U.S. patent application number 13/147484 was filed with the patent office on 2012-10-11 for methods for the detection of jc polyoma virus.
This patent application is currently assigned to BIOGEN IDEC MA INC.. Invention is credited to Leonid Gorelik, Alexey Lugovskoy.
Application Number | 20120258443 13/147484 |
Document ID | / |
Family ID | 42542341 |
Filed Date | 2012-10-11 |
United States Patent
Application |
20120258443 |
Kind Code |
A1 |
Gorelik; Leonid ; et
al. |
October 11, 2012 |
METHODS FOR THE DETECTION OF JC POLYOMA VIRUS
Abstract
Methods and compositions for determining whether a subject is at
risk for PML, including subjects being treated with
immunosuppressants, by determining whether the subject harbors a
JCV variant with reduced binding for sialic acid relative to a
normal JCV, are presented. Furthermore, combinations of JCV-VP1
sequence variations that are associated with PML and that can be
used as a basis of an assay for identifying subjects susceptible to
PML, subjects with PML (e.g., early stage PML), or subjects at risk
of developing PML in response to an immunosuppressive treatment are
provided.
Inventors: |
Gorelik; Leonid; (Quincy,
MA) ; Lugovskoy; Alexey; (Woburn, MA) |
Assignee: |
BIOGEN IDEC MA INC.
Cambridge
MA
|
Family ID: |
42542341 |
Appl. No.: |
13/147484 |
Filed: |
February 5, 2010 |
PCT Filed: |
February 5, 2010 |
PCT NO: |
PCT/US10/00342 |
371 Date: |
June 25, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61150310 |
Feb 5, 2009 |
|
|
|
Current U.S.
Class: |
435/5 |
Current CPC
Class: |
G01N 2800/28 20130101;
G01N 2333/025 20130101; G01N 2469/20 20130101; G01N 2800/50
20130101; C07K 16/081 20130101; G01N 2800/52 20130101; G01N
33/56983 20130101; C07K 2317/33 20130101 |
Class at
Publication: |
435/5 |
International
Class: |
C12Q 1/70 20060101
C12Q001/70; G01N 33/569 20060101 G01N033/569 |
Claims
1. A method comprising: interrogating a biological sample from a
subject for at least one indicium of a variant JCV VP1 capsid
protein that comprises a substitution of amino acid residue 122,
and wherein the subject is determined to have an increased
susceptibility for PML if the sample comprises the at least one
indicium.
2. The method of claim 1, further comprising interrogating the
biological sample for at least one indicium of a variant JCV VP1
capsid protein that comprises a substitution of at least one of
amino acid residues 2, and 66.
3. The method of claim 2, wherein the sample is interrogated using
an assay capable of detecting at least one indicium of each of
variant JCV VP1 capsid proteins having a substitution of at least
one of amino acid residues 2, 66, and 122, and wherein the subject
is determined to have an increased susceptibility for PML if the
sample comprises at least one indicium of at least one of the
variant JCV VP1 capsid proteins.
4. The method of claim 1, further comprising interrogating the
biological sample for at least one indicium of a variant JCV VP1
capsid protein that comprises a deletion of one or more of amino
acid fragments 50-51, 54-55 and 123-125.
5. The method of claim 4, wherein the sample is interrogated using
an assay capable of detecting at least one indicium of each of
variant JCV VP1 capsid proteins having a deletion of at least one
of amino acid fragments 50-51, 54-55 and 123-125, and wherein the
subject is determined to have an increased susceptibility for PML
if the sample comprises at least one indicium of at least one of
the variant JCV VP1 capsid proteins.
6. The method of claim 1, further comprising interrogating the
biological sample for at least one indicium of a variant JCV VP1
capsid protein suspected of having low sialic acid binding.
7. The method of claim 1, further comprising interrogating the
biological sample for at least one indicium of a variant JCV VP1
capsid protein that comprises a substitution of at least one of
amino acid residues 55, 60, 265, 267, and 269.
8. The method of claim 7, wherein the sample is interrogated using
an assay capable of detecting at least one indicium of each of
variant JCV VP1 capsid proteins having a substitution of at least
one of amino acid residues 55, 60, 265, 267, and 269, and wherein
the subject is determined to have an increased susceptibility for
PML if the sample comprises at least one indicium of at least one
of the variant JCV VP1 capsid proteins.
9. The method of claim 1, wherein the biological sample is a blood
sample.
10. The method of claim 1, wherein the biological sample is a CSF
sample.
11. The method of claim 1, wherein the biological sample is a urine
sample.
12. The method of claim 1, wherein the subject is known to have
been previously infected with a wild-type JCV.
13. The method of claim 12, wherein a new biological sample from
the subject is interrogated for at least one indicium of at least
one variant JCV VP1 capsid protein at least twice each year.
14. The method of claim 1, wherein the detection of at least one
indicium of a variant JCV VP1 capsid protein is used to identify
the subject as inappropriate for an immunosuppressive
treatment.
15. The method of claim 1, wherein the detection of at least one
indicium of a variant JCV VP1 capsid protein is used to recommend a
modification of an immunosuppressive treatment for the subject.
16. The method of claim 1, wherein the absence of indicia of a
variant JCV VP1 capsid protein is used to identify the subject as
appropriate for an immuno suppressive treatment.
17. The method of claim 1, wherein the absence of indicia of a
variant JCV VP1 capsid protein is used to identify the subject as
appropriate for continued immunosuppressive treatment.
18. The method of claim 1, wherein the biological sample is
interrogated for the presence of an antibody that is specific for a
variant JCV VP1 capsid protein.
19. (canceled)
20. The method of claim 1, wherein the biological sample is
interrogated for the presence of a variant JCV VP1 capsid
protein.
21. The method of claim 1, wherein the biological sample is
interrogated for the presence of a nucleic acid sequence that
encodes a variant JCV VP1 capsid protein.
22. The method of claim 20, wherein the biological sample is
interrogated using an ELISA based analysis.
Description
RELATED APPLICATIONS
[0001] This application claims the benefit under 35 U.S.C.
.sctn.119(e) from U.S. provisional application Ser. No. 61/150,310
entitled "Methods for the Detection of JC Polyoma Virus" filed Feb.
5, 2009, the disclosure of which is incorporated herein by
reference.
FIELD OF THE INVENTION
[0002] The invention relates to methods for the detection of the
human JC polyomavirus virus, diagnosis of progressive multifocal
leukoencephalopathy (PML), and the development of therapeutics for
PML.
BACKGROUND OF THE INVENTION
[0003] JC polyomavirus (JCV) infection in humans can cause a
demyelinating disease of the central nervous system, progressive
multifocal leukoencephalopathy (PML). However, JCV infection
usually does not result in PML in healthy subjects. JCV infection
is prevalent in many human populations without causing widespread
PML. PML typically only develops in JCV-infected subjects that also
have a weakened immune system. Subjects that are immuno-compromised
due to a disease or an immunosuppressive treatment may be
vulnerable to PML associated with a JCV infection.
SUMMARY OF THE INVENTION
[0004] Aspects of the invention relate to methods and compositions
for determining whether a subject is susceptible to PML. In
particular, the invention provides methods and compositions for
determining whether a subject is at risk of developing PML if the
subject's immune system is compromised or suppressed. For example,
aspects of the invention relate to determining whether a subject is
suitable for an initial or continued treatment with an
immunosuppressive agent by determining the subject's risk profile
for developing PML caused by a JCV infection.
[0005] The human genome is exposed to and may acquire many viruses
during the lifetime of an individual. One example of such a virus
is JC polyomavirus (JCV). JC virus infection is highly prevalent in
humans. Primary infection with JCV occurs asymptomatically during
childhood (Padgett & Walker, 1973). JCV is then disseminated
throughout the body, probably through viraemia (Ikegaya et al.,
2004). It is thought that JCV persist mostly in brain and renal
tissue. While infection by JCV is asymptomatic in most subjects,
infection may result in serious conditions (like PML) and even
death in some subjects. Subjects most susceptible to PML are
subjects that are immuno-compromised (e.g., AIDS patients) or
subjects undergoing treatment with immuno-suppressants (for
instance after organ transplant or to treat an inflammation related
condition such as multiple sclerosis). The present invention
provides JCV variants, identifies a panel of variants including
novel variants that are associated with increased PML risk, and
methods related to discoveries of structural and functional
connections between JCV variants and PML.
[0006] A "wild type" JCV sequence is used herein to refer to the
sequence of any of the archetypes of JCV found in healthy subjects
not having PML, and/or not being at risk for PML. In some
embodiments, a consensus "wild type" reference sequence may be an
average of sequences found in a group of healthy individuals. The
discrepancy between high viral prevalence and low incidence of PML
suggests that, in addition to immune dysfunction, there could be
some unique viral characteristics that regulate the progression
from the asymptomatic infection to the PML. In some embodiments,
aspects of the invention relate to the discovery that the part of
the viral surface protein that is responsible for viral interaction
with cellular receptors and host cell infection acquires specific
amino acid mutations in the patient somewhere en route from the
kidney, the site of asymptomatic infection, to the CNS, the site of
PML. Furthermore, in some embodiments PML-specific mutations change
the ability of the viral capsid to bind various sialic acids and a
variety of peripheral cell types but retain the ability to bind to
CNS glial cells.
[0007] Based on the mathematical analysis of the published VP1
sequences from PML and non-PML patients, a positive selection of
specific amino acid variants during PML is provided. However, since
publicly available PML sequences were obtained from CSF or brain
tissues of PML patients whereas non-PML sequences were obtained
from the urine of healthy subjects, just based on the analysis of
Genebank samples it could not unequivocally be demonstrated whether
these amino acid variants were produced via a viral mutation in the
patients or represented one or more rare viral variants that occur
in all JCV clades and are enriched (e.g., positively selected) in
PML cases as being more likely to be causing PML. According to
aspects of the invention, VP1 substitutions occur within the
patient and can lead to PML. This is supported by the analysis of
matched urine-CSF and urine-plasma samples from the same patient
taken at the same time point. CSF and plasma VP1 sequences from PML
patients contained single amino acid substitutions or deletions of
several amino acids relative to VP1 sequences isolated from the
urine of the same patient. As shown herein, JC viral types found in
the CSF, plasma, and urine of the same individual were of the same
viral strain, whereas different patients carried different strains.
Therefore, but without wishing to be bound by theory, the presence
of VP1 amino acid substitutions in the CSF, but not in urine,
results from the appearance of a mutation within a patient rather
than by a dual infection with two different viral variants.
[0008] Some of the amino acid substitutions detected in the CSF and
plasma of PML patients were previously described. However, these
substitutions had not been directly correlated with increased PML
risk and their structural and functional properties had not been
associated with aspects of PML development and progression.
Additional JCV VP1 mutations and/or deletions associated with PML
also are provided herein.
[0009] According to aspects of the invention, substitutions in the
VP1 protein may be more important for determining early disease
progression (e.g., by enabling the virus to migrate from the
periphery to the CNS and infecting CNS cells) rather than
determining different outcomes in different clinical contexts.
However, in some embodiments there may be an association between
the type of mutation present in VP1 and certain clinical
measurements. For example, lower JCV CSF replication levels were
observed in patients with non-mutated virus or virus carrying
mutations/deletions at positions 122-134. It also is possible that
since mutations affect the strength of viral interaction with
cellular receptors, viral release from dead cells also may be
hindered for a virus that binds to those receptors tightly.
Accordingly, a virus that has a weaker cell binding avidity may be
found to be released into the extracellular space more abundantly.
This is consistent with the observation that mutants at positions
55-61 and 265-271 lose their ability to bind to sialic acid
receptors relative to non-mutated virus, and thus might have a
better ability to detach from cell debris (after the virus kills
the host cell) and find their way to the CSF.
[0010] Accordingly, even though a subject may be concurrently
infected with several different versions of JCV (e.g., with
different variants in different tissues or organs), PML associated
mutations is more likely to arise from an existing JCV virus
population in an individual that is infected with a wild-type
JCV.
[0011] Aspects of the invention are based, at least in part, on the
discovery that certain types of mutations in the JCV capsid protein
are associated with the conversion of an asymptomatic form of JCV
infection into a PML-associated form of JCV. According to aspects
of the invention, without committing to any particular mechanism,
mutations that disrupt the ability of a JCV particle to bind to or
interact with sialic acid can result in the virus no longer being
contained in the peripheral compartment of a subject and result in
the virus obtaining freer passage to the CNS, a site of PML
disease. In some embodiments, these mutations allow virus to
achieve that by avoiding "trapping" on certain glycoproteins and
glycolipid pseudoreceptors expressed in peripheral organs and
cells, including but not limited to immune cells and red blood
cells. Additionally, as some of these sites are targets on normal
host immune response (antibody and T-cell) these mutations may
allow virus evading recognition by the immune system, particularly
in subjects with weakened immune systems.
[0012] Aspects of the invention provide methods and compositions
for evaluating a subject's risk profile for PML.
[0013] In some embodiments, aspects of the invention relate to
determining whether a subject has been exposed to an infection by
any JCV variant. In some aspects, infection by a wild-type JCV
variant may increase the risk profile for PML since PML associated
mutations may arise from the wild-type JCV, even though these may
be rare events. Accordingly, in some embodiments, a subject may be
tested for the presence of one or more indicia of JCV infection
(e.g., detection of viral proteins or nucleic acid, or indirectly
via the detection of an immune response to a JCV infection, e.g.,
in the form of serum antibodies to JCV viral proteins). It should
be appreciated that indicia of any JCV infection (e.g., wild-type
or variant) may be evaluated. If a subject has already been exposed
to a JCV infection, then the subject may be identified as having a
higher risk profile than a non-infected subject. Accordingly, a
JCV-infected subject that is being treated with an
immunosuppressive agent, may be evaluated for specific JCV
mutations or may be monitored more frequently than a non-infected
subject.
[0014] In some embodiments, a subject that is being treated with
(or is going to start a treatment with) an immunosuppressive agent
is tested for one or more indicia of JCV infection. If one or more
indicia of JCV infection are detected, the subject may be evaluated
for the presence of one or more JCV variants associated with PML as
described herein. If no indicia for JCV are detected, the subject
may be monitored over time, e.g., every 4 weeks, monthly, every
three months, every 4 months, every 6 months, or every 12 months,
for the presence of any indicia of JCV infection. If a JCV
infection is detected, the subject may be further evaluated for the
presence of one or more JCV variants. If a JCV variant associated
with increased PML risk is detected, the subject may be further
monitored to detect any early signs of PML and/or the treatment
regimen may be altered as described in more detail herein.
[0015] In one aspect the invention provides a method comprising
interrogating a biological sample from a subject for at least one
indicium of a variant JCV VP1 capsid protein that comprises a
substitution of amino acid residue 122, and wherein the subject is
determined to have an increased susceptibility for PML if the
sample comprises the at least one indicium.
[0016] In one aspect the invention provides a method comprising
interrogating a biological sample from a subject for at least one
indicium of a variant XV VP1 capsid protein that comprises a
substitution of amino acid residue 2, and wherein the subject is
determined to have an increased susceptibility for PML if the
sample comprises the at least one indicium.
[0017] In one aspect the invention provides a method comprising
interrogating a biological sample from a subject for at least one
indicium of a variant JCV VP1 capsid protein that comprises a
substitution of amino acid residue 66, and wherein the subject is
determined to have an increased susceptibility for PML if the
sample comprises the at least one indicium.
[0018] In one aspect the invention provides a method comprising
interrogating a biological sample from a subject for at least one
indicium of a variant JCV VP1 capsid protein that comprises a
substitution of amino acid residue 283, and wherein the subject is
determined to have an increased susceptibility for PML if the
sample comprises the at least one indicium.
[0019] In some embodiments the method further comprises
interrogating the biological sample for at least one indicium of a
variant JCV VP1 capsid protein that comprises a substitution of at
least one of amino acid residues 2 and 66. In some embodiments the
method further comprises interrogating the biological sample for at
least one indicium of a variant JCV VP1 capsid protein that
comprises a substitution of at least one of amino acid residues 122
and 66. In some embodiments the method further comprises
interrogating the biological sample for at least one indicium of a
variant JCV VP1 capsid protein that comprises a substitution of at
least one of amino acid residues 2 and 122. In some embodiments the
sample is interrogated using an assay capable of detecting at least
one indicium of each of variant JCV VP1 capsid proteins having a
substitution of at least one of amino acid residues 2, 66, and 122,
and wherein the subject is determined to have an increased
susceptibility for PML if the sample comprises at least one
indicium of at least one of the variant JCV VP1 capsid proteins. In
some embodiments the sample is interrogated using an assay capable
of detecting at least one indicium of each of variant JCV VP1
capsid proteins having a substitution of at least one of amino acid
residues 2, 66, 122 and 283 and wherein the subject is determined
to have an increased susceptibility for PML if the sample comprises
at least one indicium of at least one of the variant JCV VP1 capsid
proteins.
[0020] In some embodiments the method further comprises
interrogating the biological sample for at least one indicium of a
variant JCV VP1 capsid protein that comprises a deletion of amino
acid fragment 50-51. In some embodiments the method further
comprises interrogating the biological sample for at least one
indicium of a variant JCV VP1 capsid protein that comprises a
deletion of amino acid fragment 54-55. In some embodiments the
method further comprises interrogating the biological sample for at
least one indicium of a variant JCV VP1 capsid protein that
comprises a deletion of amino acid fragment 123-125. In some
embodiments the method further comprises interrogating the
biological sample for at least one indicium of a variant JCV VP1
capsid protein that comprises a deletion of amino acid fragment
125-134. In some embodiments the method further comprises
interrogating the biological sample for at least one indicium of a
variant JCV VP1 capsid protein that comprises a deletion of amino
acid fragment 125-136.
[0021] In some embodiments the method further comprises
interrogating the biological sample for at least one indicium of a
variant JCV VP1 capsid protein that comprises a deletion of one or
more of amino acid fragments 50-51, 54-55 and 123-125. In some
embodiments the sample is interrogated using an assay capable of
detecting at least one indicium of each of variant JCV VP1 capsid
proteins having a deletion of at least one of amino acid fragments
50-51, 54-55 and 123-125, and wherein the subject is determined to
have an increased susceptibility for PML if the sample comprises at
least one indicium of at least one of the variant JCV VP1 capsid
proteins.
[0022] In some embodiments the method further comprises
interrogating the biological sample for at least one indicium of a
variant JCV VP1 capsid protein suspected of having low sialic acid
binding.
[0023] In some embodiments the method further comprises
interrogating the biological sample for at least one indicium of a
variant JCV VP1 capsid protein that comprises a substitution of at
least one of amino acid residues 55, 60, 265, 267, and 269. In some
embodiments the sample is interrogated using an assay capable of
detecting at least one indicium of each of variant JCV VP1 capsid
proteins having a substitution of at least one of amino acid
residues 55, 60, 265, 267, and 269, and wherein the subject is
determined to have an increased susceptibility for PML if the
sample comprises at least one indicium of at least one of the
variant JCV VP1 capsid proteins.
[0024] In some embodiments the biological sample is a blood sample.
In some embodiments the biological sample is a CSF sample. In some
embodiments the biological sample is a urine sample.
[0025] In some embodiments the subject is known to have been
previously infected with a wild-type JCV. In some embodiments a new
biological sample from the subject is interrogated for at least one
indicium of at least one variant JCV VP1 capsid protein at least
twice each year. In some embodiments a new biological sample from
the subject is interrogated for at least one indicium of at least
one variant JCV VP1 capsid protein at least daily, weekly, monthly,
bimonthly, quarterly, twice each year, yearly, every two years or
every five years or any frequency in between.
[0026] In some embodiments the detection of at least one (e.g., 2,
3, 4, 5, or more) indicium of a variant JCV VP1 capsid protein is
used to identify the subject as inappropriate for an
immunosuppressive treatment. In some embodiments the detection of
at least one, at least two, at least three, at least four, at least
five, at least six, at least seven, at least 8, at least 9, at
least 10 or more indicia of a variant JCV VP1 capsid protein is
used to identify the subject as inappropriate for an
immunosuppressive treatment.
[0027] In some embodiments the detection of at least one indicium
of a variant JCV VP1 capsid protein is used to recommend a
modification of an immunosuppressive treatment for the subject. In
some embodiments the detection of at least one at least two, at
least three, at least four, at least five, at least six, at least
seven, at least 8, at least 9, at least 10 or more indicia of a
variant JCV VP1 capsid protein is used to recommend a modification
of an immunosuppressive treatment for the subject.
[0028] In some embodiments the absence of indicia of a variant JCV
VP1 capsid protein is used to identify the subject as appropriate
for an immunosuppressive treatment.
[0029] In some embodiments the absence of indicia of a variant JCV
VP1 capsid protein is used to identify the subject as appropriate
for continued immunosuppressive treatment.
[0030] In some embodiments the biological sample is interrogated
for the presence of an antibody that is specific for a variant JCV
VP1 capsid protein.
[0031] In some embodiments the biological sample is interrogated
for the presence of a variant JCV VP1 capsid protein.
[0032] In some embodiments the biological sample is interrogated
for the presence of a variant JCV VP1 capsid protein.
[0033] In some embodiments the biological sample is interrogated
for the presence of a nucleic acid sequence that encodes a variant
JCV VP1 capsid protein.
[0034] In some embodiments the biological sample is interrogated
using an ELISA based analysis.
[0035] Accordingly, in some embodiments, subjects can be screened
to determine whether they are at risk of developing PML. In certain
embodiments, subjects can be screened to detect early stage PML
before the disease progresses to a serious clinical condition. A
subject may be assayed for PML risk or early stage PML by
interrogating a biological sample obtained from the subject for
indicia of exposure to a PML-associated variant of JCV, for example
a JCV variant that is predicted to have reduced binding to sialic
acid. The invention provides specific positions in the major JC
virus capsid protein (JCV-VP1) that are associated with PML risk
and/or PML disease progression. In some embodiments, the risk
profile of a subject for PML is determined based on the mutational
status at one or more selected positions of the VP1 protein of a JC
virus to which the subject has been exposed.
[0036] Aspects of the invention are useful for detecting PML risk
or early stage disease progression in susceptible subjects, for
example, in patients that are immuno-compromised and/or being
treated with immuno-suppressive agents.
[0037] Accordingly, in one aspect the invention provides methods
for determining that a subject is susceptible to PML. In some
embodiments, the method comprises determining that a subject is
susceptible to PML if the subject harbors a JCV variant suspected
of having low sialic acid binding properties (e.g., avidity or
affinity).
[0038] In some embodiments, the method comprises determining
whether a subject harbors a JCV variant suspected of having low
sialic acid binding, and identifying the subject as being
susceptible to PML if the subject harbors the JCV variant. In some
embodiments, the method comprises testing a subject for the
presence of a JCV variant suspected of having low sialic acid
binding and identifying the subject as susceptible to PML if the
presence of a JCV variant suspected of having low sialic acid
binding is detected.
[0039] In one aspect the invention provides methods for determining
that a subject is appropriate for an immunosuppressive treatment.
In some embodiments, a method comprises determining that a subject
is appropriate for an immunosuppressive treatment if the subject
does not harbor a JCV variant suspected of having low sialic acid
binding. In some embodiments, a method comprises determining
whether a subject harbors a JCV variant suspected of having low
sialic acid binding; and identifying the subject as appropriate for
an immunosuppressive treatment if the subject does not harbor the
JCV variant, or identifying the subject as being inappropriate for
an immunosuppressive treatment if the subject harbors the JCV
variant.
[0040] In one aspect the invention provides methods for determining
that a subject is inappropriate for an immunosuppressive treatment.
In some embodiments, a method comprises determining that a subject
is inappropriate for an immunosuppressive treatment if the subject
harbors a JCV variant suspected of having low sialic acid
binding.
[0041] In some of the embodiments of the methods provided herein
determining comprises assaying a biological sample from the subject
for an indicium of the JCV variant suspected of having low sialic
acid binding. In some of the embodiments of the methods provided
herein a biological sample is a urine sample, a blood sample,
plasma, serum, mucosal swab, or a CSF sample. In some of the
embodiments of the methods provided herein the indicium is the
presence of an antibody that can specifically bind to a JCV variant
suspected of having low sialic acid binding. In some of the
embodiments of the methods provided herein the indicium is the
presence of a nucleic acid sequence associated with a JCV
polypeptide variant suspected of having low sialic acid binding,
wherein the nucleic acid sequence is not present in a wild type
JCV.
[0042] In some of the embodiments of the methods provided herein
the assaying comprises contacting the biological sample with a JCV
antibody and evaluating the sample for the presence of a JCV
variant or JCV peptide variant. In some of the embodiments of the
methods provided herein the assaying comprises contacting the
biological sample with a JCV peptide and evaluating the sample for
the presence of a JCV antibody. In some of the embodiments of the
methods provided herein the assaying comprises performing a PCR
reaction on the biological sample and evaluating the sample for the
presence of a JCV nucleic acid variant.
[0043] In some of the embodiments of the methods provided herein
the immunosuppressive treatment comprises administering an
immunosuppressant drug. In some of the embodiments of the methods
provided herein the immunosuppressive treatment comprises
administration of an anti-VLA4 antibody. In some of the embodiments
of the methods provided herein, the immunosuppressant drug is
natalizumab.
[0044] In some of the embodiments of the methods provided herein
the JCV variant suspected of having low sialic acid binding is a
JCV variant comprising one or more mutations in the JCV sialic acid
binding site. In some of the embodiments of the methods provided
herein the mutation in the JCV sialic acid binding site is L55F,
K60M, K60E, K60N, N265D, N265T, S267F, S267L, S269F, S269Y or
S269C.
[0045] In some of the embodiments of the methods provided herein
the low sialic acid binding of the JCV variant is lower than the
sialic binding of WT JCV.
[0046] In some of the embodiments of the methods provided herein
the subject is in need of treatment with an immunosuppressant drug
or the subject is being treated with an immunosuppressant drug.
[0047] In one aspect the invention provides a method comprising
obtaining a biological sample from a subject, assaying the
biological sample for an indicium of a JCV variant suspected of
having low sialic acid binding, wherein the subject is identified
as being susceptible to PML if the biological sample contains an
indicium of the JCV variant.
[0048] In one aspect the invention provides a method comprising
obtaining a biological sample from a subject, assaying the
biological sample for an indicium of a JCV variant suspected of
having low sialic acid binding, wherein the subject is identified
as either i) appropriate for an immunosuppressive treatment if the
biological sample does not contain the indicium of the JCV variant
ii) inappropriate for an immunosuppressive treatment if the
biological sample contains the indicium of the JCV variant.
[0049] In one aspect the invention provides a method comprising
monitoring a subject receiving an immunosuppressive treatment for
harboring a JCV variant suspected of having low sialic acid
binding.
[0050] In one aspect the invention provides a method comprising
monitoring a subject receiving an immunosuppressive treatment for a
sign of exposure to JCV, and, if the sign of exposure to JCV is
detected, then monitoring the subject for harboring a JCV variant
suspected of having low sialic acid binding.
[0051] In some of the embodiments of the methods provided herein
the monitoring comprises periodically obtaining and assaying a
biological sample from the subject for an indicium of the JCV
variant.
[0052] In one aspect the invention provides a method comprising
obtaining a biological sample from a subject, assaying the
biological sample for an indicium of JCV, wherein if the biological
sample contains an indicium of JCV, the subject is periodically
monitored for the presence of a JCV variant suspected of having low
sialic acid binding, and wherein if the clinical sample does not
contain JCV, the subject is periodically monitored for an exposure
JCV.
[0053] In one aspect the invention provides a method of determining
whether a treatment regimen for administering an immunosuppressive
agent to a subject should be modified, the method comprising
obtaining a biological sample from a subject, assaying the
biological sample for an indicium of a JCV variant suspected of
having low sialic acid binding, wherein the treatment regimen
should be modified for the subject if the biological sample has the
indicium of the JCV variant.
[0054] In some of the embodiments of the methods provided herein
the treatment regimen should be modified by administering a lower
dose of the immunosuppressive agent, replacing the
immunosuppressive agent with a different immunosuppressive agent,
or halting administration of the immunosuppressive agent.
[0055] In one aspect the invention provides a method comprising
administering a first immunosuppressant drug to a subject, and
monitoring if the subject harbors a JCV variant suspected of having
low sialic acid binding. In some of the embodiments of the methods
provided herein the dosage and/or frequency of administration of
the first immunosuppressant drug is reduced if the subject harbors
the JCV variant. In some of the embodiments of the methods provided
herein the first immunosuppressant drug is replaced with a second
immunosuppressant drug if the subject harbors the JCV variant. In
some of the embodiments of the methods provided herein the subject
is screened for a symptom of PML if the subject harbors the JCV
variant. In some of the embodiments of the methods provided herein
the subject is treated for PML if the subject harbors the JCV
variant.
[0056] In one aspect the invention provides a method of detecting a
JCV variant suspected of having low sialic acid binding, the method
comprising interrogating a biological sample from a subject using a
high sensitivity assay specific for the indicium of a JCV variant
suspected of having low sialic acid binding. In some of the
embodiments of the methods provided herein the interrogating
comprises contacting the biological sample with an antibody that
can specifically bind the JCV variant. In some of the embodiments
of the methods provided herein the interrogating comprises
contacting the biological sample with a JCV variant
polypeptide.
[0057] In some of the embodiments of the methods provided herein
the interrogating comprises contacting the biological sample with a
JCV variant nucleic acid.
[0058] Aspects of the invention include panels of JCV-VP1 amino
acid positions at which sequence variations are associated with PML
risk and/or disease progression. Methods and compositions are
provided for screening subjects to identify individuals that have
been exposed to a variant JC virus having PML-associated sequence
variations at one or more of the VP-1 amino acid positions in a
panel.
[0059] Aspects of the invention can be used to diagnose PML, or to
evaluate and/or monitor PML disease progression, regression, and/or
status in a subject.
[0060] Certain aspects of the invention relate to evaluating
therapeutic treatments for PML.
[0061] Other aspects of the invention relate to vaccines against
PML-associated JC virus variants.
[0062] In one aspect, the invention provides a method for
determining if a subject is at risk for, or has, progressive
multifocal leukoencephalopathy (PML), the method comprising
assaying a biological sample from a subject for an indicium of
exposure to a variant JC polyomavirus. In some embodiments the
assay interrogates at least one JCV-VP1 position selected from
positions 69, 74, 75, 113, 117, 128, 134, 158, 164, 223, 271, 321,
332, and 345 in Table 1A for the presence of a sequence variation,
and wherein the subject is identified as being at risk for, or
having, PML if a sequence variation is present at one or more of
the interrogated positions.
[0063] In one aspect, the invention provides a method for
determining if a subject is at risk for, or has, progressive
multifocal leukoencephalopathy (PML), the method comprising
assaying a biological sample from a subject for an indicium of
exposure to a variant JC polyomavirus. In some embodiments the
assay interrogates one position for the presence of a sequence
variation. In some embodiments the position is position 164. In
some embodiments the subject is identified as being at risk for, or
having, PML if a sequence variation is present at position 164.
[0064] In one aspect, the invention provides a method for
determining if a subject is at risk for, or has, progressive
multifocal leukoencephalopathy (PML), the method comprising
assaying a biological sample from a subject for an indicium of
exposure to a variant JC polyomavirus, wherein the assay
interrogates at least eight JCV-VP1 positions selected from the
positions in Table 1A for the presence of a sequence variation, and
wherein the subject is identified as being at risk for, or having,
PML if a sequence variation is present at one or more of the
interrogated positions.
[0065] In one aspect, the invention provides a method for
determining if a subject is at risk for, or has, progressive
multifocal leukoencephalopathy (PML), the method comprising
assaying a biological sample from a subject for an indicium of
exposure to a variant JC polyomavirus, wherein the assay
interrogates at least eight JCV-VP1 positions selected from the
positions in Table 1A for the presence of a sequence variation,
wherein a sequence variation is one of the following 55F, 60M, 60E,
61L, 66H, 66N, 69D, 74S, 75R, 113L, 117S, 123C, 128A, 134G, 158L,
164K, 223A, 265D, 265T, 267F, 267L, 269F, 269Y, 271H, 321V, 332E or
345K, and wherein the subject is identified as being at risk for,
or having, PML if a sequence variation is present at one or more of
the interrogated positions.
[0066] In some embodiments, more than eight positions in Table 1A
may be interrogated. In some embodiments 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21 or 22 positions are interrogated.
[0067] In one aspect, the invention provides a method for
determining if a subject is at risk for, or has, progressive
multifocal leukoencephalopathy (PML), the method comprising
assaying a biological sample from a subject for an indicium of
exposure to a variant JC polyomavirus, wherein the assay
interrogates at least five JCV-VP1 positions selected from the
positions in Table 1B for the presence of a sequence variation, and
wherein the subject is identified as being at risk for, or having,
PML if a sequence variation is present at one or more of the
interrogated positions.
[0068] In some embodiments, more than five positions in Table 1B
may be interrogated. In some embodiments six or seven positions are
interrogated.
[0069] In one aspect, the invention provides a method for
determining if a subject is at risk, or has, for progressive
multifocal leukoencephalopathy (PML), the method comprising
assaying a biological sample from a subject for an indicium of
exposure to a variant JC polyomavirus, wherein the assay
interrogates at least four JCV-VP1 positions selected from the
positions in Table 1C for the presence of a sequence variation, and
wherein the subject is identified as being at risk for, or having,
PML if a sequence variation is present at one or more of the
interrogated positions.
[0070] In one aspect, the invention provides a method for
determining if a subject is at risk for, or has, progressive
multifocal leukoencephalopathy (PML), the method comprising
assaying a biological sample from a subject for an indicium of
exposure to a variant JC polyomavirus, wherein the assay
interrogates at least two JCV-VP1 positions selected from the
positions in Table 1D for the presence of a sequence variation, and
wherein the subject is identified as being at risk for, or having,
PML if a sequence variation is present at one or more of the
interrogated positions.
[0071] In some embodiments, more than two positions in Table 1D may
be interrogated. In some embodiments 3, 4 or 5 positions are
interrogated.
[0072] In one aspect, the invention provides a method for
determining if a subject is at risk for, or has, progressive
multifocal leukoencephalopathy (PML), the method comprising
assaying a biological sample from a subject for an indicium of
exposure to a variant JC polyomavirus, wherein the assay
interrogates at least two JCV-VP1 positions selected from the
positions in Table 1F for the presence of a sequence variation, and
wherein the subject is identified as being at risk for, or having,
PML if a sequence variation is present at one or more of the
interrogated positions.
[0073] In some embodiments, more than two positions in Table 1F may
be interrogated. In some embodiments 3 or 4 positions are
interrogated.
[0074] In one aspect, the invention provides a method for
determining if a subject is at risk for, or has, progressive
multifocal leukoencephalopathy (PML), the method comprising:
assaying a biological sample from a subject for an indicium of
exposure to a variant JC polyomavirus, wherein the assay
interrogates at least eight JCV-VP1 positions selected from the
positions in Table 1G for the presence of a sequence variation, and
wherein the subject is identified as being at risk for, or having,
PML if a sequence variation is present at one or more of the
interrogated positions.
[0075] In some embodiments, more than eight positions in Table 1G
may be interrogated. In some embodiments 9, 10, 11, 12, 13, 14 or
15 positions are interrogated.
[0076] In one aspect, the invention provides a method for
determining if a subject is at risk for, or has, progressive
multifocal leukoencephalopathy (PML), the method comprising:
assaying a biological sample from a subject for an indicium of
exposure to a variant JC polyomavirus, wherein the assay
interrogates at least one JCV-VP1 position selected from the
positions in Table 1H for the presence of a sequence variation, and
wherein the subject is identified as being at low risk for, or not
having, PML if a sequence variation is present at one or more of
the interrogated positions. In some embodiments two positions in
Table 1H are interrogated.
[0077] In one aspect, the invention provides a method for
determining if a subject is at risk for, or has, progressive
multifocal leukoencephalopathy (PML), the method comprising:
assaying a biological sample from a subject for an indicium of
exposure to a variant JC polyomavirus, wherein the assay
interrogates at least one JCV-VP1 position selected from the
positions in Table 1H for the presence of a sequence variation,
wherein a sequence variation is one of the following 115E or 277K,
and wherein the subject is identified as being at low risk for, or
not having, PML if a sequence variation is present at one or more
of the interrogated positions.
[0078] In some embodiments, two positions in Table 1H are
interrogated. In one aspect, the invention provides a method for
determining if a subject is at risk for, or has, progressive
multifocal leukoencephalopathy (PML), the method comprising
assaying a biological sample from a subject for an indicium of
exposure to a variant JC polyomavirus, wherein the assay
interrogates positions in selected regions of JCV-VP1 for the
presence of a sequence variation, and wherein the subject is
identified as being at low risk for, or not having, PML if less
than a selected number of sequence variations are present at the
interrogated positions.
[0079] In one aspect, the invention provides a method for
determining if a subject is at risk for, or has, progressive
multifocal leukoencephalopathy (PML), the method comprising
assaying a biological sample from a subject for an indicium of
exposure to a variant JC polyomavirus, wherein the assay
interrogates at least positions 55-75 and 265-271 of JCV-VP1 for
the presence of a sequence variation, and wherein the subject is
identified as being at low risk for, or not having, PML if less
than two sequence variations are present at the interrogated
positions.
[0080] In one aspect, the invention provides a method for
determining if a subject is at risk for, or has, progressive
multifocal leukoencephalopathy (PML), the method comprising
assaying a biological sample from a subject for an indicium of
exposure to a variant JC polyomavirus, wherein the assay
interrogates at least positions 55-75, 113-164, 223, 265-277 and
321-345 of JCV-VP1 for the presence of a sequence variation, and
wherein the subject is identified as being at low risk for, or not
having, PML if less than three sequence variations are present at
the interrogated positions.
[0081] In one aspect, the invention provides a method for
determining if a subject is at risk for, or has, progressive
multifocal leukoencephalopathy (PML), the method comprising
assaying a biological sample from a subject for an indicium of
exposure to a variant JC polyomavirus, wherein the assay
interrogates at least positions 55-75, 113-164, 223, 265-277 and
321-345 of JCV-VP1 for the presence of a sequence variation, and
wherein the subject is identified as being at low risk for, or not
having, PML if less than two sequence variations are present at the
interrogated positions.
[0082] In one aspect, the invention provides a method for
determining if a subject is at risk for, or has, progressive
multifocal leukoencephalopathy (PML), the method comprising
assaying a biological sample from a subject for an indicium of
exposure to a variant JC polyomavirus, wherein the assay
interrogates position 164 and at least one other JCV-VP1 position
selected from the positions in Table 1A for the presence of a
sequence variation, and wherein the subject is identified as being
at risk for, or having, PML if a sequence variation is present at
one or more of the interrogated positions.
[0083] In one aspect, the invention provides a method for
determining if a subject is at risk for, or has, progressive
multifocal leukoencephalopathy (PML), the method comprising
assaying a biological sample from a subject for an indicium of
exposure to a variant JC polyomavirus, wherein the assay
interrogates position 164 and at least one other JCV-VP1 position
selected from the positions in Table 1A for the presence of a
sequence variation, and wherein the subject is identified as being
at risk for, or having, PML if a sequence variation is present at
two or more of the interrogated positions.
[0084] In one aspect, the invention provides a method for
determining if a subject is at risk for, or has, progressive
multifocal leukoencephalopathy (PML), the method comprising
assaying a biological sample from a subject for an indicium of
exposure to a variant JC polyomavirus, wherein the assay
interrogates positions in selected regions of JCV-VP1 for the
presence of a sequence variation, and wherein the subject is
identified as being at risk for, or having, PML if the number of
amino acids with a specific characteristic present at the
interrogated positions has increased. In some embodiments, the
specific characteristic is non-polarity.
[0085] In one aspect, the invention provides a method for
determining if a subject is at risk for, or has, progressive
multifocal leukoencephalopathy (PML), the method comprising
assaying a biological sample from a subject for an indicium of
exposure to a variant JC polyomavirus, wherein the assay
interrogates at least positions 55-75 and 265-271 of JCV-VP1 for
the presence of a sequence variation, and wherein the subject is
identified as being at risk for, or having, PML if the total number
of non-polar amino acid variants (Gly, Ala, Val, Leu, Ile, or Pro)
or aromatic variants (Phe, Tyr, or Trp) at the interrogated
positions has increased.
[0086] In one aspect, the invention provides a method for
determining if a subject is at risk for, or has, progressive
multifocal leukoencephalopathy (PML), the method comprising
assaying a biological sample from a subject for an indicium of
exposure to a variant JC polyomavirus, wherein the assay
interrogates at least positions 55-75, 113-164, 223, 265-277 and
321-345 of JCV-VP1 for the presence of a variant, and wherein the
subject is identified as being at risk for, or having, PML if the
total number of non-polar amino acid variants or aromatic variants
at the interrogated positions has increased.
[0087] In one aspect, the invention provides a method for
determining if a subject is at risk for, or has, progressive
multifocal leukoencephalopathy (PML), the method comprising
assaying a biological sample from a subject for an indicium of
exposure to a variant JC polyomavirus, wherein the assay
interrogates at least positions 55-75 and 265-271 of JCV-VP1 for
the presence of a sequence variation, and wherein the subject is
identified as being at risk for, or having, PML if the one or more
of the sequence variations at the interrogated positions result in
an increase in non-polar surface area of 10 square angstrom or more
per sequence variation.
[0088] In one aspect, the invention provides a method for
determining if a subject is at risk for, or has, progressive
multifocal leukoencephalopathy (PML), the method comprising
assaying a biological sample from a subject for an indicium of
exposure to a variant JC polyomavirus, wherein the assay
interrogates positions in selected regions of JCV-VP1 for the
presence of a sequence variation, and wherein the subject is
identified as being at low risk for, or not having, PML if the
number of amino acids with a specific characteristic present at the
interrogated positions has decreased. In some embodiments the
specific characteristic is polarity.
[0089] In one aspect, the invention provides a method for
determining if a subject is at risk for, or has, progressive
multifocal leukoencephalopathy (PML), the method comprising
assaying a biological sample from a subject for an indicium of
exposure to a variant JC polyomavirus, wherein the assay
interrogates at least positions 55-75 and 265-271 of JCV-VP1 for
the presence of a sequence variation, and wherein the subject is
identified as being at risk for, or having, PML if the total number
of polar amino acid variants (Ser, Thr, Cys, Met, Asn, or Gln),
positively charged variants (Lys, Arg, or His), or negatively
charged variants (Asp or Glu) at the interrogated positions has
decreased.
[0090] In one aspect, the invention provides a method for
determining if a subject is at risk for, or has, progressive
multifocal leukoencephalopathy (PML), the method comprising
assaying a biological sample from a subject for an indicium of
exposure to a variant JC polyomavirus, wherein the assay
interrogates at least positions 55-75, 113-164, 223, 265-277 and
321-345 of JCV-VP1 for the presence of a sequence variation, and
wherein the subject is identified as being at risk for, or having,
PML if the total number of polar amino acid variants, positively
charged variants, or negatively charged variants at the
interrogated positions has decreased.
[0091] In one aspect, the invention provides a method for
determining if a subject is at risk for, or has, progressive
multifocal leukoencephalopathy (PML), the method comprising
assaying a biological sample from a subject for an indicium of
exposure to a variant JC polyomavirus, wherein the assay
interrogates at least positions 55-75 and 265-271 of JCV-VP1 for
the presence of a sequence variation, and wherein the subject is
identified as being at risk for, or having, PML if the one or more
of the sequence variations at the interrogated positions result in
a decrease in polar surface area of 10 square angstrom or more per
sequence variation.
[0092] In one aspect, the invention provides methods for
interrogating selected JCV-VP1 positions for sequence variations in
a biological sample.
[0093] In some embodiments, interrogating selected JCV-VP1
positions for sequence variations comprises determining the
presence in a biological sample of one or more antibodies that
specifically bind polypeptides comprising one or more amino acid
sequence variations selected from the panel of Table 1A or 1H. In
some embodiments the presence of the one or more antibodies is
determined by specific binding to recombinantly produced
polypeptides comprising the one or more amino acid sequence
variations. In some embodiments the presence of the one or more
antibodies is determined by specific binding to synthetically
produced polypeptides comprising the one or more amino acid
sequence variations.
[0094] In some embodiments, interrogating selected JCV-VP1
positions for sequence variations comprises determining the
presence in the biological sample of one or more polypeptides
comprising the one or more amino acid sequence variations selected
from the panel of Table 1A or 1H. In some embodiments the presence
of the one or more polypeptides is detected by specific binding of
the polypeptides to one or more peptide binding agents. In some
embodiments the peptide binding agent is an antibody.
[0095] In some embodiments, interrogating selected JCV-VP1
positions for sequence variations comprises determining the
presence in a biological sample of nucleic acids that code for the
one or more amino acid sequence variations selected from the panel
of Table 1A or 1H.
[0096] In some embodiments, interrogating selected JCV-VP1
positions for sequence variations is performed in a sample of
blood, cerebrospinal fluid, serum, urine, sputum, bone marrow,
brain, spleen or kidney, or other tissue.
[0097] In some embodiments, the method for determining if a subject
is at risk for, or has, progressive multifocal leukoencephalopathy
(PML), comprises assaying a biological sample from a subject for an
indicium of exposure to a variant JC polyomavirus, wherein the
exposure to variant JCV comprises a current infection with a
variant JCV.
[0098] In some embodiments, the method for determining if a subject
is at risk for, or has, progressive multifocal leukoencephalopathy
(PML), comprises assaying a biological sample from a subject for an
indicium of exposure to a variant JC polyomavirus, the exposure to
variant JCV comprises a prior infection, or the variant JCV is not
detectable in the blood or urine of the subject.
[0099] In one aspect, the invention provides a method for
determining if a subject is at risk for, or has, progressive
multifocal leukoencephalopathy (PML), the method comprising
assaying a biological sample from a subject for an indicium of
exposure to a variant JC polyomavirus, wherein the assay
interrogates at least two JCV-VP1 positions selected from the
positions in Table 1F for the presence of a sequence variation, and
wherein the subject is identified as being at low risk for, or not
having, PML if no sequence variation is present at one of the
interrogated positions.
[0100] In one aspect, the invention provides a method for
determining if a subject is at risk for, or has, progressive
multifocal leukoencephalopathy (PML), the method comprising
assaying a biological sample from a subject for an indicium of
exposure to a variant JC polyomavirus, wherein the assay
interrogates at least two JCV-VP1 positions selected from the
positions in Table 1G for the presence of a sequence variation, and
wherein the subject is identified as being at low risk for, or not
having, PML if no sequence variation is present at one of the
interrogated positions.
[0101] In one aspect, the invention provides kits for diagnosing if
a subject is at risk for PML.
[0102] In some embodiments the kit for diagnosing if a subject is
at risk for PML comprises one or more containers, each container
containing a polypeptide comprising one or more amino acid sequence
variations selected from the panel of Table 1A, Table 17 and/or
Table 18, and/or one or more other variants described herein, and
the kit further comprising instructions for using the polypeptide
to determine the presence of antibodies that specifically bind
these polypeptides.
[0103] In some embodiments, the kit for diagnosing if a subject is
at risk for PML comprises one or more containers, each container
containing a polypeptide comprising one or more amino acid sequence
variations selected from the panel of Table 1B, and the kit further
comprising instructions for using the polypeptide to determine the
presence of antibodies that specifically bind these
polypeptides.
[0104] In some embodiments, the kit for diagnosing if a subject is
at risk for PML comprises one or more containers, each container
containing a polypeptide comprising one or more amino acid sequence
variations selected from the panel of Table 1C, and the kit further
comprising instructions for using the polypeptide to determine the
presence of antibodies that specifically bind these
polypeptides.
[0105] In some embodiments, the kit for diagnosing if a subject is
at risk for PML comprises one or more containers, each container
containing a polypeptide comprising one or more amino acid sequence
variations selected from the panel of Table 1D, and the kit further
comprising instructions for using the polypeptide to determine the
presence of antibodies that specifically bind these
polypeptides.
[0106] In some embodiments, the kit for diagnosing if a subject is
at risk for PML comprises one or more containers, each container
containing a polypeptide comprising one or more amino acid sequence
variations selected from the panel of Table 1F, and the kit further
comprising instructions for using the polypeptide to determine the
presence of antibodies that specifically bind these
polypeptides.
[0107] In some embodiments, the kit for diagnosing if a subject is
at risk for PML comprises one or more containers, each container
containing a polypeptide comprising one or more amino acid sequence
variations selected from the panel of Table 1G, and the kit further
comprising instructions for using the polypeptide to determine the
presence of antibodies that specifically bind these
polypeptides.
[0108] In some embodiments, the kit for diagnosing if a subject is
at risk for PML comprises one or more containers, each container
containing a polypeptide comprising one or more amino acid sequence
variations selected from the panel of Table 1H, and the kit further
comprising instructions for using the polypeptide to determine the
presence of antibodies that specifically bind these
polypeptides.
[0109] In some embodiments, the kit for diagnosing if a subject is
at risk for PML comprises one or more containers, each container
containing a polypeptide comprising an amino acid sequence
variations at position 164, and the kit further comprising
instructions for using the polypeptide to determine the presence of
antibodies that specifically bind these polypeptides.
[0110] In one aspect, the invention provides methods for
determining onset, progression, or regression, of PML in a
subject.
[0111] In one embodiment of the method for determining onset,
progression, or regression, of PML in a subject, the method
comprising determining the number of amino acid sequence variations
in variant JCV-VP1 in a first biological sample obtained from the
subject, determining the number of amino acid sequence variations
in variant JCV-VP1 in a second biological sample obtained from the
subject at a later time than the first sample was obtained,
comparing the number of sequence variations in the first sample
with number of sequence variations in the second sample, wherein a
lower number of sequence variations in the first sample compared
with the number of sequence variations in the second sample
indicates onset or progression of PML in the subject, and wherein a
higher number of sequence variations in the first sample compared
with the number of sequence variations in the second sample
indicates regression of PML in the subject.
[0112] In one embodiment of the method for determining onset,
progression, or regression, of PML in a subject, the sequence
variations are selected from the positions in Table 1A.
