U.S. patent application number 13/413276 was filed with the patent office on 2012-08-09 for tumor treatment.
Invention is credited to Paul Polakis.
Application Number | 20120201822 13/413276 |
Document ID | / |
Family ID | 35351719 |
Filed Date | 2012-08-09 |
United States Patent
Application |
20120201822 |
Kind Code |
A1 |
Polakis; Paul |
August 9, 2012 |
TUMOR TREATMENT
Abstract
The invention concerns an improved method for treating tumor,
including cancer, which combines the administration of a
chemotherapeutic agent and an antagonist of a gene product the
expression of which is upregulated by the chemotherapeutic agent.
The invention further concerns methods and means for the diagnosis
and classification of tumors, and for the prognosis of the outcome
of tumor treatment, and patient response to a particular treatment
modality.
Inventors: |
Polakis; Paul; (Burlingame,
CA) |
Family ID: |
35351719 |
Appl. No.: |
13/413276 |
Filed: |
March 6, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11155987 |
Jun 17, 2005 |
8147827 |
|
|
13413276 |
|
|
|
|
60580745 |
Jun 18, 2004 |
|
|
|
Current U.S.
Class: |
424/135.1 ;
424/130.1; 424/133.1; 424/136.1; 424/178.1; 506/9; 514/1.1;
514/283; 514/44A; 514/44R |
Current CPC
Class: |
A61K 31/4745 20130101;
A61K 31/7072 20130101; C07K 16/30 20130101; A61P 43/00 20180101;
A61K 31/4745 20130101; A61K 2300/00 20130101; A61K 2300/00
20130101; A61K 2039/505 20130101; A61K 31/7076 20130101; A61K
31/513 20130101; C12N 2799/022 20130101; A61K 31/525 20130101; A61K
31/513 20130101; A61P 35/00 20180101; A61K 45/06 20130101; A61K
31/522 20130101; A61P 35/04 20180101 |
Class at
Publication: |
424/135.1 ;
514/283; 424/130.1; 514/1.1; 514/44.A; 514/44.R; 424/136.1;
424/178.1; 424/133.1; 506/9 |
International
Class: |
A61K 39/395 20060101
A61K039/395; A61P 35/00 20060101 A61P035/00; A61K 31/7052 20060101
A61K031/7052; C40B 30/04 20060101 C40B030/04; A61K 31/437 20060101
A61K031/437; A61K 38/02 20060101 A61K038/02 |
Claims
1. A method comprising administering to a subject diagnosed with a
tumor an effective amount of a chemotherapeutic agent, and an
antagonist of a gene product encoded by a gene the expression of
which has been determined to be selectively upregulated in said
tumor relative to corresponding normal cells by said
chemotherapeutic agent.
2. The method of claim 1 wherein the tumor is cancer.
3. The method of claim 2 wherein said subject is human.
4. The method of claim 3 wherein said cancer is selected from the
group consisting of breast cancer, colorectal cancer, lung cancer,
prostate cancer, hepatocellular cancer, gastric cancer, pancreatic
cancer, cervical cancer, ovarian cancer, liver cancer, bladder
cancer, cancer of the urinary tract, thyroid cancer, renal cancer,
carcinoma, melanoma, brain cancer, and skin cancer.
5. The method of claim 4 wherein said cancer is lung cancer.
6. The method of claim 4 wherein said cancer is breast cancer.
7. The method of claim 4 wherein said cancer is colorectal
cancer.
8. The method of claim 7 wherein said colorectal cancer is
adenocarcinoma.
9. The method of claim 4 wherein said cancer is squamous cell
carcinoma.
10. The method of claim 3 wherein said chemotherapeutic agent is
selected from the group consisting of alkylating agents; alkyl
sulfonates; aziridines; ethylenimines; methylamelamines; nitrogen
mustards; nitrosureas; anti-metabolites; folic acid analogues;
purine analogs; pyrimidine analogs, androgens; anti-adrenals; folic
acid replenishers; aceglatone; aldophosphamide glycoside;
aminolevulinic acid; amsacrine; bestrabucil; bisantrene;
edatraxate; defofamine; demecolcine; diaziquone; elfornithine;
elliptinium acetate; etoglucid; gallium nitrate; hydroxyurea;
lentinan; lonidamine; mitoguazone; mitoxantrone; mopidamol;
nitracrine; pentostatin; phenamet; pirarubicin; podophyllinic acid;
2-ethylhydrazide; procarbazine; PSK ; razoxane; sizofiran;
spirogermanium; tenuazonic acid; triaziquone;
2,2',2''-trichlorotriethylamine; urethan; vindesine; dacarbazine;
mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine;
arabinoside ("Ara-C"); cyclophosphamide; thiotepa; taxanes;
chlorambucil; gemcitabine; 6-thioguanine; mercaptopurine;
methotrexate; platinum analogs; vinblastine; platinum; etoposide
(VP-16); ifosfamide; mitomycin C; mitoxantrone; vincristine;
vinorelbine; navelbine; novantrone; teniposide; daunomycin;
aminopterin; xeloda; ibandronate; camptothecin-11 (CPT-11,
irinotecan); topoisomerase inhibitor RFS 2000;
difluoromethylornithine (DMFO); retinoic acid; esperamicins;
capecitabine; anti-hormonal agents; and pharmaceutically acceptable
salts, acids or derivatives thereof.
11. The method of claim 10 wherein the chemotherapeutic agent is
CPT-11 or 5-FU.
12. The method of claim 11 wherein the chemotherapeutic agent is
CPT-11.
13. The method of claim 12 wherein said cancer is colorectal
cancer.
14. The method of claim 13 wherein said colon cancer is metastatic
adenocarcinoma.
15. The method of claim 3 wherein the antagonist is selected from
the group consisting of antibodies, antibody fragments,
immunoconjugates, peptides, non-peptide small organic molecules,
antisense molecules, and oligonucleotide decoys.
16. The method of claim 15 wherein the antagonist binds to said
gene product.
17. The method of claim 16 wherein the antagonist is an
antibody.
18. The method of claim 16 wherein the antibody is an antibody
fragment.
19. The method of claim 14 wherein the antibody fragment is
selected from the group consisting of Fab, Fab', F(ab')2, Fv
fragments, diabodies, linear antibodies, single-chain antibody
molecules; and multispecific antibodies formed from antibody
fragments.
20. The method of claim 16 wherein the antagonist is an
immunoconjugate.
21. The method of claim 20 wherein the antagonist is an
immunoconjugate comprising a LY6D/E48 monoclonal antibody.
22. The method of claim 21 wherein the immunoclojugate is a
LY6D/E48-MMAE immunoconjugate.
23. The method of claim 17 wherein the antibody is humanized.
24. The method of claim 17 wherein the antibody is human.
25. The method of claim 12 wherein the gene upregulated by CPT-11
is one or more of the genes listed in Table I.
26. The method of claim 25 wherein the gene upregulated by CPT-11
is selected from the group consisting of LY6D/E48/(Accession No.
Y12642); galectin-7 (Accession No. AA010777); periplakin (Accession
No. AF001691); antileukoproteinase (Accession No. X04470);
aquaporin (Accession No. N74607); annexin 8 (Accession No. X16662);
neuromedin U (Accession No. X76029); maspin (Accession No. U04313);
aquaporin 3 (Accession No. AA630981); keratin 23 (Accession No.
AI961431); est (Accession No. A1769930); SPRR3 (Accession No.
AI278521); S100-type protein (Accession No. AI963434); and genes
with expression patterns similar to galectin-7.
27. The method of claim 26 wherein the genes with similar
expression patters to galectin-7 are selected from the group
consisting of keratin 10; keratin 1; keritinocyte differentiation
associated protein; GSPT2; plakophillin; loricrin; est GB AI739528;
keratin 14; est GB W73855; profilaggrin; C4.4a; desmocollin 3;
keratin 5; LY6D/E48; HNK-1 sulfotransferase; maspin; Unigene
cluster Hs.201446; ataxia-telangiectasia group D associated
protein; and annexin VIII.
28. The method of claim 27 wherein the gene upregulated by CPT-11
is selected from the group consisting of LY6D/E48 (Accession No.
Y12642); galectin-7 (Accession No. AA010777); periplakin (Accession
No. AF001691); maspin (Accession No. U04313); and aquaporin 3
(Accession No. AA630981).
29. The method of claim 28 wherein the gene upregulated by CPT-11
is LY6D/E48 (Accession No. Y12642) or galectin-7 (Accession No.
AA010777).
30. The method of claim 29 wherein the gene upregulated by CPT-11
is LY6D/E48 and the antagonist is an anti-LY6D/E48 antibody,
antibody fragment or immunoconjugate.
31. A method for inhibiting the proliferation of tumor cells
comprising: (a) confirming the presence of at least one gene that
is selectively upregulated in said tumor cells relative to normal
cells by a chemotherapeutic agent; and (b) treating said tumor
cells with said chemotherapeutic agent and an antagonist of at
least one of said genes.
32. The method of claim 31 wherein said tumor cells are those of a
solid tumor.
33. The method of claim 32 wherein said solid tumor is a
cancer.
34. The method of claim 33 wherein said cancer is sleeted from the
group consisting of breast cancer, colorectal cancer, lung cancer,
prostate cancer, hepatocellular cancer, gastric cancer, pancreatic
cancer, cervical cancer, ovarian cancer, liver cancer, bladder
cancer, cancer of the urinary tract, thyroid cancer, renal cancer,
carcinoma, melanoma, and brain cancer.
35. The method of claim 24 wherein said antagonist is an antibody,
antibody fragment or immunoconjugate.
36. The method of claim 35 wherein said treatment is
concurrent.
37. The method of claim 35 wherein said treatment is
consecutive.
38. The method of claim 35 wherein said cells are treated with the
chemotherapeutic agents first, followed by treatment with said
antibody, antibody fragment or immunoconjugate.
39. The method of claim 35 wherein treatment with said
chemotherapeutic agent continues concurrently with the treatment
with said antibody, antibody fragment or immunoconjugate.
40. A therapeutic composition comprising an effective amount of a
chemotherapeutic agent and an antagonist of a gene product encoded
by a gene the expression of which is selectively upregulated in
tumor cells relative to corresponding normal cells by said
chemotherapeutic agent.
41. The composition of claim 40 wherein said chemotherapeutic agent
is 5-FU or CPT-11.
42. The composition of claim 41 wherein the chemotherapeutic agent
is CPT-11.
43. The composition of claim 42 wherein said tumor is colorectal
cancer.
44. The composition of claim 43 wherein said tumor is colorectal
adenocarcinoma.
45. The composition of claim 44 wherein said gene is selected from
the group consisting of LY6D/E48 (Accession No. Y12642); galectin-7
(Accession No. AA010777); periplakin (Accession No. AF001691);
maspin (Accession No. U04313); and aquaporin 3 (Accession No.
AA630981).
46. The composition of claim 45 wherein said antagonist is an
antibody, antibody fragment or immunoconjugate.
47. The composition of claim 45 wherein said antagonist is a
non-peptide small molecule.
48. A prognostic method, comprising: (a) determining the expression
level of one or more genes selected from the group consisting of
LY6D/E48 (Accession No. Y12642); galectin-7 (Accession No.
AA010777); periplakin (Accession No. AF001691); maspin (Accession
No. U04313); and aquaporin 3 (Accession No. AA630981), or its
expression product, in tumor cells of a subject diagnosed with
adenocarcinoma, before and following treatment with CPT-11,
relative to corresponding normal cells; and (b) identifying said
patient as likely to respond well to combination treatment with
CPT-11 and an antagonists of a gene, the expression of which has
been selectively induced by CPT-11 treatment.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This is a non-provisional application filed under 37 C.F.R.
1.53(b), claiming priority under U.S.C. Section 119(e) to
Provisional Application Ser. No. 60/580,745, filed on Jun. 18,
2004.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention relates to the treatment of tumor. In
particular, the invention concerns an improved method for treating
tumor, including cancer, which combines the administration of a
chemotherapeutic agent and an antagonist of a gene product the
expression of which is upregulated by the chemotherapeutic agent.
The invention further concerns methods and means for the diagnosis
and classification of tumors, and for the prognosis of the outcome
of tumor treatment, and patient response to a particular treatment
modality.
[0004] 2. Description of the Related Art
[0005] Colorectal cancer is a leading cause of cancer mortality in
Westernized countries accounting for over 50,000 deaths per year in
the United States alone (Greenlee et al. Cancer statistics, 2001,
CA Cancer J. Clin. 51:15-36). Approximately 50% of the patients
diagnosed with colorectal cancer are treated successfully by
surgical resection of the primary tumor. The remaining patients are
either diagnosed with or, subsequent to surgery, progress to
advanced disease where the 5-year survival rate drops precipitously
due to invasion and metastasis of the primary lesion (Adjei, A. A.
(1999), Br. J. Clin. Pharmacol. 48:265-277). These patients are
candidates for systemic therapy, which is administered following
surgery in the adjuvant setting or as palliative therapy for those
ineligible for surgery. For the past four decades, 5-fluorouracil
(5-FU) has served as first-line therapy for the treatment of
colorectal cancer. 5-FU is frequently used in combination with
drugs such as leucovorin, which enhance the inhibition of
thymidylate synthase by 5-FU treatment (Poon et al. (1991) J. Clin.
Oncol. 9, 1967-1972). However, inhibition of thymidylate synthase
alone is likely approaching a limit with respect to efficacy in
colorectal cancer (Ragnhammer et al. (2001) Acta Oncol 40,
282-308). More recently, iminotecan (CPT-11) was proven beneficial
for patients that has failed 5-FU-based therapies and was
subsequently tested in combination therapy with 5-FU (Saltz et al.
(2000) N. Engl. J. Med. 343, 905-914). 5-FU/leucovorin plus CPT-11
is now recommended as first-line therapy in advanced colorectal
cancer.
[0006] The most common group of cancers among women in the United
States is breast cancer, which is a complex disease, including
several distinct subtypes, which differ in their pathology and
respond differently to standard treatment. Several groups have
conducted gene expression studies to classify various breast cancer
types or predict clinical outcome (see, e.g. Golub et al. (1999)
Science 286:531-537; Bhattacharjae et al. (2001) Proc. Natl. Acad.
Sci. USA 98:13790-13795; Chen-Hsiang et al. (2001), Bioinformatics
17 (Suppl. 1):S316-S322; Ramaswamy et al. (2001) Proc. Natl. Acad.
Sci. USA 98:15149-15154 (2001); Martin et al. (2000) Cancer Res.
60:2232-2238; West et al., (2001) Proc. Natl. Acad. Sci. USA
98:11462-11467); Sorlie et al., (2001) Proc. Natl. Acad. Sci. USA
98:10869-10874; Yan et al., Cancer Res. 61:8375-8380 (2001); Van De
Vivjer et al. (2002), New England Journal of Medicine 347:
1999-2009; Ahr et al, (2002) Lancet 359:131-2; van't Veer et al.
(2002) Nature 415:530-6; Dowsett and Ellis (2003) Am. J. Clin.
Oncol. 25:S34-9). It has been reported that 5-FU treatment
transcriptionally activates certain genes in breast cancer cell
lines and 5-FU resistant colorectal cancer cell lines (Maxwell et
al. (2003) Cancer Res. 63:4602-4606).
SUMMARY OF THE INVENTION
[0007] The present invention is, at least in part, based on the
recognition that differences in gene expression between normal and
cancer cells following exposure to standard care chemotherapeutics
can be exploited to provide new combination therapies of cancer.
For example, a cell surface antigen preferentially induced in
cancer cells following drug treatment might serve as a target for
an antagonist, such as, for example, a therapeutic antibody or a
small molecule, used in combination with that drug. In addition,
having an understanding of the genetic programs engaged by
drug-treated cancer cells can provide new markers for efficacy and
prognosis as well as further our understanding the mechanisms of
drug action.
[0008] In one aspect, the invention concerns a method comprising
administering to a subject diagnosed with a tumor an effective
amount of a chemotherapeutic agent, and an antagonist of a gene
product encoded by a gene the expression of which has been
determined to be selectively upregulated in such tumor relative to
corresponding normal cells by the chemotherapeutic agent.
[0009] In another aspect, the invention concerns a method for
inhibiting the proliferation of tumor cells comprising:
[0010] (a) confirming the presence of at least one gene that is
selectively upregulated in said tumor cells relative to normal
cells by a chemotherapeutic agent; and
[0011] (b) treating said tumor cells with the chemotherapeutic
agent and an antagonist of at least one of the selectively
upregulated genes.
[0012] In yet another aspect, the invention concerns a therapeutic
composition comprising an effective amount of a chemotherapeutic
agent and an antagonist of a gene product encoded by a gene the
expression of which is selectively upregulated in tumor cells
relative to corresponding normal cells by the chemotherapeutic
agent.
[0013] In a still further aspect, the invention concerns a
prognostic method, comprising:
[0014] (a) determining the expression level of one or more genes,
or their expression products, before and after treatment with a
chemotherapeutic agent, relative to corresponding normal cells, in
a subject diagnosed with a tumor; and
[0015] (b) identifying the subject as likely to respond well to
combination treatment with the chemotherapeutic agent and an
antagonist of a gene, the expression of which has been selectively
induced by the chemotherapeutic agent.
[0016] In all aspects, the tumor is preferably cancer, such as, for
example, breast cancer, colorectal cancer, lung cancer, prostate
cancer, hepatocellular cancer, gastric cancer, pancreatic cancer,
cervical cancer, ovarian cancer, liver cancer, bladder cancer,
cancer of the urinary tract, thyroid cancer, renal cancer,
carcinoma, melanoma, or brain cancer.
