U.S. patent application number 13/448820 was filed with the patent office on 2012-08-30 for methods and compositions for targeting gc1qr/p32.
This patent application is currently assigned to Sanford -Burnham Medical Research Institute. Invention is credited to Valentina Fogal, Erkki Ruoslahti.
Application Number | 20120219502 13/448820 |
Document ID | / |
Family ID | 39690654 |
Filed Date | 2012-08-30 |
United States Patent
Application |
20120219502 |
Kind Code |
A1 |
Ruoslahti; Erkki ; et
al. |
August 30, 2012 |
METHODS AND COMPOSITIONS FOR TARGETING GC1QR/P32
Abstract
Disclosed are compositions and methods useful for targeting
gC1q/p32 receptors. The disclosed targeting is useful for
delivering therapeutic and detectable agents to cancerous cells,
and to areas of inflammation.
Inventors: |
Ruoslahti; Erkki; (La Jolla,
CA) ; Fogal; Valentina; (La Jolla, CA) |
Assignee: |
Sanford -Burnham Medical Research
Institute
|
Family ID: |
39690654 |
Appl. No.: |
13/448820 |
Filed: |
April 17, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11777382 |
Jul 13, 2007 |
8178104 |
|
|
13448820 |
|
|
|
|
60807255 |
Jul 13, 2006 |
|
|
|
Current U.S.
Class: |
424/9.1 ;
424/174.1; 435/5; 435/6.1; 435/7.23; 514/19.3; 514/44A |
Current CPC
Class: |
G01N 2333/4716 20130101;
C07K 2317/76 20130101; A61P 43/00 20180101; A61K 38/08 20130101;
A61P 35/00 20180101; C07K 16/30 20130101; G01N 33/574 20130101 |
Class at
Publication: |
424/9.1 ;
435/7.23; 435/6.1; 435/5; 424/174.1; 514/44.A; 514/19.3 |
International
Class: |
G01N 33/574 20060101
G01N033/574; C12Q 1/70 20060101 C12Q001/70; A61K 38/02 20060101
A61K038/02; A61K 39/395 20060101 A61K039/395; A61P 35/00 20060101
A61P035/00; A61K 31/713 20060101 A61K031/713; C12Q 1/68 20060101
C12Q001/68; A61K 49/00 20060101 A61K049/00 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with government support under NIH
grants PO1 CA 82713, and RO1 CA115410; and Cancer Center support
grant P30 CA 30199; as well as Department of Defense grant DAMD
17-02-1-0315. The government has certain rights in the invention.
Claims
1-6. (canceled)
7. A method of detecting the presence of gC1q/p32 receptor, the
method comprising a. bringing into contact a cell and a Lyp-1
composition, wherein the Lyp-1 composition comprises a moiety
linked to a composition comprising SEQ ID NO:1; and b. detecting
interaction between gC1q/p32 receptor and the Lyp-1 composition,
thereby detecting the presence of gC1q/p32 receptor.
8. The method of claim 7, wherein the moiety is a detectable agent,
a polypeptide, a nucleic acid molecule, or a small molecule.
9. The method of claim 7, wherein the Lyp-1 composition comprises a
virus.
10. The method of claim 7, wherein the Lyp-1 composition comprises
a phage.
11. The method of claim 8, wherein the detectable agent is a small
molecule, a fluorophore, fluorescein, rhodamine, a radionuclide,
indium-111, technetium-99, carbon-11, carbon-13, or a combination
thereof.
12. A method of detecting interaction between a gC1q/p32 receptor
and a Lyp-1 composition, wherein the Lyp-1 composition comprises a
moiety linked to a composition comprising SEQ ID NO:1, the method
comprising: a. selecting a cell for its potential to comprise a
gC1q/p32 receptor; b. bringing into contact the Lyp-1 composition
and the cell; and c. detecting interaction between the gC1q/p32
receptor and the Lyp-1 composition.
13. The method of claim 12, wherein the moiety is a detectable
agent.
14. The method of claim 12, wherein the moiety is a polypeptide, a
nucleic acid molecule, a small molecule, a fluorophore,
fluorescein, rhodamine, a radionuclide, indium-111, technetium-99,
carbon-11, carbon-13, or a combination thereof.
15-17. (canceled)
18. A method of assessing gC1q/p32 receptor level in a cell of a
subject, comprising: a. bringing into contact a cell of the subject
and a Lyp-1 composition comprising a detectable agent linked to a
composition comprising SEQ ID NO:1; and b. detecting the level of
Lyp-1 composition interacting with gC1q/p32 receptor, thereby
assessing gC1q/p32 receptor level in the cell.
19. The method of claim 18, wherein the level of gC1q/p32 receptor
in the subject is compared to a previous measurement in the same
subject.
20. The method of claim 18, wherein the level of gC1q/p32 receptor
in the subject is compared to a control level or standard
level.
21. A method of identifying a subject having a disease associated
with gC1q/p32 receptor, the method comprising a. bringing into
contact a cell of the subject and a Lyp-1 composition, wherein the
Lyp-1 composition comprises a moiety linked to a composition
comprising SEQ ID NO:1; and b. detecting interaction between
gC1q/p32 receptor and the Lyp-1 composition, thereby detecting the
presence or level of gC1q/p32, wherein the presence or level of
gC1q/p32 receptor identifies the subject as having a disease
associated with a gC1q/p32 receptor.
22. The method of claim 21, wherein the disease is cancer.
23. The method of claim 21, wherein the cell is a cancerous
cell.
24. A method of screening for a compound that interacts with a
gC1q/p32 receptor, comprising: a. bringing into contact a test
compound, a Lyp-1 composition, and a gC1q/p32 receptor, wherein the
Lyp-1 composition comprises SEQ ID NO:1; and b. detecting unbound
Lyp-1 composition, wherein a given amount of unbound Lyp-1
composition indicates a compound that interacts with gC1q/p32
receptor.
25. The method of claim 24, wherein the Lyp-1 composition further
comprises a moiety linked to a composition comprising SEQ ID
NO:1.
26. The method of claim 25, wherein the moiety further comprises a
detectable agent.
27-28. (canceled)
29. The method of claim 12, wherein the cell is in an organism, in
a subject, in situ, ex vivo, in culture, or in vitro.
30. (canceled)
31. A method, the method comprising administering to the subject a
composition that modulates gC1q/p32 receptor expression or
activity, wherein the subject has cancer cells having an elevated
level of gC1q/p32 receptor compared with non-cancerous cells in the
subject. {*page 20, lines 22-29, page 67, lines 28-30, and page 68,
lines 4-10*}
32. The method of claim 31, wherein the disease is cancer.
33. The method of claim 31, wherein expression or activity of the
gC1q/p32 receptor is inhibited.
34. The method of claim 33, wherein expression of the gC1q/p32
receptor is inhibited using an interfering nucleic acid.
35. The method of claim 34, wherein the interfering nucleic acid is
siRNA.
36. The method of claim 33, wherein the activity of the gC1q/p32
receptor is inhibited by a LyP-1 peptide, an antibody, or a small
molecule mimic of Lyp-1.
37. The method of claim 18, wherein the cell is in an organism, in
a subject, in situ, ex vivo, in culture, or in vitro.
38. The method of claim 21, wherein the cell is in an organism, in
a subject, in situ, ex vivo, in culture, or in vitro.
39. The method of claim 24, wherein the cell is in an organism, in
a subject, in situ, ex vivo, in culture, or in vitro.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of copending prior U.S.
application Ser. No. 11/777,382, filed Jul. 13, 2007, entitled
"Methods and Compositions For Treating GC1QR/P32," by Erkki
Ruoslahti and Valentina Fogal, which claims benefit of U.S.
Provisional Application No. 60/807,255, filed Jul. 13, 2006, both
of which are herein incorporated in their entirety by
reference.
REFERENCE TO SEQUENCE LISTING
[0003] The Sequence Listing submitted Apr. 16, 2012, as a text file
named "SBMRI.sub.--20.sub.--8403_MIC_AFD_Sequence_Listing.txt,"
created on Apr. 12, 2012, and having a size of 3,212 bytes is
hereby incorporated by reference.
FIELD OF THE INVENTION
[0004] The present invention relates generally to the fields of
molecular medicine and cancer biology and, more specifically, to
molecules that interact with the gC1q/p32 receptor.
BACKGROUND OF THE INVENTION
[0005] C1q is a component of the CI complex of the classical
complement pathway (R. B. Sim and K. B. M. Reid, Immunology Today
1991; 12:307-311). The biological functions of C1q are diverse,
including initiation of the complement cascade for opsonization and
cytolysis, and mediation of several different functions depending
on the cell types expressing the C1q receptor. C1q enhances FcR and
CR1-mediated phagocytosis in monocytes/macrophages (D. A. Bobak et
al., Eur. J. Immunol. 1988; 18:2001-2007; D. A. Bobak et al., J.
Immunol. 1987; 138:1150-1156), stimulates immunoglobulin production
by B cells (K. R. Young et al., J. Immunol. 1991; 146:3356-3364),
activates platelets to express .alpha.IIb/.beta.3 integrins,
P-selectin, and procoagulant activity (E. I. B. Peerschke et al.,
J. Exp. Med. 1993; 178:579-587; E. I. B. Peerschke et al., J.
Immunol. 1994; 152:5896-5901), activates tumor cytotoxicity of
macrophages (R. W. Leu et al., J. Immunol. 1990; 144:2281-2286),
exerts anti-proliferative effects on T cell growth (A. Chen et al.,
J. Immunol. 1994; 153:1430-1440), and serves as a receptor for the
Listeria monocytogenes invasion protein InIB Braun et al., EMBO J,
2000; 19: 1458-1466).
[0006] A 33 kilodalton (kD) receptor, designated gC1qR/p32 (and
alternatively referred to as p32, and referred to herein as
gC1qR/p32), which binds to the globular head of C1q molecules has
been identified, cloned and sequenced (B. Ghebrehiwet et al., J.
Exp. Med. 1994; 179:1809-1821; E. I. B. Peerschke et al., J.
Immunol. 1994; 152:5896-5901; A. Chen et al., J. Immunol. 1994;
153: 1430-1440). The crystal structure of gC1qR/p32 has also been
solved (Jiang et al. PNAS, 1999; 96, 3572-3577). Another 60 kD
receptor, designated cC1qR, binds to the amino-terminal
collagen-like region of C1q (B. Ghebrehiwet, Behring Inst. Mitt.
1989; 84:204-215; A. Chen et al., J. Immunol. 1994; 153:1430-1440).
Based on the detection of gC1q-R mRNA by polymerase chain reaction
(PCR) amplification and gC1q-R protein expression by immunochemical
methods, this receptor was found to exist on a large number of
different cell types, e.g. B cells, T cells, monocytes/macrophages,
neutrophils, eosinophils, fibroblasts, platelets, endothelial
cells, liver cells, neural cells and smooth muscle cells. The
gC1q-R protein is over-expressed in tumor cells and tumors
(Rubinstein et al., Int J Cancer, 2004; 110: 741-750).
[0007] The endothelial lining of blood vessels is highly
diversified. Many, and perhaps all, normal tissues impart a
tissue-specific "signature" on their vasculature, and tumor vessels
differ from normal vessels both in morphology and molecular
composition (Ruoslahti E. Specialization of tumor vasculature. Nat
Rev Cancer 2002; 2:83-90). Tumors induce angiogenesis to support
expansive growth (Hanahan D, Weinberg R A. The hallmarks of cancer.
Cell 2000; 100:57-70) and many of the changes in tumor vessels are
angiogenesis related (Brooks P G et al. J Reprod Med 1994;
39:755-60; Christian et al. J Cell Biol 2003; 163:871-8; Ferrara et
al. Nat Med 1999; 5: 1359-64; Pasqualini et al Cancer Res 2000; 60:
722-7). Moreover, tumor blood vessels have tumor type-specific and,
in some stages, stage-specific characteristics; in vivo screening
of phage libraries has yielded distinct sets of homing peptides
selectively recognizing angiogenic signatures in two transgenic
mouse models of organ-specific tumorigenesis. Homing peptides can
also distinguish the angiogenic blood vessels of premalignant
lesions from those of fully malignant lesions in the same tumor.
Lymphatic vessels in tumors also carry specific markers that
distinguish tumor lymphatics from lymphatics in normal tissues
(Laakkonen et al., Nat Med 2002; 8: 751-755; Laakkonen et al., Proc
Natl Acad Sci USA, 2004; 101: 9381-9386: Zhang et al., Cancer Res,
2006; 66: 5696-9706). Tumor blood vessels and lymphatics provide
important targets for tumor therapy. Destroying tumor blood vessels
or preventing their growth suppresses tumor growth, whereas tumor
lymphatics are not essential for tumor growth, but destroying them
reduces metastasis (Saharinen et al. Trends Immunol 2004;
25:387-95).
[0008] The elevated expression of gC1qR/p32 in tumors and the
findings reported here show there is a need for new therapeutic
strategies for selectively targeting gC1q receptors (gC1qR,
alternatively referred to in the art and herein as p32, and
throughout as gC1qR/p32). The present invention satisfies this need
by providing molecules that selectively interact with gC1qR/p32,
and which are suitable for selectively targeting chemotherapeutic
drugs, gene therapy vectors or other agents to the appropriate
tissue. Related advantages also are provided.
BRIEF SUMMARY OF THE INVENTION
[0009] Disclosed herein are methods of treating a disease
associated with gC1q/p32 receptor comprising identifying a subject
having a disease associated with the gC1q/p32 receptor; and
administering to the subject a composition comprising SEQ ID NO:
1.
[0010] Also disclosed are methods of detecting the presence of
gC1q/p32 receptor, comprising bringing into contact a cell and a
Lyp-1 composition, wherein the Lyp-1 composition comprises a moiety
linked to a composition comprising SEQ ID NO: 1; and detecting
interaction between gC1q/p32 receptor and the Lyp-1 composition,
thereby detecting the presence of gC1q/p32 receptor.
[0011] Further disclosed are methods of detecting interaction
between a gC1q/p32 receptor and a Lyp-1 composition, wherein the
Lyp-1 composition comprises a moiety linked to a composition
comprising SEQ ID NO: 1, the method comprising: selecting a cell
for its potential to comprise a gC1q/p32 receptor; bringing into
contact the Lyp-1 composition and the cell; and detecting
interaction between the gC1q/p32 receptor and the Lyp-1
composition.
[0012] Also disclosed are methods of delivering a Lyp-1 composition
to a gC1q/p32 receptor, wherein the Lyp-1 composition comprises a
moiety linked to a composition comprising SEQ ID NO: 1; wherein the
method comprises bringing into contact the Lyp-1 composition and a
cell, thereby delivering the Lyp-1 composition to the gC1q/p32
receptor.
[0013] Disclosed are methods of delivering a Lyp-1 composition to a
gC1q/p32 receptor, wherein the Lyp-1 composition comprises a moiety
linked to a composition comprising SEQ ID NO: 1; comprising:
selecting a cell for its potential to comprise a gC1q/p32 receptor;
and bringing into contact the Lyp-1 composition and the cell,
thereby delivering the Lyp-1 composition to the gC1q/p32
receptor.
[0014] Further disclosed are methods of determining and/or
assessing gC1q/p32 receptor level in a cell of a subject,
comprising: bringing into contact a cell of the subject and a Lyp-1
composition comprising a detectable agent linked to a composition
comprising SEQ ID NO: 1; and detecting the level of Lyp-1
composition interacting with gC1q/p32 receptor, thereby determining
and/or assessing gC1q/p32 receptor level in the cell.
[0015] Disclosed herein are methods of identifying a subject having
a disease associated with gC1q/p32 receptor, the method comprising
bringing into contact a cell of the subject and a Lyp-1
composition, wherein the Lyp-1 composition comprises a moiety
linked to a composition comprising SEQ ID NO:1; and detecting
interaction between gC1q/p32 receptor and the Lyp-1 composition,
thereby detecting the presence or level of gC1q/p32 on the cell,
wherein the presence or level of gC1q/p32 receptor on the cell
identifies the subject as having a disease associated with a
gC1q/p32 receptor.
[0016] Further disclosed are methods of screening for a compound
that interacts with a gC1q/p32 receptor, comprising: bringing into
contact a test compound, a Lyp-1 composition, and a gC1q/p32
receptor, wherein the Lyp-1 composition comprises SEQ ID NO: 1; and
detecting unbound Lyp-1 composition, wherein a given amount of
unbound Lyp-1 composition indicates a compound that interacts with
gC1q/p32 receptor.
[0017] Also disclosed are methods of treating a disease associated
with gC1q/p32 receptor comprising identifying a subject having a
disease associated with the gC1q/p32 receptor; and administering to
the subject a composition that interacts with the gC1q/p32 receptor
in the same location as Lyp-1, thereby treating a disease
associated with the gC1q/p32 receptor.
[0018] The gC1q/p32 receptor can be, for example, on or in a cell.
The cell can be in any context, such as in an organism, in situ, ex
vivo, in culture, and/or in vitro.
[0019] Also disclosed is a method of treating or preventing a
disease in a subject associated with gC1q/p32 receptor, the method
comprising administering to the subject a composition that
modulates gC1q/p32 receptor expression or activity, thereby
treating or preventing a disease in a subject associated with the
gC1q/p32 receptor. The disease can be cancer. Expression or
activity of the gC1q/p32 receptor can be inhibited. This can occur
by the use of interfering nucleic acid, such as shRNA or siRNA.
Activity of the gC1q/p32 receptor can be inhibited by the LyP-1
peptide, an antibody, or a small molecule mimic of Lyp-1.
[0020] Additional advantages of the disclosed method and
compositions will be set forth in part in the description which
follows, and in part will be understood from the description, or
may be learned by practice of the disclosed method and
compositions. The advantages of the disclosed method and
compositions will be realized and attained by means of the elements
and combinations particularly pointed out in the appended claims.
It is to be understood that both the foregoing general description
and the following detailed description are exemplary and
explanatory only and are not restrictive of the invention as
claimed.
BRIEF DESCRIPTION OF THE DRAWINGS
[0021] The accompanying drawings, which are incorporated in and
constitute a part of this specification, illustrate several
embodiments of the disclosed method and compositions and together
with the description, serve to explain the principles of the
disclosed method and compositions.
[0022] FIG. 1 shows gC1q/p32R binds Lyp-1 peptide in pull down
assay. Pull down assays are shown with biotinylated Lyp-1 peptide
(SEQ ID NO: 1, CGNKRTRGC) from protein extracts derived from
MDA-MB-435 cultured cells (a) or MDA-MB-435 tumor xenografts (b). A
tumor homing peptide, CREKA (SEQ ID NO: 3), and a peptide CRV which
resembles Lyp-1 in its amino acid composition and cyclic structure
(SEQ ID NO: 4, CRVRTRSGC), were used as negative controls. (a) Left
panel: silver staining of Lyp-1 bound proteins. The arrow indicates
a specific 33 kD band, which was identified as gC1q/p32R by mass
spectrometry. Right panel: immunoblot of total cell extract (Tot
lysate) and proteins bound to Lyp-1 and control peptides using a
monoclonal antibody against gC1q/p32 receptor. The antibody
recognizes a band of 33 kD in the total proteins lysate and in the
Lyp-1 pull down. Anti gC1q/p32 receptor reactive bands are not
detected in the pull downs from both control peptides. Silver
staining of proteins pulled down from MDA-MB-435 tumor xenografts
by Lyp-1 peptide, revealed an additional 75 kD band (b-left panel),
which was also identified as gC1q/p32 receptor by mass
spectrometry. The monoclonal antibody against gC1qR/p32 recognized
a 75 kD and a 33 kD band only in the Lyp-1 peptide pull down
(b-right panel).
[0023] FIG. 2 shows Lyp-1 phage specifically binds to purified
gC1qR/p32 protein. (a) Purified gC1qR or BSA, as a control, were
coated onto microtiter wells (5 .mu.g/ml) and targeted for binding
with 108 pfu of insertless phage, Lyp-1 phage, or control phage
carrying another tumor homing peptide (CREKA, SEQ ID NO: 3). After
16 hours of incubation at 37.degree. C., bound phages were eluted
and quantified by plaque assay. Results are expressed as fold of
Lyp-1 and CREKA (SEQ ID NO: 3) phages recovered over insertless
phage and are representative of five independent experiments. (b)
An antibody against the N-terminus of gC1qR inhibits Lyp-1 phage
binding to purified gC1qR/p32. Left panel: Diagram of precursor (aa
1-282) and mature (aa 74-282) gC1qR/p32 protein. Boxes indicate the
amino acid residues recognized by the monoclonal antibodies, mAb
60.11 and mAb 74.5.2, respectively at the N-terminus (aa 76-93) and
C-terminus (aa 204-282) of the mature protein. The amino acid
sequence recognized by mAb 60.11 is also indicated. Right panel:
1.5.times.10.sup.7 pfu of insertless and Lyp-1 phages were allowed
to bind for 6 hours at 37.degree. C. to gC1qR/p32 protein coated
onto microtiter plates in the presence or absence of 20 .mu.g/ml of
either mAbs 60.11, 74.5.2 or purified mouse IgG1 (mIgG). The
results are representative of three independent experiments and are
expressed as percentage of phage binding, with Lyp-1 phage binding
alone as 100%.
[0024] FIG. 3 shows LyP-1 peptide binds to p32 protein in tumor
cell extracts. A. Proteins bound to biotinylated LyP-1 peptide
(CGNKRTRGC, SEQ ID NO: 1) from extracts of cultured MDA-MB-435
cells. Peptides with the sequences CREKA (SEQ ID NO: 3) and
CRVRTRSGC (CRV, SEQ ID NO: 4) were used as negative controls in the
pull down. Left panel: silver staining of LyP-1 bound proteins. The
arrow indicates a specific band that was identified as p32 by mass
spectrometry. Right panel: Anti-p32 immunoblot of total cell
extract (lysate) and proteins bound to the LyP-1 and control
peptides. B. Phage binding to p32. Purified p32, or BSA as a
control, were coated onto microtiter wells and binding of LyP-1
phage, insertless phage, and phage clones displaying the tumor
homing peptides CREKA (SEQ ID NO: 3) and LyP-2 (CNRRTKAGC, SEQ ID
NO: 7) to the wells was tested. Results are expressed as fold of
bound peptide phage over insertless phage (.+-.SD) and are
representative of five independent experiments. C. Diagrammatic
representation of precursor (amino acids 1-282) and mature (amino
acids 74-282) forms of p32 protein. Boxes indicate the amino acid
residues recognized by the monoclonal antibodies, mAb 60.11 and mAb
74.5.2, respectively, at the N-terminus (amino acids 76-93) and
C-terminus (amino acids 204-282) of the mature protein. The amino
acid sequence recognized by mAb 60.11 is also shown. D. Inhibition
of LyP-1 phage binding to purified p32 by mAb 60.11. Anti-p32 mAb
74.5.2 and purified mouse IgG1 (mIgG; negative control) do not
inhibit the binding. The results are representative of three
independent experiments and are expressed as percentage of phage
binding (.+-.SD), with LyP-1 phage binding alone as 100%.
[0025] FIG. 4 shows expression and cell surface localization of p32
in tumor cells. A. Immunoblot of endogenous p32 in extracts of the
indicated cultured tumor cell lines. p32 was detected with mAb
60.11, and .beta.-actin was used as loading control. B and C. FACS
analysis to detect cell surface expression of p32 in tumor cell
cultures (B) and primary cell suspensions from MDA-MB-435 and C8161
tumor xenografts (C, left panel). Rabbit IgG or a polyclonal
antibody against full-length p32 were applied to live cells and
detected with an Alexa 488-labeled secondary antibody. Propidium
iodide-negative (living) cells were gated for the analysis. The
total expression level of p32 in lysates from tumor xenografts was
detected by immunoblot (C, right panel).
[0026] FIG. 5 shows LyP-1 binds to p32 at the cell surface. A.
C8161 cells were transiently transfected with pEGFP together with
either empty pcDNA3.1 vector or p32 pcDNA3.1 vector. Transfected
cells were sorted for EGFP expression and the sorted populations
were used for phage binding assay and immunoblot analysis with
anti-p32. LyP-1 phage binding to cells transfected with the empty
vector or p32 vector is expressed as fold binding over insertless
phage. The graph represents the mean of binding in two independent
experiments performed in duplicate (LyP-1 vs. insertless phage in
p32-trasfected cells p<0.05; Student's t test). B. MDA-MB-435
S35 cells were transiently transfected with p32-specific or control
siRNAs. 48 hours after transfection, inhibition of p32 expression
was checked by immunoblot analysis and immunostaining (upper
panels). .beta.-actin was used as a control. (Lower panels) cells
transfected with p32 siRNA or control siRNA were incubated for 1 h
at 4.degree. C. in the presence of 10 .mu.M FITC conjugated LyP-1
peptide or a control peptide, ARALPSQRSR (ARAL, SEQ ID NO: 5),
which has same overall charge as LyP-1. Cells incubated in the
absence of peptide served as negative control. Down-regulation of
p32 expression reduced LyP-1 binding to the cells (left panel), but
control peptide fluorescence was unaffected (right panel). A
representative experiment out of three is shown. C. LyP-1 phage
binding in Raji cells in the presence of 40 .mu.g/ml of mIgG1
(control), mAb 60.11, or mAb 74.5.2. Insertless phage was used to
determine background phage binding. The results are representative
of three independent experiments and are expressed as percentage of
phage binding (.+-.SD), with binding of LyP-1 phage in the presence
of mIgG1 set as 100%.
[0027] FIG. 6 shows expression of p32 in tumor xenografts and human
cancers. A. Double staining of sections from MDA-MB-435 xenograft
tumors for p32 and podoplanin as a marker for lymphatic vessels, or
CD31 and Meca-32 as markers for blood vessels. Polyclonal anti-p32
antibody recognizes cell clusters in podoplanin-positive areas.
Cells that are positive both for p32 and podoplanin frequently line
vessel-like structures that are negative for the blood vessel
markers (lower panels). B. Co-localization of LyP-1 peptide and p32
in tumors. Fluorescein-conjugated LyP-1 peptide was intravenously
injected into mice bearing MDA-MB-435 tumors and allowed to
circulate for 1 hour before removal of the tumor for p32
immunohistochemical staining and analysis of LyP-1 fluorescence. C.
Partial tumor co-localization of intravenously injected FITC-LyP-1
peptide (upper panel) and p32 protein (lower panels) with the
macrophages markers CD11b and Gr-1. D and E. Immunohistochemical
detection of p32 in human tissue arrays. Anti-p32 mAb 60.11 was
used for the staining (D) Sequential tissue sections were stained
separately for p32 and epithelial membrane antigen (EMA). (E)
Comparison of p32 expression in tumors and the corresponding normal
tissues. Parallel sections of all tissues examined were incubated
with mIgG instead of mAb60.11 and showed no staining.
[0028] FIG. 7 shows knockdown of p32 in MDA-MB-435 tumor cells. A.
Upper left panel, immunoblot analysis on whole cell lysates from
three MDA-MB-435 clones stably expressing ShRNA for p32 (p32 kd; Cl
1,2, and 3) and three clones expressing a base mismatch control
ShRNA (Control, Cl 4,5, and 6). Upper right panel-acidification of
the culture media in p32 knockdown clones, as indicated by the
color change of the phenol red indicator in the media to
orange/yellow. Lower panels: lactate production and glucose
consumption 4 days post cells seeding calculated as described in
materials and shown as relative to control (p<0.001). B.
Cellular ATP from lysates of p32 knockdown and control cells grown
for 4 days in media with the indicated glucose concentrations. The
ATP present in each lysate was normalized for the ATP production of
control clones grown in 25 mM glucose. The result is the average
(.+-.SEM) of two independent experiments performed with three p32
kd and three control clones. (*=p<0.03, **=p<0.002). C.
Oxygen consumption. Shown are the values for p32 knockdown clones
relative to control clones. The results come from three independent
experiments (.+-.SD) performed in triplicate (**=p<0.001,
*=p<0.05). D. Confocal analysis of p32 localization in cells.
p32 knockdown and control cells were stained with anti-N-terminal
p32 polyclonal antibody and anti-cytochrome c monoclonal antibody,
followed by Alexa 488 and Alexa 594 anti-rabbit and anti-mouse
secondary antibodies, respectively. The panels on the right are
high magnification of the white-framed areas in the merge
panels.
[0029] FIG. 8 shows the effect of p32 knockdown on growth and
survival of tumor cells in vitro. A. Proliferation of MDA-MB-435
p32 knockdown (kd) and control cells under high (25 mM) and low
(2.5 mM) glucose conditions. Average cell number at each time point
was determined by counting absolute cell number in duplicate wells
of three p32 knockdown and control clones (p<0.0002). The panel
on the right shows the color media of two control and p32 kd clones
after 6 days in 25 mM or 2.5 mM glucose. B. Left panel--Microscopic
analysis of p32 knockdown and control cells after 3 days in medium
containing the indicated glucose concentration. The p32 kd clones
show morphological changes in 2.5 mM glucose and cell death becomes
pronounced in 0.5 mM glucose. Cell death was quantified by FACS
analysis of cells that bind FITC-annexin V (right panel;
*=<0.05). C. Upper left panel, immunoblot analysis of a parental
p32 kd clone and single clones derived from it that express p32
from a cDNA resistant to the p32 shRNA silencing (Cl #3,8,14) or
that were transfected with empty cDNA vector (Cl #9,10,18). A clone
expressing control ShRNA (Control) was used to detect the
endogenous level of p32. The lower left panel shows the restoration
of culture medium pH by reintroduction of p32. The middle panels
and the panel on the right show lactate production, glucose
consumption, and growth rate in control, p32 kd and p32-restored
(p32 kd+p32) clones.
[0030] FIG. 9 shows growth properties of tumors derived from p32
knockdown cells. Tumors were grown from three p32 kd and control
clones (6 mice per clone) in the mammary fat pad of nude mice. A.
Control tumors are homogenous in size, while p32 kd tumors are
either significantly smaller than the control cell tumors, or
swollen and hemorrhagic. The middle panel shows an example of a
knockdown cell tumor with extensive necrosis accompanied by
hemorrhage. The right panel shows average of tumor volume as a
function of time (.+-.SEM, p<0.001). B. BrdU incorporation in
tumor cells. Mice were administered a pulse of BrdU 24 h prior to
sacrifice. The graph indicates the number of cells per field that
scored positive for BrdU staining. The data were derived by
counting via Image-J software the number of BrdU positive cells in
4 random fields per tumor (N=14 tumors per group); p<0.003. C.