[0113] In one embodiment of the method for determining onset,
progression, or regression, of PML in a subject, the sequence
variations are selected from the positions in Table 1B.
[0114] In one embodiment of the method for determining onset,
progression, or regression, of PML in a subject, the sequence
variations are selected from the positions in Table 1C.
[0115] In one embodiment of the method for determining onset,
progression, or regression, of PML in a subject, the sequence
variations are selected from the positions in Table 1D.
[0116] In one embodiment of the method for determining onset,
progression, or regression, of PML in a subject, the sequence
variations are selected from the positions in Table 1F.
[0117] In one embodiment of the method for determining onset,
progression, or regression, of PML in a subject, the sequence
variations are selected from the positions in Table 1G.
[0118] In some embodiments of the method for determining onset,
progression, or regression, of PML in a subject, the sequence
variations are determined by comparing the variant JCV-VP1 to a
wild type JCV-VP1.
[0119] In one embodiment of the method for determining onset,
progression, or regression, of PML in a subject, the method
comprises determining if a sequence variation is present at
position 164 in variant JCV-VP1 in a first biological sample
obtained from the subject, determining if a sequence variation is
present at position 164 in variant JCV-VP1 in a second biological
sample obtained from the subject at a later time than the first
sample was obtained, wherein absence of the sequence variation in
the first sample and the presence of the sequence variation in the
second sample indicates onset or progression of PML in the subject,
and wherein presence of the sequence variation in the first sample
and absence of the sequence variation in the second sample
indicates regression of PML in the subject.
[0120] In some embodiments of the method for determining onset,
progression, or regression, of PML in a subject, the method further
comprises additional monitoring of the onset, progression, or
regression, of PML in a subject by obtaining additional samples
from the subject at later time points, determining the number of
amino acid sequence variations in JCV-VP1 in these samples, and
comparing the number of sequence variations in these samples to the
number of sequence variations in one or more previous samples.
[0121] In some embodiments of the method for determining onset,
progression, or regression, of PML in a subject, the subject is
monitored while undergoing treatment with an immunosuppressant. In
some embodiments the immunosuppressant is natalizumab.
[0122] In one embodiment of the method for determining onset,
progression, or regression, of PML in a subject, the method
comprises determining the viral load of a variant JCV-VP1 in a
first biological sample obtained from the subject, determining the
viral load of a variant JCV-VP1 in a second biological sample
obtained from the subject at a later time than the first sample was
obtained, comparing the viral load in the first sample with viral
load in the second sample, wherein a lower viral load in the first
sample compared with the viral load in the second sample indicates
onset or progression of PML in the subject, and wherein a higher
viral load in the first sample compared with the viral load in the
second sample indicates regression of PML in the subject.
[0123] In some embodiments of the method for determining onset,
progression, or regression, of PML in a subject, the method
comprising determining the viral load of a variant JCV-VP1, the
variant JCV-VP1 comprises one or more sequence variations selected
from the positions in Table 1A.
[0124] In some embodiments of the method for determining onset,
progression, or regression, of PML in a subject, the method
comprising determining the viral load of a variant JCV-VP1, the
variant JCV-VP1 comprises one or more sequence variations selected
from the positions in Table 1B.
[0125] In some embodiments of the method for determining onset,
progression, or regression, of PML in a subject, the method
comprising determining the viral load of a variant JCV-VP1, the
variant JCV-VP1 comprises one or more sequence variations selected
from the positions in Table 1C.
[0126] In some embodiments of the method for determining onset,
progression, or regression, of PML in a subject, the method
comprising determining the viral load of a variant JCV-VP1, the
variant JCV-VP1 comprises one or more sequence variations selected
from the positions in Table 1D.
[0127] In some embodiments of the method for determining onset,
progression, or regression, of PML in a subject, the method
comprising determining the viral load of a variant JCV-VP1, the
variant JCV-VP1 comprises one or more sequence variations selected
from the positions in Table 1F.
[0128] In some embodiments of the method for determining onset,
progression, or regression, of PML in a subject, the method
comprising determining the viral load of a variant JCV-VP1, the
variant JCV-VP1 comprises one or more sequence variations selected
from the positions in Table 1G.
[0129] In some embodiments of the method for determining onset,
progression, or regression, of PML in a subject, the method
comprising determining the viral load of a variant JCV-VP1, the
variant JCV-VP1 comprises a sequence variation at position 164.
[0130] In some embodiments of the method for determining onset,
progression, or regression, of PML in a subject, the viral load of
variant JCV-VP1 is compared to the viral load of a wild type
JCV-VP1.
[0131] In some embodiments of the method for determining onset,
progression, or regression, of PML in a subject, the method
comprising determining the viral load of a variant JCV-VP1, the
method further comprises additional monitoring of the onset,
progression, or regression, of PML in a subject by obtaining
additional samples from the subject at later time points,
determining the viral load of variant JCV-VP1 in these samples, and
comparing the viral load in these samples to the viral load in one
or more previous samples.
[0132] In some embodiments of the method for determining onset,
progression, or regression, of PML in a subject, the method
comprising determining the viral load of a variant JCV-VP1, the
subject is monitored while undergoing treatment with an
immunosuppressant. In some embodiments the immunosuppressant is
natalizumab.
[0133] In one aspect, the invention provides methods for monitoring
response to treatment for PML in a subject.
[0134] In some embodiments of the method for monitoring response to
treatment for PML in a subject, the method comprises determining
the number of amino acid sequence variations in JCV-VP1 in a first
biological sample obtained from the subject, administering the PML
treatment to the subject, determining the number of amino acid
sequence variations in JCV-VP1 in a second sample, wherein the
second sample is obtained from the subject after treatment and at a
time later than the first sample, and comparing the number of amino
acid sequence variations in the first sample with the number of
amino acid sequence variations in the second sample, wherein a
lower number of amino acid sequence variations in the second sample
than in the first sample indicates that the subject is responsive
to the PML treatment.
[0135] In some embodiments of the method for monitoring response to
treatment for PML in a subject, the method comprises determining
the viral load of a JCV variant in a first biological sample
obtained from the subject, administering the PML treatment to the
subject, determining the viral load of a JCV variant in a second
sample, wherein the second sample is obtained from the subject
after treatment and at a time later than the first sample, and
comparing the viral load in the first sample with the viral load in
the second sample, wherein a lower viral load in the second sample
than in the first sample indicates that the subject is responsive
to the PML treatment.
[0136] In one aspect, the invention provides methods for selecting
a course of treatment of a subject having or suspected of having
PML.
[0137] In some embodiments of the method for selecting a course of
treatment of a subject having or suspected of having PML, the
method comprises determining the number of amino acid sequence
variations in JCV-VP1 in a biological sample obtained from the
subject, comparing the number of sequence variations to a control
number of sequence variations, determining the stage of PML based
at least in part on the difference in the number of sequence
variations in the sample compared to the control number of sequence
variations, and selecting a course of treatment for the subject
appropriate to the stage of PML of the subject.
[0138] In some embodiments of the method for selecting a course of
treatment of a subject having or suspected of having PML, the
method comprises determining the viral load of a JCV variant in a
biological sample obtained from the subject, comparing the viral
load to the viral load in a control sample, determining the stage
of PML based at least in part on the difference in viral load in
the sample compared to the control sample, and selecting a course
of treatment for the subject appropriate to the stage of PML of the
subject.
[0139] In one aspect, the invention provides methods for deciding
or aiding in the decision to discontinue treatment of a subject
with one or more immunosuppressants.
[0140] In some embodiments of the method for deciding or aiding in
the decision to discontinue treatment of a subject with one or more
immunosuppressants comprises determining the number of amino acid
sequence variations in JCV-VP1 in a biological sample obtained from
the subject, comparing the number of sequence variations to a
control number of sequence variations, determining a decision to
discontinue treatment of a subject with one or more
immunosuppressants based at least in part on the difference in the
number of sequence variations in the sample compared to the control
number of sequence variations.
[0141] In some embodiments of the method for deciding or aiding in
the decision to discontinue treatment of a subject with one or more
immunosuppressants comprises determining the vial load of a JCV
variant in a biological sample obtained from the subject, comparing
the viral load to a viral load in a control sample, determining a
decision to discontinue treatment of a subject with one or more
immunosuppressants based at least in part on the difference in
viral load in the sample compared to the control sample.
[0142] In some embodiments of the method for deciding or aiding in
the decision to discontinue treatment of a subject with one or more
immunosuppressants, the immunosuppressant is natalizumab.
[0143] In one aspect, the invention provides methods for
identifying candidate therapeutic compounds.
[0144] In some embodiments of the method for identifying a
candidate therapeutic compound, the method comprises contacting an
isolated polypeptide comprising one or more amino acid sequence
variations selected from the panel of Table 1A, Table 17 and/or
Table 18, and/or one or more other variants described herein, with
a compound to determine if the compound binds to the isolated
polypeptide, wherein if the compound binds to the isolated
polypeptide the compound is a candidate therapeutic compound.
[0145] In one aspect, the invention also provides candidate
therapeutic compounds identified by contacting an isolated
polypeptide comprising one or more amino acid sequence variations
selected from the panel of Table 1A, Table 17 and/or Table 18,
and/or one or more other variants described herein.
[0146] In some embodiments of the method for identifying a
candidate therapeutic compound, the method comprises determining a
number of amino acid sequence variations in JCV-VP1 in a first
biological sample obtained from the subject, administering a
compound, determining the number of amino acid sequence variations
in JCV-VP1 in a second biological sample obtained from the subject
at a time after administration of the compound, wherein if the
number of amino acid sequence variations in JCV-VP1 in the second
sample is lower than in the first sample the compound is a
candidate therapeutic compound.
[0147] In one aspect, the invention also provides candidate
therapeutic compounds identified by determining a number of amino
acid sequence variations in JCV-VP1 in a first biological sample
obtained from the subject, administering a compound, and
determining the number of amino acid sequence variations in JCV-VP1
in a second biological sample obtained from the subject at a time
after administration of the compound.
[0148] In some embodiments of the method for identifying a
candidate therapeutic compound, the method comprises determining a
viral load of a JCV variant in a first biological sample obtained
from the subject, administering a compound, determining the viral
load of a JCV variant in a second biological sample obtained from
the subject at a time after administration of the compound, wherein
if the viral load in the second sample is lower than in the first
sample the compound is a candidate therapeutic compound.
[0149] In one aspect, the invention also provides candidate
therapeutic compounds identified by determining a viral load of a
JCV variant in a first biological sample obtained from the subject,
administering a compound and determining the viral load of a JCV
variant in a second biological sample obtained from the subject at
a time after administration of the compound
[0150] In one aspect, the invention also provides vaccines
comprising a polypeptide having a sequence variation at one or more
JCV-VP1 positions selected from the positions in Table 1A, Table 17
and/or Table 18, and/or one or more other variants described
herein. In some embodiments the vaccine comprises two or more
polypeptides having a sequence variation at one or more JCV-VP1
positions selected from the positions in Table 1A. In some
embodiments, the vaccine further comprises an adjuvant.
[0151] In one aspect, the invention also provides methods of
immunizing a subject against PML, the method comprising
administering a vaccine comprising one or more polypeptides having
a sequence variation at one or more JCV-VP1 positions selected from
the positions in Table 1A, Table 17 and/or Table 18, and/or one or
more other variants described herein.
[0152] In one aspect, the invention also provides an isolated
antibody that specifically binds to a polypeptide having a sequence
variation at one or more JCV-VP1 positions selected from the
positions in Table 1A. In some embodiments the polypeptide has 2,
3, 4, 5, or more sequence variations at JCV-VP1 positions selected
from the positions in Table 1A, Table 17 and/or Table 18, and/or
one or more other variants described herein. In some embodiments,
the antibody is a monoclonal antibody. In some embodiments the
antibody is a polyclonal antibody.
[0153] In certain embodiments, the antibody specifically binds to a
VP1 particle comprising at least one VP1 polypeptide containing a
sequence variation described herein. A VP1 particle useful in the
invention can be produced using methods known in the art, in
general by expressing a recombinant VP1 polypeptide comprising a
variant described herein. A VP1 particle contains at least 2, 4,
10, 20, 30, 40, or 50 VP1 polypeptides. In some embodiments, the
VP1 particle comprises only VP1 polypeptides containing a variant.
In other embodiments, the VP1 particle is a heterogeneous particle
containing more than one VP1 polypeptide sequence; e.g., more than
one variant polypeptide or at least one variant polypeptide and at
least one wild type polypeptide.
[0154] The invention also encompasses an isolated nucleic acid
sequence encoding a VP1 polypeptide variant (e.g., containing one
or more variants described in Tables 1A-1H, Table 17 and/or Table
18, and/or one or more other variants described herein) or a
peptide of such a polypeptide, the polypeptide or peptide includes
the sialic acid binding region of a VP1 polypeptide. In some cases,
the invention includes such an isolated nucleic acid sequence
operatively linked to a heterologous expression control sequence.
The invention also includes vectors and host cells, transiently or
stably transfected containing such nucleic acid sequences. Methods
for producing such sequences, vectors, and host cells are known in
the art.
[0155] Each of the limitations of the invention can encompass
various embodiments of the invention. It is, therefore, anticipated
that each of the limitations of the invention involving any one
element or combinations of elements can be included in each aspect
of the invention. This invention is not limited in its application
to the details of construction and the arrangement of components
set forth in the following description or illustrated in the
drawings. The invention is capable of other embodiments and of
being practiced or of being carried out in various ways. Also, the
phraseology and terminology used herein is for the purpose of
description and should not be regarded as limiting. The use of
"including," "comprising," or "having," "containing", "involving",
and variations thereof herein, is meant to encompass the items
listed thereafter and equivalents thereof as well as additional
items.
BRIEF DESCRIPTION OF THE DRAWINGS
[0156] FIG. 1 shows the comparison of a reference JCV-VP1 sequence
to the SV40 COA sequence;
[0157] FIG. 2 shows a model of JCV-VP1;
[0158] FIG. 3 shows VP1 peptide sequences;
[0159] FIG. 4 shows a phylogenetic distribution of PML associated
viruses;
[0160] FIG. 5 shows a structural model of JCV
VP1/NeuNAc-(.alpha.2,3)-Gal-(.beta.1,3)-[(.alpha.2,6)-NeuNAc]-Glc-NAc
tetrasaccharide complex;
[0161] FIG. 6 shows the quality of the viral like particles;
[0162] FIG. 7 shows that WT JCV binds to some glycans;
[0163] FIG. 8 shows the structure of selected gangliosides and
their ability to bind to WT JCV;
[0164] FIG. 9 shows that the F55 and F269 mutations are not capable
of binding Neu5Ac.alpha.(2-3) and .alpha.(2-6) glycans;
[0165] FIG. 10 shows the structure of selected gangliosides and
their ability to bind to mutant JCV;
[0166] FIG. 11 compares the ability of WT and mutant to JCV to bind
selected gangliosides;
[0167] FIG. 12 shows that mutant JVC is still capable of binding
glial cell lines;
[0168] FIG. 13 shows that the mutant specific JCV antibodies can be
distinguished from a WT JCV antibody;
[0169] FIG. 14 shows an assay for distinguishing mutant antibodies
from WT;
[0170] FIG. 15 compares mutant JCV and WT JCV antibodies for their
ability to bind to a mutant JCV-VLP;
[0171] FIG. 16 compares mutant JCV and WT JCV antibodies for their
ability to bind to a mutant JCV-VLP;
[0172] FIG. 17 shows that a patient that has the F269 mutant virus
has developed an antibody response against the WT virus but not
against the F269 mutant virus;
[0173] FIG. 18 shows that (top) rabbit immunized with non-mutant
VLP raises antibody to the site (S269 in this cases) that could get
mutated;
[0174] FIG. 19 shows that higher CSF JCV DNA levels were found in
patients with mutations of the BC and HI loops than in those with
mutations of the DE loop or no mutations;
[0175] FIG. 20 shows a structural model of JCV
VP1/NeuNAc-(a2,3)-Gal-(b1,3)-[(a2,6)-NeuNAc]-Glc-NAc
tetrasaccharide complex; and,
[0176] FIG. 21 shows PML specific mutations of VP1 abolish or
drastically change specificity of viral capsid protein VP1 for
sialated gangliosides.
DETAILED DESCRIPTION OF THE INVENTION
[0177] Aspects of the invention relate to identifying and managing
the healthcare of subjects who are at increased risk of progressive
multifocal leukoencephalopathy (PML). PML can be caused by a JC
polyomavirus (JCV) infection in humans, particularly in subjects
that have a weakened immune system. However, PML does not develop
in all JCV-infected subjects having weakened immune systems.
According to the invention, only certain JCV variants cause PML. In
some embodiments, JCV variants that have reduced sialic acid
binding are particularly likely to cause PML. Accordingly, aspects
of the invention relate to methods and compositions for detecting
the presence of JCV variants predicted to have reduced binding to
sialic acid.
[0178] According to aspects of the invention, and without wishing
to be bound by theory, a JCV variant that has low sialic acid
binding, relative to the sialic binding of a wild-type JCV, has
reduced binding to peripheral sites (e.g., sialic acid on
peripheral cells, proteins, sugars, or other molecules). Therefore,
in some embodiments these variants are more likely to spread to
other parts of the body, for example, the CNS. In addition,
according to aspects of the invention, subjects with healthy immune
systems control the spread of certain JCV variants with reduced
sialic acid binding. However, in subjects with compromised immune
systems, these variants are more likely to evade the immune system
and progress to PML.
[0179] Accordingly, aspects of the invention relate to compositions
and methods for detecting the presence of JCV variants that are
predicted to have low sialic acid binding (e.g., low binding or
avidity) relative to the binding of normal or wild-type JCV. In
some embodiments, JCV variants with one or more mutations in the
sialic acid binding domain of a JCV capsid protein are predicted to
have low sialic acid binding properties. In some embodiments,
specific variants described herein are predicted to have low sialic
acid binding properties.
[0180] According to aspects of the invention, subjects that harbor
JCV variants with one or more mutations that are predicted to
reduce sialic acid binding are identified as having increased
susceptibility to PML (e.g., compared to a subject that does not
harbor JCV or such a JCV variant), particularly if their immune
system is compromised. Accordingly, subjects that harbor a reduced
sialic acid binding JCV variant are at risk of developing PML if
they are treated with an immunosuppressive drug (e.g., natalizumab
or other immunosuppressive drug).
[0181] In some embodiments, JCV mutations that are associated with
PML susceptibility in a subject are mutations at positions 122, 2,
and 66 and deletions of amino acids 50-51, 123-125 and 126-134 in
the VP1 capsid protein of JCV. In some embodiments, JCV mutations
that are associated with PML susceptibility in a subject are H122R,
A2V, and D66G. In some embodiments, JCV mutations that are
associated with PML susceptibility in a subject are H122R, A2V, and
D66G and 283I. In some embodiments a subject is susceptible to PML
if the JCV VP1 capsid protein comprises a substitution of at least
one of amino acid residues 122, 2, 66, 55, 60, 265, 267, and 269,
or one or more deletions of amino acids 50-51, 123-125 and
126-134.
[0182] Aspects of the invention are useful to assist in the
selection and/or monitoring of a therapy for a subject that is in
need of an immunosuppressive treatment (e.g., a subject with
multiple sclerosis, or any other condition that can be treated with
one or more immunosuppressive drugs). In some embodiments, aspects
of the invention can be used to identify subjects that are
susceptible to PML prior to initiating an immunosuppressive
treatment. In some embodiments, subjects that are receiving an
immunosuppressive treatment may be monitored for the appearance of
JCV variants that are associated with increased risk for PML. In
some embodiments, if a subject is identified as having a JCV
variant with reduced binding to sialic acid, then the subject is i)
not treated with an immunosuppressive drug, ii) treated with a low
dosage or frequency of drug administration, and/or iii) monitored
regularly for early symptoms of PML. If symptoms of PML appear
during treatment, the treatment may be halted or the amount or
frequency of drug administration may be reduced. In some
embodiments, an alternative immunosuppressive drug may be
substituted for a first drug if one or more symptoms of PML are
present.
[0183] Aspects of the invention may be used to implement patient
monitoring procedures. In some embodiments, patients are first
assayed to determine whether they have been exposed to JCV (e.g.,
by assaying patient serum for the presence of a JCV antibody).
Patients that have not been exposed to JCV are identified as having
a low risk for PML. However, in some embodiments, such patients are
monitored periodically to determine whether or when they are
exposed to JCV. If signs of JCV exposure are identified in a
subject prior to treatment or during treatment, then the subject
can be evaluated for the presence of one or more JCV variants
associated with increased risk for PML (e.g., one or more variants
predicted to have reduced sialic acid binding relative to a normal
or wild type form of JCV). Patients may be monitored periodically
for the presence of PML-associated JCV variants. If a patient is
found to harbor one or more PML-associated JCV variants, then the
patient may be monitored carefully for signs of PML, the patient's
treatment may be stopped or altered, and/or the patient may be
treated with one or more prophylactic or therapeutic drugs to help
protect the patient from PML.
[0184] In some embodiments a patient or subject is monitored daily,
weekly, biweekly, monthly, bimonthly, quarterly, twice a year,
yearly or each two years. In some embodiments a patient or subject
is monitored when the patient or subject is undergoing treatment
with immunosuppressants.
[0185] According to aspects of the invention, a JCV variant may be
predicted to have low sialic acid binding (e.g., affinity or
avidity) if the variant has one or more mutations in the sialic
binding pocket of the JVC VP1 protein. In some embodiments,
mutations in any one or more of the amino acids that are within 12
Angstroms of a molecule bound in the sialic acid binding pocket can
be predicted to affect sialic acid binding. A list of VP1 amino
acids within 12 Angstoms of a molecule bound in the sialic acid
binding pocket is provided in Table 16 in Example 12. Accordingly,
a JCV variant with a mutation in one or more of these amino acids
may be identified as being a candidate for reduced binding to
sialic acid and therefore increased risk for causing PML.
[0186] According to aspects of the invention, several different
naturally-occurring JCV VP1 sequences may be used as normal or
wild-type reference sequences if they are from JCV variants that
are not associated with increased risk for PML as described herein.
Examples of such reference sequences are described in more detail
herein and, for example, in Cubitt et al., Predicted amino acid
sequences for 100 JCV strains, Journal of NeuroVirology, 7:
339-344, 2001, the sequence disclosures of which are incorporated
herein by reference in their entirety.
[0187] According to aspects of the invention, the sialic acid
binding properties (e.g., affinity or avidity) of a variant JCV may
be measured using any suitable assay. For example, JCV and or JCV
VP1 binding to sialic acid may measured using hemmaglutination
assays, direct binding to immobilized molecules (e.g.,
gangliosides, sugars, glycoproteins, etc.), cell-based binding
assays (e.g., where binding is detected with labeled antibodies
using flow cytometry), etc., or any combination thereof. In some
embodiments, low binding is more than a 5 fold reduction in binding
(e.g., avidity or affinity) relative to the binding of a normal or
wild-type JCV reference as described herein. However, in some
embodiments, low binding is more than about 10 fold, 50 fold, 100
fold, 200 fold, 500 fold, 1,000 fold, 5,000, 10,000 fold or greater
reduction in binding relative to a normal or wild-type JCV
reference.
[0188] Accordingly, aspects of the invention relate to determining
whether a subject is susceptible to PML due to the presence of a
PML-associated JCV variant. In some embodiments, this information
can be used to determine whether the subject is suitable for
treatment with an immunosuppressive agent. In some embodiments,
this information can be used to determine whether a subject being
treated with an immunosuppressive agent should continue the
treatment or should be switched to a different dosage, regimen,
and/or type of immunosuppressive drug. In certain embodiments, the
detection of a PML-associated JCV variant in a subject being
treated with an immunosuppressive agent provides a basis for
discontinuing the treatment, at least for a predetermined period of
time.
[0189] Patients being treated with an immunosuppressive agent can
be monitored periodically for the presence of a JCV infection. In
some embodiments, if a subject is known or identified to have a JCV
infection, the subject may be periodically monitored for the
presence of a JCV variant that is predicted to have a reduced
binding for sialic acid.
[0190] Accordingly, the invention provides methods and compositions
for determining if a subject is at risk for progressive multifocal
leukoencephalopathy (PML) or has PML (e.g., early stage PML). In
one embodiment, a biological sample of a subject is interrogated
for exposure to a variant JC virus having one or more sequence
variations associated with PML, for example, one or more sequence
variants predicted to result in reduced sialic acid binding. In
some embodiments a plurality of specific predetermined VP-1
positions are interrogated for their mutational status. The pattern
of sequence variations found at the specific positions provides a
risk profile of the subject for PML.
[0191] In some embodiments, the invention provides panels of
JCV-VP1 amino acid positions at which sequence variations are
associated with PML risk and/or PML disease progression. Methods
and compositions are provided for assaying biological samples for
indicia of PML risk. In some embodiments, JC virus polypeptides
and/or nucleic acids may be isolated and analyzed to determine
whether they have sequence variations at one or more predetermined
VP-1 positions. However, in certain circumstances, JC virus can be
difficult to isolate from certain biological samples obtained from
subjects that have low JC viral loads even through they have been
exposed to JC virus and may have a current JC viral infection.
Nonetheless, a subject's exposure to a PML-associated variant JC
virus can be inferred from the presence, in a biological sample
obtained from the subject, of antibodies (e.g., serum antibodies)
against one or more PML-associated variant JCV-VP1
polypeptides.
[0192] JCV sequences in the brain of PML patients are so variable
that identical JCV sequences have never been detected in different
PML patients (Yogo & Sugimoto, 2001). However, aspects of the
invention are based on an analysis of JCV sequences from healthy
and PML subjects and the identification of a subset of positions in
the VP1 sequence at which amino acid substitutions are strongly
correlated with PML. In one aspect, the invention provides guidance
as to which positions in JCV-VP1 need to be interrogated to arrive
at a risk profile for PML. In one aspect, the invention provides
novel panels of VP1 amino acid positions at which sequence
variations are predictive of a risk of PML in a subject infected
with the corresponding variant JCV. Aspects of the invention relate
to screening subjects for the presence of signs or indicia of JCV
variants with reduced binding to sialic acid. In some embodiments,
panels of JCV sequence variations associated with different PML
risk profiles are provided in Table 1A-1H and described in more
detail herein.
JCV and VP1
[0193] In some embodiments, JCV sequence variations associated with
PML are found at selected positions in the major capsid protein
(VP1) of JCV. Sequences of many VP1 proteins described in the
literature have been analyzed to identify a subset of VP1 positions
where sequence variations are strongly associated with PML.
According to the invention, an amino acid is identified as mutant
or variant at a specific position on VP-1 if it differs from the
amino acid at that position in a consensus sequence or other
reference sequence (e.g., the sequence of a wild type archetype
virus). In some embodiments the consensus sequence for the VP1
protein of JCV from healthy subjects is provided by GenBank ID
No#37050849 (AAQ88264; shown as the VP1 sequence in FIG. 1).
JCV-VP1 is conserved when compared to SV40 as shown in FIG. 1. A
number of different archetypes of JCV have been identified. As used
herein, an archetype is a JCV found in the urine of healthy
individuals. In some embodiments, the VP1 sequence of FIG. 1 is a
reference sequence. In some embodiments, a reference sequence is
one or more of the archetypes of Zheng et al. (2005). The three
main archetypes are determined by region (EU archetype is found in
people of European ancestry and the CY and MY archetypes are found
in people of Asian ancestry). While PML-associated sequence
variations were identified based on comparisons to a "consensus"
sequence, several archetypes have the same amino acids at the
positions identified as PML-associated, and the invention can
therefore be practiced based on sequence comparisons to any of the
archetypal sequences. In other embodiments, assays can be based on
determining whether a JCV has one or more predetermined amino acids
at certain positions without performing a comparison to a reference
sequence. It should be appreciated that methods for determining the
presence of certain JCV-VP1 variant sequences can be based on a
direct characterization of JCV nucleic acids or polypeptides
isolated from a subject. Alternatively, the presence of variant JCV
in a subject (or prior exposure of the subject to variant JCV) can
be inferred by detecting subject antibodies (e.g., serum
antibodies) that are specific for one or more of the variant
JCV-VP1 sequences. It should be appreciated that aspects of the
invention also provide for comparing a JCV-VP1 sequence to other
reference sequences. However, even if other reference sequences are
used, an analysis may involve determining the identity of an amino
acid at one or more of the PML associated VP1 positions described
herein.
[0194] According to the invention, the sequence analysis of VP1
variants identified "hot spot" regions of sequence variations
associated with risk for PML. In some embodiments, sequence
variations that are indicative of risk for PML are located in the
surface loops of the VP1 protein. These positions can be found in
Tables 1B-1D. In some embodiments, the total number of sequence
variations in a specific area of the VP1 protein may be indicative
of risk for PML (See Table 2). In some embodiments, the presence of
variant amino acids at 2 or more (e.g., 3, 4, 5, 6, 7, 8, 9, 10, or
more) of the positions described herein may be indicative of risk
for PML. The polarity of these regions may be indicative of risk
for PML and the risk for PML may increase if polar amino acids are
replaced with non-polar amino acids. In some embodiments, a loss of
a polar amino acid at any one or more of the positions identified
in Table 1A or Tables 1B-1D results in a JCV virus having an
increased association with PML. In some embodiments, a loss of a
polar amino acid at any one or more positions within one of the
structural regions shown in FIG. 2 (e.g., within a region defined
by positions 55-75 or 265-271 of the JCV-VP1 polypeptide sequence)
results in a JC virus having an increased association with PML.
Similarly, in certain embodiments a gain of a non-polar amino acid
at any one or more of the positions identified in Table 1A or
Tables 1B-1D results in a JCV virus having an increased association
with PML. Also, in certain embodiments, a gain of a non-polar amino
acid at any one or more positions within one of the structural
regions shown in FIG. 2 (e.g., within a region defined by positions
55-75 or 265-271 of the JCV-VP1 polypeptide sequence) results in a
JC virus having an increased association with PML. FIG. 2 shows a
predicted JCV-VP1 structure highlighting regions where certain
amino acids positions identified as being associated with PML were
mapped to the structure. The predicted structure of the JCV-VP1
protein is based on the crystal structure of the SV40 coat protein
1 and the sequence similarity between the JCV and SV40 proteins.
Parsing of the sequence variations showed that a decrease in the
number of polar amino acids and/or an increase in the number of
non-polar amino acids on the surface area of the VP1 protein
resulted in an increased risk for PML (See Example 3). In one
embodiment, a subject is at risk for PML if a sequence variation in
one or more of the surface loops results in an increase in
non-polar surface area of 10-square angstrom or more per sequence
variation, or a decrease in polar surface area of 10-square
angstrom or more per sequence variation. While the current
invention is not limited to a specific mechanism it is believed
that the changes in the surface loop may impede antibodies from
binding to the JCV-VP1 and/or facilitate the JCV VP1 interaction
with its receptors such as carbohydrate and/or a protein receptor,
such as 5HT2A. Changes in a surface loop of VP1 (e.g., an increase
in non-polar amino acids or surface area and/or a decrease in polar
amino acids or surface area) may increase the affinity of VP1 for
the cell receptor and facilitate viral entry and/or infection of a
host cell, or certain specific host cells important for PML
progression.
Panels of Sequence Variations
[0195] It should be appreciated that interrogating a position may
comprises both determining the amino acid at that position and
comparing that amino acid to a reference amino acid (e.g., the
amino acid found in the wild type/control variant, for example in
the consensus sequence or an archetype sequence).
[0196] It should be appreciated that any single variant or
combination of variants can be indicative of risk for PML. It
should be appreciated that the total number of variants present in
a certain region or in a selected group of interrogated variants
may indicate a risk for PML.
[0197] Aspects of the invention relate to providing one or more
positions on a JCV-VP1 amino acid sequence that correspond to JCV
variants that are associated with risk for PML. For example, each
of the positions shown in Table 1A are associated with risk for PML
and any suitable assay can be used to detect the presence of, or
indicators (indicia) of past exposure to, a JCV variant having an
amino acid variant at one or more of the selected positions. In
some embodiments, an assay can be used to detect the presence of,
or exposure to, a JCV variant having a variant amino acid variant
at two or more positions selected from the positions listed in
Table 1A, wherein the presence of the variant/variants is
indicative of PML.
[0198] In some embodiments, JCV mutations that are associated with
PML susceptibility in a subject are mutations at positions 122, 2,
and 66 and deletions of amino acids 50-51, 123-125 and 126-134 in
the VP1 capsid protein of JCV. In some embodiments, JCV mutations
that are associated with PML susceptibility in a subject are H122R,
A2V, and D66G. In some embodiments a subject is susceptible to PML
if the JCV VP1 capsid protein comprises a substitution of at least
one of amino acid residues 122, 2, 66, 55, 60, 265, 267, and 269,
or one or more deletions of amino acids 50-51, 123-125 and
126-134.
[0199] In some embodiments, the selected positions are interrogated
by comparing the amino acid present at that position to the amino
acid present in a reference. If the amino acid present at a
selected position differs from the amino acid found in the
reference, the position is said to be mutated. Accordingly, in some
aspects the invention provides tables (e.g., databases) of
containing lists of variants that are related to a risk for PML.
The databases also provide variants and variants that are
protective of PML. In some embodiments any variant found at a
selected position is indicative of risk for PML. In further
embodiments the tables provide groups of variants associated with
PML that can be interrogated as a group to arrive at a risk profile
for PML for a subject. It should be appreciated that many of the
variants identified in the reference database are not very common.
For instance a variant indicative of risk for PML may be found in
only 10% of the samples of a person known to be at risk for PML. To
arrive at a risk profile for a subject more than one position may
need to be interrogated. Accordingly, in one aspect the invention
provides tables of groups of positions and number of positions
within that group that need to be identified to arrive at a risk
profile for PML. In some embodiments, at least 8 (e.g., 8, 9, 10 or
more, or all) positions in Table 1A need to be interrogated to be
arrive at a subject's risk profile for PML. Similarly, 2, 3, 4, 5,
6, 7, 8, 9, 10 or more or all positions in any of the tables may be
interrogated.
[0200] Amino acids found at the positions indicated in the Tables
may be indicative of risk for PML by comparing the amino acid to an
amino acid found in a reference. For instance, in Table 1A, the
wild type (e.g., reference/consensus) amino acid at position 55 is
leucine (L). In some embodiments, any amino acid found at position
55 that is not leucine is indicative of risk for PML. In some
embodiments, a particular variant is associated with risk for PML.
For instance, the presence of a phenylalanine (F) at position 55
may be indicative of risk for PML. Accordingly, the emergence of a
variant amino acid (e.g., Phe) at position 55 may be indicative of
onset or progression of PML. Similarly, the emergence of one or
more other variant amino acids described herein for PML-associated
positions on VP1 may be indicative of onset or progression of PML.
In some embodiments, the presence of an amino acid with a
particular characteristic may be indicative of the risk for PML.
For instance, the presence in the JCV variant of an amino acid that
is less polar than the amino acid found in the reference sequence
is indicative of risk for PML. In addition to being indicative for
risk for PML, the variants found at specific positions may also be
used to determine onset, progression or regression in a subject. In
some embodiments, the variants found at specific positions allow
for the monitoring of treatment of a subject for PML. In some
embodiments, the variants found at specific positions allow for the
selection of a treatment of a subject having or suspected of having
PML.
[0201] In some embodiments, amino acids found at specific amino
positions can be indicative as being protective for PML, e.g.,
identifying the person for being at lower risk for developing
PML.
[0202] It should be appreciated that in some embodiments, the risk
for PML can be determined without comparing the amino acid
determined at a particular position to a reference sequence. For
instance, if in a sample position 55 is interrogated and the amino
acid found at that position is a phenylalanine, then the subject is
determined to be at risk for PML. This determination can be made
without comparing the amino acid found at position 55 to a wild
type reference.
[0203] It should be appreciated that the invention provides methods
for determining both the current and past existence of JCV
variants. A subject that has been exposed to a JCV variant, but
that currently can not be identified as being infected with that
JCV variant, can be determined to be exposed to that JCV variant by
determining the presence of indicators for that JCV variant. A
subject can develop antibodies against any foreign agent, including
viruses and bacteria, to which the subject is exposed. The presence
of a virus, or variant of the virus in a subject can therefore be
diagnosed by the detection of an antibody specific to that virus or
virus variant. If the virus replicates and mutates (and thus
creates a new variant) the body will develop new antibodies
specific for the mutated version of the virus. Even if a specific
virus variant is no longer present in the body, past exposure to
the variant can still be determined by the presence of the
antibody. Accordingly, in one embodiment the mutational status of
the JCV variants (both current and past exposure) is determined by
the detection of the presence of antibodies against one or more
specific variants. In one embodiment, the presence of a
VP1-antibody is determined by specific binding of the antibody to
one or more polypeptides comprising one or more of the variants. It
should be appreciated that antibodies can be determine
qualitatively and quantitatively. An antibody detection assay of
the invention therefore facilitates the determination of all viral
variants the subject has ever been exposed to and an estimate of
the viral load of variants currently present in the body through
the quantization of the specific antibodies.
[0204] In one embodiment, the amino acid variants are detected
directly, e.g., the presence of virus variants in a subject is
determined by determining the presence of polypeptides comprising
one or more variants of the variants. Agents are developed that can
specifically bind a particular polypeptide. In some embodiments
these agents are antibodies. In some embodiments, the variants are
determined by determining the sequence of the nucleic acids
encoding the variants. A sample is obtained from a subject and
analyzed for the presence of a particular virus variant. It should
be appreciated that specific JCV variants may only be present in
the brain and spinal fluid, while "wild type" variants may be
present in other tissues in the same subject. The presence of
polypeptides may be determined by antibodies specific for these
polypeptides. The assay will allow for the determination of both
the presence of specific variants and the quantitation of these
variants (the viral load), in addition the ratio of variant to wild
type can be determined.
[0205] It should be appreciated that an immunosupressive agent may
increase the susceptibility of a subject to the progression or
flare up of a latent microbial infection or to the contraction of a
new microbial infection. In some embodiments the microbial
infection is infection by JCV, which caused PML. Accordingly, the
risk for PML may be assessed prior to initiating treatment with an
immunosuppressive agent, during administration of an
immunosupressive agent, or assessed after an immunosupressive agent
has been administered or after treatment with immunosupressive
treatment has been terminated.
[0206] In some embodiments, the risk for PML as determined by the
methods of the invention will aid in deciding on treatment with
immunosuppressants or immunosuppresive agents. In some embodiments
an increased risk for PML diagnosed during treatment with
immunossuppressents may suggest a modification or termination of
the treatment regimen with immunosuppressants.
TABLE-US-00001 TABLE 1A Panel of JCV-VP1 variants PML patients PML
PML Healthy (brain + patients patients JCV individ- peripheral
(peripheral (brain VP1 uals tissue) tissue) tissue) pos WT #seq
#mut % mut mut #seq #mut % mut mut #seq #mut % mut mut #seq #mut %
mut mut 55 L 29 0 0 50 5 10 5F 13 3 23 3F 37 2 5 2F 60 K 29 0 0 50
4 8 2M 13 1 8 1N 37 3 8 2M 1E 1E 1N 61 S 29 0 0 50 1 2 1L 13 0 0 37
1 3 1L 66 D 29 0 0 50 5 10 4H 13 0 0 37 5 14 4H 1N 1N 69 E 29 0 0
50 1 2 1D 13 0 0 37 1 3 1D 74 N 29 0 0 50 4 8 4S 13 0 0 37 4 11 4S
75 K 29 0 0 50 3 6 3R 13 0 0 37 3 8 3R 113 I 41 3 7 3L 50 18 36 18L
13 5 38 5L 37 13 35 13L 117 T 41 1 2 1S 50 8 16 8S 13 0 0 37 8 22
8S 123 S 41 0 0 50 4 8 4C 13 2 15 2C 37 2 5 2C 128 T 41 2 5 2A 50 6
12 6A 13 0 0 37 6 16 6A 134 A 41 20 49 20G 50 47 94 47G 13 10 77
10G 37 37 100 37G 158 V 29 0 0 50 4 8 4L 13 0 0 37 4 11 4L 164 T 29
5 17 5K 50 46 92 46K 13 10 77 10K 37 36 97 36K 223 V 42 0 0 52 1 2
1A 14 0 0 38 1 3 1A 265 N 42 0 0 52 4 8 3D 14 4 29 3D 38 0 0 1T 1T
267 S 42 0 0 52 4 8 3F 14 1 7 1F 38 3 8 2F 1L 1L 269 S 42 0 0 52 12
23 9F 14 1 7 1F 38 11 29 8F 3Y 3Y 271 Q 42 0 0 52 1 2 1H 14 0 0 38
1 3 1H 321 I 42 20 48 20V 32 28 88 28V 5 1 20 1V 27 27 100 27V 332
Q 42 20 48 20E 32 29 91 29E 5 2 40 2E 27 27 100 27E 345 R 42 0 0 32
8 25 8K 5 0 0 27 8 30 8K
TABLE-US-00002 TABLE 1B Panel of Group I JCV-VP1 variants PML
patients PML PML Healthy (brain + patients patients JCV individ-
peripheral (peripheral (brain VP1 uals tissue) tissue) tissue) pos
WT #seq #mut % mut mut #seq #mut % mut mut #seq #mut % mut mut #seq
#mut % mut mut 55 L 29 0 0 50 5 10 5F 13 3 23 3F 37 2 5 2F 60 K 29
0 0 50 4 8 2M 13 1 8 1N 37 3 8 2M 1E 1E 1N 61 S 29 0 0 50 1 2 1L 13
0 0 37 1 3 1L 66 D 29 0 0 50 5 10 4H 13 0 0 37 5 14 4H 1N 1N 69 E
29 0 0 50 1 2 1D 13 0 0 37 1 3 1D 74 N 29 0 0 50 4 8 4S 13 0 0 37 4
11 4S 75 K 29 0 0 50 3 6 3R 13 0 0 37 3 8 3R
TABLE-US-00003 TABLE 1C Panel of Group II JCV-VP1 variants PML
patients PML PML Healthy (brain + patients patients JCV individ-
peripheral (peripheral (brain VP1 uals tissue) tissue) tissue) pos
WT #seq #mut % mut mut #seq #mut % mut mut #seq #mut % mut mut #seq
#mut % mut mut 265 N 42 0 0 52 4 8 3D 14 4 29 3D 38 0 0 1T 1T 267 S
42 0 0 52 4 8 3F 14 1 7 1F 38 3 8 2F 1L 1L 269 S 42 0 0 52 12 23 9F
14 1 7 1F 38 11 29 8F 3Y 3Y 271 Q 42 0 0 52 1 2 1H 14 0 0 38 1 3
1H
TABLE-US-00004 TABLE 1D Panel of Group III JCV-VP1 variants PML
patients PML PML Healthy (brain + patients patients JCV individ-
peripheral (peripheral (brain VP1 uals tissue) tissue) tissue) pos
WT #seq #mut % mut mut #seq #mut % mut mut #seq #mut % mut mut #seq
#mut % mut mut 113 I 41 3 7 3L 50 18 36 18L 13 5 38 5L 37 13 35 13L
123 S 41 0 0 50 4 8 4C 13 2 15 2C 37 2 5 2C 158 V 29 0 0 50 4 8 4L
13 0 0 37 4 11 4L 164 T 29 5 17 5K 50 46 92 46K 13 10 77 10K 37 36
97 36K 345 R 42 0 0 32 8 25 8K 5 0 0 27 8 30 8K
TABLE-US-00005 TABLE 1E Panel of Groups I-III JCV-VP1 variants PML
patients PML PML Healthy (brain + patients patients JCV individ-
peripheral (peripheral (brain VP1 uals tissue) tissue) tissue) pos
WT #seq #mut % mut mut #seq #mut % mut mut #seq #mut % mut mut #seq
#mut % mut mut 55 L 29 0 0 50 5 10 5F 13 3 23 3F 37 2 5 2F 60 K 29
0 0 50 4 8 2M 13 1 8 1N 37 3 8 2M 1E 1E 1N 61 S 29 0 0 50 1 2 1L 13
0 0 37 1 3 1L 66 D 29 0 0 50 5 10 4H 13 0 0 37 5 14 4H 1N 1N 69 E
29 0 0 50 1 2 1D 13 0 0 37 1 3 1D 74 N 29 0 0 50 4 8 4S 13 0 0 37 4
11 4S 75 K 29 0 0 50 3 6 3R 13 0 0 37 3 8 3R 113 I 41 3 7 3L 50 18
36 18L 13 5 38 5L 37 13 35 13L 123 S 41 0 0 50 4 8 4C 13 2 15 2C 37
2 5 2C 158 V 29 0 0 50 4 8 4L 13 0 0 37 4 11 4L 164 T 29 5 17 5K 50
46 92 46K 13 10 77 10K 37 36 97 36K 265 N 42 0 0 52 4 8 3D 14 4 29
3D 38 0 0 1T 1T 267 S 42 0 0 52 4 8 3F 14 1 7 1F 38 3 8 2F 1L 1L
269 S 42 0 0 52 12 23 9F 14 1 7 1F 38 11 29 8F 3Y 3Y 271 Q 42 0 0
52 1 2 1H 14 0 0 38 1 3 1H 345 R 42 0 0 32 8 25 8K 5 0 0 27 8 30
8K
TABLE-US-00006 TABLE 1F Panel of JCV-VP1 variants found in most PML
brain samples PML patients PML PML Healthy (brain + patients
patients JCV individ- peripheral (peripheral (brain VP1 uals
tissue) tissue) tissue) pos WT #seq #mut % mut mut #seq #mut % mut
mut #seq #mut % mut mut #seq #mut % mut mut 134 A 41 20 49 20G 50
47 94 47G 13 10 77 10G 37 37 100 37G 164 T 29 5 17 5K 50 46 92 46K
13 10 77 10K 37 36 97 36K 321 I 42 20 48 20V 32 28 88 28V 5 1 20 1V
27 27 100 27V 332 Q 42 20 48 20E 32 29 91 29E 5 2 40 2E 27 27 100
27E
TABLE-US-00007 TABLE 1G Panel of JCV-VP1 risk variants no found in
samples from healthy individuals PML patients PML PML Healthy
(brain + patients patients JCV individ- peripheral (peripheral
(brain VP1 uals tissue) tissue) tissue) pos WT #seq #mut % mut mut
#seq #mut % mut mut #seq #mut % mut mut #seq #mut % mut mut 55 L 29
0 0 50 5 10 5F 13 3 23 3F 37 2 5 2F 60 K 29 0 0 50 4 8 2M 13 1 8 1N
37 3 8 2M 1E 1E 1N 61 S 29 0 0 50 1 2 1L 13 0 0 37 1 3 1L 66 D 29 0
0 50 5 10 4H 13 0 0 37 5 14 4H 1N 1N 69 E 29 0 0 50 1 2 1D 13 0 0
37 1 3 1D 74 N 29 0 0 50 4 8 4S 13 0 0 37 4 11 4S 75 K 29 0 0 50 3
6 3R 13 0 0 37 3 8 3R 123 S 41 0 0 50 4 8 4C 13 2 15 2C 37 2 5 2C
158 V 29 0 0 50 4 8 4L 13 0 0 37 4 11 4L 223 V 42 0 0 52 1 2 1A 14
0 0 38 1 3 1A 265 N 42 0 0 52 4 8 3D 14 4 29 3D 38 0 0 1T 1T 267 S
42 0 0 52 4 8 3F 14 1 7 1F 38 3 8 2F 1L 1L 269 S 42 0 0 52 12 23 9F
14 1 7 1F 38 11 29 8F 3Y 3Y 271 Q 42 0 0 52 1 2 1H 14 0 0 38 1 3 1H
345 R 42 0 0 32 8 25 8K 5 0 0 27 8 30 8K
TABLE-US-00008 TABLE 1H Panel of JCV-VP1 variants found in healthy
individuals PML patients PML PML Healthy (brain + patients patients
JCV individ- peripheral (peripheral (brain VP1 uals tissue) tissue)
tissue) pos WT #seq #mut % mut mut #seq #mut % mut mut #seq #mut %
mut mut #seq #mut % mut mut 115 V 41 1 2 1E 50 0 0 13 0 0 37 0 0
277 R 42 1 2 1K 52 0 0 14 0 0 38 0 0
TABLE-US-00009 TABLE 2 A: Healthy Subjects SEQUENCE #MUT #REGION
LENGTH VARIANTS AAQ88264_gi|37050849|gb|AAQ 0 0 347 CONSENSUS
AAB60589_gi|1161330|gb|AAB6 2 0 27 128 A 134 G
AAC54623_gi|1161332|gb|AAC5 0 0 27 AAG48112_gi|12056896|gb|AAG 2 0
142 321 V 332 E AAG48114_gi|12056899|gb|AAG 2 0 142 321 V 332 E
AAG48119_gi|12056907|gb|AAG 2 0 142 321 V 332 E
AAG48121_gi|12056910|gb|AAG 2 0 142 321 V 332 E
AAG48123_gi|12056913|gb|AAG 2 0 142 321 V 332 E
AAG48125_gi|12056916|gb|AAG 2 0 142 321 V 332 E
AAG48127_gi|12056919|gb|AAG 2 0 142 321 V 332 E
AAG48544_gi|12082440|gb|AAG 1 0 56 134 G
AAG48545_gi|12082442|gb|AAG 1 0 56 134 G
AAG48546_gi|12082444|gb|AAG 1 0 56 134 G
AAG48547_gi|12082446|gb|AAG 1 0 56 134 G
AAG48548_gi|12082448|gb|AAG 1 0 56 134 G
AAG48549_gi|12082450|gb|AAG 2 1 56 113 L 134 G
AAG48550_gi|12082452|gb|AAG 2 1 56 113 L 134 G
AAG48551_gi|12082454|gb|AAG 2 1 56 113 L 134 G
AAL12481_gi|16118426|gb|AAL 2 0 142 321 V 332 E
AAL12483_gi|16118429|gb|AAL 2 0 142 321 V 332 E
AAR06661_gi|37993002|gb|AAR 0 0 347 AAR12957_gi|38156673|gb|AAR 1 0
347 134 G AAR13077_gi|38176429|gb|AAR 1 0 347 134 G
AAR13659_gi|38195910|gb|AAR 0 0 347 AAR32743_gi|39939397|gb|AAR 0 0
347 AAR89187_gi|40737215|gb|AAR 0 0 347 AAR89193_gi|40737222|gb|AAR
0 0 347 AAR89199_gi|40737229|gb|AAR 0 0 347
AAR89205_gi|40737236|gb|AAR 0 0 347 AAR89211_gi|40737243|gb|AAR 1 0
347 277 K AAR89217_gi|40737250|gb|AAR 0 0 347
AAR89223_gi|40737257|gb|AAR 0 0 347 AAR89229_gi|40737264|gb|AAR 0 0
347 AAR89235_gi|40737271|gb|AAR 0 0 347 AAR89241_gi|40737278|gb|AAR
0 0 347 AAR89247_gi|40737285|gb|AAR 0 0 347
AAR89253_gi|40737292|gb|AAR 0 0 347 AAR89259_gi|40737299|gb|AAR 1 0
347 134 G AAR89265_gi|40737543|gb|AAR 0 0 347
AAR89271_gi|40737550|gb|AAR 1 0 347 115 E
AAR89277_gi|40737557|gb|AAR 0 0 347 AAR89283_gi|40737564|gb|AAR 0 0
347 ABA60111_gi|76885940|gb|ABA 0 0 58 BAA01963_gi|425204|dbj|BAA0
4 1 347 134 G 164 K 321 V 332 E BAA01964_gi|425205|dbj|BAA0 4 1 347
134 G 164 K 321 V 332 E BAA07834_gi|1772312|dbj|BAA 2 0 134 321 V
332 E BAA07836_gi|1785835|dbj|BAA 2 0 134 321 V 332 E
BAA07838_gi|1785837|dbj|BAA 2 0 134 321 V 332 E
BAA07840_gi|1772321|dbj|BAA 2 0 134 321 V 332 E
BAB11698_gi|9796401|dbj|BAB 4 1 347 134 G 164 K 321 V 332 E
BAB11704_gi|9796408|dbj|BAB 4 1 347 134 G 164 K 321 V 332 E
BAB11716_gi|9796422|dbj|BAB 3 0 347 134 G 321 V 332 E
BAB11722_gi|9796429|dbj|BAB 3 0 347 134 G 321 V 332 E Average
Values 1.2 0.1 234.7 B: PML Samples Sequence #mut #region Length
Variants AAB62680_gi|2246607|gb|AA 5 1 347 128 A 134 G 164 K 321 V
332 E AAT09819_gi|47078338|gb|A 5 3 347 113 L 134 G 164 K 265 T 332
E AAT09825_gi|47078345|gb|A 1 1 347 267 F AAT09831_gi|47078352|gb|A
1 1 347 55 F AAT09837_gi|47078359|gb|A 1 1 347 60 N
BAE02848_gi|68445641|dbj| 4 3 246 113 L 134 G 164 K 265 D
BAE02849_gi|68445643|dbj| 3 2 246 55 F 134 G 164 K
BAE02850_gi|68445645|dbj| 4 3 246 113 L 134 G 164 K 265 D
BAE02851_gi|68445647|dbj| 4 3 246 113 L 123 C 134 G 164 K
BAE02852_gi|68445649|dbj| 3 2 246 134 G 164 K 269 F
BAE02853_gi|68445651|dbj| 4 3 246 113 L 123 C 134 G 164 K
BAE02854_gi|68445653|dbj| 3 2 246 55 F 134 G 164 K
BAE02855_gi|68445655|dbj| 2 1 246 134 G 164 K
BAE02856_gi|68445657|dbj| 3 2 246 134 G 164 K 265 D
AAB60586_gi|1161322|gb|AAB 2 0 134 321 V 332 E Partial
AAB60584_gi|1161319|gb|AAB 2 0 134 321 V 332 E Partial
AAB62687_gi|2246615|gb|AAB 6 2 347 55 F 128 A 134 G 164 K 321 V 332
E AAB94036_gi|2735983|gb|AAB 4 1 347 55 F 134 G 321 V 332 E
BAA01965_gi|425206|dbj|BAA 6 2 347 128 A 134 G 164 K 269 F 321 V
332 E BAA01966_gi|425207|dbj|BAA 9 5 347 66 H 75 R 117 S 134 G 158
L 164 K 321 V 332 E 345 K BAA01967_gi|425208|dbj|BAA 8 4 347 117 S
134 G 158 L 164 K 267 L 321 V 332 E 345 K
BAA01968_gi|425209|dbj|BAA 8 3 347 74 S 117S 128 A 134 G 164 K 321
V 332 E 345 K BAA01969_gi|425210|dbj|BAA 6 3 347 113 L 134 G 164 K
269 F 321 V 332 E BAA01970_gi|425211|dbj|BAA 5 2 347 113 L 134 G
164 K 321 V 332 E BAA05636_gi|538231|dbj|BAA 5 2 347 113 L 134 G
164 K 321 V 332 E BAA05637_gi|538234|dbj|BAA 6 3 347 113 L 134 G
164 K 269 F 321 V 332 E BAA05638_gi|538238|dbj|BAA 5 2 347 134 G
164 K 269 Y 321 V 332 E BAB11728_gi|9796436|dbj|BA 6 3 347 113 L
134 G 164 K 269 F 321 V 332 E BAB11734_gi|9796443|dbj|BA 5 2 347
134 G 164 K 269 Y 321 V 332 E BAE00111_gi|67968154|dbj|B 8 3 347 74
S 117 S 128 A 134 G 164 K 321 V 332 E 345 K
BAE00117_gi|67968161|dbj|B 9 4 347 74 S 117 S 128 A 134 G 164 K 269
F 321 V 332 E 337 K BAE00123_gi|67968168|dbj|B 9 4 347 74 S 117 S
128 A 134 G 164 K 269 F 321 V 332 E 337 K
BAE00129_gi|67968175|dbj|B 4 1 347 134 G 164 K 321 V 332 E
BAE00135_gi|67968182|dbj|B 5 2 347 61 L 134 G 164 K 321 V 332 E
BAE00141_gi|67968189|dbj|B 4 1 347 134 G 164 K 321 V 332 E
BAE00147_gi|67968204|dbj|B 5 2 347 113 L 134 G 164 K 321 V 332 E
BAE00153_gi|67968211|dbj|B 6 3 347 113 L 134 G 164 K 269 Y 321 V
332 E BAE00159_gi|67968218|dbj|B 6 3 347 60 M 113 L 134 G 164 K 321
V 332 E BAE00165_gi|67968225|dbj|B 6 3 347 113 L 123 C 134 G 164 K
321 V 332 E BAE00171_gi|67968232|dbj|B 6 3 347 105 L 123 C 134 G
164 K 321 V 332 E BAE02837_gi|68445619|dbj|B 2 1 246 134 G 164 K
BAE02838_gi|68445621|dbj|B 3 2 246 66 H 134 G 164 K
BAE02839_gi|68445623|dbj|B 3 2 246 66 H 134 G 164 K
BAE02840_gi|68445625|dbj|B 4 3 246 60 E 66 H 134 G 164 K
BAE02841_gi|68445627|dbj|B 4 3 246 113 L 134 G 164 K 267 F
BAE02842_gi|68445629|dbj|B 4 3 246 60 M 134 G 164 K 270 H
BAE02843_gi|68445631|dbj|B 3 2 246 66 H 134 G 164 K
BAE02844_gi|68445633|dbj|B 4 3 246 113 L 134 G 164 K 269 F
BAE02845_gi|68445635|dbj|B 4 3 246 113 L 134 G 164 K 267 F
BAE02846_gi|68445637|dbj|B 3 1 246 134 G 164 K 223 A
BAE02847_gi|68445639|dbj|B 4 3 246 69 D 134 G 164 K 269 F
P03089_gi|116626|sp|P03089 8 4 347 75 R 117 S 134 G 158 L 164 K 321
V 332 E 345 K BAB11710_gi|9796415|dbj|BAB 8 4 347 75 R 117 S 134 G
158 L 164 K 321 V 332 E 345 K MAD-1 Average values 4.7 2.4
300.8
Diagnostics
[0207] Accordingly, methods of the invention are useful in one
aspect for determining if a subject is at risk for, or has, PML
based on the panels and groups of variant/variants of the
invention. Assaying a biological sample from a subject for an
indicium of exposure to a variant JCV will allow for the
determination if a person is at risk for, or has, PML, or is
infected by a JCV variant associated with PML. The determination of
whether a subject has been exposed to, or is infected with, a JCV
variant having a sequence variation at one or more of the VP1
positions described herein allows for the assessment of whether a
subject is at risk for PML (variants at VP1 positions of a JCV
variant associated with PML are also referred to as variants of the
invention). In one aspect, the invention provides correlations
between the mutational status at predetermined positions of a JCV
variant and risk for PML. In some embodiments the variants are
located on the JCV-VP1 protein.