[0017] The chemotherapeutic agent can be any molecule currently
used or developed in the future for the treatment of tumor, e.g.
cancer. Chemotherapeutic agents include, without limitation,
alkylating agents; alkyl sulfonates; aziridines; ethylenimines;
methylamelamines; nitrogen mustards; nitrosureas; anti-metabolites;
folic acid analogues; purine analogs; pyrimidine analogs,
androgens; anti-adrenals; folic acid replenishers; aceglatone;
aldophosphamide glycoside; aminolevulinic acid; amsacrine;
bestrabucil; bisantrene; edatraxate; defofamine; demecolcine;
diaziquone; elfornithine; elliptinium acetate; etoglucid; gallium
nitrate; hydroxyurea; lentinan; lonidamine; mitoguazone;
mitoxantrone; mopidamol; nitracrine; pentostatin; phenamet;
pirarubicin; podophyllinic acid; 2-ethylhydrazide; procarbazine;
PSK.TM.; razoxane; sizofiran; spirogermanium; tenuazonic acid;
triaziquone; 2,2',2''-trichlorotriethylamine; urethan; vindesine;
dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman;
gacytosine; arabinoside ("Ara-C"); cyclophosphamide; thiotepa;
taxanes; chlorambucil; gemcitabine; 6-thioguanine; mercaptopurine;
methotrexate; platinum analogs; vinblastine; platinum; etoposide
(VP-16); ifosfamide; mitomycin C; mitoxantrone; vincristine;
vinorelbine; navelbine; novantrone; teniposide; daunomycin;
aminopterin; xeloda; ibandronate; camptothecin-11 (CPT-11);
topoisomerase inhibitor RFS 2000; difluoromethylornithine (DMFO);
retinoic acid; esperamicins; capecitabine; anti-hormonal agents;
and pharmaceutically acceptable salts, acids or derivatives
thereof.
[0018] In all aspects, the preferred chemotherapeutic agent is
CPT-11 or 5-FU.
[0019] In all aspects, antagonist include, for example, antibodies,
peptides, non-peptide small organic molecules, antisense molecules,
and oligonucleotide decoys, antibodies (including antibody
fragments) and non-peptide small organic molecules being preferred.
The antibody can be humanized (including chimeric antibodies), or
human, for example. The antagonist cab bind to or otherwise
interact with the gene product.
BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Table I. Transcripts induced in Colo205 tumor xenografts
exposed to CPT-11. Three tumor-bearing mice each were treated with
CPT-11 or saline control and oligonucleotide microarray analysis
was performed on all 6 RNA preparations. The fold change for
transcripts in each CPT-11 treated sample relative to each control
was calculated and the average fold change (Avg fold) for the nine
possible comparisons is presented along with the percentage (%
AGREE) of comparisons yielding a positive fold change.
[0021] Table II. Transcripts induced in the intestine f mice
exposed to CPT-11. Three tumor-bearing mice each were treated with
CPT-11 or saline control and oligonucleotide microarray analysis
was performed on all 6 RNA preparations. The fold change for
transcripts in each CPT-11 sample relative to each control was
calculated and the average fold change (Ave fold) for the nine
possible comparisons is presented along with the percentage (%
AGREE) of comparisons yielding a positive fold change.
[0022] FIG. 1. mRNA transcripts coding for cell surface proteins
induced by CPT-11 (Table I). A. Real-time PCR analysis of RNA from
xenograft tumors grown in mice administered CPT-11 or saline.
Relative amounts of the six transcripts were measured in three
tumors from each group and plotted as fold change relative to S1,
arbitrarily set to one. Cycle thresholds (Ct) were normalized to
GAPDH (white bars) and Actine (black bars). B. Time course of
LY6D/E48 mRNA induction following addition of 10 .mu.M CPT-11 for
48 hours. Fold change is relative to vehicle control. Transcript
was not detected (ND) in PC3 and 293 cell lines.
[0023] FIG. 2. Real-time PCR analysis of mRNA transcripts
identified by microarray analysis. The relative expression levels
of the some of the genes induced by CPT-11 (Table I) were compared
in a parallel analysis using RNA extracted from the Colo205 and
DLD-1 tumors. Cycle threshold values were normalized to both GAPDH
(white bars) and Actin (black bars) and fold increases are relative
to S1, which was set to a value of one.
[0024] FIG. 3. Expression of mouse intestinal transcripts
homologous to those induced in human tumor xenografts. Signal
intensities are presented via standard deviations obtained by
oligonucleotide array analysis of RNA extracted from three
independent human tumor xenografts from mice treated with CPT-11
(black bars) or saline control (white bars). The indicated
transcripts are those that underwent the highest and most
consistent induction on the human array (upper panel) determined by
a fold-change algorithm (Table I) and that were also represented by
a homolog on the mouse array (lower).
[0025] FIG. 4. Induction of E48/Ly-6D gene expression in Colo205
cells by CPT-11 in vitro. Cultured Colo205 cells were incubated
with the indicated concentrations of CPT-11 for 2 days and then
subjected to immunofluorescent straining (A) or fluorescent
activated cell sorting (B) using monoclonal antibodies specific to
E48/Ly-6D. Immunofluorescent staining for E48/Ly-6D was performed
with antibody 15A5 (green) and the cells counter stained with DAPI
(blue) to localize nuclei. Fluorescent activated cell sorting was
performed with two independent monoclonal antibodies to E48/Ly-6D
(15A5 and 17H7), a control antibody reactive to an epitope not
present on E48 (GD) and with secondary (2.degree.) antibody
only.
[0026] FIG. 5. Effect of CPT-11 and anti-LY6D/E48-vc-MMAE on tumor
growth in vivo. Mice were inoculated with colo205 human colorectal
cancer cells. Following the appearance of palpable tumors, animals
were administered three doses of 80 mg/kgCPT-11 alone or in
combination with 3 mg/kg anti-LY6D/E48-vc-MMAE or anti-IL8-vc-MMAE,
as a negative control, according to the indicated schedule.
[0027] FIG. 6. Anti-tumor activity of CPT-11 combined with
anti-LY6D/E48 immunoconjugate. A. Nude mice bearing Colo205 human
tumor xenografts were administered three doses of CPT-11 at 80
mg/kg (open arrows) plus four doses at 3 mg/kg of either
anti-LY6D/E48-vc-MMAE or control immunoconjugate anti-IL8-vc-MMAE
(closed arrows). A third group received CPT-11 plus MAb vehicle
(PBS). B. The immunoconjugates and PBS control were administered in
the absence of CPT-11.
[0028] FIG. 7. H&E staining of Colo205 human tumor xenografts.
Tumor xenografts were fixed in formalin/ethanol and sections were
stained with hematoxylin and Eosin. Examples of tumors from mice
administered CT-11 (right) or saline (left) are presented.
[0029] FIG. 8. Scatter plot of gene expression data for normal
intestine. Oligonucleotide array data obtained with RNA extracted
from normal intestine of tumor bearing mice treated with saline
(Y-axis) or CPT-11 (X-axis) presented as a 2-D plot. Signal
intensities for all probes on the Mu74Av2 mouse chip set are
plotted on a log.sub.10 scale. Most probes fall on the diagonal,
which indicates no difference on treatment with CPT-11.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
A. Definitions
[0030] Unless defined otherwise, technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs.
Singleton et al., Dictionary of Microbiology and Molecular Biology
2nd ed., J. Wiley & Sons (New York, N.Y. 1994), and March,
Advanced Organic Chemistry Reactions, Mechanisms and Structure 4th
ed., John Wiley & Sons (New York, N.Y. 1992), provide one
skilled in the art with a general guide to many of the terms used
in the present application.
[0031] One skilled in the art will recognize many methods and
materials similar or equivalent to those described herein, which
could be used in the practice of the present invention. Indeed, the
present invention is in no way limited to the methods and materials
described. For purposes of the present invention, the following
terms are defined below.
[0032] The term "microarray" refers to an ordered arrangement of
hybridizable array elements, preferably polynucleotide probes, on a
substrate.
[0033] The term "polynucleotide," when used in singular or plural,
generally refers to any polyribonucleotide or
polydeoxribonucleotide, which may be unmodified RNA or DNA or
modified RNA or DNA. Thus, for instance, polynucleotides as defined
herein include, without limitation, single- and double-stranded
DNA, DNA including single- and double-stranded regions, single- and
double-stranded RNA, and RNA including single- and double-stranded
regions, hybrid molecules comprising DNA and RNA that may be
single-stranded or, more typically, double-stranded or include
single- and double-stranded regions. In addition, the term
"polynucleotide" as used herein refers to triple-stranded regions
comprising RNA or DNA or both RNA and DNA. The strands in such
regions may be from the same molecule or from different molecules.
The regions may include all of one or more of the molecules, but
more typically involve only a region of some of the molecules. One
of the molecules of a triple-helical region often is an
oligonucleotide. The term "polynucleotide" specifically includes
cDNAs. The term includes DNAs (including cDNAs) and RNAs that
contain one or more modified bases. Thus, DNAs or RNAs with
backbones modified for stability or for other reasons are
"polynucleotides" as that term is intended herein. Moreover, DNAs
or RNAs comprising unusual bases, such as inosine, or modified
bases, such as tritiated bases, are included within the term
"polynucleotides" as defined herein. In general, the term
"polynucleotide" embraces all chemically, enzymatically and/or
metabolically modified forms of unmodified polynucleotides, as well
as the chemical forms of DNA and RNA characteristic of viruses and
cells, including simple and complex cells.
[0034] The term "oligonucleotide" refers to a relatively short
polynucleotide, including, without limitation, single-stranded
deoxyribonucleotides, single- or double-stranded ribonucleotides,
RNA:DNA hybrids and double-stranded DNAs. Oligonucleotides, such as
single-stranded DNA probe oligonucleotides, are often synthesized
by chemical methods, for example using automated oligonucleotide
synthesizers that are commercially available. However,
oligonucleotides can be made by a variety of other methods,
including in vitro recombinant DNA-mediated techniques and by
expression of DNAs in cells and organisms.
[0035] The terms "differentially expressed gene," "differential
gene expression" and their synonyms, which are used
interchangeably, refer to a gene whose expression is activated to a
higher or lower level in a subject suffering from a disease,
specifically cancer, such as breast cancer, relative to its
expression in a normal or control subject. The terms also include
genes whose expression is higher or lower level at different stages
of the same disease. The terms also include genes whose expression
is higher or lower in patients who are significantly sensitive or
resistant to certain therapeutic drugs. It is also understood that
a differentially expressed gene may be either activated or
inhibited at the nucleic acid level or protein level, or may be
subject to alternative splicing to result in a different
polypeptide product. Such differences may be evidenced by a change
in mRNA levels, surface expression, secretion or other partitioning
of a polypeptide, for example. Differential gene expression may
include a comparison of expression between two or more genes or
their gene products, or a comparison of the ratios of the
expression between two or more genes or their gene products, or
even a comparison of two differently processed products of the same
gene, which differ between normal subjects and subjects suffering
from a disease, specifically cancer, or between various stages of
the same disease. Differential expression includes both
quantitative, as well as qualitative, differences in the temporal
or cellular expression pattern in a gene or its expression products
among, for example, normal and diseased cells, or among cells which
have undergone different disease events or disease stages, or cells
that are significantly sensitive or resistant to certain
therapeutic drugs For the purpose of this invention, "differential
gene expression" is considered to be present when there is at least
an about two-fold, preferably at least about four-fold, more
preferably at least about six-fold, most preferably at least about
ten-fold difference between the expression of a given gene in
normal and diseased subjects, or in various stages of disease
development in a diseased subject, or in patients who are
differentially sensitive to certain therapeutic drugs.
[0036] The term "selectively upregulated" is used herein to refer
to a gene that is induced by at least two-fold in a tumor by a
given treatment whereas no significant induction is detected in
corresponding normal tissue in the same treated subject.
[0037] The term "tumor," as used herein, refers to all neoplastic
cell growth and proliferation, whether malignant or benign, and all
pre-cancerous and cancerous cells and tissues.
[0038] The terms "cancer" and "cancerous" refer to or describe the
physiological condition in mammals that is typically characterized
by unregulated cell growth. Examples of cancer include but are not
limited to, breast cancer, colon cancer, lung cancer, prostate
cancer, hepatocellular cancer, gastric cancer, pancreatic cancer,
cervical cancer, ovarian cancer, liver cancer, bladder cancer,
cancer of the urinary tract, thyroid cancer, renal cancer,
carcinoma, melanoma, and brain cancer.
[0039] The "pathology" of cancer includes all phenomena that
compromise the well-being of the patient. This includes, without
limitation, abnormal or uncontrollable cell growth, metastasis,
interference with the normal functioning of neighboring cells,
release of cytokines or other secretory products at abnormal
levels, suppression or aggravation of inflammatory or immunological
response, neoplasia, premalignancy, malignancy, invasion of
surrounding or distant tissues or organs, such as lymph nodes,
etc.
[0040] The term "treatment" refers to both therapeutic treatment
and prophylactic or preventative measures, wherein the object is to
prevent or slow down (lessen) the targeted pathologic condition or
disorder. Those in need of treatment include those already with the
disorder as well as those prone to have the disorder or those in
whom the disorder is to be prevented. In tumor (e.g., cancer)
treatment, a therapeutic agent may directly decrease the pathology
of tumor cells, or render the tumor cells more susceptible to
treatment by other therapeutic agents, e.g., radiation and/or
chemotherapy.
[0041] A "chemotherapeutic agent" is a chemical compound useful in
the treatment of cancer. Examples of chemotherapeutic agents
include alkylating agents such as thiotepa and cyclosphosphamide
(CYTOXAN.TM.); alkyl sulfonates such as busulfan, improsulfan and
piposulfan; aziridines such as benzodopa, carboquone, meturedopa,
and uredopa; ethylenimines and methylamelamines including
altretamine, triethylenemelamine, trietylenephosphoramide,
triethylenethiophosphaoramide and trimethylolomelamine; nitrogen
mustards such as chlorambucil, chlomaphazine, cholophosphamide,
estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide
hydrochloride, melphalan, novembichin, phenesterine, prednimustine,
trofosfamide, uracil mustard; nitrosureas such as carmustine,
chlorozotocin, fotemustine, lomustine, nimustine, ranimustine;
antibiotics such as aclacinomysins, actinomycin, authramycin,
azaserine, bleomycins, cactinomycin, calicheamicin, carabicin,
caminomycin, carzinophilin, chromomycins, dactinomycin,
daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, doxorubicin,
epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins,
mycophenolic acid, nogalamycin, olivomycins, peplomycin,
potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin,
streptozocin, tubercidin, ubenimex, zinostatin, zorubicin;
anti-metabolites such as methotrexate and 5-fluorouracil (5-FU);
folic acid analogues such as denopterin, methotrexate, pteropterin,
trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine,
thiamiprine, thioguanine; pyrimidine analogs such as ancitabine,
azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine,
doxifluridine, enocitabine, floxuridine, androgens such as
calusterone, dromostanolone propionate, epitiostanol, mepitiostane,
testolactone; anti-adrenals such as aminoglutethimide, mitotane,
trilostane; folic acid replenisher such as frolinic acid;
aceglatone; aldophosphamide glycoside; aminolevulinic acid;
amsacrine; bestrabucil; bisantrene; edatraxate; defofamine;
demecolcine; diaziquone; elformithine; elliptinium acetate;
etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidamine;
mitoguazone; mitoxantrone; mopidamol; nitracrine; pentostatin;
phenamet; pirarubicin; podophyllinic acid; 2-ethylhydrazide;
procarbazine; PSK.RTM.; razoxane; sizofiran; spirogermanium;
tenuazonic acid; triaziquone; 2,2',2''-trichlorotriethylamine;
urethan; vindesine; dacarbazine; mannomustine; mitobronitol;
mitolactol; pipobroman; gacytosine; arabinoside ("Ara-C");
cyclophosphamide; thiotepa; taxanes, e.g. paclitaxel (TAXOL.TM.,
Bristol-Myers Squibb Oncology, Princeton, N.J.) and docetaxel
(TAXOTERE.TM., Rhone-Poulenc Rorer, Antony, France); chlorambucil;
gemcitabine; 6-thioguanine; mercaptopurine; methotrexate; platinum
analogs such as cisplatin and carboplatin; vinblastine; platinum;
etoposide (VP-16); ifosfamide; mitomycin C; mitoxantrone;
vincristine; vinorelbine; navelbine; novantrone; teniposide;
daunomycin; aminopterin; xeloda; ibandronate; camptothecin-11
(CPT-11); topoisomerase inhibitor RFS 2000; difluoromethylornithine
(DMFO); retinoic acid; esperamicins; capecitabine; and
pharmaceutically acceptable salts, acids or derivatives of any of
the above. Also included in this definition are anti-hormonal
agents that act to regulate or inhibit hormone action on tumors
such as anti-estrogens including for example tamoxifen, raloxifene,
aromatase inhibiting 4(5)-imidazoles, 4-hydroxytamoxifen,
trioxifene, keoxifene, LY 117018, onapristone, and
toremifene(Fareston); and anti-androgens such as flutamide,
nilutamide, bicalutamide, leuprolide, and goserelin; and
pharmaceutically acceptable salts, acids or derivatives of any of
the above.
[0042] A "growth inhibitory agent" when used herein refers to a
compound or composition which inhibits growth of a tumor, such as a
cancer, cell, either in vitro or in vivo. Thus, the growth
inhibitory agent is one which significantly reduces the percentage
of tumor cells in S phase. Examples of growth inhibitory agents
include agents that block cell cycle progression (at a place other
than S phase), such as agents that induce G1 arrest and M-phase
arrest. Classical M-phase blockers include the vincas (vincristine
and vinblastine), TAXOL.TM., and topo II inhibitors such as
doxorubicin, epirubicin, daunorubicin, etoposide, and bleomycin.
Those agents that arrest G1 also spill over into S-phase arrest,
for example, DNA alkylating agents such as tamoxifen, prednisone,
dacarbazine, mechlorethamine, cisplatin, methotrexate,
5-fluorouracil (5-FU), and ara-C. Further information can be found
in The Molecular Basis of Cancer, Mendelsohn and Israel, eds.,
Chapter 1, entitled "Cell cycle regulation, oncogenes, and
antineoplastic drugs" by Murakami et al. (W B Saunders:
Philadelphia, 1995), especially p. 13.
