U.S. patent application number 13/372576 was filed with the patent office on 2012-06-07 for compositions and methods for free-solution conjugate nucleic acid analysis.
This patent application is currently assigned to NORTHWESTERN UNIVERSITY. Invention is credited to Annelise E. Barron, Robert J. Meagher, Wyatt N. Vreeland.
Application Number | 20120141997 13/372576 |
Document ID | / |
Family ID | 39763104 |
Filed Date | 2012-06-07 |
United States Patent
Application |
20120141997 |
Kind Code |
A1 |
Meagher; Robert J. ; et
al. |
June 7, 2012 |
Compositions And Methods For Free-Solution Conjugate Nucleic Acid
Analysis
Abstract
The present invention provides compositions and methods for
performing free-solution conjugate analysis of nucleic acid
molecules. For example, the present invention provides multiplexed
single-base extension assays for genotyping. In particular, the
present invention provides a series of disperse polyamide "drag
tags" for use in achieving high-resolution separation of nucleic
acid reaction products.
Inventors: |
Meagher; Robert J.;
(Mountain House, CA) ; Vreeland; Wyatt N.;
(Washington, DC) ; Barron; Annelise E.; (Evanston,
IL) |
Assignee: |
NORTHWESTERN UNIVERSITY
Evanston
IL
|
Family ID: |
39763104 |
Appl. No.: |
13/372576 |
Filed: |
February 14, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11960185 |
Dec 19, 2007 |
8114599 |
|
|
13372576 |
|
|
|
|
60875635 |
Dec 19, 2006 |
|
|
|
Current U.S.
Class: |
435/6.11 ;
204/456 |
Current CPC
Class: |
C12Q 1/6827 20130101;
Y10T 436/143333 20150115; C12Q 1/6827 20130101; C12Q 2565/125
20130101; C12Q 2565/627 20130101; C12Q 2533/101 20130101 |
Class at
Publication: |
435/6.11 ;
204/456 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; G01N 33/559 20060101 G01N033/559 |
Goverment Interests
STATEMENT REGARDING FEDERAL FUNDING
[0002] This invention was made with government support under Grant
No. 5R01HG002918 awarded by National Institutes of Health. The
government has certain rights in the invention.
Claims
1. A composition comprising a set of four or more monodisperse
uncharged polyamides conjugated to four or more DNA molecules such
that the electrophoretic mobility of the DNA-polyamide bioconjugate
is modified compared to an unconjugated DNA molecule.
2. The composition of claim 2, wherein said bioconjugate comprises
an uncharged polyamide conjugated to one end of said DNA
molecule.
3. The composition of claim 1, wherein said bioconjugate comprises
uncharged polyamides conjugated to both ends of said DNA
molecule.
4. A method for detection of single nucleotide polymorphisms
comprising: a) providing one or more DNA samples to be tested, b)
providing four or more DNA-polyamide bioconjugates specific to one
or more single nucleotide polymorphisms, c) contacting said DNA
sample with said DNA-polyamide bioconjugates, d) performing a
single nucleotide polymorphism assay under conditions such that a
single nucleotide polymorphism in said DNA sample is detected if
present, e) applying the assayed sample to a free solution
electrophoretic instrument, and f) detecting the presence or
absence of a single nucleotide polymorphism in said DNA sample.
5. The method of claim 4, further comprising the determination of a
disease state in said subject DNA sample based on the detection of
the presence of a single nucleotide polymorphism.
6. The method of claim 4, further comprising the diagnosis of a
disease state in said subject based on the detection of the
presence of a disease state single nucleotide polymorphism in said
subject DNA sample.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a continuation of allowed U.S.
patent application Ser. No. 11/960,185, filed Dec. 19, 2007, which
claims priority to U.S. Provisional Application 60/875,635 filed
Dec. 19, 2006, each of which is herein incorporated by
reference.
FIELD OF THE INVENTION
[0003] The present invention provides compositions and methods for
performing free-solution conjugate analysis of nucleic acid
molecules. For example, the present invention provides multiplexed
single-base extension assays for genotyping. In particular, the
present invention provides a series of disperse polyamide "drag
tags" for use in achieving high-resolution separation of nucleic
acid reaction products.
BACKGROUND OF THE INVENTION
[0004] Although the sequencing of the first human genome was
completed amidst much fanfare in 2003, a great need still exists
for studying variability among different individual human genomes
as well as among the genomes of other organisms. More than 90% of
the genetic variability among humans is thought to consist of
single-nucleotide polymorphisms (SNPs), and efforts are ongoing to
map more than 300,000 SNPs..sup.1,2 While many SNPs have no
significant impact on protein expression or cell function, specific
SNPs have been found to predispose individuals to certain diseases,
including sickle cell anemia and Alzheimer's disease..sup.3,4 For
example, mutations in the p53 gene have been implicated in a wide
variety of human cancers, with missense mutations comprising a
large majority of deleterious p53 sequence alterations..sup.5-9
Furthermore, sequence polymorphisms in a variety of interacting
genes are suspected to be responsible for complex diseases such as
cancer, heart disease and psychiatric disorders; the results of
multiplexed, multigene SNP analyses in large populations are
expected to enable valuable insights into such
conditions..sup.1,10
[0005] A wide variety of techniques has been proposed for SNP
detection, and many of these methods have recently been
reviewed..sup.11,12 Most methods begin with PCR amplification of
the gene region to be tested, typically followed by an enzymatic
allele discrimination reaction, and then the detection and
identification of the reaction products. Biomolecule detection
schemes based on fluorescence or fluorescence resonance energy
transfer, mass spectrometry, or microarrays can allow accurate
identification of allele-specific products. Each method has its
advantages and disadvantages with respect to simplicity,
sensitivity, ease of multiplexing, throughput, and cost; the choice
of SNP genotyping method varies depending on the specific needs and
resources of each laboratory.
[0006] One widely used technique for allele discrimination based on
the synthesis activity of DNA polymerase is the single-base
extension (SBE) assay, also known as mini-sequencing or
primer-guided nucleotide incorporation..sup.13-15 In this
technique, an oligonucleotide primer is hybridized with its 3' end
immediately upstream of the locus to be genotyped. The SBE reaction
is analogous to Sanger cycle sequencing,.sup.16 except that only
chain terminators (ddNTPs) are included in the reaction. The DNA
polymerase incorporates the ddNTP complementary to the target base
on the template, and further extension of the DNA chain does not
occur. A variety of different detection schemes can be used to
determine the identity of the ddNTP that was incorporated and the
genotype of the target allele. SBE followed by MALDI-TOF mass
spectrometry,.sup.17,18 solid-phase mediated fluorescence
detection,.sup.19 or electrophoresis with 4-color LIF
detection.sup.20 are all capable of multiplexed allele
discrimination and detection.
[0007] Electrophoretic separation is an attractive method for
separating SBE reaction products because capillary array
electrophoresis (CAE) instruments are widely available; however, it
tends to be a relatively costly approach to SNP detection,.sup.12
in part because CAE instruments are expensive to purchase and
maintain. Increased throughput, either by higher order multiplexing
(more SNPs per capillary) or shorter analysis time, is required to
make electrophoretic separation competitive for SNP detection. Both
of these goals can be achieved by using free-solution conjugate
electrophoresis (FSCE) in place of conventional electrophoresis
with a gel or polymer sieving matrix. FSCE, which is sometimes
called end-labeled free-solution electrophoresis (ELFSE),.sup.21-24
is also expected to simplify the transition to microfluidic
electrophoresis devices, which promise to be both faster and much
less expensive than the bulky, complex CAE instruments, and to
greatly expand the range of potential users of this technology.
[0008] What are needed are new tools and approaches for practicing
FSCE so that its potential as a viable technology to aid in SNP
detection is realized.
SUMMARY OF THE INVENTION
[0009] The present invention provides compositions and methods for
performing free-solution conjugate analysis of nucleic acid
molecules. For example, the present invention provides multiplexed
single-base extension assays for genotyping. In particular, the
present invention provides a series of disperse polyamide "drag
tags" for use in achieving high-resolution separation of nucleic
acid reaction products.
[0010] In one embodiment, the present invention provides
compositions and methods comprising a bioconjugate approach in
performing multiplexed single-base extension (SBE) assays. For
example, the compositions of the present invention are demonstrated
herein to be useful in genotyping a large panel of point mutants in
exons 5-9 of the p53 gene. However, the present invention is not
limited to the point mutation being genotyped, and it is
contemplated that a multitude of genetic mutations can be genotyped
by applying the compositions and methods as described herein.
[0011] The "drag-tag", a synthetic, uncharged, unlabeled polyamide
of precise length, modifies the electrophoretic mobility of the
DNA, allowing for rapid electrophoretic separation, facilitating
peak identification. In one embodiment, a series of monodisperse
polyamide drag-tags was developed using both chemical and
biological synthesis. In some embodiments, the drag-tags find
utility in achieving high-resolution separation of genotyping
reaction products by microchannel electrophoresis without a
polymeric sieving matrix. For example, a highly multiplexed SBE
reaction was performed in which 16 unique drag-tagged primers were
used simultaneously to probe 16 different p53 gene loci, with an
abbreviated thermal cycling protocol of only 9 minutes. The
drag-tagged SBE products were separated by free-solution conjugate
electrophoresis (FSCE) in both capillaries and microfluidic chips
with genotyping accuracy in excess of, for example, 96%. In the
example, the separation required less than 70 seconds in a glass
microfluidic chip, or about 20 minutes in a commercial capillary
array sequencing instrument. Therefore, it is contemplated that
compared to gel electrophoresis, FSCE offers greater freedom in the
design of SBE primers by essentially decoupling the length of the
primer and the electrophoretic mobility of the genotyping products.
In some embodiments, FSCE in combination with the compositions of
the present invention provides the facile implementation of SBE on
integrated microfluidic electrophoresis devices for rapid,
high-throughput genetic mutation detection or SNP scoring.
[0012] The compositions and methods of the present invention are
not limited to use in SNP detection or multiplex genotype analysis.
A wide variety of nucleic acid analysis and characterization
techniques may employs the compositions and methods of the present
invention. Exemplary methods are described herein, although the
present invention is not limited to these examples.
DESCRIPTION OF THE FIGURES
[0013] FIG. 1 is an exemplary schematic representation of a
DNA-drag-tag conjugate. The DNA primer is designed to probe the
template locus of interest by adding one dideoxynucleotide with an
identifying fluorophore and ranges in size from 17 to 23 bases. The
drag-tag, a synthetic, uncharged, unlabeled polyamide of precise
length, modifies the electrophoretic mobility of the DNA, allowing
for rapid electrophoretic separation, facilitating peak
identification.
[0014] FIG. 2 is a four-color electropherogram showing the FSCE
separation of the products of a 16-plex SBE genotyping reaction
with a wild-type p53 template. Separations were performed in free
aqueous solution on an ABI 3100 CE instrument using a capillary
array with an effective length of 36 cm. The buffer was 89 mM Tris,
89 mM TAPS, 2 mM EDTA with 7 M urea. The run temperature was
55.degree. C. Samples were injected electrokinetically at 44 V/cm
for 20 seconds. The field strength for the separation was 312 V/cm,
with a current of 11 .mu.A per capillary. Each peak is labeled with
the corresponding p53 locus and genotype.
[0015] FIG. 3 shows (A) four-color FSCE electropherograms showing
the analysis of 16-plex SBE reactions using PCR amplicons of two
different p53 variants as templates, with the mutated loci
highlighted, including two heterozygotes confirmed by re-sequencing
of the mutant template in (B) and pseudo-gel representation of 22
separate SBE-FSCE analyses of p53 variants (C). The wild-type
sample is the left-most column, with 21 different mutant samples
shown.
[0016] FIG. 4 depicts the separation of a 16plex wild-type p53 SBE
sample by free-solution electrophoresis in a glass microfluidic
chip, with an adsorbed layer of poly-N-hydroxyethylacrylamide used
to coat the interior microchannel's surface to suppress
electroosmotic flow and analyte adsorption. The region between 35
and 38 seconds is magnified in the inset to show the distinct
elution times of the first "A" and "C" peaks.
