U.S. patent application number 13/429889 was filed with the patent office on 2012-07-12 for rnai-mediated inhibition of rho kinase for treatment of ocular disorders.
This patent application is currently assigned to ALCON RESEARCH, LTD.. Invention is credited to Jon E. Chatterton, Abbot F. Clark.
Application Number | 20120178794 13/429889 |
Document ID | / |
Family ID | 38218805 |
Filed Date | 2012-07-12 |
United States Patent
Application |
20120178794 |
Kind Code |
A1 |
Chatterton; Jon E. ; et
al. |
July 12, 2012 |
RNAi-Mediated Inhibition of RHO Kinase for Treatment of Ocular
Disorders
Abstract
RNA interference is provided for inhibition of Rho kinase mRNA
expression for treating patients with ocular disorders,
particularly for treating intraocular pressure, ocular hypertension
and glaucoma. Rho kinase mRNA targets include mRNA for ROCK1 and
ROCK2.
Inventors: |
Chatterton; Jon E.; (Fort
Worth, TX) ; Clark; Abbot F.; (Arlington,
TX) |
Assignee: |
ALCON RESEARCH, LTD.
Fort Worth
TX
|
Family ID: |
38218805 |
Appl. No.: |
13/429889 |
Filed: |
March 26, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12940375 |
Nov 5, 2010 |
8168609 |
|
|
13429889 |
|
|
|
|
12500239 |
Jul 9, 2009 |
|
|
|
12940375 |
|
|
|
|
11641410 |
Dec 19, 2006 |
|
|
|
12500239 |
|
|
|
|
60754094 |
Dec 27, 2005 |
|
|
|
Current U.S.
Class: |
514/44A |
Current CPC
Class: |
A61P 27/00 20180101;
A61P 43/00 20180101; C12N 15/1137 20130101; A61P 27/02 20180101;
A61K 31/7084 20130101; A61P 27/06 20180101; A61P 9/12 20180101;
C12N 2310/14 20130101 |
Class at
Publication: |
514/44.A |
International
Class: |
A61K 31/713 20060101
A61K031/713; A61P 27/06 20060101 A61P027/06; A61P 27/02 20060101
A61P027/02 |
Claims
1. A method of attenuating expression of Rho kinase mRNA of a
subject, comprising: administering to an eye of the subject a
composition comprising an effective amount of interfering RNA
having a length of 19 to 49 nucleotides and a pharmaceutically
acceptable carrier, the interfering RNA comprising: a sense
nucleotide strand and an antisense nucleotide strand wherein the
antisense strand: comprises a ribonucleotide sequence consisting of
the base sequence of SEQ ID NO: 3, 9-28, or 30-79 with uridine
bases substituted for thymidine bases; is substantially
complementary to the sense strand; and hybridizes under
physiological conditions to a portion of mRNA corresponding to SEQ
ID NO:1 or SEQ ID NO: 2; wherein the interfering RNA directs
RISC-mediated cleavage of Rho kinase mRNA, and wherein the
expression of Rho kinase mRNA is attenuated thereby.
2. The method of claim 1 wherein the subject is a human and the
human has ocular hypertension.
3. The method of claim 1 wherein the subject is a human and the
human has glaucoma.
4. The method of claim 1 wherein the composition is administered
via a topical, intravitreal, transcleral, periocular, conjunctival,
subtenon, intracameral, subretinal, subconjunctival, retrobulbar,
or intracanalicular route.
5. The method of claim 1 wherein the antisense strand is designed
to target an mRNA corresponding to SEQ ID NO:1 comprising
nucleotide 605, 653, 659, 1248, 1562, 1876, 2266, 2474, 2485, 2740,
2808, 2834, 3007, 3146, 3199, 3245, 3379, 3453, 3511, 3513, 3519,
3782, 998, 1132, 1200, 1648, 1674, 1708, or 2077.
6. The method of claim 1 wherein the antisense strand is designed
to target an mRNA corresponding to SEQ ID NO:2 comprising
nucleotide 1102, 1865, 2000, 2229, 2514, 2584, 2738, 3305, 4111,
4652, 5184, 5187, 5255, 5315, 5439, 5450, 5578, 5579, 5611, 5625,
5795, 6000, 6228, 6264, 584, 1337, 1678, 2773, 2814, 2941, 3357,
3398, 3481, 3633, 3644, 3645, 3767, 3836, 4023, 4097, 5202, or
5440.
7. The method of claim 1 further comprising administering to the
subject a second interfering RNA having a length of 19 to 49
nucleotides, and comprising a sense nucleotide strand, an antisense
nucleotide strand, and a region of at least near-perfect
complementarity of at least 19 nucleotides; wherein the antisense
strand of the second interfering RNA hybridizes under physiological
conditions to a second portion of mRNA corresponding to SEQ ID NO:1
or SEQ ID NO:2 and the antisense strand has a region of at least
near-perfect contiguous complementarity of at least 19 nucleotides
with the second hybridizing portion of mRNA corresponding to SEQ ID
NO:1 or SEQ ID NO:2, respectively.
8. The method of claim 1 wherein the sense nucleotide strand and
the antisense nucleotide strand are connected by a hairpin
loop.
9. A method of attenuating expression of Rho kinase mRNA of a
subject, comprising: administering to an eye of the subject a
composition comprising an effective amount of single-stranded
interfering RNA having a length of 19 to 49 nucleotides and a
pharmaceutically acceptable carrier, wherein the single-stranded
interfering RNA hybridizes under physiological conditions to a
portion of mRNA corresponding to SEQ ID NO:1 comprising nucleotide
605, 653, 659, 1248, 1562, 1876, 2266, 2474, 2485, 2740, 2808,
2834, 3007, 3146, 3199, 3245, 3379, 3453, 3511, 3513, 3519, 3782,
998, 1132, 1200, 1648, 1674, 1708, or 2077, and the interfering RNA
has a region of at least 80% to 100 contiguous complementarity of
at least 19 nucleotides with the hybridizing portion of mRNA
corresponding to SEQ ID NO:1, or wherein the single-stranded
interfering RNA hybridizes under physiological conditions to a
portion of mRNA corresponding to SEQ ID NO:2 comprising nucleotide
1102, 1865, 2000, 2229, 2514, 2584, 2738, 3305, 4111, 4652, 5184,
5187, 5255, 5315, 5439, 5450, 5578, 5579, 5611, 5625, 5795, 6000,
6228, 6264, 584, 1337, 1678, 2773, 2814, 2941, 3357, 3398, 3481,
3633, 3644, 3645, 3767, 3836, 4023, 4097, 5202, or 5440 and the
interfering RNA has a region of at least 80% to 100% contiguous
complementarity of at least 19 nucleotides with the hybridizing
portion of mRNA corresponding to SEQ ID NO:2, wherein the
interfering RNA directs cleavage of Rho kinase mRNA, and wherein
the expression of Rho kinase mRNA is thereby attenuated.
10. A method of attenuating expression of Rho kinase mRNA in a
subject, the method comprising: administering to an eye of the
subject a composition comprising an effective amount of interfering
RNA having a length of 19 to 49 nucleotides and a pharmaceutically
acceptable carrier, the interfering RNA comprising: a region of at
least 13 contiguous nucleotides having at least 90% sequence
complementarity to, or at least 90% sequence identity with, the
penultimate 13 nucleotides of the 3' end of a ribonucleotide
sequence consisting of the base sequence of 3, 9-28, or 30-79, with
uridine bases substituted for thymidine bases wherein the
interfering RNA directs RISC-mediated cleavage of Rho kinase mRNA,
and wherein the expression of the Rho kinase mRNA is attenuated
thereby.
11. The method of claim 10 wherein the Rho kinase mRNA is ROCK1
mRNA and the interfering RNA comprises: a region of at least 13
contiguous nucleotides having at least 90% sequence complementarity
to, or at least 90% sequence identity with, the penultimate 13
nucleotides of the 3' end of an mRNA corresponding to 3, 9-28, 30,
or 73-79.
12. The method of claim 10 wherein the Rho kinase mRNA is ROCK2
mRNA and the interfering RNA comprises: a region of at least 13
contiguous nucleotides having at least 90% sequence complementarity
to, or at least 90% sequence identity with, the penultimate 13
nucleotides of the 3' end of an mRNA corresponding to SEQ ID NO:31,
SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID
NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ
ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45,
SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID
NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ
ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59,
SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID
NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ
ID NO:69, SEQ ID NO:70, SEQ ID NO:71, or SEQ ID NO:72.
13. The method of claim 10 wherein the interfering RNA comprises a
region of at least 14 contiguous nucleotides having at least 85%
sequence complementarity to, or at least 85% sequence identity
with, the penultimate 14 nucleotides of the 3' end of an mRNA
corresponding to the sequence identified by the sequence
identifier.
14. The method of claim 10 wherein the interfering RNA comprises a
region of at least 15, 16, 17, or 18 contiguous nucleotides having
at least 80% sequence complementarity to, or at least 80% sequence
identity with, the penultimate 15, 16, 17, or 18 nucleotides,
respectively, of the 3' end of an mRNA corresponding to the
sequence identified by the sequence identifier.
15. The method of claim 10 wherein the composition further
comprises a second interfering RNA having a length of 19 to 49
nucleotides and comprising a region of at least 13 contiguous
nucleotides having at least 90% complementarity to, or at least 90%
sequence identity with, the penultimate 13 nucleotides of the 3'
end of a second mRNA corresponding to any one of SEQ ID NO: 3,
9-28, or 30-79.
16. The method of claim 10, wherein the subject has ocular
hypertension.
17. The method of claim 10, wherein the subject has glaucoma.
18. The method of claim 10 wherein the composition is administered
via a topical, intravitreal, transcleral, periocular, conjunctival,
subtenon, intracameral, subretinal, subconjunctival, retrobulbar,
or intracanalicular route.
19. The method of claim 10 wherein the composition is administered
via in vivo expression from an interfering RNA expression vector.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] The present application is a divisional of U.S. patent
application Ser. No. 12,940,375 filed Nov. 5, 2010, which is a
divisional of 12/500,239, filed Jul. 9, 2009, which is a divisional
of Ser. No. 11/641,410 filed Dec. 19, 2006, which claims benefit to
U.S. Provisional Patent Application Ser. No. 60/754,094 filed Dec.
27, 2005.
FIELD OF THE INVENTION
[0002] The present invention relates to the field of interfering
RNA compositions for inhibition of expression of Rho kinase mRNA
targets in ocular disorders, particularly for reducing intraocular
pressure in the treatment of ocular hypertension and glaucoma.
BACKGROUND OF THE INVENTION
[0003] Glaucoma is a heterogeneous group of optic neuropathies that
share certain clinical features. The loss of vision in glaucoma is
due to the selective death of retinal ganglion cells in the neural
retina that is clinically diagnosed by characteristic changes in
the visual field, nerve fiber layer defects, and a progressive
cupping of the optic nerve head (ONH). One of the main risk factors
for the development of glaucoma is the presence of ocular
hypertension (OHT), i.e., elevated intraocular pressure (IOP). An
adequate IOP is needed to maintain the shape of the eye and to
provide a pressure gradient to allow for the flow of aqueous humor
to the avascular cornea and lens. IOP levels also may be involved
in the pathogenesis of normal tension glaucoma (NTG), as evidenced
by patients benefiting from IOP lowering medications. Once
adjustments for central corneal thickness are made to IOP readings
in NTG patients, many of these patients may be found to be ocular
hypertensive.
[0004] The elevated IOP associated with glaucoma is due to elevated
aqueous humor outflow resistance in the trabecular meshwork (TM), a
small specialized tissue located in the iris-corneal angle of the
ocular anterior chamber. Glaucomatous changes to the TM include a
loss in TM cells and the deposition and accumulation of
extracellular debris including proteinaceous plaque-like material.
In addition, there are also changes that occur in the glaucomatous
ONH. In glaucomatous eyes, there are morphological and mobility
changes in ONH glial cells. In response to elevated IOP and/or
transient ischemic insults, there is a change in the composition of
the ONH extracellular matrix and alterations in the glial cell and
retinal ganglion cell axon morphologies.
[0005] Primary glaucomas result from disturbances in the flow of
intraocular fluid that has an anatomical or physiological basis.
Secondary glaucomas occur as a result of injury or trauma to the
eye or a preexisting disease. Primary open angle glaucoma (POAG),
also known as chronic or simple glaucoma, represents the majority
of all primary glaucomas. POAG is characterized by the degeneration
of the trabecular meshwork, resulting in abnormally high resistance
to fluid drainage from the eye. A consequence of such resistance is
an increase in the IOP that is required to drive the fluid normally
produced by the eye across the increased resistance.
[0006] Rho-associated, coiled-coil containing protein kinases, also
known as Rho kinases or ROCKs, are effectors of the Rho family of
small GTP-binding proteins (Rho GTPases). The Rho GTPase signaling
pathway appears to play a role in regulating aqueous humor outflow,
for example, by altering the cytoskeletal organization of
trabecular meshwork (TM) and/or ciliary muscle (CM) cells. Small
molecule inhibitors of Rho kinase cause reversible changes in TM
cell morphology and cytoskeletal organization, decrease
contractility of isolated CM tissue, and increase aqueous humor
outflow facility in organ culture (Waki M. et al., Curr Eye Res.
