U.S. patent application number 13/084979 was filed with the patent office on 2012-06-28 for compositions and methods for modulating pgc-1alpha to treat neurological diseases and disorders.
This patent application is currently assigned to Dana-Farber Cancer Institute, Inc.. Invention is credited to Jiandie Lin, Bruce M. Spiegelman.
Application Number | 20120167240 13/084979 |
Document ID | / |
Family ID | 36000767 |
Filed Date | 2012-06-28 |
United States Patent
Application |
20120167240 |
Kind Code |
A1 |
Lin; Jiandie ; et
al. |
June 28, 2012 |
Compositions and Methods for Modulating PGC-1Alpha to Treat
Neurological Diseases and Disorders
Abstract
The present invention provides methods for modulating
mitochondrial function, modulating lesion formation in the brain,
modulating neurite growth, modulating neuronal degeneration, and
treating and preventing neurological diseases or disorders
comprising modulating the expression of activity of PGC-1.alpha..
The present invention also provides an animal, e.g., transgenic
mouse, in which the PGC-1.alpha. gene is misexpressed. Methods for
identifying compounds which are capable of treating or preventing a
neurological disease or disorder are also described.
Inventors: |
Lin; Jiandie; (Ann Arbor,
MI) ; Spiegelman; Bruce M.; (Waban, MA) |
Assignee: |
Dana-Farber Cancer Institute,
Inc.
Boston
MA
|
Family ID: |
36000767 |
Appl. No.: |
13/084979 |
Filed: |
April 12, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11660986 |
Feb 4, 2008 |
7947652 |
|
|
PCT/US05/31715 |
Sep 6, 2005 |
|
|
|
13084979 |
|
|
|
|
60607412 |
Sep 3, 2004 |
|
|
|
Current U.S.
Class: |
800/18 ; 435/375;
435/6.1; 435/6.13; 514/17.7; 514/44R; 800/13 |
Current CPC
Class: |
A61P 25/28 20180101;
G01N 2800/2835 20130101; A61P 25/20 20180101; Y10T 436/143333
20150115; A61P 25/06 20180101; A61P 25/16 20180101; G01N 2500/00
20130101; A61P 25/24 20180101; G01N 33/6896 20130101; A61K 38/1709
20130101; A61P 25/22 20180101; A61P 25/00 20180101; A61P 25/18
20180101 |
Class at
Publication: |
800/18 ;
514/17.7; 514/44.R; 435/375; 435/6.13; 435/6.1; 800/13 |
International
Class: |
A01K 67/027 20060101
A01K067/027; A61P 25/16 20060101 A61P025/16; A61P 25/00 20060101
A61P025/00; A61P 25/20 20060101 A61P025/20; A61P 25/24 20060101
A61P025/24; A01K 67/00 20060101 A01K067/00; A61P 25/18 20060101
A61P025/18; A61P 25/06 20060101 A61P025/06; A61K 38/17 20060101
A61K038/17; A61K 31/7088 20060101 A61K031/7088; C12N 5/02 20060101
C12N005/02; C12Q 1/68 20060101 C12Q001/68; A61P 25/28 20060101
A61P025/28; A61P 25/22 20060101 A61P025/22 |
Goverment Interests
GOVERNMENT RIGHTS
[0001] This invention was made at least in part with support by
grants awarded from the National Institute of Diabetes and Kidney
Diseases (NIDDK) of the National Institutes of Health, grant
numbers DK54477, DK61562, and K01DK065584. The U.S. government may
have certain rights in the invention.
Claims
1-43. (canceled)
44. A method for treating or preventing a neurological disease or
disorder in a subject comprising the step of administering to said
subject a peroxisome proliferator-activated receptor gamma
coactivator 1 alpha (PGC-1.alpha.) modulator, wherein the
PGC-1.alpha. modulator increases PGC-1.alpha. expression or
activity, and wherein the modulator is a PGC-1.alpha. polypeptide
comprising the amino acid sequence of SEQ ID NO: 2 or a portion
thereof, such that said polypeptide or portion thereof maintains
the ability to modulate one or more of the following biological
activities: mitochondrial function; the activity or expression of a
mitochondrial gene selected from the group consisting of LDH2,
Ndufb5, COX6a1, and ATP5j; the activity or expression of a neuronal
gene selected from the group consisting of NF--H, NF-M, MOBP,
ATP.alpha.1, and ATP1.alpha.2; lesion formation; neurite formation;
neurite growth; neuronal degeneration; body weight; energy
expenditure; gluconeogenesis; and interaction with nuclear hormone
receptors, such that the neurological disease or disorder is
treated or prevented.
45. The method of claim 44, wherein the PGC-1.alpha. polypeptide or
portion thereof comprises an amino acid sequence which is at least
90 percent identical to the amino acid sequence of SEQ ID NO:
2.
46. The method of claim 44, wherein the PGC-1.alpha. polypeptide or
portion thereof is encoded by a nucleic acid molecule which
hybridizes to a complement of a nucleic acid molecule consisting of
SEQ ID NO:1 at 6.times.SSC at 45.degree. C., followed by one or
more washes in 0.2.times.SSC, 0.1% SDS at 65.degree. C.
47. The method of claim 44, wherein the PGC-1.alpha. polypeptide or
portion thereof further comprises a heterologous polypeptide.
48. A method for treating or preventing a neurological disease or
disorder in a subject comprising the step of administering to said
subject a PGC-1.alpha. modulator, wherein the PGC-1.alpha.
modulator increases PGC-1.alpha. expression or activity, and
wherein the modulator is a PGC-1.alpha. nucleic acid comprising the
nucleotide sequence of SEQ ID NO:1, or a portion thereof, such that
said polypeptide or portion thereof maintains the ability to
modulate one or more of the following biological activities:
mitochondrial function; the activity or expression of a
mitochondrial gene selected from the group consisting of LDH2,
Ndufb5, COX6a1, and ATP5j; the activity or expression of a neuronal
gene selected from the group consisting of NF--H, NF-M, MOBP,
ATP.alpha.1, and ATP1.alpha.2; lesion formation; neurite formation;
neurite growth; neuronal degeneration; body weight; energy
expenditure; gluconeogenesis; and interaction with nuclear hormone
receptors, such that the neurological disease or disorder is
treated or prevented.
49. The method of claim 48, wherein the PGC-1.alpha. nucleic acid
or portion thereof comprises a nucleic acid sequence which is at
least 90 percent identical to the nucleic acid sequence of SEQ ID
NO:1.
50. The method of claim 48, wherein the PGC-1.alpha. nucleic acid
or portion thereof further encodes a heterologous polypeptide.
51. The method of claim 44 or 48, wherein the neurological disease
or disorder is selected from the group consisting of Alzheimer's
disease, Parkinson's disease, Huntington's disease, Pick's disease,
Kuf's disease, Lewy body disease, neurofibrillary tangles,
Rosenthal fibers, Mallory's hyaline, senile dementia, myasthenia
gravis, Gilles de la Tourette's syndrome, multiple sclerosis (MS),
amyotrophic lateral sclerosis (ALS), progressive supranuclear palsy
(PSP), epilepsy, Creutzfeldt-Jakob disease, deamess-dytonia
syndrome, Leigh syndrome, Leber hereditary optic neuropathy (LHON),
parkinsonism, dystonia, motor neuron disease, neuropathy-ataxia and
retinitis pimentosa (NARP), maternal inherited Leigh syndrome
(MILS), Friedreich ataxia, hereditary spastic paraplegia,
Mohr-Tranebjaerg syndrome, Wilson disease, sporatic Alzheimer's
disease, sporadic amyotrophic lateral sclerosis, sporadic
Parkinson's disease, autonomic function disorders, hypertension,
sleep disorders, neuropsychiatric disorders, depression,
schizophrenia, schizoaffective disorder, korsakoff s psychosis,
mania, anxiety disorders, phobic disorder, learning or memory
disorders, amnesia or age-related memory loss, attention deficit
disorder, dysthymic disorder, major depressive disorder,
obsessive-compulsive disorder, psychoactive substance use
disorders, panic disorder, bipolar affective disorder, severe
bipolar affective (mood) disorder (BP--I), migraines, hyperactivity
and movement disorders.
52. The method of claim 44 or 48, wherein the neurological disease
or disorder is Parkinson's disease.
53. The method of claim 44 or 48, wherein the subject is human.
54. The method of claim 44 or 48, wherein said modulator is
administered in a pharmaceutically acceptable formulation.
55. The method of claim 44 or 48, wherein the PGC-1.alpha.
modulator modulates mitochondrial function.
56. The method of claim 55, wherein mitochondrial function is
modulated in the brain.
57. The method of claim 44 or 48, wherein the PGC-1.alpha.
modulator modulates lesion formation in the brain.
58. The method of claim 44 or 48, wherein the PGC-1.alpha.
modulator modulates neurite growth.
Description
BACKGROUND OF THE INVENTION
[0002] Understanding the regulatory circuits that govern cellular
energy and glucose metabolism has been a focus of research interest
in the past decade. Recent studies have implicated transcription
coactivators of the PGC-1 family, in particular PGC-1.alpha. and
PGC-1.beta., as important regulators of mitochondrial biogenesis
and cellular respiration in several cell types (Kelly, D. P., and
Scarpulla, R. C. (2004) Genes Dev 18, 357-368; Puigserver, P., and
Spiegelman, B. M. (2003) Endocr Rev 24, 78-90). Notably, the
expression of PGC-1.alpha. has been found to be dysregulated in
diabetic liver and skeletal muscle, tissues critical for
maintaining normal blood glucose levels, while PGC-1.beta. mRNA
levels are also lowered in diabetic muscle (Mootha et al. (2003)
Nat Genet. 34, 267-273; Patti, M. et al. (2003) Proc Natl Acad Sci
USA 100, 8466-8471; Yoon J. C., et al. (2001) Nature 413, 131-138).
PGC-1.alpha. was initially identified as a cold-inducible
coactivator for PPAR.gamma. in brown fat (Puigserver et al. (1998)
Cell 92, 829-839). Subsequent studies revealed that PGC-1.alpha. is
able to bind to and augment transcriptional activities of many
nuclear receptors and several other transcription factors outside
the nuclear receptor superfamily. Adenoviral-mediated or transgenic
expression of PGC-1.alpha. in cultured cells and in vivo leads to
activation of mitochondrial biogenesis and increases in cellular
respiration (Lehman et al., (2000) J Clin Invest 106, 847-856; Lin
et al. (2002b) Nature 418, 797-801; St-Pierre et al. (2003) J Biol
Chem 278, 26597-26603; Wu et al. (1999) Cell 98, 115-124).
Consistent with a regulatory role in the cellular adaptations to
increased energy requirements, the expression of PGC-1.alpha.
itself is highly regulated in response to nutritional and
environmental stimuli. For example, PGC-1.alpha. mRNA is strongly
induced in brown fat by cold exposure and in skeletal muscle
following physical activity (Baar et al. (2002) Faseb J 16,
1879-1886; Goto et al. (2000) Biochem Biophys Res Commun 274,
350-354; Puigserver et al. (1998) Cell 92, 829-839). Increased
PGC-1.alpha. levels in these tissues lead to enhanced mitochondrial
electron transport activities that enable cells to meet rising
energy demands, such as during adaptive thermogenesis in brown fat
and contraction in muscle.
[0003] In addition to its role in mitochondrial biology,
PGC-1.alpha. also regulates several key metabolic programs that go
beyond simple mitochondrial biogenesis and oxidative
phosphorylation. For example, PGC-1.alpha. drives expression of
myofibrillar proteins characteristic of slow-twitch muscle fibers
when expressed in fast-twitch muscle beds of transgenic mice (Lin
et al. (2002b) Nature 418, 797-801). In the liver, PGC-1.alpha.
mRNA level is rapidly induced following short-term fasting (Yoon et
al. (2001) Nature 413, 131-138). Adenoviral-mediated expression of
PGC-1.alpha. in cultured primary hepatocytes and in live rats leads
to activation of the entire program of gluconeogenesis and
increased glucose production (Yoon et al. (2001) Nature 413,
131-138). In all of these cases, PGC-1.alpha. interacts with
cell-selective transcription factors to execute these
tissue-specific functions, such as MEF2c in skeletal muscle and
HNF4.alpha. and FOXO1 in the liver.
SUMMARY OF THE INVENTION
[0004] The present invention is based, at least in part, on the
discovery that modulation of PGC-1.alpha., e.g., PGC-1.alpha.
expression or activity, leads to the modulation of lesion
formation, e.g., brain lesion formation, neurological degeneration,
and neurite formation. Therefore, in one aspect, the present
invention provides a method for treating and/or preventing a
neurological disease or disorder in a subject, e.g., a human, by
administering a PGC-1.alpha. modulator.
[0005] Examples of neurological diseases or disorders include
Alzheimer's disease, Parkinson's disease, Huntington's disease,
Pick's disease, Kuf's disease, Lewy body disease, neurofibrillary
tangles, Rosenthal fibers, Mallory's hyaline, senile dementia,
myasthenia gravis, Gilles de la Tourette's syndrome, multiple
sclerosis (MS), amyotrophic lateral sclerosis (ALS), progressive
supranuclear palsy (PSP), epilepsy, Creutzfeldt-Jakob disease,
deafness-dytonia syndrome, Leigh syndrome, Leber hereditary optic
neuropathy (LHON), parkinsonism, dystonia, motor neuron disease,
neuropathy-ataxia and retinitis pimentosa (NARP), maternal
inherited Leigh syndrome (MILS), Friedreich ataxia, hereditary
spastic paraplegia, Mohr-Tranebjaerg syndrome, Wilson disease,
sporatic Alzheimer's disease, sporadic amyotrophic lateral
sclerosis, sporadic Parkinson's disease, autonomic function
disorders, hypertension, sleep disorders, neuropsychiatric
disorders, depression, schizophrenia, schizoaffective disorder,
korsakoff's psychosis, mania, anxiety disorders, phobic disorder,
learning or memory disorders, amnesia or age-related memory loss,
attention deficit disorder, dysthymic disorder, major depressive
disorder, obsessive-compulsive disorder, psychoactive substance use
disorders, panic disorder, bipolar affective disorder, severe
bipolar affective (mood) disorder (BP-1), migraines, hyperactivity
and movement disorders.
[0006] In one embodiment, a PGC-1.alpha. modulator is used in the
methods of the invention,
[0007] wherein the modulator is capable of modulating PGC-1.alpha.
polypeptide activity. In another embodiment, the modulator is a
PGC-1.alpha. polypeptide comprising the amino acid sequence of SEQ
ID NO: 2, or a fragment thereof. In still another embodiment, the
modulator includes a PGC-1.alpha. polypeptide comprising an amino
acid sequence which is at least 90 percent identical to the amino
acid sequence of SEQ ID NO: 2.
[0008] In yet another embodiment, the PGC-1.alpha. modulator is an
isolated naturally occurring allelic variant of a polypeptide
consisting of the amino acid sequence of SEQ ID NO:2, wherein the
polypeptide is encoded by a nucleic acid molecule which hybridizes
to a complement of a nucleic acid molecule consisting of SEQ ID
NO:1 at 6.times.SSC at 45.degree. C., followed by one or more
washes in 0.2.times.SSC, 0.1% SDS at 65.degree. C.
[0009] In still a further embodiment, the PGC-1.alpha. modulator is
capable of modulating PGC-1.alpha. nucleic acid expression. For
example, the PGC-1.alpha. modulator includes a PGC-1.alpha. nucleic
acid molecule, e.g., a PGC-1.alpha. nucleic acid molecule
comprising the nucleotide sequence of SEQ ID NO:1, or a fragment
thereof. In another embodiment, the PGC-1.alpha. modulator is a
modulator of a transcriptional activator which modulates the
expression of PGC-1.alpha..
[0010] In yet another embodiment, the PGC-1.alpha. modulator
modulates mitochondrial function, e.g., mitochondrial function in
the brain. In still another embodiment, the PGC-1.alpha. modulator
is capable of modulating lesion formation in the brain. In still a
further embodiment, the PGC-1.alpha. modulator is capable of
modulating neurite growth.
[0011] In another aspect, the invention provides a method of
modulating brain lesion formation by contacting a cell with a
PGC-1.alpha. modulator such that brain lesion formation is
modulated. In yet another aspect, the invention provides a method
for modulating neuronal degeneration by contacting a cell with a
PGC-1.alpha. modulator such that neuronal degeneration is
modulated.
[0012] In still another aspect, the invention provides methods for
identifying a compound capable of treating or preventing a
neurological disease or disorder comprising the step of assaying
the ability of the compound to modulate PGC-1.alpha. nucleic acid
expression or PGC-1.alpha. polypeptide activity. In one embodiment,
a modulating compound is identified by detecting modulation of
mitochondrial function or by detecting modulation in the expression
or activity of mitochondrial genes, e.g., LDH2, Ndufb5, COX6a1, and
ATP5j. In another embodiment, a modulating compound is identified
by detecting modulation in the expression or activity of neuronal
genes, e.g., NF--H, NF-M, MOBP, ATPa1, and ATP1a2. A PGC-1.alpha.
modulator identified by the methods of the invention includes, but
is not limited to, a small molecule, a nucleic acid molecule, a
polypeptide, a peptide or peptidomimetic.
[0013] In still another aspect, the invention provides methods for
assessing whether a subject is afflicted with a neurological
disease or disorder or is at risk of developing a neurological
disease or disorder, comprising the step of detecting the
expression of the PGC-1.alpha. gene or the activity of PGC-1.alpha.
in a cell or tissue sample of a subject, e.g., cerebrospinal fluid,
spinal fluid, and neural tissue.
[0014] In yet another aspect, the invention provides a non-human
animal, in which a PGC-1.alpha. gene is misexpressed, e.g., a
transgenic animal, in particular, a mouse. In a further embodiment,
the animal has a PGC-1.alpha. gene that is disrupted by the removal
of DNA encoding all or part of the PGC-1.alpha. gene. The present
invention also includes animals that are homozygous for the
disrupted gene or heterozygous for the disrupted gene. In one
embodiment, the invention provides a transgenic mouse with a
disruption of the PGC-1.alpha. gene, e.g., an insertion or deletion
of the PGC-1.alpha. gene.
BRIEF DESCRIPTION OF THE DRAWINGS
[0015] FIGS. 1A-F depict the generation of PGC-1.alpha. deficient
mice. In particular, FIG. 1A depicts hybridization analysis of
PGC-1.alpha. mRNA in liver and skeletal muscle using a probe
spanning exons 3 to 5 of PGC-1.alpha.. Hybridization with a probe
specific for ribosomal protein 36B4 was included as a loading
control. FIG. 1B depicts the results of immunoblotting of
PGC-1.alpha. protein. Lysates containing in vitro translated
PGC-1.alpha. were used as a positive control. Note the absence of
PGC-1.alpha. protein in brown fat extracts from
PGC-1.alpha..sup.-/- mice. FIGS. 1C-D depict H&E staining of
paraffin-embedded liver sections. FIGS. 1E-F depict H&E
staining of plastic-embedded brown fat sections.
[0016] FIGS. 2A-E depict impaired glucose homeostasis and hepatic
energy metabolism in the absence of PGC-1.alpha.. In particular,
FIG. 2A depicts plasma glucose levels in PGC-1.alpha..sup.+/+
(filled box), PGC-1.alpha..sup.+/- (dotted box) and
PGC-1.alpha..sup.-/- (open box) in the fed and fasted (24 hours)
states. *p=0.0007. FIG. 2B depicts plasma insulin concentrations in
the same group of mice used in (2A). *p=0.005. FIG. 2C depicts
total and uncoupled respiration in wild-type (+/+) and PGC-1.alpha.
deficient (-/-) hepatocytes. *p<0.02. Data in FIGS. 2A-C
represent mean.+-.s.e.m. Furthermore, FIG. 2D depicts defective
hormone-induced gluconeogenic gene expression in hepatocytes
lacking PGC-1.alpha.. Primary hepatocytes were isolated from
PGC-1.alpha..sup.+/+ and PGC-1.alpha..sup.-/- mice and treated with
0.2 .mu.M or 1.0 .mu.M of a combination of forskolin and dex for 3
or 6 hours before RNA isolation and hybridization. Hybridization
for ribosomal protein 36B4 mRNA was included as a loading control.
FIG. 2E depicts the results of pyruvate tolerance test. Three-month
old male mice were fasted overnight before receiving IP injection
of a pyruvate solution as described in the Examples Section.
*p<0.0002; **p<0.02.
[0017] FIGS. 3A-E depict the constitutive activation of the
gluconeogenic program in PGC-1.alpha. deficient liver. In
particular, FIG. 3A depicts hybridization analysis of mRNAs for
metabolic genes in the fed and fasted liver. Three-month old male
mice were fed ad libitum or fasted for 24 hours before harvesting
tissues for mRNA analysis. FIG. 3B depicts expression of mRNAs for
transcription factors that regulate hepatic metabolism. Note the
dramatic induction of C/EBP.beta. mRNA in fed PGC-1.alpha..sup.-/-
liver compared to wild-type liver. FIG. 3C is a graph depicting
real-time PCR analysis of mRNA levels for the C/EBP family members.
FIG. 3D is a graph which illustrates that PGC-1.alpha. does not
coactivate C/EBP.beta.. H2.35 hepatoma cells were transiently
transfected with a UAS-luciferase reporter with
Gal4-DBD-C/EBP.beta. in the presence or absence of PGC-1.alpha..
Luciferase activity was measured 30 hours following transfection.
FIG. 3E is a graph which depicts induction of endogenous
gluconeogenic genes by C/EBP.beta. in primary hepatocytes. Primary
hepatocytes were isolated from PGC-1.alpha..sup.+/+ (filled box)
and PGC-1.alpha..sup.-/- (open box) mouse liver and infected with
adenoviruses expression GFP or C/EBP.beta.. Total RNA were
harvested following 3 hours of treatments with 0.2 .mu.M forskolin
and 0.1 .mu.M dex. Relative abundance of G6Pase and PEPCK mRNA was
examined by real-time PCR followed by normalization to 18S
ribosomal RNA.
[0018] FIGS. 4A-F depict resistance to diet-induced obesity and
insulin resistance in PGC-1.alpha..sup.-/- mice. FIG. 4A is a graph
which depicts body weight of PGC-1.alpha..sup.+/+ (filled circle,
n=6) and PGC-1.alpha..sup.-/- (filled square, n=6) mice fed a
high-fat diet. Twelve-week old males were fed a high-fat diet for
16 weeks. Body weight was measured weekly. FIG. 4B depicts
representative DEXA scanning images of PGC-1.alpha..sup.+/+ and
PGC-1.alpha..sup.-/- mice after 12 weeks of high-fat feeding. FIG.
4C is a graph depicting body fat content in PGC-1.alpha..sup.+/+
and PGC-1.alpha..sup.-/- mice under chow (four month-old males) or
high-fat feeding. Percent body fat was determined by automated
analysis of DEXA images with a program supplied by manufacturer.
*p=0.005; **p=0.001. FIG. 4D is a graph depicting fasting glucose
and insulin levels in high-fat fed mice. *p=0.0001; **p=0.02. FIG.
4E is a graph depicting insulin tolerance test on high-fat fed
PGC-1.alpha..sup.+/+ (filled circle, n=5) and PGC-1.alpha..sup.-/-
(filled square, n=5) mice. *p<0.004. FIG. 4F is a graph
depicting glucose tolerance test in high-fat fed mice following an
overnight fast. *p<0.02. Insulin and glucose tolerance tests
were performed as described in the Examples Section. The data in
FIGS. 4A and 4C-F represent mean.+-.s.e.m.
[0019] FIGS. 5A-F are graphs depicting analysis of whole-body
energy balance and thermogenesis in PGC-1.alpha..sup.-/- mice. FIG.
5A illustrates that food intake was measured in a two-day period
and normalized to body weight. FIG. 5B illustrates whole body
O.sub.2 consumption in PGC-1.alpha..sup.+/+ (n=5) and
PGC-1.alpha..sup.-/- (n=5) mice as monitored by CLAMS. Shown is the
averaged value over two days and three nights. *p<0.006. FIG. 5C
depicts body temperature of 6 to 7-week old PGC-1.alpha..sup.+/+
(circle, n=6) and PGC-1.alpha..sup.-/- (square, n=6) mice exposed
to cold temperature (4.degree. C.). *p<0.008. Data in FIGS. 5B-C
represent mean.+-.s.e.m. FIG. 5D illustrates gene expression in
brown fat analyzed by quantitative real-time PCR. Intrascapular
brown fat was dissected from PGC-1.alpha..sup.+/+ (filled box) and
PGC-1.alpha..sup.-/- (open box) mice maintained at 24.degree. C. or
after 5 hours of cold exposure at 4.degree. C. Primers specific for
18S ribosomal RNA were used for normalization. FIG. 5E depicts
analysis of skeletal muscle gene expression in wild-type (filled
box) and PGC-1.alpha. deficient (open box) mice by quantitative
real-time PCR. Quadriceps muscle was dissected from 4-month old
male mice and frozen at -80.degree. C. before RNA isolation and
analysis. Primers specific for 18S ribosomal RNA were used for
normalization. FIG. 5F depicts the activation of AMPK in
PGC-1.alpha..sup.-/- skeletal muscle. Tissue extracts were prepared
from wild-type or PGC-1.alpha. null quadriceps muscle and analyzed
by immunoblotting using antibodies specific for phosphorylated AMPK
(pAMPK) and ACC (pACC), or an antibody that reacts with both
phosphorylated and non-phosphorylated forms of AMPK.
[0020] FIGS. 6A-D depict hyperactivity and limb clasping in
PGC-1.alpha..sup.-/- mice. FIG. 6A depicts a representative trace
of movement monitoring for PGC-1.alpha..sup.+/+ (circles) and
PGC-1.alpha..sup.-/- (squares) mice over a period of three days.
FIG. 6B depicts a representative trace of whole body O.sub.2
consumption in PGC-1.alpha..sup.+/+ (circles) and
PGC-1.alpha..sup.-/- (squares) mice. N and D denote night and day
periods, respectively. FIG. 6C is a graph depicting measurements of
physical activity in 3-month old male mice with CLAMS. Shown is the
average movement counts during the monitoring period. *p<0.01.
FIG. 6D illustrates the limb clasping in PGC-1.alpha..sup.-/-
mice.
[0021] FIGS. 7A-H depict the results of histological staining of
brain sections from wild type and PGC-1.alpha. null mice. FIGS.
7A-B depict low magnification pictures showing cortex (ctx) and
striatum (STR) of PGC-1.alpha..sup.+/+ mouse brain (FIG. 7A) and
PGC-1.alpha..sup.-/- mice (FIG. 7B) stained with Luxol fast blue
and H&E. Note spongiform pathology predominantly in the
striatum of the PGC-1.alpha..sup.-/- mouse brain (red arrows).
(Scalebar=200 .mu.m). FIGS. 7C-D depict high magnification pictures
of the striatum of wild type (FIG. 7C) and PGC-1.alpha..sup.-/-
brains (FIG. 7D) stained with Luxol fast blue/H&E. Shown are
spongiform lesions in the striatum that are predominantly
associated with the white matter. FIGS. 7E-F depicts
immunohistochemical staining with an anti-GFAP antibody. Note
abundant presence of reactive astrocytes (blue arrows) in the
striatum of PGC-1.alpha..sup.-/- mice (FIG. 7F), but not in wild
type controls (FIG. 7E). FIGS. 7G-H depicts less striatal neurites
are detected in the PGC-1.alpha..sup.-/- brain (FIG. 7H) with a
neurofilament heavy chain antibody compared to wild-type striatum
(FIG. 7G). (Scalebar=200 .mu.m).
[0022] FIGS. 8 A-B depict gene expression analysis in mouse brain
and neurite growth in cultured primary striatal neurons. FIG. 8A is
a graph depicting analysis of mitochondrial gene expression in
wild-type (filled box, n=4) and PGC-1.alpha. deficient (open box,
n=6) mouse brain by real-time PCR. Whole brain was dissected from
3-month old male mice and frozen at -80.degree. C. before RNA
isolation and analysis. Primers specific for 18S ribosomal RNA were
used for normalization. *p<0.02. FIG. 8B is a graph depicting
real-time PCR analysis of non-mitochondrial genes involved in
normal brain function as in (FIG. A). *p<0.02.
[0023] FIGS. 9A-D depict genotyping of mice of the present
invention by PCR with tail DNA. In particular, FIG. 9A illustrates
DNA that was isolated from neomycin-resistant ES cell clones,
digested with BamHI and subjected to hybridization using probe L to
detect homologous recombination and the presence of the flox
allele. FIGS. 9B-D illustrate chimeric founders which were bred
with wild-type C57/Bl6 mice to obtain offspring containing a
germ-line PGC-1.alpha. flox allele. Primers used for genotyping
include SEQ ID NO:s 41 and 42 for wild type animals and SEQ ID NO:s
43 and 44 for knock-out animals.
[0024] FIGS. 10A & B depict a model arising from these studies
concerning the dietary control of gluconeogenesis.
DETAILED DESCRIPTION OF THE INVENTION
[0025] The present invention is based, at least in part, on the
discovery that modulation of PGC-1.alpha., e.g., PGC-1.alpha.
expression or activity, leads to the modulation of lesion
formation, e.g., brain lesion formation, neurological degeneration,
and neurite formation. Therefore, in one aspect, the present
invention provides methods for treating and/or preventing a
neurological disease or disorder in a subject, e.g., a human
subject, by administering to the subject a PGC-1.alpha. modulator,
e.g., a PGC-1.alpha. agonist or antagonist.
[0026] PGC-1.alpha. null animals, e.g., mice, have been generated
which display neurological defects, e.g., brain lesions, and
histological abnormalities of the brain. The PGC-1.alpha. deficient
animals also display behavioral abnormalities, e.g., hyperactivity,
and an increase in energy expenditure which correlates with their
increased activity. Because of this increase in energy expenditure
and hyperactivity, the PGC-1.alpha.-deficient animals are also
resistant to obesity and insulin resistance.
[0027] It has been determined that the behavioral abnormalities of
these animals are associated with lesions in the brain, e.g., the
striatum, a brain area that plays a role in motor coordination.
Without intending to be bound by theory; the prominent spongiform
lesions in the striatum and in other areas of the PGC-1.alpha. null
mouse brain suggest that abnormal CNS function is likely underlying
the hyperactivity in the null animals. It is possible that many of
these affected neurons play an inhibitory function with respect to
physical movements of the mice, in that their loss is accompanied
by increased movement and other neurological abnormalities. The
PGC-1.alpha.-deficient animals also display alterations in the
expression of genes involved in oxidative metabolism and neuronal
function, and display impaired neurite growth. Furthermore, the
hyperactivity displayed by mice deficient in PGC-1.alpha. with
neurodegeneration is similar to the hyperactivity associated with
neurological diseases and disorders, including, for example,
Huntington's disease (HD).
[0028] Accordingly, in one aspect, the present invention is based,
at least in part, on the discovery that PGC-1.alpha. functions in
the development of neurological diseases and disorders, including
neurodegenerative diseases and disorders and movement disorders,
and is involved in mitochondrial function in the brain, lesion
formation in the brain, neurite generation, and neurological
degeneration. Therefore, modulation of PGC-1.alpha., e.g.,
modulation of the expression or activity of PGC-1.alpha. and/or the
pathways controlled by PGC-1.alpha., through genetic or
pharmacological methods, can improve brain function in neurological
diseases and disorders or protect the brain from developing
characteristics associated with neurological diseases or disorders,
to thereby treat and/or prevent neurological diseases and disorders
in a subject.
[0029] In another aspect, the present invention provides methods
for modulating a neurological disease or disorder in a subject by
administering a PGC-1.alpha. modulator to induce PGC-1.alpha.
expression or activity. The present invention also provides methods
for modulating mitochondrial function, e.g., in the brain, in a
subject by administering a PGC-1.alpha. modulator to induce
PGC-1.alpha. expression or activity. The present invention also
provides methods for modulating lesion formation and neurite growth
by administering a PGC-1.alpha. modulator to induce PGC-1.alpha.
expression or activity.
[0030] In another aspect, the invention features methods for
identifying a compound which modulates the expression or activity
of PGC-1.alpha.. The methods include contacting PGC-1.alpha. or a
cell expressing PGC-1.alpha. with a test compound and determining
the effect of the test compound on the expression or activity of
PGC-1.alpha. to, thereby, identify a compound which modulates,
e.g., increases or decreases, PGC-1.alpha. expression or
activity.
[0031] In another aspect, the invention features a non-human
animal, in which the gene encoding the PGC-1.alpha. protein is
misexpressed. In preferred embodiments, the non-human animal is a
transgenic animal. The transgenic non-human animal can be, without
limitation, a mammal; a bird; a reptile or an amphibian. Suitable
mammals for uses described herein include, e.g., ruminants,
ungulates, domesticated mammals, and dairy animals. Other suitable
animals include goats, sheep, camels, cows, pigs, horses, oxen,
llamas, chickens, geese, and turkeys. Methods for the preparation
and use of such animals are known in the art. A protocol for the
production of a transgenic pig can be found in White and
Yannoutsos, Current Topics in Complement Research: 64th Forum in
Immunology, pp. 88-94; U.S. Pat. No. 5,523,226; U.S. Pat. No.
5,573,933; PCT Application WO93/25071; and PCT Application
WO95/04744. A protocol for the production of a transgenic rat can
be found in Bader and Ganten, Clinical and Experimental
Pharmacology and Physiology, Supp. 3:S81-S87, 1996. A protocol for
the production of a transgenic cow can be found in Transgenic
Animal Technology, A Handbook, 1994, ed., Carl A. Pinkert, Academic
Press, Inc. A protocol for the production of a transgenic sheep can
be found in Transgenic Animal Technology, A Handbook, 1994, ed.,
Carl A. Pinkert, Academic Press, Inc.
DEFINITIONS
[0032] As used herein, the term "modulator of PGC-1.alpha.
expression or activity" includes a compound or agent that is
capable of modulating or regulating PGC-1.alpha. expression or at
least one PGC-1.alpha. activity, as described herein. A modulator
of PGC-1.alpha. expression or activity can be an inducer of
PGC-1.alpha. expression or activity or an inhibitor of PGC-1.alpha.
expression or activity. As used herein, an "inducer or agonist of
PGC-1.alpha. activity" agonizes, stimulates, enhances, and/or
mimics a PGC-1.alpha. activity, either completely or partially. An
"inducer or agonist of PGC-1.alpha. expression" increases,
enhances, or stimulates PGC-1.alpha. expression, either completely
or partially, directly or indirectly. As used herein, an "inhibitor
or antagonist of PGC-1.alpha. activity" antagonizes, reduces, or
blocks PGC-1.alpha. activity, either completely or partially. An
"inhibitor or antagonist of PGC-1.alpha. expression" reduces or
blocks PGC-1.alpha. expression, either completely or partially,
directly or indirectly. Examples of PGC-1.alpha. inhibitors include
small molecules, antisense PGC-1.alpha. nucleic acid molecules,
ribozymes, siRNA molecules, and anti-PGC-1.alpha. antibodies.
Examples of PGC-1.alpha. inducers include PGC-1.alpha. mimetics,
e.g., peptidomimetics, small molecules, nucleic acid molecules
encoding PGC-1.alpha., and PGC-1.alpha. proteins or fragments
thereof.
