U.S. patent application number 13/276333 was filed with the patent office on 2012-05-31 for methods and compositions for improved fertilization and embryonic survival.
This patent application is currently assigned to Wisconsin Alumni Research Foundation. Invention is credited to Hasan Khatib.
Application Number | 20120135889 13/276333 |
Document ID | / |
Family ID | 41018478 |
Filed Date | 2012-05-31 |
United States Patent
Application |
20120135889 |
Kind Code |
A1 |
Khatib; Hasan |
May 31, 2012 |
METHODS AND COMPOSITIONS FOR IMPROVED FERTILIZATION AND EMBRYONIC
SURVIVAL
Abstract
Single nucleotide polymorphic site at position 11646 of the
bovine FGF2 gene is associated with improved fertilization rate
and/or improved embryo survival rate, as well as improved milk
production. Also disclosed are nucleic acid molecules, kits,
methods of genotyping and marker assisted bovine breeding
methods.
Inventors: |
Khatib; Hasan; (Madison,
WI) |
Assignee: |
Wisconsin Alumni Research
Foundation
Madison
WI
|
Family ID: |
41018478 |
Appl. No.: |
13/276333 |
Filed: |
October 19, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12424796 |
Apr 16, 2009 |
8067171 |
|
|
13276333 |
|
|
|
|
61046253 |
Apr 18, 2008 |
|
|
|
Current U.S.
Class: |
506/16 ;
536/24.3 |
Current CPC
Class: |
C12Q 1/6883 20130101;
C12Q 1/6888 20130101; C12Q 2600/156 20130101 |
Class at
Publication: |
506/16 ;
536/24.3 |
International
Class: |
C40B 40/06 20060101
C40B040/06; C07H 21/04 20060101 C07H021/04 |
Goverment Interests
STATEMENT OF GOVERNMENT INTEREST
[0002] This invention was made with United States government
support awarded by the USDA under grant nos. USDA/CSREES
09-CRHF-O-6055 and 07-CRHF-O-6055. The United States government has
certain rights in this invention.
Claims
1. An isolated nucleic acid molecule comprising position 1326 of
SEQ ID NO: 1, and at least 8 contiguous nucleotides of SEQ ID NO: 1
adjacent to position 1326 of SEQ ID No:1, wherein position 1326 of
SEQ ID No:1 is a guanine.
2. A nucleic acid molecule according to claim 1, which comprises at
least 15 contiguous nucleotides of SEQ ID NO: 1 adjacent to
position 1326 of SEQ ID No:1.
3. A nucleic acid molecule according to claim 1, which comprises at
least 20 contiguous nucleotides of SEQ ID NO: 1 adjacent position
1326 of SEQ ID No: 1.
4. An isolated nucleic acid molecule according to claim 1, which
comprises not more than 150 nucleotides.
5. An isolated nucleic acid molecule according to claim 1, which
comprises not more than 100 nucleotides.
6. An isolated nucleic acid molecule according to claim 1, which
comprises not more than 50 nucleotides.
7. A nucleic acid molecule according to claim 1, wherein position
1326 of SEQ ID No:1 is within 4 nucleotides of the center of the
nucleic acid molecule.
8. A nucleic acid molecule according to claim 7, wherein position
1326 of SEQ ID No:1 is at the center of the nucleic acid
molecule.
9. A nucleic acid molecule according to claim 1, wherein position
1326 of SEQ ID No:1 is at the 3'-end of the nucleic acid
molecule.
10. An array of nucleic acid molecules comprising at least two
nucleic acid molecules according to claim 1.
11. A kit comprising a nucleic acid molecule of claim 1, and a
suitable container.
12-25. (canceled)
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This is a divisional application of U.S. application Ser.
No. 12/424,796 filed on Apr. 16, 2009 claiming priority to U.S.
Patent Application No. 61/046,253, filed on Apr. 18, 2008, the
entire disclosure of which is incorporated herein by reference.
FIELD OF THE INVENTION
[0003] The present invention relates to a method of genetic testing
for improved embryonic survival rate and mild production traits in
cattle.
BACKGROUND OF THE INVENTION
[0004] At present, a major challenge of genomic and genetic studies
in livestock species is the identification and mapping of
individual quantitative trait loci (QTL) and quantitative trait
genes (QTG) that control agricultural traits. Candidate genes are
typically chosen based on the results of previous linkage mapping
studies and on comparative biological or physiological functions in
other species (Rothschild and Soller, 1997). A review of recent
publications shows that many QTL have been mapped for traits of
economical importance in dairy cattle (see e.g. Khatkar et al.,
2004). However, despite the large number of QTL studies in cattle
and other species, little progress has been made on the
identification of major genes affecting milk production, fertility
and health traits in dairy cattle. One major limitation when
choosing a candidate gene is the large number of provisional genes
present in most QTL regions.
[0005] Reproductive performance in high-producing dairy cows is
currently suboptimal and continues to decline as characterized by
low fertilization rates and reduced embryonic survival (Moore and
Thatcher, 2006). The decrease in fertility in dairy cattle is a
worldwide problem. In the U.S.A., the first-service conception rate
has been decreasing for many years with an estimated decline of
0.45% per year over a 20-year period (Butler and Smith, 1989). Lucy
(2001) estimated that the first-service conception rate had
declined from about 65% in 1951 to 40% in 1996. In the U.K., the
conception rate is declining at about 1% per year, and at
first-service it is currently lower than 40% (Royal et al., 2000).
The reasons for the reduced reproductive efficiency are manifold,
but it seems likely that there are substantial genetic effects
contributing to this infertility, despite the low heritability of
most fertility traits (VeerKamp and Beerda, 2007). Shook (2006)
estimated that genetics account for about one-third of the decrease
in daughter pregnancy rates.
[0006] Despite the large number of quantitative trait loci studies
in cattle and other species, little progress has been made on the
identification of major genes affecting reproduction traits
(Veerkamp and Beerda, 2007). The present inventors previously have
identified single nucleotide polymorphisms (SNPs) that may be used
to predict improved fertility in dairy cattle, including those
located in the signal transducer and activator 5A (STATA), known to
play an important role in cytokine signaling pathways. See e.g.
Khatib et al., 2008.
[0007] Such major genes would facilitate genetic testing of bulls
that enable quick and accurate evaluation of its fertility and the
survival rate of embryos conceived from these bulls. Genetic
testing of the bulls to determine their fertility and embryo
survival rate can lower the high cost of the traditional, progeny
testing methods, by by-passing the need to produce live birth.
[0008] In addition, identification of major genes that affect
reproduction traits can facilitate marker-assisted selection, which
can lower the high cost of progeny testing currently used to
improve sires. With marker-assisted selection, young bull progeny
could be evaluated immediately after birth or even before birth,
and those young bulls that are determined by genetic testing to
have undesirable markers would never be progeny tested, for the
presence/absence of the marker.
[0009] The present disclosure provides such a genetic marker that
can be used for genetic testing and for marker-assisted selection
process.
SUMMARY OF THE INVENTION
[0010] The present inventor recognized the role of the fibroblast
growth factor 2 (FGF2) gene in regulating trophectoderm expression
of interferon-tau (IFNT), the maternal pregnancy recognition factor
in ruminants (Ocon-Grove et al., 2007; Michael et al., 2006), and
chose FGF2 to test for association with embryonic survival and
fertilization rate. Bovine FGF2 has been mapped to chromosome 17,
with 3 exons and a total length of over 55 kb. Also, it is
expressed by the endometrium throughout the estrous cycle and early
pregnancy (Michael et al., 2006).
[0011] The present inventor used the pooled DNA sequencing approach
to identify SNPs in FGF2. Sequencing of a total of 6.4 kb including
3 exons of the gene revealed only one SNP (A/G): in intron 1 at
position 11646. This position is hereinafter referred to as the
"polymorphic site." This SNP, referred to as SNP11646, was
investigated for association with production traits in individuals
from Holstein populations: the granddaughter-design CDDR and the
daughter-design UW populations from the U.S.A. FGF2 variants were
found to associate with fat yield and percentage, Somatic cell
score (SCS), and productive life with significant dominance and
complete dominance effects. For the CDDR population, no significant
associations were observed for the examined traits. Given that FGF2
was chosen for this study because of its role in the INFT signal
transduction pathway and was found to be associated with production
traits, the results suggest that the candidate pathway could be an
attractive strategy to search for candidate quantitative trait
genes.
[0012] The effect of FGF2 on fertility was also investigated.
Specifically, in vitro fertilized embryos were produced from 281
Holstein cows and from 7 sires. A total of 4,542 in vitro
fertilizations were performed, from which a total of 3,171 embryos
were produced. Survival and fertilization rates were assessed at
Day 7 of embryonic development. Using the pooled DNA sequencing
approach, 2 SNPs were identified in FGF2, SNP11646 and SNP23. All
sires and cows were genotyped for these SNPs, and SNP11646 was
found to have a significant effect on survival rate. The survival
rate of embryos produced from GG cows for this SNP was 37% vs. 28%
and 29% for embryos produced from AG and AA cows, respectively.
This disclosure provides the first evidence of association between
FGF2 and embryonic mortality in cattle.
[0013] Based on the results summarized above, the present invention
provides an isolated nucleic acid molecule comprising at least one
polymorphic site selected from the group consisting of position of
SEQ ID NO: 1 (the bovine FGF2 gene), and at least 8, 9, 10, 11, 12,
13, 14, 15, 16 or 17 contiguous nucleotides or bases of SEQ ID NO:
1 adjacent to the polymorphic site, wherein the nucleic acid
molecule comprises a guanine at position 11646. It is recognized
that SEQ ID NO: 1, wherein position 1326 is an A nucleotide, is
already known, and the nucleic acid molecule therefore does not
encompass one that consists of SEQ ID NO: 1 where position 1326 is
an A nucleotide.
[0014] Preferably, the nucleic acid molecule which comprises at
least 15, more preferably at least 20, still more preferably at
least 25, contiguous bases of SEQ ID NO: 1 adjacent to the
polymorphic site. In one embodiment, the isolated nucleic acid
molecule comprises not more than 1,500 nt, preferably not more than
1000 nt, more preferably not more than 900 nt, more preferably not
more than 800 nt, more preferably not more than 700 nt, preferably
not more than 600 nt, more preferably not more than 500 nt,
preferably not more than 400 nt, more preferably not more than 300
nt, more preferably not more than 150 nt., preferably not more than
100 nt., still more preferably not more than 50 nt.
