U.S. patent application number 13/369429 was filed with the patent office on 2012-06-07 for molecular complexes which modify immune responses.
This patent application is currently assigned to THE JOHNS HOPKINS UNIVERSITY. Invention is credited to Abdel Hamad, Michael S. Lebowitz, Sean O'Herrin, Jonathan Schneck.
Application Number | 20120141482 13/369429 |
Document ID | / |
Family ID | 45724314 |
Filed Date | 2012-06-07 |
United States Patent
Application |
20120141482 |
Kind Code |
A1 |
Schneck; Jonathan ; et
al. |
June 7, 2012 |
MOLECULAR COMPLEXES WHICH MODIFY IMMUNE RESPONSES
Abstract
Extracellular domains of transmembrane heterodimeric proteins,
particularly T cell receptor and major histocompatibility complex
proteins, can be covalently linked to the heavy and light chains of
immunoglobulin molecules to provide soluble multivalent molecular
complexes with high affinity for their cognate ligands. The
molecular complexes can be used, inter alia, to detect and regulate
antigen-specific T cells and as therapeutic agents for treating
disorders involving immune system regulation, such as allergies,
autoimmune diseases, tumors, infections, and transplant
rejection.
Inventors: |
Schneck; Jonathan; (Silver
Spring, MD) ; O'Herrin; Sean; (Baltimore, MD)
; Lebowitz; Michael S.; (Pikesville, MD) ; Hamad;
Abdel; (Ellicott City, MD) |
Assignee: |
THE JOHNS HOPKINS
UNIVERSITY
Baltimore
MD
|
Family ID: |
45724314 |
Appl. No.: |
13/369429 |
Filed: |
February 9, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13156964 |
Jun 9, 2011 |
|
|
|
13369429 |
|
|
|
|
09642660 |
Aug 22, 2000 |
7973137 |
|
|
13156964 |
|
|
|
|
09063276 |
Apr 21, 1998 |
6140113 |
|
|
09642660 |
|
|
|
|
08828712 |
Mar 28, 1997 |
6015884 |
|
|
09063276 |
|
|
|
|
60014367 |
Mar 28, 1996 |
|
|
|
Current U.S.
Class: |
424/134.1 ;
435/375; 435/7.24 |
Current CPC
Class: |
A61K 2039/605 20130101;
A61P 37/06 20180101; A61K 2039/6056 20130101; A61P 37/08 20180101;
C12N 2799/026 20130101; C07K 14/70539 20130101; A61P 31/00
20180101; C07K 2319/30 20130101; C07K 2319/00 20130101; C07K
14/7051 20130101; A61K 39/00 20130101; A61K 38/00 20130101 |
Class at
Publication: |
424/134.1 ;
435/7.24; 435/375 |
International
Class: |
A61K 39/395 20060101
A61K039/395; G01N 21/64 20060101 G01N021/64; G01N 33/566 20060101
G01N033/566; C12N 5/0783 20100101 C12N005/0783; A61P 37/08 20060101
A61P037/08; A61P 31/00 20060101 A61P031/00 |
Claims
1. A method for treating a patient, comprising administering to the
patient a molecular complex, wherein the molecular complex
comprises at least four fusion proteins, wherein: (a) two first
fusion proteins comprise (i) an immunoglobulin heavy chain, wherein
the immunoglobulin heavy chain comprises a variable region, and
(ii) an extracellular domain of a first transmembrane polypeptide;
and (b) two second fusion proteins comprise (i) an immunoglobulin
light chain and (ii) an extracellular domain of a second
transmembrane polypeptide, wherein the fusion proteins associate to
form the molecular complex, wherein the molecular complex comprises
two ligand binding sites, each ligand binding site formed by the
extracellular domains of the first and second transmembrane
polypeptides, wherein each ligand binding site is bound to an
antigenic peptide, wherein the patient is selected from the group
consisting of (1) a patient suffering from an allergy, wherein the
antigenic peptide is an antigen to which the patient has an
allergic response; (2) a patient who has received or will receive
an organ transplant, wherein the antigenic peptide is an
alloantigen; (3) a patient suffering from an autoimmune disease,
wherein the antigenic peptide is an antigen to which the patient
expresses an autoimmune response; and (4) a patient having an
infection caused by an infectious agent, wherein the antigenic
peptide is a peptide of the infectious agent.
2. The method of claim 1, wherein the patient suffers from an
allergy, wherein the antigenic peptide is an antigen to which the
patient has an allergic response.
3. The method of claim 1, wherein the patient has received an organ
transplant, wherein the antigenic peptide is an alloantigen.
4. The method of claim 1, wherein the patient will receive an organ
transplant, wherein the antigenic peptide is an alloantigen.
5. The method of claim 1, wherein the patient suffers from an
autoimmune disease, wherein the antigenic peptide is an antigen to
which the patient expresses an autoimmune response.
6. The method of claim 1, wherein the patient has an infection
caused by an infectious agent and wherein the antigenic peptide is
a peptide of the infectious agent.
7. A method of labeling antigen-specific T cells, comprising:
contacting a sample which comprises antigen-specific T cells with a
molecular complex, wherein the molecular complex comprises at least
four fusion proteins, wherein: (a) two first fusion proteins
comprise (i) an immunoglobulin heavy chain, wherein the
immunoglobulin heavy chain comprises a variable region, and (ii) an
extracellular domain of a first transmembrane polypeptide; and (b)
two second fusion proteins comprise (i) an immunoglobulin light
chain and (ii) an extracellular domain of a second transmembrane
polypeptide, wherein the fusion proteins associate to form the
molecular complex, wherein the molecular complex comprises two
ligand binding sites, each ligand binding site formed by the
extracellular domains of the first and second transmembrane
polypeptides, wherein each ligand binding site is bound to an
identical antigenic peptide, whereby the antigenic peptide
specifically binds to the antigen-specific T cells, thereby
labeling the cells with the molecular complex.
8. The method of claim 7, wherein the sample is contacted in
vitro.
9. The method of claim 7, wherein the sample is contacted in
vivo.
10. A method of activating antigen-specific T cells, comprising:
contacting a sample which comprises antigen-specific T cells with a
molecular complex, wherein the molecular complex comprises at least
four fusion proteins, wherein: (a) two first fusion proteins
comprise (i) an immunoglobulin heavy chain, wherein the
immunoglobulin heavy chain comprises a variable region, and (ii) an
extracellular domain of a first transmembrane polypeptide; and (b)
two second fusion proteins comprise (i) an immunoglobulin light
chain and (ii) an extracellular domain of a second transmembrane
polypeptide, wherein the fusion proteins associate to form the
molecular complex, wherein the molecular complex comprises two
ligand binding sites, each ligand binding site formed by the
extracellular domains of the first and second transmembrane
polypeptides, wherein each ligand binding site is bound to an
antigenic peptide, whereby the antigenic peptide specifically binds
to and activates the antigen-specific T cells.
11. The method of claim 10, wherein the sample is contacted in
vitro.
12. The method of claim 10, wherein the sample is contacted in
vivo.
Description
[0001] This application is a continuation of Ser. No. 13/156,964
filed on Jun. 9, 2011, which is a division of Ser. No. 09/642,660
filed on Aug. 22, 2000, now issued as U.S. Pat. No. 7,973,137,
which is a division of Ser. No. 09/063,276 filed on Apr. 21, 1998
and issued on Oct. 31, 2000 as U.S. Pat. No. 6,140,113, which is a
continuation-in-part of Ser. No. 08/828,712 filed on Mar. 28, 1997
and issued as U.S. Pat. No. 6,015,884 on Jan. 18, 1999, which
claims the benefit of Ser. No. 60/014,367, which was filed Mar. 28,
1996.
[0002] This application incorporates by reference the contents of a
4.47 kb text file created on Feb. 8, 2012 and named
"P03085.sub.--18_sequencelisting.txt," which is the sequence
listing for this application.
BACKGROUND OF THE INVENTION
[0003] Generation of soluble divalent or multivalent molecular
complexes comprising MHC class II or T cell receptors (TCR) is
complicated by the fact that such complexes are formed by
heterodimeric integral membrane proteins. Each of these protein
complexes consists of .alpha. and .beta. integral membrane
polypeptides which bind to each other, forming a functional unit
involved in immune recognition. While both class II MHC and TCR
molecules have stable, disulfide-containing immunoglobulin domains,
obtaining them in properly folded form in the absence of their
respective integral membrane regions has proven to be difficult (6,
12).
[0004] Strategies have been developed to facilitate subunit pairing
and expression of soluble analogs of integral membrane
heterodimeric complexes (for review, see 4). Initially, the
extracellular domains of a TCR (5, 6) or class II MHC (7) were
linked via glycosylphosphatidylinositol (GPI) membrane anchor
sequences, resulting in surface expression of the polypeptide
chains to enhance subunit pairing. Subsequent enzymatic cleavage
resulted in the release of soluble monovalent heterodimers from the
GPI anchors. Another strategy facilitated pairing by covalent
linkage of immunoglobulin light chain constant regions to constant
regions of the TCR .alpha. and .beta. chains (8). Direct pairing of
the .alpha. and .beta. chains of a TCR during synthesis has also
been accomplished by covalent linkage of the variable regions of
the .alpha. and .beta. chains spaced by a 25 amino acid spacer (9)
or by linking the variable region of the a chain to the
extracellular V.beta.C.beta. chain with a 21 amino acid spacer
(10). This strategy, too, results in monomers. In several
constructs, .alpha./.beta. dimerization was facilitated by covalent
linkage of the leucine zipper dimerization motif to the
extracellular domains of the .alpha. and .beta. polypeptides of TCR
or class II MHC (11-13). Pairing of the extracellular domains of
the .alpha. and .beta. chains of class II MHC has also been
achieved after the chains were produced in separate expression
systems (14, 15). However, the utility of these probes is limited
by their intrinsic low affinity for cognate ligands.
[0005] Approaches have also been developed to generate probes for
antigen-specific T cells. The first approach used to develop
specific reagents to detect clonotypic TCRs was the generation of
high affinity anticlonotypic monoclonal antibodies. Anticlonotypic
monoclonal antibodies discriminate on the basis of specific TCR
V.alpha. and V.beta. conformational determinants, which are not
directly related to antigenic specificity. Therefore, an
anticlonotypic antibody will interact with only one of potentially
many antigen-specific different clonotypic T cells that develop
during an immune response.
[0006] The development of reagents which differentiate between
specific peptide/MHC complexes has also been an area of extensive
research. Recently, investigators have used soluble monovalent TCR
to stain cells by crosslinking TCRs with avidin after they have
been bound to a cell (10). Another approach has been to generate
monoclonal antibodies which differentiate between MHC molecules on
the basis of peptides resident in the groove of the MHC peptide
binding site. While theoretically this approach is appealing, such
antibodies have been difficult to generate. Conventional approaches
have produced only a few such antibodies with anti-peptide/MHC
specificity (36-38). It is not clear why this is the case, but the
difficulty may reflect the fact that peptides are generally buried
within the MHC molecule.
[0007] Two new approaches have been developed to obtain
peptide-specific, MHC dependent monoclonal antibodies. One approach
utilizes a recombinant antibody phage display library to generate
antibodies which have both peptide-specificity and MHC restriction
(42). In the second approach, mice are immunized with defined
peptide/MHC complexes, followed by screening of very large numbers
of the resultant monoclonal antibodies (43, 44). However, the need
to screen large numbers of monoclonal antibodies is a disadvantage
of this method.
[0008] Thus, there is a need in the art for soluble, multivalent
molecular complexes with high affinity for antigenic peptides which
can be used, for example, to detect and regulate antigen-specific T
cells and as therapeutic agents for treating disorders involving
immune system regulation.
SUMMARY OF THE INVENTION
[0009] It is an object of the present invention to provide reagents
which specifically and stably bind to and modulate antigen-specific
T cells. These and other objects of the invention are provided by
one or more of the embodiments described below.
[0010] One embodiment of the invention provides a molecular complex
which comprises at least four fusion proteins. Two first fusion
proteins comprise an immunoglobulin heavy chain and an
extracellular domain of a first transmembrane polypeptide. The
immunoglobulin heavy chain comprises a variable region. Two second
fusion proteins comprise an immunoglobulin light chain and an
extracellular domain of a second transmembrane polypeptide. The
fusion proteins associate to form the molecular complex. The
molecular complex comprises two ligand binding sites. Each ligand
binding site is formed by the extracellular domains of the first
and second transmembrane polypeptides. The affinity of the
molecular complex for a cognate ligand is increased at least
two-fold over a dimeric molecular complex consisting of a first and
a second fusion protein.
[0011] Another embodiment of the invention provides a
polynucleotide. The polynucleotide encodes a first and a second
fusion protein. The first fusion protein comprises an
immunoglobulin heavy chain and an extracellular domain of a first
transmembrane polypeptide of a heterodimeric protein. The
immunoglobulin heavy chain comprises a variable region. The
immunoglobulin light chain is C-terminal to the extracellular
domain of the first transmembrane polypeptide. The second fusion
protein comprises an immunoglobulin light chain and an
extracellular domain of a second transmembrane polypeptide of the
heterodimeric protein. The immunoglobulin light chain is C-terminal
to the extracellular portion of the second transmembrane
polypeptide. The extracellular domains of the first and second
transmembrane polypeptides form a ligand binding site.
[0012] Still another embodiment of the invention provides a host
cell comprising at least one expression construct encoding a first
and a second fusion protein. The first fusion protein comprises an
immunoglobulin heavy chain and an extracellular domain of a first
transmembrane polypeptide of a heterodimeric protein. The
immunoglobulin heavy chain comprises a variable region wherein the
immunoglobulin light chain is C-terminal to the extracellular
domain of the first transmembrane polypeptide. The second fusion
protein comprises an immunoglobulin light chain and an
extracellular domain of a second transmembrane polypeptide of the
heterodimeric protein. The immunoglobulin light chain is C-terminal
to the extracellular portion of the second transmembrane
polypeptide. The extracellular domains of the first and second
transmembrane polypeptides form a ligand binding site. The affinity
of the molecular complex for a cognate ligand is increased at least
two-fold over a dimeric molecular complex consisting of a first and
a second fusion protein.
[0013] Yet another embodiment of the invention provides a
composition. The composition comprises a cell in which a molecular
complex is bound to the surface of the cell. The molecular complex
comprises at least four fusion proteins. Two first fusion proteins
comprise an immunoglobulin heavy chain and an extracellular portion
of a first transmembrane polypeptide. The immunoglobulin heavy
chain comprises a variable region. Two second fusion proteins
comprise an immunoglobulin light chain and an extracellular portion
of a second transmembrane polypeptide. The fusion proteins
associate to form a molecular complex. The molecular complex
comprises two ligand binding sites. Each ligand binding site is
formed by the extracellular domains of the first and second
transmembrane polypeptides. The affinity of the molecular complex
for a cognate ligand is increased at least two-fold over a dimeric
molecular complex consisting of a first and a second fusion
protein.
