U.S. patent application number 13/302957 was filed with the patent office on 2012-06-07 for production of fatty acids & derivatives thereof.
This patent application is currently assigned to LS9, INC.. Invention is credited to David Berry, Shane Brubaker, George Church, Stephen B. Del Cardayre, Lisa Friedman, Zhihao Hu, Jay D. KEASLING, Andreas Schirmer, Chris Somerville.
Application Number | 20120142979 13/302957 |
Document ID | / |
Family ID | 42782392 |
Filed Date | 2012-06-07 |
United States Patent
Application |
20120142979 |
Kind Code |
A1 |
KEASLING; Jay D. ; et
al. |
June 7, 2012 |
PRODUCTION OF FATTY ACIDS & DERIVATIVES THEREOF
Abstract
Compositions and methods for production of fatty alcohols using
recombinant microorganisms are provided as well as fatty alcohol
compositions produced by such methods.
Inventors: |
KEASLING; Jay D.; (Berkeley,
CA) ; Hu; Zhihao; (South San Francisco, CA) ;
Somerville; Chris; (Berkeley, CA) ; Church;
George; (Brookline, MA) ; Berry; David;
(Cambridge, MA) ; Friedman; Lisa; (San Francisco,
CA) ; Schirmer; Andreas; (South San Francisco,
CA) ; Brubaker; Shane; (El Cerrito, CA) ; Del
Cardayre; Stephen B.; (South San Francisco, CA) |
Assignee: |
LS9, INC.
South San Francisco
CA
|
Family ID: |
42782392 |
Appl. No.: |
13/302957 |
Filed: |
November 22, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12278957 |
Apr 20, 2010 |
|
|
|
PCT/US07/11923 |
May 18, 2007 |
|
|
|
13302957 |
|
|
|
|
60801995 |
May 19, 2006 |
|
|
|
60908547 |
Mar 28, 2007 |
|
|
|
60802016 |
May 19, 2006 |
|
|
|
Current U.S.
Class: |
568/909.5 ;
435/157; 435/252.3; 435/252.33; 435/252.34; 435/252.35; 435/254.21;
568/840 |
Current CPC
Class: |
C10L 1/026 20130101;
Y02E 50/10 20130101; C07C 31/125 20130101; C12P 7/6436 20130101;
C12P 7/649 20130101; C12P 7/6463 20130101; C12P 7/04 20130101; C10L
1/328 20130101; C07C 33/02 20130101 |
Class at
Publication: |
568/909.5 ;
568/840; 435/157; 435/252.33; 435/252.3; 435/252.35; 435/254.21;
435/252.34 |
International
Class: |
C12P 7/04 20060101
C12P007/04; C12N 1/19 20060101 C12N001/19; C12N 1/21 20060101
C12N001/21; C07C 33/025 20060101 C07C033/025; C07C 31/125 20060101
C07C031/125 |
Claims
1. A method of producing a fatty alcohol composition in a
recombinant microorganism, comprising the steps of: (a) genetically
engineering a microorganism to comprise a nucleic acid sequence
encoding a polypeptide having acetyl-CoA carboxylase activity (EC
6.4.1.2), and a nucleic acid sequence encoding a polypeptide having
fatty alcohol forming activity, resulting in a recombinant
microorganism; (b) culturing the recombinant microorganism in a
culture medium containing a carbon source under conditions
effective to overexpress the acetyl-CoA carboxylase polypeptide and
the polypeptide having fatty alcohol forming activity, wherein a
fatty alcohol composition is produced by said cultured recombinant
microorganism; and (c) optionally recovering the fatty alcohol
composition from the cell culture.
2. The method of claim 1, further comprising genetically
engineering said microorganism to comprise at least one nucleic
acid sequence encoding a polypeptide having thioesterase activity,
wherein said thioesterase polypeptide is expressed.
3. The method of claim 1, wherein said polypeptide having fatty
alcohol forming activity is (i) a fatty alcohol forming acyl-CoA
reductase (FAR, EC 1.1.1.*), or (ii) an acyl-CoA reductase (EC
1.2.1.50) and an alcohol dehydrogenase (EC 1.1.1.1).
4. The method of claim 2, wherein said polypeptide having fatty
alcohol forming activity is (i) a fatty alcohol forming acyl-CoA
reductase (FAR, EC 1.1.1.*), or (ii) an acyl-CoA reductase (EC
1.2.1.50) and an alcohol dehydrogenase (EC 1.1.1.1).
5. The method of claim 4, wherein said polypeptide having fatty
alcohol forming activity is a fatty alcohol forming acyl-CoA
reductase.
6. The method of claim 1, wherein said the fatty alcohol
composition comprises one or more of saturated or unsaturated C12,
C14 or C16 fatty alcohols.
7. A recombinant microorganism comprising: (a) a nucleic acid
sequence encoding a branched chain alpha-keto acid dehydrogenase 60
(Bkd) operon including branched-chain .alpha.-keto acid
decarboxylase .alpha. and .beta. subunits (E1.alpha./.beta.), a
dihydrolipoyl transacylase component (E2), and a dihydrolipoyl
dehydrogenase component (E3); and (b) a nucleic acid sequence
encoding a .beta.-ketoacyl-ACP synthase III protein (FabH, EC
2.3.1.41) with specificity for a branched chain acyl CoA molecule,
wherein at least one nucleic acid sequence according to (a) or (b)
is exogenous to the recombinant microorganism and wherein the
recombinant microorganism produces a branched fatty acid derivative
when cultured in the presence of a carbon source under conditions
effective to express the nucleic acid sequences according to (a)
and (b).
8. The recombinant microorganism according to claim 7, wherein the
nucleic acid sequence encoding the FabH protein with specificity
for a branched chain acyl CoA molecule is exogenous to the
recombinant microorganism and the expression of a FabH endogenous
to the recombinant microorganism and lacking specificity for a
branched chain acyl CoA molecule is attenuated.
9. The recombinant microorganism according to claim 7, further
comprising a nucleic acid sequence encoding at least one
polypeptide having thioesterase activity.
10. The recombinant microorganism according to claim 9, further
comprising a nucleic acid sequence encoding a polypeptide having
fatty alcohol forming activity.
11. The recombinant microorganism according to claim 10, wherein
said polypeptide having fatty alcohol forming activity is (i) a
fatty alcohol forming acyl-CoA reductase (FAR, EC 1.1.1.*), or (II)
acyl-CoA reductases (EC 1.2.1.50) and alcohol dehydrogenase (EC
1.1.1.1).
12. The recombinant microorganism according to claim 11, wherein
said polypeptide having fatty alcohol forming activity is a fatty
alcohol forming acyl-CoA reductase.
13. A recombinant microorganism culture, comprising: the
recombinant microorganism according to claim 11 and a fermentation
medium comprising a carbon source.
14. A branched fatty alcohol composition produced by the
recombinant microorganism culture according to claim 13, wherein
said fatty alcohol composition comprises one or more of saturated
or unsaturated C12, C14 and C16 fatty alcohols.
15. A branched fatty alcohol composition obtained from the
supernatant of the recombinant microorganism culture of claim 13
wherein the fatty alcohol composition comprises C.sub.12 and
C.sub.14 fatty alcohols.
16. A branched fatty alcohol composition obtained from the
supernatant of the recombinant microorganism culture of claim 13,
wherein the fatty alcohol composition comprises unsaturated fatty
alcohols.
17. A branched fatty alcohol composition obtained from the
supernatant of the recombinant microorganism culture of claim 13,
wherein the fatty alcohol composition comprises saturated fatty
alcohols.
18. A method of producing a branched fatty alcohol composition in a
recombinant microorganism, comprising the steps of: (a) obtaining a
genetically engineered recombinant microorganism according to claim
11; (b) culturing the recombinant microorganism in a culture medium
containing a carbon source under conditions effective to express
said: (i) Bkd operon; (ii) FabH; (iii) a nucleic acid sequence
encoding a polypeptide having fatty alcohol forming activity; and
(iv) nucleic acid sequence encoding a polypeptide having
thioesterase activity; and (c) optionally recovering the branched
fatty alcohol composition from the cell culture.
19. The method of claim 18, wherein said polypeptide having fatty
alcohol forming activity is (i) a fatty alcohol forming acyl-CoA
reductase (FAR, EC 1.1.1.*), or (II) an acyl-CoA reductase (EC
1.2.1.50) and an alcohol dehydrogenase (EC 1.1.1.1).
20. The recombinant microorganism according to claim 19, wherein
said polypeptide having fatty alcohol forming activity is a fatty
alcohol forming acyl-CoA reductase.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of copending U.S. patent
application Ser. No. 12/278,957, filed Apr. 20, 2010, as the U.S.
national phase of Patent Cooperation Treaty Application No.
PCT/US2007/11923, filed May 18, 2007, which claims benefit to U.S.
Provisional Application Nos. 60/908,547 filed Mar. 28, 2007; U.S.
Provisional Application No. 60/801,995 filed May 19, 2006, and U.S.
Provisional Application No. 60/802,016 filed May 19, 2006, and, all
of which are herein incorporated by reference.
INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY
[0002] Incorporated by reference in its entirety herein is a
computer-readable nucleotide/amino acid sequence listing submitted
concurrently herewith and identified as follows: One 80,354 Byte
ASCII (Text) file named "PCT_SeqLstgAsFiled.sub.--05.18.07" created
on May 18, 2007. It is understood that the Patent and Trademark
Office will make the necessary changes in application number and
filing date for the instant application.
FIELD
[0003] Compositions and methods for production of fatty alcohols
using recombinant microorganisms e are provided as well as fatty
alcohol compositions produced by such methods.
BACKGROUND
[0004] Developments in technology have been accompanied by an
increased reliance on fuel sources and such fuel sources are
becoming increasingly limited and difficult to acquire. With the
burning of fossil fuels taking place at an unprecedented rate, it
has likely that the world's fuel demand will soon outweigh the
current fuel supplies.
[0005] As a result, efforts have been directed toward harnessing
sources of renewable energy, such as sunlight, water, wind, and
biomass. The use of biomasses to produce new sources of fuel which
are not derived from petroleum sources, (i.e. biofuel) has emerged
as one alternative option. Biofuel (biodiesel) is a biodegradable,
clean-burning combustible fuel made of long chain alkanes and
esters. Biodiesel can be used in most internal combustion diesel
engines in either a pure form, which is referred to as "neat"
biodiesel, or as a mix in any concentration with regular petroleum
diesel. Current methods of making biodiesel involve
transesterification of triacylglycerides (mainly vegetable oil)
which leads to a mixture of fatty acid esters and the unwanted side
product glycerin, thus, providing a product that is heterogeneous
and a waste product that causes economic inefficiencies.
SUMMARY
[0006] Disclosed herein are recombinant microorganisms that are
capable of synthesizing products derived from the fatty acid
biosynthetic pathway (fatty alcohols), and optionally releasing
such products into the fermentation broth. Such fatty alcohols are
useful, inter alia, specialty chemicals. These specialty chemicals
can be used to make additional products, such as nutritional
supplements, polymers, paraffin replacements, and personal care
products.
[0007] The recombinant microorganisms disclosed herein can be
engineered to yield various fatty alcohol compositions.
[0008] In one example, the disclosure provides a method for
modifying a microorganism so that it produces, and optionally
releases, fatty alcohols generated from a renewable carbon source.
Such microorganisms are genetically engineered, for example, by
introducing an exogenous DNA sequence encoding one or more proteins
capable of metabolizing a renewable carbon source to produce, and
in some examples secrete, a fatty alcohol composition. The modified
microorganisms can then be used in a fermentation process to
produce useful fatty alcohols using the renewable carbon source
(biomass) as a starting material. In some examples, an existing
genetically tractable microorganism is used because of the ease of
engineering its pathways for controlling growth, production and
reducing or eliminating side reactions that reduce biosynthetic
pathway efficiencies.
[0009] Provided herein are microorganisms that produce fatty
alcohols having defined carbon chain length, branching, and
saturation levels. In particular examples, the production of
homogeneous products decreases the overall cost associated with
fermentation and separation Microorganisms expressing one or more
exogenous nucleic acid sequences encoding at least one thioesterase
(EC 3.1.2.14) and at least one fatty alcohol forming acyl-CoA
reductase (1.1.1.*) are provided. The thioesterase peptides encoded
by the exogenous nucleic acid sequences can be chosen to provide
homogeneous products.
[0010] In some examples the microorganism that is engineered to
produce the fatty acid derivative is E. coli, Z. mobilis,
Rhodococcus opacus, Ralstonia eutropha, Vibrio furnissii,
Saccharomyces cerevisiae, Lactococcus lactis, Streptomycetes,
Stenotrophomonas maltophila, Pseudomonas or Micrococus leuteus and
their relatives.
[0011] In addition to being engineered to express exogenous nucleic
acid sequences that allow for the production of fatty alcohols, the
microorganism can additionally have one or more endogenous genes
functionally deleted or attenuated.
[0012] In addition to being engineered to express exogenous nucleic
acid sequences that allow for the production of fatty alcohols, the
microorganism can additionally have one or more additional genes
over-expressed.
[0013] In some examples, the microorganisms described herein
produce at least 1 mg of fatty alcohol per liter fermentation
broth. In other examples the microorganisms produce at least 100
mg/L, 500 mg/L, 1 g/L, 5 g/L, 10 g/L, 20 g/L, 25 g/L, 30 g/L, 35
g/L, 40 g/L, 50 g/L, 100 g/L, or 120 g/L of fatty alcohol per liter
fermentation broth. In some examples, the fatty alcohol is produced
and released from the microorganism and in yet other examples the
microorganism is lysed prior to separation of the product.
[0014] In some examples, the fatty alcohol includes a carbon chain
that is at least 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32,
or 34 carbons long. In some examples at least 50%, 60%, 70%, 80%,
85%, 90%, or 95% of the fatty alcohol product made contains a
carbon chain that is 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30,
32, or 34 carbons long. In yet other examples, at least 60%, 70%,
80%, 85%, 90%, or 95% of the fatty alcohol product contain 1, 2, 3,
4, or 5, points of unsaturation
[0015] Also provided are methods of producing alcohol. These
methods include culturing the microorganisms described herein and
separating the product from the fermentation broth.
[0016] These and other examples are described further in the
following detailed description.
BRIEF DESCRIPTION OF THE FIGURES
[0017] FIG. 1 shows the FAS biosynthetic pathway.
[0018] FIG. 2 shows biosynthetic pathways that produce waxes. Waxes
can be produced in a host cell using alcohols produced within the
host cell or they can be produced by adding exogenous alcohols in
the medium. A microorganism designed to produce waxes will produce
wax synthase enzymes (EC 2.3.1.75) using exogenous nucleic acid
sequences as well as thioesterase (EC 3.1.2.14) sequences. Other
enzymes that can be also modulated to increase the production of
waxes include enzymes involved in fatty acid synthesis (FAS enzymes
EC 2.3.1.85), acyl-CoA synthase (EC 2.3.1.86), fatty alcohol
forming acyl-CoA reductase (EC 1.1.1.*), acyl-CoA reductase
(1.2.1.50) and alcohol dehydrogenase (EC 1.1.1.1).
[0019] FIG. 3 shows biosynthetic pathways that produce fatty
alcohols. Fatty alcohols having defined carbon chain lengths can be
produced by expressing exogenous nucleic acid sequences encoding
thioesterases (EC 3.1.2.14), and combinations of acyl-CoA
reductases (EC 1.2.1.50), alcohol dehydrogenases (EC 1.1.1.1) and
fatty alcohol forming acyl-CoA reductases (FAR, EC 1.1.1*). Other
enzymes that can be also modulated to increase the production of
fatty alcohols include enzymes involved in fatty acid synthesis
(FAS enzymes EC 2.3.1.85), and acyl-CoA synthase (EC 2.3.1.86).
[0020] FIG. 4 shows biosynthetic pathways that produce fatty acids
esters. Fatty acids esters having defined carbon chain lengths can
be produced by exogenously expressing various thioesterases (EC
3.1.2.14), combinations of acyl-CoA reductase (1.2.1.50), alcohol
dehydrogenases (EC 1.1.1.1), and fatty alcohol forming Acyl-CoA
reductase (FAR, EC 1.1.1*), as well as, acetyl transferase (EC
2.3.1.84). Other enzymes that can be modulated to increase the
production of fatty acid esters include enzymes involved in fatty
acid synthesis (FAS enzymes EC 2.3.1.85), and acyl-CoA synthase (EC
2.3.1.86).
[0021] FIG. 5 shows fatty alcohol production by the strain
described in Example 4, co-transformed with pCDFDuet-1-fadD-acrl
and plasmids containing various thioesterase genes. The strains
were grown aerobically at 25.degree. C. in M9 mineral medium with
0.4% glucose in shake flasks. Saturated C10, C12, C14, C16 and C18
fatty alcohol were identified. Small amounts of C16:1 and C18:1
fatty alcohols were also detected in some samples. Fatty alcohols
were extracted from cell pellets using ethyl acetate and
derivatized with N-trimethylsilyl (TMS) imidazole to increase
detection.
[0022] FIG. 6 shows the release of fatty alcohols from the
production strain. Approximately 50% of the fatty alcohol produced
was released from the cells when they were grown at 37.degree.
C.
[0023] FIGS. 7A-7D show GS-MS spectrum of octyl octanoate (C8C8)
produced by a production hosts expressing alcohol acetyl
transferase (AATs, EC 2.3.1.84) and production hosts expressing wax
synthase (EC 2.3.1.75). FIG. 7A shows acetyl acetate extract of
strain C41(DE3, .DELTA.fadE/pHZ1.43)/pRSET B+pAS004.114B) wherein
the pHZ1.43 plasmid expressed ADP1 (wax synthase). FIG. 7B shows
acetyl acetate extract of strain C41(DE3,
.DELTA.fadE/pHZ1.43)/pRSET B+pAS004.114B) wherein the pHZ1.43
plasmid expressed SAAT. FIG. 7C shows acetyl acetate extract of
strain C41(DE3, .DELTA.fadE/pHZ1.43)/pRSET B+pAS004.114B) wherein
the pHZ1.43 plasmid did not contain ADP1 (wax synthase) or SAAT.
FIG. 7D shows the mass spectrum and fragmentation pattern of C8C8
produced by C41(DE3, .DELTA.fadE/pHZ1.43)/pRSET B+pAS004.114B)
wherein the pHZ1.43 plasmid expressed SAAT).
[0024] FIG. 8 shows the distribution of ethyl esters made when the
wax synthase from A. baylyi ADP1 (WSadp1) was co-expressed with
thioesterase gene from Cuphea hookeriana in a production host.
[0025] FIGS. 9A and 9B show chromatograms of GC/MS analysis. FIG.
9A shows a chromatogram of the ethyl extract of the culture of E.
coli LS9001 strain transformed with plasmids
pCDFDuet-1-fadD-WSadp1, pETDuet-1-`tesA. Ethanol was fed to
fermentations. FIG. 9B shows a chromatogram of ethyl hexadecanoate
and ethyl oleate used as reference.
[0026] FIG. 10 shows a table that identifies various genes that can
be over-expressed or attenuated to increase fatty acid derivative
production. The table also identifies various genes that can be
modulated to alter the structure of the fatty acid derivative
product. One of ordinary skill in the art will appreciate that some
of the genes that are used to alter the structure of the fatty acid
derivative will also increase the production of fatty acid
derivatives.
ABBREVIATIONS AND TERMS
[0027] The following explanations of terms and methods are provided
to better describe the present disclosure and to guide those of
ordinary skill in the art in the practice of the present
disclosure. As used herein, "comprising" means "including" and the
singular forms "a" or "an" or "the" include plural references
unless the context clearly dictates otherwise. For example,
reference to "comprising a cell" includes one or a plurality of
such cells, and reference to "comprising the thioesterase" includes
reference to one or more thioesterase peptides and equivalents
thereof known to those of ordinary skill in the art, and so forth.
The term "or" refers to a single element of stated alternative
elements or a combination of two or more elements, unless the
context clearly indicates otherwise. For example, the phrase
"thioesterase activity or fatty alcohol-forming acyl-CoA reductase
activity" refers to thioesterase activity, fatty alcohol forming
acyl-CoA reductase activity, or a combination of both fatty alcohol
forming acyl-CoA reductase activity, and thioesterase activity.
[0028] Unless explained otherwise, all technical and scientific
terms used herein have the same meaning as commonly understood to
one of ordinary skill in the art to which this disclosure belongs.
Although methods and materials similar or equivalent to those
described herein can be used in the practice or testing of the
present disclosure, suitable methods and materials are described
below. The materials, methods, and examples are illustrative only
and not intended to be limiting. Other features of the disclosure
are apparent from the following detailed description and the
claims.
[0029] Accession Numbers: The accession numbers throughout this
description are derived from the NCBI database (National Center for
Biotechnology Information) maintained by the National Institute of
Health, U.S.A. The accession numbers are as provided in the
database on Mar. 27, 2007.
[0030] Enzyme Classification Numbers (EC): The EC numbers provided
throughout this description are derived from the KEGG Ligand
database, maintained by the Kyoto Encyclopedia of Genes and
Genomics, sponsored in part by the University of Tokyo. The EC
numbers are as provided in the database on Mar. 27, 2007.
[0031] Attenuate: To lessen the impact, activity or strength of
something. In one example, the sensitivity of a particular enzyme
to feedback inhibition or inhibition caused by a composition that
is not a product or a reactant (non-pathway specific feedback) is
lessened such that the enzyme activity is not impacted by the
presence of a compound. For example, the fabH gene and its
corresponding amino acid sequence are temperature sensitive and can
be altered to decrease the sensitivity to temperature fluctuations.
The attenuation of the fabH gene can be used when branched amino
acids are desired. In another example, an enzyme that has been
altered to be less active can be referred to as attenuated.
[0032] A functional deletion of an enzyme can be used to attenuate
an enzyme. A functional deletion is a mutation, partial or complete
deletion, insertion, or other variation made to a gene sequence or
a sequence controlling the transcription of a gene sequence, which
reduces or inhibits production of the gene product, or renders the
gene product non-functional (i.e. the mutation described herein for
the plsB gene). For example, functional deletion of fabR in E. coli
reduces the repression of the fatty acid biosynthetic pathway and
allows E. coli to produce more unsaturated fatty acids (UFAs). In
some instances a functional deletion is described as a knock-out
mutation.
[0033] One of ordinary skill in the art will appreciate that there
are many methods of attenuating enzyme activity. For example,
attenuation can be accomplished by introducing amino acid sequence
changes via altering the nucleic acid sequence, placing the gene
under the control of a less active promoter, expressing interfering
RNA, ribozymes or antisense sequences that targeting the gene of
interest, or through any other technique known in the art.
[0034] Carbon source: Generally refers to a substrate or compound
suitable to be used as a source of carbon for prokaryotic or simple
eukaryotic cell growth. Carbon sources can be in various forms,
including, but not limited to polymers, carbohydrates, acids,
alcohols, aldehydes, ketones, amino acids, peptides, etc. These
include, for example, various monosaccharides such as glucose,
oligosaccharides, polysaccharides, cellulosic material, xylose, and
arabinose, disaccharides, such sucrose, saturated or unsaturated
fatty acids, succinate, lactate, acetate, ethanol, etc., or
mixtures thereof. The carbon source can additionally be a product
of photosynthesis, including, but not limited to glucose.
[0035] cDNA (complementary DNA): A piece of DNA lacking internal,
non-coding segments (introns) and regulatory sequences which
determine transcription. cDNA can be synthesized by reverse
transcription from messenger RNA extracted from cells.
[0036] Deletion: The removal of one or more nucleotides from a
nucleic acid molecule or one or more amino acids from a protein,
the regions on either side being joined together.
[0037] Detectable: Capable of having an existence or presence
ascertained. For example, production of a product from a reactant,
for example, the production of C18 fatty acids, is detectable using
the method provided in Example 11 below.
[0038] DNA: Deoxyribonucleic acid. DNA is a long chain polymer
which includes the genetic material of most living organisms (some
viruses have genes including ribonucleic acid, RNA). The repeating
units in DNA polymers are four different nucleotides, each of which
includes one of the four bases, adenine, guanine, cytosine and
thymine bound to a deoxyribose sugar to which a phosphate group is
attached. Triplets of nucleotides, referred to as codons, in DNA
molecules code for amino acid in a peptide. The term codon is also
used for the corresponding (and complementary) sequences of three
nucleotides in the mRNA into which the DNA sequence is
transcribed.
[0039] Endogenous: As used herein with reference to a nucleic acid
molecule and a particular cell or microorganism refers to a nucleic
acid sequence or peptide that is in the cell and was not introduced
into the cell using recombinant engineering techniques. For
example, a gene that was present in the cell when the cell was
originally isolated from nature. A gene is still considered
endogenous if the control sequences, such as a promoter or enhancer
sequences that activate transcription or translation have been
altered through recombinant techniques.
[0040] Exogenous: As used herein with reference to a nucleic acid
molecule and a particular cell refers to any nucleic acid molecule
that does not originate from that particular cell as found in
nature. Thus, a non-naturally-occurring nucleic acid molecule is
considered to be exogenous to a cell once introduced into the cell.
A nucleic acid molecule that is naturally-occurring also can be
exogenous to a particular cell. For example, an entire coding
sequence isolated from cell X is an exogenous nucleic acid with
respect to cell Y once that coding sequence is introduced into cell
Y, even if X and Y are the same cell type.
[0041] Expression: The process by which a gene's coded information
is converted into the structures and functions of a cell, such as a
protein, transfer RNA, or ribosomal RNA. Expressed genes include
those that are transcribed into mRNA and then translated into
protein and those that are transcribed into RNA but not translated
into protein (for example, transfer and ribosomal RNAs).
[0042] Fatty ester: Includes any ester made from a fatty acid. The
carbon chains in fatty acids can contain any combination of the
modifications described herein. For example, the carbon chain can
contain one or more points of unsaturation, one or more points of
branching, including cyclic branching, and can be engineered to be
short or long. Any alcohol can be used to form fatty acid esters,
for example alcohols derived from the fatty acid biosynthetic
pathway, alcohols produced by the production host through non-fatty
acid biosynthetic pathways, and alcohols that are supplied in the
fermentation broth.
[0043] Fatty acid derivative: Includes products made in part from
the fatty acid biosynthetic pathway of the host organism. The fatty
acid biosynthetic pathway includes fatty acid synthase enzymes
which can be engineered as described herein to produce fatty acid
derivatives, and in some examples can be expressed with additional
enzymes to produce fatty acid derivatives having desired carbon
chain characteristics. Exemplary fatty acid derivatives include for
example, short and long chain alcohols, hydrocarbons, and fatty
acid esters including waxes.
[0044] Fermentation Broth: Includes any medium which supports
microorganism life (i.e. a microorganism that is actively
metabolizing carbon). A fermentation medium usually contains a
carbon source. The carbon source can be anything that can be
utilized, with or without additional enzymes, by the microorganism
for energy.
[0045] Hydrocarbon: includes chemical compounds that containing the
elements carbon (C) and hydrogen (H). All hydrocarbons consist of a
carbon backbone and atoms of hydrogen attached to that backbone.
Sometimes, the term is used as a shortened form of the term
"aliphatic hydrocarbon." There are essentially three types of
hydrocarbons: (1) aromatic hydrocarbons, which have at least one
aromatic ring; (2) saturated hydrocarbons, also known as alkanes,
which lack double, triple or aromatic bonds; and (3) unsaturated
hydrocarbons, which have one or more double or triple bonds between
carbon atoms, are divided into: alkenes, alkynes, and dienes.
Liquid geologically-extracted hydrocarbons are referred to as
petroleum (literally "rock oil") or mineral oil, while gaseous
geologic hydrocarbons are referred to as natural gas. All are
significant sources of fuel and raw materials as a feedstock for
the production of organic chemicals and are commonly found in the
Earth's subsurface using the tools of petroleum geology. Oil
reserves in sedimentary rocks are the principal source of
hydrocarbons for the energy and chemicals industries. Hydrocarbons
are of prime economic importance because they encompass the
constituents of the major fossil fuels (coal, petroleum, natural
gas, etc.) and biofuels, as well as plastics, waxes, solvents and
oils.
[0046] Isolated: An "isolated" biological component (such as a
nucleic acid molecule, protein, or cell) has been substantially
separated or purified away from other biological components in
which the component naturally occurs, such as other chromosomal and
extrachromosomal DNA and RNA, and proteins. Nucleic acid molecules
and proteins that have been "isolated" include nucleic acid
molecules and proteins purified by standard purification methods.
The term also embraces nucleic acid molecules and proteins prepared
by recombinant expression in a host cell as well as chemically
synthesized nucleic acid molecules and proteins.
[0047] In one example, isolated refers to a naturally-occurring
nucleic acid molecule that is not immediately contiguous with both
of the sequences with which it is immediately contiguous (one on
the 5' end and one on the 3' end) in the naturally-occurring genome
of the organism from which it is derived.