Hematoxylin/eosin staining of tumors derived from p32 kd and
control cell clones. Dark areas in p32 kd tumors are indicative of
extensive necrosis. The upper images were taken with a 10.times.
magnification, the lower images correspond to the indicated framed
areas at 200.times. magnification. The percentage of necrotic areas
was calculated via Image-J software (p<0.001).
[0031] FIG. 10 shows inhibition of tumor growth by anti p32
treatment. A polyclonal antibody directed against aa 76-93 of both
human and mouse p32 was produced and tested for homing to tumors in
vivo. FIG. 10A-Affinity purified anti N-terminus p32 polyclonal
antibody or rabbit IgG, as a control, was injected into the tail
vein of mice bearing MDA-MB-435 or C8161 tumor xenografts. The
tumor and various organs were removed 1 hour after the injection,
sectioned, and examined for the presence of rabbit IgG using Alexa
488 anti rabbit IgG secondary antibody. The antibody recognizes
clusters of cells similar to those visualized after i.v. injection
of FITC LyP-1 or by p32 staining of tumor sections (FIG. 10A left
panel). Homing to MDA-MB-435 xenografts is more efficient than to
C8161 tumors, which express high and low levels of p32 respectively
(FIG. 10A-right panel). FIG. 10B-Mice bearing MDA-MB-435 tumor
xenografts were i.v. injected every three days with 400 and 800
.mu.g of polyclonal anti p32 or rabbit IgG (n=4 mice per group) for
a total of 33 days. In the graph are shown the kinetics of tumor
growth in anti p32 and rabbit IgG treated mice. Both doses of
antibody significantly inhibited tumor growth (Student's t test,
p<0.001) without exhibiting any toxic effect as indicated by the
constant body weight of the mice throughout the treatment.
DETAILED DESCRIPTION OF THE INVENTION
[0032] The disclosed method and compositions can be understood more
readily by reference to the following detailed description of
particular embodiments and the Example included therein and to the
Figures and their previous and following description.
[0033] Before the present compounds, compositions, articles,
devices, and/or methods are disclosed and described, it is to be
understood that they are not limited to specific synthetic methods
or specific recombinant biotechnology methods unless otherwise
specified, or to particular reagents unless otherwise specified, as
such may, of course, vary. It is also to be understood that the
terminology used herein is for the purpose of describing particular
embodiments only and is not intended to be limiting.
A. DEFINITIONS
[0034] As used in the specification and the appended claims, the
singular forms "a," "an" and "the" include plural referents unless
the context clearly dictates otherwise. Thus, for example,
reference to "a pharmaceutical carrier" includes mixtures of two or
more such carriers, and the like.
[0035] Ranges can be expressed herein as from "about" one
particular value, and/or to "about" another particular value. When
such a range is expressed, another embodiment includes from the one
particular value and/or to the other particular value. Similarly,
when values are expressed as approximations, by use of the
antecedent "about," it will be understood that the particular value
forms another embodiment. It will be further understood that the
endpoints of each of the ranges are significant both in relation to
the other endpoint, and independently of the other endpoint. It is
also understood that there are a number of values disclosed herein,
and that each value is also herein disclosed as "about" that
particular value in addition to the value itself. For example, if
the value "10" is disclosed, then "about 10" is also disclosed. It
is also understood that when a value is disclosed that "less than
or equal to" the value, "greater than or equal to the value" and
possible ranges between values are also disclosed, as appropriately
understood by the skilled artisan. For example, if the value "10"
is disclosed the "less than or equal to 10" as well as "greater
than or equal to 10" is also disclosed. It is also understood that
the throughout the application, data is provided in a number of
different formats, and that this data, represents endpoints and
starting points, and ranges for any combination of the data points.
For example, if a particular data point "10" and a particular data
point 15 are disclosed, it is understood that greater than, greater
than or equal to, less than, less than or equal to, and equal to 10
and 15 are considered disclosed as well as between 10 and 15. It is
also understood that each unit between two particular units are
also disclosed. For example, if 10 and 15 are disclosed, then 11,
12, 13, and 14 are also disclosed.
[0036] In this specification and in the claims which follow,
reference will be made to a number of terms which shall be defined
to have the following meanings:
[0037] "Optional" or "optionally" means that the subsequently
described event or circumstance may or may not occur, and that the
description includes instances where said event or circumstance
occurs and instances where it does not.
[0038] The term "multiwell plate" refers to a two dimensional array
of addressable wells located on a substantially flat surface.
Multiwell plates can include any number of discrete addressable
wells, and include addressable wells of any width or depth. Common
examples of multiwell plates include 96 well plates, 384 well
plates and 3456 well Nanoplates.TM.. Such multiwell plates can be
constructed of any suitable material. Examples of suitable material
include plastic, glass, or any essentially electrically
nonconductive material.
[0039] By "knockdown" is meant a decrease in detectable mRNA
expression. Nucleic acids are generally used to knockdown gene
expression and generally comprise a sequence capable of hybridizing
to the target sequence, such as mRNA. Examples of such functional
nucleic acids include antisense molecules, ribozymes, triplex
forming nucleic acids, external guide sequences (EGS), and small
interfering RNAs (siRNA).
[0040] The term "gene knockout" as used herein, refers to the
targeted disruption of a gene in vivo with complete loss of
function that has been achieved by any transgenic technology
familiar to those in the art. In one example, transgenic animals
having gene knockouts are those in which the target gene has been
rendered nonfunctional by an insertion targeted to the gene to be
rendered non-functional by homologous recombination.
[0041] The term "hit" refers to a test compound that shows desired
properties in an assay.
[0042] The term "test compound" refers to a chemical to be tested
by one or more screening method(s) as a putative modulator. A test
compound can be any chemical, such as an inorganic chemical, an
organic chemical, a protein, a peptide, a carbohydrate, a lipid, or
a combination thereof. Usually, various predetermined
concentrations of test compounds are used for screening, such as
0.01 micromolar, 1 micromolar and 10 micromolar. Test compound
controls can include the measurement of a signal in the absence of
the test compound or comparison to a compound known to modulate the
target.
[0043] The term "transgenic" is used to describe an organism that
includes exogenous genetic material within all of its cells. The
term includes any organism whose genome has been altered by in
vitro manipulation of the early embryo or fertilized egg or by any
transgenic technology to induce a specific gene knockout.
[0044] The term "transgene" refers to any piece of DNA which is
inserted by artifice into a cell, and becomes part of the genome of
the organism (i.e., either stably integrated or as a stable
extrachromosomal element) which develops from that cell. Such a
transgene can include a gene which is partly or entirely
heterologous (i.e., foreign) to the transgenic organism, or may
represent a gene homologous to an endogenous gene of the organism.
Included within this definition is a transgene created by the
providing of an RNA sequence that is transcribed into DNA and then
incorporated into the genome. The transgenes disclosed herein can
include DNA sequences that encode the fluorescent or bioluminescent
protein that may be expressed in a transgenic non-human animal.
[0045] The term "activity" as used herein refers to a measurable
result of the interaction of molecules. Some exemplary methods of
measuring these activities are provided herein.
[0046] The term "modulate" as used herein refers to the ability of
a compound to change an activity in some measurable way as compared
to an appropriate control. As a result of the presence of compounds
in the assays, activities can increase or decrease as compared to
controls in the absence of these compounds. Preferably, an increase
in activity is at least 25%, more preferably at least 50%, most
preferably at least 100% compared to the level of activity in the
absence of the compound. Similarly, a decrease in activity is
preferably at least 25%, more preferably at least 50%, most
preferably at least 100% compared to the level of activity in the
absence of the compound. A compound that increases a known activity
is an "agonist". One that decreases, or prevents, a known activity
is an "antagonist."
[0047] The term "inhibit" means to reduce or decrease in activity
or expression. This can be a complete inhibition or activity or
expression, or a partial inhibition. Inhibition can be compared to
a control or to a standard level. Inhibition can be 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40,
41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57,
58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74,
75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91,
92, 93, 94, 95, 96, 97, 98, 99, or 100%.
[0048] The term "monitoring" as used herein refers to any method in
the art by which an activity can be measured.
[0049] The term "providing" as used herein refers to any means of
adding a compound or molecule to something known in the art.
Examples of providing can include the use of pipettes, pipettemen,
syringes, needles, tubing, guns, etc. This can be manual or
automated. It can include transfection by any mean or any other
means of providing nucleic acids to dishes, cells, tissue,
cell-free systems and can be in vitro or in vivo.
[0050] The term "preventing" as used herein refers to administering
a compound prior to the onset of clinical symptoms of a disease or
conditions so as to prevent a physical manifestation of aberrations
associated with the disease or condition.
[0051] The term "treating" as used herein refers to administering a
compound after the onset of clinical symptoms.
[0052] The term "in need of treatment" as used herein refers to a
judgment made by a caregiver (e.g. physician, nurse, nurse
practitioner, or individual in the case of humans; veterinarian in
the case of animals, including non-human mammals) that a subject
requires or will benefit from treatment. This judgment is made
based on a variety of factors that are in the realm of a care
giver's expertise, but that include the knowledge that the subject
is ill, or will be ill, as the result of a condition that is
treatable by the compounds of the invention.
[0053] As used herein, "subject" includes, but is not limited to,
animals, plants, bacteria, viruses, parasites and any other
organism or entity. The subject can be a vertebrate, more
specifically a mammal (e.g., a human, horse, pig, rabbit, dog,
sheep, goat, non-human primate, cow, cat, guinea pig or rodent), a
fish, a bird or a reptile or an amphibian. The subject can be an
invertebrate, more specifically an arthropod (e.g., insects and
crustaceans). The term does not denote a particular age or sex.
Thus, adult and newborn subjects, as well as fetuses, whether male
or female, are intended to be covered. A patient refers to a
subject afflicted with a disease or disorder. The term "patient"
includes human and veterinary subjects.
[0054] The terms "higher," "increases," "elevates," or "elevation"
refer to increases above basal levels, e.g., as compared to a
control. The terms "low," "lower," "reduces," or "reduction" refer
to decreases below basal levels, e.g., as compared to a
control.
[0055] Throughout this application, various publications are
referenced. The disclosures of these publications in their
entireties are hereby incorporated by reference into this
application in order to more fully describe the state of the art to
which this pertains. The references disclosed are also individually
and specifically incorporated by reference herein for the material
contained in them that is discussed in the sentence in which the
reference is relied upon.
[0056] It is to be understood that the disclosed method and
compositions are not limited to specific synthetic methods,
specific analytical techniques, or to particular reagents unless
otherwise specified, and, as such, may vary. It is also to be
understood that the terminology used herein is for the purpose of
describing particular embodiments only and is not intended to be
limiting.
Materials
[0057] Disclosed are the components to be used to prepare the
disclosed compositions as well as the compositions themselves to be
used within the methods disclosed herein. These and other materials
are disclosed herein, and it is understood that when combinations,
subsets, interactions, groups, etc. of these materials are
disclosed that while specific reference of each various individual
and collective combinations and permutation of these compounds may
not be explicitly disclosed, each is specifically contemplated and
described herein. For example, if a particular peptide is disclosed
and discussed and a number of modifications that can be made to a
number of molecules including the peptide are discussed,
specifically contemplated is each and every combination and
permutation of the peptides and the modifications that are possible
unless specifically indicated to the contrary. Thus, if a class of
molecules A, B, and C are disclosed as well as a class of molecules
D, E, and F and an example of a combination molecule, A-D is
disclosed, then even if each is not individually recited each is
individually and collectively contemplated meaning combinations,
A-E, A-F, B-D, B-E, B-F, C-D, C-E, and C-F are considered
disclosed. Likewise, any subset or combination of these is also
disclosed. Thus, for example, the sub-group of A-E, B-F, and C-E
would be considered disclosed. This concept applies to all aspects
of this application including, but not limited to, steps in methods
of making and using the disclosed compositions. Thus, if there are
a variety of additional steps that can be performed it is
understood that each of these additional steps can be performed
with any specific embodiment or combination of embodiments of the
disclosed methods.
A. Lyp-1 and gC1qR/p32
[0058] It has been discovered that the Lyp-1 (SEQ ID NO: 1,
CGNKRTRGC) selectively interacts with the gC1q receptor (gC1qR/p32,
which has been described in the literature by one of the
alternative terms gC1qR and p32, and is described herein as either
gC1qR, gC1q receptor, or p32, or as "gC1qR/p32" which refers to the
protein known in the literature as gC1qR and as p32). gC1qR/p32 is
associated with tumor lymphatic vasculature, for example, the
lymphatic vasculature of breast cancer tumors, squamous carcinomas,
and osteosarcomas. gC1qR/p32 is also associated with inflammation
(Waggoner et al., J Immunol. 2005 Oct. 1; 175(7):4706-14, herein
incorporated by reference in its entirety for its teaching
concerning gC1q/p32 receptors and inflammation).
[0059] As disclosed herein, the interaction of peptide Lyp-1 (SEQ
ID NO: 1) and gC1qR/p32 was identified by pull down assays with
biotinylated Lyp-1 peptide from protein extracts (FIG. 1). A tumor
homing peptide, CREKA (SEQ ID NO: 3), and a peptide (CRV) which
resembles Lyp-1 in its amino acid composition and cyclic structure
(CRVRTRSGC, SEQ ID NO: 4), were used as negative controls. Anti
gC1qR/p32 reactive bands were not detected in the pull downs from
both control peptides. The monoclonal antibody against gC1qR/p32
recognized a 75 kD and a 33 kD band only in the Lyp-1 peptide pull
down.
[0060] Furthermore, Lyp-1 phage specifically bound to purified
gC1qR/p32 protein. Purified gC1qR/p32 or BSA, as a control, were
coated onto microtiter wells and targeted for binding with
insertless phage, Lyp-1 phage, or control phage carrying another
tumor homing peptide (CREKA, SEQ ID NO: 3). As can be seen in FIG.
2a, the Lyp-1 phage bound gC1qR/p32, while the insertless and
control phages showed essentially no interaction. Furthermore, an
antibody against the N-terminus of gC1qR/p32 inhibited Lyp-1 phage
binding to purified gC1qR/p32 (FIG. 2B).
[0061] gC1qR/p32 protein levels and cell surface expression are
also shown in cultured tumor cells and tumor xenografts. FIG. 4A
shows gC1qR/p32 western blot analysis from lysates of different
tumor cell lines. C8161 melanoma cells and HL-60 promyelocitic
leukemia cells, both low binders of Lyp-1 phage (Laakkonen et al.,
2002), express low levels of gC1qR/p32 compared to MDA-MB-435 and
BT549 breast cancer cells which exhibit higher Lyp-1 phage binding
ability. FACS analysis was used to detect the cell surface
expression of gC1qR/p32 in tumor cell cultures or primary cell
suspensions from MDA-MB-435 tumor xenografts. Propidium iodide
negative (living) cells were gated for the analysis. In cell
suspensions from MDA-MB-435 tumor xenografts, polyclonal
anti-gC1qR/p32 antibody caused a significant shift of the FACS peak
compared with the rabbit IgG control. The cell surface expression
of gC1qR/p32 was low in cultured MDA-MB-435 and BT549 cells. There
was not cell surface expression of gC1qR/p32 in C8161 cells.
[0062] Furthermore, gC1qR/p32 overexpression enhanced Lyp-1 phage
binding to C8161 melanoma cells (FIG. 5). A phage binding assay and
western blot analysis were used to detect gC1qR/p32 overexpression.
Lyp-1 phage binding to gC1qR/p32 was much greater than to empty
vector. RNAi-mediated gC1qR/p32 silencing also decreases Lyp-1
peptide binding to the cell surface. MDA-MB-435 cells were
transiently transfected with gC1qR/p32-specific or control siRNAs.
Cells incubated in the absence of peptide served as FITC negative
control. Compared to control siRNA transfected cells,
down-regulation of gC1qR/p32 expression caused a shift in the peak
of Lyp-1, but not control peptide fluorescence.
[0063] FIG. 3 shows tumor localization of gC1qR/p32 and Lyp-1
peptide. Staining of gC1qR/p32 and lymphatic or blood vessels,
podoplanin and Meca32/CD31, respectively, in MDA-MB-435 tumor
xenografts was done. Polyclonal anti-gC1qR/p32 antibody recognized
cell clusters that lack blood vessels but contain lymphatics, or
cells lining vessel-like structures positive for Podoplanin but not
CD31 or Meca32. Lyp-1 peptide localized in gC1qR/p32-positive
patches within the tumor.
[0064] Based on these findings, disclosed herein are Lyp-1
compositions useful in diseases and disorders associated with
gC1qR/p32. For example, the Lyp-1 compositions disclosed herein are
useful for reducing or preventing tumor metastasis in cancer
patients having a primary tumor. The Lyp-1 compositions can be
administered, for example, to a subject having pre-metastatic
breast or bone cancer or to a subject having early or late stage
metastatic breast or bone cancer. Lyp-1 polypeptides can also be
useful, for example, for imaging tumor lymphatic vasculature, such
as breast cancer or osteosarcoma lymphatic vasculature. The
disclosed compositions are also useful for reducing or preventing
inflammation in patients in need thereof.
[0065] Thus, disclosed herein are isolated peptides or
peptidomimetic containing the amino acid sequence GNKRTRG (SEQ ID
NO:2), or a peptidomimetic thereof. The invention further provides
an isolated peptide or peptidomimetic containing the amino acid
sequence CGNKRTRGC (SEQ ID NO:1) or a peptidomimetic thereof.
[0066] Disclosed are compositions, such as those comprising Lyp-1,
that selectively interact with tumors and sites of inflammation, as
well as other diseases and disorders associated with gC1qR/p32. A
variety of Lyp-1 compositions can be used in the disclosed methods.
Such compositions include, without limitation, peptides as
disclosed herein. The disclosed compounds, compositions, molecules
and methods can include or use the disclosed Lyp-1 compositions in
various forms, including peptides and peptidomimetics as disclosed.
For convenience of expression, in many places herein the use or
inclusion of peptides will be recited. It is understood that, in
such cases, it is considered Lyp-1 compositions in various forms
can also be used or included in the same or similar ways as is
described in terms of peptides, and such use and inclusion is
specifically contemplated and disclosed thereby.
[0067] There are multiple diseases and disorders associated with
the gC1q/p32 receptor. Examples include, but are not limited to,
cancer and inflammation.
[0068] The composition comprising SEQ ID NO:1 can further comprise
a moiety. Examples of moieties include, but are not limited to,
therapeutic or diagnostic moieties. Therapeutic moieties can
include anti-angiogenic agents or cytotoxic agents. The therapeutic
moiety can target a DNA-associated process. The therapeutic moiety
can be selected from the group consisting of an alkylating agent,
an anti-tumor antibiotic and a sequence-selective agent. Other
examples of therapeutic moieties include cyclophosphamide,
melphalan, mitomycin C, bizelesin, cisplatin, doxorubicin,
etoposide, mitoxantrone, SN-38, Et-743, actinomycin D, bleomycin,
geldanamycin, chlorambucil, methotrexate, and TLK286. The moiety
can also be a nanoparticle.
[0069] Disclosed are methods of detecting the presence of gC1q/p32
receptor, the method comprising bringing into contact a cell and a
Lyp-1 composition, wherein the Lyp-1 composition comprises a moiety
linked to a composition comprising SEQ ID NO:1; and detecting
interaction between gC1q/p32 receptor and the Lyp-1 composition,
thereby detecting the presence of gC1q/p32 receptor. The gC1q/p32
receptor can be, for example, on or in a cell. The cell can be in
any context, such as in an organism, in situ, ex vivo, in culture,
and/or in vitro.
[0070] The moiety can be a detectable moiety. Examples of such
moieties include, but are not limited to, a polypeptide, a nucleic
acid molecule, a small molecule, a fluorophore, fluorescein,
rhodamine, a radionuclide, indium-111, technetium-99, carbon-11,
carbon-13, or a combination thereof.
[0071] The Lyp-1 composition being brought into contact with the
cell described above can comprise a virus in one example. The Lyp-1
composition can also comprise a phage.
[0072] By "selectively interacts with" is meant that a stated
compound or material can preferentially interact with a stated
target compared with non-targets. Thus, for example, in vivo, Lyp-1
can preferentially interact with the gC1qR/p32 as compared to
non-target. Therefore, when gC1qR/p32 is associated with a
cancerous cell, or a site of inflammation, Lyp-1 will interact with
the cancerous cell or site of inflammation preferentially, as
compared to a non-cancerous cell, or a site without inflammation.
Selective or preferential interaction with, for example, tumors,
generally is characterized by at least a two-fold or greater
localization at the cancerous site. A Lyp-1 peptide can be
characterized by 5-fold, 10-fold, 20-fold or more preferential
localization to cancerous sites such as tumors, as compared to
several or many tissue types of non-tumoral tissue, or as compared
to most or all non-tumoral tissue. Thus, it is understood that, in
some cases, Lyp-1 interacts with, in part, one or more normal
organs in addition to those with gC1qR/p32 present. Selective
interaction can also be referred to as targeting or homing.
[0073] As discussed above, selectively interacting with, including
preferential and/or selective homing, does not mean that Lyp-1 does
not bind to any normal and/or non-targeted areas. In some
embodiments, interaction selectivity can be, for example, at least
about 20-fold, at least about 30-fold, at least about 50-fold, at
least about 75-fold, at least about 100-fold, at least about
150-fold, or at least about 200-fold selective for a corresponding
target. Selective interaction can be, for example, in terms of
relative amounts or in terms of relative K.sub.i over other
non-target components. In some embodiments, Lyp-1 can have at least
about a 50-fold selectivity, at least about a 100-fold selectivity,
at least about a 200-fold selectivity, at least about a 300-fold
selectivity, at least about a 400-fold selectivity, at least about
a 500-fold selectivity, at least about a 600-fold selectivity, at
least about a 700-fold selectivity, at least about an 800-fold
selectivity, at least about a 1000-fold selectivity, or at least
about a 1500-fold selectivity to a corresponding target. For
example, in some preferred embodiments, Lyp-1 can have a K.sub.i
value against a target of less than about 200 nM, less than about
150 nM, less than about 100 nM, or less than about 75 nM. In some
preferred embodiments, Lyp-1 can have a K.sub.i value against a
target of more than about 50 nM, more than about 25 nM, more than
about 20 nM, more than about 15 nM, more than about 10 nM, more
than about 5 nM, more than about 3 nM, or more than about 1 nM. In
some preferred embodiments, the targeting moiety binds its target
with a K.sub.D less than about 10.sup.-8 M, less than about
10.sup.-9 M, less than about 10.sup.-10 M, less than about
10.sup.-11 M, less than about 10.sup.-12 M, less than about
10.sup.-13 M, or less than about 10.sup.-14 M.
B. p32/gC1q RECEPTOR
[0074] It has been found that knocking down gC1qR/p32 expression in
tumor cells shift their metabolism toward glycolysis and that,
surprisingly, the glycolytic phenotype is associated with impaired
tumor cell survival and growth, especially under adverse growth
conditions (Example 2). At the same time, tumorigenicity of the
gC1qR/p32 knockdown cells is reduced. Therefore, disclosed herein
are methods of targeting the gC1q/p32 receptor in order to treat
gC1q/p32 receptor-related disorders and diseases, as described
herein. An example of such a disease is cancer.
[0075] Also disclosed herein is a method of treating a disease in a
subject associated with gC1q/p32 receptor, the method comprising
administering to the subject a composition that modulates gC1q/p32
receptor expression or activity, thereby treating a disease in a
subject associated with the gC1q/p32 receptor. The subject can have
cancer. Expression or activity of the gC1q/p32 receptor can be
inhibited. This can occur by the use of interfering nucleic acid,
such as shRNA or siRNA. Activity of the gC1q/p32 receptor can be
inhibited by LyP-1 peptide, an antibody, or a small molecule mimic
of Lyp-1. The methods of treating cancer disclosed herein can be
used in conjunction with other treatment therapies as well, as
described below in the section relating to moieties.
[0076] Disclosed herein are subjects having a disease associated
with the gC1q/p32 receptor. By this is meant that the subject has
either an increased level of gC1q/p32 receptor, a decreased level
of gC1q/p32 receptor, or that the gC1q/p32 receptor can be targeted
to treat or ameliorate the symptoms of a disease or disorder. By an
"increased level of gC1q/p32 receptor" is meant that the number of
gC1q/p32 receptors in the subject as a whole is increased over
normal, basal, or standard levels accepted by those of skill in the
art. It can also mean that the number of gC1q/p32 receptors present
in a given cell are increased over a basal, normal, or standard
amount. By a "decreased level of gC1q/p32 receptor" is meant that
the number of gC1q/p32 receptors in the subject as a whole is
deceased over normal, basal, or standard levels accepted by those
of skill in the art. It can also mean that the number of gC1q/p32
receptors present in a given cell are decreased over a basal,
normal, or standard amount. One of skill in the art would be able
to determine gC1q/p32 levels in a subject as a whole, as well as in
individual cells, using the methods disclosed herein and those
known to those of skill in the art. One method of doing so involves
using Lyp-1, as disclosed herein. Diseases associated with the
gC1q/p32 receptor include cancer, for example.
C. PEPTIDES AND PEPTIDOMIMETICS
[0077] Disclosed are compositions related to an isolated peptide
comprising SEQ ID NO:1 (Lyp-1). The isolated peptides can comprise,
for example, SEQ ID NO:1, an amino acid sequence at least about 90%
identical to SEQ ID NO:1, or the amino acid sequence of SEQ ID NO:1
having one or more conservative amino acid substitutions. The
peptide can be at least about 90%, 80%, 70%, or 60% identical to
the amino acid sequence of SEQ ID NO:1. The amino acid sequence of
SEQ ID NO:1 can have one, two, three, four, five, six, seven,
eight, or nine conservative amino acid substitutions, for example.
The peptide can comprise a chimera of the amino acid sequence SEQ
ID NO:1. Such a chimera can be additive, where sequence of one
sequence is added to another sequence, substitutional, where
sequence of one sequence is substituted for sequence of another
sequence, or a combination. As used herein in reference to a
specified amino acid sequence, a "conservative variant" is a
sequence in which a first amino acid is replaced by another amino
acid or amino acid analog having at least one biochemical property
similar to that of the first amino acid; similar properties
include, for example, similar size, charge, hydrophobicity or
hydrogen-bonding capacity.
[0078] The amino acid sequence can be linear, circular or cyclic.
The amino acid segment can be circularized or cyclized via any
suitable linkage, for example, a disulfide bond. The peptide can
have any suitable length, such as a length of less than 100
residues. The peptide can have a length of less than 50 residues.
The peptide can have a length of less than 20 residues.
[0079] The disclosed peptides can be in isolated form. As used
herein in reference to the disclosed peptides, the term "isolated"
means a peptide that is in a form that is relatively free from
material such as contaminating polypeptides, lipids, nucleic acids
and other cellular material that normally is associated with the
peptide in a cell or that is associated with the peptide in a
library or in a crude preparation.
[0080] The disclosed peptides can have any suitable length. The
disclosed peptides can have, for example, a relatively short length
of less than six, seven, eight, nine, ten, 12, 15, 20, 25, 30, 35
or 40 residues. The disclosed peptides also can be useful in the
context of a significantly longer sequence. Thus, the peptides can
have, for example, a length of up to 50, 100, 150, 200, 250, 300,
400, 500, 1000 or 2000 residues. In particular embodiments, a
peptide can have a length of at least 10, 20, 30, 40, 50, 60, 70,
80, 90, 100 or 200 residues. In further embodiments, a peptide can
have a length of 5 to 200 residues, 5 to 100 residues, 5 to 90
residues, 5 to 80 residues, 5 to 70 residues, 5 to 60 residues, 5
to 50 residues, 5 to 40 residues, 5 to 30 residues, 5 to 20
residues, 5 to 15 residues, 5 to 10 residues, 10 to 200 residues,
10 to 100 residues, 10 to 90 residues, 10 to 80 residues, 10 to 70
residues, 10 to 60 residues, 10 to 50 residues, 10 to 40 residues,
10 to 30 residues, 10 to 20 residues, 20 to 200 residues, 20 to 100
residues, 20 to 90 residues, 20 to 80 residues, 20 to 70 residues,
20 to 60 residues, 20 to 50 residues, 20 to 40 residues or 20 to 30
residues. As used herein, the term "residue" refers to an amino
acid or amino acid analog.
[0081] As this specification discusses various proteins and protein
sequences it is understood that the nucleic acids that can encode
those protein sequences are also disclosed. This would include all
degenerate sequences related to a specific protein sequence, i.e.
all nucleic acids having a sequence that encodes one particular
protein sequence as well as all nucleic acids, including degenerate
nucleic acids, encoding the disclosed variants and derivatives of
the protein sequences. Thus, while each particular nucleic acid
sequence may not be written out herein, it is understood that each
and every sequence is in fact disclosed and described herein
through the disclosed protein sequence.
[0082] Molecules can be produced that resemble peptides, but which
are not connected via a natural peptide linkage. For example,
linkages for amino acids or amino acid analogs can include
CH.sub.2NH--, --CH.sub.2S--, --CH.sub.2--CH.sub.2--,
--CH.dbd.CH--(cis and trans), --COCH.sub.2--, --CH(OH)CH.sub.2--,
and --CHH.sub.2SO--(These and others can be found in Spatola, A. F.
in Chemistry and Biochemistry of Amino Acids, Peptides, and
Proteins, B. Weinstein, eds., Marcel Dekker, New York, p. 267
(1983); Spatola, A. F., Vega Data (March 1983), Vol. 1, Issue 3,
Peptide Backbone Modifications (general review); Morley, Trends
Pharm Sci (1980) pp. 463-468; Hudson, D. et al., Int J Pept Prot
Res 14:177-185 (1979) (--CH.sub.2NH--, CH.sub.2CH.sub.2--); Spatola
et al. Life Sci 38:1243-1249 (1986) (--CH H.sub.2--S); Hann J.
Chem. Soc Perkin Trans. 1307-314 (1982) (--CH--CH--, cis and
trans); Almquist et al. J. Med. Chem. 23:1392-1398 (1980)
(--COCH.sub.2--); Jennings-White et al. Tetrahedron Lett 23:2533
(1982) (--COCH.sub.2--); Szelke et al. European Appin, EP 45665 CA
(1982): 97:39405 (1982) (--CH(OH)CH.sub.2--); Holladay et al.
Tetrahedron. Lett 24:4401-4404 (1983) (--C(OH)CH.sub.2--); and
Hruby Life Sci 31:189-199 (1982) (--CH.sub.2--S--); each of which
is incorporated herein by reference. A particularly preferred
non-peptide linkage is --CH.sub.2NH--. It is understood that
peptide analogs can have more than one atom between the bond atoms,
such as .beta.-alanine, .gamma.-aminobutyric acid, and the
like.