[0043] "Neoadjuvant therapy" is adjunctive or adjuvant therapy
given prior to the primary (main) therapy. Neoadjuvant therapy
includes, for example, chemotherapy, radiation therapy, and hormone
therapy. Thus, chemotherapy may be administered prior to surgery to
shrink the tumor, so that surgery can be more effective, or, in the
case of previously inoperable tumors, possible
[0044] The term "front loading" when referring to drug
administration is meant to describe an initially higher dose
followed by the same or lower doses at intervals. The initial
higher dose or doses are meant to more rapidly increase the animal
or human patient's serum drug concentration to an efficacious
target serum concentration. Front loading drug delivery includes
delivery of initial and maintenance doses by infusion or bolus
administration, intravenously or subcutaneously, for example.
[0045] "Antibodies" (Abs) and "immunoglobulins" (Igs) are
glycoproteins having the same structural characteristics. While
antibodies exhibit binding specificity to a specific antigen,
immunoglobulins include both antibodies and other antibody-like
molecules which lack antigen specificity. Polypeptides of the
latter kind are, for example, produced at low levels by the lymph
system and at increased levels by myelomas.
[0046] "Native antibodies" and "native immunoglobulins" are usually
heterotetrameric glycoproteins of about 150,000 daltons, composed
of two identical light (L) chains and two identical heavy (H)
chains. Each light chain is linked to a heavy chain by one covalent
disulfide bond, while the number of disulfide linkages varies among
the heavy chains of different immunoglobulin isotypes. Each heavy
and light chain also has regularly spaced intrachain disulfide
bridges. Each heavy chain has at one end a variable domain
(V.sub.H) followed by a number of constant domains. Each light
chain has a variable domain at one end (V.sub.L) and a constant
domain at its other end; the constant domain of the light chain is
aligned with the first constant domain of the heavy chain, and the
light-chain variable domain is aligned with the variable domain of
the heavy chain. Particular amino acid residues are believed to
form an interface between the light- and heavy-chain variable
domains.
[0047] The term "variable" refers to the fact that certain
portions-of the variable domains differ extensively in sequence
among antibodies and are used in the binding and specificity of
each particular antibody for its particular antigen. However, the
variability is not evenly distributed throughout the variable
domains of antibodies. It is concentrated in three segments called
complementarity determining regions (CDRs) or hypervariable regions
both in the light-chain and the heavy-chain variable domains. The
more highly conserved portions of variable domains are called the
framework region (FR). The variable domains of native heavy and
light chains each comprise four FR regions, largely adopting a
.beta.-sheet configuration, connected by three CDRs, which form
loops connecting, and in some cases forming part of, the n-sheet
structure. The CDRs in each chain are held together in close
proximity by the FRs and, with the CDRs from the other chain,
contribute to the formation of the antigen-binding site of
antibodies (see Kabat et al., NIH Publ. No. 91-3242, Vol. I, pages
647-669 [1991]). The constant domains involved directly in binding
an antibody to an antigen, but exhibit various effector functions,
such as participation of the antibody in antibody dependent
cellular cytotoxicity.
[0048] Papain digestion of antibodies produces two identical
antigen-binding fragments, called "Fab" fragments, each with a
single antigen-binding site, and a residual "Fc" fragment, whose
name reflects its ability to crystallize readily. Pepsin treatment
yields an F(ab').sub.2 fragment that has two antigen-combining
sites and is still capable of cross-linking antigen.
[0049] "Fv" is the minimum antibody fragment which contains a
complete antigen-recognition and -binding site. This region
consists of a dimer of one heavy- and one light-chain variable
domain in tight, non-covalent association. It is in this
configuration that the three CDRs of each variable domain interact
to define an antigen-binding site on the surface of the
V.sub.H-V.sub.L dimer. Collectively, the six CDRs confer
antigen-binding specificity to the antibody. However, even a single
variable domain (or half of an Fv comprising only three CDRs
specific for an antigen) has the ability to recognize and bind
antigen, although at a lower affinity than the entire binding
site.
[0050] The Fab fragment also contains the constant domain of the
light chain and the first constant domain (CH1) of the heavy chain.
Fab' fragments differ from Fab fragments by the addition of a few
residues at the carboxy terminus of the heavy chain CH1 domain
including one or more cysteines from the antibody hinge region.
Fab'-SH is the designation herein for Fab' in which the cysteine
residue(s) of the constant domains bear a free thiol group.
F(ab').sub.2 antibody fragments originally were produced as pairs
of Fab' fragments which have hinge cysteines between them. Other
chemical couplings of antibody fragments are also known.
[0051] The "light chains" of antibodies (immunoglobulins) from any
vertebrate species can be assigned to one of two clearly distinct
types, called kappa (.kappa.) and lambda (.lamda.), based on the
amino acid sequences of their constant domains. Depending on the
amino acid sequence of the constant domain of their heavy chains,
immunoglobulins can be assigned to different classes. There are
five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM,
and several of these may be further divided into subclasses
(isotypes), e.g., IgG1, IgG2, IgG3, IgG4, IgA, and IgA2. The
heavy-chain constant domains that correspond to the different
classes of immunoglobulins are called .alpha., .delta., .epsilon.,
.gamma., and .mu., respectively. The subunit structures and
three-dimensional configurations of different classes of
immunoglobulins are well known.
[0052] The term "antibody" is used in the broadest sense and
specifically covers intact monoclonal antibodies, polyclonal
antibodies, multispecific antibodies (e.g. bispecific antibodies)
formed from at least two intact antibodies, and antibody fragments
so long as they exhibit the desired biological activity.
[0053] "Antibody fragments" comprise a portion of an intact
antibody, preferably the antigen binding or variable region of the
intact antibody. Examples of antibody fragments include Fab, Fab',
F(ab').sub.2, and Fv fragments; diabodies; linear antibodies
(Zapata et al., Protein Eng. 8(10): 1057-1062 [1995]); single-chain
antibody molecules; and multispecific antibodies formed from
antibody fragments.
[0054] The term "monoclonal antibody" as used herein refers to an
antibody obtained from a population of substantially homogeneous
antibodies, i.e., the individual antibodies comprising the
population are identical except for possible naturally occurring
mutations that may be present in minor amounts. Monoclonal
antibodies are highly specific, being directed against a single
antigenic site. Furthermore, in contrast to conventional
(polyclonal) antibody preparations which typically include
different antibodies directed against different determinants
(epitopes), each monoclonal antibody is directed against a single
determinant on the antigen. In addition to their specificity, the
monoclonal antibodies are advantageous in that they are synthesized
by the hybridoma culture, uncontaminated by other immunoglobulins.
The modifier "monoclonal" indicates the character of the antibody
as being obtained from a substantially homogeneous population of
antibodies, and is not to be construed as requiring production of
the antibody by any particular method. For example, the monoclonal
antibodies to be used in accordance with the present invention may
be made by the hybridoma method first described by Kohler et al.,
Nature, 256:495 (1975), or may be made by recombinant DNA methods
(see, e.g., U.S. Pat. No. 4,816,567). The "monoclonal antibodies"
may also be isolated from phage antibody libraries using the
techniques described in Clackson et al., Nature, 352:624-628 (1991)
and Marks et al., J. Mol. Biol., 222:581-597 (1991), for
example
[0055] The monoclonal antibodies herein specifically include
"chimeric" antibodies (immunoglobulins) in which portion of the
heavy and/or light chain is identical with or homologous to
corresponding sequences in antibodies derived from a particular
species or belonging to a particular antibody class or subclass,
while the remainder of the chain(s) is identical with or homologous
to corresponding sequences in antibodies derived from another
species or belonging to another antibody class or subclass, as well
as fragments of such antibodies, so long as they exhibit the
desired biological activity (U.S. Pat. No. 4,816,567; Morrison et
al., Proc. Natl. Acad. Sci. USA, 81:6851-6855 [1984]).
[0056] "Humanized" forms of non-human (e.g., murine) antibodies are
chimeric immunoglobulins, immunoglobulin chains or fragments
thereof (such as Fv, Fab, Fab', F(ab').sub.2 or other
antigen-binding subsequences of antibodies) which contain minimal
sequence derived from non-human immunoglobulin. For the most part,
humanized antibodies are human immunoglobulins (recipient antibody)
in which residues from a complementarity determining region (CDR)
of the recipient are replaced by residues from a CDR of a non-human
species (donor antibody) such as mouse, rat or rabbit having the
desired specificity, affinity, and capacity. In some instances,
framework region (FR) residues of the human immunoglobulin are
replaced by corresponding non-human residues. Furthermore,
humanized antibodies may comprise residues which are found neither
in the recipient antibody nor in the imported CDR or framework
sequences. These modifications are made to further refine and
maximize antibody performance. In general, the humanized antibody
will comprise substantially all of at least one, and typically two,
variable domains, in which all or substantially all of the CDRs
correspond to those of a non-human immunoglobulin and all or
substantially all of the FRs are those of a human immunoglobulin
sequence. The humanized antibody optimally also will comprise at
least a portion of an immunoglobulin constant region (Fc),
typically that of a human immunoglobulin. For further details, see
Jones et al., Nature, 321:522-525 (1986); Reichmann et al., Nature,
332:323-329 (1988); and Presta, Curr. Op. Struct. Biol., 2:593-596
(1992). The humanized antibody includes a PRIMATIZED.TM. antibody
wherein the antigen-binding region of the antibody is derived from
an antibody produced by immunizing macaque monkeys with the antigen
of interest.
[0057] "Single-chain Fv" or "sFv" antibody fragments comprise the
V.sub.H and V.sub.L domains of antibody, wherein these domains are
present in a single polypeptide chain. Preferably, the Fv
polypeptide further comprises a polypeptide linker between the
V.sub.H and V.sub.L domains which enables the sFv to form the
desired structure for antigen binding. For a review of sFv see
Pluckthun in The Pharmacology of Monoclonal Antibodies, vol. 113,
Rosenburg and Moore eds., Springer-Verlag, New York, pp. 269-315
(1994).
[0058] The term "diabodies" refers to small antibody fragments with
two antigen-binding sites, which fragments comprise a heavy-chain
variable domain (V.sub.H) connected to a light-chain variable
domain (V.sub.L) in the same polypeptide chain (V.sub.H-V.sub.L).
By using a linker that is too short to allow pairing between the
two domains on the same chain, the domains are forced to pair with
the complementary domains of another chain and create two
antigen-binding sites. Diabodies are described more fully in, for
example, EP 404,097; WO 93/11161; and Hollinger et al., Proc. Natl.
Acad. Sci. USA, 90:6444-6448 (1993).
[0059] An "isolated" antibody is one which has been identified and
separated and/or recovered from a component of its natural
environment. Contaminant components of its natural environment are
materials which would interfere with diagnostic or therapeutic uses
for the antibody, and may include enzymes, hormones, and other
proteinaceous or nonproteinaceous solutes. In preferred
embodiments, the antibody will be purified (1) to greater than 95%
by weight of antibody as determined by the Lowry method, and most
preferably more than 99% by weight, (2) to a degree sufficient to
obtain at least 15 residues of N-terminal or internal amino acid
sequence by use of a spinning cup sequenator, or (3) to homogeneity
by SDS-PAGE under reducing or nonreducing conditions using
Coomassie blue or, preferably, silver stain. Isolated antibody
includes the antibody in situ within recombinant cells since at
least one component of the antibody's natural environment will not
be present. Ordinarily, however, isolated antibody will be prepared
by at least one purification step.
[0060] "Treatment" refers to both therapeutic treatment and
prophylactic or preventative measures. Those in need of treatment
include those already with the disorder as well as those in which
the disorder is to be prevented.
[0061] "Mammal" for purposes of treatment refers to any animal
classified as a mammal, including humans, higher primates, rodents,
domestic and farm animals, and zoo, sports, or pet animals, such as
dogs, horses, cats, cows, etc. Preferably, the mammal is human.
[0062] The term "antagonist" as used herein refers to a molecule
having the ability to inhibit a biological function of a target
polypeptide. Accordingly, the term "antagonist" is defined in the
context of the biological role of the target polypeptide. While
preferred antagonists herein specifically interact with (e.g. bind
to) the target, molecules that inhibit a biological activity of the
target polypeptide by interacting with other members of the signal
transduction pathway of which the target polypeptide is a member
are also specifically included within this definition. A preferred
biological activity inhibited by an antagonist is associated with
the development, growth, or spread of a tumor. Antagonists, as
defined herein, without limitation, include antibodies, antibody
fragments, peptides, non-peptide small molecules, antisense
molecules, and oligonucleotide decoys.
B. Detailed Description
[0063] The practice of the present invention will employ, unless
otherwise indicated, conventional techniques of molecular biology
(including recombinant techniques), microbiology, cell biology, and
biochemistry, which are within the skill of the art. Such
techniques are explained fully in the literature, such as,
"Molecular Cloning: A Laboratory Manual", 2nd edition (Sambrook et
al., 1989); "Oligonucleotide Synthesis" (M. J. Gait, ed., 1984);
"Animal Cell Culture" (R. I. Freshney, ed., 1987); "Methods in
Enzymology" (Academic Press, Inc.); "Handbook of Experimental
Immunology", 4th edition (D. M. Weir & C. C. Blackwell, eds.,
Blackwell Science Inc., 1987); "Gene Transfer Vectors for Mammalian
Cells" (J. M. Miller & M. P. Calos, eds., 1987); "Current
Protocols in Molecular Biology" (F. M. Ausubel et al., eds., 1987);
and "PCR: The Polymerase Chain Reaction", (Mullis et al., eds.,
1994).
[0064] Gene Expression Profiling Methods
[0065] The present invention takes advantage of the result of gene
expression analysis, performed on tumor samples before and after
treatment with a given chemotherapeutic agent, and on corresponding
normal samples.
[0066] Methods of gene expression profiling include methods based
on hybridization analysis of polynucleotides, methods based on
sequencing of polynucleotides, and proteomics-based methods. The
most commonly used methods known in the art for the quantification
of mRNA expression in a sample include northern blotting and in
situ hybridization (Parker & Barnes, Methods in Molecular
Biology 106:247-283 (1999)); RNAse protection assays (Hod,
Biotechniques 13:852-854 (1992)); and PCR-based methods, such as
reverse transcription polymerase chain reaction (RT-PCR) (Weis et
al., Trends in Genetics 8:263-264 (1992)). Alternatively,
antibodies may be employed that can recognize specific duplexes,
including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes
or DNA-protein duplexes. Representative methods for
sequencing-based gene expression analysis include Serial Analysis
of Gene Expression (SAGE), and gene expression analysis by
massively parallel signature sequencing (MPSS).
[0067] Differential gene expression is often studied using
microarray techniques. Thus, the expression profile of genes in
tumor cells before and after treatment with a chemotherapeutic
agents can be measured using microarray technology. In this method,
polynucleotide sequences of interest (including cDNAs and
oligonucleotides) are plated, or arrayed, on a microchip substrate.
The arrayed sequences are then hybridized with specific DNA probes
from cells or tissues of interest. The source of mRNA may, for
example, be total RNA isolated from human tumors or tumor cell
lines, and corresponding normal tissues or cell lines.
[0068] Microarrays may take different formats. Thus, for example
cDNA (typically about 500-5,000 bases long) can be immobilized on a
solid surface, such as glass, using robot spotting and exposed to a
set of targets either separately or in a mixture. This method,
"traditionally" called DNA microarray, is described, for example,
in R. Ekins and F. W. Chu (1999) Trends in Biotechnology,
17:217-218.
[0069] In another format, an array of oligonucleotides (typically
about 20-80-mer oligos) or peptide nucleic acid (PNA) probes is
synthesized either in situ (on-chip) or by conventional synthesis
followed by on-chip immobilization. The array is exposed to labeled
sample DNA, hybridized, and the identity/abundance of complementary
sequences are determined. This format, generally referred to as
oligonucleotide microarray, is available from Affymetrix, which
sells its photolithographically fabricated products under the
GeneChip.RTM. trademark.
[0070] Another commonly used gene expression profiling method is
reverse transcriptase PCR(RT-PCT). As RNA cannot serve as a
template for PCR, the first step in gene expression profiling by
RT-PCR is the reverse transcription of the RNA template into cDNA,
followed by its exponential amplification in a PCR reaction. The
two most commonly used reverse transcriptases are avilo
myeloblastosis virus reverse transcriptase (AMV-RT) and Moloney
murine leukemia virus reverse transcriptase (MMLV-RT). The reverse
transcription step is typically primed using specific primers,
random hexamers, or oligo-dT primers, depending on the
circumstances and the goal of expression profiling.
[0071] Although the PCR step can use a variety of thermostable
DNA-dependent DNA polymerases, it typically employs the Taq DNA
polymerase, which has a 5'-3' nuclease activity but lacks a 3'-5'
proofreading endonuclease activity. Thus, TaqMan.RTM. PCR typically
utilizes the 5'-nuclease activity of Taq or Tth polymerase to
hydrolyze a hybridization probe bound to its target amplicon, but
any enzyme with equivalent 5' nuclease activity can be used. Two
oligonucleotide primers are used to generate an amplicon typical of
a PCR reaction. A third oligonucleotide, or probe, is designed to
detect nucleotide sequence located between the two PCR primers. The
probe is non-extendible by Taq DNA polymerase enzyme, and is
labeled with a reporter fluorescent dye and a quencher fluorescent
dye. Any laser-induced emission from the reporter dye is quenched
by the quenching dye when the two dyes are located close together
as they are on the probe. During the amplification reaction, the
Taq DNA polymerase enzyme cleaves the probe in a template-dependent
manner. The resultant probe fragments disassociate in solution, and
signal from the released reporter dye is free from the quenching
effect of the second fluorophore. One molecule of reporter dye is
liberated for each new molecule synthesized, and detection of the
unquenched reporter dye provides the basis for quantitative
interpretation of the data.
[0072] TaqMan.RTM. RT-PCR can be performed using commercially
available equipment, such as, for example, ABI PRISM 7700.TM.