[0048] Microorganism: Includes prokaryotic and eukaryotic microbial
species from the Domains Archaea, Bacteria and Eucarya, the latter
including yeast and filamentous fungi, protozoa, algae, or higher
Protista. The terms "microbial cells" and "microbes" are used
interchangeably with the term microorganism.
[0049] Nucleic Acid Molecule: Encompasses both RNA and DNA
molecules including, without limitation, cDNA, genomic DNA, and
mRNA. Includes synthetic nucleic acid molecules, such as those that
are chemically synthesized or recombinantly produced. The nucleic
acid molecule can be double-stranded or single-stranded. Where
single-stranded, the nucleic acid molecule can be the sense strand
or the antisense strand. In addition, nucleic acid molecule can be
circular or linear.
[0050] Operably linked: A first nucleic acid sequence is operably
linked with a second nucleic acid sequence when the first nucleic
acid sequence is placed in a functional relationship with the
second nucleic acid sequence. For instance, a promoter is operably
linked to a coding sequence if the promoter affects the
transcription or expression of the coding sequence. Generally,
operably linked DNA sequences are contiguous and, where necessary
to join two protein coding regions, in the same reading frame.
Configurations of separate genes that are transcribed in tandem as
a single messenger RNA are denoted as operons. Thus placing genes
in close proximity, for example in a plasmid vector, under the
transcriptional regulation of a single promoter, constitutes a
synthetic operon.
[0051] ORF (open reading frame): A series of nucleotide triplets
(codons) coding for amino acids without any termination codons.
These sequences are usually translatable into a peptide.
[0052] Over-expressed: When a gene is caused to be transcribed at
an elevated rate compared to the endogenous transcription rate for
that gene. In some examples, over-expression additionally includes
an elevated rate of translation of the gene compared to the
endogenous translation rate for that gene. Methods of testing for
over-expression are well known in the art, for example transcribed
RNA levels can be assessed using rtPCR and protein levels can be
assessed using SDS page gel analysis.
[0053] Purified: The term purified does not require absolute
purity; rather, it is intended as a relative term. Thus, for
example, a purified fatty acid derivative preparation, such as a
wax, or a fatty acid ester preparation, is one in which the product
is more concentrated than the product is in its environment within
a cell. For example, a purified wax is one that is substantially
separated from cellular components (nucleic acids, lipids,
carbohydrates, and other peptides) that can accompany it. In
another example, a purified wax preparation is one in which the wax
is substantially-free from contaminants, such as those that might
be present following fermentation.
[0054] In one example, a fatty acid ester is purified when at least
about 50% by weight of a sample is composed of the fatty acid
ester, for example when at least about 60%, 70%, 80%, 85%, 90%,
92%, 95%, 98%, or 99% or more of a sample is composed of the fatty
acid ester. Examples of methods that can be used to purify a waxes,
fatty alcohols, and fatty acid esters, include the methods
described in Example 11 below.
[0055] Recombinant: A recombinant nucleic acid molecule or protein
is one that has a sequence that is not naturally occurring, has a
sequence that is made by an artificial combination of two otherwise
separated segments of sequence, or both. This artificial
combination can be achieved, for example, by chemical synthesis or
by the artificial manipulation of isolated segments of nucleic acid
molecules or proteins, such as genetic engineering techniques.
Recombinant is also used to describe nucleic acid molecules that
have been artificially manipulated, but contain the same regulatory
sequences and coding regions that are found in the organism from
which the nucleic acid was isolated. A recombinant cell or
microorganism is one that contains an exogenous nucleic acid
molecule, such as a recombinant nucleic acid molecule.
[0056] Release: The movement of a compound from inside a cell
(intracellular) to outside a cell (extracellular). The movement can
be active or passive. When release is active it can be facilitated
by one or more transporter peptides and in some examples it can
consume energy. When release is passive, it can be through
diffusion through the membrane and can be facilitated by
continually collecting the desired compound from the extracellular
environment, thus promoting further diffusion. Release of a
compound can also be accomplished by lysing a cell.
[0057] Surfactants: Substances capable of reducing the surface
tension of a liquid in which they are dissolved. They are typically
composed of a water-soluble head and a hydrocarbon chain or tail.
The water soluble group is hydrophilic and can be either ionic or
nonionic, and the hydrocarbon chain is hydrophobic. Surfactants are
used in a variety of products, including detergents and cleaners,
and are also used as auxiliaries for textiles, leather and paper,
in chemical processes, in cosmetics and pharmaceuticals, in the
food industry and in agriculture. In addition, they can be used to
aid in the extraction and isolation of crude oils which are found
hard to access environments or as water emulsions.
[0058] There are four types of surfactants characterized by varying
uses. Anionic surfactants have detergent-like activity and are
generally used for cleaning applications. Cationic surfactants
contain long chain hydrocarbons and are often used to treat
proteins and synthetic polymers or are components of fabric
softeners and hair conditioners. Amphoteric surfactants also
contain long chain hydrocarbons and are typically used in shampoos.
Non-ionic surfactants are generally used in cleaning products.
[0059] Transformed or recombinant cell: A cell into which a nucleic
acid molecule has been introduced, such as an acyl-CoA synthase
encoding nucleic acid molecule, for example by molecular biology
techniques. Transformation encompasses all techniques by which a
nucleic acid molecule can be introduced into such a cell,
including, but not limited to, transfection with viral vectors,
conjugation, transformation with plasmid vectors, and introduction
of naked DNA by electroporation, lipofection, and particle gun
acceleration.
[0060] Under conditions that permit product production: Any
fermentation conditions that allow a microorganism to produce a
desired product, such as fatty acids, hydrocarbons, fatty alcohols,
waxes, or fatty acid esters. Fermentation conditions usually
include temperature ranges, levels of aeration, and media
selection, which when combined allow the microorganism to grow.
Exemplary mediums include broths or gels. Generally, the medium
includes a carbon source such as glucose, fructose, cellulose, or
the like that can be metabolized by the microorganism directly, or
enzymes can be used in the medium to facilitate metabolizing the
carbon source. To determine if culture conditions permit product
production, the microorganism can be cultured for 24, 36, or 48
hours and a sample can be obtained and analyzed. For example, the
cells in the sample or the medium in which the cells were grown can
be tested for the presence of the desired product. When testing for
the presence of a product assays, such as those provided in the
Examples below, can be used.
[0061] Vector: A nucleic acid molecule as introduced into a cell,
thereby producing a transformed cell. A vector can include nucleic
acid sequences that permit it to replicate in the cell, such as an
origin of replication. A vector can also include one or more
selectable marker genes and other genetic elements known in the
art.
[0062] Wax: A variety of fatty acid esters which form solids or
pliable substances under an identified set of physical conditions.
Fatty acid esters that are termed waxes generally have longer
carbon chains than fatty acid esters that are not waxes. For
example, a wax generally forms a pliable substance at room
temperature.
DETAILED DESCRIPTION
I. Production of Fatty Acid Derivatives
[0063] The host organism that exogenous DNA sequences are
transformed into can be a modified host organism, such as an
organism that has been modified to increase the production of
acyl-ACP or acyl-CoA, reduce the catabolism of fatty acid
derivatives and intermediates, or to reduce feedback inhibition at
specific points in the biosynthetic pathway. In addition to
modifying the genes described herein additional cellular resources
can be diverted to over produce fatty acids, for example the
lactate, succinate and/or acetate pathways can be attenuated, and
acetyl-CoA carboxylase (ACC) can be over expressed. The
modifications to the production host described herein can be
through genomic alterations, extrachromosomal expression systems,
or combinations thereof. An overview of the pathway is provided in
FIGS. 1 and 2.
[0064] A. Acetyl-CoA--Malonyl-CoA to Acyl-ACP
[0065] Fatty acid synthase (FAS) is a group of peptides that
catalyze the initiation and elongation of acyl chains (Marrakchi et
al., Biochemical Society, 30:1050-1055, 2002). The acyl carrier
protein (ACP) along with the enzymes in the FAS pathway control the
length, degree of saturation and branching of the fatty acids
produced. Enzymes that can be included in FAS include AccABCD,
FabD, FabH, FabG, FabA, FabZ, FabI, FabK, FabL, FabM, FabB, and
FabF. Depending upon the desired product one or more of these genes
can be attenuated or over-expressed.
[0066] For example, the fatty acid biosynthetic pathway in the
production host uses the precursors acetyl-CoA and malonyl-CoA
(FIG. 2). E. coli or other host organisms engineered to overproduce
these components can serve as the starting point for subsequent
genetic engineering steps to provide the specific output product
(such as, fatty acid esters, hydrocarbons, fatty alcohols). Several
different modifications can be made, either in combination or
individually, to the host strain to obtain increased acetyl
CoA/malonyl CoA/fatty acid and fatty acid derivative production.
For example, to increase acetyl CoA production, a plasmid with pdh,
panK, aceEF, (encoding the E1p dehydrogenase component and the E2p
dihydrolipoamide acyltransferase component of the pyruvate and
2-oxoglutarate dehydrogenase complexes), fabH/fabD/fabG/acpP/fabF,
and in some examples additional DNA encoding fatty-acyl-CoA
reductases and aldehyde decarbonylases, all under the control of a
constitutive, or otherwise controllable promoter, can be
constructed. Exemplary Genbank accession numbers for these genes
are: pdh (BAB34380, AAC73227, AAC73226), panK (also known as coaA,
AAC76952), aceEF (AAC73227, AAC73226), fabH (AAC74175), fabD
(AAC74176), fabG (AAC74177), acpP (AAC74178), fabF (AAC74179).
[0067] Additionally, fadE, gpsA, ldhA, pflb, adhE, pta, poxB, ackA,
and/or ackB can be knocked-out, or their expression levels can be
reduced, in the engineered microorganism by transformation with
conditionally replicative or non-replicative plasmids containing
null or deletion mutations of the corresponding genes, or by
substituting promoter or enhancer sequences. Exemplary Genbank
accession numbers for these genes are; fadE (AAC73325), gspA
(AAC76632), ldhA (AAC74462), pflb (AAC73989), adhE (AAC74323), pta
(AAC75357), poxB (AAC73958), ackA (AAC75356), and ackB
(BAB81430).
[0068] The resulting engineered microorganisms can be grown in a
desired environment, for example one with limited glycerol (less
than 1% w/v in the culture medium). As such, these microorganisms
will have increased acetyl-CoA production levels. Malonyl-CoA
overproduction can be effected by engineering the microorganism as
described above, with DNA encoding accABCD (acetyl CoA carboxylase,
for example accession number AAC73296, EC 6.4.1.2) included in the
plasmid synthesized de novo. Fatty acid overproduction can be
achieved by further including DNA encoding lipase (for example
Accessions numbers CAA89087, CAA98876) in the plasmid synthesized
de novo.
[0069] In some examples, acetyl-CoA carboxylase (ACC) is
over-expressed to increase the intracellular concentration thereof
by at least 2-fold, such as at least 5-fold, or at least 10-fold,
for example relative to native expression levels.
[0070] In addition, the plsB (for example Accession number AAC7701
1) D311E mutation can be used to remove limitations on the pool of
acyl-CoA.
[0071] In addition, over-expression of an sfa gene (suppressor of
FabA, for example Accession number AAN79592) can be included in the
production host to increase production of monounsaturated fatty
acids (Rock et al., J. Bacteriology 178:5382-5387, 1996).
[0072] B. Acyl-ACP to Fatty Acid
[0073] To engineer a production host for the production of a
homogeneous population of fatty acid derivatives, one or more
endogenous genes can be attenuated or functionally deleted and one
or more thioesterases can be expressed. For example, C10 fatty acid
derivatives can be produced by attenuating thioesterase C18 (for
example accession numbers AAC73596 and POADAI), which uses
C18:1-ACP and expressing thioesterase C10 (for example accession
number Q39513), which uses C10-ACP. Thus, resulting in a relatively
homogeneous population of fatty acid derivatives that have a carbon
chain length of 10. In another example, C14 fatty acid derivatives
can be produced by attenuating endogenous thioesterases that
produce non-C14 fatty acids and expressing the thioesterase
accession number Q39473 (which uses C14-ACP). In yet another
example, C12 fatty acid derivatives can be produced by expressing
thioesterases that use C12-ACP (for example accession number
Q41635) and attenuating thioesterases that produce non-C12 fatty
acids. Acetyl CoA, malonyl CoA, and fatty acid overproduction can
be verified using methods known in the art, for example by using
radioactive precursors, HPLC, and GC-MS subsequent to cell
lysis.
TABLE-US-00001 TABLE 1 Thioesterases Preferential Accession product
Number Source Organism Gene produced AAC73596 E. coli tesA without
C18:1 leader sequence Q41635 Umbellularia fatB C12:0 california
Q39513; Cuphea fatB2 C8:0-C10:0 hookeriana AAC49269 Cuphea fatB3
C14:0-C16:0 hookeriana Q39473 Cinnamonum fatB C14:0 camphorum
CAA85388 Arabidopsis fatB[M141T]* C16:1 thaliana NP Arabidopsis
fatA C18:1 189147; thaliana NP 193041 CAC39106 Bradyrhiizobium fatA
C18:1 japonicum AAC72883 Cuphea fatA C18:1 hookeriana *Mayer et
al., BMC Plant Biology 7:1-11, 2007.
[0074] C. Fatty Acid to Acyl-CoA
[0075] Production hosts can be engineered using known peptides to
produce fatty acids of various lengths. One method of making fatty
acids involves increasing the expression of, or expressing more
active forms of, one or more acyl-CoA synthase peptides (EC
2.3.1.86).
[0076] As used herein, acyl-CoA synthase includes peptides in
enzyme classification number EC 2.3.1.86, as well as any other
peptide capable of catalyzing the conversion of a fatty acid to
acyl-CoA. Additionally, one of ordinary skill in the art will
appreciate that some acyl-CoA synthase peptides will catalyze other
reactions as well, for example some acyl-CoA synthase peptides will
accept other substrates in addition to fatty acids. Such
non-specific acyl-CoA synthase peptides are, therefore, also
included. Acyl-CoA synthase peptide sequences are publicly
available. Exemplary GenBank Accession Numbers are provided in FIG.
10.
[0077] D. Acyl-CoA to Fatty Alcohol
[0078] Production hosts can be engineered using known polypeptides
to produce fatty alcohols from acyl-CoA. One method of making fatty
alcohols involves increasing the expression of or expressing more
active forms of fatty alcohol forming acyl-CoA reductase (FAR, EC
1.1.1.*), or acyl-CoA reductases (EC 1.2.1.50) and alcohol
dehydrogenase (EC 1.1.1.1). Hereinafter fatty alcohol forming
acyl-CoA reductase (FAR, EC 1.1.1.*), acyl-CoA reductases (EC
1.2.1.50) and alcohol dehydrogenase (EC 1.1.1.1) are collectively
referred to as fatty alcohol forming peptides. In some examples all
three of the fatty alcohol forming genes can be over expressed in a
production host, and in yet other examples one or more of the fatty
alcohol forming genes can be over-expressed.
[0079] As used herein, fatty alcohol forming peptides include
peptides in enzyme classification numbers EC 1.1.1.*, 1.2.1.50, and
1.1.1.1, as well as any other peptide capable of catalyzing the
conversion of acyl-CoA to fatty alcohol. Additionally, one of
ordinary skill in the art will appreciate that some fatty alcohol
forming peptides will catalyze other reactions as well, for example
some acyl-CoA reductase peptides will accept other substrates in
addition to fatty acids. Such non-specific peptides are, therefore,
also included. Fatty alcohol forming peptides sequences are
publicly available. Exemplary GenBank Accession Numbers are
provided in FIG. 10.
[0080] Fatty alcohols can also be described as hydrocarbon-based
surfactants. For surfactant production the microorganism is
modified so that it produces a surfactant from a renewable carbon
source. Such a microorganism includes a first exogenous DNA
sequence encoding a protein capable of converting a fatty acid to a
fatty aldehyde and a second exogenous DNA sequence encoding a
protein capable of converting a fatty aldehyde to an alcohol. In
some examples, the first exogenous DNA sequence encodes a fatty
acid reductase. In one embodiment, the second exogenous DNA
sequence encodes mammalian microsomal aldehyde reductase or
long-chain aldehyde dehydrogenase. In a further example, the first
and second exogenous DNA sequences are from a multienzyme complex
from Arthrobacter AK 19, Rhodotorula glutinins, Acinobacter sp
strain. M-1, or Candida lipolytica. In one embodiment, the first
and second heterologous DNA sequences are from a multienzyme
complex from Acinobacter sp strain M-1 or Candida lipolytica.
[0081] Additional sources of heterologous DNA sequences encoding
fatty acid to long chain alcohol converting proteins that can be
used in surfactant production include, but are not limited to,
Mortierella alpina (ATCC 32222), Crytococcus curvatus, (also
referred to as Apiotricum curvatum), Alcanivorax jadensis (T9T=DSM
12718=ATCC 700854), Acinetobacter sp. HO1-N, (ATCC 14987) and
Rhodococcus opacus (PD630 DSMZ 44193).
[0082] In one example, the fatty acid derivative is a saturated or
unsaturated surfactant product having a carbon atom content limited
to between 6 and 36 carbon atoms. In another example, the
surfactant product has a carbon atom content limited to between 24
and 32 carbon atoms.
[0083] Appropriate hosts for producing surfactants can be either
eukaryotic or prokaryotic microorganisms. Exemplary hosts include
Arthrobacter AK 19, Rhodotorula glutinins, Acinobacter sp strain
M-1, Arabidopsis thalania, or Candida lipolytica , Saccharomyces
cerevisiae, and E. coli engineered to express acetyl CoA
carboxylase. Hosts which demonstrate an innate ability to
synthesize high levels of surfactant precursors in the form of
lipids and oils, such as Rhodococcus opacus, Arthrobacter AK 19,
Rhodotorula glutinins E. coli engineered to express acetyl CoA
carboxylase, and other oleaginous bacteria, yeast, and fungi can
also be used.
[0084] E. Fatty Alcohols to Fatty Esters
[0085] Production hosts can be engineered using known polypeptides
to produce fatty esters of various lengths. One method of making
fatty esters includes increasing the expression of, or expressing
more active forms of, one or more alcohol O-acetyltransferase
peptides (EC 2.3.1.84). These peptides catalyze the reaction of
acetyl-CoA and an alcohol to form CoA and an acetic ester. In some
examples the alcohol O-acetyltransferase peptides can be expressed
in conjunction with selected thioesterase peptides, FAS peptides
and fatty alcohol forming peptides, thus, allowing the carbon chain
length, saturation and degree of branching to be controlled. In
some cases the bkd operon can be coexpressed to enable branched
fatty acid precursors to be produced.
[0086] As used herein, alcohol O-acetyltransferase peptides include
peptides in enzyme classification number EC 2.3.1.84, as well as
any other peptide capable of catalyzing the conversion of
acetyl-CoA and an alcohol to form CoA and an acetic ester.
Additionally, one of ordinary skill in the art will appreciate that
alcohol O-acetyltransferase peptides will catalyze other reactions
as well, for example some alcohol O-acetyltransferase peptides will
accept other substrates in addition to fatty alcohols or acetyl-CoA
thiosester i.e., such as other alcohols and other acyl-CoA
thioesters. Such non-specific or divergent specificity alcohol
O-acetyltransferase peptides are, therefore, also included. Alcohol
O-acetyltransferase peptide sequences are publicly available.
Exemplary GenBank Accession Numbers are provided in FIG. 10. Assays
for characterizing the activity of a particular alcohol
O-acetyltransferase peptides are well known in the art. Engineered
O-acetyltransferases and O-acyltransferases can be also created
that have new activities and specificities for the donor acyl group
or acceptor alcohol moiety. Engineered enzymes could be generated
through rational and evolutionary approaches well documented in the
art.
[0087] F. Acyl-CoA to Fatty Esters (Biodiesels and Waxes)
[0088] Production hosts can be engineered using known peptides to
produce fatty acid esters from acyl-CoA and alcohols. In some
examples the alcohols are provided in the fermentation media and in
other examples the production host can provide the alcohol as
described herein. One of ordinary skill in the art will appreciate
that structurally, fatty acid esters have an A and a B side. As
described herein, the A side of the ester is used to describe the
carbon chain contributed by the alcohol, and the B side of the
ester is used to describe the carbon chain contributed by the
acyl-CoA. Either chain can be saturated or unsaturated, branched or
unbranched. The production host can be engineered to produce fatty
alcohols or short chain alcohols. The production host can also be
engineered to produce specific acyl-CoA molecules. As used herein
fatty acid esters are esters derived from a fatty acyl-thioester
and an alcohol, wherein the A side and the B side of the ester can
vary in length independently. Generally, the A side of the ester is
at least 1, 2, 3, 4, 5, 6, 7, or 8 carbons in length, while the B
side of the ester is 8, 10, 12, 14, 16, 18, 20, 22, 24, or 26
carbons in length. The A side and the B side can be straight chain
or branched, saturated or unsaturated.
[0089] The production of fatty esters, including waxes from
acyl-CoA and alcohols can be engineered using known polypeptides.
As used herein waxes are long chain fatty acid esters, wherein the
A side and the B side of the ester can vary in length
independently. Generally, the A side of the ester is at least 8,
10, 12, 14, 16, 18, 20, 22, 24, or 26 carbons in length. Similarly
the B side of the ester is at least 8, 10, 12, 14, 16, 18, 20, 22,
24, or 26 carbons in length. The A side and the B side can be
mono-, di-, tri- unsaturated. The production of fatty esters,
including waxes from acyl-CoA and alcohols can be engineered using
known polypeptides. One method of making fatty esters includes
increasing the expression of or expressing more active forms of one
or more wax synthases (EC 2.3.1.75).
[0090] As used herein, wax synthases includes peptides in enzyme
classification number EC 2.3.1.75, as well as any other peptide
capable of catalyzing the conversion of an acyl-thioester to fatty
esters. Additionally, one of ordinary skill in the art will
appreciate that some wax synthase peptides will catalyze other
reactions as well, for example some wax synthase peptides will
accept short chain acyl-CoAs and short chain alcohols to produce
fatty esters. Such non-specific wax synthases are, therefore, also
included. Wax synthase peptide sequences are publicly available.
Exemplary GenBank Accession Numbers are provided in FIG. 10.
Methods to identify wax synthase activity are provided in U.S. Pat.
No. 7,118,896, which is herein incorporated by reference.
[0091] In particular examples, if the desired product is a fatty
ester based biofuel, the microorganism is modified so that it
produces a fatty ester generated from a renewable energy source.
Such a microorganism includes an exongenous DNA sequence encoding a
wax ester synthase that is expressed so as to confer upon said
microorganism the ability to synthesize a saturated, unsaturated,
or branched fatty ester from a renewable energy source. In some
embodiments, the wax ester synthesis proteins include, but are not
limited to,: fatty acid elongases, acyl-CoA reductases,
acyltransferases or wax synthases, fatty acyl transferases,
diacylglycerol acyltransferases, acyl-coA wax alcohol
acyltransferases, bifunctional wax ester
synthase/acyl-CoA:diacylglycerol acyltransferase selected from a
multienzyme complex from Simmondsia chinensis, Acinetobacter sp.
strain ADP1 (formerly Acinetobacter calcoaceticus ADP1),
Pseudomonas aeruginosa, Fundibacter jadensis, Arabidopsis thaliana,
or Alkaligenes eutrophus. In one embodiment, the fatty acid
elongases, acyl-CoA reductases or wax synthases are from a
multienzyme complex from Alkaligenes eutrophus and other organisms
known in the literature to produce wax and fatty acid esters.
[0092] Additional sources of heterologous DNA encoding wax
synthesis proteins useful in fatty ester production include, but
are not limited to, Mortierella alpina (for example ATCC 32222),
Crytococcus curvatus, (also referred to as Apiotricwn curvatum),
Alcanivorax jadensis (for example T9T=DSM 12718=ATCC 700854),
Acinetobacter sp. HO1-N, (for example ATCC 14987) and Rhodococcus
opacus (for example PD630, DSMZ 44193).
[0093] The methods of described herein permit production of fatty
esters of varied length. In one example, the fatty ester product is
a saturated or unsaturated fatty ester product having a carbon atom
content between 24 and 46 carbon atoms. In one embodiment, the
fatty ester product has a carbon atom content between 24 and 32
carbon atoms. In another embodiment the fatty ester product has a
carbon content of 14 and 20 carbons. In another embodiment the
fatty ester is the methyl ester of C18:1. In another embodiment the
fatty acid ester is the ethyl ester of C16:1. In another embodiment
the fatty ester is the methyl ester of C16:1. In another embodiment
the fatty acid ester is octadecyl ester of octanol.
[0094] Useful hosts for producing fatty esters can be either
eukaryotic or prokaryotic microorganisms. In some embodiments such
hosts include, but are not limited to, Saccharomyces cerevisiae,
Candida lipolytica, E. coli, Arthrobacter AK 19, Rhodotorula
glutinins, Acinobacter sp strain M-1, Candida lipolytica and other
oleaginous microorganisms.
[0095] In one example the wax ester synthase from Acinetobacter sp.
ADP1 at locus AAO17391 (described in Kalscheuer and Steinbuchel, J.
Biol. Chem. 278:8075-8082, 2003, herein incorporated by reference)
is used. In another example the wax ester synthase from Simmondsia
chinensis, at locus AAD38041 is used.
[0096] Optionally a wax ester exporter such as a member of the FATP
family can be used to facilitate the release of waxes or esters
into the extracellular environment. One example of a wax ester
exporter that can be used is fatty acid (long chain) transport
protein CG7400-PA, isoform A from Drosophila melanogaster, at locus
NP.sub.--524723.
[0097] G. Acyl-ACP, Acyl-CoA to Hydrocarbon
[0098] A diversity of microorganisms are known to produce
hydrocarbons, such as alkanes, olefins, and isoprenoids. Many of
these hydrocarbons are derived from fatty acid biosynthesis. The
production of these hydrocarbons can be controlled by controlling
the genes associated with fatty acid biosynthesis in the native
hosts. For example, hydrocarbon biosynthesis in the algae
Botryococcus braunii occurs through the decarbonylation of fatty
aldehydes. The fatty aldehydes are produced by the reduction of
fatty acyl--thioesters by fatty acyl-CoA reductase. Thus, the
structure of the final alkanes can be controlled by engineering B.
braunii to express specific genes, such as thioesterases, which
control the chain length of the fatty acids being channeled into
alkane biosynthesis. Expressing the enzymes that result in branched
chain fatty acid biosynthesis in B. braunii will result in the
production of branched chain alkanes. Introduction of genes
effecting the production of desaturation of fatty acids will result
in the production of olefins. Further combinations of these genes
can provide further control over the final structure of the
hydrocarbons produced. To produce higher levels of the native or
engineered hydrocarbons, the genes involved in the biosynthesis of
fatty acids and their precursors or the degradation to other
products can be expressed, overexpressed, or attenuated. Each of
these approaches can be applied to the production of alkanes in
Vibrio furnissi M1 and its functional homologues, which produces
alkanes through the reduction of fatty alcohols (see above for the
biosynthesis and engineering of fatty alcohol production). Each of
these approaches can also be applied to the production of the
olefins produced by many strains of Micrococcus leuteus,
Stenotrophomonas maltophilia, Jeogalicoccus sp. (ATCC8456), and
related microorganisms. These microorganisms produce long chain
internal olefins that are derived from the head to head
condensation of fatty acid precursors. Controlling the structure
and level of the fatty acid precursors using the methods described
herein will result in formation of olefins of different chain
length, branching, and level of saturation.
[0099] Hydrocarbons can also be produced using evolved
oxido/reductases for the reduction of primary alcohols. Primary
fatty alcohols are known to be used to produce alkanes in
microorganisms such as Vibrio furnissii M1 (Myong-Ok, J.
Bacteriol., 187:1426-1429, 2005). An NAD(P)H dependent
oxido/reductase is the responsible catalyst. Synthetic NAD(P)H
dependent oxidoreductases can be produced through the use of
evolutionary engineering and be expressed in production hosts to
produce fatty acid derivatives. One of ordinary skill in the art
will appreciate that the process of "evolving" a fatty alcohol
reductase to have the desired activity is well known (Kolkman and
Stemmer Nat Biotechnol. 19:423-8, 2001, Ness et al., Adv Protein
Chem. 55:261-92, 2000, Minshull and Stemmer Curr Opin Chem Biol.
3:284-90, 1999, Huisman and Gray Curr Opin Biotechnol.
August;13:352-8, 2002, and see U.S. patent application
2006/0195947). A library of NAD(P)H dependent oxidoreductases is
generated by standard methods, such as error prone PCR,
site-specific random mutagenesis, site specific saturation
mutagenesis, or site directed specific mutagenesis. Additionally, a
library can be created through the "shuffling" of naturally
occurring NAD(P)H dependent oxidoreductase encoding sequences. The
library is expressed in a suitable host, such as E. coli.
Individual colonies expressing a different member of the
oxido/reductase library is then analyzed for its expression of an
oxido/reductase that can catalyze the reduction of a fatty alcohol.