[0017] FIG. 5 shows a parallel mutation detection of two p53 loci
across seven templates (wild-type and six mutants), with a single
electrophoretic analysis separating the pooled reaction products.
The mutant sample numbers correspond with those in the pseudo-gel
image shown in FIG. 3C.
[0018] FIG. 6 shows the effect of various parameters on the quality
of electrophoretic separation. (A) Theoretical plate height H as a
function of the inverse of electrophoretic velocity u for the 61-
and 103-base sequencing fragments. Electric field strength was
varied between 60 and 310 V/cm; (B) Plate height H as a function of
capillary length. The electric field was varied to give similar
velocities in each length of capillary. Values of H for the 36- and
50-cm capillaries were interpolated from nearby values to match the
velocities observed in the 80-cm capillary. (C) Resolution R, as
defined by Equation (5), calculated for selected pairs of closely
eluting DNA fragments terminated with the same base. Separations
were performed in capillaries with effective lengths of 36, 50, and
80 cm (total lengths of 47, 61, and 91 cm) at an applied potential
of 14.7 kV, with all other conditions as described in FIG. 6. The
dotted line at R=1 indicates the threshold value below which peaks
can be considered well-resolved. (D) Effect of buffer concentration
on the drag parameter .alpha..sub.1. The solid curve is drawn to
guide the eye. Buffer concentration 1.times..ident.(89 mM Tris, 89
mM TAPS, 2 mM EDTA); all buffers include 7M urea and 0.5% v/v POP-5
solution. Separation conditions are as described in FIG. 6, except
the separation voltage was 11.3 kV (240 V/cm).
DETAILED DESCRIPTION OF THE INVENTION
[0019] The following description provides exemplary embodiments of
the present invention. The present invention is not limited to
these exemplary embodiments.
[0020] FSCE is a bioconjugate technique for separating charged
biopolymers by microchannel electrophoresis in the absence of a gel
or sieving matrix. It is contemplated that monodisperse, uncharged
polyamide "drag-tags" are appended to one or both ends of a
collection of polydisperse, negatively charged nucleic acid
molecules (e.g. DNA) to create nucleic acid-polyamide bioconjugates
that have size-dependent free-solution electrophoretic mobilities
(FIG. 1). For a given bioconjugate, the mobility is determined by
both the size of the DNA "engine" (which experiences both an
electrophoretic force and hydrodynamic drag force proportional to
DNA size in an applied electric field), and by the hydrodynamic
friction added by the drag-tag, which is proportional to drag-tag
molar mass..sup.24-28 The approach was demonstrated for the
size-based separation of DNA sequencing fragments up to 110 bases
in length,.sup.23 denatured single-stranded PCR products,.sup.29,30
and double-stranded DNA restriction fragments,.sup.22 as well as
profiling of heparins.sup.31 and charged oligosaccharides..sup.32
The exemplary studies used capillary electrophoresis (CE) in free
solution, i.e., without a gel or sieving matrix of any kind.
[0021] FSCE separation of the products of a 3-fold multiplexed SBE
reaction by free-solution CE were previously demonstrated..sup.33
Using conventional SBE reaction protocols, 3 different
oligonucleotide primers were used to interrogate 3 polymorphic loci
in p53 exon 8. Each primer was conjugated to a monodisperse,
synthetic polyamide drag-tag of unique length, allowing the SBE
products to be separated by free-solution electrophoresis.
Electrophoretic separation was performed in a MegaBACE CAE
instrument; although the peaks were somewhat broad, there was
sufficient resolution to allow accurate genotyping of each locus in
several mutant samples.
[0022] In one embodiment, the compositions and methods of the
present invention provide a SBE-FSCE technique that achieves a
higher degree of multiplexing (e.g., 4 or more, 5 or more, 6, 7, 8,
9, 10, 11, 12, 13, 15, 16, 20, etc.), exemplified herein using 16
different oligonucleotide primers and 16 unique drag-tags to
simultaneously genotype 16-p53 loci. In some embodiments, an
abbreviated thermal cycling protocol cuts down the reaction time,
and DNA--drag-tag peak resolution is greatly improved. For example,
numerous p53 samples with previously characterized point mutations
in exons 5-9 were analyzed and separated by both capillary and
microfluidic chip electrophoresis. It is contemplated that a
further increase in separation is accomplished by the creation of a
wider array of unique drag-tags. By contrast, multiplexed SBE
genotyping by gel electrophoresis requires the solid-phase
synthesis and purification of DNA primers with long non-hybridizing
"tails" to enable good electrophoretic separations in gels,.sup.34
which rapidly becomes difficult as the tail length increases. In
one embodiment, SBE-FSCE offers an added degree of flexibility over
conventional SBE with easily interchangeable primers and drag-tags,
offering many different types of multiplexed assays with a single
set of drag-tags.
[0023] In one embodiment, the present invention provides a
synthetic, uncharged monodisperse polyamide for modifying the
electrophoretic mobility of DNA. In some embodiments, the uncharged
monodisperse polyamide is appended to one end of a DNA molecule. In
some embodiments, the uncharged monodisperse polyamide is appended
to both ends of a DNA molecule. In some embodiments, the
bioconjugates of DNA-polyamides and DNA exhibit size dependent
free-solution electrophoretic mobility. In some embodiments, the
bioconjugates of DNA-polyamides are used in detection of single
nucleotide polymorphisms. In some embodiments, the bioconjugates of
DNA-polyamides are used to detect and diagnose disease states, for
example cancers, cystic fibrosis, muscular dystrophy, Alzheimer's
disease, diabetes, sickle cell anemia. In some embodiments, the
bioconjugates of DNA-polyamides are used to detect a subject with a
genetic predisposition to a disease state. In some embodiments, the
bioconjugates of DNA-polyamides are used to analyze a subject's SNP
profile for drug therapy efficacy and potential design of useful
therapeutics for a particular individual based on the SNP profile
(e.g., personalized medicine).
[0024] In one embodiment, the bioconjugates of DNA-polyamides find
utility in electrophoretic methods such as capillary
electrophoresis using a free-solution matrix instead of a gel
matrix. In some embodiments, the bioconjugates are used in methods
for SNP detection by free solution conjugate electrophoresis. In
some embodiments, the compositions and methods of the present
invention as described herein are used for multiplex SNP
detection.
[0025] The present invention includes kits and compositions for
conducting methods of the invention. For example, kit or
compositions (e.g., reaction mixtures) may include sets of primers
conjugated to a plurality of different drag-tags, reagents for
making such primers, dyes, detection components, polymerase,
buffers, control reagents, or other components useful, necessary,
or sufficient for conducting the methods.
[0026] Compositions and methods of the present invention may also
be used in the context of nucleic acid sequencing reactions. For
example, the present invention provides systems, compositions, and
methods for nucleic acid sequencing in free-solution using protein
polymer drag-tags. As such, the present invention provides
protein-based molecular compositions that find use as drag-tags for
use in sequencing methods and provides systems and methods for
automated sequencing of nucleic acids in free-solution
electrophoresis.
[0027] In particular, the present invention demonstrates for the
first time the separation of sequencing fragments by free-solution
conjugate electrophoresis (FSCE) using a non-natural, genetically
engineered protein polymer drag-tag, with significantly higher
resolution and cleaner results than previously reported for this
sequencing technique. FSCE is an approach for size-based separation
of DNA in the absence of a sieving matrix, which is enabled by the
end-on attachment of a polymeric "drag-tag" that modifies the
charge-to-friction ratio of nucleic acid fragments in a
size-dependent fashion. Progress in FSCE separations has previously
been limited by the lack of suitable large, monodisperse drag-tags,
but this hurdle has been overcome by the present invention. For
example, the present invention provides compositions designed
(e.g., de novo) that are non-natural, unfolded (or "random-coil"),
genetically engineered, amino acid protein polymers useful as an
FSCE drag-tag. The resulting separation is essentially diffusion
limited, without significant adsorption of the drag-tag to
capillary walls. These compositions find use for very rapid
separations without the difficulties associated with sieving
polymers. As such, the compositions, system, and methods of the
present invention permit faster, more efficient, and more
cost-effective routes for high-throughput sequencing and other
nucleic acid analysis techniques that require high resolution
separation of nucleic acid molecules as a function of size.
[0028] Experiments conducted during the development of the present
invention employed the production of long, repetitive polypeptides
or "protein polymers" (J. I. Won, R. J. Meagher, A. E. Barron,
Electrophoresis 26, 2138 (2005)). Using techniques of genetic
engineering, artificial genes are constructed that encode for
polypeptides with simple repetitive sequences (J. I. Won, A. E.
Barron, Macromolecules 35, 8281 (2002)). Work described in J. I.
Won, R. J. Meagher, A. E. Barron, Electrophoresis 26, 2138 (2005)
and J. I. Won, R. J. Meagher, A. E. Barron, Biomacromolecules 5,
618 (March-April, 2004) discusses some initial attempts to create
protein polymer drag-tags for FSCE, which ultimately were not
useful because of sub-optimal choice of the amino acid
sequences.
[0029] Further experiments conducted during the development of the
present invention overcame these initial difficulties and provided
protein polymer drag-tags having the desired properties. For
example, a new protein polymer sequence based on modifications to
the sequences discussed in references cited above was generated.
The new protein polymer sequence contained repeats of the amino
acid sequence (Gly-Ala-Gly-Thr-Gly-Ser-Ala (SEQ ID NO:1)), which
differs from the sequence in Won et al., 2005 in the replacement of
the unstable glutamine by the stable, hydrophilic threonine
residue. A controlled cloning technique (J. I. Won, A. E. Barron,
Macromolecules 35, 8281 (2002)) was used to create multimers of the
artificial gene encoding for this sequence, ultimately expressing a
protein polymer with 18 repeats of the sequence (a total of 127
amino acids). This protein polymer, although small, was tested for
sequencing, with excellent results that surpassed the original
sequencing study performed with streptavidin in 1999 (Ren et al.,
supra). The present invention contemplates the use of these and
related (e.g., larger) protein polymers to permit free-solution
sequencing of nucleic acid fragments having a variety of sizes. The
description provided herein describes parameters of protein polymer
(or mimetics thereof) that find use in the systems and methods of
the present invention.
[0030] In some embodiments, the present invention provides methods
for nucleic acid sequencing, comprising the steps of: providing
nucleic acid fragments generated in a nucleic acid sequencing
reaction from a target nucleic acid to be sequenced (e.g.,
generating nucleic acid fragments in a sequencing reaction);
separating the nucleic acid fragments (e.g., that are conjugated to
drag-tags) in free-solution (e.g., by free-solution microchannel
electrophoresis) containing synthetic polymer drag-tags; and
identifying a sequence of the target nucleic acid by analyzing the
separated nucleic acid fragments. The nucleic acid fragments may be
generated by any sequencing method. In some embodiments, the
fragments are generated in a Sanger sequencing method. In some
embodiments, the fragments are generated in a cycle sequencing
method. In some embodiments, the fragments are contained in a
population of molecules that provide a sequencing ladder, such that
the fragments differ from one another in single-nucleotide
increments. The present invention is not limited by the size of the
fragments generated or analyzed, nor by the specific enzymatic or
chemical reaction utilized to produce the drag-tagged DNA molecules
to be sequenced. In some embodiments, however, the fragments
include at least some that are greater than 120 bases in length
(e.g., at least 150 basedbases, 180 bases, etc.).
[0031] The present invention is not limited by the manner in which
the drag-tags are utilized in the free-solution method to separate
fragments. However, in some embodiments, the drag-tags are
covalently attached to the nucleic acid fragments. While they may
be attached after the initial generation of the fragments, in some
embodiments, the fragments are generated containing the drag-tags
through the use of sequencing primers that are coupled to the
drag-tags. However, the present invention is not limited by the
method by which the drag-tags are conjugated to the DNA primers or
DNA sequencing fragments.
