U.S. patent application number 13/276783 was filed with the patent office on 2012-08-02 for methods for up-regulating antigen expression in tumors.
This patent application is currently assigned to CytoCure LLC. Invention is credited to Ian S. Dunn, Paul J. Durda, James T. Kurnick.
Application Number | 20120195855 13/276783 |
Document ID | / |
Family ID | 31978494 |
Filed Date | 2012-08-02 |
United States Patent
Application |
20120195855 |
Kind Code |
A1 |
Durda; Paul J. ; et
al. |
August 2, 2012 |
METHODS FOR UP-REGULATING ANTIGEN EXPRESSION IN TUMORS
Abstract
The invention provides methods of modulating tumor antigen
associated (TAA) expression, and methods of modulating TAA
expression in order to treat a tumor. More particularly, the
invention provides methods of increasing an immune response against
a tumor cell. Methods include administering to a subject with a
tumor an amount of IFN-.beta. receptor agonist and tumor associated
antigen (TAA) sufficient to increase an immune response against the
tumor cell.
Inventors: |
Durda; Paul J.; (Needham,
MA) ; Kurnick; James T.; (Quincy, MA) ; Dunn;
Ian S.; (Sydney, AU) |
Assignee: |
CytoCure LLC
Beverly
MA
|
Family ID: |
31978494 |
Appl. No.: |
13/276783 |
Filed: |
October 19, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10651616 |
Aug 29, 2003 |
8071321 |
|
|
13276783 |
|
|
|
|
60407492 |
Aug 29, 2002 |
|
|
|
Current U.S.
Class: |
424/85.6 |
Current CPC
Class: |
A61K 39/001156 20180801;
A61K 39/001191 20180801; A61P 35/00 20180101; A61K 35/15 20130101;
A61K 39/0011 20130101; A61K 2039/55522 20130101; A61K 38/215
20130101; A61K 39/001186 20180801; A61K 39/001152 20180801; A61K
39/001188 20180801; C07K 16/3053 20130101; A61P 35/04 20180101;
G01N 33/5011 20130101; A61K 39/001192 20180801; A61K 38/215
20130101; A61K 2300/00 20130101 |
Class at
Publication: |
424/85.6 |
International
Class: |
A61K 38/21 20060101
A61K038/21; A61P 35/04 20060101 A61P035/04; A61P 35/00 20060101
A61P035/00 |
Claims
1-65. (canceled)
66. A method of treating a tumor comprising administering to a
subject with a tumor an amount of interferon-.beta. (IFN-.beta.)
receptor agonist to up-regulate expression of a tumor associated
antigen (TAA) on the tumor followed by administering an autologous
immune cell that interacts with a tumor cell of the tumor, wherein
the IFN-.beta. receptor agonist comprises a polypeptide comprising
the amino acid sequence of SEQ ID NO: 29 or SEQ ID NO: 30, thereby
treating the tumor.
67. The method of claim 66, wherein the immune cell is a
lymphocyte.
68. The method of claim 67, wherein the lymphocyte is a T
lymphocyte.
69. The method of claim 66, wherein the amino acid sequence of the
polypeptide comprises the amino acid sequence set forth in SEQ ID
NO: 29.
70. The method of claim 69, wherein the amino acid sequence of the
polypeptide consists of the amino acid sequence set forth in SEQ ID
NO: 29.
71. The method of claim 66, wherein the amino acid sequence of the
polypeptide comprises the amino acid sequence set forth in SEQ ID
NO: 30.
72. The method of claim 71, wherein the amino acid sequence of the
polypeptide consists of the amino acid sequence set forth in SEQ ID
NO: 30.
73. The method of claim 66, wherein the tumor is metastatic.
74. The method of claim 66, wherein the treatment reduces tumor
volume, inhibits an increase in tumor volume, stimulates tumor cell
lysis or apoptosis, or reduces tumor metastasis.
75. The method of claim 66, further comprising administering an
anti-tumor therapy.
76. The method of claim 75, wherein the anti-tumor therapy
comprises surgical resection, radiotherapy, or chemotherapy.
77. The method of claim 66, wherein the subject is human.
78. The method of claim 66, wherein the TAA is selected from:
Melan-A/MART-1, tyrosinase, gp100/pmel 17, TRP-1, TRP-2, an MITF,
MITF-A, MITF-M, melanoma GP75, Annexin I, Annexin II, adenosine
deaminase-binding protein (ADAbp), PGP 9.5, Colorectal associated
antigen (CRC)--C017-1A/GA733, Ab2 BR3E4, CI17-1A/GA733, Hsp70,
Hsp90, Hsp96, Hsp105, Hsp110, HSPPC-96, stress protein gp96 (a
human colorectal cancer tumor rejection antigen, Heike 2000),
gp96-associated cellular peptide, G250, Dipeptidyl peptidase IV
(DPPIV), Mammaglobin, thyroglobulin, STn, Carcinoembryonic Antigen
(CEA), Carcinoembryonic Antigen (CEA) epitope CAP-1,
Carcinoembryonic Antigen (CEA) epitope CAP-2, etv6, aml1, Prostate
Specific Antigen (PSA), PSA epitope PSA-1, PSA epitope PSA-2, PSA
epitope PSA-3, Ad5-PSA, prostate-specific membrane antigen (PSMA),
Prostatic Acid Phosphatase (PAP), Prostate epithelium-derived Ets
transcription factor (PDEF), Parathyroid-hormone-related protein
(PTH-rP), EGFR, PLU1, Oncofetal antigenimmature laminin receptor
(OFA-iLR), MN/CA IX (CA9) (Shimizu, 2003), HP59, Cytochrome oxidase
1, sp100, msa, Ran GTPase activating protein, a RabGAP (Rab
GTPase-activating) protein, PARIS-1, T-cell receptor/CD3-zeta
chain, cTAGE-1, SCP-1, Glycolipid antigen-GM2, GD2 or GD3, GM3,
FucosylGM1, Glycoprotein (mucin) antigens-Tn, Sialyl-Tn, TF and
Mucin-1, CA125 (MUC-16), a MAGE family antigen, GAGE-1,2, BAGE,
RAGE, LAGE-1, GnT-V, EPCAM/KSA, CDK4, a MUC family antigen,
HER2/neu, ErbB-2/neu, p21 ras, RCAS1, .alpha.-fetoprotein,
E-cadherin, .alpha.-catenin, .beta.-catenin and .gamma.-catenin,
NeuGcGM3, Fos related antigen, Cyclophilin B, RCAS1, S2, L10a, L
10a, Telomerase rt peptide, cdc27, fodrin, p120ctn, PRAME,
GA733/EoCam, NY-BR-1, NY-BR-2 NY-BR-3, NY-BR-4 NY-BR-5, NY-BR-6
NY-BR-7, NY-ESO-1, L19H1, MAZ, PINCH, PRAME, Prp1p/Zer1p, WT1,
adenomatous polyposis coli protein (APC), PHF3, LAGE-1, SART3,
SCP-1, SSX-1, SSX-2, SSX-4, TAG-72, TRAG-3, MBTAA, a Smad tumor
antigen, lmp-1, HPV-16 E7, c-erbB-2, EBV-encoded nuclear antigen
(EBNA)-1, Herpes simplex thymidine kinase (HSVtk), alternatively
spliced isoform of XAGE-1 (L552S), TGF beta RII frame shift
mutation, BAX frame shift mutation, or an antigenic fragment
thereof.
79. A method of treating a subject having or at risk of having a
tumor comprising administering to the subject a) an amount of
interferon-.beta. (IFN-.beta. receptor agonist that up-regulates
expression of a tumor associated antigen (TAA) on the tumor and b)
the TAA, wherein the TAA is administered singly or multiple times
to the subject 1 day to 6 months before administering the
IFN-.beta. receptor agonist, and wherein the IFN-.beta. receptor
agonist comprises a polypeptide comprising the amino acid sequence
of SEQ ID NO: 29 or SEQ ID NO: 30, thereby treating the
subject.
80. The method of claim 79, wherein the amino acid sequence of the
polypeptide comprises the amino acid sequence set forth in SEQ ID
NO: 29.
81. The method of claim 80, wherein the amino acid sequence of the
polypeptide consists of the amino acid sequence set forth in SEQ ID
NO: 29.
82. The method of claim 79, wherein the amino acid sequence of the
polypeptide comprises the amino acid sequence set forth in SEQ ID
NO: 30.
83. The method of claim 82, wherein the amino acid sequence of the
polypeptide consists of the amino acid sequence set forth in SEQ ID
NO: 30.
84. The method of claim 79, wherein the IFN-.beta. receptor agonist
is administered singly or multiple times.
85. The method of claim 79, wherein the TAA is administered singly
or multiple times to the subject 1 to 14 days before administering
the IFN-.beta. receptor agonist.
86. The method of claim 79, wherein the TAA is administered singly
or multiple times to the subject 14 to 30 days before administering
the IFN-.beta. receptor agonist.
87. The method of claim 79, wherein the TAA is administered singly
or multiple times to the subject 1 to 6 months before administering
the IFN-.beta. receptor agonist.
88. The method of claim 79, wherein the tumor is metastatic.
89. The method of claim 79, wherein the treatment reduces tumor
volume, inhibits an increase in tumor volume, stimulates tumor cell
lysis or apoptosis, or reduces tumor metastasis.
90. The method of claim 79, wherein the treatment reduces one or
more adverse symptoms associated with the tumor.
91. The method of claim 79, wherein the treatment inhibits
progression of the tumor.
92. The method of claim 79, wherein the subject is a candidate for,
is undergoing, or has undergone anti-tumor therapy.
93. The method of claim 92, wherein the anti-tumor therapy
comprises surgical resection, radiotherapy, or chemotherapy.
94. The method of claim 79, further comprising administering an
autologous immune cell that interacts with a cell of the tumor.
95. The method of claim 94, wherein the immune cell is a
lymphocyte.
96. The method of claim 95, wherein the lymphocyte is a T
lymphocyte.
97. The method of claim 79, wherein the subject is human.
98. The method of claim 79, wherein the TAA is selected from:
Melan-A/MART-1, tyrosinase, gp100/pmel 17, TRP-1, TRP-2, an MITF,
MITF-A, MITF-M, melanoma GP75, Annexin I, Annexin II, adenosine
deaminase-binding protein (ADAbp), PGP 9.5, Colorectal associated
antigen (CRC)--C017-1A/GA733, Ab2 BR3E4, CI17-1A/GA733, Hsp70,
Hsp90, Hsp96, Hsp105, Hsp110, HSPPC-96, stress protein gp96 (a
human colorectal cancer tumor rejection antigen, Heike 2000),
gp96-associated cellular peptide, G250, Dipeptidyl peptidase IV
(DPPIV), Mammaglobin, thyroglobulin, STn, Carcinoembryonic Antigen
(CEA), Carcinoembryonic Antigen (CEA) epitope CAP-1,
Carcinoembryonic Antigen (CEA) epitope CAP-2, etv6, aml1, Prostate
Specific Antigen (PSA), PSA epitope PSA-1, PSA epitope PSA-2, PSA
epitope PSA-3, Ad5-PSA, prostate-specific membrane antigen (PSMA),
Prostatic Acid Phosphatase (PAP), Prostate epithelium-derived Ets
transcription factor (PDEF), Parathyroid-hormone-related protein
(PTH-rP), EGFR, PLU1, Oncofetal antigenimmature laminin receptor
(OFA-iLR), MN/CA IX (CA9) (Shimizu, 2003), HP59, Cytochrome oxidase
1, sp100, msa, Ran GTPase activating protein, a RabGAP (Rab
GTPase-activating) protein, PARIS-1, T-cell receptor/CD3-zeta
chain, cTAGE-1, SCP-1, Glycolipid antigen-GM2, GD2 or GD3, GM3,
FucosylGM1, Glycoprotein (mucin) antigens-Tn, Sialyl-Tn, TF and
Mucin-1, CA125 (MUC-16), a MAGE family antigen, GAGE-1,2, BAGE,
RAGE, LAGE-1, GnT-V, EPCAM/KSA, CDK4, a MUC family antigen,
HER2/neu, ErbB-2/neu, p21ras, RCAS1, .alpha.-fetoprotein,
E-cadherin, .alpha.-catenin, .beta.-catenin and .gamma.-catenin,
NeuGcGM3, Fos related antigen, Cyclophilin B, RCAS1, S2, L10a,
L10a, Telomerase rt peptide, cdc27, fodrin, p120ctn, PRAME,
GA733/EoCam, NY-BR-1, NY-BR-2 NY-BR-3, NY-BR-4 NY-BR-5, NY-BR-6
NY-BR-7, NY-ESO-1, L19H1, MAZ, PINCH, PRAME, Prp1p/Zer1p, WT1,
adenomatous polyposis coli protein (APC), PHF3, LAGE-1, SART3,
SCP-1, SSX-1, SSX-2, SSX-4, TAG-72, TRAG-3, MBTAA, a Smad tumor
antigen, lmp-1, HPV-16 E7, c-erbB-2, EBV-encoded nuclear antigen
(EBNA)-1, Herpes simplex thymidine kinase (HSVtk), alternatively
spliced isoform of XAGE-1 (L552S), TGF beta RII frame shift
mutation, BAX frame shift mutation, or an antigenic fragment
thereof.
Description
RELATED APPLICATIONS
[0001] This application claims priority to U.S. Application Ser.
No. 60/407,492, filed Aug. 29, 2002.
FIELD OF THE INVENTION
[0002] The invention relates to modulating tumor antigen associated
(TAA) expression, and more particularly to methods of modulating
TAA expression in order to treat a tumor.
BACKGROUND
[0003] Many solid tumors are presently known to involve the
infiltration of autologous lymphocytes. These autologous
lymphocytes, known as tumor-infiltrating lymphocytes (TIL), have
been shown to recognize specific antigens expressed by cells of the
solid tumor. Expression of such tumor-associated antigens (TAAs) in
combination with appropriate accessory signals leads to a specific
cytolytic (cytotoxic) reactivity of the TILs toward the solid
tumors. In addition, antibodies that can recognize similar and
unique antigens have also been shown to bind selectively to and
facilitate killing of tumor cells.
[0004] Several tumor antigens have been identified in association
with a variety of tumors (Boon, et al. (1994). Ann Rev Immunol,
12:337; Kawakami, et al. (1994). Proc Natl Acad Sci USA, 91:3515;
and Bakker, et al. (1994). J Exp Med, 179:1005). In addition to the
identification of TAAs, immunodominant epitopes recognized by TILs
have also been described for widely-expressed lineage-specific
antigens, for example, the HLA-A2-restricted Melan-A/MART-1 in
melanomas (Sensi, et al., (1995). Proc Natl Acad Sci USA, 92:5674;
and Kawakami, et al., (1994). J Exp Med, 180:347).
[0005] Although there is mounting evidence that it is possible to
induce cell mediated immunity against autologous melanomas,
clinical immunotherapy strategies (Kradin, et al. Cancer Immunol.
Immunother. (1987). 24:76); Kradin, et al. Lancet, (1989). 1:577;
Rosenberg et al., (1987). N. Eng. J. Med., (1988). 25:1676;
Dillman, et al. (1991). Cancer, 68:1; Gattoni, et al., (1966).
Semin. Oncol, 23:754; and Kan-Mitchell, et al. (1993). Cancer
Immunol. Immunother., 37:15), have failed to achieve routine
efficacy. This failure has been due, at least in part, to the
ability of tumors to evade immune destruction (Becker, et al.,
(1993). Int. Immunol., 5:1501; Jager, et al. (1997). Int. J.
Cancer, 71:142; Macurer, et al., (1996). J. Clin. Invest., 98:1633;
and Marincola, et al., (1996). J. Immunother. Emphasis Tumor
Immunol., 9:192).
SUMMARY
[0006] The invention provides methods of increasing an immune
response against a tumor cell. In one embodiment, a method includes
administering to a subject with a tumor an amount of IFN-.beta.
receptor agonist and tumor associated antigen (TAA) sufficient to
increase an immune response against the tumor cell. An immune
response includes cell-mediated or humoral immune responses.
[0007] Also provided are methods of inhibiting silencing of a tumor
associated antigen (TAA), and methods of increasing expression of a
tumor associated antigen (TAA). In one embodiment, a method
includes administering to a subject with a tumor an amount of
IFN-.beta. receptor agonist sufficient to inhibit silencing of the
tumor associated antigen (TAA). In one aspect, the subject has been
administered a tumor associated antigen (TAA) prior to,
substantially contemporaneously with or following IFN-.beta.
receptor agonist administration. In another embodiment, a method
includes contacting a cell capable of expressing a TAA with a
compound that modulates an activity of an NFAT-motif binding
protein in an amount sufficient to increase expression of a tumor
associated antigen (TAA) of the cell.
[0008] Further provided are methods of treating a tumor. In one
embodiment, a method includes administering to a subject with a
tumor an amount of IFN-.beta. receptor agonist and tumor associated
antigen (TAA) sufficient to treat the tumor. In another embodiment,
a method includes administering to a subject with a tumor an amount
of IFN-.beta. receptor agonist and an antibody or a cell that
produces an antibody that specifically binds to a tumor associated
antigen (TAA) sufficient to treat the tumor. In yet another
embodiment, a method includes administering to a subject with a
tumor an amount of IFN-.beta. receptor agonist and an immune cell
that interacts with a tumor cell sufficient to treat the tumor.
[0009] Additionally provided are methods of treating a subject
having or at risk of having a tumor. In one embodiment, a method
includes administering to the subject an amount of IFN-.beta.
receptor agonist and tumor associated antigen (TAA) sufficient to
treat the subject. In another embodiment, a method includes
administering to the subject an amount of IFN-.beta. receptor
agonist and an antibody or a cell that produces an antibody that
specifically binds to a tumor associated antigen (TAA) sufficient
to treat the subject. In yet another embodiment, a method includes
administering to the subject an amount of IFN-.beta. receptor
agonist and an immune cell that interacts with a tumor cell
sufficient to treat the subject.
[0010] Moreover provided are methods of increasing effectiveness of
an anti-tumor therapy. In one embodiment, a method includes
administering to a subject that is undergoing or has undergone
tumor therapy, an amount of IFN-.beta. receptor agonist and tumor
associated antigen (TAA) sufficient to increase effectiveness of
the anti-tumor therapy. In another embodiment, a method includes
administering to a subject that is undergoing or has undergone
tumor therapy, an amount of IFN-.beta. receptor agonist and an
antibody or a cell that produces an antibody that specifically
binds to a tumor associated antigen (TAA) sufficient to increase
effectiveness of the anti-tumor therapy. In yet another embodiment,
a method includes administering to a subject that is undergoing or
has undergone tumor therapy, an amount of IFN-.beta. receptor
agonist and an immune cell that interacts with a tumor cell
sufficient to increase effectiveness of the anti-tumor therapy.
[0011] IFN-.beta. receptor agonists useful in the invention
include, for example, IFN-.beta., an IFN-.beta. mimic, or an
IFN-.beta. receptor antibody. Compounds and agents useful in the
invention also include molecules having similar activity as
IFN-.beta. (e.g., having TAA-inducing activity).
