U.S. patent application number 13/501768 was filed with the patent office on 2012-08-16 for antiproliferative agent.
This patent application is currently assigned to NANYANG TECHNOLOGICAL UNIVERSITY. Invention is credited to Han Chung Chong, Royston Huang, Ming Jie Tan, Nguan Soon Tan.
Application Number | 20120207770 13/501768 |
Document ID | / |
Family ID | 43876362 |
Filed Date | 2012-08-16 |
United States Patent
Application |
20120207770 |
Kind Code |
A1 |
Tan; Nguan Soon ; et
al. |
August 16, 2012 |
ANTIPROLIFERATIVE AGENT
Abstract
The invention provides an antibody specific to the ANGPTL4
protein capable of neutralizing proliferation and methods of making
and using the same. The antibody of the invention is further
directed to the C terminal region of the protein and may be capable
of neutralizing cell proliferation and treating cancer. The
antibody may be monoclonal and or humanized antibody.
Inventors: |
Tan; Nguan Soon; (Singapore,
SG) ; Chong; Han Chung; (Singapore, SG) ; Tan;
Ming Jie; (Singapore, SG) ; Huang; Royston;
(Singapore, SG) |
Assignee: |
NANYANG TECHNOLOGICAL
UNIVERSITY
Singapore
SG
|
Family ID: |
43876362 |
Appl. No.: |
13/501768 |
Filed: |
October 14, 2010 |
PCT Filed: |
October 14, 2010 |
PCT NO: |
PCT/SG2010/000392 |
371 Date: |
April 13, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61251485 |
Oct 14, 2009 |
|
|
|
Current U.S.
Class: |
424/172.1 ;
435/375; 506/9; 514/44A; 530/387.3; 530/388.2; 530/389.1;
536/24.5 |
Current CPC
Class: |
C12N 2310/14 20130101;
C12N 15/1138 20130101; C12N 2310/531 20130101; A61K 2039/505
20130101; C07K 16/22 20130101; A61P 35/00 20180101; C12N 2330/50
20130101; C12N 15/1136 20130101 |
Class at
Publication: |
424/172.1 ;
536/24.5; 530/389.1; 530/388.2; 530/387.3; 514/44.A; 435/375;
506/9 |
International
Class: |
A61K 39/395 20060101
A61K039/395; C07K 16/18 20060101 C07K016/18; A61P 35/00 20060101
A61P035/00; C12N 5/07 20100101 C12N005/07; C40B 30/04 20060101
C40B030/04; C07H 21/02 20060101 C07H021/02; A61K 31/7052 20060101
A61K031/7052 |
Claims
1-29. (canceled)
30. An antagonist to angiopoietin like 4 protein (ANGPTL4) that
reduces cell proliferation and reduces a level of Reactive Oxygen
Species in a cell, wherein the antagonist comprises an interfering
RNA sequence or an antibody specific to angiopoietin like 4 protein
(ANGPTL4).
31. The antagonist of claim 30 directed to the C terminal region of
the protein.
32. The antagonist of claim 30 wherein the antibody is a monoclonal
antibody, a humanized antibody or both.
33. The anatagonist of claim 30 wherein the interfering RNA
sequence comprises that set out in SEQ ID 4, or SEQ ID NO. 5, or
SEQ ID NO. 6, or SEQ ID NO. 7.
34. A method of treating a patient to reduce cell proliferation and
reduce a level of Reactive Oxygen Species in a cell, which
comprises the step of: (a) contacting proliferating cell with an
antagonist to angiopoietin like 4 protein (ANGPTL4) wherein the
antagonist comprises an interfering RNA sequence or an antibody
specific to angiopoietin like 4 protein (ANGPTL4).
35. The method of claim 34 wherein the antagonist is directed to
the C terminal region of the protein.
36. The method of claim 34 wherein the interfering RNA sequence
comprises that set out in SEQ ID 4, or SEQ ID NO. 5, or SEQ ID NO.
6, or SEQ ID NO. 7.
37. A method of reducing cell proliferation and reducing a level of
Reactive Oxygen Species in a cell, which comprises the step of: (a)
contacting proliferating cell with an antagonist to angiopoietin
like 4 protein (ANGPTL4) wherein the antagonist comprises an
interfering RNA sequence or an antibody specific to angiopoietin
like 4 protein (ANGPTL4).
38. The method of claim 37 wherein the antagonist is directed to
the C terminal region of the protein.
39. The method of claim 37 wherein the cell is in vitro.
40. The method of claim 37 wherein the cell is in vivo, and the
modulator is administered to a subject.
41. The method of claim 37 wherein the interfering RNA sequence
comprises that set out in SEQ ID 4, or SEQ ID NO. 5, or SEQ ID NO.
6, or SEQ ID NO. 7.
42. An antagonist to angiopoietin like 4 protein (ANGPTL4) for the
treatment of a cancer wherein the antagonist comprises an
interfering RNA sequenceor an antibody specific to angiopoietin
like 4 protein (ANGPTL4) that reduces cell proliferation and
reduces the level of Reactive Oxygen Species in a cell.
43. The antagonist of claim 42 directed to the C terminal region of
the protein.
44. The antagonist of claim 42 wherein the antibody is a monoclonal
antibody and or a humanized antibody.
45. The anatagonist, of claim 42 wherein the interfering RNA
sequence comprises that set out in SEQ ID 4, or SEQ ID NO. 5, or
SEQ ID NO. 6, or SEQ ID NO. 7.
46. A composition comprising a therapeutically effective amount of
an antagonist to angiopoietin like 4 protein (ANGPTL4) wherein the
antagonist comprises an interfering RNA sequence or an antibody
specific to angiopoietin like 4 protein (ANGPTL4) that reduces cell
proliferation and reduces the level of Reactive Oxygen Species in a
cell.
47. The composition of claim 46 wherein the antagonist is directed
the C teminal region of the protein.
48. The composition of claim 46 wherein the antibody is a
monoclonal antibody and or a humanized antibody.
49. The composition of claim 46 wherein the interfering RNA
sequence comprises that set out in SEQ ID 4, or SEQ ID NO. 5, or
SEQ ID NO. 6, or SEQ ID NO. 7.
50. The antagonist or composition of claim 46 wherein the
antagonist is suitable for use in suppression of tumor growth.
51. The method, antagonist or composition of claim 46 wherein the
antagonist is suitable for use in treating metastasis.
52. A method of diagnosing an anoikis resistance proliferative
disorder, comprising the steps of (a) determining an amount of the
angiopoietin like 4 protein (ANGPTL4) protein in body fluids or
tissue sampled from a person suspected of having a proliferative
disorder using an antibody specific to angiopoietin like 4 protein
(ANGPTL4); and (b) comparing the amount of the angiopoietin like 4
protein (ANGPTL4) from a person suspected of having a proliferative
disorder with a second amount sampled from a healthy individual
wherein elevated ANGPLT4 in the first sample compared with the
second sample is indicative that an anoikis resistance
proliferative disorder is present in the person suspected of having
a proliferative disorder.
53. The method of claim 52 wherein the antibody is capable of
binding selectively a sequence set out in SEQ ID 1, or SEQ ID NO. 2
or SEQ ID NO. 3.
54. The method of claim 52 wherein the state of tumor progression
can be determined by the expression level of the angiopoietin like
4 protein (ANGPTL4) protein in body fluids or tissue sampled
increasing from a benign state to a metastatic state.
Description
INCORPORATION OF ELECTRONICALLY SUBMITTED SEQUENCE LISTING
[0001] The entirety of the sequence listing submitted
electronically at the same time of the filing of the instant
application is incorporated by reference herein.
FIELD OF THE INVENTION
[0002] The invention relates to antagonist of ANGPTL4 and methods
of using the same including methods for the treatment of cancer and
proliferative disorders.
BACKGROUND
[0003] Cancer is one of the main diseases of the 21.sup.st century
causing 13% of all deaths. While there are several chemicals that
can affect rapidly dividing cancer cells, most of these chemicals
are toxic with adverse side effects.
[0004] Cancer is expected to be the leading cause of death
worldwide in the near future. Tumor cells exploit various signaling
molecules to promote their growth, invasion and metastasis. A clear
understanding of the mechanisms of actions of these molecules in
malignancy will provide new insights into therapeutic
interventions.
[0005] In response to stresses in the tumor microenvironment, such
as hypoxia and inflammation, tumor cells exploit various signaling
molecules to sustain and promote their growth, invasiveness and
metastasis. Aggressive tumor metastasis and invasiveness is the
main cause of mortality in cancer patients. The constitutive
activation of intracellular signaling by these molecules in tumor
cells causes changes in cellular functions, including increased
proliferation and the ability of cells to grow outside their
original confined milieu, leading to metastasis. Among these
changes, the loss of dependence on integrin-mediated extracellular
matrix contact for growth, or anoikis resistance, is an essential
feature of tumor cells, yet how it is acquired remains an unsolved
problem in cancer biology.
[0006] Although low levels of reactive oxygen species (ROS)
regulate cellular signaling and play an important role in normal
cell proliferation, recent studies show that tumors exhibit an
excessive amount or persistent elevation of ROS (specifically the
superoxide anion O.sub.2.sup.-) and utilize a redox-based mechanism
to evade death by anoikis Previous studies have indicated that ROS
are involved in tumor initiation, progression and maintenance.
Furthermore, deregulated ROS production is also associated with an
invasive tumor phenotype. Oncogenic and mitogenic Ras activity is
superoxide-dependent, and a sustained increase in ROS following the
overexpression of Mox1 (the catalytic subunit of NADPH oxidase)
leads to cell transformation and aggressive tumor metastasis.
Elevated production of ROS following activation of the c-Met
proto-oncogene leads to cell transformation and malignant growth,
and Rac-dependent redox signals increase the secretion of
metalloproteases and induce the epithelial-mesenchymal transition,
which are two key features of invasive cancers. Thus, a clear
understanding of the underlying redox-based anoikis escape
mechanism and its connection to malignancy will provide new
insights into therapeutic interventions.
[0007] Anoikis resistance, a hallmark of tumor malignancies, is an
integrin-dependent process. Reactive oxygen species (ROS) generated
due to intergrin engagement oxidizes and activates Src, which
stimulates the ERK and Akt pro-survival pathways. Both pathways
regulate the subcellular location or stability of BH3-only
apoptotic proteins (eg Bad and Bim), essential for executing
anoikis. Resistance to anoikis has been suggested to be a
prerequisite for cancer cells to metastasize. The mechanism by
which invading tumor cells survive the anoikis process remains
largely unknown.
[0008] Angiopoietin-like protein 4 (ANGPTL4) are secreted proteins
mainly expressed in liver that have been demonstrated to regulate
triglyceride metabolism by inhibiting the lipolysis of
triglyceride-rich lipoproteins. Experimental results show that
ANGPTL4 function to regulate circulating triglyceride levels during
different nutritional states and therefore play a role in lipid
metabolism during feeding/fasting through differential inhibition
of Lipoprotein lipase (LPL). The N-terminal domain of
Angiopoietin-like proteins has been shown to play an active role in
lipid metabolism. Using deletion mutants, it was demonstrated that
the N-terminal domain containing fragment--(17-207) and not the
C-terminal fibrinogen-like domain containing fragment--(207-460)
increased the plasma triglyceride levels in mice. ANGPTL4 has been
identified as a novel paracrine and, possibly, endocrine regulator
of lipid metabolism and a target of peroxisome
proliferators-activated receptors (PPARs). It is expressed in
numerous cell types, such as adipocytes and hepatocytes, and is
upregulated after fasting and hypoxia. Importantly, ANGPTL4
undergoes proteolytic processing to release its C-terminal
fibrinogen-like domain (cANGPTL4), which circulates as a monomer
yet whose function remains unclear. The N-terminal coiled-coil
domain of ANGPTL4 (nANGPTL4) mediates the oligomerization of
ANGPTL4 and binds to lipoprotein lipase to modulate lipoprotein
metabolism. It is now established that the nANGPTL4 mediates its
oligomerization and binds to lipoprotein lipase to modulate
lipoprotein metabolism. In contrast, cANGPTL4 exists as a monomer,
and its function still remains unknown.
[0009] ANGPTL4 was recently linked to tumor progression. The
angiopoietin-like 4 protein (ANGPTL4) has well-studied roles in
metabolism, yet its role in cancer biology remains undefined as a
predictive gene for breast cancer metastasis, where it disrupts
endothelial integrity. However, whether ANGPTL4 promotes or
inhibits vascular permeability, and thus cancer metastasis remains
controversial. There is apparently conflicting results as to the
underlying mechanism of ANGPTL4 activity in tumor cells that have
not been clarified, hampering our understanding of its precise role
in cancer metastasis. The role of ANGPTL4 in cancer biology remains
unesertianed.
SUMMARY
[0010] The present invention seeks to ameliorate the above
mentioned problems by providing composition such as an antibody or
an SiRNA specific to angiopoietin like 4 protein (ANGPTL4) capable
of neutralizing or knocking down the protein to halt or reduce cell
proliferation and methods of making and using the same.
[0011] The invention provides an antagonist to angiopoietin like 4
protein (ANGPTL4) such as an antibody specific to angiopoietin like
4 protein (ANGPTL4) or an SiRNA capable of neutralizing or knocking
down the protein to halt or reduce cell proliferation and methods
of making and using the same.
[0012] The antagonist of the invention is further directed to the C
terminal region of the protein and may be capable of neutralizing
cell proliferation. The antagonist may be a monoclonal antibody and
or a humanized antibody.
[0013] The present invention also provides a method of treating a
patient to at least affect cell proliferation, which comprises the
step of: contacting proliferating cell with an antagonist to
angiopoietin like 4 protein (ANGPTL4). Preferably, the antagonist
comprises (a) an antibody specific to angiopoietin like 4 protein
(ANGPTL4) or (b) an antibody specific to the C terminal region of
angiopoietin like 4 protein (ANGPTL4).
[0014] An alternative form of the present invention resides in the
use of an antaogonist to angiopoietin like 4 protein (ANGPTL4) for
the treatment of a tumor. Preferably, the antagonist comprises an
antibody specific to angiopoietin like 4 protein (ANGPTL4) or an
antibody specific to the C terminal region of angiopoietin like 4
protein (ANGPTL4) preferably the use at least affects growth of the
tumor by either stopping the growth or reducing the size of the
tumor.
[0015] The present invention also relates to compositions including
pharmaceutical compositions comprising a therapeutically effective
amount of an antagonist to angiopoietin like 4 protein (ANGPTL4).
Preferably, the antagonist comprises (a) an antibody specific to or
(b) an antibody specific to the C terminal region of. As used
herein a compound will be therapeutically effective if it is able
to affect cell proliferation.
[0016] The invention also provides a method of diagnosing
proliferative disorders, comprising the steps of the determining an
amount of the angiopoietin like 4 protein (ANGPTL4) protein in body
fluids or tissue sampled from a person suspected of having a
proliferative disorder.
[0017] Accordingly, the methods and compounds described herein may
be used in diagnostic and therapeutic methods. Other aspects and
advantages of the invention will become apparent to those skilled
in the art from a review of the ensuing description, which proceeds
with reference to the following illustrative drawings of preferred
embodiments.
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] FIG. 1. Suppression of ANGPTL4 Impairs Tumorigencity.
[0019] Relative ANGPTL4 mRNA and protein levels in (a) HaCaT, HSC,
II-4 and A-5RT3, (b) A-5RT3.sub.ANGPTL4 and A-5RT3.sub.CTRL as
evaluated by qPCR and immunoblotting. Only the C-terminal
fibrinogen-like fragment of ANGPTL4 was detected. Values
(mean.+-.S.D.) from 5 independent analyses. (c) Tumour size induced
by A-5RT3.sub.ANGPTL4 compared to A-5RT3.sub.CTRL at 8 weeks post
injection. Each circle (mean.+-.S.D.) represents 3 measurements
from each mouse. (d) Immunodetection of proliferation (cyclin D1,
PCNA), and apoptosis (cleaved capsase 3, PARP, Bax) markers in
A-5RT3.sub.ANGPTL4 and A-5RT3.sub.CTRL induced tumors. (e) Tumour
size in mice injected s.c. with A-5RT3.sub.CTRL and treated i.v.
with either mAb11F6C4 or control IgG. Values (mean.+-.S.D.) from 5
mice. *:p<0.05, **:p<0.01. (f) Quantification of
A-5RT3.sub.CTRL and A-5RT3.sub.ANGPTL4 tumour colonies on soft
agar. Values (mean.+-.S.D.) from four assays. (g) Apoptotic cells
(%) after 2h anoikis was analyzed by FACS (events=5000) of three
independent experiments.
[0020] FIG. 2. ANGPTL4 modulates ROS Generation Via Interactions
with Integrins.
[0021] (a) Surface Plasmon resonance sensogram showing
dose-dependent binding profiles of integrin .beta.1 with
immobilized-ANGPTL4 GLC chip. Sensorgram was corrected against a
reference flow cell with no immobilized protein.
K.sub.D.about.10.sup.-7M was determined after global fitting
(Langmuir 1:1 model) using Scrubber2. In situ PLA detection of (b)
ANGPTL4-integrin .beta.1 complexes in indicated tumors;
phosphorylated FAK and 14-3-3/Bad complexes in (c) A-5RT3.sub.CTRL,
and A-5RT3.sub.ANGPTL4 (d) tumors. PLA signals (red) and
Hoechst-stained nuclei (blue); negative control without primary
antibodies. Values (mean.+-.S.D.) from 200 cells using BlobFinder
(Uppsula University). Scale bars 40 .mu.m. *:p<0.05. (e)
Representative immunoblot of total or phosphorylated FAK. ERK and
14-3-3 from indicated tumors. Immunoprecipitation of reduced and
activated c-Src in (f) A-5RT3.sub.ANGPTL4 cells and (g) tumors.
Cells were suspended for 1-2 h (S1 h, S2h). Cell lysates were
labled with 100 .mu.M N-(biotinoyl)-N'-(iodoacetyl)ethylenediamine
to evaluate Src redox state. hHRP-Streptavidin immunoblot performed
on anti-Src immunoprecipitates showed reduced Src.
Immunoprecipitates were probed with anti-Src for normalization.
Activated Src, Na.sup.+/H.sup.- exchanger 1 and catalase were
assessed using cognate antibodies. Representative pictures from
three experiments. (h) Intracellular ROS of A-5RT3.sub.CTRL and
A-5RT3.sub.ANGPTL4 evaluated by 5-(and
6-)-chloromethyl-2',7'-dichlorodihydro-fluorescein diacetate acetyl
ester. Data are normalized to total protein content. (i) Activities
of caspases in A-5RT3.sub.ANGPTL4 after 2 h suspension. Values
(mean.+-.S.D.) represent a fold change above A-5RT3.sub.CTRL (n=3).
*:p<0.05, **:p<0.01.
[0022] FIG. 3--Elevated Expression of ANGPTL4 in Tumors.
[0023] Relative ANGPTL4 protein and mRNA levels in (a) paired human
squamous cell carcinomas (SCC) and peri-tumor normal samples (PNSs)
determined using immunoblotting and qPCR. Values (mean.+-.S.D.)
represent a fold change compared to HaCaT or cognate PNS samples.
For paired human samples, each spot was the mean value of 3
different paraffin sections from an individual sample. Tissues from
same individual are linked by coloured lines. Three SCCs with the
highest ANGPTL4 corresponded to an invasive prognosis. (b)
Expression of ANGPTL4 from laser capture microdisected (LCM)
epithelial tumor and stromal fibroblasts from SSC and PNS.
Hematoxylin and eosin images of SCC section, before and after LCM
of epithelial tumor tissue. Microdissected tissues were processed
for qPCR. Values (mean.+-.S.D.) represent expression level from
5LCM pairs of PNS and SSC. (c) ANGPTL4 expression varies among
solid tumors procured from different anatomic sites. Heatman
profiles generated from immunofluorescence images using IMARIS
(Bitplane Scientific Software). The X-Y axis represents the length
and width, while the Z axis represents the immunofluorescence
intensity. Representative image of normal skin and skin tumor with
its corresponding heatmap was shown. The heatmaps were grouped
horizontally by respective anatomic sites.
