U.S. patent application number 13/194691 was filed with the patent office on 2012-05-31 for algal medium chain length fatty acids and hydrocarbons.
This patent application is currently assigned to Arizona Board of Regents for and on Behalf of Arizona State University. Invention is credited to Qiang HU, Shan QIN, Milton SOMMERFELD.
Application Number | 20120135478 13/194691 |
Document ID | / |
Family ID | 45530517 |
Filed Date | 2012-05-31 |
United States Patent
Application |
20120135478 |
Kind Code |
A1 |
HU; Qiang ; et al. |
May 31, 2012 |
ALGAL MEDIUM CHAIN LENGTH FATTY ACIDS AND HYDROCARBONS
Abstract
The present invention provides methods and compositions for
production of algal-based medium chain fatty acids and
hydrocarbons. More specifically, the invention relates to a
Nannochloropsis algal strain and mutants that produces high amounts
of C16 fatty acids and hydrocarbons. The present invention provides
methods and compositions for production of algal-based medium chain
fatty acids and hydrocarbons. More specifically, the invention
relates to a Nannochloropsis algal strain and mutants that produces
high amounts of C16 fatty acids and hydrocarbons.
Inventors: |
HU; Qiang; (Chandler,
AZ) ; SOMMERFELD; Milton; (Chandler, AZ) ;
QIN; Shan; (Gilbert, AZ) |
Assignee: |
Arizona Board of Regents for and on
Behalf of Arizona State University
Scottsdale
AZ
|
Family ID: |
45530517 |
Appl. No.: |
13/194691 |
Filed: |
July 29, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61369533 |
Jul 30, 2010 |
|
|
|
Current U.S.
Class: |
435/134 ;
435/167; 435/257.1 |
Current CPC
Class: |
C12P 39/00 20130101;
C12P 7/6463 20130101; C10L 1/04 20130101; C12N 1/12 20130101; C12P
7/6409 20130101; C12R 1/89 20130101 |
Class at
Publication: |
435/134 ;
435/167; 435/257.1 |
International
Class: |
C12P 5/02 20060101
C12P005/02; C12N 1/12 20060101 C12N001/12; C12P 7/64 20060101
C12P007/64 |
Claims
1. A method for producing algal medium chain length fatty acids or
hydrocarbons, comprising: culturing a first algal strain wherein
the first algal strain produces a first medium chain length fatty
acid subset wherein at least about 50% of the fatty acids in the
subset are of a chain length of C16, wherein the culturing is
conducted under conditions suitable to promote the production of
the first medium chain length fatty acid subset; and extracting oil
from the first algal strain to produce a medium chain length
combination; wherein the medium chain length combination comprises
carbon chain length C10, C12, C14 and C16 fatty acids or
hydrocarbons, wherein said oil is enriched for C16 fatty acids such
that at least about 50% of the fatty acids in said oil are C16
fatty acids.
2. The method of claim 1 wherein the medium chain length fatty acid
subset comprises at least about 60% C16 fatty acids.
3. The method of claim 1, wherein the first algal strain is
selected from the group consisting of Nannochloropsis strain
LARB-AZ 0202.0 (ATCC Deposit Number PTA-11048), LARB-AZ 0202.2
(ATCC Deposit Number PTA 11049), LARB-AZ 0202.3 (ATCC Deposit
Number PTA-11050), Nannochloropsis sp., Pinguiococcus pyrenoidosus,
Aphanocapsa sp., Biddulphia aurita, Crypthecodinium sp., Emiliania
huxleyi, Nitzschia alba, Prymnesiumparvum, Skeletonema costatum,
and Trichodesmium erythraeum.
4. The method of claim 1 further comprising co-culturing or
separately culturing a second algal strain selected from the group
consisting of Nannochloropsis strain LARB-AZ 0202.0 (ATCC Deposit
Number PTA-11048), LARB-AZ 0202.2 (ATCC Deposit Number PTA 11049),
LARB-AZ 0202.3 (ATCC Deposit Number PTA-11050), Nannochloropsis
sp., Pinguiococcus pyrenoidosus, Aphanocapsa sp., Biddulphia
aurita, Crypthecodinium sp., Emiliania huxleyi, Nitzschia alba,
Prymnesiumparvum, Skeletonema costatum, and Trichodesmium
erythraeum.
5. The method of claim 1 further comprising converting oil
extracted from the first algal strain into a hydrocarbon fraction
and refining the hydrocarbon fraction to produce one or more
sub-fractions enriched in carbon chain lengths C8, C10, C12, C14,
or C16
6. The method of claim 1 further comprising culturing one or more
further algal strains that produce a second medium chain length
fatty acid subset wherein at least about 20% of the fatty acids in
said second medium chain length fatty acid subset are medium chain
length fatty acids, wherein the culturing is conducted under
conditions suitable to promote the production of the second medium
chain length fatty acid subset.
7. The method of claim 3 wherein the first algal strain and the one
or more further algal strains are cultured as separate cultures, or
cultured together as a co-culture.
8. The method of claim 1, further comprising producing kerosene
from the oil.
9. The method of claim 3 further comprising a third algal strain
that is different from said first and second algal strains and
selected from the group consisting of Nannochloropsis strain
LARB-AZ 0202.0 (ATCC Deposit Number PTA-11048), LARB-AZ 0202.2
(ATCC Deposit Number PTA 11049), LARB-AZ 0202.3 (ATCC Deposit
Number PTA-11050), Nannochloropsis sp., Pinguiococcus pyrenoidosus,
Aphanocapsa sp., Biddulphia aurita, Crypthecodinium sp., Emiliania
huxleyi, Nitzschia alba, Prymnesiumparvum, Skeletonema costatum,
and Trichodesmium erythraeum.
10. A method for producing algal medium chain length fatty acids or
hydrocarbons, comprising: culturing one or more of Nannochloropsis
strain LARB-AZ 0202.0 (ATCC Deposit Number PTA-11048), LARB-AZ
0202.2 (ATCC Deposit Number PTA 11049), LARB-AZ 0202.3 (ATCC
Deposit Number PTA-11050), under conditions suitable to promote the
production of a first medium chain length fatty acid subset
comprising at least about 50% C16 fatty acids or hydrocarbons;
culturing one or more further algal strains under conditions
suitable to promote the production of a second medium chain length
fatty acid subset comprising at least about 50% C10 or C14 chain
length fatty acids or hydrocarbons; culturing one or more further
algal strains under conditions suitable to promote the production
of a second medium chain length fatty acid subset comprising at
least about 50% C10 or C12 chain length fatty acids or
hydrocarbons; extracting oil from the cultured Nannochloropsis
strain LARB-AZ 0202.0 or a mutant thereof and the one or more
further algal strains to produce a medium chain length combination,
wherein the medium chain length combination comprises carbon chain
length C16, C14 and one or more of C10 and C12 fatty acids or
hydrocarbons.
11. The method of claim 10, further comprising converting the
medium chain length combination into a hydrocarbon fraction and
further comprising refining the hydrocarbon fraction to produce one
or more fractions enriched in medium chain length hydrocarbons,
wherein the one or more fractions comprises one or more fractions
enriched in carbon chain length C10, C12, C14, and C16
hydrocarbons.
12. The method of claim 10 wherein said mutant of Nannochloropsis
strain LARB-AZ 20202.0 is LARB-AZ 0202.2 (ATCC Deposit Number
PTA-11049) or LARB-AZ 0202.3 (ATCC Deposit Number PTA-11050).
13. The method of claim 10, wherein the medium chain length
combination is prepared by combining oil extracted from the
Nannochloropsis strain LARB-AZ 0202.0 or a mutant thereof and the
one or more further algal strains after oil extraction or by
extracting oil from a culture comprising both the Nannochloropsis
strain LARB-AZ 0202.0 or a mutant thereof and the one or more
further algal strains.
14. The method of claim 10 wherein the one or more further algal
strains is selected from the group consisting of Nannochloropsis
strain LARB-AZ 0202.0 (ATCC Deposit Number PTA-11048), LARB-AZ
0202.2 (ATCC Deposit Number PTA 11049), LARB-AZ 0202.3 (ATCC
Deposit Number PTA-11050), Nannochloropsis sp., Pinguiococcus
pyrenoidosus, Aphanocapsa sp., Biddulphia aurita, Crypthecodinium
sp., Emiliania huxleyi, Nitzschia alba, Prymnesiumparvum,
Skeletonema costatum, and Trichodesmium erythraeum.
15. The method of claim 1 wherein the Nannochloropsis strain or
mutant thereof is grown in a cell culture that comprises 1.5 g/L
NaNO.sub.3 and at a light intensity of about 350 .mu.mol photons
m.sup.-2 s.sup.-1, and initial N.sub.2 gas concentration of the
cell culture of about 0.01 g/L.
16. The method of claim 10 wherein the Nannochloropsis strain or
mutant thereof is grown in a cell culture that comprises 1.5 g/L
NaNO.sub.3 and at a light intensity of about 350 .mu.mol photons
m.sup.-2 s.sup.-1, and initial N.sub.2 gas concentration of the
cell culture of about 0.01 g/L.
17. A composition comprising a Nannochloropsis strain LARB-AZ
0202.2 deposited at ATCC Deposit Number PTA-11049 or
Nannochloropsis strain LARB-AZ 0202.3 deposited at ATCC Deposit
Number PTA-11050, or a combination of LARB-AZ 0202.2 and LARB-AZ
0202.3.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional
Application No. 61/369,533, filed Jul. 30, 2010, the entire
contents of which are hereby incorporated by reference herein.
BACKGROUND
[0002] JP-8 is a kerosene-type military jet fuel derived from
petroleum and is being used as the primary fuel for land-based air
and ground forces (e.g., aircraft, ground vehicles, and equipment).
The US Department of Defense (DOD) is the single largest oil
consuming government body in the US, consuming over 90 million
barrels of JP-8 in fiscal 2006, which represents about 15% of
kerosene-based jet fuel produced by the U.S.
[0003] Commercial jet fuel similar to JP-8 in chemical composition
is largely consumed by the U.S. commercial (corporate/private)
aviation industry with passenger and cargo carriers burning nearly
500 million barrels of jet fuel in 2005. As having already consumed
over 80% of its proven oil reserves, the U.S. now imports more than
60% of its oil. It is anticipated that within 20 years the U.S.
will be importing from 80% to 90% of its oil. Much of this imported
oil is supplied from nations in politically-volatile regions of the
world where political instability, human rights abuses, and
terrorism are the constant threat to a stable oil supply for the
U.S.
[0004] Over $250 billion is spent on foreign oil annually,
representing a third of the growing US trade deficit and an
increasing burden on the US economy. Although the U.S. can continue
to increasingly import foreign oil, global oil supplies are not
infinite. Even based upon an optimistic estimate of the world oil
resource of approximately 2,200-3,900 billion barrels, nearly twice
the proven reserve, the world supply of petroleum oil will be
depleted within 40 years. Demand for oil by emerging and rapidly
growing economies such as in China, India, and South America, is
also increasing competition and price volatility for limited global
supplies. The severity of potential impacts of oil reduction on
U.S. military operations, national security, and the growing
economy will depend on how much, how quickly, and how far in
advance of this event we are able to provide a wide range of
renewable, affordable alternatives to JP-8 and other fossil
fuels.
[0005] Oil-rich crops and algae are widely regarded as the most
promising biological systems for cost-effective, sustainable
production of biodiesel particularly for transportation. However,
biodiesel produced from current available oil crop-based feedstocks
and commercial processes is not suitable as a JP-8 surrogate fuel
for military and commercial aviation applications due to its lower
energy density and unacceptable cold-flow features. The
disqualification of biodiesel as an alternative to JP-8 stems from
the fact that the former contains mostly methyl esters of C16 and
C18 fatty acids, whereas the latter has the main chemical
components of C9 to C14 hydrocarbons. Compared to C9 to C14
hydrocarbons, oxygenated methyl esters of C16 and C18 fatty acids
not only decrease energy density of the fuel, but also are
responsible for high fuel viscosity, high flash point, and high
freezing points (>-50.degree. C.).
[0006] Biodiesel can be processed into JP-8 surrogate fuel through
thermal, catalytic, and/or enzymatic processes. However, the
subsequent secondary processing is neither cost-effective nor
energy-efficient and consumes large quantities of fossil fuels with
an energy conversion efficiency of 8% to 15%. This results in
alternative jet fuel being prohibitively expensive and having
unacceptably low energy efficiency. Clearly, transforming
algae/plant-based oil or biodiesel into an affordable alternative
to petroleum-derived JP-8 has great potential, but this will
require significant innovations and improvements to current
feedstock production systems and subsequent downstream processes to
enhance oil conversion efficiency, while driving production costs
down.
[0007] One way to increase energy conversion efficiency while
reducing production costs of crop oil derived JP-8 surrogate fuel
is to introduce certain feedstock oils that may naturally consist
of large amounts of medium-chain fatty acids (C10 to C14). The
medium-chain fatty acids may require little cracking treatment,
which is otherwise required process to break long-chain molecules
into shorter ones. Coconut and palm kernel oils have turned out to
be the exceptions from common oil crops by containing high
concentrations (55.about.69% of total fatty acids) of medium-chain
(C12 and C14) fatty acids/esters. The world production of coconut
oil was about 50 million metric tons in 1999, and the production of
palm kernel oil was about 3.8 million tons in 2005. Indonesia,
Malaysia, Philippines, and India are the major producers of coconut
and palm kernel oils. These oils are mainly used for domestic
consumption as food and cooking/frying oil. In the U.S. and other
western countries, coconut and palm kernel oils are largely used in
the manufacture of margarine and other fat/oil products, as well as
in cosmetics, soaps, detergents and shampoos. Although coconut and
palm kernel oils are being exploited for production of biodiesel
and are considered to be kerosene-based jet fuel substitute, they
are unlikely to be used as a major feedstock for jet fuel
production due to limited supplies (Shay 1993; Srivastava &
Prasad 2000).
[0008] An alternative is to make more medium-chain fatty acids
through genetic manipulations of oil crops. However, the efforts
made thus far with oil-crops have resulted in little commercial
significance. This is due mainly to the lack of clear understanding
of cellular/subcellular regulatory networks that may provide
`global` control over complex biochemical pathways, which may lead
to partitioning of photosynthetically-fixed carbon specifically
into the formation and accumulation of lipids/oil rather than
biosynthesis of protein or carbohydrate. Lack of effective
molecular genetic tools and methodologies is another major reason
for unsuccessful strain improvement.
[0009] Microalgae may be a promising source of feedstock for
biofuels because of a) their high lipid/oil contents (40 to 60% of
dry weight); b) high specific growth rates (1 to 3 doubling time
per day); c) the ability to thrive in saline/brackish water and
utilize nutrients (N, P, and CO2) from waste-streams (e.g.,
wastewater and flue gases from fossil fuel-fired power plants) for
growth, and use marginal lands (desert, arid- and semi-arid lands)
for wide-scale production all year around; and d) co-production of
value-added products (e.g., biopolymers, proteins, polysaccharide,
pigments). However, algal oils studied for biofuels so far are
rather similar in chemical and physical properties to that of
common crop oils, which are enriched with C16 to C18 fatty
acids/esters.
SUMMARY
[0010] The present invention relates to methods and compositions
for the use of Nannochloropsis algal strains for the production of
large amounts of medium chain length fatty acids. In particular, it
has been discovered that in excess of 50% of the fatty acids
produced by Nannochloropsis strain LARB-AZ 0202.0 and mutants
thereof are C16 fatty acids. C16 fatty acids are valuable because
they are easily converted to biofuels and other useful and
important hydrocarbon based products. This heretofore unknown
strain of Nannochloropsis and its mutants can thus be used in the
production of fatty acids for use in biofuel production.