[0033] As used interchangeably herein, a "PGC-1.alpha. activity",
"biological activity of PGC-1.alpha." or "functional activity of
PGC-1.alpha." refers to an activity exerted by a PGC-1.alpha.
polypeptide or nucleic acid molecule on a PGC-1.alpha. responsive
molecule, cell, or tissue, as determined in vitro and/or in vivo,
according to standard techniques. In an exemplary embodiment, a
PGC-1.alpha. activity is the ability to modulate mitochondrial
function, e.g., oxidative metabolism. In another embodiment,
PGC-1.alpha. activity is the ability to modulate the activity or
expression of a mitochondrial gene, e.g., LDH2,Ndufb5, COX6a1, or
ATP5j. In yet another embodiment, a PGC-1.alpha. activity is the
ability to modulate the expression or activity of a neuronal gene,
e.g., NF--H, NF-M, MOBP, ATPa1, or ATP1a2. In a further embodiment,
PGC-1.alpha. activity is the ability to modulate lesion formation,
e.g., brain lesion formation, in, for example, the striatum. In yet
another embodiment, PGC-1.alpha. activity is the ability to
modulate neurite formation and/or neuronal degeneration. In another
embodiment, PGC-1.alpha. activity is the ability to modulate body
weight and energy expenditure, e.g., via hyperactivity. In a
further embodiment, PGC-1.alpha. activity is the ability to
modulate gluconeogenesis, e.g., via coactivation of Foxo1,
HNF4.alpha., GR, and other factors. In still another embodiment,
PGC-1.alpha. activity is the ability to modulate interact with
(e.g., bind to) nuclear hormone receptors. In a preferred
embodiment, PGC-1.alpha. activity is the ability to modulate
neurological diseases or disorders, e.g., neurodegenerative
diseases or disorders, in a subject.
[0034] As used herein, the term "neurological disease or disorder"
includes any disease, disorder, or condition which is caused by or
related to dysfunction or deficiency of the central nervous system,
including, but not limited to mitochondrial dysfunction, lesion
formation, neural degeneration, or misregulation or modulation of
any central nervous system specific pathway or central nervous
system specific activity. Neurological diseases or disorders
include neurodegenerative and cognitive disorders. Examples of
neurological diseases and disorders include, but are not limited
to, Alzheimer's disease, Parkinson's disease, Huntington's disease,
Pick's disease, Kuf's disease, Lewy body disease, neurofibrillary
tangles, Rosenthal fibers, Mallory's hyaline, senile dementia,
myasthenia gravis, Gilles de la Tourette's syndrome, multiple
sclerosis (MS), amyotrophic lateral sclerosis (ALS), progressive
supranuclear palsy (PSP), epilepsy, Creutzfeldt-Jakob disease,
deafness-dytonia syndrome, Leigh syndrome, Leber hereditary optic
neuropathy (LHON), parkinsonism, dystonia, motor neuron disease,
neuropathy-ataxia and retinitis pimentosa (NARP), maternal
inherited Leigh syndrome (MILS), Friedreich ataxia, hereditary
spastic paraplegia, Mohr-Tranebjaerg syndrome, Wilson disease,
sporatic Alzheimer's disease, sporadic amyotrophic lateral
sclerosis, sporadic Parkinson's disease, autonomic function
disorders, hypertension, sleep disorders, neuropsychiatric
disorders, depression, schizophrenia, schizoaffective disorder,
korsakoff's psychosis, mania, anxiety disorders, phobic disorder,
learning or memory disorders, amnesia or age-related memory loss,
attention deficit disorder, dysthymic disorder, major depressive
disorder, obsessive-compulsive disorder, psychoactive substance use
disorders, panic disorder, bipolar affective disorder, severe
bipolar affective (mood) disorder (BP-1), migraines, hyperactivity
and movement disorders. As used herein, the term "movement
disorder" includes neurological diseases or disorders that involve
the motor and movement systems, resulting in a range of
abnormalities that affect the speed, quality and ease of movement.
Movement disorders are often caused by or related to abnormalities
in brain structure and/or function. Movement disorders include, but
are not limited to (i) tremors: including, but not limited to, the
tremor associated with Parkinson's Disease, physiologic tremor,
benign familial tremor, cerebellar tremor, rubral tremor, toxic
tremor, metabolic tremor, and senile tremor; (ii) chorea,
including, but not limited to, chorea associated with Huntington's
Disease, Wilson's Disease, ataxia telangiectasia, infection, drug
ingestion, or metabolic, vascular or endocrine etiology (e.g.,
chorea gravidarum or thyrotoxicosis); (iii) ballism (defined herein
as abruptly beginning, repetitive, wide, flinging movements
affecting predominantly the proximal limb and girdle muscles); (iv)
athetosis (defined herein as relatively slow, twisting, writhing,
snake-like movements and postures involving the trunk, neck, face
and extremities); (v) dystonia (defined herein as a movement
disorder consisting of twisting, turning tonic skeletal muscle
contractions, most, but not all of which are initiated distally);
(vi) paroxysmal choreoathetosis and tonic spasm; (vii) tics
(defined herein as sudden, behaviorally related, irregular,
stereotyped, repetitive movements of variable complexity); (viii)
tardive dyskinesia; (ix) akathesia, (x) muscle rigidity, defined
herein as resistance of a muscle to stretch; (xi) postural
instability; (xii) bradykinesia; (xiii) difficulty in initiating
movements; (xiv) muscle cramps; (xv) dyskinesias and (xvi)
myoclonus.
[0035] The term "mitochondrial function" includes any cellular
activity carried out by mitochondria or mitochondrial genes,
including mitochondria or mitochondrial genes in brain cells, e.g.,
neurons. For example, mitochondria play a role in a number of
important cellular functions including, for example, oxidative
energy metabolism, amino acid biosynthesis, fatty acid oxidation,
steroid metabolism, and apoptosis. "Mitochondrial dysfunction"
includes any failure or deficiency of mitochondria or mitochondrial
genes to carry out a mitochondrial function, e.g., oxidative energy
metabolism.
[0036] The term "treatment", as used herein, is defined as the
application or administration of a therapeutic agent to a patient,
or application or administration of a therapeutic agent to an
isolated tissue or cell line from a patient, who has a disease or
disorder, a symptom of a disease or disorder or a predisposition
toward a disease or disorder, with the purpose of curing, healing,
alleviating, relieving, altering, remedying, ameliorating,
improving or affecting the disease or disorder, the symptoms of
disease or disorder or the predisposition toward a disease or
disorder. A therapeutic agent includes, but is not limited to,
small molecules, peptides, peptidomimetics, nucleic acid molecules,
antibodies, ribozymes, siRNA molecules, and sense and antisense
oligonucleotides described herein.
[0037] As used herein, "administering a treatment to an animal or
cell" is intended to refer to dispensing, delivering or applying a
treatment to an animal or cell. In terms of the therapeutic agent,
the term "administering" is intended to refer to contacting or
dispensing, delivering or applying the therapeutic agent to an
animal by any suitable route for delivery of the therapeutic agent
to the desired location in the animal, including delivery by either
the parenteral or oral route, intramuscular injection,
subcutaneous/intradermal injection, intravenous injection, buccal
administration, transdermal delivery and administration by the
intranasal or respiratory tract route.
[0038] As used herein, the term "compound" includes any agent,
e.g., peptide, peptidomimetic, small molecule, or other drug, which
binds to a PGC-1.alpha. protein or has a stimulatory or inhibitory
effect on, for example, PGC-1.alpha. expression or PGC-1.alpha.
activity.
[0039] An "inducible" promoter is a nucleotide sequence which, when
operably linked with a polynucleotide which encodes or specifies a
gene product, causes the gene product to be produced in a living
human cell substantially only when an inducer which corresponds to
the promoter is present in the cell.
[0040] A "tissue-specific" promoter is a nucleotide sequence which,
when operably linked with a polynucleotide which encodes or
specifies a gene, product, causes the gene product to be produced
in a living human cell substantially only if the cell is a cell of
the tissue type corresponding to the promoter, e.g., a brain cell.
PGC-1.alpha. may be expressed in specific portions of the brain,
e.g., in an animal model or in a subject to treat or prevent a
neurological disease or disorder. Furthermore, in another
embodiment, tissue specific PGC-1.alpha. knock-out animal models
may also be produced wherein PGC-1.alpha. is flanked (or "foxed")
by two or more lox sites, most commonly loxP sites, and is excised
using the Cre recombinase protein, as is known in the art and
described herein In one embodiment, a knock-out animal is used to
evaluate the function of PGC-1.alpha. in a specific nervous system
tissue.
[0041] The term "polymorphism" refers to the coexistence of more
than one form of a gene or portion thereof. A portion of a gene of
which there are at least two different forms, i.e., two different
nucleotide sequences, is referred to as a "polymorphic region of a
gene." A polymorphic locus can be a single nucleotide, the identity
of which differs in the other alleles. A polymorphic locus can also
be more than one nucleotide long. The allelic form occurring most
frequently in a selected population is often referred to as the
reference and/or wildtype form. Other allelic forms are typically
designated, alternative, or variant alleles. Diploid organisms may
be homozygous or heterozygous for allelic forms. A diallelic or
biallelic polymorphism has two forms. A trialleleic polymorphism
has three forms.
[0042] The term "single nucleotide polymorphism" (SNP) refers to a
polymorphic site occupied by a single nucleotide, which is the site
of variation between allelic sequences. A SNP usually arises due to
substitution of one nucleotide for another at the polymorphic site.
SNPs can also arise from a deletion of a nucleotide or an insertion
of a nucleotide relative to a reference allele. Typically, the
polymorphic site is occupied by a base other than the reference
base. For example, where the reference allele contains the base "T"
(thymidine) at the polymorphic site, the altered allele can contain
a "C" (cytidine), "G" (guanine), or "A" (adenine) at the
polymorphic site.
[0043] SNP's may occur in protein-coding nucleic acid sequences, in
which case they may give rise to a defective or otherwise variant
protein, or genetic disease. Such a SNP may alter the coding
sequence of the gene and therefore specify another amino acid (a
"missense" SNP) or a SNP may introduce a stop codon (a "nonsense"
SNP). When a SNP does not alter the amino acid sequence of a
protein, the SNP is called "silent." SNP's may also occur in
noncoding regions of the nucleotide sequence. This may result in
defective protein expression, e.g., as a result of alternative
spicing, or it may have no effect.
[0044] The term "linkage" describes the tendency of genes, alleles,
loci or genetic markers to be inherited together as a result of
their location on the same chromosome. It can be measured by
percent recombination between the two genes, alleles, loci, or
genetic markers. The term "linkage disequilibrium," also referred
to herein as "LD," refers to a greater than random association
between specific alleles at two marker loci within a particular
population. In general, linkage disequilibrium decreases with an
increase in physical distance. If linkage disequilibrium exists
between two markers, or SNPs, then the genotypic information at one
marker, or SNP, can be used to make probabilistic predictions about
the genotype of the second marker.
[0045] As used herein, a "transgenic animal" is a non-human animal,
preferably a mammal, more preferably a rodent such as a rat or
mouse, in which one or more of the cells of the animal includes a
transgene. Other examples of transgenic animals include non-human
primates, sheep, dogs, cows, goats, chickens, amphibians, etc. A
transgene is exogenous DNA which is integrated into the genome of a
cell from which a transgenic animal develops and which remains in
the genome of the mature animal, thereby directing the expression
of an encoded gene product in one or more cell types or tissues of
the transgenic animal. The transgene is introduced into the cell,
directly or indirectly by introduction into a precursor of the
cell, e.g., by microinjection, transfection or infection, e.g., by
infection with a recombinant virus. The term genetic manipulation
includes the introduction of a recombinant DNA molecule. This
molecule may be integrated within a chromosome, or it may be
extrachromosomally replicating DNA.
[0046] As used herein, an "homologous recombinant animal" is a
non-human animal, preferably a mammal, more preferably a mouse, in
which an endogenous gene has been altered by homologous
recombination between the endogenous gene and an exogenous DNA
molecule introduced into a cell of the animal, e.g., an embryonic
cell of the animal, prior to development of the animal. Transgenic
animals also include inducible transgenic animals, such as those
described in, for example, Chan I. T., et al. (2004) J Clin Invest.
113(4):528-38 and Chin L. et al (1999) Nature 400(6743):468-72.
[0047] As used herein, the term "rodent" refers to all members of
the phylogenetic order Rodentia.
[0048] As used herein, the term "misexpression" includes a non-wild
type pattern of gene expression. Expression as used herein includes
transcriptional, post transcriptional, e.g., mRNA stability,
translational, and post translational stages. Misexpression
includes: expression at non-wild type levels, i.e., over or under
expression; a pattern of expression that differs from wild type in
terms of the time or stage at which the gene is expressed, e.g.,
increased or decreased expression (as compared with wild type) at a
predetermined developmental period or stage; a pattern of
expression that differs from wild type in terms of decreased
expression (as compared with wild type) in a predetermined cell
type or tissue type; a pattern of expression that differs from wild
type in terms of the splicing size, amino acid sequence,
post-transitional modification, or biological activity of the
expressed polypeptide; a pattern of expression that differs from
wild type in terms of the effect of an environmental stimulus or
extracellular stimulus on expression of the gene, e.g., a pattern
of increased or decreased expression (as compared with wild type)
in the presence of an increase or decrease in the strength of the
stimulus. Misexpression includes any expression from a transgenic
nucleic acid. Misexpression includes the lack or non-expression of
a gene or transgene, e.g., that can be induced by a deletion of all
or part of the gene or its control sequences.
[0049] As used herein, the term "knockout" refers to an animal or
cell therefrom, in which the insertion of a transgene disrupts an
endogenous gene in the animal or cell therefrom. This disruption
can essentially eliminate PGC-1.alpha. in the animal or cell.
[0050] In preferred embodiments, misexpression of the gene encoding
the PGC-1.alpha. protein is caused by disruption of the
PGC-1.alpha. gene. For example, the PGC-1.alpha. gene can be
disrupted through removal of DNA encoding all or part of the
protein.
[0051] In preferred embodiments, the animal can be heterozygous or
homozygous for a misexpressed PGC-1.alpha. gene, e.g., it can be a
transgenic animal heterozygous or homozygous for a PGC-1.alpha.
transgene.
[0052] In preferred embodiments, the animal is a transgenic mouse
with a transgenic disruption of the PGC-1.alpha. gene, preferably
an insertion or deletion, which inactivates the gene product.
[0053] In another aspect, the invention features, a nucleic acid
molecule which, when introduced into an animal or cell, results in
the misexpression of the PGC-1.alpha. gene in the animal or cell.
In preferred embodiments, the nucleic acid molecule includes a
PGC-1.alpha. nucleotide sequence which includes a disruption, e.g.,
an insertion or deletion and preferably the insertion of a marker
sequence.
[0054] As used herein, "disruption of a gene" refers to a change in
the gene sequence, e.g., a change in the coding region. Disruption
includes insertions, deletions, point mutations, and
rearrangements, e.g., inversions. The disruption can occur in a
region of the native PGC-1.alpha. DNA sequence (e.g., one or more
exons) and/or the promoter region of the gene so as to decrease or
prevent expression of the gene in a cell as compared to the
wild-type or naturally occurring sequence of the gene. The
"disruption" can be induced by classical random mutation or by site
directed methods. Disruptions can be transgenically introduced. The
deletion of an entire gene is a disruption. Preferred disruptions
reduce PGC-1.alpha. levels to about 50% of wild type, in
heterozygotes or essentially eliminate PGC-1.alpha. in
homozygotes.
[0055] As used herein, the term "transgenic cell" refers to a cell
containing a transgene.
[0056] Various aspects of the invention are described in further
detail in the following subsections:
[0057] I. Screening Assays:
[0058] The invention provides a method (also referred to herein as
a "screening assay") for identifying modulators, i.e., candidate or
test compounds or agents (e.g., peptides, peptidomimetics, small
molecules (organic or inorganic) or other drugs) which bind to
PGC-1.alpha. proteins, have a stimulatory or inhibitory effect on,
for example, PGC-1.alpha. expression or PGC-1.alpha. activity, or
have a stimulatory or inhibitory effect on, for example, the
expression or activity of a PGC-1.alpha. substrate. Compounds
identified using assays described herein may be useful for
modulating PGC-1.alpha. expression or activity, e.g., increasing
PGC-1.alpha. expression or activity. Thus, these compounds would be
useful for treating or preventing neurological diseases or
disorders.
[0059] These assays are designed to identify compounds that bind to
or interact with a PGC-1.alpha. protein, or bind to or interact
with other intracellular or extracellular proteins that interact
with or modulate a PGC-1.alpha. protein. Such compounds may
include, but are not limited to peptides, antibodies, nucleic acid
molecules, siRNA molecules, or small organic or inorganic
compounds. Such compounds may also include other cellular
proteins.
[0060] Compounds identified via assays such as those described
herein may be useful, for example, modulating PGC-1.alpha., e.g.,
by causing increased PGC-1.alpha. expression or activity and, for
example, decreased lesion formation, increased neurite growth and
decreased mitochondrial dysfunction. Thus, these compounds would be
useful for treating or preventing a neurological disease or
disorder. In instances whereby increased PGC-1.alpha. activity or
expression is desired compounds that interact with the PGC-1.alpha.
protein may include compounds which accentuate or amplify the
expression or activity of PGC-1.alpha. protein. Such compounds
would bring about an effective increase in the level of
PGC-1.alpha. protein activity, thus identifying, treating or
preventing neurological diseases or disorders. For example, a
partial agonist or an agonist administered in a dosage or for a
length of time to increase expression or activity of PGC-1.alpha.
would act to increase mitochondrial function, reduce lesion
formation, induce neurite growth, and treat or prevent a
neurological disease or disorder. Alternatively, in instances
whereby decreased PGC-1.alpha. activity or expression is desired,
e.g., to induce symptoms of a neurological disease or disorder in
an animal model or to induce weight loss, compounds that interact
with the PGC-1.alpha. protein may include compounds which inhibit
or suppress the expression or activity of PGC-1.alpha. protein.
Such compounds would bring about an effective decrease in the level
of PGC-1.alpha. protein activity, thus acting as an inducer for a
neurological disease or disorder, depending on the dosage of the
compound and the length of time the compound is administered.
[0061] In one embodiment, the invention provides assays for
screening candidate or test compounds which are substrates of or
interact with a PGC-1.alpha. protein or polypeptide or biologically
active portion thereof. In another embodiment, the invention
provides assays for screening candidate or test compounds which
bind to or modulate the activity of a PGC-1.alpha. protein or
polypeptide or biologically active portion thereof. The test
compounds of the present invention can be obtained using any of the
numerous approaches in combinatorial library methods known in the
art, including: biological libraries; spatially addressable
parallel solid phase or solution phase libraries; synthetic library
methods requiring deconvolution; the `one-bead one-compound`
library method; and synthetic library methods using affinity
chromatography selection. The biological library approach is
limited to peptide libraries, while the other four approaches are
applicable to peptide, non-peptide oligomer or small molecule
libraries of compounds (Lam, K. S. (1997) Anticancer Drug Des.
12:145).
[0062] Examples of methods for the synthesis of molecular libraries
can be found in the art, for example in: DeWitt et al. (1993) Proc.
Natl. Acad. Sci. U.S.A. 90:6909; Erb et al. (1994) Proc. Natl.
Acad. Sci. USA 91:11422; Zuckermann et al. (1994). J. Med. Chem.
37:2678; Cho et al. (1993) Science 261:1303; Carrell et al. (1994)
Angew. Chem. Int. Ed. Engl. 33:2059; Carell et al. (1994) Angew.
Chem. Int. Ed. Engl. 33:2061; and in Gallop et al. (1994) J. Med.
Chem. 37:1233.
[0063] Libraries of compounds may be presented in solution (e.g.,
Houghten (1992) Biotechniques 13:412-421), or on beads (Lam (1991)
Nature 354:82-84), chips (Fodor (1993) Nature 364:555-556),
bacteria (Ladner U.S. Pat. No. 5,223,409), spores (Ladner USP
'409), plasmids (Cull et al. (1992) Proc Natl Acad Sci USA
89:1865-1869) or on phage (Scott and Smith (1990) Science
249:386-390); (Devlin (1990) Science 249:404-406); (Cwirla et al.
(1990) Proc. Natl. Acad. Sci. 87:6378-6382); (Felici (1991) J. Mol.
Biol. 222:301-310); (Ladner supra.).
[0064] In one embodiment, an assay is a cell-based assay in which a
cell which expresses a PGC-1.alpha. protein or biologically active
portion thereof is contacted with a test compound and the ability
of the test compound to modulate PGC-1.alpha. activity is
determined. Determining the ability of the test compound to
modulate PGC-1.alpha. activity can be accomplished by monitoring,
for example, intracellular calcium, IP.sub.3, cAMP, or
diacylglycerol concentration, or the phosphorylation profile of
intracellular proteins, or the level of transcription of downstream
genes. The cell can be of mammalian origin, e.g., a neuron. In one
embodiment, compounds that interact with PGC-1.alpha. binding site
can be screened for their ability to function as ligands, i.e., to
bind to PGC-1.alpha. binding site and modulate transcription or
modulate a signal transduction pathway. Identification of
PGC-1.alpha. ligands, and measuring the activity of the
ligand-PGC-1.alpha. complex, leads to the identification of
modulators (e.g., antagonists or agonists) of this interaction.
Such modulators may be useful in the treatment and prevention of a
neurological disease or disorder modulation of PGC-1.alpha., e.g.,
by causing increased expression or activity of PGC-1.alpha..
[0065] The ability of the test compound to modulate PGC-1.alpha.
binding to a substrate or to bind to PGC-1.alpha. can also be
determined. Determining the ability of the test compound to
modulate PGC-1.alpha. binding to a substrate can be accomplished,
for example, by coupling the PGC-1.alpha. substrate with a
radioisotope or enzymatic label such that binding of the
PGC-1.alpha. substrate to PGC-1.alpha. can be determined by
detecting the labeled PGC-1.alpha. substrate in a complex.
PGC-1.alpha. could also be coupled with a radioisotope or enzymatic
label to monitor the ability of a test compound to modulate
PGC-1.alpha. binding to a PGC-1.alpha. substrate in a complex.
Determining the ability of the test compound to bind PGC-1.alpha.
can be accomplished, for example, by coupling the compound with a
radioisotope or enzymatic label such that binding of the compound
to PGC-1.alpha. can be determined by detecting the labeled
PGC-1.alpha. compound in a complex. For example, compounds (e.g.,
PGC-1.alpha. ligands or substrates) can be labeled with .sup.125I,
.sup.35S, 14C, or .sup.3H, either directly or indirectly, and the
radioisotope detected by direct counting of radioemmission or by
scintillation counting. Compounds can further be enzymatically
labeled with, for example, horseradish peroxidase, alkaline
phosphatase, or luciferase, and the enzymatic label detected by
determination of conversion of an appropriate substrate to
product.
[0066] It is also within the scope of this invention to determine
the ability of a compound (e.g., a PGC-1.alpha. ligand or
substrate) to interact with PGC-1.alpha. without the labeling of
any of the interactants. For example, a microphysiometer can be
used to detect the interaction of a compound with PGC-1.alpha.
without the labeling of either the compound or the PGC-1.alpha.
(McConnell, H. M. et al. (1992) Science 257:1906-1912. As used
herein, a "microphysiometer" (e.g., Cytosensor) is an analytical
instrument that measures the rate at which a cell acidifies its
environment using a light-addressable potentiometric sensor (LAPS).
Changes in this acidification rate can be used as an indicator of
the interaction between a compound and PGC-1.alpha..
[0067] In another embodiment, an assay is a cell-based assay
comprising contacting a cell expressing a PGC-1.alpha. target
molecule (e.g., a PGC-1.alpha. substrate) with a test compound and
determining the ability of the test compound to modulate (e.g.,
stimulate or inhibit) the activity of the PGC-1.alpha. target
molecule. Determining the ability of the test compound to modulate
the activity of a PGC-1.alpha. target molecule can be accomplished,
for example, by determining the ability of the PGC-1.alpha. protein
to bind to or interact with the PGC-1.alpha. target molecule.
[0068] Determining the ability of the PGC-1.alpha. protein or a
biologically active fragment thereof, to bind to or interact with a
PGC-1.alpha. target molecule can be accomplished by one of the
methods described above for determining direct binding. In a
preferred embodiment, determining the ability of the PGC-1.alpha.
protein to bind to or interact with a PGC-1.alpha. target molecule
can be accomplished by determining the activity of the target
molecule. For example, the activity of the target molecule can be
determined by detecting induction of a cellular second messenger of
the target (i.e., intracellular Ca.sup.2+, diacylglycerol,
IP.sub.3, cAMP), detecting catalytic/enzymatic activity of the
target on an appropriate substrate, detecting the induction of a
reporter gene (comprising a target-responsive regulatory element
operatively linked to a nucleic acid encoding a detectable marker,
e.g., luciferase), or detecting a target-regulated cellular
response (e.g., gene expression).
[0069] In yet another embodiment, an assay of the present invention
is a cell-free assay in which a PGC-1.alpha. protein or
biologically active portion thereof, is contacted with a test
compound and the ability of the test compound to bind to the
PGC-1.alpha. protein or biologically active portion thereof is
determined. Preferred biologically active portions of the
PGC-1.alpha. proteins to be used in assays of the present invention
include fragments which participate in interactions with
non-PGC-1.alpha. molecules, e.g., fragments with high surface
probability scores. Binding of the test compound to the
PGC-1.alpha. protein can be determined either directly or
indirectly as described above. In a preferred embodiment, the assay
includes contacting the PGC-1.alpha. protein or biologically active
portion thereof with a known compound which binds PGC-1.alpha. to
form an assay mixture, contacting the assay mixture with a test
compound, and determining the ability of the test compound to
interact with a PGC-1.alpha. protein, wherein determining the
ability of the test compound to interact with a PGC-1.alpha.
protein comprises determining the ability of the test compound to
preferentially bind to PGC-1.alpha. or biologically active portion
thereof as compared to the known compound. Compounds that modulate
the interaction of PGC-1.alpha. with a known target protein may be
useful in regulating the activity of a PGC-1.alpha. protein,
especially a mutant PGC-1.alpha. protein.
[0070] In another embodiment, the assay is a cell-free assay in
which a PGC-1.alpha. protein or biologically active portion thereof
is contacted with a test compound and the ability of the test
compound to modulate (e.g., stimulate or inhibit) the activity of
the PGC-1.alpha. protein or biologically active portion thereof is
determined. Determining the ability of the test compound to
modulate the activity of a PGC-1.alpha. protein can be
accomplished, for example, by determining the ability of the
PGC-1.alpha. protein to bind to a PGC-1.alpha. target molecule by
one of the methods described above for determining direct binding.
Determining the ability of the PGC-1.alpha. protein to bind to a
PGC-1.alpha. target molecule can also be accomplished using a
technology such as real-time Biomolecular Interaction Analysis
(BIA) (Sjolander, S, and Urbaniczky, C. (1991) Anal. Chem.
63:2338-2345 and Szabo et al. (1995) Curr. Opin. Struct. Biol.
5:699-705). As used herein, "BIA" is a technology for studying
biospecific interactions in real time, without labeling any of the
interactants (e.g., BIAcore). Changes in the optical phenomenon of
surface plasmon resonance (SPR) can be used as an indication of
real-time reactions between biological molecules.
[0071] In another embodiment, determining the ability of the test
compound to modulate the activity of a PGC-1.alpha. protein can be
accomplished by determining the ability of the PGC-1.alpha. protein
to further modulate the activity of a downstream effector of a
PGC-1.alpha. target molecule. For example, the activity of the
effector molecule on an appropriate target can be determined or the
binding of the effector to an appropriate target can be determined
as previously described.
[0072] In yet another embodiment, the cell-free assay involves
contacting a PGC-1.alpha. protein or biologically active portion
thereof with a known compound which binds the PGC-1.alpha. protein
to form an assay mixture, contacting the assay mixture with a test
compound, and determining the ability of the test compound to
interact with the PGC-1.alpha. protein, wherein determining the
ability of the test compound to interact with the PGC-1.alpha.
protein comprises determining the ability of the PGC-1.alpha.
protein to preferentially bind to or modulate the activity of a
PGC-1.alpha. target molecule.
[0073] In more than one embodiment of the above assay methods of
the present invention, it may be desirable to immobilize either
PGC-1.alpha. or its target molecule to facilitate separation of
complexed from uncomplexed forms of one or both of the proteins, as
well as to accommodate automation of the assay. Binding of a test
compound to a PGC-1.alpha. protein, or interaction of a
PGC-1.alpha. protein with a target molecule in the presence and
absence of a candidate compound, can be accomplished in any vessel
suitable for containing the reactants. Examples of such vessels
include microtitre plates, test tubes, and micro-centrifuge tubes.
In one embodiment, a fusion protein can be provided which adds a
domain that allows one or both of the proteins to be bound to a
matrix. For example, glutathione-S-transferase/PGC-1.alpha. fusion
proteins or glutathione-S-transferase/target fusion proteins can be
adsorbed onto glutathione sepharose beads (Sigma Chemical, St.
Louis, Mo.) or glutathione derivatized microtitre plates, which are
then combined with the test compound or the test compound and
either the non-adsorbed target protein or PGC-1.alpha. protein, and
the mixture incubated under conditions conducive to complex
formation (e.g., at physiological conditions for salt and pH).
Following incubation, the beads or microtitre plate wells are
washed to remove any unbound components, the matrix immobilized in
the case of beads, complex determined either directly or
indirectly, for example, as described above. Alternatively, the
complexes can be dissociated from the matrix, and the level of
PGC-1.alpha. binding or activity determined using standard
techniques.
[0074] Other techniques for immobilizing proteins on matrices can
also be used in the screening assays of the invention. For example,
either a PGC-1.alpha. protein or a PGC-1.alpha. target molecule can
be immobilized utilizing conjugation of biotin and streptavidin.
Biotinylated PGC-1.alpha. protein or target molecules can be
prepared from biotin-NHS(N-hydroxy-succinimide) using techniques
known in the art (e.g., biotinylation kit, Pierce Chemicals,
Rockford, Ill.), and immobilized in the wells of
streptavidin-coated 96 well plates (Pierce Chemical).
Alternatively, antibodies reactive with PGC-1.alpha. protein or
target molecules but which do not interfere with binding of the
PGC-1.alpha. protein to its target molecule can be derivatized to
the wells of the plate, and unbound target or PGC-1.alpha. protein
trapped in the wells by antibody conjugation. Methods for detecting
such complexes, in addition to those described above for the
GST-immobilized complexes, include immunodetection of complexes
using antibodies reactive with the PGC-1.alpha. protein or target
molecule, as well as enzyme-linked assays which rely on detecting
an enzymatic activity associated with the PGC-1.alpha. protein or
target molecule.
[0075] In another embodiment, modulators of PGC-1.alpha. expression
are identified in a method wherein a cell is contacted with a
candidate compound and the expression of PGC-1.alpha. mRNA or
protein in the cell is determined. The level of expression of
PGC-1.alpha. mRNA or protein in the presence of the candidate
compound is compared to the level of expression of PGC-1.alpha.
mRNA or protein in the absence of the candidate compound. The
candidate compound can then be identified as a modulator of
PGC-1.alpha. expression based on this comparison. For example, when
expression of PGC-1.alpha. mRNA or protein is greater
(statistically significantly greater) in the presence of the
candidate compound than in its absence, the candidate compound is
identified as a stimulator of PGC-1.alpha. mRNA or protein
expression. Alternatively, when expression of PGC-1.alpha. mRNA or
protein is less (statistically significantly less) in the presence
of the candidate compound than in its absence, the candidate
compound is identified as an inhibitor of PGC-1.alpha. mRNA or
protein expression. The level of PGC-1.alpha. mRNA or protein
expression in the cells can be determined by methods described
herein for detecting PGC-1.alpha. mRNA or protein.
[0076] In yet another aspect of the invention, the PGC-1.alpha.
proteins can be used as "bait proteins" in a two-hybrid assay or
three-hybrid assay (see, e.g., U.S. Pat. No. 5,283,317; Zervos et
al. (1993) Cell 72:223-232; Madura et al. (1993) J. Biol. Chem.
268:12046-12054; Bartel et al. (1993) Biotechniques 14:920-924;
Iwabuchi et al. (1993) Oncogene 8:1693-1696; and Brent WO94/10300),
to identify other proteins, which bind to or interact with
PGC-1.alpha. ("PGC-1.alpha.-binding proteins" or "PGC-1.alpha.-bp")
and are involved in PGC-1.alpha. activity. Such
PGC-1.alpha.-binding proteins are also likely to be involved in the
propagation of signals by the PGC-1.alpha. proteins or PGC-1.alpha.
targets as, for example, downstream elements of a
PGC-1.alpha.-mediated signaling pathway. Alternatively, such
PGC-1.alpha.-binding proteins are likely to be PGC-1.alpha.
inhibitors.
[0077] The two-hybrid system is based on the modular nature of most
transcription factors, which consist of separable DNA-binding and
activation domains. Briefly, the assay utilizes two different DNA
constructs. In one construct, the gene that codes for a
PGC-1.alpha. protein is fused to a gene encoding the DNA binding
domain of a known transcription factor (e.g., GAL-4). In the other
construct, a DNA sequence, from a library of DNA sequences, that
encodes an unidentified protein ("prey" or "sample") is fused to a
gene that codes for the activation domain of the known
transcription factor. If the "bait" and the "prey" proteins are
able to interact, in vivo, forming a PGC-1.alpha.-dependent
complex, the DNA-binding and activation domains of the
transcription factor are brought into close proximity. This
proximity allows transcription of a reporter gene (e.g., LacZ)
which is operably linked to a transcriptional regulatory site
responsive to the transcription factor. Expression of the reporter
gene can be detected and cell colonies containing the functional
transcription factor can be isolated and used to obtain the cloned
gene which encodes the protein which interacts with the
PGC-1.alpha. protein.
[0078] In a further embodiment, assays may be devised through the
use of the invention for the purpose of identifying compounds which
modulate (e.g., affect either positively or negatively)
interactions between PGC-1.alpha. and its substrates and/or binding
partners. Such compounds can include, but are not limited to,
molecules such as small molecules, antibodies, peptides, hormones,
oligonucleotides, nucleic acids, and analogs thereof. Such
compounds may also be obtained from any available source, including
systematic libraries of natural and/or synthetic compounds. The
preferred assay components for use in this embodiment is a
transcriptional coactivator, PGC-1.alpha. identified herein, the
known binding partner and/or substrate of same, and the test
compound. Test compounds can be supplied from any source.
[0079] The basic principle of the assay systems used to identify
compounds that interfere with the interaction between PGC-1.alpha.
and its binding partner involves preparing a reaction mixture
containing PGC-1.alpha. and its binding partner under conditions
and for a time sufficient to allow the two products to interact and
bind, thus forming a complex. In order to test an agent for
inhibitory activity, the reaction mixture is prepared in the
presence and absence of the test compound. The test compound can be
initially included in the reaction mixture, or can be added at a
time subsequent to the addition of PGC-1.alpha. and its binding
partner. Control reaction mixtures are incubated without the test
compound or with a placebo. The formation of any complexes between
PGC-1.alpha. and its binding partner is then detected. The
formation of a complex in the control reaction, but less or no such
formation in the reaction mixture containing the test compound,
indicates that the compound interferes with the interaction of
PGC-1.alpha. and its binding partner. Conversely, the formation of
more complex in the presence of compound than in the control
reaction indicates that the compound may enhance interaction of
PGC-1.alpha. and its binding partner.