[0208] As used herein, "diagnosing" and "identifying" PML means the
recognition of whether a person is at risk for PML, or has PML. The
diagnosis of being at risk for PML is not limited to the
determination of variants at positions indicative of exposure to a
JCV variant and may be combined with diagnosis methods routine in
the art. These diagnostic assays include but are not limited to
histopathology, immunohistochemistry, flow cytometry, cytology,
patho-physiological assays, including MRI and tomography,
neurological assays biochemical assays. Detection of JCV DNA by PCR
in CSF is the most widely accepted diagnostic test of PML. It has
99% specificity and 70% selectivity. In the absence of a positive
JCV PCR result for CSF, a brain biopsy could be performed. JCV DNA
detection in brain tissue can be used as a positive diagnosis of
PML. Biochemical assays include but are not limited to variant
analysis other than at the predetermined positions, viral genome
analysis, ELISA analysis of specific proteins, platelet count etc.
Those of ordinary skill in the art will be aware of numerous
diagnostic protocols and parameters that are routinely utilized in
the art.
[0209] Diagnosis also covers a determination of the amount of JCV
variant (viral load) and the ratio of JCV variant versus JCV wild
type in a sample and/or subject.
[0210] Methods and/or kits of the invention can be used to screen
subjects for having PML and being at risk for PML as indicated by
the presence of variants at predetermined positions indicative of
exposure to a JCV variant (the variants of the invention), in which
the presence of one or more variants of the invention is associated
with being at risk for PML. Methods of the invention may be used to
diagnose the risk for PML by assessing the variants of the
invention in a sample from a subject that has been exposed or is
suspected of having been exposed to a JCV variant associated with
PML.
[0211] The invention, in some aspects, includes various assays to
determine whether a subject has been exposed to a JCV variant
having one or more variants at specific positions in the VP1
protein. Methods and assays of the invention may be used to monitor
changes in the status of variants of the invention in a sample and
or a subject over time. In addition, methods of the invention may
be used to monitor the amount of JCV variant present in subject
over time, by obtaining multiple sample from the subject at
different time points. Thus, methods of the invention may be used
to examine changes in variants of the invention and/or amount of
JCV variant in a subject or sample over time. This allows
monitoring of mutational status in a subject who is suspected to be
at risk of developing PML and also enables quantitative monitoring
in a subject who is known to have been exposed to a JCV
variant.
Detection of JCV-VP1 Variant Nucleic Acids, Polypeptides and
Antibodies
[0212] In one aspect the invention provides methods for the
detection of JCV-VP1 variant polypeptides and/or antibodies that
can specifically bind the JCV variant polypeptides in a biological
sample (also referred to as polypeptides and antibodies of the
invention, respectively). Methods of detecting polypeptides and
antibodies are well known in the art and the invention is not
limited to any specific detection method. In addition, the
polypeptides and antibodies may be detected indirectly, through the
detection of nucleic acids encoding the polypeptides or antibodies
of the invention. Methods for the detection of nucleic acids are
well known in the art and non-limiting examples are PCR,
sequencing, hybridization analysis, probe analysis and microarray
analysis, which are all embraced by the current invention.
Non-limiting examples of methods for the detection of polypeptides
and/or antibodies include peptide sequencing, mass spectrometry and
immunosorbent assays (e.g., binding of the polypeptide to an
antibody) and protein arrays.
[0213] Enzyme-linked immunosorbent assays (ELISAs) are a well-known
assays used for the detection of various antigens including
polypeptides. The invention embraces any ELISA that can detect the
presence of a polypeptides of the invention and any ELISA that can
detect the presence of antibodies of the invention in a sample.
[0214] In one embodiment a first step of an ELISA comprises
providing a primary antibody specific for a JCV-VP1 polypeptide
bound to a multiwell plate. The invention is not limited to
multiwell plates and the antibodies may be immobilized onto any
surface including beads and glass slides. The invention is also not
limited to antibodies and any peptide binding moiety, including
aptamers, antibody fragments and small molecules are embraced by
the invention. The invention embraces both the qualitative and
quantitative determination of the presence of polypeptides of the
invention. In one embodiment, the wells can be blocked using a
buffer containing a high concentration of irrelevant protein, such
as bovine serum albumin or casein. The blocking step ensures that
any uncoated areas of the surface will be occupied with
non-reactive protein, if needed. Excess blocking agent is then
removed by one or more washes. In some embodiments the ELISA is a
multiplex assay and each well of a multiwell plate comprises an
antibody specific for one specific JCV-VP1 polypeptide variant.
Once the surface is blocked, a sample containing a JCV-VP1
polypeptide, or a sample to be tested for presence of a JCV-VP1
polypeptide, can be contacted with the primary antibody and is
allowed to incubate under conditions and for an amount of time
suitable to permit specific binding of the JCV-VP1 polypeptide to
the primary antibody. Such conditions and amount of time can be,
for example, room temperature for 3-4 hours, or 4.degree. C. for
10-16 hours. Excess sample is then removed by one or more washes.
As a next step, a secondary antibody, also specific for the JCV-VP1
polypeptide, is contacted to the primary antibody-polypeptide
complex and is allowed to incubate under conditions and for an
amount of time suitable to permit specific binding of the JCV-VP1
polypeptide by the secondary antibody. Such conditions and amount
of time can be, for example, antibody at 1-10 microgram/ml, room
temperature for 1-4 hours, and 4.degree. C. for 10-16 hours. In
some embodiments, the secondary antibody is connected to a
fluorescent tag or to a metabolizing enzyme, allowing for the
detection of bound JCV-VP1 polypeptide. Alternatively, bound
JCV-VP1 polypeptide can be determined by contacting the secondary
antibody with a labeled tertiary antibody. The above-described
ELISA is referred to as a sandwich ELISA as the JCV-VP1 polypeptide
is sandwiched between two antibodies (the primary antibody and the
secondary antibody).
[0215] In some embodiments, the presence of antibodies specific for
JCV-VP1 polypeptides is determined. The invention embraces both the
qualitative and quantitative determination of presence of
antibodies of the invention. Determination of the presence of
antibodies can allow for the determination of both current and past
infection. In most instances, the human body will develop an
antibody against a foreign polypeptide, such as a JCV proteins.
Even if the virus (e.g., viral nucleic acid) itself is no longer
detected in the body, antibodies against the virus may still be
present, thereby being an indicator of exposure to the virus. In
one embodiment of a method for detecting antibodies specific for
variant JCV-VP1 polypeptides, one or more solid surfaces (e.g., a
multi-well plate, bead or slide) are provided wherein each surface
has an immobilized unique JCV-VP1 polypeptide variant.
[0216] In some embodiments the JCV-VP1 polypeptide variants are
immobilized as JCV particles (e.g., recombinant VP1 proteins that
contain one or more variants and that are self-assembled to form
particles that are immobilized, for example, on an assay surface).
These particles may contain one or more of the variants described
herein (see, e.g., Tables 1A-1H, Table 17 and/or Table 18, and/or
one or more other variants described herein).
[0217] Each polypeptide variant comprises one or more of the
variants of Tables 1A-1H, Table 17 and/or Table 18 and/or one or
more other variants described herein. Multiple peptides may cover
the same one or more variants. In one embodiment combinations of
polypeptides variants are attached to the solid surface. In some
embodiments the solid surface a multi-well plate is provided
wherein each well comprises one or more variants. In some
embodiments a multi-well plate comprises wells with peptides
covering all variants described herein that are indicative of risk
for PML. A sample comprising or suspected of comprising one or more
antibodies that can bind to a JCV-VP1 Polypeptide variant described
herein is contacted with the immobilized peptides under conditions
suitable for the antibodies to bind to the immobilized JCV-VP1
polypeptide. The presence of the bound antibodies is subsequently
detected through binding of a secondary antibody.
[0218] The ELISAs of the invention are not limited to the above
described embodiments, but also embraces competitive ELISAs and any
form of ELISA that allows for the detection of the polypeptides and
antibodies of the invention.
Onset, Progression, Regression
[0219] Methods and/or kits of the invention can be used to obtain
useful prognostic information by providing an early indicator of
PML onset, progression, and/or regression. The invention includes
methods to monitor the onset, progression, or regression of PML
and/or JCV variant infection in a subject by, for example,
obtaining samples at sequential times from a subject and assaying
such samples for exposure to JCV variants of the invention. A
subject may be suspected of having PML or may be believed not to
have PML and in the latter case, the sample may serve as a normal
baseline level for comparison with subsequent samples.
[0220] Onset of a condition is the initiation of the changes
associated with the condition in a subject. Such changes may be
evidenced by physiological symptoms. However, a patient may be
clinically asymptomatic. For example, the onset of PML and/or JCV
infection may be followed by a period during which there may be
PML-associated pathogenic changes in the subject, even though
clinical symptoms may not be evident at that time. The progression
of PML follows onset and is the advancement of the pathogenic
(e.g., physiological) elements of the condition, which may or may
not be marked by an increase in clinical symptoms. In contrast, the
regression of PML and/or JCV infection may include a decrease in
physiological characteristics of the condition, perhaps with a
parallel reduction in symptoms, and may result from a treatment or
may be a natural reversal in the condition. Onset of PML and/or JCV
infection may be indicated by a change in the variants at the
interrogated positions in samples obtained from the subject. For
example, if the number of variants at the interrogated positions is
lower in a first sample from a subject, than in a second or
subsequent sample from the subject, it may indicate the onset or
progression of PML and/or JCV infection. In some embodiments the
presence of only one variant may be indicative of the onset or
progression of PML. In some embodiments the variant is at position
164. In a particular embodiment, the emergence of a variant amino
acid (e.g., Lys) at position 164 is indicative of onset or
progression of PML. In some embodiments onset of PML and/or JCV
infection is indicated by a change in viral load of JCV variant
and/or ratio of JCV variant to JCV wild type. In some embodiments
an increase in viral load is accompanied by an increase in the
number of variants.
[0221] Progression and regression of PML and/or JCV infection may
be generally indicated by the increase or decrease in the number of
variants at interrogated positions in a subject's samples over
time. For example, if the number of variants is low in a first
sample from a subject and increased levels of variants are
determined to be present in a second or subsequent sample from the
subject, it may indicate the progression of PML and/or JCV
infection, respectively. It should be appreciated that both an
increase and a decrease in the number of variants, may be
indicative of progression or regression of PML and/or JCV
infection, respectively. For instance, the number of variants at
certain positions may increase, while the number of variants at
other positions may decrease, with both changes being indicative of
PML and/or JCV infection.
[0222] Progression of PML and/or JCV infection may also be
indicated by the increase in viral load of a JCV variant or an
increase in the ratio of JCV variant to JCV wild type, while
regression may be indicated by a decrease in viral load of a JCV
variant or a decrease in the ratio of JCV variant to JCV wild
type.
[0223] Onset, progression and regression can be determined by
assaying multiple samples that are obtained from a subject at
different time points. For instance, even if a first group of
samples taken at different time points does not show onset,
progression or regression of PML an additional sample may be
obtained and assayed for the variants of the invention and compared
to earlier samples to determine whether onset, progression or
regression are occurring. In some embodiments additional samples
are assayed when the administration regimes of one or more
immunosuppressants is modified.
Assays for PML Treatment
[0224] Methods of the invention may also be used to assess the
efficacy of a therapeutic treatment of PML by interrogation for
exposure to a variant of JC virus in a subject at various time
points. For example, the number of variants indicative of exposure
to a variant JC virus can be obtained prior to the start of a
therapeutic regimen (either prophylactic or as a treatment of
cancer or a precancerous condition), during the treatment regimen,
and/or after a treatment regimen, thus providing information on the
effectiveness of the regimen in the subject. In addition, the
abundance of JCV variants indicative of PML risk can also be
monitored over time. In some embodiments, the amount of JCV variant
(viral load) or ratio of JCV variant to wild type JCV may provides
information on the effectiveness of the regimen in the subject.
Methods of the invention may be used to compare the mutated
positions in two or more samples obtained from a subject at
different times. In some embodiments, a sample is obtained from a
subject, the subject is administered a treatment for PML and a
subsequent sample is obtained from the subject. A comparison of a
subject's variants of the invention or viral load of the JC variant
or ratio of JC variant to JCV wild type is determined in samples
obtained at different times and/or on different days, thereby
providing a measure of the status of the subject's PML, which can
be used to determine the effectiveness of any treatment for PML
and/or JCV infection in a subject.
[0225] As used herein, PML treatment encompasses both prophylactic
and therapeutic treatment, and it embraces both the prevention and
treatment of PML. A subject can receive PML treatment because the
subject has been determined to be at risk for PML or alternatively,
the subject may have PML. Thus, a treatment may reduce or eliminate
PML and/or JCV infection altogether or prevent it from becoming
worse. "Evaluation of treatment" as used herein, means the
comparison of a subject's levels of variants indicative for
exposure to a JCV variant or the viral load of the JCV variant in
samples obtained from the subject at different sample times, for
example, at least one day apart. In some embodiments, the time to
obtain the second sample from the subject is at least 5, 10, 20,
30, 40, 50, minutes after obtaining the first sample from the
subject. In certain embodiments, the time to obtain the second
sample from the subject is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 36, 48, 72,
96, 120 or more hours after obtaining the first sample from the
subject. In some embodiments, the time to obtain the second sample
from the subject is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 28, 35, 42, 49, 56, 60, 90,
120, 150, 180, 360 or more days after obtaining the first sample
from the subject.
Treatment of PML
[0226] In one embodiment, a therapeutic agent for the treatment of
PML is an anti-infective agent. A therapeutic agent may be an
anti-infective agent that treats a microbial infection, e.g., a
therapeutic agent that is effective to treat an infection of the
CNS. In some embodiments, an anti-infective agent may be an siRNA.
However, other suitable anti-infective agents may be used.
Anti-infective agents may be antimicrobial agents such as antiviral
agents. Antiviral agents may be combined with additional
anti-infective agents such as antifungal agents or antibacterial
agents. Therapeutic agents of the invention may be naturally
occurring or synthetic molecules or compounds. A therapeutic agent
useful in methods and compositions of the invention may be a
polypeptide, chemical, small molecule, lipid, nucleic acid, or
other compound.
[0227] Examples of nucleic acids that can be used as therapeutic
agents (e.g., anti-infective agents) in methods and compositions of
the invention are small interfering RNA molecules (siRNA),
antisense DNA, antisense RNA, or aptamers that can be used to
prevent and/or treat a CNS disease or disorder, including PML. A
"small interfering RNA" or "siRNA," as used herein, refers to a RNA
molecule that can be derived from the successive cleavage of a
double-stranded RNA (dsRNA) within a cell to produce an RNA
molecule. An effective siRNA generally has a length of between 15
and 30 nucleotides, and more often between 20 and 25 nucleotides.
siRNAs function to direct the destruction of corresponding mRNA
targets during RNA interference in animals. Methods of the
invention, in part, include the administration of siRNA molecules
to treat a CNS disease or disorder (e.g., a CNS infection)
associated with a variant JC virus. In some aspects, methods of the
invention may include administering to a subject a therapeutic
composition that includes an siRNA and/or a precursor siRNA as a
treatment of a CNS disease or condition. A precursor siRNA molecule
is a double-stranded RNA molecule that after administration can be
reduced in size, for example by the enzyme Dicer, to form the
intended siRNA, this becoming functional for RNAi treatment of a
CNS disease or condition. Thus, methods of the invention may
include administration of an siRNA or a precursor siRNA molecule to
treat a CNS disease or condition.
Selecting Treatment
[0228] In some embodiments, methods of the invention may be used to
help select a treatment for a subject with PML or at risk for PML.
Selection of a treatment for PML may be based upon the
determination of the variants indicative of exposure to a JCV
variant. Selection of treatment may also be based on the amount of
JCV variant in a sample (viral load) or on the ratio of variant JCV
to wildtype JCV. Methods of selecting a treatment may be useful to
assess and/or adjust treatment of subjects already receiving a drug
or therapy for PML. Based on the variants found that are indicative
of exposure to a JCV variant, it may be appropriate to alter a
therapeutic regimen for a subject. For example, detection of a
change in one or more of the positions indicative of exposure to a
JCV variant in a subject who has received or is receiving PML or
JCV treatment may indicate that the treatment regimen should be
adjusted (e.g., the dose or frequency of dosing, increased, new
treatment initiated, etc.). In some embodiments, the change in
viral load of a JCV variant or ratio of variant JCV to wildtype JCV
may indicate that the treatment regimen should be adjusted. In some
embodiments, a subject may be free of any present treatment for PML
and/or JCV infection and monitoring of variants at positions
indicative of exposure to JCV variant and/or viral load of the JCV
variant and/or the ratio of JCV variant to JCV wildtype may
identify the subject as a candidate for a treatment for PML and or
JCV infection. Thus, subjects may be selected and treated with
elevated levels of the same drugs or with different therapies as a
result of assays for indicia of exposure to a JCV variant and/or a
viral load of the JCV variant and/or a ratio of JCV variant to JCV
wild type.
[0229] According to the present invention, some subjects may be
free of symptoms otherwise calling for treatment with a particular
therapy, and the detection of indicia of exposure to a JCV variant
and/or a viral load of a JCV variant and/or a ratio of JCV variant
to JCV wild type may identify the subject as needing treatment.
This means that absent the use of the methods of the invention to
identify indicia of exposure to a JCV variant and/or a viral load
of a JCV variant and/or a ratio of JCV variant to JCV wild type,
the subject would not according to convention as of the date of the
filing of the present application have symptoms calling for
treatment with a particular PML and/or JCV infection therapy.
[0230] In one aspect, the invention provides methods for the
decision on treatment regimens for PML. A clinician can make
decisions on treatment options at least in part based on the
diagnostic assays of the invention.
Treatment Relating to Immunosuppressants
[0231] Methods of selecting treatment may be useful for persons
undergoing treatment not directed to PML or JCV infection, but
directed to a different condition. In one embodiment, the treatment
is a treatment comprising immunosuppressants. In some embodiments,
a person suspected of being at risk for developing PML is a person
undergoing treatment with immunosuppressants.
[0232] In some embodiments, detection of a change in one or more
indicia of exposure to a JCV variant in a subject who has received
or is receiving treatment not directed to PML, may indicate that
the treatment regimen should be adjusted. In some embodiments,
detection of a change in one or more indicia of exposure to a JCV
variant in a subject who has received or is receiving treatment
with immunosuppressants may indicate that the treatment regimen
should be adjusted. In some embodiments, detection of a change in
viral load of a JCV variant or ratio of JCV variant to wild type in
a subject who has received or is receiving treatment with
immunosuppressants may indicate that the treatment regimen should
be adjusted. In some embodiments, detection of a sequence change in
one or more predetermined VP1 positions of a JCV in a subject who
has received or is receiving treatment with immunosuppressants may
indicate that the treatment regimen should be terminated or
interrupted. In some embodiments, the immunosuppressant is
natalizumab. In some embodiments, detection of an increase in the
viral load of a JCV variant and/or the ratio of JCV variant to JCV
wild type in a subject who has received or is receiving treatment
with immunosuppressants may indicate that the treatment regimen
should be terminated or interrupted.
[0233] In one aspect, the invention provides methods for the
decision on treatment regimens. A clinician can make decisions on
treatment options at least in part based on the diagnostic assays
of the invention. In some embodiments the methods of the invention
provide a diagnostic assay to decide on a suitable treatment with
immunosuppressive agents. In some embodiments, a clinician may
decide to terminate or interrupt treatment with immunosuppressive
agents based on the outcome of one or more JCV-VP1 diagnostic
assays of the invention. In some embodiments, the methods of the
invention provide a diagnostic assay for the treatment of a
subject, wherein the subject is immuno-compromised. In some
embodiments, a clinician may decide to terminate or interrupt
treatment of the immuno-compromised subject based on the outcome of
a JCV-VP1 diagnostic assays of the invention
Immuno-Compromised Subjects or Subjects Undergoing Treatment with
Immuno-Suppressants
[0234] Assays of the invention may be particularly useful for
immuno-compromised subjects and/or subjects being treated with one
or more immuno-suppressants.
[0235] Subjects may receive treatment with one or more
immunosuppressive agents (also called immuno-suppressants) directed
to different diseases or conditions, including one or more of the
following non-limiting examples: cancer, organ or tissue
transplant, inflammatory conditions or diseases, multiple sclerosis
(MS), arthritis, etc., or any combination thereof.
[0236] Subjects may also be immuno-compromised. Non-limiting
examples of immuno-compromised subjects are subject that are HIV
positive or have AIDS or lymphoma or any other condition resulting
in a suppression of the immune response.
[0237] The term "immuno-suppressive agent" as used herein refers to
substances that act to suppress or mask the immune system of a
subject being treated herein. Immuno-suppressive agents may be
substances that suppress cytokine production, down-regulate or
suppress self-antigen expression, or mask the MHC antigens.
Examples of such agents include 2-amino-6-aryl-5-substituted
pyrimidines (see U.S. Pat. No. 4,665,077); nonsteroidal
anti-inflammatory drugs (NSAIDs); ganciclovir, tacrolimus,
glucocorticoids such as cortisol or aldosterone, anti-inflammatory
agents such as a cyclooxygenase inhibitor, a 5-lipoxygenase
inhibitor, or a leukotriene receptor antagonist; purine antagonists
such as azathioprine or mycophenolate mofetil (MMF); alkylating
agents such as cyclophosphamide; bromocryptine; danazol; dapsone;
glutaraldehyde (which masks the MHC antigens, as described in U.S.
Pat. No. 4,120,649); anti-idiotypic antibodies for MHC antigens and
MHC fragments; cyclosporin A; steroids such as corticosteroids or
glucocorticosteroids or glucocorticoid analogs, e.g., prednisone,
methylprednisolone, and dexamethasone; dihydrofolate reductase
inhibitors such as methotrexate (oral or subcutaneous);
hydroxycloroquine; sulfasalazine; leflunomide; cytokine or cytokine
receptor antagonists including anti-interferon-alpha, -beta, or
-gamma antibodies, anti-tumor necrosis factor-alpha antibodies
(infliximab or adalimumab), anti-TNF-alpha immunoahesin
(etanercept), anti-tumor necrosis factor-beta antibodies,
anti-interleukin-2 antibodies and anti-IL-2 receptor antibodies;
anti-LFA-1 antibodies, including anti-CD11a and anti-CD18
antibodies; anti-CD20 antibodies (e.g., rituximab, for example
available under the trademark RITUXAN); anti-L3T4 antibodies;
anti-VLA-4 antibodies (e.g., natalizumab, for example available
under the trademark TYSABR1); heterologous anti-lymphocyte
globulin; pan-T antibodies, for example anti-CD3 or anti-CD4/CD4a
antibodies; soluble peptide containing a LFA-3 binding domain (WO
90/08187 published Jul. 26, 1990); streptokinase; TGF-beta;
streptodornase; RNA or DNA from the host; FK506; RS-61443;
deoxyspergualin; rapamycin; T-cell receptor (Cohen et al., U.S.
Pat. No. 5,114,721); T-cell receptor fragments (Offner et al.,
Science, 251: 430432 (1991); WO 90/11294; Ianeway, Nature, 341: 482
(1989); and WO 91/01133); and T cell receptor antibodies (EP
340,109) such as T10B9. However, subjects receiving other
immunosupressive agents may selected for diagnostic assays and/or
treated as the invention is not limited in this respect.
Screening for Candidate Therapeutic Agents
[0238] The invention also embraces methods for screening for
candidate therapeutic agents or strategies to prevent and/or treat
PML and/or JCV infection. Assessment of the efficacy of candidate
therapeutic agents and strategies may be done using assays of the
invention in subjects (e.g., non-human animals) and in cells from
culture. In some embodiments, a candidate therapeutic agent may be
a compound or molecule that can interact with a polypeptide
comprising one or more JCV-VP1 variants associated with PML. In
some embodiments, a candidate therapeutic agent may be a compound
or molecule that can change the pattern and number of JCV-VP1
variants in a subject having a JCV infection. In some embodiments,
a candidate therapeutic is an agent that can reduce the amount of
JCV variant (viral load) in a sample or subject. In some
embodiments, a candidate therapeutic is an agent that can reduce
the ratio of variant JCV to wild type JCV. In some embodiments, a
candidate therapeutic is an agent (e.g., a small molecule) that
mimics the JCV receptor and can compete for JCV binding. In some
embodiments, administration to the subject of an agent, or exposing
a sample to the candidate agent or candidate treatment, will result
in a change in the pattern of JCV-VP1 variants associated with a
JCV infection in a subject. In some embodiments, administering to
the subject of an agent, or exposing a sample to the candidate
agent or candidate treatment, will result in a change in the number
of PML associated JCV-VP1 variants in a JCV infection. In some
embodiments, administering to the subject of an agent, or exposing
a sample to the candidate agent or candidate treatment, will result
in a decrease of JCV variant viral load and/or ratio of JCV variant
to JCV wild type.
[0239] In one embodiment, a sample comprising cells expressing a
JCV variant is exposed to a candidate therapeutic agent or
treatment. A sample comprising cells exposed to the candidate, that
do not express the JCV variant will function as a control. The
level of expression of the JCV variant (viral load) is monitored
upon administration of the candidate therapeutic or treatment, and
the change in expression of the JCV variant is compared to samples
that did not get treated with the candidate therapeutic agent. If
the level of viral load of the JCV variant of the invention in the
sample that has been exposed to the agent has changed compared with
the control sample, the agent is a candidate therapeutic or
candidate treatment. In some embodiments JCV variants are expressed
and secreted from cells and subjected to contacting with a
candidate agent. Any candidate agent that can bind the JCV variant
is a candidate therapeutic agent. In some embodiments, the
candidate therapeutic agent binds to a VP1 polypeptide of the JCV
variant.
[0240] In some embodiments, the invention provides methods for
identifying candidate therapeutic agents that suppress the number
or level of PML-associated VP1 variants in a JCV infection, and
that suppress the risk for PML. In some embodiments, the candidate
therapeutic agents are directed to a disease or condition that is
not PML or JCV infection. In some embodiments, the candidate
therapeutic agents are immunosuppressants. In some embodiments, the
candidate therapeutic agents are agents that are being prescribed
in immunosuppressant therapy.
[0241] Methods of screening for agents or treatments that modulate
levels of expression of JCV variants are encompassed by the
invention. Screening methods may include mixing the candidate agent
with cells or tissues or in a subject or exposing cells or tissues
or a subject to the candidate treatment and using methods of
assaying viral load of the JCV variants to determine the level of
expression before and after contact with the candidate agent or
treatment. A decrease in the amount of expression of the JCV
variant compared to a control is indicative that the candidate
agent or treatment is capable of treating PML and/or JCV infection
in a cell, tissue, and/or subject.
[0242] In some embodiments, an assay mixture for testing a
candidate agent comprises a candidate agent. A candidate agent may
be an antibody, a small organic compound, or a polypeptide, and
accordingly can be selected from combinatorial antibody libraries,
combinatorial protein libraries, or small organic molecule
libraries. Typically, pluralities of reaction mixtures are run in
parallel with different agent concentrations to obtain a different
response to the various concentrations. Typically, one of these
concentrations serves as a negative control, e.g., at zero
concentration of agent or at a concentration of agent below the
limits of assay detection.
[0243] Any molecule or compound can be a candidate therapeutic.
Non-limiting examples of candidate therapeutics are small
molecules, RNA including siRNAs, DNA including aptamers, and
proteins including antibodies and antibody fragments. The invention
also embraces candidate therapeutic with different modes of
action.
[0244] Candidate agents encompass numerous chemical classes,
although typically they are organic compounds, proteins or
antibodies (and fragments thereof that bind antigen). In some
embodiments, the candidate agents are small organic compounds,
e.g., those having a molecular weight of more than 50 yet less than
about 2500, for example less than about 1000 and, in certain
embodiments, less than about 500. Candidate agents comprise
functional chemical groups necessary for structural interactions
with polypeptides and/or nucleic acids, and may include at least an
amine, carbonyl, hydroxyl, or carboxyl group, optionally at least
two of the functional chemical groups or at least three of the
functional chemical groups. The candidate agents can comprise
cyclic carbon or heterocyclic structure and/or aromatic or
polyaromatic structures substituted with one or more of the
above-identified functional groups. Candidate agents also can be
biomolecules such as nucleic acids, polypeptides, saccharides,
fatty acids, sterols, isoprenoids, purines, pyrimidines,
derivatives or structural analogs of the above, or combinations
thereof and the like.
[0245] Candidate agents are obtained from a wide variety of sources
including libraries of synthetic or natural compounds. For example,
numerous means are available for random and directed synthesis of a
wide variety of organic compounds and biomolecules, including
expression of randomized oligonucleotides, synthetic organic
combinatorial libraries, phage display libraries of random or
non-random polypeptides, combinatorial libraries of proteins or
antibodies, and the like. Alternatively, libraries of natural
compounds in the form of bacterial, fungal, plant, and animal
extracts are available or readily produced. Additionally, natural
and synthetically produced libraries and compounds can be readily
be modified through conventional chemical, physical, and
biochemical means. Further, known agents may be subjected to
directed or random chemical modifications such as acylation,
alkylation, esterification, amidification, etc., to produce
structural analogs of the agents.
[0246] A variety of other reagents also can be included in the
mixture. These include reagents such as salts, buffers, neutral
proteins (e.g., albumin), detergents, etc., which may be used to
facilitate optimal protein-protein and/or protein-agent binding.
Such a reagent may also reduce non-specific or background
interactions of the reaction components. Other reagents that
improve the efficiency of the assay such as protease inhibitors,
nuclease inhibitors, antimicrobial agents, and the like may also be
used.
Kits
[0247] In some aspects of the invention, kits are provided. Kits of
the invention may contain nucleic acid, polypeptides, antibodies or
other molecules of the invention for use in vitro diagnosis,
prognosis, monitoring of PML and/or JCV infection, exposure to JCV
variants and/or testing of candidate therapeutic agents. Components
of the kits can be packaged either in aqueous medium or in
lyophilized form. Reagents for use in PCR and ELISA assays may also
be included in kits of the invention as can detectable labeling
agents in the form of intermediates or as separate moieties to be
conjugated as part of procedures to assay risk for PML, JCV
infection or exposure to a JCV variant. In some embodiments of a
kit of the invention, the kit may include instructions for
determining the presence of the variants of the invention and/or
for determining the viral load of a JCV variant. The kit may also
include control values (e.g., reference numbers) that can be used
for interpreting results of methods used in the invention.
[0248] A kit of the invention may include nucleic acid, antibodies
or polypeptides that can be used to identify one or more indicia of
exposure to JCV variants having one or more PML-associated VP1
variants. In some embodiments, kits include materials for use in
standard techniques of ELISA to identify antibodies that can bind
one or more polypeptides comprising one or more variants indicative
of exposure to a JCV variant. In some embodiments, a kit of the
invention may include nucleic acid components for binding to and
detecting nucleic acids encoding one or more variants or variant
combinations described herein as associated with PML. In some
embodiments, a kit may include one or more different antibodies
that specifically bind to one or more polypeptides comprising one
or more variants or combinations of variants of the invention. A
kit also may include components for use with the antibodies to
determine expression of JCV variants or exposure to JCV variants in
a cell, tissue or subject.
[0249] A kit may comprise a carrier being compartmentalized to
receive in close confinement therein one or more container means or
series of container means such as test tubes, vials, flasks,
bottles, syringes, or the like. The kit may also contain a control
sample. In some embodiments, the kit comprises instructions for
interpreting test results such as instructions for determining
whether a test indicates whether the level of a detected agent in
the assay correlates with exposure to a JCV infection (e.g., by a
wild-type or variant JCV).
Biological Samples
[0250] Methods for assaying for exposure to a JCV variant may be
carried out on any suitable biological sample. In some embodiments,
a sample may obtained from a subject and directly processed and
assayed for indicia of JCV as described herein. In some
embodiments, cells may be isolated from a biological sample and
grown in culture prior to analysis. As used herein, a subject may
be a human or a non-human animal, including, but not limited to a
non-human primate, cow, horse, pig, sheep, goat, dog, cat, or
rodent. Methods of the invention may be used to assay for exposure
to a variant of JCV in subjects not yet diagnosed with PML. Methods
of the invention may be used to assay for exposure to a JCV variant
in subjects not yet diagnosed as being infected with JCV. In
addition, methods of the invention may be applied to subjects who
have been diagnosed with PML and/or infection by a JCV variant. A
sample may comprise one or more cells. A sample may originate
directly from a subject or from a cell culture. A sample may be
processed (e.g., to prepare a cell lysate) or partially processed
prior to use in methods of the invention. In some embodiments, a
sample from a subject or culture may be processed to obtain nucleic
acids or polypeptides for use in assays to detect exposure to a
variant of JC virus as described herein. Thus, an initial step in
an assay may include isolation of a genomic nucleic acid sample
and/or other nucleic acids and/or polypeptides from a cell, tissue,
and/or other sample. Extraction of nucleic acids and/or
polypeptides may be by any suitable means, including routine
methods used by those of ordinary skill in the art such as methods
that include the use of detergent lysates, sonification, and/or
vortexing with glass beads, etc.
[0251] As used herein, the term "sample" means any animal material
containing DNA or RNA or protein, such as, for example, tissue or
fluid isolated from an individual (including without limitation
plasma, serum, cerebrospinal fluid, urine, lymph, tears, saliva and
tissue sections) or from in vitro cell culture constituents. A
sample containing nucleic acids may contain of deoxyribonucleic
acids (DNA), ribonucleic acids (RNA), or copolymers of
deoxyribonucleic acids and ribonucleic acids or combinations
thereof. A sample containing polypeptides may contain peptides
and/or proteins. In some embodiments the sample contains
antibodies. A sample may have been subject to purification (e.g.,
extraction) and/or other treatment. The term "sample" may also
refer to a "biological sample."
[0252] As used herein, the term "biological sample" may refer to
tissue, cells or component parts (e.g., body fluids, including but
not limited to blood, mucus, lymphatic fluid, synovial fluid,
cerebrospinal fluid, saliva, amniotic fluid, amniotic cord blood,
urine, stool, vaginal fluid, and semen, etc.) of a subject. A
"biological sample" may also refer to a homogenate, lysate, or
extract prepared from tissues, cells or component parts, or a
fraction or portion thereof, including but not limited to, for
example, plasma, serum, spinal fluid, lymph fluid, urine, the
external sections of the skin, respiratory, intestinal, and
genitourinary tracts, tears, saliva, stool, milk, blood cells,
tumors, or organs, CNS biopsies, etc.
[0253] Sample sources may include tissues, including, but not
limited to lymph tissues; body fluids (e.g., blood, lymph fluid,
etc.), cultured cells; cell lines; histological slides; tissue
embedded in paraffin; etc. The term "tissue" as used herein refers
to both localized and disseminated cell populations including, but
not limited to: brain, heart, serum, breast, colon, bladder,
epidermis, skin, uterus, prostate, stomach, testis, ovary,
pancreas, pituitary gland, adrenal gland, thyroid gland, salivary
gland, mammary gland, kidney, liver, intestine, spleen, thymus,
bone marrow, trachea, and lung. Biological fluids include, but are
not limited to, blood, lymph fluid, cerebrospinal fluid, tears,
saliva, urine, and feces, etc. Invasive and non-invasive techniques
can be used to obtain such samples and are well documented in the
art. A control sample may include a bodily fluid, a cell, a tissue,
or a lysate thereof. In some embodiments, a control sample may be a
sample from a cell or subject that is free of PML and/or infection
by, or exposure to, a JCV variant. In some embodiments, a control
sample may be a sample that is from a cell or subject that has PML
and/or has been exposed to a JCV variant. In some embodiments a
control sample is a sample comprising wild-type JC virus.
Vaccines
[0254] The present invention further relates to a vaccine for
immunizing a mammal against PML or infection by a PML-associated
JCV variant. A vaccine may comprise at least one polypeptide
comprising one or more JCV variant sequences of the invention. In
some embodiments, a vaccine may include one or more variant JCV or
JCV peptides described herein as predicted to reduce sialic acid
binding. In some embodiments, a vaccine may include a plurality of
different peptides (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 10-15, 15-20,
20-50, or more) to provide a broad range of different epitopes. In
some embodiments, the polypeptide is a full length JCV-VP1 variant
polypeptide. In still another embodiment, the polypeptide is a full
length JCV-VP1 polypeptide selected from the group consisting of
the polypeptides described herein (e.g., in FIG. 3 or Table 1 or
2B, Table 17 and/or Table 18, and/or one or more other variants
described herein), or any fragment thereof (e.g., a 10, 20, 30, 40,
50, 60, 70, 80, 90, 100, 100-150, 150-200 amino acid long
polypeptide, or a longer, shorter, or intermediate length
polypeptide) having at least one variant amino acids (e.g., 1, 2,
3, 4, 5, 6, 7, 8, 9, 10, or more variant amino acids) at one or
more of the predetermined positions described herein. In some
embodiments, the polypeptide is a fragment of a JCV-VP1 protein
comprising one or more variant amino acids of the invention. In a
further aspect, the invention relates to a pharmaceutical
composition comprising at least one JCV variant polypeptide and a
suitable excipient, diluent or carrier. In some embodiments a
polypeptide in the vaccine is about 5, about 10, about 20, about
30, about 40, or about 50 amino acids in length, or comprises the
total length of the JCV-VP1 protein. These compositions are
suitable for preventing or treating PML and/or an infection by a
JCV variant associated with PML. A pharmaceutical composition may
be administered to a subject in an effective amount to stimulate
the production of protective antibody or protective T-cell
response. In some embodiments, the vaccine is a nucleic acid
vaccine comprising nucleic acids that encode one or more variant
JCV polypeptides of the invention.
[0255] The term "immunizing" refers to the ability of a substance
to cause a humoral and/or cellular response in a subject, whether
alone or when linked to a carrier, in the presence or absence of an
adjuvant, and also refers to an immune response that blocks the
infectivity, either partially or fully, of an infectious agent. A
PML "vaccine" is an immunogenic composition capable of eliciting
protection against PML, whether partial or complete. A vaccine may
also be useful for treating a subject having PML. Administration
regimes for vaccines are known to a person of ordinary skill in the
art. In some embodiments, ranges of amounts of polypeptide vaccines
for prophylaxis of PML are from 0.01 to 100 microgram/dose, for
example 0.1 to 50 microgram/dose. Several doses may be needed per
subject in order to achieve a sufficient immune response and
subsequent protection against PML or infection by a JCV variant
associated with PML.
[0256] Pharmaceutically acceptable carriers include any carrier
that does not itself induce the production of antibodies harmful to
the individual receiving the composition. Suitable carriers are
typically large, slowly metabolized macromolecules such as
proteins, polysaccharides, polylactic acids, polyglycolic acids,
polymeric amino acids, amino acid copolymers; and inactive virus
particles. Such carriers are well known to those of ordinary skill
in the art.
[0257] Adjuvants to enhance effectiveness of the polypeptide
vaccines of the invention include, but are not limited to: aluminum
hydroxide (alum), N-acetyl-muramyl-L-threonyl-D-isoglutamine
(thr-MDP) as found in U.S. Pat. No. 4,606,918,
N-acetyl-normuramyl-L-alanyl-D-isoglutamine (nor-MDP),
N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-dipalmitoyl-s-
-n-glycero-3-hydroxyphosphoryloxy)-ethylamine (MTP-PE) and RIBI,
which contains three components extracted from bacteria,
monophosphoryl lipid A, trehalose dimycolate, and cell wall
skeleton (MPL+TDM+CWS) in a 2% squalene/Tween 80 emulsion. Any of
the three components MPL, TDM or CWS may also be used alone or in
combinations of two. In some embodiments, one or more peptides of
the invention may be used for immunization using one or more
techniques described in Goldmann et al., 1999, Journal of Virology,
Vol. 73, No. 5, pp 4465-4469, the disclosure of which is
incorporated herein by reference.
[0258] In some embodiments, a vaccine can be administered to a
subject prior to or along with the initiation of an
immuno-suppressive therapy, or any other treatment that may affect
(e.g., weaken) the immune system.
Antibodies
[0259] In certain embodiments, antibodies or antigen-binding
fragments thereof to JCV variants are also encompassed by the
invention. Antibodies may be used in detection assays described
herein (e.g., ELISA assays). Antibodies may be used in therapy to
treat subjects with PML and/or to prevent or reduce infection by
JCV variants. Suitable antibodies or fragments thereof may be
selected for the ability to bind one or more JCV variant
polypeptides described herein. The antibody or antigen-binding
fragment thereof may be an IgG1, IgG2, IgG3, IgG4, IgM, IgA1, IgA2,
IgAsec, IgD, IgE or may have an immunoglobulin constant and/or
variable domain of an IgG1, IgG2, IgG3, IgG4, IgM, IgA1, IgA2,
IgAsec, IgD or IgE. In some embodiments, the antibody is a
bispecific or multispecific antibody. In further embodiments, the
antibody is a recombinant antibody, a polyclonal antibody, a
monoclonal antibody, a humanized antibody or a chimeric antibody,
or a mixture of these. In some embodiments, the antibody is a human
antibody, e.g., a human monoclonal antibody, polyclonal antibody or
a mixture of monoclonal and polyclonal antibodies. Antigen-binding
fragments may include a Fab fragment, a F(ab).sub.2 fragment,
and/or a Fv fragment CDR3.
