Methods and Compositions for Modulating Flowering and Maturity in Plants

Abstract

The present invention provides compositions and methods for modulating flowering time in plants. Maize RAP2.7 nucleotide sequences are disclosed which upon overexpression cause later flowering and when inhibited cause earlier flowering. Also disclosed is a DNA sequence which acts as a regulator/enhancer of RAP2.7, termed VGT1. This sequence does not code for any known protein, but acts as either a RNAi element or a regulatory DNA or RNA element that either directly regulates expression of flowering genes such as Rap2.7 or specifically targets expression of other genes which control flowering genes such as Rap2.7. This element this can be used as a sequence--based marker to identify inbred and hybrids which have altered maturity. Methods for expressing these nucleotide sequences in a plant for modifying maturity and flowering in plants are provided as well as expression constructs, vectors, transformed cells and plants.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This is a continuation application of U.S. application Ser. No. 12/276,961, filed Nov. 24, 2008 which application claims priority of U.S. application Ser. No. 11/190,339 filed Jul. 27, 2005, now U.S. Pat. No. 7,479,584 issued Jan. 20, 2009 and Provisional Application Ser. No. 60/592,268 filed Jul. 29, 2004, all of which are hereby incorporated by reference in their entirety.

FIELD

[0002] This invention is related to compositions and methods for affecting flowering time in plants.

BACKGROUND

[0003] Plants have two basic growth modes during their life cycles--vegetative growth and flower and seed growth. Above ground vegetative growth of the plant develops from the apical meristem. This vegetative meristem gives rise to all of the leaves that are found on the plant. The plant will maintain its vegetative growth pattern until the apical meristem undergoes a change. This change actually alters the identity of the meristem from a vegetative to an inflorescence meristem. The inflorescence meristem produces small leaves before it next produces floral meristems. It is the floral meristem from which the flower develops.

[0004] From a genetic perspective, two phenotypic changes that control vegetative and floral growth are programmed in the plant. The first genetic change involves the switch from the vegetative to the floral state. If this genetic change is not functioning properly, then flowering will not occur. The second genetic event follows the commitment of the plant to form flowers. The observation that the organs of the plant develop in a sequential manner suggests that a genetic mechanism exists in which a series of genes are sequentially turned on and off.

[0005] Flowering time is an important agronomic trait in cultivated plant species as it determines in large measure the growing region of adaptation. Most angiosperm species are induced to flower in response to environmental stimuli such as day length and temperature, and internal cues, such as age. Genetic analysis revealed that there are several types of mutants that alter flowering time.

[0006] Studies of two distantly related dicotyledons, Arabidopsis thaliana and Antirrhinum majus, has led to the identification of three classes of homeotic genes, acting alone or in combination to determine floral organ identity (Bowman, et al., (1991) Development 112:1; Carpenter and Coen, (1990) Genes Devl. 4:1483; Schwarz-Sommer, et al., (1990) Science 250:931). Several of these genes are transcription factors whose conserved DNA-binding domain has been designated the MADS box (Schwarz-Sommer, et al., supra).

[0007] Earlier acting genes that control the identity of flower meristems have also been characterized. Flower meristems are derived from inflorescence meristems in both Arabidopsis and Antirrhinum. Two factors that control the development of meristematic cells into flowers are known. In Arabidopsis, the factors are the products of the LEAFY gene (Weigel, et al., (1992) Cell 69:843) and the APETALA1 gene (Mandel, et al., (1992) Nature 360:273). When either of these genes is inactivated by mutation, structures combining the properties of flowers and inflorescence develop (Weigel, et al., supra; Irish and Sussex, (1990) Plant Cell 2:741). In Antirrhinum, the homologue of the Arabidopsis LEAFY gene is FLORICAULA (Coen, et al., (1990) Cell 63:1311) and that of the APETALA1 gene is SQUAMOSA (Huijser, et al., (1992) EMBO J. 11:1239). The latter pair contains MADS box domains.

[0008] Genetic studies in Arabidopsis thaliana have identified five genes (APETALA1 (AP1), APETALA2 (AP2), APETALA3 (AP3), PISTILLATA (PI) and AGAMOUS (AG)) that are involved in the specification of floral organ identity. Mutations in these genes result in homeotic transformation of one organ type into another, much like the homeotic selector genes in animal development. These five genes act in spatially localized domains in a flower and in different combinations to specify the development of the sepals, petals, stamens and carpels. All five genes encode proteins which appear to function as transcription factors. Four of these proteins are members of the MADS domain family of dimeric transcription factors. MADS domain proteins are found in many organisms including yeast, mammals, insects and plants. The fifth protein, AP2, is a member of another class of DNA binding proteins which may be unique to plants

[0009] APETALA2 (AP2) plays an important role in the control of Arabidopsis flower and seed development and encodes a putative transcription factor that is distinguished by a novel DNA binding motif referred to as the AP2 domain. The AP2 domain containing or RAP2 (related to AP2) family of proteins is encoded by a minimum of 12 genes in Arabidopsis. The RAP2 genes encode two classes of proteins, AP2-like and EREBP-like, that are defined by the number of AP2 domains in each polypeptide as well as by two sequence motifs referred to as the YRG and RAYD elements that are located within each AP2 domain. RAP2 genes are differentially expressed in flower, leaf, inflorescence stem, and root. Moreover, the expression of at least three RAP2 genes in vegetative tissues are controlled by AP2. Thus, unlike other floral homeotic genes, AP2 is active during both reproductive and vegetative development.

[0010] Maize is a monocotyledonous plant species and belongs to the grass family. It is unusual for a flowering plant as it has unisexual inflorescences. The male inflorescence (tassel) develops in a terminal position, whereas the female inflorescences (ears) grow in the axil of vegetative leaves. The inflorescences, as typical for grasses, are composed of spikelets. In the case of maize each spikelet contains two florets (the grass flower) enclosed by a pair of bracts (inner and outer glume). A number of genes have been identified which modify flowering time in maize including Id1 and DLF.

[0011] There is increasing incentive by those working in the field of plant biotechnology to successfully genetically engineer plants, including the major crop varieties. One genetic modification that would be economically desirable would be to accelerate the flowering time of a plant. Induction of flowering is often the limiting factor for growing crop plants. One of the most important factors controlling induction of flowering is day length, which varies seasonally as well as geographically. There is a need to develop a method for controlling and inducing flowering in plants, regardless of the locale or the environmental conditions, thereby allowing production of crops, at any given time. Since most crop products (e.g. seeds, grains, fruits), are derived from flowers, such a method for controlling flowering would be economically invaluable.

[0012] It is an object of the present invention to provide methods and compositions for affecting flowering time in plants.

[0013] It is yet another object of the invention to provide novel nucleotide sequences isolated from maize which encode proteins which affect flowering time in plants.

[0014] It is yet another object of the invention to provide maize RAP2.7 genes which affect flowering time and internode length in maize.

[0015] It is yet another object of the invention to provide DNA regulatory factors which enhance/inhibit the ability of RAP2.7 to regulate flowering time.

[0016] It is yet another object of the invention to provide methods and compositions including nucleotide constructs, vectors, transgenic cells and plants with altered flowering characteristics as described herein.

[0017] It is yet another object of the invention to provide markers for identification of mutant plants which may have altered flowering time by the presence of marker VGT1 sequences.

SUMMARY

[0018] Compositions and methods involved in the modulation of flowering in plants are provided. The compositions include nucleic acid molecules isolated from maize which encode RAP2.7 proteins. Amino acid sequences of these proteins are also provided. Further, polynucleotides having nucleic acid sequences encoding maize RAP2.7 proteins are also provided. These proteins and the nucleotide sequences encoding them provide an opportunity to manipulate maturity of plants. When polynucleotide sequences encoding the RAP2.7 gene product are overexpressed flowering time is delayed, and when the product is inhibited flowering is earlier.

[0019] Typically maturity of a given plant is changed with crossing of earlier and later maturity plants. Agronomic traits such as yield or lodging resistance are often lost in the process. The compositions of the invention provide for the ability to make significant changes in maturity while keeping other vegetative and reproductive characteristics similar using a transgenic approach.

[0020] The invention includes methods for manipulating the maturity of plants using polynucleotide sequences that were isolated from maize (Zea mays). These sequences alone, or in combination with other sequences, can be used to control plant maturity and thus area of adaptation. In another aspect of the present invention, nucleotide constructs such as expression cassettes and transformation vectors comprising the isolated nucleotide sequences are disclosed. The transformation vectors can be used to transform plants and express the flower modulation control genes in the transformed cells. In this manner, the maturity of plants as well as area of adaptation can be controlled. Transformed cells as well as regenerated transgenic plants and seeds containing and expressing the isolated polynucleotide sequences and protein products are also provided.

[0021] Also according to the invention, a novel DNA sequence termed (VGT1) has been identified which is a 2 kb region on maize chromosome 8L. VGT1 acts as a CIS interaction type non-coding RNA sequence for maize RAP2.7. In mutants with early flowering, VGT1 may interact or repress the expression level of RAP2.7 causing down regulation of RAP2.7 and early flowering. Thus the invention also comprises nucleotide sequences encoding a VGT1 DNA factor which interacts either directly or indirectly with RAP2.7 in modulating the flowering time in plants. The invention includes nucleotide sequences, polymorphisms, "expression-type" constructs with the VGT1 sequences operably linked to promoters regions for transcription of the same, transgenic cells and plants with altered flowering time. The VGT1 sequences and the alternate forms thereof may also be used as markers to identify plants with flowering that may be different from wild type.

[0022] For any of the sequences disclosed herein, the polynucleotide of the invention or at least 20 contiguous bases therefrom may be used as probes to isolate and identify similar genes in other plant species. The sequences disclosed may also be used to isolate regulatory elements and promoter sequences that are natively associated with the polynucleotides disclosed herein to give spatial and temporal expression of operatively linked sequences to flowering in plants.

DESCRIPTION OF THE FIGURES

[0023] FIG. 1 is a graph depicting the levels of RAP2.7 expression at Day: 14, day 20 and day 27.

[0024] FIG. 2 is an illustration of the over-expression vector used in transformation, showing the portion between the right and left T-DNA borders (RB, LB). The transformation vector for RAP2.7 over-expression, PHP20922, was created by electroporating the JT vector PHP20921 into Agrobacterium. The Invitrogen (Carlsbad, California) Gateway technology was used to create PHP20921. Specifically, the RAP2.7 coding region was first amplified by PCR with 5'-primer (ggggacaagtttgtacaaaaaagcaggctatgcagttggatctgaacgt) and 3' primer (ggggaccactttgtacaagaaagctgggttcagcggggatggtgatg). These primers contain Gateway attB recombination sites. The PCR product was confirmed by sequencing and cloned into a Gateway vector pDONR221 via a BP recombination reaction as described by the vendor (Invitrogen, Carlsbad, Calif.). This resulted in the entry clone, PHP20923. Two other entry clones, PHP20830 containing the rice actin promoter, PHP20234 containing the pinII terminator, have been previously created using similar cloning strategies. A destination vector PHP20909 was also created from pDESTR4-R3 vector (Invitrogen, Carlsbad, Calif.) by inserting an expression cassette of the CaMV35S promoter driving the herbicide resistance gene Bar followed by a pinII terminator. The four vectors, PHP20923, 20830, 20234 and 20909, were then used to create the JT vector, PHP20921, via a LR recombination reaction following vendor's instructions (Invitrogen, Carlsbad, Calif.).

[0025] FIG. 3 is the deduced amino acid sequence of RAP2.7 from C22-4 allele. The two putative AP2 domains are highlighted in bold, whereas the linker region between them is italicized. The well conserved YRG and RAYD motifs are underlined, although there is an R to K substitution in the second RAYD motif.

[0026] FIG. 4 is a GAP alignment between the genomic RAP2.7 from B73 compared to the sequence of RAP2.7 of M017. Gap Weight: 50; Average Match: 10.000; Length Weight: 3; Average Mismatch: 0.000; Quality: 59308; Length: 8586; Ratio: 7.730; Gaps: 41; Percent Similarity: 87.482, Percent Identity: 87.482. Vladutu, et al., (1999) Genetics 153:993-1007.

[0027] FIG. 5 is an illustration of construction of the RAP2.7 gene fragments for the RNA interference vector. Fragment TR1 (Truncated1) was created by PCR using forward (ggatccgatctgaacgtggccgag) and reverse primers (gaattcctaggcagctgttcttgtctctttg) corresponding to roughly 2/3 of the coding sequence starting from 9 bp downstream of ATG. Fragment IR1 (Inverted1) was generated similarly by PCR with forward (gcggccgcgatctgaacgtggccgag) and reverse primers (gaattctgtgggactcccagcggcctgtgc) starting from the same position as TR1, although IR1 is only half the length of TR1.

[0028] FIG. 6 is an illustration of the vector used in transformation showing only the portion between the right and left T-DNA borders (RB, LB). As described in FIG. 5, fragments corresponding to truncated coding regions to be used for the RNA interference construct were generated by as TR1, flanked by BamH1 and EcoR1, and IR1, flanked by Notl and EcoR1 restriction sites. Vector PHP16501 containing the rice actin promoter was linearized with Notl and BamH1. In a 3-piece ligation, TR1 was cloned in downstream of Notl followed by IR1 in reverse orientation. The resulting cassette vector, PHP21767, was then cloned into a JT vector containing the CaMV35S promoter driving the herbicide resistance gene Bar. The transformation vector for RAP2.7 down regulation, PHP21842, was generated by electroporating PHP21798 into Agrobacterium.

[0029] FIG. 7 is the data showing the fine genetic and physical mapping of VGT1. First row indicates physical distance (in kb) from Rap2.7, based on sequence derived from the relevant Mo17 BAC clone from library. Second row indicates the type of molecular marker. Third row indicates the name of the molecular markers. Rows from 4 to 21 indicate the genotype of parental lines (N28 and C22-4) and of the 17 segmental QTL-Nearly Isogenic Lines. The VGT1 column shows where the QTL was mapped. The last two columns provide the phenotypic scores for DPS (Days to Pollen Shed) and ND (plant node number).

[0030] FIG. 8 is a graph showing the results of association mapping for markers developed at the Vgt1-Rap2.7 region and phenotypic data for flowering time collected in Bologna (2002 and 2003) among a set of 96 maize inbred lines. Statistical association is expressed as P from ANOVA tests.

[0031] FIG. 9 is an alignment of the VGT1 sequences from all four lines, including a consensus sequence line N28 was identical to B73.

DETAILED DESCRIPTION

[0032] The present invention provides, inter alia, compositions and methods for manipulating flowering time in plants. As used herein the term "flowering time" or maturity shall mean the time at which a plant reaches physiological maturity and is capable of reproducing.

[0033] The compositions comprise nucleic acid molecules comprising sequences of plant genes and the polypeptides encoded thereby as well as regulatory factors which are non-coding. Particularly, the nucleotide and amino acid sequences for a maize RAP2.7 (related to AP2 domain containing) gene are provided. Three RAP2.7 encoding nucleotide sequences are provided at SEQ ID NOS: 1 (cDNA), 3 (genomic) and 4 (genomic) with the corresponding protein at SEQ ID NO: 2. Three VGT1 nucleotide sequences are provided at SEQ ID NOS: 5, 6 and 7 with the consensus sequence at SEQ ID NO:8. As discussed in more detail below, the sequences of the invention are involved in many basic biochemical pathways that regulate flowering time and maturity in plants. Thus, methods are provided for the expression of these sequences in a host plant to modulate plant flowering. Some of the methods involve stably transforming a plant with a nucleotide sequence capable of modulating plant flowering operably linked with a promoter capable of driving expression (or transcription) of a nucleotide sequence in a plant cell.

[0034] Promoter and other regulatory elements which are natively associated with these genes can be easily isolated using the sequences and methods described herein with no more than routine experimentation. These sequences can be used to identify promoter, enhancer or other signaling signals in the regulatory regions of RAP2.7 encoding sequences. These regulatory and promoter elements provide for temporal and spatial expression of operably linked sequences with flowering in a plant. Methods are provided for the regulated expression of a nucleotide sequence of interest that is operably linked to the promoter regulatory sequences disclosed herein. Nucleotide sequences operably linked to the promoter sequences are transformed into a plant cell. Exposure of the transformed plant to a stimulus such as the timing of flowering induces transcriptional activation of the nucleotide sequences operably linked to these promoter regulatory sequences.

[0035] By "heterologous nucleotide sequence" is intended a sequence that is not naturally occurring with the referenced sequence. While the referenced nucleotide sequence is heterologous to the promoter sequence or vice versa, it may be homologous, or native, or heterologous, or foreign, to the plant host.

[0036] By "operably linked" is intended a functional linkage between a promoter sequence and a second sequence, wherein the promoter sequence initiates and mediates transcription of the DNA sequence corresponding to the second sequence. Generally, operably linked means that the nucleic acid sequences being linked are contiguous and, where necessary to join two protein coding regions, contiguous and in the same reading frame. In the case of a DNA regulatory factor the nucleic acid sequences are transcribed only.

[0037] A polypeptide is said to have RAP2.7-like activity when it has one or more of the properties of the native protein. It is within the skill in the art to assay protein activities obtained from various sources to determine whether the properties of the proteins are the same. In so doing, one of skill in the art may employ any of a wide array of known assays including, for example, biochemical and/or pathological assays. For example, one of skill in the art could readily produce a plant transformed with a RAP2.7 polypeptide variant and assay a property of native RAP2.7 protein in that plant material to determine whether a particular RAP2.7 property was retained by the variant.

[0038] The compositions and methods of the invention are involved in biochemical pathways and as such may also find use in the activation or modulation of expression of other genes, including those involved in other aspects of flowering time.

[0039] Although there is some conservation among these genes, proteins encoded by members of these gene families may contain different elements or motifs or sequence patterns that modulate or affect the activity, subcellular localization, and/or target of the protein in which they are found. Such elements, motifs or sequence patterns may be useful in engineering novel enzymes for modulating gene expression in particular tissues. By "modulating" or "modulation" is intended that the level of expression of a gene may be increased or decreased relative to genes driven by other promoters or relative to the normal or uninduced level of the gene in question.

[0040] According to the invention, overexpression of maize RAP2.7 caused flowering that was later than normal in plants as well as an increased number of leaves (nodes) produced prior to flowering resulting in taller plant stature. Inhibition of maize RAP2.7 caused maturation or flowering that was earlier than normal. Also the presence of mutant VGT1 correlated with earlier flowering as well, thus leading to the concept that VGT1 acts as direct or indirect enhancer/regulator of RAP2.7. Expression of the proteins encoded by RAP2.7 encoding sequences or transcription of the VGT1 regulatory element can be used to modulate or regulate the expression of proteins in these flowering pathways and other directly or indirectly affected pathways. Hence, the compositions and methods of the invention find use in altering plant flowering and maturity. In other embodiments, fragments of the sequences are used to confer desired properties to synthetic constructs for use in regulating plant maturity and flowering.

[0041] The present invention provides for isolated nucleic acid molecules comprising nucleotide sequences encoding the amino acid sequence shown in SEQ ID NO: 2 as well as their conservatively modified variants. Further provided are polypeptides having an amino acid sequence encoded by a nucleic acid molecule described herein, for example those polypeptides comprising the sequences set forth in SEQ ID NO: 1, 3 and 4, and fragments and variants thereof.

[0042] The present invention further provides for an isolated nucleic acid molecule comprising the sequences shown in SEQ ID NO: 1, 3, 4, 5, 6, 7 or 8.

[0043] The invention encompasses isolated or substantially purified nucleic acid or protein compositions. An "isolated" or "purified" nucleic acid molecule or protein, or biologically active portion thereof, is substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. In some embodiments, an "isolated" nucleic acid is free of sequences (such as other protein-encoding sequences) that naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, the isolated nucleic acid molecule can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, 0.4 kb, 0.3 kb, 0.2 kb, or 0.1 kb, or 50, 40, 30, 20 or 10 nucleotides that naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived. A protein that is substantially free of cellular material includes preparations of protein having less than about 30%, 20%, 10%, 5%, (by dry weight) of contaminating protein. When the protein of the invention or biologically active portion thereof is recombinantly produced, culture medium may represent less than about 30%, 20%, 10% or 5% (by dry weight) of chemical precursors or non-protein-of-interest chemicals.

[0044] Fragments and variants of the disclosed nucleotide sequences which retain the functional properties of the encoded peptide or of the non-coding RNA are encompassed by the present invention. By "fragment" is intended a portion of the nucleotide sequence or a portion of the amino acid sequence and hence protein encoded thereby. Fragments of a nucleotide sequence may encode protein fragments that retain the biological activity of the native protein and hence affect flowering by retaining RAP2.7-like activity or may include portions of non-coding regulatory element which retain the RAP2.7 modulating activity of VGT1. Alternatively, fragments of a nucleotide sequence that are useful as hybridization probes generally do not encode fragment proteins retaining biological activity. Thus, fragments of a nucleotide sequence may range from at least about 20 nucleotides, about 50 nucleotides, about 100 nucleotides and up to the full-length nucleotide sequence encoding the proteins or regulating RAP2.7 of the invention.

[0045] A fragment of a RAP2.7 nucleotide sequence that encodes a biologically active portion of a RAP2.7 protein of the invention will encode at least 12, 25, 30, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425 or 450, contiguous amino acids, or up to the total number of amino acids present in a full-length RAP2.7 protein of the invention.

[0046] A fragment of a VGT1 nucleotide sequence that encodes a biologically active non-transcribed RNA of the invention will encode at least 12, 25, 30, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675 or 680 contiguous nucleotide bases or up to the total number of nucleotides present in a full-length VGT1 regulatory element of the invention.

[0047] Fragments of a RAP2.7 or VGT1 nucleotide sequence that are useful as hybridization probes or PCR primers generally need not encode a biologically active portion of a protein or RNA. Thus, a fragment of a RAP2.7 or VGT1 nucleotide sequence may encode a biologically active portion of a RAP2.7 protein or a biologically active non-coding RNA, or it may be a fragment that can be used as a hybridization probe or PCR primer using methods disclosed below. A biologically active portion of a RAP2.7 protein or VGT1 regulatory element can be prepared by isolating a portion of the RAP2.7 or VGT1 nucleotide sequences of the invention, expressing the encoded portion of the Rap2.7 or the active portion of the VGT1 regulatory element (e.g., by recombinant expression in vitro), and assessing the activity of the encoded portion of the RAP2.7 protein or the regulating ability of the regulatory element on RAP2.7. Nucleic acid molecules that are fragments of a RAP2.7 or VGT1 nucleotide sequence comprise at least 16, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300 or 2400 nucleotides, or up to the number of nucleotides present in a full RAP2.7 or VGT1 nucleotide sequence disclosed herein.

[0048] By "variants" is intended substantially similar sequences. For nucleotide sequences, conservative variants include those sequences that, because of the degeneracy of the genetic code, encode the amino acid sequence of one of the polypeptides of the invention. Naturally occurring allelic variants such as these can be identified with the use of well-known molecular biology techniques, as, for example, with polymerase chain reaction (PCR) and hybridization techniques as outlined below. Variant nucleotide sequences also include synthetically-derived nucleotide sequences, such as those generated, for example, by using site-directed mutagenesis but which still encode a RAP2.7 protein or VGT1 regulatory element of the invention. Generally, variants of a particular nucleotide sequence of the invention will have at least 40%, 50%, 60%, 70%, generally at least 75%, 80%, 85%, or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to that particular nucleotide sequence as determined by sequence alignment programs described elsewhere herein using default parameters.