[0083] Also disclosed are chimeric proteins containing a disclosed
peptide fused to a heterologous protein. In one embodiment, the
heterologous protein can have a therapeutic activity such as
cytokine activity, cytotoxic activity or pro-apoptotic activity. In
a further embodiment, the heterologous protein can be an antibody
or antigen-binding fragment thereof. In other embodiments, the
chimeric protein includes a peptide containing the amino acid
sequence SEQ ID NO:1, or a conservative variant or peptidomimetic
thereof, fused to a heterologous protein. The term "heterologous,"
as used herein in reference to a protein fused to the disclosed
peptides, means a protein derived from a source other than the gene
encoding the peptide or from which the peptidomimetic is derived.
The disclosed chimeric proteins can have a variety of lengths
including, but not limited to, a length of less than 100 residues,
less than 200 residues, less than 300 residues, less than 400
residues, less than 500 residues, less than 800 residues or less
than 1000 residues.
[0084] As used herein, "chimera" and "chimeric" refer to any
combination of sequences derived from two or more sources. This
includes, for example, from single moiety of subunit (e.g.,
nucleotide, amino acid) up to entire source sequences added,
inserted and/or substituted into other sequences. Chimeras can be,
for example, additive, where one or more portions of one sequence
are added to one or more portions of one or more other sequences;
substitutional, where one or more portions of one sequence are
substituted for one or more portions of one or more other
sequences; or a combination. "Conservative substitutional chimeras"
can be used to refer to substitutional chimeras where the source
sequences for the chimera have some structural and/or functional
relationship and where portions of sequences having similar or
analogous structure and/or function are substituted for each other.
Typical chimeric and humanized antibodies are examples of
conservative substitutional chimeras.
[0085] Also disclosed are bifunctional peptides, which contain
Lyp-1 fused to a second peptide having a separate function. Such
bifunctional peptides have at least two functions conferred by
different portions of the full-length molecule and can, for
example, display anti-angiogenic activity or pro-apoptotic activity
in addition to the ability to selectively interact with
gC1qR/p32.
[0086] Also disclosed are isolated multivalent peptides that
include at least two subsequences each independently containing a
peptide (for example, the amino acid sequence SEQ ID NO:1, or a
conservative variant or peptidomimetic thereof). The multivalent
peptide can have, for example, at least three, at least five or at
least ten of such subsequences each independently containing a
peptide. In particular embodiments, the multivalent peptide can
have two, three, four, five, six, seven, eight, nine, ten, fifteen
or twenty identical or non-identical subsequences. In a further
embodiment, the multivalent peptide can contain identical
subsequences, such as repeats of SEQ ID NO:1. In a further
embodiment, the multivalent peptide contains contiguous identical
or non-identical subsequences, which are not separated by any
intervening amino acids. In yet further embodiments, the
multivalent peptide can be cyclic or otherwise conformationally
constrained. In one example, the peptide can be circularized or
cyclized via a disulfide bond.
[0087] As used herein, the term "peptide" is used broadly to mean
peptides, proteins, fragments of proteins and the like. The term
"peptidomimetic," as used herein, means a peptide-like molecule
that has the activity of the peptide upon which it is structurally
based. Such peptidomimetics include chemically modified peptides,
peptide-like molecules containing non-naturally occurring amino
acids, and peptoids and have an activity such as selective
interaction with a target of the peptide upon which the
peptidomimetic is derived (see, for example, Goodman and Ro,
Peptidomimetics for Drug Design, in "Burger's Medicinal Chemistry
and Drug Discovery" Vol. 1 (ed. M. E. Wolff; John Wiley & Sons
1995), pages 803-861).
[0088] A variety of peptidomimetics are known in the art including,
for example, peptide-like molecules which contain a constrained
amino acid, a non-peptide component that mimics peptide secondary
structure, or an amide bond isostere. A peptidomimetic that
contains a constrained, non-naturally occurring amino acid can
include, for example, an .alpha.-methylated amino acid;
.alpha.,.alpha..-dialkylglycine or .alpha.-aminocycloalkane
carboxylic acid; an N.sup..alpha.--C.sup..alpha. cyclized amino
acid; an N.sup..alpha..-methylated amino acid; a .beta.- or
.gamma.-amino cycloalkane carboxylic acid; an
.alpha.,.beta.-unsaturated amino acid; a .beta.,.beta.-dimethyl or
.beta.-methyl amino acid; a .beta.-substituted-2,3-methano amino
acid; an N--C.sup..epsilon. or C.sup..alpha.--C.sup..DELTA.
cyclized amino acid; a substituted proline or another amino acid
mimetic. A peptidomimetic which mimics peptide secondary structure
can contain, for example, a non-peptidic .beta.-turn mimic;
.gamma.-turn mimic; mimic of .beta.-sheet structure; or mimic of
helical structure, each of which is well known in the art. A
peptidomimetic also can be a peptide-like molecule which contains,
for example, an amide bond isostere such as a retro-inverso
modification; reduced amide bond; methylenethioether or
methylene-sulfoxide bond; methylene ether bond; ethylene bond;
thioamide bond; trans-olefin or fluoroolefin bond;
1,5-disubstituted tetrazole ring; ketomethylene or
fluoroketomethylene bond or another amide isostere. One skilled in
the art understands that these and other peptidomimetics are
encompassed within the meaning of the term "peptidomimetic" as used
herein.
[0089] Methods for identifying a peptidomimetic are well known in
the art and include, for example, the screening of databases that
contain libraries of potential peptidomimetics. As an example, the
Cambridge Structural Database contains a collection of greater than
300,000 compounds that have known crystal structures (Allen et al.,
Acta Crystalloqr. Section B, 35:2331 (1979)). This structural
depository is continually updated as new crystal structures are
determined and can be screened for compounds having suitable
shapes, for example, the same shape as a disclosed peptide, as well
as potential geometrical and chemical complementarity to a target
molecule. Where no crystal structure of a peptide or a target
molecule that binds the peptide is available, a structure can be
generated using, for example, the program CONCORD (Rusinko et al.,
J. Chem. Inf. Comput. Sci. 29:251 (1989)). Another database, the
Available Chemicals Directory (Molecular Design Limited,
Information Systems; San Leandro Calif.), contains about 100,000
compounds that are commercially available and also can be searched
to identify potential peptidomimetics of a peptide, for example,
with activity in selectively interacting with cancerous cells.
[0090] If desired, an isolated peptide such as Lyp-1 can be cyclic
or otherwise conformationally constrained. As used herein, a
"conformationally constrained" molecule, such as a peptide, is one
in which the three-dimensional structure is maintained
substantially in one spatial arrangement over time.
Conformationally constrained molecules can have improved properties
such as increased affinity, metabolic stability, membrane
permeability or solubility. Methods of conformational constraint
are well known in the art and include cyclization as discussed
further elsewhere herein.
[0091] As used herein in reference to a peptide, the term "cyclic"
means a structure including an intramolecular bond between two
non-adjacent amino acids or amino acid analogues. The cyclization
can be effected through a covalent or non-covalent bond.
Intramolecular bonds include, but are not limited to, backbone to
backbone, side-chain to backbone and side-chain to side-chain
bonds. A preferred method of cyclization is through formation of a
disulfide bond between the side-chains of non-adjacent amino acids
or amino acid analogs. Residues capable of forming a disulfide bond
include, for example, cysteine (Cys), penicillamine (Pen),
.beta.,.beta.-pentamethylene cysteine
(Pmc),.beta.,.beta.-pentamethylene-.beta.-mercaptopropionic acid
(Pmp) and functional equivalents thereof.
[0092] A peptide also can cyclize, for example, via a lactam bond,
which can utilize a side-chain group of one amino acid or analog
thereof to form a covalent attachment to the N-terminal amine of
the amino-terminal residue. Residues capable of forming a lactam
bond include aspartic acid (Asp), glutamic acid (Glu), lysine
(Lys), ornithine (orn), .alpha.,.beta.-diamino-propionic acid,
.gamma.-amino-adipic acid (Adp) and M-(aminomethyl)benzoic acid
(Mamb). Cyclization additionally can be effected, for example,
through the formation of a lysinonorleucine bond between lysine
(Lys) and leucine (Leu) residues or a dityrosine bond between two
tyrosine (Tyr) residues. The skilled person understands that these
and other bonds can be included in a cyclic peptide.
D. FUNCTIONAL NUCLEIC ACIDS
[0093] As disclosed herein, functional nucleic acids can be used to
modulate expression of the gC1q/p32 receptor, for example.
Functional nucleic acids are nucleic acid molecules that have a
specific function, such as binding a target molecule or catalyzing
a specific reaction. Functional nucleic acid molecules can be
divided into the following categories, which are not meant to be
limiting. For example, functional nucleic acids include antisense
molecules, aptamers, ribozymes, triplex forming molecules, and
external guide sequences. The functional nucleic acid molecules can
act as affectors, inhibitors, modulators, and stimulators of a
specific activity possessed by a target molecule, or the functional
nucleic acid molecules can possess a de novo activity independent
of any other molecules.
[0094] Functional nucleic acid molecules can interact with any
macromolecule, such as DNA, RNA, polypeptides, or carbohydrate
chains. As disclosed herein, the functional nucleic acid can
interact with the gC1q/p32 receptor. Often functional nucleic acids
are designed to interact with other nucleic acids based on sequence
homology between the target molecule and the functional nucleic
acid molecule. In other situations, the specific recognition
between the functional nucleic acid molecule and the target
molecule is not based on sequence homology between the functional
nucleic acid molecule and the target molecule, but rather is based
on the formation of tertiary structure that allows specific
recognition to take place.
[0095] Antisense molecules are designed to interact with a target
nucleic acid molecule through either canonical or non-canonical
base pairing. The interaction of the antisense molecule and the
target molecule is designed to promote the destruction of the
target molecule through, for example, RNAseH mediated RNA-DNA
hybrid degradation. Alternatively the antisense molecule is
designed to interrupt a processing function that normally would
take place on the target molecule, such as transcription or
replication. Antisense molecules can be designed based on the
sequence of the target molecule. Numerous methods for optimization
of antisense efficiency by finding the most accessible regions of
the target molecule exist. Exemplary methods would be in vitro
selection experiments and DNA modification studies using DMS and
DEPC. It is preferred that antisense molecules bind the target
molecule with a dissociation constant (k.sub.d) less than or equal
to 10.sup.-6, 10.sup.-8, 10.sup.-10, or 10.sup.-12. A
representative sample of methods and techniques which aid in the
design and use of antisense molecules can be found in the following
non-limiting list of U.S. Pat. Nos. 5,135,917, 5,294,533,
5,627,158, 5,641,754, 5,691,317, 5,780,607, 5,786,138, 5,849,903,
5,856,103, 5,919,772, 5,955,590, 5,990,088, 5,994,320, 5,998,602,
6,005,095, 6,007,995, 6,013,522, 6,017,898, 6,018,042, 6,025,198,
6,033,910, 6,040,296, 6,046,004, 6,046,319, and 6,057,437.
[0096] Aptamers are molecules that interact with a target molecule,
preferably in a specific way. Typically aptamers are small nucleic
acids ranging from 15-50 bases in length that fold into defined
secondary and tertiary structures, such as stem-loops or
G-quartets. Aptamers can bind small molecules, such as ATP (U.S.
Pat. No. 5,631,146) and theophiline (U.S. Pat. No. 5,580,737), as
well as large molecules, such as reverse transcriptase (U.S. Pat.
No. 5,786,462) and thrombin (U.S. Pat. No. 5,543,293). Aptamers can
bind very tightly with k.sub.ds from the target molecule of less
than 10.sup.-12 M. It is preferred that the aptamers bind the
target molecule with a k.sub.d less than 10.sup.-6, 10.sup.-8,
10.sup.-10, or 10.sup.-12. Aptamers can bind the target molecule
with a very high degree of specificity. For example, aptamers have
been isolated that have greater than a 10000 fold difference in
binding affinities between the target molecule and another molecule
that differ at only a single position on the molecule (U.S. Pat.
No. 5,543,293). It is preferred that the aptamer have a k.sub.d
with the target molecule at least 10, 100, 1000, 10,000, or 100,000
fold lower than the k.sub.d with a background binding molecule. It
is preferred when doing the comparison for a polypeptide for
example, that the background molecule be a different
polypeptide.
[0097] Representative examples of how to make and use aptamers to
bind a variety of different target molecules can be found in the
following non-limiting list of U.S. Pat. Nos. 5,476,766, 5,503,978,
5,631,146, 5,731,424, 5,780,228, 5,792,613, 5,795,721, 5,846,713,
5,858,660, 5,861,254, 5,864,026, 5,869,641, 5,958,691, 6,001,988,
6,011,020, 6,013,443, 6,020,130, 6,028,186, 6,030,776, and
6,051,698.
[0098] Ribozymes are nucleic acid molecules that are capable of
catalyzing a chemical reaction, either intramolecularly or
intermolecularly. Ribozymes are thus catalytic nucleic acid. It is
preferred that the ribozymes catalyze intermolecular reactions.
There are a number of different types of ribozymes that catalyze
nuclease or nucleic acid polymerase type reactions which are based
on ribozymes found in natural systems, such as hammerhead
ribozymes, (for example, but not limited to the following U.S. Pat.
Nos. 5,334,711, 5,436,330, 5,616,466, 5,633,133, 5,646,020,
5,652,094, 5,712,384, 5,770,715, 5,856,463, 5,861,288, 5,891,683,
5,891,684, 5,985,621, 5,989,908, 5,998,193, 5,998,203, WO 9858058
by Ludwig and Sproat, WO 9858057 by Ludwig and Sproat, and WO
9718312 by Ludwig and Sproat) hairpin ribozymes (for example, but
not limited to the following U.S. Pat. Nos. 5,631,115, 5,646,031,
5,683,902, 5,712,384, 5,856,188, 5,866,701, 5,869,339, and
6,022,962), and tetrahymena ribozymes (for example, but not limited
to the following U.S. Pat. Nos. 5,595,873 and 5,652,107). There are
also a number of ribozymes that are not found in natural systems,
but which have been engineered to catalyze specific reactions de
novo (for example, but not limited to the following U.S. Pat. Nos.
5,580,967, 5,688,670, 5,807,718, and 5,910,408). Preferred
ribozymes cleave RNA or DNA substrates, and more preferably cleave
RNA substrates. Ribozymes typically cleave nucleic acid substrates
through recognition and binding of the target substrate with
subsequent cleavage. This recognition is often based mostly on
canonical or non-canonical base pair interactions. This property
makes ribozymes particularly good candidates for target specific
cleavage of nucleic acids because recognition of the target
substrate is based on the target substrates sequence.
Representative examples of how to make and use ribozymes to
catalyze a variety of different reactions can be found in the
following non-limiting list of U.S. Pat. Nos. 5,646,042, 5,693,535,
5,731,295, 5,811,300, 5,837,855, 5,869,253, 5,877,021, 5,877,022,
5,972,699, 5,972,704, 5,989,906, and 6,017,756.
[0099] Triplex forming functional nucleic acid molecules are
molecules that can interact with either double-stranded or
single-stranded nucleic acid. When triplex molecules interact with
a target region, a structure called a triplex is formed, in which
there are three strands of DNA forming a complex dependant on both
Watson-Crick and Hoogsteen base-pairing. Triplex molecules are
preferred because they can bind target regions with high affinity
and specificity. It is preferred that the triplex forming molecules
bind the target molecule with a k.sub.d less than 10.sup.-6,
10.sup.-8, 10.sup.-10, or 10.sup.-12. Representative examples of
how to make and use triplex forming molecules to bind a variety of
different target molecules can be found in the following
non-limiting list of U.S. Pat. Nos. 5,176,996, 5,645,985,
5,650,316, 5,683,874, 5,693,773, 5,834,185, 5,869,246, 5,874,566,
and 5,962,426.
[0100] External guide sequences (EGSs) are molecules that bind a
target nucleic acid molecule forming a complex, and this complex is
recognized by RNase P, which cleaves the target molecule. EGSs can
be designed to specifically target a RNA molecule of choice. RNAse
P aids in processing transfer RNA (tRNA) within a cell. Bacterial
RNAse P can be recruited to cleave virtually any RNA sequence by
using an EGS that causes the target RNA:EGS complex to mimic the
natural tRNA substrate. (WO 92/03566 by Yale, and Forster and
Altman, Science 238:407-409 (1990)).
[0101] Similarly, eukaryotic EGS/RNAse P-directed cleavage of RNA
can be utilized to cleave desired targets within eukaryotic cells.
(Yuan et al., Proc. Natl. Acad. Sci. USA 89:8006-8010 (1992); WO
93/22434 by Yale; WO 95/24489 by Yale; Yuan and Altman, EMBO J
14:159-168 (1995), and Carrara et al., Proc. Natl. Acad. Sci. (USA)
92:2627-2631 (1995)). Representative examples of how to make and
use EGS molecules to facilitate cleavage of a variety of different
target molecules can be found in the following non-limiting list of
U.S. Pat. Nos. 5,168,053, 5,624,824, 5,683,873, 5,728,521,
5,869,248, and 5,877,162.
E. NUCLEIC ACID DELIVERY
[0102] In the methods described herein which include the
administration and uptake of exogenous DNA into the cells of a
subject (i.e., gene transduction or transfection), the disclosed
nucleic acids can be in the form of naked DNA or RNA, or the
nucleic acids can be in a vector for delivering the nucleic acids
to the cells, whereby the antibody-encoding DNA fragment is under
the transcriptional regulation of a promoter, as would be well
understood by one of ordinary skill in the art. The vector can be a
commercially available preparation, such as an adenovirus vector
(Quantum Biotechnologies, Inc. (Laval, Quebec, Canada). Delivery of
the nucleic acid or vector to cells can be via a variety of
mechanisms. As one example, delivery can be via a liposome, using
commercially available liposome preparations such as LIPOFECTIN,
LIPOFECTAMINE (GIBCO-BRL, Inc., Gaithersburg, Md.), SUPERFECT
(Qiagen, Inc. Hilden, Germany) and TRANSFECTAM (Promega Biotec,
Inc., Madison, Wis.), as well as other liposomes developed
according to procedures standard in the art. In addition, the
disclosed nucleic acid or vector can be delivered in vivo by
electroporation, the technology for which is available from
Genetronics, Inc. (San Diego, Calif.) as well as by means of a
SONOPORATION machine (ImaRx Pharmaceutical Corp., Tucson,
Ariz.).
[0103] As one example, vector delivery can be via a viral system,
such as a retroviral vector system which can package a recombinant
retroviral genome (see e.g., Pastan et al., Proc. Natl. Acad. Sci.
U.S.A. 85:4486, 1988; Miller et al., Mol. Cell. Biol. 6:2895,
1986). The recombinant retrovirus can then be used to infect and
thereby deliver to the infected cells nucleic acid encoding a
broadly neutralizing antibody (or active fragment thereof). The
exact method of introducing the altered nucleic acid into mammalian
cells is, of course, not limited to the use of retroviral vectors.
Other techniques are widely available for this procedure including
the use of adenoviral vectors (Mitani et al., Hum. Gene Ther.
5:941-948, 1994), adeno-associated viral (AAV) vectors (Goodman et
al., Blood 84:1492-1500, 1994), lentiviral vectors (Naidini et al.,
Science 272:263-267, 1996), pseudotyped retroviral vectors (Agrawal
et al., Exper. Hematol. 24:738-747, 1996). Physical transduction
techniques can also be used, such as liposome delivery and
receptor-mediated and other endocytosis mechanisms (see, for
example, Schwartzenberger et al., Blood 87:472-478, 1996). This
disclosed compositions and methods can be used in conjunction with
any of these or other commonly used gene transfer methods.
[0104] As one example, if the antibody-encoding nucleic acid is
delivered to the cells of a subject in an adenovirus vector, the
dosage for administration of adenovirus to humans can range from
about 10.sup.7 to 10.sup.9 plaque forming units (pfu) per injection
but can be as high as 10.sup.12 pfu per injection (Crystal, Hum.
Gene Ther. 8:985-1001, 1997; Alvarez and Curiel, Hum. Gene Ther.
8:597-613, 1997). A subject can receive a single injection, or, if
additional injections are necessary, they can be repeated at six
month intervals (or other appropriate time intervals, as determined
by the skilled practitioner) for an indefinite period and/or until
the efficacy of the treatment has been established.
[0105] Parenteral administration of the nucleic acid or vector, if
used, is generally characterized by injection. Injectables can be
prepared in conventional forms, either as liquid solutions or
suspensions, solid forms suitable for solution of suspension in
liquid prior to injection, or as emulsions. A more recently revised
approach for parenteral administration involves use of a slow
release or sustained release system such that a constant dosage is
maintained. For additional discussion of suitable formulations and
various routes of administration of therapeutic compounds, see,
e.g., Remington: The Science and Practice of Pharmacy (19th ed.)
ed. A. R. Gennaro, Mack Publishing Company, Easton, Pa. 1995.
F. ANTIBODIES
[0106] i. Antibodies Generally
[0107] Disclosed herein are antibodies that can be used to modulate
the gC1q/p32 receptor, or Lyp-1. Examples of such antibodies can be
found in FIG. 10. The term "antibodies" is used herein in a broad
sense and includes both polyclonal and monoclonal antibodies. In
addition to intact immunoglobulin molecules, also included in the
term "antibodies" are fragments or polymers of those immunoglobulin
molecules, and human or humanized versions of immunoglobulin
molecules or fragments thereof, as long as they are chosen for
their ability to interact with gC1qR/p32. The antibodies can be
tested for their desired activity using the in vitro assays
described herein, or by analogous methods, after which their in
vivo therapeutic and/or prophylactic activities are tested
according to known clinical testing methods.
[0108] The term "monoclonal antibody" as used herein refers to an
antibody obtained from a substantially homogeneous population of
antibodies, i.e., the individual antibodies within the population
are identical except for possible naturally occurring mutations
that may be present in a small subset of the antibody molecules.
The monoclonal antibodies herein specifically include "chimeric"
antibodies in which a portion of the heavy and/or light chain is
identical with or homologous to corresponding sequences in
antibodies derived from a particular species or belonging to a
particular antibody class or subclass, while the remainder of the
chain(s) is identical with or homologous to corresponding sequences
in antibodies derived from another species or belonging to another
antibody class or subclass, as well as fragments of such
antibodies, as long as they exhibit the desired antagonistic
activity (See, U.S. Pat. No. 4,816,567 and Morrison et al., Proc.
Natl. Acad. Sci. USA, 81:6851-6855 (1984)).
[0109] The disclosed monoclonal antibodies can be made using any
procedure which produces monoclonal antibodies. For example,
disclosed monoclonal antibodies can be prepared using hybridoma
methods, such as those described by Kohler and Milstein, Nature,
256:495 (1975). In a hybridoma method, a mouse or other appropriate
host animal is typically immunized with an immunizing agent to
elicit lymphocytes that produce or are capable of producing
antibodies that will specifically bind to the immunizing agent.
Alternatively, the lymphocytes may be immunized in vitro, e.g.,
using the HIV Env-CD4-co-receptor complexes described herein.
[0110] The monoclonal antibodies may also be made by recombinant
DNA methods, such as those described in U.S. Pat. No. 4,816,567
(Cabilly et al.). DNA encoding the disclosed monoclonal antibodies
can be readily isolated and sequenced using conventional procedures
(e.g., by using oligonucleotide probes that are capable of binding
specifically to genes encoding the heavy and light chains of murine
antibodies). Libraries of antibodies or active antibody fragments
can also be generated and screened using phage display techniques,
e.g., as described in U.S. Pat. No. 5,804,440 to Burton et al. and
U.S. Pat. No. 6,096,441 to Barbas et al.
[0111] In vitro methods are also suitable for preparing monovalent
antibodies. Digestion of antibodies to produce fragments thereof,
particularly, Fab fragments, can be accomplished using routine
techniques known in the art. For instance, digestion can be
performed using papain. Examples of papain digestion are described
in WO 94/29348 published Dec. 22, 1994 and U.S. Pat. No. 4,342,566.
Papain digestion of antibodies typically produces two identical
antigen binding fragments, called Fab fragments, each with a single
antigen binding site, and a residual Fc fragment. Pepsin treatment
yields a fragment that has two antigen combining sites and is still
capable of cross-linking antigen.
[0112] The fragments, whether attached to other sequences or not,
can also include insertions, deletions, substitutions, or other
selected modifications of particular regions or specific amino
acids residues, provided the activity of the antibody or antibody
fragment is not significantly altered or impaired compared to the
non-modified antibody or antibody fragment. These modifications can
provide for some additional property, such as to remove/add amino
acids capable of disulfide bonding, to increase its bio-longevity,
to alter its secretory characteristics, etc. In any case, the
antibody or antibody fragment must possess a bioactive property,
such as specific binding to its cognate antigen. Functional or
active regions of the antibody or antibody fragment may be
identified by mutagenesis of a specific region of the protein,
followed by expression and testing of the expressed polypeptide.
Such methods are readily apparent to a skilled practitioner in the
art and can include site-specific mutagenesis of the nucleic acid
encoding the antibody or antibody fragment. (Zoller, M. J. Curr.
Opin. Biotechnol. 3:348-354, 1992).
[0113] As used herein, the term "antibody" or "antibodies" can also
refer to a human antibody and/or a humanized antibody. Many
non-human antibodies (e.g., those derived from mice, rats, or
rabbits) are naturally antigenic in humans, and thus can give rise
to undesirable immune responses when administered to humans.
Therefore, the use of human or humanized antibodies in the methods
serves to lessen the chance that an antibody administered to a
human will evoke an undesirable immune response.
[0114] ii. Human Antibodies
[0115] The disclosed human antibodies can be prepared using any
technique. Examples of techniques for human monoclonal antibody
production include those described by Cole et al. (Monoclonal
Antibodies and Cancer Therapy, Alan R. Liss, p. 77, 1985) and by
Boerner et al. (J. Immunol., 147(1):86-95, 1991). Human antibodies
(and fragments thereof) can also be produced using phage display
libraries (Hoogenboom et al., J. Mol. Biol., 227:381, 1991; Marks
et al., J. Mol. Biol., 222:581, 1991).
[0116] The disclosed human antibodies can also be obtained from
transgenic animals. For example, transgenic, mutant mice that are
capable of producing a full repertoire of human antibodies, in
response to immunization, have been described (see, e.g.,
Jakobovits et al., Proc. Natl. Acad. Sci. USA, 90:2551-255 (1993);
Jakobovits et al., Nature, 362:255-258 (1993); Bruggermann et al.,
Year in Immunol., 7:33 (1993)). Specifically, the homozygous
deletion of the antibody heavy chain joining region (J(H)) gene in
these chimeric and germ-line mutant mice results in complete
inhibition of endogenous antibody production, and the successful
transfer of the human germ-line antibody gene array into such
germ-line mutant mice results in the production of human antibodies
upon antigen challenge. Antibodies having the desired activity are
selected using Env-CD4-co-receptor complexes as described
herein.
[0117] iii. Humanized Antibodies
[0118] Antibody humanization techniques generally involve the use
of recombinant DNA technology to manipulate the DNA sequence
encoding one or more polypeptide chains of an antibody molecule.
Accordingly, a humanized form of a non-human antibody (or a
fragment thereof) is a chimeric antibody or antibody chain (or a
fragment thereof, such as an Fv, Fab, Fab', or other
antigen-binding portion of an antibody) which contains a portion of
an antigen binding site from a non-human (donor) antibody
integrated into the framework of a human (recipient) antibody.
[0119] To generate a humanized antibody, residues from one or more
complementarity determining regions (CDRs) of a recipient (human)
antibody molecule are replaced by residues from one or more CDRs of
a donor (non-human) antibody molecule that is known to have desired
antigen binding characteristics (e.g., a certain level of
specificity and affinity for the target antigen). In some
instances, Fv framework (FR) residues of the human antibody are
replaced by corresponding non-human residues. Humanized antibodies
may also contain residues which are found neither in the recipient
antibody nor in the imported CDR or framework sequences. Generally,
a humanized antibody has one or more amino acid residues introduced
into it from a source which is non-human. In practice, humanized
antibodies are typically human antibodies in which some CDR
residues and possibly some FR residues are substituted by residues
from analogous sites in rodent antibodies. Humanized antibodies
generally contain at least a portion of an antibody constant region
(Fc), typically that of a human antibody (Jones et al., Nature,
321:522-525 (1986), Reichmann et al., Nature, 332:323-327 (1988),
and Presta, Curr. Opin. Struct. Biol., 2:593-596 (1992)).
[0120] Methods for humanizing non-human antibodies are well known
in the art. For example, humanized antibodies can be generated
according to the methods of Winter and co-workers (Jones et al.,
Nature, 321:522-525 (1986), Riechmann et al., Nature, 332:323-327
(1988), Verhoeyen et al., Science, 239:1534-1536 (1988)), by
substituting rodent CDRs or CDR sequences for the corresponding
sequences of a human antibody. Methods that can be used to produce
humanized antibodies are also described in U.S. Pat. No. 4,816,567
(Cabilly et al.), U.S. Pat. No. 5,565,332 (Hoogenboom et al.), U.S.
Pat. No. 5,721,367 (Kay et al.), U.S. Pat. No. 5,837,243 (Deo et
al.), U.S. Pat. No. 5,939,598 (Kucherlapati et al.), U.S. Pat. No.
6,130,364 (Jakobovits et al.), and U.S. Pat. No. 6,180,377 (Morgan
et al.).
[0121] iv. Administration of Antibodies
[0122] Administration of the antibodies can be done as disclosed
herein. Nucleic acid approaches for antibody delivery also exist.
The broadly neutralizing anti DES-1 antibodies, for example, and
antibody fragments can also be administered to patients or subjects
as a nucleic acid preparation (e.g., DNA or RNA) that encodes the
antibody or antibody fragment, such that the patient's or subject's
own cells take up the nucleic acid and produce and secrete the
encoded antibody or antibody fragment. The delivery of the nucleic
acid can be by any means, as disclosed herein, for example.
