U.S. patent application number 13/306640 was filed with the patent office on 2012-07-05 for rare cell analysis using sample splitting and dna tags.
Invention is credited to Martin Fuchs, Darren Gray, Ravl Kapur, Neil X. Krueger, Daniel Shoemaker, Mehmet Toner, Zihua Wang.
Application Number | 20120171666 13/306640 |
Document ID | / |
Family ID | 39742028 |
Filed Date | 2012-07-05 |
United States Patent
Application |
20120171666 |
Kind Code |
A1 |
Shoemaker; Daniel ; et
al. |
July 5, 2012 |
Rare Cell Analysis Using Sample Splitting And DNA Tags
Abstract
The present invention provides systems, apparatuses, and methods
to detect the presence of fetal cells when mixed with a population
of maternal cells in a sample and to test fetal abnormalities, e.g.
aneuploidy. The present invention involves labeling regions of
genomic DNA in each cell in said mixed sample with different labels
wherein each label is specific to each cell and quantifying the
labeled regions of genomic DNA from each cell in the mixed sample.
More particularly the invention involves quantifying labeled DNA
polymorphisms from each cell in the mixed sample.
Inventors: |
Shoemaker; Daniel; (San
Diego, CA) ; Fuchs; Martin; (Uxbridge, MA) ;
Krueger; Neil X.; (Roslindale, MA) ; Toner;
Mehmet; (Wellesley Hills, MA) ; Gray; Darren;
(Brookline, MA) ; Kapur; Ravl; (Stoughton, MA)
; Wang; Zihua; (Newton, MA) |
Family ID: |
39742028 |
Appl. No.: |
13/306640 |
Filed: |
November 29, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12230628 |
Sep 2, 2008 |
8168389 |
|
|
13306640 |
|
|
|
|
11763421 |
Jun 14, 2007 |
|
|
|
12230628 |
|
|
|
|
60804819 |
Jun 14, 2006 |
|
|
|
60820778 |
Jul 28, 2006 |
|
|
|
Current U.S.
Class: |
435/6.1 |
Current CPC
Class: |
C12Q 2600/16 20130101;
C12Q 1/6869 20130101; C12Q 1/6809 20130101; C12Q 2600/158 20130101;
G01N 2015/1006 20130101; C12Q 2600/156 20130101; Y10T 436/143333
20150115; B01L 3/502761 20130101; C12Q 1/6883 20130101; C12Q 1/6881
20130101; G01N 2015/1087 20130101 |
Class at
Publication: |
435/6.1 |
International
Class: |
G01N 27/62 20060101
G01N027/62 |
Claims
1.-54. (canceled)
55. A method for fetal diagnosis, the method comprising: labeling
one or more genomic DNA regions in fetal and non-fetal cells,
enriched from a maternal blood sample, using labels adapted to
distinguish between individual cells; and determining the presence
or absence of a fetal abnormality by analyzing the labeled genomic
DNA regions by mass spectrometry.
Description
CROSS-REFERENCE
[0001] This application claims the benefit of U.S. Provisional
Application No. 60/804,819, filed Jun. 14, 2006, which application
is incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0002] Analysis of specific cells can give insight into a variety
of diseases. These analyses can provide non-invasive tests for
detection, diagnosis and prognosis of diseases such as cancer or
fetal disorders, thereby eliminating the risk of invasive
diagnosis. Regarding fetal disorders, current prenatal diagnosis,
such as amniocentesis and chorionic villus sampling (CVS), are
potentially harmful to the mother and to the fetus. The rate of
miscarriage for pregnant women undergoing amniocentesis is
increased by 0.5-1%, and that figure is slightly higher for CVS.
Because of the inherent risks posed by amniocentesis and CVS, these
procedures are offered primarily to older women, e.g., those over
35 years of age, who have a statistically greater probability of
bearing children with congenital defects. As a result, a pregnant
woman at the age of 35 has to balance an average risk of 0.5-1% to
induce an abortion by amniocentesis against an age related
probability for trisomy 21 of less than 0.3%.
[0003] Regarding prenatal diagnostics, some non-invasive methods
have already been developed to screen for fetuses at higher risk of
having specific congenital defects. For example, maternal serum
alpha-fetoprotein, and levels of unconjugated estriol and human
chorionic gonadotropin can be used to identify a proportion of
fetuses with Down's syndrome. However, these tests suffer from many
false positive. Similarly, ultrasonography is used to determine
congenital defects involving neural tube defects and limb
abnormalities, but such methods are limited to time periods after
fifteen weeks of gestation and are present unreliable results.
[0004] The presence of fetal cells within the blood of pregnant
women offers the opportunity to develop a prenatal diagnostic that
replaces amniocentesis and thereby eliminates the risk of today's
invasive diagnosis. However, fetal cells represent a small number
of cells against the background of a large number of maternal cells
in the blood which make the analysis time consuming and prone to
error.
[0005] With respect to cancer diagnosis, early detection is of
paramount importance. Cancer is a disease marked by the
uncontrolled proliferation of abnormal cells. In normal tissue,
cells divide and organize within the tissue in response to signals
from surrounding cells. Cancer cells do not respond in the same way
to these signals, causing them to proliferate and, in many organs,
form a tumor. As the growth of a tumor continues, genetic
alterations may accumulate, manifesting as a more aggressive growth
phenotype of the cancer cells. If left untreated, metastasis, the
spread of cancer cells to distant areas of the body by way of the
lymph system or bloodstream, may ensue. Metastasis results in the
formation of secondary tumors at multiple sites, damaging healthy
tissue. Most cancer death is caused by such secondary tumors.
Despite decades of advances in cancer diagnosis and therapy, many
cancers continue to go undetected until late in their development.
As one example, most early-stage lung cancers are asymptomatic and
are not detected in time for curative treatment, resulting in an
overall five-year survival rate for patients with lung cancer of
less than 15%. However, in those instances in which lung cancer is
detected and treated at an early stage, the prognosis is much more
favorable.
[0006] The methods of the present invention allow for the detection
of fetal cells and fetal abnormalities when fetal cells are mixed
with a population of maternal cells, even when the maternal cells
dominate the mixture. In addition, the methods of the present
invention can also be utilized to detect or diagnose cancer.
SUMMARY OF THE INVENTION
[0007] The present invention relates to methods for the detection
of fetal cells or cancer cells in a mixed sample. In one
embodiment, the present invention provides methods for determining
fetal abnormalities in a sample comprising fetal cells that are
mixed with a population of maternal cells. In some embodiments,
determining the presence of fetal cells and fetal abnormalities
comprises labeling one or more regions of genomic DNA in each cell
from a mixed sample comprising at least one fetal cell with
different labels wherein each label is specific to each cell. In
some embodiments, the genomic DNA to be labeled comprises one or
more polymorphisms, particularly STRs or SNPs
[0008] In some embodiments, the methods of the invention allow for
simultaneously detecting the presence of fetal cells and fetal
abnormalities when fetal cells are mixed with a population of
maternal cells, even when the maternal cells dominate the mixture.
In some embodiments, the sample is enriched to contain at least one
fetal and one non fetal cell, and in other embodiments, the cells
of the enriched population can be divided between two or more
discrete locations that can be used as addressable locations.
Examples of addressable locations include wells, bins, sieves,
pores, geometric sites, slides, matrixes, membranes, electric
traps, gaps, obstacles or in-situ within a cell or nuclear
membrane.
[0009] In some embodiments, the methods comprise labeling one or
more regions of genomic DNA in each cell in the enriched sample
with different labels, wherein each label is specific to each cell,
and quantifying the labeled DNA regions. The labeling methods can
comprise adding a unique tag sequence for each cell in the mixed
sample. In some embodiments, the unique tag sequence identifies the
presence or absence of a DNA polymorphism in each cell from the
mixed sample. Labels are added to the cells/DNA using an
amplification reaction, which can be performed by PCR methods. For
example, amplification can be achieved by multiplex PCR. In some
embodiments, a further PCR amplification is performed using nested
primers for the genomic DNA region(s).
[0010] In some embodiments, the DNA regions can be amplified prior
to being quantified. The labeled DNA can be quantified using
sequencing methods, which, in some embodiments, can precede
amplifying the DNA regions. The amplified DNA region(s) can be
analyzed by sequencing methods. For example, ultra deep sequencing
can be used to provide an accurate and quantitative measurement of
the allele abundances for each STR or SNP. In other embodiments,
quantitative genotyping can be used to declare the presence of
fetal cells and to determine the copy numbers of the fetal
chromosomes. Preferably, quantitative genotyping is performed using
molecular inversion probes.
[0011] The invention also relates to methods of identifying cells
from a mixed sample with non-maternal genomic DNA and identifying
said cells with non-maternal genomic DNA as fetal cells. In some
embodiments, the ratio of maternal to paternal alleles is compared
on the identified fetal cells in the mixed sample.
[0012] In one embodiment, the invention provides for a method for
determining a fetal abnormality in a maternal sample that comprises
at least one fetal and one non fetal cell. The sample can be
enriched to contain at least one fetal cell, and the enriched
maternal sample can be arrayed into a plurality of discrete sites.
In some embodiments, each discrete site comprises no more than one
cell.
[0013] In some embodiments, the invention comprises labeling one or
more regions of genomic DNA from the arrayed samples using primers
that are specific to each DNA region or location, amplifying the
DNA region(s), and quantifying the labeled DNA region. The labeling
of the DNA region(s) can comprise labeling each region with a
unique tag sequence, which can be used to identify the presence or
absence of a DNA polymorphism on arrayed cells and the distinct
location of the cells.
[0014] The step of determining can comprise identifying
non-maternal alleles at the distinct locations, which can result
from comparing the ratio of maternal to paternal alleles at the
location. In some embodiments, the method of identifying a fetal
abnormality in an arrayed sample can further comprise amplifying
the genomic DNA regions. The genomic DNA regions can comprise one
or more polymorphisms e.g. STRs and SNPs, which can be amplified
using PCR methods including multiplex PCR. An additional
amplification step can be performed using nested primers.
[0015] The amplified DNA region(s) can be analyzed by sequencing
methods. For example, ultra deep sequencing can be used to provide
an accurate and quantitative measurement of the allele abundances
for each STR or SNP. In other embodiments, quantitative genotyping
can be sued to declare the presence of fetal cells and to determine
the copy numbers of the fetal chromosomes. Preferably, quantitative
genotyping is performed using molecular inversion probes.
[0016] In one embodiment, the invention provides methods for
diagnosing a cancer and giving a prognosis by obtaining and
enriching a blood sample from a patient for epithelial cells,
splitting the enriched sample into discrete locations, and
performing one or more molecular and/or morphological analyses on
the enriched and split sample. The molecular analyses can include
detecting the level of expression or a mutation of gene disclosed
in FIG. 10. Preferably, the method comprises performing molecular
analyses on EGFR, EpCAM, GA733-2, MUC-1, HER-2, or Claudin-7 in
each arrayed cell. The morphological analyses can include
identifying, quantifying and/or characterizing mitochondrial DNA,
telomerase, or nuclear matrix proteins.
[0017] In some embodiments, the sample can be enriched for
epithelial cells by at least 10,000 fold, and the diagnosis and
prognosis can be provided prior to treating the patient for the
cancer. Preferably, the blood samples are obtained from a patient
at regular intervals such as daily, or every 2, 3 or 4 days,
weekly, bimonthly, monthly, bi-yearly or yearly.
[0018] In some embodiments, the step of enriching a patient's blood
sample for epithelial cells involves flowing the sample through a
first array of obstacles that selectively directs cells that are
larger than a predetermined size to a first outlet and cells that
are smaller than a predetermined size to a second outlet.
Optionally, the sample can be subjected to further enrichment by
flowing the sample through a second array of obstacles, which can
be coated with antibodies that selectively bind to white blood
cells or epithelial cells. For example, the obstacles of the second
array can be coated with anti-EpCAM antibodies.
[0019] Splitting the sample of cells of the enriched population can
comprises splitting the enriched sample to locate individual cells
at discrete sites that can be addressable sites. Examples of
addressable locations include wells, bins, sieves, pores, geometric
sites, slides, matrixes, membranes, electric traps, gaps, obstacles
or in-situ within a cell or nuclear membrane.
[0020] In some embodiments there are provided kits comprising
devices for enriching the sample and the devices and reagents
needed to perform the genetic analysis. The kits may contain the
arrays for size-based separation, reagents for uniquely labeling
the cells, devices for splitting the cells into individual
addressable locations and reagents for the genetic analysis.
SUMMARY OF THE DRAWINGS
[0021] FIGS. 1A-1D illustrate various embodiments of a size-based
separation module.
[0022] FIGS. 2A-2C illustrate one embodiment of an affinity
separation module.
[0023] FIG. 3 illustrate one embodiment of a magnetic separation
module.
[0024] FIG. 4 illustrates an overview for diagnosing, prognosing,
or monitoring a prenatal condition in a fetus.
[0025] FIG. 5 illustrates an overview for diagnosing, prognosing,
or monitoring a prenatal condition in a fetus.
[0026] FIG. 6 illustrates an overview for diagnosing, prognosing or
monitoring cancer in a patient.
[0027] FIGS. 7A-7B illustrate an assay using molecular inversion
probes. FIG. 7 C illustrates an overview of the use of nucleic acid
tags.
[0028] FIGS. 8A-8C illustrate one example of a sample splitting
apparatus.
[0029] FIG. 9 illustrates the probability of having 2 or more CTC's
loaded into a single sample well.
[0030] FIG. 10 illustrates genes whose expression or mutations can
be associated with cancer or another condition diagnosed
herein.
[0031] FIG. 11 illustrates primers useful in the methods
herein.
[0032] FIG. 12A-B illustrate cell smears of the product and waste
fractions.
[0033] FIG. 13A-F illustrate isolated fetal cells confirmed by the
reliable presence of male cells.
[0034] FIG. 14 illustrates cells with abnormal trisomy 21
pathology.
[0035] FIG. 15 illustrates performance of a size-based separation
module.
[0036] FIG. 16 illustrates histograms of these cell fractions
resulting from a size-based separation module.
[0037] FIG. 17 illustrates a first output and a second output of a
size-based separation module.
[0038] FIG. 18 illustrates epithelial cells bound to a capture
module of an array of obstacles coated with anti-EpCAM.
[0039] FIGS. 19A-C illustrate one embodiment of a flow-through
size-based separation module adapted to separate epithelial cells
from blood and alternative parameters that can be used with such
device.
[0040] FIG. 20A-D illustrate various targeted subpopulations of
cells that can be isolated using size-based separation and various
cut-off sizes that can be used to separate such targeted
subpopulations.
[0041] FIG. 21 illustrates a device of the invention with counting
means to determine the number of cells in the enriched sample.
[0042] FIG. 22 illustrates an overview of one aspect of the
invention for diagnosing, prognosing, or monitoring cancer in a
patient.
[0043] FIG. 23 illustrates the use of EGFR mRNA for generating
sequencing templates.
[0044] FIG. 24 illustrates performing real-time quantitative
allele-specific PCR reactions to confirm the sequence of mutations
in EGFR mRNA.
[0045] FIG. 25 illustrates confirmation of the presence of a
mutation is when the signal from a mutant allele probe rises above
the background level of fluorescence.
[0046] FIG. 26A-B illustrate the presence of EGFR mRNA in
epithelial cells but not leukocytes.
[0047] FIG. 27 illustrate results of the first and second EGFR PCR
reactions.
[0048] FIG. 28A-B results of the first and second EGFR PCR
reactions.
[0049] FIG. 29 illustrates that EGFR wild type and mutant amplified
fragments are readily detected, despite the high leukocyte
background.
[0050] FIG. 30 illustrates the detection of single copies of a
fetal cell genome by qPCR.
[0051] FIG. 31 illustrates detection of single fetal cells in
binned samples by SNP analysis.
[0052] FIG. 32 illustrates a method of trisomy testing. The trisomy
21 screen is based on scoring of target cells obtained from
maternal blood. Blood is processed using a cell separation module
for hemoglobin enrichment (CSM-HE). Enriched cells are transferred
to slides that are first stained and subsequently probed by FISH.
Images are acquired, such as from bright field or fluorescent
microscopy, and scored. The proportion of trisomic cells of certain
classes serves as a classifier for risk of fetal trisomy 21. Fetal
genome identification can performed using assays such as: (1) STR
markers; (2) qPCR using primers and probes directed to loci, such
as the multi-repeat DYZ locus on the Y-chromosome; (3) SNP
detection; and (4) CGH (comparative genome hybridization) array
detection.
[0053] FIG. 33 illustrates assays that can produce information on
the presence of aneuploidy and other genetic disorders in target
cells. Information on aneuploidy and other genetic disorders in
target cells may be acquired using technologies such as: (1) a CGH
array established for chromosome counting, which can be used for
aneuploidy determination and/or detection of intra-chromosomal
deletions; (2) SNP/taqman assays, which can be used for detection
of single nucleotide polymorphisms; and (3) ultra-deep sequencing,
which can be used to produce partial or complete genome sequences
for analysis.
[0054] FIG. 34 illustrates methods of fetal diagnostic assays.
Fetal cells are isolated by CSM-HE enrichment of target cells from
blood. The designation of the fetal cells may be confirmed using
techniques comprising FISH staining (using slides or membranes and
optionally an automated detector), FACS, and/or binning. Binning
may comprise distribution of enriched cells across wells in a plate
(such as a 96 or 384 well plate), microencapsulation of cells in
droplets that are separated in an emulsion, or by introduction of
cells into microarrays of nanofluidic bins. Fetal cells are then
identified using methods that may comprise the use of biomarkers
(such as fetal (gamma) hemoglobin), allele-specific SNP panels that
could detect fetal genome DNA, detection of differentially
expressed maternal and fetal transcripts (such as Affymetrix
chips), or primers and probes directed to fetal specific loci (such
as the multi-repeat DYZ locus on the Y-chromosome). Binning sites
that contain fetal cells are then be analyzed for aneuploidy and/or
other genetic defects using a technique such as CGH array
detection, ultra deep sequencing (such as Solexa, 454, or mass
spectrometry), STR analysis, or SNP detection.
[0055] FIG. 35 illustrates methods of fetal diagnostic assays,
further comprising the step of whole genome amplification prior to
analysis of aneuploidy and/or other genetic defects.
INCORPORATION BY REFERENCE
[0056] All publications and patent applications mentioned in this
specification are herein incorporated by reference to the same
extent as if each individual publication or patent application was
specifically and individually indicated to be incorporated by
reference.
DETAILED DESCRIPTION OF THE INVENTION
[0057] The present invention provides systems, apparatus, and
methods to detect the presence of or abnormalities of rare analytes
or cells, such as hematapoeitic bone marrow progenitor cells,
endothelial cells, fetal cells, epithelial cells, or circulating
tumor cells in a sample of a mixed analyte or cell population
(e.g., maternal peripheral blood samples).
[0058] I. Sample Collection/Preparation
[0059] Samples containing rare cells can be obtained from any
animal in need of a diagnosis or prognosis or from an animal
pregnant with a fetus in need of a diagnosis or prognosis. In one
example, a sample can be obtained from animal suspected of being
pregnant, pregnant, or that has been pregnant to detect the
presence of a fetus or fetal abnormality. In another example, a
sample is obtained from an animal suspected of having, having, or
an animal that had a disease or condition (e.g. cancer). Such
condition can be diagnosed, prognosed, monitored and therapy can be
determined based on the methods and systems herein. Animal of the
present invention can be a human or a domesticated animals such as
a cow, chicken, pig, horse, rabbit, dogs, cat, or goat. Samples
derived from an animal or human can include, e.g., whole blood,
sweat, tears, ear flow, sputum, lymph, bone marrow suspension,
lymph, urine, saliva, semen, vaginal flow, cerebrospinal fluid,
brain fluid, ascites, milk, secretions of the respiratory,
intestinal or genitourinary tracts fluid.
[0060] To obtain a blood sample, any technique known in the art may
be used, e.g. a syringe or other vacuum suction device. A blood
sample can be optionally pre-treated or processed prior to
enrichment. Examples of pre-treatment steps include the addition of
a reagent such as a stabilizer, a preservative, a fixant, a lysing
reagent, a diluent, an anti-apoptotic reagent, an anti-coagulation
reagent, an anti-thrombotic reagent, magnetic property regulating
reagent, a buffering reagent, an osmolality regulating reagent, a
pH regulating reagent, and/or a cross-linking reagent.
[0061] When a blood sample is obtained, a preservative such an
anti-coagulation agent and/or a stabilizer is often added to the
sample prior to enrichment. This allows for extended time for
analysis/detection. Thus, a sample, such as a blood sample, can be
enriched and/or analyzed under any of the methods and systems
herein within 1 week, 6 days, 5 days, 4 days, 3 days, 2 days, 1
day, 12 hrs, 6 hrs, 3 hrs, 2 hrs, or 1 hr from the time the sample
is obtained.
[0062] In some embodiments, a blood sample can be combined with an
agent that selectively lyses one or more cells or components in a
blood sample. For example, fetal cells can be selectively lysed
releasing their nuclei when a blood sample including fetal cells is
combined with deionized water. Such selective lysis allows for the
subsequent enrichment of fetal nuclei using, e.g., size or affinity
based separation. In another example platelets and/or enucleated
red blood cells are selectively lysed to generate a sample enriched
in nucleated cells, such as fetal nucleated red blood cells
(fnRBC's), maternal nucleated blood cells (mnBC), epithelial cells
and circulating tumor cells. fnRBC's can be subsequently separated
from mnBC's using, e.g., antigen-i affinity or differences in
hemoglobin
[0063] When obtaining a sample from an animal (e.g., blood sample),
the amount can vary depending upon animal size, its gestation
period, and the condition being screened. In some embodiments, up
to 50, 40, 30, 20, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 mL of a sample
is obtained. In some embodiments, 1-50, 2-40, 3-30, or 4-20 mL of
sample is obtained. In some embodiments, more than 5, 10, 15, 20,
25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100
mL of a sample is obtained.
[0064] To detect fetal abnormality, a blood sample can be obtained
from a pregnant animal or human within 36, 24, 22, 20, 18, 16, 14,
12, 10, 8, 6 or 4 weeks of gestation.
[0065] II. Enrichment
[0066] A sample (e.g. blood sample) can be enriched for rare
analytes or rare cells (e.g. fetal cells, epithelial cells or
circulating tumor cells) using one or more any methods known in the
art (e.g. Guetta, E M et al. Stem Cells Dev, 13(1):93-9 (2004)) or
described herein. The enrichment increases the concentration of
rare cells or ratio of rare cells to non-rare cells in the sample.
For example, enrichment can increase concentration of an analyte of
interest such as a fetal cell or epithelial cell or CTC by a factor
of at least 2, 4, 6, 8, 10, 20, 50, 100, 200, 500, 1,000, 2,000,
5,000, 10,000, 20,000, 50,000, 100,000, 200,000, 500,000,
1,000,000, 2,000,000, 5,000,000, 10,000,000, 20,000,000,
50,000,000, 100,000,000, 200,000,000, 500,000,000, 1,000,000,000,
2,000,000,000, or 5,000,000,000 fold over its concentration in the
original sample. In particular, when enriching fetal cells from a
maternal peripheral venous blood sample, the initial concentration
of the fetal cells may be about 1:50,000,000 and it may be
increased to at least 1:5,000 or 1:500. Enrichment can also
increase concentration of rare cells in volume of rare cells/total
volume of sample (removal of fluid). A fluid sample (e.g., a blood
sample) of greater than 10, 15, 20, 50, or 100 mL total volume
comprising rare components of interest, and it can be concentrated
such that the rare component of interest into a concentrated
solution of less than 0.5, 1, 2, 3, 5, or 10 mL total volume.
[0067] Enrichment can occur using one or more types of separation
modules. Several different modules are described herein, all of
which can be fluidly coupled with one another in the series for
enhanced performance.
[0068] In some embodiments, enrichment occurs by selective lysis as
described above.