[0260] Antibodies can be raised against a full length JCV-VP1
protein variant or against polypeptides variants comprising a
partial sequence of JCV-VP1 protein variant. Antibodies can be
generated by injecting an animal, for example a rabbit or goat or
mouse, with the antigen (e.g., a polypeptide of a JCV-VP1
variant).
[0261] In order to prepare polyclonal antibodies, fusion proteins
containing a JCV-VP1 variant can be synthesized in bacteria by
expression of corresponding DNA sequences in a suitable cloning
vehicle. The protein can then be purified, coupled to a carrier
protein and mixed with Freund's adjuvant (to help stimulate the
antigenic response by the rabbits) and injected into rabbits or
other laboratory animals. Alternatively, the polypeptides can be
isolated from cultured cells expressing the protein. Following
booster injections at bi-weekly intervals, the rabbits or other
laboratory animals are then bled and the sera isolated. The sera
can be used directly or purified prior to use, e.g., by methods
such as affinity chromatography, Protein A-Sepharose, Antigen
Sepharose, Anti-mouse-Ig-Sepharose. The sera can then be used to
probe protein extracts run on a polyacrylamide gel to identify the
JCV variant polypeptides. Alternatively, synthetic JCV variant
polypeptides can be made and used to inoculate animals.
[0262] To produce monoclonal JCV variant antibodies, mice are
injected multiple times (see above), the mice spleens are removed
and resuspended in a phosphate buffered saline (PBS). The spleen
cells serve as a source of lymphocytes, some of which produce
antibodies of the appropriate specificity. These are then fused
with a permanently growing myeloma partner cell, and the products
of the fusion are plated into a number of tissue culture wells in
the presence of a selective agent such as HAT. The wells are then
screened by ELISA to identify those containing cells expressing
useful antibody. These are then freshly plated. After a period of
growth, these wells are again screened to identify
antibody-producing cells. Several cloning procedures are carried
out until over 90% of the wells contain single clones which are
positive for antibody production. From this procedure a stable line
of clones is established to produce the antibody. A monoclonal
antibody can then be purified by affinity chromatography using
Protein A Sepharose, ion-exchange chromatography, as well as
variations and combinations of these techniques (See e.g., U.S.
Pat. No. 6,998,467).
[0263] In some embodiments, `humanized` antibodies are used in
therapy in humans. Humanization of antibodies involves replacing
native mouse sequences with human sequences to lower the chance of
an immune response once the therapeutic antibody is introduced into
humans.
CNS Infections
[0264] JC polyomavirus is a virus that infects the brain and CNS
(Central Nervous System). Subjects suffering from microbial
infections of the CNS may be susceptible to variant JC virus
infection and/or proliferation in the CNS. Microbial infections of
the CNS may include, but are not limited to, bacterial, fungal,
protozoan, virus-like, and viral infections. Infections include
both acute and chronic conditions. Exemplary microbial CNS
infections can result in a brain abscess, meningitis, encephalitis,
vasculitis, or progressive multifocal leukoencephalopathy (PML).
Most abscess-forming infections of the CNS are spread by the blood
and are related to septicemia and endocarditis, although there may
be direct infection that arises from sinus or middle ear/mastoid
infection. Bacterial infections of the CNS may include, but are not
limited to infection by Streptococcus pneumonia, Streptococcus
pyogenes, Staphylococcus aureu, Staphylococcus epidermidis,
Enterobacteriacea, Propionibacterium, Pseudomonoas aeruginosa,
Neisseria meningitis, Haemophilus influenzae or Listeria
moncytogenes. Fungal infections of the CNS are less common than
bacterial infections, but may arise in individuals with Acquired
Immune Deficiency Syndrome (AIDS) and in other immunocompromised
individuals, such as those undergoing chemotherapy or
immunosuppressive therapy. An example of a protozoan infection of
the CNS is late-stage neurological trypanosomiasis, or sleeping
sickness, which is caused by infection of the CNS by trypanosoma
protozoa.
[0265] Viral infections of the CNS may include, but are not limited
to aseptic meningitis, encephalitis, and progressive multifocal
leukoencephalopathy (PML). Acute neurological syndromes associated
with viral infection include, for example, acute viral
encephalitis, flaccid paralysis, aspectic meningitis, and post
infectious encephalomyelitis. Acute viral encephalitis may be
caused by for example, herpes simplex virus, cytomegalovirus,
varicella, rabies or an arbovirus. Common viral agents of asceptic
meningitis include, for example, enteroviruses, mumps virus and
lymphocytic choriomeningitis virus. Post infectious
encephalomyelitis is a complication of infection with measles,
mumps, rubella and primary varicella-zoster virus infection, for
example. Guillain-barre syndrome is also an acute neurological
syndrome associated with viral infection.
[0266] Additional chronic neurological diseases attributable to
viral infection include, subacute sclerosing pan encephalitis
(caused by persistent measles infection), spongiform
encephalopathies (prion diseases) (e.g., Creutzfeldt-Jakob disease
(CJD), Gerstmann-Streussler Syndrome), and retroviral diseases
(e.g., HIV-1 and HIV-2) characterized by paralysis, wasting, and
ataxia.
[0267] Accordingly, aspects of the invention may be used to
evaluate the risk of PML in subjects having one or more symptoms of
a microbial CNS infection.
Studies of JCV Variants
[0268] Both host and viral genetics may contribute to PML. Earlier
studies focusing on viral genetic factors identified duplications
and rearrangements in the regulatory region of the viral genome
[Pfister L A, Letvin N L, Koralnik I J (2001) JC virus regulatory
region tandem repeats in plasma and central nervous system isolates
correlate with poor clinical outcome in patients with progressive
multifocal leukoencephalopathy. J Virol 75: 5672-5676; Major E O,
Amemiya K, Tornatore C S, Houff S A, Berger J R (1992) Pathogenesis
and molecular biology of progressive multifocal
leukoencephalopathy, the JC virus-induced demyelinating disease of
the human brain. Clin Microbiol Rev 5: 49-73; Loeber G, Dorries K
(1988) DNA rearrangements in organ-specific variants of
polyomavirus JC strain GS. J Virol 62: 1730-1735; Martin J D, King
D M, Slauch J M, Frisque R J (1985) Differences in regulatory
sequences of naturally occurring JC virus variants. J Virol 53:
306-311; and Zheng H Y, Takasaka T, Noda K, Kanazawa A, Mori H, et
al. (2005) New sequence polymorphisms in the outer loops of the JC
polyomavirus major capsid protein (VP1) possibly associated with
progressive multifocal leukoencephalopathy. J Gen Virol 86:
2035-2045]. Several studies with very limited sample numbers from
PML and healthy individuals also reported conflicting results on
possible association of several mutations in VP1 protein with PML
[Zheng H Y, Takasaka T, Noda K, Kanazawa A, Mori H, et al. (2005)
New sequence polymorphisms in the outer loops of the JC
polyomavirus major capsid protein (VP1) possibly associated with
progressive multifocal leukoencephalopathy. J Gen Virol 86:
2035-2045; Zheng H Y, Ikegaya H, Takasaka T, Matsushima-Ohno T,
Sakurai M, et al. (2005) Characterization of the VP1 loop mutations
widespread among JC polyomavirus isolates associated with
progressive multifocal leukoencephalopathy. Biochem Biophys Res
Commun 333: 996-1002; Kato A, Sugimoto C, Zheng H Y, Kitamura T,
Yogo Y (2000) Lack of disease-specific amino acid changes in the
viral proteins of JC virus isolates from the brain with progressive
multifocal leukoencephalopathy. Arch Virol 145: 2173-2182]. No
comprehensive analysis of an association of changes in protein
coding genes of JCV with PML has been reported. Pathogenicity of
viruses ranging from influenza virus [Srinivasan A, Viswanathan K,
Raman R, Chandrasekaran A, Raguram S, et al. (2008) Quantitative
biochemical rationale for differences in transmissibility of 1918
pandemic influenza A viruses. Proc Natl Acad Sci USA 105:
2800-2805; and Chandrasekaran A, Srinivasan A, Raman R, Viswanathan
K, Raguram S, et al. (2008) Glycan topology determines human
adaptation of avian H5N1 virus hemagglutinin. Nat Biotechnol 26:
107-113] to the mouse polyomavirus [Bauer P H, Bronson R T, Fung S
C, Freund R, Stehle T, et al. (1995) Genetic and structural
analysis of a virulence determinant in polyomavirus VP1. J Virol
69: 7925-7931; and Bauer P H, Cui C, Liu W R, Stehle T, Harrison S
C, et al. (1999) Discrimination between sialic acid-containing
receptors and pseudoreceptors regulates polyomavirus spread in the
mouse. J Virol 73: 5826-5832], a close relative of human JCV, was
shown to be determined by amino acid sequences involved in the
binding of a viral capsid protein to sialylated glycan receptors.
Changes in the affinity and specificity of the virus for its
cellular receptor(s) affect viral infectivity and transmission,
hence playing a crucial role in virulence. For example, a study of
the mouse polyomavirus showed that VP1 amino acid changes rather
than changes in the non-coding regulatory region are responsible
for the increased pathogenicity of the virus.
[0269] Aspects of the invention are illustrated by experiments
relating to the VP1 protein and its relationship to PML. Methods of
molecular evolution were used to determine the presence of putative
adaptive changes in the VP1 amino acid sequence associated with
PML. The advantage of this approach over simple statistical
association of sequence variants with the disease, is that it takes
into account the phylogenetic relationship of viral strains and
also allows identification of functionally significant amino acid
positions by examining the rate of sequence evolution.
[0270] According to aspects of the invention, a virus harboring
substitutions is adequately infectious if it was sufficiently
abundant in the CNS of PML patients to be isolated. In some
embodiments, changes in glycan specificity are predicted to allow
JCV to lose its specificity to sialated glycans expressed outside
of the CNS (e.g., RBCs). Thus, such a virus would avoid getting
trapped on "pseudoreceptors" in the periphery and travel unhindered
from sites of viral shedding to enter the brain. Mutated virus must
still maintain its specificity to glycans expressed on
oligodendrocytes. This is consistent with the observation from the
mouse polyomavirus model where a mutation in a position orthologous
to position 269 of JCV affected viral ability to bind RBCs and also
lead to the dramatic increase in viral dissemination through the
animal with a lethal outcome [Dubensky T W, Freund R, Dawe C J,
Benjamin T L (1991) Polyomavirus replication in mice: influences of
VP1 type and route of inoculation. J Virol 65: 342-349; and Freund
R, Garcea R L, Sahli R, Benjamin T L (1991) A single-amino-acid
substitution in polyomavirus VP1 correlates with plaque size and
hemagglutination behavior. J Virol 65: 350-355]. Furthermore, there
are several reports of JCV detection in tonsils of many
asymptomatically infected individuals [Kato A, Kitamura T, Takasaka
T, Tominaga T, Ishikawa A, et al. (2004) Detection of the
archetypal regulatory region of JC virus from the tonsil tissue of
patients with tonsillitis and tonsilar hypertrophy. J Neurovirol
10: 244-249; and Monaco M C, Jensen P N, Hou J, Durham L C, Major E
O (1998) Detection of JC virus DNA in human tonsil tissue: evidence
for site of initial viral infection. J Virol 72: 9918-9923.].
Although this observation was taken as a support for the JCV
infection of tonsil cells, it also could be explained by the viral
trapping in lymphoid tissues. This is consistent with JCV binding
to sialic acid in the tonsil tissue [Eash S, Tavares R, Stopa E G,
Robbins S H, Brossay L, et al. (2004) Differential distribution of
the JC virus receptor-type sialic acid in normal human tissues. Am
J Pathol 164: 419-428].
[0271] According to the invention, given the large number of
mutations that are specific for PML, it is likely that more than a
single mechanism (e.g., two or more mechanisms) may play a role in
PML etiology in different PML cases. According to some aspects of
the invention, PML associated VP1 mutations may increase JCV
tropism for brain white matter cells leading to the increased viral
infectivity and replication in oligodendrocytes. According to other
aspects of the invention, mutations in PML may allow for
immune-escape by the virus. Out of the polyclonal immune response
directed against the VP1 molecule only a limited number of
antibodies directed against the cell receptor binding site (sialic
acid) may provide protection against the spread of the viral
infection. Mutation of an amino acid within an epitope crucial for
the protective immunity may allow virus to bind to its target cells
and spread uninhibited.
[0272] Experiments described herein address how certain mutations
occur in PML and why, despite a very high prevalence of JCV, only a
small proportion of immune deficient patients develop PML.
According to aspects of the invention, the absence of clustering of
the mutations on the viral phylogenetic tree suggests that they
arise independently in individual patients rather than persist in
the general populations as pathogenic viral variants. According to
aspects of the invention, and based on the experiments described
herein, VP1 mutations play a very significant role in the mechanism
of PML emergence. Once a specific mutation affecting sialic acid
binding occurs it allows virus to spread to the brain and infect
oligodendrocytes. The fact that the mutant virus was not detected
in the kidney suggests that that particular change in glycan
binding does not offer any selective advantage to the mutated virus
in kidney. The mutations might have occurred and hence allowed the
virus to establish the residence in the brain under the conditions
of immune suppression shortly or long before the PML. Since no
viral replication was detected in brains of asymptomatic
individuals it is unlikely that compartmentalized evolution (e.g.,
intra CNS) prior to PML development could account for the presence
of mutated VP1 in CNS of PML patients. However, the issue of JCV
latency in normal brain still remains controversial so it is still
formally possible that non-mutated virus had entered the brain and
mutations arose in the brain and not periphery, e.g., kidney.
[0273] According to aspects of the invention, the healthy immune
system effectively controls viral activation in the brain. However,
as soon as the immune system fails in certain individuals harboring
such a mutated virus, the virus begins actively proliferating in
oligodendrocytes causing PML. It is also possible that a healthy
immune system may efficiently suppresses newly developed mutants in
their peripheral site (e.g., kidney) and prevent them from
spreading and infecting new target cells. Thus the timing of PML
development may be mutation limited and the interplay with
environmental or host genetic factors may contribute to the
non-deterministic development of PML. In addition, PML development
may be controlled by interactions of VP1 mutations with additional
genetic alterations of the virus including rearrangement of the
viral regulatory region as it might give the virus additional
selective advantage in increasing viral replication in
oligodendrocytes.
[0274] According to aspects of the invention, and as illustrated by
the Examples described herein, JCV VP1 mutations affecting its
receptor specificity may be responsible for PML pathology. These
results provide opportunities for the discovery of novel
anti-polyomavirus therapeutics and diagnostics of diseases caused
by these viruses. The precise role that these mutations play in
etiology of PML as well as how and where they arise requires
further extensive investigation that would involve VP1 sequence
analysis of longitudinal and time matching samples from different
organs (e.g., urine, blood, CSF) and from a variety of PML
patients.
[0275] The study of VP1 sequences from sequential samples, as
described herein, showed the persistence of the same viral strains
through the course of disease. Since the mutated virus represented
the prevalent or sole population and it was maintained over time,
it appears to be both necessary and sufficient for propagation of
the infection. Notably, additional substitutions were acquired in
case of relapse in a patient who survived the first PML episode.
This observation suggests, first, that the old mutated virus
survives efficiently, either in the CNS or in the periphery, and,
second, that the emergence of a new substitution may trigger a new
PML episode. In some embodiments, a newly mutated virus may arise
in a context of virus activation under suboptimal immune control
and once it emerges, it may not be promptly recognized by the
immune system.
[0276] In some embodiments, aspects of the invention relate to the
identity of CSF and plasma VP1 sequences in PML patients. It
appears that both plasma-isolated and CSF-isolated virus are
equally distinct from urine-isolated virus, even if the mutation
was excluded from the analysis. This indicates that the CSF and
plasma populations did not arise independently from urine but
rather one of these populations originated from the same source as
the urine population and the other originated from the first one.
Although VP1 sequences carrying PMLgenic mutations were not
observed in the urine of PML patients it is possible that that a
mutation that was originally acquired during viral replication in
the kidney did not receive any competitive advantage over the
resident non-mutant virus to become a dominant or even a detectable
population in the kidney site. This is consistent with the
observation that VLPs prepared from most mutant VP1 molecules have
lost the ability to bind to the renal tubular epithelial cells, the
site of viral infection in the kidney.
[0277] According to aspects of the invention, without wishing to be
limited by theory, when a mutation causes a virus to lose it's
specificity for one or more widely occurring sialic acid containing
receptors, the mutant virus (in the blood circulation) is more
likely than a wild-type virus to escape being trapped by a
multitude of sialo-containing oligosacharide pseudoreceptors
expressed on a great majority of cells in the periphery.
Accordingly, the mutant virus may be more likely to reach the
brain, or at least blood brain barrier (BBB). Once the virus
manages to bypass peripheral obstacles and reaches the BBB it still
has to cross the endothelial cell layer to get to the CNS. In some
embodiments, the extremely rare occurrence of PML, even in patients
with significant immune suppression, may be due to the required
temporal constellation of independently rare events such as the
appearance of certain mutant virus particle and the presence of a
BBB opening.
[0278] The hypothesis that mutations in VP1 protein contribute to
PML progression by increasing viral chances of escaping peripheral
circulation to enter CNS is consistent with the observation that
.about.10% of all PML cases contained non-mutated virus. Thus even
non-mutant virus might also enter CNS given high level of viremia
which could overwhelm the peripheral defense of viral
pseudoreceptors and also given the temporally coincident opening in
BBB. However, once a virus enters the brain there might be no
difference between mutant and non-mutant virus in their ability to
infect oligodendrocytes and spread in CNS which would be consistent
with retained ability of mutant VLPs to bind CNS derived
astrocytes, another target of JCV during ongoing brain infection.
Alternatively, VP1 mutation might have arisen during viral
replication in CNS as became dominant in CSF because it provided
some competitive advantage for the virus to spread through the
brain. Since most of the samples analyzed had all or >95% of all
isolated clones containing mutations in order for the last
hypothesis to be true the mutations must have to occur very early
during viral replication in the brain. Since virus without
mutations in VP1 can infect CNS cells quite successfully mutations
would not provided competitive advantage via gain of viral tropism
to toward CNS cells although they might have improved it. Still,
the possibility that at least in some cases virus enters the brain
in non-mutated form and acquires the mutation during its activation
within the CNS under the condition of immune suppression in a
patient cannot formally be excluded.
[0279] Regardless of the site of selection, JCV VP1 substitutions
appear to be key for viral PML-genic potential. Viral capsid and
envelope proteins are critical to mediate viral attachment to viral
target cells and infectivity. Thus, mutations in influenza HA
protein allow the virus to change its subtle specificity for the
sialic acid binding and ability of the virus to switch from
zootropic to human infectivity. Similarly, some of these mutations
were shown to be associated with increased influenza virulence in
human population as underscored by the example of 1918 influenza by
changing specificity from the sialic acid preferentially expressed
on cells in the upper portion of lung lobes to those expressed in
lower portion of lung. Another mechanism by which a virus could
gain an increase in virulence is probably via losing its wide
receptor specificity which causes virus to be trapped on cells that
it does not infect productively. One of the best studied examples
of such a mechanism comes from the studies of another polyomavirus,
murine polyomavirus infection in mice. It was demonstrated in this
model that a mutation at position 296, which is structurally
orthologous to the critical PMLgenic position 269 of JCV,
dramatically changed viral specificity for the sialic acids and
affected viral ability to bind target cells and RBCs and also lead
to the dramatic increase in viral dissemination through the animal
resulting in a lethal outcome. Thus, it appears that a change in
viral coat protein that affects viral binding to its receptor is an
extremely common mechanism that plays a crucial role in altering
viral pathogenesis and virulence with human polyomaviruses being no
exception.
[0280] In some aspects, mutations at positions 55 and 269 to
phenylanine are detected in a sample from a subject. In other
aspects, at least these mutations are detected and indicate that
the subject appeared to be most common, suggesting that these 2
sites are under strong selective pressure and provide JC virus with
most advantage to cause PML. This observation strongly correlates
with the ability of mutations at these two sites to abrogate viral
binding to peripheral cells and sialic acid containing
oligosaccharides thus suggesting that that particular loss of
function is most advantageous for the virus to be positively
selected more frequently than other mutations. As described in more
detail elsewhere herein, each of these sites accounted for 25% of
all mutations in the current study, with positions 267, 265 and 60
being next highest in frequency, each with 7.5% of all cases.
Interestingly, CSF samples from several patients contained two or
more different viral populations each carrying its own PML-specific
mutation with no virus contained two such mutations simultaneously.
Accordingly, some aspects of this invention provide that several
different mutations may arise independently during normal viral
replication and all might get selected if each provides the virus
the competitive advantage over non-mutated virus. In three cases,
or .about.10% of all cases from this study, no PML-associated
substitutions could be found in CSF and/or plasma. Other genetic
changes of JCV genome, e.g., involving mutations in the minor viral
capsid proteins VP2 or VP3, might also be hypothesized in these
cases to explain the presence of these viruses in association with
PML.
[0281] The present invention is further illustrated by the
following Examples, which in no way should be construed as further
limiting. The entire contents of all of the references (including
literature references, issued patents, published patent
applications, and co-pending patent applications) cited throughout
this application are hereby expressly incorporated by
reference.
EXAMPLES
Example 1
Detection of JCV Variants by PCR
[0282] Nucleic acids are isolated from a biological sample using
established protocols (e.g., cell lysis). Because the viral DNA may
have integrated in the genomic DNA or may still be present as a
smaller entity, both genomic DNA and shorter DNA sequences are
isolated and subjected to PCR analysis. Upon isolation the nucleic
acids are resuspended in a buffer that will facilitate PCR
analysis. Buffers that facilitate PCR analysis are known to the
skilled artisan (e.g., Maniatis) and are also commercially
available from manufacturers of PCR enzymes (e.g., New England
Biolabs, Beverly, Mass.). Nucleotide primers are designed to result
in the amplification of the JCV-VP1 gene. PCR amplification is an
established laboratory technique and comprises the addition of
nucleotide primers, a polymerase and single nucleotides, and
polymerase buffer and subjection this mixture to cycles of
annealing, amplification and dissociation resulting in the
amplification of a desired DNA sequence. Upon amplification, the
JCV-VP1 gene is separated from the residual DNA and excess single
nucleotides. The amplified JCV-VP1 DNA is sequenced and the
resulting nucleotide sequence is translated into a peptide
sequence. This peptide sequence is subsequently compared to the
variant panels to determine which JCV-VP1 polypeptide variants are
present in the biological sample.
Example 2
Detection of JCV Variants Using ELISA
[0283] Proteins and peptides are isolated from a biological sample
using standard laboratory techniques (e.g., Maniatis). Both the
cellular proteins and proteins of non-cellular components are
subjected to the analysis. In one assay the sample is interrogated
for the presence of JCV-VP1 polypeptides comprising one or more
variants of the invention. The polypeptides are detected using
sandwich ELISA comprising antibodies specific for JCV-VP1
polypeptides of the invention. The antibodies are generated by
inoculating animals (e.g., rabbits) with the JCV-VP1 polypeptides
of the invention resulting in polyclonal antibodies. If so desired,
cells can be harvested from the inoculated animal to generate
monoclonal antibodies. Methods for the generation of both
polyclonal and monoclonal antibodies are routine in the art. The
antibodies against JCV-VP1 polypeptide variants are immobilized on
a solid surface (e.g., a 96-well plate), with one antibody type per
well or surface area. The biological samples comprising the
polypeptides are added to the wells and incubated with the
immobilized antibodies. Any polypeptide JCV-VP1 variants present in
the sample will bind to an antibody specific for the polypeptide.
After incubation, the sample is removed and the solid surfaces are
washed to remove any unbound material. As a next step, a solution
containing additional antibodies specific for JCV-VP1 peptides is
added to the wells. This second aliquot of antibodies will create
the "sandwich" (e.g., immobilized antibody: JCV-VP1 polypeptide:
second antibody). This second antibody can be detected using, for
instance, a labeled tertiary antibody, allowing for the detection
of JCV-VP1 variant polypeptides. Alternatively, the secondary
antibody itself may be labeled.
[0284] In a second ELISA assay, biological samples are assayed for
the presence of antibodies against one or more of the JCV-VP1
variant polypeptides. This assay can be use to determine whether a
subject is currently infected with, or has previously been exposed
to, a JCV-VP1 variant. Even if the JCV-VP1 variant is no longer
present, antibodies against the variant may still be present in the
biological sample and can be detected. In this ELISA assay JCV-VP1
polypeptides are attached to a solid surface and the biological
samples are incubated with these polypeptides. If antibodies
specific for these polypeptides are present in the biological
samples they will bind to the polypeptides. Any unbound material is
again removed. The presence of bound antibody is detected using a
labeled secondary antibody.
Example 3
Determining Solvent Accessible Surface Area Composition of VP1
Protein
[0285] Accessible surface area calculations require the knowledge
of the 3D coordinates of biomolecule. A homology model of JCV VP1
virus-like particle was constructed using structure of CoAl of SV40
virus-like particle as a template (PDB ID: 1SVA). MODELER (A. Sali
& T. L. Blundell. Comparative protein modelling by satisfaction
of spatial restraints. J Mol. Biol. 234, 779-815, 1993) algorithm
was used for model building and the SCWRL3 (A. A. Canutescu, A. A.
Shelenkov, and R. L. Dunbrack, Jr. A graph theory algorithm for
protein side-chain prediction. Protein Science 12, 2001-2014
(2003)) approach was used for side-chain position refinement. The
polar and non-polar solvent accessible surface areas of amino acid
sidechains were calculated using Lee and Richards's method (B. Lee
B & F. M. Richards. The Interpretation of Protein Structures:
Estimation of Static Accessibility. J. Mol. Biol 55, 379-400
(1971)). Subsequently, 3D models of virus-like particles of JCV VP1
variants were constructed, and polar and non-polar solvent
accessible surface areas of their side-chains were subsequently
calculated. Difference in polar surface area upon variant was
calculated by subtracting polar solvent accessible surface areas of
the consensus sequence from the polar solvent accessible surface
areas of the variant on per amino acid side chain basis. Difference
in non-polar surface area upon variant was calculated by
subtracting non-polar solvent accessible surface areas of the
consensus sequence from the non-polar solvent accessible surface
areas of the variant on per amino acid side chain basis. The
calculation results are presented in Table 3.
TABLE-US-00010 TABLE 3 Variant Gain in Non-Polar SA Gain in Polar
SA L55->F55 14.12 0 K60->M60 27.35 -13.22 K60->N60 -10.18
-3.54 K60->E60 -5.55 -2.1 S61->L61 49.72 -9.78 D66->H66
25.86 -7.95 D66->N66 15.35 -23.4 E69->D69 -6.01 -27.12
N74->S74 -0.12 -30.62 K75->R75 1.43 11.83 N265->D265 -4.55
8.23 N265->T265 11.51 -12.15 S267->F267 92.2 -33.04
S267->L267 85.2 -31.3 S269->F269 75.44 -15.91 S269->Y269
52.69 21 Q271->H271 6.96 6.11
Example 4
Sequence Analysis of JCV Sequences
[0286] PML is a progressive and mostly fatal demyelinating disease
caused by JC virus infection and destruction of infected
oligodendrocytes in multiple brain foci of susceptible individuals.
While JC virus is highly prevalent in the human population, PML is
a rare disease that exclusively afflicts only a small percentage of
immunocompromised individuals including those affected by HIV
(AIDS) or immunosuppressive drugs. Specific viral and/or host
specific factors and not simply immune status must be at play to
account for the very large discrepancy between viral prevalence and
low disease incidence. According to the invention, several amino
acids on the surface of the JC virus capsid protein VP1 display
accelerated evolution in viral sequences isolated from PML patients
but not in sequences isolated from healthy subjects. The examples
described herein provide strong evidence that at least some of
these mutations are involved in binding of sialic acid, a known
receptor for the JC virus. Statistical methods of molecular
evolution were used to perform a comprehensive analysis of JC virus
VP1 sequences isolated from 55 PML patients and 253 sequences
isolated from the urine of healthy individuals and found that a
subset of amino acids found exclusively among PML VP1 sequences is
acquired via adaptive evolution. Modeling of the 3D structure of
the JC virus capsid showed that these residues are located within
the sialic acid binding site, a JC virus receptor for cell
infection. The involvement of some of these sites in receptor
binding was demonstrated by showing a profound reduction in
hemagglutination properties of viral like particles made of the VP1
protein carrying these mutations. All together these results
indicate that a more virulent PML causing phenotype of JC virus is
acquired via adaptive evolution that changes viral specificity for
its cellular receptor(s).
Methods:
[0287] 35 full length VP1 sequences of JC viruses isolated from PML
patients and 253 full length VP1 sequences of JC viruses isolated
from healthy subjects were downloaded from Genbank. In addition, 20
partial VP1 sequences were available from Genbank enabling the
analysis of the total of 55 sequences for positions 43-287. In
addition to these 55 VP1 sequences isolated from PML patients Table
4 also contains information from twelve more partial sequences
available from a publication by Sala et al. [Sala M, Vartanian J P,
Kousignian P, Delfraissy J F, Taoufik Y, et al. (2001) Progressive
multifocal leukoencephalopathy in human immunodeficiency virus type
1-infected patients: absence of correlation between JC virus
neurovirulence and polymorphisms in the transcriptional control
region and the major capsid protein loci. J Gen Virol 82:
899-907.]. It should be noted in these examples that all viral
samples isolated from PML patients originated from brain or CSF
tissues except one sample isolated from kidney (Table 4). All viral
samples isolated from healthy subjects originated from urine.
Multiple sequence alignments were constructed using TCoffee
[Notredame C, Higgins D G, Hering a J (2000) T-Coffee: A novel
method for fast and accurate multiple sequence alignment. J Mol
Biol 302: 205-217]. A number of PML sequences were isolated from
the same individual. In studying the evolution of viral sequences,
same patient isolated sequences were accepted for the analysis as
long as they differed from each other by .gtoreq.1 nucleotide.
However, identical "clonal" sequences were excluded from the
analysis. This resulted in the final set of 28 full-length VP1
sequences and 42 partial VP1 sequences isolated from PML patients.
All information on the origin and clonality of sequences is
contained in Table 4. Phylogenetic trees were built using the
PhyMLmaximum likelihood method [Guindon S, Gascuel O (2003) A
simple, fast, and accurate algorithm to estimate large phylogenies
by maximum likelihood. Syst Biol 52: 696-704] with F84 substitution
model [Kishino H, Hasegawa M (1989) Evaluation of the maximum
likelihood estimate of the evolutionary tree topologies from DNA
sequence data, and the branching order in hominoidea. J Mol Evol
29: 170-179 and Felsenstein J, Churchill G A (1996) A Hidden Markov
Model approach to variation among sites in rate of evolution. Mol
Biol Evol 13: 93-104.] and using several methods included in the
PHYLIP package (Felsenstein, J. 2005. PHYLIP version 3.6.
Distributed by the author. Department of Genome Sciences,
University of Washington, Seattle). VP1 sequences isolated from PML
patients and random subsets of sequences isolated from healthy
subjects were further analyzed using PAML [Yang Z (1997) PAML: a
program package for phylogenetic analysis by maximum likelihood.
Comput Appl Biosci 13: 555-556]. Multiple models of sequence
evolution (M0-M8) were studied. A likelihood ratio test was used to
evaluate the difference between models M1 and M2 to test for
positive selection. Residues with Bayes Empirical Bayes posterior
probabilities exceeding 0.5 in the analysis of either full-length
or partial set are reported in Table 5. Spidermonkey [Poon A F,
Lewis F I, Frost S D, Kosakovsky Pond S L (2008) Spidermonkey:
rapid detection of co-evolving sites using Bayesian graphical
models. Bioinformatics 24: 1949-1950] was used to analyze epistatic
interaction. Spidermonkey was run through the Datamonkey web server
[Pond S L, Frost S D (2005) Datamonkey: rapid detection of
selective pressure on individual sites of codon alignments.
Bioinformatics 21: 2531-2533].
TABLE-US-00011 TABLE 4 JCV VPl sequences from non-PML patients:
BAC66394, BAC66418, BAC66382, BAB11716, BAB11722, AAK28466,
AAK28460, AAK28478, BAC66400, BAC66388, BAD06126, BAC66406,
AAK97970, AAK97964, BAC81952, BAC81958, AAM89309, AAM89303,
BAC81922, BAC81916, BAC81910, BAC81904, AAM89297, BAD11896,
BAC81946, BAE45426, BAE45360, BAD06120, BAE45432, BAA01962,
BAE45420, BAE45414, BAE45384, BAE45378, BAE45372, AAK98036,
BAE45402, BAE45408, BAE45396, BAE45444, BAD06024, BAE75838,
BAE75832, BAE75826, BAE75820, BAE75814, AAK98030, AAK98024,
AAK98018, AAK98010, AAK98006, AAK98000, BAE45438, BAE45390,
BAD06108, BAD06102, BAD06096, BAD06090, BAD06084, BAD06048,
BAD06030, BAD06018, BAD06054, BAD06042, BAD06036, AAG30857,
BAE45366, AAN85455, BAD06150, AAN85449, AAK98042, BAD06174,
BAD06156, BAD06072, BAD06060, AAN85473, BAC81840, BAF40841,
BAF40835, BAF40829, BAF40823, BAF40811, BAF40847, BAF40781,
BAF40817, BAF40799, BAF40793, BAF40787, BAF40745, AAN85467,
AAN85461, BAC81834, BAF40751, BAF40805, BAA01961, BAD98972,
BAD98966, BAD06227, BAC66430, BAC66412, BAD91887, BAD21235,
BAD27118, BAC66424, BAA01958, BAB11710, BAD21265, BAD21259,
BAD21253, BAD21241, BAD21229, BAD21247, BAD21283, BAD21271,
BAD21295, BAD21289, BAA01959, BAA01960, BAD11848, BAD11842,
AAM89339, AAM89327, BAD11836, BAC81852, BAC81858, BAD06144,
AAG37198, AAM89315, BAD06138, BAD11890, BAD11884, BAD11878,
BAD11872, BAD11866, AAK97994, BAB11698, BAC81940, BAC81964,
AAK97946, BAD06066, BAF40769, BAC81870, BAC81864, BAC81934,
BAC66376, BAC81874, BAC81846, AAK97940, BAC81898, BAC81892,
AAK97922, AAK97916, AAK97910, AAK97982, BAF40763, BAD06078,
AAK97958, BAD11860, BAF40757, BAD06162, AAM89321, BAD11854,
AAK97928, BAD11830, BAF40775, BAB11704, BAC81928, AAK97988,
BAD11902, BAD11824, BAD06233, BAC81886, BAC81880, AAM89345,
BAD06168, AAM89333, BAD06132, BAC82365, AAK97952, BAA01964,
BAA01963, AAK97934, BAD06114, AAK97976, BAD21277, AAR13077,
BAE02908, AAR12957, AAR02463, AAR02457, BAE03058, AAR89235,
BAE02896, AAR89241, BAE02890, BAE03064, BAE03070, BAE03082,
AAG34673, AAG34667, AAR89205, AAR89217, AAR13659, BAE03088,
BAE03160, AAQ88264, AAR89187, AAR89283, AAK28472, AAR06661,
AAR89253, AAR89247, AAR89199, AAR89193, AAR89229, AAR89223,
AAR89265, AAR32743, AAR89277, BAE03166, BAE02920, BAE02914,
BAE03112, BAE03106, BAE03100, BAE03094, BAE03076, BAE02944,
BAE02998, BAE02992, BAE02986, BAE02980, BAE02974, BAE02968,
BAE02962, BAE03016, BAE02902, BAE03040, AAR89211, AAR89271,
BAE02956, BAE02938, BAE02932, BAE03148, BAE02950, BAE03004,
BAE03154, BAE03142, BAE03136, BAE03130, BAE03124, BAE03118,
BAE02926. DNA Protein DNA Isolate AA Start Patient N accession#
accession # Source name length, AA # 1 AF015537 AAB94036 brain 601
354 1 1 2 AB183539 BAE00111 brain 1-1 354 1 2 3 AB183540 BAE00117
brain 1-2 354 1 2 4 AB183541 BAE00123 brain 1-3 354 1 2 5 AB183542
BAE00129 brain 2-1 354 1 3 6 AB183543 BAE00135 brain 2-2 354 1 3 7
AB183544 BAE00141 brain 2-3 354 1 3 8 AB190449 BAE00147 brain 3-1
354 1 4 9 AB190453 BAE00171 brain 3-5 354 1 4 10 AB190452 BAE00165
brain 3-4 354 1 4 11 AB190451 BAE00159 brain 3-3 354 1 4 12
AB190450 BAE00153 brain 3-2 354 1 4 13 AY536239 AAT09819 CSF
SA21_01 354 1 5 14 AB212952 BAE94726 brain ac-1 354 1 6 15 AB212953
BAE94732 brain ac-2 354 1 7 16 D26589 BAA05636 brain Aic-1a 354 1 8
17 AF004349 AAB62680 kidney GS/K 354 1 9 18 AF004350 AAB62687 brain
GS/B 354 1 9 19 D11365 BAA01967 brain Her1-Br 354 1 10 20 AB214923
BAE02848 CSF JVL-10 245 39 11 21 AB214924 BAE02849 CSF JVL-11 245
39 12 22 AB214925 BAE02850 CSF JVL-12 245 39 13 23 AB214926
BAE02851 CSF JVL-13 245 39 14 24 AB214927 BAE02852 CSF JVL-16 245
39 15 25 AB214928 BAE02853 CSF JVL-17 245 39 16 26 AB214929
BAE02854 CSF JVL-18 245 39 17 27 AB214930 BAE02855 CSF JVL-19 245
39 18 28 AB214912 BAE02837 brain JVL-1a 245 39 19 29 AB214913
BAE02838 brain JVL-1b 245 39 19 30 AB214914 BAE02839 brain JVL-1c
245 39 19 31 AB214915 BAE02840 brain JVL-1d 245 39 19 32 AB214916
BAE02841 brain JVL-2 245 39 20 33 AB214931 BAE02856 CSF JVL-20 245
39 21 34 AB214917 BAE02842 brain JVL-3 245 39 22 35 BAE02843
BAE02843 brain JVL-4 245 39 23 36 AB214919 BAE02844 brain JVL-5 245
39 24 37 AB214920 BAE02845 brain JVL-7 245 39 25 38 AB214921
BAE02846 brain JVL-8 245 39 26 39 AB214922 BAE02847 brain JVL-9 245
39 27 40 J02226 AAA82101 brain Mad-1 354 1 28 41 D11364 BAA01966
brain Mad11-Br 354 1 29 42 D11363 BAA01965 brain Mad8-Br 354 1 30
43 D11366 BAA01968 brain NY-1B 354 1 31 44 AB212954 BAE94738 brain
oh-1 354 1 32 45 AY536243 AAT09843 CSF SA27_03 354 1 33 46 AY536242
AAT09837 CSF SA28_03 354 1 34 47 AY536241 AAT09831 CSF SA296_0 354
1 35 48 AY536240 AAT09825 CSF SA84_00 354 1 36 49 D11367 BAA01969
brain Sap-1 354 1 37 50 D26590 BAA05637 brain Tky-1 354 1 38 51
AB038254 BAB11728 brain Tky-1 354 1 39 52 AB038255 BAB11734 brain
Tky-2a 354 1 40 53 D26591 BAA05638 brain Tky-2a 354 1 41 54 D11368
BAA01970 brain Tokyo-1 354 1 42 55 AF030085 AAC40846 brain Tokyo-1?
354 1 43 56 U21840 AAB60586 brain 133 219 44 57 U21839 AAB60584
brain 133 219 45 58 NA NA CSF P9VP1 136 11 46 59 NA NA CSF P8VP1
136 11 47 60 NA NA CSF P7VP1 136 11 48 61 NA NA CSF P5VP1 136 11 49
62 NA NA CSF P4VP1 136 11 50 63 NA NA CSF P2VP1 136 11 51 64 NA NA
CSF P1VP1 136 11 52 65 NA NA CSF P12VP1 136 11 53 66 NA NA CSF
P11VP174 136 11 54 67 NA NA CSF P11VP173 136 11 54 68 NA NA CSF
P11VP172 136 11 54 69 NA NA CSF P10VP1 136 11 55
Results:
[0288] JCV VP1 gene sequences were downloaded from GenBank (Table
4) and used to construct a phylogenetic tree for a random subset of
sequences isolated from healthy individual and full-length
sequences isolated from distinct PML patients (FIG. 4a). FIG. 4 is
a phylogenetic distribution of PML associated viruses. (A) Broad
phylogenetic distribution of PML causing JC viruses. Tree branches
(labeled by G1 numbers) corresponding to PML causing viruses and
viruses isolated from healthy subjects are indicated. The tree is
constructed based on DNA sequences of VP1 gene using maximum
likelihood method. Only one sequence per patient was included. (B)
Phylogenetic distribution of mutations in the codon 269. The tree
represents VP1 genes (labeled by G1 numbers) of viruses isolated
from PML patients. Mutations in Ser269 codons are indicated by text
inserts. Circles on branches reflect aLRT support. Position 269 was
masked prior to constructing the tree to avoid attraction of
branches with mutations of this codon. The PhyML maximum likelihood
method [Guindon S, Gascuel O (2003) A simple, fast, and accurate
algorithm to estimate large phylogenies by maximum likelihood. Syst
Biol 52: 696-704.] was used with F84 substitution model [Kishino H,
Hasegawa M (1989) Evaluation of the maximum likelihood estimate of
the evolutionary tree topologies from DNA sequence data, and the
branching order in hominoidea. J Mol Evol 29: 170-179 and
Felsenstein J, Churchill G A (1996) A Hidden Markov Model approach
to variation among sites in rate of evolution. Mol Biol Evol 13:
93-104]. Application of several methods incorporated in the PHYLIP
package maximum likelihood method, distance-based and
parsimony-based methods of phylogenetic reconstruction produced
similar results. Viral sequences isolated from PML patients do not
cluster on the phylogenetic tree and are broadly distributed among
viral types and geographic origins of the samples (FIG. 4a). This
is further supported by very low population stratification measure
F.sub.ST [Slatkin M, Maddison W P (1990) Detecting isolation by
distance using phylogenies of genes. Genetics 126: 249-260] (1.8%).
In agreement with earlier studies [Zheng H Y, Takasaka T, Noda K,
Kanazawa A, Mori H, et al. (2005) New sequence polymorphisms in the
outer loops of the JC polyomavirus major capsid protein (VP1)
possibly associated with progressive multifocal
leukoencephalopathy. J Gen Virol 86: 2035-2045, Jobes D V, Chima S
C, Ryschkewitsch C F, Stoner G L (1998) Phylogenetic analysis of 22
complete genomes of the human polyomavirus JC virus. J Gen Virol 79
(Pt 10): 2491-2498, and Agostini H T, Deckhut A, Jobes D V, Girones
R, Schlunck G, et al. (2001) Genotypes of JC virus in East, Central
and Southwest Europe. J Gen Virol 82: 1221-1331], PML causing
viruses are not limited to a specific viral phylogenetic type.
[0289] Sequences from viruses isolated from PML patients were used
as well as those from healthy subjects with the goal of determining
whether PML associated evolutionary selective pressure is acting on
the viral VP1 gene. This analysis utilized the PAML package [Yang Z
(1997) PAML: a program package for phylogenetic analysis by maximum
likelihood. Comput Appl Biosci 13: 555-556] designed to identify
the presence of codons evolving under positive selection. PAML
evaluates multiple evolutionary models using the parametric
likelihood ratio test. Several models were tested including a model
of neutral evolution, a nearly neutral model allowing for purifying
(e.g., negative) selection, and a heterogeneous model that allows
some codon positions to evolve under positive selection and other
codon positions to evolve under negative selection or neutrally
(Table 5). A number of more complex models also were tested.
[0290] In the case of VP1 sequences from JCV isolated from healthy
subjects, the nearly neutral evolutionary model involving a mixture
of neutrally evolving codons and codons under purifying selection
clearly outperformed the purely neutral model (p-value
7.0.times.10.sup.-6). However, no statistical support was found for
more complex models including models with positive selection. In
contrast, for VP1 sequences isolated from PML patients, allowing
codons to evolve under positive selection resulted in a highly
significant increase in the model likelihood (Table 5). The model
with three categories of sites including sites evolving under
purifying selection, neutral sites and sites under positive
selection explained the data significantly better than the nearly
neutral model limited only to neutral sites and the sites under
purifying selection (p-value 2.5.times.10.sup.-7). More complex
models did not show significant improvement over the simplest model
with three categories of codons.
[0291] Four codon positions (corresponding to amino acids 55, 60,
267 and 269) were identified as evolving under positive selection
in the PML sampling of full length sequences (Table 5). Bayesian
posterior probabilities for positive selection computed by PAML
were above 0.5 for these codon positions. The posterior probability
for positive selection in codon 269 was close to 1. To increase the
power of analysis, partial VP1 sequences were added from JC virus
isolated from PML patients. The addition of partial sequences
revealed signal of positive selection in codon 265 (Table 5).
TABLE-US-00012 TABLE 5 Codons under positive selection in the PML
sample. Full length sequence Partial sequence set set (n = 28)
codons 43-287 (n = 42) P-value for the positive selection test
Mutations 2.5 .times. 10.sup.-7 3.5 .times. 10.sup.-6 Position WT
Mutant Bayes Empirical Bayes posterior probability 55 L F 0.82 0.94
60 K M, E, N <0.5 0.94 265 N D, T <0.5 0.85 267 S F, L 0.80
0.92 269 S F, Y, C 1.00 1.00
[0292] In this example, two VP1 mutations were not observed in the
same JCV isolate. Analysis by the Spidermonkey [Poon A F, Lewis F
I, Frost S D, Kosakovsky Pond S L (2008) Spidermonkey: rapid
detection of co-evolving sites using Bayesian graphical models.
Bioinformatics 24: 1949-1950] method revealed epistatic
interactions between positions 55 and 269 and between position 60
and 269 (with posterior probabilities 0.88 and 0.70 respectively).
This may reflect "diminishing return" epistatic interactions, e.g.,
subsequent mutations are not beneficial and possibly detrimental on
the background of a single mutation.
[0293] All substitutions in these five codons are clearly
associated with PML. At least 52% of JC viruses (or 36 out of 69
sequences, including partial sequences) isolated from PML patients
have at least one of these mutations, whereas none of these
substitutions have been observed in 253 full length viral sequences
from healthy subjects (Table 6).
TABLE-US-00013 TABLE 6 Amino acid variability of JCV VP1 sequences
##STR00001##
Residues highlighted with darker shading are distinct between PML
and non-PML groups and have Bayes Empirical Bayes posterior
probability for positive selection >0.5 (Table 5). Residues
highlighted with lighter shading are distinct between PML and
non-PML groups.
[0294] The strongest signal of positive selection in the PML sample
was detected for the codon encoding amino acid at position 269.
FIG. 4b shows that multiple independent mutations of Ser269 to
aromatic residues phenylalanine and tyrosine were observed in VP1
from PML associated viruses. The existence of multiple independent
mutations is not an artifact of phylogenetic reconstruction because
lineages with mutant variants are separated by multiple branches
with over 90% support by bootstrap analysis and support of the
likelihood ratio test implemented in PhyML [Guindon S, Gascuel O
(2003) A simple, fast, and accurate algorithm to estimate large
phylogenies by maximum likelihood. Syst Biol 52: 696-704]. These
lineages correspond to different, previously identified,
phylogenetic types of JC virus and are from diverse geographic
locations [Jobes D V, Chima S C, Ryschkewitsch C F, Stoner G L
(1998) Phylogenetic analysis of 22 complete genomes of the human
polyomavirus JC virus. J Gen Virol 79 (Pt 10): 2491-2498 and
Agostini H T, Deckhut A, Jobes D V, Girones R, Schlunck G, et al.
(2001) Genotypes of JC virus in East, Central and Southwest Europe.
J Gen Virol 82: 1221-1331].
[0295] VP1 sequences isolated from PML patients and random subsets
of sequences isolated from healthy subjects were further analyzed
using PAML [Yang Z (1997) PAML: a program package for phylogenetic
analysis by maximum likelihood. Comput Appl Biosci 13:
555-556].
[0296] Multiple models of sequence evolution incorporated in PAML
were examined including purely neutral model (M0), nearly neutral
model (M1), model with positive selection (M2) and additional more
complex models (M3-M8). A likelihood ratio test (LRT) was used to
compare the difference between models M1 and M2 to test for
positive selection. P-values for positive selection in three
datasets are shown together with Bayesian posterior probabilities
for each codon position. Residues with Bayes Empirical Bayes
posterior probabilities exceeding 0.5 are shown.
Example 5
Identified Mutations Fall in the Sialic Acid Binding Site
Methods:
[0297] A homology model of the JCV VP1 protein pentameric unit was
built with MODELER [Sali A, Blundell T L (1993) Comparative protein
modelling by satisfaction of spatial restraints. J Mol Biol 234:
779-815] using the structure of MPyV VP1 (Protein Data Bank ID:
1VPS [Stehle T, Harrison S C (1997) High-resolution structure of a
polyomavirus VP1-oligosaccharide complex: implications for assembly
and receptor binding. Embo J 16: 5139-5148] as a template. The
model of
NeuNAc-(.alpha.2,3)-Gal-(.beta.1,3)-[(.alpha.2,6)-NeuNAc]-Glc-NAc
tetrasaccharide was build based on the structure of
NeuNAc-(.alpha.2,3)-Gal-(.beta.1,3)-[(.alpha.-2,6)-NeuNAc]-Glc-NAc
bound to MPyV VP1 [Stehle T, Harrison S C (1997) High-resolution
structure of a polyomavirus VP1-oligosaccharide complex:
implications for assembly and receptor binding. Embo J 16:
5139-5148]. The model of the JCV
VP1/NeuNAc-(.alpha.2,3)-Gal-(.beta.1,3)-[(.alpha.2,6)-NeuNAc]-Glc-NAc
tetrasaccharide was extensively refined in CHARMM [Brooks B R,
Bruccoleri R E, Olafson B D, States D J, Swaminathan S, et al.
