U.S. patent application number 13/502487 was filed with the patent office on 2012-08-16 for rapid display method in translational synthesis of peptide.
Invention is credited to Kenji Kashiwagi, Patrick C. Reid.
Application Number | 20120208720 13/502487 |
Document ID | / |
Family ID | 43900380 |
Filed Date | 2012-08-16 |
United States Patent
Application |
20120208720 |
Kind Code |
A1 |
Kashiwagi; Kenji ; et
al. |
August 16, 2012 |
RAPID DISPLAY METHOD IN TRANSLATIONAL SYNTHESIS OF PEPTIDE
Abstract
Provided are linkers suitable for preparing a conjugate of a
nucleic acid and a peptide as a translation product thereof in a
reconstituted cell-free translation system in genotype-phenotype
mapping (display methods), said linkers comprising a
single-stranded structure region having a side chain base pairing
with the base at the 3'-end of an mRNA at one end and a peptidyl
acceptor region containing an amino acid attached to an oligo RNA
consisting of a nucleotide sequence of ACCA via an ester bond at
the other end, characterized in that the ester bond is formed by
using an artificial RNA catalyst. Also provided are display methods
using [mRNA]-[linker]-[peptide] conjugates assembled via such
linkers.
Inventors: |
Kashiwagi; Kenji;
(Meguro-ku, JP) ; Reid; Patrick C.; (Meguro-ku,
JP) |
Family ID: |
43900380 |
Appl. No.: |
13/502487 |
Filed: |
October 21, 2010 |
PCT Filed: |
October 21, 2010 |
PCT NO: |
PCT/JP2010/068549 |
371 Date: |
April 17, 2012 |
Current U.S.
Class: |
506/9 ; 506/16;
530/322; 536/23.1; 536/25.3 |
Current CPC
Class: |
C40B 50/06 20130101;
C40B 40/08 20130101; C12N 15/1062 20130101 |
Class at
Publication: |
506/9 ; 536/23.1;
530/322; 506/16; 536/25.3 |
International
Class: |
C40B 30/04 20060101
C40B030/04; C07H 1/00 20060101 C07H001/00; C07K 9/00 20060101
C07K009/00; C40B 40/06 20060101 C40B040/06; C07H 21/00 20060101
C07H021/00; C07H 21/04 20060101 C07H021/04 |
Foreign Application Data
Date |
Code |
Application Number |
Apr 28, 2011 |
JP |
2009-243240 |
Claims
1. A linker used for preparing a conjugate in which an mRNA and a
peptide as a translation product thereof are coupled via the linker
in a reconstituted in vitro protein synthesis system, said linker
comprising: a single-stranded structure region having side chain
bases pairing with the bases at the 3'-end of the mRNA at one end
of the linker, and a peptidyl acceptor region having a group
capable of binding to the translation product by peptidyl transfer
reaction at the other end of the linker, wherein the peptidyl
acceptor region has a structure containing an amino acid attached
to an oligo RNA consisting of a nucleotide sequence of ACCA via an
ester bond; and said ester bond is formed by an aminoacylation
reaction using an artificial RNA catalyst.
2. The linker of claim 1 wherein the single-stranded structure
region and the peptidyl acceptor region are connected via a
polyethylene glycol moiety.
3. The linker of claim 1 or 2 wherein the single-stranded structure
region consists of a single-stranded DNA.
4. The linker of claim 1 wherein the artificial RNA catalyst used
in the aminoacylation reaction has a chemical structure consisting
of any one of the RNA sequences below: TABLE-US-00007 (SEQ ID NO:
3) GGAUCGAAAGAUUUCCGCAGGCCCGAAAGGGUAUUGGCGUUAGGU (SEQ ID NO: 4)
GGAUCGAAAGAUUUCCGCGGCCCCGAAAGGGGAUUAGCGUUAGGU (SEQ ID NO: 5)
GGAUCGAAAGAUUUCCGCAUCCCCGAAAGGGUACAUGGCGUUAGGU (SEQ ID NO: 19)
GGAUCGAAAGAUUUCCGCACCCCCGAAAGGGGUAAGUGGCGUUAGGU.
5. A process for preparing an [mRNA]-[linker]-[peptide] conjugate
in which an mRNA and a peptide as a translation product thereof are
coupled via the linker of claim 1, comprising the steps of:
preparing the linker of claim 1, synthesizing an mRNA having a
sequence capable of hybridizing with the base sequence of the
single-stranded structure region of the linker downstream of a
sequence encoding a peptide; and contacting the linker with the
mRNA and translating the mRNA into the peptide in a reconstituted
in vitro protein synthesis reaction solution.
6. A process for preparing an [mRNA]-[linker]-[peptide] conjugate
in which an mRNA and a peptide as a translation product thereof are
coupled via the linker of claim 1, comprising the steps of:
preparing the linker of claim 1, synthesizing a template DNA for an
mRNA having a sequence capable of hybridizing with the base
sequence of the single-stranded structure region of the linker
downstream of a sequence encoding a peptide, and introducing the
linker and the DNA into a reconstituted in vitro protein synthesis
reaction solution, thereby performing transcription from the DNA
into the mRNA and translation into the peptide as well as complex
formation between the linker and the mRNA.
7. The process of claim 5 or 6 wherein the reconstituted in vitro
protein synthesis reaction solution contains a tRNA charged with a
non-proteinogenic amino acid or hydroxy acid, whereby the
translated peptide constitutes a unusual peptide.
8. A library comprising [mRNA]-[linker]-[unusual peptide]
conjugates prepared by the process of claim 7.
9. A method for selecting a peptide aptamer that binds to a target
substance from a library of [mRNA]-[linker]-[peptide] conjugates in
which each mRNA and a peptide as a translation product thereof are
coupled via the linker of claim 1, said method comprising the steps
of: preparing the linker of claim 1; preparing an mRNA library
comprising mRNAs each having a sequence capable of hybridizing with
the base sequence of the single-stranded structure region of the
linker downstream of a sequence encoding a random peptide sequence;
contacting the linker with the mRNA library and performing
translation into the peptide in a reconstituted in vitro protein
synthesis reaction solution, thereby preparing an
[mRNA]-[linker]-[peptide] conjugate library; contacting the target
substance with the [mRNA]-[linker]-[peptide] conjugate library; and
selecting a conjugate presenting the peptide bound to the target
substance.
10. The method of claim 9 wherein the target substance has been
biotinylated.
11. The method of claim 9 or 10 wherein the reconstituted in vitro
protein synthesis reaction solution contains a tRNA charged with a
non-proteinogenic amino acid or hydroxy acid, whereby the
translated peptide constitutes a unusual peptide.
12. A process for preparing the linker of claim 2, comprising the
steps of: synthesizing a chimeric oligonucleotide consisting of the
single-stranded structure region and an oligo RNA of a sequence of
ACCA connected via a polyethylene glycol moiety; and attaching an
amino acid to adenosine at the 3' end of the chimeric
oligonucleotide via an ester bond by a reaction using an artificial
RNA catalyst, thereby preparing a linker consisting of the
single-stranded structure region and the peptidyl acceptor region
connected via the polyethylene glycol moiety.
13. The method of claim 12 wherein the artificial RNA catalyst has
a chemical structure consisting of any one of the RNA sequences
below: TABLE-US-00008 (SEQ ID NO: 3)
GGAUCGAAAGAUUUCCGCAGGCCCGAAAGGGUAUUGGCGUUAGGU (SEQ ID NO: 4)
GGAUCGAAAGAUUUCCGCGGCCCCGAAAGGGGAUUAGCGUUAGGU (SEQ ID NO: 5)
GGAUCGAAAGAUUUCCGCAUCCCCGAAAGGGUACAUGGCGUUAGGU (SEQ ID NO: 19)
GGAUCGAAAGAUUUCCGCACCCCCGAAAGGGGUAAGUGGCGUUAGGU.
Description
TECHNICAL FIELD
[0001] The present invention relates to a novel method used for
preparing a conjugate of a cDNA or mRNA and a peptide or protein
translated therefrom in genotype-phenotype mapping (display
systems). This method was designated as RAPID display method by us.
This method is suitable for screening peptide aptamers as potential
drug candidates from unusual peptide libraries constructed using
the previously reported flexizyme system (or RAPID system: Random
Peptide Integrated Discovery system).
BACKGROUND ART
[0002] Technologies for mapping genotype and phenotype, also known
as display methods, were born as tools for evolutionary molecular
engineering, and include various known methods such as mRNA display
("in vitro virus", Nemoto N. et al. FEBS Lett. 414, 405-408 (1997),
International Publication WO98/16636; or "RNA-peptide fusions",
Roberts, R. W. & Szostak, J. W., Proc. Natl. Acad. Sci. USA.,
94, 12297-12302 (1997), International Publication WO98/31700),
STABLE (non-covalent DNA display), microbead/droplet display,
covalent DNA display, phage display, ribosome display, etc. Display
methods are useful for selecting genetic information of a
polypeptide having a specific function because a gene corresponding
to a functional peptide or protein molecule selected from a library
is conjugated to such a molecule so that the sequence thereof can
be readily read.
[0003] mRNA display is a technique for linking genotype and
phenotype by covalently coupling an mRNA as genotype and a peptide
molecule as phenotype using a cell-free translation system (in
vitro protein synthesis system), and currently applied by coupling
a synthesized peptide molecule and an mRNA encoding it via
puromycin, which is an analogue of the 3' end of a
tyrosyl-tRNA.
[0004] In mRNA display, an mRNA containing puromycin preliminarily
attached to its 3' end via a suitable linker is introduced into a
cell-free translation system to synthesize a peptide from the mRNA
so that the puromycin is fused to the C-terminus of a growing
peptide chain as a substrate for peptidyl transfer reaction on a
ribosome and the translated peptide molecule is fused to the mRNA
via the puromycin (FIG. 1A). The linker is inserted between the
mRNA and the puromycin mainly for the purpose of efficiently
incorporating the puromycin into the A site of the ribosome.
Puromycin is characterized in that the adenosine-like moiety and
the amino acid (tyrosine)-like moiety form an amide bond rather
than an ester bond, unlike the 3' end of an aminoacyl-tRNA (FIG.