[0069] In one embodiment, enrichment of rare cells occurs using one
or more size-based separation modules. Examples of size-based
separation modules include filtration modules, sieves, matrixes,
etc. Examples of size-based separation modules contemplated by the
present invention include those disclosed in International
Publication No. WO 2004/113877. Other size based separation modules
are disclosed in International Publication No. WO 2004/0144651.
[0070] In some embodiments, a size-based separation module
comprises one or more arrays of obstacles forming a network of
gaps. The obstacles are configured to direct particles as they flow
through the array/network of gaps into different directions or
outlets based on the particle's hydrodynamic size. For example, as
a blood sample flows through an array of obstacles, nucleated cells
or cells having a hydrodynamic size larger than a predetermined
certain size such as a cutoff or predetermined size, e.g., 8
microns, are directed to a first outlet located on the opposite
side of the array of obstacles from the fluid flow inlet, while the
enucleated cells or cells having a hydrodynamic size smaller than a
predetermined size, e.g., 8 microns, are directed to a second
outlet also located on the opposite side of the array of obstacles
from the fluid flow inlet.
[0071] An array can be configured to separate cells smaller or
larger than a predetermined size by adjusting the size of the gaps,
obstacles, and offset in the period between each successive row of
obstacles. For example, in some embodiments, obstacles or gaps
between obstacles can be up to 10, 20, 50, 70, 100, 120, 150, 170,
or 200 microns in length or about 2, 4, 6, 8 or 10 microns in
length. In some embodiments, an array for size-based separation
includes more than 100, 500, 1,000, 5,000, 10,000, 50,000 or
100,000 obstacles that are arranged into more than 10, 20, 50, 100,
200, 500, or 1000 rows. Preferably, obstacles in a first row of
obstacles are offset from a previous (upstream) row of obstacles by
up to 50% the period of the previous row of obstacles. In some
embodiments, obstacles in a first row of obstacles are offset from
a previous row of obstacles by up to 45, 40, 35, 30, 25, 20, 15 or
10% the period of the previous row of obstacles. Furthermore, the
distance between a first row of obstacles and a second row of
obstacles can be up to 10, 20, 50, 70, 100, 120, 150, 170 or 200
microns. A particular offset can be continuous (repeating for
multiple rows) or non-continuous. In some embodiments, a separation
module includes multiple discrete arrays of obstacles fluidly
coupled such that they are in series with one another. Each array
of obstacles has a continuous offset. But each subsequent
(downstream) array of obstacles has an offset that is different
from the previous (upstream) offset. Preferably, each subsequent
array of obstacles has a smaller offset that the previous array of
obstacles. This allows for a refinement in the separation process
as cells migrate through the array of obstacles. Thus, a plurality
of arrays can be fluidly coupled in series or in parallel, (e.g.,
more than 2, 4, 6, 8, 10, 20, 30, 40, 50). Fluidly coupling
separation modules (e.g., arrays) in parallel allows for
high-throughput analysis of the sample, such that at least 1, 2, 5,
10, 20, 50, 100, 200, or 500 mL per hour flows through the
enrichment modules or at least 1, 5, 10, or 50 million cells per
hour are sorted or flow through the device.
[0072] FIG. 1A illustrates an example of a size-based separation
module. Obstacles (which may be of any shape) are coupled to a flat
substrate to form an array of gaps. A transparent cover or lid may
be used to cover the array. The obstacles form a two-dimensional
array with each successive row shifted horizontally with respect to
the previous row of obstacles, where the array of obstacles directs
component having a hydrodynamic size smaller than a predetermined
size in a first direction and component having a hydrodynamic size
larger that a predetermined size in a second direction. For
enriching epithelial or circulating tumor cells from enucleated,
the predetermined size of an array of obstacles can be get at 6-12
.mu.m or 6-8 .mu.m. For enriching fetal cells from a mixed sample
(e.g. maternal blood sample) the predetermined size of an array of
obstacles can be between 4-10 .mu.m or 6-8 .mu.m. The flow of
sample into the array of obstacles can be aligned at a small angle
(flow angle) with respect to a line-of-sight of the array.
Optionally, the array is coupled to an infusion pump to perfuse the
sample through the obstacles. The flow conditions of the size-based
separation module described herein are such that cells are sorted
by the array with minimal damage. This allows for downstream
analysis of intact cells and intact nuclei to be more efficient and
reliable.
[0073] In some embodiments, a size-based separation module
comprises an array of obstacles configured to direct cells larger
than a predetermined size to migrate along a line-of-sight within
the array (e.g. towards a first outlet or bypass channel leading to
a first outlet), while directing cells and analytes smaller than a
predetermined size to migrate through the array of obstacles in a
different direction than the larger cells (e.g. towards a second
outlet). Such embodiments are illustrated in part in FIGS.
1B-1D.
[0074] A variety of enrichment protocols may be utilized although
gentle handling of the cells is needed to reduce any mechanical
damage to the cells or their DNA. This gentle handling also
preserves the small number of fetal or rare cells in the sample.
Integrity of the nucleic acid being evaluated is an important
feature to permit the distinction between the genomic material from
the fetal or rare cells and other cells in the sample. In
particular, the enrichment and separation of the fetal or rare
cells using the arrays of obstacles produces gentle treatment which
minimizes cellular damage and maximizes nucleic acid integrity
permitting exceptional levels of separation and the ability to
subsequently utilize various formats to very accurately analyze the
genome of the cells which are present in the sample in extremely
low numbers.
[0075] In some embodiments, enrichment of rare cells (e.g. fetal
cells, epithelial cells or circulating tumor cells (CTCs)) occurs
using one or more capture modules that selectively inhibit the
mobility of one or more cells of interest. Preferable a capture
module is fluidly coupled downstream to a size-based separation
module. Capture modules can include a substrate having multiple
obstacles that restrict the movement of cells or analytes greater
than a predetermined size. Examples of capture modules that inhibit
the migration of cells based on size are disclosed in U.S. Pat.
Nos. 5,837,115 and 6,692,952.
[0076] In some embodiments, a capture module includes a two
dimensional array of obstacles that selectively filters or captures
cells or analytes having a hydrodynamic size greater than a
particular gap size (predetermined size), International Publication
No. WO 2004/113877.
[0077] In some cases a capture module captures analytes (e.g.,
cells of interest or not of interest) based on their affinity. For
example, an affinity-based separation module that can capture cells
or analytes can include an array of obstacles adapted for
permitting sample flow through, but for the fact that the obstacles
are covered with binding moieties that selectively bind one or more
analytes (e.g., cell populations) of interest (e.g., red blood
cells, fetal cells, epithelial cells or nucleated cells) or
analytes not-of-interest (e.g., white blood cells). Arrays of
obstacles adapted for separation by capture can include obstacles
having one or more shapes and can be arranged in a uniform or
non-uniform order. In some embodiments, a two-dimensional array of
obstacles is staggered such that each subsequent row of obstacles
is offset from the previous row of obstacles to increase the number
of interactions between the analytes being sorted (separated) and
the obstacles.
[0078] Binding moieties coupled to the obstacles can include e.g.,
proteins (e.g., ligands/receptors), nucleic acids having
complementary counterparts in retained analytes, antibodies, etc.
In some embodiments, an affinity-based separation module comprises
a two-dimensional array of obstacles covered with one or more
antibodies selected from the group consisting of anti-CD71,
anti-CD235a, anti-CD36, anti-carbohydrates, anti-selectin,
anti-CD45, anti-GPA, anti-antigen-i, anti-EpCAM, anti-E-cadherin,
and anti-Muc-1.
[0079] FIG. 2A illustrates a path of a first analyte through an
array of posts wherein an analyte that does not specifically bind
to a post continues to migrate through the array, while an analyte
that does bind a post is captured by the array. FIG. 2B is a
picture of antibody coated posts. FIG. 2C illustrates coupling of
antibodies to a substrate (e.g., obstacles, side walls, etc.) as
contemplated by the present invention. Examples of such
affinity-based separation modules are described in International
Publication No WO 2004/029221.
[0080] In some embodiments, a capture module utilizes a magnetic
field to separate and/or enrich one or more analytes (cells) based
on a magnetic property or magnetic potential in such analyte of
interest or an analyte not of interest. For example, red blood
cells which are slightly diamagnetic (repelled by magnetic field)
in physiological conditions can be made paramagnetic (attributed by
magnetic field) by deoxygenation of the hemoglobin into
methemoglobin. This magnetic property can be achieved through
physical or chemical treatment of the red blood cells. Thus, a
sample containing one or more red blood cells and one or more white
blood cells can be enriched for the red blood cells by first
inducing a magnetic property in the red blood cells and then
separating the red blood cells from the white blood cells by
flowing the sample through a magnetic field (uniform or
non-uniform).
[0081] For example, a maternal blood sample can flow first through
a size-based separation module to remove enucleated cells and
cellular components (e.g., analytes having a hydrodynamic size less
than 6 .mu.ms) based on size. Subsequently, the enriched nucleated
cells (e.g., analytes having a hydrodynamic size greater than 6
.mu.ms) white blood cells and nucleated red blood cells are treated
with a reagent, such as CO.sub.2, N.sub.2, or NaNO.sub.2, that
changes the magnetic property of the red blood cells' hemoglobin.
The treated sample then flows through a magnetic field (e.g., a
column coupled to an external magnet), such that the paramagnetic
analytes (e.g., red blood cells) will be captured by the magnetic
field while the white blood cells and any other non-red blood cells
will flow through the device to result in a sample enriched in
nucleated red blood cells (including fetal nucleated red blood
cells or fnRBC's). Additional examples of magnetic separation
modules are described in U.S. application Ser. No. 11/323,971,
filed Dec. 29, 2005 entitled "Devices and Methods for Magnetic
Enrichment of Cells and Other Particles" and U.S. application Ser.
No. 11/227,904, filed Sep. 15, 2005, entitled "Devices and Methods
for Enrichment and Alteration of Cells and Other Particles".
[0082] Subsequent enrichment steps can be used to separate the rare
cells (e.g. fnRBC's) from the non-rare cells maternal nucleated red
blood cells. In some embodiments, a sample enriched by size-based
separation followed by affinity/magnetic separation is further
enriched for rare cells using fluorescence activated cell sorting
(FACS) or selective lysis of a subset of the cells.
[0083] In some embodiments, enrichment involves detection and/or
isolation of rare cells or rare DNA (e.g. fetal cells or fetal DNA)
by selectively initiating apoptosis in the rare cells. This can be
accomplished, for example, by subjecting a sample that includes
rare cells (e.g. a mixed sample) to hyperbaric pressure (increased
levels of CO.sub.2; e.g. 4% CO.sub.2). This will selectively
initiate apoptosis in the rare or fragile cells in the sample (e.g.
fetal cells). Once the rare cells (e.g. fetal cells) begin
apoptosis, their nuclei will condense and optionally be ejected
from the rare cells. At that point, the rare cells or nuclei can be
detected using any technique known in the art to detect condensed
nuclei, including DNA gel electrophoresis, in situ labeling of DNA
nick using terminal deoxynucleotidyl transferase (TdT)-mediated
dUTP in situ nick labeling (TUNEL) (Gavrieli, Y., et al. J. Cell
Biol. 119:493-501 (1992)), and ligation of DNA strand breaks having
one or two-base 3' overhangs (Taq polymerase-based in situ
ligation). (Didenko V., et al. J. Cell Biol. 135:1369-76
(1996)).
[0084] In some embodiments ejected nuclei can further be detected
using a size based separation module adapted to selectively enrich
nuclei and other analytes smaller than a predetermined size (e.g. 6
microns) and isolate them from cells and analytes having a
hydrodynamic diameter larger than 6 microns. Thus, in one
embodiment, the present invention contemplated detecting fetal
cells/fetal DNA and optionally using such fetal DNA to diagnose or
prognose a condition in a fetus. Such detection and diagnosis can
occur by obtaining a blood sample from the female pregnant with the
fetus, enriching the sample for cells and analytes larger than 8
microns using, for example, an array of obstacles adapted for
size-base separation where the predetermined size of the separation
is 8 microns (e.g. the gap between obstacles is up to 8 microns).
Then, the enriched product is further enriched for red blood cells
(RBC's) by oxidizing the sample to make the hemoglobin paramagnetic
and flowing the sample through one or more magnetic regions. This
selectively captures the RBC's and removes other cells (e.g. white
blood cells) from the sample. Subsequently, the fnRBC's can be
enriched from mnRBC's in the second enriched product by subjecting
the second enriched product to hyperbaric pressure or other
stimulus that selectively causes the fetal cells to begin apoptosis
and condense/eject their nuclei. Such condensed nuclei are then
identified/isolated using e.g. laser capture microdissection or a
size based separation module that separates components smaller than
3, 4, 5 or 6 microns from a sample. Such fetal nuclei can then by
analyzed using any method known in the art or described herein.
[0085] In some embodiments, when the analyte desired to be
separated (e.g., red blood cells or white blood cells) is not
ferromagnetic or does not have a potential magnetic property, a
magnetic particle (e.g., a bead) or compound (e.g., Fe.sup.3+) can
be coupled to the analyte to give it a magnetic property. In some
embodiments, a bead coupled to an antibody that selectively binds
to an analyte of interest can be decorated with an antibody elected
from the group of anti CD71 or CD75. In some embodiments a magnetic
compound, such as Fe.sup.3+, can be couple to an antibody such as
those described above. The magnetic particles or magnetic
antibodies herein may be coupled to any one or more of the devices
herein prior to contact with a sample or may be mixed with the
sample prior to delivery of the sample to the device(s). Magnetic
particles can also be used to decorate one or more analytes (cells
of interest or not of interest) to increase the size prior to
performing size-based separation.
[0086] Magnetic field used to separate analytes/cells in any of the
embodiments herein can uniform or non-uniform as well as external
or internal to the device(s) herein. An external magnetic field is
one whose source is outside a device herein (e.g., container,
channel, obstacles). An internal magnetic field is one whose source
is within a device contemplated herein. An example of an internal
magnetic field is one where magnetic particles may be attached to
obstacles present in the device (or manipulated to create
obstacles) to increase surface area for analytes to interact with
to increase the likelihood of binding. Analytes captured by a
magnetic field can be released by demagnetizing the magnetic
regions retaining the magnetic particles. For selective release of
analytes from regions, the demagnetization can be limited to
selected obstacles or regions. For example, the magnetic field can
be designed to be electromagnetic, enabling turn-on and turn-off
off the magnetic fields for each individual region or obstacle at
will.
[0087] FIG. 3 illustrates an embodiment of a device configured for
capture and isolation of cells expressing the transferrin receptor
from a complex mixture. Monoclonal antibodies to CD71 receptor are
readily available off-the-shelf and can be covalently coupled to
magnetic materials comprising any conventional ferroparticles, such
as, but not limited to ferrous doped polystyrene and ferroparticles
or ferro-colloids (e.g., from Miltenyi and Dynal). The anti CD71
bound to magnetic particles is flowed into the device. The antibody
coated particles are drawn to the obstacles (e.g., posts), floor,
and walls and are retained by the strength of the magnetic field
interaction between the particles and the magnetic field. The
particles between the obstacles and those loosely retained with the
sphere of influence of the local magnetic fields away from the
obstacles are removed by a rinse.
[0088] One or more of the enrichment modules herein (e.g.,
size-based separation module(s) and capture module(s)) may be
fluidly coupled in series or in parallel with one another. For
example a first outlet from a separation module can be fluidly
coupled to a capture module. In some embodiments, the separation
module and capture module are integrated such that a plurality of
obstacles acts both to deflect certain analytes according to size
and direct them in a path different than the direction of
analyte(s) of interest, and also as a capture module to capture,
retain, or bind certain analytes based on size, affinity, magnetism
or other physical property.
[0089] In any of the embodiments herein, the enrichment steps
performed have a specificity and/or sensitivity greater than 50,
60, 70, 80, 90, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5,
99.6, 99.7, 99.8, 99.9 or 99.95% The retention rate of the
enrichment module(s) herein is such that .gtoreq.50, 60, 70, 80,
90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 99.9% of the analytes or
cells of interest (e.g., nucleated cells or nucleated red blood
cells or nucleated from red blood cells) are retained.
Simultaneously, the enrichment modules are configured to remove
.gtoreq.50, 60, 70, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99,
or 99.9% of all unwanted analytes (e.g., red blood-platelet
enriched cells) from a sample.
[0090] Any of the enrichment methods herein may be further
supplemented by splitting the enriched sample into aliquots or
sub-samples. In some embodiments, an enriched sample is split into
at least 2, 5, 10, 20, 50, 100, 200, 500, or 1000 sub-samples. Thus
when an enriched sample comprises about 500 cells and is split into
500 or 1000 different sub-samples, each sub-sample will have 1 or 0
cells.
[0091] In some cases a sample is split or arranged such that each
sub-sample is in a unique or distinct location (e.g. well). Such
location may be addressable. Each site can further comprise a
capture mechanism to capture cell(s) to the site of interest and/or
release mechanism for selectively releasing cells from the cite of
interest. In some cases, the well is configured to hold a single
cell.
[0092] III. Sample Analysis
[0093] In some embodiments, the methods herein are used for
detecting the presence or conditions of rare cells that are in a
mixed sample (optionally even after enrichment) at a concentration
of up to 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or 1% of
all cells in the mixed sample, or at a concentration of less than
1:2, 1:4, 1:10, 1:50, 1:100, 1:200, 1:500, 1:1000, 1:2000, 1:5000,
1:10,000, 1:20,000, 1:50,000, 1:100,000, 1:200,000, 1:1,000,000,
1:2,000,000, 1:5,000,000, 1:10,000,000, 1:20,000,000, 1:50,000,000
or 1:100,000,000 of all cells in the sample, or at a concentration
of less than 1.times.10.sup.-3, 1.times.10.sup.-4,
1.times.10.sup.-5, 1.times.10.sup.-6, or 1.times.10.sup.-7
cells/.mu.L of a fluid sample. In some embodiments, the mixed
sample has a total of up to 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30,
40, 50, or 100 rare cells (e.g. fetal cells or epithelial
cells).
[0094] Enriched target cells (e.g., fnRBC) may be "binned" prior to
further analysis of the enriched cells (FIGS. 34 & 35). Binning
is any process which results in the reduction of complexity and/or
total cell number of the enriched cell output. Binning may be
performed by any method known in the art or described herein. One
method of binning is by serial dilution. Such dilution may be
carried out using any appropriate platform (e.g., PCR wells,
microtiter plates) and appropriate buffers. Other methods include
nanofluidic systems which can separate samples into droplets (e.g.,
BioTrove, Raindance, Fluidigm). Such nanofluidic systems may result
in the presence of a single cell present in a nanodroplet.
[0095] Binning may be preceded by positive selection for target
cells including, but not limited to, affinity binding (e.g. using
anti-CD71 antibodies). Alternately, negative selection of
non-target cells may precede binning. For example, output from a
size-based separation module may be passed through a magnetic
hemoglobin enrichment module (MHEM) which selectively removes WBCs
from the enriched sample by attracting magnetized
hemoglobin-containing cells.
[0096] For example, the possible cellular content of output from
enriched maternal blood which has been passed through a size-based
separation module (with or without further enrichment by passing
the enriched sample through a MHEM) may consist of: 1)
approximately 20 fnRBC; 2) 1,500 mnRBC; 3) 4,000-40,000 WBC; 4)
15.times.10.sup.6 RBC. If this sample is separated into 100 bins
(PCR wells or other acceptable binning platform), each bin would be
expected to contain: 1) 80 negative bins and 20 bins positive for
one fnRBC; 2) 150 mnRBC; 3) 400-4,000 WBC; 4) 15.times.10.sup.4
RBC. If separated into 10,000 bins, each bin would be expected to
contain: 1) 9,980 negative bins and 20 bins positive for one fnRBC;
2) 8,500 negative bins and 1,500 bins positive for one mnRBC;
3)<1-4 WBC; 4) 15.times.10.sup.2 RBC. One of skill in the art
will recognize that the number of bins may be increased or
decreased depending on experimental design and/or the platform used
for binning. Reduced complexity of the binned cell populations may
facilitate further genetic and/or cellular analysis of the target
cells by reducing the number of non-target cells in an individual
bin.
[0097] Analysis may be performed on individual bins to confirm the
presence of target cells (e.g. fnRBC) in the individual bin. Such
analysis may consist of any method known in the art including, but
not limited to, FISH, PCR, STR detection, SNP analysis, biomarker
detection, and sequence analysis (FIGS. 34 &35).
[0098] For example, a peripheral maternal venous blood sample
enriched by the methods herein can be analyzed to determine
pregnancy or a condition of a fetus (e.g., sex of fetus or
aneuploidy). The analysis step for fetal cells may further involves
comparing the ratio of maternal to paternal genomic DNA on the
identified fetal cells.
[0099] IV. Fetal Biomarkers
[0100] In some embodiments fetal biomarkers may be used to detect
and/or isolate fetal cells, after enrichment or after detection of
fetal abnormality or lack thereof. For example, this may be
performed by distinguishing between fetal and maternal nRBCs based
on relative expression of a gene (e.g., DYS1, DYZ, CD-71,
.epsilon.- and .zeta.-globin) that is differentially expressed
during fetal development. In preferred embodiments, biomarker genes
are differentially expressed in the first and/or second trimester.
"Differentially expressed," as applied to nucleotide sequences or
polypeptide sequences in a cell or cell nuclei, refers to
differences in over/under-expression of that sequence when compared
to the level of expression of the same sequence in another sample,
a control or a reference sample. In some embodiments, expression
differences can be temporal and/or cell-specific. For example, for
cell-specific expression of biomarkers, differential expression of
one or more biomarkers in the cell(s) of interest can be higher or
lower relative to background cell populations. Detection of such
difference in expression of the biomarker may indicate the presence
of a rare cell (e.g., fnRBC) versus other cells in a mixed sample
(e.g., background cell populations). In other embodiments, a ratio
of two or more such biomarkers that are differentially expressed
can be measured and used to detect rare cells.
[0101] In one embodiment, fetal biomarkers comprise differentially
expressed hemoglobins. Erythroblasts (nRBCs) are very abundant in
the early fetal circulation, virtually absent in normal adult blood
and by having a short finite lifespan, there is no risk of
obtaining fnRBC which may persist from a previous pregnancy.
Furthermore, unlike trophoblast cells, fetal erythroblasts are not
prone to mosaic characteristics.
[0102] Yolk sac erythroblasts synthesize .epsilon.-, .zeta.-,
.gamma.- and .alpha.-globins, these combine to form the embryonic
hemoglobins. Between six and eight weeks, the primary site of
erythropoiesis shifts from the yolk sac to the liver, the three
embryonic hemoglobins are replaced by fetal hemoglobin (HbF) as the
predominant oxygen transport system, and .epsilon.- and
.zeta.-globin production gives way to .gamma.-, .alpha.- and
.beta.-globin production within definitive erythrocytes (Peschle et
al., 1985). HbF remains the principal hemoglobin until birth, when
the second globin switch occurs and .beta.-globin production
accelerates.
[0103] Hemoglobin (Hb) is a heterodimer composed of two identical a
globin chains and two copies of a second globin. Due to
differential gene expression during fetal development, the
composition of the second chain changes from a globin during early
embryonic development (1 to 4 weeks of gestation) to .gamma. globin
during fetal development (6 to 8 weeks of gestation) to .beta.
globin in neonates and adults as illustrated in (Table 1).
TABLE-US-00001 TABLE 1 Relative expression of .epsilon., .gamma.
and .beta. in maternal and fetal RDCs. .epsilon. .gamma. B 1.sup.st
trimester Fetal ++ ++ - Maternal - +/- ++ 2.sup.nd trimester Fetal
- ++ +/- Maternal - +/- ++
[0104] In the late-first trimester, the earliest time that fetal
cells may be sampled by CVS, fnRBCs contain, in addition to .alpha.
globin, primarily .epsilon. and .gamma. globin. In the early to mid
second trimester, when amniocentesis is typically performed, fnRBCs
contain primarily .gamma. globin with some adult .beta. globin.
Maternal cells contain almost exclusively .alpha. and .beta.
globin, with traces of .gamma. detectable in some samples.