[0024] FIG. 4--Suppression of ANGPTL4 in A-5RT3 Cells Impair
Tumorigenicity In Vivo.
[0025] (a) Lentivirus mediated suppression of ANGPTL4 has no off
target effect. mRNA level of 2'5'-oligoadenylate synthetase
isoforms 1 and 2 (OAS1, OAS2), interferon-induced myxovirus
resistance 1 (MX1 and interferon-stimulated transcription factor
3.gamma. (ISGF3.gamma.) in A-5RT3.sub.ANGPTL4 and A-5RT3.sub.CTRL
determined by qPCR. Ribosomal protein L27 was used as a normalizing
housekeeping gene. (b) Representative pictures of A-5RT3.sub.CTRL
and A-5RT3.sub.ANGPTL4 induced tumors in two mice. Total of 5 mice
per group. (c) Immunofluorescence staining of A-5RT3.sub.CTRL and
A-5RT3.sub.ANGPTL4 induced tumors. Hematoxylin and eosin (H&E)
stain of tumor sections. Proliferating (Ki67) and apoptotic (TUNEL-
or cleved caspase 3) cells were identified using indicated
antibodies or assay. Sections were counterstanined with DAPI
(blue). Scale bars 40 .mu.m. (d) Heatmap showing the genes up- and
down regulated in A-5RT3.sub.CTRL and A-5RT3.sub.ANGPTL4 induced
tumors as determined by qPCR. Results were generated from three
pairs of indicated tumors. Detailed description of the genes and
expression in fold changes is in Table 1. (e) ANGPTL4 interaction
kinetic maps for mAbs, shown as association and dissociation rate
constant (K.sub.on and K.sub.off) and a combination of K.sub.on and
K.sub.off that results in the same affinity constant (K.sub.D)
values (diagonal lines) as determined by ProteOn XPR36 (Bio-Rad).
Lables in maps identify the 6 mAb clones. mAb11F6C4 was chosen for
subsequent immunotherapy experiment based on its superior K.sub.on,
K.sub.off and K.sub.D value. (f) Representative pictures of control
IgG- or mAb 11F6C4-treated nude mice injected A-5RT3. Total of 6
mice per group. White arrows indicate injection site.
[0026] FIG. 5--ANGPTL4 Interacts with Integrins .beta.5, but not
.beta.3, In Vitro and In Vivo
[0027] (a) Sensorgram showed binding profiles between different
concentrations of integrin .beta.5 and immobilized ANGPTL4 chip.
Each sensorgram was corrected as described in FIG. 2a. Integrin
.beta.3 at 75 nM did not show any detectable interaction (dotted
red). (b) Dose dependent ANGPTL4 binding to immobilized integrin
.alpha.v.beta.5 (left panel) which was specifically blocked by
anti-cANGPTL4 (right panel) as determined by ELISA. (c) Sensorgrams
showed dose dependant blocking of integrin .beta.1 (upper panel)
and .beta.5 (lower panel) to immobilized ANGPATL4 by pre-injection
with different concentrations of mAb11F6C4. In situ PLA detection
of ANGPTL4-integrin .beta.1 and ANGPTL4-integrin .beta.5 complexes
in (d) A-5RT3.sub.CTRL and A-5RT3.sub.ANGPTL4 (e) A-5RT3.sub.CTRL,
and A-5 RT3.sub.ANGPTL4 induced tumors, and of phosphorylated FAK
and 14-3-3/Bad complexes in (f) A-5RT3.sub.CTRL and
A-5RT3.sub.ANGPTL4. Higher magnification images of 5e in left
panel. PLA signals (red) and Hoechst-stained nuclei (blue).
Negative control was without primary antibodies.
[0028] FIG. 6--Deficiency in ANGPTL4 Induces Apoptosis by
Anoikis.
[0029] (a) Relative ANGPTL4 mRNA and protein levels in
doxycycline-inducible suppression of ANGPTL4 in MDA-MB-231. A
stable MDA-MB-231 cell line that expresses an anti-ANGPTL4 shRNA
(Table 2) was produced using the Knockout Singe Vector System
(Clontech). Cells were grown in the absence (-) or presence (+) of
doxycycline (1 mg/ml) for 24 h. +/- denates the removal of
doxycycline after 24 h doxycycline treatment. Percentage of
apoptotic cells of (b) MDA-MB-231 and (c) 11 different tumor cell
lines after 2 h of forced suspension was evaluated by Annexin
V-FITC/propidium iodide labling followed by FACS analysis (5000
events). MDA-MB-231 cells were treated with doxycycline for 24 h
prior anoikis assay (right panel of (b)). Tumor cell lines were
also exposed to mAb11F6C4 (10 .mu.g/ml). Values (mean.+-.S.D.) from
three independent experiments. All examined tumor cell lines, the
suppression of ANGPTL4 resulted in statistically more apoptotic
cells, *:p<0.05 (student t-test).
[0030] FIG. 7--Deficiency in ANGPTL4 Down Regulates ROS Production
in Tumor Cells.
[0031] ANGPTL4 level was suppressed either by inducible RNAi or by
immunosuppression with mAb11F6C4 (10 .mu.g/ml). Intracellular ROS
production (in fluorescence units) was evaluated by means of
CM-H.sub.2DCFDA fluorescence dye. For MDA-MB-231, ROS was measured
after 24 h treatment with 1 mg/ml doxycycline which suppressed
endogenous ANGPTL4 by 85% (see FIG. 4). Other cells were placed in
suspension for 2 h in the presence of increasing concentrations of
either pre-immune IgG or Ab11F6C4, Values (mean.+-.S.D.) from three
independent experiments. *:p<0.05, **:p<0.01.
[0032] FIG. 8--Deficiency in ANGPTL4 Stimulates Caspases 2, 3, 8
and 9 Activities in Tumor Cell Lines.
[0033] Activities of caspases 2, 3, 6, 8, 9 were measured after 2 h
of anoikis. Fold-increase in caspase activities was calculated by
comparing with the caspase activities with pre-immune IgG or, for
MDA-MB-231 in the absence of doxycycline. Values (mean.+-.S.D.)
from three independent experiments. *:p<0.05, **:p<0.01.
[0034] FIG. 9--The Effect of the Antibody on Vascularisation A and
B
[0035] FIG. 10. Elevated Expression of ANGPTL4 in Various Tumor
Types.
[0036] (A) ANGPTL4 expression varied among tumors procured from
different anatomic sites. Heatmap profiles generated from
immunofluorescence images using IMARIS (Bitplane Scientific
Software). X and Y axes represent the length and width; Z axis
represents immunofluorescence intensity. Representative images of
normal skin and skin tumor samples with their corresponding
heatmaps were shown. The heatmaps from same anatomic sites were
grouped horizontally. Results are representative of two independent
experiments with duplicates. Scale bars represent 200 .mu.m. See
FIG. S1A-C.
[0037] (B) Relative ANGPTL4 mRNA and protein levels in
non-tumorigenic skin line HaCaT and tumorigenic skin lines HSC,
11-4, and A-5RT3. See FIG. 18D.
[0038] (C-D) Relative ANGPTL4 mRNA and protein levels in paired
human squamous cell carcinoma (SCC) (C) or basal cell carcinoma
(BCC) (D) and cognate peri-tumor normal sample (PNS). Skin biopsies
from normal human skin (NS) served as additional controls. Three
SSCs with the highest mRNA ANGPTL4 levels corresponded with an
invasive prognosis. See FIG. 18E.
[0039] (E) Relative mRNA and protein levels of HIF1.alpha. in
paired human SCC and PNS. For qPCR results, data spots from same
individual were linked by coloured lines. See FIG. 18F.
[0040] (B-E) mRNA data shown are mean.+-.SD from two independent
qPCR experiments with triplicates. Ribosomal protein L27 (L27) was
used as reference housekeeping gene. *p<0.05; **p<0.01;
***p<0.001 Immunoblot data was from three independent
experiments with duplicates. For immunoblot, -tubulin served as
loading and transfer control, and only cANGPTL4 was detected for
immunoblot.
[0041] (F) Relative ANGPTL4 mRNA and protein levels in laser
capture microdissected (LCM) epithelial cells and stromal
fibroblasts from paired SCC and PNS. Hematoxylin and eosin images
of SCC section, before and after LCM of epithelial tissue were
shown in the left panel. Scale bars represent 100 .mu.m.
Microdissected tissues were processed for qPCR (middle panel) and
immunoblot (right panel) analyses.
[0042] FIG. 11. Suppression of ANGPTL4 Impairs Tumorigenicity.
[0043] (A) Relative ANGPTL4 mRNA and protein levels in A-5RT3
(parental), A-5RT3.sub.CTRL (scrambled control) and
A-5RT3.sub.ANGPTL4 (knockdown) cells. Data are mean.+-.SD from
three independent qPCR experiments with triplicates. Ribosomal
protein L27 (L27) was used as reference housekeeping gene.
Immunoblot data was from three independent experiments with
duplicates. -tubulin served as loading and transfer control.
***p<0.001; n.s. denotes not significant.
[0044] (B) Size of xenograft tumors induced in nude mice by
5.times.10.sup.5 of A-5RT3.sub.ANGPTL4 or A-5RT3.sub.CTRL after 8
weeks post-inoculation (n=5 each group). Each circle represents
mean size from three measurements on each mouse at wk 8.
***p<0.001. See FIG. 19B.
[0045] (C) Representative pictures of A-5RT3.sub.CTRL and
A-5RT3.sub.ANGPTL4-induced tumors (wk 8) in (B). Black arrows
indicate inoculation sites.
[0046] (D-E) Size of tumor volume induced in ANGPTL-knockout (KO)
and wildtype (WT) mice (D), and PBS- or recombinant
cANGPTL4-treated C57BL/6J WT mice (E) by B16F10 melanoma
(B16F10.sub.CTRL, control) and ANGPTL4-knockdown
(B16F10.sub.ANGPTL4). 1.times.10.sup.6 indicated cells were s.c.
inoculated for each mice. Mice were treated i.v. with either 3
mg/kg of cANGPTL4 or vehicle PBS thrice weekly (n=6 each group)
Values are mean.+-.SEM from three measurements on each mouse.
*p<0.05; **p<0.01; ***p<0.001). See FIG. 19C-D.
[0047] (F) ANGPTL4 interaction kinetic maps for human monoclonal
antibodies (mAbs), shown as association and dissociation rate
constant (k.sub.on and k.sub.off), and a combination of k.sub.on
and k.sub.off that results in the same affinity constant (K.sub.D)
values (diagonal lines) as determined by surface plasmon resonance
(SPR). Labels in maps identify the 6 mAb clones. mAb11F6C4 was
chosen for subsequent immunotherapy experiment based on its
superior k.sub.on, k.sub.off and K.sub.D value.
[0048] (G) Tumor volume in nude mice injected s.c. with
5.times.10.sup.5 of A-5RT3 and treated i.v. with 30 mg/kg/week of
either mAb11F6C4 or control IgG as a function of time (n=6 for each
group). Each circle represents mean.+-.SEM from three measurements
on each mouse. *p<0.05; **p<0.01; ***p<0.001.
[0049] (H) Representative pictures of control IgG- or
mAb11F6C4-treated nude mice (wk 8) as described in (G). White
arrows indicate A-5RT3 inoculation sites
[0050] (I) Immunoblot of proliferation (PCNA and cyclin D1), and
apoptosis (cleaved caspase-3, Bax and cleaved PARP) markers in
A-5RT3.sub.ANGPTL4 and A-5RT3.sub.CTRL-induced tumor biopsies.
Immunoblot data was from three independent experiments with
duplicates. (.beta.-tubulin served as loading and transfer
control
[0051] (J) Hematoxylin and eosin (H&E) and immunofluorescence
staining of A-5RT3.sub.CTRL- and A-5RT3.sub.ANGPTL4-induced tumor
sections. Proliferating (Ki67) and apoptotic (cleaved caspase-3 or
TUNEL) cells were identified using indicated antibodies or assay.
Sections were counterstained with DAPI (blue). Scale bars represent
40 .mu.m.
[0052] (K) Heatmap showing genes up- and down-regulated in
A-5RT3.sub.ANGPTL4-induced tumors relative to
A-5RT3.sub.CTRL-induced tumors as determined by qPCR. Results were
generated from three pairs of indicated tumors. Three independent
qPCR experiments with triplicates were performed. Ribosomal protein
L27 (L27) was used as reference housekeeping gene. Detailed
description of the genes and expression see Table 1.
[0053] (I-K) All experiments were performed using tumor biopsies
harvested from mice described in (B-C) at wk 8.
[0054] FIG. 12. ANGPTL4 Interacts with Integrins 131 and 05 to
Confer Tumor Cells Anoikis Resistance.
[0055] (A) Quantification of A-5RT3.sub.CTRL and A-5RT3.sub.ANGPTL4
tumor colonies on soft agar (left panel). Values (means.+-.SD) were
obtained from four independent assays with triplicates.
**p<0.01. Representative pictures were shown in the right panel.
Scale bars represent 1 mm.
[0056] (B) Percentage of apoptotic A-5RT3.sub.CTRL and
A-5RT3.sub.ANGPT4 after 2 h of anoikis as analyzed by FACS (5000
events). The sum of Annexin V.sup.+/PI.sup.- (early apoptosis) and
Annexin V.sup.+/PI.sup.+ (late apoptosis) cells were considered
apoptotic. Values (bold) denote apoptotic cells (%). Results are
representative of three independent experiments.
[0057] (C) Relative activities of caspases 2, 3, 6, 8, 9 in
A-5RT3.sub.ANGPTL4 compared with A-5RT3.sub.CTRL (assigned value 1)
after 2 h of anoikis. Values (means.+-.SD) were obtained from three
independent experiments with triplicates. *p<0.05,
**p<0.01.
[0058] (D) Percentage of anoikis-induced apoptotic
A-5RT3.sub.ANGPT4 in the presence of increasing exogenous
recombinant cANGPTL4 as analyzed by FACS (5000 events). Vehicle
(PBS) treated A-5RT3.sub.criu, and A-5RT3.sub.ANGPT4 served as
controls for comparison. Apoptotic index as described in (B). See
FIG. 20A-C.
[0059] (E-F) Representative sensorgrams of three independent
experiments showing binding profiles between immobilized-ANGPTL4
and integrin .beta.1 (E) and integrin .beta.5 (F). Integrin .beta.3
at 75 nM did not show any detectable interaction (F, dotted red
line). Sensorgram was corrected against a reference flow cell with
no immobilized protein. K.sub.D-10.sup.-7M was determined after
global fitting (Langmuir 1:1 model) using Scrubber2.
[0060] (G-H) Representative sensorgrams showed dose-dependent
blocking of integrin .beta.1 (G) and integrin .beta.5 (H) to
immobilized-ANGPTL4 by pre-injection with different indicated
concentrations of mAb11F6C4. See FIG. 20D-G.
[0061] (I-J) In situ proximity ligation (PLA) assay detection of
ANGPTL4:integrin .beta.1 (I, left two panels), ANGPTL4:integrin 5
(I, right two panels), and phosphorylated FAK (J) in
A-5RT3.sub.ANGPTL4- and A-5RT3.sub.CTRL-induced tumor biopsies.
Higher magnification images are shown in (H, 2.sup.nd and 4.sup.th
panels; J, right panel). PLA signals are shown in red and nuclei
are stained blue by Hoechst dye. Images were acquired in one
z-plane using a Zeiss LSM710 META confocal laser scanning
microscope. Negative controls were performed with only
anti-nANGPTL4 (I) or anti-FAK (J) antibodies. Scale bars represent
40 .mu.m.
[0062] (K) Immunoprecipitation and immunodetection of ANGPTL4,
integrin .beta.1, integrin .beta.5, total FAK, phosphorylated FAK
(pY397FAK), total Rac1 and GTP-bound Rac1 (GTP-Rac1), from
indicated tumor sections. Configuration-specific monoclonal
anti-Rac-GTP antibody (NewEast Biosciences) was using for
immunoprecipitation GTP-Rac1. Total FAK served as loading and
transfer control. Experiments in (I-K) were performed using tumor
biopsies harvested from A-5RT3.sub.CTRL- or
A-5RT3.sub.ANGPTL4-inoculated (5.times.10.sup.5 cells each) nude
mice at wk 8 (FIG. 11B-C). See FIG. 20H-J. All experiments in (B-K)
were repeated for at least three times with consistent results.
[0063] FIG. 13. ANGPTL4 Elevates O.sub.2.sup.- Level and Maintains
Relatively High O.sub.2.sup.-:H.sub.2O.sub.2 Ratio in Tumor
Cells.
[0064] (A, E and G) Representative electron paramagnetic resonance
(EPR) spectra of DEPMPO-superoxide spin adduct from
A-5RT3.sub.CTRL, and A-5RT3.sub.ANGPTL4 (A), A-5RT3.sub.CTRL- and
A-5RT3.sub.ANGPTL4-induced tumor (E) or MDA-MB-231 (G) in the
absence or presence of indicated chemicals or inhibitors.
MDA-MB-231 cells were treated with mAb11F6C4 (3 or 6 .mu.g/ml) or
control IgG (6 .mu.g/ml). A-5RT3.sub.CTRL, and A-5RT3.sub.ANGPTL4
were transiently transfected with vector expressing Rac1(T17N) or
Rac1(G12V), respectively. A-5RT3.sub.CTRL, A-5RT3.sub.ANGPTL4 and
MDA-MB-231 were transiently transfected with ON-TARGETplus siRNA
(Dharmacon) against either Nox1 (Nox1 kd) or Nox2 (Nox2 kd).
Superoxide adduct of DEPMPO has a hyperfine splitting constants of
a.sub.N=13.13 G; a.sub.P=55.61 G; a.sup..beta..sub.H=13.11 G;
a.sup..gamma..sub.H=0.71, 0.42, 0.7, 0.25, and 0.6 G. See FIG.
21.
[0065] (B, F and H) EPR signal intensity at 3480 G from
A-5RT3.sub.CTRL and A-5RT3.sub.ANGPTL4 in (A), A-5RT3.sub.CTRL- and
A-5RT3.sub.ANGPTL4-induced tumor in (E) or MDA-MB-231 in (G). Tiron
treated measurement served as negative signal control.
[0066] (C and I) Measurement of O.sub.2.sup.- levels using MCLA
assay in A-5RT3.sub.CTRL and A-5RT3.sub.ANGPTL4
[0067] (C), or MDA-MB-231 treated with mAb11F6C4 (3 or 6 .mu.g/ml)
or control IgG (6 .mu.g/ml) (I) in the absence or presence of
indicated chemicals or inhibitors.
[0068] (D and J) Measurement of H.sub.2O.sub.2 levels using Amplex
red assay in A-5RT3.sub.CTRL and A-5RT3.sub.ANGPTL4 (D), or in
MDA-MB-231 treated with mAb11F6C4 (3 or 6 .mu.g/ml) or control IgG
(6 .mu.g/ml) (J). Arbitrary relative O.sub.2.sup.-:H.sub.2O.sub.2
ratios were shown in boxes. See FIGS. 21D and S4F.
[0069] (B-D and F-J) Values were normalized to total proteins and
were presented as mean.+-.SEM as were obtained from three
independent experiments with triplicates. *p<0.05; **p<0.01;
***p<0.001; n.s. represents not significant. Vehicle-treated
A-5RT3.sub.CTRL (B and C), A-5RT3.sub.CTRL-induced tumor (F) and
MDA-MB-231 in the presence of control IgG (6 .mu.g/ml) (H and I)
served as cognate controls.
[0070] (K) Percentage of apoptotic MDA-MB-231 after 2 h of anoikis
as analyzed by FACS (5000 events). Apoptotic index as described in
(FIG. 12B). Values (bold) denote apoptotic cells (%) from three
independent experiments.
