U.S. patent application number 12/451564 was filed with the patent office on 2012-10-25 for pharmaceutical containing ppar-delta agonist.
This patent application is currently assigned to SENJU PHARMACEUTICAL CO., LTD.. Invention is credited to Ikuko HANANO, Jun INOUE, Yoshikuni NAKAMURA.
Application Number | 20120270910 12/451564 |
Document ID | / |
Family ID | 40031950 |
Filed Date | 2012-10-25 |
United States Patent
Application |
20120270910 |
Kind Code |
A2 |
NAKAMURA; Yoshikuni ; et
al. |
October 25, 2012 |
PHARMACEUTICAL CONTAINING PPAR-DELTA AGONIST
Abstract
Provision of an agent for promoting proliferation of meibomian
gland epithelial cells or corneal epithelial cells, and a
therapeutic agent for ocular diseases such as meibomian gland
dysfunction, dry eye and the like. A preparation containing
[3-[2-[4-isopropyl-2-(4-trifluoroethyl)phenyl-5-thiazolyl]ethyl]-5-methyl-
-1,2-benzisoxazol-6-yl]oxyacetic acid,
[4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid, or a pharmacologically acceptable salt
thereof as an active ingredient is used as an agent for promoting
proliferation of meibomian gland epithelial cells or corneal
epithelial cells, as well as a therapeutic agent for ocular
diseases such as meibomian gland dysfunction, dry eye and the
like.
Inventors: |
NAKAMURA; Yoshikuni; (Hyogo,
JP) ; HANANO; Ikuko; (Hyogo, JP) ; INOUE;
Jun; (Hyogo, JP) |
Assignee: |
SENJU PHARMACEUTICAL CO.,
LTD.
Osaka
JP
541-0046
NIPPON CHEMIPHAR CO., LTD.
Tokyo
JP
101-0032
|
Prior
Publication: |
|
Document Identifier |
Publication Date |
|
US 20100190833 A1 |
July 29, 2010 |
|
|
Family ID: |
40031950 |
Appl. No.: |
12/451564 |
Filed: |
May 20, 2008 |
PCT Filed: |
May 20, 2008 |
PCT NO: |
PCT/JP2008/059236 |
371 Date: |
March 16, 2010 |
Current U.S.
Class: |
514/365;
514/374 |
Current CPC
Class: |
C07D 263/32 20130101;
A61K 31/426 20130101; A61K 31/421 20130101; A61P 27/02 20180101;
A61P 27/14 20180101; A61P 37/08 20180101; A61K 31/427 20130101;
A61P 43/00 20180101; C07D 277/24 20130101; C07D 417/06 20130101;
A61P 27/04 20180101 |
Class at
Publication: |
514/365;
514/374 |
International
Class: |
A61K 31/427 20060101
A61K031/427; A61P 27/04 20060101 A61P027/04; A61K 31/422 20060101
A61K031/422 |
Foreign Application Data
Date |
Code |
Application Number |
May 21, 2007 |
JP |
2007-134183 |
Claims
1. An agent for promoting proliferation of a meibomian gland
epithelial cell, comprising
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methy-
l-1,2-benzisoxazol-6-yl]oxyacetic acid,
[4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]2-me-
thylphenoxy]acetic acid or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid, or a pharmacologically acceptable salt
thereof.
2. An agent for promoting proliferation of a corneal epithelial
cell, comprising
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methy-
l-1,2-benzisoxazol-6-yl]oxyacetic acid,
[4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid or [4-[3
[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-methylp-
henoxy]acetic acid, or a pharmacologically acceptable salt
thereof.
3. An agent for treating meibomian gland dysfunction, comprising
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methy-
l-1,2-benzisoxazol-6-yl]oxyacetic acid,
[4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid, or a pharmacologically acceptable salt
thereof.
4. An agent for treating a corneal epithelial disorder, comprising
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methy-
l-1,2-benzisoxazol-6-yl]oxyacetic acid,
[4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid, or a pharmacologically acceptable salt
thereof.
5. A agent for treating dry eye, comprising
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methy-
l-1,2-benzisoxazol-6-yl]oxyacetic acid,
[4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid or [4-[3-[2-(2
hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-methylphenoxy-
]acetic acid, or a pharmacologically acceptable salt thereof.
6. The agent of claim 5, wherein the dry eye is hyperevaporative
dry eye.
7. Use of
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethy-
l]-5-methyl-1,2-benzisoxazol-6-yl]oxyacetic acid,
[4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid, or a pharmacologically acceptable salt
thereof, for the production of an agent for promoting proliferation
of a meibomian gland epithelial cell.
8. Use of
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethy-
l]-5-methyl-1,2-benzisoxazol-6-yl]oxyacetic acid,
[4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid, or a pharmacologically acceptable salt
thereof, for the production of an agent for promoting proliferation
of a corneal epithelial cell.
9. Use of
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethy-
l]-5-methyl-1,2-benzisoxazol-6-yl]oxyacetic acid,
[4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid, or a pharmacologically acceptable salt
thereof, for the production of an agent for treating meibomian
gland dysfunction.
10. Use of
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methy-
l-1,2-benzisoxazol-6-yl]oxyacetic acid,
[4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid, or a pharmacologically acceptable salt
thereof, for the production of an agent for treating a corneal
epithelial disorder.
11. Use of
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methy-
l-1,2-benzisoxazol-6-yl]oxyacetic acid,
[4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid, or a pharmacologically acceptable salt
thereof, for the production of an agent for treating dry eye.
12. The use of claim 11, wherein the dry eye is hyperevaporative
dry eye.
13. A method of promoting proliferation of a meibomian gland
epithelial cell, comprising administering an effective amount of
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methy-
l-1,2-benzisoxazol-6-yl]oxyacetic acid,
[4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid, or a pharmacologically acceptable salt
thereof to a subject in need of promotion of proliferation of a
meibomian gland epithelial cell.
14. A method of promoting proliferation of a corneal epithelial
cell comprising administering an effective amount of
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methy-
l-1,2-benzisoxazol-6-yl]oxyacetic acid,
[4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid, or a pharmacologically acceptable salt
thereof to a subject in need of promotion of proliferation of a
corneal epithelial cell.
15. A method of treating meibomian gland dysfunction, comprising
administering an effective amount of
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methy-
l-1,2-benzisoxazol-6-yl]oxyacetic acid,
[4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid, or a pharmacologically acceptable salt
thereof to a subject in need of treatment of meibomian gland
dysfunction.
16. A method of treating a corneal epithelial disorder, comprising
administering an effective amount of
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methy-
l-1,2-benzisoxazol-6-yl]oxyacetic acid, [4-[3-[2
(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-methylphen-
oxy]acetic acid or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid, or a pharmacologically acceptable salt
thereof to a subject in need of treatment of a corneal, epithelial
disorder.
17. A method of treating dry eye, comprising administering an
effective amount of
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethy-
l]-5-methyl-1,2-benzisoxazol-6-yl]oxyacetic acid,
[4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid or a pharmacologically acceptable salt
thereof to a subject in need of treatment of dry eye.
18. The method of claim 17, wherein the dry eye is hyperevaporative
dry eye.
Description
TECHNICAL FIELD
[0001] The present invention relates to an agent for promoting
proliferation of meibomian gland epithelial cells or corneal
epithelial cells, which contains a PPAR (Peroxisome
Proliferator-Activated Receptor) .delta. agonist as an active
ingredient.
BACKGROUND ART
[0002] A meibomian gland is lipid-producing gland enclosed in both
the upper and lower eyelids (palpebra), and secretes a lipid
through an opening situated on a conjunctiva side from eyelashes of
eyelids. A lipid layer constituting a tear fluid contains a lipid
supplied from the meibomian glands as a component, and prevents the
tear fluid from evaporating from an eye surface. It is known that
patients with meibomian gland dysfunction or meibomitis develop
hyperevaporative dry eye, keratoconjunctiva epithelial disorder,
corneal epithelial erosion and corneal ulcer, which are associated
with dry eye, and the like, since the meibomian gland shows
functional deterioration and secretes a lipid at a lower level.