[0012] Compounds that modulate an activity of an NFAT-motif binding
protein include calcium flux modulators (e.g., ionomycin and
verapimil), VIVIT, gossypol, an N-substituted benzamide, rapamycin,
a quinazoline-2,4-dione, 1-3, a pyrrolo[3,4-d]pyrimidine-2,4-dione,
4-8, 1alpha,25-dihydroxyvitamin D3, FK506, FK520, cyclosporin,
3,5-Bis(trifluoromethyl)pyrazoles, dithiocarbamates, Vasoactive
intestinal peptide (VIP) and pituitary adenylate cyclase-activating
polypeptide (PACAP), Carboxyamidotriazole, Morphine, a
C32-O-arylethyl ether derivative of ascomycin, Ascomycin
macrolactam derivative SDZ ASM 981, or MCIP1. Additonal compounds
include, for example, an NFAT antisense nucleic acid, NFAT binding
protein (e.g., an antibody) or a dominant negative NFAT
polypeptide.
[0013] Tumors include any metastatic or non-metastatic, solid or
liquid (e.g., hematopoetic), malignant or non-malginant neplasia or
cancer in any stage, e.g., a stage I, II, III, IV or V tumor.
Particular embodiments include a sarcoma, carcinoma, melanoma,
myeloma, blastoma, lymphoma or leukemia.
[0014] Treatments provided include a therapeutic benefit, for
example, reducing tumor volume, inhibiting an increase in tumor
volume, stimulating tumor cell lysis or apoptosis, reducing tumor
metastasis, or inhibiting tumor progression. Treaments provided
also include reducing one or more adverse symptoms associated with
the tumor, including reducing mortality or prolonging lifespan.
[0015] Treatments provided further include administering an
anti-tumor therapy (e.g., surgical resection, radiotherapy, or
chemotherapy), immune enhancing therapy (e.g., an antibody or a
cell that produces an antibody that specifically binds to a tumor
associated antigen (TAA); or an immune cell that interacts with a
tumor cell) and an immune-enhancing agent. Cells that produce an
antibody that specifically binds to a tumor associated antigen
(TAA) include a plasma cell, B-cell, or a mammalian or
non-mammalian cell transfected with a nucleic acid encoding the
antibody. Immune cells that interact with a tumor cell include T
cell, NK cell, LAK cell, monocyte or macrophage, including cells
pre-selected to bind to an antigen expressed by the tumor.
[0016] Methods of identifying an agent that increases expression of
a melanoma tumor associated antigen (TAA) are additionally
provided. In one embodiment, a method includes contacting a cell
capable of expressing a melanoma TAA (e.g., a melanoma cell) with a
test agent; measuring the amount of TAA (e.g., Melan-A/MART-1,
tyrosinase, gp100/pmel 17, TRP-1, TRP-2 or MITF-M) expressed in the
presence of the test agent; and determining whether the amount of
TAA expressed is greater in the presence than in the absence of the
test agent. Increased TAA expression identifies the test agent as
an agent that increases expression of a melanoma TAA.
[0017] TAAs modulated in accordance with the invention include, for
example, antigens whose expression is increased in a tumor cell in
comparison to a non-tumor cell (e.g., normal) counterpart; antigens
whose expression is approximately the same or less in tumor cell in
comparison to a non-tumor cell counterpart; and antigens whose
expression changes during development, differentiation or in
response to a stimulus. TAAs can be present on or in a cell (e.g.,
in the cytoplasm or nucleus or attached to the cell surface). TAAs
can be present on any tumor, for example, a sarcoma, carcinoma,
melanoma, myeloma, blastoma, lymphoma or a leukemia.
[0018] Exemplary TAAs include: Melan-A/MART-1, tyrosinase,
gp100/pmel 17, TRP-1, TRP-2, an MITF, MITF-A, MITF-M, melanoma
GP75, Annexin I, Annexin II, adenosine deaminase-binding protein
(ADAbp), PGP 9.5, Colorectal associated antigen
(CRC)--C017-1A/GA733, Ab2 BR3E4, CI17-1A/GA733, Hsp70, Hsp90,
Hsp96, Hsp105, Hsp110, HSPPC-96, stress protein gp96 (a human
colorectal cancer tumor rejection antigen, Heike 2000),
gp96-associated cellular peptide, G250, Dipeptidyl peptidase IV
(DPPIV), Mammaglobin, thyroglobulin, STn, Carcinoembryonic Antigen
(CEA), Carcinoembryonic Antigen (CEA) epitope CAP-1,
Carcinoembryonic Antigen (CEA) epitope CAP-2, etv6, aml1, Prostate
Specific Antigen (PSA), PSA epitope PSA-1, PSA epitope PSA-2, PSA
epitope PSA-3, Ad5-PSA, prostate-specific membrane antigen (PSMA),
Prostatic Acid Phosphatase (PAP), Prostate epithelium-derived Ets
transcription factor (PDEF), Parathyroid-hormone-related protein
(PTH-rP), EGFR, PLU1, Oncofetal antigen-immature laminin receptor
(OFA-iLR), MN/CA IX (CA9) (Shimizu, 2003), HP59, Cytochrome oxidase
1, sp100, msa, Ran GTPase activating protein, a Rab-GAP (Rab
GTPase-activating) protein, PARIS-1, T-cell receptor/CD3-zeta
chain, cTAGE-1, SCP-1, Glycolipid antigen-GM2, GD2 or GD3, GM3,
FucosylGM1, Glycoprotein (mucin) antigens-Tn, Sialyl-Tn, TF and
Mucin-1, CA125 (MUC-16), a MAGE family antigen, GAGE-1,2, BAGE,
RAGE, LAGE-1, GnT-V, EP-CAM/KSA, CDK4, a MUC family antigen,
HER2/neu, ErbB-2/neu, p21ras, RCAS1, .alpha.-fetoprotein,
E-cadherin, .alpha.-catenin, .beta.-catenin and .gamma.-catenin,
NeuGcGM3, Fos related antigen, Cyclophilin B, RCAS1, S2, L10a,
L10a, Telomerase rt peptide, cdc27, fodrin, p120ctn, PRAME,
GA733/EoCam, NY-BR-1, NY-BR-2 NY-BR-3, NY-BR-4 NY-BR-5, NY-BR-6
NY-BR-7, NY-ESO-1, L19H1, MAZ, PINCH, PRAME, Prp1p/Zer1p, WT1,
adenomatous polyposis coli protein (APC), PHF3, LAGE-1, SART3,
SCP-1, SSX-1, SSX-2, SSX-4, TAG-72, TRAG-3, MBTAA, a Smad tumor
antigen, Imp-1, HPV-16 E7, c-erbB-2, EBV-encoded nuclear antigen
(EBNA)-1, Herpes simplex thymidine kinase (HSVtk), alternatively
spliced isoform of XAGE-1 (L552S), TGF beta RII frame shift
mutation, BAX frame shift mutation, or an immunogenic fragment
thereof.
BRIEF DESCRIPTION OF THE DRAWINGS
[0019] FIGS. 1A-1D illustrate data indicating the down-regulation
of antigen expression in melanoma. MU tumor cells in A) control
medium or D) control medium supplemented with human oncostatin M
(OSM), or in B) supernatants from EW (containing EW produced OSM)
or C) from A375 tumor cells (without OSM). Cells were stained for
cytoplasmic expression of Melan-A/MART-1 protein (A-C) or gp100 (D)
and assayed by flow cytometry. Mean channel of fluorescence is
shown within each.
[0020] FIGS. 2A-21 illustrate data indicating that interferon-beta
(IFN-.beta.) increases expression of melanocyte lineage antigens
(Melan-A/MART-1 and GP100) in melanoma cell lines 453A, A375, MU-X,
MU-89, MM96L(-), and MM96L(+). Numbers in parentheses indicate the
mean channel number. In each set, the curve to the right (stronger
fluorescence) indicates increased expression following IFN-.beta.
treatment.
[0021] FIG. 3 illustrates data indicating that interferon-beta
overcomes down-regulation of gp100 antigen by OSM. Control MU-89
(41.6) vs. MU-89 plus OSM (29.5) vs MU-89 plus IFN-beta+OSM
(63.3).
[0022] FIG. 4 illustrates data indicating that interferon-beta with
5-azacytidine (AZA) or trichostatin induces high levels of antigen
expression in constitutive low antigen-expressing cells, MU-X. MU-X
Control (12.8) vs. MU-X+Interferon-Beta 5,000 IU/mL (23.2) vs.
MU-X+5-AZA 40 uM (39.0) vs. AZA 40 uM+Interferon-Beta 5,000 IU/mL
(57.3)
[0023] FIGS. 5A and 5B illustrate the effect of A) OSM on Melanoma
Gene Expression in MU-89 cells. All shown at 0.39 ng RNA/sample
except GADPH and (3-Actin at 24.4 pg and TRP-1 at 15.6 ng; and B)
OSM on Cytotoxic T Cell Recognition of Melan-A/MART-1-expressing
targets, MU.
[0024] FIG. 6 illustrates the effect of MITF-M transfection on
endogenous expression of Melan-A/MART-1. Data shown for A375 and
MU-X tumor cells transfected with MITF-M for 24 hours in the
presence (10 .mu.M) or absence of U0126 before PCR amplification of
Melan-A/MART-1. Lane 1, MITF-M expression plasmid; 2, Empty vector
control; 3, Transfection reagents only; 4, Untransfected
control.
[0025] FIG. 7 illustrates increased killing by T lymphocytes
following IFN-.beta. treatment of melanoma cells.
[0026] FIG. 8 illustrates an exemplary reporter construct to
identify compounds having an activity of IFN-.beta.. GFP reporter
gene driven by the 1176-bp Melan-A/MART-1 promoter.
[0027] FIG. 9 illustrates augmentation of GFP fluorescence
following exposure of transfected cells to IFN-.beta..
DESCRIPTION
[0028] The invention is based at least in part on the finding that
interferon-beta (IFN-.beta.) increases expression of one or more
tumor associated antigens (TAAs). Increasing expression of a tumor
associated antigen of a cell, such as a tumor cell, increases
recognition by the immune system. Thus, treating a tumor cell or
tumor cell population with IFN-.beta., an IFN-.beta. receptor
agonist, or a compound or agent having a TAA-inducing activity as
IFN-.beta., can increase antigenicity of tumor cells, thereby
increasing recognition of tumor cells by T lymphocytes and
antibodies. Consequently, the immune system is more likely to
target the tumor cell(s) for destruction.
[0029] TAA expression on a cell can be increased with IFN-.beta.,
an IFN-.beta. receptor agonist, or a compound or agent having
similar activity as IFN-.beta. (has TAA-inducing activity).
IFN-.beta., an IFN-.beta. receptor agonist, or a compound or agent
having a TAA-inducing activity as IFN-.beta. can be combined with
one or more other compounds, agents, treatments or therapies having
an anti-tumor effect. Thus, IFN-.beta., an IFN-.beta. receptor
agonist, or a compound or agent having a TAA-inducing activity as
IFN-.beta. can be used in combination with any other anti-tumor
treatment or therapeutic protocol. For example, IFN-.beta., an
IFN-.beta. receptor agonist, or a compound or agent having a
TAA-inducing activity as IFN-.beta. can be combined with any
treatment that increases an immune response against a tumor,
thereby inhibiting tumor cell growth.
[0030] Thus, in accordance with the invention, methods of
increasing an immune response against a tumor cell are provided. In
one embodiment, a method includes administering to a subject having
a tumor an amount of IFN-.beta. receptor agonist and a tumor
associated antigen (TAA) sufficient to increase an immune response
against the tumor cell. In various aspects, an IFN-.beta. receptor
agonist comprises IFN-.beta., an IFN-.beta. mimic (e.g., variant or
modified form), or an IFN-.beta. receptor antibody. In additional
aspects, the immune response is cell-mediated or humoral. In
further aspects, TAA is adminstered as full length or antigenic
fragments, or with cells (e.g., cells that express TAA, such as
tumor cells).
[0031] As used herein, "immune response" refers to a cell mediated
or humoral (antibody mediated) response known in the art to be a
function of the immune system. Stimulating, inducing or
up-regulating an immune response means that either a cell mediated
or humoral immune response is increased or triggered. For example,
a melanoma TAA (e.g., an epitope of Melan-A/MART-1) can be
administered and a CTL (cytotoxic T-lymphocyte) response to this
antigen in a subject with metastatic melanoma elicited.
[0032] As used herein, an "IFN-.beta. receptor agonist" means a
molecule that binds to IFN-alpha/beta receptor (IFNAR), subunits
IFNAR-1 or IFNAR-2, and which elicits a response typical of
IFN-.beta.. An exemplary response includes increasing TAA
expression, i.e., a TAA inducing activity.
[0033] The invention also provides methods of increasing tumor
associated antigen expression on a cell (e.g., a tumor cell). In
one embodiment, a method includes administering to a subject having
a tumor an amount of IFN-.beta. receptor agonist and a tumor
associated antigen (TAA) sufficient to increase tumor associated
antigen expression on a tumor cell. In one aspect, an immune
enhancing agent (e.g., lymphocytes or antibody or antibody
expressing cells specific for TAA expressed by the tumor) is
adminstered prior to, substantially contemporaneously with or
following administration of IFN-.beta. receptor agonist or a tumor
associated antigen (TAA).
[0034] As used herein, the term "tumor associated antigen" or "TAA"
refers to an antigen capable of expression by a tumor cell, or on
cells of the same lineage as the tumor. The TAA in tumor may be
expressed in amounts greater than normal relative to a non-tumor
(normal) cell counterpart, or may be expressed at similar levels,
or at levels less than normal cell counterparts, particularly if
the gene encoding the TAA is down-modulated in the tumor cell.
[0035] Tumor associated antigens are antigenic molecules whose
expression facilitates interaction of immune cells or immune
molecules (e.g. antibodies) with tumor cells. TAAs are molecules or
portions of the molecules that immune targeting molecules (i.e.
receptors on immune cells and antibodies) bind. As discussed, TAAs
may be present in or on normal cells; tumor TAA expression may but
need not deviate from normal (non-tumor) counterpart cells (e.g., a
normal cell not expressing TAA, expressing less of the TAA than a
tumor cell, or expressing the same or more TAA than tumor.)
[0036] A tumor associated antigen can be expressed during an
earlier developmental or different differentiation stage of the
cell; after progressing through the developmental stage, expression
of the TAA is typically altered. For example, a melanoma
differentiation associated (mda) gene displaying enhanced or
suppressed expression during growth inhibition and differentiation,
such as MAGE and Melan-A/MART-1. As disclosed herein, TAA
expression can also be induced or increased in response to a
stimulus (e.g., IFN-.beta.). In addition, kinase inhibitors can
up-regulate TAA expression (Englaro et al. (1998). J Biol Chem
273:9966) of Melan-A/MART-1, gp100, tyrosinase, TRP-1 and TRP-2 on
melanomas and TAA expression has been reported to up-regulated of
by interferon-gamma (Gudagni et al. (1996). In Vivo 7:591). Tumor
cell expression of one or more TAA's that are atypical for the cell
is presumably due to aberrant gene regulation of the TAA.
[0037] Although not wishing to be bound by any theory,
down-regulation of TAAs is thought to contribute to tumor cell
escape from immune detection. Oncostatin M (OSM) (Durda et al.
(2003). Mol Cancer Res 1:411) and IFN-.gamma. (Le Poole et al
(2002) Am J Pathol 160:521) can down-modulate Melan-A/MART-1
expression on melanoma cells.
[0038] Specific non-limiting examples of TAAs whose expression can
be increased or induced in accordance with the invention include,
for melanoma, tumor-associated testis-specific antigen (e.g., MAGE,
BAGE, and GAGE), melanocyte differentiation antigen (e.g.,
tyrosinase, Melan-A/MART-1), a mutated or aberrantly expressed
molecule (e.g., CDK4, MUM-1, beta-catenin), gp100/pmel 17, TRP-1,
TRP-2, an MITF, MITF-A and MITF-M (King, et al. (1999). Am J Pathol
155:731). Additional specific examples of TAAs expressed by tumors
include melanoma GP75, Annexin I, Annexin II, adenosine
deaminase-binding protein (ADAbp), PGP 9.5 (Rode, et al. (1985).
Histopathology 9:147), colorectal associated antigen
(CRC)--C017-1A/GA733, Ab2 BR3E4, CI17-1A/GA733, Hsp70 (Chen, et al.
(2002). Immunol Lett 84:81), Hsp90, Hsp96, Hsp105, Hsp110, HSPPC-96
(Caudill, M. M. and Z. Li (2001). Expert Opin Biol Ther 1:539),
stress protein gp96 (a human colorectal cancer tumor rejection
antigen, Heike et al. (2000). Int J Can 86:489), gp96-associated
cellular peptides, G250, Dipeptidyl peptidase IV (DPPIV),
Mammaglobin (Tanaka, et al. (2003). Surgery 133:74), thyroglobulin,
STn (Morse, M. A. (2000). Curr Opin Mol Ther 2:453),
Carcinoembryonic Antigen (CEA), Carcinoembryonic Antigen (CEA)
epitope CAP-1, Carcinoembryonic Antigen (CEA) epitope CAP-2, etv6,
aml1, Prostate Specific Antigen (PSA), PSA epitope PSA-1, PSA
epitope PSA-2, PSA epitope PSA-3 (Correale, et al. (1998). J
Immunol 161:3186) (Roehrbom, et al. (1996). Urology 47:59),
Ad5-PSA, prostate-specific membrane antigen (PSMA), Prostatic Acid
Phosphatase (PAP), Prostate epithelium-derived Ets transcription
factor (PDEF), Parathyroid-hormone-related protein (PTH-rP), EGFR
(Plunkett, et al. (2001). J Mammary Gland Biol Neoplasia 6:467),
PLU1 (Plunkett, et al. (2001). J. Mammary Gland Biol Neoplasia
6:467), Oncofetal antigen-immature laminin receptor (OFA-iLR),
MN/CA IX (CA9) (Shimizu et al., (2003). Oncol. Rep.
September-October; 10:1307), HP59, Cytochrome oxidase 1, sp100, msa
(Devine, et al. (1991). Cancer Res 51:5826), Ran GTPase activating
protein, a Rab-GAP (Rab GTPase-activating) protein, PARIS-1 (Zhou,
et al. (2002). Biochem Biophys Res Commun 290:830), T-cell
receptor/CD3-zeta chain, cTAGE-1, SCP-1, Glycolipid antigen-GM2,
GD2 or GD3, GM3 (Bada, et al. (2002). Hum Exp Toxicol 21:263),
FucosylGM1, Glycoprotein (mucin) antigens-Tn, Sialyl-Tn (Lundin, et
al. (1999). Oncology 57:70), TF and Mucin-1 (Mukherjee, et al.
(2003). J Immunother 26:47), CA125 (MUC-16) (Reinartz, et al.