22:470-4 (2001); Honjo M. et al., Invest Ophthalmol Vis Sci.
42:137-44 (2001); Rao P V. et al., Mol. Vis. 11:288-97 (2005); Rao
P V. et al., Invest Ophthalmol Vis Sci. 42:1029-37 (2001)). Similar
effects are generated by expression of dominant negative
Rho-binding domains. However, treatment with small molecule
inhibitors of Rho kinase also causes vasodilation and conjunctival
hyperemia. In addition, the efficacy of small molecule-based
therapies is relatively short-lived requiring repeated dosing
during each day and, in some cases, the efficacy decreases with
time.
[0007] In view of the importance of ocular hypertension in glaucoma
and the side effects of prior methods of treatment, it would be
desirable to have an improved method of treating ocular
hypertension.
SUMMARY OF THE INVENTION
[0008] The present invention is directed to interfering RNAs that
silence Rho kinase mRNA expression, thus lowering intraocular
pressure in patients with ocular hypertension or glaucoma or at
risk of developing hypertension or glaucoma. Rho kinase targets
include ROCK1 (also known as ROCKI, ROK.beta., or p160ROCK) and
ROCK2 (also known as ROCKII or ROK.alpha.). The interfering RNAs of
the invention are useful for treating patients with ocular
hypertension or glaucoma such as normal tension glaucoma and open
angle glaucoma.
[0009] An embodiment of the present invention provides a method of
attenuating expression of a Rho kinase mRNA in a subject. The
method comprises administering to the subject a composition
comprising an effective amount of interfering RNA having a length
of 19 to 49 nucleotides and a pharmaceutically acceptable carrier.
In one embodiment, administration is to the eye of the subject for
attenuating expression of an ocular hypertension target in a
human.
[0010] In one embodiment of the invention, the interfering RNA
comprises a sense nucleotide strand, an antisense nucleotide strand
and a region of at least near-perfect contiguous complementarity of
at least 19 nucleotides. Further, the antisense strand hybridizes
under physiological conditions to a portion of an mRNA
corresponding to SEQ ID NO:1 or SEQ ID NO:2 which are sense cDNA
sequences encoding ROCK1 and ROCK2, respectively (GenBank accession
no. NM.sub.--005406, and NM.sub.--004850, respectively). The
antisense strand has a region of at least near-perfect contiguous
complementarity of at least 19 nucleotides with the hybridizing
portion of mRNA corresponding to SEQ ID NO:1 or SEQ ID NO:2,
respectively. The administration of such a composition attenuates
the expression of Rho kinase in the subject.
[0011] In one embodiment of the invention, an interfering RNA is
designed to target an mRNA corresponding to SEQ ID NO:1 comprising
nucleotide 605, 653, 659, 1248, 1562, 1876, 2266, 2474, 2485, 2740,
2808, 2834, 3007, 3146, 3199, 3245, 3379, 3453, 3511, 3513, 3519,
3781, 3782, 998, 1132, 1200, 1648, 1674, 1708, or 2077. In another
embodiment of the invention, an interfering RNA is designed to
target an mRNA corresponding to SEQ ID NO:2 comprising nucleotide
1102, 1865, 2000, 2229, 2514, 2584, 2738, 3305, 4111, 4652, 5184,
5187, 5255, 5315, 5439, 5450, 5578, 5579, 5611, 5625, 5795, 6000,
6228, 6264, 584, 1337, 1678, 2773, 2814, 2941, 3357, 3398, 3481,
3633, 3644, 3645, 3767, 3836, 4023, 4097, 5202, or 5440.
[0012] The present invention further provides for administering a
second interfering RNA to a subject in addition to a first
interfering RNA. The method comprises administering to the subject
a second interfering RNA having a length of 19 to 49 nucleotides
and comprising a sense nucleotide strand, an antisense nucleotide
strand, and a region of at least near-perfect complementarity of at
least 19 nucleotides; wherein the antisense strand of the second
interfering RNA hybridizes under physiological conditions to a
second portion of mRNA corresponding to SEQ ID NO:1 or SEQ ID NO:2
and the antisense strand has a region of at least near-perfect
contiguous complementarity of at least 19 nucleotides with the
second hybridizing portion of mRNA corresponding to SEQ ID NO:1 or
SEQ ID NO:2, respectively. The second interfering RNA may target
the same mRNA as the first interfering RNA or may target a
different mRNA. Further, a third, fourth, or fifth, etc.
interfering RNA may be administered in a similar manner.
[0013] Another embodiment of the invention is a method of
attenuating expression of Rho kinase in a subject comprising
administering to the subject a composition comprising an effective
amount of single-stranded interfering RNA having a length of 19 to
49 nucleotides and a pharmaceutically acceptable carrier.
[0014] For attenuating expression of ROCK1, the single-stranded
interfering RNA hybridizes under physiological conditions to a
portion of mRNA corresponding to SEQ ID NO:1 comprising nucleotide
605, 653, 659, 1248, 1562, 1876, 2266, 2474, 2485, 2740, 2808,
2834, 3007, 3146, 3199, 3245, 3379, 3453, 3511, 3513, 3519, 3781,
3782, 998, 1132, 1200, 1648, 1674, 1708, or 2077, and the
interfering RNA has a region of at least near-perfect
complementarity of at least 19 nucleotides with the hybridizing
portion of mRNA corresponding to SEQ ID NO:1. Expression of ROCK1
is thereby attenuated.
[0015] For attenuating expression of ROCK2, the single-stranded
interfering RNA hybridizes under physiological conditions to a
portion of mRNA corresponding to SEQ ID NO:2 comprising nucleotide
1102, 1865, 2000, 2229, 2514, 2584, 2738, 3305, 4111, 4652, 5184,
5187, 5255, 5315, 5439, 5450, 5578, 5579, 5611, 5625, 5795, 6000,
6228, 6264, 584, 1337, 1678, 2773, 2814, 2941, 3357, 3398, 3481,
3633, 3644, 3645, 3767, 3836, 4023, 4097, 5202, or 5440 and the
interfering RNA has a region of at least near-perfect contiguous
complementarity of at least 19 nucleotides with the hybridizing
portion of mRNA corresponding to SEQ ID NO:2. Expression of ROCK2
is thereby attenuated.
[0016] A further embodiment of the invention is a method of
treating ocular hypertension or glaucoma in a subject in need
thereof. The method comprises administering to the eye of the
subject a composition comprising an effective amount of interfering
RNA having a length of 19 to 49 nucleotides and a pharmaceutically
acceptable carrier, the interfering RNA comprising a sense
nucleotide strand, an antisense nucleotide strand, and a region of
at least near-perfect contiguous complementarity of at least 19
nucleotides. The antisense strand hybridizes under physiological
conditions to a portion of mRNA corresponding to SEQ ID NO:1 or SEQ
ID NO: 2 and has a region of at least near-perfect contiguous
complementarity of at least 19 nucleotides with the hybridizing
portion of mRNA corresponding to SEQ ID NO:1 or SEQ ID NO:2,
respectively. The ocular hypertension or glaucoma is treated
thereby.
[0017] Another embodiment of the invention is a method of treating
ocular hypertension or glaucoma in a subject in need thereof, the
method comprising administering to an eye of the subject a
composition comprising an effective amount of interfering RNA
having a length of 19 to 49 nucleotides and a pharmaceutically
acceptable carrier, the interfering RNA comprising a region of at
least 13 contiguous nucleotides having at least 90% sequence
complementarity to, or at least 90% sequence identity with, the
penultimate 13 nucleotides of the 3' end of an mRNA corresponding
to any one of SEQ ID NO:3 and SEQ ID NO:9-SEQ ID NO:79, wherein the
ocular hypertension or glaucoma is treated thereby.
[0018] Another embodiment of the invention is a method of
attenuating expression of a Rho kinase target mRNA in a subject,
comprising administering to the subject a composition comprising an
effective amount of interfering RNA having a length of 19 to 49
nucleotides and a pharmaceutically acceptable carrier, where the
interfering RNA comprises a region of at least 13 contiguous
nucleotides having at least 90% sequence complementarity to, or at
least 90% sequence identity with, the penultimate 13 nucleotides of
the 3' end of an mRNA corresponding to any one of SEQ ID NO:3 and
SEQ ID NO:9-SEQ ID NO:79 as follows.
[0019] When the Rho kinase target mRNA is ROCK1 mRNA, the
interfering RNA comprises a region of at least 13 contiguous
nucleotides having at least 90% sequence complementarity to, or at
least 90% sequence identity with, the penultimate 13 nucleotides of
the 3' end of an mRNA corresponding to SEQ ID NO:3, SEQ ID NO:9,
SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID
NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ
ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23,
SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID
NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:73, SEQ ID NO:74, SEQ
ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, or SEQ ID
NO:79.
[0020] When the Rho kinase target mRNA is ROCK2 mRNA, the
interfering RNA comprises a region of at least 13 contiguous
nucleotides having at least 90% sequence complementarity to, or at
least 90% sequence identity with, the penultimate 13 nucleotides of
the 3' end of an mRNA corresponding to SEQ ID NO:31, SEQ ID NO:32,
SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID
NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ
ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46,
SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID
NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ
ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60,
SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID
NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ
ID NO:70, SEQ ID NO:71, or SEQ ID NO:72.
[0021] In a further embodiment of the present invention, the region
of contiguous nucleotides is a region of at least 14 contiguous
nucleotides having at least 85% sequence complementarity to, or at
least 85% sequence identity with, the penultimate 14 nucleotides of
the 3' end of an mRNA corresponding to the sequence of the sequence
identifier. In yet another embodiment of the invention, the region
of contiguous nucleotides is a region of at least 15, 16, 17, or 18
contiguous nucleotides having at least 80% sequence complementarity
to, or at least 80% sequence identity with, the penultimate 15, 16,
17, or 18 nucleotides, respectively, of the 3' end of an mRNA
corresponding to the target sequence identified by the sequence
identifier.
[0022] A further embodiment of the invention is a method of
treating ocular hypertension in a subject in need thereof, the
method comprising administering to the subject a composition
comprising a double stranded siRNA molecule that down regulates
expression of a ROCK1 or ROCK2 gene via RNA interference, wherein
each strand of the siRNA molecule is independently about 19 to
about 27 nucleotides in length; and one strand of the siRNA
molecule comprises a nucleotide sequence having substantial
complementarity to an mRNA corresponding to the ROCK1 or ROCK2
gene, respectively, so that the siRNA molecule directs cleavage of
the mRNA via RNA interference.
[0023] A composition comprising interfering RNA having a length of
19 to 49 nucleotides and having a nucleotide sequence of any one of
SEQ ID NO:3, and SEQ ID NO:9-SEQ ID NO:79, or a complement thereof,
and a pharmaceutically acceptable carrier is an embodiment of the
present invention. In one embodiment, the interfering RNA is
isolated. The term "isolated" means that the interfering RNA is
free of its total natural mileau.
[0024] Another embodiment of the invention is a composition
comprising a double stranded siRNA molecule that down regulates
expression of a ROCK1 or ROCK2 gene via RNA interference, wherein
each strand of the siRNA molecule is independently about 19 to
about 27 nucleotides in length; and one strand of the siRNA
molecule comprises a nucleotide sequence has substantial
complementarity to an mRNA corresponding to the ROCK1 or ROCK2
gene, respectively, so that the siRNA molecule directs cleavage of
the mRNA via RNA interference.
[0025] The present invention provides an advantage over small
molecule inhibitors of Rho kinase since an undesirable side effect
of current small molecule therapies, e.g., hyperemia, can be
dissociated from the desirable effect of lowering intraocular
pressure.
[0026] Use of any of the embodiments as described herein in the
preparation of a medicament for attenuating expression of ROCK1 or
ROCK2 mRNA is also an embodiment of the present invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0027] FIG. 1 provides a ROCK1 western blot of GTM-3 cells
transfected with ROCK1 siRNAs #1, #2, #3, and #4; ROCK2 siRNAs #1,
#2, #3, and #4; a ROCK1 siRNA pool; a non-targeting control siRNA;
and a buffer control (-siRNA). The siRNAs were at a concentration
of 100 nM. The arrows indicate the positions of the 160-kDa ROCK1
protein and 42-kDa actin protein bands.
[0028] FIG. 2 provides a ROCK1 western blot of GTM-3 cells
transfected with ROCK1 siRNAs #1, #2, #3, and #4, and a
non-targeting control siRNA, each at 10 nM, 1 nM, and 0.1 nM, and a
buffer control (-siRNA). The arrows indicate the positions of the
160-kDa ROCK1 protein and the 42-kDa actin protein bands.
[0029] FIG. 3 provides a ROCK2 western blot of GTM-3 cells
transfected with ROCK2 siRNAs #1, #2, #3, and #4, a ROCK1 pool, and
a non-targeting control siRNA, each at 100 nM, and a buffer control
(-siRNA). The arrows indicate the positions of the 160-kDa ROCK2
protein and the 42-kDa actin protein bands.
[0030] FIG. 4 provides a ROCK2 western blot of GTM-3 cells
transfected with ROCK2 siRNAs #1, #2, #3, and #4, and a
non-targeting control siRNA, each at 10 nM, 1 nM, and 0.1 nM, and a
buffer control (-siRNA). The arrows indicate the positions of the
160-kDa ROCK2 protein and the 42-kDa actin protein bands.