[0003] In addition, the cornea consists of epithelium and an
external limiting membrane (Bowman's membrane), stroma, a internal
limiting membrane (Descemet's membrane) and endothelium. Since the
cornea is located at the frontmost part of the eyeball, it is
susceptible to external environmental influence, as a result of
which various disorders are developed. Examples of the diseases
associated with wound or defect of corneal epithelial cells include
dry eye syndrome, corneal ulcer, superficial punctuate keratitis,
corneal epithelial erosion, ocular allergic diseases associated
with corneal lesion such as vernal conjunctivitis, atopic
keratoconjunctivitis etc., and the like.
[0004] On the other hand, PPAR is one kind of intranuclear
receptors expressed in most vertebrates, and is considered to be a
transcription factor group closely related to the intracellular
sugar or lipid metabolism and cell differentiation. As the subtype,
.alpha., .delta. and .gamma.-types are known. PPAR.delta. is
sometimes indicated as PPAR.delta. (non-patent document 1).
[0005] As for the distribution of PPAR in the ocular tissue,
expression of PPAR.alpha. and .beta. in the corneal epithelial
cells of rabbit is known (non-patent document 2).
[0006] There have been reported that
5-[4-(6-methoxy-1-methyl-1H-benzimidazol-2-ylmethoxy)benzyl]thiazolidine--
2,4-dione considered to mainly have a PPAR.gamma. activation action
can be utilized as a therapeutic agent for keratoconjunctival
disorders (patent documents 1 and 2), and PPAR.alpha., .delta. or
.gamma. agonist is administered for the treatment of ocular
diseases (conjunctivitis, dry eye syndrome, keratitis etc.) (patent
document 3). In addition, it is known that PPAR.alpha. is
distributed in the liver, kidney and the like, and acts on lipid
metabolism and transportation. Furthermore, it has also been
reported that an agonist thereof can be utilized as a therapeutic
agent for corneal diseases (patent document 4). PPAR.delta.
agonists have been reported to promote proliferation and
differentiation of rat sebaceous gland epithelial cells (non-patent
document 3) and promote wound healing of the skin (non-patent
document 4). Besides the above, a method of stimulating
proliferation of .beta.-cell by administering a
non-thiazolidinedione PPAR-ligand and a GLP-1 derivative (patent
document 5), inhibition of proliferation of leukemia cell, prostate
cancer cell and the like by pioglitazone (PPAR.gamma. agonist)
(patent document 6) and the like are known.
[0007] However, many aspects of the expression and function of
PPAR.alpha., .delta. or .gamma. in each animal species and each
tissue or cell are yet to be clarified, and whether a PPAR.delta.
agonist is useful for ocular diseases in human is not correctly
known. [0008] patent document 1: WO2005/039574 [0009] patent
document 2: JP A-2001-39976 [0010] patent document 3: WO2002/076177
[0011] patent document 4: JP-A-2005-008570 [0012] patent document
5: WO2002/69994 [0013] patent document 6: WO1998/25598 [0014]
non-patent document 1: J Med Chem 2000, 43: 527-550 [0015]
non-patent document 2: J Biol Chem 2000, 275: 2837 [0016]
non-patent document 3: Molecular Genetic and Metabolism 2001, 74:
362-369 [0017] non-patent document 4: Am J Clin Dermatol 2003,
4(8): 523-530
DISCLOSURE OF THE INVENTION
Problems to be Solved by the Invention
[0018] An object of the present invention is to provide a
medicament capable of promoting proliferation of meibomian gland
epithelial cells and corneal epithelial cells, which can be a
fundamental treatment of ocular diseases such as dry eye and the
like, and a therapeutic agent which uses the promoter for ocular
diseases such as meibomian gland dysfunction, corneal epithelial
disorder, dry eye and the like.
Means of Solving the Problems
[0019] The present inventors have conducted intensive studies in
view of the above-mentioned problems and found that a specific
PPAR.delta. agonist shows a superior action in promoting
proliferation of meibomian gland epithelia cells and corneal
epithelial cells, which resulted in the completion of the present
invention.
[0020] Accordingly, the present invention includes at least the
following aspects.
[0021] (1) An agent for promoting proliferation of a meibomian
gland epithelial cell, comprising
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methy-
l-1,2-benzisoxazol-6-yl]oxyacetic acid,
[4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid, or a pharmacologically acceptable salt
thereof.
[0022] (2) An agent for promoting proliferation of a corneal
epithelial cell, comprising
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methy-
l-1,2-benzisoxazol-6-yl]oxyacetic acid,
[4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid, or a pharmacologically acceptable salt
thereof.
[0023] (3) An agent for treating meibomian gland dysfunction,
comprising
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methy-
l-1,2-benzisoxazol-6-yl]oxyacetic acid,
[4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid, or a pharmacologically acceptable salt
thereof.
[0024] (4) An agent for treating a corneal epithelial disorder,
comprising
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methy-
l-1,2-benzisoxazol-6-yl]oxyacetic acid,
[4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid, or a pharmacologically acceptable salt
thereof.
[0025] (5) An agent for treating dry eye, comprising
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methy-
l-1,2-benzisoxazol-6-yl]oxyacetic acid, [4-[3-[2-(4-3
trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-methylphenoxy-
]acetic acid or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid, or a pharmacologically acceptable salt
thereof.
(6) The agent of the aforementioned (5), wherein the dry eye is
hyperevaporative dry eye.
[0026] (7) Use of
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methy-
l-1,2-benzisoxazol-6-yl]oxyacetic acid,
[4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid, or a pharmacologically acceptable salt
thereof, for the production of an agent for promoting proliferation
of a meibomian gland epithelial cell.
[0027] (8) Use of
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methy-
l-1,2-benzisoxazol-6-yl]oxyacetic acid,
[4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid, or a pharmacologically acceptable salt
thereof, for the production of an agent for promoting proliferation
of a corneal epithelial cell.
[0028] (9) Use of
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methy-
l-1,2-benzisoxazol-6-yl]oxyacetic acid, [4-[3-[2-(4-trifluoro
ethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-methylphenoxy]acetic
acid or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propio-
nyl]-2-methylphenoxy]acetic acid, or a pharmacologically acceptable
salt thereof, for the production of an agent for treating meibomian
gland dysfunction.
[0029] (10) Use of
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methy-
l-1,2-benzisoxazol-6-yl]oxyacetic acid,
[4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid or
[4-[3-([2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2--
methylphenoxy]acetic acid, or a pharmacologically acceptable salt
thereof, for the production of an agent for treating a corneal
epithelial disorder.
[0030] (11) Use of
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methy-
l-1,2-benzisoxazol-6-yl]oxyacetic acid,
[4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid, or a pharmacologically acceptable salt
thereof, for the production of an agent for treating dry eye.
(12) The use of the aforementioned (11), wherein the dry eye is
hyperevaporative dry eye.
[0031] (13) A method of promoting proliferation of a meibomian
gland epithelial cell, comprising administering an effective amount
of
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methy-
l-1,2-benzisoxazol-6-yl]oxyacetic acid,
[4-[3-[2-(4-trifluoromethylphenyl-4-isopropyl-5-thiazolyl]propionyl]-2-me-
thylphenoxy]acetic acid or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid, or a pharmacologically acceptable salt
thereof to a subject in need of promotion of proliferation of a
meibomian gland epithelial cell.
[0032] (14) A method of promoting proliferation of a corneal
epithelial cell, comprising administering an effective amount of
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5
methyl-1,2-benzisoxazol-6-yl]oxyacetic acid, [4-[3-[2-(4
trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-methylphenoxy-
]acetic acid or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid, or a pharmacologically acceptable salt
thereof to a subject in need of promotion of proliferation of a
corneal epithelial cell.