(2003). Cancer Res 63:3234), a MAGE family antigen, GAGE-1,2, BAGE,
RAGE, LAGE-1 (Eichmuller, et al. (2003). Int J Cancer 104:482)
(Chen, et al. (1998). Proc Natl Acad Sci USA 95:6919), GnT-V
(Murata, et al. (2001). Dis Colon Rectum 44:A2-A4), MUM-1
(Kawakami, et al. (1996). Keio J Med 45:100), EP-CAM/KSA (Ullenhag,
et al. (2003). Clin Cancer Res 9:2447), CDK4, a MUC family antigen,
HER2/neu, ErbB-2/neu, p21ras, RCAS1, .alpha.-fetoprotein,
E-cadherin, .alpha.-catenin, .beta.-catenin and .gamma.-catenin,
NeuGcGM3 (Carr, et al. (2003). J Clin Oncol 21:1015), Fos related
antigen (Luo, et al. (2003). Proc Natl Acad Sci USA 100:8850),
Cyclophilin B (Tamura, et al. (2001). Jpn J Cancer Res 92:762),
RCAS1, S2 (Koga, et al. (2003). Tissue Antigens 61:136), L10a
(Koga, et al. (2003). supra), L10a, Telomerase rt peptide (Wang, et
al. (2001). Oncogene 20:7699), cdc27, fodrin, p120ctn, PRAME,
GA733/EoCam (Ross, et al. (1986). Biochem Biophys Res Commun
135:297), NY-BR-1, NY-BR-2 NY-BR-3, NY-BR-4 NY-BR-5, NY-BR-6
NY-BR-7 (Jager, et al. (2001). Cancer Res 61:2055), NY-ESO-1,
L19H1, MAZ (Daheron, et al. (1998). Leukemia 12:326), PINCH
(Greiner, et al. (2000). Exp Hematol 28:1413), PRAME (Ikeda, et al.
(1997). Immunity 6:199), Prp1p/Zer1p, WT1 (Oka, et al. (2002). Curr
Cancer Drug Targets 2:45), adenomatous polyposis coli protein
(APC), PHF3, LAGE-1, SART3 (Miyagi, et al. (2001). Clin Cancer Res
7:3950), SCP-1 (Jager, et al. (2002). Cancer Immun 2:5), SSX-1,
SSX-2, SSX-4, TAG-72 (Buchsbaum, et al. (1999). Clin Cancer Res
5(10 Suppl): 3048s-3055s), TRAG-3 (Chen, et al. (2002). Lung Cancer
38:101), MBTAA (Basu, et al. (2003). Int J Cancer 105:377), a Smad
tumor antigen, lmp-1, HPV-16 E7, c-erbB-2, EBV-encoded nuclear
antigen (EBNA)-1, Herpes simplex thymidine kinase (HSVtk),
alternatively spliced isoform of XAGE-1 (L552S; Wang, (2001).
Oncogene 20:7699), TGF beta RH frame shift mutation (Saeterdal, et
al. (2001). Proc Natl Acad Sci USA 98:13255), BAX frame shift
mutation (Saeterdal, et al. (2001). Proc Natl Acad Sci USA
98:13255).
[0039] Immunogenic fragments (subsequences, including antigenic
peptides that can be targeted) of TAAs are also included. In
addition, variants and modified forms of TAA capable of eliciting,
increasing or stimulating an immune response are also included.
[0040] TAAs can be delivered by a variety of methods. For example,
when administering one or more TAAs with IFN-.beta., an IFN-.beta.
receptor agonist, or a compound or agent having a TAA-inducing
activity as IFN-.beta., the TAA can be formulated to be presented
to the immune system to stimulate an immune response towards the
TAA. Thus, a TAA or antigenic fragment, or tumor or other cell
having TAA can be adminstered in vivo. Tumor cells expressing TAA
can optionally be treated ex vivo (e.g., with IFN-.beta., an
IFN-.beta. receptor agonist, or a compound or agent having similar
activity as IFN-.beta.) and transfused into a patient during
therapy. Any agent that enhances antigen expression or antigenicity
of the tumor can be used to treat the tumor in vivo or ex vivo.
Tumor cell lysates or extracts, or irradiated or heat killed cells
that renders them incapable of growth, but still able to induce an
immune response, can also be administered.
[0041] TAAs can be delivered as peptides (Jaeger et al. (1996) Int
J Cancer 66:162; Jager et al. (2000) Proc Natl Acad Sci USA
97:12198; Marchand et al. (1999) Int J. Cancer. 80:219, or as
peptides in combination with adjuvants (Jager et al. (1996). Int J
Cancer 67:54; Rosenberg et al. (1998). Nat Med 4:321; Cormier et
al. (1997). Cancer J Sci Am. 3:37; Wang et al. (1999). Clin Cancer
Res. 5:2756).
[0042] TAAs can be delivered with other cells. For example, TAA
peptides can be loaded into dendritic cells (Chen et al. (2001)
Gene Ther 8:316; Fong et al. (2001). J Immunol 167:7150; Therner et
al. (1999). J Exp Med 190:1669; Tso et al. (2001). Cancer Res
61:7925), or loaded into other antigen presenting cells (Pardoll
(2002). Nature Rev Immunol 2:227).
[0043] Three types of DNA-based recombinant cancer vaccines have
been used to deliver TAAs: DNA encoding TAAs can be used 1) to
modify dendritic cells, 2) as `naked` DNA-vaccine or 3) to
construct recombinant viral vaccines. Recombinant vaccines and
vaccine strategies have been developed to induce and potentiate
T-cell responses of a host to TAAs. A particular example of such a
strategy is recombinant poxvirus vectors in which the
tumor-associated antigen (TAA) is inserted as a transgene.
Recombinant vaccinia vaccines and recombinant avipox
(replication-defective) vaccines have been employed to stimulate
immune response towards the TAA; the use of diversified prime and
boost strategies using different vaccines; and the insertion of
multiple T-cell co-stimulatory molecules into recombinant poxvirus
vectors, along with the TAA gene, to enhance T-cell immune response
to the TAA and enhance or induce anti-tumor immunity.
[0044] The invention further provides methods of inhibiting
silencing of a tumor associated antigen (TAA). In one embodiment, a
method includes administering to a subject with a tumor an amount
of IFN-.beta. receptor agonist sufficient to inhibit silencing of
the tumor associated antigen (TAA). In one aspect, the subject has
been administered a tumor associated antigen (TAA) prior to,
substantially contemporaneously with or following IFN-.beta.
receptor agonist administration.
[0045] As used herein, the term "silencing" refers to a
down-regulation of TAA expression in tumor cells, a mechanism by
which tumor cells reduce antigen expression to avoid immune
detection and destruction. Thus, the terms "inhibiting silencing,"
"reversing silencing," "reducing silencing," and grammatical
variations thereof, means that the down-regulation of TAAs observed
in tumor cells is decreased or overcome. That is, "inhibiting
silencing," means that TAA expression is increased or TAA
expression is at least stabilized to the extent that little if any
additional reduction in TAA expression occurs in a tumor cell.
[0046] One mechanism by which TAA silencing occurs is through
suppression or inhibition of TAA gene expression at the
transcriptional level, which may occur by what is referred to in
the art as"gene silencing," or by a mechanism in which the gene
promoter is inhibited (Kurnick et al. (2001) J Immunol 167:1204;
Durda et al. (2003) Mol Cancer Res 1:411). "Gene silencing" is
believed to occur through chromatin remodeling or proteins that
bind DNA and that directly or indirectly inhibit transcription of
the gene. Promoter based inhibition can also occur by positive or
negative influences on transcription factors required for gene
transcription. An additional mechanism by which TAA silencing
occurs is through increased TAA protein degradation or reduced TAA
protein stability. The invention includes "inhibiting," "reversing"
and "reducing" TAA silencing, regardless of the biological
mechanism.
[0047] The invention additionally provides methods of treating a
tumor. In one embodiment, a method includes administering to a
subject with a tumor an amount of IFN-.beta. receptor agonist and
tumor associated antigen (TAA) sufficient to treat the tumor. In
particular aspects, the treatment reduces tumor volume, inhibits an
increase in tumor volume, stimulates tumor cell lysis or apoptosis,
or reduces tumor metastasis. In another aspect, the subject is
treated with or administered a further anti-tumor therapy (e.g.,
surgical resection, radiotherapy, immunotherapy or chemotherapy).
In further aspects, the subject is administered an antibody or a
cell that produces an antibody that specifically binds to a tumor
associated antigen (TAA), an immune cell that interacts with a
tumor cell, or an immune-enhancing agent.
[0048] The invention moreover provides methods of treating a
subject having or at risk of having a tumor. In one embodiment, a
method includes administering to a subject an amount of IFN-.beta.
receptor agonist and tumor associated antigen (TAA) sufficient to
treat the subject. In one aspect, the subject is a candidate for,
is undergoing, or has undergone anti-tumor therapy. In an
additional aspect, the subject is administered an immune cell that
interacts with a tumor cell.
[0049] Methods of increasing effectiveness of an anti-tumor therapy
are also provided. In one embodiment, a method includes
administering to a subject that is undergoing or has undergone
tumor therapy, an amount of IFN-.beta. receptor agonist and tumor
associated antigen (TAA) sufficient to increase effectiveness of
the anti-tumor therapy.
[0050] As used herein, the term "increase effectiveness," "promote
effectiveness," or "improve effectiveness," when used in reference
to a therapy, such as an anti-tumor therapy or treatment protocol
in combination with IFN-.beta. receptor agonist alone or in
combination with tumor associated antigen (TAA), means that the
overall therapy is improved relative to the therapy without
IFN-.beta. receptor agonist or tumor associated antigen (TAA)
treatment. Thus, the detectable or measurable therapeutic benefit
to a subject, as set forth herein, is greater with IFN-.beta.
receptor agonist or tumor associated antigen (TAA) treatment, than
in the absence of IFN-.beta. receptor agonist or tumor associated
antigen (TAA) treatment.
[0051] Non-limiting examples of IFN-.beta. receptor agonists
include, for example, IFN-.beta.. Mammalian IFN-.beta. sequences
such as human (Gray and Goeddel (1982). Nature, 298:859); rat
(Yokoyama, et al., (1997). Biochem Biophys Res Commun., 232:698);
canine (Iwata, et al., (1996). J Interferon Cytokine Res., 10:765);
porcine (J Interferon Res., (1992). 12:153) are known in the art.
Another example of IFN agonist is anti-IFN anti-idotypic antibody
(Osheroff et al. (1985). J Immunol, 135:306).
[0052] Non-limiting examples of IFN-.beta. receptor antibodies
include mammalian, human, humanized or primatized forms of heavy or
light chain, V.sub.H and V.sub.L, respectively, immunoglobulin (Ig)
molecules. "Antibody" refers to any monoclonal or polyclonal
immunoglobulin molecule, such as IgM, IgG, IgA, IgE, IgD, and any
subclass thereof. The term "antibody" also includes functional
fragment of immunoglobulins, such as Fab, Fab', (Fab).sub.2, Fv,
Fd, scFv and sdFv, unless otherwise expressly stated.
[0053] The term "IFN-.beta. receptor antibody" or "TAA antibody"
means an antibody that specifically binds to IFN-.beta. receptor
and a TAA antibody, respectively. Specific binding is that which is
selective for an epitope present in IFN-.beta. receptor or a TAA.
Selective binding can be distinguished from non-selective binding
using assays known in the art (e.g., immunoprecipitation, ELISA,
Western blotting).
[0054] The term "human" when used in reference to an antibody,
means that the amino acid sequence of the antibody is fully human,
i.e., human heavy and light chain variable and constant regions.
All of the antibody amino acids are coded for in the human DNA
antibody sequences or exist in a human antibody. An antibody that
is non-human may be made fully human by substituting the non-human
amino acid residues with amino acid residues that exist in a human
antibody. Amino acid residues present in human antibodies, CDR
region maps and human antibody consensus residues are known in the
art (see, e.g., Kabat, Sequences of Proteins of Immunological
Interest, 4.sup.th Ed.US Department of Health and Human Services.
Public Health Service (1987); Chothia and Lesk (1987). J. Mol.
Biol. 186:651; Padlan (1994). Mol. Immunol. 31:169; and Padlan
(1991). Mol. Immunol. 28:489). Methods of producing human
antibodies are known in the art (see, for example, WO 02/43478 and
WO 02/092812).
[0055] The term "humanized" when used in reference to an antibody,
means that the amino acid sequence of the antibody has non-human
amino acid residues (e.g., mouse, rat, goat, rabbit, etc.) of one
or more determining regions (CDRs) that specifically bind to the
desired antigen in an acceptor human immunoglobulin molecule, and
one or more human amino acid residues in the Fv framework region
(FR), which are amino acid residues that flank the CDRs. Human
framework region residues of the immunoglobulin can be replaced
with corresponding non-human residues. Residues in the human
framework regions can therefore be substituted with a corresponding
residue from the non-human CDR donor antibody. A humanized antibody
may include residues, which are found neither in the human antibody
nor in the donor CDR or framework sequences.
[0056] Methods of producing humanized antibodies are known in the
art (see, for example, U.S. Pat. Nos. 5,225,539; 5,530,101,
5,565,332 and 5,585,089; Riechmann, et al., (1988). Nature 332:323;
EP 239,400; WO91/09967; EP 592,106; EP 519,596; Padlan (1991).
Molecular Immunol. 28:489; Studnicka et al., (1994). Protein
Engineering 7:805; and Roguska. et al., (1994). Proc. Nat'l. Acad.
Sci. USA 91:969).
[0057] Antibodies referred to as "primatized" in the art are within
the meaning of "humanized" as used herein, except that the acceptor
human immunoglobulin molecule and framework region amino acid
residues may be any primate residue, in addition to any human
residue.
[0058] The invention includes IFN-.beta. peptides and mimetics,
IFN-.beta. receptor agonist peptides and mimetics, and modified
(variant) forms, provided that the modified form retains, at least
partial activity or function of unmodified or reference peptide or
mimetic. For example, a modified IFN-.beta. peptide or mimetic will
retain at least a part of a TAA inducing activity. Modified
(variant) peptides can have one or more amino acid residues
substituted with another residue, added to the sequence or deleted
from the sequence. Specific examples include one or more amino acid
substitutions, additions or deletions (e.g., 1-3, 3-5, 5-10, 10-20,
or more). A modified (variant) peptide can have a sequence with
50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or more
identity to a reference sequence (e.g., IFN-.beta.). The crystal
structure of recombinant interferon-beta (IFN-beta) can also be
employed to predict the effect of IFN-.beta. modifications (Senda,
et al., (1992). EMBO J. 11:3193).
[0059] As used herein, the terms "mimetic" and "mimic" refer to a
synthetic chemical compound which has substantially the same
structural and/or functional characteristics as the reference
molecule. The mimetic can be entirely composed of synthetic,
non-natural amino acid analogues, or can be a chimeric molecule
including one or more natural peptide amino acids and one or more
non-natural amino acid analogs. The mimetic can also incorporate
any number of natural amino acid conservative substitutions as long
as such substitutions do not destroy activity. As with polypeptides
which are conservative variants, routine testing can be used to
determine whether a mimetic has detectable TAA inducing
activity.
[0060] Peptide mimetic compositions can contain any combination of
non-natural structural components, which are typically from three
structural groups: a) residue linkage groups other than the natural
amide bond ("peptide bond") linkages; b) non-natural residues in
place of naturally occurring amino acid residues; or c) residues
which induce secondary structural mimicry, i.e., induce or
stabilize a secondary structure, e.g., a beta turn, gamma turn,
beta sheet, alpha helix conformation, and the like. For example, a
polypeptide can be characterized as a mimetic when one or more of
the residues are joined by chemical means other than an amide bond.
Individual peptidomimetic residues can be joined by amide bonds,
non-natural and non-amide chemical bonds other chemical bonds or
coupling means including, for example, glutaraldehyde,
N-hydroxysuccinimide esters, bifunctional maleimides,
N,N'-dicyclohexylcarbodiimide (DCC) or N,N'-diisopropylcarbodiimide
(DIC). Linking groups alternative to the amide bond include, for
example, ketomethylene (e.g., --C(.dbd.O)--CH.sub.2-- for
--C(.dbd.O)--NH--), aminomethylene (CH.sub.2--NH), ethylene, olefin
(CH.dbd.CH), ether (CH.sub.2--O), thioether (CH.sub.2--S),
tetrazole (CN.sub.4--), thiazole, retroamide, thioamide, or ester
(see, e.g., Spatola (1983) in Chemistry and Biochemistry of Amino
Acids, Peptides and Proteins, Vol. 7, pp 267-357, "Peptide and
Backbone Modifications," Marcel Decker, NY).
[0061] A "conservative substitution" is the replacement of one
amino acid by a biologically, chemically or structurally similar
residue. Biologically similar means that the substitution is
compatible with biological activity, e.g., a TAA inducing activity.
Structurally similar means that the amino acids have side chains
with similar length, such as alanine, glycine and serine, or having
similar size. Chemical similarity means that the residues have the
same charge or are both hydrophilic or hydrophobic. Particular
examples include the substitution of one hydrophobic residue, such
as isoleucine, valine, leucine or methionine for another, or the
substitution of one polar residue for another, such as the
substitution of arginine for lysine, glutamic for aspartic acids,
or glutamine for asparagine, serine for threonine, and the
like.
[0062] A specific example of an IFN-.beta. variant is Betaseron, an
analogue of human beta-interferon in which serine is substituted
for cysteine at position 17. A specific example of a IFN-.beta.
mimetic is SYR6 (Sato and Sone, (2003). Biochem J., 371(Pt 2):603).
Modified IFN-.beta. sequence candidates for use in the invention
are described, for example, in U.S. Pat. Nos.
6,514,729--recombinant interferon-beta muteins; 4,793,995--modified
(1-56) beta interferons; 4,753,795--modified (80-113) beta
interferons; and 4,738,845--modified (115-145) beta
interferons.
[0063] Peptides and peptidomimetics can be produced and isolated
using any method known in the art. Peptides can be synthesized,
whole or in part, using chemical methods known in the art (see,
e.g., Caruthers (1980). Nucleic Acids Res. Symp. Ser. 215; Horn
(1980). Nucleic Acids Res. Symp. Ser. 225; and Banga, A. K.,
Therapeutic Peptides and Proteins, Formulation, Processing and
Delivery Systems (1995) Technomic Publishing Co., Lancaster, Pa.).
Peptide synthesis can be performed using various solid-phase
techniques (see, e.g., Roberge (1995) Science 269:202; Merrifield
(1997). Methods Enzymol. 289:3) and automated synthesis may be
achieved, e.g., using the ABI 431A Peptide Synthesizer (Perkin
Elmer) in accordance with the manufacturer's instructions.
[0064] Individual synthetic residues and polypeptides incorporating
mimetics can be synthesized using a variety of procedures and
methodologies known in the art (see, e.g., Organic Syntheses
Collective Volumes, Gilman, et al. (Eds) John Wiley & Sons,
Inc., NY). Peptides and peptide mimetics can also be synthesized
using combinatorial methodologies. Techniques for generating
peptide and peptidomimetic libraries are well known, and include,
for example, multipin, tea bag, and split-couple-mix techniques
(see, for example, al-Obeidi (1998). Mol. Biotechnol. 9:205; Hruby
(1997). Curr. Opin. Chem. Biol. 1:114; Ostergaard (1997). Mol.
Divers. 3:17; and Ostresh (1996). Methods Enzymol. 267:220).