G. LYP-1 COMPOSITIONS
[0123] Disclosed are Lyp-1 compositions comprising SEQ ID NO:1
(Lyp-1), and optionally also comprising a moiety. The moiety can be
any molecule. For example, disclosed are moieties containing a
therapeutic agent linked to SEQ ID NO:1. Preferably the moiety is a
molecule that is usefully targeted to the gC1q/p32 receptor. For
example, moieties that affect the target, such as moieties with
therapeutic effect, or that facilitate detection, visualization or
imaging of the target, such as fluorescent molecule or
radionuclides. The disclosed peptides, such as SEQ ID NO:1, that
selectively interact with gC1qR/p32 can be usefully combined with,
for example, moieties that can, for example, affect tumors and
cancer, reduce or eliminate inflammation or infection, and/or
promote wound healing. A variety of therapeutic agents are useful
in the Lyp-1 compositions, including, without limitation, cancer
chemotherapeutic agents, cytotoxic agents, anti-angiogenic agents,
polypeptides, nucleic acid molecules and small molecules.
[0124] A Lyp-1 composition can comprise, for example, two or more,
three or more, five or more, ten or more, twenty or more, thirty or
more, forty or more, fifty or more, 100 or more, 200 or more, 300
or more, 400 or more, 500 or more, or 1000 or more copies of SEQ ID
NO:1. The Lyp-1 composition can comprise peptides that all have an
identical amino acid sequence. In another embodiment, the Lyp-1
composition can comprise two or more non-identical amino acid
sequences. For example, SEQ ID NO:1 and another targeting peptide
can be used separately or together. Moieties useful in a Lyp-1
composition incorporating multiple peptides include, without
limitation, phage, retroviruses, adenoviruses, adeno-associated
viruses and other viruses, cells, liposomes, polymeric matrices,
non-polymeric matrices, particles such as gold particles,
microdevices, nanodevices, and nano-scale semiconductor
materials.
[0125] A Lyp-1 composition can contain, for example, a liposome or
other polymeric matrix linked to at least two peptides. If desired,
the liposome or other polymeric matrix can be linked to at least
ten, at least 100 or at least 1000 peptides such as SEQ ID NO:1.
Liposomes can be useful in such conjugates; liposomes consist of
phospholipids or other lipids, are nontoxic, physiologically
acceptable and metabolizable carriers that are relatively simple to
make and administer (Gregoriadis, Liposome Technology, Vol. 1 (CRC
Press, Boca Raton, Fla. (1984)). The liposome or other polymeric
matrix can optionally include another component such as, without
limitation, a therapeutic agent, cancer chemotherapeutic agent,
cytotoxic agent, anti-angiogenic agent, polypeptide or nucleic acid
molecule.
[0126] Components of the disclosed Lyp-1 compositions can be
combined, linked and/or coupled in any suitable manner. For
example, moieties and peptides can be associated covalently or
non-covalently, directly or indirectly, with or without a linker
moiety.
1. Moieties
[0127] Disclosed are compositions useful for directing a moiety to
a target. For example, the moiety can be incorporated into a Lyp-1
composition. As used herein, the term "moiety" is used broadly to
mean a physical, chemical, or biological material that generally
imparts a biologically useful function to a linked molecule. A
moiety can be any natural or normatural material including, without
limitation, a biological material, such as a cell, phage or other
virus; an organic chemical such as a small molecule; a
radionuclide; a nucleic acid molecule or oligonucleotide; a
polypeptide; or a peptide. Useful moieties include, but are not
limited to, therapeutic agents such as cancer chemotherapeutic
agents, cytotoxic agents, pro-apoptotic agents, and anti-angiogenic
agents; detectable labels and imaging agents; and tags or other
insoluble supports. Useful moieties further include, without
limitation, phage and other viruses, cells, liposomes, polymeric
matrices, non-polymeric matrices or particles such as gold
particles, microdevices and nanodevices, and nano-scale
semiconductor materials. These and other moieties known in the art
can be components of a conjugate.
[0128] i. Therapeutic Agents
[0129] The moiety can be a therapeutic agent. As used herein, the
term "therapeutic agent" means a molecule which has one or more
biological activities in a normal or pathologic tissue. A variety
of therapeutic agents can be used as a moiety.
[0130] In some embodiments, the therapeutic agent can be a cancer
chemotherapeutic agent. As used herein, a "cancer chemotherapeutic
agent" is a chemical agent that inhibits the proliferation, growth,
life-span or metastatic activity of cancer cells. Such a cancer
chemotherapeutic agent can be, without limitation, a taxane such as
docetaxel; an anthracyclin such as doxorubicin; an alkylating
agent; a vinca alkaloid; an anti-metabolite; a platinum agent such
as cisplatin or carboplatin; a steroid such as methotrexate; an
antibiotic such as adriamycin; a isofamide; or a selective estrogen
receptor modulator; an antibody such as trastuzumab.
[0131] Taxanes are chemotherapeutic agents useful in Lyp-1
compositions. Useful taxanes include, without limitation, docetaxel
(Taxotere; Aventis Pharmaceuticals, Inc.; Parsippany, N.J.) and
paclitaxel (Taxol; Bristol-Myers Squibb; Princeton, N.J.). See, for
example, Chan et al., J. Clin. Oncol. 17:2341-2354 (1999), and
Paridaens et al., J. Clin. Oncol. 18:724 (2000).
[0132] A cancer chemotherapeutic agent useful in a Lyp-1
composition also can be an anthracyclin such as doxorubicin,
idarubicin or daunorubicin. Doxorubicin is a commonly used cancer
chemotherapeutic agent and can be useful, for example, for treating
breast cancer (Stewart and Ratain, In: "Cancer: Principles and
practice of oncology" 5th ed., chap. 19 (eds. DeVita, Jr., et al.;
J. P. Lippincott 1997); Harris et al., In "Cancer: Principles and
practice of oncology," supra, 1997). In addition, doxorubicin has
anti-angiogenic activity (Folkman, Nature Biotechnology 15:510
(1997); Steiner, In "Angiogenesis: Key principles-Science,
technology and medicine," pp. 449-454 (eds. Steiner et al.;
Birkhauser Verlag, 1992)), which can contribute to its
effectiveness in treating cancer.
[0133] An alkylating agent such as melphalan or chlorambucil also
can be a useful cancer chemotherapeutic agent. Similarly, a vinca
alkaloid such as vindesine, vinblastine or vinorelbine; or an
antimetabolite such as 5-fluorouracil, 5-fluorouridine or a
derivative thereof can be a useful cancer chemotherapeutic
agent.
[0134] A platinum agent also can be a useful cancer
chemotherapeutic agent. Such a platinum agent can be, for example,
cisplatin or carboplatin as described, for example, in Crown,
Seminars in Oncol. 28:28-37 (2001). Other useful cancer
chemotherapeutic agents include, without limitation, methotrexate,
mitomycin-C, adriamycin, ifosfamide and ansamycins.
[0135] A cancer chemotherapeutic agent useful for treatment of
breast cancer and other hormonally-dependent cancers also can be an
agent that antagonizes the effect of estrogen, such as a selective
estrogen receptor modulator or an anti-estrogen. The selective
estrogen receptor modulator, tamoxifen, is a cancer
chemotherapeutic agent that can be used in a conjugate for
treatment of breast cancer (Fisher et al., J. Natl. Cancer Instit.
90:1371-1388 (1998)).
[0136] The therapeutic agent can be an antibody such as a humanized
monoclonal antibody.
[0137] As an example, the anti-epidermal growth factor receptor 2
(HER2) antibody, trastuzumab (Herceptin; Genentech, South San
Francisco, Calif.) can be a therapeutic agent useful for treating
HER2/neu overexpressing breast cancers (White et al., Annu Rev.
Med. 52:125-141 (2001)).
[0138] Useful therapeutic agents also can be a cytotoxic agent,
which, as used herein, can be any molecule that directly or
indirectly promotes cell death. Useful cytotoxic agents include,
without limitation, small molecules, polypeptides, peptides,
peptidomimetics, nucleic acid-molecules, cells and viruses. As
non-limiting examples, useful cytotoxic agents include cytotoxic
small molecules such as doxorubicin, docetaxel or trastuzumab;
antimicrobial peptides such as those described further below;
pro-apoptotic polypeptides such as caspases and toxins, for
example, caspase-8; diphtheria toxin A chain, Pseudomonas exotoxin
A, cholera toxin, ligand fusion toxins such as DAB389EGF, ricinus
communis toxin (ricin); and cytotoxic cells such as cytotoxic T
cells. See, for example, Martin et al., Cancer Res. 60:3218-3224
(2000); Kreitman and Pastan, Blood 90:252-259 (1997); Allam et al.,
Cancer Res. 57:2615-2618 (1997); and Osborne and Coronado-Heinsohn,
Cancer J. Sci. Am. 2:175 (1996). One skilled in the art understands
that these and additional cytotoxic agents described herein or
known in the art can be useful in the disclosed conjugates and
methods.
[0139] In one embodiment, a therapeutic agent can be a therapeutic
polypeptide. As used herein, a therapeutic polypeptide can be any
polypeptide with a biologically useful function. Useful therapeutic
polypeptides encompass, without limitation, cytokines, antibodies,
cytotoxic polypeptides; pro-apoptotic polypeptides; and
anti-angiogenic polypeptides. As non-limiting examples, useful
therapeutic polypeptides can be a cytokine such as tumor necrosis
factor-.alpha. (TNF-.alpha.), tumor necrosis factor-.beta.
(TNF-.beta.), granulocyte macrophage colony stimulating factor
(GM-CSF), granulocyte colony stimulating factor (G-CSF), interferon
alpha (IFN-.alpha.); interferon gamma (IFN-.gamma.), interleukin-1
(IL-1), interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-4
(IL-4), interleukin-6 (IL-6), interleukin-7 (IL-7), interleukin-10
(IL-10), interleukin-12 (IL-12), lymphotactin (LTN) or dendritic
cell chemokine 1 (DC-CK1); an anti-HER2 antibody or fragment
thereof a cytotoxic polypeptide including a toxin or caspase, for
example, diphtheria toxin A chain, Pseudomonas exotoxin A, cholera
toxin, a ligand fusion toxin such as DAB389EGF or ricin; or an
anti-angiogenic polypeptide such as angiostatin, endostatin,
thrombospondin, platelet factor 4; anastellin; or one of those
described further herein or known in the art (see below). It is
understood that these and other polypeptides with biological
activity can be a "therapeutic polypeptide."
[0140] A therapeutic agent can also be an anti-angiogenic agent. As
used herein, the term "anti-angiogenic agent" means a molecule that
reduces or prevents angiogenesis, which is the growth and
development of blood vessels. A variety of anti-angiogenic agents
can be prepared by routine methods. Such anti-angiogenic agents
include, without limitation, small molecules; proteins such as
dominant negative forms of angiogenic factors, transcription
factors and antibodies; peptides; and nucleic acid molecules
including ribozymes, antisense oligonucleotides, and nucleic acid
molecules encoding, for example, dominant negative forms of
angiogenic factors and receptors, transcription factors, and
antibodies and antigen-binding fragments thereof. See, for example,
Hagedorn and Bikfalvi, Crit. Rev. Oncol. Hematol. 34:89-110 (2000),
and Kirsch et al., J. Neurooncol. 50:149-163 (2000).
[0141] Vascular endothelial growth factor (VEGF) has been shown to
be important for angiogenesis in many types of cancer, including
breast cancer angiogenesis in vivo (Borgstrom et al., Anticancer
Res. 19:4213-4214 (1999)). The biological effects of VEGF include
stimulation of endothelial cell proliferation, survival, migration
and tube formation, and regulation of vascular permeability. An
anti-angiogenic agent can be, for example, an inhibitor or
neutralizing antibody that reduces the expression or signaling of
VEGF or another angiogenic factor, for example, an anti-VEGF
neutralizing monoclonal antibody (Borgstrom et al., supra, 1999).
An anti-angiogenic agent also can inhibit another angiogenic factor
such as a member of the fibroblast growth factor family such as
FGF-1 (acidic), FGF-2 (basic), FGF-4 or FGF-5 (Slavin et al., Cell
Biol. Int. 19:431-444 (1995); Folkman and Shing, J. Biol. Chem.
267:10931-10934 (1992)) or an angiogenic factor such as
angiopoietin-1, a factor that signals through the endothelial
cell-specific Tie2 receptor tyrosine kinase (Davis et al., Cell
87:1161-1169 (1996); and Suri et al., Cell 87:1171-1180 (1996)), or
the receptor of one of these angiogenic factors. It is understood
that a variety of mechanisms can act to inhibit activity of an
angiogenic factor including, without limitation, direct inhibition
of receptor binding, indirect inhibition by reducing secretion of
the angiogenic factor into the extracellular space, or inhibition
of expression, function or signaling of the angiogenic factor.
[0142] A variety of other molecules also can function as
anti-angiogenic agents including, without limitation, angiostatin;
a kringle peptide of angiostatin; endostatin; anastellin,
heparin-binding fragments of fibronectin; modified forms of
antithrombin; collagenase inhibitors; basement membrane turnover
inhibitors; angiostatic steroids; platelet factor 4 and fragments
and peptides thereof; thrombospondin and fragments and peptides
thereof; and doxorubicin (O'Reilly et al., Cell 79:315-328 (1994));
O'Reilly et al., Cell 88:277-285 (1997); Homandberg et al., Am. J.
Path. 120:327-332 (1985); Homandberg et-al., Biochim. Biophys. Acta
874:61-71 (1986); and O'Reilly et al., Science 285:1926-1928
(1999)). Commercially available anti-angiogenic agents include, for
example, angiostatin, endostatin, metastatin and 2ME2 (EntreMed;
Rockville, Md.); anti-VEGF antibodies such as Avastin (Genentech;
South San Francisco, Calif.); and VEGFR-2 inhibitors such as
SU5416, a small molecule inhibitor of VEGFR-2 (SUGEN; South San
Francisco, Calif.) and SU6668 (SUGEN), a small molecule inhibitor
of VEGFR-2, platelet derived growth factor and fibroblast growth
factor I receptor. It is understood that these and other
anti-angiogenic agents can be prepared by routine methods and are
encompassed by the term "anti-angiogenic agent" as used herein.
[0143] The Lyp-1 compositions disclosed herein can also be used to
site of inflammation. Moieties useful for this purpose can include
therapeutic agents belonging to several basic groups including
anti-inflammatory agents which prevent inflammation, restenosis
preventing drugs which prevent tissue growth, anti-thrombogenic
drugs which inhibit or control formation of thrombus or
thrombolytics, and bioactive agents which regulate tissue growth
and enhance healing of the tissue. Examples of useful therapeutic
agents include but are not limited to steroids, fibronectin,
anti-clotting drugs, anti-platelet function drugs, drugs which
prevent smooth muscle cell growth on inner surface wall of vessel,
heparin, heparin fragments, aspirin, coumadin, tissue plasminogen
activator (TPA), urokinase, hirudin, streptokinase,
antiproliferatives (methotrexate, cisplatin, fluorouracil,
Adriamycin), antioxidants (ascorbic acid, beta carotene, vitamin
E), antimetabolites, thromboxane inhibitors, non-steroidal and
steroidal anti-inflammatory drugs, beta and calcium channel
blockers, genetic materials including DNA and RNA fragments,
complete expression genes, antibodies, lymphokines, growth factors,
prostaglandins, leukotrienes, laminin, elastin, collagen, and
integrins.
[0144] Useful therapeutic agents also can be antimicrobial
peptides. This can be particularly useful to target a wound or
other infected sites. Thus, for example, also disclosed are Lyp-1
compositions comprising an antimicrobial peptide, where the Lyp-1
composition is selectively internalized and exhibits a high
toxicity to the targeted area. Useful antimicrobial peptides can
have low mammalian cell toxicity when not incorporated into the
Lyp-1 composition. As used herein, the term "antimicrobial peptide"
means a naturally occurring or synthetic peptide having
antimicrobial activity, which is the ability to kill or slow the
growth of one or more microbes. An antimicrobial peptide can, for
example, kill or slow the growth of one or more strains of bacteria
including a Gram-positive or Gram-negative bacteria, or a fungi or
protozoa. Thus, an antimicrobial peptide can have, for example,
bacteriostatic or bacteriocidal activity against, for example, one
or more strains of Escherichia coli, Pseudomonas aeruginosa or
Staphylococcus aureus. While not wishing to be bound by the
following, an antimicrobial peptide can have biological activity
due to the ability to form ion channels through membrane bilayers
as a consequence of self-aggregation.
[0145] An antimicrobial peptide is typically highly basic and can
have a linear or cyclic structure. As discussed further below, an
antimicrobial peptide can have an amphipathic .alpha.-helical
structure (see U.S. Pat. No. 5,789,542; Javadpour et al., J. Med.
Chem. 39:3107-3113 (1996); and Blondelle and Houghten, Biochem. 31:
12688-12694 (1992)). An antimicrobial peptide also can be, for
example, a .beta.-strand/sheet-forming peptide as described in
Mancheno et al., J. Peptide Res. 51:142-148 (1998).
[0146] An antimicrobial peptide can be a naturally occurring or
synthetic peptide. Naturally occurring antimicrobial peptides have
been isolated from biological sources such as bacteria, insects,
amphibians, and mammals and are thought to represent inducible
defense proteins that can protect the host organism from bacterial
infection. Naturally occurring antimicrobial peptides include the
gramicidins, magainins, mellitins, defensins and cecropins (see,
for example, Maloy and Kari, Biopolymers 37:105-122 (1995);
Alvarez-Bravo et al., Biochem. J. 302:535-538 (1994); Bessalle et
al., FEBS 274:-151-155 (1990.); and Blondelle and Houghten in
Bristol (Ed.), Annual Reports in Medicinal Chemistry pages 159-168
Academic Press, San Diego). An antimicrobial peptide also can be an
analog of a natural peptide, especially one that retains or
enhances amphipathicity (see below).
[0147] An antimicrobial peptide incorporated into a Lyp-1
composition can have low mammalian cell toxicity linked to Lyp-1.
Mammalian cell toxicity readily can be assessed using routine
assays. As an example, mammalian cell toxicity can be assayed by
lysis of human erythrocytes in vitro as described in Javadpour et
al., supra, 1996. An antimicrobial peptide having low mammalian
cell toxicity is not lytic to human erythrocytes or requires
concentrations of greater than 100 .mu.M for lytic activity,
preferably concentrations greater than 200, 300, 500 or 1000
.mu.M.
[0148] In one embodiment, disclosed are Lyp-1 compositions in which
the antimicrobial peptide portion promotes disruption of
mitochondrial membranes when internalized by eukaryotic cells. In
particular, such an antimicrobial peptide preferentially disrupts
mitochondrial membranes as compared to eukaryotic membranes.
Mitochondrial membranes, like bacterial membranes but in contrast
to eukaryotic plasma membranes, have a high content of negatively
charged phospholipids. An antimicrobial peptide can be assayed for
activity in disrupting mitochondrial membranes using, for example,
an assay for mitochondrial swelling or another assay well known in
the art. .sub.D(KLAKLAK).sub.2, (SEQ ID NO:6) for example, is an
antimicrobial peptide which induces marked mitochondrial swelling
at a concentration of 10 .mu.M, significantly less than the
concentration required to kill eukaryotic cells.
[0149] An antimicrobial peptide that induces significant
mitochondrial swelling at, for example, 50 .mu.M, 40 .mu.M, 30
.mu.M, 20 .mu.M, 10 .mu.M, or less, is considered a peptide that
promotes disruption of mitochondrial membranes.
[0150] Antimicrobial peptides generally have random coil
conformations in dilute aqueous solutions, yet high levels of
helicity can be induced by helix-promoting solvents and amphipathic
media such as micelles, synthetic bilayers or cell membranes.
.alpha.-Helical structures are well known in the art, with an ideal
.alpha.-helix characterized by having 3.6 residues per turn and a
translation of 1.5 .ANG. per residue (5.4 .ANG. per turn; see
Creighton, Proteins: Structures and Molecular Properties W. H
Freeman, New York (1984)). In an amphipathic .alpha.-helical
structure, polar and non-polar amino acid residues are aligned into
an amphipathic helix, which is an .alpha.-helix in which the
hydrophobic amino acid residues are predominantly on one face, with
hydrophilic residues predominantly on the opposite face when the
peptide is viewed along the helical axis.
[0151] Antimicrobial peptides of widely varying sequence have been
isolated, sharing an amphipathic .alpha.-helical structure as a
common feature (Saberwal et al., Biochim. Biophys. Acta
1197:109-131 (1994)). Analogs of native peptides with amino acid
substitutions predicted to enhance amphipathicity and helicity
typically have increased antimicrobial activity. In general,
analogs with increased antimicrobial activity also have increased
cytotoxicity against mammalian cells (Maloy et al., Biopolymers
37:105-122 (1995)).
[0152] As used herein in reference to an antimicrobial peptide, the
term "amphipathic .alpha.-helical structure" means an .alpha.-helix
with a hydrophilic face containing several polar residues at
physiological pH and a hydrophobic face containing nonpolar
residues. A polar residue can be, for example, a lysine or arginine
residue, while a nonpolar residue can be, for example, a leucine or
alanine residue. An antimicrobial peptide having an amphipathic
.alpha.-helical structure generally has an equivalent number of
polar and nonpolar residues within the amphipathic domain and a
sufficient number of basic residues to give the peptide an overall
positive charge at neutral pH (Saberwal et al., Biochim. Biophys.
Acta 1197:109-131 (1994)). One skilled in the art understands that
helix-promoting amino acids such as leucine and alanine can be
advantageously included in an antimicrobial peptide (see, for
example, Creighton, supra, 1984). Synthetic, antimicrobial peptides
having an amphipathic .alpha.-helical structure are known in the
art, for example, as described in U.S. Pat. No. 5,789,542 to
McLaughlin and Becker.
[0153] It is understood by one skilled in the art of medicinal
oncology that these and other agents are useful therapeutic agents,
which can be used separately or together in the disclosed
compositions and methods. Thus, it is understood that a Lyp-1
composition can contain one or more of such therapeutic agents and
that additional components can be included as part of the
composition, if desired. As a non-limiting example, it can be
desirable in some cases to utilize an oligopeptide spacer between
Lyp-1 and the therapeutic agent (Fitzpatrick and Garnett,
Anticancer Drug Des. 10:1-9 (1995)).
[0154] Other useful agents include thrombolytics, aspirin,
anticoagulants, painkillers and tranquilizers, beta-blockers,
ace-inhibitors, nitrates, rhythm-stabilizing drugs, and diuretics.
Agents that limit damage to the heart work best if given within a
few hours of the heart attack. Thrombolytic agents that break up
blood clots and enable oxygen-rich blood to flow through the
blocked artery increase the patient's chance of survival if given
as soon as possible after the heart attack. Thrombolytics given
within a few hours after a heart attack are the most effective.
Injected intravenously, these include anisoylated plasminogen
streptokinase activator complex (APSAC) or anistreplase,
recombinant tissue-type plasminogen activator (r-tPA), and
streptokinase. The disclosed Lyp-1 compositions can use any of
these or similar agents.
[0155] ii. Detectable Agents
[0156] The moiety in the disclosed Lyp-1 compositions can also be a
detectable agent. A variety of detectable agents are useful in the
disclosed methods. As used herein, the term "detectable agent"
refers to any molecule which can be detected. Useful detectable
agents include compounds and molecules that can be administered in
vivo and subsequently detected. Detectable agents useful in the
disclosed compositions and methods include yet are not limited to
radiolabels and fluorescent molecules. The detectable agent can be,
for example, any molecule that facilitates detection, either
directly or indirectly, preferably by a non-invasive and/or in vivo
visualization technique. For example, a detectable agent can be
detectable by any known imaging techniques, including, for example,
a radiological technique. Detectable agents can include, for
example, a contrasting agent, e.g., where the contrasting agent is
ionic or non-ionic. In some embodiments, for instance, the
detectable agent comprises a tantalum compound and/or a barium
compound, e.g., barium sulfate. In some embodiments, the detectable
agent comprises iodine, such as radioactive iodine. In some
embodiments, for instance, the detectable agent comprises an
organic iodo acid, such as iodo carboxylic acid, triiodophenol,
iodoform, and/or tetraiodoethylene. In some embodiments, the
detectable agent comprises a non-radioactive detectable agent,
e.g., a non-radioactive isotope. For example, Gd can be used as a
non-radioactive detectable agent in certain embodiments.
[0157] Other examples of detectable agents include molecules which
emit or can be caused to emit detectable radiation (e.g.,
fluorescence excitation, radioactive decay, spin resonance
excitation, etc.), molecules which affect local electromagnetic
fields (e.g., magnetic, ferromagnetic, ferromagnetic, paramagnetic,
and/or superparamagnetic species), molecules which absorb or
scatter radiation energy (e.g., chromophores and/or fluorophores),
quantum dots, heavy elements and/or compounds thereof. See, e.g.,
detectable agents described in U.S. Publication No. 2004/0009122.
Other examples of detectable agents include a proton-emitting
molecules, a radiopaque molecules, and/or a radioactive molecules,
such as a radionuclide like Tc-99m and/or Xe-13. Such molecules can
be used as a radiopharmaceutical. In still other embodiments, the
disclosed compositions can comprise one or more different types of
detectable agents, including any combination of the detectable
agents disclosed herein.
[0158] Useful fluorescent moieties include fluorescein
isothiocyanate (FITC), 5,6-carboxymethyl fluorescein, Texas red,
nitrobenz-2-oxa-1,3-diazol-4-yl (NBD), coumarin, dansyl chloride,
rhodamine, amino-methyl coumarin (AMCA), Eosin, Erythrosin,
BODIPY.RTM., Cascade Blue.RTM., Oregon Green.RTM., pyrene,
lissamine, xanthenes, acridines, oxazines, phycoerythrin,
macrocyclic chelates of lanthanide ions such as Quantum Dye.TM.,
fluorescent energy transfer dyes, such as thiazole orange-ethidium
heterodimer, and the cyanine dyes Cy3, Cy3.5, Cy5, Cy5.5 and Cy7.
Examples of other specific fluorescent labels include
3-Hydroxypyrene 5,8,10-Tri Sulfonic acid, 5-Hydroxy Tryptamine
(5-HT), Acid Fuchsin, Alizarin Complexon, Alizarin Red,
Allophycocyanin, Aminocoumarin, Anthroyl Stearate, Astrazon
Brilliant Red 4G, Astrazon Orange R, Astrazon Red 6B, Astrazon
Yellow 7 GLL, Atabrine, Auramine, Aurophosphine, Aurophosphine G,
BAO 9 (Bisaminophenyloxadiazole), BCECF, Berberine Sulphate,
Bisbenzamide, Blancophor FFG Solution, Blancophor SV, Bodipy F1,
Brilliant Sulphoflavin FF, Calcien Blue, Calcium Green, Calcofluor
RW Solution, Calcofluor White, Calcophor White ABT Solution,
Calcophor White Standard Solution, Carbostyryl, Cascade Yellow,
Catecholamine, Chinacrine, Coriphosphine O, Coumarin-Phalloidin,
CY3.1 8, CY5.1 8, CY7, Dans (1-Dimethyl Amino Naphaline 5 Sulphonic
Acid), Dansa (Diamino Naphtyl Sulphonic Acid), Dansyl NH--CH3,
Diamino Phenyl Oxydiazole (DAO), Dimethylamino-5-Sulphonic acid,
Dipyrrometheneboron Difluoride, Diphenyl Brilliant Flavine 7GFF,
Dopamine, Erythrosin ITC, Euchrysin, FIF (Formaldehyde Induced
Fluorescence), Flazo Orange, Fluo 3, Fluorescamine, Fura-2,
Genacryl Brilliant Red B, Genacryl Brilliant Yellow 10GF, Genacryl
Pink 3G, Genacryl Yellow 5GF, Gloxalic Acid, Granular Blue,
Haematoporphyrin, Indo-1, Intrawhite Cf Liquid, Leucophor PAF,
Leucophor SF, Leucophor WS, Lissamine Rhodamine B200 (RD200),
Lucifer Yellow CH, Lucifer Yellow VS, Magdala Red, Marina Blue,
Maxilon Brilliant Flavin 10 GFF, Maxilon Brilliant Flavin 8 GFF,
MPS (Methyl Green Pyronine Stilbene), Mithramycin, NBD Amine,
Nitrobenzoxadidole, Noradrenaline, Nuclear Fast Red, Nuclear
Yellow, Nylosan Brilliant Flavin EBG, Oxadiazole, Pacific Blue,
Pararosaniline (Feulgen), Phorwite AR Solution, Phorwite BKL,
Phorwite Rev, Phorwite RPA, Phosphine 3R, Phthalocyanine,
Phycoerythrin R, Polyazaindacene Pontochrome Blue Black, Porphyrin,
Primuline, Procion Yellow, Pyronine, Pyronine B, Pyrozal Brilliant
Flavin 7GF, Quinacrine Mustard, Rhodamine 123, Rhodamine 5 GLD,
Rhodamine 6G, Rhodamine B, Rhodamine B 200, Rhodamine B Extra,
Rhodamine BB, Rhodamine BG, Rhodamine WT, Serotonin, Sevron
Brilliant Red 2B, Sevron Brilliant Red 4G, Sevron Brilliant Red B,
Sevron Orange, Sevron Yellow L, SITS (Primuline), SITS (Stilbene
Isothiosulphonic acid), Stilbene, Snarf 1, sulpho Rhodamine B Can
C, Sulpho Rhodamine G Extra, Tetracycline, Thiazine Red R,
Thioflavin S, Thioflavin TCN, Thioflavin 5, Thiolyte, Thiozol
Orange, Tinopol CBS, True Blue, Ultralite, Uranine B, Uvitex SFC,
Xylene Orange, and XRITC.
[0159] Particularly useful fluorescent labels include fluorescein
(5-carboxyfluorescein-N-hydroxysuccinimide ester), rhodamine
(5,6-tetramethyl rhodamine), and the cyanine dyes Cy3, Cy3.5, Cy5,
Cy5.5 and Cy7. The absorption and emission maxima, respectively,
for these fluors are: FITC (490 nm; 520 nm), Cy3 (554 nm; 568 nm),
Cy3.5 (581 nm; 588 nm), Cy5 (652 nm: 672 nm), Cy5.5 (682 nm; 703
nm) and Cy7 (755 nm; 778 nm), thus allowing their simultaneous
detection. Other examples of fluorescein dyes include
6-carboxyfluorescein (6-FAM), 2',4',1,4,-tetrachlorofluorescein
(TET), 2',4',5',7',1,4-hexachlorofluorescein (HEX),
2',7'-dimethoxy-4',5'-dichloro-6-carboxyrhodamine (JOE),
2'-chloro-5'-fluoro-7',8'-fused
phenyl-1,4-dichloro-6-carboxyfluorescein (NED), and
2'-chloro-7'-phenyl-1,4-dichloro-6-carboxyfluorescein (VIC).