Therefore, by measuring the relative expression of the .epsilon.,
.gamma. and .beta. genes in RBCs purified from maternal blood
samples, the presence of fetal cells in the sample can be
determined. Furthermore, positive controls can be utilized to
assess failure of the FISH analysis itself.
[0105] In various embodiments, fetal cells are distinguished from
maternal cells based on the differential expression of hemoglobins
.beta., .gamma. or .epsilon.. Expression levels or RNA levels can
be determined in the cytoplasm or in the nucleus of cells. Thus in
some embodiments, the methods herein involve determining levels of
messenger RNA (mRNA), ribosomal RNA (rRNA), or nuclear RNA
(nRNA).
[0106] in some embodiments, identification of fnRBCs can be
achieved by measuring the levels of at least two hemoglobins in the
cytoplasm or nucleus of a cell. In various embodiments,
identification and assay is from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15
or 20 fetal nuclei. Furthermore, total nuclei arrayed on one or
more slides can number from about 100, 200, 300, 400, 500, 700,
800, 5000, 10,000, 100,000, 1,000,000, 2,000,000 to about
3,000,000. In some embodiments, a ratio for .gamma./.beta. or
.epsilon./.beta. is used to determine the presence of fetal cells,
where a number less than one indicates that a fnRBC(s) is not
present. In some embodiments, the relative expression of
.gamma./.beta. or .epsilon./.beta. provides a fnRBC index ("FNI"),
as measured by .gamma. or .epsilon. relative to .beta.. In some
embodiments, a FNI for .gamma./.beta. greater than 5, 10, 15, 20,
25, 30, 35, 40, 45, 90, 180, 360, 720, 975, 1020, 1024, 1250 to
about 1250, indicate that a fnRBC(s) is present. In yet other
embodiments, a FNI for .gamma./.beta. of less than about 1
indicates that a fnRBC(s) is not present. Preferably, the above FNI
is determined from a sample obtained during a first trimester.
However, similar ratios can be used during second trimester and
third trimester.
[0107] In some embodiments, the expression levels are determined by
measuring nuclear RNA transcripts including, nascent or unprocessed
transcripts. In another embodiment, expression levels are
determined by measuring mRNA, including ribosomal RNA. There are
many methods known in the art for imaging (e.g., measuring) nucleic
acids or RNA including, but not limited to, using expression arrays
from Affymetrix, Inc. or Illumina, Inc.
[0108] RT-PCR primers can be designed by targeting the globin
variable regions, selecting the amplicon size, and adjusting the
primers annealing temperature to achieve equal PCR amplification
efficiency. Thus TaqMan probes can be designed for each of the
amplicons with well-separated fluorescent dyes, Alexa
fluor.RTM.-355 for .epsilon., Alexa Fluor.RTM.-488 for .gamma., and
Alexa Fluor-555 for .beta.. The specificity of these primers can be
first verified using .epsilon., .gamma., and .beta. cDNA as
templates. The primer sets that give the best specificity can be
selected for further assay development. As an alternative, the
primers can be selected from two exons spanning an intron sequence
to amplify only the mRNA to eliminate the genomic DNA
contamination.
[0109] The primers selected can be tested first in a duplex format
to verify their specificity, limit of detection, and amplification
efficiency using target cDNA templates. The best combinations of
primers can be further tested in a triplex format for its
amplification efficiency, detection dynamic range, and limit of
detection.
[0110] Various commercially available reagents are available for
RT-PCR, such as One-step RT-PCR reagents, including Qiagen One-Step
RT-PCR Kit and Applied Biosytems TaqMan One-Step RT-PCR Master Mix
Reagents kit. Such reagents can be used to establish the expression
ratio of .epsilon., .gamma., and .beta. using purified RNA from
enriched samples. Forward primers can be labeled for each of the
targets, using Alexa fluor-355 for .epsilon., Alexa fluor-488 for
.gamma., and Alexa fluor-555 for .beta.. Enriched cells can be
deposited by cytospinning onto glass slides. Additionally,
cytospinning the enriched cells can be performed after in situ
RT-PCR. Thereafter, the presence of the fluorescent-labeled
amplicons can be visualized by fluorescence microscopy. The reverse
transcription time and PCR cycles can be optimized to maximize the
amplicon signal:background ratio to have maximal separation of
fetal over maternal signature. Preferably, signal:background ratio
is greater than 5, 10, 50 or 100 and the overall cell loss during
the process is less than 50, 10 or 5%.
[0111] V. Fetal Cell Analysis
[0112] FIG. 4 illustrates an overview of some embodiments of the
present invention.
[0113] Aneuploidy means the condition of having less than or more
than the normal diploid number of chromosomes. In other words, it
is any deviation from euploidy. Aneuploidy includes conditions such
as monosomy (the presence of only one chromosome of a pair in a
cell's nucleus), trisomy (having three chromosomes of a particular
type in a cell's nucleus), tetrasomy (having four chromosomes of a
particular type in a cell's nucleus), pentasomy (having five
chromosomes of a particular type in a cell's nucleus), triploidy
(having three of every chromosome in a cell's nucleus), and
tetraploidy (having four of every chromosome in a cell's nucleus).
Birth of a live triploid is extraordinarily rare and such
individuals are quite abnormal, however triploidy occurs in about
2-3% of all human pregnancies and appears to be a factor in about
15% of all miscarriages. Tetraploidy occurs in approximately 8% of
all miscarriages. (http://www.emedicine.com/med/topic3241.htm).
[0114] In step 400, a sample is obtained from an animal, such as a
human. In some embodiments, animal or human is pregnant, suspected
of being pregnant, or may have been pregnant, and, the systems and
methods herein are used to diagnose pregnancy and/or conditions of
the fetus (e.g. trisomy). In some embodiments, the animal or human
is suspected of having a condition, has a condition, or had a
condition (e.g., cancer) and, the systems and methods herein are
used to diagnose the condition, determine appropriate therapy,
and/or monitor for recurrence.
[0115] In both scenarios a sample obtained from the animal can be a
blood sample e.g., of up to 50, 40, 30, 20, or 15 mL. In some cases
multiple samples are obtained from the same animal at different
points in time (e.g. before therapy, during therapy, and after
therapy, or during 1.sup.st trimester, 2.sup.nd trimester, and
3.sup.rd trimester of pregnancy).
[0116] In optional step 402, rare cells (e.g., fetal cells or
epithelial cells) or DNA of such rare cells are enriched using one
or more methods known in the art or described herein. For example,
to enrich fetal cells from a maternal blood sample, the sample can
be applied to a size-base separation module (e.g., two-dimensional
array of obstacles) configured to direct cells or particles in the
sample greater than 8 microns to a first outlet and cells or
particles in the sample smaller than 8 microns to a second outlet.
The fetal cells can subsequently be further enriched from maternal
white blood cells (which are also greater than 8 microns) based on
their potential magnetic property. For example, N.sub.2 or
anti-CD71 coated magnetic beads is added to the first enriched
product to make the hemoglobin in the red blood cells (maternal and
fetal) paramagnetic. The enriched sample is then flowed through a
column coupled to an external magnet. This captures both the
fnRBC's and mnRBC's creating a second enriched product. The sample
can then be subjected to hyperbaric pressure or other stimulus to
initiate apoptosis in the fetal cells. Fetal cells/nuclei can then
be enriched using microdissection, for example. It should be noted
that even an enriched product can be dominated (>50%) by cells
not of interest (e.g. maternal red blood cells). In some cases an
enriched sample has the rare cells (or rare genomes) consisting of
up to 0.01, 0.02, 0.05, 0.1, 0.2, 0.5, 1, 2, 5, 10, 20, or 50% of
all cells (or genomes) in the enriched sample. For example, using
the systems herein, a maternal blood sample of 20 mL from a
pregnant human can be enriched for fetal cells such that the
enriched sample has a total of about 500 cells, 2% of which are
fetal and the rest are maternal.
[0117] In step 404, the enriched product is split between two or
more discrete locations. In some embodiments, a sample is split
into at least 2, 10, 20, 50, 100, 200, 300, 400, 500, 600, 700,
800, 900, 1000, 2000, 3,000, 4,000, 5000, or 10,000 total different
discrete sites or about 100, 200, 500, 1000, 1200, 1500 sites. In
some embodiments, output from an enrichment module is serially
divided into wells of a 1536 microwell plate (FIG. 8). This can
result in one cell or genome per location or 0 or 1 cell or genome
per location. In some embodiments, cell splitting results in more
than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, 100, 200, 500, 1000,
2000, 5000, 10,000, 20,000, 50,000, 100,000, 200,000, or 500,000
cells or genomes per location. When splitting a sample enriched for
epithelial cells, endothelial cells, or CTC's, the load at each
discrete location (e.g., well) can include several leukocytes,
while one only some of the loads includes one or more CTC's. When
splitting a sample enriched for fetal cells preferably each site
includes 0 or 1 fetal cells.
[0118] Examples of discrete locations which could be used as
addressable locations include, but are not limited to, wells, bins,
sieves, pores, geometric sites, slides, matrixes, membranes,
electric traps, gaps, obstacles, or in-situ within a cell or
nuclear membrane. In some embodiments, the discrete cells are
addressable such that one can correlate a cell or cell sample with
a particular location.
[0119] Examples of methods for splitting a sample into discrete
addressable locations include, but are not limited to, fluorescent
activated cell sorting (FACS) (Sherlock, J V et al. Ann. Hum.
Genet. 62 (Pt. 1): 9-23 (1998)), micromanipulation (Samura, O., Ct
al Hum. Genet. 107(1):28-32 (2000)) and dilution strategies
(Findlay, I. et al. Mol. Cell. Endocrinol. 183 Suppl 1: 55-12
(2001)). Other methods for sample splitting cell sorting and
splitting methods known in the art may also be used. For example,
samples can be split by affinity sorting techniques using affinity
agents (e.g. antibodies) bound to any immobilized or mobilized
substrate (Samura O., et al., Hum. Genet. 107(1):28-32 (2000)).
Such affinity agents can be specific to a cell type e.g. RBC's
fetal cells epithelial cells including those specifically binding
EpCAM, antigen-i, or CD-71.
[0120] In some embodiments, a sample or enriched sample is
transferred to a cell sorting device that includes an array of
discrete locations for capturing cells traveling along a fluid
flow. The discrete locations can be arranged in a defined pattern
across a surface such that the discrete sites are also addressable.
In some embodiments, the sorting device is coupled to any of the
enrichment devices known in the art or disclosed herein. Examples
of cell sorting devices included are described in International
Publication No. WO 01/35071. Examples of surfaces that may be used
for creating arrays of cells in discrete addressable sites include,
but are not limited to, cellulose, cellulose acetate,
nitrocellulose, glass, quartz or other crystalline substrates such
as gallium arsenide, silicones, metals, semiconductors, various
plastics and plastic copolymers, cyclo-olefin polymers, various
membranes and gels, microspheres, beads and paramagnetic or
supramagnetic microparticles.
[0121] In some embodiments, a sorting device comprises an array of
wells or discrete locations wherein each well or discrete location
is configured to hold up to 1 cell. Each well or discrete
addressable location may have a capture mechanism adapted for
retention of such cell (e.g. gravity, suction, etc.) and optionally
a release mechanism for selectively releasing a cell of interest
from a specific well or site (e.g. bubble actuation). Figure B
illustrates such an embodiment.
[0122] In step 406, nucleic acids of interest from each cell or
nuclei arrayed are tagged by amplification. Preferably, the
amplified/tagged nucleic acids include at least 1, 2, 3, 4, 5, 6,
7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 90, 90 or 100 polymorphic
genomic DNA regions such as short tandem repeats (STRs) or variable
number of tandem repeats ("VNTR"). When the amplified DNA regions
include one or more STR/s/, the STR/s/ are selected for high
heterozygosity (variety of alleles) such that the paternal allele
of any fetal cell is more likely to be distinct in length from the
maternal allele. This results in improved power to detect the
presence of fetal cells in a mixed sample and any potential of
fetal abnormalities in such cells. In some embodiment, STR(s)
amplified are selected for their association with a particular
condition. For example, to determine fetal abnormality an STR
sequence comprising a mutation associated with fetal abnormality or
condition is amplified. Examples of STRs that can be
amplified/analyzed by the methods herein include, but are not
limited to D21S1414, D21S1411, D21S1412, D21S11 MBP, D13S634,
D13S631, D18S535, AmgXY and XHPRT. Additional STRs that can be
amplified/analyzed by the methods herein include, but are not
limited to, those at locus F13B (1:q31-q32); TPOX (2:p23-2pter);
FIBRA (FGA) (4:q28); CSFIPO (5:q33.3-q34); FI3A (6;p24-p25); THOI
(11:p15-15.5); VWA (12:p12-pter); CDU (12p12-pter); D14S1434
(14:q32.13); CYAR04 (p450) (15:q21.1) D21S11 (21:q11-q21) and
D22S1045 (22:q12.3). In some cases, STR loci are chosen on a
chromosome suspected of trisomy and on a control chromosome.
Examples of chromosomes that are often trisomic include chromosomes
21, 18, 13, and X. In some cases, 1 or more than 1, 2, 3, 4, 5, 6,
7, 8, 9, 10, 15, or 20 STRs are amplified per chromosome tested
(Samura, O. et al., Clin. Chem. 47(9):1622-6 (2001)). For example
amplification can be used to generate amplicons of up to 20, up to
30, up to 40, up to 50, up to 60, up to 70, up to 80, up to 90, up
to 100, up to 150, up to 200, up to 300, up to 400, up to 500 or up
to 1000 nucleotides in length. Di-, tri-, tetra-, or
penta-nucleotide repeat STR loci can be used in the methods
described herein.
[0123] To amplify and tag genomic DNA region(s) of interest, PCR
primers can include: (i) a primer element, (ii) a sequencing
element, and (iii) a locator element.
[0124] The primer element is configured to amplify the genomic DNA
region of interest (e.g. STR). The primer element includes, when
necessary, the upstream and downstream primers for the
amplification reactions. Primer elements can be chosen which are
multiplexible with other primer pairs from other tags in the same
amplification reaction (e.g. fairly uniform melting temperature,
absence of cross-priming on the human genome, and absence of
primer-primer interaction based on sequence analysis). The primer
element can have at least 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40
or 50 nucleotide bases, which are designed to specifically
hybridize with and amplify the genomic DNA region of interest.
[0125] The sequencing element can be located on the 5' end of each
primer element or nucleic acid tag. The sequencing element is
adapted to cloning and/or sequencing of the amplicons. (Marguiles,
M, Nature 437 (7057): 376-80) The sequencing element can be about
4, 6, 8, 10, 18, 20, 28, 36, 46 or 50 nucleotide bases in
length.
[0126] The locator element (also known as a unique tag sequence),
which is often incorporated into the middle part of the upstream
primer, can include a short DNA or nucleic acid sequence between
4-20 bp in length (e.g., about 4, 6, 8, 10, or 20 nucleotide
bases). The locator element makes it possible to pool the amplicons
from all discrete addressable locations following the amplification
step and analyze the amplicons in parallel. In some embodiments
each locator element is specific for a single addressable
location.
[0127] Tags are added to the cells/DNA at each discrete location
using an amplification reaction. Amplification can be performed
using PCR or by a variety of methods including, but not limited to,
singleplex PCR, quantitative PCR, quantitative fluorescent PCR
(QF-PCR), multiplex fluorescent PCR (MF-PCR), real time
PCR(RT-PCR), single cell PCR, restriction fragment length
polymorphism PCR (PCR-RFLP), PCR-RFLP/RT-PCR-RFLP, hot start PCR,
nested PCR, in situ polonony PCR, in situ rolling circle
amplification (RCA), bridge PCR, picotiter PCR, multiple strand
displacement amplification (MDA), and emulsion PCR. Other suitable
amplification methods include the ligase chain reaction (LCR),
transcription amplification, self-sustained sequence replication,
selective amplification of target polynucleotide sequences,
consensus sequence primed polymerase chain reaction (CP-PCR),
arbitrarily primed polymerase chain reaction (AP-PCR), degenerate
oligonucleotide-primed PCR (DOP-PCR) and nucleic acid based
sequence amplification (NABSA). Additional examples of
amplification techniques using PCR primers are described in, U.S.
Pat. Nos. 5,242,794, 5,494,810, 4,988,617 and 6,582,938.
[0128] In some embodiments, a further PCR amplification is
performed using nested primers for the one or more genomic DNA
regions of interest to ensure optimal performance of the multiplex
amplification. The nested PCR amplification generates sufficient
genomic DNA starting material for further analysis such as in the
parallel sequencing procedures below.
[0129] In step 408, genomic DNA regions tagged/amplified are pooled
and purified prior to further processing. Methods for pooling and
purifying genomic DNA are known in the art.
[0130] In step 410, pooled genomic DNA/amplicons are analyzed to
measure, e.g. allele abundance of genomic DNA regions (e.g. STRs
amplified). In some embodiments such analysis involves the use of
capillary gel electrophoresis (CGE). In other embodiments, such
analysis involves sequencing or ultra deep sequencing.
[0131] Sequencing can be performed using the classic Sanger
sequencing method or any other method known in the art.
[0132] For example, sequencing can occur by
sequencing-by-synthesis, which involves inferring the sequence of
the template by synthesizing a strand complementary to the target
nucleic acid sequence. Sequence-by-synthesis can be initiated using
sequencing primers complementary to the sequencing element on the
nucleic acid tags. The method involves detecting the identity of
each nucleotide immediately after (substantially real-time) or upon
(real-time) the incorporation of a labeled nucleotide or nucleotide
analog into a growing strand of a complementary nucleic acid
sequence in a polymerase reaction. After the successful
incorporation of a label nucleotide, a signal is measured and then
nulled by methods known in the art. Examples of
sequence-by-synthesis methods are described in U.S. Application
Publication Nos. 2003/0044781, 2006/0024711, 2006/0024678 and
2005/0100932. Examples of labels that can be used to label
nucleotide or nucleotide analogs for sequencing-by-synthesis
include, but are not limited to, chromophores, fluorescent
moieties, enzymes, antigens, heavy metal, magnetic probes, dyes,
phosphorescent groups, radioactive materials, chemiluminescent
moeities, scattering or fluorescent nanoparticles, Raman signal
generating moieties, and electrochemical detection moieties.
Sequencing-by-synthesis can generate at least 1,000, at least
5,000, at least 10,000, at least 20,000, 30,000, at least 40,000,
at least 50,000, at least 100,000 or at least 500,000 reads per
hour. Such reads can have at least 50, at least 60, at least 70, at
least 80, at least 90, at least 100, at least 120 or at least 150
bases per read.
[0133] Another sequencing method involves hybridizing the amplified
genomic region of interest to a primer complementary to it. This
hybridization complex is incubated with a polymerase, ATP
sulfurylase, luciferase, apyrase, and the substrates luciferin and
adenosine 5' phosphosulfate. Next, deoxynucleotide triphosphates
corresponding to the bases A, C, G, and T (U) are added
sequentially. Each base incorporation is accompanied by release of
pyrophosphate, converted to ATP by sulfurylase, which drives
synthesis of oxyluciferin and the release of visible light. Since
pyrophosphate release is equimolar with the number of incorporated
bases, the light given off is proportional to the number of
nucleotides adding in any one step. The process is repeated until
the entire sequence is determined.
[0134] Yet another sequencing method involves a four-color
sequencing by ligation scheme (degenerate ligation), which involves
hybridizing an anchor primer to one of four positions. Then an
enzymatic ligation reaction of the anchor primer to a population of
degenerate nonamers that are labeled with fluorescent dyes is
performed. At any given cycle, the population of nonamers that is
used is structure such that the identity of one of its positions is
correlated with the identity of the fluorophore attached to that
nonamer. To the extent that the ligase discriminates for
complementarily at that queried position, the fluorescent signal
allows the inference of the identity of the base. After performing
the ligation and four-color imaging, the anchor primer:nonamer
complexes are stripped and a new cycle begins. Methods to image
sequence information after performing ligation are known in the
art.
[0135] Preferably, analysis involves the use of ultra-deep
sequencing, such as described in Marguiles et al., Nature 437
(7057): 376-80 (2005). Briefly, the amplicons are diluted and mixed
with beads such that each bead captures a single molecule of the
amplified material. The DNA molecule on each bead is then amplified
to generate millions of copies of the sequence which all remain
bound to the bead. Such amplification can occur by PCR. Each bead
can be placed in a separate well, which can be a (optionally
addressable) picolitre-sized well. In some embodiments, each bead
is captured within a droplet of a
PCR-reaction-mixture-in-oil-emulsion and PCR amplification occurs
within each droplet. The amplification on the bead results in each
bead carrying at least one million, at least 5 million, or at least
10 million copies of the original amplicon coupled to it. Finally,
the beads are placed into a highly parallel sequencing by synthesis
machine which generates over 400,000 reads (.about.100 bp per read)
in a single 4 hour run.
[0136] Other methods for ultra-deep sequencing that can be used are
described in Hong, S. et al. Nat. Biotechnol. 22(4):435-9 (2004);
Bennett, B. et al. Pharmacogenomics 6(4):373-82 (2005); Shendure,
P. et al. Science 309 (5741):1728-32 (2005).
[0137] The role of the ultra-deep sequencing is to provide an
accurate and quantitative way to measure the allele abundances for
each of the STRs. The total required number of reads for each of
the aliquot wells is determined by the number of STRs, the error
rates of the multiplex PCR, and the Poisson sampling statistics
associated with the sequencing procedures.
[0138] In one example, the enrichment output from step 402 results
in approximately 500 cells of which 98% are maternal cells and 2%
are fetal cells. Such enriched cells are subsequently split into
500 discrete locations (e.g., wells) in a microtiter plate such
that each well contains 1 cell. PCR is used to amplify STR's
(.about.3-10 STR loci) on each chromosome of interest. Based on the
above example, as the fetal/maternal ratio goes down, the
aneuploidy signal becomes diluted and more loci are needed to
average out measurement errors associated with variable DNA
amplification efficiencies from locus to locus. The sample division
into wells containing .about.1 cell proposed in the methods
described herein achieves pure or highly enriched fetal/maternal
ratios in some wells, alleviating the requirements for averaging of
PCR errors over many loci.
[0139] In one example, let `f` be the fetal/maternal DNA copy ratio
in a particular PCR reaction. Trisomy increases the ratio of
maternal to paternal alleles by a factor 1+f/2. PCR efficiencies
vary from allele to allele within a locus by a mean square error in
the logarithm given by .sigma..sub.allele.sup.2, and vary from
locus to locus by .sigma..sub.locus.sup.2, where this second
variance is apt to be larger due to differences in primer
efficiency. N.sub.a is the loci per suspected aneuploid chromosome
and N.sub.c is the control loci. If the mean of the two maternal
allele strengths at any locus is `m` the paternal allele strength
is then the squared error expected is the mean of the
ln(ratio(m/p)), where this mean is taken over N loci is given by
2(.sigma..sub.allele.sup.2)/N. When taking the difference of this
mean of ln(ratio(m/p)) between a suspected aneuploidy region and a
control region, the error in the difference is given by
.sigma..sub.diff.sup.2=2(.sigma..sub.allele.sup.2)/N.sub.a+2(.sigma..sub-
.allele.sup.2)/N.sub.c (1)
[0140] For a robust detection of aneuploidy we require
3.sigma..sub.diff<f/2.
[0141] For simplicity, assuming N.sub.a=N=N in Equation 1, this
gives the requirement
6.sigma..sub.allele/N.sup.1/2<f/2, (3)
or a minimum N of
N=144(.sigma..sub.allele/f).sup.2 (4)
[0142] In the context of trisomy detection, the suspected
aneuploidy region is usually the entire chromosome and N denotes
the number of loci per chromosome. For reference, Equation 3 is
evaluated for N in the following Table 2 for various values of
.sigma..sub.allele and f.