[0080] The assay for compounds that interfere with the interaction
of PGC-1.alpha. with its binding partner may be conducted in a
heterogeneous or homogeneous format. Heterogeneous assays involve
anchoring either PGC-1.alpha. or its binding partner onto a solid
phase and detecting complexes anchored to the solid phase at the
end of the reaction. In homogeneous assays, the entire reaction is
carried out in a liquid phase. In either approach, the order of
addition of reactants can be varied to obtain different information
about the compounds being tested. For example, test compounds that
interfere with the interaction between PGC-1.alpha. and the binding
partners (e.g., by competition) can be identified by conducting the
reaction in the presence of the test substance, i.e., by adding the
test substance to the reaction mixture prior to or simultaneously
with PGC-1.alpha. and its interactive binding partner.
Alternatively, test compounds that disrupt preformed complexes,
e.g., compounds with higher binding constants that displace one of
the components from the complex, can be tested by adding the test
compound to the reaction mixture after complexes have been formed.
The various formats are briefly described below.
[0081] In a heterogeneous assay system, either PGC-1.alpha. or its
binding partner is anchored onto a solid surface or matrix, while
the other corresponding non-anchored component may be labeled,
either directly or indirectly. In practice, microtitre plates are
often utilized for this approach. The anchored species can be
immobilized by a number of methods, either non-covalent or
covalent, that are typically well known to one who practices the
art. Non-covalent attachment can often be accomplished simply by
coating the solid surface with a solution of PGC-1.alpha. or its
binding partner and drying. Alternatively, an immobilized antibody
specific for the assay component to be anchored can be used for
this purpose. Such surfaces can often be prepared in advance and
stored.
[0082] In related embodiments, a fusion protein can be provided
which adds a domain that allows one or both of the assay components
to be anchored to a matrix. For example,
glutathione-S-transferase/PGC-1.alpha. fusion proteins or
glutathione-S-transferase/binding partner can be adsorbed onto
glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or
glutathione derivatized microtiter plates, which are then combined
with the test compound or the test compound and either the
non-adsorbed PGC-1.alpha. or its binding partner, and the mixture
incubated under conditions conducive to complex formation (e.g.,
physiological conditions). Following incubation, the beads or
microtiter plate wells are washed to remove any unbound assay
components; the immobilized complex assessed either directly or
indirectly, for example, as described above. Alternatively, the
complexes can be dissociated from the matrix, and the level of
PGC-1.alpha. binding or activity determined using standard
techniques.
[0083] Other techniques for immobilizing proteins on matrices can
also be used in the screening assays of the invention. For example,
either PGC-1.alpha. or PGC-1.alpha. binding partner can be
immobilized utilizing conjugation of biotin and streptavidin.
Biotinylated PGC-1.alpha. protein or target molecules can be
prepared from biotin-NHS(N-hydroxy-succinimide) using techniques
known in the art (e.g., biotinylation kit, Pierce Chemicals,
Rockford, Ill.), and immobilized in the wells of
streptavidin-coated 96 well plates (Pierce Chemical). In certain
embodiments, the protein-immobilized surfaces can be prepared in
advance and stored.
[0084] In order to conduct the assay, the corresponding partner of
the immobilized assay component is exposed to the coated surface
with or without the test compound. After the reaction is complete,
unreacted assay components are removed (e.g., by washing) and any
complexes formed will remain immobilized on the solid surface. The
detection of complexes anchored on the solid surface can be
accomplished in a number of ways. Where the non-immobilized
component is pre-labeled, the detection of label immobilized on the
surface indicates that complexes were formed. Where the
non-immobilized component is not pre-labeled, an indirect label can
be used to detect complexes anchored on the surface; e.g., using a
labeled antibody specific for the initially non-immobilized species
(the antibody, in turn, can be directly labeled or indirectly
labeled with, e.g., a labeled anti-Ig antibody). Depending upon the
order of addition of reaction components, test compounds which
modulate (inhibit or enhance) complex formation or which disrupt
preformed complexes can be detected.
[0085] In an alternate embodiment of the invention, a homogeneous
assay may be used. This is typically a reaction, analogous to those
mentioned above, which is conducted in a liquid phase in the
presence or absence of the test compound. The formed complexes are
then separated from unreacted components, and the amount of complex
formed is determined. As mentioned for heterogeneous assay systems,
the order of addition of reactants to the liquid phase can yield
information about which test compounds modulate (inhibit or
enhance) complex formation and which disrupt preformed
complexes.
[0086] In such a homogeneous assay, the reaction products may be
separated from unreacted assay components by any of a number of
standard techniques, including but not limited to: differential
centrifugation, chromatography, electrophoresis and
immunoprecipitation. In differential centrifugation, complexes of
molecules may be separated from uncomplexed molecules through a
series of centrifugal steps, due to the different sedimentation
equilibria of complexes based on their different sizes and
densities (see, for example, Rivas, G., and Minton, A. P., Trends
Biochem Sci 1993 August; 18(8):284-7). Standard chromatographic
techniques may also be utilized to separate complexed molecules
from uncomplexed ones. For example, gel filtration chromatography
separates molecules based on size, and through the utilization of
an appropriate gel filtration resin in a column format; for
example, the relatively larger complex may be separated from the
relatively smaller uncomplexed components. Similarly, the
relatively different charge properties of the complex as compared
to the uncomplexed molecules may be exploited to differentially
separate the complex from the remaining individual reactants, for
example through the use of ion-exchange chromatography resins. Such
resins and chromatographic techniques are well known to one skilled
in the art (see, e.g., Heegaard, 1998, J Mol. Recognit. 11:141-148;
Hage and Tweed, 1997, J. Chromatogr. B. Biomed. Sci. Appl.,
699:499-525). Gel electrophoresis may also be employed to separate
complexed molecules from unbound species (see, e.g., Ausubel et al
(eds.), In: Current Protocols in Molecular Biology, J. Wiley &
Sons, New York. 1999). In this technique, protein or nucleic acid
complexes are separated based on size or charge, for example. In
order to maintain the binding interaction during the
electrophoretic process, nondenaturing gels in the absence of
reducing agent are typically preferred, but conditions appropriate
to the particular interactants will be well known to one skilled in
the art. Immunoprecipitation is another common technique utilized
for the isolation of a protein-protein complex from solution (see,
e.g., Ausubel et al (eds.), In: Current Protocols in Molecular
Biology, J. Wiley & Sons, New York. 1999). In this technique,
all proteins binding to an antibody specific to one of the binding
molecules are precipitated from solution by conjugating the
antibody to a polymer bead that may be readily collected by
centrifugation. The bound assay components are released from the
beads (through a specific proteolysis event or other technique well
known in the art which will not disturb the protein-protein
interaction in the complex), and a second immunoprecipitation step
is performed, this time utilizing antibodies specific for the
correspondingly different interacting assay component. In this
manner, only formed complexes should remain attached to the beads.
Variations in complex formation in both the presence and the
absence of a test compound can be compared, thus offering
information about the ability of the compound to modulate
interactions between PGC-1.alpha. and its binding partner.
[0087] Also within the scope of the present invention are methods
for direct detection of interactions between PGC-1.alpha. and its
natural binding partner and/or a test compound in a homogeneous or
heterogeneous assay system without further sample manipulation. For
example, the technique of fluorescence energy transfer may be
utilized (see, e.g., Lakowicz et al, U.S. Pat. No. 5,631,169;
Stavrianopoulos et al, U.S. Pat. No. 4,868,103). Generally, this
technique involves the addition of a fluorophore label on a first
`donor`molecule (e.g., PGC-1.alpha. or test compound) such that its
emitted fluorescent energy will be absorbed by a fluorescent label
on a second, `acceptor` molecule (e.g., PGC-1.alpha. or test
compound), which in turn is able to fluoresce due to the absorbed
energy. Alternately, the `donor` protein molecule may simply
utilize the natural fluorescent energy of tryptophan residues.
Labels are chosen that emit different wavelengths of light, such
that the `acceptor` molecule label may be differentiated from that
of the `donor`. Since the efficiency of energy transfer between the
labels is related to the distance separating the molecules, spatial
relationships between the molecules can be assessed. In a situation
in which binding occurs between the molecules, the fluorescent
emission of the `acceptor` molecule label in the assay should be
maximal. An FET binding event can be conveniently measured through
standard fluorometric detection means well known in the art (e.g.,
using a fluorimeter). A test substance which either enhances or
hinders participation of one of the species in the preformed
complex will result in the generation of a signal variant to that
of background. In this way, test substances that modulate
interactions between PGC-1.alpha. and its binding partner can be
identified in controlled assays.
[0088] In another embodiment, modulators of PGC-1.alpha. expression
are identified in a method wherein a cell is contacted with a
candidate compound and the expression of mRNA or protein,
corresponding to a PGC-1.alpha. in the cell, is determined. The
level of expression of mRNA or protein in the presence of the
candidate compound is compared to the level of expression of mRNA
or protein in the absence of the candidate compound. The candidate
compound can then be identified as a modulator of PGC-1.alpha.
expression based on this comparison. For example, when expression
of PGC-1.alpha. mRNA or protein is greater (statistically
significantly greater) in the presence of the candidate compound
than in its absence, the candidate compound is identified as a
stimulator of PGC-1.alpha. mRNA or protein expression. Conversely,
when expression of PGC-1.alpha. mRNA or protein is less
(statistically significantly less) in the presence of the candidate
compound than in its absence, the candidate compound is identified
as an inhibitor of PGC-1.alpha. mRNA or protein expression. The
level of PGC-1.alpha. mRNA or protein expression in the cells can
be determined by methods described herein for detecting
PGC-1.alpha. mRNA or protein.
[0089] In another aspect, the invention pertains to a combination
of two or more of the assays described herein. For example, a
modulating agent can be identified using a cell-based or a cell
free assay, and the ability of the agent to modulate the activity
of a PGC-1.alpha. protein can be confirmed in vivo, e.g., in an
animal such as an animal model for a neurological disease or
disorder, as described herein, or described in, for example,
Sathasivam K et al. Philos Trans R Soc Lond B Biol Sci. 1999 Jun.
29; 354(1386):963-9; Bates G P, et al. Hum Mol. Genet. 1997;
6(10):1633-7; Shaw C A et al Neurosci Biobehav Rev. 2003 October;
27(6):493-505; Menalled LB Trends Pharmacol Sci. 2002 January;
23(1):32-9; Legare M E et al. Genet Mol. Res. 2003 Sep. 30;
2(3):288-94; Oiwa Y J Neurosurg. 2003 January; 98(1):136-44; and
Bard F et al. Nat. Med. 2000 August; 6(8):916-9, the contents of
which are incorporated by reference herein.
[0090] This invention further pertains to novel agents identified
by the above-described screening assays. Accordingly, it is within
the scope of this invention to further use an agent identified as
described herein in an appropriate animal model. For example, an
agent identified as described herein (e.g., a small molecule, an
antisense PGC-1.alpha. nucleic acid molecule, a
PGC-1.alpha.-specific antibody, or a PGC-1.alpha.-binding partner)
can be used in an animal model to determine the efficacy, toxicity,
or side effects of treatment with such an agent. Alternatively, an
agent identified as described herein can be used in an animal model
to determine the mechanism of action of such an agent. Furthermore,
this invention pertains to uses of novel agents identified by the
above-described screening assays for treatments as described
herein.
[0091] Any of the compounds, including but not limited to compounds
such as those identified in the foregoing assay systems, may be
tested for a compound capable of treating or preventing a
neurological disease or disorder comprising the ability of the
compound to modulate PGC-1.alpha. nucleic acid expression or
PGC-1.alpha. polypeptide activity, thereby identifying a compound
capable of treating or preventing a neurological disease or
disorder. Cell-based and animal model-based assays for the
identification of compounds exhibiting such an ability to treat or
prevent a neurological disease or disorder described herein.
[0092] In one aspect, cell-based systems, as described herein, may
be used to identify compounds which may act to modulate
PGC-1.alpha. nucleic acid expression or PGC-1.alpha. polypeptide
activity or treat neurological diseases or disorders. For example,
such cell systems may be exposed to a compound, suspected of
exhibiting an ability to modulate PGC-1.alpha. or treat or prevent
a neurological disease or disorder, at a sufficient concentration
and for a time sufficient to elicit such an amelioration of disease
symptoms in the exposed cells. After exposure, the cells are
examined to determine whether one or more of the disease
phenotypes, e.g., Huntington's Disease, for example, has been
altered to resemble a more normal or more wild type disease
phenotype.
[0093] In addition, animal-based disease systems, such as those
described herein, may be used to identify compounds which may act
to modulate PGC-1.alpha. nucleic acid expression or PGC-1.alpha.
polypeptide activity or treat neurological diseases or disorders.
Such animal models may be used as test substrates for the
identification of drugs, pharmaceuticals, therapies, and
interventions which may be effective in modulating PGC-1.alpha.,
treating or preventing neurological diseases or disorders e.g.,
Huntington's disease.
[0094] In one embodiment, compounds which are capable of treating
or preventing a neurological disease or disorder are identified by
assaying the ability of the compound to modulate PGC-1.alpha.
nucleic acid expression or PGC-1.alpha. polypeptide activity is
determined by detecting modulation of mitochondrial function, e.g.,
mitochondrial function in the brain. Furthermore, the invention
includes identifying compound which have the ability to modulate
PGC-1.alpha. nucleic acid expression or PGC-1.alpha. polypeptide
activity is determined by detecting modulation in the expression or
activity of mitochondrial genes, e.g., LDH2, Ndufb5, COX6a1, and
ATP5j.
[0095] In still another embodiment, compounds which are capable of
treating or preventing a neurological disease or disorder are
identified by assaying the ability of the compound to modulate
PGC-1.alpha. is determined by detecting modulation in the
expression or activity of neuronal genes, e.g., NF--H, NF-M, MOBP,
ATPa1, and ATP1a2.
[0096] Additionally, gene expression patterns may be utilized to
assess the ability of a compound to modulate PGC-1 e.g., by causing
increased PGC-1.alpha. expression or activity. Thus, these
compounds would be useful for treating, preventing, or assessing a
neurological disease or disorder. For example, the expression
pattern of one or more genes may form part of a "gene expression
profile" or "transcriptional profile" which may be then be used in
such an assessment. "Gene expression profile" or "transcriptional
profile", as used herein, includes the pattern of mRNA expression
obtained for a given tissue or cell type under a given set of
conditions. Gene expression profiles may be generated, for example,
by utilizing a differential display procedure, Northern analysis
and/or RT-PCR. In one embodiment, PGC-1.alpha. gene sequences may
be used as probes and/or PCR primers for the generation and
corroboration of such gene expression profiles.
[0097] Gene expression profiles may be characterized for known
states within the cell- and/or animal-based model systems.
Subsequently, these known gene expression profiles may be compared
to ascertain the effect a test compound has to modify such gene
expression profiles, and to cause the profile to more closely
resemble that of a more desirable profile.
[0098] II. Methods of Treatment:
[0099] The present invention provides for both prophylactic and
therapeutic methods of treating or preventing a neurological
disease or disorder in a subject, e.g., a human, at risk of (or
susceptible to) a neurological disease or disorder, by
administering to said subject a PGC-1.alpha. modulator, such that
the neurological disease or disorder is treated or prevented. In a
preferred embodiment, which includes both prophylactic and
therapeutic methods, the PGC-1.alpha. modulator is administered by
in a pharmaceutically acceptable formulation.
[0100] With regard to both prophylactic and therapeutic methods of
treatment, such treatments may be specifically tailored or
modified, based on knowledge obtained from the field of
pharmacogenomics. "Pharmacogenomics," as used herein, refers to the
application of genomics technologies such as gene sequencing,
statistical genetics, and gene expression analysis to drugs in
clinical development and on the market. More specifically, the term
refers to the study of how a patient's genes determine his or her
response to a drug (e.g., a patient's "drug response phenotype", or
"drug response genotype").
[0101] Thus, another aspect of the invention provides methods for
tailoring a subject's prophylactic or therapeutic treatment with
either the PGC-1.alpha. molecules of the present invention or
PGC-1.alpha. modulators according to that individual's drug
response genotype. Pharmacogenomics allows a clinician or physician
to target prophylactic or therapeutic treatments to patients who
will most benefit from the treatment and to avoid treatment of
patients who will experience toxic drug-related side effects.
[0102] A. Prophylactic Methods
[0103] In one aspect, the invention provides a method for treating
or preventing a neurological disease or disorder by administering
to a subject an agent which modulates PGC-1.alpha. expression or
PGC-1.alpha. activity. The invention also provides methods for
modulating the formation of brain lesions, neurodegneration, and
neurite growth in a subject. Subjects at risk for a neurological
disease or disorder can be identified by, for example, any or a
combination of the diagnostic or prognostic assays described
herein. Administration of a prophylactic agent can occur prior to
the manifestation of symptoms characteristic of a neurological
disease or disorder, such that the neurological disease or disorder
or symptom thereof, e.g., hyperactivity, is prevented or,
alternatively, delayed in its progression. Depending on the type of
PGC-1.alpha. aberrancy, for example, a PGC-1.alpha. agonist or
PGC-1.alpha. antagonist agent can be used for treating the subject.
The appropriate agent can be determined based on screening assays
described herein.
[0104] B. Therapeutic Methods
[0105] The present invention provides methods for modulating
PGC-1.alpha. in a subject by administering a PGC-1.alpha. modulator
to either induce or inhibit PGC-1.alpha. expression or activity. In
one embodiment, PGC-1.alpha. expression or activity is increased by
administering an inducer or agonist of PGC-1.alpha. expression or
activity, thereby modulating lesion formation, e.g., brain lesion
formation, mitochondrial function, neurite growth, and/or
neurodegeneration, and treating or preventing a neurological
disease or disorder.
[0106] Accordingly, another aspect of the invention pertains to
methods of modulating PGC-1.alpha. expression or activity for
therapeutic purposes and for use in treatment of neurological
diseases or disorders. In an exemplary embodiment, the modulatory
method of the invention involves contacting a cell with a
PGC-1.alpha. or agent that modulates one or more of the activities
of PGC-1.alpha. protein activity associated with a neurological
disease or disorder (e.g., modulation of mitochondrial function,
brain lesion formation, neurite growth or neuronal degeneration).
An agent that modulates PGC-1.alpha. protein activity can be an
agent as described herein, such as a nucleic acid or .alpha.
protein, an siRNA targeting PGC-1.alpha. mRNA, a
naturally-occurring target molecule of a PGC-1.alpha. protein
(e.g., a PGC-1.alpha. ligand or substrate), a PGC-1.alpha.
antibody, a PGC-1.alpha. agonist or antagonist, a peptidomimetic of
a PGC-1.alpha. agonist or antagonist, or other small molecule. In
one embodiment, the agent stimulates one or more PGC-1.alpha.
activities. Examples of such stimulatory agents include active
PGC-1.alpha. protein, a nucleic acid molecule encoding
PGC-1.alpha., or a small molecule agonist, or mimetic, e.g., a
peptidomimetic. In another embodiment, the agent inhibits one or
more PGC-1.alpha. activities. Examples of such inhibitory agents
include antisense PGC-1.alpha. nucleic acid molecules, siRNA
molecules, anti-PGC-1.alpha. antibodies, small molecules, and
PGC-1.alpha. inhibitors. These modulatory methods can be performed
in vitro (e.g., by culturing the cell with the agent) or,
alternatively, in vivo (e.g., by administering the agent to a
subject). In one embodiment, the method involves administering an
agent (e.g., an agent identified by a screening assay described
herein), or combination of agents that modulates (e.g., upregulates
or downregulates) PGC-1.alpha. expression or activity. In another
embodiment, the method involves administering a PGC-1.alpha.
protein or nucleic acid molecule as therapy to compensate for
reduced, aberrant, or unwanted PGC-1.alpha. expression or
activity.
[0107] Stimulation of PGC-1.alpha. activity is desirable in
situations in which PGC-1.alpha. is abnormally downregulated and/or
in which increased PGC-1.alpha. activity is likely to have a
beneficial effect, e.g., as a treatment for a neurological disease
or disorder. Likewise, inhibition of PGC-1.alpha. activity is
desirable in situations in which PGC-1.alpha. is abnormally
upregulated and/or in which decreased PGC-1.alpha. activity is
likely to have a beneficial effect, e.g., to effect the creation of
an animal model for a neurological disease or disorder, e.g., a
non-human animal transgenic in which PGC-1.alpha. is misexpressed,
or to modulate body weight in a subject, e.g., to treat or prevent
obesity.
[0108] (i) Methods for Increasing PGC-1.alpha. Expression or
Activity
[0109] Increasing PGC-1.alpha. expression or activity leads to
treatment or prevention of a neurological disease or disorder,
therefore providing a method for treating, preventing, and
assessing a neurological disease or disorder. A variety of
techniques may be used to increase the expression, synthesis, or
activity of PGC-1.alpha..
[0110] Described in this section are methods whereby the level
PGC-1.alpha. activity may be increased, for example, by either
increasing the level of PGC-1.alpha. gene expression or by
increasing the level of active PGC-1.alpha. protein which is
present.
[0111] For example, a PGC-1.alpha. protein may be administered to a
subject. Any of the techniques discussed below may be used for such
administration. One of skill in the art will readily know how to
determine the concentration of effective, non-toxic doses of the
PGC-1.alpha. protein, utilizing techniques such as those described
below.
[0112] Additionally, RNA sequences encoding a PGC-1.alpha. protein
may be directly administered to a subject, at a concentration
sufficient to produce a level of PGC-1.alpha. protein such that
PGC-1.alpha. is modulated. Any of the techniques discussed below,
which achieve intracellular administration of compounds, such as,
for example, liposome administration, may be used for the
administration of such RNA molecules. The RNA molecules may be
produced, for example, by recombinant techniques such as those
described herein. Other pharmaceutical compositions, medications,
or therapeutics may be used in combination with the PGC-1.alpha.
agonists described herein. Further, subjects may be treated by gene
replacement therapy, resulting in permanent modulation of
PGC-1.alpha.. One or more copies of a PGC-1.alpha. gene, or a
portion thereof, that directs the production of a normal
PGC-1.alpha. protein with PGC-1.alpha. function, may be inserted
into cells using vectors which include, but are not limited to
adenovirus, adeno-associated virus, and retrovirus vectors, in
addition to other particles that introduce DNA into cells, such as
liposomes. Additionally, techniques such as those described above
may be used for the introduction of PGC-1.alpha. gene sequences
into human cells. Furthermore, expression or activity of
transcriptional activators which act upon PGC-1.alpha. may be
increased to thereby increase expression and activity of
PGC-1.alpha.. Small molecules which induce PGC-1.alpha. expression
or activity, either directly or indirectly may also be used. In one
embodiment, a small molecule functions to disrupt a protein-protein
interaction between PGC-1.alpha. and a target molecule or ligand,
thereby modulating, e.g., increasing or decreasing the activity of
PGC-1.alpha..
[0113] Cells, preferably, autologous cells, containing PGC-1.alpha.
expressing gene sequences may then be introduced or reintroduced
into the subject. Such cell replacement techniques may be
preferred, for example, when the gene product is a secreted,
extracellular gene product.
[0114] (ii) Methods for Inhibiting PGC-1.alpha. Expression,
Synthesis, or Activity
[0115] As discussed above, inhibition of PGC-1.alpha. expression or
activity may be desirable in certain situations, e.g., to create a
non-human animal transgenic in which PGC-1.alpha. is misexpressed,
or to modulate body weight in a subject, e.g., to treat or prevent
obesity. A variety of techniques may be used to inhibit the
expression, synthesis, or activity of PGC-1.alpha. genes and/or
proteins.
[0116] For example, compounds such as those identified through
assays described above, which exhibit inhibitory activity, may be
used in accordance with the invention. Such molecules may include,
but are not limited to, small organic molecules, siRNA molecules,
peptides, antibodies, and the like.
[0117] For example, compounds can be administered that compete with
endogenous ligand for the PGC-1.alpha. protein. The resulting
reduction in the amount of ligand-bound PGC-1.alpha. protein will
modulate endothelial cell physiology. Compounds that can be
particularly useful for this purpose include, for example, soluble
proteins or peptides, such as peptides comprising one or more of
the extracellular domains, or portions and/or analogs thereof, of
the PGC-1.alpha. protein, including, for example, soluble fusion
proteins such as Ig-tailed fusion proteins. (For a discussion of
the production of Ig-tailed fusion proteins, see, for example, U.S.
Pat. No. 5,116,964). Alternatively, compounds, such as ligand
analogs or antibodies, that bind to the PGC-1.alpha. receptor site,
but do not activate the protein, (e.g., receptor-ligand
antagonists) can be effective in inhibiting PGC-1.alpha. protein
activity.
[0118] Further, antisense and ribozyme molecules and siRNA
molecules which inhibit expression of the PGC-1.alpha. gene may
also be used in accordance with the invention to inhibit aberrant
PGC-1.alpha. gene activity. Still further, triple helix molecules
may be utilized in inhibiting aberrant PGC-1.alpha. gene
activity.
[0119] The antisense nucleic acid molecules used in the methods of
the invention are typically administered to a subject or generated
in situ such that they hybridize with or bind to cellular mRNA
and/or genomic DNA encoding a PGC-1.alpha. protein to thereby
inhibit expression of the protein, e.g., by inhibiting
transcription and/or translation. The hybridization can be by
conventional nucleotide complementarity to form a stable duplex,
or, for example, in the case of an antisense nucleic acid molecule
which binds to DNA duplexes, through specific interactions in the
major groove of the double helix. An example of a route of
administration of antisense nucleic acid molecules of the invention
include direct injection at a tissue site. Alternatively, antisense
nucleic acid molecules can be modified to target selected cells and
then administered systemically. For example, for systemic
administration, antisense molecules can be modified such that they
specifically bind to receptors or antigens expressed on a selected
cell surface, e.g., by linking the antisense nucleic acid molecules
to peptides or antibodies which bind to cell surface receptors or
antigens. The antisense nucleic acid molecules can also be
delivered to cells using the vectors described herein. To achieve
sufficient intracellular concentrations of the antisense molecules,
vector constructs in which the antisense nucleic acid molecule is
placed under the control of a strong pol II or pol III promoter are
preferred.
[0120] In yet another embodiment, an antisense nucleic acid
molecule used in the methods of the invention is an
.alpha.-anomeric nucleic acid molecule. An .alpha.-anomeric nucleic
acid molecule forms specific double-stranded hybrids with
complementary RNA in which, contrary to the usual .beta.-units, the
strands run parallel to each other (Gaultier et al. (1987) Nucleic
Acids. Res. 15:6625-6641). The antisense nucleic acid molecule can
also comprise a 2'-o-methylribonucleotide (Inoue et al. (1987)
Nucleic Acids Res. 15:6131-6148) or a chimeric RNA-DNA analogue
(Inoue et al. (1987) FEBS Lett. 215:327-330).
[0121] In still another embodiment, an antisense nucleic acid used
in the methods of the invention is a ribozyme. Ribozymes are
catalytic RNA molecules with ribonuclease activity which are
capable of cleaving a single-stranded nucleic acid, such as an
mRNA, to which they have a complementary region. Thus, ribozymes
(e.g., hammerhead ribozymes (described in Haselhoff and Gerlach
(1988) Nature 334:585-591)) can be used to catalytically cleave
PGC-1.alpha. mRNA transcripts thereby to inhibit translation of
PGC-1.alpha. mRNA. A ribozyme having specificity for a
PGC-1.alpha.-encoding nucleic acid can be designed based upon the
nucleotide sequence of a PGC-1.alpha. cDNA disclosed herein (i.e.,
SEQ ID NO:1). For example, a derivative of a Tetrahymena L-19 IVS
RNA can be constructed in which the nucleotide sequence of the
active site is complementary to the nucleotide sequence to be
cleaved in a PGC-1.alpha.-encoding mRNA (see, for example, Cech et
al. U.S. Pat. No. 4,987,071; and Cech et al. U.S. Pat. No.
5,116,742). Alternatively, PGC-1.alpha. mRNA can be used to select
a catalytic RNA having a specific ribonuclease activity from a pool
of RNA molecules (see, for example, Bartel, D. and Szostak, J. W.
(1993) Science 261:1411-1418).
[0122] PGC-1.alpha. gene expression can also be inhibited by
targeting nucleotide sequences complementary to the regulatory
region of the PGC-1.alpha. (e.g., the PGC-1.alpha. promoter and/or
enhancers) to form triple helical structures that prevent
transcription of the PGC-1.alpha. gene in target cells (see, for
example, Helene, C. (1991) Anticancer Drug Des. 6(6):569-84;
Helene, C. et al. (1992) Ann. N.Y. Acad. Sci. 660:27-36; and Maher,
L. J. (1992) Bioassays 14(12):807-15).
[0123] An RNA interfering agent, e.g., an siRNA molecule, which is
targeted to PGC-1.alpha., can also be used in order to inhibit
expression of PGC-1.alpha., e.g., through degradation or specific
post-transcriptional gene silencing (PTGS) of the messenger RNA
(mRNA) of PGC-1.alpha..
[0124] Antibodies that are both specific for the PGC-1.alpha.
protein and interfere with its activity may also be used to
modulate or inhibit PGC-1.alpha. protein function. Such antibodies
may be generated using standard techniques described herein,
against the PGC-1.alpha. protein itself or against peptides
corresponding to portions of the protein. Such antibodies include
but are not limited to polyclonal, monoclonal, Fab fragments,
single chain antibodies, or chimeric antibodies.
[0125] In instances where the target gene protein is intracellular
and whole antibodies are used, internalizing antibodies may be
preferred. Lipofectin liposomes may be used to deliver the antibody
or a fragment of the Fab region which binds to the target epitope
into cells. Where fragments of the antibody are used, the smallest
inhibitory fragment which binds to the target protein's binding
domain is preferred. For example, peptides having an amino acid
sequence corresponding to the domain of the variable region of the
antibody that binds to the target gene protein may be used. Such
peptides may be synthesized chemically or produced via recombinant
DNA technology using methods well known in the art (described in,
for example, Creighton (1983), supra; and Sambrook et al. (1989)
supra). Single chain neutralizing antibodies which bind to
intracellular target gene epitopes may also be administered. Such
single chain antibodies may be administered, for example, by
expressing nucleotide sequences encoding single-chain antibodies
within the target cell population by utilizing, for example,
techniques such as those described in Marasco et al. (1993) Proc.
Natl. Acad. Sci. USA 90:7889-7893).
[0126] C. Pharmaceutical Compositions
[0127] The methods of the invention involve administering to a
subject an agent which modulates PGC-1.alpha. expression or
activity (e.g., an agent identified by a screening assay described
herein), or a combination of such agents. In another embodiment,
the method involves administering to a subject a PGC-1.alpha.
protein or nucleic acid molecule as therapy to compensate for
reduced, aberrant, or unwanted PGC-1.alpha. expression or
activity.
[0128] Stimulation of PGC-1.alpha. activity is desirable in
situations in which PGC-1.alpha. is abnormally downregulated and/or
in which increased PGC-1.alpha. activity is likely to have a
beneficial effect, e.g., as a therapeutic or prophylactic.
[0129] The agents which modulate PGC-1.alpha. activity can be
administered to a subject using pharmaceutical compositions
suitable for such administration. Such compositions typically
comprise the agent (e.g., nucleic acid molecule, protein, or
antibody) and a pharmaceutically acceptable carrier. As used herein
the language "pharmaceutically acceptable carrier" is intended to
include any and all solvents, dispersion media, coatings,
antibacterial and antifungal agents, isotonic and absorption
delaying agents, and the like, compatible with pharmaceutical
administration. The use of such media and agents for
pharmaceutically active substances is well known in the art. Except
insofar as any conventional media or agent is incompatible with the
active compound, use thereof in the compositions is contemplated.
Supplementary active compounds can also be incorporated into the
compositions.
[0130] A pharmaceutical composition used in the therapeutic methods
of the invention is formulated to be compatible with its intended
route of administration. Examples of routes of administration
include parenteral, e.g., intravenous, intradermal, subcutaneous,
oral (e.g., inhalation), transdermal (topical), transmucosal, and
rectal administration. Solutions or suspensions used for
parenteral, intradermal, or subcutaneous application can include
the following components: a sterile diluent such as water for
injection, saline solution, fixed oils, polyethylene glycols,
glycerine, propylene glycol or other synthetic solvents;
antibacterial agents such as benzyl alcohol or methyl parabens;
antioxidants such as ascorbic acid or sodium bisulfate; chelating
agents such as ethylenediaminetetraacetic acid; buffers such as
acetates, citrates or phosphates and agents for the adjustment of
tonicity such as sodium chloride or dextrose. pH can be adjusted
with acids or bases, such as hydrochloric acid or sodium hydroxide.
The parenteral preparation can be enclosed in ampoules, disposable
syringes or multiple dose vials made of glass or plastic.
[0131] Pharmaceutical compositions suitable for injectable use
include sterile aqueous solutions (where water soluble) or
dispersions and sterile powders for the extemporaneous preparation
of sterile injectable solutions or dispersion. For intravenous
administration, suitable carriers include physiological saline,
bacteriostatic water, Cremophor EL.TM. (BASF, Parsippany, N.J.) or
phosphate buffered saline (PBS). In all cases, the composition must
be sterile and should be fluid to the extent that easy
syringability exists. It must be stable under the conditions of
manufacture and storage and must be preserved against the
contaminating action of microorganisms such as bacteria and fungi.
The carrier can be a solvent or dispersion medium containing, for
example, water, ethanol, polyol (for example, glycerol, propylene
glycol, and liquid polyetheylene glycol, and the like), and
suitable mixtures thereof. The proper fluidity can be maintained,
for example, by the use of a coating such as lecithin, by the
maintenance of the required particle size in the case of dispersion
and by the use of surfactants. Prevention of the action of
microorganisms can be achieved by various antibacterial and
antifungal agents, for example, parabens, chlorobutanol, phenol,
ascorbic acid, thimerosal, and the like. In many cases, it will be
preferable to include isotonic agents, for example, sugars,
polyalcohols such as manitol, sorbitol, and sodium chloride in the
composition. Prolonged absorption of the injectable compositions
can be brought about by including in the composition an agent which
delays absorption, for example, aluminum monostearate and
gelatin.
[0132] Sterile injectable solutions can be prepared by
incorporating the agent that modulates PGC-1.alpha. activity (e.g.,
a fragment of a PGC-1.alpha. protein or an anti-PGC-1.alpha.
antibody) in the required amount in an appropriate solvent with one
or a combination of ingredients enumerated above, as required,
followed by filtered sterilization. Generally, dispersions are
prepared by incorporating the active compound into a sterile
vehicle which contains a basic dispersion medium and the required
other ingredients from those enumerated above. In the case of
sterile powders for the preparation of sterile injectable
solutions, the preferred methods of preparation are vacuum drying
and freeze-drying which yields a powder of the active ingredient
plus any additional desired ingredient from a previously
sterile-filtered solution thereof.
[0133] Oral compositions generally include an inert diluent or an
edible carrier. They can be enclosed in gelatin capsules or
compressed into tablets. For the purpose of oral therapeutic
administration, the active compound can be incorporated with
excipients and used in the form of tablets, troches, or capsules.
Oral compositions can also be prepared using a fluid carrier for
use as a mouthwash, wherein the compound in the fluid carrier is
applied orally and swished and expectorated or swallowed.
