U.S. patent application number 12/972236 was filed with the patent office on 2012-06-21 for method for electroeluting genetic material from dried samples.
This patent application is currently assigned to General Electric Company. Invention is credited to Erin Jean Finehout, John Richard Nelson, Patrick McCoy Spooner.
Application Number | 20120152743 12/972236 |
Document ID | / |
Family ID | 46232952 |
Filed Date | 2012-06-21 |
United States Patent
Application |
20120152743 |
Kind Code |
A1 |
Finehout; Erin Jean ; et
al. |
June 21, 2012 |
METHOD FOR ELECTROELUTING GENETIC MATERIAL FROM DRIED SAMPLES
Abstract
In accordance with the present disclosure, a method for
extracting genetic material from a biological sample stored on a
solid medium is provided. The method includes obtaining the solid
medium, wherein the biological sample is applied on the solid
medium, and the solid medium includes chemicals that lysed the
biological sample and preserved the genetic material. The method
also includes electroeluting the genetic material directly from the
solid medium to a subsequent medium.
Inventors: |
Finehout; Erin Jean;
(Clifton Park, NY) ; Nelson; John Richard;
(Clifton Park, NY) ; Spooner; Patrick McCoy;
(Slingerlands, NY) |
Assignee: |
General Electric Company
Schenectady
NY
|
Family ID: |
46232952 |
Appl. No.: |
12/972236 |
Filed: |
December 17, 2010 |
Current U.S.
Class: |
204/456 ;
204/450 |
Current CPC
Class: |
C12N 15/101
20130101 |
Class at
Publication: |
204/456 ;
204/450 |
International
Class: |
C25B 7/00 20060101
C25B007/00 |
Claims
1. A method for extracting genetic material from a biological
sample stored on a solid medium, comprising: obtaining the solid
medium, wherein the biological sample is applied on the solid
medium, and the solid medium comprises chemicals that lyse the
biological sample and preserve the genetic material; and
electroeluting the genetic material directly from the solid medium
to a subsequent medium.
2. The method of claim 1, wherein the solid medium comprises a
cellulose-based material.
3. The method of claim 1, comprising rinsing the solid medium prior
to electroelution.
4. The method of claim 3, wherein rinsing the solid medium
comprises soaking the solid medium in buffer or flowing buffer
through or across the solid medium.
5. The method of claim 3, wherein rinsing the solid medium
comprises soaking the solid medium in water or flowing water
through or across the solid medium.
6. The method of claim 3, further comprising repairing the genetic
material prior to electroelution.
7. The method of claim 6, wherein repairing the genetic material
comprises applying a solution containing at least DNA polymerase
and DNA ligase.
8. The method of claim 7, wherein the DNA polymerase comprises DNA
polymerase activity, 3' to 5' exonuclease activity for
proofreading, and 5' to 3' exonuclease activity for nick
translation.
9. The method of claim 6, wherein repairing the genetic material
comprises applying a solution containing at least an endonuclease
that nicks DNA adjacent to abasic sites.
10. The method of claim 1, wherein the biological sample comprises
fixed cells.
11. The method of claim 10, comprising processing the fixed cells
prior to electroelution from the solid medium, wherein processing
comprises rehydrating the fixed cells, treating the fixed cells
with protease, or reversing cross-linking.
12. The method of claim 1, wherein the subsequent medium comprises
an electrophoresis gel, a solution, or a capture surface.
13. A method for extracting genetic material from a fixed tissue
sample stored on a solid medium, comprising: applying at least a
portion of the fixed tissue sample to the solid medium, wherein the
solid medium comprises chemicals that can lyse the tissue sample or
preserve the genetic material; and electroeluting the genetic
material directly from the solid medium to a subsequent medium.
14. The method of claim 13, wherein the solid medium comprises a
cellulose-based paper.
15. The method of claim 13, wherein the solid medium comprises FTA
paper.
16. The method of claim 13, comprising treating the fixed tissue
sample with protease prior to or after applying the fixed tissue
sample to the solid medium.
17. The method of claim 13, wherein the solid medium comprises
chemicals that lyse the fixed tissue sample.
18. The method of claim 13, comprising rehydrating the fixed tissue
sample prior to applying the fixed tissue sample to the solid
medium.
19. The method of claim 18, comprising reversing cross-linking
between the genetic material and protein prior to or subsequent to
applying the fixed tissue sample to the solid medium.
20. The method of claim 19, wherein reversing cross-linking
comprises applying crosslink repair buffer comprising a nucleophile
with a pH other than 7.0.
21. The method of claim 14, comprising repairing the genetic
material prior to electroelution.
22. The method of claim 21, wherein repairing the genetic material
comprises applying a solution containing at least DNA polymerase I
and DNA ligase.
23. The method of claim 21, wherein repairing the genetic material
comprises applying a solution containing at least an endonuclease
that nicks DNA adjacent to abasic sites.
24. The method of claim 13, wherein the subsequent medium comprises
an electrophoresis gel, a solution, or a capture surface.
25. A method for extracting DNA from a biological sample stored on
a cellulose-based paper, comprising: obtaining the cellulose-based
paper, wherein the biological sample is applied on the
cellulose-based paper, and the cellulose-based paper comprises
chemicals that lyse the biological sample and preserve the DNA;
repairing the DNA on the cellulose-based paper; and electroeluting
DNA directly from the cellulose-based paper into an electrophoresis
gel.