DETAILED DESCRIPTION OF THE INVENTION
[0031] RNA interference (RNAi) is a process by which
double-stranded RNA (dsRNA) is used to silence gene expression.
While not wanting to be bound by theory, RNAi begins with the
cleavage of longer dsRNAs into small interfering RNAs (siRNAs) by
an RNaseIII-like enzyme, dicer. SiRNAs are dsRNAs that are usually
about 19 to 28 nucleotides, or 20 to 25 nucleotides, or 21 to 22
nucleotides in length and often contain 2-nucleotide 3' overhangs,
and 5' phosphate and 3' hydroxyl termini. One strand of the siRNA
is incorporated into a ribonucleoprotein complex known as the
RNA-induced silencing complex (RISC). RISC uses this siRNA strand
to identify mRNA molecules that are at least partially
complementary to the incorporated siRNA strand, and then cleaves
these target mRNAs or inhibits their translation. Therefore, the
siRNA strand that is incorporated into RISC is known as the guide
strand or the antisense strand. The other siRNA strand, known as
the passenger strand or the sense strand, is eliminated from the
siRNA and is at least partially homologous to the target mRNA.
Those of skill in the art will recognize that, in principle, either
strand of an siRNA can be incorporated into RISC and function as a
guide strand. However, siRNA design (e.g., decreased siRNA duplex
stability at the 5' end of the antisense strand) can favor
incorporation of the antisense strand into RISC.
[0032] RISC-mediated cleavage of mRNAs having a sequence at least
partially complementary to the guide strand leads to a decrease in
the steady state level of that mRNA and of the corresponding
protein encoded by this mRNA. Alternatively, RISC can also decrease
expression of the corresponding protein via translational
repression without cleavage of the target mRNA. Other RNA molecules
and RNA-like molecules can also interact with RISC and silence gene
expression. Examples of other RNA molecules that can interact with
RISC include short hairpin RNAs (shRNAs), single-stranded siRNAs,
microRNAs (miRNAs), and dicer-substrate 27-mer duplexes. The term
"siRNA" as used herein refers to a double-stranded interfering RNA
unless otherwise noted. Examples of RNA-like molecules that can
interact with RISC include RNA molecules containing one or more
chemically modified nucleotides, one or more deoxyribonucleotides,
and/or one or more non-phosphodiester linkages. For purposes of the
present discussion, all RNA or RNA-like molecules that can interact
with RISC and participate in RISC-mediated changes in gene
expression will be referred to as "interfering RNAs." SiRNAs,
shRNAs, miRNAs, and dicer-substrate 27-mer duplexes are, therefore,
subsets of "interfering RNAs."
[0033] Interfering RNA of embodiments of the invention appear to
act in a catalytic manner for cleavage of target mRNA, i.e.,
interfering RNA is able to effect inhibition of target mRNA in
substoichiometric amounts. As compared to antisense therapies,
significantly less interfering RNA is required to provide a
therapeutic effect under such cleavage conditions.
[0034] The present invention relates to the use of interfering RNA
to inhibit the expression of Rho kinase (ROCK) mRNA, thus lowering
intraocular pressure in patients with glaucoma. There are two Rho
kinase isoforms: ROCK1 (also known as ROCKI, ROK.beta. or p160ROCK)
and ROCK2 (also known as ROCKII or ROK.alpha.). According to the
present invention, interfering RNAs as set forth herein provided
exogenously or expressed endogenously are particularly effective at
silencing ROCK mRNA.
[0035] Small molecule inhibitors of ROCK cause reversible changes
in trabecular meshwork cell morphology and cytoskeletal
organization, decrease contractility of isolated ciliary muscle
tissue, and increase aqueous humor outflow facility in organ
culture. Similar effects are generated by expression of dominant
negative Rho-binding domains. Treatment with small molecule
inhibitors of ROCK lowers IOP, however, such treatment also appears
to cause hyperemia. The small molecule inhibitors of ROCK examined
to date inhibit multiple kinases in addition to ROCK1 and ROCK2.
Use of interfering RNAs of the present invention having specificity
for ROCK1 or ROCK2 mRNA is expected to dissociate the desirable
IOP-lowering effect of treatment from the undesirable hyperemia
effect of treatment.
[0036] Nucleic acid sequences cited herein are written in a 5' to
3' direction unless indicated otherwise. The term "nucleic acid,"
as used herein, refers to either DNA or RNA or a modified form
thereof comprising the purine or pyrimidine bases present in DNA
(adenine "A," cytosine "C," guanine "G," thymine "T") or in RNA
(adenine "A," cytosine "C," guanine "G," uracil "U"). Interfering
RNAs provided herein may comprise "T" bases, particularly at 3'
ends, even though "T" bases do not naturally occur in RNA. "Nucleic
acid" includes the terms "oligonucleotide" and "polynucleotide" and
can refer to a single-stranded molecule or a double-stranded
molecule. A double-stranded molecule is formed by Watson-Crick base
pairing between A and T bases, C and G bases, and between A and U
bases. The strands of a double-stranded molecule may have partial,
substantial or full complementarity to each other and will form a
duplex hybrid, the strength of bonding of which is dependent upon
the nature and degree of complementarity of the sequence of
bases.
[0037] An mRNA sequence is readily deduced from the sequence of the
corresponding DNA sequence. For example, SEQ ID NO:1 provides the
sense strand sequence of DNA corresponding to the mRNA for ROCK1.
The mRNA sequence is identical to the DNA sense strand sequence
with the "T" bases replaced with "U" bases. Therefore, the mRNA
sequence of ROCK1 is known from SEQ ID NO:1 and the mRNA sequence
of ROCK2 is known from SEQ ID NO:2.
[0038] Rho kinase mRNA (ROCK1 and ROCK2): Rho-associated,
coiled-coil containing protein kinases, also known as Rho kinases
or simply ROCKs, are effectors of the Rho family of small
GTP-binding proteins (Rho GTPases). The Rho GTPase signaling
pathway appears to play a role in regulating aqueous humor outflow,
for example, by altering the cytoskeletal organization of
trabecular meshwork (TM) and/or ciliary muscle (CM) cells.
[0039] ROCKs are serine/threonine protein kinases that are
activated by GTP-bound Rho. ROCK activation leads to the
phosphorylation of several substrates involved in actin filament
assembly and cell contractility including myosin light chain,
myosin light chain phosphatase, LIM kinase, adducin, ERM, for
example. Thus, ROCKs regulate a wide variety of cellular processes
including stress-fiber formation, contraction, adhesion, migration,
phagocytosis, apoptosis, and cytokinesis. Two ROCK isoforms are
ROCK1 (also known as ROCKI, ROK.beta., or p160ROCK) and ROCK2 (also
known as ROCKII or ROK.alpha.). The two isoforms are highly
similar, particularly in their kinase domains (92% identity at the
amino acid level), however, they exhibit differences in tissue
distribution and intracellular localization suggesting that they
may have distinct, non-redundant functions. Both ROCK1 and ROCK2
are expressed in the human eye anterior segment.
[0040] The GenBank database of the National Center for
Biotechnology Information at ncbi.nlm.nih.gov provides the DNA
sequence for ROCK1 as accession no. NM.sub.--005406, provided in
the "Sequence Listing" as SEQ ID NO:1. SEQ ID NO:1 provides the
sense strand sequence of DNA that corresponds to the mRNA encoding
ROCK1 (with the exception of "T" bases for "U" bases). The coding
sequence for ROCK1 is from nucleotides 1-4065.
[0041] Equivalents of the above cited ROCK1 mRNA sequence are
alternative splice forms, allelic forms, isozymes, or a cognate
thereof. A cognate is a ROCK1 mRNA from another mammalian species
that is homologous to SEQ ID NO:1 (an ortholog).
[0042] The GenBank database provides the DNA sequence for ROCK2 as
accession no. NM 004850, provided in the "Sequence Listing" as SEQ
ID NO:2. SEQ ID NO:2 provides the sense strand sequence of DNA that
corresponds to the mRNA encoding ROCK2 (with the exception of "T"
bases for "U" bases). The coding sequence for ROCK2 is from
nucleotides 450-4616.
[0043] Equivalents of the above cited ROCK2 mRNA sequence are
alternative splice forms, allelic forms, isozymes, or a cognate
thereof. A cognate is a ROCK2 mRNA from another mammalian species
that is homologous to SEQ ID NO:2 (an ortholog).
[0044] Attenuating expression of an mRNA: The phrase, "attenuating
expression of an mRNA," as used herein, means administering or
expressing an amount of interfering RNA (e.g., an siRNA) to reduce
translation of the target mRNA into protein, either through mRNA
cleavage or through direct inhibition of translation. The reduction
in expression of the target mRNA or the corresponding protein is
commonly referred to as "knock-down" and is reported relative to
levels present following administration or expression of a
non-targeting control RNA (e.g., a non-targeting control siRNA).
Knock-down of expression of an amount including and between 50% and
100% is contemplated by embodiments herein. However, it is not
necessary that such knock-down levels be achieved for purposes of
the present invention. In one embodiment, a single interfering RNA
targeting one of the Rho kinase targets is administered to lower
IOP. In other embodiments, two or more interfering RNAs targeting
the same Rho kinase target (e.g., ROCK1) are administered to lower
IOP. In still other embodiments, two or more interfering RNAs
targeting both Rho kinase targets (e.g., ROCK1 and ROCK2) are
administered to lower IOP.
[0045] Knock-down is commonly assessed by measuring the mRNA levels
using quantitative polymerase chain reaction (qPCR) amplification
or by measuring protein levels by western blot or enzyme-linked
immunosorbent assay (ELISA). Analyzing the protein level provides
an assessment of both mRNA cleavage as well as translation
inhibition. Further techniques for measuring knock-down include RNA
solution hybridization, nuclease protection, northern
hybridization, gene expression monitoring with a microarray,
antibody binding, radioimmunoassay, and fluorescence activated cell
analysis.
[0046] Inhibition of ROCK1 or ROCK2 may also be determined in vitro
by evaluating target mRNA levels or target protein levels in, for
example, human TM cells following transfection of ROCK1- or
ROCK2-interfering RNA as described infra.
[0047] Inhibition of targets cited herein is also inferred in a
human or mammal by observing an improvement in a glaucoma symptom
such as improvement in intraocular pressure, improvement in visual
field loss, or improvement in optic nerve head changes, for
example.
[0048] Interfering RNA: In one embodiment of the invention,
interfering RNA (e.g., siRNA) has a sense strand and an antisense
strand, and the sense and antisense strands comprise a region of at
least near-perfect contiguous complementarity of at least 19
nucleotides. In a further embodiment of the invention, interfering
RNA (e.g., siRNA) has a sense strand and an antisense strand, and
the antisense strand comprises a region of at least near-perfect
contiguous complementarity of at least 19 nucleotides to a target
sequence of ROCK1 or ROCK2 mRNA, and the sense strand comprises a
region of at least near-perfect contiguous identity of at least 19
nucleotides with a target sequence of ROCK1 or ROCK2 mRNA,
respectively. In a further embodiment of the invention, the
interfering RNA comprises a region of at least 13, 14, 15, 16, 17,
or 18 contiguous nucleotides having percentages of sequence
complementarity to or, having percentages of sequence identity
with, the penultimate 13, 14, 15, 16, 17, or 18 nucleotides,
respectively, of the 3' end of the corresponding target sequence
within an mRNA.
[0049] The length of each strand of the interfering RNA comprises
19 to 49 nucleotides, and may comprise a length of 19, 20, 21, 22,
23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39,
40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides.
[0050] The antisense strand of an siRNA is the active guiding agent
of the siRNA in that the antisense strand is incorporated into
RISC, thus allowing RISC to identify target mRNAs with at least
partial complementary to the antisense siRNA strand for cleavage or
translational repression.
[0051] In embodiments of the present invention, interfering RNA
target sequences (e.g., siRNA target sequences) within a target
mRNA sequence are selected using available design tools.
Interfering RNAs corresponding to a ROCK1 or ROCK2 target sequence
are then tested by transfection of cells expressing the target mRNA
followed by assessment of knockdown as described above.
[0052] Techniques for selecting target sequences for siRNAs are
provided by Tuschl, T. et al., "The siRNA User Guide," revised May
6, 2004, available on the Rockefeller University web site; by
Technical Bulletin #506, "siRNA Design Guidelines," Ambion Inc. at
Ambion's web site; and by other web-based design tools at, for
example, the Invitrogen, Dharmacon, Integrated DNA Technologies,
Genscript, or Proligo web sites. Initial search parameters can
include G/C contents between 35% and 55% and siRNA lengths between
19 and 27 nucleotides. The target sequence may be located in the
coding region or in the 5' or 3' untranslated regions of the
mRNA.