TABLE-US-00002 TABLE 2 Required number of loci per chromosome as a
function of .sigma..sub.allele and f. f .sigma..sub.allele 0.1 0.3
1.0 0.1 144 16 1 0.3 1296 144 13 1.0 14400 1600 144
Since sample splitting decreases the number of starting genome
copies which increases .sigma..sub.allele at the same time that it
increases the value of f in some wells, the methods herein are
based on the assumption that the overall effect of splitting is
favorable; i.e., that the PCR errors do not increase too fast with
decreasing starting number of genome copies to offset the benefit
of having some wells with large f. The required number of loci can
be somewhat larger because for many loci the paternal allele is not
distinct from the maternal alleles, and this incidence depends on
the heterozygosity of the loci. In the case of highly polymorphic
STRs, this amounts to an approximate doubling of N.
[0143] The role of the sequencing is to measure the allele
abundances output from the amplification step. It is desirable to
do this without adding significantly more error due to the Poisson
statistics of selecting only a finite number of amplicons for
sequencing. The rms error in the ln(abundance) due to Poisson
statistics is approximately (N.sub.reads).sup.1/2. It is desirable
to keep this value less than or equal to the PCR error
.sigma..sub.allele. Thus, a typical paternal allele needs to be
allocated at least (.sigma..sub.allele).sup.-2 reads. The maternal
alleles, being more abundant, do not add appreciably to this error
when forming the ratio estimate for m/p. The mixture input to
sequencing contains amplicons from N.sub.loci loci of which roughly
an abundance fraction f/2 are paternal alleles. Thus, the total
required number of reads for each of the aliquot wells is given
approximately by 2N.sub.loci/(f.sigma..sub.allele.sup.2). Combining
this result with Equation 4, it is found a total number of reads
over all the wells given approximately by
N.sub.reads=288N.sub.wellsf.sup.-3. (5)
[0144] When performing sample splitting, a rough approximation is
to stipulate that the sample splitting causes f to approach unity
in at least a few wells. If the sample splitting is to have
advantages, then it must be these wells which dominate the
information content in the final result. Therefore, Equation (5)
with f=1 is adopted, which suggests a minimum of about 300 reads
per well. For 500 wells, this gives a minimum requirement for
.about.150,000 sequence reads. Allowing for the limited
heterozygosity of the loci tends to increase the requirements (by a
factor of .about.2 in the case of STRs), while the effect of
reinforcement of data from multiple wells tends to relax the
requirements with respect to this result (in the baseline case
examined above it is assumed that .about.10 wells have a pure fetal
cell). Thus the required total number of reads per patient is
expected to be in the range 100,000-300,000.
[0145] In step 412, wells with rare cells/alleles (e.g., fetal
alleles) are identified. The locator elements of each tag can be
used to sort the reads (.about.200,000 sequence reads) into `bins`
which correspond to the individual wells of the microtiter plates
(.about.500 bins). The sequence reads from each of the bins
(.about.400 reads per bin) are then separated into the different
genomic DNA region groups, (e.g. STR loci,) using standard sequence
alignment algorithms. The aligned sequences from each of the bins
are used to identify rare (e.g., non-maternal) alleles. It is
estimated that on average a 15 ml blood sample from a pregnant
human will result in .about.10 bins having a single fetal cell
each.
[0146] The following are two examples by which rare alleles can be
identified. In a first approach, an independent blood sample
fraction known to contain only maternal cells can be analyzed as
described above in order to obtain maternal alleles. This sample
can be a white blood cell fraction or simply a dilution of the
original sample before enrichment. In a second approach, the
sequences or genotypes for all the wells can be
similarity-clustered to identify the dominant pattern associated
with maternal cells. In either approach, the detection of
non-maternal alleles determines which discrete location (e.g. well)
contained fetal cells. Determining the number of bins with
non-maternal alleles relative to the total number of bins provides
an estimate of the number of fetal cells that were present in the
original cell population or enriched sample. Bins containing fetal
cells are identified with high levels of confidence because the
non-maternal alleles are detected by multiple independent
polymorphic DNA regions, e.g. STR loci.
[0147] In step 414, condition of rare cells or DNA is determined.
This can be accomplished by determining abundance of selected
alleles (polymorphic genomic DNA regions) in bin(s) with rare
cells/DNA. In some embodiments, allele abundance is used to
determine aneuploidy, e.g. chromosomes 13, 18 and 21. Abundance of
alleles can be determined by comparing ratio of maternal to
paternal alleles for each genomic region amplified (e.g., .about.12
STR's). For example, if 12 STRs are analyzed, for each bin there
are 33 sequence reads for each of the STRs. In a normal fetus, a
given STR will have 1:1 ratio of the maternal to paternal alleles
with approximately 16 sequence reads corresponding to each allele
(normal diallelic). In a trisomic fetus, three doses of an STR
marker will be detected either as three alleles with a 1:1:1 ratio
(trisomic triallelic) or two alleles with a ratio of 2:1 (trisomic
diallelic). (Adinolfi, P. et al., Prenat. Diagn, 17(13):1299-311
(1997)). In rare instances all three alleles may coincide and the
locus will not be informative for that individual patient. In some
embodiments, the information from the different DNA regions on each
chromosome are combined to increase the confidence of a given
aneuploidy call. In some embodiments, the information from the
independent bins containing fetal cells can also be combined to
further increase the confidence of the call.
[0148] In some embodiments allele abundance is used to determine
segmental anuepolidy. Normal diploid cells have two copies of each
chromosome and thus two alleles of each gene or loci. Changes in
the allele abundance for a particular chromosomal region may be
indicative of a chromosomal rearrangement, such as a deletion,
duplication or translocation event. In some embodiments, the
information from the different DNA regions on each chromosome are
combined to increase the confidence of a given segmental aneuploidy
call. In some embodiments, the information from the independent
bins containing fetal cells can also be combined to further
increase the confidence of the call.
[0149] The determination of fetal trisomy can be used to diagnose
conditions such as abnormal fetal genotypes, including, trisomy 13,
trisomy 18, trisomy 21 (Down syndrome) and Klinefelter Syndrome
(XXY). Other examples of abnormal fetal genotypes include, but are
not limited to, aneuploidy such as, monosomy of one or more
chromosomes (X chromosome monosomy, also known as Turner's
syndrome), trisomy of one or more chromosomes (13, 18, 21, and X),
tetrasomy and pentasomy of one or more chromosomes (which in humans
is most commonly observed in the sex chromosomes, e.g. XXXX, XXYY,
XXXY, XYYY, XXXXX, XXXXY, XXXYY, XYYYY and XXYYY), triploidy (three
of every chromosome, e.g. 69 chromosomes in humans), tetraploidy
(four of every chromosome, e.g. 92 chromosomes in humans) and
multiploidy. In some embodiments, an abnormal fetal genotype is a
segmental aneuploidy. Examples of segmental aneuploidy include, but
are not limited to, 1p36 duplication, dup(17)(p11.2p11.2) syndrome,
Down syndrome, Pelizaeus-Merzbacher disease, dup(22)(q11.2q11.2)
syndrome, and cat-eye syndrome. In some cases, an abnormal fetal
genotype is due to one or more deletions of sex or autosomal
chromosomes, which may result in a condition such as Cri-du-chat
syndrome, Wolf-Hirschhorn, Williams-Beuren syndrome,
Charcot-Marie-Tooth disease, Hereditary neuropathy with liability
to pressure palsies, Smith-Magenis syndrome, Neurofibromatosis,
Alagille syndrome, Velocardiofacial syndrome, DiGeorge syndrome,
Steroid sulfatase deficiency, Kallmann syndrome, Microphthalmia
with linear skin defects, Adrenal hypoplasia, Glycerol kinase
deficiency, Pelizaeus-Merzbacher disease, Testis-determining factor
on. Y, Azospermia (factor a), Azospermia (factor b), Azospermia
(factor c), or 1p36 deletion. In some embodiments, a decrease in
chromosomal number results in an XO syndrome.
[0150] In one embodiment, the methods of the invention allow for
the determination of maternal or paternal trisomy. In some
embodiments, the methods of the invention allow for the
determination of trisomy or other conditions in fetal cells in a
mixed maternal sample arising from more than one fetus.
[0151] In another aspect of the invention, standard quantitative
genotyping technology is used to declare the presence of fetal
cells and to determine the copy numbers (ploidies) of the fetal
chromosomes. Several groups have demonstrated that quantitative
genotyping approaches can be used to detect copy number changes
(Wang, Moorhead et al. 2005). However, these approaches do not
perform well on mixtures of cells and typically require a
relatively large number of input cells (.about.10,000). The current
invention addresses the complexity issue by performing the
quantitative genotyping reactions on individual cells. In addition,
multiplex PCR and DNA tags are used to perform the thousands of
genotyping reaction on single cells in highly parallel fashion.
[0152] An overview of this embodiment is illustrated in FIG. 5.
[0153] In step 500, a sample (e.g., a mixed sample of rare and
non-rare cells) is obtained from an animal or a human. See, e.g.,
step 400 of FIG. 4. Preferably, the sample is a peripheral maternal
blood sample.
[0154] In step 502, the sample is enriched for rare cells (e.g.,
fetal cells) by any method known in the art or described herein.
See, e.g., step 402 of FIG. 4.
[0155] In step 504, the enriched product is split into multiple
distinct sites (e.g., wells). See, e.g., step 404 of FIG. 4.
[0156] In step 506, PCR primer pairs for amplifying multiple (e.g.,
2-100) highly polymorphic genomic DNA regions (e.g., SNPs) are
added to each discrete site or well in the array or microtiter
plate. For example, PCR primer pairs for amplifying SNPs along
chromosome 13, 18, 21 and/or X can be designed to detect the most
frequent aneuoploidies. Other PCR primer pairs can be designed to
amplify SNPs along control regions of the genome where aneuploidy
is not expected. The genomic loci (e.g., SNPs) in the aneuploidy
region or aneuploidy suspect region are selected for high
polymorphism such that the paternal alleles of the fetal cells are
more likely to be distinct from the maternal alleles. This improves
the power to detect the presence of fetal cells in a mixed sample
as well as fetal conditions or abnormalities. SNPs can also be
selected for their association with a particular condition to be
detected in a fetus. In some cases, one or more than one, 2, 3, 4,
5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 SNPs are
analyzed per target chromosome (e.g., 13, 18, 21, and/or X). The
increase number of SNPs interrogated per chromosome ensures
accurate results. PCR primers are chosen to be multiplexible with
other pairs (fairly uniform melting temperature, absence of
cross-priming on the human genome, and absence of primer-primer
interaction based on sequence analysis). The primers are designed
to generate amplicons 10-200, 20-180, 40-160, 60-140 or 70-100 bp
in size to increase the performance of the multiplex PCR.
[0157] A second of round of PCR using nested primers may be
performed to ensure optimal performance of the multiplex
amplification. The multiplex amplification of single cells is
helpful to generate sufficient starting material for the parallel
genotyping procedure. Multiplex PCT can be performed on single
cells with minimal levels of allele dropout and preferential
amplification. See Sherlock, J., et al. Ann. Hum. Genet. 61 (Pt 1):
9-23 (1998); and Findlay, I., et al. Mol. Cell. Endocrinol. 183
Suppl. 1: S5-12 (2001).
[0158] In step 508, amplified polymorphic DNA region(s) of interest
(e.g., SNPs) are tagged e.g., with nucleic acid tags. Preferably,
the nucleic acid tags serve two roles: to determine the identity of
the different SNPs and to determine the identity of the bin from
which the genotype was derived. Nucleic acid tags can comprise
primers that allow for allele-specific amplification and/or
detection. The nucleic acid tags can be of a variety of sizes
including up to 10 base pairs, 10-40, 15-30, 18-25 or .about.22
base pair long.
[0159] In some embodiments, a nucleic acid tag comprises a
molecular inversion probe (MIP). Examples of MIPs and their uses
are described in Hardenbol, P., et al., Nat. Biotechnol.
21(6):673-8 (2003); Hardenbol, P., et al., Genome Res. 15(2):269-75
(2005); and Wang, Y., et al., Nucleic Acids Res. 33(21):e183
(2005). FIG. 7A illustrates one example of a MIP assay used herein.
The MIP tag can include a locator element to determine the identity
of the bin from which the genotype was derived. For example, when
output from an enrichment procedure results in about 500 cells, the
enriched product/cells can be split into a microliter plate
containing 500 wells such that each cell is in a different distinct
well. FIG. 7B illustrates a microtiter plate with 500 wells each of
which contains a single cell. Each cell is interrogated at 10
different SNPs per chromosome, on 4 chromosomes (e.g., chromosomes
13, 18, 21 and X). This analysis requires 40 MIPs per cell/well for
a total of 20,000 tags per 500 wells (i.e., 4 chromosomes.times.10
SNPs.times.500 wells). The tagging step can also include
amplification of the MIPs after their rearrangement or enzymatic
"gap fill".
[0160] In one embodiment, a nucleic acid tag comprises a unique
property, such as a difference in mass or chemical properties from
other tags. In another embodiments a nucleic acid tag comprises a
photoactivatable label, so that it crosslinks where it binds. In
another embodiment a nucleic acid tag can be used as a linker for
ultra deep sequencing. In another embodiment a nucleic acid tag can
be used as a linker for arrays. In another embodiment a nucleic
acid tag comprises a unique fluorescent label, (Such as FAM, JOE,
ROX, NED, HEX, SYBR, PET, TAMRA, VIC, CY-3, CY-5, dR6G, DS-33, LIZ,
DS-02, dR110, and Texas Red) which can be used to differentiate
individual DNA fragments. In another embodiment a nucleic acid tag
can serve as primer or hybridization site for a probe, to
facilitate signal amplification or detection from a single cell by
using a tractable marker. In some embodiments the labeled nucleic
acid tag can be analyzed using a system coupled to a light source,
such as an ABI 377, 310, 3700 or any other system which can detect
fluorescently labeled DNA.
[0161] In step 510, the tagged amplicons are pooled together for
further analysis.
[0162] In step 512, the genotype at each polymorphic site is
determined and/or quantified using any technique known in the art.
In one embodiment, genotyping occurs by hybridization of the MIP
tags to a microarray containing probes complementary to the
sequences of each MIP tag. See U.S. Pat. No. 6,858,412.
[0163] Using the example described above with the MIP probes, the
20,000 tags are hybridized to a single tag array containing
complementary sequences to each of the tagged MIP probes.
Microarrays (e.g. tag arrays) can include a plurality of nucleic
acid probes immobilized to discrete spots (e.g., defined locations
or assigned positions) on a substrate surface. For example, a
microarray can have at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90,
100, 500, 1,000, 5,000, 10,000, 15,000, 20,000, 30,000, 40,000,
50,000, 60,000, 70,000, 80,000, 90,000, or 100,000 different probes
complementary to MIP tagged probes. Methods to prepare microarrays
capable to monitor several genes according to the methods of the
invention are well known in the art. Examples of microarrays that
can be used in nucleic acid analysis that may be used are described
in U.S. Pat. No. 6,300,063, U.S. Pat. No. 5,837,832, U.S. Pat. No.
6,969,589, U.S. Pat. No. 6,040,138, U.S. Pat. No. 6,858,412, US
Publication No. 2005/0100893, US Publication No. 2004/0018491, US
Publication No. 2003/0215821 and US Publication No.
2003/0207295.
[0164] In step 516, bins with rare alleles (e.g., fetal alleles)
are identified. Using the example described above, rare allele
identification can be accomplished by first using the 22 bp tags to
sort the 20,000 genotypes into 500 bins which correspond to the
individual wells of the original microtiter plates. Then, one can
identify bins containing non-maternal alleles which correspond to
wells that contained fetal cells. Determining the number bins with
non-maternal alleles relative to the total number of its provides
an accurate estimate of the number of fnRBCs that were present in
the original enriched cell population. When a fetal cell is
identified in a given bin, the non-maternal alleles can be detected
by 40 independent SNPS s which provide an extremely high level of
confidence in the result.
[0165] In step 518, a condition such as trisomy is determined based
on the rare cell polymorphism. For example, after identifying the
.about.10 bins that contain fetal cells, one can determine the
ploidy of chromosomes 13, 18, 21 and X of such cells by comparing
the ratio of maternal to paternal alleles for each of .about.10
SNPs on each chromosome (X, 13, 18, 21). The ratios for the
multiple SNPs on each chromosome can be combined (averaged) to
increase the confidence of the aneuploidy call for that chromosome.
In addition, the information from the .about.10 independent bins
containing fetal cells can also be combined to further increase the
confidence of the call.
[0166] As described above, an enriched maternal sample with 500
cells can be split into 500 discrete locations such that each
location contains one cell. If ten SNPs are analyzed in each of
four different chromosomes, forty tagged MIP probes are added per
discrete location to analyze forty different SNPs per cell. The
forty SNPs are then amplified in each location using the primer
element in the MIP probe as described above. All the amplicons from
all the discrete locations are then pooled and analyzed using
quantitative genotyping as describe above. In this example a total
of 20,000 probes in a microarray are required to genotype the same
40 SNPs in each of the 500 discrete locations (4
chromosomes.times.10 SNPs.times.500 discrete locations).
[0167] The above embodiment can also be modified to provide for
genotyping by hybridizing the nucleic acid tags to bead arrays as
are commercially available by Illumina, Inc. and as described in
U.S. Pat. Nos. 7,040,959; 7,035,740; 7033,754; 7,025,935,
6,998,274; 6, 942,968; 6,913,884; 6,890,764; 6,890,741; 6,858,394;
6,846,460; 6,812,005; 6,770,441; 6,663,832; 6,620,584; 6,544,732;
6,429,027; 6,396,995; 6,355,431 and US Publication Application Nos.
20060019258; 20050266432; 20050244870; 20050216207; 20050181394;
20050164246; 20040224353; 20040185482; 20030198573; 20030175773;
20030003490; 20020187515; and 20020177141; as well as Shen, R., et
al. Mutation Research 573 70-82 (2005).
[0168] An overview of the use of nucleic acid tags is described in
FIG. 7C. After enrichment and amplification as described above,
target genomic DNA regions are activated in step 702 such that they
may bind paramagnetic particles. In step 703 assay
oligonucleotides, hybridization buffer, and paramagnetic particles
are combined with the activated DNA and allowed to hybridize
(hybridization step). In some cases, three oligonucleotides are
added for each SNP to be detected. Two of the three oligos are
specific for each of the two alleles at a SNP position and are
referred to as Allele-Specific Oligos (ASOs). A third oligo
hybridizes several bases downstream from the SNP site and is
referred to as the Locus-Specific Oligo (LSO). All three oligos
contain regions of genomic complementarity (C1, C2, and C3) and
universal PCR primer sites (P1, P2 and P3). The LSO also contains a
unique address sequence (Address) that targets a particular bead
type. In some cases, up to 1,536 SNPs may be interrogated in this
manner. During the primer hybridization process, the assay
oligonucleotides hybridize to the genomic DNA sample bound to
paramagnetic particles. Because hybridization occurs prior to any
amplification steps, no amplification bias is introduced into the
assay. The above primers can further be modified to serve the two
roles of determining the identity of the different SNPs and to
determining the identity of the bin from which the genotype was
derived. In step 704, following the hybridization step, several
wash steps are performed reducing noise by removing excess and
mis-hybridized oligonucleotides. Extension of the appropriate ASO
and ligation of the extended product to the LSO joins information
about the genotype present at the SNP site to the address sequence
on the LSO. In step 705, the joined, full-length products provide a
template for performing PCR reactions using universal PCR primers
P1, P2, and P3. Universal primers P1 and P2 are labeled with two
different labels (e.g., Cy3 and Cy5). Other labels that can be used
include, chromophores, fluorescent moieties, enzymes, antigens,
heavy metal, magnetic probes, dyes, phosphorescent groups,
radioactive materials, chemiluminescent moieties, scattering or
fluorescent nanoparticles, Raman signal generating moieties, or
electrochemical detection moieties. In step 706, the
single-stranded, labeled DNAs are eluted and prepared for
hybridization. In step 707, the single-stranded, labeled DNAs are
hybridized to their complement bead type through their unique
address sequence. Hybridization of the GoldenGate Assay products
onto the Array Matrix of Beadchip allows for separation of the
assay products in solution, onto a solid surface for individual SNP
genotype readout. In step 708, the array is washed and dried. In
step 709, a reader such as the BeadArray Reader is used to analyze
signals from the label. For example, when the labels are dye labels
such as Cy3 and Cy5, the reader can analyze the fluorescence signal
on the Sentrix Array Matrix or BeadChip. In step 710, a computer
readable medium having a computer executable logic recorded on it
can be used in a computer to perform receive data from one or more
quantified DNA genomic regions to automate genotyping clusters and
callings. Expression detection and analysis using microarrays is
described in part in Valk, P. J. et al. New England Journal of
Medicine 350(16), 1617-28, 2004; Modlich, O. et al. Clinical Cancer
Research 10(10), 3410-21, 2004; Oaken, Michael D. et al. Cancer
Res. 64(20), 7205-7209, 2004; Gardian, et al. J. Biol. Chem.
280(1), 556-563, 2005; Becker, M. et al. Mol. Cancer Ther. 4(1),
151-170, 2005; and Flechner, S M et al. Am J Transplant 4(9),
1475-89, 2004; as well as in U.S. Pat. Nos. 5,445,934; 5,700,637;
5,744,305; 5,945,334; 6,054,270; 6,140,044; 6,261,776; 6,291,183;
6,346,413; 6,399,365; 6,420,169; 6,551,817; 6,610,482; 6,733,977;
and EP 619 321; 323 203.
[0169] In any of the embodiments herein, preferably, more than
1000, 5,000, 10,000, 50,000, 100,000, 500,000, or 1,000,000 SNPs
are interrogated in parallel.
[0170] In another aspect of the invention, illustrated in part by
FIG. 6, the systems and methods herein can be used to diagnose,
prognose, and monitor neoplastic conditions such as cancer in a
patient. Examples of neoplastic conditions contemplated herein
include acute lymphoblastic leukemia, acute or chronic lymphocytic
or granulocytic tumor, acute myeloid leukemia, acute promyelocytic
leukemia, adenocarcinoma, adenoma, adrenal cancer, basal cell
carcinoma, bone cancer, brain cancer, breast cancer, bronchi
cancer, cervical dysplasia, chronic myelogenous leukemia, colon
cancer, epidermoid carcinoma, Ewing's sarcoma, gallbladder cancer,
gallstone tumor, giant cell tumor, glioblastoma multiforma,
hairy-cell tumor, head cancer, hyperplasia, hyperplastic corneal
nerve tumor, in situ carcinoma, intestinal ganglioneuroma, islet
cell tumor, Kaposi's sarcoma, kidney cancer, larynx cancer,
leiomyomater tumor, liver cancer, lung cancer, lymphomas, malignant
carcinoid, malignant hypercalcemia, malignant melanomas, marfanoid
habitus tumor, medullary carcinoma, metastatic skin carcinoma,
mucosal neuromas, mycosis fungoide, myelodysplastic syndrome,
myeloma, neck cancer, neural tissue cancer, neuroblastoma,
osteogenic sarcoma, osteosarcoma, ovarian tumor, pancreas cancer,
parathyroid cancer, pheochromocytoma, polycythemia vera, primary
brain tumor, prostate cancer, rectum cancer, renal cell tumor,
retinoblastoma, rhabdomyosarcoma, seminoma, skin cancer, small-cell
lung tumor, soft tissue sarcoma, squamous cell carcinoma, stomach
cancer, thyroid cancer, topical skin lesion, veticulum cell
sarcoma, and Wilm's tumor.
[0171] Cancers such as breast, colon, liver, ovary, prostate, and
lung as well as other tumors exfoliate epithelial cells into the
bloodstream. The presence of an increased number epithelial cells
is associated with an active tumor or other neoplastic condition,
tumor progression and spread, poor response to therapy, relapse of
disease, and/or decreased survival over a period of several years.
Therefore, enumerating and/or analyzing epithelial cells and CTC's
in the bloodstream can be used to diagnose, prognose, and/or
monitor neoplastic conditions.
[0172] In step 600, a sample is obtained from an animal such as a
human. The human can be suspected of having cancer or cancer
recurrence or may have cancer and is in need of therapy selection.
The sample obtained is a mixed sample comprising normal cells as
well as one or more CTCs, epithelial cells, endothelial cells, stem
cells, or other cells indicative of cancer. In some cases, the
sample is a blood sample. In some cases multiple samples are
obtained from the animal at different points in time (e.g., regular
intervals such as daily, or every 2, 3 or 4 days, weekly,
bimonthly, monthly, bi-yearly or yearly.