Description
BACKGROUND OF THE INVENTION
[0001] The subject matter disclosed herein relates to a solid
medium for use in the storage of genetic material from biological
samples and more particularly to methods to electroelute genetic
material from the biological samples directly from the solid
medium.
[0002] Various facilities (e.g., research or medical institutions)
include storage systems for large collections of genetic material
(e.g., DNA) collected from a wide range of sources (e.g., human
blood, cell lines, etc.). The genetic material is stored in a safe,
convenient, and minimally labor intensive manner within these
storage systems for later analysis. For example, solid media, such
as Whatman.RTM. FTA.RTM. substrates, are used to store genetic
material from various biological samples, such as tissues or cells.
However, extracting genetic material from the solid media involves
additional labor, sometimes intensive labor when dealing with
numerous samples. For example, extraction of genetic material may
include either using detergents or incubating the solid media at
high temperatures. The detergent may interfere with analysis of the
genetic material, thus additional labor is required to remove the
detergent. Also, the higher temperatures may fragment the genetic
material. Thus, there is a need to reduce the work required to
extract genetic material, while also minimizing the fragmentation
of the genetic material.
BRIEF DESCRIPTION OF THE INVENTION
[0003] In a first embodiment, a method for extracting genetic
material from a biological sample stored on a solid medium is
provided. The method includes obtaining the solid medium, wherein
the biological sample is applied on the solid medium, and the solid
medium includes chemicals that lyzed the biological sample and
preserved the genetic material. The method also includes
electroeluting the genetic material directly from the solid medium
to a subsequent medium.
[0004] In a second embodiment, a method for extracting genetic
material from a fixed tissue sample stored on a solid medium is
provided. The method includes applying at least a portion of the
fixed tissue sample to the solid medium, wherein the solid medium
includes chemicals that can lyse the cells or preserve the genetic
material. The method further includes electroeluting the genetic
material directly from the solid medium to a subsequent medium.
[0005] In a third embodiment, a method for extracting DNA from a
biological sample stored on a cellulose-based paper is provided.
The method includes obtaining the cellulose-based paper, wherein
the biological sample is applied on the cellulose-based paper, and
the cellulose based paper includes chemicals that lyse the
biological sample and preserve the DNA. The method also includes
electroeluting DNA directly from the cellulose-based paper into an
electrophoresis gel.
BRIEF DESCRIPTION OF THE DRAWINGS
[0006] These and other features, aspects, and advantages of the
present invention will become better understood when the following
detailed description is read with reference to the accompanying
drawings in which like characters represent like parts throughout
the drawings, wherein:
[0007] FIG. 1 is a flow chart illustrating a method for extracting
genetic material from a biological sample stored on a solid medium
in accordance with aspects of the present disclosure;
[0008] FIG. 2 depicts a SYBR.RTM. Gold stained electrophoresis gel
of DNA electroeluted from solid media using pulsed-field gel
electrophoresis in accordance with aspects of the present
disclosure;
[0009] FIG. 3 depicts a SYBR.RTM. Gold stained electrophoresis gel
of DNA electroeluted from solid media using alkaline gel
electrophoresis in accordance with aspects of the present
disclosure;
[0010] FIG. 4 is a flow chart illustrating a method for extracting
genetic material from a fixed tissue sample stored on a solid
medium in accordance with aspects of the present disclosure;
[0011] FIG. 5 depicts a SYBR.RTM. Gold stained electrophoresis gel,
using a vertical polyacrylamide gel electrophoresis (PAGE) system,
of multiplex PCR amplification of DNA that has been extracted from
a human prostate sample fixed in formalin and applied to
Whatman.RTM. FTA.RTM. paper;
[0012] FIG. 6 depicts a SYBR.RTM. Gold stained electrophoresis gel
of DNA electroeluted from solid media using native gel
electrophoresis in accordance with aspects of the present
disclosure;
[0013] FIG. 7 depicts a SYBR.RTM. Gold stained electrophoresis gel
of DNA electroeluted from solid media using native gel
electrophoresis in accordance with aspects of the present
disclosure; and
[0014] FIG. 8 depicts a SYBR.RTM. Gold stained electrophoresis gel
of DNA electroeluted from solid media using native gel
electrophoresis in accordance with aspects of the present
disclosure.
