoter obtained from a Bacillus strain, e.g., Bacillus
agaradherens, Bacillus alkalophilus, Bacillus amyloliquefaciens,
Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus
coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus,
Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus,
Bacillus stearothermophilus, Bacillus subtilis, or Bacillus
thuringiensis; or from a Streptomyces strain, e.g., Streptomyces
lividans or Streptomyces murinus.
[0098] Examples of suitable promoters for directing transcription
of a polynucleotide encoding a polypeptide having biological
activity in the methods of the present invention are the promoters
obtained from the E. coli lac operon, Streptomyces coelicolor
agarase gene (dagA), Bacillus lentus or Bacillus clausii alkaline
protease gene (aprH), Bacillus licheniformis alkaline protease gene
(subtilisin Carlsberg gene), Bacillus subtilis levansucrase gene
(sacB), Bacillus subtilis alpha-amylase gene (amyE), Bacillus
licheniformis alpha-amylase gene (amyL), Bacillus
stearothermophilus maltogenic amylase gene (amyM), Bacillus
amyloliquefaciens alpha-amylase gene (amyQ), Bacillus licheniformis
penicillinase gene (penP), Bacillus subtilis xylA and xylB genes,
Bacillus thuringiensis subsp. tenebrionis CryIIIA gene (cryIIIA) or
portions thereof, prokaryotic beta-lactamase gene (Villa-Kamaroff
et al., 1978, Proceedings of the National Academy of Sciences USA
75:3727-3731), and Bacillus megaterium xylA gene (Rygus and Hillen,
1992, J. Bacteriol. 174: 3049-3055; Kim et al., 1996, Gene 181:
71-76), as well as the tac promoter (DeBoer et al., 1983,
Proceedings of the National Academy of Sciences USA 80: 21-25), the
orf.beta. promoter of plasmid pUB110 (Tortosa et al., 2000, Mol.
Microbiol. 35: 1110-1119), and the spac promoter (Henner, 1990,
Methods Enzymol. 185: 223-228). Other examples are the promoter of
the spot bacterial phage promoter and the tac promoter (DeBoer et
al., 1983, Proceedings of the National Academy of Sciences USA
80:21-25). Further promoters are described in "Useful proteins from
recombinant bacteria" in Scientific American, 1980, 242:74-94; and
in Sambrook, Fritsch, and Maniatus, 1989, Molecular Cloning, A
Laboratory Manual, 2d edition, Cold Spring Harbor, N.Y.
[0099] In another preferred aspect, the promoter region comprises a
promoter that is a "consensus" promoter having the sequence TTGACA
for the "-35" region and TATAAT for the "-10" region. The consensus
promoter may be obtained from any promoter that can function in a
bacterial host cell, e.g., Bacillus. The construction of a
"consensus" promoter may be accomplished by site-directed
mutagenesis using methods well known in the art to create a
promoter that conforms more perfectly to the established consensus
sequences for the "-10" and "-35" regions of the vegetative "sigma
A-type" promoters for Bacillus subtilis (Voskuil et al., 1995,
Molecular Microbiology 17: 271-279).
[0100] In another preferred aspect, the promoter region comprises a
"consensus" promoter obtained from a promoter obtained from the E.
coli lac operon, Streptomyces coelicolor agarase gene (dagA),
Bacillus clausii or Bacillus lentus alkaline protease gene (aprH),
Bacillus licheniformis alkaline protease gene (subtilisin Carlsberg
gene), Bacillus subtilis levansucrase gene (sacB), Bacillus
subtilis alpha-amylase gene (amyE), Bacillus licheniformis
alpha-amylase gene (amyL), Bacillus stearothermophilus maltogenic
amylase gene (amyM), Bacillus amyloliquefaciens alpha-amylase gene
(amyQ), Bacillus licheniformis penicillinase gene (penP), Bacillus
subtilis xylA and xylB genes, Bacillus thuringiensis subsp.
tenebrionis CryIIIA gene (cryIIIA) or portions thereof, or
prokaryotic beta-lactamase gene spot bacterial phage promoter.
[0101] In a more preferred aspect, the promoter region comprises a
"consensus" promoter obtained from Bacillus amyloliquefaciens
alpha-amylase gene (amyQ).
[0102] In another preferred aspect, the promoter region comprises a
promoter that is a hybrid promoter.
[0103] In another preferred aspect, the promoter region comprises a
promoter that is a variant promoter. See, for example, WO
05/098016, U.S. Pat. No. 5,698,415, and U.S. Pat. No. 6,100,063. In
a preferred aspect, the variant promoter is P.sub.amyL4199, wherein
P=promoter
[0104] In another preferred aspect, the promoter region comprises a
promoter that is a tandem promoter. See, for example, WO 99/043835
and WO 05/098016. In a preferred aspect, the tandem promoter is
P.sub.consensus amyQ-P.sub.cryIIIA-cryIIIA mRNA
processing/stabilizing sequence. In another preferred aspect, the
tandem promoter is P.sub.amyL4199-P.sub.consensus
amyQ-P.sub.cryIIIA cryIIIA mRNA processing/stabilizing
sequence.
[0105] In the methods of the present invention, a hybrid or tandem
promoter will be understood to be foreign to a polynucleotide
sequence encoding a polypeptide having biological activity even if
the wild-type promoter is native to the polynucleotide sequence.
For example, in a tandem promoter consisting of at least two
promoters, one of the promoters may be a the wild-type promoter of
the polynucleotide encoding a biological substance.
[0106] Terminator.
[0107] The control sequence may also be a suitable transcription
terminator sequence, a sequence recognized by a bacterial cell to
terminate transcription. The terminator sequence is operably linked
to the 3' terminus of the nucleotide sequence encoding a
polypeptide having biological activity. Any terminator that is
functional in the bacterial host cell of choice may be used in the
present invention.
[0108] Leader.
[0109] The control sequence may also be a suitable leader sequence,
a nontranslated region of a mRNA that is important for translation
by the bacterial cell. The leader sequence is operably linked to
the 5' terminus of the nucleotide sequence directing synthesis of
the polypeptide having biological activity. Any leader sequence
that is functional in the bacterial host cell of choice may be used
in the present invention.
[0110] Signal Peptide Coding Region.
[0111] The control sequence may also be a signal peptide coding
region, which codes for an amino acid sequence linked to the amino
terminus of a polypeptide that can direct the expressed polypeptide
into the cell's secretory pathway. The signal peptide coding region
may be native to the polypeptide or may be obtained from foreign
sources. The 5' end of the coding sequence of the polynucleotide
encoding the polypeptide may inherently contain a signal peptide
coding region naturally linked in translation reading frame with
the segment of the coding region that encodes the secreted
polypeptide. Alternatively, the 5' end of the coding sequence may
contain a signal peptide coding region that is foreign to that
portion of the coding sequence that encodes the secreted
polypeptide. The foreign signal peptide coding region may be
required where the coding sequence does not naturally contain a
signal peptide coding region. Alternatively, the foreign signal
peptide coding region may simply replace the natural signal peptide
coding region in order to obtain enhanced secretion of the
polypeptide relative to the natural signal peptide coding region
normally associated with the coding sequence. The signal peptide
coding region may be obtained, for example, from an amylase or a
protease gene from a Bacillus species. However, any signal peptide
coding region capable of directing the expressed polypeptide into
the secretory pathway of a bacterial host cell of choice may be
used in the present invention.
[0112] An effective signal peptide coding region for bacterial
cells, e.g., Bacillus cells, is the signal peptide coding region
obtained from the maltogenic amylase gene from Bacillus NCIB 11837,
the Bacillus stearothermophilus alpha-amylase gene, the Bacillus
licheniformis subtilisin gene, the Bacillus licheniformis
beta-lactamase gene, the Bacillus stearothermophilus neutral
proteases genes (nprT, nprS, nprM), and the Bacillus subtilis prsA
gene. Further signal peptides are described by Simonen and Palva,
1993, Microbiological Reviews 57:109-137.
[0113] Selectable Markers.
[0114] A nucleic acid construct may further contain one or more
(several) selectable markers that permit easy selection of
transformed cells. A selectable marker is a gene the product of
which provides for biocide resistance, resistance to heavy metals,
prototrophy to auxotrophs, and the like. Examples of bacterial
selectable markers are the dal genes from Bacillus subtilis or
Bacillus licheniformis, or markers that confer antibiotic
resistance, such as ampicillin, kanamycin, erythromycin,
chloramphenicol or tetracycline resistance. Furthermore, selection
may be accomplished by co-transformation, e.g., as described in WO
91/09129, where the selectable marker is on a separate vector.
[0115] The nucleic acid construct can then be introduced into a
bacterial host cell using methods known in the art or those methods
described herein for expressing the polypeptide having biological
activity. The bacterial host cell may contain one or more (several)
copies of the same nucleic acid construct or one or more (several)
copies of at least two different nucleic acid constructs, wherein
each of the constructs are constructed as described supra.
Expression Vectors
[0116] In the methods of the present invention, a recombinant
expression vector can be constructed comprising a promoter region
operably linked to a polynucleotide sequence encoding a polypeptide
having biological activity and a modified mRNA
processing/stabilizing sequence of the present invention, which is
located downstream of the promoter region and upstream of the
ribosome binding site of the polynucleotide sequence encoding the
polypeptide having biological activity. The various nucleic acid
and control sequences described above may be joined together to
produce a recombinant expression vector that may include one or
more (several) convenient restriction sites to allow for insertion
or substitution of the polynucleotide at such sites. Alternatively,
the polynucleotide sequence encoding the polypeptide having
biological activity may be expressed by inserting the
polynucleotide sequence or a nucleic acid construct comprising the
polynucleotide sequence into an appropriate vector for expression.
In creating the expression vector, the polynucleotide sequence
encoding the polypeptide having biological activity is located in
the vector so that the coding sequence is operably linked to a
promoter region and a modified mRNA processing/stabilizing
sequence, and any other appropriate control sequences for
expression, and possibly translocation.
[0117] The recombinant expression vector may be any vector that can
be conveniently subjected to recombinant DNA procedures and can
bring about expression of the polypeptide having biological
activity on introduction into a bacterial host cell. The choice of
the vector will typically depend on the compatibility of the vector
with the bacterial host cell into which the vector is to be
introduced. The vectors may be linear or closed circular plasmids.
The vector may be an autonomously replicating vector, i.e., a
vector that exists as an extrachromosomal entity, the replication
of which is independent of chromosomal replication, e.g., a
plasmid, an extrachromosomal element, a minichromosome, or an
artificial chromosome. The vector may contain any means for
assuring self-replication. Alternatively, the vector may be one
that, when introduced into the bacterial host cell, is integrated
into the chromosome and replicated together with the chromosome
into which it has been integrated. The vector system may be a
single vector or plasmid or two or more vectors or plasmids, or a
transposon.
[0118] "Introduction" means introducing a vector into a bacterial
host cell so that the vector is maintained as a chromosomal
integrant or as a self-replicating extrachromosomal vector.
Integration is generally considered to be an advantage as the one
or more (several) coding sequences or genes are more likely to be
stably maintained in the cell. Integration of the vector into the
chromosome occurs by homologous recombination, non-homologous
recombination, or transposition.
[0119] The introduction of an expression vector into a bacterial
host cell may, for instance, be effected by transformation,
transfection, transduction, conjugation, and the like
[0120] For integration, the vector may rely on any component of the
vector for stable integration of the vector into the genome by
homologous recombination. The vector may contain additional
polynucleotide sequences for directing integration by homologous
recombination into the genome of the bacterial host cell. The
additional polynucleotide sequences enable the vector to be
integrated into the bacterial host cell genome at a precise
location in the chromosome. To increase the likelihood of
integration at a precise location, the integrational components
should preferably contain a sufficient number of nucleic acids,
such as 100 to 10,000 base pairs, preferably 400 to 10,000 base
pairs, and most preferably 800 to 10,000 base pairs, which are
highly homologous with the corresponding target sequence to enhance
the probability of homologous recombination. The integrational
components may be any polynucleotide sequence that is homologous
with the target sequence in the genome of the bacterial host cell.
Furthermore, the integrational components may be non-encoding or
encoding sequences.
[0121] For autonomous replication, the vector may further comprise
an origin of replication enabling the vector to replicate
autonomously in the Bacillus cell in question. Examples of
bacterial origins of replication are the origins of replication of
plasmids pBR322, pUC19, pACYC177, and pACYC184 permitting
replication in E. coli, and pUB110, pE194, pTA1060, and pAMR1
permitting replication in Bacillus. The origin of replication may
be one having a mutation to make its function temperature-sensitive
in the bacterial host cell (see, e.g., Ehrlich, 1978, Proceedings
of the National Academy of Sciences USA 75: 1433).
[0122] The procedures used to ligate the components described above
to construct the recombinant expression vectors are well known to
one skilled in the art (see, e.g., Sambrook et al., 1989,
supra).