[0049] By "variant" protein is intended a protein derived from the native protein by deletion (so-called truncation) or addition of one or more amino acids to the N-terminal and/or C-terminal end of the native protein; deletion or addition of one or more amino acids at one or more sites in the native protein or substitution of one or more amino acids at one or more sites in the native protein. Variant proteins encompassed by the present invention are biologically active, that is they continue to possess the desired biological activity of the native protein, hence they will continue to possess at least one activity possessed by the native RAP2.7 protein. Such variants may result from, for example, genetic polymorphism or from human manipulation. Biologically active variants of a RAP2.7 native protein of the invention will have at least 40%, 50%, 60%, 70%, generally at least 75%, 80%, 85%, 86%, 87%, 88%, 89%, about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity to the amino acid sequence for the native protein as determined by sequence alignment programs described elsewhere herein using default parameters. A biologically active variant of a protein of the invention may differ from that protein by as few as 1-15 amino acid residues, as few as 1-10, as few as 5, as few as 4, 3, 2 or even 1 amino acid residue. As used herein, reference to a particular nucleotide or amino acid sequence (a RAP2.7 or VGT1 sequence) shall include all modified variants as described supra.

[0050] The proteins of the invention may be altered in various ways including amino acid substitutions, deletions, truncations, and insertions. Methods for such manipulations are generally known in the art. For example, amino acid sequence variants of RAP2.7 proteins can be prepared by mutations in the DNA. Methods for mutagenesis and nucleotide sequence alterations are well known in the art. See, for example, Kunkel, (1985) Proc. Nad. Acad. Sci. USA 82:488-492; Kunkel, et al., (1987) Methods in Enzymol. 154:367-382; U.S. Pat. No. 4,873,192; Walker and Gaastra, eds. (1983) Techniques in Molecular Biology (MacMillan Publishing Company, New York) and the references cited therein. Guidance as to appropriate amino acid substitutions that do not affect biological activity of the protein of interest may be found in the model of Dayhoff, et al., (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, D.C.), herein incorporated by reference. Conservative substitutions, such as exchanging one amino acid with another having similar properties, may be made.

[0051] Thus, the nucleotide sequences of the invention include both naturally occurring sequences as well as mutant forms. Likewise, the proteins of the invention encompass both naturally-occurring proteins as well as variations and modified forms thereof. Such variants whether protein or nucleotide will continue to possess the desired RAP2.7 or VGT1-like activity. It is recognized that variants need not retain all of the activities and/or properties of the native RAP2.7 or VGT1. Obviously, the mutations that will be made in the DNA encoding the RPA2.7 variant must not place the sequence out of reading frame and in some embodiments will not create complementary regions that could produce secondary mRNA structure. See, EP Patent Application Publication Number 75,444.

[0052] The deletions, insertions and substitutions of the protein or nucleotide sequences encompassed herein are not expected to produce radical changes in the characteristics of the RAP 2.7 protein or VGT1 regulatory element. However, when it is difficult to predict the exact effect of the substitution, deletion or insertion in advance of doing so, one skilled in the art will appreciate that the effect will be evaluated by routine screening assays. That is, the activity of RAP2.7 polypeptides or VGT1 can be evaluated by either a change in flowering time or maturity when the encoded protein or regulatory element is altered.

[0053] Variant nucleotide sequences and proteins also encompass sequences and proteins derived from a mutagenic and recombinogenic procedure such as DNA shuffling. With such a procedure, one or more different RAP2.7 or VGT1 coding sequences can be manipulated to create a new RAP2.7 or VGT1 possessing the desired properties. In this manner, libraries of recombinant polynucleotides are generated from a population of related sequence polynucleotides comprising sequence regions that have substantial sequence identity and can be homologously recombined in vitro or in vivo. For example, using this approach, sequence motifs encoding a domain of interest may be shuffled between the RAP2.7 encoding polynucleotide of the invention and other known flowering genes to obtain a new gene coding for a protein with an improved property of interest, such as an increased K.sub.m in the case of an enzyme. Strategies for such DNA shuffling are known in the art. See, for example, Stemmer, (1994) Proc. Natl. Acad. Sci. USA 91:10747-10751; Stemmer, (1994) Nature 370:389391; Crameri, et al., (1997) Nature Biotech. 15:436-438; Moore, et al., (1997) J. Mol. Biol. 272:336-347; Zhang, et al., (1997) Proc. Natl. Acad. Sci. USA 94:4504-4509; Crameri, et al., (1998) Nature 391:288-291 and U.S. Pat. Nos. 5,605,793 and 5,837,458.

[0054] The compositions of the invention also include isolated nucleic acid molecules comprising the promoter nucleotide sequences natively associated with the RAP2.7 polynucleotides. By "promoter" is intended a regulatory region of DNA usually comprising a TATA box capable of directing RNA polymerase II to initiate RNA synthesis at the appropriate transcription initiation site for a particular coding sequence. A promoter may additionally comprise other recognition sequences generally positioned upstream or 5' to the TATA box, referred to as upstream promoter elements, which influence the transcription initiation rate.

[0055] The nucleotide sequences of the invention can be used to isolate corresponding sequences from other organisms, particularly other plants, more particularly other crop plants. In this manner, methods such as PCR, hybridization, and the like can be used to identify such sequences based on their sequence homology to the sequences set forth herein. Sequences isolated based on their sequence identity to the nucleotide sequences set forth herein or to fragments thereof are encompassed by the present invention. Such sequences include sequences that are orthologs of the disclosed sequences. By "orthologs" is intended genes derived from a common ancestral gene and which are found in different species as a result of speciation. Genes found in different species are considered orthologs when their nucleotide sequences and/or their encoded protein sequences share substantial identity as defined elsewhere herein. Functions of orthologs are often highly conserved among species. Thus, isolated sequences that have RAP2.7 or VGT1 activity or encode a RAP2.7 protein and which hybridize under stringent conditions to RAP2.7 or VGT1 sequences disclosed herein, or to fragments thereof, are encompassed by the present invention.

[0056] In a PCR approach, oligonucleotide primers can be designed for use in PCR reactions to amplify corresponding DNA sequences from cDNA or genomic DNA extracted from any plant of interest. Methods for designing PCR primers and PCR cloning are generally known in the art and are disclosed in Sambrook, et al., (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press Plainview, N.Y.). See also, Innis, et al., eds. (1990) PCR Protocols: A Guide to Methods and Applications (Academic Press, New York); Innis and Gelfand, eds. (1995) PCR Strategies (Academic Press, New York); and Innis and Gelfand, eds. (1999) PCR Methods Manual (Academic Press, New York). Known methods of PCR include, but are not limited to, methods using paired primers, nested primers, single specific primers, degenerate primers, gene-specific primers, vector-specific primers, partially-mismatched primers, and the like.

[0057] In hybridization techniques, all or part of a known nucleotide sequence is used as a probe that selectively hybridizes to other corresponding nucleotide sequences present it a population of cloned genomic DNA fragments or cDNA fragments (i.e., genomic or cDNA libraries) from a chosen organism. The hybridization probes may be genomic DNA fragments, cDNA fragments, RNA fragments or other oligonucleotides and may be labeled with a detectable group such as .sup.32P or any other detectable marker. Thus, for example, probes for hybridization can be made by labeling synthetic oligonucleotides based on the disease-resistant sequences of the invention. Methods for preparation of probes for hybridization and for construction of cDNA and genomic libraries are generally known in the art and are disclosed in Sambrook, et al., (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.).

[0058] For example, an entire sequence disclosed herein, or one or more portions thereof, may be used as a probe capable of specifically hybridizing to corresponding flowering or maturity regulating sequences, including promoters and messenger RNAs. To achieve specific hybridization under a variety of conditions, such probes include sequences that are unique among flowering or maturity related sequences and may be at least about 10 or 15 or 17 nucleotides in length or at least about 20 or 22 or 25 nucleotides in length. Such probes may be used to amplify corresponding sequences from a chosen organism by PCR. This technique may be used to isolate additional coding sequences from a desired organism or as a diagnostic assay to determine the presence of coding sequences in an organism. Hybridization techniques include hybridization screening of plated DNA libraries (either plaques or colonies; see, for example, Sambrook, et al., (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.).

[0059] Hybridization of such sequences may be carried out under stringent conditions. By "stringent conditions" or "stringent hybridization conditions" is intended conditions under which a probe will hybridize to its target sequence to a detectably greater degree than to other sequences (e.g., at least 2-fold over background). Stringent conditions are sequence-dependent and will be different under different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences that are 100% complementary to the probe can be identified (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing). Generally, a probe is less than about 1000 nucleotides in length or less than 500 nucleotides in length.

[0060] Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3. Incubation should be at a temperature of least about 30.degree. C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60.degree. C. for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulfate) at 37.degree. C., and a wash in 1.times. to 2.times.SSC (20.times.SSC=3.0 M NaCl, 0.3 M trisodium citrate) at 50 to 55.degree. C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37.degree. C., and a wash in 0.5.times. to 1.times.SSC at 55 to 60.degree. C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37.degree. C., and a wash in 0.1.times.SSC at 60 to 65.degree. C. for 20 minutes. Optionally, wash buffers may comprise about 0.1% to about 1% SDS. Duration of hybridization is generally less than about 24 hours, usually about 4 to about 12 hours.

[0061] Specificity is typically a function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, the T.sub.m, can be approximated from the equation of Meinkoth and Wahl, (1984) Anal. Biochem. 138:267-284: Trn=81.5.degree. C.+16.6 (log M)+0.41 (% GC)--0.61 (% form)-500/L; where M is the molarity of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. The T.sub.m, is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. T.sub.m, is reduced by about 1.degree. C. for each 1% of mismatching; thus, T.sub.m, hybridization and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the T.sub.m, can be decreased 10.degree. C. Generally, stringent conditions are selected to be about 5.degree. C. lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3 or 4.degree. C. lower than the thermal melting point (T.sub.m); moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9 or 10.degree. C. lower than the thermal melting point (Tm); low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15 or 20.degree. C. lower than the thermal melting point (Tm). Using the equation, hybridization and wash compositions, and desired T.sub.m, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a T.sub.m, of less than 45.degree. C. (aqueous solution) or 32.degree. C. (formamide solution), the SSC concentration may be increased so that a higher temperature can be used. An extensive guide to the hybridization of nucleic acids is found in Tijssen, (1993) Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes, Part I, Chapter 2 (Elsevier, N.Y.); and Ausubel, et al., eds. (1995) Current Protocols in Molecular Biology, Chapter 2 (Greene Publishing and Wiley-Interscience, New York). See Sambrook, et al., (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.).

[0062] In general, sequences that encode a RAP2.7 protein or which encode a VGT1 regulatory element and which hybridize to the RAP2.7 or VGT1 sequences disclosed herein will be at least about 70% homologous, and even about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 98%, 99% or more homologous with the disclosed sequences. That is, the sequence identity of the sequences may be from about 70% or 75%, and even about 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical or higher, so that the sequences may differ by only 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid residue or by 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleic acid.

[0063] The following terms are used to describe the sequence relationships between two or more nucleic acids or polynucleotides: (a) "reference sequence," (b) "comparison window," (c) "sequence identity," (d) "percentage of sequence identity" and (e) "substantial identity."

[0064] (a) As used herein, "reference sequence" is a defined sequence used as a basis for sequence comparison. A reference sequence may be a subset or the entirety of a specified sequence; for example, as a segment of a full-length cDNA or gene sequence or the complete cDNA or gene sequence.

[0065] (b) As used herein, "comparison window" makes reference to a contiguous and specified segment of a polynucleotide sequence, wherein the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Generally, the comparison window is at least 20 contiguous nucleotides in length, and optionally can be 30, 40, 50, 100 or longer. Those of skill in the art understand that to avoid a high similarity to a reference sequence due to inclusion of gaps in the polynucleotide sequence a gap penalty is typically introduced and is subtracted from the number of matches.

[0066] Methods of alignment of sequences for comparison are well known in the art. Thus, the determination of percent sequence identity between any two sequences can be accomplished using a mathematical algorithm. Non-limiting examples of such mathematical algorithms are the algorithm of Myers and Miller, (1988) CABIOS 4:11-17; the local homology algorithm of Smith, et al., (1981) Adv. Appl. Math. 2:482; the homology alignment algorithm of Needleman and Wunsch, (1970) J. Mol. Biol. 48:443-453; the search-for-similarity-method of Pearson and Lipman, (1988) Proc. Natl. Acad. Sci. 85:2444-2448; the algorithm of Karlin and Altschul, (1990) Proc. Natl. Acad. Sci. USA 872264, modified as in Karlin and Altschul, (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877.

[0067] Computer implementations of these mathematical algorithms can be utilized for comparison of sequences to determine sequence identity. Such implementations include, but are not limited to: CLUSTAL in the PC/Gene program (available from Intelligenetics, Mountain View, Calif.); the ALIGN program (Version 2.0) and GAP, BESTFIT, BLAST, FASTA and TFASTA in the Wisconsin Genetics Software Package, Version 8 (available from Genetics Computer Group (GCG), 575 Science Drive, Madison, Wis., USA). Alignments using these programs can be performed using the default parameters. The CLUSTAL program is well described by Higgins, et al., (1988) Gene 73:237-244; Higgins, et al., (1989) CABIOS 5:151-153; Corpet, et al., (1988) Nucleic Acids Res. 16:10881-90; Huang, et al., (1992) CABIOS 8:155-65 and Pearson, et al., (1994) Meth. Mol. Biol. 24:307-331. The ALIGN program is based on the algorithm of Myers and Miller, (1988) supra. A PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used with the ALIGN program when comparing amino acid sequences. The BLAST programs of Altschul, et al., (1990) J. Mol. Biol. 215:403 are based on the algorithm of Karlin and Altschul, (1990) supra. BLAST nucleotide searches can be performed with the BLASTN program, score=100, wordlength=12, to obtain nucleotide sequences homologous to a nucleotide sequence encoding a protein of the invention. BLAST protein searches can be performed with the BLASTX program, score=50, wordlength=3, to obtain amino acid sequences homologous to a protein or polypeptide of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST (in BLAST 2.0) can be utilized as described in Altschul, et al., (1997) Nucleic Acids Res. 25:3389. Alternatively, PSI-BLAST (in BLAST 2.0) can be used to perform an iterated search that detects distant relationships between molecules. See Altschul, et al., (1997) supra. When utilizing BLAST, Gapped BLAST or PSI-BLAST, the default parameters of the respective programs (e.g., BLASTN for nucleotide sequences, BLASTX for proteins) can be used (see information at www.ncbi.nlm.nih.gov). Alignment may also be performed manually by inspection.

[0068] Unless otherwise stated, sequence identity/similarity values provided herein refer to the value obtained using GAP version 10 using the following parameters: % identity using GAP Weight of 50 and Length Weight of 3; % similarity using Gap Weight of 12 and Length Weight of 4, or any equivalent program. By "equivalent program" is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide or amino acid residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by GAP Version 10. GAP uses the algorithm of Needleman and Wunsch, (1970) J. Mol. Biol. 48:443-453, to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps. GAP considers all possible alignments and gap positions and creates the alignment with the largest number of matched bases and the fewest gaps. It allows for the provision of a gap creation penalty and a gap extension penalty in units of matched bases. GAP must make a profit of gap creation penalty number of matches for each gap it inserts. If a gap extension penalty greater than zero is chosen, GAP must, in addition, make a profit for each gap inserted of the length of the gap times the gap extension penalty. Default gap creation penalty values and gap extension penalty values in Version 10 of the Wisconsin Genetics Software Package for protein sequences are 8 and 2, respectively. For nucleotide sequences the default gap creation penalty is 50 while the default gap extension penalty is 3. The gap creation and gap extension penalties can be expressed as an integer selected from the group of integers consisting of from 0 to 200. Thus, for example, the gap creation and gap extension penalties can be 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65 or greater.

[0069] GAP presents one member of the family of best alignments. There may be many members of this family, but no other member has a better quality. GAP displays four figures of merit for alignments: Quality, Ratio, Identity and Similarity. The Quality is the metric maximized in order to align the sequences. Ratio is the quality divided by the number of bases in the shorter segment. Percent Identity is the percent of the symbols that actually match. Percent Similarity is the percent of the symbols that are similar. Symbols that are across from gaps are ignored. A similarity is scored when the scoring matrix value for a pair of symbols is greater than or equal to 0.50, the similarity threshold. The scoring matrix used in Version 10 of the Wisconsin Genetics Software Package is BLOSUM62 (see, Henikoff and Henikoff, (1989) Proc. Natl. Acad. Sci. USA 89:10915).

[0070] (c) As used herein, "sequence identity" or "identity" in the context of two nucleic acid or polypeptide sequences makes reference to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window. When percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. When sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity." Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, Calif.).

[0071] (d) As used herein, "percentage of sequence identity" means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.

[0072] (e)(i) The term "substantial identity" of polynucleotide sequences means that a polynucleotide comprises a sequence that has at least 70%, 80%, 85%, 90%, 95% or higher sequence identity compared to a reference sequence using one of the alignment programs described using standard parameters. One of skill in the art will recognize that these values can be appropriately adjusted to determine corresponding identity of proteins encoded by two nucleotide sequences by taking into account codon degeneracy, amino acid similarity, reading frame positioning, and the like. Substantial identity of amino acid sequences for these purposes normally means sequence identity of at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or at least 95% or higher sequence identity.

[0073] Another indication that nucleotide sequences are substantially identical is if two molecules hybridize to each other under stringent conditions. Generally, stringent conditions are selected to be about 5.degree. C. lower than the thermal melting point (Trr,) for the specific sequence at a defined ionic strength and pH. However, stringent conditions encompass temperatures in the range of about 1.degree. C. to about 20.degree. C. lower than the T.sub.m, depending upon the desired degree of stringency as otherwise qualified herein. Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides they encode are substantially identical. This may occur, e.g., when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code. One indication that two nucleic acid sequences are substantially identical is when the polypeptide encoded by the first nucleic acid is immunologically cross-reactive with the polypeptide encoded by the second nucleic acid.

[0074] (e)(ii) The term "substantial identity" in the context of a peptide indicates that a peptide comprises a sequence with at least 70%, 75%, 80%, 83%, 85%, 88%, 90%, 93%, 95%, 96%, 97%, 98% or 99% or higher sequence identity to the reference sequence over a specified comparison window. Preferably, optimal alignment is conducted using the homology alignment algorithm of Needleman and Wunsch, (1970) J Mol. Biol. 48:443453. An indication that two peptide sequences are substantially identical is that one peptide is immunologically reactive with antibodies raised against the second peptide. Thus, a peptide is substantially identical to a second peptide, for example, where the two peptides differ only by a conservative substitution. Peptides that are "substantially similar" share sequences as noted above except that residue positions that are not identical may differ by conservative amino acid changes.

[0075] Methods for altering flowering time in a plant are provided. In some embodiments, the methods involve stably transforming a plant with a DNA construct comprising a nucleotide sequence of the invention operably linked to a promoter that drives expression (or transcription) in a plant. While the choice of promoter will depend on the desired timing and location of expression of the nucleotide sequences, desirable promoters include constitutive and tissue specific promoters. These methods may find use in agriculture, particularly in changing the maturity of a particular crop plant to alter its area of adaptation. Thus, transformed plants, plant cells, plant tissues and seeds thereof are provided by the present invention.

[0076] In another embodiment, the methods of the present invention involve identifying phenotypes associated with an altered flowering time by loss of RAP2.7 or VGT1 activity in plants that contain transposon insertions within the nucleotide sequences herein.

[0077] In some embodiments, the nucleic acid molecules comprising RAP2.7 or VGT1 sequences of the invention are provided in expression cassettes or nucleotide constructs for expression/transcription in the plant of interest. Such cassettes will include 5' and 3' regulatory sequences operably linked to a RAP2.7 or VGT1 nucleotide sequence of the invention. By "operably linked" is intended a functional linkage between a promoter and a second sequence, wherein the promoter sequence initiates and mediates transcription of the DNA sequence corresponding to the second sequence. The cassette may additionally contain at least one additional nucleotide sequence to be cotransformed into the organism. Alternatively, the additional sequence(s) can be provided on multiple expression cassettes or nucleotide construct.

[0078] Such an expression cassette or nucleotide construct is provided with a plurality of restriction sites for insertion of the RAP2.7 or VGT1 sequence to be under the transcriptional regulation of the regulatory regions. The expression cassette or nucleotide construct may additionally contain selectable marker genes. The expression cassette will include in the 5'-3' direction of transcription, a transcriptional and if necessary a translational initiation region, a RAP2.7 or VGT1 nucleotide sequence of the invention, and a transcriptional and if necessary, translational termination region functional in plants. The transcriptional initiation region, or promoter, may be native or analogous or foreign or heterologous to the plant host. Additionally, the promoter may be the natural sequence or alternatively a synthetic sequence. By "foreign" is intended that the transcriptional initiation region is not found in the native plant into which the transcriptional initiation region is introduced. As used herein, a "chimeric gene" comprises a coding sequence operably linked to a transcription initiation region that is heterologous to the coding sequence.

[0079] While it may be preferable to regulate RAP2.7 or VGT1 sequences using heterologous promoters, the native promoter sequences may be used. Such constructs would change expression levels of the RAP2.7 or amounts of the VGT1 regulatory element present in the plant or plant cell. Thus, the phenotype of the plant or plant cell is altered.

[0080] The termination region may be native with the transcriptional initiation region, may be native with the operably linked DNA sequence of interest or may be derived from another source. Convenient termination regions are available from the Ti-plasmid of A. tumefaciens, such as the octopine synthase and nopaline synthase termination regions. See also, Guerineau, et al., (1991) Mol. Gen. Genet. 262:141-144; Proudfoot, (1991) Cell 64:671-674; Sanfacon, et al., (1991) Genes Dev. 5:141-149; Mogen, et al., (1990) Plant Cell 2:1261-1272; Munroe, et al., (1990) Gene 91:151-158; Ballas, et al., (1989) Nucleic Acids Res. 17:7891-7903 and Joshi, et al., (1987) Nucleic Acid Res. 15:9627-9639. Where appropriate, the gene(s) may be optimized for increased expression in the transformed plant. That is, the genes can be synthesized using plant-preferred codons for improved expression. Methods are available in the art for synthesizing plant-preferred genes. See, for example, U.S. Pat. Nos. 5,380,831 and 5,436,391 and Murray, et al., (1989) Nucleic Acids Res. 17:477-498, herein incorporated by reference.

[0081] Additional sequence modifications are known to enhance gene expression in a cellular host. These include elimination of sequences encoding spurious polyadenylation signals, exon-intron splice site signals, transposon-like repeats and other such well characterized sequences that may be deleterious to gene expression. The G-C content of the sequence may be adjusted to enhance expression in a given host cell. When possible, the sequence is modified to avoid predicted hairpin secondary mRNA structures.

[0082] The expression cassettes/nucleotide constructs may additionally contain 5' leader sequences in the expression cassette construct. Such leader sequences can act to enhance translation. Translation leaders are known in the art and include: picornavirus leaders, for example, EMCV leader (Encephalomyocarditis 5' noncoding region) (Elroy-Stein, et al., (1989) Proc. Nat'l. Acad. Sci. USA 86:6126-6130); potyvirus leaders, for example, TEV leader (Tobacco Etch Virus) (Allison, et al., (1986); MDMV leader (Maize Dwarf Mosaic Virus); Virology 154:9-20) and human immunoglobulin heavy-chain binding protein (BiP), (Macejak, et al., (1991) Nature 353:90-94); untranslated leader from the coat protein mRNA of alfalfa mosaic virus (AMV RNA 4) (Jobling, et al., (1987) Nature 325:622625); tobacco mosaic virus leader (TMV) (Gallie, et al., (1989) in Molecular Biology of RNA, ed. Cech, (Liss, New York), pp. 237-256) and maize chlorotic mottle virus leader (MCMV) (Lommel, et al., (1991) Virology 81:382-385). See also, Della-Cioppa, et al., (1987) Plant Physiol. 84:965-968. Other methods known to enhance translation can also be utilized, for example, introns, and the like.

[0083] In those instances where it is desirable to have the expressed product of the heterologous nucleotide sequence of interest directed to a particular organelle, such as the chloroplast or mitochondrion, or secreted at the cell's surface or extracellularly, the expression cassette may further comprise a coding sequence for a transit peptide. Such transit peptides are well known in the art and include, but are not limited to, the transit peptide for the acyl carrier protein, the small subunit of RUBISCO, plant EPSP synthase, and the like.