[0033] (15) A method of treating meibomian gland dysfunction,
comprising administering an effective amount of
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methy-
l-1,2-benzisoxazol-6-yl]oxyacetic acid,
[4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid, or a pharmacologically acceptable salt
thereof to a subject in need of treatment of meibomian gland
dysfunction.
[0034] (16) A method of treating a corneal epithelial disorder,
comprising administering an effective amount of
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methy-
l-1,2-benzisoxazol-6-yl]oxyacetic acid,
[4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid, or a pharmacologically acceptable salt
thereof to a subject in need of treatment of a corneal epithelial
disorder.
[0035] (17) A method of treating dry eye, comprising administering
an effective amount of
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methy-
l-1,2-benzisoxazol-6-yl]oxyacetic acid,
[4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid, or a pharmacologically acceptable salt
thereof to a subject in need of treatment of dry eye.
(18) The method of the aforementioned (17), wherein the dry eye is
hyperevaporative dry eye.
Effect of the Invention
[0036] The present invention provides a novel meibomian gland
epithelial cell proliferative promoter or a corneal epithelial cell
proliferative promoter, which promotes proliferation of meibomian
gland epithelial cells or corneal epithelial cells. In addition,
the therapeutic agent of the present invention can be effectively
used for the treatment or improvement of diseases, for example,
meibomian gland dysfunction, a corneal epithelial disorder, dry eye
and the like.
BRIEF DESCRIPTION OF THE DRAWINGS
[0037] FIG. 1 shows the expression of mRNA of PPAR.alpha., .delta.
and .gamma. in cultured human corneal epithelial cells (upper
panel), cultured rabbit corneal epithelial cells (middle panel),
and cultured monkey meibomian gland epithelial cells (lower
panel).
BEST MODE FOR CARRYING OUT THE INVENTION
[0038] The present invention provides an agent for promoting
proliferation of a meibomian gland epithelial cell, comprising
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methy-
l-1,2-benzisoxazol-6-yl]oxyacetic acid,
[4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid, or a pharmacologically acceptable salt
thereof (hereinafter sometimes to be collectively referred to as
"the compound of the present invention") as an active ingredient.
The agent promotes proliferation of meibomian gland epithelial
cells. In addition, the present invention provides an agent for
promoting proliferation of a corneal epithelial cell, comprising
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methy-
l-1,2-benzisoxazol-6-yl]oxyacetic acid,
[4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid, or a pharmacologically acceptable salt
thereof as an active ingredient. The agent promotes proliferation
of corneal epithelial cells. The cell proliferative promoter in the
present invention means both an agent having an action to promote
cell division to increase the number of cells, and an agent having
an action to suppress cell death to increase the number of
cells.
3-[2-[4-Isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5
methyl-1,2-benzisoxazol-6-yl]oxyacetic acid (CAS No.
515138-06-4)
[0039] ##STR1## contained in the promoter of the present invention
as an active ingredient is a compound having a PPAR.delta. agonist
activity and described in WO2003/033493 (particularly Example
5).
[4-[3-[2
(4-Trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-me-
thylphenoxy]acetic acid (CAS No. 500581-25-8)
[0040] ##STR2## contained in the promoter of the present invention
as an active ingredient is a compound having a PPAR.delta. agonist
activity and described in WO2003/016291 (particularly Example
3).
[4-[3-[2-(2-Hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-me-
thylphenoxy]acetic acid (CAS No. 500581-27-1)
[0041] ##STR3## contained in the promoter of the present invention
as an active ingredient is a compound having a PPAR.delta. agonist
activity and described in WO2003/016291 (particularly Example
6).
[0042] Examples of the pharmacologically acceptable salts of these
compounds include metal salts with alkali metals such as sodium,
potassium etc.; alkaline earth metals such as calcium, magnesium
etc.; and the like. In addition, the compound of the present
invention also includes a solvate thereof.
[0043] The PPAR.delta. agonist in the present invention is a
substance that binds to a ligand binding domain (LBD) of
PPAR.delta., activates the receptor, and regulates the
transcription of a PPAR target gene. The PPAR.delta. agonist
activity can be measured by a yeast two-hybrid method using a
chimeric receptor of LED and GAL4 of yeast, and a reporter gene, in
order to exclude influence of other nuclear receptors inherently
present in mammalian cells. Specific examples of the measurement
method include PPAR-GAL4 assays described in the reference
documents, T. M. Willson et al., Journal of Medicinal Chemistry,
2000, vol. 43, No. 4, p. 528-550 and J. M. Lehmann et al., The
Journal of Biological Chemistry, 1995, vol. 270, No. 22, p.
12953-12956. The compound of the present invention has been
confirmed to have a PPAR.delta. agonist activity according to the
methods described in WO2003/033493, Example 12 and WO2003/016291,
Example 51.
[0044] The compound of the present invention can be synthesized
according to the descriptions of WO2003/033493 (particularly
Example 5) and WO2003/016291 (particularly Examples 3, 6).
[0045] In the promoter of the present invention, the content of the
active ingredient is generally 0.000001-1 wt %, preferably
0.00001-1 wt %, most preferably 0.0001-0.1 wt %.
[0046] The promoter of the present invention can contain any
carrier in addition to the above-mentioned active ingredients.
Examples of such carrier include solvents (e.g., water, alcohol
etc.), buffers (e.g., phosphate buffer, acetate buffer, borate
buffer, carbonate buffer, citrate buffer, Tris buffer, glutamic
acid, epsilon aminocaproic acid etc.), preservatives (e.g.,
benzalkonium chloride, benzethonium chloride, chlorhexidine
gluconate, chlorobutanol, benzyl alcohol, sodium dehydroacetate,
esters of paraoxybenzoic acid, sodium edetate, boric acid etc.),
isotonicity agents (e.g., sodium chloride, potassium chloride,
glycerol, mannitol, sorbitol, boric acid, glucose, propylene glycol
etc.) and the like.
[0047] The promoter of the present invention can be used in vivo or
in vitro as a medicament or test reagent and the like.
[0048] When the promoter of the present invention is used as a test
reagent, it can be utilized as a test reagent in the fields of
physiology and biochemistry and in various embodiments.
[0049] When the promoter of the present invention is used as a
medicament, it is useful as a therapeutic agent for a disease
associated with injury or atrophy of meibomian gland epithelial
cells, and a disease caused by hypofunction of meibomian gland
epithelial cells, since the agent promotes proliferation of
meibomian gland epithelial cells. Examples of the diseases include
meibomian gland dysfunction, meibomianitis and the like.
Furthermore, since the meibomian gland epithelial cells secrete a
lipid component in a tear fluid, and the lipid prevents evaporation
of the tear fluid and stabilizes the tear fluid layer, the
therapeutic agent of the present invention is useful for a disease
associated with lipid abnormality (decreased secretion, change of
component) in the tear fluid. Examples of the disease include
hyperevaporative dry eye.
[0050] Moreover, the promoter of the present invention is also
useful as a therapeutic agent for a disease associated with injury
of corneal epithelial cells (that is, wound or defect), since it
promotes proliferation of corneal epithelial cells. The promoter of
the present invention is useful as a therapeutic agent for corneal
epithelial disorders, specifically, those associated with
endogenous diseases such as Sjogren's syndrome, Stevens-Johnson
syndrome, keratoconjunctivitis sicca (dry eye) and the like; those
associated with exogenous diseases such as post-operation, drug
use, trauma, corneal ulcer, meibomianitis, exogenous diseases
during wearing contact lenses and the like; those associated with
ocular allergic diseases accompanying corneal lesion such as vernal
conjunctivitis, atopic keratoconjunctivitis and the like. The
promoter of the present invention is also useful for the treatment
of superficial punctuate keratitis and corneal epithelial erosion.