[0014] A further embodiment of the invention provides a method for
treating a patient suffering from an allergy. A molecular complex
is administered to the patient at a dose sufficient to suppress or
reduce a T cell response associated with the allergy. The molecular
complex comprises at least four fusion proteins. Two first fusion
proteins comprise an immunoglobulin heavy chain and an
extracellular domain of a first transmembrane polypeptide. The
immunoglobulin heavy chain comprises a variable region. Two second
fusion proteins comprise an immunoglobulin light chain and an
extracellular domain of a second transmembrane polypeptide. The
fusion proteins associate to form a molecular complex. The
molecular complex comprises two ligand binding sites. Each ligand
binding site is formed by the extracellular domains of the first
and second transmembrane polypeptides. The affinity of the
molecular complex for a cognate ligand is increased at least
two-fold over a dimeric molecular complex consisting of a first and
a second fusion protein. Each ligand binding site is bound to an
antigenic peptide. The antigenic peptide is an antigen to which the
patient has an allergic response.
[0015] Even another embodiment of the invention provides a method
for treating a patient who has received or will receive an organ
transplant. A molecular complex is administered to the patient at a
dose sufficient to suppress or reduce an immune response to the
organ transplant. The molecular complex comprises at least four
fusion proteins. Two first fusion proteins comprise an
immunoglobulin heavy chain and an extracellular domain of a first
transmembrane polypeptide. The immunoglobulin heavy chain comprises
a variable region. Two second fusion proteins comprise an
immunoglobulin light chain and an extracellular domain of a second
transmembrane polypeptide. The fusion proteins associate to form a
molecular complex. The molecular complex comprises two ligand
binding sites. Each ligand binding site is formed by the
extracellular domains of the first and second transmembrane
polypeptides. The affinity of the molecular complex for a cognate
ligand is increased at least two-fold over a dimeric molecular
complex consisting of a first and a second fusion protein. Each
ligand binding site is bound to an antigenic peptide. The antigenic
peptide is an alloantigen.
[0016] Yet another embodiment of the invention provides a method
for treating a patient suffering from an autoimmune disease. A
molecular complex is administered to the patient at a dose
sufficient to suppress or reduce the autoimmune response. The
molecular complex comprises at least four fusion proteins. Two
first fusion proteins comprise an immunoglobulin heavy chain and an
extracellular domain of a first transmembrane polypeptide. The
immunoglobulin heavy chain comprises a variable region. Two second
fusion proteins comprise an immunoglobulin light chain and an
extracellular domain of a second transmembrane polypeptide. The
fusion proteins associate to form a molecular complex. The
molecular complex comprises two ligand binding sites. Each ligand
binding site is formed by the extracellular domains of the first
and second transmembrane polypeptides. The affinity of the
molecular complex for a cognate ligand is increased at least
two-fold over a dimeric molecular complex consisting of a first and
a second fusion protein. Each ligand binding site is bound to an
antigenic peptide. The antigenic peptide is one to which the
patient expresses an autoimmune response.
[0017] Another embodiment of the invention provides a method for
treating a patient having a tumor. A molecular complex is
administered to the patient at a dose sufficient to induce or
enhance an immune response to the tumor. The molecular complex
comprises at least four fusion proteins. Two first fusion proteins
comprise an immunoglobulin heavy chain and an extracellular domain
of a first transmembrane polypeptide. The immunoglobulin heavy
chain comprises a variable region. Two second fusion proteins
comprise an immunoglobulin light chain and an extracellular domain
of a second transmembrane polypeptide. The fusion proteins
associate to form a molecular complex. The molecular complex
comprises two ligand binding sites. Each ligand binding site is
formed by the extracellular domains of the first and second
transmembrane polypeptides. The affinity of the molecular complex
for a cognate ligand is increased at least two-fold over a dimeric
molecular complex consisting of a first and a second fusion
protein. Each ligand binding site is bound to an antigenic peptide.
The antigenic peptide is expressed on the tumor.
[0018] Still another embodiment of the invention provides a method
for treating a patient having an infection caused by an infectious
agent. A molecular complex is administered to the patient at a dose
sufficient to induce or enhance an immune response to the
infection. The molecular complex comprises at least four fusion
proteins. Two first fusion proteins comprise an immunoglobulin
heavy chain and an extracellular domain of a first transmembrane
polypeptide. The immunoglobulin heavy chain comprises a variable
region. Two second fusion proteins comprise an immunoglobulin light
chain and an extracellular domain of a second transmembrane
polypeptide. The fusion proteins associate to form a molecular
complex. The molecular complex comprises two ligand binding sites.
Each ligand binding site is formed by the extracellular domains of
the first and second transmembrane polypeptides. The affinity of
the molecular complex for a cognate ligand is increased at least
two-fold over a dimeric molecular complex consisting of a first and
a second fusion protein. Each ligand binding site is bound to an
antigenic peptide. The antigenic peptide is a peptide of the
infectious agent.
[0019] Another embodiment of the invention provides a method of
labeling antigen-specific T cells. A sample which comprises
antigen-specific T cells is contacted with a molecular complex. The
molecular complex comprises at least four fusion proteins. Two
first fusion proteins comprise an immunoglobulin heavy chain and an
extracellular domain of a first transmembrane polypeptide. The
immunoglobulin heavy chain comprises a variable region. Two second
fusion proteins comprise an immunoglobulin light chain and an
extracellular domain of a second transmembrane polypeptide. The
fusion proteins associate to form the molecular complex. The
molecular complex comprises two ligand binding sites. Each ligand
binding site is formed by the extracellular domains of the first
and second transmembrane polypeptides. The affinity of the
molecular complex for a cognate ligand is increased at least
two-fold over a dimeric molecular complex consisting of a first and
a second fusion protein. Each ligand binding site is bound to an
identical antigenic peptide. The antigenic peptide specifically
binds to the antigen-specific T cells. The cells are labeled with
the molecular complex.
[0020] Yet another embodiment of the invention provides a method of
activating antigen-specific T cells. A sample which comprises
antigen-specific T cells is contacted with a molecular complex. The
molecular complex comprises at least four fusion proteins. Two
first fusion proteins comprise an immunoglobulin heavy chain and an
extracellular domain of a first transmembrane polypeptide. The
immunoglobulin heavy chain comprises a variable region. Two second
fusion proteins comprise an immunoglobulin light chain and an
extracellular domain of a second transmembrane polypeptide. The
fusion proteins associate to form the molecular complex. The
molecular complex comprises two ligand binding sites. Each ligand
binding site is formed by the extracellular domains of the first
and second transmembrane polypeptides. The affinity of the
molecular complex for a cognate ligand is increased at least
two-fold over a dimeric molecular complex consisting of a first and
a second fusion protein. Each ligand binding site is bound to an
identical antigenic peptide. The antigenic peptide specifically
binds to and activates the antigen-specific T cells.
[0021] Even another embodiment of the invention provides a method
of labeling a specific peptide/MHC complex. A sample comprising a
peptide/MHC complex is contacted with a composition comprising a
molecular complex. The molecular complex comprises at least four
fusion proteins. Two first fusion proteins comprise an
immunoglobulin heavy chain and an extracellular domain of a TCR
.alpha. chain. Two second fusion proteins comprise an
immunoglobulin light chain and an extracellular domain of a TCR
.beta. chain. The fusion proteins associate to form a molecular
complex. The molecular complex comprises two ligand binding sites.
Each ligand binding site is formed by the extracellular domains of
the TCR .alpha. and .beta. chains. The affinity of the molecular
complex for a cognate ligand is increased at least two-fold over a
dimeric molecular complex consisting of a first and a second fusion
protein. The ligand binding site specifically binds to and labels
the peptide/MHC complex.
[0022] Thus, the present invention provides a general approach for
producing soluble multivalent versions of heterodimeric proteins,
such as T cell receptors and class II MHC molecules. These
multivalent molecules can be used, inter alia, as diagnostic and
therapeutic agents for treating immune disorders and to study
cell-cell interactions which are driven by multivalent
ligand-receptor interactions.
BRIEF DESCRIPTION OF THE DRAWINGS
[0023] FIG. 1A. A typical configuration of a heterodimeric double
transmembrane protein. FIG. 1B. Heterodimeric transmembrane protein
made divalent and soluble by covalent linkage of outer-membrane
region to antibody. FIG. 1C. Outer-membrane region of MHC class II
covalently linked to an antibody. FIG. 1D. A schematic of the
chimeric protein showing the TCR .alpha. polypeptide (shaded)
linked to IgG1 heavy chain and TCR .beta. polypeptide (shaded)
linked to Ig kappa light chain is shown. The linkers between the
chimeric chains consist of short glycine/serine spacers.
Presumptive binding sites of two monoclonal antibodies (mAb), H57
(TCR specific) and 1B2 (2C TCR specific), on the putative 2C TCR/Ig
structure are also noted.
[0024] FIG. 2. Map of the expression vector, which encodes soluble
divalent heterodimeric proteins. Multi-step construction schematic
is shown to depict fusion of .alpha. and .beta. polypeptide subunit
linked to Ig heavy and light chains to form the chimeric
Immunoglobulin molecules.
[0025] FIG. 3. Schematic of K.sup.b/IgG loading scheme.
[0026] FIG. 4. Schematic of TCR/MHC interactions.
[0027] FIG. 5. Biochemical characterization of TCR, MHC/Ig.
Detection of chimeras in baculovirus supernatants by ELISA assays.
Plates were coated with goat-anti-mouse Fc. For detection of
TCR/Ig, the secondary antibody was either biotinylated H57 (FIG.
5A) or the anti 2C mAb 1B2 (FIG. 5B), followed by streptavidin-HRP.
For detecting I-E/Ig, the secondary antibody was biotinylated
14.4.4 (FIG. 5C).
[0028] FIG. 6. A 10% SDS-PAGE gel of affinity purified samples of
I-E.sup.k/Ig and 2C TCR/Ig chimeric proteins. Purified crude IgG
and supernatant form T. ni cells infected with wild-type
baculovirus are shown for comparison.
[0029] FIG. 7. Graph showing that the affinity of soluble divalent
2C TCR/Ig for peptide/H-2 L.sup.d complexes is higher than that of
soluble monovalent 2C TCR. RMA S-L.sup.d cells were loaded with
peptides (QL9, p2Ca, or pMCMV) and subsequently incubated with a
constant amount of FITC-labeled 30.5.7 Fab and varying
concentrations of either 2C TCR/Ig (solid lines) or soluble
monovalent 2C TCR, sm2C TCR (dashed line). Binding of FITC-30.5.7
Fab was determined by flow cytometry. Results are plotted as the
percent maximal (no 2C TCR Analog) 30.5.7 binding vs. the
concentration of 2C TCR analog. Apparent affinities were determined
from a replot of 1/(% maximal 30.5.7 binding) vs [TCR Analog] see
text and Table II for further discussion. Data shown are from one
representative experiment that has been repeated at least three
times. Each data point is the average of duplicates.
[0030] FIG. 8. Flow cytometry analysis of cells stained with either
purified mAb, 30.5.7 (FIG. 8A-8D), or 2C TCR/Ig culture
supernatants (FIGS. 8E-8H). In each panel the histogram of treated
cells (solid line) is contrasted with that of cells not treated
with any peptide and cultured for one hour at 37.degree. C. (broken
line). Histograms shown are from one representative experiment that
has been repeated at least three times.
[0031] FIG. 9. Comparison of 2C TCR/Ig reactivity vs. mAb 30.5.7
reactivity in peptide-stabilized H-2 L.sup.d molecules. RMA-S
L.sup.d cells were incubated under various conditions. Following
overnight incubation of RMA-S L.sup.d cells at 27.degree. C., cells
were cultured in the presence or absence of various H-2 L.sup.d
binding peptides: no peptide cells maintained at 27.degree. C.;
t.m..sup.-, p2Ca, and QL9 were added to cultures as described in
Materials and Methods, below. FIG. 9A shows peptide-dependent 2C
TCR/Ig reactivity. FIG. 9B shows peptide-dependent 30.5.7
reactivity.
[0032] FIG. 10. Graph demonstrating inhibition of in vitro 2C T
cell mediated lysis by soluble 2C TCR/Ig complexes.
[0033] FIG. 11. Fluorescence data showing that soluble divalent 2C
TCR/Ig interacts with SIY/MHC complexes but not with dEV-8/MHC
complexes. To cells transfected with either H-2 K.sup.b, H-2
K.sup.bm3, or H-2 K.sup.bm11 were incubated overnight at 27.degree.
C. and loaded with peptides dEV-8 (dashed line), SIY (solid line),
or pVSV (dotted line), as described below. Cells were stained with
purified 2C TCR/Ig (.about.50 .mu.g/ml) and GAM-IgG-RPE as
described in Methods, and analyzed by FACS. Resultant histograms
are shown; Panel A, T2-Kb cells; B, T2-K.sup.bm3; C, T2-K.sup.bm11.
In the histograms presented, 2C TCR/Ig reactivity with either dEV-8
(dashed line) or pVSV (dotted line) was virtually identical,
leading to difficulty in discriminating between these two
histograms.
[0034] FIG. 12. 2C CTL mediated lysis on various peptide/MHC
targets. T2 cells transfected with either H-2 L.sup.d (FIG. 12A),
H-2 K.sup.b (FIG. 12B), or H-2 K.sup.bm3 (FIG. 12C), were chromium
labeled as described and then loaded with peptides by incubating at
25.degree. C. for 1.5 hours in the presence of variable amounts of
peptides: p2Ca (.diamond-solid.) and pMCMV (.diamond.) (FIG. 12A);
and dEV-8 (.DELTA.); SIY (.quadrature.); or pVSV (.smallcircle.)
(FIGS. 12B and 12C). Peptide-loaded target cells were then
incubated at an effector to target ratio of 10:1 and specific lysis
calculated as described below. Data shown are representative of
three separate experiments.
[0035] FIG. 13. Fluorescence data showing modulation of endogenous
2C specific peptide/H-2 L.sup.d complexes on the surface of RENCA
cells by .gamma.-IFN. RENCA cells were cultured for 48 hours with 0
(FIGS. 13A and 13E), 5 (FIGS. 13B and 13F), 10 (FIGS. 13C and 13G),
or 50 (FIGS. 13D and 13H) units/ml .gamma.-IFN. As described,
.gamma.-IFN is known to have a direct effect on class I expression,
making it necessary to establish background binding of 2C TCR/Ig to
.gamma.-IFN treated cells. This was accomplished by incubating
RENCA cells with saturating amounts of the H-2 L.sup.d binding
peptide, MCMV, which efficiently displaced the endogenous H-2
L.sup.d bound peptides, including any 2C-reactive peptides. Cells
were harvested, stained with 2C TCR/Ig (75 mg/ml), FIGS. 13A-D, or
the mAb 30.5.7 (45 mg/ml), FIGS. 13E-H, as described below. Cells
were subsequently stained with GAM-IgG-RPE and analyzed by FACS.
