U.S. patent application number 11/916276 was filed with the patent office on 2012-07-26 for targeting cells with altered microrna expression.
This patent application is currently assigned to VIMAR S.P.A.. Invention is credited to Michael Zenon Michael.
Application Number | 20120190730 11/916276 |
Document ID | / |
Family ID | 36928649 |
Filed Date | 2012-07-26 |
United States Patent
Application |
20120190730 |
Kind Code |
A1 |
Michael; Michael Zenon |
July 26, 2012 |
TARGETING CELLS WITH ALTERED MICRORNA EXPRESSION
Abstract
The present invention relates to a method of modulating
development of a cell. The method includes the step of introducing
into the cell a nucleic acid with the capacity to modulate
development of the cell, the nucleic acid including a target site
for binding of a microRNA, wherein the activity and/or
concentration of the microRNA in the cell results in a level of
activity and/or concentration of the nucleic acid in the cell
sufficient to modulate development of the cell.
Inventors: |
Michael; Michael Zenon;
(Belair, ZA) |
Assignee: |
VIMAR S.P.A.
MAROSTICA
IT
|
Family ID: |
36928649 |
Appl. No.: |
11/916276 |
Filed: |
June 2, 2006 |
PCT Filed: |
June 2, 2006 |
PCT NO: |
PCT/AU06/00750 |
371 Date: |
October 2, 2008 |
Current U.S.
Class: |
514/44R ;
435/320.1; 435/366; 435/375; 536/23.1; 536/23.2; 536/23.5;
536/23.72 |
Current CPC
Class: |
A61P 31/18 20180101;
A61P 35/02 20180101; H04B 3/548 20130101; H04B 3/56 20130101; A61P
31/22 20180101; A61P 1/00 20180101; A61P 31/14 20180101; H04B
2203/547 20130101; A61P 35/00 20180101; A61P 29/00 20180101 |
Class at
Publication: |
514/44.R ;
435/375; 435/366; 536/23.1; 536/23.72; 536/23.2; 536/23.5;
435/320.1 |
International
Class: |
A61K 31/7088 20060101
A61K031/7088; C12N 5/09 20100101 C12N005/09; C12N 5/0735 20100101
C12N005/0735; C12N 5/0793 20100101 C12N005/0793; C12N 5/076
20100101 C12N005/076; C12N 15/11 20060101 C12N015/11; C12N 15/33
20060101 C12N015/33; C12N 15/38 20060101 C12N015/38; C12N 15/54
20060101 C12N015/54; C12N 15/53 20060101 C12N015/53; C12N 15/57
20060101 C12N015/57; C12N 15/19 20060101 C12N015/19; C12N 15/63
20060101 C12N015/63; A61P 35/00 20060101 A61P035/00; A61P 35/02
20060101 A61P035/02; A61P 31/18 20060101 A61P031/18; A61P 31/14
20060101 A61P031/14; A61P 31/22 20060101 A61P031/22; A61P 29/00
20060101 A61P029/00; A61P 1/00 20060101 A61P001/00; C12N 5/071
20100101 C12N005/071 |
Foreign Application Data
Date |
Code |
Application Number |
Jul 1, 2005 |
IT |
MI2005A001248 |
Claims
1. A method of modulating development of a cell, the method
including the step of introducing into the cell a nucleic acid with
the capacity to modulate development of the cell, the nucleic acid
including a target site for binding of a microRNA, wherein the
activity and/or concentration of the microRNA in the cell results
in a level of activity and/or concentration of the nucleic acid in
the cell sufficient to modulate development of the cell.
2. A method according to claim 1, wherein the nucleic acid has the
capacity to inhibit development of the cell.
3. A method according to claim 2, wherein the nucleic acid has
cytotoxic or cytostatic activity.
4. A method according to claim 3, wherein the nucleic acid encodes
a gene selected from the group consisting of herpes simplex
thymidine kinase, E. coli cytosine deaminase, E. coli
nitroreductase, P. aeruginosa carboxypeptidase, horseradish
peroxidase, and E. coli purine nucleoside phosphorylase, or an
active fragment or variant of any of these genes.
5. A method according to any one of claims 1 to 4, wherein the cell
is selected from the group consisting of a cancerous cell, a
pre-cancerous cell, an embryonic stem cell, an adult stem cell, a
haemopoietic cell including a haemopoietic precursor cell, an
adipocyte, a neuronal cell, a sperm cell or a sperm producing cell,
a pancreatic islet cell, and a virally infected cell.
6. A method according to claim 5, wherein the cancerous cell is a
colorectal cancer cell, a lung cancer cell, a thymus cancer cell, a
bladder cancer cell, a breast cancer cell, a prostate cancer cell
or a cancerous B cell.
7. A method according to any one of claims 2 to 7, wherein the
method is used to inhibit development of a cell with a reduced
activity and/or concentration of the microRNA.
8. A method according to claim 7, wherein the method is used to
ablate the cell.
9. A method according to claim 8, wherein the microRNA is selected
from the group consisting of hsa-let-7a-1, hsa-let-7a-2,
hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7f, hsa-miR-10b,
hsa-miR-15a, hsa-miR-15b, hsa-miR-16, hsa-miR-19b mature miRNA,
hsa-miR-20, hsa-miR-21, hsa-miR-22, hsa-miR-23a, hsa-miR-24,
hsa-miR-189, hsa-miR-24, hsa-miR-26, hsa-miR-26b, hsa-miR-26a,
hsa-miR-27b, hsa-miR-29a, hsa-miR-30a-3p, hsa-miR-141,
hsa-miR-142-5p, hsa-miR-142-3p, hsa-miR-143, hsa-miR-145,
hsa-miR-192, hsa-miR-194, hsa-miR-199b, hsa-miR-200b, hsa-miR-200c,
hsa-miR-320, hsa-miR-321, hsa-miR-30a-3p, hsa-miR-30a-5p,
hsa-miR-29b, hsa-miR-125b, hsa-miR-125a, hsa-miR-125b,
hsa-miR-126*, hsa-miR-126, hsa-miR-188, hsa-miR-331,
hsa-miR-181b-1, hsa-miR-155, hsa-miR-124a, hsa-miR-9 and the
corresponding orthologues of the aforementioned microRNAs.
10. A method according to claim 1, wherein the nucleic acid has the
capacity to promote development of the cell.
11. A method according to claim 2, wherein the nucleic acid is a
nucleic acid encoding a cytokine, a therapeutic protein, or an
active fragment or variant of the aforementioned.
12. A method according to claims 10 or 11, wherein the method is
used to promote development of a cell with a reduced activity
and/or concentration of a microRNA.
13. A method according to any one of claims 1 to 12, wherein the
nucleic acid includes two or more target sites for binding of the
same or different microRNAs.
14. A method according to any one of claims 1 to 13, wherein the
cell is a cell in an animal or human subject.
15. A method according to any one of claims 1 to 14, wherein the
method is used to prevent and/or treat a disease, condition or
state in an animal or human subject.
16. A nucleic acid with the capacity to modulate development of a
cell, the nucleic acid including a binding site for a microRNA.
17. A nucleic acid according to claim 16, wherein the nucleic acid
has the capacity to inhibit development of a cell.
18. A nucleic acid according to claim 17, wherein the nucleic acid
has cytotoxic or cytostatic activity.
19. A nucleic acid according to claim 18, wherein the nucleic acid
encodes a gene selected from the group consisting of herpes simplex
thymidine kinase, E. coli cytosine deaminase, E. coli
nitroreductase, P. aeruginosa carboxypeptidase, horseradish
peroxidase, and E. coli purine nucleoside phosphorylase, or an
active fragment or variant of any of these genes.
20. A nucleic acid according to any one of claims 16 to 19, wherein
the binding site is a binding site for a microRNA selected from the
group consisting of hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3,
hsa-let-7b, hsa-let-7c, hsa-let-7f, hsa-miR-10b, hsa-miR-15a,
hsa-miR-15b, hsa-miR-16, hsa-miR-19b mature miRNA, hsa-miR-20,
hsa-miR-21, hsa-miR-22, hsa-miR-23a, hsa-miR-24, hsa-miR-189,
hsa-miR-24, hsa-miR-26, hsa-miR-26b, hsa-miR-26a, hsa-miR-27b,
hsa-miR-29a, hsa-miR-30a-3p, hsa-miR-141, hsa-miR-142-5p,
hsa-miR-142-3p, hsa-miR-143, hsa-miR-145, hsa-miR-192, hsa-miR-194,
hsa-miR-199b, hsa-miR-200b, hsa-miR-200c, hsa-miR-320, hsa-miR-321,
hsa-miR-30a-3p, hsa-miR-30a-5p, hsa-miR-29b, hsa-miR-125b,
hsa-miR-125a, hsa-miR-125b, hsa-miR-126*, hsa-miR-126, hsa-miR-188,
hsa-miR-331, hsa-miR-181b-1, hsa-miR-155, hsa-miR-124a, hsa-miR-9
and the corresponding orthologues of the aforementioned
microRNAs.
21. A nucleic acid according to any one of claims 16 to 20, wherein
the nucleic acid includes two or more binding sites for binding of
the same or different microRNAs.
22. A nucleic acid according to claim 16, wherein the nucleic acid
has the capacity to promote development of the cell.
23. A nucleic acid according to claim 22, wherein the nucleic acid
is a nucleic acid encoding a cytokine, a therapeutic protein, or an
active fragment or variant of the aforementioned.
24. A nucleic acid according to any one of claims 16 to 23, wherein
the binding site is a binding for a microRNA that is differentially
expressed and/or differentially active.
25. A vector including the nucleic acid according to any one of
claims 16 to 24.
26. A vector according to claim 25, wherein the vector is a viral
vector.
27. A composition for administration to an animal or human subject,
the composition including a nucleic acid according to any one of
claims 16 to 26.
28. A cell including a nucleic acid according to any one of claims
16 to 26.
29. An animal including a cell according to claim 28.
30. A nucleic acid according to any one of claims 16 to 26, wherein
the nucleic acid is used to inhibit the development of a cell in an
animal or human subject.
31. A nucleic acid according to claim 30, wherein the nucleic acid
is used to ablate cells in an animal or human subject.
32. A nucleic acid including a non-naturally occurring binding site
for a microRNA that is differentially expressed and/or has
differential activity.
33. A nucleic acid according to claim 32, wherein the binding site
is a binding site for a microRNA that is differentially expressed
and/or differentially active in a cancerous cell as compared to a
similar non-cancerous cell.
34. A nucleic acid according to claim 32 or 33, wherein the binding
site is a binding site for a microRNA that is downregulated in the
cancerous cell as compared to the non-cancerous cell.
35. A nucleic acid according to any one of claims 32 to 34, wherein
the binding site is a binding site for a microRNA selected from the
group consisting of hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3,
hsa-let-7b, hsa-let-7c, hsa-let-7f, hsa-miR-10b, hsa-miR-15a,
hsa-miR-15b, hsa-miR-16, hsa-miR-19b mature miRNA, hsa-miR-20,
hsa-miR-21, hsa-miR-22, hsa-miR-23a, hsa-miR-24, hsa-miR-189,
hsa-miR-24, hsa-miR-26, hsa-miR-26b, hsa-miR-26a, hsa-miR-27b,
hsa-miR-29a, hsa-miR-30a-3p, hsa-miR-141, hsa-miR-142-5p,
hsa-miR-142-3p, hsa-miR-143, hsa-miR-145, hsa-miR-192, hsa-miR-194,
hsa-miR-199b, hsa-miR-200b, hsa-miR-200c, hsa-miR-320, hsa-miR-321,
hsa-miR-30a-3p, hsa-miR-30a-5p, hsa-miR-29b, hsa-miR-125b,
hsa-miR-125a, hsa-miR-125b, hsa-miR-126*, hsa-miR-126, hsa-miR-188,
hsa-miR-331, hsa-miR-181b-1, hsa-miR-155, hsa-miR-124a, hsa-miR-9
and the corresponding orthologues of the aforementioned
microRNAs.
36. A nucleic acid according to any one of claims 32 to 35, wherein
the nucleic acid includes two or more binding sites for binding of
the same or different microRNAs that are differentially expressed
and/or differentially active.
37. A nucleic acid according to any one of claims 32 to 36, wherein
the nucleic acid has the capacity to inhibit development of a
cell.
38. A nucleic acid according to claim 37, wherein the nucleic acid
has cytotoxic or cytostatic activity.
39. A nucleic acid according to claim 37 or 38, wherein the nucleic
acid encodes a gene selected from the group consisting of herpes
simplex thymidine kinase, E. coli cytosine deaminase, E. coli
nitroreductase, P. aeruginosa carboxypeptidase, horseradish
peroxidase, and E. coli purine nucleoside phosphorylase, or an
active fragment or variant of any of these genes.
40. A nucleic acid according to claim 32, wherein the nucleic acid
has the capacity to promote development of the cell.
41. A nucleic acid according to claim 40, wherein the nucleic acid
is a nucleic acid encoding a cytokine, a therapeutic protein, or an
active fragment or variant of the aforementioned.
42. A vector including the nucleic acid according to any one of
claims 32 to 41.
43. A vector according to claim 42, wherein the vector is a viral
vector.
44. A composition for administration to an animal or human subject,
the composition including a nucleic acid according to any one of
claims 32 to 43.
45. A cell including a nucleic acid according to any one of claims
32 to 43.
46. An animal including a cell according to claim 45.
47. A nucleic acid according to any one of claims 32 to 43, wherein
the nucleic acid is used to modulate the development of cells in an
animal or human subject.
48. A nucleic acid according to claim 47, wherein the nucleic acid
is used to inhibit the development of cells in an animal or human
subject.
49. A nucleic acid according to claim 47, wherein the nucleic acid
is used to ablate cells in an animal or human subject.
50. A cancerous cell including an exogenous nucleic acid including
a binding site for a microRNA, wherein the cancerous cell has a
reduced activity and/or concentration of the microRNA as compared
to a similar non-cancerous cell.
51. A cancerous cell according to claim 50, wherein the cancerous
cell is a colorectal cancer cell, a lung cancer cell, a thymus
cancer cell, a bladder cancer cell, a breast cancer cell, a
prostate cancer cell or a cancerous B cell.
52. A cancerous cell according to claim 50 or 51, wherein the
microRNA is selected from the group consisting of hsa-let-7a-1,
hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7f,
hsa-miR-10b, hsa-miR-15a, hsa-miR-15b, hsa-miR-16, hsa-miR-19b
mature miRNA, hsa-miR-20, hsa-miR-21, hsa-miR-22, hsa-miR-23a,
hsa-miR-24, hsa-miR-189, hsa-miR-24, hsa-miR-26, hsa-miR-26b,
hsa-miR-26a, hsa-miR-27b, hsa-miR-29a, hsa-miR-30a-3p, hsa-miR-141,
hsa-miR-142-5p, hsa-miR-142-3p, hsa-miR-143, hsa-miR-145,
hsa-miR-192, hsa-miR-194, hsa-miR-199b, hsa-miR-200b, hsa-miR-200c,
hsa-miR-320, hsa-miR-321, hsa-miR-30a-3p, hsa-miR-30a-5p,
hsa-miR-29b, hsa-miR-125b, hsa-miR-125a, hsa-miR-125b,
hsa-miR-126*, hsa-miR-126, hsa-miR-188, hsa-miR-331,
hsa-miR-181b-1, hsa-miR-155, hsa-miR-124a, hsa-miR-9 and the
corresponding orthologues of the aforementioned microRNAs.
53. A cancerous cell according to any one of claims 50 to 52,
wherein the exogenous nucleic acid includes two or more binding
sites for binding of the same or different microRNAs that are
differentially expressed and/or differentially active in the
cancerous cell.
54. A cancerous cell according to any one of claims 50 to 53,
wherein the exogenous nucleic acid has the capacity to inhibit
development of the cell.
55. A cancerous cell according to claim 54, wherein the nucleic
acid has cytotoxic or cytostatic activity.
56. A cancerous cell according to claim 55, wherein the exogenous
nucleic acid encodes a gene selected from the group consisting of
herpes simplex thymidine kinase, E. coli cytosine deaminase, E.
coli nitroreductase, P. aeruginosa carboxypeptidase, horseradish
peroxidase, and E. coli purine nucleoside phosphorylase, or an
active fragment or variant of any of these genes.
57. An animal including a cancerous cell according to any one of
claims 50 to 56.
58. An animal according to claim 57, wherein the animal is a
transgenic animal.
59. An animal according to claim 57 or 58, wherein the animal is
used to identify microRNAs that are differentially expressed
between cancerous and non-cancerous cells.
60. A method of preventing and/or treating a disease, condition or
state associated with target cells in a subject, the method
including the step of introducing into cells in the subject a
nucleic acid with the capacity to modulate development of a cell,
the nucleic acid including a target site for binding of the
microRNA, wherein the activity of the microRNA in the target cells
results in a level of activity of the nucleic acid sufficient to
modulate development of the target cells in the subject.
61. A method according to claim 60, wherein the disease, condition
or state is selected from the group consisting of a cancer,
including colorectal cancer, lung cancer, thymus cancer, bladder
cancer, breast cancer and prostate cancer; human B cell chronic
lymphocytic leukemia; B cell (Burkitt) Lymphoma; a disease or
disorder of pancreatic endocrine cells including diabetes; a
disease or condition associated with viral infection of cells
including EBV, HIV, Hepatitis and Herpes infection of cells;
5q-myelodysplastic syndrome (macrocytic anaemia); a disease or
conditions associated with haemopoietic dysfunction, an autoimmune
and inflammatory diseases including Crohn's disease; fragile X
mental retardation; Di George syndrome; Wilms tumour; a disease or
condition associated with neuron dysfunction; a disease or
condition associated with adipocyte dysfunction; a disease that can
be treated with embryonic or adult stem cells; and a disease or
condition associated with sperm producing cells.
62. A method according to claim 61, wherein the disease is a
cancer.
63. A method according to claim 62, wherein the target cell is a
cancerous cell or a pre-cancerous cell.
64. A method according to claim 63, wherein the cancerous cell or
pre-cancerous is a colorectal cancer cell, a lung cancer cell, a
thymus cancer cell, a bladder cancer cell, a breast cancer cell, a
prostate cancer cell or a cancerous B cell.
65. A method according to any one of claims 60 to 64, wherein the
nucleic acid has the capacity to inhibit development of the
cell.
66. A method according to claim 65, wherein the nucleic acid has
cytotoxic or cytostatic activity.
67. A method according to claim 66, wherein the nucleic acid
encodes a gene selected from the group consisting of herpes simplex
thymidine kinase, E. coli cytosine deaminase, E. coli
nitroreductase, P. aeruginosa carboxypeptidase, horseradish
peroxidase, and E. coli purine nucleoside phosphorylase, or an
active fragment or variant of any of these genes.
68. A method according to any one of claims 60 to 67, wherein the
target cells have a reduced activity and/or expression of the
microRNA.
69. A method according to any one of claims 60 to 68, wherein the
method is used to ablate the target cells in the subject.
70. A method according to any one of claims 60 to 69, wherein the
microRNA is selected from the group consisting of hsa-let-7a-1,
hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7f,
hsa-miR-10b, hsa-miR-15a, hsa-miR-15b, hsa-miR-16, hsa-miR-19b
mature miRNA, hsa-miR-20, hsa-miR-21, hsa-miR-22, hsa-miR-23a,
hsa-miR-24, hsa-miR-189, hsa-miR-24, hsa-miR-26, hsa-miR-26b,
hsa-miR-26a, hsa-miR-27b, hsa-miR-29a, hsa-miR-30a-3p, hsa-miR-141,
hsa-miR-142-5p, hsa-miR-142-3p, hsa-miR-143, hsa-miR-145,
hsa-miR-192, hsa-miR-194, hsa-miR-199b, hsa-miR-200b, hsa-miR-200c,
hsa-miR-320, hsa-miR-321, hsa-miR-30a-3p, hsa-miR-30a-5p,
hsa-miR-29b, hsa-miR-125b, hsa-miR-125a, hsa-miR-125b,
hsa-miR-126*, hsa-miR-126, hsa-miR-188, hsa-miR-331,
hsa-miR-181b-1, hsa-miR-155, hsa-miR-124a, hsa-miR-9 and the
corresponding orthologues of the aforementioned microRNAs.
71. A method according to claim 60, wherein the nucleic acid has
the capacity to promote development of the cell.
72. A method according to claim 71, wherein the nucleic acid is a
nucleic acid encoding a cytokine, a therapeutic protein, or an
active fragment or variant of the aforementioned.
73. A method according to claim 71 or 72, wherein the method is
used for the promotion of development a cell with a reduced
activity and/or concentration of a microRNA.
74. A method of inhibiting development of a cell, the cell having a
reduced activity and/or concentration of a microRNA, the method
including the step of introducing into the cell a nucleic acid with
the capacity to inhibit development of the cell, the nucleic acid
including a target site for binding of the microRNA, wherein the
reduced activity and/or concentration of the microRNA in the cell
results in a level of activity and/or concentration of the nucleic
acid in the cell sufficient to inhibit development of the cell.
75. A method of promoting development of a cell, the cell having a
reduced activity and/or concentration of a microRNA, the method
including the step of introducing into the cell a nucleic acid with
the capacity to promote development of the cell, the nucleic acid
including a target site for binding of the microRNA, wherein the
reduced activity and/or concentration of the microRNA in the cell
results in a level of activity and/or concentration of the nucleic
acid in the cell sufficient to promote development of the cell.
76. A method of detecting altered microRNA activity and/or
concentration in a cancerous or pre-cancerous cell, the method
including the steps of: determining the level of expression of a
reporter nucleic acid in the cancerous or pre-cancerous cells and
determining the level of expression of a reporter nucleic acid in
non-cancerous cells; and detecting a reduced activity of the
microRNA in the cancerous cells by an increase in the expression of
the reporter nucleic acid in the cancerous cells as compared to the
level of expression of the reporter nucleic acid in the
non-cancerous cells.
77. A method of modulating the concentration of a nucleic acid
expressed in a cancerous cell, the cancerous cell having an altered
activity and/or concentration of a microRNA as compared to a
similar non-cancerous cell, the method including the step of
introducing a target site for binding of the microRNA into the
nucleic acid to be expressed in the cell.
Description
RELATED APPLICATIONS
[0001] This application claims priority to International Patent
Application No. PCT/AU2006/000750, International Filing Date Jun.
2, 2006, entitled Targeting Cells with Altered MicroRNA Expression;
and claims priority to U.S. Provisional Application Ser. No.
60/687,547 filed Jun. 3, 2005, both of which are hereby
incorporated by reference.
FIELD OF THE INVENTION
[0002] The present invention relates to a method of modulating the
development of a cell with altered microRNA activity, and to a
method of preventing and/or treating a disease, condition or state
associated with altered microRNA activity.
[0003] The present invention also relates to nucleic acids having a
binding site for a microRNA, cells and animals including such
nucleic acids, and compositions including the nucleic acids.
BACKGROUND OF THE INVENTION
[0004] Targeted gene expression is one of the most difficult and
important goals in the development of effective therapies for a
variety of disorders, including cell proliferative disorders such
as cancer. The ultimate aim of such therapies is the provision of
controlled, sustained, and site-specific expression of a
therapeutic agent such that surrounding healthy tissue remains
relatively unaffected by the effects of the therapeutic agent.
[0005] However, one major limitation of current gene therapy
protocols has been the inability to control expression of the
therapeutic gene, and in particular, the inability to restrict
expression of the delivered gene to the desired tissue or type of
cell. In this regard, although tissue specific promoters may be
adequate to achieve specific expression of an agent in some target
tissues, for diseases such as cancer they have proved to be of less
value as non-diseased cells may also express from the promoter.
Accordingly, there is a need to identify new methods of targeting
expression of therapeutic nucleic acids.
[0006] Recently, short 20-22 nucleotide RNA molecules known as
microRNAs (miRNAs) have been identified as regulating gene
expression in variety of eukaryotic systems. In Caenorhabditis
elegans, miRNAs coordinate the transitions between stages of larval
development by regulating the translation of heterochromic genes. A
specific miRNA in Arabidopsis has been shown to direct the cleavage
of transcripts encoding several putative transcription factors. The
Drosophila bantam gene encodes a miRNA that regulates cell
proliferation and the proapoptotic gene hid. More recently, human
miR143 has been shown to regulate adipocyte differentiation.
[0007] miRNAs are formed from larger transcripts that fold to
produce hairpin structures and serve as substrates for the Dicer
family of RNase III enzymes. They share this process with an
experimental system, RNA interference (RNAi), which may be used to
silence the expression of endogenous genes in eukaryotic cells. The
products of Dicer cleavage are short dsRNA molecules, one strand of
which is retained in a ribonucleoprotein complex called the
RNA-induced silencing complex (RISC). The retained RNA acts as a
guide to target this complex to a complementary mRNA sequence which
is inactivated either by cleavage or translational interference,
depending on the degree of complementarity between the miRNA and
its target.
[0008] The present invention relates to a method of modulating the
development of cells with altered microRNA levels, and arises from
the recognition that some diseased cells have altered expression
levels of endogenous microRNAs and that expression of therapeutic
nucleic acids may be effectively targeted to such cells by
exploiting the altered expression of the microRNAs in these
cells.
[0009] A reference herein to a patent document or other matter
which is given as prior art is not to be taken as an admission that
that document or matter was known or that the information it
contains was part of the common general knowledge as at the
priority date of any of the claims.
SUMMARY OF THE INVENTION
[0010] The present invention provides a method of modulating
development of a cell, the method including the step of introducing
into the cell a nucleic acid with the capacity to modulate
development of the cell, the nucleic acid including a target site
for binding of a microRNA, wherein the activity and/or
concentration of the microRNA in the cell results in a level of
activity and/or concentration of the nucleic acid in the cell
sufficient to modulate development of the cell.
[0011] The present invention also provides a nucleic acid with the
capacity to modulate development of a cell, the nucleic acid
including a binding site for a microRNA.
[0012] The present invention also provides a nucleic acid including
a non-naturally occurring binding site for a microRNA that is
differentially expressed and/or has differential activity.
[0013] The present invention also provides a cancerous cell
including an exogenous nucleic acid including a binding site for a
microRNA, wherein the cancerous cell has a reduced activity and/or
concentration of the microRNA as compared to a similar
non-cancerous cell.
[0014] The present invention also provides an animal including
cancerous cells, the cancerous cells including an exogenous nucleic
acid including a target site for binding of a microRNA.
[0015] The present invention also provides a method of preventing
and/or treating a disease, condition or state associated with
target cells in a subject, the method including the step of
introducing into cells in the subject a nucleic acid with the
capacity to modulate development of a cell, the nucleic acid
including a target site for binding of the microRNA, wherein the
activity of the microRNA in the target cells results in a level of
activity of the nucleic acid sufficient to modulate development of
the target cells in the subject.
[0016] The present invention also provides a method of detecting
altered microRNA activity and/or concentration in a cancerous or
pre-cancerous cell, the method including the steps of: [0017]
determining the level of expression of a reporter nucleic acid in
the cancerous or pre-cancerous cells and determining the level of
expression of a reporter nucleic acid in non-cancerous cells; and
[0018] detecting a reduced activity of the microRNA in the
cancerous cells by an increase in the expression of the reporter
nucleic acid in the cancerous cells as compared to the level of
expression of the reporter nucleic acid in the non-cancerous
cells.
[0019] The present invention also provides a method of modulating
the concentration of a nucleic acid expressed in a cancerous cell,
the cancerous cell having an altered activity and/or concentration
of a microRNA as compared to a similar non-cancerous cell, the
method including the step of introducing a target site for binding
of the microRNA into the nucleic acid to be expressed in the
cell.
[0020] The present invention arises from the recognition that many
cells, including cancerous cells, have altered expression levels of
endogenous microRNAs, and that expression of therapeutic nucleic
acids may be more effectively targeted to such cells by exploiting
the altered expression of the microRNAs in these cells.
[0021] In addition, it has also been recognised that the levels of
some microRNAs are modulated during differentiation of cells or
during their normal developmental programme, and accordingly,
expression of nucleic acids may also be targeted to these cells at
specific times in their developmental programme and/or at times
when the level of the microRNAs changes.
[0022] Various terms that will be used throughout the specification
have meanings that will be well understood by a skilled addressee.
However, for ease of reference, some of these terms will now be
defined.
[0023] The term "development" as used throughout the specification
in relation to the development of a cell is to be understood to
mean the continuance of a cell in its current state or the
continuance of a cell in its normal developmental and/or metabolic
program.
[0024] In this regard, modulation of the development of a cell may,
for example, result in an inhibition or cessation of cell growth,
cell death, or an alteration in the normal developmental pathway
that a cell undergoes. Alternatively, modulation of the development
of a cell may result, for example, in increased cell survival or
rescue, or increased cell proliferation.
[0025] The term "modulate" or variants thereof as used throughout
the specification is to be understood to mean any alteration
(increase or decrease) in the activity of a process. For example,
alteration may result in activation of a process, inhibition of a
process, a change in the timing of a process or a change in
probability that a process may occur.
[0026] The term "nucleic acid" as used throughout the specification
is to be understood to mean to any oligonucleotide or
polynucleotide. The nucleic acid may be DNA or RNA and may be
single stranded or double stranded. The nucleic acid may be any
type of nucleic acid, including a nucleic acid of genomic origin,
cDNA origin (ie derived from a mRNA), derived from a virus, or of
synthetic origin. It will be appreciated that a nucleic acid with
the capacity to modulate development of a cell is a nucleic acid
that in a particular cell either inhibits or promotes development
of the cell.
[0027] In this regard, an oligonucleotide or polynucleotide may be
modified at the base moiety, sugar moiety, or phosphate backbone,
and may include other appending groups to facilitate the function
of the nucleic acid. The oligonucleotide or polynucleotide may be
modified at any position on its structure with constituents
generally known in the art. For example, an oligonucleotide may
include at least one modified base moiety which is selected from
the group including 5-fluorouracil, 5-bromouracil, 5-chlorouracil,
5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine,
5-(carboxyliydroxylmethyl) uracil,
5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil,
beta-D-galactosylqueosine, inosine, N6-isopentenyladenine,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta
D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil,
2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v),
wybutoxosine, pseudouracil, queosine, 2-thiocytosine,
5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil,
uracil5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v),
5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil,
(acp3) w, and 2,6-diaminopurine.
[0028] The oligonucleotide or polynucleotide may also include at
least one modified sugar moiety selected from the group including,
but not limited to, arabinose, 2-fluoroarabinose, xylulose, and
hexose. In addition, the oligonucleotide or polynucleotide may
include at least one modified phosphate backbone, such as a
phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a
phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl
phosphotriester, and a formacetal or any analogue thereof.
[0029] The term "subject" as used throughout the specification is
to be understood to mean any multicellular organism, including an
animal or human subject. For example, the subject may be a mammal
such as a primate, a livestock animal (eg. A horse, a cow, a sheep,
a pig, a goat), a companion animal (eg. a dog, a cat), a laboratory
test animal (eg. a mouse, a rat, a guinea pig, a bird), an animal
of veterinary significance, or an animal of economic
significance.
[0030] The term "variant" as used throughout the specification is
to be understood to mean an amino acid sequence of a polypeptide or
protein that is altered by one or more amino acids. The variant may
have "conservative" changes, wherein a substituted amino acid has
similar structural or chemical properties to the replaced amino
acid (e.g., replacement of leucine with isoleucine). A variant may
also have "non-conservative" changes (e.g., replacement of a
glycine with a tryptophan) or a deletion and/or insertion of one or
more amino acids. The term also includes within its scope any
insertions/deletions of amino acids for a particular polypeptide or
protein. A "functional variant" will be understood to mean a
variant that retains the functional capacity of a reference protein
or polypeptide.
BRIEF DESCRIPTION OF THE FIGURES
[0031] FIG. 1 shows in the top panel the stem-loop structure of the
hsa-miR-143 precursor and the nucleotide sequence of the mature
hsa-miR-143 microRNA. The bottom panel shows the stem-loop
structure of the hsa-miR-145 precursor and the nucleotide sequence
of the mature hsa-miR-145 microRNA.
[0032] FIG. 2 shows EGFP fluorescence (three days
post-transfection) from HeLa cells cotransfected with 0.1 .mu.g
EGFP/RICS-miR145 target sequence expression vector (pMM095) and
varying levels of pri-miR145 (single--pMM109, and tandem--pMM107)
expression plasmids, antisense (A/S; pMM106) and empty vector
controls (pcDNA3.1). Data are representative of two
experiments.
[0033] FIG. 3 shows the map for plasmid pMM043.
[0034] FIG. 4 shows the map for plasmid pMM095. The nucleotide
sequence of pMM095 is provided in the sequence listing and is
designated SEQ ID NO. 153.
[0035] FIG. 5 shows the map for plasmid pMM105. The nucleotide
sequence of pMM105 is provided in the sequence listing and is
designated SEQ ID NO. 154.
[0036] FIG. 6 shows the map for plasmid pMM106. The nucleotide
sequence of pMM106 is provided in the sequence listing and is
designated SEQ ID NO. 155.
[0037] FIG. 7 shows the map for plasmid pMM107. The nucleotide
sequence of pMM107 is provided in the sequence listing and is
designated SEQ ID NO. 156.
[0038] FIG. 8 shows the map for plasmid pMM109. The nucleotide
sequence of pMM109 is provided in the sequence listing and is
designated SEQ ID NO. 157.
[0039] FIG. 9 shows the map for plasmid pMM-TK/miRTarg. The
nucleotide sequence of pMM-TK/miRTarg is provided in the sequence
listing and is designated SEQ ID NO. 158.
[0040] FIG. 10 shows the map for plasmid pMM-CD/miRTarg. The
nucleotide sequence of pMM-CD/miRTarg is provided in the sequence
listing and is designated SEQ ID NO. 159.
[0041] FIG. 11 shows in the top panel real time RT-PCR quantitation
of relative pri-miR145 levels 24 h post Dox-induction. The lower
panel shows accumulation of mature miR145 in HeLa Tet-On/pMM110d
line, following 24 h incubation in 1 .mu.g/mL doxycycline, by
Northern analysis: 20 .mu.g total RNA/sample, 15% denaturing PAGE
minigel. The ethidium bromide stained gel is shown to compare
loading of samples.
[0042] FIG. 12 shows the effect of increasing miRNA target
sequences in the 3'UTR of a transgene. Cells of the stable pMM110
transgenic HeLa Tet On cell line, HTO110e, were grown in the
presence, or absence, of 2 .quadrature.g doxycycline/mL medium and
FuGene6-transfected, one after plating, with 80 ng plasmid. The
plasmids used for transfection were all derived from pMM043, with
varying numbers of miR145 target sequences inserted in the EGFP
3'UTR NotI site. Plasmids were: pMM043 (no targets), pMM095 (1
target), pMM117 (2 targets), pMM119 (8 targets). Values displayed
are the mean fluorescence (n=3) at 46 hours after transfection.
GENERAL DESCRIPTION OF THE INVENTION
[0043] As mentioned above, in one form the present invention
provides a method of modulating development of a cell, the method
including the step of introducing into the cell a nucleic acid with
the capacity to modulate development of the cell, the nucleic acid
including a target site for binding of a microRNA, wherein the
activity and/or concentration of the microRNA in the cell results
in a level of activity and/or concentration of the nucleic acid in
the cell sufficient to modulate development of the cell.
[0044] The present invention arises from the recognition that some
diseased cells have altered expression levels of endogenous
microRNAs, and that expression of nucleic acids may be effectively
targeted to these cells by exploiting the altered expression of the
microRNAs in the cells.
[0045] It will be appreciated that in the case of a reduced miRNA
expression, the expression of the nucleic acids is in fact
effectively de-targeted.
[0046] Thus, the present invention has application in fields such
as genetic engineering and therapeutic gene transfer.
[0047] The present invention is suitable for example for targeting
expression of a cytotoxic nucleic acid to a diseased cell so as to
ablate the cell, or alternatively, for targeting expression of a
therapeutic nucleic acid to a diseased cell to improve one or more
characteristics of the cell (eg for gene therapy purposes).
[0048] For example, previous studies of microRNAs differentially
expressed between colonic adenocarcinoma cells and matched normal
mucosa have identified two microRNAs, miR-143 and miR-145, that
show significantly reduced levels of the fully processed miRNA in
tumors compared to normal tissues. These miRNAs are produced from
hairpin precursor (pre-miRNAs) that are cleaved to the shorter
mature miRNA, as shown in FIG. 1. Thus, the present invention may
be used, for example, to modulate the development of cells having
reduced expression of the miR-143 or miR-145 microRNAs.