For example, each cell can be assayed as a whole cell
bioconversion, a cell extract, a permeabilized cell, or a purified
enzyme. Fatty alcohol reductases are identified by the monitoring
the fatty alcohol dependent oxidation of NAD(P)H
spectrophotometrically or fluorometrically. Production of alkanes
is monitored by GC/MS, TLC, or other methods. An oxido/reductase
identified in this manner is used to produce alkanes, alkenes, and
related branched hydrocarbons. This is achieved either in vitro or
in vivo. The latter is achieved by expressing the evolved fatty
alcohol reductase gene in an organism that produces fatty alcohols,
such as those described herein. The fatty alcohols act as
substrates for the alcohol reductase which would produce alkanes.
Other oxidoreductases can be also engineered to catalyze this
reaction, such as those that use molecular hydrogen, glutathione,
FADH, or other reductive coenzymes.
II. Genetic Engineering of Production Strain to increase Fatty Acid
Derivative Production
[0100] Heterologous DNA sequences involved in a biosynthetic
pathway for the production of fatty acid derivatives can be
introduced stably or transiently into a host cell using techniques
well known in the art for example electroporation, calcium
phosphate precipitation, DEAE-dextran mediated transfection,
liposome-mediated transfection, conjugation, transduction, and the
like. For stable transformation, a DNA sequence can further include
a selectable marker, such as, antibiotic resistance, for example
resistance to neomycin, tetracycline, chloramphenicol, kanamycin,
genes that complement auxotrophic deficiencies, and the like.
[0101] Various embodiments of this disclosure utilize an expression
vector that includes a heterologous DNA sequence encoding a protein
involved in a metabolic or biosynthetic pathway. Suitable
expression vectors include, but are not limited to, viral vectors,
such as baculovirus vectors, phage vectors, such as bacteriophage
vectors, plasmids, phagemids, cosmids, fosmids, bacterial
artificial chromosomes, viral vectors (e.g. viral vectors based on
vaccinia virus, poliovirus, adenovirus, adeno-associated virus,
SV40, herpes simplex virus, and the like), P1-based artificial
chromosomes, yeast plasmids, yeast artificial chromosomes, and any
other vectors specific for specific hosts of interest (such as E.
coli, Pseudomonas pisum and Saccharomyces cerevisiae).
[0102] Useful expression vectors can include one or more selectable
marker genes to provide a phenotypic trait for selection of
transformed host cells. The selectable marker gene encodes a
protein necessary for the survival or growth of transformed host
cells grown in a selective culture medium. Host cells not
transformed with the vector containing the selectable marker gene
will not survive in the culture medium. Typical selection genes
encode proteins that (a) confer resistance to antibiotics or other
toxins, e.g., ampicillin, neomycin, methotrexate, or tetracycline,
(b) complement auxotrophic deficiencies, or (c) supply critical
nutrients not available from complex media, e.g., the gene encoding
D-alanine racemase for Bacilli. In alternative embodiments, the
selectable marker gene is one that encodes dihydrofolate reductase
or confers neomycin resistance (for use in eukaryotic cell
culture), or one that confers tetracycline or ampicillin resistance
(for use in a prokaryotic host cell, such as E. coli).
[0103] The biosynthetic pathway gene product-encoding DNA sequence
in the expression vector is operably linked to an appropriate
expression control sequence, (promoters, enhancers, and the like)
to direct synthesis of the encoded gene product. Such promoters can
be derived from microbial or viral sources, including CMV and SV40.
Depending on the host/vector system utilized, any of a number of
suitable transcription and translation control elements, including
constitutive and inducible promoters, transcription enhancer
elements, transcription terminators, etc. can be used in the
expression vector (see e.g., Bitter et al., Methods in Enzymology,
153:516-544, 1987).
[0104] Suitable promoters for use in prokaryotic host cells
include, but are not limited to, promoters capable of recognizing
the T4, T3, Sp6 and T7 polymerases, the P.sub.R and P.sub.L
promoters of bacteriophage lambda, the trp, recA, heat shock, and
lacZ promoters of E. coli, the alpha-amylase and the sigma-specific
promoters of B. subtilis, the promoters of the bacteriophages of
Bacillus, Streptomyces promoters, the int promoter of bacteriophage
lambda, the bla promoter of the beta-lactamase gene of pBR322, and
the CAT promoter of the chloramphenicol acetyl transferase gene.
Prokaryotic promoters are reviewed by Glick, J. Ind. Microbiol.
1:277, 1987; Watson et al., MOLECULAR BIOLOGY OF THE GENE, 4th Ed.,
Benjamin Cummins (1987); and Sambrook et al., supra.
[0105] Non-limiting examples of suitable eukaryotic promoters for
use within a eukaryotic host are viral in origin and include the
promoter of the mouse metallothionein I gene (Hamer et al., J. Mol.
Appl. Gen. 1:273, 1982); the TK promoter of Herpes virus (McKnight,
Cell 31:355, 1982); the SV40 early promoter (Benoist et al., Nature
(London) 290:304, 1981); the Rous sarcoma virus promoter; the
cytomegalovirus promoter (Foecking et al., Gene 45:101, 1980); the
yeast gal4 gene promoter (Johnston, et al., PNAS (USA) 79:6971,
1982; Silver, et al., PNAS (USA) 81:5951, 1984); and the IgG
promoter (Orlandi et al., PNAS (USA) 86:3833, 1989).
[0106] The microbial host cell can be genetically modified with a
heterologous DNA sequence encoding a biosynthetic pathway gene
product that is operably linked to an inducible promoter. Inducible
promoters are well known in the art. Suitable inducible promoters
include, but are not limited to promoters that are affected by
proteins, metabolites, or chemicals. These include: a bovine
leukemia virus promoter, a metallothionein promoter, a
dexamethasone-inducible MMTV promoter, a SV40 promoter, a MRP
polIII promoter, a tetracycline-inducible CMV promoter (such as the
human immediate-early CMV promoter) as well as those from the trp
and lac operons.
[0107] In some examples a genetically modified host cell is
genetically modified with a heterologous DNA sequence encoding a
biosynthetic pathway gene product that is operably linked to a
constitutive promoter. Suitable constitutive promoters are known in
the art and include, constitutive adenovirus major late promoter, a
constitutive MPSV promoter, and a constitutive CMV promoter.
[0108] In some examples a modified host cell is one that is
genetically modified with an exongenous DNA sequence encoding a
single protein involved in a biosynthesis pathway.
[0109] In other embodiments, a modified host cell is one that is
genetically modified with exongenous DNA sequences encoding two or
more proteins involved in a biosynthesis pathway--for example, the
first and second enzymes in a biosynthetic pathway.
[0110] Where the host cell is genetically modified to express two
or more proteins involved in a biosynthetic pathway, those DNA
sequences can each be contained in a single or in separate
expression vectors. When those DNA sequences are contained in a
single expression vector, in some embodiments, the nucleotide
sequences will be operably linked to a common control element
(e.g., a promoter), e.g., the common control element controls
expression of all of the biosynthetic pathway protein-encoding DNA
sequences in the single expression vector.
[0111] When a modified host cell is genetically modified with
heterologous DNA sequences encoding two or more proteins involved
in a biosynthesis pathway, one of the DNA sequences can be operably
linked to an inducible promoter, and one or more of the DNA
sequences can be operably linked to a constitutive promoter.
[0112] In some embodiments, the intracellular concentration (e.g.,
the concentration of the intermediate in the genetically modified
host cell) of the biosynthetic pathway intermediate can be
increased to further boost the yield of the final product. The
intracellular concentration of the intermediate can be increased in
a number of ways, including, but not limited to, increasing the
concentration in the culture medium of a substrate for a
biosynthetic pathway; increasing the catalytic activity of an
enzyme that is active in the biosynthetic pathway; increasing the
intracellular amount of a substrate (e.g., a primary substrate) for
an enzyme that is active in the biosynthetic pathway; and the
like.
[0113] In some examples the fatty acid derivative or intermediate
is produced in the cytoplasm of the cell. The cytoplasmic
concentration can be increased in a number of ways, including, but
not limited to, binding of the fatty acid to coenzyme A to form an
acyl-CoA thioester. Additionally, the concentration of acyl-CoAs
can be increased by increasing the biosynthesis of CoA in the cell,
such as by over-expressing genes associated with pantothenate
biosynthesis (panD) or knocking out the genes associated with
glutathione biosynthesis (glutathione synthase).
III. Carbon Chain Characteristics
[0114] Using the teachings provided herein a range of products can
be produced. These products include hydrocarbons, fatty alcohols,
fatty acid esters, and waxes. Some of these products are useful as
biofuels and specialty chemicals. These products can be designed
and produced in microorganisms. The products can be produced such
that they contain branch points, levels of saturation, and carbon
chain length, thus, making these products desirable starting
materials for use in many applications (FIG. 10 provides a
description of the various enzymes that can be used alone or in
combination to make various fatty acid derivatives).
[0115] In other examples, the expression of exongenous FAS genes
originating from different species or engineered variants can be
introduced into the host cell to result in the biosynthesis of
fatty acid metabolites structurally different (in length,
branching, degree of unsaturation, etc.) as that of the native
host. These heterologous gene products can be also chosen or
engineered so that they are unaffected by the natural complex
regulatory mechanisms in the host cell and, therefore, function in
a manner that is more controllable for the production of the
desired commercial product. For example the FAS enzymes from
Bacillus subtilis, Saccharomyces cerevisiae, Streptomyces spp,
Ralstonia, Rhodococcus, Corynebacteria, Brevibacteria,
Mycobacteria, oleaginous yeast, and the like can be expressed in
the production host.
[0116] One of ordinary skill in the art will appreciate that when a
production host is engineered to produce a fatty acid from the
fatty acid biosynthetic pathway that contains a specific level of
unsaturation, branching, or carbon chain length the resulting
engineered fatty acid can be used in the production of the fatty
acid derivatives. Hence, fatty acid derivatives generated from the
production host can display the characteristics of the engineered
fatty acid. For example, a production host can be engineered to
make branched, short chain fatty acids, and then using the
teachings provided herein relating to fatty alcohol production
(i.e. including alcohol forming enzymes such as FAR) the production
host produce branched, short chain fatty alcohols. Similarly, a
hydrocarbon can be produced by engineering a production host to
produce a fatty acid having a defined level of branching,
unsaturation, and/or carbon chain length, thus, producing a
homogenous hydrocarbon population. Moreover, when an unsaturated
alcohol, fatty acid ester, or hydrocarbon is desired the fatty acid
biosynthetic pathway can be engineered to produce low levels of
saturated fatty acids and an additional desaturase can be expressed
to lessen the saturated product production.
[0117] A. Saturation
[0118] Production hosts can be engineered to produce unsaturated
fatty acids by engineering the production host to over-express
fabB, or by growing the production host at low temperatures (for
example less than 37.degree. C.). FabB has preference to
cis-.delta..sup.3decenoyl-ACP and results in unsaturated fatty acid
production in E. coli. Over-expression of FabB resulted in the
production of a significant percentage of unsaturated fatty acids
(de Mendoza et al., J. Biol. Chem., 258:2098-101, 1983). These
unsaturated fatty acids can then be used as intermediates in
production hosts that are engineered to produce fatty acid
derivatives, such as fatty alcohols, esters, waxes, olefins,
alkanes, and the like. One of ordinary skill in the art will
appreciate that by attenuating fabA, or over-expressing FabB and
expressing specific thioesterases (described below), unsaturated
fatty acid derivatives having a desired carbon chain length can be
produced. Alternatively, the repressor of fatty acid biosynthesis,
FabR (Genbank accession NP.sub.--418398), can be deleted, which
will also result in increased unsaturated fatty acid production in
E. coli (Zhang et al., J. Biol. Chem. 277:pp. 15558, 2002.).
Further increase in unsaturated fatty acids may be achieved by
over-expression of FabM (trans-2, cis-3-decenoyl-ACP isomerase,
Genbank accession DAA05501) and controlled expression of FabK
(trans-2-enoyl-ACP reductase II, Genbank accession NP.sub.--357969)
from Streptococcus pneumoniae (Marrakchi et al., J. Biol. Chem.
277: 44809, 2002), while deleting E. coli Fab I ((trans-2-enoyl-ACP
reductase, Genbank accession NP.sub.--415804). Additionally, to
increase the percentage of unsaturated fatty acid esters, the
microorganism can also have fabB (encoding .beta.-ketoacyl-ACP
synthase I, Accessions: BAA16180, EC:2.3.1.41), Sfa (encoding a
suppressor of fabA, Accession: AAC44390) and gnsA and gnsB (both
encoding secG null mutant suppressors, a.k.a. cold shock proteins,
Accession: ABD18647.1, AAC74076.1) over-expressed.
[0119] In some examples, the endogenous fabF gene can be
attenuated, thus, increasing the percentage of palmitoleate (C16:1)
produced.
[0120] B. Branching Including Cyclic Moieties
[0121] Fatty acid derivatives can be produced that contain branch
points, cyclic moieties, and combinations thereof, using the
teachings provided herein.
[0122] Microorganisms that naturally produce straight fatty acids
(sFAs) can be engineered to produce branched chain fatty acids
(brFAs) by expressing one or more exogenous nucleic acid sequences.
For example, E. coli naturally produces straight fatty acids
(sFAs). To engineer E. coli to produce brFAs, several genes can be
introduced and expressed that provide branched precursors (bkd
operon) and allow initiation of fatty acid biosynthesis from
branched precursors (fabH). Additionally, the organism can express
genes for the elongation of brFAs (e.g. ACP, FabF) and/or deleting
the corresponding E. coli genes that normally lead to sFAs and
would compete with the introduced genes (e.g. FabH, FabF).
[0123] The branched acyl-CoAs 2-methyl-buturyl-CoA, isovaleryl-CoA
and isobuturyl-CoA are the precursors of brFA. In most
brFA-containing microorganisms they are synthesized in two steps
(described in detail below) from branched amino acids (isoleucine,
leucine and valine) (Kadena, Microbiol. Rev. 55: pp. 288, 1991). To
engineer a microorganism to produce brFAs, or to overproduce brFAs,
expression or over-expression of one or more of the enzymes in
these two steps can be engineered. For example, in some instances
the production host may have an endogenous enzyme that can
accomplish one step and therefore, only enzymes involved in the
second step need to be expressed recombinantly.
[0124] The first step in forming branched fatty acids is the
production of the corresponding .alpha.-keto acids by a
branched-chain amino acid aminotransferase. E. coli has such an
enzyme, IlvE (EC 2.6.1.42; Genbank accession YP.sub.--026247). In
some examples, a heterologous branched-chain amino acid
aminotransferase may not be expressed. However, E. coli IlvE or any
other branched-chain amino acid aminotransferase, e.g. ilvE from
Lactococcus lactis (Genbank accession AAF34406), ilvE from
Pseudomonas putida (Genbank accession NP.sub.--745648) or ilvE from
Streptomyces coelicolor (Genbank accession NP.sub.--629657) can be
over-expressed in a host microorganism, should the aminotransferase
reaction turn out to be rate limiting in brFA biosynthesis in the
host organism chosen for fatty acid derivative production.
[0125] The second step, the oxidative decarboxylation of the
.alpha.-ketoacids to the corresponding branched-chain acyl-CoA, is
catalyzed by a branched-chain .alpha.-keto acid dehydrogenase
complexes (bkd; EC 1.2.4.4.) (Denoya et al. J. Bacteriol. 177:pp.
3504, 1995), which consist of E1.alpha./.beta. (decarboxylase), E2
(dihydrolipoyl transacylase) and E3 (dihydrolipoyl dehydrogenase)
subunits and are similar to pyruvate and .alpha.-ketoglutarate
dehydrogenase complexes. Table 2 shows potential bkd genes from
several microorganisms, that can be expressed in a production host
to provide branched-chain acyl-CoA precursors. Basically, every
microorganism that possesses brFAs and/or grows on branched-chain
amino acids can be used as a source to isolate bkd genes for
expression in production hosts such as, for example, E. coli.
Furthermore, E. coli has the E3 component (as part of its pyruvate
dehydrogenase complex; 1pd, EC 1.8.1.4, Genbank accession
NP.sub.--414658), it can therefore, be sufficient to only express
the E1.alpha./.beta. and E2 bkd genes.
TABLE-US-00002 TABLE 2 Bkd genes from selected microorganisms
Genbank Organism Gene Accession # Streptomyces coelicolor bkdA1
(E1.alpha.) NP_628006 bkdB1 (E1.alpha.) NP_628005 bkdC1 (E2)
NP_638004 Streptomyces coelicolor bkdA2 (E1.alpha.) NP_733618 bkdB2
(E1.alpha.) NP_628019 bkdC2 (E2) NP_628018 Streptomyces avermitilis
bkdA (E1a) BAC72074 bkdB (E1b) BAC72075 bkdC (E2) BAC72076
Streptomyces avermitilis bkdF (E1.alpha.) BAC72088 bkdG (E1.alpha.)
BAC72089 bkdH (E2) BAC72090 Bacillus subtilis bkdAA (E1.alpha.)
NP_390288 bkdAB (E1.alpha.) NP_390288 bkdB (E2) NP_390288
Pseudomonas putida bkdA1 (E1.alpha.) AAA65614 bkdA2 (E1.alpha.)
AAA65615 bkdC (E2) AAA65617
[0126] In another example, isobuturyl-CoA can be made in a
production host, for example in E. coli through the coexpression of
a crotonyl-CoA reductase (Ccr, EC 1.1.1.9) and isobuturyl-CoA
mutase (large subunit IcmA, EC 5.4.99.2; small subunit IcmB, EC
5.4.99.13) (Han and Reynolds J. Bacteriol. 179:pp. 5157, 1997).
Crotonyl-CoA is an intermediate in fatty acid biosynthesis in E.
coli and other microorganisms. Examples for ccr and icm genes from
selected microorganisms are given in Table 3.
TABLE-US-00003 TABLE 3 Ccr and icm genes from selected
microorganisms Genbank Organism Gene Accession # Streptomyces
coelicolor ccr NP_630556 icmA NP_629554 icmB NP_630904 Streptomyces
cinnamonensis ccr AAD53915 icmA AAC08713 icmB AJ246005
[0127] In addition to expression of the bkd genes (see above), the
initiation of brFA biosynthesis utilizes
.beta.-ketoacyl-acyl-carrier-protein synthase III (FabH, EC
2.3.1.41) with specificity for branched chain acyl CoAs (Li et al.
J. Bacteriol. 187:pp. 3795, 2005). Examples of such FabHs are
listed in Table 4. FabH genes that are involved in fatty acid
biosynthesis of any brFA-containing microorganism can be expressed
in a production host. The Bkd and FabH enzymes from production
hosts that do not naturally make brFA may not support brFA
production and therefore, Bkd and FabH can be expressed
recombinantly. Similarly, the endogenous level of Bkd and FabH
production may not be sufficient to produce brFA, therefore, they
can be over-expressed. Additionally, other components of fatty acid
biosynthesis machinery can be expressed such as acyl carrier
proteins (ACPs) and .beta.-ketoacyl-acyl-carrier-protein synthase
II candidates are acyl carrier proteins (ACPs) and
.beta.-ketoacyl-acyl-carrier-protein synthase II (fabF, EC
2.3.1.41) (candidates are listed in Table 4). In addition to
expressing these genes, some genes in the endogenous fatty acid
biosynthesis pathway may be attenuated in the production host. For
example, in E. coli the most likely candidates to interfere with
brFA biosynthesis are fabH (Genbank accession # NP.sub.--415609)
and/or fabF genes (Genbank accession #NP.sub.--415613).
[0128] As mentioned above, through the combination of expressing
genes that support brFA synthesis and alcohol synthesis branched
chain alcohols can be produced. For example, when an alcohol
reductase such as Acrl from Acinetobacter baylyi ADP1 is
coexpressed with a bkd operon, E. coli can synthesize isopentanol,
isobutanol or 2-methyl butanol. Similarly, when Acr1 is coexpressed
with ccr/icm genes, E. coli can synthesize isobutanol.
[0129] In order to convert a production host such as E. coli into
an organism capable of synthesizing co-cyclic fatty acids (cyFAs),
several genes need to be introduced and expressed that provide the
cyclic precursor cyclohexylcarbonyl-CoA (Cropp et al. Nature
Biotech. 18:pp. 980, 2000). The genes listed in Table 4 (fabH, ACP
and fabF) can then be expressed to allow initiation and elongation
of .omega.-cyclic fatty acids. Alternatively, the homologous genes
can be isolated from microorganisms that make cyFAs and expressed
in E. coli.
TABLE-US-00004 TABLE 4 FabH, ACP and fabF genes from selected
microorganisms with brFAs Genbank Organism Gene Accession #
Streptomyces coelicolor fabH1 NP_626634 ACP NP_626635 fabF
NP_626636 Streptomyces avermitilis fabH3 NP_823466 fabC3 (ACP)
NP_823467 fabF NP_823468 Bacillus subtilis fabH_A NP_389015 fabH_B
NP_388898 ACP NP_389474 fabF NP_389016 Stenotrophomonas
SmalDRAFT_0818 (FabH) ZP_01643059 maltophilia SmalDRAFT_0821 (ACP)
ZP_01643063 SmalDRAFT_0822 (FabF) ZP_01643064 Legionella
pneumophila FabH YP_123672 ACP YP_123675 fabF YP_123676
[0130] Expression of the following genes are sufficient to provide
cyclohexylcarbonyl-CoA in E. coli: ansJ, ansK, ansL, chcA and ansM
from the ansatrienin gene cluster of Streptomyces collinus (Chen et
al., Eur. J. Biochem. 261:pp. 1999, 1999) or plmJ, plmL, chcA and
plmM from the phoslactomycin B gene cluster of Streptomyces sp.
HK803 (Palaniappan et al., J. Biol. Chem. 278:pp. 35552, 2003)
together with the chcB gene (Patton et al. Biochem., 39:pp. 7595,
2000) from S. collinus, S. avermitilis or S. coelicolor (see Table
5 for Genbank accession numbers).
TABLE-US-00005 TABLE 5 Genes for the synthesis of
cyclohexylcarbonyl-CoA Genbank Organism Gene Accession #
Streptomyces collinus ansJK U72144* ansL chcA ansL chcB AF268489
Streptomyces sp. HK803 pmlJK AAQ84158 pmlL AAQ84159 chcA AAQ84160
pmlM AAQ84161 Streptomyces coelicolor chcB/caiD NP_629292
Streptomyces avermitilis chcB/caiD NP_629292 Only chcA is annotated
in Genbank entry U72144, ansJKLM are according to Chen et al. (Eur.
J. Biochem. 261: pp. 1999, 1999)
[0131] The genes listed in Table 4 (fabH, ACP and fabF) are
sufficient to allow initiation and elongation of co-cyclic fatty
acids, because they can have broad substrate specificity. In the
event that coexpression of any of these genes with the
ansJKLM/chcAB or pm1JKLM/chcAB genes from Table 5 does not yield
cyFAs,fabH, ACP and/or fabF homologs from microorganisms that make
cyFAs can be isolated (e.g. by using degenerate PCR primers or
heterologous DNA probes) and coexpressed. Table 6 lists selected
microorganisms that contain co-cyclic fatty acids.
TABLE-US-00006 TABLE 6 Examples of microorganisms that contain
.omega.-cyclic fatty acids Organism Reference Curtobacterium
pusillum ATCC19096 Alicyclobacillus acidoterrestris ATCC49025
Alicyclobacillus acidocaldarius ATCC27009 Alicyclobacillus
cycloheptanicum* Moore, J. Org. Chem. 62: pp. 2173, 1997. *uses
cycloheptylcarbonyl-CoA and not cyclohexylcarbonyl-CoA as precursor
for cyFA biosynthesis
[0132] C. Ester characteristics
[0133] One of ordinary skill in the art will appreciate that an
ester includes an A side and a B side. As described herein, the B
side is contributed by a fatty acid produced from de novo synthesis
in the host organism. In some instances where the host is
additionally engineered to make alcohols, including fatty alcohols,
the A side is also produced by the host organism. In yet other
examples the A side can be provided in the medium. As described
herein, by selecting the desired thioesterase genes the B side, and
when fatty alcohols are being made the A side, can be designed to
be have certain carbon chain characteristics. These characteristics
include points of unsaturation, branching, and desired carbon chain
lengths. Exemplary methods of making long chain fatty acid esters,
wherein the A and B side are produced by the production host are
provided in Example 6, below. Similarly, Example 5 provides methods
of making medium chain fatty acid esters. When both the A and B
side are contributed by the production host and they are produced
using fatty acid biosynthetic pathway intermediates they will have
similar carbon chain characteristics. For example, at least 50%,
60%, 70%, or 80% of the fatty acid esters produced will have A
sides and B sides that vary by 6, 4, or 2 carbons in length. The A
side and the B side will also display similar branching and
saturation levels.
[0134] In addition to producing fatty alcohols for contribution to
the A side, the host can produce other short chain alcohols such as
ethanol, propanol, isopropanol, isobutanol, and butanol for
incorporation on the A side using techniques well known in the art.
For example, butanol can be made by the host organism. To create
butanol producing cells, the LS9001 strain (described in Example 1,
below) can be further engineered to express atoB (acetyl-CoA
acetyltransferase) from Escherichia coli K12,
.beta.-hydroxybutyryl-CoA dehydrogenase from Butyrivibrio
fibrisolvens, crotonase from Clostridium beijerinckii, butyryl CoA
dehydrogense from Clostridium beijerinckii, CoA-acylating aldehyde
dehydrogenase (ALDH) from Cladosporium fulvum, and adhE encoding an
aldehyde-alchol dehydrogenase of Clostridium acetobutylicum in the
pBAD24 expression vector under the prpBCDE promoter system.
Similarly, ethanol can be produced in a production host using the
methods taught by Kalscheuer et al., Microbiology 152:2529-2536,
2006, which is herein incorporated by reference.
IV. Fermentation
[0135] The production and isolation of fatty acid derivatives can
be enhanced by employing specific fermentation techniques. One
method for maximizing production while reducing costs is increasing
the percentage of the carbon source that is converted to
hydrocarbon products. During normal cellular lifecycles carbon is
used in cellular functions including producing lipids, saccharides,
proteins, organic acids, and nucleic acids. Reducing the amount of
carbon necessary for growth-related activities can increase the
efficiency of carbon source conversion to output. This can be
achieved by first growing microorganisms to a desired density, such
as a density achieved at the peak of the log phase of growth. At
such a point, replication checkpoint genes can be harnessed to stop
the growth of cells. Specifically, quorum sensing mechanisms
(reviewed in Camilli and Bassler Science 311:1113, 2006; Venturi
FEMS Microbio Rev 30:274-291, 2006; and Reading and Sperandio FEMS
Microbiol Lett 254:1-11, 2006) can be used to activate genes such
as p53, p21, or other checkpoint genes. Genes that can be activated
to stop cell replication and growth in E. coli include umuDC genes,
the over-expression of which stops the progression from stationary
phase to exponential growth (Murli et al., J. of Bact. 182:1127,
2000). UmuC is a DNA polymerase that can carry out translesion
synthesis over non-coding lesions--the mechanistic basis of most UV
and chemical mutagenesis. The umuDC gene products are used for the
process of translesion synthesis and also serve as a DNA damage
checkpoint. UmuDC gene products include UmuC, UmuD, umuD', UmuD',
UmuD'.sub.2C, UmuD'.sub.2 and UmuD.sub.2. Simultaneously, the
product producing genes would be activated, thus minimizing the
need for replication and maintenance pathways to be used while the
fatty acid derivative is being made.
[0136] The percentage of input carbons converted to hydrocarbon
products is a cost driver. The more efficient (i.e. the higher the
percentage), the less expensive the process. For oxygen-containing
carbon sources (i.e. glucose and other carbohydrate based sources),
the oxygen must be released in the form of carbon dioxide. For
every 2 oxygen atoms released, a carbon atom is also released
leading to a maximal theoretical metabolic efficiency of about 34%
(w/w) (for fatty acid derived products). This figure, however,
changes for other hydrocarbon products and carbon sources. Typical
efficiencies in the literature are about <5%. Engineered
microorganisms which produce hydrocarbon products can have greater
than 1, 3, 5, 10, 15, 20, 25, and 30% efficiency. In one example
microorganisms will exhibit an efficiency of about 10% to about
25%. In other examples, such microorganisms will exhibit an
efficiency of about 25% to about 30%, and in other examples such
microorganisms will exhibit >30% efficiency.
[0137] In some examples where the final product is released from
the cell, a continuous process can be employed. In this approach, a
reactor with organisms producing fatty acid derivatives can be
assembled in multiple ways. In one example, a portion of the media
is removed and let to sit. Fatty acid derivatives are separated
from the aqueous layer, which will in turn, be returned to the
fermentation chamber.
[0138] In one example, the fermentation chamber will enclose a
fermentation that is undergoing a continuous reduction. In this
instance, a stable reductive environment would be created. The
electron balance would be maintained by the release of carbon
dioxide (in gaseous form). Efforts to augment the NAD/H and NADP/H
balance can also facilitate in stabilizing the electron
balance.