Resultant histograms are shown. Solid lines represent histograms of
cultures with no added peptide while dotted lines represent
histograms from cultures incubated with pMCMV. All experiments were
done in duplicate and repeated at least three times. Note the
differences in the extent of fluorescence (see the scales on the
histograms) upon staining with 2C-TCR/Ig vs. staining with
30.5.7.
[0036] FIG. 14. Comparison of the affinity of 2C TCR/IgG to
anti-L.sup.d antibody 30.5.7 and sm2C. RMAS-L.sup.d cells were
incubated >15 hours at 27.degree. C. and subsequently incubated
for 1.5 hour with the indicated concentration of peptide at
27.degree. C., room temperature. Cells were then incubated for 1.5
hours at 37.degree. C. Peptide-loaded cells were then incubated
with 2C TCR/Ig or 30.5.7 (40 .mu.g) for 1 hour, washed, and
incubated with GAM/IgG-PE for 1 hr. Cells were then washed and
analyzed by flow cytometry. Squares indicate peptide QL9 and
circles peptide p2Ca; open symbols represent data from 30.5.7, and
closed symbols, 2C TCR/IgG.
[0037] FIG. 15. A comparison of the reactivity of soluble 2C TCR/Ig
to that of soluble monovalent 2C TCR with peptide-stabilized H-2
L.sup.d molecules. RMA-S L.sup.d cells were incubated at 27.degree.
C. overnight as described. The following morning, peptides, QL9
(.DELTA.), p2Ca (.quadrature.) or MCMV (.smallcircle.) (final
concentration 100 .mu.M) were added to cultures and cell processed
as previously described. Cells were stained with serial two-fold
dilution of either soluble divalent 2C TCR/Ig superdimer (solid
lines) or soluble monovalent 2C TCR (dashed lines). Cells were
washed once in FACS wash buffer and then stained with H57-FITC.
Cells were incubated for an additional hour and processed as
described. To facilitate comparison of cells stained with either 2C
TCR/Ig or soluble monovalent 2C TCR, data are presented as mean
channel fluorescence. Data shown are from one representative
experiment that has been repeated at least three times.
[0038] FIG. 16. 2C TCR/IgG has similar sensitivity to 2C CTL as
seen in its binding p2Ca variants on RMAS L.sup.d cells.
RMAS-L.sup.d cells were incubated with p2Ca or p2Ca-like peptides,
as described in FIG. 14. Cells were stained with 2C TCR/Ig and
analyzed by flow cytometry. Representative histograms are shown in
FIGS. 15A and 15B. FIGS. 16C and 16D show comparison of staining
using either 2C TCR/Ig (FIG. 16C) or the anti-L.sup.d mAb 30.5.7
(FIG. 16D). For comparison, data presented are shown as mean
channel fluorescence derived from individual histograms.
[0039] FIG. 17. I-E/IgG binds 5KC cells but not DO11.11 cells. T
hybridoma cells, (5KC, Panel A and DO11.10, Panel B) were stained
with .sup.MCCI-E.sup.k/Ig (10 .mu.g/sample) for one hour at
4.degree. C. Cells were washed in wash buffer and incubated with
GAM/IgG1-PE for another hour at 4 C. Cells were then washed again
and analyzed by flow cytometry. Histograms of 5KC cells stained
with either .sup.MCCI-E.sup.k/Ig (solid line) or without any
primary reagent (dotted line) and of D011.10 cells stained with
.sup.MCCI-E.sup.k/Ig (dashed line) are shown.
[0040] FIG. 18. Immobilized .sup.MCCI-E.sup.k/IgG stimulates IL-2
production by .sup.MCCI-E.sup.k-specific hybridoma, 5KC. Soluble
proteins were immobilized on Immunlon 4 plates at various
concentrations and incubated overnight at 4.degree. C. Wells were
washed thoroughly, and 5KC T cell hybridoma cells
(1.times.10.sup.5) were incubated overnight at 37.degree. C. T cell
activation was measured by IL-2 production using an IL-2 ELISA
kit.
DETAILED DESCRIPTION OF THE INVENTION
[0041] To enhance our ability to analyze and regulate
antigen-specific immune responses, we have designed a general
system for expression of soluble divalent or multivalent molecular
complexes of heterodimeric proteins which form a ligand binding
site, particularly MHC class II and TCR proteins. Successful
expression of soluble molecular complexes with high avidity for
their cognate ligands is achieved using an immunoglobulin as a
molecular scaffolding structure. The immunoglobulin moiety serves
as a scaffolding for proper folding of the .alpha. and .beta.
chains, without which nonfunctional aggregates would likely result,
as previously described (4, 12). The physical proximity of the
immunoglobulin heavy and light chains, whose folding and
association is favored by a net gain in free energy, overcomes the
entropy required to bring the soluble TCR or MHC .alpha. and .beta.
chains together to facilitate their folding. Furthermore, the
intrinsic flexibility afforded by the immunoglobulin hinge region
facilitates the binding of the ligand binding sites to their
cognate ligands.
[0042] These structural features distinguish this design over
methodologies which generate soluble monovalent complexes, in that
they enable a multimeric interaction of, for example, at least two
peptide/MHC complexes with at least two TCR molecules. This
interaction has greater avidity than the interaction of TCR
monomers with a peptide/MHC complex. Molecular complexes of the
invention have the further advantage that, by altering the Fc
portion of the immunoglobulin, different biological functions can
be provided to the molecule based on biological functions afforded
by the Fc portion.
[0043] In addition, soluble TCR/Ig molecular complexes of the
invention can be used to define specific ligands recognized by T
cells. These complexes have potential uses in defining ligands of
.gamma./.delta. TCR or of undefined tumor-specific T cells.
Furthermore, since T cell activation requires cross linking of
multiple TCRs, interaction of TCR-Ig molecular complexes can mimic
natural T cell activation, facilitating both induction and
enhancement of immune responses and elucidation of biochemical
interactions involved in TCR recognition of peptide/MHC
complexes.
[0044] Molecular complexes of the invention have broader
applications than regulation of immune system responses. For
example, adhesion of cells mediated through the interactions of
integrins can be modulated using soluble divalent molecular
complexes comprising integrin molecules. Modulation of
cytokine-mediated cell stimulation can also be achieved, employing
soluble divalent molecular complexes comprising a cytokine
receptor. Binding of the ligand binding site of the cytokine
receptor to a soluble cytokine, for example, can inhibit the
ability of the cytokine to mediate cellular proliferation.
[0045] Molecular complexes of the invention comprise an
immunoglobulin scaffold and at least two ligand binding sites. The
ligand binding sites are formed by the extracellular domains of two
transmembrane polypeptides. The transmembrane polypeptides can be
any transmembrane polypeptides which form a heterodimeric protein
and which can bind a ligand, preferably an antigenic peptide.
Suitable heterodimeric proteins which can provide transmembrane
polypeptides for use in molecular complexes of the invention
include MHC class II molecules, T cell receptors, including
.alpha./.beta. and .gamma./.delta. T cell receptors, integrin
molecules, and cytokine receptors, such as receptors for IL-2,
IL-3, IL-4, IL-5, IL-6, IL-7, IL-9, erythropoietin, leukemia
inhibitory factor, granulocyte colony stimulating factor,
oncostatin M, ciliary neurotrophic factor, growth hormone, and
prolactin.
[0046] Molecular complexes of the invention comprise at least four
fusion proteins. Two fusion proteins comprise an immunoglobulin
heavy chain, including a variable region, and an extracellular
domain of a first transmembrane polypeptide, such as an MHC class
II.beta. chain or a TCR .alpha. chain. Two fusion proteins of the
molecular complex comprise an immunoglobulin .kappa. or .lamda.
light chain and an extracellular domain of a second transmembrane
polypeptide, such as an MHC class II.alpha. chain or a TCR .beta.
chain. The fusion proteins associate to form the molecular complex.
The affinity of the molecular complex for a cognate ligand is
increased at least two-fold over a dimeric molecular complex
consisting of a first and a second fusion protein. Preferably, the
affinity is increased at least 5-, 10-, 20-, 25-, 30-, 35-, 40-,
50-, 75-, or 100-fold.
[0047] The immunoglobulin heavy chain can be the heavy chain of an
IgM, IgD, IgG3, IgG1, IgG2.beta., IgG2.alpha., IgE, or IgA.
Preferably, an IgG1 heavy chain is used to form divalent molecular
complexes comprising two ligand binding sites. A variable region of
the heavy chain is included. IgM or IgA heavy chains can be used to
provide pentavalent or tetravalent molecular complexes,
respectively. Molecular complexes with other valencies can also be
constructed, using multiple immunoglobulin chains.
[0048] Fusion proteins which form molecular complexes of the
invention can comprise a peptide linker inserted between a variable
region of an immunoglobulin chain and an extracellular domain of a
transmembrane polypeptide. The length of the linker sequence can
vary, depending upon the flexibility required to regulate the
degree of antigen binding and cross-linking. Constructs can also be
designed such that the extracellular domains of transmembrane
polypeptides are directly and covalently attached to the
immunoglobulin molecules without an additional linker region. If a
linker region is included, this region will preferably contain at
least 3 and not more than 30 amino acids. More preferably, the
linker is about 5 and not more than 20 amino acids; most
preferably, the linker is less than 10 amino acids. Generally, the
linker consists of short glycine/serine spacers, but any amino acid
can be used. A preferred linker for connecting an immunoglobulin
heavy chain to an extracellular portion of a first transmembrane
protein is GLY-GLY-GLY-THR-SER-GLY (SEQ ID NO:10). A preferred
linker for connecting an immunoglobulin light chain to an
extracellular portion of a second transmembrane protein is
GLY-SER-LEU-GLY-GLY-SER (SEQ ID NO:11).
[0049] Methods of making fusion proteins, either recombinantly or
by covalently linking two protein segments, are well known.
Preferably, fusion proteins are expressed recombinantly, as
products of expression constructs. Expression constructs of the
invention comprise a polynucleotide which encodes one or more
fusion proteins in which an immunoglobulin chain is C-terminal to
an extracellular domain of a transmembrane polypeptide.
Polynucleotides in expression constructs of the invention can
comprise nucleotide sequences coding for a signal sequence;
expression of these constructs results in secretion of a fusion
protein comprising the extracellular domain of the transmembrane
polypeptide spliced to the intact variable region of the
immunoglobulin molecule. Variations or truncations of this general
structure in which one or more amino acids are inserted or deleted
but which retain the ability to bind to the target ligand are
encompassed in the present invention.
[0050] In a preferred embodiment, an expression construct comprises
a baculovirus replication system, most preferably the baculovirus
expression vector pAcUW51 (Pharmingen, California). This vector has
two separate viral promoters, polyhedron and P10, allowing
expression of both fusion proteins of a molecular complex in the
same host cell. To facilitate cloning of different genes into the
vector, multiple cloning sites can be introduced after each of the
promoters. Optionally, expression constructs which each encode one
fusion protein component of the molecular complex can be
constructed.
[0051] Expression constructs of the invention can be introduced
into host cells using any technique known in the art. These
techniques include transferrin-polycation-mediated DNA transfer,
transfection with naked or encapsulated nucleic acids,
liposome-mediated cellular fusion, intracellular transportation of
DNA-coated latex beads, protoplast fusion, viral infection,
electroporation, and calcium phosphate-mediated transfection.
[0052] Host cells comprising expression constructs of the invention
can be prokaryotic or eukaryotic. Bacterial systems for expressing
fusion proteins of the invention include those described in Chang
et al., Nature (1978) 275: 615, Goeddel et al., Nature (1979) 281:
544, Goeddel et al., Nucleic Acids Res. (1980) 8: 4057, EP 36,776,
U.S. Pat. No. 4,551,433, deBoer et al., Proc. Natl. Acad. Sci. USA
(1983) 80: 21-25, and Siebenlist et al., Cell (1980) 20: 269.
[0053] Expression systems in yeast include those described in
Hinnen et al., Proc. Natl. Acad. Sci. USA (1978) 75: 1929; Ito et
al., J. Bacteriol. (1983) 153: 163; Kurtz et al., Mol. Cell. Biol.
(1986) 6: 142; Kunze et al., J. Basic Microbiol. (1985) 25: 141;
Gleeson et al., J. Gen. Microbiol. (1986) 132: 3459, Roggenkamp et
al., Mol. Gen. Genet. (1986) 202:302) Das et al., J. Bacteriol.
(1984) 158: 1165; De Louvencourt et al., J. Bacteriol. (1983) 154:
737, Van den Berg et al., Bio/Technology (1990) 8: 135; Kunze et
al., J. Basic Microbiol. (1985) 25: 141; Cregg et al., Mol. Cell.
Biol. (1985) 5: 3376, U.S. Pat. No. 4,837,148, U.S. Pat. No.
4,929,555; Beach and Nurse, Nature (1981) 300: 706; Davidow et al.,
Curr. Genet. (1985) 10: 380, Gaillardin et al., Curr. Genet. (1985)
10: 49, Ballance et al., Biochem. Biophys. Res. Commun. (1983) 112:
284-289; Tilburn et al., Gene (1983) 26: 205-221, Yelton et al.,
Proc. Natl. Acad. Sci. USA (1984) 81: 1470-1474, Kelly and Hynes,
EMBO J. (1985) 4: 475479; EP 244,234, and WO 91/00357.
[0054] Expression of fusion proteins of the invention in insects
can be carried out as described in U.S. Pat. No. 4,745,051, Friesen
et al. (1986) "The Regulation of Baculovirus Gene Expression" in:
THE MOLECULAR BIOLOGY OF BACULOVIRUSES (W. Doerfler, ed.), EP
127,839, EP 155,476, and Vlak et al., J. Gen. Virol. (1988) 69:
765-776, Miller et al., Ann. Rev. Microbiol. (1988) 42: 177,
Carbonell et al., Gene (1988) 73: 409, Maeda et al., Nature (1985)
315: 592-594, Lebacq-Verheyden et al., Mol. Cell. Biol. (1988) 8:
3129; Smith et al., Proc. Natl. Acad. Sci. USA (1985) 82: 8404,
Miyajima et al., Gene (1987) 58: 273; and Martin et al., DNA (1988)
7:99. Numerous baculoviral strains and variants and corresponding
permissive insect host cells from hosts are described in Luckow et
al., Bio/Technology (1988) 6: 47-55, Miller et al., in GENETIC
ENGINEERING (Setlow, J. K. et al. eds.), Vol. 8 (Plenum Publishing,
1986), pp. 277-279, and Maeda et al., Nature, (1985) 315: 592-594.
A preferred method of expressing fusion proteins of the invention
is described in Materials and Methods and in Example 1, below.
[0055] Expression of fusion proteins of the invention in mammalian
cells can be achieved as described in Dijkema et al., EMBO J.
(1985) 4: 761, Gorman et al., Proc. Natl. Acad. Sci. USA (1982b)
79: 6777, Boshart et al., Cell (1985) 41: 521 and U.S. Pat. No.
4,399,216. Other features of mammalian expression can be
facilitated as described in Ham and Wallace, Meth. Enz. (1979) 58:
44, Barnes and Sato, Anal. Biochem. (1980) 102: 255, U.S. Pat. No.
