U.S. patent application number 13/418018 was filed with the patent office on 2012-09-13 for herbicide-resistant rice plants, polynucleotides encoding herbicide resistant acetohydroxyacid synthase large subunit proteins, and methods of use.
This patent application is currently assigned to INSTITUTO NACIONAL DE TECNOLOGIA AGROPECUARIA. Invention is credited to Robert Ascenzi, Alberto LIVORE, Alberto Raul Prina, Bijay K. Singh, Sherry R. Whitt.
Application Number | 20120233723 13/418018 |
Document ID | / |
Family ID | 36941796 |
Filed Date | 2012-09-13 |
United States Patent
Application |
20120233723 |
Kind Code |
A1 |
LIVORE; Alberto ; et
al. |
September 13, 2012 |
HERBICIDE-RESISTANT RICE PLANTS, POLYNUCLEOTIDES ENCODING HERBICIDE
RESISTANT ACETOHYDROXYACID SYNTHASE LARGE SUBUNIT PROTEINS, AND
METHODS OF USE
Abstract
Herbicide-resistant rice plants, isolated polynucleotides that
encode herbicide resistant and wild-type acetohydroxyacid synthase
large subunit 1 (AHASL1) polypeptides, and the amino acid sequences
of these polypeptides, are described. Expression cassettes and
transformation vectors comprising the polynucleotides of the
invention, as well as plants and host cells transformed with the
polynucleotides, are described. Methods of using the
polynucleotides to enhance the resistance of plants to
imidazolinone herbicides, and methods for controlling weeds in the
vicinity of herbicide-resistant plants are also described.
Inventors: |
LIVORE; Alberto; (Entre
Rios, AR) ; Prina; Alberto Raul; (Pcia, AR) ;
Singh; Bijay K.; (Cary, NC) ; Ascenzi; Robert;
(Cary, NC) ; Whitt; Sherry R.; (Raleigh,
NC) |
Assignee: |
INSTITUTO NACIONAL DE TECNOLOGIA
AGROPECUARIA
Buenos Aires
AR
|
Family ID: |
36941796 |
Appl. No.: |
13/418018 |
Filed: |
March 12, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11816884 |
Sep 9, 2009 |
|
|
|
PCT/US2006/007343 |
Feb 28, 2006 |
|
|
|
13418018 |
|
|
|
|
60657968 |
Mar 2, 2005 |
|
|
|
Current U.S.
Class: |
800/278 ;
435/418; 435/468; 504/100; 504/247; 504/253; 504/277; 530/372;
536/23.6; 800/300 |
Current CPC
Class: |
C12N 15/8278 20130101;
C12N 9/88 20130101; C12N 9/1022 20130101 |
Class at
Publication: |
800/278 ;
536/23.6; 530/372; 800/300; 504/100; 435/418; 435/468; 504/277;
504/253; 504/247 |
International
Class: |
C12N 15/82 20060101
C12N015/82; C07K 14/415 20060101 C07K014/415; A01H 5/00 20060101
A01H005/00; A01P 13/00 20060101 A01P013/00; A01C 1/06 20060101
A01C001/06; C12N 5/10 20060101 C12N005/10; A01N 43/50 20060101
A01N043/50; C12N 15/29 20060101 C12N015/29; A01H 5/10 20060101
A01H005/10 |
Claims
1-83. (canceled)
84. A isolated, recombinant, mutagenized, or synthetic rice AHASL1
nucleic acid molecule, or a complement thereof, that encodes a
variant rice AHASL1 polypeptide comprising an aspartate or valine
substitution at amino acid position 179 or equivalent position
relative to the amino acid sequence as shown by SEQ ID NO:2,
wherein expression of the variant rice AHASL1 polypeptide in a
plant confers upon the plant tolerance to an AHAS-inhibiting
herbicide as compared to a non-transformed variety of said
plant.
85. The rice AHASL1 nucleic acid molecule of claim 84, wherein the
nucleic acid molecule comprises a nucleotide sequence encoding a
polypeptide having the amino acid sequence as shown by SEQ ID
NO:2.
86. The rice AHASL1 nucleic acid molecule of claim 84, wherein the
nucleic acid molecule comprises a nucleotide sequence as shown by
SEQ ID NO:1.
87. A isolated rice AHAS polypeptide encoded by the nucleic acid
molecule of claim 84.
88. A transformed plant comprising a polynucleotide construct
comprising an isolated, recombinant, mutagenized, or synthetic rice
AHASL1 nucleic acid molecule, or a complement thereof, that encodes
a variant rice AHASL1 polypeptide comprising an aspartate or valine
substitution at amino acid position 179 or equivalent position
relative to the amino acid sequence as shown by SEQ ID NO:2,
wherein expression of the variant rice AHASL1 polypeptide in the
plant confers upon the plant tolerance to an AHAS-inhibiting
herbicide as compared to a non-transformed variety of said plant,
said nucleic acid molecule operably linked to a promoter that
drives expression in said plant whereby the plant exhibits
increased tolerance to an AHAS-inhibiting herbicide as compared to
the non-transformed variety of said plant.
89. The plant of claim 88, wherein the plant is a dicot or
monocot.
90. A seed of the plant of claim 88, wherein the seed comprises the
construct.
91. The seed of claim 90, wherein the seed is treated with an
AHAS-inhibiting herbicide.
92. The seed of claim 91, wherein the AHAS-inhibiting herbicide is
an imidazolinone herbicide.
93. The seed of claim 92, wherein the imidazolinone herbicide is
selected from the group consisting of:
2-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-nicotinic acid,
2-(4-isopropyl)-4-methyl-5-oxo-2-imidazolin-2-yl)-3-quinolinecarboxylic
acid,
5-ethyl-2-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-nicotinic
acid,
2-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-5-(methoxymethyl)--
nicotinic acid,
2-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-5-methylnicotinic
acid, and a mixture of methyl
6-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-m-toluate and
methyl
2-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-p-toluate.
94. The seed of claim 91, wherein the AHAS-inhibiting herbicide is
a sulfonylurea herbicide.
95. The seed of claim 94, wherein the sulfonylurea herbicide is
selected from the group consisting of: is selected from the group
consisting of: chlorsulfuron, metsulfuron methyl, sulfometuron
methyl, chlorimuron ethyl, thifensulfuron methyl, tribenuron
methyl, bensulfuron methyl, nicosulfuron, ethametsulfuron methyl,
rimsulfuron, triflusulfuron methyl, triasulfuron, primisulfuron
methyl, cinosulfuron, amidosulfuron, flazasulfuron, imazosulfuron,
pyrazosulfuron ethyl, halosulfuron, and mixtures thereof.
96. A plant part or cell of the plant of claim 88, wherein the part
or cell comprises the construct.
97. A method for controlling weeds in a field, said method
comprising: (a) growing, in a field, a rice plant according to
claim 88; and (b) contacting said plant and weeds in the field with
an effective amount of an AHAS-inhibiting herbicide, thereby
controlling the weeds.
98. The method of claim 97, wherein the AHAS-inhibiting herbicide
is selected from the group consisting of:
2-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-nicotinic acid,
2-(4-isopropyl)-4-methyl-5-oxo-2-imidazolin-2-yl)-3-quinolinecarboxylic
acid,
5-ethyl-2-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-nicotinic
acid,
2-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-5-(methoxymethyl)--
nicotinic acid,
2-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-5-methylnicotinic
acid, and a mixture of methyl
6-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-m-toluate and
methyl
2-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-p-toluate.
99. A method for producing a plant having tolerance to an
imidazolinone herbicide, the method comprising: (a) transforming a
plant cell with the nucleic acid molecule of claim 84; and (b)
generating from the plant cell a plant having increased tolerance
to an imidazolinone herbicide as compared to a non-transformed
variety of said plant.
100. A plant produced according to the method of claim 99.
101. A seed of the plant of claim 100, wherein the seed comprises
the nucleic acid molecule.
102. The seed of claim 101, wherein the seed is treated with an
AHAS-inhibiting herbicide.
103. A method for selecting for a transformed plant cell, the
method comprising: (a) transforming a plant cell with a plant
transformation vector; (b) exposing said transformed plant cell to
at least one herbicide at a concentration that inhibits the growth
of an untransformed plant cell; and (c) identifying said
transformed plant cell by its ability to grow in the presence of
said herbicide; wherein said plant transformation vector comprises
the nucleic acid molecule according to claim 84.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser.
No. 11/816,884, filed Sep. 9, 2009, which is a national phase of
International Application PCT/US2006/007343, filed Feb. 28, 2006,
which claims the benefit of U.S. Provisional Application No.
60/657,968, filed Mar. 2, 2005, each of which is herein
incorporated by reference in its entirety.
FIELD OF THE INVENTION
[0002] This invention relates to the field of agricultural
biotechnology, particularly to herbicide-resistant rice plants and
to novel polynucleotide sequences that encode herbicide-resistant
acetohydroxy acid synthase large subunit proteins.
BACKGROUND OF THE INVENTION
[0003] Weeds are one of the major constraints to rice production.
Direct seeding has reduced the labor problems of transplanting;
however, this technology has helped to increase the weed problem.
Herbicide use in rice is a common practice in most of the rice
regions under direct seeding crop and/or developed countries that
grow rice under either transplanting or direct seeding systems.
Usually a grass and a broadleaf herbicide are applied one or more
times in order to control weeds in rice crops.
[0004] Grasses, sedges and weedy rice (red rice) have been the
major groups of species that possess high fitness to the same
environments where rice is grown. They have become globally
distributed and are difficult to control weeds in rice crops.
Although there are several cultural practices that aid in control
of weeds and are convenient for better environmental care, these
practices impose restrictions and increase production costs. Land
preparation, land leveling, levees and depth of water, land
rotation, certified seed, proper plant systems and dates of
planting could be some of the cultural practices that may help to
reduce the weed seed bank and the development of herbicide-tolerant
weeds.
[0005] In spite of the many recommendations for better cultural
practices the farmers still rely on the use of herbicides as the
main tool to control weeds. The use and abuse of some of these
chemicals has resulted in the development of tolerant weeds like
propanil-resistant and butachlor-resistant barnyardgrass
(Echinochloa crus galli). In these cases, it would be convenient to
have other herbicides with different modes of action with the
ability to control most of these weed species. The availability of
such herbicides would allow for a rotation of herbicides with a
different mode of action than those herbicides that are commonly
used in rice production.
[0006] Imidazolinones are a group of herbicides with a different
mode of action than the commonly used rice herbicides. These
herbicides are known to inhibit acetohydroxyacid synthase (AHAS; EC
4.1.3.18, also known as acetolactate synthase or ALS), a key enzyme
for the biosynthesis of branched-chain amino acids. Inn particular,
acetohydroxyacid synthase (AHAS; EC 4.1.3.18, also known as
acetolactate synthase or ALS), is the first enzyme that catalyzes
the biochemical synthesis of the branched chain amino acids valine,
leucine and isoleucine (Singh (1999) "Biosynthesis of valine,
leucine and isoleucine," in Plant Amino Acid, Singh, B. K., ed.,
Marcel Dekker Inc. New York, N.Y., pp. 227-247). AHAS is the site
of action of four structurally diverse herbicide families including
the sulfonylureas (LaRossa and Falco (1984) Trends Biotechnol.
2:158-161), the imidazolinones (Shaner et al. (1984) Plant Physiol.
76:545-546), the triazolopyrimidines (Subramanian and Gerwick
(1989) "Inhibition of acetolactate synthase by
triazolopyrimidines," in Biocatalysis in Agricultural
Biotechnology, Whitaker, J. R. and Sonnet, P. E. eds., ACS
Symposium Series, American Chemical Society, Washington, D.C., pp.
277-288), and the pyrimidyloxybenzoates (Subramanian et al. (1990)
Plant Physiol. 94: 239-244.). Imidazolinone and sulfonylurea
herbicides are widely used in modern agriculture due to their
effectiveness at very low application rates and relative
non-toxicity in animals. By inhibiting AHAS activity, these
families of herbicides prevent further growth and development of
susceptible plants including many weed species. Several examples of
commercially available imidazolinone herbicides are PURSUIT.RTM.
(imazethapyr), SCEPTER.RTM. (imazaquin) and ARSENAL.RTM.
(imazapyr). Examples of sulfonylurea herbicides are chlorsulfuron,
metsulfuron methyl, sulfometuron methyl, chlorimuron ethyl,
thifensulfuron methyl, tribenuron methyl, bensulfuron methyl,
nicosulfuron, ethametsulfuron methyl, rimsulfuron, triflusulfuron
methyl, triasulfuron, primisulfuron methyl, cinosulfuron,
amidosulfuron, flazasulfuron, imazosulfuron, pyrazosulfuron ethyl
and halosulfuron.
[0007] Due to their high effectiveness and low-toxicity,
imidazolinone herbicides are favored for application by spraying
over the top of a wide area of vegetation. The ability to spray an
herbicide over the top of a wide range of vegetation decreases the
costs associated with plantation establishment and maintenance, and
decreases the need for site preparation prior to use of such
chemicals. Spraying over the top of a desired tolerant species also
results in the ability to achieve maximum yield potential of the
desired species due to the absence of competitive species. However,
the ability to use such spray-over techniques is dependent upon the
presence of imidazolinone-resistant species of the desired
vegetation in the spray over area.
[0008] Among the major agricultural crops, some leguminous species
such as soybean are naturally resistant to imidazolinone herbicides
due to their ability to rapidly metabolize the herbicide compounds
(Shaner and Robinson (1985) Weed Sci. 33:469-471). Other crops such
as corn (Newhouse et al. (1992) Plant Physiol. 100:882-886) and
rice (Barrett et al. (1989) Crop Safeners for Herbicides, Academic
Press, New York, pp. 195-220) are somewhat susceptible to
imidazolinone herbicides. The differential sensitivity to the
imidazolinone herbicides is dependent on the chemical nature of the
particular herbicide and differential metabolism of the compound
from a toxic to a non-toxic form in each plant (Shaner et al.
(1984) Plant Physiol. 76:545-546; Brown et al., (1987) Pestic.
Biochem. Physiol. 27:24-29). Other plant physiological differences
such as absorption and translocation also play an important role in
sensitivity (Shaner and Robinson (1985) Weed Sci. 33:469-471).
[0009] Plants resistant to imidazolinones, sulfonylureas and
triazolopyrimidines have been successfully produced using seed,
microspore, pollen, and callus mutagenesis in Zea mays, Arabidopsis
thaliana, Brassica napus (i.e., canola) Glycine max, Nicotiana
tabacum, and Oryza sativa (Sebastian et al. (1989) Crop Sci.
29:1403-1408; Swanson et al., 1989 Theor. Appl. Genet. 78:525-530;
Newhouse et al. (1991) Theor. Appl. Genet. 83:65-70; Sathasivan et
al. (1991) Plant Physiol. 97:1044-1050; Mourand et al. (1993) J.
Heredity 84:91-96; U.S. Pat. No. 5,545,822). In all cases, a
single, partially dominant nuclear gene conferred resistance. Four
imidazolinone resistant wheat plants were also previously isolated
following seed mutagenesis of Triticum aestivum L. cv. Fidel
(Newhouse et al. (1992) Plant Physiol. 100:882-886). Inheritance
studies confirmed that a single, partially dominant gene conferred
resistance. Based on allelic studies, the authors concluded that
the mutations in the four identified lines were located at the same
locus. One of the Fidel cultivar resistance genes was designated
FS-4 (Newhouse et al. (1992) Plant Physiol. 100:882-886).
[0010] Computer-based modeling of the three dimensional
conformation of the AHAS-inhibitor complex predicts several amino
acids in the proposed inhibitor binding pocket as sites where
induced mutations would likely confer selective resistance to
imidazolinones (Ott et al. (1996) J. Mol. Biol. 263:359-368). Wheat
plants produced with some of these rationally designed mutations in
the proposed binding sites of the AHAS enzyme have in fact
exhibited specific resistance to a single class of herbicides (Ott
et al. (1996) J. Mol. Biol. 263:359-368).
[0011] Plant resistance to imidazolinone herbicides has also been
reported in a number of patents. U.S. Pat. Nos. 4,761,373,
5,331,107, 5,304,732, 6,211,438, 6,211,439 and 6,222,100 generally
describe the use of an altered AHAS gene to elicit herbicide
resistance in plants, and specifically discloses certain
imidazolinone resistant corn lines. U.S. Pat. No. 5,013,659
discloses plants exhibiting herbicide resistance due to mutations
in at least one amino acid in one or more conserved regions. The
mutations described therein encode either cross-resistance for
imidazolinones and sulfonylureas or sulfonylurea-specific
resistance, but imidazolinone-specific resistance is not described.
U.S. Pat. No. 5,731,180 and U.S. Pat. No. 5,767,361 discuss an
isolated gene having a single amino acid substitution in a
wild-type monocot AHAS amino acid sequence that results in
imidazolinone-specific resistance. In addition, rice plants that
are resistant to herbicides that interfere with AHAS have been
developed by mutation breeding and also by the selection of
herbicide resistant plants from a pool of rice plants produced by
anther culture. See, U.S. Pat. Nos. 5,545,822, 5,736,629,
5,773,703, 5,773,704, 5,952,553 and 6,274,796.
[0012] In plants, as in all other organisms examined, the AHAS
enzyme is comprised of two subunits: a large subunit (catalytic
role) and a small subunit (regulatory role) (Duggleby and Pang
(2000) J. Biochem. Mol. Biol. 33:1-36). The AHAS large subunit
(also referred to herein as AHASL) may be encoded by a single gene
as in the case of Arabidopsis and rice or by multiple gene family
members as in maize, canola, and cotton. Specific,
single-nucleotide substitutions in the large subunit confer upon
the enzyme a degree of insensitivity to one or more classes of
herbicides (Chang and Duggleby (1998) Biochem J. 333:765-777).
[0013] For example, bread wheat, Triticum aestivum L., contains
three homoeologous acetohydroxyacid synthase large subunit genes.
Each of the genes exhibit significant expression based on herbicide
response and biochemical data from mutants in each of the three
genes (Ascenzi et al. (2003) International Society of Plant
Molecular Biologists Congress, Barcelona, Spain, Ref. No. 510-17).
The coding sequences of all three genes share extensive homology at
the nucleotide level (WO 03/014357). Through sequencing the AHASL
genes from several varieties of Triticum aestivum, the molecular
basis of herbicide tolerance in most IMI-tolerant
(imidazolinone-tolerant) lines was found to be the mutation
S653(At)N, indicating a serine to asparagine substitution at a
position equivalent to the serine at amino acid 653 in Arabidopsis
thaliana (WO 03/01436; WO 03/014357). This mutation is due to a
single nucleotide polymorphism (SNP) in the DNA sequence encoding
the AHASL protein.
[0014] Given their high effectiveness and low-toxicity,
imidazolinone herbicides are favored for agricultural use. However,
the ability to use imidazolinone herbicides in a particular crop
production system depends upon the availability of
imidazolinone-resistant varieties of the crop plant of interest. To
produce such imidazolinone-resistant varieties, plant breeders need
to develop breeding lines with the imidazolinone-resistance trait.
Thus, additional imidazolinone-resistant breeding lines and
varieties of crop plants, as well as methods and compositions for
the production and use of imidazolinone-resistant breeding lines
and varieties, are needed.
SUMMARY OF THE INVENTION
[0015] The present invention provides rice plants having increased
resistance to herbicides when compared to a wild-type rice plant.
In particular, the rice plants of the invention have increased
resistance to imidazolinone and sulfonylurea herbicides, when
compared to a wild-type rice plant. The herbicide resistant rice
plants of the invention comprise at least one copy of a gene or
polynucleotide that encodes a herbicide-resistant acetohydroxyacid
synthase large subunit 1 (AHASL1) that comprise an amino acid
substitution relative to the amino acid sequence of a wild-type,
rice AHASL1 protein. In one embodiment of the invention, the
herbicide-resistant rice plants comprise a herbicide-resistant
AHASL1 protein that comprises a valine or aspartate at amino acid
position 179 or equivalent position. The herbicide-resistant rice
plant of the invention can contain one, two, three, four, or more
copies of a gene or polynucleotide encoding a herbicide-resistant
AHASL1 protein of the invention. The rice plants of the invention
also include seeds and progeny plants that comprise at least one
copy of a gene or polynucleotide encoding a herbicide-resistant
AHASL1 of the invention.
[0016] The present invention provides herbicide-resistant rice
plants that are from the rice line that has been designated as
IMINTA 16. A sample of seeds of the IMINTA 16 line has been
deposited with the patent depository at NCIMB Ltd. and assigned
NCIMB Accession Number NCIMB 41262. The IMINTA 16 rice plants
comprise in their genomes an AHASL1 gene that comprises the
nucleotide sequences set forth in SEQ ID NOS:1 and 3, or that
encodes the AHASL1 protein comprising, the amino acid sequence set
forth in SEQ ID NO:2. When compared to the amino acid sequence of
the AHASL1 protein that is encoded by an AHASL1 gene from a
wild-type rice plant (GenBank Accession No. AB049822), the amino
acid sequence set forth in SEQ ID NO:2 possesses a single amino
acid difference from the wild-type amino acid sequence. In the
amino acid sequence set forth in SEQ ID NO: 2, there is a valine at
amino acid position 179. In the amino acid sequence of the
wild-type, rice AHASL1 protein, this same amino acid position has
an alanine.