Pharmaceutically compatible binding agents, and/or adjuvant
materials can be included as part of the composition. The tablets,
pills, capsules, troches and the like can contain any of the
following ingredients, or compounds of a similar nature: a binder
such as microcrystalline cellulose, gum tragacanth or gelatin; an
excipient such as starch or lactose, a disintegrating agent such as
alginic acid, Primogel, or corn starch; a lubricant such as
magnesium stearate or Sterotes; a glidant such as colloidal silicon
dioxide; a sweetening agent such as sucrose or saccharin; or a
flavoring agent such as peppermint, methyl salicylate, or orange
flavoring.
[0134] For administration by inhalation, the compounds are
delivered in the form of an aerosol spray from pressured container
or dispenser which contains a suitable propellant, e.g., a gas such
as carbon dioxide, or a nebulizer.
[0135] Systemic administration can also be by transmucosal or
transdermal means. For transmucosal or transdermal administration,
penetrants appropriate to the barrier to be permeated are used in
the formulation. Such penetrants are generally known in the art,
and include, for example, for transmucosal administration,
detergents, bile salts, and fusidic acid derivatives. Transmucosal
administration can be accomplished through the use of nasal sprays
or suppositories. For transdermal administration, the active
compounds are formulated into ointments, salves, gels, or creams as
generally known in the art.
[0136] The agents that modulate PGC-1.alpha. activity can also be
prepared in the form of suppositories (e.g., with conventional
suppository bases such as cocoa butter and other glycerides) or
retention enemas for rectal delivery.
[0137] In one embodiment, the agents that modulate PGC-1.alpha.
activity are prepared with carriers that will protect the compound
against rapid elimination from the body, such as a controlled
release formulation, including implants and microencapsulated
delivery systems. Biodegradable, biocompatible polymers can be
used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic
acid, collagen, polyorthoesters, and polylactic acid. Methods for
preparation of such formulations will be apparent to those skilled
in the art. The materials can also be obtained commercially from
Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal
suspensions (including liposomes targeted to infected cells with
monoclonal antibodies to viral antigens) can also be used as
pharmaceutically acceptable carriers. These can be prepared
according to methods known to those skilled in the art, for
example, as described in U.S. Pat. No. 4,522,811.
[0138] It is especially advantageous to formulate oral or
parenteral compositions in dosage unit form for ease of
administration and uniformity of dosage. Dosage unit form as used
herein refers to physically discrete units suited as unitary
dosages for the subject to be treated; each unit containing a
predetermined quantity of active compound calculated to produce the
desired therapeutic effect in association with the required
pharmaceutical carrier. The specification for the dosage unit forms
of the invention are dictated by and directly dependent on the
unique characteristics of the agent that modulates PGC-1.alpha.
activity and the particular therapeutic effect to be achieved, and
the limitations inherent in the art of compounding such an agent
for the treatment of subjects.
[0139] Toxicity and therapeutic efficacy of such agents can be
determined by standard pharmaceutical procedures in cell cultures
or experimental animals, e.g., for determining the LD50 (the dose
lethal to 50% of the population) and the ED50 (the dose
therapeutically effective in 50% of the population). The dose ratio
between toxic and therapeutic effects is the therapeutic index and
can be expressed as the ratio LD50/ED50. Agents which exhibit large
therapeutic indices are preferred. While agents that exhibit toxic
side effects may be used, care should be taken to design a delivery
system that targets such agents to the site of affected tissue in
order to minimize potential damage to uninfected cells and,
thereby, reduce side effects.
[0140] The data obtained from the cell culture assays and animal
studies can be used in formulating a range of dosage for use in
humans. The dosage of such PGC-1.alpha. modulating agents lies
preferably within a range of circulating concentrations that
include the ED50 with little or no toxicity. The dosage may vary
within this range depending upon the dosage form employed and the
route of administration utilized. For any agent used in the
therapeutic methods of the invention, the therapeutically effective
dose can be estimated initially from cell culture assays. A dose
may be formulated in animal models to achieve a circulating plasma
concentration range that includes the IC50 (i.e., the concentration
of the test compound which achieves a half-maximal inhibition of
symptoms) as determined in cell culture. Such information can be
used to more accurately determine useful doses in humans. Levels in
plasma may be measured, for example, by high performance liquid
chromatography.
[0141] As defined herein, a therapeutically effective amount of
protein or polypeptide (i.e., an effective dosage) ranges from
about 0.001 to 30 mg/kg body weight, preferably about 0.01 to 25
mg/kg body weight, more preferably about 0.1 to 20 mg/kg body
weight, and even more preferably about 1 to 10 mg/kg, 2 to 9 mg/kg,
3 to 8 mg/kg, 4 to 7 mg/kg, or 5 to 6 mg/kg body weight. The
skilled artisan will appreciate that certain factors may influence
the dosage required to effectively treat a subject, including but
not limited to the severity of the disease or disorder, previous
treatments, the general health and/or age of the subject, and other
diseases present. Moreover, treatment of a subject with a
therapeutically effective amount of a protein, polypeptide, or
antibody can include a single treatment or, preferably, can include
a series of treatments.
[0142] In a preferred example, a subject is treated with antibody,
protein, or polypeptide in the range of between about 0.1 to 20
mg/kg body weight, one time per week for between about 1 to 10
weeks, preferably between 2 to 8 weeks, more preferably between
about 3 to 7 weeks, and even more preferably for about 4, 5, or 6
weeks. It will also be appreciated that the effective dosage of
antibody, protein, or polypeptide used for treatment may increase
or decrease over the course of a particular treatment. Changes in
dosage may result and become apparent from the results of
diagnostic assays as described herein.
[0143] The present invention encompasses agents which modulate
expression or activity. An agent may, for example, be a small
molecule. For example, such small molecules include, but are not
limited to, peptides, peptidomimetics, amino acids, amino acid
analogs, polynucleotides, polynucleotide analogs, nucleotides,
nucleotide analogs, organic or inorganic compounds (i.e., including
heteroorganic and organometallic compounds) having a molecular
weight less than about 10,000 grams per mole, organic or inorganic
compounds having a molecular weight less than about 5,000 grams per
mole, organic or inorganic compounds having a molecular weight less
than about 1,000 grams per mole, organic or inorganic compounds
having a molecular weight less than about 500 grams per mole, and
salts, esters, and other pharmaceutically acceptable forms of such
compounds. It is understood that appropriate doses of small
molecule agents depends upon a number of factors within the ken of
the ordinarily skilled physician, veterinarian, or researcher. The
dose(s) of the small molecule will vary, for example, depending
upon the identity, size, and condition of the subject or sample
being treated, further depending upon the route by which the
composition is to be administered, if applicable, and the effect
which the practitioner desires the small molecule to have upon the
nucleic acid or polypeptide of the invention.
[0144] Exemplary doses include milligram or microgram amounts of
the small molecule per kilogram of subject or sample weight (e.g.,
about 1 microgram per kilogram to about 500 milligrams per
kilogram, about 100 micrograms per kilogram to about 5 milligrams
per kilogram, or about 1 microgram per kilogram to about 50
micrograms per kilogram). It is furthermore understood that
appropriate doses of a small molecule depend upon the potency of
the small molecule with respect to the expression or activity to be
modulated. Such appropriate doses may be determined using the
assays described herein. When one or more of these small molecules
is to be administered to an animal (e.g., a human) in order to
modulate expression or activity of a PGC-1.alpha. molecule, a
physician, veterinarian, or researcher may, for example, prescribe
a relatively low dose at first, subsequently increasing the dose
until an appropriate response is obtained. In addition, it is
understood that the specific dose level for any particular animal
subject will depend upon a variety of factors including the
activity of the specific compound employed, the age, body weight,
general health, gender, and diet of the subject, the time of
administration, the route of administration, the rate of excretion,
any drug combination, and the degree of expression or activity to
be modulated, e.g., the intended use of the agonist or
antagonize.
[0145] Further, an antibody (or fragment thereof) may be conjugated
to a therapeutic moiety such as a cytotoxin, a therapeutic agent or
a radioactive metal ion. A cytotoxin or cytotoxic agent includes
any agent that is detrimental to cells. Examples include taxol,
cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin,
etoposide, tenoposide, vincristine, vinblastine, colchicin,
doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone,
mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids,
procaine, tetracaine, lidocaine, propranolol, and puromycin and
analogs or homologs thereof. Therapeutic agents include, but are
not limited to, antimetabolites (e.g., methotrexate,
6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil
decarbazine), alkylating agents (e.g., mechlorethamine, thioepa
chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU),
cyclothosphamide, busulfan, dibromomannitol, streptozotocin,
mitomycin C, and cis-dichlorodiamine platinum (II) (DDP)
cisplatin), anthracyclines (e.g., daunorubicin (formerly
daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin
(formerly actinomycin), bleomycin, mithramycin, and anthramycin
(AMC)), and anti-mitotic agents (e.g., vincristine and
vinblastine).
[0146] The conjugates of the invention can be used for modifying a
given biological response, the drug moiety is not to be construed
as limited to classical chemical therapeutic agents. For example,
the drug moiety may be a protein or polypeptide possessing a
desired biological activity. Such proteins may include, for
example, a toxin such as abrin, ricin A, pseudomonas exotoxin, or
diphtheria toxin; a protein such as tumor necrosis factor,
alpha-interferon, beta-interferon, nerve growth factor, platelet
derived growth factor, tissue plasminogen activator; or biological
response modifiers such as, for example, lymphokines, interleukin-1
("IL-1"), interleukin-2 ("IL-2"), interleukin-6 ("IL-6"),
granulocyte macrophase colony stimulating factor ("GM-CSF"),
granulocyte colony stimulating factor ("G-CSF"), or other growth
factors.
[0147] Techniques for conjugating such therapeutic moiety to
antibodies are well known, see, e.g., Arnon et al., "Monoclonal
Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in
Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.),
pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies
For Drug Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson
et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe,
"Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A
Review", in Monoclonal Antibodies '84: Biological And Clinical
Applications, Pinchera et al. (eds.), pp. 475-506 (1985);
"Analysis, Results, And Future Prospective Of The Therapeutic Use
Of Radiolabeled Antibody In Cancer Therapy", in Monoclonal
Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.),
pp. 303-16 (Academic Press 1985), and Thorpe et al., "The
Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates",
Immunol. Rev., 62:119-58 (1982). Alternatively, an antibody can be
conjugated to a second antibody to form an antibody heteroconjugate
as described by Segal in U.S. Pat. No. 4,676,980.
[0148] The nucleic acid molecules used in the methods of the
invention can be inserted into vectors and used as gene therapy
vectors. Gene therapy vectors can be delivered to a subject by, for
example, intravenous injection, local administration (see U.S. Pat.
No. 5,328,470) or by stereotactic injection (see, e.g., Chen et al.
(1994) Proc. Natl. Acad. Sci. USA 91:3054-3057). The pharmaceutical
preparation of the gene therapy vector can include the gene therapy
vector in an acceptable diluent, or can comprise a slow release
matrix in which the gene delivery vehicle is imbedded.
Alternatively, where the complete gene delivery vector can be
produced intact from recombinant cells, e.g., retroviral vectors,
the pharmaceutical preparation can include one or more cells which
produce the gene delivery system.
[0149] III. Predictive Medicine:
[0150] The present invention also pertains to the field of
predictive medicine in which diagnostic assays, prognostic assays,
and monitoring clinical trials are used for prognostic (predictive)
purposes to thereby treat an individual prophylactically.
Accordingly, one aspect of the present invention relates to
diagnostic assays for determining PGC-1.alpha. protein and/or
nucleic acid expression as well as PGC-1.alpha. activity, in the
context of a biological sample (e.g., blood, serum, fluid, e.g.,
cerebrospinal fluid, spinal fluid, cells, or tissue, e.g., neural
tissue) to thereby determine whether an individual is afflicted
with neurological disease or disorder neurological disease or
disorder has a risk of developing a neurological disease or
disorder. The invention also provides for prognostic (or
predictive) assays for determining whether an individual is at risk
of developing a neurological disease or disorder. For example,
mutations in a PGC-1.alpha. gene can be assayed for in a biological
sample. Such assays can be used for prognostic or predictive
purpose to thereby phophylactically treat an individual prior to
the onset of a neurological disease or disorder.
[0151] One particular embodiment includes a method for assessing
whether a subject is afflicted with a neurological disease or
disorder has a risk of developing a neurological disease or
disorder comprising detecting the expression of the PGC-1.alpha.
gene or the activity of PGC-1.alpha. in a cell or tissue sample of
a subject, wherein a decrease in the expression of the PGC-1.alpha.
gene or a decrease in the activity of PGC-1.alpha. indicates the
presence of a neurological disease or disorder or the risk of
developing a neurological disease or disorder in the subject. In
this embodiment, subject samples tested are, for example,
cerebrospinal fluid, spinal fluid, and neural tissue.
[0152] Another aspect of the invention pertains to monitoring the
influence of PGC-1.alpha. modulators on the expression or activity
of PGC-1.alpha. in clinical trials.
[0153] These and other agents are described in further detail in
the following sections.
[0154] A. Prognostic and Diagnostic Assays
[0155] To determine whether a subject is afflicted with a
neurological disease or disorder has a risk of developing a
neurological disease or disorder, a biological sample may be
obtained from a subject and the biological sample may be contacted
with a compound or an agent capable of detecting a PGC-1.alpha.
protein or nucleic acid (e.g., mRNA or genomic DNA) that encodes a
PGC-1.alpha. protein, in the biological sample. A preferred agent
for detecting PGC-1.alpha. mRNA or genomic DNA is a labeled nucleic
acid probe capable of hybridizing to PGC-1.alpha. mRNA or genomic
DNA. The nucleic acid probe can be, for example, the PGC-1.alpha.
nucleic acid set forth in SEQ ID NO:1, or a portion thereof, such
as an oligonucleotide of at least 15, 20, 25, 30, 25, 40, 45, 50,
100, 250 or 500 nucleotides in length and sufficient to
specifically hybridize under stringent conditions to PGC-1.alpha.
mRNA or genomic DNA. Other suitable probes for use in the
diagnostic assays of the invention are described herein.
[0156] The term "biological sample" is intended to include tissues,
cells, and biological fluids isolated from a subject, as well as
tissues, cells, and fluids present within a subject, e.g.,
cerebrospinal fluid, spinal fluid, and neural tissue. That is, the
detection method of the invention can be used to detect
PGC-1.alpha. mRNA, protein, or genomic DNA in a biological sample
in vitro as well as in vivo. For example, in vitro techniques for
detection of PGC-1.alpha. mRNA include Northern hybridizations and
in situ hybridizations. In vitro techniques for detection of
PGC-1.alpha. protein include enzyme linked immunosorbent assays
(ELISAs), Western blots, immunoprecipitations and
immunofluorescence. In vitro techniques for detection of
PGC-1.alpha. genomic DNA include Southern hybridizations.
Furthermore, in vivo techniques for detection of PGC-1.alpha.
protein include introducing into a subject a labeled
anti-PGC-1.alpha. antibody. For example, the antibody can be
labeled with a radioactive marker whose presence and location in a
subject can be detected by standard imaging techniques.
[0157] In another embodiment, the methods further involve obtaining
a control biological sample from a control subject, contacting the
control sample with a compound or agent capable of detecting
PGC-1.alpha. protein, mRNA, or genomic DNA, such that the presence
of PGC-1.alpha. protein, mRNA or genomic DNA is detected in the
biological sample, and comparing the presence of PGC-1.alpha.
protein, mRNA or genomic DNA in the control sample with the
presence of PGC-1.alpha. protein, mRNA or genomic DNA in the test
sample.
[0158] Analysis of one or more PGC-1.alpha. polymorphic regions in
a subject can be useful for predicting whether a subject has or is
likely to develop a neurological disease or disorder. In preferred
embodiments, the methods of the invention can be characterized as
comprising detecting, in a sample of cells from the subject, the
presence or absence of a specific allelic variant of one or more
polymorphic regions of a PGC-1.alpha. gene. The allelic differences
can be: (i) a difference in the identity of at least one nucleotide
or (ii) a difference in the number of nucleotides, which difference
can be a single nucleotide or several nucleotides. The invention
also provides methods for detecting differences in an PGC-1.alpha.
gene such as chromosomal rearrangements, e.g., chromosomal
dislocation. The invention can also be used in prenatal
diagnostics.
[0159] A preferred detection method is allele specific
hybridization using probes overlapping the polymorphic site and
having about 5, 10, 20, 25, or 30 nucleotides around the
polymorphic region. In a preferred embodiment of the invention,
several probes capable of hybridizing specifically to allelic
variants are attached to a solid phase support, e.g., a "chip".
Oligonucleotides can be bound to a solid support by a variety of
processes, including lithography. For example, a chip can hold up
to 250,000 oligonucleotides (GeneChip, Affymetrix). Mutation
detection analysis using these chips comprising oligonucleotides,
also termed "DNA probe arrays" is described e.g., in Cronin et al.
(1996) Human Mutation 7:244. In one embodiment, a chip comprises
all the allelic variants of at least one polymorphic region of a
gene. The solid phase support is then contacted with a test nucleic
acid and hybridization to the specific probes is detected.
Accordingly, the identity of numerous allelic variants of one or
more genes can be identified in a simple hybridization experiment.
For example, the identity of the allelic variant of the nucleotide
polymorphism in the 5' upstream regulatory element can be
determined in a single hybridization experiment.
[0160] In other detection methods, it is necessary to first amplify
at least a portion of a PGC-1.alpha. gene prior to identifying the
allelic variant. Amplification can be performed, e.g., by PCR
and/or LCR (see Wu and Wallace, (1989) Genomics 4:560), according
to methods known in the art. In one embodiment, genomic DNA of a
cell is exposed to two PCR primers and amplification for a number
of cycles sufficient to produce the required amount of amplified
DNA. In preferred embodiments, the primers are located between 150
and 350 base pairs apart.
[0161] Alternative amplification methods include: self sustained
sequence replication (Guatelli, J. C. et al., 1990, Proc. Natl.
Acad. Sci. USA 87:1874-1878), transcriptional amplification system
(Kwoh, D. Y. et al., 1989, Proc. Natl. Acad. Sci. USA
86:1173-1177), Q-Beta Replicase (Lizardi, P. M. et al., 1988,
Bio/Technology 6:1197), and self-sustained sequence replication
(Guatelli et al., (1989) Proc. Nat. Acad. Sci. 87:1874), and
nucleic acid based sequence amplification (NABSA), or any other
nucleic acid amplification method, followed by the detection of the
amplified molecules using techniques well known to those of skill
in the art. These detection schemes are especially useful for the
detection of nucleic acid molecules if such molecules are present
in very low numbers.
[0162] In one embodiment, any of a variety of sequencing reactions
known in the art can be used to directly sequence at least a
portion of a PGC-1.alpha. gene and detect allelic variants, e.g.,
mutations, by comparing the sequence of the sample sequence with
the corresponding reference (control) sequence. Exemplary
sequencing reactions include those based on techniques developed by
Maxam and Gilbert (Proc. Natl. Acad Sci USA (1977) 74:560) or
Sanger (Sanger et al. (1977) Proc. Nat. Acad. Sci. 74:5463). It is
also contemplated that any of a variety of automated sequencing
procedures may be utilized when performing the subject assays
(Biotechniques (1995) 19:448), including sequencing by mass
spectrometry (see, for example, U.S. Pat. No. 5,547,835 and
international patent application Publication Number WO 94/16101,
entitled DNA Sequencing by Mass Spectrometry by H. Koster; U.S.
Pat. No. 5,547,835 and international patent application Publication
Number WO 94/21822 entitled "DNA Sequencing by Mass Spectrometry
Via Exonuclease Degradation" by H. Koster), and U.S. Pat. No.
5,605,798 and International Patent Application No. PCT/US96/03651
entitled DNA Diagnostics Based on Mass Spectrometry by H. Koster;
Cohen et al. (1996) Adv Chromatogr 36:127-162; and Griffin et al.
(1993) Appl Biochem Biotechnol 38:147-159). It will be evident to
one skilled in the art that, for certain embodiments, the
occurrence of only one, two or three of the nucleic acid bases need
be determined in the sequencing reaction. For instance, A-track or
the like, e.g., where only one nucleotide is detected, can be
carried out.
[0163] Yet other sequencing methods are disclosed, e.g., in U.S.
Pat. No. 5,580,732 entitled "Method of DNA sequencing employing a
mixed DNA-polymer chain probe" and U.S. Pat. No. 5,571,676 entitled
"Method for mismatch-directed in vitro DNA sequencing".
[0164] In some cases, the presence of a specific allele of a
PGC-1.alpha. gene in DNA from a subject can be shown by restriction
enzyme analysis. For example, a specific nucleotide polymorphism
can result in a nucleotide sequence comprising a restriction site
which is absent from the nucleotide sequence of another allelic
variant.
[0165] In a further embodiment, protection from cleavage agents
(such as a nuclease, hydroxylamine or osmium tetroxide and with
piperidine) can be used to detect mismatched bases in RNA/RNA
DNA/DNA, or RNA/DNA heteroduplexes (Myers, et al. (1985) Science
230:1242). In general, the technique of "mismatch cleavage" starts
by providing heteroduplexes formed by hybridizing a control nucleic
acid, which is optionally labeled, e.g., RNA or DNA, comprising a
nucleotide sequence of an PGC-1.alpha. allelic variant with a
sample nucleic acid, e.g., RNA or DNA, obtained from a tissue
sample. The double-stranded duplexes are treated with an agent
which cleaves single-stranded regions of the duplex such as
duplexes formed based on basepair mismatches between the control
and sample strands. For instance, RNA/DNA duplexes can be treated
with RNase and DNA/DNA hybrids treated with S1 nuclease to
enzymatically digest the mismatched regions. In other embodiments,
either DNA/DNA or RNA/DNA duplexes can be treated with
hydroxylamine or osmium tetroxide and with piperidine in order to
digest mismatched regions. After digestion of the mismatched
regions, the resulting material is then separated by size on
denaturing polyacrylamide gels to determine whether the control and
sample nucleic acids have an identical nucleotide sequence or in
which nucleotides they are different. See, for example, Cotton et
al. (1988) Proc. Natl Acad Sci USA 85:4397; Saleeba et al (1992)
Methods Enzymol. 217:286-295. In a preferred embodiment, the
control or sample nucleic acid is labeled for detection.
[0166] In another embodiment, an allelic variant can be identified
by denaturing high-performance liquid chromatography (DHPLC)
(Oefner and Underhill, (1995) Am. J. Human Gen. 57:Suppl. A266).
DHPLC uses reverse-phase ion-pairing chromatography to detect the
heteroduplexes that are generated during amplification of PCR
fragments from individuals who are heterozygous at a particular
nucleotide locus within that fragment (Oefner and Underhill (1995)
Am. J. Human Gen. 57:Suppl. A266). In general, PCR products are
produced using PCR primers flanking the DNA of interest. DHPLC
analysis is carried out and the resulting chromatograms are
analyzed to identify base pair alterations or deletions based on
specific chromatographic profiles (see O'Donovan et al. (1998)
Genomics 52:44-49).
[0167] In other embodiments, alterations in electrophoretic
mobility is used to identify the type of PGC-1.alpha. allelic
variant. For example, single strand conformation polymorphism
(SSCP) may be used to detect differences in electrophoretic
mobility between mutant and wild type nucleic acids (Orita et al.
(1989) Proc Natl. Acad. Sci. USA 86:2766; see also Cotton (1993)
Mutat Res 285:125-144; and Hayashi (1992) Genet Anal Tech Appl
9:73-79). Single-stranded DNA fragments of sample and control
nucleic acids are denatured and allowed to renature. The secondary
structure of single-stranded nucleic acids varies according to
sequence, the resulting alteration in electrophoretic mobility
enables the detection of even a single base change. The DNA
fragments may be labeled or detected with labeled probes. The
sensitivity of the assay may be enhanced by using RNA (rather than
DNA), in which the secondary structure is more sensitive to a
change in sequence. In another preferred embodiment, the subject
method utilizes heteroduplex analysis to separate double stranded
heteroduplex molecules on the basis of changes in electrophoretic
mobility (Keen et al. (1991) Trends Genet. 7:5).
[0168] In yet another embodiment, the identity of an allelic
variant of a polymorphic region is obtained by analyzing the
movement of a nucleic acid comprising the polymorphic region in
polyacrylamide gels containing a gradient of denaturant is assayed
using denaturing gradient gel electrophoresis (DGGE) (Myers et al.
(1985) Nature 313:495). When DGGE is used as the method of
analysis, DNA will be modified to insure that it does not
completely denature, for example by adding a GC clamp of
approximately 40 bp of high-melting GC-rich DNA by PCR. In a
further embodiment, a temperature gradient is used in place of a
denaturing agent gradient to identify differences in the mobility
of control and sample DNA (Rosenbaum and Reissner (1987) Biophys
Chem 265:1275).
[0169] Examples of techniques for detecting differences of at least
one nucleotide between two nucleic acids include, but are not
limited to, selective oligonucleotide hybridization, selective
amplification, or selective primer extension. For example,
oligonucleotide probes may be prepared in which the known
polymorphic nucleotide is placed centrally (allele-specific probes)
and then hybridized to target DNA under conditions which permit
hybridization only if a perfect match is found (Saiki et al. (1986)
Nature 324:163); Saiki et al (1989) Proc. Natl Acad. Sci. USA
86:6230; and Wallace et al. (1979) Nucl. Acids Res. 6:3543). Such
allele specific oligonucleotide hybridization techniques may be
used for the simultaneous detection of several nucleotide changes
in different polylmorphic regions of PGC-1.alpha.. For example,
oligonucleotides having nucleotide sequences of specific allelic
variants are attached to a hybridizing membrane and this membrane
is then hybridized with labeled sample nucleic acid. Analysis of
the hybridization signal will then reveal the identity of the
nucleotides of the sample nucleic acid.
[0170] Alternatively, allele specific amplification technology
which depends on selective PCR amplification may be used in
conjunction with the instant invention. Oligonucleotides used as
primers for specific amplification may carry the allelic variant of
interest in the center of the molecule (so that amplification
depends on differential hybridization) (Gibbs et al. (1989) Nucleic
Acids Res. 17:2437-2448) or at the extreme 3' end of one primer
where, under appropriate conditions, mismatch can prevent, or
reduce polymerase extension (Prossner (1993) Tibtech 11:238; Newton
et al. (1989) Nucl. Acids Res. 17:2503). This technique is also
termed "PROBE" for Probe Oligo Base Extension. In addition, it may
be desirable to introduce a novel restriction site in the region of
the mutation to create cleavage-based detection (Gasparini et al.
(1992) Mol. Cell. Probes 6:1).
[0171] In another embodiment, identification of the allelic variant
is carried out using an oligonucleotide ligation assay (OLA), as
described, e.g., in U.S. Pat. No. 4,998,617 and in Landegren, U. et
al., (1988) Science 241:1077-1080. The OLA protocol uses two
oligonucleotides which are designed to be capable of hybridizing to
abutting sequences of a single strand of a target. One of the
oligonucleotides is linked to a separation marker, e.g.,
biotinylated, and the other is detectably labeled. If the precise
complementary sequence is found in a target molecule, the
oligonucleotides will hybridize such that their termini abut, and
create a ligation substrate. Ligation then permits the labeled
oligonucleotide to be recovered using avidin, or another biotin
ligand. Nickerson, D. A. et al. have described a nucleic acid
detection assay that combines attributes of PCR and OLA (Nickerson,
D. A. et al., (1990) Proc. Natl. Acad. Sci. (U.S.A.) 87:8923-8927.
In this method, PCR is used to achieve the exponential
amplification of target DNA, which is then detected using OLA.
[0172] Several techniques based on this OLA method have been
developed and can be used to detect specific allelic variants of a
polymorphic region of an PGC-1.alpha. gene. For example, U.S. Pat.
No. 5,593,826 discloses an OLA using an oligonucleotide having
3'-amino group and a 5'-phosphorylated oligonucleotide to form a
conjugate having a phosphoramidate linkage. In another variation of
OLA described in Tobe et al. ((1996) Nucleic Acids Res 24: 3728),
OLA combined with PCR permits typing of two alleles in a single
microtiter well. By marking each of the allele-specific primers
with a unique hapten, i.e. digoxigenin and fluorescein, each OLA
reaction can be detected by using hapten specific antibodies that
are labeled with different enzyme reporters, alkaline phosphatase
or horseradish peroxidase. This system permits the detection of the
two alleles using a high throughput format that leads to the
production of two different colors.
[0173] The invention further provides methods for detecting single
nucleotide polymorphisms in a PGC-1.alpha. gene. Because single
nucleotide polymorphisms constitute sites of variation flanked by
regions of invariant sequence, their analysis requires no more than
the determination of the identity of the single nucleotide present
at the site of variation and it is unnecessary to determine a
complete gene sequence for each subject. Several methods have been
developed to facilitate the analysis of such single nucleotide
polymorphisms.
[0174] In one embodiment, the single base polymorphism can be
detected by using a specialized exonuclease-resistant nucleotide,
as disclosed, e.g., in Mundy, C. R. (U.S. Pat. No. 4,656,127).
According to the method, a primer complementary to the allelic
sequence immediately 3' to the polymorphic site is permitted to
hybridize to a target molecule obtained from a particular animal or
human. If the polymorphic site on the target molecule contains a
nucleotide that is complementary to the particular
exonuclease-resistant nucleotide derivative present, then that
derivative will be incorporated onto the end of the hybridized
primer. Such incorporation renders the primer resistant to
exonuclease, and thereby permits its detection. Since the identity
of the exonuclease-resistant derivative of the sample is known, a
finding that the primer has become resistant to exonucleases
reveals that the nucleotide presents in the polymorphic site of the
target molecule was complementary to that of the nucleotide
derivative used in the reaction. This method has the advantage that
it does not require the determination of large amounts of
extraneous sequence data.
[0175] In another embodiment of the invention, a solution-based
method is used for determining the identity of the nucleotide of a
polymorphic site (Cohen, D. et al. (French Patent 2,650,840; PCT
Application No. WO91/02087). As in the Mundy method of U.S. Pat.
No. 4,656,127, a primer is employed that is complementary to
allelic; sequences immediately 3' to a polymorphic site. The method
determines the identity of the nucleotide of that site using
labeled dideoxynucleotide derivatives, which, if complementary to
the nucleotide of the polymorphic site will become incorporated
onto the terminus of the primer.
[0176] An alternative method, known as Genetic Bit Analysis or GBA
is described by Goelet, P. et al. (PCT Application No. 92/15712).
The method of Goelet, P. et al. uses mixtures of labeled
terminators and a primer that is complementary to the sequence 3'
to a polymorphic site. The labeled terminator that is incorporated
is thus determined by, and complementary to, the nucleotide present
in the polymorphic site of the target molecule being evaluated. In
contrast to the method of Cohen et al. (French Patent 2,650,840;
PCT Appln. No. WO91/02087) the method of Goelet, P. et al. is
preferably a heterogeneous phase assay, in which the primer or the
target molecule is immobilized to a solid phase.
[0177] Several primer-guided nucleotide incorporation procedures
for assaying polymorphic sites in DNA have been described (Komher,
J. S. et al., Nucl. Acids. Res. 17:7779-7784 (1989); Sokolov, B.
P., Nucl. Acids Res. 18:3671 (1990); Syvanen, A.-C., et al.,
Genomics 8:684-692 (1990); Kuppuswamy, M. N. et al., Proc. Natl.
Acad. Sci. (U.S.A.) 88:1143-1147 (1991); Prezant, T. R. et al.,
Hum. Mutat. 1:159-164 (1992); Ugozzoli, L. et al., GATA 9:107-112
(1992); Nyren, P. et al., Anal. Biochem. 208:171-175 (1993)). These
methods differ from GBA in that they all rely on the incorporation
of labeled deoxynucleotides to discriminate between bases at a
polymorphic site. In such a format, since the signal is
proportional to the number of deoxynucleotides incorporated,
polymorphisms that occur in runs of the same nucleotide can result
in signals that are proportional to the length of the run (Syvanen,
A.-C., et al., Amer. J. Hum. Genet. 52:46-59 (1993)).
[0178] For determining the identity of the allelic variant of a
polymorphic region located in the coding region of a PGC-1.alpha.
gene, yet other methods than those described above can be used. For
example, identification of an allelic variant which encodes a
mutated PGC-1.alpha. protein can be performed by using an antibody
specifically recognizing the mutant protein in, e.g.,
immunohistochemistry or immunoprecipitation. Antibodies to
wild-type PGC-1.alpha. or mutated forms of PGC-1.alpha. proteins
can be prepared according to methods known in the art.
[0179] Alternatively, one can also measure an activity of a
PGC-1.alpha. protein, such as binding to a PGC-1.alpha. ligand.
Binding assays are known in the art and involve, e.g., obtaining
cells from a subject, and performing binding experiments with a
labeled lipid, to determine whether binding to the mutated form of
the protein differs from binding to the wild-type of the
protein.
[0180] Antibodies directed against reference or mutant PGC-1.alpha.
polypeptides or allelic variant thereof, which are discussed above,
may also be used in disease diagnostics and prognostics. Such
diagnostic methods, may be used to detect abnormalities in the
level of PGC-1.alpha. polypeptide expression, or abnormalities in
the structure and/or tissue, cellular, or subcellular location of
an PGC-1.alpha. polypeptide. Structural differences may include,
for example, differences in the size, electronegativity, or
antigenicity of the mutant PGC-1.alpha. polypeptide relative to the
normal PGC-1.alpha. polypeptide. Protein from the tissue or cell
type to be analyzed may easily be detected or isolated using
techniques which are well known to one of skill in the art,
including but not limited to Western blot analysis. For a detailed
explanation of methods for carrying out Western blot analysis, see
Sambrook et al, 1989, supra, at Chapter 18. The protein detection
and isolation methods employed herein may also be such as those
described in Harlow and Lane, for example (Harlow, E. and Lane, D.,
1988, "Antibodies: A Laboratory Manual", Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y.), which is incorporated
herein by reference in its entirety.
[0181] This can be accomplished, for example, by immunofluorescence
techniques employing a fluorescently labeled antibody (see below)
coupled with light microscopic, flow cytometric, or fluorimetric
detection. The antibodies (or fragments thereof) useful in the
present invention may, additionally, be employed histologically, as
in immunofluorescence or immunoelectron microscopy, for in situ
detection of PGC-1.alpha. polypeptides. In situ detection may be
accomplished by removing a histological specimen from a subject,
and applying thereto a labeled antibody of the present invention.
The antibody (or fragment) is preferably applied by overlaying the
labeled antibody (or fragment) onto a biological sample. Through
the use of such a procedure, it is possible to determine not only
the presence of the PGC-1.alpha. polypeptide, but also its
distribution in the examined tissue. Using the present invention,
one of ordinary skill will readily perceive that any of a wide
variety of histological methods (such as staining procedures) can
be modified in order to achieve such in situ detection.
[0182] Often a solid phase support or carrier is used as a support
capable of binding an antigen or an antibody. Well-known supports
or carriers include glass, polystyrene, polypropylene,
polyethylene, dextran, nylon, amylases, natural and modified
celluloses, polyacrylamides, gabbros, and magnetite. The nature of
the carrier can be either soluble to some extent or insoluble for
the purposes of the present invention. The support material may
have virtually any possible structural configuration so long as the
coupled molecule is capable of binding to an antigen or antibody.
Thus, the support configuration may be spherical, as in a bead, or
cylindrical, as in the inside surface of a test tube, or the
external surface of a rod. Alternatively, the surface may be flat
such as a sheet, test strip, etc. Preferred supports include
polystyrene beads. Those skilled in the art will know many other
suitable carriers for binding antibody or antigen, or will be able
to ascertain the same by use of routine experimentation.