DETAILED DESCRIPTION OF THE INVENTION
[0015] As discussed in detail below, embodiments of the invention
include a method for extracting genetic material (e.g., DNA)
directly from biological samples stored on a solid medium (e.g.,
chemically treated cellulose substrate) using electroelution. In
one embodiment, the method includes obtaining the solid medium that
includes a stored biological sample previously applied and dried on
the solid medium. The solid medium includes chemicals that lyse the
biological sample and preserve the genetic material. The method
also includes electroeluting the genetic material directly from the
solid medium to a subsequent medium after removing the chemicals
from the solid medium. The subsequent medium may include an
electrophoresis gel, a solution, or a capture surface (e.g., a
blotting membrane). Alternatively, fixed samples of cells or
tissues may be applied to the solid medium. The fixed samples may
be processed prior to or after application to the solid medium. For
example, processing of the fixed samples may include rehydrating
and/or lyzing the fixed sample. Whether fixed or not, the samples
may be further processed subsequent to application to the solid
medium. In particular, repair of nicks and abasic sites within the
genetic material may occur, while the genetic material is in a
fixed position on the solid medium. The methods above provide a
single platform for lyzing a biological sample, extracting DNA from
the biological sample, binding the DNA to a surface, washing the
DNA, and eluting high molecular weight (e.g., at least 10
kilobases) as wells as less fragmented DNA. The ability to directly
electroelute the genetic material from the solid medium avoids the
use of detergents normally used to extract DNA as well as the extra
steps necessary to remove the detergent and make the DNA usable for
subsequent analysis. In addition, directly electroeluting the
genetic material from the solid medium without using high
temperatures reduces the fragmentation of DNA. Prior to this
invention, researchers have had to insert the solid medium on which
the DNA is located directly into subsequent genetic analysis
reactions (e.g. PCR) to analyze the DNA that is bound on the solid
medium. It can be appreciated that elution of DNA from the solid
medium allows for the evaluation of the genetic material in more
than just one reaction. Overall, the disclosed embodiments reduce
the work of the user in extracting the DNA from the solid medium
while improving the quality and availability of the DNA.
[0016] Biological samples used in the embodiments below may include
physiological/pathological body liquids (e.g., secretions,
excretions, exudates, and transudates) or cell suspensions (e.g.,
blood, lymph, synovial fluid, semen, saliva containing buccal
cells, skin scrapings, hair root cells, etc.), liquid extracts or
homogenates of cell suspensions of humans and animals;
physiological/pathological liquids or cell suspensions of plants;
liquid products, extracts or suspensions of bacteria, fungi,
plasmids, viruses, etc.; liquid products, extracts, or suspensions
of parasites including helminths, protozoas, spirochetes, etc.;
human or animal body tissues (e.g., bone, liver kidney, etc.);
media from DNA or RNA synthesis; mixtures of chemically or
biochemically synthesized DNA or RNA; and any other source in which
DNA and/or RNA is or can be in a liquid medium.
[0017] Turning now to the figures, FIG. 1 is a flow chart
illustrating an embodiment of a method 10 for extracting genetic
material (e.g., DNA) from a biological sample (e.g., tissues,
cells, viruses, bacteriophages, or any other sample containing
nucleic acid) stored on a solid medium. Processing of the
biological sample (block 12) may occur prior to application of the
biological sample to the solid medium. For example, in certain
embodiments as described in greater detail below, biological
samples including cells or tissues may be fixed (e.g., in
formalin). Processing of the fixed tissue or cells may include
rehydrating the fixed cells or tissues, lyzing the cells or tissues
(e.g., with protease), and/or reversing cross-linking between the
genetic material (e.g., DNA) and proteins. In certain embodiments,
some of the processing, such as reversing cross-linking, may occur
subsequent to application of the fixed cells or tissues to the
solid medium.
[0018] Application of the desired biological sample to the solid
medium then occurs (block 14). In one embodiment, the solid medium
includes a chemically treated absorbent cellulose-based material.
For example, the solid medium may include Whatman.RTM. FTA.RTM. or
FTA.RTM. Elute paper (GE Healthcare). The solid medium includes
chemicals that lyze the biological sample (e.g., tissues or cells)
and/or preserve the genetic material on the solid medium. Indeed,
the solid medium and composition of chemicals may be as described
in greater detail in U.S. Pat. No. 5,976,572, entitled "Dry Solid
Medium for Storage and Analysis of Genetic Material," and U.S. Pat.
No. 5,985,327, entitled "Solid Medium and Method for DNA Storage,"
both of which are hereby incorporated by reference in their
entirety for all purposes. For example, the solid medium may
include a weak base (e.g., tris-hydroxymethyl methane (tris)),
chelating agent (e.g., ethylene diamine tetracetic acid (EDTA)),
anionic surfactant or detergent (e.g., sodium dodecyl sulphate
(SDS)), and/or uric acid or urate salt. Upon application to the
solid medium, the chemicals lyse the biological sample and denature
proteins. In addition, the chemicals inactivate nucleases and
pathogens to allow for the preservation and long term storage of
the genetic material. Any liquid within the applied sample
evaporates after application. Drying of the sample on the solid
medium (block 16) occurs after application. For example, the solid
medium containing the sample may dry overnight in a desiccator. In
certain embodiments, the solid medium containing the sample may be
encased in a protective material (e.g., a plastic case) to further
preserve the genetic material.
[0019] Upon obtaining the solid medium containing the desired dry
sample, a portion of the solid medium containing the sample is
removed for electroeluting the genetic material (e.g., DNA) from
this portion (block 18). In certain embodiments, the entire sample
may be used. Prior to electroelution, the portion of the solid
medium containing the biological sample may be rinsed to remove the
chemicals (block 20). In certain embodiments, rinsing the portion
of the sample-containing solid medium includes soaking the solid
medium portion in a buffer solution or flowing buffer through or
across the solid medium portion. In certain embodiments, the buffer
solution includes an alkaline buffer solution (e.g., pH 8.0)
including at least tris and EDTA (e.g., T.E.). For example, the
solid medium portion with the sample may be soaked one or more
times for a fixed time (e.g., 5 minutes) in the alkaline buffer
solution. In some embodiments, the buffer solution includes
Whatman.RTM. FTA.RTM. purification reagent from GE Healthcare. For
example, the solid medium portion with the sample may be soaked one
or more times for a fixed time (e.g., 5 minutes) in the FTA.RTM.