[0049] The alteration in the level and/or activity of the one or
more microRNAs in the cell may be a constitutive alteration, or
alternatively, may be an alteration that occurs at a specific
point(s) in the developmental programme of the cell. For example,
the present invention is suitable for modulating development of a
cancer cell that shows a reduced constitutive expression and/or
activity of a particular miRNA, for modulating development of a
cell infected with a virus which causes altered expression and/or
activity of a miRNA, or for modulating development of an embryonic
or adult stem cell that modulates the activity of a specific miRNA
at specific stages of its developmental programme.
[0050] Confirmation that a cell has an altered activity and/or
expression of a specific miRNA may be achieved by a suitable method
known in the art, such as Northern analysis, reverse transcription
PCR (RT-PCR) or RNase protection.
[0051] Alternatively confirmation that a cell has an altered
activity and/or expression of a specific miRNA may be achieved by
way of expression of a reporter gene linked to a target site for
the particular miRNA. In this case, the level of expression of the
reporter gene will inversely reflect the activity and/or expression
level of the miRNA in the cell.
[0052] Methods for the construction of reporter genes including a
target site for a miRNA are known in the art. For example, a target
site may be cloned into the 3'UTR of GFP, and the construct
introduced into the cell. Methods for the cloning of nucleic acid
sequences are as described in Sambrook, J, Fritsch, E. F. and
Maniatis, T. Molecular Cloning: A Laboratory Manual 2nd. ed. Cold
Spring Harbor Laboratroy Press, New York. (1989).
[0053] As discussed previously, a reduced activity and/or
expression of a miRNA may be correlated with a disease, condition
or state. For example, cancerous cells often have a reduced level
of one or more specific miRNAs. Indeed, for many cancers a reduced
level of miRNA activity and/or expression is associated with the
progression of a normal cell to a cancerous cell. Thus, the cell in
this form of the present invention may be a cancerous cell or a
pre-cancerous cell.
[0054] Examples of cancerous cells that show a reduced activity
and/or expression of a miRNA include colorectal cancer cells, lung
cancer cells, thymus cancer cells, bladder cancer cells, breast
cancer cells and prostate cancer cells.
[0055] Examples of cancerous cells generally include cells
associated with the cancers such as bladder cancer, bone cancer,
brain tumours, breast cancer, cervical cancer, colorectal cancer
including cancer of the colon, rectum, anus, and appendix, cancer
of the esophagus, Hodgkin's disease, kidney cancer, cancer of the
larynx, leukemia, liver cancer, lung cancer, lymphoma, melanoma,
moles and dysplastic nevi, multiple myeloma, muscular cancer,
non-Hodgkin's lymphoma, oral cancer, ovarian cancer, cancer of the
pancreas, prostate cancer, skin cancer, stomach cancer, testicular
cancer, teratoma, thyroid cancer, and cancer of the uterus. The
present invention also includes pre-cancerous cells, including for
example, pre-cancerous cells associated with the aforementioned
cancers.
[0056] In one form, the cell in the various forms of the present
invention is cancerous cell from a colorectal cancer or colorectal
polyp, including a cancerous cell from a colorectal adenocarcinoma
or an adenomatous polyp.
[0057] However, as discussed above, the cell in the various forms
of the present invention may also be for example an embryonic stem
(ES) cell or an adult stem cell. In this regard, microRNAs have
been identified in the mouse for which expression is repressed as
the ES cells differentiate into embryoid bodies and is undetectable
in adult organs, indicating that these miRNAs may have a role in
the maintenance of the pluripotent cell state and in the regulation
of early mammalian development.
[0058] Examples of other cells suitable for the various forms of
the present invention include haemopoietic cells including
haemopoietic precursor cells, adipocytes, chronic lymphocytic B
cells, neuronal cells, sperm cells or sperm producing cells,
pancreatic endocrine cells including pancreatic islet cells, and
virally infected cells including EBV, HIV, Hepatitis and Herpes
infected cells.
[0059] It will be appreciated that the cell for which development
is modulated in the various forms of the present invention may be
an isolated cell in vitro, or a cell present in a biological system
such as a cell in an organ or tissue, or a cell present in an
entire organism (eg animal or human subject). In this regard, the
term "biological system" is to be understood to mean any
multi-cellular system, and includes isolated groups of cells to
whole organisms.
[0060] Thus, the present invention may be used to modulate the
development of a target cell in a biological system.
[0061] Accordingly, in another form the present invention provides
a method of modulating development of a target cell in a biological
system, the method including the step of introducing into a target
cell in the biological system a nucleic acid with the capacity to
modulate development of the cells in the biological system, the
nucleic acid including a target site for binding of a microRNA,
wherein the activity and/or concentration of the microRNA in the
target cell results in a level of activity and/or concentration of
the nucleic acid in the target cell sufficient to modulate the
development of the target cell.
[0062] In one form, the biological system is an animal or human
subject, including an animal or human that is susceptible to, or
suffering from, a disease, condition or state associated with
altered microRNA activity and/or expression.
[0063] The present invention is therefore suitable for preventing
and/or treating a disease, condition or state associated with
target cells having an altered activity of a microRNA in a
subject.
[0064] Accordingly, in another form the present invention provides
a method of preventing and/or treating a disease, condition or
state associated with target cells in a subject, the method
including the step of introducing into cells in the subject a
nucleic acid with the capacity to modulate development of a cell,
the nucleic acid including a target site for binding of the
microRNA, wherein the altered activity of the microRNA in the
target cells results in a level of activity of the nucleic acid
sufficient to modulate development of the target cells in the
subject.
[0065] Examples of diseases, conditions or states associated with
altered microRNA activity and/or expression in the various forms of
the present invention are as previously discussed, including
cancers such as colorectal cancer, lung cancer, thymus cancer,
bladder cancer, breast cancer and prostate cancer; human B cell
chronic lymphocytic leukemia; B cell (Burkitt) Lymphoma; disorders
of pancreatic endocrine cells such as diabetes; diseases and
conditions associated with virally infection of cells such as EBV,
HIV, Hepatitis and Herpes infected cells; 5q-myelodysplastic
syndrome (macrocytic anaemia); diseases and conditions associated
with haemopoietic dysfunction; autoimmune and inflammatory diseases
(eg Crohn's); fragile X mental retardation; Di George syndrome;
Wilms tumour; a disease or condition associated with adipocyte
dysfunction; a disease that can be treated with embryonic or adult
stem cells; and a disease or condition associated with sperm
producing cells.
[0066] It will be appreciated that an amount of the nucleic acid
effective to provide a therapeutic or desired effect will be
introduced/administered to the cell, biological system or subject
in the various relevant forms of the present invention.
[0067] For example, methods for introducing exogenous DNAs into
cells are as described in Sambrook, J, Fritsch, E. F. and Maniatis,
T. Molecular Cloning: A Laboratory Manual 2nd. ed. Cold Spring
Harbor Laboratory Press, New York. (1989).
[0068] The present invention may be used to either inhibit the
development of target cells by use of a nucleic acid that inhibits
the development of target cells, or alternatively, to promote the
development of target cells by the use of a nucleic acid that
promotes the development of target cells. For example, the present
invention may be used to selectively ablate or rescue cells.
Methods for determining whether the development of a cell have been
inhibited or promoted are known in the art.
[0069] Thus, in one form of the present invention the development
of a cell may be inhibited.
[0070] In this case, the nucleic acid introduced into the cell will
have the capacity to inhibit development of the cell. As the
nucleic acid will include one or more target sites for binding of
one or more miRNAs, a reduction in activity and/or expression of
the one or more miRNAs in a cell will result in an increased
expression of the nucleic acid (as compared to a similar cell which
does not have a reduced activity of the one or more miRNAs) and
consequently result in a level of expression of the nucleic acid
sufficient to inhibit development of the cell.
[0071] Accordingly, in another form the present invention provides
a method of inhibiting development of a cell, the cell having a
reduced activity and/or concentration of a microRNA, the method
including the step of introducing into the cell a nucleic acid with
the capacity to inhibit development of the cell, the nucleic acid
including a target site for binding of the microRNA, wherein the
reduced activity and/or concentration of the microRNA in the cell
results in a level of activity and/or concentration of the nucleic
acid in the cell sufficient to inhibit development of the cell.
[0072] In one form, the nucleic acid with the capacity to inhibit
development of a cell is a nucleic acid with cytotoxic or
cytostatic activity, or a nucleic acid encoding a suicide gene. In
this case, the introduction of such a nucleic acid including one or
more target sites for binding of one or more miRNAs into cells will
result in an inhibition of development in those cells that have a
reduced activity and/or expression of the one or more miRNAs. In
cells that do not have a reduced activity and/or expression of the
one or more miRNAs, the miRNAs will act to reduce the expression of
the nucleic acid sufficiently that cell development is not
inhibited, or at least less inhibited than the cells with the
reduced activity and/or expression of the miRNA.
[0073] Thus, the present invention allows the selective inhibition
of cells with a reduced activity and/or expression of a specific
miRNA. In one form, the present invention may be used to
selectively ablate target cells with a reduced activity and/or
expression of a specific miRNA.
[0074] Examples of cytotoxic or suicide genes are generally as
described in Greco and Dachs (2001) J Cell Physiol. 187(1):22-36
and include herpes simplex thymidine kinase
[NC.sub.--001798:c48000-46870 (HSV2 genome)] [gi| 9629267], E. coli
cytosine deaminase [NC.sub.--000913: 355395-356678 (E. coli
genome)] [gi| 49175990], bacterial E. coli nitroreductase
[NC.sub.--000913: c603994-604647] [gi| 49175990, P. aeruginosa
carboxypeptidase G2 [AE004706.1: 3474-4712], horseradish peroxidase
[X57564] [gi|16095], and E. coli purine nucleoside phosphorylase
[U00096.2: 4618906-4619625 (E. coli genome)] [gi| 48994873]. It
will also be appreciated that active fragments of these genes may
be used, or a functional variant may be used.
[0075] In one form, the nucleic acid with the capacity to inhibit
development of the cell is selected from one of the group
consisting of herpes simplex thymidine kinase, a purine nucleoside
phosphorylase and a cytosine deaminase.
[0076] The nucleotide sequence of the HSV thymidine kinase gene is
designated SEQ ID NO. 151.
[0077] The nucleotide sequence of E. coli cytosine deaminase is
designated SEQ ID NO. 152. In this case, it should be noted that
the initiation codon is modified from GTG to ATG for mammalian
expression constructs.
[0078] An example of a plasmid encoding the HSV thymidine kinase
gene and the miRNA target sequence for miR-145 is plasmid
pMM-TK/miR-Targ, which is shown in FIG. 9. The nucleotide sequence
of this plasmid is designated SEQ ID NO.158.
[0079] An example of a plasmid encoding the E. coli cytosine
deaminase and the miRNA target sequence for miR-145 is plasmid
pMM-CD/miR-Targ, which is shown in FIG. 10. The nucleotide sequence
of this plasmid is designated SEQ ID NO.159.
[0080] In another form, the present invention allows the
development of a cell to be promoted.
[0081] In this case, the nucleic acid introduced into the cell will
have the capacity to promote development of the cell. As the
nucleic acid will include one or more target sites for binding of
one or more miRNAs, a reduction in activity and/or expression of
the one or more miRNAs will result in an increased expression of
the nucleic acid (as compared to a similar cell which does not have
a reduced activity of the one or more miRNAs) and consequently
result in a level of expression of the nucleic acid sufficient to
promote development of the cell.
[0082] Accordingly, in another form the present invention provides
a method of promoting development of a cell, the cell having a
reduced activity and/or concentration of a microRNA, the method
including the step of introducing into the cell a nucleic acid with
the capacity to promote development of the cell, the nucleic acid
including a target site for binding of the microRNA, wherein the
reduced activity and/or concentration of the microRNA in the cell
results in a level of activity and/or concentration of the nucleic
acid in the cell sufficient to promote development of the cell.
[0083] Examples of nucleic acids that have the capacity to promote
development in a cell include therapeutic genes or a cytokine gene
such as granulocyte macrophage-colony stimulating factor (GM-CSF;
human: NM.sub.--000758), G-CSF (human: NM.sub.--000759;
NM.sub.--172219; NM.sub.--172220), Interleukin 11 (human:
NM.sub.--000641), and Tumour Necrosis Factor alpha (human:
NM.sub.--000594). Thus, the nucleic acid may encode a cytokine, a
therapeutic protein or an active fragment of a cytokine or a
therapeutic protein.
[0084] In the case of a cytokine gene, the introduction of a
nucleic acid encoding a cytokine into cells will result in a
promotion of development in cells that have a reduced activity
and/or expression of the one or more miRNAs. In this case, it will
be appreciated that the cells will be susceptible to the effects of
the cytokine. In cells that do not have a reduced activity and/or
expression of the one or more miRNAs, the miRNAs will act to reduce
the expression of the nucleic acid sufficiently that cell
development is not promoted, or at least less promoted to an extent
that is less than the cells with the reduced activity and/or
expression of the miRNA.
[0085] Thus, the present invention allows the selective promotion
of development of target cells with a reduced activity and/or
expression of a specific miRNA.
[0086] It will be appreciated, that the expression of the nucleic
acid with the capacity to modulate development of a cell will
require various regulatory elements known in the art for the
expression of the inserted nucleic acids in particular cell types,
such as promoters for driving the expression of an inserted nucleic
acid in a particular cell, poly A signals for efficient
polyadenylation of mRNA transcribed from inserted nucleic acids, or
other regulatory elements to control translation, transcription or
mRNA stability.
[0087] Depending upon the cell type to be modulated, the promoter
driving the expression may be a constitutive promoter, an inducible
promoter or a cell or tissue specific promoter.
[0088] Constitutive mammalian promoters include hypoxanthine
phosphoribosyl transferase (HPTR), adenosine deaminase, pyruvate
kinase, phosphoglycerate kinase (which has intrinsic bi-directional
activity) and .beta.-actin. Exemplary viral promoters which
function constitutively in eukaryotic cells include promoters from
the simian virus, papilloma virus, adenovirus, human
immunodeficiency virus (HIV), Rous sarcoma virus, cytomegalovirus,
the long terminal repeats (LTR) of moloney leukemia virus and other
retroviruses, and the thymidine kinase promoter of herpes simplex
virus.
[0089] Inducible promoters include synthetic promoters regulated by
the TetO/TetR system and inducible promoters such as
metallothionein promoter, which may be used to induce transcription
in the presence of certain metal ions. Other inducible promoters
are known in the art.
[0090] The tissue-specific promoter will depend upon the particular
cell type. For example, promoters that allow expression in colon
cancer cells include the regulatory sequences of human
carcinoembryonic antigen (CEA) [accession:U17131; gi/967132].
[0091] Examples of microRNAs that are correlated with human cancer,
or the progression of a normal cell to a cancerous cell in humans,
are as follows (5' to 3'):
TABLE-US-00001 hsa-let-7a-1 pre-miRNA precursor: (SEQ ID NO. 1)
ugggaugagguaguagguuguauaguuuuagggucacacccaccacugggagauaacuauacaau
cuacugucuuuccua hsa-let-7 mature miRNA: (SEQ ID NO. 2)
ugagguaguagguuguauaguu hsa-let-7a-2 pre-miRNA precursor: (SEQ ID
NO. 3) agguugagguaguagguuguauaguuuagaauuacaucaagggagauaacuguacagccu
ccuagcuuuccu hsa-let-7a mature miRNA: (SEQ ID NO. 4)
ugagguaguagguuguauaguu hsa-let-7a-3 pre-miRNA precursor: (SEQ ID
NO. 5)
gggugagguaguagguuguauaguuuggggcucugcccugcuaugggauaacuauacaaucuacu
gucuuuccu hsa-let-7a mature miRNA: (SEQ ID NO. 6)
ugagguaguagguuguauaguu hsa-let-7b pre-miRNA precursor: (SEQ ID NO.
7)
cggggugagguaguagguugugugguuucagggcagugauguugccccucggaagauaacuauac
aaccuacugccuucccug hsa-let-7b mature miRNA: (SEQ ID NO. 8)
ugagguaguagguugugugguu hsa-let-7c pre-miRNA precursor: (SEQ ID NO.
9)
gcauccggguugagguaguagguuguaugguuuagaguuacacccugggaguuaacuguacaacc
uucuagcuuuccuuggagc hsa-let-7c mature miRNA: (SEQ ID NO. 10)
ugagguaguagguuguaugguu hsa-let-7f-1 pre-miRNA precursor: (SEQ ID
NO. 11)
ucagagugagguaguagauuguauaguugugggguagugauuuuacccuguucaggagauaacua
uacaaucuauugccuucccuga hsa-let-7f mature miRNA: (SEQ ID NO. 12)
ugagguaguagauuguauaguu hsa-let-7f-2 pre-miRNA precursor: (SEQ ID
NO. 13)
ugugggaugagguaguagauuguauaguuuuagggucauaccccaucuuggagauaacuauacag
ucuacugucuuucccacg hsa-let-7f mature miRNA: (SEQ ID NO. 14)
ugagguaguagauuguauaguu hsa-mir-10b pre-miRNA precursor: (SEQ ID NO.
15)
ccagagguuguaacguugucuauauauacccuguagaaccgaauuugugugguauccguauaguc
acagauucgauucuaggggaauauauggucgaugcaaaaacuuca hsa-miR-10b mature
miRNA: (SEQ ID NO. 16) uacccuguagaaccgaauuugu hsa-mir-15b pre-miRNA
precursor: (SEQ ID NO. 17)
uugaggccuuaaaguacuguagcagcacaucaugguuuacaugcuacagucaagaugcgaaucauu
auuugcugcucuagaaauuuaaggaaauucau hsa-miR-15b mature miRNA: (SEQ ID
NO. 18) uagcagcacaucaugguuuaca hsa-mir-16-1 pre-miRNA precursor:
(SEQ ID NO. 19)
gucagcagugccuuagcagcacguaaauauuggcguuaagauucuaaaauuaucuccaguauuaac
ugugcugcugaaguaagguugac hsa-miR-16 mature miRNA: (SEQ ID NO. 20)
uagcagcacguaaauauuggcg hsa-mir-16-2 pre-miRNA precursor: (SEQ ID
NO. 21)
guuccacucuagcagcacguaaauauuggcguagugaaauauauauuaaacaccaauauuacugu
gcugcuuuagugugac hsa-miR-16 mature miRNA: (SEQ ID NO. 22)
uagcagcacguaaauauuggcg hsa-mir-19b-1 pre-miRNA precursor: (SEQ ID
NO. 23)
cacuguucuaugguuaguuuugcagguuugcauccagcugugugauauucugcugugcaaauccau
gcaaaacugacugugguagug hsa-miR-19b mature miRNA: (SEQ ID NO. 24)
ugugcaaauccaugcaaaacuga hsa-mir-19b-2 pre-miRNA precursor: (SEQ ID
NO. 25)
acauugcuacuuacaauuaguuuugcagguuugcauuucagcguauauauguauauguggcugug
caaauccaugcaaaacugauugugauaaugu hsa-miR-19b mature miRNA: (SEQ ID
NO. 26) ugugcaaauccaugcaaaacuga hsa-mir-20 pre-miRNA precursor:
(SEQ ID NO. 27)
guagcacuaaagugcuuauagugcagguaguguuuaguuaucuacugcauuaugagcacuuaaag
uacugc hsa-miR-20 mature miRNA: (SEQ ID NO. 28)
uaaagugcuuauagugcagguag hsa-mir-21 pre-miRNA precursor: (SEQ ID NO.
29)
ugucggguagcuuaucagacugauguugacuguugaaucucauggcaacaccagucgaugggcugu
cugaca hsa-miR-21 mature miRNA: (SEQ ID NO. 30)
uagcuuaucagacugauguuga hsa-mir-22 pre-miRNA precursor: (SEQ ID NO.
31)
ggcugagccgcaguaguucuucaguggcaagcuuuauguccugacccagcuaaagcugccaguuga
agaacuguugcccucugcc hsa-miR-22 mature miRNA: (SEQ ID NO. 32)
aagcugccaguugaagaacugu hsa-mir-23a pre-miRNA precursor: (SEQ ID NO.
33)
ggccggcugggguuccuggggaugggauuugcuuccugucacaaaucacauugccagggauuucca
accgacc hsa-miR-23a mature miRNA: (SEQ ID NO. 34)
aucacauugccagggauuucc hsa-mir-24-1 pre-miRNA precursor: (SEQ ID NO.
35)
cuccggugccuacugagcugauaucaguucucauuuuacacacuggcucaguucagcaggaacagg
ag hsa-miR-24 mature miRNA: (SEQ ID NO. 36) uggcucaguucagcaggaacag
hsa-miR-189 mature miRNA: (SEQ ID NO. 37) gugccuacugagcugauaucagu
hsa-mir-24-2 pre-miRNA precursor: (SEQ ID NO. 38)
cucugccucccgugccuacugagcugaaacacaguugguuuguguacacuggcucaguucagcagg
aacaggg hsa-miR-24 mature miRNA: (SEQ ID NO. 39)
uggcucaguucagcaggaacag hsa-mir-26a-1 pre-miRNA precursor: (SEQ ID
NO. 40)
guggccucguucaaguaauccaggauaggcugugcaggucccaaugggccuauucuugguuacuug
cacggggacgc hsa-miR-26 mature miRNA: (SEQ ID NO. 41)
auucaaguaauccaggauaggc hsa-mir-26b pre-miRNA precursor: (SEQ ID NO.
42)
ccgggacccaguucaaguaauucaggauagguugugugcuguccagccuguucuccauuacuuggc
ucggggaccgg hsa-miR-26b mature miRNA: (SEQ ID NO. 43)
uucaaguaauucaggauagguu hsa-mir-26a-2 pre-miRNA precursor: (SEQ ID
NO. 44)
ggcuguggcuggauucaaguaauccaggauaggcuguuuccaucugugaggccuauucuugauuac
uuguuucuggaggcagcu hsa-miR-26a mature miRNA: (SEQ ID NO. 45)
uucaaguaauccaggauaggc hsa-mir-27b pre-miRNA precursor: (SEQ ID NO.
46)
accucucuaacaaggugcagagcuuagcugauuggugaacagugauugguuuccgcuuuguucaca
guggcuaaguucugcaccugaagagaaggug hsa-miR-27b mature miRNA: (SEQ ID
NO. 47) uucacaguggcuaaguucugc hsa-mir-29a pre-miRNA precursor: (SEQ
ID NO. 48)
augacugauuucuuuugguguucagagucaauauaauuuucuagcaccaucugaaaucgguuau
hsa-miR-29a mature miRNA: (SEQ ID NO. 49) uagcaccaucugaaaucgguu
hsa-mir-30a pre-miRNA precursor: (SEQ ID NO. 50)
gcgacuguaaacauccucgacuggaagcugugaagccacagaugggcuuucagucggauguuugca
gcugc hsa-miR-30a-3p mature miRNA: (SEQ ID NO. 51)
cuuucagucggauguuugcagc hsa-miR-30a-5p mature miRNA: (SEQ ID NO. 52)
uguaaacauccucgacuggaag hsa-mir-141 pre-miRNA precursor: (SEQ ID NO.
53)
cggccggcccuggguccaucuuccaguacaguguuggauggucuaauugugaagcuccuaacacug
ucugguaaagauggcucccggguggguuc hsa-miR-141 mature miRNA: (SEQ ID NO.
54) uaacacugucugguaaagaugg hsa-mir-142 pre-miRNA precursor: (SEQ ID
NO. 55)
gacagugcagucacccauaaaguagaaagcacuacuaacagcacuggaggguguaguguuuccuac
uuuauggaugaguguacugug hsa-miR-142-5p mature miRNA: (SEQ ID NO. 56)
cauaaaguagaaagcacuac hsa-miR-142-3p mature miRNA: (SEQ ID NO. 57)
uguaguguuuccuacuuuaugga hsa-mir-143 pre-miRNA precursor: (SEQ ID
NO. 58)
gcgcagcgcccugucucccagccugaggugcagugcugcaucucuggucaguugggagucugagau
gaagcacuguagcucaggaagagagaaguuguucugcagc hsa-miR-143 mature miRNA:
(SEQ ID NO. 59) ugagaugaagcacuguagcuca hsa-mir-145 pre-miRNA
precursor: (SEQ ID NO. 60)
caccuuguccucacgguccaguuuucccaggaaucccuuagaugcuaagauggggauuccuggaaa
uacuguucuugaggucaugguu hsa-miR-145 mature miRNA: (SEQ ID NO. 61)
guccaguuuucccaggaaucccuu hsa-mir-192 pre-miRNA precursor: (SEQ ID
NO. 62)
gccgagaccgagugcacagggcucugaccuaugaauugacagccagugcucucgucuccccucuggc
ugccaauuccauaggucacagguauguucgccucaaugccagc hsa-miR-192 mature
miRNA: (SEQ ID NO. 63) cugaccuaugaauugacagcc hsa-mir-194-1
pre-miRNA precursor: (SEQ ID NO. 64)
augguguuaucaaguguaacagcaacuccauguggacuguguaccaauuuccaguggagaugcug
uuacuuuugaugguuaccaa hsa-miR-194 mature miRNA: (SEQ ID NO. 65)
uguaacagcaacuccaugugga hsa-mir-194-2 pre-miRNA precursor: (SEQ ID
NO. 66)
ugguucccgcccccuguaacagcaacuccauguggaagugcccacugguuccaguggggcugcugu
uaucuggggcgagggccag hsa-miR-194 mature miRNA: (SEQ ID NO. 67)
uguaacagcaacuccaugugga hsa-mir-199b pre-miRNA precursor: (SEQ ID
NO. 68)
ccagaggacaccuccacuccgucuacccaguguuuagacuaucuguucaggacucccaaauuguac
aguagucugcacauugguuaggcugggcuggguuagacccucgg hsa-miR-199b mature
miRNA: (SEQ ID NO. 69) cccaguguuuagacuaucuguuc hsa-mir-200b
pre-miRNA precursor: (SEQ ID NO. 70)
ccagcucgggcagccguggccaucuuacugggcagcauuggauggagucaggucucuaauacugcc
ugguaaugaugacggcggagcccugcacg hsa-miR-200b mature miRNA: (SEQ ID
NO. 71) uaauacugccugguaaugaugac hsa-mir-200c pre-miRNA precursor:
(SEQ ID NO. 72)
cccucgucuuacccagcaguguuugggugcgguugggagucucuaauacugccggguaaugaugga
gg hsa-miR-200c mature miRNA: (SEQ ID NO. 73)
uaauacugccggguaaugaugg hsa-mir-320 pre-miRNA precursor: (SEQ ID NO.
74)
gcuucgcuccccuccgccuucucuucccgguucuucccggagucgggaaaagcuggguugagagggc
gaaaaaggaugaggu hsa-miR-320 mature miRNA: (SEQ ID NO. 75)
aaaagcuggguugagagggcgaa hsa-miR-321 mature miRNA: (SEQ ID NO. 76)
uaagccagggauuguggguuc hsa-mir-30a pre-miRNA precursor: (SEQ ID NO.
77)
gcgacuguaaacauccucgacuggaagcugugaagccacagaugggcuuucagucggauguuugca
gcugc hsa-miR-30a-3p mature miRNA: (SEQ ID NO. 78)
cuuucagucggauguuugcagc hsa-miR-30a-5p mature miRNA: (SEQ ID NO. 79)
uguaaacauccucgacuggaag hsa-mir-29b-1 pre-miRNA precursor: (SEQ ID
NO. 80)
cuucaggaagcugguuucauauggugguuuagauuuaaauagugauugucuagcaccauuugaaa
ucaguguucuuggggg hsa-miR-29b mature miRNA: (SEQ ID NO. 81)
uagcaccauuugaaaucaguguu hsa-mir-125b-1 pre-miRNA precursor: (SEQ ID
NO. 82)
ugcgcuccucucagucccugagacccuaacuugugauguuuaccguuuaaauccacggguuaggcu
cuugggagcugcgagucgugcu hsa-miR-125b mature miRNA: (SEQ ID NO. 83)
ucccugagacccuaacuuguga hsa-mir-125a pre-miRNA precursor: (SEQ ID
NO. 84)
ugccagucucuaggucccugagacccuuuaaccugugaggacauccagggucacaggugagguucu
ugggagccuggcgucuggcc hsa-miR-125a mature miRNA: (SEQ ID NO. 85)
ucccugagacccuuuaaccugug hsa-mir-125b-2 pre-miRNA precursor: (SEQ ID
NO. 86)
accagacuuuuccuagucccugagacccuaacuugugagguauuuuaguaacaucacaagucaggc
ucuugggaccuaggcggagggga hsa-miR-125b mature miRNA: (SEQ ID NO. 87)
ucccugagacccuaacuuguga hsa-mir-15a pre-miRNA precursor: (SEQ ID NO.
88)
ccuuggaguaaaguagcagcacauaaugguuuguggauuuugaaaaggugcaggccauauugugc
ugccucaaaaauacaagg hsa-miR-15a mature miRNA: (SEQ ID NO. 89)
uagcagcacauaaugguuugug hsa-mir-126 pre-miRNA precursor: (SEQ ID NO.
90)
cgcuggcgacgggacauuauuacuuuugguacgcgcugugacacuucaaacucguaccgugaguaa
uaaugcgccguccacggca hsa-miR-126* mature miRNA: (SEQ ID NO. 91)
cauuauuacuuuugguacgcg hsa-miR-126 mature miRNA: (SEQ ID NO. 92)
ucguaccgugaguaauaaugc hsa-mir-188 pre-miRNA precursor: (SEQ ID NO.
93) ugcucccucucucacaucccuugcaugguggagggugagcuuucugaaaaccccucccac
augcaggguuugcaggauggcgagcc hsa-miR-188 mature miRNA: (SEQ ID NO.
94) caucccuugcaugguggagggu hsa-mir-331 pre-miRNA precursor: (SEQ ID
NO. 95)
gaguuugguuuuguuuggguuuguucuagguauggucccagggaucccagaucaaaccag
gccccugggccuauccuagaaccaaccuaagcuc hsa-miR-331 mature miRNA: (SEQ
ID NO. 96) gccccugggccuauccuagaa hsa-mir-155 pre-miRNA precursor:
(SEQ ID NO. 97)
cuguuaaugcuaaucgugauagggguuuuugccuccaacugacuccuacauauuagcauu aacag
hsa-miR-155 mature miRNA: (SEQ ID NO. 98)
uuaaugcuaaucgugauagggg
[0092] An example of a microRNA that is associated with the
regulation of insulin secretion is hsa-miR-375:
TABLE-US-00002 hsa-mir-375 pre-miRNA precursor: (SEQ ID NO. 160)
ccccgcgacgagccccucgcacaaaccggaccugagcguuuuguucguucggcucgcgugaggc
hsa-miR-375 mature miRNA: (SEQ ID NO. 161)
uuuguucguucggcucgcguga
[0093] Based on experiments in mice, hsa-miR-181b-1 is likely to be
involved in haemopoiesis (B lineage cell differentiation):
TABLE-US-00003 hsa-mir-181b-1 pre-miRNA precursor: (SEQ ID NO. 162)
ccugugcagagauuauuuuuuaaaaggucacaaucaacauucauugcugucgguggguugaacug
uguggacaagcucacugaacaaugaaugcaacuguggccccgcuu hsa-miR-181b mature
miRNA: (SEQ ID NO. 163) aacauucauugcugucgguggg hsa-mir-124a-3
pre-miRNA precursor: (SEQ ID NO. 166)
UGAGGGCCCCUCUGCGUGUUCACAGCGGACCUUGAUUUAAUGUCUAUAC
AAUUAAGGCACGCGGUGAAUGCCAAGAGAGGCGCCUCC hsa-miR-124a mature miRNA:
(SEQ ID NO. 167) UUAAGGCACGCGGUGAAUGCCA hsa-mir-9-2 pre-miRNA
precursor: (SEQ ID NO. 168)
GGAAGCGAGUUGUUAUCUUUGGUUAUCUAGCUGUAUGAGUGUAUUGGUC
UUCAUAAAGCUAGAUAACCGAAAGUAAAAACUCCUUCA hsa-miR-9 mature miRNA: (SEQ
ID NO. 169) UCUUUGGUUAUCUAGCUGUAUGA
[0094] The present invention also provides orthologues of the above
human miRNAs, which may identified by method known in the art. A
database of miRNAs is found at the miRBase registry
(http://microrna.sanger.ac.uk/sequences/).
[0095] Thus, the present invention specifically provides in its
various forms the following microRNAs: hsa-let-7a-1, hsa-let-7a-2,
hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7f, hsa-miR-10b,
hsa-miR-15a, hsa-miR-15b, hsa-miR-16, hsa-miR-19b mature miRNA,
hsa-miR-20, hsa-miR-21, hsa-miR-22, hsa-miR-23a, hsa-miR-24,
hsa-miR-189, hsa-miR-24, hsa-miR-26, hsa-miR-26b, hsa-miR-26a,
hsa-miR-27b, hsa-miR-29a, hsa-miR-30a-3p, hsa-miR-141,
hsa-miR-142-5p, hsa-miR-142-3p, hsa-miR-143, hsa-miR-145,
hsa-miR-192, hsa-miR-194, hsa-miR-199b, hsa-miR-200b, hsa-miR-200c,
hsa-miR-320, hsa-miR-321, hsa-miR-30a-3p, hsa-miR-30a-5p,
hsa-miR-29b, hsa-miR-125b, hsa-miR-125a, hsa-miR-125b,
hsa-miR-126*, hsa-miR-126, hsa-miR-188, hsa-miR-331, hsa-miR-155,
hsa-miR-181b-1, hsa-miR-124a, hsa-miR-9 and corresponding
orthologues from other species.
[0096] Methods for identifying a corresponding orthologue are known
in the art, such as Weber M J. (2005) New human and mouse microRNA
genes found by homology search. FEBS J. 272(1):59-73.
[0097] As described previously, miRNAs are small RNA molecules
endogenously encoded in the genome of many species that regulate
gene expression by binding to specific mRNAs. miRNAs are formed
from larger transcripts that fold to produce hairpin structures and
serve as substrates for the Dicer family of RNase III enzymes. The
products of Dicer cleavage are short dsRNA molecules, one strand of
which is retained in a ribonucleoprotein complex called the
RNA-induced silencing complex (RISC). The retained RNA acts as a
guide to direct this complex to a target site in the mRNA which is
then inactivated either by cleavage or translational interference,
depending on the degree of complementarity between the miRNA and
its target site.
[0098] Accordingly, the modulation of the development of a cell in
the various forms of the present invention may be by way of
cleavage (or lack of cleavage) of the nucleic acid with the
capacity to modulate the development of the cell, and/or by way of
translational interference (or lack of translational interference)
of the nucleic acid with the capacity to modulate the development
of the cell.
[0099] The target site in the various forms of the present
invention may be a nucleotide sequence that has exact
complementarity to the miRNA, or alternatively, be a target site
with a reduced degree of complementarity. Methods for determining
the extent of complementarity required for binding of a miRNA (so
as to cleave the target or translationally interfere with the
target) are known in the art, for example Lewis B P, Burge CB,
Bartel D P., (2005) Conserved seed pairing, often flanked by
adenosines, indicates that thousands of human genes are microRNA
targets. Cell 120(1):15-20 and Saetrom O, Snove O Jr, Saetrom P.,
(2005) Weighted sequence motifs as an improved seeding step in
microRNA target prediction algorithms. RNA 11(7):995-1003.
[0100] The target site may be a natural target site or a
non-naturally occurring target site. In the case of a target site
occurring in a gene, it will be appreciated that the target site
may be introduced into the nucleic acid with one or more addition
nucleotides from the gene. For example, the target site may be
introduced by way of using the entire 3'UTR of a gene having a
suitable target site in that untranslated region of the mRNA.
[0101] The ability of a miRNA to bind to a target site and cleave
the mRNA and/or interfere with translation may be confirmed
experimentally by a suitable method known in the art. For example,
the psiCHECK.TM.2 Luciferase assay system (Promega) can be used to
determine miRNA activity both in vitro and in vivo. Northern blot
and RT-PCR analyses can also be used to determine cleavage of a
target transcript, while Western blot analysis will detect reduced
translation of encoded proteins.