[0084] In preparing the expression cassette/nucleotide construct, the various DNA fragments may be manipulated so as to provide for the DNA sequences in the proper orientation and, as appropriate, in the proper reading frame. Toward this end, adapters or linkers may be employed to join the DNA fragments or other manipulations may be involved to provide for convenient restriction sites, removal of superfluous DNA, removal of restriction sites, or the like. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, resubstitutions, e.g., transitions and transversions, may be involved.

[0085] Generally, the expression cassette/nucleotide construct will comprise a selectable marker gene for the selection of transformed cells. Selectable marker genes are utilized for the selection of transformed cells or tissues. Marker genes include genes encoding antibiotic resistance, such as those encoding neomycin phosphotransferase II (NEO) and hygromycin phosphotransferase (HPT), as well as genes conferring resistance to herbicidal compounds, such as glufosinate ammonium, bromoxynil, imidazolinones, and 2,4-dichlorophenoxyacetate (2,4-D). See generally, Yarranton, (1992) Curr. Opin. Biotech. 3:506-511; Christopherson, et al., (1992) Proc. Nad. Acad. Sci. USA 89:6314-6318; Yao, et al., (1992) Cell 71:63-72; Reznikoff, (1992) Mol. Microbiol. 6:2419-2422; Barkley, et al., (1980) in The Operon, pp. 177-220; Hu, et al., (1987) Cell 48:555-566; Brown, et al., (1987) Cell 49:603-612; Figge, et al., (1988) Cell 52:713-722; Deuschle, et al., (1989) Proc. Nad. Acad. Sci. USA 86:5400-5404; Fuerst, et al., (1989) Proc. Nad. Acad. Sci. USA 86:2549-2553; Deuschle, et al., (1990) Science 248:480-483; Gossen, (1993) Ph.D. Thesis, University of Heidelberg; Reines, et al., (1993) Proc. Nad. Acad. Sci. USA 90:1917-1921; Labow, et al., (1990) Mol. Cell. Biol. 10:3343-3356; Zambretti, et al., (1992) Proc. Nad. Acad. Sci. USA 89:3952-3956; Baim, et al., (1991) Proc. Nad. Acad. Sci. USA 88:5072-5076; Wyborski, et al., (1991) Nucleic Acids Res. 19:4647-4653; Hillenand-Wissman, (1989) Topics Mol. Struc. Biol. 10:143-162; Degenkolb, et al., (1991) Antimicrob. Agents Chemother. 35:1591-1595; Kleinschnidt, et al., (1988) Biochemistry 27:1094-1104; Bonin, (1993) Ph.D. Thesis, University of Heidelberg; Gossen, et al., (1992) Proc. Nad. Acad. Sci. USA 89:5547-5551; Oliva, et al., (1992) Antimicrob. Agents Chemother. 36:913-919; Hlavka, et al., (1985) Handbook of Experimental Pharmacology, Vol. 78 (Springer-Verlag, Berlin); Gill, et al., (1988) Nature 334:721-724. Such disclosures are herein incorporated by reference.

[0086] The above list of selectable marker genes is not meant to be limiting. Any selectable marker gene can be used in the present invention. A number of promoters can be used in the practice of the invention. The promoters can be selected based on the desired outcome. That is, the nucleic acids can be combined with constitutive, tissue-preferred, or other promoters for expression in plants. Constitutive promoters include, for example, the core promoter of the Rsyn7 promoter and other constitutive promoters disclosed in WO 1999/43838 and U.S. Pat. No. 6,072,050; the core CaMV 35S promoter (Odell, et al., (1985) Nature 313:810-812); rice actin (McElroy, et al., (1990) Plant Cell 2:163-171); ubiquitin (Christensen, et al., (1989) Plant Mol. Biol. 12:619-632 and Christensen, et al., (1992) Plant Mol. Biol. 18:675-689); pEMU (Last, et al., (1991) Theor. Appl. Genet. 81:581-588); MAS (Velten, et al., (1984) EMBO J. 3:2723-2730); ALS promoter (U.S. Pat. No. 5,659,026) and the like. Other constitutive promoters include, for example, U.S. Pat. Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142 and 6,177,611.

[0087] Chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator. Depending upon the objective, the promoter may be a chemical-inducible promoter, where application of the chemical induces gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression. Chemical-inducible promoters are known in the art and include, but are not limited to: the maize In2-2 promoter, which is activated by benzenesulfonamide herbicide safeners; the maize GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides; and the tobacco PR-1 a promoter, which is activated by salicylic acid. Other chemical-regulated promoters of interest include steroid-responsive promoters. See, for example, the glucocorticoid-inducible promoter in Schena, et al., (1991) Proc. Nad. Acad. Sci. USA 88:10421-10425 and McNellis, et al., (1998) Plant J. 14(2):247-257) and tetracycline-inducible and tetracycline-repressible promoters (for example, Gatz, et al., (1991) Mol. Gen. Genet. 227:229-237 and U.S. Pat. Nos. 5,814,618 and 5,789,156), herein incorporated by reference.

[0088] Tissue-preferred promoters can be utilized to target enhanced gene expression within a particular plant tissue. Tissue-preferred promoters include Yamamoto, et al., (1997) Plant J 12(2):255-265; Kawamata, et al., (1997) Plant Cell Physiol. 38(7):792-803; Hansen, et al., (1997) Mol. Gen. Genet. 254(3):337-343; Russell, et al., (1997) Transgenic Res. 6(2):157-168; Rinehart, et al., (1996) Plant Physiol. 112(3):1331-1341; Van Camp, et al., (1996) Plant Physiol. 112(2):525-535; Canevascini, et al., (1996) Plant Physiol. 112(2):513-524; Yamamoto, et al., (1994) Plant Cell Physiol. 35(5):773-778; Lam, (1994) Results Probl. Cell Differ. 20:181-196; Orozco, et al., (1993) Plant Mol. Biol. 23(6):1129-1138; Matsuoka, et al., (1993) Proc Natl. Acad. Sci. USA 90(20):9586-9590 and Guevara-Garcia, et al., (1993) Plant J. 4(3):495-505. Such promoters can be modified, if necessary, for weak expression. Leaf-specific promoters are known in the art. See, for example, Yamamoto, et al., (1997) Plant J. 12(2):255-265; Kwon, et al., (1994) Plant Physiol. 105:357-67; Yamamoto, et al., (1994) Plant Cell Physiol. 35(5):773-778; Gotor, et al., (1993) Plant J 3:509-18; Orozco, et al., (1993) Plant Mol. Biol. 23(6):1129-1138 and Matsuoka, et al., (1993) Proc. Nad. Acad. Sci. USA 90(20):9586-9590.

[0089] Where low level expression is desired, weak promoters will be used. Generally, by "weak promoter" is intended a promoter that drives expression of a coding sequence at a low level. By low level is intended at levels of about 1/1000 transcripts to about 1/100,000 transcripts to about 1/500,000 transcripts per cell. Alternatively, it is recognized that weak promoters also include promoters that are expressed in only a few cells and not in others to give a total low level of expression. Where a promoter is expressed at unacceptably high levels, portions of the promoter sequence can be deleted or modified to decrease expression levels. Such weak constitutive promoters include, for example, the core promoter of the Rsyn7 promoter (WO 1999/43838 and U.S. Pat. No. 6,072,050), the core 35S CaMV promoter, and the like. Other constitutive promoters include, for example, U.S. Pat. Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463 and 5,608,142. See also, U.S. Pat. No. 6,177,611, herein incorporated by reference.

[0090] As used herein, "vector" refers to a molecule such as a plasmid, cosmid or bacterial phage for introducing a nucleotide construct and/or expression cassette into a host cell. Cloning vectors typically contain one or a small number of restriction endonuclease recognition sites at which foreign nucleotide sequences can be inserted in a determinable fashion without loss of essential biological function of the vector, as well as a marker gene that is suitable for use in the identification and selection of cells transformed with the cloning vector. Marker genes typically include genes that provide tetracycline resistance, hygromycin resistance or ampicillin resistance.

[0091] The methods of the invention involve introducing a nucleotide construct into a plant. By "introducing" is intended presenting to the plant the nucleotide construct in such a manner that the construct gains access to the interior of a cell of the plant. The methods of the invention do not depend on a particular method for introducing a nucleotide construct to a plant, only that the nucleotide construct gains access to the interior of at least one cell of the plant. Methods for introducing nucleotide constructs into plants are known in the art including, but not limited to, stable transformation methods, transient transformation methods and virus-mediated methods.

[0092] By "stable transformation" is intended that the nucleotide construct introduced into a plant integrates into the genome of the plant and is capable of being inherited by progeny thereof. By "transient transformation" is intended that a nucleotide construct introduced into a plant does not integrate into the genome of the plant.

[0093] The nucleotide constructs of the invention may be introduced into plants by contacting plants with a virus or viral nucleic acids. Generally, such methods involve incorporating a nucleotide construct of the invention within a viral DNA or RNA molecule. It is recognized that the RAP2.7 protein of the invention may be initially synthesized as part of a viral polyprotein, which later may be processed by proteolysis in vivo or in vitro to produce the desired recombinant protein. Further, it is recognized that promoters of the invention also encompass promoters utilized for transcription by viral RNA polymerases. Methods for introducing nucleotide constructs into plants and expressing a protein encoded therein, involving viral DNA or RNA molecules, are known in the art. See, for example, U.S. Pat. Nos. 5,889,191, 5,889,190, 5,866,785, 5,589,367 and 5,316,931, herein incorporated by reference.

[0094] A variety of other transformation protocols are contemplated in the present invention. Transformation protocols as well as protocols for introducing nucleotide sequences into plants may vary depending on the type of plant or plant cell, i.e., monocot or dicot, targeted for transformation. Suitable methods of introducing nucleotide sequences into plant cells and subsequent insertion into the plant genome include microinjection (Crossway, et al., (1986) Biotechniques 4:320-334), electroporation (Riggs, et al., (1986) Proc. Nad. Acad. Sci. USA 83:5602-5606, Agrobacterium-mediated transformation (Townsend, et al., U.S. Pat. No. 5,563,055; Zhao, et al., U.S. Pat. No. 5,981,840), direct gene transfer (Paszkowski, et al., (1984) EMBO J. 3:2717-2722), and ballistic particle acceleration (see, for example, Sanford, et al., U.S. Pat. No. 4,945,050; Tomes, et al., U.S. Pat. No. 5,879,918; Tomes, et al., U.S. Pat. No. 5,886,244; Bidney, et al., U.S. Pat. No. 5,932,782; Tomes, et al., (1995) "Direct DNA Transfer into Intact Plant Cells via Microprojectile Bombardment," in Plant Cell, Tissue, and Organ Culture Fundamental Methods, eds. Gamborg and Phillips (Springer-Verlag, Berlin); McCabe, et al., (1988) Biotechnology 6:923-926); and Lecl transformation (WO 2000/28058, published May 18, 2000). Also see, Weissinger, et al., (1988) Ann. Rev. Genet. 22:421-477; Sanford, et al., (1987) Particulate Science and Technology 5:27-37 (onion); Christoul, et al., (1988) Plant Physiol. 87:671-674 (soybean); McCabe, et al., (1988) Bio/Technology 6:923-926 (soybean); Finer and McMullen, (1991) In Vitro Cell Dev. Biol. 27P:175-182 (soybean); Singh, et al., (1998) Theor. Appl. Genet. 96:319-324 (soybean); Datta, et al., (1990) Biotechnology 8:736-740 (rice); Klein, et al., (1988) Proc. Nad. Acad. Sci. USA 85:43054309 (maize); Klein, et al., (1988) Biotechnology 6:559-563 (maize); Tomes, U.S. Pat. No. 5,240,855; Buising et al., U.S. Pat. Nos. 5,322,783 and 5,324,646; Tomes, et al., (1995) `Direct DNA Transfer into Intact Plant Cells via Microprojectile Bombardment," in Plant Cell, Tissue, and Organ Culture: Fundamental Methods, ed. Gamborg (Springer-Verlag, Berlin) (maize); Klein, et al., (1988) Plant Physiol. 91:440-444 (maize); Fromm, et al., (1990) Biotechnology 8:833-839 (maize); Hooykaas-Van Slogteren, et al., (1984) Nature (London) 311:763-764; Bowen, et al., U.S. Pat. No. 5,736,369 (cereals); Bytebier, et al., (1987) Proc. Nad. Acad. Sci. USA 84:5345-5349 (Liliaceae); De Wet, et al., (1985) in The Experimental Manipulation of Ovule Tissues, ed. Chapman, et al. (Longman, N.Y.), pp. 197-209 (pollen); Kaeppler, et al., (1990) Plant Cell Reports 9:415-418 and Kaeppler, et al., (1992) Theor. Appl. Genet. 84:560-566 (whisker-mediated transformation); D'Halluin, et al., (1992) Plant Cell 4:1495-1505 (electroporation); Li, et al., (1993) Plant Cell Reports 12:250-255 and Christou and Ford, (1995) Annals of Botany 75:407-413 (rice); Osjoda, et al., (1996) Nature Biotechnology 14:745-750 (maize via Agrobacterium tumefaciens), all of which are herein incorporated by reference.

[0095] The cells that have been transformed may be grown into plants in accordance with conventional ways. See, for example, McCormick, et al., (1986) Plant Cell Reports 5:81-84. These plants may then be grown, and either pollinated with the same transformed strain or different strains, and the resulting hybrid having constitutive expression of the desired phenotypic characteristic identified. Two or more generations may be grown to ensure that constitutive expression of the desired phenotypic characteristic is stably maintained and inherited and then seeds harvested to ensure constitutive expression of the desired phenotypic characteristic has been achieved.

[0096] The present invention may be used for transformation of any plant species, including, but not limited to, monocots and dicots. Examples of plant species of interest include, but are not limited to, corn (Zea mays), Brassica spp. (e.g., B. napus, B. rapa, B. juncea), particularly those Brassica species useful as sources of seed oil, alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), millet (e.g., pearl millet (Pennisetum glaucum), proso millet (Panicum miliaceum), foxtail millet (Setaria italica), finger millet (Eleusine coracana)), sunflower (Helianthus annuus), safflower (Carthamus tinctorius), wheat (Triticum aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium barbadense, Gossypium hirsutum), sweet potato (Ipomoea batatus), cassaya (Manihot esculenta), coffee (Coffea spp.), coconut (Cocos nucifera), pineapple (Ananas comosus), citrus trees (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia sinensis), banana (Musa spp.), avocado (Persea americana), fig (Ficus casica), guava (Psidium guajava), mango (Mangifera indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentale), macadamia (Macadamia integrifolia), almond (Prunus amygdalus), sugar beets (Beta vulgaris), sugarcane (Saccharum spp.), oats, barley, vegetables, ornamentals and conifers.

[0097] Vegetables include tomatoes (Lycopersicon esculentum), lettuce (e.g., Lactuca sativa), green beans (Phaseolus vulgaris), lima beans (Phaseolus limensis), peas (Lathyrus spp.) and members of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C. cantalupensis), and musk melon (C. melo). Ornamentals include azalea (Rhododendron spp.), hydrangea (Macrophylla hydrangea), hibiscus (Hibiscus rosasanensis), roses (Rosa spp.), tulips (Tulipa spp.), daffodils (Narcissus spp.), petunias (Petunia hybrida), carnation (Dianthus caryophyllus), poinsettia (Euphorbia pulcherrima) and chrysanthemum.

[0098] Conifers that may be employed in practicing the present invention include, for example, pines such as loblolly pine (Pinus taeda), slash pine (Pinus elliotii), ponderosa pine (Pinus ponderosa), lodgepole pine (Pinus contorta), and Monterey pine (Pinus radiata); Douglas-fir (Pseudotsuga menziesii); Western hemlock (Tsuga canadensis); Sitka spruce (Picea glauca); redwood (Sequoia sempervirens); true firs such as silver fir (Abies amabilis) and balsam fir (Abies balsamea) and cedars such as Western red cedar (Thujaplicata) and Alaska yellow cedar (Chamaecyparis nootkatensis). Plants of the present invention may be crop plants (for example, alfalfa, sunflower, Brassica, cotton, safflower, peanut, sorghum, wheat, millet, tobacco, etc.), corn or soybean plants.

[0099] Plants of particular interest include grain plants that provide seeds of interest, oil-seed plants and leguminous plants. Seeds of interest include grain seeds, such as corn, wheat, barley, rice, sorghum, rye, etc. Oil-seed plants include cotton, soybean, safflower, sunflower, Brassica, maize, alfalfa, palm, coconut, etc. Leguminous plants include beans and peas. Beans include guar, locust bean, fenugreek, soybean, garden beans, cowpea, mungbean, lima bean, fava bean, lentils, chickpea, etc.

[0100] It is recognized that with these nucleotide sequences, gene silencing such as antisense constructions complementary to at least a portion of the messenger RNA (mRNA) for RAP2.7 or VGT1 sequences can be constructed. Antisense nucleotides are constructed to hybridize with the corresponding mRNA. Modifications of the antisense sequences may be made as long as the sequences hybridize to and interfere with expression of the corresponding mRNA. In this manner, antisense constructions having 70%, 80%, 85%, 90%, 95% or more sequence identity to the corresponding antisense sequences may be used. Furthermore, portions of the antisense nucleotides may be used to disrupt the expression of the target gene. Generally, sequences of at least 50 nucleotides, 100 nucleotides, 200 nucleotides or greater may be used.

[0101] Gene silencing refers to posttranscriptional interference with gene expression. Techniques such as antisense, co-suppression, and RNA interference (RNAi), for example, have been shown to be effective in gene silencing. (For reviews, see, Arndt and Rank, (1997) Genome 40(6):785-797; Turner and Schuch, (2000) Journal of Chemical Technology and Biotechnology 75(10):869-882; Klink and Wolniak, (2000) Journal of Plant Growth Regulation 19(4):371-384)

[0102] Antisense technology can be used to control gene expression through antisense DNA or RNA or through double- or triple-helix formation. Antisense techniques are discussed, for example, in Okano, (1991) Neurochem 56:560; OLIGODEOXYNUCLEOTIDES AS ANTISENSE INHIBITORS OF GENE EXPRESSION, CRC Press, Boca Raton, Fla. (1988). Triple helix formation is discussed in, for instance Lee, et al., (1979) Nucleic Acids Research 6:3073; Cooney, et al., (1988) Science 241:456 and Dervan, et al., (1991) Science 251:1360. The methods are based on binding of a polynucleotide to a complementary DNA or RNA. For example, the 5' coding portion of a polynucleotide that encodes the mature polypeptide of the present invention may be used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription, thereby preventing transcription and the production of cytokinin biosynthetic enzymes. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into cytokinin biosynthetic enzymes. The oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of cytokinin biosynthetic enzymes. The DNAs of this invention may also be employed to co-suppress or silence the cytokinin metabolic enzyme genes; for example, as described in PCT Patent Application Publication WO 1998/36083.

[0103] The RAP 2.7 nucleotide sequence operably linked to the regulatory elements herein can be an antisense sequence for a targeted gene. By "antisense DNA nucleotide sequence" is intended a sequence that is in inverse orientation to the 5'-to-3' normal orientation of that nucleotide sequence. When delivered into a plant cell, expression of the antisense DNA sequence prevents normal expression of the DNA nucleotide sequence for the targeted gene. The antisense nucleotide sequence encodes an RNA transcript that is complementary to and capable of hybridizing with the endogenous messenger RNA (mRNA) produced by transcription of the DNA nucleotide sequence for the targeted gene. In this case, production of the native protein encoded by the targeted gene is inhibited to achieve a desired phenotypic response. Thus the regulatory sequences disclosed herein can be operably linked to antisense DNA sequences to reduce or inhibit expression of a native protein in the plant seed.

[0104] It is also recognized that the level and/or activity of the polypeptide may be modulated by employing a polynucleotide that is not capable of directing, in a transformed plant, the expression of a protein or an RNA. For example, the polynucleotides of the invention may be used to design polynucleotide constructs that can be employed in methods for altering or mutating a genomic nucleotide sequence in an organism. Such polynucleotide constructs include, but are not limited to, RNA:DNA vectors, RNA:DNA mutational vectors, RNA:DNA repair vectors, mixed-duplex oligonucleotides, self-complementary RNA:DNA oligonucleotides and recombinogenic oligonucleobases. Such nucleotide constructs and methods of use are known in the art. See, U.S. Pat. Nos. 5,565,350; 5,731,181; 5,756,325; 5,760,012; 5,795,972 and 5,871,984, all of which are herein incorporated by reference. See also, WO 1998/49350, WO 1999/07865, WO 1999/25821 and Beetham, et al., (1999) Proc. Natl. Acad. Sci. USA 96:8774-8778; herein incorporated by reference. It is therefore recognized that methods of the present invention do not depend on the incorporation of the entire polynucleotide into the genome, only that the plant or cell thereof is altered as a result of the introduction of the polynucleotide into a cell. In one embodiment of the invention, the genome may be altered following the introduction of the polynucleotide into a cell. For example, the polynucleotide, or any part thereof, may incorporate into the genome of the plant. Alterations to the genome of the present invention include, but are not limited to, additions, deletions, and substitutions of nucleotides into the genome. While the methods of the present invention do not depend on additions, deletions, and substitutions of any particular number of nucleotides, it is recognized that such additions, deletions or substitutions comprises at least one nucleotide.

[0105] Methods are provided to reduce or eliminate the activity of a RAP2.7 polypeptide of the invention by transforming a plant cell with an expression cassette that expresses a polynucleotide that inhibits the expression of the RAP2.7 polypeptide. The polynucleotide may inhibit the expression of the Rap2.7 polypeptide directly, by preventing translation of the RAP2.7 messenger RNA, or indirectly, by encoding a polypeptide that inhibits the transcription or translation of a RAP2.7 gene encoding a RAP2.7 polypeptide. Methods for inhibiting or eliminating the expression of a gene in a plant are well known in the art, and any such method may be used in the present invention to inhibit the expression of a RAP2.7 polypeptide.

[0106] In some embodiments of the present invention, a plant is transformed with an expression cassette that is capable of expressing a polynucleotide that inhibits the expression of a RAP2.7 polypeptide of the invention. The term "expression" as used herein refers to the biosynthesis of a gene product, including the transcription and/or translation of said gene product. For example, for the purposes of the present invention, an expression cassette capable of expressing a polynucleotide that inhibits the expression of at least one RAP2.7 polypeptide is an expression cassette capable of producing an RNA molecule that inhibits the transcription and/or translation of at least one RAP2.7 polypeptide of the invention. The "expression" or "production" of a protein or polypeptide from a DNA molecule refers to the transcription and translation of the coding sequence to produce the protein or polypeptide, while the "expression" or "production" of a protein or polypeptide from an RNA molecule refers to the translation of the RNA coding sequence to produce the protein or polypeptide.

[0107] Examples of polynucleotides that inhibit the expression of a RAP2.7 polypeptide are given below.

i. Sense Suppression/Cosuppression

[0108] In some embodiments of the invention, inhibition of the expression of a RAP2.7 polypeptide may be obtained by sense suppression or cosuppression. For cosuppression, an expression cassette is designed to express an RNA molecule corresponding to all or part of a messenger RNA encoding a RAP2.7 polypeptide in the "sense" orientation. Over expression of the RNA molecule can result in reduced expression of the native gene. Accordingly, multiple plant lines transformed with the cosuppression expression cassette are screened to identify those that show the greatest inhibition of RAP2.7 polypeptide expression.

[0109] The polynucleotide used for cosuppression may correspond to all or part of the sequence encoding the RAP2.7 polypeptide, all or part of the 5' and/or 3' untranslated region of a RAP2.7 polypeptide transcript, or all or part of both the coding sequence and the untranslated regions of a transcript encoding a RAP2.7 polypeptide. In some embodiments where the polynucleotide comprises all or part of the coding region for the RAP2.7 polypeptide, the expression cassette is designed to eliminate the start codon of the polynucleotide so that no protein product will be translated.