Modified peptides can be further produced by chemical modification
methods (see, for example, Belousov (1997). Nucleic Acids Res.
25:3440; Frenkel (1995). Free Radic. Biol. Med. 19:373; and
Blommers (1994). Biochemistry 33:7886).
[0065] Peptides can also be synthesized and expressed as fusion
proteins with one or more additional domains linked thereto for
producing a more immunogenic peptide, or to more readily isolate a
recombinantly synthesized peptide. Domains facilitating isolation
include, for example, metal chelating peptides such as
polyhistidine tracts and histidine-tryptophan modules that allow
purification on immobilized metals; protein A domains that allow
purification on immobilized immunoglobulin; and the domain utilized
in the FLAGS extension/affinity purification system (Immunex Corp,
Seattle Wash.). The inclusion of a cleavable linker sequence such
as Factor Xa or enterokinase (Invitrogen, San Diego Calif.) between
a purification domain and the peptide can be used to facilitate
peptide purification. For example, an expression vector can include
a peptide-encoding nucleic acid sequence linked to six histidine
residues followed by a thioredoxin and an enterokinase cleavage
site (see e.g., Williams (1995). Biochemistry 34:1787; and Dobeli
(1998). Protein Expr. Purif. 12:404). The histidine residues
facilitate detection and purification of the fusion protein while
the enterokinase cleavage site provides a means for purifying the
peptide from the remainder of the fusion protein. Technology
pertaining to vectors encoding fusion proteins and application of
fusion proteins is known in the art (see e.g., Kroll (1993). DNA
Cell. Biol., 12:441).
[0066] The invention includes any metastatic or non-metastatic
tumor, cancer, malignancy or neoplasia of any cell or tissue
origin. The tumor may be in any stage, e.g., a stage I, II, III, IV
or V tumor, or in remission.
[0067] As used herein, the terms "tumor," "cancer," "malignancy,"
and "neoplasia" are used interchangeably and refer to a cell or
population of cells whose growth, proliferation or survival is
greater than growth, proliferation or survival of a normal
counterpart cell, e.g. a cell proliferative or differentiative
disorder. Such disorders can affect virtually any cell or tissue
type, e.g., carcinoma, sarcoma, melanoma, neural, and
reticuloendothelial or haematopoietic neoplastic disorders (e.g.,
myeloma, lymphoma or leukemia). A tumor can arise from a multitude
of primary tumor types, including but not limited to breast, lung,
thyroid, head and neck, brain, lymphoid, gastrointestinal (mouth,
esophagus, stomach, small intestine, colon, rectum), genito-urinary
tract (uterus, ovary, cervix, bladder, testicle, penis, prostate),
kidney, pancreas, liver, bone, muscle, skin, and metastasize to
other secondary sites.
[0068] Cells comprising a tumor may be aggregated in a cell mass or
be dispersed. A "solid tumor" refers to neoplasia or metastasis
that typically aggregates together and forms a mass. Specific
examples include visceral tumors such as melanomas, breast,
pancreatic, uterine and ovarian cancers, testicular cancer,
including seminomas, gastric or colon cancer, hepatomas, adrenal,
renal and bladder carcinomas, lung, head and neck cancers and brain
tumors/cancers.
[0069] Carcinomas refer to malignancies of epithelial or endocrine
tissue, and include respiratory system carcinomas, gastrointestinal
system carcinomas, genitourinary system carcinomas, testicular
carcinomas, breast carcinomas, prostatic carcinomas, endocrine
system carcinomas, and melanomas. Melanoma refers to malignant
tumors of melanocytes and other cells derived from pigment cell
origin that may arise in the skin, the eye (including retina), or
other regions of the body, including the cells derived from the
neural crest that also gives rise to the melanocyte lineage. A
pre-malignant form of melanoma, known as dysplastic nevus or
dysplastic nevus syndrome, is associated with melanoma
development.
[0070] Exemplary carcinomas include those forming from the uterine
cervix, lung, prostate, breast, head and neck, colon, pancreas,
testes, adrenal, kidney, esophagus, stomach, liver and ovary. The
term also includes carcinosarcomas, e.g., which include malignant
tumors composed of carcinomatous and sarcomatous tissues.
Adenocarcinoma includes a carcinoma of a glandular tissue, or in
which the tumor forms a gland like structure.
[0071] Sarcomas refer to malignant tumors of mesenchymal cell
origin. Exemplary sarcomas include for example, lymphosarcoma,
liposarcoma, osteosarcoma, chondrosarcoma, leiomyosarcoma,
rhabdomyosarcoma and fibrosarcoma.
[0072] Neural neoplasias include glioma, glioblastoma, meningioma,
neuroblastoma, retinoblastoma, astrocytoma, oligodendrocytoma
[0073] A "liquid tumor" refers to neoplasia of the
reticuloendothelial or haematopoetic system, such as a lymphoma,
myeloma and leukemia, or neoplasia that is diffuse in nature, as
they do not typically form a solid mass. Particular examples of
leukemias include acute and chronic lymphoblastic, myeolblastic and
multiple myeloma. Typically, such diseases arise from poorly
differentiated acute leukemias, e.g., erythroblastic leukemia and
acute megakaryoblastic leukemia. Specific myeloid disorders
include, but are not limited to, acute promyeloid leukemia (APML),
acute myelogenous leukemia (AML) and chronic myelogenous leukemia
(CML); lymphoid malignancies include, but are not limited to, acute
lymphoblastic leukemia (ALL), which includes B-lineage ALL and
T-lineage ALL, chronic lymphocytic leukemia (CLL), prolymphocytic
leukemia (PLL), hairy cell leukemia (HLL) and Waldenstrom's
macroglobulinemia (WM). Specific malignant lymphomas include,
non-Hodgkin lymphoma and variants, peripheral T cell lymphomas,
adult T cell leukemia/lymphoma (ATL), cutaneous T-cell lymphoma
(CTCL), large granular lymphocytic leukemia (LGF), Hodgkin's
disease and Reed-Sternberg disease.
[0074] As used herein, an "anti-tumor," "anti-cancer" or
"anti-neoplastic" treatment, therapy, activity or effect means any
compound, agent, therapy or treatment regimen or protocol that
inhibits, decreases, retards, slows, reduces or prevents tumor,
cancer or neoplastic growth, metastasis, proliferation or survival,
in vitro or in vivo. Particular non-limiting examples of anti-tumor
therapy include chemotherapy, immunotherapy, radiotherapy (ionizing
or chemical), local thermal (hyperthermia) therapy and surgical
resection. Any compound, agent, therapy or treatment regimen or
protocol having an anti-cell proliferative activity or effect can
be used in combination with an IFN-.beta. receptor agonist, or a
compound or agent having IFN-.beta. activity in accordance with the
invention.
[0075] Anti-proliferative or anti-tumor compounds, agents,
therapies or treatments can operate by biological mechanisms that
disrupt, interrupt, inhibit or delay cell cycle progression or cell
proliferation; stimulate or enhance apoptosis or cell death,
inhibit nucleic acid or protein synthesis or metabolism, inhibit
cell division, or decrease, reduce or inhibit cell survival, or
production or utilization of a necessary cell survival factor,
growth factor or signaling pathway (extracellular or
intracellular). Non-limiting examples of chemical agent classes
having anti-cell proliferative and anti-tumor activities include
alkylating agents, anti-metabolites, plant extracts, plant
alkaloids, nitrosoureas, hormones, nucleoside and nucleotide
analogues. Specific examples of drugs include cyclophosphamide,
azathioprine, cyclosporin A, prednisolone, melphalan, chlorambucil,
mechlorethamine, busulphan, methotrexate, 6-mercaptopurine,
thioguanine, 5-fluorouracil, cytosine arabinoside, AZT,
5-azacytidine (5-AZC) and 5-azacytidine related compounds such as
decitabine (5-aza-2' deoxycytidine), cytarabine,
1-beta-D-arabinofuranosyl-5-azacytosine and dihydro-5-azacytidine
(Goffin et al. (2002). Ann Oncol. 13:1699; Gaubert (2000). Eur J
Med. Chem. 35:1011), bleomycin, actinomycin D, mithramycin,
mitomycin C, carmustine, lomustine, semustine, streptozotocin,
hydroxyurea, cisplatin, mitotane, procarbazine, dacarbazine, taxol,
vinblastine, vincristine, doxorubicin and dibromomannitol.
[0076] Additional chemotherapeutic and biotherapeutic agents are
known in the art and can be employed. For example, monoclonal
antibodies that bind tumor cells or oncogene products, such as
Rituxan.RTM. and Herceptin (Trastuzumab)(anti-Her-2 neu antibody),
Bevacizumab (Avastin), Zevalin, Bexxar, Oncolym,
17-1A(Edrecolomab), 3F8 (anti-neuroblastoma antibody), MDX-CTLA4,
Campath.RTM., Mylotarg, IMC-C225 (Cetuximab), aurinstatin
conjugates of cBR96 and cAC10 (Doronina et al. (2003). Nat
Biotechnol 21:778) can be used in combination with an IFN-.beta.
receptor agonist, or a compound or agent having IFN-.beta. activity
in accordance with the invention.
[0077] Compounds or agents having similar activity as IFN-.beta. (a
TAA-inducing activity) may or may not act through IFN-.beta.
receptor. For example, TAA regulatory regions are likely to include
one or more genetic regulatory elements such that TAA expression is
responsive to other inducers and suppressor molecules (i.e., other
than IFN-.beta. or IFN-.beta. agonists). Thus, the invention may be
practiced with compounds or agents that induce or suppress
expression of a TAA via one or more genetic regulatory elements
(i.e., any cis-acting nucleic acid element that can directly or
indirectly alter expression of a TAA).
[0078] One example of such a molecule is nuclear factor of
activated T-cells (also referred to as NFAT-motif binding protein,
e.g., NFATc1, c2 c3 and c4), which is a family of transcription
factors that participate in mediating signal transduction.
Modulating (increasing or decreasing) an activity or function of an
NFAT-motif binding protein is likely to modulate TAA expression. As
used herein, the terms "activity" or "function" when used to modify
"NFAT-motif binding protein," means that NFAT-motif binding protein
is altered so as to alter TAA expression. For example, increased or
decreased binding of an NFAT binding protein to a TAA regulatory
region is one mechanism by which an NFAT-motif binding protein
could regulate TAA expression.
[0079] Thus, the invention includes methods of modulating TAA
expression, increasing an immune response against a tumor cell,
increasing effectiveness of an anti-tumor therapy, treating a
subject having or at risk of having a tumor, treating a tumor and
inhibiting silencing of a tumor associated antigen (TAA), with an
agent or compound that modulates an activity or function of an
NFAT-motif binding protein. In respective embodiments, a method
includes contacting a cell capable of expressing a TAA with a
compound that modulates an activity of an NFAT-motif binding
protein in an amount sufficient to increase expression of a tumor
associated antigen (TAA) of the cell; increase an immune response
against the tumor cell; increase effectiveness of the anti-tumor
therapy; treat the subject, treat the tumor; and inhibit silencing
of a tumor associated antigen (TAA).
[0080] Specific non-limiting examples of compounds that modulate an
activity of an NFAT-motif binding protein include a calcium flux
modulator (e.g., ionomycin or verapimil), VIVIT (Pu, et al. (2003).
Circ Res 92:725), gossypol (Baumgrass, et al. (2001). J Biol Chem
276:47914), N-substituted benzamides (Lindgren, et al. (2001). Mol
Immunol 38:267), rapamycin (Marx, et al. (1995). Circ Res 76:412),
quinazoline-2,4-diones, 1-3, and
pyrrolo[3,4-d]pyrimidine-2,4-diones, 4-8 (Michne, et al. (1995). J
Med Chem 38:2557), 1alpha,25-dihydroxyvitamin D3 (Takeuchi, et al.
(1998). J Immunol 160:209), FK506 (Rovira, et al. (2000). Curr Med
Chem 7:673), FK520 (Marx, et al. (1995). Circ Res 76:412),
cyclosporin (Rovira, et al. (2000). Curr Med Chem 7:673),
3,5-Bis(trifluoromethyl)pyrazoles (Djuric, et al. (2000). J Med
Chem 43:2975), dithiocarbamates (Martinez-Martinez, et al. (1997).
Mol Cell Biol 17:6437), Vasoactive intestinal peptide (VIP) and
pituitary adenylate cyclase-activating polypeptide (PACAP) (Ganea
and Delgado (2002). Crit. Rev Oral Biol Med 13:229),
carboxyamidotriazole (Faehling et al. (2002). Faseb J 16:1805),
morphine (Wang, et al. (2003). J Biol Chem Jul 3 [Epub ahead of
print]), C32-O-arylethyl ether derivatives of ascomycin (Armstrong,
et al. (1999). Bioorg Med Chem Lett 9:2089), Ascomycin macrolactam
derivative SDZ ASM 981 (Hultsch, et al. (1998). Arch Dermatol Res
290:501), and MCIP1 (Vega, et al. (2002). J Biol Chem
277:30401).
[0081] Additional examples of compounds that modulate an activity
of an NFAT-motif binding protein include an NFAT antisense nucleic
acid or RNAi, NFAT binding protein (e.g., an antibody; see, for
example, Lyakh et al., Mol Cell Biol. (1997). 17:2475) or dominant
negative NFAT polypeptide (see, for example, Schubert et al.
(2003). J Cell Biol 161:861; van Rooij et al. (2002). J Biol Chem
277:48617).
[0082] Antisense can be designed based on NFAT nucleic acid
sequences available in the database. Antisense includes single,
double or triple stranded polynucleotides and peptide nucleic acids
(PNAs) that bind RNA transcript or DNA. For example, a single
stranded nucleic acid can target NFAT binding protein transcript
(e.g., mRNA). Oligonucleotides derived from the transcription
initiation site of the gene, e.g., between positions -10 and +10
from the start site, are a particular one example. Triplex forming
antisense can bind to double strand DNA thereby inhibiting
transcription of the gene. The use of double stranded RNA sequences
(known as "RNAi") for inhibiting gene expression is known in the
art (see, e.g., Kennerdell et al., (1998). Cell 95:1017; Fire et
al., (1998). Nature, 391:806). Double stranded RNA sequences from
an NFAT binding protein coding region may therefore be used to
inhibit expression.
[0083] Compounds and agents having IFN-.beta. activity (including
IFN-.beta. receptor agonists) may be more or less potent than
IFN-.beta.. Thus, a compound can have significantly less (e.g., 10%
of the potency or activity) or more (e.g., 150-500%, or greater,
potency or activity) of IFN-.beta..
[0084] Compounds or agents having IFN-.beta. activity (e.g.,
increase or induce expression of a tumor associated antigen) may be
used alone or in combination with IFN-.beta., IFN-.beta. receptor
agonist, or other compounds, agents, treatment or therapies having
an anti-tumor effect or activity. For example, administering one or
more TAA's expressed by a tumor in combination with the compound or
agent having IFN-.beta. activity can increase immune response
towards a tumor that expresses or is induced to express the TAA,
thereby increasing the effectiveness of the anti-tumor therapy.
[0085] In an invention method of administering one or more TAAs
with IFN-.beta., an IFN-.beta. receptor agonist, or a compound or
agent having TAA-inducing activity as IFN-.beta., the two
components need not be administered substantially contemporaneously
with each other. In other words, a TAA may be administered to a
subject within one or more hours (e.g., 1-3, 3-6, 6-12, 12-24,
24-48, 24-72 hours), days (e.g., 1-3, 3-5, 5-7,7-10, 10-14 days,
14-30 days) or months (1-6) before or after IFN-.beta. an
IFN-.beta. receptor agonist, or a compound or agent having
TAA-inducing activity as IFN-.beta., administration. Accordingly,
one or more TAAs can be administered prior to, substantially
contemporaneous with or following administration of IFN-.beta., an
IFN-.beta. receptor agonist, or a compound or agent having similar
activity as IFN-.beta. in any order desired.
[0086] If a subject is first administered TAA (singly or multiple
times), the subject may subsequently be administered IFN-.beta., an
IFN-.beta. receptor agonist, or a compound or agent having
TAA-inducing activity as IFN-.beta., multiple times. Likewise, if a
subject is first administered IFN-.beta., an IFN-.beta. receptor
agonist, or a compound or agent having TAA-inducing activity as
IFN-.beta. singly or multiple times, the subject may be
subsequently administered TAA multiple times.
[0087] A subject may be first administered a TAA, and subsequently
administered IFN-.beta., an IFN-.beta. receptor agonist, or a
compound or agent having TAA-inducing activity as IFN-.beta..
Alternatively, a subject may be first administered IFN-.beta., an
IFN-.beta. receptor agonist, or a compound or agent having
TAA-inducing activity as IFN-.beta., and subsequently administered
a TAA. A subject may also be given multiple administrations of TAA
and IFN-.beta., an IFN-.beta. receptor agonist, or a compound or
agent having TAA-inducing activity as IFN-.beta., in any
sequence.
[0088] Any compound, agent, therapy or treatment having an
immune-stimulating or enhancing activity or effect can be used in
combination with an IFN-.beta. receptor agonist, or a compound or
agent having TAA-inducing activity as IFN-.beta., in accordance
with the invention. As used herein, the term "immune enhancing,"
when used in reference to such a compound, agent, therapy or
treatment, means that the compound provides an increase,
stimulation, induction or promotion of an immune response, humoral
or cell-mediated. Such therapies can enhance immune response
generally, or enhance immune response to the specific tumor.
Specific non-limiting examples of immune enhancing agents include
monoclonal, polyclonal antibody and mixtures thereof (e.g., that
specifically bind to a TAA).
[0089] Immune cells that interact with a tumor cell include
lymphocytes, plasma cells, B-cells expressing antibody against TAA,
NK cells, LAK cells and macrophages. Immune cells include cells
that enhance or stimulate an immune response against TAA (e.g.,
dendritic cells or antigen presenting cells) are considered "immune
enhancing". In addition, a mammalian or non-mammalian cell that
expresses an antibody (e.g., plasma cell, B-cell or a mammalian or
non-mammalian cell transfected with a nucleic acid encoding the
antibody) that specifically binds to a TAA, can be used in
accordance with the invention. An immune cell that targets a tumor
cell can be used in accordance with the invention. For example,
adoptive immunotherapy, in which tumor-infiltrating or peripheral
blood lymphocytes can be infused into a tumor patient, following
optional stimulation with a cytokine.
[0090] Immune stimulating molecules (Dredge et al. (2002) Cancer
Immunol
[0091] Immunother 51:521), such as Flt3 ligand (Disis et al. (2002)
Blood 99:2845) and cytokines (e.g., cell growth, proliferation,
chemotactic and survival factors) that enhance or stimulate
immunogenicity of TAA are considered "immune enhancing," and can be
administered prior to, substantially contemporaneously with or
following administration of IFN-.beta. receptor agonist, or a
compound or agent having TAA-inducing activity as IFN-(Nohria et
al. (1994). Biotherapy 7:261; Pardoll (1995). Annu Rev Immunol
13:399; and Ahlers et al. (1997) J Immunol 158:3947). Specific
non-limiting examples of cytokines include IL-2, IL-1.alpha.,
IL-1.beta., IL-3, IL-7, granulocyte-macrophage-colony stimulating
factor (GMCSF), IFN-.gamma., IL-12, and TNF-.alpha. (Riker et al.