[0102] In the case of the miRNAs discussed previously herein,
complementary target sites for the binding of the miRNAs are as
follows (5' to 3'):
TABLE-US-00004 hsa-let-7 mature miRNA target site:
AACUAUACAACCUACUACCUCA (SEQ ID NO. 99) hsa-let-7a mature miRNA
target site: AACUAUACAACCUACUACCUCA (SEQ ID NO. 100) hsa-let-7a
mature miRNA target site: AACUAUACAACCUACUACCUCA (SEQ ID NO. 101)
hsa-let-7b mature miRNA target site: AACCACACAACCUACUACCUCA (SEQ ID
NO. 102) hsa-let-7c mature miRNA target site:
AACCAUACAACCUACUACCUCA (SEQ ID NO. 103) hsa-let-7f mature miRNA
target site: AACUAUACAAUCUACUACCUCA (SEQ ID NO. 104) hsa-let-7f
mature miRNA target site: AACUAUACAAUCUACUACCUCA (SEQ ID NO. 105)
hsa-miR-10b mature miRNA target site: ACAAAUUCGGUUCUACAGGGUA (SEQ
ID NO. 106) hsa-miR-15b mature miRNA target site:
UGUAAACCAUGAUGUGCUGCUA (SEQ ID NO. 107) hsa-miR-16 mature miRNA
target site: CGCCAAUAUUUACGUGCUGCUA (SEQ ID NO. 108) hsa-miR-16
mature miRNA target site: CGCCAAUAUUUACGUGCUGCUA (SEQ ID NO. 109)
hsa-miR-19b mature miRNA target site: UCAGUUUUGCAUGGAUUUGCACA (SEQ
ID NO. 110) hsa-miR-19b mature miRNA target site:
UCAGUUUUGCAUGGAUUUGCACA (SEQ ID NO. 111) hsa-miR-20 mature miRNA
target site: CUACCUGCACUAUAAGCACUUUA (SEQ ID NO. 112) hsa-miR-21
mature miRNA target site: UCAACAUCAGUCUGAUAAGCUA (SEQ ID NO. 113)
hsa-miR-22 mature miRNA target site: ACAGUUCUUCAACUGGCAGCUU (SEQ ID
NO. 114) hsa-miR-23a mature miRNA target site:
GGAAAUCCCUGGCAAUGUGAU (SEQ ID NO. 115) hsa-miR-24 mature miRNA
target site: CUGUUCCUGCUGAACUGAGCCA (SEQ ID NO. 116) hsa-miR-189
mature miRNA target site: ACUGAUAUCAGCUCAGUAGGCAC (SEQ ID NO. 117)
hsa-miR-24 mature miRNA target site: CUGUUCCUGCUGAACUGAGCCA (SEQ ID
NO. 118) hsa-miR-26 mature miRNA target site:
GCCUAUCCUGGAUUACUUGAAU (SEQ ID NO. 119) hsa-miR-26b mature miRNA
target site: AACCUAUCCUGAAUUACUUGAA (SEQ ID NO. 120) hsa-miR-26a
mature miRNA target site: GCCUAUCCUGGAUUACUUGAA (SEQ ID NO. 121)
hsa-miR-27b mature miRNA target site: GCAGAACUUAGCCACUGUGAA (SEQ ID
NO. 122) hsa-miR-29a mature miRNA target site:
AACCGAUUUCAGAUGGUGCUA (SEQ ID NO. 123) hsa-miR-30a-3p mature miRNA
target site: GCUGCAAACAUCCGACUGAAAG (SEQ ID NO. 124) hsa-miR-30a-5p
mature miRNA target site: CUUCCAGUCGAGGAUGUUUACA (SEQ ID NO. 125)
hsa-miR-141 mature miRNA target site: CCAUCUUUACCAGACAGUGUUA (SEQ
ID NO. 126) hsa-miR-142-5p mature miRNA target site:
GUAGUGCUUUCUACUUUAUG (SEQ ID NO. 127) hsa-miR-142-3p mature miRNA:
UCCAUAAAGUAGGAAACACUACA (SEQ ID NO. 128) hsa-miR-143 mature miRNA
target site: UGAGCUACAGUGCUUCAUCUCA (SEQ ID NO. 129) hsa-miR-145
mature miRNA target site: AAGGGAUUCCUGGGAAAACUGGAC (SEQ ID NO. 130)
hsa-miR-192 mature miRNA target site: GGCUGUCAAUUCAUAGGUCAG (SEQ ID
NO. 131) hsa-miR-194 mature miRNA target site:
UCCACAUGGAGUUGCUGUUACA (SEQ ID NO. 132) hsa-miR-194 mature miRNA
target site: UCCACAUGGAGUUGCUGUUACA (SEQ ID NO. 133) hsa-miR-199b
mature miRNA target site: GAACAGAUAGUCUAAACACUGGG (SEQ ID NO. 134)
hsa-miR-200b mature miRNA target site: GUCAUCAUUACCAGGCAGUAUUA (SEQ
ID NO. 135) hsa-miR-200c mature miRNA target site:
CCAUCAUUACCCGGCAGUAUUA (SEQ ID NO. 136) hsa-miR-320 mature miRNA
target site: UUCGCCCUCUCAACCCAGCUUUU (SEQ ID NO. 137) hsa-miR-321
mature miRNA target site: GAACCCACAAUCCCUGGCUUA (SEQ ID NO. 138)
hsa-miR-30a-3p mature miRNA target site: GCUGCAAACAUCCGACUGAAAG
(SEQ ID NO. 139) hsa-miR-30a-5p mature miRNA target site:
CUUCCAGUCGAGGAUGUUUACA (SEQ ID NO. 140) hsa-miR-29b mature miRNA
target site: AACACUGAUUUCAAAUGGUGCUA (SEQ ID NO. 141) hsa-miR-125b
mature miRNA target site: UCACAAGUUAGGGUCUCAGGGA (SEQ ID NO. 142)
hsa-miR-125a mature miRNA target site: CACAGGUUAAAGGGUCUCAGGGA (SEQ
ID NO. 143) hsa-miR-125b mature miRNA target site:
UCACAAGUUAGGGUCUCAGGGA (SEQ ID NO. 144) hsa-miR-15a mature miRNA
target site: CACAAACCAUUAUGUGCUGCUA (SEQ ID NO. 145) hsa-miR-126*
mature miRNA target site: CGCGUACCAAAAGUAAUAAUG (SEQ ID NO. 146)
hsa-miR-126 mature miRNA target site: GCAUUAUUACUCACGGUACGA (SEQ ID
NO. 147) hsa-miR-188 mature miRNA target site:
ACCCUCCACCAUGCAAGGGAUG (SEQ ID NO. 148) hsa-miR-331 mature miRNA
target site: UUCUAGGAUAGGCCCAGGGGC (SEQ ID NO. 149) hsa-miR-155
mature miRNA target site: CCCCUAUCACGAUUAGCAUUAA (SEQ ID NO. 150)
hsa-miR-375 mature miRNA target site: UCACGCGAGCCGAACGAACAAA (SEQ
ID NO. 164) hsa-miR-181b mature miRNA target site:
CCCACCGACAGCAAUGAAUGUU (SEQ ID NO. 165) hsa-miR-124a mature miRNA
target site: UGGCAUUCACCGCGUGCCUUAA (SEQ ID NO. 170) hsa-miR-9
mature miRNA target site: UCAUACAGCUAGAUAACCAAAGA (SEQ ID NO.
171)
[0103] In the case of the nucleic acid molecule being a DNA, a
person skilled in the art will appreciate that the above target
sequences will have the U bases substituted for T bases.
[0104] The target site for binding of a microRNA in the various
forms of the present invention may be a non-naturally occurring
binding site for the particular miRNA, or alternatively, may be a
target site present in a naturally occurring gene or mRNA, such as
a target site found in the 3'UTR of a gene. In this regard,
naturally and non-naturally occurring targets for a microRNA may be
identified as described in Krek et al. (2005) Nature Genetics
37(5): 495-500.
[0105] For example, in the case of the miR-143 miRNA, Table 1
provides a listing of human mRNAs predicted to contain target sites
for hsa-miR-143, using the method as described in Krek et al.
(2005) Nature Genetics 37(5): 495-500, using default
parameters.
TABLE-US-00005 TABLE 1 human Refseq PicTar Rank Id score annotation
1 NM_138962 8.75 Homo sapiens musashi homolog 2 (Drosophila)
(MSI2), transcript variant 1, mRNA. 2 NM_033389 6.92 Homo sapiens
slingshot homolog 2 (Drosophila) (SSH2), mRNA. 3 NM_004720 6.71
Homo sapiens endothelial differentiation, lysophosphatidic acid
G-protein-coupled receptor, 4 (EDG4), mRNA. 4 NM_203445 6.71 Homo
sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 9
(ABCB9), transcript variant 3, mRNA. 5 NM_004738 6.67 Homo sapiens
VAMP (vesicle-associated membrane protein)-associated protein B and
C (VAPB), mRNA. 6 NM_006517 6.47 Homo sapiens solute carrier family
16 (monocarboxylic acid transporters), member 2 (SLC16A2), mRNA. 7
NM_005104 6.27 Homo sapiens bromodomain containing 2 (BRD2), mRNA.
8 NM_198452 6.23 Homo sapiens pregnancy upregulated
non-ubiquitously expressed CaM kinase (PNCK), mRNA. 9 NM_015575
5.42 Homo sapiens trinucleotide repeat containing 15 (TNRC15) mRNA.
10 NM_005644 5.26 Homo sapiens TAF12 RNA polymerase II, TATA box
binding protein (TBP)-associated factor, 20 kDa (TAF12), mRNA. 11
NM_004985 5.1 Homo sapiens v-Ki-ras2 Kirsten rat sarcoma 2 viral
oncogene homolog (KRAS2), transcript variant b, mRNA. 12 NM_033360
5.1 Homo sapiens v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene
homolog (KRAS2), transcript variant a, mRNA. 13 NM_007306 5.06 Homo
sapiens breast cancer 1, early onset (BRCA1), transcript variant
BRCA1-exon4, mRNA. 14 NM_144633 5.05 Homo sapiens potassium
voltage-gated channel, subfamily H (eag-related), member 8 (KCNH8),
mRNA. 15 NM_153649 4.98 Homo sapiens tropomyosin 3 (TPM3), mRNA. 16
NM_004798 4.78 Homo sapiens kinesin family member 3B (KIF3B), mRNA.
17 NM_021907 4.69 Homo sapiens dystrobrevin, beta (DTNB),
transcript variant 1, mRNA. 18 NM_183360 4.69 Homo sapiens
dystrobrevin, beta (DTNB), transcript variant 4, mRNA. 19 NM_033148
4.69 Homo sapiens dystrobrevin, beta (DTNB), transcript variant 3,
mRNA. 20 NM_183361 4.69 Homo sapiens dystrobrevin, beta (DTNB),
transcript variant 5, mRNA. 21 NM_033147 4.69 Homo sapiens
dystrobrevin, beta (DTNB), transcript variant 2, mRNA. 22 NM_014112
4.56 Homo sapiens trichorhinophalangeal syndrome I (TRPS1), mRNA.
23 NM_014502 4.51 Homo sapiens PRP19/PSO4 homolog (S. cerevisiae)
(PRP19), mRNA. 24 NM_004210 4.48 Homo sapiens neuralized-like
(Drosophila) (NEURL), mRNA. 25 NM_003284 4.46 Homo sapiens
transition protein 1 (during histone to protamine replacement)
(TNP1), mRNA. 26 NM_001282 4.42 Homo sapiens adaptor-related
protein complex 2, beta 1 subunit (AP2B1), mRNA. 27 NM_007200 4.41
Homo sapiens A kinase (PRKA) anchor protein 13 (AKAP13), transcript
variant 2, mRNA. 28 NM_144767 4.41 Homo sapiens A kinase (PRKA)
anchor protein 13 (AKAP13), transcript variant 3, mRNA. 29
NM_006738 4.41 Homo sapiens A kinase (PRKA) anchor protein 13
(AKAP13), transcript variant 1, mRNA. 30 NM_182901 4.29 Homo
sapiens chromosome 11 open reading frame 17 (C11orf17), transcript
variant 1, mRNA. 31 NM_016018 4.27 Homo sapiens CGI-72 protein
(CGI-72), transcript variant 1, mRNA. 32 NM_018013 4.23 Homo
sapiens hypothetical protein FLJ10159 (FLJ10159), mRNA. 33
NM_006302 4.23 Homo sapiens glucosidase I (GCS1), mRNA. 34
NM_024915 4.17 Homo sapiens transcription factor CP2-like 3
(TFCP2L3), mRNA. 35 NM_000168 4.13 Homo sapiens GLI-Kruppel family
member GLI3 (Greig cephalopolysyndactyly syndrome) (GLI3), mRNA. 36
NM_014450 3.99 Homo sapiens SHP2-interacting transmembrane adaptor
protein (SIT), mRNA. 37 NM_014346 3.95 Homo sapiens chromosome 22
open reading frame 4 (C22orf4), mRNA. 38 NM_000633 3.86 Homo
sapiens B-cell CLL/lymphoma 2 (BCL2), nuclear gene encoding
mitochondrial protein, transcript variant alpha, mRNA. 39 NM_002314
3.86 Homo sapiens LIM domain kinase 1 (LIMK1), transcript variant
1, mRNA. 40 NM_173478 3.84 Homo sapiens hypothetical protein
FLJ40137 (FLJ40137), mRNA. 41 NM_030952 3.84 Homo sapiens likely
ortholog of rat SNF1/AMP-activated protein kinase (SNARK), mRNA. 42
NM_018579 3.8 Homo sapiens mitochondrial solute carrier protein
(MSCP), mRNA. 43 NM_004089 3.75 Homo sapiens delta sleep inducing
peptide, immunoreactor (DSIPI), transcript variant 2, mRNA. 44
NM_198057 3.75 Homo sapiens delta sleep inducing peptide,
immunoreactor (DSIPI), transcript variant 1, mRNA. 45 NM_002830
3.72 Homo sapiens protein tyrosine phosphatase, non-receptor type 4
(megakaryocyte) (PTPN4), mRNA. 46 NM_006206 3.68 Homo sapiens
platelet-derived growth factor receptor, alpha polypeptide
(PDGFRA), mRNA. 47 NM_033004 3.64 Homo sapiens NACHT, leucine rich
repeat and PYD (pyrin domain) containing 1 (NALP1), transcript
variant 1, mRNA. 48 NM_033007 3.64 Homo sapiens NACHT, leucine rich
repeat and PYD (pyrin domain) containing 1 (NALP1), transcript
variant 4, mRNA. 49 NM_001987 3.64 Homo sapiens ets variant gene 6
(TEL oncogene) (ETV6), mRNA. 50 NM_033006 3.64 Homo sapiens NACHT,
leucine rich repeat and PYD (pyrin domain) containing 1 (NALP1),
transcript variant 3, mRNA. 51 NM_014922 3.64 Homo sapiens NACHT,
leucine rich repeat and PYD (pyrin domain) containing 1 (NALP1),
transcript variant 2, mRNA. 52 NM_018398 3.63 Homo sapiens calcium
channel, voltage-dependent, alpha 2/delta 3 subunit (CACNA2D3),
mRNA. 53 NM_147159 3.6 Homo sapiens opioid receptor, sigma 1
(OPRS1), transcript variant 4, mRNA. 54 NM_000920 3.6 Homo sapiens
pyruvate carboxylase (PC), nuclear gene encoding mitochondrial
protein, transcript variant A, mRNA. 55 NM_022172 3.6 Homo sapiens
pyruvate carboxylase (PC), nuclear gene encoding mitochondrial
protein, transcript variant 2, mRNA. 56 NM_005139 3.54 Homo sapiens
annexin A3 (ANXA3), mRNA. 57 NM_152933 3.49 Homo sapiens protein
phosphatase, EF hand calcium- binding domain 2 (PPEF2), transcript
variant 2, mRNA. 58 NM_020665 3.45 Homo sapiens transmembrane
protein 27 (TMEM27), mRNA. 59 NM_015513 3.44 Homo sapiens
cysteine-rich with EGF-like domains 1 (CRELD1), mRNA. 60 NM_006357
3.41 Homo sapiens ubiquitin-conjugating enzyme E2E 3 (UBC4/5
homolog, yeast) (UBE2E3), transcript variant 1, mRNA. 61 NM_182678
3.41 Homo sapiens ubiquitin-conjugating enzyme E2E 3 (UBC4/5
homolog, yeast) (UBE2E3), transcript variant 2, mRNA. 62 NM_138731
3.4 Homo sapiens mirror-image polydactyly 1 (MIPOL1), mRNA. 63
NM_052953 3.39 Homo sapiens leucine rich repeat containing 3B
(LRRC3B), mRNA. 64 NM_017896 3.39 Homo sapiens chromosome 20 open
reading frame 11 (C20orf11), mRNA. 65 NM_152410 3.39 Homo sapiens
PARK2 co-regulated (PACRG), mRNA. 66 NM_014892 3.36 Homo sapiens
RNA binding motif protein 16 (RBM16), mRNA. 67 NM_015516 3.36 Homo
sapiens likely ortholog of chicken tsukushi (TSK), mRNA. 68
NM_017699 3.35 Homo sapiens SID1 transmembrane family, member 1
(SIDT1), mRNA. 69 NM_144709 3.35 Homo sapiens hypothetical protein
FLJ32312 (FLJ32312), mRNA. 70 NM_015509 3.32 Homo sapiens
DKFZP566B183 protein (DKFZP566B183), mRNA. 71 NM_022822 3.28 Homo
sapiens likely ortholog of kinesin light chain 2 (KLC2), mRNA. 72
NM_182579 3.25 Homo sapiens hypothetical protein FLJ40343
(FLJ40343), mRNA. 73 NM_079834 3.21 Homo sapiens secretory carrier
membrane protein 4 (SCAMP4), mRNA. 74 NM_021120 3.18 Homo sapiens
discs, large homolog 3 (neuroendocrine-dlg, Drosophila) (DLG3),
mRNA. 75 NM_198261 3.15 Homo sapiens similar to splicing factor,
arginine/serine-rich 4 (FLJ11021), transcript variant 2, mRNA. 76
NM_198263 3.15 n/a 77 NM_023012 3.15 Homo sapiens similar to
splicing factor, arginine/serine-rich 4 (FLJ11021), transcript
variant 1, mRNA. 78 NM_198262 3.15 Homo sapiens similar to splicing
factor, arginine/serine-rich 4 (FLJ11021), transcript variant 3,
mRNA. 79 NM_018036 3.15 Homo sapiens chromosome 14 open reading
frame 103 (C14orf103), mRNA. 80 NM_003188 3.14 Homo sapiens
mitogen-activated protein kinase kinase kinase 7 (MAP3K7),
transcript variant A, mRNA. 81 NM_145331 3.14 Homo sapiens
mitogen-activated protein kinase kinase kinase 7 (MAP3K7),
transcript variant B, mRNA. 82 NM_001795 3.12 Homo sapiens cadherin
5, type 2, VE-cadherin (vascular epithelium) (CDH5), mRNA. 83
NM_024490 3.12 Homo sapiens ATPase, Class V, type 10A (ATP10A),
mRNA. 84 NM_019102 3.08 Homo sapiens homeo box A5 (HOXA5), mRNA. 85
NM_007375 3.06 Homo sapiens TAR DNA binding protein (TARDBP), mRNA.
86 NM_006769 3.04 Homo sapiens LIM domain only 4 (LMO4), mRNA. 87
NM_014603 2.99 Homo sapiens paraneoplastic antigen (HUMPPA), mRNA.
88 NM_031913 2.98 Homo sapiens chr3 synaptotagmin (CHR3SYT), mRNA.
89 NM_014399 2.97 Homo sapiens transmembrane 4 superfamily member
13 (TM4SF13), mRNA. 90 NM_005369 2.96 Homo sapiens MCF.2 cell line
derived transforming sequence (MCF2), mRNA. 91 NM_021999 2.92 Homo
sapiens integral membrane protein 2B (ITM2B), mRNA. 92 NM_144776
2.88 Homo sapiens formyltetrahydrofolate dehydrogenase (FTHFD),
transcript variant 2, mRNA. 93 NM_001901 2.88 Homo sapiens
connective tissue growth factor (CTGF), mRNA. 94 NM_004637 2.87
Homo sapiens RAB7, member RAS oncogene family (RAB7), mRNA. 95
NM_000210 2.86 Homo sapiens integrin, alpha 6 (ITGA6), mRNA. 96
NM_014939 2.85 Homo sapiens KIAA1012 (KIAA1012), mRNA. 97 NM_138717
2.83 Homo sapiens palmitoyl-protein thioesterase 2 (PPT2),
transcript variant 2, mRNA. 98 NM_152934 2.83 Homo sapiens protein
phosphatase, EF hand calcium- binding domain 2 (PPEF2), transcript
variant 3, mRNA. 99 NM_145333 2.83 Homo sapiens mitogen-activated
protein kinase kinase kinase 7 (MAP3K7), transcript variant D,
mRNA. 100 NM_145332 2.83 Homo sapiens mitogen-activated protein
kinase kinase kinase 7 (MAP3K7), transcript variant C, mRNA. 101
NM_005155 2.82 Homo sapiens palmitoyl-protein thioesterase 2
(PPT2), transcript variant 1, mRNA. 102 NM_001001330 2.81 Homo
sapiens chromosome 10 open reading frame 74 (C10orf74), mRNA. 103
NM_206909 2.8 Homo sapiens pleckstrin and Sec7 domain containing 3
(PSD3), transcript variant 2, mRNA. 104 NM_178450 2.8 Homo sapiens
membrane-associated RING-CH protein III (MARCH-III), mRNA. 105
NM_016626 2.76 Homo sapiens ring finger and KH domain containing 2
(RKHD2), mRNA. 106 NM_005584 2.73 Homo sapiens mab-21-like 1 (C.
elegans) (MAB21L1), mRNA. 107 NM_022051 2.72 Homo sapiens egl nine
homolog 1 (C. elegans) (EGLN1), mRNA. 108 NM_006621 2.72 Homo
sapiens S-adenosylhomocysteine hydrolase-like 1 (AHCYL1), mRNA. 109
NM_003077 2.72 Homo sapiens SWI/SNF related, matrix associated,
actin dependent regulator of chromatin, subfamily d, member 2
(SMARCD2), mRNA. 110 NM_005668 2.72 Homo sapiens sialyltransferase
8D (alpha-2,8- polysialyltransferase) (SIAT8D), transcript variant
1, mRNA. 111 NM_019903 2.68 Homo sapiens adducin 3 (gamma) (ADD3),
transcript variant 2, mRNA. 112 NM_032975 2.68 Homo sapiens
dystrobrevin, alpha (DTNA), transcript variant 2, mRNA. 113
NM_001390 2.68 Homo sapiens dystrobrevin, alpha (DTNA), transcript
variant 1, mRNA. 114 NM_032980 2.68 Homo sapiens dystrobrevin,
alpha (DTNA), transcript variant 6, mRNA. 115 NM_016824 2.68 Homo
sapiens adducin 3 (gamma) (ADD3), transcript variant 1, mRNA. 116
NM_000291 2.68 Homo sapiens phosphoglycerate kinase 1 (PGK1), mRNA.
117 NM_153184 2.67 Homo sapiens immunoglobulin superfamily, member
4D (IGSF4D), mRNA.
118 NM_004384 2.67 Homo sapiens casein kinase 1, gamma 3 (CSNK1G3),
mRNA. 119 NM_022552 2.65 Homo sapiens DNA
(cytosine-5-)-methyltransferase 3 alpha (DNMT3A), transcript
variant 3, mRNA. 120 NM_175629 2.65 Homo sapiens DNA
(cytosine-5-)-methyltransferase 3 alpha (DNMT3A), transcript
variant 1, mRNA. 121 NM_153759 2.65 Homo sapiens DNA
(cytosine-5-)-methyltransferase 3 alpha (DNMT3A), transcript
variant 2, mRNA. 122 NM_178835 2.62 Homo sapiens hypothetical
protein LOC152485 (LOC152485), mRNA. 123 NM_004999 2.61 Homo
sapiens myosin VI (MYO6), mRNA. 124 NM_002222 2.6 Homo sapiens
inositol 1,4,5-triphosphate receptor, type 1 (ITPR1), mRNA. 125
NM_015719 2.59 Homo sapiens collagen, type V, alpha 3 (COL5A3),
mRNA. 126 NM_013316 2.57 Homo sapiens CCR4-NOT transcription
complex, subunit 4 (CNOT4), mRNA. 127 NM_001094 2.57 Homo sapiens
amiloride-sensitive cation channel 1, neuronal (degenerin) (ACCN1),
transcript variant 2, mRNA. 128 NM_031412 2.57 Homo sapiens GABA(A)
receptor-associated protein like 1 (GABARAPL1), mRNA. 129 NM_183377
2.57 Homo sapiens amiloride-sensitive cation channel 1, neuronal
(degenerin) (ACCN1), transcript variant 1, mRNA. 130 NM_014614 2.53
Homo sapiens proteasome (prosome, macropain) activator subunit 4
(PSME4), mRNA. 131 NM_005871 2.51 Homo sapiens survival motor
neuron domain containing 1 (SMNDC1), mRNA. 132 NM_003744 2.49 Homo
sapiens numb homolog (Drosophila) (NUMB), transcript variant 3,
mRNA. 133 NM_001005745 2.49 Homo sapiens numb homolog (Drosophila)
(NUMB), transcript variant 4, mRNA. 134 NM_001005744 2.49 Homo
sapiens numb homolog (Drosophila) (NUMB), transcript variant 2,
mRNA. 135 NM_001005743 2.49 Homo sapiens numb homolog (Drosophila)
(NUMB), transcript variant 1, mRNA. 136 NM_004274 2.48 Homo sapiens
A kinase (PRKA) anchor protein 6 (AKAP6), mRNA. 137 NM_003489 2.47
Homo sapiens nuclear receptor interacting protein 1 (NRIP1), mRNA.
138 NM_017903 2.47 Homo sapiens hypothetical protein FLJ20618
(FLJ20618), mRNA. 139 NM_156036 2.47 Homo sapiens homeo box B6
(HOXB6), transcript variant 3, mRNA. 140 NM_002356 2.46 Homo
sapiens myristoylated alanine-rich protein kinase C substrate
(MARCKS), mRNA. 141 NM_004768 2.46 Homo sapiens splicing factor,
arginine/serine-rich 11 (SFRS11), mRNA. 142 NM_145734 2.45 Homo
sapiens septin 3 (SEPT3), transcript variant C, mRNA. 143 NM_001331
2.45 Homo sapiens catenin (cadherin-associated protein), delta 1
(CTNND1), mRNA. 144 NM_030571 2.43 Homo sapiens Nedd4 family
interacting protein 1 (NDFIP1), mRNA. 145 NM_004059 2.41 Homo
sapiens cysteine conjugate-beta lyase; cytoplasmic (glutamine
transaminase K, kyneurenine aminotransferase) (CCBL1), mRNA. 146
NM_080670 2.41 Homo sapiens solute carrier family 35, member A4
(SLC35A4), mRNA. 147 NM_052822 2.38 Homo sapiens secretory carrier
membrane protein 1 (SCAMP1), transcript variant 2, mRNA. 148
NM_030802 2.38 Homo sapiens C/EBP-induced protein (LOC81558), mRNA.
149 NM_080417 2.37 Homo sapiens peanut-like 2 (Drosophila)
(PNUTL2), transcript variant 4, mRNA. 150 NM_032458 2.36 Homo
sapiens PHD finger protein 6 (PHF6), mRNA. 151 NM_006148 2.35 Homo
sapiens LIM and SH3 protein 1 (LASP1), mRNA. 152 NM_024994 2.35
Homo sapiens hypothetical protein FLJ12595 (FLJ12595), mRNA. 153
NM_013437 2.34 Homo sapiens low density lipoprotein-related protein
12 (LRP12), mRNA. 154 NM_020925 2.33 Homo sapiens KIAA1573 protein
(KIAA1573), mRNA. 155 NM_138799 2.32 Homo sapiens O-acyltransferase
(membrane bound) domain containing 2 (OACT2), mRNA. 156 NM_017623
2.28 Homo sapiens cyclin M3 (CNNM3), transcript variant 1, mRNA.
157 NM_199078 2.28 Homo sapiens cyclin M3 (CNNM3), transcript
variant 2, mRNA. 158 NM_014424 2.28 Homo sapiens heat shock 27 kDa
protein family, member 7 (cardiovascular) (HSPB7), mRNA. 159
NM_000599 2.27 Homo sapiens insulin-like growth factor binding
protein 5 (IGFBP5), mRNA. 160 NM_021212 2.25 Homo sapiens
HCF-binding transcription factor Zhangfei (ZF), mRNA. 161 NM_005110
2.24 Homo sapiens glutamine-fructose-6-phosphate transaminase 2
(GFPT2), mRNA. 162 NM_022780 2.24 Homo sapiens hypothetical protein
FLJ13910 (FLJ13910), mRNA. 163 NM_014574 2.23 Homo sapiens
striatin, calmodulin binding protein 3 (STRN3), mRNA. 164 NM_153020
2.21 Homo sapiens RNA binding motif protein 24 (RBM24), mRNA. 165
NM_032221 2.2 Homo sapiens chromodomain helicase DNA binding
protein 6 (CHD6), mRNA. 166 NM_004080 2.19 Homo sapiens
diacylglycerol kinase, beta 90 kDa (DGKB), transcript variant 1,
mRNA. 167 NM_000800 2.19 Homo sapiens fibroblast growth factor 1
(acidic) (FGF1), transcript variant 1, mRNA. 168 NM_000963 2.18
Homo sapiens prostaglandin-endoperoxide synthase 2 (prostaglandin
G/H synthase and cyclooxygenase) (PTGS2), mRNA. 169 NM_003413 2.16
Homo sapiens Zic family member 3 heterotaxy 1 (odd-paired homolog,
Drosophila) (ZIC3), mRNA. 170 NM_199182 2.1 Homo sapiens hLAT1-3TM
(IMAA), mRNA. 171 NM_033137 2.09 Homo sapiens fibroblast growth
factor 1 (acidic) (FGF1), transcript variant 3, mRNA. 172 NM_033136
2.09 Homo sapiens fibroblast growth factor 1 (acidic) (FGF1),
transcript variant 2, mRNA. 173 NM_004132 2.08 Homo sapiens
hyaluronan binding protein 2 (HABP2), mRNA. 174 NM_173557 2.05 Homo
sapiens ring finger protein 152 (RNF152), mRNA. 175 NM_014906 2.04
Homo sapiens protein phosphatase 1E (PP2C domain containing)
(PPM1E), mRNA. 176 NM_032010 2.02 Homo sapiens
microtubule-associated protein 1B (MAP1B), transcript variant 2,
mRNA. 177 NM_005909 2.02 Homo sapiens microtubule-associated
protein 1B (MAP1B), transcript variant 1, mRNA. 178 NM_020432 2.02
Homo sapiens putative homeodomain transcription factor 2 (PHTF2),
mRNA. 179 NM_018712 2 Homo sapiens ELMO domain containing 1
(ELMOD1), mRNA. 180 NM_004529 2 Homo sapiens myeloid/lymphoid or
mixed-lineage leukemia (trithorax homolog, Drosophila);
translocated to, 3 (MLLT3), mRNA. 181 NM_032385 2 Homo sapiens
chromosome 5 open reading frame 4 (C5orf4), mRNA. 182 NM_002310
1.99 Homo sapiens leukemia inhibitory factor receptor (LIFR), mRNA.
183 NM_000393 1.99 Homo sapiens collagen, type V, alpha 2 (COL5A2),
mRNA. 184 NM_000321 1.98 Homo sapiens retinoblastoma 1 (including
osteosarcoma) (RB1), mRNA. 185 NM_031211 1.98 Homo sapiens LAT1-3TM
protein (LAT1-3TM), mRNA. 186 NM_207044 1.86 Homo sapiens
endosulfine alpha (ENSA), transcript variant 4, mRNA. 187 NM_207047
1.86 Homo sapiens endosulfine alpha (ENSA), transcript variant 7,
mRNA. 188 NM_207043 1.86 Homo sapiens endosulfine alpha (ENSA),
transcript variant 2, mRNA. 189 NM_006489 1.86 Homo sapiens
neuro-oncological ventral antigen 1 (NOVA1), transcript variant 2,
mRNA. 190 NM_019087 1.86 Homo sapiens ADP-ribosylation factor
related protein 2 (ARFRP2), mRNA. 191 NM_002515 1.86 Homo sapiens
neuro-oncological ventral antigen 1 (NOVA1), transcript variant 1,
mRNA. 192 NM_015200 1.81 Homo sapiens SCC-112 protein (SCC-112),
mRNA. 193 NM_017423 1.81 Homo sapiens UDP-N-acetyl-alpha-D-
galactosamine:polypeptide N- acetylgalactosaminyltransferase 7
(GalNAc-T7) (GALNT7), mRNA. 194 NM_014876 1.8 Homo sapiens KIAA0063
gene product (KIAA0063), mRNA. 195 NM_032228 1.78 Homo sapiens male
sterility domain containing 2 (MLSTD2), mRNA. 196 NM_022845 1.77
Homo sapiens core-binding factor, beta subunit (CBFB), transcript
variant 1, mRNA. 197 NM_001755 1.74 Homo sapiens core-binding
factor, beta subunit (CBFB), transcript variant 2, mRNA. 198
NM_006788 1.73 Homo sapiens ralA binding protein 1 (RALBP1), mRNA.
199 NM_001560 1.68 Homo sapiens interleukin 13 receptor, alpha 1
(IL13RA1), mRNA. 200 NM_004926 1.66 Homo sapiens zinc finger
protein 36, C3H type-like 1 (ZFP36L1), mRNA. 201 NM_018976 1.64
Homo sapiens solute carrier family 38, member 2 (SLC38A2), mRNA.
202 NM_000868 1.63 Homo sapiens 5-hydroxytryptamine (serotonin)
receptor 2C (HTR2C), mRNA. 203 NM_014810 1.63 Homo sapiens
centrosome-associated protein 350 (CAP350), mRNA. 204 NM_000721
1.61 Homo sapiens calcium channel, voltage-dependent, alpha 1E
subunit (CACNA1E), mRNA. 205 NM_002076 1.6 Homo sapiens glucosamine
(N-acetyl)-6-sulfatase (Sanfilippo disease IIID) (GNS), mRNA. 206
NM_182646 1.58 Homo sapiens cytoplasmic polyadenylation element
binding protein 2 (CPEB2), transcript variant A, mRNA. 207
NM_182485 1.58 Homo sapiens cytoplasmic polyadenylation element
binding protein 2 (CPEB2), transcript variant B, mRNA. 208
NM_021079 1.55 Homo sapiens N-myristoyltransferase 1 (NMT1), mRNA.
209 NM_199324 1.47 Homo sapiens HIV-1 induced protein HIN-1
(HSHIN1), transcript variant 1, mRNA. 210 NM_145808 1.44 Homo
sapiens myotrophin (MTPN), mRNA. 211 NM_005400 1.43 Homo sapiens
protein kinase C, epsilon (PRKCE), mRNA. 212 NM_181897 1.42 Homo
sapiens protein phosphatase 2 (formerly 2A), regulatory subunit
B'', alpha (PPP2R3A), transcript variant 2, mRNA. 213 NM_002718
1.42 Homo sapiens protein phosphatase 2 (formerly 2A), regulatory
subunit B'', alpha (PPP2R3A), transcript variant 1, mRNA. 214
NM_001438 1.2 Homo sapiens estrogen-related receptor gamma (ESRRG),
transcript variant 1, mRNA. 215 NM_206594 1.2 Homo sapiens
estrogen-related receptor gamma (ESRRG), transcript variant 2,
mRNA. 216 NM_206595 1.2 Homo sapiens estrogen-related receptor
gamma (ESRRG), transcript variant 3, mRNA.
[0106] In the case of the miR-145 miRNA, for example, Table 2
provides a listing of human mRNAs predicted to contain target sites
for hsa-miR-145, using the method as described in Krek et al.
(2005) Nature Genetics 37(5): 495-500, using default
parameters.
TABLE-US-00006 TABLE 2 Human Refseq PicTar Rank Id score annotation
1 NM_013994 13.62 Homo sapiens discoidin domain receptor family,
member 1 (DDR1), transcript variant 3, mRNA. 2 NM_013993 13.62 Homo
sapiens discoidin domain receptor family, member 1 (DDR1),
transcript variant 1, mRNA. 3 NM_001954 13.62 Homo sapiens
discoidin domain receptor family, member 1 (DDR1), transcript
variant 2, mRNA. 4 NM_015094 10 Homo sapiens hypermethylated in
cancer 2 (HIC2), mRNA. 5 NM_002017 9.85 Homo sapiens Friend
leukemia virus integration 1 (FLI1), mRNA. 6 NM_005797 7.62 Homo
sapiens epithelial V-like antigen 1 (EVA1), transcript variant 1,
mRNA. 7 NM_014871 7.58 Homo sapiens ubiquitin specific protease 52
(USP52), mRNA. 8 NM_001128 7.54 Homo sapiens adaptor-related
protein complex 1 gamma 1 subunit (AP1G1), mRNA. 9 NM_015271 7.44
Homo sapiens tripartite motif-containing 2 (TRIM2), mRNA. 10
NM_017999 7.08 Homo sapiens ring finger protein 31 (RNF31), mRNA.