[0110] Cosuppression may be used to inhibit the expression of plant genes to produce plants having undetectable protein levels for the proteins encoded by these genes. See, for example, Broin, et al., (2002) Plant Cell 14:1417-1432. Cosuppression may also be used to inhibit the expression of multiple proteins in the same plant. See, for example, U.S. Pat. No. 5,942,657. Methods for using cosuppression to inhibit the expression of endogenous genes in plants are described in Flavell, et al., (1994) Proc. Natl. Acad. Sci. USA 91:3490-3496; Jorgensen, et al., (1996) Plant Mol. Biol. 31:957-973; Johansen and Carrington, (2001) Plant Physiol. 126:930-938; Broin, et al., (2002) Plant Cell 14:1417-1432; Stoutjesdijk, et al., (2002) Plant Physiol. 129:1723-1731; Yu, et al., (2003) Phytochemistry 63:753-763 and U.S. Pat. Nos. 5,034,323, 5,283,184 and 5,942,657, each of which is herein incorporated by reference. The efficiency of cosuppression may be increased by including a poly-dT region in the expression cassette at a position 3' to the sense sequence and 5' of the polyadenylation signal. See, US Patent Publication Number 2002/0048814, herein incorporated by reference. Typically, such a nucleotide sequence has substantial sequence identity to the sequence of the transcript of the endogenous gene, optimally greater than about 65% sequence identity, more optimally greater than about 85% sequence identity, most optimally greater than about 95% sequence identity. See, U.S. Pat. Nos. 5,283,184 and 5,034,323, herein incorporated by reference.

ii. Antisense Suppression

[0111] In some embodiments of the invention, inhibition of the expression of the RAP2.7 polypeptide may be obtained by antisense suppression. For antisense suppression, the expression cassette is designed to express an RNA molecule complementary to all or part of a messenger RNA encoding the RAP2.7 polypeptide. Over expression of the antisense RNA molecule can result in reduced expression of the native gene. Accordingly, multiple plant lines transformed with the antisense suppression expression cassette are screened to identify those that show the greatest inhibition of RAP2.7 polypeptide expression.

[0112] The polynucleotide for use in antisense suppression may correspond to all or part of the complement of the sequence encoding the RAP2.7 polypeptide, all or part of the complement of the 5' and/or 3' untranslated region of the RAP2.7 transcript, or all or part of the complement of both the coding sequence and the untranslated regions of a transcript encoding the RAP2.7 polypeptide. In addition, the antisense polynucleotide may be fully complementary (i.e., 100% identical to the complement of the target sequence) or partially complementary (i.e., less than 100% identical to the complement of the target sequence) to the target sequence. Antisense suppression may be used to inhibit the expression of multiple proteins in the same plant. See, for example, U.S. Pat. No. 5,942,657. Furthermore, portions of the antisense nucleotides may be used to disrupt the expression of the target gene. Generally, sequences of at least 50 nucleotides, 100 nucleotides, 200 nucleotides, 300, 400, 450, 500, 550 or greater may be used. Methods for using antisense suppression to inhibit the expression of endogenous genes in plants are described, for example, in Liu, et al., (2002) Plant Physiol. 129:1732-1743 and U.S. Pat. Nos. 5,759,829 and 5,942,657, each of which is herein incorporated by reference. Efficiency of antisense suppression may be increased by including a poly-dT region in the expression cassette at a position 3' to the antisense sequence and 5' of the polyadenylation signal. See, US Patent Publication Number 2002/0048814, herein incorporated by reference.

iii. Double-Stranded RNA Interference

[0113] In some embodiments of the invention, inhibition of the expression of a RAP2.7 polypeptide may be obtained by double-stranded RNA (dsRNA) interference. For dsRNA interference, a sense RNA molecule like that described above for cosuppression and an antisense RNA molecule that is fully or partially complementary to the sense RNA molecule are expressed in the same cell, resulting in inhibition of the expression of the corresponding endogenous messenger RNA.

[0114] Expression of the sense and antisense molecules can be accomplished by designing the expression cassette to comprise both a sense sequence and an antisense sequence. Alternatively, separate expression cassettes may be used for the sense and antisense sequences. Multiple plant lines transformed with the dsRNA interference expression cassette or expression cassettes are then screened to identify plant lines that show the greatest inhibition of RAP2.7 polypeptide expression. Methods for using dsRNA interference to inhibit the expression of endogenous plant genes are described in Waterhouse, et al., (1998) Proc. Natl. Acad. Sci. USA 95:13959-13964, Liu, et al., (2002) Plant Physiol. 129:1732-1743 and WO 1999/49029, WO 1999/53050, WO 1999/61631 and WO 2000/49035, each of which is herein incorporated by reference.

iv. Hairpin RNA Interference and Intron-Containing Hairpin RNA Interference

[0115] In some embodiments of the invention, inhibition of the expression of one or a RAP2.7 polypeptide may be obtained by hairpin RNA (hpRNA) interference or intron-containing hairpin RNA (ihpRNA) interference. These methods are highly efficient at inhibiting the expression of endogenous genes. See, Waterhouse and Helliwell, (2003) Nat. Rev. Genet. 4:29-38 and the references cited therein.

[0116] For hpRNA interference, the expression cassette is designed to express an RNA molecule that hybridizes with itself to form a hairpin structure that comprises a single-stranded loop region and a base-paired stem. The base-paired stem region comprises a sense sequence corresponding to all or part of the endogenous messenger RNA encoding the gene whose expression is to be inhibited, and an antisense sequence that is fully or partially complementary to the sense sequence. Thus, the base-paired stem region of the molecule generally determines the specificity of the RNA interference. hpRNA molecules are highly efficient at inhibiting the expression of endogenous genes, and the RNA interference they induce is inherited by subsequent generations of plants. See, for example, Chuang and Meyerowitz, (2000) Proc. Natl. Acad. Sci. USA 97:4985-4990; Stoutjesdijk, et al., (2002) Plant Physiol. 129:1723-1731 and Waterhouse and Helliwell, (2003) Nat. Rev. Genet. 4:29-38. Methods for using hpRNA interference to inhibit or silence the expression of genes are described, for example, in Chuang and Meyerowitz, (2000) Proc. Natl. Acad. Sci. USA 97:4985-4990; Stoutjesdijk, et al., (2002) Plant Physiol. 129:1723-1731; Waterhouse and Helliwell, (2003) Nat. Rev. Genet. 4:29-38; Pandolfini, et al., BMC Biotechnology 3:7 and US Patent Application Publication Number 2003/0175965, each of which is herein incorporated by reference. A transient assay for the efficiency of hpRNA constructs to silence gene expression in vivo has been described by Panstruga, et al., (2003) Mol. Biol. Rep. 30:135-140, herein incorporated by reference.

[0117] For ihpRNA, the interfering molecules have the same general structure as for hpRNA, but the RNA molecule additionally comprises an intron that is capable of being spliced in the cell in which the ihpRNA is expressed. The use of an intron minimizes the size of the loop in the hairpin RNA molecule following splicing, and this increases the efficiency of interference. See, for example, Smith, et al., (2000) Nature 407:319-320. In fact, Smith, et al., show 100% suppression of endogenous gene expression using ihpRNA-mediated interference. Methods for using ihpRNA interference to inhibit the expression of endogenous plant genes are described, for example, in Smith, et al., (2000) Nature 407:319-320; Wesley, et al., (2001) Plant J. 27:581-590; Wang and Waterhouse, (2001) Curr. Opin. Plant Biol. 5:146-150; Waterhouse and Helliwell, (2003) Nat. Rev. Genet. 4:29-38; Helliwell and Waterhouse, (2003) Methods 30:289-295 and US Patent Application Publication Number 2003/0180945, each of which is herein incorporated by reference.

[0118] The expression cassette for hpRNA interference may also be designed such that the sense sequence and the antisense sequence do not correspond to an endogenous RNA. In this embodiment, the sense and antisense sequence flank a loop sequence that comprises a nucleotide sequence corresponding to all or part of the endogenous messenger RNA of the target gene. Thus, it is the loop region that determines the specificity of the RNA interference. See, for example, WO 2002/00904, herein incorporated by reference.

v. Amplicon-Mediated Interference

[0119] Amplicon expression cassettes comprise a plant virus-derived sequence that contains all or part of the target gene but generally not all of the genes of the native virus. The viral sequences present in the transcription product of the expression cassette allow the transcription product to direct its own replication. The transcripts produced by the amplicon may be either sense or antisense relative to the target sequence (i.e., the messenger RNA for the RAP2.7 polypeptide). Methods of using amplicons to inhibit the expression of endogenous plant genes are described, for example, in Angell and Baulcombe, (1997) EMBO J. 16:3675-3684, Angell and Baulcombe, (1999) Plant J. 20:357-362 and U.S. Pat. No. 6,646,805, each of which is herein incorporated by reference.

vi. Ribozymes

[0120] In some embodiments, the polynucleotide expressed by the expression cassette of the invention is catalytic RNA or has ribozyme activity specific for the messenger RNA of the RAP2.7 polypeptide. Thus, the polynucleotide causes the degradation of the endogenous messenger RNA, resulting in reduced expression of the RAP2.7 polypeptide.

[0121] This method is described, for example, in U.S. Pat. No. 4,987,071, herein incorporated by reference.

vii. Small Interfering RNA or Micro RNA

[0122] In some embodiments of the invention, inhibition of the expression of a RAP2.7 polypeptide may be obtained by RNA interference by expression of a gene encoding a micro RNA (miRNA). miRNAs are regulatory agents consisting of about 22 ribonucleotides. miRNA are highly efficient at inhibiting the expression of endogenous genes. See, for example Javier, et al., (2003) Nature 425:257-263, herein incorporated by reference.

[0123] For miRNA interference, the expression cassette is designed to express an RNA molecule that is modeled on an endogenous miRNA gene. The miRNA gene encodes an RNA that forms a hairpin structure containing a 22-nucleotide sequence that is complementary to another endogenous gene (target sequence). For suppression of RAP2.7 expression, the 22-nucleotide sequence is selected from a RAP2.7 transcript sequence and contains 22 nucleotides of said RAP2.7 sequence in sense orientation and 21 nucleotides of a corresponding antisense sequence that is complementary to the sense sequence. miRNA molecules are highly efficient at inhibiting the expression of endogenous genes, and the RNA interference they induce is inherited by subsequent generations of plants.

[0124] The availability of reverse genetics systems, which are well-known in the art, makes the generation and isolation of down-regulated or null mutants feasible, given the availability of a defined nucleic acid sequence, as provided herein. One such system (the Trait Utility System for Corn, i.e., TUSC) is based on successful systems from other organisms (Ballinger, et al., (1989) Proc. Natl. Acad. Sci. USA 86:9402-9406; Kaiser, et al., (1990) Proc. Natl. Acad. Sci. USA 87:1686-1690 and Rushforth, et al., (1993) Mol. Cell. Biol. 13:902-910). The central feature of the system is to identify Mu transposon insertions within a DNA sequence of interest in anticipation that at least some of these insertion alleles will be mutants. See, U.S. Pat. Nos. 6,300,542 and 5,962,764. To develop the system, DNA was collected from a large population of Mutator transposon stocks that were then self-pollinated to produced F2 seed. To find Mu transposon insertions within a specific DNA sequence, the collection of DNA samples is screened via PCR using a gene-specific primer and a primer that anneals to the inverted repeats of Mu transposons. A PCR product is expected only when the template DNA comes from a plant that contains a Mu transposon insertion within the target gene. Once such a DNA sample is identified, F2 seed from the corresponding plant is screened for a transposon insertion allele. Transposon insertion mutations of the an1 gene have been obtained via the TUSC procedure (Bensen, et al., (1995)). This system is applicable to other plant species, at times modified in accordance with knowledge and skills reasonably attributed to ordinary artisans.

[0125] The use of the term "nucleotide constructs" herein is not intended to limit the present invention to nucleotide constructs comprising DNA. Those of ordinary skill in the art will recognize that nucleotide constructs, particularly polynucleotides and oligonucleotides, comprised of ribonucleotides and combinations of ribonucleotides and deoxyribonucleotides may also be employed in the methods disclosed herein. Thus, the nucleotide constructs of the present invention encompass all nucleotide constructs that can be employed in the methods of the present invention for transforming plants including, but not limited to, those comprised of deoxyribonucleotides, ribonucleotides and combinations thereof. Such deoxyribonucleotides and ribonucleotides include both naturally occurring molecules and synthetic analogues. The nucleotide constructs of the invention also encompass all forms of nucleotide constructs including, but not limited to, single-stranded forms, double-stranded forms, hairpins, stem-and-loop structures, and the like.

[0126] Furthermore, it is recognized that the methods of the invention may employ a nucleotide construct that is capable of directing, in a transformed plant, the expression of at least one protein, or at least one RNA, such as, for example, an antisense RNA that is complementary to at least a portion of an mRNA. Typically such a nucleotide construct is comprised of a coding sequence for a protein or an RNA operably linked to 5' and 3' transcriptional regulatory regions. Alternatively, it is also recognized that the methods of the invention may employ a nucleotide construct that is not capable of directing, in a transformed plant, the expression of a protein or an RNA.

[0127] In addition, it is recognized that methods of the present invention do not depend on the incorporation of the entire nucleotide construct into the genome. Rather, the methods of the present invention only require that the plant or cell thereof is altered as a result of the introduction of the nucleotide construct into a cell. In one embodiment of the invention, the genome may be altered following the introduction of the nucleotide construct into a cell. For example, the nucleotide construct, or any part thereof, may incorporate into the genome of the plant. Alterations to the genome of the present invention include, but are not limited to, additions, deletions, and substitutions of nucleotides in the genome. While the methods of the present invention do not depend on additions, deletions or substitutions of any particular number of nucleotides, it is recognized that such additions, deletions or substitutions comprise at least one nucleotide.

[0128] In certain embodiments the nucleic acid sequences of the present invention can be used in combination ("stacked") with other polynucleotide sequences of interest in order to create plants with a desired phenotype. The combinations generated can include multiple copies of any one or more of the polynucleotides of interest. The polynucleotides of the present invention may be stacked with any gene or combination of genes to produce plants with a variety of desired trait combinations, including but not limited to traits desirable for animal feed such as high oil genes (e.g., U.S. Pat. No. 6,232,529); balanced amino acids (e.g., hordothionins (U.S. Pat. Nos. 5,990,389; 5,885,801; 5,885,802 and 5,703,409); barley high lysine (Williamson, et al., (1987) Eur. J. Biochem. 165:99-106 and WO 1998/20122) and high methionine proteins (Pedersen, et al., (1986) J. Biol. Chem. 261:6279; Kirihara, et al., (1988) Gene 71:359 and Musumura, et al., (1989) Plant Mol. Biol. 12:123)); increased digestibility (e.g., modified storage proteins (U.S. patent application Ser. No. 10/053,410, filed Nov. 7, 2001) and thioredoxins (U.S. patent application Ser. No. 10/005,429, filed Dec. 3, 2001)), the disclosures of which are herein incorporated by reference. The polynucleotides of the present invention can also be stacked with traits desirable for insect, disease or herbicide resistance (e.g., Bacillus thuringiensis toxic proteins (U.S. Pat. Nos. 5,366,892; 5,747,450; 5,737,514; 5723,756; 5,593,881; Geiser, et al., (1986) Gene 48:109); lectins (Van Damme, et al., (1994) Plant Mol. Biol. 24:825); fumonisin detoxification genes (U.S. Pat. No. 5,792,931); avirulence and disease resistance genes (Jones, et al., (1994) Science 266:789; Martin, et al., (1993) Science 262:1432; Mindrinos, et al., (1994) Cell 78:1089); acetolactate synthase (ALS) mutants that lead to herbicide resistance such as the S4 and/or Hra mutations; inhibitors of glutamine synthase such as phosphinothricin or basta (e.g., bar gene) and glyphosate resistance (EPSPS gene)) and traits desirable for processing or process products such as high oil (e.g., U.S. Pat. No. 6,232,529); modified oils (e.g., fatty acid desaturase genes (U.S. Pat. No. 5,952,544; WO 1994/11516)); modified starches (e.g., ADPG pyrophosphorylases (AGPase), starch synthases (SS), starch branching enzymes (SBE) and starch debranching enzymes (SDBE)) and polymers or bioplastics (e.g., U.S. Pat. No. 5,602,321; beta-ketothiolase, polyhydroxybutyrate synthase and acetoacetyl-CoA reductase (Schubert, et al., (1988) J. Bacteriol. 170:5837-5847) facilitate expression of polyhydroxyalkanoates (PHAs)), the disclosures of which are herein incorporated by reference. One could also combine the polynucleotides of the present invention with polynucleotides affecting agronomic traits such as male sterility (e.g., see, U.S. Pat. No. 5,583,210), stalk strength, flowering time or transformation technology traits such as cell cycle regulation or gene targeting (e.g., WO 1999/61619; WO 2000/17364; WO 1999/25821), the disclosures of which are herein incorporated by reference.

[0129] These stacked combinations can be created by any method, including but not limited to cross breeding plants by any conventional or TopCross methodology or genetic transformation. If the traits are stacked by genetically transforming the plants, the polynucleotide sequences of interest can be combined at any time and in any order. For example, a transgenic plant comprising one or more desired traits can be used as the target to introduce further traits by subsequent transformation. The traits can be introduced simultaneously in a co-transformation protocol with the polynucleotides of interest provided by any combination of transformation cassettes. For example, if two sequences will be introduced, the two sequences can be contained in separate transformation cassettes (trans) or contained on the same transformation cassette (cis). Expression of the sequences of interest can be driven by the same promoter or by different promoters. In certain cases, it may be desirable to introduce a transformation cassette that will suppress the expression of a polynucleotide of interest. This may be accompanied by any combination of other suppression cassettes or overexpression cassettes to generate the desired combination of traits in the plant.

[0130] The nucleotide constructs of the invention also encompass nucleotide constructs that may be employed in methods for altering or mutating a genomic nucleotide sequence in an organism, including, but not limited to, chimeric vectors, chimeric mutational vectors, chimeric repair vectors, mixed-duplex oligonucleotides, self-complementary chimeric oligonucleotides and recombinogenic oligonucleobases. Such nucleotide constructs and methods of use, such as, for example, chimeraplasty, are known in the art. Chimeraplasty involves the use of such nucleotide constructs to introduce site-specific changes into the sequence of genomic DNA within an organism, e.g., U.S. Pat. Nos. 5,565,350; 5,731,181; 5,756,325; 5,760,012; 5,795,972 and 5,871,984, all of which are herein incorporated by reference. See also, WO 1998/49350, WO 1999/07865, WO 1999/25821, and Beetham, et al., (1999) Proc. Nad. Acad. Sci. USA 96:8774-8778, herein incorporated by reference. The following examples are offered by way of illustration and not by way of limitation. All references cited herein are hereby expressly incorporated in their entirety herein by reference.

[0131] Other embodiments of the invention include the use of VGT1 and its alternate forms described herein as markers to screen for and identify plants which may have altered maturity. The invention thus relates to genetic markers for plants with altered maturity. The markers represent polymorphic variants of the non-coding regulatory element VGT1 that are associated with RAP2.7 regulation and thus provides a method of genotyping plants to determine those more likely to have flowering time that is altered from wildtype.

[0132] Thus, the invention relates to genetic markers and methods of identifying those markers in plants, whereby the plant is more likely to have a maturity that is earlier than normal by means of a mutant VGT1 which does not down regulate RAP2.7 appropriately.

[0133] Any method of identifying the presence or absence of these markers may be used, including, for example, single-strand conformation polymorphism (SSCP) analysis, base excision sequence scanning (BESS), RFLP analysis, heteroduplex analysis, denaturing gradient gel electrophoresis and temperature gradient electrophoresis, allelic PCR, ligase chain reaction direct sequencing, mini sequencing, nucleic acid hybridization, micro-array-type detection of the VGT1 regulatory element.

[0134] The following is a general overview of techniques which can be used to assay for the polymorphisms of the invention.

[0135] In the present invention, a sample of genetic material is obtained from a plant.

[0136] Isolation and Amplification of Nucleic Acid

[0137] Samples of genomic DNA are isolated from any convenient source including any suitable cell or tissue sample with intact interphase nuclei or metaphase cells. The cells can be obtained from solid tissue as from a fresh or preserved plant part or from a tissue sample. The sample can contain compounds which are not naturally intermixed with the biological material such as preservatives, anticoagulants, buffers, fixatives, nutrients, antibiotics, or the like.

[0138] Methods for isolation of genomic DNA from these various sources are described in, for example, Kirby, DNA Fingerprinting, An Introduction, W.H. Freeman & Co. New York (1992). Genomic DNA can also be isolated from cultured primary or secondary cell cultures or from transformed cell lines derived from any of the aforementioned tissue samples.

[0139] Samples of RNA can also be used. RNA can be isolated from tissues as described in Sambrook, et al., supra. RNA can be total cellular RNA, mRNA, poly A+RNA, or any combination thereof. For best results, the RNA is purified, but can also be unpurified cytoplasmic RNA. RNA can be reverse transcribed to form DNA which is then used as the amplification template, such that the PCR indirectly amplifies a specific population of RNA transcripts. See, e.g., Sambrook, supra, Kawasaki, et al., Chapter 8 in PCR Technology, (1992) supra, and Berg, et al., (1990) Hum. Genet. 85:655-658.

[0140] PCR Amplification

[0141] The most common means for amplification is polymerase chain reaction (PCR), as described in U.S. Pat. Nos. 4,683,195; 4,683,202 and 4,965,188, each of which is hereby incorporated by reference. Tissues should be roughly minced using a sterile, disposable scalpel and a sterile needle (or two scalpels) in a 5 mm Petri dish. Procedures for removing paraffin from tissue sections are described in a variety of specialized handbooks well known to those skilled in the art.

[0142] To amplify a target nucleic acid sequence in a sample by PCR, the sequence must be accessible to the components of the amplification system. Kits for the extraction of high-molecular weight DNA for PCR include a Genomic Isolation Kit A.S.A.P. (Boehringer Mannheim, Indianapolis, Ind.), Genomic DNA Isolation System (GIBCO BRL, Gaithersburg, Md.), Elu-Quik DNA Purification Kit (Schleicher & Schuell, Keene, N.H.), DNA Extraction Kit (Stratagene, LaJolla, Calif.), TurboGen Isolation Kit (Invitrogen, San Diego, Calif.), and the like. Use of these kits according to the manufacturer's instructions is generally acceptable for purification of DNA prior to practicing the methods of the present invention.

[0143] The concentration and purity of the extracted DNA can be determined by spectrophotometric analysis of the absorbance of a diluted aliquot at 260 nm and 280 nm. After extraction of the DNA, PCR amplification may proceed. The first step of each cycle of the PCR involves the separation of the nucleic acid duplex formed by the primer extension. Once the strands are separated, the next step in PCR involves hybridizing the separated strands with primers that flank the target sequence. The primers are then extended to form complementary copies of the target strands. For successful PCR amplification, the primers are designed so that the position at which each primer hybridizes along a duplex sequence is such that an extension product synthesized from one primer, when separated from the template (complement), serves as a template for the extension of the other primer. The cycle of denaturation, hybridization and extension is repeated as many times as necessary to obtain the desired amount of amplified nucleic acid.

[0144] In a particularly useful embodiment of PCR amplification, strand separation is achieved by heating the reaction to a sufficiently high temperature for a sufficient time to cause the denaturation of the duplex but not to cause an irreversible denaturation of the polymerase (see, U.S. Pat. No. 4,965,188, incorporated herein by reference). Typical heat denaturation involves temperatures ranging from about 80.degree. C. to 105.degree. C. for times ranging from seconds to minutes. Strand separation, however, can be accomplished by any suitable denaturing method including physical, chemical, or enzymatic means. Strand separation may be induced by a helicase, for example, or an enzyme capable of exhibiting helicase activity. For example, the enzyme RecA has helicase activity in the presence of ATP. The reaction conditions suitable for strand separation by helicases are known in the art (see, Kuhn Hoffman-Berling, (1978) CSH-Quantitative Biology, 43:63-67 and Radding, (1982) Ann. Rev. Genetics 16:405-436, each of which is incorporated herein by reference).