[0071] (L) Relative activities of caspases 2, 3, 6, 8, 9 in
mAb11F6C4-treated MDA-MB-231 after 2 h of anoikis. Values
(means.+-.SD) were from three independent experiments with
triplicates. *p<0.05; **p<0.01. Fold-increase in caspase
activities was calculated by comparing with pre-immune IgG-treated
MDA-MB-231.
[0072] FIG. 14. ANGPTL4-Mediated O.sub.2.sup.- Regulates Src and
Promotes PI3K/PKB and ERK Survival Pathways.
[0073] (A and D) Immunoblot of indicated proteins in
A-5RT3.sub.ANGPTL4 and A-5RT3.sub.CTRL-induced tumor biopsies.
Values represent mean fold change from four independent
experiments. c-Src (A) and .beta.-tubulin (D) served as respective
loading and transfer control.
[0074] (B) Immunoblot of indicated proteins in A-5RT3.sub.ANGPTL4
and A-5RT3.sub.CTRL in the absence or presence of 20 .mu.M
diphenylene iodonium (DPI), and in Nox1-knockdown (Nox1 kd)
A-5RT3.sub.ANGPTL4 and A-5RT3.sub.CTRL. Cells were suspended for 0,
1 and 2 h (S0h, S1 h and S2h). Cell lysates were labelled with 100
.mu.M N-(biotinoyl)-N'-(iodoacetyl)ethylenediamine to evaluate Src
redox state. HRP-Streptavidin immunoblot performed on anti-Src
immunoprecipitate showed reduced Src Immunoprecipitate was probed
with anti-c-Src for normalization. Values (mean.+-.SD) represent
mean fold change against value at S0h. Data shown are
representatives of three independent experiments.
[0075] (C) Percentage of apoptotic A-5RT3.sub.ANGPTL4 and
A-5RT3.sub.CTRL cells, treated with either MEK inhibitor PD98059 or
PI3K inhibitors LY294002 and Wortmannin, after 2 h of anoikis
challenge and analyzed by FACS (5000 events). The sum of Annexin
V.sup.+/PI.sup.- and Annexin V.sup.+/PI.sup.+ cells were considered
apoptotic. Values were obtained from three independent
experiments.
[0076] (E) In situ PLA detection of 14-3-3:Bad complexes in
indicated tumor sections and cells. PLA signals were red dots and
Hoechst stained nuclei blue. The cells were counterstained with
Alexa488-phallodin for actin stress fibers (green). Negative
controls were performed with only anti-14-3-3 antibodies. Images
were acquired in one z-plane using a Zeiss LSM710 META confocal
laser scanning microscope. Data shown are representative of three
independent experiments. Scale bars represent 40 .mu.m.
[0077] (F) Mean number of 14-3-3:Bad complexes (as shown in E,
right panel) was calculated from 200 cells (n=3; total 600 cells)
using BlobFinder software. Error bars represent SD.
***p<0.001.
[0078] FIG. 15. ANGPTL4 Maintains Relatively High
O.sub.2.sup.-:H.sub.2O.sub.2 Ratio In Tumor Cells
[0079] Measurement of O.sub.2.sup.- (A) and H.sub.2O.sub.2 (B)
levels in nine different tumor lines. O.sub.2.sup.- was determined
using a chemiluminescence MCLA assay. The level of H.sub.2O.sub.2
was determined using Amplex red assay, in the presence of specific
catalase inhibitor, 3-amino-1,2,4-triazole. Arbitrary relative
O.sub.2.sup.-:H.sub.2O.sub.2 ratios (B) were shown in boxes. Values
(mean.+-.SD) were normalized to total protein content. Three
independent experiments were performed with consistent results.
*p<0.05; **p<0.01.
[0080] FIG. 16. Deficiency of ANGPTL4 Activates Caspase Activities
and Induces Apoptosis Upon Anoikis in Tumor Cells.
[0081] (A) Relative activities of caspases 2, 3, 6, 8, 9 were
measured after 2 h of anoikis. Fold-increase of caspase activities
in mAb11F6C4 (6 .mu.g/ml)-treated cells was calculated by comparing
with the caspase activities treated with pre-immune IgG (6
.mu.g/ml). Values (mean.+-.SD) were obtained from at least three
independent experiments with consistent results. *p<0.05;
**p<0.01.
[0082] (B) Percentage of apoptotic cells of 9 different tumor cell
lines after 2 h of anoikis was evaluated by Annexin
V-FITC/propidium iodide labelling followed by FACS analysis (5000
events). Tumor cells were treated with 10 .mu.g/ml of control IgG
or mAb11F6C4. Apoptotic index was as described in legend of FIG.
12B. Results are representative of at least three independent
experiments. p<0.05.
[0083] (C) Relative ANGPTL4 mRNA (left panel) and protein (middle
panel) levels in MDA-MB-231, whose ANGPTL4 suppression were
doxycycline-inducible. A stable MDA-MB-231 cell line that expresses
an anti-ANGPTL4 shRNA (see supplemental experimental procedures)
was produced using the Knockout Singe Vector System (Clontech).
Cells were grown in the absence (-) or presence (+) of doxycycline
(1 .mu.g/ml) for 24 h. +/- denotes the removal of doxycycline after
24 h doxycycline treatment. The right panel shows percentage of
apoptotic cells of MDA-MB-231 as evaluated by anoikis assay. Data
shown were obtained from three independent experiments with
consistent results.
[0084] FIG. 17. ANGPTL4-Mediated Regulation of O.sub.2.sup.-
Production in Tumor.
[0085] In an autocrine manner, tumor-derived ANGPTL4 specifically
bind to integrins .beta.1 or .beta.5 and subsequently activates the
FAK and Rac1 activities, which further activates the NADPH
oxidase-dependent generation of "onco-ROS" O.sub.2.sup.-, promoting
a relatively high O.sub.2.sup.-:H.sub.2O.sub.2 ratio in tumor
cells. This pro-oxidant intracellular milieu, which may
subsidiarily maintained through NHE, favours cell survival and
proliferation by oxidizing/activating the Src machinery and
therefore stimulates its downstream PI3K/PKB .alpha.- and
ERK-mediated survival pathways. This further triggers the 14-3-3
adaptor protein to sequester the pro-apoptotic Bad from
mitochondria to prevent apoptosis and favour cell survival.
[0086] FIG. 18. Elevated Expression of C-Terminal ANGPTL4
(cANGPTL4) in Tumors, Related to FIG. 10.
[0087] (A and B) Hematoxylin and eosin (H&E) image (A) and
immunofluorescence image probed with anti-cANGPTL4 antibody (B) on
melanoma tumor tissue (representative of the tumor biopsies from
array shown in FIG. 10A). Higher magnification pictures randomly
selected from the melanoma tissue were shown on (A, right panel)
and (B, DAPI on the middle and cANGPTL4 on the right panel),
respectively. The heatmap (B, left bottom panel) was transformed
from the immunofluorescence image (B, right upper panel) based on
the gray value (immunofluorescence intensity) of cANGPTL4 as
described in FIG. 10A. Scale bars represent 200 .mu.m
[0088] (C) Average integrated gray value (immunofluorescence
intensity) of cANGPTL4 from various normal and tumor tissues (also
see FIG. 10A). Tissues from same anatomic site were grouped and
compared. Values (mean.+-.SEM) were calculated from at least three
biopsies and microscopic fields of each tissue. *p<0.05;
**p<0.01
[0089] (D-E) Immunoblot analysis using anti-nANGPTL4 antibody of
tumorigenic skin lines HSC, 11-4, and A-5RT3 (D), and human skin
squamous cell carcinomas (SCCs), basal cell carcinomas (BCCs) and
cognate peri-tumor normal sample (PNS) (E). Liver, non-tumorigenic
skin line HaCaT and normal skin biopsies (NS) served as cognate
positive controls. Coomassie stained blot or .beta.-tubulin served
as loading and transfer control. No full-length or nANGPTL4 was
detected in indicated tumor cell line, BCCs or SCCs. Anti-nANGPTL4
antibody was previously described (Kersten et al., 2000).
[0090] (F) HIF1.alpha. along with ANGPTL4 mRNA levels were
concomitantly up-regulated in SSCs when compared with PNSs with a
Pearson correlation coefficient of 0.88. See the individual mRNA
expression of ANGPTL4 and HIF1.alpha. in SCCs in FIGS. 10C and
10E.
[0091] (G-I) Relative mRNA expressions of peroxisome
proliferator-activated receptor a (PPAR.alpha.) (G), PPAR.delta.
(H) and PPAR.gamma. (I) in paired human squamous cell carcinomas
(SCCs) and peri-tumor normal samples (PNSs) as determined by qPCR.
Data spots from same individual were linked by coloured lines. Data
shown are mean.+-.SD from two independent qPCR experiments with
triplicates. Ribosomal protein L27 (L27) was used as reference
housekeeping gene. n.s. represents not significant in the
comparison between paird SCCs and PNSs.
[0092] FIG. 19. Suppression of ANGPTL4 Reduces Tumorigenicity and
Exogenously Infused cANGPTL4 Accelerates Tumor Growth, Related to
FIG. 11.
[0093] (A) Relative mRNA levels of key interferon response genes:
2',5'-oligoadenylate synthetase isoforms 1 and 2 (Oas1, Oas2),
interferon-induced myxovirus resistance 1 (M.times.1) and
interferon-stimulated transcription factor 3.gamma..gamma.
(Isgf3.gamma.) in A-5RT3 (parental cell), A-5RT3.sub.CTRL
(scrambled control cell) and A-5RT3.sub.ANGPTL4 (ANGPTL4 knockdown
cell). Results shown are mean.+-.SD from three independent qPCR
experiments with triplicates. Ribosomal protein L27 (L27) was used
as reference housekeeping gene. n.s. represents not significant in
the comparisons between A-5RT3 and A-5RT3.sub.ANGPTL4 or between
A-5RT3.sub.CTRL and A-5RT3.sub.ANGPTL4.
[0094] (B) Mean size of xenograft tumors induced in nude mice by
0.5.times., 2.times. and 8.times.10.sup.6 A-5RT3.sub.ANGPTL4 or
A-5RT3.sub.CTRL after 4 weeks post-inoculation (each group). Values
(mean.+-.SEM) were calculated from n=5 (each group) mice.
*p<0.05; ***p<0.001
[0095] (C) Representative pictures of B16F10-induced tumors in
C57BL/6J mice with i.v. treatments of either 3 mg/kg of cANGPTL4 or
control PBS thrice a week and dissected 15 days after injection
(scale bar 10 mm). See also FIG. 11E.
[0096] (D) Immunoblot detection of recombinant cANGPTL4 using
anti-His-tag and anti-cANGTPL4 antibodies. Plasma samples from
C57BL/6J mice 1 day post-treatment with cANGPTL4 or control PBS (as
described in FIG. 11E) were used. Coomassie stained blot served as
loading and transfer control. Experiments were repeated three times
with consistent results.
[0097] FIG. 20. ANGPTL4 Effects on Keratinocytes and its
Interaction with Integrins to Activate FAK, Related to FIG. 12.
[0098] (A) Percentage of anoikis-induced apoptotic skin
keratinocytes and ANGPTL4-deficient keratinocytes in the presence
of increasing exogenous recombinant cANGPTL4 as analysed by FACS
(5000 events). Vehicle(PBS)-treated keratinocytes and
ANGPTL4-deficient keratinocytes served as cognate controls for
comparison. Apoptotic index as described in (FIG. 12B).
[0099] (B-C) Apoptotic index of attached epithelial cells.
A-5RT3.sub.CTRL and A-5RT3.sub.ANGPT4 (B), and skin keratinocytes
and ANGPTL4-deficient keratinocytes (C) were detached by trypsin,
subjected for Annexin V and PI staining, and immediately analysed
by FACS (5000 events). The sum of Annexin V.sup.+/PI.sup.- and
Annexin V.sup.+/PI.sup.+ cells were considered dead. Values (bold)
denote death rate (%).
[0100] (D-G) Dose-dependent ANGPTL4 bindings to immobilized
integrin .alpha.v.beta.5 (D and E) and integrin .alpha.5.beta.1 (F
and G), which were specifically blocked by anti-cANGPTL4 as
determined by ELISA.
[0101] (H) Immunoblot detects no significant difference in the
protein expressions of integrins .beta.1, .beta.5 and .beta.3
between A-5RT3.sub.CTRL and A-5RT3.sub.ANGPTL4 cells.
[0102] (I-J) In situ PLA detection of ANGPTL4:integrin .beta.1 and
ANGPTL4:integrin .beta.5 complexes (I), and of phosphorylated FAK
(J) in A-5RT3.sub.CTRL and A-5RT3.sub.ANGPTL4 cells. PLA signals
are shown in red and nuclei were stained blue by Hoechst dye. The
cells were also counterstained with Alexa488-phallodin for actin
stress fibers (green). Negative controls were performed with only
anti-nANGPTL4 (I) or anti-FAK (J) antibodies. Images were acquired
in one z-plane using a Zeiss LSM710 META confocal laser scanning
microscope. Scale bars represent 40 .mu.m. PLA images are
representative of three independent experiments. Graph (J, right
panel) showed mean number of phosphorylated FAK calculated from 200
A-5RT3.sub.ANGPTL4 and A-5RT3.sub.CTRL cells (n=3; total 600 cells)
using BlobFinder software (Uppsula University). Error bars
represent SD. *p<0.05. All experiments were performed three or
four times with consistent results.
[0103] FIG. 21. Suppression of ANGPTL4, Nox1 and Nox2 in Tumor
Cells, Related to FIG. 13.
[0104] (A) Suppression of ANGPTL4 has no effect in the
methionine/homocysteine metabolic cycle of tumor cells Relative
mRNA level of Bhmt, Mat1a, Ahcy, Khk, Oat and Hacl1 (representative
genes in the methionine/homocysteine metabolic cycle) in
A-5RT3.sub.ANGPTL4 and A-5RT3.sub.CTRL, as determined by qPCR.
[0105] (B) Immunoblot of Nox1 and Nox2 in A-5RT3.sub.CTRL,
A-5RT3.sub.ANGPTL4 and MA-MB-231 cells. .beta.-tubulin served as
loading and transfer control. Representative blots of three
independent experiments were shown.
[0106] (C and E) Relative Nox1 and Nox2 mRNA and protein levels in
A-5RT3.sub.CTRK (scrambled control), A-5RT3.sub.Nox1 (Nox1
knockdown) and A-5RT3.sub.Nox2 (Nox2 knockdown) cells (C), and in
MDA-MB-231.sub.CTRL, (scrambled control), MDA-MB-231.sub.Nox1 (Nox1
knockdown) and MDA-MB-231.sub.Nox2 (Nox2 knockdown) cells (E).
[0107] (D and F) Measurement of H.sub.2O.sub.2 levels using Amplex
red assay in A-5RT3.sub.CTRL and A-5RT3.sub.Nox1 (D), and in
MDA-MB-231.sub.CTRL and MDA-MB-231.sub.Nox1 cells (F).
[0108] (A and C-E) Error bars represent SD from three independent
qPCR experiments with triplicates. Ribosomal protein L27 (L27) was
used as reference housekeeping gene. ***p<0.001; n.s. represents
not significant.
DETAILED DISCLOSURE
[0109] We examined the expression pattern of ANGPTL4 in various
types of human tumor cells and found that an elevated level of
ANGPTL4 is a common feature of many tumor types. Next, we found
that suppression of ANGPTL4, either by RNA interference or
monoclonal antibody, significantly impaired the growth of tumor
cells in vivo and their resistance to anoikis in vitro. Further
study of the underlying mechanism of ANGPTL4 activity led us to
propose that tumor cells express ANGPTL4 to modulate intracellular
O.sub.2.sup.- levels, conferring anoikis resistance to tumor cells
and promoting tumorigenesis and that, therefore, ANGPTL4 is a
potentia
[0110] We showed that only cANGPTL4 was detected and elevated in
many human tumor cells, predominantly secreted by the proliferative
tumor epithelial cells. cANGPTL4 specifically binds to integrins
.beta.1 and .beta.5 on tumor cells and activates the FAK and Rac1,
which further stimulates NADPH oxidase-mediated O.sub.2.sup.-
production by an autocrine pathway. However, it is conceivable that
in tissues/organs expressing high level of cANGPTL4 in proximity to
the tumor site may transmit a paracrine signal.l therapeutic target
in cancer treatment.
[0111] Consistent with the invention there is provided an
antaginost to the angiopoietin like 4 protein (ANGPTL4) such as (a)
an antibody specific to the angiopoietin like 4 protein (ANGPTL4)
and, or (b) an antibody specific to the C terminal of the protein
or (c) SiRNA. Exemplary antibodies include polyclonal, monoclonal,
humanized, bispecific, and heteroconjugate antibodies.
[0112] Antibodies directed to the C terminus of ANGPTL4
demonstrated superior association, dissociation, and affinity
constant. C-teminal expesses fibrinogen-like fragment of
ANGPTL4.
[0113] Here, we found that elevated ANGPTL4 expression is
widespread in tumors, and its suppression impairs tumor growth
associated with enhanced apoptosis. Tumor-derived ANGPTL4 interacts
with integrins to stimulate the NADPH oxidase-dependent production
of O.sub.2.sup.- A high ratio of O.sub.2.sup.-:H.sub.2O.sub.2
oxidizes/activates Src, triggering the PI3K/PKB.alpha. and ERK
pro-survival pathways to confer anoikis resistance, thus promoting
tumor growth. ANGPTL4 deficiency results in diminished
O.sub.2.sup.- production and a reduced O.sub.2.sup.-:H.sub.2O.sub.2
ratio, creating a cellular environment conducive to apoptosis.
Thus, ANGPTL4 is a novel redox factor in cancer biology and a
potential therapeutic target.
[0114] The following embodiments are encompassed by the present
invention:
[0115] An immunoglobulin that specifically binds to the C terminal
of the ANGPTL4 protein.
[0116] The immunoglobulin wherein said immunoglobulin comprises an
immunoglobulin heavy chain.
[0117] The immunoglobulin comprising an immunoglobulin light
chain.
[0118] The immunoglobulin wherein said immunoglobulin is an IgG1
kappa immunoglobulin.
[0119] The immunoglobulin wherein said immunoglobulin comprises a
human IgG1 constant region within a heavy chain of said
immunoglobulin and a human constant region within a light chain of
said immunoglobulin.
[0120] The immunoglobulin wherein said immunoglobulin comprises
fully or partially human framework regions within the variable
domain of said heavy chain and within the variable domain of said
light chain.
[0121] The immunoglobulin wherein said immunoglobulin comprises
murine framework regions within the variable domain of said heavy
chain and within said light chain.
[0122] The immunoglobulin wherein said immunoglobulin is conjugated
to an agent selected from the group consisting of a therapeutic
agent, a prodrug, a peptide, a protein, an enzyme, a virus, a
lipid, a biological response modifier, a pharmaceutical agent, and
PEG.
[0123] A composition comprising the immunoglobulin of the invention
and a carrier.
[0124] A method for preventing or treating proliferative disorders
in a subject comprising administering to said subject an effective
amount of a composition comprising the immunoglobulin of the
invention.
[0125] A pharmaceutical composition comprising the immunoglobulin
of the invention.
[0126] A method of diagnosing a proliferative disorders, comprising
the steps of (a) determining an amount of the angiopoietin like 4
protein (ANGPTL4) protein in body fluids or tissue sampled from a
person suspected of having a proliferative disorder (b) comparing
the amount of the angiopoietin like 4 protein (ANGPTL4) from a
person suspected of having a proliferative disorder with a second
amount sampled from a healthy individual wherein elevated ANGPLT4
in the first sample compared with the second sample is indicative
that a proliferative disorder is present in the person suspected of
having a proliferative disorder.
[0127] A method of diagnosing proliferative disorders in a subject
comprising, removing a sample from the subject, contacting the
sample with a composition of the invention and detecting the
presence of ANGPTL4 wherein elevated ANGPLT4 is a sample compared
with a standard of normal ANGPTL4 expression is indicative that a
proliferative disorder is present in the subject.
Polyclonal Antibodies
[0128] The antibodies of the invention may comprise polyclonal
antibodies. Methods of preparing polyclonal antibodies are known to
the skilled artisan. Polyclonal antibodies can be raised in a
mammal, for example, by one or more injections of an immunizing
agent and, if desired, an adjuvant.