Bacterial Host Cells
[0123] The present invention also relates to bacterial host cells
comprising a promoter region operably linked to a polynucleotide
sequence encoding a polypeptide having biological activity and a
modified mRNA processing/stabilizing sequence of the present
invention, which is located downstream of the promoter region and
upstream of the ribosome binding site of the polynucleotide
sequence encoding the polypeptide having biological activity,
wherein the modified mRNA processing/stabilizing sequence promotes
higher expression of the polynucleotide sequence compared to an
unmodified mRNA processing/stabilizing sequence. In a preferred
aspect, the bacterial cell is free of a foreign (heterologous)
selectable marker gene.
[0124] The present invention also relates to methods of obtaining a
bacterial host cell, comprising introducing into a bacterial cell a
nucleic acid construct comprising a promoter region operably linked
to a polynucleotide sequence encoding a polypeptide having
biological activity and a modified mRNA processing/stabilizing
sequence of the present invention, which is located downstream of
the promoter region and upstream of the ribosome binding site of
the polynucleotide sequence encoding the polypeptide having
biological activity, wherein the modified mRNA
processing/stabilizing sequence promotes higher expression of the
polynucleotide sequence compared to an unmodified mRNA
processing/stabilizing sequence.
[0125] The bacterial host cell may be any Gram positive bacterium
or a Gram negative bacterium. Gram positive bacteria include, but
not limited to, Bacillus, Streptococcus, Streptomyces,
Staphylococcus, Enterococcus, Lactobacillus, Lactococcus,
Clostridium, Geobacillus, and Oceanobacillus. Gram negative
bacteria include, but not limited to, E. coli, Pseudomonas,
Salmonella, Campylobacter, Helicobacter, Flavobacterium,
Fusobacterium, Ilyobacter, Neisseria, and Ureaplasma.
[0126] In the methods of the present invention, the bacterial host
cell may be any Bacillus cell. Bacillus cells useful in the
practice of the present invention include, but are not limited to,
Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus
atrophaeus, Bacillus brevis, Bacillus circulans, Bacillus clausii,
Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus
lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus
mojavensis, Bacillus pumilus, Bacillus stearothermophilus, Bacillus
subtilis, Bacillus thuringiensis, and Bacillus vallismortis
cells.
[0127] In a preferred aspect, the bacterial host cell is a Bacillus
amyloliquefaciens, Bacillus lentus, Bacillus licheniformis,
Bacillus stearothermophilus, or Bacillus subtilis cell. In a more
preferred aspect, the bacterial host cell is a Bacillus
amyloliquefaciens cell. In another more preferred aspect, the
bacterial host cell is a Bacillus clausii cell. In another more
preferred aspect, the bacterial host cell is a Bacillus
licheniformis cell. In another more preferred aspect, the bacterial
host cell is a Bacillus subtilis cell.
[0128] In the methods of the present invention, the bacterial host
cell may be any Streptococcus cell. Streptococcus cells useful in
the practice of the present invention include, but are not limited
to, Streptococcus equisimilis, Streptococcus pyogenes,
Streptococcus uberis, and Streptococcus equi subsp.
Zooepidemicus.
[0129] In another preferred aspect, the bacterial host cell is a
Streptococcus equisimilis cell. In another preferred aspect, the
bacterial host cell is a Streptococcus pyogenes cell. In another
preferred aspect, the bacterial host cell is a Streptococcus uberis
cell. In another preferred aspect, the bacterial host cell is a
Streptococcus equi subsp. Zooepidemicus cell.
[0130] In the methods of the present invention, the bacterial host
cell may be any Streptomyces cell. Streptomyces cells useful in the
practice of the present invention include, but are not limited to,
Streptomyces achromogenes, Streptomyces avermitilis, Streptomyces
coelicolor, Streptomyces griseus, and Streptomyces lividans.
[0131] In another preferred aspect, the bacterial host cell is a
Streptomyces achromogenes cell. In another preferred aspect, the
bacterial host cell is a Streptomyces avermitilis cell. In another
preferred aspect, the bacterial host cell is a Streptomyces
coelicolor cell. In another preferred aspect, the bacterial host
cell is a Streptomyces griseus cell. In another preferred aspect,
the bacterial host cell is a Streptomyces lividans cell.
[0132] In a further aspect of the present invention, the bacterial
host cells may additionally contain modifications, e.g., deletions
or disruptions, of other genes that may be detrimental to the
production, recovery, and/or application of a polypeptide having
biological activity. In a preferred aspect, a bacterial host cell
is a protease-deficient cell. In a more preferred aspect, the
bacterial host cell, e.g., Bacillus cell, comprises a disruption or
deletion of aprE and nprE. In another preferred aspect, the
bacterial host cell does not produce spores. In another more
preferred aspect, the bacterial host cell, e.g., Bacillus cell,
comprises a disruption or deletion of spollAC. In another preferred
aspect, the bacterial host cell, e.g., Bacillus cell, comprises a
disruption or deletion of one of the genes involved in the
biosynthesis of surfactin, e.g., srfA, srfB, srfC, and srfD. See,
for example, U.S. Pat. No. 5,958,728. Other genes, e.g., the amyE
gene, which are detrimental to the production, recovery, and/or
application of a polypeptide having biological activity may also be
disrupted or deleted.
[0133] The introduction of DNA into a Bacillus cell may, for
instance, be effected by protoplast transformation (see, e.g.,
Chang and Cohen, 1979, Molecular General Genetics 168: 111-115), by
using competent cells (see, e.g., Young and Spizizen, 1961, Journal
of Bacteriology 81: 823-829, or Dubnau and Davidoff-Abelson, 1971,
Journal of Molecular Biology 56: 209-221), by electroporation (see,
e.g., Shigekawa and Dower, 1988, Biotechniques 6: 742-751), or by
conjugation (see, e.g., Koehler and Thorne, 1987, Journal of
Bacteriology 169: 5271-5278). The introduction of DNA into an E
coli cell may, for instance, be effected by protoplast
transformation (see, e.g., Hanahan, 1983, J. Mol. Biol. 166:
557-580) or electroporation (see, e.g., Dower et al., 1988, Nucleic
Acids Res. 16: 6127-6145). The introduction of DNA into a
Streptomyces cell may, for instance, be effected by protoplast
transformation and electroporation (see, e.g., Gong et al., 2004,
Folia Microbiol. (Praha) 49: 399-405), by conjugation (see, e.g.,
Mazodier et al., 1989, J. Bacteriol. 171: 3583-3585), or by
transduction (see, e.g., Burke et al., 2001, Proc. Natl. Acad. Sci.
USA 98:6289-6294). The introduction of DNA into a Pseudomonas cell
may, for instance, be effected by electroporation (see, e.g., Choi
et al., 2006, J. Microbiol. Methods 64: 391-397) or by conjugation
(see, e.g., Pinedo and Smets, 2005, Appl. Environ. Microbiol. 71:
51-57). The introduction of DNA into a Streptococcus cell may, for
instance, be effected by natural competence (see, e.g., Perry and
Kuramitsu, 1981, Infect. Immun. 32: 1295-1297), by protoplast
transformation (see, e.g., Catt and Jollick, 1991, Microbios. 68:
189-2070, by electroporation (see, e.g., Buckley et al., 1999,
Appl. Environ. Microbiol. 65: 3800-3804), or by conjugation (see,
e.g., Clewell, 1981, Microbiol. Rev. 45: 409-436). However, any
method known in the art for introducing DNA into a host cell can be
used.
Production
[0134] In the production methods of the present invention, the
bacterial host cells are cultivated in a nutrient medium suitable
for production of the polypeptide having biological activity using
methods known in the art. For example, the cell may be cultivated
by shake flask cultivation, or small-scale or large-scale
fermentation (including continuous, batch, fed-batch, or solid
state fermentations) in laboratory or industrial fermentors
performed in a suitable medium and under conditions allowing the
polypeptide having biological activity to be expressed and/or
isolated. The cultivation takes place in a suitable nutrient medium
comprising carbon and nitrogen sources and inorganic salts, using
procedures known in the art. Suitable media are available from
commercial suppliers or may be prepared according to published
compositions (e.g., in catalogues of the American Type Culture
Collection). If the polypeptide having biological activity is
secreted into the nutrient medium, it can be recovered directly
from the medium. If the polypeptide having biological activity is
not secreted, it can be recovered from cell lysates.
[0135] The polypeptide having biological activity may be detected
using methods known in the art that are specific for the
polypeptide having biological activity. These detection methods may
include use of specific antibodies, high performance liquid
chromatography, capillary chromatography, formation of an enzyme
product, disappearance of an enzyme substrate, or SDS-PAGE. For
example, an enzyme assay may be used to determine the activity of
the enzyme. Procedures for determining enzyme activity are known in
the art for many enzymes (see, for example, D. Schomburg and M.
Salzmann (eds.), Enzyme Handbook, Springer-Verlag, New York,
1990).
[0136] The resulting polypeptide having biological activity may be
isolated using methods well known in the art. For example, the
polypeptide having biological activity may be isolated from the
nutrient medium by conventional procedures including, but not
limited to, centrifugation, filtration, extraction, spray-drying,
evaporation, or precipitation. The isolated polypeptide having
biological activity may then be further purified by a variety of
procedures known in the art including, but not limited to,
chromatography (e.g., ion exchange, affinity, hydrophobic,
chromatofocusing, and size exclusion), electrophoretic procedures
(e.g., preparative isoelectric focusing), differential solubility
(e.g., ammonium sulfate precipitation), or extraction (see, e.g.,
Protein Purification, J.-C. Janson and Lars Ryden, editors, VCH
Publishers, New York, 1989).
[0137] In the methods of the present invention, the bacterial host
cell preferably produces at least 15%, preferably at least 25%,
more preferably at least 50%, more preferably at least 75%, more
preferably at least 100%, more preferably at least 150%, more
preferably at least 200%, more preferably at least 250%, even more
preferably at least 300%, most preferably at least 400%, and even
most preferably at least 500% more of the polypeptide having
biological activity relative to a bacterial host containing the
promoter region operably linked to a polynucleotide sequence
encoding the polypeptide having biological activity and the parent
mRNA processing/stabilizing sequence located downstream of the
promoter region and upstream of the ribosome binding site of the
polynucleotide sequence encoding the polypeptide having biological
activity when cultured under identical production conditions.
Deletions/Disruptions
[0138] The present invention also relates to methods of producing a
selectable marker-free mutant of a bacterial host cell, comprising
deleting a selectable marker gene of the bacterial host cell,
wherein the bacterial cell comprises a nucleic acid construct
comprising a promoter region operably linked to a polynucleotide
sequence encoding a polypeptide having biological activity and a
modified mRNA processing/stabilizing sequence located downstream of
the promoter region and upstream of the ribosome binding site of
the polynucleotide sequence encoding the polypeptide having
biological activity, wherein the modified mRNA
processing/stabilizing sequence promotes higher expression of the
polynucleotide sequence compared to an unmodified mRNA
processing/stabilizing sequence.
[0139] Gene deletion or replacement techniques may be used for the
complete removal of a foreign or heterologous selectable marker
gene or other undesirable gene. In such methods, the deletion of
the selectable marker gene may be accomplished by homologous
recombination using a plasmid that has been constructed to
contiguously contain the 5' and 3' regions flanking the selectable
marker gene. For example, the contiguous 5' and 3' regions may be
introduced into a Bacillus cell on a temperature-sensitive plasmid,
e.g., pE194, in association with a second selectable marker at a
permissive temperature to allow the plasmid to become established
in the cell. The cell is then shifted to a non-permissive
temperature to select for cells that have the plasmid integrated
into the chromosome at one of the homologous flanking regions.
Selection for integration of the plasmid is effected by selection
for the second selectable marker. After integration, a
recombination event at the second homologous flanking region is
stimulated by shifting the cells to the permissive temperature for
several generations without selection. The cells are plated to
obtain single colonies and the colonies are examined for loss of
both selectable markers (see, for example, Perego, 1993, In A. L.
Sonneshein, J. A. Hoch, and R. Losick, editors, Bacillus subtilis
and Other Gram-Positive Bacteria, Chapter 42, American Society of
Microbiology, Washington, D.C., 1993).
[0140] A selectable marker gene may also be removed by homologous
recombination by introducing into the mutant cell a nucleic acid
fragment comprising 5' and 3' regions of the defective gene, but
lacking the selectable marker gene, followed by selecting on the
counter-selection medium. By homologous recombination, the
defective gene containing the selectable marker gene is replaced
with the nucleic acid fragment lacking the selectable marker gene.
Other methods known in the art may also be used.
[0141] The procedures described above can also be used to delete or
disrupt any undesirable gene. U.S. Pat. No. 5,891,701 discloses
techniques for deleting several genes including spollAC, aprE,
nprE, and amyE.
[0142] Other undesirable biological compounds may also be removed
by the above described methods such as the red pigment synthesized
by cypX (accession no. BG12580) and/or yvmC (accession no.
BG14121).
[0143] In a preferred aspect, the Bacillus host cell is unmarked
with any foreign or heterologous selectable markers. In another
preferred aspect, the Bacillus host cell does not produce any red
pigment synthesized by cypX and yvmC.
[0144] The present invention is further described by the following
examples that should not be construed as limiting the scope of the
invention.