[0173] In step 602, the mixed sample is then enriched for
epithelial cells or CTC's or other cell indicative of cancer.
Epithelial cells that are exfoliated from solid tumors have been
found in very low concentrations in the circulation of patients
with advanced cancers of the breast, colon, liver, ovary, prostate,
and lung, and the presence or relative number of these cells in
blood has been correlated with overall prognosis and response to
therapy. These epithelial cells which are in fact CTCs can be used
as an early indicator of tumor expansion or metastasis before the
appearance of clinical symptoms.
[0174] CTCs are generally larger than most blood cells. Therefore,
one useful approach for obtaining CTCs in blood is to enrich them
based on size, resulting in a cell population enriched in CTCs.
Another way to enrich CTCs is by affinity separation, using
antibodies specific for particular cell surface markers may be
used. Useful endothelial cell surface markers include CD105, CD106,
CD144, and CD 146; useful tumor endothelial cell surface markers
include TEM1, TEM5, and TEM8 (see, e.g., Carson-Walter et al.,
Cancer Res. 61; 6649-6655 (2001)); and useful mesenchymal cell
surface markers include CD133. Antibodies to these or other markers
may be obtained from, e.g., Chemicon, Abeam, and R&D
Systems.
[0175] In one example, a size-based separation module that enriches
CTC's from a fluid sample (e.g., blood) comprises an array of
obstacles that selectively deflect particles having a hydrodynamic
size larger than 10 .mu.m into a first outlet and particles having
a hydrodynamic size smaller than 10 .mu.m into a second outlet is
used to enrich epithelial cells and CTC's from the sample.
[0176] In step 603, the enriched product is split into a plurality
of discrete sites, such as mirowells. Exemplary microwells that can
be used in the present invention include microplates having 1536
wells as well as those of lesser density (e.g., 96 and 384 wells).
Microwell plate design contemplated herein include those have 14
outputs that can be automatically dispensed at the same time, as
well as those with 16, 24, or 32 outputs such that e.g., 32 outputs
can be dispenses simultaneously. FIG. 9 illustrates one embodiments
of a microwell plate contemplated herein.
[0177] Dispensing of the cells into the various discrete sites is
preferably automated. In some cases, about 1, 5, 10, or 15 .mu.L of
enriched sample is dispensed into each well. Preferably, the size
of the well and volume dispensed into each well is such that only 1
cell is dispensed per well and only 1-5 or less than 3 cells can
fit in each well.
[0178] An exemplary array for sample splitting is illustrated in
FIG. 8A. FIG. 8B illustrates an isometric view and FIG. 8B
illustrates a top view and cross sectional view of such an array. A
square array of wells is arranged such that each subsequent row or
column of wells is identical to the previous row or column of
wells, respectively. In some embodiments, an array of wells is
configured in a substrate or plate that about 2.0 cm.sup.2, 2.5
cm.sup.2, 3 cm.sup.2 or larger. The wells can be of any shape,
e.g., round, square, or oval. The height or width of each well can
be between 5-50 .mu.m, 10-40 .mu.m, or about 25 .mu.m. The depth of
each well can be up to 100, 80, 60, or 40 .mu.m; and the radius
between the centers of two wells in one column is between 10-60
.mu.m, 20-50 .mu.m, or about 35 .mu.m. Using these configurations,
an array of wells of area 2.5 cm.sup.2 can have a at least
0.1.times.10.sup.6 wells, 0.2.times.10.sup.6 wells,
0.3.times.10.sup.6 wells, 0.4.times.10.sup.6 wells, or
0.5.times.10.sup.6 wells.
[0179] In some embodiments, such as those illustrated in FIG. 8C
each well may have an opening at the bottom. The bottom opening is
preferably smaller in size than the cells of interest. In this
case, if the average radius of a CTC is about 10 .mu.m, the bottom
opening of each well can have a radius of up to 8, 7, 6, 5, 4, 3, 2
or 1 .mu.m. The bottom opening allows for cells none of interest
and other components smaller than the cell of interest to be
removed from the well using flow pressure, leaving the cells of
interest behind in the well for further processing. Methods and
systems for actuating removal of cells from discrete predetermined
sites are disclosed in U.S. Pat. No. 6,692,952 and U.S. application
Ser. No. 11/146,581.
[0180] In some cases, the array of wells can be a
micro-electro-mechanical system (MEMS) such that it integrates
mechanical elements, sensors, actuators, and electronics on a
common silicon substrate through microfabrication technology. Any
electronics in the system can be fabricated using integrated
circuit (IC) process sequences (e.g., CMOS, Bipolar, or BICMOS
processes), while the micromechanical components are fabricated
using compatible micromachining processes that selectively etch
away parts of the silicon wafer or add new structural layers to
form the mechanical and electromechanical devices. One example of a
MEMS array of wells includes a MEMS isolation element within each
well. The MEMS isolation element can create a flow using pressure
and/or vacuum to increase pressure on cells and particles not of
interest to escape the well through the well opening. In any of the
embodiments herein, the array of wells can be coupled to a
microscope slide or other substrate that allows for convenient and
rapid optical scanning of all chambers (i.e. discrete sites) under
a microscope. In some embodiments, a 1536-well microtiter plate is
used for enhanced convenience of reagent addition and other
manipulations.
[0181] In some cases, the enriched product can be split into wells
such that each well is loaded with a plurality of leukocytes (e.g.,
more than 100, 200, 500, 1000, 2000, or 5000). In some cases, about
2500 leukocytes are dispensed per well, while random wells will
have a single epithelial CTC or up to 2, 3, 4, or 5 epithelial
cells or CTC's. Preferably, the probability of getting a single
epithelial cell or CTC into a well is calculated such that no more
than 1 CTC is loaded per well. The probability of dispensing CTC's
from a sample into wells can be calculated using Poisson
statistics. When dispensing a 15 mL sample into 1536 wellplate at
10 .mu.L per well, it is not until the number of CTC's in the
sample is >100 that there is more than negligible probability of
two or more CTC's being loaded into the sample well. FIG. 9
illustrates the probability density function of loading two CTC's
into the same plate.
[0182] In step 604, rare cells (e.g. epithelial cells or CTC's) or
rare DNA is detected and/or analyzed in each well.
[0183] In some embodiments, detection and analysis includes
enumerating epithelial cells and/or CTC's. CTCs typically have a
short half-life of approximately one day, and their presence
generally indicates a recent influx from a proliferating tumor.
Therefore, CTCs represent a dynamic process that may reflect the
current clinical status of patient disease and therapeutic
response. Thus, in some embodiments, step 604 involves enumerating
CTC and/or epithelial cells in a sample (array of wells) and
determining based on their number if a patient has cancer, severity
of condition, therapy to be used, or effectiveness of therapy
administered.
[0184] In some cases, the method herein involve making a series of
measurements, optionally made at regular intervals such as one day,
two days, three days, one week, two weeks, one month, two months,
three months, six months, or one year, one may track the level of
epithelial cells present in a patient's bloodstream as a function
of time. In the case of existing cancer patients, this provides a
useful indication of the progression of the disease and assists
medical practitioners in making appropriate therapeutic choices
based on the increase, decrease, or lack of change in epithelial
cells, e.g., CTCs, in the patient's bloodstream. For those at risk
of cancer, a sudden increase in the number of cells detected may
provide an early warning that the patient has developed a tumor.
This early diagnosis, coupled with subsequent therapeutic
intervention, is likely to result in an improved patient outcome in
comparison to an absence of diagnostic information.
[0185] In some cases, more than one type of cell (e.g., epithelial,
endothelial, etc.) can be enumerated and a determination of a ratio
of numbers of cells or profile of various cells can be obtained to
generate the diagnosis or prognosis.
[0186] Alternatively, detection of rare cells or rare DNA (e.g.
epithelial cells or CTC's) can be made by detecting one or more
cancer biomarkers, e.g., any of those listed in FIG. 10 in one or
more cells in the array. Detection of cancer biomarkers can be
accomplished using, e.g., an antibody specific to the marker or by
detecting a nucleic acid encoding a cancer biomarker, e.g., listed
in FIG. 9.
[0187] In some cases single cell analysis techniques are used to
analyze individual cells in each well. For example, single cell PCR
may be performed on a single cell in a discrete location to detect
one or more mutant alleles in the cell (Thornhill A R, J. Mol.
Diag; (4) 11-29 (2002)) or a mutation in a gene listed in FIG. 9.
In-cell PCR, gene expression analysis can be performed even when
the number of cells per well is very low (e.g. 1 cell per well)
using techniques known in the art. (Giordano et al., Am. J. Pathol.
159:1231-1238 (2001), and Buckhaults et al., Cancer Res.
63:4144-41.49 (2003). In some cases, single cell expression
analysis can be performed to detection expression of one or more
genes of interest (Liss B., Nucleic Acids Res., 30 (2002))
including those listed in FIG. 9. Furthermore, ultra-deep
sequencing can be performed on single cells using methods such as
those described in Marguiles M., et al. Nature, "Genome sequencing
in microfabricated high-density picolitre reactors." DOI 10.1038,
in which whole genomes are fragmented, fragments are captured using
common adapters on their own beads and within droplets of an
emulsion, clonally amplified. Such ultra-deep sequencing can also
be used to detect mutations in genes associated with cancer, such
as those listed in FIG. 9. In addition, fluorescence in-situ
hybridization can be used, e.g., to determine the tissue or tissues
of origin of the cells being analyzed.
[0188] In some cases, morphological analyses are performed on the
cells in each well. Morphological analyses include identification,
quantification and characterization of mitochondrial DNA,
telomerase, or nuclear matrix proteins. Parrella et al., Cancer
Res. 61:7623-7626 (2001); Jones et al., Cancer Res. 61:1299-1304
(2001); Fliss et al., Science 287:2017-2019 (2000); and Soria et
al., Clin. Cancer Res. 5:971-975 (1999). In particular, in some
cases, the molecular analyses involves determining whether any
mitochondrial abnormalities or whether perinuclear compartments are
present. Carew et al., Mol. Cancer. 1:9 (2002); and Wallace,
Science 283:1482-1488 (1999).
[0189] A variety of cellular characteristics may be measured using
any technique known in the art, including: protein phosphorylation,
protein glycosylation, DNA methylation (Das et al., J. Clin. Oncol.
22:4632-4642 (2004)), microRNA levels (He et al., Nature
435:828-833 (2005), Lu et al., Nature 435:834-838 (2005), O'Donnell
et al., Nature 435:839-843 (2005), and Calin et al., N. Engl. J.
Med. 353:1793-1801 (2005)), cell morphology or other structural
characteristics, e.g., pleomorphisms, adhesion, migration, binding,
division, level of gene expression, and presence of a somatic
mutation. This analysis may be performed on any number of cells,
including a single cell of interest, e.g., a cancer cell.
[0190] In one embodiment, the cell(s) (such as fetal, maternal,
epithelial or CTCs) in each well are lysed and RNA is extracted
using any means known in the art. For example, The Quiagen
RNeasy.TM. 96 bioRobot.TM. 8000 system can be used to automate
high-throughput isolation of total RNA from each discrete site.
Once the RNA is extracted reverse transcriptase reactions can be
performed to generate cDNA sequences, which can then be used for
performing multiplex PCR reactions on target genes. For example, 1
or more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 target genes
can be amplified in the same reaction. When more than one target
genes are used in the same amplification reaction, primers are
chosen to be multiplexable (fairly uniform melting temperature,
absence of cross-priming on the human genome, and absence of
primer-primer interaction based on sequence analysis) with other
pairs of primers. Multiple dyes and multi-color fluorescence
readout may be used to increase the multiplexing capacity. Examples
of dyes that can be used to label primers for amplification
include, but are not limited to, chromophores, fluorescent
moieties, enzymes, antigens, heavy metal, magnetic probes, dyes,
phosphorescent groups, radioactive materials, chemiluminescent
moeities, scattering or fluorescent nanoparticles, Raman signal
generating moieties, and electrochemical detection moieties.
[0191] In another embodiment, fetal or maternal cells or nuclei are
enriched using one or more methods disclosed herein. Preferably,
fetal cells are enriched by flowing the sample through an array of
obstacles that selectively directs particles or cells of different
hydrodynamic sizes into different outlets such that fetal cells and
cells larger than fetal cells are directed into a first outlet and
one or more cells or particles smaller than the rare cells are
directed into a second outlet.
[0192] Total RNA or poly-A mRNA is then obtained from enriched
cell(s) (fetal or maternal cells) using purification techniques
known in the art. Generally, about 1 .mu.g-2 .mu.g of total RNA is
sufficient. Next, a first-strand complementary DNA (cDNA) is
synthesized using reverse transcriptase and a single T7-oligo(dT)
primer. Next, a second-strand cDNA is synthesized using DNA ligase,
DNA polymerase, and RNase enzyme. Next, the double stranded cDNA
(ds-cDNA) is purified.
[0193] In another embodiment, total RNA is extracted from enriched
cells (fetal cells or maternal cells). Next a, two one-quarter
scale Message Amp II reactions (Ambion, Austin, Tex.) are performed
for each RNA extraction using 200 ng of total RNA. MessageAmp is a
procedure based on antisense RNA (aRNA) amplification, and involves
a series of enzymatic reactions resulting in linear amplification
of exceedingly small amounts of RNA for use in array analysis.
Unlike exponential RNA amplification methods, such as NASBA and
RT-PCR, aRNA amplification maintains representation of the starting
mRNA population. The procedure begins with total or poly(A) RNA
that is reverse transcribed using a primer containing both
oligo(dT) and a T7 RNA polymerase promoter sequence. After
first-strand synthesis, the reaction is treated with RNase H to
cleave the mRNA into small fragments. These small RNA fragments
serve as primers during a second-strand synthesis reaction that
produces a double-stranded cDNA template.
[0194] In some embodiments, cDNAs, which are reverse transcribed
from mRNAs obtained from fetal or maternal cells, are tagged and
sequenced. The type and abundance of the cDNAs can be used to
determine whether a cell is a fetal cell (such as by the presence
of Y chromosome specific transcripts) or whether the fetal cell has
a genetic abnormality (such as aneuploidy, abundance or type of
alternative transcripts or problems with DNA methylation or
imprinting).
[0195] In one embodiment, PCR amplification can be performed on
genes that are expressed in epithelial cells and not in normal
cells, e.g., white blood cells or other cells remaining in an
enriched product. Exemplary genes that can be analyzed according to
the methods herein include EGFR, EpCAM, GA733-2, MUC-1, HER-2,
Claudin-7 and any other gene identified in FIG. 10.
[0196] For example, analysis of the expression level or pattern of
such a polypeptide or nucleic acid, e.g., cell surface markers,
genomic DNA, mRNA, or microRNA, may result in a diagnosis or
prognosis of cancer.
[0197] In some embodiments, cDNAs, which are reverse transcribed
from mRNAs obtained from fetal or maternal cells, are tagged and
sequenced. The type and abundance of the cDNAs can be used to
determine whether a cell is a fetal cell (such as by the presence
of Y chromosome specific transcripts) or whether the fetal cell has
a genetic abnormality (such as anueploidy, or problems with DNA
methylation or imprinting).
[0198] In some embodiments, analysis step 604 involves identifying
cells from a mixed sample that express genes which are not
expressed in the non-rare cells (e.g. EGFR or EpCAM). For example,
an important indicator for circulating tumor cells is the
presence/expression of EGFR or EGF at high levels wherein
non-cancerous epithelial cells will express EGFR or EGF at smaller
amounts if at all.
[0199] In addition, for lung cancer and other cancers, the presence
or absence of certain mutations in EGFR can be associated with
diagnosis and/or prognosis of the cancer as well and can also be
used to select a more effective treatment (see, e.g., International
Publication WO 2005/094357). For example, many non-small cell lung
tumors with EGFR mutations respond to small molecule EGFR
inhibitors, such as gefitinib (Iressa; AstraZeneca), but often
eventually acquire secondary mutations that make them drug
resistant. In some embodiments, one can determine a therapy
treatment for a patient by enriching epithelial cells and/or CTC's
using the methods herein, splitting sample of cells (preferably so
no more than 1 CTC is in a discrete location), and detecting one or
more mutations in the EGFR gene of such cells. Exemplary mutations
that can be analyzed include those clustered around the ATP-binding
pocket of the EGFR TK domain, which are known to make cells
susceptible to gefitinib inhibition. Thus, presence of such
mutations supports a diagnosis of cancer that is likely to respond
to treatment using gefitinib.
[0200] Many patients who respond to gefitinib eventually develop a
second mutation, often a methionine-to-threonine substitution at
position 790 in exon 20 of the TK domain. This type of mutation
renders such patients resistant to gefitinib. Therefore, the
present invention contemplates testing for this mutation as well to
provide further diagnostic information.
[0201] Since many EGFR mutations, including all EGFR mutations in
NSC lung cancer reported to date that are known to confer
sensitivity or resistance to gefitinib, lie within the coding
regions of exons 18 to 21, this region of the EGFR gene may be
emphasized in the development of assays for the presence of
mutations. Examples of primers that can be used to detect mutations
in EGFR include those listed in FIG. 11.
[0202] In step 605, a determination is made as to the condition of
a patient based on analysis made above. In some cases the patient
can be diagnosed with cancer or lack thereof. In some cases, the
patient can be prognosed with a particular type of cancer. In cases
where the patient has cancer, therapy may be determined based on
the types of mutations detected.
[0203] In another embodiment, cancer cells may be detected in a
mixed sample (e.g. circulating tumor cells and circulating normal
cells) using one or more of the sequencing methods described
herein. Briefly, RNA is extracted from cells in each location and
converted to cDNA as described above. Target genes are then
amplified and high throughput ultra deep sequencing is performed to
detect a mutation expression level associated with cancer.
[0204] VI. Computer Executable Logic
[0205] Any of the steps herein can be performed using computer
program product that comprises a computer executable logic recorded
on a computer readable medium. For example, the computer program
can use data from target genomic DNA regions to determine the
presence or absence of fetal cells in a sample and to determine
fetal abnormalit(ies) in cells detected. In some embodiments,
computer executable logic uses data input on STR or SNP intensities
to determine the presence of fetal cells in a test sample and
determine fetal abnormalities and/or conditions in said cells.
[0206] The computer program may be specially designed and
configured to support and execute some or all of the functions for
determining the presence of rare cells such as fetal cells or
epithelial/CTC's in a mixed sample and abnormalities and/or
conditions associated with such rare cells or their DNA including
the acts of (i) controlling the splitting or sorting of cells or
DNA into discrete locations (ii) amplifying one or more regions of
genomic DNA e.g. trisomic region(s) and non-trisomic region(s)
(particularly DNA polymorphisms such as STR and SNP) in cells from
a mixed sample and optionally control sample, (iii) receiving data
from the one or more genomic DNA regions analyzed (e.g. sequencing
or genotyping data); (iv) identifying bins with rare (e.g.
non-maternal) alleles, (v) identifying bins with rare (e.g.
non-maternal) alleles as bins containing fetal cells or epithelial
cells, (vi) determining number of rare cells (e.g. fetal cells or
epithelial cells) in the mixed sample, (vii) detecting the levels
of maternal and non-maternal alleles in identified fetal cells,
(viii) detecting a fetal abnormality or condition in said fetal
cells and/or (ix) detecting a neoplastic condition and information
concerning such condition such as its prevalence, origin,
susceptibility to drug treatment(s), etc. In particular, the
program can fit data of the quantity of allele abundance for each
polymorphism into one or more data models. One example of a data
model provides for a determination of the presence or absence of
aneuploidy using data of amplified polymorphisms present at loci in
DNA from samples that are highly enriched for fetal cells. The
determination of presence of fetal cells in the mixed sample and
fetal abnormalities and/or conditions in said cells can be made by
the computer program or by a user.
[0207] In one example, let `f` be the fetal/maternal DNA copy ratio
in a particular PCR reaction. Trisomy increases the ratio of
maternal to paternal alleles by a factor 1+f/2. PCR efficiencies
vary from allele to allele within a locus by a mean square error in
the logarithm given by .sigma..sub.allele.sup.2, and vary from
locus to locus by .sigma..sub.locus.sup.2, where this second
variance is apt to be larger due to differences in primer
efficiency. N.sub.a is the loci per suspected aneuploid chromosome
and N.sub.c is the control loci. If the mean of the two maternal
allele strengths at any locus is `m` and the paternal allele
strength is then the squared error expected is the mean of the
ln(ratio(m/p)), where this mean is taken over N loci is given by
2(.sigma..sub.allele.sup.2)/N. When taking the difference of this
mean of ln(ratio(m/p)) between a suspected aneuploidy region and a
control region, the error in the difference is given by
.sigma..sub.diff.sup.2=2(.sigma..sub.allele.sup.2)/N.sub.a+2(.sigma..sub-
.allele.sup.2)/N.sub.c (1)
[0208] For a robust detection of aneuploidy we require
3.sigma..sub.diff<f/2.
[0209] For simplicity, assuming N.sub.a=N.sub.c=N in Equation 1,
this gives the requirement
6.sigma..sub.allele/N.sup.1/2<f/2, (3)
or a minimum N of
N=144(.sigma..sub.allele/f).sup.2 (4)
[0210] In the context of trisomy detection, the suspected
aneuploidy region is usually the entire chromosome and N denotes
the number of loci per chromosome. For reference, Equation 3 is
evaluated for N in Table 2 for various values of .sigma..sub.allele
and f.
[0211] The role of the sequencing is to measure the allele
abundances output from the amplification step. It is desirable to
do this without adding significantly more error due to the Poisson
statistics of selecting only a finite number of amplicons for
sequencing. The rms error in the ln(abundance) due to Poisson
statistics is approximately (N.sub.reads).sup.-1/2. It is desirable
to keep this value less than or equal to the PCR error
.sigma..sub.allele. Thus, a typical paternal allele needs to be
allocated at least (.sigma..sub.allele).sup.-2 reads. The maternal
alleles, being more abundant, do not add appreciably to this error
when forming the ratio estimate for m/p. The mixture input to
sequencing contains amplicons from N.sub.loci loci of which roughly
an abundance fraction f/2 are paternal alleles. Thus, the total
required number of reads for each of the aliquot wells is given
approximately by 2N.sub.loci/(f.sigma..sub.allele.sup.2). Combining
this result with Equation 4, it is found a total number of reads
over all the wells given approximately by
N.sub.reads=288N.sub.wellsf.sup.-3. Thus, the program can determine
the total number of reads that need to be obtained for determining
the presence or absence of aneuploidy in a patient sample.
[0212] The computer program can work in any computer that may be
any of a variety of types of general-purpose computers such as a
personal computer, network server, workstation, or other computer
platform now or later developed. In some embodiments, a computer
program product is described comprising a computer usable medium
having the computer executable logic (computer software program,
including program code) stored therein. The computer executable
logic can be executed by a processor, causing the processor to
perform functions described herein. In other embodiments, some
functions are implemented primarily in hardware using, for example,
a hardware state machine. Implementation of the hardware state
machine so as to perform the functions described herein will be
apparent to those skilled in the relevant arts.
[0213] In one embodiment, the computer executing the computer logic
of the invention may also include a digital input device such as a
scanner. The digital input device can provide an image of the
target genomic DNA regions (e.g. DNA polymorphism, preferably STRs
or SNPs) according to method of the invention. For instance, the
scanner can provide an image by detecting fluorescent, radioactive,
or other emissions; by detecting transmitted, reflected, or
scattered radiation; by detecting electromagnetic properties or
characteristics; or by other techniques. Various detection schemes
are employed depending on the type of emissions and other factors.
The data typically are stored in a memory device, such as the
system memory described above, in the form of a data file.
[0214] In one embodiment, the scanner may identify one or more
labeled targets. For instance, in the genotyping analysis described
herein a first DNA polymorphism may be labeled with a first dye
that fluoresces at a particular characteristic frequency, or narrow
band of frequencies, in response to an excitation source of a
particular frequency. A second DNA polymorphisms may be labeled
with a second dye that fluoresces at a different characteristic
frequency. The excitation sources for the second dye may, but need
not, have a different excitation frequency than the source that
excites the first dye, e.g., the excitation sources could be the
same, or different, lasers.