11 NM_018011 6.83 Homo sapiens hypothetical protein FLJ10154
(FLJ10154), mRNA. 12 NM_199072 6.47 Homo sapiens I-mfa
domain-containing protein (HIC), mRNA. 13 NM_033046 6.27 Homo
sapiens rhotekin (RTKN), mRNA. 14 NM_173797 6.25 Homo sapiens PAP
associated domain containing 4 (PAPD4), mRNA. 15 NM_016824 6.16
Homo sapiens adducin 3 (gamma) (ADD3), transcript variant 1, mRNA.
16 NM_019903 6.16 Homo sapiens adducin 3 (gamma) (ADD3), transcript
variant 2, mRNA. 17 NM_006506 6.05 Homo sapiens RAS p21 protein
activator 2 (RASA2), mRNA. 18 NM_021832 5.84 Homo sapiens a
disintegrin and metalloproteinase domain 17 (tumor necrosis factor,
alpha, converting enzyme) (ADAM17), transcript variant 2, mRNA. 19
NM_182492 5.67 Homo sapiens hypothetical protein DKFZp434O0213
(DKFZp434O0213), mRNA. 20 NM_144497 5.5 Homo sapiens A kinase
(PRKA) anchor protein (gravin) 12 (AKAP12), transcript variant 2,
mRNA. 21 NM_005100 5.5 Homo sapiens A kinase (PRKA) anchor protein
(gravin) 12 (AKAP12), transcript variant 1, mRNA. 22 NM_005717 5.45
Homo sapiens actin related protein 2/3 complex, subunit 5, 16 kDa
(ARPC5), mRNA. 23 NM_014923 5.35 Homo sapiens fibronectin type III
domain containing 3 (FNDC3), mRNA. 24 NM_020762 5.31 Homo sapiens
SLIT-ROBO Rho GTPase activating protein 1 (SRGAP1), mRNA. 25
NM_005347 5.3 Homo sapiens heat shock 70 kDa protein 5
(glucose-regulated protein, 78 kDa) (HSPA5), mRNA. 26 NM_015184
5.21 Homo sapiens phospholipase C-like 2 (PLCL2), mRNA. 27
NM_052830 5.18 Homo sapiens gamma-glutamyltransferase-like 3
(GGTL3), transcript variant 1, mRNA. 28 NM_002657 5.13 Homo sapiens
pleiomorphic adenoma gene-like 2 (PLAGL2), mRNA. 29 NM_001002924
5.13 Homo sapiens adaptor-related protein complex 3, sigma 1
subunit (AP3S1), transcript variant 2, mRNA. 30 NM_013279 5.06 Homo
sapiens chromosome 11 open reading frame 9 (C11orf9), mRNA. 31
NM_014903 4.9 Homo sapiens neuron navigator 3 (NAV3), mRNA. 32
NM_032726 4.8 Homo sapiens phospholipase C, delta 4 (PLCD4), mRNA.
33 NM_004714 4.77 Homo sapiens dual-specificity tyrosine-(Y)-
phosphorylation regulated kinase 1B (DYRK1B), transcript variant a,
mRNA. 34 NM_006484 4.77 Homo sapiens dual-specificity tyrosine-(Y)-
phosphorylation regulated kinase 1B (DYRK1B), transcript variant c,
mRNA. 35 NM_006483 4.77 Homo sapiens dual-specificity tyrosine-(Y)-
phosphorylation regulated kinase 1B (DYRK1B), transcript variant b,
mRNA. 36 NM_033274 4.7 Homo sapiens a disintegrin and
metalloproteinase domain 19 (meltrin beta) (ADAM19), transcript
variant 2, mRNA. 37 NM_020909 4.67 Homo sapiens erythrocyte
membrane protein band 4.1 like 5 (EPB41L5), mRNA. 38 NM_024643 4.48
Homo sapiens chromosome 14 open reading frame 140 (C14orf140),
mRNA. 39 NM_017913 4.44 Homo sapiens cell division cycle 37 homolog
(S. cerevisiae)-like 1 (CDC37L1), mRNA. 40 NM_005384 4.42 Homo
sapiens nuclear factor, interleukin 3 regulated (NFIL3), mRNA. 41
NM_178026 4.42 Homo sapiens gamma-glutamyltransferase-like 3
(GGTL3), transcript variant 3, mRNA. 42 NM_018360 4.32 Homo sapiens
chromosome X open reading frame 15 (CXorf15), mRNA. 43 NM_016032
4.29 Homo sapiens zinc finger, DHHC domain containing 9 (ZDHHC9),
mRNA. 44 NM_016258 4.28 Homo sapiens YTH domain family, member 2
(YTHDF2), mRNA. 45 NM_182664 4.23 Homo sapiens Ras association
(RalGDS/AF-6) domain family 5 (RASSF5), transcript variant 2, mRNA.
46 NM_006702 4.22 Homo sapiens neuropathy target esterase (NTE),
mRNA. 47 NM_006080 4.2 Homo sapiens sema domain, immunoglobulin
domain (Ig), short basic domain, secreted, (semaphorin) 3A
(SEMA3A), mRNA. 48 NM_004276 4.12 Homo sapiens calcium binding
protein 1 (calbrain) (CABP1), transcript variant 2, mRNA. 49
NM_031205 4.12 Homo sapiens calcium binding protein 1 (calbrain)
(CABP1), transcript variant 1, mRNA. 50 NM_147193 4.05 Homo sapiens
GLIS family zinc finger 1 (GLIS1), mRNA. 51 NM_004865 4.02 Homo
sapiens TBP-like 1 (TBPL1), mRNA. 52 NM_001284 4.02 Homo sapiens
adaptor-related protein complex 3, sigma 1 subunit (AP3S1),
transcript variant 1, mRNA. 53 NM_022652 3.98 Homo sapiens dual
specificity phosphatase 6 (DUSP6), transcript variant 2, mRNA. 54
NM_001946 3.98 Homo sapiens dual specificity phosphatase 6 (DUSP6),
transcript variant 1, mRNA. 55 NM_001967 3.93 Homo sapiens
eukaryotic translation initiation factor 4A, isoform 2 (EIF4A2),
mRNA. 56 NM_000944 3.92 Homo sapiens protein phosphatase 3
(formerly 2B), catalytic subunit, alpha isoform (calcineurin A
alpha) (PPP3CA), mRNA. 57 NM_002013 3.88 Homo sapiens FK506 binding
protein 3, 25 kDa (FKBP3), mRNA. 58 NM_005433 3.82 Homo sapiens
v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 (YES1), mRNA. 59
NM_002973 3.81 Homo sapiens ataxin 2 (ATXN2), mRNA. 60 NM_145799
3.81 Homo sapiens septin 6 (SEPT6), transcript variant I, mRNA. 61
NM_001386 3.79 Homo sapiens dihydropyrimidinase-like 2 (DPYSL2),
mRNA. 62 NM_005723 3.78 Homo sapiens transmembrane 4 superfamily
member 9 (TM4SF9), mRNA. 63 NM_007146 3.71 Homo sapiens zinc finger
protein 161 (ZNF161), mRNA. 64 NM_024586 3.7 Homo sapiens oxysterol
binding protein-like 9 (OSBPL9), transcript variant 6, mRNA. 65
NM_148909 3.7 Homo sapiens oxysterol binding protein-like 9
(OSBPL9), transcript variant 7, mRNA. 66 NM_148906 3.7 Homo sapiens
oxysterol binding protein-like 9 (OSBPL9), transcript variant 3,
mRNA. 67 NM_052887 3.7 Homo sapiens toll-interleukin 1 receptor
(TIR) domain containing adaptor protein (TIRAP), transcript variant
1, mRNA. 68 NM_148907 3.7 Homo sapiens oxysterol binding
protein-like 9 (OSBPL9), transcript variant 4, mRNA. 69 NM_148908
3.7 Homo sapiens oxysterol binding protein-like 9 (OSBPL9),
transcript variant 5, mRNA. 70 NM_148905 3.7 Homo sapiens oxysterol
binding protein-like 9 (OSBPL9), transcript variant 2, mRNA. 71
NM_148904 3.7 Homo sapiens oxysterol binding protein-like 9
(OSBPL9), transcript variant 1, mRNA. 72 NM_020307 3.68 Homo
sapiens cyclin L1 (CCNL1), mRNA. 73 NM_184042 3.63 Homo sapiens
Cohen syndrome 1 (COH1), transcript variant 2, mRNA. 74 NM_001457
3.63 Homo sapiens filamin B, beta (actin binding protein 278)
(FLNB), mRNA. 75 NM_032511 3.56 Homo sapiens chromosome 6 open
reading frame 168 (C6orf168), mRNA. 76 NM_016389 3.55 Homo sapiens
influenza virus NS1A binding protein (IVNS1ABP), transcript variant
2, mRNA. 77 NM_001326 3.54 Homo sapiens cleavage stimulation
factor, 3' pre-RNA, subunit 3, 77 kDa (CSTF3), mRNA. 78 NM_152600
3.52 Homo sapiens zinc finger protein 579 (ZNF579), mRNA. 79
NM_014016 3.5 Homo sapiens SAC1 suppressor of actin mutations
1-like (yeast) (SACM1L), mRNA. 80 NM_052925 3.48 Homo sapiens
leukocyte receptor cluster (LRC) member 8 (LENG8), mRNA. 81
NM_052911 3.47 Homo sapiens establishment factor-like protein
(EFO1), mRNA. 82 NM_015129 3.46 Homo sapiens septin 6 (SEPT6),
transcript variant II, mRNA. 83 NM_002924 3.43 Homo sapiens
regulator of G-protein signalling 7 (RGS7), mRNA. 84 NM_002229 3.42
Homo sapiens jun B proto-oncogene (JUNB), mRNA. 85 NM_153498 3.35
Homo sapiens calcium/calmodulin-dependent protein kinase ID
(CAMK1D), transcript variant 2, mRNA. 86 NM_005119 3.34 Homo
sapiens thyroid hormone receptor associated protein 3 (THRAP3),
mRNA. 87 NM_173078 3.34 Homo sapiens SLIT and NTRK-like family,
member 4 (SLITRK4), mRNA. 88 NM_003893 3.31 Homo sapiens LIM domain
binding 1 (LDB1), mRNA. 89 NM_000346 3.3 Homo sapiens SRY (sex
determining region Y)- box 9 (campomelic dysplasia, autosomal sex-
reversal) (SOX9), mRNA. 90 NM_032222 3.27 Homo sapiens hypothetical
protein FLJ22374 (FLJ22374), mRNA. 91 NM_133370 3.24 Homo sapiens
splicing factor YT521-B (YT521), mRNA. 92 NM_015069 3.23 Homo
sapiens zinc finger protein 423 (ZNF423), mRNA. 93 NM_018271 3.23
Homo sapiens hypothetical protein FLJ10916 (FLJ10916), mRNA. 94
NM_030962 3.2 Homo sapiens SET binding factor 2 (SBF2), mRNA. 95
NM_014363 3.19 Homo sapiens spastic ataxia of Charlevoix- Saguenay
(sacsin) (SACS), mRNA. 96 NM_017640 3.15 Homo sapiens leucine rich
repeat containing 16 (LRRC16), mRNA. 97 NM_005544 3.14 Homo sapiens
insulin receptor substrate 1 (IRS1), mRNA. 98 NM_002912 3.09 Homo
sapiens REV3-like, catalytic subunit of DNA polymerase zeta (yeast)
(REV3L), mRNA. 99 NM_001614 3.09 Homo sapiens actin, gamma 1
(ACTG1), mRNA. 100 NM_015361 3.09 Homo sapiens R3H domain (binds
single- stranded nucleic acids) containing (R3HDM), mRNA. 101
NM_152390 3.09 Homo sapiens hypothetical protein MGC33926
(MGC33926), mRNA. 102 NM_025076 3.07 Homo sapiens UDP-glucuronate
decarboxylase 1 (UXS1), mRNA. 103 NM_152945 3.06 Homo sapiens
developmentally regulated RNA- binding protein 1 (DRB1), mRNA. 104
NM_014267 3.04 Homo sapiens small acidic protein (SMAP), mRNA. 105
NM_007345 3.04 Homo sapiens zinc finger protein 236 (ZNF236), mRNA.
106 NM_023071 3.03 Homo sapiens spermatogenesis associated,
serine-rich 2 (SPATS2), mRNA. 107 NM_004755 3.01 Homo sapiens
ribosomal protein S6 kinase, 90 kDa, polypeptide 5 (RPS6KA5),
transcript variant 1, mRNA. 108 NM_001901 2.99 Homo sapiens
connective tissue growth factor (CTGF), mRNA. 109 NM_018270 2.98
Homo sapiens chromosome 20 open reading frame 20 (C20orf20), mRNA.
110 NM_001092 2.98 Homo sapiens active BCR-related gene (ABR),
transcript variant 2, mRNA. 111 NM_021962 2.98 Homo sapiens active
BCR-related gene (ABR), transcript variant 1, mRNA. 112 NM_182527
2.97 Homo sapiens calcium binding protein 7 (CABP7), mRNA. 113
NM_021612 2.96 Homo sapiens a disintegrin and metalloproteinase
domain 11 (ADAM11), transcript variant 2, mRNA. 114 NM_020806 2.96
Homo sapiens gephyrin (GPHN), mRNA. 115 NM_000959 2.95 Homo sapiens
prostaglandin F receptor (FP)
(PTGFR), mRNA. 116 NM_016322 2.94 Homo sapiens RAB14, member RAS
oncogene family (RAB14), mRNA. 117 NM_138440 2.94 Homo sapiens
vasorin (LOC114990), mRNA. 118 NM_194293 2.93 Homo sapiens
cardiomyopathy associated 1 (CMYA1), mRNA. 119 NM_022650 2.92 Homo
sapiens RAS p21 protein activator (GTPase activating protein) 1
(RASA1), transcript variant 2, mRNA. 120 NM_002890 2.92 Homo
sapiens RAS p21 protein activator (GTPase activating protein) 1
(RASA1), transcript variant 1, mRNA. 121 NM_001616 2.92 Homo
sapiens activin A receptor, type II (ACVR2), mRNA. 122 NM_018607
2.9 Homo sapiens hypothetical protein PRO1853 (PRO1853), transcript
variant 2, mRNA. 123 NM_033346 2.87 Homo sapiens bone morphogenetic
protein receptor, type II (serine/threonine kinase) (BMPR2),
transcript variant 2, mRNA. 124 NM_007005 2.87 Homo sapiens
transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)
(TLE4), mRNA. 125 NM_033505 2.87 Homo sapiens selenoprotein I
(SELI), mRNA. 126 NM_014800 2.85 Homo sapiens engulfment and cell
motility 1 (ced-12 homolog, C. elegans) (ELMO1), transcript variant
1, mRNA. 127 NM_130442 2.85 Homo sapiens engulfment and cell
motility 1 (ced-12 homolog, C. elegans) (ELMO1), transcript variant
2, mRNA. 128 NM_023929 2.82 Homo sapiens zinc finger and BTB domain
containing 10 (ZBTB10), mRNA. 129 NM_198138 2.82 Homo sapiens
SEC31-like 2 (S. cerevisiae) (SEC31L2), transcript variant 2, mRNA.
130 NM_015277 2.8 Homo sapiens neural precursor cell expressed,
developmentally down-regulated 4-like (NEDD4L), mRNA. 131 NM_017732
2.8 Homo sapiens hypoxia-inducible factor prolyl 4- hydroxylase
(PH-4), transcript variant 2, mRNA. 132 NM_133476 2.79 Homo sapiens
zinc finger protein 384 (ZNF384), mRNA. 133 NM_022845 2.79 Homo
sapiens core-binding factor, beta subunit (CBFB), transcript
variant 1, mRNA. 134 NM_207424 2.77 Homo sapiens FLJ40536 protein
(FLJ40536), mRNA. 135 NM_017641 2.76 Homo sapiens kinesin family
member 21A (KIF21A), mRNA. 136 NM_001755 2.76 Homo sapiens
core-binding factor, beta subunit (CBFB), transcript variant 2,
mRNA. 137 NM_014840 2.76 Homo sapiens AMP-activated protein kinase
family member 5 (ARK5), mRNA. 138 NM_022977 2.75 Homo sapiens
acyl-CoA synthetase long-chain family member 4 (ACSL4), transcript
variant 2, mRNA. 139 NM_004458 2.75 Homo sapiens acyl-CoA
synthetase long-chain family member 4 (ACSL4), transcript variant
1, mRNA. 140 NM_022832 2.73 Homo sapiens ubiquitin specific
protease 46 (USP46), mRNA. 141 NM_025057 2.73 Homo sapiens
chromosome 14 open reading frame 45 (C14orf45), mRNA. 142 NM_130436
2.72 Homo sapiens dual-specificity tyrosine-(Y)- phosphorylation
regulated kinase 1A (DYRK1A), transcript variant 2, mRNA. 143
NM_001396 2.72 Homo sapiens dual-specificity tyrosine-(Y)-
phosphorylation regulated kinase 1A (DYRK1A), transcript variant 1,
mRNA. 144 NM_004096 2.72 Homo sapiens eukaryotic translation
initiation factor 4E binding protein 2 (EIF4EBP2), mRNA. 145
NM_052900 2.71 Homo sapiens CUB and Sushi multiple domains 3
(CSMD3), transcript variant c, mRNA. 146 NM_198123 2.71 Homo
sapiens CUB and Sushi multiple domains 3 (CSMD3), transcript
variant a, mRNA. 147 NM_198124 2.71 Homo sapiens CUB and Sushi
multiple domains 3 (CSMD3), transcript variant b, mRNA. 148
NM_016231 2.7 Homo sapiens nemo like kinase (NLK), mRNA. 149
NM_031284 2.7 Homo sapiens ADP-dependent glucokinase (ADPGK), mRNA.
150 NM_020772 2.7 Homo sapiens 82-kD FMRP Interacting Protein
(182-FIP), mRNA. 151 NM_018993 2.69 Homo sapiens Ras and Rab
interactor 2 (RIN2), mRNA. 152 NM_173640 2.68 Homo sapiens likely
ortholog of mouse roof plate-specific spondin (R-spondin), mRNA.
153 NM_014212 2.67 Homo sapiens homeo box C11 (HOXC11), mRNA. 154
NM_001259 2.67 Homo sapiens cyclin-dependent kinase 6 (CDK6), mRNA.
155 NM_005721 2.64 Homo sapiens ARP3 actin-related protein 3
homolog (yeast) (ACTR3), mRNA. 156 NM_014603 2.64 Homo sapiens
paraneoplastic antigen (HUMPPA), mRNA. 157 NM_015187 2.62 Homo
sapiens KIAA0746 protein (KIAA0746), mRNA. 158 NM_138638 2.6 Homo
sapiens cofilin 2 (muscle) (CFL2), transcript variant 2, mRNA. 159
NM_021914 2.6 Homo sapiens cofilin 2 (muscle) (CFL2), transcript
variant 1, mRNA. 160 NM_052905 2.58 Homo sapiens formin-like 2
(FMNL2), transcript variant 2, mRNA. 161 NM_018227 2.56 Homo
sapiens hypothetical protein FLJ10808 (FLJ10808), mRNA. 162
NM_020796 2.56 Homo sapiens sema domain, transmembrane domain (TM),
and cytoplasmic domain, (semaphorin) 6A (SEMA6A), mRNA. 163
NM_017903 2.54 Homo sapiens hypothetical protein FLJ20618
(FLJ20618), mRNA. 164 NM_002745 2.53 Homo sapiens mitogen-activated
protein kinase 1 (MAPK1), transcript variant 1, mRNA. 165
NM_001004422 2.52 Homo sapiens formin-like 2 (FMNL2), transcript
variant 3, mRNA. 166 NM_006922 2.52 Homo sapiens sodium channel,
voltage-gated, type III, alpha (SCN3A), mRNA. 167 NM_032017 2.52
Homo sapiens Ser/Thr-like kinase (MGC4796), mRNA. 168 NM_024595
2.51 Homo sapiens hypothetical protein FLJ12666 (FLJ12666), mRNA.
169 NM_004393 2.5 Homo sapiens dystroglycan 1 (dystrophin-
associated glycoprotein 1) (DAG1), mRNA. 170 NM_198793 2.48 Homo
sapiens CD47 antigen (Rh-related antigen, integrin-associated
signal transducer) (CD47), transcript variant 2, mRNA. 171
NM_001004417 2.48 Homo sapiens formin-like 2 (FMNL2), transcript
variant 4, mRNA. 172 NM_001777 2.48 Homo sapiens CD47 antigen
(Rh-related antigen, integrin-associated signal transducer) (CD47),
transcript variant 1, mRNA. 173 NM_152253 2.48 Homo sapiens choline
kinase beta (CHKB), transcript variant 2, mRNA. 174 NM_032432 2.47
Homo sapiens actin binding LIM protein family, member 2 (ABLIM2),
mRNA. 175 NM_001004421 2.46 Homo sapiens formin-like 2 (FMNL2),
transcript variant 1, mRNA. 176 NM_173809 2.46 Homo sapiens
biogenesis of lysosome-related organelles complex-1, subunit 2
(BLOC1S2), transcript variant 1, mRNA. 177 NM_002859 2.46 Homo
sapiens paxillin (PXN), mRNA. 178 NM_001001342 2.46 Homo sapiens
biogenesis of lysosome-related organelles complex-1, subunit 2
(BLOC1S2), transcript variant 2, mRNA. 179 NM_021224 2.45 Homo
sapiens zinc finger protein 462 (ZNF462), mRNA. 180 NM_032196 2.45
Homo sapiens homolog of yeast INO80 (INO80), transcript variant 2,
mRNA. 181 NM_015455 2.43 Homo sapiens carbon catabolite repression
4 protein (KIAA1194), mRNA. 182 NM_032229 2.43 Homo sapiens SLIT
and NTRK-like family, member 6 (SLITRK6), mRNA. 183 NM_130438 2.41
Homo sapiens dual-specificity tyrosine-(Y)- phosphorylation
regulated kinase 1A (DYRK1A), transcript variant 5, mRNA. 184
NM_145686 2.39 Homo sapiens mitogen-activated protein kinase kinase
kinase kinase 4 (MAP4K4), transcript variant 2, mRNA. 185 NM_004834
2.39 Homo sapiens mitogen-activated protein kinase kinase kinase
kinase 4 (MAP4K4), transcript variant 1, mRNA. 186 NM_145687 2.39
Homo sapiens mitogen-activated protein kinase kinase kinase kinase
4 (MAP4K4), transcript variant 3, mRNA. 187 NM_130437 2.38 Homo
sapiens dual-specificity tyrosine-(Y)- phosphorylation regulated
kinase 1A (DYRK1A), transcript variant 4, mRNA. 188 NM_101395 2.38
Homo sapiens dual-specificity tyrosine-(Y)- phosphorylation
regulated kinase 1A (DYRK1A), transcript variant 3, mRNA. 189
NM_014666 2.38 Homo sapiens enthoprotin (ENTH), mRNA. 190 NM_024713
2.36 Homo sapiens chromosome 15 open reading frame 29 (C15orf29),
mRNA. 191 NM_003076 2.35 Homo sapiens SWI/SNF related, matrix
associated, actin dependent regulator of chromatin, subfamily d,
member 1 (SMARCD1), transcript variant 1, mRNA. 192 NM_015074 2.35
Homo sapiens kinesin family member 1B (KIF1B), transcript variant
1, mRNA. 193 NM_014742 2.34 Homo sapiens transmembrane 9
superfamily protein member 4 (TM9SF4), mRNA. 194 NM_139071 2.34
Homo sapiens SWI/SNF related, matrix associated, actin dependent
regulator of chromatin, subfamily d, member 1 (SMARCD1), transcript
variant 2, mRNA. 195 NM_017553 2.32 Homo sapiens homolog of yeast
INO80 (INO80), transcript variant 1, mRNA. 196 NM_206909 2.32 Homo
sapiens pleckstrin and Sec7 domain containing 3 (PSD3), transcript
variant 2, mRNA. 197 NM_005863 2.27 Homo sapiens neuroepithelial
cell transforming gene 1 (NET1), mRNA. 198 NM_145341 2.25 Homo
sapiens programmed cell death 4 (neoplastic transformation
inhibitor) (PDCD4), transcript variant 2, mRNA. 199 NM_014456 2.25
Homo sapiens programmed cell death 4 (neoplastic transformation
inhibitor) (PDCD4), transcript variant 1, mRNA. 200 NM_015176 2.25
Homo sapiens F-box protein 28 (FBXO28), mRNA. 201 NM_002142 2.23
Homo sapiens homeo box A9 (HOXA9), transcript variant 2, mRNA. 202
NM_017772 2.22 Homo sapiens chromosome 6 open reading frame 197
(C6orf197), mRNA. 203 NM_017582 2.22 Homo sapiens
ubiquitin-conjugating enzyme E2Q (putative) (UBE2Q), mRNA. 204
NM_006469 2.22 Homo sapiens influenza virus NS1A binding protein
(IVNS1ABP), transcript variant 1, mRNA. 205 NM_002840 2.19 Homo
sapiens protein tyrosine phosphatase, receptor type, F (PTPRF),
transcript variant 1, mRNA. 206 NM_130440 2.19 Homo sapiens protein
tyrosine phosphatase, receptor type, F (PTPRF), transcript variant
2, mRNA. 207 NM_199437 2.17 Homo sapiens PR domain containing 10
(PRDM10), transcript variant 2, mRNA. 208 NM_199439 2.17 Homo
sapiens PR domain containing 10 (PRDM10), transcript variant 4,
mRNA. 209 NM_199438 2.17 Homo sapiens PR domain containing 10
(PRDM10), transcript variant 3, mRNA. 210 NM_005604 2.17 Homo
sapiens POU domain, class 3, transcription factor 2 (POU3F2), mRNA.
211 NM_020228 2.17 Homo sapiens PR domain containing 10 (PRDM10),
transcript variant 1, mRNA. 212 NM_019084 2.16 Homo sapiens cyclin
J (CCNJ), mRNA. 213 NM_173619 2.16 Homo sapiens hypothetical
protein MGC34761 (MGC34761), mRNA. 214 NM_017902 2.15 Homo sapiens
hypoxia-inducible factor 1, alpha subunit inhibitor (HIF1AN), mRNA.
215 NM_022735 2.14 Homo sapiens acyl-Coenzyme A binding domain
containing 3 (ACBD3), mRNA. 216 NM_002193 2.13 Homo sapiens
inhibin, beta B (activin AB beta polypeptide) (INHBB), mRNA. 217
NM_207438 2.12 Homo sapiens FLJ43808 protein (FLJ43808), mRNA. 218
NM_020689 2.12 Homo sapiens solute carrier family 24
(sodium/potassium/calcium exchanger), member 3 (SLC24A3), mRNA. 219
NM_012271 2.1 Homo sapiens huntingtin interacting protein B (HYPB),
transcript variant 2, mRNA. 220 NM_023079 2.09 Homo sapiens
hypothetical protein FLJ13855 (FLJ13855), mRNA. 221 NM_001759 2.09
Homo sapiens cyclin D2 (CCND2), mRNA. 222 NM_018246 2.07 Homo
sapiens hypothetical protein FLJ10853 (FLJ10853), mRNA. 223
NM_016201 2.06 Homo sapiens angiomotin like 2 (AMOTL2), mRNA. 224
NM_020925 2.06 Homo sapiens KIAA1573 protein (KIAA1573), mRNA. 225
NM_207406 2.05 Homo sapiens FLJ43965 protein (FLJ43965), mRNA. 226
NM_020248 2.05 Homo sapiens catenin, beta interacting protein 1
(CTNNBIP1), mRNA. 227 NM_003204 2.03 Homo sapiens nuclear factor
(erythroid-derived 2)-like 1 (NFE2L1), mRNA. 228 NM_006459 2.02
Homo sapiens SPFH domain family, member 1
(SPFH1), mRNA. 229 NM_006403 1.99 Homo sapiens neural precursor
cell expressed, developmentally down-regulated 9 (NEDD9), mRNA. 230
NM_003483 1.93 Homo sapiens high mobility group AT-hook 2 (HMGA2),
mRNA. 231 NM_203351 1.92 Homo sapiens mitogen-activated protein
kinase kinase kinase 3 (MAP3K3), transcript variant 1, mRNA. 232
NM_002401 1.92 Homo sapiens mitogen-activated protein kinase kinase
kinase 3 (MAP3K3), transcript variant 2, mRNA. 233 NM_003887 1.92
Homo sapiens development and differentiation enhancing factor 2
(DDEF2), mRNA. 234 NM_013449 1.85 Homo sapiens bromodomain adjacent
to zinc finger domain, 2A (BAZ2A), mRNA. 235 NM_003507 1.84 Homo
sapiens frizzled homolog 7 (Drosophila) (FZD7), mRNA. 236 NM_014686
1.81 Homo sapiens KIAA0355 (KIAA0355), mRNA. 237 NM_003759 1.81
Homo sapiens solute carrier family 4, sodium bicarbonate
cotransporter, member 4 (SLC4A4), mRNA. 238 NM_006380 1.79 Homo
sapiens amyloid beta precursor protein (cytoplasmic tail) binding
protein 2 (APPBP2), mRNA. 239 NM_199040 1.78 Homo sapiens nudix
(nucleoside diphosphate linked moiety X)-type motif 4 (NUDT4),
transcript variant 2, mRNA. 240 NM_019094 1.78 Homo sapiens nudix
(nucleoside diphosphate linked moiety X)-type motif 4 (NUDT4),
transcript variant 1, mRNA. 241 NM_014919 1.76 Homo sapiens
Wolf-Hirschhorn syndrome candidate 1 (WHSC1), transcript variant 4,
mRNA. 242 NM_080760 1.75 Homo sapiens dachshund homolog 1
(Drosophila) (DACH1), transcript variant 2, mRNA. 243 NM_004392
1.75 Homo sapiens dachshund homolog 1 (Drosophila) (DACH1),
transcript variant 3, mRNA. 244 NM_080759 1.75 Homo sapiens
dachshund homolog 1 (Drosophila) (DACH1), transcript variant 1,
mRNA. 245 NM_133333 1.72 Homo sapiens Wolf-Hirschhorn syndrome
candidate 1 (WHSC1), transcript variant 6, mRNA. 246 NM_133332 1.7
Homo sapiens Wolf-Hirschhorn syndrome candidate 1 (WHSC1),
transcript variant 5, mRNA. 247 NM_025146 1.62 Homo sapiens Mak3
homolog (S. cerevisiae) (MAK3), mRNA. 248 NM_002015 1.56 Homo
sapiens forkhead box O1A (rhabdomyosarcoma) (FOXO1A), mRNA. 249
NM_003458 1.56 Homo sapiens bassoon (presynaptic cytomatrix
protein) (BSN), mRNA. 250 NM_001204 1.53 Homo sapiens bone
morphogenetic protein receptor, type II (serine/threonine kinase)
(BMPR2), transcript variant 1, mRNA. 251 NM_004921 1.48 Homo
sapiens chloride channel, calcium activated, family member 3
(CLCA3), mRNA. 252 NM_005502 1.47 Homo sapiens ATP-binding
cassette, sub-family A (ABC1), member 1 (ABCA1), mRNA. 253
NM_148171 1.4 Homo sapiens ubiquitin associated protein 2 (UBAP2),
transcript variant 3, mRNA. 254 NM_015071 1.38 Homo sapiens Rho
GTPase activating protein 26 (ARHGAP26), mRNA. 255 NM_030627 1.34
Homo sapiens cytoplasmic polyadenylation element binding protein 4
(CPEB4), mRNA. 256 NM_030918 1.19 Homo sapiens sorting nexin family
member 27 (SNX27), mRNA. 257 NM_004171 1.11 Homo sapiens solute
carrier family 1 (glial high affinity glutamate transporter),
member 2 (SLC1A2), mRNA. 258 NM_021813 0.97 Homo sapiens BTB and
CNC homology 1, basic leucine zipper transcription factor 2
(BACH2), mRNA.
[0107] A target site for the binding of the microRNA may be
introduced into the nucleic acid with the capacity to modulate the
development of cell at a suitable position in the nucleic acid. For
example, in the case of the target site being introduced into a
mRNA (by way, for example, of cloning the target site into the
appropriate position in a plasmid encoding a gene to be
transcribed), the target site(s) may be introduced into one or more
of the 3'UTR, coding region and 5'UTR of the mRNA. Methods for the
cloning of nucleic acid sequences are essentially as described in
Sambrook, J, Fritsch, E. F. and Maniatis, T. Molecular Cloning: A
Laboratory Manual 2nd. ed. Cold Spring Harbor Laboratroy Press, New
York. (1989).
[0108] For example, the target site for the miR-143 and/or miR-145
microRNAs may be cloned into the 3'UTR of the HSV thymidine kinase
gene. This construct, when expressed in cells with a reduced
activity and/or expression of the miR-143 or miR-145 microRNAs,
will lead to selective ablation of these cells.
[0109] In the case of a non-naturally occurring target site, the
target site for introduction into the nucleic acid may be produced
by a method known in the art, such as chemical synthesis. For
example, phosphorothioate oligonucleotides may be synthesized by
the method as described in Stein et al. (1988) Nucl. Acids Res. 16:
3209. The target site may then be introduced into the nucleic acid
by a method known in the art. For example, complementary
oligonucleotides containing the binding site may be annealed and
then introduced into the appropriate restriction site in a
plasmid.
[0110] The nucleic acid with the capacity to modulate development
of a cell may include more than one copy of a target site for
binding of the miRNA. For example, the nucleic acid may contain 2,
3, 4 or more copies of a target site. Indeed, it is anticipated
that multiple copies of a target site may provide a greater degree
of control of the level of expression of the nucleic acid with the
capacity to modulate development of the cell.
[0111] It will also be appreciated that the copies of the target
site may be copies of the same or a similar target sequence, or one
or more copies of a target sequence for one or more different
microRNA(s).
[0112] The present invention also provides a cell including an
exogenous nucleic acid including a binding site for a microRNA, or
a cell including a nucleic acid with a non-naturally occurring
binding site for a microRNA.
[0113] In one form, the cell is a cancerous or pre-cancerous cell
with a reduced activity of a microRNA. Examples of cancerous and
pre-cancerous cells are as previously discussed herein.
[0114] Accordingly, in another form the present invention provides
a cancerous or pre-cancerous cell including an exogenous nucleic
acid including a binding site for a microRNA, wherein the cancerous
or pre-cancerous cell has a reduced activity and/or concentration
of the microRNA as compared to a similar non-cancerous cell.
[0115] The cell, such as a pre-cancerous or cancerous cell, may be
present in vitro or in vivo. For example, the cell may be an
isolated cell in vitro, or a cell present in a biological system
such as an organ, tissue, or an entire organism (eg an animal or
human subject).
[0116] Thus, the present invention also provides an animal or human
including non-cancerous cells and cancerous cells, the
non-cancerous and cancerous cells both including and/or expressing
an exogenous nucleic acid with a target site for binding of a
microRNA.
[0117] Accordingly, in another form the present invention provides
an animal including cancerous cells, the cancerous cells including
an exogenous nucleic acid including a target site for binding of a
microRNA.
[0118] In one form, the target site for binding of a microRNA is a
target site for a microRNA that has reduced expression and/or
activity in the cancerous cell, as compared to a similar
non-cancerous cell. Examples of such binding sites are as
previously herein discussed and include the binding site for the
miR-143 and/or miR-145 microRNAs.
[0119] In one form, the exogenous nucleic acid has the capacity to
modulate the development of a cell in the animal. Examples of such
nucleic acids are as previously discussed herein.
[0120] The expression of an exogenous nucleic acid in a cell may be
by way of introducing the nucleic acid into the cells by a method
known in the art. Methods for introducing exogenous DNAs into
prokaryotic and eukaryotic cells are essentially as described in
Sambrook, J, Fritsch, E. F. and Maniatis, T. Molecular Cloning: A
Laboratory Manual 2nd. ed. Cold Spring Harbor Laboratory Press, New
York. (1989).