(1983) CHARMM: A program for macromolecular energy, minimization,
and dynamics calculations. Journal of Computational Chemistry 4:
187-217] and was analyzed using PyMOL visualization software (The
PyMOL Molecular Graphics System (2002) DeLano Scientific, Palo
Alto, Calif., USA. www.pymol.org).
Results:
[0298] According to aspects of the invention, the functional role
of the five identified amino acid positions can be evaluated by
constructing a three-dimensional molecular model of the JC virus
VP1 bound to
NeuNAc-(.alpha.-2,3)-Gal-(.beta.1,3)-[(.alpha.2,6)-NeuNAc]-Glc-NAc
tetrasaccharide based on the crystal structure of MPyV
VP1/oligosaccharide complex [Stehle T, Harrison S C (1997)
High-resolution structure of a polyomavirus VP1-oligosaccharide
complex: implications for assembly and receptor binding. Embo J 16:
5139-5148]. The structural model shown in FIG. 5a suggests that all
PAML-identified amino acids are clustered on the surface of the VP1
protein at the sialic acid binding site and are likely to be
involved in sialic acid binding. FIG. 5 is a structural model of
JCV
VP1/NeuNAc-(.alpha.2,3)-Gal-(.beta.1,3)-[(.alpha.2,6)-NeuNAc]-Glc-NAc
tetrasaccharide complex. (A) A model of JCV VP1 basic pentamer in
complex with
NeuNAc-(.alpha.2,3)-Gal-(.beta.1,3)-[(.alpha.2,6)-NeuNAc]-Glc-NAc
tetrasaccharide. Surfaces of five chains of JCV VP1 are shown. The
RG motif essential for binding of core sialic acid is shown.
PML-associated mutated residues confirmed by PAML are indicated
(L55, K60, S265, S267, S269). Additional mutations unique to
PML-isolated samples also are shown (S61, D66, S123, H129, V223 and
Q271). (B) A close-up view of
NeuNAc-(.alpha.2,3)-Gal-(.beta.1,3)-[(.alpha.2,6)-NeuNAc]-Glc-NAc
tetrasaccharide/JCV VP1 complex. The location of V296 of MPyV VP1
which is predicted to be equivalent to S269 of JCV VP1 is shown in
mesh. Additionally, in some embodiments the L55F, K60M, S267F, and
S269F substitutions may induce steric clashes with the modeled
saccharide leading to a decrease in the affinity of the
interaction. Affinity to sialic acid was related to viral
pathogenicity in multiple studies of flu virus, mouse polyomavirus,
and mouse minute virus [Srinivasan A, Viswanathan K, Raman R,
Chandrasekaran A, Raguram S, et al. (2008) Quantitative biochemical
rationale for differences in transmissibility of 1918 pandemic
influenza A viruses. Proc Natl Acad Sci USA 105: 2800-2805, Bauer P
H, Cui C, Liu W R, Stehle T., Harrison S C, et al. (1999)
Discrimination between sialic acid-containing receptors and
pseudoreceptors regulates polyomavirus spread in the mouse. J Virol
73: 5826-5832 and Nam H J, Gurda-Whitaker B, Gan W Y, Ilaria S,
McKenna R, et al. (2006) Identification of the sialic acid
structures recognized by minute virus of mice and the role of
binding affinity in virulence adaptation. J Biol Chem 281:
25670-25677. Particularly, pathogenicity of mouse polyomavirus, a
close relative of the JC virus, was mapped to a VP1 amino acid
substitution at position 296 [Bauer P H, Bronson R T, Fung S C,
Freund R, Stehle T, et al. (1995) Genetic and structural analysis
of a virulence determinant in polyomavirus VP1. J Virol 69:
7925-7931], a position orthologous to position 269 in human JC
virus that showed the strongest signal of positive selection in
PML-causing viral isolates in this study. As shown in FIG. 5b,
serine 269 of the human JC virus and valine 296 of the mouse
polyomavirus occupy identical locations in the sialic acid binding
pocket.
[0299] Positions 61, 66, 123, 129, 223 and 271 are all limited to
the PML sample (Table 6) and also line up with the sialic acid
binding pocket (FIG. 5b). It is possible that those residues went
undetected by the PAML analysis due to the small sample size and
that the development of PML is accompanied by positive selection
for amino acids involved in sialic acid binding in a majority of
cases. The length of the phylogenetic tree in the analysis is short
thus limiting the power to detect positive selection [Anisimova M,
Bielawski J P, Yang Z (2001) Accuracy and power of the likelihood
ratio test in detecting adaptive molecular evolution. Mol Biol Evol
18: 1585-1592 and Anisimova M, Bielawski J P, Yang Z (2002)
Accuracy and power of bayes prediction of amino acid sites under
positive selection. Mol Biol Evol 19: 950-958]. Likelihood ratio
test for detecting positive selection using a short tree is
conservative [Anisimova M, Bielawski J P, Yang Z (2001) Accuracy
and power of the likelihood ratio test in detecting adaptive
molecular evolution. Mol Biol Evol 18: 1585-1592], and Bayes
Empirical Bayes analysis is of limited power [Anisimova M,
Bielawski J P, Yang Z (2002) Accuracy and power of bayes prediction
of amino acid sites under positive selection. Mol Biol Evol 19:
950-958]. Thus, additional PML-specific VP1 mutations can also be
positively selected. Mutations at residue 107 are also found
exclusively in the PML sample. However, it did not show evidence of
positive selection according to PAML and is not located in the
sialic acid binding pocket.
Example 6
JCV Mutants and Sialic Acid Binding
Methods: Hemagglutination Assay and Viral Like Particles
[0300] Hemagglutination assay was performed as previously described
[Chapagain M L, Nguyen T, Bui T, Verma S, Nerurkar V R (2006)
Comparison of real-time PCR and hemagglutination assay for
quantitation of human polyomavirus JC. Virol J 3: 3 and Padgett B
L, Walker D L (1973) Prevalence of antibodies in human sera against
JC virus, an isolate from a case of progressive multifocal
leukoencephalopathy. J Infect Dis 127: 467-470]. Briefly, human
type O blood was washed twice and suspended in Alsever's buffer (20
mM sodium citrate, 72 mM NaCl, 100 mM glucose, pH 6.5 adjusted with
acetic acid) at a final concentration of .about.0.5%. Serial
two-fold dilutions of VLPs were prepared in Alsever's buffer and an
equal volume of RBCs was added into each well of a 96-well "U"
bottom microtiter plate and incubated at 4.degree. C. for 3-6 hr.
Minimum HA concentration is the lowest concentration of VLP protein
that still agglutinated RBCs.
[0301] Genes encoding the VP1 protein from JC virus strains
BAE00117, AAT09831 and AAQ88264 were created synthetically and
cloned into the Gateway pDEST8 (Invitrogen) shuttle vector for
transfer into the pFASTBAC baculovirus expression system for
baculovirus expression in SF9 cells. Purification of VLPs was
performed from roughly 100 grams of frozen cell pellets from 5
liters of culture. Cells were resuspended in 500 ml of PBS
containing 0.1 mM CaCl.sub.2. The cells are disrupted by passing
the cell suspension twice through a Microfluidics Microfluidizer.
Cell debris was removed by pelleting at 8000.times.G for 15
minutes. The supernatant volume was adjusted to 720 ml with
PBS/CaCl.sub.2 and loaded onto 5 ml 40% sucrose cushions.
Virus-like particles were twice pelleted through the sucrose
cushions in a SW28 rotor at 100,000.times.G for 5 hours. The VLP
pellets were resuspended in PBS/CaCl.sub.2 and then treated with
0.25% deoxycholate for 1 hour at 37.degree. C. followed by the
addition of 4M NaCl/0.1 mM CaCl.sub.2 for 1 hour at 4.degree. C.
Precipitated material was removed by centrifugation at 8000.times.G
for 15 minutes. The resulting supernatant was concentrated and
buffer exchanged by ultrafiltration through a Pelicon-2 500,000
MWCO membrane (Millipore). The concentrated VLPs were applied to
the center of a 25-40% step gradient of Optiprep (Sigma) and banded
at 190,000 g for 17 hours in a type 50.2 rotor. VLP bands were
collected and then concentrated and buffer exchanged in an Amicon
stirred cell with a 300,000 MWCO membrane. VLP quality was
determined by gel electrophoresis and electron microscopy (FIG. 6).
Protein concentration was determined by the Micro BCA assay
(Pierce). Electron microscopy was performed at the Department of
Cell Biology at Harvard Medical School. VLP samples were placed on
carbon grids, briefly washed in water and negatively stained with
uranyl acetate and allowed to dry. The grids were viewed and imaged
on a Technai G2 Spirit BioTWIN TEM.
Results:
[0302] In order to experimentally verify the role that these
substitutions play in sialic acid binding by the VP1 capsid, viral
like particles (VLP) were recombinantly produced from VP1 protein
encoded by several different naturally occurring viruses. VLPs were
generated from viral VP1 sequences encoding substitutions with one
of the two strongest signals of positive selection identified by
PAML, one with phenylalanine at position 269 (F269) and another one
with phenylalanine at position 55 (F55). Two different VP1 genes
that were used as controls do not harbor any of the identified
PML-associated mutations, one from a healthy individual (WT) and
another one from a PML patient (Mad-1) (Table 7).
TABLE-US-00014 TABLE 7 Amino acid variability of JCV VP1 sequences
between VLPs. 55 74 75 117 128 134 158 164 269 321 332 345 WT1 L N
K T T A V T S I Q R AAQ88264 55F F N K T T A V T S I Q R AAT09831
WT2(Mad-1) L N R S T G L K S V E K P03089 269F L S K S A G V K F V
E K BAE00117
[0303] Viral hemagglutination of red blood cells (RBCs) has been
shown to be a reliable measure of sialic acid binding by
polyomaviruses [Freund R, Garcea R L, Sahli R, Benjamin T L (1991)
A single-amino-acid substitution in polyomavirus VP1 correlates
with plaque size and hemagglutination behavior. J Virol 65: 350-355
and Liu C K, Wei G, Atwood W J (1998) Infection of glial cells by
the human polyomavirus JC is mediated by an N-linked glycoprotein
containing terminal alpha(2-6)-linked sialic acids. J Virol 72:
4643-4649]. All four VLPs were tested in a hemagglutination assay.
Strikingly, both F55 and F269 variants displayed more than
8000-fold lower HA activity than either control VLP (Table 7A).
Specifically, the F55 variant completely failed to agglutinate
human type O RBCs even at 200 .mu.g/ml, the highest concentration
tested, and the F269 variant displayed very low HA activity as it
caused hemagglutination only at concentrations above 25 .mu.g/ml.
At the same time both L55 and 5269 carrying variants (WT and Mad-1)
caused hemagglutination of RBCs at concentrations down to 0.375
ng/ml and 6.25 ng/ml, correspondingly. In this example, the F55
mutant has the single amino acid difference with its corresponding
wild type variant (WT). Therefore the change in hemagglutination
can be specifically attributed to this amino acid replacement. In
addition to the change in position 269 the F269 mutant variant has
two additional amino acid positions that are different from its
corresponding control variant (Mad-1). Both of those amino acid
changes are not PML specific and are unlikely to explain the
difference in hemagglutination. While the Mad-1 isolate had
originated from a PML patient [Padgett B L, Walker DL, ZuRhein G M,
Eckroade R J, Dessel B H (1971) Cultivation of papova-like virus
from human brain with progressive multifocal leucoencephalopathy.
Lancet 1: 1257-1260] it does not contain any of the PML-specific
mutation which correlates well with its ability to hemagglutinate
RBCs. The lack of PML-genic mutations in this PML isolate suggests
that VP1 mutations are not an exclusive mechanism leading to PML
development.
TABLE-US-00015 TABLE 7A Residues 55 and 269 in VP1 protein play
very important role in hemagglutination of RBCs by Viral Like
Particles (VLPs). Viral variant Minimum HA VLP concentration, ng/ml
WT1 0.08 55F >200,000 WT2 (Mad-1) 6.25 269F 50,000
[0304] Hemagglutination was conducted as described in Materials and
Methods using serial dilutions of VLPs starting from 200 .mu.g/ml.
VLPs were added to type O RBC and incubated at 4.degree. C. for 3
hours. Agglutination is visualized by the lack of a round pellet
formed by the settling of RBCs out of suspension. E55 is a VP1
variant with phenylalanine at the position 55 (AAT09831), F269 is a
VP1 variant with phenylalanine at the position 269 (BAE0011). WT
(AAQ88264) and Mad-1 (P03089) are VP1 variants with leucine and
serine at positions 55 and 269 respectively.
[0305] Protein sequences were aligned using ClustalW, amino acids
different in at least one sequence from the rest of sequences are
shown with their positions indicated.
Example 7
Mutant JCVs Have Impaired Binding to Gangliosides
Ganglioside ELISA:
[0306] The following gangliosides were prepared at 1 mg/ml in
methanol: asialo GM1 (human), monosialo GM1 (human), GM2 (human),
GM3 (bovine), GM4 (human), disialo GD1a (bovine), GD1b (human), GD2
(human), GD3 (bovine), trisialo GT1b (bovine). All gangliosides
purchased from Calbiochem except GM2 which was purchased from
American RadioChemicals.
[0307] Gangliosides were diluted to 0.1 mg/ml in methanol and added
0.1 ml/well of an ELISA plate (Corning 9018); the methanol was
allowed to evaporate overnight. On the following day, the plates
were blocked with 0.25 ml/well 1.times.PBS with Ca.sup.2+ and
Mg.sup.2+, 1% BSA (Fraction V), 0.1% Tween-20 for one hour. The
plates were then transferred onto ice--all consequential
incubations were performed at +4.degree. C.
[0308] VLPs were prepared at 0.03 mg/ml in block buffer; the buffer
was removed from the plate and the VLPs added 0.1 ml/well. The
plate was incubated on ice for 60-90 minutes. Anti-JCV VP1 (clone
PAB597) was prepared at 0.002 mg/ml in block buffer. The plates
were washed with 0.25 ml/well block buffer; anti-VP1 was added 0.1
ml/well. The plate was incubated on ice for 45-60 minutes.
HRP-conjugated goat anti-mouse IgG (H+L) (Jackson ImmunoResearch)
was prepared at 1:5,000 in block buffer. The plate was washed; 0.1
ml/well of HRP-anti-mouse was added. The plate was incubated on ice
for 30 minutes. The plate was washed and developed with 0.1 ml
1-Step Turbo TMB (Thermo Scientific Pierce). Color development was
monitored and the reaction stopped with addition 0.1 ml
2NH.sub.3PO.sub.4. The plates were then read at 450 nm on
spectromphotometer (Molecular Devices).
[0309] Each ganglioside had control wells (HRP-anti-mouse IgG only,
PAB597 and HRP-anti-mouse IgG). The background control was
designated as HRP-anti-mouse IgG only. Each experimental well was
calculated using the formula
(Experimental-Background)/Background.
[0310] The binding of WT JCV was evaluated against a variety of
gangliosides. FIG. 7 shows that WT JCV binds to some glycans, but
not to all. The structure of selected gangliosides is shown in FIG.
8 and their ability to bind to WT JCV is indicated.
[0311] FIG. 9 shows that the F55 and F269 mutations are not capable
of binding Neu5Ac.alpha.(2-3) and .alpha.(2-6) glycans. The
structure of selected gangliosides is shown in FIG. 10 and their
ability to bind to mutant JCV is indicated.
[0312] FIG. 11 compares the ability of WT and mutant to JCV to bind
selected gangliosides.
Example 8
Mutant JCV Binds Glial Cell Lines but not Lymphocytes
Flow Cytometry Analysis of VLP Staining;
[0313] The following cells were used: SVG-A (gift from Walter
Atwood), isolated peripheral mononuclear cells from donors.
Adherent cells were detached using Accutase, collected, and washed.
Venous blood was drawn from healthy donors; PMBCs were isolated
using a standard protocol involving centrifugation over
Ficoll-Hypaque Plus (Amersham Biosciences).
[0314] All stainings were performed on ice in PBS buffer containing
calcium and magnesium, 1% bovine serum Albumin (fraction V), 2 mM
sodium azide.
[0315] Cells (1-5.times.10.sup.5 cells/sample) were incubated with
10 .mu.g/ml VLP diluted in FACS buffer, in a total volume of 0.05
ml, on ice for 60-90 minutes in 96 V-bottom well plate. Cells were
washed with 0.15 ml FACS buffer and centrifuged at 2000 rpm
(.about.800.times.g) for 5 minutes. VLP binding was detected by
staining cells with anti-JCV VP1 (clone PAB597) at 0.002 mg/ml in
0.05 ml for 45-60 minutes, followed by a wash step and detection
with Alexa Fluor 488 anti-mouse IgG (H+ L) (Invitrogen) diluted
1:100 in 0.05 ml/sample for an additional 30-45 minutes. Cells were
washed and fixed in 0.05 ml Cytofix/Cytoperm (BD) for 15-25
minutes, washed and resuspended in 0.2 ml FACS buffer. The samples
were analyzed on a FACS Calibur.
[0316] Mutant JCV (269F) does not bind lymphocytes. However, mutant
JVC is still capable of binding glial cell lines (FIG. 12). WT JCV
and a negative control are also depicted.
Example 9
Generation of Mutant Specific Anti-JCV Antibodies
[0317] For the immunization of rabbits to generate anti-JCV VP1
sera, 0.5 mg of VP1 protein in the form of virus like particles
(VLPs) in PBS buffer was injected subcutaneously into 10 spots on
the rabbit back (0.05 mg/spot). The primary immunization was
followed by 2 boosts at 2-week intervals after which, sera was
collected and assayed for anti-VP1 activity.
[0318] Detection of Anti-Mutant-JCV Antibody by Competition
ELISA:
[0319] A: Anti-serum from 269F-VLP immunized rabbit or
anti-WT-MAD1-immunized VLP rabbit serum were pre-incubated with or
without 100 ug/ml of WT-MAD1-VLP, and were then incubated with a
plate coated with 269F-VLP. Bound antibodies were revealed with a
peroxidase-conjugated anti-rabbit.
[0320] B: Anti-serum from 55F-VLP immunized rabbit or
anti-WT-immunized VLP rabbit serum were pre-incubated with or
without 100 ug/ml of WT-VLP, and were then incubated with a plate
coated with 55F-VLP. Bound antibodies were revealed with a
peroxidase-conjugated anti-rabbit.
[0321] Rabbits were injected with F269 and F55 JCV mutant VP1 VLP
resulting in the generation of antibodies specific for mutant JCVs.
A competition ELISA showed that the mutant specific JCV antibodies
can be distinguished from a WT JCV antibody (FIG. 13). The assay
configuration is illustrated in FIG. 14. Antibodies bind mutant VLP
(either F55 or F269) captured on the plate. Competition is done
with non-mutant VLP to absorb all antibodies directed at "backbone"
of the molecule, leaving only antibodies against mutant epitopes
(if such are present in the sample) to bind to the plate and be
detected.
[0322] The mutant JCV and WT JCV antibodies were also compared for
their ability to bind to a mutant JCV-VLP. ELISA plates were coated
with F269 and F55 mutant JCV polypeptides and WT JCV and mutant JCV
antibodies were added to the plates (FIGS. 15 and 16). Both the
mutants and WT JCV antibodies bind to the coated ELISA plate.
Addition of WT JCV (JCV-471 and JCV-MAD1) resulted in the
disappearance of the binding of the WT JCV antibody, while the
mutant antibodies remain bound to the ELISA plate. Furthermore
addition of JCV virus resulted in the disappearance of the bound WT
antibody, while the mutant antibody remains bound to the plate.
Example 10
JCV-VP1 Mutations as a Viral Immune Escape Mechanism in Some
Patients
[0323] Serum from a patient that carries 269F mutation in VP1
protein or anti-WT-MAD1-immunized VLP rabbit serum (as a positive
control) were pre-incubated with or without 100 .mu.g/ml of
WT-MAD1-VLP, and were then incubated with a plate coated with
269F-VLP. Bound antibodies were revealed with a
peroxidase-conjugated anti-human or rabbit antibodies to detect
antibody binding to the coated 269F mutant VLP.
[0324] FIG. 17 shows that a patient that has the F269 mutant virus
has developed an antibody response against the WT virus but not
against the F269 mutant virus.
[0325] FIG. 18 shows that (top) rabbit immunized with non-mutant
VLP raises antibody to the site(S269 in this cases) that could get
mutated. In this cases experiment was done similar to schematics on
slide 16 (above insert) with several differences, instead of the
mutant VLP a non-mutant VLP was coated on the plate and antibody
binding in sera was competed with mutant (either F55 or F269)
protein), so only antibody to non-mutated AA epitope would be left
to bind to the plate. (bottom) shows the same experiment with
healthy volunteer sample. The results in Table 8 are based on a
similar experiment with several different volunteer samples. Table
8 shows that people that are not suffering from PML can have
antibodies against PML mutants. This shows that some people carry
antibodies specific for several residues in the sialic acid binding
site (e.g., patient 29 has antibodies to L55 and S269), while
others have either antibody only to one site, L55 or 5269, and
still others to no site. According to aspects of the invention,
individuals who have no antibodies to the residues in the sialic
acid binding site or only to one of those residues might be more
vulnerable to JCV escape mutants as they would have less protection
from neutralizing antibodies.
TABLE-US-00016 TABLE 8 VLP EC50, patient ID dilution L55 S269 9
24820 + + 19 81850 - - 22 14150 - + 29 6034 + + 31 802500 - - 33
870400 - - 39 - + 42 4161 - + 49 5506 - - 51 51480 - - 59 2802 - -
60 2423 - -
Example 11
JC Virus (JCV) VP1 from Cerebrospinal Fluid (CSF) and Plasma of
Patients with Progressive Multifocal Leukoencephalopathy (PML)
Carry Specific Mutations of Amino Acid Residues Involved in Sialic
Acid Binding
[0326] As described herein, PML is currently the second most
frequent cause of AIDS-related deaths. Unlike other opportunistic
infections, it also occurs in HAART-treated patients, either
shortly after starting or during chronic successful treatment.
Following primary infection, the causative agent, JCV, establishes
a persistent benign infection in the urinary tract and is excreted
in urine in 30% of healthy persons. The mechanisms leading to JCV
reactivation and PML are unclear, but it is known that the major
JCV capsid protein, VP1, is involved in cell entry, through binding
with cell sialic acid residues and, recently, VP1 amino acid
substitutions have been reported in PML.
[0327] The entire JCV-VP1 region was amplified, cloned (2 to 48
clones per sample, median 23) and sequenced from the CSF of 26 PML
patients (20 with HIV infection), and 11 paired plasma and 6 paired
urine samples. From 9 patients, sequential CSF (n=7) or plasma
(n=2) samples were also analysed. JCV DNA was measured by real-time
PCR. 3D modeling was used to map the mutations on VP1
structure.
DNA Extraction and VP1 Amplification:
[0328] DNA was extracted from 200 .mu.L of CSF, plasma or urine
using the QIAamp Blood Kit (Qiagen) and eluted in a final volume of
50 .mu.L.
The entire JCV-VP1 region was amplified by nested PCR using the
following primers:
TABLE-US-00017 Outer (2027 bp) (SEQ ID NO: 55) VP1-LF
GCAGCCAGCTATGGCTTTAC (SEQ ID NO: 56) VP1-LR GCTGCCATTCATGAGAGGAT
Inner (1233 bp) (SEQ ID NO: 57) VP1-SF CCTCAATGGATGTTGCCTTT (SEQ ID
NO: 58) VP1-SR AAAACCAAAGACCCCT
[0329] PCR reaction mixtures consisted of 5 .mu.L of 10.times.PCR
buffer, 4 mM of each dNTP, 0.7 .mu.M of primers VP1-LF and VP1-LR
in the first round and primers VP1-SF and VP1-SR in the second
round, 1.25 unit of Platinum Taq HF (Invitrogen) and 14 of
extracted DNA in a total volume of 50 .mu.L. Cycling parameters
were (for both first and second round) 30 cycles at 94.degree. C.
for 20 sec, at 58.degree. C. for 30 sec and at 68.degree. C. for 90
sec in an automated thermal cycler (Applied Biosystems).
[0330] After the first amplification with the outer primers, 2.5
.mu.l of amplified product was transferred from the first to the
second reaction mixture. Following amplification with the inner
primers, 10 .mu.l of the amplified product from the second mixture
was electrophoresed on a 2% agarose gel containing 0.5 .mu.g/ml
ethidium bromide. The results were photographed under U.V.
illumination and regarded as positive when a band corresponding to
the expected by long DNA fragment was present.
[0331] VP1 PCR Cloning:
[0332] The amplification product was purified by the Qiagen
purification kit. A's were added to the ends of the cleaned up PCR
product by Taq polymerase (A-overhang reaction) and cloning was
carried out by the TOPO TA cloning kit (Invitrogen). Mini-prep DNA
was prepared (Qiagen) from colonies containing the cloned VP1 PCR
product.
[0333] VP1 Sequencing:
[0334] Two to 48 clones were sequenced for each sample (median 23).
Following translation of the VP1 sequences, amino acid mutations
were marked by comparison to the large selection of VP1 sequences
from PML and non-PML cases. Only mutations present in more than one
clone for sample were considered.
[0335] Real-Time PCR for Quantification of JCV-DNA:
[0336] JCV DNA was quantified in CSF, plasma and urine samples by
real-time PCR, as described previously (Bossolasco S, Calori G,
Moretti F, Boschini A, Bertelli D, Mena M, Gerevini S, Bestetti A,
Pedale R, Sala S, Sala S, Lazzarin A, Cinque P. Prognostic
significance of JC virus DNA levels in cerebrospinal fluid of
patients with HIV-associated progressive multifocal
leukoencephalopathy. Clin Infect Dis. 2005 Mar. 1;
40(5):738-44.)
[0337] Patients:
[0338] PML patients were selected on the basis of the availability
of either a) paired CSF and plasma or urine samples or b)
sequential CSF samples, all with detectable JCV DNA by real time
PCR. Samples had been drawn from patients followed at the Clinic of
Infectious Dieaeses, San Raffaele Hospital, Milano, between 1993
and 2008. Sample aliquots were kept stored at -80.degree. C. until
the retrospective analyses for the present study. JCV VP1 was
successfully amplified from a total of 26 CSF, 11 plasma and 6
urine samples from a total of 30 PML patients.
[0339] Analysis of Clinical Samples--Study Design:
[0340] 1. Analyses of CSF sequences:
[0341] CSF sequences were examined from 26 patients (Table 9) and
both type and frequency of mutations, as well as their correlations
with patients variables were analysed.
[0342] 2. Analysis of sequences from paired samples from same
patients:
[0343] Paired CSF/plasma/urine samples ("triplets") were examined
in 2 patients. CSF/plasma, CSF/urine and plasma/urine pairs were
examined from, respectively, 6, 1 and 3 patients. Sequences
obtained from triplets and pairs were compared.
[0344] 3. Analysis of sequences from sequential samples:
[0345] Sequential CSF or plasma samples were available from 5 and 2
patients, respectively. These samples had been drawn close to the
diagnosis of PML (baseline) and at different times afterwards. From
each patient, 2 to 3 samples drawn over a time frame of 17 to 477
days were analysed. 5 of these patients had a progressive course of
PML. One patient experienced virological response after
commencement of HAART. One patient underwent clinical and
virological remission following treatment with cytarabine, but had
a relapse of PML after 6 months and following withdrawal of
cytarabine.
TABLE-US-00018 TABLE 9 Characteristics of the 26 PML Patients with
JCV VP1 analysis HIV status (pos:neg) 20:6 Median age 37 Sex (M:F)
18:8 JCV DNA copies/mL (median, IQR) 22,351 (6416-1,178,877)
Ongoing HAART (number of patients) * 6 Progressors vs. survivors
(number of patients) 18:2 * Refers only to patients with HIVrelated
PML
[0346] Analysis of Clinical Samples--Results:
[0347] 1. Analyses of CSF Sequences:
[0348] VP1 PML-specific mutations were defined as mutations that
are not normally present in the urine of patients without PML.
These mutations or deletions do not involve mutations at positions
determining VP1 genotypes--which distinguish VP1 sequences
according to their geographical distribution.
[0349] One of 8 different PML-specific mutation or deletion was
identified in CSF from 24 of 26 patients (92%). These involved
amino acid substitutions in one of the JCV VP1 outer loops (Table
10).
[0350] In all of the cases almost all of the clones from the same
sample contained the mutation or the deletion. In 5 patients, two
different mutations or deletions were identified, either in same
clones (n=2) or in different clones (n=3).
TABLE-US-00019 TABLE 10 JCV VP1 mutations in the CSF of patients
with PML VP1 VP1 mutation or Nr of Patients loop deletion (aa)
patients HIV-pos (n = 20) BC 51-52 del 1 55F 5 55F + 271H* 1 61L 1
61L + 55 del* 1 DE 122R 2 122R + 125-127 del 1 122R + 2V** 1 HI
265D 2 267F + 61L* 1 169F 2 0 2 HIV-neg (n = 6) BC 55F 4 HI 265H 1
269F 1 The BC, DE and HI JCV VP1 loops are defined by similarity of
their aa sequences to the VP1 loops of SV40 (Chang D, Liou Z M, Ou
W C, Wang K Z, Wang M, Fung C Y, Tsai R T. Production of the
antigen and the antibody of the JC virus major capsid protein VP1.
J Virol Methods 1996 May; 59(1-2): 177-87), which were previously
determined by X-ray crystallography (Liddington R C, Yan Y, Moulai
J, Sahli R, Benjamin T L, Harrison S C. Structure of simian virus
40 at 3.8-A resolution. Nature 1991 Nov 28; 354(6351): 278-84).
*Either mutation/deletion was present in different clones (55F +
271H in 15 and 4 clones; 61L + 55 del in 18 and 4 clones; 267F +
61L in 15 and 4 clones) **Both mutations/deletions were present in
each clone
[0351] Higher CSF JCV DNA levels were found in patients with
mutations of the BC and HI loops than in those with mutations of
the DE loop or no mutations (FIG. 19). No correlation was observed
in patients with HIV-associated PML between type of mutation and
CD4 cell count, plasma HIV-1 RNA level or survival time.
[0352] 2. Analysis of Sequences from Paired Samples:
[0353] The analysis of the 2 CSF/plasma/urine triplets showed the
same VP1 PML-specific mutation in CSF and plasma, whereas no PML
mutation was present in the corresponding urine sequences (Table
11). Similarly, identical PML-specific mutations were found in CSF
and plasma sequences from 6 patients with CSF/plasma pairs (Table
12), but only in either CSF or plasma, but not in urine sequences
of 1 patient with CSF/urine pairs or 3 patients with plasma/urine
pairs (Table 13).
TABLE-US-00020 TABLE 11 JCV VP1 mutations in paired
CSF/plasma/urine samples from patients with PML Type of Pt Lab ID
sample PML mutation 1 CSF 269F PLASMA* 269F URINE 0 2 CSF 269F
PLASMA 269F URINE 0
TABLE-US-00021 TABLE 12 JCV VP1 mutations in paired CSF/plasma
samples from patients with PML Type of JCV DNA Pt Lab ID sample
c/mL PML mutation 3 CSF 269F PLASMA 269F 4 CSF 269F PLASMA 269F 5
CSF 122R PLASMA 122R 6 CSF 0 PLASMA 0 7 CSF 55F PLASMA 55F 8 CSF
269F PLASMA 269F
TABLE-US-00022 TABLE 13 JCV VP1 mutations in paired CSF/urine or
plasma/urine samples from patients with PML Type of Pt Lab ID
sample PML mutation 9 CSF 55F URINE 0 10 PLASMA 122R URINE 0 11
PLASMA** 55F URINE 0 12 PLASMA 0 URINE 0
[0354] 3. Analysis of Sequences from Sequential Samples:
[0355] Analysis of sequential CSF or plasma samples revealed the
persistence of the PML-specific mutations in 7 patients with
progressive disease and stable or increasing JCV DNA in CSF (Tables
14 and 15).
[0356] In the patient undergoing virological response, the
principal PML mutation present in the first CSF sample was no
longer found in a second CSF sample showing a decrease of JCV DNA
level; in this latter sample, the emergence of a previously minor
represented mutation was observed.
[0357] In the patient undergoing PML relapse a few months after
clinical and virological remission of a first episode of PML, two
different mutations were present in CSF samples drawn during the
two episodes.
TABLE-US-00023 TABLE 14 PML Mutations in Patients with Sequential
CSF Samples Days after Pt Lab ID first sample PML mutation A 0 55F
17 55F 92 55F B 0 269F 208 265D C 0 265D 56 265D D 0 55F 66 55F E 0
122R + 2V ** 477 122R + 2V ** F 0 51-52del 230 51-52del G 0 61L +
53-55 del* 63 53-55del
TABLE-US-00024 TABLE 15 PML Mutations in Patients with Sequential
Plasma Samples Days after Pt Lab ID first sample PML mutation H 0
269F 21 269F I 0 267Y 56 267Y
Tables 14 and 15, notes:
[0358] * Either mutation/deletion was present in different clones
(55F+271H in 15 and 4 clones; 61L+55 del in 18 and 4 clones;
267F+61L in 15 and 4 clones)
[0359] ** Both mutations/deletions were present in each clone
Molecular Modeling of JCV-VP1:
[0360] Molecular Modeling of JCV VP1/Tetrasacharide Complex:
[0361] A homology model of the JCV VP1 protein pentameric unit was
built with MODELER using the structure of MPyV VP1 (Protein Data
Bank ID: 1VPS as a template. The model of
NeuNAc-(.alpha.2,3)-Gal-(.beta.1,3)-[(.alpha.2,6)-NeuNAc]-Glc-NAc
tetrasaccharide was build based on the structure of
NeuNAc-(.alpha.2,3)-Gal-(.beta.1,3)-[(.alpha.2,6)-NeuNAc]-Glc-NAc
bound to MPyV VP1. The model of the JCV
VP1/NeuNAc-(.alpha.2,3)-Gal-(.beta.1,3)-[(.alpha.2,6)-NeuNAc]-Glc-NAc
tetrasaccharide was extensively refined in CHARMM and was analyzed
using PyMOL visualization software (The PyMOL Molecular Graphics
System (2002) DeLano Scientific, Palo Alto, Calif., USA.
http://www.pymol.org)
[0362] Accordingly, compared to wild-type virus (that present in
urine of healthy persons) one of 8 specific single mutations or
deletions was identified in almost all CSF clones from each of
24/26 patients (92%). These conferred substitutions or deletions in
one of the three outer loops of VP1, most frequently involving
residues 55 (55F, 7 patients, 27%) and 269 (269F, 6 patients, 23%).
Paired plasma always showed the same CSF mutation, but no mutations
were identified in urines. Mutations were maintained in sequential
samples from 7 patients with progressive disease and stable or
increasing JCV DNA in CSF. They were lost in 2 patients: 1
undergoing PML remission and relapse, with onset of a new mutation;
and 1 with decreasing CSF JCV DNA, with emergence of a previously
minor different mutant variant. By 3D modelling, all mutated
residues clustered within or in the immediate proximity to the
sialic acid cell receptor binding site on VP1.
[0363] Therefore, based on this data, in patients with PML, JCV
found from CSF and plasma, but not urine, carries PML-specific VP1
substitutions. These substitutions are maintained during disease
progression. They involve the BC, DE or HI external loops of VP1,
at critical sites for binding with the sialic acid cell receptor.
Accordingly, in PML, JCV from CSF and plasma, but not urine,
carries VP1 substitutions at critical sites for cell binding, which
are maintained during the disease. These findings support a model
whereby JCV acquires adaptive changes during transition from sites
of persistence to the brain, eventually leading to PML.
Example 12
Residues in the Sialic Acid Binding Pocket of VP1
[0364] Residues within 12 angstroms from the modeled sialic acid
containing sugar (as described in the Examples herein) are listed
in Table 16.
TABLE-US-00025 TABLE 16 MET 48 GLY 49 ASP 50 PRO 51 ASP 52 GLU 53
HIS 54 LEU 55 ARG 56 GLY 57 MET 57 GLY 58 PHE 58 GLN 59 SER 59 LYS
60 PRO 60 SER 61 ILE 62 PRO 63 SER 63 ILE 64 SER 65 SER 65 ASP 66
LEU 66 THR 67 THR 67 GLU 68 PHE 68 GLU 69 GLY 69 GLY 70 SER 70 ASP
71 GLN 71 SER 72 TYR 72 PRO 73 TYR 73 ASN 74 GLY 74 LYS 75 TRP 75
ASP 76 SER 76 ARG 77 MET 77 GLY 78 LEU 78 ILE 79 PRO 79 ASN 80 LEU
81 ALA 82 THR 83 SER 84 ASP 85 THR 86 GLU 87 ASP 88 SER 89 PRO 90
GLY 91 ASN 92 ASN 93 THR 94 LEU 95 PRO 96 ASN 120 VAL 121 HIS 122
SER 123 ASN 124 GLY 125 ASP 130 ASN 131 GLY 132 ALA 133 ALA 134 ASP
137 VAL 138 HIS 139 GLY 140 PHE 141 ASN 142 LYS 143 THR 150 LYS 151
GLY 152 ILE 153 SER 154 PHE 159 ASN 160 TYR 161 ARG 162 THR 163 THR
164 TYR 165 PRO 166 ASP 167 ASP 180 GLN 180 ARG 182 THR 183 LYS 184
TYR 185 LYS 186 GLU 187 GLU 188 VAL 190 GLN 206 MET 262 PHE 263 THR
264 ASN 265 ARG 266 SER 267 GLY 268 SER 269 GLN 270 GLN 271 TRP 272
ARG 273 TRP 288 ARG 289 VAL 290 THR 291 ARG 292 ASN 293 TYR 294 ASP
295 VAL 296 VAL 296 HIS 297 HIS 298 TRP 299 ARG 300
Example 13
CSF and Plasma, but not Urine JCV of PML Patients Carry
PML-Associated VP-1 Mutations
[0365] To investigate whether PML-associated mutations are
specifically selected in CSF of PML patients, initially paired CSF
and urine sequences from 7 patients were analysed (Table 17). In
each patient, CSF JCV-VP1 carried one amino acid substitution that
was not present in the urine derived sequence. CSF and urine
sequences were otherwise identical within individual patients and
characterized by identical polymorphisms as compared to the
reference strain (same virus subtype). PML-associated CSF mutations
involved codons 55, 60, 267, 269, and also codon 122. Plasma VP1
sequences, available from 13 patients (Table 17), were in all the
cases identical to the correspondent CSF-derived sequence, carrying
the same PML-associated substitution.
TABLE-US-00026 TABLE 17 Table 17. JCV VP1 amino acid substitutions
in sequences derived from paired urine, CSF and plasma samples from
PML patients PML-associated Matrix JCV subtype substitution 1 Urine
1B none CSF 1B L55F Plasma n.a. n.a. 2 Urine Mad-1 none CSF Mad-1
H122R; A2V Plasma n.a. n.a. 4 Urine 1A none CSF 1A H122R Plasma 1A
H122R 5 Urine Mad-1 none CSF Mad-1 S269F Plasma Mad-1 S269F 6 Urine
Undet. none CSF CONS S267Y Plasma Undet. S267Y 7 Urine 1B none CSF
1B S269F Plasma 1B S269F 8 Urine 1A none CSF 1A S269F Plasma 1A
S269F 9 Urine n.a. n.a. CSF Undet. S269F Plasma Undet. S269F 10
Urine n.a. n.a. CSF 2B S269F Plasma 2B S269F 11 Urine n.a. n.a. CSF
4v164K none Plasma 4v164K none 12 Urine n.a. n.a. CSF 1A L55F
Plasma 1A L55F 13 Urine n.a. n.a. CSF 4v128A345K L55F Plasma
4v128A345K L55F 14 Urine n.a. n.a. CSF 1Bv117T S269F Plasma 1Bv117T
S269F 16 Urine 4v164K none CSF n.a. n.a. Plasma 4v164K L55F U,
urine; CSF, cerebrospinal fluid; P, plasma. * when no substitution
is identified, then column value refers to nr of clones without
substitution/nr of clones examined.
Example 14
CSF JCV of PML Patients Consistently Carry One of Several Mutations
or Deletions Located In Sites Critical for Cell Binding
[0366] To define type and frequency of VP1 PML-associated
substitutions in vivo, CSF-derived VP1 sequences in a larger group
of patients were analysed. One main PML-associated mutation or
deletion was identified in 37 of 40 patients (90%) (Table 18). The
VP1 gene was cloned and sequenced for a number of clones as
described in Materials and Methods. Mutations were identified by
comparing the sequences to either VP1 sequences from matched urine
samples (when available) and to 460 sequences isolated from the
urine of non-PML individuals (n=460) as reported in the Genebank.
In some patients the mutation H122R was identified. In some
patients the mutation 2831 was identified. In some patient the
mutations A2V was identified. In some patient the deletion 50-51
was identified. In some patient the deletion 50-51 was identified.
In some patient the deletion 54-55 was identified. In some patient
the deletion 123-125 was identified. In some patient the deletion
125-134 was identified. In some patient the deletion 126-134 was
identified.
[0367] The most frequent changes involved codons 55 and 269, each
identified in 25% of the patients. In addition to the substitutions
already reported, at codons 55, 60, 61 and 265, 267, 269, several
other PML-associated mutations or deletions were newly identified,
involving non polymorphic VP1 codons as evidenced by comparison to
urine derived sequences from the Genebank. All these newly
identified mutations are also located in critical VP1 binding sites
(Table 18). FIG. 20 is a structural model of JCV
VP1/NeuNAc-(a2,3)-Gal-(b1,3)-[(a2,6)-NeuNAc]-Glc-NAc
tetrasaccharide complex. (A). Surfaces of five chains of JCV VP1
are shown. The RG motif essential for binding of core sialic acid
is shown. PML-associated mutated residues also are shown (L55, K60,
S265, S269). Additional mutations unique to PML-isolated samples
also are indicated (S61, D66, Q271) and (P51, D52, H122, S123,
N124, G125, Q126, A127). (B). A close-up view of FIG. 20A. The
location of V296 of MPyV VP1 which is predicted to be equivalent to
S269 of JCV VP1 is shown in mesh.
TABLE-US-00027 TABLE 18 JCV VP1 PML-associated aa substitutions and
deletions in CSF of PML patients PML-associated substitution JCV
VP1 subtype or deletion 1 4v-164K none 2 1Av-128S none 4 2B 50-51
del D66G N124S 5 1B L55F 6 1A L55F 7 3 L55F Q271H 8 1B L55F 9 1A
L55F 10 4v-128A345K L55F 16 1B S61L 54-55 del 18 1A H122R 19 1A
H122R A2V 17 1B 123-125 del 20 4v-128A N265D 21 4v-128A N265D 23 1B
S267F S61L Q271H 24 2B S267F 25 Undet. S269F 27 1B S269F 31 2B L55F
34 2B N265H 36 2B S269F 37 1Bv117T S269F 38 1B S269F 39 1A S269F
Undet., undetermined; Cons., consensus; v, variant a. sequence
available up to position 295
Example 15
Relationship between JC Virus Isolated from Different
Compartments
[0368] To inquire into the relationship between viral populations
in three compartments (kidney, plasma and CSF) population variation
of VP1 sequences represented by individually sequenced clones from
all three compartments in three patients were analyzed. With the
exception of amino acid changes presumably associated with PML
development, dominant VP1 genotypes in all three compartments were
always identical. All observed sequence variation was due to low
frequency single nucleotide variants. This suggests that PML
causing virus originated from preexisting resident population in
kidney.
[0369] The relationship between viral populations in the three
compartments can be characterized by the degree of shared low
frequency polymorphism. Single nucleotide variants observed in two
or more clones were analyzed. In all three patients, the majority
of genetic variation was confined to individual compartments as
allelic variants present in more than one sequence were observed in
a single compartment. Therefore, the viral population is highly
structured.
[0370] In two of the three patients several allelic variants were
shared between CSF and plasma populations and no variant was shared
between CSF and kidney populations or plasma and kidney
populations. In each of these two patients, the same PML-associated
mutation was observed in clones from CSF and plasma. These data are
consistent with a single origin of the CSF and plasma populations,
presumably due to a one-time escape from kidney event. In this
scenario sequence variation shared between the CSF and plasma
populations originated after the fixation of the PML-associated
mutation outside of kidney (assuming that independent multiple
mutations in the same site are not likely). VP1 sequence variation
shared between CSF and plasma populations may indicate presence of
viral migration between compartments. It is also consistent with a
scenario of step-wise infection, where a resident viral population
outside of kidney first establishes in one compartment (either CSF
or plasma), accumulates genetic variation, and then infects the
second compartment.
[0371] A third patient presents a different picture of shared
polymorphism between compartments. Two variants were shared between
CSF and kidney, three variants were shared between plasma and
kidney and one variant was shared between all three compartments.
All clones isolated from CSF and most of clones isolated from
plasma harbored the same PML-associated mutation (S269F). However,
three clones isolated from plasma had a different PML-associated
mutation (S267F). These clones lacked the dominant PML-associated
mutation.
[0372] Although the possibility of multiple successive infections
of CSF and plasma of Patient 3 cannot be excluded, these
observations are not necessarily inconsistent with the scenario of
a single origin of CSF and kidney populations after a one-time
escape from kidney. The data for Patient 3 might be an example of a
soft selective sweep. Soft selective sweep unlike the hard
selective sweep does not eliminate preexisting genetic variation
completely. The soft sweep scenario is very likely if the product
of effective population size and mutation rate (Ne.times.mu)
exceeds one. In this case multiple instances of a beneficial
mutation (or several beneficial mutations of equal or comparable
selective advantage) likely existed in the original population on
different haplotypic backgrounds. After a soft sweep, all sequences
would harbor a beneficial mutation but the population remains
polymorphic. It is possible that multiple instances of S269F
mutation and S267F mutation existed in the kidney population before
the escape and the fixation occurred following the soft sweep
scenario leading to the co-existence of S269F and S267F VP1
variants in the plasma population and shared variation between all
three compartments.
Example 16
Correlation of Various Mutations with the Clinical Outcome
[0373] To assess whether individual PML-associated VP1
substitutions could be clinically significant, e.g., being
differently selected according to patient and clinical context or
associated with different disease outcome, their presence was
correlated to a number of variables.
[0374] It was observed that JC virus with no VP1 substitutions or
substitutions involving positions 122-134 was present at the
significantly lower DNA level in CSF as compared to virus with
substitutions involving other positions (p=0.013, Mann-Whitney
test), e.g., with substitutions either at position 50-61 (p=0.02)
or 265-269 (p=0.036) s carrying different VP1 substitutions.
Example 17
PML Associated Mutation Decrease Ability of VP1 to Hemagglutinate
RBCs
[0375] In order to understand the role PML associated mutations
play in disease pathogenesis, the effect of some of these mutations
on viral receptor binding was investigated. Since JCV is known to
bind to sialic acid structures (Liu), viral ability to cause
hemagglutination of RBCs that express those structures has been
widely used as a model for viral interaction with its receptor.
[0376] Viral like particles (VLPs) prepared from the major JCV
capsid protein VP1 has been widely used as a good model
investigating the interactions of polyomaviruses with their cell
receptors. Similar to viral capsid, VLPs form viral capsid
structure as evidenced from electron microscopy (data not shown).
Next, binding of VLPs prepared from either a "wild type" or various
"mutant" VP1 molecules was investigated. A number of PML-associated
mutations that were shown to be positively selected during PML were
introduced as point mutations on a backbone of a VP1 molecule from
a single viral background (JCV type 3) and compared their ability
to hemagglutinate (e.g., bind) red blood cells (RBC). VLPs prepared
from VP1 molecule of type 3 virus just like for VLPs prepared from
type 1A (e.g., Mad-1) virus can cause RBC hemagglutination, and
they do that at the concentration as low as 760 pg/ml. However,
VLPs carrying one of most frequently occurring mutations 55F, 267F
and mutations at position 269 (F or Y) did not cause
hemagglutination even at the highest tested concentration of 100
.mu.g/ml, which corresponds to more than 100,000-fold decrease in
activity. Hemoagglutination was still apparent with the 60E, 265D
and 271H mutant VLPs, but only at very high concentrations that
corresponded to 200 to 25,000-fold losses in activity. Only binding
of 66H mutant VLP was not strongly affected and showed only 3-fold
decrease in hemoagglutination (3000 pg/ml as the lowest
hemagglutinating concentration). Neither 66H nor 271H mutations
were observed among the sequences analysed in this example, but
these mutations are identified to be PML-associated, based on an
analysis of sequences from Genebank. This effect of mutations on
the ability of VLPs to cause hemagglutination suggests that the
mutations may change viral receptor specificity by abrogating the
ability of virus to bind to cell receptor(s).
Example 18
PML-Associated Mutations Lose Ability to Hemagglutinae RBCs from
Different Blood Groups
[0377] VLPs carrying PML-associated mutations lose ability to
hemagglutinae RBCs from different blood groups. For
hemagglutination assay red blood cells (RBCs) were incubated with
serial two-fold dilutions of various VLPs starting from 100
.mu.g/ml. Minimum HA concentration is the lowest concentration of
VLP protein that still agglutinated RBCs. Hemaglutination was
examined by visual inspection as previously described. All
hemagglutination reactions were conducted in duplicates. Mean+/-SD
for the minimum HA concentration is calculated based on the
hemaglutionation results from four different blood group donors A,
B, O and AB). VLPs displaying lowest hemagglutination concentration
of 100 .mu.g/ml did not cause any hemagglutination at highest VLP
concentration tested (e.g., 100 .mu.g/ml).
Example 19
PML Associated Mutations Change Ganglioside Specificity of VP1
[0378] In order to further dissect JCV VP1 receptor specificity
binding of various mutant VLPs to different gangliosides was
investigated. Gangliosides are a group of complex
glycosphingolipids in which oligosaccharide chains containing one
or more sialic acids (N-acetylneuraminic acid, NeuNAc) are attached
to a ceramide, which anchors the structure to cellular membrane.