[0032] The methods may be conducted in any setting. However, in
some preferred embodiments, fragments are separated and analyzed in
capillary tubes. This permits the methods to be used in the context
of existing automated sequencing devices wherein the free solution
capillary tubes of the invention are substituted for the gel
containing tubes of the prior systems and devices. The methods may
also be conducted on solid surfaces, such as on cards or chips
containing microchannels. It is contemplated that such cards or
microfluidic chips may, for example, be fabricated from any sort of
glass, plastic, or elastomer material. Any of these systems may
employ the appropriate detectors to collect data and appropriate
software to analyze and report results from the data.
[0033] The present invention is not limited by the nature of the
synthetic protein-based polymer drag-tag. In some embodiments, the
protein polymer drag-tag is configured such that, in use, it is in
an unfolded form. In some embodiments, the drag-tag preparation
used is substantially homogenous (e.g., greater than 90%, 95%, 99%,
or all detectable levels, possess the same chemical structure). In
some embodiments, the drag-tag is selected such that it does not
significantly (e.g., no detectable loss in signal or results)
adsorb to a glass or plastic wall of a reaction vessel (e.g., a
capillary tube). Chemically engineered mimetics of polypeptide
sequences may also be employed. In some embodiments, the protein
polymer comprises a repeating amino acid sequence. For example, a
repeated sequence of 5-10 amino acids used to generate a polymer
containing a desired number of repeats (e.g., 10, 11, 12, 13, 14, .
. . , 18, . . . , 20, . . . 24, . . . , etc.) to generate an
appropriately sized drag-tag. In some embodiments, a plurality
(i.e., 2 or more) of the same or different repeated sequences are
conjugated to a scaffold to generate larger complexes. Any type of
scaffold may be used including, but not limited to, dendrimers or
other organic or inorganic molecules or assemblies that provide
multiple attachment sites for conjugation to the peptide sequences.
In some embodiments, the drag-tag comprises a plurality of the
motif Gly-Ala-Gly-Thr-Gly-Ser-Ala or functional equivalents
thereof.
[0034] The present invention contemplates variations of the
sequence comprising conserved or non-conserved amino acid
substitutions at one or more (e.g., 2, 3, 4, . . . etc.) positions
in each repeat unit or one or more positions in a subset of the
repeat units in the polymer. In some embodiments, at least 60%
(e.g., 65%, 75%, 80%, 90%, 95%, etc.) of the amino acids in the
polymer are not substituted. For example, as used herein Gly
(glycine), Ala (alanine), Ser (serine) and Thr (threonine) are
known as relatively polar or hydrophilic, uncharged amino acids, as
are Asn (asparagine), Trp (tryptophan), and Gln (glutamine). A
plurality of these amino acids, with the greatest number of amino
acids being chosen from among Gly, Ala, Ser, and Thr, can be chosen
to create a protein that is water-soluble and that will tend to
have a predominantly unfolded (random-coil) structure in aqueous
solution. In some embodiments, sparing use can be made of
negatively charged amino acids such as Asp (aspartate), and Glu
(glutamate) to increase water-solubility. Further, Leucine (Leu) is
a relatively hydrophobic amino acid as are Phe (phenylalanine), Ile
(isoleucine), Pro (proline) and Val (valine). It is contemplated
that these amino acids can be used, but more sparingly than the
relatively hydrophilic amino acids defined above. In some
embodiments, certain sulfur-containing amino acids such as Cys
(cysteine) and Met (methionine) can be used in very small amounts
if at all, since they are chemically reactive (Voet and Voet,
Biochemistry, 2.sup.nd Ed., John Wiley & Sons, Inc. pp. 1361).
Additional functionally equivalent properties of amino acids are
described, for example, in Taylor, J. Theor. Biol. 119(2):205-18
(1986) (incorporated herein in its entirety), where a Venn diagram
of the relationship between the 20 amino acids is depicted using
the parameters of size, aliphatic and aromatic properties,
hydrophobicity, charge and polarity. It is contemplated that any of
the amino acids demonstrating similar functional properties are
interchangeable in generating a polymer of the present
invention.
[0035] Motifs may be joined end-to-end or may be separated by
spacers, including additional amino acid sequences.
[0036] The present invention also provides kits for carrying the
methods described herein. For example, for sequencing methods
employing di-deoxy nucleotides, the kit may comprise: a) a
synthetic protein-based polymer drag-tag; and b) one or more
dideoxy nucleotides. The kits may also include any one or more
components useful, necessary, or sufficient for carrying the
various methods, including, but not limited to, a polymerase, a
polymerase dilution buffer, a dithiothreitol-containing solution,
an aqueous buffer containing a divalent cation, positive control
target nucleic acid, control primer, stop solution, and
instructions. In some embodiments, the kit comprises the drag-tag
covalently coupled to a primer.
[0037] The present invention likewise provides various compositions
(e.g., reaction mixtures, devices, etc.) used in the methods. For
example, the present invention provides compositions comprising a
nucleic acid molecule containing a synthetic protein-based polymer
drag-tag and a dideoxy nucleotide. The present invention also
provides a composition comprising a primer conjugated to a
synthetic protein polymer drag-tag.
[0038] The drag-tags of the present invention offer a new class of
molecules that enable application of free-solution conjugate
electrophoresis technologies that were not prior available. The
experimental example and description provide herein describes
desirable characteristics of drag-tags and means for assessing
drag-tag performance and properties. While certain structure of
exemplary drag-tags are provided herein, it should be understood
that other structure having the desired functions and properties
are within the scope of the invention. One or more different
drag-tags (e.g., different sizes) of the invention may be used
alone or together in a variety of nucleic acid analysis methods to
assist in the characterization of nucleic acids.
[0039] The experimental examples, below, demonstrate certain
methods of the invention by employing drag-tags having a repeating
sequence motif of Gly-Ala-Gly-Thr-Gly-Ser-Ala and variations
thereof. In some preferred embodiments, drag tags comprising this
sequence are used. The present invention contemplates variations of
this motif as well. For example, any rearranged sequence of these
amino acids is contemplated for use as a drag-tag. Guidance for
considering the properties of the individual amino acids for
generating alternate protein sequences that find use for FSCE
applications, are discussed above. The biochemical properties of
the 20 common amino acids are well characterized (Voet and Voet,
Biochemistry, 2.sup.nd Ed., John Wiley & Sons, Inc. pp. 1361).
Gly (glycine), Ala (alanine), Ser (serine), Thr (threonine) and Trp
(tryptophan) are considered relatively polar, uncharged amino
acids, which are also relatively chemically stable, and can be
considered to be the most desirable amino acids for use in a
protein-based drag-tag, and should predominate in the sequence
(e.g., greater than 50%, greater than 60%, greater than 70%, 80%,
90%, etc. of the amino acids in the polymer are from this group).
Other polar amino acids, which are somewhat less chemically stable,
are Asn (asparagine) and Gln (glutamine). A plurality of these
amino acids, with the greatest number of amino acids being chosen
from among Gly, Ala, Ser, and Thr, can be chosen to create a
protein that is water-soluble (as needed for FSCE) and contemplated
to have a predominantly unfolded (random-coil) structure in aqueous
solution, which maximizes the drag provided by the protein polymer.
More sparing use of the amino acids Gln and Asn should be made,
since these amino acid side-chains can spontaneously undergo a
biochemical reaction such that they deamidate in aqueous solution
over time, to produce Glu and Asp side chains, which are negatively
charged and will affect the electrophoretic mobility of the
drag-tag, ultimately contributing to heterogeneity. In the protein
sequence design, an initial, sparing use of negatively charged
amino acids such as Asp (aspartate), and Glu (glutamate) can be
made to increase water-solubility; but too many of these negatively
charged amino acids will decrease the effectiveness of the drag-tag
to enable the separation of larger DNA fragments. The positively
charged amino acids, Lysine (Lys) and Arginine (Arg), can also be
used, and may be advantageous as they provide for the drag-tag to
have an intrinsic electrophoretic mobility opposite to that of DNA
molecules, which enhances the resistance to DNA migration in an
electric field. However, too much use of positively charged amino
acids could create non-ideal designs, since cationic drag-tags may
complex strongly with DNA molecules or the fused silica or plastic
capillary walls, which carry negative charge as commonly used.
Therefore, a sparing use of such positively charged amino acids
should be made, if they are used at all. If the amino terminus of
the protein polymer is being used for the conjugation of the
drag-tag to the DNA molecules, it may be desirable not to use the
amino acid Lys, which has a primary amino group very similar to the
amino terminus of the protein. Further, Leucine (Leu) can be
defined as a relatively hydrophobic amino acid as are Phe
(phenylalanine), Ile (isoleucine), Pro (proline) and Val (valine).
These amino acids can be used, but should be employed more
sparingly than the relatively hydrophilic amino acids defined
above. The sulfur-containing amino acids such as Cys (cysteine) and
Met (methionine) should be used in very small amounts if at all,
since they are chemically reactive and hence could contribute to
drag-tag sample heterogeneity. Additional functionally equivalent
properties of amino acids are described, for example, in Taylor, J.
Theor. Biol. 119(2):205-18 (1986) (incorporated herein in its
entirety), where a Venn diagram of the relationship between the 20
amino acids is depicted using the parameters of size, aliphatic and
aromatic properties, hydrophobicity, charge and polarity. It is
contemplated that any of the amino acids demonstrating similar
functional properties are interchangeable in generating a polymer
of the present invention. Moreover, it is contemplated that a
variety of non-natural amino acids or other organic chemical
moieties could be introduced into a protein, using either enzymatic
or organic chemical reaction methods, which also find use for the
preparation of drag-tags for FSCE applications. Such non-natural
amino acids, whether incorporated at the termini or the internal
sequence of the protein, can be used to enhance the properties of
the protein, for example to enhance its water solubility, or to
enable facile conjugation of the drag-tag to DNA molecules.
[0040] Drag tags that find use in the compositions and methods of
the present invention (e.g., sequencing compositions and methods)
may have one or more of the following desired properties: they
should be water-soluble under the conditions in which they are
employed for conjugating DNA to them, as well as (preferably) the
conditions of the DNA sequencing reaction and of the
electrophoretic separation; they should provide a unique chemical
functionality that allows them to be conjugated to DNA molecules,
either end-on or at some other well-defined position in the DNA
molecules, either before or after the sequencing reaction; they
should not be chemically reactive nor tend to undergo spontaneous
and uncontrolled degradation, multimerization, or aggregation under
conditions in which they are commonly used or stored; they should
not have a strong tendency to spontaneously adsorb to the internal
surfaces of the analysis devices, nor to be strongly ionically
attracted to DNA molecules under commonly encountered solution
conditions; they should be amenable to essentially complete
purification, such that a predominantly homogeneous preparation of
the drag-tags may be prepared, and they should remain water-soluble
under so-called "denaturing" conditions, which might include, for
example, high temperatures and/or the use of chaotropic solution
additives including urea, formamide and other small organic
molecules used as denaturants, and a dimethylsulfoxide co-solvent.
In some embodiments, the sequences are chosen such that that they
can be produced in relatively high yields by a genetically
engineered biological organism such as E. coli, at least 10 mg/L of
culturing medium, which may mean that the sequence should not be
too simple, that is, that at least three different amino acids (of
the common twenty amino acids found in nature) should be used. In
some embodiments, the organism used to produce the protein should
be able to produce it in relatively long lengths, preferably
greater than 75 amino acids, and more preferably greater than 125
amino acids in length.
[0041] Compositions and methods of the invention find use in a
variety of nucleic acid analysis methods and may be used as part of
a system with a variety of existing devices, software components,
and other analysis components.
[0042] The present invention also provides kits for carrying the
methods described herein. For example, for sequencing methods
employing di-deoxy nucleotides, the kit may comprise: a) a
synthetic protein-based polymer drag-tag; and b) one or more
dideoxy nucleotides. The kits may also include any one or more
components useful, necessary, or sufficient for carrying the
various methods, including, but not limited to, a polymerase, a
polymerase dilution buffer, dithiothreitol solution, buffer
containing a divalent cation, positive control target nucleic acid,
control primer, stop solution, and instructions. In some
embodiments, the kit comprises the drag-tag covalently coupled to a
primer.