[0011] The present invention provides methods and compositions for
production of algal-based medium chain fatty acids and
hydrocarbons. More specifically, the invention relates to a
Nannochloropsis algal strain and mutants that produces high amounts
of C16 fatty acids and hydrocarbons. In particular embodiments, the
present invention relates to a method for producing algal medium
chain length fatty acids or hydrocarbons, comprising: [0012] (a)
culturing a first algal culture consisting of Nannochloropsis
strain LARB-AZ 0202.0 deposited at ATCC Deposit Number PTA-11048 or
a mutant thereof deposited at ATCC Deposit Number PTA 11049 or ATCC
Deposit Number PTA-11050, or a combination of two or more said
Nannochloropsis strains (LARB-AZ 0202.2; LARB-AZ 0202.3) wherein
said first algal strain produces at least a first medium chain
length fatty acid subset wherein at least 60% of the fatty acids in
said subset are of a chain length of C16, wherein the culturing is
conducted under conditions suitable to promote production of the
first medium chain fatty acid subset; and [0013] (b) extracting oil
from the first algal strain to produce a medium chain length
combination; wherein the medium chain length combination comprises
carbon chain length C10, C12, C14 and C16 fatty acids or
hydrocarbons, wherein said oil is enriched for C16 fatty acids such
that greater than 60% of the fatty acids in said oil are C16 fatty
acids; said method optionally further comprising converting oil
extracted from the first algal strain into a hydrocarbon fraction
and refining the hydrocarbon fraction to produce one or more
fractions enriched in medium chain length hydrocarbons, wherein the
one or more fractions comprises one or more fractions enriched in
carbon chain length C10, C12, C14 and C16 hydrocarbons.
[0014] While in preferred embodiments, the methods employs only
Nannochloropsis strain LARB-AZ 0202.0 either alone or in
combination with mutants thereof, in further embodiments, the
method may further comprise culturing one or more further algal
strains that produce a second medium chain length fatty acid subset
wherein at least 20% of the fatty acids in said subset are medium
chain length fatty acids wherein the culturing is conducted under
conditions suitable to promote production of the second medium
chain fatty acid subset. An example of these conditions would be
culturing under conditions cell comprising 1.5 g/L NaNO.sub.3 and
at a light intensity of about 350 .mu.mol photons m.sup.-2
s.sup.-1, and initial N.sub.2 gas concentration of the cell culture
of about 0.01 g/L.
[0015] In the various methods, the first algal strain and the one
or more further algal strains may be cultured as separate cultures
or are cultured as a co-culture. Where the method employs multiple
Nannochloropsis strains e.g., Nannochloropsis strain LARB-AZ 0202.0
and mutants thereof, the multiple strains may be co-cultured or may
be cultured in separate cultures.
[0016] In the methods of the present invention, the one or more
fractions further comprises one or more fractions enriched in
carbon chain length C16 hydrocarbons.
[0017] The methods of the present invention may further comprise
producing kerosene from the one or more fractions enriched in
medium chain length hydrocarbons.
[0018] In exemplary embodiments, the methods may further comprise
isolating an algal biomass residue and/or short-chain hydrocarbon
molecules and/or glycerol produced in said method.
[0019] The methods of the invention using Nannochloropsis strain
LARB-AZ 0202.0 or mutants thereof may be combined with methods that
use one or more further algal strains comprises at least a second
algal strain and a third algal strain that is different from said
first algal strain and independently is selected from the group
consisting of Pinguiococcus pyrenoidosus, Aphanocapsa sp.,
Biddulphia aurita, Crypthecodinium sp., Emiliania huxleyi,
Nitzschia alba, Prymnesium parvum, Skeletonema costatum, and
Trichodesmium erythraeum.
[0020] Also contemplated is a method for producing algal medium
chain length fatty acids, comprising: [0021] (a) culturing
Nannochloropsis strain LARB-AZ 0202.0 deposited under ATCC Deposit
Number PTA-11048 or a mutant thereof or a combination of said
Nannochloropsis strain LARB-AZ 0202.0 and one or more mutants
thereof under conditions suitable to promote production of medium
chain length fatty acids enriched in C16 fatty acids; and [0022]
(b) extracting oil from the cultured Nannochloropsis strain LARB-AZ
0202.0 or the one or more mutants thereof wherein the extracted oil
comprises C14 and C16 chain length fatty acids.
[0023] In specific embodiments, the mutant of Nannochloropsis
strain LARB-AZ 0202.0 is a LARB-AZ 0202.2 deposited at ATCC Deposit
Number PTA-11049 or a LARB-AZ 0202.3 deposited at ATCC Deposit
Number PTA-11050. The method may further comprise converting oil
extracted from Nannochloropsis strain LARB-AZ 0202.0 or a mutant
thereof into a hydrocarbon fraction, and optionally refining the
hydrocarbon fraction to produce one or more fractions enriched in
medium chain length hydrocarbons, wherein the one or more fractions
comprises at least one fraction enriched in carbon chain length C16
hydrocarbons. More particularly, the one or more fractions may
comprise at least one fraction enriched in carbon chain length C16
hydrocarbons, said method optionally further comprising producing
kerosene from the one or more fractions enriched in medium chain
length hydrocarbons. Further the method may comprise isolating
algal biomass.
[0024] Also described herein are methods of producing algal medium
chain length fatty acids or hydrocarbons, comprising [0025] (a)
culturing Nannochloropsis strain LARB-AZ 0202.0 deposited under
ATCC Deposit Number PTA-1 1048 or a mutant thereof or a combination
of said Nannochloropsis strain LARB-AZ 0202.0 and one or more
mutants thereof under conditions suitable to promote production of
medium chain length fatty acids enriched for C16 fatty acids;
[0026] (b) culturing one or more further algal strains that can
produce and accumulate large quantities of C14 chain length fatty
acids, wherein the culturing is conducted under conditions suitable
to promote production of the C14 chain length fatty acids; and
[0027] (c) culturing one or more further algal strains that can
produce and accumulate large quantities of C10 and/or C12 chain
length fatty acids, wherein the culturing is conducted under
conditions suitable to promote production of the C10 and/or C12
chain length fatty acids; and [0028] (d) extracting oil from the
cultured Nannochloropsis strain LARB-AZ 0202.0 or a mutant thereof
and the one or more further algal strains to produce a medium chain
length combination; wherein the medium chain length combination
comprises carbon chain length C14 and one or more of C10 and C12
fatty acids or hydrocarbons; said method optionally further
comprising converting the medium chain length combination into a
hydrocarbon fraction and further comprising refining the
hydrocarbon fraction to produce one or more fractions enriched in
medium chain length hydrocarbons, wherein the one or more fractions
comprises one or more fractions enriched in carbon chain length
C16, C10, C12, and C14 hydrocarbons.
[0029] In particular embodiments the mutant of Nannochloropsis
strain LARB-AZ 0202.0 is a LARB-AZ 0202.2 deposited at ATCC Deposit
Number PTA-11049 or a LARB-AZ 0202.3 deposited at ATCC Deposit
Number PTA-11050 or a combination of both.
[0030] In specific embodiments, the medium chain length combination
is prepared by combining oil extracted from the Nannochloropsis
strain LARB-AZ 0202.0 or a mutant thereof and the one or more
further algal strains after oil extraction or by extracting oil
from a culture comprising both the Nannochloropsis strain LARB-AZ
0202.0 or a mutant thereof and the one or more further algal
strains. More particularly, the one or more fractions further
comprises one or more fractions enriched in carbon chain length C16
hydrocarbons and optionally further comprising producing kerosene
from the one or more fractions enriched in medium chain length
hydrocarbons. By way of example, the one or more further algal
strains comprises a second algal strain and a third algal strain,
wherein the third algal strain is selected from the group
consisting of Aphanocapsa sp., Biddulphia aurita, Crypthecodinium
sp., Emiliania huxleyi, Nitzschia alba, Prymnesium parvum,
Skeletonema costatum, and Trichodesmium erythraeum.
[0031] Also contemplated is a composition comprising
Nannochloropsis strain LARB-AZ 0202.0 deposited at ATCC Deposit
Number PTA-11048. Another embodiment contemplates a composition
comprising a Nannochloropsis strain LARB-AZ 0202.2 deposited at
ATCC Deposit Number PTA-11049 or Nannochloropsis strain LARB-AZ
0202.3 deposited at ATCC Deposit Number PTA-1 1050, or a
combination of LARB-AZ 0202.2 and LARB-AZ 0202.3.
[0032] In yet another embodiment, there is a composition that
comprises Nannochloropsis strain LARB-AZ 0202.0 deposited at ATCC
Deposit Number PTA-11048 and further comprises a Nannochloropsis
strain LARB-AZ 0202.2 deposited at ATCC Deposit Number PTA-11049 or
Nannochloropsis strain LARB-AZ 0202.3 deposited at ATCC Deposit
Number PTA-11050, or a combination of LARB-AZ 0202.2 and LARB-AZ
0202.3.
[0033] Any of the aforementioned compositions may further comprise
two or more isolated algal strains selected from the group
consisting of Pinguiococcus pyrenoidosus, Aphanocapsa sp.,
Biddulphia aurita, Crypthecodinium sp., Emiliania huxleyi,
Nitzschia alba, Prymnesium parvum, Skeletonema costatum, and
Trichodesmium erythraeum, wherein the Nannochloropsis strain
LARB-AZ 0202.0 or a mutant thereof and the two or more algal
strains make up at least 90% of the algae present in the
composition. For example, the two or more isolated algal strains
comprise one or both of Crypthecodinium sp. and Trichodesmium
erythraeum. In other embodiments, the two or more isolated algal
strains further comprise an algal strain selected from the group
consisting of Pinguiococcus pyrenoidosus, Aphanocapsa sp.,
Biddulphia aurita, Emiliania huxleyi, Nitzschia alba, Prymnesium
parvum, and Skeletonema costatum.
[0034] Also contemplated is a substantially pure culture comprising
a growth medium; and a composition comprising: [0035] (a)
Nannochloropsis strain LARB-AZ 0202.0 deposited at ATCC Deposit
Number PTA-11048; [0036] (b) a Nannochloropsis strain LARB-AZ
0202.2 deposited at ATCC Deposit Number PTA-11049 or
Nannochloropsis strain LARB-AZ 0202.3 deposited at ATCC Deposit
Number PTA-11050, or a combination of LARB-AZ 0202.2 and LARB-AZ
0202.3; [0037] (c) a Nannochloropsis strain LARB-AZ 0202.0
deposited at ATCC Deposit Number PTA-11048 and further comprises a
Nannochloropsis strain LARB-AZ 0202.2 deposited at ATCC Deposit
Number PTA-11049 or Nannochloropsis strain LARB-AZ 0202.3 deposited
at ATCC Deposit Number PTA-I 1050, or a combination of LARB-AZ
0202.2 and LARB-AZ 0202.3 [0038] (d) any of the compositions in (a)
through (c) further comprising two or more isolated algal strains
selected from the group consisting of Pinguiococcus pyrenoidosus,
Aphanocapsa sp., Biddulphia aurita, Crypthecodinium sp., Emiliania
huxleyi, Nitzschia alba, Prymnesium parvum, Skeletonema costatum,
and Trichodesmium erythraeum, wherein the Nannochloropsis strain
LARB-AZ 0202.0 or a mutant thereof and the two or more algal
strains make up at least 90% of the algae present in the
composition. For example, the two or more isolated algal strains
comprise one or both of Crypthecodinium sp. and Trichodesmium
erythraeum. In other embodiments, the two or more isolated algal
strains further comprise an algal strain selected from the group
consisting of Pinguiococcus pyrenoidosus, Aphanocapsa sp.,
Biddulphia aurita, Emiliania huxleyi, Nitzschia alba, Prymnesium
parvum, and Skeletonema costatum.
[0039] Also contemplated herein is a hydrocarbon fraction, produced
by the methods described herein. Also contemplated is an isolated
medium chain hydrocarbon fraction produced by the methods described
herein.
[0040] In particular, the present invention contemplates kerosene
produced by the methods described herein. In specific embodiments,
the Nannochloropsis strain LARB-AZ 0202.0 or a mutant thereof is
grown in a cell culture that comprises 1.5 g/L NaNO.sub.3 and at
high light intensity of 350 .mu.mol photons m.sup.-1s.sup.-1, and
low initial N2 gas concentration of the cell culture of 0.01
g/L.
[0041] The invention further contemplates isolated Nannochloropsis
strain wherein said Nannochloropsis strain comprise a sequence that
is at least 99% identical to any of the sequences set forth in SEQ
ID NO: 1, SEQ ID NO:2 or SEQ ID NO:3.
[0042] Embodiments of the instant invention include methods for
producing algal medium chain length fatty acids or hydrocarbons,
comprising culturing a first algal strain wherein the first algal
strain produces a first medium chain length fatty acid subset
wherein at least about 50% of the fatty acids in the subset are of
a chain length of C16, wherein the culturing is conducted under
conditions suitable to promote the production of the first medium
chain length fatty acid subset; and extracting oil from the first
algal strain to produce a medium chain length combination; wherein
the medium chain length combination comprises carbon chain length
C10, C12, C14 and C16 fatty acids or hydrocarbons, wherein said oil
is enriched for C16 fatty acids such that greater than about 50% of
the fatty acids in said oil are C16 fatty acids. In some
embodiments of the invention, at least about 60% of the fatty acids
in the subset are of a chain length of C16. In others, the oil is
enriched for C16 fatty acids such that greater than about 60% of
the fatty acids in said oil are C16 fatty acids.
[0043] In some embodiments of the invention, the first algal strain
is selected from the group consisting of Nannochloropsis strain
LARB-AZ 0202.0 (ATCC Deposit Number PTA-11048), LARB-AZ 0202.2
(ATCC Deposit Number PTA 11049), LARB-AZ 0202.3 (ATCC Deposit
Number PTA-11050), Nannochloropsis sp., Pinguiococcus pyrenoidosus,
Aphanocapsa sp., Biddulphia aurita, Crypthecodinium sp., Emiliania
huxleyi, Nitzschia alba, Prymnesiumparvum, Skeletonema costatum,
and Trichodesmium erythraeum.
[0044] In yet other embodiments, the method further comprises a
second algal strain selected from the group consisting of
Nannochloropsis strain LARK-AZ 0202.0 (ATCC Deposit Number
PTA-11048), LARB-AZ 0202.2 (ATCC Deposit Number PTA 11049), LARB-AZ
0202.3 (ATCC Deposit Number PTA-1 1050), Nannochloropsis sp.,
Pinguiococcus pyrenoidosus, Aphanocapsa sp., Biddulphia aurita,
Crypthecodinium sp., Emiliania huxleyi, Nitzschia alba,
Prymnesiumparvum, Skeletonema costatum, and Trichodesmium
erythraeum.
[0045] In still other embodiments, the method includes converting
oil extracted from the first algal strain into a hydrocarbon
fraction and refining the hydrocarbon fraction to produce one or
more sub-fractions enriched in medium chain length hydrocarbons,
enriched in carbon chain lengths C8, C10, C12, C14, or C16.
