U.S. patent application number 13/455337 was filed with the patent office on 2012-10-25 for microrna compounds and methods for modulating mir-21 activity.
This patent application is currently assigned to REGULUS THERAPEUTICS INC.. Invention is credited to Balkrishen Bhat.
Application Number | 20120270928 13/455337 |
Document ID | / |
Family ID | 46025979 |
Filed Date | 2012-10-25 |
United States Patent
Application |
20120270928 |
Kind Code |
A1 |
Bhat; Balkrishen |
October 25, 2012 |
MICRORNA COMPOUNDS AND METHODS FOR MODULATING MIR-21 ACTIVITY
Abstract
Described herein are compositions and methods for the inhibition
of miR-21 activity. The compositions have certain nucleoside
modification patterns that yield potent inhibitors of miR-21
activity. The compositions may be used to inhibit miR-21, and also
to treat diseases associated with abnormal expression of miR-21,
such as fibrosis and cancer.
Inventors: |
Bhat; Balkrishen; (San
Diego, CA) |
Assignee: |
REGULUS THERAPEUTICS INC.
San Diego
CA
|
Family ID: |
46025979 |
Appl. No.: |
13/455337 |
Filed: |
April 25, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61478767 |
Apr 25, 2011 |
|
|
|
61565779 |
Dec 1, 2011 |
|
|
|
Current U.S.
Class: |
514/44R ;
435/375; 536/23.1 |
Current CPC
Class: |
A61P 11/00 20180101;
C12N 15/113 20130101; C12N 2310/343 20130101; A61P 1/16 20180101;
A61P 19/04 20180101; A61P 3/10 20180101; A61P 35/02 20180101; C12N
2310/113 20130101; A61P 17/02 20180101; C12N 2310/11 20130101; A61P
35/00 20180101; A61P 1/00 20180101; A61P 9/00 20180101; A61P 37/00
20180101; A61P 13/12 20180101; C12N 2310/3231 20130101; A61P 17/00
20180101; A61P 13/02 20180101; A61P 43/00 20180101; C12N 2310/35
20130101; A61P 35/04 20180101 |
Class at
Publication: |
514/44.R ;
536/23.1; 435/375 |
International
Class: |
A61K 31/7088 20060101
A61K031/7088; C12N 5/02 20060101 C12N005/02; A61P 35/00 20060101
A61P035/00; C07H 21/00 20060101 C07H021/00 |
Claims
1. A compound comprising a modified oligonucleotide consisting of 8
to 22 linked nucleosides, wherein the nucleobase sequence of the
modified oligonucleotide is complementary to miR-21 (SEQ ID NO: 1)
and wherein the modified oligonucleotide comprises at least 8
contiguous nucleosides of the following nucleoside pattern I in the
5' to 3' orientation:
(R).sub.X-N.sup.B-N.sup.Q-N.sup.Q-N.sup.B-(N.sup.Q-N.sup.Q-N.sup.Q-N.sup.-
B).sub.3-N.sup.Q-N.sup.Z wherein each R is, independently, a
non-bicyclic nucleoside; X is from 1 to 4; each N.sup.B is,
independently, a bicyclic nucleoside; each N.sup.Q is,
independently, a non-bicyclic nucleoside; and each N.sup.Z is,
independently, a modified nucleoside.
2. The compound of claim 1, wherein the modified oligonucleotide
comprises at least 8 contiguous nucleosides of the following
nucleoside pattern II in the 5' to 3' orientation:
N.sup.M-N.sup.B-N.sup.Q-N.sup.Q-N.sup.B-(N.sup.Q-N.sup.Q-N.sup.Q-N.sup.B)-
.sub.3-N.sup.Q-N.sup.Z wherein N.sup.M is a modified nucleoside
that is not a bicyclic nucleoside; each N.sup.B is, independently,
a bicyclic nucleoside; each N.sup.Q is, independently, a
non-bicyclic nucleoside; and N.sup.Z is a modified nucleoside.
3. A compound comprising a modified oligonucleotide consisting of 8
to 19 linked nucleosides, wherein the nucleobase sequence of the
modified oligonucleotide is complementary to miR-21 (SEQ ID NO: 1)
and wherein the modified oligonucleotide comprises at least 8
contiguous nucleosides of the following nucleoside pattern III in
the 5' to 3' orientation:
(R).sub.X-N.sup.B-N.sup.Q-N.sup.Q-N.sup.B-(N.sup.Q-N.sup.Q-N.sup.Q-N.sup.-
B).sub.3-N.sup.Y-N.sup.Z wherein each R is a non-bicyclic
nucleoside; X is from 1 to 4; each N.sup.B is a bicyclic
nucleoside; each N.sup.Q is a non-bicyclic nucleoside; N.sup.Y is a
modified nucleoside or an unmodified nucleoside; and each N.sup.Z
is a modified nucleoside.
4. The compound of claim 3, wherein the modified oligonucleotide
comprises at least 8 contiguous nucleosides of the following
nucleoside pattern IV in the 5' to 3' orientation:
N.sup.M-N.sup.B-N.sup.Q-N.sup.Q-N.sup.B-(N.sup.Q-N.sup.Q-N.sup.Q-N.sup.B)-
.sub.3-N.sup.Y-N.sup.Z wherein N.sup.M is a modified nucleoside
that is not a bicyclic nucleoside; each N.sup.B is, independently,
a bicyclic nucleoside; each N.sup.Q is, independently, a
non-bicyclic nucleoside; N.sup.Y is a modified nucleoside or an
unmodified nucleoside; and N.sup.Z is a modified nucleoside.
5. A compound comprising a modified oligonucleotide consisting of 8
to 19 linked nucleosides, wherein the nucleobase sequence of the
modified oligonucleotide is complementary to miR-21 (SEQ ID NO: 1)
and wherein the modified oligonucleotide comprises at least 8
contiguous nucleosides of the following nucleoside pattern V in the
5' to 3' orientation:
N.sup.M-N.sup.B-(N.sup.Q-N.sup.Q-N.sup.B-N.sup.B).sub.4-N.sup.Z
wherein N.sup.M is a modified nucleoside that is not a bicyclic
nucleoside; each N.sup.B is a bicyclic nucleoside; each N.sup.Q is
a non-bicyclic nucleoside; and N.sup.Z is a modified
nucleoside.
6. (canceled)
7. The compound of claim 1, wherein the nucleobase sequence of the
modified oligonucleotide is at least 90% complementary to the
nucleobase sequence of miR-21 (SEQ ID NO: 1).
8. The compound of claim 1 wherein each bicyclic nucleoside is
independently selected from an LNA nucleoside, a cEt nucleoside,
and an ENA nucleoside.
9. (canceled)
10. (canceled)
11. The compound of claim 1 wherein each non-bicyclic nucleoside is
independently selected from a .beta.-D-deoxyribonucleoside and a
2'-O-methoxyethyl nucleoside.
12. (canceled)
13. (canceled)
14. (canceled)
15. The compound of claim 1 wherein at least one internucleoside
linkage is a modified internucleoside linkage.
16. (canceled)
17. The compound of claim 1 wherein: a. R consists of four linked
nucleosides N.sup.R1-N.sup.R2-N.sup.R3-N.sup.R4, wherein N.sup.R1
is a 2'-O-methoxyethyl nucleoside and each of
N.sup.R2-N.sup.R3-N.sup.R4 is a .beta.-D-deoxyribonucleoside; each
N.sup.B is an S-cEt nucleoside; each N.sup.Q is a
.beta.-D-deoxyribonucleoside; and N.sup.Z is a 2'-O-methoxyethyl
nucleoside; b. each R is a 2'-O-methoxyethyl nucleoside; X is 1;
each N.sup.B is an S-cEt nucleoside; each N.sup.Q is a
.beta.-D-deoxyribonucleoside; and N.sup.Z is a 2'-O-methoxyethyl
nucleoside; c. each R is a 2'-O-methoxyethyl nucleoside; X is 1;
each N.sup.B is an S-cEt nucleoside; each N.sup.Q is a
2'-O-methoxyethyl nucleoside; and N.sup.Z is a 2'-O-methoxyethyl
nucleoside; d. each R is a 2'-O-methoxyethyl nucleoside; X is 1;
each N.sup.B is an S-cEt nucleoside; each N.sup.Q is a
.beta.-D-deoxyribonucleoside; and N.sup.Z is an S-cEt nucleoside;
e. each R is a 2'-O-methoxyethyl nucleoside; X is 1; each N.sup.B
is an LNA nucleoside; each N.sup.Q is a
.beta.-D-deoxyribonucleoside; and N.sup.Z is a 2'-O-methoxyethyl
nucleoside; or f. each R is a 2'-O-methoxyethyl nucleoside; X is 1;
each N.sup.B is an LNA nucleoside; each N.sup.Q is a
.beta.-D-deoxyribonucleoside; and N.sup.Z is an LNA nucleoside.
18. The compound of claim 2 wherein: a. N.sup.M is a
2'-O-methoxyethyl nucleoside; each N.sup.B is an S-cEt nucleoside;
each N.sup.Q is a .beta.-D-deoxyribonucleoside; and N.sup.Z is a
2'-O-methoxyethyl nucleoside; b. N.sup.M is a 2'-O-methoxyethyl
nucleoside; each N.sup.B is an S-cEt nucleoside; each N.sup.Q is a
2'-O-methoxyethyl nucleoside; and N.sup.Z is a 2'-O-methoxyethyl
nucleoside; c. N.sup.M is a 2'-O-methoxyethyl nucleoside; each
N.sup.B is an S-cEt nucleoside; each N.sup.Q is a
.beta.-D-deoxyribonucleoside; each N is a
.beta.-D-deoxyribonucleoside; and N.sup.Z is an S-cEt nucleoside;
d. N.sup.M is a 2'-O-methoxyethyl nucleoside; each N.sup.B is an
LNA nucleoside; each N.sup.Q is a .beta.-D-deoxyribonucleoside; and
N.sup.Z is a 2'-O-methoxyethyl nucleoside; or e. N.sup.M is a
2'-O-methoxyethyl nucleoside; each N.sup.B is an LNA nucleoside;
each N.sup.Q is a .beta.-D-deoxyribonucleoside; and N.sup.Z is an
LNA nucleoside.
19. The compound of claim 3 wherein: a. each R is a
2'-O-methoxyethyl nucleoside; X is 1; each N.sup.B is an S-cEt
nucleoside; each N.sup.Q is a .beta.-D-deoxyribonucleoside; N.sup.Y
is a .beta.-D-deoxyribonucleoside; and N.sup.Z is a
2'-O-methoxyethyl nucleoside; b. each R is a 2'-O-methoxyethyl
nucleoside; X is 1; each N.sup.B is an S-cEt nucleoside; each
N.sup.Q is a .beta.-D-deoxyribonucleoside; N.sup.Y is a
.beta.-D-deoxyribonucleoside; and N.sup.Z is an S-cEt nucleoside;
or c. each R is a 2'-O-methoxyethyl nucleoside; X is 1; each
N.sup.B is an S-cEt nucleoside; each N.sup.Q is a
.beta.-D-deoxyribonucleoside; N.sup.Y is an S-cEt nucleoside; and
N.sup.Z is an S-cEt nucleoside.
20. The compound of claim 4 wherein: a. N.sup.M is a
2'-O-methoxyethyl nucleoside; each N.sup.B is an S-cEt nucleoside;
each N.sup.Q is a .beta.-D-deoxyribonucleoside; N.sup.Y is a
.beta.-D-deoxyribonucleoside; N.sup.Z is a 2'-O-methoxyethyl
nucleoside; and b. N.sup.M is a 2'-O-methoxyethyl nucleoside; each
N.sup.B is an S-cEt nucleoside; each N.sup.Q is a
.beta.-D-deoxyribonucleoside; N.sup.Y is a
.beta.-D-deoxyribonucleoside; and N.sup.Z is an S-cEt nucleoside;
or c. N.sup.M is a 2'-O-methoxyethyl nucleoside; each N.sup.B is an
S-cEt nucleoside; each N.sup.Q is a .beta.-D-deoxyribonucleoside;
N.sup.Y is an S-cEt nucleoside; and N.sup.Z is an S-cEt
nucleoside.
21. The compound of claim 5 wherein: N.sup.M is a 2'-O-methoxyethyl
nucleoside; each N.sup.B is an S-cEt nucleoside; each N.sup.Q is a
.beta.-D-deoxyribonucleoside; and N.sup.Z is a 2'-O-methoxyethyl
nucleoside.
22. The compound of claim 1 wherein the modified oligonucleotide
has the nucleobase sequence of SEQ ID NO: 3 or wherein the modified
oligonucleotide has the nucleobase sequence of SEQ ID NO: 4, and
wherein each T in the sequence is independently selected from a T
and a U.
23. A method of inhibiting the activity of miR-21 comprising
contacting a cell with a compound of claim 1.
24. (canceled)
25. (canceled)
26. A method of decreasing collagen expression in a cell comprising
contacting a cell with a compound of claim 1.
27. A method of treating, preventing or delaying the onset of a
disease associated with miR-21 comprising administering to a
subject having a disease associated with miR-21 a compound of claim
1.
28. The method of claim 27, wherein the disease is fibrosis.
29. (canceled)
30. (canceled)
31. A method of treating a fibroproliferative disorder in a subject
comprising administering to the subject a compound of claim 1.
32. (canceled)
33. (canceled)
34. (canceled)
35. (canceled)
36. The method of claim 27, wherein the disease is cancer.
37.-51. (canceled)
Description
[0001] This application claims the benefit of priority to U.S.
Provisional Application Nos. 61/478,767, filed Apr. 25, 2011, and
61/565,779, filed Dec. 1, 2011, which are incorporated herein by
reference in their entireties for any purpose.
FIELD OF INVENTION
[0002] Provided herein are methods and compositions for the
modulation of miR-21 activity.
DESCRIPTION OF RELATED ART
[0003] MicroRNAs (microRNAs), also known as "mature microRNA" are
small (approximately 18-24 nucleotides in length), non-coding RNA
molecules encoded in the genomes of plants and animals. In certain
instances, highly conserved, endogenously expressed microRNAs
regulate the expression of genes by binding to the 3'-untranslated
regions (3'-UTR) of specific mRNAs. More than 1000 different
microRNAs have been identified in plants and animals. Certain
mature microRNAs appear to originate from long endogenous primary
microRNA transcripts (also known as pri-microRNAs, pri-mirs,
pri-miRs or pri-pre-microRNAs) that are often hundreds of
nucleotides in length (Lee, et al., EMBO J., 2002, 21(17),
4663-4670).
[0004] Functional analyses of microRNAs have revealed that these
small non-coding RNAs contribute to different physiological
processes in animals, including developmental timing,
organogenesis, differentiation, patterning, embryogenesis, growth
control and programmed cell death. Examples of particular processes
in which microRNAs participate include stem cell differentiation,
neurogenesis, angiogenesis, hematopoiesis, and exocytosis (reviewed
by Alvarez-Garcia and Miska, Development, 2005, 132,
4653-4662).
SUMMARY OF INVENTION
[0005] Provided herein are compounds comprising a modified
oligonucleotide, wherein the nucleobase sequence of the modified
oligonucleotide is complementary to miR-21 and wherein the modified
oligonucleotide has a nucleoside pattern described herein.
[0006] Provided herein are methods for inhibiting the activity of
miR-21 comprising contacting a cell with a compound described
herein. In certain embodiments, the cell is in vivo. In certain
embodiments, the cell is in vitro.
[0007] Provided herein are methods for treating a disease
associated with miR-21 comprising administering to a subject having
a disease associated with miR-21 a compound described herein. In
certain embodiments, the animal is a human.
[0008] The compounds described herein are provided for use in
therapy.
[0009] Provided herein are compounds comprising a modified
oligonucleotide consisting of 8 to 22 linked nucleosides, wherein
the nucleobase sequence of the modified oligonucleotide is
complementary to miR-21 (SEQ ID NO: 1) and wherein the modified
oligonucleotide comprises at least 8 contiguous nucleosides of the
following nucleoside pattern I in the 5' to 3' orientation:
(R).sub.X-N.sup.B-N.sup.Q-N.sup.Q-N.sup.B-(N.sup.Q-N.sup.Q-N.sup.Q-N.sup-
.B).sub.3-N.sup.Q-N.sup.Z
wherein each R is, independently, a non-bicyclic nucleoside; X is
from 1 to 4; each N.sup.B is, independently, a bicyclic nucleoside;
each N.sup.Q is, independently, a non-bicyclic nucleoside; and each
N.sup.Z is, independently, a modified nucleoside.
[0010] Provided herein are compounds comprising a modified
oligonucleotide consisting of 8 to 19 linked nucleosides, wherein
the nucleobase sequence of the modified oligonucleotide is
complementary to miR-21 (SEQ ID NO: 1) and wherein the modified
oligonucleotide comprises at least 8 contiguous nucleosides of the
following nucleoside pattern II in the 5' to 3' orientation:
N.sup.M-N.sup.B-N.sup.Q-N.sup.Q-N.sup.B-(N.sup.Q-N.sup.Q-N.sup.Q-N.sup.B-
).sub.3-N.sup.Q-N.sup.Z
wherein N.sup.M is, independently, a modified nucleoside that is
not a bicyclic nucleoside; each N.sup.B is, independently, a
bicyclic nucleoside; each N.sup.Q is, independently, a non-bicyclic
nucleoside; and N.sup.Z is, independently, a modified
nucleoside.
[0011] Provided herein are compounds comprising a modified
oligonucleotide consisting of 8 to 19 linked nucleosides, wherein
the nucleobase sequence of the modified oligonucleotide is
complementary to miR-21 (SEQ ID NO: 1) and wherein the modified
oligonucleotide comprises at least 8 contiguous nucleosides of the
following nucleoside pattern III in the 5' to 3' orientation:
(R).sub.X-N.sup.B-N.sup.Q-N.sup.Q-N.sup.B-(N.sup.Q-N.sup.Q-N.sup.Q-N.sup-
.B).sub.3-N.sup.Y-N.sup.Z
wherein each R is a non-bicyclic nucleoside; X is from 1 to 4; each
N.sup.B is a bicyclic nucleoside; each N.sup.Q is a non-bicyclic
nucleoside; N.sup.Y is a modified nucleoside or an unmodified
nucleoside; and each N.sup.Z is a modified nucleoside.
[0012] Provided herein are compounds comprising a modified
oligonucleotide consisting of 8 to 19 linked nucleosides, wherein
the nucleobase sequence of the modified oligonucleotide is
complementary to miR-21 (SEQ ID NO: 1) and wherein the modified
oligonucleotide comprises at least 8 contiguous nucleosides of the
following nucleoside pattern IV in the 5' to 3' orientation:
N.sup.M-N.sup.B-N.sup.Q-N.sup.Q-N.sup.B-(N.sup.Q-N.sup.Q-N.sup.Q-N.sup.B-
).sub.3-N.sup.Y-N.sup.Z
wherein N.sup.M is a modified nucleoside that is not a bicyclic
nucleoside; each N.sup.B is a bicyclic nucleoside; each N.sup.Q is
a non-bicyclic nucleoside; N.sup.Y is a modified nucleoside or an
unmodified nucleoside; and N.sup.Z is a modified nucleoside.
[0013] Provided herein are compounds comprising a modified
oligonucleotide consisting of 8 to 19 linked nucleosides, wherein
the nucleobase sequence of the modified oligonucleotide is
complementary to miR-21 (SEQ ID NO: 1) and wherein the modified
oligonucleotide comprises at least 8 contiguous nucleosides of the
following nucleoside pattern V in the 5' to 3' orientation:
N.sup.M-N.sup.B-(N.sup.Q-N.sup.Q-N.sup.B-N.sup.B).sub.4-N.sup.Z
wherein N.sup.M is a modified nucleoside that is not a bicyclic
nucleoside; each N.sup.B is a bicyclic nucleoside; each N.sup.Q is
a non-bicyclic nucleoside; and N.sup.Z is a modified
nucleoside.
[0014] In certain embodiments of nucleoside pattern I or III, X is
1, X is 2, X is 3, or X is 4.
[0015] In certain embodiments of any of the compounds provided
herein, the modified oligonucleotide comprises at least 9, at least
10, at least 11, at least 12, at least 13, at least 14, at least
15, at least 16, at least 17, at least 18, at least 19, at least
20, at least 21, or 22 contiguous nucleosides of nucleoside pattern
I, II, III, IV or V. In certain embodiments of any of the compounds
provided herein, the modified oligonucleotide consists of 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 linked
nucleosides of nucleoside pattern I, II, III, IV or V.
[0016] In certain embodiments of any of the compounds provided
herein, the nucleobase sequence of the modified oligonucleotide is
at least 90% complementary is at least 95% complementary, or is
100% complementary to the nucleobase sequence of miR-21 (SEQ ID NO:
1).
[0017] In certain embodiments of any of the compounds provided
herein, the nucleobase at position 1 of miR-21 is paired with the
first nucleobase at the 3'-terminus of the modified
oligonucleotide.
[0018] In certain embodiments of any of the compounds provided
herein, each bicyclic nucleoside is independently selected from an
LNA nucleoside, a cEt nucleoside, and an ENA nucleoside.
[0019] In certain embodiments of any of the compounds provided
herein, at least two non-bicyclic nucleosides comprise sugar
moieties that are different from one another. In certain
embodiments of any of the compounds provided herein, each
non-bicyclic nucleoside has the same type of sugar moiety.
[0020] In certain embodiments of any of the compounds provided
herein, each bicyclic nucleoside is a cEt nucleoside. In certain
embodiments, the cEt nucleoside is an S-cEt nucleoside. In certain
embodiments, the cEt nucleoside is an R-cEt nucleoside. In certain
embodiments of any of the compounds provided herein, each bicyclic
nucleoside is an LNA nucleoside.
[0021] In certain embodiments of any of the compounds provided
herein, each non-bicyclic nucleoside is independently selected from
a .beta.-D-deoxyribonucleoside, a .beta.-D-ribonucleoside,
2'-O-methyl nucleoside, a 2'-O-methoxyethyl nucleoside, and a
2'-fluoronucleoside. In certain embodiments of any of the compounds
provided herein, each non-bicyclic nucleoside is independently
selected from a .beta.-D-deoxyribonucleoside, and a
2'-O-methoxyethyl nucleoside. In certain embodiments of any of the
compounds provided herein, each non-bicyclic nucleoside is a
.beta.-D-deoxyribonucleoside. In certain embodiments of any of the
compounds provided herein, each non-bicyclic nucleoside is a
2'-O-methoxyethyl nucleoside.
[0022] In certain embodiments of any of the compounds provided
herein, each bicyclic nucleoside comprises a non-methylated
nucleobase.
[0023] In certain embodiments of any of the compounds provided
herein, no more than two non-bicyclic nucleosides are
2'-O-methoxyethyl nucleosides. In certain such embodiments, each
other non-bicyclic nucleoside is a
.beta.-D-deoxyribonucleoside.
[0024] In certain embodiments of any of the compounds provided
herein, the 5'-most and the 3'-most non-bicyclic nucleosides are
2'-O-methoxyethyl nucleosides and each other non-bicyclic
nucleoside is a .beta.-D-deoxyribonucleoside. In certain
embodiments of any of the compounds provided herein, two
non-bicyclic nucleosides are 2'-MOE nucleosides and each other
non-bicyclic nucleoside is a .beta.-D-deoxyribonucleoside.
[0025] In certain embodiments of nucleoside pattern I or III, each
nucleoside of R is a 2'-O-methoxyethyl nucleoside. In certain
embodiments of nucleoside pattern I or III, three nucleosides of R
are 2'-O-methoxyethyl nucleosides and one nucleoside of R is a
.beta.-D-deoxyribonucleoside.
[0026] In certain embodiments of any of the compounds provided
herein, at least one internucleoside linkage is a modified
internucleoside linkage. In certain embodiments of any of the
compounds provided herein, each internucleoside linkage is a
modified internucleoside linkage. In certain embodiments, the
modified internucleoside linkage is a phosphorothioate
internucleoside linkage.
[0027] In certain embodiments of any of the compounds provided
herein, at least one nucleoside comprises a modified nucleobase. In
certain embodiments of any of the compounds provided herein, at
least one cytosine is a 5-methyl cytosine. In certain embodiments
of any of the compounds provided herein, each cytosine is a
5-methylcytosine. In certain embodiments of any of the compounds
provided herein, the cytosine at position two of the modified
oligonucleotide is a 5-methylcytosine.
[0028] In certain embodiments of nucleoside pattern I, R consists
of four linked nucleosides N.sup.R1-N.sup.R2N.sup.R3-N.sup.R4,
where N.sup.R1 is a 2'-O-methoxyethyl nucleoside and each of
N.sup.R2-N.sup.R3-N.sup.R4 is a .beta.-D-deoxyribonucleoside; each
N.sup.B is an S-cEt nucleoside; each N.sup.Q is a
.beta.-D-deoxyribonucleoside; and N.sup.Z is a 2'-O-methoxyethyl
nucleoside. In certain embodiments of nucleoside pattern I, each R
is a 2'-O-methoxyethyl nucleoside; X is 1; each N.sup.B is an S-cEt
nucleoside; each N.sup.Q is a .beta.-D-deoxyribonucleoside; and
N.sup.Z is a 2'-O-methoxyethyl nucleoside. In certain embodiments
of nucleoside pattern I, each R is a 2'-O-methoxyethyl nucleoside;
X is 1; each N.sup.B is an S-cEt nucleoside; each N.sup.Q is a
2'-O-methoxyethyl nucleoside; and N.sup.Z is a 2'-O-methoxyethyl
nucleoside. In certain embodiments of nucleoside pattern I, each R
is a 2'-O-methoxyethyl nucleoside; X is 1; each N.sup.B is an S-cEt
nucleoside; each N.sup.Q is a .beta.-D-deoxyribonucleoside; and
N.sup.Z is an S-cEt nucleoside. In certain embodiments of
nucleoside pattern I, each R is a 2'-O-methoxyethyl nucleoside; X
is 1; each N.sup.B is an LNA nucleoside; each N.sup.Q is a
.beta.-D-deoxyribonucleoside; and N.sup.Z is a 2'-O-methoxyethyl
nucleoside. In certain embodiments of nucleoside pattern I, each R
is a 2'-O-methoxyethyl nucleoside; X is 1; each N.sup.B is an LNA
nucleoside; each N.sup.Q is a .beta.-D-deoxyribonucleoside; and
N.sup.Z is an LNA nucleoside.
[0029] In certain embodiments of nucleoside pattern II, N.sup.M is
a 2'-O-methoxyethyl nucleoside; each N.sup.B is an S-cEt
nucleoside; each N.sup.Q is a .beta.-D-deoxyribonucleoside; and
N.sup.Z is a 2'-O-methoxyethyl nucleoside. In certain embodiments
of nucleoside pattern II, N.sup.M is a 2'-O-methoxyethyl
nucleoside; each N.sup.B is an S-cEt nucleoside; each N.sup.Q is a
2'-O-methoxyethyl nucleoside; and N.sup.Z is a 2'-O-methoxyethyl
nucleosid. In certain embodiments of nucleoside pattern I, N.sup.M
is a 2'-O-methoxyethyl nucleoside; each N.sup.B is an S-cEt
nucleoside; each N.sup.Q is a .beta.-D-deoxyribonucleoside; each N
is a .beta.-D-deoxyribonucleoside; and N.sup.Z is an S-cEt
nucleoside. In certain embodiments of nucleoside pattern II,
N.sup.M is a 2'-O-methoxyethyl nucleoside; each N.sup.B is an LNA
nucleoside; each N.sup.Q is a .beta.-D-deoxyribonucleoside; and
N.sup.Z is a 2'-O-methoxyethyl nucleoside. In certain embodiments
of nucleoside pattern II, N.sup.M is a 2'-O-methoxyethyl
nucleoside; each N.sup.B is an LNA nucleoside; each N.sup.Q is a
.beta.-D-deoxyribonucleoside; and N.sup.Z is an LNA nucleoside.
[0030] In certain embodiments of nucleoside pattern III, each R is
a 2'-O-methoxyethyl nucleoside; X is 1; each N.sup.B is an S-cEt
nucleoside; each N.sup.Q is a .beta.-D-deoxyribonucleoside; N.sup.Y
is a .beta.-D-deoxyribonucleoside; and N.sup.Z is a
2'-O-methoxyethyl nucleoside. In certain embodiments of nucleoside
pattern III, each R is a 2'-O-methoxyethyl nucleoside; X is 1; each
N.sup.B is an S-cEt nucleoside; each N.sup.Q is a
.beta.-D-deoxyribonucleoside; N.sup.Y is a
.beta.-D-deoxyribonucleoside; and N.sup.Z is an S-cEt nucleoside.
In certain embodiments of nucleoside pattern III, each R is a
2'-O-methoxyethyl nucleoside; X is 1; each N.sup.B is an S-cEt
nucleoside; each N.sup.Q is a .beta.-D-deoxyribonucleoside; N.sup.Y
is an S-cEt nucleoside; and N.sup.Z is an S-cEt nucleoside.
[0031] In certain embodiments of nucleoside pattern IV, N.sup.M is
a 2'-O-methoxyethyl nucleoside; each N.sup.B is an S-cEt
nucleoside; each N.sup.Q is a .beta.-D-deoxyribonucleoside; N.sup.Y
is a .beta.-D-deoxyribonucleoside; N.sup.Z is a 2'-O-methoxyethyl
nucleoside. In certain embodiments of nucleoside pattern IV,
N.sup.M is a 2'-O-methoxyethyl nucleoside; each N.sup.B is an S-cEt
nucleoside; each N.sup.Q is a .beta.-D-deoxyribonucleoside; N.sup.Y
is a .beta.-D-deoxyribonucleoside; and N.sup.Z is an S-cEt
nucleoside. In certain embodiments of nucleoside pattern IV,
N.sup.M is a 2'-O-methoxyethyl nucleoside; each N.sup.B is an S-cEt
nucleoside; each N.sup.Q is a .beta.-D-deoxyribonucleoside; N.sup.Y
is an S-cEt nucleoside; and N.sup.Z is an S-cEt nucleoside.
[0032] In certain embodiments of nucleoside pattern V, N.sup.M is a
2'-O-methoxyethyl nucleoside; each N.sup.B is an S-cEt nucleoside;
each N.sup.Q is a .beta.-D-deoxyribonucleoside; and N.sup.Z is a
2'-O-methoxyethyl nucleoside.
[0033] In certain embodiments of any of the compounds provided
herein, the modified oligonucleotide has the nucleobase sequence of
SEQ ID NO: 3, wherein each T in the sequence is independently
selected from T and U. In certain embodiments of any of the
compounds provided herein, the modified oligonucleotide has the
nucleobase sequence of SEQ ID NO: 4, wherein each T in the sequence
is independently selected from T and U.
[0034] Provided herein are methods for inhibiting the activity of
miR-21 comprising contacting a cell with a compound provided
herein. In certain embodiments, the cell is in vivo. In certain
embodiments, the cell is in vitro. In certain embodiments, the cell
is a fibroblast cell, a hyperproliferative cell, a keratinocyte, or
a hypoxic cell. In certain embodiments, the fibroblast cell is a
hyperproliferative fibroblast cell.
[0035] Provided herein are methods for decreasing collagen
expression in a cell comprising contacting a cell with a compound
provided herein.
[0036] Provided herein are methods to treat, prevent, or delay the
onset of a disease associated with miR-21, comprising administering
to a subject having such a disease any of the compounds provided
herein.
[0037] In certain embodiments, the disease is fibrosis. In certain
embodiments the fibrosis is kidney fibrosis, lung fibrosis, liver
fibrosis, cardiac fibrosis, skin fibrosis, age-related fibrosis,
spleen fibrosis, scleroderma, or post-transplant fibrosis.
[0038] In certain embodiments, the fibrosis is kidney fibrosis and
is present in a subject having a disease selected from
glomerulosclerosis, tubulointerstitial fibrosis, IgA nephropathy,
interstitial fibrosis/tubular atrophy; chronic kidney damage,
glomerular disease, glomerulonephritis, diabetes mellitus,
idiopathy focal segmental glomerulosclerosis, membranous
nephropathy, collapsing glomerulopathy, chronic recurrent kidney
infection, and end stage renal disease. In certain embodiments, the
kidney fibrosis results from acute or repetitive trauma to the
kidney.
[0039] In certain embodiments, the fibrosis is liver fibrosis and
is present in a subject having a disease selected from chronic
liver injury, hepatitis infection, non-alcoholic steatohepatitis,
and cirrhosis.
[0040] In certain embodiments, the pulmonary fibrosis is idiopathic
pulmonary fibrosis, or the subject has chronic obstructive
pulmonary disease.
[0041] In certain embodiments, disease is an inflammatory
disease.
[0042] Provided herein are methods of promoting wound healing in a
subject comprising administering to a subject having an acute or
chronic wound any of the compounds provided herein. In certain
embodiments, the chronic wound is an acute or chronic surgical
wound, a penetrating wound, an avulsion injury, a crushing injury,
a shearing injury, a burn injury, a laceration, a bite wound, an
arterial ulcer, a venous ulcer, a pressure ulcer, or a diabetic
ulcer. In certain embodiments, the compound is administered
topically to the wound.