Sequence Detection System.TM. (Perkin-Elmer-Applied Biosystems,
Foster City, Calif., USA), or Lightcycler (Roche Molecular
Biochemicals, Mannheim, Germany). 5'-Nuclease assay data are
initially expressed as Ct, or the threshold cycle. As discussed
above, fluorescence values are recorded during every cycle and
represent the amount of product amplified to that point in the
amplification reaction. The point when the fluorescent signal is
first recorded as statistically significant is the threshold cycle
(Ct). To minimize errors and the effect of sample-to-sample
variation, RT-PCR is usually performed using an internal standard.
The ideal internal standard is expressed at a relatively constant
level among different tissues, and is unaffected by the
experimental treatment. RNAs frequently used to normalize patterns
of gene expression are mRNAs for the housekeeping genes
glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) and
.beta.-actin.
[0073] Real-time quantitative PCR measures PCR product accumulation
through a dual-labeled fluorigenic probe (i.e., TaqMan.RTM. probe).
Real time PCR is compatible both with quantitative competitive PCR,
where internal competitor for each target sequence is used for
normalization, and with quantitative comparative PCR using a
normalization gene contained within the sample, or a housekeeping
gene for RT-PCR. For further details see, e.g. Held et al. (1996)
Genome Research 6:986-994.
[0074] Other methods of gene expression profiling include, for
example, the MassARRAYmethod developed by Sequenom, Inc. (San
Diego, Calif.) (see, e.g. Ding and Cantor, (2003) Proc. Natl. Acad.
Sci. USA 100:3059-3064); differential display (Liang and Pardee,
(1992) Science 257:967-971); amplified fragment length polymorphism
(iAFLP) (Kawamoto et al., (1999) Genome Res. 12:1305-1312);
BeadArray.TM. technology (Illumina, San Diego, Calif.; Oliphant et
al., Discovery of Markers for Disease (Supplement to
Biotechniques), June 2002; Ferguson et al., (2000) Analytical
Chemistry 72:5618); BeadsArray for Detection of Gene Expression
(BADGE), using the commercially available Luminex 100 LabMAP system
and multiple color-coded microspheres (Luminex Corp., Austin, Tex.)
in a rapid assay for gene expression (Yang et al., (2001) Genome
Res. 11:1888-1898); and high coverage expression profiling (HiCEP)
analysis (Fukumura et al., (2003) Nucl. Acids. Res. 31(16)
e94).
[0075] Immunohistochemistry-based methods antibodies or antisera,
preferably polyclonal antisera, and most preferably monoclonal
antibodies specific for each marker are used to detect expression.
The antibodies can be detected by direct labeling of the antibodies
themselves, for example, with radioactive labels, fluorescent
labels, hapten labels such as, biotin, or an enzyme such as horse
radish peroxidase or alkaline phosphatase. Alternatively, unlabeled
primary antibody is used in conjunction with a labeled secondary
antibody, comprising antisera, polyclonal antisera or a monoclonal
antibody specific for the primary antibody. Immunohistochemistry
protocols and kits are well known in the art and are commercially
available.
[0076] Since one purpose of the invention is the identification of
cell surface molecules which are selectively activated in tumor
cells when exposed to chemotherapeutic (e.g. cytotoxic) agents,
proteomics methods, alone or in combination with gene expression
analysis, are particularly suitable for monitoring such changes in
polypeptide abundance. The term "proteome" is defined as the
totality of the proteins present in a sample (e.g. tissue,
organism, or cell culture) at a certain point of time. Proteomics
includes, among other things, study of the global changes of
protein expression in a sample (also referred to as "expression
proteomics"). Proteomics typically includes the following steps:
(1) separation of individual proteins in a sample by 2-D gel
electrophoresis (2-D PAGE); (2) identification of the individual
proteins recovered from the gel, e.g. my mass spectrometry or
N-terminal sequencing, and (3) analysis of the data using
bioinformatics. Proteomics methods are valuable supplements to
other methods of gene expression profiling, and can be used, alone
or in combination with other methods, to detect the cell surface
molecules of the present invention.
[0077] Chemotherapy of Cancer
[0078] The purpose of chemotherapeutic treatment of cancer is to
cure the patient or, at least, slow down disease progression,
increase survival, reduce the likelihood of cancer recurrence,
control symptoms and/or maintain or improve quality of life.
Chemotherapy varies depending on the type of cancer, and, in case
of solid tumors, can be performed before and/or after surgical
removal of primary tumor. For some cancers, there are a few
universally accepted standard therapies, while the treatment of
others is not yet standardized.
[0079] Exemplary chemotherapeutic agents have been listed before,
and generally can be classified according to their mechanism of
action. Some chemotherapeutic agents directly damage DNA and RNA.
By disrupting replication of the DNA such chemotherapeutics either
completely halt replication, or result in the production of
nonsense DNA or RNA. This category includes, for example, cisplatin
(Platinol.RTM.), daunorubicin (Cerubidine.RTM.), doxorubicin
(Adriamycin.RTM.), and etoposide (VePesid.RTM.). Another group of
cancer chemotherapeutic agents interfere with the formation of
nucleotides or deoxyribonucleotides, so that RNA synthesis and cell
replication is blocked. Examples of drugs in this class include
methotrexate (Abitrexate.RTM.), mercaptopurine (Purinethol.RTM.),
fluorouracil (Adrucil.RTM.), and hydroxyurea (Hydrea.RTM.). A third
class of chemotherapeutic agents effects the synthesis or breakdown
of mitotic spindles, and, as a result, interrupt cell division.
Examples of drugs in this class include vinblastine (Velban.RTM.),
vincristine (Oncovin.RTM.) and taxenes, such as, pacitaxel
(Taxol.RTM.), and tocetaxel (Taxotere.RTM.). Other classifications,
for example, based on the chemical structure of the
chemotherapeutic agents, are also possible.
[0080] For breast cancer, doxorubicin (Adriamycin.RTM.) is
considered by most the most effective single chemotherapeutic
agent. In addition, 5-FU has been in clinical use for several
decades, and is the cornerstone of many combination therapies for
breast cancer. Other chemotherapeutic agents commonly used for the
treatment of breast cancer include, for example, anthracyclines,
taxane derivatives, and various combinations therapies, such as CMF
(cyclophosphamide-methotrexate-fluorouracil) chemotherapy. Most
patients receive chemotherapy immediately following surgical
removal of tumor. This approach is commonly referred to as adjuvant
therapy. However, chemotherapy can be administered also before
surgery, as so called neoadjuvant treatment. Although the use of
neo-adjuvant chemotherapy originates from the treatment of advanced
and inoperable breast cancer, it has gained acceptance in the
treatment of other types of cancers as well. The efficacy of
neoadjuvant chemotherapy has been tested in several clinical
trials. In the multi-center National Surgical Adjuvant Breast and
Bowel Project B-18 (NSAB B-18) trial (Fisher et al., J. Clin.
Oncology 15:2002-2004 (1997); Fisher et al., J. Clin. Oncology
16:2672-2685 (1998)) neoadjuvant therapy was performed with a
combination of adriamycin and cyclophosphamide ("AC regimen"). In
another clinical trial, neoadjuvant therapy was administered using
a combination of 5-fluorouracil (5-FU), epirubicin and
cyclophosphamide ("FEC regimen") (van Der Hage et al., J. Clin.
Oncol. 19:4224-4237 (2001)). Other clinical trials have also used
taxane-containing neoadjuvant treatment regiments. See, e.g. Holmes
et al., J. Natl. Cancer Inst. 83:1797-1805 (1991) and Moliterni et
al., Seminars in Oncology, 24:S17-10-S-17-14 (1999). For further
information about neoadjuvant chemotherapy for breast cancer see,
Cleator et al., Endocrine-Related Cancer 9:183-195 (2002).
[0081] 5-FU, CPT-11 (irinotecan), and oxaliplatin, administered
alone or in combination, have proven effective in the treatment of
advanced colorectal cancer (CRC) (see, e.g. Grothey et al. (2004)
J. Clin. Oncol. 22:1209-15).
[0082] Non-small-cell lung cancer (NSCLC) has been shown to respond
well to combination therapy with vinorelbine, cisplatin and
optionally paclitaxel (see, e.g. Rodriguez et al. (2004) Am. J.
Clin. Oncol. 27:299-303).
[0083] Chemotherapeutic regimens for the treatment of other types
of cancer are also well know to those skilled in the art.
[0084] The approach of the present invention is generally
applicable to determine the effect of any of these treatments on
the gene expression pattern of the tumor treated, which, in turn,
enables the identification of antagonists that can lead to more
effective combination therapies.
[0085] Antagonists
[0086] The first step in identifying antagonists of a target
polypeptide, is typically in vitro screening to identify compounds
that selectively bind the target polypeptide. Receptor-binding can
be tested using target polypeptides isolated from their respective
native sources, or produced by recombinant DNA technology and/or
chemical synthesis. The binding affinity of the candidate compounds
can be tested by direct binding (see, e.g. Schoemaker et al., J.
Pharmacol. Exp. Ther., 285:61-69 (1983)) or by indirect, e.g.
competitive, binding. In competitive binding experiments, the
concentration of a compound necessary to displace 50% of another
compound bound to the target polypeptide (IC50) is usually used as
a measure of binding affinity. If the test compound binds the
target selectively and with high affinity, displacing the first
compound, it is identified as an antagonist. Cell based assays can
be used in a similar manner.
[0087] A preferred group of antagonists includes antibodies
specifically binding to the target polypeptide. Antibody "binding
affinity" may be determined by equilibrium methods (e.g.
enzyme-linked immunoabsorbent assay (ELISA) or radioimmunoassay
(RIA)), or kinetics (e.g. BIACORE.TM. analysis), for example. Also,
the antibody may be subjected to other "biological activity
assays", e.g., in order to evaluate its "potency" or
pharmacological activity and potential efficacy as a therapeutic
agent. Such assays are known in the art and depend on the target
antigen and intended use for the antibody.
Antibodies
[0088] Techniques for producing antibodies are well known in the
art.
(1) Antibody Preparation
[0089] (i) Antigen Preparation
[0090] Soluble antigens or fragments thereof, optionally conjugated
to other molecules, can be used as immunogens for generating
antibodies. For transmembrane molecules, such as receptors,
fragments of these (e.g. the extracellular domain of a receptor)
can be used as the immunogen. Alternatively, cells expressing the
transmembrane molecule can be used as the immunogen. Such cells can
be derived from a natural source (e.g. cancer cell lines) or may be
cells which have been transformed by recombinant techniques to
express the transmembrane molecule. Other antigens and forms
thereof useful for preparing antibodies will be apparent to those
in the art.
[0091] (ii) Polyclonal Antibodies
[0092] Polyclonal antibodies are preferably raised in animals by
multiple subcutaneous (sc) or intraperitoneal (ip) injections of
the relevant antigen and an adjuvant. It may be useful to conjugate
the relevant antigen to a protein that is immunogenic in the
species to be immunized, e.g., keyhole limpet hemocyanin, serum
albumin, bovine thyroglobulin, or soybean trypsin inhibitor using a
bifunctional or derivatizing agent, for example, maleimidobenzoyl
sulfosuccinimide ester (conjugation through cysteine residues),
N-hydroxysuccinimide (through lysine residues), glutaraldehyde,
succinic anhydride, SOCl.sub.2.
[0093] Animals are immunized against the antigen, immunogenic
conjugates, or derivatives by combining, e.g., 100 .mu.g or 5 .mu.g
of the protein or conjugate (for rabbits or mice, respectively)
with 3 volumes of Freund's complete adjuvant and injecting the
solution intradermally at multiple sites. One month later the
animals are boosted with 1/5 to 1/10 the original amount of peptide
or conjugate in Freund's complete adjuvant by subcutaneous
injection at multiple sites. Seven to 14 days later the animals are
bled and the serum is assayed for antibody titer. Animals are
boosted until the titer plateaus. Preferably, the animal is boosted
with the conjugate of the same antigen, but conjugated to a
different protein and/or through a different cross-linking reagent.
Conjugates also can be made in recombinant cell culture as protein
fusions. Also, aggregating agents such as alum are suitably used to
enhance the immune response.
[0094] (iii) Monoclonal Antibodies
[0095] Monoclonal antibodies may be made using the hybridoma method
first described by Kohler et al., Nature, 256:495 (1975), or may be
made by recombinant DNA methods (U.S. Pat. No. 4,816,567). In the
hybridoma method, a mouse or other appropriate host animal, such as
a hamster or macaque monkey, is immunized as hereinabove described
to elicit lymphocytes that produce or are capable of producing
antibodies that will specifically bind to the protein used for
immunization. Alternatively, lymphocytes may be immunized in vitro.
Lymphocytes then are fused with myeloma cells using a suitable
fusing agent, such as polyethylene glycol, to form a hybridoma cell
(Goding, Monoclonal Antibodies: Principles and Practice, pp. 59-103
(Academic Press, 1986)).
[0096] The hybridoma cells thus prepared are seeded and grown in a
suitable culture medium that preferably contains one or more
substances that inhibit the growth or survival of the unfused,
parental myeloma cells. For example, if the parental myeloma cells
lack the enzyme hypoxanthine guanine phosphoribosyl transferase
(HGPRT or HPRT), the culture medium for the hybridomas typically
will include hypoxanthine, aminopterin, and thymidine (HAT medium),
which substances prevent the growth of HGPRT-deficient cells.
[0097] Preferred myeloma cells are those that fuse efficiently,
support stable high-level production of antibody by the selected
antibody-producing cells, and are sensitive to a medium such as HAT
medium. Among these, preferred myeloma cell lines are murine
myeloma lines, such as those derived from MOPC-21 and MPC-11 mouse
tumors available from the Salk Institute Cell Distribution Center,
San Diego, Calif. USA, and SP-2 or X63-Ag8-653 cells available from
the American Type Culture Collection, Rockville, Md. USA. Human
myeloma and mouse-human heteromyeloma cell lines also have been
described for the production of human monoclonal antibodies
(Kozbor, J. Immunol., 133:3001 (1984); Brodeur et al., Monoclonal
Antibody Production Techniques and Applications, pp. 51-63 (Marcel
Dekker, Inc., New York, 1987)).
[0098] Culture medium in which hybridoma cells are growing is
assayed for production of monoclonal antibodies directed against
the antigen. Preferably, the binding specificity of monoclonal
antibodies produced by hybridoma cells is determined by
immunoprecipitation or by an in vitro binding assay, such as
radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay
(ELISA).
[0099] After hybridoma cells are identified that produce antibodies
of the desired specificity, affinity, and/or activity, the clones
may be subcloned by limiting dilution procedures and grown by
standard methods (Goding, Monoclonal Antibodies: Principles and
Practice, pp. 59-103 (Academic Press, 1986)). Suitable culture
media for this purpose include, for example, D-MEM or RPMI-1640
medium. In addition, the hybridoma cells may be grown in vivo as
ascites tumors in an animal.
[0100] The monoclonal antibodies secreted by the subclones are
suitably separated from the culture medium, ascites fluid, or serum
by conventional immunoglobulin purification procedures such as, for
example, protein A-Sepharose, hydroxylapatite chromatography, gel
electrophoresis, dialysis, or affinity chromatography.
[0101] DNA encoding the monoclonal antibodies is readily isolated
and sequenced using conventional procedures (e.g., by using
oligonucleotide probes that are capable of binding specifically to
genes encoding the heavy and light chains of the monoclonal
antibodies). The hybridoma cells serve as a preferred source of
such DNA. Once isolated, the DNA may be placed into expression
vectors, which are then transfected into host cells such as E. coli
cells, simian COS cells, Chinese Hamster Ovary (CHO) cells, or
myeloma cells that do not otherwise produce immunoglobulin protein,
to obtain the synthesis of monoclonal antibodies in the recombinant
host cells. Recombinant production of antibodies will be described
in more detail below.
[0102] In a further embodiment, antibodies or antibody fragments
can be isolated from antibody phage libraries generated using the
techniques described in McCafferty et al., Nature, 348:552-554
(1990). Clackson et al., Nature, 352:624-628 (1991) and Marks et
al., J. Mol. Biol., 222:581-597 (1991) describe the isolation of
murine and human antibodies, respectively, using phage libraries.
Subsequent publications describe the production of high affinity
(nM range) human antibodies by chain shuffling (Marks et al.,
Bio/Technology, 10:779-783 (1992)), as well as combinatorial
infection and in vivo recombination as a strategy for constructing
very large phage libraries (Waterhouse et al., Nuc. Acids. Res.,
21:2265-2266 (1993)). Thus, these techniques are viable
alternatives to traditional monoclonal antibody hybridoma
techniques for isolation of monoclonal antibodies.
[0103] The DNA also may be modified, for example, by substituting
the coding sequence for human heavy- and light-chain constant
domains in place of the homologous murine sequences (U.S. Pat. No.
4,816,567; Morrison, et al., Proc. Natl. Acad. Sci. USA, 81:6851
(1984)), or by covalently joining to the immunoglobulin coding
sequence all or part of the coding sequence for a
non-immunoglobulin polypeptide.
[0104] Typically such non-immunoglobulin polypeptides are
substituted for the constant domains of an antibody, or they are
substituted for the variable domains of one antigen-combining site
of an antibody to create a chimeric bivalent antibody comprising
one antigen-combining site having specificity for an antigen and
another antigen-combining site having specificity for a different
antigen.
[0105] (iv) Humanized and Human Antibodies
[0106] A humanized antibody has one or more amino acid residues
introduced into it from a source which is non-human. These
non-human amino acid residues are often referred to as "import"
residues, which are typically taken from an "import" variable
domain. Humanization can be essentially performed following the
method of Winter and co-workers (Jones et al., Nature, 321:522-525
(1986); Riechmann et al., Nature, 332:323-327 (1988); Verhoeyen et
al., Science, 239:1534-1536 (1988)), by substituting rodent CDRs or
CDR sequences for the corresponding sequences of a human antibody.
Accordingly, such "humanized" antibodies are chimeric antibodies
(U.S. Pat. No. 4,816,567) wherein substantially less than an intact
human variable domain has been substituted by the corresponding
sequence from a non-human species. In practice, humanized
antibodies are typically human antibodies in which some CDR
residues and possibly some FR residues are substituted by residues
from analogous sites in rodent antibodies.