[0043] The present invention likewise provides various compositions
(e.g., reaction mixtures, devices, etc.) used in the methods. For
example, the present invention provides compositions comprising a
nucleic acid molecule containing a synthetic protein-based polymer
drag-tag and a dideoxy nucleotide or a dye-deoxy nucleotide. The
present invention also provides a composition comprising a primer
conjugated to a synthetic protein polymer drag-tag. The present
invention also provides compositions for use in conjunction with
U.S. Pat. No. 6,200,748 (incorporated herein in its entirety),
where primers are labeled for use in sequencing reactions. The
primers of the patent are coupled to either a chromophore or a
fluorophore prior to use in a sequencing reaction, and the
synthetic protein-based polymer drag-tag can additionally be
complexed with such a molecule for improving upon the methods as
described in the patent.
[0044] Compositions and methods of the present invention find
utility with multiple CE nucleic acid analysis platforms, such as
automated sequencing devices and systems. For example, ABI and
Applied Biosystems market a number of fluorescent CE nucleic acid
genetic analyzers such as ABI PRISM.RTM. 310 Genetic Analyzer, ABI
PRISM.RTM. 3100 Genetic Analyzer, ABI.RTM. PRISM 3100-Avant.TM.
Genetic Analyzer, Applied Biosystems 3130/3130xl Genetic Analyzers,
and Applied Biosystems 3730/3730xl Genetic Analyzers. Other
companies also make relevant instruments for capillary or
microfluidic chip electrophoresis, including Agilent Inc. and
Beckman-Coulter Inc. The ABI PRISM.RTM. 310 Genetic Analyzer has
only one capillary tube chosen from two lengths, either 47 or 61
cm, and will accommodate 48 or 96 sample tubes. The ABI PRISM.RTM.
3100 and ABI.RTM. PRISM 3100-Avant.TM. Genetic Analyzers are DNA
analysis systems with 16 or 4 capillary tubes, respectively,
operating in parallel. Capillary tubes for the two systems come in
4 lengths, 22, 36, 50 and 80 cm long, with the run times increasing
from around 20 minutes for the shorter tubes to over three hours
for the 80 cm tubes. The Applied Biosystems 3130/3130xl Genetic
Analyzers have 4 and 16 capillary tubes, respectively, with
capillary length options the same as for the ABI PRISM.RTM. 3100,
and can further accommodate 96 and 384 microtiter sample plates
instead of sample tubes. The Applied Biosystems 3730/3730xl Genetic
Analyzers contain either 48 or 96 capillary tubes, respectively,
and use the same microtiter sample plate configuration as the
3130/3130xl instruments. The instruments as previously discussed
are suitable for use with one or both dye-deoxy terminator dye
systems (e.g., BigDye.RTM. and dRhodamine), however the present
invention can be used with both terminator dye systems. Software
accompanies each instrument for sample analysis and data
interpretation, such as SeqScape.RTM., GeneMapper.RTM., and other
Sequence Analysis software and defined by the instrument used. The
fluorescence based CE systems of ABI and Applied Biosystems can
perform multiple genetic analyses, including multiplex SNP genotype
analysis (SNPlex, SnaPshot.RTM.), linkage mapping, restriction
fragment length (RFLP) analysis, sequencing and Genetic Identity
testing (e.g., DNA fingerprinting).
[0045] The aforementioned instruments marketed by ABI and Applied
Biosystems are described in U.S. Pat. Nos. 6,358,385, 5,821,058,
5,567,292, 5,332,666 and 5,171,534 (and foreign counterparts),
incorporated herein in their entireties. Additional fluorescence
based nucleic acids sequencing systems include, but are not limited
to, CEQ.TM. 8000 Genetic Analysis System (Beckman Coulter) and 4300
DNA Analysis System by LI-COR.
[0046] However, the present invention is not limited to
fluorescence based genetic analysis systems. It is contemplated
that the compositions and methods of the present invention can be
used in all types sequencing systems. For example, it is
contemplated that other fluorimetric and non-fluorimetric nucleic
acid sequencing systems can be used with the present invention,
such as Pyrosequencing.TM. (e.g., real time sequencing by enzymatic
cleavage of fluorescently labeled DNA), and non-fluorimetric Sanger
enzymatic sequencing and Maxim & Gilbert sequencing other
related chemical sequencing methods (Lilian et al., Quart. Rev. of
Biophys. 35:169-200 (2002), incorporated herein in its entirety),
and colorimetric DNA sequencing as described in Beck, Anal.
Biochem. 164:514-20 (1987).
[0047] The following examples are provided in order to demonstrate
and further illustrate certain preferred embodiments and aspects of
the present invention and are not to be construed as limiting the
scope thereof.
EXAMPLES
Example 1
Synthesis of Polypeptoid Drag-Tags
[0048] A series of 14 linear polypeptoid drag-tags ranging in size
from 8 to 60 N-methoxyethylglycine (NMEG) monomers was synthesized
on an ABI 433A automated peptide synthesizer (Applied Biosystems,
Foster City, Calif.) using the submonomer protocol..sup.28,35
Aliquots of resin were removed every 4 cycles of peptoid synthesis
beginning with the 8th cycle. Peptoid chains were capped at the
N-terminus with 3-maleimidopropionic acid using
diisopropylcarbodiimide (DIC) as a coupling reagent..sup.28 The
maleimide-activated polypeptoids were cleaved from the resin with
TFA and purified to near-total monodispersity by C18 reversed-phase
HPLC. The monodispersity was assessed by FSCE by conjugating each
polypeptoid to a fluorescently labeled, thiolated 20-base
oligonucleotide, and analyzing by CE in free solution..sup.28
[0049] The 15th drag-tag was a branched polypeptoid, consisting of
a 30mer poly(NMEG) backbone derivatized with five 8mer oligo(NMEG)
branches, activated at the N-terminus with sulfosuccinimidyl
4-(N-maleimidomethyl)-1-cyclohexane carboxylate
(Sulfo-SMCC)..sup.30 The 16th drag-tag was a linear protein polymer
with the highly repetetive sequence
(GAGTGSA).sub.4-GAGTGRA-(GAGTGSA).sub.7-GAGTGRA-(GAGTGSA).sub.5-- G
(SEQ ID NO:2), with a total length of 127 amino acids. An
artificial gene encoding this protein polymer was constructed by
the controlled cloning method,.sup.29,36,37 and the protein polymer
was expressed in E. coli. Following purification by affinity
chromatography, the protein polymer was activated at the N-terminus
with Sulfo-SMCC to yield a maleimide-activated drag-tag.
Example 2
Primers for Single-Base Extension Reactions
[0050] A set of 16 oligonucleotide primers, as shown in Table 1,
was synthesized by Integrated DNA Technologies (Coralville, Iowa,
USA). The primers range in length from 17 to 23 bases and include a
5'-thiol functionality to enable conjugation to maleimide-activated
drag-tags. Each primer has a calculated T.sub.m of 55.degree.
C..+-.1.degree. C. and was designed to avoid stable hairpin
structures or extendable homodimers. The forward (+) and reverse
(-) strands of p53 were both considered for primer design,
especially when probing for mutations at 2 adjacent loci.
TABLE-US-00001 TABLE 1 Drag-tag Migration Wild Exon Locus Strand
Sequence/SEQ ID NO Size order Type 9 328-1 -
AAGACTTAGTACCTGAAGGGTGA (3) 8 1 A 5 128-1 + CCTTCCTCTTCCTACAGTACTCC
(4) 12 2 C 9 330-2 - GGTCCCAAGACTTAGTACCTGA (5) 16 3 A 6 198-1 -
ACT CCA CAC GCA AAT TTC CTT (6) 20 4 C 6 196-2 - ACA CGC AAA TTT
CCT TCC ACT (7) 24 5 C 7 249-3 - GTG ATG ATG GTG AGG ATG GG (8) 28
6 C 6 196-1 + CCC CTC CTC AGC ATC TTA TC (9) 32 7 C 7 245-1 + TAA
CAG TTC CTG CAT GGG C (10) 36 8 G 8 273-1 + ACG GAA CAG CTT TGA GGT
G (11) 40 9 C 8 273-2 - CCA GGA CAG GCA CAA ACA (12) 44 10 C 5
173-1 + CAG CAC ATG ACG GAG GTT (13) 48 11 G 6 221-3 + TGT GGT GGT
GCC CTA TGA (14) 52 12 G 5 149-1 + GTG CAG CTG TGG GTT GAT (15) 56
13 T 5 175-2 + GAC GGA GGT TGT GAG GC (16) 60 14 G 5 144-1 + CCA
AGA CCT GCC CTG TG (17) 70* 15 C 5 173-2 + AGC ACA TGA CGG AGG TTI
(18) 127** 16 T Table 1 contains the primer designs for multiplexed
SBE-FSCE. The drag-tags are all linear poly-N-methoxyethylglycines
made by solid-phase synthetic methods, except for a branched 70mer
NMEG (*).sup.30 and a linear 127mer genetically engineered protein
polymer (**).
[0051] The 16 drag-tag-primer conjugates were created by reacting
each thiolated primer with a different maleimide-activated
drag-tag. The thiolated primers were reduced prior to conjugation
by incubating 2 nmol of primer with a 20:1 molar excess of TCEP
(Acros Organics, Morris Plains, N.J.) for 90 min at 40.degree. C.
Reduced DNA was conjugated to the drag-tags by mixing 90 pmol of
reduced DNA with 2.5 nmol of drag-tag in a total volume of 10 .mu.L
of pH 7.2 sodium phosphate buffer. The DNA-drag-tag mixture was
left to react at room temperature overnight. The large excess of
drag-tag relative to DNA ensured nearly complete conjugation of
DNA. As shown in Table 1, the DNA primers were conjugated to
drag-tags in reverse order of length; the longest DNA primers were
paired with the shortest drag-tags to ensure an unambiguous
migration order of the conjugates during free-solution
electrophoresis. The 16 drag-tag-primer conjugates were pooled
prior to the multiplexed SBE reactions, with a total primer
concentration of 2 pmol/.mu.L.
Example 3
Template DNA for SBE Reactions and SBE Reactions
[0052] Previously characterized p53 wild-type and mutant samples
were a gift from the National Institute of Standards and
Technology. Exons 5-9 of the p53 gene (including introns) were
present as an insert of approximately 2 kbp in a plasmid cloning
vector. A plasmid containing the wild-type p53 gene was available
in large quantity, and was used directly as a template for SBE
reactions. Plasmid DNA containing variants of p53 exons 5-9 with
point mutations were available in much lower quantities; the entire
2 kbp insert covering exons 5-9 was PCR-amplified prior to the SBE
reaction, a common first step in SNP detection..sup.12 Residual
nucleotides and PCR primers that could interfere with the
subsequent SBE reaction were digested by treating the PCR product
with Shrimp Alkaline Phosphatase (USB, Cleveland, Ohio, USA) and
Exonuclease I (USB) at 37.degree. C. for 1 hour, followed by
deactivation of the enzymes at 75.degree. C. for 15 minutes.
[0053] SBE reactions were carried out using the SNaPshot Multiplex
kit (Applied Biosystems, Foster City, Calif., USA), which includes
a premix of sequencing polymerase, buffer concentrate, and ddNTP
chain terminators labeled with 4 different dichlororhodamine
(dRhodamine) dyes. The SBE reactions were prepared by mixing 2.5
.mu.L of the SNaPshot premix, 0.5 .mu.L of the pooled drag-tag
primer mix (1 pmol total primer), 0.025-0.10 pmol of template DNA,
0.5 .mu.L of 125 mM HCl and water for a total volume to 5 .mu.L.
The SBE reaction was carried out in 5 cycles: 96.degree. C. for 2
sec (denaturation), 51.5.degree. C. for 5 sec (annealing), and
60.degree. C. for 10 sec (extension). The complete thermal cycling
procedure required approximately 9 minutes. Excess dye terminators
and buffer salts were removed using Centri-Sep gel filtration spin
columns (Princeton Separations, Princeton, N.J., USA).