(1999). Surgery 126:112; Scheibenbogen et al. (2002). Int J Cancer
98:409; Disis et al. (2002). Blood 99:2845; Schiller et al. (1990).
J Clin Invest 86:1211; Chen et al. (2001). Gene Ther 8:316; Elzey
et al. (2001). Int J Cancer 94:842). GMCSF stimulates
antigen-presenting cells and exhibits anti-tumor activity,
including against leukemia, melanoma, breast carcinoma, prostate
carcinoma and renal cell carcinoma, can be used in accordance with
the invention.
[0092] Molecules that that down-regulate the effects of TH1 immune
response inhibitors are also considered as "immune enhancing."
Specific non-limiting examples include antibodies to IL-10 or IL-10
receptor (Murray et al. (2003) Infect Dis 188:458), IL-4 and IL-5,
thereby up-regulating the TH1 immune response
[0093] Kinase inhibitors that enhance or stimulate TAA expression
include Gleevec (STI571) and inhibitors of protein kinases (e.g.
AKT inhibitor, H-89, PD98059, PD184352, U0126, HA1077, forskolin
and Y27632). Such kinase inhibitors may synergize with other
compounds (e.g., IFN-.beta. that stimulate, enhance or increase TAA
expression.
[0094] "Gene silencing inhibitors" including DNA methyl transferase
inhibitors such as 5-azacytosine and inhibitors of histone
deacetylase such as trichostatin A are considered as "immune
enhancing." IFN-.beta. may also synergize with such inhibitors.
[0095] Adjuvants refer to a class of substances which when added to
an antigen improve the immune response. Examples include compounds
which promote uptake by accessory cells (e.g. macrophages and
dendritic cells) which process antigen, such as alum (aluminum
hydroxide), incomplete Freund's adjuvant, complete Freund's
adjuvant, Ribi, Montanide ISA.TM.51, GERBU vaccine adjuvant, CAP
vaccine adjuvant, SLN (solid lipid nanoparticles), CpG DNA and
RC529 adjuvant.
[0096] The invention therefore also provides methods of treating a
tumor, methods of treating a subject having or at risk of having a
tumor, and methods of increasing effectiveness of an anti-tumor
therapy. In respective embodiments, a method includes administering
to a subject with a tumor an amount of IFN-.beta. receptor agonist
and an antibody or a cell that produces an antibody that
specifically binds to a tumor associated antigen (TAA) sufficient
to treat the tumor; administering to the subject an amount of
IFN-.beta. receptor agonist and an antibody or a cell that produces
an antibody that specifically binds to a tumor associated antigen
(TAA) sufficient to treat the subject; and administering to a
subject that is undergoing or has undergone tumor therapy, an
amount of IFN-.beta. receptor agonist and an antibody or a cell
that produces an antibody that specifically binds to a tumor
associated antigen (TAA) sufficient to increase effectiveness of
the anti-tumor therapy. In various aspects, the cell producing an
antibody that specifically binds to a tumor associated antigen
(TAA) is selected from a plasma cell, B-cell, or a mammalian or
non-mammalian cell transfected with a nucleic acid encoding the
antibody.
[0097] The invention therefore further provides methods of treating
a tumor, methods of treating a subject having or at risk of having
a tumor, and methods of increasing effectiveness of an anti-tumor
therapy. In respective embodiments, a method includes administering
to a subject with a tumor an amount of IFN-.beta. receptor agonist
and an immune cell that interacts with a tumor cell sufficient to
treat the tumor; administering to the subject an amount of
IFN-.beta. receptor agonist and an immune cell that interacts with
a tumor cell sufficient to treat the subject; and administering to
a subject that is undergoing or has undergone tumor therapy, an
amount of IFN-.beta. receptor agonist and an immune cell that
interacts with a tumor cell sufficient to increase effectiveness of
the anti-tumor therapy. In various aspects, the cell is selected
from a T cell, NK cell, LAK cell, monocyte or macrophage. In an
additional aspect, the cell has been pre-selected to bind to an
antigen (e.g., a TAA) expressed by the tumor (e.g., T lymphocytes
selected for strong avidity to TAA as presented on HLA molecules,
Dudley et al. (2002). Science 298:850; Yee et al. (2002). PNAS
99:16168).
[0098] Methods of the invention include providing a detectable or
measurable therapeutic benefit to a subject. A therapeutic benefit
is any objective or subjective transient or temporary, or longer
term improvement in the condition. Thus, a satisfactory clinical
endpoint is achieved when there is an incremental improvement in
the subjects condition or a partial reduction in the severity or
duration of one or more associated adverse symptoms or
complications or inhibition or reversal of one or more of the
physiological, biochemical or cellular manifestations or
characteristics of the disease. A therapeutic benefit or
improvement ("ameliorate" is used synonymously) therefore need not
be complete ablation of the tumor or any or all adverse symptoms or
complications associated with the tumor. For example, inhibiting an
increase in tumor cell mass (stabilization of a disease) can
increase the subjects lifespan (reduce mortality) even if only for
a few days, weeks or months, even though complete ablation of the
tumor has not resulted.
[0099] Particular examples of therapeutic benefit or improvement
include a reduction in tumor volume (size or cell mass), inhibiting
an increase in tumor volume, a slowing or inhibition of tumor
worsening or progression, stimulating tumor cell lysis or
apoptosis, reducing or inhibiting tumor metastasis, reduced
mortality, prolonging lifespan. Adverse symptoms and complications
associated with tumor, neoplasia, and cancer that can be reduced or
decreased include, for example, nausea, lack of appetite, and
lethargy. Thus, a reduction in the severity or frequency of
symptoms, an improvement in the subjects subjective feeling, such
as increased energy, appetite, psychological well being, are
examples of therapeutic benefit
[0100] The doses or "sufficient amount" for treatment to achieve a
therapeutic benefit or improvement are effective to ameliorate one,
several or all adverse symptoms or complications of the condition,
to a measurable extent, although reducing or inhibiting a
progression or worsening of the condition or an adverse symptom, is
a satisfactory outcome. The dose may be proportionally increased or
reduced as indicated by the status of the disease being treated or
the side effects of the treatment. Doses also considered sufficient
are those that result in a reduction of the use of another
therapeutic regimen or protocol. For example, an IFN-.beta.
receptor agonist and one or more TAAs is considered as having a
therapeutic effect if administration results in less
chemotherapeutic drug, radiation or immunotherapy being required
for tumor treatment.
[0101] As is typical for treatment protocols, some subjects will
exhibit greater or less response to treatment. Thus, appropriate
amounts will depend upon the condition treated (e.g., the type or
stage of the tumor), the therapeutic effect desired, as well as the
individual subject (e.g., the bioavailability within the subject,
gender, age, etc.).
[0102] Subjects appropriate for treatment include those having or
at risk of having a tumor cell, those undergoing as well as those
who are undergoing or have undergone anti-tumor therapy, including
subjects where the tumor is in remission. The invention is
therefore applicable to treating a subject who is at risk of a
tumor or a complication associated with a tumor. Prophylactic
methods are therefore included.
[0103] Subjects include those who have risk factors associated with
tumor development. For example, subjects at risk for developing
melanoma include fair skin, high numbers of naevi (dysplastic
nevus), sun exposure (ultraviolet radiation), patient phenotype,
family history, and history of a previous melanoma. Subjects at
risk for developing cancer can be identified with genetic screens
for tumor associated genes, gene deletions or gene mutations.
Subjects at risk for developing breast cancer lack Brcal, for
example. Subjects at risk for developing colon cancer have deleted
or mutated tumor suppressor genes, such as adenomatous polyposis
coli (APC), for example.
[0104] The term "subject" refers to animals, typically mammalian
animals, such as a non human primate (apes, gibbons, chimpanzees,
orangutans, macaques), a domestic animal (dogs and cats), a farm
animal (horses, cows, goats, sheep, pigs), experimental animal
(mouse, rat, rabbit, guinea pig) and humans. Subjects include
animal disease models, for example, a rodent model for testing in
vivo efficacy of IFN-.beta. receptor agonist and one or more TAAs
(e.g., a tumor animal model).
[0105] IFN- receptor agonist, compounds and agents having a
TAA-inducing activity as IFN-.beta. can be administered in a
conventional dosage form prepared by combining IFN-.beta. receptor
agonist, or a compound or agent having TAA-inducing activity as
IFN-.beta. with a conventional pharmaceutically acceptable carrier
or diluent according to known techniques. The pharmaceutically
acceptable carrier or diluent is dictated by the amount of active
ingredient with which it is to be combined, the route of
administration and other known variables.
[0106] Pharmaceutical compositions include "pharmaceutically
acceptable" and "physiologically acceptable" carriers, diluents or
excipients. As used herein, the term "pharmaceutically acceptable"
and "physiologically acceptable," when referring to carriers,
diluents or excipients includes solvents (aqueous or non-aqueous),
detergents, solutions, emulsions, dispersion media, coatings,
isotonic and absorption promoting or delaying agents, compatible
with pharmaceutical administration and with the other components of
the formulation. Such formulations can be contained in a tablet
(coated or uncoated), capsule (hard or soft), microbead, emulsion,
powder, granule, crystal, suspension, syrup or elixir.
[0107] Pharmaceutical compositions can be formulated to be
compatible with a particular route of administration. Compositions
for parenteral, intradermal, or subcutaneous administration can
include a sterile diluent, such as water, saline solution, fixed
oils, polyethylene glycols, glycerine, propylene glycol or other
synthetic solvents. The preparation may contain one or more
preservatives to prevent microorganism growth (e.g., antibacterial
agents such as benzyl alcohol or methyl parabens; antioxidants such
as ascorbic acid or sodium bisulfite; chelating agents such as
ethylenediaminetetraacetic acid; buffers such as acetates, citrates
or phosphates and agents for the adjustment of tonicity such as
sodium chloride or dextrose).
[0108] Pharmaceutical compositions for injection include sterile
aqueous solutions (where water soluble) or dispersions and sterile
powders for the extemporaneous preparation of sterile injectable
solutions or dispersion. For intravenous administration, suitable
carriers include physiological saline, bacteriostatic water,
Cremophor EL.TM. (BASF, Parsippany, N.J.) or phosphate buffered
saline (PBS). The carrier can be a solvent or dispersion medium
containing, for example, water, ethanol, polyol (e.g., glycerol,
propylene glycol, and polyetheylene glycol), and suitable mixtures
thereof. Fluidity can be maintained, for example, by the use of a
coating such as lecithin, or by the use of surfactants.
Antibacterial and antifungal agents include, for example, parabens,
chlorobutanol, phenol, ascorbic acid and thimerosal. Including an
agent that delays absorption, for example, aluminum monostearate
and gelatin can prolonged absorption of injectable
compositions.
[0109] For transmucosal or transdermal administration, penetrants
appropriate to the barrier to be permeated are used in the
formulation. Such penetrants are known in the art, and include, for
example, for transmucosal administration, detergents, bile salts,
and fusidic acid derivatives; for transdermal administration,
ointments, salves, gels, or creams.
[0110] Additional pharmaceutical formulations and delivery systems
are known in the art and are applicable in the methods of the
invention (see, e.g., Remington's Pharmaceutical Sciences (1990)
18th ed., Mack Publishing Co., Easton, Pa.; The Merck Index (1996)
12th ed., Merck Publishing Group, Whitehouse, N.J.; Pharmaceutical
Principles of Solid Dosage Forms, Technonic Publishing Co., Inc.,
Lancaster, Pa., (1993); and Poznansky, et al., Drug Delivery
Systems, R. L. Juliano, ed., Oxford, N.Y. (1980), pp. 253-315)
[0111] Methods of identifying an agent that increases expression of
a melanoma tumor associated antigen (TAA) are also provided. In one
embodiment, a method includes contacting a cell capable of
expressing a melanoma TAA with a test agent (e.g., a melanoma
cell); measuring the amount of TAA expressed in the presence of the
test agent; and determining whether the amount of TAA expressed is
greater in the presence than in the absence of the test agent,
wherein increased TAA expression identifies the test agent as an
agent that increases expression of a melanoma TAA. In one aspect,
the TAA is a differentiation antigen, e.g., Melan-A/MART-1,
tyrosinase, gp100/pmel 17, TRP-1, TRP-2 or MITF-M, or an antigenic
fragment thereof.
[0112] Kits that include one or more of IFN-.beta. and IFN-.beta.
receptor agonist, or a compound or agent having a TAA-inducing
activity as IFN-.beta. packaged into suitable packaging material,
are also provided. A kit typically includes a label or packaging
insert including a description of the components or instructions
for use in vitro, in vivo, or ex vivo, of the components therein. A
kit can contain a collection of such components, e.g., IFN-.beta.
an IFN-.beta. receptor agonist, or a compound or agent having a
TAA-inducing activity as IFN-.beta., and one or more TAAs.
[0113] In one embodiment, a kit includes IFN-.beta., an IFN-.beta.
receptor agonist, or a compound or agent having a TAA-inducing
activity as IFN-.beta., and instructions for treating (prophylaxis
or therapeutic), a tumor of a subject. In another embodiment, the
container includes one or more TAAs. In yet another embodiment, the
kit or container includes an anti-tumor agent (e.g., a drug or
antibody, such as an anti-TAA antibody).
[0114] The term "packaging material" refers to a physical structure
housing the components of the kit. The packaging material can
maintain the components sterilely, and can be made of material
commonly used for such purposes (e.g., paper, corrugated fiber,
glass, plastic, foil, ampules, etc.). The label or packaging insert
can include appropriate written instructions.
[0115] Kits of the invention therefore can additionally include
labels or instructions for using the kit components in a method of
the invention. Instructions can include instructions for practicing
any of the methods of the invention described herein including
treatment methods. Thus, for example, a kit can include IFN-.beta.
and one or more TAAs, together with instructions for administering
to a subject in a treatment method of the invention.
[0116] The instructions may be on "printed matter," e.g., on paper
or cardboard within or affixed to the kit, or on a label affixed to
the kit or packaging material, or attached to a vial or tube
containing a component of the kit. Instructions may additionally be
included on a computer readable medium, such as a disk (floppy
diskette or hard disk), optical CD such as CD- or DVD-ROM/RAM,
magnetic tape, electrical storage media such as RAM and ROM and
hybrids of these such as magnetic/optical storage media.
[0117] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention pertains.
Although methods and materials similar or equivalent to those
described herein can be used in the practice or testing of the
present invention, suitable methods and materials are described
herein.
[0118] All publications, patents and other references cited herein
are incorporated by reference in their entirety. In case of
conflict, the specification, including definitions, controls.
[0119] As used herein, the singular forms "a", "and," and "the"
include plural referents unless the context clearly indicates
otherwise. Thus, for example, reference to an "IFN-beta agonist"
includes a plurality of IFN-beta agonists and reference to "a tumor
associated antigen" includes reference to one or more tumor
associated antigens.
[0120] A number of embodiments of the invention have been
described. Nevertheless, it will be understood that various
modifications may be made without departing from the spirit and
scope of the invention. Accordingly, the following examples are
intended to illustrate but not limit the scope of invention
described in the claims.
EXAMPLES
Example I
[0121] This example describes exemplary materials, methods and
procedures.
[0122] Cell Lines: All cell lines have been previously described.
Melanoma tumor cells lines, MU, MU-X, EW, were established at the
Massachusetts General Hospital (Ramirez-Montagut, et al. (2000).
Clin. Exp. Immunol. 119:11). A375 was purchased from American Type
Culture Collection, (Manassas, Va.). IGR-39D, 453A and 136.2 were
provided by Dr. Peter Schrier, Leiden University, Leiden, The
Netherlands. MM96L was provided by Dr. P. G. Parsons, Queensland
Institute of Medical Research, Herston, Australia; (+) and (-)
varieties (i.e. high and low expressors of Melan-A/MART-1 antigen)
were derived by Dr. James Kurnick. The U937 myelomonocytic cell
line was isolated by Dr. Kenneth Nilsson, Uppsala University,
Uppsala, Sweden. U2-OS, a human osteosarcoma cell line as described
by Nelissen (Nelissen et al. (2000). Exp Hematol 28:422.).
[0123] Reagents: Antibodies against Melan-A/MART-1 (clone A103)
(Chen, et al. (1996) Proc Natl Acad Sci USA 93:5915) were purchased
from Vector Laboratories/NoivoCastra Laboratories (Burlingame,
Calif.). Anti-gp100 (clone HMB45) antibodies were obtained from Lab
Vision Corp. (Fremont, Calif.). Recombinant human oncostatin M
(rhOSM) was obtained from R&D Systems, (Minneapolis Minn.).
Chemicals and other reagents were Analytical Grade and obtained
from Sigma-Aldrich, (St. Louis, Mo.). Recombinant human
beta-interferon-1a (Avonex.RTM.) and interferon-1b (Betaseron
.RTM.) were products of Biogen (Cambridge, Mass.) and Berlex
Laboratories Inc. (Montville, N.J.), respectively.
[0124] Conditioned Medium: Conditioned medium from Melan-A/MART-1
deficient melanoma tumor cell lines was generated by culturing
cells at a starting concentration of 5.times.10.sup.5 cells/ml in
DMEM medium supplemented with between 1 and 10% FBS. Supernatants
were collected after 72 hours by centrifugation of the cell
cultures and filtration of the medium through a 0.2 micron filter
(Millipore, Bedford, Mass.). Conditioned medium containing 1% FBS
was concentrated between 10 and 20 fold by collecting the retentate
from a nominal 301d) YM membrane (Centriprep, Millipore, Bedford,
Mass.). In addition to tumor cell lines MU-X, EW and IGR39D, three
non-melanoma cell lines were also used to generate conditioned
medium under similar conditions. These human tumor cell lines were:
Daudi (B cell lymphoma); Jurkat (T cell lymphoma; MCF-7 (breast
carcinoma), which were obtained from the ATCC (American Type
Culture Collection, Bethesda, Md.).
[0125] Determination of Protein Antigen in Tumor Cells via Flow
Cytometric Analysis: To evaluate expression of cytoplasmic
Melan-A/MART-1 antigen in melanoma tumor cell lines, cells were
first fixed for 10' in 1% paraformaldehyde; the cells are pelleted
and incubated for 5' in 0.1% saponin prior to washing and addition
of monoclonal antibody specific for Melan-A/MART-1, A-103
(Ramirez-Montagut, et al., supra) for 45' at 22.degree. C.
Following two washes, the cells were stained for 30' with
FITC-conjugated goat-anti-mouse Ig antibody (DAKO, Carpenteria,
Calif.) prior to fixation in 1% paraformaldehyde and analysis by
flow cytometry (FACScan, Becton-Dickinson, Mt. View, Calif.).
Histograms of fluorescence staining were generated for comparison
of anti-Melan-A/MART-1 staining of various cell populations. Mean
channel fluorescence was calculated using the "LYSIS" software
provided by the manufacturer. Gp100 expression was determined
similarly using the HMB45 monoclonal antibody.