4,767,704, U.S. Pat. No. 4,657,866, U.S. Pat. No. 4,927,762, U.S.
Pat. No. 4,560,655, WO 90/103430, WO 87/00195, and U.S. Pat. No. RE
30,985.
[0056] Ligand binding sites of molecular complexes can contain a
bound ligand, preferably an antigenic peptide. Ligands can be
passively bound to the ligand binding site, as described in
Materials and Methods, below. Active binding can also be
accomplished, for example, using alkaline stripping, rapid
neutralization, and slow refolding of the molecular complex (see
FIG. 3 for a schematic). Ligands can also be covalently bound to
the ligand binding site. Any peptide capable of inducing an immune
response can be bound to the ligand binding site, including
peptides which cause allergic or autoimmune responses,
alloantigens, peptides which are expressed by tumors, and peptides
of infectious agents, such as bacteria, viruses, or fungi.
Identical antigenic peptides can be bound to each ligand binding
site of a molecular complex.
[0057] Molecular complexes of the invention can be used
diagnostically, to label antigen-specific cells in vitro or in
vivo. A sample comprising antigen-specific T cells can be contacted
with a molecular complex in which each ligand binding site is bound
to an identical antigenic peptide. The sample can be, for example,
peripheral blood, lymphatic fluid, lymph nodes, spleen, thymus,
bone marrow, or cerebrospinal fluid.
[0058] The antigenic peptide specifically binds to the
antigen-specific T cells and labels them with the antigenic
peptide-loaded complex. Antigenic peptide/MHC complexes can be, but
need not be, conjugated to a reporter group, such as a radiolabel
or fluorescent label, to facilitate detection. The molecular
complex can be in solution or can be affixed to a solid substrate,
such as a glass or plastic slide or tissue culture plate or latex,
polyvinylchloride, or polystyrene beads.
[0059] Antigen-specific T cells which are bound to the antigenic
peptides can be separated from cells which are not bound. Any
method known in the art can be used to achieve this separation,
including plasmapheresis, flow cytometry, or differential
centrifugation. Antigen-specific T cells which have been isolated
from a patient can be treated with a reagent, such as a cytokine, a
chemotherapeutic agent, or an antibody, and reinfused into the
patient to provide a therapeutic effect. Optionally, the number of
antigen-specific T cells which are bound to the antigenic peptides
can be quantitated or counted, for example by flow cytometry.
[0060] Molecular complexes in which TCR polypeptides form ligand
binding sites can also be used to label specific peptide/MHC
complexes in vitro and in vivo. A distinct advantage of soluble
high affinity TCR/Ig molecular complexes is that even in the
absence of any a priori knowledge about their ligands, they can be
useful in defining specific peptide/MHC ligands recognized, for
example, by uncharacterized tumor-specific T cells or T cells
involved in autoimmune responses. Not only are soluble divalent
TCR/Ig molecules efficient probes for the qualitative and
quantitative detection of specific peptide/MHC complexes, but due
to their strong affinity for the target peptide, these molecular
complexes can be used to purify and characterize specific
peptide/MHC complexes.
[0061] The MHC molecules in peptide/MHC complexes can be MHC class
I or class II molecules, or a non-classical MHC-like molecule. A
peptide of a peptide/MHC complex can be, for example, a peptide
which is expressed by a tumor, a peptide of an infectious agent, an
autoimmune antigen, an antigen which stimulates an allelic
response, or a transplant antigen or alloantigen.
[0062] A sample, such as a peripheral blood, lymphatic fluid, or a
tumor sample, which comprises a peptide/MHC complex can be
contacted with a composition comprising a molecular complex. The
molecular complex comprises at least four fusion proteins. Two
first fusion proteins comprise an immunoglobulin heavy chain and an
extracellular domain of a TCR .alpha. chain. Two second fusion
proteins comprise an immunoglobulin light chain and an
extracellular domain of a TCR .beta. chain. The fusion proteins
associate to form a molecular complex. The molecular complex
comprises two ligand binding sites. Each ligand binding site is
formed by the extracellular domains of the TCR .alpha. and TCR
.beta. chains. The ligand binding site specifically binds to and
labels the peptide/MHC complex and can be detected as described
above.
[0063] Molecular complexes of the invention can also be used to
activate or inhibit antigen-specific T cells. It is possible to
conjugate toxin molecules, such as ricin or Pseudomonas toxin, to
molecular complexes of the invention. Similarly, molecular
complexes can be conjugated to molecules which stimulate an immune
response, such as lymphokines or other effector molecules. Doses of
the molecular complex can be modified to either activate or inhibit
antigen-specific T cells.
[0064] A sample which comprises antigen-specific T cells can be
contacted, in vivo or in vitro, with molecular complexes in which
each ligand binding site is bound to an antigenic peptide. The
antigenic peptide specifically binds to and activates or inhibits
the antigen-specific T cells. For example, cytokine activation or
inhibition can be stimulated or suppressed in specific T-cell
subsets. Hewitt et al., J. Exp. Med. 175:1493 (1992); Choi et al.
Proc. Natl. Acad. Sci. 86:8941 (1989); Kappler et al., Science
244:811 (1989); Minasi et al., J. Exp. Med. 177:1451 (1993);
Sundstedt et al., Immunology 82:117 (1994); and White et al., Cell
56:27 (1989).
[0065] Molecular complexes of the invention can be used
therapeutically, to inhibit or stimulate immune responses. For
example, molecular complexes comprising antigenic peptides to which
a patient has an allergic response can be administered to the
patient in order to treat an allergy. The molecular complexes are
administered to the patient at a dose sufficient to suppress or
reduce a T cell response associated with the allergy.
[0066] Similarly, a patient who has received or will receive an
organ transplant can be treated with molecular complexes of the
invention. Molecular complexes in which each ligand binding site is
bound to an alloantigen can be administered to a patient at a dose
sufficient to suppress or reduce an immune response to the organ
transplant. Alloantigens include the HLA antigens, including class
I and class II MHC molecules, and minor histocompatibility antigens
such as the ABO blood group antigens, autoantigens on T and B
cells, and monocyte/endothelial cell antigens.
[0067] Autoimmune diseases, such as Goodpasture's syndrome,
multiple sclerosis, Graves' disease, myasthenia gravis, systemic
lupus erythematosus, insulin-dependent diabetes mellitis,
rheumatoid arthritis, pemphigus vulgaris, Addison's disease,
dermatitis herpetiformis, celiac disease, and Hashimoto's
thyroiditis, can be similarly treated. A patient who suffers from
an autoimmune disease can be treated with molecular complexes of
the invention in which each ligand binding site is bound to an
antigenic peptide to which the patient expresses an autoimmune
response. The molecular complexes are administered to the patient
at a dose sufficient to suppress or reduce the autoimmune
response.
[0068] Immune responses of a patient can also be induced or
enhanced using molecular complexes of the invention. Molecular
complexes in which each ligand binding site is bound to a peptide
expressed by a tumor can be used to treat the tumor. The peptide
can be a tumor-specific peptide, such as EGFRvIII, Ras, or
p185.sup.HER2, or can be a peptide which is expressed both by the
tumor and by the corresponding normal tissue. Similarly, molecular
complexes in which each ligand binding site is bound to a peptide
of an infectious agent, such as a protein component of a bacterium
or virus, can be used to treat infections. In each case, the
appropriate molecular complexes are administered to the patient at
a dose sufficient to induce or enhance an immune response to the
tumor or the infection.
[0069] Molecular complexes of the invention can be bound to the
surface of a cell, such as a dendritic cell. A population of
molecular complexes in which all ligand binding sites are bound to
identical antigenic peptides can also be bound to the cell. Binding
can be accomplished by providing the fusion protein of the
molecular complex with an amino acid sequence which will anchor it
to the cell membrane and expressing the fusion protein in the cell
or can be accomplished chemically, as is known in the art.
[0070] Compositions comprising molecular complexes of the invention
can comprise a pharmaceutically acceptable carrier.
Pharmaceutically acceptable carriers are well known to those in the
art. Such carriers include, but are not limited to, large, slowly
metabolized macromolecules, such as proteins, polysaccharides,
polylactic acids, polyglycolic acids, polymeric amino acids, amino
acid copolymers, and inactive virus particles. Pharmaceutically
acceptable salts can also be used in compositions of the invention,
for example, mineral salts such as hydrochlorides, hydrobromides,
phosphates, or sulfates, as well as salts of organic acids such as
acetates, proprionates, malonates, or benzoates. Compositions of
the invention can also contain liquids, such as water, saline,
glycerol, and ethanol, as well as substances such as wetting
agents, emulsifying agents, or pH buffering agents. Liposomes, such
as those described in U.S. Pat. No. 5,422,120, WO 95/13796, WO
91/14445, or EP 524,968 B1, can also be used as a carrier for a
composition of the invention.
[0071] The particular dosages of divalent and multivalent molecular
complexes employed for a particular method of treatment will vary
according to the condition being treated, the binding affinity of
the particular reagent for its target, the extent of disease
progression, etc. However, the dosage of molecular complexes will
generally fall in the range of 1 pg/kg to 100 mg/kg of body weight
per day. Where the active ingredient of the pharmaceutical
composition is a polynucleotide encoding fusion proteins of a
molecular complex, dosage will generally range from 1 nM to 50
.mu.M per kg of body weight.
[0072] The amounts of each active agent included in the
compositions employed in the examples described herein provide
general guidance of the range of each component to be utilized by
the practitioner upon optimizing the method of the present
invention for practice either in vitro or in vivo. Moreover, such
ranges by no means preclude use of a higher or lower amount of a
component, as might be warranted in a particular application. For
example, the actual dose and schedule may vary depending on whether
the compositions are administered in combination with other
pharmaceutical compositions, or depending on individual differences
in pharmacokinetics, drug disposition, and metabolism. Similarly,
amounts may vary for in vitro applications depending on the
particular cell line utilized, e.g., the ability of the plasmid
employed to replicate in that cell line. For example, the amount of
nucleic acid to be added per cell or treatment will likely vary
with the length and stability of the nucleic acid, as well as the
nature of the sequence, and may be altered due to factors not
inherent to the method of the present invention, e.g., the cost
associated with synthesis, for instance. One skilled in the art can
easily make any necessary adjustments in accordance with the
necessities of the particular situation.
[0073] A sufficient dose of the composition for a particular use is
that which will produce the desired effect in a host. This effect
can be monitored using several end-points known to those skilled in
the art. For example, one desired effect might comprise effective
nucleic acid transfer to a host cell. Such transfer could be
monitored in terms of a therapeutic effect, e.g., alleviation of
some symptom associated with the disease being treated, or further
evidence of the transferred gene or expression of the gene within
the host, e.g, using PCR, Northern or Southern hybridization
techniques, or transcription assays to detect the nucleic acid in
host cells, or using immunoblot analysis, antibody-mediated
detection, or the assays described in the examples below, to detect
protein or polypeptide encoded by the transferred nucleic acid, or
impacted level or function due to such transfer.
[0074] The following are provided for exemplification purposes only
and are not intended to limit the scope of the invention described
in broad terms above.
Materials and Methods
[0075] The following materials and methods are used in the examples
described below.
[0076] Cells and Culture Conditions. RMA-S, RMA-S L.sup.d, T2, T2
K.sup.b, T2 Kbm3, T2 K.sup.bm11, and RENCA cells were maintained by
1:10 passage three times weekly in RPMI-1640, supplemented with 2
mM glutamine, nonessential amino acids, 50 .mu.g/ml of gentamicin,
5.times.10.sup.-5 M 2-mercaptoethanol, and 10% fetal calf
serum.
[0077] T2, T2 L.sup.d, and T cell hybridomas 5KC and DO11.10 were
maintained by 1:20 passage three times weekly in RPMI-1640
supplemented with 2 mM glutamine, nonessential amino acids, 50
.mu.g/ml of gentamicin, 5.times.10.sup.-5 M 2-mercaptoethanol, and
10% fetal calf serum. Transfected T2 L.sup.d cells were grown in
G418 (1 mg/ml, GIBCO).
[0078] Construction of the Soluble Divalent Molecules.
[0079] The genes encoding the chimeric 2C TCR/Ig molecule were
constructed by insertion of cDNA encoding the extracellular domains
of the TCR .alpha. and .beta. chains upstream of cDNA encoding the
murine IgG1 heavy, 93G7, and light chain, 91A3, respectively (FIG.
1A) (20). A HindIII restriction enzyme site and linker were
inserted immediately 5' of the codon for Asp at the start of the
mature kappa protein in clone 91A3. A KpnI restriction enzyme site
was introduced 3' of the stop codon in the kappa polypeptide. A
KpnI restriction site and linker were inserted immediately 5' of
the codon for Glu located at the start of the mature
Ig.gamma..sub.1 polypeptide in clone 93G7. An SphI restriction site
was introduced 3' to the stop codon in the .gamma..sub.1
polypeptide.
[0080] The genes encoding the 2C-TCR .alpha. and .beta. chains have
previously been described (5). A KpnI restriction site and linker
were inserted immediately 3' to the codon for the Gln residue at
the interface between the extracellular and transmembrane domains
of the 2C-TCR a polypeptide. The 5' regions of the gene already
expressed an appropriate restriction enzyme endonuclease site,
EcoR1. An Xho1 site was introduced 5' to the start of the signal
sequence in the 2C-TCR .beta. chain, and a HindIII restriction
enzyme endonuclease site was introduced immediately 3' to the codon
for the Ile residue at the interface between the extracellular and
transmembrane domains of the .beta. polypeptide. In the
construction of the chimeric proteins, linkers of six amino acid
residues were introduced at the junctions between the end of the
TCR .alpha. and .beta. and the mature gamma and kappa polypeptides,
respectively (FIG. 1B).
[0081] A similar approach was used to modify the genes encoding the
I-E .alpha. and .beta. chains A KpnI restriction site and linker
was inserted immediately 3' to the interface between the
extracellular and transmembrane domains of the I-E .beta.
polypeptide. The 5' regions of the gene had already been modified
to encode the MCC peptide (21) and also already expressed an EcoRI
site. The I-E .alpha. chain was modified by introduction of a
HindIII restriction enzyme endonuclease site immediately 3' to the
codon at the interface between the extracellular and transmembrane
domains.
[0082] A baculovirus expression vector was used, as described
previously (21). This vector has two separate viral promoters,
polyhedron and P10, allowing simultaneous expression of both
chimeric polypeptide chains in the same cell (FIG. 1A). The
expression vector was digested with XhoI and Kpn1 and 2C
TCR.sub..beta./Ig.sub..kappa. was inserted downstream of the P10
promoter (FIG. 1A). Subsequently, the 2C TCR.sub..alpha./Ig.gamma.1
was inserted into an EcoRI/SphI site downstream of the polyhedron
promoter.
[0083] Mutagenesis.