[0129] Typically, the immunizing agent and/or adjuvant will be
injected in the mammal by multiple subcutaneous or intraperitoneal
injections. The intensity of the response is determined by several
factors including the size of the immunogen molecule, its chemical
characteristics, and how different it is from the animal's own
proteins. Most natural immunogens are proteins with a molecular
weight above 5 kDa that come from sources phylogenically far
removed from the host animal (i.e., human proteins injected into
rabbits or goats). It is desirable to use highly purified proteins
as immunogens, since the animal will produce antibodies to even
small amounts of impurities present as well as to the major
component. The antibody response increases with repeated exposure
to the immunogen, so a series of injections at regular intervals is
needed to achieve both high levels of antibody production and
antibodies of high affinity.
[0130] To the extent that the antagonist is an antibody that
engages the c terminal of the fibrinogen-like fragment of ANGPTL4
preventing cell proliferation, the immunogen will be an selected
from amino acids comprising the c terminal of the fibrinogen-like
fragment of ANGPTL4. Preferably, the amino acid sequence will be
selected from the region of about 186-406 in the human ANGPTL4
protein or about 190-410 in the mouse ANGPTL4 protein. Sequences of
at least 5, 6, 7, 8, 9, 10, 15, 20, 25, 30 amino acids from this
region will generally be used to generate those antibodies.
Desirably, the sequence selected will generate an antibody that
specifically interferes with binding of ANGPTL4 to apoptosis
inducing compounds.
[0131] Not all immunogenic molecules will however generate the
level of antibody desired. To increase the intensity of the immune
response immunogens are combined with complex mixtures called
adjuvants. Adjuvants are a mixture of natural or synthetic
compounds that, when administered with antigens, enhance the immune
response. Adjuvants are used to (1) stimulate an immune response to
an antigen that is not inherently immunogenic, (2) increase the
intensity of the immune response, (3) preferentially stimulate
either a cellular or a humoral response (i.e., protection from
disease versus antibody production). Examples of adjuvants which
may be employed include Freund's complete adjuvant and MPL-TDM
adjuvant (monophosphoryl Lipid A, synthetic trehalose
dicorynomycolate). A more extensive discussion of adjuvants and
their use in immunization protocols is given in Immunology Methods
Manual, vol. 2, I. Lefkovits, ed., Academic Press, San Diego,
Calif., 1997, ch. 13 Immunology Methods Manual is available as a
four volume set, (Product Code Z37, 435-0); on CD-ROM, (Product
Code Z37, 436-9); or both, (Product Code Z37, 437-7)
[0132] If the immunogen is still unable to generate an acceptable
response, it may be conjugated to a carrier protein that is more
immunogenic. Small molecules such as drugs, organic compounds, and
peptides and oligosaccharides with a molecular weight of less than
2-5 kDa like, for example, small segments if ANGPTL4 such as those
with a fibrinogen-like fragment in their structure, may not be
immunogenic, even when administered in the presence of adjuvant. In
order to generate an immune response to these compounds, it is
necessary to attach them to a protein or other compound, termed a
carrier that is immunogenic. When attached to a carrier protein the
small molecule immunogen is called a hapten. Haptens are also
conjugated to carrier proteins for use in immunoassays. The carrier
protein provides a means of attaching the hapten to a solid support
such as a microtiter plate or nitrocellulose membrane. When
attached to agarose they may be used for purification of the
anti-hapten antibodies. They may also be used to create a
multivalent antigen that will be able to form large
antigen-antibody complexes. When choosing carrier proteins,
remember that the animal will form antibodies to the carrier
protein as well as to the attached hapten. It is therefore relevant
to select a carrier protein for immunization that is unrelated to
proteins that may be found in the assay sample. If haptens are
being conjugated for both immunization and assay, the two carrier
proteins should be as different as possible. This allows the
antiserum to be used without having to isolate the anti-hapten
antibodies from the anti-carrier antibodies.
[0133] Where the immunizing agent is a fibrinogen-like fragment
segment such as from the c terminal preferably the fibrinogen-like
fragment segment is conjugated to a protein known to be immunogenic
in the mammal being immunized.
[0134] Examples of such immunogenic proteins include but are not
limited to keyhole limpet hemocyanin (KLH), serum albumin, bovine
thyroglobulin, soybean trypsin inhibitor, and a toxoid, for example
tetanus toxoid.
[0135] KLH is a respiratory protein found in molluscs. Its large
size makes it very immunogenic, and the large number of lysine
residues available for conjugation make it very useful as a carrier
for haptens. The phylogenic separation between mammals and molluscs
increases the immunogenicity and reduces the risk of
cross-reactivity between antibodies against the KLH carrier and
naturally occurring proteins in mammalian samples.
[0136] KLH is offered both in its native form, for conjugation via
amines, and succinylated, for conjugation via carboxyl groups.
Succinylated KLH may be conjugated to a hapten containing amine
groups (such as a peptide) via cross-linking with carbodiimide
between the newly introduced carboxyl groups of KLH and the amine
groups of the hapten.
[0137] Protocols for conjugation of haptens to carrier proteins may
be found in Antibodies: A Laboratory Manual, E. Harlow and D. Lane,
ed., Cold Spring Harbor Laboratory (Cold Spring Harbor, N.Y., 1988)
pp. 78-87 (Product Code A 2926)
[0138] The immunization protocol may be selected by one skilled in
the art without undue experimentation. Protocols for preparing
immunogens, immunization of animals, and collection of antiserum
may be found in Antibodies: A Laboratory Manual, E. Harlow and D.
Lane, ed., Cold Spring Harbor Laboratory (Cold Spring Harbor, N.Y.,
1988) pp. 55-120 (Product Code A 2926).
[0139] Monoclonal Antibodies
[0140] The antibodies may, alternatively, be monoclonal antibodies.
Monoclonal antibodies may be prepared using hybridoma methods, such
as those described by Kohler and Milstein (1975), Nature, 256:495.
In a hybridoma method, a mouse, hamster, or other appropriate host
animal, is typically immunized with an immunizing agent as
described above to elicit lymphocytes that produce or are capable
of producing antibodies that will specifically bind to the
immunizing agent. Alternatively, the lymphocytes may be immunized
in vitro.
[0141] Generally, either peripheral blood lymphocytes ("PBLs") are
used if cells of human origin are desired, or spleen cells or lymph
node cells are used if non-human mammalian sources are desired. The
lymphocytes are then fused with an immortalized cell line using a
suitable fusing agent, such as polyethylene glycol, to form a
hybridoma cell. Immortalized cell lines are usually transformed
mammalian cells, particularly myeloma cells of rodent, bovine and
human origin. Usually, rat or mouse myeloma cell lines are
employed. The hybridoma cells may be cultured in a suitable culture
medium that preferably contains one or more substances that inhibit
the growth or survival of the unfused, immortalized cells. For
example, if the parental cells lack the enzyme hypoxanthine guanine
phosphoribosyl transferase (HGPRT or HPRT), the culture medium for
the hybridomas typically will include hypoxanthine, aminopterin,
and thymidine ("HAT medium"), which substances prevent the growth
of HGPRT-deficient cells.
[0142] Preferred immortalized cell lines are those that fuse
efficiently, support stable high level expression of antibody by
the selected antibody-producing cells, and are sensitive to a
medium such as HAT medium. More preferred immortalized cell lines
are murine myeloma lines, which can be obtained, for instance, from
the Salk Institute Cell Distribution Center, San Diego, Calif. and
the American Type Culture Collection, Manassas, Va. Human myeloma
and mouse-human heteromyeloma cell lines also have been described
for the production of human monoclonal antibodies (Kozbor, J.
(1984) Immunol., 133:3001).
[0143] The culture medium in which the hybridoma cells are cultured
can then be assayed for the presence of monoclonal antibodies
directed against ANGPTL4 and/or the c terminal of ANGPTL4 or any of
the sequences SEQ ID No. 1 to 3.
[0144] After the desired hybridoma cells are identified, the clones
may be subcloned by limiting dilution procedures and grown by
standard methods. Suitable culture media for this purpose include,
for example, Dulbecco's Modified Eagle's Medium and RPMI-1640
medium. Alternatively, the hybridoma cells may be grown in vivo as
ascites in a mammal.
[0145] The monoclonal antibodies secreted by the subclones may be
isolated or purified from the culture medium or ascites fluid by
conventional immunoglobulin purification procedures such as, for
example, protein A-Sepharose, hydroxylapatite chromatography, gel
electrophoresis, dialysis, or affinity chromatography.
[0146] The monoclonal antibodies may also be made by recombinant
DNA methods, such as those described in U.S. Pat. No.
4,816,567.
[0147] The antibodies may be monovalent antibodies. Methods for
preparing monovalent antibodies are well known in the art. For
example, one method involves recombinant expression of
immunoglobulin light chain and modified heavy chain. The heavy
chain is truncated generally at any point in the Fc region so as to
prevent heavy chain cross-linking. Alternatively, the relevant
cysteine residues are substituted with another amino acid residue
or are deleted so as to prevent cross-linking.
[0148] In vitro methods are also suitable for preparing monovalent
antibodies. Digestion of antibodies to produce fragments thereof,
particularly, Fab fragments, can be accomplished using routine
techniques known in the art.
Human and Humanized Antibodies
[0149] The antibodies of the invention may further comprise
humanized antibodies or human antibodies. Humanized forms of
non-human (e.g., murine) antibodies are chimeric immunoglobulins,
immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab',
F(ab').sub.2 or other antigen-binding sub-sequences of antibodies)
which contain minimal sequence derived from non-human
immunoglobulin. Humanized antibodies include human immunoglobulins
(recipient antibody) in which residues from a complementary
determining region (CDR) of the recipient are replaced by residues
from a CDR of a non-human species (donor antibody) such as mouse,
rat or rabbit having the desired specificity, affinity and
capacity. In some instances, Fv framework residues of the human
immunoglobulin are replaced by corresponding non-human residues.
Humanized antibodies may also comprise residues which are found
neither in the recipient antibody nor in the imported CDR or
framework sequences. In general, the humanized antibody will
comprise substantially all of at least one, and typically two,
variable domains, in which all or substantially all of the CDR
regions correspond to those of a non-human immunoglobulin and all
or substantially all of the FR regions are those of a human
immunoglobulin consensus sequence. The humanized antibody optimally
also will comprise at least a portion of an immunoglobulin constant
region (Fc), typically that of a human immunoglobulin.
[0150] Methods for humanizing non-human antibodies are well known
in the art. Generally, a humanized antibody has one or more amino
acid residues introduced into it from a source which is non-human.
These non-human amino acid residues are often referred to as
"import" residues, which are typically taken from an "import"
variable domain. Humanization can be essentially performed
following the method of Winter and co-workers [Jones et al., (1986)
Nature, 321:522-525; Riechmann et al., (1988) Nature, 332:323-327;
Verhoeyen et al., (1988) Science 239:1534-1536], by substituting
rodent CDRs or CDR sequences for the corresponding sequences of a
human antibody. Accordingly, such "humanized" antibodies are
chimeric antibodies (U.S. Pat. No. 4,816,567), wherein
substantially less than an intact human variable domain has been
substituted by the corresponding sequence from a non-human species.
In practice, humanized antibodies are typically human antibodies in
which some CDR residues and possibly some FR residues are
substituted by residues from analogous sites in rodent
antibodies.
[0151] Human antibodies can also be produced using various
techniques known in the art, including phage display libraries
[Hoogenboom and Winter, J. (1991) Mol. Biol., 227:381; Marks et
al., (1991) J. Mol. Biol., 222:581]. The techniques of Cole et al.
and Boerner et al. are also available for the preparation of human
monoclonal antibodies (Cole et al., (1985) Monoclonal Antibodies
and Cancer Therapy, Alan R. Liss, p. 77 and Boerner et al., (1991)
J. Immunol., 147(1):86-95]. Similarly, human antibodies can be made
by introducing of human immunoglobulin loci into transgenic
animals, e.g., mice in which the endogenous immunoglobulin genes
have been partially or completely inactivated. Upon challenge,
human antibody production is observed, which closely resembles that
seen in humans in all respects, including gene rearrangement,
assembly, and antibody repertoire. This approach is described, for
example, in U.S. Pat. Nos. 5,545,807; 5,545,806; 5,569,825;
5,625,126; 5,633,425; 5,661,016, and in the following scientific
publications: Marks et al., (1992) Bio/Technology 10, 779-783;
Lonberg et al., (1994) Nature 368 856-859; Morrison, (1994) Nature
368, 812-13; Fishwild et al., (1996) Nature Biotechnology 14,
845-51; Neuberger, (1996) Nature Biotechnology 14, 826; Lonberg and
Huszar, (1995) Intern. Rev. Immunol. 13 65-93.
[0152] Bispecific Antibodies
[0153] Bispecific antibodies are monoclonal, preferably human or
humanized, antibodies that have binding specificities for at least
two different antigens. In the present case, one of the binding
specificities is for ANGPTL4 and/or a segment of ANGPTL4 comprising
portions of the c terminal of the fibrinogen-like fragment of
ANGPTL4, the other one is for another compound having ANGPTL4.
[0154] Methods for making bispecific antibodies are known in the
art. Traditionally, the recombinant production of bispecific
antibodies is based on the co-expression of two immunoglobulin
heavy-chain/light-chain pairs, where the two heavy chains have
different specificities [Milstein and Cuello, (1983) Nature,
305:537-539].
[0155] Heteroconjugate Antibodies
[0156] Heteroconjugate antibodies are also within the scope of the
present invention. Heteroconjugate antibodies are composed of two
covalently joined antibodies. Such antibodies have, for example,
been proposed to target immune system cells to unwanted cells [U.S.
Pat. No. 4,676,980], and for treatment of HIV infection [WO
91/00360; WO 92/200373; EP 03089]. It is contemplated that the
antibodies may be prepared in vitro using known methods in
synthetic protein chemistry, including those involving crosslinking
agents. For example, immunotoxins may be constructed using a
disulfide exchange reaction or by forming a thioether bond.
Examples of suitable reagents for this purpose include
iminothiolate and methyl-4-mercaptobutyrimidate and those
disclosed, for example, in U.S. Pat. No. 4,676,980.
Immunoconjugates
[0157] The invention also pertains to immunoconjugates comprising
an antibody conjugated to a cytotoxic agent such as a
chemotherapeutic agent, toxin (e.g., an enzymatically active toxin
against hemagglutinin), or a radioactive isotope (i.e., a
radioconjugate).
[0158] Conjugates of the antibody and cytotoxic agent are made
using a variety of bifunctional protein-coupling agents such as
N-succinnimidyl-3-(2-pyridyldithiol) propionate (SPDP),
iminothiolane (IT), bifunctional derivatives of imidoesters (such
as dimethyl adipimidate HCL), active esters (such as disuccinimidyl
suberate), aldehydes (such as glutareldehyde), bis-azido compounds
(such as bis(p-azidobenzoyl)hexanediamine), bis-diazonium
derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine),
diisocyanates (such as tolyene 2,6-diisocyanate), and bis-active
fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene).
Method of Treatment and or Use of the Antibodies of the
Invention
[0159] The present invention also provides a method of treating a
patient to at least affect a proliferative disorder, which
comprises the step of: contacting a cell with an antagonist such as
(a) an antibody specific to angiopoietin like 4 protein (ANGPTL4)
or (b) an antibody specific to the C terminal region of
angiopoietin like 4 protein (ANGPTL4). Preferably, the antagonist
interferes with cell proliferation by means that neutralize
angiopoietin like 4 protein (ANGPTL4) expression.
[0160] An alternative form of the present invention resides in the
use of an antibody specific angiopoietin like 4 protein (ANGPTL4)
or an antibody specific to the C terminal region of angiopoietin
like 4 protein (ANGPTL4) for the treatment of cancer, preferably
the use at least affects cell proliferation.
[0161] Cancer may include, all types of known tumors that exhibit
over expression of angiopoietin like 4 protein (ANGPTL4). Cell
proliferating or tumor refers to cells that are growing
uncontrollably.
[0162] "Treatment" and "treat" and synonyms thereof refer to
therapeutic treatment wherein the object is to prevent or slow down
(lessen) a tumor. Treatment may include prophylactic passive
immunization or immunotherapy treatment of a patent. Those in need
of such treatment include those with a proliferative disorder.
[0163] As used herein a "therapeutically effective amount" of a
compound will be an amount of active agent that is capable of
preventing or at least slowing down (lessening) cell proliferation
or tumerogenesis. Dosages and administration of an antagonist of
the invention in a pharmaceutical composition may be determined by
one of ordinary skill in the art of clinical pharmacology or
pharmacokinetics. See, for example, Mordenti and Rescigno, (1992)
Pharmaceutical Research, 9:17-25; Morenti et al., (1991)
Pharmaceutical Research, 8:1351-1359; and Mordenti and Chappell,
"The use of interspecies scaling in toxicokinetics" in
Toxicokinetics and New Drug Development, Yacobi et al. (eds)
(Pergamon Press: NY, 1989), pp. 42-96. An effective amount of the
antagonist to be employed therapeutically, for example an antibody,
will depend, for example, upon the therapeutic objectives, the
route of administration, and the condition of the mammal.
Accordingly, it will be necessary for the therapist to titer the
dosage and modify the route of administration as required to obtain
the optimal therapeutic effect. A typical daily dosage might range
from about 10 ng/kg to up to 100 mg/kg of the mammal's body weight
or more per day, preferably about 1 .mu.g/kg/day to 10 mg/kg/day.
Doses may include an antibody amount any where in the range of 0.1
to 20 mg/kg of bodyweight or more preferably 1, 5, 10 mg/kg of
bodyweight.
Compositions of the Invention
[0164] Antibodies produced according to the invention, can be
administered for the treatment of cell prloferation, tumoregenisis,
metastesis, or cancer in the form of pharmaceutical
compositions.
[0165] Thus, the present invention also relates to compositions
including pharmaceutical compositions comprising a therapeutically
effective amount of (a) an antibody specific to angiopoietin like 4
protein (ANGPTL4) and, or (b) an antibody specific to the C
terminal region of angiopoietin like 4 protein (ANGPTL4). As used
herein a compound will be therapeutically effective if it is able
to affect cell proliferation.
[0166] Pharmaceutical forms of the invention suitable for
injectable use include sterile aqueous solutions such as sterile
phosphate-buffered saline (where water soluble) or dispersions and
sterile powders for the extemporaneous preparation of sterile
injectable solutions and or one or more carrier. Alternatively,
injectable solutions may be delivered encapsulated in liposomes to
assist their transport across cell membrane. Alternatively or in
addition such preparations may contain constituents of
self-assembling pore structures to facilitate transport across the
cellular membrane. It must be stable under the conditions of
manufacture and storage and must be preserved against the
contaminating/destructive action of microorganisms such as, for
example, bacteria and fungi.
[0167] The carrier can be a solvent or dispersion medium
containing, for example, water, ethanol, polyol (for example,
glycerol, propylene glycol and liquid polyethylene glycol, and the
like), suitable mixtures thereof, and vegetable oils. The proper
fluidity can be maintained, for example, by the use of a coating
such as, for example, lecithin, by the maintenance of the required
particle size in the case of dispersion and by the use of
surfactants. Preventing the action of microorganisms in the
compositions of the invention is achieved by adding antibacterial
and/or antifungal agents, for example, parabens, chlorobutanol,
phenol, sorbic acid, thimerosal and the like. In many cases, it
will be preferable to include isotonic agents, for example, sugars
or sodium chloride. Prolonged absorption of the injectable
compositions can be brought about by the use in the compositions of
agents delaying absorption, for example, aluminum monostearate and
gelatin.
[0168] Sterile injectable solutions are prepared by incorporating
the active compounds in the required amount in the appropriate
solvent with several of the other ingredients enumerated above, as
required, followed by filtered sterilization. Generally,
dispersions are prepared by incorporating the various sterilized
active ingredient into a sterile vehicle which contains the basic
dispersion medium and the required other ingredients from those
enumerated above. In the case of sterile powders for the
preparation of sterile injectable solutions, the preferred methods
of preparation are vacuum drying and freeze-drying, to yield a
powder of the active ingredient plus any additional desired
ingredient from previously sterile-filtered solution thereof.