Furthermore, the promoter of the present invention is also useful
as a corneal wound healing promoter.
[0051] Furthermore, the promoter of the present invention is useful
as an agent for treating dry eye, particularly, highly useful as an
agent for treating hyperevaporative dry eye, since the agent
simultaneously shows a promoting action on proliferation of corneal
epithelial cells and a meibomian gland epithelial cell
proliferative action and affords an effect by directly acting on
the corneal tissues and an effect of improving the tear fluid
function by acting on meibomian gland cells.
[0052] In the therapeutic agent of the present invention, the
content of the active ingredient is generally 0.000001-1 wt %,
preferably 0.00001-1 wt %, most preferably 0.0001-0.1 wt %.
[0053] Examples of the subject of administration of the promoter or
therapeutic agent of the present invention include mammals (e.g.,
human, mouse, rat, hamster, rabbit, cat, dog, bovine, sheep, monkey
etc.)
[0054] The therapeutic agent of the present invention can be used
in a dosage form of, for example, eye drop, patch, ointment,
lotion, cream, oral agent and the like, and can contain, in
addition to the above-mentioned active ingredients, any carrier,
for example, a pharmaceutically acceptable carrier.
[0055] While the administration route of the therapeutic agent of
the present invention is not particularly limited as long as the
aforementioned treatment effect is afforded, it is preferably
topically administered to the eye. Examples of the dosage form of a
topical administration to the eye include eye drop and ophthalmic
ointment.
[0056] For example, when the therapeutic agent of the present
invention is used as an eye drop or ophthalmic ointment,
stabilizers (e.g., sodium bisulfite, sodium thiosulfate, sodium
edetate, sodium citrate, ascorbic acid, dibutylhydroxytoluene
etc.), solubilizing agents (e.g., glycerol, propylene glycol,
macrogol, polyoxyethylene hydrogenated castor oil etc.), suspending
agents (e.g., polyvinylpyrrolidone, hydroxypropylmethylcellulose,
hydroxyethylcellulose, sodium carboxymethylcellulose etc.),
emulsifiers (e.g., polyvinylpyrrolidone, soybean lecithin, egg-yolk
lecithin, polyoxyethylene hydrogenated castor oil, polysorbate 80
etc.), buffers (e.g., phosphate buffer, acetate buffer, borate
buffer, carbonate buffer, citrate buffer, Tris buffer, glutamic
acid, epsilon aminocaproic acid etc.), viscous agents (e.g.,
water-soluble cellulose derivative such as methylcellulose,
hydroxyethylcellulose, hydroxypropylmethylcellulose,
carboxymethylcellulose etc., sodium chondroitin sulfate, sodium
hyaluronate, carboxyvinyl polymer, polyvinyl alcohol,
polyvinylpyrrolidone, macrogol etc.), preservatives (e.g.,
benzalkonium chloride, benzethonium chloride, chlorhexidine
gluconate, chlorobutanol, benzyl alcohol, sodium dehydroacetate,
esters of paraoxybenzoic acid, sodium edetate, boric acid etc.),
isotonicity agents (e.g., sodium chloride, potassium chloride,
glycerol, mannitol, sorbitol, boric acid, glucose, propylene glycol
etc.), pH adjusters (e.g., hydrochloric acid, sodium hydroxide,
phosphoric acid, acetic acid etc.), algefacients (e.g., l-menthol,
d-camphor, d-borneol, peppermint oil etc.), ointment bases (white
petrolatum, purified lanolin, liquid paraffin, vegetable oil (olive
oil, camelia oil, peanuts oil etc.) etc.) and the like can be added
as additives. While the amount of the additives varies depending on
the kind of additive, use and the like, they may be added in such
amounts that affords a concentration capable of achieving the
object of use of the additive.
[0057] When the therapeutic agent of the present invention is used
in the form of an eye drop or ophthalmic ointment, the agent can be
produced according to a method generally used in the pharmaceutical
field and, for example, based on the method described in the
Japanese Pharmacopoeia, 14th Edition, Preparation General Rules,
section of eye drop and section of ophthalmic ointment.
[0058] Examples of the form of an eye drop include aqueous eye
drops (aqueous instillation, aqueous suspension instillation,
viscose instillation etc.), non-aqueous eye drops (non-aqueous
instillation, non-aqueous suspension instillation etc.), emulsion
eye drops and the like.
[0059] While the pH of the eye drop is appropriately determined
according to the form of the eye drop, it is generally within the
range of 4-8. When the eye drop is an aqueous instillation, the pH
is particularly preferably adjusted to pH 6-8 from the aspect of
solubility of the active ingredient.
[0060] The eye drop is generally a preparation sterilized by a
method such as sterilization by filtration, irradiation
sterilization (e.g., electron sterilization, ultraviolet
sterilization, gamma sterilization etc.), autoclave sterilization,
hot-air sterilization and the like.
[0061] When the agent is formulated into an eye drop, the liquid is
preferably filled in an instillation container provided with a
liquid drip opening having a small diameter that enables control of
the drip amount to facilitate instillation into the eye. The
material to be used for the container is synthetic resin, glass,
cellulose, pulp and the like, and is appropriately selected
according to the property and the amount of use of the active
ingredient and the base. From the aspects of squeezability and
durability, the container is preferably made of a synthetic resin.
Specific examples of the so material of the synthetic resin include
polyethylene resin (e.g., low density polyethylene or high density
polyethylene), polypropylene resin, ethylene-propylene copolymer
resin, poly(ethylene terephthalate) resin and the like.
[0062] Examples of the instillation container include a container
wherein a spigot member is fit into a container body, which are
independently molded, an integrally-molded container wherein a
liquid is tightly sealed simultaneously with the molding of the
container (e.g., WO2004/006826) and the like. When an
integrally-molded container is employed, the container is superior
in the aspects of cost or hygiene, since the container and the
liquid are continuously produced. The instillation container may be
a unit dose type container which is disposed after each time of use
(e.g., JP-A-9-207959). When this container is employed, a
preparation without preservatives, which is highly safe to the
cornea, can be formulated. In addition, such containers may be
adhesion-packed with a UV blocking film. Furthermore, the
containers may be colored (brown, green, blue, yellow etc.) to
enhance the UV blocking performance.
[0063] The present invention provides a method of promoting
proliferation of a meibomian gland epithelial cell, comprising
administering an effective amount of the compound of the present
invention to a subject in need of promotion of proliferation of
meibomian gland epithelial cells. The method is desirably performed
for the treatment of meibomian gland dysfunction.
[0064] In addition, the present invention provides a method of
promoting proliferation of a corneal epithelial cell, comprising
administering an effective amount of the compound of the present
invention to a subject in need of promotion of proliferation of
corneal epithelial cells. The method is desirably performed for the
treatment of a corneal epithelial disorders.
[0065] In addition, the present invention provides a method of
treating dry eye, comprising administering an effective amount of
the compound of the present invention to patients suffering from
dry eye.
[0066] The effective amount of the compound of the present
invention cannot be defined automatically since it varies depending
on the age, body weight and condition of the subject of
administration, a treatment object and the like. When the prater or
therapeutic agent of the present invention is administered to
human, for example, a solution containing the compound of the
present invention at 0.000001-1 wt %, preferably 0.00001-1 wt %,
most preferably 0.0001-0.1 wt %, is generally instilled once-eight
times a day by 1-2 drops for one eye/instillation, namely, about
50-200 .mu.L per instillation. The amount of the compound contained
in a solution having a concentration and a volume thin such ranges
can be exemplified as an effective amount.
EXAMPLES
[0067] The present invention is explained in detail in the
following by referring to Experimental Examples, which are not to
be construed as limitative.
Experimental Example 1
Effect on Increase of Cell Number of Normal Human Corneal
Epithelial Cells
1. Cells Used
[0068] Normal human corneal epithelial cells (KURABO) were
used.