1B). Thus, the conjugate of the puromycin and the peptide fused to
each other on the ribosome is resistant to hydrolysis and
stable.
[0005] In mRNA display, it is necessary to attach puromycin to the
3' end of the mRNA in advance outside the cell-free translation
system in order to couple the mRNA and the translation product via
the puromycin. This attachment takes place by either first
preparing a puromycin-conjugated linker having a spacer consisting
of a linear polymer synthesized at the 5' end from puromycin and
then fusing the linker to the 3' end of the mRNA or conjugating a
spacer to the 3' end of the mRNA and then fusing the puromycin to
the conjugate. In either method, the linear polymer spacer
typically contains a phosphate group or nucleotide at an end, and
the linkage between the 3' end of the mRNA and the 5' end of the
linker is a covalent bond via the phosphate group. This covalent
bond is formed by a reaction using an RNA ligase or DNA ligase or a
standard organic chemistry reaction.
CITATION LIST
Patent Documents
[0006] Patent document 1: Japanese Patent No. 3683282
(International Publication WO98/16636) [0007] Patent document 2:
Japanese Patent No. 3683902 [0008] Patent document 3: Japanese
Patent No. 3692542 (International Publication WO98/31700)
Non-Patent Documents
[0008] [0009] Non-patent document 1: Nemoto N. et al. FEBS Lett.
414, 405-408 (1997) [0010] Non-patent document 2: Roberts, R. W.
& Szostak, J. W., Proc. Natl. Acad. Sci. USA., 94, 12297-12302
(1997)
SUMMARY OF INVENTION
Technical Problems
[0011] In known mRNA display methods, an mRNA template having
puromycin at the 3' end is added to a cell-free translation system
using wheat germ extract or rabbit reticulocyte lysate to translate
it into a peptide. Thus, it is necessary to carry out transcription
from DNA into mRNA and fusion reaction between mRNA and puromycin
in advance outside the translation system.
[0012] Recently, reconstituted cell-free translation systems were
developed by individually purifying and mixing elements necessary
for translation in systems using E. coli ribosomes (H. F. Kung, B.
Redfield, B. V. Treadwell, B. Eskin, C. Spears and H. Weissbach
(1977) "DNA-directed in vitro synthesis of beta-galactosidase.
Studies with purified factors" The Journal of Biological Chemistry
Vol. 252, No. 19, 6889-6894; M. C. Gonza, C. Cunningham and R. M.
Green (1985) "Isolation and point of action of a factor from
Escherichia coli required to reconstruct translation" Proceeding of
National Academy of Sciences of the United States of America Vol.
82, 1648-1652; M. Y. Pavlov and M. Ehrenberg (1996) "Rate of
translation of natural mRNAs in an optimized in vitro system"
Archives of Biochemistry and Biophysics Vol. 328, No. 1, 9-16; Y.
Shimizu, A. Inoue, Y. Tomari, T. Suzuki, T. Yokogawa, K. Nishikawa
and T. Ueda (2001) "Cell-free translation reconstituted with
purified components" Nature Biotechnology Vol. 19, No. 8, 751-755;
H. Ohashi, Y. Shimizu, B. W. Ying, and T. Ueda (2007) "Efficient
protein selection based on ribosome display system with purified
components" Biochemical and Biophysical Research Communications
Vol. 352, No. 1, 270-276). The reconstituted cell-free translation
systems are freed of elements irrelevant to translation by
fractionating a cell-free translation system based on an E. coli
extract and reassembling fractions so that inclusion of inhibitors
such as nucleases and proteases can be prevented more easily than
in conventional cell-free translation systems using cell extracts.
Transcription from DNA and translation can also be simultaneously
performed by adding elements necessary for transcription
reaction.
[0013] If such a cell-free coupled transcription-translation system
is used, mRNA synthesis by transcription from template DNA can take
place in the same system as translation reaction. Moreover, if
complex formation between an mRNA and a linker molecule could also
take place in the same system, transcription of cDNA to preparation
of an mRNA-peptide fusion could be accomplished in one pot (in the
same reaction vessel), unlike conventional mRNA display methods.
The first object of the present invention is to provide a display
method taking advantage of such a reconstituted cell-free
translation system capable of controlling components of the
reaction system.
[0014] Further, the second object of the present invention is to
make it possible to construct an mRNA or cDNA library presenting
unusual peptides by combining such a display method with a
previously reported technique for synthesizing a unusual peptide
using a ribozyme capable of catalyzing the synthesis of an acylated
tRNA (flexizyme).
Solution to Problems
[0015] The RAPID display method of the present invention made it
possible to completely accomplish transcription, translation and
linker-mRNA complex formation followed by linkage between the
peptide and the linker in a single translation system by modifying
mRNA display to replace the puromycin-conjugated linker by a linker
molecule now developed by us and further optimizing the
reconstituted cell-free translation system.
[0016] As compared with conventional mRNA display methods, the
RAPID display method mainly has the following features.
(a) The 3' end of the linker molecule has a structure in which an
amino acid is attached to adenosine via an ester (i.e.,
aminoacylated) rather than puromycin. (b) Aminoacylation reaction
is mediated by an artificial RNA catalyst (ribozyme). (c) A
reconstituted cell-free translation system is used. (d) The fusion
between the linker and an mRNA is made by complex formation based
on hybridization in a translation system rather than ligation. (e)
Transcription, translation and complex formation with the linker
can be performed in a single translation reaction vessel.
[0017] Moreover, unusual peptides can also be presented as
phenotypes by applying techniques for synthesizing unusual peptides
by translation in the same translation system. Acylation reaction
for charging a tRNA with a non-proteinogenic amino acid or hydroxy
acid, which is a constituent unit of a unusual peptide, is also
mediated by an artificial RNA catalyst (ribozyme).
[0018] The present invention is summarized as follows.
(1) A linker used for preparing a conjugate in which an mRNA and a
peptide as a translation product thereof are coupled via the linker
in a reconstituted in vitro protein synthesis system, said linker
comprising: a single-stranded structure region having side chain
bases pairing with the bases at the 3'-end of the mRNA at one end
of the linker, and a peptidyl acceptor region having a group
capable of binding to the translation product by peptidyl transfer
reaction at the other end of the linker, wherein the peptidyl
acceptor region has a structure containing an amino acid attached
to an oligo RNA consisting of a nucleotide sequence of ACCA via an
ester bond; and said ester bond is formed by an aminoacylation
reaction using an artificial RNA catalyst. (2) The linker as
defined in (1) above wherein the single-stranded structure region
and the peptidyl acceptor region are connected via a polyethylene
glycol moiety. (3) The linker as defined in (1) or (2) above
wherein the single-stranded structure region consists of a
single-stranded DNA. (4) The linker as defined in any one of
(1)-(3) above wherein the artificial RNA catalyst used in the
aminoacylation reaction has a chemical structure consisting of any
one of the RNA sequences below:
TABLE-US-00001 (SEQ ID NO: 3)
GGAUCGAAAGAUUUCCGCAGGCCCGAAAGGGUAUUGGCGUUAGGU (SEQ ID NO: 4)
GGAUCGAAAGAUUUCCGCGGCCCCGAAAGGGGAUUAGCGUUAGGU (SEQ ID NO: 5)
GGAUCGAAAGAUUUCCGCAUCCCCGAAAGGGUACAUGGCGUUAGGU (SEQ ID NO: 19)
GGAUCGAAAGAUUUCCGCACCCCCGAAAGGGGUAAGUGGCGUUAGGU.
(5) A process for preparing an [mRNA]-[linker]-[peptide] conjugate
in which an mRNA and a peptide as a translation product thereof are
coupled via the linker as defined in any one of (1)-(4) above, said
process comprising the steps of: preparing the linker as defined in
any one of (1)-(4) above; synthesizing an mRNA having a sequence
capable of hybridizing with the base sequence of the
single-stranded structure region of the linker downstream of a
sequence encoding a peptide; and contacting the linker with the
mRNA and translating the mRNA into the peptide in a reconstituted
in vitro protein synthesis reaction solution. (6) A process for
preparing an [mRNA]-[linker]-[peptide] conjugate in which an mRNA
and a peptide as a translation product thereof are coupled via the
linker as defined in any one of (1)-(4) above, said process
comprising the steps of: preparing the linker as defined in any one
of (1)-(4) above, synthesizing a template DNA for an mRNA having a
sequence capable of hybridizing with the base sequence of the
single-stranded structure region of the linker downstream of a
sequence encoding a peptide, and introducing the linker and the DNA
into a reconstituted in vitro protein synthesis reaction solution,
thereby performing transcription from the DNA into the mRNA and
translation into the peptide as well as complex formation between
the linker and the mRNA. (7) The process as defined in (5) or (6)
above wherein the reconstituted in vitro protein synthesis reaction
solution contains a tRNA charged with a non-proteinogenic amino
acid or hydroxy acid, whereby the translated peptide constitutes a
unusual peptide. (8) A library comprising [mRNA]-[linker]-[unusual
peptide] conjugates prepared by the process as defined in (7)
above. (9) A method for selecting a peptide aptamer that binds to a
target substance from a library of [mRNA]-[linker]-[peptide]
conjugates in which each mRNA and a peptide as a translation
product thereof are coupled via the linker as defined in any one of
(1)-(4) above, said method comprising the steps of: preparing the
linker as defined in any one of (1)-(4) above; preparing an mRNA
library comprising mRNAs each having a sequence capable of
hybridizing with the base sequence of the single-stranded structure
region of the linker downstream of a sequence encoding a random
peptide sequence; contacting the linker with the mRNA library and
performing translation into the peptide in a reconstituted in vitro
protein synthesis reaction solution, thereby preparing an
[mRNA]-[linker]-[peptide] conjugate library; contacting the target
substance with the [mRNA]-[linker]-[peptide] conjugate library; and
selecting a conjugate presenting the peptide bound to the target
substance. (10) The method as defined in (9) above wherein the
target substance has been biotinylated. (11) The method as defined
in (9) or (10) above wherein the reconstituted in vitro protein
synthesis reaction solution contains a tRNA charged with a
non-proteinogenic amino acid or hydroxy acid, whereby the
translated peptide constitutes a unusual peptide. (12) A process
for preparing the linker as defined in (2) above, said process
comprising the steps of: synthesizing a chimeric oligonucleotide
consisting of the single-stranded structure region and an oligo RNA
of a sequence of ACCA connected via a polyethylene glycol moiety;
and attaching an amino acid to adenosine at the 3' end of the
chimeric oligonucleotide via an ester bond by a reaction using an
artificial RNA catalyst, thereby preparing a linker consisting of
the single-stranded structure region and the peptidyl acceptor
region connected via the polyethylene glycol moiety. (13) The
process as defined in (12) above wherein the artificial RNA
catalyst has a chemical structure consisting of any one of the RNA
sequences below:
TABLE-US-00002 (SEQ ID NO: 3)
GGAUCGAAAGAUUUCCGCAGGCCCGAAAGGGUAUUGGCGUUAGGU (SEQ ID NO: 4)
GGAUCGAAAGAUUUCCGCGGCCCCGAAAGGGGAUUAGCGUUAGGU (SEQ ID NO: 5)
GGAUCGAAAGAUUUCCGCAUCCCCGAAAGGGUACAUGGCGUUAGGU (SEQ ID NO: 19)
GGAUCGAAAGAUUUCCGCACCCCCGAAAGGGGUAAGUGGCGUUAGGU.