[0169] The active ingredient may be held within a matrix which
controls the release of the active agent. Preferably, the matrix
comprises a substance selected from the group consisting of lipid,
polyvinyl alcohol, polyvinyl acetate, polycaprolactone,
poly(glycolic)acid, poly(lactic)acid, polycaprolactone, polylactic
acid, polyanhydrides, polylactide-co-glycolides, polyamino acids,
polyethylene oxide, acrylic terminated polyethylene oxide,
polyamides, polyethylenes, polyacrylonitriles, polyphosphazenes,
poly(ortho esters), sucrose acetate isobutyrate (SAIB), and
combinations thereof and other polymers such as those disclosed in
U.S. Pat. Nos. 6,667,371; 6,613,355; 6,596,296; 6,413,536;
5,968,543; 4,079,038; 4,093,709; 4,131,648; 4,138,344; 4,180,646;
4,304,767; 4,946,931, each of which is expressly incorporated by
reference herein in its entirety. Preferably, the matrix
sustainedly releases the antibody.
[0170] Pharmaceutically acceptable carriers and/or diluents may
also include any and all solvents, dispersion media, coatings,
antibacterials and/or antifungals, isotonic and absorption delaying
agents and the like. The use of such media and agents for
pharmaceutical active substances is well known in the art. Except
insofar as any conventional media or agent is incompatible with the
active ingredient, use thereof in the therapeutic compositions is
contemplated.
PREFERRED EMBODIMENTS
[0171] The angiopoietin-like 4 sustains an elevated pro-survival
intracellular O.sub.2.sup.-:H.sub.2O.sub.2 ratio and confers
anoikis resistance to tumor.
[0172] Tumor regression in malignant cancers remain a most
significant anticancer strategy. Here we showed that elevated
ANGPTL4 expression is widespread in tumors, and its suppression
impairs tumor growth associated with enhanced apoptotis. ANGPTL4
interacts with integrins to modulate intracellular ROS generation
that confers anoikis resistance and sustains tumor growth,
underscoring ANGPTL4 as a novel player in redox cancer biology, a
tumor biomarker, and thus a potential therapeutic target.
[0173] Our results demonstrate that tumor-derived ANGPTL4 confers
anoikis resistance to tumors via autocrine adhesion mimicry. We
show that elevated expression of ANGPTL4 is widespread in tumors.
Our findings, that ANGPTL4 hijacks integrin-mediated signaling to
maintain an elevated, oncogenic O.sub.2.sup.-:H.sub.2O.sub.2 ratio
to confer anoikis resistance to tumor cells, identify ANGPTL4 as a
novel factor in redox cancer biology and suggest anticancer
strategies focused on redox-based apoptosis induction in tumors.
Treatment of cancer cells with ANGPTL4-targeted RNAi or monoclonal
antibodies imparts a significant decrease in in vivo tumor growth
and induces apoptosis in 10 different cancer cell lines upon
anoikis challenge. These findings should appeal to a broad audience
of clinicians, cancer biologists, molecular biologists and drug
designers.
Highlights
[0174] Elevated expression of ANGPTL4 is a common feature of many
human tumor types.
[0175] ANGPTL4 binds integrin to stimulate the NADPH
oxidase-dependent production of O.sub.2.sup.-.
[0176] ANGPTL4 sustains a high O.sub.2.sup.-:H.sub.2O.sub.2 ratio
to activate pro-survival pathways.
[0177] Suppression of ANGPTL4 impairs tumor growth and enhances
anoikis/apoptosis.
[0178] Analysis of human tumor cell lines (FIG. 1a), squamous cell
carcinoma biopsies (SCC) and tumor tissue arrays (FIG. 3) revealed
a widespread elevated ANGPTL4 mRNA and protein in epithelial
tumors, regardless of anatomical site. ANGPTL4 expression increases
as tumors progress from begnign to invessive/metastatic state. To
assess the role of ANGPTL4 in tumorigenesis, we suppressed it by
RNAi in a highly metastatic skin tumor cell, A-5RT3 (FIG. 3b, FIG.
4a), generating the A-5RT3.sub.ANGPTL4 line. Injection of
A-5RT3.sub.ANGPTL4 line into immunodeficient mice yielded
.about.90% tumor regression, associated with increased apoptosis
and reduced cell proliferation, compared to control
A-5RT3.sub.CTRL. (FIG. 1c, 1d, 4b, 4c). qPCR-focused array of
A-5RT3.sub.ANGPTL4 tumor displayed increased expression of many
pro-apoptotic genes, whilst cell proliferation genes were reduced
(FIG. 4d). Notably, immunosuppression of ANGPTL4 with a monoclonal
antibody, mAb11F6C4, significantly attenuated in vivo tumor growth
(FIG. 1e, 4e, 4f). A-5RT3.sub.ANGPTL4 formed 4-fold lower tumor
colonies on soft agar (FIG. 10 and were more suceptable to anoikis
resistance, with 40% more apoptosis within 2 h (FIG. 1g).
[0179] We hypothesized that ANGPTL4 modulates oxidative stress of
tumor via integrin-mediated signaling. ANGPTL4 interacted with
integrins 131 and .beta.5 but not with .beta.3 (FIG. 2a, 5a, 5b),
which were blocked by either mAb11F6C4 or integrin-specific
antibodies (FIG. 5 c) In situ proximity ligation assay detected
ANGPTL4-integrin complexes in vivo (FIG. 2b,5d, 5e). Integrin
activation triggered focal adhesion kinase (FAK) in A-5RT3.sub.CTRL
cells and tumors, which were reduced by .about.70% in
A-5RT3.sub.ANGPTL4 (FIG. 2c, 2d). The expression of phosphorylated
ERK1 (FIG. 2e) and the number of 14-3-3/Bad complexes (FIG. 2c, 2d,
5f) were reduced by .about.85%, with 80% reduction of the
14-3-3.beta./.sigma. proteins in the A-5RT3.sub.ANGTL4 induced
tumors (FIG. 2e). The 14-3-3 adaptor protein sequesters
pro-apoptotic Bad from mitochondria to prevent apaptosis (11).
Further analysis showed diminished oxidized/activated Src (8),
Na+/H_exchanger 1 (12), and increased catalase in
A-5RT3.sub.ANGPTL4 (FIG. 2f, 2g), suggesting that ANGPTL4 modulates
ROS generation for tumor survival.
[0180] To underscore the prevalence of ANGPTL4 in ROS generation in
tumors, we examined the impact of reduced ANGPTL4 against anoikis
in 12 tumor cell lines. The suppression of ANGPTL4, either by
constitutive (FIG. 1g), inducible (FIG. 6a 6b) RNAi or
immunosuppression with mAb11F6C4 (FIG. 6c) resulted in 30%-60% more
apoptosis within 2 hours. High intracellular ROS were reduced
dose-dependantly by ANGPTL4 suppression (FIG. 2h, FIG. 7)
Importanly, caspases 2, 3, 8, and 9 activities were increased by
3-8-fold (FIG. 2i; FIG. 8), indicating reduced anoikis
resistance.
[0181] Altogether, ANGPTL4 is a candidate biomarker for human
tumors, predominantly produced by epithelial tumor cells and a
novel player in redox cancer biology. ANGPTL4 interacts with
integrins to modulate ROS production, confers anoikis resistance to
promote tumerogenesis, and is thus a potential therapeutic
target.
[0182] It is known that in response to microenvironmental stress,
such as hypoxia and inflammation, tumor cells exploit various
signaling molecules to promote their growth, invasiveness and
metastasis. The loss of dependence on integrin-mediated ECM contact
for growth (or anoikis resistance) is an essential feature of tumor
cells, yet how it is acquired is a central problem in cancer
biology. Our study demonstrates a novel role for tumor-secreted
ANGPTL4, which confers anoikis resistance to tumors via an
autocrine adhesion mimicry that stimulates a redox-based
pro-survival pathway (FIG. 17). Tumor-secreted ANGPTL4 interacts
with integrins in an autocrine fashion to stimulate the NADPH
oxidase-dependent generation of O.sub.2.sup.-, promoting a high
O.sub.2.sup.-:H.sub.2O.sub.2 ratio, and consequently activating
downstream PI3K/PKB.alpha. and ERK activities. Our findings
identify ANGPTL4 as an important novel redox player in cancer
biology and suggest that anticancer therapeutics focused on
redox-based apoptosis induction in tumors represent an exciting and
viable strategy.
[0183] The full-length ANGPTL4 is proteolytically cleaved, giving
rise to the N-terminal coiled-coil domain (nANGPTL4) and the
C-terminal fibrinogen-like domain (cANGPTL4). Depending on the
tissue examined, differential expression of the various domains of
ANGPTL4 was observed (Kersten et al., 2000). These observations
raise the intriguing possibility that the different domains of
ANGPTL4 have distinct biological functions. Furthermore, how
cANGPTL4 triggers intracellular signaling to propagate its effect
remains an unsolved question, hampering our understanding of the
role of ANGPTL4.
[0184] We showed that only cANGPTL4 was detected and elevated in
many human tumor cells, predominantly secreted by the proliferative
tumor epithelial cells. cANGPTL4 specifically binds to integrins
.beta.1 and .beta.5 on tumor cells and activates the FAK and Rac1,
which further stimulates NADPH oxidase-mediated O.sub.2.sup.-
production by an autocrine pathway. However, it is conceivable that
in tissues/organs expressing high level of cANGPTL4 in proximity to
the tumor site may transmit a paracrine signal. Although integrins
alone are not oncogenic, integrin-mediated signalings are often
required to enable tumor survival and influence tumor growth
(Desgrosellier and Cheresh, 2010). Our findings show that
ANGPTL4-mediated integrin engagement activates ROS production,
which leads to a pro-survival signal and sustained
anchorage-related signals even in the absence of ECM and cell
contact. The pro-oxidant intracellular environment leads to
redox-mediated activation of the Src machinery, and therefore
stimulates downstream PI3K/PKB.alpha. and ERK pro-survival
pathways, which further triggers the 14-3-3 adaptor protein to
sequester the pro-apoptotic Bad from mitochondria, which confers
resistance to anoikis and favors tumor survival and growth. More
importantly, our findings indicating that cANGPTL4 can modulate
integrin-mediated signaling, are a pivotal step toward a better
mechanistic understanding of the role of ANGPTL4.
[0185] A cell's fate is determined by the cellular redox state,
through a complicated regulation mechanism, delicately maintained
by intracellular ROS generators and antioxidant enzyme systems. Low
or transient levels of intracellular ROS stimulate cellular signals
essential for normal cellular functions. The dysregulation of
intracellular ROS levels, resulting in excessive level or
persistent elevation of ROS have been linked to tumor growth,
invasiveness and metastasis. Indeed, elevated levels of ROS have
been detected in almost all cancers (Liou and Storz, 2010). An
elevated O.sub.2.sup.- or O.sub.2.sup.-:H.sub.2O.sub.2 ratio is
particularly important for cancer cells to sustain their
tumorigenicity and metastatic potential (Clement and Pervaiz, 2001;
Pervaiz and Clement, 2007). Indeed, the disruption of
ANGPTL4-mediated redox signaling via genetic and antibody-mediated
suppression of ANGPTL4 essentially reduced the activities of FAK,
Rac1 and O.sub.2.sup.- production. These changes resulted in an
increase in tumor cells' sensitivity to anoikis and impaired
tumorigenesis. ANGPTL4-stimulated NADPH oxidase activity, leading
to O.sub.2.sup.- production, can be inhibited by DPI and apocynin,
two structurally and functionally distinct NADPH oxidase
inhibitors, but not by the mitochondrial complex I inhibitor
rotenone, suggesting that O.sub.2.sup.- was "purposely" produced by
enzymatic NADPH oxidase, rather than as a by-product of
mitochondrial activity. Two survival pathways--the PKB.alpha. and
ERK, which have been shown to exert anoikis-suppressing effects,
were complementarily employed by ANGPTL4 to confer resistance to
anoikis in tumor cells.
[0186] The tumor microenvironment plays a pivotal role in
modulating gene expression and epithelial tumor cells' behavior.
The tumor-promoting role of inflammation in the tumor
microenvironment are well-recognized. The nuclear hormone receptors
PPAR, in particular PPAR.gamma. and .delta./.beta.isotypes, play
major roles in the regulation of inflammation, and have been
implicated in tumorigenesis (Peters and Gonzalez, 2009; Wagner and
Wagner, 2010; Panigrahy et al., 2005; Murphy and Holder, 2000).
Although, in our analysis of paired PNSs and SSCs, we did not
observe any correlation between the expression of either
PPAR.gamma. or .delta./.beta. and their target gene ANGPTL4, we
cannot exclude their involvement and/or other oncogenic pathways or
cell types in the tumor microenvironment that enhanced the
expression of cANGPTL4 in tumors. It is also conceivable that PPARs
in cancer-associated fibroblasts play a more dominant role in the
regulation of epithelial tumor growth. Indeed, we showed that PPAR
.beta./.delta.-deficient fibroblasts can increase the proliferation
of normal epithelial cells and SCCs via regulating interleukin-1
signaling pathway. The activation of interleukin-1 signaling was
reported to enhance the growth of tumors, whereas its repression by
the interleukin-1 receptor antagonist has an anti-tumor effect. A
dysregulated inflammatory response can promote tumoriogenesis and
maglinancy by stimulating ROS production. Although not examined in
this study, we cannot rule out the possibility that other producers
of O.sub.2.sup.-, such as cytosolic 5-lipooxygenase, which also
requires Rac 1 activation to function, may act in conjunction with
ANGPTL4-stimulated NADPH oxidase activity to maintain an elevated
intracellular O.sub.2.sup.- level for tumor growth.
[0187] In summary, we provided evidence that tumor cells employ
ANGPTL4 to hijack integrin-mediated signaling that modulates
intracellular O.sub.2.sup.- levels to confer anoikis resistance to
tumor cells and to enhance tumorigenesis. Our findings identify
ANGPTL4 as a novel tumor biomarker and redox factor in cancer
biology, making ANGPTL4 a potential therapeutic target in cancer
treatment.
Elevated Expression of ANGPTL4 in Various Tumor Types.
[0188] To examine the expression profile of ANGPTL4 in known human
tumors, we first screened its expression pattern on two
commercially available human tumor tissue arrays, which cover most
of the common benign, malignant and metastatic tumors originating
from various anatomic sites. By immunofluorescence with an
anti-cANGPTL4 antibody, we observed a widespread elevated
expression of ANGPTL4 in all epithelial tumor samples compared with
the corresponding normal tissues, regardless of anatomical site of
origin (FIGS. 10A and 18A-B). The level of immunofluorescence
signal, however, varied among different types of tumor. Notably,
the expression of ANGPTL4 increases as tumors progress from a
benign state to an invasive/metastatic state (FIG. 18C). Next, we
determined the expression of ANGPTL4 on three human skin
tumorigenic lines (HSC, 11-4 and A-5RT3), 10 human squamous cell
carcinoma biopsies (SCCs) and 13 basal cell carcinoma biopsies
(BCCs) by quantitative real-time PCR (qPCR) and immunoblot
analyses. Consistent with our prior results, we observed
significant upregulation of ANGPTL4 mRNA and protein levels in
these epithelial tumor cells when compared with the non-tumorigenic
human skin line HaCaT or cognate peri-tumor normal samples (PNSs),
respectively (FIGS. 10B-D). No difference was observed between
normal skin biopsies (NS) and PNS (FIGS. 10C-D). Interestingly, the
three SCCs expressing the highest mRNA level of ANGPTL4
corresponded with an invasive prognosis (FIG. 10C), underscoring
our finding in tumor tissue arrays. In addition, polyclonal
antibodies against either the N- or C-termini of ANGPTL4 detected
only the cANGPTL4 in these tumor lines and SSCs (FIGS. 10B-D and
18D-E). The expression of ANGPTL4 is upregulated by hypoxia and by
peroxisome-proliferator activated receptors (PPARs). To understand
the reason for the increased expression of ANGPTL4 in tumor cells,
we examined the expression of hypoxia-inducible factor 1 alpha
(HIF1.alpha.) and PPARs in the SCC samples. We found a concomitant
upregulation of HIF1.alpha. along with ANGPTL4 in SSCs when
compared with PNSs and with a Pearson correlation coefficient of
0.88 (FIGS. 10E and 18F). Although no clear correlation was
observed between the expression of ANGPTL4 and the three PPAR
isotypes (FIGS. 18G-I), we cannot exclude an involvement of PPARs
and/or other oncogenic pathways that enhanced the expression of
cANGPTL4 in tumors. These results suggested that, at least for SCC,
the elevated expression of ANGPTL4 reflected the tumor's hypoxic
microenvironment. Being a secreted protein highly detected in tumor
cells, ANGPTL4 may perform an important paracrine or autocrine
function in tumors. Therefore, we sought to determine the source of
ANGPTL4 in tumors. We isolated epithelial tumor and stromal
tissues, which consist mainly of fibroblasts, from SCCs and PNSs,
using laser capture microdissection (LCM). qPCR and immunoblot
analyses were performed on these samples. Our results revealed that
epithelial tumor cells, rather than tumor stroma, were the major
contributor of ANGPTL4 in SCCs (FIG. 10F), and only a low, baseline
level of ANGPTL4 expression was found in normal PNS stroma and
epithelia, suggesting that ANGPTL4 may have an autocrine role in
tumors.
[0189] Suppression of ANGPTL4 Impairs in Vivo Tumor Growth.
[0190] Our findings revealed an elevated expression level of
ANGPTL4 in tumors. Next, we investigated its biological relevance
to tumor growth by RNA interference. Four sets of siRNAs targeting
different segments of the ANGPTL4 sequence were permanently
introduced into the metastatic skin tumor line A-5RT3, and the
sub-line with highest knockdown efficiency (designated
A-5RT3.sub.ANGPTL4) was selected for subsequent studies. A
non-targeting scrambled siRNA was also integrated into A-5RT3
(designated A-5RT3.sub.CTRL), serving as a negative control.
ANGPTL4 mRNA and protein levels were successfully suppressed by
>85% in A-5RT3.sub.ANGPTL4 when compared with the parental
control A-5RT3 or the scrambled control A-5RT3.sub.CTRL (FIG. 11A).
The induction of interferon responses has been reported as a
challenge to the specificity of some RNA interference approaches.
To test whether the RNAi-mediated silencing of ANGPTL4 was
associated with interferon responses, we measured the expression of
some key interferon response genes by qPCR. No induction of Oas1,
Oas2, Mx1 or Isgf3 was detected in the A-5RT3.sub.ANGPTL4 when
compared with either wild-type, untreated A-5RT3 or A-5RT3.sub.CTRL
(FIG. 19A), verifying that our RNAi experiment did not produce an
off-target effect. As expected, the injection of A-5RT3.sub.CTRL
cells into immunodeficient mice induced large primary tumors
(.about.1000 mm.sup.3) in all five mice at week eight, however
A-5RT3.sub.ANGTL4-induced tumors showed a 90% reduction in tumor
growth (FIGS. 11B-C). A-5RT3.sub.ANGPTL4-induced tumor growth was
similarly reduced, albeit a 40% reduction, when mice were implanted
with increasing number of tumor cells (FIG. 19B). To strengthen the
above observation, we implanted B 16F10 cells subcutaneously into
ANGPTL4-knockout (KO) and control (WT) mice. WT and KO mice were
maintained in a C57BL/6J background and B16F10 melanoma was derived
from the same background. Notably, B16F10 tumor cells implanted in
KO mice grew significantly slower than those implanted in WT mice;
at 15 days post implantation, the average tumor volume in KO mice
was .about.6-fold smaller than that in WT mice (FIG. 11D). The
injection of ANGPTL4-knockdown (B16F10.sub.ANGPTL4) cells into KO
mice induced little tumor growth, and showed similar growth profile
in WT mice to control B16F10 (B16F10.sub.CTRL-induced tumors in KO
mice (FIG. 11D). Conversely, WT mice implanted with
B16F10.sub.CTRL, and intravenously injected thrice weekly with
recombinant N-terminal histidine-tagged recombinant cANGPTL4 showed
greater tumor growth, the average tumor volume in cANGPTL4-treated
mice was .about.3-fold larger than PBS-treated mice (FIGS. 11E and
19C-D). B 16F10.sub.ANGPTL4-induced tumor growth was diminished in
PBS-treated mice when compared to cANGPTL4-treated mice (FIG. 11E).