EXAMPLES
DNA Sequencing
[0145] DNA sequencing was performed using an Applied Biosystems
Model 3130.times. Genetic Analyzer (Applied Biosystems, Foster
City, Calif., USA) using dye terminator chemistry (Giesecke et al.,
1992, Journal of Virol. Methods 38: 47-60). Sequences were
assembled using phred/phrap/consed (University of Washington,
Seattle, Wash., USA) with sequence specific primers.
Strains
[0146] Bacillus plasmids were constructed in Bacillus subtilis
168.DELTA.4. Bacillus subtilis 168.DELTA.4 is derived from the
Bacillus subtilis type strain 168 (BGSC 1A1, Bacillus Genetic Stock
Center, Columbus, Ohio, USA) and has deletions in the spollAC,
aprE, nprE, and amyE genes. The deletion of these four genes was
performed essentially as described for Bacillus subtilis
A164.DELTA.5, which is described in detail in U.S. Pat. No.
5,891,701.
Media
[0147] LB medium was composed per liter of 10 g of tryptone, 5 g of
yeast extract, and 5 g of NaCl.
[0148] LB plates were composed of LB medium and 15 g of bacto agar
per liter.
[0149] LB ampicillin medium was composed of LB medium and 100 .mu.g
of ampicillin per ml.
[0150] LB ampicillin plates were composed of LB ampicillin medium
and 15 g of bacto agar per liter.
[0151] VY medium was composed per liter of 25 g of veal infusion
(BD Diagnostics, Franklin Lakes, N.J., USA) and 5 g of yeast
extract.
[0152] 2.times.YT medium was composed per liter of 16 g of
Tryptone, 10 g of yeast extract, and 5 g of NaCl.
[0153] 2.times.YT ampicillin medium was composed of 2.times.YT
medium and 100 .mu.g of ampicillin per ml.
[0154] 2.times.YT ampicillin plates were composed per liter of
2.times.YT ampicillin medium and 15 g of bacto agar.
[0155] TBAB medium was composed of Difco Tryptose Blood Agar Base
(BD Diagnostics, Franklin Lakes, N.J., USA).
[0156] TBAB chloramphenicol plates were composed of TBAB medium and
5 .mu.g of chloramphenicol per ml.
[0157] TBAB neomycin plates were composed of TBAB medium and 6
.mu.g of neomycin per ml.
[0158] TBAB erythromycin/lincomycin plates were composed of TBAB
medium and 1 .mu.g of erythromycin and 25 .mu.g of lincomycin per
ml.
[0159] TBAB milk plates were composed of TBAB medium overlaid with
a milk overlay composed of 0.6 ml of a sterile 10% solution of
powdered milk dissolved in deionized water added to 6 ml of melted
TBAB agar.
[0160] PS-1 medium was composed per liter of 100 g sucrose, 40 g of
soybean flour, 3.96 g of disodium phosphate (anhydrous), 5 g of
CaCO.sub.3, and 100 .mu.l of pluronic acid.
Example 1
Construction of a Consensus cryIIIA Promoter
[0161] A consensus version of the cryIIIA promoter was constructed
in which the native -35 and -10 regions were changed to those of a
consensus sigma A-dependent promoter. The consensus cryIIIA (cry3A)
promoter was constructed by annealing two complementary 97
nucleotide oligos, 999555 and 999556.
TABLE-US-00001 Oligo 999555: (SEQ ID NO: 7)
5'-CGGGCCTTAAGGGCCCTCGAAACGTAAGATGAAACCTTAGATAAA
AGTGCTTTTTTTGTTGACATTGAAGAATTATTAATGTTATAATTAATT AAGG-3' Oligo
999556: (SEQ ID NO: 8)
5'-CCTTAATTAATTATAACATTAATAATTCTTCAATGTCAACAAAAA
AAGCACTTTTATCTAAGGTTTCATCTTACGTTTCGAGGGCCCTTAAGG CCCG-3'
[0162] Two 20 .mu.l annealing reactions were performed containing
10 .mu.l (500 .mu.mol) and 5 .mu.l (250 pmol) of each oligo,
respectively. Both reactions were incubated at 95.degree. C. for 5
minutes, and then the tubes were cooled gradually to room
temperature. The resulting annealed product from each reaction was
an approximately 97 bp double-stranded DNA fragment including the
consensus -35 and -10 promoter regions, an Sfi I restriction site
at the 5' end, and a Pac I site at the 3' end.
[0163] Each annealed product was amplified by PCR using 2 .mu.l (25
or 12.5 .mu.mol) of the annealed product as template with primers
999557 and 999558, using an EXPAND.RTM.High Fidelity PLUS PCR
System (Roche Applied Science, Indianapolis, Ind., USA), according
to manufacturer's instructions.
TABLE-US-00002 Primer 999557: (SEQ ID NO: 9)
5'-CGGGCCTTAAGGGCCCTCGAA-3' Primer 999558: (SEQ ID NO: 10)
5'-CCTTAATTAATTATAACATT-3'
[0164] The products of the two PCR reactions, which were the same,
were pooled, analyzed by 2.0% agarose electrophoresis with 50 mM
Tris base-50 mM boric acid-1 mM disodium EDTA (TBE) buffer, and
purified using a QIAQUICK.RTM. Gel Extraction Kit (QIAGEN Inc.,
Valencia, Calif., USA).
[0165] The purified 97 bp PCR product was then cloned into pCR2.1
using a TOPO.RTM. TA Cloning Kit (Invitrogen, Carlsbad, Calif.,
USA) and transformed into ONE SHOT.RTM. TOP10 Chemically Competent
E. coli cells (Invitrogen, Carlsbad, Calif., USA) according to the
manufacturer's instructions. Plasmid DNA from several transformants
was purified using a BIOROBOT.RTM. 9600 (QIAGEN Inc., Valencia,
Calif., USA) and tested for the presence of the cloned PCR fragment
by digestion with Eco RI followed by 0.8% agarose electrophoresis
in TBE buffer. One plasmid with Eco RI fragments of approximately
3.94 kb and 115 bp was designated pCR2.1-consensus cryIIIA. The DNA
sequence of the cloned PCR fragment was confirmed by DNA
sequencing.
[0166] Plasmid pCR2.1-consensus cryIIIA was digested with Sfi I and
Pac I and analyzed by 2.0% agarose electrophoresis in TBE buffer,
and an approximately 82 bp fragment bearing the consensus cryIIIA
promoter was purified using a QIAQUICK.RTM. Gel Extraction Kit.
Plasmid pNBT2 (pDG268.DELTA.-P.sub.cryIIIA/cryIIIAstab/SAV, U.S.
Pat. No. 6,255,076) was digested with Sfi I and Pac I and analyzed
by 2.0% agarose electrophoresis in TBE buffer, and an approximately
7162 bp vector fragment was purified using a QIAQUICK.RTM. Gel
Extraction Kit. The pNBT2 vector fragment and consensus cryIIIA
promoter fragment were ligated together with T4 DNA ligase (Roche
Diagnostics Corporation, Indianapolis, Ind., USA) according to the
manufacturer's instructions, and E. coli XL10-GOLD.RTM.
Ultracompetent cells (Stratagene Corporation, La Jolla, Calif.,
USA) were transformed with the ligation according to manufacturer's
instructions. Plasmid DNA from several transformants was purified
using a BIOROBOT.RTM. 9600 and tested by digestion with Eco RI and
Sfi I followed by 0.8% agarose electrophoresis in TBE buffer. One
plasmid with expected fragments of approximately 5799 bp and 1446
bp was designated pGME079 (FIG. 2).
[0167] Plasmid pGME079 was linearized by digestion with Sca I.
Bacillus subtilis 168.DELTA.4 was transformed with the linearized
plasmid according to the procedure of Anagnostopoulos and Spizizen,
1961, J. Bacteriol. 81: 741-746, and transformants were selected
for chloramphenicol resistance on TBAB chloramphenicol plates at
37.degree. C. One transformant with the P.sub.consensus
cryIIIA/cryIIIA stab/aprH cassette inserted at the amyL locus was
designated Bacillus subtilis GME201.
Example 2
Construction of a Modified cryIIIA mRNA Processing/Stabilizing
Sequence
[0168] A modified mRNA processing/stabilizing sequence was
constructed comprising a second Shine-Dalgarno sequence in addition
to the native cryIIIA mRNA processing/stabilizing sequence.
[0169] An approximately 524 bp fragment, comprising the cryIIIA
mRNA processing/stabilizing sequence, was amplified by PCR from
plasmid pNBT3 (pDG268.DELTA.Neo-P.sub.cryIIIA/cryIIIAstab/SAV, U.S.
Pat. No. 6,255,076) using primers 999255 and 999254 shown below.
The 5' end of primer 999254 incorporates the complement of an extra
Shine-Dalgarno sequence.
TABLE-US-00003 Primer 999255: (SEQ ID NO: 11)
5'-AGCTTAATTAAAGATAATAT-3' Primer 999254: (SEQ ID NO: 12)
5'-GGCTGGATCACCTCCTTTCTATCCATTAGACGGTGCAAAT-3'
[0170] An approximately 596 bp fragment, comprising the N-terminal
coding region of the Bacillus clausii alkaline protease gene
(aprH), was amplified from plasmid pNBT3 using primers 999253 and
999256 shown below. The 5end of primer 999253 incorporates an extra
Shine-Dalgarno sequence and is complementary to the 5end of primer
999254.
TABLE-US-00004 Primer 999253: (SEQ ID NO: 13)
5'-AGAAAGGAGGTGATCCAGCCGCACCTTATGAAAAATCATTTTATC-3' Primer 999256:
(SEQ ID NO: 14) 5'-AAGCTTGCGCCACCACGAAT-3'
[0171] Both PCRs were performed using 50 ng of plasmid pNBT3
template DNA, 0.4 .mu.M each of each primer, 200 .mu.M each of
dATP, dCTP, dGTP, and dTTP, 1.times.PCR Buffer II with 2.5 mM
MgCl.sub.2, and 2.5 units of Taq DNA polymerase in a 50 .mu.l
reaction volume. The reactions were performed in a ROBOCYCLER.RTM.
40 thermocycler (Stratagene Corporation, Lo Jolla, Calif., USA)
programmed for 1 cycle at 95.degree. C. for 2 minutes; 30 cycles
each at 95.degree. C. for 1 minute, 55.degree. C. for 1 minute, and
72.degree. C. for 2 minutes; and 1 cycle at 72.degree. C. for 5
minutes.
[0172] The two PCR reactions were analyzed by 0.8% agarose
electrophoresis in TBE buffer and the products were purified using
a QIAQUICK.RTM. Gel Extraction Kit. The two purified PCR products
were used as template DNA for a third PCR, using primers 999255 and
999256, which fused the two fragments via the complementary ends
provided by the sequences of primers 999593 and 999594.
[0173] The PCR was performed using 50 ng of each purified PCR
fragment, 200 .mu.m each of dATP, dCTP, dGTP, and dTTP, 1.times.
PCR Buffer II with 2.5 mM MgCl.sub.2, and 2.5 units of Taq DNA
polymerase. The reactions were performed in a ROBOCYCLER.RTM. 40
thermocycler programmed for 1 cycle at 95.degree. C. for 2 minutes;
5 cycles each at 95.degree. C. for 1 minute, 55.degree. C. for 1
minute, and 72.degree. C. for 2 minutes; 0.4 .mu.M each of each
primer was then added to the reaction and 25 cycles were performed,
each at 95.degree. C. for 1 minute, 55.degree. C. for 1 minute, and
72.degree. C. for 2 minutes; and finally 1 cycle at 72.degree. C.
for 5 minutes. The PCR products were visualized by 0.8% agarose
electrophoresis in TBE buffer.
[0174] The resulting approximately 1080 bp PCR product was cloned
into pCR2.1 using a TOPO.RTM. TA Cloning Kit and transformed into
ONE SHOT.RTM. TOP10 Chemically Competent E. coli cells according to
the manufacturer's instructions. Plasmid DNA from several
transformants was purified using a BIOROBOT.RTM. 9600 and analyzed
by DNA sequencing to identify those containing the desired modified
cryIIIA mRNA processing/stabilizing sequence. One plasmid with the
expected DNA sequence was designated pCR2.1-stabx2.
Example 3
Construction of Plasmid pNBT48
[0175] Plasmid pNBT3 (pDG268MCS.DELTA.neo-P.sub.cryIIIA/cryIIIA
stab/SAV; U.S. Pat. No. 5,955,310) was digested with Sfi I and Bam
HI and analyzed by 0.8% agarose electrophoresis in TBE buffer, and
an approximately 6704 bp vector fragment was purified using a
QIAQUICK.RTM. Gel Extraction Kit. Plasmid pNBT8
(pDG268MCS-P.sub.amyQ/SAV; U.S. Pat. No. 5,955,310) was digested
with Sfi I and Bam HI and analyzed by 0.8% agarose electrophoresis
in TBE buffer, and an approximately 1402 bp fragment comprising the
Bacillus amyloliquefaciens amyQ promoter and Bacillus clausii aprH
coding sequence was purified using a QIAQUICK.RTM. Gel Extraction
Kit. The pNBT3 vector fragment and the P.sub.amyQ-aprH fragment
were ligated together with T4 DNA ligase as described according to
the manufacturer's instructions, and E. coli DH5.alpha. cells
(Gibco BRL, Gaithersburg, Md., USA) were transformed with the
ligation according to the manufacturer's instructions, selecting
for ampicillin resistance on 2.times.YT ampicillin plates at
37.degree. C.