[0183] One means for labeling an anti-PGC-1.alpha. polypeptide
specific antibody is via linkage to an enzyme and use in an enzyme
immunoassay (EIA) (Voller, "The Enzyme Linked Immunosorbent Assay
(ELISA)", Diagnostic Horizons 2:1-7, 1978, Microbiological
Associates Quarterly Publication, Walkersville, Md.; Voller, et
al., J. Clin. Pathol. 31:507-520 (1978); Butler, Meth. Enzymol.
73:482-523 (1981); Maggio, (ed.) Enzyme Immunoassay, CRC Press,
Boca Raton, Fla., 1980; Ishikawa, et al., (eds.) Enzyme
Immunoassay, Kgaku Shoin, Tokyo, 1981). The enzyme which is bound
to the antibody will react with an appropriate substrate,
preferably a chromogenic substrate, in such a manner as to produce
a chemical moiety which can be detected, for example, by
spectrophotometric, fluorimetric or by visual means. Enzymes which
can be used to detectably label the antibody include, but are not
limited to, malate dehydrogenase, staphylococcal nuclease,
delta-5-steroid isomerase, yeast alcohol dehydrogenase,
alpha-glycerophosphate, dehydrogenase, triose phosphate isomerase,
horseradish peroxidase, alkaline phosphatase, asparaginase, glucose
oxidase, beta-galactosidase, ribonuclease, urease, catalase,
glucose-6-phosphate dehydrogenase, glucoamylase and
acetylcholinesterase. The detection can be accomplished by
colorimetric methods which employ a chromogenic substrate for the
enzyme. Detection may also be accomplished by visual comparison of
the extent of enzymatic reaction of a substrate in comparison with
similarly prepared standards.
[0184] Detection may also be accomplished using any of a variety of
other immunoassays. For example, by radioactively labeling the
antibodies or antibody fragments, it is possible to detect
fingerprint gene wild type or mutant peptides through the use of a
radioimmunoassay (RIA) (see, for example, Weintraub, B., Principles
of Radioimmunoassays, Seventh Training Course on Radioligand Assay
Techniques, The Endocrine Society, March, 1986, which is
incorporated by reference herein). The radioactive isotope can be
detected by such means as the use of a gamma counter or a
scintillation counter or by autoradiography.
[0185] It is also possible to label the antibody with a fluorescent
compound. When the fluorescently labeled antibody is exposed to
light of the proper wave length, its presence can then be detected
due to fluorescence. Among the most commonly used fluorescent
labeling compounds are fluorescein isothiocyanate, rhodamine,
phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde and
fluorescamine. The antibody can also be detectably labeled using
fluorescence emitting metals such as .sup.152Eu, or others of the
lanthanide series. These metals can be attached to the antibody
using such metal chelating groups as diethylenetriaminepentacetic
acid (DTPA) or ethylenediaminetetraacetic acid (EDTA).
[0186] The antibody also can be detectably labeled by coupling it
to a chemiluminescent compound. The presence of the
chemiluminescent-tagged antibody is then determined by detecting
the presence of luminescence that arises during the course of a
chemical reaction. Examples of particularly useful chemiluminescent
labeling compounds are luminol, isoluminol, theromatic acridinium
ester, imidazole, acridinium salt and oxalate ester.
[0187] Likewise, a bioluminescent compound may be used to label the
antibody of the present invention. Bioluminescence is a type of
chemiluminescence found in biological systems in, which a catalytic
protein increases the efficiency of the chemiluminescent reaction.
The presence of a bioluminescent protein is determined by detecting
the presence of luminescence. Important bioluminescent compounds
for purposes of labeling are luciferin, luciferase and
aequorin.
[0188] If a polymorphic region is located in an exon, either in a
coding or non-coding portion of the gene, the identity of the
allelic variant can be determined by determining the molecular
structure of the mRNA, pre-mRNA, or cDNA. The molecular structure
can be determined using any of the above described methods for
determining the molecular structure of the genomic DNA.
[0189] The methods described herein may be performed, for example,
by utilizing pre-packaged diagnostic kits, such as those described
above, comprising at least one probe or primer nucleic acid
described herein, which may be conveniently used, e.g., to
determine whether a subject has or is at risk of developing a
disease associated with a specific PGC-1.alpha. allelic
variant.
Sample nucleic acid to be analyzed by any of the above-described
diagnostic and prognostic methods can be obtained from any cell
type or tissue of a subject. For example, a subject's bodily fluid
(e.g. blood) can be obtained by known techniques (e.g.,
venipuncture). Alternatively, nucleic acid tests can be performed
on dry samples (e.g., hair or skin). Fetal nucleic acid samples can
be obtained from maternal blood as described in International
Patent Application No. WO91/07660 to Bianchi. Alternatively,
amniocytes or chorionic villi may be obtained for performing
prenatal testing.
[0190] Diagnostic procedures may also be performed in situ directly
upon tissue sections
[0191] (fixed and/or frozen) of subject tissue obtained from
biopsies or resections, such that no nucleic acid purification is
necessary. Nucleic acid reagents may be used as probes and/or
primers for such in situ procedures (see, for example, Nuovo, G.
J., 1992, PCR in situ hybridization: protocols and applications,
Raven Press, NY).
[0192] In addition to methods which focus primarily on the
detection of one nucleic acid sequence, profiles may also be
assessed in such detection schemes. Fingerprint profiles may be
generated, for example, by utilizing a differential display
procedure, Northern analysis and/or RT-PCR.
[0193] B. Monitoring of Effects During Clinical Trials
[0194] The present invention further provides methods for
determining the effectiveness of a PGC-1.alpha. modulator (e.g., a
PGC-1.alpha. modulator identified herein) in treating or preventing
a neurological disease or disorder or assessing risk of developing
a neurological disease or disorder in a subject. For example, the
effectiveness of a PGC-1.alpha. modulator in increasing or
decreasing PGC-1.alpha. gene expression, protein levels, or in
upregulating or down-regulating PGC-1.alpha. activity, can be
monitored in clinical trials of subjects exhibiting increased or
decreased PGC-1.alpha. gene expression, protein levels, or
upregulated or downregulated PGC-1.alpha. activity. In such
clinical trials, the expression or activity of a PGC-1.alpha. gene,
and preferably, other genes that have been implicated in, for
example, a PGC-1.alpha. pathway can be used as a "read out" or
marker of the phenotype of a particular cell.
[0195] For example, and not by way of limitation, genes, including
PGC-1.alpha., that are modulated in cells by treatment with an
agent which modulates PGC-1.alpha. activity (e.g., identified in a
screening assay as described herein) can be identified. Thus, to
study the effect of agents which modulate PGC-1.alpha. activity on
subjects suffering a neurological disease or disorder, or agents to
be used as a prophylactic, for example, a clinical trial, cells can
be isolated and RNA prepared and analyzed for the levels of
expression of PGC-1.alpha. and other genes implicated in
PGC-1.alpha. activity or expression. The levels of gene expression
(e.g., a gene expression pattern) can be quantified by Northern
blot analysis or RT-PCR, as described herein, or alternatively by
measuring the amount of protein produced, by one of the methods
described herein, or by measuring the levels of activity of
PGC-1.alpha. or other genes. In this way, the gene expression
pattern can serve as a marker, indicative of the physiological
response of the cells to the agent which modulates PGC-1.alpha.
activity. This response state may be determined before, and at
various points during treatment of the individual with the agent
which modulates PGC-1.alpha. activity.
[0196] In a preferred embodiment, the present invention provides a
method for monitoring the effectiveness of treatment of a subject
with an agent which modulates PGC-1.alpha. activity (e.g., an
agonist, antagonist, peptidomimetic, protein, peptide, nucleic
acid, siRNA, or small molecule identified by the screening assays
described herein) including the steps of (i) obtaining a
pre-administration sample from a subject prior to administration of
the agent; (ii) detecting the level of expression of a PGC-1.alpha.
protein, mRNA, or genomic DNA in the pre-administration sample;
(iii) obtaining one or more post-administration samples from the
subject; (iv) detecting the level of expression or activity of the
PGC-1.alpha. protein, mRNA, or genomic DNA in the
post-administration samples; (v) comparing the level of expression
or activity of the PGC-1.alpha. protein, mRNA, or genomic DNA in
the pre-administration sample with the PGC-1.alpha. protein, mRNA,
or genomic DNA in the post administration sample or samples; and
(vi) altering the administration of the agent to the subject
accordingly. For example, increased administration of the agent may
be desirable to increase the expression or activity of PGC-1.alpha.
to higher levels than detected, i.e., to increase the effectiveness
of the agent. According to such an embodiment, PGC-1.alpha.
expression or activity may be used as an indicator of the
effectiveness of an agent, even in the absence of an observable
phenotypic response.
[0197] IV. Recombinant Expression Vectors and Host Cells Used in
the Methods of the Invention
[0198] The methods of the invention (e.g., the screening assays and
therapeutic and/or preventative methods described herein) include
the use of vectors, preferably expression vectors, containing a
nucleic acid encoding a PGC-1.alpha. protein (or a portion
thereof). For example, in one embodiment, a vector containing a
nucleic acid encoding a PGC-1.alpha. protein, or portion thereof,
is used to deliver a PGC-1.alpha. protein, or portion thereof, to a
subject, to treat or prevent a neurological disease or disorder in
the subject. In one embodiment, the vector containing a nucleic
acid encoding a PGC-1.alpha. protein, or portion thereof, is
targeted to a specific cell type, organ or tissue, e.g., a brain
cell or a specific portion of the brain, e.g., the striatum, using,
e.g., a tissue specific promoter as described herein.
[0199] As used herein, the term "vector" refers to a nucleic acid
molecule capable of transporting another nucleic acid to which it
has been linked. One type of vector is a "plasmid", which refers to
a circular double stranded DNA loop into which additional DNA
segments can be ligated. Another type of vector is a viral vector,
wherein additional DNA segments can be ligated into the viral
genome. Certain vectors are capable of autonomous replication in a
host cell into which they are introduced (e.g., bacterial vectors
having a bacterial origin of replication and episomal mammalian
vectors). Other vectors (e.g., non-episomal mammalian vectors) are
integrated into the genome of a host cell upon introduction into
the host cell, and thereby are replicated along with the host
genome. Moreover, certain vectors are capable of directing the
expression of genes to which they are operatively linked. Such
vectors are referred to herein as "expression vectors". In general,
expression vectors of utility in recombinant DNA techniques are
often in the form of plasmids. In the present specification,
"plasmid" and "vector" can be used interchangeably as the plasmid
is the most commonly used form of vector. However, the invention is
intended to include such other forms of expression vectors, such as
viral vectors (e.g., replication defective retroviruses,
adenoviruses and adeno-associated viruses), which serve equivalent
functions.
[0200] The recombinant expression vectors to be used in the methods
of the invention comprise a nucleic acid of the invention in a form
suitable for expression of the nucleic acid in a host cell, which
means that the recombinant expression vectors include one or more
regulatory sequences, selected on the basis of the host cells to be
used for expression, which is operatively linked to the nucleic
acid sequence to be expressed. Within a recombinant expression
vector, "operably linked" is intended to mean that the nucleotide
sequence of interest is linked to the regulatory sequence(s) in a
manner which allows for expression of the nucleotide sequence
(e.g., in an in vitro transcription/translation system or in a host
cell when the vector is introduced into the host cell). The term
"regulatory sequence" is intended to include promoters, enhancers
and other expression control elements (e.g., polyadenylation
signals). Such regulatory sequences are described, for example, in
Goeddel (1990) Methods Enzymol. 185:3-7. Regulatory sequences
include those which direct constitutive expression of a nucleotide
sequence in many types of host cells and those which direct
expression of the nucleotide sequence only in certain host cells
(e.g., tissue-specific regulatory sequences). It will be
appreciated by those skilled in the art that the design of the
expression vector can depend on such factors as the choice of the
host cell to be transformed, the level of expression of protein
desired, and the like. The expression vectors of the invention can
be introduced into host cells to thereby produce proteins or
peptides, including fusion proteins or peptides, encoded by nucleic
acids as described herein (e.g., PGC-1.alpha. proteins, mutant
forms of PGC-1.alpha. proteins, fusion proteins, and the like).
[0201] The recombinant expression vectors to be used in the methods
of the invention can be designed for expression of PGC-1.alpha.
proteins in prokaryotic or eukaryotic cells. For example,
PGC-1.alpha. proteins can be expressed in bacterial cells such as
E. coli, insect cells (using baculovirus expression vectors), yeast
cells, or mammalian cells. Suitable host cells are discussed
further in Goeddel (1990) supra. Alternatively, the recombinant
expression vector can be transcribed and translated in vitro, for
example using T7 promoter regulatory sequences and T7
polymerase.
[0202] Expression of proteins in prokaryotes is most often carried
out in E. coli with vectors containing constitutive or inducible
promoters directing the expression of either fusion or non-fusion
proteins. Fusion vectors add a number of amino acids to a protein
encoded therein, usually to the amino terminus of the recombinant
protein. Such fusion vectors typically serve three purposes: 1) to
increase expression of recombinant protein; 2) to increase the
solubility of the recombinant protein; and 3) to aid in the
purification of the recombinant protein by acting as a ligand in
affinity purification. Often, in fusion expression vectors, a
proteolytic cleavage site is introduced at the junction of the
fusion moiety and the recombinant protein to enable separation of
the recombinant protein from the fusion moiety subsequent to
purification of the fusion protein. Such enzymes, and their cognate
recognition sequences, include Factor Xa, thrombin and
enterokinase. Typical fusion expression vectors include pGEX
(Pharmacia Biotech Inc; Smith, D. B. and Johnson, K. S. (1988) Gene
67:31-40), pMAL (New England Biolabs, Beverly, Mass.) and pRIT5
(Pharmacia, Piscataway, N.J.) which fuse glutathione S-transferase
(GST), maltose E binding protein, or protein A, respectively, to
the target recombinant protein.
[0203] Purified fusion proteins can be utilized in PGC-1.alpha.
activity assays, (e.g., direct assays or competitive assays
described in detail below), or to generate antibodies specific for
PGC-1.alpha. proteins. In a preferred embodiment, a PGC-1.alpha.
fusion protein expressed in a retroviral expression vector of the
present invention can be utilized to infect bone marrow cells which
are subsequently transplanted into irradiated recipients. The
pathology of the subject recipient is then examined after
sufficient time has passed (e.g., six weeks).
[0204] In another embodiment, a nucleic acid of the invention is
expressed in mammalian cells using a mammalian expression vector.
Examples of mammalian expression vectors include pCDM8 (Seed, B.
(1987) Nature 329:840) and pMT2PC (Kaufman et al. (1987) EMBO J.
6:187-195). When used in mammalian cells, the expression vector's
control functions are often provided by viral regulatory elements.
For example, commonly used promoters are derived from polyoma,
Adenovirus 2, cytomegalovirus and Simian Virus 40. For other
suitable expression systems for both prokaryotic and eukaryotic
cells see chapters 16 and 17 of Sambrook, J. et al., Molecular
Cloning: A Laboratory Manual. 2nd ed., Cold Spring Harbor
Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., 1989.
[0205] In another embodiment, the recombinant mammalian expression
vector is capable of directing expression of the nucleic acid
preferentially in a particular cell type (e.g., tissue-specific
regulatory elements are used to express the nucleic acid).
Tissue-specific regulatory elements are known in the art.
Non-limiting examples of suitable tissue-specific promoters include
neuron-specific promoters (e.g., the neurofilament promoter; Byrne
and Ruddle, 1989, Proc. Natl. Acad. Sci. USA 86:5473-5477), albumin
promoter (liver-specific; Pinkert et al., 1987, Genes Dev.
1:268-277), lymphoid-specific promoters (Calame and Eaton, 1988,
Adv. Immunol. 43:235-275), in particular promoters of T cell
receptors (Winoto and Baltimore, 1989, EMBO J. 8:729-733) and
immunoglobulins (Banerji et al., 1983, Cell 33:729-740; Queen and
Baltimore, 1983, Cell 33:741-748), pancreas-specific promoters
(Edlund et al., 1985, Science 230:912-916), and mammary
gland-specific promoters (e.g., milk whey promoter; U.S. Pat. No.
4,873,316 and European Application Publication No. 264,166).
Developmentally-regulated promoters are also encompassed, for
example the murine hox promoters (Kessel and Gruss, 1990, Science
249:374-379) and the .alpha.-fetoprotein promoter (Camper and
Tilghman, 1989, Genes Dev. 3:537-546).
[0206] The methods of the invention may further use a recombinant
expression vector comprising a DNA molecule of the invention cloned
into the expression vector in an antisense orientation. That is,
the DNA molecule is operatively linked to a regulatory sequence in
a manner which allows for expression (by transcription of the DNA
molecule) of an RNA molecule which is antisense to PGC-1.alpha.
mRNA. Regulatory sequences operatively linked to a nucleic acid
cloned in the antisense orientation can be chosen which direct the
continuous expression of the antisense RNA molecule in a variety of
cell types, for instance viral promoters and/or enhancers, or
regulatory sequences can be chosen which direct constitutive,
tissue specific, or cell type specific expression of antisense RNA.
The antisense expression vector can be in the form of a recombinant
plasmid, phagemid, or attenuated virus in which antisense nucleic
acids are produced under the control of a high efficiency
regulatory region, the activity of which can be determined by the
cell type into which the vector is introduced. For a discussion of
the regulation of gene expression using antisense genes, see
Weintraub, H. et al., Antisense RNA as a molecular tool for genetic
analysis, Reviews--Trends in Genetics, Vol. 1(1) 1986.
[0207] Another aspect of the invention pertains to the use of host
cells into which a PGC-1.alpha. nucleic acid molecule of the
invention is introduced, e.g., a PGC-1.alpha. nucleic acid molecule
within a recombinant expression vector or a PGC-1.alpha. nucleic
acid molecule containing sequences which allow it to homologously
recombine into a specific site of the host cell's genome. The terms
"host cell" and "recombinant host cell" are used interchangeably
herein. It is understood that such terms refer not only to the
particular subject cell but to the progeny or potential progeny of
such a cell. Because certain modifications may occur in succeeding
generations due to either mutation or environmental influences,
such progeny may not, in fact, be identical to the parent cell, but
are still included within the scope of the term as used herein.
[0208] A host cell can be any prokaryotic or eukaryotic cell. For
example, a PGC-1.alpha. protein can be expressed in bacterial cells
such as E. coli, insect cells, yeast or mammalian cells (such as
Chinese hamster ovary cells (CHO) or COS cells). Other suitable
host cells are known to those skilled in the art.
[0209] Vector DNA can be introduced into prokaryotic or eukaryotic
cells via conventional transformation or transfection techniques.
As used herein, the terms "transformation" and "transfection" are
intended to refer to a variety of art-recognized techniques for
introducing foreign nucleic acid (e.g., DNA) into a host cell,
including calcium phosphate or calcium chloride co-precipitation,
DEAE-dextran-mediated transfection, lipofection, or
electroporation. Suitable methods for transforming or transfecting
host cells can be found in Sambrook et al. (Molecular Cloning: A
Laboratory. Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989),
and other laboratory manuals.
[0210] A host cell used in the methods of the invention, such as a
prokaryotic or eukaryotic host cell in culture, can be used to
produce (i.e., express) a PGC-1.alpha. protein. Accordingly, the
invention further provides methods for producing a PGC-1.alpha.
protein using the host cells of the invention. In one embodiment,
the method comprises culturing the host cell of the invention (into
which a recombinant expression vector encoding a PGC-1.alpha.
protein has been introduced) in a suitable medium such that a
PGC-1.alpha. protein is produced. In another embodiment, the method
further comprises isolating a PGC-1.alpha. protein from the medium
or the host cell.
[0211] The host cells of the invention can also be used to produce
nonhuman transgenic animals. For example, in one embodiment, a host
cell of the invention is a fertilized oocyte or an embryonic stem
cell into which sequences encoding a polypeptide corresponding to a
marker of the invention have been introduced. Such host cells can
then be used to create non-human transgenic animals in which
exogenous sequences encoding a marker protein of the invention have
been introduced into their genome or homologous recombinant animals
in which endogenous gene(s) encoding a polypeptide corresponding to
a marker of the invention sequences have been altered. Such animals
are useful for studying the function and/or activity of
PGC-1.alpha., for identifying and/or evaluating modulators of
PGC-1.alpha. polypeptide activity, as well as in pre-clinical
testing of therapeutics or diagnostic molecules, for marker
discovery or evaluation, e.g., therapeutic and diagnostic marker
discovery or evaluation, or as surrogates of drug efficacy and
specificity.
[0212] A transgenic animal of the invention can be created by
introducing a nucleic acid encoding a polypeptide corresponding to
PGC-1.alpha. into the male pronuclei of a fertilized oocyte, e.g.,
by microinjection, retroviral infection, and allowing the oocyte to
develop in a pseudopregnant female foster animal. Intronic
sequences and polyadenylation signals can also be included in the
transgene to increase the efficiency of expression of the
transgene. A tissue-specific regulatory sequence(s) can be operably
linked to the transgene to direct expression of the polypeptide of
the invention to particular cells. Methods for generating
transgenic animals via embryo manipulation and microinjection,
particularly animals such as mice, have become conventional in the
art and are described, for example, in U.S. Pat. Nos. 4,736,866 and
4,870,009, U.S. Pat. No. 4,873,191 and in Hogan, Manipulating the
Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., 1986. Similar methods are used for production of
other transgenic animals. A transgenic founder animal can be
identified based upon the presence of the transgene in its genome
and/or expression of mRNA encoding the transgene in tissues or
cells of the animals. A transgenic founder animal can then be used
to breed additional animals carrying the transgene. Moreover,
transgenic animals carrying the transgene can further be bred to
other transgenic animals carrying other transgenes.
[0213] To create an homologous recombinant animal, a vector is
prepared which contains at least a portion of a gene encoding a
polypeptide corresponding to a marker of the invention into which a
deletion, addition or substitution has been introduced to thereby
alter, e.g., functionally disrupt, the gene. In a preferred
embodiment, the vector is designed such that, upon homologous
recombination, the endogenous gene is functionally disrupted (i.e.,
no longer encodes a functional protein; also referred to as a
"knock out" vector). Alternatively, the vector can be designed such
that, upon homologous recombination, the endogenous gene is mutated
or otherwise altered but still encodes functional protein (e.g.,
the upstream regulatory region can be altered to thereby alter the
expression of the endogenous protein). In the homologous
recombination vector, the altered portion of the gene is flanked at
its 5' and 3' ends by additional nucleic acid of the gene to allow
for homologous recombination to occur between the exogenous gene
carried by the vector and an endogenous gene in an embryonic stem
cell. The additional flanking nucleic acid sequences are of
sufficient length for successful homologous recombination with the
endogenous gene. Typically, several kilobases of flanking DNA (both
at the 5' and 3' ends) are included in the vector (see, e.g.,
Thomas and Capecchi, 1987, Cell 51:503 for a description of
homologous recombination vectors). The vector is introduced into an
embryonic stem cell line (e.g., by electroporation) and cells in
which the introduced gene has homologously recombined with the
endogenous gene are selected (see, e.g., Li et al., 1992, Cell
69:915). The selected cells are then injected into a blastocyst of
an animal (e.g., a mouse) to form aggregation chimeras (see, e.g.,
Bradley, Teratocarcinomas and Embryonic Stem Cells: A Practical
Approach, Robertson, Ed., IRL, Oxford, 1987, pp. 113-152). A
chimeric embryo can then be implanted into a suitable
pseudopregnant female foster animal and the embryo brought to term.
Progeny harboring the homologously recombined DNA in their germ
cells can be used to breed animals in which all cells of the animal
contain the homologously recombined DNA by germline transmission of
the transgene. Methods for constructing homologous recombination
vectors and homologous recombinant animals are described further in
Bradley (1991) Current Opinion in Bio/Technology 2:823-829 and in
PCT Publication NOS. WO 90/11354, WO 91/01140, WO 92/0968, and WO
93/04169.
[0214] In another embodiment, transgenic non-human animals can be
produced which contain selected systems which allow for regulated
expression of the transgene. One example of such a system is the
cre/loxP recombinase system of bacteriophage P1. For a description
of the cre/loxP recombinase system, see, e.g., Lakso et al. (1992)
Proc. Natl. Acad. Sci. USA 89:6232-6236. Another example of a
recombinase system is the FLP recombinase system of Saccharomyces
cerevisiae (O'Gorman et al., 1991, Science 251:1351-1355). If a
cre/loxP recombinase system is used to regulate expression of the
transgene, animals containing transgenes encoding both the Cre
recombinase and a selected protein are required. Such animals can
be provided through the construction of "double" transgenic
animals, e.g., by mating two transgenic animals, one containing a
transgene encoding a selected protein and the other containing a
transgene encoding a recombinase.
[0215] Clones of the non-human transgenic animals described herein
can also be produced according to the methods described in Wilmut
et al. (1997) Nature 385:810-813 and PCT Publication NOS. WO
97/07668 and WO 97/07669.
[0216] V. Isolated Nucleic Acid Molecules Used in the Methods of
the Invention
[0217] The nucleotide sequence of the isolated human PGC-1.alpha.
cDNA and the predicted amino acid sequence of the human
PGC-1.alpha. polypeptide are shown in SEQ ID NOs:1 and 2,
respectively. The nucleotide and amino acid sequences of human
PGC-1.alpha. are also described in GenBank Accession No.
GI:29570796. The nucleotide sequence of the isolated human
PGC-1.alpha. cDNA and the predicted amino acid sequence of the
human PGC-1.alpha. polypeptide are shown in SEQ ID NOs:45 and 46,
respectively. The nucleotide and amino acid sequences of mouse
PGC-1.alpha. are also described in GenBank Accession No.
GI:6679432.
[0218] The methods of the invention include the use of isolated
nucleic acid molecules that encode PGC-1.alpha. proteins or
biologically active portions thereof, as well as nucleic acid
fragments sufficient for use as hybridization probes to identify
PGC-1.alpha.-encoding nucleic acid molecules (e.g., PGC-1.alpha.
mRNA) and fragments for use as PCR primers for the amplification or
mutation of PGC-1.alpha. nucleic acid molecules. As used herein,
the term "nucleic acid molecule" is intended to include DNA
molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g.,
mRNA) and analogs of the DNA or RNA generated using nucleotide
analogs. The nucleic acid molecule can be single-stranded or
double-stranded, but preferably is double-stranded DNA.
[0219] A nucleic acid molecule used in the methods of the present
invention, e.g., a nucleic acid molecule having the nucleotide
sequence of SEQ ID NO:1, or a portion thereof, can be isolated
using standard molecular biology techniques and the sequence
information provided herein. Using all or portion of the nucleic
acid sequence of SEQ ID NO:1 as a hybridization probe, PGC-1.alpha.
nucleic acid molecules can be isolated using standard hybridization
and cloning techniques (e.g., as described in Sambrook, J., Fritsh,
E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual.
2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., 1989).
[0220] Moreover, a nucleic acid molecule encompassing all or a
portion of SEQ ID NO:1 can be isolated by the polymerase chain
reaction (PCR) using synthetic oligonucleotide primers designed
based upon the sequence of SEQ ID NO:1.
[0221] A nucleic acid used in the methods of the invention can be
amplified using cDNA, mRNA or, alternatively, genomic DNA as a
template and appropriate oligonucleotide primers according to
standard PCR amplification techniques. Furthermore,
oligonucleotides corresponding to PGC-1.alpha. nucleotide sequences
can be prepared by standard synthetic techniques, e.g., using an
automated DNA synthesizer.
[0222] In a preferred embodiment, the isolated nucleic acid
molecules used in the methods of the invention comprise the
nucleotide sequence shown in SEQ ID NO:1, a complement of the
nucleotide sequence shown in SEQ ID NO:1, or a portion of any of
these nucleotide sequences. A nucleic acid molecule which is
complementary to the nucleotide sequence shown in SEQ ID NO:1, is
one which is sufficiently complementary to the nucleotide sequence
shown in SEQ ID NO:1 such that it can hybridize to the nucleotide
sequence shown in SEQ ID NO:1 thereby forming a stable duplex.
[0223] In still another preferred embodiment, an isolated nucleic
acid molecule used in the methods of the present invention
comprises a nucleotide sequence which is at least about 55%, 60%,
65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more
identical to the entire length of the nucleotide sequence shown in
SEQ ID NO:1 or a portion of any of this nucleotide sequence.
[0224] Moreover, the nucleic acid molecules used in the methods of
the invention can comprise only a portion of the nucleic acid
sequence of SEQ ID NO:1, for example, a fragment which can be used
as a probe or primer or a fragment encoding a portion of a
PGC-1.alpha. protein, e.g., a biologically active portion of a
PGC-1.alpha. protein. The probe/primer typically comprises
substantially purified oligonucleotide. The oligonucleotide
typically comprises a region of nucleotide sequence that hybridizes
under stringent conditions to at least about 12 or 15, preferably
about 20 or 25, more preferably about 30, 35, 40, 45, 50, 55, 60,
65, or 75 consecutive nucleotides of a sense sequence of SEQ ID
NO:1 of an anti-sense sequence of SEQ ID NO:1 or of a naturally
occurring allelic variant or mutant of SEQ ID NO:1. In one
embodiment, a nucleic acid molecule used in the methods of the
present invention comprises a nucleotide sequence which is greater
than 100, 100-200, 200-300, 300-400, 400-500, 500-600, 600-700,
700-800, 800-900, 900-1000, 1000-1100, 1100-1200, 1200-1300, or
more nucleotides in length and hybridizes under stringent
hybridization conditions to a nucleic acid molecule of SEQ ID
NO:1.
[0225] As used herein, the term "hybridizes under stringent
conditions" is intended to describe conditions for hybridization
and washing under which nucleotide sequences that are significantly
identical or homologous to each other remain hybridized to each
other. Preferably, the conditions are such that sequences at least
about 70%, more preferably at least about 80%, even more preferably
at least about 85% or 90% identical to each other remain hybridized
to each other. Such stringent conditions are known to those skilled
in the art and can be found in Current Protocols in Molecular
Biology, Ausubel et al., eds., John Wiley & Sons, Inc. (1995),
sections 2, 4 and 6. Additional stringent conditions can be found
in Molecular Cloning: A Laboratory Manual, Sambrook et al., Cold
Spring Harbor Press, Cold Spring Harbor, N.Y. (1989), chapters 7, 9
and 11. A preferred, non-limiting example of stringent
hybridization conditions includes hybridization in 4.times. sodium
chloride/sodium citrate (SSC), at about 65-70.degree. C. (or
hybridization in 4.times.SSC plus 50% formamide at about
42-50.degree. C.) followed by one or more washes in 1.times.SSC, at
about 65-70.degree. C. A preferred, non-limiting example of highly
stringent hybridization conditions includes hybridization in
1.times.SSC, at about 65-70.degree. C. (or hybridization in
1.times.SSC plus 50% formamide at about 42-50.degree. C.) followed
by one or more washes in 0.3.times.SSC, at about 65-70.degree. C. A
preferred, non-limiting example of reduced stringency hybridization
conditions includes hybridization in 4.times.SSC, at about
50-60.degree. C. (or alternatively hybridization in 6.times.SSC
plus 50% formamide at about 40-45.degree. C.) followed by one or
more washes in 2.times.SSC, at about 50-60.degree. C. Ranges
intermediate to the above-recited values, e.g., at 65-70.degree. C.
or at 42-50.degree. C. are also intended to be encompassed by the
present invention. SSPE (1.times.SSPE is 0.15M NaCl, 10 mM
NaH.sub.2PO.sub.4, and 1.25 mM EDTA, pH 7.4) can be substituted for
SSC (1.times.SSC is 0.15M NaCl and 15 mM sodium citrate) in the
hybridization and wash buffers; washes are performed for 15 minutes
each after hybridization is complete. The hybridization temperature
for hybrids anticipated to be less than 50 base pairs in length
should be 5-10.degree. C. less than the melting temperature
(T.sub.m) of the hybrid, where T.sub.m is determined according to
the following equations. For hybrids less than 18 base pairs in
length, T.sub.m (.degree. C.)=2(# of A+T bases)+4(# of G+C bases).
For hybrids between 18 and 49 base pairs in length,
T.sub.m(.degree. C.)=81.5+16.6(log.sub.10[Na.sup.+])+0.41(%
G+C)-(600/N), where N is the number of bases in the hybrid, and
[Na.sup.+] is the concentration of sodium ions in the hybridization
buffer ([Na.sup.+] for 1.times.SSC=0.165 M). It will also be
recognized by the skilled practitioner that additional reagents may
be added to hybridization and/or wash buffers to decrease
non-specific hybridization of nucleic acid molecules to membranes,
for example, nitrocellulose or nylon membranes, including but not
limited to blocking agents (e.g., BSA or salmon or herring sperm
carrier DNA), detergents (e.g., SDS), chelating agents (e.g.,
EDTA), Ficoll, PVP and the like. When using nylon membranes, in
particular, an additional preferred, non-limiting example of
stringent hybridization conditions is hybridization in 0.25-0.5M
NaH.sub.2PO.sub.4, 7% SDS at about 65.degree. C., followed by one
or more washes at 0.02M NaH.sub.2PO.sub.4, 1% SDS at 65.degree. C.,
see e.g., Church and Gilbert (1984) Proc. Natl. Acad. Sci. USA
81:1991-1995, (or alternatively 0.2.times.SSC, 1% SDS).
[0226] In preferred embodiments, the probe further comprises a
label group attached thereto, e.g., the label group can be a
radioisotope, a fluorescent compound, an enzyme, or an enzyme
co-factor. Such probes can be used as a part of a diagnostic test
kit for identifying cells or tissue which misexpress a PGC-1.alpha.
protein, such as by measuring a level of a PGC-1.alpha.-encoding
nucleic acid in a sample of cells from a subject e.g., detecting
PGC-1.alpha. mRNA levels or determining whether a genomic
PGC-1.alpha. gene has been mutated or deleted.
[0227] The methods of the invention further encompass the use of
nucleic acid molecules that differ from the nucleotide sequence
shown in SEQ ID NO:1 due to degeneracy of the genetic code and thus
encode the same PGC-1.alpha. proteins as those encoded by the
nucleotide sequence shown in SEQ ID NO:1. In another embodiment, an
isolated nucleic acid molecule included in the methods of the
invention has a nucleotide sequence encoding a protein having an
amino acid sequence shown in SEQ ID NO:2.
[0228] The methods of the invention further include the use of
allelic variants of human PGC-1.alpha., e.g., functional and
non-functional allelic variants. Functional allelic variants are
naturally occurring amino acid sequence variants of the human
PGC-1.alpha. protein that maintain a PGC-1.alpha. activity.
Functional allelic variants will typically contain only
conservative substitution of one or more amino acids of SEQ ID
NO:2, or substitution, deletion or insertion of non-critical
residues in non-critical regions of the protein.
[0229] Non-functional allelic variants are naturally occurring
amino acid sequence variants of the human PGC-1.alpha. protein that
do not have a PGC-1.alpha. activity. Non-functional allelic
variants will typically contain a non-conservative substitution,
deletion, or insertion or premature truncation of the amino acid
sequence of SEQ ID NO:2, or a substitution, insertion or deletion
in critical residues or critical regions of the protein.
[0230] The methods of the present invention may further use
non-human orthologues of the human PGC-1.alpha. protein.