[0053] An embodiment of a 19-nucleotide DNA target sequence for
ROCK1 mRNA is present at nucleotides 605 to 623 of SEQ ID NO:1:
TABLE-US-00001 5'- ATAACATGCTGCTGGATAA -3'. SEQ ID NO: 3
An siRNA of the invention for targeting a corresponding mRNA
sequence of SEQ ID NO:3 and having 21-nucleotide strands and a
2-nucleotide 3' overhang is:
TABLE-US-00002 5'- AUAACAUGCUGCUGGAUAANN-3' SEQ ID NO: 4 3'
-NNUAUUGUACGACGACCUAUU-5'. SEQ ID NO: 5
Each "N" residue can be any nucleotide (A, C, G, U, T) or modified
nucleotide. The 3' end can have a number of "N" residues between
and including 1, 2, 3, 4, 5, and 6. The "N" residues on either
strand can be the same residue (e.g., UU, AA, CC, GG, or TT) or
they can be different (e.g., AC, AG, AU, CA, CG, CU, GA, GC, GU,
UA, UC, or UG). The 3' overhangs can be the same or they can be
different. In one embodiment, both strands have a 3'UU
overhang.
[0054] An siRNA of the invention for targeting a corresponding mRNA
sequence of SEQ ID NO:3 and having 21-nucleotide strands and a 3'UU
overhang on each strand is:
TABLE-US-00003 5'-AUAACAUGCUGCUGGAUAAUU-3' SEQ ID NO: 6
3'-UUUAUUGUACGACGACCUAUU-5'. SEQ ID NO: 7
The interfering RNA may also have a 5' overhang of nucleotides or
it may have blunt ends. An siRNA of the invention for targeting a
corresponding mRNA sequence of SEQ ID NO:3 and having 19-nucleotide
strands and blunt ends is:
TABLE-US-00004 5'- AUAACAUGCUGCUGGAUAA -3' SEQ ID NO: 80 3'-
UAUUGUACGACGACCUAUU -5'. SEQ ID NO: 81
[0055] The strands of a double-stranded interfering RNA (e.g., an
siRNA) may be connected to form a hairpin or stem-loop structure
(e.g., an shRNA). An shRNA of the invention targeting a
corresponding mRNA sequence of SEQ ID NO:2 and having a 19 by
double-stranded stem region and a 3'UU overhang is:
##STR00001##
N is a nucleotide A, T, C, G, U, or a modified form known by one of
ordinary skill in the art. The number of nucleotides N in the loop
is a number between and including 3 to 23, or 5 to 15, or 7 to 13,
or 4 to 9, or 9 to 11, or the number of nucleotides N is 9. Some of
the nucleotides in the loop can be involved in base-pair
interactions with other nucleotides in the loop. Examples of
oligonucleotide sequences that can be used to form the loop include
5'-UUCAAGAGA-3' (Brummelkamp, T. R. et al. (2002) Science 296: 550)
and 5'-UUUGUGUAG-3' (Castanotto, D. et al. (2002) RNA 8:1454). It
will be recognized by one of skill in the art that the resulting
single chain oligonucleotide forms a stem-loop or hairpin structure
comprising a double-stranded region capable of interacting with the
RNAi machinery.
[0056] The siRNA target sequence identified above can be extended
at the 3' end to facilitate the design of dicer-substrate 27-mer
duplexes. Extension of the 19-nucleotide DNA target sequence (SEQ
ID NO:3) identified in the ROCK1 DNA sequence (SEQ ID NO:1) by 6
nucleotides yields a 25-nucleotide DNA target sequence present at
nucleotides 605 to 629 of SEQ ID NO:1:
TABLE-US-00005 5'- ATAACATGCTGCTGGATAAATCTGG -3'. SEQ ID NO: 82
A dicer-substrate 27-mer duplex of the invention for targeting a
corresponding mRNA sequence of SEQ ID NO:82 is:
TABLE-US-00006 5'- AUAACAUGCUGCUGGAUAAAUCUGG -3' SEQ ID NO: 83 3'-
UUUAUUGUACGACGACCUAUUUAGACC -5'. SEQ ID NO: 84
The two nucleotides at the 3' end of the sense strand (i.e., the GG
nucleotides of SEQ ID NO:83) may be deoxynucleotides for enhanced
processing. Design of dicer-substrate 27-mer duplexes from 19-21
nucleotide target sequences, such as provided herein, is further
discussed by the Integrated DNA Technologies (IDT) website and by
Kim, D.-H. et al., (February, 2005) Nature Biotechnology 23:2;
222-226.
[0057] When interfering RNAs are produced by chemical synthesis,
phosphorylation at the 5' position of the nucleotide at the 5' end
of one or both strands (when present) can enhance siRNA efficacy
and specificity of the bound RISC complex but is not required since
phosphorylation can occur intracellularly.
[0058] Table 1 lists examples of ROCK1 and ROCK2 DNA target
sequences of SEQ ID NO:1 and SEQ ID NO:2, respectively, from which
siRNAs of the present invention are designed in a manner as set
forth above. ROCK1 and ROCK2 encode the two Rho kinase isoforms, as
noted above.
TABLE-US-00007 TABLE 1 ROCK1 and ROCK2 Target Sequences for siRNAs
# of Starting Nucleotide with reference to ROCK1 Target Sequences
SEQ ID NO: 1 SEQ ID NO: ATAACATGCTGCTGGATAA 605 3
GTACTTGTATGAAGATGAA 653 9 GTATGAAGATGAATAAGGA 659 10
TAGCTCCAATGCAGATAAA 1248 11 ATCAGTTGGAAGACTTAAA 1562 12
GACCTTCAAGCTCGAATTA 1876 13 GAACATTTGACTGGAAATA 2266 14
TAGCTCAGCTTACGAAACA 2474 15 ACGAAACAGTATAGAGGAA 2485 16
TTTGAATTGACGCAAGAAA 2740 17 CACTGTTAGTCGGCTTGAA 2808 18
ACAGCATGCTAACCAAAGA 2834 19 GTTAACAAATTGGCAGAAA 3007 20
ACCAGATGGTAGTGAAACA 3146 21 GTAGAAGAATGTGCACATA 3199 22
GCAAAGAGAGTGATATTGA 3245 23 GTACCAAATAGAGGAAATA 3379 24
GTTCTATAATGACGAACAA 3453 25 GATAAACTGTTTCACGTTA 3511 26
TAAACTGTTTCACGTTAGA 3513 27 GTTTCACGTTAGACCTGTA 3519 28
TGTCGAAGATGCCATGTTA 3781 29 GTCGAAGATGCCATGTTAA 3782 30
AACGACATCTCTTCTTCAA 998 73 GAAGAAACATTCCCTATTC 1132 74
TAGCAATCGTAGATACTTA 1200 75 GCCAATGACTTACTTAGGA 1648 76
GGACACAGCTGTAAGATTG 1674 77 GAGATGAGCAAGTCAATTA 1708 78
GTAACCAAAGCTCGTTTAA 2077 79 # of Starting Nucleotide with reference
to ROCK2 Target Sequences SEQ ID NO: 2 SEQ ID NO:
ACAACATGCTCTTGGATAA 1102 31 TGTTAATACTCGCCTAGAA 1865 32
GAAAGCTGATCATGAAGCA 2000 33 CAGCTGGAATCTAACAATA 2229 34
GATATGACATACCAACTAA 2514 35 AGGCACGACTAGCAGATAA 2584 36
ATTAGACTGTGACCTCAAA 2738 37 GATGATGGCTAGACACAAA 3305 38
CTAAAGAAATTCCAAGGAT 4111 39 TCGTATTCTTCCAGTGAAA 4652 40
TTGCAACTATGCACTTGTA 5184 41 CAACTATGCACTTGTATAA 5187 42
GTTGCATGTTCATGTTTAA 5255 43 TTCCTAATGCTTCATGATA 5315 44
CTAGCTTTGTGGAAGATAA 5439 45 GAAGATAAATCGTGCACTA 5450 46
CCTTGATGTCTGTCTATTA 5578 47 CTTGATGTCTGTCTATTAT 5579 48
TTTACAGACCTCAGTATTA 5611 49 TATTAGTCTGTGACTACAA 5625 50
TAAATATGATCCTCAGACA 5795 51 CAGCAATGGTAAGCGTAAA 6000 52
CTCCGTCTCTACCAATATA 6228 53 TGATGGTGGTGGCCTGTAA 6264 54
CTTGCTGGATGGCTTAAAT 584 55 GGATTCACTTGTAGGAACA 1337 56
TCATCGGATTTACCTACTA 1678 57 TAAATGAGCTCCTTAAACA 2773 58
GTTAGAAACCTGACATTAA 2814 59 ATAACCATCTCATGGAAAT 2941 60
TCTCTTGAGGAAACTAATA 3357 61 CAATCTTGCAAATGAGAAA 3398 62
TAAGCGCAGCAGCTATTAA 3481 63 GAGAATAGAAAGCTACATA 3633 64
GCTACATATGGAGCTTAAA 3644 65 CTACATATGGAGCTTAAAT 3645 66
GATGACATTGGACAGTAAA 3767 67 TCTGGATAGTTCCAGTATA 3836 68
GAACAATCCAATCCTTACA 4023 69 GTATAGAGCAGATGCTAAA 4097 70
ATAAAGCCATAATGTTGGA 5202 71 TAGCTTTGTGGAAGATAAA 5440 72
As cited in the examples above, one of skill in the art is able to
use the target sequence information provided in Table 1 to design
interfering RNAs having a length shorter or longer than the
sequences provided in the table and by referring to the sequence
position in SEQ ID NO:1 or SEQ ID NO:2 and adding or deleting
nucleotides complementary or near complementary to SEQ ID NO:1 or
SEQ ID NO:2 respectively.
[0059] The target RNA cleavage reaction guided by siRNAs and other
forms of interfering RNA is highly sequence specific. In general,
siRNA containing a sense nucleotide strand identical in sequence to
a portion of the target mRNA and an antisense nucleotide strand
exactly complementary to a portion of the target mRNA are siRNA
embodiments for inhibition of mRNAs cited herein. However, 100%
sequence complementarity between the antisense siRNA strand and the
target mRNA, or between the antisense siRNA strand and the sense
siRNA strand, is not required to practice the present invention.
Thus, for example, the invention allows for sequence variations
that might be expected due to genetic mutation, strain
polymorphism, or evolutionary divergence.
[0060] In one embodiment of the invention, the antisense strand of
the siRNA has at least near-perfect contiguous complementarity of
at least 19 nucleotides with the target mRNA. "Near-perfect," as
used herein, means the antisense strand of the siRNA is
"substantially complementary to," and the sense strand of the siRNA
is "substantially identical to" at least a portion of the target
mRNA. "Identity," as known by one of ordinary skill in the art, is
the degree of sequence relatedness between nucleotide sequences as
determined by matching the order and identity of nucleotides
between the sequences. In one embodiment, the antisense strand of
an siRNA having 80% and between 80% up to 100% complementarity, for
example, 85%, 90% or 95% complementarity, to the target mRNA
sequence are considered near-perfect complementarity and may be
used in the present invention. "Perfect" contiguous complementarity
is standard Watson-Crick base pairing of adjacent base pairs. "At
least near-perfect" contiguous complementarity includes "perfect"
complementarity as used herein. Computer methods for determining
identity or complementarity are designed to identify the greatest
degree of matching of nucleotide sequences, for example, BLASTN
(Altschul, S. F., et al. (1990) J. Mol. Biol. 215:403-410).
[0061] The term "percent identity" describes the percentage of
contiguous nucleotides in a first nucleic acid molecule that is the
same as in a set of contiguous nucleotides of the same length in a
second nucleic acid molecule. The term "percent complementarity"
describes the percentage of contiguous nucleotides in a first
nucleic acid molecule that can base pair in the Watson-Crick sense
with a set of contiguous nucleotides in a second nucleic acid
molecule.
[0062] The relationship between a target mRNA (sense strand) and
one strand of an siRNA (the sense strand) is that of identity. The
sense strand of an siRNA is also called a passenger strand, if
present. The relationship between a target mRNA (sense strand) and
the other strand of an siRNA (the antisense strand) is that of
complementarity. The antisense strand of an siRNA is also called a
guide strand.
[0063] The penultimate base in a nucleic acid sequence that is
written in a 5' to 3' direction is the next to the last base, i.e.,
the base next to the 3' base. The penultimate 13 bases of a nucleic
acid sequence written in a 5' to 3' direction are the last 13 bases
of a sequence next to the 3' base and not including the 3' base.
Similarly, the penultimate 14, 15, 16, 17, or 18 bases of a nucleic
acid sequence written in a 5' to 3' direction are the last 14, 15,
16, 17, or 18 bases of a sequence, respectively, next to the 3'
base and not including the 3' base.
[0064] The phrase "a region of at least 13 contiguous nucleotides
having at least 90% sequence complementarity to, or at least 90%
sequence identity with, the penultimate 13 nucleotides of the 3'
end of an mRNA corresponding to any one of (a sequence identifier)"
allows a one nucleotide substitution. Two nucleotide substitutions
(i.e., 11/13=85% identity/complementarity) are not included in such
a phrase.
[0065] In one embodiment of the invention, the region of contiguous
nucleotides is a region of at least 14 contiguous nucleotides
having at least 85% sequence complementarity to, or at least 85%
sequence identity with, the penultimate 14 nucleotides of the 3'
end of an mRNA corresponding to the sequence identified by each
sequence identifier. Two nucleotide substitutions (i.e., 12/14=86%
identity/complementarity) are included in such a phrase.