[0215] In one embodiment, a human being may inspect a printed or
displayed image constructed from the data in an image file and may
identify the data (e.g. fluorescence from microarray) that are
suitable for analysis according to the method of the invention. In
another embodiment, the information is provided in an automated,
quantifiable, and repeatable way that is compatible with various
image processing and/or analysis techniques.
[0216] Another aspect of the invention is kits which permit the
enrichment and analysis of the rare cells present in small
qualities in the samples. Such kits may include any materials or
combination of materials described for the individual steps or the
combination of steps ranging from the enrichment through the
genetic analysis of the genomic material. Thus, the kits may
include the arrays used for size-based separation or enrichment,
labels for uniquely labeling each cell, the devices utilized for
splitting the cells into individual addressable locations and the
reagents for the genetic analysis. For example, a kit might contain
the arrays for size-based separation, unique labels for the cells
and reagents for detecting polymorphisms including STRs or SNPs,
such as reagents for performing PCR.
[0217] While preferred embodiments of the present invention have
been shown and described herein, it will be obvious to those
skilled in the art that such embodiments are provided by way of
example only. Numerous variations, changes, and substitutions will
now occur to those skilled in the art without departing from the
invention. It should be understood that various alternatives to the
embodiments of the invention described herein may be employed in
practicing the invention. It is intended that the following claims
define the scope of the invention and that methods and structures
within the scope of these claims and their equivalents be covered
thereby.
EXAMPLES
Example 1
Separation of Fetal Cord Blood
[0218] FIG. 1E shows a schematic of the device used to separate
nucleated cells from fetal cord blood.
[0219] Dimensions: 100 mm.times.28 mm.times.1 mm
[0220] Array design: 3 stages, gap size=18, 12 and 8 .mu.m for the
first, second and third stage, respectively.
[0221] Device fabrication: The arrays and channels were fabricated
in silicon using standard photolithography and deep silicon
reactive etching techniques. The etch depth is 140 .mu.m. Through
holes for fluid access are made using KOH wet etching. The silicon
substrate was sealed on the etched face to form enclosed fluidic
channels using a blood compatible pressure sensitive adhesive
(9795, 3M, St Paul, Minn.).
[0222] Device packaging: The device was mechanically mated to a
plastic manifold with external fluidic reservoirs to deliver blood
and buffer to the device and extract the generated fractions.
[0223] Device operation: An external pressure source was used to
apply a pressure of 2.0 PSI to the buffer and blood reservoirs to
modulate fluidic delivery and extraction from the packaged
device.
[0224] Experimental conditions: Human fetal cord blood was drawn
into phosphate buffered saline containing Acid Citrate Dextrose
anticoagulants. 1 mL of blood was processed at 3 mL/hr using the
device described above at room temperature and within 48 hrs of
draw. Nucleated cells from the blood were separated from enucleated
cells (red blood cells and platelets), and plasma delivered into a
buffer stream of calcium and magnesium-free Dulbecco's Phosphate
Buffered Saline (14190-144, Invitrogen, Carlsbad, Calif.)
containing 1% Bovine Serum Albumin (BSA) (A8412-100ML,
Sigma-Aldrich, St Louis, Mo.) and 2 mM EDTA (15575-020, Invitrogen,
Carlsbad, Calif.).
[0225] Measurement techniques: Cell smears of the product and waste
fractions (FIG. 12A-12B) were prepared and stained with modified
Wright-Giemsa (WG16, Sigma Aldrich, St. Louis, Mo.).
[0226] Performance: Fetal nucleated red blood cells were observed
in the product fraction (FIG. 12A) and absent from the waste
fraction (FIG. 12B).
Example 2
Isolation of Fetal Cells from Maternal Blood
[0227] The device and process described in detail in Example 1 were
used in combination with immunomagnetic affinity enrichment
techniques to demonstrate the feasibility of isolating fetal cells
from maternal blood.
[0228] Experimental conditions: blood from consenting maternal
donors carrying male fetuses was collected into K.sub.2EDTA
vacutainers (366643, Becton Dickinson, Franklin Lakes, N.J.)
immediately following elective termination of pregnancy. The
undiluted blood was processed using the device described in Example
1 at room temperature and within 9 his of draw. Nucleated cells
from the blood were separated from enucleated cells (red blood
cells and platelets), and plasma delivered into a buffer stream of
calcium and magnesium-free Dulbecco's Phosphate Buffered Saline
(14190-144, Invitrogen, Carlsbad, Calif.) containing 1% Bovine
Serum Albumin (BSA) (A8412-100mL, Sigma-Aldrich, St Louis, Mo.).
Subsequently, the nucleated cell fraction was labeled with
anti-CD71 microbeads (130-046-201, Miltenyi Biotech Inc., Auburn,
Calif.) and enriched using the MiniMACS.TM. MS column (130-042-201,
Miltenyi Biotech Inc., Auburn, Calif.) according to the
manufacturer's specifications. Finally, the CD71-positive fraction
was spotted onto glass slides.
[0229] Measurement techniques: Spotted slides were stained using
fluorescence in situ hybridization (FISH) techniques according to
the manufacturer's specifications using Vysis probes (Abbott
Laboratories, Downer's Grove, Ill.). Samples were stained from the
presence of X and Y chromosomes. In one case, a sample prepared
from a known Trisomy 21 pregnancy was also stained for chromosome
21.
[0230] Performance: Isolation of fetal cells was confirmed by the
reliable presence of male cells in the CD71-positive population
prepared from the nucleated cell fractions (FIGS. 13A-13F). In the
single abnormal case tested, the trisomy 21 pathology was also
identified (FIG. 14).
Example 3
Confirmation of the Presence of Male Fetal Cells in Enriched
Samples
[0231] Confirmation of the presence of a male fetal cell in an
enriched sample is performed using qPCR with primers specific for
DYZ, a marker repeated in high copy number on the Y chromosome.
After enrichment of fnRBC by any of the methods described herein,
the resulting enriched fnRBC are binned by dividing the sample into
100 PCR wells. Prior to binning, enriched samples may be screened
by FISH to determine the presence of any fnRBC containing an
aneuploidy of interest. Because of the low number of fnRBC in
maternal blood, only a portion of the wells will contain a single
fnRBC (the other wells are expected to be negative for fnRBC). The
cells are fixed in 2% Paraformaldehyde and stored at 4.degree. C.
Cells in each bin are pelleted and resuspended in 5 .mu.l PBS plus
1 .mu.l 20 mg/ml Proteinase K (Sigma #P-2308). Cells are lysed by
incubation at 65.degree. C. for 60 minutes followed by inactivation
of the Proteinase K by incubation for 15 minutes at 95.degree. C.
For each reaction, primer sets (DYZ forward primer
TCGAGTGCATTCCATTCCG; DYZ reverse primer ATGGAATGGCATCAAACGGAA; and
DYZ Taqman Probe 6FAM-TGGCTGTCCATTCCA-MGBNFQ), TaqMan Universal PCR
master mix, No AmpErase and water are added. The samples are run
and analysis is performed on an ABI 7300: 2 minutes at 50.degree.
C., 10 minutes 95.degree. C. followed by 40 cycles of 95.degree. C.
(15 seconds) and 60.degree. C. (1 minute). Following confirmation
of the presence of male fetal cells, further analysis of bins
containing fnRBC is performed. Positive bins may be pooled prior to
further analysis.
[0232] FIG. 30 shows the results expected from such an experiment.
The data in FIG. 30 was collected by the following protocol.
Nucleated red blood cells were enriched from cord cell blood of a
male fetus by sucrose gradient two Heme Extractions (HE). The cells
were fixed in 2% paraformaldehyde and stored at 4.degree. C.
Approximately 10.times.1000 cells were pelleted and resuspended
each in 5 .mu.l PBS plus 1 .mu.l 20 mg/ml Proteinase K (Sigma
#P-2308). Cells were lysed by incubation at 65.degree. C. for 60
minutes followed by a inactivation of the Proteinase K by 15 minute
at 95.degree. C. Cells were combined and serially diluted 10-fold
in PBS for 100, 10 and 1 cell per 6 .mu.l final concentration were
obtained. Six .mu.l of each dilution was assayed in quadruplicate
in 96 well format. For each reaction, primer sets (0.9 uM DYZ
forward primer TCGAGTGCATTCCATTCCG; 0.9 uM DYZ reverse primer
ATGGAATGGCATCAAACGGAA; and 0.5 uM DYZ TaqMan. Probe
6FAM-TGGCTGTCCATTCCA-MGBNFQ), TaqMan Universal PCR master mix, No
AmpErase and water were added to a final volume of 25 it per
reaction. Plates were run and analyzed on an ABI 7300: 2 minutes at
50.degree. C., 10 minutes 95.degree. C. followed by 40 cycles of
95.degree. C. (15 seconds) and 60.degree. C. (1 minute). These
results show that detection of a single fnRBC in a bin is possible
using this method.
Example 4
Confirmation of the Presence of Fetal Cells in Enriched Samples by
STR Analysis
[0233] Maternal blood is processed through a size-based separation
module, with or without subsequent MHEM enhancement of fnRBCs. The
enhanced sample is then subjected to FISH analysis using probes
specific to the aneuploidy of interest (e.g., trisomy 13, trisomy
18, and XYY). Individual positive cells are isolated by "plucking"
individual positive cells from the enhanced sample using standard
micromanipulation techniques. Using a nested PCR protocol, STR
marker sets are amplified and analyzed to confirm that the
FISH-positive aneuploid cell(s) are of fetal origin. For this
analysis, comparison to the maternal genotype is typical. An
example of a potential resulting data set is shown in Table 3.
Non-maternal alleles may be proven to be paternal alleles by
paternal genotyping or genotyping of known fetal tissue samples. As
can be seen, the presence of paternal alleles in the resulting
cells, demonstrates that the cell is of fetal origin (cells #1, 2,
9, and 10). Positive cells may be pooled for further analysis to
diagnose aneuploidy of the fetus, or may be further analyzed
individually.
TABLE-US-00003 TABLE 3 STR locus alleles in maternal and fetal
cells STR STR STR STR STR locus locus locus locus locus DNA Source
D14S D16S D8S F13B vWA Maternal alleles 14, 17 11, 12 12, 14 9, 9
16, 17 Cell #1 alleles 8 19 Cell #2 alleles 17 15 Cell #3 alleles
14 Cell #4 alleles Cell #5 alleles 17 12 9 Cell #6 alleles Cell #7
alleles 19 Cell #8 alleles Cell #9 alleles 17 14 7, 9 17, 19 Cell
#10 alleles 15
Example 5
Confirmation of the Presence of Fetal Cells in Enriched Samples by
SNP Analysis
[0234] Maternal blood is processed through a size-based separation
module, with or without subsequent MHEM enhancement of fnRBCs. The
enhanced sample is then subjected to FISH analysis using probes
specific to the aneuploidy of interest (e.g., triploidy 13,
triploidy 18, and XYY). Samples testing positive with FISH analysis
are then binned into 96 microtiter wells, each well containing 15
.mu.l of the enhanced sample. Of the 96 wells, 5-10 are expected to
contain a single fnRBC and each well should contain approximately
1000 nucleated maternal cells (both WBC and mnRBC). Cells are
pelleted and resuspended in 5 .mu.l PBS plus 1 .mu.l 20 mg/ml
Proteinase K (Sigma #P-2308). Cells are lysed by incubation at
65.degree. C. for 60 minutes followed by a inactivation of the
Proteinase K by 15 minute at 95.degree. C.
[0235] In this example, the maternal genotype (BB) and fetal
genotype (AB) for a particular set of SNPs is known. The genotypes
A and B encompass all three SNPs and differ from each other at all
three SNPs. The following sequence from chromosome 7 contains these
three SNPs (rs7795605, rs7795611 and rs7795233 indicated in
brackets, respectively):
(ATGCAGCAAGGCACAGACTAA[G/A]CAAGGAGA[G/C]GCAAAATTTTC[A/G]TAGGGGAGAGAAATGGG-
TCAT T).
[0236] In the first round of PCR, genomic DNA from binned enriched
cells is amplified using primers specific to the outer portion of
the fetal-specific allele A and which flank the interior SNP
(forward primer ATGCAGCAAGGCACAGACTACG; reverse primer
AGAGGGGAGAGAAATGGGTCATT). In the second round of PCR, amplification
using real time SYBR Green PCR is performed with primers specific
to the inner portion of allele A and which encompass the interior
SNP (forward primer CAAGGCACAGACTAAGCAAGGAGAG; reverse primer
GGCAAAATTTTCATAGGGGAGAGAAATGGGTCATT).
[0237] Expected results are shown in FIG. 31. Here, six of the 96
wells test positive for allele A, confirming the presence of cells
of fetal origin, because the maternal genotype (BB) is known and
cannot be positive for allele A. DNA from positive wells may be
pooled for further analysis or analyzed individually.
Example 6
Quantitative Genotyping Using Molecular Inversion Probes for
Trisomy Diagnosis on Fetal Cells
[0238] Fetal cells or nuclei can be isolated as described in the
enrichment section or as described in example 1. Quantitative
genotyping can then be used to detect chromosome copy number
changes. FIG. 5 depicts a flow chart depicting the major steps
involved in detecting chromosome copy number changes using the
methods described herein. For example, the enrichment process
described in example 1 may generate a final mixture containing
approximately 500 maternal white blood cells (WBCs), approximately
100 maternal nuclear red blood cells (mnBCs), and a minimum of
approximately 10 fetal nucleated red blood cells (fnRBCs) starting
from an initial 20 ml blood sample taken late in the first
trimester. The output of the enrichment procedure would be divided
into separate wells of a microtiter plate with the number of wells
chosen so no more than one cell or genome copy is located per well,
and where some wells may have no cell or genome copy at all.
[0239] Perform multiplex PCR and nested PCR: PCR primer pairs for
multiple (40-100) highly polymorphic SNPs can then be added to each
well in the microtiter plate. For example, SNPs primers can be
designed along chromosomes 13, 18, 21 and X to detect the most
frequent aneuploidies, and along control regions of the genome
where aneuploidy is not expected. Multiple (.about.10) SNPs would
be designed for each chromosome of interest to allow for
non-informative genotypes and to ensure accurate results. The SNPs
listed in the Table below can be used to performed analysis and
associated PCR primers can be designed as described below.
TABLE-US-00004 SNPs that can be used for fetal cell analysis
Chromosome 13 Chromosome 18 Chromosome 21 Chromosome X refSNP
rs9510053 refSNP rs584853 refSNP rs469000 refSNP rs6608727 refSNP
rs7339372 refSNP rs2345588 refSNP rs7278903 refSNP rs2015487 refSNP
rs9580269 refSNP rs9973072 refSNP rs1004044 refSNP rs5953330 refSNP
rs724946 refSNP rs7504787 refSNP rs11910419 refSNP rs5953330 refSNP
rs11842845 refSNP rs4303617 refSNP rs2832890 refSNP rs1984695
refSNP rs7490040 refSNP rs9947441 refSNP rs1785477 refSNP rs5906775
refSNP rs12430585 refSNP rs2912334 refSNP rs2250226 refSNP
rs5951325 refSNP rs713280 refSNP rs11659665 refSNP rs2243594 refSNP
rs11798710 refSNP rs202090 refSNP rs8098249 refSNP rs10483087
refSNP rs4898352 refSNP rs5000966 refSNP rs12968582 refSNP rs855262
refSNP rs5987079
[0240] PCR primers would be chosen to be multiplexible with other
pairs (fairly uniform melting temperature, absence of cross-priming
on the human genome, and absence of primer-primer interaction based
on sequence analysis). The primers would be designed to generate
amplicons 70-100 bp in size to increase the performance of the
multiplex PCR. The primers would contain a 22 bp tag on the 5'
which is used in the genotyping analysis. Multiplex PCR protocols
can be performed as described in Findlay et al. Molecular Cell
Endocrinology 183 (2001) S5-S12. Primer concentrations can vary
from 0.7 pmoles to 60 pmoles per reaction. Briefly, PCRs are
performed in a total volume of 25 .mu.A per well, Taq polymerase
buffer (Perkin-Elmer), 200 .mu.M dNTPs, primer, 1.5 mM MgCl2 and
0.6 units AmpliTaq (Perkin-Elmer). After denaturation at 95.degree.
C. for 5 min, 41 cycles at 94, 60 and 72.degree. C. for 45 s are
performed in a MJ DNA engine thermal cycler. The amplification can
be run with an annealing temperature different that 60.degree. C.
depending on the primer pair being amplified. Final extension can
be for 10 min.
[0241] A second of round of PCR using nested primers may be
performed to ensure optimal performance of the multiplex
amplification. Two ul aliquot of each PCR reaction is diluted 40
fold (to 80 ul total) with nuclease free water from the PCR kit. A
no template or negative control is generated to test for
contamination. The amplification with the nested PCR primers is run
with an annealing temperature of 60.degree. C.-68.degree. C.
depending on the primer pair being amplified.
TABLE-US-00005 Nested PCR cycle Step Temp (C.) Time (mins) 1.0 95
0.5 2.0 94 0.5 3.0 X 1.5 4.0 72 1.5 5.0 cycle to step 2, 44 times
6.0 72 10
TABLE-US-00006 Master mix for nested primers 1 rxn 9 rxns 2X Q Mix
12.5 112.5 titanium 0.5 4.5 Q 2.5 22.5 water 3.3 29.3 5 uM primers
1.3 40X diluted template 5.0 45.0 25.0 213.8
[0242] Genotyping using MIP technology with bin specific tags: The
Molecular Inversion Probe (MIP) technology developed by Affymetrix
(Santa Clara, Calif.) can genotype 20,000 SNPs or more in a single
reaction. In the typical MIP assay, each SNP would be assigned a 22
bp DNA tag which allows the SNP to be uniquely identified during
the highly parallel genotyping assay. In this example, the DNA tags
serve two roles: (1) determine the identity of the different SNPs
and (2) determine the identity of the well from which the genotype
was derived. For example, a total of 20,000 tags would be required
to genotype the same 40 SNPs in 500 wells different wells (4
chromosomes.times.10 SNPs.times.500 wells)
[0243] The tagged MIP probes would be combined with the amplicons
from the initial multiplex single-cell PCR (or nested PCR) and the
genotyping reactions would be performed. The probe/template mix
would be divided into 4 tubes each containing a different
nucleotide (e.g. G, A, T or C). Following an extension and ligation
step, the mixture would be treated with exonuclease to remove all
linear molecules and the tags of the surviving circular molecules
would be amplified using PCR. The amplified tags form all of the
bins would then be pooled and hybridized to a single DNA microarray
containing the complementary sequences to each of the 20,000
tags.
[0244] Identify bins with non-maternal alleles (e.g. fetal cells):
The first step in the data analysis procedure would be to use the
22 bp tags to sort the 20,000 genotypes into bins which correspond
to the individual wells of the original microtiter plates, The
second step would be to identify bins contain non-maternal alleles
which correspond to wells that contained fetal cells. Determining
the number bins with non-maternal alleles relative to the total
number of bins would provide an accurate estimate of the number of
fnRBCs that were present in the original enriched cell population.
When a fetal cell is identified in a given bin, the non-maternal
alleles would be detected by 40 independent SNPs which provide an
extremely high level of confidence in the result.
[0245] Detect ploidy for chromosomes 13, 18, and 21: After
identifying approximately 10 bins that contain fetal cells, the
next step would be to determine the ploidy of chromosomes 13, 18,
21 and X by comparing ratio of maternal to paternal alleles for
each of the 10 SNPs on each chromosome. The ratios for the multiple
SNPs on each chromosome can be combined (averaged) to increase the
confidence of the aneuploidy call for that chromosome. In addition,
the information from the approximate 10 independent bins containing
fetal cells can also be combined to further increase the confidence
of the call.
Example 7
Ultra-Deep Sequencing for Trisomy Diagnosis on Fetal Cells
[0246] Fetal cells or nuclei can be isolated as described in the
enrichment section or as described in example 1. The enrichment
process described in example 1 may generate a final mixture
containing approximately 500 maternal white blood cells (WBCs),
approximately 100 maternal nuclear red blood cells (mnBCs), and a
minimum of approximately 10 fetal nucleated red blood cells
(fnRBCs) starting from an initial 20 ml blood sample taken late in
the first trimester. The output of the enrichment procedure would
be divided into separate wells of a microliter plate with the
number of wells chosen so no more than one cell or genome copy is
located per well, and where some wells may have no cell or genome
copy at all.
[0247] Perform multiplex PCR and Ultra-Deep Sequencing with bin
specific tags: PCR primer pairs for highly polymorphic STR loci
(multiple loci per chromosome of interest) are then added to each
well in the microliter plate. The polymorphic STRs listed in the
Table below can be used to performed analysis and associated PCR
primers can be designed.
TABLE-US-00007 STR loci that can be used for fetal cell analysis
CHROMOSOME MARKER LOCATION D21S1414 21q21 MBP 18q23-ter D13S634
13q14.3-22 D13S631 13q31-32 D18S535 18q12.2-12.3 D21S1412
21(S171-S198) D21S1411 21q22.3 D21S11 21q21 D18S386 18q22.1-18q22.2
D13S258 13q21.2-13q31 D13S303 13q22-13q31 D18S1002 18q11
[0248] The primers for each STR will have two important features.
First, each of the primers will contain a common .about.18 bp
sequence on the 5' end which is used for the subsequent DNA cloning
and sequencing procedures. Second, each well in the microliter
plate is assigned a unique .about.6 bp DNA tag sequence which is
incorporated into the middle part of the upstream primer for each
of the different STRs. The DNA tags make it possible to pool all of
the STR amplicons following the multiplex PCR which makes it
possible to analyze the amplicons in parallel more cost effectively
during the ultra-deep sequencing procedure. DNA tags of length
.about.6 bp provide a compromise between information content (4096
potential bins) and the cost of synthesizing primers.
[0249] Multiplex PCR protocols can be performed as described in
Findlay et al. Molecular Cell Endocrinology 183 (2001) S5-S12.
Primer concentrations can vary from 0.7 pmoles to 60 pmoles per
reaction. Briefly, PCRs are performed in a total volume of 25 .mu.l
per well, Taq polymerase buffer (Perkin-Elmer), 200 .mu.M dNTPs,
primer, 1.5 mM MgCl2 and 0.6 units AmpliTaq (Perkin-Elmer). After
denaturation at 95.degree. C. for 5 min, 41 cycles at 94, 60 and
72.degree. C. for 45 s are performed in a MJ DNA engine thermal
cycler. The amplification can be run with an annealing temperature
different that 60.degree. C. depending on the primer pair being
amplified. Final extension can be for 10 min.
[0250] Following PCR, the amplicons from each of the wells in the
microtiter plate are pooled, purified and analyzed using a
single-molecule sequencing strategy as described in Margulies et
al. Nature 437 (2005) 376-380. Briefly, the amplicons are diluted
and mixed with beads such that each bead captures a single molecule
of the amplified material. The DNA-carrying beads are isolated in
separate 100 um aqueous droplets made through the creation of a
PCR-reation-mixture-in-oil emulsion. The DNA molecule on each bead
is then amplified to generate millions of copies of the sequence,
which all remain bound to the bead. Finally, the beads are placed
into a highly parallel sequencing-by-synthesis machine which can
generate over 400,000 sequence reads (.about.100 bp per read) in a
single 4 hour run.
[0251] Ultra-deep sequencing provides an accurate and quantitative
way to measure the allele abundances for each of the STRs. The
total required number of reads for each of the aliquot wells is
determined by the number of STRs and the error rates of the
multiplex PCR and the Poisson sampling statistics associated with
the sequencing procedures. Statistical models which may account for
variables in amplification can be used to detect ploidy changes
with high levels of confidence. Using this statistical model it can
be predicted that .about.100,000 to 300,000 sequence reads will be
required to analyze each patient, with .about.3 to 10 STR loci per
chromosome. Specifically, .about.33 reads for each of 12 STRs in
each of the individual wells of the microtiter plate will be read
(33 reads.times.12 STRs per well.times.500 wells=200,000
reads).