Fluorescent labels can be obtained from a variety of commercial
sources, including Amersham Pharmacia Biotech, Piscataway, N.J.;
Molecular Probes, Eugene, Oreg.; and Research Organics, Cleveland,
Ohio. Fluorescent probes and there use are also described in
Handbook of Fluorescent Probes and Research Products by Richard P.
Haugland.
[0160] Further examples of radioactive detectable agents include
gamma emitters, e.g., the gamma emitters In-111, I-125 and I-131,
Rhenium-186 and 188, and Br-77 (see. e.g., Thakur, M. L. et al.,
Throm Res. Vol. 9 pg. 345 (1976); Powers et al., Neurology Vol. 32
pg. 938 (1982); and U.S. Pat. No. 5,011,686); positron emitters,
such as Cu-64, C-11, and O-15, as well as Co-57, Cu-67, Ga-67,
Ga-68, Ru-97, Tc-99m, In-113m, Hg-197, Au-198, and Pb-203. Other
radioactive detectable agents can include, for example tritium,
C-14 and/or thallium, as well as Rh-105, I-123, Nd-147, Pm-151,
Sm-153, Gd-159, Tb-161, Er-171 and/or Tl-201.
[0161] The use of Technitium-99m (Tc-99m) is preferable and has
been described in other applications, for example, see U.S. Pat.
No. 4,418,052 and U.S. Pat. No. 5,024,829. Tc-99m is a gamma
emitter with single photon energy of 140 keV and a half-life of
about 6 hours, and can readily be obtained from a Mo-99/Tc-99
generator.
[0162] In some embodiments, compositions comprising a radioactive
detectable agent can be prepared by coupling a targeting moiety
with radioisotopes suitable for detection. Coupling can occur via a
chelating agent such as diethylenetriaminepentaacetic acid (DTPA),
4,7,10-tetraazacyclododecane-N--,N',N'',N'''-tetraacetic acid
(DOTA) and/or metallothionein, any of which can be covalently
attached to the targeting moiety. In some embodiments, an aqueous
mixture of technetium-99m, a reducing agent, and a water-soluble
ligand can be prepared and then allowed to react with a disclosed
targeting moiety. Such methods are known in the art, see e.g.,
International Publication No. WO 99/64446. In some embodiments,
compositions comprising radioactive iodine, can be prepared using
an exchange reaction. For example, exchange of hot iodine for cold
iodine is well known in the art. Alternatively, a radio-iodine
labeled compound can be prepared from the corresponding bromo
compound via a tributylstannyl intermediate.
[0163] Magnetic detectable agents include paramagnetic contrasting
agents, e.g., gadolinium diethylenetriaminepentaacetic acid, e.g.,
used with magnetic resonance imaging (MRI) (see, e.g., De Roos, A.
et al., Int. J. Card. Imaging Vol. 7 pg. 133 (1991)). Some
preferred embodiments use as the detectable agent paramagnetic
atoms that are divalent or trivalent ions of elements with an
atomic number 21, 22, 23, 24, 25, 26, 27, 28, 29, 42, 44, 58, 59,
60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70. Suitable ions
include, but are not limited to, chromium(III), manganese(II),
iron(II), iron(III), cobalt(II), nickel(II), copper(II),
praseodymium(III), neodymium(III), samarium(III) and
ytterbium(III), as well as gadolinium(III), terbium(III),
dysoprosium(III), holmium(III), and erbium(III). Some preferred
embodiments use atoms with strong magnetic moments, e.g.,
gadolinium(III).
[0164] In some embodiments, compositions comprising magnetic
detectable agents can be prepared by coupling a targeting moiety
with a paramagnetic atom. For example, the metal oxide or a metal
salt, such as a nitrate, chloride or sulfate salt, of a suitable
paramagnetic atom can be dissolved or suspended in a water/alcohol
medium, such as methyl, ethyl, and/or isopropyl alcohol. The
mixture can be added to a solution of an equimolar amount of the
targeting moiety in a similar water/alcohol medium and stirred. The
mixture can be heated moderately until the reaction is complete or
nearly complete. Insoluble compositions formed can be obtained by
filtering, while soluble compositions can be obtained by
evaporating the solvent. If acid groups on the chelating moieties
remain in the disclosed compositions, inorganic bases (e.g.,
hydroxides, carbonates and/or bicarbonates of sodium, potassium
and/or lithium), organic bases, and/or basic amino acids can be
used to neutralize acidic groups, e.g., to facilitate isolation or
purification of the composition.
[0165] In preferred embodiments, the detectable agent can be
coupled to Lyp-1 in such a way so as not to interfere with the
ability of Lyp-1 to interact with gC1qR/p32. In some embodiments,
the detectable agent can be chemically bound to Lyp-1. In some
embodiments, the detectable agent can be chemically bound to a
moiety that is itself chemically bound to Lyp-1, indirectly linking
the imaging and targeting moieties.
H. PHARMACEUTICAL COMPOSITIONS AND CARRIERS
[0166] The disclosed compositions can be administered in vivo in a
pharmaceutically acceptable carrier. By "pharmaceutically
acceptable" is meant a material that is not biologically or
otherwise undesirable, i.e., the material can be administered to a
subject, along with the Lyp-1 composition, without causing any
undesirable biological effects or interacting in a deleterious
manner with any of the other components of the pharmaceutical
composition in which it is contained. The carrier would naturally
be selected to minimize any degradation of the active ingredient
and to minimize any adverse side effects in the subject, as would
be well known to one of skill in the art. The materials can be in
solution, suspension (for example, incorporated into
microparticles, liposomes, or cells).
1. Pharmaceutically Acceptable Carriers
[0167] The compositions, including antibodies, can be used
therapeutically in combination with a pharmaceutically acceptable
carrier.
[0168] Suitable carriers and their formulations are described in
Remington: The Science and Practice of Pharmacy (19th ed.) ed. A.
R. Gennaro, Mack Publishing Company, Easton, Pa. 1995. Typically,
an appropriate amount of a pharmaceutically-acceptable salt is used
in the formulation to render the formulation isotonic. Examples of
the pharmaceutically-acceptable carrier include, but are not
limited to, saline, Ringer's solution and dextrose solution. The pH
of the solution is preferably from about 5 to about 8, and more
preferably from about 7 to about 7.5. Further carriers include
sustained release preparations such as semipermeable matrices of
solid hydrophobic polymers containing the antibody, which matrices
are in the form of shaped articles, e.g., films, liposomes or
microparticles. It will be apparent to those persons skilled in the
art that certain carriers can be more preferable depending upon,
for instance, the route of administration and concentration of
composition being administered.
[0169] Pharmaceutical carriers are known to those skilled in the
art. These most typically would be standard carriers for
administration of drugs to humans, including solutions such as
sterile water, saline, and buffered solutions at physiological pH.
The compositions can be administered intramuscularly or
subcutaneously. Other compounds will be administered according to
standard procedures used by those skilled in the art.
[0170] Pharmaceutical compositions can include carriers,
thickeners, diluents, buffers, preservatives, surface active agents
and the like in addition to the molecule of choice. Pharmaceutical
compositions can also include one or more active ingredients such
as antimicrobial agents, antiinflammatory agents, anesthetics, and
the like.
[0171] The pharmaceutical composition can be administered in a
number of ways depending on whether local or systemic treatment is
desired, and on the area to be treated. Administration can be
topically (including ophthalmically, vaginally, rectally,
intranasally), orally, by inhalation, or parenterally, for example
by intravenous drip, subcutaneous, intraperitoneal or intramuscular
injection. The disclosed antibodies can be administered
intravenously, intraperitoneally, intramuscularly, subcutaneously,
intracavity, or transdermally.
[0172] Preparations for parenteral administration include sterile
aqueous or non-aqueous solutions, suspensions, and emulsions.
Examples of non-aqueous solvents are propylene glycol, polyethylene
glycol, vegetable oils such as olive oil, and injectable organic
esters such as ethyl oleate. Aqueous carriers include water,
alcoholic/aqueous solutions, emulsions or suspensions, including
saline and buffered media. Parenteral vehicles include sodium
chloride solution, Ringer's dextrose, dextrose and sodium chloride,
lactated Ringer's, or fixed oils. Intravenous vehicles include
fluid and nutrient replenishers, electrolyte replenishers (such as
those based on Ringer's dextrose), and the like. Preservatives and
other additives can also be present such as, for example,
antimicrobials, anti-oxidants, chelating agents, and inert gases
and the like.
[0173] Formulations for topical administration can include
ointments, lotions, creams, gels, drops, suppositories, sprays,
liquids and powders. Conventional pharmaceutical carriers, aqueous,
powder or oily bases, thickeners and the like may be necessary or
desirable.
[0174] Compositions for oral administration include powders or
granules, suspensions or solutions in water or non-aqueous media,
capsules, sachets, or tablets. Thickeners, flavorings, diluents,
emulsifiers, dispersing aids or binders may be desirable.
[0175] Some of the compositions can be administered as a
pharmaceutically acceptable acid- or base-addition salt, formed by
reaction with inorganic acids such as hydrochloric acid,
hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid,
sulfuric acid, and phosphoric acid, and organic acids such as
formic acid, acetic acid, propionic acid, glycolic acid, lactic
acid, pyruvic acid, oxalic acid, malonic acid, succinic acid,
maleic acid, and fumaric acid, or by reaction with an inorganic
base such as sodium hydroxide, ammonium hydroxide, potassium
hydroxide, and organic bases such as mono-, di-, trialkyl and aryl
amines and substituted ethanolamines.
I. COMBINATORIAL CHEMISTRY/SCREENING METHODS
[0176] The disclosed compositions can be used as targets for any
combinatorial technique to identify molecules or macromolecular
molecules that interact with the disclosed compositions in a
desired way. Also disclosed are the compositions that are
identified through combinatorial techniques or screening techniques
in which the compositions disclosed in SEQ ID NO:1 or portions
thereof, are used as the target in a combinatorial or screening
protocol.
[0177] It is understood that when using the disclosed compositions
in combinatorial techniques or screening methods, molecules, such
as macromolecular molecules, will be identified that have
particular desired properties, such as interaction with gC1qR/p32.
The molecules identified and isolated when using the disclosed
compositions, such as Lyp-1, are also disclosed. Thus, the products
produced using the combinatorial or screening approaches that
involve the disclosed compositions, such as Lyp-1, are also
considered herein disclosed.
[0178] Disclosed herein are methods of screening for a compound
that interacts with a gC1q/p32 receptor, comprising: bringing into
contact a test compound, a Lyp-1 composition, and a gC1q receptor,
wherein the Lyp-1 composition comprises SEQ ID NO: 1; and detecting
unbound Lyp-1 composition, wherein a given amount of unbound Lyp-1
composition indicates a compound that interacts with gC1q/p32
receptor.
[0179] Also disclosed is a method of screening for a test compound
that modulates gC1q/p32 receptor activity, comprising: contacting a
cell that comprises the gC1q/p32 receptor with a test compound; and
detecting altered gC1q/p32 receptor activity; wherein altered
levels of gC1q/p32 receptor activity indicate a compound that
modulates gC1q/p32 receptor activity.
[0180] By "altered levels of activity" is meant that the gC1q/p32
receptor can display an increase or decrease in activity. The
increase in activity can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46,
47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63,
64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80,
81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97,
98, 99, or 100% increase, or a 1 2, 3, 4, 5, 6, 7, 8, 9, 10, 20,
25, 30, 35, 40, 45, 50, 75, or 100 fold or more increase in
activity, as compared to a standard, control, or basal level. The
decrease in activity can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46,
47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63,
64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80,
81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97,
98, 99, or 100% decrease in activity as compared to a standard,
control, or basal level. For example, a test compound can interact
with the gC1q/p32 receptor in such as way as to decrease the
ability of the gC1q/p32 receptor to interact with another compound,
thereby decreasing its activity. In another example, a test
compound can prevent the synthesis of the gC1q/p32 receptor,
thereby decreasing its activity in that way.
[0181] Disclosed is a method of screening for a test compound that
interacts with the gC1q/p32 receptor, comprising: contacting a cell
that comprises the gC1q/p32 receptor with a test compound; and
detecting interaction between the gC1q/p32 receptor and the test
compound. After the test compound has been shown to interact with
the gC1q/p32 receptor, it can further be tested for its ability to
modulate gC1q/p32 receptor activity, including the ability to treat
a gC1q/p32 receptor-related disorder.
[0182] Further disclosed is a method of screening for a test
compound that can be used to treat a gC1q/p32 receptor-related
disorder, such as cancer, comprising: contacting a cell that
comprises the gC1q/p32 receptor with a test compound; and detecting
altered gC1q/p32 receptor activity; wherein altered levels of
gC1q/p32 receptor activity indicate a compound that can modulate
gC1q/p32 receptor activity. After the test compound has been shown
to modulate gC1q/p32 receptor activity, the test compound can then
be tested for its ability to treat a gC1q/p32 receptor-related
disorder.
[0183] The modulation can comprise a decrease in gC1q/p32 receptor
activity, expression, or the ability to treat a gC1q/p32
receptor-related disease. By a "decrease" is meant that the
activity is less in the presence of the test compound than not in
the presence of the test compound. The modulation can comprise an
increase in gC1q/p32 receptor activity or related activity. By an
"increase" is meant that the activity is greater in the presence of
the test compound than not in the presence of the test
compound.
[0184] The response of the gC1q/p32 receptor can be measured in the
presence of various concentrations of test compound. The measuring
steps can also comprise measuring the response at various
concentrations of the test compound. For example, the concentration
of the test compound can range from 1 nM to 1000 .mu.M.
[0185] Assays contemplated by the invention include both binding
assays and activity assays; these assays may be performed in
conventional or high throughput formats. Modulator screens are
designed to identify stimulatory and inhibitory agents. The sources
for potential agents to be screened include natural sources, such
as a cell extract (e.g., invertebrate cells including, but not
limited to, bacterial, fungal, algal, and plant cells) and
synthetic sources, such as chemical compound libraries or
biological libraries such as antibody substance or peptide
libraries. Agents are screened for the ability to either stimulate
or inhibit the activity. Binding assays are used to detect activity
levels. Both functional and binding assays of activity are readily
adapted to screens for modulators such as agonist (stimulatory) and
antagonist (inhibitory) compounds.
[0186] Contemplated herein are a multitude of assays to screen and
identify modulators, such as agonists and antagonists, of the
gC1q/p32 receptor (and downstream activity). In one example, the
cell is immobilized and interaction with a candidate modulator is
detected. In another example, the test compound is immobilized. In
yet another example, interaction between gC1q/p32 receptor and the
test compound is assessed in a solution assay. Another contemplated
assay involves a variation of the di-hybrid assay wherein a
modulator of protein/protein interactions is identified by
detection of a positive signal in a transformed or transfected host
cell.
[0187] Candidate modulators for screening according to contemplated
by the invention include any chemical compounds, including
libraries of chemical compounds. There are a number of different
libraries used for the identification of small molecule modulators,
including: (1) chemical libraries, (2) natural product libraries,
and (3) combinatorial libraries comprised of random peptides,
oligonucleotides or organic molecules. Chemical libraries consist
of random chemical structures, or analogs of known compounds, or
analogs of compounds that have been identified as "hits" or "leads"
in prior drug discovery screens, some of which may be derived from
natural products or from non-directed synthetic organic chemistry.
Natural product libraries are collections of microorganisms,
animals, plants, or marine organisms which are used to create
mixtures for screening by: (1) fermentation and extraction of
broths from soil, plant or marine microorganisms or (2) extraction
of plants or marine organisms. Natural product libraries include
polyketides, non-ribosomal peptides, and variants (non-naturally
occurring) thereof. For a review, see Science 282:63-68 (1998).
Combinatorial libraries are composed of large numbers of peptides,
oligonucleotides, or organic compounds as a mixture. These
libraries are relatively easy to prepare by traditional automated
synthesis methods, PCR, cloning, or synthetic methods. Of
particular interest are non-peptide combinatorial libraries. Still
other libraries of interest include peptide, protein,
peptidomimetic, multiparallel synthetic collection,
recombinatorial, and polypeptide libraries. For a review of
combinatorial chemistry and libraries created therefrom, see Myers,
Curr. Opin. Biotechnol. 8:701-707 (1997). Identification of
modulators through use of the various libraries described herein
permits modification of the candidate "hit" (or "lead") to optimize
the capacity of the "hit" to modulate activity.
[0188] Candidate modulators contemplated by the invention can be
designed and include soluble forms of binding partners, as well as
chimeric, or fusion, proteins thereof. A "binding partner" as used
herein broadly encompasses non-peptide modulators, peptide
modulators (e.g., neuropeptide variants), antibodies (including
monoclonal and polyclonal antibodies, single chain antibodies,
chimeric antibodies, bifunctional/bispecific antibodies, humanized
antibodies, human antibodies, and complementary determining region
(CDR)-grafted antibodies, including compounds which include CDR
and/or antigen-binding sequences, which specifically recognize a
polypeptide as disclosed herein), antibody fragments, and modified
compounds comprising antibody domains that are immunospecific for
the expression product.
[0189] Assays that measure binding or interaction of compounds with
target proteins include assays that identify compounds that inhibit
unfolding or denaturation of a target protein, assays that separate
compounds that bind to target proteins through affinity
ultrafiltration followed by ion spray mass spectroscopy/HPLC
methods or other physical and analytical methods, capillary
electrophoresis assays and two-hybrid assays.
[0190] One such screening method to identify direct binding of test
ligands to a target protein is described in U.S. Pat. No.
5,585,277, incorporated herein by reference. This method relies on
the principle that proteins generally exist as a mixture of folded
and unfolded states, and continually alternate between the two
states. When a test ligand binds to the folded form of a target
protein (i.e., when the test ligand is a ligand of the target
protein), the target protein molecule bound by the ligand remains
in its folded state. Thus, the folded target protein is present to
a greater extent in the presence of a test ligand which binds the
target protein, than in the absence of a ligand. Binding of the
ligand to the target protein can be determined by any method which
distinguishes between the folded and unfolded states of the target
protein. The function of the target protein need not be known in
order for this assay to be performed. Virtually any agent can be
assessed by this method as a test ligand, including, but not
limited to, metals, polypeptides, proteins, lipids,
polysaccharides, polynucleotides and small organic molecules.
[0191] Another method for identifying ligands of a target protein
is described in Wieboldt et al., Anal. Chem., 69:1683-1691 (1997),
incorporated herein by reference. This technique screens
combinatorial libraries of 20-30 agents at a time in solution phase
for binding to the target protein. Agents that bind to the target
protein are separated from other library components by simple
membrane washing. The specifically selected molecules that are
retained on the filter are subsequently liberated from the target
protein and analyzed by HPLC and pneumatically assisted
electrospray (ion spray) ionization mass spectroscopy. This
procedure selects library components with the greatest affinity for
the target protein, and is particularly useful for small molecule
libraries.
[0192] Alternatively, such binding interactions are evaluated
indirectly using the yeast two-hybrid system described in Fields et
al., Nature, 340:245-246 (1989), and Fields et al., Trends in
Genetics, 10:286-292 (1994), both of which are incorporated herein
by reference. The two-hybrid system is a genetic assay for
detecting interactions between two proteins or polypeptides. It can
be used to identify proteins that bind to a known protein of
interest, or to delineate domains or residues critical for an
interaction. Variations on this methodology have been developed to
clone genes that encode DNA binding proteins, to identify peptides
that bind to a protein, and to screen for drugs. The two-hybrid
system exploits the ability of a pair of interacting proteins to
bring a transcription activation domain into close proximity with a
DNA binding domain that binds to an upstream activation sequence
(UAS) of a reporter gene, and is generally performed in yeast. The
assay requires the construction of two hybrid genes encoding (1) a
DNA-binding domain that is fused to a first protein and (2) an
activation domain fused to a second protein. The DNA-binding domain
targets the first hybrid protein to the UAS of the reporter gene;
however, because most proteins lack an activation domain, this
DNA-binding hybrid protein does not activate transcription of the
reporter gene. The second hybrid protein, which contains the
activation domain, cannot by itself activate expression of the
reporter gene because it does not bind the UAS. However, when both
hybrid proteins are present, the noncovalent interaction of the
first and second proteins tethers the activation domain to the UAS,
activating transcription of the reporter gene.
[0193] The literature is replete with examples of the use of
radiolabeled ligands in HTS binding assays for drug discovery (see
Williams, Med. Res. Rev. 11:147-184 (1991); Sweetnam et al., J.
Nat. Prod. 56:441-455 (1993) herein incorporated by reference in
their entirety for their teaching concerning high throughput
screens). It is also possible to screen for novel neuroregeneration
compounds with radiolabeled ligands in HTS binding screens. Other
reasons that recombinant receptors are preferred for HTS binding
assays include better specificity (higher relative purity) and
ability to generate large amounts of receptor material (see
Hodgson, Bio/Technology 10:973-980 (1992)).
[0194] A variety of heterologous systems are available for
expression of recombinant proteins and are well known to those
skilled in the art. Such systems include bacteria (Strosberg et
al., Trends in Pharm. Sci. 13:95-98 (1992)), yeast (Pausch, Trends
in Biotech. 15:487-494 (1997)), several kinds of insect cells
(Vanden Broeck, Intl. Rev. Cytol. 164:189-268 (1996)), amphibian
cells (Jayawickreme et al., Curr. Opin. Biotechnol. 8:629-634
(1997)) and several mammalian cell lines (CHO, HEK293, COS, etc.;
see Gerhardt et al., Eur. J. Pharmacol. 334:1-23 (1997); Wilson et
al., Brit. J. Pharmacol. 125:1387-1392 (1998)). These examples do
not preclude the use of other possible cell expression systems,
including cell lines obtained from nematodes (WO 98/37177).
[0195] Inhibition of gC1qR/p32, or downstream products or genes
related thereto, can result in a variety of biological responses,
which are typically mediated by proteins expressed in the host
cells. The proteins can be native constituents of the host cell or
can be introduced through well-known recombinant technology. They
can be mutants of native varieties as well. The proteins can be
intact or chimeric.
[0196] Fluorescence changes can also be used to monitor
ligand-induced changes in membrane potential or intracellular pH;
an automated system suitable for HTS has been described for these
purposes (Schroeder et al., J. Biomol. Screening 1:75-80 (1996)).
Among the modulators that can be identified by these assays are
natural ligand compounds; synthetic analogs and derivatives of
natural ligands; antibodies, antibody fragments, and/or
antibody-like compounds derived from natural antibodies or from
antibody-like combinatorial libraries; and/or synthetic compounds
identified by high throughput screening of libraries; and other
libraries known in the art. All modulators that interact with
gC1qR/p32 are useful for identifying Lyp-1-like polypeptides (e.g.,
for diagnostic purposes, pathological purposes, and other purposes
known in the art). Agonist and antagonist modulators are useful for
up-regulating and down-regulating gC1qR/p32 activity, respectively,
for purposes described herein.
[0197] The assays may be performed using single putative
modulators; they may also be performed using a known agonist in
combination with candidate antagonists (or visa versa).
[0198] Detectable molecules that may be used include, but are not
limited to, molecules that are detectable by spectroscopic,
photochemical, biochemical, immunochemical, electrical,
radioactive, and optical means, including but not limited to
bioluminescence, phosphorescence, and fluorescence. These
detectable molecules should be a biologically compatible molecule
and should not compromise the biological function of the molecule
and must not compromise the ability of the detectable molecule to
be detected. Preferred detectable molecules are optically
detectable molecules, including optically detectable proteins, such
that they may be excited chemically, mechanically, electrically, or
radioactively to emit fluorescence, phosphorescence, or
bioluminescence. More preferred detectable molecules are inherently
fluorescent molecules, such as fluorescent proteins, including, for
example, Green Fluorescent Protein (GFP). The detectable molecule
may be conjugated to the GRK protein by methods as described in
Barak et al. (U.S. Pat. Nos. 5,891,646 and 6,110,693). The
detectable molecule may be conjugated at the front-end, at the
back-end, or in the middle.
J. COMPUTER ASSISTED DRUG DESIGN
[0199] The disclosed compositions can be used as targets for any
molecular modeling technique to identify either the structure of
the disclosed compositions or to identify potential or actual
molecules, such as small molecules, which interact in a desired way
with the disclosed compositions.
[0200] It is understood that when using the disclosed compositions
in modeling techniques, molecules, such as macromolecular
molecules, will be identified that have particular desired
properties such as inhibition or stimulation or the target
molecule's function. The molecules identified and isolated when
using the disclosed compositions, such as Lyp-1, are also
disclosed. Thus, the products produced using the molecular modeling
approaches that involve the disclosed compositions, such as Lyp-1,
are also considered herein disclosed.
[0201] Thus, one way to isolate molecules that bind a molecule of
choice is through rational design. This can be achieved through
structural information and computer modeling. Computer modeling
technology allows visualization of the three-dimensional atomic
structure of a selected molecule and the rational design of new
compounds that will interact with the molecule. The
three-dimensional construct typically depends on data from x-ray
crystallographic analyses or NMR imaging of the selected molecule.
The molecular dynamics require force field data. The computer
graphics systems enable prediction of how a new compound will link
to the target molecule and allow experimental manipulation of the
structures of the compound and target molecule to perfect binding
specificity. Prediction of what the molecule-compound interaction
will be when small changes are made in one or both requires
molecular mechanics software and computationally intensive
computers, usually coupled with user-friendly, menu-driven
interfaces between the molecular design program and the user.
[0202] Examples of molecular modeling systems are the CHARMm and
QUANTA programs, Polygen Corporation, Waltham, Mass. CHARMm
performs the energy minimization and molecular dynamics functions.
QUANTA performs the construction, graphic modeling and analysis of
molecular structure. QUANTA allows interactive construction,
modification, visualization, and analysis of the behavior of
molecules with each other.
[0203] A number of articles review computer modeling of drugs
interactive with specific proteins, such as Rotivinen, et al., 1988
Acta Pharmaceutica Fennica 97, 159-166; Ripka, New Scientist 54-57
(Jun. 16, 1988); McKinaly and Rossmann, 1989 Annu. Rev. Pharmacol.
Toxiciol. 29, 111-122; Perry and Davies, QSAR: Quantitative
Structure-Activity Relationships in Drug Design pp. 189-193 (Alan
R. Liss, Inc. 1989); Lewis and Dean, 1989 Proc. R. Soc. Lond. 236,
125-140 and 141-162; and, with respect to a model enzyme for
nucleic acid components, Askew, et al., 1989 J. Am. Chem. Soc. 111,
1082-1090. Other computer programs that screen and graphically
depict chemicals are available from companies such as BioDesign,
Inc., Pasadena, Calif., Allelix, Inc, Mississauga, Ontario, Canada,
and Hypercube, Inc., Cambridge, Ontario. Although these are
primarily designed for application to drugs specific to particular
proteins, they can be adapted to design of molecules specifically
interacting with specific regions of DNA or RNA, once that region
is identified.
[0204] Although described above with reference to design and
generation of compounds which could alter binding, one could also
screen libraries of known compounds, including natural products or
synthetic chemicals, and biologically active materials, including
proteins, for compounds which alter substrate binding or enzymatic
activity.
K. COMPOSITIONS WITH SIMILAR FUNCTIONS
[0205] It is understood that the compositions disclosed herein have
certain functions, such as interacting with gC1qR/p32. Disclosed
herein are certain structural requirements for performing the
disclosed functions, and it is understood that there are a variety
of structures which can perform the same function which are related
to the disclosed structures, and that these structures will
ultimately achieve the same result, for example stimulation or
inhibition.
L. KITS
[0206] Disclosed herein are kits that are drawn to reagents that
can be used in practicing the methods disclosed herein. The kits
can include any reagent or combination of reagent discussed herein
or that would be understood to be required or beneficial in the
practice of the disclosed methods. For example, the kits could
include Lyp-1 and gC1q/p32 receptors.
M. MIXTURES
[0207] Whenever the method involves mixing or bringing into contact
compositions or components or reagents, performing the method
creates a number of different mixtures. For example, if the method
includes 3 mixing steps, after each one of these steps a unique
mixture is formed if the steps are performed separately. In
addition, a mixture is formed at the completion of all of the steps
regardless of how the steps were performed. The present disclosure
contemplates these mixtures, obtained by the performance of the
disclosed methods as well as mixtures containing any disclosed
reagent, composition, or component, for example, disclosed
herein.
N. SYSTEMS
[0208] Disclosed are systems useful for performing, or aiding in
the performance of, the disclosed method. Systems generally
comprise combinations of articles of manufacture such as
structures, machines, devices, and the like, and compositions,
compounds, materials, and the like. Such combinations that are
disclosed or that are apparent from the disclosure are
contemplated.
O. COMPUTER READABLE MEDIA
[0209] It is understood that the disclosed nucleic acids and
proteins can be represented as a sequence consisting of the
nucleotides of amino acids. There are a variety of ways to display
these sequences, for example the nucleotide guanosine can be
represented by G or g. Likewise the amino acid valine can be
represented by Val or V. Those of skill in the art understand how
to display and express any nucleic acid or protein sequence in any
of the variety of ways that exist, each of which is considered
herein disclosed. Specifically contemplated herein is the display
of these sequences on computer readable mediums, such as,
commercially available floppy disks, tapes, chips, hard drives,
compact disks, and video disks, or other computer readable mediums.
Also disclosed are the binary code representations of the disclosed
sequences. Those of skill in the art understand what computer
readable mediums. Thus, computer readable mediums on which the
nucleic acids or protein sequences are recorded, stored, or
saved.
P. PEPTIDE SYNTHESIS
[0210] The compositions disclosed herein and the compositions
necessary to perform the disclosed methods can be made using any
method known to those of skill in the art for that particular
reagent or compound unless otherwise specifically noted.
[0211] One method of producing the disclosed proteins, such as SEQ
ID NO:1, is to link two or more peptides or polypeptides together
by protein chemistry techniques. For example, peptides or
polypeptides can be chemically synthesized using currently
available laboratory equipment using either Fmoc
(9-fluorenylmethyloxycarbonyl) or Boc (tert-butyloxycarbonoyl)
chemistry. (Applied Biosystems, Inc., Foster City, Calif.). One
skilled in the art can readily appreciate that a peptide or
polypeptide corresponding to the disclosed proteins, for example,
can be synthesized by standard chemical reactions. For example, a
peptide or polypeptide can be synthesized and not cleaved from its
synthesis resin whereas the other fragment of a peptide or protein
can be synthesized and subsequently cleaved from the resin, thereby
exposing a terminal group which is functionally blocked on the
other fragment. By peptide condensation reactions, these two
fragments can be covalently joined via a peptide bond at their
carboxyl and amino termini, respectively, to form an antibody, or
fragment thereof (Grant G A (1992) Synthetic Peptides: A User
Guide. W.H. Freeman and Co., N.Y. (1992); Bodansky M and Trost B.,
Ed. (1993) Principles of Peptide Synthesis.