[0066] In a further embodiment of the invention, the region of
contiguous nucleotides is a region of at least 15, 16, 17, or 18
contiguous nucleotides having at least 80% sequence complementarity
to, or at least 80% sequence identity with, the penultimate 14
nucleotides of the 3' end of an mRNA corresponding to the sequence
of the sequence identifier. Three nucleotide substitutions are
included in such a phrase.
[0067] The target sequence in the mRNAs corresponding to SEQ ID
NO:1 or SEQ ID NO:2 may be in the 5' or 3' untranslated regions of
the mRNA as well as in the coding region of the mRNA.
[0068] One or both of the strands of double-stranded interfering
RNA may have a 3' overhang of from 1 to 6 nucleotides, which may be
ribonucleotides or deoxyribonucleotides or a mixture thereof. The
nucleotides of the overhang are not base-paired. In one embodiment
of the invention, the interfering RNA comprises a 3' overhang of TT
or UU. In another embodiment of the invention, the interfering RNA
comprises at least one blunt end. The termini usually have a 5'
phosphate group or a 3' hydroxyl group. In other embodiments, the
antisense strand has a 5' phosphate group, and the sense strand has
a 5' hydroxyl group. In still other embodiments, the termini are
further modified by covalent addition of other molecules or
functional groups.
[0069] The sense and antisense strands of the double-stranded siRNA
may be in a duplex formation of two single strands as described
above or may be a single molecule where the regions of
complementarity are base-paired and are covalently linked by a
hairpin loop so as to form a single strand. It is believed that the
hairpin is cleaved intracellularly by a protein termed dicer to
form an interfering RNA of two individual base-paired RNA
molecules.
[0070] Interfering RNAs may differ from naturally-occurring RNA by
the addition, deletion, substitution or modification of one or more
nucleotides. Non-nucleotide material may be bound to the
interfering RNA, either at the 5' end, the 3' end, or internally.
Such modifications are commonly designed to increase the nuclease
resistance of the interfering RNAs, to improve cellular uptake, to
enhance cellular targeting, to assist in tracing the interfering
RNA, to further improve stability, or to reduce the potential for
activation of the interferon pathway. For example, interfering RNAs
may comprise a purine nucleotide at the ends of overhangs.
Conjugation of cholesterol to the 3' end of the sense strand of an
siRNA molecule by means of a pyrrolidine linker, for example, also
provides stability to an siRNA.
[0071] Further modifications include a 3' terminal biotin molecule,
a peptide known to have cell-penetrating properties, a
nanoparticle, a peptidomimetic, a fluorescent dye, or a dendrimer,
for example.
[0072] Nucleotides may be modified on their base portion, on their
sugar portion, or on the phosphate portion of the molecule and
function in embodiments of the present invention. Modifications
include substitutions with alkyl, alkoxy, amino, deaza, halo,
hydroxyl, thiol groups, or a combination thereof, for example.
Nucleotides may be substituted with analogs with greater stability
such as replacing a ribonucleotide with a deoxyribonucleotide, or
having sugar modifications such as 2' OH groups replaced by 2'
amino groups, 2' O-methyl groups, 2' methoxyethyl groups, or a
2'-O, 4'-C methylene bridge, for example. Examples of a purine or
pyrimidine analog of nucleotides include a xanthine, a
hypoxanthine, an azapurine, a methylthioadenine, 7-deaza-adenosine
and O- and N-modified nucleotides. The phosphate group of the
nucleotide may be modified by substituting one or more of the
oxygens of the phosphate group with nitrogen or with sulfur
(phosphorothioates). Modifications are useful, for example, to
enhance function, to improve stability or permeability, or to
direct localization or targeting.
[0073] There may be a region or regions of the antisense
interfering RNA strand that is (are) not complementary to a portion
of SEQ ID NO:1 or SEQ ID NO:2. Non-complementary regions may be at
the 3', 5' or both ends of a complementary region or between two
complementary regions.
[0074] Interfering RNAs may be generated exogenously by chemical
synthesis, by in vitro transcription, or by cleavage of longer
double-stranded RNA with dicer or another appropriate nuclease with
similar activity. Chemically synthesized interfering RNAs, produced
from protected ribonucleoside phosphoramidites using a conventional
DNA/RNA synthesizer, may be obtained from commercial suppliers such
as Ambion Inc. (Austin, Tex.), Invitrogen (Carlsbad, Calif.), or
Dharmacon (Lafayette, Colo.). Interfering RNAs are purified by
extraction with a solvent or resin, precipitation, electrophoresis,
chromatography, or a combination thereof, for example.
Alternatively, interfering RNA may be used with little if any
purification to avoid losses due to sample processing.
[0075] Interfering RNAs can also be expressed endogenously from
plasmid or viral expression vectors or from minimal expression
cassettes, for example, PCR generated fragments comprising one or
more promoters and an appropriate template or templates for the
interfering RNA. Examples of commercially available plasmid-based
expression vectors for shRNA include members of the pSilencer
series (Ambion, Austin, Tex.) and pCpG-siRNA (InvivoGen, San Diego,
Calif.). Viral vectors for expression of interfering RNA may be
derived from a variety of viruses including adenovirus,
adeno-associated virus, lentivirus (e.g., HIV, FIV, and EIAV), and
herpes virus. Examples of commercially available viral vectors for
shRNA expression include pSilencer adeno (Ambion, Austin, Tex.) and
pLenti6/BLOCK-iTTM-DEST (Invitrogen, Carlsbad, Calif.). Selection
of viral vectors, methods for expressing the interfering RNA from
the vector and methods of delivering the viral vector are within
the ordinary skill of one in the art. Examples of kits for
production of PCR-generated shRNA expression cassettes include
Silencer Express (Ambion, Austin, Tex.) and siXpress (Minis,
Madison, Wis.). A first interfering RNA may be administered via in
vivo expression from a first expression vector capable of
expressing the first interfering RNA and a second interfering RNA
may be administered via in vivo expression from a second expression
vector capable of expressing the second interfering RNA, or both
interfering RNAs may be administered via in vivo expression from a
single expression vector capable of expressing both interfering
RNAs.
[0076] Interfering RNAs may be expressed from a variety of
eukaryotic promoters known to those of ordinary skill in the art,
including pol III promoters, such as the U6 or H1 promoters, or pol
II promoters, such as the cytomegalovirus promoter. Those of skill
in the art will recognize that these promoters can also be adapted
to allow inducible expression of the interfering RNA.
[0077] Hybridization under Physiological Conditions: In certain
embodiments of the present invention, an antisense strand of an
interfering RNA hybridizes with an mRNA in vivo as part of the RISC
complex.
[0078] "Hybridization" refers to a process in which single-stranded
nucleic acids with complementary or near-complementary base
sequences interact to form hydrogen-bonded complexes called
hybrids. Hybridization reactions are sensitive and selective. In
vitro, the specificity of hybridization (i.e., stringency) is
controlled by the concentrations of salt or formamide in
prehybridization and hybridization solutions, for example, and by
the hybridization temperature; such procedures are well known in
the art. In particular, stringency is increased by reducing the
concentration of salt, increasing the concentration of formamide,
or raising the hybridization temperature.
[0079] For example, high stringency conditions could occur at about
50% formamide at 37.degree. C. to 42.degree. C. Reduced stringency
conditions could occur at about 35% to 25% formamide at 30.degree.
C. to 35.degree. C. Examples of stringency conditions for
hybridization are provided in Sambrook, J., 1989, Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y. Further examples of stringent
hybridization conditions include 400 mM NaCl, 40 mM PIPES pH 6.4, 1
mM EDTA, 50.degree. C. or 70.degree. C. for 12-16 hours followed by
washing, or hybridization at 70.degree. C. in 1.times.SSC or
50.degree. C. in 1.times.SSC, 50% formamide followed by washing at
70.degree. C. in 0.3.times.SSC, or hybridization at 70.degree. C.
in 4.times.SSC or 50.degree. C. in 4.times.SSC, 50% formamide
followed by washing at 67.degree. C. in 1.times.SSC. The
temperature for hybridization is about 5-10.degree. C. less than
the melting temperature (T.sub.m) of the hybrid where T.sub.m is
determined for hybrids between 19 and 49 base pairs in length using
the following calculation: T.sub.m.degree.
C.=81.5+16.6(log.sub.10[Na+])+0.41 (% G+C)-(600/N) where N is the
number of bases in the hybrid, and [Na+] is the concentration of
sodium ions in the hybridization buffer.
[0080] The above-described in vitro hybridization assay provides a
method of predicting whether binding between a candidate siRNA and
a target will have specificity. However, in the context of the RISC
complex, specific cleavage of a target can also occur with an
antisense strand that does not demonstrate high stringency for
hybridization in vitro.
[0081] Single-stranded interfering RNA: As cited above, interfering
RNAs ultimately function as single strands. Single-stranded (ss)
interfering RNA has been found to effect mRNA silencing, albeit
less efficiently than double-stranded siRNA. Therefore, embodiments
of the present invention also provide for administration of a ss
interfering RNA that hybridizes under physiological conditions to a
portion of SEQ ID NO:1 or SEQ ID NO:2 and has a region of at least
near-perfect contiguous complementarity of at least 19 nucleotides
with the hybridizing portion of SEQ ID NO:1 or SEQ ID NO:2,
respectively. The ss interfering RNA has a length of 19 to 49
nucleotides as for the ds siRNA cited above. The ss interfering RNA
has a 5' phosphate or is phosphorylated in situ or in vivo at the
5' position. The term "5' phosphorylated" is used to describe, for
example, polynucleotides or oligonucleotides having a phosphate
group attached via ester linkage to the C5 hydroxyl of the sugar
(e.g., ribose, deoxyribose, or an analog of same) at the 5' end of
the polynucleotide or oligonucleotide.
[0082] SS interfering RNAs are synthesized chemically or by in
vitro transcription or expressed endogenously from vectors or
expression cassettes as for ds interfering RNAs. 5' Phosphate
groups may be added via a kinase, or a 5' phosphate may be the
result of nuclease cleavage of an RNA. Delivery is as for ds
interfering RNAs. In one embodiment, ss interfering RNAs having
protected ends and nuclease resistant modifications are
administered for silencing. SS interfering RNAs may be dried for
storage or dissolved in an aqueous solution. The solution may
contain buffers or salts to inhibit annealing or for
stabilization.
[0083] Hairpin interfering RNA: A hairpin interfering RNA is a
single molecule (e.g., a single oligonucleotide chain) that
comprises both the sense and antisense strands of an interfering
RNA in a stem-loop or hairpin structure (e.g., a shRNA). For
example, shRNAs can be expressed from DNA vectors in which the DNA
oligonucleotides encoding a sense interfering RNA strand are linked
to the DNA oligonucleotides encoding the reverse complementary
antisense interfering RNA strand by a short spacer. If needed for
the chosen expression vector, 3' terminal T's and nucleotides
forming restriction sites may be added. The resulting RNA
transcript folds back onto itself to form a stem-loop
structure.
[0084] Mode of administration: Interfering RNA may be delivered via
aerosol, buccal, dermal, intradermal, inhaling, intramuscular,
intranasal, intraocular, intrapulmonary, intravenous,
intraperitoneal, nasal, ocular, oral, otic, parenteral, patch,
subcutaneous, sublingual, topical, or transdermal administration,
for example.
[0085] Interfering RNA may be delivered directly to the eye by
ocular tissue injection such as periocular, conjunctival, subtenon,
intracameral, intravitreal, intraocular, subretinal,
subconjunctival, retrobulbar, or intracanalicular injections; by
direct application to the eye using a catheter or other placement
device such as a retinal pellet, intraocular insert, suppository or
an implant comprising a porous, non-porous, or gelatinous material;
by topical ocular drops or ointments; or by a slow release device
in the cul-de-sac or implanted adjacent to the sclera
(transscleral) or within the eye. Intracameral injection may be
through the cornea into the anterior chamber to allow the agent to
reach the trabecular meshwork. Intracanalicular injection may be
into the venous collector channels draining Schlemm's canal or into
Schlemm's canal.
[0086] Subject: A subject in need of treatment for ocular
hypertension or at risk for developing ocular hypertension is a
human or other mammal having ocular hypertension or at risk of
having ocular hypertension associated with undesired or
inappropriate expression or activity of targets as cited herein,
i.e., ROCK1 or ROCK2. Ocular structures associated with such
disorders may include the eye, retina, choroid, lens, cornea,
trabecular meshwork, iris, optic nerve, optic nerve head, sclera,
anterior or posterior segments, or ciliary body, for example. A
subject may also be an ocular cell, cell culture, organ or an ex
vivo organ or tissue.
[0087] Formulations and Dosage: Pharmaceutical formulations
comprise interfering RNAs, or salts thereof, of the invention up to
99% by weight mixed with a physiologically acceptable carrier
medium such as water, buffer, saline, glycine, hyaluronic acid,
mannitol, and the like.
[0088] Interfering RNAs of the present invention are administered
as solutions, suspensions, or emulsions. The following are examples
of possible formulations embodied by this invention.