[0176] Plasmid DNA from one transformant was purified using a
QIAPREP.RTM. 8 Plasmid Kit (QIAGEN Inc., Valencia, Calif., USA) and
analyzed by restriction enzyme digestion with Nco I followed by
0.8% agarose electrophoresis in TBE buffer. One plasmid that
yielded expected DNA fragment sizes of approximately 6802 bp and
1304 bp was identified and designated pNBT48 (FIG. 3).
Example 4
Construction of an amyQ Promoter--Modified cryIIIA mRNA
Processing/Stabilizing Sequence
[0177] An amyQ promoter linked to a modified cryIIIA mRNA
processing/stabilizing sequence was constructed. Plasmid
pCR2.1-stabx2 was digested with Pac I, and the ends were blunted
using T4 DNA polymerase and dNTPs using standard methods. The
blunt-ended plasmid was then digested with Hind III and analyzed by
0.8% agarose electrophoresis in TBE buffer, and an approximately
1067 bp fragment, bearing the modified cryIIIA mRNA
processing/stabilizing sequence and aprH N-terminal coding region,
was purified using a QIAQUICK.RTM. Gel Extraction Kit.
[0178] Plasmid pNBT48 was digested with Ecl 13611 and Hind III and
analyzed by 0.8% agarose electrophoresis in TBE buffer, and an
approximately 7601 bp vector fragment was purified using a
QIAQUICK.RTM. Gel Extraction Kit. The pNBT48 vector fragment and
the modified cryIIIA mRNA processing/stabilizing sequence fragment
were ligated together with T4 DNA ligase according to the
manufacturer's instructions, and E. coli DH5.alpha. cells were
transformed with the ligation according to the manufacturer's
instructions, selecting for ampicillin resistance on 2.times.YT
ampicillin plates at 37.degree. C. Plasmid DNA from several
transformants was purified using a BIOROBOT.RTM. 9600 and analyzed
by restriction enzyme digestion with Nco I followed by 0.8% agarose
gel electrophoresis in TBE buffer. One plasmid that gave an
expected DNA fragment size of approximately 1800 bp was identified
and designated pNBT55 (pDG268.DELTA.Neo-P.sub.amyQ/mod. cryIIIA
stab/aprH) (FIG. 4).
Example 5
Construction of an amyQ Promoter--Modified cryIIIA mRNA
Processing/Stabilizing Sequence
[0179] An amyQ promoter linked to a modified cryIIIA mRNA
processing/stabilizing sequence was constructed. Plasmid pNBT55 was
linearized by digestion with Sca I. Bacillus subtilis 168.DELTA.4
was transformed with the linearized plasmid according to the
procedure of Anagnostopoulos and Spizizen, 1961, supra, and
transformants were selected for chloramphenicol resistance on TBAB
chloramphenicol plates at 37.degree. C. Chloramphenicol-resistant
transformants were screened for protease production by patching
colonies onto TBAB milk plates and scoring for clearing zones and
also for neomycin sensitivity by patching colonies onto TBAB
neomycin plates at 37.degree. C. to confirm that the DNA had
inserted into the amyE gene of the Bacillus subtilis chromosome by
double crossover. A chloramphenicol resistant, neomycin sensitive,
protease-producing transformant (with the P.sub.amyQ/mod. cryIIIA
stab/aprH cassette inserted at the amyE locus) was identified and
designated Bacillus subtilis BW199.
Example 6
Construction of an amyQ Promoter--Wild-Type cryIIIA mRNA
Processing/Stabilizing Sequence
[0180] An amyQ promoter linked to a wild-type cryIIIA mRNA
processing/stabilizing sequence was constructed. Plasmid pNBT3 was
digested with Pac I, and the ends were blunted using T4 DNA
polymerase and dNTPs. The blunt-ended plasmid was then digested
with Hind III and analyzed by 0.8% agarose electrophoresis in TBE
buffer, and an approximately 1067 bp fragment, bearing the
wild-type cryIIIA mRNA processing/stabilizing sequence and Bacillus
clausii alkaline protease gene (aprH) N-terminal coding region, was
purified using a QIAQUICK.RTM. Gel Extraction Kit.
[0181] The pNBT48 vector fragment of approximately 7601 bp (Example
4) and the wild-type cryIIIA mRNA processing/stabilizing sequence
fragment of approximately 1067 bp were ligated together with T4 DNA
ligase according to the manufacturer's instructions, and E. coli
DH5a cells were transformed with the ligation according to the
manufacturer's instructions, selecting for ampicillin resistance on
2.times.YT ampicillin plates at 37.degree. C. Plasmid DNA from
several transformants was purified using a BIOROBOT.RTM. 9600 and
analyzed by restriction enzyme digestion with Nco I followed 0.8%
agarose electrophoresis in TBE buffer. One plasmid that yielded an
expected DNA fragment size of approximately 1800 bp was identified
and designated pNBT56 (pDG268.DELTA.Neo-P.sub.amyQ/cryIIIA
stab/aprH) (FIG. 5).
Example 7
Construction of an amyQ Promoter--Wild-Type CryIIIa mRNA
Processing/Stabilizing Sequence
[0182] An amyQ promoter linked to a wild-type cryIIIA mRNA
processing/stabilizing sequence was constructed. Plasmid pNBT56 was
linearized by digestion with Sca I. Bacillus subtilis 168.DELTA.4
was transformed with the linearized plasmid according to the
procedure of Anagnostopoulos and Spizizen, 1961, supra, and
transformants were selected for chloramphenicol resistance on TBAB
chloramphenicol plates at 37.degree. C. Chloramphenicol-resistant
transformants were screened for protease production by patching
colonies onto TBAB milk plates and scoring for clearing zones and
also for neomycin sensitivity by patching colonies onto TBAB
neomycin plates at 37.degree. C. to confirm that the DNA had
inserted into the amyE gene of the Bacillus subtilis chromosome by
double crossover. A chloramphenicol resistant, neomycin sensitive,
protease-producing transformant (with the P.sub.amyQcryIIIA
stab/aprH cassette inserted at the amyE locus) was identified and
designated Bacillus subtilis BW198.
Example 8
Evaluation of an amyQ Promoter--Modified cryIIIA mRNA
Processing/Stabilizing Sequence
[0183] Production of Bacillus clausii alkaline protease (AprH) by
Bacillus subtilis strain BW199 was compared to the isogenic strain,
Bacillus subtilis strain BW198, which utilizes the wild-type
cryIIIA mRNA processing/stabilizing sequence. Both strains were
grown at 37.degree. C. in quadruplicate in 250 ml shake flasks
containing 25 ml of PS-1 medium. One ml samples were removed on
days 3 (T1), 4 (T2), and 5 (T3); and clarified supernatants were
assayed for protease activity.
[0184] Protease activity was measured according to the following
procedure. Culture supernatants were diluted appropriately in
sample buffer (0.01% TWEEN.RTM., 100 mM TRIS pH 8.5) followed by a
series dilution from 1-fold to 1/3-fold to 1/9-fold of the diluted
sample. Bacillus clausii alkaline protease standard (Novozymes A/S,
Bagsvrd, Denmark; 4,260 NPU/g) was diluted in sample buffer
accordingly to establish a linear standard curve. A total of 20
.mu.l of each dilution including standard was transferred to a
96-well flat-bottom plate. Two hundred microliters of a
Suc-Ala-Ala-Pro-Phe-pNA substrate solution (100 mg of
Suc-Ala-Ala-Pro-Phe-pNA per ml DMSO diluted 1:55.6 in 100 mM TRIS
pH 8.5) was added to each well, and the plate was incubated at
ambient temperature for 10 minutes. During the incubation the rate
of the reaction was measured at 405 nm using a BIOMEK.RTM. 3000
(Beckman Coulter, Inc, Fullerton Calif., USA). Sample
concentrations were determined by extrapolation from the generated
standard curve.
[0185] The relative results are shown in FIG. 6. Bacillus subtilis
cells harboring the modified cryIIIA mRNA processing/stabilizing
sequence produced on average approximately 65% more Bacillus
clausii alkaline protease by day 5 compared to cells harboring the
wild-type cryIIIA mRNA processing/stabilizing sequence. Thus, in
comparison to the wild-type cryIIIA mRNA processing/stabilizing
sequence, the modified cryIIIA mRNA processing/stabilizing sequence
provided a significant increase in productivity.
Example 9
Construction of an cryIIIA Promoter--Modified cryIIIA mRNA
Processing/Stabilizing Sequence
[0186] A cryIIIA promoter linked to a modified cryIIIA mRNA
processing/stabilizing sequence was constructed. Plasmid
pCR2.1-stabx2 was digested with Pac I and Sac I and analyzed by
0.8% agarose electrophoresis in TBE buffer, and an approximately
568 bp fragment bearing the modified cryIIIA mRNA
processing/stabilizing sequence was purified using a QIAQUICK.RTM.
Gel Extraction Kit. Plasmid pNBT2 was digested with Pac I and Sac I
and analyzed by 0.8% agarose electrophoresis in TBE buffer, and an
approximately 6704 bp vector fragment was purified using a
QIAQUICK.RTM. Gel Extraction Kit. The pNBT2 vector fragment and the
modified cryIIIA mRNA processing/stabilizing sequence fragment were
ligated together with T4 DNA ligase according to the manufacturer's
instructions, and E. coli XL10-Gold.RTM. Ultracompetent cells were
transformed with the ligation according to the manufacturer's
instructions, selecting for ampicillin resistance on 2.times. YT
ampicillin plates at 37.degree. C. Plasmid DNA from several
transformants was purified using a BIOROBOT.RTM. 9600 and tested by
digestion with Pac I and Eco RI followed by 0.8% agarose
electrophoresis in TBE buffer. One plasmid with expected fragments
of approximately 5882 bp and 1388 bp was designated pGME085 (FIG.
7).
[0187] Plasmid pGME085 was linearized by digestion with Bsa I and
Sca I and analyzed by 0.8% agarose electrophoresis in TBE buffer,
and an approximately 6851 bp vector fragment was purified using a
QIAQUICK.RTM. Gel Extraction Kit. Bacillus subtilis 168.DELTA.4 was
transformed with the purified plasmid fragment according to the
procedure of Anagnostopoulos and Spizizen, 1961, supra, and
transformants were selected for chloramphenicol resistance on TBAB
chloramphenicol plates at 37.degree. C. One transformant with the
P.sub.cryIIIA/mod. cryIIIA stab/aprH cassette inserted at the amyL
locus was designated Bacillus subtilis GME202.
Example 10
Construction of a Consensus cryIIIA Promoter--Modified cryIIIA mRNA
processing/stabilizing sequence
[0188] A cryIIIA promoter comprising consensus -35 and -10 regions
linked to a modified cryIIIA mRNA processing/stabilizing sequence
was constructed. Plasmid pGME079 was digested with Pac I and Sac I
and analyzed by 0.8% agarose electrophoresis in TBE buffer, and an
approximately 6704 bp vector fragment was purified using a
QIAQUICK.RTM. Gel Extraction Kit. The pGME079 vector fragment and
the modified cryIIIA mRNA processing/stabilizing sequence fragment
of approximately 568 bp (Example 9) were ligated together with T4
DNA ligase according to the manufacturer's instructions, and E.
coli XL10-GOLD.RTM. Ultracompetent cells were transformed with the
ligation according to the manufacturer's instructions, selecting
for ampicillin resistance on 2.times.YT ampicillin plates at
37.degree. C. Plasmid DNA from several transformants was purified
using a BIOROBOT.RTM. 9600 and tested by digestion with Pac I and
Sac I followed by 0.8% agarose electrophoresis in TBE buffer. One
plasmid with expected fragments of approximately 6704 bp and 566 bp
was designated pGME080 (FIG. 8).
[0189] Plasmid pGME080 was linearized by digestion with Bsa I and
Sac I and analyzed by 0.8% agarose electrophoresis in TBE buffer,
and an approximately 6851 bp vector fragment was purified using a
QIAQUICK.RTM. Gel Extraction Kit. Bacillus subtilis 168.DELTA.4 was
transformed with the purified plasmid fragment according to the
procedure of Anagnostopoulos and Spizizen, 1961, supra, and
transformants were selected for chloramphenicol resistance on TBAB
chloramphenicol plates at 37.degree. C. One transformant with the
P.sub.consensus cryIIIA/mod. cryIIIA stab/aprH cassette inserted at
the amyL locus was designated Bacillus subtilis GME203.