purification reagent. In other embodiments, both the alkaline
buffer solution and the FTA.RTM. purification reagent may be used
to rinse the sample-containing solid medium portion. For example,
the sample-containing solid medium portion may be soaked for a
fixed time (e.g., 5 minutes each soaking) twice in the alkaline
buffer solution and for a fixed time (e.g., 5 minutes each soaking)
twice in the FTA.RTM. purification reagent. In alternative
embodiments, rinsing the portion of the sample-containing solid
medium includes soaking the solid medium portion in water or
flowing water through or across the solid medium portion. For
example, the solid medium portion with the sample may be soaked one
or more times for a fixed time (e.g., 5 minutes) in the water. In
certain implementations of electroelution (e.g., electroelution in
dialysis tubing), rinsing of the sample-containing solid medium may
not be necessary.
[0020] Also, prior to electroeluting genetic material from the
sample-containing solid medium portion, the solid medium portion
with the sample may be treated with enzymes (block 22) to reduce or
eliminate non-DNA contaminants (e.g., proteins, lipids,
carbohydrates, etc.). For example, an enzymatic solution may
include hydrolytic enzymes such as proteases, lipases, and/or
glycoside hydrolases.
[0021] Further, prior to electroeluting genetic material from the
sample-containing solid medium portion, the genetic material (e.g.,
DNA) may be repaired while fixed in position on the solid medium
(block 24). Genetic material, such as DNA, stored on the solid
medium may include nicks (i.e., absence of phosphodiester bond
between adjacent nucleotides) or abasic sites (also called AP
sites, i.e., absence of a purine or pyrimidine base in a nucleotide
while retaining the integrity of the phosphodiester ribose
backbone) introduced via a fixing agent (e.g., formalin) in
pre-processed samples or via other means. In certain embodiments,
repairing the genetic material includes applying a solution
containing at least DNA polymerase (e.g., E. coli DNA polymerase I)
and DNA ligase (e.g., T4 DNA ligase or a bacterial DNA ligase) to
repair the nicked damage. For example, the DNA polymerase includes
DNA polymerase activity in addition to both 3' to 5' exonuclease
activity to mediate proofreading and 5' to 3' exonuclease activity
to mediate nick translation during DNA repair. DNA polymerase
requires dNTP's. The DNA ligase includes enzymatic activity to form
a phosphodiester bond between adjacent nucleotides. DNA ligase
requires either rATP or NAD. The sample-containing solid medium
portion may be incubated with the DNA repair solution at 37.degree.
C. for 30 minutes, and then incubated at 65.degree. C. for 20
minutes. In other embodiments, the DNA repair solution may include
other DNA repair enzymes with similar or different DNA repair
mechanisms. For example, AP endonuclease (e.g., E. coli
endonuclease IV) can also be used to remove abasic sites. The
abasic site can be cleaved by an AP endonuclease, leaving 3'
hydroxyl and 5' deoxyribosephosphate termini. This structure can be
subsequently repaired by the combined action of DNA polymerase and
DNA ligase.
[0022] After obtaining the sample-containing solid medium, the
genetic material is directly electroeluted from the solid medium to
a subsequent medium (block 26). In certain embodiments, the
sample-containing solid medium portion may be disposed directly
into a well of an electrophoresis gel (e.g., agarose gel), the well
sealed with agarose, and the genetic material directly
electroeluted into the electrophoresis gel (FIGS. 2 and 3). In
other embodiments, the genetic material may be electroeluted into a
solution. Electroelution into a solution may occur in a variety of
ways. For example, D-tube.TM. dialyzers (Merck Biosciences Ltd.),
dialysis cassettes or tubing, Whatman.RTM. Elutrap.RTM.
Electroelution Systems (GE Healthcare), or other devices may be
used to electroelute the genetic material directly from the solid
medium into solution. In further embodiments, the genetic material
may be directly electroeluted from the solid medium onto a capture
surface. The capture surface may be on a blotting membrane (e.g.,
diethylaminoethyl cellulose (DEAE)).
[0023] Following electroelution, the extracted genetic material may
be analyzed (block 28). The genetic material extracted from the
sample-containing solid medium includes high molecular weight DNA
optimally of at least 10 kilobases with few nicks present. Indeed,
the DNA extracted in accordance with the present approaches may
approach 40 kilobases. In particular, DNA extraction, according to
the above embodiment, occurs in the absence of detergents. If
detergent were used in extracting the DNA from the solid medium,
additional steps would typically be performed to remove the
detergent before any subsequent analysis of the extracted DNA could
occur. In addition, the extraction of DNA at high temperatures
(e.g., 95.degree. C.), which fragments DNA, is avoided in the above
embodiment. Thus, high molecular weight DNA with minimal
fragmentation is made available for analysis with minimal work. The
extracted DNA may be used in a variety of analyses including
polymerase chain reaction (PCR), single-nucleotide polymorphism
analysis, real-time PCR, and other downstream uses of the DNA.