[0015] The nucleic acid molecule preferably contains the
polymorphic site which is within 4 nucleotides of the center of the
nucleic acid molecule. Preferably, the polymorphic site is at the
center of the nucleic acid molecule.
[0016] In another embodiment, the nucleic acid molecule contains
the polymorphic site which is at the 3'-end of the nucleic acid
molecule.
[0017] In another embodiment, the nucleic acid molecule contains
the polymorphic site which is at the 5'-end of the nucleic acid
molecule.
[0018] The present invention also provides an array of nucleic acid
molecules comprising at least two nucleic acid molecules described
above.
[0019] The present invention further provides a kit comprising a
nucleic acid molecule described above, and a suitable
container.
[0020] Also provided is a method for detecting SNPs in a bovine
FGF2 gene, wherein the FGF2 gene has a nucleic acid sequence of SEQ
ID NO: 1, the method comprising determining the identity of a
nucleotide at position 11646, and comparing the identity to the
nucleotide identity at a corresponding position of SEQ ID NO:
1.
[0021] In another embodiment, the present invention provides a
method for genotyping a bovine cell, using the method above.
Suitable bovine cell may be an adult cell, an embryo cell, a sperm,
an egg, a fertilized egg, or a zygote. The identity of the
nucleotide may be determined by sequencing the FGF2 gene, or a
relevant fragment thereof, isolated from the cell.
[0022] In a further embodiment, the present invention provides a
method for testing the fertility of a bull cattle, the method
comprising collecting a nucleic acid sample from the cattle, and
genotyping said nucleic sample as described above, wherein a bull
having a FGF2 gene sequence which comprises a guanine at position
11646 is selected for breeding purposes.
[0023] Preferably, a bull having a FGF2 gene sequence which is
homozygous at the above described polymorphic site is selected for
breeding purposes.
[0024] Preferably, a bull having a FGF2 gene sequence which
comprises a guanine at position 11646 is selected for breeding
purposes.
[0025] Preferably, a bull having a FGF2 gene sequence which is
homozygously G at position 11646 is selected for breeding
purposes.
[0026] Further provided is a method for selectively breeding of
cattle using a multiple ovulation and embryo transfer procedure
(MOET), the method comprising superovulating a female animal,
collecting eggs from said superovulated female, in vitro
fertilizing said eggs from a suitable male animal, implanting said
fertilized eggs into other females allowing for an embryo to
develop, genotyping the developing embryo, and terminating
pregnancy if the developing embryo does not have guanine (C) at
position 11646. Preferably, pregnancy is terminated if the embryo
is not homozygously G at position 11646.
[0027] In a preferred embodiment, the present invention provides a
method for selectively breeding dairy cattles, comprising selecting
a bull whose FGF2 gene is hemizygously or homozygously guanine at
position 11646, and using its semen for fertilizing a female
animal. Preferably the bull is homozygous with regard to the above
SNP site. More preferably, the female animal is also homozygous at
the above SNP site.
DESCRIPTION OF THE DRAWINGS
[0028] FIG. 1 shows the FGF2 gene sequence (SEQ ID NO: 1) where the
polymorphic site at position 11646 is shown as shaded and bold.
DETAILED DESCRIPTION OF THE INVENTION
[0029] It has been found at least two positions of the bovine FGF2
gene are polymorphic. The term "polymorphism" as used herein refers
to the occurrence of two or more alternative genomic sequences or
alleles between or among different genomes or individuals.
[0030] "Polymorphic" refers to the condition in which two or more
variants of a specific genomic sequence can be found in a
population. A "polymorphic site" is the locus at which the
variation occurs. Polymorphisms generally have at least two
alleles, each occurring at a significant frequency in a selected
population. A polymorphic locus may be as small as one base pair.
The first identified allelic form is arbitrarily designated as the
reference form, and other allelic forms are designated as
alternative or variant alleles. The allelic form occurring most
frequently in a selected population is sometimes referred to as the
wild type form. Diploid organisms may be homozygous or heterozygous
for allelic forms. A biallelic polymorphism has two forms, and a
triallelic polymorphism has three forms, and so on.
[0031] Polymorphisms may provide functional differences in the
genetic sequence, through changes in the encoded polypeptide,
changes in mRNA stability, binding of transcriptional and
translation factors to the DNA or RNA, and the like. Polymorphisms
are also used to detect genetic linkage to phenotypic
variation.
[0032] One type of polymorphism, single nucleotide polymorphisms
(SNPs), has gained wide use for the detection of genetic linkage
recently. SNPs are generally biallelic systems, that is, there are
two alleles that an individual may have for any particular SNP
marker. In the instant case, the SNPs are used for determining the
genotypes of the FGF2 gene, which are found to have strong
correlation to embryonic mortality rate.
[0033] It is to be understood that any nucleic sequence provided
herein also encompasses the complementary sequence corresponding
thereto. In order to provide an unambiguous identification of the
specific site of a polymorphism, the numbering of the original FGF2
sequence in the GenBank is shown in FIG. 1 and is used throughout
this disclosure.
[0034] The present invention provides nucleic acid based genetic
markers for identifying bovine animals with superior breeding (such
as fertility and embryo survival rates) traits. In general, for use
as markers, nucleic acid fragments, preferably DNA fragments, may
be as short as 7 nucleotides (nt), but may preferably be at least
12 nt, 15 nt, usually at least 20 nt, often at least 50 nt. Such
small DNA fragments are useful as primers for the polymerase chain
reaction (PCR), and probes for hybridization screening, etc.
[0035] The term primer refers to a single-stranded oligonucleotide
capable of acting as a point of initiation of template-directed DNA
synthesis under appropriate conditions (i.e., in the presence of
four different nucleoside triphosphates and an agent for
polymerization, such as, DNA or RNA polymerase or reverse
transcriptase) in an appropriate buffer and at a suitable
temperature. The appropriate length of a primer depends on the
intended use of the primer but typically ranges from 15 to 30 nt.
Short primer molecules generally require cooler temperatures to
form sufficiently stable hybrid complexes with the template. A
primer need not reflect the exact sequence of the template but must
be sufficiently complementary to hybridize with a template. The
term primer site, or priming site, refers to the area of the target
DNA to which a primer hybridizes. The term primer pair means a set
of primers including a 5' upstream primer that hybridizes with the
5' end of the DNA sequence to be amplified and a 3', downstream
primer that hybridizes with the complement of the 3' end of the
sequence to be amplified.
[0036] The term "probe" or "hybridization probe" denotes a defined
nucleic acid segment (or nucleotide analog segment) which can be
used to identify by hybridizing to a specific polynucleotide
sequence present in samples, said nucleic acid segment comprising a
nucleotide sequence complementary of the specific polynucleotide
sequence to be identified. "Probes" or "hybridization probes" are
nucleic acids capable of binding in a base-specific manner to a
complementary strand of nucleic acid.
[0037] An objective of the present invention is to determine which
embodiment of the polymorphisms a specific sample of DNA has. For
example, it is desirable to determine whether the nucleotide at a
particular position is A or G. An oligonucleotide probe can be used
for such purpose. Preferably, the oligonucleotide probe will have a
detectable label, and contains an A at the corresponding position.
Experimental conditions can be chosen such that if the sample DNA
contains an A, they hybridization signal can be detected because
the probe hybridizes to the corresponding complementary DNA strand
in the sample, while if the sample DNA contains a G, no
hybridization signal is detected.
[0038] Similarly, PCR primers and conditions can be devised,
whereby the oligonucleotide is used as one of the PCR primers, for
analyzing nucleic acids for the presence of a specific sequence.
These may be direct amplification of the genomic DNA, or RT-PCR
amplification of the mRNA transcript of the FGF2 gene, or a
suitable fragment thereof. The use of the polymerase chain reaction
is described in Saiki et al. (1985) Science 230:1350-1354.
Amplification may be used to determine whether a polymorphism is
present, by using a primer that is specific for the polymorphism.
Alternatively, various methods are known in the art that utilize
oligonucleotide ligation as a means of detecting polymorphisms, for
examples see Riley et al (1990) Nucleic Acids Res. 18:2887-2890;
and Delahunty et al (1996) Am. J. Hum. Genet. 58:1239-1246. The
detection method may also be based on direct DNA sequencing, or
hybridization, or a combination thereof. Where large amounts of DNA
are available, genomic DNA is used directly. Alternatively, the
region of interest is cloned into a suitable vector and grown in
sufficient quantity for analysis. The nucleic acid may be amplified
by PCR, to provide sufficient amounts for analysis.
[0039] Hybridization may be performed in solution, or such
hybridization may be performed when either the oligonucleotide
probe or the target polynucleotide is covalently or noncovalently
affixed to a solid support. Attachment may be mediated, for
example, by antibody-antigen interactions, poly-L-Lys, streptavidin
or avidin-biotin, salt bridges, hydrophobic interactions, chemical
linkages, UV cross-linking baking, etc. Oligonucleotides may be
synthesized directly on the solid support or attached to the solid
support subsequent to synthesis. Solid-supports suitable for use in
detection methods of the invention include substrates made of
silicon, glass, plastic, paper and the like, which may be formed,
for example, into wells (as in 96-well plates), slides, sheets,
membranes, fibers, chips, dishes, and beads. The solid support may
be treated, coated or derivatized to facilitate the immobilization
of the allele-specific oligonucleotide or target nucleic acid. For
screening purposes, hybridization probes of the polymorphic
sequences may be used where both forms are present, either in
separate reactions, spatially separated on a solid phase matrix, or
labeled such that they can be distinguished from each other.