[0046] Further embodiments of the invention also comprise culturing
one or more further algal strains that produce a second medium
chain length fatty acid subset wherein at least about 20% of the
fatty acids in said subset are medium chain length fatty acids,
wherein the culturing is conducted under conditions suitable to
promote the production of the second medium chain length fatty acid
subset. In still others, the method includes a first algal strain
and one or more further algal strains cultured as separate
cultures, or cultured together as a co-culture.
[0047] In some embodiments, the method further comprises generating
one or more sub-fractions enriched in carbon chain length C16. In
still other embodiments, the methods further comprise producing
kerosene from the one or more fractions.
[0048] The method of any one of claims 3-8 wherein the one or more
further algal strains comprises at least a second algal strain and
a third algal strain that is different from said first and second
algal strains and selected from the group consisting of
Nannochloropsis strain LARB-AZ 0202.0 (ATCC Deposit Number PTA-1
1048), LARB-AZ 0202.2 (ATCC Deposit Number PTA 11049), LARB-AZ
0202.3 (ATCC Deposit Number PTA-11050), Nannochloropsis sp.,
Pinguiococcus pyrenoidosus, Aphanocapsa sp., Biddulphia aurita,
Crypthecodinium sp., Emiliania huxleyi, Nitzschia alba,
Prymnesiumparvum, Skeletonema costatum, and Trichodesmium
erythraeum.
[0049] Other embodiments of the instant invention include methods
for producing algal medium chain length fatty acids or
hydrocarbons, comprising culturing one or more of Nannochloropsis
strain LARB-AZ 0202.0 (ATCC Deposit Number PTA-11048), LARB-AZ
0202.2 (ATCC Deposit Number PTA 11049), LARB-AZ 0202.3 (ATCC
Deposit Number PTA-11050), under conditions suitable to promote the
production of a first medium chain length fatty acid subset
comprising at least about 50% C16 fatty acids or hydrocarbons,
culturing one or more further algal strains under conditions
suitable to promote the production of a second medium chain length
fatty acid subset comprising at least about 50% C10 or C14 chain
length fatty acids or hydrocarbons, culturing one or more further
algal strains under conditions suitable to promote the production
of a second medium chain length fatty acid subset comprising at
least about 50% C10 or C12 chain length fatty acids or
hydrocarbons, and extracting oil from the cultured Nannochloropsis
strain LARB-AZ 0202.0 or a mutant thereof and the one or more
further algal strains to produce a medium chain length combination,
wherein the medium chain length combination comprises carbon chain
length C16, C14 and one or more of C10 and C12 fatty acids or
hydrocarbons.
[0050] Some embodiments further comprise converting the medium
chain length combination into a hydrocarbon fraction and further
comprising refining the hydrocarbon fraction to produce one or more
fractions enriched in medium chain length hydrocarbons, wherein the
one or more fractions comprises one or more fractions enriched in
carbon chain length C10, C12, C14, and C16 hydrocarbons. In still
other embodiments, the mutant of Nannochloropsis strain LRB-AZ
20202.0 is a LRB-AZ 0202.2 deposited at ATCC Deposit Number
PTA-11049 or a LRB-AZ 0202.3 deposited at ATCC Deposit Number
PTA-11050.
[0051] In other embodiments, the medium chain length combination is
prepared by combining oil extracted from the Nannochloropsis strain
LRB-AZ 0202.0 or a mutant thereof and the one or more further algal
strains after oil extraction or by extracting oil from a culture
comprising both the Nannochloropsis strain LRB-AZ 0202.0 or a
mutant thereof and the one or more further algal strains. In still
other embodiments, the method further comprises a second algal
strain and a third algal strain, wherein the third algal strain is
selected from the group consisting of Nannochloropsis strain
LARB-AZ 0202.0 (ATCC Deposit Number PTA-11048), LARB-AZ 0202.2
(ATCC Deposit Number PTA 11049), LARB-AZ 0202.3 (ATCC Deposit
Number PTA-11050), Nannochloropsis sp., Pinguiococcus pyrenoidosus,
Aphanocapsa sp., Biddulphia aurita, Crypthecodinium sp., Emiliania
huxleyi, Nitzschia alba, Prymnesiumparvum, Skeletonema costatum,
and Trichodesmium erythraeum.
[0052] In still other embodiments, the methods further comprise
co-culturing a second algal strain which produces a second medium
chain fatty acid subset which is different from the first. In some
embodiments, the second medium chain fatty acid subset comprises
C8, C10, C12, or C14 fatty acids. In yet other embodiments, at
least one medium chain length fatty acid subset comprises at least
about 5% of total dry cell weight.
[0053] In still other embodiments, at least one medium chain fatty
acid subset is isolated from Nannochloropsis sp. or a mutant
thereof. Still other embodiments further comprise converting one or
more medium chain length fatty acid subsets into one or more
hydrocarbon fractions, comprising a deoxygenation/hydroxylation
step. In some embodiments, the hydrocarbon fraction comprises at
least about 50% C16 chain length hydrocarbons. In still others, the
embodiments further comprise blending the one or more hydrocarbon
fractions to generate refined oils enriched with two or more
hydrocarbons of specific carbon chain lengths selected from the
group consisting of C8, C10, C12, C14, and C16. In some embodiments
of the invention, the two or more hydrocarbons of specific chain
lengths are C10 and C12. In still other embodiments, the two or
more hydrocarbons of specific chain lengths are C12 and C14. In yet
others, the two or more hydrocarbons of specific chain lengths are
C10 and C14. In further embodiments, the two or more hydrocarbons
of specific chain lengths are C8 and C10. In still further aspects,
the two or more hydrocarbons of specific chain lengths are C10 and
C16.
[0054] In some embodiments of the invention, the refined oil is
kerosene. In some embodiments, the kerosene comprises a
distribution of hydrocarbons in C8-C16 range. In still others, the
kerosene comprises a distribution of hydrocarbons in the C10-C16,
C8-C14, or C10-C14 range.
[0055] Some embodiments of the invention are compositions
comprising a Nannochloropsis strain LRB-AZ 0202.2 deposited at ATCC
Deposit Number PTA-11049 or Nannochloropsis strain LRB-AZ 0202.3
deposited at ATCC Deposit Number PTA-11050, or a combination of
LRB-AZ 0202.2 and LRB-AZ 0202.3.
[0056] Embodiments of the invention also include methods wherein at
least one algal medium chain fatty acid subset is isolated from any
one of the organisms selected from the group consisting of
Nannochloropsis strain LARB-AZ 0202.0 (ATCC Deposit Number
PTA-11048), LARB-AZ 0202.2 (ATCC Deposit Number PTA 11049), LARB-AZ
0202.3 (ATCC Deposit Number PTA-11050), Nannochloropsis sp.,
Pinguiococcus pyrenoidosus, Aphanocapsa sp., Biddulphia aurita,
Crypthecodinium sp., Emiliania huxleyi, Nitzschia alba,
Prymnesiumparvum, Skeletonema costatum, and Trichodesmium
erythraeum.
[0057] Some embodiments of the methods disclosed herein comprise
growing algal cells under culturing conditions comprising 1.5 g/L
NaNO.sub.3 and at a light intensity of about 350 .mu.mol photons
m.sup.-2 s.sup.-1, and initial N.sub.2 gas concentration of the
cell culture of about 0.01 g/L.
[0058] Some embodiments of the invention include a hydrocarbon
fraction produced by the methods disclosed herein. Others include
an isolated medium chain length hydrocarbon fraction produced by
the methods disclosed herein. Still others include kerosene
produced by the methods disclosed herein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0059] FIG. 1: The effect of light intensities and initial nitrogen
concentrations on growth of LARB-AZ 0202.0 grown in the glass
columns (5 cm in diameter) containing 600 ml of basal F/2 culture
medium. The culture temperature was maintained at 25.degree. C. and
cultures were agitated by bubbling of compressed air containing
1-2% CO2 through a glass capillary tube inserted into the bottom of
the glass column.
[0060] FIG. 2: Effect of initial nitrogen concentrations on cell
dry weight of the cultures at 20 and 350 .mu.mol m.sup.-2 s.sup.-1.
Algal samples were taken on day 3, 6 and 9 of cultivation. Culture
conditions were the same as in FIG. 1.
[0061] FIG. 3: Effect of different initial nitrogen concentrations
and light intensities on cellular neutral lipid content of LARB-AZ
0202.0. Culture conditions were the same as in FIG. 1.
[0062] FIG. 4: Productivity of neutral lipid in LARB-AZ 0202.0
cultures grown at low and high light intensities in the presence of
the different initial nitrogen concentrations. The experimental
conditions were the same as described in FIG. 1.
[0063] FIG. 5: Effect of initial nitrate concentrations on growth
of LARB-AZ 0202.0 in the photobioreactor (PBR) at ASU Algae Test
Bed Facility, ASU Polytechnic campus, Mesa, Ariz. The experiment
was conducted in June, 2009. PBR measured
wide.times.high.times.depth=4'.times.4.times.1.5''. Each PBR unit
contained ca. 50 liters of culture.
[0064] FIG. 6: Effect of initial nitrate concentrations on the
cellular lipid content of LARB-AZ 0202.0 grown in PBR outdoors. The
culture conditions were the same as in FIG. 5.
[0065] FIG. 7: A) Increase in cell dry weight (DW) and ash-free dry
weight (AFDW) (FIG. 7A) with concomitant decrease in nitrogen
concentration (FIG. 7B) in the raceway cultivation of LARB-AZ
0202.0 outdoors.
[0066] FIG. 8: Effect of initial cell concentration on growth of
LARB-AZ 0202.0 in the PBR outdoors.
[0067] FIG. 9: Effect of initial cell concentration on total lipid
content of LARB-AZ 0202.0 in the PBR outdoors.
[0068] FIG. 10: Effect of initial cell concentration on neutral
lipid content of LARB-AZ 0202.0 in the PBR outdoors.
[0069] FIG. 11: Correlation between the lipid content (both total
lipid/neutral lipid) and pigment content (both chlorophyll and
carotenoids) in Nannochloropsis strain LARB-AZ 0202.0 grown in a
thin panel PBR outdoors. Initial cell density of the cultures was
OD 0.6 at 750 nm.
[0070] FIG. 12: Correlation between the lipid content (both total
lipid/neutral lipid) and pigment content (both chlorophyll and
carotenoids) in Nannochloropsis strain LARB-AZ 0202.0 grown in a
thin panel PBR outdoors. Initial cell density of the cultures was
OD 1.6 at 750 nm.
[0071] FIG. 13: Volumetric biomass productivity curves for
Nannochloropsis wild type (LARB-AZ 0202.0; deposited with ATCC
under deposit number PTA-11048 on Jun. 15, 2010), and mutants
(LARB-AZ 0202.2 deposited with ATCC under deposit number PTA-11049
on Jun. 15, 2010 and LARB-AZ 0202.3 deposited with ATCC under
deposit number PTA-11050 on Jun. 15, 2010. Biomass productivity is
plotted as a function of time during growth. Wild type and mutant
strains were cultured at 140 (LL) and 300 (HL) .mu.mol photons
m.sup.-2 s.sup.-1.
[0072] FIG. 14A: 4.sup.th day observation of mutant LARB-AZ 0202.2
(dark color) and wild type Nannochloropsis LARB-AZ 0202.0 (light
color) grown in the flat panel photobioreactors outdoors. FIG. 14B:
Growth kinetics of the wild type LARB-AZ 0202.0 and the mutant
2H-5-8 (LARB-AZ 0202.2) in flat panel photobioreactor outdoors.
[0073] FIG. 15A: 12.sup.th day observation of mutant LARB-AZ 0202.3
(dark color) and wild type Nannochloropsis LARB-AZ 0202.0 (light
color). FIG. 15B. Growth kinetics of the wild type LARB-AZ 0202.0
and the mutant 2H-4-3 (LARB-AZ 0202.3) in flat panel
photobioreactor outdoors.
[0074] FIG. 16: Algal-based jet fuel production.
[0075] FIG. 17: ITS sequence of Nannochloropsis sp. LARB-AZ 0202.0
(SEQ ID NO:1).
[0076] FIG. 18: ITS sequence of Nannochloropsis sp. LARB-AZ 0202.2
(SEQ ID NO:2).
[0077] FIG. 19: ITS sequence of Nannochloropsis sp. LARB-AZ 0202.3
(SEQ ID NO:3).
[0078] FIG. 20: Phylogenetic tree of Nannochloropsis sp. LARB-AZ
0202.0 and mutants LARB-AZ 0202.2 and LARB-AZ 0202.3.
DETAILED DESCRIPTION
[0079] Previous efforts to produce algal oil fractions enriched in
medium chain length fatty acids used a cracking process to break
long chain fatty acids/esters into shorter ones, followed by
further processing. The methods of the present invention do not
require such a cracking process, but instead rely on the use of
algae that endogenously produce medium chain length fatty acids and
not hydrocarbons. As a result, the methods of the invention using
this algal strain allow isolation of algal fatty acids and
processing into a hydrocarbon fraction using, for example, a
deoxygenation step. In particular, the present inventors have
identified a specific strain of Nannochloropsis (LARB-AZ 0202.0)
that comprises a greater than 50% C16 fatty acid content. Indeed,
the Nannochloropsis strain is one which comprises approximately 68%
C16 fatty acids which is greater than any other Nannochloropsis
algal strain identified to date.
[0080] The Nannochloropsis LARB-A 0202.0 can be distinguished from
other Nannochloropsis strains in that it has an ITS sequence that
comprises the sequence of SEQ ID NO:1. The Nannochloropsis LARB-A
0202.2 can be distinguished from other Nannochloropsis strains in
that it has a ITS sequence that comprises the sequence of SEQ ID
NO:2. The Nannochloropsis LARB-A 0202.3 can be distinguished from
other Nannochloropsis strains in that it has a ITS sequence that
comprises the sequence of SEQ ID NO:3. Thus, the present invention
relates to novel Nannochloropsis LARB-A 0202.0 which is deposited
at ATCC Deposit Number PTA-11048, mutants thereof deposited at ATCC
Deposit Number PTA-11049 and ATCC Deposit Number PTA-11049, as well
as Nannochloropsis strains that comprise a ITS sequence that
comprises a sequence that is at least 99%, preferably at least
99.4%, preferably at least 99.5%, or 99.6% or 99.7% or 99.8%
identical to the sequence set forth in SEQ ID NO:1, SEQ ID NO:2 or
SEQ ID NO:3.
[0081] The methods of the invention can produce, for example, more
kerosene-based jet fuel than "common" algal oils which are enriched
with a mixture of long chain fatty acids (C16 to C22) with a given
amount of algal feedstock. As such, the invention can beneficially
reduce capital and operational costs associated with the oil
cracking and separation processes.
[0082] Algal oil from Nannochloropsis LARB-AZ 0202.0 (and the
mutants thereof described herein) enriched in C16 chain length
fatty acids can be used for various purposes, including but not
limited to production of algal-based kerosene substitutes, high
quality detergents, and research reagents (for example, isolated
hydrocarbon fractions of a single chain length for use as standards
that can be optionally labeled for research use).
[0083] As used herein, the phrase "medium chain length fatty acids"
refers to fatty acids and esters thereof that range in carbon chain
length from C8 to C16. The Nannochloropsis strains of the present
invention may be used in combination with two or more other algal
strains (i.e.: 2, 3, 4, 5, or more algal strains) to produce and
accumulate large quantities of medium chain length fatty acids.
"Large quantities" means that 20% or more of total fatty acids
produced by the algal strain are medium-chain length fatty acids.