[0139] The availability of intracellular NADPH can be also enhanced
by engineering the production host to express an NADH:NADPH
transhydrogenase. The expression of one or more NADH:NADPH
transhydrogenase converts the NADH produced in glycolysis to NADPH
which enhances the production of fatty acid derivatives.
[0140] Disclosed herein is a system for continuously producing and
exporting fatty acid derivatives out of recombinant host
microorganisms via a transport protein. Many transport and efflux
proteins serve to excrete a large variety of compounds and can be
evolved to be selective for a particular type of fatty acid
derivatives. Thus, in some embodiments an exogenous DNA sequence
encoding an ABC transporter will be functionally expressed by the
recombinant host microorganism, so that the microorganism exports
the fatty acid derivative into the culture medium. In one example,
the ABC transporter is an ABC transporter from Caenorhabditis
elegans, Arabidopsis thalania, Alkaligenes eutrophus or Rhodococcus
erythropolis (locus AAN73268). In another example, the ABC
transporter is an ABC transporter chosen from CER5 (locuses
At1g51500 or AY734542), AtMRP5, AmiS2 and AtPGPI. In some examples,
the ABC transporter is CER5. In yet another example, the CER5 gene
is from Arabidopsis (locuses At1g51500, AY734542, At3g21090 and
At1g51460).
[0141] The transport protein, for example, can also be an efflux
protein selected from: AcrAB, TolC and AcrEF from E. coli, or
tll1618, tll1619 and tll0139 from Thermosynechococcus elongatus
BP-1.
[0142] In addition, the transport protein can be, for example, a
fatty acid transport protein (FATP) selected from Drosophila
melanogaster, Caenorhabditis elegans, Mycobacterium tuberculosis or
Saccharomyces cerevisiae or any one of the mammalian FATP's. The
FATPs can additionally be resynthesized with the membranous regions
reversed in order to invert the direction of substrate flow.
Specifically, the sequences of amino acids composing the
hydrophilic domains (or membrane domains) of the protein, could be
inverted while maintaining the same codons for each particular
amino acid. The identification of these regions is well known in
the art.
[0143] Production hosts can also be chosen for their endogenous
ability to release fatty acid derivatives. The efficiency of
product production and release into the fermentation broth can be
expressed as a ratio intracellular product to extracellular
product. In some examples the ratio can be 5:1, 4:1, 3:1, 2:1, 1:1,
1:2, 1:3, 1:4, or 1:5.
[0144] The production host can be additionally engineered to
express recombinant cellulosomes, such as those described in PCT
application number PCT/US2007/003736, which will allow the
production host to use cellulosic material as a carbon source. For
example, the production host can be additionally engineered to
express invertases (EC 3.2.1.26) so that sucrose can be used as a
carbon source.
[0145] Similarly, the production host can be engineered using the
teachings described in U.S. Pat. Nos. 5,000,000, 5,028,539,
5,424,202, 5,482,846, and 5,602,030 to Ingram et al. so that the
production host can assimilate carbon efficiently and use
cellulosic materials as carbons sources.
IV. Post Production Processing
[0146] The fatty acid derivatives produced during fermentation can
be separated from the fermentation media. Any technique known for
separating fatty acid derivatives from aqueous media can be used.
One exemplary separation process provided herein is a two phase
(bi-phasic) separation process. This process involves fermenting
the genetically engineered production hosts under conditions
sufficient to produce a fatty acid derivative, allowing the
derivative to collect in an organic phase and separating the
organic phase from the aqueous fermentation broth. This method can
be practiced in both a batch and continuous fermentation
setting.
[0147] Bi-phasic separation uses the relative immisiciblity of
fatty acid derivatives to facilitate separation. Immiscible refers
to the relative inability of a compound to dissolve in water and is
defined by the compounds partition coefficient. The partition
coefficient, P, is defined as the equilibrium concentration of
compound in an organic phase (in a bi-phasic system the organic
phase is usually the phase formed by the fatty acid derivative
during the production process, however, in some examples an organic
phase can be provided (such as a layer of octane to facilitate
product separation) divided by the concentration at equilibrium in
an aqueous phase (i.e. fermentation broth). When describing a two
phase system the P is usually discussed in terms of logP. A
compound with a logP of 10 would partition 10:1 to the organic
phase, while a compound of logP of 0.1 would partition 10:1 to the
aqueous phase. One or ordinary skill in the art will appreciate
that by choosing a fermentation broth and the organic phase such
that the fatty acid derivative being produced has a high logP
value, the fatty acid derivative will separate into the organic
phase, even at very low concentrations in the fermentation
vessel.
[0148] The fatty acid derivatives produced by the methods described
herein will be relatively immiscible in the fermentation broth, as
well as in the cytoplasm. Therefore, the fatty acid derivative will
collect in an organic phase either intracellularly or
extracellularly. The collection of the products in an organic phase
will lessen the impact of the fatty acid derivative on cellular
function and will allow the production host to produce more
product. Stated another way, the concentration of the fatty acid
derivative will not have as significant of an impact on the host
cell.
[0149] The fatty alcohols, fatty acid esters, waxes, and
hydrocarbons produced as described herein allow for the production
of Komogeneous compounds wherein at least 60%, 70%, 80%, 90%, or
95% of the fatty alcohols, fatty acid esters, and waxes produced
will have carbon chain lengths that vary by less than 4 carbons, or
less than 2 carbons. These compounds can also be produced so that
they have a relatively uniform degree of saturation, for example at
least 60%, 70%, 80%, 90%, or 95% of the fatty alcohols, fatty acid
esters, hydrocarbons and waxes will be mono-, di-, or
tri-unsaturated. These compounds can be used directly as fuels,
personal care additives, nutritional supplements. These compounds
can also be used as feedstock for subsequent reactions for example
transesterification, hydrogenation, catalytic cracking via either
hydrogenation, pyrolisis, or both or epoxidations reactions to make
other products.
V. Fuel Compositions
[0150] The fatty acid derivatives described herein can be used as
fuel. One of ordinary skill in the art will appreciate that
depending upon the intended purpose of the fuel different fatty
acid derivatives can be produced and used. For example, for
automobile fuel that is intended to be used in cold climates a
branched fatty acid derivative may be desirable and using the
teachings provided herein, branched hydrocarbons, fatty acid
esters, and alcohols can be made. Using the methods described
herein fuels comprising relatively homogeneous fatty acid
derivatives that have desired fuel qualities can be produced. Such
fuels can be characterized by carbon fingerprinting, their lack of
impurities when compared to petroleum derived fuels or bio-diesel
derived from triglycerides and, moreover, the fatty acid derivative
based fuels can be combined with other fuels or fuel additives to
produce fuels having desired properties.
[0151] A. Carbon Fingerprinting
[0152] Biologically produced fatty acid derivatives represent a new
feedstock for fuels, such as alcohols, diesel and gasoline. Some
biofuels made using fatty acid derivatives have not been produced
from renewable sources and as such, are new compositions of matter.
These new fuels can be distinguished from fuels derived form
petrochemical carbon on the basis of dual carbon-isotopic
fingerprinting. Additionally, the specific source of biosourced
carbon (e.g. glucose vs. glycerol) can be determined by dual
carbon-isotopic fingerprinting (see, U.S. Pat. No. 7,169,588, which
is herein incorporated by reference).
[0153] This method usefully distinguishes chemically-identical
materials, and apportions carbon in products by source (and
possibly year) of growth of the biospheric (plant) component. The
isotopes, .sup.14C and .sup.13C, bring complementary information to
this problem. The radiocarbon dating isotope (.sup.14C), with its
nuclear half life of 5730 years, clearly allows one to apportion
specimen carbon between fossil ("dead") and biospheric ("alive")
feedstocks [Currie, L. A. "Source Apportionment of Atmospheric
Particles," Characterization of Environmental Particles, J. Buffle
and H. P. van Leeuwen, Eds., 1 of Vol. I of the IUPAC Environmental
Analytical Chemistry Series (Lewis Publishers, Inc) (1992) 3 74].
The basic assumption in radiocarbon dating is that the constancy of
.sup.14C concentration in the atmosphere leads to the constancy of
.sup.14C in living organisms. When dealing with an isolated sample,
the age of a sample can be deduced approximately by the
relationship t=(-5730/0.693)1n(A/A.sub.O) (Equation 5) where t=age,
5730 years is the half-life of radiocarbon, and A and A.sub.O are
the specific .sup.14C activity of the sample and of the modern
standard, respectively [Hsieh, Y., Soil Sci. Soc. Am J., 56, 460,
(1992)]. However, because of atmospheric nuclear testing since 1950
and the burning of fossil fuel since 1850, .sup.14C has acquired a
second, geochemical time characteristic. Its concentration in
atmospheric CO2--and hence in the living biosphere--approximately
doubled at the peak of nuclear testing, in the mid-1960s. It has
since been gradually returning to the steady-state cosmogenic
(atmospheric) baseline isotope rate (.sup.14C/.sup.12C) of ca.
1.2.times.10.sup.12, with an approximate relaxation "half-life" of
7-10 years. (This latter half-life must not be taken literally;
rather, one must use the detailed atmospheric nuclear input/decay
function to trace the variation of atmospheric and biospheric
.sup.14C since the onset of the nuclear age.) It is this latter
biospheric .sup.14C time characteristic that holds out the promise
of annual dating of recent biospheric carbon. .sup.14C can be
measured by accelerator mass spectrometry (AMS), with results given
in units of "fraction of modern carbon" (f.sub.M). f.sub.M is
defined by National Institute of Standards and Technology (NIST)
Standard Reference Materials (SRMs) 4990B and 4990C, known as
oxalic acids standards HOxI and HOxII, respectively. The
fundamental definition relates to 0.95 times the .sup.14C/.sup.12C
isotope ratio HOxI (referenced to AD 1950). This is roughly
equivalent to decay-corrected pre-Industrial Revolution wood. For
the current living biosphere (plant material), f.sub.M approx
1.1.
[0154] The stable carbon isotope ratio (.sup.13C /.sup.12C)
provides a complementary route to source discrimination and
apportionment. The .sup.13C /.sup.12C ratio in a given biosourced
material is a consequence of the .sup.13C /.sup.12C ratio in
atmospheric carbon dioxide at the time the carbon dioxide is fixed
and also reflects the precise metabolic pathway. Regional
variations also occur. Petroleum, C3 plants (the broadleaf),
C.sub.4 plants (the grasses), and marine carbonates all show
significant differences in .sup.13C /.sup.12C and the corresponding
delta.sup.13C values. Furthermore, lipid matter of C3 and C4 plants
analyze differently than materials derived from the carbohydrate
components of the same plants as a consequence of the metabolic
pathway. Within the precision of measurement, .sup.13C shows large
variations due to isotopic fractionation effects, the most
significant of which for the instant invention is the
photosynthetic mechanism. The major cause of differences in the
carbon isotope ratio in plants is closely associated with
differences in the pathway of photosynthetic carbon metabolism in
the plants, particularly the reaction occurring during the primary
carboxylation, i.e., the initial fixation of atmospheric CO.sub.2.
Two large classes of vegetation are those that incorporate the "C3"
(or Calvin-Benson) photosynthetic cycle and those that incorporate
the "C4" (or Hatch-Slack) photosynthetic cycle. C3 plants, such as
hardwoods and conifers, are dominant in the temperate climate
zones. In C3 plants, the primary CO.sub.2 fixation or carboxylation
reaction involves the enzyme ribulose-1,5-diphosphate carboxylase
and the first stable product is a 3-carbon compound. C4 plants, on
the other hand, include such plants as tropical grasses, corn and
sugar cane. In C4 plants, an additional carboxylation reaction
involving another enzyme, phosphoenol-pyruvate carboxylase, is the
primary carboxylation reaction. The first stable carbon compound is
a 4-carbon acid which is subsequently decarboxylated. The CO.sub.2
thus released is refixed by the C3 cycle.
[0155] Both C4 and C3 plants exhibit a range of .sup.13C /.sup.12C
isotopic ratios, but typical values are ca. -10 to -14 per mil (C4)
and -21 to -26 per mil (C3) [Weber et al., J. Agric. Food Chem.,
45, 2942 (1997)]. Coal and petroleum fall generally in this latter
range. The .sup.13C measurement scale was originally defined by a
zero set by pee dee belemnite (PDB) limestone, where values are
given in parts per thousand deviations from this material. The
".DELTA..sup.13C ", values are in parts per thousand (per mil),
abbreviated %, and are calculated as follows:
.delta. 13 C .ident. ( 13 C / 12 C ) sample - ( 13 C / 12 C )
standard ( 13 C / 12 C ) standard .times. 100 % ( Equation 6 )
##EQU00001##
Since the PDB reference material (RM) has been exhausted, a series
of alternative RMs have been developed in cooperation with the
IAEA, USGS, NIST, and other selected international isotope
laboratories. Notations for the per mil deviations from PDB is
.DELTA..sup.13C. Measurements are made on CO.sub.2 by high
precision stable ratio mass spectrometry (IRMS) on molecular ions
of masses 44, 45 and 46.
[0156] The fatty acid derivatives and the associated biofuels,
chemicals, and mixtures may be completely distinguished from their
petrochemical derived counterparts on the basis of .sup.14C (fM)
and dual carbon-isotopic fingerprinting, indicating new
compositions of matter.
[0157] The fatty acid derivatives described herein have utility in
the production of biofuels and chemicals. The new fatty acid
derivative based product compositions provided by the instant
invention additionally may be distinguished on the basis of dual
carbon-isotopic fingerprinting from those materials derived solely
from petrochemical sources. The ability to distinguish these
products is beneficial in tracking these materials in commerce. For
example, fuels or chemicals comprising both "new" and "old" carbon
isotope profiles may be distinguished from fuels and chemicals made
only of "old" materials. Hence, the instant materials may be
followed in commerce on the basis of their unique profile and for
the purposes of defining competition, and for determining shelf
life.
[0158] In some examples a biofuel composition is made that includes
a fatty acid derivative having .delta..sup.13C of from about -10.9
to about -15.4, wherein the fatty acid derivative accounts for at
least about 85% of biosourced material (derived from a renewable
resource such as cellulosic materials and sugars) in the
composition. In other examples, the biofuel composition includes a
fatty acid derivative having the formula
X-(CH(R)).sub.nCH.sub.3
[0159] wherein X represents CH.sub.3, --CH.sub.2OR.sup.1;
--C(O)OR.sup.2; or --C(O)NR.sup.3R.sup.4;
[0160] R is, for each n, independently absent, H or lower
aliphatic;
[0161] n is an integer from 8 to 34, such as from 10 to 24; and
[0162] R.sup.1, R.sup.2, R.sup.3 and R.sup.4 independently are
selected from H and lower alkyl. Typically, when R is lower
aliphatic, R represents a branched, unbranched or cyclic lower
alkyl or lower alkenyl moiety. Exemplary R groups include, without
limitation, methyl, isopropyl, isobutyl, sec-butyl, cyclopentenyl
and the like. The fatty acid derivative is additionally
characterized as having a .delta..sup.13C of from about -10.9 to
about -15.4; and the fatty acid derivative accounts for at least
about 85% of biosourced material in the composition. In some
examples the fatty acid derivative in the biofuel composition is
characterized by having a fraction of modern carbon (f.sub.M
.sup.14C) of at least about 1.003, 1.010, or 1.5.
[0163] B. Fatty Acid Derivatives
[0164] The centane number (CN), viscosity, melting point, and heat
of combustion for various fatty acid esters have been characterized
in for example, Knothe, Fuel Processing Technology 86:1059-1070,
2005, which is herein incorporated by reference. Using the
teachings provided herein a production host can be engineered to
produce anyone of the fatty acid esters described in the Knothe,
Fuel Processing Technology 86:1059-1070, 2005.
[0165] Alcohols (short chain, long chain, branched or unsaturated)
can be produced by the production hosts described herein. Such
alcohols can be used as fuels directly or they can be used to
create an ester, i.e. the A side of an ester as described above.
Such ester alone or in combination with the other fatty acid
derivatives described herein are useful a fuels.
[0166] Similarly, hydrocarbons produced from the microorganisms
described herein can be used as biofuels. Such hydrocarbon based
fuels can be designed to contain branch points, defined degrees of
saturation, and specific carbon lengths. When used as biofuels
alone or in combination with other fatty acid derivatives the
hydrocarbons can be additionally combined with additives or other
traditional fuels (alcohols, diesel derived from triglycerides, and
petroleum based fuels).
[0167] C. Impurities
[0168] The fatty acid derivatives described herein are useful for
making bio-fuels. These fatty acid derivatives are made directly
from fatty acids and not from the chemical processing of
triglycerides. Accordingly, fuels comprising the disclosed fatty
acid derivatives will contain less of the impurities than are
normally associated with bio-fuels derived from triglycerides, such
as fuels derived from vegetable oils and fats.
[0169] The crude fatty acid derivative bio-fuels described herein
(prior to mixing the fatty acid derivative with other fuels such as
traditional fuels) will contain less transesterification catalyst
than petrochemical diesel or bio-diesel. For example, the fatty
acid derivative can contain less than about 2%, 1.5%, 1.0%, 0.5%,
0.3%, 0.1%, 0.05%, or 0% of a transesterification catalyst or an
impurity resulting from a transesterification catalyst.
Transesterification catalysts include for example, hydroxide
catalysts such as NaOH, KOH, LiOH, and acidic catalysts, such as
mineral acid catalysts and Lewis acid catalysts. Catalysts and
impurities resulting from transesterification catalysts include,
without limitation, tin, lead, mercury, cadmium, zinc, titanium,
zirconium, hafnium, boron, aluminum, phosphorus, arsenic, antimony,
bismuth, calcium, magnesium, strontium, uranium, potassium, sodium,
lithium, and combinations thereof.
[0170] Similarly, the crude fatty acid derivative bio-fuels
described herein (prior to mixing the fatty acid derivative with
other fuels such as petrochemical diesel or bio-diesel) will
contain less glycerol (or glycerin) than bio-fuels made from
triglycerides. For example, the fatty acid derivative can
containless than about 2%, 1.5%, 1.0%, 0.5%, 0.3%, 0.1%, 0.05%, or
0% glycerol.
[0171] The crude biofuel derived from fatty acid derivatives will
also contain less free alcohol (i.e. alcohol that is used to create
the ester) than bio-diesel made from triglycerides. This is in-part
due to the efficiency of utilization of the alcohol by the
production host. For example, the fatty acid derivative will
contain less than about 2%, 1.5%, 1.0%, 0.5%, 0.3%, 0.1%, 0.05%, or
0% free alcohol.
[0172] Biofuel derived from the disclosed fatty acid derivatives
can be additionally characterized by its low concentration of
sulfur compared to petroleum derived diesel. For example, biofuel
derived from fatty acid derivatives can have less than about 2%,
1.5%, 1.0%, 0.5%, 0.3%, 0.1%, 0.05%, or 0% sulfur.
[0173] D. Additives
[0174] Fuel additives are used to enhance the performance of a fuel
or engine. For example, fuel additives can be used to alter the
freezing/gelling point, cloud point, lubricity, viscosity,
oxidative stability, ignition quality, octane level, and flash
point. In the United States, all fuel additives must be registered
with Environmental Protection Agency and companies that sell the
fuel additive and the name of the fuel additive are publicly
available on the agency website and also by contacting the agency.
One of ordinary skill in the art will appreciate that the fatty
acid derivatives described herein can be mixed with one or more
such additives to impart a desired quality.
[0175] One of ordinary skill in the art will also appreciate that
the fatty acid derivatives described herein are can be mixed with
other fuels such as bio-diesel derived from triglycerides, various
alcohols such as ethanol and butanol, and petroleum derived
products such as gasoline. In some examples, a fatty acid
derivative, such as C16:1 ethyl ester or C18:1 ethyl ester, is
produced which has a low gel point. This low gel point fatty acid
derivative is mixed with bio-diesel made from triglycerides to
lessen the overall gelling point of the fuel. Similarly, a fatty
acid derivative such as C16:1 ethyl ester or C18:1 ethyl ester can
be mixed with petroleum derived diesel to provide a mixture that is
at least and often greater than 5% biodiesel. In some examples, the
mixture includes at least 20% or greater of the fatty acid
derivative.
[0176] For example, a biofuel composition can be made that includes
at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90% or 95%
of a fatty acid derivative that includes a carbon chain that is
8:0, 10:0, 12:0, 14:0, 14:1, 16:0, 16:1, 18:0, 18:1, 18:2, 18:3,
20:0, 20:1, 20:2, 20:3, 22:0, 22:1 or 22:3. Such biofuel
compositions can additionally include at least one additive
selected from a cloud point lowering additive that can lower the
cloud point to less than about 5.degree. C., or 0.degree. C., a
surfactant, or a microemulsion, at least about 5%, 10%, 15%, 20%,
30%, 40%, 50%, 60%, 70% or 80%, 85%, 90%, or 95% diesel fuel from
triglycerides, petroleum derived gasoline or diesel fuel from
petroleum.
EXAMPLES
[0177] FIG. 1 is a diagram of the FAS pathway showing the enzymes
directly involved in the synthesis of acyl-ACP. To increase the
production of waxes/fatty acid esters, and fatty alcohols one or
more of the enzymes can be over expressed or mutated to reduce
feedback inhibition. Additionally, enzymes that metabolize the
intermediates to make non-fatty acid based products (side
reactions) can be functionally deleted or attenuated to increase
the flux of carbon through the fatty acid biosynthetic pathway.
Examples 1, 2, and 8 below provide exemplary production hosts that
have been modified to increase fatty acid production.
[0178] FIGS. 2, 3 and 4 show biosynthetic pathways that can be
engineered to make fatty alcohols and wax/fatty acid esters,
respectively. As illustrated in FIG. 2 the conversion of each
substrate (acetyl-CoA, malonyl-CoA, acyl-ACP, fatty acid, and
acyl-CoA) to each product (acetyl-CoA, malonyl-CoA, acyl-ACP, fatty
acid, and acyl-CoA) can be accomplished using several different
polypeptides that are members of the enzyme classes indicated. The
Examples below describe microorganisms that have been engineered or
can be engineered to produce specific fatty alcohols and
waxes/fatty acid esters and hydrocarbons.
Example 1
Production Host Construction
[0179] An exemplary production host is LS9001. LS9001 was produced
by modifying C41(DE3) from Overexpress.com (Saint Beausine, France)
to functionally deleting the fadE gene (acyl-CoA
dehydrogenase).
[0180] Briefly, the fadE knock-out strain of E. coli was made using
primers YafV_NotI and Ivry_Ol to amplify about 830 by upstream of
fadE and primers Lpcaf_ol and LpcaR_Bam to amplify about 960 by
downstream of fadE. Overlap PCR was used to create a construct for
in frame deletion of the complete fadE gene. The fadE deletion
construct was cloned into the temperature sensitive plasmid pKOV3,
which contained a SacB gene for counterselection, and a chromosomal
deletion of fadE was made according to the method of Link et al.,
J. Bact. 179:6228-6237, 1997. The resulting strain was not capable
of degrading fatty acids and fatty acyl-CoAs (this functional
deletion is herein designated as .DELTA.fadE).
[0181] Additional modifications that can be included in a
production host include introducing a plasmid carrying the four
genes which are responsible for acetyl-CoA carboxylase activity in
E. coli (accA, B, C, and D, Accessions: NP.sub.--414727,
NP.sub.--417721, NP.sub.--417722, NP.sub.--416819, EC 6.4.1.2). The
accABCD genes were cloned in two steps as bicistronic operons into
the NcoI/HindIII and NdeI/AvrII sites of pACYCDuct-1 (Novagen,
Madison, Wis.) the resulting plasmid was termed pAS004.126.
[0182] Additional modifications that can be included in a
production host include the following: over-expression of aceEF
(encoding the E1p dehydrogase component and the E2p
dihydrolipoamide acyltransferase component of the pyruvate and
2-oxoglutarate dehydrogenase complexes); and
fabH/fabD/fabG/acpP/fabF (encoding FAS) from any organism known in
the art to encode such proteins, including for example E. coli,
Nitrosomonas europaea (ATCC 19718), Bacillus subtilis,
Saccharomyces cerevisiae, Streptomyces spp, Ralstonia, Rhodococcus,
Corynebacteria, Brevibacteria, Mycobacteria, oleaginous yeast, and
the like can be expressed in the production host. Similarly,
production hosts can be engineered to express accABCD (encoding
acetyl co-A carboxylase) from Pisum savitum instead of, or in
addition to, the E. coli homologues. However, when the production
host is also producing butanol it is less desirable to express the
Pisum savitum homologue.
[0183] In some exemplary production hosts, genes can be knocked out
or attenuated using the method of Link, et al., J. Bacteriol.
179:6228-6237, 1997. For example, genes that can be knocked out or
attenuated include gpsA (encoding biosynthetic sn-glycerol
3-phosphate dehydrogenase, accession NP.sub.--418065, EC:
1.1.1.94); ldhA (encoding lactate dehydrogenase, accession
NP.sub.--415898, EC: 1.1.1.28); pflb (encoding formate
acetyltransferase 1, accessions: P09373, EC: 2.3.1.54); adhE
(encoding alcohol dehydrogenase, accessions: CAA47743, EC: 1.1.1.1,
1.2.1.10); pta (encoding phosphotransacetylase, accessions:
NP.sub.--416800, EC: 2.3.1.8); poxB (encoding pyruvate oxidase,
accessions: NP.sub.--415392, EC: 1.2.2.2); ackA (encoding acetate
kinase, accessions: NP.sub.--416799, EC: 2:7.2.1) and combinations
thereof.
[0184] Similarly, the PlsB[D311E] mutation can be introduced into
LS9001 to attenuate PlsB using the method described above for the
fadE deletion. Once introduced, this mutation will decrease the
amount of carbon being diverted to phospholipid production (see,
FIG. 1). Briefly, an allele encoding PlsB[D311E] is made by
replacing the GAC codon for aspartate 311 with a GAA codon for
glutamate. The altered allele is made by gene synthesis and the
chromosomal plsB wildtype allele is exchanged for the mutant
plsB[D311E] allele using the method of Link et al. (see above).
Example 2
Production Host Modifications
[0185] The following plasmids were constructed for the expression
of various proteins that are used in the synthesis of fatty acid
derivatives. The constructs were made using standard molecular
biology methods and all the cloned genes were put under the control
of IPTG-inducible promoters (T7, tac or lac promoters).
[0186] The `tesA gene (thioesterase A gene accession
NP.sub.--415027 without leader sequence (Cho and Cronan, J. Biol.
Chem., 270:4216-9, 1995, EC: 3.1.1.5, 3.1.2.-) of E. coli was
cloned into NdeI/AvrII digested pETDuct-1 (pETDuct-1 described
herein is available from Novagen, Madison, Wis.). Genes encoding
for FatB-type plant thioesterases (TEs) from Umbellularia
California, Cuphea hookeriana and Cinnamonum camphorum (accessions:
UcFatB1=AAA34215, ChFatB2=AAC49269, ChFatB3=AAC72881,
CcFatB=AAC49151 were individually cloned into three different
vectors: (i) NdeI/AvrII digested pETDuet-1, (ii) XhoI/HindIII
digested pBluescript KS+ (Stratagene, La Jolla, Calif.)(used to
create N-terminal lacZ::TE fusion proteins) and (iii) XbaI/HindIII
digested pMAL-c2X (New England Lab, Ipswich, Mass.) (used to create
n-terminal MalE::TE fusions). The fadD gene (encoding acyl-CoA
synthetase) from E. coli was cloned into a NcoI/HindIII digested
pCDFDuet-1 derivative, which contained the acrl gene (acyl-CoA
reductase) from Acinetobacter baylyi ADP1 within its NdeI/AvrII
sites. Table 7 provides a summary of the plasmids generated to make
several exemplary production strains, one of ordinary skill in the
art will appreciate that different plasmids and genomic
modifications can be used to achieve similar strains
TABLE-US-00007 TABLE 7 Summary of Plasmids used in Production hosts
Source Organism Plasmid Gene Product Accession No., EC number
pETDuet-1-tesA E. coli Accessions: NP_415027, TesA EC: 3.1.1.5,
3.1.2.-- pETDuet-1-TEuc Umbellularia Q41635 pBluescript-TEuc
California AAA34215 pMAL-c2X-TEuc UcFatB1 pETDuet-1-TEch Cuphea
hookeriana ABB71581 pBluescript-TEch ChFatB2 AAC49269 pMAL-c2X-TEch
ChFatB3 AAC72881 pETDuet-1-TEcc Cinnamonum AAC49151
pBluescript-TEcc camphorum TEci CcFatB pCDFDuet-1- E. coli fadD:
Accessions NP_416319, fadD-acr1 EC 6.2.1.3 acr1: Accessions
YP_047869
[0187] The chosen expression plasmids contain compatible replicons
and antibiotic resistance markers, so that a four-plasmid
expression system can be established. Therefore, LS9001 can be
co-transformed with (i) any of the TE-expressing plasmids, (ii) the
FadD-expressing plasmid, which also expresses acrl and (iii) wax
synthase expression plasmid. When induced with IPTG, the resulting
strain will produce increased concentrations of fatty-alcohols from
carbon sources such as glucose. The carbon chain length and degree
of saturation of the fatty alcohol produced is dependent on the
thioesterase gene that is expressed.