[0040] Hybridization may also be performed with nucleic acid arrays
and subarrays such as described in WO 95/11995. The arrays would
contain a battery of allele-specific oligonucleotides representing
each of the polymorphic sites. One or both polymorphic forms may be
present in the array, for example the polymorphism of position
11646 of the FGF2 gene may be represented by either, or both, of
the listed nucleotides. Usually such an array will include at least
2 different polymorphic sequences, i.e. polymorphisms located at
unique positions within the locus. Arrays of interest may further
comprise sequences, including polymorphisms, of other genetic
sequences, particularly other sequences of interest. The
oligonucleotide sequence on the array will usually be at least
about 12 nt in length, may be the length of the provided
polymorphic sequences, or may extend into the flanking regions to
generate fragments of 100 to 200 nt in length. For examples of
arrays, see Ramsay (1998) Nat. Biotech. 16:4044; Hacia et al.
(1996) Nature Genetics 14:441-447; Lockhart et al. (1996) Nature
Biotechnol. 14:1675-1680; and De Risi et al. (1996) Nature Genetics
14:457-460.
[0041] The identity of polymorphisms may also be determined using a
mismatch detection technique, including but not limited to the
RNase protection method using riboprobes (Winter et al., Proc.
Natl. Acad. Sci. USA 82:7575, 1985; Meyers et al., Science
230:1242, 1985) and proteins which recognize nucleotide mismatches,
such as the E. coli mutS protein (Modrich, P. Ann. Rev. Genet.
25:229-253, 1991). Alternatively, variant alleles can be identified
by single strand conformation polymorphism (SSCP) analysis (Orita
et al., Genomics 5:874-879, 1989; Humphries et al., in Molecular
Diagnosis of Genetic Diseases, R. Elles, ed., pp. 321-340, 1996) or
denaturing gradient gel electrophoresis (DGGE) (Wartell et al.,
Nucl. Acids Res. 18:2699-2706, 1990; Sheffield et al., Proc. Natl.
Acad. Sci. USA 86:232-236, 1989).
[0042] A polymerase-mediated primer extension method may also be
used to identify the polymorphism(s). Several such methods have
been described in the patent and scientific literature and include
the "Genetic Bit Analysis" method (WO92/15712) and the
ligase/polymerase mediated genetic bit analysis (U.S. Pat. No.
5,679,524). Related methods are disclosed in WO91/02087,
WO90/09455, WO95/17676, U.S. Pat. Nos. 5,302,509, and 5,945,283.
Extended primers containing a polymorphism may be detected by mass
spectrometry as described in U.S. Pat. No. 5,605,798. Another
primer extension method is allele-specific PCR (Ruao et al., Nucl.
Acids Res. 17:8392, 1989; Ruao et al., Nucl. Acids Res. 19,
6877-6882, 1991; WO 93/22456; Turki et al., J. Clin. Invest.
95:1635-1641, 1995). In addition, multiple polymorphic sites may be
investigated by simultaneously amplifying multiple regions of the
nucleic acid using sets of allele-specific primers as described in
Wallace et al. (WO 89/10414).
[0043] A detectable label may be included in an amplification
reaction. Suitable labels include fluorochromes, e.g. fluorescein
isothiocyanate (FITC), rhodamine, Texas Red, phycoerythrin,
allophycocyanin, 6-carboxyfluorescein (6-FAM),
2',7'-dimethoxy-4',5'-dichloro-6-carboxyfluorescein (JOE),
6-carboxy-X-rhodamine (ROX),
6-carboxy-2',4',7',4,7-hexachlorofluorescein (HEX),
5-carboxyfluorescein (5-FAM) or
N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA), radioactive
labels, e.g. .sup.32P, .sup.35S, .sup.3H; etc. The label may be a
two stage system, where the amplified DNA is conjugated to biotin,
haptens, etc. having a high affinity binding partner, e.g. avidin,
specific antibodies, etc., where the binding partner is conjugated
to a detectable label. The label may be conjugated to one or both
of the primers. Alternatively, the pool of nucleotides used in the
amplification is labeled, so as to incorporate the label into the
amplification product.
[0044] It is readily recognized by those ordinarily skilled in the
art that in order to maximize the signal to noise ratio, in probe
hybridization detection procedure, the polymorphic site should at
the center of the probe fragment used, whereby a mismatch has a
maximum effect on destabilizing the hybrid molecule; and in a PCR
detection procedure, the polymorphic site should be placed at the
very 3'-end of the primer, whereby a mismatch has the maximum
effect on preventing a chain elongation reaction by the DNA
polymerase. The location of nucleotides in a polynucleotide with
respect to the center of the polynucleotide are described herein in
the following manner. When a polynucleotide has an odd number of
nucleotides, the nucleotide at an equal distance from the 3' and 5'
ends of the polynucleotide is considered to be "at the center" of
the polynucleotide, and any nucleotide immediately adjacent to the
nucleotide at the center, or the nucleotide at the center itself is
considered to be "within 1 nucleotide of the center." With an odd
number of nucleotides in a polynucleotide any of the five
nucleotides positions in the middle of the polynucleotide would be
considered to be within 2 nucleotides of the center, and so on.
When a polynucleotide has an even number of nucleotides, there
would be a bond and not a nucleotide at the center of the
polynucleotide. Thus, either of the two central nucleotides would
be considered to be "within 1 nucleotide of the center" and any of
the four nucleotides in the middle of the polynucleotide would be
considered to be "within 2 nucleotides of the center," and so
on.
[0045] In some embodiments, a composition contains two or more
differently labeled oligonucleotides for simultaneously probing the
identity of nucleotides or nucleotide pairs at two or more
polymorphic sites. It is also contemplated that primer compositions
may contain two or more sets of allele-specific primer pairs to
allow simultaneous targeting and amplification of two or more
regions containing a polymorphic site.
[0046] Alternatively, the relevant portion of the FGF2 gene of the
sample of interest may be amplified via PCR and directly sequenced,
and the sequence be compared to the wild type sequence shown in
FIG. 1. It is readily recognized that, other than those
specifically disclosed herein, numerous primers can be devised to
achieve the objectives. PCR and sequencing techniques are well
known in the art and reagents and equipments are readily available
commercially.
[0047] DNA markers have several advantages; segregation is easy to
measure and is unambiguous, and DNA markers are co-dominant, i.e.,
heterozygous and homozygous animals can be distinctively
identified. Once a marker system is established, selection
decisions could be made very easily, since DNA markers can be
assayed any time after a blood sample can be collected from the
individual infant animal, or even earlier by testing embryos in
vitro if very early embryos are collected.
[0048] The use of marker assisted genetic selection will greatly
facilitate and speed up cattle breeding problems. For example, a
modification of the multiple ovulation and embryo transfer (MOET)
procedure can be used with genetic marker technology. Specifically,
females are superovulated, eggs are collected, in vitro fertilized
using semen from superior males and implanted into other females
allowing for use of the superior genetics of the female (as well as
the male) without having to wait for her to give birth to one calf
at a time. Developing blastomeres at the 4-8 cell stage may be
assayed for presence of the marker, and selection decisions made
accordingly.
[0049] In one embodiment of the invention an assay is provided for
detection of presence of a desirable genotype using the
markers.
[0050] The term "genotype" as used herein refers to the identity of
the alleles present in an individual or a sample. In the context of
the present invention, a genotype preferably refers to the
description of the polymorphic alleles present in an individual or
a sample. The term "genotyping" a sample or an individual for a
polymorphic marker refers to determining the specific allele or the
specific nucleotide carried by an individual at a polymorphic
marker.
[0051] The present invention is suitable for identifying a bovine,
including a young or adult bovine animal, an embryo, a semen
sample, an egg, a fertilized egg, or a zygote, or other cell or
tissue sample therefrom, to determine whether said bovine possesses
the desired genotypes of the present invention, which are
indicative of improved reproductive traits.
[0052] Further provided is a method for genotyping the bovine FGF2
gene, comprising determining for the two copies of the FGF2 gene
present in the bovine the identity of the nucleotide pair at
position 11646.
[0053] One embodiment of a genotyping method of the invention
involves examining both copies of the FGF2 gene, or a fragment
thereof, to identify the nucleotide pair at the polymorphic site in
the two copies to assign a genotype to the individual. In some
embodiments, "examining a gene" may include examining one or more
of: DNA containing the gene, mRNA transcripts thereof, or cDNA
copies thereof. As will be readily understood by the skilled
artisan, the two "copies" of a gene, mRNA or cDNA, or fragment
thereof in an individual may be the same allele or may be different
alleles. In another embodiment, a genotyping method of the
invention comprises determining the identity of the nucleotide pair
at the polymorphic site.
[0054] The present invention further provides a kit for genotyping
a bovine sample, the kit comprising in a container a nucleic acid
molecule, as described above, designed for detecting the
polymorphism, and optionally at least another component for
carrying out such detection. Preferably, a kit comprises at least
two oligonucleotides packaged in the same or separate containers.
The kit may also contain other components such as hybridization
buffer (where the oligonucleotides are to be used as a probe)
packaged in a separate container. Alternatively, where the
oligonucleotides are to be used to amplify a target region, the kit
may contain, preferably packaged in separate containers, a
polymerase and a reaction buffer optimized for primer extension
mediated by the polymerase, such as PCR.
[0055] In one embodiment the present invention provides a breeding
method whereby genotyping as described above is conducted on bovine
embryos, and based on the results, certain cattle are either
selected or dropped out of the breeding program.
[0056] Through use of the linked marker loci, procedures termed
"marker assisted selection" (MAS) may be used for genetic
improvement within a breeding nucleus; or "marker assisted
introgression" for transferring useful alleles from a resource
population to a breeding nucleus (Soller 1990; Soller 1994).
[0057] As summarized above, the present inventors recognized the
role of the FGF2 gene in regulating trophectoderm expression of
interferon-tau (IFNT), the maternal pregnancy recognition factor in
ruminants, and choose FGF2 to test for association with embryonic
survival and fertilization rate. The inventors produced a total of
4,542 in vitro fertilizations, resulting in a total of 3,171
embryos. Survival and fertilization rates were assessed at Day 7 of
embryonic development. Using the pooled DNA sequencing approach, 2
single nucleotide polymorphisms (SNP) were identified in FGF2,
SNP11646 and SNP23. All sires and cows were genotyped for these
SNP, and SNP11646 was found to have a significant effect on
survival rate. The survival rate of embryos produced from GG cows
for this SNP was 37% vs. 28% and 29% for embryos produced from AG
and AA cows, respectively.