Advantageous Effects of Invention
[0019] By using a linker molecule capable of binding to an mRNA in
a reconstituted cell-free translation reaction solution, an
[mRNA]-[linker]-[peptide] conjugate can be prepared only by adding
the linker and a cDNA or mRNA to perform translation reaction in a
single reaction vessel.
[0020] Moreover, an [mRNA]-[linker]-[unusual peptide] conjugate
presenting a unusual peptide synthesized by translation from
sequence information of a template nucleic acid molecule can be
obtained by introducing a tRNA charged with a non-proteinogenic
amino acid or hydroxy acid into the same reconstituted cell-free
translation reaction solution.
[0021] Thus, a gene library of artificial peptide aptamers expected
to improve in vivo stability and binding affinity for a target
protein can be simply constructed by combining the RAPID display
method with a technique for synthesizing a unusual peptide by
translation.
BRIEF DESCRIPTION OF DRAWINGS
[0022] FIG. 1A schematically shows the process in which a
translated peptide molecule is coupled to an mRNA via a
puromycin-conjugated linker in mRNA display.
[0023] FIG. 1B shows the structure of the peptidyl acceptor region
of the linker (puromycin-conjugated linker).
[0024] FIG. 2A schematically shows the process in which a
translated peptide molecule is coupled to an mRNA via an RAPID
linker (e.g., an L-Phe-conjugated linker shown as an example) in
the RAPID display method of the present invention.
[0025] FIG. 2B shows the structure of the peptidyl acceptor region
of the linker (L-Phe-conjugated linker).
[0026] FIG. 3 shows that a linker molecule (an 21-ACCA) has been
aminoacylated by a flexizyme-catalyzed reaction (Example 1).
[0027] FIG. 4 shows the yields of complexes of a peptide aptamer
(TNF-.alpha.-DW) and an mRNA when the mRNA was added to the
reaction solution (Example 1).
[0028] FIG. 5 shows the yields of complexes of a peptide aptamer
(TNF-.alpha.-DW) and an mRNA when a cDNA was added to the reaction
solution (Example 1).
[0029] FIG. 6 shows the result confirming that the peptide-mRNA
complex presenting TNF-.alpha.-DW was recovered more efficiently
than a control (EMP1SS) complex unbounded to the target (Example
2).
[0030] FIG. 7 shows changes in binding affinity with the number of
rounds when a peptide aptamer was selected by repeating selection
multiple times using a TNF-.alpha.-DW-spiked library and an 21-Phe
linker (Example 3).
DETAILED DESCRIPTION OF THE INVENTION
[0031] 1. Linker
[0032] The linker in the RAPID display method of the present
invention connects an mRNA and a peptide translated therefrom by
binding to the 3' end of the mRNA at one end and to the C-terminus
of the peptide at the other end in the same manner as in known mRNA
display methods.
[0033] However, the linker in the RAPID display method of the
present invention differs in the structure of both ends from those
used in known mRNA display methods. The linker used in the RAPID
display method of the present invention is herein sometimes
referred to as "RAPID linker".
[0034] First, the region at one end of the linker binding to the
C-terminus of a peptide is explained. This region is herein
sometimes referred to as "peptidyl acceptor" or simply "acceptor".
Thus, the term "peptidyl acceptor" refers to a molecule having a
structure capable of binding to a peptide growing by peptidyl
transfer reaction on a ribosome (peptidyl-tRNA). The peptidyl
acceptor may refer to a region located at an end of a linker or may
refer to a whole structure including a linker. For example, the
peptidyl acceptor in known mRNA display methods is puromycin
located at one end of a linker or a puromycin-conjugated linker as
a whole structure including a linker.
[0035] The RAPID linker of the present invention is characterized
by the structure and the preparation process of the peptidyl
acceptor.
[0036] In the RAPID display method, a linker having a sequence
consisting of a 4-residue ribonucleotide ACCA is synthesized at the
3' end, and then a given amino acid is attached to adenosine at the
3' end, thereby conferring a structure as peptidyl acceptor on the
linker. During peptide elongation reaction on a ribosome, the amino
acid attached to the end of the linker accepts the C-terminus of
the peptide of the peptidyl-tRNA and binds to the peptide. The
structure in which an amino acid is attached to the RNA sequence
ACCA via an ester bond is herein referred to as "peptidyl acceptor
region".
[0037] The peptidyl acceptor in known mRNA display methods is
puromycin that has an aminonucleoside structure in which a ribose
in the adenosine-like moiety and an amino acid are linked via an
amide bond. In the RAPID display method of the present invention,
however, an amino acid is attached to the 3'-O of ribose via an
ester bond. In other words, the peptidyl acceptor in the RAPID
display of the present invention has a nucleoside structure similar
to that of natural aminoacyl-tRNA. See FIG. 2B showing the
structure of a linker to which L-phenylalanine is attached as an
example of such a peptidyl acceptor (L-Phe-conjugated linker) in
comparison with FIG. 1B (puromycin-conjugated linker). In the
present invention, the peptidyl acceptor shows an incorporation
efficiency comparable to or higher than that of puromycin by
adopting a structure closer to that of the natural acceptor.
[0038] The formation of a bond between the peptidyl acceptor and
the C-terminus of the peptide seems to occur by the proximity of
the amino group of the peptidyl acceptor incorporated into the A
site to the ester bond at the C-terminus of the attached peptide of
the peptidyl-tRNA in the P site in the same manner as normal
peptidyl transfer reaction in ribosomes. Thus, the covalent bond
formed with the C-terminus of the peptide chain is typically an
amide bond in the same manner as in mRNA display. It should be
noted that a linker having an unnatural (non-proteinogenic) amino
acid such as a D-amino acid or .beta. (beta)-amino acid can also be
used in the RAPID display of the present invention by using an
artificial RNA catalyst (flexizyme) for the synthesis of the
linker.
[0039] Next, binding to an mRNA at the other end of the linker is
explained.
[0040] In the RAPID display method of the present invention, the 5'
end of the linker and the 3' end of a mRNA molecule forms a complex
by hybridization based on base pairing. Thus, the 5' end of the
linker assumes a single-stranded structure having a nucleic acid
base in the side chain. This region in the RAPID linker is herein
referred to as "single-stranded structure region". Specific
examples of single-stranded structures having a nucleic acid base
in the side chain include single-stranded DNAs, single-stranded
RNAs, single-stranded PNAs (peptide nucleic acids), etc. The
resulting complexes must be also stably kept during peptide
selection. As the complementarity between the nucleotide sequence
of the single-stranded structure region of the linker and the
sequence of the 3' end of the mRNA molecule increases, the
efficiency of double-strand formation increases and stability also
increases. Stability also depends on the GC content, the salt
concentration of the reaction solution, and reaction temperature.
Especially, this region desirably has a high GC content,
specifically a GC content of 80% or more, preferably 85% or more.
Specific examples of such structures at the 5' end of the linker
include, but in any way are not limited to, single-stranded DNAs
consisting of 13-21 nucleotides used in the Examples herein below
having the nucleotide sequences:
TABLE-US-00003 5'-CTCCCGCCCCCCGTCC-3' (SEQ ID NO: 1)
5'-CCCGCCTCCCGCCCCCCGTCC-3'. (SEQ ID NO: 2)
[0041] The rest of the linker excluding both ends is designed to
have a flexible, hydrophilic and simple linear structure with less
side chains as a whole similarly to the structure of linkers used
in known mRNA display methods. Therefore, linear polymers
including, for example, oligonucleotides such as single- or
double-stranded DNA or RNA; polyalkylenes such as polyethylene;
polyalkylene glycols such as polyethylene glycol; polystyrenes;
polysaccharides; or combinations thereof can be appropriately
selected and used. The linker preferably has a length of 100
angstroms or more, more preferably about 100-1000 angstroms.
[0042] A specific non-limiting example of linkers that can be used
in the present invention includes a chimeric DNA/RNA
oligonucleotide comprising a single-stranded structure region
consisting of a single-stranded DNA having a high-GC content
sequence and an RNA consisting of an ACCA sequence at the 3' end
wherein the DNA and RNA are connected via a polyethylene glycol
moiety (PEG linker). For example, a typical example includes
[DNA]-[Spacer18].sub.n-rArCrCrA (wherein Spacer18 is hexaethylene
glycol, and n is an integer of 4-8) synthesized in Example 1.
[0043] 2. Amino Acid Modification of the Linker
[0044] As indicated above, it is necessary to attach an amino acid
to the oligo RNA moiety (ACCA sequence) at an end of the linker
molecule in order to confer a structure as a peptidyl acceptor on
the linker. The present invention is characterized in that this
attachment of an amino acid takes place using an artificial RNA
catalyst.