[0084] For mutagenesis, cDNA molecules encoding the individual
polypeptides were subcloned into pSP72 and pSP73 vectors (Promega,
Madison, Wis.). Oligonucleotide-directed mutagenesis was performed
using the Chameleon kit (Stratagene, La Jolla, Calif.). All
mutations were confirmed by sequencing.
[0085] The following oligonucleotides were used to introduce the
above mutations:
TABLE-US-00001 5' IgG1 mutation, (SEQ ID NO: 1)
ctgtcagtaactgcaggtgtccactctggtaccagcggtgaggttcagat cagcagtctggagc;
3' IgG1 mutation, (SEQ ID NO: 2)
agcctctcccactctcctggtaaatgagcatgctctcagtgtccttggag ccctctggtc; 5'
Igk mutation, (SEQ ID NO: 3)
ctgttgctctgttttcaaggtaccaggtgtggaagcttgggaggatctga
tatccagatgacgcaaatccatcc; 3' Igk mutation, (SEQ ID NO: 4)
gtcaagagatcaacaggaatgagtgttagggtaccagacaaaggtcctga gacgccaccaccagc;
3' 2C TCR a mutation, (SEQ ID NO: 5) cagatatgaacctaa
actttcaaggaggaggtacctgtcagttatggga ctccgaatc; 5' 2C TCR .beta.
mutation, (SEQ ID NO: 6)
ccaaagagaccagtatcctgactcgaggaagcatgtctaacactgcctt c; 3' 2C TCRb
mutation, (SEQ ID NO: 7)
ctgcaaccatcctctatgagatcggtcggaagcttaggatctggacctac
tggggaaggccaccctatatgc; 3' IE.sup.d.alpha. (SEQ ID NO: 8)
ggtagcgaccggcgctcagctggaattcaagcttccattctctttagttt
ctgggaggagggt-3'; IE.sup.kb (SEQ ID NO: 9)
gcacagtccacatctgcacagaacaagggaggaggtaccggggatccggt
tattagtacatttattaag.
[0086] Detection and Biochemical Analysis of Chimeras.
[0087] The conformational integrity of the chimeric molecules was
detected by ELISA assays using antibodies specific for each moiety
of the protein. The primary antibody used was specific for murine
IgG1 Fc. The secondary antibody used was either a biotinylated: H57
(used at 1:5,000 final dilution), a hamster monoclonal antibody
(mAb) specific for a conformational epitope expressed on the .beta.
chain of murine TCR (22) or 1B2 (23, 24), a murine mAb specific for
a clonotypic epitope expressed on 2C TCR. I-E.sup.k/Ig was assayed
using biotinylated 14.4.4, an anti I-E.sub..alpha. chain specific
mAb, as the secondary antibody.
[0088] Wells were incubated with the primary antibody, 10 mg/ml,
for 1 hour at RT, and then blocked with a 2% BSA solution prior to
use. After three washes with PBS containing 0.05% Tween 20 and 1%
FCS, culture supernatants (100 .mu.l) from infected baculovirus
cells were incubated for 1 hour at RT. Plates were then washed
extensively and incubated with the biotinylated second antibody.
When using biotinylated second antibody 1B2, wells were incubated
with 100 .mu.l 10% mouse serum for an additional hour, after
washing out unbound culture supernatants to reduce background
reactivity.
[0089] After an hour incubation with the biotinylated antibody, the
plates were washed and incubated with HRP-conjugated streptavidin
(100 ml of a 1:10000 dilution) for one hour, washed and developed
with 3,3',5,5'-tetramethylbenzidine dihydrochloride (TMB) substrate
for 3-5 minutes. The reaction was stopped by the addition of 1M
H.sub.2SO.sub.4 and optical density was measured at 450 nm. The
assay was linear over the range of 1-50 ng/ml of purified IgG.
I-E.sup.k/Ig was assayed similarly with 14.4.4 as the primary
antibody and goat-anti-mouse-lambda conjugated to horse radish
peroxidase as the secondary antibody.
[0090] Purification of Chimeras.
[0091] For protein production, Trichoplusia ni cells were infected
with virus, MOI 5-10, and supernatants were harvested after 72
hours of infection. The chimeric protein was purified from one
liter culture supernatants passed over a 2.5 ml affinity column of
protein G sepharose. The chimeric protein was eluted with 0.1 M
glycine/0.15 M NaCl, pH 2.4. The eluate was immediately neutralized
with 2 M Tris pH 8 (0.1 M final concentration). Fractions were
pooled, concentrated in an Amicon concentrator (50 kd molecular
weight cutoff), and washed with PBS.
[0092] SDS-PAGE analysis of the chimeric protein was preformed as
described (25). Samples were electrophoresed through a 10%
SDS-polyacrylamide gel.
[0093] Peptide Loading of Cells.
[0094] RMA-S and T2 cell lines are defective in antigen processing
and express functionally "empty" class I MHC on their cell surface.
These "empty" MHC molecules can be loaded with peptides using the
following protocol (25). Cells (RMA-S, RMA-S L.sup.d, T2, T2
L.sup.d', T2 Kb, T2 Kbm3 or T2 K.sup.bm11) are cultured at
27.degree. C. overnight. The following morning, cells are cultured
in the presence of various antigenic peptides (100 .mu.M final
concentration) or in the absence of peptides for an additional 1.5
hours at 27.degree. C. and then incubated for one hour at
37.degree. C. RENCA cells were loaded with peptides by incubation
with peptides (100 .mu.M final concentration) for >2 hour at
37.degree. C. Cells were then harvested and processed for FACS
analysis as described.
[0095] All peptides were made by the Johns Hopkins University
biopolymer laboratory peptide synthesis facility. Peptides were
made by F-MOC chemical synthesis and then purified by preparative
HPLC.
[0096] Measurement of Affinities of Soluble 2C TCR for H-2 L.sup.d
Molecules.
[0097] Affinities of soluble 2C TCR analogs for peptide loaded
cells were determined in a competition assay with FITC-30.5.7 Fab
similar to one previously described. Schlueter et al., Journal of
Molecular Biology 256:859-869 (1996). 30.5.7 is a monoclonal
antibody that recognizes an epitope near the peptide-exposed face
of H-2 L.sup.d; thus 30.5.7 and 2C TCR compete for binding to the
peptide exposed face of H-2 L.sup.d. K.sub.d of 30.5.7 Fab for
peptide-loaded RMA-S L.sup.d cells were determined as follows.
Cells (0.3.times.10.sup.6/ml) were loaded with peptide as described
above. Subsequently, peptide-loaded or control cells were incubated
with varying concentrations of FITC-30.5.7 Fab for 1 hr. at
4.degree. C., and then diluted 1:6 with FACS wash buffer (PBS, 1%
FCS, 0.02% NaN.sub.3) immediately prior to analysis by flow
cytometry. K.sub.d were estimated from a plot of 1/(mean channel
fluorescence) vs. 1/[FITC-30.5.7 Fab].
[0098] Affinities of 2C TCR analogs were determined by competition
with constant concentrations of FITC-30.5.7 Fab. Cells were loaded
with peptide, and subsequently incubated with a constant
concentration of FITC-30.5.7 Fab and varying concentration of 2C
TCR analogs for 1 hour at 4.degree. C. Cells were diluted 1:6 with
FACS wash buffer immediately prior to analysis by flow cytometry.
Maximal inhibition of FITC-30.5.7 Fab binding was determined by
incubation in the presence of 30.5.7 mAb (75 mg). K.sub.app was
determined from a plot of 1/(% maximal inhibition) vs. [2C TCR
analog]. K.sub.app was corrected for the affinity of FITC-30.5.7
Fab for peptide loaded cells according to the equation K.sub.d,
TCR=K.sub.app/(1+([FITC 30.5.7 Fab]/K.sub.d,30.5.7)) Schlueter et
al., supra.
[0099] Direct Flow Microfluorimetry.
[0100] Approximately 1.times.10.sup.6 peptide-loaded or control
cells were incubated for 60 minutes at 4.degree. C. with either 100
.mu.l of mAb 30.5.7 culture supernatants, or 50 .mu.l of TCR/Ig
culture supernatants, 10 .mu.g/ml final concentration. Cells were
washed twice in PBS and then incubated for an additional 60 minutes
at 4.degree. C. in 50 .mu.l of 1:40 dilution of fluorescent
phycoerythrin-labeled-F(ab').sub.2 goat anti-mouse IgG (Cappel
Laboratories). Cells were then washed two additional times with
FACS wash buffer prior to analysis by flow cytometry.
[0101] To compare level of fluorescence of cells stained with
either the soluble divalent 2C TCR/Ig or the soluble monovalent 2C
TCR, RMA-S L.sup.d cells were incubated with peptides, as described
above. Cells were incubated for one hour with serial two-fold
dilution of either soluble 2C TCR/Ig or soluble monovalent 2C TCR,
washed once in FACS wash buffer, and then stained with saturating
amounts of H57-FITC for an hour, washed twice in FACS wash buffer,
and analyzed by flow cytometry.
[0102] For staining of MCC specific hybridoma cells,
.sup.MCCIE.sup.K/Ig (5 .mu.g/well) was incubated with cells for 1
hour at 4.degree. C., washed and followed by goat anti-mouse
IgG.sub.1 conjugated to RPE for an additional hour. Hybridoma cells
were then washed twice. Cells were analyzed by flow cytometry.
[0103] T Cell Stimulation Assay.
[0104] Various concentrations of soluble .sup.MCCIE.sup.k.sub.2Ig
or the murine anti-CD3 monoclonal antibody, 2C22, were immobilized
on sterile Immunlon 4 plates (Dynatech) overnight at 4.degree. C.
Following two washes, either the MCC-specific 5KC cells or the
control ovalbumin specific-DO11.10 cells (1.times.10.sup.5/well)
were added in 250 .mu.l of culture medium and incubated overnight
at 37.degree. C. IL-2 was measured using an ELISA assay.
[0105] CTL Assays.
[0106] Splenocytes from 2C TCR transgenic mice (Sha et al. Nature
336:73-76, 1988) were resuspended at 1.25.times.10.sup.6 per ml and
stimulated with 1.75.times.10.sup.6 BALB/c splenocytes that had
been exposed to 3,000 cGy radiation. On day 7, the 2C T
cell-enriched cultures were restimulated at 5.times.10.sup.5 per ml
with 2.5.times.10.sup.6 per ml BALB/c splenocytes. Experiments were
performed on this and subsequent stimulations on day 4. All
subsequent stimulation was performed with 3.75.times.10.sup.5 per
ml 2C splenocytes and 2.5.times.10.sup.6 per ml BALB/c cells in the
presence of IL-2 (5 units/ml).
[0107] Assays were performed in triplicate according to established
CTL protocols. Briefly, target cells (2-4.times.10.sup.6) were
incubated with 100 5Ci .sup.51[Cr] at 37.degree. C. for 1 h. After
three washes, cells were added to V-bottom 96 well plates
(3.times.10.sup.3/100 .mu.A) and incubated (25.degree. C. for 1.5
hour) with peptides at the indicated concentrations. 2C T cells
(3.times.10.sup.4/100 .mu.l) were added to targets and plates were
incubated at 37.degree. C. for 4.5 hour. Maximum release was
achieved by incubating targets with 5% Triton X 100. Percent
specific lysis was calculated from raw data using [(experimental
release-spontaneous release)/(maximum release-spontaneous
release)].times.100.
Example 1
[0108] This example demonstrates general construction and
biochemical characterization of chimeric molecules.
[0109] Characteristics of a general system for the expression of
soluble divalent analogs of heterodimeric proteins include relative
simplicity, broad applicability, and maintenance of molecular
stability of the soluble analog. To accomplish this, IgG was chosen
as a general molecular scaffold because it is divalent by nature
and can be simply modified to serve as a scaffold (16, 26-28). Of
further advantage is the fact that the IgG scaffold facilitates
subunit pairing, folding, secretion, and stability of the
covalently linked heterodimeric polypeptides.
[0110] Using immunoglobulin as a backbone, a general system has
been designed for expression of soluble recombinant multivalent
analogs of heterodimeric transmembrane proteins (FIGS. 1B-1D and
FIG. 2). As shown in FIG. 2, site-directed mutagenesis was used to
insert restriction enzyme sites, such as KpnI and Hind III, into
the 5' region of the Ig heavy and light chains, respectively. The
enzyme sites were introduced immediately after the leader sequence
prior to the start of the mature protein encoding the intact
variable domains. This strategy leads to a generic system for
expression of chimeric polypeptides and serves as a foundation
molecule for construction of soluble divalent analogs of two
different classes of heterodimeric proteins. The different classes
of heterodimeric transmembrane proteins, which contain .alpha. and
.beta. polymorphic integral membrane polypeptides that bind each
other forming a functional unit involved in immune recognition,
include, but are not limited to, proteins such as T cell receptors,
and class II MHC molecules, integrins, and cytokine receptors.
[0111] A multi-step construction was used to genetically fuse
.alpha. and .beta. polypeptides to immunoglobulin heavy and light
chains to form the chimeric IgG molecules. In one embodiment,
chimeric fusion partners consisted of cDNA encoding a murine IgG1
arsenate-specific heavy chain, 93G7, and .kappa. light chain, 91A3
(Haseman et al Proc Natl Acad Sci USA 87:3942-3946 (1990). Both of
these immunoglobulin polypeptides have been expressed and produce
intact soluble intact IgG1 molecules in baculovirus infected cells.
cDNA encoding the light chain clone 91A3 was modified by
introduction of 5' HindIII site and linker immediately prior to
position one amino acid residue, Asp, at the start of the mature
protein. A KpnI restriction enzyme endonuclease site was introduced
after the stop codon in the mature .kappa. polypeptide. cDNA
encoding the 93G7 clone was modified but introduction of a KpnI
restriction enzyme endonuclease site immediately prior to 5' to
amino acid residue position Glu located at the start of the mature
protein, and an SpHI restriction enzyme endonuclease site 3' to the
stop codon in the mature IgG1 protein.
[0112] In another embodiment, we analyzed the ability of the Ig
scaffold to facilitate production of two classes of heterodimers,
TCR .alpha.,.beta. heterodimers, and class II .alpha.,.beta.
heterodimers. The TCR heterodimer was derived from the well
characterized alloreactive, class I-specific 2C CTL clone (24, 29).
The class II MHC heterodimer was derived from the murine class II
molecule I-Ek that had previously been modified to also encode a
nominal peptide antigen derived from moth cytochrome C (MCC) (21,
30).
[0113] Soluble divalent TCR chimeras were generated by linking cDNA
encoding the extracellular domains of TCR .alpha. or .beta. chains
to cDNA encoding Ig.gamma.1 heavy and .kappa. light chain
polypeptides, respectively. Site-directed mutagenesis was used to
introduce restriction endonuclease enzyme sites into the TCR
.alpha. and .beta. genes immediately preceding the regions encoding
the transmembrane domains (FIG. 2). The enzyme sites introduced
into the TCR cDNAs were complementary to those introduced into the
immunoglobulin cDNAs 5' to the regions encoding the intact
immunoglobulin variable domains. The DNA encoding the restriction
sites was part of a sequence encoding the six amino acid glycine,
serine linker (FIG. 1B) which was designed to allow flexibility.