Example 3
Production of Fatty Alcohol in the Recombinant E. coli Strain
[0188] Fatty alcohols were produced by expressing a thioesterase
gene and an acyl-CoA reductase gene (FAR) exogenously in a
production host. More specifically, plasmids pCDFDuet-1-fadD-acrl
(acyl-CoA reductase) and pETDuet-1-`tesA (thioesterase) were
transformed into E. coli strain LS9001 (described in Example 1) and
corresponding transformants were selected in LB plate supplemented
with 100 mg/L of spectinomycin and 50 mg/L of carbenicillin. Four
transformants of LS9001/pCDFDuet-1-fadD-acrl were independently
inoculated into 3 mL of M9 medium supplemented with 50 mg/L of
carbenicillin and 100 mg/L of spectinomycin). The samples
containing the transformants were grown in at 25.degree. C. in a
shaker (250 rpm) until they reached 0.5 OD.sub.600. 1.5 mL of each
sample was transferred into a 250 mL flask containing 30 mL of the
medium described above. The resulting culture was grown at
25.degree. C. in a shaker until the culture reached between 0.5-1.0
OD.sub.600. IPTG was then added to a final concentration of 1 mM,
and growth continued for 40 hours.
[0189] The cells were then spun down at 4000 rpm and the cell
pellets were suspended in 1.0 mL of methanol. 3 mL of ethyl acetate
was then mixed with the suspended cells. 3 mL of H.sub.2O were then
added to the mixture and the mixture was sonicated for 20 minutes.
The resulting sample was centrifuged at 4000 rpm for 5 minutes and
the organic phase (the upper phase) which contained fatty alcohol
and was subjected to GC/MS analysis. Total alcohol (including
tetradecanol, hexadecanol, hexadecenol and octadecenol) yield was
about 1-10 mg/L. When an E. coli strain carrying only empty vectors
was cultured in the same way, only 0.2-0.5 mg/L of fatty alcohols
were found in the ethyl acetate extract.
Example 4
Production and Release of Fatty Alcohol from Production Host
[0190] Acrl (acyl-CoA reductase) was expressed in E. coli grown on
glucose as the sole carbon and energy source. The E. coli produced
small amounts of fatty alcohols such as dodecanol (C12:0-OH),
tetradecanol (C14:0-OH) and hexadecanol (C16:0-OH). In other
samples, FadD (acyl-CoA synthetase) was expressed together with
acrl in E. coli and a five-fold increase in fatty alcohol
production was observed.
[0191] In other samples, acrl, fadD, accABCD (acetyl-CoA
Carboxylase) (plasmid carrying accABCD constructed as described in
Example 1) were expressed along with various individual
thioesterases (TEs) in wildtype E. coli C41(DE3) and an E. coli
C41(DE3 .DELTA.fadE, a strain lacking acyl-CoA dehydrogenase. This
resulted in additional increases in fatty alcohol production and
modulating the profiles of fatty alcohols (see FIG. 5). For
example, over-expression of E. coli `tesA (pETDuet-1-`tesA) in this
system achieved approximately a 60-fold increase in C12:0-OH,
C14:0-OH and C16:0-OH with C14:0-OH being the major fatty alcohol.
A very similar result was obtained when the ChFatB3 enzyme (FatB3
from Cuphea hookeriana in pMAL-c2X-TEcu) was expressed. When the
UcFatB1 enzyme (FatB1 from Umbellularia californicain in
pMAL-c2X-TEuc) was expressed, fatty alcohol production increased
approximately 20-fold and C12:0-OH was the predominant fatty
alcohol.
[0192] Expression of ChFatB3 and UcFatB 1 also led to the
production of significant amounts of the unsaturated fatty alcohols
C16:1-OH and C14:1-OH, respectively. The presence of fatty alcohols
was also found in the supernatant of samples generated from the
expression of tesA (FIG. 6). At 37.degree. C. approximately equal
amounts of fatty alcohols were found in the supernatant and in the
cell pellet, whereas at 25.degree. C. approximately 25% of the
fatty alcohols were found in the supernatant.
Example 5
Medium Chain Fatty Acid Esters
[0193] Alcohol acetyl transferases (AATs, EC 2.3.1.84), which is
responsible for acyl acetate production in various plants, can be
used to produce medium chain length waxes, such as octyl octanoate,
decyl octanoate, decyl decanoate, and the like. Fatty esters,
synthesized from medium chain alcohol (such as C6, C8) and medium
chain acyl-CoA (or fatty acids, such as C6 or C8) have a relative
low melting point. For example, hexyl hexanoate has a melting point
of -55.degree. C. and octyl octanoate has a melting point of -18 to
-17.degree. C. The low melting points of these compounds makes them
good candidates for use as biofuels.
[0194] In this example, a SAAT gene was co-expressed in a
production host C41(DE3, .DELTA.fadE) with fadD from E. coli and
acrl (alcohol reductase from A. baylyi ADP1) and octanoic acid was
provided in the fermentation broth. This resulted in the production
of octyl octanoate. Similarly, when the wax synthase gene from A.
baylyi ADP1 was expressed in the production host instead of the
SAAT gene octyl octanoate was produced.
[0195] A recombinant SAAT gene was synthesized using DNA 2.0 (Menlo
Park, Calif. 94025). The synthesized DNA was based on the published
gene sequence (accession number AF193789) and modified to eliminate
the NcoI site. The synthesized SAAT gene (as a BamHI-HindIII
fragment) was cloned in pRSET B (Invitrogen, Calsbad, Calif.),
linearized with BamHI and HindIII. The resulted plasmid, pHZ1.63A
was cotransformed into an E. coli production host with pAS004.114B,
which carries a fadD gene from E. coli and acrl gene from A. baylyi
ADP1. The transformants were grown in 3 mL of M9 medium with 2% of
glucose. After IPTG induction and the addition of 0.02% of octanoic
acid, the culture was continued at 25.degree. C. from 40 hours.
After that, 3 mL of acetyl acetate was added to the whole culture
and mixed several times with mixer. The acetyl acetate phase was
analyzed by GC/MS.
[0196] Surprising, in the acetyl acetate extract, there is no acyl
acetate found. However, a new compound was found and the compound
was octyl octanoate. Whereas the control strain without the SAAT
gene [C41(DE3, .DELTA.fadE)/pRSET B.sub.+pAS004.114B] did not
produce octyl octanoate. Also the strain [C41(DE3,
.DELTA.fadE)/pHZ1.43 B.sub.+pAS004.114B], in which the wax synthase
gene from A. baylyi ADP1 was carried by pHZ1.43 produced octyl
octanoate (see FIGS. 7B).
[0197] The finding that SAAT activity produces octyl octanoate has
not reported before and makes it possible to produce medium chain
waxes such as octyl octanoate, octyl decanoate, which have low
melting point and are good candidates to be use for biofuel to
replace triglyceride based biodiesel.
Example 6
Production of Wax Ester in E. coli Strain LS9001
[0198] Wax esters were produced by engineering an E. coli
production host to express a fatty alcohol forming acyl-CoA
reductase, thioesterase, and a wax synthase. Thus, the production
host produced both the A and the B side of the ester and the
structure of both sides was influenced by the expression of the
thioesterase gene.
[0199] More specifically, wax synthase from A. baylyi ADP1 (termed
WSadp1, accessions AA017391, EC: 2.3.175) was amplified with the
following primers using genomic DNA from A. baylyi ADP1 as the
template. The primers were (1) WSadp1_NdeI, 5'-
TCATATGCGCCCATTACATCCG -3' and (2) WSadp1_Avr, 5'-
TCCTAGGAGGGCTAATTTAGCCCTTTAGTT-3'. The PCR product was digested
with NdeI and AvrII and cloned into pCOALDeut-1 to give pHZ 1.43.
The plasmid carrying WSadp1 was then co-transformed into E. coli
strain LS9001 with both pETDuet-1'tesA and pCDFDuet-1-fadD-acrl and
transformants were selected in LB plates supplemented with 50 mg/L
of kanamycin, 50 mg/L of carbenicillin and 100 mg/L of
spectinomycin. Three transformants were inoculated in 3 mL of LBKCS
(LB broth supplement with 50 mg/L of kanamycin, 50 mg/L of
carbenicillin, 100 mg/L of spectinomycin and 10 g/L of glucose) and
cultured at 37.degree. C. shaker (250 rpm). When the cultures
reached 0.5 OD.sub.600, 1.5 mL of each culture was transferred into
250 mL flasks containing 50 mL of LBKCS and the flasks were grown
in a shaker (250 rpm) at 37.degree. C. until the culture reached
0.5-1.0 OD.sub.600. IPTG was then added to a final concentration of
1 mM. The induced cultures were grown at 37.degree. C. shaker for
another 40-48 hours.
[0200] The culture was then placed into 50 mL conical tubes and the
cells were spun down at 3500 .times.g for 10 minutes. The cell
pellet was then mixed with 5 mL of ethyl acetate. The ethyl acetate
extract was analyzed with GC/MS. The intracellular yield of waxes
(including C16C16, C14:1C16, C18:1C18:1, C2C14, C2C16, C2C16:1,
C16C16:1 and C2C18:1) was about 10 mg/L. When an E. coli strain
only carrying empty vectors was cultured in the same way, only 0.2
mg/L of wax was found in the ethyl acetate extract.
Example 7
Production and Release of Fatty-Ethyl Ester from Production
Host
[0201] The LS9001 strain was modified by transforming it with the
plasmids carrying a wax synthase gene from A. baylyi (plasmid
pHZ1.43), a thioesterase gene from Cuphea hookeriana (plasmid
pMAL-c2X-TEcu) and a fadD gene from E. coli (plasmid
pCDFDuet-1-fadD). This recombinant strain was grown at 25.degree.
C. in 3 mL of M9 medium with 50 mg/L of kanamycin, 100 mg/L of
carbenicillin and 100 mg/L of spectinomycin. After IPTG induction,
the media was adjusted to a final concentration of 1% ethanol and
2% glucose. The culture was allowed to grow for 40 hours after IPTG
induction. The cells were separated from the spent medium by
centrifugation at 3500 .times.g for 10 minutes). The cell pellet
was re-suspended with 3 mL of M9 medium. The cell suspension and
the spent medium were then extracted with 1 volume of ethyl
acetate. The resulting ethyl acetate phases from the cells
suspension and the supernatant were subjected to GC-MS analysis.
The results showed that the C16 ethyl ester was the most prominent
ester species (as expected for this thioesterase, see Table 1), and
that 20% of the fatty acid ester produced was released from the
cell (see FIG. 8). A control E. coli strain C41(DE3, .DELTA.fadE)
containing pCOLADuet-1 (empty vector for the wax synthase gene),
pMAL-c2X-TEuc (containing fatB from U. california) and
pCDFDuet-1-fadD (fadD gene from E. coli) failed to produce
detectable amounts of fatty ethyl esters. The fatty acid esters
were quantified using commercial palmitic acid ethyl ester as the
reference. Fatty acid esters were also made using the methods
described herein except that methanol, or isopropanol was added to
the fermentation broth and the expected fatty acid esters were
produced.
Example 8
The Influence of Various Thioesterases on the Composition of
Fatty-Ethyl Esters Produced in Recombinant E. coli Strains
[0202] The thioesterases FatB3 (C. hookeriana), TesA (E. coli), and
FatB (U. california) were expressed simultaneously with wax
synthase (A. baylyi). A plasmid termed pHZ1.61 was constructed by
replacing the NotI/AvrII fragment (carrying the acrl gene) with the
NotI-AvrII fragment from pHZ1.43 so that fadD and the ADP1 wax
synthase were in one plasmid and both coding sequences were under
the control of separate T7 promoter. The construction of pHZ1.61
made it possible to use a two plasmid system instead of the three
plasmid system as described in Example 6. pHZ1.61 was then
co-transformed into E. coli C41(DE3, .DELTA.fadE) with one of the
various plasmids carrying the different thioesterase genes stated
above.
[0203] The total fatty acid ethyl esters (supernatant and
intracellular fatty acid ethyl esters) produced by these
transformants were evaluated using the technique described herein.
The yields and the composition of fatty acid ethyl esters are
summarized in Table 8.
TABLE-US-00008 TABLE 8 The yields (mg/L) and the composition of
fatty acid ethyl esters by recombinant E. coli C41(DE3,
.DELTA.fadE)/pHZ1.61 and plasmids carrying various thioesterase
genes. Thioesterases C2C10 C2C12:1 C2C12 C2C14:1 C2C14 C2C16:1
C2C16 C2C18:1 'TesA 0.0 0.0 6.5 0.0 17.5 6.9 21.6 18.1 ChFatB3 0.0
0.0 0.0 0.0 10.8 12.5 11.7 13.8 ucFatB 6.4 8.5 25.3 14.7 0.0 4.5
3.7 6.7 pMAL 0.0 0.0 0.0 0.0 5.6 0.0 12.8 7.6 Note: 'TesA,
pETDuet-1-'tesA; chFatB3, pMAL-c2X-TEcu; ucFatB, pMAL-c2X-TEuc;
pMAL, pMAL-c2X, the empty vector for thioesterase genes used in the
study.
Example 9
Production Host Construction
[0204] The genes that control fatty acid production are conserved
between microorganisms. For example, Table 9 identifies the
homologues of many of the genes described herein which are known to
be expressed in microorganisms that produce hydrocarbons. To
increase fatty acid production and, therefore, hydrocarbon
production in microorganisms such as those identified in Table 9,
heterologous genes, such as those from E. coli can be expressed.
One of ordinary skill in the art will also appreciate that genes
that are endogenous to the micoorganisms provided in Table 9 can
also be over-expressed, or attenuated using the methods described
herein. Moreover, genes that are described in FIG. 10 can be
expressed or attenuated in microorganisms that endogenously produce
hydrocarbons to allow for the production of specific hydrocarbons
with defined carbon chain length, saturation points, and branch
points.
[0205] For example, exogenous nucleic acid sequences encoding
acetyl-CoA carboxylase are introduced into K. radiotolerans. The
following genes comprise the acetyl-CoA carboxylase protein product
in K. radiotolerans; acetyl CoA carboxylase, alpha subunit
(accA/ZP.sub.--00618306), acetyl-CoA carboxylase, biotin carboxyl
carrier protein (accB/ZP.sub.--00618387), acetyl-CoA carboxylase,
biotin carboxylase subunit (accC/ZP.sub.--00618040), and acetyl-CoA
carboxylase, beta (carboxyltranferase) subunit
(accD/ZP.sub.--00618306). These genes are cloned into a plasmid
such that they make a synthetic acetyl-CoA carboxylase operon
(accABCD) under the control of a K. radiotolerans expression system
such as the expression system disclosed in Ruyter et al., Appl
Environ Microbiol. 62:3662-3667, 1996. Transformation of the
plasmid into K. radiotolerans will enhance fatty acid production.
The hydrocarbon producing strain of K. radiotolerans can also be
engineered to make branched, unsaturated hydrocarbons having
specific carbon chain lengths using the methods disclosed
herein.
TABLE-US-00009 TABLE 9 Hydrocarbon Production Hosts Gene Accession
No./Seq Organism Name ID/Loci EC No. Desulfovibrio desulfuricans
accA YP_388034 6.4.1.2 G20 Desulfovibrio desulfuricans accC
YP_388573/YP_388033 6.3.4.14, G22 6.4.1.2 Desulfovibrio
desulfuricans accD YP_388034 6.4.1.2 G23 Desulfovibrio
desulfuricans fabH YP_388920 2.3.1.180 G28 Desulfovibrio
desulfuricans fabD YP_388786 2.3.1.39 G29 Desulfovibrio
desulfuricans fabG YP_388921 1.1.1.100 G30 Desulfovibrio
desulfuricans acpP YP_388922/YP_389150 3.1.26.3, G31 1.6.5.3,
1.6.99.3 Desulfovibrio desulfuricans fabF YP_388923 2.3.1.179 G32
Desulfovibrio desulfuricans gpsA YP_389667 1.1.1.94 G33
Desulfovibrio desulfuricans ldhA YP_388173/YP_390177 1.1.1.27, G34
1.1.1.28 Erwinia (micrococcus) accA 942060-943016 6.4.1.2 amylovora
Erwinia (micrococcus) accB 3440869-3441336 6.4.1.2 amylovora
Erwinia (micrococcus) accC 3441351-3442697 6.3.4.14, amylovora
6.4.1.2 Erwinia (micrococcus) accD 2517571-2516696 6.4.1.2
amylovora Erwinia (micrococcus) fadE 1003232-1000791 1.3.99.--
amylovora Erwinia (micrococcus) plsB(D311E) 333843-331423 2.3.1.15
amylovora Erwinia (micrococcus) aceE 840558-843218 1.2.4.1
amylovora Erwinia (micrococcus) aceF 843248-844828 2.3.1.12
amylovora Erwinia (micrococcus) fabH 1579839-1580789 2.3.1.180
amylovora Erwinia (micrococcus) fabD 1580826-1581749 2.3.1.39
amylovora Erwinia (micrococcus) fabG CAA74944 1.1.1.100 amylovora
Erwinia (micrococcus) acpP 1582658-1582891 3.1.26.3, amylovora
1.6.5.3, 1.6.99.3 Erwinia (micrococcus) fabF 1582983-1584221
2.3.1.179 amylovora Erwinia (micrococcus) gpsA 124800-125810
1.1.1.94 amylovora Erwinia (micrococcus) ldhA 1956806-1957789
1.1.1.27, amylovora 1.1.1.28 Kineococcus radiotolerans accA
ZP_00618306 6.4.1.2 SRS30216 Kineococcus radiotolerans accB
ZP_00618387 6.4.1.2 SRS30216 Kineococcus radiotolerans accC
ZP_00618040/ 6.3.4.14, SRS30216 ZP_00618387 6.4.1.2 Kineococcus
radiotolerans accD ZP_00618306 6.4.1.2 SRS30216 Kineococcus
radiotolerans fadE ZP_00617773 1.3.99.-- SRS30216 Kineococcus
radiotolerans plsB(D311E) ZP_00617279 2.3.1.15 SRS30216 Kineococcus
radiotolerans aceE ZP_00617600 1.2.4.1 SRS30216 Kineococcus
radiotolerans aceF ZP_00619307 2.3.1.12 SRS30216 Kineococcus
radiotolerans fabH ZP_00618003 2.3.1.180 SRS30216 Kineococcus
radiotolerans fabD ZP_00617602 2.3.1.39 SRS30216 Kineococcus
radiotolerans fabG ZP_00615651 1.1.1.100 SRS30216 Kineococcus
radiotolerans acpP ZP_00617604 3.1.26.3, SRS30216 1.6.5.3, 1.6.99.3
Kineococcus radiotolerans fabF ZP_00617605 2.3.1.179 SRS30216
Kineococcus radiotolerans gpsA ZP_00618825 1.1.1.94 SRS30216
Kineococcus radiotolerans ldhA ZP_00618879 1.1.1.27, SRS30216
1.1.1.28 Rhodospirillum rubrum accA YP_425310 6.4.1.2
Rhodospirillum rubrum accB YP_427521 6.4.1.2 Rhodospirillum rubrum
accC YP_427522/YP_425144/ 6.3.4.14, YP_427028/ 6.4.1.2
YP_426209/YP_427404 Rhodospirillum rubrum accD YP_428511 6.4.1.2
Rhodospirillum rubrum fadE YP_427035 1.3.99.-- Rhodospirillum
rubrum aceE YP_427492 1.2.4.1 Rhodospirillum rubrum aceF YP_426966
2.3.1.12 Rhodospirillum rubrum fabH YP_426754 2.3.1.180
Rhodospirillum rubrum fabD YP_425507 2.3.1.39 Rhodospirillum rubrum
fabG YP_425508/YP_425365 1.1.1.100 Rhodospirillum rubrum acpP
YP_425509 3.1.26.3, 1.6.5.3, 1.6.99.3 Rhodospirillum rubrum fabF
YP_425510/YP_425510/ 2.3.1.179 YP_425285 Rhodospirillum rubrum gpsA
YP_428652 1.1.1.94 Rhodospirillum rubrum ldhA YP_426902/YP_428871
1.1.1.27, 1.1.1.28 Vibrio furnissii accA 1, 16 6.4.1.2 Vibrio
furnissii accB 2, 17 6.4.1.2 Vibrio furnissii accC 3, 18 6.3.4.14,
6.4.1.2 Vibrio furnissii accD 4, 19 6.4.1.2 Vibrio furnissii fadE
5, 20 1.3.99.-- Vibrio furnissii plsB(D311E) 6, 21 2.3.1.15 Vibrio
furnissii aceE 7, 22 1.2.4.1 Vibrio furnissii aceF 8, 23 2.3.1.12
Vibrio furnissii fabH 9, 24 2.3.1.180 Vibrio furnissii fabD 10, 25
2.3.1.39 Vibrio furnissii fabG 11, 26 1.1.1.100 Vibrio furnissii
acpP 12, 27 3.1.26.3, 1.6.5.3, 1.6.99.3 Vibrio furnissii fabF 13,
28 2.3.1.179 Vibrio furnissii gpsA 14, 29 1.1.1.94 Vibrio furnissii
ldhA 15, 30 1.1.1.27, 1.1.1.28 Stenotrophomonas maltophilia accA
ZP_01643799 6.4.1.2 R551-3 Stenotrophomonas maltophilia accB
ZP_01644036 6.4.1.2 R551-3 Stenotrophomonas maltophilia accC
ZP_01644037 6.3.4.14, R551-3 6.4.1.2 Stenotrophomonas maltophilia
accD ZP_01644801 6.4.1.2 R551-3 Stenotrophomonas maltophilia fadE
ZP_01645823 1.3.99.-- R551-3 Stenotrophomonas maltophilia
plsB(D311E) ZP_01644152 2.3.1.15 R551-3 Stenotrophomonas
maltophilia aceE ZP_01644724 1.2.4.1 R551-3 Stenotrophomonas
maltophilia aceF ZP_01645795 2.3.1.12 R551-3 Stenotrophomonas
maltophilia fabH ZP_01643247 2.3.1.180 R551-3 Stenotrophomonas
maltophilia fabD ZP_01643535 2.3.1.39 R551-3 Stenotrophomonas
maltophilia fabG ZP_01643062 1.1.1.100 R551-3 Stenotrophomonas
maltophilia acpP ZP_01643063 3.1.26.3, R551-3 1.6.5.3, 1.6.99.3
Stenotrophomonas maltophilia fabF ZP_01643064 2.3.1.179 R551-3
Stenotrophomonas maltophilia gpsA ZP_01643216 1.1.1.94 R551-3
Stenotrophomonas maltophilia ldhA ZP_01645395 1.1.1.27, R551-3
1.1.1.28 For Table 9, Accession Numbers are from GenBank, Release
159.0 as of Apr. 15, 2007, EC Numbers are from KEGG, Release 42.0
as of April 2007 (plus daily updates up to and including May 09,
2007), results for Erwinia amylovora strain Ea273 are taken from
the Sanger sequencing center, completed shotgun sequence as of May
9, 2007, positions for Erwinia represent locations on the Sanger
psuedo-chromosome, sequences from Vibrio furnisii M1 are from the
LS9 VFM1 pseudochromosome, v2 build, as of Sep. 28, 2006, and
include the entire gene, and may also include flanking
sequence.
Example 10
Additional Exemplary Production strains
[0206] Table 10, below provides additional exemplary production
strains. Two example biosynthetic pathways are described for
producing fatty acids, fatty alcohols, and wax esters. A
genetically engineered host can be produced by cloning the
expression of the accABCD genes from E. coli, the `tesA gene from
E. coli, and fadD gene from E. coli into a host cell. Host cells
can be selected from E. coli, yeast, add to the list. These genes
can also be transformed into a host cell that is modified to
contain one or more of the genetic manipulations described in
Examples 1 and 2, above.
Example 11
Fermentation
[0207] Host microorganisms can be also engineered to express umuC
and umuD from E. coli in pBAD24 under the prpBCDE promoter system
through de novo synthesis of this gene with the appropriate
end-product production genes. For small scale hydrocarbon product
production, E. coli BL21(DE3) cells harbouring pBAD24 (with
ampicillin resistance and the end-product synthesis pathway) as
well as pUMVC1 (with kanamycin resistance and the acetyl
CoA/malonyl CoA over-expression system) are incubated overnight at
at 37.degree. C. shaken at >200 rpm 2 L flasks in 500 ml LB
medium supplemented with 75 .mu.g/mL ampicillin and 50 .mu.g/ml
kanamycin until cultures reached an OD.sub.600 of >0.8. Upon
achieving an OD.sub.600 of >0.8, cells are supplemented with 25
mM sodium proprionate (pH 8.0) to activate the engineered gene
systems for production as well as to stop cellular proliferation
(through activation of umuC and umuD proteins). Induction is
performed for 6 hours at 30.degree. C. After incubation, media is
examined for product using GC- MS (as described below).
[0208] For large scale product production, the engineered
microorganisms are grown in 10 L, 100 L or larger batches,
fermented and induced to express desired products based on the
specific genes encoded in plasmids as appropriate. E. coli
BL21(DE3) cells harbouring pBAD24 (with ampicillin resistance and
the end-product synthesis pathway) as well as pUMVC1 (with
kanamycin resistance and the acetyl-CoA/malonyl-CoA over-expression
system) are incubated from a 500 mL seed culture for 10 L
fermentations (5 L for 100 L fermentations) in LB media (glycerol
free) at 37.degree. C. shaken at >200 rpm until cultures reached
an OD.sub.600 of >0.8 (typically 16 hours) incubated with 50
.quadrature.g/mL kanamycin and 75 .mu.g/mL ampicillin. Media is
treated with continuously supplemented to maintain a 25 mM sodium
proprionate (pH 8.0) to activate the engineered in gene systems for
production as well as to stop cellular proliferation (through
activation of umuC and umuD proteins). Media is continuously
supplemented with glucose to maintain a concentration 90 g/100 mL.
After the first hour of induction, aliquots of no more than 10% of
the total cell volume are removed each hour and allowed to sit
unaggitated so as to allow the hydrocarbon product to rise to the
surface and undergo a spontaneous phase separation. The hydrocarbon
component is then collected and the aqueous phase returned to the
reaction chamber. The reaction chamber is operated continuously.
When the OD.sub.600 drops below 0.6, the cells are replaced with a
new batch grown from a seed culture.
[0209] For wax ester production, subsequent to isolation, the wax
esters are washed briefly in 1 M HCl to split the ester bond, and
returned to pH 7 with extensive washing with distilled water.
Example 12
Product Characterization
[0210] To characterize and quantify the fatty alcohols and fatty
acid esters, gas chromatography (GC) coupled with electron impact
mass spectra (MS) detection was used. Fatty alcohol samples were
first derivatized with an excess of N-trimethylsilyl (TMS)
imidazole to increase detection sensitivity. Fatty acid esters did
not required derivatization. Both fatty alcohol-TMS derivatives and
fatty acid esters were dissolved in an appropriate volatile
solvent, like ethyl acetate. The samples were analyzed on a 30 m
DP-5 capillary column using the following method. After a 14
splitless injection onto the GC/MS column, the oven is held at
100.degree. C. for 3 minutes. The temperature was ramped up to
320.degree. C. at a rate of 20.degree. C./minute. The oven was held
at 320.degree. C. for an additional 5 minutes. The flow rate of the
carrier gas helium was 1.3 mL/minute. The MS quadrapole scans from
50 to 550 m/z. Retention times and fragmentation patterns of
product peaks were compared with authentic references to confirm
peak identity.
[0211] For example, hexadeconic acid ethyl ester eluted at 10.18
minutes (FIGS. 9A and 9B). The parent ion of 284 mass units was
readily observed. More abundent were the daughter ions produced
during mass fragmentation. This included the most prevalent
daughter ion of 80 mass units. The derivatized fatty alcohol
hexadecanol-TMS eluted at 10.29 minutes and the parent ion of 313
could be observed. The most prevalent ion was the M-14 ion of 299
mass units.
[0212] Quantification was carried out by injecting various
concentrations of the appropriate authentic references using the
GC/MS method described above. This information was used to generate
a standard curve with response (total integrated ion count) versus
concentration.
Equivalents
[0213] While specific examples of the subject inventions are
explicitly disclosed herein, the above specification and examples
herein are illustrative and not restrictive. Many variations of the
inventions will become apparent to those skilled in the art upon
review of this specification including the examples. The full scope
of the inventions should be determined by reference to the
examples, along with their full scope of equivalents, and the
specification, along with such variations.