[0058] The present inventors used the pooled DNA sequencing
approach to find polymorphisms in more than 6 kb of FGF2 including
all the exons and the 3' UTR, and found only one SNP at position 23
(SNP23) and one SNP in intron 1 (SNP11646).
[0059] The identification of genes causing early embryonic death is
a challenging task in mammalian species (VanRaden and Miller,
2006). Successful discovery of such genes requires both the
development of an appropriate resource population and an
appropriate strategy of choosing candidate genes. The present study
met both of these requirements in an investigation of the
association between FGF2 polymorphisms and survival rate and
fertilization success. First, we have collected ovaries from cows
whose oocytes have been used to generate IVF embryos with the aim
of identifying genes affecting fertility traits in cattle. Second,
FGF2 was chosen as a candidate gene affecting early embryonic
survival because of its roles in embryonic development and in the
signal transduction pathway of IFNT, which has a key role in the
initiation and maintenance of pregnancy in ruminants (Spencer and
Bazer, 2004). Using the same dataset, we previously showed that
mutations in signal transducer and activator 5A (STAT5A) are
associated with embryonic survival, fertilization rate, and milk
composition in Holstein dairy cattle (Khatib et al., 2008). It is
worth noting that STAT5A is also a member of IFNT signal
transduction pathway.
[0060] Although the mechanisms that cause embryonic mortality have
not yet been identified, several studies have reported the
important role of FGF2 in early stages of embryo development and
initiation of pregnancy. The present inventor herein provides the
first evidence of the involvement of FGF2 in embryonic mortality in
cattle. Larson et al. (1992) reported that the addition of the
growth factors FGF2 and transforming growth factor beta to cultures
of IVF embryos improved the development of these embryos to
blastocyst stages. Carlone and Rider (1993) have shown that the
uterine expression of FGF2 was increased by the implanting embryo
in rats. Moreover, they showed that in the presence of the embryo,
FGF2 was expressed by the endometrium both intra- and
extracellularly, while in the absence of the embryo, FGF2
expression differed significantly. The authors suggested that
intra- and extracellular FGF2 has a role in the cellular
communication between the embryo and the uterus and that the
developing embryos may employ the maternal growth factors for their
own development (Carlone and Rider, 1993). More recently, Michael
and colleagues (2006) reported that FGF2 is expressed in the
endometrium throughout the estrous cycle and that this gene
controls the expression of IFNT. Given that IFNT plays a key role
in regulating the expression of genes involved in embryo
implantation and in protection of the conceptus against maternal
rejection (Martal et al., 1997), the instant disclosure that FGF2
is associated with early embryonic death is in agreement with the
exciting discovery of Michael and colleagues (2006).
[0061] The present inventor previously has shown that other members
of the IFNT pathway--osteopontin, STAT1, uterine milk protein--are
also associated with milk production and health traits (Leonard et
al. 2005; Cobanoglu et al., 2006; Khatib et al., 2007a; Khatib et
al., 2007b). Here it is disclosed that the GG genotype of FGF2
SNP11646 is associated with significant increases in milk
composition and productive life in Holstein dairy cattle
populations. It is also disclosed that the A allele was associated
with a significant decrease in embryonic survival. Thus, the
findings on the involvement of STAT5A and FGF2 in both milk
production and fertility traits imply that IFNT pathway could be an
excellent candidate pathway to search for other genes that tie milk
production and health traits of cows with pregnancy success and
embryonic survival at the molecular level. Such genes can be used
in gene assisted selection programs to improve production and
reproduction performance in cattle.
[0062] The following examples are intended to illustrate preferred
embodiments of the invention and should not be interpreted to limit
the scope of the invention as defined in the claims.
Examples
I. Association of Bovine FGF2 Gene with Milk Fat and Productive
Life
Materials and Methods
[0063] Populations and Phenotypic Data The association between FGF2
and milk production and health traits was examined in a total of
2,167 individuals from 2 different Holstein cattle populations: the
University of Wisconsin (UW) resource population, and the
Cooperative Dairy DNA Repository (CDDR) population. For a detailed
description of the UW populations see Gonda et al. (2006) and
Khatib et al. (2007a). Yield deviation (YD) and predicted
transmitting ability (PTA) data for the UW population and PTA data
for the CDDR population for milk yield, milk protein and fat yields
and percentages, productive life (PL), and somatic cell scores
(SCS) were obtained from the Animal Improvement Programs Laboratory
(Beltsville, Md.). A summary statistics of phenotypic data from the
2 resource populations is given in Table 1.
TABLE-US-00001 TABLE 1 Means and standard deviations (SD) of PTA of
cows in the UW and of sons in CDDR resource populations for the
production traits UW population (PTA) CDDR population (PTA) Trait
Mean (SD) SD Mean SD Fat, kg -5.48 21.00 3.23 23.49 Fat percentage
-0.0002 0.008 -0.002 0.009 Milk, kg -142.69 540.56 110.71 741.26
Protein yield, kg -6.43 14.53 7.11 21.38 Protein percentage -0.008
0.003 0.001 0.004 PL 0.59 1.07 -2.24 13.11 SCS 2.97 0.12 3.02
0.16
[0064] DNA Preparation, Polymorphism Detection, and Genotyping
[0065] A total of 851 blood samples were obtained from the UW
resource population. Genomic DNA was extracted by using GFX Genomic
Blood DNA Purification kit (Amersham Biosciences, Piscataway,
N.J.). Semen samples from the CDDR population were obtained from 27
sires and their 1,316 sons, and genomic DNA was extracted by
standard methods using proteinase K and phenol/chloroform.
[0066] In order to detect SNP in the FGF2 gene (GenBank Accession
number NC.sub.--007304), 14 different sets of primers were designed
(Table 2) to amplify a total of 6,389 by (including all exons of
the gene) using pooled DNA samples of 30 individuals. The PCR
products were sequenced and SNP were identified by visually
inspecting sequence traces.
TABLE-US-00002 TABLE 2 Primer sequences, locations, and product
sizes Fragment Size Primer (Location) Sequence (bp) FGF2-1 (5' UTR)
GAAAGCTCCGCAATGTAGAG 1076 (SEQ ID NO: 2) FGF2-2 (intron 1)
CCAACAAGGACCTTTTAGTTGG (SEQ ID NO: 3) FGF2-3 (intron 1)
GTTAACAAGGCCAAGTGGAGG 626 (SEQ ID NO: 4) FGF2-4 (intron 2)
CTGCCTCACACGAGCTGTC (SEQ ID NO: 5) FGF2-5 (intron 2)
CTGCTCTTCCAAGGAGATGTG 502 (SEQ ID NO: 6) FGF2-6 (3' UTR)
CCAAACTGAGCAGCTCACTG (SEQ ID NO: 7) FGF2-7 (3' UTR)
CAGTGAGCTGCTCAGTTTGG 749 (SEQ ID NO: 8) FGF2-8 (3' UTR)
CAGATCCCTCCTGAGTATTC (SEQ ID NO: 9) FGF2-In1 (intron 1)
TCAGTCTTCACATCCGTCTCAG 476 (SEQ ID NO: 10) FGF2-In2 (intron 1)
TCATACACTGAAGCCTGAAGC (SEQ ID NO: 11) FGF2-In3 (intron 1)
GAACCAGTCTGTTGTTCCGTGT 332 (SEQ ID NO: 12) FGF2-In4 (intron 1)
CAGATCAGATCAGATCAGTCGCT (SEQ ID NO: 13) FGF2-In5 (intron 1)
GCATCAGGTTTGAGGATCAA 490 (SEQ ID NO: 14) FGF2-In6 (intron 1)
AGGATCAAGTTTTCCACCTG (SEQ ID NO: 15) FGF2-In7 (intron 1)
TCACTCATGCCTGGAAGGGT 320 (SEQ ID NO: 16) FGF2-In8 (intron 1)
TATGTCCAGGTTGGCCTATAC (SEQ ID NO: 17) FGF2-In9 (intron 1)
AGAGTCTTTCTCTGAGTCAG 530 (SEQ ID NO: 18) FGF2-In10 (intron 1)
TGAAGTCATTTGGTGAAGGC (SEQ ID NO: 19) FGF2-In11 (intron 1)
CAGCAACTTAGCACTAGCTAC 390 (SEQ ID NO: 20) FGF2-In12 (intron 1)
CAGAGGCTCATTACATGGCC (SEQ ID NO: 21) FGF2-In13 (intron 1)
ATGGTCCAGCTCTCACATCC 472 (SEQ ID NO: 22) FGF2-In14 (intron 1)
GTGTAATATGTCTGAAACATC (SEQ ID NO: 23) FGF2-In15 (intron 1)
GCTGATACTGGTACATTACT 506 bp (SEQ ID NO: 24) FGF2-In16 (intron 1)
GCAAACAGTGGCTACCTTGG (SEQ ID NO: 25) FGF2-In17 (intron 2)
CCTGGTGGCTCAGATGGT 460 bp (SEQ ID NO: 26) FGF2-In18 (intron 2)
CTCAGAATTCTCATGCACT (SEQ ID NO: 27)
[0067] For individual genotyping, primers FGF2-F 5'
CATAGTTCTGTAGACTAGAAG-3' (SEQ ID NO:28) and FGF2-R 5'
CCTCTAAAGAAGGATTAAGTCAAAATGGGGCTGGTA 3' (SEQ ID NO:29) were used to
amplify a 207-bp fragment. The sequence of primer FGF2-R was
modified to include a recognition site for the restriction enzyme
Csp6I. Amplification was performed in a 25-.m.mu.l reaction volume,
which included 50 ng genomic DNA, 50 ng each primer, 200 .mu.M each
dNTP, 2.5 .mu.l 10.times.PCR buffer (Promega, Madison, Wis.), and
0.5 u Taq DNA polymerase (Promega). The temperature cycles were as
follows: 95.degree. C. for 5 min, followed by 32 cycles of
94.degree. C. for 45 s, touchdown annealing from 63-50.degree. C.
for 45 s (-2.degree. C./cycle), 72.degree. C. for 45 s, and a final
extension at 72.degree. C. for 8 min. The PCR products were
digested with the restriction enzyme Csp6I and electrophoresed on a
2.0% agarose gel. The A allele was indicated by a band of 207 bp,
while the G allele was indicated by a band of 171 bp.