2. Preparation Method of Test Substance Solution
[0069] As a test substance,
[3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methy-
l-1,2-benzisoxazol-6-yl]oxyacetic acid (hereinafter to be referred
to as compound A) was used. Compound A was dissolved in ethanol
(Wako Pure Chemical Industries, Ltd.) to a concentration 200-fold
of the final concentration in a culture medium, and the solution
was stored at -80.degree. C. until immediately before use.
[0070] As a cell culture medium for consideration of the cell
number-increasing effect by compound A, a culture medium (basal
medium) obtained by adding insulin, hydrocortisone and transferrin
contained in HCGS growth additive set (KURABO) to EpiLife (KURABO)
was used.
3. Test Method
1) Cell Culture and Addition of Compound A
[0071] Normal human corneal epithelial cells cryopreserved in
liquid nitrogen were thawed and the cell number was counted. The
total amount thereof was transferred to EpiLife added with all of
the HCGS growth additive set (insulin, epidermal growth factor mEGF
derived from mouse, hydrocortisone, transferrin, bovine brain
hypophysis extract) (4 mL, complete medium), and suspended well
therein. The cell suspension was seeded on a fibronectin-coated 24
well plate (Becton Dickinson) at a cell number of 2.times.10.sup.4
cells/500 .mu.L/well (1.times.10.sup.4 cells/cm.sup.2 since bottom
area was 2 cm.sup.2).
[0072] After completion of cell seeding, the culture plate was
incubated in an incubator set to 37.degree. C., 5% CO.sub.2, 95%
air and 100% humidity for 24 hr. and the culture medium was changed
to 400 .mu.L of the basal medium (EpiLife added with insulin,
hydrocortisone and transferrin from HCGS growth additives).
[0073] After 24 hr thereafter, the culture medium was changed to
the following culture medium (each 400 .mu.L).
[1] basal medium alone (non-addition group)
[2] basal medium+mEGF (final concentration: 1 ng/mL; positive
control group)
[3] basal medium+compound A (final concentration: 0.1 nm, 1 nM,
0.01 .mu.M, 0.1 .mu.M; compound A addition group)
[0074] Ethanol (5 .mu.L) was added to 1 mL each of culture media
[1] and [2] to uniformly set the ethanol concentration of all
culture media to 0.5%.
2) Measurement of Cell Number
[0075] After 24 hr from the start of the stimulation with compound
A, the culture supernatant was removed from each well, and a basal
medium added with 10% Cell Counting Kit-8 (DOJINDO) was dispensed
to each well by 200 .mu.L. After dispensing, the culture plate was
transferred to an incubator set to 37.degree. C., 5% CO.sub.2, 95%
air and 100% humidity and incubated for 2 hr. The supernatant (100
.mu.L) was transferred to a 96 well culture plate for tissue
culture (Corning), and the absorbance of each well at 450 nm was
measured with a microplate reader (Dainippon Sumitomo Pharma Co.,
Ltd.), and used as an index of cell number increase.
4. Statistical Analysis
[0076] The values of the positive control group and the compound A
addition group were calculated based on the average absorbance of
the non-addition group as 100%, and the non-addition group was
compared with the compound A addition group and positive control
group according to the Dunnett multiple comparison test
(one-tailed). A critical value of less than 5% as a result of the
test was judged as significant.
5. Test Results
[0077] The cell number increasing effect of each group is shown in
Table 1. The measured absorbances show that the cell number of the
positive control group and compound A addition group is
significantly higher than that of the non-addition group where the
cell number of the non-addition group is 100%, and an increase in
the cell number is suggested in these groups (p<0.01). From the
test results, it has been clarified that compound A increases the
cell number of normal human corneal epithelial cells.
TABLE-US-00001 TABLE 1 Cell number significant difference increase
rate (to non-addition group (%) group) non-addition group 100.0
.+-. 7.7 mEGF 147.5 .+-. 47.2 ** 10.sup.-10 M compound A 177.4 .+-.
20.8 ** 10.sup.-9 M compound A 169.0 .+-. 8.2 ** 10.sup.-8 M
compound A 187.4 .+-. 10.2 ** 10.sup.-7 M compound A 172.6 .+-.
16.0 ** The changes in the cell number when compound A was added to
cultivated normal human corneal epithelial cells are shown in the
values relative to the average value of the non-addition group as
100% (mean .+-. standard deviation, N = 3-4). **in the Table shows
a significant difference from the non-addition group (p <
0.01).
Experimental Example 2
Study of Promoting Action on Corneal Epithelial Wound Healing
1. Animal Used
[0078] Male Japanese white rabbits (KITAYAMA LABES Co., Ltd.) were
used. The experimental animals were used according to the
International Guiding Principles for Biomedical Research involving
Animals.
2. Preparation Method of Test Substance Instillation
[0079] Compound A was used as a test substance. Compound A was
dissolved in the following vehicle at 0.0005% or suspended in the
following vehicle at 0.005% and used as an instillation.
TABLE-US-00002 sodium dihydrogen phosphate dihydrate 0.05 g sodium
chloride 0.45 g ultra-pure water e.q. polysorbate 80 0.05 mL sodium
hydroxide e.q. total amount 50 mL (pH 7.0)
[0080] As a control for the compound A administration group, the
above-mentioned vehicle instillation group free of medicament was
used.
3. Experimental Method
1) Corneal Epithelial Scraping
[0081] Animals received intramuscular injection (1 mL/kg) of a
Selactal (2% xylazine; Bayer, Ltd.): Ketalar (5% ketamine; DAIICHI
SANO COMPANY, LIMITED)=1:1 mixture for systemic anesthesia, and
oxybuprocaine hydrochloride instillation (Benoxil instillation
0.4%; Santen Pharmaceutical CO., Ltd.) and then the eyeballs were
exposed. Using a trephine with a diameter of 10 mm, a mark
(diameter 10 mm) was stamped on the corneal epithelium in the
central part of the cornea, and the entire corneal epithelial layer
within the marked circle was scraped off with a handy rooter under
a stereomicroscope. After scraping, the corneal surface was washed
with physiological saline (OTSUKA PHARMACEUTICAL FACTORY, INC.),
and the corneal epithelial scraping treatment was completed by
placing the eyeball back in the orbitae.
2) Administration
[0082] Compound A instillation or an instillation vehicle was
instilled by 50 .mu.L each time into the treated eye with a
micropipette twice a day on the day of corneal epithelial scraping
and four times a day from the next day to the completion of the
test.
3) Evaluation
[0083] Using the time point when the corneal epithelial scraping
was completed in all animals as a test starting time (0 hr), the
area of corneal epithelium defect was quantified 40, 48, 56 and 64
hr later, based on which wound healing of the corneal epithelium
was evaluated. To be precise, 0.1% fluorescein sodium (Wako Pure
Chemical Industries, Ltd.) solution (10 .mu.L) was instilled into
the treated eye at each time point, and the anterior ocular segment
of the animals was immediately photographed using a slit lamp with
a blue filter, whereby the fluorescein-stained corneal epithelial
deficient region was recorded. The developed photograph was stored
as digital images on a computer, and the area of the
fluorescein-stained corneal epithelial defect was measured using an
image analysis software (Image-Pro Plus).
4, Statistical Analysis
[0084] The area of the fluorescein-stained corneal epithelial
defect measured at each time point was calculated based on the
initial value of each animal as 100%, and taken as the ratio of the
remaining corneal epithelial defect. The ratio of the remaining
corneal epithelial defect at each time point was compared between
the vehicle instillation group and compound A instillation group
using the t-test. A critical value of less than 5% as a result of
the test was judged as significant.
5. Test Results
[0085] The ratio of the raining corneal epithelial defect in the
vehicle instillation group, and 0.0005% and 0.005% compound A
instillation groups at each time point of the measurement is shown
in Table 2. It is shown that the ratio of the corneal epithelial
defect significantly decreased in the 0.005% compound A
instillation group in 40 hors from the corneal epithelial scraping.