[0045] It is theoretically possible to attach an amino acid to the
3'-O of an oligo RNA synthesized by conventional chemical synthesis
such as solid-phase synthesis via an ester, but it is practically
impossible to introduce the synthetic product into a cell-free
translation system after post-treatment of synthesis reaction
because it is highly reactive and lacks stability. In the present
invention, this problem is solved by aminoacylation reaction of the
oligo RNA using a "flexizyme", which is an artificial RNA catalyst
developed as an aminoacyl-tRNA synthetase. In this method,
aminoacylation reaction can be performed under mild conditions and
the product can be introduced into a translation system and used in
it only after simple post-treatment. For details, see the following
documents: [0046] H. Murakami, H. Saito, and H. Suga, (2003),
Chemistry & Biology, Vol. 10, 655-662; [0047] H. Murakami, D.
Kourouklis, and H. Suga, (2003), Chemistry & Biology, Vol. 10,
1077-1084; [0048] H. Murakami, A. Ohta, H. Ashigai, H. Suga (2006)
Nature Methods 3, 357-359; [0049] N. Niwa, Y. Yamagishi, H.
Murakami, H. Suga (2009) Bioorganic & Medicinal Chemistry
Letters 19, 3892-3894; and [0050] JPA-2008-125396 or
WO2007/066627.
[0051] Flexizymes are also known by designations such as
dinitrobenzyl flexizyme (dFx), enhanced flexizyme (eFx), amino
flexizyme (aFx), etc. Flexizymes have the ability to catalyze
aminoacylation of adenosine at the 3' end using a weakly activated
amino acid as a substrate by recognizing the carbonyl group with
which the amino acid reacts, an aromatic ring in the side chain or
leaving group of the amino acid, and an ACC-3' sequence at the 3'
end of the linker. This is why an oligo RNA structure consisting of
an ACCA-3' sequence is essential at the end of the RAPID linker.
Flexizyme-mediated aminoacylation reaction proceeds only by placing
an amino acid substrate and a linker molecule having a cognate
oligo RNA moiety on ice in the presence of a flexizyme for about 2
hours.
[0052] In the present invention, flexizymes having the sequences
shown below are suitably used.
TABLE-US-00004 Original flexizyme Fx (SEQ ID NO: 3)
[GGAUCGAAAGAUUUCCGCAGGCCCGAAAGGGUAUUGGCGUUAGGU-3', 45 nt] Enhanced
flexizyme eFx (SEQ ID NO: 4)
[5'-GGAUCGAAAGAUUUCCGCGGCCCCGAAAGGGGAUUAGCGUUAGGU- 3', 45 nt])
Dinitrobenzyl flexizyme dFx (SEQ ID NO: 5)
[5'-GGAUCGAAAGAUUUCCGCAUCCCCGAAAGGGUACAUGGCGUUAGG U-3', 46 nt]
Amino flexizyme aFx (SEQ ID NO: 19)
[5'-GGAUCGAAAGAUUUCCGCACCCCCGAAAGGGGUAAGUGGCGUUAGG U-3', 47
nt])
[0053] Flexizyme Fx is capable of catalyzing aminoacylation using
amino acid substrates having a cyanomethyl leaving group and a side
chain aromatic ring (e.g., cyanomethyl esters of phenylalanine,
tyrosine, etc.), while flexizymes eFx, dFx, aFx are capable of
catalyzing aminoacylation using amino acid substrates having a
4-chlorobenzylthiol leaving group and a non-aromatic ring side
chain in addition to the leaving groups and side chains that can be
used with flexizyme Fx. For details, see the documents cited above.
By reacting an amino acid having such a structure and a linker in
the presence of a flexizyme, therefore, a molecule in which the
amino acid is attached via an ester bond to the 3'-hydroxyl group
on the ribose ring in adenosine at the 3' end of the linker can be
obtained. Amino acid substrates having any structure can be
attached, including not only amino acids used in natural
translation but also non-proteinogenic amino acids such as D-amino
acids or .beta. (beta)-amino acids (i.e., other than L-amino acids
normally found in naturally occurring proteins). Further, a
hydroxycarboxylic acid instead of an amino acid can be attached to
the 3' end of the linker or incorporated as a peptidyl acceptor
into a ribosome.
[0054] 3. Reaction in a Translation System
[0055] According to the RAPID display method, a linker is added to
a cell-free translation system (also referred to as "in vitro
protein synthesis system") along with a cDNA or mRNA and reacted
for a predetermined period, thereby allowing for translation from
the mRNA and complex formation with the linker molecule followed by
linkage between the peptide and the linker.
[0056] The cell-free translation system used can be a conventional
reconstituted cell-free translation systems with appropriate
modifications, and transcription from DNA can also be performed in
the same system as used for translation if it contains a
DNA-dependent RNA polymerase (preferably T7RNA polymerase).
[0057] The following reactions (a) to (d) can be performed in a
single reaction vessel (one-pot), if it is a coupled
transcription-translation synthesis system:
(a) a reaction in which a DNA is transcribed into an mRNA; (b) a
reaction in which the 3' end of the mRNA forms a complex with the
single-stranded structure region at an end of a linker via
hybridization; (c) a reaction in which the mRNA is translated into
a peptide; (d) a reaction in which the C-terminus of the translated
peptide binds to the peptidyl acceptor region at the other end of
the linker via an amide bond; (e) a reaction in which a
[peptide]-[linker]-[mRNA] complex is released from the
ribosome.
[0058] Alternatively, a series of reactions starting from (b) are
performed in a reconstituted cell-free translation system, when a
preliminarily prepared mRNA is added to the translation system
along with a linker.
[0059] A reconstituted cell-free translation system should comprise
purified ribosomes, translation initiation factors, translation
elongation factors, an mRNA, an aminoacyl-tRNA, ATP or GTP used as
a substrate, etc. (M. H. Schreier, B. Erni and T. Staehelin (1977)
"Initiation of mammalian protein synthesis. I. Purification and
characterization of seven initiation factors." Journal of Molecular
Biology, Vol. 116, No. 4, 727-53. H. Trachsel, B. Emi, M. H.
Schreier and T. Staehelin (1977) "Initiation of mammalian protein
synthesis. II. The assembly of the initiation complex with purified
initiation factors." Journal of Molecular Biology, Vol. 116, No. 4,
755-67.). Among them, the aminoacyl-tRNA can be replaced by adding
a tRNA, an aminoacyl-tRNA synthetase and its substrate into the
same reaction solution. Additionally, proteins or enzymes and their
substrates such as translation termination factors, ribosome
recycling factors, creatine kinase, myokinase, nucleotide
diphosphate kinase, pyrophosphatase can be added to increase the
efficiency or fidelity of translation reaction as common in
conventional cell-free translation systems (P. C. Jelenc and C. G.
Kurland (1979) "Nucleoside triphosphate regeneration decreases the
frequency of translation errors" Proceedings of the Natural Academy
Science of the United States of America Vol. 76, No. 7, 3174-3178).
When transcription reaction is to be performed simultaneously with
translation, a cDNA as well as T7 RNA polymerase and its substrate
can be added in place of mRNA.
[0060] In the present invention, a DNA or RNA having a necessary
sequence is introduced into a cell-free translation system
comprising components optimized for an intended purpose. The
sequence of the DNA or RNA should be such that a cDNA is
transcribed into an mRNA and that translation of the mRNA starts in
the synthesis system used. The full length of the region encoding
the amino acid sequence of a peptide should be translated to the
end, and a spacer sequence consisting of a peptide for conferring
flexibility is also fused to the C-terminus of the translated amino
acid, immediately followed by a stop codon. For example, a peptide
sequence (Cys- (Gly-Ser-)x3) and an amber codon (stop codon)
immediately downstream of it are encoded. Additionally, the 3' end
of the mRNA has a structure capable of hybridizing with the
single-stranded structure region of a linker to form a double
strand, so that the downstream of the coding region (immediately
downstream of the stop codon) should have a sequence complementary
to the sequence of the single-stranded structure region. The
sequence of this region (double strand-forming region) is herein
referred to as linker hybridization sequence.
[0061] Specifically, the cDNA or mRNA desirably contains the
following sequences:
[0062] (1) A promoter sequence compatible with the RNA polymerase
used in the cDNA. TAATACGACTCACTATA (SEQ ID NO: 6) in the case of
T7 promoter.
[0063] (2) A sequence encoding a relevant sequence upstream of a
start codon.
When E. coli-derived ribosomes are used in a cell-free translation
system, the gene for the SD sequence is included. This is also
found in conventional protein synthesis. For example, GGGTTAACTTTAA
GAAGGAGATATACAT (SEQ ID NO: 7): a modified sequence upstream of
gene 10 protein of T7 phage. The SD sequence is underlined.
[0064] (3) A sequence constituting an ORF [a sequence encoding an
amino acid sequence having a spacer fused to the C-terminus of a
peptide aptamer] of a variant gene library, beginning with a start
codon (ATG).
[0065] Depending on the stop codon used here, its cognate release
factor should be removed from the cell-free translation system. A
cell-free translation reaction solution is prepared by removing RF1
when TAG (amber codon) is used, or removing RF2 when TGA (opal
codon) is used, or removing both RF1 and RF2 when TAA (ochre codon)
is used.
[0066] (4) A sequence encoding a double strand-forming region
(linker hybridization sequence).
[0067] The reconstituted cell-free translation reaction solution
used in the present invention preferably contains components
adapted for intended purposes. For example, the release factor
cognate to the amber codon, a peptidyl-tRNA hydrolase (PTH), which
is an enzyme cleaving peptidyl-tRNA, and the like are removed in
the Examples herein below.
[0068] Further, an acylated tRNA preliminarily charged with a
desired non-proteinogenic amino acid (or hydroxy acid) (i.e.,
having an activated amino acid attached thereto) can be added to a
reconstituted cell-free translation system containing only limited
natural amino acids. By correlating the codons for excluded natural
amino acids with the anticodon of the tRNA acylated with a
non-proteinogenic amino acid (or hydroxy acid), a peptide
containing the non-proteinogenic amino acid (or hydroxy acid) can
be synthesized by translation on a ribosome on the basis of genetic
information of the mRNA. Alternatively, a unusual peptide
containing no natural amino acid can also be synthesized by
translation by adding an acylated tRNA charged with a
non-proteinogenic amino acid (or hydroxy acid) to a reconstituted
cell-free translation system containing no natural amino acid.