[0043] Provided herein are methods to treat a fibroproliferative
disorder in a subject comprising administering to the subject any
of the compounds provided herein.
[0044] Any of the methods provided herein may comprise selecting a
subject having elevated miR-21 expression in one or more
tissues.
[0045] In certain embodiments, administering any of the compounds
provided herein to a subject reduces collagen expression.
[0046] In certain embodiments, a subject is in need of improved
organ function, wherein the organ function is selected from cardiac
function, pulmonary function, liver function, and kidney function.
In certain embodiments, the administering of any of the compounds
provided herein improves organ function in the subject, wherein the
organ function is selected from cardiac function, pulmonary
function, liver function, and kidney function.
[0047] Any of the methods provided herein comprises evaluating
kidney function in a subject, which may include measuring blood
urea nitrogen in the blood of the subject; measuring creatinine in
the blood of the subject; measuring creatinine clearance in the
subject; measuring proteinuria in the subject; measuring albumin:Cr
ratio in the subject; and/or measuring urinary output in the
subject.
[0048] Any of the methods provided herein may comprise evaluating
liver function in a subject, which may include measuring alanine
aminotransferase levels in the blood of the subject; measuring
aspartate aminotransferase levels in the blood of the subject;
measuring bilirubin levels in the blood of the subject; measuring
albumin levels in the blood of the subject; measuring prothrombin
time in the subject; measuring ascites in the subject; and/or
measuring encephalopathy in the subject.
[0049] Any of the methods provided herein may comprise evaluating
lung function in a subject, which may include measuring vital
capacity in the subject; measuring forced vital capacity in the
subject; measuring forced expiratory volume in one second in the
subject; measuring peak expiratory flow rate in the subject;
measuring forced expiratory flow in the subject; measuring maximal
voluntary ventilation in the subject; determining the ratio of
forced expiratory volume in one second to forced vital capacity in
the subject; measuring ventilation/perfusion ratio in the subject;
measuring nitrogen washout in the subject; and/or measuring
absolute volume of air in one or more lungs of a subject.
[0050] Any of the methods provided herein may comprise evaluating
cardiac function in a subject, which may include measuring cardiac
output in the subject; measuring stroke volume in the subject;
measuring mean systolic ejection rate in the subject; measuring
systolic blood pressure in the subject; measuring left ventricular
ejection fraction in the subject; determining stroke index in the
subject; determining cardiac index in the subject; measuring left
ventricular percent fractional shortening in the subject; measuring
mean velocity of circumferential fiber shortening in the subject;
measuring left ventricular inflow velocity pattern in the subject;
measuring pulmonary venous flow velocity pattern in the subject;
and/or measuring peak early diastolic velocity of the mitral
annulus of the subject.
[0051] Any of the methods provided herein may comprise
administering to a subject at least one therapeutic agent selected
from an anti-inflammatory agent, an immunosuppressive agent, an
anti-diabetic agent, digoxin, a vasodilator, an angiotensin II
converting enzyme (ACE) inhibitors, an angiotensin II receptor
blockers (ARB), a calcium channel blocker, an isosorbide dinitrate,
a hydralazine, a nitrate, a hydralazine, a beta-blocker, a
natriuretic peptides, a heparinoid, and a connective tissue growth
factor inhibitor. In certain embodiments, the anti-inflammatory
agent is a non-steroidal anti-inflammatory agent, wherein the
non-steroidal anti-inflammatory agent is optionally selected from
ibuprofen, a COX-1 inhibitor and a COX-2 inhibitor. In certain
embodiments, the immunosuppressive agent is selected from a
corticosteroid, cyclophosphamide, and mycophenolate mofetil. In
certain embodiments, anti-inflammatory agent is a corticosteroid,
wherein the corticosteroid is optionally prednisone. In certain
embodiments, the angiotensin II converting enzyme (ACE) inhibitors
is selected from captopril, enalapril, lisinopril, benazepril,
quinapril, fosinopril, and ramipril. In certain embodiments, the
angiotensin II receptor blockers (ARB) is selected from
candesartan, irbesartan, olmesartan, losartan, valsartan,
telmisartan, and eprosartan.
[0052] In certain embodiments, a disease is cancer. In certain
embodiments, the cancer is liver cancer, breast cancer, bladder
cancer, prostate cancer, colon cancer, lung cancer, brain cancer,
hematological cancer, pancreatic cancer, head and neck cancer,
cancer of the tongue, stomach cancer, skin cancer, or thyroid
cancer. In certain embodiments, the liver cancer is hepatocellular
carcinoma. In certain embodiments, the brain cancer is glioblastoma
multiforme. In certain embodiments, the hematological cancer is
acute myelogenous leukemia, acute lymphocytic leukemia, acute
monocytic leukemia, multiple myeloma, chronic lymphotic leukemia,
chronic myeloid leukemia, hodgkin's lymphoma, or non-hodgkin's
lymphoma.
[0053] In certain embodiments, the methods provided herein comprise
administering at least one additional anti-cancer therapy to the
subject. In certain embodiments, the anti-cancer therapy is a DNA
damaging agent, a proliferation inhibitor, an anti-folate, a growth
factor receptor inhibitor, an anti-angiogenic agent, a receptor
tyrosine kinase inhibitor, a kinase inhibitor, a growth factor
inhibitor, a cytotoxic agent, radiation therapy, or surgical
resection of a tumor. In certain embodiments, the DNA damaging
agent is 1,3-bis(2-chloroethyl)-1-nitrosourea, busulfan,
carboplatin, carmustine, chlorambucil, cisplatin, cyclophosphamide,
dacarbazine, daunorubicin, doxorubicin, epirubicin, etoposide,
idarubicin, ifosfamide, irinotecan, lomustine, mechlorethamine,
melphalan, mitomycin C, mitoxantrone, oxaliplatin, temozolomide, or
topotecan. In certain embodiments, the anti-folate is methotrexate,
aminopterin, thymidylate synthase, serine hydroxymethyltransferase,
folyilpolyglutamyl synthetase, g-glutamyl hydrolase,
glycinamide-ribonucleotide transformylase, leucovorin,
amino-imidazole-carboxamide-ribonucleotide transformylase,
5-fluorouracil, or a folate transporter. In certain embodiments,
the growth factor receptor inhibitor is erlotinib, or gefitinib. In
certain embodiments, the angiogenesis inhibitor is bevacizumab,
thalidomide, carboxyamidotriazole, TNP-470, CM101, IFN-.alpha.,
platelet factor-4, suramin, SU5416, thrombospondin, a VEGFR
antagonist, cartilage-derived angiogenesis inhibitory factor, a
matrix metalloproteinase inhibitor, angiostatin, endostatin,
2-methoxyestradiol, tecogalan, tetrathiomolybdate, prolactin, or
linomide. In certain embodiments, the kinase inhibitor is
bevacizumab, BIBW 2992, cetuximab, imatinib, trastuzumab,
gefitinib, ranibizumab, pegaptanib, sorafenib, dasatinib,
sunitinib, erlotinib, nilotinib, lapatinib, panitumumab,
vandetanib, E7080, pazopanib, mubritinib, or fostamatinib.
[0054] In certain embodiments, the administering to a subject
having cancer results in reduction of tumor size and/or tumor
number. In certain embodiments, the administering to a subject
having cancer prevents or delays an increase in tumor size and/or
tumor number. In certain embodiments, the administering to a
subject having cancer prevents or slows metastatic progression. In
certain embodiments, the administering to a subject having cancer
extends overall survival time and/or progression-free survival of
the subject. In certain embodiments, the methods provided herein
comprise selecting a subject having elevated serum
alpha-fetoprotein and/or elevated serum
des-gamma-carboxyprothrombin. In certain embodiments, the methods
provided herein comprise reducing serum alpha-fetoprotein and/or
serum des-gamma-carboxyprothrombin. In certain embodiments, the
methods provided herein comprise selecting an animal having
abnormal liver function.
[0055] In any of the methods provided herein, subject is a
human.
[0056] In any of the methods provided herein, the compound is
present as a pharmaceutical composition.
[0057] Any of the compounds provided herein may be for use in
therapy. Any of the compounds provided herein may be for use in the
treatment of fibrosis. Any of the compounds provided herein may be
for use in promoting wound healing. Any of the compounds provided
herein may be for use in treating cancer. Any of the compounds
provided herein may be for use in preventing and/or delaying the
onset of metastasis.
[0058] Any of the compounds provided herein may be for use in
treating cardiac disease.
[0059] Any of the compounds provided herein may be for use in the
preparation of a medicament. Any of the compounds provided herein
may be for use in the preparation of a medicament for treating
fibrosis. Any of the compounds provided herein may be for use in
the preparation of a medicament for promoting wound healing. Any of
the compounds provided herein may be for use in the preparation of
a medicament for treating cancer. Any of the compounds provided
herein may be for use in the preparation of a medicament for
preventing and/or delaying the onset of metastasis.
BRIEF DESCRIPTION OF THE FIGURES
[0060] FIG. 1 shows urinary albumin to creatinine ratio (ACR,
.mu.gAlb/mgCr) in ischemic reperfusion/nephrectomy (IR/Nx) model
mice administered anti-miR21 compounds, as described in Example
5.
[0061] FIG. 2 shows (A) collagen 1A1 and (B) collagen 3A1
expression in kidneys of UUO model mice administered anti-miR21
compounds, as described in Example 6.
DETAILED DESCRIPTION
[0062] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as is commonly understood by one
of skill in the arts to which the invention belongs. Unless
specific definitions are provided, the nomenclature utilized in
connection with, and the procedures and techniques of, analytical
chemistry, synthetic organic chemistry, and medicinal and
pharmaceutical chemistry described herein are those well known and
commonly used in the art. In the event that there is a plurality of
definitions for terms herein, those in this section prevail.
Standard techniques may be used for chemical synthesis, chemical
analysis, pharmaceutical preparation, formulation and delivery, and
treatment of subjects. Certain such techniques and procedures may
be found for example in "Carbohydrate Modifications in Antisense
Research" Edited by Sangvi and Cook, American Chemical Society,
Washington D.C., 1994; and "Remington's Pharmaceutical Sciences,"
Mack Publishing Co., Easton, Pa., 18th edition, 1990; and which is
hereby incorporated by reference for any purpose. Where permitted,
all patents, patent applications, published applications and
publications, GENBANK sequences, websites and other published
materials referred to throughout the entire disclosure herein,
unless noted otherwise, are incorporated by reference in their
entirety. Where reference is made to a URL or other such identifier
or address, it is understood that such identifiers can change and
particular information on the internet can change, but equivalent
information can be found by searching the internet. Reference
thereto evidences the availability and public dissemination of such
information.
[0063] Before the present compositions and methods are disclosed
and described, it is to be understood that the terminology used
herein is for the purpose of describing particular embodiments only
and is not intended to be limiting. It must be noted that, as used
in the specification and the appended claims, the singular forms
"a," "an" and "the" include plural referents unless the context
clearly dictates otherwise.
DEFINITIONS
[0064] "Fibrosis" means the formation or development of excess
fibrous connective tissue in an organ or tissue. In certain
embodiments, fibrosis occurs as a reparative or reactive process.
In certain embodiments, fibrosis occurs in response to damage or
injury. The term "fibrosis" is to be understood as the formation or
development of excess fibrous connective tissue in an organ or
tissue as a reparative or reactive process, as opposed to a
formation of fibrous tissue as a normal constituent of an organ or
tissue.
[0065] "Subject suspected of having" means a subject exhibiting one
or more clinical indicators of a disease.
[0066] "Subject suspected of having fibrosis" means a subject
exhibiting one or more clinical indicators of fibrosis.
[0067] "Fibroblast" means a cell that gives rise to connective
tissue.
[0068] "Fibroproliferative disorder" means a disorder characterized
by excessive proliferation and/or activation of fibroblasts.
[0069] "Liver cancer" means a malignant tumor of the liver, either
a primary cancer or metastasized cancer. In certain embodiments,
liver cancer includes, but is not limited to, cancer arising from
hepatocytes, such as, for example, hepatomas and hepatocellular
carcinomas; fibrolamellar carcinoma; and cholangiocarcinomas (or
bile duct cancer).
[0070] "Metastasis" means the process by which cancer spreads from
the place at which it first arose as a primary tumor to other
locations in the body. The metastatic progression of a primary
tumor reflects multiple stages, including dissociation from
neighboring primary tumor cells, survival in the circulation, and
growth in a secondary location.
[0071] "Overall survival time" means the time period for which a
subject survives after diagnosis of or treatment for a disease. In
certain embodiments, the disease is cancer. In some embodiments,
overall survival time is survival after diagnosis. In some
embodiments, overall survival time is survival after the start of
treatment.
[0072] "Progression-free survival" means the time period for which
a subject having a disease survives, without the disease getting
worse. In certain embodiments, progression-free survival is
assessed by staging or scoring the disease. In certain embodiments,
progression-free survival of a subject having liver cancer is
assessed by evaluating tumor size, tumor number, and/or
metastasis.
[0073] "Anti-miR" means an oligonucleotide having nucleobase
sequence complementary to a microRNA. In certain embodiments, an
anti-miR is a modified oligonucleotide.
[0074] "Anti-miR-X" where "miR-X" designates a particular microRNA,
means an oligonucleotide having a nucleobase sequence complementary
to miR-X. In certain embodiments, an anti-miR-X is fully
complementary to miR-X. In certain embodiments, an anti-miR-X is at
least 80%, at least 85%, at least 90%, or at least 95%
complementary to miR-X. In certain embodiments, an anti-miR-X is a
modified oligonucleotide.
[0075] "miR-21" means the mature miRNA having the nucleobase
sequence UAGCUUAUCAGACUGAUGUUGA (SEQ ID NO: 1).
[0076] "miR-21 stem-loop sequence" means the stem-loop sequence
having the nucleobase sequence
UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGUCUGACA
(SEQ ID NO: 2).
[0077] "Target nucleic acid" means a nucleic acid to which an
oligomeric compound is designed to hybridize.
[0078] "Targeting" means the process of design and selection of
nucleobase sequence that will hybridize to a target nucleic
acid.
[0079] "Targeted to" means having a nucleobase sequence that will
allow hybridization to a target nucleic acid.
[0080] "Target engagement" means the interaction of an
oligonucleotide with the microRNA to which it is complementary, in
a manner that changes the activity, expression or level of the
microRNA. In certain embodiments, target engagement means an
anti-miR interacting with the microRNA to which it is
complementary, such that the activity of the microRNA is
inhibited.
[0081] "Modulation" means a perturbation of function, amount, or
activity. In certain embodiments, modulation means an increase in
function, amount, or activity. In certain embodiments, modulation
means a decrease in function, amount, or activity.
[0082] "Expression" means any functions and steps by which a gene's
coded information is converted into structures present and
operating in a cell.
[0083] "5' target site" means the nucleobase of a target nucleic
acid which is complementary to the 3'-most nucleobase of a
particular oligonucleotide.
[0084] "3' target site" means the nucleobase of a target nucleic
acid which is complementary to the 5'-most nucleobase of a
particular oligonucleotide.
[0085] "Region" means a portion of linked nucleosides within a
nucleic acid. In certain embodiments, an oligonucleotide has a
nucleobase sequence that is complementary to a region of a target
nucleic acid. For example, in certain such embodiments an
oligonucleotide is complementary to a region of a microRNA
stem-loop sequence. In certain such embodiments, an oligonucleotide
is fully complementary to a region of a microRNA stem-loop
sequence.
[0086] "Segment" means a smaller or sub-portion of a region.
[0087] "Nucleobase sequence" means the order of contiguous
nucleobases in an oligomeric compound or nucleic acid, typically
listed in a 5' to 3' orientation, independent of any sugar,
linkage, and/or nucleobase modification.
[0088] "Contiguous nucleobases" means nucleobases immediately
adjacent to each other in a nucleic acid.
[0089] "Nucleobase complementarity" means the ability of two
nucleobases to pair non-covalently via hydrogen bonding.
[0090] "Complementary" means that one nucleic acid is capable of
hybridizing to another nucleic acid or oligonucleotide. In certain
embodiments, complementary refers to an oligonucleotide capable of
hybridizing to a target nucleic acid.
[0091] "Fully complementary" means each nucleobase of an
oligonucleotide is capable of pairing with a nucleobase at each
corresponding position in a target nucleic acid. In certain
embodiments, an oligonucleotide is fully complementary to a
microRNA, i.e. each nucleobase of the oligonucleotide is
complementary to a nucleobase at a corresponding position in the
microRNA. In certain embodiments, an oligonucleotide wherein each
nucleobase has complementarity to a nucleobase within a region of a
microRNA stem-loop sequence is fully complementary to the microRNA
stem-loop sequence.
[0092] "Percent complementarity" means the percentage of
nucleobases of an oligonucleotide that are complementary to an
equal-length portion of a target nucleic acid. Percent
complementarity is calculated by dividing the number of nucleobases
of the oligonucleotide that are complementary to nucleobases at
corresponding positions in the target nucleic acid by the total
number of nucleobases in the oligonucleotide.
[0093] "Percent identity" means the number of nucleobases in first
nucleic acid that are identical to nucleobases at corresponding
positions in a second nucleic acid, divided by the total number of
nucleobases in the first nucleic acid. In certain embodiments, the
first nucleic acid is a microRNA and the second nucleic acid is a
microRNA. In certain embodiments, the first nucleic acid is an
oligonucleotide and the second nucleic acid is an
oligonucleotide.
[0094] "Hybridize" means the annealing of complementary nucleic
acids that occurs through nucleobase complementarity.
[0095] "Mismatch" means a nucleobase of a first nucleic acid that
is not capable of pairing with a nucleobase at a corresponding
position of a second nucleic acid.
[0096] "Identical" in the context of nucleobase sequences, means
having the same nucleobase sequence, independent of sugar, linkage,
and/or nucleobase modifications and independent of the methyl state
of any pyrimidines present.
[0097] "MicroRNA" means an endogenous non-coding RNA between 18 and
25 nucleobases in length, which is the product of cleavage of a
pre-microRNA by the enzyme Dicer. Examples of mature microRNAs are
found in the microRNA database known as miRBase
(http://microrna.sanger.ac.uk/). In certain embodiments, microRNA
is abbreviated as "microRNA" or "miR."
[0098] "Pre-microRNA" or "pre-miR" means a non-coding RNA having a
hairpin structure, which is the product of cleavage of a pri-miR by
the double-stranded RNA-specific ribonuclease known as Drosha.
[0099] "Stem-loop sequence" means an RNA having a hairpin structure
and containing a mature microRNA sequence. Pre-microRNA sequences
and stem-loop sequences may overlap. Examples of stem-loop
sequences are found in the microRNA database known as miRBase
(http://microrna.sanger.ac.uk/).
[0100] "Pri-microRNA" or "pri-miR" means a non-coding RNA having a
hairpin structure that is a substrate for the double-stranded
RNA-specific ribonuclease Drosha.
[0101] "microRNA precursor" means a transcript that originates from
a genomic DNA and that comprises a non-coding, structured RNA
comprising one or more microRNA sequences. For example, in certain
embodiments a microRNA precursor is a pre-microRNA. In certain
embodiments, a microRNA precursor is a pri-microRNA.
[0102] "microRNA-regulated transcript" means a transcript that is
regulated by a microRNA.
[0103] "Monocistronic transcript" means a microRNA precursor
containing a single microRNA sequence.
[0104] "Polycistronic transcript" means a microRNA precursor
containing two or more microRNA sequences.
[0105] "Seed sequence" means a nucleobase sequence comprising from
6 to 8 contiguous nucleobases of nucleobases 1 to 9 of the 5'-end
of a mature microRNA sequence.
[0106] "Seed match sequence" means a nucleobase sequence that is
complementary to a seed sequence, and is the same length as the
seed sequence.
[0107] "Oligomeric compound" means a compound that comprises a
plurality of linked monomeric subunits. Oligomeric compounds
included oligonucleotides.
[0108] "Oligonucleotide" means a compound comprising a plurality of
linked nucleosides, each of which can be modified or unmodified,
independent from one another.
[0109] "Naturally occurring internucleoside linkage" means a 3' to
5' phosphodiester linkage between nucleosides.
[0110] "Natural sugar" means a sugar found in DNA (2'-H) or RNA
(2'-OH).
[0111] "Internucleoside linkage" means a covalent linkage between
adjacent nucleosides.
[0112] "Linked nucleosides" means nucleosides joined by a covalent
linkage.
[0113] "Nucleobase" means a heterocyclic moiety capable of
non-covalently pairing with another nucleobase.
[0114] "Nucleoside" means a nucleobase linked to a sugar
moiety.
[0115] "Nucleotide" means a nucleoside having a phosphate group
covalently linked to the sugar portion of a nucleoside.
[0116] "Compound comprising a modified oligonucleotide consisting
of a number of linked nucleosides means a compound that includes a
modified oligonucleotide having the specified number of linked
nucleosides. Thus, the compound may include additional substituents
or conjugates. Unless otherwise indicated, the compound does not
include any additional nucleosides beyond those of the
oligonucleotide.
[0117] "Compound comprising a modified oligonucleotide consisting
of a number of linked nucleosides means a compound that includes a
modified oligonucleotide having the specified number of linked
nucleosides. Thus, the compound may include additional substituents
or conjugates. Unless otherwise indicated, the compound does not
include any additional nucleosides beyond those of the modified
oligonucleotide.
[0118] "Modified oligonucleotide" means an oligonucleotide having
one or more modifications relative to a naturally occurring
terminus, sugar, nucleobase, and/or internucleoside linkage. A
modified oligonucleotide may comprise unmodified nucleosides.
[0119] "Single-stranded modified oligonucleotide" means a modified
oligonucleotide which is not hybridized to a complementary
strand.
[0120] "Modified nucleoside" means a nucleoside having any change
from a naturally occurring nucleoside. A modified nucleoside may
have a modified sugar, and unmodified nucleobase. A modified
nucleoside may have a modified sugar and a modified nucleobase. A
modified nucleoside may have a natural sugar and a modified
nucleobase. In certain embodiments, a modified nucleoside is a
bicyclic nucleoside. In certain embodiments, a modified nucleoside
is a non-bicyclic nucleoside.
[0121] "Modified internucleoside linkage" means any change from a
naturally occurring internucleoside linkage.
[0122] "Phosphorothioate internucleoside linkage" means a linkage
between nucleosides where one of the non-bridging atoms is a sulfur
atom.
[0123] "Modified sugar moiety" means substitution and/or any change
from a natural sugar.
[0124] "Unmodified nucleobase" means the naturally occurring
heterocyclic bases of RNA or DNA: the purine bases adenine (A) and
guanine (G), and the pyrimidine bases thymine (T), cytosine (C)
(including 5-methylcytosine), and uracil (U).
[0125] "5-methylcytosine" means a cytosine comprising a methyl
group attached to the 5 position.
[0126] "Non-methylated cytosine" means a cytosine that does not
have a methyl group attached to the 5 position.
[0127] "Modified nucleobase" means any nucleobase that is not an
unmodified nucleobase.
[0128] "Furanosyl" means a structure comprising a 5-membered ring
consisting of four carbon atoms and one oxygen atom.
[0129] "Naturally occurring furanosyl" means a ribofuranosyl as
found in naturally occurring RNA or a deoxyribofuranosyl as found
in naturally occurring DNA.
[0130] "Sugar moiety" means a naturally occurring furanosyl or a
modified sugar moiety.
[0131] "Modified sugar moiety" means a substituted sugar moiety or
a sugar surrogate.
[0132] "Substituted sugar moiety" means a furanosyl that is not a
naturally occurring furanosyl. Substituted sugar moieties include,
but are not limited to sugar moieties comprising modifications at
the 2'-position, the 5'-position and/or the 4'-position of a
naturally occurring furanosyl. Certain substituted sugar moieties
are bicyclic sugar moieties.
[0133] "Sugar surrogate" means a structure that does not comprise a
furanosyl and that is capable of replacing the naturally occurring
furanosyl of a nucleoside, such that the resulting nucleoside is
capable of (1) incorporation into an oligonucleotide and (2)
hybridization to a complementary nucleoside. Such structures
include relatively simple changes to the furanosyl, such as rings
comprising a different number of atoms (e.g., 4, 6, or 7-membered
rings); replacement of the oxygen of the furanosyl with a
non-oxygen atom (e.g., carbon, sulfur, or nitrogen); or both a
change in the number of atoms and a replacement of the oxygen. Such
structures may also comprise substitutions corresponding with those
described for substituted sugar moieties (e.g., 6-membered
carbocyclic bicyclic sugar surrogates optionally comprising
additional substituents). Sugar surrogates also include more
complex sugar replacements (e.g., the non-ring systems of peptide
nucleic acid). Sugar surrogates include without limitation
morpholinos, cyclohexenyls and cyclohexitols.
[0134] "2'-O-methyl sugar" or "2'-OMe sugar" means a sugar having a
O-methyl modification at the 2' position.
[0135] "2'-O-methoxyethyl sugar" or "2'-MOE sugar" means a sugar
having a O-methoxyethyl modification at the 2' position.
[0136] "2'-O-fluoro" or "2'-F" means a sugar having a fluoro
modification of the 2' position.
[0137] "Bicyclic sugar moiety" means a modified sugar moiety
comprising a 4 to 7 membered ring (including by not limited to a
furanosyl) comprising a bridge connecting two atoms of the 4 to 7
membered ring to form a second ring, resulting in a bicyclic
structure. In certain embodiments, the 4 to 7 membered ring is a
sugar ring. In certain embodiments the 4 to 7 membered ring is a
furanosyl. In certain such embodiments, the bridge connects the
2'-carbon and the 4'-carbon of the furanosyl.
[0138] "Locked nucleic acid (LNA) sugar moiety" means a substituted
sugar moiety comprising a (CH.sub.2)--O bridge between the 4' and
2' furanose ring atoms.
[0139] "ENA sugar moiety" means a substituted sugar moiety
comprising a (CH.sub.2).sub.2--O bridge between the 4' and 2'
furanose ring atoms.
[0140] "Constrained ethyl (cEt) sugar moiety" means a substituted
sugar moiety comprising a CH(CH.sub.3)--O bridge between the 4' and
the 2' furanose ring atoms. In certain embodiments, the
CH(CH.sub.3)--O bridge is constrained in the S orientation. In
certain embodiments, the (CH.sub.2).sub.2--O is constrained in the
R orientation.
[0141] "S-cEt sugar moiety" means a substituted sugar moiety
comprising an S-constrained CH(CH.sub.3)--O bridge between the 4'
and the 2' furanose ring atoms.
[0142] "R-cEt sugar moiety" means a substituted sugar moiety
comprising an R-constrained CH(CH.sub.3)--O bridge between the 4'
and the 2' furanose ring atoms.
[0143] "2'-O-methyl" nucleoside means a 2'-modified nucleoside
having a 2'-O-methyl sugar modification.
[0144] "2'-O-methoxyethyl nucleoside" means a 2'-modified
nucleoside having a 2'-O-methoxyethyl sugar modification. A
2'-O-methoxyethyl nucleoside may comprise a modified or unmodified
nucleobase.
[0145] "2'-fluoro nucleoside" means a 2'-modified nucleoside having
a 2'-fluoro sugar modification. A 2'-fluoro nucleoside may comprise
a modified or unmodified nucleobase.
[0146] "Bicyclic nucleoside" means a 2'-modified nucleoside having
a bicyclic sugar moiety. A bicyclic nucleoside may have a modified
or unmodified nucleobase.
[0147] "cEt nucleoside" means a nucleoside comprising a cEt sugar
moiety. A cEt nucleoside may comprise a modified or unmodified
nucleobase.
[0148] "S-cEt nucleoside" means a nucleoside comprising an S-cEt
sugar moiety.
[0149] "R-cEt nucleoside" means a nucleoside comprising an R-cEt
sugar moiety.
[0150] "Non-bicyclic nucleoside" means a nucleoside that has a
sugar other than a bicyclic sugar. In certain embodiments, a
non-bicyclic nucleoside comprises a naturally occurring sugar. In
certain embodiments, a non-bicyclic nucleoside comprises a modified
sugar. In certain embodiments, a non-bicyclic nucleoside is a
.beta.-D-deoxyribonucleoside. In certain embodiments, a
non-bicyclic nucleoside is a 2'-O-methoxyethyl nucleoside.
[0151] ".beta.-D-deoxyribonucleoside" means a naturally occurring
DNA nucleoside. A .beta.-D-deoxyribonucleoside may comprise a
modified or unmodified nucleobase.
[0152] .beta.-D-ribonucleoside" means a naturally occurring RNA
nucleoside. A .beta.-D-ribonucleoside may comprise a modified or
unmodified nucleobase.
[0153] "LNA nucleoside" means a nucleoside comprising a LNA sugar
moiety.
[0154] "ENA nucleoside" means a nucleoside comprising an ENA sugar
moiety.
[0155] "Motif" means a pattern of modified and/or unmodified
nucleobases, sugars, and/or internucleoside linkages in an
oligonucleotide. In certain embodiments, a motif is a nucleoside
pattern.
[0156] "Nucleoside pattern" means a pattern of nucleoside
modifications in a modified oligonucleotide or a region thereof. A
nucleoside pattern is a motif that describes the arrangement of
nucleoside modifications in an oligonucleotide.
[0157] "Fully modified oligonucleotide" means each nucleobase, each
sugar, and/or each internucleoside linkage is modified.
[0158] "Uniformly modified oligonucleotide" means each nucleobase,
each sugar, and/or each internucleoside linkage has the same
modification throughout the modified oligonucleotide.
[0159] "Stabilizing modification" means a modification to a
nucleoside that provides enhanced stability to a modified
oligonucleotide, in the presence of nucleases, relative to that
provided by 2'-deoxynucleosides linked by phosphodiester
internucleoside linkages. For example, in certain embodiments, a
stabilizing modification is a stabilizing nucleoside modification.
In certain embodiments, a stabilizing modification is an
internucleoside linkage modification.
[0160] "Stabilizing nucleoside" means a nucleoside modified to
provide enhanced nuclease stability to an oligonucleotide, relative
to that provided by a 2'-deoxynucleoside. In one embodiment, a
stabilizing nucleoside is a 2'-modified nucleoside.
[0161] "Stabilizing internucleoside linkage" means an
internucleoside linkage that provides improved nuclease stability
to an oligonucleotide relative to that provided by a phosphodiester
internucleoside linkage. In one embodiment, a stabilizing
internucleoside linkage is a phosphorothioate internucleoside
linkage.
[0162] "Subject" means a human or non-human animal selected for
treatment or therapy.
[0163] "Subject in need thereof" means the state in which a subject
is identified as in need of a therapy or treatment.
[0164] "Subject suspected of having" means a subject exhibiting one
or more clinical indicators of a disease.
[0165] "Administering" means providing a pharmaceutical agent or
composition to a subject, and includes, but is not limited to,
administering by a medical professional and self-administering.
[0166] "Parenteral administration" means administration through
injection or infusion. Parenteral administration includes, but is
not limited to, subcutaneous administration, intravenous
administration, or intramuscular administration.
[0167] "Subcutaneous administration" means administration just
below the skin.
[0168] "Intravenous administration" means administration into a
vein.
[0169] "Intracardial administration" means administration into the
heart. In certain embodiments, intracardial administration occurs
by way of a catheter. In certain embodiments, intracardial
administration occurs by way of open heart surgery.
[0170] "Pulmonary administration" means administration to the
lungs.
[0171] "Administered concomitantly" refers to the co-administration
of two agents in any manner in which the pharmacological effects of
both are manifest in the patient at the same time. Concomitant
administration does not require that both agents be administered in
a single pharmaceutical composition, in the same dosage form, or by
the same route of administration. The effects of both agents need
not manifest themselves at the same time. The effects need only be
overlapping for a period of time and need not be coextensive.
[0172] "Duration" means the period of time during which an activity
or event continues. In certain embodiments, the duration of
treatment is the period of time during which doses of a
pharmaceutical agent or pharmaceutical composition are
administered.
[0173] "Therapy" means a disease treatment method. In certain
embodiments, therapy includes, but is not limited to, chemotherapy,
radiation therapy, or administration of a pharmaceutical agent.
[0174] "Treatment" means the application of one or more specific
procedures used for the cure or amelioration of a disease. In
certain embodiments, the specific procedure is the administration
of one or more pharmaceutical agents.
[0175] "Amelioration" means a lessening of severity of at least one
indicator of a condition or disease. In certain embodiments,
amelioration includes a delay or slowing in the progression of one
or more indicators of a condition or disease. The severity of
indicators may be determined by subjective or objective measures
which are known to those skilled in the art.
[0176] "At risk for developing" means the state in which a subject
is predisposed to developing a condition or disease. In certain
embodiments, a subject at risk for developing a condition or
disease exhibits one or more symptoms of the condition or disease,
but does not exhibit a sufficient number of symptoms to be
diagnosed with the condition or disease. In certain embodiments, a
subject at risk for developing a condition or disease exhibits one
or more symptoms of the condition or disease, but to a lesser
extent required to be diagnosed with the condition or disease.