TABLE-US-00008 Amount in weight % Interfering RNA up to 99; 0.1-99;
0.1-50; 0.5-10.0 Hydroxypropylmethylcellulose 0.5 Sodium chloride
0.8 Benzalkonium Chloride 0.01 EDTA 0.01 NaOH/HCl qs pH 7.4
Purified water (RNase-free) qs 100 mL Interfering RNA up to 99;
0.1-99; 0.1-50; 0.5-10.0 Phosphate Buffered Saline 1.0 Benzalkonium
Chloride 0.01 Polysorbate 80 0.5 Purified water (RNase-free) q.s.
to 100% Interfering RNA up to 99; 0.1-99; 0.1-50; 0.5-10.0
Monobasic sodium phosphate 0.05 Dibasic sodium phosphate 0.15
(anhydrous) Sodium chloride 0.75 Disodium EDTA 0.05 Cremophor EL
0.1 Benzalkonium chloride 0.01 HCl and/or NaOH pH 7.3-7.4 Purified
water (RNase-free) q.s. to 100% Interfering RNA up to 99; 0.1-99;
0.1-50; 0.5-10.0 Phosphate Buffered Saline 1.0
Hydroxypropyl-.beta.-cyclodextrin 4.0 Purified water (RNase-free)
q.s. to 100%
[0089] Generally, an effective amount of the interfering RNAs of
embodiments of the invention results in an extracellular
concentration at the surface of the target cell of from 100 .mu.M
to 1 .mu.M, or from 1 nM to 100 nM, or from 5 nM to about 50 nM, or
to about 25 nM. The dose required to achieve this local
concentration will vary depending on a number of factors including
the delivery method, the site of delivery, the number of cell
layers between the delivery site and the target cell or tissue,
whether delivery is local or systemic, etc. The concentration at
the delivery site may be considerably higher than it is at the
surface of the target cell or tissue. Topical compositions are
delivered to the surface of the target organ one to four times per
day, or on an extended delivery schedule such as daily, weekly,
bi-weekly, monthly, or longer, according to the routine discretion
of a skilled clinician. The pH of the formulation is about pH 4-9,
or pH 4.5 to pH 7.4.
[0090] Therapeutic treatment of patients with interfering RNAs
directed against ROCK1 or ROCK2 mRNA is expected to be beneficial
over small molecule treatments by increasing the duration of
action, thereby allowing less frequent dosing and greater patient
compliance.
[0091] An effective amount of a formulation may depend on factors
such as the age, race, and sex of the subject, the severity of the
ocular hypertension, the rate of target gene transcript/protein
turnover, the interfering RNA potency, and the interfering RNA
stability, for example. In one embodiment, the interfering RNA is
delivered topically to a target organ and reaches the ROCK1 or
ROCK2 mRNA-containing tissue such as the trabecular meshwork,
retina or optic nerve head at a therapeutic dose thereby
ameliorating an ocular hypertension-associated disease process.
[0092] Acceptable carriers: An acceptable carrier refers to those
carriers that cause at most, little to no ocular irritation,
provide suitable preservation if needed, and deliver one or more
interfering RNAs of the present invention in a homogenous dosage.
An acceptable carrier for administration of interfering RNA of
embodiments of the present invention include the cationic
lipid-based transfection reagents TransIT.RTM.-TKO (Mirus
Corporation, Madison, Wis.), LIPOFECTIN.RTM., Lipofectamine,
OLIGOFECTAMINE.TM. (Invitrogen, Carlsbad, Calif.), or
DHARMAFECT.TM. (Dharmacon, Lafayette, Colo.); polycations such as
polyethyleneimine; cationic peptides such as Tat, polyarginine, or
Penetratin (Antp peptide); or liposomes. Liposomes are formed from
standard vesicle-forming lipids and a sterol, such as cholesterol,
and may include a targeting molecule such as a monoclonal antibody
having binding affinity for endothelial cell surface antigens, for
example. Further, the liposomes may be PEGylated liposomes.
[0093] The interfering RNAs may be delivered in solution, in
suspension, or in bioerodible or non-bioerodible delivery devices.
The interfering RNAs can be delivered alone or as components of
defined, covalent conjugates. The interfering RNAs can also be
complexed with cationic lipids, cationic peptides, or cationic
polymers; complexed with proteins, fusion proteins, or protein
domains with nucleic acid binding properties (e.g., protamine); or
encapsulated in nanoparticles or liposomes. Tissue- or
cell-specific delivery can be accomplished by the inclusion of an
appropriate targeting moiety such as an antibody or antibody
fragment.
[0094] For ophthalmic delivery, an interfering RNA may be combined
with ophthalmologically acceptable preservatives, co-solvents,
surfactants, viscosity enhancers, penetration enhancers, buffers,
sodium chloride, or water to form an aqueous, sterile ophthalmic
suspension or solution. Solution formulations may be prepared by
dissolving the interfering RNA in a physiologically acceptable
isotonic aqueous buffer. Further, the solution may include an
acceptable surfactant to assist in dissolving the inhibitor.
Viscosity building agents, such as hydroxymethyl cellulose,
hydroxyethyl cellulose, methylcellulose, polyvinylpyrrolidone, or
the like may be added to the compositions of the present invention
to improve the retention of the compound.
[0095] In order to prepare a sterile ophthalmic ointment
formulation, the interfering RNA is combined with a preservative in
an appropriate vehicle, such as mineral oil, liquid lanolin, or
white petrolatum. Sterile ophthalmic gel formulations may be
prepared by suspending the interfering RNA in a hydrophilic base
prepared from the combination of, for example, CARBOPOL.RTM.-940
(BF Goodrich, Charlotte, N.C.), or the like, according to methods
known in the art. VISCOAT.RTM. (Alcon Laboratories, Inc., Fort
Worth, Tex.) may be used for intraocular injection, for example.
Other compositions of the present invention may contain penetration
enhancing agents such as cremephor and TWEEN.RTM. 80
(polyoxyethylene sorbitan monolaureate, Sigma Aldrich, St. Louis,
Mo.), in the event the interfering RNA is less penetrating in the
eye.
[0096] Kits: Embodiments of the present invention provide a kit
that includes reagents for attenuating the expression of an mRNA as
cited herein in a cell. The kit contains an siRNA or an shRNA
expression vector. For siRNAs and non-viral shRNA expression
vectors the kit also contains a transfection reagent or other
suitable delivery vehicle. For viral shRNA expression vectors, the
kit may contain the viral vector and/or the necessary components
for viral vector production (e.g., a packaging cell line as well as
a vector comprising the viral vector template and additional helper
vectors for packaging). The kit may also contain positive and
negative control siRNAs or shRNA expression vectors (e.g., a
non-targeting control siRNA or an siRNA that targets an unrelated
mRNA). The kit also may contain reagents for assessing knockdown of
the intended target gene (e.g., primers and probes for quantitative
PCR to detect the target mRNA and/or antibodies against the
corresponding protein for western blots). Alternatively, the kit
may comprise an siRNA sequence or an shRNA sequence and the
instructions and materials necessary to generate the siRNA by in
vitro transcription or to construct an shRNA expression vector.
[0097] A pharmaceutical combination in kit form is further provided
that includes, in packaged combination, a carrier means adapted to
receive a container means in close confinement therewith and a
first container means including an interfering RNA composition and
an acceptable carrier. Such kits can further include, if desired,
one or more of various conventional pharmaceutical kit components,
such as, for example, containers with one or more pharmaceutically
acceptable carriers, additional containers, etc., as will be
readily apparent to those skilled in the art. Printed instructions,
either as inserts or as labels, indicating quantities of the
components to be administered, guidelines for administration,
and/or guidelines for mixing the components, can also be included
in the kit.
[0098] The ability of interfering RNA to knock-down the levels of
endogenous target gene expression in, for example, human trabecular
meshwork (TM) cells is evaluated in vitro as follows. Transformed
human TM cells, for example, cell lines designated GTM-3 or HTM-3
(see Pang, I. H. et al., 1994. Curr. Eye Res. 13:51-63), are plated
24 h prior to transfection in standard growth medium (e.g., DMEM
supplemented with 10% fetal bovine serum). Transfection is
performed using Dharmafect 1 (Dharmacon, Lafayette, Colo.)
according to the manufacturer's instructions at interfering RNA
concentrations ranging from 0.1 nM-100 nM. SiCONTROL.TM.
Non-Targeting siRNA #1 and siCONTROLT.TM. Cyclophilin B siRNA
(Dharmacon) are used as negative and positive controls,
respectively. Target mRNA levels and cyclophilin B mRNA (PPIB,
NM.sub.--000942) levels are assessed by qPCR 24 h post-transfection
using, for example, TAQMAN.RTM. forward and reverse primers and a
probe set that preferably encompasses the target site (Applied
Biosystems, Foster City, Calif.). The positive control siRNA gives
essentially complete knockdown of cyclophilin B mRNA when
transfection efficiency is 100%. Therefore, target mRNA knockdown
is corrected for transfection efficiency by reference to the
cyclophilin B mRNA level in TM cells transfected with the
cyclophilin B siRNA. Target protein levels may be assessed
approximately 72 h post-transfection (actual time dependent on
protein turnover rate) by western blot, for example. Standard
techniques for RNA and/or protein isolation from cultured cells are
well-known to those skilled in the art. To reduce the chance of
non-specific, off-target effects, the lowest possible concentration
of interfering RNA is used that produces the desired level of
knock-down in target gene expression.
[0099] The ability of interfering RNAs of the present invention to
knock-down levels of Rho kinase protein expression is further
exemplified in Examples 1 and 2 as follows.
Example 1
Interfering RNA for Specifically Silencing ROCK1 in Trabecular
Meshwork Cells
[0100] The present study examines the ability of ROCK1-interfering
RNA to knock down the levels of endogenous ROCK1 expression in
cultured human glaucomatous trabecular meshwork (TM) cells.
[0101] Transfection of GTM-3 cells (Pang, I. H., et al., 1994 Curr
Eye Res. 13:51-63) was accomplished using standard in vitro
concentrations (100 nM) of ROCK1 or ROCK2 siRNAs, or a
non-targeting control siRNA and DHARMAFECT.RTM. #1 transfection
reagent (Dharmacon, Chicago, Ill.). All siRNAs were dissolved in
1.times. siRNA buffer, an aqueous solution of 20 mM KCl, 6 mM HEPES
(pH 7.5), 0.2 mM MgCl.sub.2. ROCK1 protein expression was evaluated
by western blot analysis 72 hours post-transfection. The ROCK1
siRNAs are double-stranded interfering RNAs having specificity for
the following targets: siROCK1#1 targets SEQ ID NO:23; siROCK1#2
targets SEQ ID NO:29; siROCK1#3 targets SEQ ID NO:10; siROCK1#4
targets SEQ ID NO:9. The siROCK2 sequences are set forth in Example
2, infra. At 100 nM, each of the four ROCK1 siRNAs decreased ROCK1
expression relative to a non-targeting control siRNA as shown by
the western blot data of FIG. 1. SiROCK1#2 targeting SEQ ID NO:29
and siROCK1#3 targeting SEQ ID NO:10 appeared to be particularly
effective. The ROCK2 siRNAs had little, if any, effect on ROCK1
expression, confirming the specificity of ROCK2 siRNAs for the
ROCK2 target.
[0102] A further study was carried out using the siRNAs at lower
concentrations. GTM-3 cells were transfected with the ROCK1 or
non-targeting control siRNAs at 10 nM, 1 nM, and 0.1 nM, and target
gene expression was evaluated by western blot analysis 72 hours
post-transfection. Control samples included a buffer control in
which the volume of siRNA was replaced with an equal volume of
1.times.siRNA buffer (-siRNA). As shown by the data of FIG. 2, each
of the four ROCK1 siRNAs reduced ROCK1 protein expression
significantly at 10 nM and 1 nM, however, siROCK1#2 also silenced
ROCK1 protein expression relatively effectively at 0.1 nM.
Example 2
Interfering RNA for Specifically Silencing ROCK2 in Trabecular
Meshwork Cells
[0103] The present study examines the ability of ROCK2-interfering
RNA to knock down the levels of endogenous ROCK2 expression in
cultured human glaucomatous trabecular meshwork (TM) cells.
[0104] Transfection of GTM-3 cells (Pang, I. H., et al., 1994 Curr
Eye Res. 13:51-63) was accomplished using standard in vitro
concentrations (100 nM) of ROCK1 or ROCK2 siRNA, or a non-targeting
control siRNA and DHARMAFECT.RTM. #1 transfection reagent
(Dharmacon, Chicago, Ill.). ROCK2 protein expression was evaluated
by western blot analysis 72 hours post-transfection. The ROCK2
siRNAs are double-stranded interfering RNAs having specificity for
the following targets: siROCK2#1 targets SEQ ID NO:33; siROCK2#2
targets SEQ ID NO:38; siROCK2#3 targets SEQ ID NO:34; siROCK2#4
targets SEQ ID NO:39. At 100 nM, each of the four ROCK2 siRNAs
decreased ROCK2 expression relative to a non-targeting control
siRNA and relative to a pool of ROCK1-specific siRNAs as shown by
the western blot data of FIG. 3. The ROCK1 siRNA pool had little,
if any, effect on ROCK2 expression, confirming the specificity of
ROCK1 siRNAs for the ROCK1 target.
[0105] A further study was carried out using the siRNAs at lower
concentrations. GTM-3 cells were transfected with the ROCK2 or
non-targeting control siRNAs at 10 nM, 1 nM, and 0.1 nM, and target
gene expression was evaluated by western blot analysis 72 hours
post-transfection. Control samples included a buffer control in
which the volume of siRNA was replaced with an equal volume of
1.times.siRNA buffer (-siRNA). As shown by the data of FIG. 4, each
of the four siRNAs reduced ROCK2 protein expression significantly
at 10 and 1 nM, with siROCK2#3 exhibiting slightly greater efficacy
than the others.