Next, we reasoned that treating mice injected with A-5RT3.sub.CTRL
cells with an antibody that interferes with the action of ANGPTL4
will recapitulate the observation made with A-5RT3.sub.ANGTL4. To
this end, the monoclonal human cANGPTL4-directed antibody mAb11F6C4
was identified and produced for our immunotherapy experiment based
on its superior k.sub.on, k.sub.off and K.sub.D values, as
determined by surface plasmon resonance (SPR) (FIG. 11F). Notably,
immunosuppression of ANGPTL4 with mAb11F6C4 significantly
attenuated in vivo tumor growth in immunodeficient mice, compared
with control IgG-treated mice (n=6 each group) (FIGS. 11G-H)
Immunoblot and immunofluorescence analysis of
A-5RT3.sub.ANGPTL4-induced tumor biopsies indicated significantly
reduced cell proliferation and enhanced cell apoptosis when
compared with A-5RT3.sub.CTRL-induced tumors (FIGS. 11I-J). A
qPCR-focused array of A-5RT3.sub.ANGPTL4-induced tumor biopsies
further suggested increased expression of many pro-apoptotic genes,
whereas expression of cell proliferation genes were diminished
(FIG. 11K; Table 1). Altogether, these observations clearly
supported a tumor-promoting role of cANGPTL4.
ANGPTL4-Deficient Tumor Cells Showed Increase Susceptibility to
Anoikis.
[0191] Anchorage-independent growth or anoikis resistance of tumor
cells, a hallmark of tumor malignancy, can be investigated by tumor
colony formation in soft agar and anoikis assays, which are
well-established in vitro approaches to study and predict
self-renewal and metastatic potentials of in vivo tumor cells.
Underscoring our in vivo findings, the colony-forming potential of
A-5RT3.sub.ANGPTL4 was dramatically undermined and formed
significantly (.about.85%) fewer tumor colonies on soft agar when
compared with A-5RT3.sub.CTRL (FIG. 12A). Furthermore,
A-5RT3.sub.ANGPTL4 was also more susceptible to anoikis, having 30%
more apoptotic A-5RT3.sub.ANGPTL4 cells, as well as significantly
enhanced activities from caspases 2, 3, 8 and 9 when compared with
A-5RT3.sub.CTRL after 2 h of anoikis (FIG. 12B-C). The addition of
exogenous recombinant cANGPTL4 reduced the apoptotic index of
A-5RT3.sub.ANGPTL4 in a dose-dependent manner (FIG. 12D).
Similarly, ANGPTL4 deficiency in human keratinocytes rendered these
cells .about.50% more susceptible to anoikis when compared to
control keratinocytes, suggesting that low amount of ANGPTL4 was
also necessary to confer anoikis resistance in normal epithelial
cells (FIG. 20A). No difference in apoptotic index was observed
with adhered A-5RT3 and keratinocytes (FIG. 20A-B).
[0192] ANGPTL4 Interacts with Integrins .beta.1 and .beta.5.
[0193] Our above findings indicated that ANGPTL4 endows tumor cells
with resistance to anoikis and therefore sustain their growth, but
how ANGPTL4 mediates this process remains a central question in our
understanding of ANGPTL4 in cancer biology. Previous studies have
revealed that anoikis is an integrin-dependent process, thus we
hypothesize that ANGPTL4 also exerts its role in tumor cells
through integrins-mediated signaling. First, we examined if
cANGPTL4 can interact with integrin. Indeed, results obtained from
SPR and ELISA assays showed that ANGPTL4 specifically interacts
with integrins .beta.1 and .beta.5, but not with .beta.3 (FIG.
12E-F), which were blocked by either mAb11F6C4 or integrin-specific
antibodies (FIGS. 12G-H and 20D-G). ANGPTL4 deficiency did not
affect the expression of integrins .beta.1, .beta.3 and .beta.5
(FIG. 20H). An in situ proximity ligation assay (PLA) detected
ANGPTL4-integrin complexes both in A-5RT3.sub.CTRL cells and
A-5RT3.sub.CTRL-induced tumor biopsies (FIGS. 201 and 121),
confirming that this interaction also exists in vivo. Further
investigation revealed that integrin activation by ANGPTL4 binding
triggered focal adhesion kinase (FAK) in A-5RT3.sub.CTRL cells and
tumors, which were reduced by >70% in A-5RT3.sub.ANGPTL4 (FIGS.
12J and 20J). All of these findings were further corroborated by
results from immunodetection on tumor biopsies (FIG. 12K). Our
findings suggest that ANGPTL4 secreted by epithelial tumor cells
acts in an autocrine manner to hijack the integrin/FAK-regulated
pathway to confer anoikis resistance to tumors, and thus sustain
tumor growth.
ANGPTL4 Elevates O.sub.2.sup.- Level and Maintains a High
O.sub.2.sup.-:H.sub.2O.sub.2 Ratio in Tumor Cells.
[0194] Reactive oxygen species (ROS; e.g. O.sub.2.sup.- and
H.sub.2O.sub.2) have long been recognized as important second
messengers, functioning in the relay of intracellular signals in
normal and cancer cells. ROS can be regulated through integrin
engagement and an elevated O.sub.2.sup.- level or relatively high
O.sub.2.sup.-:H.sub.2O.sub.2 ratio allows tumor cells to survive
and to avoid anoikis. In this regard, we asked whether
ANGPTL4-integrin interaction can regulate ROS production in tumor
cells. Using electron paramagnetic resonance spectroscopy (EPR) in
combination with
5-(diethoxyphosphoryl)-5-methyl-1-pyrroline-N-oxide (DEPMPO) spin
trapping, we measured a significant decrease in O.sub.2.sup.- level
in A-5RT3.sub.ANGPTL4 when compared with A-5RT3.sub.CTRL (FIG.
13A-B), suggesting ANGPTL4 is vital in sustaining O.sub.2.sup.-
production in tumor cells. To determine the source of
O.sub.2.sup.-, similar experiments were performed using specific
inhibitors that block the mitochondrial respiratory chain complex I
and membrane-bound NADPH oxidase, which are two major producers of
O.sub.2.sup.- in mammalian cells. Treatment of tumor cells with
rotenone, a mitochondrial respiratory chain complex I inhibitor,
did not alter their cellular O.sub.2.sup.- level (FIG. 13A-B)
suggesting that such a complex has little role in generating
O.sub.2.sup.- in tumors. Further excluding mitochondria as the
source of ANGPTL4-mediated O.sub.2.sup.- generation, our qPCR
analysis showed no change in the expression of selected genes in
the methionine/homocysteine metabolic cycle (FIG. 21A), as
previously studied in db/db diabetic rodent hepatocytes. In
contrast, O.sub.2.sup.- level was significantly abrogated by using
two different NADPH oxidase inhibitors, namely, diphenylene
iodonium (DPI) and apocynin (FIG. 13A-B). Reactive oxygen species
generated through the involvement of the small GTPase Rac1 and
NADPH oxidase upon integrin engagement exert a mandatory role in
transmitting a pro-survival signal that ensures the tumor cells
escape from anoikis. In accordance with these results, comparative
immunoblot analysis of anti-cANGPTL4 immunoprecipitates from
A-5RT3.sub.CTRL- and A-5RT3.sub.ANGPTL4-induced tumor lysates
detected integrins .beta.1 and .beta.5, along with phosphorylated
FAK and active GTP-bound Rac1, in A-5RT3.sub.CTRL-induced tumor,
but were significantly reduced in A-5RT3.sub.ANGPTL4-induced tumor
(FIG. 12K). To further validate the relevance of Rac1 in
ANGPTL4-mediated O.sub.2.sup.- production, we next transiently
transfected A-5RT3.sub.CTRL and A-5RT3.sub.ANGPTL4 with
dominant-negative Rac1 (T17N) and constitutively active Rac1
(G12V), respectively. We measured a significantly diminished
O.sub.2.sup.- level in the former system and, conversely, an
obvious rescued level of O.sub.2.sup.- production in the latter
one. The percentage of inhibition and recovery was consistent with
the .about.65% transfection efficiencies, as estimated using a
GFP-expressing vector. The requirement of Rac1 suggested a
Nox-dependent mechanism. Thus, we examined the expression of Nox1
and Nox 2 in A-5RT3 (FIG. 21B). Nox 3 is expressed predominantly in
the inner ear and is involved in the biogenesis of
otoconia/otolith. Next, we performed Nox1 and Nox2 knockdown (Nox1
kd and Nox2 kd, respectively) in A-5RT3.sub.CTRL and
A-5RT3.sub.ANGPTL4 (FIG. 21C), and measured O.sub.2.sup.- level
using EPR (FIG. 13A-B). The results indicated that Nox 1 NADPH
oxidase is the predominant producer of ANGPTL4-mediated
O.sub.2.sup.- generation in tumor cells. As expected, O.sub.2.sup.-
was completely abolished when treated with the superoxide scavenger
Tiron, which serves as a negative control for superoxide
measurement (FIG. 13A-B). These data were reproduced by a reliable
chemiluminescence method using
2-methyl-6-(4-methoxyphenyl)-3,7-dihydroimidazo[1,2-a]pyrazin-3-one
hydrochloride (MCLA; FIG. 13C). Next, we measured the level of
H.sub.2O.sub.2 in tumor cells in the presence of a specific
catalase inhibitor, 3-amino-1,2,4-triazole. H.sub.2O.sub.2 levels
in A-5RT3.sub.ANGPTL4 were significantly higher when compared with
A-5RT3.sub.CTRL (FIG. 13D). Nox1 knockdown did not affect the
H.sub.2O.sub.2 level, suggesting that ANGPTL4 modulated
H.sub.2O.sub.2 production via a linked as-yet-unknown mechanism
(FIG. 21D). Notably, the lower O.sub.2.sup.- level and
O.sub.2.sup.-:H.sub.2O.sub.2 ratio was concurrent with threefold
more apoptosis and significantly enhanced caspase activities within
2 h of anoikis in A-5RT3.sub.ANGPTL4 when compared with
A-5RT3.sub.CTRL (FIGS. 13A-D and 12B-C). In concordance, we
observed a reduced O.sub.2.sup.- level in
A-5RT3.sub.ANGPTL4-induced tumors when compared with
A-5RT3.sub.CTRL-induced tumors as determined by EPR (FIG. 13E-F)
which was associated with increased apoptosis (FIG. 11I-K).
[0195] To underscore the relevance of these findings to other
cancers, similar experiments were performed using the breast cancer
line MDA-MB-231, after using the mononclonal antibody mAb11F6C4 to
dose-dependently neutralize endogenous cANGPTL4. We showed earlier
that mAb11F6C4 was able to block cANGPTL4-integrin interaction
(FIGS. 12G-H and 20D-G). Consistent with the above results, the
immunosuppression of cANGPTL4 in MDA-MB-231 reduced the
O.sub.2.sup.- level (FIG. 13G-I), lowered the
O.sub.2.sup.-:H.sub.2O.sub.2 ratio (FIG. 13J), and enhanced
apoptosis and caspase activities (FIG. 13K-L). The knockdown of
Nox1 (FIG. 21E), but not Nox2, reduced ANGPTL4-mediated
O.sub.2.sup.- production (FIG. 13G-I) with little effect on
H.sub.2O.sub.2 production (FIG. 21F). Taken together, these
findings indicated that ANGPTL4 could protect tumor cells from
anoikis via an NADPH oxidase-dependent O.sub.2.sup.- generation
mechanism.
ANGPTL4-Mediated O.sub.2.sup.- Activates Src, PI3K/PKB and ERK
Survival Pathways
[0196] Reports have shown that ROS produced via integrin engagement
oxidizes and activates Src, which stimulates the ERK and PKB.alpha.
pro-survival pathways. Both pathways regulate the subcellular
localization or stability of BH3-only apoptotic proteins (e.g. Bad
and Bim), essential for executing anoikis. Thus, we asked whether
ANGPTL4-integrin engaged O.sub.2.sup.- generation employs these
downstream signaling pathways to modulate tumor cell behavior.
Indeed, immunoblot analysis revealed significantly diminished
expression of oxidized/activated Src, phosphorylated PKB.alpha. and
ERK1 in A-5RT3.sub.ANGPTL4-induced tumors and A-5RT3.sub.ANGPTL4
cells (FIGS. 14A and left panel of 14B). Similar immunoblot
analysis performed in the presence of DPI and with Nox1 knockdown
cells, which attenuate ANGPTL4-mediated O.sub.2.sup.- production,
found severely diminished Src, PKB.alpha. and ERK1 activations,
emphasizing the role of O.sub.2.sup.- in their activities (FIG.
14B). The inhibition of PI3K by LY29402 and Wortmannin, a pivotal
upstream mediator of PKB.alpha., caused significantly (four-fold)
more apoptosis of tumor cells within 2 h of anoikis challenge,
reaching levels comparable to those of A-5RT3.sub.ANGPTL4 (FIG.
14C). In addition, inhibition of MEK1/2, the upstream signal of
ERK1, by PD98059 also resulted in a significant enhancement of
apoptotic cell numbers upon anoikis challenge, albeit to a lesser
extent (.about.50%) when compared with PI3K inhibitors (FIG. 14C).
These results suggested that PI3K/PKB.alpha. and ERK1/2 downstream
survival pathways were modulated and exploited by ANGPTL4
engagement in tumor cells, the former being the predominant
path.
[0197] The 14-3-3 adaptor protein is known to act downstream of the
survival pathways by sequestering pro-apoptotic Bad from the
mitochondria to prevent apoptosis. In agreement with these previous
findings, the number of 14-3-3/Bad complexes and
14-3-3.beta./.sigma. proteins were significantly reduced by
.about.70% in A-5RT3.sub.ANGPTL4-induced tumors (FIG. 14D-F). The
Na.sup.+/H.sup.+ exchanger 1 (NHE), which positively influences
cell proliferation by maintaining an alkaline intracellular
environment, was diminished in A-5RT3.sub.ANGPTL4-induced tumors
(FIG. 14D), indicating that NHE plays a subsidiary role to
ANGPTL4-mediated tumor cell growth. Upon oxidant challenge in tumor
cells, the induction of superoxide dismutase (SOD) expression was
muted, allowing tumor cell proliferation. In agreement with these
studies, we found that expression of the cytosolic Zn/CuSOD was
significantly enhanced in A-5RT3.sub.ANGPTL4-induced tumors (FIG.
14D), which indirectly contribute to the reduced
O.sub.2.sup.-:H.sub.2O.sub.2 ratio in ANGPTL4-deficient tumor cells
(see FIGS. 13D, J and 21D, F).
ANGPTL4 Deficiency Abrogates O.sub.2.sup.- Production and
Sensitizes Cancer Cells to Anoikis
[0198] Our results revealed that the suppression of ANGPTL4, either
by constitutive RNAi (FIG. 13A-C) or immunosuppression with
mAb11F6C4 (FIG. 13G-I) resulted in a dose-dependent reduction of
O.sub.2.sup.- levels. To underscore the importance of ANGPTL4 in
the regulation of O.sub.2.sup.- production, maintenance of high
O.sub.2.sup.-:H.sub.2O.sub.2 ratio, and hence tumor survival, we
examined the impact of reduced ANGPTL4 against anoikis in nine
different cancer cell lines, in addition to A-5RT3 and MDA-MB-231.
Treatment with mAb11F6C4, which blocked cANGPTL4-integrin
interaction, resulted in a dose-dependent reduction of
O.sub.2.sup.- levels (40-80% for 6 .mu.g/mL mAb11F6C4; FIG. 15A), a
reduction in O.sub.2.sup.-:H.sub.2O.sub.2 ratio (70-90% for 6
.mu.g/mL mAb11F6C4; FIG. 15B), a 3-8 fold increase in the
activities of caspases 2, 3, 8 and 9 (FIG. 16A) and 30-60% more
apoptotic tumor cells (FIG. 16B), all indicating weakened anoikis
resistance and further corroborating our previous observations on
A-5RT3 and MDA-MB-231. Higher percentage of apoptotic tumor cells
was also observed using inducible RNAi against ANGPTL4 in
MDA-MB-231 (FIG. 16C). These findings indicated that
ANGPTL4-mediated O.sub.2.sup.- production for anoikis resistance
may be a common feature in tumor cells.
TABLE-US-00001 TABLE 1 Relative fold change of gene expressions in
A-5RT3.sub.ANGPTL4-induced tumors as compared with that of A-
5RT3.sub.CTRL-induced tumors, related to FIG. 2 and 11 Gene
A-5RT3.sub.CTRL A-5RT3.sub.ANGPTL4 Down-regulated (>2-fold)
Diablo 1.000 0.070 Ccnd1 1.000 0.102 Ccna2 1.000 0.119 Xiap 1.000
0.120 Pcna 1.000 0.177 Cox10 1.000 0.223 Birc2 1.000 0.247 Ki67
1.000 0.269 Birc3 1.000 0.345 Cdk5 1.000 0.498 Mcl1 1.000 0.500
Cdk4 1.000 0.549 Up-regulated (>2-fold) Casp7 1.000 1.927 Bid
1.000 2.051 Bbc3 1.000 2.075 Perp 1.000 2.246 Parp1 1.000 2.308 Pxn
1.000 2.947 Bcl2l1 1.000 3.112 Cdkn1c 1.000 3.609 Fas 1.000 6.171
Chuk 1.000 6.353 Bax 1.000 8.363 Casp1 1.000 10.499 Casp2 1.000
10.560 Cdkn1a 1.000 13.037 Bcl2l2 1.000 14.671 Casp10 1.000 24.740
Note: The Gene expression levels in A-5RT3.sub.CTRL-induced tumors
were assigned value one.
TABLE-US-00002 TABLE 2 Sequences of ANGPTL4, Nox1, Nox2 and Control
siRNAs siRNA Sense Primer (5' .fwdarw. 3') Antisense Primer (5'
.fwdarw. 3') ANGPTL4 set 1* AAAGCTGCAAGATGACCTCAGATGGAGGCTG
##STR00001## ANGPTL4 set 2.sup.# ##STR00002## ##STR00003## Nox1
AAAGGGCCACAGATGGCTCCCTTGCCTCCAT AAAAATGGAGGCAAGGGAGCCATCTGTGGCC
Nox2 AAAGGGCCAGATGTTCTTTCTACAGAAGAAT
AAAAATTCTTCTGTAGAAAGAACATCTGGCC Mouse
AAAGCTGTGAGATGACTTCAGATGGAGGCTG AAAACAGCCTCCATCTGAAGTCATCTCACAG
ANGPTL4 Control AAAGCTGTCTTCAAGCTTGATATCGAAGACTA
AAAATAGTCTTCGATATCAAGCTTGAAGACAG siRNA *ANGPTL4 Set 1 siRNA used
for lentivirus-mediated RNA interference (SEQ ID NO. 4 & 5).
.sup.#ANGPTL4 set 2 shRNA was cloned into pSingle-tTS-shRNA vector
(Clontech) and used for doxycycline-inducible knockdown in
MDA-MB-231 cells (SEQ ID NO. 6 & 7).