Sequence CWU 1
1
301498DNAVibrio furnisii 1gtagatgagc ctaaattttc tagaatttag
aaaaacctat tgtagaactg gaagctaaaa 60ttcaggcgct tcgtgacgtg tctcgtcatg
gcggtggaac ttccgtagat cttgaaaaag 120agatcgaaca gctagaaaag
aaaagcctag agcttaaaaa gaaaattttc ggtgatttag 180gggcatggca
agtggcacag atggctcgcc atccacaacg tccttacacc ttagattaca
240tcaacaacat gtttacggag ttcgatgaac tagccggtga ccgtgcattt
gctgacgaca 300aagcgatcgt gggcggcatg gcccgcttag atggtcgccc
tgtgatggtg attggtcatc 360agaaaggccg tgaaacccgt gaaaaagtaa
aacgtaactt tgggatgcca aagccagaag 420gttaccgtaa agccctgcgt
ttgatggaaa tggctgagcg tttcaacatg ccaatcatta 480ccttcatcga cacggcgg
4982564DNAVibrio furnisii 2atgaattcgc tttgtcggca gccgttcgcg
cgctgcaagc aaagtaaacc caaacactct 60gcagctcaat tgagctgtct tattcacaag
ataaaagaga aagaaacaat ggatattcgt 120aaaatcaaga agcttatcga
attggttgaa gagtcaggca ttgctgagct agaaatttct 180gaaggtgaag
aatcggtacg catcagtcgt cacggtgtcg ccccagttgc acctatccag
240tatgcagcac ctgcaccaat ggcagcgcca gtagcagcac ctgcagcagc
gccagtcgct 300gaagcaccag cagcagccaa aacgcctgcg ggccacatgg
ttctttctcc aatggtgggt 360acgttctacc gttcaccaag tccagatgca
aaatcattca tcgaagtggg tcaaactgtg 420aaagcgggtg acacattgtg
catcgttgaa gcgatgaaaa tgatgaacca aatcgaagca 480gacaagtctg
gtgtagtgac cgagatcctt gttgaagacg gtcaggccgt agaattcgac
540cagccacttg ttgtcatcga ataa 56431344DNAVibrio furnisii
3atgctagata agttagtcat cgcgaaccga ggcgaaattg cgcttcgtat tcttcgtgca
60tgtaaagagt tgggcatcaa aactgttgcc gttcactcca cagcagaccg cgatctaaaa
120cacgtcctgc tggcggatga aaccgtatgt atcggccctg caaaaggcat
cgatagctac 180ttgaacattc cacgcatcat ttcagccgct gaagtgaccg
gcgcagtggc catccacccg 240ggttacggct tcctgtctga aaatgcggac
tttgctgaac aagttgagcg cagcggcttt 300atcttcgtgg gtccaaaagc
cgacaccatc cgcctgatgg gcgataaagt gtcagccatc 360accgcgatga
agaaagcagg cgttccttgt gtaccgggtt ctgacggtcc tctggacaac
420gatgaagtga aaaaccgtgc acacgcgaaa cgcattggtt acccagtgat
catcaaagcc 480tctggtggcg gcggcggtcg cggtatgcgt gtggttcgca
gcgaagcgga actggtcaat 540gccatcagca tgacccgtgc agaagcgaaa
gcggcgttca acaacgacat ggtttacatg 600gagaaatacc tcgaaaaccc
acgtcacgtt gaagtccaag ttctggccga tggtcagggc 660agcgcgatcc
acttgggtga acgcgactgt tccatgcagc gtcgtcacca gaaagtagtg
720gaagaagcgc cagcaccagg cattactgaa gagatgcgta agtacatcgg
tgaacgctgt 780acccgtgcgt gtatcgaaat cggttaccgc ggcgcaggta
cgtttgagtt cctgtacgaa 840aacggcgaat tctacttcat cgaaatgaac
acacgtattc aggttgaaca cccagtgact 900gaaatggtca caggcgttga
cttgatcaaa gaacagctgc gcatcgcagc aggccaaccg 960ctgtcgttca
cacaagacga catcaaaatt cgtggccatg cgatggaatg ccgtatcaac
1020gcggaagacc cagaacgctt cctaccttgc ccaggcaaga tcacccgttt
ccactcacca 1080ggtggcatgg gcgtgcgttg ggaatcacac atctactcag
gctacaccgt accggcgtac 1140tacgactcga tgatcggcaa actgatcacc
tttggtgaga accgtgacgt cgcgattgca 1200cggatgcgta acgcgctcga
tgagatgatt gtggaaggta tcaaaaccaa cattccactg 1260cagcaagtaa
tcatgaaaga tgagaacttc caacacggtg gcaccaacat ccactatctg
1320gagaaaaagc tggggctgca ataa 13444927DNAVibrio furnisii
4atgagctggc ttgagaagat tttagaaaaa agcaacatcg gaagttcacg taaagcgtct
60atccctgaag gggtttggac caaatgtaca tcgtgtgaac aggtgcttta ttacgctgaa
120ctagagcgca atcttgaagt ttgtccgaag tgtaatcatc acatgcgtat
gaaggcgcgc 180cgtcgtcttg aaacgttctt ggacgaagca aaccgttacg
aaatcgcgga cgaactcgaa 240ccgcaagata aactgaaatt taaagactcc
aaacgttaca aagagcgtct tgcgactgcg 300cagaagagca gtggcgaaaa
agatgcgctg attgtgatga aaggcgagtt gatgacgatt 360ccagtcgtgg
cgtgtgcgtt tgaattctcg ttcatgggcg gttcaatggg gtcggttgtc
420ggtgcgcgtt tcgtgcgtgc agttgaagcg gcgattgaag cgaactgtgg
tctggtctgt 480ttctctgcca gtggtggcgc acgtatgcaa gaagcgctga
tgtcgctgat gcagatggcc 540aaaaccagtg cagcgctcga gcgtctaacg
gcgaaaggtc tcccgtttat ctccgtgatg 600acagacccaa ccatgggtgg
ggtgtctgcg agtctggcaa tgctgggcga catcaacatc 660ggtgagccga
aagcactgat cggtttcgcg ggtcgtcgcg tgatcgagca gaccgtgcgc
720gaagagctgc cggaaggttt ccaacgcagc gaattcctgc tggagcacgg
tgcgattgat 780atgatcgttg accgtcgtga aatgcgtcag cgtgtggctg
gcctgctggc gaaaatgaca 840cgtcaggagt cgccgctggt ggtttctgtg
aacgatgcgc caaatgaagc cgcatattct 900gtaccagaag cgaacaaaaa agggtaa
92752445DNAVibrio furnisii 5atggacatct tgctctcaat cttagggttc
gtggtcgtgt taagcggctg cctgtaccac 60agaacctcat taatgactgc cttagccgca
ctgaccgtga ccatgttggt cctgtcgttg 120tttggcccag tgggtatcat
cagctgggcg ctgtacttag ccgctatcgc ggtattggca 180gtcccgtcaa
tccgtcaaag tctcatcagc ggtaagacac taaaggtatt caaaaaagta
240ctgcctgcga tgtcgcagac agaaaaagaa gcgcttgatg ctggcaccgt
gtggtgggaa 300gccgaactgt tcaaaggcaa accggactgg caacagctga
gccatatcaa agcgcccaca 360ctttctgccg aagaacaggc gttcctcgat
ggcccagtga acgaagtgtg cgccatggtg 420aacgactatc aggtgactca
cgaattggcg gatttgcctc cggaagtgtg gcaatacctg 480aaagaccaca
aatttttcgc catgatcatt aagaagcagt acggcggctt ggaattttcc
540gcgtacgcgc aatcgctggt gctacaaaag ctgacgggcg tatcgggcgt
gctctcttcc 600accgtcggcg tgccgaactc tctcggcccg ggcgaactgc
tgcaacatta cggcaccgac 660gatcagaaag attactacct ccctcgtttg
gcggaaggca aagagattcc atgtttcgcg 720ctgaccagcc cagaagcggg
ctctgatgcg ggctcgattc cggattacgg catcgtgtgc 780aaagacgaat
gggaaggcaa agaagtgctg ggcatgcgcc tgacatggaa caaacgctac
840atcacgctgg cgccagttgc gacggttctt ggtttggcct ttaaactgcg
cgaccctgac 900gggctattgg gcgaccaaaa agagattggc atcacgtgtg
ctttgatccc gacacacctc 960aaaggggtgg aaatcggcaa tcgtcacttc
ccattgaacg tgccgttcca aaatggcccg 1020acgcgcgcga acgatctatt
tgtgccgctg gacttcatca tcggtggccc atcgatggcc 1080ggccaaggtt
ggcgcatgct ggtggaatgt ttatcagtgg gtcgcggtat tacgctgcca
1140tcgaactcaa ctggcggcat caaagcggcg gcaatggcaa cgggcgctta
tgcgcgcatt 1200cgtcgtcagt tcaagcaacc cattggtcac atggaaggga
ttgaagaacc tttggcgcgc 1260cttgcaggga acgcttacgt gatggatgca
gcgagcaacc tcactgtcgc ggggattgat 1320gccggcgaaa aaccatcggt
tatttctgcg attgtgaagt atcactgtac ccaccgcggc 1380caacgctcaa
tcatcgatgc aatggacatc gtcggcggca aaggcatctg tttgggccca
1440tcgaacttcc ttgcgcgagg ttaccaaggt tcccctatcg cgatcaccgt
ggaaggcgcc 1500aacattctga cccgctccat gatcatcttt ggtcagggtg
ctattcgctg ccatccgtac 1560gttttgaaag agatggaagc agcgtattca
gacagcgcca atgcggtcga acaatttgac 1620gccgcgctgg ctggccatgt
cagctttacc atgagtaact tggtgcgctg catctggttt 1680ggtctgaccg
acgggttagg ctctgccgca ccaaccaaag atgccaccaa acgttactat
1740cagcaactca accgttacag tgcaaacctt gccctgctgg ccgatatttc
catggccgta 1800ctgggtggct ccctgaaacg taaagagcgc ctgtccgcgc
gtttgggtga tattttaagc 1860caactttatc tcagctcagc aacgctgaag
cgctttgaga atgatggtcg cccagcagaa 1920gatttggcct tggtacactg
ggggctgcaa gacagcttga aacagaccga agtggcgatt 1980gatgagttct
tggcgaactt cccgaacaag gtgatcggca aagccctgcg tgtcttgatc
2040atgccatttg gccgcgtgcg caaagcacca aacgacaagc tcgacagcaa
agtggcgcag 2100atcattcaaa cgccaagtgc gacccgctca cgcatcggtc
gtcatcagta cctcgaaccg 2160actgcacata acgcggtcgg caagattgaa
ctggcgttga atgtgattct tcaagcagaa 2220ccggtgttcg acaaggtatg
caaagcgctg aacgaacgtc gcccattcac gcaattggat 2280caagtggcac
aatgtggcct tgagcaaaag ctgatcaccg agcaagaagc cgaactgctg
2340atcgaagccg agcaacaccg cttatacacc atcaatgtgg atgactttgc
gccgcaggag 2400ttagcagcaa aaaagtcaca acccaagctg gtcgaggtcg cgtga
244562424DNAVibrio furnisii 6atgtcttctg gacactcatt ttcgcgttcc
ttgttgaaat taccactgtc tgttctggta 60aaaggtacgg tcattccatc caatccgatc
gatgatctcg agattgatat taacaagccg 120atcgtctatg cactaccctt
tcgctccaat gtcgacctgt tgacgctgca aacgcatgcg 180ttacaagccg
gcctgccgga tccgttagaa ccgctgacca ttcatagtca cacgctgaaa
240cgttacgtgt tcatctcgtc gcgccccacg ctgctgcaag atgacaatca
ggtgccgacc 300gattctatcg ccacattcag cgaaatgctc agcctgcatc
aagaagattc ggagttggat 360gtgcaggtca ttcctgccac cgtcctgtgg
ggacgcaaac cgggcaaaga aggtcgggaa 420cgtccatatt tgcaagcctt
gaatggcccg caaaaagcca aagcggtctt tgccgccgga 480cgggactgtt
tggtgcgctt tagccccgtg gtctcgctgc gttatatggc cgactcgcac
540ggcaccgatg cctcgattgc ccacaagctg gcacgtgtgg cgcgcattca
cttctcacgt 600cagaagctgg cggcgtctgg gccgaacctg ccacaacgcc
accagttgtt ccaacgcttg 660atgaattccc cagcgatcga aaaagcgatt
gctgatgaag cggccgcgaa gaacatctcg 720ctggagaaag cgcgtaaaga
agcgcacgac atgcttgatg aaatcgccgc agatttctct 780tactcgttgg
tgcgcaaagg cgatcgcatt ctgggttggt tatggaaccg catctatcaa
840ggcttgaaca tcaataacgc cgcgacggtg cgccgcttgg cacaagatgg
tcacgagatt 900gtgtatgtgc cctgtcaccg cagccacatg gattacctgt
tgctgtcata cgtgttgtat 960cacgaaggca tggtgccccc gcacattgca
gcaggtatta acctcaactt cttcccggcc 1020ggaccgattt tccgccgtgg
tggcgcattc tttattcgtc gcagctttaa aggcaacaaa 1080ctctattcaa
ccatcttccg cgagtatctg gcagagctgt ttgccaaagg ctactcggtg
1140gagtacttca gtgaaggggg ccgctcacgc acaggtcgcc tgctgcaagc
caaaaccggc 1200atgctggcga tgaccattca agccatgttg cgcggtctca
accgcccggt cacactggtg 1260cccgtgtaca tcggctatga acatgtgatg
gaagtgggta cttacgccaa agagctgcgc 1320ggtaaacgca aagagaaaga
gaatgccagc ctagtgctgc gcaccattcg taaactgcgc 1380aacttcggtc
aaggctacgt gaactttggt gagccgattc cattgaacca gttcttgaat
1440gagcaagtgc ccgagtggac acaagacatc gatgccatgg gcgccagcaa
accccagtgg 1500atgacaccgg tggtgaacaa gctcgcgacg aagatgatga
cgcacattaa cgatgcagcg 1560gccgccaatg ccatgaccct atgtgcgacg
gcgcttttgg catcgcgtca gcgcgcgctg 1620gcccgtgaca atctggtgaa
gcagatcgat tgctacctgc aactgctgcg caacgtgccc 1680tattccaaca
cctataccgt gccaagcgac agcgcggaaa gtttggtgca gcacgccgaa
1740tcactggata agtttgtggt ggaaaccgac accatgggcg acatcatttc
gctcgatcgc 1800aatcagtcga ttctgatgac ctactaccgc aacaacatca
ttcacctgct ggcgttgcca 1860tcactgattg cgcagatgct gatccgtcag
caacaaatgc cggtggaaca gattcagacc 1920tgtgttgcga aggtgtaccc
attcctcaaa caagagctgt tcctcagcca tgatgaaacg 1980caactcgatg
aggtggtgat gcattatctc gctgagctgc aacgccaaca actggtgacg
2040ctggacgatg gcattgccac catcaaccaa gcgcagacgc aggtgctgat
gcttctgggt 2100cgcaccatct ctgagacgct gcaacgctac gcgatcacgc
tcaacctgtt ggtggctaac 2160cctgagctgg gcaaatccga tctggaaagc
aagagccaag aaattgcgca gcgtctgggt 2220cgactgcacg gcatcaacgc
ccccgagttt ttcgacaaag gcgtgttctc atcgatgttt 2280gtcacgctca
aacagcaagg ttacctcgac agcgatggca actgccacct cgaccagacc
2340aagcacttct cgcgcatgct ctacaccatg ctttaccctg aagtgcgcct
gactattcag 2400gaaagtatct gtcaggtgga ataa 242472661DNAVibrio
furnisii 7atgtctgaca tgaagcatga cgtagatgca ctggaaactc aggagtggtt
agccgcactt 60gagtcagttg tacgtgaaga aggcgtagag cgtgcccagt atctactaga
agaagtactg 120gaaaaagcac gtctagacgg cgttgatatg ccaactggta
ttacaactaa ctacatcaac 180acgattcctg cggcgcaaga accggcatac
ccaggcgaca cgaccattga acgtcgtatt 240cgttcgatca ttcgttggaa
cgcgatcatg atcgttctgc gtgcatcgaa gaaagacctg 300gatctgggcg
gccacatggc atcattccag tcttcagctg cgttctatga aacatgtttc
360aaccacttct tccgtgcacc aaacgagaag gacggtggtg acctggttta
ctaccaaggt 420catatttctc cagggattta cgcgcgtgca ttcgttgaag
gccgcctgac agaagaacaa 480ctggataact tccgtcaaga agtggatggc
aaaggtattc cttcctaccc acacccgaaa 540ctgatgcctg aattctggca
attcccaact gtatcgatgg gtctgggtcc tatcgcatcg 600atctaccaag
ctcgcttcct gaaatacctg gaaggccgtg gcatgaaaga cactgctgag
660cagcgcgttt acgcgttctt gggcgacggt gagatggatg agccagaatc
acgtggtgcc 720atttctttcg cggcgcgtga gaaactggac aacctgtgct
tcctgatcaa ctgtaacctg 780caacgtctgg atggcccagt aatgggtaac
ggcaagatca tccaagagct agaaggcctg 840ttcaaaggcg ctggctggaa
cgtggtgaaa gtgatctggg gtaacaactg ggattctctg 900ctggcaaaag
acacttcagg taaattgctg caactgatga acgaaaccat cgacggcgac
960taccaaacgt tcaaagcgaa agatggcgcg tacgttcgtg agcatttctt
cggtaaatac 1020ccagagacag cagcgctggt tgctgacatg actgacgacg
aagtgttcgc cctgaaacgt 1080ggtggtcacg agtcttctaa actgtacgca
gcgttcaaga acgcacaaga caccaaaggc 1140cgtccaaccg ttatcctcgc
gaagactgta aaaggttacg gcatgggtga tgcggctcaa 1200ggtaagaaca
ttgcacacca agtgaagaag atggacatga cgcacgtgat cgcgatgcgt
1260aaccgtctgg gtctgcaaga cataatttct gatgaagaag tgaacaacct
gccttacctg 1320aaactggaag aaggttcaaa agaattcgaa tacctgcacg
ctcgtcgtaa agcgctgcac 1380ggttacacgc cacagcgtct gcctaagttc
acacaagagc ttgtgattcc tgaactggaa 1440gagttcaaac cgcttctgga
agaacagaaa cgtgaaatct cttcaaccat ggcttacgtg 1500cgtgcactga
acattctgtt gaaagacaaa aatattggta agaacatcgt tcctatcatt
1560gctgacgaag cacgtacttt cggtatggaa ggtctgttcc gtcaaatcgg
tatctacaac 1620ccacacggcc agacgtacac gcctgaagac cgtggcgtgg
tgtcttacta caaagaagac 1680actgcaggtc aggtactgca agaagggatc
aacgaactgg gtgcaatgtc atcttgggtt 1740gcggctgcga catcttacag
caccaacaac ctgccaatga ttccgttcta catctactac 1800tcaatgttcg
gtttccaacg cgttggcgac atggcatgga tggcaggtga ccaacaagcg
1860cgtggtttcc tactgggcgc aacggctggc cgtacaaccc tgaacggtga
aggcctgcag 1920cacgaagatg gtcactcaca cattcaagcc gcgacaattc
cgaactgtat ctcttacgac 1980ccaacattcg cttacgaagt tgcggtgatc
atgcaagacg gtatccgtcg tatgtatggc 2040gatcaagaga acgtgttcta
ctacatgacg ctgatgaacg agaactacgc tcacccagcg 2100atgccagaag
gcgcagaaga aggtatccgt aaaggtatct acaaactgga aacgctgtct
2160ggttctaaag gtaaggttca actgatgagc tcaggtacta tcatgaatga
agtacgcaaa 2220gcggcagtga tcctgagcga agaatacggc atcgcgtctg
atgtttactc tgtaacctca 2280ttcaacgaac tggctcgtga tggtcagaac
gtcgagcgtt acaacatgct tcacccagaa 2340gccgaagcgc aagtacctta
catcgcttca gtgatgggaa ctgaaccagc aatcgctgca 2400accgactaca
tgaagaacta cgctgaccaa gttcgcgcgt tcattcctgc agagtcttac
2460aaagtgctgg gtactgacgg cttcggtcgt tcagacagcc gtgagaacct
acgtcgtcac 2520ttcgaagtga acgcaggcta cgtcgttgtt gctgcgctaa
acgaactagc gaaacgtggt 2580gaagttgaga aatctgtggt ggcggaagct
atcaagaaat tcgacatcga cactgaaaaa 2640actaacccgc tatacgctta a
266181893DNAVibrio furnisii 8atggctatcg aaatttacgt accagatatc
ggtgcagatg aggttgaagt gactgagatt 60cttgtcagcg taggcgacaa ggttgaagaa
gaacaatctc tgattactgt tgaaggcgac 120aaagcttcta tggaagttcc
tgcgtctcag gccggtattg tcaaagaaat caaagttgtg 180actggtgata
aagtcacaac tggctcactg atcatggtgt ttgaagcgga aggtgcagca
240gcggctgcac cagcacctgc ggcggaagca gcaccagttg cggcagcacc
agcagccgtt 300gaactgaaag aagttaacgt accggacatc ggcggtgacg
aagttgaagt gactgaaatc 360atggttgcgg tgggtgacac cgtgtctgaa
gagcagtcgc tgatcaccgt tgaaggcgac 420aaagcgtcaa tggaagtgcc
tgcgccattc gcgggtaccg tgaaagagat caagatcgca 480tcgggtgaca
aagtgaccac aggctcactg atcatggtct tcgaagtggc cggttctggt
540gcgccagcag cggcagcgcc agctcaggca gcggctccag cagcagcgcc
agcggtagca 600gcagataaag aagttaacgt gccagatatc ggcggcgatg
aagttgaagt gactgaaatc 660atggttgcag ttggcgacat ggtgagcgaa
gagcaatctc tgatcactgt ggaaggcgac 720aaagcgtcga tggaagttcc
tgcaccattc gcgggtaaag tgaaagcgat caaagtcgcg 780gctggcgaca
aagtgtcgac tggctcactg atcatggtgt ttgaagtggc aggcgcagcg
840ccggcagctg tttcagcacc agctcaagcc gcagcacctg cagcagcggc
accgaaagct 900gaagcgccag cggcagcagc acctgcagcg gcaaccggcg
acttccaaga gaacaatgaa 960tacgcacacg cgtcgccagt ggttcgtcgc
ttagcgcgtg aattcggtgt gaacctgtct 1020aaagtgaaag gttcaggtcg
taagagccgc attctgaaag aagatgttca gaactacgtg 1080aaagaagcgc
tgaaacgcct agaatcaggc gcagcatcag ccgcatctgg caaaggcgac
1140ggcgcagcac ttggcctgct accttggcca aaagtggact tcagcaagtt
cggtgacact 1200gaaattcagc cactgtctcg cattaagaag atctctggcg
cgaacctgca ccgtaactgg 1260gtgatgatcc cgcacgtgac ccagtgggat
aacgcagaca tcacagaact agaagctttc 1320cgtaaagaac agaacgcgat
cgaagcgaag aaagacactg gcatgaagat cacgccactg 1380gtgtttatca
tgaaagcggc tgcgaaagcg ctggaagcat tccctgcgtt caactcgtct
1440ctgtctgaag atggtgaaag cctgattctg aagaaatacg tgaacatcgg
tatcgcggtt 1500gatacaccaa acggtctggt tgttcctgtg ttcaaagacg
tgaacaagaa aggcatttac 1560gagctgtctg aagagttggc agtcgtatcg
aagaaagcac gtgcaggtaa actgacggcg 1620tctgacatgc aaggcggctg
tttcaccatc tctagtctgg gtggtatcgg cggtacagca 1680ttcacaccaa
tcgtgaatgc accagaagta ggtattctgg gtgtgtctaa gtctgaaatg
1740aagccagtgt ggaacggcaa agaatttgcg ccacgtctgc aactgcctct
gtctctgtca 1800tacgaccacc gtgtgatcga tggcgcggaa ggtgcacgct
tcatcactta cttgaacggt 1860tgcctgagcg acattcgtcg tctggttctg taa
18939951DNAVibrio furnisii 9atgtatagca aaattttagg tacaggcagc
tacctgccat ctcaggtgcg tactaacgcg 60gatttagaga aaatggtaga tacaagtgat
gagtggattg tcacgcgtac tggtattcgc 120gagcgtcgta ttgccgcaga
taatgaaacc gttgccgata tgggctttta cgcggcgcaa 180aacgctattg
agatggcggg cattgataaa aacgacatcg atttaatcat ccttgccacg
240accagtagca gtcacacgtt cccttcgtct gcctgtcagg tgcaagcgaa
actgggcatt 300aaaggttgcc cagcgtttga ccttgcggca gcgtgttctg
gttttatcta cggattgtca 360gtcgcggatc aacacatcaa atcgggcatg
tgtaaaaacg tgctggtgat tggtgccgat 420gcgttgtcaa aaacgtgtga
cccaaccgat cgctcaacca ttatcctgtt tggtgatggt 480gcgggtgcgg
ttgtggttgg tgccagtgaa gaacctggca ttttgtcgac tcatgtttac
540gctgatggtc aattcggcga cctgctcagc ctggaagtac cagagcgtgg
cggtgatgtg 600gacaaatggc tatatatggc cggcaacgaa gtgttcaaag
tggcggtgac gcagctttca 660aaactggtca aagacacgct ggcagccaac
aatatgcaca agtctgaact agactggttg 720gtaccgcatc aagcgaacta
tcgcattatt tctgcgacgg cgaaaaaatt gtcgatgtcg 780ctggatcaag
tggtgatcac gttggaccgt catgggaaca cgtctgctgc aacggtgccg
840acggcactgg acgaagcggt acgtgatggc cggatcaaac ggggtcagac
gctactttta 900gaagcctttg gtggtggttt cacctggggt tctgcgttag
tgaagttcta a 95110924DNAVibrio furnisii 10atgagcaagt ttgctatcgt
atttccaggt caaggttctc aagcggttgg tatgcttgcc 60gagcttggcg aacagtatga
cgtagttaaa caaactttcg cagaagcgtc tgacgcactg 120ggttacgacc
tatgggcatt ggttcagaac ggtcctgttg aagatctcaa ccagactttc
180cgtacgcaac ctgcactgct ggcgtcttct gtggcgattt ggcgtgtatg
gcaagcgctg 240ggtcttgagc agccagaagt gctggcaggc cacagccttg
gtgaatactc tgcactggtt 300tgtgccggtg tgattgattt taaagccgcg
atcaaattgg tcgaactgcg tggtcaactg 360atgcaagaag cagtacctgc
aggaaccggc gcaatgtacg cgatcatcgg tttggatgat 420gcggcgattg
ccaaagcgtg tgaagacgct gcgcaaggcg acgtggtgtc tccggtgaac
480ttcaactcac caggccaagt ggtcattgcc ggtcagaaag atgcggtaga
acgcgcgggc 540gcactgtgta aagaagcggg cgcgaaacgt gcactgccac
tgccggtgtc agtgccttca 600cactgcgcgc tgatgaaacc tgcagcagaa
aaactggctg tggcgctaga agcgcttgag 660ttcaacgcgc cgcaaatccc
agtgattaac aacgtggacg ttgcgacaga aacggatcca 720gcgaaaatca
aagatgcgtt ggttcgtcaa ctacacagcc cagtccgctg gacagaaggc
780gtggagaaga tggcagcaca aggcattgaa aaactaattg aagttggccc
aggcaaagta 840ctgactggtt tgactaaacg tattgtgaaa acgcttgatg
cagcagcagt gaacgacatc 900gcttcactgg aagccgttaa gtaa
92411747DNAVibrio furnisii 11atgagtaatt tcatgaacct ggaaggcaaa
attgtcctgg ttactggcgc aagccgtggt 60atcggtaaag caatcgcgga actattggtt
gaacgtggtg ccacagtgat tggtacagcg 120accagcgaaa gcggcgcaga