[0252] Identify bins with non-maternal alleles (e.g. fetal cells):
The first step in the data analysis procedure would be to use the 6
bp DNA tags to sort the 200,000 sequence reads into bins which
correspond to the individual wells of the microtiter plates. The
.about.400 sequence reads from each of the bins would then be
separated into the different STR groups using standard sequence
alignment algorithms. The aligned sequences from each of the bins
would then be analyzed to identify non-maternal alleles. These can
be identified in one of two ways. First, an independent blood
sample fraction known to contain only maternal cells can be
analyzed as described above. This sample can be a white blood cell
fraction (which will contain only negligible numbers of fetal
cells), or simply a dilution of the original sample before
enrichment. Alternatively, the genotype profiles for all the wells
can be similarity-clustered to identify the dominant pattern
associated with maternal cells. In either approach, the detection
of non-maternal alleles then determines which wells in the initial
microtiter plate contained fetal cells. Determining the number bins
with non-maternal alleles relative to the total number of bins
provides an estimate of the number of fetal cells that were present
in the original enriched cell population. Bins containing fetal
cells would be identified with high levels of confidence because
the non-maternal alleles are detected by multiple independent
STRs.
[0253] Detect ploidy for chromosomes 13, 18, and 21: After
identifying the bins that contained fetal cells, the next step
would be to determine the ploidy of chromosomes 13, 18 and 21 bp
comparing the ratio of maternal to paternal alleles for each of the
STRs. Again, for each bin there will be .about.33 sequence reads
for each of the 12 STRs. In a normal fetus, a given STR will have
1:1 ratio of the maternal to paternal alleles with approximately 16
sequence reads corresponding to each allele (normal diallelic). In
a trisomic fetus, three doses of an STR marker can be detected
either as three alleles with a 1:1:1 ratio (trisomic triallelic) or
two alleles with a ratio of 2:1 (trisomic diallelic). In rare
instances all three alleles may coincide and the locus will not be
informative for that individual patient. The information from the
different STRs on each chromosome can be combined to increase the
confidence of a given aneuploidy call. In addition, the information
from the independent bins containing fetal cells can also be
combined to further increase the confidence of the call.
Example 8
Sequencing for Trisomy Diagnosis on Fetal Cells
[0254] Fetal cells or nuclei can be isolated as described in the
enrichment section or as described in example 1 and 2. Sequencing
methods can then be used to detect chromosome copy number changes.
FIG. 4 depicts a flow chart depicting the major steps involved in
detecting chromosome copy number changes using the methods
described herein. For example, the enrichment process described in
example 1 may generate a final mixture containing approximately 500
maternal white blood cells (WBCs), approximately 100 maternal
nuclear red blood cells (mnBCs), and a minimum of approximately 10
fetal nucleated red blood cells (fnRBCs) starting from an initial
20 ml blood sample taken late in the first trimester. The output of
the enrichment procedure would be divided into separate wells of a
microtiter plate with the number of wells chosen so no more than
one cell or genome copy is located per well, and where some wells
may have no cell or genome copy at all.
[0255] Perform Multiplex PCR and Sequencing with Bin Specific
Tags:
[0256] PCR primer pairs for highly polymorphic STR loci (multiple
loci per chromosome of interest) can be added to each well in the
microtiter plate. For example, STRs could be designed along
chromosomes 13, 18, 21 and X to detect the most frequent
aneuploidies, and along control regions of the genome where
aneuploidy is not expected. Typically, four or more STRs should be
analyzed per chromosome of interest to ensure accurate detection of
aneuploidy.
[0257] The primers for each. STR can be designed with two important
features. First, each primer can contain a common .about.18 bp
sequence on the 5' end which can be used for the subsequent DNA
cloning and sequencing procedures. Second, each well in the
microtiter plate can be assigned a unique .about.6 bp DNA tag
sequence which can be incorporated into the middle part of the
upstream primer for each of the different STRs. The DNA tags make
it possible to pool all of the STR amplicons following the
multiplex PCR, which makes possible to analyze the amplicons in
parallel during the ultra-deep sequencing procedure. Furthermore,
nested PCR strategies for the STR amplification can achieve higher
reliability of amplification from single cells.
[0258] Sequencing can be performed using the classic Sanger
sequencing method or any other method known in the art.
[0259] For example, sequencing can occur by
sequencing-by-synthesis, which involves inferring the sequence of
the template by synthesizing a strand complementary to the target
nucleic acid sequence. Sequence-by-synthesis can be initiated using
sequencing primers complementary to the sequencing element on the
nucleic acid tags. The method involves detecting the identity of
each nucleotide immediately after (substantially real-time) or upon
(real-time) the incorporation of a labeled nucleotide or nucleotide
analog into a growing strand of a complementary nucleic acid
sequence in a polymerase reaction. After the successful
incorporation of a label nucleotide, a signal is measured and then
nulled by methods known in the art. Examples of
sequence-by-synthesis methods are described in U.S. Application
Publication Nos. 2003/0044781, 2006/0024711, 2006/0024678 and
2005/0100932. Examples of labels that can be used to label
nucleotide or nucleotide analogs for sequencing-by-synthesis
include, but are not limited to, chromophores, fluorescent
moieties, enzymes, antigens, heavy metal, magnetic probes, dyes,
phosphorescent groups, radioactive materials, chemiluminescent
moeities, scattering or fluorescent nanoparticles, Raman signal
generating moieties, and electrochemical detection moieties.
Sequencing-by-synthesis can generate at least 1,000, at least
5,000, at least 10,000, at least 20,000, 30,000, at least 40,000,
at least 50,000, at least 100,000 or at least 500,000 reads per
hour. Such reads can have at least 50, at least 60, at least 70, at
least 80, at least 90, at least 100, at least 120 or at least 150
bases per read.
[0260] Another sequencing method involves hybridizing the amplified
genomic region of interest to a primer complementary to it. This
hybridization complex is incubated with a polymerase, ATP
sulfurylase, luciferase, apyrase, and the substrates luciferin and
adenosine 5' phosphosulfate. Next, deoxynucleotide triphosphates
corresponding to the bases A, C, G, and T (U) are added
sequentially. Each base incorporation is accompanied by release of
pyrophosphate, converted to ATP by sulfurylase, which drives
synthesis of oxyluciferin and the release of visible light. Since
pyrophosphate release is equimolar with the number of incorporated
bases, the light given off is proportional to the number of
nucleotides adding in any one step. The process is repeated until
the entire sequence is determined.
[0261] Yet another sequencing method involves a four-color
sequencing by ligation scheme (degenerate ligation), which involves
hybridizing an anchor primer to one of four positions. Then an
enzymatic ligation reaction of the anchor primer to a population of
degenerate nonamers that are labeled with fluorescent dyes is
performed. At any given cycle, the population of nonamers that is
used is structure such that the identity of one of its positions is
correlated with the identity of the fluorophore attached to that
nonamer. To the extent that the ligase discriminates for
complementarily at that queried position, the fluorescent signal
allows the inference of the identity of the base. After performing
the ligation and four-color imaging, the anchor primer:nonamer
complexes are stripped and a new cycle begins.
[0262] Identify bins with non-maternal alleles (e.g. fetal cells):
The first step in the data analysis procedure would be to use the 6
bp DNA tags to sort the 200,000 sequence reads into bins which
correspond to the individual wells of the microtiter plates. The
.about.400 sequence reads from each of the bins would then be
separated into the different STR groups using standard sequence
alignment algorithms. The aligned sequences from each of the bins
would then be analyzed to identify non-maternal alleles. These can
be identified in one of two ways. First, an independent blood
sample fraction known to contain only maternal cells can be
analyzed as described above. This sample can be a white blood cell
fraction (which will contain only negligible numbers of fetal
cells), or simply a dilution of the original sample before
enrichment. Alternatively, the genotype profiles for all the wells
can be similarity-clustered to identify the dominant pattern
associated with maternal cells. In either approach, the detection
of non-maternal alleles then determines which wells in the initial
microtiter plate contained fetal cells. Determining the number bins
with non-maternal alleles relative to the total number of bins
provides an estimate of the number of fetal cells that were present
in the original enriched cell population. Bins containing fetal
cells would be identified with high levels of confidence because
the non-maternal alleles are detected by multiple independent
STRs.
[0263] Detect ploidy for chromosomes 13, 18, and 21: After
identifying the bins that contained fetal cells, the next step
would be to determine the ploidy of chromosomes 13, 18 and 21 by
comparing the ratio of maternal to paternal alleles for each of the
STRs. Again, for each bin there will be .about.33 sequence reads
for each of the 12 STRs. In a normal fetus, a given STR will have
1:1 ratio of the maternal to paternal alleles with approximately 16
sequence reads corresponding to each allele (normal diallelic). In
a trisomic fetus, three doses of an STR marker can be detected
either as three alleles with a 1:1:1 ratio (trisomic triallelic) or
two alleles with a ratio of 2:1 (trisomic diallelic). In rare
instances all three alleles may coincide and the locus will not be
informative for that individual patient. The information from the
different STRs on each chromosome can be combined to increase the
confidence of a given aneuploidy call. In addition, the information
from the independent bins containing fetal cells can also be
combined to further increase the confidence of the call.
Example 9
Device Embodiment
[0264] Microfluidic devices of the invention were designed by
computer-aided design (CAD) and microfabricated by
photolithography. A two-step process was developed in which a blood
sample is first debulked to remove the large population of small
cells, and then the rare target epithelial cells target cells are
recovered by immunoaffinity capture. The devices were defined by
photolithography and etched into a silicon substrate based on the
CAD-generated design. The cell enrichment module, which is
approximately the size of a standard microscope slide, contains 14
parallel sample processing sections and associated sample handling
channels that connect to common sample and buffer inlets and
product and waste outlets. Each section contains an array of
microfabricated obstacles that is optimized to enrich the target
cell type by hydrodynamic size via displacement of the larger cells
into the product stream. In this example, the microchip was
designed to separate red blood cells (RBCs) and platelets from the
larger leukocytes and CTCs. Enriched populations of target cells
were recovered from whole blood passed through the device.
Performance of the cell enrichment microchip was evaluated by
separating RBCs and platelets from white blood cells (WBCs) in
normal whole blood (FIG. 15). In cancer patients, CTCs are found in
the larger WBC fraction. Blood was minimally diluted (30%), and a 6
ml sample was processed at a flow rate of up to 6 ml/hr. The
product and waste stream were evaluated in a Coulter Model
"A.sup.C-T diff" clinical blood analyzer, which automatically
distinguishes, sizes, and counts different blood cell populations.
The enrichment chip achieved separation of RBCs from WBCs, in which
the WBC fraction had >99% retention of nucleated cells, >99%
depletion of RBCs, and >97% depletion of platelets.
Representative histograms of these cell fractions are shown in FIG.
16. Routine cytology confirmed the high degree of enrichment of the
WBC and RBC fractions (FIG. 17).
[0265] Next, epithelial cells were recovered by affinity capture in
a microfluidic module that is functionalized with immobilized
antibody. A capture module with a single chamber containing a
regular array of antibody-coated microfabricated obstacles was
designed. These obstacles are disposed to maximize cell capture by
increasing the capture area approximately four-fold, and by slowing
the flow of cells under laminar flow adjacent to the obstacles to
increase the contact time between the cells and the immobilized
antibody. The capture modules may be operated under conditions of
relatively high flow rate but low shear to protect cells against
damage. The surface of the capture module was functionalized by
sequential treatment with 10% silane, 0.5% gluteraldehyde, and
avidin, followed by biotinylated anti-EpCAM. Active sites were
blocked with 3% bovine serum albumin in PBS, quenched with dilute
Tris HCl, and stabilized with dilute L-histidine. Modules were
washed in PBS after each stage and finally dried and stored at room
temperature. Capture performance was measured with the human
advanced lung cancer cell line NCI-H1650 (ATCC Number CRL-5883).
This cell line has a heterozygous 15 bp in-frame deletion in exon
19 of EGFR that renders it susceptible to gefitinib. Cells from
confluent cultures were harvested with trypsin, stained with the
vital dye Cell Tracker Orange (CMRA reagent, Molecular Probes,
Eugene, Oreg.), resuspended in fresh whole blood, and fractionated
in the microfluidic chip at various flow rates. In these initial
feasibility experiments, cell suspensions were processed directly
in the capture modules without prior fractionation in the cell
enrichment module to debulk the red blood cells; hence, the sample
stream contained normal blood red cells and leukocytes as well as
tumor cells. After the cells were processed in the capture module,
the device was washed with buffer at a higher flow rate (3 ml/hr)
to remove the nonspecifically bound cells. The adhesive top was
removed and the adherent cells were fixed on the chip with
paraformaldehyde and observed by fluorescence microscopy. Cell
recovery was calculated from hemacytometer counts; representative
capture results are shown in Table 4. Initial yields in
reconstitution studies with unfractionated blood were greater than
60% with less than 5% of non-specific binding.
TABLE-US-00008 TABLE 4 Run Avg. flow Length of No. cells No. cells
number rate run processed captured Yield 1 3.0 1 hr 150,000 38,012
25% 2 1.5 2 hr 150,000 30,000/ml 60% 3 1.08 2 hr 106,000 68 661 64%
4 1.21 2 hr 121 000 75 4 1 62% indicates data missing or illegible
when filed
[0266] Next, NCI-H1650 cells that were spiked into whole blood and
recovered by size fractionation and affinity capture as described
above were successfully analyzed in situ. In a trial run to
distinguish epithelial cells from leukocytes, 0.5 ml of a stock
solution of fluorescein-labeled CD45 pan-leukocyte monoclonal
antibody were passed into the capture module and incubated at room
temperature for 30 minutes. The module was washed with buffer to
remove unbound antibody, and the cells were fixed on the chip with
1% paraformaldehyde and observed by fluorescence microscopy. As
shown in FIG. 18, the epithelial cells were bound to the obstacles
and floor of the capture module. Background staining of the flow
passages with CD45 pan-leukocyte antibody is visible, as are
several stained leukocytes, apparently because of a low level of
non-specific capture.
Example 10
Device Embodiments
[0267] A design for preferred device embodiments of the invention
is shown in FIG. 19A, and parameters corresponding to three
preferred device embodiments associated with this design are shown
in FIGS. 19B and 19C. These embodiments are particularly useful for
enrich epithelial cells from blood.
Example 11
Determining Counts for Large Cell Types
[0268] Using the methods of the invention, a diagnosis of the
absence, presence, or progression of cancer may be based on the
number of cells in a cellular sample that are larger than a
particular cutoff size. For example, cells with a hydrodynamic size
of 14 microns or larger may be selected. This cutoff size would
eliminate most leukocytes. The nature of these cells may then be
determined by downstream molecular or cytological analysis.
[0269] Cell types other than epithelial cells that would be useful
to analyze include endothelial cells, endothelial progenitor cells,
endometrial cells, or trophoblasts indicative of a disease state.
Furthermore, determining separate counts for epithelial cells,
e.g., cancer cells, and other cell types, e.g., endothelial cells,
followed by a determination of the ratios between the number of
epithelial cells and the number of other cell types, may provide
useful diagnostic information.
[0270] A device of the invention may be configured to isolate
targeted subpopulations of cells such as those described above, as
shown in FIGS. 20A-D. A size cutoff may be selected such that most
native blood cells, including red blood cells, white blood cells,
and platelets, flow to waste, while non-native cells, which could
include endothelial cells, endothelial progenitor cells,
endometrial cells, or trophoblasts, are collected in an enriched
sample. This enriched sample may be further analyzed.
[0271] Using a device of the invention, therefore, it is possible
to isolate a subpopulation of cells from blood or other bodily
fluids based on size, which conveniently allows for the elimination
of a large proportion of native blood cells when large cell types
are targeted. As shown schematically in FIG. 21, a device of the
invention may include counting means to determine the number of
cells in the enriched sample, or the number of cells of a
particular type, e.g., cancer cells, within the enriched sample,
and further analysis of the cells in the enriched sample may
provide additional information that is useful for diagnostic or
other purposes.
Example 12
Method for Detection of EGFR Mutations
[0272] A blood sample from a cancer patient is processed and
analyzed using the devices and methods of the invention, resulting
in an enriched sample of epithelial cells containing CTCs. This
sample is then analyzed to identify potential EGFR mutations. The
method permits both identification of known, clinically relevant
EGFR mutations as well as discovery of novel mutations. An overview
of this process is shown in FIG. 22.
[0273] Below is an outline of the strategy for detection and
confirmation of EGFR mutations:
[0274] 1) Sequence CTC EGFR mRNA [0275] a) Purify CTCs from blood
sample; [0276] b) Purify total RNA from CTCs; [0277] c) Convert RNA
to cDNA using reverse transcriptase; [0278] d) Use resultant cDNA
to perform first and second PCR reactions for generating sequencing
templates; and [0279] e) Purify the nested PCR amplicon and use as
a sequencing template to sequence EGFR exons 18-21.
[0280] 2) Confirm RNA sequence using CTC genomic DNA [0281] a)
Purify CTCs from blood sample; [0282] b) Purify genomic DNA (gDNA)
from CTCs; [0283] c) Ampler exons 18, 19, 20, and/or 21 via PCR
reactions; and [0284] d) Use the resulting PCR amplicon(s) in
real-time quantitative allele-specific PCR reactions in order to
confirm the sequence of mutations discovered via RNA
sequencing.
[0285] Further details for each step outlined above are as
follows.
[0286] 1) Sequence CTC EGFR mRNA [0287] a) Purify CTCs from blood
sample. CTCs are isolated using any of the size-based enrichment
and/or affinity purification devices of the invention. [0288] b)
Purify total RNA from CTCs. Total RNA is then purified from
isolated CTC populations using, e.g., the Qiagen Micro RNeasy kit,
or a similar total RNA purification protocol from another
manufacturer; alternatively, standard RNA purification protocols
such as guanidium isothiocyanate homogenization followed by
phenol/chloroform extraction and ethanol precipitation may be used.
One such method is described in "Molecular Cloning--A Laboratory
Manual, Second Edition" (1989) by J. Sambrook, E. F. Fritch and T.
Maniatis, p. 7.24. [0289] c) Convert RNA to cDNA using reverse
transcriptase. cDNA reactions are carried out based on the
protocols of the supplier of reverse transcriptase. Typically, the
amount of input RNA into the cDNA reactions is in the range of 10
picograms (pg) to 2 micrograms (.mu.g) total RNA. First-strand DNA
synthesis is carried out by hybridizing random 7mer DNA primers, or
oligo-dT primers, or gene-specific primers, to RNA templates at
65.degree. C. followed by snap-chilling on ice. cDNA synthesis is
initiated by the addition of iScript Reverse Transcriptase (BioRad)
or SuperScript Reverse Transcriptase (Invitrogen) or a reverse
transcriptase from another commercial vendor along with the
appropriate enzyme reaction buffer. For iScript, reverse
transcriptase reactions are carried out at 42.degree. C. for 30-45
minutes, followed by enzyme inactivation for 5 minutes at
85.degree. C. cDNA is stored at -20.degree. C. until use or used
immediately in PCR reactions. Typically, cDNA reactions are carried
out in a final volume of 20 and 10% (2 .mu.l) of the resultant cDNA
is used in subsequent PCR reactions. [0290] d) Use resultant cDNA
to perform first and second PCR reactions for generating sequencing
templates. cDNA from the reverse transcriptase reactions is mixed
with DNA primers specific for the region of interest (FIG. 23). See
Table 5 for sets of primers that may be used for amplification of
exons 18-21. In Table 5, primer set M13(+)/M12(-) is internal to
primer set M11(+)/M14(-). Thus primers M 13(+) and M12(-) may be
used in the nested round of amplification, if primers M11(+) and
M14(-) were used in the first round of expansion. Similarly, primer
set M11(+)/M14(-) is internal to primer set M15(+)/M16(-), and
primer set M23(+)/M24(-) is internal to primer set M21(+)/M22(-).
Hot Start PCR reactions are performed using Qiagen Hot-Star Taq
Polymerase kit, or Applied Biosystems HotStart TaqMan polymerase,
or other Hot Start thermostable polymerase, or without a hot start
using Promega GoTaq Green Taq Polymerase master mix, TagMan DNA
polymerase, or other thermostable DNA polymerase. Typically,
reaction volumes are 50 .mu.l, nucleotide triphosphates are present
at a final concentration of 200 .mu.M for each nucleotide,
MgCl.sub.2 is present at a final concentration of 1-4 mM, and oligo
primers are at a final concentration of 0.5 .mu.M. Hot start
protocols begin with a 10-15 minute incubation at 95.degree. C.,
followed by 40 cycles of 94.degree. C. for one minute
(denaturation), 52.degree. C. for one minute (annealing), and
72.degree. C. for one minute (extension). A 10 minute terminal
extension at 72.degree. C. is performed before samples are stored
at 4.degree. C. until they are either used as template in the
second (nested) round of PCRs, or purified using QiaQuick Spin
Columns (Qiagen) prior to sequencing. If a hot-start protocol is
not used, the initial incubation at 95.degree. C. is omitted. If a
PCR product is to be used in a second round of PCRs, 2 .mu.l (4%)
of the initial PCR product is used as template in the second round
reactions, and the identical reagent concentrations and cycling
parameters are used.
TABLE-US-00009 [0290] TABLE 5 Primer Sets for expanding EGFR mRNA
around Exons 18-21 SEQ ID cDNA Amplicon Name NO Sequence (5' to 3')
Coordinates Size NXK-M11(+) 1 TTGCTGCTGGTGGTGGC (+) 1966-1982 813
NXK-M14(-) 2 CAGGGATTCCGTCATATGGC (-) 2778-2759 NXK-M13(+) 3
GATCGGCCTCTTCATGCG (+) 1989-2006 747 NXK M12(-) 4
GATCCAAAGGTCATCAACTCCC (-) 2735-2714 NXK-M15(+) 5
GCTGTCCAACGAATGGGC (+) 1904-1921 894 NXK-M16(-) 6
GGCGTTCTCCTTTCTCCAGG (-) 2797-2778 NXK-M21(+) 7 ATGCACTGGGCCAGGTCTT
(+) 1881-1899 944 NXK-M22(-) 8 CGATGGTACATATGGGTGGCT (-) 2824-2804
NXK-M23(+) 9 AGGCTGTCCAACGAATGGG (+) 1902-1920 904 NXK-M24(-) 10
CTGAGGGAGGCGTTCTCCT (-) 2805-2787
[0291] e) Purify the nested PCR amplicon and use as a sequencing
template to sequence EGFR exons 18-21. Sequencing is performed by
ABI automated fluorescent sequencing machines and
fluorescence-labeled DNA sequencing ladders generated via
Sanger-style sequencing reactions using fluorescent
dideoxynucleotide mixtures. PCR products are purified using Qiagen
QuickSpin columns, the Agencourt AMPure PCR Purification System, or
PCR product purification kits obtained from other vendors. After
PCR products are purified, the nucleotide concentration and purity
is determined with a Nanodrop 7000 spectrophotometer, and the PCR
product concentration is brought to a concentration of 25 ng/.mu.l.
As a quality control measure, only PCR products that have a
UV-light absorbance ratio (A.sub.260/A.sub.280) greater than 1.8
are used for sequencing. Sequencing primers are brought to a
concentration of 3.2 pmol/.mu.l.
[0292] 2) Confirm RNA sequence using CTC genomic DNA [0293] a)
Purify CTCs from blood sample. As above, CTCs are isolated using
any of the size-based enrichment and/or affinity purification
devices of the invention. [0294] b) Purify genomic DNA (gDNA) from
CTCs. Genomic DNA is purified using the Qiagen DNeasy Mini kit, the
Invitrogen ChargeSwitch gDNA kit, or another commercial kit, or via
the following protocol: [0295] 1. Cell pellets are either lysed
fresh or stored at -80.degree. C. and are thawed immediately before
lysis. [0296] 2. Add 500 .mu.l 50 mM Tris pH 7.9/100 mM EDTA/0.5%
SDS (TES buffer). [0297] 3. Add 12.5 .mu.l Proteinase K (IBI5406,
20 mg/ml), generating a final [ProtK]=0.5 mg/ml. [0298] 4. Incubate
at 55.degree. C. overnight in rotating incubator. [0299] 5. Add 20
.mu.l of RNase cocktail (500 U/ml RNase A+20,000 U/ml RNase T1,
Ambion #2288) and incubate four hours at 37.degree. C. [0300] 6.