[0024] FIGS. 2 and 3 illustrate examples of the electroelution of
DNA directly from the sample-containing solid medium into
electrophoresis gels. FIG. 2 depicts a SYBR.RTM. Gold (Invitrogen)
stained electrophoresis gel of DNA electroeluted from solid media
using pulsed-field gel electrophoresis. Electrophoresis was in a 1%
agarose gel, 0.5.times.TE, ph 8.0 for 18 hours at 6 V/cm with a
switch angle of 120.degree. and switch time from 50-90 seconds. 20
.mu.L of Jurkat cells (suspended at 2.times.10.sup.6 cells/mL) were
applied to either Whatman.RTM. FTA.RTM. or FTA.RTM. Elute paper and
dried as described above. Portions of the dried samples of Jurkat
cells were removed from the FTA.RTM. or FTA.RTM. Elute paper and
washed according to a variety of methods indicated below. In
addition, some of the samples were eluted, prior to loading, into
95.degree. C. water. Wet paper portions including the samples of
Jurkat cells were placed directly into the wells of the
electrophoresis gel and sealed with agarose. The samples
electroeleuted into the electrophoresis gel, shown in FIG. 2, are
as follows:
[0025] Lane 1: Saccharomyces cerevisiae chromosomal DNA size marker
(BioRad); Lane 3: FTA.RTM. paper soaked for 5 minutes in TE, ph
8.0; Lane 5: FTA.RTM. paper soaked for 5 minutes in FTA.RTM.
purification reagent (two times) and soaked for 5 minutes in TE
buffer, ph 8.0 (two times); Lane 7: FTA.RTM. Elute paper soaked in
water for 5 minutes; Lane 9: FTA.RTM. Elute paper soaked in water
for 5 minutes, then vortexed for 15 seconds; Lane 11: FTA.RTM.
Elute paper soaked in water for 5 minutes, then eluted into
95.degree. C. water for 25 minutes; Lane 12: FTA.RTM. Elute paper
soaked in water for 5 minutes, then eluted into 95.degree. C. water
for 25 minutes, and vortexed for 60 seconds; and Lane 14:
Saccharomyces cerevisiae chromosomal DNA size marker (BioRad).
After pulsed-field gel electrophoresis, the DNA was stained with
SYBR.RTM. Gold and the gel was imaged on a Typhoon.TM. Imager
fluorescent scanner.
[0026] The results in FIG. 2 demonstrate the electroelution of high
molecular weight DNA from the samples of Jurkat cells directly from
the solid medium (i.e., FTA.RTM. or FTA.RTM. Elute paper) into the
electrophoresis gel. The electroeluted DNA is less than 225
kilobases but estimated to be approximately 40 kilobases. FIG. 2
also demonstrates the absence of high molecular weight DNA when
attempting to elute the DNA under high temperature conditions
(e.g., 95.degree. C.). Thus, in order to electroelute high
molecular weight DNA from the solid medium directly into the
electrophoresis gel only a simple rinse in a buffer solution (e.g.,
TE buffer or FTA.RTM. purification reagent) or water is needed.
[0027] FIG. 3 illustrates similar results using alkaline gel
electrophoresis. FIG. 3 depicts a SYBR.RTM. Gold stained
electrophoresis gel of DNA electroeluted from solid media using
alkaline standard gel electrophoresis. Electrophoresis was in a 1%
agarose gel, 30 mM NaOH, 1 mM EDTA, for 2 hours at 150 mA. During
electrophoresis the gel was covered in a glass plate to prevent
diffusion out of the gel. As above, 20 .mu.L of Jurkat cells
(suspended at 2.times.10.sup.6 cells/mL) were applied to
Whatman.RTM. FTA.RTM. paper and dried as described above. Portions
of the dried samples of Jurkat cells were removed from the FTA.RTM.
paper and washed according to a variety of methods indicated below.
Wet paper portions including the samples of Jurkat cells were
placed directly into the wells of the electrophoresis gel and
sealed with agarose. The samples electroeleuted into the
electrophoresis gel, shown in FIG. 3, with lanes 1-8 are as
follows:
[0028] Lane 1: FTA.RTM. paper soaked for 5 minutes in TE, ph 8.0;
Lane 3: FTA.RTM. paper soaked for 5 minutes in FTA.RTM.
purification reagent (two times) and soaked for 5 minutes in TE
buffer, ph 8.0 (two times); Lane 5: purified human DNA (Male,
Applied Biosystems); and Lane 7: 1 kb ladder (New England Biolabs).
After electrophoresis, the gel was neutralized in a solution
containing 1M Tris-HCL (pH=7.7) and 1.5M NaCl for 30 minutes. The
DNA was stained with SYBR.RTM. Gold and the gel was imaged on a
Typhoon.TM. Imager fluorescent scanner.
[0029] The results in FIG. 3 also demonstrate the electroelution of
high molecular weight DNA from the samples of Jurkat cells directly
from the solid medium (i.e., FTA.RTM. or FTA.RTM. Elute paper) into
the electrophoresis gel. The electroeluted DNA is greater than 10
kilobases. Thus, as above, in order to electroelute high molecular
weight DNA from the solid medium directly into the electrophoresis
gel only a simple rinse in a buffer solution (e.g., TE buffer or
FTA.RTM. purification reagent) or water is needed. The fact that
the large DNA is also present on an alkaline gel indicates that the
electroeluted DNA contains few nicks. As the DNA in an alkaline gel
is single stranded, any nicks in the backbone would result in DNA
fragments.