tgcgatcagt gcgtacctag gcgacaacgg caaaggtctg 180gcgttgaatg
tgacagatgt agcgtctatc gaatccgtgc tgaaaagcat taacgatgaa
240ttcggcggtg ttgatattct ggtgaacaac gcgggtatca cgcgtgacaa
cctgctgatg 300cgtatgaaag atgacgagtg gaccgatatt ctggatacca
acttgacgtc gatcttccgt 360ctgtctaaag ctgtacttcg tggcatgatg
aaaaaacgcc aaggccgtat cattaatgtc 420ggttctgttg tcggtacaat
gggtaacgcg ggtcaaacaa actacgcagc cgcaaaagcg 480ggcgtaatcg
gctttacgaa gtcaatggca cgtgaagttg catcccgtgg cgtgaccgtg
540aacacagttg caccaggttt catcgaaacg gatatgacaa aagcgctgaa
tgacgaccaa 600cgtgctgcta cacttgcaca agtgccagca ggtcgtctgg
gtgatccacg tgaaatcgca 660tccgcggttg cattcttggc atctccagaa
gcagcgtaca ttaccggtga aactctgcac 720gttaacggcg gaatgtacat ggtttaa
74712525DNAVibrio furnisii 12gaagtgaacg gaacttgttc ggtaaaatgt
tgacttcgtc caaaacttgt caatgaaatg 60cgcaagattt gtgcatgata tatgtcaaaa
atggtgtgaa tttcggttaa aatcgccaaa 120tttgtggttt gaccagcaag
gtcccccttg caactttcac tagtttgaat aaactacgga 180atcatcgcat
taggcgaaat ctgtaaagga aaagaaaaaa tgagcaacat cgaagaacgc
240gtaaagaaaa tcatcgttga acagctaggc gtagacgaag cagaagtgaa
aaacgaagct 300tctttcgttg aagacctagg tgcggattct ctagacactg
ttgagcttgt tatggctctg 360gaagaagaat tcgacactga gattcctgat
gaagaagcag agaaaatcac tactgttcaa 420gctgcgatcg attacgtaaa
cagcgctcag taatgtctct ccccaggcgg ccctctggcc 480gcctgagttt
ttctcactca tctataatct ctcatagaat tttca 525131251DNAVibrio furnisii
13atgatcgtgt ccaagcgtcg tgtcgttgtc actggcatgg gtatgttgtc accggtaggc
60aacactgtag aatcttcttg gaaagccctg ctagctggtc aaagtggtat cgtgaatatc
120gaacactttg atacaacaaa tttctcaact cgtttcgcag gtctggtaaa
agatttcaac 180tgcgaagagt acatgtctaa aaaagatgcc cgtaaaatgg
atttatttat ccagtacggt 240attgctgcgg gcatccaagc gctagacgat
tctggtctgg tgatcactga agaaaacgcg 300ccacgcgtcg gtgttgcaat
cggctcgggc atcggtggtc ttgatttgat cgaaaaaggt 360catcaagcgc
ttatggagaa aggtccacgt aaagtgagcc cattcttcgt cccttcaacc
420atcgtgaaca tggttgccgg taacttatct atcatgcgtg gtcttcgtgg
tcctaacatc 480gcgatttcaa ctgcatgtac cacaggttta cataacatcg
gccacgcggc gcgtatgatt 540gcatacggcg atgcggaagc gatggttgct
ggtggtagtg aaaaagcgtc tacccctctg 600ggtatggctg gcttcggtgc
cgctaaagcg ctgtctacac gcaacgatga acctgcaaaa 660gcttctcgcc
cttgggacaa agaccgtgac ggttttgttc tgggtgacgg cgcaggcgtg
720atggttctgg aaggatacga acacgcaaaa gcgcgtggcg cgaaaatcta
cgcagaaatc 780gtaggcttcg gtatgtccgg tgacgcgtac cacatgactt
cgccaagcga agatggttca 840ggtggcgcgc tggctatgga agcggcgatg
cgtgatgcag cactagcggg tacacaaatc 900ggctacgtga acgcgcacgg
tacgtcaaca ccagcaggtg acgtagcgga agtgaaaggt 960atcaaacgtg
cacttggcga agacggtgcg aaacaagtac tgatctcttc aaccaaatcg
1020atgaccggtc acctactggg tgctgcaggc tcggtagaag ccatcattac
cgtgatgtct 1080ctggttgacc aaatcgttcc gccaaccatc aacctggata
atccagaaga aggtttgggc 1140gtggatttgg ttccgcacac agcacgtaaa
gtggaaggca tggaatacgc gatgtgtaac 1200tcgtttggct ttggtggcac
aaacggttca ctgatcttca agcgcgtata a 1251141035DNAVibrio furnisii
14atgactgatt cacacacaaa caatgcttac ggtaaagcga tcgccatgac cgtcattggc
60gcgggttcgt acggcacatc tctggccatt tctttggctc gcaacggcgc caatgttgtc
120ctgtggggac acgatccggt ccacatggcg cgtttggaag cggaacgtgc
taaccacgaa 180ttcctccctg acatcgattt tccaccgtcg ctgatcattg
aatccgattt gcaaaaagcg 240gtgcaagcga gccgcgatct gctggtggtg
gtgccaagcc atgtgtttgc gattgtgctc 300aacagcctgc aaccttactt
gcgagaagat acccgtatct gctgggcaac caaagggttg 360gaaccggaca
caggacgttt gctgcaagat gtggcgcatg acgtgctggg tgaatcccat
420ccattggcgg tgctgtctgg cccgacgttt gcgaaagagc tggcgatggg
tatgcccact 480gcgatttcag tggcatcgcc tgacgcgcag tttgtcgccg
atctgcagga aaagattcac 540tgcagcaaaa ccttccgtgt ttatgccaac
agcgatttca tcggcatgca actggggggc 600gctgtgaaga acgtgattgc
cattggtgcg gggatgtcgg atggcatcgg ctttggtgcc 660aacgctcgta
cggcgctgat tacccgtggt ttggcggaaa tgacccgtct gggcgcggcg
720ctgggcgcgc agccggaaac cttcatgggc atggcggggc tgggtgattt
ggtgctgacg 780tgtaccgata accaatcgcg caaccgtcgt tttggtttgg
ccttgggcca aggcaaagat 840gtcgatacgg cgcaacaaga tatcggtcaa
gtggtggaag ggtatcggaa caccaaagag 900gtgtggctac tggcgcaacg
catgggcgtg gagatgccaa tagttgaaca aatttatcaa 960gtattgtatc
aaggaaagga cgcccgcatg gcagcacaag atttgctggc gcgcgataaa
1020aaagcagaac gataa 103515855DNAVibrio furnisii 15gtggtgtgtg
cgtttgtgaa cgacgatttg agtgcgaccg tgttggaaga actgtatcaa 60gggggcactc
gcctgatcgc catgcgctgc gcgggctttg ataaagtgga tttagacgcc
120gcaaaacgca ttggcatgca ggtggttcgc gtacctgcgt attcaccaga
agcggtggca 180gagcacgcgg tcgggttgat gatgtgtctg aaccgccgtt
accacaaagc gtatcagcgc 240acacgtgagg ccaacttctc gttggaaggc
ttggtgggct ttaacttcta tggcaaaacc 300gtgggtgtga ttggttcagg
caagattggc attgcagcga tgcgtatcct caaaggcctt 360ggcatgaaca
ttctctgctt tgacccgtat gaaaacccat tggccattga aatcggcgcg
420aaatacgttc aattgccgga gctgtatgca aacagcgaca tcattacgct
gcactgcccg 480atgaccaaag aaaactacca cctgctggat gagcaagcgt
tcgctcaaat gaaggatggg 540gtgatgatca tcaataccag ccgtggcgaa
ttgcttgatt cagtcgcagc cattgaagcg 600ctcaaacgtg gccgtattgg
cgcgctgggc ttagacgtat acgacaacga aaaagatctg 660ttcttccaag
acaagtcgaa cgatgtgatt gtagatgacg tgttccgccg cctgtccgcc
720tgccataacg tgctgtttac cggccatcag gcgtttttga cagaagatgc
cctgcacaat 780atcgcgcaaa ccacgcttaa caacgtgctg gcgtttgagc
aaggcaccaa atctggaaac 840gaattagtta actaa 85516177PRTVibrio
furnisiimisc_feature(2)..(2)Xaa can be any naturally occurring
amino acid 16Phe Xaa Asn Leu Glu Lys Pro Ile Val Glu Leu Glu Ala
Lys Ile Gln1 5 10 15Ala Leu Arg Asp Val Ser Arg His Gly Gly Gly Thr
Ser Val Asp Leu 20 25 30Glu Lys Glu Ile Glu Gln Leu Glu Lys Lys Ser
Leu Glu Leu Lys Lys 35 40 45Lys Ile Phe Gly Asp Leu Gly Ala Trp Gln
Val Ala Gln Met Ala Arg 50 55 60His Pro Gln Arg Pro Tyr Thr Leu Asp
Tyr Ile Asn Asn Met Phe Thr65 70 75 80Glu Phe Asp Glu Leu Ala Gly
Asp Arg Ala Phe Ala Asp Asp Lys Ala 85 90 95Ile Val Gly Gly Met Ala
Arg Leu Asp Gly Arg Pro Val Met Val Ile 100 105 110Gly His Gln Lys
Gly Arg Glu Thr Arg Glu Lys Val Lys Arg Asn Phe 115 120 125Gly Met
Pro Lys Pro Glu Gly Tyr Arg Lys Ala Leu Arg Leu Met Glu 130 135
140Met Ala Glu Arg Phe Asn Met Pro Ile Ile Thr Phe Ile Asp Thr
Ala145 150 155 160Gly Ala Tyr Pro Gly Val Gly Ala Glu Glu Arg Gly
Gln Ser Glu Ala 165 170 175Ile17187PRTVibrio furnisii 17Met Asn Ser
Leu Cys Arg Gln Pro Phe Ala Arg Cys Lys Gln Ser Lys1 5 10 15Pro Lys
His Ser Ala Ala Gln Leu Ser Cys Leu Ile His Lys Ile Lys 20 25 30Glu
Lys Glu Thr Met Asp Ile Arg Lys Ile Lys Lys Leu Ile Glu Leu 35 40
45Val Glu Glu Ser Gly Ile Ala Glu Leu Glu Ile Ser Glu Gly Glu Glu
50 55 60Ser Val Arg Ile Ser Arg His Gly Val Ala Pro Val Ala Pro Ile
Gln65 70 75 80Tyr Ala Ala Pro Ala Pro Met Ala Ala Pro Val Ala Ala
Pro Ala Ala 85 90 95Ala Pro Val Ala Glu Ala Pro Ala Ala Ala Lys Thr
Pro Ala Gly His 100 105 110Met Val Leu Ser Pro Met Val Gly Thr Phe
Tyr Arg Ser Pro Ser Pro 115 120 125Asp Ala Lys Ser Phe Ile Glu Val
Gly Gln Thr Val Lys Ala Gly Asp 130 135 140Thr Leu Cys Ile Val Glu
Ala Met Lys Met Met Asn Gln Ile Glu Ala145 150 155 160Asp Lys Ser
Gly Val Val Thr Glu Ile Leu Val Glu Asp Gly Gln Ala 165 170 175Val
Glu Phe Asp Gln Pro Leu Val Val Ile Glu 180 18518447PRTVibrio
furnisii 18Met Leu Asp Lys Leu Val Ile Ala Asn Arg Gly Glu Ile Ala
Leu Arg1 5 10 15Ile Leu Arg Ala Cys Lys Glu Leu Gly Ile Lys Thr Val
Ala Val His 20 25 30Ser Thr Ala Asp Arg Asp Leu Lys His Val Leu Leu
Ala Asp Glu Thr 35 40 45Val Cys Ile Gly Pro Ala Lys Gly Ile Asp Ser
Tyr Leu Asn Ile Pro 50 55 60Arg Ile Ile Ser Ala Ala Glu Val Thr Gly
Ala Val Ala Ile His Pro65 70 75 80Gly Tyr Gly Phe Leu Ser Glu Asn
Ala Asp Phe Ala Glu Gln Val Glu 85 90 95Arg Ser Gly Phe Ile Phe Val
Gly Pro Lys Ala Asp Thr Ile Arg Leu 100 105 110Met Gly Asp Lys Val
Ser Ala Ile Thr Ala Met Lys Lys Ala Gly Val 115 120 125Pro Cys Val
Pro Gly Ser Asp Gly Pro Leu Asp Asn Asp Glu Val Lys 130 135 140Asn
Arg Ala His Ala Lys Arg Ile Gly Tyr Pro Val Ile Ile Lys Ala145 150
155 160Ser Gly Gly Gly Gly Gly Arg Gly Met Arg Val Val Arg Ser Glu
Ala 165 170 175Glu Leu Val Asn Ala Ile Ser Met Thr Arg Ala Glu Ala
Lys Ala Ala 180 185 190Phe Asn Asn Asp Met Val Tyr Met Glu Lys Tyr
Leu Glu Asn Pro Arg 195 200 205His Val Glu Val Gln Val Leu Ala Asp
Gly Gln Gly Ser Ala Ile His 210 215 220Leu Gly Glu Arg Asp Cys Ser
Met Gln Arg Arg His Gln Lys Val Val225 230 235 240Glu Glu Ala Pro
Ala Pro Gly Ile Thr Glu Glu Met Arg Lys Tyr Ile 245 250 255Gly Glu
Arg Cys Thr Arg Ala Cys Ile Glu Ile Gly Tyr Arg Gly Ala 260 265
270Gly Thr Phe Glu Phe Leu Tyr Glu Asn Gly Glu Phe Tyr Phe Ile Glu
275 280 285Met Asn Thr Arg Ile Gln Val Glu His Pro Val Thr Glu Met
Val Thr 290 295 300Gly Val Asp Leu Ile Lys Glu Gln Leu Arg Ile Ala
Ala Gly Gln Pro305 310 315 320Leu Ser Phe Thr Gln Asp Asp Ile Lys
Ile Arg Gly His Ala Met Glu 325 330 335Cys Arg Ile Asn Ala Glu Asp
Pro Glu Arg Phe Leu Pro Cys Pro Gly 340 345 350Lys Ile Thr Arg Phe
His Ser Pro Gly Gly Met Gly Val Arg Trp Glu 355 360 365Ser His Ile
Tyr Ser Gly Tyr Thr Val Pro Ala Tyr Tyr Asp Ser Met 370 375 380Ile
Gly Lys Leu Ile Thr Phe Gly Glu Asn Arg Asp Val Ala Ile Ala385 390
395 400Arg Met Arg Asn Ala Leu Asp Glu Met Ile Val Glu Gly Ile Lys
Thr 405 410 415Asn Ile Pro Leu Gln Gln Val Ile Met Lys Asp Glu Asn
Phe Gln His 420 425 430Gly Gly Thr Asn Ile His Tyr Leu Glu Lys Lys
Leu Gly Leu Gln 435 440 44519308PRTVibrio furnisii 19Met Ser Trp
Leu Glu Lys Ile Leu Glu Lys Ser Asn Ile Gly Ser Ser1 5 10 15Arg Lys
Ala Ser Ile Pro Glu Gly Val Trp Thr Lys Cys Thr Ser Cys 20 25 30Glu
Gln Val Leu Tyr Tyr Ala Glu Leu Glu Arg Asn Leu Glu Val Cys 35 40
45Pro Lys Cys Asn His His Met Arg Met Lys Ala Arg Arg Arg Leu Glu
50 55 60Thr Phe Leu Asp Glu Ala Asn Arg Tyr Glu Ile Ala Asp Glu Leu
Glu65 70 75 80Pro Gln Asp Lys Leu Lys Phe Lys Asp Ser Lys Arg Tyr
Lys Glu Arg 85 90 95Leu Ala Thr Ala Gln Lys Ser Ser Gly Glu Lys Asp
Ala Leu Ile Val 100 105 110Met Lys Gly Glu Leu Met Thr Ile Pro Val
Val Ala Cys Ala Phe Glu 115 120 125Phe Ser Phe Met Gly Gly Ser Met
Gly Ser Val Val Gly Ala Arg Phe 130 135 140Val Arg Ala Val Glu Ala
Ala Ile Glu Ala Asn Cys Gly Leu Val Cys145 150 155 160Phe Ser Ala
Ser Gly Gly Ala Arg Met Gln Glu Ala Leu Met Ser Leu 165 170 175Met
Gln Met Ala Lys Thr Ser Ala Ala Leu Glu Arg Leu Thr Ala Lys 180 185
190Gly Leu Pro Phe Ile Ser Val Met Thr Asp Pro Thr Met Gly Gly Val
195 200 205Ser Ala Ser Leu Ala Met Leu Gly Asp Ile Asn Ile Gly Glu
Pro Lys 210 215 220Ala Leu Ile Gly Phe Ala Gly Arg Arg Val Ile Glu
Gln Thr Val Arg225 230 235 240Glu Glu Leu Pro Glu Gly Phe Gln Arg
Ser Glu Phe Leu Leu Glu His 245 250 255Gly Ala Ile Asp Met Ile Val
Asp Arg Arg Glu Met Arg Gln Arg Val 260 265 270Ala Gly Leu Leu Ala
Lys Met Thr Arg Gln Glu Ser Pro Leu Val Val 275 280 285Ser Val Asn
Asp Ala Pro Asn Glu Ala Ala Tyr Ser Val Pro Glu Ala 290 295 300Asn
Lys Lys Gly30520814PRTVibrio furnisii 20Met Asp Ile Leu Leu Ser Ile
Leu Gly Phe Val Val Val Leu Ser Gly1 5 10 15Cys Leu Tyr His Arg Thr
Ser Leu Met Thr Ala Leu Ala Ala Leu Thr 20 25 30Val Thr Met Leu Val
Leu Ser Leu Phe Gly Pro Val Gly Ile Ile Ser 35 40 45Trp Ala Leu Tyr
Leu Ala Ala Ile Ala Val Leu Ala Val Pro Ser Ile 50 55 60Arg Gln Ser
Leu Ile Ser Gly Lys Thr Leu Lys Val Phe Lys Lys Val65 70 75 80Leu
Pro Ala Met Ser Gln Thr Glu Lys Glu Ala Leu Asp Ala Gly Thr 85 90
95Val Trp Trp Glu Ala Glu Leu Phe Lys Gly Lys Pro Asp Trp Gln Gln
100 105 110Leu Ser His Ile Lys Ala Pro Thr Leu Ser Ala Glu Glu Gln
Ala Phe 115 120 125Leu Asp Gly Pro Val Asn Glu Val Cys Ala Met Val
Asn Asp Tyr Gln 130 135 140Val Thr His Glu Leu Ala Asp Leu Pro Pro
Glu Val Trp Gln Tyr Leu145 150 155 160Lys Asp His Lys Phe Phe Ala
Met Ile Ile Lys Lys Gln Tyr Gly Gly 165 170 175Leu Glu Phe Ser Ala
Tyr Ala Gln Ser Leu Val Leu Gln Lys Leu Thr 180 185 190Gly Val Ser
Gly Val Leu Ser Ser Thr Val Gly Val Pro Asn Ser Leu 195 200 205Gly
Pro Gly Glu Leu Leu Gln His Tyr Gly Thr Asp Asp Gln Lys Asp 210 215
220Tyr Tyr Leu Pro Arg Leu Ala Glu Gly Lys Glu Ile Pro Cys Phe
Ala225 230 235 240Leu Thr Ser Pro Glu Ala Gly Ser Asp Ala Gly Ser
Ile Pro Asp Tyr 245 250 255Gly Ile Val Cys Lys Asp Glu Trp Glu Gly
Lys Glu Val Leu Gly Met 260 265 270Arg Leu Thr Trp Asn Lys Arg Tyr
Ile Thr Leu Ala Pro Val Ala Thr 275 280 285Val Leu Gly Leu Ala Phe
Lys Leu Arg Asp Pro Asp Gly Leu Leu Gly 290 295 300Asp Gln Lys Glu
Ile Gly Ile Thr Cys Ala Leu Ile Pro Thr His Leu305 310 315 320Lys
Gly Val Glu Ile Gly Asn Arg His Phe Pro Leu Asn Val Pro Phe 325 330
335Gln Asn Gly Pro Thr Arg Ala Asn Asp Leu Phe Val Pro Leu Asp Phe
340 345 350Ile Ile Gly Gly Pro Ser Met Ala Gly Gln Gly Trp Arg Met
Leu Val 355 360 365Glu Cys Leu Ser Val Gly Arg Gly Ile Thr Leu Pro
Ser Asn Ser Thr 370 375 380Gly Gly Ile Lys Ala Ala Ala Met Ala Thr
Gly Ala Tyr Ala Arg Ile385 390 395 400Arg Arg Gln Phe Lys Gln Pro
Ile Gly His Met Glu Gly Ile Glu Glu 405 410 415Pro Leu Ala Arg Leu
Ala Gly Asn Ala Tyr Val Met Asp Ala Ala Ser 420 425 430Asn Leu Thr
Val Ala Gly Ile Asp Ala Gly Glu Lys Pro Ser Val Ile 435 440 445Ser
Ala Ile Val Lys Tyr His Cys Thr His Arg Gly Gln Arg Ser Ile 450 455
460Ile Asp Ala Met Asp Ile Val Gly Gly Lys Gly Ile Cys Leu Gly
Pro465 470 475 480Ser Asn Phe Leu Ala Arg Gly Tyr Gln Gly Ser Pro
Ile Ala Ile Thr 485 490 495Val Glu Gly Ala Asn Ile Leu Thr Arg Ser
Met Ile Ile Phe Gly Gln 500 505 510Gly Ala Ile Arg Cys His Pro Tyr
Val Leu Lys Glu Met Glu Ala Ala 515 520 525Tyr Ser Asp Ser Ala Asn
Ala Val Glu Gln Phe Asp Ala Ala Leu Ala 530 535 540Gly His Val Ser
Phe Thr Met Ser Asn Leu Val Arg Cys Ile Trp Phe545 550
555 560Gly Leu Thr Asp Gly Leu Gly Ser Ala Ala Pro Thr Lys Asp Ala
Thr 565 570 575Lys Arg Tyr Tyr Gln Gln Leu Asn Arg Tyr Ser Ala Asn
Leu Ala Leu 580 585 590Leu Ala Asp Ile Ser Met Ala Val Leu Gly Gly
Ser Leu Lys Arg Lys 595 600 605Glu Arg Leu Ser Ala Arg Leu Gly Asp
Ile Leu Ser Gln Leu Tyr Leu 610 615 620Ser Ser Ala Thr Leu Lys Arg
Phe Glu Asn Asp Gly Arg Pro Ala Glu625 630 635 640Asp Leu Ala Leu
Val His Trp Gly Leu Gln Asp Ser Leu Lys Gln Thr 645 650 655Glu Val
Ala Ile Asp Glu Phe Leu Ala Asn Phe Pro Asn Lys Val Ile 660 665
670Gly Lys Ala Leu Arg Val Leu Ile Met Pro Phe Gly Arg Val Arg Lys
675 680 685Ala Pro Asn Asp Lys Leu Asp Ser Lys Val Ala Gln Ile Ile
Gln Thr 690 695 700Pro Ser Ala Thr Arg Ser Arg Ile Gly Arg His Gln
Tyr Leu Glu Pro705 710 715 720Thr Ala His Asn Ala Val Gly Lys Ile
Glu Leu Ala Leu Asn Val Ile 725 730 735Leu Gln Ala Glu Pro Val Phe
Asp Lys Val Cys Lys Ala Leu Asn Glu 740 745 750Arg Arg Pro Phe Thr
Gln Leu Asp Gln Val Ala Gln Cys Gly Leu Glu 755 760 765Gln Lys Leu
Ile Thr Glu Gln Glu Ala Glu Leu Leu Ile Glu Ala Glu 770 775 780Gln
His Arg Leu Tyr Thr Ile Asn Val Asp Asp Phe Ala Pro Gln Glu785 790
795 800Leu Ala Ala Lys Lys Ser Gln Pro Lys Leu Val Glu Val Ala 805
81021807PRTVibrio furnisii 21Met Ser Ser Gly His Ser Phe Ser Arg
Ser Leu Leu Lys Leu Pro Leu1 5 10 15Ser Val Leu Val Lys Gly Thr Val
Ile Pro Ser Asn Pro Ile Asp Asp 20 25 30Leu Glu Ile Asp Ile Asn Lys
Pro Ile Val Tyr Ala Leu Pro Phe Arg 35 40 45Ser Asn Val Asp Leu Leu
Thr Leu Gln Thr His Ala Leu Gln Ala Gly 50 55 60Leu Pro Asp Pro Leu
Glu Pro Leu Thr Ile His Ser His Thr Leu Lys65 70 75 80Arg Tyr Val
Phe Ile Ser Ser Arg Pro Thr Leu Leu Gln Asp Asp Asn 85 90 95Gln Val
Pro Thr Asp Ser Ile Ala Thr Phe Ser Glu Met Leu Ser Leu 100 105
110His Gln Glu Asp Ser Glu Leu Asp Val Gln Val Ile Pro Ala Thr Val
115 120 125Leu Trp Gly Arg Lys Pro Gly Lys Glu Gly Arg Glu Arg Pro
Tyr Leu 130 135 140Gln Ala Leu Asn Gly Pro Gln Lys Ala Lys Ala Val
Phe Ala Ala Gly145 150 155 160Arg Asp Cys Leu Val Arg Phe Ser Pro
Val Val Ser Leu Arg Tyr Met 165 170 175Ala Asp Ser His Gly Thr Asp
Ala Ser Ile Ala His Lys Leu Ala Arg 180 185 190Val Ala Arg Ile His
Phe Ser Arg Gln Lys Leu Ala Ala Ser Gly Pro 195 200 205Asn Leu Pro
Gln Arg His Gln Leu Phe Gln Arg Leu Met Asn Ser Pro 210 215 220Ala
Ile Glu Lys Ala Ile Ala Asp Glu Ala Ala Ala Lys Asn Ile Ser225 230
235 240Leu Glu Lys Ala Arg Lys Glu Ala His Asp Met Leu Asp Glu Ile
Ala 245 250 255Ala Asp Phe Ser Tyr Ser Leu Val Arg Lys Gly Asp Arg
Ile Leu Gly 260 265 270Trp Leu Trp Asn Arg Ile Tyr Gln Gly Leu Asn
Ile Asn Asn Ala Ala 275 280 285Thr Val Arg Arg Leu Ala Gln Asp Gly
His Glu Ile Val Tyr Val Pro 290 295 300Cys His Arg Ser His Met Asp
Tyr Leu Leu Leu Ser Tyr Val Leu Tyr305 310 315 320His Glu Gly Met
Val Pro Pro His Ile Ala Ala Gly Ile Asn Leu Asn 325 330 335Phe Phe
Pro Ala Gly Pro Ile Phe Arg Arg Gly Gly Ala Phe Phe Ile 340 345
350Arg Arg Ser Phe Lys Gly Asn Lys Leu Tyr Ser Thr Ile Phe Arg Glu
355 360 365Tyr Leu Ala Glu Leu Phe Ala Lys Gly Tyr Ser Val Glu Tyr
Phe Ser 370 375 380Glu Gly Gly Arg Ser Arg Thr Gly Arg Leu Leu Gln
Ala Lys Thr Gly385 390 395 400Met Leu Ala Met Thr Ile Gln Ala Met
Leu Arg Gly Leu Asn Arg Pro 405 410 415Val Thr Leu Val Pro Val Tyr
Ile Gly Tyr Glu His Val Met Glu Val 420 425 430Gly Thr Tyr Ala Lys
Glu Leu Arg Gly Lys Arg Lys Glu Lys Glu Asn 435 440 445Ala Ser Leu
Val Leu Arg Thr Ile Arg Lys Leu Arg Asn Phe Gly Gln 450 455 460Gly
Tyr Val Asn Phe Gly Glu Pro Ile Pro Leu Asn Gln Phe Leu Asn465 470
475 480Glu Gln Val Pro Glu Trp Thr Gln Asp Ile Asp Ala Met Gly Ala
Ser 485 490 495Lys Pro Gln Trp Met Thr Pro Val Val Asn Lys Leu Ala
Thr Lys Met 500 505 510Met Thr His Ile Asn Asp Ala Ala Ala Ala Asn
Ala Met Thr Leu Cys 515 520 525Ala Thr Ala Leu Leu Ala Ser Arg Gln
Arg Ala Leu Ala Arg Asp Asn 530 535 540Leu Val Lys Gln Ile Asp Cys
Tyr Leu Gln Leu Leu Arg Asn Val Pro545 550 555 560Tyr Ser Asn Thr
Tyr Thr Val Pro Ser Asp Ser Ala Glu Ser Leu Val 565 570 575Gln His
Ala Glu Ser Leu Asp Lys Phe Val Val Glu Thr Asp Thr Met 580 585
590Gly Asp Ile Ile Ser Leu Asp Arg Asn Gln Ser Ile Leu Met Thr Tyr
595 600 605Tyr Arg Asn Asn Ile Ile His Leu Leu Ala Leu Pro Ser Leu
Ile Ala 610 615 620Gln Met Leu Ile Arg Gln Gln Gln Met Pro Val Glu
Gln Ile Gln Thr625 630 635 640Cys Val Ala Lys Val Tyr Pro Phe Leu