[0017] The present invention further provides isolated
polynucleotides and isolated polypeptides for rice (Oryza sativa)
AHASL1 proteins. The polynucleotides of the invention encompass
nucleotide sequences that encode herbicide-resistant AHASL1
proteins. The herbicide-resistant AHASL1 proteins of the invention
are imidazolinone-resistant AHASL1 proteins that comprise an
alanine-to-valine substitution at position 179 in their respective
amino acid sequences, when compared to the corresponding wild-type
amino acid sequence. The polynucleotides of the invention encompass
the nucleotide sequences set forth in SEQ ID NOS:1 and 3,
nucleotide sequences encoding the amino acid sequence set forth in
SEQ ID NO:2, and fragments and variants of said nucleotide
sequences that encode proteins comprising AHAS activity,
particularly herbicide-resistant AHAS activity.
[0018] The present invention provides expression cassettes for
expressing the polynucleotides of the invention in plants, plant
cells, and other, non-human host cells. The expression cassettes
comprise a promoter expressible in the plant, plant cell, or other
host cells of interest operably linked to a polynucleotide of the
invention that encodes a herbicide-resistant AHASL1 protein. If
necessary for targeting expression to the chloroplast, the
expression cassette can also comprise an operably linked
chloroplast-targeting sequence that encodes of a chloroplast
transit peptide to direct an expressed AHASL1 protein to the
chloroplast. The expression cassettes of the invention find use in
a method for enhancing the herbicide tolerance of a plant and a
host cell. The method involves transforming the plant or host cell
with an expression cassette of the invention, wherein the
expression cassette comprises a promoter that is expressible in the
plant or host cell of interest and the promoter is operably linked
to a polynucleotide of the invention that encodes an
herbicide-resistant AHASL1 protein of the invention. The method
further comprises regenerating a transformed plant from the
transformed plant cell.
[0019] The present invention provides a method for increasing AHAS
activity in a plant comprising transforming a plant cell with a
polynucleotide construct comprising a nucleotide sequence operably
linked to a promoter that drives expression in a plant cell and
regenerating a transformed plant from the transformed plant cell.
The nucleotide sequence is selected from those nucleotide sequences
that encode the herbicide-resistant AHASL1 proteins of the
invention, particularly the nucleotide sequences set forth in SEQ
ID NOS:1 and 3, nucleotide sequences encoding the amino acid
sequence set forth in SEQ ID NO:2, and fragments and variants
thereof. A plant produced by this method comprises increased AHAS
activity, when compared to an untransformed plant.
[0020] The present invention provides a method for producing a
herbicide-resistant plant comprising transforming a plant cell with
a polynucleotide construct comprising a nucleotide sequence
operably linked to a promoter that drives expression in a plant
cell and regenerating a transformed plant from said transformed
plant cell. The nucleotide sequence is selected from those
nucleotide sequences that encode the herbicide-resistant AHASL1
proteins of the invention, particularly the nucleotide sequences
set forth in SEQ ID NOS:1 and 3, nucleotide sequences encoding the
amino acid sequence set forth in SEQ ID NO:2, and fragments and
variants thereof, including, but not limited to, the mature forms
of the herbicide-resistant AHASL1 proteins of the invention. A
herbicide-resistant plant produced by this method comprises
enhanced resistance to at least one herbicide, particularly an
imidazolinone or sulfonylurea herbicide, when compared to an
untransformed plant.
[0021] The present invention provides a method for enhancing
herbicide-tolerance in a herbicide-tolerant plant. The method finds
use in enhancing the resistance of a plant that already is
resistant to a level of a herbicide that would kill or
significantly injure a wild-type plant. Such a herbicide-tolerant
plant can be a herbicide-tolerant plant that has been genetically
engineered for herbicide-tolerance or a herbicide-tolerant plant
that was developed by means that do not involve recombinant DNA
such as, for example, the IMINTA 16 rice plants of the present
invention. The method comprises transforming a herbicide-tolerant
plant with a polynucleotide construct comprising a nucleotide
sequence operably linked to a promoter that drives expression in a
plant cell and regenerating a transformed plant from the
transformed plant cell. The nucleotide sequence is selected from
those nucleotide sequences that encode the herbicide-resistant
AHASL1 proteins of the invention, particularly the nucleotide
sequences set forth in SEQ ID NO: 1 and 3, nucleotide sequences
encoding the amino acid sequence set forth in SEQ ID NO:2, and
fragments and variants thereof.
[0022] The present invention provides transformation vectors
comprising a selectable marker gene of the invention. The
selectable marker gene comprises a promoter that drives expression
in a host cell operably linked to a polynucleotide comprising a
nucleotide sequence that encodes a herbicide-resistant AHASL1
protein of the invention. The transformation vector can
additionally comprise a gene of interest to be expressed in the
host cell and can also, if desired, include a chloroplast-targeting
sequence that is operably linked to the polynucleotide of the
invention.
[0023] The present invention further provides methods for using the
transformation vectors of the invention to select for cells
transformed with the gene of interest. Such methods involve the
transformation of a host cell with the transformation vector,
exposing the cell to a level of an imidazolinone or sulfonylurea
herbicide that would kill or inhibit the growth of a
non-transformed host cell, and identifying the transformed host
cell by its ability to grow in the presence of the herbicide. In
one embodiment of the invention, the host cell is a plant cell and
the selectable marker gene comprises a promoter that drives
expression in a plant cell.
[0024] The present invention provides a method for controlling
weeds in the vicinity of the herbicide-resistant plants of the
invention, including the herbicide-resistant rice plants described
above and plants transformed with the herbicide-resistant AHASL1
polynucleotides of the invention. Such transformed plants comprise
in their genomes at least one expression cassette comprising a
promoter that drives gene expression in a plant cell, wherein the
promoter is operably linked to an AHASL1 polynucleotide of the
invention. The method comprises applying an effective amount of a
herbicide to the weeds and to the herbicide-resistant plant,
wherein the herbicide-resistant plant, plant has increased
resistance to at least one herbicide, particularly an imidazolinone
or sulfonylurea herbicide, when compared to a wild-type or
untransformed plant.
[0025] The plants of the present invention can be transgenic or
non-transgenic. An example of a non-transgenic rice plant having
increased resistance to imidazolinone and/or sulfonylurea
herbicides includes a rice plant having NCIMB Accession Number
NCIMB 41262, or mutant, recombinant, or a genetically engineered
derivative of the plant having NCIMB Accession Number NCIMB 41262;
or of any progeny of the plant having NCIMB Accession Number NCIMB
41262; or a plant that is a progeny of any of these plants; or a
plant that comprises the herbicide resistance characteristics of
the plant having NCIMB Accession Number NCIMB 41262.
[0026] The present invention also provides plants, plant organs,
plant tissues, plant cells, seeds, and non-human host cells that
are transformed with the at least one polynucleotide, expression
cassette, or transformation vector of the invention. Such
transformed plants, plant organs, plant tissues, plant cells,
seeds, and non-human host cells have enhanced tolerance or
resistance to at least one herbicide, at levels of the herbicide
that kill or inhibit the growth of an untransformed plant, plant
tissue, plant cell, or non-human host cell, respectively.
Preferably, the transformed plants, plant tissues, plant cells, and
seeds of the invention are Arabidopsis thaliana and crop
plants.
BRIEF DESCRIPTION OF THE DRAWING(S)
[0027] FIG. 1 is a nucleotide sequence alignment of the
herbicide-resistant rice AHASL1 gene of the present invention (SEQ
ID NO:1) with some known plant AHASL nucleotide sequences. The
C-to-T transitions (relative to wild-type) at nucleotide 542 in SEQ
ID NO:1 is indicated by white type within a black box. The start
and stop codons are represented in bold-face type. The names of the
other AHASL sequences in the figure are defined as follows:
"OsAHASL1.1" is a wild-type AHASL1 nucleotide sequence from El Paso
rice background; "OsAHASL1.2" is a wild-type AHASL1 nucleotide
sequence from IRGA rice background; "OsAHASL1.4" is a rice AHASL1
nucleotide sequence (Accession No. AB049822); "OsAHASL1.6" is a
rice AHASL1 nucleotide sequence (Accession No. AB049823);
"ZmAHASL1" is a corn AHASL1 nucleotide sequence (Accession No.
X63554); "ZmAHASL2" is a corn AHASL2 nucleotide sequence (Accession
No. X63553); "OsAHASL2" is a rice AHASL2 nucleotide sequence
(Accession No. AL731599); "AtAHASL" is a Arabidopsis thaliana AHASL
nucleotide sequence (Accession No. AY124092).
[0028] FIG. 2 is an amino acid sequence alignment of the
herbicide-resistant rice AHASL1 protein of the present invention
(SEQ ID NO:2) with some known plant AHASL nucleotide sequences. The
Ala-to-Val substitution (relative to wild-type) at position 179 in
SEQ ID NO:2 is indicated by white type within a black box. The
initial methionine (M) is represented in bold-face type. The other
names used in the figure refer to the amino acid sequences encoded
by the nucleotide sequences indicated in the description of FIG. 1
above.
SEQUENCE LISTING
[0029] The nucleotide and amino acid sequences listed in the
accompanying sequence listing are shown using standard letter
abbreviations for nucleotide bases, and three-letter code for amino
acids. The nucleotide sequences follow the standard convention of
beginning at the 5' end of the sequence and proceeding forward
(i.e., from left to right in each line) to the 3' end. Only one
strand of each nucleic acid sequence is shown, but the
complementary strand is understood to be included by any reference
to the displayed strand. The amino acid sequences follow the
standard convention of beginning at the amino terminus of the
sequence and proceeding forward (i.e., from left to right in each
line) to the carboxyl terminus.
[0030] SEQ ID NO:1 sets forth the nucleotide sequence encoding an
imidazolinone-resistant AHASL1 protein from rice with the
Ala.sub.179-to-Val substitution. The coding region of SEQ ID NO:1
corresponds to nucleotides 7 to 1938.
[0031] SEQ ID NO:2 sets forth the amino acid sequence of an
imidazolinone-resistant AHASL1 protein from rice with the
Ala.sub.179-to-Val substitution that is encoded by the nucleotide
sequence set forth in SEQ ID NO:1.
[0032] SEQ ID NO:3 sets forth the nucleotide sequence of the coding
region of SEQ ID NO:1.
[0033] SEQ ID NOS:4-18 set forth the nucleotide sequences of
primers used for the PCR amplification and DNA sequencing of the
AHASL1 gene of the invention as described in Example 2 below (see,
Table 1).
DETAILED DESCRIPTION OF THE INVENTION
[0034] The present invention relates to rice plants having
increased resistance to herbicides when compared to a wild-type
rice plant. The herbicide resistant rice plants of the invention
were produced as described hereinbelow by exposing wild-type (with
respect to herbicide resistance) rice seeds to a mutagen, sowing
the seeds, allowing the plants to mature and reproduce, and
selecting progeny plants that displayed enhanced resistance to
imidazolinone herbicides, relative to the resistance of a wild-type
rice plant. The invention provides the herbicide resistant rice
line and plants thereof that are referred to herein IMINTA 16. Such
herbicide resistant rice plants find use in methods for controlling
weeds, particularly red rice and other weeds that are sensitive to
imidazolinone and sulfonylurea herbicides.
[0035] From the IMINTA 16 herbicide-resistant rice plants, the
coding region of an acetohydroxyacid synthase large subunit 1
(AHASL1) gene was isolated by polymerase chain reaction (PCR)
amplification and sequenced. By comparing the polynucleotide
sequences of the herbicide resistant rice plants of the invention
to a rice AHASL1 cDNA from a wild-type rice plant (GenBank
Accession No. AB049822), it was discovered that the coding region
of the AHASL1 polynucleotide sequence from IMINTA 16 differed from
the wild-type rice AHASL1 cDNA sequence by a single nucleotide. For
the AHASL1 polynucleotide sequence of IMINTA 16, there was a C-to-T
transition at nucleotide 542 (SEQ ID NO:1, FIG. 1). This C-to-T
transition in the AHASL1 polynucleotide sequence results in a
Ala-to-Val substitution at amino acid 179 in a conserved region of
the predicted amino acid sequence of the AHASL1 protein, relative
to the amino acid sequence of the wild-type AHASL1 protein (FIG.
2).
[0036] The invention further relates to isolated polynucleotide
molecules comprising nucleotide sequences that encode the
herbicide-resistant AHASL1 proteins of IMINTA 16 rice plants and to
such AHASL1 proteins. The invention discloses the isolation and
nucleotide sequence of polynucleotides encoding a
herbicide-resistant rice AHASL1 proteins from herbicide-resistant
rice plant that was produced by chemical mutagenesis of wild-type
rice plants. The herbicide-resistant AHASL1 proteins of the
invention comprise an alanine-to-valine substitution at position
179 in their respective amino acid sequences, when compared to the
corresponding wild-type AHASL1 amino acid sequence.
[0037] The present invention provides isolated polynucleotide
molecules that encode herbicide resistant AHASL1 proteins from rice
(Oryza sativa L.). Specifically, the invention provides isolated
polynucleotide molecules comprising: the nucleotide sequences set
forth in SEQ ID NOS: 1 and 3, nucleotide sequences encoding AHASL1
proteins comprising the amino acid sequence set forth in SEQ ID
NO:2, and fragments and variants of such nucleotide sequences that
encode functional AHASL1 proteins that comprise herbicide-resistant
AHAS activity.
[0038] The isolated herbicide-resistant AHASL1 polynucleotide
molecules of the invention comprise nucleotide sequences that
encode herbicide-resistant AHASL1 proteins. Such polynucleotide
molecules can be used in polynucleotide constructs for the
transformation of plants, particularly crop plants, to enhance the
resistance of the plants to herbicides, particularly herbicides
that are known to inhibit AHAS activity, more particularly
imidazolinone and sulfonylurea herbicides. Such polynucleotide
constructs can be used in expression cassettes, expression vectors,
transformation vectors, plasmids and the like. The transgenic
plants obtained following transformation with such polynucleotide
constructs show increased resistance to AHAS-inhibiting herbicides
such as, for example, imidazolinone and sulfonylurea
herbicides.
[0039] Compositions of the invention include polynucleotide
molecules comprising nucleotide sequences that encode AHASL1
proteins. In particular, the present invention provides for
isolated polynucleotide molecules comprising nucleotide sequences
encoding the amino acid sequence shown in SEQ ID NOS:2, and
fragments and variants thereof that encode polypeptides comprising
AHAS activity. Further provided are polypeptides having an amino
acid sequence encoded by a polynucleotide molecule described
herein, for example those set forth in SEQ ID NOS:1 and 3, and
fragments and variants thereof that encode polypeptides comprising
AHAS activity, particularly herbicide-resistant AHASL activity. The
polynucleotides molecules of the invention further encompass
nucleotide sequences that encode mature forms of the AHASL1
proteins described above. Such mature forms of AHASL1 proteins
comprise AHAS activity, particularly herbicide-resistant AHAS
activity, but lack the chloroplast transit peptide that is part of
full-length AHASL1 proteins.
[0040] The invention encompasses isolated or substantially purified
nucleic acid or protein compositions. An "isolated" or "purified"
polynucleotide molecule or protein, or biologically active portion
thereof, is substantially or essentially free from components that
normally accompany or interact with the polynucleotide molecule or
protein as found in its naturally occurring environment. Thus, an
isolated or purified polynucleotide molecule or protein is
substantially free of other cellular material, or culture medium
when produced by recombinant techniques, or substantially free of
chemical precursors or other chemicals when chemically synthesized.
Preferably, an "isolated" nucleic acid is free of sequences
(preferably protein encoding sequences) that naturally flank the
nucleic acid (i.e., sequences located at the 5' and 3' ends of the
nucleic acid) in the genomic DNA of the organism from which the
nucleic acid is derived. For example, in various embodiments, the
isolated polynucleotide molecule can contain less than about 5 kb,
4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequences
that naturally flank the polynucleotide molecule in genomic DNA of
the cell from which the nucleic acid is derived. A protein that is
substantially free of cellular material includes preparations of
protein having less than about 30%, 20%, 10%, 5%, or 1% (by dry
weight) of contaminating protein. When the protein of the invention
or biologically active portion thereof is recombinantly produced,
preferably culture medium represents less than about 30%, 20%, 10%,
5%, or 1% (by dry weight) of chemical precursors or
non-protein-of-interest chemicals.
[0041] The present invention provides isolated polypeptides
comprising AHASL1 proteins. The isolated polypeptides comprise an
amino acid sequence selected from the group consisting of the amino
acid sequence set forth in SEQ ID NO:2, the amino acid sequences
encoded by nucleotide sequences set forth in SEQ ID NOS:1 and 3,
and functional fragments and variants of said amino acid sequences
that encode an AHASL1 polypeptide comprising AHAS activity. By
"functional fragments and variants" is intended fragments and
variants of the exemplified polypeptides that comprise AHAS
activity.
[0042] Additionally provided are isolated polypeptides comprising
the mature forms of the AHASL1 proteins of the invention. Such
mature forms of AHASL1 proteins comprise AHAS activity,
particularly herbicide-resistant AHAS activity, but lack the
chloroplast transit peptide that is part of full-length AHASL1
proteins.
[0043] In certain embodiments of the invention, the methods involve
the use of herbicide-tolerant or herbicide-resistant plants. By an
"herbicide-tolerant" or "herbicide-resistant" plant, it is intended
that a plant that is tolerant or resistant to at least one
herbicide at a level that would normally kill, or inhibit the
growth of, a normal or wild-type plant. In one embodiment of the
invention, the herbicide-tolerant plants of the invention comprise
a herbicide-tolerant or herbicide-resistant AHASL1 protein. By
"herbicide-tolerant AHASL1 protein" or "herbicide-resistant AHASL1
protein", it is intended that such an AHASL1 protein displays
higher AHAS activity, relative to the AHAS activity of a wild-type
AHASL1 protein, when in the presence of at least one herbicide that
is known to interfere with AHAS activity and at a concentration or
level of the herbicide that is to known to inhibit the AHAS
activity of the wild-type AHASL1 protein. Furthermore, the AHAS
activity of such a herbicide-tolerant or herbicide-resistant AHASL1
protein may be referred to herein as "herbicide-tolerant" or
"herbicide-resistant" AHAS activity.
[0044] For the present invention, the terms "herbicide-tolerant"
and "herbicide-resistant" are used interchangeable and are intended
to have an equivalent meaning and an equivalent scope. Similarly,
the terms "herbicide-tolerance" and "herbicide-resistance" are used
interchangeable and are intended to have an equivalent meaning and
an equivalent scope. Likewise, the terms "imidazolinone-resistant"
and "imidazolinone-resistance" are used interchangeable and are
intended to be of an equivalent meaning and an equivalent scope as
the terms "imidazolinone-tolerant" and "imidazolinone-tolerance",
respectively.
[0045] The invention encompasses herbicide-resistant AHASL1
polynucleotides and herbicide-resistant AHASL1 proteins. By
"herbicide-resistant AHASL1 polynucleotide" is intended a
polynucleotide that encodes a protein comprising
herbicide-resistant AHAS activity. By "herbicide-resistant AHASL1
protein" is intended a protein or polypeptide that comprises
herbicide-resistant AHAS activity.
[0046] Further, it is recognized that a herbicide-tolerant or
herbicide-resistant AHASL1 protein can be introduced into a plant
by transforming a plant or ancestor thereof with a nucleotide
sequence encoding a herbicide-tolerant or herbicide-resistant
AHASL1 protein. Such herbicide-tolerant or herbicide-resistant
AHASL1 proteins are encoded by the herbicide-tolerant or
herbicide-resistant AHASL1 polynucleotides. Alternatively, a
herbicide-tolerant or herbicide-resistant AHASL1 protein may occur
in a plant as a result of a naturally occurring or induced mutation
in an endogenous AHASL1 gene in the genome of a plant or progenitor
thereof.
[0047] The present invention provides plants, plant tissues, plant
cells, and host cells with increased resistance or tolerance to at
least one herbicide, particularly an imidazolinone or sulfonylurea
herbicide. The preferred amount or concentration of the herbicide
is an "effective amount" or "effective concentration." By
"effective amount" and "effective concentration" is intended an
amount and concentration, respectively, that is sufficient to kill
or inhibit the growth of a similar, wild-type, plant, plant tissue,
plant cell, or host cell, but that said amount does not kill or
inhibit as severely the growth of the herbicide-resistant plants,
plant tissues, plant cells, and host cells of the present
invention. Typically, the effective amount of a herbicide is an
amount that is routinely used in agricultural production systems to
kill weeds of interest. Such an amount is known to those of
ordinary skill in the art.
[0048] By "similar, wild-type, plant, plant tissue, plant cell or
host cell" is intended a plant, plant tissue, plant cell, or host
cell, respectively, that lacks the herbicide-resistance
characteristics and/or particular polynucleotide of the invention
that are disclosed herein. The use of the term "wild-type" is not,
therefore, intended to imply that a plant, plant tissue, plant
cell, or other host cell lacks recombinant DNA in its genome,
and/or does not possess herbicide resistant characteristics that
are different from those disclosed herein.