The TCR .alpha.-Ig.gamma. and TCR .beta.-Ig.kappa. constructs were
cloned into the modified dual promoter baculovirus expression
vector, pAcUW51 (FIG. 2) (21). This vector allows simultaneous
expression of both chimeric chains from cells infected with a
single viral stock.
[0114] For expression of soluble divalent class II MHC molecules,
cDNAs encoding the I-Ek .beta. and I-E .alpha. chains were
genetically linked to cDNA encoding the Ig.gamma.1 heavy and
.kappa. light chain polypeptides, respectively. The 5' end of the
.beta. cDNA was previously linked via a thrombin cleavage site to
DNA encoding an antigenic peptide derived from MCC (residues
81-101) (21). Site-directed mutagenesis was used to introduce
restriction enzyme endonuclease sites into the 3' region of the
.sup.MCCI-Ek.beta. and I-E.alpha. genes immediately preceding the
regions encoding the transmembrane domains, as described for 2C
TCR. The constructs were cloned into the dual promoter baculovirus
expression vector described above.
[0115] FIG. 1B depicts a schematic representation of a chimeric
molecule. The .alpha. polypeptide is attached via a short six amino
acid linker, GGGTSG (SEQ ID NO:10), to the amino terminal end of
the variable region of the Ig.kappa. chain, while the .beta.
polypeptide is attached via another six amino acid linker, GSLGGS
(SEQ ID NO:11), to the amino terminus of the variable region of the
Ig.gamma. chain.
Example 2
[0116] This example demonstrates detection of soluble heterodimeric
proteins.
[0117] Cells infected with baculovirus containing transfer vectors
encoding the soluble chimeric Ig constructs described above secrete
a soluble chimeric Ig-like molecule detected by specific ELISA
assays 4-5 days post infection. For 2C TCR/IgG, the assay was based
on a primary antibody specific for murine IgG1 Fc (plated at 10
.mu.g/ml) and a biotinylated secondary antibody, H57 (used at
1:5000 final dilution), specific for a conformational epitope
expressed on the .beta. chain of many TCR (FIG. 5A) or biotinylated
1B2 or a monoclonal antibody specific for a clontoypic epitope
expressed on 2C TCR (FIG. 5B). For detection of I-E/IgG chimeric
molecules, the same primary antibody was used and the biotinylated
secondary antibody was 14.4.4, which is specific for I-E .alpha.
chain (FIG. 5C). Supernatants from infected cells were incubated
for 1 hour at room temperature. Plates were washed extensively with
phosphate buffered saline, incubated with the biotinylated
secondary antibody for 1 hour at room temperature. The plates were
then washed and incubated with HRP-conjugated streptavidin (100
.mu.l of a 1:10000 dilution) (Sigma, St. Louis, Mo.) for 1 hour at
room temperature, washed and developed with
3,3',5,5'-tetramethylbenzidine dihydrochloride (TMB) substrate for
3-5 minutes. Supernatants from cells infected with baculovirus
containing the 2C TCR/Ig and I-E/Ig transfer vectors were compared
to control supernatant from cells infected with the wild type
baculovirus.
[0118] The chimeric proteins are conformationally intact as shown
in FIG. 5. The soluble divalent 2C TCR/Ig is reactive with H57, a
monoclonal antibody specific for a conformational epitope expressed
on most TCR.beta. chains as well as with 1B2, the anti-clonotypic
monoclonal antibody determinant specific for the 2C TCR as shown in
FIGS. 5A and 5B. Soluble divalent class II molecules are reactive
with the conformationally dependent monoclonal antibody specific
for a native alpha chain determinant only expressed on intact I-E
molecules, monoclonal antibody 14.4.4 as shown in FIG. 5C. The
immunoglobulin portion of the chimeric molecules is also
conformationally intact. It is reactive in an immunoglobulin
specific ELISA, as mentioned above, and can be used to purify the
chimeric molecules. Protein G or arsenate-sepharose affinity
purification column methods can also be used.
[0119] The purified material has the expected molecular weights
when analyzed by SDA-PAGE as depicted in FIG. 6. The chimeric
TCR.beta./Ig.kappa. has an apparent molecular weight (MW) of 55,000
and the chimeric TCR.alpha./Ig.gamma.1 has an apparent MW of
approximately 89,000. The chimeric I-E.alpha./Ig.kappa. has an
approximate MW of 44,000 and the chimeric I-E.beta./Ig.gamma.1 has
an apparent MW of approximately 76,000.
Example 3
[0120] This example demonstrates affinity measurements of soluble
divalent TCR interaction with peptide/MHC complexes.
[0121] A competitive inhibition assay was developed to measure the
affinity of soluble 2C TCR/Ig for peptide/MHC complexes. This
assay, similar to one previously used to determine the affinity of
soluble monovalent 2C TCR for peptide/MHC complexes (Schlueter et
al., Journal of Molecular Biology 256:859-869 (1996), is based on
mAb 30.5.7 binding to a region of the x2 helix of H-2 L.sup.d that
overlaps with TCR receptor binding (Solheim et al., Journal of
Immunology 154:1188-1197 (1995); Solheim et al., Journal of
Immunology 150:800-811 (1993).
[0122] Briefly, affinities of 30.5.7 Fab fragments for RMA-S
L.sup.d cells were determined by direct saturation analysis of
30.5.7 Fab binding to cells analyzed by flow cytometry. Cells were
incubated with increasing amounts of FITC labeled 30.5.7 Fab, and
dissociation constants were estimated from a plot of 1/MCF vs.
1/[30.5.7 Fab]. Affinities of 2C TCR analogs were determined by
competition of the 2C TCR analog with a constant amount of FITC
labeled 30.5.7 Fab fragments for RMA-S L.sup.d cells as described
above. K.sub.app was calculated from a plot of (% maximal 30.5.7
Fab binding).sup.-1 vs. [2C TCR analog]. The K.sub.app was
corrected for the affinity of 30.5.7 Fab for RMA-S L.sup.d cells
according to the equation K.sub.d.TCR=K.sub.app/(1+{30.5.7
Fab]/K.sub.d.30.5.7) (Schlueter et al., 1996). The values reported
in the Table 2 are from one representative experiment that has been
repeated at least three times. Each data point used in
determination of the K.sub.d is the average of duplicate points.
Hence, the affinity of soluble TCR analogs was measured in terms of
their inhibition of 30.5.7 binding.
[0123] To determine the affinity of the soluble 2C TCR analogs, one
has to first determine the K.sub.d of 30.5.7 Fab fragments for
peptide-loaded H-2 L.sup.d molecules. This measurement was
determined by direct saturation analysis of 30.5.7-FITC Fab binding
to H-2 L.sup.d molecules on the surface of RMA-S L.sup.d cells.
RMA-S cells were chosen because these cells express empty MHC
molecules that can be readily loaded with specific peptides of
interest (Catipovic et al., Journal of Experimental Medicine
176:1611-1618 (1992); Townsend et al., Nature 340:443-428 (1989).
The affinity of 30.5.7 for H-2 L.sup.d molecules is dependent on
the peptide loaded into H-2 L.sup.d (Table 2). The affinity of the
30.5.7 for QL9-loaded H-2 L.sup.d molecules is 12.2 nM while the
affinities for p2Ca, pMCMV and SL9-loaded H-2 L.sup.d molecules
range between 4.8-6.4 nM. These small, peptide-dependent,
differences in affinity are reproducible and variations in affinity
were accounted for in the competitive binding assays. These values
are in good agreement with the previously measured affinities of
125I-30.5.7 Fab for the same peptide/H-2 L.sup.d complexes (8.8 to
16 nM; Schlueter et al., 1996).
[0124] 2C TCR/Ig inhibited binding of 30.5.7 Fab to H-2 L.sup.d
molecules loaded with either QL9 or p2Ca peptides, but did not
inhibit 30.5.7 Fab binding to pMCMV loaded H-2 L.sup.d molecules
(FIG. 7). The affinity of soluble divalent 2C TCR/Ig for QL9 loaded
molecules is 13.3 nM (FIG. 7 and Table 2). As expected, the
affinity of 2C TCR/Ig for p2Ca loaded molecules, 90 nM, is lower
than that for QL9 loaded H-2 L.sup.d. Although a small amount of
competitive inhibition was seen with SL9 loaded cells, the affinity
of the soluble divalent 2C TCR/Ig chimeras for SL9 loaded molecules
is too low to be accurately measured under the conditions
tested.
[0125] In all cases analyzed, the affinity of the soluble divalent
2C TCR/Ig was significantly higher than the affinity of the soluble
monovalent 2C TCR for its cognate ligand (FIG. 7 and Table 2). The
affinity of soluble divalent 2C TCR/Ig was 50-fold higher for
QL9-loaded H-2 L.sup.d and at least 20-fold higher for p2Ca-loaded
H-2 L.sup.d molecules than that of soluble monovalent 2C TCR for
the same peptide/MHC complexes (Table 2). Thus, the affinity of
soluble 2C TCR/Ig chimeras for cognate ligands was significantly
increased. The finding that the chimeric molecules of the present
invention demonstrate increased affinity for their specific ligands
over what is seen for monovalent molecules was not an expected
result. In fact, the chimeric CD4-IgG molecules disclosed in Capon
et al., Nature 337:525-531 (1989), do not demonstrate improved
target affinity.
TABLE-US-00002 TABLE 2 Measured Affinities of TCR analogs for
peptide loaded RMA-SL.sup.d cells Peptide/MHC 30.5.7 Fab 2C TCR/Ig
2C-sm TCR complex K.sub.d (nM) K.sub.app (nM) K.sub.d (nM)
K.sub.app (nM) K.sub.d (nM) QL9 12.2 18.3 13.3 953.4 613.6 p2Ca 5.8
107.7 90.5 >2000.sup.2 >2000.sup.2 pMCMV 4.8 ndc.sup.1
ndc.sup.1 --.sup.3 --.sup.3 .sup.1ndc--no detectable competition
with 30.5.7 Fab fragments .sup.2Competition was detected at the
highest concentration of 2C-smTCR used, but an accurate measure of
the K.sub.d could not be determined. .sup.3not done.
Example 4
[0126] This example demonstrates binding specificity of soluble
divalent TCR chimeras to peptide-loaded H-2 L.sup.d molecules.
[0127] Based on the relatively high affinity of soluble divalent 2C
TCR/Ig for peptide/MHC complexes, we postulated that these
molecules might be useful in analysis of peptide/MHC complexes by
direct flow cytometry-based assays. To study peptide specificity of
2C TCR/Ig, we compared reactivity of 2C TCR/Ig with that of H-2
L.sup.d reactive mAb, 30.5.7, in direct flow cytometry assays.
Specific peptides (see Table 3 for sequences) were loaded into H-2
L.sup.d molecules on RMA-S L.sup.d cells. Peptides listed in Table
2 are a collection of H-2 L.sup.d and H-2 K.sup.b binding peptides
used in analysis of the reactivity of the soluble divalent 2C
TCR/Ig. Lysis and affinity data are summarized from their primary
references (Corr et al., Science 265:946-49, 1994; Huang et al.,
Proc. Natl. Acad. Sci. 93, 1996; Solheim et al., J. Immunol.
150:800-811, 1993; Sykulev et al., Immunity 1:15-24, 1994a; Sykulev
et al., Proc. Natl. Acad. Sci. 91:11487-91, 1994b; Tallquist et
al., J. Immunol 155:2419-26, 1996; Udaka et al., Cell 69:989-98,
1996; Van Bleek and Nathanson, Nature 348:213-16, 1990).
TABLE-US-00003 TABLE 3 Peptides used in this study: Their reported
effectiveness in 2C CTL assays and affinities of 2C TCR for
peptide/MHC complexes. peptide peptide MHC 2C-mediated name
sequence restriction lysis K.sub.d (.mu.M) p2Ca LSPFPFDL (SEQ H-2
L.sup.d +++ 0.5-0.1 ID NO: 12) QL9 QLSPFPFDL H-2 L.sup.d ++++ 0.066
(SEQ ID NO: 13) SL9 LSPFPFDLL H-2 L.sup.d +/- 71 (SEQ ID NO: 14)
tum TQNHRALDL H-2 L.sup.d na na (SEQ ID NO: 15) pMCMV YPHFMPTNL
H-2L.sup.d - nd (SEQ ID NO: 16) gp 70 SPSYVYHQF H-2 L.sup.d na na
(SEQ ID NO: 17) dEV-8 EQYKFYSV H-2 K.sup.b - unknown (SEQ ID NO:
18) dEV-8 H-2 K.sup.bm3 +++ unknown SIY SIYRYYGL (SEQ H-2 K.sup.b
+++ unknown ID NO: 19) SIY H-2 K.sup.bm3 unknown unknown pVSV
RGYVYQGL H-2 K.sup.b - nd NP(52-59) (SEQ ID NO: 20) na--not
available. nd--none detected. The affinity were below the
sensitivity of the assay used.
[0128] The temperature-dependent reactivity of RMA-S L.sup.d with
2C TCR/Ig was significantly different than the reactivity of RMA-S
L.sup.d with mAb 30.5.7. As expected (Solheim et al., 1995; Solheim
et al., 1993), RMA-S L.sup.d cells expressed more serologically
reactive H-2 L.sup.d molecules recognized by mAb 30.5.7 on cells
cultured at 27.degree. C. than when cells were cultured at
37.degree. C. (FIG. 8A); mean channel fluorescence (MCF) increased
approximately 5-fold. Thus the epitope on H-2 L.sup.d molecules
recognized by mAb 30.5.7 can be stabilized by incubating cells at
low temperatures. In contrast, RMA-S L.sup.d cells expressed very
low amounts of H-2 L.sup.d molecules recognized by 2C TCR/Ig on
cells cultured at either 27.degree. C. or at 37.degree. C. (FIG. 8,
Panel E). This finding is consistent with the expected
peptide-dependent reactivity of 2C TCR/Ig which should not
recognize unloaded MHC, even when conformationally stabilized by
decreased temperature.
[0129] 2C TCR/Ig reactivity also showed exquisite peptide
specificity. As expected, all H-2 L.sup.d-binding peptides
stabilized expression of the epitope recognized by mAb 30.5.7 (FIG.
8, Panels B-D and FIG. 9). Only H-2 L.sup.d molecules loaded with
2C reactive peptides, peptides p2Ca, QL9, and SL9 expressed
peptide/H-2L.sup.d epitopes that reacted with 2C TCR/Ig (FIG. 8,
Panels F-H and FIG. 9). MCF increased approximately 10- to
200-fold, from a MCF of 10 for either unloaded cells or cells
loaded with an irrelevant H-2 L.sup.d binding peptide, to as high
as 2200 for RMA-S L.sup.d cells loaded with peptide QL9 (FIG. 9).