Orthologues of the human PGC-1.alpha. protein are proteins that are
isolated from non-human organisms and possess the same PGC-1.alpha.
activity.
[0231] The methods of the present invention further include the use
of nucleic acid molecules comprising the nucleotide sequence of SEQ
ID NO:1 or a portion thereof, in which a mutation has been
introduced. The mutation may lead to amino acid substitutions at
"non-essential" amino acid residues or at "essential" amino acid
residues. A "non-essential" amino acid residue is a residue that
can be altered from the wild-type sequence of PGC-1.alpha. (e.g.,
the sequence of SEQ ID NO:2) without altering the biological
activity, whereas an "essential" amino acid residue is required for
biological activity. For example, amino acid residues that are
conserved among the PGC-1.alpha. proteins of the present invention
and other members of the PGC-1 family are not likely to be amenable
to alteration.
[0232] Mutations can be introduced into SEQ ID NO:1 by standard
techniques, such as site-directed mutagenesis and PCR-mediated
mutagenesis. Preferably, conservative amino acid substitutions are
made at one or more predicted non-essential amino acid residues. A
"conservative amino acid substitution" is one in which the amino
acid residue is replaced with an amino acid residue having a
similar side chain. Families of amino acid residues having similar
side chains have been defined in the art. These families include
amino acids with basic side chains (e.g., lysine, arginine,
histidine), acidic side chains (e.g., aspartic acid, glutamic
acid), uncharged polar side chains (e.g., asparagine, glutamine,
serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g.,
glycine, alanine, valine, leucine, isoleucine, proline,
phenylalanine, methionine, tryptophan), beta-branched side chains
(e.g., threonine, valine, isoleucine) and aromatic side chains
(e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, a
predicted nonessential amino acid residue in a PGC-1.alpha. protein
is preferably replaced with another amino acid residue from the
same side chain family. Alternatively, in another embodiment,
mutations can be introduced randomly along all or part of a
PGC-1.alpha. coding sequence, such as by saturation mutagenesis,
and the resultant mutants can be screened for PGC-1.alpha.
biological activity to identify mutants that retain activity.
Following mutagenesis of SEQ ID NO:1 the encoded protein can be
expressed recombinantly and the activity of the protein can be
determined using the assay described herein.
[0233] Another aspect of the invention pertains to the use of
isolated nucleic acid molecules which are antisense to the
nucleotide sequence of SEQ ID NO:1. An "antisense" nucleic acid
comprises a nucleotide sequence which is complementary to a "sense"
nucleic acid encoding a protein, e.g., complementary to the coding
strand of a double-stranded cDNA molecule or complementary to an
mRNA sequence. Accordingly, an antisense nucleic acid can hydrogen
bond to a sense nucleic acid. The antisense nucleic acid can be
complementary to an entire PGC-1.alpha. coding strand, or to only a
portion thereof. In one embodiment, an antisense nucleic acid
molecule is antisense to a "coding region" of the coding strand of
a nucleotide sequence encoding a PGC-1.alpha.. The term "coding
region" refers to the region of the nucleotide sequence comprising
codons which are translated into amino acid residues. In another
embodiment, the antisense nucleic acid molecule is antisense to a
"noncoding region" of the coding strand of a nucleotide sequence
encoding PGC-1.alpha.. The term "noncoding region" refers to 5' and
3' sequences which flank the coding region that are not translated
into amino acids (also referred to as 5' and 3' untranslated
regions).
[0234] Given the coding strand sequences encoding PGC-1.alpha.
disclosed herein, antisense nucleic acids of the invention can be
designed according to the rules of Watson and Crick base pairing.
The antisense nucleic acid molecule can be complementary to the
entire coding region of PGC-1.alpha. mRNA, but more preferably is
an oligonucleotide which is antisense to only a portion of the
coding or noncoding region of PGC-1.alpha. mRNA. For example, the
antisense oligonucleotide can be complementary to the region
surrounding the translation start site of PGC-1.alpha. mRNA. An
antisense oligonucleotide can be, for example, about 5, 10, 15, 20,
25, 30, 35, 40, 45 or 50 nucleotides in length. An antisense
nucleic acid of the invention can be constructed using chemical
synthesis and enzymatic ligation reactions using procedures known
in the art. For example, an antisense nucleic acid (e.g., an
antisense oligonucleotide) can be chemically synthesized using
naturally occurring nucleotides or variously modified nucleotides
designed to increase the biological stability of the molecules or
to increase the physical stability of the duplex formed between the
antisense and sense nucleic acids, e.g., phosphorothioate
derivatives and acridine substituted nucleotides can be used.
Examples of modified nucleotides which can be used to generate the
antisense nucleic acid include 5-fluorouracil, 5-bromouracil,
5-chlorouracil, 5-iodouracil, hypoxanthine, xantine,
4-acetylcytosine, 5-(carboxyhydroxylmethyl)uracil,
5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil,
beta-D-galactosylqueosine, inosine, N6-isopentenyladenine,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methylthio-N6-isopentenyladenine,
uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxyacetic acid methylester,
uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil,
3-(3-amino-3-N-2-carboxypropyl)uracil, (acp3)w, and
2,6-diaminopurine. Alternatively, the antisense nucleic acid can be
produced biologically using an expression vector into which a
nucleic acid has been subcloned in an antisense orientation (i.e.,
RNA transcribed from the inserted nucleic acid will be of an
antisense orientation to a target nucleic acid of interest).
Antisense nucleic acid molecules used in the methods of the
invention are further described above, in section IV.
[0235] In yet another embodiment, the PGC-1.alpha. nucleic acid
molecules used in the methods of the present invention can be
modified at the base moiety, sugar moiety or phosphate backbone to
improve, e.g., the stability, hybridization, or solubility of the
molecule. For example, the deoxyribose phosphate backbone of the
nucleic acid molecules can be modified to generate peptide nucleic
acids (see Hyrup B. et al. (1996) Bioorganic & Medicinal
Chemistry 4 (1): 5-23). As used herein, the terms "peptide nucleic
acids" or "PNAs" refer to nucleic acid mimics, e.g., DNA mimics, in
which the deoxyribose phosphate backbone is replaced by a
pseudopeptide backbone and only the four natural nucleobases are
retained. The neutral backbone of PNAs has been shown to allow for
specific hybridization to DNA and RNA under conditions of low ionic
strength. The synthesis of PNA oligomers can be performed using
standard solid phase peptide synthesis protocols as described in
Hyrup B. et al. (1996) supra; Perry-O'Keefe et al. (1996) Proc.
Natl. Acad. Sci. 93:14670-675.
[0236] PNAs of PGC-1.alpha. nucleic acid molecules can be used in
the therapeutic and diagnostic applications described herein. For
example, PNAs can be used as antisense or antigene agents for
sequence-specific modulation of gene expression by, for example,
inducing transcription or translation arrest or inhibiting
replication. PNAs of PGC-1.alpha. nucleic acid molecules can also
be used in the analysis of single base pair mutations in a gene,
(e.g., by PNA-directed PCR clamping); as `artificial restriction
enzymes` when used in combination with other enzymes, (e.g., S1
nucleases (Hyrup B. et al. (1996) supra)); or as probes or primers
for DNA sequencing or hybridization (Hyrup B. et al. (1996) supra;
Perry-O'Keefe et al. (1996) supra).
[0237] In another embodiment, PNAs of PGC-1.alpha. can be modified,
(e.g., to enhance their stability or cellular uptake), by attaching
lipophilic or other helper groups to PNA, by the formation of
PNA-DNA chimeras, or by the use of liposomes or other techniques of
drug delivery known in the art. For example, PNA-DNA chimeras of
PGC-1.alpha. nucleic acid molecules can be generated which may
combine the advantageous properties of PNA and DNA. Such chimeras
allow DNA recognition enzymes, (e.g., RNAse H and DNA polymerases),
to interact with the DNA portion while the PNA portion would
provide high binding affinity and specificity. PNA-DNA chimeras can
be linked using linkers of appropriate lengths selected in terms of
base stacking, number of bonds between the nucleobases, and
orientation (Hyrup B. et al. (1996) supra). The synthesis of
PNA-DNA chimeras can be performed as described in Hyrup B. et al.
(1996) supra and Finn P. J. et al. (1996) Nucleic Acids Res. 24
(17): 3357-63. For example, a DNA chain can be synthesized on a
solid support using standard phosphoramidite coupling chemistry and
modified nucleoside analogs, e.g.,
5'-(4-methoxytrityl)amino-5'-deoxy-thymidine phosphoramidite, can
be used as a between the PNA and the 5' end of DNA (Mag, M. et al.
(1989) Nucleic Acid Res. 17: 5973-88). PNA monomers are then
coupled in a stepwise manner to produce a chimeric molecule with a
5' PNA segment and a 3' DNA segment (Finn P. J. et al. (1996)
supra). Alternatively, chimeric molecules can be synthesized with a
5' DNA segment and a 3' PNA segment (Peterser, K. H. et al. (1975)
Bioorganic Med. Chem. Lett. 5: 1119-11124).
[0238] In other embodiments, the oligonucleotide used in the
methods of the invention may include other appended groups such as
peptides (e.g., for targeting host cell receptors in vivo), or
agents facilitating transport across the cell membrane (see, e.g.,
Letsinger et al. (1989) Proc. Natl. Acad. Sci. USA 86:6553-6556;
Lemaitre et al. (1987) Proc. Natl. Acad. Sci. USA 84:648-652; PCT
Publication No. WO88/09810) or the blood-brain barrier (see, e.g.,
PCT Publication No. WO89/10134). In addition, oligonucleotides can
be modified with hybridization-triggered cleavage agents (See,
e.g., Krol et al. (1988) Bio-Techniques 6:958-976) or intercalating
agents. (See, e.g., Zon (1988) Pharm. Res. 5:539-549). To this end,
the oligonucleotide may be conjugated to another molecule, (e.g., a
peptide, hybridization triggered cross-linking agent, transport
agent, or hybridization-triggered cleavage agent).
[0239] VI. Isolated PGC-1.alpha. Proteins and Anti-PGC-1.alpha.
Antibodies Used in the Methods of the Invention
[0240] The methods of the invention include the use of isolated
PGC-1.alpha. proteins, and biologically active portions thereof, as
well as polypeptide fragments suitable for use as immunogens to
raise anti-PGC-1.alpha. antibodies. In one embodiment, native
PGC-1.alpha. proteins can be isolated from cells or tissue sources
by an appropriate purification scheme using standard protein
purification techniques. In another embodiment, PGC-1.alpha.
proteins are produced by recombinant DNA techniques. Alternative to
recombinant expression, a PGC-1.alpha. protein or polypeptide can
be synthesized chemically using standard peptide synthesis
techniques.
[0241] As used herein, a "biologically active portion" of a
PGC-1.alpha. protein includes a fragment of a PGC-1.alpha. protein
having a PGC-1.alpha. activity. Biologically active portions of a
PGC-1.alpha. protein include peptides comprising amino acid
sequences sufficiently identical to or derived from the amino acid
sequence of the PGC-1.alpha. protein, e.g., the amino acid sequence
shown in SEQ ID NO:2, which include fewer amino acids than the full
length PGC-1.alpha. proteins, and exhibit at least one activity of
a PGC-1.alpha. protein. Typically, biologically active portions
comprise a domain or motif with at least one activity of the
PGC-1.alpha. protein (e.g., the N-terminal region of the
PGC-1.alpha. protein that is believed to be involved in the
regulation of apoptotic activity). A biologically active portion of
a PGC-1.alpha. protein can be a polypeptide which is, for example,
25, 50, 75, 100, 125, 150, 175, 200, 250, 300 or more amino acids
in length. Biologically active portions of a PGC-1.alpha. protein
can be used as targets for developing agents which modulate a
PGC-1.alpha. activity.
[0242] In a preferred embodiment, the PGC-1.alpha. protein used in
the methods of the invention has an amino acid sequence shown in
SEQ ID NO:2. In other embodiments, the PGC-1.alpha. protein is
substantially identical to SEQ ID NO:2, and retains the functional
activity of the protein of SEQ ID NO:2, yet differs in amino acid
sequence due to natural allelic variation or mutagenesis, as
described in detail in subsection V above. Accordingly, in another
embodiment, the PGC-1.alpha. protein used in the methods of the
invention is a protein which comprises an amino acid sequence at
least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%,
97%, 98%, 99% or more identical to SEQ ID NO:2.
[0243] To determine the percent identity of two amino acid
sequences or of two nucleic acid sequences, the sequences are
aligned for optimal comparison purposes (e.g., gaps can be
introduced in one or both of a first and a second amino acid or
nucleic acid sequence for optimal alignment and non-identical
sequences can be disregarded for comparison purposes). In a
preferred embodiment, the length of a reference sequence aligned
for comparison purposes is at least 30%, preferably at least 40%,
more preferably at least 50%, even more preferably at least 60%,
and even more preferably at least 70%, 80%, or 90% of the length of
the reference sequence (e.g., when aligning a second sequence to
the PGC-1.alpha. amino acid sequence of SEQ ID NO:2 having 500
amino acid residues, at least 75, preferably at least 150, more
preferably at least 225, even more preferably at least 300, and
even more preferably at least 400 or more amino acid residues are
aligned). The amino acid residues or nucleotides at corresponding
amino acid positions or nucleotide positions are then compared.
When a position in the first sequence is occupied by the same amino
acid residue or nucleotide as the corresponding position in the
second sequence, then the molecules are identical at that position
(as used herein amino acid or nucleic acid "identity" is equivalent
to amino acid or nucleic acid "homology"). The percent identity
between the two sequences is a function of the number of identical
positions shared by the sequences, taking into account the number
of gaps, and the length of each gap, which need to be introduced
for optimal alignment of the two sequences.
[0244] The comparison of sequences and determination of percent
identity between two sequences can be accomplished using a
mathematical algorithm. In a preferred embodiment, the percent
identity between two amino acid sequences is determined using the
Needleman and Wunsch (J. Mol. Biol. 48:444-453 (1970)) algorithm
which has been incorporated into the GAP program in the GCG
software package (available at http://www.gcg.com), using either a
Blosum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14,
12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6. In
yet another preferred embodiment, the percent identity between two
nucleotide sequences is determined using the GAP program in the GCG
software package (available at http://www.gcg.com), using a
NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and
a length weight of 1, 2, 3, 4, 5, or 6. In another embodiment, the
percent identity between two amino acid or nucleotide sequences is
determined using the algorithm of E. Meyers and W. Miller (Comput.
Appl. Biosci. 4:11-17 (1988)) which has been incorporated into the
ALIGN program (version 2.0 or 2.0U), using a PAM120 weight residue
table, a gap length penalty of 12 and a gap penalty of 4.
[0245] The methods of the invention may also use PGC-1.alpha.
chimeric or fusion proteins. As used herein, a PGC-1.alpha.
"chimeric protein" or "fusion protein" comprises a PGC-1.alpha.
polypeptide operatively linked to a non-PGC-1.alpha. polypeptide.
An "PGC-1.alpha. polypeptide" refers to a polypeptide having an
amino acid sequence corresponding to a PGC-1.alpha. molecule,
whereas a "non-PGC-1.alpha. polypeptide" refers to a polypeptide
having an amino acid sequence corresponding to a protein which is
not substantially homologous to the PGC-1.alpha. protein, e.g., a
protein which is different from the PGC-1.alpha. protein and which
is derived from the same or a different organism. Within a
PGC-1.alpha. fusion protein the PGC-1.alpha. polypeptide can
correspond to all or a portion of a PGC-1.alpha. protein. In a
preferred embodiment, a PGC-1.alpha. fusion protein comprises at
least one biologically active portion of a PGC-1.alpha. protein. In
another preferred embodiment, a PGC-1.alpha. fusion protein
comprises at least two biologically active portions of a
PGC-1.alpha. protein. Within the fusion protein, the term
"operatively linked" is intended to indicate that the PGC-1.alpha.
polypeptide and the non-PGC-1.alpha. polypeptide are fused in-frame
to each other. The non-PGC-1.alpha. polypeptide can be fused to the
N-terminus or C-terminus of the PGC-1.alpha. polypeptide.
[0246] For example, in one embodiment, the fusion protein is a
GST-PGC-1.alpha. fusion protein in which the PGC-1.alpha. sequences
are fused to the C-terminus of the GST sequences. Such fusion
proteins can facilitate the purification of recombinant
PGC-1.alpha..
[0247] In another embodiment, this fusion protein is a PGC-1.alpha.
protein containing a heterologous signal sequence at its
N-terminus. In certain host cells (e.g., mammalian host cells),
expression and/or secretion of PGC-1.alpha. can be increased
through use of a heterologous signal sequence.
[0248] The PGC-1.alpha. fusion proteins used in the methods of the
invention can be incorporated into pharmaceutical compositions and
administered to a subject in vivo. The PGC-1.alpha. fusion proteins
can be used to affect the bioavailability of a PGC-1.alpha.
substrate. Use of PGC-1.alpha. fusion proteins may be useful
therapeutically for the treatment of disorders caused by, for
example, (i) aberrant modification or mutation of a gene encoding a
PGC-1.alpha. protein; (ii) mis-regulation of the PGC-1.alpha. gene;
and (iii) aberrant post-translational modification of a
PGC-1.alpha. protein.
[0249] Moreover, the PGC-1.alpha.-fusion proteins used in the
methods of the invention can be used as immunogens to produce
anti-PGC-1.alpha. antibodies in a subject, to purify PGC-1.alpha.
ligands and in screening assays to identify molecules which inhibit
the interaction of PGC-1.alpha. with a PGC-1.alpha. substrate.
[0250] Preferably, a PGC-1.alpha. chimeric or fusion protein used
in the methods of the invention is produced by standard recombinant
DNA techniques. For example, DNA fragments coding for the different
polypeptide sequences are ligated together in-frame in accordance
with conventional techniques, for example by employing blunt-ended
or stagger-ended termini for ligation, restriction enzyme digestion
to provide for appropriate termini, filling-in of cohesive ends as
appropriate, alkaline phosphatase treatment to avoid undesirable
joining, and enzymatic ligation. In another embodiment, the fusion
gene can be synthesized by conventional techniques including
automated DNA synthesizers. Alternatively, PCR amplification of
gene fragments can be carried out using anchor primers which give
rise to complementary overhangs between two consecutive gene
fragments which can subsequently be annealed and reamplified to
generate a chimeric gene sequence (see, for example, Current
Protocols in Molecular Biology, eds. Ausubel et al. John Wiley
& Sons: 1992). Moreover, many expression vectors are
commercially available that already encode a fusion moiety (e.g., a
GST polypeptide). A PGC-1.alpha.-encoding nucleic acid can be
cloned into such an expression vector such that the fusion moiety
is linked in-frame to the PGC-1.alpha. protein.
[0251] The present invention also pertains to the use of variants
of the PGC-1.alpha. proteins which function as either PGC-1.alpha.
agonists (mimetics) or as PGC-1.alpha. antagonists. Variants of the
PGC-1.alpha. proteins can be generated by mutagenesis, e.g.,
discrete point mutation or truncation of a PGC-1.alpha. protein. An
agonist of the PGC-1.alpha. proteins can retain substantially the
same, or a subset, of the biological activities of the naturally
occurring form of a PGC-1.alpha. protein. An antagonist of a
PGC-1.alpha. protein can inhibit one or more of the activities of
the naturally occurring form of the PGC-1.alpha. protein by, for
example, competitively modulating a PGC-1.alpha.-mediated activity
of a PGC-1.alpha. protein. Thus, specific biological effects can be
elicited by treatment with a variant of limited function. In one
embodiment, treatment of a subject with a variant having a subset
of the biological activities of the naturally occurring form of the
protein has fewer side effects in a subject relative to treatment
with the naturally occurring form of the PGC-1.alpha. protein.
[0252] In one embodiment, variants of a PGC-1.alpha. protein which
function as either PGC-1.alpha. agonists (mimetics) or as
PGC-1.alpha. antagonists can be identified by screening
combinatorial libraries of mutants, e.g., truncation mutants, of a
PGC-1.alpha. protein for PGC-1.alpha. protein agonist or antagonist
activity. In one embodiment, a variegated library of PGC-1.alpha.
variants is generated by combinatorial mutagenesis at the nucleic
acid level and is encoded by a variegated gene library. A
variegated library of PGC-1.alpha. variants can be produced by, for
example, enzymatically ligating a mixture of synthetic
oligonucleotides into gene sequences such that a degenerate set of
potential PGC-1.alpha. sequences is expressible as individual
polypeptides, or alternatively, as a set of larger fusion proteins
(e.g., for phage display) containing the set of PGC-1.alpha.
sequences therein. There are a variety of methods which can be used
to produce libraries of potential PGC-1.alpha. variants from a
degenerate oligonucleotide sequence. Chemical synthesis of a
degenerate gene sequence can be performed in an automatic DNA
synthesizer, and the synthetic gene then ligated into an
appropriate expression vector. Use of a degenerate set of genes
allows for the provision, in one mixture, of all of the sequences
encoding the desired set of potential PGC-1.alpha. sequences.
Methods for synthesizing degenerate oligonucleotides are known in
the art (see, e.g., Narang, S. A. (1983) Tetrahedron 39:3; Itakura
et al. (1984) Annu. Rev. Biochem. 53:323; Itakura et al., (1984)
Science 198:1056; Ike et al. (1983) Nucleic Acid Res. 11:477).
[0253] In addition, libraries of fragments of a PGC-1.alpha.
protein coding sequence can be used to generate a variegated
population of PGC-1.alpha. fragments for screening and subsequent
selection of variants of a PGC-1.alpha. protein. In one embodiment,
a library of coding sequence fragments can be generated by treating
a double stranded PCR fragment of a PGC-1.alpha. coding sequence
with a nuclease under conditions wherein nicking occurs only about
once per molecule, denaturing the double stranded DNA, renaturing
the DNA to form double stranded DNA which can include
sense/antisense pairs from different nicked products, removing
single stranded portions from reformed duplexes by treatment with
S1 nuclease, and ligating the resulting fragment library into an
expression vector. By this method, an expression library can be
derived which encodes N-terminal, C-terminal and internal fragments
of various sizes of the PGC-1.alpha. protein.
[0254] Several techniques are known in the art for screening gene
products of combinatorial libraries made by point mutations or
truncation, and for screening cDNA libraries for gene products
having a selected property. Such techniques are adaptable for rapid
screening of the gene libraries generated by the combinatorial
mutagenesis of PGC-1.alpha. proteins. The most widely used
techniques, which are amenable to high through-put analysis, for
screening large gene libraries typically include cloning the gene
library into replicable expression vectors, transforming
appropriate cells with the resulting library of vectors, and
expressing the combinatorial genes under conditions in which
detection of a desired activity facilitates isolation of the vector
encoding the gene whose product was detected. Recursive ensemble
mutagenesis (REM), a new technique which enhances the frequency of
functional mutants in the libraries, can be used in combination
with the screening assays to identify PGC-1.alpha. variants (Arkin
and Yourvan (1992) Proc. Natl. Acad. Sci. USA 89:7811-7815;
Delgrave et al. (1993) Protein Engineering 6(3):327-331).
[0255] The methods of the present invention further include the use
of anti-PGC-1.alpha. antibodies. An isolated PGC-1.alpha. protein,
or a portion or fragment thereof, can be used as an immunogen to
generate antibodies that bind PGC-1.alpha. using standard
techniques for polyclonal and monoclonal antibody preparation. A
full-length PGC-1.alpha. protein can be used or, alternatively,
antigenic peptide fragments of PGC-1.alpha. can be used as
immunogens. The antigenic peptide of PGC-1.alpha. comprises at
least 8 amino acid residues of the amino acid sequence shown in SEQ
ID NO:2 and encompasses an epitope of PGC-1.alpha. such that an
antibody raised against the peptide forms a specific immune complex
with the PGC-1.alpha. protein. Preferably, the antigenic peptide
comprises at least 10 amino acid residues, more preferably at least
15 amino acid residues, even more preferably at least 20 amino acid
residues, and most preferably at least 30 amino acid residues.
[0256] Preferred epitopes encompassed by the antigenic peptide are
regions of PGC-1.alpha. that are located on the surface of the
protein, e.g., hydrophilic regions, as well as regions with high
antigenicity.
[0257] A PGC-1.alpha. immunogen is typically used to prepare
antibodies by immunizing a suitable subject, (e.g., rabbit, goat,
mouse, or other mammal) with the immunogen. An appropriate
immunogenic preparation can contain, for example, recombinantly
expressed PGC-1.alpha. protein or a chemically synthesized
PGC-1.alpha. polypeptide. The preparation can further include an
adjuvant, such as Freund's complete or incomplete adjuvant, or
similar immunostimulatory agent. Immunization of a suitable subject
with an immunogenic PGC-1.alpha. preparation induces a polyclonal
anti-PGC-1.alpha. antibody response.
[0258] The term "antibody" as used herein refers to immunoglobulin
molecules and immunologically active portions of immunoglobulin
molecules, i.e., molecules that contain an antigen binding site
which specifically binds (immunoreacts with) an antigen, such as a
PGC-1.alpha.. Examples of immunologically active portions of
immunoglobulin molecules include F(ab) and F(ab').sub.2 fragments
which can be generated by treating the antibody with an enzyme such
as pepsin. The invention provides polyclonal and monoclonal
antibodies that bind PGC-1.alpha. molecules. The term "monoclonal
antibody" or "monoclonal antibody composition", as used herein,
refers to a population of antibody molecules that contain only one
species of an antigen binding site capable of immunoreacting with a
particular epitope of PGC-1.alpha.. A monoclonal antibody
composition thus typically displays a single binding affinity for a
particular PGC-1.alpha. protein with which it immunoreacts.
[0259] Polyclonal anti-PGC-1.alpha. antibodies can be prepared as
described above by immunizing a suitable subject with a
PGC-1.alpha. immunogen. The anti-PGC-1.alpha. antibody titer in the
immunized subject can be monitored over time by standard
techniques, such as with an enzyme linked immunosorbent assay
(ELISA) using immobilized PGC-1.alpha.. If desired, the antibody
molecules directed against PGC-1.alpha. can be isolated from the
mammal (e.g., from the blood) and further purified by well known
techniques, such as protein A chromatography to obtain the IgG
fraction. At an appropriate time after immunization, e.g., when the
anti-PGC-1.alpha. antibody titers are highest, antibody-producing
cells can be obtained from the subject and used to prepare
monoclonal antibodies by standard techniques, such as the hybridoma
technique originally described by Kohler and Milstein (1975) Nature
256:495-497) (see also, Brown et al. (1981) J. Immunol. 127:539-46;
Brown et al. (1980) J. Biol. Chem. 255:4980-83; Yeh et al. (1976)
Proc. Natl. Acad. Sci. USA 76:2927-31; and Yeh et al. (1982) Int.
J. Cancer 29:269-75), the more recent human B cell hybridoma
technique (Kozbor et al. (1983) Immunol Today 4:72), the
EBV-hybridoma technique (Cole et al. (1985) Monoclonal Antibodies
and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96) or trioma
techniques. The technology for producing monoclonal antibody
hybridomas is well known (see generally Kenneth, R. H. in
Monoclonal Antibodies: A New Dimension In Biological Analyses,
Plenum Publishing Corp., New York, N.Y. (1980); Lerner, E. A.
(1981) Yale J. Biol. Med. 54:387-402; Gefter, M. L. et al. (1977)
Somatic Cell Genet. 3:231-36). Briefly, an immortal cell line
(typically a myeloma) is fused to lymphocytes (typically
splenocytes) from a mammal immunized with a PGC-1.alpha. immunogen
as described above, and the culture supernatants of the resulting
hybridoma cells are screened to identify a hybridoma producing a
monoclonal antibody that binds PGC-1.alpha..
[0260] Any of the many well known protocols used for fusing
lymphocytes and immortalized cell lines can be applied for the
purpose of generating an anti-PGC-1.alpha. monoclonal antibody
(see, e.g., G. Galfre et al. (1977) Nature 266:55052; Gefter et al.
(1977) supra; Lerner (1981) supra; and Kenneth (1980) supra).
Moreover, the ordinarily skilled worker will appreciate that there
are many variations of such methods which also would be useful.
Typically, the immortal cell line (e.g., a myeloma cell line) is
derived from the same mammalian species as the lymphocytes. For
example, murine hybridomas can be made by fusing lymphocytes from a
mouse immunized with an immunogenic preparation of the present
invention with an immortalized mouse cell line. Preferred immortal
cell lines are mouse myeloma cell lines that are sensitive to
culture medium containing hypoxanthine, aminopterin and thymidine
("HAT medium"). Any of a number of myeloma cell lines can be used
as a fusion partner according to standard techniques, e.g., the
P3-NS1/1-Ag4-1, P3-.times.63-Ag8.653 or Sp2/O--Ag14 myeloma lines.
These myeloma lines are available from ATCC. Typically,
HAT-sensitive mouse myeloma cells are fused to mouse splenocytes
using polyethylene glycol ("PEG"). Hybridoma cells resulting from
the fusion are then selected using HAT medium, which kills unfused
and unproductively fused myeloma cells (unfused splenocytes die
after several days because they are not transformed). Hybridoma
cells producing a monoclonal antibody of the invention are detected
by screening the hybridoma culture supernatants for antibodies that
bind PGC-1.alpha., e.g., using a standard ELISA assay.
[0261] Alternative to preparing monoclonal antibody-secreting
hybridomas, a monoclonal anti-PGC-1.alpha. antibody can be
identified and isolated by screening a recombinant combinatorial
immunoglobulin library (e.g., an antibody phage display library)
with PGC-1.alpha. to thereby isolate immunoglobulin library members
that bind PGC-1.alpha.. Kits for generating and screening phage
display libraries are commercially available (e.g., the Pharmacia
Recombinant Phage Antibody System, Catalog No. 27-9400-01; and the
Stratagene SurfZAP.TM. Phage Display Kit, Catalog No. 240612).
Additionally, examples of methods and reagents particularly
amenable for use in generating and screening antibody display
library can be found in, for example, Ladner et al. U.S. Pat. No.
5,223,409; Kang et al. PCT International Publication No. WO
92/18619; Dower et al. PCT International Publication No. WO
91/17271; Winter et al. PCT International Publication WO 92/20791;
Markland et al. PCT International Publication No. WO 92/15679;
Breitling et al. PCT International Publication WO 93/01288;
McCafferty et al. PCT International Publication No. WO 92/01047;
Garrard et al. PCT International Publication No. WO 92/09690;
Ladner et al. PCT International Publication No. WO 90/02809; Fuchs
et al. (1991) Bio/Technology 9:1370-1372; Hay et al. (1992) Hum.
Antibod. Hybridomas 3:81-85; Huse et al. (1989) Science
246:1275-1281; Griffiths et al. (1993) EMBO J. 12:725-734; Hawkins
et al. (1992) J. Mol. Biol. 226:889-896; Clarkson et al. (1991)
Nature 352:624-628; Gram et al. (1992) Proc. Natl. Acad. Sci. USA
89:3576-3580; Garrad et al. (1991) Bio/Technology 9:1373-1377;
Hoogenboom et al. (1991) Nuc. Acid Res. 19:4133-4137; Barbas et al.
(1991) Proc. Natl. Acad. Sci. USA 88:7978-7982; and McCafferty et
al. (1990) Nature 348:552-554.
[0262] Additionally, recombinant anti-PGC-1.alpha. antibodies, such
as chimerzic and humanized monoclonal antibodies, comprising both
human and non-human portions, which can be made using standard
recombinant DNA techniques, are within the scope of the methods of
the invention. Such chimeric and humanized monoclonal antibodies
can be produced by recombinant DNA techniques known in the art, for
example using methods described in Robinson et al. International
Application No. PCT/US86/02269; Akira, et al. European Patent
Application 184,187; Taniguchi, M., European Patent Application
171,496; Morrison et al. European Patent Application 173,494;
Neuberger et al. PCT International Publication No. WO 86/01533;
Cabilly et al. U.S. Pat. No. 4,816,567; Cabilly et al. European
Patent Application 125,023; Better et al. (1988) Science
240:1041-1043; Liu et al. (1987) Proc. Natl. Acad. Sci. USA
84:3439-3443; Liu et al. (1987) J. Immunol. 139:3521-3526; Sun et
al. (1987) Proc. Natl. Acad. Sci. USA 84:214-218; Nishimura et al.
(1987) Canc. Res. 47:999-1005; Wood et al. (1985) Nature
314:446-449; Shaw et al. (1988) J. Natl. Cancer Inst. 80:1553-1559;
Morrison, S. L. (1985) Science 229:1202-1207; Oi et al. (1986)
BioTechniques 4:214; Winter U.S. Pat. No. 5,225,539; Jones et al.
(1986) Nature 321:552-525; Verhoeyan et al. (1988) Science
239:1534; and Beidler et al. (1988) J. Immunol. 141:4053-4060.
[0263] An anti-PGC-1.alpha. antibody can be used to detect
PGC-1.alpha. protein (e.g., in a cellular lysate or cell
supernatant) in order to evaluate the abundance and pattern of
expression of the PGC-1.alpha. protein. Anti-PGC-1.alpha.
antibodies can be used diagnostically to monitor protein levels in
tissue as part of a clinical testing procedure, e.g., to, for
example, determine the efficacy of a given treatment regimen.
Detection can be facilitated by coupling (i.e., physically linking)
the antibody to a detectable substance. Examples of detectable
substances include various enzymes, prosthetic groups, fluorescent
materials, luminescent materials, bioluminescent materials, and
radioactive materials. Examples of suitable enzymes include
horseradish peroxidase, alkaline phosphatase, .beta.-galactosidase,
or acetylcholinesterase; examples of suitable prosthetic group
complexes include streptavidin/biotin and avidin/biotin; examples
of suitable fluorescent materials include umbelliferone,
fluorescein, fluorescein isothiocyanate, rhodamine,
dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerythrin; an example of a luminescent material includes
luminol; examples of bioluminescent materials include luciferase,
luciferin, and aequorin, and examples of suitable radioactive
material include .sup.125I, .sup.131I, .sup.35S or .sup.3H.
[0264] This invention is further illustrated by the following
Exemplification which should not be construed as limiting. The
contents of all references, sequences, Figures, GenBank Accession
Numbers, and published patent applications cited throughout this
application are hereby incorporated by reference.
EXAMPLES
Materials and Methods
[0265] The following materials and methods were used for the
experiments described below.
[0266] Generation of PGC-1.alpha..sup.-/- mice
[0267] A targeting plasmid was constructed using genomic DNA
fragments derived from Sv129 mouse strain. A loxP site and a
neomycin/thymidine kinase cassette flanked by two loxP sites were
introduced into the PGC-1.alpha. locus. Embryonic stem (ES) cell
(derived from Sv129 strain) electroporation, selection and
screening were performed using standard gene targeting techniques.
Genomic DNA was isolated from neomycin-resistant ES cell clones,
digested with BamHI and subjected to hybridization using probe L to
detect homologous recombination and the presence of the flox allele
(FIG. 9A). Chimeric founders were bred with wild-type C57/Bl6 mice
to obtain offspring containing a germ-line PGC-1.alpha. flox
allele. These mice were subsequently bred with ZP3-cre transgenic
(in C57/Bl6 background) mice to generate PGC-1.alpha..sup.+/-
offspring. The cre recombinase-mediated generation of
PGC-1.alpha..sup.+/- allele was confirmed by Southern hybridization
using probe L following restriction digestion by BamHI.
Heterozygous mice were mated to obtain PGC-1.alpha..sup.-/- mice.