[0145] Template-dependent extension of primers in PCR is catalyzed by a polymerizing agent in the presence of adequate amounts of four deoxyribonucleotide triphosphates (typically dATP, dGTP, dCTP and dTTP) in a reaction medium comprised of the appropriate salts, metal cations and pH buffering systems. Suitable polymerizing agents are enzymes known to catalyze template-dependent DNA synthesis. In some cases, the target regions may encode at least a portion of a protein expressed by the cell. In this instance, mRNA may be used for amplification of the target region. Alternatively, PCR can be used to generate a cDNA library from RNA for further amplification, the initial template for primer extension is RNA. Polymerizing agents suitable for synthesizing a complementary, copy-DNA (cDNA) sequence from the RNA template are reverse transcriptase (RT), such as avian myeloblastosis virus RT, Moloney murine leukemia virus RT or Thermus thermophilus (Tth) DNA polymerase, a thermostable DNA polymerase with reverse transcriptase activity marketed by Perkin Elmer Cetus, Inc. Typically, the genomic RNA template is heat degraded during the first denaturation step after the initial reverse transcription step leaving only DNA template. Suitable polymerases for use with a DNA template include, for example, E. coli DNA polymerase I or its Klenow fragment, T4 DNA polymerase, Tth polymerase, and Taq polymerase, a heat-stable DNA polymerase isolated from Thermus aquaticus and commercially available from Perkin Elmer Cetus, Inc. The latter enzyme is widely used in the amplification and sequencing of nucleic acids. The reaction conditions for using Taq polymerase are known in the art and are described in Gelfand, (1989) PCR Technology, supra.

[0146] Allele Specific PCR

[0147] Allele-specific PCR differentiates between target regions differing in the presence of absence of a variation or polymorphism. PCR amplification primers are chosen which bind only to certain alleles of the target sequence. This method is described by Gibbs, Nucleic Acid Res. 17:12427-2448 (1989).

[0148] Allele Specific Oligonucleotide Screening Methods

[0149] Further diagnostic screening methods employ the allele-specific oligonucleotide (ASO) screening methods, as described by Saiki et al., Nature 324:163-166 (1986). Oligonucleotides with one or more base pair mismatches are generated for any particular allele. ASO screening methods detect mismatches between variant target genomic or PCR amplified DNA and non-mutant oligonucleotides, showing decreased binding of the oligonucleotide relative to a mutant oligonucleotide. Oligonucleotide probes can be designed so that under low stringency, they will bind to both polymorphic forms of the allele, but at high stringency, bind to the allele to which they correspond. Alternatively, stringency conditions can be devised in which an essentially binary response is obtained, i.e., an ASO corresponding to a variant form of the target gene will hybridize to that allele, and not to the wild-type allele.

[0150] Ligase Mediated Allele Detection Method

[0151] Target regions of a test subject's DNA can be compared with target regions in unaffected and affected family members by ligase-mediated allele detection. See Landegren et al., Science 241:107-1080 (1988). Ligase may also be used to detect point mutations in the ligation amplification reaction described in Wu et al., Genomics 4:560-569 (1989). The ligation amplification reaction (LAR) utilizes amplification of specific DNA sequence using sequential rounds of template dependent ligation as described in Wu, supra, and Barany, Proc. Nat. Acad. Sci. 88:189-193 (1990).

[0152] Denaturing Gradient Gel Electrophoresis

[0153] Amplification products generated using the polymerase chain reaction can be analyzed by the use of denaturing gradient gel electrophoresis. Different alleles can be identified based on the different sequence-dependent melting properties and electrophoretic migration of DNA in solution. DNA molecules melt in segments, termed melting domains, under conditions of increased temperature or denaturation. Each melting domain melts cooperatively at a distinct, base-specific melting temperature (T.sub.m). Melting domains are at least 20 base pairs in length, and may be up to several hundred base pairs in length.

[0154] Differentiation between alleles based on sequence specific melting domain differences can be assessed using polyacrylamide gel electrophoresis, as described in Chapter 7 of Erlich, ed., PCR Technology, "Principles and Applications for DNA Amplification", W.H. Freeman and Co., New York (1992), the contents of which are hereby incorporated by reference.

[0155] Generally, a target region to be analyzed by denaturing gradient gel electrophoresis is amplified using PCR primers flanking the target region. The amplified PCR product is applied to a polyacrylamide gel with a linear denaturing gradient as described in Myers et al., Meth. Enzymol. 155:501-527 (1986), and Myers et al., in Genomic Analysis, A Practical Approach, K. Davies Ed. IRL Press Limited, Oxford, pp. 95-139 (1988), the contents of which are hereby incorporated by reference. The electrophoresis system is maintained at a temperature slightly below the Tm of the melting domains of the target sequences.

[0156] In an alternative method of denaturing gradient gel electrophoresis, the target sequences may be initially attached to a stretch of GC nucleotides, termed a GC clamp, as described in Chapter 7 of Erlich, supra. Preferably, at least 80% of the nucleotides in the GC clamp are either guanine or cytosine. Preferably, the GC clamp is at least 30 bases long. This method is particularly suited to target sequences with high T.sub.m's.

[0157] Generally, the target region is amplified by the polymerase chain reaction as described above. One of the oligonucleotide PCR primers carries at its 5' end, the GC clamp region, at least 30 bases of the GC rich sequence, which is incorporated into the 5' end of the target region during amplification. The resulting amplified target region is run on an electrophoresis gel under denaturing gradient conditions as described above. DNA fragments differing by a single base change will migrate through the gel to different positions, which may be visualized by ethidium bromide staining.

[0158] Temperature Gradient Gel Electrophoresis

[0159] Temperature gradient gel electrophoresis (TGGE) is based on the same underlying principles as denaturing gradient gel electrophoresis, except the denaturing gradient is produced by differences in temperature instead of differences in the concentration of a chemical denaturant. Standard TGGE utilizes an electrophoresis apparatus with a temperature gradient running along the electrophoresis path. As samples migrate through a gel with a uniform concentration of a chemical denaturant, they encounter increasing temperatures. An alternative method of TGGE, temporal temperature gradient gel electrophoresis (TTGE or tTGGE) uses a steadily increasing temperature of the entire electrophoresis gel to achieve the same result. As the samples migrate through the gel the temperature of the entire gel increases, leading the samples to encounter increasing temperature as they migrate through the gel. Preparation of samples, including PCR amplification with incorporation of a GC clamp, and visualization of products are the same as for denaturing gradient gel electrophoresis.

[0160] Single-Strand Conformation Polymorphism Analysis

[0161] Target sequences or alleles at the VGT1 loci can be differentiated using single-strand conformation polymorphism analysis, which identifies base differences by alteration in electrophoretic migration of single-stranded PCR products, as described in Orita et al., Proc. Nat. Acad. Sci. 85:2766-2770 (1989). Amplified PCR products can be generated as described above, and heated or otherwise denatured, to form single-stranded amplification products. Single-stranded nucleic acids may refold or form secondary structures which are partially dependent on the base sequence. Thus, electrophoretic mobility of single-stranded amplification products can detect base-sequence difference between alleles or target sequences.

[0162] Chemical or Enzymatic Cleavage of Mismatches

[0163] Differences between target sequences can also be detected by differential chemical cleavage of mismatched base pairs, as described in Grompe et al., Am. J. Hum. Genet. 48:212-222 (1991). In another method, differences between target sequences can be detected by enzymatic cleavage of mismatched base pairs, as described in Nelson et al., Nature Genetics 4:11-18 (1993). Briefly, genetic material from a plant and an affected family member may be used to generate mismatch free heterohybrid DNA duplexes. As used herein, "heterohybrid" means a DNA duplex strand comprising one strand of DNA from one plant, and a second DNA strand from another plant, usually a plant differing in the phenotype for the trait of interest. Positive selection for heterohybrids free of mismatches allows determination of small insertions, deletions or other polymorphisms that may be associated with VGT1 polymorphisms.

[0164] Non-Gel Systems

[0165] Other possible techniques include non-gel systems such as TAQMAN.TM. (Perkin Elmer). In this system, oligonucleotide PCR primers are designed that flank the mutation in question and allow PCR amplification of the region. A third oligonucleotide probe is then designed to hybridize to the region containing the base subject to change between different alleles of the gene. This probe is labeled with fluorescent dyes at both the 5' and 3' ends. These dyes are chosen such that while in this proximity to each other the fluorescence of one of them is quenched by the other and cannot be detected. Extension by Taq DNA polymerase from the PCR primer positioned 5' on the template relative to the probe leads to the cleavage of the dye attached to the 5' end of the annealed probe through the 5' nuclease activity of the Taq DNA polymerase. This removes the quenching effect allowing detection of the fluorescence from the dye at the 3' end of the probe. The discrimination between different DNA sequences arises through the fact that if the hybridization of the probe to the template molecule is not complete, i.e., there is a mismatch of some form, the cleavage of the dye does not take place. Thus, only if the nucleotide sequence of the oligonucleotide probe is completely complimentary to the template molecule to which it is bound will quenching be removed. A reaction mix can contain two different probe sequences each designed against different alleles that might be present thus allowing the detection of both alleles in one reaction.

[0166] Yet another technique includes an Invader Assay, which includes isothermic amplification that relies on a catalytic release of fluorescence. See Third Wave Technology at world wide web at twt.com.

[0167] Non-PCR Based DNA Screening

[0168] Hybridization probes are generally oligonucleotides which bind through complementary base pairing to all or part of a target nucleic acid. Probes typically bind target sequences lacking complete complementarity with the probe sequence depending on the stringency of the hybridization conditions. The probes are preferably labeled directly or indirectly, such that by assaying for the presence or absence of the probe, one can detect the presence or absence of the target sequence. Direct labeling methods include radioisotope labeling, such as with P.sup.32 or S.sup.35. Indirect labeling methods include fluorescent tags, biotin complexes which may be bound to avidin or streptavidin, or peptide or protein tags. Visual detection methods include photoluminescents, Texas red, rhodamine and its derivatives, red leuco dye and 3,3',5,5'-tetramethylbenzidine (TMB), fluorescein, and its derivatives, dansyl, umbelliferone and the like or with horse radish peroxidase, alkaline phosphatase and the like.

[0169] Hybridization probes include any nucleotide sequence capable of hybridizing to the chromosome where VGT1 resides, and thus defining a genetic marker linked to VGT1, including a restriction fragment length polymorphism, a hypervariable region, repetitive element, or a variable number tandem repeat. Further suitable hybridization probes include exon fragments or portions of cDNAs or genes known to map to the relevant region of the chromosome.

[0170] Preferred tandem repeat hybridization probes for use according to the present invention are those that recognize a small number of fragments at a specific locus at high stringency hybridization conditions, or that recognize a larger number of fragments at that locus when the stringency conditions are lowered.

[0171] One or more additional restriction enzymes and/or probes and/or primers can be used. Additional enzymes, constructed probes, and primers can be determined by routine experimentation by those of ordinary skill in the art and are intended to be within the scope of the invention.

[0172] Although the methods described herein may be in terms of the use of a single restriction enzyme and a single set of primers, the methods are not so limited. One or more additional restriction enzymes and/or probes and/or primers can be used, if desired. Indeed, in some situations it may be preferable to use combinations of markers giving specific haplotypes. Additional enzymes, constructed probes and primers can be determined through routine experimentation, combined with the teachings provided and incorporated herein.

[0173] The sequences surrounding the polymorphism will facilitate the development of alternate PCR tests in which a primer of about 4-30 contiguous bases taken from the sequence immediately adjacent to the polymorphism is used in connection with a polymerase chain reaction to greatly amplify the region before treatment with the desired restriction enzyme. The primers need not be the exact complement; substantially equivalent sequences are acceptable. The design of primers for amplification by PCR is known to those of skill in the art and is discussed in detail in Ausubel (ed.), Short Protocols in Molecular Biology, 4th Edition, John Wiley and Sons (1999).

[0174] The following is a brief description of primer design.

[0175] Primer Design Strategy

[0176] Increased use of polymerase chain reaction (PCR) methods has stimulated the development of many programs to aid in the design or selection of oligonucleotides used as primers for PCR. Four examples of such programs that are freely available via the Internet are: PRIMER by Mark Daly and Steve Lincoln of the Whitehead Institute (UNIX, VMS, DOS, and Macintosh), Oligonucleotide Selection Program (OSP) by Phil Green and LaDeana Hiller of Washington University in St. Louis (UNIX, VMS, DOS, and Macintosh), PGEN by Yoshi (DOS only), and Amplify by Bill Engels of the University of Wisconsin (Macintosh only). Generally these programs help in the design of PCR primers by searching for bits of known repeated-sequence elements and then optimizing the T.sub.m by analyzing the length and GC content of a putative primer. Commercial software is also available and primer selection procedures are rapidly being included in most general sequence analysis packages.

[0177] Sequencing and PCR Primers

[0178] Designing oligonucleotides for use as either sequencing or PCR primers requires selection of an appropriate sequence that specifically recognizes the target, and then testing the sequence to eliminate the possibility that the oligonucleotide will have a stable secondary structure. Inverted repeats in the sequence can be identified using a repeat-identification or RNA-folding program such as those described above. If a possible stem structure is observed, the sequence of the primer can be shifted a few nucleotides in either direction to minimize the predicted secondary structure. The sequence of the oligonucleotide should also be compared with the sequences of both strands of the appropriate vector and insert DNA. Obviously, a sequencing primer should only have a single match to the target DNA. It is also advisable to exclude primers that have only a single mismatch with an undesired target DNA sequence. For PCR primers used to amplify genomic DNA, the primer sequence should be compared to the sequences in the GenBank database to determine if any significant matches occur. If the oligonucleotide sequence is present in any known DNA sequence or, more importantly, in any known repetitive elements, the primer sequence should be changed.

[0179] The following examples serve to better illustrate the invention and are not intended to limit the scope of the invention in any way. All references and patents disclosed herein are specifically incorporated herein in their entirety by reference. [0180] Salvi S., Morgante M., Fengler K., Meeley R., Ananiev E., Svitashev S., Bruggemann E., Niu X., Li B., Tingey S V., Tomes D., Miao G.-H., Phillips R L., Tuberosa R. Progress in the positional cloning of Vgt1, a QTL controlling flowering time in maize (2003). Proceedings of 57.sup.th Corn and Sorghum and 32.sup.nd Soybean Seed Research Conference. Dec. 11-13, 2002, Chicago. [0181] Phillips R. L., Kim T. S., Kaeppler S. M., Parentoni S. N., Shaver D. L., Stucker R. I. and Openshaw S. J. 1992. Genetic dissection of maturity using RFLPs. Proc. 47th Ann. Corn and Sorghum Res. Conf. 47:135-150. [0182] Vladutu, C., McLaughlin J. and Phillips R. L. 1999. Fine Mapping and Characterization of Linked Quantitative Trait Loci Involved in the Transition of the Maize Apical Meristem From Vegetative to Generative Structures. Genetics 153: 993-1007. [0183] Salvi S., Tuberosa R., Chiapparino E., Maccaferri M., Veillet S., van Beuningen L., Isaac P., Edward K. J., Phillips R. L. (2002). Toward positional cloning of Vgt1, a QTL controlling the transition from the vegetative to the reproductive phase in maize. Plant Mol Biol 48:601-613.

EXAMPLES

Example 1

RAP2.7 Expression Level is Associated with Differences in Maturity

[0184] It was determined that Rap2.7 gene expression level determines the transition to flowering in plants and that vgt1 is a cis-element that regulates RAP2.7 transcription. Two plants with different maturities (N28 and C22-4) were then screened to identify if the RAP2.7 expression levels differ between them.

[0185] RNA was synthesized from N28 and C22-4 from different tissues and stages of development, and RAP2.7 expression was measured by RT-PCR.

[0186] Tissue Types:

[0187] Mature leaves--exposed, blades+sheaths

[0188] Immature leaves--in whorl, blades+sheaths

[0189] Shoot apical meristems

[0190] Roots--whole, including root apical meristems

[0191] Stalks--leftovers

[0192] Developmental Stages

TABLE-US-00001 Sample Number Genotype 1 2 3 4 5 N28 (late) veg veg veg trans rep C22-4 (early) veg trans rep rep rep

[0193] Gene Expression Assay

[0194] First total RNA was prepared from frozen tissue samples. cDNA was then made by reverse transcriptase and the PAR2.7 region was amplified using PCR with agarose gel and ethidium bromide staining. Band fluorescence was quantified and tubulin was used as an internal control, and to normalize expression levels.

[0195] FIG. 1 shows the levels of RAP2.7 expression at Day: 14 before transition, C22-4 on transition at 20 days, and N28 at transition at 27 days. Last two dates have 3 samples of each. P values are significantly different at the first two sampling dates, but not at the latest date. There is RAP2.7 signal from meristems, and other tissues. RAP2.7 is a repressor of flowering, and must be below a particular level for flowering to occur.

[0196] The results indicate that RAP2.7 is expressed in every tissue type. RAP2.7 expression levels are lower in C22-4 than in N28 before the reproductive transition (mature leaves), and RAP2.7 expression levels decrease during development in both C22-4 and N28. Thus, overexpression of RAP2.7 will delay transition from vegetative state to flowering.

Example 2

Over-Expression of Maize Rap2.7 Under a Moderate-Strength Constitutive Promoter

[0197] The cDNA sequences of RAP2.7 were obtained from a RT-PCR experiment. Specifically, total RNA from C22-4 leaves was isolated and used as template in RT-PCR with gene-specific primers. The gene-specific primers were designed based on RAP2.7 genomic sequences from B73 genotype. The primer sequences are sense -ATGCAGTTGGATCTGAACGT (SEQ ID NO: 9) and antisense -GCCATCACCATCCCCGCTGA (SEQ ID NO:10).

[0198] The RT-PCR amplified fragment of RAP2.7, including the entire 1371-bp sequence including the ATG start codon and the TAG stop codon, was fused to the rice actin promoter and pinII terminator to produce an expression cassette. This expression cassette was then linked to a selectable marker cassette containing a bar gene driven by CaMV 35S promoter and a pinII terminator in FIG. 2.

[0199] Transgenic maize plants were produced by transforming Immature GS3 maize embryos with this expression cassette, using the Agrobacterium-based transformation method described as below.

[0200] For Agrobacterium-mediated transformation of maize with the expression cassette comprising the rice actin promoter operably linked to the maize RAP2.7 gene, the method of Zhao was employed (U.S. Pat. No. 5,981,840, and PCT patent publication WO98/32326; the contents of which are hereby incorporated by reference). While the method below is described for the transformation of maize plants with the actin promoter--RAP2.7 expression cassette, those of ordinary skill in the art recognize that this method can be used to produce transformed maize plants with any nucleotide construct or expression cassette of the invention that comprises a promoter operably linked to maize RAP2.7 gene for expression in a plant.

[0201] Briefly, immature embryos were isolated from maize and the embryos contacted with a suspension of Agrobacterium, where the bacteria are capable of transferring the ACTIN promoter-RAP2.7 expression cassette (illustrated above) to at least one cell of at least one of the immature embryos (step 1: the infection step). In this step the immature embryos were immersed in an Agrobacterium suspension for the initiation of inoculation. The embryos were co-cultured for a time with the Agrobacterium (step 2: the co-cultivation step). The immature embryos were cultured on solid medium following the infection step. Following this co-cultivation period an optional "resting" step was included. In this resting step, the embryos were incubated in the presence of at least one antibiotic known to inhibit the growth of Agrobacterium without the addition of a selective agent for plant transformants (step 3: resting step). The immature embryos were cultured on solid medium with antibiotic, but without a selecting agent, for elimination of Agrobacterium and for a resting phase for the infected cells. Next, inoculated embryos were cultured on medium containing a selective agent and growing transformed callus was recovered (step 4: the selection step). Preferably, the immature embryos were cultured on solid medium with a selective agent resulting in the selective growth of transformed cells. The resulting calli were then regenerated into plants by culturing the calli on solid, selective medium (step 5: the regeneration step).

[0202] The transformation produced 15 events in GS3XGaspe flint, an early-flowering genotype. Transformation in GS3XHC69, a normal maturity genotype, was problematic during shoot regeneration process and only produced 5 events. The problem was presumed to be related to the transgene. Two of the 5 events had delays in flowering time for up to 30 days. In GS3XGaspe flint genotype, majority (16 out of 20) of the events had various degrees of delay in flowering time, from 16 days to 36 days. In almost all events with delayed flowering, there was significant change in plant architecture, mostly increase in plant height and internode length.

[0203] Ectopic expression of Rap2.7 with the rice actin promoter resulted in over expression of the gene, and significantly delayed flowering as measured by the number of leaves (nodes) produced prior to flowering. According to the invention, vectors for transformation were produced in two corn genetic backgrounds (GS3 X HC69, and GS3 X GF, gaspe flint) using the Rap2.7 structural gene with the rice actin promoter.

[0204] A brief summary of the T0 phenotype from over-expressing RAP2.7 in maize is shown in the following tables. As a reference, GS3XGaspe plants coming out of tissue culture get pollinated (exuding silks) within 45-60 days, and have 10 or less leaves. Since these are T0 plants, accurate counts for leaf number and days to flowering are not possible. The plants that were late in flowering also had substantial increase in internode elongation, resulting in increase in plant height. These plants also had delayed senescence.

TABLE-US-00002 Events GS3XHC69 GS3XGaspe Late 2 16 Total 5 20

TABLE-US-00003 Days to Pollination GS3XGaspe Events .sup. <60 days 4 61-70 days 5 71-80 days 7 .sup. >81 days 1 no ear 3

TABLE-US-00004 Leaf Number (estimated) GS3XGaspe Events <10 4 10-12 10 13-14 4 >15 2

Example 3

Down-Regulation of Maize Rap2.7 by RNA Interference

[0205] Two fragments from the cDNA sequences of RAP2.7 from genotype C22-4 were cloned by PCR to create an inverted repeat as illustrated below. Specifically, a 955-bp fragment starting at 9-bp downstream from ATG was cloned by PCR and designated as ZM-RAP2.7 (TR1) as a truncated form. Another fragment, 499-bp in length starting from the same position, was cloned and designated as ZM-RAP2.7 (IR1) for inverted repeat FIG. 5.

[0206] FIG. 5 Illustration of construction of the RAP2.7 gene fragments for RNA interference vector. TR1 fragment was then ligated to IR1, with IR1 in reverse orientation. The ligated 2-piece fragment was then linked to rice actin promoter with actin 5'-UTR and actin intron1 to create a full expression cassette. This expression cassette was then linked to a selectable marker cassette containing a bar gene driven by CaMV 35S promoter and a pinII terminator.

[0207] FIG. 6 is an illustration of the vector used in transformation. Note only the portion between the right and left T-DNA borders (RB, LB) is shown. Transgenic maize plants were produced by transforming Immature GS3 maize embryos with this expression cassette, using the Agrobacterium-based transformation method described for the RAP2.7 over-expression study. The transformation produced 20 transgenic events from GS3XHC69, a genotype with a normal maturity; and 15 events from GS3XGaspe flint, an early-flowering genotype. Based on preliminary observation on TO plants, all 15 events from the GS3XGaspe flint background showed no visible change in flowering time. However, 9 out of the 20 GS3XHC69 transgenic events had various degrees of early flowering phenotype. The earliest event flowered approximately 2 week earlier compared to other events with the same construct, and to other unrelated transgenic plants in the same greenhouse room. All plants had normal plant architecture.