[0212] Springer-Verlag Inc., NY (which is herein incorporated by
reference at least for material related to peptide synthesis).
Alternatively, the peptide or polypeptide is independently
synthesized in vivo as described herein. Once isolated, these
independent peptides or polypeptides can be linked to form a
peptide or fragment thereof via similar peptide condensation
reactions.
[0213] For example, enzymatic ligation of cloned or synthetic
peptide segments allow relatively short peptide fragments to be
joined to produce larger peptide fragments, polypeptides or whole
protein domains (Abrahmsen L et al., Biochemistry, 30:4151 (1991)).
Alternatively, native chemical ligation of synthetic peptides can
be utilized to synthetically construct large peptides or
polypeptides from shorter peptide fragments. This method consists
of a two step chemical reaction (Dawson et al. Synthesis of
Proteins by Native Chemical Ligation. Science, 266:776-779 (1994)).
The first step is the chemoselective reaction of an unprotected
synthetic peptide--thioester with another unprotected peptide
segment containing an amino-terminal Cys residue to give a
thioester-linked intermediate as the initial covalent product.
Without a change in the reaction conditions, this intermediate
undergoes spontaneous, rapid intramolecular reaction to form a
native peptide bond at the ligation site (Baggiolini M et al.
(1992) FEBS Lett. 307:97-101; Clark-Lewis I et al., J. Biol. Chem.,
269:16075 (1994); Clark-Lewis I et al., Biochemistry, 30:3128
(1991); Rajarathnam K et al., Biochemistry 33:6623-30 (1994)).
Alternatively, unprotected peptide segments are chemically linked
where the bond formed between the peptide segments as a result of
the chemical ligation is an unnatural (non-peptide) bond
(Schnolzer, M et al. Science, 256:221 (1992)). This technique has
been used to synthesize analogs of protein domains as well as large
amounts of relatively pure proteins with full biological activity
(deLisle Milton R C et al., Techniques in Protein Chemistry IV.
Academic Press, New York, pp. 257-267 (1992)).
Methods
[0214] Disclosed are methods of interacting compositions with
gC1qR/p32. Such interactions can be, for example, selective,
targeted or homing. Interaction with gC1qR/p32 can be mediated by
Lyp-1 and can involve any Lyp-1 or Lyp-1 composition as described
herein. Interaction with gC1qR/p32 can be useful for detecting
and/or treating diseases and conditions, such as diseases and/or
conditions associated with gC1qR/p32.
[0215] Disclosed herein are methods of treating a disease
associated with gC1q/p32 receptor comprising identifying a subject
having a disease associated with the gC1q/p32 receptor; and
administering to the subject a composition comprising SEQ ID NO:1
(Lyp-1).
[0216] Also disclosed are methods of treating a disease associated
with gC1q/p32 receptor comprising identifying a subject having a
disease associated with the gC1q/p32 receptor; and administering to
the subject a composition that interacts with the gC1q/p32 receptor
in the same location as Lyp-1, thereby treating a disease
associated with the gC1q/p32 receptor. The composition that
interacts with the gC1q/p32 receptor can be, for example, an
antibody, protein, or chemical.
[0217] Disclosed are methods of delivering a Lyp-1 composition to a
gC1q/p32 receptor, wherein the Lyp-1 composition comprises a moiety
linked to a composition comprising SEQ ID NO:1; wherein the method
comprises bringing into contact the Lyp-1 composition and a cell,
thereby delivering the Lyp-1 composition to the gC1q/p32
receptor.
[0218] In one example, the cell is in a subject. When the cell is
in a subject, the cell can be selected for its potential to
comprise a gC1q/p32 receptor by detecting the presence of gC1q/p32
receptor on another cell of the subject.
[0219] Also disclosed are methods of delivering a Lyp-1 composition
to a gC1q/p32 receptor, wherein the Lyp-1 composition comprises a
moiety linked to a composition comprising SEQ ID NO:1; comprising:
selecting a cell for its potential to comprise a gC1q/p32 receptor;
and bringing into contact the Lyp-1 composition and the cell,
thereby delivering the Lyp-1 composition to the gC1q/p32
receptor.
[0220] Also disclosed are methods of detecting interaction between
a gC1q/p32 receptor and a Lyp-1 composition, wherein the Lyp-1
composition comprises a moiety linked to a composition comprising
SEQ ID NO:1, the method comprising: selecting a cell for its
potential to comprise a gC1q/p32 receptor; bringing into contact
the Lyp-1 composition and the cell; and detecting interaction
between the gC1q/p32 receptor and the Lyp-1 composition.
[0221] Disclosed are methods of determining and/or assessing
gC1q/p32 receptor level in a cell of a subject, comprising:
bringing into contact a cell of the subject and a Lyp-1 composition
comprising a detectable agent linked to a composition comprising
SEQ ID NO:1; and detecting the level of Lyp-1 composition
interacting with gC1q/p32 receptor, thereby determining and/or
assessing gC1q/p32 receptor level in the cell. The level of
gC1q/p32 receptor in the subject is compared to a previous
measurement in the same subject, or can be compared to a control
level or standard level.
[0222] Also disclosed are methods of identifying a subject having a
disease associated with gC1q/p32 receptor, the method comprising
bringing into contact a cell of the subject and a Lyp-1
composition, wherein the Lyp-1 composition comprises a moiety
linked to a composition comprising SEQ ID NO:1; and detecting
interaction between gC1q/p32 receptor and the Lyp-1 composition,
thereby detecting the presence or level of gC1q/p32 on the cell,
wherein the presence or level of gC1q/p32 receptor on the cell
identifies the subject as having a disease associated with a
gC1q/p32 receptor.
[0223] Also disclosed are methods of screening for a compound that
interacts with a gC1q/p32 receptor, comprising bringing into
contact a test compound, a Lyp-1 composition, and a gC1q/p32
receptor, wherein the Lyp-1 composition comprises SEQ ID NO:1; and
detecting unbound Lyp-1 composition, wherein a given amount of
unbound Lyp-1 composition indicates a composition that interacts
with gC1q/p32 receptor. The Lyp-1 composition can comprise a
moiety, wherein the moiety comprises SEQ ID NO:1. In one example,
the moiety can be a detectable agent. Methods of screening are
discussed in more detail below.
[0224] Further disclosed herein is a method of treating or
preventing a disease in a subject associated with gC1q/p32
receptor, the method comprising administering to the subject a
composition that modulates gC1q/p32 receptor expression or
activity, thereby treating a disease in a subject associated with
the gC1q/p32 receptor. The subject can have cancer. The composition
can have a therapeutic effect on the cancer. The size of a tumor
can be reduced. The growth of a tumor can be reduced, stopped or
reversed.
[0225] Expression or activity of the gC1q/p32 receptor can be
inhibited. This can occur by the use of interfering nucleic acid,
such as shRNA or siRNA. Activity of the gC1q/p32 receptor can be
inhibited by LyP-1 peptide, an antibody, or a small molecule mimic
of Lyp-1. Examples of these can be found in FIG. 10 and Example 2.
The methods of treating or preventing cancer disclosed herein can
be used in conjunction with other treatment therapies as well.
[0226] The therapeutic effect of the composition disclosed above
can be a slowing in the increase of or a reduction of tumor burden.
This slowing in the increase of, or reduction in the tumor burden,
can be 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%,
60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 300%,
400%, 500%, 600%, 700%, 800%, 900%, or 1000% or more improvement in
the increase of, or reduction in the tumor burden of, compared with
a non-treated tumor, or a tumor treated by a different method.
[0227] The gC1q/p32 receptor involved in the disclosed methods can
be, for example, on or in a cell. The cell can be in any context,
such as in an organism, in situ, ex vivo, in culture, and/or in
vitro.
[0228] The disclosed compositions can be used to treat any disease
where uncontrolled cellular proliferation occurs such as cancers. A
non-limiting list of different types of cancers can be as follows:
lymphomas (Hodgkins and non-Hodgkins), leukemias, carcinomas,
carcinomas of solid tissues, squamous cell carcinomas,
adenocarcinomas, sarcomas, gliomas, high grade gliomas, blastomas,
neuroblastomas, plasmacytomas, histiocytomas, melanomas, adenomas,
hypoxic tumors, myelomas, AIDS-related lymphomas or sarcomas,
metastatic cancers, or cancers in general.
[0229] A representative but non-limiting list of cancers that the
disclosed compositions can be used to treat is the following:
lymphoma, B cell lymphoma, T cell lymphoma, mycosis fungoides,
Hodgkin's Disease, myeloid leukemia, bladder cancer, brain cancer,
nervous system cancer, head and neck cancer, squamous cell
carcinoma of head and neck, kidney cancer, lung cancers such as
small cell lung cancer and non-small cell lung cancer,
neuroblastoma/glioblastoma, ovarian cancer, pancreatic cancer,
prostate cancer, skin cancer, liver cancer, melanoma, squamous cell
carcinomas of the mouth, throat, larynx, and lung, colon cancer,
cervical cancer, cervical carcinoma, breast cancer, and epithelial
cancer, renal cancer, genitourinary cancer, pulmonary cancer,
esophageal carcinoma, head and neck carcinoma, large bowel cancer,
hematopoietic cancers; testicular cancer; colon and rectal cancers,
prostatic cancer, or pancreatic cancer.
Example 1
Lyp-1 and gC1qR/p32
[0230] Interaction of Lyp-1 with gC1qR/p32 was demonstrated in a
pull down assay. Pull down assays were performed with biotinylated
Lyp-1 peptide (SEQ ID NO:1, CGNKRTRGC) from protein extracts
derived from MDA-MB-435 cultured cells or MDA-MB-435 tumor
xenografts. A tumor homing peptide, CREKA (SEQ ID NO:3), and a
peptide CRV which resembles Lyp-1 in its amino acid composition and
cyclic structure (SEQ ID NO:4, CRVRTRSGC), were used as negative
controls. The Lyp-1 bound proteins were visualized using silver
staining and immunobloting. The left panel of FIG. 1(a) shows the
results of silver staining The arrow indicates a specific 33 kD
band, which was identified as gC1qR/p32 by mass spectrometry. The
right panel of FIG. 1(a) shows the results of immunobloting of
total cell extract (Tot lysate) and proteins bound to Lyp-1 and
control peptides using a monoclonal antibody against gC1qR/p32. The
antibody recognizes a band of 33 kD in the total proteins lysate
and in the Lyp-1 pull down. Anti gC1qR/p32 reactive bands are not
detected in the pull downs from both control peptides. The left
panel of FIG. 1(b) shows the results of silver staining of proteins
pulled down from MDA-MB-435 tumor xenografts by Lyp-1 peptide,
revealed an additional 75 kD band, which was also identified as
gC1qR/p32 by mass spectrometry. The right panel of FIG. 1(b) shows
the results of immunoblotting. The monoclonal antibody against
gC1qR/p32 recognized a 75 kD and a 33 kD band only in the Lyp-1
peptide pull down.
[0231] Lyp-1 expressing phage was shown to specifically bind to
purified gC1qR/p32 protein. Purified gC1qR/p32 or BSA, as a
control, were coated onto microtiter wells (5 .mu.g/ml) and
targeted for binding with 108 pfu of insertless phage, Lyp-1 phage,
or control phage carrying another tumor homing peptide (CREKA, SEQ
ID NO:3). After 16 hours of incubation at 37.degree. C., bound
phages were eluted and quantified by plaque assay. The results are
show in FIG. 2(a). Results are expressed as fold of Lyp-1 and CREKA
(SEQ ID NO:3) phages recovered over insertless phage and are
representative of five independent experiments.
[0232] An antibody against the N-terminus of gC1qR/p32 was shown to
inhibit Lyp-1 phage binding to purified gC1qR/p32. The left panel
of FIG. 2(b) shows a diagram of precursor (aa 1-282) and mature (aa
74-282) gC1qR/p32 protein. Boxes indicate the amino acid residues
recognized by the monoclonal antibodies, mAb 60.11 and mAb 74.5.2,
respectively at the N-terminus (aa 76-93) and C-terminus (aa
204-282) of the mature protein. The amino acid sequence recognized
by mAb 60.11 is also indicated. 1.5.times.10.sup.7 pfu of
insertless and Lyp-1 phages were allowed to bind for 6 hours at
37.degree. C. to gC1qR/p32 protein coated onto microtiter plates in
the presence or absence of 20 .mu.g/ml of either mAbs 60.11, 74.5.2
or purified mouse IgG1 (mIgG). The results are shown in the right
panel of FIG. 2(b). The results are representative of three
independent experiments and are expressed as percentage of phage
binding, with Lyp-1 phage binding alone as 100%.
[0233] gC1qR/p32 protein levels and cell surface expression was
measured in cultured tumor cells and tumor xenografts. Lysates of
different tumor cell lines were subjected to Western blot analysis
for gC1qR/p32. Actin was used as loading control. C8161 melanoma
cells and HL-60 promyelocitic leukemia cells, both low binders of
Lyp-1 phage (Laakkonen et al., 2002), express low levels of
gC1qR/p32 compared to MDA-MB-435 and BT549 breast cancer cells
which exhibit higher Lyp-1 phage binding ability (see FIG. 4(a)).
(b-c) FACS analysis was used to detect the cell surface expression
of gC1qR/p32 in tumor cell cultures (FIG. 4(b)) or primary cell
suspensions from MDA-MB-435 tumor xenografts (FIG. 4(c)). Propidium
iodide negative (living) cells were gated for the analysis. In cell
suspensions from MDA-MB-435 tumor xenografts, polyclonal
anti-gC1qR/p32 antibody causes a significant shift of the FACS peak
compared with the rabbit IgG control (see FIG. 4(c)). The cell
surface expression of gC1qR/p32 is low in cultured MDA-MB-435 and
BT549 cells (see FIG. 4(b)). MDA-MB-435 S35, a MDA-MB-435 subclone
with higher Lyp-1 phage binding ability, exhibits a bigger shift of
the FACS peak compared to the parental MDA-MB-435 cells. gC1qR/p32
is not expressed on the cell surface in C8161 cells.
[0234] gC1qR/p32 overexpression was shown to enhance Lyp-1 phage
binding to C8161 melanoma cells. C8161 cells were transiently
transfected with pEGFP (2 .mu.g) together with either pcDNA3 or
pcDNA3gC1qR/p32 (10 .mu.g). 22 hours post transfection cells were
sorted for EGFP expression. The two sorted populations were used
for phage binding assay and Western blot analysis to detect
gC1qR/p32 overexpression. The results are shown in FIG. 5. Lyp-1
phage binding to empty vector or gC1qR/p32 transfected cells is
expressed as fold of binding over insertless phage. The graph
represents the mean fold of binding of two independent experiments
performed in duplicate.
[0235] RNAi-mediated gC1qR/p32 silencing was shown to decrease
Lyp-1 peptide binding to the cell surface. MDA-MB-435 cells were
transiently transfected with gC1qR/p32-specific or control siRNAs.
48 hours after transfection, inhibition of gC1qR/p32 expression was
checked by Western blot analysis and immunostaining .beta.-actin
was used as a control. gC1qR/p32 silencing visibly reduced
gC1qR/p32 in both the Western blot and in immunostaining gC1qR/p32
cell surface expression in control and gC1qR/p32-siRNA transfected
cells was determined by FACS analysis on living (propidium iodide
negative) cells. Rabbit IgG were used as staining control.
gC1qR/p32 silencing reduced cell surface expression to be the same
as the control. gC1qR/p32 or control siRNA transfected cells were
incubated for 1 hour at 4.degree. C. in the presence of 10 .mu.M
FITC conjugated Lyp-1 peptide or a control peptide-ARAL-which has
same amino acid charge (ARALPSQRSR, SEQ ID NO:5) and exhibits less
binding ability (first graft on the left). The amount of
fluorescence in living cells was analyzed by FACS. Cells incubated
in the absence of peptide served as FITC negative control. Compared
to control siRNA transfected cells, down-regulation of gC1qR/p32
expression (in the presence of gC1qR/p32 siRNA) caused a shift in
the peak of Lyp-1 fluorescence but not control peptide
fluorescence. Detection of the control peptide showed no difference
in the cells exposed to the gC1qR/p32 siRNA and the control
siRNA.
[0236] Tumor localization of gC1qR/p32 and Lyp-1 peptide was
visualized. gC1qR/p32, lymphatic or blood vessels, podoplanin and
Meca32/CD31 were stained with fluorescently-labeled antibodies in
MDA-MB-435 tumor xenografts. Polyclonal anti-gC1qR/p32 antibody
recognizes cell clusters that lack blood vessels but contain
lymphatics, or cells lining vessel-like structures positive for
Podoplanin but not CD31 or Meca32. Fluorescein-conjugated Lyp-1
peptide was i.v. injected into mice bearing MDA-MB-435 tumors and
allowed to circulate for 1 hour before removal of the tumor for
gC1qR/p32 immunohistochemical analysis. Lyp-1 peptide localizes in
gC1qR/p32-positive patches within the tumor.
Example 2
The Mitochondrial/Cell Surface Protein p32/gC1qR Regulates the
Balance Between Glycolysis and Oxidative Phosphorylation in Tumor
Cells
i. Introduction
[0237] A tumor homing peptide, LyP-1, selectively binds to
tumor-associated lymphatic vessels and tumor cells in certain
tumors and exhibits an anti-tumor effect. It is herein shown that
the multi-ligand, multi-compartmental protein p32/gC1qR is the
receptor for LyP-1. The LyP-1 peptide specifically bound gC1qR/p32
from extracts of cultured tumor cells, and gC1qR/p32 co-localized
with intravenously injected LyP-1 in tumor lymphatics and in cells
positioned adjacent to these vessels. Immunohistochemical analysis
of human tissues revealed greatly elevated expression of gC1qR/p32
in several cancers relative to corresponding normal tissues.
Knocking down gC1qR/p32 expression with shRNA elevated glycolysis
and decreased mitochondrial respiration in MDA-MB-435 tumor cells.
Surprisingly, the knockdown compromised the ability of the tumor
cells to survive and proliferate in low glucose conditions and
severely diminished their tumorigenicity in vivo. Restored
expression of gC1qR/p32 reversed these changes.
[0238] Tumors can be distinguished from their non-malignant
counterparts by specific molecular signatures expressed in
malignant cells and tumor vasculature. Tumor associated antigens
such as certain growth factor and cytokine receptors, membrane-type
matrix metalloproteinases, and cell adhesion molecules are highly
expressed in many tumors. Similarly, biochemical features that
distinguish tumor vasculature from the vasculature of normal
tissues include the expression of various angiogenesis-related
molecules (Ruoslahti, 2002; St Croix et al., 2000). Tumor
lymphatics are also specialized, since they express markers that
are not present in the lymphatics of normal tissues (or in tumor
blood vessels) (Laakkonen et al., 2002; Zhang et al., 2006). The
markers in tumor blood vessels and lymphatics can vary between
tumor types, and the marker profile of the vessels changes as
tumorigenesis advances from premalignant lesions to fully malignant
tumors (Hoffman et al., 2003; Joyce et al., 2003; Zhang et al.,
2006).
[0239] The distinct protein profile of tumor vessels and tumor
cells can be exploited in ligand-directed (synaphic) targeting of
diagnostic therapeutic agents. Targeting can improve the
specificity and efficacy of a compound while reducing side effects
(Arap et al., 2002; Arap et al., 1998b; Jain, 1998). This partial
success emphasizes the need to find new molecules that recognize
selectively expressed markers in tumors.
[0240] In vivo screening of phage libraries that display random
peptide sequences on their surface has yielded a number of specific
homing peptides for tumor vasculature and tumor cells (Arap et al.,
1998a; Porkka et al., 2002). Identification of receptors for homing
peptides provides new tumor markers, and may also reveal signaling
pathways that, if interrupted, affect tumor growth/malignancy.
LyP-1, a cyclic nonapeptide that specifically recognizes lymphatic
vessels in certain tumors (Laakkonen et al., 2002), is a case in
point. Lymphatic vessels are an important conduit for the spread of
solid tumors, and their abundance in and around tumors correlates
with propensity to metastasize (Alitalo et al., 2004; Stacker et
al., 2002).
[0241] The LyP-1 peptide provides a marker for these vessels, but
also binds to tumor cells, offering the ability to selectively
target both tumor lymphatics and tumor cells. Moreover, the target
molecule (receptor) for the LyP-1 peptide appears to be involved in
tumor growth because systemic administration of LyP-1 inhibits
tumor growth in mice (Laakkonen et al., 2004). LyP-1 appears to be
cytotoxic against tumor cells undergoing stress, as LyP-1
accumulation coincides with hypoxic areas in tumors and tumor
starvation enhances its binding and internalization in cultured
tumor cells (Laakkonen et al., 2004). These unique properties of
the LyP-1 system prompted the search for the tumor cell receptor
for this peptide.
[0242] In this study, p32/p33/gC1qR/HABP1 (p32) has been identified
as the cellular receptor for LyP-1. This protein was originally
isolated based on its co-purification with the nuclear splicing
factor SF-2 (Krainer et al., 1991). It was also found to bind to
the globular heads of the C1q protein and was therefore designated
the gC1q/p32 receptor (gC1qR/p32) (Ghebrehiwet et al., 1994).
Plasma proteins and extracellular matrix components, such as
kininogen, factor XII, vitronectin and hyaluronic acid, have been
also reported to bind to gC1qR/p32 (Deb and Datta, 1996; Herwald et
al., 1996; Joseph et al., 1996; Lim et al., 1996). In addition,
gC1qR/p32 interacts with several bacterial and viral proteins,
showing its possible role in microbial pathogenesis (Braun et al.,
2000; Kittlesen et al., 2000; Matthews and Russell, 1998; Tange et
al., 1996).
[0243] The gC1qR/p32 protein can be present in diverse cellular
compartments depending on the cell type and physiological
conditions. This protein has been variously located in mitochondria
(Dedio et al., 1998; Matthews and Russell, 1998; Muta et al.,
1997), nucleus (Krainer et al., 1991; Majumdar et al., 2002), and
at the cell surface (Ghebrehiwet et al., 1994; Gupta et al., 1991;
Soltys et al., 2000). It may also be secreted and bound to the
extracellular matrix (Herwald et al., 1996; Lim et al., 1996;
Rozanov et al., 2002a). The disparate observations on its multiple
protein interactions and cellular localization, have left the
physiological role(s) of gC1qR/p32 in mammalian cells unclear. In
the yeast, the gC1qR/p32 homologue has been reported to regulate
oxidative phosphorylation (Muta et al., 1997).
[0244] It is herein shown that knocking down gC1qR/p32 expression
in tumor cells shift their metabolism toward glycolysis and that,
surprisingly, the glycolytic phenotype is associated with impaired
tumor cell survival and growth, especially under adverse growth
conditions. At the same time, tumorigenicity of the gC1qR/p32
knockdown cells is reduced.
ii. Results
[0245] a. LyP-1 Peptide Binds to gC1qR/p32 Protein
[0246] To identify the receptor for the LyP-1 peptide,
biotin-labeled LyP-1 and control peptides were incubated with
extracts of MDA-MB-435 cells, a cell line that binds and
internalizes LyP-1 (Laakkonen et al., 2004). LyP-1 bound a specific
band in the 30 kDa range that was not seen in the controls (FIG.
3A, left panel), which were the pentapeptide CREKA (SEQ ID NO: 3)
(Simberg et al., 2007) and the nonapeptide CRVRTRSGC (SEQ ID NO:
4), which resembles LyP-1 in its amino acid composition and cyclic
structure. Two independent MALDI-TOF analyses indicated that the
specific band represents the mature form of a protein known as
gC1qR/p32, a receptor for the globular head of complement component
C1q (Ghebrehiwet et al., 2002; Ghebrehiwet et al., 1994). LyP-1
affinity isolation also yielded gC1qR/p32 from cultured BT549
breast carcinoma cells and from extracts of MDA-MB-435 xenograft
tumors.
[0247] The identification of the LyP-1-binding protein as gC1qR/p32
was confirmed by immunoblotting and phage binding assays. A
monoclonal antibody directed against gC1qR/p32 specifically
recognized the band (FIG. 3A right panel). No detectable gC1qR/p32
was pulled down by the control peptides. The LyP-1 phage bound to
purified gC1qR/p32 protein an average of 60-fold more than
insertless control phage, while only marginal binding of either
phage to plates coated with BSA was seen (FIG. 3B). LyP-2, a
peptide, which shares a consensus sequence with LyP-1 but binds a
different spectrum of tumor lymphatics (Zhang et al., 2006), did
not significantly bind to gC1qR/p32. A monoclonal antibody, mAb
60.11, which binds to gC1qR/p32 near the N-terminus (amino acids
76-93), reduced LyP-1 phage binding to gC1qR/p32 by 90% (FIG. 3C).
In contrast, mAb 74.5.2, which recognizes the C-terminal end of
gC1qR/p32 (amino acids 204-218), did not inhibit the phage binding.
These results indicate that the interaction between LyP-1 and
gC1qR/p32 is specific and that the N-terminus of gC1qR/p32 between
amino acids 76 and 93 plays an important role in the
interaction.
[0248] Immunoblotting revealed a correlation between gC1qR/p32
expression and LyP-1 binding in a number of tumor cell lines; HL-60
leukemia cells and C8161 melanoma cells, previously shown not to
significantly bind LyP-1 (Laakkonen et al., 2002), expressed low
levels of gC1qR/p32 protein, whereas two strong LyP-1 binders,
MDA-MB-435 and BT549 ((Laakkonen et al., 2002), expressed abundant
gC1qR/p32 (FIG. 4A).
[0249] b. The gC1qR/p32 Protein is Expressed at the Cell Surface
and Mediates LyP-1 Binding
[0250] For gC1qR/p32 to act as a LyP-1 receptor, it would have to
be expressed at the cell surface. While primarily localized in
intracellular compartments (mitochondria, nucleus and cytoplasm),
gC1qR/p32 has also been reported to be present at cell surface
(Ghebrehiwet et al., 1994; Guo et al., 1999; Peerschke et al.,
1994). gC1qR/p32 was also found at the cell surface. A polyclonal
anti-gC1qR/p32 antibody produced a small but consistent shift in
FACS analysis of live MDA-MB-435 cells (FIG. 4B). A greater shift
was obtained in an MDA-MB-435 subclone (S35), which binds LyP-1
with higher efficiency than the parental cell line. Raji Burkitt
lymphoma cells were even more strongly positive. Interestingly, the
total gC1qR/p32 expression level was similar in the parental
MDA-MB-435 and the S35 variant cells (FIG. 4A). Single cell
suspensions from MDA-MB-435 tumor xenografts were more strongly
positive for cell surface gC1qR/p32 protein than cultured
MDA-MB-435 cells, whereas C8161 cells remained essentially negative
for LyP-1 binding even as primary tumor cells (FIG. 4C).
[0251] The effect of forced expression and knockdown of gC1qR/p32
on LyP-1 binding was next studied. Transient transfection of C8161
cells with gC1qR/p32 cDNA increased LyP-1 phage binding to 5-fold
over control phage (FIG. 5A). A less than 2-fold binding was
obtained upon transfection with the empty vector. Transfection with
a gC1qR/p32 siRNA construct markedly reduced expression in
MDA-MB-435 cells (FIG. 5B, upper left panel), with an accompanying
reduction in the binding of FITC-LyP-1 peptide to the cells (FIG.
5B lower left panel). Controls showed that an unrelated siRNA did
not affect gC1qR/p32 expression or LyP-1 binding, and neither siRNA
changed the expression of .beta.-actin. Also, a control peptide,
which like LyP-1 has three basic residues but does not
significantly bind to the MDA-MB-435 cells (Laakkonen et al.,
2002), gave the same amount of background fluorescence in the
gC1qR/p32 knockdown and control cells (FIG. 5B, lower right panel).
Finally, blocking gC1qR/p32 with mAb 60.11 in Raji cells (which
express high levels of cell surface gC1qR/p32) reduced LyP-1
binding to these cells by 50%, while the phage binding was
unaffected by mAb 74.5.2 (FIG. 5C). These results are consistent
with those obtained with purified gC1qR/p32 protein (FIG. 3C) and
indicate that the gC1qR/p32 level expression at the cell surface
dictates LyP-1 binding to the cells. They also suggest that cell
surface localization of gC1qR/p32 is regulated independently of
total gC1qR/p32 expression, and that tumor microenvironment may
enhance the cell surface expression.
[0252] c. Expression of gC1qR/p32 in MDA-MB-435 Tumor Xenografts
and Human Cancers
[0253] To investigate the localization of gC1qR/p32 in tumors,
sections of MDA-MB-435 tumor xenografts were stained for gC1qR/p32
and podoplanin (a lymphatic/macrophage marker). Clusters of cells
strongly positive for gC1qR/p32 were found in close proximity to
tumor lymphatics, whereas there was no association with blood
vessels as visualized by staining for CD31 or Meca-32 (FIG. 6A,
upper panels). Cells expressing gC1qR/p32 were also found lining
vessel-like structures that were also positive for podoplanin, but
not for CD31 or Meca-32 (FIG. 6A, lower panels). Normal tissues and
C8161 tumor xenografts showed much less gC1qR/p32 staining than the
MDA-MB-435 tumors. Intravenously injected FITC-LyP-1 peptide
accumulated in tumor areas with high expression levels of gC1qR/p32
and closely associated with vessel lumens (FIG. 6B). There was a
good degree of co-localization of the gC1qR/p32/LyP-1 positive
cells and the macrophage markers DC11b and Gr-1 (FIG. 6C). The
localization of gC1qR/p32 in the lymphatic areas of tumors confirms
the previously noted association of LyP-1 with MDA-MB-435 tumor
lymphatics. The gC1qR/p32-positive cells integrated into the
lymphatics in these tumors are likely tumor macrophages and/or
macrophage-like precursors of lymphatic endothelial cells.
[0254] Next, the levels of gC1qR/p32 expression in a variety of
human carcinomas were compared by immunohistochemical staining for
gC1qR/p32 in clinical samples. The intensity of the staining (FIG.