VLP binding to these ganglioside was measured in ELISA like format,
where gangliosides were coated in ELISA plates akin to antigen and
followed by addition of VLPs, which binding was detected with VP1
specific monoclonal antibodies. Using a type 3 "wild type" JCV VLP,
the strongest binding was observed to GD1b, GD2 and GT1a, with more
than 8-12 fold increase of signal as compared to the background
produced by binding of VLP to the well without any ganglioside
(FIG. 21). PML specific mutations of VP1 abolish or drastically
change specificity of viral capsid protein VP1 for sialated
gangliosides. Binding of VLPs to an array of gangliosides coated on
a 96-well plate was detected with a two step process involving
detection of VLPs bound to a ganglioside with VP1-specific murine
antibodies and anti-murine IgG HRP labeled antibodies followed by
development with TMB solution. VLP binding to a specific
ganglioside was calculated as percent increase in the optical
density obtained with the specific VLP present relative to that
obtained without VLP and antibodies alone in the presence of the
same galnlioside, 100*(OD.sub.450(plus VLP)-OD.sub.450(minus
VLP))/OD.sub.450(minus VLP). Schematic structure of ganglioside is
shown to reveal core binding structure bound by various VLPs. One
representative experiment of four conducted is shown. This
ganglioside specificity is consistent with what was previously
described for the type 1A "wild type" virus Mad-1. Binding of VLPs
to asialo-GM1 and GD1a was much weaker but still significant over
the background, while binding to other gangliosides was very
negligible relative to no-ganglioside background. Based on the
binding pattern it appears that the major "core" structure bound by
wild type virus consists of a tetrasaccharide
GalNAc(.beta.1-4)[Neu5Ac(.alpha.2-8)-Neu5Ac(.alpha.2-3)]
Gal(.beta.1-4)Glc structure, with di-sialic acid motif of
Neu5Ac(.beta.2-8)-Neu5Ac(.alpha.2-3) being crucial for binding.
[0379] However, binding of all mutant VLPs was drastically
different from the "wild type" molecule. Specifically, as seen in
FIG. 21, the VLP mutants 55F, 60E, 267F, 269F and 269Y completely
lost binding to all sialated gangliosides while still showing
unchanged binding to asialated GM1 structure (e.g., asialo-GM1).
Still, others, such as 66H, 265H and 271H showed a much broader
range of ganglioside binding than the original non-mutated VLP
molecule.
Example 20
Binding of VLPs to Various Cellular Targets
[0380] Results from hemagglutination and direct ganglioside binding
assays jointly suggest that PML associated mutations change viral
receptor specificity and especially viral ability to bind to
sialated oligosaccharide structures. Therefore, it was investigated
next how these mutation-conferred changes in specific receptor
binding affected JCV ability to bind to its purported target cells.
Binding of the above wild-type and mutant VLPs to the three major
cell types reported to be important for viral cell cycle: kidney
epithelial cells, lymphocytes and CNS cells was measured. Primary
human renal proximal tubular epithelial cells (HRPTECs) were chosen
as cells from the site of viral asymptomatic persistence of
non-mutated virus. Primary human B lymphocytes were also chosen, as
the cell type suggested to be critical for viral spread from
peripheral site to the CNS, as well as other lymphoid cells, e.g.,
primary T lymphocytes and lymphocytic cell line Jurkat. Although
productive infection of lymphoid cells has not been unequivocally
demonstrated, lymphocytes have been shown to bind JCV via their
sialic acid structures (Atwood et al.) and thus could potentially
carry the virus in vivo. Primary human fetal astrocytes and the
human glial cell line SVG-A were also employed as a model cell type
for CNS infection during PML. Infection of astrocytes has been well
documented in PML patients and both of these glial cell types can
be infected by JCV in vitro.
[0381] PML-ogenic mutants of VP1 lose binding ability to kidney and
blood cells but bind to the glial cells. Glial cell line SVG-A(A),
primary human astrocytes (B), human brain microvascular endothelial
cell (C), kidney tubular epithelial cells (D), or peripheral blood
mononuclear cells (E and F) cells were first incubated with
different VLP (as indicated on the x-axis) and further incubated
with anti-VP1 antibodies followed by staining with fluorescently
labeled antibodies. Binding of VLPs to T- (E) and B-lymphocytes(E)
was evaluated after co-staining of PBMCs with antibodies specific
for human CD3 and CD20 markers and gating on the corresponding
population. Ratio of mean fluorescent intensity (MFI) of cells
stained with anti-VP1 antibodies in the presence of VLPs relative
to the background MFI of cells stained only with the detection
antibodies in the absence of VLP is plotted for each VLP. Mean MFI
ratio+/SD is calculated based on the results from several
independent experiments (N is indicated on the graph). VLPs made
from "wild type" VP1 strongly bound to all of the above cell types
with MFI of more than 2-fold above background staining. However,
binding of mutant VLPs was dependent on both the cell type and the
position of the mutated amino acid. Specifically, the most frequent
PML associated mutations 55F, 267F, 269F and 269Y abrogated binding
of VLPs to kidney tubular epithelial cell and all lymphocytic
cells, but not to the primary astrocytes or glial cell line SVG-A.
Both CNS cell types still strongly bound VLPs carrying these
mutations (with the exception of 55F that bind SVG-A cells but not
primary astrocytes). VLPs carrying 60E, 66H and 271H still bound
all cell types, including kidney epithelial cells and lymphocytes,
although binding of 271H was strongly diminished.
Example 21
VLPs Carrying PML-Associated Mutations Bind Glial Cells in Sialic
Acid Independent Fashion
[0382] Since binding of the virus to cells has been previously
demonstrated to be sialic acid dependent (e.g., Atwood et al), but
the data demonstrate that most PML-associated mutations abolish
binding of VLPs to sialic acid containing gangliosides, it was
tested next whether binding of mutant VLPs to cells is still sialic
acid dependent. To do that either SVG-A or Jurkat cells were
treated with Neuraminidase to remove sialic acid from cell surface.
Staining of the cells with lectins specific for various
conformations of neuraminic acids (e.g., Sambucus Nigra Lectin
(SNA) and Maackia amurensis lectin (MAA)) proved neuraminidase
treatment effectiveness in sialic acid removal. Binding of
PML-ogenic mutants of VP1 to glial cells is sialic acid
independent. Glial cell line SVG-A cells or lymphoid cell line
Jurkats were first either pretreated with .alpha.2-3,6
neuraminidase for 60 min at 37.degree. C. or mock treated followed
by incubation at 4C with the indicated VLP and staining with the
detection antibodies as described herein.
[0383] Binding of type 3 wild type VLPs to both SVG-A and Jurkat
cells is sialic acid dependent, confirming what was previously
shown for Mad-1 virus (e.g., type 1A wild type). However, binding
of all tested but K60E mutant VLPs to SVG-A cells was not affected
by neuraminidase treatment suggesting that binding of these mutants
to these cells is sialic acid-independent. Interestingly, those
mutants that were still able to bind to Jurkat cells (e.g., K60E,
D66H, N265D and Q271H) bound in a sialic acid dependent manner as
evidenced by diminished binding to Jurkat cells treated with the
neuraminidase.
[0384] As can be seen from summary Table 19, binding of VLPs to
Jurkat cells appears to be largely sialic acid mediated, so that
mutant VLPs that do not show any binding to sialated gangliosides
do not bind to Jurkat cells and those that do also bind to Jurkat
cells in sialic acid dependent fashion. One notable exception to
that observation is N265D mutant, which, based on direct binding to
gangliosides, seemed to have gained very broad sialic acid binding,
but still lost its binding to Jurkat cell. Based on the above
results it appears that VLP binding results are in line with VLP
binding to RBCs as judged from hemagglutination results.
[0385] In summary, it appears that PML associated mutations largely
abolish sialic acid dependent binding of the virus to many
different peripheral cells types, including RBCs, kidney tubular
epithelial cells and lymphoid cells. Binding of mutant virus to
CNS-specific glial cells appears to be largely unaffected and
sialic acid independent.
TABLE-US-00028 TABLE 19 Correlation of VLP binding between various
assays SA-dependent HA SA HRPTEC Jurkat Astrocytes SVG-A Jurkat
SVG-A Wild Type 3 +++ ++ +++ +++ +++ +++ YES YES L55F - - - - +/-
+++ NO NO K60E - - +++ ++ ++++ +++ YES Part. D66H ++ +++ +++ +++
+++++ +++ Part. NO N265D + ++++ - - +++ ++++ NO NO S267F - - - - ++
++ NO NO S269F - - - - ++ +++ NO NO S269Y - - - - ++ +++++ NO NO
Q271H +/- +++ + + +++ +++++ YES NO
The following methods and materials were used in connection with
examples 13-21:
Patients and Samples
[0386] The present study was approved by the Ethical Committee of
the Institution. To investigate the presence and evolution of
PML-associated mutations in vivo, from a large cohort of PML
patients, followed at the Department of Infectious Diseases of San
Raffaele Hospital between 1992 and 2009, 40 patients were initially
selected from whom paired CSF, plasma or urine samples were
available and contained JCV DNA as determined by real-time PCR
(Bossolasco). VP1 was eventually amplified from at least two
different types of samples in 14 of these patients.
[0387] 43 additional PML patients were subsequently selected with
only CSF available and JCV DNA detected in CSF by real-time PCR.
JCV VP1 was successfully amplified from 28 of these patients. Thus,
paired samples from 14 patients and CSF-derived sequences from a
total of 40 patients could be studied.
JCV VP1 PCR
DNA Extraction and VP1 Amplification
[0388] DNA was extracted from 200 .mu.L of CSF, plasma or urine
using the QIAamp Blood Kit (Qiagen) and eluted in a final volume of
50 .mu.L. VP1 was amplified either using primers flanking the whole
VP1 gene (full VP1 PCR), or, when amplification with this method
was not successful, by a semi-nested PCR assay that amplified
separately shorter VP1 regions (short fragment VP1 PCR).
[0389] The full VP1 PCR consisted of a nested assay that used the
outer primers VP1-LF and VP1-LR, amplifying a 2027 bp fragment; and
the inner primers VP1-SF and VP1-SR, amplifying a 1233 bp long
fragment. The PCR reaction mixture consisted of 5 .mu.L of
10.times.PCR buffer, 4 mM of each dNTP, 0.7 .mu.M of primers VP1-LF
and VP1-LR in the first round and primers VP1-SF and VP1-SR in the
second round, 1.25 unit of Platinum Taq HF (Invitrogen) and 1 .mu.L
of extracted DNA (first round) or 2.5 .mu.l of amplified product
(second round) in a total volume of 50 .mu.L. Cycling parameters
were (for both first and second round) 30 cycles at 94.degree. C.
for 20 sec, at 58.degree. C. for 30 sec and at 68.degree. C. for 90
sec in an automated thermal cycler (Applied Biosystems).
[0390] The short fragment PCR consisted of a semi-nested PCR that
used primers VP1-1 and VP1-4a in the first round, amplifying a 797
bp fragment, followed by two semi-nested assays with primers VP1-1
and VP1-2a, amplifying a 481 bp-long fragment, or with primers
VP1-1.5 and VP1-4a, amplifying a 490 bp-long fragment (Zheng)
(Table 20) The PCR reaction mixture consisted of 2.5 .mu.L
10.times.PCR buffer, 200 .mu.M of each dNTP, 1.5 mM MgCl2, 0.5
.mu.M primers and 1.25 unit of AmpliTaq Gold DNA Polymerase
(Applied Biosystems). In the first round 4 .mu.L of extracted DNA
were added in a total volume of 25 .mu.L and the cycling parameters
were 20 cycles at 94.degree. C. for 20 sec, at 55.degree. C. for 30
sec and at 68.degree. C. for 90 sec in an automated thermal cycler
(Applied Biosystems). This first step PCR product was purified with
ExoSAP-IT PCR Clean-up Kit, the protocol consists of a single
pipetting step (enzyme mixture addition), a 30-min incubation at
37.degree. C. followed by enzyme inactivation at 80.degree. C. for
a further 15 min. In the second round of semi-nested PCR 4 .mu.L of
cleaned PCR product were added in a total volume of 25 .mu.L and
the cycling parameters were 40 cycles at 94.degree. C. for 20 sec,
at 62.degree. C. for 30 sec and at 68.degree. C. for 90 sec in an
automated thermal cycler (Applied Biosystems).
[0391] With both assays, following amplification with the inner
primers, 10 .mu.l of the amplified product from the second mixture
was electrophoresed on a 2% agarose gel containing 0.5 .mu.g/ml
ethidium bromide. The results were photographed under U.V.
illumination and regarded as positive when a band corresponding to
the expected by long DNA fragment was present.
TABLE-US-00029 TABLE 20 Nucleotide sequences of the primers used in
the full length nested PCR and short-fragment semi-nested PCR
forJCV-VP1 Name Sequence Nt. Number * VP1-LF GCAGCCAGCTATGGCTTTAC
(SEQ ID NO: 55) VP1-LR GCTGCCATTCATGAGAGGAT (SEQ ID NO: 56) VP1-SF
CCTCAATGGATGTTGCCTTT (SEQ ID NO: 57) VP1-SR AAAACCAAAGACCCCT (SEQ
ID NO: 58) VP1-1 TTGACTCAATTACAGAGGTAGAAT (SEQ ID NO: 59) VP1-4a
AGAAATTGGGTAGGGGTTTTTAAC (SEQ ID NO: 60) VP1-2a
AGGTACGCCTTGTGCTCTGTGTTC (SEQ ID NO: 61) VP1-1.5
GTGCAGGGCACCAGCTTTCATT (SEQ ID NO: 62) * according to the Mad-1
strain (ref)
VP1 PCR Cloning and Sequencing
[0392] The amplification product was purified by the Qiagen
purification kit. A's were added to the ends of the cleaned up PCR
product by Taq polymerase (A-overhang reaction) and cloning was
carried out by the TOPO TA cloning kit (Invitrogen). Mini-prep DNA
was prepared (Qiagen) from colonies containing the cloned VP1 PCR
product. Two to 48 clones were sequenced for each sample (median
23). Following translation of the VP1 sequences, amino acid
mutations were marked by comparison to the large selection of VP1
sequences from PML and non-PML cases. Only mutations present in
more than one clone for sample were considered.
Real-Time PCR for Quantification of JCV-DNA
[0393] JCV DNA was quantified in CSF, plasma and urine samples by
real-time PCR, as described previously (Bossolasco S. et al.
2005)
Hemagglutination Assay
[0394] Red blood cells (RBCs) from type O+ donors were washed twice
and suspended in Alsever's buffer (20 mM sodium citrate, 72 mM
NaCl, 100 mM glucose, pH 6.5 adjusted with acetic acid) at a final
concentration of .about.0.5%. Serial two-fold dilutions starting
from 100 .mu.g/ml of VLPs were prepared in Alsever's buffer and an
equal volume of RBCs was added into each well of a 96-well "U"
bottom microtiter plate and incubated at 4.degree. C. for 3-6 hr
(24 two-fold dilutions were performed). Minimum HA concentration is
the lowest concentration of VLP protein that still agglutinated
RBCs.
Ganglioside ELISA
[0395] Specific gangliosides (resuspended in methanol) were coated
onto a microtiter plate (10 .mu.g) overnight. The plates were
blocked (1% BSA (Fraction V), 0.1% Tween-20, PBS with Ca++, Mg++).
VLPs were prepared at 30 .mu.g/ml in block buffer and added (100
.mu.l/well). All incubations were performed on ice. After 90
minutes, the plates were washed with block buffer. VLP binding was
detected with a two step process involving binding of anti-VP1
(PAB597 at 2 .mu.g/ml) and HRP-anti-mIgG (1:100). Plates were
washed and developed with TMB Turbo ELISA solution. The reaction
was stopped with acid and the plate read on a spectrophotometer at
450 nm.
Flow Cytometry Analysis of VLP Binding to Cells
[0396] Cells were detached and collected (SVG-A, Jurkat, Human
Astrocytes, Human Renal Proximal Tubular Epithelials). A sample
(1-5.times.10.sup.5 cells) was first incubated with VLP (10-30
.mu.g/ml) in FACS Buffer (1% BSA [Fraction V], 2 mM sodium azide,
PBS with Ca++, Mg++) in a volume of 50 .mu.l for 60-90 minutes on
ice. Cells were washed with FACS Buffer and further incubated with
anti-VP1 (PAB597 2 .mu.g/ml) for 60 minutes, followed by washing
and incubation with AlexaFluor488-anti-mIgG (1:100) for another
30-45 minutes. Cells were washed and fixed in Cytofix/Cytoperm for
20 minutes, followed by a final wash and resuspension in FACS
buffer. The cells were analyzed on a BD FACSCalibur. Appropriate
controls and staining with other antibodies (isotype control, GM1,
asialo GM1, GD1a, GT1b) and lectins (Peanut Agglutinin (PNA),
Sambucus Nigra Lectin (SNA), Maackia Amurensis Lectin II (Mal II))
where necessary. In some cases cells were pretreated with
.alpha.2-3 neuraminidase, .alpha.2-3,6 neuraminidase, or PNGaseF to
alter their cell surface suger structures.
[0397] The foregoing written specification is considered to be
sufficient to enable one skilled in the art to practice the
invention. The present invention is not to be limited in scope by
examples provided, since the examples are intended as a single
illustration of one aspect of the invention and other functionally
equivalent embodiments are within the scope of the invention.
Various modifications of the invention in addition to those shown
and described herein will become apparent to those skilled in the
art from the foregoing description and fall within the scope of the
appended claims. The advantages and objects of the invention are
not necessarily encompassed by each embodiment of the
invention.
[0398] The contents of all references, patents and published patent
applications cited throughout this application are incorporated
herein by reference in their entirety.
Sequence CWU 1
1
621354PRTJC virus 1Met Ala Pro Thr Lys Arg Lys Gly Glu Arg Lys Asp
Pro Val Gln Val1 5 10 15Pro Lys Leu Leu Ile Arg Gly Gly Val Glu Val
Leu Glu Val Lys Thr 20 25 30Gly Val Asp Ser Ile Thr Glu Val Glu Cys
Phe Leu Thr Pro Glu Met 35 40 45Gly Asp Pro Asp Glu His Leu Arg Gly
Phe Ser Lys Ser Ile Ser Ile 50 55 60Ser Asp Thr Phe Glu Ser Asp Ser
Pro Asn Lys Asp Met Leu Pro Cys65 70 75 80Tyr Ser Val Ala Arg Ile
Pro Leu Pro Asn Leu Asn Glu Asp Leu Thr 85 90 95Cys Gly Asn Ile Leu
Met Trp Glu Ala Val Thr Leu Lys Thr Glu Val 100 105 110Ile Gly Val
Thr Thr Leu Met Asn Val His Ser Asn Gly Gln Ala Thr 115 120 125His
Asp Asn Gly Ala Ala Lys Pro Val Gln Gly Thr Ser Phe His Phe 130 135
140Phe Ser Val Gly Gly Glu Ala Leu Glu Leu Gln Gly Val Val Phe
Asn145 150 155 160Tyr Arg Thr Thr Tyr Pro Asp Gly Thr Ile Phe Pro
Lys Asn Ala Thr 165 170 175Val Gln Ser Gln Val Met Asn Thr Glu His
Lys Ala Tyr Leu Asp Lys 180 185 190Asn Lys Ala Tyr Pro Val Glu Cys
Trp Val Pro Asp Pro Thr Arg Asn 195 200 205Glu Asn Thr Arg Tyr Phe
Gly Thr Leu Thr Gly Gly Glu Asn Val Pro 210 215 220Pro Val Leu His
Ile Thr Asn Thr Ala Thr Thr Val Leu Leu Asp Glu225 230 235 240Phe
Gly Val Gly Pro Leu Cys Lys Gly Asp Asn Leu Tyr Leu Ser Ala 245 250
255Val Asp Val Cys Gly Met Phe Thr Asn Arg Ser Gly Ser Gln Gln Trp
260 265 270Arg Gly Leu Ser Arg Tyr Phe Lys Val Gln Leu Arg Lys Arg
Arg Val 275 280 285Lys Asn Pro Tyr Pro Ile Ser Phe Leu Leu Thr Asp
Leu Ile Asn Arg 290 295 300Arg Thr Pro Arg Val Asp Gly Gln Pro Met
Tyr Gly Met Asp Ala Gln305 310 315 320Ile Glu Glu Val Arg Val Phe
Glu Gly Thr Glu Gln Leu Pro Gly Asp 325 330 335Pro Asp Met Met Arg
Tyr Val Asp Arg Tyr Gly Gln Leu Gln Thr Lys 340 345 350Met
Leu2349PRTSimian Virus 40 2Pro Lys Lys Pro Lys Glu Pro Val Gln Val
Pro Lys Leu Val Ile Lys1 5 10 15Gly Gly Ile Glu Val Leu Gly Val Lys
Thr Gly Val Asp Ser Phe Thr 20 25 30Glu Val Glu Cys Phe Leu Asn Pro
Gln Met Gly Asn Pro Asp Glu His 35 40 45Gln Lys Gly Leu Ser Lys Ser
Leu Ala Ala Glu Lys Gln Phe Thr Asp 50 55 60Asp Ser Pro Asp Lys Glu
Gln Leu Pro Cys Tyr Ser Val Ala Arg Ile65 70 75 80Pro Leu Pro Asn
Ile Asn Glu Asp Leu Thr Cys Gly Asn Ile Leu Met 85 90 95Trp Glu Ala
Val Thr Val Lys Thr Glu Val Ile Gly Val Thr Ala Met 100 105 110Leu
Asn Leu His Ser Gly Thr Gln Lys Thr His Glu Asn Gly Ala Gly 115 120
125Lys Pro Ile Gln Gly Ser Asn Phe His Phe Phe Ala Val Gly Gly Glu
130 135 140Pro Leu Glu Leu Gln Gly Val Leu Ala Asn Tyr Arg Thr Lys
Tyr Pro145 150 155 160Ala Gln Thr Val Thr Pro Lys Asn Ala Thr Val
Asp Ser Gln Gln Met 165 170 175Asn Thr Asp His Lys Ala Val Leu Asp
Lys Asp Asn Ala Tyr Pro Val 180 185 190Glu Cys Trp Val Pro Asp Pro
Ser Lys Asn Glu Asn Thr Arg Tyr Phe 195 200 205Gly Thr Tyr Thr Gly
Gly Glu Asn Val Pro Pro Val Leu His Ile Thr 210 215 220Asn Thr Ala
Thr Thr Val Leu Leu Asp Glu Gln Gly Val Gly Pro Leu225 230 235
240Cys Lys Ala Asp Ser Leu Tyr Val Ser Ala Asp Val Asp Ile Cys Gly
245 250 255Leu Phe Thr Asn Thr Ser Gly Thr Gln Gln Trp Lys Gly Leu
Pro Arg 260 265 270Tyr Phe Lys Ile Thr Leu Arg Lys Arg Ser Val Lys
Asn Pro Tyr Pro 275 280 285Ile Ser Phe Leu Leu Ser Asp Leu Ile Asn
Arg Arg Thr Gln Arg Val 290 295 300Asp Gly Gln Pro Met Ile Gly Met
Ser Ser Gln Val Glu Glu Val Arg305 310 315 320Val Tyr Glu Asp Thr
Glu Glu Leu Pro Gly Asp Pro Asp Met Ile Arg 325 330 335Tyr Ile Asp
Glu Phe Gly Gln Thr Thr Thr Arg Met Gln 340 3453133PRTJC virus 3Asn
Val Pro Pro Val Leu His Ile Thr Asn Thr Ala Thr Thr Val Leu1 5 10
15Leu Asp Glu Phe Gly Val Gly Pro Leu Cys Lys Gly Asp Asn Leu Tyr
20 25 30Leu Ser Ala Val Asp Val Cys Gly Met Phe Thr Asn Arg Ser Gly
Ser 35 40 45Gln Gln Trp Arg Gly Leu Ser Arg Tyr Phe Lys Val Gln Leu
Arg Lys 50 55 60Arg Arg Val Lys Asn Pro Tyr Pro Ile Ser Phe Leu Leu
Thr Asp Leu65 70 75 80Ile Asn Arg Arg Thr Pro Arg Val Asp Gly Gln
Pro Met Tyr Gly Met 85 90 95Asp Ala Gln Val Glu Glu Val Arg Val Phe
Glu Gly Thr Glu Glu Leu 100 105 110Pro Gly Asp Pro Asp Met Met Arg
Tyr Val Asp Arg Tyr Gly Gln Leu 115 120 125Gln Thr Lys Met Leu
1304133PRTJC virus 4Asn Val Pro Pro Val Leu His Ile Thr Asn Thr Ala
Thr Thr Val Leu1 5 10 15Leu Asp Glu Phe Gly Val Gly Pro Leu Cys Lys
Gly Asp Asn Leu Tyr 20 25 30Leu Ser Ala Val Asp Val Cys Gly Met Phe
Thr Asn Arg Ser Gly Ser 35 40 45Gln Gln Trp Arg Gly Leu Ser Arg Tyr
Phe Lys Val Gln Leu Arg Lys 50 55 60Arg Arg Val Lys Asn Pro Tyr Pro
Ile Ser Phe Leu Leu Thr Asp Leu65 70 75 80Ile Asn Arg Arg Thr Pro
Arg Val Asp Gly Gln Pro Met Tyr Gly Met 85 90 95Asp Ala Gln Val Glu
Glu Val Arg Val Phe Glu Gly Thr Glu Glu Leu 100 105 110Pro Gly Asp
Pro Asp Met Met Arg Tyr Val Asp Arg Tyr Gly Gln Leu 115 120 125Gln
Thr Lys Met Leu 1305354PRTJC virus 5Met Ala Pro Thr Lys Arg Lys Gly
Glu Arg Lys Asp Pro Val Gln Val1 5 10 15Pro Lys Leu Leu Ile Arg Gly
Gly Val Glu Val Leu Glu Val Lys Thr 20 25 30Gly Val Asp Ser Ile Thr
Glu Val Glu Cys Phe Leu Thr Pro Glu Met 35 40 45Gly Asp Pro Asp Glu
His Phe Arg Gly Phe Ser Lys Ser Ile Ser Ile 50 55 60Ser Asp Thr Phe
Glu Ser Asp Ser Pro Asn Lys Asp Met Leu Pro Cys65 70 75 80Tyr Ser
Val Ala Arg Ile Pro Leu Pro Asn Leu Asn Glu Asp Leu Thr 85 90 95Cys
Gly Asn Ile Leu Met Trp Glu Ala Val Thr Leu Lys Thr Glu Val 100 105
110Ile Gly Val Thr Thr Leu Met Asn Val His Ser Asn Gly Gln Ala Ala
115 120 125His Asp Asn Gly Ala Gly Lys Pro Val Gln Gly Thr Ser Phe
His Phe 130 135 140Phe Ser Val Gly Gly Glu Ala Leu Glu Leu Gln Gly
Val Val Phe Asn145 150 155 160Tyr Arg Thr Lys Tyr Pro Asp Gly Thr
Ile Phe Pro Lys Asn Ala Thr 165 170 175Val Gln Ser Gln Val Met Asn
Thr Glu His Lys Ala Tyr Leu Asp Lys 180 185 190Asn Lys Ala Tyr Pro
Val Glu Cys Trp Val Pro Asp Pro Thr Arg Asn 195 200 205Glu Asn Thr
Arg Tyr Phe Gly Thr Leu Thr Gly Gly Glu Asn Val Pro 210 215 220Pro
Val Leu His Ile Thr Asn Thr Ala Thr Thr Val Leu Leu Asp Glu225 230
235 240Phe Gly Val Gly Pro Leu Cys Lys Gly Asp Asn Leu Tyr Leu Ser
Ala 245 250 255Val Asp Val Cys Gly Met Phe Thr Asn Arg Ser Gly Ser
Gln Gln Trp 260 265 270Arg Gly Leu Ser Arg Tyr Phe Lys Val Gln Leu
Arg Lys Arg Arg Val 275 280 285Lys Asn Pro Tyr Pro Ile Ser Phe Leu
Leu Thr Asp Leu Ile Asn Arg 290 295 300Arg Thr Pro Arg Val Asp Gly
Gln Pro Met Tyr Gly Met Asp Ala Gln305 310 315 320Val Glu Glu Val
Arg Val Phe Glu Gly Thr Glu Glu Leu Pro Gly Asp 325 330 335Pro Asp
Met Met Arg Tyr Val Asp Arg Tyr Gly Gln Leu Gln Thr Lys 340 345
350Met Leu6354PRTJC virus 6Met Ala Pro Thr Lys Arg Lys Gly Glu Arg
Lys Asp Pro Val Gln Val1 5 10 15Pro Lys Leu Leu Ile Arg Gly Gly Val
Glu Val Leu Glu Val Lys Thr 20 25 30Gly Val Asp Ser Ile Thr Glu Val
Glu Cys Phe Leu Thr Pro Glu Met 35 40 45Gly Asp Pro Asp Glu His Phe
Arg Gly Phe Ser Lys Ser Ile Ser Ile 50 55 60Ser Asp Thr Phe Glu Ser
Asp Ser Pro Asn Lys Asp Met Leu Pro Cys65 70 75 80Tyr Ser Val Ala
Arg Ile Pro Leu Pro Asn Leu Asn Glu Asp Leu Thr 85 90 95Cys Gly Asn
Ile Leu Met Trp Glu Ala Val Thr Leu Lys Thr Glu Val 100 105 110Ile
Gly Val Thr Thr Leu Met Asn Val His Ser Asn Gly Gln Ala Thr 115 120
125His Asp Asn Gly Ala Gly Lys Pro Val Gln Gly Thr Ser Phe His Phe
130 135 140Phe Ser Val Gly Gly Glu Ala Leu Glu Leu Gln Gly Val Val
Phe Asn145 150 155 160Tyr Arg Thr Thr Tyr Pro Asp Gly Thr Ile Phe
Pro Lys Asn Ala Thr 165 170 175Val Gln Ser Gln Val Met Asn Thr Glu
His Lys Ala Tyr Leu Asp Lys 180 185 190Asn Lys Ala Tyr Pro Val Glu
Cys Trp Val Pro Asp Pro Thr Arg Asn 195 200 205Glu Asn Thr Arg Tyr
Phe Gly Thr Leu Thr Gly Gly Glu Asn Val Pro 210 215 220Pro Val Leu
His Ile Thr Asn Thr Ala Thr Thr Val Leu Leu Asp Glu225 230 235
240Phe Gly Val Gly Pro Leu Cys Lys Gly Asp Asn Leu Tyr Leu Ser Ala
245 250 255Val Asp Val Cys Gly Met Phe Thr Asn Arg Ser Gly Ser Gln
Gln Trp 260 265 270Arg Gly Leu Ser Arg Tyr Phe Lys Val Gln Leu Arg
Lys Arg Arg Val 275 280 285Lys Asn Pro Tyr Pro Ile Ser Phe Leu Leu
Thr Asp Leu Ile Asn Arg 290 295 300Arg Thr Pro Arg Val Asp Gly Gln
Pro Met Tyr Gly Met Asp Ala Gln305 310 315 320Val Glu Glu Val Arg
Val Phe Glu Gly Thr Glu Glu Leu Pro Gly Asp 325 330 335Pro Asp Met
Met Arg Tyr Val Asp Arg Tyr Gly Gln Leu Gln Thr Lys 340 345 350Met
Leu7354PRTJC virus 7Met Ala Pro Thr Lys Arg Lys Gly Glu Arg Lys Asp
Pro Val Gln Val1 5 10 15Pro Lys Leu Leu Ile Arg Gly Gly Val Glu Val
Leu Glu Val Lys Thr 20 25 30Gly Val Asp Ser Ile Thr Glu Val Glu Cys
Phe Leu Thr Pro Glu Met 35 40 45Gly Asp Pro Asp Glu His Leu Arg Gly
Phe Ser Lys Ser Ile Ser Ile 50 55 60Ser Asp Thr Phe Glu Ser Asp Ser
Pro Asn Lys Asp Met Leu Pro Cys65 70 75 80Tyr Ser Val Ala Arg Ile
Pro Leu Pro Asn Leu Asn Glu Asp Leu Thr 85 90 95Cys Gly Asn Ile Leu
Met Trp Glu Ala Val Thr Leu Lys Thr Glu Val 100 105 110Ile Gly Val
Thr Thr Leu Met Asn Val His Ser Asn Gly Gln Ala Ala 115 120 125His
Asp Asn Gly Ala Gly Lys Pro Val Gln Gly Thr Ser Phe His Phe 130 135
140Phe Ser Val Gly Gly Glu Ala Leu Glu Leu Gln Gly Val Val Phe
Asn145 150 155 160Tyr Arg Thr Lys Tyr Pro Asp Gly Thr Ile Phe Pro
Lys Asn Ala Thr 165 170 175Val Gln Ser Gln Val Met Asn Thr Glu His
Lys Ala Tyr Leu Asp Lys 180 185 190Asn Lys Ala Tyr Pro Val Glu Cys
Trp Val Pro Asp Pro Thr Arg Asn 195 200 205Glu Asn Thr Arg Tyr Phe
Gly Thr Leu Thr Gly Gly Glu Asn Val Pro 210 215 220Pro Val Leu His
Ile Thr Asn Thr Ala Thr Thr Val Leu Leu Asp Glu225 230 235 240Phe
Gly Val Gly Pro Leu Cys Lys Gly Asp Asn Leu Tyr Leu Ser Ala 245 250
255Val Asp Val Cys Gly Met Phe Thr Asn Arg Ser Gly Phe Gln Gln Trp
260 265 270Arg Gly Leu Ser Arg Tyr Phe Lys Val Gln Leu Arg Lys Arg
Arg Val 275 280 285Lys Asn Pro Tyr Pro Ile Ser Phe Leu Leu Thr Asp
Leu Ile Asn Arg 290 295 300Arg Thr Pro Arg Val Asp Gly Gln Pro Met
Tyr Gly Met Asp Ala Gln305 310 315 320Val Glu Glu Val Arg Val Phe
Glu Gly Thr Glu Glu Leu Pro Gly Asp 325 330 335Pro Asp Met Met Arg
Tyr Val Asp Arg Tyr Gly Gln Leu Gln Thr Lys 340 345 350Met
Leu8354PRTJC virus 8Met Ala Pro Thr Lys Arg Lys Gly Glu Arg Lys Asp
Pro Val Gln Val1 5 10 15Pro Lys Leu Leu Ile Arg Gly Gly Val Glu Val
Leu Glu Val Lys Thr 20 25 30Gly Val Asp Ser Ile Thr Glu Val Glu Cys
Phe Leu Thr Pro Glu Met 35 40 45Gly Asp Pro Asp Glu His Leu Arg Gly
Phe Ser Lys Ser Ile Ser Ile 50 55 60Ser His Thr Phe Glu Ser Asp Ser
Pro Asn Arg Asp Met Leu Pro Cys65 70 75 80Tyr Ser Val Ala Arg Ile
Pro Leu Pro Asn Leu Asn Glu Asp Leu Thr 85 90 95Cys Gly Asn Ile Leu
Met Trp Glu Ala Val Thr Leu Lys Thr Glu Val 100 105 110Ile Gly Val
Thr Ser Leu Met Asn Val His Ser Asn Gly Gln Ala Thr 115 120 125His
Asp Asn Gly Ala Gly Lys Pro Val Gln Gly Thr Ser Phe His Phe 130 135
140Phe Ser Val Gly Gly Glu Ala Leu Glu Leu Gln Gly Val Leu Phe
Asn145 150 155 160Tyr Arg Thr Lys Tyr Pro Asp Gly Thr Ile Phe Pro
Lys Asn Ala Thr 165 170 175Val Gln Ser Gln Val Met Asn Thr Glu His
Lys Ala Tyr Leu Asp Lys 180 185 190Asn Lys Ala Tyr Pro Val Glu Cys
Trp Val Pro Asp Pro Thr Arg Asn 195 200 205Glu Asn Thr Arg Tyr Phe
Gly Thr Leu Thr Gly Gly Glu Asn Val Pro 210 215 220Pro Val Leu His
Ile Thr Asn Thr Ala Thr Thr Val Leu Leu Asp Glu225 230 235 240Phe
Gly Val Gly Pro Leu Cys Lys Gly Asp Asn Leu Tyr Leu Ser Ala 245 250
255Val Asp Val Cys Gly Met Phe Thr Asn Arg Ser Gly Ser Gln Gln Trp
260 265 270Arg Gly Leu Ser Arg Tyr Phe Lys Val Gln Leu Arg Lys Arg
Arg Val 275 280 285Lys Asn Pro Tyr Pro Ile Ser Phe Leu Leu Thr Asp
Leu Ile Asn Arg 290 295 300Arg Thr Pro Arg Val Asp Gly Gln Pro Met
Tyr Gly Met Asp Ala Gln305 310 315 320Val Glu Glu Val Arg Val Phe
Glu Gly Thr Glu Glu Leu Pro Gly Asp 325 330 335Pro Asp Met Met Arg
Tyr Val Asp Lys Tyr Gly Gln Leu Gln Thr Lys 340 345 350Met
Leu9354PRTJC virus 9Met Ala Pro Thr Lys Arg Lys Gly Glu Arg Lys Asp
Pro Val Gln Val1 5 10 15Pro Lys Leu Leu Ile Arg Gly Gly Val Glu Val
Leu Glu Val Lys Thr 20 25 30Gly Val Asp Ser Ile Thr Glu Val Glu Cys
Phe Leu Thr Pro Glu Met 35 40 45Gly Asp Pro Asp Glu His Leu Arg Gly
Phe Ser Lys Ser Ile Ser Ile 50 55 60Ser Asp Thr Phe Glu Ser Asp Ser
Pro Asn Lys Asp Met Leu Pro Cys65 70 75 80Tyr Ser Val Ala Arg
Ile Pro Leu Pro Asn Leu Asn Glu Asp Leu Thr 85 90 95Cys Gly Asn Ile
Leu Met Trp Glu Ala Val Thr Leu Lys Thr Glu Val 100 105 110Ile Gly
Val Thr Ser Leu Met Asn Val His Ser Asn Gly Gln Ala Thr 115 120
125His Asp Asn Gly Ala Gly Lys Pro Val Gln Gly Thr Ser Phe His Phe
130 135 140Phe Ser Val Gly Gly Glu Ala Leu Glu Leu Gln Gly Val Leu
Phe Asn145 150 155 160Tyr Arg Thr Lys Tyr Pro Asp Gly Thr Ile Phe
Pro Lys Asn Ala Thr 165 170 175Val Gln Ser Gln Val Met Asn Thr Glu
His Lys Ala Tyr Leu Asp Lys 180 185 190Asn Lys Ala Tyr Pro Val Glu
Cys Trp Val Pro Asp Pro Thr Arg Asn 195 200 205Glu Asn Thr Arg Tyr
Phe Gly Thr Leu Thr Gly Gly Glu Asn Val Pro 210 215 220Pro Val Leu
His Ile Thr Asn Thr Ala Thr Thr Val Leu Leu Asp Glu225 230 235
240Phe Gly Val Gly Pro Leu Cys Lys Gly Asp Asn Leu Tyr Leu Ser Ala
245 250 255Val Asp Val Cys Gly Met Phe Thr Asn Arg Leu Gly Ser Gln
Gln Trp 260 265 270Arg Gly Leu Ser Arg Tyr Phe Lys Val Gln Leu Arg
Lys Arg Arg Val 275 280 285Lys Asn Pro Tyr Pro Ile Ser Phe Leu Leu
Thr Asp Leu Ile Asn Arg 290 295 300Arg Thr Pro Arg Val Asp Gly Gln
Pro Met Tyr Gly Met Asp Ala Gln305 310 315 320Val Glu Glu Val Arg
Val Phe Glu Gly Thr Glu Glu Leu Pro Gly Asp 325 330 335Pro Asp Met
Met Arg Tyr Val Asp Lys Tyr Gly Gln Leu Gln Thr Lys 340 345 350Met
Leu10354PRTJC virus 10Met Ala Pro Thr Lys Arg Lys Gly Glu Arg Lys
Asp Pro Val Gln Val1 5 10 15Pro Lys Leu Leu Ile Arg Gly Gly Val Glu
Val Leu Glu Val Lys Thr 20 25 30Gly Val Asp Ser Ile Thr Glu Val Glu
Cys Phe Leu Thr Pro Glu Met 35 40 45Gly Asp Pro Asp Glu His Leu Arg
Gly Phe Ser Lys Ser Ile Ser Ile 50 55 60Ser Asp Thr Phe Glu Ser Asp
Ser Pro Ser Lys Asp Met Leu Pro Cys65 70 75 80Tyr Ser Val Ala Arg
Ile Pro Leu Pro Asn Leu Asn Glu Asp Leu Thr 85 90 95Cys Gly Asn Ile
Leu Met Trp Glu Ala Val Thr Leu Lys Thr Glu Val 100 105 110Ile Gly
Val Thr Ser Leu Met Asn Val His Ser Asn Gly Gln Ala Ala 115 120
125His Asp Asn Gly Ala Gly Lys Pro Val Gln Gly Thr Ser Phe His Phe
130 135 140Phe Ser Val Gly Gly Glu Ala Leu Glu Leu Gln Gly Val Val
Phe Asn145 150 155 160Tyr Arg Thr Lys Tyr Pro Asp Gly Thr Ile Phe
Pro Lys Asn Ala Thr 165 170 175Val Gln Ser Gln Val Met Asn Thr Glu
His Lys Ala Tyr Leu Asp Lys 180 185 190Asn Lys Ala Tyr Pro Val Glu
Cys Trp Val Pro Asp Pro Thr Arg Asn 195 200 205Glu Asn Thr Arg Tyr
Phe Gly Thr Leu Thr Gly Gly Glu Asn Val Pro 210 215 220Pro Val Leu
His Ile Thr Asn Thr Ala Thr Thr Val Leu Leu Asp Glu225 230 235
240Phe Gly Val Gly Pro Leu Cys Lys Gly Asp Asn Leu Tyr Leu Ser Ala
245 250 255Val Asp Val Cys Gly Met Phe Thr Asn Arg Ser Gly Ser Gln
Gln Trp 260 265 270Arg Gly Leu Ser Arg Tyr Phe Lys Val Gln Leu Arg
Lys Arg Arg Val 275 280 285Lys Asn Pro Tyr Pro Ile Ser Phe Leu Leu
Thr Asp Leu Ile Asn Arg 290 295 300Arg Thr Pro Arg Val Asp Gly Gln
Pro Met Tyr Gly Met Asp Ala Gln305 310 315 320Val Glu Glu Val Arg
Val Phe Glu Gly Thr Glu Glu Leu Pro Gly Asp 325 330 335Pro Asp Met
Met Arg Tyr Val Asp Lys Tyr Gly Gln Leu Gln Thr Lys 340 345 350Met