[0121] In the case of an animal, the animal may also be a
transgenic animal with the nucleic acid stably integrated into the
genome of the cells of the animal. Methods for producing transgenic
animals are known in the art.
[0122] The present invention also provides a nucleic acid that has
the capacity to modulate development of a cell and which includes a
binding site for a microRNA.
[0123] Nucleic acids in the various forms of the present invention
may be produced by a method known in the art, such as cloning, in
vitro transcription (for a RNA), chemical synthesis or any
combination of such methods. The present invention also provides
vectors including the nucleic acids of the present invention, and
cells including the vectors and nucleic acids.
[0124] Examples of nucleic acids with the capacity to modulate the
development of cells are as previously discussed herein. Thus, the
nucleic acid may have the capacity to inhibit the development of a
cell (eg cytostatic or cytotoxic activity), or alternatively, may
have the capacity to promote development of a cell.
[0125] Accordingly, in another form the present invention provides
a nucleic acid with the capacity to modulate development of a cell,
the nucleic acid including a binding site for a microRNA. Examples
of binding sites for microRNAs are as previously discussed
herein.
[0126] In one form, the binding site for the microRNA is a binding
site for a microRNA that has an altered activity and/or
concentration in a cell, as compared to another cell.
[0127] Thus, the nucleic acid may include a binding for a microRNA
that is differentially expressed and/or differentially active.
[0128] The nucleic acid may have the capacity to either inhibit or
promote development of a cell. Examples of nucleic acids that have
the capacity to modulate development are as discussed previously
herein.
[0129] It will be appreciated that the nucleic acids of the present
invention may be used in a composition for exposure to a cell, so
as to introduce the nucleic acid into the cell, or a composition
for administration to an animal or human subject, or be part of a
vector, such as a viral vector, for introducing the nucleic acids
into cells in vitro, or cells in a biological system, such as cells
in an animal or human subject.
[0130] In this case, the nucleic acid may be used for example to
inhibit the development of a cell(s) in an animal or human subject,
such as ablating the cell(s) in an animal or human subject.
[0131] The nucleic acid in the various forms of the present
invention may be an isolated nucleic acid. In this regard, the term
"isolated" is to be understood to mean an entity, for example a
nucleic acid, a polypeptide, or a cell, which is removed from its
natural environment.
[0132] The nucleic acid in the various forms of the present
invention may also be present and/or expressed in a cell.
[0133] Accordingly, in another form the present invention also
provides a cell including an exogenous nucleic with the capacity to
modulate development of the cell, the nucleic acid including a
binding site for a microRNA.
[0134] The cell may be a prokaryotic cell or a eukaryotic cell.
[0135] An example of a suitable prokaryotic cell is Escherichia
coli. Such a cell is useful for maintaining and/or propagating
plasmids including the nucleic acid. An example of a suitable
eukaryotic cell is a human colon cell, or cell derived
therefrom.
[0136] In one form, the cell is a eukaryotic cell that has an
altered level and/or activity of one or more microRNAs. Examples of
such cells are as previously discussed herein.
[0137] The cell may be an isolated cell in vitro, or a cell present
in a biological system such as an organ, tissue, or an entire
organism (eg an animal or human subject).
[0138] In one form, the cell is a cancerous or pre-cancerous cell
with a reduced activity of a microRNA.
[0139] Accordingly, in another form the present invention provides
a cancerous or pre-cancerous cell with reduced activity of a
microRNA, the cancerous or pre-cancerous cell including an
exogenous nucleic with the capacity to modulate development of the
cell, the nucleic acid including a binding site for the microRNA.
The reduced activity of the microRNA is as compared to a similar
non-cancerous cell.
[0140] The cancerous or pre-cancerous cell may be an isolated cell
in vitro, or a cell present in a biological system such as an
organ, tissue, or an entire organism (eg an animal or human
subject).
[0141] For example, the cells may be present in a whole animal or
human that contains non-cancerous cells and cancerous cells, both
of which express an exogenous nucleic with the capacity to modulate
development of the cell, the nucleic acid including a binding site
for a microRNA.
[0142] Thus, the present invention also provides an animal
including non-cancerous cells and cancerous cells, the
non-cancerous and cancerous cells both including and/or expressing
an exogenous nucleic acid with the capacity to modulate development
of the cell, the nucleic acid including a binding site for a
microRNA.
[0143] In one form, the binding site for the microRNA is a binding
site for a microRNA that has an altered activity and/or
concentration in the cancerous cells as compared to the
non-cancerous cells.
[0144] The present invention also provides a nucleic acid including
a non-naturally occurring binding site for a microRNA that is
differentially expressed and/or has differential activity.
[0145] Accordingly, in another form the present invention provides
a nucleic acid including a non-naturally occurring binding site for
a microRNA, wherein the microRNA is differentially expressed or
differentially active between cells.
[0146] The nucleic acid may be an isolated nucleic acid. The
nucleic acid may be present and/or expressed in a cell.
[0147] The binding site for the differentially expressed or active
microRNA is a binding site of a microRNA that has altered
expression and/or activity between different types of cells. In one
form, the cells are of a similar type.
[0148] Examples of differentially expressed microRNAs include the
miR-143 and miR-145 microRNAs, which are differentially expressed
between colonic tumours and normal colonic tissue.
[0149] In one form, the binding site is a non-naturally occurring
binding site for a microRNA that has an altered expression and/or
activity in cancerous or pre-cancerous cells, as compared to the
level of expression and/or activity in normal or non-cancerous
cells. For example, the microRNA may have a reduced expression
and/or activity in cancerous or pre-cancerous cells, as compared to
the level of expression and/or activity in normal or non-cancerous
cells.
[0150] Accordingly, in another form the present invention provides
an isolated nucleic acid including a non-naturally occurring
binding site for a microRNA that is down-regulated in a cancerous
cell as compared to a similar non-cancerous cell.
[0151] In one form, the nucleic acid is a nucleic acid with the
capacity to modulate development of a cell. Nucleic acids that have
the capacity to modulate the development of a cell are as
previously discussed herein. Thus, the nucleic acid may inhibit (eg
have cytotoxic or cytostatic activity) or promote the development
of a cell.
[0152] In one form, the nucleic acid includes two or more binding
sites for binding of the same or different microRNAs that are
differentially expressed and/or differentially active.
[0153] It will be appreciated that the nucleic acid may be used in
a composition for exposure to a cell, so as to introduce the
nucleic acid into the cell, or for administration to an animal or
human subject, or be part of a vector, such as a viral vector, for
introducing into cells, including cells in an animal or human
subject.
[0154] In one form, the nucleic acid is used to inhibit the
development of a cell(s) in an animal or human subject, including
the ablation of the cell(s) in an animal or human subject.
[0155] Methods for the design of target sites for microRNAs are as
previously discussed herein.
[0156] Methods for determining whether the binding site occurs
naturally are known in the art.
[0157] For example, the BLAST algorithm can be used for determining
the extent of nucleotide homology between a target sequence and
sequences in a specific genome. BLAST identifies local alignments
between the sequences in the database and predicts the probability
of the local alignment occurring by chance. The BLAST algorithm is
as described in Altschul et al. (1990) J. Mol. Biol.
215:403-410.
[0158] The nucleic acid may be an exogenous nucleic acid introduced
into a cell and then expressed.
[0159] Accordingly, the present invention also provides a cell
including a nucleic acid including a non-naturally occurring
binding site for a microRNA that is differentially expressed and/or
differentially active.
[0160] The cell may be a prokaryotic cell or a eukaryotic cell.
[0161] An example of a suitable prokaryotic cell is Escherichia
coli. Such a cell is useful for maintaining and/or propagating
plasmids including the nucleic acid.
[0162] In one form, the cell is a eukaryotic cell that has an
altered level and/or activity of one or more microRNAs. Examples of
such cells are as previously described herein.
[0163] The cell may be an isolated cell in vitro, or a cell present
in a biological system such as cell present in an organ, tissue, or
an entire organism (eg an animal or human subject).
[0164] In one form, the cell is a cancerous or pre-cancerous
cell.
[0165] Accordingly, in another form the present invention provides
a cancerous or pre-cancerous cell including a nucleic acid
including a non-naturally occurring binding site for a
microRNA.
[0166] In one form, the cell is a cancerous or pre-cancerous cell
with a reduced activity of a microRNA.
[0167] Accordingly, in another form the present invention provides
a cancerous or pre-cancerous cell with reduced activity of a
microRNA, the cancerous or pre-cancerous cell including a nucleic
acid including a non-naturally occurring binding site for a
microRNA that is differentially expressed and/or differentially
active in the cancerous or pre-cancerous cell as compared to a
similar non-cancerous cell.
[0168] For example, the cells may be present in a whole animal or
human that contains non-cancerous cells and cancerous cells, either
or both of which include and/or express a nucleic acid including a
non-naturally occurring binding site for a microRNA.
[0169] Accordingly, in another form the present invention provides
an animal including cancerous cells, the cancerous cells including
a nucleic acid including a non-naturally occurring binding site for
a microRNA.
[0170] In one form, the microRNA is differentially expressed or
differentially active in the cancerous cells as compared to
non-cancerous cells.
[0171] Accordingly, in another form the present invention provides
an animal including non-cancerous cells and cancerous cells, the
non-cancerous and cancerous cells both including and/or expressing
a nucleic acid including a non-naturally occurring binding site for
a microRNA that is differentially expressed or differentially
active in the cancerous cell as compared to the non-cancerous
cell.
[0172] The nucleic acids of the present invention may be introduced
into a cell by a suitable method known in art. For example, the
nucleic acid may be introduced into a cell by transformation using
calcium phosphate, viral infection, electroporation, lipofection,
or particle bombardment. In this regard, transformed cells include
stably transformed cells in which the inserted DNA is capable of
replication either as an autonomously replicating plasmid or as
part of the host chromosome, or cells which transiently express the
inserted DNA or RNA for limited periods of time. Methods for
introducing exogenous DNAs into prokaryotic and eukaryotic cells
are essentially as described in Sambrook, J, Fritsch, E. F. and
Maniatis, T. Molecular Cloning: A Laboratory Manual 2nd. ed. Cold
Spring Harbor Laboratory Press, New York. (1989).
[0173] In the case of the nucleic acid being a mRNA, the mRNA may
be produced in the cell by transcription of the relevant DNA.
Alternatively, the mRNA may be an exogenous mRNA introduced into
the cell. Methods for producing mRNAs in vitro are known in the
art.
[0174] For a mRNA expressed in the cell from a DNA template, the
target site may be cloned into a suitable expression vector for use
in the cell type of interest by methods known in the art. Methods
for the isolation of nucleic acid sequences and their cloning into
a suitable expression vector are essentially as described in
Sambrook, J, Fritsch, E. F. and Maniatis, T. Molecular Cloning: A
Laboratory Manual 2nd. ed. Cold Spring Harbor Laboratroy Press, New
York. (1989). The recombinant molecule may then be introduced into
the cell and the cloned nucleic acid expressed. The vector may be
any nucleic acid capable of having a foreign nucleic acid inserted
into the vector. For example, the vector may be a plasmid, all or
part of a viral genome, or any other nucleic acid capable of
autonomous replication in a prokaryotic or eukaryotic host.
[0175] The present invention also provides a vector including the
various nucleic acids of the present invention.
[0176] In one form, the vector is a viral vector that allows the
nucleic acid to be introduced into the target cells by infection.
Examples of such viral vectors that can be employed to deliver the
nucleic acid to a cell include a recombinant adenovirus, a
recombinant lentivirus, a recombinant retrovirus, a recombinant
adeno-associated virus (AAV), a recombinant herpesvirus, a
recombinant SV-40 virus, an Epstein-Barr virus, or a recombinant
pox virus, such as a recombinant vaccinia virus.
[0177] Accordingly, in one form the present invention provides a
viral vector including a nucleic acid with the capacity to modulate
development of a cell, the nucleic acid including a binding site
for a microRNA.
[0178] In another form, the present invention also provides a viral
vector including a nucleic acid including a non-naturally occurring
binding site for a differentially expressed microRNA.
[0179] In this case, it will be appreciated that the viral vector
may be formed from all or part of a viral genome. The viral vector
may also be a naturally occurring or a recombinant virus and
further may be replication deficient or replication proficient.
[0180] As will be appreciated, expression of the relevant inserted
DNA in plasmid or viral vectors will generally require various
regulatory elements known in the art for the expression of inserted
nucleic acids, for example promoters for driving the expression of
an inserted nucleic acid in a particular cell, poly A signals for
efficient polyadenylation of mRNA transcribed from inserted nucleic
acids, or other regulatory elements to control translation,
transcription or mRNA stability.
[0181] Depending upon the cell type to be modulated, the promoter
driving the expression may be a constitutive promoter, an inducible
promoter or a cell or tissue specific promoter.
[0182] Constitutive mammalian promoters include hypoxanthine
phosphoribosyl transferase (HPTR), adenosine deaminase,
phosphoglycerate kinase, pyruvate kinase, and .beta.-actin.
Exemplary viral promoters which function constitutively in
eukaryotic cells include promoters from the simian virus, papilloma
virus, adenovirus, human immunodeficiency virus (HIV), Rous sarcoma
virus, cytomegalovirus, the long terminal repeats (LTR) of moloney
leukemia virus and other retroviruses, and the thymidine kinase
promoter of herpes simplex virus.
[0183] Inducible promoters include synthetic promoters regulated by
the TetO/TetR system and inducible promoters such as
metallothionein promoter, which may be used to induced
transcription in the presence of certain metal ions. Other
inducible promoters are known in the art.
[0184] The tissue-specific promoter will depend upon the particular
cell type. For example, promoters that allow expression in colon
cancer cells include the regulatory sequences of human
carcinoembryonic antigen (CEA) [accession:U17131; gi/967132].
[0185] The present invention also provides a composition including
the various nucleic acids described herein.
[0186] Accordingly, in one form the present invention also provides
a composition including a nucleic acid with the capacity to
modulate development of a cell, the nucleic acid including a
binding site for a microRNA.
[0187] In another form, the present provides a composition
including a nucleic acid including a non-naturally occurring
binding site for a differentially expressed or differentially
active microRNA.
[0188] The compositions are suitable for exposing the nucleic acids
of the present invention to cells. Methods of introducing nucleic
acids into cells are as previously discussed herein.
[0189] The compositions of the present invention are also suitable
for administration to a subject to prevent and/or treat a disease,
condition or state associated with cells that have an altered
activity and/or expression of a microRNA.
[0190] For example, the nucleic acids may be combined with a
pharmaceutically acceptable carrier, stabilizer, buffer or diluent
to produce a composition for administration to a subject. Thus, the
present invention also provides a pharmaceutical composition
including one or more nucleic acids of the invention in an
acceptable carrier.
[0191] The nucleic acid may be delivered to a cell or a subject by
a method known in the art. For example, the nucleic acid molecules
can be administered to cells by encapsulation in liposomes, by
iontophoresis, or by incorporation into other vehicles, such as
biodegradable polymers, hydrogels, cyclodextrins,
poly(lactic-co-glycolic)acid (PLGA) and PLCA microspheres,
biodegradable nanocapsules, and bioadhesive microspheres. The
nucleic acid molecules may also be formulated or complexed with
polyethyleneimine and derivatives thereof, such as
polyethyleneimine-polyethyleneglycol-N-acetylgalactosamine
(PEI-PEG-GAL) or
polyethyleneimine-polyethyleneglycol-tri-N-acetylgalac-tosamine
(PEI-PEG-triGAL) derivatives.
[0192] For administration to a subject, the nucleic acids can be
administered and introduced by standard means, with or without
stabilizers, buffers, and the like, to form a pharmaceutical
composition. Suitable forms, in part, depend upon the use or the
route of entry, for example oral, transdermal, by injection, or
delivery by way of infection with a virus.
[0193] When it is desired to use a liposome delivery mechanism,
standard protocols for formation of liposomes can be followed. The
compositions of the present invention can also be formulated and
used as tablets, capsules or elixirs for oral administration,
suppositories for rectal administration, sterile solutions,
suspensions for injectable administration, and the other
compositions known in the art.
[0194] Surface-modified liposomes containing poly (ethylene glycol)
lipids (PEG-modified, or long-circulating liposomes or stealth
liposomes) offer a method for increasing the accumulation of drugs
in target tissues. Such liposomes have been shown to accumulate
selectively in tumors.
[0195] Administration routes that lead to systemic absorption
include intravenous, subcutaneous, intraperitoneal, inhalation,
oral, intrapulmonary and intramuscular routes. Each of these
administration routes exposes the nucleic acids of the present
invention to cells or tissue.
[0196] The nucleic acids of the present invention will generally be
delivered at a pharmaceutically effective dose to prevent, inhibit
the occurrence, or treat (so as to alleviate a symptom to some
extent) a disease, condition or state. The pharmaceutically
effective dose depends on the type of disease or condition being
treated, the composition used, the route of administration, the
type of subject being treated, the physical characteristics of the
specific subject under consideration, concurrent medication, and
other factors that those skilled in the medical arts will
recognize. Generally, an amount between 0.1 mg/kg and 100 mg/kg
body weight/day of active ingredients is administered.
[0197] The nucleic acid molecules of the present invention, and
compositions and formulations thereof, can be administered orally,
topically, parenterally, by inhalation or spray, or rectally in
dosage unit formulations containing conventional non-toxic
pharmaceutically acceptable carriers, adjuvants and/or vehicles.
The term "parenteral" includes percutaneous, subcutaneous,
intravascular (e.g., intravenous), intramuscular, or intrathecal
injection or infusion techniques and the like.
[0198] As discussed previously, the present invention also provides
a pharmaceutical composition including a nucleic acid molecule of
the invention and a pharmaceutically acceptable carrier. One or
more nucleic acid molecules of the invention can be present in
association with one or more non-toxic pharmaceutically acceptable
carriers and/or diluents and/or adjuvants, and if desired other
active ingredients. The pharmaceutical compositions containing
nucleic acid molecules of the invention can be in a form suitable
for oral use, for example, as tablets, troches, lozenges, aqueous
or oily suspensions, dispersible powders or granules, emulsion,
hard or soft capsules, or syrups or elixirs.
[0199] Compositions intended for oral use can be prepared according
to a suitable method known in the to the art. The composition may
contain one or more such sweetening agents, flavoring agents,
coloring agents or preservative agents in order to provide a
pharmaceutically acceptable preparations. Tablets contain the
active ingredient in admixture with non-toxic pharmaceutically
acceptable excipients that are suitable for the manufacture of
tablets. These excipients can be, for example, inert diluents; such
as calcium carbonate, sodium carbonate, lactose, calcium phosphate
or sodium phosphate; granulating and disintegrating agents, for
example, corn starch, or alginic acid; binding agents, for example
starch, gelatin or acacia; and lubricating agents, for example
magnesium stearate, stearic acid or talc. The tablets can be
uncoated or they can be coated by known techniques. In some cases
such coatings can be prepared by known techniques to delay
disintegration and absorption in the gastrointestinal tract and
thereby provide a sustained action over a longer period. For
example, a time delay material such as glyceryl monosterate or
glyceryl distearate can be employed.
[0200] Formulations for oral use can also be presented as hard
gelatin capsules, wherein the active ingredient is mixed with an
inert solid diluent, for example, calcium carbonate, calcium
phosphate or kaolin, or as soft gelatin capsules wherein the active
ingredient is mixed with water or an oil medium, for example peanut
oil, liquid paraffin or olive oil.
[0201] Aqueous suspensions contain the active materials in a
mixture with excipients suitable for the manufacture of aqueous
suspensions. Such excipients are suspending agents, for example
sodium carboxymethylcellulose, methylcellulose,
hydropropyl-methylcellulose, sodium alginate, polyvinylpyrrolidone,
gum tragacanth and gum acacia; dispersing or wetting agents can be
a naturally-occurring phosphatide, for example, lecithin, or
condensation products of an alkylene oxide with fatty acids, for
example polyoxyethylene stearate, or condensation products of
ethylene oxide with long chain aliphatic alcohols, for example
heptadecaethyleneoxycetanol, or condensation products of ethylene
oxide with partial esters derived from fatty acids and a hexitol
such as polyoxyethylene sorbitol monooleate, or condensation
products of ethylene oxide with partial esters derived from fatty
acids and hexitol anhydrides, for example polyethylene sorbitan
monooleate. The aqueous suspensions can also contain one or more
preservatives, for example ethyl, or n-propyl p-hydroxybenzoate,
one or more coloring agents, one or more flavoring agents, and one
or more sweetening agents, such as sucrose or saccharin.
[0202] Oily suspensions can be formulated by suspending the active
ingredients in a vegetable oil, for example arachis oil, olive oil,
sesame oil or coconut oil, or in a mineral oil such as liquid
paraffin. The oily suspensions can contain a thickening agent, for
example beeswax, hard paraffin or cetyl alcohol. Sweetening agents
and flavoring agents can be added to provide palatable oral
preparations. These compositions can be preserved by the addition
of an anti-oxidant such as ascorbic acid
[0203] Dispersible powders and granules suitable for preparation of
an aqueous suspension by the addition of water provide the active
ingredient in admixture with a dispersing or wetting agent,
suspending agent and one or more preservatives. Suitable dispersing
or wetting agents or suspending agents are exemplified by those
already mentioned above. Additional excipients, for example
sweetening, flavoring and coloring agents, can also be present.
[0204] Pharmaceutical compositions of the present invention can
also be in the form of oil-in-water emulsions. The oily phase can
be a vegetable oil or a mineral oil or mixtures of these. Suitable
emulsifying agents can be naturally-occurring gums, for example gum
acacia or gum tragacanth, naturally-occurring phosphatides, for
example soy bean, lecithin, and esters or partial esters derived
from fatty acids and hexitol, anhydrides, for example sorbitan
monooleate, and condensation products of the said partial esters
with ethylene oxide, for example polyoxyethylene sorbitan
monooleate. The emulsions can also contain sweetening and flavoring
agents.
[0205] Syrups and elixirs can be formulated with sweetening agents,
for example glycerol, propylene glycol, sorbitol, glucose or
sucrose. Such formulations can also contain a demulcent, a
preservative and flavoring and coloring agents. The pharmaceutical
compositions can be in the form of a sterile injectable aqueous or
oleaginous suspension. This suspension can be formulated as known
in the art using suitable dispersing or wetting agents and
suspending agents that have been discussed previously. The sterile
injectable preparation can also be a sterile injectable solution or
suspension in a non-toxic parentally acceptable diluent or solvent,
for example as a solution in 1,3-butanediol. Among the acceptable
vehicles and solvents that can be employed are water, Ringer's
solution and isotonic sodium chloride solution. In addition,
sterile, fixed oils are conventionally employed as a solvent or
suspending medium. For this purpose, any bland fixed oil can be
employed including synthetic mono- or diglycerides. In addition,
fatty acids such as oleic acid find use in the preparation of
injectables.
[0206] The nucleic acid molecules of the present invention can also
be administered in the form of suppositories, e.g., for rectal
administration of the drug. These compositions can be prepared by
mixing the nucleic acid with a suitable non-irritating excipient
that is solid at ordinary temperatures but liquid at the rectal
temperature and will therefore melt in the rectum to release the
nucleic acid. Such materials include cocoa butter and polyethylene
glycols.
[0207] The nucleic acid molecules of the present invention can also
be administered parenterally in a sterile medium. The nucleic acid,
depending on the vehicle and concentration used, can either be
suspended or dissolved in the vehicle. Advantageously, adjuvants
such as local anesthetics, preservatives and buffering agents can
be dissolved in the vehicle.
[0208] It is understood that the specific dose level for any
particular subject will depend upon a variety of factors including
the age, body weight, general health, time of administration, route
of administration, and rate of excretion, drug combination and the
severity of the particular disease undergoing therapy.
[0209] For administration to non-human animals, the composition can
also be added to the animal feed or drinking water. It can be
convenient to formulate the animal feed and drinking water
compositions so that the animal takes in a therapeutically
appropriate quantity of the composition along with its diet. It can
also be convenient to present the composition as a premix for
addition to the feed or drinking water.
[0210] The nucleic acid molecules of the present invention can also
be administered to a subject in combination with other therapeutic
compounds to increase the overall therapeutic effect. The use of
multiple compounds to treat an indication can increase the
beneficial effects while reducing the presence of side effects.
[0211] It will be appreciated that the various compositions of the
present invention can also be formulated for administering the
nucleic acid molecules of the invention to specific cell types. For
example, receptors such as the asialoglycoprotein receptor are
unique to hepatocytes and bind branched galactose-terminal
glycoproteins, such as asialoorosomucoid. Alternatively, some
receptors such as the folate receptor are overexpressed in many
cancer cells. The use of galactose, galactosamine, or folate based
conjugates to transport exogenous compounds across cell membranes
can provide a targeted delivery approach to, for example, the
treatment of liver disease, cancers of the liver, or other
cancers.
[0212] The nucleic acid molecules of the present invention may also
be complexed with or covalently attached to nanoparticles, such as
Hepatitis B virus or L envelope proteins.
[0213] Alternatively, certain the nucleic molecules of the present
invention can be expressed within cells from eukaryotic promoters
as previously discussed.
[0214] Viral vectors expressing the nucleic acids of the present
invention may be constructed based upon, for example,
adeno-associated virus, retrovirus, adenovirus, or alphavirus. The
viral vectors can either be use to introduce the nucleic acid into
cells, or alternatively, the viral vector can be packaged and
infections used to introduce the nucleic acids of the present
invention to cells. The viral vectors can provide for transient
expression or stable expression of the nucleic acid molecules.
[0215] Therapeutic delivery of biolomolecules is generally as
described in Bladon, C. (2002) "Pharmaceutical Chemistry:
Therapeutic Aspects of Biomolecules" John Wiley & Sons Ltd.
[0216] Viral and gene therapy techniques are as generally described
in "Viral Vectors for Gene Therapy Methods and Protocols" Edited by
Jules G Constant, Curtis A Machida (2003) Humana Press Inc., "Gene
Delivery to Mammalian Cells: Viral Gene Transfer Techniques" Edited
by William C Heiser (2004) Humana Press Inc., "Viruses in Human
Gene Therapy" Edited by J. H. Vos (1995) Carolina Academic Press,
and "Viral Therapy Of Human Cancers" Edited by J. G. Sinkovics and
J. C. Horwath (2005) Marcel Dekker.
[0217] The present invention is also suitable for modulating the
concentration of a nucleic acid in a cancerous cell or
pre-cancerous cell.
[0218] In this case, an altered activity and/or concentration of a
microRNA in a cancerous cell allows the concentration of the
nucleic acid in the cell to be modulated by including in the
nucleic acid a target site for binding of the microRNA. As will be
appreciated, the modulation of the concentration of the nucleic
acid is as compared to a similar cell not having an altered
activity and/or expression of the microRNA.
[0219] For example, a reduced activity and/or concentration of a
microRNA in a cancerous cell allows the concentration of the
nucleic acid in the cell to be modulated by including in the
nucleic acid a target site for binding of the microRNA.
[0220] Accordingly, the present invention also provides a method of
modulating the concentration of a nucleic acid expressed in a
cancerous cell, the cancerous cell having an altered activity
and/or concentration of a microRNA as compared to a similar
non-cancerous cell, the method including the step of introducing a
target site for binding of the microRNA into the nucleic acid to be
expressed in the cell.
[0221] Methods for cloning and introducing nucleic acids into cells
are as previously discussed. Determination that the concentration
of a nucleic acid may be accomplished by a suitable method known in
the art, such as Northern analysis, RT-PCR or RNase protection.
[0222] The present invention is also suitable for detecting an
altered microRNA activity and/or concentration in a cancerous or
pre-cancerous cell, such as a cancerous cell in vitro, or a
cancerous or pre-cancerous cell in an animal or human. In this
case, the cancerous cells and non-cancerous cells both express a
reporter nucleic acid including a target site for binding of a
microRNA, and an altered activity of the microRNA may be detected
in the cancerous cells by determining the level of expression of
the reporter nucleic acid in the cancerous and non-cancerous cells,
and detecting a change in the activity of the microRNA in the
cancerous cells by a change in the expression of the reporter
nucleic acid in the cancerous cells as compared to the level of
expression of the reporter nucleic acid in the non-cancerous
cells.
[0223] For example, the present invention is suitable for detecting
a reduced microRNA activity and/or concentration in a cancerous or
pre-cancerous cell. a reduced activity of the microRNA may be
detected in the cancerous cells by determining the level of
expression of the reporter nucleic acid in the cancerous and
non-cancerous cells, and detecting a reduced activity of the
microRNA in the cancerous cells by an increase in the expression of
the reporter nucleic acid in the cancerous cells as compared to the
level of expression of the reporter nucleic acid in the
non-cancerous cells.
[0224] Accordingly, in another form the present invention provides
a method of detecting altered microRNA activity and/or
concentration in a cancerous or pre-cancerous cell, the method
including the steps of: [0225] determining the level of expression
of a reporter nucleic acid in the cancerous or pre-cancerous cells
and determining the level of expression of a reporter nucleic acid
in non-cancerous cells; and [0226] detecting a reduced activity of
the microRNA in the cancerous cells by an increase in the
expression of the reporter nucleic acid in the cancerous cells as
compared to the level of expression of the reporter nucleic acid in
the non-cancerous cells.
[0227] In one form, the cancerous cells are present in an animal or
human subject.
[0228] The non-cancerous cell may be the same or similar cells. In
one embodiment, the cancerous (or precancerous cells) and the
non-cancerous cells are both present in an animal or human
subject.
[0229] In one form, the method may be used to detect a reduced
activity of the microRNA by detecting an increase in the expression
of the reporter nucleic acid in the cancerous cells as compared to
the level of expression of the reporter nucleic acid in the
non-cancerous cells.
[0230] In one form, the reporter nucleic acid in the cancerous (or
pre-cancerous cells) is the same or a similar reporter nucleic acid
as present in the non-cancerous cells.
[0231] Suitable reporter nucleic acids are known in the art. For
example, the reporter nucleic acid may produce a detectable product
such as LacZ, or GFP. Alternatively, the reporter nucleic acid may
be detected by an immunological detection method, with use of
antibodies raised to the protein encoded by the reporter nucleic
acid. Another method of detecting the reporter nucleic acid is by
use of hybridization with a detectably labelled complementary
nucleic acid probe.
[0232] Finally, standard techniques may be used for recombinant DNA
technology, oligonucleotide synthesis, and tissue culture and
transfection (e.g., electroporation, lipofection). Enzymatic
reactions and purification techniques may be performed according to
manufacturer's specifications or as commonly accomplished in the
art or as described herein. The foregoing techniques and procedures
may be generally performed according to conventional methods well
known in the art and as described in various general and more
specific references that are cited and discussed throughout the
present specification. See e.g., Sambrook et al. Molecular Cloning:
A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y. (1989) and Ausubel, F. M. et al. (1989)
Current Protocols in Molecular Biology, John Wiley & Sons, New
York, N.Y.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0233] Reference will now be made to experiments that embody the
above general principles of the present invention. However, it is
to be understood that the following description is not to limit the
generality of the above description.
Example 1
RNA Isolation From Tissue Samples and Cell Lines
[0234] Cell lines may be maintained in an appropriate medium.
Colorectal tumors and the corresponding normal mucosae may be
obtained from fresh surgical resections, following informed consent
from patients, and then classified according to standard
histopathological classification methods.
[0235] RNA may isolated from cell lines, using Trizol reagent
(Invitrogen, Carlsbad, Calif.) according to the manufacturer's
instructions. RNA may be purified from colorectal tissues using the
procedure of Chomczynski, P. and Sacchi, N. (1987). Anal. Biochem.
162: 156-159.
Example 2
Cloning of MicroRNAs miRNAs may be cloned essentially as described
by Elbashir et al. (2001) Genes Dev. 15: 188-200, except that
nucleic acids may be electroeluted from acrylamide gel slices using
the Biotrap system (Schleicher and Schuell GmbH, Dassel, Germany).
Briefly, small RNA fractions of between 18 and 26 bases may be size
selected on a denaturing polyacrylamide gel. Adapter
oligonucleotides, containing EcoRI restriction sites, may then be
directionally ligated to the RNA molecules. The adapter-ligated RNA
may then be amplified by RT-PCR. Concatamerized fragments,
containing multimers of religated, EcoRI-digested PCR products,
between 200 and 650 bp, are size selected on an agarose gel and
recovered by electroelution. The concatamers may then be
end-repaired and dA-tailed with Taq DNA polymerase, then cloned
into pGEM T-easy (Promega, Madison, Wis.) or pTOPO (Invitrogen)
according to the manufacturers' instructions. Plasmid inserts from
the resultant colonies may be analyzed by PCR using primers to
vector sequences. The nucleic acid sequence of selected inserts may
then be determined following treatment of the PCR products with
Exonuclease I and Shrimp Alkaline Phosphatase according to the
ExoSAP-IT protocol (USB Corporation, Cleveland, Ohio). Clones
created by this procedure will contain concatamers of PCR products,
and generally likely to represent between two and five independent
small RNAs.
Example 3
Northern Analysis
[0236] Total RNA (20 .mu.g) may be separated on a 15% denaturing
polyacrylamide gel. Loadings are visualized by ethidium bromide
staining. The RNA may then be transferred to Hybond N+ nylon
membrane by semi-dry blotting (OWL Separation Systems, Portsmouth,
N.H.). Probes may be generated by T4 Polynucleotide Kinase (New
England Biolabs, Beverly, Mass.) mediated end-labeling of DNA
oligonucleotides with [.gamma.-32P]ATP. To increase the specific
activity of the probes, the miRNA sequence may be concatamerized as
a trimer of direct repeats, then cloned into pGEM T-easy and the
insert amplified using PCR with M13 forward and reverse primers.
Antisense probes may then be synthesized using Taq
polymerase-generated linear amplification from the Sephadex
G-50-purified PCR products to incorporate multiple
[.gamma.-32P]dCTP bases.
[0237] Filter hybridization may be performed in QuikHyb Solution
(Stratagene, La Jolla, Calif.) containing 10.sup.6 cpm/ml probe for
1 h, with washes, as per the manufacturers' recommendations.
Filters may be analyzed using a Fujifilm-BAS 2500 phoshorimager and
signal intensity quantitated (as photostimulated
luminescence/mm.sup.2) using Analytical Imaging Station (version
3.0) software (Imaging Research Inc., Brock University, Ontario,
Canada).
[0238] miRNA sequences may be identified by BLAST (as described in
Altschul et al. (1990) J. Mol. Biol. 215: 403-410) by comparison to
the Genbank and EMBL public nucleotide databases. MicroRNAs may
also be identified by comparison with the databases of the miRNA
registry. The secondary structures of putative pre-miRNA hairpins
may be determined using the Mfold 3.1 algorithm (as described in
Mathews et al. (1999) J. Mol. Biol. 288: 911-940). Potential mRNA
target sequences may be identified by searching the Genbank
nonredundant and dbEST databases using BLAST and FASTA algorithms
(as described in Pearson, W. R. and Lipman, D. J. (1988) Proc.
Natl. Acad. Sci. USA, 85: 2444-2448) algorithms.
Example 4
Identification of Colorectal MicroRNAs
[0239] Small RNA fragments (between 18 and 27 bases) in total RNA,
purified from both a colonic adenocarcinoma and its matched normal
mucosa, may be size fractionated and cloned. The clones from the
cancer-derived sample and clones representing normal mucosa may
then be sequenced. Sequence analysis and comparison with public
database nucleotide sequences will enable identification of many of
the clones or assignment to a possible genomic origin for the
transcripts.
Example 5
Accumulation of MicroRNAs in Colorectal Tissues and in Cancer Cell
Lines
[0240] To confirm that the various sequences accumulate as miRNAs
and investigate whether changes in miRNA steady-state levels are
associated with neoplastic epithelium, Northern blot analysis may
be undertaken against a panel of RNAs from matched colorectal
cancer and normal mucosa specimens.
[0241] Northern blot analysis may be used to determine the levels
of mature miRNAs and precursor hairpin molecules in cell lines
derived from a variety of cancerous human tissues.
Example 6
Cloning of the miR145 Target Sequence into GFP
[0242] A mammalian Enhanced Green Fluorescence Protein (EGFP)
expression cassette (pMM043; FIG. 2) was created by directionally
inserting the EGFP coding sequence from pEGFP1 (Clontech) as a
Bg/II/NotI fragment, into BamHI/NotI linearized pcDNA3.1(+)
(Invitrogen). The unique NotI and XbaI sites in the reporter gene
3' untranslated region provided convenient sites for the insertion
of miRNA-complementary and predicted in vivo target sequences.
pMM095 (FIG. 3) was created by annealing the oligonucleotides #527
(5'-CTAGCAGATCCTGGGAAAACTGGAC-3'; SEQ ID NO.1) and #528
(5'-CTAGGTCCAGTTTTCCCAGGATCTG-3'; SEQ ID NO.2), then ligating the
hybrid, which contains the predicted RIGS gene miR145-target
sequence, into the XbaI site of pMM043. The nucleotide sequence of
pMM095 is provided in the sequence listing and is designated SEQ ID
NO. 153.