[0068] Statistical Analysis
[0069] Association of FGF2 variants with milk production and health
traits was evaluated in 3 Holstein cattle populations. For the
granddaughter-design CDDR population, PTAs for each trait were
analyzed using the following allele substitution effect model:
y.sub.ij=.mu.+s.sub.i.beta.x.sub.ij+.epsilon..sub.ij
where y.sub.ij represents the PTA of bull j of sire i; .mu. is a
general constant; s.sub.i is the fixed effect of sire i,; .beta. is
the regression coefficient representing half the allele
substitution effect (.alpha./2); x.sub.ij represents the number of
allele G copies (0, 1, 2) at the FGF2 locus of bull j of sire i;
and .epsilon..sub.ij represents the random residual term.
[0070] For the daughter-design UW population, dominance effects for
individual cow PTAs and YDs for each trait were analyzed using the
following mixed model:
y.sub.ijkl=.mu.+s.sub.imgs.sub.j+d.sub.ijk.tau.+f.sub.l.epsilon..sub.ijk-
l
where y.sub.ijkl represents the PTA or YD for milk protein (kg and
percentage), fat (kg and percentage), and productive life of
daughter k of sire i of maternal grandsire j; msg.sub.j represents
the random effect for the maternal grand sire j; .tau. represents
an effect associated with M. paratuberculosis infectious status;
d.sub.ijk is an indicator variable assuming values 0 or 1 for
noninfected and infected cows, respectively. M. paratuberculosis
infection status was included in the model because the UW
population was originally created to search for genetic markers
associated with susceptibility to paratuberculosis; f.sub.l
represents the effect of the FGF2 gene (1=AA, AG, GG); and the
remaining terms were as defined in the previous model. While
deviations for yield traits are corrected for the effect of
contemporaries, individual measures of productive life do not
account for these differences, therefore for this trait an
additional random effect for herd was fitted in the analysis.
[0071] Additive genetic effect for the FGF2 locus on the individual
records analysis was estimated as half of the difference between
homozygous ({circumflex over (f)}.sub.GG-{circumflex over
(f)}.sub.AA)/2. Dominance effect was estimated as the difference
between the heterozygote and the average of the two homozygotes.
Complete dominance genetic effect was estimated as half of the
difference between the heterozygote and recessive homozygote group
(group ({circumflex over (f)}.sub.AG-.sub.{circumflex over
(f)}.sub.AA)/2.
[0072] All the analyses were implemented using the NLME library in
R software v. 2.5.1, available form The R Foundation for
Statistical Computing.
[0073] Results
[0074] Using the DNA sequencing approach, A/G SNP was detected; it
is at position 11646 in intron 1 of FGF2. The frequencies of
alleles A and G in the UW resource population were 0.35 and 0.65,
respectively and the genotype frequencies (AA=0.13, AG=0.45,
GG=0.42) were as expected for Hardy-Weinberg equilibrium. The
frequency of allele G in the CDDR population was 0.63. The
association between the FGF2 SNP and milk production and health
traits was examined in 851 cows from the UW population, and in
1,316 bulls from the CDDR population.
[0075] Table 3 shows the estimates of the additive, dominance, and
complete dominance for PTA of milk production and productive life
traits in the UW population. Complete dominant gene action was
significant for fat yield, fat percentage, and productive life. A
dominance genetic effect was significant for fat yield and fat
percentage. For YD, complete dominant gene action was significant
for fat yield (P<0.05) and productive life (P<0.01) with
estimates of 9.27.+-.3.77 kg and 1.54.+-.0.56 mo respectively. An
additive genetic effect was significant only for productive life
(P<0.05), with an estimate of 1.22.+-.0.57 mo. For fat yield,
the least-squares estimate of the AA genotype was 13.83 vs. 31.96
and 26.14 kg for the AG and GG genotypes, respectively. Similarly,
for productive life, the AG and GG genotypes showed an increase of
3.1 and 2.46 mo respectively compared to the AA genotype.
[0076] For the CDDR population, analysis of PTAs for milk yield and
composition and productive life did not reveal significant
associations with any of the examined traits (Table 4). However,
the directions of least-squares estimates for fat yield were
consistent with those in the UW population. The estimate of
genotype AA was 5.59 vs. 6.77 kg fat for genotype GG.
TABLE-US-00003 TABLE 3 Least-squares means (LSM) for FGF2 genotypes
and estimates of additive, dominance, and complete dominance
effects for milk yield and composition traits and for productive
life estimated from PTAs in the UW population LSM LSM LSM Dominance
Complete Trait AA AG GG Additive effect effect dominance Fat yield
-7.46 -2.91 -4.49 1.48 .+-. 1.12 3.06 .+-. 1.43* 2.27 .+-. 1.06*
Fat -1.20 0.71 0.48 0.84 .+-. 0.40* 1.07 .+-. 0.51* 0.95 .+-. 0.38*
percentage Milk yield -108.71 -122.25 -150.26 -20.77 .+-. 29.57
7.23 .+-. 37.60 -6.77 .+-. 27.97 Protein -5.88 -5.36 -6.57 -0.34
.+-. 0.79 0.85 .+-. 1.00 0.25 .+-. 0.74 yield Protein -0.93 -0.60
-0.75 0.09 .+-. 0.19 0.24 .+-. 0.24 0.16 .+-. 0.18 Percentage PL
0.34 0.49 0.49 0.07 .+-. 0.03.dagger. 0.08 .+-. 0.05 0.07 .+-.
0.03* .dagger.P < 0.1; *P < 0.05
TABLE-US-00004 TABLE 4 Least-squares means (LSM) for FGF2 genotypes
and estimates of additive, dominance, and complete dominance
effects for milk yield and composition traits and for productive
life estimated from PTAs in the CDDR population LSM LSM LSM
Dominance Complete Trait AA AG GG Additive effect effect dominance
Fat yield 5.59 5.33 6.77 0.59 .+-. 0.98 -0.85 .+-. 1.18 -0.13 .+-.
0.87 Fat -0.010 0.009 -0.030 0.050 .+-. 0.040 -0.001 .+-. 0.040
0.020 .+-. 0.030 percentage Milk yield 268.24 223.60 220.52 -23.85
.+-. 25.50 -20.77 .+-. 31.95 -22.31 .+-. 23.48 Protein 11.97 11.19
11.43 -0.26 .+-. 0.67 -0.50 .+-. 0.81 -0.38 .+-. 0.60 yield Protein
0.015 0.017 0.019 0.018 .+-. 0.010 0.003 .+-. 0.020 0.010 .+-.
0.010 Percentage PL -0.4 -0.38 -0.42 0.19 .+-. 0.55 0.59 .+-. 0.37
0.39 .+-. 0.49
[0077] Discussion
[0078] Using the pooled DNA sequencing approach to search for
polymorphisms in 6,389 by including 466 by of the 3 three exons of
the gene, SNP in intron 1 was identified at position 11646. It is
widely accepted that highly conserved sequences are less subject to
mutations. For example, investigation of 481 segments that are
absolutely conserved between orthologous regions of the human, rat
and mouse genomes revealed almost no natural variation in the human
population and only 6 variants were found in a total of 106,767
bases examined (Bejerano et al., 2004). Indeed, there is a
similarity of 97% among bovine, mouse, and human for the protein
sequence of FGF2.
[0079] The SNP in FGF2 was investigated for association with
production traits in 2 Holstein populations, and significant
associations between FGF2 variants and fat yield and percentage,
SCS, and productive life traits were observed in the UW but not in
the CDDR population. However, the correlation between SCS and
productive life in the North America Holstein population is -0.36
(Khatib et al., 2005). Both SCS and productive life are indicators
of health conditions in cows. Productive life is a longevity trait
defined as a cow's total lifetime months in milk with limits of 10
months per lactation and 7 years of age (VanRaden and Wiggans,
1995). The association of FGF2 with milk composition and health
traits was consistent in the examined populations.
[0080] In a previous study, we reported a significant association
between the protease inhibitor gene (PI) and productive life and
milk composition traits in Holstein dairy cattle (Khatib et al.,
2005). In a subsequent study aimed at investigating the PI region,
we reported the association of the UTMP gene--located on bovine
chromosome 21 within 321.6 kb of PI--with productive life in both
the CDDR and the UW populations (Khatib et al., 2007a). We
concluded that additional studies are needed to confirm whether the
observed associations between PI and UTMP with productive life were
due to polymorphisms in these genes or to other loci in that
region. In this study, we found that FGF2, which is a member of the
same pathway as UTMP, was also associated with a significant
increase in productive life.
[0081] This is the first report on the association between FGF2 and
production traits in dairy cattle. However, it remains to be
investigated by which mechanisms FGF2 affects these traits. For
milk composition traits, it has been reported that FGF2 is
expressed in the mammary gland and plays a role in local regulation
of mammary development in mouse (Coleman-Krnacik and Rosen, 1994)
and in cattle (Plath et al., 1998). In addition, FGF2 has been
reported to stimulate IFNT expression (Michael et al., 2006), which
in turn actives a cascade of genes previously found to be
associated with milk production and health traits.
[0082] Bovine IFNT is released by the conceptus as early as Day 9
of pregnancy and serves as the signal for maternal recognition of
pregnancy. IFNT binds to the receptor IFNAR present on the cells of
the endometrium and activates the phosphorylation of janus-kinases
JAK1 and TYK2, which in turn phosphorylate the tyrosine residues of
STAT1 and STAT2. Following phosphorylation, both STAT1 and STAT2
are released from the receptor and bind a third DNA-binding
protein, interferon regulatory factor (IRF) 9, to form the ISGF3
complex. Then, the ISGF3 complex translocates from the cytoplasm to
the nucleus and binds to the promoter region of IRF1 to increase
the rate of transcription of targeted genes such as STAT1, STAT2,
IRF9, and 2',5' oligoadenylate synthetase (OAS). Expression of OAS
may enhance the secretion of UTMP and OPN proteins (Spencer and
Bazer, 2002; Stewart et al., 2002). The expression of UTMP is also
induced by STAT5 which is stimulated by the growth hormone receptor
(GHR) (Spencer and Bazer, 2002; Stewart et al., 2002; Spencer and
Bazer, 2004). Several members of this pathway, including STAT1
(Cobanoglu et al., 2006), UTMP (Khatib et al., 2007a), OPN (Leonard
et al., 2005), STAT5 (Khatib et al., 2008), and GHR (Blott et al.,
2003), have been reported to be associated with milk production and
health traits. Taken together, our findings support the usefulness
of the candidate pathway strategy in choosing candidate genes
affecting quantitative traits.