[0069] Acylated tRNAs charged with a non-proteinogenic amino acid
(or hydroxy acid) can be prepared by using the artificial RNA
catalysts "flexizymes" capable of catalyzing aminoacyl-tRNA
synthesis as described above. As indicated above, these artificial
RNA catalysts are capable of charging an amino acid having any side
chain and also have the function of recognizing only a consensus
sequence 5'-RCC-3' (R=A or G) at the 3' end of tRNAs to acylate the
3' end of the tRNAs, and therefore, they can act on any tRNAs
having different anticodons. Moreover, the recognition site in an
amino acid contains no substituent at the .alpha. position, so that
not only L-amino acids but also hydroxy acids (having a hydroxyl
group at the .alpha.-position), N-methylamino acids (having an
N-methylamino acid at the .alpha.-position), N-acylamino acids
(having an N-acylamino group at the .alpha.-position), D-amino
acids and the like can be used as substrates. Detailed description
can be found in the documents about flexizymes cited above as well
as in Y. Goto, H. Suga (2009) "Translation initiation with
initiator tRNA charged with exotic peptides" Journal of the
American Chemical Society, Vol. 131, No. 14, 5040-5041,
WO2008/059823 entitled by "TRANSLATION AND SYNTHESIS OF POLYPEPTIDE
HAVING NONNATIVE STRUCTURE AT N-TERMINUS AND APPLICATION THEREOF",
Goto et al., ACS Chem. Biol., 2008, 3, 120-129, WO2008/117833
entitled by "PROCESS FOR SYNTHESIZING CYCLIC PEPTIDE COMPOUND",
etc.
[0070] A comprehensive technology for translation/synthesis,
modification and screening of peptides based on a core technology
consisting of a synthesis system of unusual peptides (a concept
including both kit and synthesis method) using a tRNA acylated with
a non-proteinogenic amino acid or hydroxy acid via a "flexizyme"
was designated by us as RAPID system (Random Peptide Integrated
Discovery system). The RAPID system allows for the
translation/synthesis of various unusual peptides as in vitro
translation products based on template mRNAs of relevant sequences.
It should be understood from the foregoing description that unusual
peptides as used herein refer to polymers containing the various
substrates described above as their components and include any
translation products that can be synthesized by the RAPID system
other than twenty natural amino acids, including amino acids having
various side chains, .beta. (beta)-amino acids, .gamma.
(gamma)-amino acids and .delta. (delta)-amino acids, D-amino acids,
and derivatives having a structure in which an amino group or a
carboxyl group on the amino acid backbone is substituted. Further,
unusual peptides may have a backbone structure other than normal
amide bonds. For example, unusual peptides also include
depsipeptides consisting of amino and hydroxy acids, polyesters
produced by continuous condensation of hydroxy acids, peptides
methylated at the nitrogen atom of the amide bond by introducing an
N-methylamino acid, and peptides having various acyl groups
(acetyl, pyroglutamic acid, fatty acids, etc.) at the N-terminus.
Furthermore, cyclic peptides obtained by circularizing non-cyclic
peptides consisting of an amino acid sequence bearing a pair of
functional groups capable of forming a bond between them at
opposite ends can also be synthesized by the RAPID system (or
cyclic N-methylpeptides can be obtained if N-methylpeptides are
used). Circularization may occur under the conditions of cell-free
translation systems with a pair of some functional groups, as
exemplified by a cyclic peptide circularized via a thioether bond
obtained by translation/synthesis of a peptide sequence bearing a
chloroacetyl group and a cysteine group at opposite ends as shown
in the Examples herein below.
[0071] The RAPID system allows for the synthesis of peptides having
various structures only by changing template mRNAs because unusual
peptides are synthesized by ribosomal translation. If
translation/synthesis is performed using an mRNA (or corresponding
DNA) containing a random sequence, a random peptide library can be
readily constructed. The RAPID display method of the present
invention is suitably used to link unusual peptides synthesized by
the RAPID system to mRNAs representing their genotypes. The RAPID
linker of the present invention is added along with a template cDNA
or mRNA to a cell-free translation system optimized for the
synthesis of a unusual peptide and the mixture is reacted for a
predetermined period, whereby the unusual peptide as the resulting
translation product is coupled to the mRNA via the linker and
presented.
[0072] Next, the linkage between the linker and the mRNA occurring
in the cell-free translation system is explained. As described in
the section of Background Art, it was necessary to ligate the
linker and the mRNA outside the translation system at a stage prior
to translation reaction in known mRNA display methods. In contrast,
the RAPID display method of the present invention is characterized
in that complex formation between the linker and the mRNA by
hybridization can be carried out in the translation system.
[0073] With reference to FIG. 2, the process in which hybridization
between an mRNA and a RAPID linker, synthesis of a peptide molecule
and fusion of the linker to the C-terminus of the peptide take
place by introducing the mRNA along with the linker into a
cell-free translation system is explained.
[0074] As indicated above, the linkage between the mRNA and the
linker results from the formation of a double strand via a hydrogen
bond between the base sequence of the single-stranded structure
region of the linker and a complementary base sequence at the 3'
end of the mRNA. This linkage is made to map the mRNA to the
translated peptide molecule, so that an [mRNA]-[linker]-[peptide]
complex formed during translation on a ribosome must be also stably
kept during the selection of the translated peptide.
[0075] By introducing an mRNA along with an RAPID linker into a
cell-free translation system, a ribosome is located on the mRNA and
translation reaction starts, whereby a peptide chain elongates and
the terminated peptide chain binds to the amino acid of a peptidyl
acceptor region consisting of [rACCA-amino acid] of the linker at
the C-terminus and dissociates from tRNA. Without wishing to limit
the concept of the present invention but for illustrative purposes
only, we believe that the hybridization between the mRNA and the
RAPID linker may occur at a stage before the elongation reaction of
a peptide chain starts if the mRNA and the RAPID linker are
introduced into the cell-free translation system at the same time.
Alternatively, complex formation by hybridization between the mRNA
and the RAPID linker on the ribosome properly occurs even when
transcription from a cDNA and translation reaction take place first
and then the linker is added into the translation reaction solution
lacking termination factors and PTH. Then, a covalent linkage seems
to occur between [rACCA-amino acid] at an end of the linker and the
C-terminus of the peptide when this moiety accidentally enters the
ribosomal A site at the end of translation. The reaction occurs
with high efficiency because hybridization between the mRNA and the
linker has already occurred at the end of translation and this
[rACCA-amino acid] substrate is connected to the mRNA on the
ribosome via the linker and shows a locally very high
concentration.
[0076] The fact that the [mRNA]-[linker]-[peptide] complex thus
formed on the ribosome is stably kept even after the peptide chain
dissociates from the ribosome is also supported in the Examples
herein below.
[0077] 4. Selection of a Peptide Aptamer
[0078] In evolutionary molecular engineering, large amounts of
potential genes are provided and clones having a target phenotype
are selected from them in order to create a protein or peptide
having a desired function or property.
[0079] Basically, a DNA population is prepared first to give an RNA
population as an in vitro transcript, and then a peptide population
as an in vitro translation product. From this peptide population, a
peptide having a desired function or property is selected by some
screening system. If one wishes to obtain a peptide molecule
binding to a specific protein, for example, the peptide population
is injected into a target protein-immobilized column, whereby a
mixture of peptide molecules bound to the column can be recovered.
The template mRNA fused to each peptide molecule like a tag in a
population of the recovered peptide-mRNA complexes is converted
back into the DNA by reverse transcriptase to give a biased library
containing a lot of clones having a target phenotype amplified by
PCR, and then similar selection experiments are performed again.
Alternatively, it is also possible to perform reverse transcription
reaction before selection for the purpose of making nucleic acid
moieties double-stranded in order to avoid the possibility of
recovering an RNA aptamer. By repeating this procedure, clones
having a desired phenotype become concentrated in the population
over generations.
[0080] To identify a peptide aptamer, the gene for a peptide
aptamer binding to a target substance can be cloned by repeating
the steps of mixing a library of mapped molecules and the target
substance, selecting mapped molecules presenting peptides bound to
the target substance (active species), and preparing a nucleic acid
library by PCR from nucleic acid moieties of the mapped molecules
selected. The step of selecting mapped molecules bound to the
target substance can be accomplished by allowing [RNA (or DNA/RNA
hybrid)]-[linker]-[peptide] complexes to bind to the target
substance and separating them from other complexes by an
appropriate method to identify a peptide having a desired binding
property.
[0081] The target substance may be a protein, nucleic acid,
carbohydrate, lipid or any other compound. It is convenient to
derivatize the target substance with a label isolatable by binding
to a solid phase in order to separate active species complexes
binding to the target substance from other complexes. For example,
the target substance is biotinylated and isolated by specific
binding to an immobilized biotin-binding protein in the Examples
herein below. Such specific binding pairs that can be used include,
but are not limited to, biotin-binding protein (avidin,
streptavidin, etc.)/biotin pairs as well as maltose-binding
protein/maltose, polyhistidine peptide/metal ion (nickel, cobalt,
etc.), glutathione-S-transferase/glutathione, antibody/antigen
(epitope), etc.
[0082] By using evolutionary molecular engineering, it is possible
in principle to obtain a peptide having a non-naturally occurring
amino acid sequence from a gene library of DNA sequences consisting
of randomly connected four bases A, T, G, C. Further, a unusual
peptide containing a non-proteinogenic amino acid (or hydroxy acid)
can also be synthesized by translation as an in vitro translation
product by introducing a tRNA acylated with the non-proteinogenic
amino acid (or hydroxy acid) into a translation system. A library
of unusual peptides can be efficiently obtained by repeating the
steps of selecting an active species presenting a peptide having a
desired binding property from a population of complexes of a
unusual peptide and an mRNA (or cDNA), amplifying a mapped gene
moiety and translating it again.