In a further embodiment, the two or more algal strains produce and
accumulate at least 25% of the fatty acids produced as medium chain
length fatty acids; more preferably, at least 30%, 35%, 40%, 45%,
50%, 55%, or more. Those of skill in the art will understand that
while the algal strains employed produce medium-chain fatty acids,
they may also produce other chain length fatty acids.
[0084] As used herein, the term "algae" or "algal strain" includes
both microalgae and cyanobacteria. In one embodiment, the algae are
eukaryotic microalgae.
[0085] "Suitable conditions" for culturing algae are well known to
those of skill in the art, and include appropriate light conditions
(to promote photosynthetic growth), growth media (nutrients, pH,
etc.), and CO2 supply. The volume of growth medium can be any
volume suitable for cultivation of the algae for methods of the
invention. Any suitable nutrient supply can be used. Such nutrient
supplies can include (or can supplemented by) wastewater or waste
gases. In these embodiments, the methods further provide waste
remediation benefits. For example, nutrient-contaminated water or
wastewater (e.g., industrial wastewater, agricultural wastewater
domestic wastewater, contaminated groundwater and surface water),
or waste gases emitted from power generators burning natural gas or
biogas, and flue gas emissions from fossil fuel fired power plants
can be used as part of the growth medium. In these embodiments, the
algae can be first cultivated in a primary growth medium, followed
by addition of wastewater and/or waste gas. Alternatively, the
algae can be cultivated solely in the waste stream source. When a
particular nutrient or element is added into the culture medium, it
will be taken up and assimilated by the algae. Typically, waste
water is added to the culture medium at a desired rate. This water,
being supplied from the waste water source, contains additional
nutrients, such as phosphates, and/or trace elements (such as iron,
zinc), which supplement the growth of the algae. In one embodiment,
if the waste water being treated contains sufficient nutrients to
sustain the microalgal growth, it may be possible to use less of
the growth medium. As the waste water becomes cleaner due to algal
treatment, the amount of growth medium can be increased. The major
factors affecting waste-stream feeding rate include: 1) algal
growth rate, 2) light intensity, 4) culture temperature, 5) initial
nutrient concentrations in wastewater; 5) the specific uptake rate
of certain nutrients; 6) design and performance of a specific
bioreactor and 7) specific maintenance protocols.
[0086] Growth of the algae can be in any type of system or
photobioreactor. As used herein, a "photobioreactor" is an
industrial-scale culture vessel made of transparent clear materials
(e.g., glass, acrylic, polycarbonate, PVC, etc) in which algae grow
and proliferate. For use in this aspect of the invention, any type
of system or photobioreactor can be used, including but not limited
to open raceways (i.e. shallow ponds (water level ca. 15 to 30 cm
high) each covering an area of 1000 to 5000 m.sup.2 constructed as
a loop in which the culture is circulated by a paddle-wheel, closed
systems, i.e. photobioreactors made of transparent tubes or
containers in which the culture is mixed by either a pump or air
bubbling, tubular photobioreactors and flat plate-type
photobioreactors.
[0087] As used herein, "conditions suitable to promote production"
means that the conditions employed result in algal production of
medium chain length fatty acids equal to at least 5% of total dry
cell weight, and preferably 10%, 15%, 20%, 25%, or more.
[0088] The methods of the invention comprise extracting oil (i.e.:
total fatty acids) from algae. Any suitable process for extracting
oil from the algae can be used, including but not limited to
solvent extraction and supercritical fluid extraction. Initially,
algae are harvested from liquid culture in the photobioreactor
using a suitable harvesting method (such as centrifugation,
dissolved air floatation, membrane filtration, polymer-assisted
flocculation, etc., singularly or in combination). The harvested
algae can then be dried, if desired, using any suitable technique
(such as sun-drying, drum-drying, freeze drying, or spray-drying)
The resulting dried algae can be in any useful form, including but
not limited to a form of algal flour.
[0089] As used herein, a "medium chain length fatty acid subset" is
the set of medium chain length fatty acids produced by a given
algal strain. Thus, culturing an algal strain that can produce
large quantities of a medium chain length fatty acid subset under
conditions suitable to promote production of the medium chain fatty
acid subset, results in production of a medium chain length fatty
acid subset that comprises at least 5% of total dry cell weight.
The subset may comprise medium chain length fatty acids of any
specific chain length or combination of chain lengths. The methods
comprise use of a first algal strain that is a Nannochloropsis
LARB-AZ 0202.0 strain or a mutant thereof that produces a first
medium chain fatty acid subset which comprises at least 50% C16
fatty acids as compared to the total fatty acids produced by the
strain.
[0090] The methods may use the Nannochloropsis LARB-AZ 0202.0
strain of the invention alone, or in combination with one or more
mutants of Nannochloropsis LARB-AZ 0202.0. In further embodiments,
the methods may use Nannochloropsis LARB-AZ 0202.0 strain of the
invention and/or one or more mutants of Nannochloropsis LARB-AZ
0202.0 strain of the invention in combination with one or more
further algal strains to produce a second or further medium chain
fatty acid. Thus, where two algal strains are used, it is
contemplated that the first strain is a Nannochloropsis strain as
described herein and the second strain is another algal strain that
produces a high level of one or more medium chain length fatty acid
subset comprising C10, C12, and C14 fatty acids; likewise, where
three algal strains are used the methods comprise production of
three medium chain fatty acid subsets (where one of the three algal
strains individually produce C16 and the other algal strains
produce other medium chain length fatty acid subset comprising C10,
C12, and C14 fatty acids), and so on.
[0091] As used herein a "medium chain length combination" is a
combined medium-chain length product (fatty acids or hydrocarbons)
from the first algal strain that is a Nannochloropsis LARB-AZ
0202.0 wild type (deposited with ATCC under deposit number
PTA-11048 on June 15, 2010) or a mutant thereof (e.g.,
Nannochloropsis LARB-AZ 0202.2 deposited with ATCC under deposit
number PTA-I 1049 on June 15, 2010 or Nannochloropsis LARB-AZ
0202.3 deposited with ATCC under deposit number PTA-11050 on June
15, 2010) and is responsible for the production of the bulk of C16
fatty acids and hydrocarbons and one or more other algal strains
that are responsible for the production of a medium chain length
combination that comprises carbon chain length C10, C12, and C14
fatty acids or hydrocarbons. The medium chain length combination
may comprise either medium chain length fatty acids or medium chain
length hydrocarbons, depending on the stage of processing.
[0092] In one embodiment, the first algal strain that is a
Nannochloropsis LARB-AZ 0202.0 strain or mutant thereof and the one
or more algal strains are co-cultured; in this case a medium chain
length combination comprising medium chain length fatty acids is
obtained upon oil extraction; if the medium chain length
combination is then further processed to produce a hydrocarbon
fraction (see below), then the medium chain length combination will
comprise medium chain length hydrocarbons after hydrocarbon
fractionation. In another embodiment, the first (i.e., the
Nannochloropsis LARB-AZ 0202.0 strain of the invention or a mutant
thereof) algal strain and the one or more further algal strains are
cultured separately; in this embodiment, the medium chain length
combination is obtained sometime after oil extraction. For example,
the first and second (or further) subsets can be combined
immediately after oil extraction (resulting in a medium chain
length combination comprising medium chain length fatty acids); or
after other steps, such as after hydrocarbon fractionation, or
after production of one or more fractions enriched in medium chain
length hydrocarbons (see below), either of which results in a
medium chain length combination comprising medium chain length
hydrocarbons. As will be apparent to one of skill in the art, if
three or more algal strains are used, they could all be
co-cultured, or a subset could be co-cultured while other algal
strains are cultured separately, and thus the combination of their
medium chain length fatty acid subset or medium chain length
hydrocarbons may comprise multiple combination events.
[0093] Oil extraction from algae can be accompanied by extraction
of other algal biomass that is separated from the oil during the
extraction process. Thus, in another embodiment, the methods of the
invention further comprise isolating algal biomass. Such biomass
can include, but is not limited to, bulk products (useful, for
example, for animal feed and biofertilizer); ethanol and methane
(requires subsequent fermentation; useful, for example, in energy
production); and specialty products, including but not limited to
pigments (chlorophyll), polymers, carotenoids (e.g., beta-carotene,
zeaxanthin, lutein, and astaxanthin), and polyunsaturated fatty
acids.
[0094] The methods of the invention further comprise converting oil
extracted from the first algal strain i.e., Nannochloropsis LARB-AZ
0202.0 strain or mutants thereof or combinations of the
Nannochloropsis LARB-AZ 0202.0 strain and one or more mutants
thereof. Optionally, the methods may further comprise converting
oil extracted from one or more further algal strains into a
hydrocarbon fraction (i.e.: conversion of fatty acids into
hydrocarbons). Any suitable process for converting algal fatty
acids into hydrocarbons can be used, including but not limited to a
deoxygenation/hydroxylation process, such as by chemical catalysis
or hydrogen loading. A medium chain length combination prepared
following hydrocarbon fractionation comprises medium chain length
hydrocarbons. Such a medium chain length combination can be
produced in whole or in part (by combination of hydrocarbon
fractions produced from less than all of the algal strains
employed) after hydrocarbon fractionation, or hydrocarbon
fractionation can be performed separately on oil extracted from
each algal strain. At least 30% of the hydrocarbons present in the
hydrocarbon fraction are medium chain length hydrocarbons; in
further embodiments, at least 35%, 40%, 45%, 50%, 55%, or more of
the hydrocarbons present in the hydrocarbon fraction are medium
chain length hydrocarbons.
[0095] As will be apparent to those of skill in the art, byproducts
of hydrocarbon conversion, such as lighter fractions of
hydrocarbons (e.g., C1-C6) and/or glycerol (glycerin), can also be
obtained during hydrocarbon fractionation. Thus in a further
embodiment, the methods further comprises isolating short-chain
hydrocarbon molecules (C1-C6) and/or glycerol. The short chain
hydrocarbons can be used, for example, to make tail gas or
gasoline. Glycerol has many uses, including but not limited to use
in pharmaceutical products (used as/in, for example, lubricants,
humectants, expectorants, cough syrups, etc.), personal care
products (used as/in, for example, emollients, lubricants,
humectants, solvents, toothpastes, mouthwashes, skin care products,
soap, etc.) and food/beverage products (sweetener, filler,
etc.).
[0096] In a further embodiment, the methods comprise refining the
hydrocarbon fraction to produce one or more fractions enriched in
medium chain length hydrocarbons, wherein the one or more fractions
comprise one or more fractions enriched in C16 chain length as well
as one or more fractions enriched in carbon chain length C10, C12,
and/or C14 hydrocarbons. For example, a separation/refining
technology separates and concentrates desirable hydrocarbon
fractions from a deoxygenation process, resulting in a series of
refined fractions enriched with one or more hydrocarbons of
specific carbon chain lengths. A medium chain length combination
prepared following refining comprises medium chain length
hydrocarbons. Such a medium chain length combination can be
produced in whole or in part (by combination of hydrocarbons
produced from less than all of the algal strains employed) after
refining, or refining can be performed separately on hydrocarbon
fractions from each algal strain. The one or more fractions can
comprise a single fraction that comprises the C16 chain length
enriched fatty acids from the Nannochloropsis LARB-AZ 0202.0 wild
type or mutants thereof in combination with the C10, C12, and C14
chain length hydrocarbons from the other algal strains, four
separate fractions, one comprising the C16 chain length enriched
hydrocarbons from the Nannochloropsis LARB-AZ 0202.0 wild type or
mutants thereof, one comprising C10 chain length hydrocarbons, one
comprising C12 chain length hydrocarbons, and one comprising C14
chain length hydrocarbons, or other variations thereof. At least
90% of the hydrocarbons present in each fraction enriched in medium
chain length hydrocarbons are of the desired chain length(s)
hydrocarbon; in various further embodiments at least 91%, 92%, 93%,
94%, 95%, 96%, 97%, 98%, 99%, or more of the hydrocarbons present
in each fraction enriched in medium chain length hydrocarbons are
of the desired chain length(s) hydrocarbon.
[0097] Any suitable refining process can be used that serves to
separate and concentrate fractions enriched in medium chain length
fatty acids. In various embodiments, the refining comprises vacuum
distillation or molecular distillation to separate and purify
medium-chain (C8-C16) fatty acid (FA) or fatty acid methyl ester
(FAME) from long-chain fatty acids (C18 or longer) or FAME. Vacuum
distillation has been extensively used in petroleum refining,
whereas molecular distillation is a newer technology that has been
proved to be effective in separating one liquid from complex liquid
mixtures. The vacuum distillation is similar in principle with the
conventional fractional distillation (commonly called atmospheric
distillation to distinguish it from the vacuum method), except that
larger-diameter columns are used in vacuum distillation to maintain
comparable vapor velocities at reduced operating pressures. A
vacuum of 50 to 100 millimeters of mercury absolute is produced by
a vacuum pump or steam ejector. The major advantage of vacuum
distillation is that it allows for distilling heavier materials at
lower temperatures than those that would be required at atmospheric
pressure, thus avoiding thermal cracking of the components. An
extension of the distillation process, superfractionation employs
smaller-diameter columns with a much larger number of trays (100 or
more) and reflux ratios exceeding 5:1. With such equipment it is
possible to isolate a very narrow range of components or even pure
compounds. Common applications involve the separation of
high-purity solvents such as isoparaffins or of individual aromatic
compounds for use as petrochemicals.
[0098] Molecular distillation is characterized by short exposure of
the distilled liquid to elevated temperatures, high vacuum in the
distillation space, and a small distance between the condenser and
evaporator. The short residence of the liquid on the evaporating
cylinder, in the order of a few seconds to 1 min, is guaranteed by
distributing the liquid in the form of a uniform thin film. By
reducing the pressure of non-condensable gas in the evaporator to
lower than 0.1 Pa, a reduction in distillation temperatures can be
obtained. Molecular distillation shows promise in the separation,
purification and concentration of natural products, usually
composed of complex and thermally sensitive molecules. Furthermore,
this process has advantages over other techniques that use solvents
as the separating agent, avoiding problems with toxicity.
Centrifugal and falling films are two basic types of molecular
distillation units that use short exposure of the distilled liquid
to the evaporating cylinder. These types of distillation units have
been used to demonstrate and compare the distillation of many
different compounds, such as fatty acids, including the isomers
with same carbon numbers in the molecular structures (for example:
this technology can be used to separate C18: 3 from C18: 2 , C18: 1
or C18: 0).
[0099] The refining process results in one or more refined oils
enriched in carbon chain length C16 fatty acids. The refining
process may further lead to refined oils enriched with one or more
medium chain length fatty acids (for example, C10, C11, C12, C13,
or C14).
[0100] In another embodiment, the methods further comprise blending
one or more of the medium chain length hydrocarbon fractions. Such
blending can comprise any combination of medium chain length fatty
acid fractions desired for a given purpose (i.e.: C10 and C12; C12
and C14; C10 and C14; C8, C10 and C16, etc.). For example, blending
can result in a series of refined oils enriched with two or more
hydrocarbons of specific carbon chain lengths.
[0101] In one embodiment, blending can be used to produce kerosene.