Leu11354PRTJC virus 11Met Ala Pro Thr Lys Arg Lys Gly Glu Arg Lys
Asp Pro Val Gln Val1 5 10 15Pro Lys Leu Leu Ile Arg Gly Gly Val Glu
Val Leu Glu Val Lys Thr 20 25 30Gly Val Asp Ser Ile Thr Glu Val Glu
Cys Phe Leu Thr Pro Glu Met 35 40 45Gly Asp Pro Asp Glu His Leu Arg
Gly Phe Ser Lys Ser Ile Ser Ile 50 55 60Ser Asp Thr Phe Glu Ser Asp
Ser Pro Asn Lys Asp Met Leu Pro Cys65 70 75 80Tyr Ser Val Ala Arg
Ile Pro Leu Pro Asn Leu Asn Glu Asp Leu Thr 85 90 95Cys Gly Asn Ile
Leu Met Trp Glu Ala Val Thr Leu Lys Thr Glu Val 100 105 110Leu Gly
Val Thr Thr Leu Met Asn Val His Ser Asn Gly Gln Ala Thr 115 120
125His Asp Asn Gly Ala Gly Lys Pro Val Gln Gly Thr Ser Phe His Phe
130 135 140Phe Ser Val Gly Gly Glu Ala Leu Glu Leu Gln Gly Val Val
Phe Asn145 150 155 160Tyr Arg Thr Lys Tyr Pro Asp Gly Thr Ile Phe
Pro Lys Asn Ala Thr 165 170 175Val Gln Ser Gln Val Met Asn Thr Glu
His Lys Ala Tyr Leu Asp Lys 180 185 190Asn Lys Ala Tyr Pro Val Glu
Cys Trp Val Pro Asp Pro Thr Arg Asn 195 200 205Glu Asn Thr Arg Tyr
Phe Gly Thr Leu Thr Gly Gly Glu Asn Val Pro 210 215 220Pro Val Leu
His Ile Thr Asn Thr Ala Thr Thr Val Leu Leu Asp Glu225 230 235
240Phe Gly Val Gly Pro Leu Cys Lys Gly Asp Asn Leu Tyr Leu Ser Ala
245 250 255Val Asp Val Cys Gly Met Phe Thr Asn Arg Ser Gly Phe Gln
Gln Trp 260 265 270Arg Gly Leu Ser Arg Tyr Phe Lys Val Gln Leu Arg
Lys Arg Arg Val 275 280 285Lys Asn Pro Tyr Pro Ile Ser Phe Leu Leu
Thr Asp Leu Ile Asn Arg 290 295 300Arg Thr Pro Arg Val Asp Gly Gln
Pro Met Tyr Gly Met Asp Ala Gln305 310 315 320Val Glu Glu Val Arg
Val Phe Glu Gly Thr Glu Glu Leu Pro Gly Asp 325 330 335Pro Asp Met
Met Arg Tyr Val Asp Arg Tyr Gly Gln Leu Gln Thr Lys 340 345 350Met
Leu12354PRTJC virus 12Met Ala Pro Thr Lys Arg Lys Gly Glu Arg Lys
Asp Pro Val Gln Val1 5 10 15Pro Lys Leu Leu Ile Arg Gly Gly Val Glu
Val Leu Glu Val Lys Thr 20 25 30Gly Val Asp Ser Ile Thr Glu Val Glu
Cys Phe Leu Thr Pro Glu Met 35 40 45Gly Asp Pro Asp Glu His Leu Arg
Gly Phe Ser Lys Ser Ile Ser Ile 50 55 60Ser Asp Thr Phe Glu Ser Asp
Ser Pro Asn Lys Asp Met Leu Pro Cys65 70 75 80Tyr Ser Val Ala Arg
Ile Pro Leu Pro Asn Leu Asn Glu Asp Leu Thr 85 90 95Cys Gly Asn Ile
Leu Met Trp Glu Ala Val Thr Leu Lys Thr Glu Val 100 105 110Leu Gly
Val Thr Thr Leu Met Asn Val His Ser Asn Gly Gln Ala Thr 115 120
125His Asp Asn Gly Ala Gly Lys Pro Val Gln Gly Thr Ser Phe His Phe
130 135 140Phe Ser Val Gly Gly Glu Ala Leu Glu Leu Gln Gly Val Val
Phe Asn145 150 155 160Tyr Arg Thr Lys Tyr Pro Asp Gly Thr Ile Phe
Pro Lys Asn Ala Thr 165 170 175Val Gln Ser Gln Val Met Asn Thr Glu
His Lys Ala Tyr Leu Asp Lys 180 185 190Asn Lys Ala Tyr Pro Val Glu
Cys Trp Val Pro Asp Pro Thr Arg Asn 195 200 205Glu Asn Thr Arg Tyr
Phe Gly Thr Leu Thr Gly Gly Glu Asn Val Pro 210 215 220Pro Val Leu
His Ile Thr Asn Thr Ala Thr Thr Val Leu Leu Asp Glu225 230 235
240Phe Gly Val Gly Pro Leu Cys Lys Gly Asp Asn Leu Tyr Leu Ser Ala
245 250 255Val Asp Val Cys Gly Met Phe Thr Asn Arg Ser Gly Ser Gln
Gln Trp 260 265 270Arg Gly Leu Ser Arg Tyr Phe Lys Val Gln Leu Arg
Lys Arg Arg Val 275 280 285Lys Asn Pro Tyr Pro Ile Ser Phe Leu Leu
Thr Asp Leu Ile Asn Arg 290 295 300Arg Thr Pro Arg Val Asp Gly Gln
Pro Met Tyr Gly Met Asp Ala Gln305 310 315 320Val Glu Glu Val Arg
Val Phe Glu Gly Thr Glu Glu Leu Pro Gly Asp 325 330 335Pro Asp Met
Met Arg Tyr Val Asp Arg Tyr Gly Gln Leu Gln Thr Lys 340 345 350Met
Leu13354PRTJC virus 13Met Ala Pro Thr Lys Arg Lys Gly Glu Arg Lys
Asp Pro Val Gln Val1 5 10 15Pro Lys Leu Leu Ile Arg Gly Gly Val Glu
Val Leu Glu Val Lys Thr 20 25 30Gly Val Asp Ser Ile Thr Glu Val Glu
Cys Phe Leu Thr Pro Glu Met 35 40 45Gly Asp Pro Asp Glu His Leu Arg
Gly Phe Ser Lys Ser Ile Ser Ile 50 55 60Ser Asp Thr Phe Glu Ser Asp
Ser Pro Asn Lys Asp Met Leu Pro Cys65 70 75 80Tyr Ser Val Ala Arg
Ile Pro Leu Pro Asn Leu Asn Glu Asp Leu Thr 85 90 95Cys Gly Asn Ile
Leu Met Trp Glu Ala Val Thr Leu Lys Thr Glu Val 100 105 110Leu Gly
Val Thr Thr Leu Met Asn Val His Ser Asn Gly Gln Ala Thr 115 120
125His Asp Asn Gly Ala Gly Lys Pro Val Gln Gly Thr Ser Phe His Phe
130 135 140Phe Ser Val Gly Gly Glu Ala Leu Glu Leu Gln Gly Val Val
Phe Asn145 150 155 160Tyr Arg Thr Lys Tyr Pro Asp Gly Thr Ile Phe
Pro Lys Asn Ala Thr 165 170 175Val Gln Ser Gln Val Met Asn Thr Glu
His Lys Ala Tyr Leu Asp Lys 180 185 190Asn Lys Ala Tyr Pro Val Glu
Cys Trp Val Pro Asp Pro Thr Arg Asn 195 200 205Glu Asn Thr Arg Tyr
Phe Gly Thr Leu Thr Gly Gly Glu Asn Val Pro 210 215 220Pro Val Leu
His Ile Thr Asn Thr Ala Thr Thr Val Leu Leu Asp Glu225 230 235
240Phe Gly Val Gly Pro Leu Cys Lys Gly Asp Asn Leu Tyr Leu Ser Ala
245 250 255Val Asp Val Cys Gly Met Phe Thr Asn Arg Ser Gly Ser Gln
Gln Trp 260 265 270Arg Gly Leu Ser Arg Tyr Phe Lys Val Gln Leu Arg
Lys Arg Arg Val 275 280 285Lys Asn Pro Tyr Pro Ile Ser Phe Leu Leu
Thr Asp Leu Ile Asn Arg 290 295 300Arg Thr Pro Arg Val Asp Gly Gln
Pro Met Tyr Gly Met Asp Ala Gln305 310 315 320Val Glu Glu Val Arg
Val Phe Glu Gly Thr Glu Glu Leu Pro Gly Asp 325 330 335Pro Asp Met
Met Arg Tyr Val Asp Arg Tyr Gly Gln Leu Gln Thr Lys 340 345 350Met
Leu14354PRTJC virus 14Met Ala Pro Thr Lys Arg Lys Gly Glu Arg Lys
Asp Pro Val Gln Val1 5 10 15Pro Lys Leu Leu Ile Arg Gly Gly Val Glu
Val Leu Glu Val Lys Thr 20 25 30Gly Val Asp Ser Ile Thr Glu Val Glu
Cys Phe Leu Thr Pro Glu Met 35 40 45Gly Asp Pro Asp Glu His Leu Arg
Gly Phe Ser Lys Ser Ile Ser Ile 50 55 60Ser Asp Thr Phe Glu Ser Asp
Ser Pro Asn Lys Asp Met Leu Pro Cys65 70 75 80Tyr Ser Val Ala Arg
Ile Pro Leu Pro Asn Leu Asn Glu Asp Leu Thr 85 90 95Cys Gly Asn Ile
Leu Met Trp Glu Ala Val Thr Leu Lys Thr Glu Val 100 105 110Leu Gly
Val Thr Thr Leu Met Asn Val His Ser Asn Gly Gln Ala Thr 115 120
125His Asp Asn Gly Ala Gly Lys Pro Val Gln Gly Thr Ser Phe His Phe
130 135 140Phe Ser Val Gly Gly Glu Ala Leu Glu Leu Gln Gly Val Val
Phe Asn145 150 155 160Tyr Arg Thr Lys Tyr Pro Asp Gly Thr Ile Phe
Pro Lys Asn Ala Thr 165 170 175Val Gln Ser Gln Val Met Asn Thr Glu
His Lys Ala Tyr Leu Asp Lys 180 185 190Asn Lys Ala Tyr Pro Val Glu
Cys Trp Val Pro Asp Pro Thr Arg Asn 195 200 205Glu Asn Thr Arg Tyr
Phe Gly Thr Leu Thr Gly Gly Glu Asn Val Pro 210 215 220Pro Val Leu
His Ile Thr Asn Thr Ala Thr Thr Val Leu Leu Asp Glu225 230 235
240Phe Gly Val Gly Pro Leu Cys Lys Gly Asp Asn Leu Tyr Leu Ser Ala
245 250 255Val Asp Val Cys Gly Met Phe Thr Asn Arg Ser Gly Phe Gln
Gln Trp 260 265 270Arg Gly Leu Ser Arg Tyr Phe Lys Val Gln Leu Arg
Lys Arg Arg Val 275 280 285Lys Asn Pro Tyr Pro Ile Ser Phe Leu Leu
Thr Asp Leu Ile Asn Arg 290 295 300Arg Thr Pro Arg Val Asp Gly Gln
Pro Met Tyr Gly Met Asp Ala Gln305 310 315 320Val Glu Glu Val Arg
Val Phe Glu Gly Thr Glu Glu Leu Pro Gly Asp 325 330 335Pro Asp Met
Met Arg Tyr Val Asp Arg Tyr Gly Gln Leu Gln Thr Lys 340 345 350Met
Leu15354PRTJC virus 15Met Ala Pro Thr Lys Arg Lys Gly Glu Arg Lys
Asp Pro Val Gln Val1 5 10 15Pro Lys Leu Leu Ile Arg Gly Gly Val Glu
Val Leu Glu Val Lys Thr 20 25 30Gly Val Asp Ser Ile Thr Glu Val Glu
Cys Phe Leu Thr Pro Glu Met 35 40 45Gly Asp Pro Asp Glu His Leu Arg
Gly Phe Ser Lys Ser Ile Ser Ile 50 55 60Ser Asp Thr Phe Glu Ser Asp
Ser Pro Asn Lys Asp Met Leu Pro Cys65 70 75 80Tyr Ser Val Ala Arg
Ile Pro Leu Pro Asn Leu Asn Glu Asp Leu Thr 85 90 95Cys Gly Asn Ile
Leu Met Trp Glu Ala Val Thr Leu Lys Thr Glu Val 100 105 110Ile Gly
Val Thr Thr Leu Met Asn Val His Ser Asn Gly Gln Ala Thr 115 120
125His Asp Asn Gly Ala Gly Lys Pro Val Gln Gly Thr Ser Phe His Phe
130 135 140Phe Ser Val Gly Gly Glu Ala Leu Glu Leu Gln Gly Val Val
Phe Asn145 150 155 160Tyr Arg Thr Lys Tyr Pro Asp Gly Thr Ile Phe
Pro Lys Asn Ala Thr 165 170 175Val Gln Ser Gln Val Met Asn Thr Glu
His Lys Ala Tyr Leu Asp Lys 180 185 190Asn Lys Ala Tyr Pro Val Glu
Cys Trp Val Pro Asp Pro Thr Arg Asn 195 200 205Glu Asn Thr Arg Tyr
Phe Gly Thr Leu Thr Gly Gly Glu Asn Val Pro 210 215 220Pro Val Leu
His Ile Thr Asn Thr Ala Thr Thr Val Leu Leu Asp Glu225 230 235
240Phe Gly Val Gly Pro Leu Cys Lys Gly Asp Asn Leu Tyr Leu Ser Ala
245 250 255Val Asp Val Cys Gly Met Phe Thr Asn Arg Ser Gly Tyr Gln
Gln Trp 260 265 270Arg Gly Leu Ser Arg Tyr Phe Lys Val Gln Leu Arg
Lys Arg Arg Val 275 280 285Lys Asn Pro Tyr Pro Ile Ser Phe Leu Leu
Thr Asp Leu Ile Asn Arg 290 295 300Arg Thr Pro Arg Val Asp Gly Gln
Pro Met Tyr Gly Met Asp Ala Gln305 310 315 320Val Glu Glu Val Arg
Val Phe Glu Gly Thr Glu Glu Leu Pro Gly Asp 325 330 335Pro Asp Met
Met Arg Tyr Val Asp Arg Tyr Gly Gln Leu Gln Thr Lys 340 345 350Met
Leu16354PRTJC virus 16Met Ala Pro Thr Lys Arg Lys Gly Glu Arg Lys
Asp Pro Val Gln Val1 5 10 15Pro Lys Leu Leu Ile Arg Gly Gly Val Glu
Val Leu Glu Val Lys Thr 20 25 30Gly Val Asp Ser Ile Thr Glu Val Glu
Cys Phe Leu Thr Pro Glu Met 35 40 45Gly Asp Pro Asp Glu His Leu Arg
Gly Phe Ser Lys Ser Ile Ser Ile 50 55 60Ser Asp Thr Phe Glu Ser Asp
Ser Pro Asn Lys Asp Met Leu Pro Cys65
70 75 80Tyr Ser Val Ala Arg Ile Pro Leu Pro Asn Leu Asn Glu Asp Leu
Thr 85 90 95Cys Gly Asn Ile Leu Met Trp Glu Ala Val Thr Leu Lys Thr
Glu Val 100 105 110Leu Gly Val Thr Thr Leu Met Asn Val His Ser Asn
Gly Gln Ala Thr 115 120 125His Asp Asn Gly Ala Gly Lys Pro Val Gln
Gly Thr Ser Phe His Phe 130 135 140Phe Ser Val Gly Gly Glu Ala Leu
Glu Leu Gln Gly Val Val Phe Asn145 150 155 160Tyr Arg Thr Lys Tyr
Pro Asp Gly Thr Ile Phe Pro Lys Asn Ala Thr 165 170 175Val Gln Ser
Gln Val Met Asn Thr Glu His Lys Ala Tyr Leu Asp Lys 180 185 190Asn
Lys Ala Tyr Pro Val Glu Cys Trp Val Pro Asp Pro Thr Arg Asn 195 200
205Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr Gly Gly Glu Asn Val Pro
210 215 220Pro Val Leu His Ile Thr Asn Thr Ala Thr Thr Val Leu Leu
Asp Glu225 230 235 240Phe Gly Val Gly Pro Leu Cys Lys Gly Asp Asn
Leu Tyr Leu Ser Ala 245 250 255Val Asp Val Cys Gly Met Phe Thr Asn
Arg Ser Gly Phe Gln Gln Trp 260 265 270Arg Gly Leu Ser Arg Tyr Phe
Lys Val Gln Leu Arg Lys Arg Arg Val 275 280 285Lys Asn Pro Tyr Pro
Ile Ser Phe Leu Leu Thr Asp Leu Ile Asn Arg 290 295 300Arg Thr Pro
Arg Val Asp Gly Gln Pro Met Tyr Gly Met Asp Ala Gln305 310 315
320Val Glu Glu Val Arg Val Phe Glu Gly Thr Glu Glu Leu Pro Gly Asp
325 330 335Pro Asp Met Met Arg Tyr Val Asp Arg Tyr Gly Gln Leu Gln
Thr Lys 340 345 350Met Leu17354PRTJC virus 17Met Ala Pro Thr Lys
Arg Lys Gly Glu Arg Lys Asp Pro Val Gln Val1 5 10 15Pro Lys Leu Leu
Ile Arg Gly Gly Val Glu Val Leu Glu Val Lys Thr 20 25 30Gly Val Asp
Ser Ile Thr Glu Val Glu Cys Phe Leu Thr Pro Glu Met 35 40 45Gly Asp
Pro Asp Glu His Leu Arg Gly Phe Ser Lys Ser Ile Ser Ile 50 55 60Ser
Asp Thr Phe Glu Ser Asp Ser Pro Asn Lys Asp Met Leu Pro Cys65 70 75
80Tyr Ser Val Ala Arg Ile Pro Leu Pro Asn Leu Asn Glu Asp Leu Thr
85 90 95Cys Gly Asn Ile Leu Met Trp Glu Ala Val Thr Leu Lys Thr Glu
Val 100 105 110Ile Gly Val Thr Thr Leu Met Asn Val His Ser Asn Gly
Gln Ala Thr 115 120 125His Asp Asn Gly Ala Gly Lys Pro Val Gln Gly
Thr Ser Phe His Phe 130 135 140Phe Ser Val Gly Gly Glu Ala Leu Glu
Leu Gln Gly Val Val Phe Asn145 150 155 160Tyr Arg Thr Lys Tyr Pro
Asp Gly Thr Ile Phe Pro Lys Asn Ala Thr 165 170 175Val Gln Ser Gln
Val Met Asn Thr Glu His Lys Ala Tyr Leu Asp Lys 180 185 190Asn Lys
Ala Tyr Pro Val Glu Cys Trp Val Pro Asp Pro Thr Arg Asn 195 200
205Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr Gly Gly Glu Asn Val Pro
210 215 220Pro Val Leu His Ile Thr Asn Thr Ala Thr Thr Val Leu Leu
Asp Glu225 230 235 240Phe Gly Val Gly Pro Leu Cys Lys Gly Asp Asn
Leu Tyr Leu Ser Ala 245 250 255Val Asp Val Cys Gly Met Phe Thr Asn
Arg Ser Gly Tyr Gln Gln Trp 260 265 270Arg Gly Leu Ser Arg Tyr Phe
Lys Val Gln Leu Arg Lys Arg Arg Val 275 280 285Lys Asn Pro Tyr Pro
Ile Ser Phe Leu Leu Thr Asp Leu Ile Asn Arg 290 295 300Arg Thr Pro
Arg Val Asp Gly Gln Pro Met Tyr Gly Met Asp Ala Gln305 310 315
320Val Glu Glu Val Arg Val Phe Glu Gly Thr Glu Glu Leu Pro Gly Asp
325 330 335Pro Asp Met Met Arg Tyr Val Asp Arg Tyr Gly Gln Leu Gln
Thr Lys 340 345 350Met Leu18354PRTJC virus 18Met Ala Pro Thr Lys
Arg Lys Gly Glu Arg Lys Asp Pro Val Gln Val1 5 10 15Pro Lys Leu Leu
Ile Arg Gly Gly Val Glu Val Leu Glu Val Lys Thr 20 25 30Gly Val Asp
Ser Ile Thr Glu Val Glu Cys Phe Leu Thr Pro Glu Met 35 40 45Gly Asp
Pro Asp Glu His Leu Arg Gly Phe Ser Lys Ser Ile Ser Ile 50 55 60Ser
Asp Thr Phe Glu Ser Asp Ser Pro Ser Lys Asp Met Leu Pro Cys65 70 75
80Tyr Ser Val Ala Arg Ile Pro Leu Pro Asn Leu Asn Glu Asp Leu Thr
85 90 95Cys Gly Asn Ile Leu Met Trp Glu Ala Val Thr Leu Lys Thr Glu
Val 100 105 110Ile Gly Val Thr Ser Leu Met Asn Val His Ser Asn Gly
Gln Ala Ala 115 120 125His Asp Asn Gly Ala Gly Lys Pro Val Gln Gly
Thr Ser Phe His Phe 130 135 140Phe Ser Val Gly Gly Glu Ala Leu Glu
Leu Gln Gly Val Val Phe Asn145 150 155 160Tyr Arg Thr Lys Tyr Pro
Asp Gly Thr Ile Phe Pro Lys Asn Ala Thr 165 170 175Val Gln Ser Gln
Val Met Asn Thr Glu His Lys Ala Tyr Leu Asp Lys 180 185 190Asn Lys
Ala Tyr Pro Val Glu Cys Trp Val Pro Asp Pro Thr Arg Asn 195 200
205Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr Gly Gly Glu Asn Val Pro
210 215 220Pro Val Leu His Ile Thr Asn Thr Ala Thr Thr Val Leu Leu
Asp Glu225 230 235 240Phe Gly Val Gly Pro Leu Cys Lys Gly Asp Asn
Leu Tyr Leu Ser Ala 245 250 255Val Asp Val Cys Gly Met Phe Thr Asn
Arg Ser Gly Ser Gln Gln Trp 260 265 270Arg Gly Leu Ser Arg Tyr Phe
Lys Val Gln Leu Arg Lys Arg Arg Val 275 280 285Lys Asn Pro Tyr Pro
Ile Ser Phe Leu Leu Thr Asp Leu Ile Asn Arg 290 295 300Arg Thr Pro
Arg Val Asp Gly Gln Pro Met Tyr Gly Met Asp Ala Gln305 310 315
320Val Glu Glu Val Arg Val Phe Glu Gly Thr Glu Glu Leu Pro Gly Asp
325 330 335Pro Asp Met Met Arg Tyr Val Asp Lys Tyr Gly Gln Leu Gln
Thr Lys 340 345 350Met Leu19354PRTJC virus 19Met Ala Pro Thr Lys
Arg Lys Gly Glu Arg Lys Asp Pro Val Gln Val1 5 10 15Pro Lys Leu Leu
Ile Arg Gly Gly Val Glu Val Leu Glu Val Lys Thr 20 25 30Gly Val Asp
Ser Ile Thr Glu Val Glu Cys Phe Leu Thr Pro Glu Met 35 40 45Gly Asp
Pro Asp Glu His Leu Arg Gly Phe Ser Lys Ser Ile Ser Ile 50 55 60Ser
Asp Thr Phe Glu Ser Asp Ser Pro Ser Lys Asp Met Leu Pro Cys65 70 75
80Tyr Ser Val Ala Arg Ile Pro Leu Pro Asn Leu Asn Glu Asp Leu Thr
85 90 95Cys Gly Asn Ile Leu Met Trp Glu Ala Val Thr Leu Lys Thr Glu
Val 100 105 110Ile Gly Val Thr Ser Leu Met Asn Val His Ser Asn Gly
Gln Ala Ala 115 120 125His Asp Asn Gly Ala Gly Lys Pro Val Gln Gly
Thr Ser Phe His Phe 130 135 140Phe Ser Val Gly Gly Glu Ala Leu Glu
Leu Gln Gly Val Val Phe Asn145 150 155 160Tyr Arg Thr Lys Tyr Pro
Asp Gly Thr Ile Phe Pro Lys Asn Ala Thr 165 170 175Val Gln Ser Gln
Val Met Asn Thr Glu His Lys Ala Tyr Leu Asp Lys 180 185 190Asn Lys
Ala Tyr Pro Val Glu Cys Trp Val Pro Asp Pro Thr Arg Asn 195 200
205Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr Gly Gly Glu Asn Val Pro
210 215 220Pro Val Leu His Ile Thr Asn Thr Ala Thr Thr Val Leu Leu
Asp Glu225 230 235 240Phe Gly Val Gly Pro Leu Cys Lys Gly Asp Asn
Leu Tyr Leu Ser Ala 245 250 255Val Asp Val Cys Gly Met Phe Thr Asn
Arg Ser Gly Phe Gln Gln Trp 260 265 270Arg Gly Leu Ser Arg Tyr Phe
Lys Val Gln Leu Arg Lys Arg Arg Val 275 280 285Lys Asn Pro Tyr Pro
Ile Ser Phe Leu Leu Thr Asp Leu Ile Asn Arg 290 295 300Arg Thr Pro
Arg Val Asp Gly Gln Pro Met Tyr Gly Met Asp Ala Gln305 310 315
320Val Glu Glu Val Arg Val Phe Glu Gly Thr Glu Glu Leu Pro Gly Asp
325 330 335Pro Asp Met Met Arg Tyr Val Asp Lys Tyr Gly Gln Leu Gln
Thr Lys 340 345 350Met Leu20354PRTJC virus 20Met Ala Pro Thr Lys
Arg Lys Gly Glu Arg Lys Asp Pro Val Gln Val1 5 10 15Pro Lys Leu Leu
Ile Arg Gly Gly Val Glu Val Leu Glu Val Lys Thr 20 25 30Gly Val Asp
Ser Ile Thr Glu Val Glu Cys Phe Leu Thr Pro Glu Met 35 40 45Gly Asp
Pro Asp Glu His Leu Arg Gly Phe Ser Lys Ser Ile Ser Ile 50 55 60Ser
Asp Thr Phe Glu Ser Asp Ser Pro Ser Lys Asp Met Leu Pro Cys65 70 75
80Tyr Ser Val Ala Arg Ile Pro Leu Pro Asn Leu Asn Glu Asp Leu Thr
85 90 95Cys Gly Asn Ile Leu Met Trp Glu Ala Val Thr Leu Lys Thr Glu
Val 100 105 110Ile Gly Val Thr Ser Leu Met Asn Val His Ser Asn Gly
Gln Ala Ala 115 120 125His Asp Asn Gly Ala Gly Lys Pro Val Gln Gly
Thr Ser Phe His Phe 130 135 140Phe Ser Val Gly Gly Glu Ala Leu Glu
Leu Gln Gly Val Val Phe Asn145 150 155 160Tyr Arg Thr Lys Tyr Pro
Asp Gly Thr Ile Phe Pro Lys Asn Ala Thr 165 170 175Val Gln Ser Gln
Val Met Asn Thr Glu His Lys Ala Tyr Leu Asp Lys 180 185 190Asn Lys
Ala Tyr Pro Val Glu Cys Trp Val Pro Asp Pro Thr Arg Asn 195 200
205Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr Gly Gly Glu Asn Val Pro
210 215 220Pro Val Leu His Ile Thr Asn Thr Ala Thr Thr Val Leu Leu
Asp Glu225 230 235 240Phe Gly Val Gly Pro Leu Cys Lys Gly Asp Asn
Leu Tyr Leu Ser Ala 245 250 255Val Asp Val Cys Gly Met Phe Thr Asn
Arg Ser Gly Phe Gln Gln Trp 260 265 270Arg Gly Leu Ser Arg Tyr Phe
Lys Val Gln Leu Arg Lys Arg Arg Val 275 280 285Lys Asn Pro Tyr Pro
Ile Ser Phe Leu Leu Thr Asp Leu Ile Asn Arg 290 295 300Arg Thr Pro
Arg Val Asp Gly Gln Pro Met Tyr Gly Met Asp Ala Gln305 310 315
320Val Glu Glu Val Arg Val Phe Glu Gly Thr Glu Glu Leu Pro Gly Asp
325 330 335Pro Asp Met Met Arg Tyr Val Asp Lys Tyr Gly Gln Leu Gln
Thr Lys 340 345 350Met Leu21344PRTJC virus 21Met Gly Ala Ala Leu
Ala Leu Leu Gly Asp Leu Val Ala Thr Val Ser1 5 10 15Glu Ala Ala Ala
Ala Thr Gly Phe Ser Val Ala Glu Ile Ala Ala Gly 20 25 30Glu Ala Ala
Ala Thr Ile Glu Val Glu Ile Ala Ser Leu Ala Thr Val 35 40 45Glu Gly
Ile Thr Ser Thr Ser Glu Ala Ile Ala Ala Ile Gly Leu Thr 50 55 60Pro
Glu Thr Tyr Ala Val Ile Thr Gly Ala Pro Gly Ala Val Ala Gly65 70 75
80Phe Ala Ala Leu Val Gln Thr Val Thr Gly Gly Ser Ala Ile Ala Gln
85 90 95Leu Gly Tyr Arg Phe Phe Ala Asp Trp Asp His Lys Val Ser Thr
Val 100 105 110Gly Leu Phe Gln Gln Pro Ala Met Ala Leu Gln Leu Phe
Asn Pro Glu 115 120 125Asp Tyr Tyr Asp Ile Leu Phe Pro Gly Val Asn
Ala Phe Val Asn Asn 130 135 140Ile His Tyr Leu Asp Pro Arg His Trp
Gly Pro Ser Leu Phe Ser Thr145 150 155 160Ile Ser Gln Ala Phe Trp
Asn Leu Val Arg Asp Asp Leu Pro Ser Leu 165 170 175Thr Ser Gln Glu
Ile Gln Arg Arg Thr Gln Lys Leu Phe Val Glu Ser 180 185 190Leu Ala
Arg Phe Leu Glu Glu Thr Thr Trp Ala Ile Val Asn Ser Pro 195 200
205Val Asn Leu Tyr Asn Tyr Ile Ser Asp Tyr Tyr Ser Arg Leu Ser Pro
210 215 220Val Arg Pro Ser Met Val Arg Gln Val Ala Gln Arg Glu Gly
Thr Tyr225 230 235 240Ile Ser Phe Gly His Ser Tyr Thr Gln Ser Ile
Asp Asp Ala Asp Ser 245 250 255Ile Gln Glu Val Thr Gln Arg Leu Asp
Leu Lys Thr Pro Asn Val Gln 260 265 270Ser Gly Glu Phe Ile Glu Lys
Ser Ile Ala Pro Gly Gly Ala Asn Gln 275 280 285Arg Ser Ala Pro Gln
Trp Met Leu Pro Leu Leu Leu Gly Leu Tyr Gly 290 295 300Thr Val Thr
Pro Ala Leu Glu Ala Tyr Glu Asp Gly Pro Asn Lys Lys305 310 315
320Lys Arg Arg Lys Glu Gly Pro Arg Ala Ser Ser Lys Thr Ser Tyr Lys
325 330 335Arg Arg Ser Arg Ser Ser Arg Ser 34022354PRTJC virus
22Met Ala Pro Thr Lys Arg Lys Gly Glu Arg Lys Asp Pro Val Gln Val1
5 10 15Pro Lys Leu Leu Ile Arg Gly Gly Val Glu Val Leu Glu Val Lys
Thr 20 25 30Gly Val Asp Ser Ile Thr Glu Val Glu Cys Phe Leu Thr Pro
Glu Met 35 40 45Gly Asp Pro Asp Glu His Leu Arg Gly Phe Ser Lys Ser
Ile Ser Ile 50 55 60Ser Asp Thr Phe Glu Ser Asp Ser Pro Asn Lys Asp
Met Leu Pro Cys65 70 75 80Tyr Ser Val Ala Arg Ile Pro Leu Pro Asn
Leu Asn Glu Asp Leu Thr 85 90 95Cys Gly Asn Ile Leu Met Trp Glu Ala
Val Thr Leu Lys Thr Glu Val 100 105 110Ile Gly Val Thr Thr Leu Met
Asn Val His Ser Asn Gly Gln Ala Thr 115 120 125His Asp Asn Gly Ala
Gly Lys Pro Val Gln Gly Thr Ser Phe His Phe 130 135 140Phe Ser Val
Gly Gly Glu Ala Leu Glu Leu Gln Gly Val Val Phe Asn145 150 155
160Tyr Arg Thr Lys Tyr Pro Asp Gly Thr Ile Phe Pro Lys Asn Ala Thr
165 170 175Val Gln Ser Gln Val Met Asn Thr Glu His Lys Ala Tyr Leu
Asp Lys 180 185 190Asn Lys Ala Tyr Pro Val Glu Cys Trp Val Pro Asp
Pro Thr Arg Asn 195 200 205Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr
Gly Gly Glu Asn Val Pro 210 215 220Pro Val Leu His Ile Thr Asn Thr
Ala Thr Thr Val Leu Leu Asp Glu225 230 235 240Phe Gly Val Gly Pro
Leu Cys Lys Gly Asp Asn Leu Tyr Leu Ser Ala 245 250 255Val Asp Val
Cys Gly Met Phe Thr Asn Arg Ser Gly Ser Gln Gln Trp 260 265 270Arg
Gly Leu Ser Arg Tyr Phe Lys Val Gln Leu Arg Lys Arg Arg Val 275 280
285Lys Asn Pro Tyr Pro Ile Ser Phe Leu Leu Thr Asp Leu Ile Asn Arg
290 295 300Arg Thr Pro Arg Val Asp Gly Gln Pro Met Tyr Gly Met Asp
Ala Gln305 310 315 320Val Glu Glu Val Arg Val Phe Glu Gly Thr Glu
Glu Leu Pro Gly Asp 325 330 335Pro Asp Met Met Arg Tyr Val Asp Arg
Tyr Gly Gln Leu Gln Thr Lys 340 345 350Met Leu23354PRTJC virus
23Met Ala Pro Thr Lys Arg Lys Gly Glu Arg Lys Asp Pro Val Gln Val1
5 10 15Pro Lys Leu Leu Ile Arg Gly Gly Val Glu Val Leu Glu Val Lys
Thr 20 25 30Gly Val Asp Ser Ile Thr Glu Val Glu Cys Phe Leu Thr Pro
Glu Met 35 40 45Gly Asp Pro Asp Glu His Leu Arg Gly Phe Ser Lys Leu
Ile Ser Ile 50 55 60Ser Asp Thr Phe Glu Ser Asp Ser Pro Asn Lys Asp
Met Leu Pro Cys65
70 75 80Tyr Ser Val Ala Arg Ile Pro Leu Pro Asn Leu Asn Glu Asp Leu
Thr 85 90 95Cys Gly Asn Ile Leu Met Trp Glu Ala Val Thr Leu Lys Thr
Glu Val 100 105 110Ile Gly Val Thr Thr Leu Met Asn Val His Ser Asn
Gly Gln Ala Thr 115 120 125His Asp Asn Gly Ala Gly Lys Pro Val Gln
Gly Thr Ser Phe His Phe 130 135 140Phe Ser Val Gly Gly Glu Ala Leu
Glu Leu Gln Gly Val Val Phe Asn145 150 155 160Tyr Arg Thr Lys Tyr
Pro Asp Gly Thr Ile Phe Pro Lys Asn Ala Thr 165 170 175Val Gln Ser
Gln Val Met Asn Thr Glu His Lys Ala Tyr Leu Asp Lys 180 185 190Asn
Lys Ala Tyr Pro Val Glu Cys Trp Val Pro Asp Pro Thr Arg Asn 195 200
205Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr Gly Gly Glu Asn Val Pro
210 215 220Pro Val Leu His Ile Thr Asn Thr Ala Thr Thr Val Leu Leu
Asp Glu225 230 235 240Phe Gly Val Gly Pro Leu Cys Lys Gly Asp Asn
Leu Tyr Leu Ser Ala 245 250 255Val Asp Val Cys Gly Met Phe Thr Asn
Arg Ser Gly Ser Gln Gln Trp 260 265 270Arg Gly Leu Ser Arg Tyr Phe
Lys Val Gln Leu Arg Lys Arg Arg Val 275 280 285Lys Asn Pro Tyr Pro
Ile Ser Phe Leu Leu Thr Asp Leu Ile Asn Arg 290 295 300Arg Thr Pro
Arg Val Asp Gly Gln Pro Met Tyr Gly Met Asp Ala Gln305 310 315
320Val Glu Glu Val Arg Val Phe Glu Gly Thr Glu Glu Leu Pro Gly Asp
325 330 335Pro Asp Met Met Arg Tyr Val Asp Arg Tyr Gly Gln Leu Gln
Thr Lys 340 345 350Met Leu24354PRTJC virus 24Met Ala Pro Thr Lys
Arg Lys Gly Glu Arg Lys Asp Pro Val Gln Val1 5 10 15Pro Lys Leu Leu
Ile Arg Gly Gly Val Glu Val Leu Glu Val Lys Thr 20 25 30Gly Val Asp
Ser Ile Thr Glu Val Glu Cys Phe Leu Thr Pro Glu Met 35 40 45Gly Asp
Pro Asp Glu His Leu Arg Gly Phe Ser Lys Ser Ile Ser Ile 50 55 60Ser
Asp Thr Phe Glu Ser Asp Ser Pro Asn Lys Asp Met Leu Pro Cys65 70 75
80Tyr Ser Val Ala Arg Ile Pro Leu Pro Asn Leu Asn Glu Asp Leu Thr
85 90 95Cys Gly Asn Ile Leu Met Trp Glu Ala Val Thr Leu Lys Thr Glu
Val 100 105 110Ile Gly Val Thr Thr Leu Met Asn Val His Ser Asn Gly
Gln Ala Thr 115 120 125His Asp Asn Gly Ala Gly Lys Pro Val Gln Gly
Thr Ser Phe His Phe 130 135 140Phe Ser Val Gly Gly Glu Ala Leu Glu
Leu Gln Gly Val Val Phe Asn145 150 155 160Tyr Arg Thr Lys Tyr Pro
Asp Gly Thr Ile Phe Pro Lys Asn Ala Thr 165 170 175Val Gln Ser Gln
Val Met Asn Thr Glu His Lys Ala Tyr Leu Asp Lys 180 185 190Asn Lys
Ala Tyr Pro Val Glu Cys Trp Val Pro Asp Pro Thr Arg Asn 195 200
205Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr Gly Gly Glu Asn Val Pro
210 215 220Pro Val Leu His Ile Thr Asn Thr Ala Thr Thr Val Leu Leu
Asp Glu225 230 235 240Phe Gly Val Gly Pro Leu Cys Lys Gly Asp Asn
Leu Tyr Leu Ser Ala 245 250 255Val Asp Val Cys Gly Met Phe Thr Asn
Arg Ser Gly Ser Gln Gln Trp 260 265 270Arg Gly Leu Ser Arg Tyr Phe
Lys Val Gln Leu Arg Lys Arg Arg Val 275 280 285Lys Asn Pro Tyr Pro
Ile Ser Phe Leu Leu Thr Asp Leu Ile Asn Arg 290 295 300Arg Thr Pro
Arg Val Asp Gly Gln Pro Met Tyr Gly Met Asp Ala Gln305 310 315
320Val Glu Glu Val Arg Val Phe Glu Gly Thr Glu Glu Leu Pro Gly Asp
325 330 335Pro Asp Met Met Arg Tyr Val Asp Arg Tyr Gly Gln Leu Gln
Thr Lys 340 345 350Met Leu25354PRTJC virus 25Met Ala Pro Thr Lys
Arg Lys Gly Glu Arg Lys Asp Pro Val Gln Val1 5 10 15Pro Lys Leu Leu
Ile Arg Gly Gly Val Glu Val Leu Glu Val Lys Thr 20 25 30Gly Val Asp
Ser Ile Thr Glu Val Glu Cys Phe Leu Thr Pro Glu Met 35 40 45Gly Asp
Pro Asp Glu His Leu Arg Gly Phe Ser Lys Ser Ile Ser Ile 50 55 60Ser
Asp Thr Phe Glu Ser Asp Ser Pro Asn Lys Asp Met Leu Pro Cys65 70 75
80Tyr Ser Val Ala Arg Ile Pro Leu Pro Asn Leu Asn Glu Asp Leu Thr
85 90 95Cys Gly Asn Ile Leu Met Trp Glu Ala Val Thr Leu Lys Thr Glu
Val 100 105 110Leu Gly Val Thr Thr Leu Met Asn Val His Ser Asn Gly
Gln Ala Thr 115 120 125His Asp Asn Gly Ala Gly Lys Pro Val Gln Gly
Thr Ser Phe His Phe 130 135 140Phe Ser Val Gly Gly Glu Ala Leu Glu
Leu Gln Gly Val Val Phe Asn145 150 155 160Tyr Arg Thr Lys Tyr Pro
Asp Gly Thr Ile Phe Pro Lys Asn Ala Thr 165 170 175Val Gln Ser Gln
Val Met Asn Thr Glu His Lys Ala Tyr Leu Asp Lys 180 185 190Asn Lys
Ala Tyr Pro Val Glu Cys Trp Val Pro Asp Pro Thr Arg Asn 195 200
205Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr Gly Gly Glu Asn Val Pro
210 215 220Pro Val Leu His Ile Thr Asn Thr Ala Thr Thr Val Leu Leu
Asp Glu225 230 235 240Phe Gly Val Gly Pro Leu Cys Lys Gly Asp Asn
Leu Tyr Leu Ser Ala 245 250 255Val Asp Val Cys Gly Met Phe Thr Asn
Arg Ser Gly Ser Gln Gln Trp 260 265 270Arg Gly Leu Ser Arg Tyr Phe
Lys Val Gln Leu Arg Lys Arg Arg Val 275 280 285Lys Asn Pro Tyr Pro
Ile Ser Phe Leu Leu Thr Asp Leu Ile Asn Arg 290 295 300Arg Thr Pro
Arg Val Asp Gly Gln Pro Met Tyr Gly Met Asp Ala Gln305 310 315
320Val Glu Glu Val Arg Val Phe Glu Gly Thr Glu Glu Leu Pro Gly Asp
325 330 335Pro Asp Met Met Arg Tyr Val Asp Arg Tyr Gly Gln Leu Gln
Thr Lys 340 345 350Met Leu26354PRTJC virus 26Met Ala Pro Thr Lys
Arg Lys Gly Glu Arg Lys Asp Pro Val Gln Val1 5 10 15Pro Lys Leu Leu
Ile Arg Gly Gly Val Glu Val Leu Glu Val Lys Thr 20 25 30Gly Val Asp
Ser Ile Thr Glu Val Glu Cys Phe Leu Thr Pro Glu Met 35 40 45Gly Asp
Pro Asp Glu His Leu Arg Gly Phe Ser Lys Ser Ile Ser Ile 50 55 60Ser
Asp Thr Phe Glu Ser Asp Ser Pro Asn Lys Asp Met Leu Pro Cys65 70 75
80Tyr Ser Val Ala Arg Ile Pro Leu Pro Asn Leu Asn Glu Asp Leu Thr
85 90 95Cys Gly Asn Ile Leu Met Trp Glu Ala Val Thr Leu Lys Thr Glu
Val 100 105 110Leu Gly Val Thr Thr Leu Met Asn Val His Ser Asn Gly
Gln Ala Thr 115 120 125His Asp Asn Gly Ala Gly Lys Pro Val Gln Gly
Thr Ser Phe His Phe 130 135 140Phe Ser Val Gly Gly Glu Ala Leu Glu
Leu Gln Gly Val Val Phe Asn145 150 155 160Tyr Arg Thr Lys Tyr Pro
Asp Gly Thr Ile Phe Pro Lys Asn Ala Thr 165 170 175Val Gln Ser Gln
Val Met Asn Thr Glu His Lys Ala Tyr Leu Asp Lys 180 185 190Asn Lys
Ala Tyr Pro Val Glu Cys Trp Val Pro Asp Pro Thr Arg Asn 195 200
205Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr Gly Gly Glu Asn Val Pro
210 215 220Pro Val Leu His Ile Thr Asn Thr Ala Thr Thr Val Leu Leu
Asp Glu225 230 235 240Phe Gly Val Gly Pro Leu Cys Lys Gly Asp Asn
Leu Tyr Leu Ser Ala 245 250 255Val Asp Val Cys Gly Met Phe Thr Asn
Arg Ser Gly Tyr Gln Gln Trp 260 265 270Arg Gly Leu Ser Arg Tyr Phe
Lys Val Gln Leu Arg Lys Arg Arg Val 275 280 285Lys Asn Pro Tyr Pro
Ile Ser Phe Leu Leu Thr Asp Leu Ile Asn Arg 290 295 300Arg Thr Pro
Arg Val Asp Gly Gln Pro Met Tyr Gly Met Asp Ala Gln305 310 315
320Val Glu Glu Val Arg Val Phe Glu Gly Thr Glu Glu Leu Pro Gly Asp
325 330 335Pro Asp Met Met Arg Tyr Val Asp Arg Tyr Gly Gln Leu Gln
Thr Lys 340 345 350Met Leu27354PRTJC virus 27Met Ala Pro Thr Lys
Arg Lys Gly Glu Arg Lys Asp Pro Val Gln Val1 5 10 15Pro Lys Leu Leu
Ile Arg Gly Gly Val Glu Val Leu Glu Val Lys Thr 20 25 30Gly Val Asp
Ser Ile Thr Glu Val Glu Cys Phe Leu Thr Pro Glu Met 35 40 45Gly Asp
Pro Asp Glu His Leu Arg Gly Phe Ser Met Ser Ile Ser Ile 50 55 60Ser
Asp Thr Phe Glu Ser Asp Ser Pro Asn Lys Asp Met Leu Pro Cys65 70 75
80Tyr Ser Val Ala Arg Ile Pro Leu Pro Asn Leu Asn Glu Asp Leu Thr
85 90 95Cys Gly Asn Ile Leu Met Trp Glu Ala Val Thr Leu Lys Thr Glu
Val 100 105 110Leu Gly Val Thr Thr Leu Met Asn Val His Ser Asn Gly
Gln Ala Thr 115 120 125His Asp Asn Gly Ala Gly Lys Pro Val Gln Gly
Thr Ser Phe His Phe 130 135 140Phe Ser Val Gly Gly Glu Ala Leu Glu
Leu Gln Gly Val Val Phe Asn145 150 155 160Tyr Arg Thr Lys Tyr Pro
Asp Gly Thr Ile Phe Pro Lys Asn Ala Thr 165 170 175Val Gln Ser Gln
Val Met Asn Thr Glu His Lys Ala Tyr Leu Asp Lys 180 185 190Asn Lys
Ala Tyr Pro Val Glu Cys Trp Val Pro Asp Pro Thr Arg Asn 195 200
205Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr Gly Gly Glu Asn Val Pro
210 215 220Pro Val Leu His Ile Thr Asn Thr Ala Thr Thr Val Leu Leu
Asp Glu225 230 235 240Phe Gly Val Gly Pro Leu Cys Lys Gly Asp Asn
Leu Tyr Leu Ser Ala 245 250 255Val Asp Val Cys Gly Met Phe Thr Asn
Arg Ser Gly Ser Gln Gln Trp 260 265 270Arg Gly Leu Ser Arg Tyr Phe
Lys Val Gln Leu Arg Lys Arg Arg Val 275 280 285Lys Asn Pro Tyr Pro
Ile Ser Phe Leu Leu Thr Asp Leu Ile Asn Arg 290 295 300Arg Thr Pro
Arg Val Asp Gly Gln Pro Met Tyr Gly Met Asp Ala Gln305 310 315
320Val Glu Glu Val Arg Val Phe Glu Gly Thr Glu Glu Leu Pro Gly Asp
325 330 335Pro Asp Met Met Arg Tyr Val Asp Arg Tyr Gly Gln Leu Gln
Thr Lys 340 345 350Met Leu28354PRTJC virus 28Met Ala Pro Thr Lys
Arg Lys Gly Glu Arg Lys Asp Pro Val Gln Val1 5 10 15Pro Lys Leu Leu
Ile Arg Gly Gly Val Glu Val Leu Glu Val Lys Thr 20 25 30Gly Val Asp
Ser Ile Thr Glu Val Glu Cys Phe Leu Thr Pro Glu Met 35 40 45Gly Asp
Pro Asp Glu His Leu Arg Gly Phe Ser Lys Ser Ile Ser Ile 50 55 60Ser
Asp Thr Phe Glu Ser Asp Ser Pro Asn Lys Asp Met Leu Pro Cys65 70 75
80Tyr Ser Val Ala Arg Ile Pro Leu Pro Asn Leu Asn Glu Asp Leu Thr
85 90 95Cys Gly Asn Ile Leu Met Trp Glu Ala Val Thr Leu Lys Thr Glu
Val 100 105 110Leu Gly Val Thr Thr Leu Met Asn Val His Cys Asn Gly
Gln Ala Thr 115 120 125His Asp Asn Gly Ala Gly Lys Pro Val Gln Gly
Thr Ser Phe His Phe 130 135 140Phe Ser Val Gly Gly Glu Ala Leu Glu
Leu Gln Gly Val Val Phe Asn145 150 155 160Tyr Arg Thr Lys Tyr Pro
Asp Gly Thr Ile Phe Pro Lys Asn Ala Thr 165 170 175Val Gln Ser Gln
Val Met Asn Thr Glu His Lys Ala Tyr Leu Asp Lys 180 185 190Asn Lys
Ala Tyr Pro Val Glu Cys Trp Val Pro Asp Pro Thr Arg Asn 195 200
205Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr Gly Gly Glu Asn Val Pro
210 215 220Pro Val Leu His Ile Thr Asn Thr Ala Thr Thr Val Leu Leu
Asp Glu225 230 235 240Phe Gly Val Gly Pro Leu Cys Lys Gly Asp Asn
Leu Tyr Leu Ser Ala 245 250 255Val Asp Val Cys Gly Met Phe Thr Asn
Arg Ser Gly Ser Gln Gln Trp 260 265 270Arg Gly Leu Ser Arg Tyr Phe
Lys Val Gln Leu Arg Lys Arg Arg Val 275 280 285Lys Asn Pro Tyr Pro
Ile Ser Phe Leu Leu Thr Asp Leu Ile Asn Arg 290 295 300Arg Thr Pro
Arg Val Asp Gly Gln Pro Met Tyr Gly Met Asp Ala Gln305 310 315
320Val Glu Glu Val Arg Val Phe Glu Gly Thr Glu Glu Leu Pro Gly Asp
325 330 335Pro Asp Met Met Arg Tyr Val Asp Arg Tyr Gly Gln Leu Gln
Thr Lys 340 345 350Met Leu29354PRTJC virus 29Met Ala Pro Thr Lys
Arg Lys Gly Glu Arg Lys Asp Pro Val Gln Val1 5 10 15Pro Lys Leu Leu
Ile Arg Gly Gly Val Glu Val Leu Glu Val Lys Thr 20 25 30Gly Val Asp
Ser Ile Thr Glu Val Glu Cys Phe Leu Thr Pro Glu Met 35 40 45Gly Asp
Pro Asp Glu His Leu Arg Gly Phe Ser Lys Ser Ile Ser Ile 50 55 60Ser
Asp Thr Phe Glu Ser Asp Ser Pro Asn Lys Asp Met Leu Pro Cys65 70 75
80Tyr Ser Val Ala Arg Ile Pro Leu Pro Asn Leu Asn Glu Asp Leu Thr
85 90 95Cys Gly Asn Ile Leu Met Trp Glu Ala Val Thr Leu Lys Thr Glu
Val 100 105 110Leu Gly Val Thr Thr Leu Met Asn Val His Cys Asn Gly
Gln Ala Thr 115 120 125His Asp Asn Gly Ala Gly Lys Pro Val Gln Gly
Thr Ser Phe His Phe 130 135 140Phe Ser Val Gly Gly Glu Ala Leu Glu
Leu Gln Gly Val Val Phe Asn145 150 155 160Tyr Arg Thr Lys Tyr Pro
Asp Gly Thr Ile Phe Pro Lys Asn Ala Thr 165 170 175Val Gln Ser Gln
Val Met Asn Thr Glu His Lys Ala Tyr Leu Asp Lys 180 185 190Asn Lys
Ala Tyr Pro Val Glu Cys Trp Val Pro Asp Pro Thr Arg Asn 195 200
205Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr Gly Gly Glu Asn Val Pro
210 215 220Pro Val Leu His Ile Thr Asn Thr Ala Thr Thr Val Leu Leu
Asp Glu225 230 235 240Phe Gly Val Gly Pro Leu Cys Lys Gly Asp Asn
Leu Tyr Leu Ser Ala 245 250 255Val Asp Val Cys Gly Met Phe Thr Asn
Arg Ser Gly Ser Gln Gln Trp 260 265 270Arg Gly Leu Ser Arg Tyr Phe
Lys Val Gln Leu Arg Lys Arg Arg Val 275 280 285Lys Asn Pro Tyr Pro
Ile Ser Phe Leu Leu Thr Asp Leu Ile Asn Arg 290 295 300Arg Thr Pro
Arg Val Asp Gly Gln Pro Met Tyr Gly Met Asp Ala Gln305 310 315
320Val Glu Glu Val Arg Val Phe Glu Gly Thr Glu Glu Leu Pro Gly Asp
325 330 335Pro Asp Met Met Arg Tyr Val Asp Arg Tyr Gly Gln Leu Gln
Thr Lys 340 345 350Met Leu30245PRTJC virus 30Phe Leu Thr Pro Glu
Met Gly Asp Pro Asp Glu His Leu Arg Gly Phe1 5 10 15Ser Lys Ser Ile
Ser Ile Ser Asp Thr Phe Glu Ser Asp Ser Pro Asn 20 25 30Lys Asp Met
Leu Pro Cys Tyr Ser Val Ala Arg Ile Pro Leu Pro Asn 35 40 45Leu Asn
Glu Asp Leu Thr Cys Gly Asn Ile Leu Met Trp Glu Ala Val 50 55