[0177] "Prevent the onset of means to prevent the development of a
condition or disease in a subject who is at risk for developing the
disease or condition. In certain embodiments, a subject at risk for
developing the disease or condition receives treatment similar to
the treatment received by a subject who already has the disease or
condition.
[0178] "Delay the onset of means to delay the development of a
condition or disease in a subject who is at risk for developing the
disease or condition. In certain embodiments, a subject at risk for
developing the disease or condition receives treatment similar to
the treatment received by a subject who already has the disease or
condition.
[0179] "Therapeutic agent" means a pharmaceutical agent used for
the cure, amelioration or prevention of a disease.
[0180] "Dose" means a specified quantity of a pharmaceutical agent
provided in a single administration. In certain embodiments, a dose
may be administered in two or more boluses, tablets, or injections.
For example, in certain embodiments, where subcutaneous
administration is desired, the desired dose requires a volume not
easily accommodated by a single injection. In such embodiments, two
or more injections may be used to achieve the desired dose. In
certain embodiments, a dose may be administered in two or more
injections to minimize injection site reaction in an individual. In
certain embodiments, a dose is administered as a slow infusion.
[0181] "Dosage unit" means a form in which a pharmaceutical agent
is provided. In certain embodiments, a dosage unit is a vial
containing lyophilized oligonucleotide. In certain embodiments, a
dosage unit is a vial containing reconstituted oligonucleotide.
[0182] "Therapeutically effective amount" refers to an amount of a
pharmaceutical agent that provides a therapeutic benefit to an
animal.
[0183] "Pharmaceutical composition" means a mixture of substances
suitable for administering to an individual that includes a
pharmaceutical agent. For example, a pharmaceutical composition may
comprise a sterile aqueous solution.
[0184] "Pharmaceutical agent" means a substance that provides a
therapeutic effect when administered to a subject.
[0185] "Active pharmaceutical ingredient" means the substance in a
pharmaceutical composition that provides a desired effect.
[0186] "Improved organ function" means a change in organ function
toward normal limits. In certain embodiments, organ function is
assessed by measuring molecules found in a subject's blood. For
example, in certain embodiments, improved liver function is
measured by a reduction in blood liver transaminase levels.
[0187] "Acceptable safety profile" means a pattern of side effects
that is within clinically acceptable limits.
[0188] "Side effect" means a physiological response attributable to
a treatment other than desired effects. In certain embodiments,
side effects include, without limitation, injection site reactions,
liver function test abnormalities, renal function abnormalities,
liver toxicity, renal toxicity, central nervous system
abnormalities, and myopathies. Such side effects may be detected
directly or indirectly. For example, increased aminotransferase
levels in serum may indicate liver toxicity or liver function
abnormality. For example, increased bilirubin may indicate liver
toxicity or liver function abnormality.
[0189] "Injection site reaction" means inflammation or abnormal
redness of skin at a site of injection in an individual.
[0190] "Subject compliance" means adherence to a recommended or
prescribed therapy by a subject.
[0191] "Comply" means the adherence with a recommended therapy by a
subject.
[0192] "Recommended therapy" means a treatment recommended by a
medical professional to treat, ameliorate, delay, or prevent a
disease.
Overview
[0193] miR-21 is a ubiquitously expressed microRNA that is linked
to a variety of cellular processes, including cell differentiation,
proliferation, apoptosis and matrix turnover. Additionally, miR-21
is associated with multiple diseases. miR-21 is frequently
upregulated in cancer, and inhibition of miR-21 has demonstrated a
reduction in tumor growth in several animal models of cancer
Inhibition of miR-21 in an animal model of cardiac hypertrophy
demonstrated a role for miR-21 in heart disease. A role in fibrosis
has been demonstrated in animal models of cardiac fibrosis, kidney
fibrosis, and lung fibrosis. A study of the inhibition of miR-21 in
a tissue explants model illustrated that the inhibition of miR-21
promotes wound healing. As such, inhibitors of miR-21 are useful in
a variety of research and clinical settings.
[0194] To identify potent inhibitors of miR-21, a large number of
anti-miR-21 compounds were designed. The compounds varied in
length, and in the number, placement, and identity of bicyclic
nucleosides and non-bicyclic nucleosides. An initial series of
compounds was tested in an in vitro luciferase assay, which
identified a subset of compounds as active compounds vitro active
compounds. These in vitro active compounds were then tested in in
vivo assays to identify those compounds that are potent inhibitors
of miR-21 in vivo. From the initial in vitro and in vivo screens,
certain compounds were selected as the basis for the design of
additional compounds. The experimentally observed correlations
between structure and activity (both in vitro and in vivo) were
used to inform the design of these additional compounds, with
further variations in length and selection and arrangement of
bicyclic and non-bicyclic nucleosides. The in vitro and in vivo
screening assays were then repeated for these additional compounds.
Certain compounds were also tested for other properties, for
example, susceptibility to exonuclease activity. It was observed
that the most active in vitro compounds most active in vitro were
not necessarily the most active in vivo compounds those most active
in vivo, and further that some moderately active in vitro compounds
moderately active in vitro were highly active in vivo compounds. Of
178 compounds screened in vitro during this process, 60 were
identified as active in the luciferase assay. Of these 60 active in
vitro compounds, a subset was identified as active in vivo. Through
this iterative process of designing and screening compounds, it was
observed that compounds having particular patterns of bicyclic and
non-bicyclic modifications were potent inhibitors of miR-21 in
vivo. As such, these compounds are useful for the modulation of
cellular processes that are promoted by the activity of miR-21.
Further, such compounds are useful for treating, preventing, and/or
delaying the onset of diseases associated with miR-21. Such
diseases may be characterized by abnormally high expression of
miR-21, relative to non-disease samples. Such diseases include, but
are not limited to, fibrosis, acute kidney injury, cardiac
hypertrophy, myocardial infarction, and cancer. Additionally, the
compositions and methods provided herein may be used to promote
wound healing.
Certain Modified Oligonucleotides Targeted to miR-21
[0195] Provided herein are modified oligonucleotides having certain
patterns of bicyclic and non-bicyclic nucleosides. Modified
oligonucleotides having the patterns identified herein are
effective inhibitors of miR-21 activity.
[0196] Each of the nucleoside patterns illustrated herein is shown
in the 5' to 3' orientation.
[0197] In certain embodiments, provided herein are compounds
comprising a modified oligonucleotide consisting of 8 to 22 linked
nucleosides, wherein the nucleobase sequence of the modified
oligonucleotide is complementary to miR-21 (SEQ ID NO: 1) and
wherein the modified oligonucleotide comprises at least 8
contiguous nucleosides of the following nucleoside pattern I in the
5' to 3' orientation:
(R).sub.X-N.sup.B-N.sup.Q-N.sup.Q-N.sup.B-(N.sup.Q-N.sup.Q-N.sup.Q-N.sup-
.B).sub.3-N.sup.Q-N.sup.Z
[0198] wherein each R is a non-bicyclic nucleoside; X is from 1 to
4;
[0199] each N.sup.B is a bicyclic nucleoside;
[0200] each N.sup.Q is a non-bicyclic nucleoside; and
[0201] each N.sup.Z is a modified nucleoside.
[0202] In certain embodiments of nucleoside pattern I, X is 1. In
certain embodiments of nucleoside pattern I, X is 2. In certain
embodiments of nucleoside pattern I, X is 3. In certain embodiments
of nucleoside pattern I, X is 4.
[0203] In certain embodiments, provided herein are compounds
comprising a modified oligonucleotide consisting of 8 to 19 linked
nucleosides, wherein the nucleobase sequence of the modified
oligonucleotide is complementary to miR-21 (SEQ ID NO: 1) and
wherein the modified oligonucleotide comprises at least 8
contiguous nucleosides of the following nucleoside pattern II in
the 5' to 3' orientation:
N.sup.M-N.sup.B-N.sup.Q-N.sup.Q-N.sup.B-(N.sup.Q-N.sup.Q-N.sup.Q-N.sup.B-
).sub.3-N.sup.Q-N.sup.Z
[0204] wherein N.sup.M is a modified nucleoside that is not a
bicyclic nucleoside;
[0205] each N.sup.B is a bicyclic nucleoside;
[0206] each N.sup.Q is a non-bicyclic nucleoside; and
[0207] N.sup.Z is a modified nucleoside.
[0208] In certain embodiments, provided herein are compounds
comprising a modified oligonucleotide consisting of 8 to 22 linked
nucleosides, wherein the nucleobase sequence of the modified
oligonucleotide is complementary to miR-21 (SEQ ID NO: 1) and
wherein the modified oligonucleotide comprises at least 8
contiguous nucleosides of the following nucleoside pattern III in
the 5' to 3' orientation:
(R).sub.X-N.sup.B-N.sup.Q-N.sup.Q-N.sup.B-(N.sup.Q-N.sup.Q-N.sup.Q-N.sup-
.B).sub.3-N.sup.Y-N.sup.Z
[0209] wherein each R is a non-bicyclic nucleoside; X is from 1 to
4;
[0210] each N.sup.B is a bicyclic nucleoside;
[0211] each N.sup.Q is a non-bicyclic nucleoside;
[0212] N.sup.Y is a modified nucleoside or an unmodified
nucleoside; and
[0213] each N.sup.Z is a modified nucleoside.
[0214] In certain embodiments of nucleoside pattern III, X is 1. In
certain embodiments of nucleoside pattern I, X is 2. In certain
embodiments of nucleoside pattern III, X is 3. In certain
embodiments of nucleoside pattern III, X is 4.
[0215] In certain embodiments, provided herein are compounds
comprising a modified oligonucleotide consisting of 8 to 19 linked
nucleosides, wherein the nucleobase sequence of the modified
oligonucleotide is complementary to miR-21 (SEQ ID NO: 1) and
wherein the modified oligonucleotide comprises at least 8
contiguous nucleosides of the following nucleoside pattern IV in
the 5' to 3' orientation:
N.sup.M-N.sup.B-N.sup.Q-N.sup.Q-N.sup.B-(N.sup.Q-N.sup.Q-N.sup.Q-N.sup.B-
).sub.3-N.sup.Y-N.sup.Z
[0216] wherein N.sup.M is a modified nucleoside that is not a
bicyclic nucleoside;
[0217] each N.sup.B is a bicyclic nucleoside;
[0218] each N.sup.Q is a non-bicyclic nucleoside;
[0219] N.sup.Y is a modified nucleoside or an unmodified
nucleoside; and
[0220] N.sup.Z is a modified nucleoside.
[0221] In certain embodiments, provided herein are compounds
comprising a modified oligonucleotide consisting of 8 to 19 linked
nucleosides, wherein the nucleobase sequence of the modified
oligonucleotide is complementary to miR-21 (SEQ ID NO: 1) and
wherein the modified oligonucleotide comprises at least 8
contiguous nucleosides of the following nucleoside pattern V in the
5' to 3' orientation:
N.sup.M-N.sup.B-(N.sup.Q-N.sup.Q-N.sup.B-N.sup.B).sub.4-N.sup.Z
[0222] wherein N.sup.M is a modified nucleoside that is not a
bicyclic nucleoside;
[0223] each N.sup.B is a bicyclic nucleoside;
[0224] each N.sup.Q is a non-bicyclic nucleoside; and
[0225] N.sup.Z is a modified nucleoside.
[0226] The following embodiments apply to any of the nucleoside
patterns described herein, including nucleoside patterns Ito V.
[0227] In certain embodiments, the modified oligonucleotide
comprises at least 9, at least 10, at least 11, at least 12, at
least 13, at least 14, at least 15, at least 16, at least 17, at
least 18, at least 19, at least 20, at least 21, or 22 contiguous
nucleosides of a nucleoside pattern described herein.
[0228] In certain embodiments of any of the nucleoside patterns
described herein, the nucleobase sequence of the modified
oligonucleotide is at least 90% complementary to miR-21 (SEQ ID NO:
1). In certain embodiments, the nucleobase sequence of the modified
oligonucleotide is at least 95% complementary to (SEQ ID NO: 1). In
certain embodiments, the nucleobase sequence of the modified
oligonucleotide is 100% complementary to (SEQ ID NO: 1).
[0229] In certain embodiments of any of the nucleoside patterns
described herein the nucleobase sequence of the modified
oligonucleotide is complementary to miR-21 such that position 1 of
the microRNA is paired with the 3'-terminal nucleobase of the
oligonucleotide. For example:
##STR00001##
It is to be understood that, in SEQ ID NO: 3 and SEQ ID NO: 4, each
"T" in the sequence may independently be either a "T" nucleobase or
a "U" nucleobase, and that a compound having the sequence of SEQ ID
NO: 3 or SEQ ID NO: 4 may comprise all T's, all U's, or any
combination of U's and T's. Thus, the presence of "T" at various
positions in SEQ ID NO: 3 and SEQ ID NO: 4 throughout the present
disclosure and in the accompanying sequence listing is not limiting
with respect to whether that particular nucleobase is a "T" or a
"U."
[0230] In certain embodiments of any of the nucleoside patterns
described herein, each bicyclic nucleoside is independently
selected from an LNA nucleoside, a cEt nucleoside, and an ENA
nucleoside. In certain embodiments, the sugar moieties of at least
two bicyclic nucleosides are different from one another. In certain
embodiments, all bicyclic nucleosides have the same sugar moieties
as one another. In certain embodiments, each bicyclic nucleoside is
a cEt nucleoside. In certain embodiments, each bicyclic nucleoside
is an LNA nucleoside.
[0231] In certain embodiments of any of the nucleoside patterns
described herein, a cEt nucleoside is an S-cEt nucleoside. In
certain embodiments of any of the nucleoside patterns described
herein, a cEt nucleoside is an R-cEt nucleoside.
[0232] In certain embodiments of any of the nucleoside patterns
described herein, each non-bicyclic nucleoside is independently
selected from a .beta.-D-deoxyribonucleoside, a
.beta.-D-ribonucleoside, a 2'-O-methyl nucleoside, a
2'-O-methoxyethyl nucleoside, and a 2'-fluoronucleoside.
[0233] In certain embodiments of any of the nucleoside patterns
described herein, each non-bicyclic nucleoside is independently
selected from a .beta.-D-deoxyribonucleoside, and a
2'-O-methoxyethyl nucleoside.
[0234] In certain embodiments of any of the nucleoside patterns
described herein, at least two non-bicyclic nucleosides comprise
sugar moieties that are different from one another and are
independently selected from a .beta.-D-deoxyribonucleoside, a
.beta.-D-ribonucleoside, a 2'-O-methyl nucleoside, a
2'-O-methoxyethyl nucleoside, and a 2'-fluoronucleoside.
[0235] In certain embodiments of any of the nucleoside patterns
described herein, at least two non-bicyclic nucleosides comprise
sugar moieties that are different from one another and are
independently selected from a .beta.-D-deoxyribonucleoside and a
2'-O-methoxyethyl nucleoside.
[0236] In certain embodiments of any of the nucleoside patterns
described herein, each non-bicyclic nucleoside has the same type of
sugar moiety and is selected from a .beta.-D-deoxyribonucleoside, a
.beta.-D-ribonucleoside, a 2'-O-methyl nucleoside, a
2'-O-methoxyethyl nucleoside, and a 2'-fluoronucleoside.
[0237] In certain embodiments of any of the nucleoside patterns
described herein, each non-bicyclic nucleoside is a
.beta.-D-deoxyribonucleoside. In certain embodiments, each
non-bicyclic nucleoside is a 2'-O-methyl nucleoside.
[0238] In certain embodiments of any of the nucleoside patterns
described herein, no more than 3 of the non-bicyclic nucleosides
are 2'-O-methoxyethyl nucleosides. In certain embodiments, no more
than 2 of the non-bicyclic nucleosides are 2'-O-methoxyethyl
nucleosides. In certain embodiments, no more than 1 of the
non-bicyclic nucleosides is a 2'-O-methoxyethyl nucleoside.
[0239] In certain embodiments of any of the nucleoside patterns
described herein, one non-bicyclic nucleoside is a 2'-MOE
nucleoside and each other non-bicyclic nucleosides is a
.beta.-D-deoxyribonucleoside. In certain embodiments, two
non-bicyclic nucleosides are 2'-O-methoxyethyl nucleosides and each
other non-bicyclic nucleoside is a .beta.-D-deoxyribonucleoside. In
certain embodiments, three non-bicyclic nucleosides are
2'-O-methoxyethyl nucleosides and each other non-bicyclic
nucleoside is a .beta.-D-deoxyribonucleoside.
[0240] In certain embodiments of any of the nucleoside patterns
described herein, the 5'-most non-bicyclic nucleoside and the
3'-most non-bicyclic nucleoside are 2'-O-methoxyethyl nucleosides,
and each other non-bicyclic nucleoside is a
.beta.-D-deoxyribonucleoside.
[0241] In certain embodiments of any nucleoside pattern I, where X
is 4, each nucleoside of R is a 2'-O-methoxyethyl nucleoside. In
certain embodiments of nucleoside pattern I, where X is 4, two
nucleosides of R are .beta.-D-deoxyribonucleosides and two
nucleosides of R are 2'-O-methoxyethyl nucleosides. In certain
embodiments of nucleoside pattern I, where X is 4, three
nucleosides of R are .beta.-D-deoxyribonucleosides and one
nucleoside of R is a 2'-O-methoxyethyl nucleoside.
[0242] In certain embodiments of nucleoside pattern I, R is
N.sup.R1-N.sup.R2-N.sup.R3-N.sup.R4 where N.sup.R1 is a 2'-MOE
nucleoside, N.sup.R2 is a .beta.-D-deoxyribonucleoside, N.sup.R3 is
a .beta.-D-deoxyribonucleoside, and N.sup.R4 is a
.beta.-D-deoxyribonucleoside.
[0243] In certain embodiments of nucleoside pattern I, R consists
of four linked nucleosides N.sup.R1-N.sup.R2-N.sup.R3-N.sup.R4,
wherein N.sup.R1 is a 2'-O-methoxyethyl nucleoside and each of
N.sup.R2-N.sup.R3-N.sup.R4 is a .beta.-D-deoxyribonucleoside; each
N.sup.B is an S-cEt nucleoside; each N.sup.Q is a
.beta.-D-deoxyribonucleoside; and N.sup.Z is a 2'-O-methoxyethyl
nucleoside. In certain embodiments, the modified oligonucleotide
has the nucleobase sequence of SEQ ID NO: 4, wherein each T in the
sequence is independently selected from T and U.
[0244] In certain embodiments of nucleoside pattern I, X is 1 and
each nucleoside of R is a 2'-O-methoxyethyl nucleoside; each
N.sup.B is an S-cEt nucleoside; each N.sup.Q is a 2'-O-methoxyethyl
nucleoside; and N.sup.Z is a 2'-O-methoxyethyl nucleoside. In
certain embodiments, the modified oligonucleotide has the
nucleobase sequence of SEQ ID NO: 3, wherein each T in the sequence
is independently selected from T and U.
[0245] In certain embodiments of nucleoside pattern I, X is 4 and
each nucleoside of R is a 2'-O-methoxyethyl nucleoside; each
N.sup.B is an S-cEt nucleoside; each N.sup.Q is a 2'-O-methoxyethyl
nucleoside; and N.sup.Z is a 2'-O-methoxyethyl nucleoside. In
certain embodiments, the modified oligonucleotide has the
nucleobase sequence of SEQ ID NO: 4, wherein each T in the sequence
is independently selected from T and U.
[0246] In certain embodiments of nucleoside pattern II, N.sup.M is
a 2'-O-methoxyethyl nucleoside; each N.sup.B is an S-cEt
nucleoside; each N.sup.Q is a .beta.-D-deoxyribonucleoside; and
N.sup.Z is a 2'-O-methoxyethyl nucleoside. In certain embodiments,
the modified oligonucleotide has the nucleobase sequence of SEQ ID
NO: 3, wherein each T in the sequence is independently selected
from T and U.
[0247] In certain embodiments of nucleoside pattern II, N.sup.M is
a 2'-O-methoxyethyl nucleoside; each N.sup.B is an S-cEt
nucleoside; each N.sup.Q is a .beta.-D-deoxyribonucleoside; and
N.sup.Z is an S-cEt nucleoside. In certain embodiments, the
modified oligonucleotide has the nucleobase sequence of SEQ ID NO:
3, wherein each T in the sequence is independently selected from T
and U.
[0248] In certain embodiments of nucleoside pattern II, N.sup.M is
a 2'-O-methoxyethyl nucleoside; each N.sup.B is an LNA nucleoside;
each N.sup.Q is a .beta.-D-deoxyribonucleoside; and N.sup.Z is a
2'-O-methoxyethyl nucleoside. In certain embodiments, the modified
oligonucleotide has the nucleobase sequence of SEQ ID NO: 3,
wherein each T in the sequence is independently selected from T and
U.
[0249] In certain embodiments of nucleoside pattern II, N.sup.M is
a 2'-O-methoxyethyl nucleoside; each N.sup.B is an LNA nucleoside;
each N.sup.Q is a .beta.-D-deoxyribonucleoside; and N.sup.Z is an
LNA nucleoside. In certain embodiments, the modified
oligonucleotide has the nucleobase sequence of SEQ ID NO: 3,
wherein each T in the sequence is independently selected from T and
U.
[0250] In certain embodiments of nucleoside pattern III, R is a
modified nucleoside that is not a bicyclic nucleoside; and x is 1.
In certain embodiments of nucleoside pattern III, R is a modified
nucleoside that is not a bicyclic nucleoside; x is 1; and each
N.sup.Q is an unmodified nucleoside. In certain embodiments of
nucleoside pattern III, R is a modified nucleoside that is not a
bicyclic nucleoside; x is 1; each N.sup.Q is an unmodified
nucleoside; each N.sup.B is independently selected from an S-cEt
nucleoside and an LNA nucleoside; and N.sup.Y is selected from a
.beta.-D-deoxyribonucleoside, a 2'-O-methoxyethyl nucleoside, an
S-cEt nucleoside, and an LNA nucleoside. In certain embodiments of
nucleoside pattern III, R is a modified nucleoside that is not a
bicyclic nucleoside; x is 1; and each N.sup.Q is a
.beta.-D-deoxyribonucleoside. In certain embodiments of nucleoside
pattern III, R is a modified nucleoside that is not a bicyclic
nucleoside; x is 1; each N.sup.Q is a .beta.-D-deoxyribonucleoside;
each N.sup.B is independently selected from an S-cEt nucleoside and
an LNA nucleoside; and N.sup.Y is selected from a
.beta.-D-deoxyribonucleoside, a 2'-O-methoxyethyl nucleoside, an
S-cEt nucleoside, and an LNA nucleoside. In certain embodiments of
nucleoside pattern III, R is a modified nucleoside that is not a
bicyclic nucleoside; x is 1; each N.sup.Q is an unmodified
nucleoside; each N.sup.B is an S-cEt nucleoside; and N.sup.Y is
selected from a.beta.-D-deoxyribonucleoside, a 2'-O-methoxyethyl
nucleoside, and an S-cEt nucleoside. In certain embodiments of
nucleoside pattern III, R is a modified nucleoside that is not a
bicyclic nucleoside; x is 1; each N.sup.Q is a
.beta.-D-deoxyribonucleoside; each N.sup.B is an S-cEt nucleoside;
and N.sup.Y is selected from a .beta.-D-deoxyribonucleoside, a
2'-O-methoxyethyl nucleoside, and an S-cEt nucleoside. In certain
embodiments, the modified oligonucleotide of pattern III has the
nucleobase sequence of SEQ ID NO: 3, wherein each T in the sequence
is independently selected from T and U.
[0251] In certain embodiments of nucleoside pattern IV, N.sup.M is
a 2'-O-methoxyethyl nucleoside; each N.sup.B is selected from an
S-cEt nucleoside and an LNA nucleoside; each N.sup.Q is selected
from a .beta.-D-deoxyribonucleoside and a 2'-O-methoxyethyl
nucleoside; N.sup.Y is selected from a 2'-O-methoxyethyl
nucleoside, an S-cEt nucleoside, an LNA nucleoside, and a
.beta.-D-deoxyribonucleoside; and N.sup.Z is selected from a
2'-O-methoxyethyl nucleoside, an LNA nucleoside, and an S-cEt
nucleoside. In certain embodiments, the modified oligonucleotide of
pattern IV has the nucleobase sequence of SEQ ID NO: 3, wherein
each T in the sequence is independently selected from T and U.
[0252] In certain embodiments of nucleoside pattern IV, N.sup.M is
a 2'-O-methoxyethyl nucleoside; each N.sup.B is an S-cEt
nucleoside; each N.sup.Q is selected from a
.beta.-D-deoxyribonucleoside and a 2'-O-methoxyethyl nucleoside;
N.sup.Y is selected from a 2'-O-methoxyethyl nucleoside, an S-cEt
nucleoside, and a .beta.-D-deoxyribonucleoside; and N.sup.Z is
selected from a 2'-O-methoxyethyl nucleoside and an S-cEt
nucleoside. In certain embodiments, the modified oligonucleotide of
pattern IV has the nucleobase sequence of SEQ ID NO: 3, wherein
each T in the sequence is independently selected from T and U.
[0253] In certain embodiments of nucleoside pattern IV, N.sup.M is
a 2'-O-methoxyethyl nucleoside; each N.sup.B is an S-cEt
nucleoside; each N.sup.Q is a .beta.-D-deoxyribonucleoside; N.sup.Y
is an S-cEt nucleoside; and N.sup.Z is an S-cEt nucleoside. In
certain embodiments, the modified oligonucleotide of pattern IV has
the nucleobase sequence of SEQ ID NO: 3, wherein each T in the
sequence is independently selected from T and U.
[0254] In certain embodiments of nucleoside pattern V, N.sup.M is a
2'-O-methoxyethyl nucleoside; each N.sup.B is selected from an
S-cEt nucleoside and an LNA nucleoside; each N.sup.Q is selected
from a .beta.-D-deoxyribonucleoside and a 2'-O-methoxyethyl
nucleoside; and N.sup.Z is selected from a 2'-O-methoxyethyl
nucleoside, an LNA nucleoside, and an S-cEt nucleoside. In certain
embodiments, the modified oligonucleotide of pattern V has the
nucleobase sequence of SEQ ID NO: 3, wherein each Tin the sequence
is independently selected from T and U.
[0255] In certain embodiments of nucleoside pattern V, N.sup.M is a
2'-O-methoxyethyl nucleoside; each N.sup.B is an S-cEt nucleoside;
each N.sup.Q is a .beta.-D-deoxyribonucleoside; and N.sup.Z is
selected from a 2'-O-methoxyethyl nucleoside and an S-cEt
nucleoside. In certain embodiments, the modified oligonucleotide of
pattern V has the nucleobase sequence of SEQ ID NO: 3, wherein each
Tin the sequence is independently selected from T and U.
[0256] In certain embodiments of nucleoside pattern V, N.sup.M is a
2'-O-methoxyethyl nucleoside; each N.sup.B is an S-cEt nucleoside;
each N.sup.Q is a .beta.-D-deoxyribonucleoside; and N.sup.Z is a
2'-O-methoxyethyl nucleoside. In certain embodiments, the modified
oligonucleotide of pattern V has the nucleobase sequence of SEQ ID
NO: 3, wherein each T in the sequence is independently selected
from T and U.
[0257] In certain embodiments, a compound provided herein has a
nucleobase sequence and modifications as shown in Table 1.
Nucleoside modifications are indicated as follows: nucleosides not
followed by a subscript indicate .beta.-D-deoxyribonucleosides;
nucleosides followed by a subscript "E" indicate 2'-MOE
nucleosides; nucleosides followed by a subscript "L" are LNA
nucleosides; nucleosides followed by a subscript "S" indicate S-cEt
nucleosides. Each internucleoside linkage is a phosphorothioate
internucleoside linkage. Superscript "Me" indicates a 5-methyl
group on the base of the nucleoside.
TABLE-US-00001 TABLE 1 Anti-miR-21 compounds Com- SEQ pound ID #
Sequence and Chemistry (5' to 3') NO 25068
T.sub.E.sup.MeC.sub.EA.sub.EA.sub.EC.sub.SA.sub.ET.sub.EC.sub.SA.sub-
.EG.sub.ET.sub.EC.sub.ST.sub.EG.sub.EA.sub.EU.sub.SA.sub.EA.sub.EG.sub.EC.-
sub.ST.sub.EA.sub.E 4 25070
A.sub.EC.sub.SATC.sub.SAGTC.sub.STGAU.sub.SAAGC.sub.STA.sub.E 3
25072
A.sub.EC.sub.SA.sub.ET.sub.EC.sub.SA.sub.EG.sub.ET.sub.EC.sub.ST.sub-
.EG.sub.EA.sub.EU.sub.SA.sub.EA.sub.EG.sub.EC.sub.ST.sub.EA.sub.E 3
25082
T.sub.E.sup.MeCAAC.sub.SATC.sub.SAGTC.sub.STGAU.sub.SAAGC.sub.STA.su-
b.E 4 25922
A.sub.E.sup.MeC.sub.SAT.sup.MeC.sub.SAGT.sup.MeC.sub.STGAT.sub.SAAG.-
sup.MeC.sub.STA.sub.E 3 25923
A.sub.EC.sub.SATC.sub.SAGTC.sub.STGAU.sub.SAAGC.sub.STA.sub.S 3
25924
A.sub.E.sup.MeC.sub.SAT.sup.MeC.sub.SAGT.sup.MeC.sub.STGAT.sub.SAAG.-
sup.MeC.sub.STA.sub.S 3 25114
A.sub.E.sup.MeC.sub.LAT.sup.MeC.sub.LAGT.sup.MeC.sub.LTGAT.sub.LAAG.-
sup.MeC.sub.LTA.sub.E 3 25115
A.sub.E.sup.MeC.sub.LAT.sup.MeC.sub.LAGT.sup.MeC.sub.LTGAT.sub.LAAG.-
sup.MeC.sub.LTA.sub.L 3 25221
A.sub.EC.sub.SATC.sub.SAGTC.sub.STGAU.sub.SAAGC.sub.SUsA.sub.S 3
25220
A.sub.EC.sub.SATC.sub.SA.sub.SGTC.sub.SU.sub.SGAU.sub.SA.sub.SAGC.su-
b.SUsA.sub.E 3
[0258] In certain embodiments of any of the nucleoside patterns
described herein, a modified oligonucleotide consists of 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 linked
nucleosides. In certain embodiments, the modified oligonucleotide
comprises at least 8 linked nucleosides of a nucleoside pattern set
forth in nucleoside pattern I. In certain embodiments, the modified
oligonucleotide comprises at least 8 linked nucleosides of a
nucleoside pattern set forth in nucleoside pattern II. In certain
embodiments, the modified oligonucleotide comprises at least 8
linked nucleosides of a nucleoside pattern set forth in nucleoside
pattern III. In certain embodiments, the modified oligonucleotide
comprises at least 8 linked nucleosides of a nucleoside pattern set
forth in nucleoside pattern IV. In certain embodiments, the
modified oligonucleotide comprises at least 8 linked nucleosides of
a nucleoside pattern set forth in nucleoside pattern V.
[0259] In certain embodiments, a modified oligonucleotide having
any of the nucleoside patterns described herein comprises at least
one modified internucleoside linkage. In certain embodiments, each
internucleoside linkage is a modified internucleoside linkage. In
certain embodiments, the modified internucleoside linkage is a
phosphorothioate internucleoside linkage.
[0260] In certain embodiments, a modified oligonucleotide has a
nucleobase sequence wherein at least one nucleobase is a cytosine.
In certain embodiments, at least one cytosine is a 5-methyl
cytosine. In certain embodiments, each cytosine is a 5-methyl
cytosine. In certain embodiments, at least one nucleoside comprises
a modified nucleobase.
[0261] Modified oligonucleotides may undergo cleavage by
exonucleases and/or endonucleases at various positions throughout
the modified oligonucleotide. The products of such enzymatic
cleavage may retain miR-21 inhibitory activity, and as such are
considered active metabolites. As such, a metabolic product of a
modified oligonucleotide may be used in the methods described
herein.
[0262] In certain embodiments, a modified oligonucleotide targeted
to miR-21 has a nucleoside pattern selected from Table 2A, where
N.sup.M is a modified nucleoside that is not a bicyclic nucleoside;
each N.sup.B is a bicyclic nucleoside; each N.sup.Q is a
non-bicyclic nucleoside; and N.sup.Z is a modified nucleoside.