Example 11
Evaluation of Bacillus subtilis strains GME201, GME202, and
GME203
[0190] A Bacillus subtilis strain bearing the wild-type cryIIIA
promoter and unmodified (wild-type) cryIIIA mRNA
processing/stabilizing sequence was created to serve as a baseline
control for comparison to Bacillus subtilis strains GME201, GME202,
and GME203. Genomic DNA was isolated from Bacillus subtilis PL1801
spollE::Tn917 comprising the P.sub.cryIIIA/cryIIIA stab/aprH
cassette inserted at the amyE locus (U.S. Pat. No. 5,955,310),
according to the procedure of Pitcher et al., 1989, Lett. Appl.
Microbiol. 8: 151-156. Bacillus subtilis 168.DELTA.4 was
transformed with the genomic DNA according to the procedure of
Anagnostopoulos and Spizizen, 1961, supra, and transformants were
selected for chloramphenicol resistance on TBAB chloramphenicol
plates at 37.degree. C. One such transformant was designated
Bacillus subtilis GME200.
[0191] Bacillus subtilis strains GME200, GME201, GME202, and GME203
were grown at 37.degree. C. in triplicate in 250 ml shake flasks
containing 25 ml of PS-1 medium. One ml samples were removed on
days 3 (T1), 4 (T2), and 5 (T3) and clarified supernatants were
assayed for protease activity, as described in Example 8.
[0192] Mean relative Bacillus clausii alkaline protease production
values for the above cultures are shown in FIG. 9. The results
demonstrated that strains in which the protease was expressed from
the constructs comprising a consensus cryIIIA promoter and/or a
modified cryIIIA mRNA processing/stabilizing sequence (Bacillus
subtilis GME201, GME202, and GME203) all produced more protease
than Bacillus subtilis GME200, in which the protease was expressed
from the wild-type cryIIIA promoter linked to an unmodified cryIIIA
mRNA processing/stabilizing sequence. Bacillus subtilis GME202
provided a 73% increase in comparison to Bacillus subtilis GME200,
while Bacillus subtilis GME203 provided a 13% increase relative to
Bacillus subtilis GME201. Bacillus subtilis GME201 provided a 133%
increase in comparison to Bacillus subtilis GME200, while Bacillus
subtilis GME203 provided a 53% increase relative to Bacillus
subtilis GME202. The highest productivity was from the promoter
variant of Bacillus subtilis GME203, comprising both the consensus
P.sub.cryIIIA and the modified cryIIIA mRNA processing/stabilizing
sequence, which provided a 164% increase in comparison to Bacillus
subtilis GME200.
Example 12
Construction of Bacillus licheniformis host strain MDT283
[0193] Bacillus licheniformis SJ1904 (WO 94/014968) was transformed
with C-component gene deletion plasmid pNBT38 (U.S. Published
Application 20050221446) by electroporation according to the
procedure of Xue et al., 1999, J. Microbiol. Methods 34(3):
183-191. Briefly, 1-5 ml of an overnight culture of Bacillus
licheniformis grown in LBS medium was used to inoculate 50 ml of
fresh LBS medium, and the culture was incubated at 37.degree. C.
and 250 rpm. The culture was grown to stationary phase, and cells
were harvested by centrifugation at 6500.times.g when the culture
experienced an increase in growth rate after a period of slow
growth (1-3 hours after the end of exponential growth). Cells were
washed twice with 50 ml of ice-cold MSG (0.5 M mannitol, 0.5 M
sorbitol, 10% glycerol) and resuspended in approximately 750 .mu.l
of MSG. Cells were transformed as follows or stored at -20.degree.
C. Sixty .mu.l of electrocompetent cells were mixed with plasmid
DNA in an electroporation cuvette with a 1-mm electrode gap and
subjected to an electrical pulse using a GENE PULSER.RTM. set to 25
.mu.F, 200), and 1.0 kV. Electroporated cells were then transferred
to 950 .mu.l of LBSM medium containing 0.2 .mu.g of erythromycin
per ml for induction of erythromycin resistance. The transformants
were incubated for 2.5-3 hours at 34.degree. C. and 250 rpm and
then selected for erythromycin resistance on TBAB
erythromycin/lincomycin plates at 34.degree. C.
[0194] One such transformant was grown on TBAB plates with
erythromycin selection at 50.degree. C. in order to select for
integration of pNBT38 into the chromosome at the C-component gene.
One such integrant was then grown in VY medium without selection at
34.degree. C. in order to permit excision and loss of the
integrated plasmid. The culture was plated on LB plates at
37.degree. C., and colonies were screened for sensitivity to
erythromycin, indicating loss of the plasmid. Several
erythromycin-sensitive clones were tested by PCR with primers
991173 and 991176, as described in Example 2.
TABLE-US-00005 Primer 991173: (SEQ ID NO: 15)
5'-GAATTCGACGGCTTCCCGTGCGCC-3' Primer 991176: (SEQ ID NO: 16)
5'-AAGCTTCCATTCAAACCTGGTGAGGAAG-3'
[0195] One clone in which the PCR amplified a fragment of
approximately 606 bp, indicating deletion of the C-component
protease gene from the chromosome, was designated Bacillus
licheniformis MDT283.
Example 13
Construction of plasmid vectors pMDT131 and pMDT160
[0196] Plasmids pMDT131 and pMDT160 were constructed to create
temperature-sensitive plasmids conferring chloramphenicol
resistance.
[0197] Plasmid pMDT131 was constructed by insertion of a
chloramphenicol resistance gene into plasmid pMRT074 (U.S.
Published Application 20030175902). Plasmid pMRT074 was digested
with Eco RI, and the ends were blunted by incubation for 20 minutes
at 11.degree. C. with T4 DNA polymerase (Roche Diagnostics
Corporation, Indianapolis, Ind., USA) and 25 .mu.M of each dNTP,
followed by heat-inactivation of the polymerase by incubation for
10 minutes at 75.degree. C. The plasmid was then digested with Not
1, analyzed by 0.8% agarose electrophoresis in TBE buffer, and a
vector fragment of approximately 4355 bp was purified using a
QIAQUICK.RTM. Gel Extraction Kit. Plasmid pNBT1 (pDG268MCS; U.S.
Pat. No. 6,255,076) was digested with Eco 47111 and Not 1, analyzed
by 0.8% agarose electrophoresis in TBE buffer, and a fragment of
approximately 1222 bp, bearing a cat gene and a multiple cloning
site, was purified using a QIAQUICK.RTM. Gel Extraction Kit. The
pMRT074 vector fragment was ligated with the cat fragment using T4
DNA ligase according to the manufacturer's instructions, and
Bacillus subtilis 168.DELTA.4 was transformed with the ligation
according to the procedure of Anagnostopoulos and Spizizen, 1961,
supra, selecting for chloramphenicol resistance on TBAB
chloramphenicol plates at 34.degree. C. Plasmid DNA was isolated
from one transformant using a Plasmid Midi Kit (QIAGEN Inc.,
Valencia, Calif., USA) and confirmed by digestion with Bam HI
followed by 0.8% agarose electrophoresis in TBE buffer, which
yielded expected fragments of approximately 3779 bp and 1802 bp.
The resulting plasmid was designated pMDT131 (FIG. 10).
[0198] Plasmid pMDT159 was constructed by elimination of the Bam
HI, Sma I, and Asp 718 restriction sites of pMRT074. Plasmid
pMRT074 was digested with Bam HI and Asp 718, and the ends were
blunted by incubation for 20 minutes at 11.degree. C. with T4 DNA
and 25 .mu.M of each dNTP, followed by heat-inactivation of the
polymerase by incubation for 10 minutes at 75.degree. C. The
digested plasmid was analyzed by 0.8% agarose electrophoresis in
TBE buffer, and a vector fragment of approximately 6022 bp was
purified using a QIAQUICK.RTM. Gel Extraction Kit. The purified
fragment was treated with T4 DNA ligase according to the
manufacturer's instructions, and Bacillus subtilis strain
168.DELTA.4 was transformed with the ligation according to the
procedure of Anagnostopoulos and Spizizen, 1961, supra, selecting
for erythromycin resistance on TBAB erythromycin/lincomycin plates
at 34.degree. C. The resulting plasmid was designated pMDT159 (FIG.
11). Loss of the Bam HI, Sma 1, and Asp 718 sites was confirmed by
restriction digestion.
[0199] Plasmid pMDT160 was constructed by introduction of a
chloramphenicol resistance gene into pMDT159. Plasmid pMDT159 was
digested with Eco RI, and the ends were blunted by incubation for
20 minutes at 11.degree. C. with T4 DNA polymerase and 25 .mu.M of
each dNTP, followed by heat-inactivation of the polymerase by
incubation for 10 minutes at 75.degree. C. The plasmid was then
digested with Not I and analyzed by 0.8% agarose electrophoresis in
TBE buffer, and a vector fragment of approximately 4354 bp was
purified using a QIAQUICK.RTM. Gel Extraction Kit. Plasmid pNBT1
was digested with Eco 47111 and Not I, analyzed by 0.8% agarose
electrophoresis in TBE buffer, and a fragment of approximately 1222
bp bearing a cat gene and a multiple cloning site was purified
using a QIAQUICK.RTM. Gel Extraction Kit. The pMRT074 vector
fragment was ligated with the pNBT1 cat fragment using T4 DNA
ligase as described above, and Bacillus subtilis 168.DELTA.4 was
transformed with the ligation according to the procedure of
Anagnostopoulos and Spizizen, 1961, supra, selecting for
chloramphenicol resistance on TBAB chloramphenicol plates at
34.degree. C. Plasmid DNA was isolated from one transformant using
a Plasmid Midi Kit and confirmed by digestion with Xba I followed
by 0.8% agarose electrophoresis in TBE buffer, which yielded
expected fragments of approximately 2193 bp, 1817 bp, and 1566 bp.
The resulting plasmid was designated pMDT160 (FIG. 12).
Example 14
Construction of Plasmid pHyGe204
[0200] Plasmid pHyGe203 was constructed by insertion of the B.
licheniformis amyL fragments of pMRT044 (U.S. Published Application
20030175902) into plasmid vector pMDT160. Plasmid pMDT160 was
digested with Sma I and Hind III and analyzed by 1.0% agarose
electrophoresis in TAE (40 mM Tris-20 mM sodium acetate-1 mM EDTA
pH7.2) buffer, and a vector fragment of approximately 5531 bp was
purified using a QIAQUICK.RTM. Gel Extraction Kit. Plasmid pMRT044
was digested with Sma I and Hind III and analyzed by 1.0% agarose
electrophoresis in TAE buffer, and a fragment of approximately 1072
bp, bearing amyL upstream and downstream fragments, was purified
using a QIAQUICK.RTM. Gel Extraction Kit. The pMDT160 vector
fragment and pMRT044 amyL fragment were ligated together using a
Rapid Ligation Kit (Roche Diagnostics Corporation, Indianapolis,
Ind., USA) according to the manufacturer's instructions, and
Bacillus subtilis strain 168.DELTA.4 was transformed with the
ligation according to the procedure of Anagnostopoulos and
Spizizen, 1961, supra, selecting for chloramphenicol resistance on
TBAB chloramphenicol plates at 34.degree. C. The resulting plasmid
was designated pHyGe203 (FIG. 13). The plasmid was confirmed by
digestion with Nco I followed by 1.0% agarose electrophoresis in
TAE buffer, which yielded expected fragments of approximately 5343
bp and 1260 bp.
[0201] Plasmid pHyGe204 was constructed by insertion of the cryIIIA
mRNA processing/stabilizing sequence and Bacillus clausii aprH gene
of pNBT18 (pDG268MCS.DELTA.neo-long cryIIIA stab/SAV, U.S. Pat. No.
6,255,076) between the amyL upstream and downstream fragments of
pHyGe203. Plasmid pHyGe203 was digested with Ecl 136II and Barn II
and analyzed by 1.0% agarose electrophoresis in TAE buffer, and a
vector fragment of approximately 6586 bp was purified using a
QIAQUICK.RTM. Gel Extraction Kit. Plasmid pNBT18 was digested with
Pac I, and the ends were blunted by incubation for 20 minutes at
11.degree. C. with T4 DNA polymerase and 25 .mu.M of each dNTP. The
digested plasmid was then digested with Bam HI and analyzed by 1.0%
agarose electrophoresis in TAE buffer, and a fragment of
approximately 1768 bp, bearing the cryIIIA mRNA
processing/stabilizing sequence and Bacillus clausii aprH gene, was
purified using a QIAQUICK.RTM. Gel Extraction Kit. The pHyGe203
vector fragment and the mRNA processing/stabilizing sequence/aprH
fragment were ligated using a Rapid Ligation Kit according to the
manufacturer's instructions, and Bacillus subtilis strain
168.DELTA.4 was transformed with the ligation according to the
procedure of Anagnostopoulos and Spizizen, 1961, supra, selecting
for chloramphenicol resistance on TBAB chloramphenicol plates at
34.degree. C. The resulting plasmid was designated pHyGe204. The
plasmid was confirmed by digestion with Nco 1 and with Hind III
followed by 1.0% agarose electrophoresis in TAE buffer, which
yielded expected fragments of approximately 6249 bp and 2103 bp for
Nco 1 and 6743 bp and 1609 bp for Hind III.