The ratio significantly decreased in the 0.0005% and 0.005%
compound A instillation groups 48 hours later. From the test
results, it has been clarified that instillation of compound A
promotes wound healing of corneal epithelial defect. TABLE-US-00003
TABLE 2 0.0005% 0.005% vehicle compound A compound A installation
instillation instillation group group (%) group (%) group (%) 0 hr
100.0 .+-. 0.0 100.0 .+-. 0.0 100.0 .+-. 0.0 (initial value) 40 hr
later 28.1 .+-. 5.3 24.8 .+-. 2.7 18.6 .+-. 8.0* 48 hr later 18.1
.+-. 6.1 11.8 .+-. 2.9* 9.1 .+-. 6.4* 56 hr later 11.1 .+-. 8.1 3.8
.+-. 2.8 3.4 .+-. 3.7 64 hr later 5.1 .+-. 6.9 0.8 .+-. 1.4 0.9
.+-. 1.3 The ratio (%) of the remaining corneal epithelial defect
after the corneal epithelial scraping treatment of the rabbit eyes
was calculated for each animal based on the initial value as 100%
(mean .+-. standard deviation, N = 6). *in the Table shows a
significant difference from the vehicle instillation group (p <
0.05).
Experimental Example 3
Effect on Cell Number Increase in Meibomian Gland Epithelial
Cells
1. Preparation of Monkey Meibomian Gland Epithelial Cell
[0086] An eyelid of monkey isolated and stored in D-PBS was
transferred to a clean bench, and cell preparation was aseptically
performed as follows.
[0087] The isolated eyelid was immersed in 80% ethanol for 30 sec,
washed three times with D-PBS added with 1% penicillin-streptomycin
(Invitrogen), and transferred to a minimum essential medium (MEM;
Invitrogen). The adipose tissue and muscular tissue surrounding the
meibomian glandular tissue of the eyelid were removed under a
stereomicroscope. They were transferred to MEM containing 0.3 U/mL
collagenase A (Roche Diagnostics) and 2.4 U/mL dispase II (Roche
Diagnostics), and shaken at 37.degree. C. for 4 hr and at 4.degree.
C. overnight. The enzyme-treated tissue was set under a
stereomicroscope, and the eyelash and eyelid connective tissue were
removed to isolate the meibomian glandular tissue. Trypsin-EDTA (4
mL, Invitrogen) was added to the isolated glandular tissue, and the
mixture was incubated at 37.degree. C. for 10 min. After
incubation, MEM (5 mL) containing 10% FBS (Invitrogen) was added
thereto to stop the enzyme reaction, and the tissue constituting
cells were dispersed by repeated suction and discharge of the
mixture 5 times using an injection syringe equipped with a 21G
injection needle. The cell dispersion was passed through 100 .mu.m
and 40 .mu.m nylon filters (Cell Strainer; Falcon), and cell mass
and the like contained therein which could not be treated with the
enzyme were removed. The cell suspension passed through the filters
was collected in a centrifuge tube (50 mL) and centrifuged at room
temperature, 1,500 rpm for 5 min. To the cell layers containing the
object cells obtained by the centrifugation was added 80 .mu.L of
D-PBS containing 0.5% bovine serum albumin (BSA; Sigma-Aldrich),
and the cells were sufficiently suspended therein. Anti-Fibroblast
Microbeads (Militenyi Biotec, 20 .mu.L) was added thereto, and the
mixture was left standing at room temperature for 30 min. After
completion of the reaction with an antibody, 2 mL of D-PBS
containing 0.5% BSA was added thereto, and the mixture was
centrifuged again at room temperature, 1,500 rpm for 5 ml. To the
cell layers containing the object cells obtained by the
centrifugation was added 1 mL of D-PBS containing 0.5% BSA, and the
cells were sufficiently suspended therein. The suspension was added
dropwise to LD column (Militenyi Biotec) equilibrated in advance
with a column washing solution (D-PBS containing 2 mM EDTA (DOJINDO
LABORATORIES) and 0.5% BSA). Then, 2 mL of the column washing
solution was added dropwise to the LD column. During the period of
from immediately after dropwise addition of the cell suspension to
the completion of the dropwise addition of the column washing
solution, the antibody-unlabeled object cells (non-fibroblast) that
did not adsorb to the column were recovered in a 50 mL centrifuge
tube. The cells collected in the centrifuge tube were centrifuged
at room temperature, 1,500 rpm for 5 min, and the supernatant was
removed. The sediment was suspended in Defined Keratinocyte Serum
Free Medium (5 mL), centrifuged at room temperature, 1,500 rpm for
5 min, and removed the supernatant. Again, the residue was
suspended in DK-SFM (3 mL), centrifuged at room temperature and
1,500 rpm for 5 nm, and the supernatant was removed. The cells were
suspended in DK-SFM (2 mL) and seeded on a 6 well multi-well plate
for cell culture, which had been treated with collagen. The seeded
cells were cultured in Defined keratinocyte-Serum Free Medium
(DK-SFM; Invitrogen, attached Supplement was added as instructed in
the preparation protocol), cultured in an incubator (SANYO) set to
37.degree. C., 5% CO.sub.2, 95% air, 100% humidity, and the culture
medium was exchanged with a new one every 48 hr until the cells
became subconfluent.
2. Preparation Method of Test Substance Solution
[0088] As a test substance, compound A,
[4-[3-[2-(4-trifluoromethyl)phenyl-4-isopropyl-5-thiazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid (hereinafter to be referred to as compound
B) or
[4-[3-[2-(2-hydroxy-4-chlorophenyl)-5-isopropyl-4-oxazolyl]propionyl]-2-m-
ethylphenoxy]acetic acid (hereinafter to be referred to as compound
C) was used. The test substance was dissolved in ethanol (Nacalai
Tesque) to a concentration 200-fold of the final concentration in a
culture medium, and the solution was stored at -80.degree. C. until
immediately before use.
[0089] For consideration of cell proliferation promoting effect by
the test substance, a culture medium obtained by removing the
supplement attached to DK-SFM from DK-SFM was used as a basal
medium (basal DK-SFM). As a positive control for confirmation of
the cell proliferation promoting effect, a culture medium (complete
DK-SFM) was used, which was obtained by adding the attached
supplement to the basal medium.
3. Test Method
1) Collagen Treatment of Culture Plate
[0090] The day before using a culture plate, 50 .mu.L of 0.01% type
I collagen (Nitta Gelatin Inc.) was dispensed to each well of the
culture plate, and allowed to coat the well at 4.degree. C. until
immediately before the test. On the day of the test, the type I
collagen solution was removed and the bottom of the culture plate
was washed three times with D-PBS, and used for the test as a
collagen-treated culture plate.
2) Cell Culture and Addition of Test Substance
[0091] For the test, monkey meibomian gland epithelial cells were
used, which had been cultured to sub-confluent in a culture plate
(diameter 3.5 cm) and cryopreserved in liquid nitrogen. The cells
suspended in Cellbanker (Nippon Zenyaku Kogyo Co., Ltd.) and
cryopreserved were thawed, and transferred to a 50 mL centrifuge
tube, and 10-fold amount of complete DK-SFM was added. The cell
layers were collected by centrifugation at room temperature, 1,500
rpm for 5 min. A suitable amount of complete DK-SFM was added to a
concentration of the obtained cells of 3.times.10.sup.6 cells/mL.