TABLE-US-00002 TABLE 2A Metabolic Products of Nucleoside Pattern II
5' 3' N.sup.M N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Z N.sup.B N.sup.Q N.sup.Q N.sup.B
N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B
N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Z N.sup.Q N.sup.Q
N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q
N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Z N.sup.Q
N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q
N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Z N.sup.B
N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B
N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Z N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Z N.sup.Q N.sup.Q N.sup.B N.sup.Q
N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q
N.sup.Z N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q
N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Z N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Z
N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B
N.sup.Q N.sup.Z N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q
N.sup.B N.sup.Q N.sup.Z N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q
N.sup.B N.sup.Q N.sup.Z N.sup.M N.sup.B N.sup.Q N.sup.Q N.sup.B
N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B
N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.M N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.B
N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q
N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.B
N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B
N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.Q
N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q
N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B
N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q
N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.B
N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B
N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q
N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B
N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q
[0263] In certain embodiments, a modified oligonucleotide targeted
to miR-21 has a nucleoside pattern selected from Table 2B, where
N.sup.M is a modified nucleoside that is not a bicyclic nucleoside;
each N.sup.B is a bicyclic nucleoside; each N.sup.Q is a
non-bicyclic nucleoside; N.sup.Y is a modified nucleoside or an
unmodified nucleoside; and N.sup.Z is a modified nucleoside.
TABLE-US-00003 TABLE 2B Metabolic Products of Nucleoside Patten IV
5' 3' N.sup.M N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Y N.sup.Z N.sup.B N.sup.Q N.sup.Q N.sup.B
N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B
N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Y N.sup.Z N.sup.Q N.sup.Q
N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q
N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Y N.sup.Z N.sup.Q
N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q
N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Y N.sup.Z N.sup.B
N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B
N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Y N.sup.Z N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Y N.sup.Z N.sup.Q N.sup.Q N.sup.B N.sup.Q
N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Y
N.sup.Z N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q
N.sup.Q N.sup.Q N.sup.B N.sup.Y N.sup.Z N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Y N.sup.Z
N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B
N.sup.Y N.sup.Z N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q
N.sup.B N.sup.Y N.sup.Z N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q
N.sup.B N.sup.Y N.sup.Z N.sup.M N.sup.B N.sup.Q N.sup.Q N.sup.B
N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B
N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Y N.sup.M N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Y N.sup.B
N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q
N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Y N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.B
N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B
N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Y N.sup.Q N.sup.B N.sup.Q
N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q
N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B
N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B
N.sup.Y N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Y N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q
N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Y N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.B
N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B
N.sup.Y N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q
N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B
N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Y N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Y N.sup.Q
N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.Q N.sup.Q N.sup.Q N.sup.B N.sup.Y
[0264] In certain embodiments, a modified oligonucleotide targeted
to miR-21 has a nucleoside pattern selected from Table 2C, where
N.sup.M is a modified nucleoside that is not a bicyclic nucleoside;
each N.sup.B is a bicyclic nucleoside; each N.sup.Q is a
non-bicyclic nucleoside; and N.sup.Z is a modified nucleoside.
TABLE-US-00004 TABLE 2C Metabolic Products of Nucleoside Patten VII
5' 3' N.sup.M N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.B N.sup.Z N.sup.B N.sup.Q N.sup.Q N.sup.B
N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B
N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Z N.sup.Q N.sup.Q
N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q
N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Z N.sup.Q
N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q
N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Z N.sup.B
N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B
N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Z N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.B N.sup.Z N.sup.Q N.sup.Q N.sup.B N.sup.B
N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B
N.sup.Z N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B
N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Z N.sup.B N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Z
N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B
N.sup.B N.sup.Z N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q
N.sup.B N.sup.B N.sup.Z N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q
N.sup.B N.sup.B N.sup.Z N.sup.M N.sup.B N.sup.Q N.sup.Q N.sup.B
N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B
N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.M N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.Y N.sup.B
N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B
N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.B
N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B
N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.B N.sup.B
N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B
N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B
N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B
N.sup.B N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B
N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.Q N.sup.B
N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B
N.sup.B N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B
N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B
N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.B N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q
N.sup.Q N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.Q
N.sup.Q N.sup.B N.sup.B N.sup.Q N.sup.Q N.sup.B N.sup.B
[0265] In certain embodiments, a modified oligonucleotide targeted
to miR-21 has a nucleoside pattern and nucleobase sequence selected
from Table 3A. Nucleosides not followed by a subscript indicate
.beta.-D-deoxyribonucleosides. Nucleosides followed by a subscript
"E" indicate 2'-MOE nucleosides. Nucleosides followed by a
subscript "S" indicate S-cEt nucleosides. Each internucleoside
linkage is a phosphorothioate internucleoside linkage. Nucleobases
may or may not comprise a methyl group at the 5' position.
TABLE-US-00005 TABLE 3A Metabolic products of compound # 25070 5'
3' N.sub.1 N.sub.2 N.sub.3 N.sub.4 N.sub.5 N.sub.6 N.sub.7 N.sub.8
N.sub.9 N.sub.10 N.sub.11 N.sub.12 N.sub.13 N.sub.14 N.sub.15
N.sub.16 N.sub.17 N.sub.18 N.sub.19 A.sub.E C.sub.S A T C.sub.S A G
T C.sub.S T G A U.sub.S A A G C.sub.S T A.sub.E C.sub.S A T C.sub.S
A G T C.sub.S T G A U.sub.S A A G C.sub.S T A.sub.E A T C.sub.S A G
T C.sub.S T G A U.sub.S A A G C.sub.S T A.sub.E T C.sub.S A G T
C.sub.S T G A U.sub.S A A G C.sub.S T A.sub.E C.sub.S A G T C.sub.S
T G A U.sub.S A A G C.sub.S T A.sub.E A G T C.sub.S T G A U.sub.S A
A G C.sub.S T A.sub.E G T C.sub.S T G A U.sub.S A A G C.sub.S T
A.sub.E T C.sub.S T G A U.sub.S A A G C.sub.S T A.sub.E C.sub.S T G
A U.sub.S A A G C.sub.S T A.sub.E T G A U.sub.S A A G C.sub.S T
A.sub.E G A U.sub.S A A G C.sub.S T A.sub.E A U.sub.S A A G C.sub.S
T A.sub.E A.sub.E C.sub.S A T C.sub.S A G T C.sub.S T G A U.sub.S A
A G C.sub.S T A.sub.E C.sub.S A T C.sub.S A G T C.sub.S T G A
U.sub.S A A G C.sub.S C.sub.S A T C.sub.S A G T C.sub.S T G A
U.sub.S A A G C.sub.S T C.sub.S A T C.sub.S A G T C.sub.S T G A
U.sub.S A A G C.sub.S A T C.sub.S A G T C.sub.S T G A U.sub.S A A G
C.sub.S T A T C.sub.S A G T C.sub.S T G A U.sub.S A A G C.sub.S T
C.sub.S A G T C.sub.S T G A U.sub.S A A G C.sub.S T T C.sub.S A G T
C.sub.S T G A U.sub.S A A G C.sub.S C.sub.S A G T C.sub.S T G A
U.sub.S A A G C.sub.S T C.sub.S A G T C.sub.S T G A U.sub.S A A G
C.sub.S A G T C.sub.S T G A U.sub.S A A G C.sub.S T A G T C.sub.S T
G A U.sub.S A A G C.sub.S G T C.sub.S T G A U.sub.S A A G C.sub.S T
G T C.sub.S T G A U.sub.S A A G C.sub.S T C.sub.S T G A U.sub.S A A
G C.sub.S T T C.sub.S T G A U.sub.S A A G C.sub.S C.sub.S T G A
U.sub.S A A G C.sub.S T C.sub.S T G A U.sub.S A A G C.sub.S T G A
U.sub.S A A G C.sub.S T T G A U.sub.S A A G C.sub.S G A U.sub.S A A
G C.sub.S T
[0266] In certain embodiments, a modified oligonucleotide targeted
to miR-21 has a nucleoside pattern and nucleobase sequence selected
from Table 3B. Nucleosides not followed by a subscript indicate
.beta.-D-deoxyribonucleosides. Nucleosides followed by a subscript
"E" indicate 2'-MOE nucleosides. Nucleosides followed by a
subscript "S" indicate S-cEt nucleosides. Each internucleoside
linkage is a phosphorothioate internucleoside linkage. Nucleobases
may or may not comprise a methyl group at the 5' position.
TABLE-US-00006 TABLE 3B Metabolic products of compound # 25923 5'
3' N.sub.1 N.sub.2 N.sub.3 N.sub.4 N.sub.5 N.sub.6 N.sub.7 N.sub.8
N.sub.9 N.sub.10 N.sub.11 N.sub.12 N.sub.13 N.sub.14 N.sub.15
N.sub.16 N.sub.17 N.sub.18 N.sub.19 A.sub.E C.sub.S A T C.sub.S A G
T C.sub.S T G A U.sub.S A A G C.sub.S T A.sub.S C.sub.S A T C.sub.S
A G T C.sub.S T G A U.sub.S A A G C.sub.S T A.sub.S A T C.sub.S A G
T C.sub.S T G A U.sub.S A A G C.sub.S T A.sub.S T C.sub.S A G T
C.sub.S T G A U.sub.S A A G C.sub.S T A.sub.S C.sub.S A G T C.sub.S
T G A U.sub.S A A G C.sub.S T A.sub.S A G T C.sub.S T G A U.sub.S A
A G C.sub.S T A.sub.S G T C.sub.S T G A U.sub.S A A G C.sub.S T
A.sub.S T C.sub.S T G A U.sub.S A A G C.sub.S T A.sub.S C.sub.S T G
A U.sub.S A A G C.sub.S T A.sub.S T G A U.sub.S A A G C.sub.S T
A.sub.S G A U.sub.S A A G C.sub.S T A.sub.S A U.sub.S A A G C.sub.S
T A.sub.S A.sub.E C.sub.S A T C.sub.S A G T C.sub.S T G A U.sub.S A
A G C.sub.S T A.sub.E C.sub.S A T C.sub.S A G T C.sub.S T G A
U.sub.S A A G C.sub.S C.sub.S A T C.sub.S A G T C.sub.S T G A
U.sub.S A A G C.sub.S T C.sub.S A T C.sub.S A G T C.sub.S T G A
U.sub.S A A G C.sub.S A T C.sub.S A G T C.sub.S T G A U.sub.S A A G
C.sub.S T A T C.sub.S A G T C.sub.S T G A U.sub.S A A G C.sub.S T
C.sub.S A G T C.sub.S T G A U.sub.S A A G C.sub.S T T C.sub.S A G T
C.sub.S T G A U.sub.S A A G C.sub.S C.sub.S A G T C.sub.S T G A
U.sub.S A A G C.sub.S T C.sub.S A G T C.sub.S T G A U.sub.S A A G
C.sub.S A G T C.sub.S T G A U.sub.S A A G C.sub.S T A G T C.sub.S T
G A U.sub.S A A G C.sub.S G T C.sub.S T G A U.sub.S A A G C.sub.S T
G T C.sub.S T G A U.sub.S A A G C.sub.S T C.sub.S T G A U.sub.S A A
G C.sub.S T T C.sub.S T G A U.sub.S A A G C.sub.S C.sub.S T G A
U.sub.S A A G C.sub.S T C.sub.S T G A U.sub.S A A G C.sub.S T G A
U.sub.S A A G C.sub.S T T G A U.sub.S A A G C.sub.S G A U.sub.S A A
G C.sub.S T
[0267] In certain embodiments, a modified oligonucleotide targeted
to miR-21 has a nucleoside pattern and nucleobase sequence selected
from Table 3C. Nucleosides not followed by a subscript indicate
.beta.-D-deoxyribonucleosides. Nucleosides followed by a subscript
"E" indicate 2'-MOE nucleosides. Nucleosides followed by a
subscript "S" indicate S-cEt nucleosides. Each internucleoside
linkage is a phosphorothioate internucleoside linkage. Nucleobases
may or may not comprise a methyl group at the 5' position.
TABLE-US-00007 TABLE 3C Metabolic products of compound # 25221 5'
3' N.sub.1 N.sub.2 N.sub.3 N.sub.4 N.sub.5 N.sub.6 N.sub.7 N.sub.8
N.sub.9 N.sub.10 N.sub.11 N.sub.12 N.sub.13 N.sub.14 N.sub.15
N.sub.16 N.sub.17 N.sub.18 N.sub.19 A.sub.E C.sub.S A T C.sub.S A G
T C.sub.S T G A U.sub.S A A G C.sub.S U.sub.S A.sub.S C.sub.S A T
C.sub.S A G T C.sub.S T G A U.sub.S A A G C.sub.S U.sub.S A.sub.S A
T C.sub.S A G T C.sub.S T G A U.sub.S A A G C.sub.S U.sub.S A.sub.S
T C.sub.S A G T C.sub.S T G A U.sub.S A A G C.sub.S U.sub.S A.sub.S
C.sub.S A G T C.sub.S T G A U.sub.S A A G C.sub.S U.sub.S A.sub.S A
G T C.sub.S T G A U.sub.S A A G C.sub.S U.sub.S A.sub.S G T C.sub.S
T G A U.sub.S A A G C.sub.S U.sub.S A.sub.S T C.sub.S T G A U.sub.S
A A G C.sub.S U.sub.S A.sub.S C.sub.S T G A U.sub.S A A G C.sub.S
U.sub.S A.sub.S T G A U.sub.S A A G C.sub.S U.sub.S A.sub.S G A
U.sub.S A A G C.sub.S U.sub.S A.sub.S A U.sub.S A A G C.sub.S
U.sub.S A.sub.S A.sub.E C.sub.S A T C.sub.S A G T C.sub.S T G A
U.sub.S A A G C.sub.S U.sub.S A.sub.E C.sub.S A T C.sub.S A G T
C.sub.S T G A U.sub.S A A G C.sub.S C.sub.S A T C.sub.S A G T
C.sub.S T G A U.sub.S A A G C.sub.S U.sub.S C.sub.S A T C.sub.S A G
T C.sub.S T G A U.sub.S A A G C.sub.S A T C.sub.S A G T C.sub.S T G
A U.sub.S A A G C.sub.S U.sub.S A T C.sub.S A G T C.sub.S T G A
U.sub.S A A G C.sub.S T C.sub.S A G T C.sub.S T G A U.sub.S A A G
C.sub.S U.sub.S T C.sub.S A G T C.sub.S T G A U.sub.S A A G C.sub.S
C.sub.S A G T C.sub.S T G A U.sub.S A A G C.sub.S U.sub.S C.sub.S A
G T C.sub.S T G A U.sub.S A A G C.sub.S A G T C.sub.S T G A U.sub.S
A A G C.sub.S U.sub.S A G T C.sub.S T G A U.sub.S A A G C.sub.S G T
C.sub.S T G A U.sub.S A A G C.sub.S U.sub.S G T C.sub.S T G A
U.sub.S A A G C.sub.S T C.sub.S T G A U.sub.S A A G C.sub.S U.sub.S
T C.sub.S T G A U.sub.S A A G C.sub.S C.sub.S T G A U.sub.S A A G
C.sub.S U.sub.S C.sub.S T G A U.sub.S A A G C.sub.S T G A U.sub.S A
A G C.sub.S U.sub.S T G A U.sub.S A A G C.sub.S G A U.sub.S A A G
C.sub.S U.sub.S
[0268] In certain embodiments, a modified oligonucleotide targeted
to miR-21 has a nucleoside pattern and nucleobase sequence selected
from Table 3D. Nucleosides not followed by a subscript indicate
.beta.-D-deoxyribonucleosides. Nucleosides followed by a subscript
"E" indicate 2'-MOE nucleosides. Nucleosides followed by a
subscript "S" indicate S-cEt nucleosides. Each internucleoside
linkage is a phosphorothioate internucleoside linkage. Nucleobases
may or may not comprise a methyl group at the 5' position.
TABLE-US-00008 TABLE 3D Metabolic products of compound # 25220 5'
3' N.sub.1 N.sub.2 N.sub.3 N.sub.4 N.sub.5 N.sub.6 N.sub.7 N.sub.8
N.sub.9 N.sub.10 N.sub.11 N.sub.12 N.sub.13 N.sub.14 N.sub.15
N.sub.16 N.sub.17 N.sub.18 N.sub.19 A.sub.E C.sub.S A T C.sub.S
A.sub.S G T C.sub.S U.sub.S G A U.sub.S A.sub.S A G C.sub.S U.sub.S
A.sub.E C.sub.S A T C.sub.S A.sub.S G T C.sub.S U.sub.S G A U.sub.S
A.sub.S A G C.sub.S U.sub.S A.sub.E A T C.sub.S A.sub.S G T C.sub.S
U.sub.S G A U.sub.S A.sub.S A G C.sub.S U.sub.S A.sub.E T C.sub.S
A.sub.S G T C.sub.S U.sub.S G A U.sub.S A.sub.S A G C.sub.S U.sub.S
A.sub.E C.sub.S A.sub.S G T C.sub.S U.sub.S G A U.sub.S A.sub.S A G
C.sub.S U.sub.S A.sub.E A.sub.S G T C.sub.S U.sub.S G A U.sub.S
A.sub.S A G C.sub.S U.sub.S A.sub.E G T C.sub.S U.sub.S G A U.sub.S
A.sub.S A G C.sub.S U.sub.S A.sub.E T C.sub.S U.sub.S G A U.sub.S
A.sub.S A G C.sub.S U.sub.S A.sub.E C.sub.S U.sub.S G A U.sub.S
A.sub.S A G C.sub.S U.sub.S A.sub.E U.sub.S G A U.sub.S A.sub.S A G
C.sub.S U.sub.S A.sub.E G A U.sub.S A.sub.S A G C.sub.S U.sub.S
A.sub.E A U.sub.S A.sub.S A G C.sub.S U.sub.S A.sub.E A.sub.E
C.sub.S A T C.sub.S A.sub.S G T C.sub.S U.sub.S G A U.sub.S A.sub.S
A G C.sub.S U.sub.S A.sub.E C.sub.S A T C.sub.S A.sub.S G T C.sub.S
U.sub.S G A U.sub.S A.sub.S A G C.sub.S C.sub.S A T C.sub.S A.sub.S
G T C.sub.S U.sub.S G A U.sub.S A.sub.S A G C.sub.S U.sub.S C.sub.S
A T C.sub.S A.sub.S G T C.sub.S U.sub.S G A U.sub.S A.sub.S A G
C.sub.S A T C.sub.S A.sub.S G T C.sub.S U.sub.S G A U.sub.S A.sub.S
A G C.sub.S U.sub.S A T C.sub.S A.sub.S G T C.sub.S U.sub.S G A
U.sub.S A.sub.S A G C.sub.S T C.sub.S A.sub.S G T C.sub.S U.sub.S G
A U.sub.S A.sub.S A G C.sub.S U.sub.S T C.sub.S A.sub.S G T C.sub.S
U.sub.S G A U.sub.S A.sub.S A G C.sub.S C.sub.S A.sub.S G T C.sub.S
U.sub.S G A U.sub.S A.sub.S A G C.sub.S U.sub.S C.sub.S A.sub.S G T
C.sub.S U.sub.S G A U.sub.S A.sub.S A G C.sub.S A.sub.S G T C.sub.S
U.sub.S G A U.sub.S A.sub.S A G C.sub.S U.sub.S A.sub.S G T C.sub.S
U.sub.S G A U.sub.S A.sub.S A G C.sub.S G T C.sub.S U.sub.S G A
U.sub.S A.sub.S A G C.sub.S U.sub.S G T C.sub.S U.sub.S G A U.sub.S
A.sub.S A G C.sub.S T C.sub.S U.sub.S G A U.sub.S A.sub.S A G
C.sub.S U.sub.S T C.sub.S U.sub.S G A U.sub.S A.sub.S A G C.sub.S
C.sub.S U.sub.S G A U.sub.S A.sub.S A G C.sub.S U.sub.S C.sub.S
U.sub.S G A U.sub.S A.sub.S A G C.sub.S U.sub.S G A U.sub.S A.sub.S
A G C.sub.S U.sub.S U.sub.S G A U.sub.S A.sub.S A G C.sub.S G A
U.sub.S A.sub.S A G C.sub.S U.sub.S
[0269] In certain embodiments, a modified oligonucleotide consists
of greater than 19 linked nucleosides, and comprises a nucleoside
pattern described herein. The nucleosides that are present in
addition to the nucleosides described by the nucleoside pattern are
either modified or unmodified. For example, a modified
oligonucleotide consisting of 21 linked nucleosides and having a
nucleobase sequence complementary to miR-21 may have nucleoside
pattern II, which is 19 linked nucleosides in length. The
additional two nucleosides may be comprised of modified or
unmodified sugar moieties. In certain embodiments, a modified
oligonucleotide consists of 19 linked nucleosides and comprises any
of the nucleoside patterns described herein. In certain
embodiments, a modified oligonucleotide consists of 20 linked
nucleosides and comprises any of the nucleoside patterns described
herein. In certain embodiments, a modified oligonucleotide consists
of 21 linked nucleosides and comprises any of the nucleoside
patterns described herein. In certain embodiments, a modified
oligonucleotide consists of 22 linked nucleosides and comprises any
of the nucleoside patterns described herein. In certain
embodiments, a modified oligonucleotide consists of 23 linked
nucleosides and comprises any of the nucleoside patterns described
herein. In certain embodiments, a modified oligonucleotide consists
of 24 linked nucleosides and comprises any of the nucleoside
patterns described herein. In certain embodiments, a modified
oligonucleotide consists of 25 linked nucleosides and comprises any
of the nucleoside patterns described herein.
Certain Uses of the Invention
[0270] Modulation of miR-21 Activity
[0271] The compounds provided herein are potent and specific
inhibitors of miR-21 activity, and are thus useful for modulating
miR-21 activity.
[0272] MicroRNAs bind to and repress the expression of messenger
RNAs. In certain instances, inhibiting the activity of a microRNA
leads to de-repression of the messenger RNA, i.e. the messenger RNA
expression is increased at the level of RNA and/or protein.
Provided herein are methods for modulating the expression of a
miR-21-regulated transcript, comprising contacting a cell with a
compound of the invention, wherein the compound comprises a
modified oligonucleotide having a sequence complementary to a
miR-21.
[0273] In certain embodiments, a miR-21-regulated transcript is
YOD1, and inhibition of miR-21 results in an increase in the level
of YOD1 mRNA. In certain embodiments, a miR-21 regulated transcript
is PPAR-alpha, and inhibition of miR-21 results in an increase in
the level of PPAR-alpha mRNA. In certain embodiments, a
miR-21-regulated transcript is RNF167.
[0274] In certain embodiments, a miR-21-regulated transcript is
SPG20. In certain embodiments, inhibition of miR-21 in the liver
results in an increase in the level of SPG20 mRNA.
[0275] In certain embodiments, following contacting a cell with a
compound of the invention, an at least 1.5-fold increase in the
mRNA level of a miR-21-regulated transcript is observed. In certain
embodiments, following contacting a cell with a compound of the
invention, an at least 2.0-fold increase in the mRNA level of a
miR-21-regulated transcript is observed. In certain embodiments,
the mRNA level of the microRNA-regulated transcript increases at
least 2.5-fold. In certain embodiments, the mRNA level of the
microRNA-regulated transcript increases at least 3.0-fold. In
certain embodiments, the mRNA level of the microRNA-regulated
transcript increases at least 3.5-fold. In certain embodiments, the
mRNA level of the microRNA-regulated transcript increases at least
4.0-fold. In certain embodiments, the mRNA level of the
microRNA-regulated transcript increases at least 4.5-fold. In
certain embodiments, the mRNA level of the microRNA-regulated
transcript increases at least 5.0-fold.
[0276] Certain microRNAs are known to target several messenger
RNAs, in some cases hundreds of messenger RNAs. Inhibiting the
activity of a single microRNA can lead to detectable changes in
expression of many of the microRNAs targets. Provided herein are
methods for modulating multiple miR-21-regulated transcripts,
comprising inhibiting the activity of miR-21, wherein broad gene
expression changes occur.
[0277] In certain embodiments, phenotypic changes may be observed
following inhibition of a miR-21 with a compound of the invention.
Such phenotypic changes may occur with or without detectable
changes in the expression of a miR-21-regulated transcript.
[0278] Fibroproliferative Disorders
[0279] A normal physiological response to damage or injury in an
organ or tissue involves repair of the damaged tissue, which is a
fundamental biological process necessary for survival. During the
repair process, after foreign materials, bacteria, and damaged
tissue are eliminated, fibroblasts migrate in to the site of injury
to deposit new extracellular matrix, which then becomes
structurally organized as part of the tissue remodeling phase.
[0280] Fibroblasts are the most common cells found in connective
tissue, and are responsible for the synthesis of reticulin and
other elastic fibres which support the extracellular matrix and
play an important part in normal wound healing (Sempowski, G. D. et
al., 2002. Wound Repair Regeneration. 3: 120-131). Fibroblasts are
responsible for the deposition of collagen, which is necessary to
repair injured tissue and restore its structure and function.
During the wound-healing process, activated fibroblasts are
transformed into myofibroblasts, which are collagen-secreting
alpha-SMA+ fibroblasts. In the initial stages of the wound-healing
process, myofibroblasts produce matrix metalloproteases, which
disrupt the basement membrane and permit inflammatory cells to be
efficiently recruited to the site of injury. During the later
stages of injury repair, myofibroblasts promote wound contraction,
the process by which the edges of the wound migrate toward the
center of the wound. Thus, fibroblast activity is essential to the
normal healing process.
[0281] Fibroblasts that participate in the normal injury repair
process may be derived from local mesenchymal cells, recruited from
the bone marrow, or derived by epithelial-mesenchymal transition.
Epithelial-mesenchymal transition (EMT) describes a series of rapid
changes of cell phenotype (Kalluri, R. and Neilson, E.G. 2003. J.
Clin. Invest. 112: 1776-1784) during which static epithelial cells
lose cell-cell contacts, acquire mesenchymal features and manifest
a migratory phenotype. Resident fibroblasts, infiltrating
fibrocytes or pericyte-like cells may also participate in the
injury repair process.
[0282] Under some conditions, the tissue repair process occurs in
excess, resulting an excessive accumulation of extracellular matrix
(ECM) components and substantial remodeling of the ECM, which
contribute to the formation of a permanent fibrotic scar. The
formation of this excess fibrous connective tissue, a process known
as fibrosis, contributes to abnormal changes in tissue architecture
and interferes with normal organ function.
[0283] Fibrosis can occur in any part of the body, and can result
from a variety of physical, metabolic, ischemic, infectious,
inflammatory or immunological injuries. Although the anatomical
locations, origins, and clinical manifestations of fibrosis may be
diverse, there are important pathological features common to all
types of fibrosis. Regardless of the location in which fibrosis
occurs, the fibrotic process involves the secretion and activation
of profibrotic cytokines, the expansion and activation of
mesenchymal cell populations, and extracellular matrix synthesis
and organization, and ultimately leads to the destruction of normal
tissue. Left untreated, fibrosis can lead to a variety of
conditions of the heart, lungs, kidney, liver, eye, and skin, among
other tissues.
[0284] As demonstrated herein, the inhibition of miR-21 in a model
of fibrosis led to decreased collagen deposition. Accordingly,
provided herein are compositions and methods for treating,
preventing, and/or delaying the onset of fibrosis, comprising
administering a compound comprising a modified oligonucleotide,
wherein the modified oligonucleotide is complementary to miR-21, to
a subject. The subject may have received a diagnosis of fibrosis,
may be at risk for developing fibrosis, or may be suspected of
having fibrosis.
[0285] In certain embodiments, a subject having fibrosis has kidney
fibrosis, lung fibrosis, liver fibrosis, cardiac fibrosis, skin
fibrosis, age-related fibrosis, spleen fibrosis, scleroderma, or
post-transplant fibrosis.
[0286] Many diseases or abnormalities of the kidney are
characterized by the presence of fibrosis. As such, the compounds
provided herein are useful for treating, ameliorating, preventing,
and/or delaying the onset of any kidney disease that is
characterized by the presence of fibrosis. In certain embodiments,
a subject having fibrosis has a kidney disease or condition. In
certain embodiments, a subject at risk for developing fibrosis has
a kidney disease or condition. In certain embodiments, a subject
suspected of having fibrosis has a kidney disease or condition.
Accordingly, provided herein are methods for treating a subject
having, at risk for developing, or suspected of having fibrosis,
wherein the subject has a kidney disease or condition. The kidney
disease or condition may be one or more of, without limitation,
glomerular disease, tubulointerstitial fibrosis, IgA nephropathy,
interstitial fibrosis/tubular atrophy, glomerulosclerosis,
glomerulonephritis, diabetes mellitus, idiopathic focal segmental
glomerulosclerosis, membranous nephropathy, collapsing
glomerulopathy, chronic recurrent kidney infection, diabetes
mellitus, diabetic nephropathy, chronic recurrent kidney infection,
hypertension, systemic hypertension, intraglomerular hypertension,
or end stage renal disease.
[0287] Chronic kidney disease may be characterized by the presence
of fibrosis. Accordingly, in certain embodiments, the kidney
disease or condition is chronic kidney disease. In certain
embodiments, the subject is at risk for developing chronic kidney
disease. In certain embodiments, a subject having acute kidney
injury is at risk for developing fibrosis and/or chronic kidney
disease. Accordingly, the compositions and methods provided herein
may be administered to a subject having acute kidney injury, to
prevent or delay the onset of fibrosis and/or chronic kidney
disease.
[0288] In certain embodiments, a subject having fibrosis has kidney
fibrosis that results from acute or repetitive trauma to the
kidney. The trauma may result from surgery, chemotherapy, radiation
treatment, allograft rejection, chronic transplant rejection, and
acute transplant rejection.
[0289] In certain embodiments, kidney fibrosis may result from
exposure to any agent that may be nephrotoxic after acute or
chronic exposure. Such agents include pharmaceutical agents,
including but not limited to analgesics, non-steroidal
anti-inflammatory drugs, antibiotics, lithium, cyclosporine,
mesalazine, contrast media, chemotherapeutic agents; occupational
toxins, including but not limited to heavy metals; and
environmental toxins, including but not limited to heavy metals
(e.g. cadmium, mercuric chloride) or plant nephrotoxins (e.g.
aristolochic acid).
[0290] Many diseases or abnormalities of the liver are
characterized by the presence of fibrosis. As such, in certain
embodiments, a subject having fibrosis has a liver disease or
condition. In certain embodiments, a subject at risk for developing
fibrosis has a liver disease or condition. In certain embodiments,
a subject suspected of having fibrosis has a liver disease or
condition. Accordingly, provided herein are methods for treating a
subject having, at risk for developing, or suspected of having
fibrosis, wherein the subject has a liver disease or condition. In
certain embodiments, a liver disease or condition may be one or
more of, without limitation, chronic liver injury, hepatitis virus
infection (including hepatitis C virus infection and hepatitis B
virus infection), non-alcoholic fatty liver disease (NAFLD),
non-alcoholic steatohepatitis (NASH), alcoholic liver disease
(ALD), alcoholic steatohepatitis, bridging fibrosis, or cirrhosis.
In certain embodiments a liver disease or condition is associated
with exposure to toxic chemicals. In certain embodiments, a liver
disease or condition results from exposure to pharmaceutical
agents, e.g. acetaminophen. In certain embodiments, a subject
receiving chemotherapy is at risk for liver fibrosis and/or chronic
liver injury.
[0291] Fibrosis may be present in many diseases or abnormalities of
the lung. As such, in certain embodiments, a subject having
fibrosis has a lung disease or condition. In certain embodiments, a
subject at risk for developing fibrosis has a lung disease or
condition. In certain embodiments, a subject suspected of having
fibrosis has a lung disease or condition. Accordingly, provided
herein are methods for treating a subject having, at risk for
developing, or suspected of having fibrosis, wherein the subject
has a lung disease or condition. In certain embodiments, a lung
disease or condition may be one or more of, without limitation,
lung fibrosis, idiopathic pulmonary fibrosis, or chronic
obstructive lung disease. In certain embodiments, lung fibrosis may
result from inhalation of particulate matter, such as those found
in silica gel, asbestos, air pollutants or cigarette smoke.
[0292] In certain embodiments the fibrosis is cardiac fibrosis.
[0293] In certain embodiments the fibrosis is skin fibrosis. In
certain embodiments the fibrosis is age-related fibrosis. In
certain embodiments the fibrosis is spleen fibrosis.
[0294] Scleroderma is a chronic autoimmune disease characterized by
fibrosis, among other symptoms. In certain embodiments, a subject
having fibrosis has scleroderma. In certain embodiments, a subject
having scleroderma has fibrosis in internal organs, in addition to
fibrosis of the skin.
[0295] Fibrosis frequently occurs in transplanted organs, leading
to loss of organ function and ultimately to chronic rejection of
the transplanted organ. Prevention or treatment of fibrosis in
transplanted organs may prevent or delay chronic rejection of the
transplanted organ, or in other words may prolong function of the
transplanted organ. Accordingly, in certain embodiments a subject
has post-transplant fibrosis. In certain embodiments, the
post-transplant fibrosis is kidney post-transplant fibrosis. In
certain embodiments, the transplantation associated fibrosis is
liver post-transplant fibrosis. In certain embodiments, a compound
described herein is administered prior to transplantation. In
certain embodiments, a compound described herein is administered
concurrently with transplantation. In certain embodiments, a
compound described herein is administered following
transplantation.
[0296] Provided herein are methods for treating a subject having a
fibroproliferative disorder. In certain embodiments such methods
comprise administering to a subject having or suspected of having a
fibroproliferative disorder a modified oligonucleotide having a
nucleobase sequence which is complementary to a miRNA or a
precursor thereof. In certain embodiments, the miRNA is miR-21.