[0049] As used herein unless clearly indicated otherwise, the term
"plant" intended to mean a plant any developmental stage, as well
as any part or parts of a plant that may be attached to or separate
from a whole intact plant. Such parts of a plant include, but are
not limited to, organs, tissues, and cells of a plant. Examples of
particular plant parts include a stem, a leaf, a root, an
inflorescence, a flower, a floret, a fruit, a pedicle, a peduncle,
a stamen, an anther, a stigma, a style, an ovary, a petal, a sepal,
a carpel, a root tip, a root cap, a root hair, a leaf hair, a seed
hair, a pollen grain, a microspore, a cotyledon, a hypocotyl, an
epicotyl, xylem, phloem, parenchyma, endosperm, a companion cell, a
guard cell, and any other known organs, tissues, and cells of a
plant. Furthermore, it is recognized that a seed is a plant.
[0050] The plants of the present invention include both
non-transgenic plants and transgenic plants. By "non-transgenic
plant" is intended mean a plant lacking recombinant DNA in its
genome. By "transgenic plant" is intended to mean a plant
comprising recombinant DNA in its genome. Such a transgenic plant
can be produced by introducing recombinant DNA into the genome of
the plant. When such recombinant DNA is incorporated into the
genome of the transgenic plant, progeny of the plant can also
comprise the recombinant DNA. A progeny plant that comprises at
least a portion of the recombinant DNA of at least one progenitor
transgenic plant is also a transgenic plant.
[0051] The present invention provides the herbicide-resistant rice
line and plants thereof known as IMINTA 16. A deposit of at least
250 seeds of IMINTA 16 was made to the patent depository of NCIMB
Ltd., Ferguson Building, Craibstone Estate Bucksburn, Aberdeen,
AB21 9YA, Scotland, UK on Jan. 5, 2005 and assigned NCIMB Accession
Number MCIMB 41262. Due to a shortage of seeds of the IMINTA 16
line at the time of filing, less than 2500 seeds of the IMINTA 16
line were submitted to NCIMB Ltd. prior to filing. Applicants will
supply additional seeds of IMINTA 16 line to reach a total of at
least 2500 seeds as the seeds become available. The deposits will
be maintained under the terms of the Budapest Treaty on the
International Recognition of the Deposit of Microorganisms for the
Purposes of Patent Procedure. The deposit of the seeds of IMINTA 16
was made for a term of at least 30 years and at least 5 years after
the most recent request for the furnishing of a sample of that
deposit is received by NCIMB Ltd. Additionally, Applicants have
satisfied all the requirements of 37 C.F.R.
.sctn..sctn.1.801-1.809, including providing an indication of the
viability of the sample. The deposit will irrevocably and without
restriction or condition be available to the public upon issuance
of a patent. However, it should be understood that the availability
of the deposit does not constitute a license to practice the
subject invention.
[0052] The present invention provides herbicide-resistant rice
plants of IMINTA 16 line that were produced by a mutation breeding.
Wild-type rice plants were mutagenized by exposing the plants to a
mutagen, particularly a chemical mutagen, more particularly sodium
azide. However, the present invention is not limited to
herbicide-resistant rice plants that are produced by a mutagensis
method involving the chemical mutagen sodium azide. Any mutagensis
method known in the art may be used to produce the
herbicide-resistant rice plants of the present invention. Such
mutagensis methods can involve, for example, the use of any one or
more of the following mutagens: radiation, such as X-rays, Gamma
rays (e.g., cobalt 60 or cesium 137), neutrons, (e.g., product of
nuclear fission by uranium 235 in an atomic reactor), Beta
radiation (e.g., emitted from radioisotopes such as phosphorus 32
or carbon 14), and ultraviolet radiation (preferably from 2500 to
2900 nm), and chemical mutagens such as base analogues (e.g.,
5-bromo-uracil), related compounds (e.g., 8-ethoxy caffeine),
antibiotics (e.g., streptonigrin), alkylating agents (e.g., sulfur
mustards, nitrogen mustards, epoxides, ethylenamines, sulfates,
sulfonates, sulfones, lactones), azide, hydroxylamine, nitrous
acid, ethyl methanesulfonate (EMS), or acridines.
Herbicide-resistant plants can also be produced by using tissue
culture methods to select for plant cells comprising
herbicide-resistance mutations and then regenerating
herbicide-resistant plants therefrom. See, for example, U.S. Pat.
Nos. 5,773,702 and 5,859,348, both of which are herein incorporated
in their entirety by reference. Further details of mutation
breeding can be found in "Principals of Cultivar Development" Fehr,
1993 Macmillan Publishing Company the disclosure of which is
incorporated herein by reference.
[0053] Analysis of the AHASL1 gene of the rice plants of IMINTA 16
line revealed a point mutation. In the AHASL1 gene from IMINTA 16,
the point mutation results in the substitution of a valine for the
alanine that is found at amino acid position 179 in the wild-type
AHASL1 amino acid sequence of GenBank Accession No. AB049822. Thus,
the present invention discloses that substituting another amino
acid for the alanine at position 179 of the rice AHAL1 protein can
cause a rice plant to have enhanced resistance to a herbicide,
particularly an imidazolinone and/or sulfonylurea herbicide. As
disclosed in Example 3 below, alanine 179 is found in a conserved
region of AHASL proteins and other amino acid substitutions for the
proline at 179 have been disclosed that are known to confer
herbicide resistance on a plant that comprises such an AHASL
protein. Accordingly, the herbicide-resistant rice plants of the
invention include, but are not limited to those rice plants which
comprise in their genomes at least one copy of an AHASL1
polynucleotide that encodes a herbicide-resistant AHASL1 protein
that comprises an aspartate or valine at amino acid position 179 or
equivalent position.
[0054] The rice plants of the invention additionally include plants
that comprise, relative to the wild-type AHASL1 protein, an
aspartate or valine at amino acid position 179 or equivalent
position and one or more additional amino acid substitutions in the
AHASL1 protein relative to the wild-type AHASL1 protein, wherein
such a rice plant has increased resistance to at least one
herbicide when compared to a wild-type rice plant. Such additional
amino acid substitutions include, but are not limited, to: a
threonine at amino acid position 96 or equivalent position; an
alanine, threonine, histidine, leucine, arginine, isoleucine,
glutamine, or serine at amino acid position 171 or equivalent
position; a leucine at amino acid position 548 or equivalent
position; and an asparagine, threonine, or phenylalanine at amino
acid position 627 or equivalent position.
[0055] The present invention provides AHASL1 proteins with amino
acid substitutions at particular amino acid positions within
conserved regions of the rice AHASL1 proteins disclosed herein.
Unless otherwise indicated herein, particular amino acid positions
refer to the position of that amino acid in the full-length rice
AHASL1 amino acid sequences set forth in SEQ ID NO:2. Furthermore,
those of ordinary skill will recognize that such amino acid
positions can vary depending on whether amino acids are added or
removed from, for example, the N-terminal end of an amino acid
sequence. Thus, the invention encompasses the amino substitutions
at the recited position or equivalent position (e.g., "amino acid
position 179 or equivalent position"). By "equivalent position" is
intended to mean a position that is within the same conserved
region as the exemplified amino acid position. Examples of such
conserved regions are provided in Table 2 below.
[0056] In addition, the present invention provides rice AHASL1
polypeptides comprising an aspartate or valine at amino acid
position 179 or equivalent position and one or more additional
amino acid substitutions in the AHASL1 protein, relative to the
wild-type AHASL1 protein, wherein AHASL1 polypetide comprises
herbicide tolerant AHAS activity, when compared to the AHAS
activity of a wild-type AHASL1. These amino acid substitutions
include, but are not limited, to those that are known to confer
resistance on a plant to at least one herbicide, particularly an
imidazolinone herbicide and/or a sulfonylurea herbicide. Such
additional amino acid substitutions include, but are not limited,
to: a threonine at amino acid position 96 or equivalent position;
an alanine, threonine, histidine, leucine, arginine, isoleucine,
glutamine, or serine at amino acid position 171 or equivalent
position; a leucine at amino acid position 548 or equivalent
position; and an asparagine, threonine, or phenylalanine at amino
acid position 627 or equivalent position. The invention further
provides isolated polynucleotides encoding such AHASL1
polypeptides, as well as expression cassettes, transformation
vectors, transformed host cells, transformed plants, and methods
comprising such polynucleotides.
[0057] The present invention provides methods for enhancing the
tolerance or resistance of a plant, plant tissue, plant cell, or
other host cell to at least one herbicide that interferes with the
activity of the AHAS enzyme. Preferably, such an AHAS-inhibiting
herbicide is an imidazolinone herbicide, a sulfonylurea herbicide,
a triazolopyrimidine herbicide, a pyrimidyloxybenzoate herbicide, a
sulfonylamino-carbonyltriazolinone, or mixture thereof. More
preferably, such a herbicide is an imidazolinone herbicide, a
sulfonylurea herbicide, or mixture thereof. For the present
invention, the imidazolinone herbicides include, but are not
limited to, PURSUIT.RTM. (imazethapyr), CADRE.RTM. (imazapic),
RAPTOR.RTM. (imazamox), SCEPTER.RTM. (imazaquin), ASSERT.RTM.
(imazethabenz), ARSENAL.RTM. (imazapyr), a derivative of any of the
aforementioned herbicides, and a mixture of two or more of the
aforementioned herbicides, for example, imazapyr/imazamox
(ODYSSEY.RTM.). More specifically, the imidazolinone herbicide can
be selected from, but is not limited to,
2-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-nicotinic acid,
2-(4-isopropyl)-4-methyl-5-oxo-2-imidazolin-2-yl)-3-quinolinecarboxylic
acid,
5-ethyl-2-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-nicotinic
acid,
2-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-5-(methoxymethyl)--
nicotinic acid,
2-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-5-methylnicotinic
acid, and a mixture of methyl
6-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-m-toluate and
methyl 2-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-p-toluate.
The use of
5-ethyl-2-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-nicotinic
acid and
2-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-5-(methoxymethyl)-ni-
cotinic acid is preferred. The use of
2-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-5-(methoxymethyl)-nicoti-
nic acid is particularly preferred.
[0058] For the present invention, the sulfonylurea herbicides
include, but are not limited to, chlorsulfuron, metsulfuron methyl,
sulfometuron methyl, chlorimuron ethyl, thifensulfuron methyl,
tribenuron methyl, bensulfuron methyl, nicosulfuron,
ethametsulfuron methyl, rimsulfuron, triflusulfuron methyl,
triasulfuron, primisulfuron methyl, cinosulfuron, amidosulfuron,
flazasulfuron, imazosulfuron, pyrazosulfuron ethyl, halosulfuron, a
derivative of any of the aforementioned herbicides, and a mixture
of two or more of the aforementioned herbicides. The
triazolopyrimidine herbicides of the invention include, but are not
limited to, cloransulam, diclosulam, florasulam, flumetsulam,
metosulam, and penoxsulam. The pyrimidinyloxybenzoate herbicides of
the invention include, but are not limited to, bispyribac,
pyrithiobac, pyriminobac, pyribenzoxim and pyriftalid. The
sulfonylamino-carbonyltriazolinone herbicides include, but are not
limited to, flucarbazone and propoxycarbazone.
[0059] It is recognized that pyrimidinyloxybenzoate herbicides are
closely related to the pyrimidinylthiobenzoate herbicides and are
generalized under the heading of the latter name by the Weed
Science Society of America. Accordingly, the herbicides of the
present invention further include pyrimidinylthiobenzoate
herbicides, including, but not limited to, the
pyrimidinyloxybenzoate herbicides described above.
[0060] The present invention provides methods for enhancing AHAS
activity in a plant comprising transforming a plant with a
polynucleotide construct comprising a promoter operably linked to
an AHASL1 nucleotide sequence of the invention. The methods involve
introducing a polynucleotide construct of the invention into at
least one plant cell and regenerating a transformed plant
therefrom. The methods involve the use of a promoter that is
capable of driving gene expression in a plant cell. Preferably,
such a promoter is a constitutive promoter or a tissue-preferred
promoter. The methods find use in enhancing or increasing the
resistance of a plant to at least one herbicide that interferes
with the catalytic activity of the AHAS enzyme, particularly an
imidazolinone or sulfonylurea herbicide.
[0061] The present invention provides expression cassettes for
expressing the polynucleotides of the invention in plants, plant
tissues, plant cells, and other host cells. The expression
cassettes comprise a promoter expressible in the plant, plant
tissue, plant cell, or other host cells of interest operably linked
to a polynucleotide of the invention that comprises a nucleotide
sequence encoding either a full-length (i.e. including the
chloroplast transit peptide) or mature AHASL1 protein (i.e. without
the chloroplast transit peptide). If expression is desired in the
plastids or chloroplasts of plants or plant cells, the expression
cassette may also comprise an operably linked chloroplast-targeting
sequence that encodes a chloroplast transit peptide.
[0062] The expression cassettes of the invention find use in a
method for enhancing the herbicide tolerance of a plant or a host
cell. The method involves transforming the plant or host cell with
an expression cassette of the invention, wherein the expression
cassette comprises a promoter that is expressible in the plant or
host cell of interest and the promoter is operably linked to a
polynucleotide of the invention that comprises a nucleotide
sequence encoding an imidazolinone-resistant AHASL1 protein of the
invention.
[0063] The use of the term "polynucleotide constructs" herein is
not intended to limit the present invention to polynucleotide
constructs comprising DNA. Those of ordinary skill in the art will
recognize that polynucleotide constructs, particularly
polynucleotides and oligonucleotides, comprised of ribonucleotides
and combinations of ribonucleotides and deoxyribonucleotides may
also be employed in the methods disclosed herein. Thus, the
polynucleotide constructs of the present invention encompass all
polynucleotide constructs that can be employed in the methods of
the present invention for transforming plants including, but not
limited to, those comprised of deoxyribonucleotides,
ribonucleotides, and combinations thereof. Such
deoxyribonucleotides and ribonucleotides include both naturally
occurring molecules and synthetic analogues. The polynucleotide
constructs of the invention also encompass all forms of
polynucleotide constructs including, but not limited to,
single-stranded forms, double-stranded forms, hairpins,
stem-and-loop structures, and the like. Furthermore, it is
understood by those of ordinary skill the art that each nucleotide
sequences disclosed herein also encompasses the complement of that
exemplified nucleotide sequence.
[0064] Furthermore, it is recognized that the methods of the
invention may employ a polynucleotide construct that is capable of
directing, in a transformed plant, the expression of at least one
protein, or at least one RNA, such as, for example, an antisense
RNA that is complementary to at least a portion of an mRNA.
Typically such a polynucleotide construct is comprised of a coding
sequence for a protein or RNA operably linked to 5' and 3'
transcriptional regulatory regions. Alternatively, it is also
recognized that the methods of the invention may employ a
polynucleotide construct that is not capable of directing, in a
transformed plant, the expression of a protein or RNA.
[0065] Further, it is recognized that, for expression of a
polynucleotides of the invention in a host cell of interest, the
polynucleotide is typically operably linked to a promoter that is
capable of driving gene expression in the host cell of interest.
The methods of the invention for expressing the polynucleotides in
host cells do not depend on particular promoter. The methods
encompass the use of any promoter that is known in the art and that
is capable of driving gene expression in the host cell of
interest.
[0066] The present invention encompasses AHASL1 polynucleotide
molecules and fragments and variants thereof. Polynucleotide
molecules that are fragments of these nucleotide sequences are also
encompassed by the present invention. By "fragment" is intended a
portion of the nucleotide sequence encoding an AHASL1 protein of
the invention. A fragment of an AHASL1 nucleotide sequence of the
invention may encode a biologically active portion of an AHASL1
protein, or it may be a fragment that can be used as a
hybridization probe or PCR primer using methods disclosed below. A
biologically active portion of an AHASL1 protein can be prepared by
isolating a portion of one of the AHASL1 nucleotide sequences of
the invention, expressing the encoded portion of the AHASL1 protein
(e.g., by recombinant expression in vitro), and assessing the
activity of the encoded portion of the AHASL1 protein.
Polynucleotide molecules that are fragments of an AHASL1 nucleotide
sequence comprise at least about 15, 20, 50, 75, 100, 200, 300,
350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950,
1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1500, 1600,
1700, 1800, 1900, or 1950 nucleotides, or up to the number of
nucleotides present in a full-length nucleotide sequence disclosed
herein (for example, 1961 and 1932 nucleotides for SEQ ID NOS:1 and
3, respectively) depending upon the intended use.
[0067] A fragment of an AHASL1 nucleotide sequence that encodes a
biologically active portion of an AHASL1 protein of the invention
will encode at least about 15, 25, 30, 50, 75, 100, 125, 150, 175,
200, 250, 300, 350, 400, 450, 500, 550, 600, or 625 contiguous
amino acids, or up to the total number of amino acids present in a
full-length AHASL1 protein of the invention (for example, 644 amino
acids for SEQ ID NO: 2). Fragments of an AHASL1 nucleotide sequence
that are useful as hybridization probes for PCR primers generally
need not encode a biologically active portion of an AHASL1
protein.
[0068] Polynucleotide molecules that are variants of the nucleotide
sequences disclosed herein are also encompassed by the present
invention. "Variants" of the AHASL1 nucleotide sequences of the
invention include those sequences that encode the AHASL1 proteins
disclosed herein but that differ conservatively because of the
degeneracy of the genetic code. These naturally occurring allelic
variants can be identified with the use of well-known molecular
biology techniques, such as polymerase chain reaction (PCR) and
hybridization techniques as outlined below. Variant nucleotide
sequences also include synthetically derived nucleotide sequences
that have been generated, for example, by using site-directed
mutagenesis but which still encode the AHASL1 protein disclosed in
the present invention as discussed below. Generally, nucleotide
sequence variants of the invention will have at least about 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to a
particular nucleotide sequence disclosed herein. A variant AHASL1
nucleotide sequence will encode an AHASL1 protein, respectively,
that has an amino acid sequence having at least about 90%, 91%,
92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the amino
acid sequence of an AHASL1 protein disclosed herein.
[0069] In addition, the skilled artisan will further appreciate
that changes can be introduced by mutation into the nucleotide
sequences of the invention thereby leading to changes in the amino
acid sequence of the encoded AHASL1 proteins without altering the
biological activity of the AHASL1 proteins. Thus, an isolated
polynucleotide molecule encoding an AHASL1 protein having a
sequence that differs from that of SEQ ID NOS: 1 or 3,
respectively, can be created by introducing one or more nucleotide
substitutions, additions, or deletions into the corresponding
nucleotide sequence disclosed herein, such that one or more amino
acid substitutions, additions or deletions are introduced into the
encoded protein. Mutations can be introduced by standard
techniques, such as site-directed mutagenesis and PCR-mediated
mutagenesis. Such variant nucleotide sequences are also encompassed
by the present invention.
[0070] For example, preferably, conservative amino acid
substitutions may be made at one or more predicted, preferably
nonessential amino acid residues. A "nonessential" amino acid
residue is a residue that can be altered from the wild-type
sequence of an AHASL1 protein (e.g., the sequence of SEQ ID NO: 2)
without altering the biological activity, whereas an "essential"
amino acid residue is required for biological activity. A
"conservative amino acid substitution" is one in which the amino
acid residue is replaced with an amino acid residue having a
similar side chain. Families of amino acid residues having similar
side chains have been defined in the art. These families include
amino acids with basic side chains (e.g., lysine, arginine,
histidine), acidic side chains (e.g., aspartic acid, glutamic
acid), uncharged polar side chains (e.g., glycine, asparagine,
glutamine, serine, threonine, tyrosine, cysteine), nonpolar side
chains (e.g., alanine, valine, leucine, isoleucine, proline,
phenylalanine, methionine, tryptophan), beta-branched side chains
(e.g., threonine, valine, isoleucine) and aromatic side chains
(e.g., tyrosine, phenylalanine, tryptophan, histidine). Such
substitutions would not be made for conserved amino acid residues,
or for amino acid residues residing within a conserved motif.
[0071] The proteins of the invention may be altered in various ways
including amino acid substitutions, deletions, truncations, and
insertions. Methods for such manipulations are generally known in
the art. For example, amino acid sequence variants of the AHASL1
proteins can be prepared by mutations in the DNA. Methods for
mutagenesis and nucleotide sequence alterations are well known in
the art. See, for example, Kunkel (1985) Proc. Natl. Acad. Sci. USA
82:488-492; Kunkel et al. (1987) Methods in Enzymol. 154:367-382;
U.S. Pat. No. 4,873,192; Walker and Gaastra, eds. (1983) Techniques
in Molecular Biology (MacMillan Publishing Company, New York) and
the references cited therein. Guidance as to appropriate amino acid
substitutions that do not affect biological activity of the protein
of interest may be found in the model of Dayhoff et al. (1978)
Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found.,
Washington, D.C.), herein incorporated by reference. Conservative
substitutions, such as exchanging one amino acid with another
having similar properties, may be preferable.
[0072] Alternatively, variant AHASL1 nucleotide sequences can be
made by introducing mutations randomly along all or part of an
AHASL1 coding sequence, such as by saturation mutagenesis, and the
resultant mutants can be screened for AHAS activity to identify
mutants that retain AHAS activity, including herbicide-resistant
AHAS activity. Following mutagenesis, the encoded protein can be
expressed recombinantly, and the activity of the protein can be
determined using standard assay techniques.