The pattern of reactivity mimicked the known affinities of
monovalent 2C TCR for peptide/H-2 L.sup.d complexes (see Table 3
for affinities). RMA-S L.sup.d cells loaded with peptide QL9, p2Ca,
or SL9 had MCF values of 2200, 550, and 100, respectively, when
stained with 2C TCR/Ig. Thus, soluble divalent 2C TCR/Ig chimeras
reacted strongly with QL9/H-2 L.sup.d complexes, modestly with
p2Ca/H-2 L.sup.d complexes, and weakly with SL9/H-2 L.sup.d
complexes. The fact that 2C TCR/Ig bound to SL9-loaded H-2 L.sup.d
molecules indicates, that even in a direct flow cytometry assay,
soluble divalent 2C TCR/Ig chimeras could be used to detect
specific peptide/MHC complexes that have affinities as weak as 71
.mu.M for monovalent 2C TCR.
Example 5
[0130] This example demonstrates inhibition of in vitro 2C T cell
mediated lysis by soluble divalent 2C TCR/Ig molecules.
[0131] Soluble divalent 2C TCR/Ig blocks 2C reactive T cell
responses. Since soluble divalent 2C TCR/Ig interacts with high
avidity with H-2 L.sup.d molecules loaded with the appropriate
peptides in the flow cytometry assay, we explored whether the
reagent could effectively inhibit 2C T cells in in vitro
cytotoxicity CTL assays. This was analyzed using a cell line
derived from 2C transgenic mice to lyse tumor target cells
expressing H-2 L.sup.d. CTL were tested in a routine 4 hour
.sup.51Cr cytotoxicity assay. Untransfected, MC57G, and L.sup.d
transfected, MC57G L.sup.d, cells were used as targets. The percent
specific lysis was determined as: .sup.51Cr cpm (experimental)-CPM
(spontaneous)/cpm (maximum)-cpm (spontaneous). Standard errors were
routinely less than 5% and spontaneous release was usually 10-15%
of maximal release.
[0132] Using both untransfected MC57G and L.sup.d transfected,
MC57G L.sup.d, we were able to establish a window of H-2L.sup.d
specific lysis mediated by the 2C CTL line. To test the influence
of 2C TCR/Ig, target cells were pretreated with either 2C TCR/Ig,
or I-E.sup.k/Ig and analyzed for lysis by the CTL cell line derived
from 2C transgenic mice. Significant inhibition of lysis was seen
at each effector to target cell ratio analyzed when cells were
treated with 2C TCR/Ig (see FIG. 10). While some non-specific
inhibition was seen in the I-E.sup.k/Ig treated target cells,
significantly more inhibition was seen in the 2C TCR/Ig treated
target cells.
[0133] In this assay, the target cells were normal tumor cells
which load their cell surface MHC molecules with a variety of
different endogenous peptides. Using these target cells, one does
not need to specifically load H-2 L.sup.d molecules with the p2Ca
peptide, since p2Ca or p2Ca-like peptides, together with a large
number of irrelevant peptides, are endogenously loaded onto
cellular MHC molecules. Inhibition of CTL-mediated lysis indicates
that soluble divalent 2C TCR/Ig can effectively interact with the
relevant peptides even within a milieu of a large number of
irrelevant peptides. Thus, this approach could be used to search
the universe of peptide/MHC complexes to identify only those
complexes relevant to specific T cell responses of interest. In
particular, these high avidity soluble analogs of heterodimeric
proteins may specifically be useful in identification of unknown
tumor and autoimmune antigens.
Example 6
[0134] This example demonstrates binding of soluble divalent TCR
chimeras to self restricted peptide/MHC complexes.
[0135] In addition to recognizing peptide/H-2 L.sup.d ligands, two
peptides, SIY and dEV-8, that sensitize either H-2 K.sup.b or H-2
K.sup.bm3 targets for lysis by 2C CTL have also been defined (see
Table 3 for sequences). To analyze the ability of 2C TCR/Ig to bind
to these alternate 2C-reactive complexes, the binding of 2C TCR/Ig
to peptide loaded transfected T2 cells was studied. Since T2 cells
are derived from a human cell line, T2 cells do not naturally
express H-2 K.sup.b as do RMA-S cells. Thus to study the binding of
2C TCR/Ig to peptide-loaded H-2 K.sup.b or various H-2 K.sup.bm
mutant molecules, the T2 system was chosen since it is not
complicated by the expression of MHC molecules from the parental
cell line. Similar to RMA-S L.sup.d cells, T2 cells also express
empty MHC molecules that can be readily loaded with different
peptides. For these studies peptide-loaded T2 cells transfected
with: H-2 K.sup.b, T2 K.sup.b; H-2 K.sup.bm3, T2 K.sup.bm3; and H-2
K.sup.bm11, T2 K.sup.bm11 were utilized. Tallquist et al., Journal
of Immunology 155:2419-2426 (1995); Tallquist et al., Journal of
Experimental Medicine 184:1017-1026 (1996).
[0136] Peptide SIY-loaded T2 K.sup.b or T2 K.sup.bm11 cells both
expressed epitopes recognized by 2C TCR/Ig (FIGS. 11A and 11C). MCF
of cells incubated with 2C TCR/Ig increased approximately 20 fold
from 14 for pVSV loaded- to 276 for SIY loaded-T2 K.sup.b and from
16 for pVSV loaded- to 250 for SIY-loaded T2 K.sup.bm11. SIY-loaded
T2 K.sup.bm3 cells showed a much weaker but still significant
interaction with 2C TCR/Ig (FIG. 11B); compare SIY-loaded (solid
lines; MCF, 36) to pVSV-loaded (dotted lines; MCF, 12) T2 K.sup.bm3
cells. The 2C TCR/Ig binding data to SIY/MHC complexes was
consistent with 2C CTL mediated lysis on various SIY/MHC targets
(FIG. 12). 2C CTL mediated efficient lysis of SIY loaded T2 K.sup.b
and T2 K.sup.bm11 cells (FIG. 12B and data not shown, LD50.about.10
ng/ml for SIY/T2 K.sup.b). 2C CTL mediated lysis of SIY loaded T2
K.sup.bm3 cells was significantly less efficient (FIG. 12C,
LD50.about.100 ng/ml).
[0137] The binding of 2C TCR/Ig to dFV-8 loaded cells revealed a
striking difference between the affinity of 2C TCR/Ig for dEV-8/MHC
complexes and the ability of that same peptide/MHC complex to
mediate lysis by 2C CTL. As expected, dEV-8 loaded T2 K.sup.b cells
were neither lysed by 2C CTL (FIG. 12B), nor were they recognized
by 2C TCR/Ig in flow cytometry assays (FIG. 12A). Interestingly, no
significant binding of 2C TCR/Ig could be found to dEV-8 loaded T2
K.sup.bm3 cells (FIG. 12B). MCF of cells stained with 2C TCR/Ig was
similar whether cells were loaded with either dEV-8 or a control
H-2 Kb-binding peptide, pVSV (FIG. 12; compare dotted to dashed
lines). This is most surprising in that, consistent with previous
reports (Tallquist et al., 1996), dEV-8 loaded T2 K.sup.bm3 cells
were efficiently lysed by 2C CTL (FIG. 12C). In fact, dEV-8 loaded
T2 K.sup.bm3 cells were much better target cells
(LD50.about.0.5-1.0 ng/ml), than SIY loaded T2 K.sup.bm3 cells
(LD50.about.100 ng/ml), where a significant binding of 2C TCR/Ig
was seen (FIG. 12B). The efficiency of lysis by 2C CTL of dEV-8
loaded T2 K.sup.bm3 cells, was on the same order of magnitude as
that of p2Ca-loaded T2 L.sup.d cells (FIG. 12A, LD50.about.0.5
ng/ml), which was also efficiently recognized in the 2C TCR/Ig
binding assay (FIG. 8). A similar, although significantly less
dramatic, lack of correlation between cytolysis and 2C TCR/Ig
binding was seen for dEV-8 loaded T2 K.sup.bm11 cells. dEV-8-loaded
T2 Kb.sup.m11 cells are relatively poor targets for 2C CTL
(Tallquist et al., 1996) (data not shown), but were also not
reactive with 2C TCR/Ig in flow cytometry assays (FIG. 11C).
Example 7
[0138] This example demonstrates analysis of the effects of
.gamma.-IFN on expression of endogenous 2C-specific peptide/MHC
complexes.
[0139] The specificity and affinity of 2C TCR/Ig for peptide/MHC
complexes suggested that one might be able to use this reagent to
probe the influence of lymphokines on endogenous, cell surface,
peptide/MHC complexes. To analyze this possibility and to follow
the expression of endogenous 2C-reactive peptide/H-2 L.sup.d
complexes within a heterogeneous peptide/MHC environment, the
influence of .gamma.-IFN on the H-2 L.sup.d-expressing murine cell
line RENCA was studied.
[0140] RENCA cells were cultured in the presence of variable
amounts of .gamma.-IFN to induce up-regulation of naturally loaded
peptide/MHC complexes. 2C TCR/Ig binding to RENCA cells increased
as a function of .gamma.-IFN induction (FIG. 13A-D, solid lines).
The effect of .gamma.-IFN was dose dependent with a maximal 2-3
fold increase seen on cells treated with 10 units/ml of
.gamma.-IFN. Since .gamma.-IFN is known to have a direct effect on
class I expression (FIG. 13E-H) (Hengel et al., Journal of Virology
68:289-297 (1994), it is necessary to normalize for any
non-specific 2C TCR/Ig binding secondary to increased expression of
H-2 L.sup.d. This was accomplished by incubating RENCA cells with a
control irrelevant H-2 L.sup.d-binding peptide, pMCMV.
[0141] Since p2Ca is known to have a weak affinity for H-2 L.sup.d
(Sykulev et al., Immunity 1:15-22 (1994a) exchange with a higher
affinity H-2 L.sup.d binding peptide like pMCMV (Sykulev et al.,
1994a) should be very efficient. Therefore, background reactivity
of 2C TCR/Ig could be determined by the efficient displacement of
endogenous p2Ca or p2Ca-like peptides by incubating the cells with
saturating amounts of the control pMCMV peptide. In all cases, 2C
TCR/Ig binding could be blocked by prior incubation of cells with
the control H-2 L.sup.d binding, pMCMV (FIGS. 13A-D, dotted lines).
Prior incubation of RENCA cells with a 2C specific peptide, QL9,
induced a dramatic increase in 2C TCR/Ig binding. The results of
these experiments indicate that 2C TCR/Ig can be used as a
sensitive probe to analyze cell surface expression of endogenous
2C-reactive peptide/MHC complexes.
[0142] The effect of .gamma.-IFN on 2C TCR/Ig reactivity was
distinct from its effects on 30.5.7 reactivity. At all
concentrations analyzed, 5-50 units/ml, .gamma.-IFN induced a 5-6
fold increase in serologically reactive H-2 L.sup.d, as recognized
by mAb 30.5.7 (FIG. 13E-H). MCF of unstimulated RENCA cells was
500, while the MCF of .gamma.-IFN stimulated cells was between 2666
and 3038. The maximal effect of .gamma.-IFN was seen at the lowest
dose used in the experiment presented, 5 units/ml, and in other
experiments was seen even at dose of .gamma.-IFN as low as 1
unit/ml.
[0143] Interestingly, the dose response curve of .gamma.-IFN on 2C
TCR/Ig reactivity was shifted. .gamma.-IFN at 5 units/ml had a
relatively small but significant effect on 2C TCR/Ig reactivity.
Maximal effects of .gamma.-IFN on 2C TCR/Ig reactivity required
.gamma.-IFN treatment at 10 units/ml, approximately ten-fold more
than needed for maximal effects of .gamma.-IFN on 30.5.7
reactivity. These results indicate a differential effect of
.gamma.-IFN on MHC heavy chain expression than that of .gamma.-IFN
on specific peptide antigen/MHC complex expression.
[0144] These results show that this approach is a general one for
producing soluble divalent versions of heterodimeric proteins.
Soluble divalent analogs of heterodimeric proteins of this
invention are characterized as having high avidity or affinity for
their target ligands. The same technology for generating soluble
divalent heterodimeric proteins can be used to develop other
molecular complexes, including both rodent and human class II HLA
molecules and .alpha./.beta. and .gamma./.delta. T cell
receptors.
Example 8
[0145] This example demonstrates peptide specificity of 2C
TCR/IgG.
[0146] To examine potential uses of TCR/IgG molecular complexes, we
analyzed the specificity and sensitivity of 2C TCR/Ig recognition
for peptide/MHC complexes. Initially, we compared the ability of 2C
TCR/IgG to detect specific peptide/MHC complexes using either 2C
TCR/IgG or the alloreactive L.sup.d-specific mAb, 30.5.7.
[0147] For these experiments, the 2C-reactive peptides, p2CA and
QL9, were loaded into L.sup.d molecules expressed on T2-L.sup.d
cells. These cells have a defect in the antigen processing pathway
and therefore express empty Ld molecules that serve as a source of
L.sup.d molecules that can be homogenously loaded peptides of
interest.
[0148] 2C TCR/IgG binds to peptide-loaded T2-L.sup.d cells in a
dose-dependent fashion similar to the binding of mAb 30.5.7 (FIG.
14). Mean channel florescence (MCF) of peptide-loaded cells stained
with 2C TCR2IgG increased from a value of 1 to 600 for p2CA loaded
cells and to approximately 2500 for QL9-loaded cells, as was
observed in previous reports (31, 32). MCF of cells stained with
30.5.7 increased from 500 to approximately 3000 for both p2CA and
QL9 loaded T2-L.sup.d cells. 2C TCR/Ig was as sensitive as mAb
30.5.7 in detecting peptide stabilized H2L.sup.d molecules on
T2L.sup.d cells. Even the lowest peptide concentration that
stabilized sufficient amounts of L.sup.d molecules for recognition
by 30.5.7, 0.1 nM QL9 and 1 nM p2CA, also stabilized sufficient
amounts of L.sup.d molecules for recognition by 2C TCR/IgG. Thus,
2C TCR/Ig was as sensitive as mAb 30.5.7 at recognizing specific
peptide/MHC complexes.
[0149] We next compared the ability to use soluble divalent 2C
TCR/IgG to soluble monovalent, 2C TCR in flow cytometry.
Previously, we had measured the "relative affinities" of these two
moieties for cognate peptide/MHC-complexes and had shown that the
divalent TCR displays an approximately 50 fold-enhancement in
"avidity." Binding of 2C TCR/IgG to QL9-loaded L.sup.d molecules
was very sensitive and could be detected even at the lowest
concentration tested, 1 nM (FIG. 15). In contrast, greater than 100
nM of soluble monovalent 2C TCR was required to detect binding to
QL9-loaded L.sup.d molecules.
[0150] The difference in "relative affinity" had an even more
dramatic impact on the ability to detect p2CA loaded Ld molecules.
Approximately, 3 nM of 2C TCR/IgG was required to detect
p2CA-loaded L.sup.d molecules. Even at the highest concentrations
tested, 3000 nM, soluble monovalent 2C TCR could not detect
p2CA-loaded L.sup.d molecules. L.sup.d molecules loaded with a
control peptide, MCMV, were not recognized at any concentration by
either soluble monovalent or divalent 2C TCR.