6D, right panel) was visually scored and compared with a parallel
staining for an epithelial membrane antigen in tumor cells (6D,
left panel). An immuno-score was assigned to each sample based on
the percentage of tumor cells within the tissue and their intensity
of gC1qR/p32 staining (Table 1). Compared to non-malignant tissues,
several tumor types showed elevated gC1qR/p32 expression levels
(FIG. 6E). In particular, breast lobular carcinoma, endometroid
adenocarcinoma, melanoma, and carcinomas of the colon and testis,
as well as squamous cell carcinomas of the lung, exhibited markedly
elevated gC1qR/p32 expression. None of the nine prostate carcinomas
examined contained significant gC1qR/p32 levels. The expression of
gC1qR/p32 was high in cancers of stomach, pancreas and kidney, but
the corresponding non-malignant tissues also expressed gC1qR/p32 at
substantial levels. These results confirm and extend previous
reports showing preferential expression of gC1qR/p32 by
adenocarcinoma cells.
[0255] d. Stable Knockdown of gC1qR/p32 Alters Tumor Cell
Metabolism and Growth
[0256] To delineate the role of gC1qR/p32 in tumor physiology
shRNA-based knockdown of gC1qR/p32 expression was employed in tumor
with subsequent analysis of the cells in vitro and in vivo. shRNAs
complementary to gC1qR/p32 or a two-base-pair mismatch control
shRNA were expressed in MDA-MB-435 tumor cells. A series of
gC1qR/p32 and control shRNA stable clones were screened for
gC1qR/p32 expression. Three gC1qR/p32 shRNA clones, with
undetectable gC1qR/p32 expression, and three control shRNA clones
were selected for analysis (FIG. 7A, upper left panel). Each of the
gC1qR/p32 knockdown clones showed markedly reduced uptake of
FITC-LyP-1 peptide compared to control clones. Strikingly,
gC1qR/p32 knockdown induced acidification of the culture medium, as
indicated by a phenol red color change 3-4 days after cell seeding
(FIG. 7A upper right panel). Consistent with a decrease in pH,
lactate production was significantly increased in gC1qR/p32
knockdown compared to control cells (FIG. 7A lower left panel).
[0257] Lactic acid is a byproduct of glycolysis and can accumulate
under anaerobic conditions or in cases of mitochondrial
dysfunction. The ensuing reliance on glycolysis for ATP production
is associated with a high rate of conversion of glucose to lactate
and a high rate of glucose uptake. It was found that gC1qR/p32
knockdown cells consumed more glucose than the control clones,
indicating increased glycolysis (FIG. 7A lower right panel).
However, the elevated glycolytic rate and lactate production was
not related to increased cell growth of the gC1qR/p32 knockdown
cells, as these cells grew more slowly than the control cells (see
FIG. 8 below).
[0258] The gC1qR/p32 protein has been found to be present in each
of the main cellular compartments, but it is predominantly a
mitochondrial protein (Dedio et al., 1998; Jiang et al., 1999; Muta
et al., 1997; Soltys et al., 2000; van Leeuwen and O'Hare, 2001).
Consistent with a mitochondrial role of gC1qR/p32, a growth defect
in yeast lacking the gC1qR/p32 homolog has been linked to an
abnormality in maintaining mitochondrial ATP synthesis (Muta et
al., 1997). The gC1qR/p32 knockdown cells, when grown in normal
media containing high (25 mM) glucose, produced 20% less total ATP
than control cells (FIG. 7B). The decrease in mitochondrial ATP
production may have been greater than that, as increased ATP
production via glycolysis may have compensated for some of the lost
mitochondrial ATP synthesis. Reducing glucose concentration in the
media to 2.5 mM was more detrimental to cellular ATP production in
gC1qR/p32 knockdown (50% reduction) compared to control clones.
These data show that gC1qR/p32 can be required for efficient ATP
production through oxidative phosphorylation (OXPHOS). Consistent
with such a role, gC1qR/p32 knockdown cells consumed less oxygen
than control clones (FIG. 7C). Thus, loss of gC1qR/p32 shifts
energy metabolism toward glycolysis, likely via perturbation of
mitochondrial function.
[0259] Mitochondrial morphology is closely linked to energy
metabolism. Enhanced respiration correlates with an interconnected
mitochondrial network and enlarged cristae compartment, while
reduced OXPHOS and enhanced glycolysis correlates with fragmented
mitochondria and matrix expansion (Alirol and Martinou, 2006).
Confocal analysis of mitochondria in gC1qR/p32 knockdown and
control clones showed that the mitochondrial network was fragmented
rather than fibrillar when gC1qR/p32 was not expressed (FIG. 7D).
Taken together, these data support the view that gC1qR/p32 is
critical for mitochondrial function, and its inactivation alters
energy metabolism in favor of glycolysis.
[0260] e. Loss of gC1qR/p32 Impairs Cell Growth and Increases Cell
Death
[0261] The gC1qR/p32 knockdown cells grew more slowly than control
cells (FIG. 8A, left and middle panels). The difference was
particularly striking in medium containing only 2.5 mM glucose.
Under these low glucose conditions, the medium in the gC1qR/p32
knockdown cells did not become acidic (FIG. 8A, right panel),
indicating that the cells were not able to carry out glycolysis at
a level that would support cell growth.
[0262] Tumor cells have a tendency to undergo cell death under low
glucose conditions (Inoki et al., 2003; Jones et al., 2005). It was
next determined whether loss of gC1qR/p32 would confer this trait
to the MDA-MB-435 cells. The percentage of annexin V-positive cells
in the gC1qR/p32 knockdown and control cells was similar in high
glucose media, but a greater sensitivity of the knockdown cells
became evident in low glucose media (FIG. 8B).
[0263] To show the specificity of the shRNA knockdown, gC1qR/p32
production was restored in knockdown cells. A gC1qR/p32 cDNA in
which silent mutations confer resistance to inhibition by the
gC1qR/p32 shRNA was employed to bring gC1qR/p32 expression to the
original level (FIG. 8C). This treatment normalized lactate
accumulation, glucose consumption, and proliferation of the
knockdown cells (FIG. 8C). These results show that off-target
effects are not responsible for the phenotypic effects of the
knockdown.
[0264] f. Loss of gC1qR/p32 Suppresses Malignancy of Tumor
Cells
[0265] The elevated gC1qR/p32 expression in tumors and impaired
proliferation and survival of gC1qR/p32 knockdown cells, prompted
the investigation of the role of gC1qR/p32 in tumorigenesis.
Control and gC1qR/p32 knockdown cell clones were orthotopically
injected into the mammary gland fat pad of nude mice, and tumor
growth was monitored. The gC1qR/p32 knockdown cells produced
smaller tumors than controls or the tumors were swollen and soft,
and purple color and release of blood upon cutting indicated
intratumoral hemorrhage (FIG. 9A, left and middle panels). Even
with the hemorrhage contributing to the size of the knockdown
tumors, the growth rate of these tumors was significantly lower
than that of control tumors (p<0.001). Assessment of cell
proliferation in the tumors by BrdU incorporation showed
significantly reduced number of BrdU-positive cells in the
gC1qR/p32 knockdown tumors (FIG. 9B), which is consistent with the
slow proliferation rate of the knockdown cells in vitro.
Histopathological analysis of tumor sections revealed extensive
necrosis in the gC1qR/p32 knockdown compared to control tumors
(FIG. 9C). Some necrosis was evident even in small gC1qR/p32
knockdown tumors, indicating that necrosis is an early event in
tumors produced by gC1qR/p32-deficient cells. Taken together these
data establish an important role for gC1qR/p32 in tumor growth and
maintenance.
iii. Discussion
[0266] It is herein shown that a mitochondrial/cell surface
protein, p32/gC1qR, is the receptor for a tumor-homing peptide,
LyP-1, which specifically recognizes an epitope in tumor lymphatics
and tumor cells in certain cancers. It is shown that knocking down
gC1qR/p32 expression with shRNA elevates glycolysis, decreases
mitochondrial respiration, and reduces tumorigenicity in MDA-MB-435
tumor cells. As the expression of gC1qR/p32 is frequently
up-regulated in experimental and human cancers, the results show
that elevated glycolysis (the Warburg effect) is not necessarily
advantageous to tumor growth.
[0267] Several lines of evidence show that the LyP-1 peptide
specifically binds a protein known as gC1qR/p32 or the receptor for
the C1q component of the complement, gC1qR/p32. First, LyP-1 phage
binds purified gC1qR/p32 protein and the interaction was inhibited
by an antibody directed against the N-terminus of gC1qR/p32.
Second, endogenous expression levels and cell surface localization
of gC1qR/p32 correlated with the ability of different cell lines to
bind LyP-1. Third, overexpression of gC1qR/p32 enhanced and RNAi
silencing decreased LyP-1 binding to cells. Finally, intravenously
injected FITC-LyP-1 peptide homed in vivo to the areas in tumors
where gC1qR/p32 expression was high. The identification of
gC1qR/p32 as the LyP-1 receptor prompted the further study of the
expression and role of gC1qR/p32 in cancer.
[0268] The gC1qR/p32 protein is primarily mitochondrial, but it can
be found in the cytoplasm, nuclei, and most importantly for the
LyP-1 binding, at the cell surface (Ghebrehiwet et al., 1994; Guo
et al., 1999; Peerschke et al., 1994). Several other mitochondrial
proteins are also found in extra-mitochondrial locations (Soltys
and Gupta, 1999). For example, the mitochondrial chaperone proteins
HSP60 and HSP70 have also been observed at the cell surface (Soltys
and Gupta, 1997) and endoplasmic reticulum (Singh et al., 1997;
Soltys and Gupta, 1996). HSP60 found at the surface of tumor cells
and stressed cells (Kaur et al., 1993; Xu et al., 1994) can
function as a chaperone for certain proteins (Khan et al., 1998).
Interestingly, a chaperone-like function has also been suggested
for gC1qR/p32 (Hirasawa et al., 2001; Kittlesen et al., 2000;
Robles-Flores et al., 2002; Rozanov et al., 2002b; Schaerer et al.,
2001; Storz et al., 2000). FACS data corroborate the earlier
findings on the cell surface localization of gC1qR/p32 and indicate
that the tumor microenvironment may enhance the cell surface
expression of gC1qR/p32.
[0269] The amount of gC1qR/p32 at the surface did not necessarily
correlate with the total amount of gC1qR/p32 in the cell, showing
that the localization is separately controlled. Interestingly, two
ubiquitous intracellular proteins, nucleolin (Christian et al.,
2003) and annexin 1 (Oh et al., 2004) have been shown to be
aberrantly expressed at the cell surface in tumor blood vessels,
where they serve as specific markers of angiogenesis. The
expression of gC1qR/p32 in tissues is much more restricted than
that of nucleolin or annexin 1, but its cell surface expression may
add a further degree of tumor specificity, as the LyP-1 peptide
(Laakkonen et al., 2004; Laakkonen et al., 2002) and anti-gC1qR/p32
(this study) are strikingly specific in their tumor accumulation
upon systemic administration.
[0270] Antibody staining of tissue sections with anti-gC1qR/p32
antibody, and intravenously injected anti-gC1qR/p32, confirmed the
previously reported association of LyP-1 with specific areas in
tumors. Similar to the LyP-1 peptide (Laakkonen et al., 2004;
Laakkonen et al., 2002), the antibody outlined two main locations
within tumors: cell clusters in areas that were rich in lymphatics,
but sparsely populated with blood vessels, and vessel-like
structures that apparently represent lymphatics. Bone
marrow-derived macrophages that contribute to lymphagiogenesis have
been described (Kerjaschki et al., 2006; Maruyama et al., 2007;
Maruyama et al., 2005), and it was found that a significant number
of intensely gC1qR/p32-positive cells within tumors were also
positive for macrophage markers. It was hypothesized that the
LyP-1/anti-gC1qR/p32-positive cells represent a rare macrophage
population that can serve as a precursor to lymphatic endothelial
cells.
[0271] The findings with shRNA-mediated knockdown of gC1qR/p32 show
an important role of gC1qR/p32 in tumor cells. In vitro, the
knockdown resulted in a striking increase in the utilization of the
glycolytic pathway of glucose metabolism by tumor cells. These
metabolic changes are similar to those caused by mutations that
disable the gC1qR/p32 homologue in yeast (Muta et al., 1997). The
gC1qR/p32 knockdown was also associated with impaired cell growth,
increased cell death, and compromised tumorigenicity. These changes
were specifically caused by the knockdown, as an shRNA-resistant
gC1qR/p32 construct reversed them.
[0272] It was found that breast cancers and some other
adenocarcinomas up-regulate gC1qR/p32, but some other cancers,
notably prostate cancers, do not express gC1qR/p32 at detectable
levels. The mouse and human genomes appear to contain only one
gC1qR/p32-related gene, making it unlikely that a related gene
would serve in the same role in tumors that lack gC1qR/p32.
Interestingly, in contrast to most malignancies, a majority of
prostate cancers are not highly glycolytic (Effert et al., 1996;
Hofer et al., 1999; Liu, 2006). Hence, they may not need the
offsetting activity of gC1qR/p32.
[0273] One factor that drives the glycolytic response in tumors is
the myc oncogene (Shim et al., 1997). It is noteworthy that c-myc
changes are common in breast cancers (Blancato et al., 2004; Liao
and Dickson, 2000) which exhibit high glycolytic activity (Isidoro
et al., 2005). Thus, the role of gC1qR/p32 can be to counteract
excessive glycolysis-promoting activities of c-myc, while allowing
its tumor-promoting effects to remain intact.
[0274] There can also exist a link between mitochondrial
metabolism, autophagy and gC1qR/p32. Autophagy is a dynamic process
of subcellular degradation. By mobilizing nutrients that result
from macromolecular degradation, autophagy acts to buffer metabolic
stress in organisms from yeast to mammals (Levine, 2007;
Rubinsztein et al., 2007). A role for gC1qR/p32 protein in
autophagy has been previously suggested (Sengupta et al., 2004) and
recently gC1qR/p32 has been reported to interact with and stabilize
the autophagic inducer protein smARF in mitochondria (Reef et al.,
2007). Moreover, deletion of the genes for various
autophagy-related proteins in yeast resulted in abnormal
mitochondrial morphology and lowered oxidative phosphorylation,
along with a growth defect (Zhang et al., 2007). This phenocopies
observations in tumor cells with knocked down gC1qR/p32, as these
cells also displayed altered mitochondria, a shift from oxidative
phosphorylation to glycolysis, and poor growth.
[0275] Autophagy can act as a tumor suppressor, but it can also
enhance tumor growth (Degenhardt et al., 2006; Levine, 2007). The
tumor suppressor function can relate to the role of autophagy in
removal of sources of oxygen radicals that would cause DNA damage,
with the resulting accumulation of mutations that can accelerate
tumor progression. The other side of the coin is that autophagy is
a survival mechanism for cells under stress. Tumors often outgrow
their blood supply, which results in local areas of hypoxia and
nutrient depletion; turning on autophagy provide a cannibalistic
mechanism for survival under such stress.
[0276] These results agree well with the assumption that gC1qR/p32
expression is involved in the autophagy response. First, the LyP-1
peptide accumulated in hypoxic (and presumably also
nutrient-deficient) regions in tumors (Laakkonen et al., 2004), and
it is demonstrated in the present work with anti-gC1qR/p32
antibodies that these regions preferentially express gC1qR/p32.
Second, tumors that lack the autophagy response are prone to
necrosis through a process dubbed metabolic catastrophe (Jin et
al., 2007). This is exactly what was observed with tumors grown
from gC1qR/p32 knockdown cells; these tumors often contained a
large necrotic and hemorrhagic core. Moreover, LyP-1 peptide
treatment induced TUNEL-positive lesions in tumors in vivo
(Laakkonen et al., 2004), indicating apoptosis or incipient
necrosis at these sites.
[0277] Given the dual effect of autophagy (and by extension
presumably of gC1qR/p32 expression) on tumorigenesis, the question
arises as to whether suppressing autophagy would be helpful in
treating tumors, or that might be harmful. Partial tumor necrosis
resulting from suppression of autophagy is one mechanism that could
produce a harmful result, as necrosis causes inflammation, and
inflammatory mediators can promote tumor growth (Degenhardt et al.,
2006). The results show that necrosis elicited by autophagy
suppression can be beneficial as a treatment modality. Extensive
necrosis was observed in a majority of the gC1qR/p32 knockdown
tumors, yet the tumors grew more slowly than the wild type tumors.
The results show that gC1qR/p32 represents a new target for tumor
therapy; RNAi, or human monoclonal antibodies and small molecular
weight compounds that mimic the LyP-1 peptide, for example, can be
used for harnessing this potential.
iv. Experimental Procedures
[0278] a. Reagents
[0279] Mouse monoclonal 60.11 and 74.5.2 anti-gC1qR/p32 antibodies
were purchased from Chemicon (Temecula, Calif.). Rat monoclonal
anti-mouse CD-31, rat anti-MECA-32, rat anti mouse CD-11b and
R-Phycoerythrin (R-PE)-conjugated rat anti-mouse Gr-1 were from
BD-PharMingen (San Jose, Calif.), the anti-epithelial membrane
antigen (clone E29) was from Chemicon and anti .beta.-actin from
Sigma-Aldrich (St. Louis, Mo.). Monoclonal anti-cytochrome c was
purchased from BD-PharMingen. Rat anti-podoplanin antibody was
kindly provided by Drs. T. Petrova and K. Alitalo (University of
Helsinki, Helsinki, Finland). ChromPure Rabbit IgG (whole molecule)
was from Jackson ImmunoResearch Laboratories (West Grove, Pa.) and
purified Mouse IgG1 (mIgG) from BD-Pharmingen. Purified polyclonal
anti-full-length gC1qR/p32 was a generous gift from Dr. B.
Ghebrehiwet (Stony Brook University, NY). Polyclonal antibody
anti-gC1qR/p32 NH2-terminal antibody was generated in New Zealand
White rabbits against a mixture of peptides corresponding to amino
acids 76-93 of mouse (TEGDKAFVEFLTDEIKEE, SEQ ID NO 8) and human
(TDGDKAFVDFLSDEIKEE, SEQ ID NO: 9) gC1qR/p32 protein. The peptides
were coupled to keyhole limpet hemocyanin (Pierce, Rockford, Ill.)
via a cysteine residue added at their N-termini and the conjugate
was used to immunize the rabbits according to instructions of the
hemocyanine manufacturer. The antibody was affinity purified on the
peptides coupled to Sulfolink Gel (Pierce,) via the N-terminal
cysteine. Dr. A. Strongin (Burnham Institute for Medical Research,
La Jolla, Calif.) kindly provided human gC1qR/p32 cDNA in pcDNA3.1
Zeo and pET-15b vectors. Oligonucleotide duplexes for transient
siRNA knock-down of gC1qR/p32 (C1QBP-HSS101146-47-48 Stealth RNAi)
and negative control duplexes (Stealth RNAi control low GC and
medium GC) were purchased from Invitrogen (Carlsbad, Calif.).
Tissue Arrays (core diameter 0.6 mm) of paraformaldehyde fixed and
paraffin-embedded tumor and normal tissue samples were from Applied
Phenomics LLC (Tartu, Estonia).
[0280] b. Cell Culture and Generation of Stable Cell Lines
[0281] MDA-MB-435, C8161, BT549, HL60, and Raji cells were
maintained in DMEM containing 4500 mg/ml (25 mM) of glucose
(without sodium pyruvate) and supplemented with 10% FBS and 1%
Glutamine Pen-Strep (Omega Scientific, Tarzana, Calif.) at
37.degree. C./5% CO2. For experiments in high and low glucose
conditions, cells were first adapted for a few days to DMEM (25 mM
glucose) supplement with 10% dialized FBS (dFBS; glucose.ltoreq.5
mg/dl, Invitrogen).
[0282] Stable expression of control and gC1qR/p32 shRNA in
MDA-MB-435 cells was achieved through the BLOCK-iT Lentiviral RNAi
Expression system (Invitrogen). The design of shRNAs sequences
complementary to gC1qR/p32 (Gene-Bank NM.sub.--001212) was carried
out using Invitrogen's RNAi Designer. The double-stranded
oligonucleotides were first cloned into the pENTRTM/U6 vector and
tested for gC1qR/p32 silencing by transient transfection. The
optimal gC1qR/p32 shRNA sequence (targeting nucleotides
5'-GGATGAGGTTGGACAAGAAGA-3', SEQ ID NO: 10) was subsequently
transferred into the pLenti6/BLOCK-iTTM-DEST vector for lentiviral
RNAi production in 293FT cell line according to the manufacturer's
instructions. As a control shRNA, we used a two-base-pair
mismatched shRNA targeting a different region of gC1qR/p32 cDNA
(5'-CCCAATaTCGTGGTTGAtGTTATAA-3', SEQ ID NO 11) lowercase
nucleotides indicate the base pair mismatch). MDA-MB-435 cells were
transduced with gC1qR/p32 and control RNAi lentiviral stocks.
Selection of stably transduced clones was done in medium containing
Blasticidin (5 .mu.g/ml, Invitrogen).
[0283] To produce a gC1qR/p32 construct resistant to the selected
shRNA, the quick Change II site-directed mutagenesis kit
(Stratagene; Cedar Creek, Tex.) was used to introduce two silent
mutations within the gC1qR/p32 sequence targeted by the shRNA
(5'-GGATGAGGTTGGACAgGAgGA-3', SEQ ID NO: 12, lowercase nucleotides
indicate silent mutations). The pcDNA3.1Zeo gC1qR/p32 construct was
used as a template. The resulting construct was transfected into an
MDA-MB-435 cell clone stably expressing the gC1qR/p32 shRNA, and
Zeocin (600 .mu.g/ml, Invitrogen) was used to select clones with
restored gC1qR/p32 expression.
[0284] c. Pull-Down Assays and Mass Spectrometry
[0285] Streptavidin agarose beads (Sigma-Aldrich) were resuspended
in 2 volumes of phosphate buffer saline (PBS) and conjugated to 3
.mu.g/10 .mu.l beads of biotynilated peptides for 2 h on ice. After
incubation, beads were washed three times with PBS/50 mM
n-octyl-.beta.-D glucopyranoside (Calbiochem; San Diego, Calif.) to
remove free peptides. Cells at 80-90% of confluence were pelleted
and lysed in cold PBS/200 mM n-octyl-.beta.-D glucopyranoside and
1% protease inhibitor cocktail (Sigma-Aldrich). The lysate was
incubated on ice for 30 min before centrifugation at 14000 rpm for
30 min. An aliquot of the supernatant containing 1 mg of protein
was pre-cleared with 40 .mu.l of streptavidin beads for 2 h at
4.degree. C. and subsequently incubated with streptavidin beads
loaded with biotinylated peptides over night at 4.degree. C. After
6 washes with PBS/50 mM n-octyl-.beta.-D glucopyranoside, the beads
were boiled for 5 min in 40 .mu.l of SDS-PAGE-loading buffer, and
the eluted material was separated on a 4-20% polyacrylamide gel and
visualized by silver staining (Invitrogen). Bands that appeared in
the LyP-1 but not control peptide pull down were cut out, digested
with trypsin, and the resulting peptides were analyzed by
matrix-assisted laser desorption ionization-time of flight
(MALDI-TOF) mass spectrometry. The information was queried against
a protein sequence data via Profound software.
[0286] d. In Vitro Phage Binding Assays
[0287] Microtiter wells (Costar, Corning, N.Y.) were coated
overnight at 4.degree. C. with 5 .mu.g/ml of either purified
gC1qR/p32 or BSA (Sigma-Aldrich) in 100 .mu.l/well of carbonate
buffer (15 mM sodium carbonate, 35 mM sodium bicarbonate). Wells
were washed three times with TBS and blocked with Pierce Superblock
buffer according to the manufactures instructions. 108 pfu of LyP-1
and control phages were added to the wells in 100 .mu.l/well of
TBS/0.05% tween-20 and incubated for 16 h at 37.degree. C. After 6
washes in TBS/0.05% tween-20, bound phages were eluted with 200
.mu.l of Tris-HCl 1M pH 7.5/0.5% SDS for 30 min and subsequently
quantified by plaque assay. For inhibition of phage binding by anti
gC1qR/p32 antibodies the assay was performed as described above
with the difference that 1.5.times.107 pfu of LyP-1 or insertless
phages were allowed to bind for 6 h at 37.degree. C. to gC1qR/p32
protein in the presence of 20 .mu.g/ml of mAb anti gC1qR/p32
antibodies or mIgG. When the assay was performed with cells,
2.times.10.sup.6 Raji cells were resuspended in 500 .mu.l of PBS/1%
BSA and pre-incubated for 1 h at 4.degree. C. with 40 .mu.g/ml of
mAb anti gC1qR/p32 antibodies or mIgG. 108 pfu of insertelss or
LyP-1 phages were subsequently added to the cells and incubated at
4.degree. C. for 3 h. Cells were washed 5 times with PBS/1% BSA and
bound phages were quantified by plaque assay.
[0288] e. Immunoblotting and Immunohistology
[0289] Cells grown in tissue culture plates were rinsed with PBS
and lyzed with NET buffer 1% NP40 (150 mM NaCl, 50 mM Tris-Hcl pH
7.5, 5 mM EDTA pH 8, 1% NP40) containing complete protease
inhibitor cocktail. Unbound material was removed by centrifugation
at 14,000 rpm for 20 min. Protein concentration of the supernatant
was determined by Bio-Rad protein assay. To prepare tumor lysates,
tumors were removed, minced, and dissociated in DMEM (1:4 weight to
volume) supplemented with 1 mg/ml collagenase (Sigma-Aldrich) for
30 min at 37.degree. C. The cell suspension was centrifuged at 1000
rpm for 5 min and the cell pellet was washed 3 times with PBS/1%
BSA prior to lysis in NET buffer containing 1% NP40. An aliquot of
each lysate containing equivalent amounts of protein was separated
by SDS-PAGE on 4-20% gradient gels and proteins were transferred to
nitrocellulose membrane (Invitrogen). Immunoblots were prepared
with 1 .mu.g/ml of primary antibodies 60.11 monoclonal
anti-gC1qR/p32, polyclonal anti-gC1qR/p32 and anti-.beta.-actin and
goat anti-rabbit or rabbit anti-mouse IgG-HRP (diluted 1:1000, Dako
Cytomation; Carpinteria, Calif.). The blots were developed using
SuperSignal West Pico Chemiluminescent Substrate (Pierce, Rockford,
Ill.).
[0290] Immunohistochemical staining of frozen tissue sections was
carried out using acetone fixation and reagents from Molecular
Probes (Invitrogen). The secondary antibodies were: AlexaFluor-594
goat anti-rat or rabbit IgG, AlexaFluor-488 goat anti rabbit IgG.
The slides were washed with PBS, incubated for 5 min with DAPI (1
.mu.g/ml) and mounted with ProLong Gold anti-fade reagent.
Cytochrome c and gC1qR/p32 were detected in cultured cells fixed in
4% PFA for 20 min at room temperature, followed by permeabilization
with 0.2% Triton-X-100 in PBS for 5 min. Paraffin-embedded normal
and malignant human tissue array sections were deparaffinized and
then treated with Target Retrieval Solution (Dako-Cytometion). The
tissue array sections were stained as described above, except
gC1qR/p32 and epithelial membrane antigen, which were detected with
biotinylated anti-mouse IgG and Vectastain ABC kit (Vector
Laboratories Inc, Burlingame, Calif.). To prevent non-specific
staining due to endogenous biotin, sections were treated with DAKO
Biotin Blocking system prior to antibody incubation.
[0291] f. FACS Analysis
[0292] Cultured cells were detached with cell enzyme-free
dissociation buffer (Gibco/Invitrogen) and collected in PBS
containing 1% BSA (PBSB). Single cells suspensions from tumors were
obtained as indicated above. For FACS staining, 2.5.times.105 cells
were resuspended in 100 .mu.l of PBSB and incubated with polyclonal
anti-full-length gC1qR/p32 or rabbit IgG (20 .mu.g/ml) in PBSB for
30 min at 4.degree. C. The cells were washed in PBSB and stained
with goat anti rabbit Alexa 488 (2.5 .mu.g/ml) for 30 min at
4.degree. C. For FACS analysis of bound FITC-peptides, cultured
cells were detached as above and incubated with 10 .mu.M of
FITC-peptides in 10% FCS/DMEM for 1 hour at 4.degree. C. After
washes with PBSB, the cells were resuspended in PBS containing 2
.mu.g/ml of propidium iodide (PI, Molecular Probes/Invitrogen) to
distinguish between live and dead cells, and 10,000 cells per
sample were analyzed using a BD Biosciences FACSort.
[0293] g. Quantification of Growth Rates and Cell Death
[0294] MDA-MB-435 clones were seeded in DMEM (25 mM glucose)/10%
dialyzed FBS in duplicate at a density of 2.5.times.104 cells per
well in 12-well plates and allowed to adhere overnight. The medium
was removed by washing and substituted with glucose-free DMEM
supplement with 10% dialyzed FBS and either 25 or 2.5 mM glucose
(Mediatech, Inc., Herndon, Va.). The absolute cell count in each
well at each time point was quantified by flow cytometry using
CountBright absolute counting beads (Molecular Probes/Invitrogen).
For cell death quantification, cells were grown for 3 days in
either 25, 2.5, or 0.5 mM glucose, and the Annexin V-FITC kit from
BioVision (Mountain View, Calif.) was used to quantify dead cells
by flow cytometry.
[0295] h. Quantification of Lactate Production and Glucose
Consumption
[0296] The amount of lactate present in the culture media was
determined by generally following the Sigma Diagnostic procedure No
836-UV. All the components were purchased separately from Sigma.
Nicotinamide adenine dinucleotide (10 mg) was dissolved in 2 ml
glycine buffer, 4 ml of water and 100 .mu.l lactate dehydrogenase
(1000 U/ml). In a 96-well plate, 5 .mu.l of media sample was added
to 145 .mu.l of the enzyme mixture and incubated at room
temperature for 30 min. Increased absorbance at 340 nm due to NADH
production was used as measure of lactate originally present in the
media. Lactate production/well at a given time point (Tx) was
determined from: (A340 nm of cells media at Tx-A340 nm of media
only [To]) divided by cell number at Tx. The amount of glucose
present in the media was determined using the Glucose Assay Kit
(K606-100) from BioVision. Glucose consumption/well was calculated
as: (nmol glucose in media only (To)-nmol glucose in cell media at
Tx) divided by cell number at Tx.
[0297] i. Measurement of Cellular ATP
[0298] Cellular ATP levels were determined by a
luciferin-luciferase-based assay using the ATP Bioluminescence
Assay Kit CLS II (Roche; city, state). Cells (2.5.times.106) were
seeded in 6-well plates in DMEM (25 mM glucose)/10% dFCS. The day
after cells were washed, and fresh medium containing 25 or 2.5 mM
glucose was added. Four days later, the cells were lysed in 300
.mu.l of NET buffer containing 1% NP40. Supernatants were diluted 4
times in 100 mM Tris, 4 mM EDTA, pH 7.75, and 50 .mu.l samples were
assayed with 50 .mu.l of luciferase reagent in duplicate on a
Spectra Max Gemini plate reader. The light signal was integrated
for 10 s after a delay of 1 s. The bioluminescence units were
normalized for the protein concentration determined by Bio-Rad
protein assay (Bio-Rad Laboratories, Hercules, Calif.).