[0073] Thus, the nucleotide sequences of the invention include the
sequences disclosed herein as well as fragments and variants
thereof. The AHASL1 nucleotide sequences of the invention, and
fragments and variants thereof, can be used as probes and/or
primers to identify and/or clone AHASL homologues in other plants.
Such probes can be used to detect transcripts or genomic sequences
encoding the same or identical proteins.
[0074] In this manner, methods such as PCR, hybridization, and the
like can be used to identify such sequences having substantial
identity to the sequences of the invention. See, for example,
Sambrook et al. (1989) Molecular Cloning: Laboratory Manual (2d
ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.) and
Innis, et al. (1990) PCR Protocols: A Guide to Methods and
Applications (Academic Press, NY). AHASL nucleotide sequences
isolated based on their sequence identity to the AHASL1 nucleotide
sequences set forth herein or to fragments and variants thereof are
encompassed by the present invention.
[0075] In a hybridization method, all or part of a known AHASL1
nucleotide sequence can be used to screen cDNA or genomic
libraries. Methods for construction of such cDNA and genomic
libraries are generally known in the art and are disclosed in
Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d
ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.). The
so-called hybridization probes may be genomic DNA fragments, cDNA
fragments, RNA fragments, or other oligonucleotides, and may be
labeled with a detectable group such as .sup.32P, or any other
detectable marker, such as other radioisotopes, a fluorescent
compound, an enzyme, or an enzyme co-factor. Probes for
hybridization can be made by labeling synthetic oligonucleotides
based on the known AHASL1 nucleotide sequence disclosed herein.
Degenerate primers designed on the basis of conserved nucleotides
or amino acid residues in a known AHASL1 nucleotide sequence or
encoded amino acid sequence can additionally be used. The probe
typically comprises a region of nucleotide sequence that hybridizes
under stringent conditions to at least about 12, preferably about
25, more preferably about 50, 75, 100, 125, 150, 175, 200, 250,
300, 350, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, or
1800 consecutive nucleotides of an AHASL1 nucleotide sequence of
the invention or a fragment or variant thereof. Preparation of
probes for hybridization is generally known in the art and is
disclosed in Sambrook et al. (1989) Molecular Cloning: A Laboratory
Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview,
N.Y.), herein incorporated by reference.
[0076] For example, the entire AHASL1 sequence disclosed herein, or
one or more portions thereof, may be used as a probe capable of
specifically hybridizing to corresponding AHASL1 sequences and
messenger RNAs. Hybridization techniques include hybridization
screening of plated DNA libraries (either plaques or colonies; see,
for example, Sambrook et al. (1989) Molecular Cloning: A Laboratory
Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview,
N.Y.).
[0077] Hybridization of such sequences may be carried out under
stringent conditions. By "stringent conditions" or "stringent
hybridization conditions" is intended conditions under which a
probe will hybridize to its target sequence to a detectably greater
degree than to other sequences (e.g., at least 2-fold over
background). Stringent conditions are sequence-dependent and will
be different in different circumstances.
[0078] Typically, stringent conditions will be those in which the
salt concentration is less than about 1.5 M Na ion, typically about
0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to
8.3 and the temperature is at least about 30.degree. C. for short
probes (e.g., 10 to 50 nucleotides) and at least about 60.degree.
C. for long probes (e.g., greater than 50 nucleotides). Stringent
conditions may also be achieved with the addition of destabilizing
agents such as formamide. Exemplary low stringency conditions
include hybridization with a buffer solution of 30 to 35%
formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37.degree.
C., and a wash in 1.times. to 2.times.SSC (20.times.SSC=3.0 M
NaCl/0.3 M trisodium citrate) at 50 to 55.degree. C. Exemplary
moderate stringency conditions include hybridization in 40 to 45%
formamide, 1.0 M NaCl, 1% SDS at 37.degree. C., and a wash in
0.5.times. to 1.times.SSC at 55 to 60.degree. C. Exemplary high
stringency conditions include hybridization in 50% formamide, 1 M
NaCl, 1% SDS at 37.degree. C., and a wash in 0.1.times.SSC at 60 to
65.degree. C. Optionally, wash buffers may comprise about 0.1% to
about 1% SDS. The duration of hybridization is generally less than
about 24 hours, usually about 4 to about 12 hours.
[0079] Specificity is typically the function of post-hybridization
washes, the critical factors being the ionic strength and
temperature of the final wash solution. For DNA-DNA hybrids, the
T.sub.m can be approximated from the equation of Meinkoth and Wahl
(1984) Anal. Biochem. 138:267-284: T.sub.m=81.5.degree. C.+16.6
(log M)+0.41 (% GC)-0.61 (% form)-500/L; where M is the molarity of
monovalent cations, % GC is the percentage of guanosine and
cytosine nucleotides in the DNA, % form is the percentage of
formamide in the hybridization solution, and L is the length of the
hybrid in base pairs. The T.sub.m is the temperature (under defined
ionic strength and pH) at which 50% of a complementary target
sequence hybridizes to a perfectly matched probe. T.sub.m is
reduced by about 1.degree. C. for each 1% of mismatching; thus,
T.sub.m, hybridization, and/or wash conditions can be adjusted to
hybridize to sequences of the desired identity. For example, if
sequences with >90% identity are sought, the T.sub.m can be
decreased 10.degree. C. Generally, stringent conditions are
selected to be about 5.degree. C. lower than the thermal melting
point (T.sub.m) for the specific sequence and its complement at a
defined ionic strength and pH. However, severely stringent
conditions can utilize a hybridization and/or wash at 1, 2, 3, or
4.degree. C. lower than the thermal melting point (T.sub.m);
moderately stringent conditions can utilize a hybridization and/or
wash at 6, 7, 8, 9, or 10.degree. C. lower than the thermal melting
point (T.sub.m); low stringency conditions can utilize a
hybridization and/or wash at 11, 12, 13, 14, 15, or 20.degree. C.
lower than the thermal melting point (T.sub.m). Using the equation,
hybridization and wash compositions, and desired T.sub.m, those of
ordinary skill will understand that variations in the stringency of
hybridization and/or wash solutions are inherently described. If
the desired degree of mismatching results in a T.sub.m of less than
45.degree. C. (aqueous solution) or 32.degree. C. (formamide
solution), it is preferred to increase the SSC concentration so
that a higher temperature can be used. An extensive guide to the
hybridization of nucleic acids is found in Tijssen (1993)
Laboratory Techniques in Biochemistry and Molecular
Biology--Hybridization with Nucleic Acid Probes, Part I, Chapter 2
(Elsevier, N.Y.); and Ausubel et al., eds. (1995) Current Protocols
in Molecular Biology, Chapter 2 (Greene Publishing and
Wiley-Interscience, New York). See Sambrook et al. (1989) Molecular
Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory
Press, Plainview, N.Y.).
[0080] It is recognized that the polynucleotide molecules and
proteins of the invention encompass polynucleotide molecules and
proteins comprising a nucleotide or an amino acid sequence that is
sufficiently identical to the nucleotide sequence of SEQ ID NOS:1,
3, 4, and/or 6, or to the amino acid sequence of SEQ ID NOS:2
and/or 5. The term "sufficiently identical" is used herein to refer
to a first amino acid or nucleotide sequence that contains a
sufficient or minimum number of identical or equivalent (e.g., with
a similar side chain) amino acid residues or nucleotides to a
second amino acid or nucleotide sequence such that the first and
second amino acid or nucleotide sequences have a common structural
domain and/or common functional activity. For example, amino acid
or nucleotide sequences that contain a common structural domain
having at least about 45%, 55%, or 65% identity, preferably 75%
identity, more preferably 85%, 95%, or 98% identity are defined
herein as sufficiently identical.
[0081] To determine the percent identity of two amino acid
sequences or of two nucleic acids, the sequences are aligned for
optimal comparison purposes. The percent identity between the two
sequences is a function of the number of identical positions shared
by the sequences (i.e., percent identity=number of identical
positions/total number of positions (e.g., overlapping
positions).times.100). In one embodiment, the two sequences are the
same length. The percent identity between two sequences can be
determined using techniques similar to those described below, with
or without allowing gaps. In calculating percent identity,
typically exact matches are counted.
[0082] The determination of percent identity between two sequences
can be accomplished using a mathematical algorithm. A preferred,
nonlimiting example of a mathematical algorithm utilized for the
comparison of two sequences is the algorithm of Karlin and Altschul
(1990) Proc. Natl. Acad. Sci. USA 87:2264, modified as in Karlin
and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877. Such
an algorithm is incorporated into the NBLAST and XBLAST programs of
Altschul et al. (1990) J. Mol. Biol. 215:403. BLAST nucleotide
searches can be performed with the NBLAST program, score=100,
wordlength=12, to obtain nucleotide sequences homologous to the
polynucleotide molecules of the invention. BLAST protein searches
can be performed with the XBLAST program, score=50, wordlength=3,
to obtain amino acid sequences homologous to protein molecules of
the invention. To obtain gapped alignments for comparison purposes,
Gapped BLAST can be utilized as described in Altschul et al. (1997)
Nucleic Acids Res. 25:3389. Alternatively, PSI-Blast can be used to
perform an iterated search that detects distant relationships
between molecules. See Altschul et al. (1997) supra. When utilizing
BLAST, Gapped BLAST, and PSI-Blast programs, the default parameters
of the respective programs (e.g., XBLAST and NBLAST) can be used.
See web site www.ncbi.nlm.nih.gov. Another preferred, non-limiting
example of a mathematical algorithm utilized for the comparison of
sequences is the algorithm of Myers and Miller (1988) CABIOS
4:11-17. Such an algorithm is incorporated into the ALIGN program
(version 2.0), which is part of the GCG sequence alignment software
package. When utilizing the ALIGN program for comparing amino acid
sequences, a PAM120 weight residue table, a gap length penalty of
12, and a gap penalty of 4 can be used. Alignment may also be
performed manually by inspection.
[0083] Unless otherwise stated, sequence identity/similarity values
provided herein refer to the value obtained using the full-length
sequences of the invention and using multiple alignment by mean of
the algorithm Clustal W (Nucleic Acid Research, 22(22):4673-4680,
1994) using the program AlignX included in the software package
Vector NTI Suite Version 7 (InforMax, Inc., Bethesda, Md., USA)
using the default parameters; or any equivalent program thereof. By
"equivalent program" is intended any sequence comparison program
that, for any two sequences in question, generates an alignment
having identical nucleotide or amino acid residue matches and an
identical percent sequence identity when compared to the
corresponding alignment generated by AlignX in the software package
Vector NTI Suite Version 7.
[0084] The AHASL1 nucleotide sequences of the invention include
both the naturally occurring sequences as well as mutant forms,
particularly mutant forms that encode AHASL1 proteins comprising
herbicide-resistant AHAS activity. Likewise, the proteins of the
invention encompass both naturally occurring proteins as well as
variations and modified forms thereof. Such variants will continue
to possess the desired AHAS activity. Obviously, the mutations that
will be made in the DNA encoding the variant must not place the
sequence out of reading frame and preferably will not create
complementary regions that could produce secondary mRNA structure.
See, EP Patent Application Publication No. 75,444.
[0085] The deletions, insertions, and substitutions of the protein
sequences encompassed herein are not expected to produce radical
changes in the characteristics of the protein. However, when it is
difficult to predict the exact effect of the substitution,
deletion, or insertion in advance of doing so, one skilled in the
art will appreciate that the effect will be evaluated by routine
screening assays. That is, the activity can be evaluated by AHAS
activity assays. See, for example, Singh et al. (1988) Anal.
Biochem. 171:173-179, herein incorporated by reference.
[0086] Variant nucleotide sequences and proteins also encompass
sequences and proteins derived from a mutagenic and recombinogenic
procedure such as DNA shuffling. With such a procedure, one or more
different AHASL coding sequences can be manipulated to create a new
AHASL protein possessing the desired properties. In this manner,
libraries of recombinant polynucleotides are generated from a
population of related sequence polynucleotides comprising sequence
regions that have substantial sequence identity and can be
homologously recombined in vitro or in vivo. For example, using
this approach, sequence motifs encoding a domain of interest may be
shuffled between the AHASL1 gene of the invention and other known
AHASL genes to obtain a new gene coding for a protein with an
improved property of interest, such as an increased K.sub.m in the
case of an enzyme. Strategies for such DNA shuffling are known in
the art. See, for example, Stemmer (1994) Proc. Natl. Acad. Sci.
USA 91:10747-10751; Stemmer (1994) Nature 370:389-391; Crameri et
al. (1997) Nature Biotech. 15:436-438; Moore et al. (1997) J. Mol.
Biol. 272:336-347; Zhang et al. (1997) Proc. Natl. Acad. Sci. USA
94:4504-4509; Crameri et al. (1998) Nature 391:288-291; and U.S.
Pat. Nos. 5,605,793 and 5,837,458.
[0087] The nucleotide sequences of the invention can be used to
isolate corresponding sequences from other organisms, particularly
other plants, more particularly other dicots. In this manner,
methods such as PCR, hybridization, and the like can be used to
identify such sequences based on their sequence homology to the
sequences set forth herein. Sequences isolated based on their
sequence identity to the entire AHASL1 sequences set forth herein
or to fragments thereof are encompassed by the present invention.
Thus, isolated sequences that encode for an AHASL protein and which
hybridize under stringent conditions to the sequence disclosed
herein, or to fragments thereof, are encompassed by the present
invention.
[0088] In a PCR approach, oligonucleotide primers can be designed
for use in PCR reactions to amplify corresponding DNA sequences
from cDNA or genomic DNA extracted from any plant of interest.
Methods for designing PCR primers and PCR cloning are generally
known in the art and are disclosed in Sambrook et al. (1989)
Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor
Laboratory Press, Plainview, N.Y.). See also Innis et al., eds.
(1990) PCR Protocols: A Guide to Methods and Applications (Academic
Press, New York); Innis and Gelfand, eds. (1995) PCR Strategies
(Academic Press, New York); and Innis and Gelfand, eds. (1999) PCR
Methods Manual (Academic Press, New York). Known methods of PCR
include, but are not limited to, methods using paired primers,
nested primers, single specific primers, degenerate primers,
gene-specific primers, vector-specific primers,
partially-mismatched primers, and the like.
[0089] The AHASL1 polynucleotide sequences of the invention are
provided in expression cassettes for expression in the plant of
interest. The cassette will include 5' and 3' regulatory sequences
operably linked to an AHASL1 polynucleotide sequence of the
invention. By "operably linked" is intended a functional linkage
between a promoter and a second sequence, wherein the promoter
sequence initiates and mediates transcription of the DNA sequence
corresponding to the second sequence. Generally, operably linked
means that the nucleic acid sequences being linked are contiguous
and, where necessary to join two protein coding regions, contiguous
and in the same reading frame. The cassette may additionally
contain at least one additional gene to be cotransformed into the
organism. Alternatively, the additional gene(s) can be provided on
multiple expression cassettes.
[0090] Such an expression cassette is provided with a plurality of
restriction sites for insertion of the AHASL1 polynucleotide
sequence to be under the transcriptional regulation of the
regulatory regions. The expression cassette may additionally
contain selectable marker genes.
[0091] The expression cassette will include in the 5'-3' direction
of transcription, a transcriptional and translational initiation
region (i.e., a promoter), an AHASL1 polynucleotide sequence of the
invention, and a transcriptional and translational termination
region (i.e., termination region) functional in plants. The
promoter may be native or analogous, or foreign or heterologous, to
the plant host and/or to the AHASL1 polynucleotide sequence of the
invention. Additionally, the promoter may be the natural sequence
or alternatively a synthetic sequence. Where the promoter is
"foreign" or "heterologous" to the plant host, it is intended that
the promoter is not found in the native plant into which the
promoter is introduced. Where the promoter is "foreign" or
"heterologous" to the AHASL1 polynucleotide sequence of the
invention, it is intended that the promoter is not the native or
naturally occurring promoter for the operably linked AHASL1
polynucleotide sequence of the invention. As used herein, a
chimeric gene comprises a coding sequence operably linked to a
transcription initiation region that is heterologous to the coding
sequence.
[0092] While it may be preferable to express the AHASL1
polynucleotides of the invention using heterologous promoters, the
native promoter sequences may be used. Such constructs would change
expression levels of the AHASL1 protein in the plant or plant cell.
Thus, the phenotype of the plant or plant cell is altered.
[0093] The termination region may be native with the
transcriptional initiation region, may be native with the operably
linked AHASL1 sequence of interest, may be native with the plant
host, or may be derived from another source (i.e., foreign or
heterologous to the promoter, the AHASL1 polynucleotide sequence of
interest, the plant host, or any combination thereof). Convenient
termination regions are available from the Ti-plasmid of A.
tumefaciens, such as the octopine synthase and nopaline synthase
termination regions. See also Guerineau et al. (1991) Mol. Gen.
Genet. 262:141-144; Proudfoot (1991) Cell 64:671-674; Sanfacon et
al. (1991) Genes Dev. 5:141-149; Mogen et al. (1990) Plant Cell
2:1261-1272; Munroe et al. (1990) Gene 91:151-158; Ballas et al.
(1989) Nucleic Acids Res. 17:7891-7903; and Joshi et al. (1987)
Nucleic Acid Res. 15:9627-9639.
[0094] Where appropriate, the gene(s) may be optimized for
increased expression in the transformed plant. That is, the genes
can be synthesized using plant-preferred codons for improved
expression. See, for example, Campbell and Gowri (1990) Plant
Physiol. 92:1-11 for a discussion of host-preferred codon usage.
Methods are available in the art for synthesizing plant-preferred
genes. See, for example, U.S. Pat. Nos. 5,380,831, and 5,436,391,
and Murray et al. (1989) Nucleic Acids Res. 17:477-498, herein
incorporated by reference.
[0095] Additional sequence modifications are known to enhance gene
expression in a cellular host. These include elimination of
sequences encoding spurious polyadenylation signals, exon-intron
splice site signals, transposon-like repeats, and other such
well-characterized sequences that may be deleterious to gene
expression. The G-C content of the sequence may be adjusted to
levels average for a given cellular host, as calculated by
reference to known genes expressed in the host cell. When possible,
the sequence is modified to avoid predicted hairpin secondary mRNA
structures.
[0096] Nucleotide sequences for enhancing gene expression can also
be used in the plant expression vectors. These include the introns
of the maize AdhI, intronl gene (Callis et al. Genes and
Development 1:1183-1200, 1987), and leader sequences, (W-sequence)
from the Tobacco Mosaic virus (TMV), Maize Chlorotic Mottle Virus
and Alfalfa Mosaic Virus (Gallie et al. Nucleic Acid Res.
15:8693-8711, 1987 and Skuzeski et al. Plant Mol. Biol. 15:65-79,
1990). The first intron from the shrunken-1 locus of maize, has
been shown to increase expression of genes in chimeric gene
constructs. U.S. Pat. Nos. 5,424,412 and 5,593,874 disclose the use
of specific introns in gene expression constructs, and Gallie et
al. (Plant Physiol. 106:929-939, 1994) also have shown that introns
are useful for regulating gene expression on a tissue specific
basis. To further enhance or to optimize AHAS small subunit gene
expression, the plant expression vectors of the invention may also
contain DNA sequences containing matrix attachment regions (MARs).
Plant cells transformed with such modified expression systems,
then, may exhibit overexpression or constitutive expression of a
nucleotide sequence of the invention.
[0097] The expression cassettes may additionally contain 5' leader
sequences in the expression cassette construct. Such leader
sequences can act to enhance translation. Translation leaders are
known in the art and include: picornavirus leaders, for example,
EMCV leader (Encephalomyocarditis 5' noncoding region) (Elroy-Stein
et al. (1989) Proc. Natl. Acad. Sci. USA 86:6126-6130); potyvirus
leaders, for example, TEV leader (Tobacco Etch Virus) (Gallie et
al. (1995) Gene 165(2):233-238), MDMV leader (Maize Dwarf Mosaic
Virus) (Virology 154:9-20), and human immunoglobulin heavy-chain
binding protein (BiP) (Macejak et al. (1991) Nature 353:90-94);
untranslated leader from the coat protein mRNA of alfalfa mosaic
virus (AMV RNA 4) (Jobling et al. (1987) Nature 325:622-625);
tobacco mosaic virus leader (TMV) (Gallie et al. (1989) in
Molecular Biology of RNA, ed. Cech (Liss, New York), pp. 237-256);
and maize chlorotic mottle virus leader (MCMV) (Lommel et al.
(1991) Virology 81:382-385). See also, Della-Cioppa et al. (1987)
Plant Physiol. 84:965-968. Other methods known to enhance
translation can also be utilized, for example, introns, and the
like.
[0098] In preparing the expression cassette, the various DNA
fragments may be manipulated, so as to provide for the DNA
sequences in the proper orientation and, as appropriate, in the
proper reading frame. Toward this end, adapters or linkers may be
employed to join the DNA fragments or other manipulations may be
involved to provide for convenient restriction sites, removal of
superfluous DNA, removal of restriction sites, or the like. For
this purpose, in vitro mutagenesis, primer repair, restriction,
annealing, resubstitutions, e.g., transitions and transversions,
may be involved.
[0099] A number of promoters can be used in the practice of the
invention. The promoters can be selected based on the desired
outcome. The nucleic acids can be combined with constitutive,
tissue-preferred, or other promoters for expression in plants.