As used herein, "kerosene" is a distribution of a variety of
hydrocarbons in the C8-C16 range; preferably in the C10-C16,
C8-C14, or C10-C14 range, and can be used, for example, in jet
engine fuel (including but not limited to Jet-A, Jet-A1, Jet-B,
JP-4, JP-5, JP-7, and JP-8); rocket fuel (including but not limited
to RP-1); heating fuel (such as in kerosene heaters, portable
stoves, and other heating sources); and to power appliances where
electrical power is not otherwise available. It will be understood
by those of skill in art that the kerosene can also be produced by
appropriate production of medium chain length hydrocarbon fractions
from the hydrocarbon fraction. In one embodiment, producing
kerosene comprises combining two or more of the fractions enriched
in medium chain hydrocarbons, where the resulting kerosene
comprises at least 50% C16 chain length hydrocarbons extracted and
prepared from the Nannochloropsis LARB-AZ 0202.0 strain of the
present invention or mutants thereof (including Nannochloropsis
LARB-AZ 0202.2, Nannochloropsis LARB-AZ 0202.3, and Nannochloropsis
strains that comprise a ITS sequence that comprises a sequence at
least 99.4% identical to the sequence of any of SEQ ID NO:1, SEQ ID
NO:2 or SEQ ID NO:3) along with additional amounts of C10, C12, and
C14 chain length hydrocarbons from other algal strains; in various
further embodiments, at least 55%, 60%, 65%, 70%, 75%, 89%, 85%,
90%, 95%, 98% of carbon chain length C10, C12, and C14
hydrocarbons. The fractions so combined may comprise medium chain
length hydrocarbons of the same type or different. In another
embodiment, the kerosene may further comprise carbon chain length
C16, C8 and/or C9 fatty acids each, if present, at 15% or less of
the total hydrocarbon present in the kerosene; in preferred
embodiments, each, if present, at less than 10%, 9%, 8%, 7%, 6%,
5%, 4%, 3%, 2% or less of the total hydrocarbon present in the
kerosene.
[0102] Acceptable JP-8 surrogate fuel can thus be obtained by the
blending of one or more fractions enriched in medium chain length
hydrocarbons along with other additives according to the
specification and qualification of petroleum derived JP-8 or other
aviation fuels.
[0103] In a further embodiment the first algal strain that is a
Nannochloropsis LARB-AZ 0202.0 or a mutant thereof is combined with
one or more further algal strains are selected from the group
consisting of Pinguiococcus pyrenoidosus, Aphanocapsa sp. (Kenyon,
1972), Biddulphia aurita (Orcutt & Patterson 1975),
Crypthecodinium sp., Emiliania huxleyi (Volkman et al. 1981),
Nitzschia alba (Tornabene et al. 1974), Prymnesium parvum (Lee
& Loeblich 1971), Skeletonema costatum (Ackman et al. 1964),
and Trichodesmium erythraeum (Parker et al. 1967). The types of
medium chain fatty acids produced these organisms (and thus the
potential medium chain fatty acid subsets) can be found in
WO/2008/036654 Table 1 and FIG. 1; based on the teachings herein,
those of skill in the art will understand which algal strains to
use, depending on the type of medium chain length combination
desired. In specific embodiments, the algal strains are identified
as follows:
[0104] Pinguiococcus pyrenoidosus (Pinguiophyceae) CCMP 2078
[0105] Crypthecodinium sp. CCMP 316
[0106] Aphanocapsa sp.: CCMP2524
[0107] Odontella aurita: CCMP145
[0108] Emiliania huxleyi: CCMP1742
[0109] Nitzschia alba: CCMP2426
[0110] Prymnesium parvum: CCMP1962
[0111] Skeletonema costatum: CCMP1281
[0112] Trichodesmium sp.: CCMP1985
[0113] All of the algal strains can be obtained from CCMP address:
Provasoli-Guillard National Center for the Culture of Marine
Phytoplankton, Bigelow Laboratory for Ocean Sciences, P.O. Box 475,
180 McKown Point Road, West Boothbay Harbor, Me. 04575, U.S.A.)
[0114] The present invention provides methods for producing algal
medium chain length fatty acids, comprising [0115] (a) cultures of
Nannochloropsis LARB-0202.0 (deposited with ATCC under deposit
number PTA-11048 on June 15, 2010) or mutants thereof
((Nannochloropsis LARB-AZ 0202.2 deposited with ATCC under deposit
number PTA-11049 on Jun. 15, 2010 and Nannochloropsis LARB-AZ
0202.3 deposited with ATCC under deposit number PTA-11050 on Jun.
15, 2010) deposited under the Budapest Treaty Form (BP/1) with the
American Type Culture Collection (ATCC), IP Licensing and Services,
10801 University Boulevard, Manassas, Va. 20110-2209, USA under
conditions to maintain viability and integrity of cultures for
subsequent production of medium chain length fatty acids); and
[0116] (b) extracting oil from the cultured Nannochloropsis LARB-AZ
0202.0 wild type and mutants thereof (LARB-AZ 0202.2 and LARB-AZ
0202.3) wherein at least 50% of the total fatty acids in the
extracted oil comprise C16 chain length fatty acids.
[0117] The inventors have discovered that Nannochloropsis LARB-AZ
0202.0 and mutants thereof (LARB-AZ 0202.2 and LARB-AZ 0202.3, such
as the strains deposited at ATCC under deposit numbers PTA-11048,
PTA-11049, and PTA-11050, respectively, on Jun. 15, 2010, are
capable of producing large amounts of C16 chain length medium chain
length fatty acids. Thus, the methods of the invention can be used
for various purposes, including but not limited to production of
algal-based kerosene substitutes, high quality detergents, and
research reagents (for example, isolated hydrocarbon fractions of a
single chain length for use as standards that can be optionally
labeled for research use).
[0118] In a further embodiment, the methods comprise converting oil
extracted from Nannochloropsis LARB-AZ 0202.0, and mutants thereof
(LARB-AZ 0202.2, LARB-AZ 0202.3) into a hydrocarbon fraction, where
hydrocarbon fraction comprises at least 50% C16 chain length
hydrocarbons as isolated from the Nannochloropsis LARB-AZ 0202.0
wild type or mutants thereof (LARB-AZ 0202.2 and LARB-AZ
0202.3).
[0119] In another embodiment, the methods further comprise refining
the hydrocarbon fraction to produce one or more fractions enriched
particularly in C16 medium chain length hydrocarbons, wherein the
one or more fractions comprises at least one fraction enriched in
carbon chain length C16 hydrocarbons. In a further embodiment, the
one or more fractions comprise at least one fraction enriched in
carbon chain length C14 hydrocarbons or C18 hydrocarbons. In a
further embodiment, the method further comprises blending the one
or more fractions enriched in medium chain length hydrocarbons to
produce, for example, kerosene. Such blending may further comprise
blending with medium chain length hydrocarbon fractions derived
from another algal strain, such as C14 and C16 producer such as for
example Pinguiococcus pyrenoidosus variant CCMP 2078 and/or a
producer of C10 and/or C12 chain length hydrocarbon chains (for
example, those derived from Crypthecodinium sp. and/or
Trichodesmium erythraeum). These methods of the invention may also
comprise isolating algal biomass, and/or isolating short-chain
hydrocarbon molecules and/or glycerol, as disclosed in the methods
described above.
[0120] In addition, the present invention provides methods for
producing algal medium chain length fatty acids or hydrocarbons,
comprising [0121] (a) culturing Nannochloropsis LARB-AZ 0202.0 and
mutants thereof (LARB-AZ 0202.2 and LARB-AZ 0202.3) under
conditions to promote production of C16 chain length fatty acids;
[0122] (b) culturing one or more further algal strains that can
produce and accumulate large quantities of such as C14 and/or C10
and/or C12 chain length fatty acids, wherein the culturing is
conducted under conditions suitable to promote production of the
C14 and/or C10 and/or C12 chain length fatty acids; and [0123] (c)
extracting oil from the cultured Nannochloropsis LARB-AZ 0202.0 and
mutants thereof (LARB-AZ 0202.2 and LARB-AZ 0202.3) and the one or
more further algal strains to produce a medium chain length
combination; wherein the medium chain length combination comprises
carbon chain length C16 and one or more of carbon chain length C14
and C10 and C12 fatty acids or hydrocarbons.
[0124] Such methods of the invention can be used for various
purposes, including but not limited to production of algal-based
kerosene substitutes, high quality detergents, and research
reagents (for example, isolated hydrocarbon fractions of a single
chain length for use as standards that can be optionally labeled
for research use). In various embodiments, the one or more further
algal strains are one or more of Pinguiococcus pyrenoidosus,
Crypthecodinium sp. and Trichodesmium erythraeum. In a further
embodiment, the medium chain length combination comprises carbon
chain length C16 as derived from Nannochloropsis LARB-AZ 0202.0 or
mutants thereof (LARB-AZ 0202.2 and LARB-AZ 0202.3), C10, C12, as
derived from Crypthecodinium sp. and Trichodesmium erythraeum and
C14 fatty acids or hydrocarbons as derived from Pinguiococcus
pyrenoidosus. In a further embodiment, the medium chain length
combination is prepared by combining oil extracted from the
Nannochloropsis LARB-AZ 0202.0 or mutants thereof (LARB-AZ 0202.2
and LARB-AZ 0202.3) and the one or more further algal strains after
oil extraction. In a further embodiment, the medium chain length
combination is prepared by extracting oil from a culture comprising
both the Nannochloropsis LARB-AZ 0202.0 or mutants thereof (LARB-AZ
0202.2, LARB-AZ 0202.3) and the one or more further algal strains
(including e.g., Pinguiococcus pyrenoidosus).
[0125] In a further embodiment, the methods comprise converting oil
extracted from Nannochloropsis LARB-AZ 0202.0 or mutants thereof
(LARB-AZ 0202.2, LARB-AZ 0202.3) and the one or more further algal
strains into a hydrocarbon fraction, where hydrocarbon fraction is
as defined above. In another embodiment, the methods further
comprise refining the hydrocarbon fraction to produce one or more
fractions enriched in medium chain length hydrocarbons, wherein the
one or more fractions comprises one or more fractions enriched in
C16 carbon chain length as derived from Nannochloropsis LARB-AZ
0202.0 or mutants thereof (LARB-AZ 0202.2, LARB-AZ 0202.3) and one
or more fractions enriched in C10, C12, and/or C14 hydrocarbons as
derived from other algal strains. In a further embodiment, the one
or more fractions comprise at least one fraction enriched in carbon
chain length C16 hydrocarbons from Nannochloropsis LARB-AZ 0202.0
or a mutant thereof (LARB-AZ 0202.2, LARB-AZ 0202.3). In a further
embodiment, the method further comprises blending one or more of
the fractions enriched in medium chain length hydrocarbons to, for
example, produce kerosene. These methods of the invention may also
comprise isolating algal biomass, and/or isolating short-chain
hydrocarbon molecules and/or glycerol, as described above. In a
further embodiment of any of the above methods, the one or more
further algal strains comprises a second algal strain and a third
algal strain, wherein the third algal strain is selected from the
group consisting of Aphanocapsa sp., Biddulphia aurita,
Crypthecodinium sp., Emiliania huxleyi, Nitzschia alba, Prymnesium
parvum, Skeletonema costatum, and Trichodesmium erythraeum.
[0126] The present invention also provides methods for producing
algal medium chain length fatty acids or hydrocarbons, comprising
[0127] (a) culturing Nannochloropsis LARB-AZ 0202.0 or mutants
thereof (such as for example
[0128] LARB-AZ 0202.2, LARB-AZ 0202.3 or a Nannochloropsis strain
derived from LARB-AZ 0202.0 that comprises a ITS sequence that is
at least 99.4% identical with the sequence of SEQ ID NO: 1, SEQ ID
NO:2 or SEQ ID NO:3) or a combination of Nannochloropsis LARB-AZ
0202.0 with one or more mutants thereof under conditions to promote
production of medium chain length fatty acids, wherein the medium
chain length fatty acids comprise C16 chain length fatty acids;
[0129] (b) culturing Trichodesmium erythraeum under conditions to
promote production of medium chain length fatty acids, wherein the
medium chain length fatty acids comprise C10 chain length fatty
acids; [0130] (c) culturing Crypthecodinium sp. under conditions to
promote production of medium chain length fatty acids, wherein the
medium chain length fatty acids comprise C12 chain length fatty
acids; [0131] (d) culturing Pinguiococcus pyrenoidosus. under
conditions to promote production of medium chain length fatty
acids, wherein the medium chain length fatty acids comprise C14
chain length fatty acids; and [0132] (e) extracting oil from the
cultured Nannochloropsis LARB-AZ 0202.0 or mutants thereof (LARB-AZ
0202.2, LARB-AZ 0202.3), Trichodesmium erythraeum, the
Crypthecodinium sp. And the Pinguiococcus pyrenoidosus to produce a
medium chain length combination; wherein the medium chain length
combination comprises carbon chain length C16, C10, C12 and C14
fatty acids or hydrocarbons.
[0133] The methods of the invention can be used for various
purposes, including but not limited to production of algal-based
kerosene substitutes, high quality detergents, and research
reagents (for example, isolated hydrocarbon fractions of a single
chain length for use as standards that can be optionally labeled
for research use). In one embodiment, the medium chain length
combination further comprises carbon chain length C14 fatty acids
or hydrocarbons. In a further embodiment, the methods further
comprise (d) culturing one or more algal strains selected from the
group consisting of Pinguiococcus pyrenoidosus, Aphanocapsa sp.,
Biddulphia aurita, Emiliania huxleyi, Nitzschia alba, Prymnesium
parvum, and Skeletonema costatum under conditions to promote
production of medium chain length fatty acids, wherein the medium
chain length fatty acids comprise C14 and/or C16 chain length fatty
acids; and (e) extracting oil from the cultured one or more algal
strains to be included in the medium chain length combination; and
wherein the medium chain length combination comprises carbon chain
length C14 and/or C16 fatty acids or hydrocarbons.
[0134] In a further embodiment, the medium chain length combination
is prepared by combining oil extracted from the culture
Trichodesmium erythraeum and Crypthecodinium sp. after oil
extraction. In another embodiment, the medium chain length
combination is prepared by extracting oil from a culture comprising
both the Trichodesmium erythraeum and Crypthecodinium sp. In
another embodiment, the medium chain length combination is prepared
by combining oil extracted from the culture Trichodesmium
erythraeum, Crypthecodinium sp., and the one or more algal strains
after oil extraction. In a further embodiment, the medium chain
length combination is prepared by extracting oil from a culture
comprising the Trichodesmium erythraeum, the Crypthecodinium sp.,
and the one or more algal strains. In a further embodiment, the
methods further comprise converting the oil extracted from the
algal strains into a hydrocarbon fraction, as defined above.
[0135] The methods may further comprise refining the hydrocarbon
fraction to produce one or more fractions enriched in medium chain
length hydrocarbons, wherein the one or more fractions comprises
one or more fractions enriched in carbon chain length C10 and C12
hydrocarbons, and optionally C14 and/or C16 hydrocarbons. The
methods may further comprise blending one or more of the fractions
enriched in medium chain length hydrocarbons to, for example,
produce kerosene. In various further embodiments, the methods
further comprise isolating algal biomass, and/or isolating
short-chain hydrocarbon molecules and/or glycerol, as discussed
above.
[0136] The present invention also provides compositions comprising
isolated Nannochloropsis strains. In one embodiment, the invention
provides a composition comprising Nannochloropsis strain LARB-AZ
0202.0 deposited at ATCC Deposit Number PTA-11048. The invention
also provides a composition comprising a Nannochloropsis strain
LARB-AZ 0202.2 deposited at ATCC Deposit Number PTA-11049 or
Nannochloropsis strain LARB-AZ 0202.3 deposited at ATCC Deposit
Number PTA-11050, or a combination of LARB-AZ 0202.2 and LARB-AZ
0202.3. In addition, the invention also provides a composition
comprising Nannochloropsis strain LARB-AZ 0202.0 deposited at ATCC
Deposit Number PTA-11048 and a Nannochloropsis strain LARB-AZ
0202.2 deposited at ATCC Deposit Number PTA-11049 or
Nannochloropsis strain LARB-AZ 0202.3 deposited at ATCC Deposit
Number PTA-11050, or a combination of LARB-AZ 0202.2 and LARB-AZ
0202.3.