II. Association of FGF2 SNP11646 with Embryonic Mortality in
Cattle
[0083] Materials and Methods
[0084] Embryo Data Collection
[0085] A total of 281 independent ovaries were collected from a
total of 281 cows from a local abattoir over a period of 26 months
and used in in vitro fertilization (IVF) experiments with semen
from 7 sires. On average, 12 oocytes were aspirated from each
ovary. Oocytes from 191 ovaries were fertilized with semen from one
of three sires (i.e., semen from a particular sire was used to
fertilize all oocytes harvested from one ovary). For the remaining
90 ovaries, aspirated oocytes were divided into 2 groups; each
group was fertilized with semen from one of 4 additional sires. A
summary of the experimental design including the number of oocytes
used in the IVF for each sire is reported in Table 5.
TABLE-US-00005 TABLE 5 Number of ovaries and oocytes used in
in-vitro fertilization with each sire and average number of oocytes
aspirated from each cow Number of Total oocytes Average number of
Sire ovaries fertilized oocytes/ovary (std dev) 1 91.sup. 1217
13.37 (9.08) 2 62.sup. 1140 18.39 (16.21) 3 38.sup. 518 13.63
(7.43) 4 61.sup.a 506 8.30 (5.11) 5 61.sup.a 515 8.44 (4.57) 6
29.sup.b 318 10.97 (5.80) 7 29.sup.b 328 11.31 (5.81) Total 281
.sup. 4542 12.24 (9.68) .sup.a,bOocytes were aspirated from each of
61 and 29 ovaries, respectively, divided into two groups, and
fertilized in parallel with semen from 2 different sires
[0086] Oocytes were aspirated from antral follicles; processed in
TALP-Hepes with 0.22 mM sodium pyruvate, 25 .mu.g/ml gentamicin
sulfate, and 3 mg/ml BSA; and immediately incubated for 20-24 h in
50-.mu.l drops of maturation medium that had been equilibrated in
5% carbon dioxide in air at 39.degree. C. and high humidity. On Day
2 oocytes were washed 3.times. in TALP-Hepes and then were placed
(up to 10 oocytes each) in 44-.mu.l mineral oil-overlaid microdrops
of IVF-Talp (Biowhittaker, Walkersburg, Md.) supplemented with 0.22
mM sodium pyruvate, 25 .mu.g/ml gentamicin sulfate, and 6 mg/ml
essentially fatty acid free BSA.
[0087] Oocytes were fertilized with frozen-thawed percoll-separated
bull semen after being adjusted to a final concentration of 1
million sperm/ml. Each microdrop received 2.0 .mu.g/ml heparin to
help induce capacitation; hypotaurine, penicillamine, and
epinephrine also added were to maintain sperm membrane integrity
and motility. After fertilization, putative zygotes were stripped
of their cumulus cells by vortexing for 3 minutes, then washed
3.times. in TALP-Hepes before being placed into 50 .mu.l mineral
oil-overlaid microdrops of synthetic oviductal fluid (Biowhittaker)
supplemented with 0.22 mM sodium pyruvate, 25 .mu.g/ml gentamicin
sulfate, and 8 mg/ml essentially fatty acid free BSA.
[0088] Survival and Fertilization Rates
[0089] A total of 4542 fertilizations were performed. Survival rate
of embryos was calculated as the number of viable embryos out of
the number of total cultured embryos evaluated at Day 7 of
development (fertilization=day 0). Viability was determined as a
function of the embryo's ability to attain the morphological stage
of blastocyst on Day 7 of development. Embryos that failed to show
cellular compaction (morula stage) on day 5 or 6 were considered
non viable. Therefore only embryos exhibiting adequate compaction
followed by the formation of a blastocoele on Day 7 were considered
viable. Fertilization rate was calculated as the number of embryos
produced out of the total number of fertilizations. Survival and
fertilization rates were assessed under the same environmental
conditions to minimize biased conclusions. The environmental
conditions during incubation were: temperature of 39.degree. C., 5%
carbon dioxide in compressed air (.about.20% oxygen tension), and
95% relative humidity in a water jacketed CO.sub.2 incubator.
[0090] Polymorphism Identification and Genotyping
[0091] We extended our SNP search to include the 5' UTR of FGF2
using the primers FGF1-F 5'-GACCTATTAGATGTGACGCC-3' (SEQ ID NO:30)
and FGF1-R 5'-GGACTGGCTTTGCTGAGCAG-3' (SEQ ID NO:31). A G/T SNP was
identified at position 23 (SNP23) of FGF2 (GenBank Accession number
NC.sub.--007304). For individual genotyping of SNP11646, primers
FGF2-F 5'-CATAGTTCTGTAGACTAGAAG-3' (SEQ ID NO:28) and FGF2-R
5'-CCTCTAAAGAAGGATTAAGTCAAAATGGGGCTGGTA-3' (SEQ ID NO:29) were used
to amplify a 207-bp fragment. For genotyping SNP23, primers FGF1-F
and FGF1-R were used to amplify a 790-bp fragment. Amplification
was performed in a 25-.mu.1 reaction volume, which included 50 ng
genomic DNA, 50 ng each primer, 200 .mu.M each dNTP, 2.5 .mu.l 10X
PCR buffer (Promega, Madison, Wis.), and 0.5 u Taq DNA polymerase
(Promega). The temperature cycles were as follows: 95.degree. C.
for 5 min, followed by 32 cycles of 94.degree. C. for 45 s,
touchdown annealing from 63 to 50.degree. C. for 45 s (-2.degree.
C./cycle), 72.degree. C. for 45 s, and a final extension at
72.degree. C. for 8 min. To detect variants of SNP11646 and SNP23,
PCR products were digested with the restriction enzymes Csp6I and
HaeII, respectively, and electrophoresed on a 2.0% agarose gel. The
A and G alleles of SNP11646 were indicated by bands of 207 and 171
bp, respectively, the G allele of SNP23 was indicated by a band of
425 bp, and the T allele was indicated by bands of 285 and 140
bp.
[0092] Statistical Analysis
[0093] No evidence of linkage disequilibrium was found between
SNP23 and SNP11646, therefore they were assumed independent in the
subsequent analysis. Ovaries from which fewer than 5 eggs were
harvested were discarded and not further analyzed. Association
between FGF2 polymorphisms and proportion of fertilized ova
(fertilization rate) and survival of fertilized ova at Day 7
(survival rate) was analyzed using the following mixed linear
model:
y.sub.ijk=.mu.+o.sub.i+s.sub.j+SNP11656.sub.ijk+SNP23.sub.ijk.epsilon..s-
ub.ijk
where y.sub.ijk represents in turn, the survival or fertilization
rate of a batch of ova k from ovary i fertilized with semen from
sire j; .mu. represents the mean for the trait considered; o.sub.i
represents the random effect of the individual ovary from which ova
were harvested; s.sub.j represents the random effect of sire;
SNP11646.sub.ijk represents the fixed effect of SNP11646 genotype
(AA, AG, GG); SNP23.sub.ijk represents the fixed effect of SNP23
genotype (GG, GT, TT); and .epsilon..sub.ijk represent the
residuals, assumed normal and independent. Ovary effect was fitted
to account for the experimental design in which, for some ovaries,
oocytes collected were fertilized with different sires. Ovaries and
sires were assumed uncorrelated in the analysis, with variance
structures I.sigma..sup.-2.sub.o and 1.sigma..sup.2.sub.s
respectively. An interaction effect between the two polymorphisms
included in a preliminary analysis did not reach significance and
was excluded from the final model. For both SNP, additivity and
dominance were tested as the difference between the two homozygous
genotypes (additive) and the difference between the heterozygous
and the average of the two homozygous genotypes (dominance).
Additive and dominance effects were calculated as the weighted
difference between the two alternative homozygous genotypes (i.e.,
1/2(GG-AA); 1/2(GG-TT)), or the difference between the heterozygous
and the average of the two homozygous genotypes (i.e., AG--1/2
(AA+GG); GT--1/2 (GG+TT)). All the analyses were performed with the
function lmer of the lme4 package of R software v. 2.5.1.
[0094] Results
[0095] In this study we extended our search for SNP in the 5' UTR
of FGF2 and identified a G/T SNP at position 23. To investigate the
association of SNP23 and SNP11646 with fertility traits, we
performed a total 4,542 in vitro fertilizations using semen from 7
sires and ovaries from 281 cows which produced a total of 3,171
embryos. Survival and fertilization rates were evaluated at Day 7
of development.
[0096] Genotyping results of the cows revealed that the frequencies
of the G and A alleles at SNP11646 were 0.53 and 0.47,
respectively, while frequencies of the G and T alleles at SNP23
were 0.82 and 0.18, respectively. Table 6 shows the estimated
differences between genotypes of cows for SNP11646 and SNP23 for
survival and fertilization rates. For fertilization rate, no
significant genotypic differences were found for either SNP. On the
contrary, embryonic survival showed a significant association with
SNP11646. Survival rate of embryos produced from GG dams was 10.73%
higher than that of embryos produced from AG dams (P=0.005) and
8.66% higher than that of embryos produced from AA dams (P=0.079).
Dominance test was significant for this SNP (P=0.047) and estimates
of additive and dominance genetic effects for survival rate were of
4.5% (.+-.0.023) and 6.3% (.+-.0.031), respectively. Least square
means and standard errors for survival and fertilization rates for
the cows' genotypes for SNP11646 and SNP23 are shown in Table 7.