[0030] As discussed above, the electroelution of DNA directly from
the solid medium also applies to fixed cells or tissues. FIG. 4 is
a flow chart illustrating a method 30 for extracting genetic
material (e.g., DNA) from a fixed tissue sample stored on a solid
medium. Although the method 30 is discussed in terms of fixed
tissues samples, the fixed samples may also include fixed cells
(e.g., derived from tissues or cell culture lines). To begin,
tissue is collected from a source (e.g., a mouse or human) (block
32). Following collection of the tissue, the tissue sample is fixed
with a fixing agent (block 34) such as formalin, paraformaldehyde,
or other fixing agent, according to methods know to the art. During
fixation, the genetic material (e.g., DNA) forms cross-links with
proteins. In certain embodiments, such as the embedding of the
fixed tissue sample in paraffin, the fixed tissue samples may be
dehydrated (block 36) in a series of ethanol washes with the
ethanol sequentially increasing in concentration. The dehydrated
samples may then be washed in xylene and embedded in paraffin.
[0031] After obtaining the desired fixed tissue sample, if the
sample was previously dehydrated, then the sample is rehydrated
(block 38) in a series of ethanol washes sequentially decreasing in
concentration. For example, the fixed tissue sample is rehydrated
sequentially for 5 minutes each in 100% ethanol, 75% ethanol, 50%
ethanol, 25% ethanol, and distilled water (or T.E.). Following
rehydration of the fixed tissue sample, the rehydrated sample may
be incubated overnight in 1 M potassium thiocyanate. The fixed
tissue sample, rehydrated or not, may be lyzed (block 40), e.g.,
with a protease, prior to application to the solid medium. For
example the fixed tissue sample may be lyzed in a digest buffer
solution including Proteinase K (0.5 mg/mL), 50 mM Tris at pH 7.4,
10 mM EDTA, 0.5% SDS, and 50 mM NaCl at 55.degree. C. for at least
three hours. In certain embodiments, the fixed tissue sample may be
lysed via chemicals present on the solid medium as described
above.
[0032] Application of at least a portion of the desired fixed
tissue sample to the solid medium then occurs (block 42). The
sample of fixed is applied to the solid medium via such methods as
rubbing the sample against the media, pressing the sample against
the media, etc. The solid medium is as described above. The solid
medium includes chemicals to preserve the genetic material on the
solid medium. In certain embodiments, where lyzing of the fixed
tissue is desired subsequent to application of the sample, the
solid medium includes chemicals that lyze the fixed tissue sample
as described above. Any liquid within the applied tissue sample
evaporates after application. Drying of the sample on the solid
medium (block 44) occurs after application. For example, the solid
medium containing the sample may dry overnight in a desiccator. In
certain embodiments, the solid medium containing the sample may be
encased in a protective material (e.g., a plastic film) to further
preserve the genetic material.
[0033] Upon obtaining the solid medium containing the desired dry,
fixed tissue sample, a portion of the solid medium containing the
sample is removed for electroeluting the genetic material (e.g.,
DNA) from this portion. In certain embodiments, the entire sample
may be used. Prior to electroelution, the portion of the solid
medium containing the sample may be rinsed to remove the chemicals
(block 46). In certain embodiments, rinsing the portion of the
sample-containing solid medium includes soaking the solid medium
portion in a buffer solution. As described above, the buffer
solution may include an alkaline buffer solution (e.g., TE) or
FTA.RTM. purification reagent. For example, the sample-containing
solid medium portion may be soaked for a fixed time (e.g., 5
minutes each soaking) twice in the FTA.RTM. purification reagent
and for a fixed time (e.g., 5 minutes each soaking) twice in the
alkaline buffer solution. However, in certain embodiments, the
rinses may occur only in the alkaline buffer solution, only in the
FTA.RTM. purification reagent, or only in water as described above.
As previously mentioned, in certain embodiments of electroelution
(e.g., electroelution in dialysis tubing), rinsing of the
sample-containing solid medium may not be necessary.
[0034] As mentioned above, prior to electroeluting genetic material
from the sample-containing solid medium portion, the solid medium
portion with the fixed sample may be treated with enzymes (block
48) to reduce or eliminate non-DNA contaminants (e.g., proteins,
lipids, carbohydrates, etc.). For example, an enzymatic solution
may include hydrolytic enzymes such as proteases, lipases, and/or
glycoside hydrolases.
[0035] In addition, prior to electroeluting, the cross-linking
between the genetic material and protein may be reversed (block 50)
subsequent to applying the fixed tissue sample to the solid medium.
For example, a crosslink repair buffer including a primary amine
(e.g., bicine, pH 8.5) or other nucleophile with a pH higher than
7.0 (preferably with a pH between 7.5-10). To reverse the
cross-links, the sample-containing solid medium portion is
incubated in the crosslink repair buffer (e.g. at 65.degree. C. for
20 hours). The primary amine or nucleophile reacts with the portion
of the crosslink that comes from the aldehyde that originally
formed the cross-links (between the genetic material and/or the
protein) and reverses these cross-links. Alternatively, a
sulfhydryl reagent can be used in place of amine, which will also
react with the portion of the crosslink that is derived from the
aldehyde. This reaction occurs more rapidly than amine-based
nucleophile when performed at a pH below 7. In certain embodiments,
as mentioned above, the reversal of the cross-linking may occur
prior to application of the fixed tissue sample to the solid
medium. Further, prior to electroeluting genetic material from the
sample-containing solid medium portion, the genetic material (e.g.,
DNA) may be repaired while fixed in position on the solid medium
(block 52) as described above.