[0126] Cytotoxicity Assays: TIL were assayed for the ability to
lyse melanoma target cells in 4 hours via a .sup.51Cr-release
assay, as previously described (Ramirez-Montagut, et al., supra).
The melanoma target cells with high constitutive expression of
Melan-A/MART-1 were generated by low density culture
(1-2.times.10.sup.5/ml). These Melan-A/MART-1 expressing cells were
compared with respect to their susceptibility to cytolysis to the
same cells cultured for 3 to 6 days in the presence of conditioned
medium from the Melan-A/MART-1 negative variant, MU-X, to derive
target cells with low Melan-A/MART-1 expression. Low Melan-A/MART-1
expressing cells were further assayed after pulsing with
Melan-A/MART-1 peptide amino acids 27-35 (AAGIGILTV; SEQ ID NO:1);
(Zhai, et al. (1996). J. Immunol. 156:700; Stevens, et al. (1995).
J. Immunol. 154:762; Rivoltini, et al. (1995). J. Immunol.
154:2257; Kawakami, Y. and S. A. Rosenberg. (1997). Int Rev
Immunol. 14:173, by culturing these target cells at 37.degree. C.
for 2 hours in 1 ml of medium containing 5 mg of peptide prior to
labeling with .sup.51Cr for use in cytolytic assays to demonstrate
renewed susceptibility to specific T cell recognition.
[0127] In further instances, bulk and cloned TIL progeny were also
assayed against autologous tumor (MU), allogeneic melanomas, as
well as NK (K562), and LAK (Daudi), and EBV-transformed B
lymphocyte targets: EBV-3 (HLA-A1, B8, DR3), EBV-19 (HLA-A2, B18,
DR5), using the foregoing .sup.51Cr-release assay. Pulsing included
the following melanocyte lineage-derived peptides: Tyrosinase
(Rivoltini, et al., supra): MLLAVLYCL (SEQ ID NO:2) or YMNGTMSQV
(SEQ ID NO:3), MAGE-3 (Gaugler, et al. (1994). J Exp Med 179:921):
EBDPIGHLY (SEQ ID NO:4). Clones were screened for cytotoxic
activity at effector to target ratios of 50:1 and below.
[0128] PCR Analysis: Equal quantities of oligo-dT18
reverse-transcribed RNAs were subjected to RT-PCR analyses, as
previously described (Kurnick, et al. (2001) J Immunol 167:1204),
using multiple dilutions to establish conditions where initial
amounts of control mRNAs resulted in sub-saturating amounts of
products, with representative template concentrations shown.
Primers were designed from appropriate GenBank mRNA and genomic
entries and designed to be intron-spanning to prevent simultaneous
amplification of traces of genomic DNAs. Where this was not
possible RNAs were treated with RNase-free DNase I and
repurified.
[0129] Primer sequences: (Forward {sense}/reverse{anti-sense}
pairs) (SEQ ID NOs:5-22)
TABLE-US-00001 Melan-A/MART-1: CAAGATGCCAAGAGAAGATGCTCACT/
GCTTGCATTTTTCCTACACCATTCCA; .beta.-Actin: GAGATCACTGCCCTGGCACCCA/
GCTCCAACCGACTGCTGTCACCTTCAC; gp100/Pmel17:
CTGATTGGTGCAAATGCCTCCTTCT/ AGGAAGTGCTTGTTCCCTCCATCCA; tyrosinase:
CAGCCCAGCATCATTCTTCTCCTCT/ GCAGTGAGGACGGCCCCTACCA; TRP-1:
TGTTGCCCAGACCTGTCCCCT/ GCAACATTTCCTGCATGTCTTTCTCCA; TRP-2:
CCTAGTGAACAAGGAGTGCTGCCC/ CGCTGGAGATCTCTTTCCAGACACAAC; MITF-M:
TCTCTCACTGGATTGGTGCCACCT/ CATGCCTGGGCACTCGCTCTCT MITF-A:
CCAAGCCTCCGATAAGCTCCTCCA/ CATGCCTGGGCACTCGCTCTCT GAPDH:
TGAAGGTCGGAGTCAACGGATTTGGT/ CTGCAAATGAGCCCCAGCCTTCT MITF-M and
MITF-A share a common reverse primer owing to their shared mRNA 3'
regions. PCR product identities were confirmed by automated
sequencing.
Example II
[0130] This example describes expression data of
melanocyte-associated antigens and transcription factors.
[0131] Melan-A/MART-1 deficient cells, such as MU-X and EW, produce
soluble factors that down-modulate antigen expression in otherwise
constitutively positive cells (Kurnick, et al., supra);
Ramirez-Montagut, et al., supra). To determine the natural
repertoire of gene expression of related proteins in a series of
antigen-positive and deficient cell lines, four
Melan-A/MART-1-expressing melanoma cell lines, 136.2, 453A, MM96L
(an antigen-expressing variant, designated MM96L+, and an
Melan-A/MART-1 deficient variant designated MM96L-) and MU (an
antigen-expressing variant, designated MU, and an Melan-AJMART-1
deficient variant designated MU-X), and an additional five cell
lines that have weak or deficient Melan-A/MART-1 expression, MU-X,
EW, IGR-39D, MM976L- and A375, as well as the Burkitt
lymphoma-derived RAMOS cell line, were studied (Table 1). Antigen
expression of Melan-A/MART-1 (MA/M1), gp100 and tyrosinase was
assessed by cytoplasmic staining with appropriate monoclonal
antibodies. In addition, assessment of gross differences in the
relative mRNA steady-state levels for these markers between
different cell lines was made following PCR amplification.
[0132] As shown in Table 1A, below, low expression of
Melan-A/MART-1 is generally associated with low gp100 and
tyrosinase expression. Among the melanomas, only EW secretes
measurable amounts of protein (as determined in ELISA), but an
additional 5 cell lines show detectable OSM mRNA levels, albeit
weaker than EW (and non-melanoma RAMOS). Only MM96 and A375 appear
to be deficient for OSM mRNA. Tyrosinase related proteins TRP-1 and
TRP-2 parallel the expression of the other melanocyte markers.
[0133] A series of transcription factors related to melanocyte
differentiation were also examined. As shown in Table 1B, the
melanocyte-associated allele of MITF, namely MITF-M, was expressed
strongly on the Melan-A/MART-1 expressing tumors, but not on the
antigen deficient cell lines, except for A375. In contrast, the
MITF-A isoform was expressed on all but the RAMOS cell line. Sox 10
showed a pattern similar to MITF-M, although it was detectable in
MU-X as well as A375. Pax 3, brn2 and tbx2 were widely expressed
among all of the melanomas, although tbx2 was only weakly expressed
in EW.
TABLE-US-00002 TABLE 1 Antigen and Transcription Factor mRNA Levels
in Melanoma Cell Lines. TUMOR 136.2 453A MM96L MU-89 MU-X EW
IGR-39D A375 RAMOS 1A. Melanocyte Lineage Antigen Expression
(Protein and mRNA) OSM ++ + - ++ +/- ++++ ++ - ++++ MA/M1 ++++ ++++
++++ ++++ +/- +/- +/- +/-* - gp100 ++++ ++++ ++++ ++++ + + + + -
tyrosinase ++++ ++++ ++++ ++++ - - +/- +/- - TRP-1 ++++ ++++ ++++
+++ ++ - ++ ++ - TRP-2 +++ ++++ ++++ ++ +/- - - ++ - *A375 have
detectable mRNA for Melan-A/MART-1, but are relatively deficient in
cytoplasmic protein expression. 1B. Transcription Factor Expression
(mRNA) MITF-M ++++ ++++ ++++ ++++ +/- +/- +/- ++ - MITF-A ++++ ++++
++++ ++++ ++++ ++++ ++++ ++++ - BRN2 ++++ ++++ ++++ ++++ ++++ ++++
++++ ++++ - STAT3 ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ Pax3
++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ + SOX 10 ++++ ++++ ++++
++++ + - +/- ++++ - Tbx2 ++++ ++++ ++++ ++++ +++ + +++ ++++ - The
(++++) designation indicates easily detectable (relatively high
level) product formation. Where the designation of +/- is assigned,
product levels were reproducibly low, often requiring a second
round of nested PCR for unequivocal detection. (Comparison of the
relative levels between separate markers is not feasible with these
assays).
Example III
[0134] This example describes down-regulation of
melanocyte-associated antigens Melan-A/MART-1 and gp100. This
example also describes data indicating that IFN-beta up-regulates
melanocyte-associated antigens Melan-A/MART-1 and gp100.
[0135] Expression of Melan-A/MART-1 can be down-regulated by
culture with supernatants from Melan-A/MART-1-negative tumors such
as EW and A375 (Ramirez-Montagut, et al., supra). In brief, MU
tumor cells were cultured for 3 days in control medium or in 20
ng/ml of OSM (FIGS. 1A and 1D), or in supernatants from EW
(contains OSM) (FIG. 1B) or A375 tumor cells (does not contain OSM)
(FIG. 1C). Cells were stained for cytoplasmic expression of
Melan-A/MART-1 protein (FIGS. 1A-1C) or gp100 (FIG. 1D) and assayed
by flow cytometry.
[0136] The data indicate that Melanoma Antigen Silencing Activity
(MASA) produced by EW cells includes OSM and at least one
additional soluble factor, designated MASA2, that is present in EW
supernatants following removal of OSM, and is also present in A375
cells that do not produce OSM.
[0137] The loss of Melan-A/MART-1 is associated with a marked
diminution in the ability of T cells to lyse tumor cells which have
been treated with MASA-containing supernatants (Ramirez-Montagut,
et al., supra). The loss of T cell-mediated lysis can be overcome
by the addition of the Melan-A/MART-1-derived peptide, AAGIGILTV
(SEQ ID NO:1), which restores cytolytic susceptibility. Loss of
Melan-A/MART-1 is generally accompanied by diminished gp100 and
tyrosinase, as well as other melanocyte lineage proteins,
indicating that there is a "global" change in the tumor cells.
However, the down-modulation of antigen expression appears to be
somewhat selective as the HLA Class I antigen needed for
presentation of the melanoma peptide is not down-modulated
(Kurnick, et al., supra). When MASA-containing conditioned medium
was removed from the Melan-A/MART-1 expressing tumor cells, there
was renewed expression of this antigen. These antigen positive
cells are again lysed by Melan-A/MART-1-specific cytotoxic T
cells.
[0138] Oncostatin M and other melanoma cell line derived factors
can down modulate melanocyte lineage antigen expression in various
melanoma cell lines (Kurnick, et al., supra). A number of cytokines
for up and down-modulating activity of melanocyte lineage antigens
were evaluated.
[0139] Surprisingly, interferon-beta had up-modulating activity on
all melanoma cell lines, both low and high expressors of
Melan-A/MART-1 (FIG. 2). Furthermore, interferon-beta could reverse
the down modulating effect of Oncostatin M on gp 100 (FIG. 3--HMB
45 staining), and the effect of interferon-beta was augmented by
treating the cells with a DNA methylase inhibitor such as 5
azadeoxycytidine (FIG. 4--gp 100 (HMB) staining).
[0140] In sum, the foregoing data indicate that interferon-beta can
inhibit the antigen down-modulating effect of Oncostatin-M, a known
cytokine capable of mediating antigen-silencing in the melanoma
system, as well as down-modulation induced by an additional
molecule or molecules produced by melanoma cells (MASA) that
manifest antigen silencing. Interferon-beta can up-regulate
Melan-A/MART-1 antigen expression on all melanoma cell lines
studied to date regardless of the mechanism controlling antigen
expression down-modulation.
[0141] IFN-.beta. also enhances expression of MHC class I antigens
(HLA-A,B and C), and IFN-.gamma. enhances both class I and class II
MHC antigens, thus increasing production of antigen-presenting
molecules on tumor cells. Expression of new TAA and new HLA is
therefore a doubly-effective treatment for enhancing T cell
recognition of tumor cells, making it more likely that a cytotoxic
T lymphocyte (CTL) will bind and kill tumor cells treated with
IFN-.beta..
Example IV
[0142] This example describes down-regulation of
melanocyte-associated antigens MITF, tyrosinase, TRP-1 and TRP-2.
This example also describes data indicating that transfection of
MITF-M up-regulated Melan-A/MART-1 antigen expression.
[0143] Tumors with low or absent Melan-A/MART-1 are also relatively
deficient in tyrosinase and gp100; 3 of 4 low-Melan-A/MART-1
melanomas have low MITF-M, including the MU-X line derived from
Melan-A/MART-1+MU cells. The sox10 regulator of MITF-M expression
is deficient in 2 of 4 of the low-Melan-A/MART-1 melanomas, while
another melanocyte-lineage transcription factor, tbx2, was
deficient at the mRNA level only in the Melan-A/MART-1-low EW cell
line (Table 1).
[0144] OSM induces down-modulation of various melanocyte-related
genes, including Melan-A/MART-1, tyrosinase, gp100, TRP-1 and TRP-2
(FIG. 5). While OSM also down-modulates MITF-M expression, the
MITF-A isoform is not detectably responsive to OSM. Expression of
the microphthalmia gene variants is dependent on different
promoters and with different N-termini in their respective
translated proteins (Udono, et al. (2000). Biochim Biophys Acta
1491:205). The differential action can provide clues to the
promoter elements responsive to OSM; for example, only the MITF-M
isoform promoter has a perfect CRE site.
[0145] All four of the Melan-A/MART-1 deficient melanoma cell lines
studied produce strong antigen-silencing activity. This suggests a
correlation between antigen expression and the production of an
antigen-silencing factor. Melanocytes, which normally express this
antigen, must be down-regulated in order to shut off transcription
of this protein. If a tumor mutant had lost the Melan-A/MART-1
gene, or its promoter, there would be no selective advantage for
the cell to continue to produce an "antigen-silencing" factor. The
simultaneous loss of tyrosinase and gp100 suggest that any
mutations in these cells would be targeting some gene regulatory
molecules, as it would be less likely that all of these
chromosomally distinct genes would be deleted or mutated
simultaneously in several different tumor lines. Whether such a
gene is involved in differentiation of the melanocyte lineage, or
perhaps maintenance of a less mature phenotype, active production
of MASA seems to be characteristic of antigen-negative
melanomas.
[0146] To express MITF-M in cell lines expressing low levels of
Melan-A/MART-1, MITF-M coding sequence was amplified from
MITF-M-positive cells and cloned in an SV40-promoter expression
vector (pSV21ink); translation of the MITF-M insert uses optimal
Kozak initiation signals (Kozak (1999). Gene 234:187). Constructs
were transfected into low-Melan-A/MART-1 expressor melanoma (MU-X
and A375). In all studies controls comprised empty vector,
transfection reagents in the absence of added DNA, and
corresponding untransfected cells. Data shown in FIG. 6 for A375
and MU-X tumor cells transfected with MITF-M for 24 hours in the
presence (10 .mu.M) or absence of U0126 before PCR amplification of
Melan-A/MART-1.
[0147] MUX and A375 cell lines exhibited up-regulation of
endogenous Melan-A/MART-1 after transfection with the MITF-M
expression construct (FIG. 6). A MEK inhibitor (U0126) was then
added to determine whether it could synergize with ectopically
introduced MITF-M. In this regard, plasmid-encoded MITF-M gene is
not subject to the normal MITF-M transcriptional controls, since
U0126 down-modulates native MITF-M message.
[0148] U0126 addition augmented enhancement of Melan-A/MART-1
expression in both MITF-M transfected A375 and MU-X tumor cell
lines. These results indicate that controlling MITF-M expression
would also control Melan-A/MART-1 expression.
Example V
[0149] This example describes data indicating that IFN-.beta.
up-regulation of melanocyte-associated antigen expression increases
T cell killing of melanoma cells.
[0150] In brief, A375 cells were treated with 100,000 units of
IFN-.beta. for three days. The cells were subsequently labeled with
.sup.51Cr and tested as targets in a cytotoxicity assay using bulk
anti-melanoma T lymphocytes as the effector cells (Example I).
[0151] As shown in FIG. 7, up-regulation of antigen expression
induced by IFN-.beta. results in melanoma cells that can be killed
by T lymphocytes. These results demonstrate that IFN-.beta. can
increase targeting of tumor cells by the immune system.
Example VI
[0152] This example describes recombinant constructs used for
screening compounds which effect tumor-antigen expression.
[0153] To identify other compounds having the same effect as
interferon-beta, recombinant DNA constructs which contain a
sequence tag (e.g luciferase, or green fluorescent protein (GFP) or
an enzyme activity) linked to a Melan-A/MART-1 regulatory element
(e.g., promoter) can be constructed and inserted into
Melan-A/MART-1 melanoma cells (e.g., a low expressor cell line).
Transfected cell lines can then used for screening of small organic
compounds and larger compounds having biological activity, e.g.,
compounds that up-regulate expression of Melan-A/MART-1, and other
antigens.
[0154] For identification of TAA modulating agents, a reporter that
incorporates the promoter region from the Melan-A/MART-1 melanocyte
lineage differentiation antigen and tag sequence was constructed.
The exemplary construct including green fluorescent protein (GFP)
is illustrated in FIG. 8. GFP reporter systems have been previously
described (Haseloff, (1999). Methods Cell Biol 58:139; Tsien
(1998). Annu Rev Biochem 67:509; Chiesa et al. (2001). Biochem J
355:1; Belmont (2001). Trends Cell Biol 11:250).
[0155] A number of melanoma cells have been transfected with
linearized constructs expressing GFP from an extended
Melan-A/MART-1 promoter (1176 bp) and separately with a construct
expressing GFP by means of the SV40 promoter (depicted in FIG.
8).
[0156] Stable transfectants were selected by co-transfection with a
plasmid conferring resistance to Geneticin (G418). The expression
results of such constructs are shown in FIG. 9.