Example 4
Capillary Electrophoresis Separations
[0054] High-throughput separations were performed in free solution
in an Applied Biosystems Prism 3100 capillary array sequencing
instrument, with an array of 16 capillaries (effective length 36
cm, total length 47 cm, inner diameter 50 .mu.m). The separations
were conducted in 1.times.TTE buffer (89 mM Tris, 89 mM TAPS, 2 mM
EDTA) with 7M urea and 1:100 (v/v) aqueous dilution of the POP-6
polymer solution (ABI) as a wall-coating to suppress
electro-osmotic flow and prevent analyte adsorption. Samples were
injected electro-kinetically by applying a potential of 1-2 kV
(22-44 V/cm) for 5-20 seconds. Electrophoresis was performed at
55.degree. C., with a potential of 15 kV (320 V/cm).
Example 5
Microfluidic Chip Separations
[0055] Free-solution electrophoresis was performed in microfluidic
chips, using a custom-built instrument..sup.38 Microfluidic
separations were carried out in straight-channel, borosilicate
glass microfluidic chips fabricated by Micronit (Enschede, The
Netherlands). The microchannels were 50 .mu.m wide and 20 .mu.m
deep with a standard 4-arm, "offset T" design..sup.39 Internal
channel surfaces were coated (to eliminate electroosmotic flow)
with an adsorbed layer of poly-N-hydroxyethylacrylamide by
pretreating the channels with 1M HCl for 10 minutes, and then
flushing with a dilute solution of the polymer for 10
minutes..sup.40,41 The glass found in these microchips (borofloat)
has a significantly different chemical composition than that of
fused-silica capillaries. As a result of this chemical difference,
the POP-6 polymer solution does not sufficiently coat the surface
(from hydrophobic association) to decrease EOF and reduce
non-specific binding. Poly-N-hydroxyethylacrylamide, on the other
hand, binds to the surface by hydrogen bonding between the polymer
and the glass-surface silanol groups..sup.40,41
[0056] Residual template DNA from the SBE reaction was removed by
centrifugal ultrafiltration with a Microcon ultrafiltration device
(Millipore, Bedford, Mass.) to achieve successful sample injection
on the chip. Injection was accomplished by applying a potential
between the sample and waste reservoir in the cross arm to fill the
injection zone. After 30 seconds, the potentials were switched to
separation mode, causing the material in the injection zone to
migrate into the separation channel at a field strength of 530
V/cm. Pullback voltages were applied to prevent sample leakage into
the separation channel. A custom-built temperature controller was
used to maintain a temperature of 55.degree. C. during the
separation.
Results
Genotyping
[0057] The SBE-FSCE compositions and methods as described herein
allows for, for example, the simultaneous genotyping of 16 mutation
"hot-spots" in p53 exons 5-9 using the 16 different primers
described in Table 1, which range in size from 17 to 23 bases. Each
primer was conjugated to a monodisperse polyamide drag-tag of
unique size, chosen from a set of drag-tags that included 14
different lengths of linear poly(N-methoxyethylglycine)
(poly(NMEG)), one branched poly(NMEG) and one genetically
engineered protein polymer. A multiplexed SBE reaction with
fluorescent ddNTPs extends the primer-drag-tag conjugates by one
base, and rapid, high-resolution separation of the bioconjugates by
free-solution microchannel electrophoresis allows unambiguous
determination of the genotypes simply by the observation of the
color of each product peak. As seen in FIG. 2, an exemplary
separation of the wild-type p53 SBE products achieved using a
commercial CE sequencing instrument is shown. The CE separation
gives 16 sharp, well-resolved peaks of different colors, each of
which corresponds to the wild-type genotypes shown in Table 1. The
identity of each peak and the yield of the conjugation reaction by
separate CE analysis of individual drag-tag-primer conjugates were
confirmed.
[0058] In samples with a point mutation at one or more loci, the
corresponding peak(s) change color from those observed for the
wild-type sample. For example, in FIG. 3A, the sixth peak is green
rather than black, indicating a C to A substitution mutation at
locus 249-3. Other templates displayed mixed genotypes at certain
loci, as in FIG. 3B, which illustrates peaks of 2 colors at 2 loci.
This sample heterozygosity was confirmed by direct sequencing.
Notably, these dual genotypes were typically a mixture of wild-type
and the expected mutation, indicating that the original sample cell
lines contain mixed populations of wild-type and mutant cells.
[0059] As an exemplary experiment to demonstrate the utility of the
compositions and methods as described herein, twenty-two different
p53 templates were tested with the resulting electropherograms
presented in a "pseudo-gel" format in FIG. 3C, with blue, black,
red, and green bands of varying intensity corresponding to the peak
heights in the original electropherograms. This representation
allows for the rapid comparison and identification of mutations in
the different templates, although the original electropherograms
(as in FIG. 2, FIGS. 3A and 3B) are also useful for identifying
possible heterozygotes or low-level peaks that do not show up
strongly in the pseudo-gel image.
[0060] Of 16 loci across 22 mutant templates (352 loci total),
SBE-FSCE correctly and reproducibly genotyped 325 loci.
Twenty-seven loci reproducibly gave genotypes that were different
from those that were expected based on direct sequencing that had
been done at NIST, including 10 apparent heterozygotes. When the
original NIST genetic samples were then re-sequenced, 14 of the 27
unexpected genotypes were confirmed to be accurate, including 5 of
the 10 apparent heterozygotes; hence, SBE-FSCE more accurately
identified these heterozygotes than the original direct sequencing
done at NIST. Overall, 339 of the 352 loci were confirmed to be
correctly genotyped, representing an accuracy of 96.3% for
SBE-FSCE. Accuracies in excess of 99% have been reported for other
SBE-based assays,.sup.42 and the molecular biology of the SBE
reaction is seemingly not affected by the drag-tag's presence.
[0061] Possible interaction or complementarity of the different
primers used in a highly multiplexed SBE assay becomes more likely
as the level of multiplexing increases; however, sophisticated
software for multiplexed primer design is currently used to analyze
all possible combinations of primer-dimers for potential stable or
extendable structures..sup.43,44 The issue of primer
complementarity presents a difficulty for multiplexing any
genotyping assay based on primer extension, and is not specific to
the FSCE separation technique as described herein, nor to CE
separation and detection in general.
[0062] In the preceding examples, primers were dictated by the loci
of known mutations in the panel of available cell line samples.
Urea (7M) and elevated temperature during the electrophoretic
analysis to ensure denaturation of any primer-dimers was performed.
It is contemplated that some low-level peaks that did not
correspond specifically to any of the individual drag-tagged
primers (low-intensity bands in FIG. 3C) were still present, but
easily distinguishable from the reaction products. The expected SBE
genotyping peaks were the dominant products observed, indicating
that the primers annealed preferentially with the template, rather
than with each other.
[0063] The final primer listed in Table 1 for locus 173-2 included
the "universal" base inosine (I) at the 3' end to probe for
mutations adjacent to a polymorphic site (locus 173-1), because
chain extension following a 3'-mismatch is inefficient. This
inosine-containing primer gave the expected genotype (T) for locus
173-2, as can be observed by the topmost red band present for most
of the samples depicted in FIG. 3C. However, this strategy was
found to be ineffective in the two templates tested with known
mutations at locus 173-1 (mutants 1 and 20 in FIG. 3C), with a low
efficiency of chain extension and apparently incorrect genotyping
results in both cases.
[0064] The SBE reaction conditions were modified from the
manufacturer's recommended protocol to give optimal performance
with the drag-tag labeled primers. The 51.5.degree. C. annealing
temperature was determined empirically as the annealing temperature
that gave the most even peak heights across all of the loci in the
wild-type sample. Only 5 cycles were used in an attempt to shorten
the thermal cycling reaction; however reactions with as few as 2
cycles gave sufficient signal in our ABI 3100 CE instrument. The
shortened reaction time, along with the addition of a small amount
of HCl to the SBE reaction mixture, also alleviated a side reaction
which is contemplated to be the base-catalyzed ring-opening of the
maleimidopropionic acid linker on the polypeptoid drag-tags..sup.45
Drag-tags prepared using a Sulfo-SMCC linker (including the
branched polypeptoid and the linear protein polymer reported here)
are less prone to this side reaction. If signal strength were a
limiting factor, a more conventional SBE reaction with 20-25 cycles
could be performed using a set of drag-tags prepared with the more
stable Sulfo-SMCC linker.
Microfluidic Chip Separations
[0065] FIG. 4 illustrates the exemplary rapid separation of SBE
reaction products in a microfluidic electrophoresis chip using the
wild-type p53 template. The 16plex SBE-FSCE samples are separated
with high resolution in less than 70 seconds in a glass
microfluidic device with an effective separation length of 8 cm,
approximately 20 times faster than CE. Separations on microfluidic
chips are achieved much faster because of the geometry and design
of the injection scheme. By using isotachophoretic injection on a
chip with a double-T injection geometry,.sup.39 the sample "stacks"
into a very narrow, well-defined zone that is readily separated in
the 8 cm separation channel of the microfluidic chip. The peak
spacing is comparable to that observed with CE, except for the
first two peaks that are more closely spaced. As desired, software
may be employed to optimize data collection and analysis for a
particular system that is employed.
Flexibility of the SBE-FSCE Method
[0066] The polyamide drag-tags and oligonucleotide primers as shown
for the examples and described herein are interchangeable; any
drag-tag can be paired with any primer to allow tailored conjugates
for custom applications. Whereas the specific primer-drag-tag
conjugates described in Table 1 allow for multiplexed mutation
detection of 16 different loci from the same individual, other
tests are possible. For example, many of the mutant samples have
mutations at p53 loci 273-1 and 273-2. The genotypes of these 2
loci could be tracked across several different samples in parallel
by creating a different multiplexed set of primers. To this end,
the primer for locus 273-1 was conjugated to seven different
poly-N-methoxyethylglycine (polyNMEG) drag-tags ranging in size
from 8 to 32 monomers, and the primer for 273-2 was conjugated to
larger drag-tags, 36 to 60 monomers in length. Seven separate SBE
reactions were run in parallel with 7 different templates, each
using a unique pair of the primer-drag-tag conjugates. The
resulting SBE reaction products were then pooled and analyzed by CE
in a single capillary (FIG. 5). Since a unique pair of
primer-drag-tag conjugates was used for each template, each peak in
the electropherogram can be assigned to a specific template and
locus. The wild-type is seen to have the genotype "CC", whereas
mutant 7 has the genotype "TC", and mutant 8 has the genotype "GG".
These results correlate with the results determined by sequencing,
and also with the 16plex genotyping reaction result for each mutant
sample. This combination of drag-tags and primers allows the 273-1
and 273-2 loci from 96 patient samples to be analyzed in 16 minutes
with the 16-capillary ABI 3100, or in approximately 1 minute by
microfluidic chip electrophoresis. Any combination of primers is
easily paired with any combination of drag-tags. By contrast,
conventional CE with polymer matrix-based separation of the SBE
reaction products requires custom synthesis of primers with
different lengths of DNA "tails" for each situation, so that SBE
reaction products (which are very similar in size) are separated by
electrophoresis in a gel..sup.34 A thiolated primer of length 17-24
bases is of comparable cost to a standard primer with a long "tail"
but can be used for multiple different applications using FSCE.
Protein polymer and poly(NMEG) drag-tags are easily synthesized on
a lab-bench scale of tens of milligrams for a modest cost; these
amounts being sufficient to perform thousands of the reactions
described herein. Thus the drag-tags themselves represent only a
small added expense in the SBE-FSCE procedure.
[0067] It is contemplated that the degree of multiplexing possible
with SBE-FSCE depends primarily on the number of unique drag-tags
available, however no fundamental barrier prevents the synthesis of
additional unique drag-tags to allow the use of additional primers.
It is contemplated that the creation of an arbitrarily large number
of unique drag-tags, with the potential for further multiplexing of
the SBE-FSCE technique, is primarily limited by the ability to
design a suitable set of compatible primers. Multiplexed SBE with
simultaneous interrogation of 30 SNPs followed by MALDI-TOF mass
spectrometry analysis (requiring primers of easily distinguished
molecular weight) has been reported,.sup.18 however the molecular
biology of SBE itself (e.g., without utilizing the compositions and
methods of the present invention) is incompatible with further
multiplexing using the FSCE technique.