Example 7
Expression of GFP with the miR145 Target Sequence is Repressed in
Cells that Overexpress the miR145 Precursor Molecule
[0243] (i) Pri-miR145 Expression Constructs:
[0244] A fragment of the pri-miR145 transcript was cloned by PCR
amplification of the sequence corresponding to positions 184 and
734 of cDNA clone F1136638 fis (Genbank ID:21752921). The
oligonucleotides used were #556 (5'-TCCGGTACTTTTCAGGGCAA-3'; SEQ ID
NO.4) and #557 (5'-CAAGAAACGCATGCCTGATG-3'; SEQ ID NO.5) in a
standard PCR reaction using 50 ng HeLa genomic DNA as template with
cycling conditions: 94.degree. C. 3 minutes; 40 amplification
cycles 94.degree. C. 30 sec., 55.degree. C. 30 sec., 72.degree. C.
1 min; 72.degree. C. 10 minutes and final extension 72.degree. C.
10 min. The 550 bp product was agarose gel purified and cloned into
pGEMT-easy (Promega) to create plasmid pMM105. The EcoRI insert of
pMM105 (SEQ ID NO. 154) was then ligated into EcoRI linearised
pcDNA3.1(+) (Invitrogen) to create the expression constructs:
pMM109 (single sense insert; FIG. 8), pMM106 (single antisense
insert; FIG. 6), and pMM107 (tandem sense inserts; FIG. 7). The
nucleotide sequence of pMM106 is provided in the sequence listing
and is designated SEQ ID NO. 155. The nucleotide sequence of pMM107
is provided in the sequence listing and is designated SEQ ID NO.
156. The nucleotide sequence of pMM109 is provided in the sequence
listing and is designated SEQ ID NO. 157.
[0245] (ii) Transfections:
[0246] Cotransfections of HeLa cells involved FuGene 6
(Roche)-mediated transfection of 0.1 .mu.g of pMM095 with between
0.1 .mu.g and 1 .mu.g pri-miR145 expression vector (pMM109, pMM106,
pMM107) in 24 well culture plates, using standard FuGene 6 (Roche)
protocols. EGFP activity was detected as direct fluorescence of
live cells, 3 days following transfection, on a Typhoon fluorimager
(Amersham Biosciences) and quantified using Imagequant
software.
[0247] The miRNA, miR145, accumulates to only very low levels in
HeLa (cervical carcinoma) cells. It was found that an enhanced
Green Fluorescence Protein (EGFP) reporter gene construct
containing the miR145 target sequence (from the RIGS transcript) is
as active in these cells as an EGFP construct lacking the target
sequence, as detected by fluorescence of the transfected cells.
[0248] However, as shown in FIG. 2, if cells are co-transfected
with a construct that overexpresses the miR145 precursor molecule,
pri-miR145, EGFP activity is severely repressed, with the
repression occurring in a dose responsive manner.
Example 8
Incorporating miRNA Target Sequences into Reporter and Cytotoxic
Genes
[0249] A series of constructs will be created to contain
combinations of the complementary target sequences for miR143 and
miR145 in the 3'UTR of reporter genes (EGFP, LacZ, Renilla
luciferase) within constitutive expression vectors. These vectors
will include plasmids (for liposome mediated transfection and mouse
transgenesis) and lentiviral systems.
[0250] As the contribution of independent targets sequences (or
miRNA response elements; MREs) to the repression of a transcript
are known to be cumulative, combinations that include up to four
copies of each MRE will also be created.
[0251] The EGFP construct described previously will be used, in
conjunction with clones that contain several (up to four copies of
the miR145 and miR143 complementary sequences), cloned into the
NotI site of the 3'UTR. LacZ constructs will be based on the
synthetic, codon-optimised .beta.-galactosidase sequence, described
by Anson and Limberis (2004) J. Biotechnology 108: 17-30.
[0252] The LacZ plasmid vectors will be based on the pcDNA3.1(+)
expression backbone and that target sequences will also be inserted
into the NotI site of the 3'UTR.
[0253] Luciferase constructs will be created using the
psiCHECK.TM.-2 vector (Promega) by insertion of target sequences
into the multiple cloning region in the 3'UTR of the synthetic
Renilla luciferase gene. The psiCHECK.TM.-2 vector also provides
firefly luciferase as an internal control to normalise for
transfection efficiency. Luciferase activities of transfected and
transduced (in the case of lentiviral derivations) cells will be
detected using the Dual Luciferase.RTM. Assay system (Promega)
according to manufacturer's instructions.
Example 9
Effect of miRNA Target Sequences in Cultured Cells
[0254] The discovery that diseased (cancer) cells lack the
repressive function provided by miR143 and miR145 allows us to
address the possibility that we can exploit this phenomenon to
control the expression of therapeutic genes in these cells.
[0255] Results from experiments using the RIGS MRE in EGFP
constructs show that the presence of miR145 will limit expression
of foreign genes (that contain complementary 3'UTR sequences) in
those cells.
[0256] A mammalian cell line that accumulates significant levels of
mature miR143 or miR145 has not yet been identified. A lack of
miR143 accumulation in cell lines has also been reported by others
and is postulated to be a consequence of the control of fundamental
processes (such as proliferation) by these miRNAs.
[0257] To generate systems in which these miRNAs can be induced, to
mimic the status of "normal" cells, dox-inducible miR145 HeLa cell
lines will be produced to allow an investigation of the
stoichiometry between miR145 levels and target sequences and the
ability to silence gene expression. This will enable us to
determine, in vitro, whether a threshold level of cytoplasmic
miR145 is required to suppress reporter gene (EGFP, LacZ,
luciferase) activity and cytotoxic gene (herpes simplex virus
thymidine kinase) function.
[0258] Doxycycline-inducible pri-miR145 expression constructs were
created by incorporating the PmeI insert from pMM106 (containing
the pri-miR145 subfragment described earlier) to displace EGFP in
the Tet-inducible expression cassette pMM060 between the unique
Ascl (blunted) and PmII sites. pMM060 utilises both the
Tet-responsive promoter and tTR modified transrepressor described
by Rossi et al. (1998) Nat. Genet. 20(4):389-93, with the
transrepressor under the control of constitutive murine
phosphoglycerate kinase regulatory sequences. The construct with a
single sense copy of the 550 bp pri-miR145 subsequence is called
pMM110.
[0259] HeLa Tet-On cells (Clontech) have been stably-transformed
with the pMM110 construct using FuGene 6-mediated transfection and
following selection on both genticin and puromycin, clonal lines
have been isolated. Different HeLa Tet-On/pMM110 lines display
varying levels of pri-miR145 induction and mature miR145
accumulation, following 24 h exposure to 1 .mu.g doxycycline/mL
growth medium. The data is shown in FIG. 11.
Example 10
Effect of miRNA Target Sequences in Primary Colonic Cells
[0260] It is necessary to determine whether miR143 and miR145MREs
will enable disease specific expression of transgenes in mammalian
tissues. To develop a rapid assay for miR143/miR145 retarded gene
expression in colonic epithelium and adenocarcinomas, the
expression of LacZ (+/-multiple miR145 MREs in 3'UTR) in colonic
mucosa and compare that with expression in tumour cells will be
examined.
[0261] Normal murine intestinal tissues and tumours from an
azoxymethane (AOM)-treated p53-knockout mouse (Hu et al. (2005)
Int. J. Cancer 115: 561-567), will be maintained in culture to
establish this study and also to refine the process and
vectors.
[0262] Culture conditions will be essentially as described by
Whitehead et al. (1999) Gastroenterology 117:858-65.
[0263] Normal intestinal mucosa, adenomatous and cancer tissues
will also be obtained from the resections of consenting cancer
patients and cultured as above.
[0264] Reporter gene constructs will be inserted into a lentiviral
vector system as described in Anson and Fuller (2003) J. Gene Med.
5:829-838, and Fuller and Anson (2001) Human Gene Therapy 12:
2081-2093, and used to infect cultured explants.
[0265] All constructs will also incorporate a constitutive EYFP
expression cassette to define and normalise the level of lentiviral
infection between samples. Initial experiments will use only a
constitutive EYFP expression cassette in the lentivirus vector, to
establish this system. It will also be determined whether a dual
luciferase assay (psiCHECK.TM. 2; Promega) is more informative,
than the lacZ marker, in this system.
[0266] If this approach is successful, the LacZ reporter gene will
be replaced with the conditional cytotoxic gene, thymidine kinase,
to determine whether MRE-derived tissue specificity is sufficient
to selectively ablate tumour cells. Naturally, this will lead to
the creation of constructs with tissue-specific promoters to
enhance disease-specificity.
Example 11
Effect of miRNA Target Sequences on Gene Expression In Vivo
[0267] Transgenic mice will be created that express a LacZ reporter
gene, containing multiple miR145 and miR143 complementary sequences
in the 3'UTR, under the control of a constitutive promoter (CMV).
The transgene construct will also comprise a second reporter gene
(EGFP) that does not contain such targeting sequences, but uses the
same promoter. Direct fluorescence (or immunohistochemical
detection of EGFP) will define the tissue distribution of transgene
expression while the subset of cells that also stain for LacZ
activity will indicate those which are not affected by
microRNA-mediated silencing.
[0268] Fluorescence will entail direct observation of fresh or
paraformaldehyde-fixed tissues using an inverted fluorescence
microscope. Fixed tissue may be pre-treated with 0.1% sodium
borohydride, to reduce autofluorescence. GFP specific antibodies
(Living Colours.RTM. Peptide Antibody; Clontech) will be used for
immunohistochemical detection, using standard procedures.
[0269] While the entire transgenic mouse will be assessed,
particular attention will be paid to colorectal tissues.
[0270] Favourable transgenic mouse lines will be crossed with a p53
knockout mouse strain that is currently being used by the Young
group to generate a murine model of colorectal cancer following
administration of the carcinogen, azoxymethane (Hu et al. (2005)
Int. J. Cancer 115: 561-567). The progeny of this cross will be
examined for enhanced LacZ expression in tumour cells relative to
surrounding epithelium.
[0271] To create transgenic mice, pronuclear injection of
constructs (linear DNA fragments containing expression cassettes)
into embryos isolated from pregnant, superovulated C57BL/6, females
will be performed and embryos reimplanted commercially at the GenSA
facility (IMVS, Adelaide). Resultant lines will be genotyped (by
PCR) for appropriate genomic insertion of the injected sequences,
as described in Rulicke T. and Hubscher U. (2000) Exp. Physiol. 85:
589-601.
[0272] These founder lines will be assessed for low copy number
insertion of the intact introduced expression cassettes and
screened for appropriate expression of the transgenes using
real-time RT-PCR and immunohistochemistry. Relative copy number
determinations will be made using PCR of genomic DNA and/or
Southern Blot analysis. Real time RT-PCR will utilize transgene
mRNA-specific primers and cDNA templates in a 1.times.SYBR green
PCR Master Mix (Applied Biosystems) reaction. A Corbett Rotorgene
2000 (Corbett Research Pty. Ltd., Australia) will be used for PCR
amplification and detection.
[0273] The final hybrid line will be inbred to ensure homozygosity
for the transgenes, before cross-breeding with the p53 mutant mouse
line and other murine models for cancer and polyposis.
Example 12
Effect of miRNA Target Sequences on Gene Expression in Stem Cells
and Their Derivatives
[0274] MicroRNA target sequences in the 3'UTR of reporter and
therapeutic genes will be used to assess the potential for
exploiting tissue (or cell lineage)-specific microRNAs to limit
transgene expression to defined cell lineages and tissues.
[0275] For example, target sequences for the neural-specific
miRNAs, miR124a and miR9, will be inserted into the 3'UTR of the
EGFP or LacZ reporter genes. A lentiviral delivery system will then
deliver the synthetic gene into the genomes of murine embryonic
stem cells. Transduced embryonic stem cells will then be induced to
differentiate into a variety of cells types, including neural
progenitors (using the stromal-cell derived induction method of
Kawasaki et al. (2000) Neuron 28: 31-40). Reporter gene activity
will be correlated with the expression of molecular markers to
define which cell lineages allow expression of the introduced gene
and which display miR9/124a-mediated silencing. Alternatively, the
transduced murine ES cells will be transferred into blastocysts to
generate chimeric mice, from which stable transgenic germ lines
will be generated (Pfeifer et al. (2001) Proc. Natl. Acad. Sci. USA
99: 2140-2145). The spatial expression of reporter genes will be
determined using direct detection (EGFP fluorescence or
3-galactosidase staining) or immunohistochemistry.
[0276] Other experiments will study miRNA-mediated transgene
regulation in cells that derive from transgenic adult stem cells.
These will involve in vitro and in vivo studies of transduced bone
marrow-derived stem cells, or haematopoietic progenitor cells,
containing reporter genes (or therapeutic genes) with embedded
miRNA target sequences. The target sequences will bind with
haematopoietic lineage-specific miRNAs, such as miR142-3p. For
example, the methodology may be accomplished as described in Brown
et al. (2006) Nature Medicine 12: 585-591.
Example 13
The Effect of Increasing miRNA Target Sequences in the 3'UTR of a
Transgene
[0277] Cells of the stable pMM110 transgenic HeLa Tet On cell line,
HT0110e, were grown in the presence, or absence, of 2 .quadrature.g
doxycycline/mL medium and FuGene6-transfected, one day after
plating, with 80 ng plasmid. The plasmids used for transfection
were all derived from pMM043, with varying numbers of miR145 target
sequences inserted in the EGFP 3'UTR NotI site. Plasmids were:
pMM043 (no targets), pMM095 (1 target), pMM117 (2 targets), pMM119
(8 targets). In this cell line, doxycycline induces the expression
of mature miR145 above the low background level present in HeLa
cells. Values displayed are the mean fluorescence (n=3) at 46 hours
after transfection.
[0278] The data is shown in FIG. 12. The data demonstrates the
Dox-inducible miR145 silencing of EGFP fluorescence in the
transiently transfected cell line HT0110e, with the extent of
silencing correlating with the number of miR145 target sequences
present in the 3'UTR of EGFP.
[0279] Finally, it will be appreciated that various modifications
and variations of the methods and compositions of the invention
described herein will be apparent to those skilled in the art
without departing from the scope and spirit of the invention.
Although the invention has been described in connection with
specific preferred embodiments, it should be understood that the
invention as claimed should not be unduly limited to such specific
embodiments. Indeed, various modifications of the described modes
for carrying out the invention which are apparent to those skilled
in the art are intended to be within the scope of the present
invention.
Sequence CWU 1
1
171180RNAHomo sapiens 1ugggaugagg uaguagguug uauaguuuua gggucacacc
caccacuggg agauaacuau 60acaaucuacu gucuuuccua 80222RNAHomo sapiens
2ugagguagua gguuguauag uu 22372RNAHomo sapiens 3agguugaggu
aguagguugu auaguuuaga auuacaucaa gggagauaac uguacagccu 60ccuagcuuuc
cu 72422RNAHomo sapiens 4ugagguagua gguuguauag uu 22574RNAHomo
sapiens 5gggugaggua guagguugua uaguuugggg cucugcccug cuaugggaua
acuauacaau 60cuacugucuu uccu 74622RNAHomo sapiens 6ugagguagua
gguuguauag uu 22783RNAHomo sapiens 7cggggugagg uaguagguug
ugugguuuca gggcagugau guugccccuc ggaagauaac 60uauacaaccu acugccuucc
cug 83822RNAHomo sapiens 8ugagguagua gguugugugg uu 22984RNAHomo
sapiens 9gcauccgggu ugagguagua gguuguaugg uuuagaguua cacccuggga
guuaacugua 60caaccuucua gcuuuccuug gagc 841022RNAHomo sapiens
10ugagguagua gguuguaugg uu 221187RNAHomo sapiens 11ucagagugag
guaguagauu guauaguugu gggguaguga uuuuacccug uucaggagau 60aacuauacaa
ucuauugccu ucccuga 871222RNAHomo sapiens 12ugagguagua gauuguauag uu
221383RNAHomo sapiens 13ugugggauga gguaguagau uguauaguuu uagggucaua
ccccaucuug gagauaacua 60uacagucuac ugucuuuccc acg 831422RNAHomo
sapiens 14ugagguagua gauuguauag uu 2215110RNAHomo sapiens
15ccagagguug uaacguuguc uauauauacc cuguagaacc gaauuugugu gguauccgua
60uagucacaga uucgauucua ggggaauaua uggucgaugc aaaaacuuca
1101622RNAHomo sapiens 16uacccuguag aaccgaauuu gu 221798RNAHomo
sapiens 17uugaggccuu aaaguacugu agcagcacau caugguuuac augcuacagu
caagaugcga 60aucauuauuu gcugcucuag aaauuuaagg aaauucau
981822RNAHomo sapiens 18uagcagcaca ucaugguuua ca 221989RNAHomo
sapiens 19gucagcagug ccuuagcagc acguaaauau uggcguuaag auucuaaaau
uaucuccagu 60auuaacugug cugcugaagu aagguugac 892022RNAHomo sapiens
20uagcagcacg uaaauauugg cg 222181RNAHomo sapiens 21guuccacucu
agcagcacgu aaauauuggc guagugaaau auauauuaaa caccaauauu 60acugugcugc
uuuaguguga c 812222RNAHomo sapiens 22uagcagcacg uaaauauugg cg
222387RNAHomo sapiens 23cacuguucua ugguuaguuu ugcagguuug cauccagcug
ugugauauuc ugcugugcaa 60auccaugcaa aacugacugu gguagug 872423RNAHomo
sapiens 24ugugcaaauc caugcaaaac uga 232596RNAHomo sapiens
25acauugcuac uuacaauuag uuuugcaggu uugcauuuca gcguauauau guauaugugg
60cugugcaaau ccaugcaaaa cugauuguga uaaugu 962623RNAHomo sapiens
26ugugcaaauc caugcaaaac uga 232771RNAHomo sapiens 27guagcacuaa
agugcuuaua gugcagguag uguuuaguua ucuacugcau uaugagcacu 60uaaaguacug
c 712823RNAHomo sapiens 28uaaagugcuu auagugcagg uag 232972RNAHomo
sapiens 29ugucggguag cuuaucagac ugauguugac uguugaaucu cauggcaaca
ccagucgaug 60ggcugucuga ca 723022RNAHomo sapiens 30uagcuuauca
gacugauguu ga 223185RNAHomo sapiens 31ggcugagccg caguaguucu
ucaguggcaa gcuuuauguc cugacccagc uaaagcugcc 60aguugaagaa cuguugcccu
cugcc 853222RNAHomo sapiens 32aagcugccag uugaagaacu gu
223373RNAHomo sapiens 33ggccggcugg gguuccuggg gaugggauuu gcuuccuguc
acaaaucaca uugccaggga 60uuuccaaccg acc 733421RNAHomo sapiens
34aucacauugc cagggauuuc c 213568RNAHomo sapiens 35cuccggugcc
uacugagcug auaucaguuc ucauuuuaca cacuggcuca guucagcagg 60aacaggag
683622RNAHomo sapiens 36uggcucaguu cagcaggaac ag 223723RNAHomo
sapiens 37gugccuacug agcugauauc agu 233873RNAHomo sapiens
38cucugccucc cgugccuacu gagcugaaac acaguugguu uguguacacu ggcucaguuc
60agcaggaaca ggg 733922RNAHomo sapiens 39uggcucaguu cagcaggaac ag
224077RNAHomo sapiens 40guggccucgu ucaaguaauc caggauaggc ugugcagguc
ccaaugggcc uauucuuggu 60uacuugcacg gggacgc 774122RNAHomo sapiens
41auucaaguaa uccaggauag gc 224277RNAHomo sapiens 42ccgggaccca
guucaaguaa uucaggauag guugugugcu guccagccug uucuccauua 60cuuggcucgg
ggaccgg 774322RNAHomo sapiens 43uucaaguaau ucaggauagg uu
224484RNAHomo sapiens 44ggcuguggcu ggauucaagu aauccaggau aggcuguuuc
caucugugag gccuauucuu 60gauuacuugu uucuggaggc agcu 844521RNAHomo
sapiens 45uucaaguaau ccaggauagg c 214697RNAHomo sapiens
46accucucuaa caaggugcag agcuuagcug auuggugaac agugauuggu uuccgcuuug
60uucacagugg cuaaguucug caccugaaga gaaggug 974721RNAHomo sapiens
47uucacagugg cuaaguucug c 214864RNAHomo sapiens 48augacugauu
ucuuuuggug uucagaguca auauaauuuu cuagcaccau cugaaaucgg 60uuau
644921RNAHomo sapiens 49uagcaccauc ugaaaucggu u 215071RNAHomo
sapiens 50gcgacuguaa acauccucga cuggaagcug ugaagccaca gaugggcuuu
cagucggaug 60uuugcagcug c 715122RNAHomo sapiens 51cuuucagucg
gauguuugca gc 225222RNAHomo sapiens 52uguaaacauc cucgacugga ag
225395RNAHomo sapiens 53cggccggccc uggguccauc uuccaguaca guguuggaug
gucuaauugu gaagcuccua 60acacugucug guaaagaugg cucccgggug gguuc
955422RNAHomo sapiens 54uaacacuguc ugguaaagau gg 225587RNAHomo
sapiens 55gacagugcag ucacccauaa aguagaaagc acuacuaaca gcacuggagg
guguaguguu 60uccuacuuua uggaugagug uacugug 875620RNAHomo sapiens
56cauaaaguag aaagcacuac 205723RNAHomo sapiens 57uguaguguuu
ccuacuuuau gga 2358106RNAHomo sapiens 58gcgcagcgcc cugucuccca
gccugaggug cagugcugca ucucugguca guugggaguc 60ugagaugaag cacuguagcu
caggaagaga gaaguuguuc ugcagc 1065922RNAHomo sapiens 59ugagaugaag
cacuguagcu ca 226088RNAHomo sapiens 60caccuugucc ucacggucca
guuuucccag gaaucccuua gaugcuaaga uggggauucc 60uggaaauacu guucuugagg
ucaugguu 886124RNAHomo sapiens 61guccaguuuu cccaggaauc ccuu
2462110RNAHomo sapiens 62gccgagaccg agugcacagg gcucugaccu
augaauugac agccagugcu cucgucuccc 60cucuggcugc caauuccaua ggucacaggu
auguucgccu caaugccagc 1106321RNAHomo sapiens 63cugaccuaug
aauugacagc c 216485RNAHomo sapiens 64augguguuau caaguguaac
agcaacucca uguggacugu guaccaauuu ccaguggaga 60ugcuguuacu uuugaugguu
accaa 856522RNAHomo sapiens 65uguaacagca acuccaugug ga
226685RNAHomo sapiens 66ugguucccgc ccccuguaac agcaacucca uguggaagug
cccacugguu ccaguggggc 60ugcuguuauc uggggcgagg gccag 856722RNAHomo
sapiens 67uguaacagca acuccaugug ga 2268110RNAHomo sapiens
68ccagaggaca ccuccacucc gucuacccag uguuuagacu aucuguucag gacucccaaa
60uuguacagua gucugcacau ugguuaggcu gggcuggguu agacccucgg
1106923RNAHomo sapiens 69cccaguguuu agacuaucug uuc 237095RNAHomo
sapiens 70ccagcucggg cagccguggc caucuuacug ggcagcauug gauggaguca
ggucucuaau 60acugccuggu aaugaugacg gcggagcccu gcacg 957123RNAHomo
sapiens 71uaauacugcc ugguaaugau gac 237268RNAHomo sapiens
72cccucgucuu acccagcagu guuugggugc gguugggagu cucuaauacu gccggguaau
60gauggagg 687322RNAHomo sapiens 73uaauacugcc ggguaaugau gg
227482RNAHomo sapiens 74gcuucgcucc ccuccgccuu cucuucccgg uucuucccgg
agucgggaaa agcuggguug 60agagggcgaa aaaggaugag gu 827523RNAHomo
sapiens 75aaaagcuggg uugagagggc gaa 237621RNAHomo sapiens
76uaagccaggg auuguggguu c 217771RNAHomo sapiens 77gcgacuguaa
acauccucga cuggaagcug ugaagccaca gaugggcuuu cagucggaug 60uuugcagcug
c 717822RNAHomo sapiens 78cuuucagucg gauguuugca gc 227922RNAHomo
sapiens 79uguaaacauc cucgacugga ag 228081RNAHomo sapiens
80cuucaggaag cugguuucau auggugguuu agauuuaaau agugauuguc uagcaccauu
60ugaaaucagu guucuugggg g 818123RNAHomo sapiens 81uagcaccauu
ugaaaucagu guu 238288RNAHomo sapiens 82ugcgcuccuc ucagucccug
agacccuaac uugugauguu uaccguuuaa auccacgggu 60uaggcucuug ggagcugcga
gucgugcu 888322RNAHomo sapiens 83ucccugagac ccuaacuugu ga
228486RNAHomo sapiens 84ugccagucuc uaggucccug agacccuuua accugugagg
acauccaggg ucacagguga 60gguucuuggg agccuggcgu cuggcc 868523RNAHomo
sapiens 85ucccugagac ccuuuaaccu gug 238689RNAHomo sapiens
86accagacuuu uccuaguccc ugagacccua acuugugagg uauuuuagua acaucacaag
60ucaggcucuu gggaccuagg cggagggga 898722RNAHomo sapiens
87ucccugagac ccuaacuugu ga 228883RNAHomo sapiens 88ccuuggagua
aaguagcagc acauaauggu uuguggauuu ugaaaaggug caggccauau 60ugugcugccu
caaaaauaca agg 838922RNAHomo sapiens 89uagcagcaca uaaugguuug ug
229085RNAHomo sapiens 90cgcuggcgac gggacauuau uacuuuuggu acgcgcugug
acacuucaaa cucguaccgu 60gaguaauaau gcgccgucca cggca 859121RNAHomo
sapiens 91cauuauuacu uuugguacgc g 219221RNAHomo sapiens
92ucguaccgug aguaauaaug c 219386RNAHomo sapiens 93ugcucccucu
cucacauccc uugcauggug gagggugagc uuucugaaaa ccccucccac 60augcaggguu
ugcaggaugg cgagcc 869422RNAHomo sapiens 94caucccuugc augguggagg gu
229594RNAHomo sapiens 95gaguuugguu uuguuugggu uuguucuagg uaugguccca
gggaucccag aucaaaccag 60gccccugggc cuauccuaga accaaccuaa gcuc
949621RNAHomo sapiens 96gccccugggc cuauccuaga a 219765RNAHomo
sapiens 97cuguuaaugc uaaucgugau agggguuuuu gccuccaacu gacuccuaca
uauuagcauu 60aacag 659822RNAHomo sapiens 98uuaaugcuaa ucgugauagg gg
229922RNAHomo sapiens 99aacuauacaa ccuacuaccu ca 2210022RNAHomo
sapiens 100aacuauacaa ccuacuaccu ca 2210122RNAHomo sapiens
101aacuauacaa ccuacuaccu ca 2210222RNAHomo sapiens 102aaccacacaa
ccuacuaccu ca 2210322RNAHomo sapiens 103aaccauacaa ccuacuaccu ca
2210422RNAHomo sapiens 104aacuauacaa ucuacuaccu ca 2210522RNAHomo
sapiens 105aacuauacaa ucuacuaccu ca 2210622RNAHomo sapiens
106acaaauucgg uucuacaggg ua 2210722RNAHomo sapiens 107uguaaaccau
gaugugcugc ua 2210822RNAHomo sapiens 108cgccaauauu uacgugcugc ua
2210922RNAHomo sapiens 109cgccaauauu uacgugcugc ua 2211023RNAHomo
sapiens 110ucaguuuugc auggauuugc aca 2311123RNAHomo sapiens
111ucaguuuugc auggauuugc aca 2311223RNAHomo sapiens 112cuaccugcac
uauaagcacu uua 2311322RNAHomo sapiens 113ucaacaucag ucugauaagc ua
2211422RNAHomo sapiens 114acaguucuuc aacuggcagc uu 2211521RNAHomo
sapiens 115ggaaaucccu ggcaauguga u 2111622RNAHomo sapiens
116cuguuccugc ugaacugagc ca 2211723RNAHomo sapiens 117acugauauca
gcucaguagg cac 2311822RNAHomo sapiens 118cuguuccugc ugaacugagc ca
2211922RNAHomo sapiens 119gccuauccug gauuacuuga au 2212022RNAHomo
sapiens 120aaccuauccu gaauuacuug aa 2212121RNAHomo sapiens
121gccuauccug gauuacuuga a 2112221RNAHomo sapiens 122gcagaacuua
gccacuguga a 2112321RNAHomo sapiens 123aaccgauuuc agauggugcu a
2112422RNAHomo sapiens 124gcugcaaaca uccgacugaa ag 2212522RNAHomo
sapiens 125cuuccagucg aggauguuua ca 2212622RNAHomo sapiens
126ccaucuuuac cagacagugu ua 2212720RNAHomo sapiens 127guagugcuuu
cuacuuuaug 2012823RNAHomo sapiens 128uccauaaagu aggaaacacu aca
2312922RNAHomo sapiens 129ugagcuacag ugcuucaucu ca 2213024RNAHomo
sapiens 130aagggauucc ugggaaaacu ggac 2413121RNAHomo sapiens
131ggcugucaau ucauagguca g 2113222RNAHomo sapiens 132uccacaugga
guugcuguua ca 2213322RNAHomo sapiens 133uccacaugga guugcuguua ca
2213423RNAHomo sapiens 134gaacagauag ucuaaacacu ggg 2313523RNAHomo
sapiens 135gucaucauua ccaggcagua uua 2313622RNAHomo sapiens
136ccaucauuac ccggcaguau ua 2213723RNAHomo sapiens 137uucgcccucu
caacccagcu uuu 2313821RNAHomo sapiens 138gaacccacaa ucccuggcuu a
2113922RNAHomo sapiens 139gcugcaaaca uccgacugaa ag 2214022RNAHomo
sapiens 140cuuccagucg aggauguuua ca 2214123RNAHomo sapiens
141aacacugauu ucaaauggug cua 2314222RNAHomo sapiens 142ucacaaguua
gggucucagg ga 2214323RNAHomo sapiens 143cacagguuaa agggucucag gga
2314422RNAHomo sapiens 144ucacaaguua gggucucagg ga 2214522RNAHomo
sapiens 145cacaaaccau uaugugcugc ua 2214621RNAHomo sapiens
146cgcguaccaa aaguaauaau g 2114721RNAHomo sapiens 147gcauuauuac
ucacgguacg a 2114822RNAHomo sapiens 148acccuccacc augcaaggga ug
2214921RNAHomo sapiens 149uucuaggaua ggcccagggg c 2115022RNAHomo
sapiens 150ccccuaucac gauuagcauu aa 221511131DNAherpes simplex
virus 7 151atggcttctc acgccggcca acagcacgcg cctgcgttcg gtcaggctgc
tcgtgcgagc 60gggcctaccg acggccgcgc ggcgtcccgt cctagccatc gccagggggc
ctccggagcc 120cgcggggatc cggagctgcc cacgctgctg cgggtttata
tagacggacc ccacggggtg 180gggaagacca ccacctccgc gcagctgatg
gaggccctgg ggccgcgcga caatatcgtc 240tacgtccccg agccgatgac