[0137] The present invention further provides a composition that
combines the Nannochloropsis strains of the invention with other
algal strains. For example, the present invention further provides
a composition comprising two or more isolated algal strains
selected from the group consisting of Nannochloropsis LARB-AZ
0202.0 or mutants thereof (such as e.g., LARB-AZ 0202.2, LARB-AZ
0202.3), Pinguiococcus pyrenoidosus, Aphanocapsa sp., Biddulphia
aurita, Crypthecodinium sp., Emiliania huxleyi, Nitzschia alba,
Prymnesium parvum, Skeletonema costatum, and Trichodesmium
erythraeum, wherein the two or more algal strains make up at least
90% of the algae present in the composition. In further
embodiments, at least 95%, 98%, or 99% of the algae present in the
composition are of the recited algal type. The isolated algal
composition can be cultured or stored in solution, frozen, dried,
or on solid agar plates. Alternatively, the compositions may
comprise harvested algal compositions (wet or dried) in, for
example, the form of an algal flour. In specific embodiments, the
algal strains are identified as follows:
[0138] Pinguiococcus pyrenoidosus (Pinguiophyceae): CCMP 2078
[0139] Crypthecodinium sp.: CCMP 316
[0140] Aphanocapsa sp.: CCMP2524
[0141] Odontella aurita: CCMP145
[0142] Emiliania huxleyi: CCMP1742
[0143] Nitzschia alba: CCMP2426
[0144] Prymnesium parvum: CCMP1962
[0145] Skeletonema costatum: CCMP1281
[0146] Trichodesmium sp.: CCMP1985
[0147] The above algal strains can be obtained from CCMP address:
Provasoli-Guillard National Center for the Culture of Marine
Phytoplankton, Bigelow Laboratory for Ocean Sciences, P.O. Box 475,
180 McKown Point Road, West Boothbay Harbor, Me. 04575, U.S.A.)
[0148] The algal compositions of invention can be used, for
example, in the methods of the invention for the production of
medium chain length fatty acids and hydrocarbons therefrom. In one
embodiment, the composition comprises three or more isolated algal
species selected from the group. In a further embodiment, the two
or more isolated algal strains comprise Nannochloropsis LARB-AZ
0202.0 (ATCC deposit no. PTA-11048) or mutants thereof (e.g.,
LARB-AZ 0202.2 ATCC deposit no. PTA-11049, and LARB-AZ 0202.3 ATCC
deposit no. PTA-11050). In a further embodiment, the two or more
isolated strains further comprise Pinguiococcus pyrenoidosus. In a
still further embodiment, the two or more isolated algal strains
comprise one or both of Crypthecodinium sp. and Trichodesmium
erythraeum.
[0149] In addition, the present invention provides a substantially
pure culture comprising
[0150] (a) growth medium; and
[0151] (b) the composition of mixture of isolated algal strains as
described above.
[0152] As used herein, the term "growth medium" refers to any
suitable medium for cultivating algae of the present invention. The
algae of the invention can grow photosynthetically on CO2 and
sunlight, plus a minimum amount of nutrients. The volume of growth
medium can be any volume suitable for cultivation of the algae for
any purpose, whether for standard laboratory cultivation, to large
scale cultivation for use in, for example, medium chain fatty acid
production. Suitable algal growth medium can be any such medium,
including but not limited to BG-11 growth medium (see, for example,
Rippka, 1979); culturing temperatures of between 10.degree. and
38.degree. C. are used; in other embodiments, temperature ranges
between 15.degree. and 30.degree. are used. Similarly, light
intensity between 20 .mu.mol photons m.sup.-2 s.sup.-1 to 1000
.mu.mol photons m.sup.-2 s.sup.-1 is used; in various embodiments,
the range may be 100 .mu.mol photons m.sup.-2 s.sup.-1 to 500
.mu.mol photons m.sup.-2 s.sup.-1 or 150 .mu.mol photons m.sup.-2
s.sup.-1 to 250 .mu.mol photons m.sup.-2 s.sup.-1. Further,
aeration is carried out with between 0% and 20% CO2; in various
embodiments, aeration is carried out with between 0.5% and 10%
CO.sub.2, 0.5% to 5% CO.sub.2, or 0.5% and 2% CO.sub.2.
[0153] For maintenance and storage purposes, the compositions of
the invention may be maintained in standard artificial growth
medium. For regular maintenance purposes, the compositions can be
kept in liquid cultures or solid agar plates under either
continuous illumination or a light/dark cycle of moderate ranges of
light intensities (10 to 40 .mu.mol m.sup.-2 s.sup.-1) and
temperatures (18.degree. C. to 25.degree. C.). The culture Ph may
vary from pH 6.5 to pH 9.5. No CO2 enrichment is required for
maintenance of the compositions. In various non-limiting examples,
the temperature of culture medium in growth tanks is preferably
maintained at from about 10.degree. C. to about 38.degree. C., in
further embodiments, between about 20.degree. C. to about
30.degree. C. In various embodiments, the growth medium useful for
culturing the compositions of the present invention comprises
wastewater or waste gases, as discussed above.
[0154] The present invention further provides an algal-derived
hydrocarbon fraction. In one embodiment, the algal-derived
hydrocarbon fraction is produced by the methods described herein
above. Preferably, at least 30% of the hydrocarbons present in the
hydrocarbon fraction are medium chain length hydrocarbons; in
further embodiments, at least 35%, 40%, 45%, 50%, 55%, or more of
the hydrocarbons present in the hydrocarbon fraction are medium
chain length hydrocarbons. More preferably, at least 90% of the
hydrocarbons present in each fraction enriched in medium chain
length hydrocarbons are of the desired chain length(s) hydrocarbon;
in various further embodiments at least 91%, 92%, 93%, 94%, 95%,
96%, 97%, 98%, 99%, or more of the hydrocarbons present in each
fraction enriched in medium chain length hydrocarbons are of the
desired chain length(s) hydrocarbon.
[0155] In addition, the present invention provides algal-derived
kerosene. In one embodiment, algal-derived kerosene is produced
from the fatty acids and hydrocarbons that are produced by the
methods described above. In particular, producing kerosene may
comprise combining two or more of the fractions enriched in medium
chain hydrocarbons, where the resulting kerosene comprises at least
50% C16 hydrocarbons derived from Nannochloropsis LARB-AZ 0202.0 or
mutants thereof (LARB-AZ 0202.2, LARB-AZ 0202.3) in combination
with C10, C12, and C14 chain length hydrocarbons; in various
further embodiments, at least 55%, 60%, 65%, 70%, 75%, 89%, 85%,
90%, 95%, 98% of carbon chain length C10, C12, and C14
hydrocarbons. The fractions so combined may comprise medium chain
length hydrocarbons of the same type or different. In another
embodiment, the kerosene may further comprise carbon chain length
C16, C8 and/or C9 fatty acids each, if present, at 15% or less of
the total hydrocarbon present in the kerosene; in preferred
embodiments, each, if present, at less than 10%, 9%, 8%, 7%, 6%,
5%, 4%, 3%, 2% or less of the total hydrocarbon present in the
kerosene.
Exemplary Embodiments
EXAMPLE 1
[0156] A general process diagram of the proposed algae-based jet
fuel production technology is shown in FIG. 14.
[0157] In various non-limiting examples, the following processes
can be carried out in conjunction with algae-based medium chain
length fatty acid production: [0158] Production of algal feedstock
using a number of selected algal species grown in one or more
photobioreactors of same or different designs. Each selected algal
species will produce large quantities of oil enriched with one or
more medium-chain length fatty acids/esters. [0159] Oil-rich cells
are harvested and dried in a form of algal flour. [0160] Algal
flour is subjected to solvent extraction using a chemical
extraction method. A supercritical liquid extraction method can
also be employed as an alternative. [0161] Resulting algal oil is
subjected to a deoxygenating/hydroxylation process to convert algal
oil to hydrocarbons. [0162] A separation/refining technology
separates and concentrates desirable hydrocarbon fractions from the
deoxygenation process. As a result, a series of refined oils
enriched with one or more hydrocarbons of specific carbon chain
lengths will be produced. [0163] Acceptable JP-8 surrogate fuel is
obtained by the blending of several refined algal oils along with
other additives according to the specification and qualification of
petroleum derived JP-8 or other aviation fuels. [0164] As a
by-product from algal oil extraction, algal biomass residues are
prepared and used as bulk material in, for example, protein-rich
animal feed or polysaccharide-rich biopolymers and fertilizer. Some
specialty products such as high-value carotenoids (e.g.,
beta-carotene, zeaxanthin, lutein, and astaxanthin) can also be
extracted and separated from selected algal strains. [0165] High
carbohydrate-containing biomass residues from oil extraction
process can also be obtained and used a substrate for fermentation
or anaerobic digestion to produce ethanol and/or methane, which in
turn can be used to generate electricity/energy necessary for algal
mass culture and oil processing/refinery processes. Remaining
undigested biomass residues can be incinerated for additional heat
and electricity. The generation of CO2 from anaerobic digestion and
incineration processes can be recycled back into the
photobioreactor to be used by the algae, resulting in zero net CO2
emissions. [0166] The methods of the invention employ algae for
medium chain fatty acid extraction and conversion into
hydrocarbons, thus minimizing or eliminating the need to use
cracking for hydrocarbon production, thus greatly reducing costs
and energy consumption. Furthermore, resulting short-chain
hydrocarbon molecules can be isolated as by-products of the methods
to make tail gas or gasoline.
EXAMPLE 2
[0167] The inventors have performed screening for medium-chain
oil-producers from numerous algal species/strains isolated by and
maintained in their laboratory. One of the algal strains tested is
a marine alga Nannochloropsis LARB-AZ 0202.0 ATCC Number PTA-11048
and mutants thereof (LARB-AZ 0202.2 ATCC Number PTA-11049 and
LARB-AZ 0202.3 ATCC Number PTA-11050, which have the ability to
produce lipids enriched with C16 fatty acid, which can make up at
least 50% to 60% of total fatty acids produced in the cell. LARB-AZ
0202.0 is a Nannochloropsis strain that was originally isolated by
Qiang Hu from the Red Sea near Eilat, Israel in March 2007. The
algal strain was isolated using a standard agar plating approach
and has been since maintained in F/2 artificial culture medium at
room temperature and continuous illumination of ca. 20 .mu.mol
m.sup.-2 s.sup.-1.
[0168] GC/MS analysis of the fatty acid composition of
Nannochloropsis strain LARB-AZ 0202.0 showed that the medium chain
fatty acids (C14 and C16) represented ca. 72% and the long chain
fatty acids (C18 through C20) represented approximately 28% of
total fatty acids in the cells. The content of medium chain fatty
acids in Nannochloropsis strain LARB-AZ 0202.0 is the highest or
among the highest in Nannochloropsis strains reported thus far
(Table 1).
TABLE-US-00001 TABLE 1 Comparison of Fatty Acids Profiles of
Nannochloropsis LRB-AZ 0202.0 and other Nannochloropsis strains
published in literature. N. sp N. oculata N. sp N. sp Kobayashi
LRB- N. sp N. sp (Droop) Xu Fang et al., 2008 N. sp N. occanica AZ
Hu et al., Roncarati et al., et al., NLP Gouveia et Seychelles
Patil et al., Fatty Acids 0202.0 2003 et al., 2004 2004 2004 N. sp
PLP al., 2009 et al., 2009 2007 C14:0 3.32 4.1-5.7 2.51 2.39 5.2
4.3 4.6 3.6 7.16 16.9 16.9 C14:1 0.04 0.02 C15:0 0.36 0.48 0.65
C15:1 0.23 C16:0 41.79 24.4-31.8 14.39 14.53 25.1 24.6 20.3 21.3
23.35 17.2 17.2 C16:1 27.54 25.1-27.9 19.49 15.67 27.1-30.8 30.2
17.5 14.4 26.87 18.2 18.2 C17:1 0.04 10.50 4.12 C18:0 1.56 0.5-1.2
11.28 1.83 1.1-2.1 1.1 0.6 0.3 0.45 1.8 1.8 C18:1 n9c 16.03 7.1-10
5.59 10.12 7.1-10.4 11.0 7.4 7.6 13.20 4.1 4.1 C18:2 n6t 0.01
2.9-4.5 6.77 3.61 5.7 7.6 1.21 9.7 9.7 C18:2 n6c 0.30 C20:0 0.06
0.2-0.3 3.09 1.96 0.1 0.1 C18:3 n6c 0.04 1.69 1.87 0.2 0.3 0.5 0.5
C18:3 n3 0.02 1.88 0.65 6.7 5.8 C20:1 0.01 0.6-1.2 0.91 0.2 0.2 0.5
0.5 C21:0 0.03 C20:2 0.03 0.2 0.2 0.5 0.5 C22:0 0.01 0.1 0.1 C20:3
n6c 0.73 0.81 0.53 0.1 0.2 C20:5 7.55 18-25.3 18.24 21.48 20.1-30.9
21.8 25.8 26.7 14.31 23.4 23.4
Characterization of Nannochloropsis Strain LARB-AZ 0202.0 Under
Laboratory Conditions
[0169] Effect of light intensity and nitrogen concentration on
growth, total and neutral lipid contents and productivity of algal
biomass and lipids of LARB-AZ 0202.0. In order to assess the
potential of using LARB-AZ 0202.0 as a candidate strain for
production of medium chain fatty acids, the effects of nitrogen
concentration on growth and production of algal biomass and lipid
under low light and high light conditions were investigated under
controlled laboratory culture conditions. Four nitrogen
concentrations (i.e., 0.01, 0.06, 0.12 and 0.24 g nitrogen as
nitrate) and two light levels (20 and 350 .mu.mol m.sup.-2
s.sup.-1) were selected for the study. As shown in FIG. 1, LARB-AZ
0202.0 grew rapidly at the low and high light intensities for the
first 3 to 5 days and then leveled off as the cultures continued.
The maximum cell concentration in the cultures with the initial
nitrogen concentration of 0.26 g L.sup.-1 at 350 photons m.sup.-2
was about twice of that obtained in the low light cultures. As the
initial nitrogen concentration decreased from 0.24 g L.sup.-1 to
0.01 g L.sup.-1, the growth rate decreased accordingly and the
differences in growth between the cultures at low light and high
light became smaller.
[0170] FIG. 2 shows cell dry weights of LARB-AZ 0202.0 cultures
maintained at the different initial nitrogen concentrations and
light intensities. The maximum final cell concentrations of 2.4 g
and 8.0 g L.sup.-1 were obtained in the cultures with the highest
initial nitrogen concentration of 0.24 g L-1 at low and high light
intensities, respectively. Compared to the low light cultures, the
final cell concentration in the high light cultures was affected to
a larger extent by the initial nitrogen concentration; i.e., the
higher the initial nitrogen concentration, the high the final cell
density of the culture.