Extract with Phenol (Kodak, Tris pH 8 equilibrated), shake to mix,
spin 5 min. in tabletop centrifuge. [0301] 7. Transfer aqueous
phase to fresh tube. [0302] 8. Extract with
Phenol/Chloroform/Isoamyl alcohol (EMD, 25:24:1 ratio, Tris pH 8
equilibrated), shake to mix, spin five minutes in tabletop
centrifuge. [0303] 9. Add 50 .mu.l 3M NaOAc pH=6. [0304] 10. Add
500 .mu.l EtOH. [0305] 11. Shake to mix. Strings of precipitated
DNA may be visible. If anticipated DNA concentration is very low,
add carrier nucleotide (usually yeast tRNA). [0306] 12. Spin one
minute at max speed in tabletop centrifuge. [0307] 13. Remove
supernatant. [0308] 14. Add 500 .mu.l 70% EtOH, Room Temperature
(RT) [0309] 15. Shake to mix. [0310] 16. Spin one minute at max
speed in tabletop centrifuge. [0311] 17. Air dry 10-20 minutes
before adding TE. [0312] 18. Resuspend in 400 .mu.l TE. Incubate at
65.degree. C. for 10 minutes, then leave at RT overnight before
quantitation on Nanodrop. [0313] c) Amplify exons 18, 19, 20,
and/or 21 via PCR reactions. Hot start nested PCR amplification is
carried out as described above in step 1d, except that there is no
nested round of amplification. The initial PCR step may be stopped
during the log phase in order to minimize possible loss of
allele-specific information during amplification. The primer sets
used for expansion of EGFR exons 18-21 are listed in Table 6 (see
also Paez et al., Science 304:1497-1500 (Supplementary Material)
(2004)).
TABLE-US-00010 [0313] TABLE 6 Primer sets for expanding EGFR
genomic DNA SEQ Ampli- ID con Name NO Sequence (5' to 3') Exon Size
NXK-ex18.1(+) 11 TCAGAGCCTGTGTTTCTACC 18 534 AA NXK-ex18.2(-) 12
TGGTCTCACAGGACCACTGA 18 TT NXK-ex18.3(+) 13 TCCAAATGAGCTGGCAAGTG 18
397 NXK-ex18.4(-) 14 TCCCAAACACTCAGTGAAAC 18 AAA NXK-ex19.1(+) 15
AAATAATCAGTGTGATTCGT 19 495 GGAG NXK-ex19.2(-) 16
GAGGCCAGTGCTGTCTCTAA 19 GG NXK-ex19.3(+) 17 GTGCATCGCTGGTAACATCC 19
298 NXK-ex19.4(-) 18 TGTGGAGATGAGCAGGGTCT 19 NXK-ex20.1(+) 19
ACTTCACAGCCCTGCGTAAA 20 555 C NXK-ex20.2(-) 20 ATGGGACAGGCACTGATTTG
20 T NXK-ex20.3(+) 21 ATCGCATTCATGCGTCTTCA 20 379 NXK-ex20.4(-) 22
ATCCCCATGGCAAACTCTTG 20 NXK-ex21.1(+) 23 GCAGCGGGTTACATCTTCTT 21
526 TC NXK-ex21.2(-) 24 CAGCTCTGGCTCACACTACC 21 AG NXK-ex21.3(+) 25
GCAGCGGGTTACATCTTCTT 21 349 TC NXK-ex21.4(-) 26 CATCCTCCCCTGCATGTGT
21
[0314] d) Use the resulting PCR amplicon(s) in real-time
quantitative allele-specific PCR reactions in order to confirm the
sequence of mutations discovered via RNA sequencing. An aliquot of
the PCR amplicons is used as template in a multiplexed
allele-specific quantitative PCR reaction using TaqMan PCR 5'
Nuclease assays with an Applied Biosystems model 7500 Real Time PCR
machine (FIG. 24). This round of PCR amplifies subregions of the
initial PCR product specific to each mutation of interest. Given
the very high sensitivity of Real. Time PCR, it is possible to
obtain complete information on the mutation status of the EGFR gene
even if as few as 10 CTCs are isolated. Real Time PCR provides
quantification of allelic sequences over 8 logs of input DNA
concentrations; thus, even heterozygous mutations in impure
populations are easily detected using this method.
[0315] Probe and primer sets are designed for all known mutations
that affect gefitinib responsiveness in NSCLC patients, including
over 40 such somatic mutations, including point mutations,
deletions, and insertions, that have been reported in the medical
literature. For illustrative purposes, examples of primer and probe
sets for five of the point mutations are listed in Table 7. In
general, oligonucleotides may be designed using the primer
optimization software program Primer Express (Applied Biosystems),
with hybridization conditions optimized to distinguish the wild
type EGFR DNA sequence from mutant alleles. EGFR genomic DNA
amplified from lung cancer cell lines that are known to carry EGFR
mutations, such as H358 (wild type), H1650 (15-bp deletion,
.DELTA.2235-2249), and H1975 (two point mutations, 2369 C.fwdarw.T,
2573 T.fwdarw.G), is used to optimize the allele-specific Real Time
PCR reactions. Using the TaqMan 5' nuclease assay, allele-specific
labeled probes specific for wild type sequence or for known EGFR
mutations are developed. The oligonucleotides are designed to have
melting temperatures that easily distinguish a match from a
mismatch, and the Real Time PCR conditions are optimized to
distinguish wild type and mutant alleles. All Real Time PCR
reactions are carried out in triplicate.
[0316] Initially, labeled probes containing wild type sequence are
multiplexed in the same reaction with a single mutant probe.
Expressing the results as a ratio of one mutant allele sequence
versus wild type sequence may identify samples containing or
lacking a given mutation. After conditions are optimized for a
given probe set, it is then possible to multiplex probes for all of
the mutant alleles within a given exon within the same Real Time
PCR assay, increasing the ease of use of this analytical tool in
clinical settings.
[0317] A unique probe is designed for each wild type allele and
mutant allele sequence. Wild-type sequences are marked with the
fluorescent dye VIC at the 5' end, and mutant sequences with the
fluorophore FAM. A fluorescence quencher and Minor Groove Binding
moiety are attached to the 3' ends of the probes. ROX is used as a
passive reference dye for normalization purposes. A standard curve
is generated for wild type sequences and is used for relative
quantitation. Precise quantitation of mutant signal is not
required, as the input cell population is of unknown, and varying,
purity. The assay is set up as described by ABI product literature,
and the presence of a mutation is confirmed when the signal from a
mutant allele probe rises above the background level of
fluorescence (FIG. 25), and this threshold cycle gives the relative
frequency of the mutant allele in the input sample.
TABLE-US-00011 TABLE 7 Probes and Primers for Allele-Specific qPCR
EMBL SEQ Chromosome 7 ID Sequence (5' to 3', Genomic Name NO
mutated position in bold) Coordinates Description Mutation NXK-M01
27 CCGCAGCATGTCAAGATCAC (+)55,033,694- (+) primer L858R 55,033,713
NXK-M02 28 TCCTTCTGCATGGTATTCTTTCTCT (-)55,033,769- (-) primer
55,033,745 Pwt-L858R 29 VIC-TTTGGGCTGGCCAA-MGB (+)55,033,699- WT
allele probe 55,033,712 Pmut-L858R 30 FAM-TTTTGGGCGGGCCA-MGB
(+)55,033,698- Mutant allele 55,033,711 probe NXK-M03 31
ATGGCCAGCGTGGACAA (+)55,023,207- (+) primer T790M 55,023,224
NXK-M04 32 AGCAGGTACTGGGAGCCAATATT (-)55,023,355- (-) primer
55,023,333 Pwt-T790M 33 VIC-ATGAGCTGCGTGATGA-MGB (-)55,023,290- WT
allele probe 55,023,275 Pmut-T790M 34 FAM-ATGAGCTGCATGATGA-MGB
(-)55,023,290- Mutant allele 55,023,275 probe NXK-M05 35
GCCTCTTACACCCAGTGGAGAA (+)55,015,831- (+) primer G719S, C
55,015,852 NXK-ex18.5 36 GCCTGTGCCAGGGACCTT (-)55,015,965- (-)
primer 55,015,948 Pwt-G719SC 37 VIC-ACCGGAGCCCAGCA-MGB
(-)55,015,924- WT allele probe 55,015,911 Pmut-G719S 38
FAM-ACCGGAGCTCAGCA-MGB (-)55,015,924- Mutant allele 55,015,911
probe mut-G719C 39 FAM-ACCGGAGCACAGCA-MGB (-)55,015,924- Mutant
allele 55,015,911 probe NXK-ex21.5 40 ACAGCAGGGTCTTCTCTGTTTCAG
(+)55,033,597- (+) primer H835L 55,033,620 NXK-M10 41
ATCTTGACATGCTGCGGTGTT (-)55,033,710 (-) primer 55,033,690 Pwt-H835L
42 VIC-TTGGTGCACCGCGA-MGB (+)55,033,803- WT allele probe 55,033,816
Pmut-H835L 43 FAM-TGGTGCTCCGCGAC-MGB (+)55,033,803- Mutant allele
55,033,816 probe NXK-M07 101 TGGATCCCAGAAGGTGAGAAA (+)55,016,630-
(+) primer delE746- 55,016,650 A750 NXK-ex19.5 102
AGCAGAAACTCACATCGAGGATTT (-)55,016,735- (-) primer 55,016,712
Pwt-delE746- 103 AAGGAATTAAGAGAAGCAA (+)55,016,681- WT allele probe
A750 55,016,699 Pmut-delE746- 104 CTATCAAAACATCTCC (+)55,016,676-
Mutant allele A750var1 55,016,691 probe, variant 1 Pmut-delE746-
105 CTATCAAGACATCTCC (+)55,016,676- Mutant allele A750var1
55,016,691 probe, variant 2
Example 13
Absence of EGFR Expression in Leukocytes
[0318] To test whether EGFR mRNA is present in leukocytes, several
PCR experiments were performed. Four sets of primers, shown in
Table 8, were designed to amplify four corresponding genes: [0319]
1) BCKDK (branched-chain a-ketoacid dehydrogenase complex
kinase)--a "housekeeping" gene expressed in all types of cells, a
positive control for both leukocytes and tumor cells; [0320] 2)
CD45--specifically expressed in leukocytes, a positive control for
leukocytes and a negative control for tumor cells; [0321] 3)
EpCaM--specifically expressed in epithelial cells, a negative
control for leukocytes and a positive control for tumor cells; and
[0322] 4) EGFR--the target mRNA to be examined.
TABLE-US-00012 [0322] TABLE 8 SEQ ID Amplicon Name NO Sequence (5'
to 3') Description Size BCKD_1 44 AGTCAGGACCCATGCACGG BCKDK (+)
primer 273 BCKD_2 45 ACCCAAGATGCAGCAGTGTG BCKDK (-) primer CD45_1
46 GATGTCCTCCTTGTTCTACTC CD45 (+) primer 263 CD45_2 47
TACAGGGAATAATCGAGCATGC CD45 (-) primer EpCAM_1 48
GAAGGGAAATAGCAAATGGACA EpCAM (+) primer 222 EpCAM_2 49
CGATGGAGTCCAAGTTCTGG EpCAM (-) primer EGFR_1 50
AGCACTTACAGCTCTGGCCA EGFR (+) primer 371 EGFR_2 51
GACTGAACATAACTGTAGGCTG EGFR (-) primer
[0323] Total RNAs of approximately 9.times.10.sup.6 leukocytes
isolated using a cell enrichment device of the invention (cutoff
size 4 .mu.m) and 5.times.10.sup.6 H1650 cells were isolated by
using RNeasy mini kit (Qiagen). Two micrograms of total RNAs from
leukocytes and H1650 cells were reverse transcribed to obtain first
strand cDNAs using 100 pmol random hexamer (Roche) and 200 U
Superscript II (Invitrogen) in a 20 .mu.l reaction. The subsequent
PCR was carried out using 0.5 .mu.l of the first strand cDNA
reaction and 10 pmol of forward and reverse primers in total 25
.mu.l of mixture. The PCR was run for 40 cycles of 95.degree. C.
for 20 seconds, 56.degree. C. for 20 seconds, and 70.degree. C. for
30 seconds. The amplified products were separated on a 1% agarose
gel. As shown in FIG. 26A, BCKDK was found to be expressed in both
leukocytes and H1650 cells; CD45 was expressed only in leukocytes;
and both EpCAM and EGFR were expressed only in H1650 cells. These
results, which are fully consistent with the profile of EGFR
expression shown in FIG. 26B, confirmed that EGFR is a particularly
useful target for assaying mixtures of cells that include both
leukocytes and cancer cells, because only the cancer cells will be
expected to produce a signal.
Example 14
EGFR Assay with Low Quantities of Target RNA or High Quantities of
Background RNA
[0324] In order to determine the sensitivity of the assay described
in Example 12, various quantities of input NSCLC cell line total
RNA were tested, ranging from 100 pg to 50 ng. The results of the
first and second EGFR PCR reactions (step 1d, Example 12) are shown
in FIG. 27. The first PCR reaction was shown to be sufficiently
sensitive to detect 1 ng of input RNA, while the second round
increased the sensitivity to 100 pg or less of input RNA. This
corresponds to 7-10 cells, demonstrating that even extremely dilute
samples may generate detectable signals using this assay.
[0325] Next, samples containing 1 ng of NCI-H1975 RNA were mixed
with varying quantities of peripheral blood mononuclear cell (PBMC)
RNA ranging from 1 ng to 1 .mu.g and used in PCR reactions as
before. As shown in FIG. 28A, the first set of PCR reactions
demonstrated that, while amplification occurred in all cases,
spurious bands appeared at the highest contamination level.
However, as shown in FIG. 28B, after the second, nested set of PCR
reactions, the desired specific amplicon was produced without
spurious bands even at the highest contamination level. Therefore,
this example demonstrates that the EGFR PCR assays described herein
are effective even when the target RNA occupies a tiny fraction of
the total RNA in the sample being tested.
[0326] Table 8 lists the RNA yield in a variety of cells and shows
that the yield per cell is widely variable, depending on the cell
type. This information is useful in order to estimate the amount of
target and background RNA in a sample based on cell counts. For
example, 1 ng of NCL-H1975 RNA corresponds to approximately 100
cells, while 1 .mu.g of PBMC RNA corresponds to approximately
10.sup.6 cells. Thus, the highest contamination level in the
above-described experiment, 1,000:1 of PBMC RNA to NCL-H1975 RNA,
actually corresponds to a 10,000:1 ratio of PBMCs to NCL-H1975
cells. Thus, these data indicate that EGFR may be sequenced from as
few as 100 CTCs contaminated by as many as 10.sup.6 leukocytes.
TABLE-US-00013 TABLE 8 RNA Yield versus Cell Type Cells Count RNA
Yield [RNA]/Cell NCI-H1975 2 .times. 10.sup.6 26.9 .mu.g 13.5 pg
NCI-H1650 2 .times. 10.sup.6 26.1 .mu.g 13.0 pg H358 2 .times.
10.sup.6 26.0 .mu.g 13.0 pg HT29 2 .times. 10.sup.6 21.4 .mu.g 10.7
pg MCF7 2 .times. 10.sup.6 25.4 .mu.g 12.7 pg PBMC #1 19 .times.
10.sup.6 10.2 .mu.g 0.5 pg PBMC #2 16.5 .times. 10.sup.6 18.4 .mu.g
1.1 pg
[0327] Next, whole blood spiked with 1,000 cells/ml of Cell Tracker
(Invitrogen)-labeled H1650 cells was run through the capture module
chip of FIG. 19C. To avoid inefficiency in RNA extraction from
fixed samples, the captured H1650 cells were immediately counted
after running and subsequently lysed for RNA extraction without
formaldehyde fixation. Approximately 800 captured H1650 cells and
>10,000 contaminated leukocytes were lysed on the chip with 0.5
ml of 4M guanidine thiocyanate solution. The lysate was extracted
with 0.5 ml of phenol/chloroform and precipitated with 1 ml of
ethanol in the presence of 10 .mu.g of yeast tRNA as carrier. The
precipitated RNAs were DNase I-treated for 30 minutes and then
extracted with phenol/chloroform and precipitated with ethanol
prior to first strand cDNA synthesis and subsequent PCR
amplification. These steps were repeated with a second blood sample
and a second chip. The cDNA synthesized from chip1 and chip2 RNAs
along with H1650 and leukocyte cDNAs were PCR amplified using two
sets of primers, CD45.sub.--1 and CD45.sub.--2 (Table 7) as well as
EGFR.sub.--5 (forward primer, 5'-GTTCGGCACGGTGTATAAGG-3') (SEQ ID
NO: ______) and EGFR.sub.--6 (reverse primer,
5'-CTGGCCATCACGTAGGCTTC-3') (SEQ ID NO: ______). EGFR.sub.--5 and
EGFR.sub.--6 produce a 138 bp wild type amplified fragment and a
123 bp mutant amplified fragment in H1650 cells. The PCR products
were separated on a 2.5% agarose gel. As shown in FIG. 29, EGFR
wild type and mutant amplified fragments were readily detected,
despite the high leukocyte background, demonstrating that the EGFR
assay is robust and does not require a highly purified sample.
Sequence CWU 1
1
70117DNAArtificial Sequencesynthetic primer 1ttgctgctgg tggtggc
17220DNAArtificial Sequencesynthetic primer 2cagggattcc gtcatatggc
20318DNAArtificial Sequencesynthetic primer 3gatcggcctc ttcatgcg
18422DNAArtificial Sequencesynthetic primer 4gatccaaagg tcatcaactc
cc 22518DNAArtificial Sequencesynthetic primer 5gctgtccaac gaatgggc
18620DNAArtificial Sequencesynthetic primer 6ggcgttctcc tttctccagg
20719DNAArtificial Sequencesynthetic primer 7atgcactggg ccaggtctt
19821DNAArtificial Sequencesynthetic primer 8cgatggtaca tatgggtggc
t 21919DNAArtificial Sequencesynthetic primer 9aggctgtcca acgaatggg
191019DNAArtificial Sequencesynthetic primer 10ctgagggagg cgttctcct
191122DNAArtificial Sequencesynthetic primer 11tcagagcctg
tgtttctacc aa 221222DNAArtificial Sequencesynthetic primer
12tggtctcaca ggaccactga tt 221320DNAArtificial Sequencesynthetic
primer 13tccaaatgag ctggcaagtg 201423DNAArtificial
Sequencesynthetic primer 14tcccaaacac tcagtgaaac aaa
231524DNAArtificial Sequencesynthetic primer 15aaataatcag
tgtgattcgt ggag 241622DNAArtificial Sequencesynthetic primer
16gaggccagtg ctgtctctaa gg 221720DNAArtificial Sequencesynthetic
primer 17gtgcatcgct ggtaacatcc 201820DNAArtificial
Sequencesynthetic primer 18tgtggagatg agcagggtct
201921DNAArtificial Sequencesynthetic primer 19acttcacagc
cctgcgtaaa c 212021DNAArtificial Sequencesynthetic primer
20atgggacagg cactgatttg t 212120DNAArtificial Sequencesynthetic
primer 21atcgcattca tgcgtcttca 202220DNAArtificial
Sequencesynthetic primer 22atccccatgg caaactcttg
202322DNAArtificial Sequencesynthetic primer 23gcagcgggtt
acatcttctt tc 222422DNAArtificial Sequencesynthetic primer
24cagctctggc tcacactacc ag 222522DNAArtificial Sequencesynthetic
primer 25gcagcgggtt acatcttctt tc 222619DNAArtificial
Sequencesynthetic primer 26catcctcccc tgcatgtgt 192720DNAArtificial
Sequencesynthetic primer 27ccgcagcatg tcaagatcac
202825DNAArtificial Sequencesynthetic primer 28tccttctgca
tggtattctt tctct 252914DNAArtificial Sequencesynthetic probe
29tttgggctgg ccaa 143014DNAArtificial Sequencesynthetic probe
30ttttgggcgg gcca 143117DNAArtificial Sequencesynthetic primer
31atggccagcg tggacaa 173223DNAArtificial Sequencesynthetic primer
32agcaggtact gggagccaat att 233316DNAArtificial Sequencesynthetic
probe 33atgagctgcg tgatga 163416DNAArtificial Sequencesynthetic
probe 34atgagctgca tgatga 163522DNAArtificial Sequencesynthetic
primer 35gcctcttaca cccagtggag aa 223618DNAArtificial
Sequencesynthetic primer 36gcctgtgcca gggacctt 183714DNAArtificial
Sequencesynthetic probe 37accggagccc agca 143814DNAArtificial
Sequencesynthetic probe 38accggagctc agca 143914DNAArtificial
Sequencesynthetic probe 39accggagcac agca 144024DNAArtificial
Sequencesynthetic primer 40acagcagggt cttctctgtt tcag
244121DNAArtificial Sequencesynthetic primer 41atcttgacat
gctgcggtgt t 214214DNAArtificial Sequencesynthetic probe
42ttggtgcacc gcga 144314DNAArtificial Sequencesynthetic probe
43tggtgctccg cgac 144419DNAArtificial Sequencesynthetic primer
44agtcaggacc catgcacgg 194520DNAArtificial Sequencesynthetic primer
45acccaagatg cagcagtgtg 204621DNAArtificial Sequencesynthetic
primer 46gatgtcctcc ttgttctact c 214722DNAArtificial
Sequencesynthetic primer 47tacagggaat aatcgagcat gc
224822DNAArtificial Sequencesynthetic primer 48gaagggaaat
agcaaatgga ca 224920DNAArtificial Sequencesynthetic primer
49cgatggagtc caagttctgg 205020DNAArtificial Sequencesynthetic
primer 50agcacttaca gctctggcca 205122DNAArtificial
Sequencesynthetic primer 51gactgaacat aactgtaggc tg
225221DNAArtificial Sequencesynthetic primer 52tggatcccag
aaggtgagaa a 215324DNAArtificial Sequencesynthetic primer
53agcagaaact cacatcgagg attt 245419DNAArtificial Sequencesynthetic
probe 54aaggaattaa gagaagcaa 195516DNAArtificial Sequencesynthetic
probe 55ctatcaaaac atctcc 165616DNAArtificial Sequencesynthetic
probe 56ctatcaagac atctcc 165719DNAArtificial Sequencesynthetic
primer 57tcgagtgcat tccattccg 195821DNAArtificial Sequencesynthetic
primer 58atggaatggc atcaaacgga a 215915DNAArtificial
Sequencesynthetic probe 59tggctgtcca ttcca 156065DNAArtificial
Sequencesynthetic oligonucleotide 60atgcagcaag gcacagacta
arcaaggaga sgcaaaattt tcrtagggga gagaaatggg 60tcatt
656122DNAArtificial Sequencesynthetic primer 61atgcagcaag
gcacagacta cg 226223DNAArtificial Sequencesynthetic primer
62agaggggaga gaaatgggtc att 236325DNAArtificial Sequencesynthetic
primer 63caaggcacag actaagcaag gagag 256435DNAArtificial
Sequencesynthetic primer 64ggcaaaattt tcatagggga gagaaatggg tcatt
356520DNAArtificial Sequencesynthetic primer 65gttcggcacg
gtgtataagg 206620DNAArtificial Sequencesynthetic primer
66ctggccatca cgtaggcttc 206713DNAArtificial Sequencesynthetic probe
67cggagatggc cca 136815DNAArtificial Sequencesynthetic probe
68gcaactcatc atgca 156915DNAArtificial Sequencesynthetic probe
69ttttgggcgg gccaa 157019DNAArtificial Sequencesynthetic probe
70gaccgtttgg gagttgata 19
* * * * *
References