[0068] In one embodiment, the present invention provides a novel
SBE-FSCE technique useful to simultaneously multiplex genotype
mismatches with rapid electrophoretic analysis in free solution.
For example, as described herein 16 loci on p53 exons 5-9, were
genotyped followed by rapid electrophoretic analysis allowing
separation of each of the genotyping products in free solution with
excellent resolution. As such, high-throughput analysis is
achievable with parallel, commercially available capillary array
sequencing instruments or miniaturized microfluidic chips. In some
embodiments, the method described herein is employed for the
detection of point mutations, and as a high-throughput approach for
SNP detection.
[0069] In one embodiment, the SBE-FSCE compositions and methods as
described herein represent a "modular" genotyping approach,
applicable to any gene, where the same oligonucleotide primer can
be tailored to multiple uses by the facile attachment of different
drag-tags. The molecular biology of SBE allows for a very high
degree of multiplexing, while FSCE requires each genotyping product
to be conjugated to a drag-tag of a unique size and hydrodynamic
drag. In some embodiments, the primer design for use in multiplex
reactions is performed by a computer software program (e.g.,
Oligo.RTM., PrimerDesign, etc.).
[0070] In some embodiments, microfluidic separation of the SBE-FSCE
products is performed in at least 50 seconds, at least 1 minute, in
at least 2 minutes, in at least 3 minutes, in at least 4 minutes,
in at least 7 minutes.
Example 6
Production of Protein Polymer Drag-Tags for Sequencing
Reactions
[0071] A synthetic oligonucleotide encoding for three repeats of
the amino acid sequence (Gly-Ala-Gly-Thr-Gly-Ser-Ala) was purchased
from Oligos Etc (Wilsonville, Oreg.), and multimerized using the
controlled cloning process as previously described (J. I. Won, R.
J. Meagher, A. E. Barron, Electrophoresis 26, 2138 (2005); I. Won,
A. E. Barron, Macromolecules 35, 8281 (2002); J. I. Won, R. J.
Meagher, A. E. Barron, Biomacromolecules 5, 618 (2004)). A multimer
encoding 18 repeats of the amino acid sequence was cloned into a
modified pET-19B plasmid, isolated and expressed as a fusion
protein with an N-terminal polyhistidine tag in E. coli. The fusion
protein was recovered from the bacterial cell lysate by immobilized
metal affinity chromatography (IMAC) using a nickel chelating resin
(Probond, Invitrogen, Carksbad, Calif.). The N-terminal
polyhistidine tag was chemically cleaved using cyanogen bromide in
70% formic acid, and the cleaved protein was purified from residual
uncleaved fusion protein and His-tag with a second IMAC step. The
target protein was obtained, with the molecular weight confirmed by
MALDI-TOF mass spectrometry. DNA sequencing of the gene indicated
that two serine to arginine mutations had occurred, thus the actual
protein polymer sequence used was
(GAGTGSA).sub.4-GAGTGRA-(GAGTGSA).sub.7-GAGTGRA-(GAGTGSA).sub.5G
(SEQ ID NO:22).
Example 7
Conjugation of drag-tag to DNA sequencing primer
[0072] The protein polymer was activated at the N-terminus with
Sulfo-SMCC by adding a 10:1 molar excess of Sulfo-SMCC to 1.2 mg of
the protein in 80 .mu.L of 100 mM sodium phosphate buffer, pH 7.2.
The mixture was vortexed for 1 hour, and excess Sulfo-SMCC was
removed using a Centri-Sep gel filtration column (Princeton
Separations, Adelphia, N.J.). The purified, activated drag-tag was
frozen and lyophilized, then resuspended in pure water at a
concentration of 10 mg/mL.
[0073] A 17 base, thiolated M13 (-40) forward sequencing primer
(5'-X.sub.1GTTTTCCCAGTCACGAC (SEQ ID NO:19), where X.sub.1 is a
5'-C6 thiol linker) was purchased from Integrated DNA Technologies
(Coralville, Iowa). The 5'-thiol group was reduced by incubating 2
nmol of the DNA with a 20:1 molar excess of TCEP at 40.degree. C.
in a total volume of 20 .mu.L of 70 mM sodium phosphate buffer, pH
7.2, for two hours. The reduced oligonucleotide was desalted with a
Centri-Sep column, and immediately mixed with a 100-fold molar
excess of activated drag-tag in 25 mM sodium phosphate buffer, pH
7.2, with a final DNA concentration of 4.2 pmol/.mu.L. The
conjugation reaction was allowed to proceed at room temperature for
4 hours before use. The conjugation yield was estimated at
approximately 84% as determined by performing a single-base
extension reaction with the conjugated primer, separating the
products by free-solution electrophoresis, and measuring the areas
of the peaks for conjugated and unconjugated DNA.
Example 8
Sequencing Reactions and Cleanup
[0074] DNA sequencing reactions were carried out using the SNaPshot
Multiplex single-base extension (SBE) kit (Applied Biosystems,
Foster City, Calif.), with deoxyribonucleotide triphosphates
(dNTPs) added to facilitate Sanger sequencing instead of
single-base extension. Five .mu.L of the SNaPshot premix was mixed
with 8 nmol dNTPs (1.8 nmol dCTP, 1.8 nmol dTTP, 2.2 nmol dGTP, and
2.2 nmol dATP), 4.2 pmol of drag-tag-labeled primer, and 0.16 .mu.g
of M13 mp18 control DNA template (Amersham Biosciences, Piscataway,
N.J.) in a total volume of 10 .mu.L. The reaction was cycled in a
MJ Research Products Thermal Cycler, with 26 cycles of denaturation
at 96.degree. C. for 5 seconds, annealing at 50.degree. C. for 5
seconds, and chain extension at 60.degree. C. for 30 seconds. Upon
completion of thermal cycling, the reaction products were purified
using a Centri-Sep column (Princeton Separations, Adelphia, N.J.)
to remove residual buffer salts, dNTPs, and chain terminators. The
purified product was diluted to a final volume of 20 .mu.L, and
stored at -20.degree. C. until use.
Example 9
Capillary Electrophoresis
[0075] DNA sequencing separations with 4-color LIF detection were
performed using an Applied Biosystems Prism 3100 Genetic Analyzer
with arrays of 16 fused silica capillaries with inner diameters of
50 cm and effective lengths (from inlet to the detector) of 36, 50,
or 80 cm (total lengths of 47, 61, or 91 cm). Separations were
carried out at 55.degree. C. in a denaturing buffer consisting of
1.times.TTE (89 mM Tris, 89 mM TAPS, 2 mM EDTA) with 7 M urea, and
0.5% v/v POP-5 solution (PDMA) added as a dynamic wall coating
agent. The buffer was filtered with a 0.45 .mu.m filter prior to
use. The capillary was flushed with fresh buffer between each run,
and the buffer reservoirs were replenished every 1-3 runs.
[0076] Sequencing samples were denatured prior to analysis by
heating (in water) to 95.degree. C. for 30 seconds, followed by
snap cooling on ice. Samples were introduced into the capillaries
by electrokinetic injection at 1 kV for 20 seconds. Run voltages
ranging from 3 to 15 kV were tested, with emission from the
SNaPshot dRhodamine terminators detected using ABI Dye Set E5.
Results
[0077] In the standard theory of FSCE (C. Desruisseaux, D. Long, G.
Drouin, G. W. Slater, Macromolecules 34, 44 (2001); L. C. McCormick
et al., Journal of Chromatography A 924, 43 (2001); R. J. Meagher
et al., Electrophoresis 26, 331 (2005)), the electrophoretic
mobility of a composite object is determined by a weighted average
of the electrophoretic mobilities of charged DNA and uncharged
drag-tag monomers. Mathematically, this weighted average mobility
for a chain with M.sub.c charged DNA monomers and M.sub.u uncharged
monomers is:
.mu. = .mu. 0 M c M c + .alpha. 1 M u ( 1 ) ##EQU00001##
Wherein .mu..sub.o is the free-solution electrophoretic mobility of
DNA (independent of size), and .alpha..sub.1 is a weighting factor
that rescales the number of uncharged monomers based on differences
in size and persistence length as compared to the DNA monomers.
Uncharged polymer chains are considerably more flexible than ssDNA,
and typical values of .alpha..sub.1 range from 1/5 to 1/6. The
product .alpha..ident..alpha..sub.1M.sub.u has frequently been used
to characterize the overall drag provided by a drag-tag, and can be
calculated from experimental data.
[0078] A controlled cloning technique (J. I. Won, A. E. Barron,
Macromolecules 35, 8281 (2002)) was utilized to create an
artificial gene encoding for a repetitive protein polymer with the
repeating sequence (GAGTGSA).sub.18G (SEQ ID NO:21), with the final
sequence being
(GAGTGSA).sub.4-GAGTGRA-(GAGTGSA).sub.7-GAGTGRA-(GAGTGSA).sub.5-G
(SEQ ID NO:22). DNA sequencing confirmed the sequence of the gene.
This biochemical change to the designed amino acid sequence, with
the addition of two arginine residues, increased the net charge of
the protein polymer by +2 units, which did not strongly affect the
final properties of the drag-tag. Following Sulfo-SMCC activation
of the amino terminus, the original protein polymer sequence would
have yielded a net charge of -1 (from the carboxyl terminus),
whereas the two arginine mutations give the drag-tag a net charge
of +1.
[0079] Although positively charged drag-tags have been contemplated
to exhibit problems with ionic interaction between the drag-tag and
capillary walls or DNA, the very slight positive charge of this
drag-tag did not lead to such problems. The drag-tag experiences an
electrical force in the opposite direction of the DNA, resulting in
a slight "tug" opposing the motion of the DNA, and the net effect
is contemplated to be dramatic (one positively charged residue
provides a similar effect to 5-6 uncharged amino acids). Thus,
drag-tags with a slight positive charge are recommended with
caution as it is contemplated that a critical amount of positive
charge exists above which the ionic interactions between the
drag-tag and capillary, or drag-tag and DNA, decrease the
separation performance.
[0080] The ABI SNaPshot kit, intended for single-base extension
genotyping reactions, was converted to a DNA sequencing kit by the
addition of dNTPs. Addition of different amounts of dNTPs allows
generation of sequencing reads of varying lengths, with a certain
amount of empirical investigation required to determine the
appropriate level for a desired read length. A total concentration
of 800 .mu.M dNTPs in the sequencing reaction generated a ladder of
sequencing products up to about 250 bases long, an appropriate size
range for this small drag-tag. A slightly skewed distribution of
the four dNTPs (220 .mu.M dGTP and dATP, 180 .mu.M dCTP and dTTP)
led to slightly more even peak heights than was obtained using
equal concentrations of each dNTP. A sequencing reaction with a
common sequencing "premix" kit (BigDye v3.1, ABI) was also
performed, however the large size distribution of the sequencing
products was not optimal for the drag-tag.
[0081] The examples show that the sequencing reaction can be
performed with the protein polymer drag-tag attached to the
sequencing primer, and that the presence of the drag-tag does not
interfere with the action of the sequencing polymerase, or disrupt
the stability of the primer-template-enzyme complex. As seen
previously with streptavidin (H. Ren et al., Electrophoresis 20,
2501 (1999)), thermal cycling was performed in the absence of
streptavidin, and the resulting sequencing products were conjugated
to streptavidin afterward because the high temperature of the
sequencing reaction would lead to irreversible denaturation and
aggregation of streptavidin. Whereas conjugation to streptavidin
after the sequencing reaction is dependent upon exactly the right
ratio of streptavidin to DNA, conjugation beforehand allows precise
characterization of the extent of conjugation prior to the
sequencing reaction.
[0082] A typical sequencing electropherogram, obtained in a
capillary with an effective length of 36 cm, at a field strength of
312 V/cm, was demonstrated. The smaller fragments are resolved far
more than necessary for unambiguous identification of each base.