[0299] j. Quantification of Oxygen Consumption
[0300] Oxygen consumption rates of cells in culture were measured
using the BD Oxygen Biosensor Systems (OBS) from BD Bioscience.
Triplicate samples of 12,000 cells seeded onto 96-well OBS plates
in final media volume of 200 .mu.l were used for the measurement.
The number of cells at each time point was determined using
CountBright absolute counting beads by sampling cells seeded onto
side-by-side plates. Fluorescence was measured every 24 h on a
Spectra Max Gemini plate reader (excitation 485 nm and emission 630
nm) using the bottom plate reading configuration. Each measurement
was normalized by factoring in a blank reading from the same well
prior to the addition of the cells and the number of cells in the
well at the time of the measurement (Guarino et al., 2004).
[0301] k. Mice and Tumors
[0302] To produce tumors, BALB/c nude mice were orthotopically
injected into the mammary fat pad with 2.times.106 MDA-MB-435
cells/100 .mu.l of PBS. All animal experimentation received
approval from the Animal Research Committee of Burnham Institute
for Medical Research. The sizes of tumors were monitored and
measured every three days. For in vivo BrdU labeling of tumor
cells, tumor-bearing mice were intraperitoneally injected with 1 mg
of BrdU (Sigma-Aldrich). The mice were sacrificed 24 h later, and
the tumors were removed and fixed in Bouin's solution (Ricca
Chemical Company, Arlington, Tex.) for 72 h prior to processing for
paraffin embedding.
TABLE-US-00001 TABLE 1 Immuno-score of gC1qR/p32 expression in
malignant and normal tissues. Cases CARCINOMA TYPE Score 1 2 3 4 5
6 Breast Ductal I 1 1.5 2.5 1 1 1.5 % 60 70 100 60 70 80 IS 60 105
250 60 70 123 Lobular I 2.5 2.5 0 2.5 2 NT % 90 90 80 100 IS 225
225 0 200 200 Mucinous I 1 1 % 60 20 IS 60 20 Endometroid
Adenocarcinoma I 2 1.5 1.5 3 1 % 60 90 100 90 90 IS 120 135 150 270
90 Ovarial Adenocarcinoma I 1.5 1 1 1 1 % 50 15 10 40 30 IS 75 15
10 40 30 Colon Adenocarcinoma I 2.5 2 2.5 3 2 % 100 40 100 80 90 IS
250 80 250 240 180 Stomac Adenocarcinoma I 2 2 NT 3 3 % 70 90 100
100 IS 140 180 300 300 Pancreas I 1.sub.(NT islet) 2.5.sub.(NT) NT
2 0 % 40 80 90 IS 40 200 180 0 Kidney Clear cells carcinoma I 1.5
1.5 2 2 1 % 90 70 70 80 10 IS 135 105 140 160 10 Melanoma Skin I
2.5 2 % 80 40 IS 200 80 Metastasis I 2 1.5 % 70 30 IS 140 45 Liver
I 0 % IS 0 Testis I 3 3 3 % 100 100 90 IS 300 300 270 Lung Squamous
cells I 2.5 1.sub.(necr) 1.sub.(necr) NT % 50 15 10 IS 125 15 10
Sarcoma I 0.sub.(necr) % IS 0 Glioblastoma I 1 1 1 % 30 30 20 IS 30
30 20 Spleen Histiocytoma I 1.5 % 80 IS 120 Prostate I 0
0.sub.(stroma 2+) 1 0.sub.(stroma+) 3.sub.(stroma+) 0.sub.(stroma+)
% 10 10 IS 0 0 10 0 30 0 Bladder I 1 % 10 IS 10 Cases CARCINOMA
TYPE Score 7 8 9 10 11 Breast Ductal I 1 1 2 1 1.5 % 50 60 100 60
80 IS 50 60 200 60 120 Lobular I 1.5 1 % 70 40 IS 105 40 Mucinous I
% IS Endometroid Adenocarcinoma I % IS Ovarial Adenocarcinoma I %
IS Colon Adenocarcinoma I % IS Stomac Adenocarcinoma I % IS
Pancreas I % IS Kidney Clear cells carcinoma I % IS Melanoma Skin I
% IS Metastasis I % IS Liver I % IS Testis I % IS Lung Squamous
cells I % IS Sarcoma I % IS Glioblastoma I % IS Spleen Histiocytoma
I % IS Prostate I 0 0 1.5 % 15 IS 0 0 22.5 Bladder I % IS TYPE OF
NORMAL TISSUE INTENSITY CELLS POSITIVE frontal lobe 1-2+ microglia
(gray matter) frontal lobe 1-2+ microglia (white matter) cerebellum
1+ Purkinje cells (cortex) Peripheral nerve - Adrenal gland 2+
cortex Liver 1-2+ Pancreas 3+ Ovary - Testis +/- gonia cells 2+
Leydig cells Thyroid 1-2+ epithelium Spleen +/- small lymphocytes +
Lung 2+/3+ macrophages Myocard 1+ Aorta +/- Salivary gland 1+/2+
Liver 1/2+ Esophagus 1+ Musc. Mucosa Stomac 1-2+ (antrum) Small
intestine 3+ (Ileum) Cecum 1+ ! no epithelium, sm muscle Kidney
2-3+ distal ducts (cortex) Kidney 2+/3+ (medulla) Bladder +/- ! no
epithelium, sm muscle Uterus - Oviduct 3+ Epithelium Prostate 2-3+
Skeletal muscle +/- Skin - Dermis 1+ Epidermis Lymph node ! Not
considered: smoker Adipose tissue - Ependymis - Tongue +/- Thymus -
stroma +/- Hassal bodies Placenta 1-2+ Fetal membranes - Umbilical
cord - I = staining intensity (scale 1-3), % = percentage of tumor
cells (EMA positive) with a given gC1qR/p32 intensity of staining
(scale 0-100). IS = immuno-score: I .times. % (scale 0-300). NT
(non-tumor) was used to indicate samples were tumor cells were not
identified.
REFERENCES
[0303] Alirol, E., and Martinou, J. C. (2006). Mitochondria and
cancer: is there a morphological connection? Oncogene 25,
4706-4716. [0304] Alitalo, K., Mohla, S., and Ruoslahti, E. (2004).
Lymphangiogenesis and cancer: meeting report. Cancer Res 64,
9225-9229. [0305] Arap, W., Haedicke, W., Bernasconi, M., Kain, R.,
Rajotte, D., Krajewski, S., Ellerby, H. M., Bredesen, D. E.,
Pasqualini, R., and Ruoslahti, E. (2002). Targeting the prostate
for destruction through a vascular address. Proc Natl Acad Sci USA
99, 1527-1531. [0306] Arap, W., Pasqualini, R., and Ruoslahti, E.
(1998a). Cancer treatment by targeted drug delivery to tumor
vasculature in a mouse model. Science 279, 377-380. [0307] Arap,
W., Pasqualini, R., and Ruoslahti, E. (1998b). Chemotherapy
targeted to tumor vasculature. Curr Opin Oncol 10, 560-565. [0308]
Blancato, J., Singh, B., Liu, A., Liao, D. J., and Dickson, R. B.
(2004). Correlation of amplification and overexpression of the
c-myc oncogene in high-grade breast cancer: FISH, in situ
hybridisation and immunohistochemical analyses. Br J Cancer 90,
1612-1619. [0309] Braun, L., Ghebrehiwet, B., and Cossart, P.
(2000). gC1q-R/p32, a C1q-binding protein, is a receptor for the
In1B invasion protein of Listeria monocytogenes. Embo J 19,
1458-1466. [0310] Christian, S., Pilch, J., Akerman, M. E., Porkka,
K., Laakkonen, P., and Ruoslahti, E. (2003). Nucleolin expressed at
the cell surface is a marker of endothelial cells in angiogenic
blood vessels. J Cell Biol 163, 871-878. [0311] Deb, T. B., and
Datta, K. (1996). Molecular cloning of human fibroblast hyaluronic
acid-binding protein confirms its identity with P-32, a protein
co-purified with splicing factor SF2. Hyaluronic acid-binding
protein as P-32 protein, co-purified with splicing factor SF2. J
Biol Chem 271, 2206-2212. [0312] Dedio, J., Jahnen-Dechent, W.,
Bachmann, M., and Muller-Esterl, W. (1998). The multiligand-binding
protein gC1qR, putative C1q receptor, is a mitochondrial protein. J
Immunol 160, 3534-3542. [0313] Degenhardt, K., Mathew, R.,
Beaudoin, B., Bray, K., Anderson, D., Chen, G., Mukherjee, C., Shi,
Y., Gelinas, C., Fan, Y., et al. (2006). Autophagy promotes tumor
cell survival and restricts necrosis, inflammation, and
tumorigenesis. Cancer Cell 10, 51-64. [0314] Effert, P. J., Bares,
R., Handt, S., Wolff, J. M., Bull, U., and Jakse, G. (1996).
Metabolic imaging of untreated prostate cancer by positron emission
tomography with 18-fluorine-labeled deoxyglucose. J Urol 155,
994-998. [0315] Fantin, V. R., St-Pierre, J., and Leder, P. (2006).
Attenuation of LDH-A expression uncovers a link between glycolysis,
mitochondrial physiology, and tumor maintenance. Cancer Cell 9,
425-434. [0316] Garber, K. (2006). Energy deregulation: licensing
tumors to grow. Science 312, 1158-1159. [0317] Ghebrehiwet, B.,
Jesty, J., and Peerschke, E. I. (2002). gC1q-R/p33:
structure-function predictions from the crystal structure.
Immunobiology 205, 421-432. [0318] Ghebrehiwet, B., Lim, B. L.,
Peerschke, E. I., Willis, A. C., and Reid, K. B. (1994). Isolation,
cDNA cloning, and overexpression of a 33-kD cell surface
glycoprotein that binds to the globular "heads" of C1q. J Exp Med
179, 1809-1821. [0319] Ghosh, I., Chowdhury, A. R., Rajeswari, M.
R., and Datta, K. (2004). Differential expression of Hyaluronic
Acid Binding Protein 1 (HABP1)/P32/C1QBP during progression of
epidermal carcinoma. Mol Cell Biochem 267, 133-139. [0320] Guarino,
R. D., Dike, L. E., Haq T. A., Rowley, J. A., Pitner, J. B., and
Timmins, M. R. (2004). Method for determining oxygen consumption
rates of static cultures from microplate measurements of
pericellular dissolved oxygen concentration. Biotechnol Bioeng 86,
775-787. [0321] Guo, W. X., Ghebrehiwet, B., Weksler, B.,
Schweitzer, K., and Peerschke, E. I. (1999). Up-regulation of
endothelial cell binding proteins/receptors for complement
component C1q by inflammatory cytokines J Lab Clin Med 133,
541-550. [0322] Gupta, S., Batchu, R. B., and Datta, K. (1991).
Purification, partial characterization of rat kidney hyaluronic
acid binding protein and its localization on the cell surface. Eur
J Cell Biol 56, 58-67. [0323] Herwald, H., Dedio, J., Kellner, R.,
Loos, M., and Muller-Esterl, W. (1996). Isolation and
characterization of the kininogen-binding protein p33 from
endothelial cells. Identity with the gC1q receptor. J Biol Chem
271, 13040-13047. [0324] Hirasawa, A., Awaji, T., Xu, Z., Shinoura,
H., and Tsujimoto, G. (2001). Regulation of subcellular
localization of alpha1-adrenoceptor subtypes. Life Sci 68,
2259-2267. [0325] Hofer, C., Laubenbacher, C., Block, T., Breul,
J., Hartung, R., and Schwaiger, M. (1999).
Fluorine-18-fluorodeoxyglucose positron emission tomography is
useless for the detection of local recurrence after radical
prostatectomy. Eur Urol 36, 31-35. [0326] Hoffman, J. A., Giraudo,
E., Singh, M., Zhang, L., Inoue, M., Porkka, K., Hanahan, [0327]
D., and Ruoslahti, E. (2003). Progressive vascular changes in a
transgenic mouse model of squamous cell carcinoma. Cancer Cell 4,
383-391. [0328] Inoki, K., Zhu, T., and Guan, K. L. (2003). TSC2
mediates cellular energy response to control cell growth and
survival. Cell 115, 577-590. [0329] Isidoro, A., Casado, E.,
Redondo, A., Acebo, P., Espinosa, E., Alonso, A. M., Cejas, P.,
Hardisson, D., Fresno Vara, J. A., Belda-Iniesta, C., et al.
(2005). Breast carcinomas fulfill the Warburg hypothesis and
provide metabolic markers of cancer prognosis. Carcinogenesis 26,
2095-2104. [0330] Jain, R. K. (1998). The next frontier of
molecular medicine: delivery of therapeutics. Nat Med 4, 655-657.
[0331] Jiang, J., Zhang, Y., Krainer, A. R., and Xu, R. M. (1999).
Crystal structure of human p32, a doughnut-shaped acidic
mitochondrial matrix protein. Proc Natl Acad Sci USA 96, 3572-3577.
[0332] Jin, S., DiPaola, R. S., Mathew, R., and White, E. (2007).
Metabolic catastrophe as a means to cancer cell death. J Cell Sci
120, 379-383. [0333] Jones, R. G., Plas, D. R., Kubek, S., Buzzai,
M., Mu, J., Xu, Y., Birnbaum, M. J., and Thompson, C. B. (2005).
AMP-activated protein kinase induces a p53-dependent metabolic
checkpoint. Mol Cell 18, 283-293. [0334] Joseph, K., Ghebrehiwet,
B., Peerschke, E. I., Reid, K. B., and Kaplan, A. P. (1996).
Identification of the zinc-dependent endothelial cell binding
protein for high molecular weight kininogen and factor XII:
identity with the receptor that binds to the globular "heads" of
C1q (gC1q-R). Proc Natl Acad Sci USA 93, 8552-8557. [0335] Joyce,
J. A., Laakkonen, P., Bernasconi, M., Bergers, G., Ruoslahti, E.,
and Hanahan, D. (2003). Stage-specific vascular markers revealed by
phage display in a mouse model of pancreatic islet tumorigenesis.
Cancer Cell 4, 393-403. [0336] Kaur, I., Voss, S. D., Gupta, R. S.,
Schell, K., Fisch, P., and Sondel, P. M. (1993). [0337] Human
peripheral gamma delta T cells recognize hsp60 molecules on Daudi
Burkitt's lymphoma cells. J Immunol 150, 2046-2055. [0338]
Kerjaschki, D. (2005). The crucial role of macrophages in
lymphangiogenesis. J Clin Invest 115, 2316-2319. [0339] Kerjaschki,
D., Huttary, N., Raab, I., Regele, H., Bojarski-Nagy, K., Bartel,
G., Krober, S. M., Greinix, H., Rosenmaier, A., Karlhofer, F., et
al. (2006). Lymphatic endothelial progenitor cells contribute to de
novo lymphangiogenesis in human renal transplants. Nat Med 12,
230-234. [0340] Khan, I. U., Wallin, R., Gupta, R. S., and Kammer,
G. M. (1998). Protein kinase A-catalyzed phosphorylation of heat
shock protein 60 chaperone regulates its attachment to histone 2B
in the T lymphocyte plasma membrane. Proc Natl Acad Sci USA 95,
10425-10430. [0341] Kittlesen, D. J., Chianese-Bullock, K. A., Yao,
Z. Q., Braciale, T. J., and Hahn, Y. S. (2000). Interaction between
complement receptor gC1qR and hepatitis C virus core protein
inhibits T-lymphocyte proliferation. J Clin Invest 106, 1239-1249.
[0342] Krainer, A. R., Mayeda, A., Kozak, D., and Binns, G. (1991).
Functional expression of cloned human splicing factor SF2: homology
to RNA-binding proteins, UI 70K, and Drosophila splicing
regulators. Cell 66, 383-394. [0343] Laakkonen, P., Akerman, M. E.,
Biliran, H., Yang, M., Ferrer, F., Karpanen, T., Hoffman, R. M.,
and Ruoslahti, E. (2004). Antitumor activity of a homing peptide
that targets tumor lymphatics and tumor cells. Proc Natl Acad Sci
USA 101, 9381-9386. [0344] Laakkonen, P., Porkka, K., Hoffman, J.
A., and Ruoslahti, E. (2002). A tumor-homing peptide with a
targeting specificity related to lymphatic vessels. Nat Med 8,
751-755. [0345] Lee, S. M., Lee, E. J., Hong, H. Y., Kwon, M. K.,
Kwon, T. H., Choi, J. Y., Park, R. W., Kwon, T. G., Yoo, E. S.,
Yoon, G. S., et al. (2007). Targeting bladder tumor cells in vivo
and in the urine with a peptide identified by phage display. Mol
Cancer Res 5, 11-19. [0346] Levine, B. (2007). Cell biology:
autophagy and cancer. Nature 446, 745-747. [0347] Liao, D. J., and
Dickson, R. B. (2000). c-Myc in breast cancer. Endocr Relat Cancer
7, 143-164. [0348] Lim, B. L., Reid, K. B., Ghebrehiwet, B.,
Peerschke, E. I., Leigh, L. A., and Preissner, K. T. (1996). The
binding protein for globular heads of complement C1q, gC1qR.
Functional expression and characterization as a novel vitronectin
binding factor. J Biol Chem 271, 26739-26744. [0349] Liu, Y.
(2006). Fatty acid oxidation is a dominant bioenergetic pathway in
prostate cancer. Prostate Cancer Prostatic Dis 9, 230-234. [0350]
Majumdar, M., Meenakshi, J., Goswami, S. K., and Datta, K. (2002).
Hyaluronan binding protein 1 (HABP1)/C1QBP/p32 is an endogenous
substrate for MAP kinase and is translocated to the nucleus upon
mitogenic stimulation. Biochem Biophys Res Commun 291, 829-837.
[0351] Maruyama, K., Asai, J., Ii, M., Thorne, T., Losordo, D. W.,
and D'Amore, P. A. (2007). Decreased macrophage number and
activation lead to reduced lymphatic vessel formation and
contribute to impaired diabetic wound healing. Am J Pathol 170,
1178-1191. [0352] Maruyama, K., Ii, M., Cursiefen, C., Jackson, D.
G., Keino, H., Tomita, M., Van Rooijen, N., Takenaka, H., D'Amore,
P. A., Stein-Streilein, J., et al. (2005). Inflammation-induced
lymphangiogenesis in the cornea arises from CD11b-positive
macrophages. J Clin Invest 115, 2363-2372. [0353] Matthews, D. A.,
and Russell, W. C. (1998). Adenovirus core protein V interacts with
p32-a protein which is associated with both the mitochondria and
the nucleus. J Gen Virol 79 (Pt 7), 1677-1685. [0354] Muta, T.,
Kang, D., Kitajima, S., Fujiwara, T., and Hamasaki, N. (1997). p32
protein, a splicing factor 2-associated protein, is localized in
mitochondrial matrix and is functionally important in maintaining
oxidative phosphorylation. J Biol Chem 272, 24363-24370. [0355] Oh,
P., Li, Y., Yu, J., Dun, E., Krasinska, K. M., Carver, L. A.,
Testa, J. E., and Schnitzer, J. E. (2004). Subtractive proteomic
mapping of the endothelial surface in lung and solid tumours for
tissue-specific therapy. Nature 429, 629-635. [0356]
Parle-McDermott, A., McWilliam, P., Tighe, O., Dunican, D., and
Croke, D. T. (2000). Serial analysis of gene expression identifies
putative metastasis-associated transcripts in colon tumour cell
lines. Br J Cancer 83, 725-728. [0357] Peerschke, E. I., Reid, K.
B., and Ghebrehiwet, B. (1994). Identification of a novel 33-kDa
C1q-binding site on human blood platelets. J Immunol 152,
5896-5901. [0358] Porkka, K., Laakkonen, P., Hoffman, J. A.,
Bernasconi, M., and Ruoslahti, E. (2002). A fragment of the HMGN2
protein homes to the nuclei of tumor cells and tumor endothelial
cells in vivo. Proc Natl Acad Sci USA 99, 7444-7449. [0359] Reef,
S., Shifman, O., Oren, M., and Kimchi, A. (2007). The autophagic
inducer smARF interacts with and is stabilized by the mitochondrial
p32 protein. Oncogene. [0360] Robles-Flores, M., Rendon-Huerta, E.,
Gonzalez-Aguilar, H., Mendoza-Hernandez, G., Islas, S., Mendoza,
V., Ponce-Castaneda, M. V., Gonzalez-Mariscal, L., and
Lopez-Casillas, F. (2002). p32 (gC1qBP) is a general protein kinase
C(PKC)-binding protein; interaction and cellular localization of
P32-PKC complexes in ray hepatocytes. J Biol Chem 277, 5247-5255.
[0361] Rozanov, D. V., Ghebrehiwet, B., Postnova, T. I., Eichinger,
A., Deryugina, E. I., and Strongin, A. Y. (2002a). The
hemopexin-like C-terminal domain of membrane type 1 matrix
metalloproteinase regulates proteolysis of a multifunctional
protein, gC1qR. J Biol Chem 277, 9318-9325. [0362] Rozanov, D. V.,
Ghebrehiwet, B., Ratnikov, B., Monosov, E. Z., Deryugina, E. I.,
and Strongin, A. Y. (2002b). The cytoplasmic tail peptide sequence
of membrane type-1 matrix metalloproteinase (MT1-MMP) directly
binds to gC1qR, a compartment-specific chaperone-like regulatory
protein. FEBS Lett 527, 51-57. [0363] Rubinstein, D. B.,
Stortchevoi, A., Boosalis, M., Ashfaq, R., Ghebrehiwet, B.,
Peerschke, E. I., Calvo, F., and Guillaume, T. (2004). Receptor for
the globular heads of C1q (gC1q-R, p33, hyaluronan-binding protein)
is preferentially expressed by adenocarcinoma cells. Int J Cancer
110, 741-750. [0364] Rubinsztein, D. C., Gestwicki, J. E., Murphy,
L. O., and Klionsky, D. J. (2007). Potential therapeutic
applications of autophagy. Nat Rev Drug Discov 6, 304-312. [0365]
Ruoslahti, E. (2002). Specialization of tumour vasculature. Nat Rev
Cancer 2, 83-90. [0366] Schaerer, M. T., Kannenberg, K., Hunziker,
P., Baumann, S. W., and Sigel, E. (2001). Interaction between
GABA(A) receptor beta subunits and the multifunctional protein
gC1q-R. J Biol Chem 276, 26597-26604. [0367] Schledzewski, K.,
Falkowski, M., Moldenhauer, G., Metharom, P., Kzhyshkowska, J.,
Ganss, R., Demory, A., Falkowska-Hansen, B., Kurzen, H., Ugurel,
S., et al. (2006). Lymphatic endothelium-specific hyaluronan
receptor LYVE-1 is expressed by stabilin-1+, F4/80+,
CD11b+macrophages in malignant tumours and wound healing tissue in
vivo and in bone marrow cultures in vitro: implications for the
assessment of lymphangiogenesis. J Pathol 209, 67-77. [0368]
Sengupta, A., Tyagi, R. K., and Datta, K. (2004). Truncated
variants of hyaluronan-binding protein 1 bind hyaluronan and induce
identical morphological aberrations in COS-1 cells. Biochem J 380,
837-844. [0369] Shaw, R. J. (2006). Glucose metabolism and cancer.
Curr Opin Cell Biol 18, 598-608. [0370] Shim, H., Dolde, C., Lewis,
B. C., Wu, C. S., Dang, G., Jungmann, R. A., Dalla-Favera, R., and
Dang, C. V. (1997). c-Myc transactivation of LDH-A: implications
for tumor metabolism and growth. Proc Natl Acad Sci USA 94,
6658-6663. [0371] Simberg, D., Duza, T., Park, J. H., Essler, M.,
Pilch, J., Zhang, L., Derfus, A. M., Yang, M., Hoffman, R. M.,
Bhatia, S., et al. (2007). Biomimetic amplification of nanoparticle
homing to tumors. Proc Natl Acad Sci USA 104, 932-936. [0372]
Singh, B., Soltys, B. J., Wu, Z. C., Patel, H. V., Freeman, K. B.,
and Gupta, R. S. (1997). Cloning and some novel characteristics of
mitochondrial Hsp70 from Chinese hamster cells. Exp Cell Res 234,
205-216. [0373] Soltys, B. J., and Gupta, R. S. (1996).
Immunoelectron microscopic localization of the 60-kDa heat shock
chaperonin protein (Hsp60) in mammalian cells. Exp Cell Res 222,
16-27.
[0374] Soltys, B. J., and Gupta, R. S. (1997). Cell surface
localization of the 60 kDa heat shock chaperonin protein (hsp60) in
mammalian cells. Cell Biol Int 21, 315-320. [0375] Soltys, B. J.,
and Gupta, R. S. (1999). Mitochondrial-matrix proteins at
unexpected locations: are they exported? Trends Biochem Sci 24,
174-177. [0376] Soltys, B. J., Kang, D., and Gupta, R. S. (2000).
Localization of P32 protein (gC1q-R) in mitochondria and at
specific extramitochondrial locations in normal tissues. Histochem
Cell Biol 114, 245-255. [0377] St Croix, B., Rago, C., Velculescu,
V., Traverso, G., Romans, K. E., Montgomery, E., Lal, A., Riggins,
G. J., Lengauer, C., Vogelstein, B., and Kinzler, K. W. (2000).
Genes expressed in human tumor endothelium. Science 289, 1197-1202.
[0378] Stacker, S. A., Achen, M. G., Jussila, L., Baldwin, M. E.,
and Alitalo, K. (2002). Lymphangiogenesis and cancer metastasis.
Nat Rev Cancer 2, 573-583. [0379] Storz, P., Hausser, A., Link, G.,
Dedio, J., Ghebrehiwet, B., Pfizenmaier, K., and Johannes, F. J.
(2000). Protein kinase C [micro] is regulated by the
multifunctional chaperon protein p32. J Biol Chem 275, 24601-24607.
[0380] Tange, T. O., Jensen, T. H., and Kjems, J. (1996). In vitro
interaction between human immunodeficiency virus type 1 Rev protein
and splicing factor ASF/SF2-associated protein, p32. J Biol Chem
271, 10066-10072. [0381] van Leeuwen, H. C., and O'Hare, P. (2001).
Retargeting of the mitochondrial protein p32/gClQr to a cytoplasmic
compartment and the cell surface. J Cell Sci 114, 2115-2123. [0382]
Wallace, D. C. (2005). Mitochondria and cancer: Warburg addressed.
Cold Spring Harb Symp Quant Biol 70, 363-374. [0383] Xu, Q.,
Schett, G., Seitz, C. S., Hu, Y., Gupta, R. S., and Wick, G.
(1994). Surface staining and cytotoxic activity of heat-shock
protein 60 antibody in stressed aortic endothelial cells. Circ Res
75, 1078-1085. [0384] Zhang, L., Giraudo, E., Hoffman, J. A.,
Hanahan, D., and Ruoslahti, E. (2006). Lymphatic zip codes in
premalignant lesions and tumors. Cancer Res 66, 5696-5706. [0385]
Zhang, Y., Qi, H., Taylor, R., Xu, W., Liu, L. F., and Jin, S.
(2007). The Role of Autophagy in Mitochondria Maintenance:
Characterization of Mitochondrial Functions in Autophagy-Deficient
S. cerevisiae Strains. Autophagy 3, 337-346.
TABLE-US-00002 [0385] Sequences SEQ ID NO: 1 CGNKRTRGC SEQ ID NO: 2
GNKRTRG SEQ ID NO: 3 CREKA SEQ ID NO: 4 CRVRTRSGC SEQ ID NO: 5
ARALPSQRSR SEQ ID NO: 6 .sub.D(KLAKLAK).sub.2 SEQ ID NO: 7
CNRRTKAGC SEQ ID NO: 8 TEGDKAFVEFLTDEIKEE SEQ ID NO: 9
TDGDKAFVDFLSDEIKEE SEQ ID NO: 10 GGATGAGGTTGGACAAGAAGA SEQ ID NO:
11 CCCAATATCGTGGTTGATGTTATAA SEQ ID NO: 12 GGATGAGGTTGGACAGGAGGA
Sequence CWU 1
1
1219PRTArtificial SequenceDescription of Artificial Sequence; note
= synthetic construct 1Cys Gly Asn Lys Arg Thr Arg Gly Cys1
527PRTArtificial SequenceDescription of Artificial Sequence; note =
synthetic construct 2Gly Asn Lys Arg Thr Arg Gly1 535PRTArtificial
SequenceDescription of Artificial Sequence; note = synthetic
construct 3Cys Arg Glu Lys Ala1 549PRTArtificial
SequenceDescription of Artificial Sequence; note = synthetic
construct 4Cys Arg Val Arg Thr Arg Ser Gly Cys1 5510PRTArtificial
SequenceDescription of Artificial Sequence; note = synthetic
construct 5Ala Arg Ala Leu Pro Ser Gln Arg Ser Arg1 5
1067PRTArtificial SequenceDescription of Artificial Sequence; note
= synthetic construct 6Lys Leu Ala Lys Leu Ala Lys1
579PRTArtificial SequenceDescription of Artificial Sequence; note =
synthetic construct 7Cys Asn Arg Arg Thr Lys Ala Gly Cys1
5818PRTArtificial SequenceDescription of Artificial Sequence; note
= synthetic construct 8Thr Glu Gly Asp Lys Ala Phe Val Glu Phe Leu
Thr Asp Glu Ile Lys1 5 10 15Glu Glu918PRTArtificial
SequenceDescription of Artificial Sequence; note = synthetic
construct 9Thr Asp Gly Asp Lys Ala Phe Val Asp Phe Leu Ser Asp Glu
Ile Lys1 5 10 15Glu Glu1021DNAArtificial SequenceDescription of
Artificial Sequence; note = synthetic construct 10ggatgaggtt
ggacaagaag a 211125DNAArtificial SequenceDescription of Artificial
Sequence; note = synthetic construct 11cccaatatcg tggttgatgt tataa
251221DNAArtificial SequenceDescription of Artificial Sequence;
note = synthetic construct 12ggatgaggtt ggacaggagg a 21
* * * * *