Example 15
Construction of Plasmid pHyGe205
[0202] Plasmid pHyGe205 was constructed by insertion of the
modified cryIIIA mRNA processing/stabilizing sequence and Bacillus
clausii aprH gene of pGME080 between the amyL upstream and
downstream fragments of pHyGe203. Plasmid pGME080 was digested with
Pac I, and the ends were blunted by incubation for 20 minutes at
11.degree. C. with T4 DNA polymerase and 25 .mu.M of each dNTP. The
digested plasmid was then digested with Bam HI and analyzed by 1.0%
agarose electrophoresis in TAE buffer, and a fragment of
approximately 1793 bp, bearing the modified cryIIIA mRNA
processing/stabilizing sequence and Bacillus clausii aprH gene, was
purified using a QIAQUICK.RTM. Gel Extraction Kit. The pHyGe203 Ed
136II/Bam HI vector fragment (described above) and the modified
mRNA processing/stabilizing sequence/aprH fragment were ligated
using a Rapid Ligation Kit according to the manufacturer's
instructions, and Bacillus subtilis strain 168.DELTA.4 was
transformed with the ligation according to the procedure of
Anagnostopoulos and Spizizen, 1961, supra, selecting for
chloramphenicol resistance on TBAB chloramphenicol plates at
34.degree. C. The resulting plasmid was designated pHyGe205 (FIG.
14). The plasmid was confirmed by digestion with Nco I and with
Hind III followed by 1.0% agarose electrophoresis in TAE buffer,
which yielded expected fragments of approximately 6274 bp and 2103
bp for Nco 1 and 6743 bp and 1634 bp for Hind III.
Example 16
Construction of Plasmid pHyGe206
[0203] A fragment bearing a triple tandem promoter was cloned by
PCR from Bacillus licheniformis strain MDT220 (U.S. Published
Application 20050221446). Genomic DNA was isolated from Bacillus
licheniformis strain MDT220 according to the procedure of Pitcher
et al., 1989, supra. A fragment bearing the
P.sub.amyL4199/P.sub.short consensus amyQ/P.sub.cryIIIA triple
tandem promoter was PCR amplified from Bacillus licheniformis
MDT220 genomic DNA using oligonucleotide primers 994112 and 060762
with an Expand High Fidelity PCR System (Roche Diagnostics
Corporation, Indianapolis, Ind., USA) according to manufacturer's
instructions. The PCR was performed in an Eppendorf Mastercylcer
Gradient thermal cycler programmed for 1 cycle at 94.degree. C. for
2 minutes; 11 cycles each at 94.degree. C. for 30 seconds,
58.degree. C. for 30 seconds, 72.degree. C. for 1 minute 15
seconds; 15 cycles each at 94.degree. C. for 30 seconds, 58.degree.
C. for 30 seconds, 72.degree. C. for 1 minute 15 seconds plus 5
seconds for each successive cycle; and 1 cycle at 72.degree. C. for
7 minutes.
TABLE-US-00006 Primer 994112: (SEQ ID NO: 17)
5'-GCGGCCGCTCGCTTTCCAATCTGA-3' Primer 060762: (SEQ ID NO: 18)
5'-ATCGATAATAATTTATACACTATTCTATTGG-3'
[0204] The resulting PCR product of approximately 991 bp was
purified using a QIAQUICK.RTM. PCR Purification Kit (QIAGEN Inc.,
Valencia, Calif.) according to the manufacturer's instructions,
cloned into pCR2.1 using a TOPO.RTM. TA Cloning Kit, and
transformed into ONE SHOT.RTM. TOP10 Chemically Competent E. coli
cells according to the manufacturer's instructions. The resulting
plasmid was designated pHyGe201 (FIG. 15). The sequence of the
triple tandem promoter in pHyGe201 was confirmed by DNA
sequencing.
[0205] Plasmid pHyGe206 was constructed by insertion of a triple
tandem promoter from plasmid pHyGe201 into plasmid vector pMDT131.
Plasmid pMDT131 was digested with Cla I and Not I and analyzed by
1.0% agarose electrophoresis in TAE buffer, and a vector fragment
of approximately 5568 bp was purified using a QIAQUICK.RTM. Gel
Extraction Kit. Plasmid pHyGe201 was digested with Cla I and Not I
and analyzed by 1.0% agarose electrophoresis in TAE buffer, and a
vector fragment of approximately 983 bp, bearing a triple tandem
promoter, was purified using a QIAQUICK.RTM. Gel Extraction Kit.
The pMDT131 vector fragment and the triple tandem promoter fragment
were ligated using a Rapid Ligation Kit according to the
manufacturer's instructions, and Bacillus subtilis strain
168.DELTA.4 was transformed with the ligation according to the
procedure of Anagnostopoulos and Spizizen, 1961, supra, selecting
for chloramphenicol resistance on TBAB chloramphenicol plates at
34.degree. C. The resulting plasmid was designated pHyGe206 (FIG.
16). The plasmid was confirmed by digestion with Pac I followed by
1.0% agarose electrophoresis in TAE buffer, which yielded expected
fragments of approximately 3187 bp, 2490 bp, and 874 bp.
Example 17
Construction of Bacillus licheniformis Strains with a cryIIIA mRNA
Processing/Stabilizing Sequence and Bacillus clausii aprH Gene
Inserted at the amyL Locus
[0206] Bacillus licheniformis strain MDT283 was transformed with
plasmid pHyGe204 as described in Example 12. Electroporated cells
were then transferred to 950 .mu.l of LBSM medium containing 0.2
.mu.g/ml erythromycin for induction of erythromycin resistance. The
transformants were incubated for 2.5-3 hours at 34.degree. C. and
250 rpm and then selected for erythromycin resistance on TBAB
erythromycin/lincomycin plates at 34.degree. C.
[0207] One such transformant was grown on TBAB plates with
erythromycin selection at 50.degree. C. in order to select for
integration of pHyGe204 into the chromosome at the amyL locus. One
such integrant was then grown in VY medium without selection at
34.degree. C. in order to permit excision and loss of the
integrated plasmid. The culture was plated on LB plates at
37.degree. C., and colonies were screened for sensitivity to
erythromycin, indicating loss of the plasmid.
Erythromycin-sensitive colonies were screened for inability to form
a zone of clearing on agar containing 0.5% starch azure
(Sigma-Aldrich, St. Louis, Mo., USA), indicating that the amyL gene
had been replaced by the cryIIIA mRNA processing/stabilizing
sequence and Bacillus clausii aprH gene. Insertion of the cryIIIA
mRNA processing/stabilizing sequence and aprH gene at the amyL
locus was confirmed by PCR using primer 950872, which binds
upstream of amyL, and primer 950984, which binds within the aprH
coding region. One such strain was designated Bacillus
licheniformis HyGe208.
TABLE-US-00007 Primer 950872: (SEQ ID NO: 19)
5'-CCAGGCCTTAAGGGCCGCATGCGTCCTTCTTTGTGCT-3' Primer 950984: (SEQ ID
NO: 20) 5'-CGACTTCCTCTTCCTCAGAG-3'
[0208] Bacillus licheniformis strain MDT283 was transformed with
plasmid pHyGe205 by electroporation as described above, selecting
for erythromycin resistance on TBAB erythromycin/lincomycin plates
at 34.degree. C. One such transformant was grown on TBAB plates
with erythromycin selection at 50.degree. C. in order to select for
integration of pHyGe205 into the chromosome at the amyL locus. One
such integrant was then grown in VY medium without selection at
34.degree. C. in order to permit excision and loss of the
integrated plasmid. The culture was plated on LB plates at
37.degree. C., and colonies were screened for sensitivity to
erythromycin, indicating loss of the plasmid.
Erythromycin-sensitive colonies were screened for inability to form
a zone of clearing on agar containing 0.5% starch azure, indicating
that the amyL gene had been replaced by the modified cryIIIA mRNA
processing/stabilizing sequence and Bacillus clausii aprH gene.
Insertion of the cryIIIA mRNA processing/stabilizing sequence and
aprH gene at the amyL locus was confirmed by PCR using primers
950872 and 950984 shown above. One such strain was designated
Bacillus licheniformis HyGe209.
Example 18
Construction of Bacillus licheniformis Strains with a Triple Tandem
Promoter and Bacillus clausii aprH Gene Inserted at the amyL
Locus
[0209] Bacillus licheniformis strains HyGe208 and HyGe209 were
transformed with plasmid pHyGe206 as described in Example 12,
selecting for erythromycin resistance on TBAB
erythromycin/lincomycin plates at 34.degree. C. One such
transformant was grown on TBAB plates with erythromycin selection
at 50.degree. C. in order to select for integration of pHyGe205
into the chromosome at the amyL locus. One such integrant was then
grown in VY medium without selection at 34.degree. C. in order to
permit excision and loss of the integrated plasmid. The culture was
plated on LB plates at 37.degree. C., and colonies were screened
for sensitivity to erythromycin, indicating loss of the plasmid.
Erythromycin-sensitive colonies were screened for ability to form
large zones of clearing on agar containing 1% nonfat dry milk,
indicating that the triple tandem promoter had been inserted
upstream of the Bacillus clausii aprH gene. The presence of an aprH
expression cassette at the amyL locus was confirmed by PCR using
primer 950872 shown above, which binds upstream of amyL, and primer
991797, which binds downstream of amyL. One such strain derived
from Bacillus licheniformis HyGe208 and had an expected PCR product
of approximately 3094 bp was designated Bacillus licheniformis
HyGe210; one derived from Bacillus licheniformis HyGe209 and had an
expected PCR product of approximately 3119 bp was designated
Bacillus licheniformis HyGe211. Bacillus licheniformis strain
HyGe210 contains an aprH expression cassette comprising the
P.sub.amyL4199/P.sub.short consensus amyQ/P.sub.cryIIIA/cryIIIA
stab promoter at the amyL locus. Bacillus licheniformis strain
HyGe211 contains an aprH expression cassette comprising the
P.sub.amyL4199/P.sub.short consensus amyQ/P.sub.cryIIIA/mod.
cryIIIA stab promoter at the amyL locus. The sequences of the aprH
expression cassettes in HyGe210 and HyGe211 were confirmed by DNA
sequencing of the PCR products.
Example 19
Evaluation of Triple Tandem Promoter Variants
[0210] Bacillus licheniformis strains HyGe210 and HyGe211 were
cultivated in standard small fermentation tanks under conditions
suitable for Bacillus clausii alkaline protease (AprH) production,
using a medium comprising hydrolyzed potato protein and mineral
salts with a sucrose feed. Whole broth samples were assayed for
protease activity at various time points during fermentation.
[0211] Protease activity was measured according to the following
procedure. Culture supernatants were diluted appropriately in
sample buffer (0.01% TWEEN.RTM., 100 mM TRIS pH 8.5) followed with
a series dilution from 1-fold to 1/3-fold to 1/9-fold of the
diluted sample. Bacillus clausii alkaline protease (AprH) standard
(Novozymes A/S, Bagsvrd, Denmark) was diluted in sample buffer
using two-fold steps starting with a 0.625 NPU/ml concentration and
ending with a 0.078 NPU/ml concentration. A total of 20 .mu.l of
each dilution including standard was transferred to a 96-well
flat-bottom plate. Two hundred microliters of a
Suc-Ala-Ala-Pro-Phe-pNA substrate solution (100 mg of
Suc-Ala-Ala-Pro-Phe-pNA per ml DMSO diluted 1:55.6 in 100 mM TRIS
pH 8.5) was added to each well, and the plate was incubated at
ambient temperature for 10 minutes. During the incubation the rate
of the reaction was measured at 405 nm using a BIOMEK.RTM. 3000.
Sample concentrations were determined by extrapolation from the
generated standard curve.
[0212] The results are shown in FIG. 17. The results demonstrated
that Bacillus licheniformis HyGe211, in which the protease was
expressed from a triple promoter construct comprising a modified
cryIIIA mRNA processing/stabilizing sequence, produced more
protease than Bacillus licheniformis HyGe210, in which the protease
was expressed from a triple promoter construct comprising an
unmodified cryIIIA mRNA processing/stabilizing sequence. After the
72 hour fermentation, Bacillus licheniformis HyGe211 provided a 61%
increase in comparison to Bacillus licheniformis HyGe210.
Example 20
Construction of pMDT100
[0213] Plasmid pMDT100 is an E. coli replicon containing the
P.sub.amyL4199/P.sub.short consensus amyQ/P.sub.cryIIIA/cryIIIAstab
triple tandem promoter driving expression of the Bacillus clausii
alkaline protease gene (aprH). This aprH expression cassette and
the cat gene of pC194 (Horinouchi and Weisblum, 1982, J. Bacteriol.
150: 804-814) are flanked on both sides by fragments of the
Bacillus subtilis alpha-amylase (amyE) gene, permitting insertion
of the aprH expression cassette and cat gene at the amyE locus of
the Bacillus subtilis chromosome by double homologous recombination
via the two amyE fragments. Replacement of the aprH gene in pMDT100
with another gene allows chromosomal insertion and expression of
that gene in Bacillus subtilis. The construction of pMDT100 is
described below.
[0214] Plasmid pNBT51.