Table 8 shows survival and fertilization rates and the total number
of embryos produced from cows of each genotype for each sire. The
GG genotype was associated with an increase in survival rate
compared to the AG and AA genotypes. The highest difference in
survival rate among genotypes was observed for embryos produced
from Sire 5 with 59% survival rate for GG cows vs. 28% survival
rate for AA cows. Sires 1, 2, 3, 4, and 6 showed genotype
differences of 8% to 10% survival rate. In contrast, for sire 7,
survival rates of embryos produced form AA and GG cows were not
significantly different.
TABLE-US-00006 TABLE 6 Estimated differences expressed in
percentages (.+-.standard error) between dams' genotypes for
SNP11646 and SNP23 for survival and fertilization rates SNP11646
SNP23 Trait/genotype GG-AG GG-AA AG-AA GG-GT GG-TT GT-TT Survival
rate 10.7.sup.b .+-. 3.7 8.6.sup.a .+-. 4.9 -2.1 .+-. 4.7 3.3 .+-.
3.0 7.0 .+-. 9.4 4.28 .+-. 9.7 (%) Fertilization .sup. -4.0 .+-.
3.0 .sup. 2.5 .+-. 4.0 -7.6 .+-. 4.0 1.9 .+-. 3.2 3.4 .+-. 7.4 2.0
.+-. 7.6 rate (%) .sup.aP = 0.079 for the difference in survival
rate between the GG and AA genotypes .sup.bP = 0.005 for the
difference in survival rate between the GG and AG genotypes
TABLE-US-00007 TABLE 7 Least square means and standard errors for
embryo survival and fertilization rates for each cow genotype for
SNP11646 and SNP23 SNP11646 SNP23 Trait/genotype AA AG GG GG GT TT
Survival 0.28 .+-. 0.039 0.26 .+-. 0.041 0.36 .+-. 0.046 0.33 .+-.
0.022 0.30 .+-. 0.034 0.26 .+-. 0.092 rate Fertilization 0.65 .+-.
0.031 0.72 .+-. 0.033 0.68 .+-. 0.037 0.70 .+-. 0.018 0.68 .+-.
0.033 0.67 .+-. 0.037 rate
TABLE-US-00008 TABLE 8 Survival and fertilization rates (%) for
each cow SNP11646 genotype and the total number of embryos and
fertilizations for each sire Survival rate Total Fertilization
Total Sire/cows' (%) em- rate (%) fer- genotype.sup.a AA AG GG
bryos AA AG GG tilizations Sire 1 40 39 48 240 76 77 72 318 Sire 2
32 33 41 336 50 72 79 518 Sire 3 26 26 36 368 71 70 75 506 Sire 4
24 30 34 372 71 78 67 515 Sire 5 28 24 59 239 72 73 74 328 Sire 6
33 34 43 805 72 66 75 1140 Sire 7 36 30 34 811 70 65 66 1217
.sup.aNumbers of cows with AA, AG, and GG genotypes were 70, 123,
and 88 respectively.
REFERENCES CITED
[0097] Bejerano, G., M. Pheasant, I. Makunin, S. Stephen, W. J.
Kent, J. S. Mattick, and D. Haussler. 2004. Ultraconserved elements
in the human genome. Science 304:1321-1325. [0098] Blott, S., J. J.
Kim, S. Moisio, A. Schmidt-Kiintzel, A. Cornet, P. Berzi, N.
Cambisano, C. Ford, G. Grisart, D. Johnson, L. Karim, P. Simon, R.
Snell, R. Spelman, J. Wong, J. Vilkki, M. Georges, F. Farnir, and
W. Coppieters. 2003. Molecular dissection of a quantitative trait
locus: a phenylalanine-to-tyrosine substitution in the
transmembrane domain of the bovine growth hormone receptor is
associated with a major effect on milk yield and composition.
Genetics 163:253-66. [0099] Butler, W. R., and R. D. Smith. 1989.
Interrelationships between energy balance and postpartum
reproductive function in dairy cattle. J. Dairy Sci. 72:767-783.
[0100] Carlone, D. L., and V. Rider. 1993. Embryonic modulation of
basic fibroblast growth factor in the rat uterus. Biol. Reprod.
49:653-665. [0101] Cobanoglu, O., I. Zaitoun, Y. M. Chang, G. E.
Shook, and H. Khatib. 2006. Effects of the signal transducer and
activator of transcription 1 (STAT1) gene on milk production traits
in Holstein dairy cattle. J. Dairy Sci. 89:4433-4437 Khatib, H., V.
Schutzkus, Y. M. Chang and G. J. M. Rosa. 2007a. Pattern of
expression of the uterine milk protein gene and its association
with productive life in dairy cattle. J. Dairy Sci. 90:2427-2433.
[0102] Cobanoglu, O., I. Zaitoun, Y. M. Chang, G. E. Shook, and H.
Khatib. 2006. Effects of the signal transducer and activator of
transcription 1 (STAT1) gene on milk production traits in Holstein
dairy cattle. J. Dairy Sci. 89:4433-4437. [0103] Coleman-Krnacik,
S., and J. M. Rosen. 1994. Differential temporal and spatial gene
expression of fibroblast growth factor family members during mouse
mammary gland development. Mol. Endocrinol. 8:218-29. [0104] Gonda,
M. G., Y. M. Chang, G. E. Shook, M. T. Collins and B. W.
Kirkpatrick. 2006. Genetic variation of Mycobacterium avium ssp.
paratuberculosis infection in US Holsteins. J. Dairy Sci.
89:1804-1812. [0105] Khatib, H., E. Heifetz, and J. C. Dekkers.
2005. Association of the protease inhibitor gene with production
traits in Holstein dairy cattle. J. Dairy Sci. 88:1208-1213. [0106]
Khatib, H., V. Schutzkus, Y. M. Chang and G. J. M. Rosa. 2007a.
Pattern of expression of the uterine milk protein gene and its
association with productive life in dairy cattle. J. Dairy Sci.
90:2427-2433. [0107] Khatib, H., I. Zaitoun, J. Wiebelhaus-Finger,
Y. M. Chang and G. J. M. Rosa. 2007. The association of bovine
PPARGC1A and OPN genes with milk composition in two independent
Holstein cattle populations. J. Dairy Sci. 90:2966-2970. [0108]
Khatib, H., R. L. Monson, V. Schutzkus, D. M. Kohl, G. J. M. Rosa,
and J. J. Rutledge. 2008. Mutations in the STAT5A Gene are
Associated with Embryonic Survival and Milk Composition in Cattle.
J. Dairy Sci. (in press). [0109] Khatib, H., R. L. Monson, V.
Schutzkus, D. M. Kohl, G. J. M. Rosa, and J. J. Rutledge. 2008.
Mutations in the STAT5A gene are associated with embryonic survival
and milk composition in cattle. J. Dairy Sci. 91:784-793. [0110]
Khatkar, M. S, P. C. Thomson, I. Tammen, H. W. Raadsma. 2004.
Quantitative trait loci mapping in dairy cattle: review and
meta-analysis. Genet Sel Evol. 36:163-190. [0111] Larson, R. C., G.
G. Ignotz, and W. B. Currie. 1992. Transforming growth factor beta
and basic fibroblast growth factor synergistically promote early
bovine embryo development during the fourth cell cycle. Mol.
Reprod. Dev. 33:432-435. [0112] Leonard, S., H. Khatib, V.
Schutzkus, Y. M. Chang, and C. Maltecca. 2005. Effects of the
osteopontin gene variants on milk production traits in dairy
cattle. J. Dairy Sci. 88:4083-4086. [0113] Lucy, M. C. 2001.
Reproductive loss in high-producing dairy cattle: where will it
end? [0114] J. Dairy Sci. 84:1277-1293. [0115] Martal, J., N. Ch
ne, S. Camous, L. Huynh, F. Lantier, P. Hermier, R. L'Haridon, G.
Charpigny, M. Charlier, and G. Chaouat. 1997. Recent developments
and potentialities for reducing embryo mortality in ruminants: the
role of IFN-tau and other cytokines in early pregnancy. Reprod.
Fertil. Dev. 9:355-380 Michael, D. D., I. M. Alvarex, O. M. Ocon,
A. M. Powell, N. C. Talbot, S. E. Johnson, and A. D. Ealy. 2006.
Fibroblast growth factor-2 is expressed by the bovine uterus and
stimulates interferon-tau production in bovine trophectoderm.
Endocrinology 147: 3571-3579. [0116] Michael, D. D., I. M. Alvarex,
O. M. Ocon, A. M. Powell, N. C. Talbot, S. E. Johnson, and A. D.
Ealy. 2006. Fibroblast growth factor-2 is expressed by the bovine
uterus and stimulates interferon-tau production in bovine
trophectoderm. Endocrinology 147: 3571-3579. [0117] Moore, K., and
W. W. Thatcher. 2006. Major advances associated with reproduction
in dairy cattle. J. Dairy Sci. 89:1254-1266. [0118] Ocon-Grove, O.
M., F. N. Cooke, I. M. Alvarez, S. E. Johnson, T. L. Ott, and A. D.
Ealy AD. 2007. Ovine endometrial expression of fibroblast growth
factor (FGF) 2 and conceptus expression of FGF receptors during
early pregnancy. Domest. Anim. Endocrinol. (In press). [0119]
Plath, A., R. Einspanier, C. Gabler, F. Peters, F. Sinowatz, D.
Gospodarowicz, D. Schams. 1998. Expression and localization of
members of the fibroblast growth factor family in the bovine
mammary gland. J. Dairy Sci. 81:2604-2613. [0120] Rothschild, M.
F., and M. Soller. 1997. Candidate gene analysis to detect genes
controlling traits of economic importance in domestic livestock.
Probe 8:13-22. [0121] Spencer, T. E., and F. W. Bazer. 2002.
Biology of progesterone action during pregnancy recognition and
maintenance of pregnancy. Front. Biosci. 1:d1879-1898. [0122]
Spencer, T. E., and F. W. Bazer. 2004. Conceptus signals for
establishment and maintenance of pregnancy. Reprod. Biol
Endocrinol. 2:49. [0123] Stewart, M. D., Y. Choi, G. A. Johnson, L.
Y. Yu-Lee, F. W. Bazer and T. E. Spencer. 2002. Roles of Stat1,
Stat2, and interferon regulatory factor-9 (IRF-9) in interferon tau
regulation of IRF-1. Biol. Reprod. 66:393-400. [0124] VanRaden, P.