[0297] Cancer and Metastasis
[0298] Abnormally high expression of miR-21 has been demonstrated
in numerous types of cancer. Further, inhibition of miR-21 in in
vitro and in vivo models has demonstrated that inhibitors of miR-21
are useful for the inhibition of cellular processes that support
cancer cell growth, as well as for the treatment of cancer.
[0299] Accordingly, in certain embodiments, the compounds provided
herein are used for treating, preventing, ameliorating, and/or
delaying the onset of cancer. In certain embodiments, the cancer is
liver cancer, breast cancer, lung cancer, colon cancer, ovarian
cancer, cervical cancer, leukemia, lymphoma, brain cancer,
esophageal cancer, Hodgkin lymphoma, non-Hodgkin lymphoma, kidney
cancer, melanoma, myeloma, oral cancer, pancreatic cancer, prostate
cancer, rectal cancer, stomach cancer, bladder cancer, thyroid
cancer, or testicular cancer. In certain embodiments, the liver
cancer is hepatocellular carcinoma. In certain embodiments, the
liver cancer is due to metastasis of cancer that originated in
another part of the body, for example bone cancer, colon cancer or
breast cancer.
[0300] In certain embodiments, in liver cancer, miR-21 is elevated
and the level of one or more miR-21-regulated transcripts is
reduced. In certain embodiments, the reduced miR-21-regulated
transcript is SPG20.
[0301] In certain embodiments, the liver cancer is hepatocellular
carcinoma (HCC). The diagnosis of hepatocellular carcinoma is
typically made by liver imaging tests such as abdominal ultrasound,
helical computed tomography (CT) scan or triple phase CT scan. Such
imaging tests may be performed in conjunction with measurement of
blood levels of alpha-fetoprotein and/or blood levels of
des-gamma-carboxyprothrombin. In certain subjects, MRI may be used
in place of CT scan. The liver imaging tests allow the assessment
of the tumor size, number, location, metastasis outside the liver,
patency and or invasion of the arteries and veins of the liver by
the tumor. This assessment aids the decision as to the mode of
therapeutic or palliative intervention that is appropriate. The
final diagnosis is typically confirmed by needle biopsy and
histopathological examination.
[0302] Accordingly, in certain embodiments, the liver cancer is
detected following a computed tomography (CT) scan that detects
tumors. In certain embodiments, the liver cancer is detected
following magnetic resonance imaging (MRI). In certain embodiments,
HCC is characterized as a single primary tumor. In certain
embodiments, HCC is characterized as multiple primary tumors. In
certain embodiments, HCC is characterized as a poorly defined
primary tumor with an infiltrative growth pattern. In certain
embodiments, the HCC is a single primary tumor with vascular
invasion. In certain embodiments, the HCC is characterized as
multiple primary tumors with vascular invasion. In certain
embodiments, the HCC has metastasized to one or more lymph nodes.
In certain such embodiments, the lymph nodes are regional lymph
nodes. In certain embodiments, the HCC has metastasized to one or
more distant tissues. In certain embodiments, the HCC has
metastasized to other regions of the liver, the portal vein, lymph
nodes, adrenal glands, bone or lungs. In certain embodiments,
fibrosis is present.
[0303] A number of systems have been employed to predict the
prognosis for HCC, including the TNM system, the Okuda system, the
Barcelona Clinic Liver Cancer (BCLC) and the CLIP score. Each of
these systems incorporates four features that have been recognized
as being important determinants of survival: the severity of
underlying liver disease, the size of the tumor, extension of the
tumor into adjacent structures, and the presence of metastases. The
TNM system classifies HCC as stage I, II, III, IV, or V. The BCLC
classifies HCC as Stage A1, A2, A3, A4, B, C, and D, and includes
consideration of a Child-Pugh score.
[0304] In certain embodiments, liver cancer is classified as Stage
1, Stage 2, Stage 3A, Stage 3B, Stage 3C, or Stage 4. Stage 1 is
characterized by a cancer is no bigger than 2 cm in size and that
has not begun to spread. At Stage 2, the cancer is affecting blood
vessels in the liver, or there is more than one tumor in the liver.
At Stage 3A, the cancer is bigger than 5 cm in size or has spread
to the blood vessels near the liver. At Stage 3B, the cancer has
spread to nearby organs, such as the bowel or the stomach, but has
not spread to the lymph nodes. At Stage 3C the cancer can be of any
size and has spread to nearby lymph nodes. At Stage 4 the cancer
has spread to parts of the body further away from the liver, such
as the lungs.
[0305] Biomarkers in a subject's blood may be used to augment a
diagnosis of liver cancer, stage a liver cancer, or develop a
prognosis for survival. Such biomarkers include blood tumor
biomarkers, such as alpha-fetoprotein and des-gamma
carboxyprothrombin. In certain such embodiments, the subject has
elevated blood alpha-fetoprotein. In certain such embodiments, the
subject has elevated blood des-gamma carboxyprothrombin.
[0306] A subject having liver cancer may also suffer from abnormal
liver function. Liver function may be assessed by liver function
tests, which measure, among other things, blood levels of liver
transaminases. In certain embodiments, a subject having abnormal
liver function has elevated blood liver transaminases. Blood liver
transaminases include alanine aminotransferase (ALT) and aspartate
aminotransferase (AST). In certain embodiments, a subject having
abnormal liver function has elevated blood bilirubin. In certain
embodiments, a subject has abnormal blood albumin levels.
[0307] In certain embodiments, a subject's liver function is
assessed by the Child-Pugh classification system, which defines
three classes of liver function. In this classification system,
points are assigned to measurements in one of five categories:
bilirubin levels, albumin levels, prothrombin time, ascites, and
encephalopathy. One point is assigned per each of the following
characteristics present: blood bilirubin of less than 2.0 mg/dl;
blood albumin of greater than 3.5 mg/dl; a prothrombin time of less
than 1.7 international normalized ratio (INR); ascites is absent;
or encephalopathy is absent. Two points are assigned per each of
the following characteristics present: blood bilirubin of 2-3
mg/dl; blood bilirubin of 3.5 to 2.8 mg/dl; prothrombin time of
1.7-2.3 INR; ascites is mild to moderate; or encephalopathy is
mild. Three points are assigned per each of the following
characteristics present: bilirubin of greater than 3.0 mg/dl; blood
albumin of less than 2.8 mg/dl; prothrombin time of greater than
2.3 INR; ascites is severe to refractory; or encephalopathy is
severe. The scores are added and Class A is assigned for a score of
5-6 points, Class B is assigned for a score of 7-9 points, and
Class C is assigned for a score of 10-15 points,
[0308] A subject having liver cancer may have previously suffered
from, or may currently suffer from, chronic hepatitis C infection,
chronic hepatitis B infection, non-alcoholic fatty liver disease,
or cirrhosis. Subjects having liver cancer accompanied by and/or
resulting from hepatitis C infection, hepatitis B infection,
non-alcoholic fatty liver disease, or cirrhosis may be treated by
the methods described herein.
[0309] A subject's response to treatment may be evaluated by tests
similar to those used to diagnosis the liver cancer, including,
without limitation, CT scan, MRI, and needle biopsy. Response to
treatment may also be assessed by measuring biomarkers in blood,
for comparison to pre-treatment levels of biomarkers.
[0310] miR-21 has also been linked to the process of metastasis.
While EMT does occur in normal physiological processes, EMT has
been connected to the process of metastasis. The relevance of EMT
in tumor progression has been explored in several studies
(Greenburg, G. and Hay, E. 1986. Dev. Biol. 115: 363-379; Boyer, B.
et al., 1989. J. Cell. Biol. 109: 1495-1509; Uehara, Y. et al.,
1992. J. Cell. Biol. 117: 889-894). Epithelial cells are held
together through integrins to an underlying extracellular matrix
(ECM) called the basement membrane. Mesenchymal cells, on the other
hand, have the ability to invade and move through the
three-dimensional structure of the ECM. Therefore, EMT at least
superficially resembles the transformation of normal adherent cells
into the metastatic phenotype.
[0311] Provided herein are methods for treating, preventing,
ameliorating, and/or delaying the onset of metastasis. The
metastasis may result from the migration of cancer cells from any
primary site of cancer to any secondary site of cancer.
[0312] Acute Kidney Injury
[0313] Acute kidney injury is a rapid loss of kidney function,
which may be brought on by a number of causes, including low blood
volume, exposure to toxins, and urinary obstruction. Elevated
miR-21 has been observed in a model of acute kidney injury.
Accordingly, in certain embodiments, the compounds provided herein
are used for treating, preventing, ameliorating, and/or delaying
the onset of acute kidney injury. In certain embodiments, acute
kidney injury may be the result of exposure to toxic substances,
such as environmental toxins or cancer therapeutic agents. Acute
kidney injury may arise from damage to the kidney itself, for
example in conditions such as glomerulonephritis, acute tubular
necrosis, and acute interstitial nephritis. In certain embodiments,
acute kidney injury is caused by urinary tract obstruction, such as
that related to benign prostatic hyperplasia, kidney stones,
obstructed urinary catheter, bladder stone, bladder, ureteral or
renal malignancy. In certain embodiments, the acute kidney injury
may progress to fibrosis and/or chronic kidney disease. Thus, in
some embodiments, the compounds provided herein are administered to
a subject with acute kidney injury to prevent or delay the onset of
fibrosis and/or chronic kidney disease. In some embodiments, the
compounds provided herein are administered to a subject to enhance
recovery from acute kidney injury.
[0314] Cardiac Diseases
[0315] Elevated miR-21 expression has been found in human cardiac
disease, and inhibition of miR-21 in relevant animal models has
demonstrated improvements in cardiac fibrosis and cardiac function.
Accordingly, in certain embodiments, the compounds provided herein
are used for treating, preventing, ameliorating, and/or delaying
the onset of one more cardiac diseases. In certain embodiments, a
cardiac disease is cardiac fibrosis, cardiac enlargement, cardiac
hypertrophy, cardiac dilation, hypertrophic cardiomyopathy, heart
failure, post-myocardial infarction remodeling, myocardial
infarction, cardiomyopathy (for example, hypertrophic
cardiomyopathy, restrictive cardiomyopathy, dilated cardiomyopathy
(DCM), idiopathic dilated cardiomyopathy, or dilated cardiomyopathy
with arrhythmias), diastolic heart failure, chronic atrial
fibrillation, primary pulmonary hypertension, acute respiratory
distress syndrome, brugada syndrome, progressive cardiac conduction
disease, uremic pericarditis, anthracycline cardiomyopathy,
arterial fibrosis, post-radiation lymphatic fibrosis, sarcoidosis,
scleroderma, endocardial fibroelastosis, serotonergic excess,
cardiac valvulopathy, atrial fibrosis, atrial fibrillation, mitral
valvular disease, hypertension, chronic ventricular dysfunction,
pressure and volume overload, or myocardial fibrosis.
[0316] Cellular Processes
[0317] Provided herein are compositions and methods for reducing or
preventing fibroblast proliferation or activation. Also provided
herein are compositions and methods for inhibiting the synthesis of
extracellular matrix, which includes but is not limited to the
synthesis of collagen, fibronectin, collagenase, or a tissue
inhibitor of metalloproteinase.
[0318] Provided herein are methods for modulating the cellular
processes associated with epithelial-mesenchymal transition (EMT).
Such methods comprise contacting an epithelial cell with a compound
consisting of a modified oligonucleotide, wherein the modified
oligonucleotide is complementary to miR-21. In certain embodiments,
the contacting delays the transition of an epithelial cell to a
fibroblast. In certain embodiments, the contacting prevents the
transition of an epithelial cell to a fibroblast.
[0319] In certain embodiments, a compound provided herein may stop,
slow, or reduce the proliferation of cancer cells. In certain
embodiments, a compound provided herein may induce apoptosis in
cancer cells. In certain embodiments, a compound provided herein
may reduce cancer cell survival.
[0320] In certain embodiments, the epithelial cell is a cancer
cell. In certain embodiments, the contacting delays the metastasis
of the cancer cell. In certain embodiments, the contacting prevents
metastasis of the cancer cell.
Certain Clinical Outcomes
[0321] In certain embodiments, administration of the compounds or
methods provided herein result in one or more clinically desirable
outcomes in a subject. Such improvements may be used to determine
the extent to which a subject is responding to treatment.
[0322] In certain embodiments a clinically desirable outcome is the
amelioration of fibrosis. In certain embodiments a clinically
desirable outcome is the slowing of further progression of
fibrosis. In certain embodiments a clinically desirable outcome is
the halting of further progression of fibrosis. In certain
embodiments a clinically desirable outcome is a reduction in
fibrosis. In certain embodiments a clinically desirable outcome is
a reduction in collagen content in the organ having fibrosis.
[0323] In certain embodiments a clinically desirable outcome is the
amelioration of fibrosis in any organ or tissue. In certain
embodiments a clinically desirable outcome is the slowing of
further progression of fibrosis. In certain embodiments a
clinically desirable outcome is the halting of further progression
of fibrosis. In certain embodiments a clinically desirable outcome
is a reduction in fibrosis. In certain embodiments a clinically
desirable outcome is a reduction in collagen content in the
affected organ.
[0324] In certain embodiments a clinically desirable outcome is
improved kidney function. Kidney function may be assessed by one or
more known methods commonly performed in a clinical setting,
including, without limitation: measuring blood urea nitrogen in the
blood of the subject; measuring creatinine in the blood of the
subject; measuring creatinine clearance in the subject; measuring
proteinuria in the subject; measuring microalbumin:creatinine ratio
in the subject; measuring urinary output in the subject; measuring
kidney injury molecule-1 (KIM-1) mRNA levels in the urine; and/or
measuring clustering levels in the urine.
[0325] In certain embodiments, a clinically desirable outcome is
improved liver function. Liver function may be assessed by one or
more known methods commonly performed in a clinical setting,
including, without limitation: measuring alanine aminotransferase
levels in the blood of the subject; measuring aspartate
aminotransferase levels in the blood of the subject; measuring
bilirubin levels in the blood of the subject; measuring albumin
levels in the blood of the subject; measuring prothrombin time in
the subject; measuring ascites in the subject; and/or measuring
encephalopathy in the subject.
[0326] In certain embodiments a clinically desirable outcome is
improved lung function in a subject having pulmonary fibrosis. In
certain embodiments the subject has idiopathic pulmonary fibrosis.
Lung function may be assessed by one or more known methods commonly
performed in a clinical setting, including, without limitation:
measuring vital capacity in the subject; measuring forced vital
capacity in the subject; measuring forced expiratory volume in one
second in the subject; measuring peak expiratory flow rate in the
subject; measuring forced expiratory flow in the subject; measuring
maximal voluntary ventilation in the subject; determining the ratio
of forced expiratory volume in one second to forced vital capacity
in the subject; measuring ventilation/perfusion ratio in the
subject; measuring nitrogen washout in the subject; measuring
absolute volume of air in one or more lungs of a subject; and
administering the 6-minute walk test.
[0327] In certain embodiments a clinically desirable outcome is
improved cardiac function in a subject having cardiac fibrosis.
Cardiac function may be assessed by one or more known methods
commonly performed in a clinical setting, including, without
limitation: measuring cardiac output in the subject; measuring
stroke volume in the subject; measuring mean systolic ejection rate
in the subject; measuring systolic blood pressure in the subject;
measuring left ventricular ejection fraction in the subject;
determining stroke index in the subject; determining cardiac index
in the subject; measuring left ventricular percent fractional
shortening in the subject; measuring mean velocity of
circumferential fiber shortening in the subject; measuring left
ventricular inflow velocity pattern in the subject; measuring
pulmonary venous flow velocity pattern in the subject; measuring
peak early diastolic velocity of the mitral annulus of the
subject.
[0328] In certain embodiments a clinically desirable outcome is
reduction of tumor number and/or reduction of tumor size in a
subject having cancer. In certain embodiments a clinically
desirable outcome is a reduction in cancer cell number in a subject
having cancer. Additional clinically desirable outcomes include the
extension of overall survival time of the subject, and/or extension
of progression-free survival time of the subject. In certain
embodiments, administration of a compound provided herein prevents
an increase in tumor size and/or tumor number. In certain
embodiments, administration of a compound provided herein prevents
metastatic progression. In certain embodiments, administration of a
compound provided herein slows or stops metastatic progression. In
certain embodiments, administration of a compound provided herein
prevents the recurrence of tumors. In certain embodiments,
administration of a compound provided herein prevents recurrence of
tumor metastasis.
[0329] Certain desirable clinical outcomes may be assessed by
measurements of blood biomarkers. In certain embodiments,
administration of a compound provided herein may result in the
decrease of blood alpha-fetoprotein and/or blood des-gamma
carboxyprothrombin. Administration of a compound provided herein
may further result in the improvement of liver function, as
evidenced by a reduction in blood ALT and/or AST levels.
Certain Additional Therapies
[0330] Treatments for fibrosis or any of the conditions listed
herein may comprise more than one therapy. As such, in certain
embodiments provided herein are methods for treating a subject
having or suspected of having fibrosis comprising administering at
least one therapy in addition to administering a modified
oligonucleotide having a nucleobase sequence complementary to a
miR-21.
[0331] In certain embodiments, the at least one additional therapy
comprises a pharmaceutical agent.
[0332] In certain embodiments, pharmaceutical agents include
anti-inflammatory agents. In certain embodiments, an
anti-inflammatory agent is a steroidal anti-inflammatory agent. In
certain embodiments, a steroid anti-inflammatory agent is a
corticosteroid. In certain embodiments, a corticosteroid is
prednisone. In certain embodiments, an anti-inflammatory agent is a
non-steroidal anti-inflammatory drug. In certain embodiments, a
non-steroidal anti-inflammatory agent is ibuprofen, a COX-I
inhibitor, or a COX-2 inhibitor.
[0333] In certain embodiments, pharmaceutical agents include
immunosuppressive agents. In certain embodiments, an
immunosuppressive agent is a corticosteroid, cyclophosphamide, or
mycophenolate mofetil.
[0334] In certain embodiments, pharmaceutical agents include
anti-diabetic agent. Antidiabetic agents include, but are not
limited to, biguanides, glucosidase inhibitors, insulins,
sulfonylureas, and thiazolidenediones.
[0335] In certain embodiments, pharmaceutical agents include
angiotensin II receptor blockers (ARB). In certain embodiments, an
angiotensin II receptor blocker is candesartan, irbesartan,
olmesartan, losartan, valsartan, telmisartan, or eprosartan.
[0336] In certain embodiments, pharmaceutical agents include, but
are not limited to, diuretics (e.g. sprionolactone, eplerenone,
furosemide), inotropes (e.g. dobutamine, milrinone), digoxin,
vasodilators, angiotensin II converting enzyme (ACE) inhibitors
(e.g. are captopril, enalapril, lisinopril, benazepril, quinapril,
fosinopril, and ramipril), calcium channel blockers, isosorbide
dinitrate, hydralazine, nitrates (e.g. isosorbide mononitrate,
isosorbide dinitrate), hydralazine, beta-blockers (e.g. carvedilol,
metoprolol), and natriuretic peptides (e.g. nesiritide).
[0337] In certain embodiments, pharmaceutical agents include
heparinoids. In certain embodiments, a heparinoid is pentosan
polysulfate.
[0338] In certain embodiments, a pharmaceutical agent is a
pharmaceutical agent that blocks one or more responses to
fibrogenic signals.
[0339] In certain embodiments, a pharmaceutical agent is an
anti-connective tissue growth factor therapy. In certain
embodiments, an anti-CTGF therapy is a monoclonal antibody against
CTGF.
[0340] In certain embodiments, an additional therapy may be a
pharmaceutical agent that enhances the body's immune system,
including low-dose cyclophosphamide, thymostimulin, vitamins and
nutritional supplements (e.g., antioxidants, including vitamins A,
C, E, beta-carotene, zinc, selenium, glutathione, coenzyme Q-10 and
echinacea), and vaccines, e.g., the immunostimulating complex
(ISCOM), which comprises a vaccine formulation that combines a
multimeric presentation of antigen and an adjuvant.
[0341] In certain embodiments, the additional therapy is selected
to treat or ameliorate a side effect of one or more pharmaceutical
compositions of the present invention. Such side effects include,
without limitation, injection site reactions, liver function test
abnormalities, renal function abnormalities, liver toxicity, renal
toxicity, central nervous system abnormalities, and myopathies. For
example, increased aminotransferase levels in serum may indicate
liver toxicity or liver function abnormality. For example,
increased bilirubin may indicate liver toxicity or liver function
abnormality.
[0342] Further examples of additional pharmaceutical agents
include, but are not limited to, immunoglobulins, including, but
not limited to intravenous immunoglobulin (IVIg); analgesics (e.g.,
acetaminophen); salicylates; antibiotics; antivirals; antifungal
agents; adrenergic modifiers; hormones (e.g., anabolic steroids,
androgen, estrogen, calcitonin, progestin, somatostatin, and
thyroid hormones); immunomodulators; muscle relaxants;
antihistamines; osteoporosis agents (e.g., biphosphonates,
calcitonin, and estrogens); prostaglandins, antineoplastic agents;
psychotherapeutic agents; sedatives; poison oak or poison sumac
products; antibodies; and vaccines.
[0343] Cancer treatments often comprise more than one therapy. As
such, in certain embodiments the present invention provides methods
for reducing or preventing metastasis comprising administering to a
subject a compound comprising a modified oligonucleotide, wherein
the modified oligonucleotide is complementary to miR-21, and
administering at least one additional therapy that is an
anti-cancer therapy.
[0344] In certain embodiments, an anti-cancer therapy is
chemotherapy. Suitable chemotherapeutic agents include docetaxel,
cyclophosphamide, ifosfamide, methotrexate, vinblastine, cisplatin,
5-fluorouracil, gemcitabine, doxorubicin, mitomycin c, sorafenib,
etoposide, carboplatin, epirubicin, irinotecan and oxaliplatin. An
additional suitable chemotherapeutic agent includes an oligomeric
compound, other than a composition targeted to miR-21 provided
herein, that is used to treat cancer.
[0345] In certain embodiments, an anti-cancer therapy is radiation
therapy. In certain embodiments, an anti-cancer therapy is surgical
resection of a tumor. In certain embodiments, an anti-cancer
therapy is a DNA damaging agent, a proliferation inhibitor, an
anti-folate, a growth factor receptor inhibitor, an anti-angiogenic
agent, a receptor tyrosine kinase inhibitor, a kinase inhibitor, a
growth factor inhibitor, or a cytotoxic agent.
[0346] In certain embodiments, a DNA damaging agent is
1,3-bis(2-chloroethyl)-1-nitrosourea, busulfan, carboplatin,
carmustine, chlorambucil, cisplatin, cyclophosphamide, dacarbazine,
daunorubicin, doxorubicin, epirubicin, etoposide, idarubicin,
ifosfamide, irinotecan, lomustine, mechlorethamine, melphalan,
mitomycin C, mitoxantrone, oxaliplatin, temozolomide, or
topotecan.
[0347] In certain embodiments, an anti-folate is methotrexate,
aminopterin, thymidylate synthase, serine hydroxymethyltransferase,
folyilpolyglutamyl synthetase, g-glutamyl hydrolase,
glycinamide-ribonucleotide transformylase, leucovorin,
amino-imidazole-carboxamide-ribonucleotide transformylase,
5-fluorouracil, or a folate transporter.
[0348] In certain embodiments, a growth factor receptor is
erlotinib, or gefitinib.
[0349] In certain embodiments, an angiogenesis inhibitor is
bevacizumab, thalidomide, carboxyamidotriazole, TNP-470, CM101,
IFN-.alpha., platelet factor-4, suramin, SU5416, thrombospondin, a
VEGFR antagonist, cartilage-derived angiogenesis inhibitory factor,
a matrix metalloproteinase inhibitor, angiostatin, endostatin,
2-methoxyestradiol, tecogalan, tetrathiomolybdate, prolactin, or
linomide.
[0350] In certain embodiments, a kinase inhibitor is bevacizumab,
BIBW 2992, cetuximab, imatinib, trastuzumab, gefitinib,
ranibizumab, pegaptanib, sorafenib, dasatinib, sunitinib,
erlotinib, nilotinib, lapatinib, panitumumab, vandetanib, E7080,
pazopanib, mubritinib, or fostamatinib.
Certain MicroRNA Nucleobase Sequences
[0351] The modified oligonucleotides having a nucleoside pattern
described herein have a nucleobase sequence that is complementary
to miR-21 (SEQ ID NO: 1), or a precursor thereof (SEQ ID NO: 2). In
certain embodiments, each nucleobase of the modified
oligonucleotide is capable of undergoing base-pairing with a
nucleobase at each corresponding position in the nucleobase
sequence of miR-21, or a precursor thereof. In certain embodiments
the nucleobase sequence of a modified oligonucleotide may have one
or more mismatched base pairs with respect to the nucleobase
sequence of miR-21 or precursor sequence, and remains capable of
hybridizing to its target sequence.
[0352] As the miR-21 sequence is contained within the miR-21
precursor sequence, a modified oligonucleotide having a nucleobase
sequence complementary to miR-21 is also complementary to a region
of the miR-21 precursor.
[0353] In certain embodiments, a modified oligonucleotide consists
of a number of linked nucleosides that is equal to the length of
miR-21.
[0354] In certain embodiments, the number of linked nucleosides of
a modified oligonucleotide is less than the length of miR-21. A
modified oligonucleotide having a number of linked nucleosides that
is less than the length of miR-21, wherein each nucleobase of the
modified oligonucleotide is complementary to each nucleobase at a
corresponding position of miR-21, is considered to be a modified
oligonucleotide having a nucleobase sequence that is fully
complementary to a region of the miR-21 sequence. For example, a
modified oligonucleotide consisting of 19 linked nucleosides, where
each nucleobase is complementary to a corresponding position of
miR-21 that is 22 nucleobases in length, is fully complementary to
a 19 nucleobase region of miR-21. Such a modified oligonucleotide
has approximately 86% overall complementarity to the entire length
of miR-21, and has 100% complementarity to a 19 nucleobase portion
of miR-21.
[0355] In certain embodiments, a modified oligonucleotide comprises
a nucleobase sequence that is complementary to a seed sequence,
i.e. a modified oligonucleotide comprises a seed-match sequence. In
certain embodiments, a seed sequence is a hexamer seed sequence. In
certain such embodiments, a seed sequence is nucleobases 1-6 of
miR-21. In certain such embodiments, a seed sequence is nucleobases
2-7 of miR-21. In certain such embodiments, a seed sequence is
nucleobases 3-8 of miR-21. In certain embodiments, a seed sequence
is a heptamer seed sequence. In certain such embodiments, a
heptamer seed sequence is nucleobases 1-7 of miR-21. In certain
such embodiments, a heptamer seed sequence is nucleobases 2-8 of
miR-21. In certain embodiments, the seed sequence is an octamer
seed sequence. In certain such embodiments, an octamer seed
sequence is nucleobases 1-8 of miR-21. In certain embodiments, an
octamer seed sequence is nucleobases 2-9 of miR-21.
[0356] In certain embodiments, a modified oligonucleotide has a
nucleobase sequence having one mismatch with respect to the
nucleobase sequence of miR-21, or a precursor thereof. In certain
embodiments, a modified oligonucleotide has a nucleobase sequence
having two mismatches with respect to the nucleobase sequence of
miR-21, or a precursor thereof. In certain such embodiments, a
modified oligonucleotide has a nucleobase sequence having no more
than two mismatches with respect to the nucleobase sequence of
miR-21, or a precursor thereof. In certain such embodiments, the
mismatched nucleobases are contiguous. In certain such embodiments,
the mismatched nucleobases are not contiguous.
[0357] In certain embodiments, the number of linked nucleosides of
a modified oligonucleotide is greater than the length of miR-21. In
certain such embodiments, the nucleobase of an additional
nucleoside is complementary to a nucleobase of the miR-21 stem-loop
sequence. In certain embodiments, the number of linked nucleosides
of a modified oligonucleotide is one greater than the length of
miR-21. In certain such embodiments, the additional nucleoside is
at the 5' terminus of an oligonucleotide. In certain such
embodiments, the additional nucleoside is at the 3' terminus of an
oligonucleotide. In certain embodiments, the number of linked
nucleosides of a modified oligonucleotide is two greater than the
length of miR-21. In certain such embodiments, the two additional
nucleosides are at the 5' terminus of an oligonucleotide. In
certain such embodiments, the two additional nucleosides are at the
3' terminus of an oligonucleotide. In certain such embodiments, one
additional nucleoside is located at the 5' terminus and one
additional nucleoside is located at the 3' terminus of an
oligonucleotide. In certain embodiments, a region of the
oligonucleotide may be fully complementary to the nucleobase
sequence of miR-21, but the entire modified oligonucleotide is not
fully complementary to miR-21. For example, a modified
oligonucleotide consisting of 24 linked nucleosides, where the
nucleobases of nucleosides 1 through 23 are each complementary to a
corresponding position of miR-21 that is 22 nucleobases in length,
has a 22 nucleoside portion that is fully complementary to the
nucleobase sequence of miR-21 and approximately 96% overall
complementarity to the nucleobase sequence of miR-21.
Certain Modified Oligonucleotides
[0358] In certain embodiments, a modified oligonucleotide consists
of 8 to 30 linked nucleosides. In certain embodiments, a modified
oligonucleotide consists of 15 to 30 linked nucleosides. In certain
embodiments, a modified oligonucleotide consists of 15 to 25 linked
nucleosides. In certain embodiments, a modified oligonucleotide
consists of 15 to 19 linked nucleosides. In certain embodiments, a
modified oligonucleotide consists of 15 to 16 linked nucleosides.
In certain embodiments, a modified oligonucleotide consists of 19
to 24 linked nucleosides. In certain embodiments, a modified
oligonucleotide consists of 21 to 24 linked nucleosides.
[0359] In certain embodiments, a modified oligonucleotide consists
of 8 linked nucleosides. In certain embodiments, a modified
oligonucleotide consists of 9 linked nucleosides. In certain
embodiments, a modified oligonucleotide consists of 10 linked
nucleosides. In certain embodiments, a modified oligonucleotide
consists of 11 linked nucleosides. In certain embodiments, a
modified oligonucleotide consists of 12 linked nucleosides. In
certain embodiments, a modified oligonucleotide consists of 13
linked nucleosides. In certain embodiments, a modified
oligonucleotide consists of 14 linked nucleosides. In certain
embodiments, a modified oligonucleotide consists of 15 linked
nucleosides. In certain embodiments, a modified oligonucleotide
consists of 16 linked nucleosides. In certain embodiments, a
modified oligonucleotide consists of 17 linked nucleosides. In
certain embodiments, a modified oligonucleotide consists of 18
linked nucleosides. In certain embodiments, a modified
oligonucleotide consists of 19 linked nucleosides. In certain
embodiments, a modified oligonucleotide consists of 20 linked
nucleosides. In certain embodiments, a modified oligonucleotide
consists of 21 linked nucleosides. In certain embodiments, a
modified oligonucleotide consists of 22 linked nucleosides. In
certain embodiments, a modified oligonucleotide consists of 23
linked nucleosides. In certain embodiments, a modified
oligonucleotide consists of 24 linked nucleosides. In certain
embodiments, a modified oligonucleotide consists of 25 linked
nucleosides.
[0360] The nucleobase sequences set forth herein, including but not
limited to those found in the examples and in the sequence listing,
are independent of any modification to the nucleic acid. As such,
nucleic acids defined by a SEQ ID NO may comprise, independently,
one or more modifications to one or more sugar moieties, to one or
more internucleoside linkages, and/or to one or more
nucleobases.
[0361] Although the sequence listing accompanying this filing
identifies each nucleobase sequence as either "RNA" or "DNA" as
required, in practice, those sequences may be modified with any
combination of chemical modifications. One of skill in the art will
readily appreciate that such designation as "RNA" or "DNA" to
describe modified oligonucleotides is somewhat arbitrary. For
example, a modified oligonucleotide comprising a nucleoside
comprising a 2'-OH sugar moiety and a thymine base could be
described as a DNA having a modified sugar (2'-OH for the natural
2'-H of DNA) or as an RNA having a modified base (thymine
(methylated uracil) for natural uracil of RNA).
[0362] Accordingly, nucleic acid sequences provided herein,
including, but not limited to those in the sequence listing, are
intended to encompass nucleic acids containing any combination of
natural or modified RNA and/or DNA, including, but not limited to
such nucleic acids having modified nucleobases. By way of further
example and without limitation, an oligonucleotide having the
nucleobase sequence "ATCGATCG" encompasses any oligonucleotide
having such nucleobase sequence, whether modified or unmodified,
including, but not limited to, such compounds comprising
[0363] RNA bases, such as those having sequence "AUCGAUCG" and
those having some DNA bases and some RNA bases such as "AUCGATCG"
and oligonucleotides having other modified bases, such as
"AT.sup.meCGAUCG," wherein .sup.meC indicates a 5-methylcytosine.