ttactggcag gtgctggggg cctccgagac
cctgacgaac 300atctacaaca cgcagcaccg tctggaccgc ggcgagatat
cggccgggga ggcggcggtg 360gtaatgacca gcgcccagat aacaatgagc
acgccttatg cggcgacgga cgccgttttg 420gctcctcata tcggggggga
ggctgtgggc ccgcaagccc cgcccccggc cctcaccctt 480gttttcgacc
ggcaccctat cgcctccctg ctgtgctacc cggccgcgcg gtacctcatg
540ggaagcatga ccccccaggc cgtgttggcg ttcgtggccc tcatgccccc
gaccgcgccc 600ggcacgaacc tggtcctggg tgtccttccg gaggccgaac
acgccgaccg cctggccaga 660cgccaacgcc cgggcgagcg gcttgacctg
gccatgctgt ccgccattcg ccgtgtctac 720gatctactcg ccaacacggt
gcggtacctg cagcgcggcg ggaggtggcg ggaggactgg 780ggccggctga
cgggggtcgc cgcggcgacc ccgcgccccg accccgagga cggcgcgggg
840tctctgcccc gcatcgagga cacgctgttt gccctgttcc gcgttcccga
gctgctggcc 900cccaacgggg acttgtacca catttttgcc tgggtcttgg
acgtcttggc cgaccgcctc 960cttccgatgc atctatttgt cctggattac
gatcagtcgc ccgtcgggtg tcgagacgcc 1020ctgttgcgcc tcaccgccgg
gatgatccca acccgcgtca caaccgccgg gtccatcgcc 1080gagatacgcg
acctggcgcg cacgtttgcc cgcgaggtgg ggggagttta g
11311521284DNAEscherichia coli 152gtgtcgaata acgctttaca aacaattatt
aacgcccggt taccaggcga agaggggctg 60tggcagattc atctgcagga cggaaaaatc
agcgccattg atgcgcaatc cggcgtgatg 120cccataactg aaaacagcct
ggatgccgaa caaggtttag ttataccgcc gtttgtggag 180ccacatattc
acctggacac cacgcaaacc gccggacaac cgaactggaa tcagtccggc
240acgctgtttg aaggcattga acgctgggcc gagcgcaaag cgttattaac
ccatgacgat 300gtgaaacaac gcgcatggca aacgctgaaa tggcagattg
ccaacggcat tcagcatgtg 360cgtacccatg tcgatgtttc ggatgcaacg
ctaactgcgc tgaaagcaat gctggaagtg 420aagcaggaag tcgcgccgtg
gattgatctg caaatcgtcg ccttccctca ggaagggatt 480ttgtcgtatc
ccaacggtga agcgttgctg gaagaggcgt tacgcttagg ggcagatgta
540gtgggggcga ttccgcattt tgaatttacc cgtgaatacg gcgtggagtc
gctgcataaa 600accttcgccc tggcgcaaaa atacgaccgt ctcatcgacg
ttcactgtga tgagatcgat 660gacgagcagt cgcgctttgt cgaaaccgtt
gctgccctgg cgcaccatga aggcatgggc 720gcgcgagtca ccgccagcca
caccacggca atgcactcct ataacggggc gtatacctca 780cgcctgttcc
gcttgctgaa aatgtccggt attaactttg tcgccaaccc gctggtcaat
840attcatctgc aaggacgttt cgatacgtat ccaaaacgtc gcggcatcac
gcgcgttaaa 900gagatgctgg agtccggcat taacgtctgc tttggtcacg
atgatgtctt cgatccgtgg 960tatccgctgg gaacggcgaa tatgctgcaa
gtgctgcata tggggctgca tgtttgccag 1020ttgatgggct acgggcagat
taacgatggc ctgaatttaa tcacccacca cagcgcaagg 1080acgttgaatt
tgcaggatta cggcattgcc gccggaaaca gcgccaacct gattatcctg
1140ccggctgaaa atgggtttga tgcgctgcgc cgtcaggttc cggtacgtta
ttcggtacgt 1200ggcggcaagg tgattgccag cacacaaccg gcacaaacca
ccgtatatct ggagcagcca 1260gaagccatcg attacaaacg ttga
12841536195DNAplasmid pMM095 153gacggatcgg gagatctccc gatcccctat
ggtgcactct cagtacaatc tgctctgatg 60ccgcatagtt aagccagtat ctgctccctg
cttgtgtgtt ggaggtcgct gagtagtgcg 120cgagcaaaat ttaagctaca
acaaggcaag gcttgaccga caattgcatg aagaatctgc 180ttagggttag
gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt
240gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat
agcccatata 300tggagttccg cgttacataa cttacggtaa atggcccgcc
tggctgaccg cccaacgacc 360cccgcccatt gacgtcaata atgacgtatg
ttcccatagt aacgccaata gggactttcc 420attgacgtca atgggtggag
tatttacggt aaactgccca cttggcagta catcaagtgt 480atcatatgcc
aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt
540atgcccagta catgacctta tgggactttc ctacttggca gtacatctac
gtattagtca 600tcgctattac catggtgatg cggttttggc agtacatcaa
tgggcgtgga tagcggtttg 660actcacgggg atttccaagt ctccacccca
ttgacgtcaa tgggagtttg ttttggcacc 720aaaatcaacg ggactttcca
aaatgtcgta acaactccgc cccattgacg caaatgggcg 780gtaggcgtgt
acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca
840ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa
gctggctagc 900gtttaaactt aagcttggta ccgagctcgg atctcgagct
caagcttcga attctgcagt 960cgacggtacc gcgggcccgg gatccaccgg
tcgccaccat ggtgagcaag ggcgaggagc 1020tgttcaccgg ggtggtgccc
atcctggtcg agctggacgg cgacgtaaac ggccacaagt 1080tcagcgtgtc
cggcgagggc gagggcgatg ccacctacgg caagctgacc ctgaagttca
1140tctgcaccac cggcaagctg cccgtgccct ggcccaccct cgtgaccacc
ctgacctacg 1200gcgtgcagtg cttcagccgc taccccgacc acatgaagca
gcacgacttc ttcaagtccg 1260ccatgcccga aggctacgtc caggagcgca
ccatcttctt caaggacgac ggcaactaca 1320agacccgcgc cgaggtgaag
ttcgagggcg acaccctggt gaaccgcatc gagctgaagg 1380gcatcgactt
caaggaggac ggcaacatcc tggggcacaa gctggagtac aactacaaca
1440gccacaacgt ctatatcatg gccgacaagc agaagaacgg catcaaggtg
aacttcaaga 1500tccgccacaa catcgaggac ggcagcgtgc agctcgccga
ccactaccag cagaacaccc 1560ccatcggcga cggccccgtg ctgctgcccg
acaaccacta cctgagcacc cagtccgccc 1620tgagcaaaga ccccaacgag
aagcgcgatc acatggtcct gctggagttc gtgaccgccg 1680ccgggatcac
tctcggcatg gacgagctgt acaagtaaag cggccgctcg agtctagcag
1740atcctgggaa aactggacct agagggcccg tttaaacccg ctgatcagcc
tcgactgtgc 1800cttctagttg ccagccatct gttgtttgcc cctcccccgt
gccttccttg accctggaag 1860gtgccactcc cactgtcctt tcctaataaa
atgaggaaat tgcatcgcat tgtctgagta 1920ggtgtcattc tattctgggg
ggtggggtgg ggcaggacag caagggggag gattgggaag 1980acaatagcag
gcatgctggg gatgcggtgg gctctatggc ttctgaggcg gaaagaacca
2040gctggggctc tagggggtat ccccacgcgc cctgtagcgg cgcattaagc
gcggcgggtg 2100tggtggttac gcgcagcgtg accgctacac ttgccagcgc
cctagcgccc gctcctttcg 2160ctttcttccc ttcctttctc gccacgttcg
ccggctttcc ccgtcaagct ctaaatcggg 2220ggctcccttt agggttccga
tttagtgctt tacggcacct cgaccccaaa aaacttgatt 2280agggtgatgg
ttcacgtagt gggccatcgc cctgatagac ggtttttcgc cctttgacgt
2340tggagtccac gttctttaat agtggactct tgttccaaac tggaacaaca
ctcaacccta 2400tctcggtcta ttcttttgat ttataaggga ttttgccgat
ttcggcctat tggttaaaaa 2460atgagctgat ttaacaaaaa tttaacgcga
attaattctg tggaatgtgt gtcagttagg 2520gtgtggaaag tccccaggct
ccccagcagg cagaagtatg caaagcatgc atctcaatta 2580gtcagcaacc
aggtgtggaa agtccccagg ctccccagca ggcagaagta tgcaaagcat
2640gcatctcaat tagtcagcaa ccatagtccc gcccctaact ccgcccatcc
cgcccctaac 2700tccgcccagt tccgcccatt ctccgcccca tggctgacta
atttttttta tttatgcaga 2760ggccgaggcc gcctctgcct ctgagctatt
ccagaagtag tgaggaggct tttttggagg 2820cctaggcttt tgcaaaaagc
tcccgggagc ttgtatatcc attttcggat ctgatcaaga 2880gacaggatga
ggatcgtttc gcatgattga acaagatgga ttgcacgcag gttctccggc
2940cgcttgggtg gagaggctat tcggctatga ctgggcacaa cagacaatcg
gctgctctga 3000tgccgccgtg ttccggctgt cagcgcaggg gcgcccggtt
ctttttgtca agaccgacct 3060gtccggtgcc ctgaatgaac tgcaggacga
ggcagcgcgg ctatcgtggc tggccacgac 3120gggcgttcct tgcgcagctg
tgctcgacgt tgtcactgaa gcgggaaggg actggctgct 3180attgggcgaa
gtgccggggc aggatctcct gtcatctcac cttgctcctg ccgagaaagt
3240atccatcatg gctgatgcaa tgcggcggct gcatacgctt gatccggcta
cctgcccatt 3300cgaccaccaa gcgaaacatc gcatcgagcg agcacgtact
cggatggaag ccggtcttgt 3360cgatcaggat gatctggacg aagagcatca
ggggctcgcg ccagccgaac tgttcgccag 3420gctcaaggcg cgcatgcccg
acggcgagga tctcgtcgtg acccatggcg atgcctgctt 3480gccgaatatc
atggtggaaa atggccgctt ttctggattc atcgactgtg gccggctggg
3540tgtggcggac cgctatcagg acatagcgtt ggctacccgt gatattgctg
aagagcttgg 3600cggcgaatgg gctgaccgct tcctcgtgct ttacggtatc
gccgctcccg attcgcagcg 3660catcgccttc tatcgccttc ttgacgagtt
cttctgagcg ggactctggg gttcgaaatg 3720accgaccaag cgacgcccaa
cctgccatca cgagatttcg attccaccgc cgccttctat 3780gaaaggttgg
gcttcggaat cgttttccgg gacgccggct ggatgatcct ccagcgcggg
3840gatctcatgc tggagttctt cgcccacccc aacttgttta ttgcagctta
taatggttac 3900aaataaagca atagcatcac aaatttcaca aataaagcat
ttttttcact gcattctagt 3960tgtggtttgt ccaaactcat caatgtatct
tatcatgtct gtataccgtc gacctctagc 4020tagagcttgg cgtaatcatg
gtcatagctg tttcctgtgt gaaattgtta tccgctcaca 4080attccacaca
acatacgagc cggaagcata aagtgtaaag cctggggtgc ctaatgagtg
4140agctaactca cattaattgc gttgcgctca ctgcccgctt tccagtcggg
aaacctgtcg 4200tgccagctgc attaatgaat cggccaacgc gcggggagag
gcggtttgcg tattgggcgc 4260tcttccgctt cctcgctcac tgactcgctg
cgctcggtcg ttcggctgcg gcgagcggta 4320tcagctcact caaaggcggt
aatacggtta tccacagaat caggggataa cgcaggaaag 4380aacatgtgag
caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg
4440tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc
aagtcagagg 4500tggcgaaacc cgacaggact ataaagatac caggcgtttc
cccctggaag ctccctcgtg 4560cgctctcctg ttccgaccct gccgcttacc
ggatacctgt ccgcctttct cccttcggga 4620agcgtggcgc tttctcatag
ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc 4680tccaagctgg
gctgtgtgca cgaacccccc gttcagcccg accgctgcgc cttatccggt
4740aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc
agcagccact 4800ggtaacagga ttagcagagc gaggtatgta ggcggtgcta
cagagttctt gaagtggtgg 4860cctaactacg gctacactag aagaacagta
tttggtatct gcgctctgct gaagccagtt 4920accttcggaa aaagagttgg
tagctcttga tccggcaaac aaaccaccgc tggtagcggt 4980ttttttgttt
gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg
5040atcttttcta cggggtctga cgctcagtgg aacgaaaact cacgttaagg
gattttggtc 5100atgagattat caaaaaggat cttcacctag atccttttaa
attaaaaatg aagttttaaa 5160tcaatctaaa gtatatatga gtaaacttgg
tctgacagtt accaatgctt aatcagtgag 5220gcacctatct cagcgatctg
tctatttcgt tcatccatag ttgcctgact ccccgtcgtg 5280tagataacta
cgatacggga gggcttacca tctggcccca gtgctgcaat gataccgcga
5340gacccacgct caccggctcc agatttatca gcaataaacc agccagccgg
aagggccgag 5400cgcagaagtg gtcctgcaac tttatccgcc tccatccagt
ctattaattg ttgccgggaa 5460gctagagtaa gtagttcgcc agttaatagt
ttgcgcaacg ttgttgccat tgctacaggc 5520atcgtggtgt cacgctcgtc
gtttggtatg gcttcattca gctccggttc ccaacgatca 5580aggcgagtta
catgatcccc catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg
5640atcgttgtca gaagtaagtt ggccgcagtg ttatcactca tggttatggc
agcactgcat 5700aattctctta ctgtcatgcc atccgtaaga tgcttttctg
tgactggtga gtactcaacc 5760aagtcattct gagaatagtg tatgcggcga
ccgagttgct cttgcccggc gtcaatacgg 5820gataataccg cgccacatag
cagaacttta aaagtgctca tcattggaaa acgttcttcg 5880gggcgaaaac
tctcaaggat cttaccgctg ttgagatcca gttcgatgta acccactcgt
5940gcacccaact gatcttcagc atcttttact ttcaccagcg tttctgggtg
agcaaaaaca 6000ggaaggcaaa atgccgcaaa aaagggaata agggcgacac
ggaaatgttg aatactcata 6060ctcttccttt ttcaatatta ttgaagcatt
tatcagggtt attgtctcat gagcggatac 6120atatttgaat gtatttagaa
aaataaacaa ataggggttc cgcgcacatt tccccgaaaa 6180gtgccacctg acgtc
61951543567DNAplasmid pMM105 154aattcgattt ccggtacttt tcagggcaat
tgaagttccg gtcactactc ccccccagag 60caataagcca catccggcga cgtgtggcac
cccaccctgg ctgctacaga tggggctgga 120tgcagaagag aactccagct
ggtccttagg gacacggcgg ccttggcgct gaaggccact 180cgctcccacc
ttgtcctcac ggtccagttt tcccaggaat cccttagatg ctaagatggg
240gattcctgga aatactgttc ttgaggtcat ggtttcacag ctggatttgc
ctccttccca 300ccccacagtt gccccccaat ggggcctcgg ctggctcaca
ggatgagggt tcaagaagaa 360ggctgtccct ggaggtaaga gggcttatga
accatgttcc aaacctttgc gttgcttttc 420tttccatcgt gtctatttca
taacatccct gtgaggctgg atgtgggaac ttcagcactg 480ccgtactctt
gggaaatttg tccaaggcca cccggctgag cagcggttga accaggacac
540atcaggcatg cgtttcttga atcactagtg aattcgcggc cgcctgcagg
tcgaccatat 600gggagagctc ccaacgcgtt ggatgcatag cttgagtatt
ctatagtgtc acctaaatag 660cttggcgtaa tcatggtcat agctgtttcc
tgtgtgaaat tgttatccgc tcacaattcc 720acacaacata cgagccggaa
gcataaagtg taaagcctgg ggtgcctaat gagtgagcta 780actcacatta
attgcgttgc gctcactgcc cgctttccag tcgggaaacc tgtcgtgcca
840gctgcattaa tgaatcggcc aacgcgcggg gagaggcggt ttgcgtattg
ggcgctcttc 900cgcttcctcg ctcactgact cgctgcgctc ggtcgttcgg
ctgcggcgag cggtatcagc 960tcactcaaag gcggtaatac ggttatccac
agaatcaggg gataacgcag gaaagaacat 1020gtgagcaaaa ggccagcaaa
aggccaggaa ccgtaaaaag gccgcgttgc tggcgttttt 1080ccataggctc
cgcccccctg acgagcatca caaaaatcga cgctcaagtc agaggtggcg
1140aaacccgaca ggactataaa gataccaggc gtttccccct ggaagctccc
tcgtgcgctc 1200tcctgttccg accctgccgc ttaccggata cctgtccgcc
tttctccctt cgggaagcgt 1260ggcgctttct catagctcac gctgtaggta
tctcagttcg gtgtaggtcg ttcgctccaa 1320gctgggctgt gtgcacgaac
cccccgttca gcccgaccgc tgcgccttat ccggtaacta 1380tcgtcttgag
tccaacccgg taagacacga cttatcgcca ctggcagcag ccactggtaa
1440caggattagc agagcgaggt atgtaggcgg tgctacagag ttcttgaagt
ggtggcctaa 1500ctacggctac actagaagaa cagtatttgg tatctgcgct
ctgctgaagc cagttacctt 1560cggaaaaaga gttggtagct cttgatccgg
caaacaaacc accgctggta gcggtggttt 1620ttttgtttgc aagcagcaga
ttacgcgcag aaaaaaagga tctcaagaag atcctttgat 1680cttttctacg
gggtctgacg ctcagtggaa cgaaaactca cgttaaggga ttttggtcat
1740gagattatca aaaaggatct tcacctagat ccttttaaat taaaaatgaa
gttttaaatc 1800aatctaaagt atatatgagt aaacttggtc tgacagttac
caatgcttaa tcagtgaggc 1860acctatctca gcgatctgtc tatttcgttc
atccatagtt gcctgactcc ccgtcgtgta 1920gataactacg atacgggagg
gcttaccatc tggccccagt gctgcaatga taccgcgaga 1980cccacgctca
ccggctccag atttatcagc aataaaccag ccagccggaa gggccgagcg
2040cagaagtggt cctgcaactt tatccgcctc catccagtct attaattgtt
gccgggaagc 2100tagagtaagt agttcgccag ttaatagttt gcgcaacgtt
gttgccattg ctacaggcat 2160cgtggtgtca cgctcgtcgt ttggtatggc
ttcattcagc tccggttccc aacgatcaag 2220gcgagttaca tgatccccca
tgttgtgcaa aaaagcggtt agctccttcg gtcctccgat 2280cgttgtcaga
agtaagttgg ccgcagtgtt atcactcatg gttatggcag cactgcataa
2340ttctcttact gtcatgccat ccgtaagatg cttttctgtg actggtgagt
actcaaccaa 2400gtcattctga gaatagtgta tgcggcgacc gagttgctct
tgcccggcgt caatacggga 2460taataccgcg ccacatagca gaactttaaa
agtgctcatc attggaaaac gttcttcggg 2520gcgaaaactc tcaaggatct
taccgctgtt gagatccagt tcgatgtaac ccactcgtgc 2580acccaactga
tcttcagcat cttttacttt caccagcgtt tctgggtgag caaaaacagg
2640aaggcaaaat gccgcaaaaa agggaataag ggcgacacgg aaatgttgaa
tactcatact 2700cttccttttt caatattatt gaagcattta tcagggttat
tgtctcatga gcggatacat 2760atttgaatgt atttagaaaa ataaacaaat
aggggttccg cgcacatttc cccgaaaagt 2820gccacctgat gcggtgtgaa
ataccgcaca gatgcgtaag gagaaaatac cgcatcagga 2880aattgtaagc
gttaatattt tgttaaaatt cgcgttaaat ttttgttaaa tcagctcatt
2940ttttaaccaa taggccgaaa tcggcaaaat cccttataaa tcaaaagaat
agaccgagat 3000agggttgagt gttgttccag tttggaacaa gagtccacta
ttaaagaacg tggactccaa 3060cgtcaaaggg cgaaaaaccg tctatcaggg
cgatggccca ctacgtgaac catcacccta 3120atcaagtttt ttggggtcga
ggtgccgtaa agcactaaat cggaacccta aagggagccc 3180ccgatttaga
gcttgacggg gaaagccggc gaacgtggcg agaaaggaag ggaagaaagc
3240gaaaggagcg ggcgctaggg cgctggcaag tgtagcggtc acgctgcgcg
taaccaccac 3300acccgccgcg cttaatgcgc cgctacaggg cgcgtccatt
cgccattcag gctgcgcaac 3360tgttgggaag ggcgatcggt gcgggcctct
tcgctattac gccagctggc gaaaggggga 3420tgtgctgcaa ggcgattaag
ttgggtaacg ccagggtttt cccagtcacg acgttgtaaa 3480acgacggcca
gtgaattgta atacgactca ctatagggcg aattgggccc gacgtcgcat
3540gctcccggcc gccatggcgg ccgcggg 35671555998DNAplasmid pMM106
155aattcactag tgattcaaga aacgcatgcc tgatgtgtcc tggttcaacc
gctgctcagc 60cgggtggcct tggacaaatt tcccaagagt acggcagtgc tgaagttccc
acatccagcc 120tcacagggat gttatgaaat agacacgatg gaaagaaaag
caacgcaaag gtttggaaca 180tggttcataa gccctcttac ctccagggac
agccttcttc ttgaaccctc atcctgtgag 240ccagccgagg ccccattggg
gggcaactgt ggggtgggaa ggaggcaaat ccagctgtga 300aaccatgacc
tcaagaacag tatttccagg aatccccatc ttagcatcta agggattcct
360gggaaaactg gaccgtgagg acaaggtggg agcgagtggc cttcagcgcc
aaggccgccg 420tgtccctaag gaccagctgg agttctcttc tgcatccagc
cccatctgta gcagccaggg 480tggggtgcca cacgtcgccg gatgtggctt
attgctctgg gggggagtag tgaccggaac 540ttcaattgcc ctgaaaagta
ccggaaatcg aattctgcag atatccagca cagtggcggc 600cgctcgagtc
tagagggccc gtttaaaccc gctgatcagc ctcgactgtg ccttctagtt
660gccagccatc tgttgtttgc ccctcccccg tgccttcctt gaccctggaa
ggtgccactc 720ccactgtcct ttcctaataa aatgaggaaa ttgcatcgca
ttgtctgagt aggtgtcatt 780ctattctggg gggtggggtg gggcaggaca
gcaaggggga ggattgggaa gacaatagca 840ggcatgctgg ggatgcggtg
ggctctatgg cttctgaggc ggaaagaacc agctggggct 900ctagggggta
tccccacgcg ccctgtagcg gcgcattaag cgcggcgggt gtggtggtta
960cgcgcagcgt gaccgctaca cttgccagcg ccctagcgcc cgctcctttc
gctttcttcc 1020cttcctttct cgccacgttc gccggctttc cccgtcaagc
tctaaatcgg gggctccctt 1080tagggttccg atttagtgct ttacggcacc
tcgaccccaa aaaacttgat tagggtgatg 1140gttcacgtag tgggccatcg
ccctgataga cggtttttcg ccctttgacg ttggagtcca 1200cgttctttaa
tagtggactc ttgttccaaa ctggaacaac actcaaccct atctcggtct
1260attcttttga tttataaggg attttgccga tttcggccta ttggttaaaa
aatgagctga 1320tttaacaaaa atttaacgcg aattaattct gtggaatgtg
tgtcagttag ggtgtggaaa 1380gtccccaggc tccccagcag gcagaagtat
gcaaagcatg catctcaatt agtcagcaac 1440caggtgtgga aagtccccag
gctccccagc aggcagaagt atgcaaagca tgcatctcaa 1500ttagtcagca
accatagtcc cgcccctaac tccgcccatc ccgcccctaa ctccgcccag
1560ttccgcccat tctccgcccc atggctgact aatttttttt atttatgcag
aggccgaggc 1620cgcctctgcc tctgagctat tccagaagta gtgaggaggc
ttttttggag gcctaggctt 1680ttgcaaaaag ctcccgggag cttgtatatc
cattttcgga tctgatcaag agacaggatg 1740aggatcgttt cgcatgattg
aacaagatgg attgcacgca ggttctccgg ccgcttgggt 1800ggagaggcta
ttcggctatg actgggcaca acagacaatc ggctgctctg atgccgccgt
1860gttccggctg tcagcgcagg ggcgcccggt tctttttgtc aagaccgacc
tgtccggtgc 1920cctgaatgaa ctgcaggacg aggcagcgcg gctatcgtgg
ctggccacga cgggcgttcc 1980ttgcgcagct gtgctcgacg ttgtcactga
agcgggaagg gactggctgc tattgggcga 2040agtgccgggg caggatctcc
tgtcatctca ccttgctcct gccgagaaag tatccatcat 2100ggctgatgca
atgcggcggc tgcatacgct tgatccggct acctgcccat tcgaccacca
2160agcgaaacat cgcatcgagc gagcacgtac tcggatggaa gccggtcttg
tcgatcagga 2220tgatctggac gaagagcatc aggggctcgc gccagccgaa
ctgttcgcca ggctcaaggc 2280gcgcatgccc gacggcgagg atctcgtcgt
gacccatggc gatgcctgct tgccgaatat 2340catggtggaa aatggccgct
tttctggatt catcgactgt ggccggctgg gtgtggcgga 2400ccgctatcag
gacatagcgt tggctacccg tgatattgct gaagagcttg gcggcgaatg
2460ggctgaccgc ttcctcgtgc tttacggtat cgccgctccc gattcgcagc
gcatcgcctt 2520ctatcgcctt cttgacgagt tcttctgagc gggactctgg
ggttcgaaat gaccgaccaa 2580gcgacgccca acctgccatc acgagatttc
gattccaccg ccgccttcta tgaaaggttg 2640ggcttcggaa tcgttttccg
ggacgccggc tggatgatcc tccagcgcgg ggatctcatg 2700ctggagttct
tcgcccaccc caacttgttt attgcagctt ataatggtta caaataaagc
2760aatagcatca caaatttcac aaataaagca tttttttcac tgcattctag
ttgtggtttg 2820tccaaactca tcaatgtatc ttatcatgtc tgtataccgt
cgacctctag ctagagcttg 2880gcgtaatcat ggtcatagct gtttcctgtg
tgaaattgtt atccgctcac
aattccacac 2940aacatacgag ccggaagcat aaagtgtaaa gcctggggtg
cctaatgagt gagctaactc 3000acattaattg cgttgcgctc actgcccgct
ttccagtcgg gaaacctgtc gtgccagctg 3060cattaatgaa tcggccaacg
cgcggggaga ggcggtttgc gtattgggcg ctcttccgct 3120tcctcgctca
ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt atcagctcac
3180tcaaaggcgg taatacggtt atccacagaa tcaggggata acgcaggaaa
gaacatgtga 3240gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg
cgttgctggc gtttttccat 3300aggctccgcc cccctgacga gcatcacaaa
aatcgacgct caagtcagag gtggcgaaac 3360ccgacaggac tataaagata
ccaggcgttt ccccctggaa gctccctcgt gcgctctcct 3420gttccgaccc
tgccgcttac cggatacctg tccgcctttc tcccttcggg aagcgtggcg
3480ctttctcata gctcacgctg taggtatctc agttcggtgt aggtcgttcg
ctccaagctg 3540ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg
ccttatccgg taactatcgt 3600cttgagtcca acccggtaag acacgactta
tcgccactgg cagcagccac tggtaacagg 3660attagcagag cgaggtatgt
aggcggtgct acagagttct tgaagtggtg gcctaactac 3720ggctacacta
gaagaacagt atttggtatc tgcgctctgc tgaagccagt taccttcgga
3780aaaagagttg gtagctcttg atccggcaaa caaaccaccg ctggtagcgg
tttttttgtt 3840tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag
aagatccttt gatcttttct 3900acggggtctg acgctcagtg gaacgaaaac
tcacgttaag ggattttggt catgagatta 3960tcaaaaagga tcttcaccta
gatcctttta aattaaaaat gaagttttaa atcaatctaa 4020agtatatatg
agtaaacttg gtctgacagt taccaatgct taatcagtga ggcacctatc
4080tcagcgatct gtctatttcg ttcatccata gttgcctgac tccccgtcgt
gtagataact 4140acgatacggg agggcttacc atctggcccc agtgctgcaa
tgataccgcg agacccacgc 4200tcaccggctc cagatttatc agcaataaac
cagccagccg gaagggccga gcgcagaagt 4260ggtcctgcaa ctttatccgc
ctccatccag tctattaatt gttgccggga agctagagta 4320agtagttcgc
cagttaatag tttgcgcaac gttgttgcca ttgctacagg catcgtggtg
4380tcacgctcgt cgtttggtat ggcttcattc agctccggtt cccaacgatc
aaggcgagtt 4440acatgatccc ccatgttgtg caaaaaagcg gttagctcct
tcggtcctcc gatcgttgtc 4500agaagtaagt tggccgcagt gttatcactc
atggttatgg cagcactgca taattctctt 4560actgtcatgc catccgtaag
atgcttttct gtgactggtg agtactcaac caagtcattc 4620tgagaatagt
gtatgcggcg accgagttgc tcttgcccgg cgtcaatacg ggataatacc
4680gcgccacata gcagaacttt aaaagtgctc atcattggaa aacgttcttc
ggggcgaaaa 4740ctctcaagga tcttaccgct gttgagatcc agttcgatgt
aacccactcg tgcacccaac 4800tgatcttcag catcttttac tttcaccagc
gtttctgggt gagcaaaaac aggaaggcaa 4860aatgccgcaa aaaagggaat
aagggcgaca cggaaatgtt gaatactcat actcttcctt 4920tttcaatatt
attgaagcat ttatcagggt tattgtctca tgagcggata catatttgaa
4980tgtatttaga aaaataaaca aataggggtt ccgcgcacat ttccccgaaa
agtgccacct 5040gacgtcgacg gatcgggaga tctcccgatc ccctatggtg
cactctcagt acaatctgct 5100ctgatgccgc atagttaagc cagtatctgc
tccctgcttg tgtgttggag gtcgctgagt 5160agtgcgcgag caaaatttaa
gctacaacaa ggcaaggctt gaccgacaat tgcatgaaga 5220atctgcttag
ggttaggcgt tttgcgctgc ttcgcgatgt acgggccaga tatacgcgtt
5280gacattgatt attgactagt tattaatagt aatcaattac ggggtcatta
gttcatagcc 5340catatatgga gttccgcgtt acataactta cggtaaatgg
cccgcctggc tgaccgccca 5400acgacccccg cccattgacg tcaataatga
cgtatgttcc catagtaacg ccaataggga 5460ctttccattg acgtcaatgg
gtggagtatt tacggtaaac tgcccacttg gcagtacatc 5520aagtgtatca
tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct
5580ggcattatgc ccagtacatg accttatggg actttcctac ttggcagtac
atctacgtat 5640tagtcatcgc tattaccatg gtgatgcggt tttggcagta
catcaatggg cgtggatagc 5700ggtttgactc acggggattt ccaagtctcc
accccattga cgtcaatggg agtttgtttt 5760ggcaccaaaa tcaacgggac
tttccaaaat gtcgtaacaa ctccgcccca ttgacgcaaa 5820tgggcggtag
gcgtgtacgg tgggaggtct atataagcag agctctctgg ctaactagag
5880aacccactgc ttactggctt atcgaaatta atacgactca ctatagggag
acccaagctg 5940gctagcgttt aaacttaagc ttggtaccga gctcggatcc
actagtccag tgtggtgg 59981566568DNAplasmid pMM107 156aattcgattt
ccggtacttt tcagggcaat tgaagttccg gtcactactc ccccccagag 60caataagcca
catccggcga cgtgtggcac cccaccctgg ctgctacaga tggggctgga
120tgcagaagag aactccagct ggtccttagg gacacggcgg ccttggcgct
gaaggccact 180cgctcccacc ttgtcctcac ggtccagttt tcccaggaat
cccttagatg ctaagatggg 240gattcctgga aatactgttc ttgaggtcat
ggtttcacag ctggatttgc ctccttccca 300ccccacagtt gccccccaat
ggggcctcgg ctggctcaca ggatgagggt tcaagaagaa 360ggctgtccct
ggaggtaaga gggcttatga accatgttcc aaacctttgc gttgcttttc
420tttccatcgt gtctatttca taacatccct gtgaggctgg atgtgggaac
ttcagcactg 480ccgtactctt gggaaatttg tccaaggcca cccggctgag
cagcggttga accaggacac 540atcaggcatg cgtttcttga atcactagtg
aattcgattt ccggtacttt tcagggcaat 600tgaagttccg gtcactactc
ccccccagag caataagcca catccggcga cgtgtggcac 660cccaccctgg
ctgctacaga tggggctgga tgcagaagag aactccagct ggtccttagg
720gacacggcgg ccttggcgct gaaggccact cgctcccacc ttgtcctcac
ggtccagttt 780tcccaggaat cccttagatg ctaagatggg gattcctgga
aatactgttc ttgaggtcat 840ggtttcacag ctggatttgc ctccttccca
ccccacagtt gccccccaat ggggcctcgg 900ctggctcaca ggatgagggt
tcaagaagaa ggctgtccct ggaggtaaga gggcttatga 960accatgttcc
aaacctttgc gttgcttttc tttccatcgt gtctatttca taacatccct
1020gtgaggctgg atgtgggaac ttcagcactg ccgtactctt gggaaatttg
tccaaggcca 1080cccggctgag cagcggttga accaggacac atcaggcatg
cgtttcttga atcactagtg 1140aattctgcag atatccagca cagtggcggc
cgctcgagtc tagagggccc gtttaaaccc 1200gctgatcagc ctcgactgtg
ccttctagtt gccagccatc tgttgtttgc ccctcccccg 1260tgccttcctt
gaccctggaa ggtgccactc ccactgtcct ttcctaataa aatgaggaaa
1320ttgcatcgca ttgtctgagt aggtgtcatt ctattctggg gggtggggtg
gggcaggaca 1380gcaaggggga ggattgggaa gacaatagca ggcatgctgg
ggatgcggtg ggctctatgg 1440cttctgaggc ggaaagaacc agctggggct
ctagggggta tccccacgcg ccctgtagcg 1500gcgcattaag cgcggcgggt
gtggtggtta cgcgcagcgt gaccgctaca cttgccagcg 1560ccctagcgcc
cgctcctttc gctttcttcc cttcctttct cgccacgttc gccggctttc
1620cccgtcaagc tctaaatcgg gggctccctt tagggttccg atttagtgct
ttacggcacc 1680tcgaccccaa aaaacttgat tagggtgatg gttcacgtag
tgggccatcg ccctgataga 1740cggtttttcg ccctttgacg ttggagtcca
cgttctttaa tagtggactc ttgttccaaa 1800ctggaacaac actcaaccct
atctcggtct attcttttga tttataaggg attttgccga 1860tttcggccta
ttggttaaaa aatgagctga tttaacaaaa atttaacgcg aattaattct
1920gtggaatgtg tgtcagttag ggtgtggaaa gtccccaggc tccccagcag
gcagaagtat 1980gcaaagcatg catctcaatt agtcagcaac caggtgtgga
aagtccccag gctccccagc 2040aggcagaagt atgcaaagca tgcatctcaa
ttagtcagca accatagtcc cgcccctaac 2100tccgcccatc ccgcccctaa
ctccgcccag ttccgcccat tctccgcccc atggctgact 2160aatttttttt
atttatgcag aggccgaggc cgcctctgcc tctgagctat tccagaagta
2220gtgaggaggc ttttttggag gcctaggctt ttgcaaaaag ctcccgggag
cttgtatatc 2280cattttcgga tctgatcaag agacaggatg aggatcgttt
cgcatgattg aacaagatgg 2340attgcacgca ggttctccgg ccgcttgggt
ggagaggcta ttcggctatg actgggcaca 2400acagacaatc ggctgctctg
atgccgccgt gttccggctg tcagcgcagg ggcgcccggt 2460tctttttgtc
aagaccgacc tgtccggtgc cctgaatgaa ctgcaggacg aggcagcgcg
2520gctatcgtgg ctggccacga cgggcgttcc ttgcgcagct gtgctcgacg
ttgtcactga 2580agcgggaagg gactggctgc tattgggcga agtgccgggg
caggatctcc tgtcatctca 2640ccttgctcct gccgagaaag tatccatcat
ggctgatgca atgcggcggc tgcatacgct 2700tgatccggct acctgcccat
tcgaccacca agcgaaacat cgcatcgagc gagcacgtac 2760tcggatggaa
gccggtcttg tcgatcagga tgatctggac gaagagcatc aggggctcgc
2820gccagccgaa ctgttcgcca ggctcaaggc gcgcatgccc gacggcgagg
atctcgtcgt 2880gacccatggc gatgcctgct tgccgaatat catggtggaa
aatggccgct tttctggatt 2940catcgactgt ggccggctgg gtgtggcgga
ccgctatcag gacatagcgt tggctacccg 3000tgatattgct gaagagcttg
gcggcgaatg ggctgaccgc ttcctcgtgc tttacggtat 3060cgccgctccc
gattcgcagc gcatcgcctt ctatcgcctt cttgacgagt tcttctgagc
3120gggactctgg ggttcgaaat gaccgaccaa gcgacgccca acctgccatc
acgagatttc 3180gattccaccg ccgccttcta tgaaaggttg ggcttcggaa
tcgttttccg ggacgccggc 3240tggatgatcc tccagcgcgg ggatctcatg
ctggagttct tcgcccaccc caacttgttt 3300attgcagctt ataatggtta
caaataaagc aatagcatca caaatttcac aaataaagca 3360tttttttcac
tgcattctag ttgtggtttg tccaaactca tcaatgtatc ttatcatgtc
3420tgtataccgt cgacctctag ctagagcttg gcgtaatcat ggtcatagct
gtttcctgtg 3480tgaaattgtt atccgctcac aattccacac aacatacgag
ccggaagcat aaagtgtaaa 3540gcctggggtg cctaatgagt gagctaactc
acattaattg cgttgcgctc actgcccgct 3600ttccagtcgg gaaacctgtc
gtgccagctg cattaatgaa tcggccaacg cgcggggaga 3660ggcggtttgc
gtattgggcg ctcttccgct tcctcgctca ctgactcgct gcgctcggtc
3720gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg taatacggtt
atccacagaa 3780tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc
agcaaaaggc caggaaccgt 3840aaaaaggccg cgttgctggc gtttttccat
aggctccgcc cccctgacga gcatcacaaa 3900aatcgacgct caagtcagag
gtggcgaaac ccgacaggac tataaagata ccaggcgttt 3960ccccctggaa
gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg
4020tccgcctttc tcccttcggg aagcgtggcg ctttctcata gctcacgctg
taggtatctc 4080agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc
acgaaccccc cgttcagccc 4140gaccgctgcg ccttatccgg taactatcgt
cttgagtcca acccggtaag acacgactta 4200tcgccactgg cagcagccac
tggtaacagg attagcagag cgaggtatgt aggcggtgct 4260acagagttct
tgaagtggtg gcctaactac ggctacacta gaagaacagt atttggtatc
4320tgcgctctgc tgaagccagt taccttcgga aaaagagttg gtagctcttg
atccggcaaa 4380caaaccaccg ctggtagcgg tttttttgtt tgcaagcagc