[0208] The T0 data shows that if you down regulate RAP2.7 earlier flowering is observed. The following table shows the next (T1) generation of plants. We can see from this data that the phenotype is heritable and stable and the initial trend of decreased days to pollination is still observed.

TABLE-US-00005 PHP21842 T1 Phenotype Event- Plant Transgene Leaf # Days to Pollination 1-1 + 15 58 1-2 + 13 55 1-3 + 15 57 2-1 + 14 57 2-2 + 14 54 2-3 + 13 53 3-1 + 14 57 3-2 + 13 57 3-3 + 14 59 Control + 19.2 66 average (n = 20)

Example 4

Positional Cloning of Vgt1

[0209] Positional cloning was completed after mapping Vgt1 in a 1.3-cM interval flanked by two AFLP markers (Salvi et al., 2002), in a cross between two nearly isogenic lines, N28 and its early derivative C22-4 (Vladutu et al., 1999). Following BAC library screening and the analysis of the relevant BAC contig, further development of new markers and genetic mapping allowed for the delimiting of Vgt1 within a ca. 2.7-kb region (FIG. 7.)

[0210] Sequencing of the relevant BAC clone and of the corresponding DNA region from the parental lines involved in the cross showed that Vgt1 lies within an intergenic region, ca. 75 kb upstream of an Ap-2 like gene (Rap2.7) and ca. 10 kb downstream of a RAD51-like gene. The 2.7 kb region found to be completely associated with Vgt1 is essentially a low-copy region with a number of polymorphisms between N28 and C22-4 (one of the polymorphisms is caused by the insertion of a MITE transposable element in C22-4).

[0211] Surprisingly, this sequence does not code for any known protein. It is hypothesized to either be a RNAi element or a regulatory RNA or DNA element that either directly regulates expression of flowering genes such as Rap2.7 or specifically targets expression of other genes which control flowering genes such as Rap2.7.

Example 5

Vgt1 is Associated with Maturity Shift in Inbred Lines

[0212] The information gathered with the positional cloning study allowed the testing of the 2.7 kb region as candidate for controlling flowering time through association mapping. Several SNPs and other polymorphisms identified at and around Vgt1 were screened on a panel of ca. 100 lines representative of cultivated maize germplasm (Remington et al., 2001) and a panel of elite proprietary lines.

[0213] Linkage disequilibrium at the Vgt1 region was quickly dissipated over distance of ca. 1 kb within the panel of 100 lines. Association analysis showed that among the genes and sequence at and around Vgt1, the only DNA region statistically associated with flowering time was a sub-region of ca. 2 kb within the same 2.7 kb region identified by positional cloning (FIG. 8.).

[0214] This element thus can be used as a sequence-based marker to identify inbred and hybrids which have altered maturity.

Sequence CWU 1

1

1411371DNAZea mays 1atgcagttgg atctgaacgt ggccgaggcg ccgccgccgg tggagatgga ggcgagcgac 60tcggggtcgt cggtgctgaa cgcgtcggaa gcggcgtcgg cgggcggcgc gcccgcgccg 120gcggaggagg gatctagctc aacgccggcc gtgctggagt tcagcatcct catccggagc 180gatagcgacg cggccggcgc ggacgaggac gaggacgcca cgccatcgcc tcctcctcgc 240caccgccacc agcaccagca gcagctcgtg acccgcgagc tgttcccggc cggcgccggt 300ccgccggccc cgacgccgcg gcattgggcc gagctcggct tcttccgcgc cgacctgcag 360cagcaacagg cgccgggccc caggatcgtg ccgcacccac acgccgcgcc gccgccggcc 420aagaagagcc gccgcggccc gcgctcccgc agctcgcagt accgcggcgt caccttctac 480cgccgcacag gccgctggga gtcccacatc tgggattgcg gcaagcaggt gtacctaggt 540ggattcgaca ccgctcacgc cgctgcaagg gcgtacgacc gggcggcgat caagttccgc 600ggcgtcgacg ccgacatcaa cttcaacctc agcgactacg aggacgacat gaagcagatg 660gggagcctgt ccaaggagga gttcgtgcac gtcctgcgcc gtcagagcac cggcttctcg 720agaggcagct ccaggtacag aggcgtcacc ctgcacaagt gcggccgctg ggaggcgcgc 780atggggcagt tcctcggcaa gaaagcttac gacaaggccg ccatcaaatg caatggcaga 840gaggccgtga caaacttcga gccgagcacg tatcacgggg agctgccgac tgaagttgct 900gatgtcgatc tgaacctgag catatctcag ccgagccccc aaagagacaa gaacagctgc 960ctaggtctgc agctccacca cggaccattc gagggctccg aactgaagaa aaccaagatc 1020gacgatgctc cctctgagct cccgggccgc cctcgtcggc tgtctcctgt cgtggctgag 1080catccgccgg cctggcctgc gcagccgcct caccccttct tcgtcttcac aaaccatgag 1140atgagtgcat caggagatct ccacaggagg cctgcagggg ctgttcccag ctgggcatgg 1200caggtggcag cagcagctcc tcctcctgcc gccctgccgt cgtccgctgc agcatcatca 1260ggattctcca acaccgccac gacagctgcc accgccgccc catcggcctc ctccctccgg 1320tactgcccac cgccgccgcc gccgccgtcg agccatcacc atccccgctg a 13712456PRTZea mays 2Met Gln Leu Asp Leu Asn Val Ala Glu Ala Pro Pro Pro Val Glu Met1 5 10 15Glu Ala Ser Asp Ser Gly Ser Ser Val Leu Asn Ala Ser Glu Ala Ala 20 25 30Ser Ala Gly Gly Ala Pro Ala Pro Ala Glu Glu Gly Ser Ser Ser Thr 35 40 45Pro Ala Val Leu Glu Phe Ser Ile Leu Ile Arg Ser Asp Ser Asp Ala 50 55 60Ala Gly Ala Asp Glu Asp Glu Asp Ala Thr Pro Ser Pro Pro Pro Arg65 70 75 80His Arg His Gln His Gln Gln Gln Leu Val Thr Arg Glu Leu Phe Pro 85 90 95Ala Gly Ala Gly Pro Pro Ala Pro Thr Pro Arg His Trp Ala Glu Leu 100 105 110Gly Phe Phe Arg Ala Asp Leu Gln Gln Gln Gln Ala Pro Gly Pro Arg 115 120 125Ile Val Pro His Pro His Ala Ala Pro Pro Pro Ala Lys Lys Ser Arg 130 135 140Arg Gly Pro Arg Ser Arg Ser Ser Gln Tyr Arg Gly Val Thr Phe Tyr145 150 155 160Arg Arg Thr Gly Arg Trp Glu Ser His Ile Trp Asp Cys Gly Lys Gln 165 170 175Val Tyr Leu Gly Gly Phe Asp Thr Ala His Ala Ala Ala Arg Ala Tyr 180 185 190Asp Arg Ala Ala Ile Lys Phe Arg Gly Val Asp Ala Asp Ile Asn Phe 195 200 205Asn Leu Ser Asp Tyr Glu Asp Asp Met Lys Gln Met Gly Ser Leu Ser 210 215 220Lys Glu Glu Phe Val His Val Leu Arg Arg Gln Ser Thr Gly Phe Ser225 230 235 240Arg Gly Ser Ser Arg Tyr Arg Gly Val Thr Leu His Lys Cys Gly Arg 245 250 255Trp Glu Ala Arg Met Gly Gln Phe Leu Gly Lys Lys Ala Tyr Asp Lys 260 265 270Ala Ala Ile Lys Cys Asn Gly Arg Glu Ala Val Thr Asn Phe Glu Pro 275 280 285Ser Thr Tyr His Gly Glu Leu Pro Thr Glu Val Ala Asp Val Asp Leu 290 295 300Asn Leu Ser Ile Ser Gln Pro Ser Pro Gln Arg Asp Lys Asn Ser Cys305 310 315 320Leu Gly Leu Gln Leu His His Gly Pro Phe Glu Gly Ser Glu Leu Lys 325 330 335Lys Thr Lys Ile Asp Asp Ala Pro Ser Glu Leu Pro Gly Arg Pro Arg 340 345 350Arg Leu Ser Pro Val Val Ala Glu His Pro Pro Ala Trp Pro Ala Gln 355 360 365Pro Pro His Pro Phe Phe Val Phe Thr Asn His Glu Met Ser Ala Ser 370 375 380Gly Asp Leu His Arg Arg Pro Ala Gly Ala Val Pro Ser Trp Ala Trp385 390 395 400Gln Val Ala Ala Ala Ala Pro Pro Pro Ala Ala Leu Pro Ser Ser Ala 405 410 415Ala Ala Ser Ser Gly Phe Ser Asn Thr Ala Thr Thr Ala Ala Thr Ala 420 425 430Ala Pro Ser Ala Ser Ser Leu Arg Tyr Cys Pro Pro Pro Pro Pro Pro 435 440 445Pro Ser Ser His His His Pro Arg 450 45537236DNAZea mays 3caagacttga gctcgaaaag tagcacagag agttcacaac tcgaacggag ctcaaatcac 60taacacaatc gatcaaatgc gaggaggcgg agtgtgggag tcttagaatg cttagtggat 120gcttagatgt ttcctccatg cgcctagagg tcccttttat agccccaaga cacctaagag 180ccgttggaga tcaacatgga atgctatcct tgccttctgt cgagtggcgc accggacagg 240tcctgtagat tgttcggtgc gcgatctcct tccaaatttg gcatatccga ccgttgctcc 300tctgggctga ttggcgcacc ggacacagtc cggtgcacac cggacagtcc ggtgcaccag 360ctgaccgttg gagcagtcca cgtgtcgcgc gaagattgcg tggccgaccg ttgctcaggc 420gaccgttggc tcaccggaca gtccggtgca ccaccggaca gtccggtgaa ttatagtcgt 480acgccgccgt cgaaacccga gagcggcgag ttcacagtgg accagcctgg cgcaccggac 540actgtccggt gcaccattgg acattgtccg gtgcaccacc ggacagtccc gtgtgcgaga 600ccgagcacaa gattggctgc acagagccaa gcttttccct ttttctccct tcttttttag 660tcactgtttc tagcacttgg ataaccatgt tagtacataa aacaattcac caagtctaga 720aacatacctt ttgccttgat tttcacttct cactttattt ggcacataag aacttaatta 780aacgtgttgg gcacttaatc accaaaacat tatagaaatg gcccaaaggc acatttccct 840ttcagtaata agttaatacc tctttatatc attatttgaa cactgtgcaa tgatgttcat 900ttatgtaatc gttgtgtacg tcagttctaa ttctagcacg tacatggttc acatccaatt 960tgtcttctaa aaacgaatgt gacataatgt catatgtatg tgataatgct ttttgttggg 1020gtccttcgtc tttcaaaggt cctcaaaaac acatttaacc attggttgtt agcacatcct 1080taagtgttgc aggagctttg gtattgaata ccttcggagc aggacatgga ggaagacgaa 1140gatgttagct tcgtcataac aacacaagga aacgaaggca gaagtggaac aaggccggga 1200tatggtgttt tcaagactct gtatccaaag caaaaaagac agaaagacga tactgccctt 1260acataatttg taaactatgt gaacaagttt tatggacatg tttgtaactt tacacgaaat 1320tgtaccacca cactataaat agataaatag tgccctgcat gaggcgcctc ttgggaacaa 1380tgaggaacaa ctctgtataa tcctttttct tctaagtacc ttcgggtttt ctcctcatca 1440aaaagccgaa ggtactattg taaattcgtt tcatataaag aaagaaatcc caagttgttt 1500gagataagta atcttatcta gctttgttat agccatgtgt gtaatcttta tctttatcct 1560ctgacaatcc tatatattat atataataac cttcgtactt tacttggatg tcccgaagga 1620caaactcttt aagtacgaag gataacatct tttttaataa tgtgttgcct tgttttttat 1680tgtgtacaac aattaaaaac gagtgaccaa cattttcatg tcagggtatg gggacccatt 1740ggagactcga tatccaaatg aggatgagta tatgatgaat cctataccta tgatgagtat 1800aagtatgaga atcaggatga gtataacttc atcagaatag gtgcgggggc gtccttgtgg 1860gcgtgcctac cgtgcgatcg cacaaggcct ccaaaaccat agggccccaa aatttataac 1920aatctttata tacaatataa ataaaaaata ttattttata taaaatattt accaacatat 1980agcatagaat cgtaaaagcg ttgaaatcga tctgttctta ttgttattca aactatttac 2040ctccagcaca ttgtagtcat tagataaaaa agattgagat cttattgtca ctatcttaag 2100aagacacagt taaaagaggt agacaatatg tcaatatgct ttgatgcaag tgaccaattc 2160gtgacgttga gtttcctcta agattttgtt taaaaaattg ctatgttgac attctaaatt 2220ttataaagca gaggagcaaa actgagtaaa atcgcattta atgataaaaa tgtggaaagt 2280gacaaaacta agaatacaat tttaaatagt ccaatatttt tttactatct tttgcacagg 2340gcctctcaac ttgggaggac gcttctgggt gtgggtttac aaattcgatg aaaaattccc 2400cattgacaaa cgataggagg atatttttct cccagcacaa aatagcatag ccataaggca 2460acaaggcatg gcaaaggatc gtatcatcgt catccgagac ccattgcttt ctctctctct 2520cctcgtgctt tcattactgg ggtgggggtg gagtggacca gtggagtgga gaaatgacaa 2580atccaggccc gcaggcagcc ccacccacca aatcggccga gcagggtgcc caaatcagga 2640aggattttaa ggttaaccgg ctgccaccgc ccaccgccgg tgaccccagt ctctcttcta 2700tctatatatt acccgcctcc ttttctcctc tctctccgcc ccaccctcct tcctcagctc 2760cgttgcgcac cgccaccgcc ggccggccag ccgccggagc accgaaagac ccccgttctt 2820tcctgtaaaa aaaaacccgc cgcctttagc tagctaaccg gtcgtcctct tcacccccta 2880gctttgctag ctctagctag gaacgaaaga aattaaagga taactgagat tgctgattgg 2940tggtccgggt acggtgttct tgagtcgtga agcgacagta cagtggctag ggtcgtgccg 3000cccctgcagt ctccggggtt gcgtgcagga tggtcgtcag ggatcgggag tgaggaggca 3060tcagctctcg cggtcgtgga gcctaaatgt accgcaacaa cgactcggca ctctcctgct 3120tctacctctt cctcctctgg ttcttcttct tgaagtagac accaccagtt cgccaggtag 3180ttagcagccc agttgcgact ggggatcggt ggcgggctgc cgcttgcgag ttgtaagctt 3240ggaggggagg ggagcaggag caggagatgc agttggatct gaacgtggcc gaggcgccgc 3300cgccggtgga gatggaggcg agcgactcgg ggtcgtcggt gctgaacgcg tcggaagcgg 3360cgtcggcggg cggcgcgccc gcgccggcgg aggagggatc tagctcaacg ccggccgtgc 3420tggagttcag catcctcatc cggagcgata gcgacgcggc cggcgcggac gaggacgagg 3480acgccacgcc atcgcctcct cctcgccacc gccaccagca ccagcagcag ctcgtgaccc 3540gcgagctgtt cccggccggc gccggtccgc cggccccgac gccgcggcat tgggccgagc 3600tcggcttctt ccgcgccgac ctgcagcagc aacaggcgcc gggccccagg atcgtgccgc 3660acccacacgc cgcgccgccg ccggccaaga agagccgccg cggcccgcgc tcccgcagct 3720cgcagtaccg cggcgtcacc ttctaccgcc gcacaggccg ctgggagtcc cacatctggt 3780cagtactacc actgtctaca actagccaca ccacaccgat tgcttccgac tctcattaat 3840ttctgacaca aactctccgt cttcctcctc ttctcccgcg acgcagggat tgcggcaagc 3900aggtgtacct aggtgagcaa gagcagatct cttttgcgtt cccaaagatt tttccccttt 3960tagttcctta tcccatccca tctcgaatgg cctagctaac cgattcagtg gtggtccggc 4020tgctggccga tatacgcagg tggattcgac accgctcacg ccgctgcaag gcacgcactg 4080gactggacgc ccagaattct tcgtcatgtg agtctctgac cgaattgatt gattaacgag 4140tctctggctc ctggaactcg cagggcgtac gaccgggcgg cgatcaagtt ccgcggcgtc 4200gacgccgaca tcaacttcaa cctcagcgac tacgaggacg acatgaagca gatggggagc 4260ctgtccaagg aggagttcgt gcacgtcctg cgccgtcaga gcaccggctt ctcgagaggc 4320agctccaggt acagaggcgt caccctgcac aagtgcggcc gctgggaggc gcgcatgggg 4380cagttcctcg gcaagaagta agaaccaacc aacgcttctt ttctttttct tttttttata 4440gcatgcagtg atgattcaac cttagttgtg cctttcctcc taatcctata tatgtaggat 4500ttagtactgg ttgactatat aagtatatat gtattgttca gtaaaagtat acataggtta 4560gctgcatgtt tatgtatgta gctggttgtt tcaatcagaa gataaaaaaa aagggaagta 4620gtggctaggg aattcctcca atcctcaccg gtgggaacgc cgtgcttggg tgcaggtaca 4680tataccttgg gctattcgac agcgaagtag aggctgcaag gttcttcatc ttggattctg 4740ccgttcatat atgcataatc atgtctttta atttccaaag ggttgagtac cgactcgatt 4800cctcttcgtg tcttttttct ttctttcttc gaaatccaga gcctacgaca aggccgccat 4860caaatgcaat ggcagagagg ccgtgacgaa cttcgagccg agcacgtatc acggggagct 4920gccgactgaa ggtacgtatt ttctttctgc atatatatat cttcaggtat tattggctat 4980taaactgctt ggatcttact gcttcttctg cagttgctga tgtcgatctg aacctgagca 5040tatctcagcc gagcccccaa agagacaaga acagctgcct aggtctgcag ctccaccacg 5100gaccattcga gggctccgaa ctgaagaaaa ccaaggcaag cgctaacgat agatatacct 5160tgacaagcta gtatcaaaca aaaccagtaa aaaaagttta ctttcttgtc gaatttcatt 5220gcctacctga tgtacgtact tgtgcttctg cacaaaataa cgaaatcctt ttgccctctg 5280atgatgatgc agatcgacga tgctccctct gagctaccgg gccgccctcg tcagctgtct 5340cctctcgtgg ctgagcatcc gccggcctgg cctgcgcagc cgcctcaccc cttcttcgtc 5400ttcacaaacc atgaggttag gtgacagcta ctgatcgaga tgcagcagca gttcaaacct 5460gtctgttcca aggaccttta ggccggatta ccaaatcatc ggtcaactgt cctgtctgtt 5520atatatttat gtgttaattt ataatacaag tgtgactatt tttcaaacct tccttcaaaa 5580tgcatgaaaa gagttttttt taacgaaagg cgaaaagaaa atatgatact tgggacagga 5640gcaagcttgg atcatcagaa agtattatta attaggatca ctgagctgtt cattttgttc 5700ttgagtcaat cctaatcgta ctatgtcagt gaatgaactt gtgttgcacc aatgcagatg 5760agtgcatcag gagatctcca caggaggcct gcaggggctg ttcccagctg ggcatggcag 5820gtggcagcag cagctcctcc tcctgccgcc ctgccgtcgt ccgctgcagc atcatcagga 5880ttctccaaca ccgccacgac agctgccacc accgccccat cggcctcctc cctccggtac 5940tgcccgccgc cgccgccgcc gtcgagccat caccatcccc gctgagagaa tcaagaagcc 6000gcactgtaaa tctgccggga agctagcatt ttccccccgg cccctccccc tctccgggcg 6060ttgcgacttt ttcagttttg cgccgccggc cggggtggtg gtttcttgta gccgatcgat 6120tggattcctc gtattactgc tgcttacact cccaattaag tgaaaaaaaa acgctcctct 6180actctttaca ctacacacac tgttagctga tcgattggac gtacttgcta gctgctgttg 6240ctgctgctag cttgagattg actaacttca gcacttggat tgatctatat ctatatgact 6300atatagacga cacattgtgt acgtgtagat aatatttctt cttttcctga ccgccataaa 6360actgtttact ctggccattt tgaactaaag gctagctaca aatgagtgtc cttctcggcc 6420ttctacatgt tctggtcatg gacatcgaga gatcaaactt ctctgtcctg cttactagat 6480acgtactaga tttacttagc ctagatagat tccgttccaa actcgaggcc aggcgcatcg 6540agatccgaga acttcatcca ctcgtcgctc atcatgctgc atgcatgatg gtctcaactc 6600tgaggcatgc aaacgcagtg agacgaactg ggaggaattt atatagagta tatattgtcc 6660ggcctgttgg tgataaagat agaatgcatg cacgctaact gccaacatgc atgggtgctg 6720catcgaattt ttggtatggt gcatgcatac cgtgcattgg tgctctgcta gtactaggac 6780caatctccat ggctccatta gatctcttgt ttactcgtct ccatgtgcct ctcaaagtgt 6840gtactagcta gttgcggcac acaagttggc agttgtttgt tgtttcagcg gggaagaagg 6900aggtcaccgt tgtcatcgtc aggggcgaag ctaggatcag aagacagagg gggcaggctt 6960agcctccaag cgaccaaacc agtaagaaca caatataaaa atggcaagag aaccaaccat 7020aatatatata ttgatatata atcttcatta aaaaacagta taatgaaaca acatctattt 7080tgtcaaacaa aataaaatta aatctcagtt attttgaatt tagctctacg tgtattagct 7140agatcatagg tgaaagtcgc ctagaggggg ggtgaatagg gcgaaactga aatttacaaa 7200tataaacaca actacaagcc gggttagcgt tataag 723647306DNAZea mays 4tagaatatat aatctagagc aaactagtta gtccaaatat ttgtgttggg aattcaacca 60ccaaaattat ttataggaaa aggttaaacc ctatttccct ttcactaatt aattggaaga 120acttgaggtg tagtcttctt cgtcgtcgtg ccgttaatgg ggtcctagca cagtacttgc 180tctaccgagg ttgggtacca aggttctttt gttttgcttt tgttagacac cccatgtggg 240gaggggtact atgtttatca aactgtagaa acctaacagg cgactttgac ctctggagaa 300tctttgtaaa tgctacatag tgaaaccttg ttgactcacc ataggagtgt ttaagggttt 360gatcgactta tggcaaaaag ggggtcacgg ctcgtgagta aagtgtaaga cctttgcata 420gggttagaaa ctgatatatc agtcatgctc acaattaaga acggccttgg gagctccttt 480gattagagat actgtagata cattcatgat gatggtttga tgatggtgcc tctaattatg 540atttctagta ttttctctac gaggaggtac tatttgggat aataagctag gttttaagat 600aaaatttggc ttatattaat gattaaaacc tgataaagta aaagcaacct gctatcagct 660taactccaca taaagctagt ccattttagc caaacaagat atttgctgag tacgttgatg 720tgtgcaaaat ggagaacttt tatcttaaaa caccaggttg tccacactgc aaccactgct 780caagcgagga tgaaggcaac atgaagaact ttcaggagtt tctagacttc aaggagtttt 840aaactagatt agtggtaaac cccagtcagc tgcctgtgaa ggccttatct ttactacgtt 900ccgcgttagc actttgttta cttgttaagt tgatggatac atcatgttgt aataagttaa 960tacctcttta tatcattatt tgaacactgt gcaatgatgt tcatttatgt aatcgctgtg 1020tatgtcagtt ctaattctag cacatacatg gttcacatcc agtttgtctt ctaaaaaacg 1080aatgtgacat aatgtcatat gtatgtgata atgctttttg ttggggtcct tcgtctttca 1140aaggtcctca aaaacacatt taaccattgg ttgttagcac atccttaagt gttgcaggag 1200ctttggtatt gaataccttc ggagcaggac atggaggaag acgaagatgt tagcttcgtc 1260ataacaacac aaggaaacga aggcagaagt ggaacaaggc cgggatatgg tgttttcaag 1320actctgtaac caaagcaaaa aagacataaa gacgatactg tccttacata atttgtaaac 1380tatatgaaca agttttatgg acatgtttgt aactttacac gaaactgtac caccacacta 1440tagatagata aatagtgccc tgcatgaggc gcctcttggg aacaatgagg aacaactgtg 1500tgtaatcctt tttcttctaa gtaccttcgg gttttctcct catcaaaaag cggaaggtac 1560tattgtaaat ttgtttcata taaagaaaga aatcccaagt tgtttgagat aagtaatctt 1620atctagcttc gttatagccc tgtgtgtaat ctttatcttt atcctctgac aatcctatat 1680attatatata ataaccttcg tactttactt ggatgtctcg aaggacaaac tctttaagta 1740cgaaggataa catctttttt aataatatgt tgccttgttt ttttattgtg tacaacaatt 1800aaaaacgagt gaccaacatt ttcatgtcgg ggtatggaga cccattggag actcctaaat 1860gaggatgggt atatgatgaa tcctatacct atgatgagta taagtatgag aatcaggatg 1920agtataactt catcagaaaa ggtacggggg cgtccttgtg ggcgtgccta cagtgcgatc 1980gcacaaggcc tccaaaacca tagagcccca aaatttataa caatctttat atacaatata 2040aataaaaaaa tattatttta tataaaatat ttaccaacat atagcataga atcgtaaaag 2100cgttgaaatc gatatgttct tattgttatt caaactattt acctccagca tattgtagtc 2160attagataaa aaagattgag atcttattgt cactatctta agacgacaca gttaaaagag 2220gtagacaata tgatttgatg caagtaacca attcgtggcg ttgagtttcc tttaagattt 2280tttaaaaaaa aattgctatg ttgacattct aaattttata aagcagagga gcaaaactga 2340gtaaaatcgt aattaatgat aaaaatgcgg aaagtgacaa aactaagaat acaattttaa 2400atagtccaat atctttttac tatcttttgc acagggcctc tcaacttggg aggacgcttc 2460tgggtgtggg tttacaaatt cgatgaaaaa ttccccattg acaaacgata ggaggatatt 2520tttctcccag cacaaaatag catagccata aggcaacaag gcatggcaaa ggatcgtatc 2580atcgtcatcc gagacccatt gctttctctc tctctcctcg tgctttcatt actggggtgg 2640gggtggagtg gaccagtgga gtggagaaat gacaaatcca ggcccgcagg cagccccacc 2700caccaaatcg gccgagcagg gtgcccaaat caggaaggat tttaaggtta accggctgcc 2760accgcccacc gccggtgacc ccagtctctc ttctatctat atattacccg cctccttttc 2820tcctctctct ccgccccacc ctccttcctc agctccgttg cgcaccgcca ccgccggccg 2880gccagccgcc ggagcaccga aagacccccg ttctttcctg taaaaaaaaa cccgccgcct 2940ttagctagct aaccggtcgt cctcttcacc ccctagcttt gctagctcta gctaggaacg 3000aaagaaatta aaggataact gagattgctg attggtggtc cgggtacggt gttcttgagt 3060cgtgaagcga cagtacagtg gctagggtcg tgccgcccct gcagtctccg gggttgcgtg 3120caggatggtc gtcagggatc aggagtgagg aggcatcagc tctcgcggtc gtggagccta 3180aatgtaccgc aacaacgact cggcactctc ctgcttctac ctcttcctcc tctggttctt 3240cttcttgaag tagacaccac cagttcgcca ggtagttagc agcccagttg cgactgggga 3300tcggtggcgg gctgccgctt gcgagttgta agcttggagg ggaggggagc aggagcagga 3360gatgcagctg gatctgaacg tggccgaggc gccgccgccg gtggagatgg aggcgagcga 3420ctcggggtcg tcggtgctga acgcgtcgga agcggcgtcg gcgggcggcg cgcccgcgcc 3480ggcggaggag gggtccagct caacgccggc cgcgctggag ttcagcatcc tcatccggag 3540cgacagcgac gcggccggcg cggacgagga cgaggacgcc