[0083] For details of molecular biology techniques with respect to
the description herein above and below in the Examples, see, for
example, Sambrook, Molecular Cloning: A Laboratory Manual, 3rd
edition, Cold Spring Harbor Laboratory Press, 2001; Golemis,
Protein-Protein Interactions: A Molecular Cloning Manual, 2nd
edition, Cold Spring Laboratory Press, 2005, etc.
[0084] The following examples further illustrate the present
invention. However, these examples are only for illustrating the
present invention but should not be construed to limit the scope of
the present invention.
Example 1
[0085] [Synthesis Of Linkers]
Chimeric DNA/RNA oligonucleotides comprising a DNA and a RNA
connected via polyethylene glycol (5 units of Spacer18) were used
as linkers. Various linkers were purchased from BEX (Tokyo). In the
sequence shown below, *A and *C correspond to RNA, and SPC18
corresponds to Spacer18 (hexaethylene glycol).
TABLE-US-00005 an21-ACOA:
5'-CCCGCCTCCCGCCCCCCGTCC-[SPC18].sub.5-A*-C*-C*-A*-3'
[Aminoacylation of the Linkers]
[0086] L-phenylalanine or .beta.-L-alanine was attached to the 3'
end of the an 21-ACCA linker molecule via an ester bond by a
flexizyme-catalyzed reaction. The reaction product was identified
by acrylamide electrophoretic analysis of the purified reaction
product solution under acidic conditions. If the bands derived from
the linker molecule are aminoacylated, the mobility decreases.
Thus, aminoacylation efficiency can be determined by comparing the
intensity of bands derived from unreacted materials and bands
derived from the reaction product.
[0087] Acylation reaction for attaching L-phenylalanine was
performed by adding 5 .mu.L of 20 .mu.M flexizyme eFx, 20 .mu.M an
21-ACCA linker, and a substrate (L-phenylalanine cyanomethyl ester)
to 20% dimethyl sulfoxide in 0.1 M HEPES-potassium buffer (pH 7.5),
600 mM magnesium chloride, and reacting the mixture on ice for 2
hours. Specifically, 40 .mu.M linker molecule dissolved in pure
water and flexizyme eFx (200 .mu.M, 0.5 .mu.L) were first added to
0.2 M HEPES-potassium buffer (pH 7.5), and the mixture was heated
on a thermoblock (ND-MD1, Nissin Scientific Corporation) at
95.degree. C. for 2 minutes, and allowed to stand at room
temperature for 5 minutes. Then, acylation reaction of the linker
molecule was started by adding magnesium chloride (3 M, 1 .mu.L)
and a substrate (25 mM in dimethyl sulfoxide, 1 .mu.L) on ice, and
the mixture was allowed to stand on ice for 2 hours. For attaching
.beta.-L-alanine, .beta.-L-alanine p-chlorobenzyl thioether was
used as a substrate under the same conditions at pH 8.0. The
reaction was quenched by adding 40 .mu.L of 0.3 M sodium acetate
(pH 5.0). The reaction product was precipitated with ethanol, and
the pellet was washed with 70% ethanol and dissolved in 10 .mu.L of
1 mM sodium acetate. After the reaction, the solution was separated
by 20% denaturing polyacrylamide gel electrophoresis (50 mM sodium
acetate (pH 5.0), 6 M urea) under acidic conditions, and the gel
after migration was analyzed by fluorescent staining with SYBR
Green II (Invitrogen, SYBR is a registered trademark of Molecular
Probes Inc.).
[0088] As shown in FIG. 3, the results demonstrated that the
mobility of the linker molecule of the reaction product is lower
than that of the unreacted control linker molecule, indicating that
the linker molecule has been aminoacylated by a flexizyme-catalyzed
reaction.
[Synthesis of cDNAs]
[0089] The cDNAs used for forming peptide-mRNA complexes were
prepared by annealing synthetic oligonucleotides by PCR. Synthetic
DNAs having the sequences shown below were purchased from Operon
Biotechnologies, Inc. (Tokyo). Each cDNA obtained by annealing
these oligo DNAs comprises a T7 promoter sequence, a ribosome
binding site, a start codon, a peptide aptamer sequence, a spacer
peptide sequence (CGSGSGS), an amber codon and a linker
hybridization sequence.
TABLE-US-00006 TNF-a_D-Trp.R66:
GCCGCTGCCGCTGCCGCAATGCTTCAGATACAGACAATGCAGACGTTGCA TATGTATATCTCCTTC
EMP1SS.F63: GAAGGAGATATACATATGGCAGCAGGTGGTACCTATTCTTCTCATTTTGG
TCCGCTGACCTGG EMP1SS.R63:
GCCGCTGCCGCTGCCGCATGCTGCACCACCTTGCGGCTTAGAAACCCAGG TCAGCGGACCAAA
T7g10M.F48: AATACGACTCACTATAGGGTTAACTTTAAGAAGGAGATATACATATG
CGS3an13.R39: TTTCCGCCCCCCGTCCTAGCTGCCGCTGCCGCTGCCGCA CGS3an21.R44:
CCGCCTCCCGCCCCCCGTCCTAGCTGCCGCTGCCGCTGCCGCA
[0090] Annealing by PCR was performed by the following
procedure.
[0091] 20 uL of a PCR reaction solution (10 mM Tris-HCl (pH 9.0),
50 mM potassium chloride, 2.5 mM magnesium chloride, 250 .mu.M
dNTPs, 0.2% Triton X-100 (Triton X-100, NACALAI TESQUE, INC.) and
Taq polymerase) containing 250 nM T7g10M.F48 and TNF-a_D-Trp.R66
(or a combination of EMP1SS.F63 and EMP1SS.R63) was prepared and
reacted at 94.degree. C. for 1 min, followed by 5 cycles of
{50.degree. C. 30 sec, 72.degree. C. 30 sec} using a thermal cycler
(TC-3000, Techne). Then, 100 .mu.L of a PCR reaction solution
containing 500 nM each of the primers T7g10M.F48 and GCSan21.R44
(or GCSan13.R39) was prepared, and combined with 1 .mu.L of the
former PCR reaction product solution, and the mixture was reacted
by temperature cycling of 10 cycles of {94.degree. C. 40 sec,
50.degree. C. 40 sec, 72.degree. C. 40 sec}. The reaction product
was routinely purified by phenol-chloroform extraction, chloroform
extraction, and ethanol precipitation.
[Preparation of mRNAs]
[0092] To prepare mRNAs, RNAs were synthesized by transcription
reaction using T7 RNA polymerase from the cDNA (TNF-.alpha.-DW (an
21)) prepared by the procedure described above and the resulting
reaction products were routinely purified by phenol-chloroform
extraction, chloroform extraction, and 2-propanol precipitation.
The purified mRNAs were diluted to a concentration of 10 .mu.M as
determined from the UV absorbance at 260 nm.
[Transcription/translation, hybridization with the linkers and
conjugation to a peptidyl acceptor]
[0093] Translation from mRNAs and complex formation with linker
molecules or transcription from cDNAs, translation and complex
formation with linker molecules were performed using a
reconstituted cell-free translation system.
[0094] The reconstituted cell-free translation system used in the
present example comprises the following biological polymers: 70S
ribosome (1.2 uM), translation initiation factors (IF1 (0.7 uM),
IF2 (0.4 uM), IF3 (1.5 uM)), elongation factors (EF-G (0.26 uM),
EF-Tu/EF-Ts complex (10 uM)), translation termination factors (RF2
(0.25 uM), RF3 (0.17 uM)), methionyl-tRNA transformylase (MTF (0.6
uM)), ribosome recycling factor (RRF (0.5 uM)), aminoacyl-tRNA
synthetases (AlaRS (0.73 uM), ArgRS (0.03 uM), AsnRS (0.38 uM),
CysRS (0.02 uM), GlnRS (0.06 uM), GluRS (0.23 uM), GlyRS (0.09 uM),
HisRS (0.02 uM), IleRS (0.4 uM), LeuRS (0.04 uM), MetRS (0.03 uM),
PheRS (0.68 uM), ProRS (0.16 uM), SerRS (0.04 uM), ThrRS (0.09 uM),
TrpRS (0.03 uM), ValRS (0.02 uM), AspRS (0.13 uM), LysRS (0.11 uM),
TyrRS (0.02 uM)), creatine kinase (CK, from Roche (4 ug/mL)),
myokinase (MK, from Roche (3 ug/mL)), pyrophosphatase (PPa (0.1
uM)), nucleotide diphosphate kinase (NDK (0.1 uM)), T7 RNA
polymerase (17 phage gene-derived recombinant, 0.1 uM), E. coli
tRNA (from Roche, 1.5 mg/mL). The ribosome was purified from E.
coli in the logarithmic growth phase, while various proteins other
than the ribosome are recombinant proteins expressed and purified
from cloned genes for E. coli, unless otherwise specified.
[0095] Besides the biological polymers, the following components
are included: 50 mM HEPES-KOH (pH7.6), 2 mM NTPs, 20 mM creatine
phosphate, 100 mM potassium acetate, 2 mM spermidine, 1 mM
dithiothreitol, 6 mM magnesium acetate, 0.1 mM
10-formyl-5,6,7,8-tetrahydrofolic acid.
[0096] 2.5 .mu.L of a transcription/translation reaction solution
was prepared, containing 1.5 .mu.M mRNA or 0.15 .mu.M cDNA, an
aminoacyl-initiator tRNA bearing N-chloroacetyl-D-tryptophan
(CIAc-D-Trp) as an acyl group (prepared by the procedure disclosed
in JPA-2008-125396), and 19 amino acids (each 5 mM) constituting
natural proteins except for methionine in addition to the
components mentioned above.
[0097] In the case where an mRNA is preliminarily prepared by
transcription reaction and then translated into a peptide and the
resulting peptide is fused to a linker, a peptide-mRNA complex was
prepared by the following procedure. First, 4 mM sodium acetate, pH
5.0 and mRNA were mixed in 1:3, and the mixture was heated on a
thermoblock at 95.degree. C. for 1 minute and then allowed to stand
at room temperature for 5 min. A 25 .mu.M linker solution dissolved
in 1 mM sodium acetate was added and the mixture was allowed to
stand for 10 minutes to form an mRNA-linker complex. To this were
added the other components of the translation system and the
mixture was incubated in a constant-temperature water bath
(NT-202D, Nissin Scientific Corporation) at 37.degree. C. for 30
minutes, then at room temperature for 12 min, and 0.1 M EDTA
(ethylenediaminetetraacetic acid, molecular biology grade, NACALAI
TESQUE, INC.) adjusted to pH 7.5 was added at a final concentration
of 20 mM, and the mixture was further incubated in the
constant-temperature water bath at 37.degree. C. for 30
minutes.