[0100] Such constitutive promoters include, for example, the core
promoter of the Rsyn7 promoter and other constitutive promoters
disclosed in WO 99/43838 and U.S. Pat. No. 6,072,050; the core CaMV
35S promoter (Odell et al. (1985) Nature 313:810-812); rice actin
(McElroy et al. (1990) Plant Cell 2:163-171); ubiquitin
(Christensen et al. (1989) Plant Mol. Biol. 12:619-632 and
Christensen et al. (1992) Plant Mol. Biol. 18:675-689); pEMU (Last
et al. (1991) Theor. Appl. Genet. 81:581-588); MAS (Velten et al.
(1984) EMBO J. 3:2723-2730); ALS promoter (U.S. Pat. No.
5,659,026), and the like. Other constitutive promoters include, for
example, U.S. Pat. Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597;
5,466,785; 5,399,680; 5,268,463; 5,608,142; and 6,177,611.
[0101] Tissue-preferred promoters can be utilized to target
enhanced AHASL1 expression within a particular plant tissue. Such
tissue-preferred promoters include, but are not limited to,
leaf-preferred promoters, root-preferred promoters, seed-preferred
promoters, and stem-preferred promoters. Tissue-preferred promoters
include Yamamoto et al. (1997) Plant J. 12(2):255-265; Kawamata et
al. (1997) Plant Cell Physiol. 38(7):792-803; Hansen et al. (1997)
Mol. Gen. Genet. 254(3):337-343; Russell et al. (1997) Transgenic
Res. 6(2):157-168; Rinehart et al. (1996) Plant Physiol. 112(3):
1331-1341; Van Camp et al. (1996) Plant Physiol. 112(2):525-535;
Canevascini et al. (1996) Plant Physiol. 112(2):513-524; Yamamoto
et al. (1994) Plant Cell Physiol. 35(5):773-778; Lam (1994) Results
Probl. Cell Differ. 20:181-196; Orozco et al. (1993) Plant Mol.
Biol. 23(6):1129-1138; Matsuoka et al. (1993) Proc Natl. Acad. Sci.
USA 90(20):9586-9590; and Guevara-Garcia et al. (1993) Plant J.
4(3):495-505. Such promoters can be modified, if necessary, for
weak expression.
[0102] In one embodiment, the nucleic acids of interest are
targeted to the chloroplast for expression. In this manner, where
the nucleic acid of interest is not directly inserted into the
chloroplast, the expression cassette will additionally contain a
chloroplast-targeting sequence comprising a nucleotide sequence
that encodes a chloroplast transit peptide to direct the gene
product of interest to the chloroplasts. Such transit peptides are
known in the art. With respect to chloroplast-targeting sequences,
"operably linked" means that the nucleic acid sequence encoding a
transit peptide (i.e., the chloroplast-targeting sequence) is
linked to the AHASL1 polynucleotide of the invention such that the
two sequences are contiguous and in the same reading frame. See,
for example, Von Heijne et al. (1991) Plant Mol. Biol. Rep.
9:104-126; Clark et al. (1989) J. Biol. Chem. 264:17544-17550;
Della-Cioppa et al. (1987) Plant Physiol. 84:965-968; Romer et al.
(1993) Biochem. Biophys. Res. Commun. 196:1414-1421; and Shah et
al. (1986) Science 233:478-481. While the AHASL1 proteins of the
invention include a native chloroplast transit peptide, any
chloroplast transit peptide known in art can be fused to the amino
acid sequence of a mature AHASL1 protein of the invention by
operably linking a choloroplast-targeting sequence to the 5'-end of
a nucleotide sequence encoding a mature AHASL1 protein of the
invention.
[0103] Chloroplast targeting sequences are known in the art and
include the chloroplast small subunit of ribulose-1,5-bisphosphate
carboxylase (Rubisco) (de Castro Silva Filho et al. (1996) Plant
Mol. Biol. 30:769-780; Schnell et al. (1991) J. Biol. Chem. 266(5):
3335-3342); 5-(enolpyruvyl)shikimate-3-phosphate synthase (EP SPS)
(Archer et al. (1990) J. Bioenerg. Biomemb. 22(6):789-810);
tryptophan synthase (Zhao et al. (1995) J. Biol. Chem.
270(11):6081-6087); plastocyanin (Lawrence et al. (1997) J. Biol.
Chem. 272(33):20357-20363); chorismate synthase (Schmidt et al.
(1993) J. Biol. Chem. 268(36):27447-27457); and the light
harvesting chlorophyll a/b binding protein (LHBP) (Lamppa et al.
(1988) J. Biol. Chem. 263:14996-14999). See also Von Heijne et al.
(1991) Plant Mol. Biol. Rep. 9:104-126; Clark et al. (1989) J.
Biol. Chem. 264:17544-17550; Della-Cioppa et al. (1987) Plant
Physiol. 84:965-968; Romer et al. (1993) Biochem. Biophys. Res.
Commun. 196:1414-1421; and Shah et al. (1986) Science
233:478-481.
[0104] Methods for transformation of chloroplasts are known in the
art. See, for example, Svab et al. (1990) Proc. Natl. Acad. Sci.
USA 87:8526-8530; Svab and Maliga (1993) Proc. Natl. Acad. Sci. USA
90:913-917; Svab and Maliga (1993) EMBO J. 12:601-606. The method
relies on particle gun delivery of DNA containing a selectable
marker and targeting of the DNA to the plastid genome through
homologous recombination. Additionally, plastid transformation can
be accomplished by transactivation of a silent plastid-borne
transgene by tissue-preferred expression of a nuclear-encoded and
plastid-directed RNA polymerase. Such a system has been reported in
McBride et al. (1994) Proc. Natl. Acad. Sci. USA 91:7301-7305.
[0105] The nucleic acids of interest to be targeted to the
chloroplast may be optimized for expression in the chloroplast to
account for differences in codon usage between the plant nucleus
and this organelle. In this manner, the nucleic acids of interest
may be synthesized using chloroplast-preferred codons. See, for
example, U.S. Pat. No. 5,380,831, herein incorporated by
reference.
[0106] As disclosed herein, the AHASL1 nucleotide sequences of the
invention find use in enhancing the herbicide tolerance of plants
that comprise in their genomes a gene encoding a herbicide-tolerant
AHASL1 protein. Such a gene may be an endogenous gene or a
transgene. Additionally, in certain embodiments, the nucleic acid
sequences of the present invention can be stacked with any
combination of polynucleotide sequences of interest in order to
create plants with a desired phenotype. For example, the
polynucleotides of the present invention may be stacked with any
other polynucleotides encoding polypeptides having pesticidal
and/or insecticidal activity, such as, for example, the Bacillus
thuringiensis toxin proteins (described in U.S. Pat. Nos.
5,366,892; 5,747,450; 5,737,514; 5,723,756; 5,593,881; and Geiser
et al. (1986) Gene 48:109). The combinations generated can also
include multiple copies of any one of the polynucleotides of
interest.
[0107] It is recognized that with these nucleotide sequences,
antisense constructions, complementary to at least a portion of the
messenger RNA (mRNA) for the AHASL1 polynucleotide sequences can be
constructed. Antisense nucleotides are constructed to hybridize
with the corresponding mRNA. Modifications of the antisense
sequences may be made as long as the sequences hybridize to and
interfere with expression of the corresponding mRNA. In this
manner, antisense constructions having 70%, preferably 80%, more
preferably 85% sequence identity to the corresponding antisensed
sequences may be used. Furthermore, portions of the antisense
nucleotides may be used to disrupt the expression of the target
gene. Generally, sequences of at least 50 nucleotides, 100
nucleotides, 200 nucleotides, or greater may be used.
[0108] The nucleotide sequences of the present invention may also
be used in the sense orientation to suppress the expression of
endogenous genes in plants. Methods for suppressing gene expression
in plants using nucleotide sequences in the sense orientation are
known in the art. The methods generally involve transforming plants
with a DNA construct comprising a promoter that drives expression
in a plant operably linked to at least a portion of a nucleotide
sequence that corresponds to the transcript of the endogenous gene.
Typically, such a nucleotide sequence has substantial sequence
identity to the sequence of the transcript of the endogenous gene,
preferably greater than about 65% sequence identity, more
preferably greater than about 85% sequence identity, most
preferably greater than about 95% sequence identity. See, U.S. Pat.
Nos. 5,283,184 and 5,034,323; herein incorporated by reference.
[0109] While the herbicide-resistant AHASL1 polynucleotides of the
invention find use as selectable marker genes for plant
transformation, the expression cassettes of the invention can
include another selectable marker gene for the selection of
transformed cells. Selectable marker genes, including those of the
present invention, are utilized for the selection of transformed
cells or tissues. Marker genes include, but are not limited to,
genes encoding antibiotic resistance, such as those encoding
neomycin phosphotransferase II (NEO) and hygromycin
phosphotransferase (HPT), as well as genes conferring resistance to
herbicidal compounds, such as glufosinate ammonium, bromoxynil,
imidazolinones, and 2,4-dichlorophenoxyacetate (2,4-D). See
generally, Yarranton (1992) Curr. Opin. Biotech. 3:506-511;
Christopherson et al. (1992) Proc. Natl. Acad. Sci. USA
89:6314-6318; Yao et al. (1992) Cell 71:63-72; Reznikoff (1992)
Mol. Microbiol. 6:2419-2422; Barkley et al. (1980) in The Operon,
pp. 177-220; Hu et al. (1987) Cell 48:555-566; Brown et al. (1987)
Cell 49:603-612; Figge et al. (1988) Cell 52:713-722; Deuschle et
al. (1989) Proc. Natl. Acad. Aci. USA 86:5400-5404; Fuerst et al.
(1989) Proc. Natl. Acad. Sci. USA 86:2549-2553; Deuschle et al.
(1990) Science 248:480-483; Gossen (1993) Ph.D. Thesis, University
of Heidelberg; Reines et al. (1993) Proc. Natl. Acad. Sci. USA
90:1917-1921; Labow et al. (1990) Mol. Cell. Biol. 10:3343-3356;
Zambretti et al. (1992) Proc. Natl. Acad. Sci. USA 89:3952-3956;
Baim et al. (1991) Proc. Natl. Acad. Sci. USA 88:5072-5076;
Wyborski et al. (1991) Nucleic Acids Res. 19:4647-4653;
Hillenand-Wissman (1989) Topics Mol. Struc. Biol. 10:143-162;
Degenkolb et al. (1991) Antimicrob. Agents Chemother. 35:1591-1595;
Kleinschnidt et al. (1988) Biochemistry 27:1094-1104; Bonin (1993)
Ph.D. Thesis, University of Heidelberg; Gossen et al. (1992) Proc.
Natl. Acad. Sci. USA 89:5547-5551; Oliva et al. (1992) Antimicrob.
Agents Chemother. 36:913-919; Hlavka et al. (1985) Handbook of
Experimental Pharmacology, Vol. 78 (Springer-Verlag, Berlin); Gill
et al. (1988) Nature 334:721-724. Such disclosures are herein
incorporated by reference.
[0110] The above list of selectable marker genes is not meant to be
limiting. Any selectable marker gene can be used in the present
invention.
[0111] The isolated polynucleotide molecules comprising nucleotide
sequence that encode the AHASL1 proteins of the invention can be
used in vectors to transform plants so that the plants created have
enhanced resistant to herbicides, particularly imidazolinone
herbicides. The isolated AHASL1 polynucleotide molecules of the
invention can be used in vectors alone or in combination with a
nucleotide sequence encoding the small subunit of the AHAS (AHASS)
enzyme in conferring herbicide resistance in plants. See, U.S. Pat.
No. 6,348,643; which is herein incorporated by reference.
[0112] The invention also relates to a plant expression vector
comprising a promoter that drives expression in a plant operably
linked to an isolated polynucleotide molecule of the invention. The
isolated polynucleotide molecule comprises a nucleotide sequence
encoding an AHASL1 protein, particularly an AHASL1 protein
comprising an amino sequence that is set forth in SEQ ID NO:2, or a
functional fragment and variant thereof. The plant expression
vector of the invention does not depend on a particular promoter,
only that such a promoter is capable of driving gene expression in
a plant cell. Preferred promoters include constitutive promoters
and tissue-preferred promoters.
[0113] The transformation vectors of the invention can be used to
produce plants transformed with a gene of interest. The
transformation vector will comprise a selectable marker gene of the
invention and a gene of interest to be introduced and typically
expressed in the transformed plant. Such a selectable marker gene
comprises a herbicide-resistant AHASL1 polynucleotide of the
invention operably linked to a promoter that drives expression in a
host cell. For use in plants and plant cells, the transformation
vector comprises a selectable marker gene comprising a
herbicide-resistant AHASL1 polynucleotide of the invention operably
linked to a promoter that drives expression in a plant cell.
[0114] The genes of interest of the invention vary depending on the
desired outcome. For example, various changes in phenotype can be
of interest including modifying the fatty acid composition in a
plant, altering the amino acid content of a plant, altering a
plant's insect and/or pathogen defense mechanisms, and the like.
These results can be achieved by providing expression of
heterologous products or increased expression of endogenous
products in plants. Alternatively, the results can be achieved by
providing for a reduction of expression of one or more endogenous
products, particularly enzymes or cofactors in the plant. These
changes result in a change in phenotype of the transformed
plant.
[0115] In one embodiment of the invention, the genes of interest
include insect resistance genes such as, for example, Bacillus
thuringiensis toxin protein genes (U.S. Pat. Nos. 5,366,892;
5,747,450; 5,736,514; 5,723,756; 5,593,881; and Geiser et al.
(1986) Gene 48:109).
[0116] The AHASL1 proteins or polypeptides of the invention can be
purified from, for example, rice plants and can be used in
compositions. Also, an isolated polynucleotide molecule encoding an
AHASL1 protein of the invention can be used to express an AHASL1
protein of the invention in a microbe such as E. coli or a yeast.
The expressed AHASL1 protein can be purified from extracts of E.
coli or yeast by any method known to those or ordinary skill in the
art.
[0117] The invention also relates to a method for creating a
transgenic plant that is resistant to herbicides, comprising
transforming a plant with a plant expression vector comprising a
promoter that drives expression in a plant operably linked to an
isolated polynucleotide molecule of the invention. The isolated
polynucleotide molecule comprises a nucleotide sequence encoding an
AHASL1 protein of the invention, particularly an AHASL1 protein
comprising: an amino sequence that is set forth in SEQ ID NO:2, an
amino acid sequence encoded by SEQ ID NO:1 or 3, or a functional
fragment and variant of said amino acid sequences.
[0118] The invention also relates to the non-transgenic rice
plants, transgenic plants produced by the methods of the invention,
and progeny and other descendants of such non-transgenic and
transgenic plants, which plants exhibit enhanced or increased
resistance to herbicides that interfere with the AHAS enzyme,
particularly imidazolinone and sulfonylurea herbicides.
[0119] The AHASL1 polynucleotides of the invention, particularly
those encoding herbicide-resistant AHASL1 proteins, find use in
methods for enhancing the resistance of herbicide-tolerant plants.
In one embodiment of the invention, the herbicide-tolerant plants
comprise a herbicide-tolerant or herbicide resistant AHASL1
protein. The herbicide-tolerant plants include both plants
transformed with a herbicide-tolerant AHASL1 nucleotide sequences
and plants that comprise in their genomes an endogenous gene that
encodes a herbicide-tolerant AHASL1 protein. Nucleotide sequences
encoding herbicide-tolerant AHASL1 proteins and herbicide-tolerant
plants comprising an endogenous gene that encodes a
herbicide-tolerant AHASL1 protein include the polynucleotides and
plants of the present invention and those that are known in the
art. See, for example, U.S. Pat. Nos. 5,013,659, 5,731,180,
5,767,361, 5,545,822, 5,736,629, 5,773,703, 5,773,704, 5,952,553
and 6,274,796; all of which are herein incorporated by reference.
Such methods for enhancing the resistance of herbicide-tolerant
plants comprise transforming a herbicide-tolerant plant with at
least one polynucleotide construction comprising a promoter that
drives expression in a plant cell that is operably linked to a
herbicide resistant AHASL1 polynucleotide of the invention,
particularly the polynucleotide encoding a herbicide-resistant
AHASL1 protein set forth in SEQ ID NO:1 or 3 polynucleotides
encoding the amino acid sequence set forth in SEQ ID NO:2, and
fragments and variants said polynucleotides that encode
polypeptides comprising herbicide-resistant AHAS activity.
[0120] Numerous plant transformation vectors and methods for
transforming plants are available. See, for example, An, G. et al.
(1986) Plant Pysiol., 81:301-305; Fry, J., et al. (1987) Plant Cell
Rep. 6:321-325; Block, M. (1988) Theor. Appl. Genet.76:767-774;
Hinchee, et al. (1990) Stadler. Genet. Symp. 203212.203-212;
Cousins, et al. (1991) Aust. J. Plant Physiol. 18:481-494; Chee, P.
P. and Slightom, J. L. (1992) Gene.118:255-260; Christou, et al.
(1992) Trends. Biotechnol. 10:239-246; D'Halluin, et al. (1992)
Bio/Technol. 10:309-314; Dhir, et al. (1992) Plant Physiol.
99:81-88; Casas et al. (1993) Proc. Nat. Acad. Sci. USA
90:11212-11216; Christou, P. (1993) In Vitro Cell. Dev.
Biol.-Plant; 29P:119-124; Davies, et al. (1993) Plant Cell Rep.
12:180-183; Dong, J. A. and Mchughen, A. (1993) Plant Sci.
91:139-148; Franklin, C. I. and Trieu, T. N. (1993) Plant. Physiol.
102:167; Golovkin, et al. (1993) Plant Sci. 90:41-52; Guo Chin Sci.
Bull. 38:2072-2078; Asano, et al. (1994) Plant Cell Rep. 13; Ayeres
N. M. and Park, W. D. (1994) Crit. Rev. Plant. Sci. 13:219-239;
Barcelo, et al. (1994) Plant. J. 5:583-592; Becker, et al. (1994)
Plant. J. 5:299-307; Borkowska et al. (1994) Acta. Physiol Plant.
16:225-230; Christou, P. (1994) Agro. Food. Ind. Hi Tech. 5: 17-27;
Eapen et al. (1994) Plant Cell Rep. 13:582-586; Hartman, et al.
(1994) Bio-Technology 12: 919923; Ritala, et al. (1994) Plant. Mol.
Biol. 24:317-325; and Wan, Y. C. and Lemaux, P. G. (1994) Plant
Physiol. 104:3748.
[0121] The methods of the invention involve introducing a
polynucleotide construct into a plant. By "introducing" is intended
presenting to the plant the polynucleotide construct in such a
manner that the construct gains access to the interior of a cell of
the plant. The methods of the invention do not depend on a
particular method for introducing a polynucleotide construct to a
plant, only that the polynucleotide construct gains access to the
interior of at least one cell of the plant. Methods for introducing
polynucleotide constructs into plants are known in the art
including, but not limited to, stable transformation methods,
transient transformation methods, and virus-mediated methods.
[0122] By "stable transformation" is intended that the
polynucleotide construct introduced into a plant integrates into
the genome of the plant and is capable of being inherited by
progeny thereof. By "transient transformation" is intended that a
polynucleotide construct introduced into a plant does not integrate
into the genome of the plant.
[0123] For the transformation of plants and plant cells, the
nucleotide sequences of the invention are inserted using standard
techniques into any vector known in the art that is suitable for
expression of the nucleotide sequences in a plant or plant cell.
The selection of the vector depends on the preferred transformation
technique and the target plant species to be transformed. In an
embodiment of the invention, an AHASL1 nucleotide sequence is
operably linked to a plant promoter that is known for high-level
expression in a plant cell, and this construct is then introduced
into a plant that that is susceptible to an imidazolinone herbicide
and a transformed plant it regenerated. The transformed plant is
tolerant to exposure to a level of an imidazolinone herbicide that
would kill or significantly injure an untransformed plant. This
method can be applied to any plant species; however, it is most
beneficial when applied to crop plants, particularly crop plants
that are typically grown in the presence of at least one herbicide,
particularly an imidazolinone herbicide.
[0124] Methodologies for constructing plant expression cassettes
and introducing foreign nucleic acids into plants are generally
known in the art and have been previously described. For example,
foreign DNA can be introduced into plants, using tumor-inducing
(Ti) plasmid vectors. Other methods utilized for foreign DNA
delivery involve the use of PEG mediated protoplast transformation,
electroporation, microinjection whiskers, and biolistics or
microprojectile bombardment for direct DNA uptake. Such methods are
known in the art. (U.S. Pat. No. 5,405,765 to Vasil et al.; Bilang
et al. (1991) Gene 100: 247-250; Scheid et al., (1991) Mol. Gen.
Genet., 228: 104-112; Guerche et al., (1987) Plant Science 52:
111-116; Neuhause et al., (1987) Theor. Appl. Genet. 75: 30-36;
Klein et al., (1987) Nature 327: 70-73; Howell et al., (1980)
Science 208:1265; Horsch et al., (1985) Science 227: 1229-1231;
DeBlock et al., (1989) Plant Physiology 91: 694-701; Methods for
Plant Molecular Biology (Weissbach and Weissbach, eds.) Academic
Press, Inc. (1988) and Methods in Plant Molecular Biology (Schuler
and Zielinski, eds.) Academic Press, Inc. (1989). The method of
transformation depends upon the plant cell to be transformed,
stability of vectors used, expression level of gene products and
other parameters.