acgccgtcgc ctcctcctcg 3600ccaccgccac cagcaccagc agcagctcgt gacccgcgag ctgttcccgg ctggcgccgg 3660cccgccggcc ccggcgccgc ggcattgggc cgagctcggc ttcttccgcg ccgacctgca 3720gcagcaacag gcgccgggcc ccaggatcgt gccgcaccca cacgccgcgc cgccgccggc 3780caagaagagc cgccgcggcc cgcgctcccg cagctcgcag taccgcggcg tcaccttcta 3840ccgccgcaca ggccgctggg agtcccacat ctggtcagta ctaccactgt ctacaactag 3900ccacaccaca ccgattgctt ccgactctca ttaatttctg acacaaactc tccgtcttcc 3960tcctcttctc ccgcgacgca gggattgcgg caagcaggtg tacctaggtg agcaagagca 4020gatctctttt gcgttcccaa agattttccc cttttagctc ctcatcccat ctcgaatggc 4080ctagctaacc gattcactgg tggtccggct gctggccgat atacgcaggt ggattcgaca 4140ccgctcacgc cgctgcaagg cacgcactgg actggacgcc cagaattctt cgtcatgtga 4200gtctctgacc ggattggttg attgattgat taacgagtct ctggctcctg gaactcgcag 4260ggcgtacgac cgggcggcga tcaagttccg cggcgtggac gccgacatca acttcaacct 4320cagcgactac gaggacgaca tgaagcagat ggggagcctg tccaaggagg agttcgtgca 4380cgtcctgcgc cgccagagca ccggcttctc gagaggcagc tccaggtaca gaggcgtcac 4440cctgcacaag tgcggccgct gggaggcgcg catggggcag ttcctcggca agaagtaaga 4500accaaccaac gcttcttttt ttttatagca tgcagatgat gattcacact tagttgtgcc 4560tctcctccta atcctatgta ggatttagta ttggttgact acatatctat tgttatatat 4620gtattgttca gtaaaagtat acataggtta gctgcatgtt tatgtatgta gctggttgtt 4680tcaatcagaa gataaaaaga aagggaagta gtggctaggg aattcctcca atcctcaccg 4740gtgggaacgc cgtgcttggg tgcaggtaca tataccttgg gctattcgac agcgaagtag 4800aggctgcaag gttcttcatc ttggattctg ccgttcatat atgcataacc atgtcttttc 4860atttccaaag ggttgagtac cgactcgatt cctctttttt tttctttctt tcttcgaaat 4920ccagagctta cgacaaggcc gccatcaaat gcaatggcag agaggccgtg acgaacttcg 4980agccgagcac gtatcacggg gagctgccga ctgaaggtac gtatttcttt ctgcatatat 5040ataatcttca ggtattattg gctattaaac tgcttggatt ttactgcttc ttctgcagtt 5100gctgatgtcg atctgaacct gagcatatct cagccgagcc cccaaagaga caagaacagc 5160tgcctaggtc tgcagctcca ccacggacca ttcgagggct ccgaactgaa gaaaaccaag 5220gcaagcgcta acgatagata taccttgaca agctagtatc aaacaaaacc agtatttttt 5280ttactttctt gtcgaatttc attgcctacc tgatgtacgt acttgtgctt ctgcacagaa 5340taacgaaatc cttttgccct ctgatgatga tgcagatcga cgatgctccc tctgacctcc 5400cgggccgccc tcgtcggctg tctcctctcg tggctgagca tccgccggcc tggcctgcgc 5460agccgcctca ccccttcttc gtcttcacaa accatgaggt taggtgacag ctactgatcg 5520agatgcagca gcagttcaaa acttagatcc ggtcccttgt cctgtctgtt ccaaggacct 5580ttaggccgga ttaccaaatc atcggtcaac tgtcctgtct gttatatatt tatgtgttta 5640taatacaagt gtgactattt ttcaaacctt ccttcaaaat gcatgaaaag agtttttttt 5700ttaacgaaag gcgaaaagaa aatatgatac tttgggacag gagcaagctt ggatcatcag 5760aaagtattat taattaggat cactgagctg ttcattttgt tcttgaatca atcctaatcg 5820tactatgtca gtgaatgaac ttgtgttgca ccaatgcaga tgagtgcatc aggagatctc 5880cacaggaggc ctgcaggggc tgttcccagc tgggcatggc aggtggcagc agcagctcct 5940cctcctgccg ccctgccgtc gtccgctgca gcatcatcag gattctccaa caccgccacg 6000acagctgcca ccgccgcccc atcggcctcc tccctccggt actgcccgcc gccgccgccg 6060ccgccgtcga gccatcacca tcgccgctga gagaatcaag aagccgcact gtaaatctgc 6120cgggaatgaa gctagcattt tccccccggc cctcccctct ccgggcgttg cgactttttc 6180agttttgcgc cgccagccgg ggtggtggtt tcttgtaacc gatcggttgg attcctcgta 6240ttactgctta cactcccaat taagtgggaa aaaacgctcc tctactcttt acactagaca 6300cactgttagc tgatcgattg gacgtacttg ctagctgctg ttgctgctgc tagctagaga 6360ttgactaact gaagcacttg gattgatcta tatctatatg actatataga cacattgtgt 6420acgtgtagat aatatttctt tatttcctga ccgccataaa actgtttact ctagccattt 6480tgaactaaag gctagctaca aatgagtgtc cgtctcggcc ttctacatgt tctggtcatg 6540gacatcgaga gatcaaactt ctctgtcctg cttactagat acgtactaga tttacttagc 6600ctagatagat ttcgttccaa actcgaggcc aggcgcatcg agatccgagc acttcatcca 6660ctcgtcgttc atcgtgctgc atgcatgatg gtctcaactc tgaggcatgc aaacgcagtg 6720agaacgaact gggaggaatt tatatagagt atatattgtc cggcctgttg gtgataaaga 6780tagaatgcat gcacgctaac tgccaacatg catgggtgct gcatcgaatt tttggtatgg 6840tgcggtgcat gcataccgtg cattggtggg gagaatccat gaaatagcac ttgtttgaga 6900cggcgttcac gaaatagcat ccgatttcaa gtaattcata gaatagcact tgttttacca 6960aattaattca gaaaataaca ctctatctat attttgcatt cttttattgc ttacctcaca 7020tacaaatgga ccaaattacc cctatttatc acaaccttct ttttttatct cttatgtcca 7080taagaacaac ataaataaat aaaatatatg acctatattt ttatagtgtt aaacatacaa 7140atagacacat gttttatgaa cgaagaagtc tatatttaac tattaaattt agaactaggt 7200atcttcggtt gtcgaacttt taaaattaga catatttggt ccattaaaag gtcttagatt 7260gtacttccta tgttcttttt tatttgatac ggttgttttt tttcaa 730654230DNAZea mays 5ctccacctct ctcgtacgct ttgattggcc gctcgcacgc atttatcgcc aagatcgggc 60ttgcccatca ctgggatcat cctggctggc tggctggccg gccacatatc aaacatggat 120ttgctatatt ttaaatgcct gaaatatgtt atactatgtt ttttagataa cgatctttac 180agtcgattta tgaatgtgta gaattaagat tgagcttcct gatgaaaaaa tcaggcaaga 240ggctcttttg gttggagacc tggcatggca cttgcctgcg agtcaagcaa accctatgcc 300actgtttgga ccaggccact ttcctagaga gccgaatcag acatcactat cggaattcga 360atgagtgctc agcactttac cgagtgcaat taatcggaca ctcggcaaag cattctttgt 420cgagtgccac tctcggcgaa ctaataaggc tctcgggaca gatctcgtat gtcgagagcg 480gaacactcga catagaaaaa cactcggcaa aagaggtttt gtcgaatgac aagctctcgg 540caaaatgtga cactcgataa gggtcgtcaa gagtcgtcta ttgttgacgg ccattaactt 600tcccgagtgt caaacgttga cacttgggaa ttatcttctt tttgtcgatt gtaacctggc 660aaaccctcgg caaaagtata ctttgcggag tgtcttccct caacactcga taaagaatat 720ttgtttcttt ttcttttttc tataccaaac tctttgtgac gttttttctg cagtatatag 780acatacatat tcaattttac acaattatca aagtgtttgc tataattaat agatttagtt 840tgtttaattg aatttctgag aaccaatcaa atagacccga attagacata tctagacatt 900taaaaagtaa gatactaaaa aataatagtg tttaccttca accggtacta aatgtcattc 960ctgtagtaga caggataacg aaagctagtc tatttagatc atcagttcca gttcgagatt 1020ttaaatgcta gtccctccat ttcaatttac aatttattta atttttttag tgtgataccg 1080tttagcgtat gtagctttga tttttttata tatttttgca aaattttgaa taagacaagt 1140gtgtcaaatt tggtgtaaaa attaaacgaa attataaatt ggagcggagg gagtagaaat 1200ctacgatttt tctagctgag gcagactgtg cgcattccca tccatcgagt ccacttgcac 1260ctctcctcga catgaatacg aatgtacgat ccgatgaatt ccccacaaag aagcaattaa 1320cgtcaaatcc atcatcgtca taaaacgacg ataccgagct agcgtttaat tagtttgtta 1380gacgaaccag aaactatatt atatcgcttt gtgtccaaaa attacttata ttatatatag 1440ttctcgtgca tctacgtaca cgtaacatcg ctcttaaatt tgtccttact tggtgtaaaa 1500agattaatct acaaagacta tattgttaaa gcaaaattga ggaagctgta tttaacctcg 1560tgaccaccta aactagtggg aatgccccat ccctcaatag aactagtttt atttggcaaa 1620catcatggaa agaatatatc agatacacta ctctcgcaca gagagagatg tcaagtggtt 1680tgggcatcaa aaccataagc ggacgggttt cgagtttgga cctttgaatc tggttgatgt 1740tggagcaaga agaagcaaaa atgacacatg gcatcattgt gaagcttgcg tcgagacgaa 1800gcaagacaaa ggcaaagtag cgaaggtaca ctgttaccgc cggcaataac tacgtacgta 1860catgcatgta agacatgcat tgtaccgtga catacatgta tgtcatataa atctatgtag 1920atcactccta cgaccggcgg ctaatttcac tacacacatg atgcatggat ggaatggatg 1980tgaagtgaga ctgtgagagc actatcggaa tcactttctt cgccgagtgt cgctttccat 2040gaataaacat gtgaacctag gcctaggcac cttccacttc agggcttgtt cggttagctc 2100tcaatccatg tggattgagc gggattggat gggtttgaat cccaaacaag tcaaacttct 2160tcacaatttt ttccaatccc atccaatcca tgtgtattgg gaataaccga acaagccctc 2220aggcatcatc ttctacaaat gtagaatgtg tgaaggtagg caaacgtaac ggaaaggcag 2280gaagctcatc gccaacgcat ctcctctcct gctccttttg acgacctttc atacctgcac 2340ccgctttttc tggaaagggc atcaagattt atatatatat atgttattca ccagtaaatt 2400tcattattat tagctttgtt tacaacaagt attattatta ttatccgggc tgtgagcaga 2460gggagctggt acaacttgtc ccttgagacg gccaagaggc aacagtgttg tgggcttgcg 2520gccatgacgc gacgttgcta gctgccgtgt ccaacaggaa gagaagacgg cgacgtggtc 2580gcactgtacg tttttcccgc cacacaaacg gggcgggggg cggtggtata ctggtatggt 2640ggccactggc cagccgccgt gccggtgcag gcagcagccc acaggaccaa cgccgccgcc 2700aatggatcgg acggcctctg ctactgctag aaatggaaag cacgcaggta cgtggggccc 2760cctccctttc ccgcgcaagt gcagtgccag tgcggcagtg cgtgtgtcat tattctgtcc 2820ggaccggtag gtagtagtat cagatgtact accagtcaaa cgacagtgcc ttccgcggcg 2880gccaaaggta cagtgacact ttgccaaaaa caaaaaaaaa acagcaaata aagaaaggaa 2940cgcgcgcggg aatatatcga tctcatcttt ttttttcttt tttgttgttg ttgtctacag 3000agatggtaag gaataaataa ataaaggtgc taaataaaga ccggattctt tatttctttc 3060caaatccaga aaaggaatta tcttccccgg aatctatttt cgagcaaata ataataataa 3120tatatgattt tgttattttt cattggttct ctggttaatc attttggacg tcatctacct 3180aataacatag gtcgtccact atgtggagcg cacggcctta gcttaagaca caatttgttg 3240acttccagga ttatataatc caccttatag attatataat catataatga tatctagtta 3300tcaagattat ataataatcc acctaataat ttgtgttgtt tgtttgcctc ttgatatagt 3360aggactatgt agcctactga catgatcaat ttacttctct aatcaccggc aaaatgaaaa 3420atccattgtt taccttgcct tgagttgtat taacggtttc caccaaagtc gttcaagact 3480ctaagtagct cacatgtatt ccatccagtc ttcaaatact ttaaggggtc ttcactttgg 3540atgtaaatac tttatgttta agcatttgaa gctcatttta gactaggata cccttgatct 3600aggtggtcca catattctcc taggcatgac aaattactca gagacacgct tcctcttccc 3660actacatgtg tgcatgcatt gaaaccgtga aaaaacctac gagtgcaatc gatcaggtcg 3720ggaaaaaaag gcacacctag aggctagagc tcagtcagtc ccgaacgatt gcaaaaaaaa 3780aagacactag agctcgacct caaaacccag tgtgtcaatt tttacagcca gcgttgcaac 3840catctaagct aacatcttgt atttaaatat tatagaaaca acaaccctat ttaatagttc 3900cttggtatat atacaagatc atgtccaaaa catcaagcat ttgaagacta gatgtagtac 3960atggaccaac ctgcaacctt actttatcag agaaatcgtc agtccacaca tatttgtcat 4020taattaccaa ggcactactg agaggttaga tgcccacacc gtttcaccaa atgattggtt 4080aaaaagcacg gactcctgtg gagctgctac tctgcagagg agcgggagtc agaaccattt 4140ttagaagagc caaagtccta ccaaacatac tcttactctc tctttttaaa ggtactacct 4200cttttgaatt taaatgtatt actccctctt 423064236DNAZea mays 6ctccacctct ctcgtacgct ttgattggcc gctcgcacgc atttatcgcc aagatcgggc 60ttgcccatca ctgggatcat cctggctggc tggctggccg gccacatatc aaacatggat 120ttgctatatt ttaaatgcct gaaatatgtt atactatgtt ttttagataa cgatctttac 180agtcgattta tgaatgtgta gaattaagat tgagcttcct gatgaaaaaa tcaggcaaga 240ggctcttttg gttggagacc tggcatggca cttgcctgcg agtcaagcaa accctatgcc 300actgtttgga ccaggccact ttcctagaga gccgaatcag acatcactat cggaattcga 360atgagtgctc agcactttac cgagtgcaat taatcggaca ctcggcaaag cattctttgt 420cgagtgccac tctcggcgaa ctaataaggc tctcgggaca gatctcgtat gtcgagagcg 480gaacactcga catagaaaaa cactcggcaa aagaggtttt gccgaatgcc aagctctcgg 540caaaatgcga cactcggtaa gggtcgtcaa gagtcgtcta ttgttgacgg ccattaactt 600tcccgagtgt caaacgttga cacttgggaa ttatcttctt tttgtcgagt gtaacctggc 660aaaccctcgg caaaaatata ctttgcggag tgtcttccct cgacactcga taaagaatat 720ttgtttcttt ttcttttttc tataccaaac tctttgtgac gttttttctg cagtatatag 780acatacatat tcaattttac acaattatca aagtgtttgc tataattaat agatttagtt 840tgtttaattg aatttctgag aaccaaccaa atagacccga attagacata tctagacatt 900taaaaagtaa gatactaaaa aataatagtg tttaccttca accggtacta aatatcattc 960ctgtagtaga caggataacg aaagctagtc tatttagatc atcagttcca gttcgagatt 1020ttaaatgcta gtccctccat ttcaatttac aatttattta atttttttag tgtgataccg 1080tttagcgtat gtagctttga ttttttttat atatttttgc aaaattttga ataagacaag 1140tgtgtcaaat ttggtgtaaa aattaaacga aattataaat tggagcggag ggagtagaaa 1200tctacgattt ttctagctga ggcagactgt gcgcattccc atccatcgag tccacttgca 1260cctctcctcg acatgaatac gaatgtacga tccgatgaat tccccacaaa gaagcaatta 1320acgtcaaatc catcatcgtc ataaaacgac gataccgagc tagcgtttaa ttagtttgtt 1380agacgaacca gaaactatat tatatcgctt tgtgtccaaa aattacttat attatatata 1440gttctcgtgc atctacgtac acgtaacatc gctcttaaat ttgtccttac ttggtgtaaa 1500aagattaatc tacaaagact atattgttaa agcaaaattg aggaagctgt atttaacctc 1560gtgaccacct aaactagtgg gaatgcccca tccctcaata gaactagttt tatttggcaa 1620acatcatgga aagaatatat cagatacact actctcgcac agagagagat gtcaagtggt 1680ttgggcatca aaaccataag cggacgggtt tcgagtttgg acctttgaat ctggttgatg 1740ttggagcaag aagaagcaaa aatgacacat ggcatcattg tgaagcttgc gtcgagacga 1800agcaagacaa aggcaaagta gcgaaggtac actgttaccg ccggcaataa ctacgtacgt 1860acatgcatgt aagacatgca ttgtaccgtg acatacatgt atgtcatata aatctatgta 1920gatcactcct acgaccggcg gctaatttca ctacacacat gatgcatgga tggaatggat 1980gtgaagtgag actgtgagag cactatcgga atcactttct tcgccgagtg tcgctttcca 2040tgaataaaca tgtgaaccta ggcctaggca ccttccactt cagggcttgt tcggttagct 2100ctcaatccat gtggattgag cgggattgga tgggtttgaa tcccaaacaa gtcaaacttc 2160ttcacaattt tttccaatcc catccaatcc atgtgtattg ggaataaccg aacaagccct 2220caggcatctt ctacaaatgt agaatgtgtg aaggtaggca aacgtaacgg aaaggcagga 2280agctcatcgc caacgcatct cctctcctgc tccttttgac gacctttcat acctgcaccc 2340gctttttctg gaaagggcat caagatttat atatatatat atatgttatt caccagtaaa 2400tttcattatt attagctttg tttacaacaa gtattattat tattatccgg gctgtgagca 2460gagggagctg gtacaacttg tcccttgaga cggccaagag gcaacagtgt tgtgggcttg 2520cggccatgac gcgacgttgc tagctgccgt gtccaacagg aagagaagac ggcgacgtgg 2580tcgcactgta cgtttttccc gccacacaaa cggggcgggg ggcgggggta tactggtatg 2640gtggccactg gccagccgcc gtgccggtgc aggcagcagc ccacaggacc aacgccgccg 2700ccaatggatc ggacggcctc tgctactgct agaaatggaa agcacgcagg tacgtggggc 2760cccctccctt tcccgcgcaa gtgcagtgcc agtgcggcag tgcgtgtgtc attattctgt 2820ccggaccggt aggtagtagt atcagatgta ctaccagtca aacgacagtg ccttccgcgg 2880cggccaaagg tacagtgaca ctttgccaaa aacaaaaaaa aaacagcaaa taaagaaagg 2940aacgcgcgcg ggaatatatc gatctcatct ttttttttct tttttgttgt tgttgtctac 3000agagatggta aggaataaat aaataaaggt gctaaataaa gaccggattc tttatttctt 3060tccaaatcca gaaaaggaat tatcttcccc ggaatctatt ttcgagcaaa taataataat 3120aataatatat gattttgtta tttttcattg gttctctggt taatcatttt ggacgtcatc 3180tacctaataa cataggtcgt ccactatgtg gagcgcacgg ccttagctta agacacaatt 3240tgttgacttc caggattata taatccacct tatagattat ataatcatat aatgatatct 3300agttatcaag attatataat aatccaccta ataatttgtg ttgtttgttt gcctcttgat 3360atagtaggac tatgtagcct actgacatga tcaatttact tctctaatca ccggcaaaat 3420gaaaaatcca ttgtttacct tgccttgagt tgtattaacg gtttccacca aagtcgttca 3480agactctaag tagctcacat gtattccatc cagtcttcaa atactttaag gggtcttcac 3540tttggatgta aatactttat gtttaagcat ttgaagctca ttttagacta ggataccctt 3600gatctaggtg gtccacatat tctcctaggc atgacaaatt actcagagac acgcttcctc 3660ttcccactac atgtgtgcat gcattgaaac cgtgaaaaaa cctacgagtg caatcgatca 3720ggtcgggaaa aaaaggcaca cctagaggct agagctcagt cagtcccgaa cgattgcaaa 3780aaaaaaaaga cactagagct cgacctcaaa acccagtgtg tcaattttta cagccagcgt 3840tgcaaccatc taagctaaca tcttgtattt aaatattata gaaacaacaa ccctatttaa 3900tagttccttg gtatatatac aagatcatgt ccaaaacatc aagcatttga agactagatg 3960tagtacatgg accaacctgc aaccttactt tatcagagaa atcgtcagtc cacacatatt 4020tgtcattaat taccaaggca ctactgagag gttagatgcc cacaccgttt caccaaatga 4080ttggttaaaa agcacggact cctgtggagc tgctactctg cagaggagcg ggagtcagaa 4140ccatttttag aagagccaaa gtcctaccaa acatactctt actctctctt tttaaaggta 4200ctacctcttt tgaatttaaa tgtattactc cctctt 423674313DNAZea mays 7ataaatttat tttgaagata taaatatttt aacggtattt tttattaata aaatgattta 60tatggattat acagatagag tctctctcta ctctctagtc ctgtgtacgt gcaggtttgg 120caaggtatga acaggacgtc aaacgcgtac gtgtactcca cacacactcc acctctctcg 180tacgctttga ttggccgctc gcacgcattt atcgccaaga tcgggcttgc ccatcactgg 240gatcatcctg gctggctggc tggccggcca catatcaaac atggatttgc tcatttgcta 300tattttaaat gcctgaaata tgttatacta tgttttttag ataacgatct ttacagtcga 360tttatgaatg tgtagaatta agattgagct tcctgatgaa aaaatcaggc aagaggctct 420tttggttgga gacctggcat ggcacttgcc tgcgagtcaa gcaaacccta tgccactgtt 480tggaccaagc cactttccta gagagccgaa tcagacatca ctatcggaat tcgaatgagt 540gctcagcact ttaccgagtg taattaatcg gacactcggc aaagcattct ttgtcgagtg 600tcactctcgg cgaactaata aggctctcgg gacagatctc gtatgtcgag agcggaacac 660tcgacataga aaaacactcg gcaaaagagg ttttaccgaa tgccaagctc tcggcaaaat 720gcgacactcg gtaagggtcg tcaagagtcg tctattgttg acggccatta actttcccga 780gtgtcaaacg ttgacacttg ggaattatct tctttttgtc gattgtaacc tggcaaaccc 840tcggcaaaag tatactttac ggagtgtctt ccctcaacac tcgataaaga atatttgttt 900ctttttcttt tttctatacc aaactctttg tgacgttttt tctgcagtat atagacatac 960atattcaatt ttacacaatt atcaaagtgt ttgctataat taatagattt agtttgttta 1020attgaatttc tgagaaccaa ccaaatagac ccgaattaga catatctaga catttaaaaa 1080gtaagatact aaaaaataat agtgtttacc ttcaaccggt actaaatatc attcctgtag 1140tagacaggat aacgaaagct agtctattta gatcatcagt tccagttcga gattttaaat 1200gctagtccct ccatttcaat ttacaattta tttaattttt ttagtgtgat accgtttagc 1260atataatata ctttaagtgt agctttgatt tttttatata tttttgcaaa attttgaata 1320agacaagtat gtcaaatttg gtgtaaaaat taaacgaatt tataaattgg agcggaggga 1380gtagaaatct acgatttttc tagctgaggc agactgtgcg cattcccatc catcgagtcc 1440acttgcacct ctcctcgaca tgaatacgaa tgtacgatcc gatgaattcc ccacaaagaa 1500gcaattaacg tcaaatccat catcgtcata aaacgacgat accgagctag cgtttaatta 1560gtttgttaga cgaaccagaa actatattat atcgctttgt gtccaaaaat tacttatatt 1620atatatagtt ctcgtgcatc tacgtacacg taacatcgct cttaaatttg tccttacttg 1680gtgtaaaaag attaatctac aaagactata ttgttaaagc aaaattgagg aagctgtatt 1740taacctcgtg accacctaaa ctagtgggaa ttccccatcc ctcaatagaa ctagttttat 1800ttggcaaaca tcatggaaag aatatatcag atacactact ctcgcacaga aagagacgtc 1860aagtggtttg ggcatcaaaa ccataagcgg acgggtttcg agtttggacc tttgaatctg 1920gttgatgttg gagcaagaag aagcagaaat gacacatggc atcattgtga agcttgcgtc 1980gagacgaagc aagacaaagg caaagtagca aaggtacact gttaccgccg gcaataacta 2040cgtacgtacg tgcatgtaag acatgcattg taccgtgaca tacatgtatg tcatataaat 2100ctatgtagat cactcctacg accggcggct tatcgtcact acaacgcatg atacatggat 2160ggaatggatg tgaagtgaga ctgtgagagc actatcggaa tcgcgttctt tgtcaaatgt 2220cgctttccat aaataaacat gtgaacctag gcctaggcac cttccacttc aggcatcttc 2280tacaaatgta gaatgtgtga aggtaggcaa acgtaacggg aaaggcagga agctcatcgc 2340caacgcatct cctctcctgc tccttttgac gacctttcat acctgcaccc gctttttctg 2400gaaagggcat caagatttat atatatatgt tatttttcat tattattagc tttgtttaca 2460acaagtatta ttattattat ccgggctgtg agcagaggga gctggtacaa cttgtccctt 2520gagacggcca agaggcaaca gtgttgtggg cttgcggcca tgacgacgtt gctagctgcc 2580gtgtccaaca ggaagagaag acggcgacgt ggtcgcactg tacgtttttc ccgccacaca 2640aacggggcgg ggggcggtgg tatactggta tggtggccac tggccagccg ccgtgccggt 2700gcaggcagca gcccacagga ccaacgccgc cgccaatgga