[0106] The references cited herein, to the extent that they provide
exemplary procedural or other details supplementary to those set
forth herein, are specifically incorporated by reference.
[0107] Those of skill in the art, in light of the present
disclosure, will appreciate that obvious modifications of the
embodiments disclosed herein can be made without departing from the
spirit and scope of the invention. All of the embodiments disclosed
herein can be made and executed without undue experimentation in
light of the present disclosure. The full scope of the invention is
set out in the disclosure and equivalent embodiments thereof. The
specification should not be construed to unduly narrow the full
scope of protection to which the present invention is entitled.
[0108] As used herein and unless otherwise indicated, the terms "a"
and "an" are taken to mean "one", "at least one" or "one or more".
Sequence CWU 1
1
8414065DNAHomo sapiens 1atgtcgactg gggacagttt tgagactcga tttgaaaaaa
tggacaacct gctgcgggat 60cccaaatcgg aagtgaattc ggattgtttg ctggatggat
tggatgcttt ggtatatgat 120ttggattttc ctgccttaag aaaaaacaaa
aatattgaca actttttaag cagatataaa 180gacacaataa ataaaatcag
agatttacga atgaaagctg aagattatga agtagtgaag 240gtgattggta
gaggtgcatt tggagaagtt caattggtaa ggcataaatc caccaggaag
300gtatatgcta tgaagcttct cagcaaattt gaaatgataa agagatctga
ttctgctttt 360ttctgggaag aaagggacat catggctttt gccaacagtc
cttgggttgt tcagcttttt 420tatgcattcc aagatgatcg ttatctctac
atggtgatgg aatacatgcc tggtggagat 480cttgtaaact taatgagcaa
ctatgatgtg cctgaaaaat gggcacgatt ctatactgca 540gaagtagttc
ttgcattgga tgcaatccat tccatgggtt ttattcacag agatgtgaag
600cctgataaca tgctgctgga taaatctgga catttgaagt tagcagattt
tggtacttgt 660atgaagatga ataaggaagg catggtacga tgtgatacag
cggttggaac acctgattat 720atttcccctg aagtattaaa atcccaaggt
ggtgatggtt attatggaag agaatgtgac 780tggtggtcgg ttggggtatt
tttatacgaa atgcttgtag gtgatacacc tttttatgca 840gattctttgg
ttggaactta cagtaaaatt atgaaccata aaaattcact tacctttcct
900gatgataatg acatatcaaa agaagcaaaa aaccttattt gtgccttcct
tactgacagg 960gaagtgaggt tagggcgaaa tggtgtagaa gaaatcaaac
gacatctctt cttcaaaaat 1020gaccagtggg cttgggaaac gctccgagac
actgtagcac cagttgtacc cgatttaagt 1080agtgacattg atactagtaa
ttttgatgac ttggaagaag ataaaggaga ggaagaaaca 1140ttccctattc
ctaaagcttt cgttggcaat caactacctt ttgtaggatt tacatattat
1200agcaatcgta gatacttatc ttcagcaaat cctaatgata acagaactag
ctccaatgca 1260gataaaagct tgcaggaaag tttgcaaaaa acaatctata
agctggaaga acagctgcat 1320aatgaaatgc agttaaaaga tgaaatggag
cagaagtgca gaacctcaaa cataaaacta 1380gacaagataa tgaaagaatt
ggatgaagag ggaaatcaaa gaagaaatct agaatctaca 1440gtgtctcaga
ttgagaagga gaaaatgttg ctacagcata gaattaatga gtaccaaaga
1500aaagctgaac aggaaaatga gaagagaaga aatgtagaaa atgaagtttc
tacattaaag 1560gatcagttgg aagacttaaa gaaagtcagt cagaattcac
agcttgctaa tgagaagctg 1620tcccagttac aaaagcagct agaagaagcc
aatgacttac ttaggacaga atcggacaca 1680gctgtaagat tgaggaagag
tcacacagag atgagcaagt caattagtca gttagagtcc 1740ctgaacagag
agttgcaaga gagaaatcga attttagaga attctaagtc acaaacagac
1800aaagattatt accagctgca agctatatta gaagctgaac gaagagacag
aggtcatgat 1860tctgagatga ttggagacct tcaagctcga attacatctt
tacaagagga ggtgaagcat 1920ctcaaacata atctcgaaaa agtggaagga
gaaagaaaag aggctcaaga catgcttaat 1980cactcagaaa aggaaaagaa
taatttagag atagatttaa actacaaact taaatcatta 2040caacaacggt
tagaacaaga ggtaaatgaa cacaaagtaa ccaaagctcg tttaactgac
2100aaacatcaat ctattgaaga ggcaaagtct gtggcaatgt gtgagatgga
aaaaaagctg 2160aaagaagaaa gagaagctcg agagaaggct gaaaatcggg
ttgttcagat tgagaaacag 2220tgttccatgc tagacgttga tctgaagcaa
tctcagcaga aactagaaca tttgactgga 2280aataaagaaa ggatggagga
tgaagttaag aatctaaccc tgcaactgga gcaggaatca 2340aataagcggc
tgttgttaca aaatgaattg aagactcaag catttgaggc agacaattta
2400aaaggtttag aaaagcagat gaaacaggaa ataaatactt tattggaagc
aaagagatta 2460ttagaatttg agttagctca gcttacgaaa cagtatagag
gaaatgaagg acagatgcgg 2520gagctacaag atcagcttga agctgagcaa
tatttctcga cactttataa aacccaggta 2580aaggaactta aagaagaaat
tgaagaaaaa aacagagaaa atttaaagaa aatacaggaa 2640ctacaaaatg
aaaaagaaac tcttgctact cagttggatc tagcagaaac aaaagctgag
2700tctgagcagt tggcgcgagg ccttctggaa gaacagtatt ttgaattgac
gcaagaaagc 2760aagaaagctg cttcaagaaa tagacaagag attacagata
aagatcacac tgttagtcgg 2820cttgaagaag caaacagcat gctaaccaaa
gatattgaaa tattaagaag agagaatgaa 2880gagctaacag agaaaatgaa
gaaggcagag gaagaatata aactggagaa ggaggaggag 2940atcagtaatc
ttaaggctgc ctttgaaaag aatatcaaca ctgaacgaac ccttaaaaca
3000caggctgtta acaaattggc agaaataatg aatcgaaaag attttaaaat
tgatagaaag 3060aaagctaata cacaagattt gagaaagaaa gaaaaggaaa
atcgaaagct gcaactggaa 3120ctcaaccaag aaagagagaa attcaaccag
atggtagtga aacatcagaa ggaactgaat 3180gacatgcaag cgcaattggt
agaagaatgt gcacatagga atgagcttca gatgcagttg 3240gccagcaaag
agagtgatat tgagcaattg cgtgctaaac ttttggacct ctcggattct
3300acaagtgttg ctagttttcc tagtgctgat gaaactgatg gtaacctccc
agagtcaaga 3360attgaaggtt ggctttcagt accaaataga ggaaatatca
aacgatatgg ctggaagaaa 3420cagtatgttg tggtaagcag caaaaaaatt
ttgttctata atgacgaaca agataaggag 3480caatccaatc catctatggt
attggacata gataaactgt ttcacgttag acctgtaacc 3540caaggagatg
tgtatagagc tgaaactgaa gaaattccta aaatattcca gatactatat
3600gcaaatgaag gtgaatgtag aaaagatgta gagatggaac cagtacaaca
agctgaaaaa 3660actaatttcc aaaatcacaa aggccatgag tttattccta
cactctacca ctttcctgcc 3720aattgtgatg cctgtgccaa acctctctgg
catgttttta agccaccccc tgccctagag 3780tgtcgaagat gccatgttaa
gtgccacaga gatcacttag ataagaaaga ggacttaatt 3840tgtccatgta
aagtaagtta tgatgtaaca tcagcaagag atatgctgct gttagcatgt
3900tctcaggatg aacaaaaaaa atgggtaact catttagtaa agaaaatccc
taagaatcca 3960ccatctggtt ttgttcgtgc ttcccctcga acgctttcta
caagatccac tgcaaatcag 4020tctttccgga aagtggtcaa aaatacatct
ggaaaaacta gttaa 406526401DNAHomo sapiens 2caaggcggcc ggcggcgacc
atggcagcgg gccggcggcg gccgtagtgg cccaggcctg 60ggcttcagcc tcccggggcc
ccagagggcg gggcggtccg ggccgcggcg gtggcggcgc 120cacttccctg
ctcccgcccg aggactcctg cgggcactcg ctgaggacca gcggaccggc
180ggcgcgaatc tgactgaggg gcggggacgc cgtctgttcc ccgccgctcc
cggcagggcc 240gggccgggct gggccgggct gggccgggcg ggcccctggg
agcagccccc aggcggggga 300ccgccttgga gacccgaagc cggagctaga
ggcaggcggt gggcccgggt ggagtcccgg 360ccggagctgg tggttcgggg
gcggtgctag gccccgaggc tgcgggacct gagcgcgagg 420agcctgagtg
cgggtccagc ggtggcggca tgagccggcc cccgccgacg gggaaaatgc
480ccggcgcccc cgagaccgcg ccgggggacg gggcaggcgc gagccgccag
aggaagctgg 540aggcgctgat ccgagaccct cgctccccca tcaacgtgga
gagcttgctg gatggcttaa 600attccttggt ccttgattta gattttcctg
ctttgaggaa aaacaagaac atagataatt 660tcttaaatag atatgagaaa
attgtgaaaa aaatcagagg tctacagatg aaggcagaag 720actatgatgt
tgtaaaagtt attggaagag gtgcttttgg tgaagtgcag ttggttcgtc
780acaaggcatc gcagaaggtt tatgctatga agcttcttag taagtttgaa
atgataaaaa 840gatcagattc tgcctttttt tgggaagaaa gagatattat
ggcctttgcc aatagcccct 900gggtggttca gcttttttat gcctttcaag
atgataggta tctgtacatg gtaatggagt 960acatgcctgg tggagacctt
gtaaacctta tgagtaatta tgatgtgcct gaaaaatggg 1020ccaaatttta
cactgctgaa gttgttcttg ctctggatgc aatacactcc atgggtttaa
1080tacacagaga tgtgaagcct gacaacatgc tcttggataa acatggacat
ctaaaattag 1140cagattttgg cacgtgtatg aagatggatg aaacaggcat
ggtacattgt gatacagcag 1200ttggaacacc ggattatata tcacctgagg
ttctgaaatc acaagggggt gatggtttct 1260atgggcgaga atgtgattgg
tggtctgtag gtgttttcct ttatgagatg ctagtggggg 1320atactccatt
ttatgcggat tcacttgtag gaacatatag caaaattatg gatcataaga
1380attcactgtg tttccctgaa gatgcagaaa tttccaaaca tgcaaagaat
ctcatctgtg 1440ctttcttaac agatagggag gtacgacttg ggagaaatgg
ggtggaagaa atcagacagc 1500atcctttctt taagaatgat cagtggcatt
gggataacat aagagaaacg gcagctcctg 1560tagtacctga actcagcagt
gacatagaca gcagcaattt cgatgacatt gaagatgaca 1620aaggagatgt
agaaaccttc ccaattccta aagcttttgt tggaaatcag ctgcctttca
1680tcggatttac ctactataga gaaaatttat tattaagtga ctctccatct
tgtagagaaa 1740ctgattccat acaatcaagg aaaaatgaag aaagtcaaga
gattcagaaa aaactgtata 1800cattagaaga acatcttagc aatgagatgc
aagccaaaga ggaactggaa cagaagtgca 1860aatctgttaa tactcgccta
gaaaaaacag caaaggagct agaagaggag attaccttac 1920ggaaaagtgt
ggaatcagca ttaagacagt tagaaagaga aaaggcgctt cttcagcaca
1980aaaatgcaga atatcagagg aaagctgatc atgaagcaga caaaaaacga
aatttggaaa 2040atgatgttaa cagcttaaaa gatcaacttg aagatttgaa
aaaaagaaat caaaactctc 2100aaatatccac tgagaaagtg aatcaactcc
agagacaact ggatgaaacc aatgctttac 2160tgcgaacaga gtctgatact
gcagcccggt taaggaaaac ccaggcagaa agttcaaaac 2220agattcagca
gctggaatct aacaatagag atctacaaga taaaaactgc ctgctggaga
2280ctgccaagtt aaaacttgaa aaggaattta tcaatcttca gtcagctcta
gaatctgaaa 2340ggagggatcg aacccatgga tcagagataa ttaatgattt
acaaggtaga atatgtggcc 2400tagaagaaga tttaaagaac ggcaaaatct
tactagcgaa agtagaactg gagaagagac 2460aacttcagga gagatttact
gatttggaaa aggaaaaaag caacatggaa atagatatga 2520cataccaact
aaaagttata cagcagagcc tagaacaaga agaagctgaa cataaggcca
2580caaaggcacg actagcagat aaaaataaga tctatgagtc catcgaagaa
gccaaatcag 2640aagccatgaa agaaatggag aagaagctct tggaggaaag
aactttaaaa cagaaagtgg 2700agaacctatt gctagaagct gagaaaagat
gttctctatt agactgtgac ctcaaacagt 2760cacagcagaa aataaatgag
ctccttaaac agaaagatgt gctaaatgag gatgttagaa 2820acctgacatt