[0125] Other suitable methods of introducing nucleotide sequences
into plant cells and subsequent insertion into the plant genome
include microinjection as Crossway et al. (1986) Biotechniques
4:320-334, electroporation as described by Riggs et al. (1986)
Proc. Natl. Acad. Sci. USA 83:5602-5606, Agrobacterium-mediated
transformation as described by Townsend et al., U.S. Pat. No.
5,563,055, Zhao et al., U.S. Pat. No. 5,981,840, direct gene
transfer as described by Paszkowski et al. (1984) EMBO J.
3:2717-2722, and ballistic particle acceleration as described in,
for example, Sanford et al., U.S. Pat. No. 4,945,050; Tomes et al.,
U.S. Pat. No. 5,879,918; Tomes et al., U.S. Pat. No. 5,886,244;
Bidney et al., U.S. Pat. No. 5,932,782; Tomes et al. (1995) "Direct
DNA Transfer into Intact Plant Cells via Microprojectile
Bombardment," in Plant Cell, Tissue, and Organ Culture: Fundamental
Methods, ed. Gamborg and Phillips (Springer-Verlag, Berlin); McCabe
et al. (1988) Biotechnology 6:923-926); and Lecl transformation (WO
00/28058). Also see, Weissinger et al. (1988) Ann. Rev. Genet.
22:421-477; Sanford et al. (1987) Particulate Science and
Technology 5:27-37 (onion); Christou et al. (1988) Plant Physiol.
87:671-674 (soybean); McCabe et al. (1988) Bio/Technology 6:923-926
(soybean); Finer and McMullen (1991) In Vitro Cell Dev. Biol.
27P:175-182 (soybean); Singh et al. (1998) Theor. Appl. Genet.
96:319-324 (soybean); Datta et al. (1990) Biotechnology 8:736-740
(rice); Klein et al. (1988) Proc. Natl. Acad. Sci. USA 85:4305-4309
(maize); Klein et al. (1988) Biotechnology 6:559-563 (maize);
Tomes, U.S. Pat. No. 5,240,855; Buising et al., U.S. Pat. Nos.
5,322,783 and 5,324,646; Tomes et al. (1995) "Direct DNA Transfer
into Intact Plant Cells via Microprojectile Bombardment," in Plant
Cell, Tissue, and Organ Culture: Fundamental Methods, ed. Gamborg
(Springer-Verlag, Berlin) (maize); Klein et al. (1988) Plant
Physiol. 91:440-444 (maize); Fromm et al. (1990) Biotechnology
8:833-839 (maize); Hooykaas-Van Slogteren et al. (1984) Nature
(London) 311:763-764; Bowen et al., U.S. Pat. No. 5,736,369
(cereals); Bytebier et al. (1987) Proc. Natl. Acad. Sci. USA
84:5345-5349 (Liliaceae); De Wet et al. (1985) in The Experimental
Manipulation of Ovule Tissues, ed. Chapman et al. (Longman, N.Y.),
pp. 197-209 (pollen); Kaeppler et al. (1990) Plant Cell Reports
9:415-418 and Kaeppler et al. (1992) Theor. Appl. Genet. 84:560-566
(whisker-mediated transformation); D'Halluin et al. (1992) Plant
Cell 4:1495-1505 (electroporation); Li et al. (1993) Plant Cell
Reports 12:250-255 and Christou and Ford (1995) Annals of Botany
75:407-413 (rice); Osjoda et al. (1996) Nature Biotechnology
14:745-750 (maize via Agrobacterium tumefaciens); all of which are
herein incorporated by reference.
[0126] The polynucleotides of the invention may be introduced into
plants by contacting plants with a virus or viral nucleic acids.
Generally, such methods involve incorporating a polynucleotide
construct of the invention within a viral DNA or RNA molecule. It
is recognized that the an AHASL1 protein of the invention may be
initially synthesized as part of a viral polyprotein, which later
may be processed by proteolysis in vivo or in vitro to produce the
desired recombinant protein. Further, it is recognized that
promoters of the invention also encompass promoters utilized for
transcription by viral RNA polymerases. Methods for introducing
polynucleotide constructs into plants and expressing a protein
encoded therein, involving viral DNA or RNA molecules, are known in
the art. See, for example, U.S. Pat. Nos. 5,889,191, 5,889,190,
5,866,785, 5,589,367 and 5,316,931; herein incorporated by
reference.
[0127] The cells that have been transformed may be grown into
plants in accordance with conventional ways. See, for example,
McCormick et al. (1986) Plant Cell Reports 5:81-84. These plants
may then be grown, and either pollinated with the same transformed
strain or different strains, and the resulting hybrid having
constitutive expression of the desired phenotypic characteristic
identified. Two or more generations may be grown to ensure that
expression of the desired phenotypic characteristic is stably
maintained and inherited and then seeds harvested to ensure
expression of the desired phenotypic characteristic has been
achieved. In this manner, the present invention provides
transformed seed (also referred to as "transgenic seed") having a
polynucleotide construct of the invention, for example, an
expression cassette of the invention, stably incorporated into
their genome.
[0128] The present invention may be used for transformation of any
plant species, including, but not limited to, monocots and dicots.
Examples of plant species of interest include, but are not limited
to, corn or maize (Zea mays), Brassica sp. (e.g., B. napus, B.
rapa, B. juncea), particularly those Brassica species useful as
sources of seed oil, alfalfa (Medicago sativa), rice (Oryza
sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum
vulgare), millet (e.g., pearl millet (Pennisetum glaucum), proso
millet (Panicum miliaceum), foxtail millet (Setaria italica),
finger millet (Eleusine coracana), sunflower (Helianthus annuus),
safflower (Carthamus tinctorius), wheat (Triticum aestivum, T.
Turgidum ssp. durum), soybean (Glycine max), tobacco (Nicotiana
tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea),
cotton (Gossypium barbadense, Gossypium hirsutum), sweet potato
(Ipomoea batatus), cassaya (Manihot esculenta), coffee (Coffea
spp.), coconut (Cocos nucifera), pineapple (Ananas comosus), citrus
trees (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia
sinensis), banana (Musa spp.), avocado (Persea americana), fig
(Ficus casica), guava (Psidium guajava), mango (Mangifera indica),
olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium
occidentale), macadamia (Macadamia integrifolia), almond (Prunus
amygdalus), sugar beets (Beta vulgaris), sugarcane (Saccharum
spp.), oats, barley, vegetables, ornamentals, and conifers.
Preferably, plants of the present invention are crop plants (for
example, sunflower, Brassica sp., cotton, sugar, beet, soybean,
peanut, alfalfa, safflower, tobacco, corn, rice, wheat, rye, barley
triticale, sorghum, millet, etc.).
[0129] The herbicide resistant plants of the invention find use in
methods for controlling weeds. Thus, the present invention further
provides a method for controlling weeds in the vicinity of a
herbicide-resistant plant of the invention. The method comprises
applying an effective amount of a herbicide to the weeds and to the
herbicide-resistant plant, wherein the plant has increased
resistance to at least one herbicide, particularly an imidazolinone
or sulfonylurea herbicide, when compared to a wild-type plant. In
such a method for controlling weeds, the herbicide-resistant plants
of the invention are preferably crop plants, including, but not
limited to, rice, sunflower, alfalfa, Brassica sp., soybean,
cotton, safflower, peanut, tobacco, tomato, potato, wheat, maize,
sorghum, barley, rye, millet, and sorghum.
[0130] By providing plants having increased resistance to
herbicides, particularly imidazolinone and sulfonylurea herbicides,
a wide variety of formulations can be employed for protecting
plants from weeds, so as to enhance plant growth and reduce
competition for nutrients. A herbicide can be used by itself for
pre-emergence, post-emergence, pre-planting and at planting control
of weeds in areas surrounding the plants described herein or an
imidazolinone herbicide formulation can be used that contains other
additives. The herbicide can also be used as a seed treatment.
Additives found in an imidazolinone or sulfonylurea herbicide
formulation include other herbicides, detergents, adjuvants,
spreading agents, sticking agents, stabilizing agents, or the like.
The herbicide formulation can be a wet or dry preparation and can
include, but is not limited to, flowable powders, emulsifiable
concentrates and liquid concentrates. The herbicide and herbicide
formulations can be applied in accordance with conventional
methods, for example, by spraying, irrigation, dusting, or the
like.
[0131] The present invention provides non-transgenic and transgenic
seeds with increased tolerance to at least one herbicide,
particularly an AHAS-inhibiting herbicide, more particularly an
imidazolinone herbicide. Such seeds include, for example,
non-transgenic rice seeds comprising the herbicide-tolerance
characteristics of the plant with NCIMB Accession Number NCIMB
41262, and transgenic seeds comprising an IMI nucleic acid molecule
of the invention that encodes an IMI protein.
[0132] The present invention provides methods for producing a
herbicide-resistant plant, particularly a herbicide-resistant rice
plant, through conventional plant breeding involving sexual
reproduction. The methods comprise crossing a first plant that is
resistant to a herbicide to a second plant that is not resistant to
the herbicide. The first plant can be any of the herbicide
resistant plants of the present invention including, for example,
transgenic plants comprising at least one of the polynucleotides of
the present invention that encode a herbicide resistant IMI protein
and non-transgenic rice plants that comprise the
herbicide-tolerance characteristics of the rice plant with NCIMB
Accession Number NCIMB 41262. The second plant can be any plant
that is capable of producing viable progeny plants (i.e., seeds)
when crossed with the first plant. Typically, but not necessarily,
the first and second plants are of the same species. The methods of
the invention can further involve one or more generations of
backcrossing the progeny plants of the first cross to a plant of
the same line or genotype as either the first or second plant.
Alternatively, the progeny of the first cross or any subsequent
cross can be crossed to a third plant that is of a different line
or genotype than either the first or second plant. The methods of
the invention can additionally involve selecting plants that
comprise the herbicide tolerance characteristics of the first
plant.
[0133] The present invention further provides methods for
increasing the herbicide-resistance of a plant, particularly a
herbicide-resistant rice plant, through conventional plant breeding
involving sexual reproduction. The methods comprise crossing a
first plant that is resistant to a herbicide to a second plant that
may or may not be resistant to the herbicide or may be resistant to
different herbicide or herbicides than the first plant. The first
plant can be any of the herbicide resistant plants of the present
invention including, for example, transgenic plants comprising at
least one of the IMI nucleic acids of the present invention that
encode IMI protein and non-transgenic rice plants that comprise the
herbicide-tolerance characteristics of the rice plant with NCIMB
Accession Number NCIMB 41262. The second plant can be any plant
that is capable of producing viable progeny plants (i.e., seeds)
when crossed with the first plant. Typically, but not necessarily,
the first and second plants are of the same species. The progeny
plants produced by this method of the present invention have
increased resistance to a herbicide when compared to either the
first or second plant or both. When the first and second plants are
resistant to different herbicides, the progeny plants will have the
combined herbicide tolerance characteristics of the first and
second plants. The methods of the invention can further involve one
or more generations of backcrossing the progeny plants of the first
cross to a plant of the same line or genotype as either the first
or second plant. Alternatively, the progeny of the first cross or
any subsequent cross can be crossed to a third plant that is of a
different line or genotype than either the first or second plant.
The methods of the invention can additionally involve selecting
plants that comprise the herbicide tolerance characteristics of the
first plant, the second plant, or both the first and the second
plant.
[0134] The plants of the present invention can be transgenic or
non-transgenic. An example of a non-transgenic rice plant having
increased resistance to imidazolinone is the rice plant (IMINTA 16)
having NCIMB Accession Number NCIMB 41262; or mutant, recombinant,
or a genetically engineered derivative of the plant having NCIMB
Accession Number NCIMB 41262; or of any progeny of the plant having
NCIMB Accession Number NCIMB 41262; or a plant that is a progeny of
any of these plants; or a plant that comprises the herbicide
tolerance characteristics of the plant having NCIMB Accession
Number NCIMB 41262.
[0135] The present invention also provides plants, plant organs,
plant tissues, plant cells, seeds, and non-human host cells that
are transformed with the at least one polynucleotide, expression
cassette, or transformation vector of the invention. Such
transformed plants, plant organs, plant tissues, plant cells,
seeds, and non-human host cells have enhanced tolerance or
resistance to at least one herbicide, at levels of the herbicide
that kill or inhibit the growth of an untransformed plant, plant
tissue, plant cell, or non-human host cell, respectively.
Preferably, the transformed plants, plant tissues, plant cells, and
seeds of the invention are Arabidopsis thaliana and crop
plants.
[0136] The present invention provides methods that involve the use
of at least one AHAS-inhibiting herbicide selected from the group
consisting of imidazolinone herbicides, sulfonylurea herbicides,
triazolopyrimidine herbicides, pyrimidinyloxybenzoate herbicides,
sulfonylamino-carbonyltriazolinone herbicides, and mixtures
thereof. In these methods, the AHAS-inhibiting herbicide can be
applied by any method known in the art including, but not limited
to, seed treatment, soil treatment, and foliar treatment.
[0137] Prior to application, the AHAS-inhibiting herbicide can be
converted into the customary formulations, for example solutions,
emulsions, suspensions, dusts, powders, pastes and granules. The
use form depends on the particular intended purpose; in each case,
it should ensure a fine and even distribution of the compound
according to the invention.
[0138] The formulations are prepared in a known manner (see e.g.
for review U.S. Pat. No. 3,060,084, EP-A 707 445 (for liquid
concentrates), Browning, "Agglomeration", Chemical Engineering,
Dec. 4, 1967, 147-48, Perry's Chemical Engineer's Handbook, 4th
Ed., McGraw-Hill, New York, 1963, pages 8-57 and et seq. WO
91/13546, U.S. Pat. No. 4,172,714, U.S. Pat. No. 4,144,050, U.S.
Pat. No. 3,920,442, U.S. Pat. No. 5,180,587, U.S. Pat. No.
5,232,701, U.S. Pat. No. 5,208,030, GB 2,095,558, U.S. Pat. No.
3,299,566, Klingman, Weed Control as a Science, John Wiley and
Sons, Inc., New York, 1961, Hance et al., Weed Control Handbook,
8th Ed., Blackwell Scientific Publications, Oxford, 1989 and
Mollet, H., Grubemann, A., Formulation technology, Wiley VCH Verlag
GmbH, Weinheim (Germany), 2001, 2. D. A. Knowles, Chemistry and
Technology of Agrochemical Formulations, Kluwer Academic
Publishers, Dordrecht, 1998 (ISBN 0-7514-0443-8), for example by
extending the active compound with auxiliaries suitable for the
formulation of agrochemicals, such as solvents and/or carriers, if
desired emulsifiers, surfactants and dispersants, preservatives,
antifoaming agents, anti-freezing agents, for seed treatment
formulation also optionally colorants and/or binders and/or gelling
agents.
[0139] Examples of suitable solvents are water, aromatic solvents
(for example Solvesso products, xylene), paraffins (for example
mineral oil fractions), alcohols (for example methanol, butanol,
pentanol, benzyl alcohol), ketones (for example cyclohexanone,
gamma-butyrolactone), pyrrolidones (NMP, NOP), acetates (glycol
diacetate), glycols, fatty acid dimethylamides, fatty acids and
fatty acid esters. In principle, solvent mixtures may also be
used.
[0140] Examples of suitable carriers are ground natural minerals
(for example kaolins, clays, talc, chalk) and ground synthetic
minerals (for example highly disperse silica, silicates).
[0141] Suitable emulsifiers are nonionic and anionic emulsifiers
(for example polyoxyethylene fatty alcohol ethers, alkylsulfonates
and arylsulfonates).
[0142] Examples of dispersants are lignin-sulfite waste liquors and
methylcellulose.
[0143] Suitable surfactants used are alkali metal, alkaline earth
metal and ammonium salts of lignosulfonic acid, naphthalenesulfonic
acid, phenolsulfonic acid, dibutylnaphthalenesulfonic acid,
alkylarylsulfonates, alkyl sulfates, alkylsulfonates, fatty alcohol
sulfates, fatty acids and sulfated fatty alcohol glycol ethers,
furthermore condensates of sulfonated naphthalene and naphthalene
derivatives with formaldehyde, condensates of naphthalene or of
naphthalenesulfonic acid with phenol and formaldehyde,
polyoxyethylene octylphenol ether, ethoxylated isooctylphenol,
octylphenol, nonylphenol, alkylphenol polyglycol ethers,
tributylphenyl polyglycol ether, tristearylphenyl polyglycol ether,
alkylaryl polyether alcohols, alcohol and fatty alcohol ethylene
oxide condensates, ethoxylated castor oil, polyoxyethylene alkyl
ethers, ethoxylated polyoxypropylene, lauryl alcohol polyglycol
ether acetal, sorbitol esters, lignosulfite waste liquors and
methylcellulose.
[0144] Substances which are suitable for the preparation of
directly sprayable solutions, emulsions, pastes or oil dispersions
are mineral oil fractions of medium to high boiling point, such as
kerosene or diesel oil, furthermore coal tar oils and oils of
vegetable or animal origin, aliphatic, cyclic and aromatic
hydrocarbons, for example toluene, xylene, paraffin,
tetrahydronaphthalene, alkylated naphthalenes or their derivatives,
methanol, ethanol, propanol, butanol, cyclohexanol, cyclohexanone,
isophorone, highly polar solvents, for example dimethyl sulfoxide,
N-methylpyrrolidone or water.
[0145] Also anti-freezing agents such as glycerin, ethylene glycol,
propylene glycol and bactericides such as can be added to the
formulation.
[0146] Suitable antifoaming agents are for example antifoaming
agents based on silicon or magnesium stearate.
[0147] Suitable preservatives are for example Dichlorophen and
enzylalkoholhemiformal.
[0148] Seed Treatment formulations may additionally comprise
binders and optionally colorants.
[0149] Binders can be added to improve the adhesion of the active
materials on the seeds after treatment. Suitable binders are block
copolymers EO/PO surfactants but also polyvinylalcoholsl,
polyvinylpyrrolidones, polyacrylates, polymethacrylates,
polybutenes, polyisobutylenes, polystyrene, polyethyleneamines,
polyethyleneamides, polyethyleneimines (Lupasol.RTM.,
Polymin.RTM.), polyethers, polyurethans, polyvinylacetate, tylose
and copolymers derived from these polymers.
[0150] Optionally, also colorants can be included in the
formulation. Suitable colorants or dyes for seed treatment
formulations are Rhodamin B, C.I. Pigment Red 112, C.I. Solvent Red
1, pigment blue 15:4, pigment blue 15:3, pigment blue 15:2, pigment
blue 15:1, pigment blue 80, pigment yellow 1, pigment yellow 13,
pigment red 112, pigment red 48:2, pigment red 48:1, pigment red
57:1, pigment red 53:1, pigment orange 43, pigment orange 34,
pigment orange 5, pigment green 36, pigment green 7, pigment white
6, pigment brown 25, basic violet 10, basic violet 49, acid red 51,
acid red 52, acid red 14, acid blue 9, acid yellow 23, basic red
10, basic red 108.
[0151] An examples of a suitable gelling agent is carrageen
(Satiagel.RTM.).
[0152] Powders, materials for spreading, and dustable products can
be prepared by mixing or concomitantly grinding the active
substances with a solid carrier.
[0153] Granules, for example coated granules, impregnated granules
and homogeneous granules, can be prepared by binding the active
compounds to solid carriers. Examples of solid carriers are mineral
earths such as silica gels, silicates, talc, kaolin, attaclay,
limestone, lime, chalk, bole, loess, clay, dolomite, diatomaceous
earth, calcium sulfate, magnesium sulfate, magnesium oxide, ground
synthetic materials, fertilizers, such as, for example, ammonium
sulfate, ammonium phosphate, ammonium nitrate, ureas, and products
of vegetable origin, such as cereal meal, tree bark meal, wood meal
and nutshell meal, cellulose powders and other solid carriers.
[0154] In general, the formulations comprise from 0.01 to 95% by
weight, preferably from 0.1 to 90% by weight, of the
AHAS-inhibiting herbicide. In this case, the AHAS-inhibiting
herbicides are employed in a purity of from 90% to 100% by weight,
preferably 95% to 100% by weight (according to NMR spectrum). For
seed treatment purposes, respective formulations can be diluted
2-10 fold leading to concentrations in the ready to use
preparations of 0.01 to 60% by weight active compound by weight,
preferably 0.1 to 40% by weight.
[0155] The AHAS-inhibiting herbicide can be used as such, in the
form of their formulations or the use forms prepared therefrom, for
example in the form of directly sprayable solutions, powders,
suspensions or dispersions, emulsions, oil dispersions, pastes,
dustable products, materials for spreading, or granules, by means
of spraying, atomizing, dusting, spreading or pouring. The use
forms depend entirely on the intended purposes; they are intended
to ensure in each case the finest possible distribution of the
AHAS-inhibiting herbicide according to the invention.