TABLE-US-00003 Melan-A/MART-1 promoter (SEQ ID NO: 26)
AGATCCTGCCACTGCACTCCAGCCTGGGCGACAGAGTGAGTCTCCATCTC
AGAAAAAAAAAATGTGTTTGAGCCTAGTTATAATGATTTAAAATTCATGG
TCCGACACCGCAATTACTTTTGCACCAACCTAATTGATGTCTAAGTAGGT
CATATTCTACCTGCAAAAAGAAAATTTCATCTATCCCTTTCACATAGATG
GAAACCCACTATCTCCAGTGGACAGTTAACACCAAAGGCATCACAGAGAA
CTCATGGAGCTCAGCTGAGGAGGTTTCAGGGATTTTTCTATTTCCTTTTC
TTGATTATGAGAGTCTGGGACTAGATGCTCTCCAGACCTGTGCCTAAAGA
CTCTTCAACCCTTTGAGATGGAGATGAGGGAGGGAATAGGGAACCCAGTT
TAGTTTGGATTTCAGATCCTTTTGTGGGTCATAAGCGTGATGATTGGGTT
TCCATGTTCACGTGTGAGATATGCCTCCCTCAAACCTTGTTACAATGACA
TGGGCACCTTACCTATCTGACATGAGAAAAACAAATGTGGATTTCAGATA
AACAAAAAATAACTCTTTTAGTGTATATGTCCCATAGAATATGTGGACAT
ATTTATCCTAAAAATATTGTATGGGACATAGTTGTATTAAGAAACTGTTC
ATTGTTTATCTGAAGTTCAAATTTAACTGGGCATCCTCCTCAGCTGAGCT
CCATGAGTTCTCTGTGATGCCTTTGGTGTTAACTGTCCACTGGAGATAGT
GGGTTTCCATCTATGTGAAAGGGATAGATGAAATTTTCTTTTTGCAGGTA
GAATATGACCTACTTAGACATCAATTAGGTTGGTGCAAAAGTAATTGTGG
TGTCGGACCATGAATTTTAAATCATTATAACTAGGCTCATGTCATATTTT
ATGTGACATGGCAATCCTATGGAGGAGGGACCAACATTTAAAATAAATGG
CTTCCCTAGGATAGAGCACTGGGACTGGGGAAAACAGAGGCCACAGTCAG
CTGTGACTTTTTGAAGGAAGGAATAAAGTTGGTTTCTTTCATGCCAATTT
AGCAATTACAGACGACCCCGTCAGAAATCTAAACCCGTGACTATCATGGG
ACTCAAAACCAGGAAAAAAAATAAGTCAAAACGATTAAGAGCCAGAGAAG
CAGTCTTCATACACGCGGCCAGCCA GFP coding sequence (SEQ ID NO: 27)
ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGT
CGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGG
GCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACC
ACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTA
CGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACT
TCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTC
TTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGG
CGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGG
ACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAAC
GTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAA
GATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACC
AGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCAC
TACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGA
TCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCA
TGGACGAGCTGTACAAGTAA SV40 late polyA signal (SEQ ID NO: 28)
CAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATG
CAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATT
TGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTC
ATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAG
TAAAACCTCTACAAATGTGGTA
[0157] The above sequences are the relevant functional portions of
reporter transfected into the appropriate cell lines such that GFP
can be expressed from the Melan-A/MART-1 promoter (in cells with
the right transcriptional apparatus; i.e. "high" Melan-A/MART-1
cells). An "extended" MART promoter (1176 bp) was derived from
amplification of human genomic DNA with primers corresponding to
the 5' and 3' ends of the sequence as shown. GFP sequence ("EGFP")
is from a Clontech vector. Initiation codon is underlined;
termination TAA codon at end of this segment. SV40 late poly A
signal: SV40 sequences are widely used and are known in the art. No
intronic sequences are present in the construct.
[0158] In brief, both high and low antigen expressing cells, MM96L
and A375, respectively, were transfected with the exemplary
Melan-A/MART-1-GFP recombinant reporter construct (FIG. 8). After
cloning out cells containing the construct, the effect of
interferon-p was studied.
[0159] The MM96L-Melan-A/MART-1-GFP reporter cells treated with
IFN-.beta. for 72 hours showed augmentation of GFP fluorescence
(GFP emission is shown in FIG. 9), in common with its endogenous
Melan-A/MART-1 gene. A375 reporter cells treated with IFN-.beta.
also showed augmentation of GFP fluorescence. In contrast, SV40
promoter-driven GFP exhibited no such response. This data therefore
demonstrated that the GFP reporter systems recapitulated the
regulation of native Melan-A/MART-1 gene. A reporter driven by
Melan-A/MART-1 regulatory region cellular system is therefore
useful for screening and identifying compounds, agents and drugs
that up-regulate antigen expression.
[0160] These reporter constructs can be employed in vivo. For
example, tumor cells can be propagated subcutaneously in
immunodeficient mice, and induced with IFN-.beta. in vivo. The
tumors can be injected directly with antigen-up-regulators (e.g.,
IFN-.beta., assuring that there is local drug available. Mice can
also be treated with IFN-.beta. subcutaneously following
establishment of antigen negative tumor cells (such as MU-X and
A375). By biopsying subcutaneous tumor sites at regular intervals
following IFN-.beta. therapy, a time-course for induction of
antigen will be developed. Any reversion of tumor cells to
antigen-negative status following termination of drug therapy can
also be studied. Also, since human T cells that are able to
recognize and lyse antigen positive tumors are available, tumor
biopsies stained with antibody to human CD3 can demonstrate altered
infiltrating of adoptively transferred human CTL following
antigen-induction therapy. In particular, observing the recruitment
of T cells to tumors that are expressing GFP, as opposed to those
that are GFP negative, as a demonstration of induced tumor antigen
(Melan-A/MART-1). The studies using GFP-transfected tumor cells
will parallel those for the un-transfected cells described
below.
Example VII
[0161] This example describes in vivo applications of IFN-.beta.
and tumor associated antigens (TAAs). This example also describes
exemplary assays for monitoring the effect of IFN-.beta. alone and
in combination with TAAs. IFN-.beta. is safe and well-tolerated in
ambulatory patients, thus providing an agent with relatively
well-described in vivo toxicities and tolerances. By combining
IFN-.beta. therapy with tumor-associated antigens, both enhanced
immunity and enhanced tumor antigen expression leading to more
effective tumor killing in vivo are expected. T cell immunity and
tumor antigen expression during in vivo administration, and
correlating clinical responses with the induction of T cells
specific for tumor antigens, as well as with antigen expression by
the tumors, before, during and after therapy has been instituted
will be analyzed.
[0162] Human tumor xenografts in mice will enable evaluation of the
in vivo induction of tumor (e.g., melanocyte) antigens. Both
antigen-positive and antigen-negative tumor cells can co-exist in
human tumors that have developed spontaneously over a period of
months to years. Tumor heterogeneity is not readily demonstrable in
tumor transplant models where the tumor-injected animals are
inherently short-lived, and generally the tumors are clonally
homogeneous during the course of the studies. Thus, although tumors
in animal models may not absolutely reflect tumors in humans, there
are compelling reasons to develop animal models employing low
antigen expressing xenografts. For example, prognosis for a
melanoma patient with established metastatic disease is quite poor
even with aggressive current therapies, and the use of
immunotherapies alone have shown limited success even when rather
innovative treatment regimes have been employed.
[0163] Animal treatments include combining multi-epitope tumor
(e.g., melanocyte) antigen with IFN-.beta. therapy to induce
enhanced host immunity against the tumors, or to maintain and
increase tumor antigen expression to enhance recognition of tumor
cells which might otherwise escape immune destruction. Clinical
endpoints include assessment of both host immunity and expression
of tumor antigens, achieving improved host immunity (systemic and
intra-tumoral cellular and huimoral immunity; Melan-A, MAGE-10, and
NY-ESO-1b specific CD8.sup.+ T cells--measured by tetramer method,
Melan-A, MAGE-10, and NY-ESO-1b specific activated (interferon
gamma releasing) CD8.sup.+ T cells--measured by ELISPOT; DTH to
tyrosinase leader, Melan-A, MAGE-10, and NY-ESO-1b peptide;
NY-ESO-1 reactive antibodies, etc.) or inhibition of tumor growth
or tumor destruction (measurement of tumor size) in patients with
tumors, such as melanoma; and toxicities and adverse events (as
defined by National Cancer Institute Common Toxicity Criteria (CTC)
Scale).
[0164] TAAs used are components of proteins recognized by the
autologous immune system on tumors such as melanomas. One of more
TAAs could be expressed in the tumor. Expression of tyrosinase,
Melan-A, NY-ESO-1, LAGE, and MAGE-10 in tumor tissue can be tested
by reverse transcription-polymerase chain reaction (RT-PCR)
analysis or immunohistochemistry. As all study peptides are
presented by HLA-A2, patients expressing HLA-A2 are treatment
candidates.
[0165] Enhanced immunity to the antigen Melan-A has been observed
when Montanide ISA.TM.51 is used as an adjuvant with Melan-A
peptide. The addition of Montanide ISA.TM.51 to TAAs given with or
without IFN-.beta. is likely to lead to enhanced immunological and
clinically beneficial effects in melanoma patients.
[0166] Exemplary TAAs, formulations and routes of administration
are as follows:
Tyrosinase leader: HLA-A2 binding peptide encoded by tyrosinase
gene; sequence [0167] MLLAVLYCL (SEQ ID NO:2); position 1-9 [0168]
Formulation: 333 .mu.g/mL tyrosinase leader in 100% DMSO [0169]
Intended dose: 100 .mu.g [0170] Vial size: 1-mL vial with 0.45 mL
peptide solution [0171] Route of administration: intradermal [0172]
Source: LICR Melan-A ELA: Analog of HLA-A2 binding peptide encoded
by Melan-A gene; sequence [0173] ELAGIGILTV (SEQ ID NO:23);
position 26-35 (E27L) [0174] Formulation: 333 .mu.g/mL peptide in
30% DMSO in phosphate buffered saline [0175] Intended dose: 100
.mu.g [0176] Vial size: 1-mL vial with 0.45 mL peptide solution
[0177] Route of administration: intradermal [0178] Source: LICR
MAGE-10.A: HLA-A2 binding peptide encoded by MAGE gene; sequence
[0179] GLYDGMEHL (SEQ ID NO:24); position 254-262 [0180]
Formulation: lyophilized powder [0181] Intended dose: 300 .mu.g
[0182] Vial size: 1-mL vial with 400 .mu.g peptide [0183] Route of
administration: intradermal [0184] Source: LICR NY-ESO-1b: HLA-A2
binding peptide encoded by NY-ESO-1 gene; sequence [0185] SLLMWITQC
(SEQ ID NO:25); position 157-165 [0186] Formulation: 2 mg/mL
NY-ESO-1b in 100% DMSO [0187] Intended dose: 100 .mu.g [0188] Vial
size: 1-mL vial with 0.3 mL peptide solution [0189] Route of
administration: intradermal [0190] Source: LICR
Montanide ISA-51
[0190] [0191] Formulation: montanide oleate (Montanide 80) in
mineral oil solution (Drakeol 6VR) [0192] Intended dose: 1.0 mL
[0193] Vial size: 3 mL [0194] Route of administration: subcutaneous
[0195] Source: SEPPIC, Paris, France
Interferon .beta.
[0195] [0196] Rebif.RTM. 22 ug (6.times.10.sup.6 IU)/vial Serono,
Rockland, Mass.
[0197] Exemplary patient inclusion criteria include one or more of
the following, for example, confirmation of metastatic melanoma;
HLA-A2 positive; Relapsed Stage 1V melanoma with lesions that are
resectable or accessible to biopsy; at least 4 weeks since surgery
before initiating protocol; at least 4 weeks since the last
chemotherapy, biologic therapy, or immunotherapy; no concurrent
biologic therapy or immunotherapy; performance status >70
(Karnofsky Scale); and life expectancy .gtoreq.4 months.
[0198] Exemplary laboratory values of candidate patients can be
within the following limits:
TABLE-US-00004 Hemoglobin .gtoreq.9.0 g/dL .gtoreq.10.0 g/dL (if
<50 kg) Neutrophil count .gtoreq.1.5 .times. 10.sup.9/L
Lymphocyte count .gtoreq.0.5 .times. 10.sup.9/L Platelet count
.gtoreq.100 .times. 10.sup.9/L Serum creatinine .ltoreq.1.8 mg/dL
Serum bilirubin .ltoreq.2 mg/dL
[0199] Optional exemplary patient exclusion criteria include one or
more of the following, for example, clinically significant heart
disease (NYHA Class III or IV); serious illnesses, eg, serious
infections requiring antibiotics, bleeding disorders; prior bone
marrow or stem cell transplant; history of immunodeficiency disease
or autoimmune disease; metastatic disease to the central nervous
system, unless treated and stable; HIV positive; chemotherapy,
radiation therapy, or immunotherapy within 4 weeks before study
entry (6 weeks for nitrosoureas); concomitant treatment with
steroids, antihistaminic drugs, or nonsteroidal anti-inflammatory
drugs (unless used in low doses for prevention of an acute
cardiovascular event or for pain control)--topical or inhalational
steroids are permitted; participation in another clinical trial
within 4 weeks prior to enrollment; pregnancy or lactation; women
of childbearing potential not using a medically acceptable means of
contraception; unavailability of the patient for immunological and
clinical follow-up assessment.
[0200] For melanoma, an exemplary protocol employs one or more of
four TAA peptides (melanoma peptide vaccine) comprising a
tyrosinase leader, Melan-A ELA, MAGE-10.A2 and NY-ESO-1b.
Peptide(s) will be administered by subcutaneous injection every 3
weeks for six vaccinations. Peptides will be mixed together with
Montanide ISA-51 and given at separate injection sites. In
addition, patients will be randomized to receive or not to receive
IFN-.beta. by subcutaneous injection, 3 times weekly (M, W F) (6
million units per injection of IFN-.beta.) for each of the three
weeks between the vaccine boosts, beginning at week 7 (i.e. with
the third vaccine injection). This protocol will allow for primary
and early secondary immune responses to be initiated prior to
introducing an agent that is unlikely to alter effector phase
immune responses, but might alter the cytokine repertoire during
initial vaccine induction of anti-tumor immunity. Waiting for an
early immune response to develop minimizes the time for
IFN-resistant tumors to be selected before the immune response has
been sufficiently enhanced to destroy tumors having up-regulated
antigen expression.
[0201] Patients can be monitored for toxicity after each vaccine
and IFN-.beta. injection. Systemic immunity can be assayed using
blood samples to be obtained at baseline and at specified time
points, for the assessment of peptide-specific antibodies by ELISA,
as well as peptide-specific CD8.sup.+ T cells by tetramer analysis
and ELISPOT. Peptide-specific delayed-type hypersensitivity (DTH)
skin reaction will be measured at baseline and after the third and
sixth set of peptide injections. If DTH reactions occur at other
time points, they will be measured. Tissue samples from one
metastatic lesion will be obtained at baseline and at least one
time after two cycles of interferon .beta. treatment for evaluation
of antigen expression. Additional tests for peptide-specific
cellular and humoral immunity will be done two weeks after the
sixth set of peptide injections. Clinical hematology and
biochemistry measurements will be taken at baseline, and as
specified in the protocol schema. Disease status will be assessed
at baseline and two weeks after the sixth set of peptide
injections.
[0202] Whenever accessible tumor deposits are available, and can be
biopsied, or excised with minimal risk to the patients being
treated, both intra-tumor immunity and histology and antigen
expression on tumor cells will be investigated. 3 types of tests
will be performed whenever sufficient tissue is available to allow
for the following assays:
[0203] Histology and antigen expression on tumor cells: Routine
histology will be performed to evaluate tumor necrosis and the
status of infiltrating lymphocytes. Frozen sections of tumor tissue
will also be stained for expression of the antigens to determine
both intensity and heterogeneity in antigen expression,
particularly with respect to any regressing or progressing lesions.
In addition to evaluation of tumor and host immune responses, image
analysis of tumor antigen expression and micro-dissection specimens
for amplification of mRNA for quantitative PCR analysis on tumors
before and after therapy will be conducted.
[0204] Image Analysis: In order to evaluate enhanced MHC and
melanocyte antigen expression, biopsies will be stained with
antibodies to HLA Class I and II antigens, as there should be an
increase in MHC expression if the tumor cells are responsive to
IFN-.beta.. In parallel, the tissues will be stained with
antibodies to the tumor-associated antigens (Melan-A, Tyrosinase,
N.Y.-ESO and MAGE-10). Both immunoperoxidase staining and
FITC-fluorescent-tagged antibody staining will be performed to
acquire quantitative data on the levels of antigen expression in
the tissue as a whole, and tumor cells individually.
[0205] Molecular Analysis of single tumor cells present in biopsies
post therapy: In addition to conventional histological techniques,
using laser capture micro-dissection technology, individual tumor
cells will be evaluated for expression of a larger series of
melanocyte associated antigens and transcription factors to
determine not only which of the vaccine antigens are expressed, but
also to determine if there is more consistent expression of
additional melanocyte lineage antigens that is more amenable to
targeting in subsequent treatments. Inclusion of the following
genes (Table 2) will allow evaluation of improved immunotherapy
protocols should additional antigens prove to be more amenable to
homogeneous expression either with or without additional induction
by IFN-.beta.. In addition to the choice of genes encoding the
vaccine antigens and HLA-A2, selection of the panel genes is made
on the basis of their relevance to the melanocytic lineage, known
role in controlling melanocytic gene expression, relevance to the
IFN-.beta. response, and as control markers.
[0206] At the single cell level correlations between levels of
mRNAs expressed from antigen genes and those expressed from chosen
transcription factor genes during the course of the treatment can
be evaluated. MITF-M is strongly associated with the control of
expression of a number of melanocytic antigens including tyrosinase
and Melan-A/MART-1. SOX10 is one transcription factor in turn
regulating MITF-M, and which is not expressed in some of the low
antigen-expressing cell lines. Type I interferons (including
IFN-.alpha. and IFN-.beta.) use a common receptor composed of two
subunits. Examining expression of other antigen genes in addition
to those included in the vaccine preparation will be performed as
expression of melanocytic antigens is regulated coordinately. Up-
or down-regulation of Melan-A/MART-1, for example, is often
correlated with a corresponding change in TRP-1, TRP-2, and gp100
expression.
[0207] Evaluation of biopsy material from treated patients to
determine which antigens are still expressed, and which are
enhanced by IFN-.beta. will to help evaluate tumor heterogeneity,
and more importantly, homogeneity of antigen expression that can be
utilized for identification of targets that will make immunotherapy
a more successful approach.
TABLE-US-00005 TABLE 2 Exemplary genes to be evaluated for
expression in tumor cells. Gene Classification Gene Name Antigens
in vaccine Melan-A, tyrosinase, MAGE1-A2, NY-ESO-1b HLA HLA-A2
Other Melanoma-Associated Antigens TRP1, TRP2, gp100 (pmel 17)
Melanoma Associated Transcription MITF-M, SOX10 Factors IFN-Type I
Receptor IFNAR-1, IFNAR-2 Other Markers MITF-A, .beta.-Actin
[0208] TaqMan chemistry and appropriate instrumentation allows
rigorous quantitative PCR analysis of mRNA levels of desired
molecular targets, and has been applied towards single-cell
analyses. To obtain information regarding expression of a panel of
markers, some of which may be at low copy number per individual
cell, an amplification step from each single-cell mRNA source will
be performed, where it is critical that such a step faithfully
preserves the relative abundance of each species within the mRNA
transcriptome. With single or low numbers of cells, T7 RNA
polymerase-mediated amplification via the generation of
complementary RNA transcripts (cRNAs) (Eberwine. (1996).
Biotechniques, 20: 584; Luo, et al., (1999). Nat Med, 5:117; and
Abe, et al., (2003). J Hum Genet, 48:142) can generate long in
vitro transcripts (Riechmann, et al., (1990). Virology, 177:710;
Puurand, et al., Virus Res, 40:135, 1996; and Shi, et al., (2002).
J Virol, 76:5847), well in excess of the MITF mRNAs. Following T7
polymerase-mediated amplification, the resulting cRNAs are
reverse-transcribed with random hexamers for subsequent TaqMan
Q-PCR analysis.