[0036] After obtaining the solid medium portion with the fixed
tissue sample, the genetic material is directly electroeluted from
the solid medium to a subsequent medium (block 54) as described
above to obtain high molecular weight DNA of at least 10 kilobases.
The extracted genetic material may then be analyzed (block 56) in a
variety of ways (e.g., PCR) as demonstrated in FIG. 5.
[0037] FIG. 5 illustrates the quality of the DNA extracted from
formalin-fixed tissue samples on solid media following crosslink
reversal and DNA repair as described above. FIG. 5 depicts a
SYBR.RTM. Gold stained electrophoresis gel, using a vertical
polyacrylamide gel electrophoresis (PAGE) system, of multiplex PCR
amplification of DNA that has been extracted from a human prostate
sample fixed in formalin and applied to Whatman.RTM. FTA.RTM. paper
as described above. Electrophoresis was in a 6% TBE
(Tris-Borate-EDTA)-UREA gel and 1.times.TBE for 40 minutes at 160V.
The fixed human prostate sample was processed as described above
(e.g., rehydrated or lysed) and applied to the FTA.RTM. paper. The
samples on the FTA.RTM. paper were then subjected to crosslink
reversal and/or DNA repair (with or without endonuclease IV (Endo
IV)). After crosslink reversal and/or DNA repair, the solid media
is added directly to a PCR reaction containing 3 sets of PCR
primers. The sequences of the primers are as follows: 5'
CTCACCCTGAAGTTCTCAGG 3' (primer 1), 5' CCTCAAGGGCACCTTTGCCA 3'
(primer 2), 5' GTCTACCCTTGGACCCAG 3' (primer 3), and 5'
GATGAAGTTGGTGGTGAGG 3' (primer 4). The PCR primers are designed to
produce products of 78 base pairs (primers 1 and 2), 218 base pairs
(primers 1 and 3), and 380 base pairs (primers 1 and 4) if high
molecular weight human DNA is present. Amplification conditions
were as follows: step 1: 95.degree. C. for 7 minutes; step 2 (for
15 cycles): 95.degree. C. for 1 minute, 69.degree. C. for 1 minute,
and 72.degree. C. for 1 minute; step 3 (for 15 cycles): 95.degree.
C. for 1 minute, 63.degree. C. for 1 minute, and 72.degree. C. for
1 minute; step 4: 72.degree. C. for 10 minutes; and then step 5:
4.degree. C. The samples shown in FIG. 5 are as follows:
[0038] Lane 1: low molecular weight DNA ladder (New England
Biolabs); Lane 3: purified human DNA (Male, Applied Biosystems);
Lane 4: no DNA control; Lane 5: purified human DNA treated with
repair reaction (without Endo IV); Lane 6: purified human DNA
treated with repair reaction (with Endo IV); Lane 8: formalin-fixed
human prostate sample on FTA.RTM. paper with crosslink reversal and
repair reactions (without Endo IV); Lane 9: formalin-fixed human
prostate sample on FTA.RTM. paper with repair reaction only (with
Endo IV); Lane 10: formalin-fixed human prostate sample on FTA.RTM.
paper with crosslink reversal and repair reactions (with Endo IV);
Lane 11: formalin-fixed human prostate sample on FTA.RTM. paper
with repair reaction only (with Endo IV); Lane 12: formalin-fixed
human prostate sample on FTA.RTM. paper with crosslink reversal
reaction only; Lane 13: formalin-fixed human prostate sample on
FTA.RTM. paper without crosslink reversal and repair reactions; and
Lane 15: low molecular weight DNA ladder. After PAGE gel
electrophoresis, the DNA was stained with SYBR.RTM. Gold and the
gel was imaged on a Typhoon.TM. Imager fluorescent scanner.
[0039] The results in FIG. 5 demonstrate the appearance of the
higher molecular weight PCR products (218 base pairs and 380 base
pairs) when the sample on the FTA.RTM. paper has been treated to
reverse cross-links and to repair DNA (Lane 10) as described above.
All other combinations of treatment fail to produce these higher
molecular weight PCR products. While the DNA in this experiment has
not been eluted from the FTA.RTM. paper prior to PCR, it can be
appreciated that if the repaired sample still located on the
FTA.RTM. paper can be used for PCR amplification of higher
molecular weight targets, this result in combination with the
ability to elute DNA from FTA.RTM. paper would allow for a greater
range of DNA interrogation experiments to be performed on such
samples.
[0040] FIGS. 6 and 7 illustrate the benefit of rehydrating fixed
samples prior to electroelution from the FTA paper. FIGS. 6 and 7
depict a SYBR.RTM. Gold stained electrophoresis gel of DNA
electroeluted from solid media using native gel electrophoresis.