The cell suspension was dispensed to each well by 64 .mu.L such
that the cell number was 6.times.10.sup.4 cells/cm.sup.2 per the
bottom area (0.32 cm.sup.2) of the collagen-treated 96-well culture
plate for tissue culture. After completion of the cell seeding, the
culture plate was transferred to an incubator set to 37.degree. C.,
5% CO.sub.2, 95% air, 100% humidity and cultured for 24 hr. The
culture medium was exchanged with basal DK-SFM (100 .mu.L) and
further cultured for 24 hr. Then, the culture medium in each well
of the culture plate was exchanged with 100 .mu.L each of the
following culture medium, the culture plate was placed back in the
incubator and cell stimulation was started.
[1] basal medium alone (basal DK-SFM, non-addition group)
[2] basal medium+supplement (complete DK-SFM positive control
group)
[3] basal medium+compound A (final concentration: 0.01 .mu.M, 0.1
.mu.M and 1 .mu.M; compound A addition group)
[4] basal medium+compound B (final concentration: 0.01 .mu.M, 0.1
.mu.M and 1 .mu.M; compound B addition group)
[5] basal medium+compound C (final concentration: 0.01 .mu.M, 0.1
.mu.M and 1 .mu.M; compound C addition group)
[0092] Ethanol (5 .mu.L) was added to 1 mL each of culture media
[1] and [2] to uniformly set the ethanol concentration of all
culture media to 0.5%.
2) Measurement of Cell Number
[0093] After 48 hr from the first cell stimulation, the culture
medium was exchanged with the culture medium of the above-mentioned
[1]-[5] prepared anew. After 48 hr, the culture medium was
exchanged again with the culture medium of the above-mentioned
[1]-[5] prepared anew. After 48 hr, the culture supernatant was
removed from each well, and a basal medium added with 10% Cell
Counting Kit-8 (DOJINDO) was dispensed to each well by 100 .mu.L.
After dispensing, the culture plate was transferred to an incubator
set to 37.degree. C., 5% CO.sub.2, 95% air and 100% humidity and
incubated for 2 hr. After incubation for 2 hr, the absorbance at
450 nm was measured with a microplate reader (Dainippon Sumitomo
Pharma Co., Ltd.), and used as an index of cell number
increase.
4. Statistical Analysis
[0094] The values of each of the positive control group and the
test substance addition group were calculated based on the so
average absorbance of the non-addition group as 100%, and the
non-addition group was compared with the test substance addition
group and positive control group according to the Dunnett multiple
comparison test (one-tailed). A critical value of less than 5% as a
result of the test was judged as significant.
5. Test Results
[0095] The cell number increase promoting effect of each group is
shown in Table 3. The measured absorbances show that the increase
in the cell number of each test substance addition group is
significantly higher than that of the non-addition group where the
cell number of the non-addition group is 100%, and an increase in
the cell number is suggested. In the positive control group for
confirmation of the cell number increase promoting effect, a
tendency toward cell number increase was observed, though not
significant. From the test results, it has been clarified that each
test substance increases the number of monkey meibomian gland
epithelial cells. TABLE-US-00004 TABLE 3 cell number significant
increase ratio difference (to non- group (%) addition group)
non-addition group 100.0 .+-. 7.1 supplement 114.2 .+-. 6.7
10.sup.-8 M compound A 175.3 .+-. 9.0 ** 10.sup.-7 M compound A
177.1 .+-. 9.7 ** 10.sup.-6 M compound A 189.8 .+-. 13.1 **
10.sup.-8 M compound B 155.0 .+-. 28.0 ** 10.sup.-7 M compound B
174.4 .+-. 8.9 ** 10.sup.-6 M compound B 158.8 .+-. 15.2 **
10.sup.-8 M compound C 155.0 .+-. 11.6 ** 10.sup.-7 M compound C
175.2 .+-. 7.8 ** 10.sup.-6 M compound C 179.4 .+-. 7.5 ** The
changes in the cell number when each test substance or supplement
(positive control) was added to cultured monkey meibomian gland
epithelial cells are shown in values based on the average value of
the non-addition group as 100% (mean .+-. standard deviation, N = 5
or 10). **in the Table shows a significant difference from the
non-addition group (p < 0.01).
Experimental Example 4
Effect on Increase of Cell Number of Normal Human Corneal
Epithelial Cells
1. Cells Used
[0096] Normal human corneal epithelial cells (KURABO) were
used.
2. Test Substance and Preparation Method
[0097] As a test substance, compound B or compound C was used.
Compound B and compound C were each dissolved in ethanol (Wako Pure
Chemical Industries, Ltd.) to a concentration 200-fold of, the
final concentration in a culture medium, and the solution was
stored at -80.degree. C. until immediately before use.
[0098] As a cell culture medium for consideration of the cell
number-increasing effect by compound B and compound C, a culture
medium (basal medium) obtained by adding insulin, hydrocortisone
and transferrin contained in HOGS growth additive set (KURABO) to
EpiLife (KURABO) was used.
3. Test Method
1) Cell Culture and Addition of Test Substance
[0099] Normal human corneal epithelial cells cryopreserved in
liquid nitrogen were thawed and the cell number was counted. The
total amount thereof was transferred to EpiLife added with all of
the HCGS growth additive set (insulin, epidermal growth factor mEGF
derived from mouse, hydrocortisone, transferrin, bovine brain
hypophysis extract) (4 mL, complete medium), and suspended well
therein. The cell suspension was seeded on a fibronectin-coated 24
well plate (Becton Dickinson) at a cell number of 2.times.10.sup.4
cells/500 .mu.L/well (1.times.10.sup.4 cells/cm.sup.2 since bottom
area was 2 cm.sup.2). After completion of cell seeding, the culture
plate was incubated in an incubator set to 37.degree. C., 5%
CO.sub.2, 95% air and 100% humidity for 24 hr. and the culture
medium was changed to 400 .mu.L of the basal medium (EpiLife added
with insulin, hydrocortisone and transferrin from HCGS growth
additives). After 24 hr thereafter, the culture medium was changed
to the following culture medium (each 400 .mu.L).
[1] basal medium alone (non-addition group)
[2] basal medium+mEGF (final concentration: 1 ng/mL; positive
control group)
[3] basal medium+compound B (final concentration, 0.01 .mu.M, 0.1
.mu.M, 1 .mu.M; compound B addition group)
[4] basal medium+compound C (final concentration: 0.01 .mu.M, 0.1
.mu.M; compound C addition group)
[0100] Ethanol (5 .mu.L) was added to 1 mL each of culture media
[1] and [2] to uniformly set the ethanol concentration of all
culture media to 0.5%.
2) Measurement of Cell Number
[0101] After 24 hr from the start of the stimulation with compound
B or compound C, the culture supernatant was removed from each
well, and a basal medium added with 10% Cell Counting Kit-8
(DOJINDO) was dispensed to each well by 200 .mu.L. After
dispensing, the culture plate was transferred to an incubator set
to 37.degree. C., 59% CO.sub.2, 95% air and 100% humidity and
incubated for 2 hr. The supernatant (100 .mu.L) was transferred to
a 96 well culture plate for tissue culture (Corning), and the
absorbance of each well at 450 nm was measured with a microplate
reader (Dainippon Sumitomo Pharma Co., Ltd.), and used as an index
of cell number increase.
4. Statistical Analysis
[0102] The values of the positive control group and the compound B
or compound C addition group were calculated based on the average
absorbance of the non-addition group as 100%, and the non-addition
group was compared with the compound B or compound C addition group
and positive control group according to the Dunnett multiple
comparison test (one-tailed). A critical value of less than 5% as a
result of the test was judged as significant.
5. Test Results
[0103] The cell number increasing effect of each group is shown in
Table 4. The measured absorbances show that the cell number of the
positive control group, compound B addition group, and compound C
addition group is significantly higher than that of the
non-addition group where increase in the cell number of the
non-addition group is 100%, and an increase in the cell number is
suggested in these groups (p<0.01). From the test results, it
has been clarified that both compound B and compound C increase the
cell number of normal human corneal epithelial cells.