[0209] The "housekeeping" genes commonly used for normalization
purposes in a variety of expression-based studies .beta.-actin,
GAPDH) have been noted as problematic for tissue-based and
single-cell studies. Thus, a presynthesized internal spiked
standard in the assays, in the form of a surrogate non-mammalian
mRNA (luciferase) generated by in vitro transcription, will be
added. This is achieved by cloning luciferase coding sequence into
Promega Corp. vector pSP64polyA, and preparing polyA+ run-off in
vitro transcripts with SP6 polymerase. The plasmid template is
digested with RNase-free DNAse, the RNA transcripts purified by
three cycles of ammonium acetate precipitation, quantitated
spectrophotometrically and gel tested for full-length integrity. If
necessary, full-length species will be purified by excision of the
correct gel band and extraction from agarose. A quantity equivalent
to 100 copies of polyA+ luciferase RNA will be added to each cell
lysate prior to initial reverse-transcription, second-strand cDNA
synthesis and subsequent T7 polymerase amplification of cRNA. In
consequence, detection of the internal introduced standard (with
its own specific primer/probe TaqMan system) will have identical
enzymatic requirements as for the cellular mRNAs themselves. Levels
of each target gene in the above panel will then be expressed as
ratios to the levels of the introduced standard. .beta.-actin (high
abundance mRNA) and MITF-A (moderate to low abundance mRNA) is
included in the gene panel for single-cell analysis (Table 2) as
widely-expressed controls for confirming that the endogenous mRNAs
themselves from each cellular isolate are intact. Normalization
will more accurately use the introduced surrogate mRNA
standard.
[0210] In addition to analyzing immunity represented in the
circulating lymphocytes in the blood, intra-tumoral lymphocytes
with tetramers will be stained to determine the frequency of
peptide-specific CD8+ T cells present within the tumor tissue.
Furthermore, by culturing small tumor fragments in the presence of
Interleukin-2, large numbers of in vivo-activated
tumor-infiltrating lymphocytes can be further studied for cytotoxic
activity against tumor targets (Hishii, et al., (1997). Proc. Natl.
Acad Sci (USA), 94:1378; Ramirez-Montagut, et al., (2000). 119:11;
Kradin, et al., (1989). Lancet, 1:577; Hishii, et al., (1999). Clin
Exp Immunol, 116:388; and Pandolfi, et al., (1991). Cancer Res.,
51:3164) from the same patient when available, and from HLA-A2
matched cell lines if autologous tumor target is unavailable.
Functional assessment of cytotoxic activity will complement the
tetramer assays, which will give an indication of the frequency of
T-cell receptor positive cells with specificity for the tumor
vaccine antigens. These studies will indicate whether TAAs
administered with IFN-.beta., increase local tumor immunity for
successful tumor immunotherapy.
[0211] Although it is anticipated that there will be a measure of
tumor antigen heterogeneity in tumor biopsies, both antigen
positive and antigen-deficient tumor cells can show enhanced tumor
antigen expression following treatment with IFN-.beta.. Evaluating
the ability of tumor to up-regulate both melanocyte lineage
antigens and HLA antigens will reveal whether individual tumor
deposits contain IFN-responsive tumor cells. In the event tumor
cells show no antigen induction, the possibility of lost
IFN-receptors, or lost IFN-response elements would be expected to
limit the efficacy of antigen-up-regulation therapy.
[0212] The combined therapy (e.g, IFN-beta and TAAs) will enhance
clinical responses in tumor (e.g., melanoma) patients via enhanced
antigen expression, improved cell-mediated immunity and destruction
of tumor cells with antigen expression. To the extent that tumor
remains after therapy, evaluation of tumor antigen expression and
host immune response in situ will allow refinements in the
treatment protocol. For example, if there is loss of TAA expression
that is present in the vaccine, but retention of other TAAs on the
tumor cells, a follow-up administration could be performed using
different TAAs to which T cells can be targeted. Also, if TAAs not
represented in the original vaccine are up-regulated with
IFN-.beta., future administrations can include such TAAs responsive
to up-regulation.
[0213] Tissue Processing and Analysis: For tissue sample
processing, laser capture microdissection (LCM) has emerged as a
revolutionary technique for genetic analysis, combining precise
microscopy with molecular expression profiling at the single cell
level (Emmert-Buck, et al., (1996). Science, 274:921; Schutze and
Lahr, (1998). Nat Biotechnol, 16:737; Sgroi, et al., (1999). Cancer
Res, 59:5656; Miura, et al., (2002). Cancer Res, 62:3244; De
Preter, et al., (2003). Cancer Lett, 197:53; and Fend and Raffeld,
(2000). J Clin Pathol, 53:666). The same processing scheme towards
single-cell analysis of archived samples of primary resected tumor
samples from each of the patients in the study will be applied.
Preserved paraffin-embedded materials can be used as sources of
such material by means of laser-capture microdissection.
[0214] For each patient biopsy sample LCM 20 single cell isolates
with morphological characteristics of melanoma tumor cells will be
obtained. Subsequently, with the procedure described above,
quantitative fluorogenic PCR with the TaqMan chemistry as described
(Xiang, et al., (2001). Immunol Cell Biol, 79:472) will be
performed using triplicate determinations in each case. To improve
the screening rate and for reasons of economy, the 384-well plate
format now available with the TaqMan instrumentation will be
employed. Primers and probes will be designed with PrimerExpress
software, with the primers positioned such that they span large
introns if possible (this is feasible in all cases). In any case,
owing to the cRNA amplification step, it is unlikely that the
minimal amount of genomic DNA contributed by the original target
cell will be a confounding factor for expression analysis.
Preliminary studies will define optimal probe concentrations for
each primer/probe combination. Also, preliminary work will be
performed to determine the assay sensitivity achievable with the
cRNA amplification under the conditions. In practical terms, this
means the amount of total reverse-transcribed cRNA needed for
accurate Q-PCR. Since >1000-fold amplification with the T7 RNA
polymerase is readily achievable in even a single round (Eberwine,
(1996), supra), limitations from the amounts of amplified target
cRNA is unlikely.
[0215] Mouse Models Murine tumor models, developed in an
immunodeficient mouse, will provide a system to develop or evaluate
assays for monitoring the human clinical trial as well as testing
the efficacy of IFN-.beta. to up-regulate antigen expression in
vivo. This work will afford an opportunity for comparison of the
responses in both human clinical trial and the in vivo mouse
model.
[0216] Human tumor cell lines will be propagated in culture and
implanted into rag 2-deficient (rag-2.sup.-/-) mice. When
rag2.sup.-/- mice are challenged with 1.times.10.sup.6 melanoma
cells, palpable tumors are apparent within 2 weeks and these tumors
reach an approximate area of 200 mm.sup.2 within 4 weeks. In brief,
rag.sup.-/- mice will be injected in the s.c space with
1.times.10.sup.6 melanoma cells. When tumors reach a size of 100
mm.sup.2, mice will be randomly assigned to groups of 5 for
treatment. "Control" animals will be treated with an injection of
compound diluent. `Protocol` animals will be treated with compounds
using escalating doses reflective of previous reports (Clemons, et
al., (2002). Pancreas, 25:251) (serum levels of IFN-.beta. will be
monitored by ELISA). Treatments will be continued every other day
for one week. Every other day for 7 days, mice will be sacraficed
and tumors excised and evaluated. Each tumor will be dissociated
using collagenase and dispase solutions. The resulting single cell
suspension will be used for flow cytometric or PCR analysis of
antigen expression as with in vitro cultured cells. Each set of
studies will be repeated twice.
[0217] High and low antigen expressing tumor cells, MU and MU-X,
cultured in individual mice will be subjected to fine needle
biopsies to provide cells for single cell PCR and
immunohistochemical experimentation. Expression of mRNA for the
genes listed in Table 2 will be evaluated by the same single-cell
Q-PCR procedure as described above.
[0218] Immunodeficient mouse models will be used to evaluate the
ability of antigen-enhancing agents to up-regulate tumor antigen
expression in vivo. Multiple antigen induction observed in human
melanoma cells in vitro will be evaluated in vivo. Bio-availability
of IFN-.beta. in animal tumor models, using doses of antigen
up-regulatory agents that will be sub-lethal to the mouse, will be
determined. Both MU and MU-X tumor cells can be grown in
immunodeficient mice in subcutaneous sites (Fukumura, et al.,
(1995). Cancer Res, 55:4824). These studies will allow refinements
to human clinical trial described above, as regards
immunohistochemistry and single cell rtPCR evaluation of antigen
expression.
[0219] A typical dosing efficacy protocol is described below for
comparing the response of antigen positive (MU) and antigen
negative (MU-X) tumor cells. In each case tumors will be stained
with antibodies to Melan-A/MART-1 (A103), gp100/pme117 (HMB45) and
HLA Class I antigen (W6/32). In addition, RNA will be extracted for
PCR assessment of induction of mRNA for these and other melanocyte
lineage antigens.
[0220] 120 animals total per study:
[0221] 15 animals receiving only MU-X tumor and injected with
saline only on day 0. Tumor will be excised daily from 5 animals
for in vitro assay of antigen expression at days 1, 3 and 7. [0222]
45 animals receiving MU-X tumor followed by intravenous injection
of IFN-.beta. on day 0 at 3 dosage levels (10, 100, and 1000 IU/g
animal weight). Tumor will be excised from 5 animals in each dosage
group for in vitro assay of antigen expression at days 1, 3 and
7.
[0223] 15 animals receiving only MU tumor and injected with saline
only on day 0. Tumor will be excised daily from 5 animals for in
vitro assay of antigen expression at days days 1, 3 and 7. [0224]
45 animals receiving MU tumor followed by intralesional injection
of human IFN-.beta. on day 0 at 3 dosage levels (10, 100, and 1000
IU/g animal weight). Tumor will be excised from 5 animals in each
dosage group for in vitro assay of antigen expression at days 1, 3
and 7.
Sequence CWU 1
1
3019PRTHomo sapiensmisc_featureMelan-A/MART-1 peptide amino acids
1Ala Ala Gly Ile Gly Ile Leu Thr Val1 529PRTHomo
sapiensmisc_featureHLA-A2 binding peptide encoded by tyrosinase
gene 2Met Leu Leu Ala Val Leu Tyr Cys Leu1 539PRTHomo
sapiensmisc_featureTyrosinase derived peptide 3Tyr Met Asn Gly Thr
Met Ser Gln Val1 549PRTHomo sapiensmisc_featureMAGE-3 derived
peptide 4Glu Asx Asp Pro Ile Gly His Leu Tyr1 5526DNAHomo
sapiensmisc_featureForward sense primer 5caagatgcca agagaagatg
ctcact 26626DNAHomo sapiensmisc_featureReverse anti-sense primer
6gcttgcattt ttcctacacc attcca 26722DNAHomo
sapiensmisc_featureForward sense primer 7gagatcactg ccctggcacc ca
22827DNAHomo sapiensmisc_featureReverse anti-sense primer
8gctccaaccg actgctgtca ccttcac 27925DNAHomo
sapiensmisc_featureForward sense primer 9ctgattggtg caaatgcctc
cttct 251025DNAHomo sapiensmisc_featureReverse anti-sense primer
10aggaagtgct tgttccctcc atcca 251125DNAHomo
sapiensmisc_featureForward sense primer 11cagcccagca tcattcttct
cctct 251222DNAHomo sapiensmisc_featureReverse anti-sense
12gcagtgagga cggcccctac ca 221321DNAHomo sapiensmisc_featureForward
sense primer 13tgttgcccag acctgtcccc t 211427DNAHomo
sapiensmisc_featureReverse anti-sense primer 14gcaacatttc
ctgcatgtct ttctcca 271524DNAHomo sapiensmisc_featureForward sense
primer 15cctagtgaac aaggagtgct gccc 241627DNAHomo
sapiensmisc_featureReverse anti-sense primer 16cgctggagat
ctctttccag acacaac 271724DNAHomo sapiensmisc_featureForward sense
primer 17tctctcactg gattggtgcc acct 241822DNAHomo
sapiensmisc_featureReverse anti-sense primer 18catgcctggg
cactcgctct ct 221924DNAHomo sapiensmisc_featureForward sense primer
19ccaagcctcc gataagctcc tcca 242022DNAHomo
sapiensmisc_featureReverse anti-sense primer 20catgcctggg
cactcgctct ct 222126DNAHomo sapiensmisc_featureForward sense primer
21tgaaggtcgg agtcaacgga tttggt 262223DNAHomo
sapiensmisc_featureReverse anti-sense primer 22ctgcaaatga
gccccagcct tct 232310PRTArtificial SequenceHomo sapiens peptide
23Glu Leu Ala Gly Ile Gly Ile Leu Thr Val1 5 10249PRTArtificial
SequenceHomo sapiens peptide 24Gly Leu Tyr Asp Gly Met Glu His Leu1
5259PRTArtificial SequenceHomo sapiens peptide 25Ser Leu Leu Met
Trp Ile Thr Gln Cys1 5261175DNAHomo
sapiensmisc_featureMelan-A/MART-1 promoter 26agatcctgcc actgcactcc
agcctgggcg acagagtgag tctccatctc agaaaaaaaa 60aatgtgtttg agcctagtta
taatgattta aaattcatgg tccgacaccg caattacttt 120tgcaccaacc
taattgatgt ctaagtaggt catattctac ctgcaaaaag aaaatttcat
180ctatcccttt cacatagatg gaaacccact atctccagtg gacagttaac
accaaaggca 240tcacagagaa ctcatggagc tcagctgagg aggtttcagg
gatttttcta tttccttttc 300ttgattatga gagtctggga ctagatgctc
tccagacctg tgcctaaaga ctcttcaacc 360ctttgagatg gagatgaggg
agggaatagg gaacccagtt tagtttggat ttcagatcct 420tttgtgggtc
ataagcgtga tgattgggtt tccatgttca cgtgtgagat atgcctccct
480caaaccttgt tacaatgaca tgggcacctt acctatctga catgagaaaa
acaaatgtgg 540atttcagata aacaaaaaat aactctttta gtgtatatgt
cccatagaat atgtggacat 600atttatccta aaaatattgt atgggacata
gttgtattaa gaaactgttc attgtttatc 660tgaagttcaa atttaactgg
gcatcctcct cagctgagct ccatgagttc tctgtgatgc 720ctttggtgtt
aactgtccac tggagatagt gggtttccat ctatgtgaaa gggatagatg
780aaattttctt tttgcaggta gaatatgacc tacttagaca tcaattaggt
tggtgcaaaa 840gtaattgtgg tgtcggacca tgaattttaa atcattataa
ctaggctcat gtcatatttt 900atgtgacatg gcaatcctat ggaggaggga
ccaacattta aaataaatgg cttccctagg 960atagagcact gggactgggg
aaaacagagg ccacagtcag ctgtgacttt ttgaaggaag 1020gaataaagtt
ggtttctttc atgccaattt agcaattaca gacgaccccg tcagaaatct
1080aaacccgtga ctatcatggg actcaaaacc aggaaaaaaa ataagtcaaa
acgattaaga 1140gccagagaag cagtcttcat acacgcggcc agcca
117527720DNAArtificial SequenceGreen Fluorescent Protein derived
from Aequorea victoria 27atggtgagca agggcgagga gctgttcacc
ggggtggtgc ccatcctggt cgagctggac 60ggcgacgtaa acggccacaa gttcagcgtg
tccggcgagg gcgagggcga tgccacctac 120ggcaagctga ccctgaagtt
catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180ctcgtgacca
ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag
240cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg
caccatcttc 300ttcaaggacg acggcaacta caagacccgc gccgaggtga
agttcgaggg cgacaccctg 360gtgaaccgca tcgagctgaa gggcatcgac
ttcaaggagg acggcaacat cctggggcac 420aagctggagt acaactacaa
cagccacaac gtctatatca tggccgacaa gcagaagaac 480ggcatcaagg
tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc
540gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc
cgacaaccac 600tacctgagca cccagtccgc cctgagcaaa gaccccaacg
agaagcgcga tcacatggtc 660ctgctggagt tcgtgaccgc cgccgggatc
actctcggca tggacgagct gtacaagtaa 72028222DNASimian virus
40misc_featureSV40 late polyA signal 28cagacatgat aagatacatt
gatgagtttg gacaaaccac aactagaatg cagtgaaaaa 60aatgctttat ttgtgaaatt
tgtgatgcta ttgctttatt tgtaaccatt ataagctgca 120ataaacaagt
taacaacaac aattgcattc attttatgtt tcaggttcag ggggaggtgt
180gggaggtttt ttaaagcaag taaaacctct acaaatgtgg ta 22229166PRTHomo
sapiensmisc_featurebeta-interferon-1a 29Met Ser Tyr Asn Leu Leu Gly
Phe Leu Gln Arg Ser Ser Asn Phe Gln1 5 10 15Cys Gln Lys Leu Leu Trp
Gln Leu Asn Gly Arg Leu Glu Tyr Cys Leu 20 25 30Lys Asp Arg Met Asn
Phe Asp Ile Pro Glu Glu Ile Lys Gln Leu Gln 35 40 45Gln Phe Gln Lys
Glu Asp Ala Ala Leu Thr Ile Tyr Glu Met Leu Gln 50 55 60Asn Ile Phe
Ala Ile Phe Arg Gln Asp Ser Ser Ser Thr Gly Trp Asn65 70 75 80Glu
Thr Ile Val Glu Asn Leu Leu Ala Asn Val Tyr His Gln Ile Asn 85 90
95His Leu Lys Thr Val Leu Glu Glu Lys Leu Glu Lys Glu Asp Phe Thr
100 105 110Arg Gly Lys Leu Met Ser Ser Leu His Leu Lys Arg Tyr Tyr
Gly Arg 115 120 125Ile Leu His Tyr Leu Lys Ala Lys Glu Tyr Ser His
Cys Ala Trp Thr 130 135 140Ile Val Arg Val Glu Ile Leu Arg Asn Phe
Tyr Phe Ile Asn Arg Leu145 150 155 160Thr Gly Tyr Leu Arg Asn
16530165PRTArtificial Sequencebeta-interferon-1b 30Ser Tyr Asn Leu
Leu Gly Phe Leu Gln Arg Ser Ser Asn Phe Gln Ser1 5 10 15Gln Lys Leu
Leu Trp Gln Leu Asn Gly Arg Leu Glu Tyr Cys Leu Lys 20 25 30Asp Arg
Met Asn Phe Asp Ile Pro Glu Glu Ile Lys Gln Leu Gln Gln 35 40 45Phe
Gln Lys Glu Asp Ala Ala Leu Thr Ile Tyr Glu Met Leu Gln Asn 50 55
60Ile Phe Ala Ile Phe Arg Gln Asp Ser Ser Ser Thr Gly Trp Asn Glu65
70 75 80Thr Ile Val Glu Asn Leu Leu Ala Asn Val Tyr His Gln Ile Asn
His 85 90 95Leu Lys Thr Val Leu Glu Glu Lys Leu Glu Lys Glu Asp Phe
Thr Arg 100 105 110Gly Lys Leu Met Ser Ser Leu His Leu Lys Arg Tyr
Tyr Gly Arg Ile 115 120 125Leu His Tyr Leu Lys Ala Lys Glu Tyr Ser
His Cys Ala Trp Thr Ile 130 135 140Val Arg Val Glu Ile Leu Arg Asn
Phe Tyr Phe Ile Asn Arg Leu Thr145 150 155 160Gly Tyr Leu Arg Asn
165
* * * * *