[0171] Initial nitrogen concentration and light intensity not only
affected growth but neutral lipid content of LARB-AZ 0202.0. A
reverse correlation was observed between the initial nitrogen
concentration and neutral lipid content in the cells in the
cultures. Under low light of 20 .mu.mol photons m.sup.-2 s.sup.-1,
the lowest neutral lipid content of >5% of cell dry weight (DW)
occurred in the cultures containing the highest initial
concentration of nitrogen, whereas the highest neutral lipid
content of 36% of DW was observed in the cultured with the lowest
initial nitrogen concentration (FIG. 3A). The trend was also true
for the cultures exposed to the high light, although the
differences in the maximum cellular neutral lipid content were less
drastic between the low and high nitrogen cultures (FIG. 3B).
Accordingly, the maximum neutral lipid content of the lowest
nitrogen culture was ca. 22% of DW, whereas that of the highest
nitrogen cultures was about 42% of DW (FIG. 3B).
[0172] Neutral lipid productivity was calculated from growth and
neutral lipid content data obtained from the experiments described
above and the results are shown in FIG. 4. The maximum neutral
lipid productivity of 0.06 g L.sup.-1 d.sup.-1 was obtained in the
low light cultures with the lowest initial nitrogen concentration
of 0.01 g L.sup.-1 (FIG. 4A), whereas the maximum neutral lipid
yield of 0.28 g L.sup.-1 d.sup.-1 was obtained from the high light
cultures containing the highest initial nitrogen concentration
(FIG. 4B).
[0173] Productivity of algal biomass and total lipid (sum of
neutral lipid polar lipid) in cultures of LARB-AZ 0202.0 was
compared with that reported with other Nannochloropsis strains in
the literature. As shown in Table 2, Nannochloropsis strain LARB-AZ
0202.0 has the ability to produce the greatest amounts of biomass
and total lipid among the Nannochloropsis strains reported thus far
under laboratory culture conditions.
TABLE-US-00002 TABLE 2 Comparison of lipid and biomass
productivities of Nannochloropsis strain LRB-0202.0 with other
Nannochloropsis strains reported in the literature. Culture Culture
Cell Biomass Lipid Strain mode Illumination device density/mass
Lipid content productivity productivity Reference N. oculata Indoor
Continuous 2.0 L flasks N/A 14.7% DW N/A 0.02 g/L/day Converti et
al., Batch 70 .mu.mol/m.sup.2/s 2009 N. gaditana Semi- Light/Dark
Glass tubes 2.23 .times. 10.sup.8/ml 1.57 pg cell.sup.-1 N/A N/A
Ferreira et al., continuous 12:12 (h) D30 mm 2009 162
.mu.mol/m.sup.2/s N. oculta Batch Continuous 1.1 L columns 1.4 g/L
25.1% DW N/A N/A Hsueh et al., 1000 Lx D69 mm 2009 N. sp F&M-
Batch Continuous 250 ml flasks N/A 29.6% DW 0.21 g/L/day 0.061
g/L/day Rodolfi et al., M26 100 .mu.mol/m.sup.2/s 2009 N. sp
F&M- Batch Continuous 250 ml flasks N/A 24.4% DW 0.20 g/L/day
0.048 g/L/day Rodolfi et al., M27 100 .mu.mol/m.sup.2/s 2009 N. sp
F&M- Batch Continuous 250 ml flasks N/A 30.9% DW 0.18 g/L/day
0.055 g/L/day Rodolfi et al., M24 100 .mu.mol/m.sup.2/s 2009 N. sp
F&M- Batch Continuous 250 ml flasks N/A 21.6% DW 0.17 g/L/day
0.038 g/L/day Rodolfi et al., M29 100 .mu.mol/m.sup.2/s 2009 N. sp
F&M- Semi- Continuous 0.6 L tubes N/A 63% DW 0.80 g/L/day 0.055
g/L/day Rodolfi et al., M24 continuous 200 .mu.mol/m.sup.2/s D45 mm
2009 N. oculata Semi- Continuous Glass cylinders 1.28 g/L 29.7% DW
0.48 g/L/day 0.142 g/L/day Chiu et al., 2009 continuous 300
.mu.mol/m.sup.2/s D70 mm N. oculata Semi- Continuous Glass
cylinders N/A 30.7% DW 0.497 g/L/day 0.151 g/L/day Chiu et al.,
2009 continuous 300 .mu.mol/m.sup.2/s D70 mm N. oculata Semi-
Continuous Glass cylinders N/A 41.2% DW 0.296 g/L/day 0.121 g/L/day
Chiu et al., 2009 continuous 300 .mu.mol/m.sup.2/s D70 mm N. sp
Batch Continuous 250 ml flasks 0.22 g/L 62% DW N/A N/A Hu et al.,
(PP983) 50 .mu.mol/m.sup.2/s 2006 N. sp Batch Continuous 250 ml
flasks 0.51 g/L 42.7% DW N/A N/A Fang et al., 73 .mu.mol/m.sup.2/s
2004 N. sp Semi- Light/Dark 120 ml Pyrex 1.15 .times. 10.sup.8/ml
33.25% DW 0.376 g/L/day N/A Fabregas et continuous 12:12 (h) D30 mm
al., 2004 0-480 .mu.mol/m.sup.2/s N. sp Batch Continuous 10 L Scott
glass 0.633 g/L 9% DW N/A N/A Hu et al., 50 .mu.mol/m.sup.2/s
bottles 2003 N. sp Batch Light/Dark 100 L 2.43 .times. 10.sup.7/ml
1.1 pg cell.sup.-1 N/A N/A Dunstan et al., 12:12 (h) Polyethylene
1993 100 .mu.mol/m.sup.2/s bags N. oculata Batch Continuous 2 L
Scott glass 9.5 pg cell.sup.-1 58% DW N/A N/A Hodgson et al., 65
.mu.mol/m.sup.2/s bottles 1991 N. salina Batch Continuous 10 L
flasks 3 .times. 10.sup.7/ml 50% DW N/A N/A Emdadi et al., 50
.mu.mol/m.sup.2/s 1989 N. sp QII Batch Continuous Fernbach 2 g/L
55% AFDW 0.33 g/L/day 0.18 g/L/day Suen et al., 62
.mu.mol/m.sup.2/s flasks/Roux 1987 bottles N. sp. LRB- Batch
Continuous 600 ml glass 11.2 g/L 58% DW 0.88 g/L/day 0.52 g/L/day
Shan et al., AZ 0202.0 350 .mu.mol/m.sup.2/s tubes D38 mm 2009
Optimization of Nannochloropsis Strain LARB-AZ 0202.0 Cultures
Under Outdoor Environmental Conditions
[0174] Effect of initial nitrogen concentrations on biomass and
lipid production of LARB-AZ 0202.0 grown in a flat panel
photobioreactor outdoors. When inoculated from a seed culture into
the flat panel photobioreactor (PBR) that contained F/2 culture
media varying in initial nitrogen concentrations ranging from 0.38
to 1.5 g L.sup.-1 NaNO3, LARB-AZ 0202.0 cells exhibited the
different growth kinetics, as shown in FIG. 5. The cultures
containing 1.5 g L.sup.-1 NaNO3 exhibited the highest growth,
reaching ca. 3 g L.sup.-1 of cell dry weight after 9 days of
cultivation. The lower concentrations of nitrate in the cultures
resulted in somewhat reduced growth during the same period of
cultivation. The cultures with the lowest nitrate concentration
exhibited rapid growth for the first 6 days and then declined
gradually as the culture proceeded.
[0175] The cells that were used for the experiment contained about
20% of total lipid on a per cell dry weight basis. The total lipid
decreased somewhat in the cultures containing 0.38, 0.75 and 1.5 g
L.sup.-1 of nitrate during the first 2-4 days and then recovered or
slightly increased. By the end of cultivation, the total lipid in
the cells was below 25% of cell dry weight. In contrast, the
cultures in the absence of external nitrate supply experienced
rapid increase in cellular total lipid from ca. 20% to 45% of total
lipids during the same period of time. It was concluded that
deprivation of nitrogen in the growth medium is a prerequisite for
triggering lipid synthesis and accumulation in algal cells.
[0176] Effect of initial cell concentrations on growth, lipid
content and productivity of LARB-AZ 0202.0 in the flat panel
photobioreactor outdoors. The effects of initial cell
concentrations on growth, lipid content and productivity of LARB-AZ
0202.0 in the PBR were investigated in October, 2009. The seed
culture was maintained in an open raceway pond adjacent to the PBR
for 4 weeks. The cell concentration in the pond prior to the
experiment was 2.21 g L.sup.-1 (FIG. 7A) and the nitrate was
completely depleted from the culture medium (FIG. 7B).
[0177] For the initial cell density experiment, algal suspension
from the seed culture was diluted to various extents, as shown in
Table 3.
TABLE-US-00003 TABLE 3 Treatment ID, dilution factor, initial cell
counts and initial cell dry weight of seed culture for the cell
density experiment. Dilution factor Initial cell counts Initial
cell dry weight Treatment (times, .times.) (.times.10.sup.8
ml.sup.-1) (g L.sup.-1) A 8 .times. 0.4 0.42 B 4 .times. 0.8 0.64 C
2 .times. 1.2 1.14 D 1.5 .times. 1.4 1.56 E 0 1.6 2.21
[0178] FIG. 8 shows the growth kinetics of LARB-AZ 0202.0 cultures
as a function of initial cell concentrations on a dry weight (a)
and ash-free dry weight (b) basis. When the initial cell
concentration was equal or below 0.64 g L-.sup.1 , growth was
slower than that with the initial cell concentration of equal or
greater than 1.14 g L.sup.-1.
[0179] Initial cell concentration in the PBR also affected cellular
lipid content. The highest total lipid content of nearly 70% of DW
was observed in the cultures with the lowest initial cell
concentration after 8 to 9 days of cultivation (FIG. 9a, b). The
highest initial cell concentration resulted in the lowest maximum
lipid content of 45% of DW in the cells. The neutral lipid content
essentially followed the same trend (FIG. 10).
[0180] Correlation between the content of lipids and pigments in
Nannochloropsis strain LARB-AZ 0202.0 grown in flat plate PBR
outdoors. A reverse relationship between the carotenoid content and
lipid (including total lipid and neutral lipid) was observed in
Nannochloropsis strain LARB-AZ 0202.0 grown in flat plate PBR
outdoors. As shown in FIG. 11, the higher the lipid content (both
neutral lipid and total lipid) the lower the pigment content (both
chlorophyll and carotenoid). A higher initial cell density showed
the same trend, though the slope of the correlation fit was
somewhat different (FIG. 12).
[0181] Quantitative measurement of lipid, particularly neutral
lipid by conventional gravimetric methods is time- and
labor-intensive. In contrast, spectrophotometric measurement of the
chlorophyll and carotenoid content is simple and straight forward.
The correlation between the lipid and pigment contents in the cell
that are established in this invention can be applied to commercial
large-scale cultivation of algae for lipid/oil production. The
cellular content of total lipid and neutral lipid can be calculated
by measuring the chlorophyll and/or carotenoid content in the
cells.
[0182] Strain improvement by chemical mutagenesis. In order to
further improve the performance and/or the lipid content of
Nannochloropsis strain LARB-AZ 0202.0, a chemical mutagenesis
approach was applied to the parental strain, followed by a
screening and selection process to obtain superior strains to the
parental strain. Two mutants, i.e., LARB-AZ 0202.2 and LARB-AZ
0202.3 have been generated and partially characterized. The mutants
and the parental strain were cultured in a glass column PBR mixed
with compressed air containing 1% CO2. Cultures were exposed to
continuous illumination of light intensity ranging from 140 to 300
photons m.sup.-2 s.sup.-1. Overall biomass productivity of all
three strains were higher under high light (HL, 300 .mu.mol photons
m.sup.-2 s.sup.-1) with LARB-AZ 0202.3 achieving the highest
volumetric productivity (0.9 g L.sup.-1 d.sup.-1) and parent wild
type the lowest (0.72 g L.sup.-1 d.sup.-1). Biomass productivity of
all three strains substantially decreased in response to low light
(140 .mu.mol photons m.sup.-2 s.sup.-1) growth conditions. However,
LARB-AZ 0202.3 mutant showed the highest biomass productivity (0.74
g L.sup.-1 d.sup.-1) under low light conditions as well. LARB-AZ
0202.3 mutant possessed high photosynthetic productivity as
measured by chlorophyll a (Chl a) content under HL conditions
throughout the growth period. Cellular content of chlorophyll per
dry weight declined gradually in all three tested strains over
time. Volumetric productivity of biomass was closely associated
with the volumetric productivity of chlorophyll. Total lipid and
neutral lipid productivity of LARB-AZ 0202.2 mutant grown in
nitrogen deprived media for 7 days were 222 and 174 mg L.sup.-1
d.sup.-1, respectively, while those of wild type parent was 202 and
151 mg L.sup.-1 d.sup.-1, respectively. A comparison of the fatty
acid profile of LARB-AZ 0202.2 mutant with its parent wild type
confirmed a significant increase of C14:0 and C16:0 in the mutant.
Total medium chain fatty acids that contribute directly to
MCFA-rich oil production had an overall increase of 12.2 percent
over that of wild type parent.
[0183] Outdoor cultivation of LARB-AZ 0202.0-derived mutants
LARB-AZ 0202.2 and LARB-AZ 0202.3 Cultivation of the
Nannochloropsis mutants LARB-AZ 0202.2 and LARB-AZ 0202.3 was also
conducted in a flat panel photobioreactor outdoors. Culture
conditions: growth medium-f/2 with 0.25 amount of Sodium Nitrate
(0.18 g/L); Replicates: three; constant supply of CO2 1%;
Temperature was controlled during the day time with cooling system
and never exceeded 28.degree. C.; pH ranged between 7.6 to 9.2;
Maximum light intensity ranged between 800-15600 .mu.mol photons
m.sup.-2 s.sup.-1.
[0184] As shown in FIGS. 14A, B and 15A, B, the two mutants LARB-AZ
0202.2 and LARB-AZ 0202.3 grew more rapidly than the wild type
LARB-AZ 0202.0 under identical culture conditions.
[0185] Materials and methods. Preparation of culture media for
mutation experiment: The parent wild type Nannochloropsis strain
LARB-AZ 0202.0 was maintained in a modified Guillard f2 medium
(Guillard and Ryther, 1962) containing 0.75 g NaNO.sub.3 L.sup.-1
NaNO.sub.3 and 0.03 g L.sup.-1 NaH.sub.2PO.sub.4. Cultures were
maintained at 21.+-.1C.degree. and a light intensity of 50-60
photons m.sup.-2 s.sup.-1,. Cultures at early log-phase
(3.times.10.sup.7 cells ml.sup.-1) were subjected to chemical
mutagenesis.
[0186] Experimental design: The mutation program used ethyl methane
sulphonate (EMS) solution as mutagenic agent. The first step in the
mutation program was to determine the appropriate concentration of
EMS and time of treatment for the parent culture, and to determine
the survival rate under the EMS treatment.
[0187] Survival count: Preliminary analysis of survival data with
EMS concentrations ranging from 25 to 100 .mu.L/mL showed that EMS
treatment of 50 .mu.L/mL could produce a wide range (0.3 to 87
percent) of survival rates depending on the duration of
treatment.
[0188] To determine the effect of EMS treatment duration on cell
survival, exponentially grown parental cells (approximately
3.0.times.10.sup.7 cells/ml) were transferred to a test tube
containing a potassium buffer, pH 7. The cells were treated with 50
.mu.L/mL EMS (approximately 460 mmol) in a screw-cap glass tube.
After incubation, the cells were treated for the different time
intervals (20 to 180 min) with 7% sodium thiosulphate. Individually
treated cell cultures were thoroughly washed twice with distilled
water and incubated in the dark overnight prior to plating.