tcggacggcc tctgctactg 2760ctagaaatgg aaagcacgca ggtacgtggg gccccctccc tttcccgcgc aagtgcagtg 2820ccagtgcggc agtgcgtgtg tcattattct gtccggaccg gtaggtagta gtatcagatg 2880tactaccagt caaacgacag tgccttccgc ggcggccaaa ggtacagtga cactttgcca 2940aaaacaaaaa aaaaacagca aataaagaaa ggaacgcgcg cgggaatata tcgatctcat 3000cttttttttt ctttgttgtt gttgttgtct acagagatgg taaggaaata aataaataaa 3060ggtgctacat aaagaccgga ttctttattt ctttccaaat ccagaaaagg aattatcttc 3120cccggaatct attttcgaca aataataata ataatatatg attttgttat ttttcattgg 3180ttctctggtt aatcattttg gacgtcatct acctaataac ataggtcgtc cactatgtgg 3240agcgcacggc cttagcttaa gacacaattt gttgacttcc aggattatat aatccacctt 3300atagattata taatcatata atgatatcta gttatcaaga ttatataata atccacctaa 3360taatttgtgt tgtttgtttg cctcttgata tagtaggact atgtagccta ctgacatgat 3420caatttactt ctctaatcac cggcaaaatg aaaaatccat tgtttacctt gccttgagtt 3480gtattaacgg tttccaccaa agtcgttcaa gactctaagt agctcacatg tattccatcc 3540agtcttcaaa tactttaagg ggtcttcact ttggatgtaa atactttatg tttaagcatt 3600tgaagctcat tttagactag gatacccttg atctaggtgg tccacatatt ctcctaggca 3660tgacaaatta ctcagagaca cgcttcctct tcccactaca tgtgtgcatg cattgaaacc 3720gtgaaaaaac ctacgagtgc aatcgatcag gtcgggaaaa aaaggcacac ctagaggcta 3780gagctcagtc agtcccgaac gattgcaaaa aaaaaaagac actagagctc gacctcaaaa 3840cccagtgtgt caatttttac agccagcgtt gcaaccatct aagctaacat cttgtattta 3900aatattatag aaacaacaac cctatttaat agttccttgg tatatataca agatcatgtc 3960caaaacatca agcatttgaa gactagatgt agtacatgga ccaacctgca accttacttt 4020atcagagaaa tcgtcagtcc acacatattt gtcattaatt accaaggcac tactgagagg 4080ttagatgccc acaccgtttc accaaatgat tggttaaaaa gcacggactc ctgtggagct 4140gctactctgc agaggagcgg gagtcagaac catttttaga agagccaaag tcctaccaaa 4200catactctta ctctctcttt ttaaaggtac tacctctttt gaatttaaat gtattactcc 4260ctctttaaag agataataga gaagacgaac aagaaaggga gagggagaaa cga 431384232DNAZea mays 8ctccacctct ctcgtacgct ttgattggcc gctcgcacgc atttatcgcc aagatcgggc 60ttgcccatca ctgggatcat cctggctggc tggctggccg gccacatatc aaacatggat 120ttgctatatt ttaaatgcct gaaatatgtt atactatgtt ttttagataa cgatctttac 180agtcgattta tgaatgtgta gaattaagat tgagcttcct gatgaaaaaa tcaggcaaga 240ggctcttttg gttggagacc tggcatggca cttgcctgcg agtcaagcaa accctatgcc 300actgtttgga ccaggccact ttcctagaga gccgaatcag acatcactat cggaattcga 360atgagtgctc agcactttac cgagtgcaat taatcggaca ctcggcaaag cattctttgt 420cgagtgccac tctcggcgaa ctaataaggc tctcgggaca gatctcgtat gtcgagagcg 480gaacactcga catagaaaaa cactcggcaa aagaggtttt gccgaatgcc aagctctcgg 540caaaatgcga cactcggtaa gggtcgtcaa gagtcgtcta ttgttgacgg ccattaactt 600tcccgagtgt caaacgttga cacttgggaa ttatcttctt tttgtcgatt gtaacctggc 660aaaccctcgg caaaagtata ctttgcggag tgtcttccct caacactcga taaagaatat 720ttgtttcttt ttcttttttc tataccaaac tctttgtgac gttttttctg cagtatatag 780acatacatat tcaattttac acaattatca aagtgtttgc tataattaat agatttagtt 840tgtttaattg aatttctgag aaccaaccaa atagacccga attagacata tctagacatt 900taaaaagtaa gatactaaaa aataatagtg tttaccttca accggtacta aatatcattc 960ctgtagtaga caggataacg aaagctagtc tatttagatc atcagttcca gttcgagatt 1020ttaaatgcta gtccctccat ttcaatttac aatttattta atttttttag tgtgataccg 1080tttagcgtat gtagctttga tttttttata tatttttgca aaattttgaa taagacaagt 1140gtgtcaaatt tggtgtaaaa attaaacgaa attataaatt ggagcggagg gagtagaaat 1200ctacgatttt tctagctgag gcagactgtg cgcattccca tccatcgagt ccacttgcac 1260ctctcctcga catgaatacg aatgtacgat ccgatgaatt ccccacaaag aagcaattaa 1320cgtcaaatcc atcatcgtca taaaacgacg ataccgagct agcgtttaat tagtttgtta 1380gacgaaccag aaactatatt atatcgcttt gtgtccaaaa attacttata ttatatatag 1440ttctcgtgca tctacgtaca cgtaacatcg ctcttaaatt tgtccttact tggtgtaaaa 1500agattaatct acaaagacta tattgttaaa gcaaaattga ggaagctgta tttaacctcg 1560tgaccaccta aactagtggg aatgccccat ccctcaatag aactagtttt atttggcaaa 1620catcatggaa agaatatatc agatacacta ctctcgcaca gagagagatg tcaagtggtt 1680tgggcatcaa aaccataagc ggacgggttt cgagtttgga cctttgaatc tggttgatgt 1740tggagcaaga agaagcaaaa atgacacatg gcatcattgt gaagcttgcg tcgagacgaa 1800gcaagacaaa ggcaaagtag cgaaggtaca ctgttaccgc cggcaataac tacgtacgta 1860catgcatgta agacatgcat tgtaccgtga catacatgta tgtcatataa atctatgtag 1920atcactccta cgaccggcgg ctaatttcac tacacacatg atgcatggat ggaatggatg 1980tgaagtgaga ctgtgagagc actatcggaa tcactttctt cgccgagtgt cgctttccat 2040gaataaacat gtgaacctag gcctaggcac cttccacttc agggcttgtt cggttagctc 2100tcaatccatg tggattgagc gggattggat gggtttgaat cccaaacaag tcaaacttct 2160tcacaatttt ttccaatccc atccaatcca tgtgtattgg gaataaccga acaagccctc 2220aggcatcttc tacaaatgta gaatgtgtga aggtaggcaa acgtaacgga aaggcaggaa 2280gctcatcgcc aacgcatctc ctctcctgct ccttttgacg acctttcata cctgcacccg 2340ctttttctgg aaagggcatc aagatttata tatatatata tatgttattc accagtaaat 2400ttcattatta ttagctttgt ttacaacaag tattattatt attatccggg ctgtgagcag 2460agggagctgg tacaacttgt cccttgagac ggccaagagg caacagtgtt gtgggcttgc 2520ggccatgacg cgacgttgct agctgccgtg tccaacagga agagaagacg gcgacgtggt 2580cgcactgtac gtttttcccg ccacacaaac ggggcggggg gcggtggtat actggtatgg 2640tggccactgg ccagccgccg tgccggtgca ggcagcagcc cacaggacca acgccgccgc 2700caatggatcg gacggcctct gctactgcta gaaatggaaa gcacgcaggt acgtggggcc 2760ccctcccttt cccgcgcaag tgcagtgcca gtgcggcagt gcgtgtgtca ttattctgtc 2820cggaccggta ggtagtagta tcagatgtac taccagtcaa acgacagtgc cttccgcggc 2880ggccaaaggt acagtgacac tttgccaaaa acaaaaaaaa aacagcaaat aaagaaagga 2940acgcgcgcgg gaatatatcg atctcatctt tttttttctt ttttgttgtt gttgtctaca 3000gagatggtaa ggaataaata aataaaggtg ctaaataaag accggattct ttatttcttt 3060ccaaatccag aaaaggaatt atcttccccg gaatctattt tcgagcaaat aataataata 3120atatatgatt ttgttatttt tcattggttc tctggttaat cattttggac gtcatctacc 3180taataacata ggtcgtccac tatgtggagc gcacggcctt agcttaagac acaatttgtt 3240gacttccagg attatataat ccaccttata gattatataa tcatataatg atatctagtt 3300atcaagatta tataataatc cacctaataa tttgtgttgt ttgtttgcct cttgatatag 3360taggactatg tagcctactg acatgatcaa tttacttctc taatcaccgg caaaatgaaa 3420aatccattgt ttaccttgcc ttgagttgta ttaacggttt ccaccaaagt cgttcaagac 3480tctaagtagc tcacatgtat tccatccagt cttcaaatac tttaaggggt cttcactttg 3540gatgtaaata ctttatgttt aagcatttga agctcatttt agactaggat acccttgatc 3600taggtggtcc acatattctc ctaggcatga caaattactc agagacacgc ttcctcttcc 3660cactacatgt gtgcatgcat tgaaaccgtg aaaaaaccta cgagtgcaat cgatcaggtc 3720gggaaaaaaa ggcacaccta gaggctagag ctcagtcagt cccgaacgat tgcaaaaaaa 3780aaaagacact agagctcgac ctcaaaaccc agtgtgtcaa tttttacagc cagcgttgca 3840accatctaag ctaacatctt gtatttaaat attatagaaa caacaaccct atttaatagt 3900tccttggtat atatacaaga tcatgtccaa aacatcaagc atttgaagac tagatgtagt 3960acatggacca acctgcaacc ttactttatc agagaaatcg tcagtccaca catatttgtc 4020attaattacc aaggcactac tgagaggtta gatgcccaca ccgtttcacc aaatgattgg 4080ttaaaaagca cggactcctg tggagctgct actctgcaga ggagcgggag tcagaaccat 4140ttttagaaga gccaaagtcc taccaaacat actcttactc tctcttttta aaggtactac 4200ctcttttgaa tttaaatgta ttactccctc tt 4232949DNAartificial sequenceprimer 9ggggacaagt ttgtacaaaa aagcaggcta tgcagttgga tctgaacgt 491047DNAartificial sequenceprimer 10ggggaccact ttgtacaaga aagctgggtt cagcggggat ggtgatg 471124DNAartificial sequenceprimer 11ggatccgatc tgaacgtggc cgag 241231DNAartificial sequenceprimer 12gaattcctag gcagctgttc ttgtctcttt g 311326DNAartificial sequenceprimer 13gcggccgcga tctgaacgtg gccgag 261430DNAartificial sequenceprimer 14gaattctgtg ggactcccag cggcctgtgc 30

Claims

1. An isolated nucleic acid molecule that encodes a polypeptide having RAP2.7-like activity, said nucleic acid molecule being selected from the group consisting of: (a) a nucleic acid molecule comprising the sequence set forth in SEQ ID NOS: 1, 3, or 4; (b) a nucleic acid molecule comprising a sequence encoding the amino acid sequence set forth in SEQ ID NOS: 2; (c) a nucleic acid molecule comprising a sequence having at least 80% sequence identity to the nucleotide sequence set forth in SEQ ID NOS: 1, 3, or 4; and (d) a nucleic acid molecule comprising a sequence of at least 50 consecutive nucleic acids of any of (a) through (d).

2. A vector comprising the nucleic acid molecule of claim 1.

3. A plant cell having stably incorporated in its genome the nucleic acid molecule of claim 1.

4. The plant cell of claim 3, wherein said plant cell is from a monocot plant.

5. The plant cell of claim 4, wherein said monocot plant is maize.

6. A plant having stably incorporated into its genome the nucleic acid molecule of claims 1.

7. A method for altering flowering time in a plant comprising: transforming a plant cell with a nucleic acid molecule operably linked to a promoter that regulates transcription of said sequence in a plant cell; wherein said nucleic acid molecule comprises a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence comprising the sequence set forth in SEQ ID NOS: 1, 3, or 4; (b) a nucleotide sequence encoding the amino acid sequence of SEQ ID NO:2; (c) a nucleotide sequence having at least 80% sequence identity to the sequence of SEQ ID NOS: 1, 3, or 4, wherein said nucleotide sequence encodes a protein which regulates flowering in plants.

8. The method of claim 6, wherein said plant is a monocot.

9. The method of claim 7, wherein said monocot is maize.

10. The method of claim 7 wherein said nucleic acid molecule is a vector for over-expression of RAP2.7.

11. The method of claim 7 wherein said plant flowers later than a plant which does not have the overexpression vector incorporated therein.

12. The method of claim 7 wherein said nucleic acid moleculare is a vector for inhibiting expression of RAP2.7.

13. The method of claim 12 wherein said vector is an RNA interference vector.

14. The method of claim 13 wherein said plant flowers earlier than a plant which does not have an RNA interference vector incorporated therein.

15. A method for altering maturity of a plant, said method comprising: transforming said plant with a nucleic acid molecule comprising a heterologous sequence operably linked to a promoter that induces transcription of said heterologous sequence in a plant cell; and regenerating stably transformed plants, wherein said heterologous sequence comprises a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence comprising the sequence set forth in SEQ ID NOS: 1, 3 or 4; (b) a nucleotide sequence comprising at least 50 contiguous nucleotides of the sequence of SEQ ID NOS: 1, 3, or 4, wherein said nucleotide sequence encodes a protein flowering regulatory activity; and (c) a nucleotide sequence having at least 80% sequence identity to the sequence of SEQ ID NOS: 1, 3, or 4.

16. The plant of claim 18, wherein said promoter is a constitutive promoter.

17. The plant of claim 18, wherein said promoter is a tissue-preferred promoter.

18. The plant of claim 18, wherein said promoter is an inducible promoter.

19. The method of 15, wherein said plant is a monocot.

20. The method of 16, wherein said monocot is maize.

21. The method of claim 15 wherein said nucleic acid molecule is a vector for over-expression of RAP2.7.

22. The method of claim 18 wherein said plant matures earlier than a plant which does not have the overexpression vector incorporated therein.

23. The method of claim 15 wherein said nucleic acid molecule is a vector for inhibiting expression of RAP2.7.

24. The method of claim 20 wherein said vector is an RNA interference vector.

25. The method of claim 13 wherein said plant matures later than a plant which does not have an RNA interference vector incorporated therein.

26. An isolated polypeptide having flowering regulatory activity and selected from the group consisting of: (a) a polypeptide comprising the amino acid sequence set forth in SEQ ID NOS: 2; (b) a polypeptide encoded by a nucleotide sequence comprising the sequence set forth in SEQ ID NOS: 1, 3, or 4; (c) a polypeptide encoded by a nucleotide sequence that has at least 80% sequence identity to the sequence set forth in SEQ ID NOS: 1, 3, or 4. (d) a polypeptide comprising an amino acid sequence having at least 90% sequence identity to the sequence set forth in SEQ ID NO:2; and (e) a polypeptide comprising an amino acid sequence of at least 30 consecutive amino acids of any of (a) through (d).

27. A nucleotide construct comprising: a nucleic acid molecule encoding an amino acid of claim 23, wherein said nucleic acid molecule is operably linked to a promoter that drives expression in a host cell.

28. An isolated nucleic acid molecule that encodes a regulatory element having regulatory activity for flowering time, said nucleic acid molecule being selected from the group consisting of: (a) a nucleic acid molecule comprising the sequence set forth in SEQ ID NOS: 5, 6, 7, or 8; (b) a nucleic acid molecule comprising a sequence having at least 80% sequence identity to the nucleotide sequence set forth in SEQ ID NOS: 5, 6, 7, or 8; and (c) a nucleic acid molecule comprising a sequence of at least 50 consecutive nucleic acids of any of (a) through (c).

29. A vector comprising the nucleic acid molecule of claim 28.

30. A plant cell having stably incorporated in its genome the nucleic acid molecule of claim 27.

31. The plant cell of claim 30, wherein said plant cell is from a monocot plant.

32. The plant cell of claim 31, wherein said monocot plant is maize.

33. A plant having stably incorporated in its genome the nucleic acid molecule of claim 27.

34. A method for changing maturity of a plant, said method comprising: stably introducing into the genome of a plant, at least one nucleotide construct comprising a nucleic acid molecule operably linked to a heterologous promoter that drives transcription in a plant cell, wherein said nucleic acid molecule encodes a regulatory element having regulatory activity on flowering time and is selected from the group consisting of: (a) a nucleic acid molecule comprising the sequence set forth in SEQ ID NOS: 5, 6, 7, or 8; (b) a nucleic acid molecule comprising a sequence having at least 80% sequence identity to the nucleotide sequence set forth in SEQ ID NOS: 5, 6, 7, or 8; and (c) a nucleic acid molecule comprising a sequence of at least consecutive nucleic acids of any of (a) through (c).

35. A method of changing the maturity of a plant comprising, introducing to a plant cell, a VGT1 expression construct, comprising, a VGT1 regulatory element which regulates RAP2.7 expression, operably linked to a promoter.

36. A method of identifying a plant with altered maturity time, comprising: assaying said plant for a VGT1 polymorphism, wherein said polymorphism is identified in FIG. 8 wherein said VGT1 polymorphism is associated with a earlier maturity in said plant than the maturity of a plant without said VGT1 polymorphism.