Determination of the sequence is straightforward, up to
M.sub.C.apprxeq.115, although slight mobility shifts introduced by
the different dye terminators cause certain peaks to overlap, or
even elute in the reverse order. Specifically, the G-terminated
fragments elute slightly earlier than expected, causing some
ambiguities. The G-terminated fragments have slightly lower
resolution than fragments terminated with other bases. Beyond about
120 bases, the mobility shifts and unresolved peaks for repeated
bases make identification of the sequence less easy, however since
the M13 mp18 sequence is known a priori, the observed peaks can be
aligned with the known sequence to at least 180 bases with minimal
effort. As has been done with existing commercial automated
sequencing systems, software can also be used to adjust for
discrepancies in certain ranges of the reaction to enhance accurate
base calls. For a truly unknown template, it is contemplated that
more data processing techniques may be used to correct for the
mobility shifts of the different terminators (as is commonly done
for gel-based sequencing) and analyze peak widths to determine if a
single broad peak might represent two or more repeated bases.
[0083] When compared to previous streptavidin sequencing results
(H. Ren et al., Electrophoresis 20, 2501 (1999)), the compositions
and methods of the present invention demonstrate sharper, cleaner
peaks and significantly better resolution with the protein polymer
drag-tag. This is observed by comparing distinctive features such
as the CCCCGGG run at 75-81 bases, or the TAAT peaks at 99-102
bases, both of which display sharper, better-resolved peaks than
the streptavidin sequencing results.
[0084] Following the standard theory of FSCE as described herein, a
rearrangement of Equation (1) indicates that a plot of
(.mu..sub.0/.mu.-1) versus 1/M.sub.c gives a straight line with a
slope equivalent to .alpha.=.alpha..sub.1M.sub.u. Sequencing data
(plotted) in FIG. 6 is linear, with an overall slope of
25.0.+-.0.05. Slight curvature is apparent at either end of the
data set, and is contemplated to result from the influence of end
effects that were ignored in the derivation of Equation (1) (D.
Long, A. V. Dobrynin, M. Rubinstein, A. Ajdari, Journal of Chemical
Physics 108, 1234 (Jan. 15, 1998); L. C. McCormick, G. W. Slater,
Electrophoresis 26, 1659 (2005)). Linear fitting of the fragments
labeled with each terminator separately yields slightly different
.alpha. values for each dye terminator, which are contemplated to
result from differences in hydrodynamic properties or net charge
for each of the dye terminators. These slight differences in a
correlate with the mobility shifts for the different terminators
observed.
[0085] Several factors lead to an observation of band broadening in
FSCE, including the initial injection zone width, analyte-wall
interactions, polydispersity of the drag-tag, and thermal
diffusion. Following the approach of H. Ren et al., Electrophoresis
20, 2501 (1999), the relative magnitudes of the different effects
upon the theoretical plate height H are quantified using an
equation akin to the van Deemter equation of chromatography:
H = A L + 2 D u + Wu + BL ( 2 ) ##EQU00002##
wherein L and u refer to the effective length of the capillary and
the electrophoretic velocity, D is the diffusion coefficient, and
A, W, and B are constants related to the magnitudes of injection
plug width, analyte-wall interactions, and polydispersity of the
drag-tag, respectively. The height of a theoretical plate is
related to peak broadness and for Gaussian peaks the plate height H
is determined from the peak elution time, peak width, and capillary
length. By independently varying either L or u, and calculating H
for a given size of DNA, the relative contributions of the
different effects on band broadening can thus be determined using
Equation (2). Ideally, for a narrow injection zone and a
monodisperse, non-adsorbing drag-tag, the primary contribution to
band-broadening is diffusion.
[0086] In addition to the plate height H, the resolution between
adjacent peaks is considered for determining read lengths. The
resolution factor R is the ratio of peak width at half-maximum to
the spacing between two peaks. The resolution for two peaks for DNA
of size M.sub.1 and M.sub.2 can be defined as:
R = ( w 1 + w 2 ) 2 ( M 2 - M 1 ) ( t 1 - t 2 ) ( 3 )
##EQU00003##
wherein w.sub.1 and w.sub.2 refer to the peak widths, and t.sub.1
and t.sub.2 refer to the peak elution times.
[0087] In practice, peaks for which R.ltoreq.1 are well-resolved,
whereas peaks for which R>1 are run together, makes determining
sequence difficult.
[0088] Using a capillary array with an effective length of 36 cm
(total length of 47 cm), the electrophoretic velocity was varied by
adjusting the applied voltage between 3 kV and 15 kV, the maximum
allowed by the instrument. The electrophoretic velocity u and
theoretical plate height H were tracked for two sizes of DNA,
M.sub.c=61 and 103 (terminated by C and A, respectively). The two
sizes were chosen in part because the same two sizes were tracked
by Ren et al. in their experiments, allowing a direct comparison
between the two studies, and also because these peaks are
relatively isolated from other C- or A-terminated fragments,
allowing easy identification and estimation of peak width. The
electrophoretic velocities u for these two fragments increased
linearly with the electric field strength. No curvature was
apparent in the behavior of velocity with field strength,
indicating that the drag-tag-DNA conjugate behaves as a random coil
object (without segregation of the drag-tag from the DNA) over the
entire range of field strengths.
[0089] Theoretical plate heights H for the two sizes of
DNA-drag-tag conjugates are plotted with respect to the inverse of
velocity (1/u) in FIG. 6A. The plate heights H for both sizes of
DNA are linear with respect to 1/u for all but the lowest
velocities tested, with an intercept approaching zero at high
velocity (i.e. as 1/u approaches zero). According to Equation (2),
this indicates that diffusion is the primary contributor to
band-broadening at these conditions. The measured slope of
1.7.times.10.sup.-4 mm.sup.2/s suggests a diffusion coefficient D
of about 8.5.times.10.sup.-7 cm.sup.2/s for the DNA-drag-tag
conjugates, which correlates well with diffusion coefficients for
DNA fragments of similar size measured during free-solution
electrophoresis by Nkodo et at (A. E. Nkodo et al., Electrophoresis
22, 2424 (2001)).
[0090] Sequencing separations were performed with three different
lengths of capillary arrays, with 36, 50, and 80 cm effective
lengths. Unlike the ABI 310 instrument used by Ren et at (H. Ren et
al., Electrophoresis 20, 2501 (1999)), for which many different
lengths of capillary may be used, the ABI 3100 offers only four
choices: the three as used herein, along with a short, 22 cm array,
at a considerable expense for each array. As with electrophoretic
velocity, plate heights were calculated for the 61- and 103-base,
C- and A-terminated DNA fragments and plotted with respect to
capillary length (at constant electrophoretic velocity u) in FIG.
6B. Some low-level peaks that arise from the heterogeneity of the
drag-tag can be observed in the electropherogram. These do not
interfere with identification of small DNA fragments, but the extra
peaks become compressed for larger fragments resulting in an
uneven, elevated baseline that can make identification of the peaks
difficult.
[0091] According to the standard theory of FSCE, the resolution of
diffusion-limited FSCE separations is independent of capillary
length L, with dependence instead on the total applied potential
(the product EL). This is different from many other electrophoretic
or chromatographic separations, for which resolution increases with
L, typically raised to some fractional power. The resolution R is
plotted as a function of DNA size in FIG. 6C for each length of
capillary at a total applied potential of 14.7 kV. The read-length
is approximated as the point at which R=1, which occurs between
M.sub.c=110 and 120 bases, although more advanced base calling
software is capable of accurately identifying cases where a single
broad peak represents two or more identical bases in a row. The
values of R are similar for both 36- and 50-cm capillaries, and
slightly better for the 80-cm capillary. Although the uncertainty
inherent in measurements of R is large, detailed comparisons of the
electropherograms for the different lengths of capillary tubes
indicate narrower peaks separated by deeper valleys for the 80-cm
capillaries, suggesting that the better resolution for the 80-cm
case is real.
[0092] The friction parameter .alpha., or more fundamentally the
product .alpha..sub.1M.sub.u, is a relative quantity that depends
on the properties of the charged and uncharged monomers.
Specifically, as described in R. J. Meagher et al., Electrophoresis
26, 331 (January, 2005) .alpha..sub.1 depends on the ratio of sizes
of the uncharged and charged monomers and the ratio of Kuhn lengths
(related to chain stiffness) of the uncharged and charged monomers.
Although the monomer sizes are fixed by their chemical structures,
the ratio of Kuhn lengths depends on the solution conditions. It is
contemplated that increasing ionic strength decreases the Kuhn
length of DNA without significantly affecting the drag-tag, thereby
increasing .alpha..sub.1
(C. Desruisseaux, D. Long, G. Drouin, G. W. Slater, Macromolecules
34, 44 (2001)).
[0093] To measure this effect, exemplary sequencing separations
were performed with TTE buffer concentrations varying by a factor
of 4, from 0.5.times. to 2.times.. The resulting electropherograms
were used to calculate the values of .alpha..sub.1 for each buffer
concentration, with results shown in FIG. 6D. As found previously
for streptavidin, the value of .alpha..sub.1 depends on ionic
strength, increasing by 20% over the concentration range
studied.
[0094] Although increasing the ionic strength has an impact on the
friction imposed by the drag-tag, it is not clear that this leads
to increased sequencing performance for high ionic strengths, as no
consistent trend between the buffer ionic strength and the
resolution was seen. It is contemplated that heat generation caused
by high current with high ionic strength buffers degrades
sequencing performance, despite the larger values of .alpha..sub.1.
It is contemplated that the optimum buffer concentration involves a
tradeoff between increased .alpha. (high ionic strength) and
decreased current (low ionic strength), with the requirement of
good buffering capacity imposing a constraint on the minimum buffer
concentration. It is further contemplated that the capillary inner
diameter is also subject to optimization, as heat removal is
optimal in narrower capillaries, allowing for the use of buffers
with higher ionic strength or higher electric fields.
[0095] As such, the first major progress in FSCE sequencing since
the first report of sequencing with streptavidin in 1999 by Ren et
al. (H. Ren et al., Electrophoresis 20, 2501 (1999)) is exemplified
herein. The protein polymer drag-tag compositions as described have
an effective drag similar to streptavidin, with a of about 25,
however compositions of the present invention yield significantly
cleaner results, with sharper peaks. The compositions of the
present invention can therefore be used successfully for DNA
sequencing. For example, the presence of a 127-amino acid long
protein polymer attached to the short (17 base) sequencing primer
does not interfere with the ability of the primer to hybridize to
the template, or with the chain elongation activity of the
sequencing polymerase.
[0096] It is further contemplated that FSCE and the compositions
and methods as described herein are amenable to sequencing on
microfluidic devices, which offer numerous advantages and greater
flexibility than capillary sequencing instruments.
[0097] All publications and patents mentioned in the present
application are herein incorporated by reference. Various
modification and variation of the described methods and
compositions of the invention will be apparent to those skilled in
the art without departing from the scope and spirit of the
invention. Although the invention has been described in connection
with specific preferred embodiments, it should be understood that
the invention as claimed should not be unduly limited to such
specific embodiments. Indeed, various modifications of the
described modes for carrying out the invention that are obvious to
those skilled in the relevant fields are intended to be within the
scope of the following claims.
REFERENCES
[0098] (1) Collins, F. S.; Brooks, L. D.; Chakravarti, A. Genome
Research 1998, 8, 1229-1231. [0099] (2) Brookes, A. J. Gene 1999,
234, 177-186. [0100] (3) Strittmatter, W. J.; Saunders, A. M.;
Schmechel, D.; Pericakvance, M.; Enghild, J.; Salvesen, G. S.;
Roses, A. D. Proceedings of the National Academy of Sciences of the
United States of America 1993, 90, 1977-1981. [0101] (4)
Strittmatter, W. J.; Roses, A. D. Proceedings of the National
Academy of Sciences of the United States of America 1995, 92,
4725-4727. [0102] (5) Greenblatt, M. S.; Bennett, W. P.; Hollstein,
M.; Harris, C. C. Cancer Research 1994, 54, 4855-4878. [0103] (6)
Soussi, T.; Beroud, C. Nature Reviews Cancer 2001, 1, 233-240.