TABLE-US-00003 TABLE 3 Sequences of Quantitative Real-time PCR
(qPCR) Primers GenBank Sense Primers Antisense Primers Accession
Official (5' .fwdarw. 3') (5' .fwdarw. 3') NM 00432 Bax
GGGTGGTTGGGTGAGACTC AGACACGTAAGGAAAACGC NM 01441 Bbc3
GACCTCAACGCACAGTACG AGGAGTCCCATGATGAGAT NM 13857 Bcl211
TGCGTGGAAAGCGTAGACA GCTGCTGCATTGTTCCCATA NM 00405 Bcl212
GCGGAGTTCACAGCTCTAT AAAAGGCCCCTACAGTTAC NM 00119 Bid
GACAGCATGGACCGTAGCA AGGTGCGTAGGTTCTGGTTA NM 00116 Birc2
GTTTCAGGTCTGTCACTGG TGGCATACTACCAGATGAC NM 18296 Birc3
TCCTGGATAGTCTACTAACT GCTTCTTGCAGAGAGTTTCT NM 03329 Casp1
TCCAATAATGGACAAGTCA GCTGTACCCCAGATTTTGTA NM 00123 Casp10
ATTGGTCCCAAGACATGAA TGTTCCCTGTTTGTCCACTC NM 03928 Casp2
AAACGAGGTTCCTGGTACA TCCTTGATAAGTGCGTTCAC NM 03334 Casp7
AGTGACAGGTATGGGCGTT GAGGTTGCAGTCTTCCGAG NM 00123 Ccna2
GATGGTAGTTTTGAGTCAC CACGAGGATAGCTCTCATA NM 05305 Ccnd1
GCTGGAGCCCGTGAAAAAG CTCCGCCTCTGGCATTTTG NM 00007 Cdk4
CAGATGGCACTTACACCCG GCAGCCCAATCAGGTCAAA NM 00493 Cdk5
GCCGCAATGTGCTACACAG GAGTAACAGCGGACGGGAA NM 00038 Cdkn1
GTCACTGTCTTGTACCCTTG CGGCGTTTGGAGTGGTAGA NM 00007 Cdkn1
ACATCCACGATGGAGCGTC GGAAGTCGTAATCCCAGCG NM 00127 Chuk
CAGCCATTTACCTGGCATG GAGGGTCCCAATTCAACAT NM 00130 Cox10
CCAGCAAGTAAGACCCAAG TCATCTCTTTCCACCGCTTT NM 01988 Diablo
GGTACAGACAGTGTTTGTG CTACTAAGGGAATGAGGCT NM 00004 Fas
TATCACCACTATTGCTGGA ACGAAGCAGTTGAACTTTCT NM 00241 Ki67
TGTTCCCACTACACAATGTC ACTTACGCGAGACCAACAG NM 02196 Mc11
GTGCCTTTGTGGCTAAACA AGTCCCGTTTTGTCCTTACG NM 00161 Parn1
GATGCCTATTACTGCACTG CGGTCCTGCTTTTTAACCTT NM 02212 Pern
CAACCCTGCTGTCACTTAC AGGTCATCTTCGTAGTTGGG NM 18264 Pcna
ACACTAAGGGCCGAAGATA CGGCATATACGTGCAAATT NM 00285 Pxn
GCGGACTTGGAGTCTACCA TCCAGTTGGGTATGAGTAG NM 00116 Xian
GACAGGCCATCTGAGACAC GGGGTTAGGTGAGCATAGT NM 00068 Ahcy
GCATCCGAGGCATCTCTGA GCCATAGAGGTTGTCAAAC NM 00171 Bhmt
GACACCTTCATACCTTAGCT ACAGGTTTACCGGATGCTAT NM 01226 Hacl1
CCTTCTTATCATCGGGAAA CCCATAGGGGTGGGCAAAA NM 00022 Khk
GCTATTCTGTGGACCTACG AGTATAGGATGGTGCGGCT NM 00042 Mat1a
CATCAAGCACATCGGCTAC CCGAACATCAAACCCTGAT NM 00027 Oat
TGCTGTCAACCAAGGGCAT GCCTCCACTCCTGTATTCAT NM 00098 L27
TGATGGCACCTCAGATCGC AGAGTACCTTGTGGGCATT Note: Melt curve analysis
was included to assure that only one PCR product was formed.
Experimental Reagents.
[0199] Antibodies were used: cyclinD1, keratin 10, integrins B1 and
B5, involucrin (Chemicon); caspase-3 (R&D Systems); PCNA,
transglutaminase 1 (TGase 1), .beta.-tubulin, 14-3-3.beta.,
14-3-3.sigma., catalase, ERK1/2, p(T202/Y204)ERK1/2 (Santa Cruz
Biotechnology); c-Src, p(Y416)Src, FAK, p(Y925)FAK (Cell Signaling
Technology); pan-14-3-3 and BAD (Abcam); Bax and Cleaved PARP
(Millipore); Ki67 (NovaCastra); secondary Alexa488-conjugated
antibodies (Invitrogen); secondary HRP-conjugated antibodies (Santa
Cruz Biotechnology). Rat tail collagen type I (BD Biosciences,
USA), pFIV lentivirus-based siRNA vector and packaging kit (System
acetyl ester was from Molecular Probes. Transfection reagent ExGen
500 and restriction enzymes were from Fermentas. Monoclonal and
polyclonal antibodies against the C-terminal region human (186-406
amino acids) and mouse (190-410 amino acids) ANGPTL4 were produced
according to standard procedures. Unless specified, all reagents
were obtained from Sigma.
Cell Culture.
[0200] HaCat is a non-tumor human keratinocyte cell line, II-4 and
A-5RT3 are tumoriogenic HaCat derivatives were provided by the
German Cancer Research Center. HSC is a human squamous cell
carcinoma cell line was provided by Prof. Aso (Yamagata University
School of Medicine, Japan). All cell lines were cultured in
Dulbecco's Modified Eagle's Medium (DMEM; Hyclone, USA)
supplemented with 10% heat-inactivated fetal bovine serum (FBS,
Hyclone). All cells were cultured at 37.degree. C., 5% CO.sub.2 and
75% humidified incubator.
Human Tumor Samples.
[0201] Human squamous cell carcinoma biopsies along with their
paired peri-tumor normal samples were provided by the National Skin
Centre of Singapore. Whole SCCs and PNSs samples, inclusive of
epithelia and stroma, were subjected to total protein or RNA
extraction for immunoblotting or qPCR analyses. For LCM samples,
epithelial and stromal fractions were microdissectioned from
8-nm-thick sectioned tissues using PALM Microbeam Axio Observer Z1
(Carl Zeiss) and qPCR was performed as described.
[0202] Commercial tumor tissue arrays #MTU951 and #MET961
(Pantomics, Inc., USA) were utilized to study the expression
profile of ANGPTL4 in a large known human tumor set by
immunofluorescence imaging. The #MTU951 human tumor tissue array
contains 40 tumor types, covering most of the common benign,
malignant and metastatic tumors originated from 27 anatomic sites,
and the #MET961 human cancer metastasis tissue array consists of 48
cases of metastatic cancers from >8 anatomic sites. The two
tissue arrays were probed with anti-cANGPTL4 polyclonal antibody
followed by Alexa488 goat-anti-rabbit IgG. Images were taken by an
inverted microscope (ECLISPSE TE2000-U; Nikon) with equal exposure
and gain. The 3D heatmaps were generated using IMARIS software
(Bitplane Scientific Software). In the heatmaps, the X-Y axis
represents the length and width, while the Z axis represents the IF
intensity.
[0203] Human basal cell carcinoma biopsies (BCCs) and squamous cell
carcinoma biopsies (SCCs) along with their paired peri-tumor normal
samples (PNSs) were provided by Dr. Pan, Dr. Tan(National Skin
Centre, Singapore) and purchased from Asterand plc, USA. BCC, SCC
and PNS samples, inclusive of epithelia and stroma, were subjected
to protein and RNA extraction for immunoblotting and qPCR analyses,
respectively.
[0204] Commercial tumor tissue arrays #MTU951 and #MET961
(Pantomics, Inc., USA) were utilized to study the expression
profile of ANGPTL4 in a large human tumor set by immunofluorescence
(IF) imaging. The #MTU951 human tumor tissue array contains 40
tumor types, covering most of the common benign, malignant and
metastatic tumors originating from 27 anatomic sites, and the
#MET961 human cancer metastasis tissue array consists of 48 cases
of metastatic cancers from >8 anatomic sites. The two tissue
arrays were probed with anti-cANGPTL4 polyclonal antibody followed
by Alexa488 goat-anti-rabbit IgG. Images were taken using MIRAX
MIDI with Plan-Apochromatic 20.times./0.8 objective, with equal
exposure and gain and each images automatically stitched by MIRAX
Scan software (Carl Zeiss). The 3D heatmaps were generated using
IMARIS software (Bitplane Scientific Software). In the heatmaps,
the X-Y axes represent the length and width, whereas the Z axis
represents the IF intensity. The gray value (IF intensity) was
obtained from three biopsies using TissueQuest software
(TissueGnostic GmbH).
Suppression of ANGPTL4 by RNA Interference (RNAi).
[0205] Four sets of siRNAs against human ANGPTL4 and a scrambled
sequence as control (Table 2) were subcloned into the
pFIV-H1/U6-puro pFIV/siRNA lentivirus system. The correct pFIV
siRNA constructs were verified by sequencing using H1 primer.
Pseudovirus purification and transduction were performed'.
ANGPTL4-knockdown tumor cells were enriched by puromycin selection
for 1 week. The A-5RT3 sub-cell line designated A-5RT3.sub.ANGPTL4,
with the highest knockdown efficiency was chosen in this study, and
the non-targeted siRNA transduced line was denoted as
A-5RT3.sub.CTRL. The expression of endogenous ANGPTL4 in MDA-MB-231
cells was also suppressed using tetracycline-inducible
pSingle-tTS-shRNA vector (Clontech). Knockdown efficiency of
ANGPTL4 and relative expression level of indicated genes were
determined by qPCR and immunoblotting.
Total RNA Isolation and Quantitative Real-Time PCR (qPCR).
[0206] Total RNA was extracted and qPCR was performed. Expression
was related to the housekeeping gene 60S ribosomal protein L27
(RPL27) which did not change under any of the experimental
conditions studied. The sequence of primers is available in Table
3. For focused mRNA array, genes whose expression was changed
significantly (>2-fold) were listed and heatmaps were generated
using Orange Canvas 1.0 software.
Immunoblotting.
[0207] Total protein was extracted from cells, or tumor tissues
with ice-cold lysis buffer (20 mM Na.sub.2H.sub.2PO.sub.4, 250 mM
NaCl, 1% Triton-100, 0.1% SDS). Equal amount of protein extracts
were resolved by SDS-PAGE and electrotransferred onto PVDF
membranes. Membranes were processed according to standard procedure
and proteins were detected by chemiluminesence (Millipore, USA).
.beta.-tubulin was used as loading and transfer control.
In Vivo Tumorigenecity Assay.
[0208] Five BALB/c athymic nude female mice (20-22g), aged 5-6
weeks, were purchased from A*STARBiological Resources Centre
(Singapore), and maintained in panthogen-free conditions. The
animal studies were approved by the Institutional Animal Care and
Use Committee (IACUC0092), Nanyang Technological University, and
all experiments were carried out in strict compliance with their
regulations. A total of 5.times.10.sup.5 cells (A-5RT3.sub.CTRL or
A-5RT3.sub.ANGPTL4) was injected subcutaneously into the
interscapular region of each nude mouse. Injection site was rotated
to avoid site bias. The injected tumor cells were allowed to grow
for 8 weeks, The subcutaneous xenograft tumors were measured
externally with a vernier caliper every other day, and tumor volume
was estimated by using the equation, V=(L.times.W.sup.2)/2, where L
is the length of the major axis of the tumor, and W is the length
of the minor axis. Mice were sacrificed at the end of the
experiment, and their tumors were harvested for further
analysis.
[0209] For the antibody treatment, 6 nude mice were implanted with
A-5RT3.sub.CTRL as above. One week post implantation, 30 mg/kg/week
of either mAb11F6C4 or isotype control IgG were intravenously
administrated once weekly for 4 weeks. The dose of antibody and
delivery mode was consistent with studies using mAb14D12, another
anti-ANGPTL4 mAb.sup.2. Mice were sacrificed after treatments and
tumors were harvested for further analyses. Laser scanning
microscope with a Plan-Apochromat 63.times./1.40 Oil objective and
ZEN 2008 software (Carl Zeiss).
Soft Agar and Anoikis Assay.
[0210] A-5RT3.sub.CTRL and A-5RT3.sub.ANGPTL4 cells were used in
soft agar assay. 0.6% Noble agar (Sigma Aldrich) in DMEM with 10%
FBS was allowed to solidify in 6-well plate, and 1.times.10.sup.4
cells were plated in 0.3% Noble agar in DMEM with 10% FBS on top.
Tumor cell colonies were stained with 1 mg/ml thiazolyl blue
tetrazolium in PBS after 4 weeks.
[0211] Cells were subjected to anoikis assay. Briefly, anoikis was
induced by forced suspension where 5.0.times.10.sup.5 cells were
seeded onto 1.0% serum-free DMEM equilibrated agarose in the
presence either 10 .mu.g/ml of pre-immune IgG or mAb11F6C4. For
MBA-MD-231, the cells were exposed to 1 .mu.g/ml doxycyline for 24
h to knockdown ANGPTL4 prior anoikis. Cells were harvested at
indicated time points, and analyzed for apoptosis by FACS
analysis.
[0212] A-5RT3.sub.CTRL and A-5RT3.sub.ANGPTL4 cells were used in
soft agar assay. 0.6% Noble agar (Sigma Aldrich) in DMEM with 10%
FBS was allowed to solidify in 6-well plate, and 1.times.10.sup.4
cells were plated in 0.3% Noble agar in DMEM with 10% FBS on top.
Tumor-cell colonies were stained with 1 mg/ml thiazolyl blue
tetrazolium in PBS after four weeks.
[0213] Cells were subjected to an anoikis assay. Briefly, anoikis
was induced by forced suspension, wherein 5.0.times.10.sup.5 cells
were seeded onto 1.0% serum-free DMEM equilibrated agarose in the
presence of either 10 g/ml of pre-immune IgG or mAb11F6C4. For
MBA-MD-231, the cells were exposed to 1 g/ml doxycyline for 24 h to
knockdown ANGPTL4 prior anoikis. For rescue experiments, cells were
subjected to anoikis in the presence of either indicated
concentrations of exogenous recombinant cANGPTL4 or vehicle (PBS).
Cells were harvested at indicated time points, and analyzed for
apoptosis by FACS analysis. Apoptotic index of attached cells were
determined immediately after harvesting with trypsin.
Membrane Protein Extraction.
[0214] HEK293T cells were transferred with either empty mammalian
expression vector pEF1-mycA (Invitrogen) or vector carrying cDNAs
encoding human integrins .beta.1, .beta.3 and .beta.5 by means of
ExGen 500. Forty-eight hours post-transfection, cell membranes were
first isolated using ProteoExtractNative Protein Extraction Kit
(Calbiochem) and subjected to enrichment by sucrose step gradient.
The proteins were displayed against PBS prior to SPR analysis.
Fluorescence-Activated Cell Sorting (FACS).
[0215] Cells were analyzed for apoptosis using the Annexin V-FITC
apoptosis kit (BD Pharmingen) according to manufacturer's
instructions. After 2 h of anoikis challenge, cells were harvested,
washed in cold PBS and strained with annexin V-FITC and propidium
iodide for 15 min at room temperature in the dark. Cells were
resuspended in binding buffer (10 mM HEPES, pH 7.4, 140 mM NaCl,
2.5 mM CaCL.sub.2), and subjected to flow cytometry on a FACS
Calibur (Becton Dickinson). Data were analyzed using the CellQuest
software (Becton Dickinson). The analyser threshold was adjusted on
the flow cytometer channel to exclude most of the subcellular
debris to reduce the background noise. The totality of Annexin
V.sup.+/PI.sup.- (early apoptosis) and Annexin V.sup.+/PI.sup.+
cells (late apoptosis) were considered apoptotic.
Surface Plasmon Resonance (SPR Analysis)
[0216] Purifided fibrinogen-like fragment of ANGPTL4 (cANGPTL4) was
immobilized onto ProteOn GLC chip by amine coupling as recommended
by the manufacturer (Bio-Rad). Different concentrations of
integrins were introduced into the GLC chip at a flow rate of 25
.mu.l/min for 5 mM with running buffer (50 mM Tris, pH8.0, 100
mMNaC1). Polyclonal anti-cANGPTL4 antibodies against the
immobilized cANGPTL4 determined the Rmax value to be 423.1
resonance unit (RU). Global fitting of the data to a Languir 1:1
model was used to determine the association (K.sub.on) dissociation
(K.sub.off) and affinity constant (K.sub.D) using scrubber2
(Biologic Software Pty Ltd). The experimental Rmax values of
integrins .beta.1 and .beta.5 for cANGPTL4 were determined to be
365.6 and 341.9 RU, respectively. The affinity constants of the 6
mAbs for ANGPTL4 were determined using the one shot Kinetics
protocol as described by manufacturer (Bio-Rad).
[0217] Purified fibrinogen-like fragment of ANGPTL4 (cANGPTL4) was
immobilized onto ProteOn GLC chip by amine coupling, as recommended
by the manufacturer (Bio-Rad). Different concentrations of
integrins were introduced into the GLC chip at a flow rate of 25
.mu.l/min for 5 mM with running buffer (50 mM Tris, pH 8.0, 100 mM
NaCl). Polyclonal anti-cANGPTL4 antibodies against the immobilized
cANGPTL4 determined the Rmax value to be 423.1 resonance unit (RU).
Global fitting of the data to a Langmuir 1:1 model was used to
determine the association (k.sub.on), dissociation (k.sub.off) and
affinity constant (K.sub.D) using Scrubber2 (BioLogic Software Pte
Ltd). The experimental Rmax values of integrins .beta.1 and .beta.5
for cANGPTL4 were determined to be 365.6 and 341.9 RU,
respectively. The affinity constants of the 6 mAbs for ANGPTL4 were
determined using the One-Shot Kinetics protocol as described by
manufacturer (Bio-Rad).
Detection of Src Oxidation by Carboxymethylation.
[0218] The detection of reduced Src was performed with minor
modifications to the method described in (5). Cells were subjected
to anoikis as described above. At indicated times, cells were lysed
with 500 n1 of lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl,
0.5% Triton X100, 10 .mu.g/ml leupeptin) containing 100 nM of
N-(biotinoyl)-N'-(iodoacetyl) ethylenediamine. Lysate was clarified
by centrifugation and c-Src was immunoprecipitated using specific
anti-c-Src antibodies. Immunocomplexese were resolved by SDS-PAGE
and the biotinylated/reduced fraction of Src Kinase was detected
with horseradish peroxidase (HRP)-conjagated streptavidin and by
chemiluminescence.
[0219] The detection of reduced Src was performed with minor
modifications. Cells were subjected to anoikis as described above.
At indicated time, cells were lysed and with 500 .mu.l of lysis
buffer (50 mM Tris-HCl, pH 7.5, 150 nM NaCl, 0.5% Triton X-100, 10
.mu.g/ml aprotinin and 10 .mu.g/ml leupeptin) containing 100 nM of
N-(biotinoyl)-N-(iodoacetyl) ethylenediamine. Lysates were
clarified by centrifugation and c-Src was immunoprecipitated using
specific anti-c-Src antibodies. Immunocomplexes were resolved by
SBS-PAGE and the biotinylated/reduced fraction of Src kinase was
detected with horseradish peroxidase (HRP)-conjugated streptavidin
and by chemiluminesence.
Intracellular ROS Assay.
[0220] Cells were subjected to anoikis as described above. Five
minutes before the end of each inmcubation time, 5-(and
6)-chloromethyl-2',7'-dichlorodihydro-fluorescein diacetate acetyl
ester was added to a final concentration of 10 nM. Cells were lysed
in 500 n1 of RIPA buffer and analysed by fluorescence analysis
using a Perkin Elmer Fluorescence Spectrophotometer at excitation
of 485 nm and emission of 525 nm
Laser Capture Microdissection (LCM)
[0221] For LCM samples, epithelial and stromal fractions were
microdissectioned from 8-nm-thick sectioned tissues using PALM
Microbeam Axio Observer Z1 (Carl Zeiss) separately. LCM tissues
were collected into microfuge tubes with opaque AdhesiveCaps (Carl
Zeiss). RNA was extracted using Optimum.TM. FFPE RNA Isolation kit
(Ambion) pooled from 8 LCM tissues. 5 ng RNA was subjected to Full
Spectrum Complete Transcriptome RNA Amplification kit (System
Biosciences) prior to qPCR as previously described.