[0107] The choice of human variable domains, both light and heavy,
to be used in making the humanized antibodies is very important to
reduce antigenicity. According to the so-called "best-fit" method,
the sequence of the variable domain of a rodent antibody is
screened against the entire library of known human variable domain
sequences. The human sequence which is closest to that of the
rodent is then accepted as the human FR for the humanized antibody
(Sims et al., J. Immunol., 151:2296 (1993); Chothia et al., J. Mol.
Biol., 196:901 (1987)). Another method uses a particular FR derived
from the consensus sequence of all human antibodies of a particular
subgroup of light or heavy chains. The same FR may be used for
several different humanized antibodies (Carter et al., Proc. Natl.
Acad. Sci. USA, 89:4285 (1992); Presta et al., J. Immunol.,
151:2623 (1993)).
[0108] It is further important that antibodies be humanized with
retention of high affinity for the antigen and other favorable
biological properties. To achieve this goal, according to a
preferred method, humanized antibodies are prepared by a process of
analysis of the parental sequences and various conceptual humanized
products using three-dimensional models of the parental and
humanized sequences. Three-dimensional immunoglobulin models are
commonly available and are familiar to those skilled in the art.
Computer programs are available which illustrate and display
probable three-dimensional conformational structures of selected
candidate immunoglobulin sequences. Inspection of these displays
permits analysis of the likely role of the residues in the
functioning of the candidate immunoglobulin sequence, i.e., the
analysis of residues that influence the ability of the candidate
immunoglobulin to bind its antigen. In this way, FR residues can be
selected and combined from the recipient and import sequences so
that the desired antibody characteristic, such as increased
affinity for the target antigen(s), is achieved. In general, the
CDR residues are directly and most substantially involved in
influencing antigen binding.
[0109] Alternatively, it is now possible to produce transgenic
animals (e.g., mice) that are capable, upon immunization, of
producing a full repertoire of human antibodies in the absence of
endogenous immunoglobulin production. For example, it has been
described that the homozygous deletion of the antibody heavy-chain
joining region (JH) gene in chimeric and germ-line mutant mice
results in complete inhibition of endogenous antibody production.
Transfer of the human germ-line immunoglobulin gene array in such
germ-line mutant mice will result in the production of human
antibodies upon antigen challenge. See, e.g., Jakobovits et al.,
Proc. Natl. Acad. Sci. USA, 90:2551 (1993); Jakobovits et al.,
Nature, 362:255-258 (1993); Bruggermann et al., Year in Immunol.,
7:33 (1993); and Duchosal et al. Nature 355:258 (1992). Human
antibodies can also be derived from phage-display libraries
(Hoogenboom et al., J. Mol. Biol., 227:381 (1991); Marks et al., J.
Mol. Biol., 222:581-597 (1991); Vaughan et al. Nature Biotech
14:309 (1996)).
[0110] (v) Antibody Fragments
[0111] Various techniques have been developed for the production of
antibody fragments. Traditionally, these fragments were derived via
proteolytic digestion of intact antibodies (see, e.g., Morimoto et
al., Journal of Biochemical and Biophysical Methods 24:107-117
(1992) and Brennan et al., Science, 229:81 (1985)). However, these
fragments can now be produced directly by recombinant host cells.
For example, the antibody fragments can be isolated from the
antibody phage libraries discussed above. Alternatively, Fab'-SH
fragments can be directly recovered from E. coli and chemically
coupled to form F(ab').sub.2 fragments (Carter et al.,
Bio/Technology 10:163-167 (1992)). According to another approach,
F(ab')2 fragments can be isolated directly from recombinant host
cell culture. Other techniques for the production of antibody
fragments will be apparent to the skilled practitioner. In other
embodiments, the antibody of choice is a single chain Fv fragment
(scFv). See WO 93/16185.
[0112] (vi) Multispecific Antibodies
[0113] Multispecific antibodies have binding specificities for at
least two different antigens. While such molecules normally will
only bind two antigens (i.e. bispecific antibodies, BsAbs),
antibodies with additional specificities such as trispecific
antibodies are encompassed by this expression when used herein.
Thus, bispecific antibodies binding to two cell surface molecules,
the expression of which is upregulated by a chemotherapeutic agent,
are specifically included.
[0114] Methods for making bispecific antibodies are known in the
art. Traditional production of full length bispecific antibodies is
based on the coexpression of two immunoglobulin heavy chain-light
chain pairs, where the two chains have different specificities
(Millstein et al., Nature, 305:537-539 (1983)). Because of the
random assortment of immunoglobulin heavy and light chains, these
hybridomas (quadromas) produce a potential mixture of 10 different
antibody molecules, of which only one has the correct bispecific
structure. Purification of the correct molecule, which is usually
done by affinity chromatography steps, is rather cumbersome, and
the product yields are low. Similar procedures are disclosed in WO
93/08829, and in Traunecker et al., EMBO J., 10:3655-3659
(1991).
[0115] According to a different approach, antibody variable domains
with the desired binding specificities (antibody-antigen combining
sites) are fused to immunoglobulin constant domain sequences. The
fusion preferably is with an immunoglobulin heavy chain constant
domain, comprising at least part of the hinge, CH2, and CH3
regions. It is preferred to have the first heavy-chain constant
region (CH1) containing the site necessary for light chain binding,
present in at least one of the fusions. DNAs encoding the
immunoglobulin heavy chain fusions and, if desired, the
immunoglobulin light chain, are inserted into separate expression
vectors, and are co-transfected into a suitable host organism. This
provides for great flexibility in adjusting the mutual proportions
of the three polypeptide fragments in embodiments when unequal
ratios of the three polypeptide chains used in the construction
provide the optimum yields. It is, however, possible to insert the
coding sequences for two or all three polypeptide chains in one
expression vector when the expression of at least two polypeptide
chains in equal ratios results in high yields or when the ratios
are of no particular significance.
[0116] In a preferred embodiment of this approach, the bispecific
antibodies are composed of a hybrid immunoglobulin heavy chain with
a first binding specificity in one arm, and a hybrid immunoglobulin
heavy chain-light chain pair (providing a second binding
specificity) in the other arm. It was found that this asymmetric
structure facilitates the separation of the desired bispecific
compound from unwanted immunoglobulin chain combinations, as the
presence of an immunoglobulin light chain in only one half of the
bispecific molecule provides for a facile way of separation. This
approach is disclosed in WO 94/04690. For further details of
generating bispecific antibodies see, for example, Suresh et al.,
Methods in Enzymology, 121:210 (1986).
[0117] According to another approach described in WO96/27011, the
interface between a pair of antibody molecules can be engineered to
maximize the percentage of heterodimers which are recovered from
recombinant cell culture. The preferred interface comprises at
least a part of the CH3 domain of an antibody constant domain. In
this method, one or more small amino acid side chains from the
interface of the first antibody molecule are replaced with larger
side chains (e.g. tyrosine or tryptophan). Compensatory "cavities"
of identical or similar size to the large side chain(s) are created
on the interface of the second antibody molecule by replacing large
amino acid side chains with smaller ones (e.g. alanine or
threonine). This provides a mechanism for increasing the yield of
the heterodimer over other unwanted end-products such as
homodimers.
[0118] Bispecific antibodies include cross-linked or
"heteroconjugate" antibodies. For example, one of the antibodies in
the heteroconjugate can be coupled to avidin, the other to biotin.
Such antibodies have, for example, been proposed to target immune
system cells to unwanted cells (U.S. Pat. No. 4,676,980), and for
treatment of HIV infection (WO 91/00360, WO 92/200373, and EP
03089). Heteroconjugate antibodies may be made using any convenient
cross-linking methods. Suitable cross-linking agents are well known
in the art, and are disclosed in U.S. Pat. No. 4,676,980, along
with a number of cross-linking techniques.
[0119] Techniques for generating bispecific antibodies from
antibody fragments have also been described in the literature. For
example, bispecific antibodies can be prepared using chemical
linkage. Brennan et al., Science, 229: 81 (1985) describe a
procedure wherein intact antibodies are proteolytically cleaved to
generate F(ab').sub.2 fragments. These fragments are reduced in the
presence of the dithiol complexing agent sodium arsenite to
stabilize vicinal dithiols and prevent intermolecular disulfide
formation. The Fab' fragments generated are then converted to
thionitrobenzoate (TNB) derivatives. One of the Fab'-TNB
derivatives is then reconverted to the Fab'-thiol by reduction with
mercaptoethylamine and is mixed with an equimolar amount of the
other Fab'-TNB derivative to form the bispecific antibody. The
bispecific antibodies produced can be used as agents for the
selective immobilization of enzymes.
[0120] Recent progress has facilitated the direct recovery of
Fab'-SH fragments from E. coli, which can be chemically coupled to
form bispecific antibodies. Shalaby et al., J. Exp. Med., 175:
217-225 (1992) describe the production of a fully humanized
bispecific antibody F(ab').sub.2 molecule. Each Fab' fragment was
separately secreted from E. coli and subjected to directed chemical
coupling in vitro to form the bispecific antibody. The bispecific
antibody thus formed was able to bind to cells overexpressing the
ErbB2 receptor and normal human T cells, as well as trigger the
lytic activity of human cytotoxic lymphocytes against human breast
tumor targets.
[0121] Various techniques for making and isolating bispecific
antibody fragments directly from recombinant cell culture have also
been described. For example, bispecific antibodies have been
produced using leucine zippers. Kostelny et al., J. Immunol.,
148(5):1547-1553 (1992). The leucine zipper peptides from the Fos
and Jun proteins were linked to the Fab' portions of two different
antibodies by gene fusion. The antibody homodimers were reduced at
the hinge region to form monomers and then re-oxidized to form the
antibody heterodimers. This method can also be utilized for the
production of antibody homodimers. The "diabody" technology
described by Hollinger et al., Proc. Natl. Acad. Sci. USA,
90:6444-6448 (1993) has provided an alternative mechanism for
making bispecific antibody fragments. The fragments comprise a
heavy-chain variable domain (V.sub.H) connected to a light-chain
variable domain (V.sub.L) by a linker which is too short to allow
pairing between the two domains on the same chain. Accordingly, the
V.sub.H and V.sub.L domains of one fragment are forced to pair with
the complementary V.sub.L and V.sub.H domains of another fragment,
thereby forming two antigen-binding sites. Another strategy for
making bispecific antibody fragments by the use of single-chain Fv
(sFv) dimers has also been reported. See Gruber et al., J.
Immunol., 152:5368 (1994).
[0122] Antibodies with more than two valencies are contemplated.
For example, trispecific antibodies can be prepared. Tutt et al. J.
Immunol. 147: 60 (1991).
[0123] (vii) Effector Function Engineering
[0124] It may be desirable to modify the antibody of the invention
with respect to effector function, so as to enhance the
effectiveness of the antibody in treating cancer, for example. For
example cysteine residue(s) may be introduced in the Fc region,
thereby allowing interchain disulfide bond formation in this
region. The homodimeric antibody thus generated may have improved
internalization capability and/or increased complement-mediated
cell killing and antibody-dependent cellular cytotoxicity (ADCC).
See Caron et al., J. Exp Med. 176:1191-1195 (1992) and Shopes, B.
J. Immunol. 148:2918-2922 (1992). Homodimeric antibodies with
enhanced anti-tumor activity may also be prepared using
heterobifunctional cross-linkers as described in Wolff et al.
Cancer Research 53:2560-2565 (1993). Alternatively, an antibody can
be engineered which has dual Fc regions and may thereby have
enhanced complement lysis and ADCC capabilities. See Stevenson et
al. Anti-Cancer Drug Design 3:219-230 (1989).
[0125] (viii) Immunoconjugates
[0126] The invention also pertains to immunoconjugates comprising
the antibody described herein conjugated to a cytotoxic agent such
as a chemotherapeutic agent, toxin (e.g. an enzymatically active
toxin of bacterial, fungal, plant or animal origin, or fragments
thereof), or a radioactive isotope (i.e., a radioconjugate).
[0127] Chemotherapeutic agents useful in the generation of such
immunoconjugates have been described above. Enzymatically active
toxins and fragments thereof which can be used include diphtheria A
chain, nonbinding active fragments of diphtheria toxin, exotoxin A
chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain,
modeccin A chain, alpha-sarcin, Aleurites fordii proteins, dianthin
proteins, Phytolaca americana proteins (PAPI, PAPII, and PAP-S),
momordica charantia inhibitor, curcin, crotin, sapaonaria
officinalis inhibitor, gelonin, mitogellin, restrictocin,
phenomycin, enomycin and the tricothecenes. A variety of
radionuclides are available for the production of radioconjugate
antibodies. Examples include .sup.212Bi, .sup.133I, .sup.131In,
.sup.90Y and .sup.186Re.
[0128] Conjugates of the antibody and cytotoxic agent are made
using a variety of bifunctional protein coupling agents such as
N-succinimidyl-3-(2-pyridyldithiol) propionate (SPDP),
iminothiolane (IT), bifunctional derivatives of imidoesters (such
as dimethyl adipimidate HCL), active esters (such as disuccinimidyl
suberate), aldehydes (such as glutareldehyde), bis-azido compounds
(such as bis (p-azidobenzoyl) hexanediamine), bis-diazonium
derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine),
diisocyanates (such as tolyene 2,6-diisocyanate), and bis-active
fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene). For
example, a ricin immunotoxin can be prepared as described in
Vitetta et al. Science 238: 1098 (1987). Carbon-14-labeled
1-isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic acid
(MX-DTPA) is an exemplary chelating agent for conjugation of
radionucleotide to the antibody. See WO94/11026.
[0129] In another embodiment, the antibody may be conjugated to a
"receptor" (such streptavidin) for utilization in tumor
pretargeting wherein the antibody-receptor conjugate is
administered to the patient, followed by removal of unbound
conjugate from the circulation using a clearing agent and then
administration of a "ligand" (e.g. avidin) which is conjugated to a
cytotoxic agent (e.g. a radionucleotide).
[0130] (ix) Immunoliposomes
[0131] The antibodies may also be formulated as immunoliposomes.
Liposomes containing the antibody are prepared by methods known in
the art, such as described in Epstein et al., Proc. Natl. Acad.
Sci. USA, 82:3688 (1985); Hwang et al., Proc. Natl. Acad. Sci. USA,
77:4030 (1980); and U.S. Pat. Nos. 4,485,045 and 4,544,545.
Liposomes with enhanced circulation time are disclosed in U.S. Pat.
No. 5,013,556.
[0132] Particularly useful liposomes can be generated by the
reverse phase evaporation method with a lipid composition
comprising phosphatidylcholine, cholesterol and PEG-derivatized
phosphatidylethanolamine (PEG-PE). Liposomes are extruded through
filters of defined pore size to yield liposomes with the desired
diameter. Fab' fragments of the antibody of the present invention
can be conjugated to the liposomes as described in Martin et al. J.
Biol. Chem. 257: 286-288 (1982) via a disulfide interchange
reaction. A chemotherapeutic agent (such as Doxorubicin) is
optionally contained within the liposome. See Gabizon et al. J.
National Cancer Inst. 81(19)1484 (1989).
[0133] (x) Antibody Dependent Enzyme Mediated Prodrug Therapy
(ADEPT)
[0134] The antibodies of the present invention may also be used in
ADEPT by conjugating the antibody to a prodrug-activating enzyme
which converts a prodrug (e.g. a peptidyl chemotherapeutic agent,
see WO81/01145) to an active anti-cancer drug. See, for example, WO
88/07378 and U.S. Pat. No. 4,975,278.
[0135] The enzyme component of the immunoconjugate useful for ADEPT
includes any enzyme capable of acting on a prodrug in such a way so
as to covert it into its more active, cytotoxic form.
[0136] Enzymes that are useful in the method of this invention
include, but are not limited to, alkaline phosphatase useful for
converting phosphate-containing prodrugs into free drugs;
arylsulfatase useful for converting sulfate-containing prodrugs
into free drugs; cytosine deaminase useful for converting non-toxic
5-fluorocytosine into the anti-cancer drug, 5-fluorouracil;
proteases, such as serratia protease, thermolysin, subtilisin,
carboxypeptidases and cathepsins (such as cathepsins B and L), that
are useful for converting peptide-containing prodrugs into free
drugs; D-alanylcarboxypeptidases, useful for converting prodrugs
that contain D-amino acid substituents; carbohydrate-cleaving
enzymes such as beta-galactosidase and neuraminidase useful for
converting glycosylated prodrugs into free drugs; beta-lactamase
useful for converting drugs derivatized with beta-lactams into free
drugs; and penicillin amidases, such as penicillin V amidase or
penicillin G amidase, useful for converting drugs derivatized at
their amine nitrogens with phenoxyacetyl or phenylacetyl groups,
respectively, into free drugs. Alternatively, antibodies with
enzymatic activity, also known in the art as "abzymes", can be used
to convert the prodrugs of the invention into free active drugs
(see, e.g., Massey, Nature 328: 457-458 (1987)). Antibody-abzyme
conjugates can be prepared as described herein for delivery of the
abzyme to a tumor cell population.
[0137] (xi) Antibody-salvage Receptor Binding Epitope Fusions.
[0138] In certain embodiments of the invention, it may be desirable
to use an antibody fragment, rather than an intact antibody, to
increase tumor penetration, for example. In this case, it may be
desirable to modify the antibody fragment in order to increase its
serum half life. This may be achieved, for example, by
incorporation of a salvage receptor binding epitope into the
antibody fragment (e.g. by mutation of the appropriate region in
the antibody fragment or by incorporating the epitope into a
peptide tag that is then fused to the antibody fragment at either
end or in the middle, e.g., by DNA or peptide synthesis).
[0139] The salvage receptor binding epitope preferably constitutes
a region wherein any one or more amino acid residues from one or
two loops of a Fc domain are transferred to an analogous position
of the antibody fragment. Even more preferably, three or more
residues from one or two loops of the Fc domain are transferred.