Genotyping of mice used in this study was performed by PCR with
tail DNA as shown in FIG. 9.
Animal Experiments
[0268] Mice were maintained on a standard rodent chow or a high-fat
diet containing 57% fat-derived calories (D12331, Research
Diets.TM.) with twelve-hour light and dark cycles. Plasma glucose
and insulin concentrations were measured from tail blood using
glucometer (Lifescan, Johnson & Johnson.TM.) and an insulin
ELISA kit (Crystal Chem. Inc..TM.), respectively.
[0269] For diet-induced obesity, body weight was measured weekly
for a period of 4 months. Body fat content was measured using a
dual X-ray absorptiometry (Piximus, Lunar Corporation.TM.) after
three months on the high-fat diet.
[0270] For cold exposure, 6 to 7-week old male mice were
individually housed in cages kept at 4.degree. C. with free access
to food and water. Core body temperature was monitored using a
rectal thermometer at various times after the start of cold
exposure. Brown fat was dissected 5 hours after cold exposure and
subjected to gene expression analysis.
[0271] Metabolic monitoring was performed using a Comprehensive Lab
Animal Monitoring System (CLAMS, Columbia Instruments) that
simultaneously measures whole body oxygen consumption and physical
movements for sixteen mice. Mice were acclimated in the monitoring
chambers for two days before the experiment to minimize the changes
in housing environments. Data was collected every 48 minutes for
each mouse over a period of three days. Metabolic rate and physical
activity were averaged for the whole study period with the
exception of the first five data points that tend to be influenced
by animal handling at the beginning of studies.
Histological Analysis
[0272] Tissues were dissected and fixed in 4% paraformaldehyde
overnight and rinsed with phosphate-buffered saline. Brown fat was
subsequently dehydrated and embedded in plastic (JB-4, Electron
Microscopy Sciences.TM.) and sectioned at 1.5 .mu.m for Hematoxylin
and Eosin (H&E) staining. Liver tissue was dehydrated in
ethanol, paraffin-embedded, and sectioned at 4 .mu.m for H&E
staining.
[0273] Brain tissue for neuropathological examination was prepared
from 6 and 12-week old wild-type and PGC-1.alpha. null mice.
Tissues were fixed in situ by intracardiac perfusion with 15 ml PBS
followed by 30 ml 4% paraformaldehyde (PFA) in phosphate buffer
solution (PBS). Brains were removed, postfixed in 4% PFA overnight
at 4.degree. C. and embedded in paraffin. Coronal sections (6
.mu.m) were stained both conventionally with H&E, luxol fast
blue (H&E+LFB), and 0.1% cresyl echt violet (Niss1), and
immunohistochemically with antibodies against glial fibrillary
acidic protein (GFAP, polyclonal antibody 1:200; Dako.TM., Hamburg,
Germany) as an astrocyte marker and against neurofilament 200 kD
(monoclonal antibody 1:50; Sigma.TM.) to label axons.
RNA and Protein Analysis
[0274] Total RNA was isolated from cultured hepatocytes or tissues
using Trizol reagents (Invitrogen.TM.). For hybridization, 10-20
.mu.s of RNA samples were separated on a formaldehyde gel,
transferred to nylon membrane and then hybridized with
gene-specific probes. For real-time PCR analysis, RNA samples were
reverse-transcribed and used in quantitative PCR reactions in the
presence of a fluorescent dye (Cybergreen.TM., Bio-rad.TM.).
Relative abundance of mRNA was calculated after normalization to
18S ribosomal RNA. Sequences for the primers used in this study
were shown in Table 1.
TABLE-US-00001 TABLE 1 List of primers used in real-time PCR
analysis. SEQ SEQ Gene Forward primer ID NO. Reverse primer ID NO.
PGC-1.alpha. agccgtgaccactgacaacgag 3 gctgcatggttctgagtgctaag 22
PGC-1.beta. cgctccaggagactgaatccag 4 cttgactactgtctgtgaggc 23 PEPCK
catatgctgatcctgggcataac 5 caaacttcatccaggcaatgtc 24 G6Pase
acaccgactactacagcaacag 6 cctcgaaagatagcaagagtag 25 UCP1
ggcattcagaggcaaatcagct 7 caatgaacactgccacacctc 26 Cox7a1
gtctcccaggctctggtccg 8 ctgtacaggacgttgtccattc 27 Ndufb5
tccgaagactgtcgctcctgtg 9 tatgttcaccagtgttatgcca 28 CKmt2
ggtacgcactggccgaagcatc 10 tgatcctgctccgtcatctcag 29 H-FABP
gtcggtacctggaagctagtggac 11 gatctctgtgttcttgaaggtac 30 Atp5J
gttctgcagaggatcttcaggc 12 gtcctccagatgcctgtcgctt 31 Dio2
cagtgtggtgcacgtctccaatc 13 tgaaccaaagttgaccaccag 32 UCP2
caggtcactgtgcccttacca 14 cactacgttccaggatcccaa 33 18S
agtccctgccctttgtacaca 15 cgatccgagggcctcacta 34 LDH2
cactgtagtgggcgttggacaa 16 cggccacaattttcggagtctg 35 Cox6a1
caacgtgttcctcaagtcgcgg 17 gccaggttctctttactcatc 36 NF-H
gctggacagtgagctgagaaac 18 caaagccaatccgacactcttc 37 NF-M
gatgagctacacgctggactcg 19 tgtaggaggaggacacggtgct 38 MOBP
actccaagcgtgagatcgtggac 20 ggacgcagctggctggtgcttg 39 ATP1a1
tcatcgtagccaacgtgccag 21 gtcttgtctgagcagatggtag 40
[0275] For the detection of PGC-1.alpha. protein, nuclear extracts
(80 .mu.g) prepared from brown fat were analyzed by immunoblotting
using mouse polyclonal antibodies raised against purified
C-terminus of PGC-1.alpha.. Muscle AMPK was detected with
antibodies that recognize total AMPK (#07-181, Upstate
Biotechnology.TM.) or phosphorylated AMPK (2531, Cell Signaling
Technology.TM.). ACC phosphorylation was detected using a
phospho-ACC specific antibody (3661, Cell Signaling
Technology.TM.).
Primary Hepatocytes
[0276] Primary hepatocytes were isolated following perfusion of
whole liver first with perfusion buffer (Hank's Balanced Saline,
HBSS) and then collagenase solution (HBSS with 1% BSA and 0.05%
collagenase) for 10 minutes. Dispersed cells were resuspended and
seeded onto collagen-coated plates in DMEM supplemented with 10%
fetal bovine serum in the presence of 1 mM sodium pyruvate, 1 .mu.M
dexamethasone (dex) and 50 nM insulin. Two hours after plating, the
medium was changed to a maintenance medium containing DMEM
supplemented with 0.1% BSA and 1 mM sodium pyruvate. For hormonal
treatments, hepatocytes were cultured in minimal media (DMEM with
0.1% BSA) for 40 hours and then treated with 0.2 .mu.M or 1 .mu.M
of a combination of forskolin and dex for 3 or 6 hours before RNA
isolation.
[0277] For adenoviral infection, hepatocytes were incubated with
varying titers of adenovirus expressing either GFP or C/EBP.beta.
for 3 hours and then maintained in starvation media for 24 hours.
Infected cells were treated with 0.2 .mu.M forskolin and 0.1 .mu.M
dex for 3 hours before RNA isolation.
[0278] For respiration measurements, hepatocytes were cultured in
the presence of 0.2 .mu.M dex overnight and then removed from
plates by incubating with the trypsin/EDTA solution. Oxygen
consumption was measured essentially as previously described (Fan,
M., et al. (2004) Genes Dev 18, 278-289; Wu, Z., (1999) Cell 98,
115-124). Measurements were performed in the presence of 25 mM
glucose, 1 mM pyruvate and 2% BSA.
Insulin/Glucose/Pyruvate Tolerance Tests
[0279] For insulin tolerance test, high-fat fed mice were fasted
for 4 hours before receiving an intraperitoneal injection of
insulin at 0.8 mU/kg. Plasma glucose levels were measured from tail
blood before or 15, 30, 45, 60, 100 minutes after insulin
infusion.
[0280] For glucose tolerance test, high-fat fed mice were fasted
overnight (14 hours) and injected intraperitoneally with a glucose
solution (prepared in saline) at 2 g/kg. Plasma glucose levels were
measured from tail blood before or 15, 30, 45, 60, 90, 180 minutes
after glucose infusion.
[0281] Pyruvate tolerance test was performed as described (Miyake,
K., et al. (2002) J Clin Invest 110, 1483-1491). Briefly,
three-month old male mice were fasted for 14 hours before receiving
an intraperitoneal dose of pyruvate (in saline) at 2 g/kg. Plasma
glucose levels were determined as indicated above.
Transient Transfection
[0282] Mouse H2.35 hepatoma cells (CRL-1995, ATCC) were maintained
in DMEM supplemented with 4% fetal bovine serum in the presence of
0.2 .mu.M dex. For transfection, 100 ng of reporter plasmid
(Gal-C/EBP.beta.) was transiently transfected using Superfect.TM.
(Qiagen.TM.) in the presence of 500 ng of vector or
pcDNA3-PGC-1.alpha.. Luciferase activity was measured 40 hours
following transfection.
Example 1
Generation of PGC-1.alpha. Null Mice
[0283] To generate mouse strains deficient in PGC-1.alpha. by
homologous recombination, a targeting plasmid was constructed
flanking exons 3 to 5 of the PGC-1.alpha. gene with loxP sites
(FIG. 9A). These three exons encode a highly conserved region in
PGC-1.alpha., including the LXXLL motif that mediates its
interaction with many nuclear receptors. PGC-1.alpha..sup.+/- mice
were generated through transgenic expression of cre recombinase
under the control of ZP3 promoter, which is transiently activated
during oocyte development (Lewandoski, M. et al. (1997) Curr Biol
7, 148-151). PGC-1.alpha..sup.-/- mice were obtained from offspring
of heterozygous breeding pairs. Homologous recombination and
cre-mediated excision events were confirmed by hybridization and
PCR analysis of genomic DNA isolated from PGC-1.alpha..sup.+/+,
PGC-1.alpha..sup.+/- and PGC-1.alpha..sup.-/- mice (FIGS. 9B-D).
Analysis of PGC-1.alpha. expression revealed that its mRNA was
absent in skeletal muscle and liver from PGC-1.alpha..sup.-/- mice
and reduced to approximately 50% in PGC-1.alpha..sup.+/- mice as
revealed by RNA hybridization and real-time PCR analysis (FIG. 1A).
As expected, no PGC-1.alpha. protein was detected in the nuclear
extract prepared from PGC-1.alpha..sup.-/- brown fat (FIG. 1B).
[0284] Pups lacking PGC-1.alpha. were born at the expected
Mendelian ratio, suggesting that PGC-1.alpha. is dispensable for
embryonic development. However, only half of PGC-1.alpha..sup.-/-
pups survive early postnatal period and grow into adults (Table
2).
TABLE-US-00002 TABLE 2 Genotypes of offspring from heterozygous
breeding pairs at various stages. Genotype Total
PGC-1.alpha..sup.+/+ PGC-1.alpha..sup.+/- PGC-1.alpha..sup.-/- Day
1 pups 17 (23%) 38 (52%) 18 (25%) 73 Weaning 135 (29%) 264 (57%) 65
(14%) 464 (day 21) PGC-1.alpha..sup.-/- mice weigh approximately
10-15% less than the PGC-1.alpha..sup.+/+ and PGC-1.alpha..sup.+/-
littermates at two months of age and are fertile. Hematoxylin/eosin
(H&E) staining of tissue sections revealed normal histology in
several tissues including heart, skeletal muscle, pancreas and
liver (FIGS. 1C-D). In contrast, PGC-1.alpha..sup.-/- brown fat
appeared abnormal, with abundant accumulation of large lipid
droplets (FIG. 1E-F), a feature commonly associated with impaired
thermogenic function. Electron microscopy studies revealed no
obvious changes in the abundance and morphology of mitochondria in
brown fat and liver.
Measurement of plasma and liver lipid levels shows no significant
difference between wild-type and PGC-1.alpha. null mice in the fed
state while the triglyceride content is lower in the liver of null
mice (Table 3).
TABLE-US-00003 TABLE 3 Plasma and liver lipids and liver glycogen
content in wild type. Shown is Mean .+-. SEM. Lipids/ glycogen
PGC-1.alpha..sup.+/+ PGC-1.alpha..sup.-/- Chow-fed Plasma Fed 78.6
.+-. 9.0 75.7 .+-. 5.4 triglyceride 24-hr 75.7 .+-. 9.3 68.3 .+-.
9.7 (mg/dL) fasting 48-hr 56.4 .+-. 5.7 54.6 .+-. 5.9 fasting
Plasma Fed 68.0 .+-. 3.8 65.3 .+-. 2.5 cholesterol 24-hr 81.3 .+-.
3.6 72.1 .+-. 1.9 (mg/dL) fasting Plasma free Fed 0.97 .+-. 0.09
1.09 .+-. 0.04 fatty acids 24-hr 1.77 .+-. 0.16 1.56 .+-. 0.06 (mM)
fasting Liver Fed 3.4 .+-. 0.7 3.8 .+-. 0.9 triglyceride 24-hr 56.5
.+-. 4.1 .sup. 34.9 .+-. 6.7 (p = 0.024) (mg/g) fasting Liver Fed
7.6 .+-. 0.6 .sup. 10.3 .+-. 1.3 (p = 0.09) glycogen 24-hr 2.0 .+-.
0.2 .sup. 2.8 .+-. 0.4 (p = 0.11) (mg/g) fasting High-fat fed
Plasma Fed 94.0 .+-. 9.0 77.0 .+-. 8.9 triglyceride (mg/dL) Plasma
Fed 129.9 .+-. 8.3 .sup. 106.2 .+-. 4.6 (p = 0.016) cholesterol
(mg/dL)
Example 2
PGC-1.alpha. Plays a Critical Role In Hormone-Induced
Gluconeogenesis
[0285] PGC-1.alpha. has been shown to influence glucose metabolism
in muscle and liver. The expression of PGC-1.alpha. itself is
induced in liver in response to fasting, a metabolic state
characterized by active glycogenolysis, gluconeogenesis and fatty
acid .beta.-oxidation (Aoki, T. T. (1981) Prog Clin Biol Res 67,
161-177). To examine the requirement for PGC-1.alpha. in the
regulation of glucose metabolism, measured blood glucose and
insulin levels were measured in mice under various nutritional
states. There is no difference in plasma glucose levels in
PGC-1.alpha..sup.+/+, PGC-1.alpha..sup.+/- and PGC-1.alpha..sup.-/-
mice when food is provided ad libitum (FIG. 2A). Mice deficient in
PGC-1.alpha., however, develop mild hypoglycemia after 24 hours of
fasting. Examination of blood insulin levels revealed that although
PGC-1.alpha..sup.-/- mice are able to maintain euglycemia in the
fed state, they do so with reduced circulating insulin
concentrations (FIG. 2B). In contrast, no reduction in insulin
levels was observed in PGC-1.alpha..sup.-/- mice in the fasted
state. Blood glucose levels tend to be lower in the
PGC-1.alpha..sup.-/- mice after prolonged fasting (48 hours)
although the difference does not reach statistical
significance.
[0286] PGC-1.alpha. has been shown to control the expression of
genes involved in mitochondrial fatty acid .beta.-oxidation and
oxidative phosphorylation in various cell types including
hepatocytes. Proper mitochondrial respiration is necessary to
generate the ATP that supports the enzymatic function of the
gluconeogenic pathway. To determine the effects of PGC-1.alpha.
deficiency on mitochondrial respiration, an oxygen electrode was
used to measure oxygen consumption in isolated hepatocytes. Total
oxygen consumption rate is reduced 17% in PGC-1.alpha..sup.-/-
hepatocytes compared to wild-type controls (FIG. 2C). Respiration
due to mitochondrial proton leak is also reduced approximately 20%
in the PGC-1.alpha. deficient hepatocytes (FIG. 2C). These data
illustrate that mitochondrial function is impaired in the
hepatocytes from PGC-1.alpha..sup.-/- mice.
[0287] Hepatic gluconeogenesis is of major importance in the fasted
state (Hanson, R. W., and Reshef, L. (1997) Annu Rev Biochem 66,
581-611; Pilkis, S. J., and Granner, D. K. (1992) Annu Rev Physiol
54, 885-909) and is controlled by PGC-1.alpha. in gain of function
experiments (Herzig, S., et al. (2001) Nature 413, 179-183; Yoon,
J. C., et al. (2001) Nature 413, 131-138). The induction of
PGC-1.alpha. and gluconeogenic genes, such as phosphoenolpyruvate
carboxykinase (PEPCK) and glucose-6-phosphatase (G6Pase), are
mediated by a rise in the circulating concentrations of
counter-regulatory hormones, such as glucagon and glucocorticoids,
and a fall in insulin levels. To determine whether PGC-1.alpha. is
essential for expression of this program, primary hepatocytes were
isolated from PGC-1.alpha..sup.+/+ and PGC-1.alpha..sup.-/- mice
and examined the expression of the PEPCK and G6Pase genes in
response to hormonal treatments. Basal levels of PEPCK and G6Pase
mRNA were similar in PGC-1.alpha..sup.+/+ and PGC-1.alpha..sup.-/-
hepatocytes, as revealed by RNA hybridization and quantitative
real-time PCR analysis (FIG. 2D). Following treatments with
glucocorticoid and forskolin, PGC-1.alpha..sup.+/+ hepatocytes
exhibit a robust and dose-dependent increase in PEPCK and G6Pase
mRNA (FIG. 2D). In contrast, the induction of PEPCK and G6Pase mRNA
expression is greatly diminished in hepatocytes isolated from
PGC-1.alpha..sup.-/- mice at all treatment conditions examined.
These results clearly demonstrate that PGC-1.alpha. is an essential
mediator of transcriptional activation of gluconeogenic genes in
response to hormonal stimulation in isolated hepatocytes.
[0288] To determine whether PGC-1.alpha. is necessary for
gluconeogenesis in vivo, blood glucose levels in mice were examined
following intra-peritoneal injection of pyruvate, an important
substrate for this pathway. Consistent with defects in
gluconeogenic gene expression and mitochondrial function in the
PGC-1.alpha..sup.-/- hepatocytes, mice lacking PGC-1.alpha. have
greatly reduced ability to convert pyruvate into glucose compared
to wild-type littermates (FIG. 2E).
Example 3
Constitutive Activation of the Hepatic Gluconeogenic Program In
Vivo in the Absence of PGC-1.alpha.
[0289] The nutritional regulation of PEPCK and G6Pase genes under
fed and fasted states in the mice was examined. As expected,
wild-type mice activate multiple adaptive metabolic changes in
response to fasting (FIG. 3A), as shown by increased expression of
gluconeogenic genes and those involved in fatty acid oxidation
(MCAD), ketone body synthesis (mitochondrial HMG-CoA synthase) and
bile acid synthesis (Cyp7a1) (Rhee, J., et al. (2003) Proc Natl
Acad Sci USA 100, 4012-4017; Shin, D. J., et al. (2003) J Biol Chem
278, 50047-50052). Surprisingly, the expression of PEPCK, G6Pase,
HMG-CoA synthase and MCAD is similar in PGC-1.alpha..sup.+/+ and
PGC-1.alpha..sup.-/- liver in the fasted state (FIG. 3A). More
unexpectedly, the mRNA levels of PEPCK, G6Pase and HMG-CoA synthase
are greatly elevated in PGC-1.alpha..sup.-/- mouse liver under fed
conditions (FIG. 3A). Notably, expression of G6Pase in the fed
state is near the level that is usually seen in fasted liver. These
results indicate that although PGC-1.alpha. is not required for the
expression of gluconeogenic and ketogenic genes, this coactivator
is essential for proper nutritional regulation of this response.
Since basal levels of PEPCK and G6Pase expression are similar in
untreated primary hepatocytes in the presence or absence of
PGC-1.alpha. (FIG. 2D), this indicates that systemic signals are
probably responsible for the constitutive activation of these genes
under fed conditions in mice lacking PGC-1.alpha..
[0290] The aberrant activation of PEPCK and G6Pase expression is
likely due to dysregulation of one or more transcription factors
that can regulate the PEPCK and G6Pase genes in the absence of
PGC-1.alpha.. To assess this possibility, mRNA levels of several
transcription factors known to have at least some connection with
this process were examined. As shown in FIG. 3B, the expression of
HNF4.alpha. and PPAR.alpha., key regulators of hepatic metabolism
in the fasted state, was comparable in PGC-1.alpha..sup.+/+ and
PGC-1.alpha..sup.-/- liver in the fed state, although the induction
of HNF4.alpha. in response to fasting is blunted in the absence of
PGC-1.alpha.. The mRNA levels for FOXO1 and GR remain unchanged
between genotypes in both fed and fasted states. As expected, the
expression of sterol response element binding protein 1c (SREBP1c),
a central regulator of hepatic lipogenesis (Horton, J. D., et al.
(2002) J Clin Invest 109, 1125-1131), is suppressed in response to
fasting in both PGC-1.alpha..sup.+/+ and PGC-1.alpha..sup.-/- mice.
This indicates that although the expression of gluconeogenic and
ketogenic genes is dysregulated in the absence of PGC-1.alpha., the
nutritional regulation of SREBP1c is still intact. In contrast,
there is a striking increase in the abundance of C/EBP.beta. mRNA
in PGC-1.alpha..sup.-/- mouse liver, precisely mirroring the
aberrant expression of PEPCK and G6Pase in the fed state (FIG. 3A).
C/EBP.beta. is normally induced in the fasted state in wild-type
animals but is abnormally activated in the fed state in the null
mice. C/EBP.delta. is also induced in the fed liver lacking
PGC-1.alpha. while C/EBP.alpha. is expressed normally with respect
to PGC-1.alpha. genotypes. The aberrant induction of C/EBP.beta.
and C/EBP.delta., however, is absent when PGC-1.alpha.-deficient
hepatocytes are grown in cell culture, indicating that systemic
signals are likely responsible for their increased expression (FIG.
3C). These results indicate that altered C/EBP transcription factor
activities, particularly C/EBP.beta., may play a role in the
constitutive activation of gluconeogenic gene expression seen in
the PGC-1.alpha. deficient mouse liver.
Example 4
PGC-1.alpha.-Independent Activation of Gluconeogenic Genes by
C/EBP.beta.
[0291] C/EBP.beta. is a transcription factor that belongs to the
basic leucine-zipper family and has been shown to modulate the
activity of the transfected PEPCK promoter in response to
gluconeogenic hormones (Croniger, C. et al. (1998) J Biol Chem 273,
31629-31632; Park, E. A. et al. (1993) J Biol Chem 268, 613-619;
Roesler, W. J. (2001) Annu Rev Nutr 21, 141-165). Pups lacking
C/EBP.beta. develop severe hypoglycemia and half of them died
shortly after birth due to a failure to activate hepatic
gluconeogenic gene expression and glucose production (Croniger, C.
et al. (1997) J Biol Chem 272, 26306-26312; Liu, S. et al. (1999) J
Clin Invest 103, 207-213). The effects of C/EBP.beta. on the
endogenous gluconeogenic genes have not been studied. Moreover, a
functional interaction between C/EBP.beta. and PGC-1.alpha. has not
been examined to date. As shown in FIG. 3D, PGC-1.alpha. does not
coactivate C/EBP.beta. in transient transfection assays. Whether
C/EBP.beta. could modulate expression of endogenous genes of
gluconeogenesis and whether it could do so in the absence of
PGC-1.alpha. was next examined. Primary hepatocytes were isolated
from wild-type and PGC-1.alpha. deficient mice, infected with a
recombinant adenovirus expressing a control GFP protein or
C/EBP.beta. and examined for the expression of PEPCK and G6Pase. As
shown in FIG. 3E, adenoviral mediated expression of C/EBP.beta.
activates the transcription of the G6Pase gene approximately
17-fold in wild-type hepatocytes. PEPCK mRNA level is also elevated
1.8-fold in response to ectopic C/EBP.beta. expression.
Importantly, induction of gluconeogenic gene expression by
C/EBP.beta. was also observed in the PGC-1.alpha..sup.-/- cells
with a 12-fold increase in G6Pase mRNA and approximately 3-fold
induction of PEPCK mRNA. The absolute levels of these mRNAs are
somewhat higher in hepatocytes with an intact PGC-1.alpha. gene.
These results demonstrate that C/EBP.beta. is able to turn on
gluconeogenic gene expression in a PGC-1.alpha.-independent manner
and indicate that elevated C/EBP.beta. in PGC-1.alpha..sup.-/-
animals may be at least partially responsible for the inappropriate
activation of those gluconeogenic genes in the fed state.
Example 5
PGC-1.alpha..sup.-/- Mice are Resistant to Diet-Induced Obesity
[0292] The well-established role of PGC-1.alpha. in stimulating
mitochondrial respiration, as well as the reduction of respiration
in PGC-1.alpha. deficient hepatocytes (FIG. 2C) and abnormal brown
fat morphology (FIG. 1D) all suggest that the null mice may be
prone to the development of obesity due to reduced energy
expenditure. To critically assess this, the animals were fed a
high-fat diet containing 58% of calories derived from fat. As shown
in FIG. 4A, and as expected, wild-type mice gain substantial body
weight throughout the course of high-fat feeding. In contrast,
PGC-1.alpha..sup.-/- mice are surprisingly resistant to
diet-induced obesity (FIG. 4A). Analysis of body fat content using
a dual energy X-ray absorptiometry (DEXA) scanner revealed that
PGC-1.alpha..sup.-/- mice are remarkably leaner (22.6.+-.2.4% body
fat, n=6) than the PGC-1.alpha..sup.+/+ controls (39.8.+-.2.8% body
fat, n=5) after 16 weeks of high-fat feeding (FIGS. 4B-C). In fact,
a small but significant decrease in body fat content was observed
in PGC-1.alpha..sup.-/- mice fed a chow diet (FIG. 4C). As expected
from their obesity, high-fat fed PGC-1.alpha..sup.+/+ mice
developed insulin resistance as indicated by elevated fasting
glucose and insulin concentrations and in vivo insulin tolerance
test (FIGS. 4D-E). PGC-1.alpha..sup.-/- mice, however, display
significantly enhanced insulin sensitivity and improved glycemic
control in a glucose tolerance test (FIGS. 4E-F) compared to the
control mice. Similar results were seen in PGC-1.alpha..sup.-/-
mice when maintained on a normal rodent chow. These data clearly
indicate that PGC-1.alpha. null mice are resistant to obesity
caused by high-fat feeding and are protected from developing
insulin resistance and glucose intolerance that ordinarily
accompanies this obesity.
[0293] The two major arms of energy balance were also examined:
energy intake as measured by food intake and energy expenditure.
Both PGC-1.alpha..sup.+/+ and PGC-1.alpha..sup.-/- mice show
similar food intake at various time points during postnatal
development and high-fat feeding (FIG. 5A). In contrast, energy
expenditure, measured as O.sub.2 consumption, is approximately 23%
higher in PGC-1.alpha..sup.-/- mice throughout a three-day period
of metabolic monitoring (FIG. 5B). Thus, the resistance to
diet-induced obesity in PGC-1.alpha..sup.-/- mice correlates with a
substantial increase in energy expenditure.
Example 6
Reduced Thermogenic Capacity and Hyperactivity in
PGC-1.alpha..sup.-/- Mice
[0294] Two key components of energy expenditure are adaptive
thermogenesis and physical activity. To determine whether increased
oxygen consumption in PGC-1.alpha..sup.-/- mice is due to enhanced
thermogenesis, the thermogenic capacity of these animals was
examined with a standard cold challenge. Resting body temperature
is similar between PGC-1.alpha..sup.+/+ and PGC-1.alpha..sup.-/-
mice (FIG. 5C, t=0). 6-week old mice were exposed to 4.degree. C.
and their core body temperature monitored. Both
PGC-1.alpha..sup.+/+ and PGC-1.alpha..sup.-/- mice respond to cold
temperature by increasing frequency of shivering. In contrast to
wild-type littermates, which are able to keep body temperature
around 36.5.degree. C. after an initial drop of approximately
1.5.degree. C., PGC-1.alpha..sup.-/- mice display striking
sensitivity to the cold temperature (FIG. 5C). Body temperature of
PGC-1.alpha..sup.-/- mice drops to 33.5.degree. C. within 3 hours
and the hypothermia becomes lethal if the exposure of the null mice
is extended beyond 6 hours. Defense of body temperature in mice is
mainly the function of brown adipose tissue, which generates heat
due in large part to abundant expression of the mitochondrial
uncoupler, UCP1 (Bouillaud, F. et al. (1985) Proc Natl Acad Sci USA
82, 445-448; Jacobsson, A., et al. (1985) J Biol Chem 260,
16250-16254). Analysis of brown fat gene expression revealed that
the induction of UCP1 in the null mice was reduced to approximately
45% of the wild-type level while the induction of type 2
iodothyronine deiodinase (D2) mRNA was reduced nearly 50% in
PGC-1.alpha..sup.-/- mice compared to controls (FIG. 5D). The
expression of PGC-113 is unchanged while mRNAs encoding several
enzymes involved in mitochondrial electron transport and fatty acid
oxidation are reduced in PGC-1.alpha..sup.-/- brown fat. These data
indicate that the increased energy expenditure in the
PGC-1.alpha..sup.-/- mice is not due to increased thermogenesis in
these animals; on the contrary, the mice are hypothermic when
challenged.
[0295] Skeletal muscle is a major tissue involved in energy
expenditure in vivo. To determine whether PGC-1.alpha. is also
required for normal mitochondrial function in skeletal muscle,
mitochondrial gene expression in quadriceps muscle from wild-type
and PGC-1.alpha. null mice was examined. mRNA levels for a large
number of genes involved in fatty acid oxidation and mitochondrial
function are reduced 30-60% in PGC-1.alpha..sup.-/- mice, including
those involved in intracellular fatty acid trafficking, the Krebs
Cycle, electron transport (Ndufb5 and Cox7a1), ATP synthesis
(Atp5j) and mitochondrial protein translation (FIG. 5E).
Interestingly, the expression of ERR.alpha., a direct target of
PGC-1.alpha. and an important mediator of PGC-1.alpha. action, is
also reduced in the absence of PGC-1.alpha. while PGC-1.beta. mRNA
level remains largely unchanged (FIG. 5E).
[0296] Impaired mitochondrial energy metabolism might be expected
to negatively affect ATP/AMP ratios. Consistent with this,
AMP-activated protein kinase (AMPK), a key component of cellular
energy-sensing pathways (Carling, D. (2004) Trends Biochem Sci 29,
18-24), is strongly activated in PGC-1.alpha. deficient skeletal
muscle. The levels of phosphorylated AMPK and acetyl-CoA
carboxylase (ACC), a known substrate for activated AMPK, are
significantly increased in PGC-1.alpha..sup.-/- muscle (FIG. 5F).
These data clearly indicate that PGC-1.alpha. is essential for
normal mitochondrial gene expression and energy metabolism in
skeletal muscle.
[0297] The lack of an increase in thermogenesis or mitochondrial
gene expression in the mutant animals suggested that the higher
metabolic rate in PGC-1.alpha. deficient mice might be caused by
altered levels of physical activity. To assess this, the frequency
of animal movements was monitored and quantitated using the
Comprehensive Lab Animal Monitoring System (CLAMS), which is
capable of simultaneously recording whole body oxygen consumption
and physical activity. As shown in FIGS. 6A-B, a higher oxygen
consumption rate in PGC-1.alpha..sup.-/- mice is accompanied by
profound hyperactivity as indicated by increased physical movement.
PGC-1.alpha. deficient mice are hypermetabolic and hyperactive
compared to wild-type controls both during daytime and at night. In
fact, the PGC-1.alpha. null mice displayed a 40% increase in the
frequency of random movements during the monitoring period (FIG.
6C). These results strongly indicate that the increase in energy
expenditure seen in PGC-1.alpha..sup.-/- mice is due to the
hyperactivity displayed by the null animals.
Example 7
Striatal Degeneration in PGC-1.alpha. Null Mouse Brain
[0298] Hyperactivity in PGC-1.alpha..sup.-/- mice could result from
altered circulating hormones and/or signals that originated from
the central nervous system. Measurements of several hormones known
to influence animal movement, including thyroid hormone and
catecholamines, showed no significant alterations (Table 4).
TABLE-US-00004 TABLE 4 Concentrations of circulating hormones in
wild type and PGC-1.alpha. null mice. Hormones PGC-1.alpha..sup.+/+
PGC-1 .alpha..sup.-/- Triiodothyronine (ng/ml) 0.43 .+-. 0.06 0.44
.+-. 0.04 (n.s.) Leptin (ng/ml) 0.86 .+-. 0.22 0.25 .+-. 0.09 (p =
0.01) Glucagon (pg/ml) 61 .+-. 23 52 .+-. 14 (n.s.) Corticosterone
(ng/ml) 231 .+-. 35 196 .+-. 27 (n.s.) Epinephrine (pg/ml) 485 .+-.
144 768 .+-. 304 (n.s.) Norepinephrine (pg/ml) 1484 .+-. 280 1042
.+-. 291 (n.s.)
[0299] Besides a simple increase in total movement, it was observed
that PGC-1.alpha. null mice display behavioral changes that are
characteristic of certain neurological disorders, including
stimulus-induced myoclonus, exaggerated startle responses, dystonic
posturing and frequent limb clasping (FIG. 6D). These findings are
consistent with lesions in the striatum, the brain area that is
affected in certain neurological diseases characterized by
disorders of movement, including Huntington's disease.
[0300] Neuropathology in the PGC-1.alpha..sup.-/- mouse brain was
assessed by histological analysis. The overall brain anatomy
appeared similar in the PGC-1.alpha..sup.+/+ and
PGC-1.alpha..sup.-/- mice. However, a striking spongiform pattern
of lesions was found predominantly in the striatum of three-month
old PGC-1.alpha..sup.-/- mice (FIG. 7). The number and size of
lesions decrease from the dorsal to the ventral side and also from
the lateral to the medial parts of the striatum. Occasionally, much
smaller and less abundant lesions were also found in the cortex,
especially in cortical layer V/VI of the motor cortex, nucleus
accumbens, thalamus, substantia nigra, hippocampus and the
mammalliary body. The spongiform lesions in the striatum and brain
stem were associated with gliosis, as indicated by strong
immunoreactivity for glial fibrillary associated protein (GFAP), a
hallmark for reactive astrocytes (FIGS. 7E-F). No reactive
astrocytes were found in the minor lesions in other brain areas. To
determine if the lesions were mainly affecting the white matter,
brain sections of PGC-1.alpha..sup.+/+ and PGC-1.alpha..sup.-/-
mice were stained with Luxol fast blue for myelin. As seen in FIGS.
7A-D, lesions are predominantly associated with the white matter
and rarely with the grey matter. The overall neuronal density
appeared similar in wild-type mice and PGC-1.alpha. null mice,
although neurons containing vacuoles in PGC-1.alpha..sup.-/- mouse
brain were occasionally observed. Immunostaining using a
neurofilament-heavy chain (NF220) antibody showed that striatal
neurons have lost NF220-positive neurites in the absence of
PGC-1.alpha. (FIGS. 7G-H). In fact, the spongiform lesions appear
to arise from the loss of axons in the striatal area in
PGC-1.alpha..sup.-/- mouse brain. These results clearly demonstrate
that PGC-1.alpha. is required for normal brain function and that
loss of PGC-1.alpha. leads to neuronal degeneration in specific
brain areas, most prominently in the striatum.