aaaaatagag caagaaactc agaagcgctg ccttacacaa aatgacctga
2880agatgcaaac acaacaggtt aacacactaa aaatgtcaga aaagcagtta
aagcaagaaa 2940ataaccatct catggaaatg aaaatgaact tggaaaaaca
aaatgctgaa cttcgaaaag 3000aacgtcagga tgcagatggg caaatgaaag
agctccagga tcagctcgaa gcagaacagt 3060atttctcaac cctttataaa
acacaagtta gggagcttaa agaagaatgt gaagaaaaga 3120ccaaacttgg
taaagaattg cagcagaaga aacaggaatt acaggatgaa cgggactctt
3180tggctgccca actggagatc accttgacca aagcagattc tgagcaactg
gctcgttcaa 3240ttgctgaaga acaatattct gatttggaaa aagagaagat
catgaaagag ctggagatca 3300aagagatgat ggctagacac aaacaggaac
ttacggaaaa agatgctaca attgcttctc 3360ttgaggaaac taataggaca
ctaactagtg atgttgccaa tcttgcaaat gagaaagaag 3420aattaaataa
caaattgaaa gatgttcaag agcaactgtc aagattgaaa gatgaagaaa
3480taagcgcagc agctattaaa gcacagtttg agaagcagct attaacagaa
agaacactca 3540aaactcaagc tgtgaataag ttggctgaga tcatgaatcg
aaaagaacct gtcaagcgtg 3600gtaatgacac agatgtgcgg agaaaagaga
aggagaatag aaagctacat atggagctta 3660aatctgaacg tgagaaattg
acccagcaga tgatcaagta tcagaaagaa ctgaatgaaa 3720tgcaggcaca
aatagctgaa gagagccaga ttcgaattga actgcagatg acattggaca
3780gtaaagacag tgacattgag cagctgcggt cacaactcca agccttgcat
attggtctgg 3840atagttccag tataggcagt ggaccagggg atgctgaggc
agatgatggg tttccagaat 3900caagattaga aggatggctt tcattgcctg
tacgaaacaa cactaagaaa tttggatggg 3960ttaaaaagta tgtgattgta
agcagtaaga agattctttt ctatgacagt gaacaagata 4020aagaacaatc
caatccttac atggttttag atatagacaa gttatttcat gtccgaccag
4080ttacacagac agatgtgtat agagcagatg ctaaagaaat tccaaggata
ttccagattc 4140tgtatgccaa tgaaggagaa agtaagaagg aacaagaatt
tccagtggag ccagttggag 4200aaaaatctaa ttatatttgc cacaagggac
atgagtttat tcctactctt tatcatttcc 4260caaccaactg tgaggcttgt
atgaagcccc tgtggcacat gtttaagcct cctcctgctt 4320tggagtgccg
ccgttgccat attaagtgtc ataaagatca tatggacaaa aaggaggaga
4380ttatagcacc ttgcaaagta tattatgata tttcaacggc aaagaatctg
ttattactag 4440caaattctac agaagagcag cagaagtggg ttagtcggtt
ggtgaaaaag atacctaaaa 4500agcccccagc tccagaccct tttgcccgat
catctcctag aacttcaatg aagatacagc 4560aaaaccagtc tattagacgg
ccaagtcgac agcttgcccc aaacaaacct agctaactgc 4620cttctatgaa
agcagtcatt attcaaggtg atcgtattct tccagtgaaa acaagactga
4680aatatgatgg cccaaaattt attaaaaagc tatattttcc tgagagactg
atacatacac 4740tcatacatat atgtgttccc cttttccctg taatataaat
tacaaatctg ggctcctttg 4800aagcaacagg ttgaaccaac aatgattggt
tgatagacta aggatatatg caactcttcc 4860agacttttcc ataaagctct
ctcggcagtc gctcacacta caatgcacac aaggattgag 4920aagagttaaa
ggctaaagaa aacatctttt ctagcttcaa cagagaggtt tcaccagcac
4980atttaccaga agaatctggg aatggattcc actacagtga tattgactgc
atctttaaga 5040agtgaccatt atactgtgta tatatatata aacacacaca
catatatata tatatatata 5100gtactctaat actgcaagaa ggttttttaa
acttcccact ttatttttta tacacattaa 5160tcagatatca ttacttgctg
cagttgcaac tatgcacttg tataaagcca taatgttgga 5220gtttatatca
ctcattcctg tgtacctgat ggaagttgca tgttcatgtt taagcagtta
5280ctgtaacaag aagtttaaag ttaattatat cagtttccta atgcttcatg
ataggcaact 5340ttacccattt tgaatgcctt aatttaattt ttttcaaagt
ctcagccctg tctgtattaa 5400aaaacaaaaa aagcgtttac cagctcttag
gatgtaaact agctttgtgg aagataaatc 5460gtgcactatt tttacacata
aatagttata tcaatgtcag cctattttga ttaacaaatg 5520tttttaaagt
attattggtt atagaaacaa taatggatgg tgttggaact aatatatcct
5580tgatgtctgt ctattattca ttcaactctt tttacagacc tcagtattag
tctgtgacta 5640caaaatattt tatttgcttt aaatttgctg gctaccctag
atgtgttttt attcctggta 5700aagacatttg tgattacatt ttcacactta
agattcaaaa tttttcccaa atataaagaa 5760aactaagaca gactgtagat
gcattttaaa tatttaaata tgatcctcag acatgcagct 5820gtgtgtggca
gtattttagt accgggttaa gaaaactggc aactgggaag aagtggcctc
5880aaaggcactt aatttgattt ttatttttta aatgctgtca aagttacagt
ttacgcagga 5940cattcttgcc gtattctcat gatcccagat aagtgtgtgt
tttatactgc aacaatatgc 6000agcaatggta agcgtaaagt tttttttttg
tttttgtttt tttttatatt atgaagtctt 6060ttaacagtct ctctttatat
aaatacacag agtttggtat gatatttaaa tacatcatct 6120ggccaggcat
ggtggcttac gcctgtaatc ctagcacttt gggaggccaa gacgggcgga
6180tcacctgagg tgaggagttc aagaccagcc tgcccaacat agtgaaactc
cgtctctacc 6240aatatacaaa aattagccgg gcatgatggt ggtggcctgt
aatcccagct acttgggagg 6300ctgagacagg agaatcgctt gaacccagga
gacggtggtt gcagtgagcg aagatcgagc 6360cactgcactc cagcctgggc
agctgaacaa gactccgtct c 6401319DNAArtificialTarget Sequence
3ataacatgct gctggataa 19421DNAArtificialSense strand with 3'NN
4auaacaugcu gcuggauaan n 21521DNAArtificialAntisense strand with
3'NN 5uuauccagca gcauguuaun n 21621RNAArtificialSense Strand
6auaacaugcu gcuggauaau u 21721RNAArtificialAntisense Strand
7uuauccagca gcauguuauu u 21848DNAArtificialHairpin duplex with loop
8auaacaugcu gcuggauaan nnnnnnnuua uccagcagca uguuauuu
48919DNAArtificialTarget Sequence 9gtacttgtat gaagatgaa
191019DNAArtificialTarget Sequence 10gtatgaagat gaataagga
191119DNAArtificialTarget Sequence 11tagctccaat gcagataaa
191219DNAArtificialTarget Sequence 12atcagttgga agacttaaa
191319DNAArtificialTarget Sequence 13gaccttcaag ctcgaatta
191419DNAArtificialTarget Sequence 14gaacatttga ctggaaata
191519DNAArtificialTarget Sequence 15tagctcagct tacgaaaca
191619DNAArtificialTarget Sequence 16acgaaacagt atagaggaa
191719DNAArtificialTarget Sequence 17tttgaattga cgcaagaaa
191819DNAArtificialTarget Sequence 18cactgttagt cggcttgaa
191919DNAArtificialTarget Sequence 19acagcatgct aaccaaaga
192019DNAArtificialTarget Sequence 20gttaacaaat tggcagaaa
192119DNAArtificialTarget Sequence 21accagatggt agtgaaaca
192219DNAArtificialTarget Sequence 22gtagaagaat gtgcacata
192319DNAArtificialTarget Sequence 23gcaaagagag tgatattga
192419DNAArtificialTarget Sequence 24gtaccaaata gaggaaata
192519DNAArtificialTarget Sequence 25gttctataat gacgaacaa
192619DNAArtificialTarget Sequence 26gataaactgt ttcacgtta
192719DNAArtificialTarget Sequence 27taaactgttt cacgttaga
192819DNAArtificialTarget Sequence 28gtttcacgtt agacctgta
192919DNAArtificialTarget Sequence 29tgtcgaagat gccatgtta
193019DNAArtificialTarget Sequence 30gtcgaagatg ccatgttaa
193119DNAArtificialTarget Sequence 31acaacatgct cttggataa
193219DNAArtificialTarget Sequence 32tgttaatact cgcctagaa
193319DNAArtificialTarget Sequence 33gaaagctgat catgaagca
193419DNAArtificialTarget Sequence 34cagctggaat ctaacaata
193519DNAArtificialTarget Sequence 35gatatgacat accaactaa
193619DNAArtificialTarget Sequence 36aggcacgact agcagataa
193719DNAArtificialTarget Sequence 37attagactgt gacctcaaa
193819DNAArtificialTarget Sequence 38gatgatggct agacacaaa
193919DNAArtificialTarget Sequence 39ctaaagaaat tccaaggat
194019DNAArtificialTarget Sequence 40tcgtattctt ccagtgaaa
194119DNAArtificialTarget Sequence 41ttgcaactat gcacttgta
194219DNAArtificialTarget Sequence 42caactatgca cttgtataa
194319DNAArtificialTarget Sequence 43gttgcatgtt catgtttaa
194419DNAArtificialTarget Sequence 44ttcctaatgc ttcatgata
194519DNAArtificialTarget Sequence 45ctagctttgt ggaagataa
194619DNAArtificialTarget Sequence 46gaagataaat cgtgcacta
194719DNAArtificialTarget Sequence 47ccttgatgtc tgtctatta
194819DNAArtificialTarget Sequence 48cttgatgtct gtctattat
194919DNAArtificialTarget Sequence 49tttacagacc tcagtatta
195019DNAArtificialTarget Sequence 50tattagtctg tgactacaa
195119DNAArtificialTarget Sequence 51taaatatgat cctcagaca
195219DNAArtificialTarget Sequence 52cagcaatggt aagcgtaaa
195319DNAArtificialTarget Sequence
53ctccgtctct accaatata 195419DNAArtificialTarget Sequence
54tgatggtggt ggcctgtaa 195519DNAArtificialTarget Sequence
55cttgctggat ggcttaaat 195619DNAArtificialTarget Sequence
56ggattcactt gtaggaaca 195719DNAArtificialTarget Sequence
57tcatcggatt tacctacta 195819DNAArtificialTarget Sequence
58taaatgagct ccttaaaca 195919DNAArtificialTarget Sequence
59gttagaaacc tgacattaa 196019DNAArtificialTarget Sequence
60ataaccatct catggaaat 196119DNAArtificialTarget Sequence
61tctcttgagg aaactaata 196219DNAArtificialTarget Sequence
62caatcttgca aatgagaaa 196319DNAArtificialTarget Sequence
63taagcgcagc agctattaa 196419DNAArtificialTarget Sequence
64gagaatagaa agctacata 196519DNAArtificialTarget Sequence
65gctacatatg gagcttaaa 196619DNAArtificialTarget Sequence
66ctacatatgg agcttaaat 196719DNAArtificialTarget Sequence
67gatgacattg gacagtaaa 196819DNAArtificialTarget Sequence
68tctggatagt tccagtata 196919DNAArtificialTarget Sequence
69gaacaatcca atccttaca 197019DNAArtificialTarget Sequence
70gtatagagca gatgctaaa 197119DNAArtificialTarget Sequence
71ataaagccat aatgttgga 197219DNAArtificialTarget Sequence
72tagctttgtg gaagataaa 197319DNAArtificialTarget Sequence
73aacgacatct cttcttcaa 197419DNAArtificialTarget Sequence
74gaagaaacat tccctattc 197519DNAArtificialTarget Sequence
75tagcaatcgt agatactta 197619DNAArtificialTarget Sequence
76gccaatgact tacttagga 197719DNAArtificialTarget Sequence
77ggacacagct gtaagattg 197819DNAArtificialTarget Sequence
78gagatgagca agtcaatta 197919DNAArtificialTarget Sequence
79gtaaccaaag ctcgtttaa 198019RNAArtificialSense Strand 80auaacaugcu
gcuggauaa 198119RNAArtificialAntisense Strand 81uuauccagca
gcauguuau 198225DNAArtificialSense Strand 82ataacatgct gctggataaa
tctgg 258325RNAArtificialSense Strand 83auaacaugcu gcuggauaaa ucugg
258427RNAArtificialAntisense Strand 84ccagauuuau ccagcagcau guuauuu
27
* * * * *