Similarly, an oligonucleotide having the nucleobase sequence
"AUCGAUCG" encompasses any oligonucleotide having such nucleobase
sequence, whether modified or unmodified, including, but not
limited to, such compounds comprising DNA bases, such as those
having sequence "ATCGATCG" and those having some DNA bases and some
RNA bases such as "AUCGATCG" and oligonucleotides having other
modified bases, such as "AT.sup.meCGAUCG," wherein .sup.meC
indicates a 5-methylcytosine.
Certain Modifications
[0364] In certain embodiments, oligonucleotides provided herein may
comprise one or more modifications to a nucleobase, sugar, and/or
internucleoside linkage, and as such is a modified oligonucleotide.
A modified nucleobase, sugar, and/or internucleoside linkage may be
selected over an unmodified form because of desirable properties
such as, for example, enhanced cellular uptake, enhanced affinity
for other oligonucleotides or nucleic acid targets and increased
stability in the presence of nucleases.
[0365] In certain embodiments, a modified oligonucleotide comprises
one or more modified nucleosides. In certain such embodiments, a
modified nucleoside is a stabilizing nucleoside. An example of a
stabilizing nucleoside is a sugar-modified nucleoside.
[0366] In certain embodiments, a modified nucleoside is a
sugar-modified nucleoside. In certain such embodiments, the
sugar-modified nucleosides can further comprise a natural or
modified heterocyclic base moiety and/or a natural or modified
internucleoside linkage and may include further modifications
independent from the sugar modification. In certain embodiments, a
sugar modified nucleoside is a 2'-modified nucleoside, wherein the
sugar ring is modified at the 2' carbon from natural ribose or
2'-deoxy-ribose.
[0367] In certain embodiments, a 2'-modified nucleoside has a
bicyclic sugar moiety. In certain such embodiments, the bicyclic
sugar moiety is a D sugar in the alpha configuration. In certain
such embodiments, the bicyclic sugar moiety is a D sugar in the
beta configuration. In certain such embodiments, the bicyclic sugar
moiety is an L sugar in the alpha configuration. In certain such
embodiments, the bicyclic sugar moiety is an L sugar in the beta
configuration.
[0368] In certain embodiments, the bicyclic sugar moiety comprises
a bridge group between the 2' and the 4'-carbon atoms. In certain
such embodiments, the bridge group comprises from 1 to 8 linked
biradical groups. In certain embodiments, the bicyclic sugar moiety
comprises from 1 to 4 linked biradical groups. In certain
embodiments, the bicyclic sugar moiety comprises 2 or 3 linked
biradical groups. In certain embodiments, the bicyclic sugar moiety
comprises 2 linked biradical groups. Examples of such 4' to 2'
sugar substituents, include, but are not limited to:
--[C(R.sub.a)(R.sub.b)].sub.n--,
--[C(R.sub.a)(R.sub.b)].sub.n--O--, --C(R.sub.aR.sub.b)--N(R)--O--
or, --C(R.sub.aR.sub.b)--O--N(R)--;
4'-CH.sub.2-2',4'-(CH.sub.2).sub.2-2',4'-(CH.sub.2).sub.3-2;
4'-(CH.sub.2)--O-2' (LNA); 4'-(CH.sub.2)-5-2;
4'-(CH.sub.2).sub.2--O-2' (ENA); 4'-CH(CH.sub.3)--O-2' (cEt) and
4'-CH(CH.sub.2OCH.sub.3)--O-2', and analogs thereof (see, e.g.,
U.S. Pat. No. 7,399,845, issued on Jul. 15, 2008);
4'-C(CH.sub.3)(CH.sub.3)--O-2' and analogs thereof, (see, e.g.,
WO2009/006478, published Jan. 8, 2009); 4'-CH.sub.2-N(OCH.sub.3)-2'
and analogs thereof (see, e.g., WO2008/150729, published Dec. 11,
2008); 4'-CH.sub.2--O--N(CH.sub.3)-2' (see, e.g., US2004/0171570,
published Sep. 2, 2004); 4'-CH.sub.2--O--N(R)-2', and
4'-CH.sub.2-N(R)--O-2'-, wherein each R is, independently, H, a
protecting group, or C.sub.1-C.sub.12 alkyl;
4'-CH.sub.2-N(R)--O-2', wherein R is H, C.sub.1-C.sub.12 alkyl, or
a protecting group (see, U.S. Pat. No. 7,427,672, issued on Sep.
23, 2008); 4'-CH.sub.2--C(H)(CH.sub.3)-2' (see, e.g.,
Chattopadhyaya, et al., J. Org. Chem., 2009, 74, 118-134); and
4'-CH.sub.2--C--(.dbd.CH.sub.2)-2' and analogs thereof (see,
published PCT International Application WO 2008/154401, published
on Dec. 8, 2008). [0369] In certain embodiments, such 4' to 2'
bridges independently comprise 1 or from 2 to 4 linked groups
independently selected from --[C(R.sub.a)(R.sub.b)].sub.n--,
--C(R.sub.a).dbd.C(R.sub.b)--, --C(R.sub.a).dbd.N--,
--C(.dbd.NR.sub.a)--, --C(.dbd.O)--, --C(.dbd.S)--, --O--,
--Si(R.sub.a).sub.2--, --S(.dbd.O).sub.x--, and --N(R.sub.a)--;
[0370] wherein:
[0371] x is 0, 1, or 2;
[0372] n is 1, 2, 3, or 4;
[0373] each R.sub.a and R.sub.b is, independently, H, a protecting
group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted
C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted
C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted
C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted
C.sub.5-C.sub.20 aryl, heterocycle radical, substituted heterocycle
radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7
alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical,
halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1,
acyl (C(.dbd.O)--H), substituted acyl, CN, sulfonyl
(S(.dbd.O).sub.2-J.sub.1), or sulfoxyl (S(.dbd.O)-J.sub.1); and
[0374] each J.sub.1 and J.sub.2 is, independently, H,
C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl,
C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl,
C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl,
C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl
(C(.dbd.O)--H), substituted acyl, a heterocycle radical, a
substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl,
substituted C.sub.1-C.sub.12 aminoalkyl, or a protecting group.
[0375] Nucleosides comprising such bicyclic sugar moieties are
referred to as bicyclic nucleosides or BNAs. In certain
embodiments, bicyclic nucleosides include, but are not limited to,
(A) .alpha.-L-Methyleneoxy (4'-CH.sub.2--O-2') BNA;
(B).beta.-D-Methyleneoxy (4'-CH.sub.2--O-2') BNA; (C) Ethyleneoxy
(4'-(CH.sub.2).sub.2--O-2') BNA; (D) Aminooxy
(4'-CH.sub.2--O--N(R)-2') BNA; (E) Oxyamino
(4'-CH.sub.2-N(R)--O-2') BNA; (F) Methyl(methyleneoxy)
(4'-CH(CH.sub.3)--O-2') BNA (also referred to as constrained ethyl
or cEt); (G) methylene-thio (4'-CH.sub.2--S-2') BNA; (H)
methylene-amino (4'-CH2-N(R)-2') BNA; (I) methyl carbocyclic
(4'-CH.sub.2--CH(CH.sub.3)-2') BNA; (J) c-MOE (4'-CH.sub.2--OMe-2')
BNA and (K) propylene carbocyclic (4'-(CH.sub.2).sub.3-2') BNA as
depicted below.
##STR00002## ##STR00003##
wherein Bx is a nucleobase moiety and R is, independently, H, a
protecting group, or C.sub.1-C.sub.12 alkyl.
[0376] In certain embodiments, a 2'-modified nucleoside comprises a
2'-substituent group selected from halo, allyl, amino, azido, SH,
CN, OCN, CF.sub.3, OCF.sub.3, O-, S-, or N(R.sub.m)-alkyl; O-, S-,
or N(R.sub.m)-alkenyl; O-, S- or N(R.sub.m)-alkynyl;
O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl,
O-aralkyl, O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n) or
O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n), where each R.sub.m and
R.sub.n is, independently, H, an amino protecting group or
substituted or unsubstituted C.sub.1-C.sub.10 alkyl. These
2'-substituent groups can be further substituted with one or more
substituent groups independently selected from hydroxyl, amino,
alkoxy, carboxy, benzyl, phenyl, nitro (NO.sub.2), thiol,
thioalkoxy (S-alkyl), halogen, alkyl, aryl, alkenyl and
alkynyl.
[0377] In certain embodiments, a 2'-modified nucleoside comprises a
2'-substituent group selected from F, NH.sub.2, N.sub.3, OCF.sub.3,
O--CH.sub.3, O(CH.sub.2).sub.3NH.sub.2, CH.sub.2--CH.dbd.CH.sub.2,
O--CH.sub.2--CH.dbd.CH.sub.2, OCH.sub.2CH.sub.2OCH.sub.3,
O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n),
--O(CH.sub.2).sub.2--O--(CH.sub.2).sub.2N(CH.sub.3).sub.2, and
N-substituted acetamide
(O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n) where each R.sub.m and
R.sub.n is, independently, H, an amino protecting group or
substituted or unsubstituted C.sub.1-C.sub.10 alkyl.
[0378] In certain embodiments, a 2'-modified nucleoside comprises a
2'-substituent group selected from F, OCF.sub.3, O--CH.sub.3,
OCH.sub.2CH.sub.2OCH.sub.3, 2'--O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(CH.sub.3).sub.2,
--O(CH.sub.2).sub.2--O--(CH.sub.2).sub.2N--(CH.sub.3).sub.2, and
O--CH.sub.2--C(.dbd.O)--N(H)CH.sub.3.
[0379] In certain embodiments, a 2'-modified nucleoside comprises a
2'-substituent group selected from F, O--CH.sub.3, and
OCH.sub.2CH.sub.2OCH.sub.3.
[0380] In certain embodiments, a sugar-modified nucleoside is a
4'-thio modified nucleoside. In certain embodiments, a
sugar-modified nucleoside is a 4'-thio-2'-modified nucleoside. A
4'-thio modified nucleoside has a .beta.-D-ribonucleoside where the
4'-0 replaced with 4'-S. A 4'-thio-2'-modified nucleoside is a
4'-thio modified nucleoside having the 2'-OH replaced with a
2'-substituent group. Suitable 2'-substituent groups include
2'-OCH.sub.3, 2'-O--(CH.sub.2).sub.2--OCH.sub.3, and 2'-F.
[0381] In certain embodiments, a modified oligonucleotide comprises
one or more internucleoside modifications. In certain such
embodiments, each internucleoside linkage of a modified
oligonucleotide is a modified internucleoside linkage. In certain
embodiments, a modified internucleoside linkage comprises a
phosphorus atom.
[0382] In certain embodiments, a modified oligonucleotide comprises
at least one phosphorothioate internucleoside linkage. In certain
embodiments, each internucleoside linkage of a modified
oligonucleotide is a phosphorothioate internucleoside linkage.
[0383] In certain embodiments, a modified internucleoside linkage
does not comprise a phosphorus atom. In certain such embodiments,
an internucleoside linkage is formed by a short chain alkyl
internucleoside linkage. In certain such embodiments, an
internucleoside linkage is formed by a cycloalkyl internucleoside
linkages. In certain such embodiments, an internucleoside linkage
is formed by a mixed heteroatom and alkyl internucleoside linkage.
In certain such embodiments, an internucleoside linkage is formed
by a mixed heteroatom and cycloalkyl internucleoside linkages. In
certain such embodiments, an internucleoside linkage is formed by
one or more short chain heteroatomic internucleoside linkages. In
certain such embodiments, an internucleoside linkage is formed by
one or more heterocyclic internucleoside linkages. In certain such
embodiments, an internucleoside linkage has an amide backbone. In
certain such embodiments, an internucleoside linkage has mixed N,
O, S and CH.sub.2 component parts.
[0384] In certain embodiments, a modified oligonucleotide comprises
one or more modified nucleobases. In certain embodiments, a
modified oligonucleotide comprises one or more 5-methylcytosines.
In certain embodiments, each cytosine of a modified oligonucleotide
comprises a 5-methylcytosine.
[0385] In certain embodiments, a modified nucleobase is selected
from 5-hydroxymethyl cytosine, 7-deazaguanine and 7-deazaadenine.
In certain embodiments, a modified nucleobase is selected from
7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
In certain embodiments, a modified nucleobase is selected from
5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6
substituted purines, including 2 aminopropyladenine,
5-propynyluracil and 5-propynylcytosine.
[0386] In certain embodiments, a modified nucleobase comprises a
polycyclic heterocycle. In certain embodiments, a modified
nucleobase comprises a tricyclic heterocycle. In certain
embodiments, a modified nucleobase comprises a phenoxazine
derivative. In certain embodiments, the phenoxazine can be further
modified to form a nucleobase known in the art as a G-clamp.
Certain Pharmaceutical Compositions
[0387] Provided herein are pharmaceutical compositions comprising
oligonucleotides. In certain embodiments, such pharmaceutical
compositions are used for the treatment of metabolic disorders, and
associated conditions. In certain embodiments, a pharmaceutical
composition provided herein comprises a compound comprising a
modified oligonucleotide consisting of 8 to 30 linked nucleosides
and having a nucleobase sequence complementary miR-21, or a
precursor thereof. In certain embodiments, a pharmaceutical
composition provided herein comprises a compound consisting of a
modified oligonucleotide consisting of 8 to 30 linked nucleosides
and having a nucleobase sequence complementary to miR-21, or a
precursor thereof.
[0388] Suitable administration routes include, but are not limited
to, oral, rectal, transmucosal, intestinal, enteral, topical,
suppository, through inhalation, intrathecal, intracardiac,
intraventricular, intraperitoneal, intranasal, intraocular,
intratumoral, and parenteral (e.g., intravenous, intramuscular,
intramedullary, and subcutaneous). In certain embodiments,
pharmaceutical intrathecals are administered to achieve local
rather than systemic exposures. For example, pharmaceutical
compositions may be injected directly in the area of desired effect
(e.g., into the liver).
[0389] In certain embodiments, a pharmaceutical composition is
administered in the form of a dosage unit (e.g., tablet, capsule,
bolus, etc.). In some embodiments, a pharmaceutical compositions
comprises a modified oligonucleotide at a dose within a range
selected from 25 mg to 800 mg, 25 mg to 700 mg, 25 mg to 600 mg, 25
mg to 500 mg, 25 mg to 400 mg, 25 mg to 300 mg, 25 mg to 200 mg, 25
mg to 100 mg, 100 mg to 800 mg, 200 mg to 800 mg, 300 mg to 800 mg,
400 mg to 800 mg, 500 mg to 800 mg, 600 mg to 800 mg, 100 mg to 700
mg, 150 mg to 650 mg, 200 mg to 600 mg, 250 mg to 550 mg, 300 mg to
500 mg, 300 mg to 400 mg, and 400 mg to 600 mg. In certain
embodiments, such pharmaceutical compositions comprise a modified
oligonucleotide in a dose selected from 25 mg, 30 mg, 35 mg, 40 mg,
45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90
mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg,
135 mg, 140 mg, 145 mg, 150 mg, 155 mg, 160 mg, 165 mg, 170 mg, 175
mg, 180 mg, 185 mg, 190 mg, 195 mg, 200 mg, 205 mg, 210 mg, 215 mg,
220 mg, 225 mg, 230 mg, 235 mg, 240 mg, 245 mg, 250 mg, 255 mg, 260
mg, 265 mg, 270 mg, 270 mg, 280 mg, 285 mg, 290 mg, 295 mg, 300 mg,
305 mg, 310 mg, 315 mg, 320 mg, 325 mg, 330 mg, 335 mg, 340 mg, 345
mg, 350 mg, 355 mg, 360 mg, 365 mg, 370 mg, 375 mg, 380 mg, 385 mg,
390 mg, 395 mg, 400 mg, 405 mg, 410 mg, 415 mg, 420 mg, 425 mg, 430
mg, 435 mg, 440 mg, 445 mg, 450 mg, 455 mg, 460 mg, 465 mg, 470 mg,
475 mg, 480 mg, 485 mg, 490 mg, 495 mg, 500 mg, 505 mg, 510 mg, 515
mg, 520 mg, 525 mg, 530 mg, 535 mg, 540 mg, 545 mg, 550 mg, 555 mg,
560 mg, 565 mg, 570 mg, 575 mg, 580 mg, 585 mg, 590 mg, 595 mg, 600
mg, 605 mg, 610 mg, 615 mg, 620 mg, 625 mg, 630 mg, 635 mg, 640 mg,
645 mg, 650 mg, 655 mg, 660 mg, 665 mg, 670 mg, 675 mg, 680 mg, 685
mg, 690 mg, 695 mg, 700 mg, 705 mg, 710 mg, 715 mg, 720 mg, 725 mg,
730 mg, 735 mg, 740 mg, 745 mg, 750 mg, 755 mg, 760 mg, 765 mg, 770
mg, 775 mg, 780 mg, 785 mg, 790 mg, 795 mg, and 800 mg. In certain
such embodiments, a pharmaceutical composition of the comprises a
dose of modified oligonucleotide selected from 25 mg, 50 mg, 75 mg,
100 mg, 150 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 500 mg, 600
mg, 700 mg, and 800 mg.
[0390] In certain embodiments, a pharmaceutical agent is sterile
lyophilized modified oligonucleotide that is reconstituted with a
suitable diluent, e.g., sterile water for injection or sterile
saline for injection. The reconstituted product is administered as
a subcutaneous injection or as an intravenous infusion after
dilution into saline. The lyophilized drug product consists of a
modified oligonucleotide which has been prepared in water for
injection, or in saline for injection, adjusted to pH 7.0-9.0 with
acid or base during preparation, and then lyophilized. The
lyophilized modified oligonucleotide may be 25-800 mg of an
oligonucleotide. It is understood that this encompasses 25, 50, 75,
100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 425,
450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750,
775, and 800 mg of modified lyophilized oligonucleotide. Further,
in some embodiments, the lyophilized modified oligonucleotide is an
amount of an oligonucleotide within a range selected from 25 mg to
800 mg, 25 mg to 700 mg, 25 mg to 600 mg, 25 mg to 500 mg, 25 mg to
400 mg, 25 mg to 300 mg, 25 mg to 200 mg, 25 mg to 100 mg, 100 mg
to 800 mg, 200 mg to 800 mg, 300 mg to 800 mg, 400 mg to 800 mg,
500 mg to 800 mg, 600 mg to 800 mg, 100 mg to 700 mg, 150 mg to 650
mg, 200 mg to 600 mg, 250 mg to 550 mg, 300 mg to 500 mg, 300 mg to
400 mg, and 400 mg to 600 mg. The lyophilized drug product may be
packaged in a 2 mL Type I, clear glass vial (ammonium
sulfate-treated), stoppered with a bromobutyl rubber closure and
sealed with an aluminum FLIP-OFF.RTM. overseal.
[0391] In certain embodiments, the pharmaceutical compositions
provided herein may additionally contain other adjunct components
conventionally found in pharmaceutical compositions, at their
art-established usage levels. Thus, for example, the compositions
may contain additional, compatible, pharmaceutically-active
materials such as, for example, antipruritics, astringents, local
anesthetics or anti-inflammatory agents, or may contain additional
materials useful in physically formulating various dosage forms of
the compositions of the present invention, such as dyes, flavoring
agents, preservatives, antioxidants, opacifiers, thickening agents
and stabilizers. However, such materials, when added, should not
unduly interfere with the biological activities of the components
of the compositions of the present invention. The formulations can
be sterilized and, if desired, mixed with auxiliary agents, e.g.,
lubricants, preservatives, stabilizers, wetting agents,
emulsifiers, salts for influencing osmotic pressure, buffers,
colorings, flavorings and/or aromatic substances and the like which
do not deleteriously interact with the oligonucleotide(s) of the
formulation.
[0392] Lipid moieties have been used in nucleic acid therapies in a
variety of methods. In one method, the nucleic acid is introduced
into preformed liposomes or lipoplexes made of mixtures of cationic
lipids and neutral lipids. In another method, DNA complexes with
mono- or poly-cationic lipids are formed without the presence of a
neutral lipid. In certain embodiments, a lipid moiety is selected
to increase distribution of a pharmaceutical agent to a particular
cell or tissue. In certain embodiments, a lipid moiety is selected
to increase distribution of a pharmaceutical agent to fat tissue.
In certain embodiments, a lipid moiety is selected to increase
distribution of a pharmaceutical agent to muscle tissue.
[0393] In certain embodiments, INTRALIPID is used to prepare a
pharmaceutical composition comprising an oligonucleotide.
Intralipid is fat emulsion prepared for intravenous administration.
It is made up of 10% soybean oil, 1.2% egg yolk phospholipids,
2.25% glycerin, and water for injection. In addition, sodium
hydroxide has been added to adjust the pH so that the final product
pH range is 6 to 8.9.
[0394] In certain embodiments, a pharmaceutical composition
provided herein comprises a polyamine compound or a lipid moiety
complexed with a nucleic acid. In certain embodiments, such
preparations comprise one or more compounds each individually
having a structure defined by formula (Z) or a pharmaceutically
acceptable salt thereof,
##STR00004##
[0395] wherein each X.sup.a and X.sup.b, for each occurrence, is
independently C.sub.1-6 alkylene; n is 0, 1, 2, 3, 4, or 5; each R
is independently H, wherein at least n+2 of the R moieties in at
least about 80% of the molecules of the compound of formula (Z) in
the preparation are not H; m is 1, 2, 3 or 4; Y is O, NR.sup.2, or
S; R.sup.1 is alkyl, alkenyl, or alkynyl; each of which is
optionally substituted with one or more substituents; and R.sup.2
is H, alkyl, alkenyl, or alkynyl; each of which is optionally
substituted each of which is optionally substituted with one or
more substituents; provided that, if n=0, then at least n+3 of the
R moieties are not H. Such preparations are described in PCT
publication WO/2008/042973, which is herein incorporated by
reference in its entirety for the disclosure of lipid preparations.
Certain additional preparations are described in Akinc et al.,
Nature Biotechnology 26, 561-569 (1 May 2008), which is herein
incorporated by reference in its entirety for the disclosure of
lipid preparations.
[0396] In certain embodiments, pharmaceutical compositions provided
herein comprise one or more modified oligonucleotides and one or
more excipients. In certain such embodiments, excipients are
selected from water, salt solutions, alcohol, polyethylene glycols,
gelatin, lactose, amylase, magnesium stearate, talc, silicic acid,
viscous paraffin, hydroxymethylcellulose and
polyvinylpyrrolidone.
[0397] In certain embodiments, a pharmaceutical composition
provided herein is prepared using known techniques, including, but
not limited to mixing, dissolving, granulating, dragee-making,
levigating, emulsifying, encapsulating, entrapping or tableting
processes.
[0398] In certain embodiments, a pharmaceutical composition
provided herein is a liquid (e.g., a suspension, elixir and/or
solution). In certain of such embodiments, a liquid pharmaceutical
composition is prepared using ingredients known in the art,
including, but not limited to, water, glycols, oils, alcohols,
flavoring agents, preservatives, and coloring agents.
[0399] In certain embodiments, a pharmaceutical composition
provided herein is a solid (e.g., a powder, tablet, and/or
capsule). In certain of such embodiments, a solid pharmaceutical
composition comprising one or more oligonucleotides is prepared
using ingredients known in the art, including, but not limited to,
starches, sugars, diluents, granulating agents, lubricants,
binders, and disintegrating agents.
[0400] In certain embodiments, a pharmaceutical composition
provided herein is formulated as a depot preparation. Certain such
depot preparations are typically longer acting than non-depot
preparations. In certain embodiments, such preparations are
administered by implantation (for example subcutaneously or
intramuscularly) or by intramuscular injection. In certain
embodiments, depot preparations are prepared using suitable
polymeric or hydrophobic materials (for example an emulsion in an
acceptable oil) or ion exchange resins, or as sparingly soluble
derivatives, for example, as a sparingly soluble salt.
[0401] In certain embodiments, a pharmaceutical composition
provided herein comprises a delivery system. Examples of delivery
systems include, but are not limited to, liposomes and emulsions.
Certain delivery systems are useful for preparing certain
pharmaceutical compositions including those comprising hydrophobic
compounds. In certain embodiments, certain organic solvents such as
dimethylsulfoxide are used.
[0402] In certain embodiments, a pharmaceutical composition
provided herein comprises one or more tissue-specific delivery
molecules designed to deliver the one or more pharmaceutical agents
of the present invention to specific tissues or cell types. For
example, in certain embodiments, pharmaceutical compositions
include liposomes coated with a tissue-specific antibody.
[0403] In certain embodiments, a pharmaceutical composition
provided herein comprises a co-solvent system. Certain of such
co-solvent systems comprise, for example, benzyl alcohol, a
nonpolar surfactant, a water-miscible organic polymer, and an
aqueous phase. In certain embodiments, such co-solvent systems are
used for hydrophobic compounds. A non-limiting example of such a
co-solvent system is the VPD co-solvent system, which is a solution
of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the
nonpolar surfactant Polysorbate 80.TM. and 65% w/v polyethylene
glycol 300. The proportions of such co-solvent systems may be
varied considerably without significantly altering their solubility
and toxicity characteristics. Furthermore, the identity of
co-solvent components may be varied: for example, other surfactants
may be used instead of Polysorbate 80.TM.; the fraction size of
polyethylene glycol may be varied; other biocompatible polymers may
replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other
sugars or polysaccharides may substitute for dextrose.
[0404] In certain embodiments, a pharmaceutical composition
provided herein comprises a sustained-release system. A
non-limiting example of such a sustained-release system is a
semi-permeable matrix of solid hydrophobic polymers. In certain
embodiments, sustained-release systems may, depending on their
chemical nature, release pharmaceutical agents over a period of
hours, days, weeks or months.
[0405] In certain embodiments, a pharmaceutical composition
provided herein is prepared for oral administration. In certain of
such embodiments, a pharmaceutical composition is formulated by
combining one or more compounds comprising a modified
oligonucleotide with one or more pharmaceutically acceptable
carriers. Certain of such carriers enable pharmaceutical
compositions to be formulated as tablets, pills, dragees, capsules,
liquids, gels, syrups, slurries, suspensions and the like, for oral
ingestion by a subject. In certain embodiments, pharmaceutical
compositions for oral use are obtained by mixing oligonucleotide
and one or more solid excipient. Suitable excipients include, but
are not limited to, fillers, such as sugars, including lactose,
sucrose, mannitol, or sorbitol; cellulose preparations such as, for
example, maize starch, wheat starch, rice starch, potato starch,
gelatin, gum tragacanth, methyl cellulose,
hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose,
and/or polyvinylpyrrolidone (PVP). In certain embodiments, such a
mixture is optionally ground and auxiliaries are optionally added.
In certain embodiments, pharmaceutical compositions are formed to
obtain tablets or dragee cores. In certain embodiments,
disintegrating agents (e.g., cross-linked polyvinyl pyrrolidone,
agar, or alginic acid or a salt thereof, such as sodium alginate)
are added.
[0406] In certain embodiments, dragee cores are provided with
coatings. In certain such embodiments, concentrated sugar solutions
may be used, which may optionally contain gum arabic, talc,
polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or
titanium dioxide, lacquer solutions, and suitable organic solvents
or solvent mixtures. Dyestuffs or pigments may be added to tablets
or dragee coatings.
[0407] In certain embodiments, pharmaceutical compositions for oral
administration are push-fit capsules made of gelatin. Certain of
such push-fit capsules comprise one or more pharmaceutical agents
of the present invention in admixture with one or more filler such
as lactose, binders such as starches, and/or lubricants such as
talc or magnesium stearate and, optionally, stabilizers. In certain
embodiments, pharmaceutical compositions for oral administration
are soft, sealed capsules made of gelatin and a plasticizer, such
as glycerol or sorbitol. In certain soft capsules, one or more
pharmaceutical agents of the present invention are be dissolved or
suspended in suitable liquids, such as fatty oils, liquid paraffin,
or liquid polyethylene glycols. In addition, stabilizers may be
added.
[0408] In certain embodiments, pharmaceutical compositions are
prepared for buccal administration. Certain of such pharmaceutical
compositions are tablets or lozenges formulated in conventional
manner
[0409] In certain embodiments, a pharmaceutical composition is
prepared for administration by injection (e.g., intravenous,
subcutaneous, intramuscular, etc.). In certain of such embodiments,
a pharmaceutical composition comprises a carrier and is formulated
in aqueous solution, such as water or physiologically compatible
buffers such as Hanks's solution, Ringer's solution, or
physiological saline buffer. In certain embodiments, other
ingredients are included (e.g., ingredients that aid in solubility
or serve as preservatives). In certain embodiments, injectable
suspensions are prepared using appropriate liquid carriers,
suspending agents and the like. Certain pharmaceutical compositions
for injection are presented in unit dosage form, e.g., in ampoules
or in multi-dose containers. Certain pharmaceutical compositions
for injection are suspensions, solutions or emulsions in oily or
aqueous vehicles, and may contain formulatory agents such as
suspending, stabilizing and/or dispersing agents. Certain solvents
suitable for use in pharmaceutical compositions for injection
include, but are not limited to, lipophilic solvents and fatty
oils, such as sesame oil, synthetic fatty acid esters, such as
ethyl oleate or triglycerides, and liposomes. Aqueous injection
suspensions may contain substances that increase the viscosity of
the suspension, such as sodium carboxymethyl cellulose, sorbitol,
or dextran. Optionally, such suspensions may also contain suitable
stabilizers or agents that increase the solubility of the
pharmaceutical agents to allow for the preparation of highly
concentrated solutions.
[0410] In certain embodiments, a pharmaceutical composition is
prepared for transmucosal administration. In certain of such
embodiments penetrants appropriate to the barrier to be permeated
are used in the formulation. Such penetrants are generally known in
the art.
[0411] In certain embodiments, a pharmaceutical composition is
prepared for administration by inhalation. Certain of such
pharmaceutical compositions for inhalation are prepared in the form
of an aerosol spray in a pressurized pack or a nebulizer. Certain
of such pharmaceutical compositions comprise a propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In
certain embodiments using a pressurized aerosol, the dosage unit
may be determined with a valve that delivers a metered amount. In
certain embodiments, capsules and cartridges for use in an inhaler
or insufflator may be formulated. Certain of such formulations
comprise a powder mixture of a pharmaceutical agent of the
invention and a suitable powder base such as lactose or starch.
[0412] In certain embodiments, a pharmaceutical composition is
prepared for rectal administration, such as a suppositories or
retention enema. Certain of such pharmaceutical compositions
comprise known ingredients, such as cocoa butter and/or other
glycerides.
[0413] In certain embodiments, a pharmaceutical composition is
prepared for topical administration. Certain of such pharmaceutical
compositions comprise bland moisturizing bases, such as ointments
or creams. Exemplary suitable ointment bases include, but are not
limited to, petrolatum, petrolatum plus volatile silicones, and
lanolin and water in oil emulsions. Exemplary suitable cream bases
include, but are not limited to, cold cream and hydrophilic
ointment.
[0414] In certain embodiments, a pharmaceutical composition
provided herein comprises a modified oligonucleotide in a
therapeutically effective amount. In certain embodiments, the
therapeutically effective amount is sufficient to prevent,
alleviate or ameliorate symptoms of a disease or to prolong the
survival of the subject being treated. Determination of a
therapeutically effective amount is well within the capability of
those skilled in the art.
[0415] In certain embodiments, one or more modified
oligonucleotides provided herein is formulated as a prodrug. In
certain embodiments, upon in vivo administration, a prodrug is
chemically converted to the biologically, pharmaceutically or
therapeutically more active form of an oligonucleotide. In certain
embodiments, prodrugs are useful because they are easier to
administer than the corresponding active form. For example, in
certain instances, a prodrug may be more bioavailable (e.g.,
through oral administration) than is the corresponding active form.
In certain instances, a prodrug may have improved solubility
compared to the corresponding active form. In certain embodiments,
prodrugs are less water soluble than the corresponding active form.
In certain instances, such prodrugs possess superior transmittal
across cell membranes, where water solubility is detrimental to
mobility. In certain embodiments, a prodrug is an ester. In certain
such embodiments, the ester is metabolically hydrolyzed to
carboxylic acid upon administration. In certain instances the
carboxylic acid containing compound is the corresponding active
form. In certain embodiments, a prodrug comprises a short peptide
(polyaminoacid) bound to an acid group. In certain of such
embodiments, the peptide is cleaved upon administration to form the
corresponding active form.
[0416] In certain embodiments, a prodrug is produced by modifying a
pharmaceutically active compound such that the active compound will
be regenerated upon in vivo administration. The prodrug can be
designed to alter the metabolic stability or the transport
characteristics of a drug, to mask side effects or toxicity, to
improve the flavor of a drug or to alter other characteristics or
properties of a drug. By virtue of knowledge of pharmacodynamic
processes and drug metabolism in vivo, those of skill in this art,
once a pharmaceutically active compound is known, can design
prodrugs of the compound (see, e.g., Nogrady (1985) Medicinal
Chemistry A Biochemical Approach, Oxford University Press, New
York, pages 388-392).
Certain Routes of Administration
[0417] In certain embodiments, administering to a subject comprises
parenteral administration. In certain embodiments, administering to
a subject comprises intravenous administration. In certain
embodiments, administering to a subject comprises subcutaneous
administration.