[0151] To further demonstrate the efficacy of 2C TCR/Ig in
analyzing pepMHC complexes, an array of p2Ca peptide variants bound
to L.sup.d were tested in the direct flow cytometry assay (Table 1,
FIGS. 16A-16D). As expected, QL9-loaded H-2L.sup.d expressing cells
had the highest MCF, .about.3000, when stained with 2C TCR/IgG,
while p2Ca elicited a signal approximately 10-fold lower (FIGS. 16A
and 16C).
[0152] Peptide specificity of 2C TCR/IgG was further demonstrated
by the differential binding of 2C TCR/Ig to L.sup.d molecules
loaded with p2Ca, and its peptide variants, A1-A5, A7, D1, L4 and
Y4, (FIGS. 16C and 16D). Specifically, peptide variants A1, A2, D1,
L4 and Y4 each stabilized the L.sup.d molecule were all recognized
to varying extents by 2C TCR/IgG. L.sup.d molecules loaded with
other peptide variants, A3, A4, A5, and A7, could not be detected
by 2C TCR/Ig, even though these peptides all stabilized L.sup.d as
measured by 30.5.7 binding. These data are similar to the
previously published data based on surface plasmon resonance (SPR)
(33).
[0153] Thus, there were no peptides detected by SPR that were not
also recognized by 2C TCR/IgG in the flow cytometry-based assay.
Together, these data indicate that 2C TCR/IgG is both a specific
and sensitive probe for cognate ligands.
Example 9
[0154] This example demonstrates that .sup.MCCI-E.sup.k/IgG binds
and activates a cognate T cell hybridoma.
[0155] To assess the interaction of soluble divalent I-E analogs
with antigen specific T cells, we determined whether
.sup.MCCI-E.sup.k/IgG could stain antigen specific T cell
hybridomas. .sup.MCCI-E.sup.k/IgG binds specifically to 5KC, a moth
cytochrome C (MCC)-specific, I-E.sup.k-restricted T cell hybridoma
(FIG. 17). Mean channel fluorescence of 5KC cells stained with
.sup.MCCI-E.sup.k/Ig increased approximate 15-fold, from 19 to 300.
Specific staining of 5KC cells was seen with as little as 5 nM of
.sup.MCCI-E.sup.k/Ig complexes. In contrast, .sup.MCCI-E.sup.k/Ig
complexes did not react with DO11.10, an irrelevant control T cell
hybridoma specific for ovalbumin peptide in the context of I-Ad
(FIG. 17), even though both 5KC and DO11.10 expressed the same
level of TCR.
[0156] The biological activity of .sup.MCCI-E.sup.k/IgG was further
assessed by comparing the ability of .sup.MCCI-E.sup.k/IgG and
anti-CD3 mAb to stimulate the antigen specific T cell hybridomas,
5KC and DO11.10. For these assays, proteins were immobilized on
plastic, and activation of 5KC or DO11.10 cells was assayed by
lymphokine secretion. Immobilized .sup.MCCI-E.sup.k/IgG stimulated
IL-2 production by 5KC but not DO11.10 (FIG. 18).
.sup.MCCI-E.sup.k/IgG stimulated 5KC to produce IL-2 at a level
comparable to or slightly better than did anti-CD3 mAb. At the
lowest concentration tested (92 ng/ml), approximately 10-fold
greater stimulation was achieved with .sup.MCCI-E.sup.k/IgG over
anti-CD3 mAb.
[0157] These results demonstrate that even when immobilized on a
plate, soluble divalent .sup.MCCI-E.sup.k/IgG retains its
specificity for its cell-surface cognate TCR and is as efficient at
activation of antigen-specific T cells as is anti-CD3 mAb.
NUMBERED REFERENCES
[0158] 1. Garcia, K. C., Degano, M., Pease, L. R., Huang, M.,
Peterson, P. A., Teyton, L., and Wilson, I. A. (1998) Science 279
(February 20), 1166-1172 [0159] 2. Garboczi, D. N., Ghosh, P., Utz,
U., Fan, Q. R., Biddison, W. E., and Wiley, D. C. (1996) Nature 384
(November 14), 134-141 [0160] 3. Garcia, K. C., Degano, M.,
Stanfield, R. L., Brunmark, A., Jackson, M. R., Peterson, P. A.,
Teyton, L., and Wilson, I. A. (1996) Science 274 (October 11),
209-219 [0161] 4. Traunecker, A., Dolder, B., Oliveri, F., and
Karjalainen, K. (1989) Immunology Today 10, 29-32 [0162] 5.
Slanetz, A., and Bothwell, A. L. M. (1991) Eur. J. Immunol. 21,
179-183 [0163] 6. Lin, A. Y., Devaux, B., Green, A., Sagerstrom,
C., Elliott, J. F., and Davis, M. M. (1990) Science 249, 677-679
[0164] 7. Wettstein, D. A., Boniface, J. J., Reay, P. A., Schild,
H., and Davis, M. M. (1991) Journal of Experimental Medicine 174,
219-228 [0165] 8. Weber, S., Traunecker, A., Oliveri, F., Gerhard,
W., and Karjalainen, K. (1992) Nature 356, 793-796 [0166] 9. Soo
Hoo, W. F., Lacy, M. J., Denzin, L. K., Voss Jr., E. W., Hardman,
K. D., and Kranz, D. M. (1992) Proc Natl Acad Sci. USA 89,
4759-4763 [0167] 10. Plaksin, D., Polakova, K., McPhie, P., and
Margulies, D. H. (1997) J. Immunol. 158, 2218-2227 [0168] 11.
Chang, H.-C., Bao, Z.-Z., Yao, Y., Tse, A. G. D., Coyarts, E. C.,
Madsen, M., Kawasaki, E., Brauer, P. P., Sacchettini, J. C.,
Nathenson, S. G., and Reinherz, E. L. (1994) Proc. Natl. Acad. Sci.
USA 91, 11408-11412 [0169] 12. Kalandadze, A., Galleno, M.,
Foncerrada, L., Strominger, J. L., and Wucherpfennig, K. W. (1996)
Biol. Chem. 271(3), 20156-20162 [0170] 13. Scott, C. A., Garcia, K.
C., Carbone, F. R., Wilson, I. A., and Teyton, L. (1996) Journal of
Experimental Medicine 183 (May), 2087-2095 [0171] 14. Arimilli, S.,
Cardoso, C., Mukku, P., Baichwal, V., and Nag, B. (1995) J. Biol.
Chem. 270(2), 971-977 [0172] 15. Altman, J. D., Reay, P. A., and
Davis, M. M. (1993) Proc. Natl. Acad. Sci. USA 90 (November),
10330-10334 [0173] 16. Dal Porto, J., Johansen, T. E., Catipovic,
B., Parfitt, D. J., Tuveson, D., Gether, U., Kozlowski, S., Fearon,
D., and Schneck, J. P. (1993) Proc. Natl. Acad. Sci. USA 90,
6671-6675 [0174] 17. O'Herrrin, S. M., Lebowitz, M. S., Bieler, J.
G., al-Ramadi, B. K., Utz, U., and Bothwell, A. L. M. (1997) J.
Exp. Med. 186(8), 1333-1345 [0175] 18. Altman, J. D., Moss, P. A.
H., Goulder, P. J. R., Barouch, D. H., McHeyzer-Williams, M. G.,
Bell, J. I., McMichael, A. J., and Davis, M. M. (1996) Science 274
(October 4), 94-96 [0176] 19. Murali-Krishna, K., Altman, J. D.,
Suresh, M., Sourdive, D. J. D., Zajac, A. J., Miller, J. D.,
Slansky, J., and Ahmed, R. (1998) Immunity 8 (February), 177-187
[0177] 20. Haseman, C. A., and Capra, J. D. (1990) Proc. Natl.
Acad. Sci. USA 87, 3942-3946 [0178] 21. Kozono, H., White, J.,
Clements, J., Magrrack, P., and Kappler, J. (1994) Nature 369,
151-154 [0179] 22. Finkel, T. H., Marrack, P., Kappler, J. W.,
Kubo, R. T., and Cambier, J. C. (1989) J Immunol 142, 3006-3012
[0180] 23. Brodnicki, T. C., Holman, P 0, and Kranz, D. M. (1996)
Molecular Immunology 33(3), 253-263 [0181] 24. Kranz, D. M.,
Sherman, D. H., Sitkovsky, M. V., Pasternack, M. S., and Eisen, H.
N. (1984) Proc. Natl. Acad. Sci. USA 81 (January), 573-577 [0182]
25. Catipovic, B., Dal Porto, J., Mage, M., Johansen, T. E., and
Schneck, J. P. (1992) Journal of Experimental Medicine 176,
1611-1618 [0183] 26. Hebell, T., Ahearn, J. M., and Fearon, D. T.
(1991) Science 254, 102-105 [0184] 27. Lenschow, D. J., Zeng, Y.,
Thistlehwaite, J. R., Montag, A., Brady, W., Gibson, M. G.,
Linsley, P. S., and Bluestone, J. A. (1992) Science 257, 789-791
[0185] 28. Finck, B. K., Linsley, P. S., and Wofsy, D. (1994)
Science 265, 1225-1227 [0186] 29. Udaka, K., Tsomides, T. J., and
Eisen, H. N. (1992) Cell 69, 989-998 [0187] 30. Schwartz, R. H.
(1985) Ann Rev Immunol 3 237-261 [0188] 31. Sykulev, Y., Brunmark,
A., Jackson, M., Cohen, R. J., Peterson, P. A., and Eisen, H. N.
(1994) Immunity 1 (April), 15-22 [0189] 32. Sykulev, T., Brunmark,
A., Tsomides, T. J., Kageyama, S., Jackson, M., Peterson, P. A.,
and Eisen, H. N. (1994) Proc. Natl. Acad. Sci. USA 91, 11487-11491
[0190] 33. Al-Ramadi, B. K., Jelonek, M. T., Boyd, L. F.,
Margulies, D. H., and Bothwell, A. L. M. (1995) The Journal of
Immunology 155, 662-673 [0191] 34. Matsui, K., Boniface, J. J.,
Beay, P., Schild, H., De St. Groth, B. F., and Davis, M. M. (1991)
Science 254, 1788-1791 [0192] 35. Lyons, D. S., Lieberman, S. A.,
Hampl, J., Boniface, J. J., Chien, Y.-h., Berg, L. J., and Davis,
M. M. (1996) Immunity 5, 53-61 [0193] 36. Froscher, B. G., and
Klinman, N. R. (1986) J Exp Med 164, 196-210 [0194] 37. Wylie, D.
E., Sherman, L. A., and Klinman, N. R. (1982) Journal of
Experimental Medicine 155 (February), 403-414 [0195] 38. Leeuwen,
A. v., Goulmy, E., and Rood, J. J. v. (1979 Journal of Experimental
Medicine 150, 1075-1083 [0196] 39. Madden, D. R., Garboczi, D. N.,
and Wiley, D. C. (1993) Cell 75, 693-708 [0197] 40. Fremont, D. H.,
Matsumura, M., Sture, E. A., Peterson, P. A., and Wilson, I. A.
(1992) Science 257, 919-927 [0198] 41. Bluestone, J. A., Jameson,
S., Miller, S., and Dick, R. (1992) Journal of Experimental
Medicine 176, 1757-1761 [0199] 42. Andersen, P. S., Stryhn, A.,
Hansen, B. E., Fugger, L., Engberg, J., and Buus, S. (1996) Proc.
Natl. Acad. Sci. USA 193 93 (March), 1820-1824 [0200] 43. Porgador,
A., Yewdell, J. W., Deng, Y., Bennink, J. R., and Germain, R. N.
(1997) Immunity 6 (June), 715-726 [0201] 44. Dadaglio, G., Nelson,
C. A., Deck, M. B., Petzold, S. J., and Unanue, E. R. (1997)
Immunity 6 (June), 727-738
Sequence CWU 1
1
20165DNAArtificial Sequenceoligonucleotide for introducing
mutations 1ctgtcagtaa ctgcaggtgt ccactctggt accagcggtg aggttcagct
tcagcagtct 60ggagc 65260DNAArtificial Sequenceoligonucleotide for
introducing mutations 2agcctctccc actctcctgg taaatgagca tgctctcagt
gtccttggag ccctctggtc 60374DNAArtificial Sequenceoligonucleotide
for introducing mutations 3ctgttgctct gttttcaagg taccaggtgt
ggaagcttgg gaggatctga tatccagatg 60acgcaaatcc atcc
74466DNAArtificial Sequenceantigenic peptideoligonucleotide for
introducing mutations 4gtcaagagct tcaacaggaa tgagtgttag ggtaccagac
aaaggtcctg agacgccacc 60accagc 66558DNAArtificial
Sequenceoligonucleotide for introducing mutations 5cagatatgaa
cctaaacttt caaggaggag gtacctgtca gttatgggac tccgaatc
58650DNAArtificial Sequenceoligonucleotide for introducing
mutations 6ccaaagagac cagtatcctg actcgaggaa gcatgtctaa cactgccttc
50769DNAArtificial Sequenceoligonucleotide for introducing
mutations 7ctgcaaccat cctctatgag atcggaagct taggatctgg tacctactgg
ggaaggccac 60cctatatgc 69863DNAArtificial Sequenceoligonucleotide
for introducing mutations 8ggtagcgacc ggcgctcagc tggaattcaa
gcttccattc tctttagttt ctgggaggag 60ggt 63969DNAArtificial
Sequenceoligonucleotide for introducing mutations 9gcacagtcca
catctgcaca gaacaaggga ggaggtaccg gggatccggt tattagtaca 60tttattaag
69106PRTArtificial Sequencelinker 10Gly Gly Gly Thr Ser Gly1
5116PRTArtificial Sequencelinker 11Gly Ser Leu Gly Gly Ser1
5128PRTArtificial Sequenceantigenic peptide 12Leu Ser Pro Phe Pro
Phe Asp Leu1 5139PRTArtificial Sequenceantigenic peptide 13Gln Leu
Ser Pro Phe Pro Phe Asp Leu1 5149PRTArtificial Sequenceantigenic
peptide 14Leu Ser Pro Phe Pro Phe Asp Leu Leu1 5159PRTArtificial
Sequenceantigenic peptide 15Thr Gln Asn His Arg Ala Leu Asp Leu1
5169PRTArtificial Sequenceantigenic peptide 16Tyr Pro His Phe Met
Pro Thr Asn Leu1 5179PRTArtificial Sequenceantigenic peptide 17Ser
Pro Ser Tyr Val Tyr His Gln Phe1 5188PRTArtificial
Sequenceantigenic peptide 18Glu Gln Tyr Lys Phe Tyr Ser Val1
5198PRTArtificial Sequenceantigenic peptide 19Ser Ile Tyr Arg Tyr
Tyr Gly Leu1 5208PRTArtificial Sequenceantigenic peptide 20Arg Gly
Tyr Val Tyr Gln Gly Leu1 5
* * * * *