[0098] In the case where a cDNA is added to a reaction solution and
transcription, translation and fusion to a linker are performed in
this reaction solution, a peptide-mRNA complex was prepared by the
following procedure. First, a solution containing the components
other than the linker was prepared and reacted in a
constant-temperature water bath at 37.degree. C. for 30 minutes to
perform transcription and translation reactions. To this was added
0.25 .mu.L of 25 .mu.M linker solution, and the mixture was further
incubated at 37.degree. C. for 30 minutes, then at room temperature
for 12 minutes. Then, 0.1 M EDTA (ethylenediaminetetraacetic acid,
molecular biology grade, NACALAI TESQUE, INC.) adjusted to pH 7.5
was added at a final concentration of 20 mM, and the mixture was
further incubated in the constant-temperature water bath at
37.degree. C. for 30 minutes.
[Reverse Transcription]
[0099] To improve stability of the mRNA moiety of the peptide-mRNA
complex, an RNA-DNA hybrid strand was formed by reverse
transcription reaction. Specifically, the following procedure was
applied. To the translation reaction product described above were
added 12 mM Tris-HCl (pH 8.3), 5 .mu.M reverse transcription primer
(CGS3an 13.R21), 0.5 mM dNTPs, 18 mM Mg (OAc).sub.2, and 10 mM KOH
(each expressed by the final concentration). To this was added 1
unit of M-MLV Reverse Transcriptase (RNaseH Minus, Point Mutant,
Promega), and the mixture was reacted in a constant-temperature
water bath at 42.degree. C. for 10 minutes. Then, EDTA and
hydrochloric acid were added at final concentrations of 10 mM and
18 mM, respectively.
[Selection]
[0100] The following procedure was taken to assess whether or not
the peptide-mRNA complex molecule prepared in this manner is
recovered by interaction between the presented peptide and a target
protein.
[0101] Human tumor necrosis factor-alpha (hereinafter referred to
as TNF-.alpha.) was chosen as a target protein.
[0102] To 6 .mu.L of a cell-free translation reaction product
solution containing a peptide-mRNA complex molecule was added
biotinylated TNF-.alpha. protein at a final concentration of 250
nM, and this solution was transferred to a 0.6 mL ultra-low
retention Eppendorf tube (platinum (ultra-low retention) tube, BM
Equipment Co., Ltd.), and gently stirred on a rotator (RT-30 mini,
Tietech Co., Ltd.) at 4.degree. C. for 1 hr to induce binding. To
this solution was added 3 .mu.L of a suspension of
streptavidin-immobilized magnetic beads (Dynabeads.RTM.
Streptavidin M-280, Invitrogen), and the mixture was stirred for
further 10 minutes. Then, the magnetic beads were separated by
centrifugation and using a magnet holder, and the supernatant was
removed, and the pellet was resuspended in 50 .mu.L of TBS (Tris
Buffered Saline, 50 mM Tris-HCl (trishydroxymethylaminomethane,
NACALAI TESQUE, INC.) pH 7.5, 150 mM sodium chloride) containing
0.05% Tween20 (polyoxyethylene sorbitan monolaurate, NACALAI
TESQUE, INC.). This washing process was repeated four times.
[0103] Subsequently, 25 .mu.L of PCR (taq-) buffer (10 mM Tris-HCl
(pH 9.0), 50 mM potassium chloride, 2.5 mM magnesium chloride, 250
.mu.M dNTPs, 0.25 .mu.M T7g10m.F48, 0.25 .mu.M CGS3an 13.R21, 0.2%
Triton X-100) was added to the magnetic beads, and the suspension
was heated on a thermoblock at 95.degree. C. for 5 minutes and then
the supernatant was collected, whereby a DNA was recovered from the
magnetic beads after reverse transcription.
[Quantification by Real-Time PCR]
[0104] The amount of the DNA was determined by real-time PCR before
the target protein was added and after it was recovered from the
magnetic beads. Using LightCycler.RTM. 1.5 (Roche Applied Science)
as a real-time PCR system, a reaction solution containing Taq
polymerase, SYBR.RTM. Green I (1:100,000 dilution, Invitrogen), and
a test sample solution in the PCR (taq-) buffer described above was
assayed.
Model Experiment Targeting Tnf-.alpha.
[0105] TNF-.alpha. and a peptide aptamer binding to TNF-.alpha.,
TNF-.alpha.-DW were chosen as a target protein and a peptide
aptamer used to test the function of the linkers.
[0106] The TNF-.alpha. protein used in the present example was a
recombinant soluble TNF-.alpha. expressed by E. coli. The
recombinant TNF-.alpha. is a fusion of a sequence of the 77th to
233rd amino acids of wild-type TNF-.alpha. to AviTag sequence
(GLNDIFEAQKIEWHE) and His.times.6 tag sequence at the N-terminus.
This protein and a biotin ligase (BirA) using AviTag as a substrate
are co-expressed in E. coli, whereby the side chain of the lysine
residue of AviTag is biotinylated, so that the TNF-.alpha. used in
the present example can be readily separated by
streptavidin-immobilized beads.
[0107] The TNF-.alpha.-DW used as a peptide aptamer was a peptide
XQRLHCLYLKH(X: Ac-D-Trp) circularized with a thioether formed by a
reaction between the chloroacetyl group of a non-proteinogenic
amino acid N-chloroacetyl-D-tryptophan (ClAc-D-Trp) and the thiol
group in the side chain of cysteine in the peptide sequence. A cDNA
encoding a sequence containing a spacer amino acid sequence CGSGSGS
fused to the C-terminus of this peptide was prepared by the method
described above to form a peptide-mRNA complex molecule in a
cell-free transcription/translation system.
[0108] The yields of peptide-mRNA complexes using a combination of
this peptide aptamer and the target protein are shown in FIG. 4 and
FIG. 5. The yields with an 21-Phe, that is a linker having
L-phenylalanine attached to the 3' end via an ester and an
21-.beta.-Ala were 1.30% and 0.25% when the mRNA was added to the
translation reaction solution (FIG. 4), or 0.65% and 0.38% when a
cDNA was added (FIG. 5). However, the yield with the an 21-ACCA
linker unmodified at the 3' end was about several tens of times
lower than those obtained with the modified linkers (0.015% in the
case of mRNA, or 0.007% in the case of cDNA), showing that
peptide-mRNA complex molecules are efficiently recovered by
conjugating L-phenylalanine or .beta.-L-alanine to the C-terminus
of the peptide synthesized by translation via a covalent bond.
Example 2
[0109] Verification of Mapping Between the Presented Peptide and
the mRNA
[0110] In the foregoing experiments using a single type of the
presented peptide and the mRNA encoding its sequence, one cannot
exclude the possibility that another linker molecule binds to the
peptide synthesized by translation from the mRNA as an acceptor or
the possibility that the linker molecule and mRNA molecule forming
a double strand are replaced by another linker molecule or mRNA
during the manipulation. Thus, the following experiments were
performed to verify that mapping between the peptide presented by
recovered peptide-mRNA-linker complex molecules and the mRNA has
been exactly made.
[0111] First, an mRNA or cDNA encoding a peptide sequence that does
not bind to the target protein (EMP1SS: XAAGGTYSSHFGPLTWVSKPQGGAA,
wherein X is Ac-D-Trp similarly to TNF-.alpha.-DW) as a control of
TNF-.alpha.-DW was prepared by the procedure shown in Example 1,
and mixed with an mRNA or cDNA encoding TNF-.alpha.-DW in a molar
ratio of 100:1. This mixture was used to perform experiments
similar to those described above, and the recovered DNA was
amplified by PCR under the following conditions. That is, 20 .mu.L
of a reaction solution containing Taq polymerase and a test sample
solution in PCR (taq-) buffer was prepared and reacted by
temperature cycling of 30 cycles of {94.degree. C. 40 sec,
61.degree. C. 40 sec, 72.degree. C. 40 sec} (with a slope of
0.5.degree. C./sec from 61.degree. C. to 72.degree. C.) using a
thermal cycler. 2.5 .mu.L of the reaction product solution was
separated by electrophoresis using a gel consisting of TAE (40 mM
Tris-acetate, 1 mM EDTA) and 3% agarose (low electroendosmosis,
NACALAI TESQUE, INC.), and electrophoretograms were obtained under
a transilluminator after staining with ethidium bromide. The
results are shown in FIG. 6.
[0112] A band derived from the mRNA encoding TNF-.alpha.-DW is
observed at the position of about 90 bp, while a band derived from
the mRNA encoding the control EMP1SS is observed at the position of
about 150 bp. When the an 21-ACCA linker containing no peptidyl
acceptor was used, only a band derived from the mRNA of EMP1SS was
observed, reflecting the molar ratio of the two types of cDNA in
the initial mixture. With an 21-Phe, however, a band derived from
the mRNA of TNF-.alpha.-DW was observed with a fluorescent
intensity comparable to or higher than that of EMP1SS. Thus, it was
demonstrated that peptide-mRNA complexes presenting TNF-.alpha.-DW
that binds to the target protein were recovered more efficiently
than peptide-mRNA complexes presenting EMP1SS that does not bind to
the target. This indicates that mapping between the peptide
presented by peptide-mRNA-linker complex molecules and the mRNA
does not change during the experiments. In addition, this result
was equally obtained either when peptide-mRNA complexes were formed
by adding the mRNAs into the translation reaction solution or
peptide-mRNA complexes were formed by adding cDNAs.
Example 3
[0113] Selection of a TNF-.alpha.-DW-Spiked Library
[Random Peptide Library]
[0114] Evaluation was made to determine whether or not an mRNA or
cDNA encoding a low copy number peptide aptamer contained in an
mRNA library encoding random peptide sequences can be selected by
repeating selection multiple times.