60Thr Leu Lys Thr Glu Val Ile Gly Val Thr Thr Leu Met Asn Val His65
70 75 80Ser Asn Gly Gln Ala Thr His Asp Asn Gly Ala Gly Lys Pro Val
Gln 85 90 95Gly Thr Ser Phe His Phe Phe Ser Val Gly Gly Glu Ala Leu
Glu Leu 100 105 110Gln Gly Val Val Phe Asn Tyr Arg Thr Lys Tyr Pro
Asp Gly Thr Ile 115 120 125Phe Pro Lys Asn Ala Thr Val Gln Ser Gln
Val Met Asn Thr Glu His 130 135 140Lys Ala Tyr Leu Asp Lys Asn Lys
Ala Tyr Pro Val Glu Cys Trp Val145 150 155 160Pro Asp Pro Thr Arg
Asn Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr 165 170 175Gly Gly Glu
Asn Val Pro Pro Val Leu His Ile Thr Asn Thr Ala Thr 180 185 190Thr
Val Leu Leu Asp Glu Phe Gly Val Gly Pro Leu Cys Lys Gly Asp 195 200
205Asn Leu Tyr Leu Ser Ala Val Asp Val Cys Gly Met Phe Thr Asn Arg
210 215 220Ser Gly Ser Gln Gln Trp Arg Gly Leu Ser Arg Tyr Phe Lys
Val Gln225 230 235 240Leu Arg Lys Arg Arg 24531245PRTJC virus 31Phe
Leu Thr Pro Glu Met Gly Asp Pro Asp Glu His Leu Arg Gly Phe1 5 10
15Ser Lys Ser Ile Ser Ile Ser His Thr Phe Glu Ser Asp Ser Pro Asn
20 25 30Lys Asp Met Leu Pro Cys Tyr Ser Val Ala Arg Ile Pro Leu Pro
Asn 35 40 45Leu Asn Glu Asp Leu Thr Cys Gly Asn Ile Leu Met Trp Glu
Ala Val 50 55 60Thr Leu Lys Thr Glu Val Ile Gly Val Thr Thr Leu Met
Asn Val His65 70 75 80Ser Asn Gly Gln Ala Thr His Asp Asn Gly Ala
Gly Lys Pro Val Gln 85 90 95Gly Thr Ser Phe His Phe Phe Ser Val Gly
Gly Glu Ala Leu Glu Leu 100 105 110Gln Gly Val Val Phe Asn Tyr Arg
Thr Lys Tyr Pro Asp Gly Thr Ile 115 120 125Phe Pro Lys Asn Ala Thr
Val Gln Ser Gln Val Met Asn Thr Glu His 130 135 140Lys Ala Tyr Leu
Asp Lys Asn Lys Ala Tyr Pro Val Glu Cys Trp Val145 150 155 160Pro
Asp Pro Thr Arg Asn Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr 165 170
175Gly Gly Glu Asn Val Pro Pro Val Leu His Ile Thr Asn Thr Ala Thr
180 185 190Thr Val Leu Leu Asp Glu Phe Gly Val Gly Pro Leu Cys Lys
Gly Asp 195 200 205Asn Leu Tyr Leu Ser Ala Val Asp Val Cys Gly Met
Phe Thr Asn Arg 210 215 220Ser Gly Ser Gln Gln Trp Arg Gly Leu Ser
Arg Tyr Phe Lys Val Gln225 230 235 240Leu Arg Lys Arg Arg
24532245PRTJC virus 32Phe Leu Thr Pro Glu Met Gly Asp Pro Asp Glu
His Leu Arg Gly Phe1 5 10 15Ser Lys Ser Ile Ser Ile Ser Asn Thr Phe
Glu Ser Asp Ser Pro Asn 20 25 30Lys Asp Met Leu Pro Cys Tyr Ser Val
Ala Arg Ile Pro Leu Pro Asn 35 40 45Leu Asn Glu Asp Leu Thr Cys Gly
Asn Ile Leu Met Trp Glu Ala Val 50 55 60Thr Leu Lys Thr Glu Val Ile
Gly Val Thr Thr Leu Met Asn Val His65 70 75 80Ser Asn Gly Gln Ala
Thr His Asp Asn Gly Ala Gly Lys Pro Val Gln 85 90 95Gly Thr Ser Phe
His Phe Phe Ser Val Gly Gly Glu Ala Leu Glu Leu 100 105 110Gln Gly
Val Val Phe Asn Tyr Arg Thr Lys Tyr Pro Asp Gly Thr Ile 115 120
125Phe Pro Lys Asn Ala Thr Val Gln Ser Gln Val Met Asn Thr Glu His
130 135 140Lys Ala Tyr Leu Asp Lys Asn Lys Ala Tyr Pro Val Glu Cys
Trp Val145 150 155 160Pro Asp Pro Thr Arg Asn Glu Asn Thr Arg Tyr
Phe Gly Thr Leu Thr 165 170 175Gly Gly Glu Asn Val Pro Pro Val Leu
His Ile Thr Asn Thr Ala Thr 180 185 190Thr Val Leu Leu Asp Glu Phe
Gly Val Gly Pro Leu Cys Lys Gly Asp 195 200 205Asn Leu Tyr Leu Ser
Ala Val Asp Val Cys Gly Met Phe Thr Asn Arg 210 215 220Ser Gly Ser
Gln Gln Trp Arg Gly Leu Ser Arg Tyr Phe Lys Val Gln225 230 235
240Leu Arg Lys Arg Arg 24533245PRTJC virus 33Phe Leu Thr Pro Glu
Met Gly Asp Pro Asp Glu His Leu Arg Gly Phe1 5 10 15Ser Glu Ser Ile
Ser Ile Ser His Thr Phe Glu Ser Asp Ser Pro Asn 20 25 30Lys Asp Met
Leu Pro Cys Tyr Ser Val Ala Arg Ile Pro Leu Pro Asn 35 40 45Leu Asn
Glu Asp Leu Thr Cys Gly Asn Ile Leu Met Trp Glu Ala Val 50 55 60Thr
Leu Lys Thr Glu Val Ile Gly Val Thr Thr Leu Met Asn Val His65 70 75
80Ser Asn Gly Gln Ala Thr His Asp Asn Gly Ala Gly Lys Pro Val Gln
85 90 95Gly Thr Ser Phe His Phe Phe Ser Val Gly Gly Glu Ala Leu Glu
Leu 100 105 110Gln Gly Val Val Phe Asn Tyr Arg Thr Lys Tyr Pro Asp
Gly Thr Ile 115 120 125Phe Pro Lys Asn Ala Thr Val Gln Ser Gln Val
Met Asn Thr Glu His 130 135 140Lys Ala Tyr Leu Asp Lys Asn Lys Ala
Tyr Pro Val Glu Cys Trp Val145 150 155 160Pro Asp Pro Thr Arg Asn
Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr 165 170 175Gly Gly Glu Asn
Val Pro Pro Val Leu His Ile Thr Asn Thr Ala Thr 180 185 190Thr Val
Leu Leu Asp Glu Phe Gly Val Gly Pro Leu Cys Lys Gly Asp 195 200
205Asn Leu Tyr Leu Ser Ala Val Asp Val Cys Gly Met Phe Thr Asn Arg
210 215 220Ser Gly Ser Gln Gln Trp Arg Gly Leu Ser Arg Tyr Phe Lys
Val Gln225 230 235 240Leu Arg Lys Arg Arg 24534245PRTJC virus 34Phe
Leu Thr Pro Glu Met Gly Asp Pro Asp Glu His Leu Arg Gly Phe1 5 10
15Ser Lys Ser Ile Ser Ile Ser Asp Thr Phe Glu Ser Asp Ser Pro Asn
20 25 30Lys Asp Met Leu Pro Cys Tyr Ser Val Ala Arg Ile Pro Leu Pro
Asn 35 40 45Leu Asn Glu Asp Leu Thr Cys Gly Asn Ile Leu Met Trp Glu
Ala Val 50 55 60Thr Leu Lys Thr Glu Val Leu Gly Val Thr Thr Leu Met
Asn Val His65 70 75 80Ser Asn Gly Gln Ala Thr His Asp Asn Gly Ala
Gly Lys Pro Val Gln 85 90 95Gly Thr Ser Phe His Phe Phe Ser Val Gly
Gly Glu Ala Leu Glu Leu 100 105 110Gln Gly Val Val Phe Asn Tyr Arg
Thr Lys Tyr Pro Asp Gly Thr Ile 115 120 125Phe Pro Lys Asn Ala Thr
Val Gln Ser Gln Val Met Asn Thr Glu His 130 135 140Lys Ala Tyr Leu
Asp Lys Asn Lys Ala Tyr Pro Val Glu Cys Trp Val145 150 155 160Pro
Asp Pro Thr Arg Asn Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr 165 170
175Gly Gly Glu Asn Val Pro Pro Val Leu His Ile Thr Asn Thr Ala Thr
180 185 190Thr Val Leu Leu Asp Glu Phe Gly Val Gly Pro Leu Cys Lys
Gly Asp 195 200 205Asn Leu Tyr Leu Ser Ala Val Asp Val Cys Gly Met
Phe Thr Asn Arg 210 215 220Phe Gly Ser Gln Gln Trp Arg Gly Leu Ser
Arg Tyr Phe Lys Val Gln225 230 235 240Leu Arg Lys Arg Arg
24535245PRTJC virus 35Phe Leu Thr Pro Glu Met Gly Asp Pro Asp Glu
His Leu Arg Gly Phe1 5 10 15Ser Met Ser Ile Ser Ile Ser Asp Thr Phe
Glu Ser Asp Ser Pro Asn 20 25 30Lys Asp Met Leu Pro Cys Tyr Ser Val
Ala Arg Ile Pro Leu Pro Asn 35 40 45Leu Asn Glu Asp Leu Thr Cys Gly
Asn Ile Leu Met Trp Glu Ala Val 50 55 60Thr Leu Lys Thr Glu Val Ile
Gly Val Thr Thr Leu Met Asn Val His65 70 75 80Ser Asn Gly Gln Ala
Thr His Asp Asn Gly Ala Gly Lys Pro Val Gln 85 90 95Gly Thr Ser Phe
His Phe Phe Ser Val Gly Gly Glu Ala Leu Glu Leu 100 105 110Gln Gly
Val Val Phe Asn Tyr Arg Thr Lys Tyr Pro Asp Gly Thr Ile 115 120
125Phe Pro Lys Asn Ala Thr Val Gln Ser Gln Val Met Asn Thr Glu His
130 135 140Lys Ala Tyr Leu Asp Lys Asn Lys Ala Tyr Pro Val Glu Cys
Trp Val145 150 155 160Pro Asp Pro Thr Arg Asn Glu Asn Thr Arg Tyr
Phe Gly Thr Leu Thr 165 170 175Gly Gly Glu Asn Val Pro Pro Val Leu
His Ile Thr Asn Thr Ala Thr 180 185 190Thr Val Leu Leu Asp Glu Phe
Gly Val Gly Pro Leu Cys Lys Gly Asp 195 200 205Asn Leu Tyr Leu Ser
Ala Val Asp Val Cys Gly Met Phe Thr Asn Arg 210 215 220Ser Gly Ser
Gln His Trp Arg Gly Leu Ser Arg Tyr Phe Lys Val Gln225 230 235
240Leu Arg Lys Arg Arg 24536245PRTJC virus 36Phe Leu Thr Pro Glu
Met Gly Asp Pro Asp Glu His Leu Arg Gly Phe1 5 10 15Ser Lys Ser Ile
Ser Ile Ser His Thr Phe Glu Ser Asp Ser Pro Asn 20 25 30Lys Asp Met
Leu Pro Cys Tyr Ser Val Ala Arg Ile Pro Leu Pro Asn 35 40 45Leu Asn
Glu Asp Leu Thr Cys Gly Asn Ile Leu Met Trp Glu Ala Val 50 55 60Thr
Leu Lys Thr Glu Val Ile Gly Val Thr Thr Leu Met Asn Val His65 70 75
80Ser Asn Gly Gln Ala Thr His Asp Asn Gly Ala Gly Lys Pro Val Gln
85 90 95Gly Thr Ser Phe His Phe Phe Ser Val Gly Gly Glu Ala Leu Glu
Leu 100 105 110Gln Gly Val Val Phe Asn Tyr Arg Thr Lys Tyr Pro Asp
Gly Thr Ile 115 120 125Phe Pro Lys Asn Ala Thr Val Gln Ser Gln Val
Met Asn Thr Glu His 130 135 140Lys Ala Tyr Leu Asp Lys Asn Lys Ala
Tyr Pro Val Glu Cys Trp Val145 150 155 160Pro Asp Pro Thr Arg Asn
Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr 165 170 175Gly Gly Glu Asn
Val Pro Pro Val Leu His Ile Thr Asn Thr Ala Thr 180 185 190Thr Val
Leu Leu Asp Glu Phe Gly Val Gly Pro Leu Cys Lys Gly Asp 195 200
205Asn Leu Tyr Leu Ser Ala Val Asp Val Cys Gly Met Phe Thr Asn Arg
210 215 220Ser Gly Ser Gln Gln Trp Arg Gly Leu Ser Arg Tyr Phe Lys
Val Gln225 230 235 240Leu Arg Lys Arg Arg 24537245PRTJC virus 37Phe
Leu Thr Pro Glu Met Gly Asp Pro Asp Glu His Leu Arg Gly Phe1 5 10
15Ser Lys Ser Ile Ser Ile Ser Asp Thr Phe Glu Ser Asp Ser Pro Asn
20 25 30Lys Asp Met Leu Pro Cys Tyr Ser Val Ala Arg Ile Pro Leu Pro
Asn 35 40 45Leu Asn Glu Asp Leu Thr Cys Gly Asn Ile Leu Met Trp Glu
Ala Val 50 55 60Thr Leu Lys Thr Glu Val Leu Gly Val Thr Thr Leu Met
Asn Val His65 70 75 80Ser Asn Gly Gln Ala Thr His Asp Asn Gly Ala
Gly Lys Pro Val Gln 85 90 95Gly Thr Ser Phe His Phe Phe Ser Val Gly
Gly Glu Ala Leu Glu Leu 100 105 110Gln Gly Val Val Phe Asn Tyr Arg
Thr Lys Tyr Pro Asp Gly Thr Ile 115 120 125Phe Pro Lys Asn Ala Thr
Val Gln Ser Gln Val Met Asn Thr Glu His 130 135 140Lys Ala Tyr Leu
Asp Lys Asn Lys Ala Tyr Pro Val Glu Cys Trp Val145 150 155 160Pro
Asp Pro Thr Arg Asn Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr 165 170
175Gly Gly Glu Asn Val Pro Pro Val Leu His Ile Thr Asn Thr Ala Thr
180 185 190Thr Val Leu Leu Asp Glu Phe Gly Val Gly Pro Leu Cys Lys
Gly Asp 195 200 205Asn Leu Tyr Leu Ser Ala Val Asp Val Cys Gly Met
Phe Thr Asn Arg 210 215 220Ser Gly Phe Gln Gln Trp Arg Gly Leu Ser
Arg Tyr Phe Lys Val Gln225 230 235 240Leu Arg Lys Arg Arg
24538245PRTJC virus 38Phe Leu Thr Pro Glu Met Gly Asp Pro Asp Glu
His Leu Arg Gly Phe1 5 10 15Ser Lys Ser Ile Ser Ile Ser Asp Thr Phe
Glu Ser Asp Ser Pro Asn 20 25 30Lys Asp Met Leu Pro Cys Tyr Ser Val
Ala Arg Ile Pro Leu Pro Asn 35 40 45Leu Asn Glu Asp Leu Thr Cys Gly
Asn Ile Leu Met Trp Glu Ala Val 50 55 60Thr Leu Lys Thr Glu Val Leu
Gly Val Thr Thr Leu Met Asn Val His65 70 75 80Ser Asn Gly Gln Ala
Thr His Asp Asn Gly Ala Gly Lys Pro Val Gln 85 90 95Gly Thr Ser Phe
His Phe Phe Ser Val Gly Gly Glu Ala Leu Glu Leu 100 105 110Gln Gly
Val Val Phe Asn Tyr Arg Thr Lys Tyr Pro Asp Gly Thr Ile 115 120
125Phe Pro Lys Asn Ala Thr Val Gln Ser Gln Val Met Asn Thr Glu His
130 135 140Lys Ala Tyr Leu Asp Lys Asn Lys Ala Tyr Pro Val Glu Cys
Trp Val145 150 155 160Pro Asp Pro Thr Arg Asn Glu Asn Thr Arg Tyr
Phe Gly Thr Leu Thr 165 170 175Gly Gly Glu Asn Val Pro Pro Val Leu
His Ile Thr Asn Thr Ala Thr 180 185 190Thr Val Leu Leu Asp Glu Phe
Gly Val Gly Pro Leu Cys Lys Gly Asp 195 200 205Asn Leu Tyr Leu Ser
Ala Val Asp Val Cys Gly Met Phe Thr Asn Arg 210 215 220Phe Gly Ser
Gln Gln Trp Arg Gly Leu Ser Arg Tyr Phe Lys Val Gln225 230 235
240Leu Arg Lys Arg Arg 24539245PRTJC virus 39Phe Leu Thr Pro Glu
Met Gly Asp Pro Asp Glu His Leu Arg Gly Phe1 5 10 15Ser Lys Ser Ile
Ser Ile Ser Asp Thr Phe Glu Ser Asp Ser Pro Asn 20 25 30Lys Asp Met
Leu Pro Cys Tyr Ser Val Ala Arg Ile Pro Leu Pro Asn 35 40 45Leu Asn
Glu Asp Leu Thr Cys Gly Asn Ile Leu Met Trp Glu Ala Val 50 55 60Thr
Leu Lys Thr Glu Val Ile Gly Val Thr Thr Leu Met Asn Val His65 70 75
80Ser Asn Gly Gln Ala Thr His Asp Asn Gly Ala Gly Lys Pro Val Gln
85 90 95Gly Thr Ser Phe His Phe Phe Ser Val Gly Gly Glu Ala Leu Glu
Leu 100 105 110Gln Gly Val Val Phe Asn Tyr Arg Thr Lys Tyr Pro Asp
Gly Thr Ile 115 120 125Phe Pro Lys Asn Ala Thr Val Gln Ser Gln Val
Met Asn Thr Glu His 130 135 140Lys Ala Tyr Leu Asp Lys Asn Lys Ala
Tyr Pro Val Glu Cys Trp Val145 150 155 160Pro Asp Pro Thr Arg Asn
Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr 165 170 175Gly Gly Glu Asn
Ala Pro Pro Val Leu His Ile Thr Asn Thr Ala Thr 180 185 190Thr Val
Leu Leu Asp Glu Phe Gly Val Gly Pro Leu Cys Lys Gly Asp 195 200
205Asn Leu Tyr Leu Ser Ala Val Asp Val Cys Gly Met Phe Thr Asn Arg
210 215 220Ser Gly Ser Gln Gln Trp Arg Gly Leu Ser Arg Tyr Phe Lys
Val Gln225 230 235 240Leu Arg Lys Arg Arg 24540245PRTJC virus 40Phe
Leu Thr Pro Glu Met Gly Asp Pro Asp Glu His Leu Arg Gly Phe1 5 10
15Ser Lys Ser Ile Ser Ile Ser Asp Thr Phe Asp Ser Asp Ser Pro Asn
20 25 30Lys Asp Met Leu Pro Cys Tyr Ser Val Ala Arg Ile Pro Leu Pro
Asn 35 40 45Leu Asn Glu Asp Leu Thr Cys Gly Asn Ile Leu Met Trp Glu
Ala Val 50 55 60Thr Leu Lys Thr Glu Val Ile Gly Val Thr Thr Leu Met
Asn Val His65
70 75 80Ser Asn Gly Gln Ala Thr His Asp Asn Gly Ala Gly Lys Pro Val
Gln 85 90 95Gly Thr Ser Phe His Phe Phe Ser Val Gly Gly Glu Ala Leu
Glu Leu 100 105 110Gln Gly Val Val Phe Asn Tyr Arg Thr Lys Tyr Pro
Asp Gly Thr Ile 115 120 125Phe Pro Lys Asn Ala Thr Val Gln Ser Gln
Val Met Asn Thr Glu His 130 135 140Lys Ala Tyr Leu Asp Lys Asn Lys
Ala Tyr Pro Val Glu Cys Trp Val145 150 155 160Pro Asp Pro Thr Arg
Asn Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr 165 170 175Gly Gly Glu
Asn Val Pro Pro Val Leu His Ile Thr Asn Thr Ala Thr 180 185 190Thr
Val Leu Leu Asp Glu Phe Gly Val Gly Pro Leu Cys Lys Gly Asp 195 200
205Asn Leu Tyr Leu Ser Ala Val Asp Val Cys Gly Met Phe Thr Asn Arg
210 215 220Ser Gly Phe Gln Gln Trp Arg Gly Leu Ser Arg Tyr Phe Lys
Val Gln225 230 235 240Leu Arg Lys Arg Arg 24541354PRTJC virus 41Met
Ala Pro Thr Lys Arg Lys Gly Glu Arg Lys Asp Pro Val Gln Val1 5 10
15Pro Lys Leu Leu Ile Arg Gly Gly Val Glu Val Leu Glu Val Lys Thr
20 25 30Gly Val Asp Ser Ile Thr Glu Val Glu Cys Phe Leu Thr Pro Glu
Met 35 40 45Gly Asp Pro Asp Glu His Leu Arg Gly Phe Ser Lys Ser Ile
Ser Ile 50 55 60Ser Asp Thr Phe Glu Ser Asp Ser Pro Asn Lys Asp Met
Leu Pro Cys65 70 75 80Tyr Ser Val Ala Arg Ile Pro Leu Pro Asn Leu
Asn Glu Asp Leu Thr 85 90 95Cys Gly Asn Ile Leu Met Trp Glu Ala Val
Thr Leu Lys Thr Glu Val 100 105 110Ile Gly Val Thr Thr Leu Met Asn
Val His Ser Asn Gly Gln Ala Ala 115 120 125His Asp Asn Gly Ala Gly
Lys Pro Val Gln Gly Thr Ser Phe His Phe 130 135 140Phe Ser Val Gly
Gly Glu Ala Leu Glu Leu Gln Gly Val Val Phe Asn145 150 155 160Tyr
Arg Thr Lys Tyr Pro Asp Gly Thr Ile Phe Pro Lys Asn Ala Thr 165 170
175Val Gln Ser Gln Val Met Asn Thr Glu His Lys Ala Tyr Leu Asp Lys
180 185 190Asn Lys Ala Tyr Pro Val Glu Cys Trp Val Pro Asp Pro Thr
Arg Asn 195 200 205Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr Gly Gly
Glu Asn Val Pro 210 215 220Pro Val Leu His Ile Thr Asn Thr Ala Thr
Thr Val Leu Leu Asp Glu225 230 235 240Phe Gly Val Gly Pro Leu Cys
Lys Gly Asp Asn Leu Tyr Leu Ser Ala 245 250 255Val Asp Val Cys Gly
Met Phe Thr Asn Arg Ser Gly Ser Gln Gln Trp 260 265 270Arg Gly Leu
Ser Arg Tyr Phe Lys Val Gln Leu Arg Lys Arg Arg Val 275 280 285Lys
Asn Pro Tyr Pro Ile Ser Phe Leu Leu Thr Asp Leu Ile Asn Arg 290 295
300Arg Thr Pro Arg Val Asp Gly Gln Pro Met Tyr Gly Met Asp Ala
Gln305 310 315 320Val Glu Glu Val Arg Val Phe Glu Gly Thr Glu Glu
Leu Pro Gly Asp 325 330 335Pro Asp Met Met Arg Tyr Val Asp Arg Tyr
Gly Gln Leu Gln Thr Lys 340 345 350Met Leu42354PRTJC virus 42Met
Ala Pro Thr Lys Arg Lys Gly Glu Arg Lys Asp Pro Val Gln Val1 5 10
15Pro Lys Leu Leu Ile Arg Gly Gly Val Glu Val Leu Glu Val Lys Thr
20 25 30Gly Val Asp Ser Ile Thr Glu Val Glu Cys Phe Leu Thr Pro Glu
Met 35 40 45Gly Asp Pro Asp Glu His Leu Arg Gly Phe Ser Lys Ser Ile
Ser Ile 50 55 60Ser Asp Thr Phe Glu Ser Asp Ser Pro Asn Lys Asp Met
Leu Pro Cys65 70 75 80Tyr Ser Val Ala Arg Ile Pro Leu Pro Asn Leu
Asn Glu Asp Leu Thr 85 90 95Cys Gly Asn Ile Leu Met Trp Glu Ala Val
Thr Leu Lys Thr Glu Val 100 105 110Leu Gly Val Thr Thr Leu Met Asn
Val His Ser Asn Gly Gln Ala Thr 115 120 125His Asp Asn Gly Ala Gly
Lys Pro Val Gln Gly Thr Ser Phe His Phe 130 135 140Phe Ser Val Gly
Gly Glu Ala Leu Glu Leu Gln Gly Val Val Phe Asn145 150 155 160Tyr
Arg Thr Lys Tyr Pro Asp Gly Thr Ile Phe Pro Lys Asn Ala Thr 165 170
175Val Gln Ser Gln Val Met Asn Thr Glu His Lys Ala Tyr Leu Asp Lys
180 185 190Asn Lys Ala Tyr Pro Val Glu Cys Trp Val Pro Asp Pro Thr
Arg Asn 195 200 205Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr Gly Gly
Glu Asn Val Pro 210 215 220Pro Val Leu His Ile Thr Asn Thr Ala Thr
Thr Val Leu Leu Asp Glu225 230 235 240Phe Gly Val Gly Pro Leu Cys
Lys Gly Asp Asn Leu Tyr Leu Ser Ala 245 250 255Val Asp Val Cys Gly
Met Phe Thr Thr Arg Ser Gly Ser Gln Gln Trp 260 265 270Arg Gly Leu
Ser Arg Tyr Phe Lys Val Gln Leu Arg Lys Arg Arg Val 275 280 285Lys
Asn Pro Tyr Pro Ile Ser Phe Leu Leu Thr Asp Leu Ile Asn Arg 290 295
300Arg Thr Pro Arg Val Asp Gly Gln Pro Met Tyr Gly Met Asp Ala
Gln305 310 315 320Ile Glu Glu Val Arg Val Phe Glu Gly Thr Glu Glu
Leu Pro Gly Asp 325 330 335Pro Asp Met Met Arg Tyr Val Asp Arg Tyr
Gly Gln Leu Gln Thr Lys 340 345 350Met Leu43354PRTJC virus 43Met
Ala Pro Thr Lys Arg Lys Gly Glu Arg Lys Asp Pro Val Gln Val1 5 10
15Pro Lys Leu Leu Ile Arg Gly Gly Val Glu Val Leu Glu Val Lys Thr
20 25 30Gly Val Asp Ser Ile Thr Glu Val Glu Cys Phe Leu Thr Pro Glu
Met 35 40 45Gly Asp Pro Asp Glu His Leu Arg Gly Phe Ser Lys Ser Ile
Ser Ile 50 55 60Ser Asp Thr Phe Glu Ser Asp Ser Pro Asn Lys Asp Met
Leu Pro Cys65 70 75 80Tyr Ser Val Ala Arg Ile Pro Leu Pro Asn Leu
Asn Glu Asp Leu Thr 85 90 95Cys Gly Asn Ile Leu Met Trp Glu Ala Val
Thr Leu Lys Thr Glu Val 100 105 110Ile Gly Val Thr Thr Leu Met Asn
Val His Ser Asn Gly Gln Ala Thr 115 120 125His Asp Asn Gly Ala Ala
Lys Pro Val Gln Gly Thr Ser Phe His Phe 130 135 140Phe Ser Val Gly
Gly Glu Ala Leu Glu Leu Gln Gly Val Val Phe Asn145 150 155 160Tyr
Arg Thr Thr Tyr Pro Asp Gly Thr Ile Phe Pro Lys Asn Ala Thr 165 170
175Val Gln Ser Gln Val Met Asn Thr Glu His Lys Ala Tyr Leu Asp Lys
180 185 190Asn Lys Ala Tyr Pro Val Glu Cys Trp Val Pro Asp Pro Thr
Arg Asn 195 200 205Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr Gly Gly
Glu Asn Val Pro 210 215 220Pro Val Leu His Ile Thr Asn Thr Ala Thr
Thr Val Leu Leu Asp Glu225 230 235 240Phe Gly Val Gly Pro Leu Cys
Lys Gly Asp Asn Leu Tyr Leu Ser Ala 245 250 255Val Asp Val Cys Gly
Met Phe Thr Asn Arg Phe Gly Ser Gln Gln Trp 260 265 270Arg Gly Leu
Ser Arg Tyr Phe Lys Val Gln Leu Arg Lys Arg Arg Val 275 280 285Lys
Asn Pro Tyr Pro Ile Ser Phe Leu Leu Thr Asp Leu Ile Asn Arg 290 295
300Arg Thr Pro Arg Val Asp Gly Gln Pro Met Tyr Gly Met Asp Ala
Gln305 310 315 320Ile Glu Glu Val Arg Val Phe Glu Gly Thr Glu Gln
Leu Pro Gly Asp 325 330 335Pro Asp Met Met Arg Tyr Val Asp Arg Tyr
Gly Gln Leu Gln Thr Lys 340 345 350Met Leu44354PRTJC virus 44Met
Ala Pro Thr Lys Arg Lys Gly Glu Arg Lys Asp Pro Val Gln Val1 5 10
15Pro Lys Leu Leu Ile Arg Gly Gly Val Glu Val Leu Glu Val Lys Thr
20 25 30Gly Val Asp Ser Ile Thr Glu Val Glu Cys Phe Leu Thr Pro Glu
Met 35 40 45Gly Asp Pro Asp Glu His Phe Arg Gly Phe Ser Lys Ser Ile
Ser Ile 50 55 60Ser Asp Thr Phe Glu Ser Asp Ser Pro Asn Lys Asp Met
Leu Pro Cys65 70 75 80Tyr Ser Val Ala Arg Ile Pro Leu Pro Asn Leu
Asn Glu Asp Leu Thr 85 90 95Cys Gly Asn Ile Leu Met Trp Glu Ala Val
Thr Leu Lys Thr Glu Val 100 105 110Ile Gly Val Thr Thr Leu Met Asn
Val His Ser Asn Gly Gln Ala Thr 115 120 125His Asp Asn Gly Ala Ala
Lys Pro Val Gln Gly Thr Ser Phe His Phe 130 135 140Phe Ser Val Gly
Gly Glu Ala Leu Glu Leu Gln Gly Val Val Phe Asn145 150 155 160Tyr
Arg Thr Thr Tyr Pro Asp Gly Thr Ile Phe Pro Lys Asn Ala Thr 165 170
175Val Gln Ser Gln Val Met Asn Thr Glu His Lys Ala Tyr Leu Asp Lys
180 185 190Asn Lys Ala Tyr Pro Val Glu Cys Trp Val Pro Asp Pro Thr
Arg Asn 195 200 205Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr Gly Gly
Glu Asn Val Pro 210 215 220Pro Val Leu His Ile Thr Asn Thr Ala Thr
Thr Val Leu Leu Asp Glu225 230 235 240Phe Gly Val Gly Pro Leu Cys
Lys Gly Asp Asn Leu Tyr Leu Ser Ala 245 250 255Val Asp Val Cys Gly
Met Phe Thr Asn Arg Ser Gly Ser Gln Gln Trp 260 265 270Arg Gly Leu
Ser Arg Tyr Phe Lys Val Gln Leu Arg Lys Arg Arg Val 275 280 285Lys
Asn Pro Tyr Pro Ile Ser Phe Leu Leu Thr Asp Leu Ile Asn Arg 290 295
300Arg Thr Pro Arg Val Asp Gly Gln Pro Met Tyr Gly Met Asp Ala
Gln305 310 315 320Ile Glu Glu Val Arg Val Phe Glu Gly Thr Glu Gln
Leu Pro Gly Asp 325 330 335Pro Asp Met Met Arg Tyr Val Asp Arg Tyr
Gly Gln Leu Gln Thr Lys 340 345 350Met Leu45354PRTJC virus 45Met
Ala Pro Thr Lys Arg Lys Gly Glu Arg Lys Asp Pro Val Gln Val1 5 10
15Pro Lys Leu Leu Ile Arg Gly Gly Val Glu Val Leu Glu Val Lys Thr
20 25 30Gly Val Asp Ser Ile Thr Glu Val Glu Cys Phe Leu Thr Pro Glu
Met 35 40 45Gly Asp Pro Asp Glu His Leu Arg Gly Phe Ser Asn Ser Ile
Ser Ile 50 55 60Ser Asp Thr Phe Glu Ser Asp Ser Pro Asn Lys Asp Met
Leu Pro Cys65 70 75 80Tyr Ser Val Ala Arg Ile Pro Leu Pro Asn Leu
Asn Glu Asp Leu Thr 85 90 95Cys Gly Asn Ile Leu Met Trp Glu Ala Val
Thr Leu Lys Thr Glu Val 100 105 110Ile Gly Val Thr Thr Leu Met Asn
Val His Ser Asn Gly Gln Ala Thr 115 120 125His Asp Asn Gly Ala Ala
Lys Pro Val Gln Gly Thr Ser Phe His Phe 130 135 140Phe Ser Val Gly
Gly Glu Ala Leu Glu Leu Gln Gly Val Val Phe Asn145 150 155 160Tyr
Arg Thr Thr Tyr Pro Asp Gly Thr Ile Phe Pro Lys Asn Ala Thr 165 170
175Val Gln Ser Gln Val Met Asn Thr Glu His Lys Ala Tyr Leu Asp Lys
180 185 190Asn Lys Ala Tyr Pro Val Glu Cys Trp Val Pro Asp Pro Thr
Arg Asn 195 200 205Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr Gly Gly
Glu Asn Val Pro 210 215 220Pro Val Leu His Ile Thr Asn Thr Ala Thr
Thr Val Leu Leu Asp Glu225 230 235 240Phe Gly Val Gly Pro Leu Cys
Lys Gly Asp Asn Leu Tyr Leu Ser Ala 245 250 255Val Asp Val Cys Gly
Met Phe Thr Asn Arg Ser Gly Ser Gln Gln Trp 260 265 270Arg Gly Leu
Ser Arg Tyr Phe Lys Val Gln Leu Arg Lys Arg Arg Val 275 280 285Lys
Asn Pro Tyr Pro Ile Ser Phe Leu Leu Thr Asp Leu Ile Asn Arg 290 295
300Arg Thr Pro Arg Val Asp Gly Gln Pro Met Tyr Gly Met Asp Ala
Gln305 310 315 320Ile Glu Glu Val Arg Val Phe Glu Gly Thr Glu Gln
Leu Pro Gly Asp 325 330 335Pro Asp Met Met Arg Tyr Val Asp Arg Tyr
Gly Gln Leu Gln Thr Lys 340 345 350Met Leu46245PRTJC virus 46Phe
Leu Thr Pro Glu Met Gly Asp Pro Asp Glu His Leu Arg Gly Phe1 5 10
15Ser Lys Ser Ile Ser Ile Ser Asp Thr Phe Glu Ser Asp Ser Pro Asn
20 25 30Lys Asp Met Leu Pro Cys Tyr Ser Val Ala Arg Ile Pro Leu Pro
Asn 35 40 45Leu Asn Glu Asp Leu Thr Cys Gly Asn Ile Leu Met Trp Glu
Ala Val 50 55 60Thr Leu Lys Thr Glu Val Leu Gly Val Thr Thr Leu Met
Asn Val His65 70 75 80Ser Asn Gly Gln Ala Thr His Asp Asn Gly Ala
Gly Lys Pro Val Gln 85 90 95Gly Thr Ser Phe His Phe Phe Ser Val Gly
Gly Glu Ala Leu Glu Leu 100 105 110Gln Gly Val Val Phe Asn Tyr Arg
Thr Lys Tyr Pro Asp Gly Thr Ile 115 120 125Phe Pro Lys Asn Ala Thr
Val Gln Ser Gln Val Met Asn Thr Glu His 130 135 140Lys Ala Tyr Leu
Asp Lys Asn Lys Ala Tyr Pro Val Glu Cys Trp Val145 150 155 160Pro
Asp Pro Thr Arg Asn Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr 165 170
175Gly Gly Glu Asn Val Pro Pro Val Leu His Ile Thr Asn Thr Ala Thr
180 185 190Thr Val Leu Leu Asp Glu Phe Gly Val Gly Pro Leu Cys Lys
Gly Asp 195 200 205Asn Leu Tyr Leu Ser Ala Val Asp Val Cys Gly Met
Phe Thr Asp Arg 210 215 220Ser Gly Ser Gln Gln Trp Arg Gly Leu Ser
Arg Tyr Phe Lys Val Gln225 230 235 240Leu Arg Lys Arg Arg
24547245PRTJC virus 47Phe Leu Thr Pro Glu Met Gly Asp Pro Asp Glu
His Phe Arg Gly Phe1 5 10 15Ser Lys Ser Ile Ser Ile Ser Asp Thr Phe
Glu Ser Asp Ser Pro Asn 20 25 30Lys Asp Met Leu Pro Cys Tyr Ser Val
Ala Arg Ile Pro Leu Pro Asn 35 40 45Leu Asn Glu Asp Leu Thr Cys Gly
Asn Ile Leu Met Trp Glu Ala Val 50 55 60Thr Leu Lys Thr Glu Val Ile
Gly Val Thr Thr Leu Met Asn Val His65 70 75 80Ser Asn Gly Gln Ala
Thr His Asp Asn Gly Ala Gly Lys Pro Val Gln 85 90 95Gly Thr Ser Phe
His Phe Phe Ser Val Gly Gly Glu Ala Leu Glu Leu 100 105 110Gln Gly
Val Val Phe Asn Tyr Arg Thr Lys Tyr Pro Asp Gly Thr Ile 115 120
125Phe Pro Lys Asn Ala Thr Val Gln Ser Gln Val Met Asn Thr Glu His
130 135 140Lys Ala Tyr Leu Asp Lys Asn Lys Ala Tyr Pro Val Glu Cys
Trp Val145 150 155 160Pro Asp Pro Thr Arg Asn Glu Asn Thr Arg Tyr
Phe Gly Thr Leu Thr 165 170 175Gly Gly Glu Asn Val Pro Pro Val Leu
His Ile Thr Asn Thr Ala Thr 180 185 190Thr Val Leu Leu Asp Glu Phe
Gly Val Gly Pro Leu Cys Lys Gly Asp 195 200 205Asn Leu Tyr Leu Ser
Ala Val Asp Val Cys Gly Met Phe Thr Asn Arg 210 215 220Ser Gly Ser
Gln Gln Trp Arg Gly Leu Ser Arg Tyr Phe Lys Val Gln225 230 235
240Leu Arg Lys Arg Arg 24548245PRTJC virus 48Phe Leu Thr Pro Glu
Met Gly Asp Pro Asp Glu His Leu Arg Gly Phe1 5 10 15Ser Lys Ser Ile
Ser Ile Ser Asp Thr Phe Glu Ser Asp Ser Pro Asn 20 25
30Lys Asp Met Leu Pro Cys Tyr Ser Val Ala Arg Ile Pro Leu Pro Asn
35 40 45Leu Asn Glu Asp Leu Thr Cys Gly Asn Ile Leu Met Trp Glu Ala
Val 50 55 60Thr Leu Lys Thr Glu Val Leu Gly Val Thr Thr Leu Met Asn
Val His65 70 75 80Ser Asn Gly Gln Ala Thr His Asp Asn Gly Ala Gly
Lys Pro Val Gln 85 90 95Gly Thr Ser Phe His Phe Phe Ser Val Gly Gly
Glu Ala Leu Glu Leu 100 105 110Gln Gly Val Val Phe Asn Tyr Arg Thr
Lys Tyr Pro Asp Gly Thr Ile 115 120 125Phe Pro Lys Asn Ala Thr Val
Gln Ser Gln Val Met Asn Thr Glu His 130 135 140Lys Ala Tyr Leu Asp
Lys Asn Lys Ala Tyr Pro Val Glu Cys Trp Val145 150 155 160Pro Asp
Pro Thr Arg Asn Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr 165 170
175Gly Gly Glu Asn Val Pro Pro Val Leu His Ile Thr Asn Thr Ala Thr
180 185 190Thr Val Leu Leu Asp Glu Phe Gly Val Gly Pro Leu Cys Lys
Gly Asp 195 200 205Asn Leu Tyr Leu Ser Ala Val Asp Val Cys Gly Met
Phe Thr Asp Arg 210 215 220Ser Gly Ser Gln Gln Trp Arg Gly Leu Ser
Arg Tyr Phe Lys Val Gln225 230 235 240Leu Arg Lys Arg Arg
24549245PRTJC virus 49Phe Leu Thr Pro Glu Met Gly Asp Pro Asp Glu
His Leu Arg Gly Phe1 5 10 15Ser Lys Ser Ile Ser Ile Ser Asp Thr Phe
Glu Ser Asp Ser Pro Asn 20 25 30Lys Asp Met Leu Pro Cys Tyr Ser Val
Ala Arg Ile Pro Leu Pro Asn 35 40 45Leu Asn Glu Asp Leu Thr Cys Gly
Asn Ile Leu Met Trp Glu Ala Val 50 55 60Thr Leu Lys Thr Glu Val Leu
Gly Val Thr Thr Leu Met Asn Val His65 70 75 80Cys Asn Gly Gln Ala
Thr His Asp Asn Gly Ala Gly Lys Pro Val Gln 85 90 95Gly Thr Ser Phe
His Phe Phe Ser Val Gly Gly Glu Ala Leu Glu Leu 100 105 110Gln Gly
Val Val Phe Asn Tyr Arg Thr Lys Tyr Pro Asp Gly Thr Ile 115 120
125Phe Pro Lys Asn Ala Thr Val Gln Ser Gln Val Met Asn Thr Glu His
130 135 140Lys Ala Tyr Leu Asp Lys Asn Lys Ala Tyr Pro Val Glu Cys
Trp Val145 150 155 160Pro Asp Pro Thr Arg Asn Glu Asn Thr Arg Tyr
Phe Gly Thr Leu Thr 165 170 175Gly Gly Glu Asn Val Pro Pro Val Leu
His Ile Thr Asn Thr Ala Thr 180 185 190Thr Val Leu Leu Asp Glu Phe
Gly Val Gly Pro Leu Cys Lys Gly Asp 195 200 205Asn Leu Tyr Leu Ser
Ala Val Asp Val Cys Gly Met Phe Thr Asn Arg 210 215 220Ser Gly Ser
Gln Gln Trp Arg Gly Leu Ser Arg Tyr Phe Lys Val Gln225 230 235
240Leu Arg Lys Arg Arg 24550245PRTJC virus 50Phe Leu Thr Pro Glu
Met Gly Asp Pro Asp Glu His Leu Arg Gly Phe1 5 10 15Ser Lys Ser Ile
Ser Ile Ser Asp Thr Phe Glu Ser Asp Ser Pro Asn 20 25 30Lys Asp Met
Leu Pro Cys Tyr Ser Val Ala Arg Ile Pro Leu Pro Asn 35 40 45Leu Asn
Glu Asp Leu Thr Cys Gly Asn Ile Leu Met Trp Glu Ala Val 50 55 60Thr
Leu Lys Thr Glu Val Ile Gly Val Thr Thr Leu Met Asn Val His65 70 75
80Ser Asn Gly Gln Ala Thr His Asp Asn Gly Ala Gly Lys Pro Val Gln
85 90 95Gly Thr Ser Phe His Phe Phe Ser Val Gly Gly Glu Ala Leu Glu
Leu 100 105 110Gln Gly Val Val Phe Asn Tyr Arg Thr Lys Tyr Pro Asp
Gly Thr Ile 115 120 125Phe Pro Lys Asn Ala Thr Val Gln Ser Gln Val
Met Asn Thr Glu His 130 135 140Lys Ala Tyr Leu Asp Lys Asn Lys Ala
Tyr Pro Val Glu Cys Trp Val145 150 155 160Pro Asp Pro Thr Arg Asn
Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr 165 170 175Gly Gly Glu Asn
Val Pro Pro Val Leu His Ile Thr Asn Thr Ala Thr 180 185 190Thr Val
Leu Leu Asp Glu Phe Gly Val Gly Pro Leu Cys Lys Gly Asp 195 200
205Asn Leu Tyr Leu Ser Ala Val Asp Val Cys Gly Met Phe Thr Asn Arg
210 215 220Ser Gly Phe Gln Gln Trp Arg Gly Leu Ser Arg Tyr Phe Lys
Val Gln225 230 235 240Leu Arg Lys Arg Arg 24551245PRTJC virus 51Phe
Leu Thr Pro Glu Met Gly Asp Pro Asp Glu His Leu Arg Gly Phe1 5 10
15Ser Lys Ser Ile Ser Ile Ser Asp Thr Phe Glu Ser Asp Ser Pro Asn
20 25 30Lys Asp Met Leu Pro Cys Tyr Ser Val Ala Arg Ile Pro Leu Pro
Asn 35 40 45Leu Asn Glu Asp Leu Thr Cys Gly Asn Ile Leu Met Trp Glu
Ala Val 50 55 60Thr Leu Lys Thr Glu Val Leu Gly Val Thr Thr Leu Met
Asn Val His65 70 75 80Cys Asn Gly Gln Ala Thr His Asp Asn Gly Ala
Gly Lys Pro Val Gln 85 90 95Gly Thr Ser Phe His Phe Phe Ser Val Gly
Gly Glu Ala Leu Glu Leu 100 105 110Gln Gly Val Val Phe Asn Tyr Arg
Thr Lys Tyr Pro Asp Gly Thr Ile 115 120 125Phe Pro Lys Asn Ala Thr
Val Gln Ser Gln Val Met Asn Thr Glu His 130 135 140Lys Ala Tyr Leu
Asp Lys Asn Lys Ala Tyr Pro Val Glu Cys Trp Val145 150 155 160Pro
Asp Pro Thr Arg Asn Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr 165 170
175Gly Gly Glu Asn Val Pro Pro Val Leu His Ile Thr Asn Thr Ala Thr
180 185 190Thr Val Leu Leu Asp Glu Phe Gly Val Gly Pro Leu Cys Lys
Gly Asp 195 200 205Asn Leu Tyr Leu Ser Ala Val Asp Val Cys Gly Met
Phe Thr Asn Arg 210 215 220Ser Gly Ser Gln Gln Trp Arg Gly Leu Ser
Arg Tyr Phe Lys Val Gln225 230 235 240Leu Arg Lys Arg Arg
24552245PRTJC virus 52Phe Leu Thr Pro Glu Met Gly Asp Pro Asp Glu
His Phe Arg Gly Phe1 5 10 15Ser Lys Ser Ile Ser Ile Ser Asp Thr Phe
Glu Ser Asp Ser Pro Asn 20 25 30Lys Asp Met Leu Pro Cys Tyr Ser Val
Ala Arg Ile Pro Leu Pro Asn 35 40 45Leu Asn Glu Asp Leu Thr Cys Gly
Asn Ile Leu Met Trp Glu Ala Val 50 55 60Thr Leu Lys Thr Glu Val Ile
Gly Val Thr Thr Leu Met Asn Val His65 70 75 80Ser Asn Gly Gln Ala
Thr His Asp Asn Gly Ala Gly Lys Pro Val Gln 85 90 95Gly Thr Ser Phe
His Phe Phe Ser Val Gly Gly Glu Ala Leu Glu Leu 100 105 110Gln Gly
Val Val Phe Asn Tyr Arg Thr Lys Tyr Pro Asp Gly Thr Ile 115 120
125Phe Pro Lys Asn Ala Thr Val Gln Ser Gln Val Met Asn Thr Glu His
130 135 140Lys Ala Tyr Leu Asp Lys Asn Lys Ala Tyr Pro Val Glu Cys
Trp Val145 150 155 160Pro Asp Pro Thr Arg Asn Glu Asn Thr Arg Tyr
Phe Gly Thr Leu Thr 165 170 175Gly Gly Glu Asn Val Pro Pro Val Leu
His Ile Thr Asn Thr Ala Thr 180 185 190Thr Val Leu Leu Asp Glu Phe
Gly Val Gly Pro Leu Cys Lys Gly Asp 195 200 205Asn Leu Tyr Leu Ser
Ala Val Asp Val Cys Gly Met Phe Thr Asn Arg 210 215 220Ser Gly Ser
Gln Gln Trp Arg Gly Leu Ser Arg Tyr Phe Lys Val Gln225 230 235
240Leu Arg Lys Arg Arg 24553245PRTJC virus 53Phe Leu Thr Pro Glu
Met Gly Asp Pro Asp Glu His Leu Arg Gly Phe1 5 10 15Ser Lys Ser Ile
Ser Ile Ser Asp Thr Phe Glu Ser Asp Ser Pro Asn 20 25 30Lys Asp Met
Leu Pro Cys Tyr Ser Val Ala Arg Ile Pro Leu Pro Asn 35 40 45Leu Asn
Glu Asp Leu Thr Cys Gly Asn Ile Leu Met Trp Glu Ala Val 50 55 60Thr
Leu Lys Thr Glu Val Ile Gly Val Thr Thr Leu Met Asn Val His65 70 75
80Ser Asn Gly Gln Ala Thr His Asp Asn Gly Ala Gly Lys Pro Val Gln
85 90 95Gly Thr Ser Phe His Phe Phe Ser Val Gly Gly Glu Ala Leu Glu
Leu 100 105 110Gln Gly Val Val Phe Asn Tyr Arg Thr Lys Tyr Pro Asp
Gly Thr Ile 115 120 125Phe Pro Lys Asn Ala Thr Val Gln Ser Gln Val
Met Asn Thr Glu His 130 135 140Lys Ala Tyr Leu Asp Lys Asn Lys Ala
Tyr Pro Val Glu Cys Trp Val145 150 155 160Pro Asp Pro Thr Arg Asn
Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr 165 170 175Gly Gly Glu Asn
Val Pro Pro Val Leu His Ile Thr Asn Thr Ala Thr 180 185 190Thr Val
Leu Leu Asp Glu Phe Gly Val Gly Pro Leu Cys Lys Gly Asp 195 200
205Asn Leu Tyr Leu Ser Ala Val Asp Val Cys Gly Met Phe Thr Asn Arg
210 215 220Ser Gly Ser Gln Gln Trp Arg Gly Leu Ser Arg Tyr Phe Lys
Val Gln225 230 235 240Leu Arg Lys Arg Arg 24554245PRTJC virus 54Phe
Leu Thr Pro Glu Met Gly Asp Pro Asp Glu His Leu Arg Gly Phe1 5 10
15Ser Lys Ser Ile Ser Ile Ser Asp Thr Phe Glu Ser Asp Ser Pro Asn
20 25 30Lys Asp Met Leu Pro Cys Tyr Ser Val Ala Arg Ile Pro Leu Pro
Asn 35 40 45Leu Asn Glu Asp Leu Thr Cys Gly Asn Ile Leu Met Trp Glu
Ala Val 50 55 60Thr Leu Lys Thr Glu Val Ile Gly Val Thr Thr Leu Met
Asn Val His65 70 75 80Ser Asn Gly Gln Ala Thr His Asp Asn Gly Ala
Gly Lys Pro Val Gln 85 90 95Gly Thr Ser Phe His Phe Phe Ser Val Gly
Gly Glu Ala Leu Glu Leu 100 105 110Gln Gly Val Val Phe Asn Tyr Arg
Thr Lys Tyr Pro Asp Gly Thr Ile 115 120 125Phe Pro Lys Asn Ala Thr
Val Gln Ser Gln Val Met Asn Thr Glu His 130 135 140Lys Ala Tyr Leu
Asp Lys Asn Lys Ala Tyr Pro Val Glu Cys Trp Val145 150 155 160Pro
Asp Pro Thr Arg Asn Glu Asn Thr Arg Tyr Phe Gly Thr Leu Thr 165 170
175Gly Gly Glu Asn Val Pro Pro Val Leu His Ile Thr Asn Thr Ala Thr
180 185 190Thr Val Leu Leu Asp Glu Phe Gly Val Gly Pro Leu Cys Lys
Gly Asp 195 200 205Asn Leu Tyr Leu Ser Ala Val Asp Val Cys Gly Met
Phe Thr Asp Arg 210 215 220Ser Gly Ser Gln Gln Trp Arg Gly Leu Ser
Arg Tyr Phe Lys Val Gln225 230 235 240Leu Arg Lys Arg Arg
2455520DNAArtificial SequenceSYNTHETIC OLIGONUCLEOTIDE 55gcagccagct
atggctttac 205620DNAArtificial SequenceSYNTHETIC OLIGONUCLEOTIDE
56gctgccattc atgagaggat 205720DNAArtificial SequenceSYNTHETIC
OLIGONUCLEOTIDE 57cctcaatgga tgttgccttt 205816DNAArtificial
SequenceSYNTHETIC OLIGONUCLEOTIDE 58aaaaccaaag acccct
165924DNAArtificial SequenceSYNTHETIC OLIGONUCLEOTIDE 59ttgactcaat
tacagaggta gaat 246024DNAArtificial SequenceSYNTHETIC
OLIGONUCLEOTIDE 60agaaattggg taggggtttt taac 246124DNAArtificial
SequenceSYNTHETIC OLIGONUCLEOTIDE 61aggtacgcct tgtgctctgt gttc
246222DNAArtificial SequenceSYNTHETIC OLIGONUCLEOTIDE 62gtgcagggca
ccagctttca tt 22
* * * * *
References