Lys Gln Glu Leu Phe Leu Ser 645 650 655His Asp Glu Thr Gln Leu Asp
Glu Val Val Met His Tyr Leu Ala Glu 660 665 670Leu Gln Arg Gln Gln
Leu Val Thr Leu Asp Asp Gly Ile Ala Thr Ile 675 680 685Asn Gln Ala
Gln Thr Gln Val Leu Met Leu Leu Gly Arg Thr Ile Ser 690 695 700Glu
Thr Leu Gln Arg Tyr Ala Ile Thr Leu Asn Leu Leu Val Ala Asn705 710
715 720Pro Glu Leu Gly Lys Ser Asp Leu Glu Ser Lys Ser Gln Glu Ile
Ala 725 730 735Gln Arg Leu Gly Arg Leu His Gly Ile Asn Ala Pro Glu
Phe Phe Asp 740 745 750Lys Gly Val Phe Ser Ser Met Phe Val Thr Leu
Lys Gln Gln Gly Tyr 755 760 765Leu Asp Ser Asp Gly Asn Cys His Leu
Asp Gln Thr Lys His Phe Ser 770 775 780Arg Met Leu Tyr Thr Met Leu
Tyr Pro Glu Val Arg Leu Thr Ile Gln785 790 795 800Glu Ser Ile Cys
Gln Val Glu 80522886PRTVibrio furnisii 22Met Ser Asp Met Lys His
Asp Val Asp Ala Leu Glu Thr Gln Glu Trp1 5 10 15Leu Ala Ala Leu Glu
Ser Val Val Arg Glu Glu Gly Val Glu Arg Ala 20 25 30Gln Tyr Leu Leu
Glu Glu Val Leu Glu Lys Ala Arg Leu Asp Gly Val 35 40 45Asp Met Pro
Thr Gly Ile Thr Thr Asn Tyr Ile Asn Thr Ile Pro Ala 50 55 60Ala Gln
Glu Pro Ala Tyr Pro Gly Asp Thr Thr Ile Glu Arg Arg Ile65 70 75
80Arg Ser Ile Ile Arg Trp Asn Ala Ile Met Ile Val Leu Arg Ala Ser
85 90 95Lys Lys Asp Leu Asp Leu Gly Gly His Met Ala Ser Phe Gln Ser
Ser 100 105 110Ala Ala Phe Tyr Glu Thr Cys Phe Asn His Phe Phe Arg
Ala Pro Asn 115 120 125Glu Lys Asp Gly Gly Asp Leu Val Tyr Tyr Gln
Gly His Ile Ser Pro 130 135 140Gly Ile Tyr Ala Arg Ala Phe Val Glu
Gly Arg Leu Thr Glu Glu Gln145 150 155 160Leu Asp Asn Phe Arg Gln
Glu Val Asp Gly Lys Gly Ile Pro Ser Tyr 165 170 175Pro His Pro Lys
Leu Met Pro Glu Phe Trp Gln Phe Pro Thr Val Ser 180 185 190Met Gly
Leu Gly Pro Ile Ala Ser Ile Tyr Gln Ala Arg Phe Leu Lys 195 200
205Tyr Leu Glu Gly Arg Gly Met Lys Asp Thr Ala Glu Gln Arg Val Tyr
210 215 220Ala Phe Leu Gly Asp Gly Glu Met Asp Glu Pro Glu Ser Arg
Gly Ala225 230 235 240Ile Ser Phe Ala Ala Arg Glu Lys Leu Asp Asn
Leu Cys Phe Leu Ile 245 250 255Asn Cys Asn Leu Gln Arg Leu Asp Gly
Pro Val Met Gly Asn Gly Lys 260 265 270Ile Ile Gln Glu Leu Glu Gly
Leu Phe Lys Gly Ala Gly Trp Asn Val 275 280 285Val Lys Val Ile Trp
Gly Asn Asn Trp Asp Ser Leu Leu Ala Lys Asp 290 295 300Thr Ser Gly
Lys Leu Leu Gln Leu Met Asn Glu Thr Ile Asp Gly Asp305 310 315
320Tyr Gln Thr Phe Lys Ala Lys Asp Gly Ala Tyr Val Arg Glu His Phe
325 330 335Phe Gly Lys Tyr Pro Glu Thr Ala Ala Leu Val Ala Asp Met
Thr Asp 340 345 350Asp Glu Val Phe Ala Leu Lys Arg Gly Gly His Glu
Ser Ser Lys Leu 355 360 365Tyr Ala Ala Phe Lys Asn Ala Gln Asp Thr
Lys Gly Arg Pro Thr Val 370 375 380Ile Leu Ala Lys Thr Val Lys Gly
Tyr Gly Met Gly Asp Ala Ala Gln385 390 395 400Gly Lys Asn Ile Ala
His Gln Val Lys Lys Met Asp Met Thr His Val 405 410 415Ile Ala Met
Arg Asn Arg Leu Gly Leu Gln Asp Ile Ile Ser Asp Glu 420 425 430Glu
Val Asn Asn Leu Pro Tyr Leu Lys Leu Glu Glu Gly Ser Lys Glu 435 440
445Phe Glu Tyr Leu His Ala Arg Arg Lys Ala Leu His Gly Tyr Thr Pro
450 455 460Gln Arg Leu Pro Lys Phe Thr Gln Glu Leu Val Ile Pro Glu
Leu Glu465 470 475 480Glu Phe Lys Pro Leu Leu Glu Glu Gln Lys Arg
Glu Ile Ser Ser Thr 485 490 495Met Ala Tyr Val Arg Ala Leu Asn Ile
Leu Leu Lys Asp Lys Asn Ile 500 505 510Gly Lys Asn Ile Val Pro Ile
Ile Ala Asp Glu Ala Arg Thr Phe Gly 515 520 525Met Glu Gly Leu Phe
Arg Gln Ile Gly Ile Tyr Asn Pro His Gly Gln 530 535 540Thr Tyr Thr
Pro Glu Asp Arg Gly Val Val Ser Tyr Tyr Lys Glu Asp545 550 555
560Thr Ala Gly Gln Val Leu Gln Glu Gly Ile Asn Glu Leu Gly Ala Met
565 570 575Ser Ser Trp Val Ala Ala Ala Thr Ser Tyr Ser Thr Asn Asn
Leu Pro 580 585 590Met Ile Pro Phe Tyr Ile Tyr Tyr Ser Met Phe Gly
Phe Gln Arg Val 595 600 605Gly Asp Met Ala Trp Met Ala Gly Asp Gln
Gln Ala Arg Gly Phe Leu 610 615 620Leu Gly Ala Thr Ala Gly Arg Thr
Thr Leu Asn Gly Glu Gly Leu Gln625 630 635 640His Glu Asp Gly His
Ser His Ile Gln Ala Ala Thr Ile Pro Asn Cys 645 650 655Ile Ser Tyr
Asp Pro Thr Phe Ala Tyr Glu Val Ala Val Ile Met Gln 660 665 670Asp
Gly Ile Arg Arg Met Tyr Gly Asp Gln Glu Asn Val Phe Tyr Tyr 675 680
685Met Thr Leu Met Asn Glu Asn Tyr Ala His Pro Ala Met Pro Glu Gly
690 695 700Ala Glu Glu Gly Ile Arg Lys Gly Ile Tyr Lys Leu Glu Thr
Leu Ser705 710 715 720Gly Ser Lys Gly Lys Val Gln Leu Met Ser Ser
Gly Thr Ile Met Asn 725 730 735Glu Val Arg Lys Ala Ala Val Ile Leu
Ser Glu Glu Tyr Gly Ile Ala 740 745 750Ser Asp Val Tyr Ser Val Thr
Ser Phe Asn Glu Leu Ala Arg Asp Gly 755 760 765Gln Asn Val Glu Arg
Tyr Asn Met Leu His Pro Glu Ala Glu Ala Gln 770 775 780Val Pro Tyr
Ile Ala Ser Val Met Gly Thr Glu Pro Ala Ile Ala Ala785 790 795
800Thr Asp Tyr Met Lys Asn Tyr Ala Asp Gln Val Arg Ala Phe Ile Pro
805 810 815Ala Glu Ser Tyr Lys Val Leu Gly Thr Asp Gly Phe Gly Arg
Ser Asp 820 825 830Ser Arg Glu Asn Leu Arg Arg His Phe Glu Val Asn
Ala Gly Tyr Val 835 840 845Val Val Ala Ala Leu Asn Glu Leu Ala Lys
Arg Gly Glu Val Glu Lys 850 855 860Ser Val Val Ala Glu Ala Ile Lys
Lys Phe Asp Ile Asp Thr Glu Lys865 870 875 880Thr Asn Pro Leu Tyr
Ala 88523630PRTVibrio furnisii 23Met Ala Ile Glu Ile Tyr Val Pro
Asp Ile Gly Ala Asp Glu Val Glu1 5 10 15Val Thr Glu Ile Leu Val Ser
Val Gly Asp Lys Val Glu Glu Glu Gln 20 25 30Ser Leu Ile Thr Val Glu
Gly Asp Lys Ala Ser Met Glu Val Pro Ala 35 40 45Ser Gln Ala Gly Ile
Val Lys Glu Ile Lys Val Val Thr Gly Asp Lys 50 55 60Val Thr Thr Gly
Ser Leu Ile Met Val Phe Glu Ala Glu Gly Ala Ala65 70 75 80Ala Ala
Ala Pro Ala Pro Ala Ala Glu Ala Ala Pro Val Ala Ala Ala 85 90 95Pro
Ala Ala Val Glu Leu Lys Glu Val Asn Val Pro Asp Ile Gly Gly 100 105
110Asp Glu Val Glu Val Thr Glu Ile Met Val Ala Val Gly Asp Thr Val
115 120 125Ser Glu Glu Gln Ser Leu Ile Thr Val Glu Gly Asp Lys Ala
Ser Met 130 135 140Glu Val Pro Ala Pro Phe Ala Gly Thr Val Lys Glu
Ile Lys Ile Ala145 150 155 160Ser Gly Asp Lys Val Thr Thr Gly Ser
Leu Ile Met Val Phe Glu Val 165 170 175Ala Gly Ser Gly Ala Pro Ala
Ala Ala Ala Pro Ala Gln Ala Ala Ala 180 185 190Pro Ala Ala Ala Pro
Ala Val Ala Ala Asp Lys Glu Val Asn Val Pro 195 200 205Asp Ile Gly
Gly Asp Glu Val Glu Val Thr Glu Ile Met Val Ala Val 210 215 220Gly
Asp Met Val Ser Glu Glu Gln Ser Leu Ile Thr Val Glu Gly Asp225 230
235 240Lys Ala Ser Met Glu Val Pro Ala Pro Phe Ala Gly Lys Val Lys
Ala 245 250 255Ile Lys Val Ala Ala Gly Asp Lys Val Ser Thr Gly Ser
Leu Ile Met 260 265 270Val Phe Glu Val Ala Gly Ala Ala Pro Ala Ala
Val Ser Ala Pro Ala 275 280 285Gln Ala Ala Ala Pro Ala Ala Ala Ala
Pro Lys Ala Glu Ala Pro Ala 290 295 300Ala Ala Ala Pro Ala Ala Ala
Thr Gly Asp Phe Gln Glu Asn Asn Glu305 310 315 320Tyr Ala His Ala
Ser Pro Val Val Arg Arg Leu Ala Arg Glu Phe Gly 325 330 335Val Asn
Leu Ser Lys Val Lys Gly Ser Gly Arg Lys Ser Arg Ile Leu 340 345
350Lys Glu Asp Val Gln Asn Tyr Val Lys Glu Ala Leu Lys Arg Leu Glu
355 360 365Ser Gly Ala Ala Ser Ala Ala Ser Gly Lys Gly Asp Gly Ala
Ala Leu 370 375 380Gly Leu Leu Pro Trp Pro Lys Val Asp Phe Ser Lys
Phe Gly Asp Thr385 390 395 400Glu Ile Gln Pro Leu Ser Arg Ile Lys
Lys Ile Ser Gly Ala Asn Leu 405 410 415His Arg Asn Trp Val Met Ile
Pro His Val Thr Gln Trp Asp Asn Ala 420 425 430Asp Ile Thr Glu Leu
Glu Ala Phe Arg Lys Glu Gln Asn Ala Ile Glu 435 440 445Ala Lys Lys
Asp Thr Gly Met Lys Ile Thr Pro Leu Val Phe Ile Met 450 455 460Lys
Ala Ala Ala Lys Ala Leu Glu Ala Phe Pro Ala Phe Asn Ser Ser465 470
475 480Leu Ser Glu Asp Gly Glu Ser Leu Ile Leu Lys Lys Tyr Val Asn
Ile 485 490 495Gly Ile Ala Val Asp Thr Pro Asn Gly Leu Val Val Pro
Val Phe Lys 500 505 510Asp Val Asn Lys Lys Gly
Ile Tyr Glu Leu Ser Glu Glu Leu Ala Val 515 520 525Val Ser Lys Lys
Ala Arg Ala Gly Lys Leu Thr Ala Ser Asp Met Gln 530 535 540Gly Gly
Cys Phe Thr Ile Ser Ser Leu Gly Gly Ile Gly Gly Thr Ala545 550 555
560Phe Thr Pro Ile Val Asn Ala Pro Glu Val Gly Ile Leu Gly Val Ser
565 570 575Lys Ser Glu Met Lys Pro Val Trp Asn Gly Lys Glu Phe Ala
Pro Arg 580 585 590Leu Gln Leu Pro Leu Ser Leu Ser Tyr Asp His Arg
Val Ile Asp Gly 595 600 605Ala Glu Gly Ala Arg Phe Ile Thr Tyr Leu
Asn Gly Cys Leu Ser Asp 610 615 620Ile Arg Arg Leu Val Leu625
63024316PRTVibrio furnisii 24Met Tyr Ser Lys Ile Leu Gly Thr Gly
Ser Tyr Leu Pro Ser Gln Val1 5 10 15Arg Thr Asn Ala Asp Leu Glu Lys
Met Val Asp Thr Ser Asp Glu Trp 20 25 30Ile Val Thr Arg Thr Gly Ile
Arg Glu Arg Arg Ile Ala Ala Asp Asn 35 40 45Glu Thr Val Ala Asp Met
Gly Phe Tyr Ala Ala Gln Asn Ala Ile Glu 50 55 60Met Ala Gly Ile Asp
Lys Asn Asp Ile Asp Leu Ile Ile Leu Ala Thr65 70 75 80Thr Ser Ser
Ser His Thr Phe Pro Ser Ser Ala Cys Gln Val Gln Ala 85 90 95Lys Leu
Gly Ile Lys Gly Cys Pro Ala Phe Asp Leu Ala Ala Ala Cys 100 105
110Ser Gly Phe Ile Tyr Gly Leu Ser Val Ala Asp Gln His Ile Lys Ser
115 120 125Gly Met Cys Lys Asn Val Leu Val Ile Gly Ala Asp Ala Leu
Ser Lys 130 135 140Thr Cys Asp Pro Thr Asp Arg Ser Thr Ile Ile Leu
Phe Gly Asp Gly145 150 155 160Ala Gly Ala Val Val Val Gly Ala Ser
Glu Glu Pro Gly Ile Leu Ser 165 170 175Thr His Val Tyr Ala Asp Gly
Gln Phe Gly Asp Leu Leu Ser Leu Glu 180 185 190Val Pro Glu Arg Gly
Gly Asp Val Asp Lys Trp Leu Tyr Met Ala Gly 195 200 205Asn Glu Val
Phe Lys Val Ala Val Thr Gln Leu Ser Lys Leu Val Lys 210 215 220Asp
Thr Leu Ala Ala Asn Asn Met His Lys Ser Glu Leu Asp Trp Leu225 230
235 240Val Pro His Gln Ala Asn Tyr Arg Ile Ile Ser Ala Thr Ala Lys
Lys 245 250 255Leu Ser Met Ser Leu Asp Gln Val Val Ile Thr Leu Asp
Arg His Gly 260 265 270Asn Thr Ser Ala Ala Thr Val Pro Thr Ala Leu
Asp Glu Ala Val Arg 275 280 285Asp Gly Arg Ile Lys Arg Gly Gln Thr
Leu Leu Leu Glu Ala Phe Gly 290 295 300Gly Gly Phe Thr Trp Gly Ser
Ala Leu Val Lys Phe305 310 31525307PRTVibrio furnisii 25Met Ser Lys
Phe Ala Ile Val Phe Pro Gly Gln Gly Ser Gln Ala Val1 5 10 15Gly Met
Leu Ala Glu Leu Gly Glu Gln Tyr Asp Val Val Lys Gln Thr 20 25 30Phe
Ala Glu Ala Ser Asp Ala Leu Gly Tyr Asp Leu Trp Ala Leu Val 35 40
45Gln Asn Gly Pro Val Glu Asp Leu Asn Gln Thr Phe Arg Thr Gln Pro
50 55 60Ala Leu Leu Ala Ser Ser Val Ala Ile Trp Arg Val Trp Gln Ala
Leu65 70 75 80Gly Leu Glu Gln Pro Glu Val Leu Ala Gly His Ser Leu
Gly Glu Tyr 85 90 95Ser Ala Leu Val Cys Ala Gly Val Ile Asp Phe Lys
Ala Ala Ile Lys 100 105 110Leu Val Glu Leu Arg Gly Gln Leu Met Gln
Glu Ala Val Pro Ala Gly 115 120 125Thr Gly Ala Met Tyr Ala Ile Ile
Gly Leu Asp Asp Ala Ala Ile Ala 130 135 140Lys Ala Cys Glu Asp Ala
Ala Gln Gly Asp Val Val Ser Pro Val Asn145 150 155 160Phe Asn Ser
Pro Gly Gln Val Val Ile Ala Gly Gln Lys Asp Ala Val 165 170 175Glu
Arg Ala Gly Ala Leu Cys Lys Glu Ala Gly Ala Lys Arg Ala Leu 180 185
190Pro Leu Pro Val Ser Val Pro Ser His Cys Ala Leu Met Lys Pro Ala
195 200 205Ala Glu Lys Leu Ala Val Ala Leu Glu Ala Leu Glu Phe Asn
Ala Pro 210 215 220Gln Ile Pro Val Ile Asn Asn Val Asp Val Ala Thr
Glu Thr Asp Pro225 230 235 240Ala Lys Ile Lys Asp Ala Leu Val Arg
Gln Leu His Ser Pro Val Arg 245 250 255Trp Thr Glu Gly Val Glu Lys
Met Ala Ala Gln Gly Ile Glu Lys Leu 260 265 270Ile Glu Val Gly Pro
Gly Lys Val Leu Thr Gly Leu Thr Lys Arg Ile 275 280 285Val Lys Thr
Leu Asp Ala Ala Ala Val Asn Asp Ile Ala Ser Leu Glu 290 295 300Ala
Val Lys30526248PRTVibrio furnisii 26Met Ser Asn Phe Met Asn Leu Glu
Gly Lys Ile Val Leu Val Thr Gly1 5 10 15Ala Ser Arg Gly Ile Gly Lys
Ala Ile Ala Glu Leu Leu Val Glu Arg 20 25 30Gly Ala Thr Val Ile Gly
Thr Ala Thr Ser Glu Ser Gly Ala Asp Ala 35 40 45Ile Ser Ala Tyr Leu
Gly Asp Asn Gly Lys Gly Leu Ala Leu Asn Val 50 55 60Thr Asp Val Ala
Ser Ile Glu Ser Val Leu Lys Ser Ile Asn Asp Glu65 70 75 80Phe Gly
Gly Val Asp Ile Leu Val Asn Asn Ala Gly Ile Thr Arg Asp 85 90 95Asn
Leu Leu Met Arg Met Lys Asp Asp Glu Trp Thr Asp Ile Leu Asp 100 105
110Thr Asn Leu Thr Ser Ile Phe Arg Leu Ser Lys Ala Val Leu Arg Gly
115 120 125Met Met Lys Lys Arg Gln Gly Arg Ile Ile Asn Val Gly Ser
Val Val 130 135 140Gly Thr Met Gly Asn Ala Gly Gln Thr Asn Tyr Ala
Ala Ala Lys Ala145 150 155 160Gly Val Ile Gly Phe Thr Lys Ser Met
Ala Arg Glu Val Ala Ser Arg 165 170 175Gly Val Thr Val Asn Thr Val
Ala Pro Gly Phe Ile Glu Thr Asp Met 180 185 190Thr Lys Ala Leu Asn
Asp Asp Gln Arg Ala Ala Thr Leu Ala Gln Val 195 200 205Pro Ala Gly
Arg Leu Gly Asp Pro Arg Glu Ile Ala Ser Ala Val Ala 210 215 220Phe
Leu Ala Ser Pro Glu Ala Ala Tyr Ile Thr Gly Glu Thr Leu His225 230
235 240Val Asn Gly Gly Met Tyr Met Val 2452777PRTVibrio furnisii
27Met Ser Asn Ile Glu Glu Arg Val Lys Lys Ile Ile Val Glu Gln Leu1
5 10 15Gly Val Asp Glu Ala Glu Val Lys Asn Glu Ala Ser Phe Val Glu
Asp 20 25 30Leu Gly Ala Asp Ser Leu Asp Thr Val Glu Leu Val Met Ala
Leu Glu 35 40 45Glu Glu Phe Asp Thr Glu Ile Pro Asp Glu Glu Ala Glu
Lys Ile Thr 50 55 60Thr Val Gln Ala Ala Ile Asp Tyr Val Asn Ser Ala
Gln65 70 7528416PRTVibrio furnisii 28Met Ile Val Ser Lys Arg Arg
Val Val Val Thr Gly Met Gly Met Leu1 5 10 15Ser Pro Val Gly Asn Thr
Val Glu Ser Ser Trp Lys Ala Leu Leu Ala 20 25 30Gly Gln Ser Gly Ile
Val Asn Ile Glu His Phe Asp Thr Thr Asn Phe 35 40 45Ser Thr Arg Phe
Ala Gly Leu Val Lys Asp Phe Asn Cys Glu Glu Tyr 50 55 60Met Ser Lys
Lys Asp Ala Arg Lys Met Asp Leu Phe Ile Gln Tyr Gly65 70 75 80Ile
Ala Ala Gly Ile Gln Ala Leu Asp Asp Ser Gly Leu Val Ile Thr 85 90
95Glu Glu Asn Ala Pro Arg Val Gly Val Ala Ile Gly Ser Gly Ile Gly
100 105 110Gly Leu Asp Leu Ile Glu Lys Gly His Gln Ala Leu Met Glu
Lys Gly 115 120 125Pro Arg Lys Val Ser Pro Phe Phe Val Pro Ser Thr
Ile Val Asn Met 130 135 140Val Ala Gly Asn Leu Ser Ile Met Arg Gly
Leu Arg Gly Pro Asn Ile145 150 155 160Ala Ile Ser Thr Ala Cys Thr
Thr Gly Leu His Asn Ile Gly His Ala 165 170 175Ala Arg Met Ile Ala
Tyr Gly Asp Ala Glu Ala Met Val Ala Gly Gly 180 185 190Ser Glu Lys
Ala Ser Thr Pro Leu Gly Met Ala Gly Phe Gly Ala Ala 195 200 205Lys
Ala Leu Ser Thr Arg Asn Asp Glu Pro Ala Lys Ala Ser Arg Pro 210 215
220Trp Asp Lys Asp Arg Asp Gly Phe Val Leu Gly Asp Gly Ala Gly
Val225 230 235 240Met Val Leu Glu Gly Tyr Glu His Ala Lys Ala Arg
Gly Ala Lys Ile 245 250 255Tyr Ala Glu Ile Val Gly Phe Gly Met Ser
Gly Asp Ala Tyr His Met 260 265 270Thr Ser Pro Ser Glu Asp Gly Ser
Gly Gly Ala Leu Ala Met Glu Ala 275 280 285Ala Met Arg Asp Ala Ala
Leu Ala Gly Thr Gln Ile Gly Tyr Val Asn 290 295 300Ala His Gly Thr
Ser Thr Pro Ala Gly Asp Val Ala Glu Val Lys Gly305 310 315 320Ile
Lys Arg Ala Leu Gly Glu Asp Gly Ala Lys Gln Val Leu Ile Ser 325 330
335Ser Thr Lys Ser Met Thr Gly His Leu Leu Gly Ala Ala Gly Ser Val
340 345 350Glu Ala Ile Ile Thr Val Met Ser Leu Val Asp Gln Ile Val
Pro Pro 355 360 365Thr Ile Asn Leu Asp Asn Pro Glu Glu Gly Leu Gly
Val Asp Leu Val 370 375 380Pro His Thr Ala Arg Lys Val Glu Gly Met
Glu Tyr Ala Met Cys Asn385 390 395 400Ser Phe Gly Phe Gly Gly Thr
Asn Gly Ser Leu Ile Phe Lys Arg Val 405 410 41529344PRTVibrio
furnisii 29Met Thr Asp Ser His Thr Asn Asn Ala Tyr Gly Lys Ala Ile
Ala Met1 5 10 15Thr Val Ile Gly Ala Gly Ser Tyr Gly Thr Ser Leu Ala
Ile Ser Leu 20 25 30Ala Arg Asn Gly Ala Asn Val Val Leu Trp Gly His
Asp Pro Val His 35 40 45Met Ala Arg Leu Glu Ala Glu Arg Ala Asn His
Glu Phe Leu Pro Asp 50 55 60Ile Asp Phe Pro Pro Ser Leu Ile Ile Glu
Ser Asp Leu Gln Lys Ala65 70 75 80Val Gln Ala Ser Arg Asp Leu Leu
Val Val Val Pro Ser His Val Phe 85 90 95Ala Ile Val Leu Asn Ser Leu
Gln Pro Tyr Leu Arg Glu Asp Thr Arg 100 105 110Ile Cys Trp Ala Thr
Lys Gly Leu Glu Pro Asp Thr Gly Arg Leu Leu 115 120 125Gln Asp Val
Ala His Asp Val Leu Gly Glu Ser His Pro Leu Ala Val 130 135 140Leu
Ser Gly Pro Thr Phe Ala Lys Glu Leu Ala Met Gly Met Pro Thr145 150
155 160Ala Ile Ser Val Ala Ser Pro Asp Ala Gln Phe Val Ala Asp Leu
Gln 165 170 175Glu Lys Ile His Cys Ser Lys Thr Phe Arg Val Tyr Ala
Asn Ser Asp 180 185 190Phe Ile Gly Met Gln Leu Gly Gly Ala Val Lys
Asn Val Ile Ala Ile 195 200 205Gly Ala Gly Met Ser Asp Gly Ile Gly
Phe Gly Ala Asn Ala Arg Thr 210 215 220Ala Leu Ile Thr Arg Gly Leu
Ala Glu Met Thr Arg Leu Gly Ala Ala225 230 235 240Leu Gly Ala Gln
Pro Glu Thr Phe Met Gly Met Ala Gly Leu Gly Asp 245 250 255Leu Val
Leu Thr Cys Thr Asp Asn Gln Ser Arg Asn Arg Arg Phe Gly 260 265
270Leu Ala Leu Gly Gln Gly Lys Asp Val Asp Thr Ala Gln Gln Asp Ile
275 280 285Gly Gln Val Val Glu Gly Tyr Arg Asn Thr Lys Glu Val Trp
Leu Leu 290 295 300Ala Gln Arg Met Gly Val Glu Met Pro Ile Val Glu
Gln Ile Tyr Gln305 310 315 320Val Leu Tyr Gln Gly Lys Asp Ala Arg
Met Ala Ala Gln Asp Leu Leu 325 330 335Ala Arg Asp Lys Lys Ala Glu
Arg 34030284PRTVibrio furnisii 30Val Val Cys Ala Phe Val Asn Asp
Asp Leu Ser Ala Thr Val Leu Glu1 5 10 15Glu Leu Tyr Gln Gly Gly Thr
Arg Leu Ile Ala Met Arg Cys Ala Gly 20 25 30Phe Asp Lys Val Asp Leu
Asp Ala Ala Lys Arg Ile Gly Met Gln Val 35 40 45Val Arg Val Pro Ala
Tyr Ser Pro Glu Ala Val Ala Glu His Ala Val 50 55 60Gly Leu Met Met
Cys Leu Asn Arg Arg Tyr His Lys Ala Tyr Gln Arg65 70 75 80Thr Arg
Glu Ala Asn Phe Ser Leu Glu Gly Leu Val Gly Phe Asn Phe 85 90 95Tyr
Gly Lys Thr Val Gly Val Ile Gly Ser Gly Lys Ile Gly Ile Ala 100 105
110Ala Met Arg Ile Leu Lys Gly Leu Gly Met Asn Ile Leu Cys Phe Asp
115 120 125Pro Tyr Glu Asn Pro Leu Ala Ile Glu Ile Gly Ala Lys Tyr
Val Gln 130 135 140Leu Pro Glu Leu Tyr Ala Asn Ser Asp Ile Ile Thr
Leu His Cys Pro145 150 155 160Met Thr Lys Glu Asn Tyr His Leu Leu
Asp Glu Gln Ala Phe Ala Gln 165 170 175Met Lys Asp Gly Val Met Ile
Ile Asn Thr Ser Arg Gly Glu Leu Leu 180 185 190Asp Ser Val Ala Ala
Ile Glu Ala Leu Lys Arg Gly Arg Ile Gly Ala 195 200 205Leu Gly Leu
Asp Val Tyr Asp Asn Glu Lys Asp Leu Phe Phe Gln Asp 210 215 220Lys
Ser Asn Asp Val Ile Val Asp Asp Val Phe Arg Arg Leu Ser Ala225 230
235 240Cys His Asn Val Leu Phe Thr Gly His Gln Ala Phe Leu Thr Glu
Asp 245 250 255Ala Leu His Asn Ile Ala Gln Thr Thr Leu Asn Asn Val
Leu Ala Phe 260 265 270Glu Gln Gly Thr Lys Ser Gly Asn Glu Leu Val
Asn 275 280
* * * * *