[0115] First, a peptide aptamer library presenting a random
sequence of 8-12 amino acids was prepared. This library was
prepared as an mRNA encoding the random sequence. This library has
a similar structure to those of the preparations described above
except that the sequence region presenting TNF-.alpha.-DW or EMP1SS
is randomized and the region with which the linker hybridizes to
form a double strand has a length of 13 bp.
[Preparation of a TNF-.alpha.-DW-Spiked Library]
[0116] A spiked library was prepared by mixing an mRNA encoding
TNF-.alpha.-DW (TNF-.alpha.-DW (an13): the region forming a double
strand with the linker has a length of 13 bp) with this random
peptide library in a molar ratio of 1,000,000:1.
[Round 1]
[0117] This spiked mRNA library and an 21-Phe linker was used to
perform translation and peptide-mRNA complex formation following
the procedures shown in Examples 1 and 2 above (round 1).
[0118] Negative selection was performed in which a peptide-mRNA
complex solution was mixed with unbound streptavidin-immobilized
magnetic beads at 4.degree. C. for 10 minutes, whereby peptide-mRNA
complexes binding to the magnetic beads were eliminated. To this
solution was added TNF-.alpha. at a final concentration of 250 nM,
and mixed at 4.degree. C. for 1 hour. Streptavidin-immobilized
magnetic beads were added to this solution, and bound at 4.degree.
C. for 10 minutes and washed with TBST four times.
[0119] Then, the washed magnetic beads were suspended in 10 .mu.L
of a reverse transcription reaction solution (5 units/.mu.L M-MLV
Reverse Transcriptase (Promega), 2 .mu.M CGS3an 21.R44, 0.5 mM
dNTP, 10 mM Tris-HCl (pH 8.3), 15 mM potassium chloride,
0.6.degree. C. mM magnesium chloride, 2 mM dithiothreitol), and the
suspension was warmed at 42.degree. C. for 1 hr to perform reverse
transcription reaction. Subsequently, 15 .mu.L of PCR (taq-) buffer
(containing 0.25 .mu.M T7g10m.F48 and 0.25 .mu.M CGS3an 21.R44 as
primers) was added to the suspension of the magnetic beads, and the
mixture was heated on a thermoblock at 95.degree. C. for 5 minutes
and then the supernatant was collected, whereby a DNA was recovered
from the magnetic beads after reverse transcription.
[0120] An aliquot each of the mRNA immediately after translation
and the recovered DNA was assayed for the copy number by real-time
PCR in the same manner as in Example 1. Further, amplification by
PCR was performed in the same manner as in Example 2 and terminated
before the amplification reaction reached saturation to avoid
reannealing of the reaction products to each other.
[Rounds 2, 3 and 4]
[0121] In round 2 and the subsequent rounds, the results were
compared in the case where an mRNA synthesized from the PCR product
of the previous round was used for translation reaction or the cDNA
obtained as the PCR product of the previous round was used to
perform transcription and translation reactions at the same time.
Experimental procedures were similar to those of Examples 1 and 2
except that negative selection was performed multiple times.
Specifically, the number of times of negative selection increases
by one in each round. In round 2 and the subsequent rounds, PCR
amplification was also terminated before the amplification reaction
reached saturation.
[Identification of Selected Sequences]
[0122] After the operation of round 2 was repeated multiple times,
a great increase in binding affinity was observed in round 4.
Changes in binding affinity with the number of rounds are shown in
FIG. 7. The PCR products were routinely cloned using pGEM-T easy
Vector System I (Promega), and 5 clones each were analyzed by DNA
sequencing. The results showed that all the resulting clones had
the same sequence as that of TNF-.alpha.-DW (an21).
[0123] It was demonstrated that peptide aptamers can be selected
from peptide libraries consisting of random sequences by this
method.
SEQUENCE LISTING FREE TEXT
[0124] SEQ ID NO: 1: Synthetic oligonucleotide
[0125] SEQ ID NO: 2: Synthetic oligonucleotide
[0126] SEQ ID NO: 3: Flexizyme Fx
[0127] SEQ ID NO: 4: Flexizyme eFX
[0128] SEQ ID NO: 5: Flexizyme dFx
[0129] SEQ ID NO: 6: Synthetic oligonucleotide
[0130] SEQ ID NO: 7: Synthetic oligonucleotide
[0131] SEQ ID NO: 8: Synthetic oligonucleotide TNF-a_D-Trp.R66
[0132] SEQ ID NO: 9: Synthetic oligonucleotide EMP1SS.F63
[0133] SEQ ID NO: 10: Synthetic oligonucleotide EMP1SS.R63
[0134] SEQ ID NO: 11: Synthetic oligonucleotide T7g10M.F48
[0135] SEQ ID NO: 12: Synthetic oligonucleotide CGS3an 13.R39
[0136] SEQ ID NO: 13: Synthetic oligonucleotide CGS3an 21.R44
[0137] SEQ ID NO: 14: Synthetic oligonucleotide CGSan13.R21
[0138] SEQ ID NO: 15: TNF-alpha-DW (an 21)
[0139] SEQ ID NO: 16: TNF-alpha-DW (an 13)
[0140] SEQ ID NO: 17: EMP1SS (an 21)
[0141] SEQ ID NO: 18: TNF-alpha
[0142] SEQ ID NO: 19: Flexizyme aFx.
(Notes) In the DNAs of SEQ ID NOs: 15-17, the codon for methionine
is assigned to a non-proteinogenic amino acid (ClAc-D-Trp) (genetic
code reprogramming).
Sequence CWU 1
1
19116DNAArtificialsynthetic oligonucleotide 1ctcccgcccc ccgtcc
16221DNAArtificialsynthetic oligonucleotide 2cccgcctccc gccccccgtc
c 21345RNAArtificialFlexizyme Fx 3ggaucgaaag auuuccgcag gcccgaaagg
guauuggcgu uaggu 45445RNAArtificialFlexizyme eFx 4ggaucgaaag
auuuccgcgg ccccgaaagg ggauuagcgu uaggu 45546RNAArtificialFlexizyme
dFx 5ggaucgaaag auuuccgcau ccccgaaagg guacauggcg uuaggu
46617DNAArtificialsynthetic oligonucletide 6taatacgact cactata
17728DNAArtificialsynthetic oligonucleotide 7gggttaactt taagaaggag
atatacat 28866DNAArtificialsynthetic oligonucleotide TNF-a
D-Trp.R66 8gccgctgccg ctgccgcaat gcttcagata cagacaatgc agacgttgca
tatgtatatc 60tccttc 66963DNAArtificialsynthetic oligonucleotide
EMP1SS.F63 9gaaggagata tacatatggc agcaggtggt acctattctt ctcattttgg
tccgctgacc 60tgg 631063DNAArtificialsynthetic oligonucleotide
EMP1SS.R63 10gccgctgccg ctgccgcatg ctgcaccacc ttgcggctta gaaacccagg
tcagcggacc 60aaa 631148DNAArtificialsynthetic oligonucleotide
T7g10M.F48 11taatacgact cactataggg ttaactttaa gaaggagata tacatatg
481239DNAArtificialsynthetic oligonucleotide CGS3an13.R39
12tttccgcccc ccgtcctagc tgccgctgcc gctgccgca
391344DNAArtificialsynthetic oligonucleotide CGS3an21.R44
13cccgcctccc gccccccgtc ctagctgccg ctgccgctgc cgca
441421DNAArtificialsynthetic oligonucleotide CGSan13.R21
14tagctgccgc tgccgctgcc g 2115122DNAArtificialTNF-alfa-DW(an21)
15taatacgact cactataggg ttaactttaa gaaggagata tacatatgca acgtctgcat
60tgtctgtatc tgaagcattg cggcagcggc agcggcagct aggacggggg gcgggaggcg
120gg 12216117DNAArtificialTNF-alfa-DW(an13) 16taatacgact
cactataggg ttaactttaa gaaggagata tacatatgca acgtctgcat 60tgtctgtatc
tgaagcattg cggcagcggc agcggcagct aggacggggg gcggaaa
11717164DNAArtificialEMP1SS(an21) 17taatacgact cactataggg
ttaactttaa gaaggagata tacatatggc agcaggtggt 60acctattctt ctcattttgg
tccgctgacc tgggtttcta agccgcaagg tggtgcagca 120tgcggcagcg
gcagcggcag ctaggacggg gggcgggagg cggg 16418183PRTArtificialTNF-alfa
18Met Ser Gly Leu Asn Asp Ile Phe Glu Ala Gln Lys Ile Glu Trp His1
5 10 15Glu Gly His His His His His His Gly Ser Val Arg Ser Ser Ser
Arg 20 25 30Thr Pro Ser Asp Lys Pro Val Ala His Val Val Ala Asn Pro
Gln Ala 35 40 45Glu Gly Gln Leu Gln Trp Leu Asn Arg Arg Ala Asn Ala
Leu Leu Ala 50 55 60Asn Gly Val Glu Leu Arg Asp Asn Gln Leu Val Val
Pro Ser Glu Gly65 70 75 80Leu Tyr Leu Ile Tyr Ser Gln Val Leu Phe
Lys Gly Gln Gly Cys Pro 85 90 95Ser Thr His Val Leu Leu Thr His Thr
Ile Ser Arg Ile Ala Val Ser 100 105 110Tyr Gln Thr Lys Val Asn Leu
Leu Ser Ala Ile Lys Ser Pro Cys Gln 115 120 125Arg Glu Thr Pro Glu
Gly Ala Glu Ala Lys Pro Trp Tyr Glu Pro Ile 130 135 140Tyr Leu Gly
Gly Val Phe Gln Leu Glu Lys Gly Asp Arg Leu Ser Ala145 150 155
160Glu Ile Asn Arg Pro Asp Tyr Leu Asp Phe Ala Glu Ser Gly Gln Val
165 170 175Tyr Phe Gly Ile Ile Ala Leu
1801947RNAArtificialFlexizyme aFx 19ggaucgaaag auuuccgcac
ccccgaaagg gguaaguggc guuaggu 47
* * * * *