Electrophoresis was in a 0.8% agarose TBE gel for 80 minutes at 110
volts. The samples shown in FIG. 6 are as follows: Lane 1: 1 kb DNA
ladder (New England Biolabs); Lane 2: 0.5 mm slice of
formalin-fixed human prostate sample applied directly to FTA.RTM.
paper, dried, and rinsed in water and electroeluted; Lane 3: 20
.mu.L of Jurkat cells (suspended at 2.times.10.sup.6 cells/mL) were
applied to FTA.RTM. paper, dried, and electroeluted; and Lane 4:
purified human DNA (Male, Applied Biosystems). The electroeluted
samples shown in FIG. 7 are as follows: Lane 1: purified human DNA
(Male, Applied Biosystems); Lane 2: 20 .mu.L of Jurkat cells
(suspended at 2.times.10.sup.6 cells/mL) were applied to FTA.RTM.
paper, and dried; Lane 3: an approximately 0.5 mm slice of
formalin-fixed human prostate sample was rehydrated as described
above and applied to FTA.RTM. paper, dried, and rinsed in water;
and Lane 4: approximately 0.5 mm of formalin-fixed human prostate
sample was scraped off the paraffin block as a series of flakes,
then rehydrated as described above, applied to FTA.RTM. paper,
dried, and rinsed in water. After TBE-gel electrophoresis, the DNA
was stained with SYBR.RTM. Gold and the gel was imaged on a
Typhoon.TM. Imager fluorescent scanner.
[0041] The results in FIGS. 6 and 7, in particular a comparison
between lane 2 of FIG. 6 and lanes 3 and 4 of FIG. 7, clearly
indicate that the rehydration process aids in the retrieval of DNA
from fixed samples. The inclusion of steps to rehydrate tissue
samples that have been dehydrated in preparation for fixation and
for paraffin embedding increases the yield of genetic material from
the fixed sample upon electroelution.
[0042] FIG. 8 illustrates the effect of DNA repair on the molecular
weight of DNA obtained from fixed samples that have been
electroeluted from FTA paper. FIG. 8 depicts a SYBR.RTM. Gold
stained electrophoresis gel of DNA electroeluted from solid media
using native gel electrophoresis. Electrophoresis was in a 0.8%
agarose TBE gel for 80 minutes at 110 volts. Samples from
formalin-fixed human lung (ILS 19279-A04) were applied to FTA.RTM.
paper as described above. Cross-links were repaired in 100 mM
bicine pH 9.5 and/or treated with a DNA repair reaction in certain
samples as described above. The samples were stopped at different
stages of the reactions. The samples shown in FIG. 8 are as
follows:
[0043] Lane 1: 1 kb DNA ladder (New England Biolabs); Lane 2: post
rehydration (i.e., ethanol and T.E. washes); Lane 3: post FTA.RTM.
purification reagent washes; Lane 4: post Proteinase K digestion;
Lane 5: post crosslink reversal reaction conducted at 65.degree.
C.; Lane 6: post crosslink reversal reaction conducted at room
temperature; Lane 7: post DNA precipitation (plus crosslink
reversal reaction conducted at 65.degree. C.); Lane 8: post DNA
precipitation (plus crosslink reversal reaction conducted at room
temperature); Lane 9: post DNA repair reaction (plus crosslink
reversal reaction conducted at 65.degree. C.); and Lane 10: post
DNA repair reaction (plus crosslink reversal reaction conducted at
room temperature).
[0044] The results in FIG. 8 demonstrate the appearance of high
molecular weight material in lanes 9 and 10 (indicated by the
arrow) only after the DNA repair reaction has been used to repair
the DNA that is still attached to the FTA.RTM. paper. The DNA is
repaired while it is still attached to the FTA.RTM. paper, before
the DNA has been subjected to the forces involved in elution of the
DNA from the FTA.RTM. paper and the forces that are applied to DNA
in solution. This prevents strands of DNA which contain nicks that
are located relatively near each other, but on opposite sides, from
separating. By repairing these highly nicked and gapped strands,
they are prevented from becoming double stranded breaks, and the
resulting product is higher molecular weight DNA. The increase in
molecular weight provides evidence that the DNA repair reaction was
able to repair nicks and gaps in the DNA.
[0045] Technical effects of the disclosed embodiments include
extracting genetic material (e.g., high molecular weight DNA of at
least 10 kilobases) directly from the solid medium via
electroelution. The extraction of genetic material occurs in the
absence of detergent, thus eliminating additional steps necessary
for the removal of detergent prior to any subsequent analysis of
the genetic material. Also, the extraction of genetic material
avoids the use of high temperatures (e.g., 95.degree. C.), thus
allowing the extraction of minimally fragmented DNA. The extraction
of genetic material, via electroelution directly from the solid
medium, applies to both fixed and non-fixed samples. Further, the
genetic material may be processed while still on the solid medium.
For example, genetic material may be repaired and/or cross-links
reversed in fixed cells between the genetic material and protein.
Thus, the solid medium provides a single platform for the
extraction of genetic material and related processes (e.g., DNA
repair) minimizing the work for the user.
[0046] This written description uses examples to disclose the
invention, including the best mode, and also to enable any person
skilled in the art to practice the invention, including making and
using any devices or systems and performing any incorporated
methods. The patentable scope of the invention is defined by the
claims, and may include other examples that occur to those skilled
in the art. Such other examples are intended to be within the scope
of the claims if they have structural elements that do not differ
from the literal language of the claims, or if they include
equivalent structural elements with insubstantial differences from
the literal languages of the claims.
Sequence CWU 1
1
4120DNAHomo sapiens 1ctcaccctga agttctcagg 20220DNAHomo sapiens
2cctcaagggc acctttgcca 20318DNAHomo sapiens 3gtctaccctt ggacccag
18419DNAHomo sapiens 4gatgaagttg gtggtgagg 19
* * * * *