M., and G. R. Wiggans. 1995. Productive life evaluations:
calculation, accuracy, and economic value. J. Dairy Sci.
78:631-638. [0125] VanRaden, P. M. and R. H. Miller. 2006. Effects
of nonadditive genetic interactions, inbreeding, and recessive
defects on embryo and fetal loss by seventy days. J. Dairy Sci.
89:2716-2721. [0126] Veerkamp, R. F., and B. Beerda. 2007. Genetics
and genomics to improve fertility in high producing dairy cows.
Theriogenology 68S:S266-S273. [0127] Royal, M., G. E. Mann, and A.
P. Flint. 2000. Strategies for reversing the trend towards
subfertility in dairy cattle. Vet. J. 160:53-60. Shook, G. E. 2006.
Major advances in determining appropriate selection goals. J. Dairy
Sci. 89:1349-1361. [0128] Spencer, T. E., and F. W. Bazer. 2004.
Conceptus signals for establishment and maintenance of pregnancy.
Reprod. Biol Endocrinol. 2:49.
Sequence CWU 1
1
3113300DNABos taurus 1agctttatga acagtatgtt taatcttatt gtagtcttat
gaaagaagtg ttattttcat 60cttacagata gggatagagt ttttgctatt ggcttttcaa
accatggtct ctttgtgatt 120gtaagtaatt aattgtgtct tccagatttg
ttagtgttta gaatacagtt catggccaga 180atttcagatg gacggtgtgg
cataaatttg aacagaaata gtgattttta aaaatagttt 240aaacttccca
gagcctttac tgtgctcagc aaagttagtc tctcatcttt tcttctaccc
300ctttattgca tcctttttta tttagaaaat atttgtcatg aattaatacg
aaacaattct 360ttaatatttt agggattgct ttctgaagaa ctcaaagatt
tttaaaaggc atatttaaaa 420attaagagca ggacataatt aagaataaat
accatataag aatgggataa acctcaaaga 480tagagtctgt aaagatgcag
aataagctaa ggcatgcaga aaatacaaag agaatgatta 540aaaggatgtt
taaaaagtta gttaggccct ttcaaggaaa tttgagatag gctcactatt
600taaggacata gtgtaagatg aaaagaaaaa aatttagaaa aaaaagcaga
tggacctggg 660cctattttat gttaatgtta atcttcttct ccaagtgaga
ttgtcaatca ataattgtct 720gagtgtctca ttgagaaaat aaagaccaag
gtagacaaag agatacaaag aaagcactta 780gccagacaca tctagaaatg
tgtttataat gaaactcctc tttccttgaa atcacttgtc 840cccctttttt
gaccccctgt attttaaaat ataaaatatt taactttgta aatttcttgc
900caaccagccc atctcgcaga gtacatttct actcttcatc ccctcagtct
tcacatccgt 960ctcaggctct gtgttttcag ttctgctgtg tccttcatac
tcacgggggt ctctgcattg 1020ttgccacagc tgctctcgtt cggtccctga
ctgttgcaac tgccttctac ctgatcccat 1080ctgtatcagt ttgctagggc
tgccataaca gattaccgta gactgagtgg ctcaaacaac 1140agaaattgat
tttctcatag ttctgtagac tagaagtcca agatacagct gtctgcatgt
1200ctggtctttc tgcggcctct tcggggtttg cagcagccac cttacacatg
gtcacctctc 1260tgtgcacaca tcctgatctc ttcttcttgt aagggcacca
ttcagatttg gttagggccc 1320actctgtaac agccccattt tgacttaatc
cttctttaga ggccccatct ccaaatagta 1380attttctgag gtactggggc
ttcaggcttc agtgtatgaa tttggggtgg gggtacagtt 1440cagcccacag
caccagtgag tcaactggat attgttcctt ggcagagtat ctttccagag
1500agcagctctg atcttgttat ccctctattt agaaaaactt catggacagt
ctagtcccct 1560ggttcccaca ttgcttacag atgtgggcac tgtagaaagt
ctatgagaat tacagagaat 1620aggaagttac cagcagatga gtgattgtct
tatatatcag aaagtgggat aaaggtattt 1680tctggaaact ctagatagct
aggaagcctg atgtaggtcc ttgaaaaaaa tccaagggac 1740ttgagaatac
ggagaaaaga agataacata gaaaatagta aataggctcg tatatagtgg
1800aagagtagca gtatacatag gcttcacatg ttatttcggt ggaatatctg
accaaatttc 1860tcataacaac cttctgcaaa agaagtacat tttctttggg
agagtagagt tttttcatat 1920ttgggcttct aaggccagga cccaaggact
gtatcacctt taatgaactg gaagtatgct 1980ctccctccaa aaggtaaaga
attaaagata aaattggtga tatggattta ttatcatgat 2040ctgaaagtat
tcttaataga cagctgactc tgtttcctaa ttaccaccct gaagtgaagc
2100tttagattct cattttaatt caaagctttt tgctagaccc ttcacccagc
tattggcagt 2160attgctcaca tcctcataca gcaggagaat ttttagtgat
ttacatgata ttttgcagct 2220caacgaattt ttcttgaaag gcgttgcagg
aagctacatt gctcaagaag tagatagtct 2280tcaagtgttt taatgagatt
aggaaaaaaa caccagttga gatacctgtt tggttatacc 2340tctgttgagt
cttttccaga cttgttattt tgggctgtac ttaatgatgt tgaactgtag
2400agcttttgtg cataggattc tggagactct gggccttgcg catgccctca
cctccagcag 2460tgagagggtg ttcctactag gtacctctgt tttctggaag
aagcctaatg ctcaccgtgg 2520ctgacagtta atatatgtgg ttctttataa
ttcagcctga ctcaaagaga tacagtacat 2580cttccttcca ggttgggtat
tttaacctgg acagtccatg aacaagctcc aggtttccat 2640aattccttga
aaatatatat aaaatattat atcaaggtgt tgtttctgag gggagaatac
2700acagcacttt atcagattct caaaaagttg tccatggccc aaaatacgtc
agggacactg 2760ctgctgctaa ctgaggtgta tcttctcact aacccagctg
tcgggaagag ccgatttgaa 2820tgtgttgatt tgagtctgta gtttatggtg
aatgatgctt gggagtaaca tctttgcaaa 2880actggtgtct gtgttaattc
taagaaatat ttcaagctgc tgttgatctc attacatagt 2940gtccactctg
aggcctcctg agggaaattt ctctgtggta actgtcggga ctagctcatg
3000cttctccttg gcagccagtt tattttaacc ttatggactc tgggaagctt
gttattgcta 3060ctggcttcta gaaagcctaa tatgtggtcc acttctagca
agtatgataa tctcaatcct 3120ggcttcacaa atttttaacc cttatttcct
atttgcctta tttaaaacca tttttaaagt 3180ttgttttttt gtcttggtat
attgtctgta tctttgtaac tcatcttaaa tattatttgg 3240ggccagacag
gttacatacc tcaataaaaa attttattga tttcttattt taaccacaaa
3300220DNAArtificial SequencePCR primer FGF2-1 2gaaagctccg
caatgtagag 20322DNAArtificial SequencePCR primer FGF2-2 3ccaacaagga
ccttttagtt gg 22421DNAArtificial SequencePCR primer FGF2-3
4gttaacaagg ccaagtggag g 21519DNAArtificial SequencePCR primer
FGF2-4 5ctgcctcaca cgagctgtc 19621DNAArtificial SequencePCR primer
FGF2-5 6ctgctcttcc aaggagatgt g 21720DNAArtificial SequencePCR
primer FGF2-6 7ccaaactgag cagctcactg 20820DNAArtificial SequencePCR
primer FGF2-7 8cagtgagctg ctcagtttgg 20920DNAArtificial SequencePCR
primer FGF2-8 9cagatccctc ctgagtattc 201022DNAArtificial
SequencePCR primer FGF2-In1 10tcagtcttca catccgtctc ag
221121DNAArtificial SequencePCR primer FGF2-In2 11tcatacactg
aagcctgaag c 211222DNAArtificial SequencePCR primer FGF2-In3
12gaaccagtct gttgttccgt gt 221323DNAArtificial SequencePCR primer
FGF2-In4 13cagatcagat cagatcagtc gct 231420DNAArtificial
SequencePCR primer FGF2-In5 14gcatcaggtt tgaggatcaa
201520DNAArtificial SequencePCR primer FGF2-In6 15aggatcaagt
tttccacctg 201620DNAArtificial SequencePCR primer FGF2-In7
16tcactcatgc ctggaagggt 201721DNAArtificial SequencePCR primer
FGF2-In8 17tatgtccagg ttggcctata c 211820DNAArtificial SequencePCR
primer FGF2-In9 18agagtctttc tctgagtcag 201920DNAArtificial
SequencePCR primer FGF2-In10 19tgaagtcatt tggtgaaggc
202021DNAArtificial SequencePCR primer FGF2-In11 20cagcaactta
gcactagcta c 212120DNAArtificial SequencePCR primer FGF2-In12
21cagaggctca ttacatggcc 202220DNAArtificial SequencePCR primer
FGF2-In13 22atggtccagc tctcacatcc 202321DNAArtificial SequencePCR
primer FGF2-In14 23gtgtaatatg tctgaaacat c 212420DNAArtificial
SequencePCR primer FGF2-In15 24gctgatactg gtacattact
202520DNAArtificial SequencePCR primer FGF2-In16 25gcaaacagtg
gctaccttgg 202618DNAArtificial SequencePCR primer FGF2-In17
26cctggtggct cagatggt 182719DNAArtificial SequencePCR primer
FGF2-In18 27ctcagaattc tcatgcact 192821DNAArtificial SequencePCR
primer FGF2-F 28catagttctg tagactagaa g 212936DNAArtificial
SequencePCR primer FGF2-R 29cctctaaaga aggattaagt caaaatgggg ctggta
363020DNAArtificial SequencePCR primer FGF1-F 30gacctattag
atgtgacgcc 203120DNAArtificial SequencePCR primer FGF1-R
31ggactggctt tgctgagcag 20
* * * * *