[0156] Aqueous use forms can be prepared from emulsion
concentrates, pastes or wettable powders (sprayable powders, oil
dispersions) by adding water. To prepare emulsions, pastes or oil
dispersions, the substances, as such or dissolved in an oil or
solvent, can be homogenized in water by means of a wetter,
tackifier, dispersant or emulsifier. However, it is also possible
to prepare concentrates composed of active substance, wetter,
tackifier, dispersant or emulsifier and, if appropriate, solvent or
oil, and such concentrates are suitable for dilution with
water.
[0157] The active compound concentrations in the ready-to-use
preparations can be varied within relatively wide ranges. In
general, they are from 0.0001 to 10%, preferably from 0.01 to 1%
per weight.
[0158] The AHAS-inhibiting herbicide may also be used successfully
in the ultra-low-volume process (ULV), it being possible to apply
formulations comprising over 95% by weight of active compound, or
even to apply the active compound without additives.
[0159] The following are examples of formulations:
[0160] 1. Products for dilution with water for foliar applications.
For seed treatment purposes, such products may be applied to the
seed diluted or undiluted.
[0161] A) Water-Soluble Concentrates (SL, LS)
[0162] Ten parts by weight of the AHAS-inhibiting herbicide are
dissolved in 90 parts by weight of water or a water-soluble
solvent. As an alternative, wetters or other auxiliaries are added.
The AHAS-inhibiting herbicide dissolves upon dilution with water,
whereby a formulation with 10% (w/w) of AHAS-inhibiting herbicide
is obtained.
[0163] B) Dispersible Concentrates (DC)
[0164] Twenty parts by weight of the AHAS-inhibiting herbicide are
dissolved in 70 parts by weight of cyclohexanone with addition of
10 parts by weight of a dispersant, for example
polyvinylpyrrolidone. Dilution with water gives a dispersion,
whereby a formulation with 20% (w/w) of AHAS-inhibiting herbicide
is obtained.
[0165] C) Emulsifiable Concentrates (EC)
[0166] Fifteen parts by weight of the AHAS-inhibiting herbicide are
dissolved in 7 parts by weight of xylene with addition of calcium
dodecylbenzenesulfonate and castor oil ethoxylate (in each case 5
parts by weight). Dilution with water gives an emulsion, whereby a
formulation with 15% (w/w) of AHAS-inhibiting herbicide is
obtained.
[0167] D) Emulsions (EW, EO, ES)
[0168] Twenty-five parts by weight of the AHAS-inhibiting herbicide
are dissolved in 35 parts by weight of xylene with addition of
calcium dodecylbenzenesulfonate and castor oil ethoxylate (in each
case 5 parts by weight). This mixture is introduced into 30 parts
by weight of water by means of an emulsifier machine (e.g.
Ultraturrax) and made into a homogeneous emulsion. Dilution with
water gives an emulsion, whereby a formulation with 25% (w/w) of
AHAS-inhibiting herbicide is obtained.
[0169] E) Suspensions (SC, OD, FS)
[0170] In an agitated ball mill, 20 parts by weight of the
AHAS-inhibiting herbicide are comminuted with addition of 10 parts
by weight of dispersants, wetters and 70 parts by weight of water
or of an organic solvent to give a fine AHAS-inhibiting herbicide
suspension. Dilution with water gives a stable suspension of the
AHAS-inhibiting herbicide, whereby a formulation with 20% (w/w) of
AHAS-inhibiting herbicide is obtained.
[0171] F) Water-Dispersible Granules and Water-Soluble Granules
(WG, SG)
[0172] Fifty parts by weight of the AHAS-inhibiting herbicide are
ground finely with addition of 50 parts by weight of dispersants
and wetters and made as water-dispersible or water-soluble granules
by means of technical appliances (for example extrusion, spray
tower, fluidized bed). Dilution with water gives a stable
dispersion or solution of the AHAS-inhibiting herbicide, whereby a
formulation with 50% (w/w) of AHAS-inhibiting herbicide is
obtained.
[0173] G) Water-Dispersible Powders and Water-Soluble Powders (WP,
SP, SS, WS)
[0174] Seventy-five parts by weight of the AHAS-inhibiting
herbicide are ground in a rotor-stator mill with addition of 25
parts by weight of dispersants, wetters and silica gel. Dilution
with water gives a stable dispersion or solution of the
AHAS-inhibiting herbicide, whereby a formulation with 75% (w/w) of
AHAS-inhibiting herbicide is obtained.
[0175] I) Gel-Formulation (GF)
[0176] In an agitated ball mill, 20 parts by weight of the
AHAS-inhibiting herbicide are comminuted with addition of 10 parts
by weight of dispersants, 1 part by weight of a gelling agent
wetters and 70 parts by weight of water or of an organic solvent to
give a fine AHAS-inhibiting herbicide suspension. Dilution with
water gives a stable suspension of the AHAS-inhibiting herbicide,
whereby a formulation with 20% (w/w) of AHAS-inhibiting herbicide
is obtained. This gel formulation is suitable for us as a seed
treatment.
[0177] 2. Products to be applied undiluted for foliar applications.
For seed treatment purposes, such products may be applied to the
seed diluted.
[0178] A) Dustable Powders (DP, DS)
[0179] Five parts by weight of the AHAS-inhibiting herbicide are
ground finely and mixed intimately with 95 parts by weight of
finely divided kaolin. This gives a dustable product having 5%
(w/w) of AHAS-inhibiting herbicide.
[0180] B) Granules (GR, FG, GG, MG)
[0181] One-half part by weight of the AHAS-inhibiting herbicide is
ground finely and associated with 95.5 parts by weight of carriers,
whereby a formulation with 0.5% (w/w) of AHAS-inhibiting herbicide
is obtained. Current methods are extrusion, spray-drying or the
fluidized bed. This gives granules to be applied undiluted for
foliar use.
[0182] Conventional seed treatment formulations include for example
flowable concentrates FS, solutions LS, powders for dry treatment
DS, water dispersible powders for slurry treatment WS,
water-soluble powders SS and emulsion ES and EC and gel formulation
GF. These formulations can be applied to the seed diluted or
undiluted. Application to the seeds is carried out before sowing,
either directly on the seeds.
[0183] In a preferred embodiment a FS formulation is used for seed
treatment. Typcially, a FS formulation may comprise 1-800 g/l of
active ingredient, 1-200 g/l Surfactant, 0 to 200 g/l antifreezing
agent, 0 to 400 g/l of binder, 0 to 200 g/l of a pigment and up to
1 liter of a solvent, preferably water.
[0184] The present invention non-transgenic and transgenic seeds of
the herbicide-resistant plants of the present invention. Such seeds
include, for example, non-transgenic rice seeds comprising the
herbicide-tolerance characteristics of the plant with NCIMB
Accession Number NCIMB 41262, and transgenic seeds comprising a
polynucleotide molecule of the invention that encodes an IMI
protein.
[0185] For seed treatment, seeds of the herbicide resistant plants
according of the present invention are treated with herbicides,
preferably herbicides selected from the group consisting of
AHAS-inhibiting herbicides such as amidosulfuron, azimsulfuron,
bensulfuron, chlorimuron, chlorsulfuron, cinosulfuron,
cyclosulfamuron, ethametsulfuron, ethoxysulfuron, flazasulfuron,
flupyrsulfuron, foramsulfuron, halosulfuron, imazosulfuron,
iodosulfuron, mesosulfuron, metsulfuron, nicosulfuron, oxasulfuron,
primisulfuron, prosulfuron, pyrazosulfuron, rimsulfuron,
sulfometuron, sulfosulfuron, thifensulfuron, triasulfuron,
tribenuron, trifioxysulfuron, triiiusulfuron, tritosulfuron,
imazamethabenz, imazamox, imazapic, imazapyr, imazaquin,
imazethapyr, cloransulam, diclosulam, florasulam, flumetsulam,
metosulam, penoxsulam, bispyribac, pyriminobac, propoxycarbazone,
flucarbazone, pyribenzoxim, pyriftalid, pyrithiobac, and mixtures
thereof, or with a formulation comprising a AHAS-inhibiting
herbicide.
[0186] The term seed treatment comprises all suitable seed
treatment techniques known in the art, such as seed dressing, seed
coating, seed dusting, seed soaking, and seed pelleting.
[0187] In accordance with one variant of the present invention, a
further subject of the invention is a method of treating soil by
the application, in particular into the seed drill: either of a
granular formulation containing the AHAS-inhibiting herbicide as a
composition/formulation (e.g. a granular formulation, with
optionally one or more solid or liquid, agriculturally acceptable
carriers and/or optionally with one or more agriculturally
acceptable surfactants. This method is advantageously employed, for
example, in seedbeds of cereals, maize, cotton, and sunflower.
[0188] The present invention also comprises seeds coated with or
containing with a seed treatment formulation comprising at least
one ALS inhibitor selected from the group consisting of
amidosulfuron, azimsulfuron, bensulfuron, chlorimuron,
chlorsulfuron, cinosulfuron, cyclosulfamuron, ethametsulfuron,
ethoxysulfuron, flazasulfuron, flupyrsulfuron, foramsulfuron,
halosulfuron, imazosulfuron, iodosulfuron, mesosulfuron,
metsulfuron, nicosulfuron, oxasulfuron, primisulfuron, prosulfuron,
pyrazosulfuron, rimsulfuron, sulfometuron, sulfosulfuron,
thifensulfuron, triasulfuron, tribenuron, trifloxysulfuron,
triflusulfuron, tritosulfuron, imazamethabenz, imazamox, imazapic,
imazapyr, imazaquin, imazethapyr, cloransulam, diclosulam,
florasulam, flumetsulam, metosulam, penoxsulam, bispyribac,
pyriminobac, propoxycarbazone, flucarbazone, pyribenzoxim,
pyriflalid and pyrithiobac.
[0189] The term seed embraces seeds and plant propagules of all
kinds including but not limited to true seeds, seed pieces,
suckers, corms, bulbs, fruit, tubers, grains, cuttings, cut shoots
and the like and means in a preferred embodiment true seeds.
[0190] The term "coated with and/or containing" generally signifies
that the active ingredient is for the most part on the surface of
the propagation product at the time of application, although a
greater or lesser part of the ingredient may penetrate into the
propagation product, depending on the method of application. When
the said propagation product is (re)planted, it may absorb the
active ingredient.
[0191] The seed treatment application with the AHAS-inhibiting
herbicide or with a formulation comprising the AHAS-inhibiting
herbicide is carried out by spraying or dusting the seeds before
sowing of the plants and before emergence of the plants.
[0192] In the treatment of seeds, the corresponding formulations
are applied by treating the seeds with an effective amount of the
AHAS-inhibiting herbicide or a formulation comprising the
AHAS-inhibiting herbicide. Herein, the application rates are
generally from 0.1 g to 10 kg of the a.i. (or of the mixture of
a.i. or of the formulation) per 100 kg of seed, preferably from 1 g
to 5 kg per 100 kg of seed, in particular from 1 g to 2.5 kg per
100 kg of seed. For specific crops such as lettuce the rate can be
higher.
[0193] The present invention provides a method for combating
undesired vegetation or controlling weeds comprising contacting the
seeds of the resistant plants according to the present invention
before sowing and/or after pregermination with an AHAS-inhibiting
herbicide. The method can further comprise sowing the seeds, for
example, in soil in a field or in a potting medium in greenhouse.
The method finds particular use in combating undesired vegetation
or controlling weeds in the immediate vicinity of the seed.
[0194] The control of undesired vegetation is understood as meaning
the killing of weeds and/or otherwise retarding or inhibiting the
normal growth of the weeds. Weeds, in the broadest sense, are
understood as meaning all those plants which grow in locations
where they are undesired.
[0195] The weeds of the present invention include, for example,
dicotyledonous and monocotyledonous weeds. Dicotyledonous weeds
include, but are not limited to, weeds of the genera: Sinapis,
Lepidium, Galium, Stellaria, Matricaria, Anthemis, Galinsoga,
Chenopodium, Urtica, Senecio, Amaranthus, Portulaca, Xanthium,
Convolvulus, Ipomoea, Polygonum, Sesbania, Ambrosia, Cirsium,
Carduus, Sonchus, Solanuni, Rorippa, Rotala, Lindernia, Lamiurn,
Veronica, Abutilon, Emex, Datura, Viola, Galeopsis, Papaver,
Centaurea, Trifolium, Ranunculus, and Taraxacum. Monocotyledonous
weeds include, but are not limited to, weeds of the genera:
Echinochloa, Setaria, Panicum, Digitaria, Phleum, Poa, Festuca,
Eleusine, Brachiaria, Lolium, Bromus, Avena, Cyperus, Sorghum,
Agropyron, Cynodon, Monochoria, Fimbristyslis, Sagittaria,
Eleocharis, Scirpus, Paspalum, Ischaemum, Sphenoclea,
Dactyloctenium, Agrostis, Alopecurus, Apera.
[0196] In addition, the weeds of the present invention can include,
for example, crop plants that are growing in an undesired location.
For example, a volunteer maize plant that is in a field that
predominantly comprises soybean plants can be considered as a weed,
if the maize plant is undesired in the field of soybean plants.
[0197] The articles "a" and "an" are used herein to refer to one or
more than one (i.e., to at least one) of the grammatical object of
the article. By way of example, "an element" means one or more
elements.
[0198] As used herein, the word "comprising," or variations such as
"comprises" or "comprising," will be understood to imply the
inclusion of a stated element, integer or step, or group of
elements, integers or steps, but not the exclusion of any other
element, integer or step, or group of elements, integers or
steps.
[0199] The following examples are offered by way of illustration
and not by way of limitation.
Example 1
Production of an Imidazolinone-Resistant Rice Line
[0200] AHASL is a nuclear encoded enzyme and its gene, in different
species, has been sequenced in its wild form and other forms
showing sites of mutation that confer resistance to sulfonylurea
and imidazolinone herbicides. In order to produce rice plants with
herbicide-resistant AHAS enzymes, rice seeds were treated with a
chemical mutagen in an attempt to induce small changes at the
active site of interaction with the herbicide in order to prevent
inhibition. Leading rice varieties and elite rice lines were
selected in order to generate a new mutation that is resistant to
the most active imidazolinones in excellent germplasm. Selection
pressure was based on exposure of four-leaf stage plants to two of
the most active imidazolinone herbicides applied in one application
during several generations until homozygous highly resistant lines
were obtained. The imidazolinone-resistance rice lines were
produced as described below.
[0201] In the late spring of growing season number 1, Two samples
of seeds (600 g each) of the rice cultivar IRGA 417 were treated
with a 0.001 M sodium azide aqueous solution at pH 3 (phosphate
buffer 0.067M). This treatment was applied by soaking each
seed-sample in a two-liter Erlenmeyer containing one liter of the
sodium azide solution, under constant shaking, for 18 hours, at
room temperature. After treatment, the seeds were rinsed in tap
water and, later on, they were partially dried-aerated on blotting
paper sheets in order to extract the moisture from the seeds
surface. Afterwards, treated seeds were directly sown at the field
nursery in Concepcion del Uruguay, E.R., Argentina.
[0202] Treated (M.sub.1) and untreated control seeds of the rice
cultivar IRGA 417 were planting in the field nursery a rate of 50
plants per square meter. The plants were grown under flooding
conditions until maturity (26% grain moisture) and bulk harvested.
No plants of the check lines survived after the treatment. Seeds
(M.sub.2) of the plants were collected and dried in a convector
drier for 14 h at 45.degree. C. They were kept in close storage
until next growing season.
[0203] In the late spring of growing season number 2, M.sub.2 seeds
were planted with an experimental seed planter for large areas at a
rate of 50 kg/ha in at the field nursery in Concepcion del Uruguay,
E. R., Argentina. An area of 3 ha was established comprising a
population of approximately 6.times.10.sup.6 M.sub.2 plants. IRGA
417 (wild type) was also planted as a control. The entire area was
subjected to a selection pressure with a mixture of two
Imidazolinones herbicides. Three separate applications were done
with a commercial sprayer in different directions to prevent any
escape and resulting in a 3.times. treatment. A total volume of 222
L/ha was sprayed at 50 psi, with Teejets 8002 nozzles, in each
application. The rate of the 1.times. treatment was a mixture of
Arsenal.RTM. (Imazapir 75 cc a.i/ha) and Cadre.RTM. (Imazapic 24.85
cc a.i/ha) in a water solution with a non-ionic surfactant
(Citowett) at the rate of 0.25%. The applications were done at the
four leaf-stage of the rice plants. No rainfall was registered
during the 7 days after treatments.
[0204] Observations at regular times were done to survey the entire
herbicide-treated area. At 90 days after the herbicide treatment,
the surviving individuals were labeled and transplanted to the
greenhouse for asexual multiplication and seed production. A total
of 10 individual plants were grown, and the seed was harvested and
dried in a seed incubator for 7 days at 50.degree. C. As expected,
none of the control plants (IRGA 417) survived the herbicide
treatment.
[0205] Seeds (M.sub.3) from selected M.sub.2 plants were planted in
individual pots under greenhouse conditions in Concepcion del
Uruguay, E.R., Argentina during the winter immediately following
the second season. A 2.times. treatment was applied with a backpack
sprayer divided in two applications of IX rate of Arsenal.RTM.
(Imazapir 75 cc a.i/ha) and Cadre.RTM. (Imazapic 24.85 cc a.i/ha)
in a water solution with a non-ionic surfactant (Citowet) at the
rate of 0.25%.
[0206] Tillers from the herbicide-tolerant plants (e.g., plants
that survived herbicide treatments) were grown until maturity (26%
grain moisture) and hand harvested. The harvested seed (M.sub.4)
was subjected to a dormancy breaking treatment of 7 days at
50.degree. C. and prepared for the next growing season planting.
Seeds from two herbicide-tolerant plants were kept separately. The
seeds from were prepared for a late-season planting outdoors at
Concepcion del Uruguay, E.R., Argentina.
[0207] In the summer of growing season number 3, M.sub.4 seeds of
an herbicide-tolerant M.sub.3 plant that was designated as IMINTA
16 were planted with at the rate of 50 kg/ha. A treatment of
2.times. Imidazolinones herbicides, (1.times.) Arsenal.RTM.
(Imazapir 75 cc a.i/ha) and Cadre.RTM. (Imazapic 24.85 cc a.i/ha)
in a water solution with a non-ionic surfactant (Citowet) at the
rate of 0.25% was applied at the four to five leaves stage of the
rice plants. No phytotoxic symptoms were observed for plants of the
IMINTA 16 line. No wild-type segregants (i.e., not tolerant to the
herbicide treatment) were observed, and a highly homogenous
population in agronomic and tolerance traits had been produced.
Individual IMINTA 16 plants were transplanted into the greenhouse
for seed production, and seeds (M.sub.5) were harvested later that
year.
Example 2
An Imidazoline-Resistant Rice Line with Mutations in the AHASL1
Genes
[0208] Genomic DNA was separately extracted from leaves of
greenhouse-grown seedlings of the IMINTA 16 line described in
Example 1 above and the AHASL1 gene was amplified by a polymerase
chain reaction (PCR) method using the primers described below. The
resulting products of the individual PCR amplifications were
sequenced using standard methods.
[0209] The primers used for PCR and sequencing are provided in
Table 1. The primers were selected manually by visual inspection of
the publicly known rice sequences for Oryza sativa `Kinmaze`, Oryza
sativa japonica and Oryza sativa indica. The primers were nested
approximately every 400-500 bp along the approximately 2000 bp of
the AHAS gene. Several primers were designed for each 500 bp
stretch to maximize the likelihood of success of amplification. No
weight was given to conserved regions when choosing primers. The
primer sequences were checked for hairpins and dimers via the
website www.rnature.com/oligonucleotide.html. Because there are no
introns present in the AHASL1 gene, the entire gene represents
coding sequence, and is therefore conserved. Primers were designed
to have a GC content close to 50% and similar melting temperatures,
approximately 54-58.degree. C. The primer names in Table 1 reflect
the exact starting base position according to public AHASL1
nucleotide sequences for rice (GenBank Accession No. AB049822).
U136851 refers to a region upstream of the start codon in the AHAS
gene and was designed from a BAC clone (OSJNBa0053B21), accession
no. AL731599.
TABLE-US-00001 TABLE 1 Primers for PCR Amplification and DNA
Sequencing of the Rice AHASL1 Gene in IMINTA 16 Melting GC Primer
Temp. content Name Sequence 5' to 3' (.degree. C.) (%) Pair 1
U136851 GACATATGGGGCCCACTGT (SEQ ID NO: 4) 58.8 58 L789
GTAGATTCATCGAGGTGTC (SEQ ID NO: 5) 54.5 47.4 Pair 2 U642*
GTCCTTGATGTGGAGGACAT (SEQ ID NO: 6) 57.3 50 L1369
CATATTGCGGTGGGATCTCT (SEQ ID NO: 7) 57.3 50 Pair 3 U1229
GGGCTTGAATGCTCTGCTAC (SEQ ID NO: 8) 59.4 55 L1742
CGGGTTGCCCAAGTATGTAT (SEQ ID NO: 9) 57.3 50 Pair 4 U1633
ACCTCCCTGTGAAGGTGATG (SEQ ID NO: 10) 59.4 55 L2155*
AGGATTACCATGCCAAGCAC (SEQ ID NO: 11) 57.3 50 Alternate PCR primers
and sequencing primers U037 CACCACCCACCATGGCTA (SEQ ID NO: 12) 58.2
61.1 U114 GTAAGAACCACCAGCGAC (SEQ ID NO: 13) 56 55.6 U1109
GTGGATAAGGCTGACCTGT (SEQ ID NO: 14) 56.7 52.6 U1166
GGGAAAATTGAGGCTTTTGCA (SEQ ID NO: 15) 55.9 42.9 L1299
CTCATTGTGCCATGCACTAA (SEQ ID NO: 16) 55.3 45 U1721
GCATACATACTTGGGCAAC (SEQ ID NO: 17) 54 47 L2054
CATACCACTCTTTATGGGTC (SEQ ID NO: 18) 52 45 *Also used U642 and
L2155 as a PCR pair
[0210] When the PCR-amplified genomic DNA from the IMINTA 16
seedlings was examined, a single base change (i.e., transition, C
to T) was identified in the coding region of the gene that caused
an amino acid substitution in the AHASL1 protein at amino acid
position 179 from Ala in the wild type line to Val in the IMINTA 16
line. The site of this substitution corresponds to position 205 in
the Arabidopsis thaliana AHASL protein (see, Table 2 below). The
Ala205Val substitution in the Arabidopsis thaliana AHASL protein is
known to confer on plants that express this protein tolerance to
imidazolinone herbicides.