[0215] Plasmid pNBT10 (pDG268MCS-Pr.sub.cryIIIA/cryIIIAstab/SAV;
U.S. Pat. No. 6,255,076) was isolated from E. coli DH5.alpha. as a
host, using a QIAGEN.RTM. Plasmid Kit (QIAGEN Inc., Valencia,
Calif., USA) according to the manufacturer's instructions, and
digested with Cla I and Sca I. Cleavage occurred at the Cla I site
at approximately codon 326 of the aprH coding sequence and not at
the Cla I site at approximately codon 23, which was blocked by
methylation due to E. coli Dam DNA methyltransferase. The Cla I
ends were blunted using Klenow fragment (New England Biolabs, Inc.,
Beverly, Mass., USA) and dNTPs according to the manufacturer's
instructions. The digested plasmid was analyzed by 0.8% agarose
electrophoresis in TBE buffer, and a vector fragment of
approximately 6615 bp was purified using a QIAQUICK.RTM. Gel
Extraction Kit. Plasmid pOS4301 (Bacillus Genetic Stock Center,
Ohio State University, Columbus, Ohio, USA) was digested with Sal I
and Sca I, and the Sal I ends were blunted using Klenow fragment
and dNTPs, as described above. The digested plasmid was analyzed by
0.8% agarose electrophoresis in TBE buffer, and a fragment of
approximately 840 bp bearing the E. coli rmB transcription
terminator was purified using a QIAQUICK.RTM. Gel Extraction Kit.
The same 840 bp Sal I/Sca I fragment could be isolated from the
vector pKK223-3 (GE Healthcare, Piscataway, N.J., USA) (FIG. 18).
The pNBT10 vector fragment and terminator-bearing fragment were
ligated together with T4 DNA ligase (Roche Diagnostics Corporation,
Indianapolis, Ind., USA) according to the manufacturer's
instructions, and E. coli DH5.alpha. cells were transformed with
the ligation according to the manufacturer's instructions,
selecting for ampicillin resistance on 2.times.YT ampicillin plates
at 37.degree. C. The resulting plasmid was designated pNBT51
(pDG268-P.sub.cryIIIA/cryIIIAstab/SAV.DELTA.) (FIG. 19).
[0216] Plasmid pNBT52.
[0217] Plasmid pNBT51 was digested with Sfi I, and the ends were
blunted by incubation for 20 minutes at 11.degree. C. with T4 DNA
polymerase (Roche Diagnostics Corporation, Indianapolis, Ind., USA)
and 25 .mu.M of each dNTP, followed by heat-inactivation of the
polymerase by incubation for 10 minutes at 75.degree. C. The
blunt-ended plasmid was then digested with Dra III and analyzed by
0.8% agarose electrophoresis in TBE buffer, and a vector fragment
of approximately 5920 bp was purified using a QIAQUICK.RTM. Gel
Extraction Kit. Plasmid pNBT20 (pDG268MCS-P.sub.short consensus
amyQ/SAV; U.S. Pat. No. 6,255,076) was digested with Dra III and
Ecl 136II, and a fragment of approximately 1641 bp bearing a short
consensus amyQ promoter (P.sub.short consensus amyQ) was purified
using a QIAQUICK.RTM. Gel Extraction Kit. The pNBT51 vector
fragment and P.sub.short consensus amyQ fragment were ligated as
described above, and E. coli DH5.alpha. cells were transformed with
the ligation as described above, selecting for ampicillin
resistance on 2.times.YT ampicillin plates at 37.degree. C. Plasmid
DNA was isolated from several transformants using a QIAPREP.RTM. 8
Miniprep Kit, digested with Sph I, and analyzed by 0.8% agarose
electrophoresis in TBE buffer. One plasmid with expected
restriction fragments of approximately 4873 bp and 2688 bp was
designated pNBT52 (pDG268-P.sub.short consensus
amyQ/P.sub.cryIIIA/cryIIIAstab/SAV.DELTA.)(FIG. 20).
[0218] Plasmid pNBT53.
[0219] Plasmid pNBT6 (pHP13 amp-SAV; U.S. Pat. No. 6,255,076) was
digested with Sfi I and Sac 1 and analyzed by 0.8% agarose
electrophoresis in TBE buffer, and a vector fragment of
approximately 6438 bp was purified using a QIAQUICK.RTM. Gel
Extraction Kit. Plasmid pNBT52 was digested with Sfi I and Sac I
and analyzed by 0.8% agarose electrophoresis in TBE buffer, and a
fragment of approximately 727 bp bearing the P.sub.short consensus
amyQ/P.sub.cryIIIA/cryIIIAstab tandem promoter was purified using a
QIAQUICK.RTM. Gel Extraction Kit. The pNBT6 vector fragment and
P.sub.short consensus amyQ/P.sub.cryIIIA/cryIIIAstab fragment were
ligated as described above, and E. coli DH5.alpha. cells were
transformed with the ligation as described above, selecting for
ampicillin resistance on 2.times.YT ampicillin plates at 37.degree.
C. Plasmid DNA was isolated from several transformants using a
QIAPREP.RTM. 8 Miniprep Kit, digested with Pvu II, and analyzed by
0.8% agarose electrophoresis using TBE buffer. One plasmid with
expected restriction fragments of approximately 4903 bp, 1320 bp,
and 942 bp was designated pNBT53 (pHP13 amp-P.sub.short consensus
amyQ/P.sub.cryIIIA/cryIIIAstab/SAV) (FIG. 21).
[0220] Plasmid pNBT54.
[0221] Plasmid pNBT1 (pDG268MCS; U.S. Pat. No. 6,255,076) was
digested with Sfi I and Bam HI and analyzed by 0.8% agarose
electrophoresis in TBE buffer, and a vector fragment of
approximately 6040 bp was purified using a QIAQUICK.RTM. Gel
Extraction Kit. Plasmid pNBT53 was digested with Sfi I and Bam HI
and analyzed by 0.8% agarose electrophoresis in TBE buffer, and a
fragment of approximately 1953 bp bearing the P.sub.short consensus
amyQ/P.sub.cryIIIAcryIIIAstab/SAV cassette was purified using a
QIAQUICK.RTM. Gel Extraction Kit. The pNBT1 vector fragment and
P.sub.short consensus amyQ/P.sub.cryIIIA/cryIIIAstab/SAV fragment
were ligated as described above, and E. coli DH5.alpha. cells were
transformed with the ligation as described above, selecting for
ampicillin resistance on 2.times.YT ampicillin plates at 37.degree.
C. Plasmid DNA was isolated from several transformants using a
QIAPREP.RTM. 8 Miniprep Kit and analyzed by simultaneous digestion
with Sfi I and Bam HI followed by 0.8% agarose gel electrophoresis
in TBE buffer. One plasmid with expected restriction fragments of
approximately 6040 bp and 1953 bp was designated pNBT54
(pDG268MCS-P.sub.short consensus
amyQ/P.sub.cryIIIA/cryIIIAstab/SAV) (FIG. 22).
[0222] Plasmid pNBT35.
[0223] Plasmid pNBT2
(pDG268MCS.DELTA.-Pr.sub.cryIIIA/cryIIIAstab/SAV; U.S. Pat. No.
6,255,076) was digested with Sfi I and Bam HI and analyzed by 0.8%
agarose gel electrophoresis in TBE buffer, and a vector fragment of
approximately 5394 bp was purified using a QIAQUICK.RTM. Gel
Extraction Kit. Plasmid pNBT54 was digested with Sfi I and Bam HI,
and analyzed by 0.8% agarose gel electrophoresis in TBE buffer, and
a fragment of approximately 1953 bp bearing the P.sub.short
consensus amyQ/P.sub.cryIIIA/cryIIIAstab/SAV cassette was purified
using a QIAQUICK.RTM. Gel Extraction Kit. The pNBT2 vector fragment
and P.sub.short consensus amyQ/P.sub.cryIIIA/cryIIIAstab/SAV
fragment were ligated as described above, and E. coli DH5.alpha.
cells were transformed with the ligation as described above,
selecting for ampicillin resistance on 2.times.YT ampicillin plates
at 37.degree. C. Plasmid DNA was isolated from several
transformants using a QIAPREP.RTM. 8 Miniprep Kit, digested with
Nco I, and analyzed by 0.8% agarose gel electrophoresis in TBE
buffer. One plasmid with expected restriction fragments of
approximately 5492 bp and 1855 bp was designated pNBT35
(pDG268MCS.DELTA.-P.sub.short consensus
amyQ/P.sub.cryIIIA/cryIIIAstab/SAV) (FIG. 23).
[0224] Plasmid pNBT30.
[0225] Plasmid pNBT30 was constructed to contain a PCR clone of the
amyL4199 variant of the amyL gene promoter (U.S. Pat. No.
6,100,063). Bacillus licheniformis SJ1904 genomic DNA was isolated
according to the procedure of Pitcher et al., 1989, supra. The
amyL4199 promoter (P.sub.amyL4199) gene was amplified by PCR from
Bacillus licheniformis SJ1904 genomic DNA using primers 950872 and
991151 shown below. Primer 950872 incorporates an Sfi I restriction
site, and primer 991151 incorporates a Sac I restriction site and
the variant nucleotides of P.sub.amyL4199.
TABLE-US-00008 Primer 950872: (SEQ ID NO: 21)
5'-CCAGGCCTTAAGGGCCGCATGCGTCCTTCTTTGTGCT-3' Primer 991151: (SEQ ID
NO: 22) 5'-GAGCTCCTTTCAATGTGATACATATGA-3'
[0226] The PCR was performed using AMPLITAQ.RTM. Gold DNA
Polymerase (Applied Biosystems, Foster City, Calif., USA) according
to manufacturer's recommendations, except that the MgCl.sub.2
concentration was 3 mM, rather than the standard 1.5 mM. The
amplification reaction (50 .mu.l) was composed of 10 mM Tris-HCl
(pH 8.3), 50 mM KCl, 3.0 mM MgCl.sub.2, 200 .mu.M of each dNTP, 0.5
.mu.M of each primer, 0.25 units of AMPLITAQ.RTM. Gold DNA
Polymerase, and approximately 200 ng of template DNA. The PCR was
performed in a ROBOCYCLER.RTM. 40 Temperature Cycler programmed for
1 cycle at 95.degree. C. for 9 minutes; 30 cycles each at
95.degree. C. for 1 minute, 55.degree. C. for 1 minute, and
72.degree. C. for 1 minute; and 1 cycle at 72.degree. C. for 3
minutes.
[0227] The resulting PCR product of approximately 625 bp was cloned
into vector pCR2.1 using a TOPO.RTM. TA Cloning Kit and transformed
into ONE SHOT.RTM. TOP10 Chemically Competent E. coli cells
according to the manufacturer's instructions. Plasmid DNA was
isolated from several transformants using a QIAPREP.RTM. 8 Miniprep
Kit and analyzed for the presence of the cloned PCR fragment by
digestion with Eco RI followed by 0.8% agarose electrophoresis in
TBE buffer. One plasmid with expected restriction fragments of
approximately 3913 bp and 640 bp was designated pNBT30
(pCR2.1-amyL4199) (FIG. 24). The DNA sequence of the cloned PCR
fragment was confirmed by DNA sequencing.
[0228] Plasmid pNBT31.
[0229] Plasmid pNBT3
(pDG268MCS.DELTA.neo-Pr.sub.cryIIIA/cryIIIAstab/SAV; U.S. Pat. No.
6,255,076) was digested with Sfi I and Sac I and analyzed by 0.8%
agarose electrophoresis in TBE buffer, and a vector fragment of
approximately 7931 bp was purified using a QIAQUICK.RTM. Gel
Extraction Kit. Plasmid pNBT30 was digested with Sfi I and Sac I,
analyzed by 0.8% agarose electrophoresis in TBE buffer, and a
fragment of approximately 612 bp bearing P.sub.amyL4199 was
purified using a QIAQUICK.RTM. Gel Extraction Kit. The pNBT3 vector
fragment and P.sub.amyL4199 fragment were ligated as described
above, and E. coli XL1-Blue cells (Stratagene Corporation, La
Jolla, Calif., USA) were transformed with the ligation according to
the manufacturer's instructions, selecting for ampicillin
resistance on 2.times. YT ampicillin plates at 37.degree. C.
Plasmid DNA was isolated from several transformants using a
QIAPREP.RTM. 8 Miniprep Kit, digested with Nco 1, and analyzed by
0.8% agarose electrophoresis in TBE buffer. One plasmid with
expected restriction fragments of approximately 6802 bp and 1741 bp
was designated pNBT31 (FIG. 25).
[0230] Plasmid pNBT36.