[0104] (7) Soussi, T.; Lozano, G. Biochemical and Biophysical
Research Communications 2005, 331, 834-842. [0105] (8) Birch, J.
M.; Alston, R. D.; McNally, R. J.; Evans, D. G.; Kelsey, A. M.;
Harris, M.; Eden, O. B.; Varley, J. M. Oncogene 2001, 20,
4621-4628. [0106] (9) Olivier, M.; Goldgar, D. E.; Sodha, N.;
Ohgaki, H.; Kleihuesi, P.; Hainaut, P.; Eeles, R. A. Cancer
Research 2003, 63, 6643-6650. [0107] (10) Kirk, B. W.; Feinsod, M.;
Favis, R.; Kliman, R. M.; Barany, F. Nucleic Acids Research 2002,
30, 3295-3311. [0108] (11) Landegren, U.; Nilsson, M.; Kwok, P. Y.
Genome Research 1998, 8, 769-776. [0109] (12) Chen, X.; Sullivan,
P. F. Pharmacogenomics Journal 2003, 3, 77-96. [0110] (13) Syvanen,
A. C.; Aaltosetala, K.; Harju, L.; Kontula, K.; Soderlund, H.
Genomics 1990, 8, 684-692. [0111] (14) Pastinen, T.; Partanen, J.;
Syvanen, A. C. Clinical Chemistry 1996, 42, 1391-1397. [0112] (15)
Pastinen, T.; Kurg, A.; Metspalu, A.; Peltonen, L.; Syvanen, A. C.
Genome Research 1997, 7, 606-614. [0113] (16) Sanger, F.; Nicklen,
S.; Coulson, A. R. Proceedings of the National Academy of Sciences
of the United States of America 1977, 74, 5463-5467. [0114] (17)
Ross, P.; Hall, L.; Smirnov, I.; Haff, L. Nature Biotechnology
1998, 16, 1347-1351. [0115] (18) Kim, S.; Ulz, M. E.; Nguyen, T.;
Li, C. M.; Sato, T.; Tycko, B.; Ju, J. Genomics 2004, 83, 924-931.
[0116] (19) Bell, P. A.; Chaturvedi, S.; Gelfand, C. A.; Huang, C.
Y.; Kochersperger, M.; Kopla, R.; Modica, F.; Pohl, M.; Varde, S.;
Zhao, R. B.; Zhao, X. J.; Boyce-Jacino, M. T. Biotechniques 2002,
32, S70-S77. [0117] (20) Makridakis, N. M.; Reichardt, J. K. V.
Biotechniques 2001, 31, 1374-1380. [0118] (21) Mayer, P.; Slater,
G. W.; Drouin, G. Analytical Chemistry 1994, 66, 1777-1780. [0119]
(22) Heller, C.; Slater, G. W.; Mayer, P.; Dovichi, N.; Pinto, D.;
Viovy, J. L.; Drouin, G. Journal of Chromatography A 1998, 806,
113-121. [0120] (23) Ren, H.; Karger, A. E.; Oaks, F.; Menchen, S.;
Slater, G. W.; Drouin, G. Electrophoresis 1999, 20, 2501-2509.
[0121] (24) Meagher, R. J.; Won, J. I.; McCormick, L. C.; Nedelcu,
S.; Bertrand, M. M.; Bertram, J. L.; Drouin, G.; Barron, A. E.;
Slater, G. W. Electrophoresis 2005, 26, 331-350. [0122] (25)
Grossman, P. D. F.; Menchen, S. M.; Woo, S. L.; Winn-Deen, E. S.:
World, 1993. [0123] (26) Noolandi, J. Electrophoresis 1992, 13,
394-395. [0124] (27) Vreeland, W. N.; Desruisseaux, C.; Karger, A.
E.; Drouin, G.; Slater, G. W.; Barron, A. E. Analytical Chemistry
2001, 73, 1795-1803. [0125] (28) Vreeland, W. N.; Slater, G. W.;
Barron, A. E. Bioconjugate Chemistry 2002, 13, 663-670. [0126] (29)
Won, J. I.; Meagher, R. J.; Barron, A. E. Electrophoresis 2005, 26,
2138-2148. [0127] (30) Haynes, R. D.; Meagher, R. J.; Won, J. I.;
Bogdan, F. M.; Barron, A. E. Bioconjugate Chemistry 2005, 16,
929-938. [0128] (31) Sudor, J.; Novotny, M. V. Analytical Chemistry
1997, 69, 3199-3204. [0129] (32) Sudor, J.; Novotny, M. V.
Analytical Chemistry 1995, 67, 4205-4209. [0130] (33) Vreeland, W.
N.; Meagher, R. J.; Barron, A. E. Analytical Chemistry 2002, 74,
4328-4333. [0131] (34) Sanchez, J. J.; Phillips, C.; Borsting, C.;
Balogh, K.; Bogus, M.; Fondevila, M.; Harrison, C. D.;
Musgrave-Brown, E.; Salas, A.; Syndercombe-Court, D.; Schneider, P.
M.; Carracedo, A.; Morling, N. Electrophoresis 2006, 27, 1713-1724.
[0132] (35) Zuckermann, R. N.; Kerr, J. M.; Kent, S. B. H.; Moos,
W. H. Journal of the American Chemical Society 1992, 114,
10646-10647. [0133] (36) Won, J. I.; Barron, A. E. Macromolecules
2002, 35, 8281-8287. [0134] (37) Won, J. I.; Meagher, R. J.;
Barron, A. E. Biomacromolecules 2004, 5, 618-627. [0135] (38)
Chiesl, T. N.; Shi, W.; Barron, A. E. Analytical Chemistry 2005,
77, 772-779. [0136] (39) Shultz-Lockyear, L. L.; Colyer, C. L.;
Fan, Z. H.; Roy, K. I.; Harrison, D. J. Electrophoresis 1999, 20,
529-538. [0137] (40) Albarghouthi, M. N.; Buchholz, B. A.;
Huiberts, P. J.; Stein, T. M.; Barron, A. E. Electrophoresis 2002,
23, 1429-1440. [0138] (41) Albarghouthi, M. N.; Stein, T. M.;
Barron, A. E. Electrophoresis 2003, 24, 1166-1175. [0139] (42)
Hirschhorn, J. N.; Sklar, P.; Linbland-Toh, K.; Lim, Y.-M.;
Ruiz-Guiterrez, M.; Bolk, S.; Langhorst, B.; Schaffner, S.;
Winchester, E.; Lander, E. S. Proceedings of the National Academy
of Sciences of the United States of America 2000, 97, 12164-12169.
[0140] (43) Rachlin, J.; Ding, C. M.; Cantor, C.; Kasif, S. Nucleic
Acids Research 2005, 33, W544-W547. [0141] (44) Kaderali, L.;
Deshpande, A.; Nolan, J. P.; White, P. S. Nucleic Acids Research
2003, 31, 1796-1802. [0142] (45) Hermanson, G. Bioconjugate
Techniques; Academic Press, Inc: San Diego, Calif., 1996. [0143]
(46) Paegel, B. M.; Blazej, R. G.; Mathies, R. A. Current Opinion
in Biotechnology 2003, 14, 42-50. [0144] (47) Paegel, B. M.; Yeung,
S. H. I.; Mathies, R. A. Analytical Chemistry 2002, 74, 5092-5098.
[0145] (48) Ferrance, J. P.; Wu, Q. R.; Giordano, B.; Hernandez,
C.; Kwok, Y.; Snow, K.; Thibodeau, S.; Landers, J. P. Analytica
Chimica Acta 2003, 500, 223-236.
Sequence CWU 1
1
2217PRTArtificial SequenceSynthetic 1Gly Ala Gly Thr Gly Ser Ala1
5236PRTArtificial SequenceSynthetic 2Gly Ala Gly Thr Gly Ser Ala
Gly Ala Gly Thr Gly Arg Ala Gly Ala1 5 10 15Gly Thr Gly Ser Ala Gly
Ala Gly Thr Gly Arg Ala Gly Ala Gly Thr 20 25 30Gly Ser Ala Gly
35323DNAArtificial SequenceSynthetic 3aagacttagt acctgaaggg tga
23423DNAArtificial SequenceSynthetic 4ccttcctctt cctacagtac tcc
23522DNAArtificial SequenceSynthetic 5ggtcccaaga cttagtacct ga
22621DNAArtificial SequenceSynthetic 6actccacacg caaatttcct t
21721DNAArtificial SequenceSynthetic 7acacgcaaat ttccttccac t
21820DNAArtificial SequenceSynthetic 8gtgatgatgg tgaggatggg
20920DNAArtificial SequenceSynthetic 9cccctcctca gcatcttatc
201019DNAArtificial SequenceSynthetic 10taacagttcc tgcatgggc
191119DNAArtificial SequenceSynthetic 11acggaacagc tttgaggtg
191218DNAArtificial SequenceSynthetic 12ccaggacagg cacaaaca
181318DNAArtificial SequenceSynthetic 13cagcacatga cggaggtt
181418DNAArtificial SequenceSynthetic 14tgtggtggtg ccctatga
181518DNAArtificial SequenceSynthetic 15gtgcagctgt gggttgat
181617DNAArtificial SequenceSynthetic 16gacggaggtt gtgaggc
171717DNAArtificial SequenceSynthetic 17ccaagacctg ccctgtg
171818DNAArtificial SequenceSynthetic 18agcacatgac ggaggttn
181918DNAArtificial SequenceSynthetic 19ngttttccca gtcacgac
182036PRTArtificial SequenceSynthetic 20Gly Ala Gly Thr Gly Ser Ala
Gly Ala Gly Thr Gly Arg Ala Gly Ala1 5 10 15Gly Thr Gly Ser Ala Gly
Ala Gly Thr Gly Arg Ala Gly Ala Gly Thr 20 25 30Gly Ser Ala Gly
3521127PRTArtificial SequenceSynthetic 21Gly Ala Gly Thr Gly Ser
Ala Gly Ala Gly Thr Gly Ser Ala Gly Ala1 5 10 15Gly Thr Gly Ser Ala
Gly Ala Gly Thr Gly Ser Ala Gly Ala Gly Thr 20 25 30Gly Ser Ala Gly
Ala Gly Thr Gly Ser Ala Gly Ala Gly Thr Gly Ser 35 40 45Ala Gly Ala
Gly Thr Gly Ser Ala Gly Ala Gly Thr Gly Ser Ala Gly 50 55 60Ala Gly
Thr Gly Ser Ala Gly Ala Gly Thr Gly Ser Ala Gly Ala Gly65 70 75
80Thr Gly Ser Ala Gly Ala Gly Thr Gly Ser Ala Gly Ala Gly Thr Gly
85 90 95Ser Ala Gly Ala Gly Thr Gly Ser Ala Gly Ala Gly Thr Gly Ser
Ala 100 105 110Gly Ala Gly Thr Gly Ser Ala Gly Ala Gly Thr Gly Ser
Ala Gly 115 120 12522127PRTArtificial SequenceSynthetic 22Gly Ala
Gly Thr Gly Ser Ala Gly Ala Gly Thr Gly Ser Ala Gly Ala1 5 10 15Gly
Thr Gly Ser Ala Gly Ala Gly Thr Gly Ser Ala Gly Ala Gly Thr 20 25
30Gly Arg Ala Gly Ala Gly Thr Gly Ser Ala Gly Ala Gly Thr Gly Ser
35 40 45Ala Gly Ala Gly Thr Gly Ser Ala Gly Ala Gly Thr Gly Ser Ala
Gly 50 55 60Ala Gly Thr Gly Ser Ala Gly Ala Gly Thr Gly Ser Ala Gly
Ala Gly65 70 75 80Thr Gly Ser Ala Gly Ala Gly Thr Gly Arg Ala Gly
Ala Gly Thr Gly 85 90 95Ser Ala Gly Ala Gly Thr Gly Ser Ala Gly Ala
Gly Thr Gly Ser Ala 100 105 110Gly Ala Gly Thr Gly Ser Ala Gly Ala
Gly Thr Gly Ser Ala Gly 115 120 125
* * * * *