TABLE-US-00005 TABLE 4 significant cell number difference (to non-
group increase rate (%) addition group) non-addition goup 100.0
.+-. 32.2 mEGF 232.8 .+-. 22.5 ** 10.sup.-8 M compound B 252.4 .+-.
34.7 ** 10.sup.-7 M compound B 256.4 .+-. 11.0 ** 10.sup.-6 M
compound B 254.3 .+-. 11.7 ** 10.sup.-8 M compound C 243.3 .+-. 6.6
** 10.sup.-7 M compound C 247.5 .+-. 14.1 ** 10.sup.-6 M compound C
260.2 .+-. 2.5 ** The changes in the cell number when compound B or
compound C was added to cultivated normal human corneal epithelial
cells are shown in the values relative to the average value of the
non-addition group as 100% (mean .+-. standard deviation, N = 4).
**in the Table shows a significant difference from the non-addition
group (p < 0.01).
Experimental Example 5
Expression of PPARs in Corneal Epithelial Cell and Meibomian Gland
Epithelial Cell
1. Cells Used
[0104] Monkey meibomian gland epithelial cells used were those
prepared and cultured by a method similar to (Experimental Example
3). Human corneal epithelial cells (KURABO) used were those
cultured in a incubator set to 37.degree. C., 5% CO.sub.2, 95% air,
100% humidity in a serum-free basal medium for normal human corneal
epithelial cell proliferation (EpiLife; KURABO). Rabbit corneal
epithelial cells used were those prepared and cultured by the
following method.
[0105] Cornea was cut out from the eyeballs isolated from an
euthanized rabbit, stored in Dulbecco's phosphate buffered saline
(D-PBS; Invitrogen) and transferred to a clean bench. The following
cell preparation operations were all performed aseptically.
[0106] The isolated corneal button was washed three times in D-PBS
added with 1% penicillin-streptomycin (Invitrogen), and transferred
to a minimum essential medium (MEM; Invitrogen). Corneal
endothelium cells and Descemet's membrane of the corneal button
immersed in MEM were detached with a knife for eye surgery (Alcon),
and the detached corneal button (corneal stroma and corneal
epithelium) was transferred to MEM added with dispase II (Roche
Diagnostics) at 2.4 U/mL. This was incubated at 37.degree. C. for 1
hr, and the corneal button treated with dispase II was transferred
to MEM. The corneal epithelium of the corneal button immersed in
MEM was detached with a knife for eye surgery, and corneal button
residue (corneal stroma) was removed from the MEM. The MEN
containing the detached corneal epithelial cells was collected in a
50 mL centrifuge tube, centrifuged at room temperature, 1,500 rpm
for 5 min and the supernatant was discarded to give corneal
epithelial cell layers. To the corneal epithelial cell layers was
added 1 mL of trypsin-EDTA (Invitrogen) and the mixture was mixed
well and incubated at 37.degree. C. for 5 min to eliminate
cell-cell adhesion. Thereto was added 9 mL of M containing 10%
fetal bovine serum (FBS; Invitrogen) to stop the enzyme reaction,
and the mixture was centrifuged again at room temperature, 1,500
rpm for 5 min to give corneal epithelial cell layers. To the
obtained corneal epithelial cell layers was added 1 mL of a
serum-free liquid medium for normal rabbit corneal epithelial cell
growth (RCGM2; KURABO) to suspend the cells therein, and the cells
were seeded in a cell culture plate (diameter 10 cm, IWAKI) added
with 9 mL of RCGM2. The seeded cells were cultured in a incubator
(SANYO) set to 37.degree. C., 5% CO.sub.2, 95% air, 100% humidity.
The culture medium was exchanged with a new one every 48 hr until
the day of the test.
2. Test Method
1) Extraction of Total RNA from Cell
[0107] Total RNA was extracted from each cell according to a
conventional method for TRIzol Reagent (Invitrogen).
2) Preparation of cDNA from Extracted Total RNA
[0108] The total RNA extracted was treated with DNase at 37.degree.
C. for 30 min to remove genomic DNA according to a conventional
method for DNA-free (Ambion).
[0109] cDNA was prepared from the extracted total RNA according to
a conventional method for Superscript II Reverse Transcriptase
(Invitrogen). That is, cDNA complementary to the total RNA treated
with DNase was prepared from 1 .mu.g of the total RNA using a
random primer (Invitrogen).
3) Amplification of PPARs Gene (Polymerase Chain Reaction; PCR)
[0110] PCR of PPARs gene was performed according to a conventional
method for Platinum PCR SuperMix (Invitrogen). The PPARs primer was
designed such that the PCR product became about 200 bps in
reference to the known sequences of human, chimpanzee, Macaca
fascicularis, bovine, mouse and the like. TABLE-US-00006 (SEQ ID
NO: 1) PPAR.alpha.:GTAGAATCTGCGGGGACAAG (sense) (SEQ ID NO: 2)
:GTTGTGTGACATCCCGACAG (antisense) (SEQ ID NO: 3)
PPAR.delta.:TTCCTTCCAGCAGCTACACA (sense) (SEQ ID NO: 4)
:GATCGTACGACGGAAGAAGC (antisense) (SEQ ID NO: 5)
PPAR.gamma.:CTCCGTGGATCTCTCCGTAA (sense) (SEQ ID NO: 6)
:GATGCAGGCTCCACTTTGAT (antisense)
[0111] The PCR reaction was completed by a reaction at 94.degree.
C. for 2 min 15 sec. followed by 35 cycles of 3-step reactions at
94.degree. C. for 30 sec, 55.degree. C. for 30 sec and 72.degree.
C. for 30 sec. The sample after PCR reaction was electrophoresed on
2% agarose gel, and DNA separated in the gel was stained with SYBR
Gold (Molecular Probes). The images of the stained DNA luminescent
on a UV transilluminator were stored as digital data.
3. Test Results
[0112] The bands of the DNA after electrophoresis are shown in FIG.
1. As a result of this test, it was confirmed that all of
PPAR.alpha., PPAR.delta. and PPAR.gamma. were expressed in human
corneal epithelial cells and monkey meibomian gland epithelial
cells. In rabbit corneal epithelial cells, only the expression of
PPAR.delta. was confirmed. Bonazzi et al., report that PPAR.alpha.
and PPAR.beta. (=.delta.) from PPARs are expressed in rabbit
corneal epithelial cells (Bonazzi A. et al., J. Biol. Chem. (2000);
275 (4): 2837-2844). In the report, they used a special method to
detect PPAR.alpha., which suggests that the PPAR.alpha. expression
level in rabbit corneal epithelial cells is extremely small.
INDUSTRIAL APPLICABILITY
[0113] According to the present invention, a novel agent for
promoting proliferation of meibomian gland epithelial cells or a
novel agent for promoting proliferation of corneal epithelial cells
is provided, and the agent promotes proliferation of meibomian
gland epithelial cells or corneal epithelial cells. In addition,
the therapeutic agent of the present invention can be effectively
used for the treatment or improvement of diseases such as meibomian
gland dysfunction, corneal epithelial disorder, dry eye and the
like.
[0114] This application is based on a patent application No.
2007-134183 filed in Japan (filing date: May 21, 2007), the
contents of which are incorporated in full herein by this
reference.
Sequence CWU 1
1
6 1 20 DNA Artificial sequence Synthetic construct; primer 1
gtagaatctg cggggacaag 20 2 20 DNA Artificial sequence Synthetic
construct; primer 2 gttgtgtgac atcccgacag 20 3 20 DNA Artificial
sequence Synthetic construct; primer 3 ttccttccag cagctacaca 20 4
20 DNA Artificial sequence Synthetic construct; primer 4 gatcgtacga
cggaagaagc 20 5 20 DNA Artificial sequence Synthetic construct;
primer 5 ctccgtggat ctctccgtaa 20 6 20 DNA Artificial sequence
Synthetic construct; primer 6 gatgcaggct ccactttgat 20
* * * * *