Example 3
Herbicide-Resistant Rice AHASL1 Proteins
[0211] The present invention discloses both the nucleotide and
amino acid sequences for herbicide resistant rice AHASL1
polypeptides. Plants comprising herbicide-resistant AHASL1
polypeptides have been previously identified, and a number of
conserved regions of AHASL1 polypeptides that are the sites of
amino acids substitutions that confer herbicide resistance have
been described. See, Devine and Eberlein (1997) "Physiological,
biochemical and molecular aspects of herbicide resistance based on
altered target sites". In: Herbicide Activity: Toxicology,
Biochemistry and Molecular Biology, Roe et al. (eds.), pp. 159-185,
IOS Press, Amsterdam; and Devine and Shukla, (2000) Crop Protection
19:881-889.
[0212] Using the AHASL1 sequences of the invention and methods
known to those of ordinary skill in art, one can produce additional
polynucleotides encoding herbicide resistant AHASL1 polypeptides
having one, two, three, or more amino acid substitutions at the
identified sites in these conserved regions. Table 2 provides the
conserved regions of AHASL1 proteins, the amino acid substitutions
known to confer herbicide resistance within these conserved
regions, and the corresponding amino acids in the rice AHASL1
proteins set forth in SEQ ID NO:2.
TABLE-US-00002 TABLE 2 Amino Acid Substitutions in Conserved
Regions of AHASL Polypeptides that are Known to Confer
Herbicide-Resistance and their Equivalent Position in Rice AHASL1
Polypeptides Amino acid Conserved region.sup.1 Mutation.sup.2
Reference position in rice VFAYPGGASMEIHQALTRS.sup.3 Ala.sub.122 to
Thr Bernasconi et al..sup.4 Ala.sub.96 (SEQ ID NO: 19)
AITGQVPRRMIGT.sup.3 Pro.sub.197 to Ala Boutsalis et al..sup.5
Pro.sub.171.sup.12 (SEQ ID NO: 20) Pro.sub.197 to Thr Guttieri et
al..sup.6 Pro.sub.197 to His Guttieri et al..sup.7 Pro.sub.197 to
Leu Guttieri at al..sup.6 Pro.sub.197 to Arg Guttieri et al..sup.6
Pro.sub.197 to Ile Boutsalis et al..sup.5 Pro.sub.197 to Gln
Guttieri et al..sup.6 Pro.sub.197 to Ser Guttieri at al..sup.6
AFQETP.sup.3 Ala.sub.205 to Asp Hartnett et al..sup.8
A1a.sub.179.sup.13 (SEQ ID NO: 21) Ala.sub.205 to Val.sup.11
Simpson.sup.9 QWED.sup.3 Trp.sub.574 to Leu Bruniard.sup.10
Trp.sub.548 (SEQ ID NO: 22) Boutsalis et al..sup.5 IPSGG.sup.3
Ser.sub.653 to Asn Chang & Ser.sub.627 (SEQ ID NO: 23)
Duggleby.sup.12 Ser.sub.653 to Thr Lee et al..sup.13 Ser.sub.653 to
Phe .sup.1Conserved regions from Devine and Eberlein (1997)
"Physiological, biochemical and molecular aspects of herbicide
resistance based on altered target sites". In: Herbicide Activity:
Toxicology, Biochemistry and Molecular Biology, Roe et al. (eds.),
pp. 159-185, IOS Press, Amsterdam and Devine and Shukla, (2000)
Crop Protection 19:881-889. .sup.2Amino acid numbering corresponds
to the amino acid sequence of the Arabidopsis thaliana AHASL
polypeptide. .sup.3The rice AHASL1 proteins of the invention (SEQ
ID NO: 2) have the same conserved regions. .sup.4Bernasconi et al.
(1995) J. Biol. Chem. 270(29):17381-17385. .sup.5Boutsalis et al.
(1999) Pestic. Sci. 55:507-516. .sup.6Guttieri et al. (1995) Weed
Sci. 43:143-178. .sup.7Guttieri et al. (1992) Weed Sci. 40:670-678.
.sup.8Hartnett et al. (1990) "Herbicide-resistant plants carrying
mutated acetolactate synthase genes," In: Managing Resistance to
Agrochemicals: Fundamental Research to Practical Strategies, Green
et al. (eds.), American Chemical Soc. Symp., Series No. 421,
Washington, DC, USA .sup.9Simpson (1998) Down to Earth 53(1):26-35.
.sup.10Bruniard (2001) Inheritance of imidazolinone resistance,
characterization of cross-resistance pattern, and identification of
molecular markers in sunflower (Helianthus annuus L.). Ph.D.
Thesis, North Dakota State University, Fargo, ND, USA, pp 1-78.
.sup.11The present invention discloses the amino acid sequence of a
herbicide-resistant rice AHASL1 protein with the Ala.sub.179 to Val
substitution (SEQ ID NO: 2) and a polynucleotide sequences encoding
this herbicide resistant AHASL1 (SEQ ID NOS: 1 and 3). .sup.12Chang
and Duggleby (1998) Biochem J. 333:765-777. .sup.13Lee et al.
(1999) FEES Lett. 452:341-345.
[0213] All publications and patent applications mentioned in the
specification are indicative of the level of those skilled in the
art to which this invention pertains. All publications and patent
applications are herein incorporated by reference to the same
extent as if each individual publication or patent application was
specifically and individually indicated to be incorporated by
reference.
[0214] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be obvious that certain changes and
modifications may be practiced within the scope of the appended
claims.
Sequence CWU 1
1
2311961DNAOryza sativa 1cccaccatgg ctacgaccgc cgcggccgcg gccgccacct
tgtccgccgc cgcgacggcc 60aagaccggcc gtaagaacca ccagcgacac cacgtctttc
ccgctcgagg ccgggtgggg 120gcggcggcgg tcaggtgctc ggcggtgtcc
ccggtcaccc cgccgtcccc ggcgccgccg 180gccacgccgc tccggccgtg
ggggccggcc gagccccgca agggcgcgga catcctcgtg 240gaggcgctgg
agcggtgcgg cgtcagcgac gtgttcgcct acccgggcgg cgcgtccatg
300gagatccacc aggcgctgac gcgctccccg gtcatcacca accacctctt
ccgccacgag 360cagggcgagg cgttcgcggc gtccgggtac gcgcgcgcgt
ccggccgcgt cggggtctgc 420gtcgccacct ccggccccgg ggcaaccaac
ctcgtgtccg cgctcgccga cgcgctgctc 480gactccgtcc cgatggtcgc
catcacgggc caggtccccc gccgcatgat cggcaccgac 540gtcttccagg
agacgcccat agtcgaggtc acccgctcca tcaccaagca caattacctt
600gtccttgatg tggaggacat cccccgcgtc atacaggaag ccttcttcct
cgcgtcctcg 660ggccgtcctg gcccggtgct ggtcgacatc cccaaggaca
tccagcagca gatggctgtg 720ccagtctggg acacctcgat gaatctaccg
gggtacattg cacgcctgcc caagccaccc 780gcgacagaat tgcttgagca
ggtcttgcgt ctggttggcg agtcacggcg cccgattctc 840tatgtcggtg
gtggctgctc tgcatctggt gatgaattgc gccggtttgt tgagctgacc
900ggcatcccag ttacaaccac tctgatgggc ctcggcaatt tccccagtga
tgatccgttg 960tccctgcgca tgcttgggat gcatggcacg gtgtacgcaa
attatgcggt ggataaggct 1020gacctgttgc ttgcatttgg cgtgcggttt
gatgatcgtg tgacagggaa aattgaggct 1080tttgcaagca gggccaagat
tgtgcacatt gacattgatc cagcggagat tggaaagaac 1140aagcaaccac
atgtgtcaat ttgcgcagat gttaagcttg ctttacaggg cttgaatgct
1200ctgctagacc agagcacaac aaagacaagt tctgatttta gtgcgtggca
caatgagttg 1260gaccagcaga agagggagtt tcctctgggg tacaagactt
ttggtgaaga gatcccaccg 1320caatatgcta ttcaggtgct ggatgagctg
acgaaagggg aggcaatcat cgctactggt 1380gttggacagc accagatgtg
ggcggcacaa tattacacct acaagcggcc acggcagtgg 1440ctgtcttcgg
ctggtctggg cgcaatggga tttgggctgc ctgctgcagc tggtgcttct
1500gtggctaacc caggtgtcac agttgttgat attgatgggg atggtagctt
cctcatgaac 1560attcaggagt tggcattgat ccgcattgag aacctcccgg
tgaaggtgat ggtgttgaac 1620aaccaacatt tgggtatggt tgtgcaatgg
gaggataggt tttacaaggc aaatagggcg 1680catacatact tgggcaaccc
agaatgtgag agtgagatat atccagattt tgtgactatt 1740gctaaagggt
tcaatattcc tgcagtccgt gtaacaaaga agagtgaagt ccgtgccgcc
1800atcaagaaga tgctcgatac cccagggcca tacttgttgg atatcatcgt
cccacaccag 1860gagcatgtgc tgcctatgat cccaagtggg ggcgcattca
aggacatgat cctggatggt 1920gatggcagga ctgtgtatta atctataatc
tgtatgttgg c 19612644PRTOryza sativa 2Met Ala Thr Thr Ala Ala Ala
Ala Ala Ala Thr Leu Ser Ala Ala Ala1 5 10 15Thr Ala Lys Thr Gly Arg
Lys Asn His Gln Arg His His Val Phe Pro 20 25 30Ala Arg Gly Arg Val
Gly Ala Ala Ala Val Arg Cys Ser Ala Val Ser 35 40 45Pro Val Thr Pro
Pro Ser Pro Ala Pro Pro Ala Thr Pro Leu Arg Pro 50 55 60Trp Gly Pro
Ala Glu Pro Arg Lys Gly Ala Asp Ile Leu Val Glu Ala65 70 75 80Leu
Glu Arg Cys Gly Val Ser Asp Val Phe Ala Tyr Pro Gly Gly Ala 85 90
95Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser Pro Val Ile Thr Asn
100 105 110His Leu Phe Arg His Glu Gln Gly Glu Ala Phe Ala Ala Ser
Gly Tyr 115 120 125Ala Arg Ala Ser Gly Arg Val Gly Val Cys Val Ala
Thr Ser Gly Pro 130 135 140Gly Ala Thr Asn Leu Val Ser Ala Leu Ala
Asp Ala Leu Leu Asp Ser145 150 155 160Val Pro Met Val Ala Ile Thr
Gly Gln Val Pro Arg Arg Met Ile Gly 165 170 175Thr Asp Val Phe Gln
Glu Thr Pro Ile Val Glu Val Thr Arg Ser Ile 180 185 190Thr Lys His
Asn Tyr Leu Val Leu Asp Val Glu Asp Ile Pro Arg Val 195 200 205Ile
Gln Glu Ala Phe Phe Leu Ala Ser Ser Gly Arg Pro Gly Pro Val 210 215
220Leu Val Asp Ile Pro Lys Asp Ile Gln Gln Gln Met Ala Val Pro
Val225 230 235 240Trp Asp Thr Ser Met Asn Leu Pro Gly Tyr Ile Ala
Arg Leu Pro Lys 245 250 255Pro Pro Ala Thr Glu Leu Leu Glu Gln Val
Leu Arg Leu Val Gly Glu 260 265 270Ser Arg Arg Pro Ile Leu Tyr Val
Gly Gly Gly Cys Ser Ala Ser Gly 275 280 285Asp Glu Leu Arg Arg Phe
Val Glu Leu Thr Gly Ile Pro Val Thr Thr 290 295 300Thr Leu Met Gly
Leu Gly Asn Phe Pro Ser Asp Asp Pro Leu Ser Leu305 310 315 320Arg
Met Leu Gly Met His Gly Thr Val Tyr Ala Asn Tyr Ala Val Asp 325 330
335Lys Ala Asp Leu Leu Leu Ala Phe Gly Val Arg Phe Asp Asp Arg Val
340 345 350Thr Gly Lys Ile Glu Ala Phe Ala Ser Arg Ala Lys Ile Val
His Ile 355 360 365Asp Ile Asp Pro Ala Glu Ile Gly Lys Asn Lys Gln
Pro His Val Ser 370 375 380Ile Cys Ala Asp Val Lys Leu Ala Leu Gln
Gly Leu Asn Ala Leu Leu385 390 395 400Asp Gln Ser Thr Thr Lys Thr
Ser Ser Asp Phe Ser Ala Trp His Asn 405 410 415Glu Leu Asp Gln Gln
Lys Arg Glu Phe Pro Leu Gly Tyr Lys Thr Phe 420 425 430Gly Glu Glu
Ile Pro Pro Gln Tyr Ala Ile Gln Val Leu Asp Glu Leu 435 440 445Thr
Lys Gly Glu Ala Ile Ile Ala Thr Gly Val Gly Gln His Gln Met 450 455
460Trp Ala Ala Gln Tyr Tyr Thr Tyr Lys Arg Pro Arg Gln Trp Leu
Ser465 470 475 480Ser Ala Gly Leu Gly Ala Met Gly Phe Gly Leu Pro
Ala Ala Ala Gly 485 490 495Ala Ser Val Ala Asn Pro Gly Val Thr Val
Val Asp Ile Asp Gly Asp 500 505 510Gly Ser Phe Leu Met Asn Ile Gln
Glu Leu Ala Leu Ile Arg Ile Glu 515 520 525Asn Leu Pro Val Lys Val
Met Val Leu Asn Asn Gln His Leu Gly Met 530 535 540Val Val Gln Trp
Glu Asp Arg Phe Tyr Lys Ala Asn Arg Ala His Thr545 550 555 560Tyr
Leu Gly Asn Pro Glu Cys Glu Ser Glu Ile Tyr Pro Asp Phe Val 565 570
575Thr Ile Ala Lys Gly Phe Asn Ile Pro Ala Val Arg Val Thr Lys Lys
580 585 590Ser Glu Val Arg Ala Ala Ile Lys Lys Met Leu Asp Thr Pro
Gly Pro 595 600 605Tyr Leu Leu Asp Ile Ile Val Pro His Gln Glu His
Val Leu Pro Met 610 615 620Ile Pro Ser Gly Gly Ala Phe Lys Asp Met
Ile Leu Asp Gly Asp Gly625 630 635 640Arg Thr Val Tyr31932DNAOryza
sativa 3atggctacga ccgccgcggc cgcggccgcc accttgtccg ccgccgcgac
ggccaagacc 60ggccgtaaga accaccagcg acaccacgtc tttcccgctc gaggccgggt
gggggcggcg 120gcggtcaggt gctcggcggt gtccccggtc accccgccgt
ccccggcgcc gccggccacg 180ccgctccggc cgtgggggcc ggccgagccc
cgcaagggcg cggacatcct cgtggaggcg 240ctggagcggt gcggcgtcag
cgacgtgttc gcctacccgg gcggcgcgtc catggagatc 300caccaggcgc
tgacgcgctc cccggtcatc accaaccacc tcttccgcca cgagcagggc
360gaggcgttcg cggcgtccgg gtacgcgcgc gcgtccggcc gcgtcggggt
ctgcgtcgcc 420acctccggcc ccggggcaac caacctcgtg tccgcgctcg
ccgacgcgct gctcgactcc 480gtcccgatgg tcgccatcac gggccaggtc
ccccgccgca tgatcggcac cgacgtcttc 540caggagacgc ccatagtcga
ggtcacccgc tccatcacca agcacaatta ccttgtcctt 600gatgtggagg
acatcccccg cgtcatacag gaagccttct tcctcgcgtc ctcgggccgt
660cctggcccgg tgctggtcga catccccaag gacatccagc agcagatggc
tgtgccagtc 720tgggacacct cgatgaatct accggggtac attgcacgcc
tgcccaagcc acccgcgaca 780gaattgcttg agcaggtctt gcgtctggtt
ggcgagtcac ggcgcccgat tctctatgtc 840ggtggtggct gctctgcatc
tggtgatgaa ttgcgccggt ttgttgagct gaccggcatc 900ccagttacaa
ccactctgat gggcctcggc aatttcccca gtgatgatcc gttgtccctg
960cgcatgcttg ggatgcatgg cacggtgtac gcaaattatg cggtggataa
ggctgacctg 1020ttgcttgcat ttggcgtgcg gtttgatgat cgtgtgacag
ggaaaattga ggcttttgca 1080agcagggcca agattgtgca cattgacatt
gatccagcgg agattggaaa gaacaagcaa 1140ccacatgtgt caatttgcgc
agatgttaag cttgctttac agggcttgaa tgctctgcta 1200gaccagagca
caacaaagac aagttctgat tttagtgcgt ggcacaatga gttggaccag
1260cagaagaggg agtttcctct ggggtacaag acttttggtg aagagatccc
accgcaatat 1320gctattcagg tgctggatga gctgacgaaa ggggaggcaa
tcatcgctac tggtgttgga 1380cagcaccaga tgtgggcggc acaatattac
acctacaagc ggccacggca gtggctgtct 1440tcggctggtc tgggcgcaat
gggatttggg ctgcctgctg cagctggtgc ttctgtggct 1500aacccaggtg
tcacagttgt tgatattgat ggggatggta gcttcctcat gaacattcag
1560gagttggcat tgatccgcat tgagaacctc ccggtgaagg tgatggtgtt
gaacaaccaa 1620catttgggta tggttgtgca atgggaggat aggttttaca
aggcaaatag ggcgcataca 1680tacttgggca acccagaatg tgagagtgag
atatatccag attttgtgac tattgctaaa 1740gggttcaata ttcctgcagt
ccgtgtaaca aagaagagtg aagtccgtgc cgccatcaag 1800aagatgctcg
ataccccagg gccatacttg ttggatatca tcgtcccaca ccaggagcat
1860gtgctgccta tgatcccaag tgggggcgca ttcaaggaca tgatcctgga
tggtgatggc 1920aggactgtgt at 1932419DNAArtificial SequencePCR
amplification and sequencing primer U136851 4gacatatggg gcccactgt
19519DNAArtificial SequencePCR amplification and sequencing primer
L789 5gtagattcat cgaggtgtc 19620DNAArtificial SequencePCR
amplification and sequencing primer U642 6gtccttgatg tggaggacat
20720DNAArtificial SequencePCR amplification and sequencing primer
L1369 7catattgcgg tgggatctct 20820DNAArtificial SequencePCR
amplification and sequencing primer U1229 8gggcttgaat gctctgctac
20920DNAArtificial SequencePCR amplification and sequencing primer
L1742 9cgggttgccc aagtatgtat 201020DNAArtificial SequencePCR
amplification and sequencing primer U1633 10acctccctgt gaaggtgatg
201120DNAArtificial SequencePCR amplification and sequencing primer
L2155 11aggattacca tgccaagcac 201218DNAArtificial SequencePCR
amplification and sequencing primer U037 12caccacccac catggcta
181318DNAArtificial SequencePCR amplification and sequencing primer
U114 13gtaagaacca ccagcgac 181419DNAArtificial SequencePCR
amplification and sequencing primer U1109 14gtggataagg ctgacctgt
191521DNAArtificial SequencePCR amplification and sequencing primer
U1166 15gggaaaattg aggcttttgc a 211620DNAArtificial SequencePCR
amplification and sequencing primer L1299 16ctcattgtgc catgcactaa
201719DNAArtificial SequencePCR amplification and sequencing primer
U1721 17gcatacatac ttgggcaac 191820DNAArtificial SequencePCR
amplification and sequencing primer L2054 18cataccactc tttatgggtc
201919PRTArtificial SequenceConserved region 19Val Phe Ala Tyr Pro
Gly Gly Ala Ser Met Glu Ile His Gln Ala Leu1 5 10 15Thr Arg
Ser2013PRTArtificial SequenceConserved region 20Ala Ile Thr Gly Gln
Val Pro Arg Arg Met Ile Gly Thr1 5 10216PRTArtificial
SequenceConserved region 21Ala Phe Gln Glu Thr Pro1
5224PRTArtificial SequenceConserved region 22Gln Trp Glu
Asp1235PRTArtificial SequenceConserved region 23Ile Pro Ser Gly
Gly1 5
* * * * *
References