Still more preferred, the epitope is taken from the CH2 domain of
the Fc region (e.g., of an IgG) and transferred to the CH1, CH3, or
V.sub.H region, or more than one such region, of the antibody.
Alternatively, the epitope is taken from the CH2 domain of the Fc
region and transferred to the C.sub.L region or V.sub.L region, or
both, of the antibody fragment. See, e.g., U.S. Pat. No. 5,739,277,
issued Apr. 14, 1998.
[0140] (xii) Covalent Modifications
[0141] Covalent modifications of the antibody are included within
the scope of this invention. They may be made by chemical synthesis
or by enzymatic or chemical cleavage of the antibody, if
applicable. Other types of covalent modifications of the antibody
are introduced into the molecule by reacting targeted amino acid
residues of the antibody with an organic derivatizing agent that is
capable of reacting with selected side chains or the N- or
C-terminal residues.
[0142] Removal of any carbohydrate moieties present on the antibody
may be accomplished chemically or enzymatically. Chemical
deglycosylation requires exposure of the antibody to the compound
trifluoromethanesulfonic acid, or an equivalent compound. This
treatment results in the cleavage of most or all sugars except the
linking sugar (N-acetylglucosamine or N-acetylgalactosamine), while
leaving the antibody intact. Chemical deglycosylation is described
by Hakimuddin, et al. Arch. Biochem. Biophys. 259:52 (1987) and by
Edge et al. Anal. Biochem., 118:131 (1981). Enzymatic cleavage of
carbohydrate moieties on antibodies can be achieved by the use of a
variety of endo- and exo-glycosidases as described by Thotakura et
al. Meth. Enzymol. 138:350 (1987).
[0143] Another type of covalent modification of the antibody
comprises linking the antibody to one of a variety of
nonproteinaceous polymers, e.g., polyethylene glycol, polypropylene
glycol, or polyoxyalkylenes, in the manner set forth in U.S. Pat.
No. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or
4,179,337.
(2) Recombinant Production of Antibodies
[0144] The antibodies of the present invention can be made, for
example, by techniques of recombinant DNA technology.
[0145] Suitable host cells for cloning or expressing the DNA in the
vectors herein are the prokaryote, yeast, or higher eukaryote cells
described above. Suitable prokaryotes for this purpose include
eubacteria, such as Gram-negative or Gram-positive organisms, for
example, Enterobacteriaceae such as Escherichia, e.g., E. coli,
Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, e.g.,
Salmonella typhimurium, Serratia, e.g., Serratia marcescans, and
Shigella, as well as Bacilli such as B. subtilis and B.
licheniformis (e.g., B. licheniformis 41P disclosed in DD 266,710
published Apr. 12, 1989), Pseudomonas such as P. aeruginosa, and
Streptomyces. One preferred E. coli cloning host is E. coli 294
(ATCC 31,446), although other strains such as E. coli B, E. coli
X1776 (ATCC 31,537), and E. coli W3110 (ATCC 27,325) are suitable.
These examples are illustrative rather than limiting.
[0146] In addition to prokaryotes, eukaryotic microbes such as
filamentous fungi or yeast are suitable cloning or expression hosts
for antibody-encoding vectors. Saccharomyces cerevisiae, or common
baker's yeast, is the most commonly used among lower eukaryotic
host microorganisms. However, a number of other genera, species,
and strains are commonly available and useful herein, such as
Schizosaccharomyces pombe; Kluyveromyces hosts such as, e.g., K.
lactic, K. fragilis (ATCC 12,424), K. bulgaricus (ATCC 16,045), K.
wickeramii (ATCC 24,178), K. waltii (ATCC 56,500), K. drosophilarum
(ATCC 36,906), K. thermotolerans, and K. marxianus; yarrowia (EP
402,226); Pichia pastoris (EP 183,070); Candida; Trichoderma reesia
(EP 244,234); Neurospora crassa; Schwanniomyces such as
Schwanniomyces occidentalis; and filamentous fungi such as, e.g.,
Neurospora, Penicillium, Tolypocladium, and Aspergillus hosts such
as A. nidulans and A. niger.
[0147] Suitable host cells for the expression of glycosylated
antibody are derived from multicellular organisms. Examples of
invertebrate cells include plant and insect cells. Numerous
baculoviral strains and variants and corresponding permissive
insect host cells from hosts such as Spodoptera frugiperda
(caterpillar), Aedes aegypti (mosquito), Aedes albopictus
(mosquito), Drosophila melanogaster (fruitfly), and Bombyx mori
have been identified. A variety of viral strains for transfection
are publicly available, e.g., the L-1 variant of Autographa
californica NPV and the Bm-5 strain of Bombyx mori NPV, and such
viruses may be used as the virus herein according to the present
invention, particularly for transfection of Spodoptera frugiperda
cells. Plant cell cultures of cotton, corn, potato, soybean,
petunia, tomato, and tobacco can also be utilized as hosts.
[0148] However, interest has been greatest in vertebrate cells, and
propagation of vertebrate cells in culture (tissue culture) has
become a routine procedure. Examples of useful mammalian host cell
lines are monkey kidney CV1 line transformed by SV40 (COS-7, ATCC
CRL 1651); human embryonic kidney line (293 or 293 cells subcloned
for growth in suspension culture, Graham et al., J. Gen Virol.
36:59 (1977)); baby hamster kidney cells (BHK, ATCC CCL 10);
Chinese hamster ovary cells/-DHFR(CHO, Urlaub et al., Proc. Natl.
Acad. Sci. USA 77:4216 (1980)); mouse sertoli cells (TM4, Mather,
Biol. Reprod. 23:243-251 (1980)); monkey kidney cells (CV1 ATCC CCL
70); African green monkey kidney cells (VERO-76, ATCC CRL-1587);
human cervical carcinoma cells (HELA, ATCC CCL 2); canine kidney
cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC
CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells
(Hep G2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51);
TRI cells (Mather et al., Annals N.Y. Acad. Sci. 383:44-68 (1982));
MRC 5 cells; FS4 cells; and a human hepatoma line (Hep G2).
[0149] Host cells are transformed with expression or cloning
vectors, which are well known in the art, for antibody production
and cultured in conventional nutrient media modified as appropriate
for inducing promoters, selecting transformants, or amplifying the
genes encoding the desired sequences.
[0150] The host cells used to produce the antibodies of this
invention may be cultured in a variety of media. Commercially
available media such as Ham's F10 (Sigma), Minimal Essential Medium
((MEM), (Sigma), RPMI-1640 (Sigma), and Dulbecco's Modified Eagle's
Medium ((DMEM), Sigma) are suitable for culturing the host cells.
In addition, any of the media described in Ham et al., Meth. Enz.
58:44 (1979), Barnes et al., Anal. Biochem. 102:255 (1980), U.S.
Pat. No. 4,767,704; 4,657,866; 4,927,762; 4,560,655; or 5,122,469;
WO 90/03430; WO 87/00195; or U.S. Pat. Re. 30,985 may be used as
culture media for the host cells. Any of these media may be
supplemented as necessary with hormones and/or other growth factors
(such as insulin, transferrin, or epidermal growth factor), salts
(such as sodium chloride, calcium, magnesium, and phosphate),
buffers (such as HEPES), nucleotides (such as adenosine and
thymidine), antibiotics (such as GENTAMYCIN.TM. drug), trace
elements (defined as inorganic compounds usually present at final
concentrations in the micromolar range), and glucose or an
equivalent energy source. Any other necessary supplements may also
be included at appropriate concentrations that would be known to
those skilled in the art. The culture conditions, such as
temperature, pH, and the like, are those previously used with the
host cell selected for expression, and will be apparent to the
ordinarily skilled artisan.
[0151] When using recombinant techniques, the antibodies can be
produced intracellularly, in the periplasmic space, or directly
secreted into the medium. If the antibody is produced
intracellularly, as a first step, the particulate debris, either
host cells or lysed fragments, is removed, for example, by
centrifugation or ultrafiltration. Carter et al., Bio/Technology
10:163-167 (1992) describe a procedure for isolating antibodies
which are secreted to the periplasmic space of E. coli. Briefly,
cell paste is thawed in the presence of sodium acetate (pH 3.5),
EDTA, and phenylmethylsulfonylfluoride (PMSF) over about 30 min.
Cell debris can be removed by centrifugation. Where the antibody is
secreted into the medium, supernatants from such expression systems
are generally first concentrated using a commercially available
protein concentration filter, for example, an Amicon or Millipore
Pellicon ultrafiltration unit. A protease inhibitor such as PMSF
may be included in any of the foregoing steps to inhibit
proteolysis and antibiotics may be included to prevent the growth
of adventitious contaminants.
[0152] The antibody composition prepared from the cells can be
purified using, for example, hydroxylapatite chromatography, gel
electrophoresis, dialysis, and affinity chromatography, with
affinity chromatography being the preferred purification technique.
The suitability of protein A as an affinity ligand depends on the
species and isotype of any immunoglobulin Fc domain that is present
in the antibody. Protein A can be used to purify antibodies that
are based on human .gamma.1, .gamma.2, or .gamma.4 heavy chains
(Lindmark et al., J. Immunol. Meth. 62:1-13 (1983)). Protein G is
recommended for all mouse isotypes and for human .gamma.3 (Guss et
al., EMBO J. 5:15671575 (1986)). The matrix to which the affinity
ligand is attached is most often agarose, but other matrices are
available. Mechanically stable matrices such as controlled pore
glass or poly(styrenedivinyl)benzene allow for faster flow rates
and shorter processing times than can be achieved with agarose.
Where the antibody comprises a CH3 domain, the Bakerbond ABX.TM.
resin (J. T. Baker, Phillipsburg, N.J.) is useful for purification.
Other techniques for protein purification such as fractionation on
an ion-exchange column, ethanol precipitation, Reverse Phase HPLC,
chromatography on silica, chromatography on heparin SEPHAROSE.TM.
chromatography on an anion or cation exchange resin (such as a
polyaspartic acid column), chromatofocusing, SDS-PAGE, and ammonium
sulfate precipitation are also available depending on the antibody
variant to be recovered.
[0153] Pharmaceutical Formulations
[0154] The chemotherapeutic agents herein are typically
administered following dosages and routes of administration used in
current clinical practice. For example, 5-fluorouracil (5-FU,
Adrucil.RTM.) is in clinical use for the treatment of breast
cancer, gastrointestinal cancers, including anal, esophageal,
pancreas and gastric cancers, head and neck cancer, liver cancer,
and ovarian cancer, and is typically administered as an i.v. bolus
injection or continuous infusion. The amount of time and schedule
varies depending on the type and stage of cancer, the treatment
history and overall condition of patient, and other factors
typically considered by practicing physicians. For administration
as a continuous infusion, a typical dosing schedule is a weekly
continuous infusion at 1,300 mg/m.sup.2, which may be modified
during treatment.
[0155] The antineoplastic agent irinotecan hydrochloride trihydrate
(CPT-11, Camptosar, PNU-101440E;
(S)[1,4'-bipiperidine]-1'-carboxylic acid,
4,11-diethyl-3,4,12,14-tetrahydro-4-hydroxy-3,14-dioxo-1H-pyrano[3'-
,4':6,7]indolizino(1,2-b)quinolin-9-yl ester, monohydrochloride,
trihydrate; C.sub.33H.sub.38N.sub.4O.sub.6.HCl.3H.sub.2O) is a
semisynthetic derivative of the natural product camptothecin
(Kunimoto et al. (1987) Cancer Res. 47:5944-5947; Sawada et al.
(1991) Chem. Pharm. Bull. 39:1446-1454). CPT-11 has been approved
by the U.S. Food and Drug Administration for the treatment of
patients with metastatic carcinoma of the colon or rectum whose
disease has recurred or progressed following 5-fluorouracil-based
therapy. The recommended starting dosage of CPT-11 is either 125
mg/m.sup.2 i.v. over 90 min once a week for 4 weeks, followed by a
2-week rest, or 350 mg/m.sup.2 given once every 3 weeks. Dosage
modifications after the initial dose are based on individual
patient tolerance.
[0156] Formulations, dosages and treatment protocols used to
administer the antagonists of the present invention will vary
depending on the specific antagonist, the type and stage of cancer,
and other factors typically considered in clinical practice, and
can be readily determined by those skilled in the art. If the
antagonist is an antibody, therapeutic formulations are prepared
for storage by mixing the antibody having the desired degree of
purity with optional physiologically acceptable carriers,
excipients or stabilizers (Remington's Pharmaceutical Sciences 16th
edition, Osol, A. Ed. (1980)), in the form of lyophilized
formulations or aqueous solutions. Acceptable carriers, excipients,
or stabilizers are nontoxic to recipients at the dosages and
concentrations employed, and include buffers such as phosphate,
citrate, and other organic acids; antioxidants including ascorbic
acid and methionine; preservatives (such as octadecyldimethylbenzyl
ammonium chloride; hexamethonium chloride; benzalkonium chloride,
benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl
parabens such as methyl or propyl paraben; catechol; resorcinol;
cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less
than about 10 residues) polypeptide; proteins, such as serum
albumin, gelatin, or immunoglobulins; hydrophilic polymers such as
polyvinylpyrrolidone; amino acids such as glycine, glutamine,
asparagine, histidine, arginine, or lysine; monosaccharides,
disaccharides, and other carbohydrates including glucose, mannose,
or dextrins; chelating agents such as EDTA; sugars such as sucrose,
mannitol, trehalose or sorbitol; salt-forming counter-ions such as
sodium; metal complexes (e.g., Zn-protein complexes); and/or
non-ionic surfactants such as TWEEN.TM., PLURONICS.TM. or
polyethylene glycol (PEG).
[0157] The formulation may also contain more than one active
compound as necessary for the particular indication being treated,
preferably those with complementary activities that do not
adversely affect each other. For example, it may be desirable to
further provide an immunosuppressive agent. Such molecules are
suitably present in combination in amounts that are effective for
the purpose intended.
[0158] The active ingredients may also be entrapped in microcapsule
prepared, for example, by coacervation techniques or by interfacial
polymerization, for example, hydroxymethylcellulose or
gelatin-microcapsule and poly-(methylmethacylate) microcapsule,
respectively, in colloidal drug delivery systems (for example,
liposomes, albumin microspheres, microemulsions, nano-particles and
nanocapsules) or in macroemulsions. Such techniques are disclosed
in Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed.
(1980).
[0159] The formulations to be used for in vivo administration must
be sterile. This is readily accomplished by filtration through
sterile filtration membranes.
[0160] Sustained-release preparations may be prepared. Suitable
examples of sustained-release preparations include semipermeable
matrices of solid hydrophobic polymers containing the antibody
variant, which matrices are in the form of shaped articles, e.g.,
films, or microcapsule. Examples of sustained-release matrices
include polyesters, hydrogels (for example,
poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)),
polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic
acid and ethyl-L-glutamate, non-degradable ethylene-vinyl acetate,
degradable lactic acid-glycolic acid copolymers such as the LUPRON
DEPOT.TM. (injectable microspheres composed of lactic acid-glycolic
acid copolymer and leuprolide acetate), and
poly-D-(-)-3-hydroxybutyric acid. While polymers such as
ethylene-vinyl acetate and lactic acid-glycolic acid enable release
of molecules for over 100 days, certain hydrogels release proteins
for shorter time periods. When encapsulated antibodies remain in
the body for a long time, they may denature or aggregate as a
result of exposure to moisture at 37.degree. C., resulting in a
loss of biological activity and possible changes in immunogenicity.
Rational strategies can be devised for stabilization depending on
the mechanism involved. For example, if the aggregation mechanism
is discovered to be intermolecular S--S bond formation through
thio-disulfide interchange, stabilization may be achieved by
modifying sulfhydryl residues, lyophilizing from acidic solutions,
controlling moisture content, using appropriate additives, and
developing specific polymer matrix compositions.
[0161] The formulation is administered to a mammal in need of
treatment with the antibody, preferably a human, in accord with
known methods, such as intravenous administration as a bolus or by
continuous infusion over a period of time, by intramuscular,
intraperitoneal, intracerobrospinal, subcutaneous, intra-articular,
intrasynovial, intrathecal, oral, topical, or inhalation routes. In
preferred embodiments, the formulation is administered to the
mammal by intravenous administration. For such purposes, the
formulation may be injected using a syringe or via an IV line, for
example.
[0162] The appropriate dosage ("therapeutically effective amount")
of the antibody will depend, for example, on the condition to be
treated, the severity and course of the condition, whether the
antibody is administered for preventive or therapeutic purposes,
previous therapy, the patient's clinical history and response to
the antibody, the type of antibody used, and the discretion of the
attending physician. The antibody is suitably administered to the
patent at one time or over a series of treatments and may be
administered to the patent at any time from diagnosis onwards. The
antibody may be administered as the sole treatment or in
conjunction with other drugs or therapies useful in treating the
condition in question.
[0163] As a general proposition, the therapeutically effective
amount of the antibody administered will be in the range of about
0.1 to about 50 mg/kg of patent body weight whether by one or more
administrations, with the typical range of antibody used being
about 0.3 to about 20 mg/kg, more preferably about 0.3 to about 15
mg/kg, administered daily, for example. However, other dosage
regimens may be useful. The progress of this therapy is easily
monitored by conventional techniques.
[0164] The present invention also includes therapeutic mixtures of
one or more chemotherapeutic agents and one or more antagonists of
a gene or genes that are selectively upregulated by such
chemotherapeutic agent(s). Formulations comprising such therapeutic
mixtures can be prepared using methods and ingredients known in the
art, such as those discussed above. Similarly, dosages are expected
to be within the ranges discussed above, although in a combination
the effective doses of the active ingredients may be lower than the
dosage for the same active ingredient when used alone.
[0165] Administration "in combination" includes administration as a
mixture, simultaneous administration using separate formulations,
and consecutive administration in any order.
[0166] The methods of the present invention may be combined with
other treatment options, including surgical procedures, radiation,
and/or the administration of any type of anti-cancer agent.