[0231] Plasmid pNBT35 was digested with Sfi I, and the ends were
blunted using T4 DNA polymerase and dNTPs, as described above. The
blunt ended plasmid was then digested with Dra III, and analyzed by
0.8% agarose electrophoresis in TBE buffer. A vector fragment of
approximately 5808 bp was purified using a QIAQUICK.RTM. Gel
Extraction Kit. Plasmid pNBT31 was digested with Dra III and Ecl
13611, analyzed by 0.8% agarose electrophoresis in TBE buffer, and
a fragment of approximately 2150 bp bearing P.sub.amyL4199 was
purified using a QIAQUICK.RTM. Gel Extraction Kit. The pNBT35
vector fragment and P.sub.amyL4199 fragment were ligated as
described above, and E. coli SURE.RTM. cells (Stratagene
Corporation, La Jolla, Calif., USA) were transformed with the
ligation according to the manufacturer's instructions, selecting
for ampicillin resistance on 2.times. YT ampicillin plates at
37.degree. C. Plasmid DNA was isolated from several transformants
using a QIAPREP.RTM. 8 Miniprep Kit, digested with Nco 1, and
analyzed by 0.8% agarose electrophoresis in TBE buffer. One plasmid
with expected restriction fragments of approximately 5492 bp and
2466 bp was designated pNBT36 (FIG. 26).
[0232] Plasmid pMDT100.
[0233] Plasmid pNBT13
(pDG268.DELTA.neo-P.sub.amyL/P.sub.cryIIIA/cryIIIAstab/SAV; U.S.
Pat. No. 6,255,076) was digested with Dra III and Sac I, and a
vector fragment of approximately 6395 bp was purified using a
QIAQUICK.RTM. Gel Extraction Kit. Plasmid pNBT36 was digested with
Dra III and Sac I, analyzed by 0.8% agarose electrophoresis in TBE
buffer, and a fragment of approximately 2873 bp bearing the
P.sub.amyL4199/P.sub.amyQ(sc)/P.sub.cryIIIA triple tandem promoter
was purified using a QIAQUICK.RTM. Gel Extraction Kit. The pNBT13
vector fragment and P.sub.amyL4199/P.sub.amyQ (sc)/P.sub.cryIIIA
fragment were ligated as described above, and E. coli SURE.RTM.
cells were transformed with the ligation as described above,
selecting for ampicillin resistance on 2.times. YT ampicillin
plates at 37.degree. C. Plasmid DNA was isolated from several
transformants using a QIAPREP.RTM. 8 Miniprep Kit, digested with
Apa I, and analyzed by 0.8% agarose electrophoresis in TBE buffer.
One plasmid with expected restriction fragments of approximately
4974 bp and 4294 bp was designated pMDT100 (FIG. 27).
[0234] Plasmid pMDT100 was linearized by digestion with Sca I.
Bacillus subtilis 168.DELTA.4 was transformed with the linearized
plasmids according to the procedure of Anagnostopoulos and
Spizizen, 1961, supra, and transformants were selected for
chloramphenicol resistance on TBAB chloramphenicol plates at
37.degree. C. Chloramphenicol-resistant transformants were screened
for protease production by patching colonies onto TBAB milk plates
and scoring for clearing zones and also for neomycin sensitivity by
patching colonies onto TBAB neomycin plates at 37.degree. C. to
confirm that the DNA had inserted into the amyE gene of the
Bacillus subtilis chromosome by double crossover. A chloramphenicol
resistant, neomycin sensitive, protease-producing transformant
(with the P.sub.amyL4199/P.sub.short consensus
amyQ/P.sub.cryIIIA/CryIIIA stab/aprH cassette inserted at the amyE
locus) was identified and designated Bacillus subtilis MDT130.
Example 21
Construction of pMDT174
[0235] Plasmids pMDT100 and pGME080 were digested with Pac I and
Sac I. The digested plasmids were analyzed by 0.8% agarose
electrophoresis in TBE buffer, and an approximately 8727 bp vector
fragment of pMDT100 and an approximately 566 bp fragment of pGME080
bearing the modified cryIIIA stabilizer were purified using a
QIAQUICK.RTM. Gel Extraction Kit. The purified fragments were
ligated together with T4 DNA ligase as described above, and E. coli
XL10-GOLD.RTM. Ultracompetent cells were transformed with the
ligation according to manufacturer's instructions. Plasmid DNA from
several transformants was purified using a BIOROBOT.RTM. 9600 and
tested by digestion with Fnu 4HI followed by 0.8% agarose
electrophoresis in TBE buffer. Digestion of the desired ligation
product was expected to produce approximately 36 fragments,
including an approximately 912 bp fragment not expected from
pMDT100 and excluding an approximately 1045 bp fragment expected
for pMDT100. One plasmid with such a restriction pattern was
designated pMDT174 (FIG. 28), which contains an aprH expression
cassette comprising a triple tandem promoter with a modified
cryIIIA mRNA processing/stabilizing sequence
(P.sub.amyL4199/P.sub.short consensus amyQ/P.sub.cryIIIA/mod.
cryIIIA stab)
[0236] Plasmid pMDT100 was linearized by digestion with Sca I.
Bacillus subtilis 168.DELTA.4 was transformed with the linearized
plasmids according to the procedure of Anagnostopoulos and
Spizizen, 1961, supra, and transformants were selected for
chloramphenicol resistance on TBAB chloramphenicol plates at
37.degree. C. Chloramphenicol-resistant transformants were screened
for protease production by patching colonies onto TBAB milk plates
and scoring for clearing zones and also for neomycin sensitivity by
patching colonies onto TBAB neomycin plates at 37.degree. C. to
confirm that the DNA had inserted into the amyE gene of the
Bacillus subtilis chromosome by double crossover. A chloramphenicol
resistant, neomycin sensitive, protease-producing transformant
(with the P.sub.amyL4199/P.sub.short consensus
amyQ/P.sub.cryIIIA/mod. cryIIIA stab/aprH cassette inserted at the
amyE locus) was identified and designated Bacillus subtilis
MDT131.
Example 22
Evaluation of Triple Tandem Promoter Variants in Bacillus
subtilis
[0237] Plasmids pMDT100 and pMDT174 were linearized by digestion
with Sca I. Bacillus subtilis 168.DELTA.4 was transformed with the
linearized plasmids according to the procedure of Anagnostopoulos
and Spizizen, 1961, supra, and transformants were selected for
chloramphenicol resistance on TBAB chloramphenicol plates at
37.degree. C. Chloramphenicol-resistant transformants were screened
for protease production by patching colonies onto TBAB milk plates
and scoring for clearing zones and also for neomycin sensitivity by
patching colonies onto TBAB neomycin plates at 37.degree. C. to
confirm that the DNA had inserted into the amyE gene of the
Bacillus subtilis chromosome by double crossover. Chloramphenicol
resistant, neomycin sensitive, protease-producing transformants
were identified; one derived from pMDT100 (with the
P.sub.amyL4199/P.sub.short consensus amyQ/P.sub.cryIIIA/cryIIIA
stab/aprH cassette inserted at the amyE locus) was designated
Bacillus subtilis MDT130, and one derived from pMDT100 (with the
P.sub.amyL4199/P.sub.short consensus amyQ/P.sub.cryIIIA/mod.
cryIIIA stab/aprH cassette inserted at the amyE locus) was
designated Bacillus subtilis MDT131.
[0238] Genomic DNA was isolated from Bacillus subtilis strains
MDT130 and MDT131 according to the procedure of Pitcher et al.,
1989, supra. Bacillus subtilis A164.DELTA.5 (U.S. Pat. No.
5,891,701) was transformed with the genomic DNAs according to the
procedure of Anagnostopoulos and Spizizen, 1961, supra, and
transformants were selected for chloramphenicol resistance on TBAB
chloramphenicol plates at 37.degree. C. One transformant derived
from MDT130 DNA (with the P.sub.amyL4199/P.sub.short consensus
amyQ/P.sub.cryIIIA/cryIIIA stab/aprH cassette inserted at the amyE
locus) was designated MDT134; one derived from MDT131 DNA (with the
P.sub.amyL4199/P.sub.short consensus amyQ/P.sub.cryIIIA/mod.
cryIIIA stab/aprH cassette inserted at the amyE locus) was
designated MDT135.
[0239] Bacillus subtilis strains MDT134 and MDT135 were grown at
37.degree. C. in triplicate in 250 ml shake flasks containing 50 ml
of PS-1 medium. Samples were removed at 3, 4, and 5 days, and whole
broths were assayed for protease activity as described above.
[0240] The results are shown in FIG. 29. The results demonstrated
that Bacillus subtilis MDT135, in which the protease was expressed
from a triple promoter construct comprising a modified cryIIIA mRNA
processing/stabilizing sequence, produced more protease than
Bacillus subtilis MDT134, in which the protease was expressed from
a triple promoter construct comprising an unmodified cryIIIA mRNA
processing/stabilizing sequence. In comparison to Bacillus subtilis
MDT134, Bacillus subtilis MDT135 provided an 87% increase after
three days, a 100% increase after 4 days, and a 58% increase after
5 days.
[0241] The invention described and claimed herein is not to be
limited in scope by the specific aspects herein disclosed, since
these aspects are intended as illustrations of several aspects of
the invention. Any equivalent aspects are intended to be within the
scope of this invention. Indeed, various modifications of the
invention in addition to those shown and described herein will
become apparent to those skilled in the art from the foregoing
description. Such modifications are also intended to fall within
the scope of the appended claims. In the case of conflict, the
present disclosure including definitions will control.
[0242] Various references are cited herein, the disclosures of
which are incorporated by reference in their entireties.
Sequence CWU 1
1
22110DNABacillus thuringiensis 1agaaaggagg 10225DNABacillus
thuringiensis 2agaaaggagg tgatccagcc gcacc 25328DNABacillus
thuringiensis 3tagaaaggag gtgatccagc cgcacctt 284546DNABacillus
thuringiensis 4agcttaatta aagataatat ctttgaattg taacgcccct
caaaagtaag aactacaaaa 60aaagaatacg ttatatagaa atatgtttga accttcttca
gattacaaat atattcggac 120ggactctacc tcaaatgctt atctaactat
agaatgacat acaagcacaa ccttgaaaat 180ttgaaaatat aactaccaat
gaacttgttc atgtgaatta tcgctgtatt taattttctc 240aattcaatat
ataatatgcc aatacattgt tacaagtaga aattaagaca cccttgatag
300ccttactata cctaacatga tgtagtatta aatgaatatg taaatatatt
tatgataaga 360agcgacttat ttataatcat tacatatttt tctattggaa
tgattaagat tccaatagaa 420tagtgtataa attatttatc ttgaaaggag
ggatgcctaa aaacgaagaa cattaaaaac 480atatatttgc accgtctaat
ggatttatga aaaatcattt tatcagtttg aaaattatgt 540attatg
5465571DNABacillus subtilis 5agcttaatta aagataatat ctttgaattg
taacgcccct caaaagtaag aactacaaaa 60aaagaatacg ttatatagaa atatgtttga
accttcttca gattacaaat atattcggac 120ggactctacc tcaaatgctt
atctaactat agaatgacat acaagcacaa ccttgaaaat 180ttgaaaatat
aactaccaat gaacttgttc atgtgaatta tcgctgtatt taattttctc
240aattcaatat ataatatgcc aatacattgt tacaagtaga aattaagaca
cccttgatag 300ccttactata cctaacatga tgtagtatta aatgaatatg
taaatatatt tatgataaga 360agcgacttat ttataatcat tacatatttt
tctattggaa tgattaagat tccaatagaa 420tagtgtataa attatttatc
ttgaaaggag ggatgcctaa aaacgaagaa cattaaaaac 480atatatttgc
accgtctaat ggatagaaag gaggtgatcc agccgcacct tatgaaaaat
540cattttatca gtttgaaaat tatgtattat g 571642DNAArtificialBacillus
thuringensis 6ggagccgctg agctaccaca gattgtgaaa ggagaggtta ac
42797DNABacillus thuringiensis 7cgggccttaa gggccctcga aacgtaagat
gaaaccttag ataaaagtgc tttttttgtt 60gacattgaag aattattaat gttataatta
attaagg 97897DNABacillus thuringiensis 8ccttaattaa ttataacatt
aataattctt caatgtcaac aaaaaaagca cttttatcta 60aggtttcatc ttacgtttcg
agggccctta aggcccg 97921DNABacillus thuringiensis 9cgggccttaa
gggccctcga a 211020DNABacillus thuringiensis 10ccttaattaa
ttataacatt 201120DNABacillus thuringiensis 11agcttaatta aagataatat
201240DNABacillus thuringiensis 12ggctggatca cctcctttct atccattaga
cggtgcaaat 401345DNABacillus clausii 13agaaaggagg tgatccagcc
gcaccttatg aaaaatcatt ttatc 451420DNABacillus clausii 14aagcttgcgc
caccacgaat 201524DNABacillus licheniformis 15gaattcgacg gcttcccgtg
cgcc 241628DNABacillus licheniformis 16aagcttccat tcaaacctgg
tgaggaag 281724DNABacillus licheniformis 17gcggccgctc gctttccaat
ctga 241831DNABacillus licheniformis 18atcgataata atttatacac
tattctattg g 311937DNABacillus licheniformis 19ccaggcctta
agggccgcat gcgtccttct ttgtgct 372020DNABacillus licheniformis
20cgacttcctc ttcctcagag 202137DNABacillus licheniformis
21ccaggcctta agggccgcat gcgtccttct ttgtgct 372227DNABacillus
licheniformis 22gagctccttt caatgtgata catatga 27
* * * * *