[0301] PGC-1.alpha. has been shown to regulate oxidative metabolism
and biological programs associated with increased oxidative
capacity in a tissue-specific manner. Analysis of gene expression
in the brains of wild-type and mutant mice by real-time PCR
revealed that mRNA levels of many mitochondrial genes are reduced
in mutants (FIG. 8A). Interestingly, the expression of several
brain-specific genes not involving mitochondrial function,
including those encoding neurofilament proteins (NF--H and NF-M),
myelin-associated oligodendrocyte basic protein (MOBP) and
Na.sup.+/K.sup.+ ATPase (ATP1a2) is also significantly reduced in
the PGC-1.alpha. null brain compared to wild-type controls (FIG.
8B). In contrast, mRNA encoding another sodium pump subunit,
ATP1a1, is not altered. These results indicate that, in addition to
its key role in the regulation of mitochondrial gene expression,
PGC-1.alpha. may also have important function in the control of
neuronal gene expression and function. In fact, primary striatal
neurons isolated from PGC-1.alpha..sup.-/- mouse embryos display a
severe impairment in neurite growth. Striatal neurons lacking
PGC-1.alpha. have greatly reduced branches of neurites whereas
wild-type neurons exhibit robust neurite outgrowth and form an
extensive network in culture.
EQUIVALENTS
[0302] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims.
Sequence CWU 1
1
4716317DNAHomo sapiens 1tagtaagaca ggtgccttca gttcactctc agtaaggggc
tggttgcctg catgagtgtg 60tgctctgtgt cactgtggat tggagttgaa aaagcttgac
tggcgtcatt caggagctgg 120atggcgtggg acatgtgcaa ccaggactct
gagtctgtat ggagtgacat cgagtgtgct 180gctctggttg gtgaagacca
gcctctttgc ccagatcttc ctgaacttga tctttctgaa 240ctagatgtga
acgacttgga tacagacagc tttctgggtg gactcaagtg gtgcagtgac
300caatcagaaa taatatccaa tcagtacaac aatgagcctt caaacatatt
tgagaagata 360gatgaagaga atgaggcaaa cttgctagca gtcctcacag
agacactaga cagtctccct 420gtggatgaag acggattgcc ctcatttgat
gcgctgacag atggagacgt gaccactgac 480aatgaggcta gtccttcctc
catgcctgac ggcacccctc caccccagga ggcagaagag 540ccgtctctac
ttaagaagct cttactggca ccagccaaca ctcagctaag ttataatgaa
600tgcagtggtc tcagtaccca gaaccatgca aatcacaatc acaggatcag
aacaaaccct 660gcaattgtta agactgagaa ttcatggagc aataaagcga
agagtatttg tcaacagcaa 720aagccacaaa gacgtccctg ctcggagctt
ctcaaatatc tgaccacaaa cgatgaccct 780cctcacacca aacccacaga
gaacagaaac agcagcagag acaaatgcac ctccaaaaag 840aagtcccaca
cacagtcgca gtcacaacac ttacaagcca aaccaacaac tttatctctt
900cctctgaccc cagagtcacc aaatgacccc aagggttccc catttgagaa
caagactatt 960gaacgcacct taagtgtgga actctctgga actgcaggcc
taactccacc caccactcct 1020cctcataaag ccaaccaaga taaccctttt
agggcttctc caaagctgaa gtcctcttgc 1080aagactgtgg tgccaccacc
atcaaagaag cccaggtaca gtgagtcttc tggtacacaa 1140ggcaataact
ccaccaagaa agggccggag caatccgagt tgtatgcaca actcagcaag
1200tcctcagtcc tcactggtgg acacgaggaa aggaagacca agcggcccag
tctgcggctg 1260tttggtgacc atgactattg ccagtcaatt aattccaaaa
cagaaatact cattaatata 1320tcacaggagc tccaagactc tagacaacta
gaaaataaag atgtctcctc tgattggcag 1380gggcagattt gttcttccac
agattcagac cagtgctacc tgagagagac tttggaggca 1440agcaagcagg
tctctccttg cagcacaaga aaacagctcc aagaccagga aatccgagcc
1500gagctgaaca agcacttcgg tcatcccagt caagctgttt ttgacgacga
agcagacaag 1560accggtgaac tgagggacag tgatttcagt aatgaacaat
tctccaaact acctatgttt 1620ataaattcag gactagccat ggatggcctg
tttgatgaca gcgaagatga aagtgataaa 1680ctgagctacc cttgggatgg
cacgcaatcc tattcattgt tcaatgtgtc tccttcttgt 1740tcttctttta
actctccatg tagagattct gtgtcaccac ccaaatcctt attttctcaa
1800agaccccaaa ggatgcgctc tcgttcaagg tccttttctc gacacaggtc
gtgttcccga 1860tcaccatatt ccaggtcaag atcaaggtct ccaggcagta
gatcctcttc aagatcctgc 1920tattactatg agtcaagcca ctacagacac
cgcacgcacc gaaattctcc cttgtatgtg 1980agatcacgtt caagatcgcc
ctacagccgt cggcccaggt atgacagcta cgaggaatat 2040cagcacgaga
ggctgaagag ggaagaatat cgcagagagt atgagaagcg agagtctgag
2100agggccaagc aaagggagag gcagaggcag aaggcaattg aagagcgccg
tgtgatttat 2160gtcggtaaaa tcagacctga cacaacacgg acagaactga
gggaccgttt tgaagttttt 2220ggtgaaattg aggagtgcac agtaaatctg
cgggatgatg gagacagcta tggtttcatt 2280acctaccgtt atacctgtga
tgcttttgct gctcttgaaa atggatacac tttgcgcagg 2340tcaaacgaaa
ctgactttga gctgtacttt tgtggacgca agcaattttt caagtctaac
2400tatgcagacc tagattcaaa ctcagatgac tttgaccctg cttccaccaa
gagcaagtat 2460gactctctgg attttgatag tttactgaaa gaagctcaga
gaagcttgcg caggtaacat 2520gttccctagc tgaggatgac agagggatgg
cgaatacctc atgggacagc gcgtccttcc 2580ctaaagacta ttgcaagtca
tacttaggaa tttctcctac tttacactct ctgtacaaaa 2640acaaaacaaa
acaacaacaa tacaacaaga acaacaacaa caataacaac aatggtttac
2700atgaacacag ctgctgaaga ggcaagagac agaatgatat ccagtaagca
catgtttatt 2760catgggtgtc agctttgctt ttcctggagt ctcttggtga
tggagtgtgc gtgtgtgcat 2820gtatgtgtgt gtgtatgtat gtgtgtggtg
tgtgtgcttg gtttagggga agtatgtgtg 2880ggtacatgtg aggactgggg
gcacctgacc agaatgcgca agggcaaacc atttcaaatg 2940gcagcagttc
catgaagaca cgcttaaaac ctagaacttc aaaatgttcg tattctattc
3000aaaaggaaat atatatatat atatatatat atatatatat atatataaat
taaaaaggaa 3060agaaaactaa caaccaacca accaaccaac caaccacaaa
ccaccctaaa atgacagccg 3120ctgatgtctg ggcatcagcc tttgtactct
gtttttttaa gaaagtgcag aatcaacttg 3180aagcaagctt tctctcataa
cgtaatgatt atatgacaat cctgaagaaa ccacaggttc 3240catagaacta
atatcctgtc tctctctctc tctctctctc tctctttttt ttttcttttt
3300ccttttgcca tggaatctgg gtgggagagg atactgcggg caccagaatg
ctaaagtttc 3360ctaacatttt gaagtttctg tagttcatcc ttaatcctga
cacccatgta aatgtccaaa 3420atgttgatct tccactgcaa atttcaaaag
ccttgtcaat ggtcaagcgt gcagcttgtt 3480cagcggttct ttctgaggag
cggacaccgg gttacattac taatgagagt tgggtagaac 3540tctctgagat
gtgttcagat agtgtaattg ctacattctc tgatgtagtt aagtatttac
3600agatgttaaa tggagtattt ttattttatg tatatactat acaacaatgt
tcttttttgt 3660tacagctatg cactgtaaat gcagccttct tttcaaaact
gctaaatttt tcttaatcaa 3720gaatattcaa atgtaattat gaggtgaaac
aattattgta cactaacata tttagaagct 3780gaacttactg cttatatata
tttgattgta aaaacaaaaa gacagtgtgt gtgtctgttg 3840agtgcaacaa
gagcaaaatg atgctttccg cacatccatc ccttaggtga gcttcaatct
3900aagcatcttg tcaagaaata tcctagtccc ctaaaggtat taaccacttc
tgcgatattt 3960ttccacattt tcttgtcgct tgtttttctt tgaagtttta
tacactggat ttgttagggg 4020aatgaaattt tctcatctaa aatttttcta
gaagatatca tgattttatg taaagtctct 4080caatgggtaa ccattaagaa
atgtttttat tttctctatc aacagtagtt ttgaaactag 4140aagtcaaaaa
tctttttaaa atgctgtttt gttttaattt ttgtgatttt aatttgatac
4200aaaatgctga ggtaataatt atagtatgat ttttacaata attaatgtgt
gtctgaagac 4260tatctttgaa gccagtattt ctttcccttg gcagagtatg
acgatggtat ttatctgtat 4320tttttacagt tatgcatcct gtataaatac
tgatatttca ttcctttgtt tactaaagag 4380acatatttat cagttgcaga
tagcctattt attataaatt atgagatgat gaaaataata 4440aagccagtgg
aaattttcta cctaggatgc atgacaattg tcaggttgga gtgtaagtgc
4500ttcatttggg aaattcagct tttgcagaag cagtgtttct acttgcacta
gcatggcctc 4560tgacgtgacc atggtgttgt tcttgatgac attgcttctg
ctaaatttaa taaaaacttc 4620agaaaaacct ccattttgat catcaggatt
tcatctgagt gtggagtccc tggaatggaa 4680ttcagtaaca tttggagtgt
gtattcaagt ttctaaattg agattcgatt actgtttggc 4740tgacatgact
tttctggaag acatgataca cctactactc aattgttctt ttcctttctc
4800tcgcccaaca cgatcttgta agatggattt cacccccagg ccaatgcagc
taattttgat 4860agctgcattc atttatcacc agcatattgt gttctgagtg
aatccactgt ttgtcctgtc 4920ggatgcttgc ttgatttttt ggcttcttat
ttctaagtag atagaaagca ataaaaatac 4980tatgaaatga aagaacttgt
tcacaggttc tgcgttacaa cagtaacaca tctttaatcc 5040gcctaattct
tgttgttctg taggttaaat gcaggtattt taactgtgtg aacgccaaac
5100taaagtttac agtctttctt tctgaatttt gagtatcttc tgttgtagaa
taataataaa 5160aagactatta agagcaataa attattttta agaaatcgag
atttagtaaa tcctattatg 5220tgttcaagga ccacatgtgt tctctatttt
gcctttaaat ttttgtgaac caattttaaa 5280tacattctcc tttttgccct
ggattgttga catgagtgga atacttggtt tcttttctta 5340cttatcaaaa
gacagcacta cagatatcat attgaggatt aatttatccc ccctaccccc
5400agcctgacaa atattgttac catgaagata gttttcctca atggacttca
aattgcatct 5460agaattagtg gagcttttgt atcttctgca gacactgtgg
gtagcccatc aaaatgtaag 5520ctgtgctcct ctcattttta tttttatttt
tttgggagag aatatttcaa atgaacacgt 5580gcaccccatc atcactggag
gcaaatttca gcatagatct gtaggatttt tagaagaccg 5640tgggccattg
ccttcatgcc gtggtaagta ccacatctac aattttggta accgaactgg
5700tgctttagta atgtggattt ttttcttttt taaaagagat gtagcagaat
aattcttcca 5760gtgcaacaaa atcaattttt tgctaaacga ctccgagaac
aacagttggg ctgtcaacat 5820tcaaagcagc agagagggaa ctttgcacta
ttggggtatg atgtttgggt cagttgataa 5880aaggaaacct tttcatgcct
ttagatgtga gcttccagta ggtaatgatt atgtgtcctt 5940tcttgatggc
tgtaatgaga acttcaatca ctgtagtcta agacctgatc tatagatgac
6000ctagaatagc catgtactat aatgtgatga ttctaaattt gtacctatgt
gacagacatt 6060ttcaataatg tgaactgctg atttgatgga gctactttaa
gatttgtagg tgaaagtgta 6120atactgttgg ttgaactatg ctgaagaggg
aaagtgagcg attagttgag cccttgccgg 6180gccttttttc cacctgccaa
ttctacatgt attgttgtgg ttttattcat tgtatgaaaa 6240ttcctgtgat
tttttttaaa tgtgcagtac acatcagcct cactgagcta ataaagggaa
6300acgaatgttt caaatct 63172798PRTHomo sapiens 2Met Ala Trp Asp Met
Cys Asn Gln Asp Ser Glu Ser Val Trp Ser Asp1 5 10 15Ile Glu Cys Ala
Ala Leu Val Gly Glu Asp Gln Pro Leu Cys Pro Asp 20 25 30Leu Pro Glu
Leu Asp Leu Ser Glu Leu Asp Val Asn Asp Leu Asp Thr 35 40 45Asp Ser
Phe Leu Gly Gly Leu Lys Trp Cys Ser Asp Gln Ser Glu Ile 50 55 60Ile
Ser Asn Gln Tyr Asn Asn Glu Pro Ser Asn Ile Phe Glu Lys Ile65 70 75
80Asp Glu Glu Asn Glu Ala Asn Leu Leu Ala Val Leu Thr Glu Thr Leu
85 90 95Asp Ser Leu Pro Val Asp Glu Asp Gly Leu Pro Ser Phe Asp Ala
Leu 100 105 110Thr Asp Gly Asp Val Thr Thr Asp Asn Glu Ala Ser Pro
Ser Ser Met 115 120 125Pro Asp Gly Thr Pro Pro Pro Gln Glu Ala Glu
Glu Pro Ser Leu Leu 130 135 140Lys Lys Leu Leu Leu Ala Pro Ala Asn
Thr Gln Leu Ser Tyr Asn Glu145 150 155 160Cys Ser Gly Leu Ser Thr
Gln Asn His Ala Asn His Asn His Arg Ile 165 170 175Arg Thr Asn Pro
Ala Ile Val Lys Thr Glu Asn Ser Trp Ser Asn Lys 180 185 190Ala Lys
Ser Ile Cys Gln Gln Gln Lys Pro Gln Arg Arg Pro Cys Ser 195 200
205Glu Leu Leu Lys Tyr Leu Thr Thr Asn Asp Asp Pro Pro His Thr Lys
210 215 220Pro Thr Glu Asn Arg Asn Ser Ser Arg Asp Lys Cys Thr Ser
Lys Lys225 230 235 240Lys Ser His Thr Gln Ser Gln Ser Gln His Leu
Gln Ala Lys Pro Thr 245 250 255Thr Leu Ser Leu Pro Leu Thr Pro Glu
Ser Pro Asn Asp Pro Lys Gly 260 265 270Ser Pro Phe Glu Asn Lys Thr
Ile Glu Arg Thr Leu Ser Val Glu Leu 275 280 285Ser Gly Thr Ala Gly
Leu Thr Pro Pro Thr Thr Pro Pro His Lys Ala 290 295 300Asn Gln Asp
Asn Pro Phe Arg Ala Ser Pro Lys Leu Lys Ser Ser Cys305 310 315
320Lys Thr Val Val Pro Pro Pro Ser Lys Lys Pro Arg Tyr Ser Glu Ser
325 330 335Ser Gly Thr Gln Gly Asn Asn Ser Thr Lys Lys Gly Pro Glu
Gln Ser 340 345 350Glu Leu Tyr Ala Gln Leu Ser Lys Ser Ser Val Leu
Thr Gly Gly His 355 360 365Glu Glu Arg Lys Thr Lys Arg Pro Ser Leu
Arg Leu Phe Gly Asp His 370 375 380Asp Tyr Cys Gln Ser Ile Asn Ser
Lys Thr Glu Ile Leu Ile Asn Ile385 390 395 400Ser Gln Glu Leu Gln
Asp Ser Arg Gln Leu Glu Asn Lys Asp Val Ser 405 410 415Ser Asp Trp
Gln Gly Gln Ile Cys Ser Ser Thr Asp Ser Asp Gln Cys 420 425 430Tyr
Leu Arg Glu Thr Leu Glu Ala Ser Lys Gln Val Ser Pro Cys Ser 435 440
445Thr Arg Lys Gln Leu Gln Asp Gln Glu Ile Arg Ala Glu Leu Asn Lys
450 455 460His Phe Gly His Pro Ser Gln Ala Val Phe Asp Asp Glu Ala
Asp Lys465 470 475 480Thr Gly Glu Leu Arg Asp Ser Asp Phe Ser Asn
Glu Gln Phe Ser Lys 485 490 495Leu Pro Met Phe Ile Asn Ser Gly Leu
Ala Met Asp Gly Leu Phe Asp 500 505 510Asp Ser Glu Asp Glu Ser Asp
Lys Leu Ser Tyr Pro Trp Asp Gly Thr 515 520 525Gln Ser Tyr Ser Leu
Phe Asn Val Ser Pro Ser Cys Ser Ser Phe Asn 530 535 540Ser Pro Cys
Arg Asp Ser Val Ser Pro Pro Lys Ser Leu Phe Ser Gln545 550 555
560Arg Pro Gln Arg Met Arg Ser Arg Ser Arg Ser Phe Ser Arg His Arg
565 570 575Ser Cys Ser Arg Ser Pro Tyr Ser Arg Ser Arg Ser Arg Ser
Pro Gly 580 585 590Ser Arg Ser Ser Ser Arg Ser Cys Tyr Tyr Tyr Glu
Ser Ser His Tyr 595 600 605Arg His Arg Thr His Arg Asn Ser Pro Leu
Tyr Val Arg Ser Arg Ser 610 615 620Arg Ser Pro Tyr Ser Arg Arg Pro
Arg Tyr Asp Ser Tyr Glu Glu Tyr625 630 635 640Gln His Glu Arg Leu
Lys Arg Glu Glu Tyr Arg Arg Glu Tyr Glu Lys 645 650 655Arg Glu Ser
Glu Arg Ala Lys Gln Arg Glu Arg Gln Arg Gln Lys Ala 660 665 670Ile
Glu Glu Arg Arg Val Ile Tyr Val Gly Lys Ile Arg Pro Asp Thr 675 680
685Thr Arg Thr Glu Leu Arg Asp Arg Phe Glu Val Phe Gly Glu Ile Glu
690 695 700Glu Cys Thr Val Asn Leu Arg Asp Asp Gly Asp Ser Tyr Gly
Phe Ile705 710 715 720Thr Tyr Arg Tyr Thr Cys Asp Ala Phe Ala Ala
Leu Glu Asn Gly Tyr 725 730 735Thr Leu Arg Arg Ser Asn Glu Thr Asp
Phe Glu Leu Tyr Phe Cys Gly 740 745 750Arg Lys Gln Phe Phe Lys Ser
Asn Tyr Ala Asp Leu Asp Ser Asn Ser 755 760 765Asp Asp Phe Asp Pro
Ala Ser Thr Lys Ser Lys Tyr Asp Ser Leu Asp 770 775 780Phe Asp Ser
Leu Leu Lys Glu Ala Gln Arg Ser Leu Arg Arg785 790
795322DNAArtificial SequenceForward primer 3agccgtgacc actgacaacg
ag 22422DNAArtificial SequenceForward primer 4cgctccagga gactgaatcc
ag 22523DNAArtificial SequenceForward primer 5catatgctga tcctgggcat
aac 23622DNAArtificial SequenceForward primer 6acaccgacta
ctacagcaac ag 22722DNAArtificial SequenceForward primer 7ggcattcaga
ggcaaatcag ct 22820DNAArtificial SequenceForward primer 8gtctcccagg
ctctggtccg 20922DNAArtificial SequenceForward primer 9tccgaagact
gtcgctcctg tg 221022DNAArtificial SequenceForward primer
10ggtacgcact ggccgaagca tc 221124DNAArtificial SequenceForward
primer 11gtcggtacct ggaagctagt ggac 241222DNAArtificial
SequenceForward primer 12gttctgcaga ggatcttcag gc
221323DNAArtificial SequenceForward primer 13cagtgtggtg cacgtctcca
atc 231421DNAArtificial SequenceForward primer 14caggtcactg
tgcccttacc a 211521DNAArtificial SequenceForward primer
15agtccctgcc ctttgtacac a 211622DNAArtificial SequenceForward
primer 16cactgtagtg ggcgttggac aa 221722DNAArtificial
SequenceForward primer 17caacgtgttc ctcaagtcgc gg
221822DNAArtificial SequenceForward primer 18gctggacagt gagctgagaa
ac 221922DNAArtificial SequenceForward primer 19gatgagctac
acgctggact cg 222023DNAArtificial SequenceForward primer
20actccaagcg tgagatcgtg gac 232121DNAArtificial SequenceForward
primer 21tcatcgtagc caacgtgcca g 212223DNAArtificial
SequenceReverse primer 22gctgcatggt tctgagtgct aag
232321DNAArtificial SequenceReverse primer 23cttgactact gtctgtgagg
c 212422DNAArtificial SequenceReverse primer 24caaacttcat
ccaggcaatg tc 222522DNAArtificial SequenceReverse primer
25cctcgaaaga tagcaagagt ag 222621DNAArtificial SequenceReverse
primer 26caatgaacac tgccacacct c 212722DNAArtificial
SequenceReverse primer 27ctgtacagga cgttgtccat tc
222822DNAArtificial SequenceReverse primer 28tatgttcacc agtgttatgc
ca 222922DNAArtificial SequenceReverse primer 29tgatcctgct
ccgtcatctc ag 223023DNAArtificial SequenceReverse primer
30gatctctgtg ttcttgaagg tac 233122DNAArtificial SequenceReverse
primer 31gtcctccaga tgcctgtcgc tt 223221DNAArtificial
SequenceReverse primer 32tgaaccaaag ttgaccacca g
213321DNAArtificial SequenceReverse primer 33cactacgttc caggatccca
a 213419DNAArtificial SequenceReverse primer 34cgatccgagg gcctcacta
193522DNAArtificial SequenceReverse primer 35cggccacaat tttcggagtc
tg 223621DNAArtificial SequenceReverse primer 36gccaggttct
ctttactcat c 213722DNAArtificial SequenceReverse primer
37caaagccaat ccgacactct tc 223822DNAArtificial SequenceReverse
primer 38tgtaggagga ggacacggtg ct 223922DNAArtificial
SequenceReverse primer 39ggacgcagct ggctggtgct tg
224022DNAArtificial SequenceReverse primer 40gtcttgtctg agcagatggt
ag 224121DNAArtificial SequenceGenotyping primer
41cttccatgtg tcactgtagt c 214220DNAArtificial SequenceGenotyping
primer 42ggatgatagg tatgcgttac 204323DNAArtificial
SequenceGenotyping primer 43tccagtaggc agagatttat gac
234423DNAArtificial SequenceGenotyping primer 44ccaactgtct
ataattccag ttc 23453029DNAMus musculus 45aattcggcac gaggttgcct
gcatgagtgt gtgctgtgtg tcagagtgga ttggagttga 60aaaagcttga ctggcgtcat
tcgggagctg gatggcttgg gacatgtgca gccaagactc 120tgtatggagt
gacatagagt gtgctgctct ggttggtgag gaccagcctc tttgcccaga
180tcttcctgaa cttgaccttt ctgaacttga tgtgaatgac ttggatacag
acagctttct 240gggtggattg aagtggtgta gcgaccaatc ggaaatcata
tccaaccagt acaacaatga 300gcctgcgaac atatttgaga agatagatga
agagaatgag gcaaacttgc tagcggtcct 360cacagagaca ctggacagtc
tccccgtgga tgaagacgga ttgccctcat ttgatgcact 420gacagatgga
gccgtgacca ctgacaacga ggccagtcct tcctccatgc ctgacggcac
480ccctccccct caggaggcag aagagccgtc tctacttaag aagctcttac
tggcaccagc 540caacactcag ctcagctaca atgaatgcag cggtcttagc
actcagaacc atgcagcaaa 600ccacacccac aggatcagaa caaaccctgc
cattgttaag accgagaatt catggagcaa 660taaagcgaag agcatttgtc
aacagcaaaa gccacaaaga cgtccctgct cagagcttct 720caagtatctg
accacaaacg atgaccctcc tcacaccaaa cccacagaaa acaggaacag
780cagcagagac aaatgtgctt ccaaaaagaa gtcccataca caaccgcagt
cgcaacatgc 840tcaagccaaa ccaacaactt tatctcttcc tctgacccca
gagtcaccaa atgaccccaa 900gggttcccca tttgagaaca agactattga
gcgaacctta agtgtggaac tctctggaac 960tgcaggccta actcctccca
caactcctcc tcataaagcc aaccaagata accctttcaa 1020ggcttcgcca
aagctgaagc cctcttgcaa gaccgtggtg ccaccgccaa ccaagagggc
1080ccggtacagt gagtgttctg gtacccaagg cagccactcc accaagaaag
ggcccgagca 1140atctgagttg tacgcacaac tcagcaagtc ctcagggctc
agccgaggac acgaggaaag 1200gaagactaaa cggcccagtc tccggctgtt
tggtgaccat gactactgtc agtcactcaa 1260ttccaaaacg gatatactca
ttaacatatc acaggagctc caagactcta gacaactaga 1320cttcaaagat
gcctcctgtg actggcaggg gcacatctgt tcttccacag attcaggcca
1380gtgctacctg agagagactt tggaggccag caagcaggtc tctccttgca
gcaccagaaa 1440acagctccaa gaccaggaaa tccgagcgga gctgaacaag
cacttcggtc atccctgtca 1500agctgtgttt gacgacaaat cagacaagac
cagtgaacta agggatggcg acttcagtaa 1560tgaacaattc tccaaactac
ctgtgtttat aaattcagga ctagccatgg atggcctatt 1620tgatgacagt
gaagatgaaa gtgataaact gagctaccct tgggatggca cgcagcccta
1680ttcattgttc gatgtgtcgc cttcttgctc ttcctttaac tctccgtgtc
gagactcagt 1740gtcaccaccg aaatccttat tttctcaaag accccaaagg
atgcgctctc gttcaagatc 1800cttttctcga cacaggtcgt gttcccgatc
accatattcc aggtcaagat caaggtcccc 1860aggcagtaga tcctcttcaa
gatcctgtta ctactatgaa tcaagccact acagacaccg 1920cacacaccgc
aattctccct tgtatgtgag atcacgttca aggtcaccct acagccgtag
1980gcccaggtac gacagctatg aagcctatga gcacgaaagg ctcaagaggg
atgaataccg 2040caaagagcac gagaagcggg agtctgaaag ggccaaacag
agagagaggc agaagcagaa 2100agcaattgaa gagcgccgtg tgatttacgt
tggtaaaatc agacctgaca caacgcggac 2160agaattgaga gaccgctttg
aagtttttgg tgaaattgag gaatgcaccg taaatctgcg 2220ggatgatgga
gacagctatg gtttcatcac ctaccgttac acctgtgacg ctttcgctgc
2280tcttgagaat ggatatactt tacgcaggtc gaacgaaact gacttcgagc
tgtacttttg 2340tggacggaag caatttttca agtctaacta tgcagaccta
gataccaact cagacgattt 2400tgaccctgct tccaccaaga gcaagtatga
ctctctggat tttgatagtt tactgaagga 2460agctcagaga agcttgcgca
ggtaacgtgt tcccaggctg aggaatgaca gagagatggt 2520caatacctca
tgggacagcg tgtcctttcc caagactctt gcaagtcata cttaggaatt
2580tctcctactt tacactctct gtacaaaaat aaaacaaaac aaaacaacaa
taacaacaac 2640aacaacaaca ataacaacaa caaccatacc agaacaagaa
caacggttta catgaacaca 2700gctgctgaag aggcaagaga cagaatgata
atccagtaag cacacgttta ttcacgggtg 2760tcagctttgc tttccctgga
ggctcttggt gacagtgtgt gtgcgtgtgt gtgtgtgggt 2820gtgcgtgtgt
gtatgtgtgt gtgtgtactt gtttggaaag tacatatgta cacatgtgag
2880gacttggggg cacctgaaca gaacgaacaa gggcgacccc ttcaaatggc
agcatttcca 2940tgaagacaca cttaaaacct acaacttcaa aatgttcgta
ttctatacaa aaggaaaata 3000aataaatata aaaaaaaaaa aaaaaaaaa
302946797PRTMus musculus 46Met Ala Trp Asp Met Cys Ser Gln Asp Ser
Val Trp Ser Asp Ile Glu1 5 10 15Cys Ala Ala Leu Val Gly Glu Asp Gln
Pro Leu Cys Pro Asp Leu Pro 20 25 30Glu Leu Asp Leu Ser Glu Leu Asp
Val Asn Asp Leu Asp Thr Asp Ser 35 40 45Phe Leu Gly Gly Leu Lys Trp
Cys Ser Asp Gln Ser Glu Ile Ile Ser 50 55 60Asn Gln Tyr Asn Asn Glu
Pro Ala Asn Ile Phe Glu Lys Ile Asp Glu65 70 75 80Glu Asn Glu Ala
Asn Leu Leu Ala Val Leu Thr Glu Thr Leu Asp Ser 85 90 95Leu Pro Val
Asp Glu Asp Gly Leu Pro Ser Phe Asp Ala Leu Thr Asp 100 105 110Gly
Ala Val Thr Thr Asp Asn Glu Ala Ser Pro Ser Ser Met Pro Asp 115 120
125Gly Thr Pro Pro Pro Gln Glu Ala Glu Glu Pro Ser Leu Leu Lys Lys
130 135 140Leu Leu Leu Ala Pro Ala Asn Thr Gln Leu Ser Tyr Asn Glu
Cys Ser145 150 155 160Gly Leu Ser Thr Gln Asn His Ala Ala Asn His
Thr His Arg Ile Arg 165 170 175Thr Asn Pro Ala Ile Val Lys Thr Glu
Asn Ser Trp Ser Asn Lys Ala 180 185 190Lys Ser Ile Cys Gln Gln Gln
Lys Pro Gln Arg Arg Pro Cys Ser Glu 195 200 205Leu Leu Lys Tyr Leu
Thr Thr Asn Asp Asp Pro Pro His Thr Lys Pro 210 215 220Thr Glu Asn
Arg Asn Ser Ser Arg Asp Lys Cys Ala Ser Lys Lys Lys225 230 235
240Ser His Thr Gln Pro Gln Ser Gln His Ala Gln Ala Lys Pro Thr Thr
245 250 255Leu Ser Leu Pro Leu Thr Pro Glu Ser Pro Asn Asp Pro Lys
Gly Ser 260 265 270Pro Phe Glu Asn Lys Thr Ile Glu Arg Thr Leu Ser
Val Glu Leu Ser 275 280 285Gly Thr Ala Gly Leu Thr Pro Pro Thr Thr
Pro Pro His Lys Ala Asn 290 295 300Gln Asp Asn Pro Phe Lys Ala Ser
Pro Lys Leu Lys Pro Ser Cys Lys305 310 315 320Thr Val Val Pro Pro
Pro Thr Lys Arg Ala Arg Tyr Ser Glu Cys Ser 325 330 335Gly Thr Gln
Gly Ser His Ser Thr Lys Lys Gly Pro Glu Gln Ser Glu 340 345 350Leu
Tyr Ala Gln Leu Ser Lys Ser Ser Gly Leu Ser Arg Gly His Glu 355 360
365Glu Arg Lys Thr Lys Arg Pro Ser Leu Arg Leu Phe Gly Asp His Asp
370 375 380Tyr Cys Gln Ser Leu Asn Ser Lys Thr Asp Ile Leu Ile Asn
Ile Ser385 390 395 400Gln Glu Leu Gln Asp Ser Arg Gln Leu Asp Phe
Lys Asp Ala Ser Cys 405 410 415Asp Trp Gln Gly His Ile Cys Ser Ser
Thr Asp Ser Gly Gln Cys Tyr 420 425 430Leu Arg Glu Thr Leu Glu Ala
Ser Lys Gln Val Ser Pro Cys Ser Thr 435 440 445Arg Lys Gln Leu Gln
Asp Gln Glu Ile Arg Ala Glu Leu Asn Lys His 450 455 460Phe Gly His
Pro Cys Gln Ala Val Phe Asp Asp Lys Ser Asp Lys Thr465 470 475
480Ser Glu Leu Arg Asp Gly Asp Phe Ser Asn Glu Gln Phe Ser Lys Leu
485 490 495Pro Val Phe Ile Asn Ser Gly Leu Ala Met Asp Gly Leu Phe
Asp Asp 500 505 510Ser Glu Asp Glu Ser Asp Lys Leu Ser Tyr Pro Trp
Asp Gly Thr Gln 515 520 525Pro Tyr Ser Leu Phe Asp Val Ser Pro Ser
Cys Ser Ser Phe Asn Ser 530 535 540Pro Cys Arg Asp Ser Val Ser Pro
Pro Lys Ser Leu Phe Ser Gln Arg545 550 555 560Pro Gln Arg Met Arg
Ser Arg Ser Arg Ser Phe Ser Arg His Arg Ser 565 570 575Cys Ser Arg
Ser Pro Tyr Ser Arg Ser Arg Ser Arg Ser Pro Gly Ser 580 585 590Arg
Ser Ser Ser Arg Ser Cys Tyr Tyr Tyr Glu Ser Ser His Tyr Arg 595 600
605His Arg Thr His Arg Asn Ser Pro Leu Tyr Val Arg Ser Arg Ser Arg
610 615 620Ser Pro Tyr Ser Arg Arg Pro Arg Tyr Asp Ser Tyr Glu Ala
Tyr Glu625 630 635 640His Glu Arg Leu Lys Arg Asp Glu Tyr Arg Lys
Glu His Glu Lys Arg 645 650 655Glu Ser Glu Arg Ala Lys Gln Arg Glu
Arg Gln Lys Gln Lys Ala Ile 660 665 670Glu Glu Arg Arg Val Ile Tyr
Val Gly Lys Ile Arg Pro Asp Thr Thr 675 680 685Arg Thr Glu Leu Arg
Asp Arg Phe Glu Val Phe Gly Glu Ile Glu Glu 690 695 700Cys Thr Val
Asn Leu Arg Asp Asp Gly Asp Ser Tyr Gly Phe Ile Thr705 710 715
720Tyr Arg Tyr Thr Cys Asp Ala Phe Ala Ala Leu Glu Asn Gly Tyr Thr
725 730 735Leu Arg Arg Ser Asn Glu Thr Asp Phe Glu Leu Tyr Phe Cys
Gly Arg 740 745 750Lys Gln Phe Phe Lys Ser Asn Tyr Ala Asp Leu Asp
Thr Asn Ser Asp 755 760 765Asp Phe Asp Pro Ala Ser Thr Lys Ser Lys
Tyr Asp Ser Leu Asp Phe 770 775 780Asp Ser Leu Leu Lys Glu Ala Gln
Arg Ser Leu Arg Arg785 790 795475PRTMus
musculusmisc_feature(2)..(3)Xaa's at postions 2 and 3 may be any
amino acid 47Leu Xaa Xaa Leu Leu1 5
* * * * *
References