[0418] In certain embodiments, administering to a subject comprises
intraarterial administration. In certain embodiments, administering
to a subject comprises intracardial administration. Suitable means
for intracardial administration include the use of a catheter, or
administration during open heart surgery. In certain embodiments,
administration comprises use of a stent.
[0419] In certain embodiments, administration includes pulmonary
administration. In certain embodiments, pulmonary administration
comprises delivery of aerosolized oligonucleotide to the lung of a
subject by inhalation. Following inhalation by a subject of
aerosolized oligonucleotide, oligonucleotide distributes to cells
of both normal and inflamed lung tissue, including alveolar
macrophages, eosinophils, epithelium, blood vessel endothelium, and
bronchiolar epithelium. A suitable device for the delivery of a
pharmaceutical composition comprising a modified oligonucleotide
includes, but is not limited to, a standard nebulizer device.
Formulations and methods for modulating the size of droplets using
nebulizer devices to target specific portions of the respiratory
tract and lungs are well known to those skilled in the art.
Additional suitable devices include dry powder inhalers or metered
dose inhalers.
[0420] In certain embodiments, pharmaceutical compositions are
administered to achieve local rather than systemic exposures. For
example, pulmonary administration delivers a pharmaceutical
composition to the lung, with minimal systemic exposure.
[0421] Additional suitable administration routes include, but are
not limited to, oral, rectal, transmucosal, intestinal, enteral,
topical, suppository, intrathecal, intraventricular,
intraperitoneal, intranasal, intraocular, intramuscular,
intramedullary, and intratumoral.
Certain Compounds
[0422] Provided herein are compounds comprising a modified
oligonucleotide having certain nucleoside patterns, and uses of
these compounds to modulate the activity, level or expression of a
target nucleic acid. In certain embodiments, the compound comprises
an oligonucleotide. In certain such embodiments, the compound
consists of an oligonucleotide. In certain embodiments, the
oligonucleotide is a modified oligonucleotide. In certain
embodiments, a modified oligonucleotide is complementary to a small
non-coding RNA. In certain embodiments, the small non-coding RNA is
miR-21.
[0423] In certain such embodiments, the compound comprises a
modified oligonucleotide hybridized to a complementary strand, i.e.
the compound comprises a double-stranded oligomeric compound. In
certain embodiments, the hybridization of a modified
oligonucleotide to a complementary strand forms at least one blunt
end. In certain such embodiments, the hybridization of a modified
oligonucleotide to a complementary strand forms a blunt end at each
terminus of the double-stranded oligomeric compound. In certain
embodiments, a terminus of a modified oligonucleotide comprises one
or more additional linked nucleosides relative to the number of
linked nucleosides of the complementary strand. In certain
embodiments, the one or more additional nucleosides are at the 5'
terminus of an oligonucleotide. In certain embodiments, the one or
more additional nucleosides are at the 3' terminus of an
oligonucleotide. In certain embodiments, at least one nucleobase of
a nucleoside of the one or more additional nucleosides is
complementary to the target RNA. In certain embodiments, each
nucleobase of each one or more additional nucleosides is
complementary to the target RNA. In certain embodiments, a terminus
of the complementary strand comprises one or more additional linked
nucleosides relative to the number of linked nucleosides of an
oligonucleotide. In certain embodiments, the one or more additional
linked nucleosides are at the 3' terminus of the complementary
strand. In certain embodiments, the one or more additional linked
nucleosides are at the 5' terminus of the complementary strand. In
certain embodiments, two additional linked nucleosides are linked
to a terminus. In certain embodiments, one additional nucleoside is
linked to a terminus.
[0424] In certain embodiments, the compound comprises a modified
oligonucleotide conjugated to one or more moieties which enhance
the activity, cellular distribution or cellular uptake of the
resulting antisense oligonucleotides. In certain such embodiments,
the moiety is a cholesterol moiety. In certain embodiments, the
moiety is a lipid moiety. Additional moieties for conjugation
include carbohydrates, phospholipids, biotin, phenazine, folate,
phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines,
coumarins, and dyes. In certain embodiments, a conjugate group is
attached directly to an oligonucleotide. In certain embodiments, a
conjugate group is attached to a modified oligonucleotide by a
linking moiety selected from amino, hydroxyl, carboxylic acid,
thiol, unsaturations (e.g., double or triple bonds),
8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl
4-(N-maleimidomethyl)cyclo-hexane-1-carboxylate (SMCC),
6-aminohexanoic acid (AHEX or AHA), substituted C.sub.1-C.sub.10
alkyl, substituted or unsubstituted C.sub.2-C.sub.10 alkenyl, and
substituted or unsubstituted C.sub.2-C.sub.10 alkynyl. In certain
such embodiments, a substituent group is selected from hydroxyl,
amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy,
halogen, alkyl, aryl, alkenyl and alkynyl.
[0425] In certain such embodiments, the compound comprises a
modified oligonucleotide having one or more stabilizing groups that
are attached to one or both termini of a modified oligonucleotide
to enhance properties such as, for example, nuclease stability.
Included in stabilizing groups are cap structures. These terminal
modifications protect a modified oligonucleotide from exonuclease
degradation, and can help in delivery and/or localization within a
cell. The cap can be present at the 5'-terminus (5'-cap), or at the
3'-terminus (3'-cap), or can be present on both termini. Cap
structures include, for example, inverted deoxy abasic caps.
[0426] Suitable cap structures include a 4',5'-methylene
nucleotide, a 1-(beta-D-erythrofuranosyl) nucleotide, a 4'-thio
nucleotide, a carbocyclic nucleotide, a 1,5-anhydrohexitol
nucleotide, an L-nucleotide, an alpha-nucleotide, a modified base
nucleotide, a phosphorodithioate linkage, a threo-pentofuranosyl
nucleotide, an acyclic 3',4'-seco nucleotide, an acyclic
3,4-dihydroxybutyl nucleotide, an acyclic 3,5-dihydroxypentyl
nucleotide, a 3'-3'-inverted nucleotide moiety, a 3'-3'-inverted
abasic moiety, a 3'-2'-inverted nucleotide moiety, a 3'-2'-inverted
abasic moiety, a 1,4-butanediol phosphate, a 3'-phosphoramidate, a
hexylphosphate, an aminohexyl phosphate, a 3'-phosphate, a
3'-phosphorothioate, a phosphorodithioate, a bridging
methylphosphonate moiety, and a non-bridging methylphosphonate
moiety 5'-amino-alkyl phosphate, a 1,3-diamino-2-propyl phosphate,
3-aminopropyl phosphate, a 6-aminohexyl phosphate, a
1,2-aminododecyl phosphate, a hydroxypropyl phosphate, a
5'-5'-inverted nucleotide moiety, a 5'-5'-inverted abasic moiety, a
5'-phosphoramidate, a 5'-phosphorothioate, a 5'-amino, a bridging
and/or non-bridging 5'-phosphoramidate, a phosphorothioate, and a
5'-mercapto moiety.
Certain Additional Therapies
[0427] Treatments for a disease associated with miR-21 may comprise
more than one therapy. As such, in certain embodiments provided
herein are methods for treating a subject having or suspected of
having a disease associated with miR-21 comprising administering at
least one therapy in addition to administering a modified
oligonucleotide having a nucleobase sequence complementary to the
microRNA.
[0428] In certain embodiments, the at least one additional therapy
comprises a pharmaceutical agent.
[0429] In certain embodiments, pharmaceutical agents include
anti-inflammatory agents. In certain embodiments, an
anti-inflammatory agent is a steroidal anti-inflammatory agent. In
certain embodiments, a steroid anti-inflammatory agent is a
corticosteroid. In certain embodiments, a corticosteroid is
prednisone. In certain embodiments, an anti-inflammatory agent is a
non-steroidal anti-inflammatory drugs. In certain embodiments, a
non-steroidal anti-inflammatory agent is ibuprofen, a COX-I
inhibitor, or a COX-2 inhibitor.
[0430] In certain embodiments, pharmaceutical agents include
anti-diabetic agents. Antidiabetic agents include, but are not
limited to, biguanides, glucosidase inhibitors, insulins,
sulfonylureas, and thiazolidenediones.
[0431] In certain embodiments, pharmaceutical agents include, but
are not limited to, diuretics (e.g. sprionolactone, eplerenone,
furosemide), inotropes (e.g. dobutamine, milrinone), digoxin,
vasodilators, angiotensin II converting enzyme (ACE) inhibitors
(e.g. are captopril, enalapril, lisinopril, benazepril, quinapril,
fosinopril, and ramipril), angiotensin II receptor blockers (ARB)
(e.g. candesartan, irbesartan, olmesartan, losartan, valsartan,
telmisartan, eprosartan), calcium channel blockers, isosorbide
dinitrate, hydralazine, nitrates (e.g. isosorbide mononitrate,
isosorbide dinitrate), hydralazine, beta-blockers (e.g. carvedilol,
metoprolol), and natriuretic peptides (e.g. nesiritide).
[0432] In certain embodiments, pharmaceutical agents include
heparinoids. In certain embodiments, a heparinoid is pentosan
polysulfate.
[0433] In certain embodiments, a pharmaceutical agent is a
pharmaceutical agent that blocks one or more responses to
fibrogenic signals.
[0434] In certain embodiments, a pharmaceutical agent is an
anti-connective tissue growth factor therapy. In certain
embodiments, an anti-CTGF therapy is a monoclonal antibody against
CTGF.
[0435] In certain embodiments, an additional therapy may be a
pharmaceutical agent that enhances the body's immune system,
including low-dose cyclophosphamide, thymostimulin, vitamins and
nutritional supplements (e.g., antioxidants, including vitamins A,
C, E, beta-carotene, zinc, selenium, glutathione, coenzyme Q-10 and
echinacea), and vaccines, e.g., the immunostimulating complex
(ISCOM), which comprises a vaccine formulation that combines a
multimeric presentation of antigen and an adjuvant.
[0436] In certain embodiments, the additional therapy is selected
to treat or ameliorate a side effect of one or more pharmaceutical
compositions of the present invention. Such side effects include,
without limitation, injection site reactions, liver function test
abnormalities, renal function abnormalities, liver toxicity, renal
toxicity, central nervous system abnormalities, and myopathies. For
example, increased aminotransferase levels in serum may indicate
liver toxicity or liver function abnormality. For example,
increased bilirubin may indicate liver toxicity or liver function
abnormality.
[0437] Further examples of additional pharmaceutical agents
include, but are not limited to, immunoglobulins, including, but
not limited to intravenous immunoglobulin (IVIg); analgesics (e.g.,
acetaminophen); salicylates; antibiotics; antivirals; antifungal
agents; adrenergic modifiers; hormones (e.g., anabolic steroids,
androgen, estrogen, calcitonin, progestin, somatostan, and thyroid
hormones); immunomodulators; muscle relaxants; antihistamines;
osteoporosis agents (e.g., biphosphonates, calcitonin, and
estrogens); prostaglandins, antineoplastic agents;
psychotherapeutic agents; sedatives; poison oak or poison sumac
products; antibodies; and vaccines.
Certain Kits
[0438] The present invention also provides kits. In some
embodiments, the kits comprise one or more compounds of the
invention comprising a modified oligonucleotide, wherein the
nucleobase sequence of the oligonucleotide is complementary to the
nucleobase sequence of miR-21. The compounds complementary to
miR-21 can have any of the nucleoside patterns described herein. In
some embodiments, the compounds complementary to miR-21 can be
present within a vial. A plurality of vials, such as 10, can be
present in, for example, dispensing packs. In some embodiments, the
vial is manufactured so as to be accessible with a syringe. The kit
can also contain instructions for using the compounds complementary
to miR-21.
[0439] In some embodiments, the kits may be used for administration
of the compound complementary to miR-21 to a subject. In such
instances, in addition to compounds complementary to miR-21, the
kit can further comprise one or more of the following: syringe,
alcohol swab, cotton ball, and/or gauze pad. In some embodiments,
the compounds complementary to miR-21 can be present in a
pre-filled syringe (such as a single-dose syringes with, for
example, a 27 gauge, 1/2 inch needle with a needle guard), rather
than in a vial. A plurality of pre-filled syringes, such as 10, can
be present in, for example, dispensing packs. The kit can also
contain instructions for administering the compounds complementary
to miR-21.
Certain Experimental Models
[0440] In certain embodiments, the present invention provides
methods of using and/or testing modified oligonucleotides of the
present invention in an experimental model. Those having skill in
the art are able to select and modify the protocols for such
experimental models to evaluate a pharmaceutical agent of the
invention.
[0441] Generally, modified oligonucleotides are first tested in
cultured cells. Suitable cell types include those that are related
to the cell type to which delivery of a modified oligonucleotide is
desired in vivo. For example, suitable cell types for the study of
the methods described herein include primary or cultured cells.
[0442] In certain embodiments, the extent to which a modified
oligonucleotide interferes with the activity of miR-21 is assessed
in cultured cells. In certain embodiments, inhibition of microRNA
activity may be assessed by measuring the levels of the microRNA.
Alternatively, the level of a predicted or validated
microRNA-regulated transcript may be measured. An inhibition of
microRNA activity may result in the increase in the
miR-21-regulated transcript, and/or the protein encoded by
miR-21-regulated transcript. Further, in certain embodiments,
certain phenotypic outcomes may be measured.
[0443] Several animal models are available to the skilled artisan
for the study of miR-21 in models of human disease. For example,
inhibitors of miR-21 may be studied in models of cancer, such as
orthotopic xenograft models, toxin-induced cancer models, or
genetically-induced cancer models. In such cancer models, the
studies may be performed to evaluate the effects of inhibitors of
miR-21 on tumor size, tumor number, overall survival and/or
progression-free survival.
[0444] The effects of inhibitors of miR-21 on cardiac function and
fibrosis may be studied in models of transaortic banding or
myocardial infarction, each of which induces abnormal cardiac
function and fibrosis. Models of kidney fibrosis include unilateral
ureteral obstruction and ischemia/reperfusion injury. During early
time points, the kidney ischemia reperfusion injury model may be
used as a model for acute kidney injury, while later time points
serve as a model for kidney fibrosis. Liver fibrosis models are
induced by, for example, carbon tetrachloride intoxication or bile
duct resection. The effects of miR-21 on lung fibrosis may be
studied, for example, in a model of bleomycin-induced pulmonary
fibrosis. Wound healing models are also available to the skilled
artisan, for example the C57Bl/KsJ-db/db mice, which exhibit
several characteristics of adult onset diabetes, such as markedly
delayed wound closure.
Certain Quantitation Assays
[0445] The effects of antisense inhibition of miR-21 following the
administration of modified oligonucleotides may be assessed by a
variety of methods known in the art. In certain embodiments, these
methods are be used to quantitate microRNA levels in cells or
tissues in vitro or in vivo. In certain embodiments, changes in
microRNA levels are measured by microarray analysis. In certain
embodiments, changes in microRNA levels are measured by one of
several commercially available PCR assays, such as the TaqMan.RTM.
MicroRNA Assay (Applied Biosystems). In certain embodiments,
antisense inhibition of miR-21 is assessed by measuring the mRNA
and/or protein level of a target of miR-21. Antisense inhibition of
miR-21 generally results in the increase in the level of mRNA
and/or protein of a target of the microRNA.
Target Engagement Assay
[0446] Modulation of microRNA activity with an anti-miR or microRNA
mimic may be assessed by measuring target engagement. In certain
embodiments, target engagement is measured by microarray profiling
of mRNAs. The sequences of the mRNAs that are modulated (either
increased or decreased) by the anti-miR or microRNA mimic are
searched for microRNA seed sequences, to compare modulation of
mRNAs that are targets of the microRNA to modulation of mRNAs that
are not targets of the microRNA. In this manner, the interaction of
the anti-miR with miR-21, or miR-21 mimic with its targets, can be
evaluated. In the case of an anti-miR, mRNAs whose expression
levels are increased are screened for the mRNA sequences that
comprise a seed match to the microRNA to which the anti-miR is
complementary.
EXAMPLES
[0447] The following examples are presented in order to more fully
illustrate some embodiments of the invention. They should, in no
way be construed, however, as limiting the broad scope of the
invention. Those of ordinary skill in the art will readily adopt
the underlying principles of this discovery to design various
compounds without departing from the spirit of the current
invention.
Example 1
In Vitro Screening of Anti-miR-21 Compounds
[0448] Various anti-miRs targeted to miR-21 and comprising cEt
nucleosides were evaluated for their inhibitory effects on miR-21
activity. As shown in Table A, these compounds varied in length and
in number, type and placement of modified nucleosides. 25919
comprises 2'-MOE and 2'-fluoro nucleosides and is known to inhibit
miR-21, and was thus included as a positive control. The remaining
compounds comprise cEt nucleosides in combination with 2'-MOE
nucleosides and/or .beta.-D-deoxyribonucleosides.
TABLE-US-00009 TABLE A anti-miR-21 compounds Com- SEQ pound ID #
Sequence and chemistry (5' to 3') NO 25919
U.sub.EC.sub.EA.sub.FA.sub.FC.sub.FA.sub.FU.sub.FC.sub.FA.sub.FG.sub-
.FU.sub.FC.sub.EU.sub.EG.sub.EA.sub.FU.sub.FA.sub.FA.sub.FG.sub.FC.sub.FU.-
sub.EA.sub.E 4 25067
T.sub.e.sup.MeCA.sub.SA.sup.MeCA.sub.ST.sup.MeCAG.sub.ST.sup.MeCTGA.-
sub.STAAG.sub.S.sup.MeCTA.sub.e 4 25068
T.sub.E.sup.MeC.sub.EA.sub.EA.sub.EC.sub.SA.sub.ET.sub.EC.sub.SA.sub-
.EG.sub.ET.sub.EC.sub.ST.sub.EG.sub.EA.sub.EU.sub.SA.sub.EA.sub.EG.sub.EC.-
sub.ST.sub.EA.sub.E 4 25070
A.sub.EC.sub.SATC.sub.SAGTC.sub.STGAU.sub.SAAGC.sub.STA.sub.E 3
25071
A.sub.e.sup.MeCA.sub.ST.sup.MeCAG.sub.ST.sup.MeCTGA.sub.STA.sub.SAG.-
sub.S.sup.MeCTA.sub.e 3 25072
A.sub.EC.sub.SA.sub.ET.sub.EC.sub.SA.sub.EG.sub.ET.sub.EC.sub.ST.sub-
.EG.sub.EA.sub.EU.sub.SA.sub.EA.sub.EG.sub.EC.sub.ST.sub.EA.sub.E 3
25077
A.sub.eT.sub.e.sup.MeC.sub.eA.sub.SG.sub.ST.sub.e.sup.MeC.sub.eT.sub-
.eG.sub.SA.sub.ST.sub.eA.sub.eA.sub.SG.sub.S.sup.MeC.sub.eT.sub.eA.sub.e
5 25082
T.sub.E.sup.MeCAAC.sub.SATC.sub.SAGTC.sub.STGAU.sub.SAAGC.sub.STA.su-
b.E 4 25731
A.sub.eT.sub.e.sup.MeC.sub.eA.sub.eG.sub.eT.sub.e.sup.MeC.sub.eT.sub-
.eG.sub.SA.sub.ST.sub.eA.sub.SA.sub.SG.sub.e.sup.MeC.sub.eU.sub.SA.sub.S
5
[0449] In the preceding Table A, nucleosides not followed by a
subscript indicate .beta.-D-deoxyribonucleosides. Nucleosides
followed by a subscript "E" indicate 2'-MOE nucleosides.
Nucleosides followed by a subscript "S" indicate S-cEt nucleosides.
Nucleosides followed by a subscript "F" indicate 2'-fluoro
nucleosides. Each internucleoside linkage is a phosphorothioate
internucleoside linkage. Superscript "Me" indicates a 5-methyl
group on the pyrimidine base of the nucleoside.
[0450] The compounds were assessed for miR-21 inhibitory activity
in a luciferase assay. A microRNA luciferase sensor construct was
engineered using pGL3-MCS2 (Promega). The construct was introduced
into Hela cells to test the ability of anti-miR compounds to
inhibit activity of miR-21. In this assay, miR-21 present in the
Hela cells binds to its cognate site(s) in the luciferase sensor
construct, and suppresses luciferase expression. When the
appropriate anti-miR is introduced into the cells, it binds to
miR-21 and relieves suppression of luciferase expression. Thus, in
this assay anti-miRs that are effective inhibitors of miR-21
expression will cause an increase in luciferase expression.
[0451] Day1:
[0452] Hela cells (ATCC), stably transfected with a luciferase
construct engineered to contain a sequence complementary of miR-21,
were seeded in T-170 flasks (BD Falcon) at 3.5*10.sup.6
cells/flask. Hela cells were grown in Dulbecco's Modified Eagle
Medium with High Glucose (Invitrogen).
[0453] Day 2:
[0454] Each flask of Hela cells was transfected with 0.5 ug of a
phRL sensor plasmid (Promega) expressing Renilla to be used in
normalization. Hela cells were transfected using 20 ul
Lipofectamine 2000/flask (Invitrogen). After 4 hours of
transfection, cells were washed with PBS and trypsinized Hela cells
were plated at 40 k/well in 24 well plates (BD Falcon) and left
overnight.
[0455] Day 3:
[0456] Hela cells were transfected with anti-miRs using Lipofectin
(Invitrogen) at 2.5 ul Lipofectin/100 nM ASO/ml Opti-MEM I Reduced
Serum Medium (Invitrogen) for 4 hours. After ASO transfection, Hela
cells were refed with Dulbecco's Modified Eagle Medium with High
Glucose (Invitrogen).
[0457] Day 4:
[0458] Hela cells are passively lysed and luciferase activity
measured using the Dual-Luciferase Reporter Assay System
(Promega).
[0459] The luciferase assay was performed to test the ability of
anti-miRs with the nucleoside patterns described herein to inhibit
the activity of miR-21. Results were compared to a `mock`
treatment, in which cells received no anti-miR treatment. The
experiment was repeated and results of two experimental replicates
are shown in the following Table B, as the luciferase value
normalized to beta-galactosidase activity.
TABLE-US-00010 TABLE B Inhibitory activity of anti-miR-21 compounds
Concentration of Oligonucleotide Treatment 500 nM 100 nM 20 nM 4 nM
.8 nM .16 nM Mock transfection 39 40 47 50 33 45 25919 202 171 114
84 53 40 25067 42 30 41 43 23 38 25068 122 97 86 64 54 45 25070 165
132 128 99 87 65 25071 42 53 63 50 36 48 25072 143 115 86 76 49 40
25077 40 42 33 45 33 34 25082 202 176 147 112 89 70 25731 59 38 39
32 45 34
[0460] As illustrated in Table B, several cEt-containing compounds
demonstrated inhibition of miR-21 in a dose-dependent manner 25068,
25070, 25072, and 25082.
Example 2
Modified Nucleoside Variations of Anti-miR-21 Compound 25070
[0461] As shown in the preceding Example, 25070 is a potent
inhibitor of miR-21 activity in the luciferase assay. To evaluate
changes in the type of modified nucleoside at various positions of
25070, additional anti-miR-21 compounds were designed as shown in
Table C.
TABLE-US-00011 TABLE C Additional anti-miR-21 compounds Reference
Variation relative # Sequence and Chemistry (5' to 3') to 25070
25070 A.sub.EC.sub.SATC.sub.SAGTC.sub.STGAU.sub.SAAGC.sub.STA.sub.E
None (SEQ ID NO: 3) 25922
A.sub.E.sup.MeC.sub.SAT.sup.MeC.sub.SAGT.sup.MeC.sub.STGAT.sub.SAAG.-
sup.MeC.sub.STA.sub.E Each cytosine is a 5- (SEQ ID NO: 3) methyl
cytosine 25923
A.sub.EC.sub.SATC.sub.SAGTC.sub.STGAU.sub.SAAGC.sub.STA.sub.S
3'-terminal nucleoside is a (SEQ ID NO: 3) cEt nucleoside rather
than 2'-MOE nucleoside 25924
A.sub.E.sup.MeC.sub.SAT.sup.MeC.sub.SAGT.sup.MeC.sub.STGAT.sub.SAAG.-
sup.MeC.sub.STA.sub.S 3'-terminal nucleoside is a (SEQ ID NO: 3)
cEt nucleoside rather than 2'-MOE nucleoside and each cytosine is a
5-methyl cytosine 25116
A.sub.E.sup.MeC.sub.SA.sub.ET.sub.E.sup.MeC.sub.SA.sub.EG.sub.ET.sub-
.E.sup.MeC.sub.ST.sub.EG.sub.EA.sub.E.sup.MeT.sub.SA.sub.EA.sub.EG.sub.E.s-
up.MeC.sub.ST.sub.EA.sub.E Each non-bicyclic (SEQ ID NO: 3)
nucleoside is a 2'-MOE nucleoside and each each cytosine is a
5-methyl cytosine 25117
A.sub.E.sup.MeC.sub.LA.sub.ET.sub.E.sup.MeC.sub.LA.sub.EG.sub.ET.sub-
.E.sup.MeC.sub.LT.sub.EG.sub.EA.sub.E.sup.MeT.sub.LA.sub.EA.sub.EG.sub.E.s-
up.MeC.sub.LT.sub.EA.sub.E Each non-bicyclic (SEQ ID NO: 3)
nucleoside is a 2'-MOE nucleoside and each each cytosine is a
5-methyl cytosine
[0462] In the preceding Table F, nucleosides not followed by a
subscript indicate .beta.-D-deoxyribonucleosides. Nucleosides
followed by a subscript "E" indicate 2'-MOE nucleosides.
Nucleosides followed by a subscript "S" indicate S-cEt nucleosides.
Nucleosides followed by a subscript "F" indicate 2'-fluoro
nucleosides. Each internucleoside linkage is a phosphorothioate
internucleoside linkage. Superscript "Me" indicates a 5-methyl
group on the pyrimidine base of the nucleoside.
[0463] The luciferase assay was performed as described herein to
test the ability of anti-miRs in Table F to inhibit the activity of
miR-21. Results were compared to a `mock` treatment, in which cells
received no anti-miR treatment. The experiment was repeated and
results of two experimental replicates are shown in the following
Table D, as fold change in luciferase value relative to the mock
treatment.
TABLE-US-00012 TABLE D Luciferase assay testing various anti-miR-21
compounds Concentration of anti-miR compound Treatment 50.0 16.7
5.6 1.9 0.6 0.2 25070 11.00 11.28 6.22 1.14 1.01 1.04 25922 11.46
11.60 8.81 1.34 1.10 1.02 25923 10.81 11.34 5.18 1.10 1.01 1.06
25924 8.99 13.01 7.80 1.37 1.25 1.10 25116 1.98 5.64 2.47 1.06 0.98
1.06 25117 2.91 7.36 3.64 1.14 1.15 1.05
[0464] As illustrated in Table D, several cEt-containing compounds
demonstrated inhibition of miR-21 in a dose-dependent manner, in
addition to 25070: 25922, 25923, and 25924. The anti-miR-21
compounds 25116 and 25117, each of which has a sugar modification
at each nucleoside, where each cytosine is a 5-methylcytosine, were
not effective inhibitors of miR-21.
Example 3
Comparison of Nucleoside Patterns Conferring Activity to
Anti-miR-21 Compounds
[0465] To determine the relationship amongst the nucleoside
patterns that conferred activity to anti-miR-21 compounds, the
placement of modified and unmodified nucleosides was compared
across the active anti-miR-21 compounds, which are shown in Table
E.
TABLE-US-00013 TABLE E Active cEt-containing anti-miR-21 compounds
Corresponding SEQ Row in Table Compound ID below # Sequence and
Chemistry (5' to 3') NO 1 25068
T.sub.E.sup.MeC.sub.EA.sub.EA.sub.EC.sub.SA.sub.ET.sub.EC.sub.SA.s-
ub.EG.sub.ET.sub.EC.sub.ST.sub.EG.sub.EA.sub.EU.sub.SA.sub.EA.sub.EG.sub.E-
C.sub.ST.sub.EA.sub.E 4 2 25070
A.sub.EC.sub.SATC.sub.SAGTC.sub.STGAU.sub.SAAGC.sub.STA.sub.E 3 3
25072
A.sub.EC.sub.SA.sub.ET.sub.EC.sub.SA.sub.EG.sub.ET.sub.EC.sub.ST.s-
ub.EG.sub.EA.sub.EU.sub.SA.sub.EA.sub.EG.sub.EC.sub.ST.sub.EA.sub.E
3 4 25082
T.sub.E.sup.MeCAAC.sub.SATC.sub.SAGTC.sub.STGAU.sub.SAAGC.sub.STA.-
sub.E 4 5 25922
A.sub.E.sup.MeC.sub.SAT.sup.MeC.sub.SAGT.sup.MeC.sub.STGAT.sub.SAA-
G.sup.MeC.sub.STA.sub.E 3 6 25923
A.sub.EC.sub.SATC.sub.SAGTC.sub.STGAU.sub.SAAGC.sub.STA.sub.S 3 7
25924
A.sub.E.sup.MeC.sub.SAT.sup.MeC.sub.SAGT.sup.MeC.sub.STGAT.sub.SAA-
G.sup.MeC.sub.STA.sub.S 3
TABLE-US-00014 TABLE F Aligned structures of active cEt-containing
anti-miR-21 compounds Nucleobase and sugar moiety 1 T.sub.E
.sup.MeC.sub.E A.sub.E A.sub.E C.sub.S A.sub.E T.sub.E C.sub.S
A.sub.E G.sub.E T.sub.E C.sub.S T.sub.E G.sub.E A.sub.E U.sub.S
A.sub.E A.sub.E G.sub.E C.sub.S T.sub.E A.sub.E 2 A.sub.E C.sub.S A
T C.sub.S A G T C.sub.S T G A U.sub.S A A G C.sub.S T A.sub.E 3
A.sub.E C.sub.S A.sub.E T.sub.E C.sub.S A.sub.E G.sub.E T.sub.E
C.sub.S T.sub.E G.sub.E A.sub.E U.sub.S A.sub.E A.sub.E G.sub.E
C.sub.S T.sub.E A.sub.E 4 T.sub.E .sup.MeC A A C.sub.S A T C.sub.S
A G T C.sub.S T G A U.sub.S A A G C.sub.S T A.sub.E 5 A.sub.E
.sup.MeC.sub.S A T .sup.MeC.sub.S A G T .sup.MeC.sub.S T G A
U.sub.S A A G .sup.MeC.sub.S T A.sub.E 6 A.sub.E C.sub.S A T
C.sub.S A G T C.sub.S T G A U.sub.S A A G C.sub.S T A.sub.S 7
A.sub.E .sup.MeC.sub.S A T .sup.MeC.sub.S A G T .sup.MeC.sub.S T G
A T.sub.S A A G .sup.MeC.sub.S T A.sub.S
[0466] The comparison of the placement of modified and unmodified
nucleosides (Table F above) revealed certain nucleoside patterns
that were common to each highly active anti-miR-21 compound.
[0467] For example, a comparison of the structure at the
5'-terminus of each compound revealed a region that ranges in
length from 1 to 4 nucleosides, each of which is non-bicyclic
nucleoside (Column `R` in Table G below). The next region has one
bicyclic nucleoside, followed by two non-bicyclic nucleosides,
followed by one bicyclic nucleoside (Column `1` in Table G
below).
[0468] Next follows a repeating block of four nucleosides, three
non-bicyclic nucleosides followed by one bicyclic nucleoside, and
this block of four nucleosides occurs a total of three times
(Column `2` in Table G below).
[0469] In each active anti-miR-21 the two 3'-terminal nucleosides
are non-bicyclic nucleosides (Column `T` in Table G below).
TABLE-US-00015 TABLE G Nucleoside pattern structure Region R 1 2 T
Nucleoside N.sup.Q N.sup.B-N.sup.Q-N.sup.Q-N.sup.B
(N.sup.Q-N.sup.Q-N.sup.Q-N.sup.B).sub.3 N.sup.Q-N.sup.Z Type Length
of 1 to 4
[0470] This nucleoside pattern is represented by the following
formula I, in the 5' to 3' orientation:
(R).sub.X-N.sup.B-N.sup.Q-N.sup.Q-N.sup.B-(N.sup.Q-N.sup.Q-N.sup.Q-N.sup-
.B).sub.3-N.sup.Q-N.sup.Z [0471] wherein each R is a non-bicyclic
nucleoside; X is from 0 to 4; [0472] each N.sup.B is a bicyclic
nucleoside; [0473] each N.sup.Q is a non-bicyclic nucleoside; and
[0474] each N.sup.Z is a modified nucleoside.
[0475] This formula encompasses each of the nucleoside patterns of
the active anti-miR-21 compounds 25068, 25070, 25072, 25082, 25922,
25923, and 25924, demonstrating that nucleoside pattern I yields an
active anti-miR activity, with a flexibility allowed in the choice
of bicyclic nucleoside, non-bicyclic nucleoside, and modified
nucleoside. Accordingly, provided herein are compositions
comprising modified oligonucleotides having nucleobase
complementarity to miR-21 and a nucleoside pattern described by
formula I.