[0167] Further details of the invention are illustrated by the
following non-limiting Example.
EXAMPLE
Treatment of Human Colorectal Tumor Xenografts with Irinotecan
(CPT-11) Activates Genes Normally Expressed by Squamous Cell
Epithelium
[0168] This study was designed to identify gene transcripts acutely
expressed by human colorectal adenocarcinomas following in vivo
exposure to the standard care chemotherapeutic irinotecan. Colo205
and DLD-1 xenografts were used as p53 wild-type (wt) and p53 mutant
tumor models, respectively, and gene expression by normal murine
colon tissue resected from the same animals was also analyzed. The
expression levels of numerous transcripts were reproducibly altered
by drug treatment of the tumors, including, but not limited to, the
genes normally expressed by squamous cell epithelium.
[0169] Materials and Methods
[0170] Cell lines--Colo205, HCT116, HT29 (ATCC Nos. CCL222, CCL221,
CCL247, HTB38, respectively) are human colorectal adenocarcinoma
cell lines. 293 is a human immortalized embryonic kidney cell line
(ATCC CRL1573). PC-3 is a human prostate adenocarcinoma cell line
(ATCC CRL1435) and HT1080 is a human fibrosarcoma cell line (ATCC
CCL-121). PC-3 stable cell lines were generated by transfection
(Effectene, Qiagen) with a CMV-driven vector encoding either an
NH2-terminal gD epitope-tagged form of LY6D/E48 or an empty vector
and selected in 400 .mu.g/ml G418 (Geneticin, Life Technologies,
Inc.). Growth conditions were according to American Type Culture
Collection (ATCC, Manassas, Va.) guidelines. For all cell lines,
CPT11 treatments were done in 10 cm dishes for the indicated
timepoints. Cells were harvested and RNA was prepared using RNeasy
kit (Qiagen, Hilden, Germany). TaqMan.RTM. real-time quantitative
PCR analysis was performed as described below.
[0171] Growth and treatment of human tumor xenografts--Female nude
mice (Charles River Laboratories, Hollister Calif.) were maintained
in accordance with the guide for the Care and Use of Laboratory
Animals, Colo205 human colorectal cancer cells were harvested,
resuspended in HBSS, and injected s.c. into flanks
(5.times.10.sup.6 cells/flank) of 6-8 week old mice. Tumors were
allowed to grow for two weeks at which time 0.1 ml of CPT-11 (80
mg/kg mouse) or 0.1 ml of saline control was administered
intraperitoneally (IP) to each animal three consecutive times at 4
day intervals. Twenty-four hours following the final dose of CPT-11
or saline, tumors were resected from the animals. Three tumors from
CPT-11 treated animals with masses of 0.23, 0.18, and 0.50 grams,
and three from the saline controls with masses of 0.23, 0.36 and
0.38 grams were each divided in half. Half of each tumor was frozen
immediately in liquid nitrogen for subsequent extraction of RNA and
the other half was fixed in 10% neutral buffer formalin overnight
and then transferred 24 hours later into 70% ethanol for
sectioning, microscopic analysis and analysis by in situ
hybridization. Tumor xenografts of the DLD-1 colorectal cell line
were treated and prepared in essentially the same manner. The
masses of the DLD-1 colorectal tumor xenografts at time of
resection were 0.24, 0.10 and 0.21 for saline controls and 0.21,
0.1 and 0.12 for CPT-11-treated tumors.
[0172] For in vivo efficacy studies, mice were inoculated with
Colo205 cells, 5 million cells/mouse, on the right dorsal flank
area subcutaneously, in a volume of no more than 0.2 mls. When
tumors reached a mean tumor volume of about 100-200 mm.sup.3, mice
were grouped into treatment groups of 8 to 10 mice, each to begin
the following treatments. All IV injection were delivered into the
tail vein.
[0173] Groups:
[0174] Vehicle (PBS) only--IV, volume of 0.1 mls, 1.times./week for
4 weeks.
[0175] Anti-E48-vc-MMAE only--4 mg/kg, IV, volume of 0.1 mls,
1.times./week for 4 weeks.
[0176] Anti-IL8-vc-MMAE only--4 mg/kg, IV, volume of 0.1 mols,
1.times./week for 4 weeks.
[0177] Vehicle (PBS)+CPT-11--IV, volume of 0.1 mls, 1.times./week
for 4 weeks
[0178] +CPT-11, 80 mg/kg, IP, volume of 0.2 mls, treatment on day
0, 4 & 8 only.
[0179] Anti-IL8-vc-MMAE+CPT-11--3 mg/kg, IV, volume of 0.1 mls,
1.times./week for 4 weeks+CPT-11, 80 mg/kg, IP, volume of 0.2 mls,
treatment on day 0, 4 & 8 only.
[0180] Anti-E48-vc-MMAE--3 mg/kg, IV, volume of 0.1 mls,
1.times./week for 4 weeks+CPT-11, 80 mg/kg, IP, volume of 0.2 mls,
treatment on day 0, 4 & 8 only. Tumor volumes were measured by
clipper twice per week for a duration of 8 weeks or until tumors
ulcerated or reached a volume of greater than 1000 mm.sup.3. Tumor
volume (mm.sup.3) was calculated as a.times.b.sup.2.times.0.5,
where a and b are the lung and short diameters of the tumor,
respectively.
[0181] Preparation and analysis of tumor RNA--Tumor xenograft
specimens were homogenized in 3.5 ml of lysis buffer (4 M guanidine
thiocyanate, 25 mM sodium citrate, 0.5% N-laurylsarcosine, 0.7%
2-mercaptoethanol) and layered on 1.5 ml of a 5.7 M cesium
chloride, 50 mM EDTA (pH 8.0) solution. Following centrifugation at
150,000.times.g overnight, the RNA pellet was dried, resuspended in
water, phenolchloroform-extracted, and ethanol-precipitated. The
RNA was finally resuspended in water and the integrity of the RNA
preparations was monitored by visualization of 18S and 28S
ribosomal RNA on Agarose gels and found to be of good quality.
[0182] Oligonucleotide Array Analysis--Approximately 10 .mu.g of
total RNA purified from tumor specimen served as starting material
for the preparation of probes required for oligonucleotide array
analysis on the Affymetrix Human Genome U95 Gene Chip.RTM. set.
Probes were prepared according to previously described protocols
(Wodicka et al. (1997) Nat. Biotechnol. 15:1359-1367) and as per
the manufacturer's recommendations. Following hybridization, the
arrays were washed and stained with streptavidin-phycoerythrin and
then scanned with the Gene Array scanner (Aglient Technologies).
Default parameters provided in the Affymetrix data analysis
software package (Micro Analysis Suite version 4) were applied in
determining the signal intensities, referred to as average
difference. Sample normalization was done using global scaling (as
stated in the Affymetrix "Expression Analysis Technical Manual")
and a target intensity of 1500 was used to determine average
difference expression values. The average difference obtained with
probes derived from tumors treated with CPT-11, were base-lined
against average differences obtained from probes prepared from
saline control tumors to generate the fold-difference value for
each gene call. A fold-difference value was determined by comparing
each of three CPT-11-treated samples to each of the three control
samples resulting in nine possible fold-difference values for each
gene call. The fold-difference for each of the nine pair-wise
comparisons and an average with standard deviation is presented for
each gene set listed in Table I. Normal mouse colon tissue was also
resected from the experimental and control animals and the
extracted RNA subjected to analysis on Affymetrix Mu74Av2 chip set
essentially as described for the human tumor xenografts. The mouse
data presented in Table II only lists the average fold-differences
and standard deviations for the indicated genes.
[0183] Real-Time PCR (TaqMan.RTM.)--The source of RNA used for
RT-PCR analysis was the same as that used for the preparation of
probes for oligonucleotide array analysis. Quantitative Reverse
Transcriptase-PCR(RT-PCR) was performed using TaqMan.RTM. assay
reagents from Perkin-Elmer, Applied Biosystems, 50 .mu.l RT-PCR
reactions consisted of 5 .mu.l 10.times. TaqMan Buffer A, 300 .mu.M
of each dNTP, 5 mM MgCl.sub.2, 10 unites of RNase inhibitor, 12.5
units of MuLV Reverse Transcriptase, 1.25 units of AmpliTaq Gold
DNA Polymerase, 200 nM probe, 500 nM primers and 100 ng RNA.
Reaction conditions consisted of reverse transcription at
48.degree. C. for 10 minutes, denaturation at 95.degree. C. for 10
minutes, and 40 thermal cycles of 95.degree. C. for 25 seconds, and
65.degree. C. for 1 min. Reaction products were analyzed on
4-agarose gels (Invitrogen). Fold-induction for each gene of
interest was determined using the .DELTA..DELTA.Ct method and the
result is presented relative to both GAPDH and actin in each
figure. The following specific probes and primer sets were used for
MFGE8 (Acc#U58516): forward primer: GGTACCATGTGCCACAACTG (SEQ ID
NO: 1), reverse primer: GAGGCAACCAGGGAGACA (SEQ ID NO: 2), and
probe: CCCCTGTCCCCAAGAACACTTCC (SEQ ID NO: 3); GPC1 (Acc#X54232):
forward primer: GCTGTCCTGAACCGACTGA (SEQ ID NO: 4), reverse primer:
GGGACGGTGATGAAAAGC (SEQ ID NO: 5), and probe: AGCAGCACTAAGCGGCCTCCC
(SEQ ID NO:6); AQP3 (Acc# N74607): forward primer:
CTGGCAGCTCCTCCATGT (SEQ ID NO: 7), reverse primer:
CCCATCTGTGCCATAAGGA (SEQ ID NO: 8), and probe,
AAGCCCTGGAAACATACACACCC (SEQ ID NO: 9); CDH17 (Acc#83228): forward
primer: CCTACTCTGCAAACCTTGGTAA (SEQ ID NO: 10), reverse primer:
TGTATGCATGGCAGGTAGTG (SEQ ID NO: 11), and probe:
AAATCTGGCCAGCTGACTGGTTCC (SEQ ID NO: 12); Ly6D/E48 (Acc#Y12642):
forward primer: GGGGATTCCACACCTCTCT (SEQ ID NO: 13); reverse
primer: CCAAGTCATCAGCATTCCAT (SEQ ID NO: 14); and probe:
CCAGACTTTCGGGGAAGCCCTC (SEQ ID NO: 15); and Ly6E/SCA-2
(Acc#U66711): forward primer: CAGCTGCATGCACTTCAA (SEQ ID NO: 16);
reverse primer: AGGACTGGCTGGATTTGG (SEQ ID NO: 17); and probe:
CCTAGACCCGGAAGTGGCAGAAAC (SEQ ID NO: 18).
[0184] In situ hybridization--All antisense and sense
.sup.33P-labeled riboprobes were generated from PCR products
derived from cDNA libraries. The antisense and sense riboprobes for
Periplakin were 633 bp in length and were primed with the
oligonucleotides containing the sequences upper
5'GACTGGACAACTGGGATGC3' (SEQ ID NO: 19) and lower
5'GACTCCAGCCACCAGGTTTAT3' (SEQ ID NO: 20), respectively. The
antisense and sense riboprobes for Aquaporin-3 were 425 bp in
length and were primed with the oligonucleotides containing the
sequences upper 5'CAAGCTGCCCATCTACACCCT3' (SEQ ID NO: 21) and lower
5'GCTGGCCGGTCGTGAA3' (SEQ ID NO: 22), respectively. The antisense
and sense riboprobes for Antileukoproteinase were 378 bp in length
and were primed with the oligonucleotides containing the sequences
upper 5'TGCCCAGTGCCTTAGATACAA3' (SEQ ID NO: 23), lower
5'CCCCAAAGGATATCAGTG3' (SEQ ID NO: 24), respectively. The
hybridization experiments were conducted as described previously
(Holcomb et al. (2000) EMBO J. 4046-4055).
[0185] Preparation of anti-E48 monoclonal antibodies and
Anti-E48-val-cit-MMAE Immunoconjugate. BALB/c mice (Charles River
Laboratories, Wilmington, Del.) were immunized with
Baculovirus-derived his8-tagged LY6D/E48 protein and diluted in
Ribi adjuvant (Corixia; Hamilton, Mont.)) twice a week, via
footpad, 5 doses. B cells from lymph nodes were harvested from 5
mice demonstrating high serum titers were fused with mouse myeloma
cells (X63.Ag8.653; available from ATCC). After 10-14 days, the
supernatants were screened for antibody production by direct ELISA
and by flow cytometry on PC-3 cells stably expressing gD-tagged
E48. Positives were subcloned twice to achieve monoclonality. For
large-scale production of purified antibody, hybridoma cells were
injected i.p. into pristine-primed Balb/c mice. The ascites fluids
were pooled and purified by protein A affinity chromatography
(Pharmacia Fast Protein Liquid Chromatography; Pharmacia, Uppsala,
Sweden).
[0186] For flow cytometry, cells were grown to 90% confluence and
removed from plates using 2 mM EDTA in PBS. Cells were washed and
resuspended in FACS buffer (PBS with 1% BSA) and incubated for 60
min with anti-LY6D/E48 monoclonal antibody 15A5 or 17H7 or anti-gD
antibody (Genentech, Inc.) followed by 60 min with anti-mouse
secondary antibody conjugated to PE. Analysis was performed on FACS
scan.
[0187] The conjugation of the anti-E48 antibody and control
anti-IL8 antibody with MMAE were performed by Seattle Genetics
Inc., as described elsewhere (Doronina, 2003: Nat Biotechnol 21;
778-84).
[0188] Results
[0189] Nude mice were inoculated with colo205 colorectal cancer
cells and tumors were established over a period of two weeks. At
this time, intraperitoneal injections of CPT-11 or saline were
administered every fourth day, and 24 hours after the third
injection tumor and normal tissues were resected. The average mass
of the tumors at this time was approximately 300 mg and did not
differ significantly between the control and drug treated
groups.
[0190] To examine the induction of mRNA transcripts at the cellular
level, in situ hybridization was performed on sections obtained
from the tumors treated with CPT-11 or saline control. By H&E
staining, the cells in the Colo205 and DLD-1 tumors treated with
CPT-11 appeared slightly swollen and the nuclei enlarged relative
to the saline-treated controls (FIG. 7). However, the cells were
largely viable with only a minor increased in the number of
apoptotic bodies. This is consistent with gross macroscopic
observations indicating no decrease in tumor volume at the time of
resection.
[0191] RNA purified from three of the saline and three of the
CPT-11 treated tumors was subjected to oligonucleotide microarray
analysis for transcript expression. Fold change values for each
drug treated tumor compared to each control tumor is presented for
the tip 43 transcripts identified as upregulated on the U95Av2 chip
(Table I). A 100% agreement indicates that all 9 of the possible
pair-wise comparisons scored positive for upregulation of the
indicated transcript, whereas 89% indicates 8/9 comparisons were
positive, and so forth. In this study, focus was on transcripts
that scored positive in at least 6/9 possible comparisons.
Transcripts that underwent significant upregulation in all three
CPT-11 treated tumors relative to controls, identified and
confirmed by real-time PCR, included milk fat globule-EGF factor 8
protein (MFGE8), Glypican-1 (GPC1), Aquaporin-3 (AQP3), cadherin-17
(CDH17), E48 antigen (LY6D) and the LY6D homolog SCA-2 (LY6E) (FIG.
1A). Among these, LY6D/E48 exhibited the most consistent and robust
induction and was chosen for further studies as a potential
antibody target.
[0192] To validate expression data by a second method, 20
transcripts that scored positive on the U95Av2 chip were chosen,
and their relative expression levels were examined by real-time PCR
(TaqMan) using the same 6 RNA samples employed for the microarray
analysis. By this method, all 20 of the transcripts were confirmed
to be significantly upregulated. Although the degree of
upregulation of a given transcript varied somewhat between the two
methods, the overall fidelity of the microarray data is strongly
supported by the results of real-time PCR analysis.
[0193] The relative expression levels of the some of the genes
induced by CPT-11 were compared in a parallel analysis using RNA
extracted from the Colo205 and DLD-1 tumors. To varying degrees,
most of the genes were induced by CPT-11 treatment of both tumor
types (FIG. 2). Periplekin and Antileukoproteinase were both
strongly expressed by the control DLD-1 tumors, but were induced by
SPT-11 to a degree less than that observed for the Colo205 tumors.
By contrast, Galectin-7 mRNA was undetectable in both treated or
control DLD-1 tumors but was present and induced by CPT-11 in the
Colo205. Activation of Keratin23 and E48 occurred in both tumor
types in response to CPT-11, but these two transcripts were
approximately 100-fold lower in the DLD-1 control tumors relative
to the Colo205 control tumors. Neuromedin U, Annexin VIII,
Transglutaminase, Aquaporin-3 and Maspin were all induced by SPT-11
and expressed at comparable levels in the Colo205 and DLD-1
tumors.
[0194] The results of in situ hybridization demonstrate that the
genes upregulated by CPT-11 are expressed by the human tumor cells
and not by murine stromal cells that could potentially infiltrate
the tumor xenografts. Moreover, in Colo205 and DLD-1 cells treated
in vitro with CPT-11, again, upregulation of some of the genes
listed in Table I was observed (data not shown). As noted above,
among the genes that exhibited a robust response to CPT-11 in vitro
was that coding for the LY6D/E48 antigen. This antigen has been
reported to be upregulated in head and neck cancers and has been
proposed as a target for antibody-based therapy in this disease
(Brankenhoff et al. (1995) Cancer Immunol. Immunother.
40:191-200).
[0195] To determine whether the induction of LY6D/E48 by CPT-11 was
cell autonomous, LY6D/E48 transcript levels were measured in
cultured Colo205 cells following addition of 10 .mu.M CPT-11. This
relatively high concentration of drug is required in vitro due to
inefficient conversion of CPT-11 by caroxylesterases to the more
active moiety SN-38 (OOsterhoff et al., Mol Cancer Ther. 2:765-71
(2003)). The LY6D/E48 transcript was elevated within 24 hours
post-treatment with a further enhancement by 48 hours (FIG. 1B). It
was possible that Colo205 was an unusually sensitive cell line with
respect to activation of LY6D/E48 by CPT-11. Therefore, additional
cell lines were investigated. The LU6D/E48 transcript could not be
detected in the absence or presence of CPT-11 in the human prostate
cancer PC3 cell not in the human embryonic kidney cell line 293.