Generation cANGPTL4 and Antibodies
[0222] Recombinant ANGPTL4 proteins were purified from the
conditioned medium of stable cANGPTL4-expressing S2 cells by
preparative isoelectric membrane electrophoresis as previously
described. Rabbit polyclonal antibodies against the C-terminal
region and N-terminal region of human ANGPTL4 were produced
in-house and previously described. Monoclonal antibodies (mAbs)
against human cANGPTL4 (a.a. 186-406) were made according to
standard protocols Briefly, mice were immunized with adjuvant
conjugated-cAngpt14. The spleen of the mouse was removed and a
single cell suspension was prepared. These cells were fused with
myeloma cells and cultured in hybridoma selection medium (HAT;
Gibco). The fused cells were cultured in microtiter plates with
peritoneal macrophages for 48 hours post-fusion (2-4.times.10.sup.6
cells/ml). The cultures were maintained in a 5% CO.sub.2 humidified
incubator for 7-21 days, and routinely fed with HAT medium. mAbs in
medium were first screened using ELISA to identify positive clones.
Positive clones were expanded and recloned by a limiting dilution
technique to ensure monoclonality. Next, surface plasmon resonance
was performed to determine the binding kinetics of mAbs. Global
fitting of the data to a Langmuir 1:1 model was used to determine
the association (k.sub.on), dissociation (k.sub.off) and affinity
constant (K.sub.D) using Scrubber2 (BioLogic Software Pte Ltd). mAb
11F6C4 was chosen for immunotherapy and other experiments based on
its superior k.sub.on, k.sub.off and K.sub.D values as well as its
ability to block interaction between cANGPTL4 and integrins.
In Vivo Tumorigenicity Assay
[0223] BALB/c athymic nude female mice (20-22 g), aged 5-6 weeks,
and C57BL/6J female mice (20-25 g) wide-type (WT), aged 6-8 weeks,
were purchased from A*STAR Biological Resources Centre (Singapore).
C57BL/6J female ANGPTL4 wild type (WT) and ANGPTL4-knockout (KO)
mice were used. All animals were maintained in pathogen-free
conditions. The animal studies were approved by the Institutional
Animal Care and Use Committee (IACUC0092), Nanyang Technological
University, and all experiments were carried out in strict
compliance with their regulations.
[0224] For nude mice experiments, a total of 5.times.10.sup.5 cells
(A-5RT3.sub.CTRL or A-5RT3.sub.ANGPTL4) were injected
subcutaneously (s.c.) into the interscapular region of each nude
mouse (n=5 for each group). Injection site was rotated to avoid
site bias. The injected tumor cells were allowed to grow for eight
weeks. The subcutaneous xenograft tumors were measured externally
with a vernier caliper every other day, and tumor volume was
estimated by using the equation, V=(L.times.W.sup.2)/2, where L is
the length of the major axis of the tumor, and W is the length of
the minor axis. Mice were sacrificed at the end of the experiment
(week 8), and their tumors were harvested for further analyses. To
test the effect of the number of injected cells on tumorigencity,
0.5.times., 2.times. and 8.times.10.sup.-6 A-5RT3.sub.CTRL or
A-5RT3.sub.ANGPTL4 were inoculated into nude mice (n=5) as above.
Experiments were terminated at week 4, as tumor volume on
8.times.10.sup.-6 inoculated group approached 3000 mm.sup.3,
accordingly to IACUC protocol. For the antibody treatment, nude
mice (n=6 for each group) were implanted with A-5RT3 as described
above. One week post implantation, 30 mg/kg/week of either
mAb11F6C4 or isotype control IgG were intravenously (i.v.)
administrated once weekly for four weeks. The dose of antibody and
delivery mode was consistent with studies using mAb14D12, another
anti-ANGPTL4 mAb27 (Desai et al., 2007). Mice were sacrificed after
treatments, and tumors were harvested for further analyses.
[0225] KO mice and cANGPTL-treated C57BL/6J mice studies were
performed as previously described (Sun and Lodish, 2010). Briefly,
1.times.10.sup.6B16F10.sub.CTRL (scrambled control cells) or
B16F10.sub.ANGPTL4 (ANGPTL4 knockdown cells) were s.c. injected
into the interscapular region of indicated mice (n=4-6 each group).
Mice were i.v. treated with either 3 mg/kg of cANGPTL4 or control
PBS thrice a week. All the animals were monitored and tumor volume
measured as above. Mice were sacrificed at the end of the
experiment (day 15), and tumors were harvested for
photographed.
In Situ Proximity Ligation Assay (PLA)
[0226] DUOLink.TM. in situ PLA (OLink Biosciences) was performed on
tumor biopsies or cells as described. Paired-primary antibodies
used in the present study were rabbit anti-p(Y397)FAK and mouse
anti-FAK antibodies, rabbit anti-pan-14-3-3 and mouse anti-BAD
antibodies, mouse anti-cANGPTL4 with either rabbit anti-.beta.1,
.beta.3 or .beta.5 integrin antibodies. As a negative control, PLA
was performed by using only anti-FAK, anti-pan-14-3-3 or
anti-nANGPTL4 antibodies, respectively. Briefly, sections/cells
were fixed with 4% paraformaldehyde for 15 min The slides were
washed twice with PBS, blocked for 1 h at room temperature with 2%
BSA in PBS containing 0.1% Triton-X, followed by incubation with
indicated antibody pairs overnight at 4.degree. C. PLA was
performed as recommended by the manufacturer (OLink Biosciences).
Images were taken using LSM710 META confocal laser scanning
microscope with a Plan-Apochromat 63.times./1.40 Oil objective and
ZEN 2008 software (Carl Zeiss).
Electron Paramagnetic Resonance (EPR) Measurement of
O.sub.2.sup.-
[0227] Entire excised tumor biopsies were dispersed enzymatically
into single cell suspensions. The tissue was minced and incubated
in digestion buffer containing hyaluronidase (1 mg/ml), collegenase
D (1 mg/ml) and DNase (100 unit/ml) (Sigma-Aldrich) in a 37.degree.
C. shaking incubator for 2 h. The dispase and hyaluronidase digests
were pooled and filtered through a 70 .mu.m Nylon cell strainer.
Cells were washed, pelleted and resuspended in PBS containing 3%
FBS. Equal cell number was used for EPR measurement of
O.sub.2.sup.-. Direct trapping of superoxide in aqueous media was
performed using the spin trap DEPMPO, which forms a relatively
stable superoxide adduct. EPR spectra were recorded at room
temperature with a Bruker D-200 ER spectrometer, operating at
X-band with a TM 110 cavity with a quartz flat cell. The EPR
parameters were set at 100 KHz, X-band microwave frequency, 9.5
GHz; microwave power, 20 mW; modulation amplitude, 1 G; time
constant, 160 s; scan time, 50 s; and receiver gain,
5.times.10.sup.5. The EPR spectra represent the averaged signals of
10 scans. EPR signal amplitude at 3480 G represents the pure line,
corresponding only to the superoxide adduct. All experiments were
performed three times.
Measurement of O.sub.2.sup.- and H.sub.2O.sub.2
[0228] Production of O.sub.2.sup.- from tumor cells were measured
using an O.sub.2.sup.--sensitive luciferin derivative,
2-methyl-6-(p-methoxyphenyl)-3,7-dihydroimidazo[1,2-a]pyrazin-3-one
(MCLA; Invitrogen). 5.times.10.sup.4 of cells were trypsinized,
washed, lysed in Krebs buffer and treated either individually or
combinatorially for 0.5 h with the following chemicals: superoxide
scavenger Tiron (10 mM), NADPH oxidase inhibitor
diphenyleneiodonium chloride (DPI, 20 .mu.M) or apocynin (500
.mu.M), mitochondrial complex I inhibitor rotenone (50 .mu.M) and
monoclonal human anti-cANGPTL4 anitbody mAb11F6C4 (3 or 6
.mu.g/ml). MCLA (2 .mu.M) was added, and the luminescent signal was
recorded immediately thereafter for 1 mM with a GloMax.RTM. 20/20
Luminometer (Promega). Intracellular H.sub.2O.sub.2 was measured as
previously described. We performed two control experiments to
verify that we were measuring H.sub.2O.sub.2. The specificity of
the assay for H.sub.2O.sub.2 was checked with catalase, and the
degradation of H.sub.2O.sub.2 or inhibition of the assay system by
the sample was checked by determining the recovery of exogenously
added H.sub.2O.sub.2. The fold change in
O.sub.2.sup.-:H.sub.2O.sub.2 ratio of A-5RT3.sub.ANGPTL4 and
mAb11F6C4-treated tumor cells were determined by direct comparison
with the value of either A-5RT3.sub.CTRL or control IgG-treated
tumor cells, which was arbitrarily assigned the value one.
Caspases Activities Assay
[0229] Cells were subjected to anoikis as described above. The
activities of caspases 2, 3, 6, 8 and 9 were measured with
Apotarget caspase colorimetric protease assay kit (Biosource
International, Camarillo, Calif.) according to the manufacturer's
instructions. O.D..sub.405, was read and the fold-increase in
caspase activities were determined by direct comparison with the
level of the A-5RT3.sub.CTRL or cognate pre-immune IgG treated
cells.
Statistical Analysis.
[0230] Statistical significance between two groups was analysed by
an unpaired nonparametric test (Mann-Whitney test) or with a
student's t-test (SPSS Inc.) All statistical tests were two-sided.
P values of <0.05 were considered significant. Values (.+-.S.D.)
from 3-5 independent experiments with triplicates.
[0231] Statistical significance between two groups was analyzed by
an unpaired nonparametric test (Mann-Whitney test) or with a
Student's t-test (SPSS, Inc.). All statistical tests were
two-sided. p value of .ltoreq.0.05 was considered significant.
[0232] Those skilled in the art will appreciate that the invention
described herein is susceptible to variations and modifications
other than those specifically described. The invention includes all
such variation and modifications. The invention also includes all
of the steps, features, formulations and compounds referred to or
indicated in the specification, individually or collectively and
any and all combinations or any two or more of the steps or
features.
[0233] Each document, reference, patent application or patent cited
in this text is expressly incorporated herein in their entirety by
reference, which means that it should be read and considered by the
reader as part of this text. That the document, reference, patent
application or patent cited in this text is not repeated in this
text is merely for reasons of conciseness.
[0234] Any manufacturer's instructions, descriptions, product
specifications, and product sheets for any products mentioned
herein or in any document incorporated by reference herein, are
hereby incorporated herein by reference, and may be employed in the
practice of the invention.
[0235] The present invention is not to be limited in scope by any
of the specific embodiments described herein. These embodiments are
intended for the purpose of exemplification only. Functionally
equivalent products, formulations and methods are clearly within
the scope of the invention as described herein.
[0236] The invention described herein may include one or more range
of values (e.g. size, concentration etc). A range of values will be
understood to include all values within the range, including the
values defining the range, and values adjacent to the range which
lead to the same or substantially the same outcome as the values
immediately adjacent to that value which defines the boundary to
the range.
[0237] Throughout this specification, unless the context requires
otherwise, the word "comprise" or variations such as "comprises" or
"comprising", will be understood to imply the inclusion of a stated
integer or group of integers but not the exclusion of any other
integer or group of integers. It is also noted that in this
disclosure and particularly in the claims and/or paragraphs, terms
such as "comprises", "comprised", "comprising" and the like can
have the meaning attributed to it in U.S. Patent law; e.g., they
can mean "includes", "included", "including", and the like; and
that terms such as "consisting essentially of" and "consists
essentially of" have the meaning ascribed to them in U.S. Patent
law, e.g., they allow for elements not explicitly recited, but
exclude elements that are found in the prior art or that affect a
basic or novel characteristic of the invention.
[0238] Other definitions for selected terms used herein may be
found within the detailed description of the invention and apply
throughout. Unless otherwise defined, all other scientific and
technical terms used herein have the same meaning as commonly
understood to one of ordinary skill in the art to which the
invention belongs.
Sequence CWU 1
1
71406PRTHomo sapiens 1Met Ser Gly Ala Pro Thr Ala Gly Ala Ala Leu
Met Leu Cys Ala Ala1 5 10 15Thr Ala Val Leu Leu Ser Ala Gln Gly Gly
Pro Val Gln Ser Lys Ser 20 25 30Pro Arg Phe Ala Ser Trp Asp Glu Met
Asn Val Leu Ala His Gly Leu 35 40 45Leu Gln Leu Gly Gln Gly Leu Arg
Glu His Ala Glu Arg Thr Arg Ser 50 55 60Gln Leu Ser Ala Leu Glu Arg
Arg Leu Ser Ala Cys Gly Ser Ala Cys65 70 75 80Gln Gly Thr Glu Gly
Ser Thr Asp Leu Pro Leu Ala Pro Glu Ser Arg 85 90 95Val Asp Pro Glu
Val Leu His Ser Leu Gln Thr Gln Leu Lys Ala Gln 100 105 110Asn Ser
Arg Ile Gln Gln Leu Phe His Lys Val Ala Gln Gln Gln Arg 115 120
125His Leu Glu Lys Gln His Leu Arg Ile Gln His Leu Gln Ser Gln Phe
130 135 140Gly Leu Leu Asp His Lys His Leu Asp His Glu Val Ala Lys
Pro Ala145 150 155 160Arg Arg Lys Arg Leu Pro Glu Met Ala Gln Pro
Val Asp Pro Ala His 165 170 175Asn Val Ser Arg Leu His Arg Leu Pro
Arg Asp Cys Gln Glu Leu Phe 180 185 190Gln Val Gly Glu Arg Gln Ser
Gly Leu Phe Glu Ile Gln Pro Gln Gly 195 200 205Ser Pro Pro Phe Leu
Val Asn Cys Lys Met Thr Ser Asp Gly Gly Trp 210 215 220Thr Val Ile
Gln Arg Arg His Asp Gly Ser Val Asp Phe Asn Arg Pro225 230 235
240Trp Glu Ala Tyr Lys Ala Gly Phe Gly Asp Pro His Gly Glu Phe Trp
245 250 255Leu Gly Leu Glu Lys Val His Ser Ile Thr Gly Asp Arg Asn
Ser Arg 260 265 270Leu Ala Val Gln Leu Arg Asp Trp Asp Gly Asn Ala
Glu Leu Leu Gln 275 280 285Phe Ser Val His Leu Gly Gly Glu Asp Thr
Ala Tyr Ser Leu Gln Leu 290 295 300Thr Ala Pro Val Ala Gly Gln Leu
Gly Ala Thr Thr Val Pro Pro Ser305 310 315 320Gly Leu Ser Val Pro
Phe Ser Thr Trp Asp Gln Asp His Asp Leu Arg 325 330 335Arg Asp Lys
Asn Cys Ala Lys Ser Leu Ser Gly Gly Trp Trp Phe Gly 340 345 350Thr
Cys Ser His Ser Asn Leu Asn Gly Gln Tyr Phe Arg Ser Ile Pro 355 360
365Gln Gln Arg Gln Lys Leu Lys Lys Gly Ile Phe Trp Lys Thr Trp Arg
370 375 380Gly Arg Tyr Tyr Pro Leu Gln Ala Thr Thr Met Leu Ile Gln
Pro Met385 390 395 400Ala Ala Glu Ala Ala Ser 4052221PRTHomo
sapiens 2Arg Asp Cys Gln Glu Leu Phe Gln Val Gly Glu Arg Gln Ser
Gly Leu1 5 10 15Phe Glu Ile Gln Pro Gln Gly Ser Pro Pro Phe Leu Val
Asn Cys Lys 20 25 30Met Thr Ser Asp Gly Gly Trp Thr Val Ile Gln Arg
Arg His Asp Gly 35 40 45Ser Val Asp Phe Asn Arg Pro Trp Glu Ala Tyr
Lys Ala Gly Phe Gly 50 55 60Asp Pro His Gly Glu Phe Trp Leu Gly Leu
Glu Lys Val His Ser Ile65 70 75 80Thr Gly Asp Arg Asn Ser Arg Leu
Ala Val Gln Leu Arg Asp Trp Asp 85 90 95Gly Asn Ala Glu Leu Leu Gln
Phe Ser Val His Leu Gly Gly Glu Asp 100 105 110Thr Ala Tyr Ser Leu
Gln Leu Thr Ala Pro Val Ala Gly Gln Leu Gly 115 120 125Ala Thr Thr
Val Pro Pro Ser Gly Leu Ser Val Pro Phe Ser Thr Trp 130 135 140Asp
Gln Asp His Asp Leu Arg Arg Asp Lys Asn Cys Ala Lys Ser Leu145 150
155 160Ser Gly Gly Trp Trp Phe Gly Thr Cys Ser His Ser Asn Leu Asn
Gly 165 170 175Gln Tyr Phe Arg Ser Ile Pro Gln Gln Arg Gln Lys Leu
Lys Lys Gly 180 185 190Ile Phe Trp Lys Thr Trp Arg Gly Arg Tyr Tyr
Pro Leu Gln Ala Thr 195 200 205Thr Met Leu Ile Gln Pro Met Ala Ala
Glu Ala Ala Ser 210 215 2203221PRTMus musculus 3Arg Asp Cys Gln Glu
Leu Phe Gln Glu Gly Glu Arg His Ser Gly Leu1 5 10 15Phe Gln Ile Gln
Pro Leu Gly Ser Pro Pro Phe Leu Val Asn Cys Glu 20 25 30Met Thr Ser
Asp Gly Gly Trp Thr Val Ile Gln Arg Arg Leu Asn Gly 35 40 45Ser Val
Asp Phe Asn Gln Ser Trp Glu Ala Tyr Lys Asp Gly Phe Gly 50 55 60Asp
Pro Gln Gly Glu Phe Trp Leu Gly Leu Glu Lys Met His Ser Ile65 70 75
80Thr Gly Asn Arg Gly Ser Gln Leu Ala Val Gln Leu Gln Asp Trp Asp
85 90 95Gly Asn Ala Lys Leu Leu Gln Phe Pro Ile His Leu Gly Gly Glu
Asp 100 105 110Thr Ala Tyr Ser Leu Gln Leu Thr Glu Pro Thr Ala Asn
Glu Leu Gly 115 120 125Ala Thr Asn Val Ser Pro Asn Gly Leu Ser Leu
Pro Phe Ser Thr Trp 130 135 140Asp Gln Asp His Asp Leu Arg Gly Asp
Leu Asn Cys Ala Lys Ser Leu145 150 155 160Ser Gly Gly Trp Trp Phe
Gly Thr Cys Ser His Ser Asn Leu Asn Gly 165 170 175Gln Tyr Phe His
Ser Ile Pro Arg Gln Arg Gln Glu Arg Lys Lys Gly 180 185 190Ile Phe
Trp Lys Thr Trp Lys Gly Arg Tyr Tyr Pro Leu Gln Ala Thr 195 200
205Thr Leu Leu Ile Gln Pro Met Glu Ala Thr Ala Ala Ser 210 215
220431DNAArtificial SequencesiRNA against human ANGPTL4 sense
strand 4aaagcugcaa gaugaccuca gauggaggcu g 31531DNAArtificial
SequencesiRNA against human ANGPTL4 antisense strand 5aaaacagccu
ccaucugagg ucaucuugca g 31681DNAArtificial SequenceshRNA against
human ANGPTL4 sense strand 6ucgaggcagc accugcgaau ucagcaucug
cauucaagag augcagaugc ugaauucgca 60ggugcugcuu uuuuacgcgu a
81780DNAArtificial SequencesiRNA against human ANGPTL4 antisence
strand 7agcuuacgcg uaaaaagcag caccugcgaa uucagcaucu gcaucucuug
aaugcagaug 60cugaauucgc aggugcugcc 80
* * * * *