[0476] To determine the relationship amongst the nucleoside
patterns that conferred activity to the active anti-miR-21
compounds that are 19 linked nucleosides in length, the placement
of modified and unmodified nucleosides was compared across all of
the highly active compounds, which are shown in Table H. To
illustrate the similar placement of certain nucleosides, the
compounds are shown again in Table I.
TABLE-US-00016 TABLE H Active anti-miR-21 compounds Corresponding
SEQ Row in Table Compound Sequence and Chemistry ID I # (5' to 3')
NO: 1 25070
A.sub.EC.sub.SATC.sub.SAGTC.sub.STGAU.sub.SAAGC.sub.STA.sub.E 3 3
25922
A.sub.E.sup.MeC.sub.SAT.sup.MeC.sub.SAGT.sup.MeC.sub.STGAT.sub.SAA-
G.sup.MeC.sub.STA.sub.E 3 4 25923
A.sub.EC.sub.SATC.sub.SAGTC.sup.STGAU.sub.SAAGC.sub.STA.sub.S 3 5
25924
AE.sup.MeC.sub.SAT.sup.MeC.sub.SAGT.sup.MeC.sub.STGAT.sub.SAAG.sup-
.MeC.sub.STA.sub.S 3 2 25072
A.sub.EC.sub.SA.sub.ET.sub.EC.sub.SA.sub.EG.sub.ET.sub.EC.sub.ST.s-
ub.EG.sub.EA.sub.EU.sub.SA.sub.EA.sub.EG.sub.EC.sub.ST.sub.EA.sub.E
3
TABLE-US-00017 TABLE I Alignment of nucleosides of active
anti-miR-21 compounds shown in Table H Nucleobase and sugar moiety
1 A.sub.E C.sub.S A T C.sub.S A G T C.sub.S T G A U.sub.S A A G
C.sub.S T A.sub.E 2 A.sub.E C.sub.S A.sub.E T.sub.E C.sub.S A.sub.E
G.sub.E T.sub.E C.sub.S T.sub.E G.sub.E A.sub.E U.sub.S A.sub.E
A.sub.E G.sub.E C.sub.S T.sub.E A.sub.E 3 A.sub.E .sup.MeC.sub.S A
T .sup.MeC.sub.S A G T .sup.MeC.sub.S T G A U.sub.S A A G
.sup.MeC.sub.S T A.sub.E 4 A.sub.E C.sub.S A T C.sub.S A G T
C.sub.S T G A U.sub.S A A G C.sub.S T A.sub.S 5 A.sub.E
.sup.MeC.sub.S A T .sup.MeC.sub.S A G T .sup.MeC.sub.S T G A
T.sub.S A A G .sup.MeC.sub.S T A.sub.S
[0477] The comparison of the placement of modified and unmodified
nucleosides (Table I above) revealed certain nucleoside patterns
that were common to each highly active anti-miR-21 compound that is
19 linked nucleosides in length.
[0478] For example, a comparison of the structures at the
5'-terminus of each compound revealed one modified nucleoside,
which is not a bicyclic nucleoside (Column `N.sup.M` in Table J
below). The next region has one bicyclic nucleoside, followed by
two non-bicyclic nucleosides, followed by one bicyclic nucleoside
(Column `1` in Table J below).
[0479] Next follows a repeating block of four nucleosides, three
non-bicyclic nucleosides followed by one bicyclic nucleoside, and
this block of four nucleosides occurs a total of three times
(Column `2` in Table J below).
[0480] In each active anti-miR-21 the next-to-last nucleoside at
the 3'-terminus is an unmodified nucleoside (Column `N` in Table J
below). The nucleoside at the 3' terminus, which is complementary
to the nucleobase at position 1 of miR-21, is a modified nucleoside
(Column `N.sup.Z` in Table J below).
TABLE-US-00018 TABLE J Nucleoside Pattern Similarities Region
N.sup.M 1 2 N N.sup.Z Nucleoside N.sup.M
N.sup.B-N.sup.Q-N.sup.Q-N.sup.B
(N.sup.Q-N.sup.Q-N.sup.Q-N.sup.B).sub.3 N.sup.Q N.sup.Z Type
[0481] This nucleoside pattern is represented by the following
formula II, in the 5' to 3' orientation:
N.sup.M-N.sup.B-N.sup.Q-N.sup.Q-N.sup.B-(N.sup.Q-N.sup.Q-N.sup.Q-N.sup.B-
).sub.3-N.sup.Q-N.sup.Z [0482] wherein N.sup.M is a modified
nucleoside that is not a bicyclic nucleoside; [0483] each N.sup.B
is a bicyclic nucleoside; [0484] each N.sup.Q is a non-bicyclic
nucleoside; and [0485] N.sup.Z is a modified nucleoside.
[0486] The data provided herein demonstrate that this nucleoside
pattern confers activity to an anti-miR-21 compound, and further
that the activity of the compound is maintained with a variety of
modified nucleosides. Accordingly, provided herein are compositions
comprising a modified oligonucleotide having a nucleobase sequence
complementary to miR-21 and a nucleoside pattern of formula II.
[0487] Similar analyses were conducted with the group of
anti-miR-21 compounds, include 25211 and 25220. As a result of the
foregoing analyses, formulas III to V were established.
Example 2
Inhibition of miR-21 in a Model of Kidney Fibrosis
[0488] Unilateral ureteral obstruction (UUO) is a well-established
experimental model of renal injury leading to interstitial
fibrosis, and thus is used as an experimental model that is
reflective of human kidney disease. UUO is induced by surgically
ligating a single ureter. As fibrosis is characterized by an
increase in collagen, the presence and extent of kidney fibrosis
may be determined by measuring collagen content. Both collagen 1A1
(Col 1A1) and collagen 3A1 (Col 3A1) are measured to assess
collagen content. Kidney fibrosis may be visualized by staining
tissue samples with picro-sirius red to detect increases in
collagen content. Kidney fibrosis may also be observed by measuring
the amount of hydroxyproline, which is a major component of
collagen, in a sample.
[0489] The cEt-containing anti-miR-21 compounds found to be active
in the luciferase assay were tested in the UUO model of kidney
fibrosis. 25919 comprising 2'-MOE and 2'-fluoro modifications is
known to inhibit miR-21 activity in vivo and was included as a
positive control. Groups of 8 animals each were treated as follows:
UUO only, UUO with PBS, or UUO with anti-miR-21 compound. Relative
to the day of the UUO procedure, PBS or anti-miR-21 compound was
administered at days -3, -1, and +5. Anti-miR-21 compounds were
administered at a dose of 20 mg/kg. As the anti-miR compounds were
administered prior to the UUO procedure, this dosing regimen is
considered a prophylactic treatment. At day 11, animals were
sacrificed and kidney was isolated for measurement of collagen
expression. Collagen expression was measured by real-time PCR and
normalized first to GAPDH and then to the sham control animals.
Collagen 1A1 and collagen 3A1 expression are shown in Table K
below.
TABLE-US-00019 TABLE K Several anti-miR-21 compounds reduce
collagen expression in the UUO model Collagen Collagen 1A1 3A1
Treatment (Normalized (Normalized Group Animal # Expression) Mean
Expression) Mean Sham 1 0.5 0.9 0.5 1.3 2 0.9 0.9 3 1.1 1.1 4 0.5
0.6 5 0.7 0.7 6 0.7 0.9 7 1.3 4.1 8 1.6 1.5 UUO-PBS 1 96.9 114.9
52.5 87.2 2 108.4 67.0 3 115.0 78.6 4 102.0 91.0 5 103.1 88.4 6
144.5 117.4 7 134.3 103.4 8 115.0 99.3 UUO-25068 1 84.7 96.4 64.8
60.6 2 75.1 56.2 3 85.5 47.4 4 89.1 76.2 5 90.4 57.0 6 125.8 63.0 7
124.4 59.6 UUO-25070 1 67.7 81.0 36.4 55.5 2 97.7 75.6 3 88.8 47.3
4 95.9 55.5 5 71.4 63.3 6 44.5 28.5 7 73.0 64.2 8 109.4 72.9
UUO-25072 1 96.2 113.8 69.4 65.5 2 85.7 54.5 3 127.4 58.8 4 100.0
69.2 5 159.2 93.8 6 120.5 65.8 7 108.0 46.9 UUO-25082 1 122.2 91.7
62.9 59.1 2 188.3 78.9 3 102.5 82.2 4 67.6 43.8 5 40.6 32.6 6 44.1
34.3 7 73.8 75.8 8 94.7 62.5 UUO-25919 1 150.2 86.6 67.1 56.9 2
54.2 33.9 3 84.6 87.6 4 67.7 47.3 5 78.7 67.7 6 62.2 46.7 7 89.2
47.0 8 106.2 57.8
[0490] This study was repeated 2 to 3 times with each of the above
treatment groups. A meta-analysis of the studies revealed that
25070 treatment exhibited the greatest potency as judged by
collagen expression, resulting in a 40% inhibition of collagen 1A1
and a 30% inhibition of collagen 3A1. 25068 was also active in
reducing collagen expression, but to a lesser extent than 25070.
25072 and 25082, while active inhibitors of miR-21 in the in vitro
tests described herein, did not consistently demonstrate a
reduction in collagen expression.
[0491] The UUO study was repeated to confirm the activity of 25070.
The anti-miR was administered subcutaneously at a dose of 20 mg/kg.
The results in Table L below confirm that 25070 is a potent
inhibitor of collagen 1A1 and collagen 3A1 expression.
TABLE-US-00020 TABLE L Prophylactic administration of 25070 reduces
collagen expression in the UUO model Collagen Collagen 1A1 3A1
(Normalized (Normalized Treatment Animal Expression) Mean
Expression) Mean Sham 1 1.0 1.0 0.7 1.3 2 1.3 0.8 3 1.0 2.9 4 0.8
0.6 UUO-PBS 1 102.7 74.3 64.5 58.8 2 76.3 61.9 3 76.5 79.5 4 53.4
61.3 5 88.8 44.8 6 70.7 44.4 7 58.8 53.3 8 67.4 60.6 UUO-25070 1
13.9 30.2 34.9 42.4 20 mg/kg SC 2 9.2 47.4 3 32.3 25.3 4 57.2 38.0
5 47.6 47.9 6 26.1 54.3 7 35.0 56.1 8 20.4 35.2
[0492] The comparison of the UUO studies revealed 25070 as a highly
potent inhibitor of collagen expression in the UUO model, thus
25070 is a candidate therapeutic agent for the treatment of
fibrosis, including kidney fibrosis.
Example 3
Comparison of Anti-miR-21 to an Angiotensin Receptor Blocker
[0493] The angiotensin receptor blocker irbesartan has been shown
to block the formation of tubulointerstitial fibrosis in a model of
chronic renal injury characterized by fibrosis. The effects of
25070 were compared to irbesartan in the UUO model of fibrosis.
[0494] Control treatment groups included UUO only (sham) and UUO
with PBS administered subcutaneously. An additional control group
included UUO with Tween-MC/20 carrier perorally. 25070 administered
subcutaneously at dose of 20 mg/kg at 5 days prior to, 2 days prior
to, and 3 days after, the UUO procedure. Irbesartan was
administered perorally on daily on days 0 through 7 following the
UUO procedure. Animals were sacrificed on Day 10 following the UUO
procedure. Kidney tissue was collected for measurement of collagen
1A1 and collagen 3A1 expression. The results are shown in Table M
below, and illustrate a statistically significant reduction
(p<0.05 by one-way ANOVA) in Col1A1 expression in the
25070-treated animals, relative to saline-treated animals.
Irbesartan did not yield a statistically significant reduction in
Col1A1 expression. Both irbesartan and 25070 produced statistically
significant reductions in Col3a1 expression, with 25070 producing a
greater reduction compared to irbesartan.
TABLE-US-00021 TABLE M 25070 reduces collagen expression to a
greater extent than irbesartan in the UUO model Collagen 1A1
Collagen 3A1 Animal (Normalized (Normalized Group # Expression)
Mean Expression) Mean Sham 1 1.1 1.0 0.9 1.1 2 0.8 0.6 3 0.9 1.6 4
1.4 1.1 UUO-PBS 1 112.5 129.6 92.1 93.2 (s.c.) 2 167.2 97.9 3 179.0
85.6 4 93.1 95.5 5 151.7 66.3 6 87.1 71.3 7 117.5 142.4 8 129.1
94.9 UUO + 25070 1 87.5 64.2 38.6 53.7 (20 mg/kg s.c.) 2 67.4 56.9
3 22.2 77.2 4 61.9 50.7 5 42.0 76.4 6 69.2 49.7 7 68.4 44.3 8 95.2
35.9 UUO- 1 272.9 150.2 248.0 132.4 Tween/MC 2 127.9 180.4 vehicle
(PO) 3 108.4 142.8 4 101.1 57.1 5 125.0 108.5 6 304.2 186.2 7 119.9
88.6 8 42.4 47.5 UUO- 1 125.4 117.8 65.5 73.2 Irbesartan 2 86.7 (no
sample) (PO) 3 106.6 63.8 4 110.7 63.2 5 198.3 50.8 6 92.2 63.6 7
118.1 82.8 8 104.1 122.5
[0495] An additional indicator of fibrosis is the percentage of
kidney tissue that exhibits collagen expression following the UUO
procedure. Accordingly, kidney tissue was also collected for
histological analysis, to assess the fraction of kidney tissue that
exhibits increased collagen expression; the results are in Table N
below. The `collagen area fraction` is measured histologically
through quantitative image processing of the area of kidney tissue
that is stained red by the picrosirius red stain; the percent
detected as red is normalized by the area of kidney section. As the
tissue sections were analyzed in a blinded fashion, while the
samples in Tables M and N are from the same study, the numbering of
the samples in Table N below does not necessarily correspond to the
numbering of samples in Table M above.
TABLE-US-00022 TABLE N 25070 reduces collagen expression to a
greater extent than irbesartan in the UUO model (not the Collagen
same as Area numbers Fraction Group as PCR) (%) Mean Sham 1 1.419
1.5 2 1.178 3 1.615 4 1.675 UUO-PBS 1 12.988 11.1 (s.c.) 2 17.691 3
12.55 4 9.99 5 8.828 6 9.394 7 9.491 8 7.49 UUO + 25070 1 7.632 8.0
(20 mg/kg s.c.) 2 9.937 3 8.015 4 6.611 5 6.319 6 11.272 7 6.803 8
7.405 UUO- 1 10.587 8.0 Tween/MC 2 8.499 vehicle (PO) 3 11.339 4
3.244 5 2.954 6 8.748 7 9.5 8 9.29 UUO- 1 6.105 8.0 Irbesartan 2
7.481 (PO) 3 15.877 4 7.914 5 6.614 6 5.706 7 7.798 8 6.154
[0496] These results demonstrate that inhibition of miR-21 with
25070 inhibits collagen expression with greater activity than
irbesartan, further confirming that 25070 is a candidate agent for
the treatment, prevention and/or amelioration of fibrosis.
Example 4
Inhibition of miR-21 in Model of Ischemia/Reperfusion Injury
[0497] A model of ischemia reperfusion injury (IRI) is created in
the mouse through unilateral or bilateral clamping of kidney
arteries, which leads to tubule damage, inflammation, and fibrosis.
Kidney dysfunction can occur either early (<5 days) or late
(>7 days) in this model, with the early time points useful to
test candidate agents for the treatment of acute kidney injury, and
the later time points useful to model chronic fibrosis.
[0498] Anti-miR-21 compounds were tested in the unilateral IRI
model. Unilateral IRI was induced for a period of 30 minutes.
Treatment groups were as follows: sham IRI procedure; IRI with PBS
administered subcutaneously; IRI with anti-miR-21 compound 25070
administered intraperitoneally at a dose of 20 mg/kg; the
2'-fluoro/2'-MOE modified anti-miR-21 25919 administered
intraperitoneally at a dose of 20 mg/kg; and a 2'-fluoro/2'
modified mismatch anti-miR-21 (having three mismatches to the
sequence of miR-21) 25319 administered intraperitoneally at a dose
of 20 mg/kg. PBS or anti-miR compound was administered on days 5,
6, and 7 following IRI, and animals were sacrificed 14 days after
IRI. As anti-miR compound is administered 5 days following the
injury to the kidney, or later, when fibrosis has already occurred
to some extent, this treatment regimen is considered a therapeutic
regimen, rather than a prophylactic regimen.
[0499] Kidney tissue was collected for analysis of collagen 1A1 and
collagen 3A1 expression (shown in Table 0), and collagen area
fraction (shown in Table P). The `collagen area fraction` was
analyzed in a blinded fashion, while the samples in Tables 0 and P
are from the same study, the numbering of the samples in Table 0
does not correspond to the numbering of samples in Table P. A
sample processing error prevented collagen area fraction from being
analyzed for the anti-miR-21 mismatch control treatment, thus
results for this treatment group are presented only for collagen
1A1 and collagen 3A1 expression. In this study, 25070 produced a
statistically significant reduction in colleen area fraction.
TABLE-US-00023 TABLE O 25070 reduces collagen expression in the IRI
model with dosing on days 5, 6, and 7 Collagen 1A1 Collagen 3A1
(Normalized (Normalized Group Animal # Expression) Mean Expression)
Mean Sham 1 2.1 1.1 2.6 1.1 2 1.1 1.0 3 0.7 0.7 4 0.7 0.7 5 1.0 0.7
6 0.7 0.9 7 0.9 1.0 8 1.3 1.3 IRI-PBS 1 83.5 85.1 64.9 63.9 2 34.8
29.4 3 79.0 61.9 4 74.5 46.6 5 102.3 61.9 6 128.6 99.5 7 92.9 82.8
IRI-25319 1 155.8 92.3 119.5 79.3 (MM) 2 181.2 209.9 3 33.4 29.0 4
34.7 18.9 5 81.8 74.7 6 90.4 50.1 7 68.5 53.1 IRI-25919 1 108.7
72.0 87.5 59.9 2 103.9 72.3 3 29.5 14.3 4 95.8 104.4 5 35.5 27.1 6
42.2 34.9 7 64.1 56.1 8 96.4 82.8 IRI-25070 1 81.7 50.2 57.8 34.2 2
57.4 18.1 3 37.9 39.3 4 55.3 36.0 5 22.3 20.6 6 52.4 38.6 7 53.0
33.4 8 41.5 29.7
TABLE-US-00024 TABLE P 25070 reduces collagen area fraction in the
IRI model with dosing on days 5, 6, and 7 Animal (not same as
Collagen Area Group PCR) Fraction (#) Mean Sham 1 1.398 1.8 2 1.406
3 2.88 4 1.782 5 1.119 6 2.11 7 1.552 8 1.795 IRI-PBS 1 12.181 15.1
2 16.352 3 14.818 4 17.089 5 14.552 6 16.92 7 13.629 IRI-25919 1
7.093 8.2 2 8.254 3 8.095 4 8.559 5 8.681 6 6.31 7 8.416 8 9.905
IRI-25070 1 10.266 9.7 2 11.772 3 10.267 4 8.404 5 7.862 6 6.975 7
8.381 8 13.773
[0500] A similar study was performed with the same treatment groups
and additional days of treatment. In this study, treatments were
administered intraperitoneally at days 5, 6, 7, 14, and 21
following the IRI procedure Animals were sacrificed on Day 27, and
kidney tissue was collected for analysis of collagen 1A1 and
collagen 3A1 expression, as well as collagen area fraction. The
`collagen area fraction` was analyzed in a blinded fashion, while
the samples in Tables Q and R from the same study, the numbering of
the samples in Table Q below does not correspond to the numbering
of samples in Table R. In this study, 25070 produced a
statistically significant reduction in collagen area fraction.
TABLE-US-00025 TABLE Q 25070 reduces collagen expression in the IRI
model with dosing on days 5, 6, 7, 14, and 21 Collagen 1A1 Collagen
3A1 (Normalized (Normalized Group Animal # Expression) Mean
Expression) Mean Sham 1 1.0 1.0 1.0 1.0 2 1.5 1.6 3 0.8 0.8 4 1.1
0.8 5 1.1 1.1 6 0.8 0.9 7 0.8 0.8 8 1.2 1.2 IRI-PBS 1 44.8 47.1
33.4 29.8 2 38.7 27.3 3 4.7 5.3 4 44.3 28.3 5 26.7 22.4 6 55.6 32.6
7 115.2 59.2 IRI-25319 1 53.8 69.9 31.7 44.2 (MM) 2 71.3 33.9 3
72.1 40.4 4 69.2 54.2 5 46.2 25.1 6 103.0 56.0 7 73.8 68.0
IRI-25919 1 75.5 48.3 40.2 34.9 2 50.4 43.1 3 49.2 34.5 4 43.2 35.7
5 41.7 41.1 6 53.6 36.9 7 44.8 24.5 8 28.0 22.9 IRI-25070 1 26.4
31.4 16.4 20.8 2 37.4 27.0 3 41.9 28.5 4 36.8 19.6 5 14.1 11.3 6
27.7 19.3 7 29.4 21.4 8 37.6 23.1
TABLE-US-00026 TABLE R 25070 reduces collagen area fraction in the
IRI model with dosing on days 5, 6, 7, 14, and 21 Animal (not
Collagen Area Group same as PCR) Fraction (#) Mean Sham 1 1.195 1.5
2 1.917 3 1.287 4 1.388 5 1.635 6 1.391 7 1.953 8 1.127 IRI-PBS 1
15.431 15.2 2 13.394 3 12.856 4 14.459 5 19.81 6 13.981 7 16.528
IRI-25319 1 10.804 13.5 (MM) 2 11.548 3 10.614 4 12.149 5 21.52 6
14.214 7 13.917 8 13 IRI-25919 1 11.882 12.8 2 9.755 3 9.506 4
12.654 5 20.319 6 11.551 7 12.224 8 14.468 IRI-25070 1 7.354 10.1 2
9.241 3 9.589 4 11.573 5 8.182 6 10.695 7 13.978 8 10.12
[0501] These studies demonstrate a reduction in collagen content
following inhibition of miR-21 in a model of acute kidney injury.
Thus, the anti-miR-21 compound 25070 is a therapeutic agent for the
treatment of acute kidney injury. For example, preventing or
delaying the onset of fibrosis following acute kidney injury may
prevent or delay the onset of chronic kidney disease.
[0502] In order to assess the flexibility of administration of the
anti-miR-21 compound 25070, the activity of the compound in the 14
day study above, where anti-miR-21 was administered at days 3, 5,
and 7 following the IRI procedure, to a different 14 day study
where anti-miR-21 was administered intraperitoneally at days 3, 5,
and 7 following the IRI procedure. The data in Table S demonstrate
that similar inhibition of collagen expression was observed in
either study, indicating that the dosing schedule can be flexible.
The fold change in collagen 1A1 or collagen 3A1 expression,
relative to sham animals is shown in Table S, and illustrates the
statistically significant reduction of collagen expression with
either dosing schedule.
TABLE-US-00027 TABLE S 25070 decreases collagen expression in the
IRI model with dosing on days 3, 5, and 7 Collagen 1A1 Collagen 3A1
(Normalized (Normalized Group Animal # Expression) Mean Expression)
Mean Sham 1 0.9 1.0 0.9 1.0 2 1.3 1.2 3 1.2 1.2 4 0.7 0.8 IRI-PBS 1
30.3 37.6 35.0 39.6 2 30.9 29.2 3 33.6 29.3 4 50.7 52.4 5 27.7 25.9
6 28.1 33.5 7 20.9 23.5 8 34.0 40.0 9 34.3 33.2 10 45.1 51.5 11
66.9 75.0 12 48.4 46.9 25070 1 37.5 27.2 35.3 27.9 (Day 3, 5, 7) 2
21.9 23.6 3 35.3 32.1 4 26.0 25.1 5 24.9 31.3 6 16.8 18.6 7 30.8
30.3 8 34.3 37.6 9 36.8 40.0 10 9.4 9.5 11 28.0 23.2 12 24.6 28.7
25070 1 21.7 24.5 24.9 26.2 (Day 5, 6, 7) 2 22.8 26.3 3 15.8 13.6 4
27.6 25.4 5 27.1 32.7 6 29.3 29.9 7 10.8 9.7 8 21.5 22.2 9 29.9
33.2 10 35.0 35.4 11 28.3 32.3 12 24.2 28.9
Example 5
Inhibition of miR-21 in an Ischemia Reperfusion Injury/Nephrectomy
Model
[0503] An ischemia reperfusion injury/nephrectomy (IR/Nx) model is
created in the mouse through temporary unilateral clamping of an
artery in one kidney, which leads to tubule damage, inflammation,
and fibrosis, followed by removal of the second kidney at a later
timepoint. In this model, the acute kidney dysfunction phase is
useful to test candidate agents for the treatment of acute kidney
injury (i.e. up to about the first 5 days), and the later phases of
kidney dysfunction are useful to model chronic fibrosis (i.e. after
about the first 5 days).
[0504] Anti-miR-21 compounds were tested in the IR/Nx model. 25109,
a 6-base mismatch to miR-21, was used as a control compound
(A.sub.EA.sub.SATC.sub.STGTC.sub.STCAU.sub.SAATA.sub.SAA.sub.E;
where nucleosides not followed by a subscript indicate
.beta.-deoxynucleosides; nucleosides followed by a subscript "E"
indicate 2'-MOE nucleosides; nucleosides followed by a subscript
"S" indicate S-cEt nucleosides; and all internucleoside linkages
are phosphorothioate internucleoside linkages).
[0505] Unilateral IR was induced for a period of 30 minutes.
Treatment groups were as follows: sham IR procedure; IR with PBS
administered subcutaneously; IR with mismatched control 25109
administered subcutaneously at a dose of 20 mg/kg; IR with
anti-miR-21 compound 25070 administered subcutaneously at a dose of
20 mg/kg; and IR with anti-miR-21 compound 25923 administered
subcutaneously at a dose of 20 mg/kg. PBS or anti-miR was
administered on days 2, 3, 4, and 8 following IR. On day 8, the
healthy kidney was removed by nephrectomy from each animal, and
animals were sacrificed on day 9. Just prior to sacrifice, urine
was collected by direct bladder puncture.
[0506] Urinary albumin to creatinine ratio was measured in the
urine from each mouse. The results of that experiment are shown in
FIG. 1. In this study, both 25070 and 25923 produced statistically
significant reductions in urinary albumin to creatinine ratio. The
geometric mean of the albumin to creatinine ratio in each group of
mice was 16 .mu.gAlb/mgCr (nephrectomy-only control), 127
.mu.gAlb/mgCr (IR/Nx, PBS control), 140 .mu.gAlb/mgCr (IR/Nx, 25109
control), 40 .mu.gAlb/mgCr (IR/Nx, 25070), and 31 .mu.gAlb/mgCr
(IR/Nx, 25923). Blood urea nitrogen and serum creatinine levels
were similar across all IR/Nx mice, and were elevated relative to
nephrectomy-only control mice (data not shown).
Example 6
Survival of IR/Nx Model Mice Following Administration of
Anti-miR-21 Compounds
[0507] The survival rate of IR/Nx model mice two days after
nephrectomy was determined across six different experiments to
determine if administration of anti-miR-21 compounds increases
survival. In the first three experiments, anti-miR-21 compound was
administered on days 5, 6, and 7 after ischemia reperfusion injury,
and nephrectomy occurred on day 10 or day 11. In the second three
experiments, anti-miR-21 compound was administered on days 2, 3,
and 4, and nephrecromy occurred on day 7. The rates of survival of
the IR/Nx mice in each experiment are shown in Table T.
TABLE-US-00028 TABLE T 25070 increases survival rate of IR/Nx mice
two days after nephrectomy. Survival rate 2 days after Nx Study Day
of Nx PBS 25070 25070 dose 1 Day 10 58.3% 91.7% 30 mg/kg 2 Day 11
50% 83.3% 30 mg/kg 3 Day 10 50% 66.6% 20 mg/kg Summary 55% (20/36)
80% (29/36) (day 10/11 Nx) 4 Day 7 41.7% 75% 20 mg/kg 5 Day 7 50%
66.7% 20 mg/kg 6 Day 7 66.7% 66.7% 20 mg/kg Summary (day 7 Nx) 52%
(19/36) 69% (25/36)
In the first three experiments, in which nephrectomy occurred on
day 10 or day 11, the survival rate of PBS-treated mice was 55%,
while the survival rate of 25070-treated mice was 80% (P=0.02 using
a 1-sided Fisher's Exact Test). In the second three experiments, in
which nephrectomy occurred on day 7, the survival rate of
PBS-treated mice was 52%, while the survival rate of 25070-treated
mice was 69% (P=0.11 using a 1-sided Fisher's Exact Test).
Example 7
Design of Additional Anti-miR-21 Compounds
[0508] Following administration of compound 25070 to mice, it has
been found that about 50% of the compound present in kidney tissue
is lacking the 3'-terminal nucleoside by 7 days post-injection. The
stability of 25070 and 25923 was assessed in an ex vivo liver
homogenate assay. In this assay, 5 .mu.M of oligonucleotide was
incubated in liver homogenate (50 mg tissue per ml) for 24 hours at
37.degree. C. Following this incubation, oligonucleotide was
extracted by Liquid-Liquid Extraction (LLE) followed by Solid-Phase
Extraction (SPE). Oligonucleotide lengths and amounts were measure
by high-performance liquid chromatography time-of-flight mass
spectrometry (HPLC-TOF MS). Nuclease activity in the liver tissue
homogenate was confirmed by using reference oligonucleotides, which
included a compound with known resistance to nuclease activity, a
compound susceptible to 3'-exonuclease activity, and a compound
susceptible to endonuclease activity. An internal standard compound
was used to control for extraction efficiency. In this assay, about
58% of compound 25070 is present as the full-length compound, and
about 27% of compound 25070 lacks the 3'-terminal nucleoside. About
68% of compound 25923 is present as the full-length compound, and
about 18% of the compound lacks the 3'-terminal nucleoside.
[0509] Additional compounds were designed, and these compounds were
tested for stability ex vivo and in vivo. Ex vivo was performed as
describe above. For testing in vivo, compounds were administered to
mice, kidney tissue was isolated, and the extraction and detection
of compound was performed as for the ex vivo assay. Table U shows
the structures for the compounds 25923, 25220 and 25221, and the
results of the stability measurements.
TABLE-US-00029 TABLE U 25923, 25220 and 25221 ex vivo and in vivo
stability ex vivo (liver) in vivo (kidney) Compound Structure N
%.dwnarw. % N - 1 % Endo N (%) N - 1 (%) 25923
A.sub.EC.sub.SATC.sub.SAGTC.sub.STGAU.sub.SAAGC.sub.STA.sub.S 17 13
2-3 58 .+-. 3 14 .+-. 5 25220
A.sub.EC.sub.SATC.sub.SA.sub.SGTC.sub.SU.sub.SGAU.sub.SA.sub.SAGC.su-
b.SU.sub.SA.sub.E 3 0 3 67 .+-. 16 16 .+-. 6 25221
A.sub.EC.sub.SATC.sub.SAGTC.sub.STGAU.sub.SAAGC.sub.SU.sub.SA.sub.S
3 0 3 76 .+-. 4 4 .+-. 1
[0510] Compounds 25220 and 25221, as well as 25923, were tested in
the UUO model for their effects on fibrosis. Groups of 8 animals
each were treated as follows: sham surgery, UUO with PBS, UUO with
25220, UUO with 25221, or UUO with 25923. Relative to the day of
the UUO procedure, PBS or anti-miR-21 compound was administered at
days -5, -3, and +3. Anti-miR-21 compounds were administered at a
dose of 20 mg/kg. As the anti-miR compounds were administered prior
to the UUO procedure, this dosing regimen is considered a
prophylactic treatment. At day 10, animals were sacrificed and
kidney was isolated for measurement of collagen expression.
Collagen expression was measured by real-time PCR and normalized to
GAPDH.
[0511] The results of that experiment are shown in FIG. 2. Collagen
1A1 and collagen 3A1 expression are shown in FIGS. 2A and 2B,
respectively. Administration of compound 25220 or 25221 reduced
collagen 1A1 and collagen 3A1 expression by a stastically
significant amount (*=p<0.05; **=p<0.01; ***=p<0.001), as
did administration of compound 25923.
[0512] Various modifications of the invention, in addition to those
described herein, will be apparent to those skilled in the art from
the foregoing description. Such modifications are also intended to
fall within the scope of the appended claims. Each reference
(including, but not limited to, journal articles, U.S. and non-U.S.
patents, patent application publications, international patent
application publications, GENBANK.RTM. accession numbers, and the
like) cited in the present application is specifically incorporated
herein by reference in its entirety.
Sequence CWU 1
1
4122RNAHomo sapiens 1uagcuuauca gacugauguu ga 22272RNAHomo sapiens
2ugucggguag cuuaucagac ugauguugac uguugaaucu cauggcaaca ccagucgaug
60ggcugucuga ca 72319DNAArtificialSynthetic 3acatcagtct gataagcta
19422DNAArtificialSynthetic 4tcaacatcag tctgataagc ta 22
* * * * *
References