However, in addition to the Colo205, three colorectal cancer cell
lines, DLD-1, HCT116 and HT29, and the fibrosarcoma cell line
HT1080, overexpressed LY6D/E48 mRNA in response to CPT-11 (FIG.
1C).
[0196] A critical assumption in targeting tumor cell-surface
proteins induced by chemotherapeutics is that the drug will not
also induce the target in the normal tissue To examine this, normal
intestine was resected from the tumor-bearing mice that were
administered CPT-11 or saline control and performed oligonucleotide
array analysis on mouse specific chips. Real-time PCR with primers
specific for corresponding mouse transcripts was performed and with
the exceptions of SPRR3 and Aquaporin-3, all of the mouse homologs
were readily detected in RNA from mouse colon. However, no
difference in expression of these genes was detected when normal
colon tissue from CPT-11 treated mice was compared to that from the
control group (data not shown). To identify any mouse that
underwent significant changes in expression in response to CPT-11,
oligonucleotide microarray analysis was performed using mouse
specific oligonucleotide array Mu74Av2. Treatment of animals with
CPT-11 resulted in the activation of a small number of genes in the
colon, but they were unrelated to most of those induced in the
human tumor xenografts (Table II). Many of the genes induced in
normal colon likely reflect an acute immunological response to
tissue damage. For example, the Ig variable chain transcripts are
highly specific to lymphoid cells and probably emanate from immune
cells present in the gut. It has further been found that some of
the cryptidin genes, which are expressed by intestinal paneth cells
for the purpose of microbial defense (Ayabe et al. (2002) J. Biol.
Chem. 277:5219-5228), were activated in two of the three animals
treated with CPT-11. These results suggest that colorectal tumor
cells and normal colon cells respond very differently to DNA
damaging agents.
[0197] More detailed analysis has shown that apart from
Metallothionein (MT1G), none of the transcripts that were induced
in the tumors by CPT-11 were induced in the normal mouse intestine
(FIG. 2, Tables I and II). Further analysis of individual mouse
transcripts by real-time PCR was also consistent with this lack of
response (data not shown). Surprisingly, the normal mouse intestine
was quite refractory to changes in gene expression in response to
treatment with CPT-11, as evidenced by a 2-dimensional matrix plot
of saline vs. CPT-11 for an entire Mu74A gene chip (FIG. 8).
Nevertheless, evidence of physiological stress was apparent from
the genes that were induced as they largely coded for proteins
involved in detoxification (cytochrome p450, metallothionein),
microbial defense (defensins) and immunological responses
(immunoglobins) (Table II).
[0198] To obtain monoclonal antibodies to LY6D/E48, mice were
immunized with purified recombinant protein. Hybridomas producing
immunoglobulins with strong specific reactivity to transfected
cells stably expressing LY6D/E48 were identified. When Colo205
cells were exposed to increasing concentrations of CPT-11 in vitro,
the intensity of the signal measured by fluorescence activated cell
sorting increased in a dose dependent manner (FIG. 4B). Also, the
signal intensity and percentage of reactive cells observed by
immunofluorescent microscopy of intact cells increased with drug
dosage (FIG. 4A).
[0199] To determine whether the induction of gene coding for cell
surface protein could be exploited in targeted cancer therapy the
effects of a drug-conjugated anti-LY6D/E48 monoclonal antibody on
tumor growth was tested. Colo205 cells were inoculated into nude
mice and CPT-11 was administered when the tumors reached
approximately 200 mm.sup.3. CPT-11 was administered alone or in
combination with either anti-LY6D/E48-vc-MMAE or as a negative
control, anti-IL8-vc-MMAE. Although CPT-11 alone transiently
reduced the rate of tumor growth, regrowth occurred at rapid rate
following the last administration. However, in combination with
anti-LY6D/E48-vc-MMAE, but not anti-IL8-vc-MMAE, tumor growth was
retarded for a significantly longer period of time (FIG. 5, FIG.
6A). In animals receiving CPT-11 plus the anti-LY6D/E48-vc-MMAE
conjugate, 6 of 8 exhibited complete responses with minimal tumor
mass in the remainder of the animals out to 8 weeks.
Anti-LY6D/E48-vc-MMAE conjugate did not exhibit any antitumor
activity relative to vehicle or the control MAb conjugate in the
absence of CPT-11 coadministration (FIG. 6B). These results
indicate a synergistic activity between CPT-11 and antibody-drug
conjugate directed against an antigen induced by CPT-11.
[0200] Discussion
[0201] Current chemotherapeutic regimens for colorectal cancer
involve concomitant administration of antimetabolites and DNA
damaging agents that produce errors on replication of DNA (Tebbutt
et al. (2002) Eur. J. Cancer 38:1000-1015). The therapeutic index
of these drugs likely relates to the relative increased rate of
proliferation of cancer cells and perhaps to the impaired ability
of cancer cells to correct or eliminate the damage. The response of
tumors to these drugs varies widely and drug resistant tumors
frequently arise following their administration. Having a detailed
understanding of the manner in which tumor cells respond to
chemotherapeutic agents would aid in the development of more
effective therapies. Monitoring the response to drug treatment at
the level of gene expression is difficult, though, as tumor
specimens from recently treated patients are not easily obtained.
In the experiments presented in this Example, clinical
circumstances have been approximated by growing human tumors in
mice and assessing changes in gene expression that occur shortly
after drug treatment. A substantial finding from these studies is
that certain colorectal tumors, particularly those with wild-type
p53, launch a robust gene expression program that resembles that
engaged by squamous epithelial cells.
[0202] The experiment presented here was designed to identify genes
that were acutely activated by CPT-11 prior to the onset of the
more dramatic responses to the drug, as determined by changes in
tumor volume. At time of tumor resection, tumor cells appeared
largely viable and the volumes of the tumors were not reduced
relative to the saline treated controls.
[0203] The specific alterations in gene expression that were
observed in colon tumor xenografts in response to CPT-11 were not
observed in normal mouse colon. Exposure to drug likely occurred in
this tissue as noticeable changes in gene expression were apparent
in the CPT-11 treated animals. Our results suggest that normal
colon tissue is buffered against radical responses to genotoxic
insults, whereas cancer cells undergo dramatic and rapid responses
at the level of gene induction. Exploiting the differential
response between normal cells and cancer cells to a primary
therapeutic can be exploited to provide novel combination therapies
with enhanced efficacy. In particular, combination therapy with a
primary chemotherapeutic drug and an antagonist of a gene
differentially induced in cancer cells as a result of treatment
with the primary chemotherapeutic drug is expected to improve the
efficacy of cancer treatment. Thus, for example, antibodies or
small molecules directed at targets selectively induced in cancer
cells by primary therapeutics hold promise to improve the
therapeutic index of drug combination.
[0204] In a particular aspect, the results presented herein
demonstrate that LY6D/E48, which is commonly upregulated n a
variety of cancer cell lines in response to CPT-11, is an effective
target for an immunoconjugate when used with the inducing drug.
[0205] All references cited throughout the disclosure are hereby
expressly incorporated by reference. Although the invention is
illustrated by reference to certain embodiment, it is not so
limited. Indeed, various modifications of the invention in addition
to those shown and described herein will become apparent to those
skilled in the art from the foregoing description and fall within
the scope of the appended claims.
TABLE-US-00001 TABLE I Genes upregulated by treatment of Colo205
tumor xenografts with CPT-11 C#1 C#2 C#3 Affy S#1 S#2 S#3 S#1 S#2
S#3 S#1 S#2 S#3 Avg probe ID fold.sup.a fold fold fold fold fold
fold fold fold fold SD % AGREE Accession #/Description 39230_at 8
9.6 13.6 9.2 10.4 16.4 17.3 19.3 28.7 15 7 100 AL022318/Phorbolin 3
36284_at 12 10.1 7.9 14 12 7.9 13 12 8.2 11 2 100 Y12642/E48
38608_at 7.9 7.8 7.5 6.7 6.8 8 11.9 12 11.2 9 2 100
AA010777/galectin7 38388_at 4.7 5.9 4.9 6 6.8 6 6.2 7.7 6.4 6 1 100
M11810/(2-5) oligo A synthetase E 926_at 7.8 5.1 5.8 7.1 5 6.6 5.5
3.3 4.6 6 1 100 J03910/metallothionein-IG (MT1G) 36890_at 5.2 2.5
3.5 7.7 3.8 5.1 9.9 4.8 7.6 6 2 100 AF001691/Periplakin 915_at 4.4
5.9 4.4 5.3 7.1 5.3 4.5 6 4.5 5 1 100 M24594/Human
interferon-inducible 56 Kd protein 39545_at 6.9 4 4.2 7.2 4.1 4.4
7.2 4.1 4.4 5 1 100 U22398/Cdk-inhibitor p57KIP2 34823_at 4.5 3 3.3
5.2 3.4 4.7 6.1 4 4.5 4 1 100 X60708/dipeptidyl peptidase IV
1358_s_at 3.6 3.9 3.6 4.9 5.3 4.9 3.8 4.1 3.8 4 1 100 U22970/Human
interferon-inducible peptide (6-16) 40031_at 1.8 3.6 4.1 2.1 4.4
4.9 2.6 6.9 7.3 4 2 100 M74542/aldehyde dehydrogenase type III
37014_at 2 3.6 7.3 2.1 3.9 7.9 1.8 3.3 5.3 4 2 100 M33882/p78
protein (MxA) 32275_at 2.5 2.3 4.7 2.6 2.4 5 3.8 3.5 8.1 4 2 100
X04470/antileukoprotease 34965_at 3.2 3 2.6 3.9 3.7 3.2 4.5 4.2 3.6
4 1 100 AF031824/leukocystatin 36922_at 5.2 3 4 4.1 2.5 3.3 3.6 2.2
3 3 1 100 X59618/small subunit ribonucleotide reductase 577_at 3.3
3.6 3.7 3.1 3.3 3.5 2.9 3.2 3.3 3 0 100 M94250/retinoic acid
inducible factor (MK) 1787_at 4.4 3.3 2.8 3.7 3 2.6 4 2.8 2.4 3 1
100 U22398/Cdk-inhibitor p57KIP2 32814_at 3.3 2.9 2.9 3.9 3.5 3.4
2.7 2.4 2.3 3 1 100 M24594/interferon-inducible 56 Kd protein
(IFIT1) 33338_at 2.7 2.9 4.2 2.5 2.6 3.8 2 2.1 3.2 3 1 100 M97936
transcription factor ISGF-3 (STAT1) 36780_at 3.6 2.7 2.8 3.2 2.4
2.5 3.2 2.4 2.5 3 0 100 M25915/complement cytolysis inhibitor (CLI)
39119_s_at 1.6 2.6 2.4 2.4 4 3.7 1.9 3.2 2.9 3 1 100
AA631972/Natural killer cell transcript 4 38389_at 1.9 2.5 2.2 2.5
3.3 2.9 2.2 2.9 2.5 3 0 100 X04371/2-5A synthetase induced by
interferon 39331_at 2.2 2.1 2.1 2 1.9 1.9 2.8 2.7 2.7 2 0 100
X79535/beta tubulin 37420_i_at 2 2.7 2 1.8 2.4 1.8 2.1 2.8 2.1 2 0
100 AL022723/MHC, class I, F (CDA12) 1375_s_at 2 1.9 2.2 2.2 2.1
2.4 2.1 1.9 2.3 2 0 100 M32304/TIMP2 39677_at 1.9 2.1 2 2 2.2 2 2.1
2.3 2.1 2 0 100 D80008/KIAA0186 296_at 1.8 1.8 1.9 1.9 1.9 2 2.1
2.1 2.2 2 0 100 X79535/Tubulin, Beta 770_at 7.6 8 2.9 7.3 8.1 3.4
6.3 6.5 6.1 6 2 100 D00632/glutathione peroxidase 39248_at 5.8 7.9
8.1 7 5.8 5.9 3.9 5.5 5.6 6 1 100 N74607/Aquaporin 3 38673_s_at 3.6
3.8 5.1 3.4 5.6 5 2.8 5 4 1 89 D64137/p57KIP2 38124_at 3.8 3.7 3.6
3.7 3.7 3.7 3.6 3.5 4 0 89 X55110/neurite outgrowth-promoting
protein (midkine) 34363_at 2.1 1.5 3.1 2.8 2.7 5.4 4.9 4 3 1 89
Z11793/selenoprotein P 39263_at 2.3 4.1 3.8 2.3 4 3.7 2.8 2.6 3 1
89 M87434/oligo A synthetase (p69 2-5A synthetase) 425_at 2.3 2.5
2.1 2.7 3 2.1 2.8 3 3 0 89 X67325/interferon alpha-inducible
protein 27 32106_at 2 1.7 2.6 3 2.5 2.6 3 2.4 2 0 89
L28101/kallistatin (PI4) 37954_at 4.7 6.2 5.2 5.4 9.5 7.8 7.4 7 2
78 X16662/Annexin VIII 34403_at 4.6 2.3 1.8 12 5.8 4.6 10.6 6 4 78
U58516/breast epithelial antigen BA46 33399_at 5.5 3.4 3 4.4 7.1
3.6 3.7 4 1 78 AA142942/Ribosomal protein S6 35099_at 4.8 4.1 3.4
3.6 5 3.1 4.1 4 1 78 AF019225/apolipoprotein L 608_at 3 2.9 3.1 3.9
4.4 4.8 4.7 4 1 78 M12529/Human apolipoprotein E 37039_at 3.4 4 3
3.5 4.1 4.9 3.5 4 1 78 J00194/human hla-dr antigen alpha-chain
38432_at 1.6 3 5.2 5.5 1.8 3.4 5.7 4 2 78
AA203213/interferon-stimulated protein 15 879_at 2.6 3.3 3.5 4.3
4.2 4.1 3.5 4 1 78 M30818/interferon-induced (MxB) .sup.aEach
CPT-11 treated tumor (C) was compared to each saline control
treated tumor (S) to generate a fold increase.
TABLE-US-00002 TABLE II Genes upregulated in mouse colon by CPT-11.
AFFY % Ave Probe ID AGREE fold .sup.a Accession/Description
92202_g_at 100.00 2.25 Al553024/PLZF, ZNF145 93996_at 100.00 1.93
X01026/cytochrome P450 2e1 93573_at 100.00 1.68
V00835/Metallothionein 1 102155_f_at 88.89 3.82 K03461/Ig kappa
light chain 160841_at 88.89 2.07 AW047343/D site albumin promote BP
94516_f_at 88.89 1.58 M55181/Preproenkephalin 2 99369_f_at 77.78
6.73 AF029261/Ig kappa light chain (Vk10c) 102154_f_at 77.78 5.64
M13284/Mouse Ig active kappa-chain V-region (V139-J1) 102157_f_at
77.78 4.48 MI5520/Mouse Ig V- kappa10-Ars-A 99405_at 77.78 4.38
U30241/Ig kappa chain mRNA hybridoma 84.15 101720_f_at 77.78 4.15
U30629/Ig kappa chain mRNA hybridoma 84.20 98765_f_at 77.78 1.98
U23095/CB17 SCID Ig heavy chain clone 58-92 101561_at 77.78 1.72
K02236/Metallothionein 2 104451_at 77.78 1.68 Al852578/est
160117_at 77.78 1.64 Al850638/est 103294_at 77.78 1.54 U67188/G
protein signaling regulator RGS5 95766_f_at 66.67 9.90
U03066/cryptdin-16 (Defcr16) 100351_f_at 66.67 9.57
U02997/cryptdin-2 (Defcr2) 93879_f_at 66.67 9.49 U02999/cryptdin-3
(Defcr3) 92812_f_at 66.67 9.13 U02995/Defensin related cryptdin
peptide 99551_f_at 66.67 7.01 U12560/cryptdin 5 gene 102814_f_at
66.67 6.76 M33226/Defensin related sequence 93863_f_at 66.67 6.64
U03003/cryptdin-6 (Defcr6) 101794_f_at 66.67 3.96 U12562/cryptdin i
gene 100360_f_at 66.67 3.11 X02466/germline Ig V(H)II gene H17
103654_at 66.67 2.84 AB018374/GARP45 102016_at 66.67 2.38 M61737
adipocyte-specific mRNA 93213_at 66.67 2.05 AB007986/single chain
antibody ScFv 93294_at 66.67 2.01 M70642/Fibroblast inducible
secreted protein 95611_at 66.67 1.89 AA726364/est 99959_at 66.67
1.76 AW061337/est 93619_at 66.67 1.75 AF022992/Period homolog
(Drosophila) 100144_at 66.67 1.69 X07699/Nucleolin 98084_at 66.67
1.66 Al849834/ est 99965_at 66.67 1.63 D31969/Vitamin D receptor
104154_at 66.67 1.61 AB021961/p53 96854_at 66.67 1.60 AJ010391/copa
gene 94688_at 66.67 1.60 X83106/Max dimerization protein 160378_at
66.67 1.58 Al853127/est 93836_at 66.67 1.56 AF041054/E1B 19K/(Nip3)
99076_at 66.67 1.54 U09504/Thyroid hormone receptor alpha 103275_at
66.67 1.51 U13836/vacuolar adenosine triphosphatase Ac116 160088_at
66.67 1.51 U90535/flavin-containing monooxygenase 5 (FMO5) aAverage
fold increase from comparison of 3 cpt-11-treated mice to 3
saline-treated mice.
Sequence CWU 0 SQTB SEQUENCE LISTING The patent application
contains a lengthy "Sequence Listing" section. A copy of the
"Sequence Listing" is available in electronic form from the USPTO
web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20120201822A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
0 SQTB SEQUENCE LISTING The patent application contains a lengthy
"Sequence Listing" section. A copy of the "Sequence Listing" is
available in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20120201822A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
* * * * *
References