agattacgcg cagaaaaaaa 4440ggatctcaag aagatccttt gatcttttct
acggggtctg acgctcagtg gaacgaaaac 4500tcacgttaag ggattttggt
catgagatta tcaaaaagga tcttcaccta gatcctttta 4560aattaaaaat
gaagttttaa atcaatctaa agtatatatg agtaaacttg gtctgacagt
4620taccaatgct taatcagtga ggcacctatc tcagcgatct gtctatttcg
ttcatccata 4680gttgcctgac tccccgtcgt gtagataact acgatacggg
agggcttacc atctggcccc 4740agtgctgcaa tgataccgcg agacccacgc
tcaccggctc cagatttatc agcaataaac 4800cagccagccg gaagggccga
gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag 4860tctattaatt
gttgccggga agctagagta agtagttcgc cagttaatag tttgcgcaac
4920gttgttgcca ttgctacagg catcgtggtg tcacgctcgt cgtttggtat
ggcttcattc 4980agctccggtt cccaacgatc aaggcgagtt acatgatccc
ccatgttgtg caaaaaagcg 5040gttagctcct tcggtcctcc gatcgttgtc
agaagtaagt tggccgcagt gttatcactc 5100atggttatgg cagcactgca
taattctctt actgtcatgc catccgtaag atgcttttct 5160gtgactggtg
agtactcaac caagtcattc tgagaatagt gtatgcggcg accgagttgc
5220tcttgcccgg cgtcaatacg ggataatacc gcgccacata gcagaacttt
aaaagtgctc 5280atcattggaa aacgttcttc ggggcgaaaa ctctcaagga
tcttaccgct gttgagatcc 5340agttcgatgt aacccactcg tgcacccaac
tgatcttcag catcttttac tttcaccagc 5400gtttctgggt gagcaaaaac
aggaaggcaa aatgccgcaa aaaagggaat aagggcgaca 5460cggaaatgtt
gaatactcat actcttcctt tttcaatatt attgaagcat ttatcagggt
5520tattgtctca tgagcggata catatttgaa tgtatttaga aaaataaaca
aataggggtt 5580ccgcgcacat ttccccgaaa agtgccacct gacgtcgacg
gatcgggaga tctcccgatc 5640ccctatggtg cactctcagt acaatctgct
ctgatgccgc atagttaagc cagtatctgc 5700tccctgcttg tgtgttggag
gtcgctgagt agtgcgcgag caaaatttaa gctacaacaa 5760ggcaaggctt
gaccgacaat tgcatgaaga atctgcttag ggttaggcgt tttgcgctgc
5820ttcgcgatgt acgggccaga tatacgcgtt gacattgatt attgactagt
tattaatagt 5880aatcaattac ggggtcatta gttcatagcc catatatgga
gttccgcgtt acataactta 5940cggtaaatgg cccgcctggc tgaccgccca
acgacccccg cccattgacg tcaataatga 6000cgtatgttcc catagtaacg
ccaataggga ctttccattg acgtcaatgg gtggagtatt 6060tacggtaaac
tgcccacttg gcagtacatc aagtgtatca tatgccaagt acgcccccta
6120ttgacgtcaa tgacggtaaa tggcccgcct ggcattatgc ccagtacatg
accttatggg 6180actttcctac ttggcagtac atctacgtat tagtcatcgc
tattaccatg gtgatgcggt 6240tttggcagta catcaatggg cgtggatagc
ggtttgactc acggggattt ccaagtctcc 6300accccattga cgtcaatggg
agtttgtttt ggcaccaaaa tcaacgggac tttccaaaat 6360gtcgtaacaa
ctccgcccca ttgacgcaaa tgggcggtag gcgtgtacgg tgggaggtct
6420atataagcag agctctctgg ctaactagag aacccactgc ttactggctt
atcgaaatta 6480atacgactca ctatagggag acccaagctg gctagcgttt
aaacttaagc ttggtaccga 6540gctcggatcc actagtccag tgtggtgg
65681575998DNAplasmid pMM109 157aattcgattt ccggtacttt tcagggcaat
tgaagttccg gtcactactc ccccccagag 60caataagcca catccggcga cgtgtggcac
cccaccctgg ctgctacaga tggggctgga 120tgcagaagag aactccagct
ggtccttagg gacacggcgg ccttggcgct gaaggccact 180cgctcccacc
ttgtcctcac ggtccagttt tcccaggaat cccttagatg ctaagatggg
240gattcctgga aatactgttc ttgaggtcat ggtttcacag ctggatttgc
ctccttccca 300ccccacagtt gccccccaat ggggcctcgg ctggctcaca
ggatgagggt tcaagaagaa 360ggctgtccct ggaggtaaga gggcttatga
accatgttcc aaacctttgc gttgcttttc 420tttccatcgt gtctatttca
taacatccct gtgaggctgg atgtgggaac ttcagcactg 480ccgtactctt
gggaaatttg tccaaggcca cccggctgag cagcggttga accaggacac
540atcaggcatg cgtttcttga atcactagtg aattctgcag atatccagca
cagtggcggc 600cgctcgagtc tagagggccc gtttaaaccc gctgatcagc
ctcgactgtg ccttctagtt 660gccagccatc tgttgtttgc ccctcccccg
tgccttcctt gaccctggaa ggtgccactc 720ccactgtcct ttcctaataa
aatgaggaaa ttgcatcgca ttgtctgagt aggtgtcatt 780ctattctggg
gggtggggtg gggcaggaca gcaaggggga ggattgggaa gacaatagca
840ggcatgctgg ggatgcggtg ggctctatgg cttctgaggc ggaaagaacc
agctggggct 900ctagggggta tccccacgcg ccctgtagcg gcgcattaag
cgcggcgggt gtggtggtta 960cgcgcagcgt gaccgctaca cttgccagcg
ccctagcgcc cgctcctttc gctttcttcc 1020cttcctttct cgccacgttc
gccggctttc cccgtcaagc tctaaatcgg gggctccctt 1080tagggttccg
atttagtgct ttacggcacc tcgaccccaa aaaacttgat tagggtgatg
1140gttcacgtag tgggccatcg ccctgataga cggtttttcg ccctttgacg
ttggagtcca 1200cgttctttaa tagtggactc ttgttccaaa ctggaacaac
actcaaccct atctcggtct 1260attcttttga tttataaggg attttgccga
tttcggccta ttggttaaaa aatgagctga 1320tttaacaaaa atttaacgcg
aattaattct gtggaatgtg tgtcagttag ggtgtggaaa 1380gtccccaggc
tccccagcag gcagaagtat gcaaagcatg catctcaatt agtcagcaac
1440caggtgtgga aagtccccag gctccccagc aggcagaagt atgcaaagca
tgcatctcaa 1500ttagtcagca accatagtcc cgcccctaac tccgcccatc
ccgcccctaa ctccgcccag 1560ttccgcccat tctccgcccc atggctgact
aatttttttt atttatgcag aggccgaggc 1620cgcctctgcc tctgagctat
tccagaagta gtgaggaggc ttttttggag gcctaggctt 1680ttgcaaaaag
ctcccgggag cttgtatatc cattttcgga tctgatcaag agacaggatg
1740aggatcgttt cgcatgattg aacaagatgg attgcacgca ggttctccgg
ccgcttgggt 1800ggagaggcta ttcggctatg actgggcaca acagacaatc
ggctgctctg atgccgccgt 1860gttccggctg tcagcgcagg ggcgcccggt
tctttttgtc aagaccgacc tgtccggtgc 1920cctgaatgaa ctgcaggacg
aggcagcgcg gctatcgtgg ctggccacga cgggcgttcc 1980ttgcgcagct
gtgctcgacg ttgtcactga agcgggaagg gactggctgc tattgggcga
2040agtgccgggg caggatctcc tgtcatctca ccttgctcct gccgagaaag
tatccatcat 2100ggctgatgca atgcggcggc tgcatacgct tgatccggct
acctgcccat tcgaccacca 2160agcgaaacat cgcatcgagc gagcacgtac
tcggatggaa gccggtcttg tcgatcagga 2220tgatctggac gaagagcatc
aggggctcgc gccagccgaa ctgttcgcca ggctcaaggc 2280gcgcatgccc
gacggcgagg atctcgtcgt gacccatggc gatgcctgct tgccgaatat
2340catggtggaa aatggccgct tttctggatt catcgactgt ggccggctgg
gtgtggcgga 2400ccgctatcag gacatagcgt tggctacccg tgatattgct
gaagagcttg gcggcgaatg 2460ggctgaccgc ttcctcgtgc tttacggtat
cgccgctccc gattcgcagc gcatcgcctt 2520ctatcgcctt cttgacgagt
tcttctgagc gggactctgg ggttcgaaat gaccgaccaa 2580gcgacgccca
acctgccatc acgagatttc gattccaccg ccgccttcta tgaaaggttg
2640ggcttcggaa tcgttttccg ggacgccggc tggatgatcc tccagcgcgg
ggatctcatg 2700ctggagttct tcgcccaccc caacttgttt attgcagctt
ataatggtta caaataaagc 2760aatagcatca caaatttcac aaataaagca
tttttttcac tgcattctag ttgtggtttg 2820tccaaactca tcaatgtatc
ttatcatgtc tgtataccgt cgacctctag ctagagcttg 2880gcgtaatcat
ggtcatagct gtttcctgtg tgaaattgtt atccgctcac aattccacac
2940aacatacgag ccggaagcat aaagtgtaaa gcctggggtg cctaatgagt
gagctaactc 3000acattaattg cgttgcgctc actgcccgct ttccagtcgg
gaaacctgtc gtgccagctg 3060cattaatgaa tcggccaacg cgcggggaga
ggcggtttgc gtattgggcg ctcttccgct 3120tcctcgctca ctgactcgct
gcgctcggtc gttcggctgc ggcgagcggt atcagctcac 3180tcaaaggcgg
taatacggtt atccacagaa tcaggggata acgcaggaaa gaacatgtga
3240gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc
gtttttccat 3300aggctccgcc cccctgacga gcatcacaaa aatcgacgct
caagtcagag gtggcgaaac 3360ccgacaggac tataaagata ccaggcgttt
ccccctggaa gctccctcgt gcgctctcct 3420gttccgaccc tgccgcttac
cggatacctg tccgcctttc tcccttcggg aagcgtggcg 3480ctttctcata
gctcacgctg taggtatctc agttcggtgt aggtcgttcg ctccaagctg
3540ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg ccttatccgg
taactatcgt 3600cttgagtcca acccggtaag acacgactta tcgccactgg
cagcagccac tggtaacagg 3660attagcagag cgaggtatgt aggcggtgct
acagagttct tgaagtggtg gcctaactac 3720ggctacacta gaagaacagt
atttggtatc tgcgctctgc tgaagccagt taccttcgga 3780aaaagagttg
gtagctcttg atccggcaaa caaaccaccg ctggtagcgg tttttttgtt
3840tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag aagatccttt
gatcttttct 3900acggggtctg acgctcagtg gaacgaaaac tcacgttaag
ggattttggt catgagatta 3960tcaaaaagga tcttcaccta gatcctttta
aattaaaaat gaagttttaa atcaatctaa 4020agtatatatg agtaaacttg
gtctgacagt taccaatgct taatcagtga ggcacctatc 4080tcagcgatct
gtctatttcg ttcatccata gttgcctgac tccccgtcgt gtagataact
4140acgatacggg agggcttacc atctggcccc agtgctgcaa tgataccgcg
agacccacgc 4200tcaccggctc cagatttatc agcaataaac cagccagccg
gaagggccga gcgcagaagt 4260ggtcctgcaa ctttatccgc ctccatccag
tctattaatt gttgccggga agctagagta 4320agtagttcgc cagttaatag
tttgcgcaac gttgttgcca ttgctacagg catcgtggtg 4380tcacgctcgt
cgtttggtat ggcttcattc agctccggtt cccaacgatc aaggcgagtt
4440acatgatccc ccatgttgtg caaaaaagcg gttagctcct tcggtcctcc
gatcgttgtc 4500agaagtaagt tggccgcagt gttatcactc atggttatgg
cagcactgca taattctctt 4560actgtcatgc catccgtaag atgcttttct
gtgactggtg agtactcaac caagtcattc 4620tgagaatagt gtatgcggcg
accgagttgc tcttgcccgg cgtcaatacg ggataatacc 4680gcgccacata
gcagaacttt aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa
4740ctctcaagga tcttaccgct gttgagatcc agttcgatgt aacccactcg
tgcacccaac 4800tgatcttcag catcttttac tttcaccagc gtttctgggt
gagcaaaaac aggaaggcaa 4860aatgccgcaa aaaagggaat aagggcgaca
cggaaatgtt gaatactcat actcttcctt 4920tttcaatatt attgaagcat
ttatcagggt tattgtctca tgagcggata catatttgaa 4980tgtatttaga
aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccacct
5040gacgtcgacg gatcgggaga tctcccgatc ccctatggtg cactctcagt
acaatctgct 5100ctgatgccgc atagttaagc cagtatctgc tccctgcttg
tgtgttggag gtcgctgagt 5160agtgcgcgag caaaatttaa gctacaacaa
ggcaaggctt gaccgacaat tgcatgaaga 5220atctgcttag ggttaggcgt
tttgcgctgc ttcgcgatgt acgggccaga tatacgcgtt 5280gacattgatt
attgactagt tattaatagt aatcaattac ggggtcatta
gttcatagcc 5340catatatgga gttccgcgtt acataactta cggtaaatgg
cccgcctggc tgaccgccca 5400acgacccccg cccattgacg tcaataatga
cgtatgttcc catagtaacg ccaataggga 5460ctttccattg acgtcaatgg
gtggagtatt tacggtaaac tgcccacttg gcagtacatc 5520aagtgtatca
tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct
5580ggcattatgc ccagtacatg accttatggg actttcctac ttggcagtac
atctacgtat 5640tagtcatcgc tattaccatg gtgatgcggt tttggcagta
catcaatggg cgtggatagc 5700ggtttgactc acggggattt ccaagtctcc
accccattga cgtcaatggg agtttgtttt 5760ggcaccaaaa tcaacgggac
tttccaaaat gtcgtaacaa ctccgcccca ttgacgcaaa 5820tgggcggtag
gcgtgtacgg tgggaggtct atataagcag agctctctgg ctaactagag
5880aacccactgc ttactggctt atcgaaatta atacgactca ctatagggag
acccaagctg 5940gctagcgttt aaacttaagc ttggtaccga gctcggatcc
actagtccag tgtggtgg 59981586606DNAplasmid pMM-TK/miRTarg
158gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc
tgctctgatg 60ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct
gagtagtgcg 120cgagcaaaat ttaagctaca acaaggcaag gcttgaccga
caattgcatg aagaatctgc 180ttagggttag gcgttttgcg ctgcttcgcg
atgtacgggc cagatatacg cgttgacatt 240gattattgac tagttattaa
tagtaatcaa ttacggggtc attagttcat agcccatata 300tggagttccg
cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc
360cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata
gggactttcc 420attgacgtca atgggtggag tatttacggt aaactgccca
cttggcagta catcaagtgt 480atcatatgcc aagtacgccc cctattgacg
tcaatgacgg taaatggccc gcctggcatt 540atgcccagta catgacctta
tgggactttc ctacttggca gtacatctac gtattagtca 600tcgctattac
catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg
660actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg
ttttggcacc 720aaaatcaacg ggactttcca aaatgtcgta acaactccgc
cccattgacg caaatgggcg 780gtaggcgtgt acggtgggag gtctatataa
gcagagctct ctggctaact agagaaccca 840ctgcttactg gcttatcgaa
attaatacga ctcactatag ggagacccaa gctggctagc 900gtttaaactt
aagcttggta ccgagctcgg atctcgagct caagcttcga attctgcagt
960cgacggtacc gcgggcccgg gatccaccgg tcgccaccat ggcttctcac
gccggccaac 1020agcacgcgcc tgcgttcggt caggctgctc gtgcgagcgg
gcctaccgac ggccgcgcgg 1080cgtcccgtcc tagccatcgc cagggggcct
ccggagcccg cggggatccg gagctgccca 1140cgctgctgcg ggtttatata
gacggacccc acggggtggg gaagaccacc acctccgcgc 1200agctgatgga
ggccctgggg ccgcgcgaca atatcgtcta cgtccccgag ccgatgactt
1260actggcaggt gctgggggcc tccgagaccc tgacgaacat ctacaacacg
cagcaccgtc 1320tggaccgcgg cgagatatcg gccggggagg cggcggtggt
aatgaccagc gcccagataa 1380caatgagcac gccttatgcg gcgacggacg
ccgttttggc tcctcatatc gggggggagg 1440ctgtgggccc gcaagccccg
cccccggccc tcacccttgt tttcgaccgg caccctatcg 1500cctccctgct
gtgctacccg gccgcgcggt acctcatggg aagcatgacc ccccaggccg
1560tgttggcgtt cgtggccctc atgcccccga ccgcgcccgg cacgaacctg
gtcctgggtg 1620tccttccgga ggccgaacac gccgaccgcc tggccagacg
ccaacgcccg ggcgagcggc 1680ttgacctggc catgctgtcc gccattcgcc
gtgtctacga tctactcgcc aacacggtgc 1740ggtacctgca gcgcggcggg
aggtggcggg aggactgggg ccggctgacg ggggtcgccg 1800cggcgacccc
gcgccccgac cccgaggacg gcgcggggtc tctgccccgc atcgaggaca
1860cgctgtttgc cctgttccgc gttcccgagc tgctggcccc caacggggac
ttgtaccaca 1920tttttgcctg ggtcttggac gtcttggccg accgcctcct
tccgatgcat ctatttgtcc 1980tggattacga tcagtcgccc gtcgggtgtc
gagacgccct gttgcgcctc accgccggga 2040tgatcccaac ccgcgtcaca
accgccgggt ccatcgccga gatacgcgac ctggcgcgca 2100cgtttgcccg
cgaggtgggg ggagtttaga gcggccgctc gagtctagca gatcctggga
2160aaactggacc tagagggccc gtttaaaccc gctgatcagc ctcgactgtg
ccttctagtt 2220gccagccatc tgttgtttgc ccctcccccg tgccttcctt
gaccctggaa ggtgccactc 2280ccactgtcct ttcctaataa aatgaggaaa
ttgcatcgca ttgtctgagt aggtgtcatt 2340ctattctggg gggtggggtg
gggcaggaca gcaaggggga ggattgggaa gacaatagca 2400ggcatgctgg
ggatgcggtg ggctctatgg cttctgaggc ggaaagaacc agctggggct
2460ctagggggta tccccacgcg ccctgtagcg gcgcattaag cgcggcgggt
gtggtggtta 2520cgcgcagcgt gaccgctaca cttgccagcg ccctagcgcc
cgctcctttc gctttcttcc 2580cttcctttct cgccacgttc gccggctttc
cccgtcaagc tctaaatcgg gggctccctt 2640tagggttccg atttagtgct
ttacggcacc tcgaccccaa aaaacttgat tagggtgatg 2700gttcacgtag
tgggccatcg ccctgataga cggtttttcg ccctttgacg ttggagtcca
2760cgttctttaa tagtggactc ttgttccaaa ctggaacaac actcaaccct
atctcggtct 2820attcttttga tttataaggg attttgccga tttcggccta
ttggttaaaa aatgagctga 2880tttaacaaaa atttaacgcg aattaattct
gtggaatgtg tgtcagttag ggtgtggaaa 2940gtccccaggc tccccagcag
gcagaagtat gcaaagcatg catctcaatt agtcagcaac 3000caggtgtgga
aagtccccag gctccccagc aggcagaagt atgcaaagca tgcatctcaa
3060ttagtcagca accatagtcc cgcccctaac tccgcccatc ccgcccctaa
ctccgcccag 3120ttccgcccat tctccgcccc atggctgact aatttttttt
atttatgcag aggccgaggc 3180cgcctctgcc tctgagctat tccagaagta
gtgaggaggc ttttttggag gcctaggctt 3240ttgcaaaaag ctcccgggag
cttgtatatc cattttcgga tctgatcaag agacaggatg 3300aggatcgttt
cgcatgattg aacaagatgg attgcacgca ggttctccgg ccgcttgggt
3360ggagaggcta ttcggctatg actgggcaca acagacaatc ggctgctctg
atgccgccgt 3420gttccggctg tcagcgcagg ggcgcccggt tctttttgtc
aagaccgacc tgtccggtgc 3480cctgaatgaa ctgcaggacg aggcagcgcg
gctatcgtgg ctggccacga cgggcgttcc 3540ttgcgcagct gtgctcgacg
ttgtcactga agcgggaagg gactggctgc tattgggcga 3600agtgccgggg
caggatctcc tgtcatctca ccttgctcct gccgagaaag tatccatcat
3660ggctgatgca atgcggcggc tgcatacgct tgatccggct acctgcccat
tcgaccacca 3720agcgaaacat cgcatcgagc gagcacgtac tcggatggaa
gccggtcttg tcgatcagga 3780tgatctggac gaagagcatc aggggctcgc
gccagccgaa ctgttcgcca ggctcaaggc 3840gcgcatgccc gacggcgagg
atctcgtcgt gacccatggc gatgcctgct tgccgaatat 3900catggtggaa
aatggccgct tttctggatt catcgactgt ggccggctgg gtgtggcgga
3960ccgctatcag gacatagcgt tggctacccg tgatattgct gaagagcttg
gcggcgaatg 4020ggctgaccgc ttcctcgtgc tttacggtat cgccgctccc
gattcgcagc gcatcgcctt 4080ctatcgcctt cttgacgagt tcttctgagc
gggactctgg ggttcgaaat gaccgaccaa 4140gcgacgccca acctgccatc
acgagatttc gattccaccg ccgccttcta tgaaaggttg 4200ggcttcggaa
tcgttttccg ggacgccggc tggatgatcc tccagcgcgg ggatctcatg
4260ctggagttct tcgcccaccc caacttgttt attgcagctt ataatggtta
caaataaagc 4320aatagcatca caaatttcac aaataaagca tttttttcac
tgcattctag ttgtggtttg 4380tccaaactca tcaatgtatc ttatcatgtc
tgtataccgt cgacctctag ctagagcttg 4440gcgtaatcat ggtcatagct
gtttcctgtg tgaaattgtt atccgctcac aattccacac 4500aacatacgag
ccggaagcat aaagtgtaaa gcctggggtg cctaatgagt gagctaactc
4560acattaattg cgttgcgctc actgcccgct ttccagtcgg gaaacctgtc
gtgccagctg 4620cattaatgaa tcggccaacg cgcggggaga ggcggtttgc
gtattgggcg ctcttccgct 4680tcctcgctca ctgactcgct gcgctcggtc
gttcggctgc ggcgagcggt atcagctcac 4740tcaaaggcgg taatacggtt
atccacagaa tcaggggata acgcaggaaa gaacatgtga 4800gcaaaaggcc
agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc gtttttccat
4860aggctccgcc cccctgacga gcatcacaaa aatcgacgct caagtcagag
gtggcgaaac 4920ccgacaggac tataaagata ccaggcgttt ccccctggaa
gctccctcgt gcgctctcct 4980gttccgaccc tgccgcttac cggatacctg
tccgcctttc tcccttcggg aagcgtggcg 5040ctttctcata gctcacgctg
taggtatctc agttcggtgt aggtcgttcg ctccaagctg 5100ggctgtgtgc
acgaaccccc cgttcagccc gaccgctgcg ccttatccgg taactatcgt
5160cttgagtcca acccggtaag acacgactta tcgccactgg cagcagccac
tggtaacagg 5220attagcagag cgaggtatgt aggcggtgct acagagttct
tgaagtggtg gcctaactac 5280ggctacacta gaagaacagt atttggtatc
tgcgctctgc tgaagccagt taccttcgga 5340aaaagagttg gtagctcttg
atccggcaaa caaaccaccg ctggtagcgg tttttttgtt 5400tgcaagcagc
agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatcttttct
5460acggggtctg acgctcagtg gaacgaaaac tcacgttaag ggattttggt
catgagatta 5520tcaaaaagga tcttcaccta gatcctttta aattaaaaat
gaagttttaa atcaatctaa 5580agtatatatg agtaaacttg gtctgacagt
taccaatgct taatcagtga ggcacctatc 5640tcagcgatct gtctatttcg
ttcatccata gttgcctgac tccccgtcgt gtagataact 5700acgatacggg
agggcttacc atctggcccc agtgctgcaa tgataccgcg agacccacgc
5760tcaccggctc cagatttatc agcaataaac cagccagccg gaagggccga
gcgcagaagt 5820ggtcctgcaa ctttatccgc ctccatccag tctattaatt
gttgccggga agctagagta 5880agtagttcgc cagttaatag tttgcgcaac
gttgttgcca ttgctacagg catcgtggtg 5940tcacgctcgt cgtttggtat
ggcttcattc agctccggtt cccaacgatc aaggcgagtt 6000acatgatccc
ccatgttgtg caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc
6060agaagtaagt tggccgcagt gttatcactc atggttatgg cagcactgca
taattctctt 6120actgtcatgc catccgtaag atgcttttct gtgactggtg
agtactcaac caagtcattc 6180tgagaatagt gtatgcggcg accgagttgc
tcttgcccgg cgtcaatacg ggataatacc 6240gcgccacata gcagaacttt
aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa 6300ctctcaagga
tcttaccgct gttgagatcc agttcgatgt aacccactcg tgcacccaac
6360tgatcttcag catcttttac tttcaccagc gtttctgggt gagcaaaaac
aggaaggcaa 6420aatgccgcaa aaaagggaat aagggcgaca cggaaatgtt
gaatactcat actcttcctt 6480tttcaatatt attgaagcat ttatcagggt
tattgtctca tgagcggata catatttgaa 6540tgtatttaga aaaataaaca
aataggggtt ccgcgcacat ttccccgaaa agtgccacct 6600gacgtc
66061596759DNAplasmid pMM1-CD/miRTarg 159gacggatcgg gagatctccc
gatcccctat ggtgcactct cagtacaatc tgctctgatg 60ccgcatagtt aagccagtat
ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120cgagcaaaat
ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc
180ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg
cgttgacatt 240gattattgac tagttattaa tagtaatcaa ttacggggtc
attagttcat agcccatata 300tggagttccg cgttacataa cttacggtaa
atggcccgcc tggctgaccg cccaacgacc 360cccgcccatt gacgtcaata
atgacgtatg ttcccatagt aacgccaata gggactttcc 420attgacgtca
atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt
480atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc
gcctggcatt 540atgcccagta catgacctta tgggactttc ctacttggca
gtacatctac gtattagtca 600tcgctattac catggtgatg cggttttggc
agtacatcaa tgggcgtgga tagcggtttg 660actcacgggg atttccaagt
ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720aaaatcaacg
ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg
780gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact
agagaaccca 840ctgcttactg gcttatcgaa attaatacga ctcactatag
ggagacccaa gctggctagc 900gtttaaactt aagcttggta ccgagctcgg
atctcgagct caagcttcga attctgcagt 960cgacggtacc gcgggcccgg
gatccaccgg tcgccaccat gtcgaataac gctttacaaa 1020caattattaa
cgcccggtta ccaggcgaag aggggctgtg gcagattcat ctgcaggacg
1080gaaaaatcag cgccattgat gcgcaatccg gcgtgatgcc cataactgaa
aacagcctgg 1140atgccgaaca aggtttagtt ataccgccgt ttgtggagcc
acatattcac ctggacacca 1200cgcaaaccgc cggacaaccg aactggaatc
agtccggcac gctgtttgaa ggcattgaac 1260gctgggccga gcgcaaagcg
ttattaaccc atgacgatgt gaaacaacgc gcatggcaaa 1320cgctgaaatg
gcagattgcc aacggcattc agcatgtgcg tacccatgtc gatgtttcgg
1380atgcaacgct aactgcgctg aaagcaatgc tggaagtgaa gcaggaagtc
gcgccgtgga 1440ttgatctgca aatcgtcgcc ttccctcagg aagggatttt
gtcgtatccc aacggtgaag 1500cgttgctgga agaggcgtta cgcttagggg
cagatgtagt gggggcgatt ccgcattttg 1560aatttacccg tgaatacggc
gtggagtcgc tgcataaaac cttcgccctg gcgcaaaaat 1620acgaccgtct
catcgacgtt cactgtgatg agatcgatga cgagcagtcg cgctttgtcg
1680aaaccgttgc tgccctggcg caccatgaag gcatgggcgc gcgagtcacc
gccagccaca 1740ccacggcaat gcactcctat aacggggcgt atacctcacg
cctgttccgc ttgctgaaaa 1800tgtccggtat taactttgtc gccaacccgc
tggtcaatat tcatctgcaa ggacgtttcg 1860atacgtatcc aaaacgtcgc
ggcatcacgc gcgttaaaga gatgctggag tccggcatta 1920acgtctgctt
tggtcacgat gatgtcttcg atccgtggta tccgctggga acggcgaata
1980tgctgcaagt gctgcatatg gggctgcatg tttgccagtt gatgggctac
gggcagatta 2040acgatggcct gaatttaatc acccaccaca gcgcaaggac
gttgaatttg caggattacg 2100gcattgccgc cggaaacagc gccaacctga
ttatcctgcc ggctgaaaat gggtttgatg 2160cgctgcgccg tcaggttccg
gtacgttatt cggtacgtgg cggcaaggtg attgccagca 2220cacaaccggc
acaaaccacc gtatatctgg agcagccaga agccatcgat tacaaacgtt
2280gaagcggccg ctcgagtcta gcagatcctg ggaaaactgg acctagaggg
cccgtttaaa 2340cccgctgatc agcctcgact gtgccttcta gttgccagcc
atctgttgtt tgcccctccc 2400ccgtgccttc cttgaccctg gaaggtgcca
ctcccactgt cctttcctaa taaaatgagg 2460aaattgcatc gcattgtctg
agtaggtgtc attctattct ggggggtggg gtggggcagg 2520acagcaaggg
ggaggattgg gaagacaata gcaggcatgc tggggatgcg gtgggctcta
2580tggcttctga ggcggaaaga accagctggg gctctagggg gtatccccac
gcgccctgta 2640gcggcgcatt aagcgcggcg ggtgtggtgg ttacgcgcag
cgtgaccgct acacttgcca 2700gcgccctagc gcccgctcct ttcgctttct
tcccttcctt tctcgccacg ttcgccggct 2760ttccccgtca agctctaaat
cgggggctcc ctttagggtt ccgatttagt gctttacggc 2820acctcgaccc
caaaaaactt gattagggtg atggttcacg tagtgggcca tcgccctgat
2880agacggtttt tcgccctttg acgttggagt ccacgttctt taatagtgga
ctcttgttcc 2940aaactggaac aacactcaac cctatctcgg tctattcttt
tgatttataa gggattttgc 3000cgatttcggc ctattggtta aaaaatgagc
tgatttaaca aaaatttaac gcgaattaat 3060tctgtggaat gtgtgtcagt
tagggtgtgg aaagtcccca ggctccccag caggcagaag 3120tatgcaaagc
atgcatctca attagtcagc aaccaggtgt ggaaagtccc caggctcccc
3180agcaggcaga agtatgcaaa gcatgcatct caattagtca gcaaccatag
tcccgcccct 3240aactccgccc atcccgcccc taactccgcc cagttccgcc
cattctccgc cccatggctg 3300actaattttt tttatttatg cagaggccga
ggccgcctct gcctctgagc tattccagaa 3360gtagtgagga ggcttttttg
gaggcctagg cttttgcaaa aagctcccgg gagcttgtat 3420atccattttc
ggatctgatc aagagacagg atgaggatcg tttcgcatga ttgaacaaga
3480tggattgcac gcaggttctc cggccgcttg ggtggagagg ctattcggct
atgactgggc 3540acaacagaca atcggctgct ctgatgccgc cgtgttccgg
ctgtcagcgc aggggcgccc 3600ggttcttttt gtcaagaccg acctgtccgg
tgccctgaat gaactgcagg acgaggcagc 3660gcggctatcg tggctggcca
cgacgggcgt tccttgcgca gctgtgctcg acgttgtcac 3720tgaagcggga
agggactggc tgctattggg cgaagtgccg gggcaggatc tcctgtcatc
3780tcaccttgct cctgccgaga aagtatccat catggctgat gcaatgcggc
ggctgcatac 3840gcttgatccg gctacctgcc cattcgacca ccaagcgaaa
catcgcatcg agcgagcacg 3900tactcggatg gaagccggtc ttgtcgatca
ggatgatctg gacgaagagc atcaggggct 3960cgcgccagcc gaactgttcg
ccaggctcaa ggcgcgcatg cccgacggcg aggatctcgt 4020cgtgacccat
ggcgatgcct gcttgccgaa tatcatggtg gaaaatggcc gcttttctgg
4080attcatcgac tgtggccggc tgggtgtggc ggaccgctat caggacatag
cgttggctac 4140ccgtgatatt gctgaagagc ttggcggcga atgggctgac
cgcttcctcg tgctttacgg 4200tatcgccgct cccgattcgc agcgcatcgc
cttctatcgc cttcttgacg agttcttctg 4260agcgggactc tggggttcga
aatgaccgac caagcgacgc ccaacctgcc atcacgagat 4320ttcgattcca
ccgccgcctt ctatgaaagg ttgggcttcg gaatcgtttt ccgggacgcc
4380ggctggatga tcctccagcg cggggatctc atgctggagt tcttcgccca
ccccaacttg 4440tttattgcag cttataatgg ttacaaataa agcaatagca
tcacaaattt cacaaataaa 4500gcattttttt cactgcattc tagttgtggt
ttgtccaaac tcatcaatgt atcttatcat 4560gtctgtatac cgtcgacctc
tagctagagc ttggcgtaat catggtcata gctgtttcct 4620gtgtgaaatt
gttatccgct cacaattcca cacaacatac gagccggaag cataaagtgt
4680aaagcctggg gtgcctaatg agtgagctaa ctcacattaa ttgcgttgcg
ctcactgccc 4740gctttccagt cgggaaacct gtcgtgccag ctgcattaat
gaatcggcca acgcgcgggg 4800agaggcggtt tgcgtattgg gcgctcttcc
gcttcctcgc tcactgactc gctgcgctcg 4860gtcgttcggc tgcggcgagc
ggtatcagct cactcaaagg cggtaatacg gttatccaca 4920gaatcagggg
ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac
4980cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga
cgagcatcac 5040aaaaatcgac gctcaagtca gaggtggcga aacccgacag
gactataaag ataccaggcg 5100tttccccctg gaagctccct cgtgcgctct
cctgttccga ccctgccgct taccggatac 5160ctgtccgcct ttctcccttc
gggaagcgtg gcgctttctc atagctcacg ctgtaggtat 5220ctcagttcgg
tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag
5280cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt
aagacacgac 5340ttatcgccac tggcagcagc cactggtaac aggattagca
gagcgaggta tgtaggcggt 5400gctacagagt tcttgaagtg gtggcctaac
tacggctaca ctagaagaac agtatttggt 5460atctgcgctc tgctgaagcc
agttaccttc ggaaaaagag ttggtagctc ttgatccggc 5520aaacaaacca
ccgctggtag cggttttttt gtttgcaagc agcagattac gcgcagaaaa
5580aaaggatctc aagaagatcc tttgatcttt tctacggggt ctgacgctca
gtggaacgaa 5640aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa
ggatcttcac ctagatcctt 5700ttaaattaaa aatgaagttt taaatcaatc
taaagtatat atgagtaaac ttggtctgac 5760agttaccaat gcttaatcag
tgaggcacct atctcagcga tctgtctatt tcgttcatcc 5820atagttgcct
gactccccgt cgtgtagata actacgatac gggagggctt accatctggc
5880cccagtgctg caatgatacc gcgagaccca cgctcaccgg ctccagattt
atcagcaata 5940aaccagccag ccggaagggc cgagcgcaga agtggtcctg
caactttatc cgcctccatc 6000cagtctatta attgttgccg ggaagctaga
gtaagtagtt cgccagttaa tagtttgcgc 6060aacgttgttg ccattgctac
aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca 6120ttcagctccg
gttcccaacg atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa
6180gcggttagct ccttcggtcc tccgatcgtt gtcagaagta agttggccgc
agtgttatca 6240ctcatggtta tggcagcact gcataattct cttactgtca
tgccatccgt aagatgcttt 6300tctgtgactg gtgagtactc aaccaagtca
ttctgagaat agtgtatgcg gcgaccgagt 6360tgctcttgcc cggcgtcaat
acgggataat accgcgccac atagcagaac tttaaaagtg 6420ctcatcattg
gaaaacgttc ttcggggcga aaactctcaa ggatcttacc gctgttgaga
6480tccagttcga tgtaacccac tcgtgcaccc aactgatctt cagcatcttt
tactttcacc 6540agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg
caaaaaaggg aataagggcg 6600acacggaaat gttgaatact catactcttc
ctttttcaat attattgaag catttatcag 6660ggttattgtc tcatgagcgg
atacatattt gaatgtattt agaaaaataa acaaataggg 6720gttccgcgca
catttccccg aaaagtgcca cctgacgtc 675916064RNAHomo sapiens
160ccccgcgacg agccccucgc acaaaccgga ccugagcguu uuguucguuc
ggcucgcgug 60aggc 6416122RNAHomo sapiens 161uuuguucguu cggcucgcgu
ga 22162110RNAHomo sapiens 162ccugugcaga gauuauuuuu uaaaagguca
caaucaacau ucauugcugu cgguggguug 60aacugugugg acaagcucac ugaacaauga
augcaacugu ggccccgcuu 11016322RNAHomo sapiens 163aacauucauu
gcugucggug gg 2216422RNAHomo sapiens 164ucacgcgagc cgaacgaaca aa
2216522RNAHomo sapiens 165cccaccgaca gcaaugaaug uu 2216687RNAHomo
sapiens 166ugagggcccc ucugcguguu cacagcggac cuugauuuaa ugucuauaca
auuaaggcac 60gcggugaaug ccaagagagg cgccucc 8716722RNAHomo sapiens
167uuaaggcacg cggugaaugc ca 2216887RNAHomo sapiens 168ggaagcgagu
uguuaucuuu gguuaucuag
cuguaugagu guauuggucu ucauaaagcu 60agauaaccga aaguaaaaac uccuuca
8716923RNAHomo sapiens 169ucuuugguua ucuagcugua uga 2317022RNAHomo
sapiens 170uggcauucac cgcgugccuu aa 2217123RNAHomo sapiens
171ucauacagcu agauaaccaa aga 23
* * * * *
References