Aliquots of the mutagenized cells were spread onto enriched f/2
medium solidified with 1% agar. Colonies on the plates were counted
after 6 weeks from the time of plating. Fast growing colonies were
individually inoculated into the enriched f/2 liquid medium in test
tubes and grown until early log-phase. Rapid growing mutant strains
were cultured for several generations and then transferred to
tubular columns and grown for further screening.
[0189] Microscopic examination of culture purity,and cell
measurements: 2.0 ml sample was collected daily, from which an
aliquot was checked under the microscope (100.times.). Cell count
was determined using a Neubauer Haemocytometer.
[0190] Dry weight measurement: Algal dry biomass was determined
daily by filtering 10 ml of the culture sample through Glass
Microfiber Filters, GF/C (Whatman) The filtered sample was then
washed with 10 ml of pH 4.0 double distilled water followed by 10
ml of 5% ammonium bicarbonate solution to remove adhering inorganic
salts, and dried at 100 C for 24 hrs. The dried sample was
immediately transferred to desiccators over silica gel for
dehydration for at least 2 hrs before weighing.
[0191] Maintenance of pH: The pH of the culture was checked twice
daily--morning and afternoon. The pH was maintained between 7.8 and
8.2 by adjusting the rate of CO2 flow into the air stream.
[0192] Lipid extraction and fatty acid analysis: Freeze-dried algal
mass was extracted with methanol containing 10% DMSO according to
Bigogno et al. (2002) but with slight modification. The biomass
with added solvent was heated at 45.degree. C. and stirred for 45
minutes after which the mixture was centrifuged at 3000 rpm for 10
min. The supernatant was removed and the pellet was re-extracted
with a mixture of diethyl ether and hexane (1:1 v/v). Equal volumes
of water to the solvent mixture and supernatants were added to form
a ratio of 1:1:1:1 (v/v/v/v). The mixture was centrifuged again and
the upper phase was collected. The water phase was re-extracted and
the organic phases that contain total lipid were combined and
evaporated to dryness under nitrogen protection. Total lipid with
little solvent provided to dissolve was transferred to a
pre-weighed Eppendorf tube, and evaporated to dryness under
nitrogen protection. Thereafter, the total lipids were measured
gravimetrically after freeze drying for 24 h. Neutral lipids were
quantified by the method previously described by Bigogno et al.
(2002). Freeze-dried total lipids were weighed and quantified by
GC-MS after derivatization to fatty acid methyl esters. Fatty acids
were identified by comparison with retention times of known
standards. Quantitative analysis was based on known amount of
heptadecanoic acid (C17:0) as the internal standard and added to
the sample before injection (Chen et al., 2008; Li et al.,
2010).
[0193] Chlorophyll a determination: Chlorophyll a was determined by
a modified methanol extraction method (Azov, 1982). For high algal
biomass concentrations. 1 ml of culture was centrifuged and
separated in a screw-cap centrifuge tube and 4 ml methanol was
added. The tubes were agitated and placed in a Buchi heating bath
B-491 at 60.degree. C. for 15 min. The samples were then cooled in
the dark for 30 min and re-centrifuged. The supernatant was
transferred into a 10 ml volumetric test tube and brought to a
final volume of 10 ml by adding methanol. Optical density was
measured against a methanol blank at 665 and 750 nm with a
Spectramax 340 PC (Molecular Device) Spectrophotometer. The
chlorophyll a concentration was determined by using the coefficient
given by Talling (1969) in the following equation: Chlorophyll a
(mg per liter)=13.9 (O.D. 665-O.D. 750). U/V In which O.D.=optical
density, U=the final methanol volume, and V=the sample volume
Results
[0194] The mutants LARB-AZ 0202.2 and LARB-AZ 0202.3 exhibited
significantly higher daily biomass productivities than the wild
type strain LARB-AZ 0202.0 (FIGS. 13B and 14B).
[0195] DNA markers for identification of Nannochloropsis sp.
LARB-AZ 0202.0 and the mutants LARB-AZ 0202.2 and LARB-AZ
0202.3
[0196] For each strain, 10 ml of cultures were harvested by
centrifugation at 4,000 g for 10 min. Cells were resuspended in 100
.mu.L of buffer A that contains (1.4M NaCl, 20 mM EDTA, 100 mM
Tris.HCl pH=8.0) and then mixed with another 300 .mu.L of buffer A.
Cell suspensions were transferred to 1.5 mL screwed cap centrifuge
tube and mixed with 300 .mu.L of glass beads. Cells were disrupted
by Bead Beater (Biospec, USA) at full speed for 20 seconds. The
cell homogenate was transferred to another 1.5 mL centrifuge tube
and equal volumes of 2.times. CTAB buffer (4% CTAB in buffer A)
were added. The homogenate was incubated at 65.degree. C. for 2 hr
and then extracted with equal volume of phenol:chloroform:isoamyl
alcohol (25:24:1). Isopropanol was added to the aqueous phase in a
volume equal to 2/3 of the aqueous phase to precipitate genomic
DNA. DNA pellet was washed with 75% ethanol and then dried in
air.
[0197] The primer set (ITS-F CCGTCGCACCTACCGATTGAAT and ITS-R
CCGCTTCACTCGCCGTTACTA) were used to amplify the target sequence
from Nannochloropsis strains. PCR was performed at 95.degree. C.
for 5 min, 35 cycles of 95.degree. C. 30 s, 60.degree. C. 30 s,
72.degree. C. 1 min 30 s, and extension at 72.degree. C. for 10
min. PCR products were cloned into TOPO TA cloning vector
(Invitrogen, USA) for sequencing.
Results
[0198] Three 1123 by ITS segments (comprising 18S ribosomal RNA
gene, partial sequence; internal transcribed spacer 1, 5.8S
ribosomal RNA gene, and internal transcribed spacer 2, complete
sequence; and 28S ribosomal RNA gene, partial sequence) were
amplified from Nannochloropsis LARB-AZ 0202.0 and the mutants
Nannochloropsis LARB-AZ 0202.2, Nannochloropsis LARB-AZ 0202.3
(FIGS. 17, 18 and 19). These sequences showed high similarity with
the species belonging to the genus Nannochloropsis as indicated by
BLAST search in NCBI (http://blast.ncbi.nlm.nih.gov) (FIG. 20). The
maximal identity shared by the ITS sequence of Nannochloropsis
LARB-AZ 0202.0 and other known Nannochloropsis spp. is 98%.
However, the 2% difference is large enough to distinguish
Nannochloropsis LARB-AZ 0202.0 and the mutants derived from it from
any other known Nannochloropsis species in the NCBI database, and
therefore the ITS sequence obtained from Nannochloropsis LARB-AZ
0202.0 and its mutants can be used as a DNA marker.
[0199] Note that seven mutations were detected in Nannochloropsis
LARB-AZ 0202.2 (G671, A677, C749, C876, T899, A954, C985) when the
sequence was aligned and compared to that of LARB-AZ 0202.0 (C671,
G677, G749, A876, C899, G954, T985). Two mutations (i.e., C181,
A434) were detected in Nannochloropsis LARB AZ 0202.3 compared to
that (i.e., T181, T434) of the wild type . These mutations
introduced by mutagenesis can be used as nucleotide markers to
distinguish mutants from wild type and to monitor any potential
cross contamination between the Nannochloropsis sp. LARB-AZ 0202.0
and its mutants.
REFERENCES
[0200] Ackman, R. G., Jangaard, P. M., Hoyle, R. J. and
Brockerhoff, H. 1964. Origin of marine fatty acids. I. Analyses of
the fatty acids produced by the diatom Skeletonema costatum. J.
Fish. Res. Bd. Can. 21: 747-756. [0201] Bigogno et al.
Phytochemistry. 2002 July; 60(5):497-503. [0202] Chen et al., 2008.
[0203] Chiu et al., Bioresour Technol. 2009 Jan;100(2):833-8.
[0204] Converti et al., 2009. [0205] Dunstan, G. A., J. K. Volkman,
S. M. Barrett, and C. D. Garland. 1993. Changes in the lipid
composition and maximization of the polyunsaturated fatty acid
content of three microalgae grown in mass culture. J. Appl. Phycol.
5: 71-83. [0206] Emdadi, D. and B. Berland. 1989. Variation in
lipid class composition during batch growth of Nannochloropsis
salina and Pavlova lutheri. Mar. Chem. 26: 215-225. [0207] Fang Xu,
Han-hua Hu, Wei Cong, Zhao-ling Cai, Fan Ouyang, Growth
characteristics and eicosapentaenoic acid production by
Nannochloropsis sp. in mixotrophic condition, Biotechnology
Letters, 2004, 26: 51-53 2004. [0208] Ferreira et al., 2009. [0209]
Gouveia L, Oliveira A C Microalgae as raw material for biofuels
production. J. 20 Ind. Microbiol. Biotechnol. 36: 269-274 2009.
[0210] Hodgson, P. A., Henderson, R. J., Sargent, J. R. &
Leftley, J. W. (1991). Patterns of variation in the lipid class and
fatty acid composition of Nannochloropsis oculata
(Eustigmatophyceae) during batch culture. 1. The growth cycle. J.
Appl. Phycol., 3: 169-181. [0211] Hsueh et al., Journal of
photochemistry and photobiology. B, Biology 2009;95(1):33-9. [0212]
Hu et al., Biotech. Lett 25:421-425, 2003. [0213] Hu et al.,
Biotech. Lett 28:987-992, 2006. [0214] Kenyon, C. N. 1972. Fatty
acid composition of unicellular strains of blue-green algae. J.
Bacterid. 109: 827-834 [0215] Kobayashi et al., 2008. [0216] Lee,
R. F. and Loeblich III, A. R. 1971. Distribution of 21 :6
hydrocarbon and its relationship to 22:6 fatty acid in algae.
Phytochemistry. 10: 593-602. [0217] Li et al., 2010. [0218] Orcutt,
D. M. and Patterson, G. W. 1975. Sterol, fatty acid and elemental
composition of diatoms grown in chemically media. Comp. Biochem.
Physiol. 5OB: 579-583. [0219] Parker, P. L., van Baalen, C. and
Maurer, L. 1967. Fatty acids in eleven species of bluegreen algae:
geochemical significance. Science. 155: 707-708. [0220] Patil et
al., Aquacult Int (2007) Fatty acid composition of 12 microalgae
for possible use in aquaculture feed 15:1-9. [0221] Pirt et al.
(1983). [0222] Rodolfi et al., Biotechnol Bioeng. 2009 Jan. 1;
102(1):100-12 2009. [0223] Roncarati et al., A. Meluzzi, S.
Acciarri, N. Tallarico, and P. Melotti. 2004. [0224] Fatty acid
composition of different microalgae strains (Nannochloropsis sp.,
Nannochloropsis oculata (Droop) Hibberd, Nannochloris atomus
Butcher and Isochrysis sp.) according to the culture phase and the
carbon dioxide concentration. Journal Of The World Aquaculture
Society 35: 401-411 2004. [0225] Samson and Leduy (1985). [0226]
Seychelles et al., 2009. [0227] Shan et al., 2009. [0228] Suen, Y.,
J. S. Hubbard, G. Holzer, and T. G. Tornabene. 1987. Total lipid
production of the green alga Nannochloropsis sp. QII under
different nitrogen regimes. J. Phycol. 23:289-296. [0229]
Tornabene, T. G., Kates, M. and Volcanl, B. E. 1974. Sterol
aliphatic hydrocarbons, and fatty acids of a nonphotosynthetic
diatom, Nitzschia alba. Lipids. 9: 279-284. [0230] Volkman et al.
1981, Volkman, J. K., Smith, D. J., Eglinton, G., Forsberg, T. E.
V. and Corner, E. D. S. 1981. Sterol and fatty acid composition of
four marine haptophycean algae. J. Mar. Biol. Ass. U. K. 61 :
509-527. [0231] Xu Fang, Zhao-ling Cai, Wei Cong, Fan Ouyang,
Growth and fatty acid composition of Nannochloropsis sp. Grown
mixotrophically in fed-batch culture, Biotechnology Letters, 26:
2004, 319-1322. [0232] Xu Fang, Cong Wei, Cai Zhao-Ling, Ouyang
Fan, Effects of organic carbon sources on cell growth and
eicosapentaenoic acid content of Nannochloropsis sp., Journal of
Applied Phycology, 2004.
Sequence CWU 1
1
511123DNANannochloropsis sp. 1ccgtcgcacc taccgattga atgattcggt
gaagctttcg gattgcgcca ctggcctcgg 60tcggcagcgt gagaagttat ctaaacctca
tcatttagag gaaggtgaag tcgtaacaag 120gtttccgtag gtgaacctgc
ggaaggatca ttaccaaaac acatcatgcc tcctggcgta 180tgcttcgagg
cattacactt cacaacctgt gcattgttta ctcctgtgaa cgctatacac
240gcacgtgctc ccggccacgc cctgcgatgg ttgctttgga tggttcctcg
gaacacgtcg 300aagccgtggc cgaatgtggg agggcgtctc taaataacct
caaacaccat tcgcaacatt 360ttatcaacct ttccaaaccg attgtttata
cttcattcaa ggcttttcta gtcttcggac 420ggaaaaagcc tggtgcatgt
ttccatgcga aacgagcgcc cgcaatgaaa atacaacttt 480cagcaacgga
tgtcttggct cccacaacga tgaagaacgc agcgaaatgc gatacgtaat
540gcgaattgca gaattccgcg agtcatcaaa cctttgaacg caccttgcgc
tttcgggata 600tgcccgttag catgtttgtt ggagtgtctg ttaaccccaa
tcaccacctt gttgtgactt 660cagagtcatg ccaagcggtc ggtggacgtt
acttgctccc gatacttcgc ccgctgcgaa 720ttctgttgtc acctcctctg
acgaggaagt ggccagaagc tggagtgcgg gcgtggagtg 780aagtagggcc
ggccacatac agtcactggg accacgcaac tcctagagct gcccccgtga
840acgtgacgag tcttctaatc aaggcaatcc gtttgaggtc taaaaggtgc
tcgtttgacg 900gaagcgctag tctacaccaa acagtttcga cttggcggca
tcttctcggt gacgtaacaa 960acaccgagaa agcctttgga ctgatcctgg
cacttgttgc cgtgtcattc catctccaat 1020tcggacctcc aatcaagcaa
ggctacccgc tgaatttaag catataacta agcggaggaa 1080aagaaactaa
ccaggattcc cctagtaacg gcgagtgaag cgg 112321123DNANannochloropsis
sp. 2ccgtcgcacc taccgattga atgattcggt gaagctttcg gattgcgcca
ctggcctcgg 60tcggcagcgt gagaagttat ctaaacctca tcatttagag gaaggtgaag
tcgtaacaag 120gtttccgtag gtgaacctgc ggaaggatca ttaccaaaac
acatcatgcc tcctggcgta 180tgcttcgagg cattacactt cacaacctgt
gcattgttta ctcctgtgaa cgctatacac 240gcacgtgctc ccggccacgc
cctgcgatgg ttgctttgga tggttcctcg gaacacgtcg 300aagccgtggc
cgaatgtggg agggcgtctc taaataacct caaacaccat tcgcaacatt
360ttatcaacct ttccaaaccg attgtttata cttcattcaa ggcttttcta
gtcttcggac 420ggaaaaagcc tggtgcatgt ttccatgcga aacgagcgcc
cgcaatgaaa atacaacttt 480cagcaacgga tgtcttggct cccacaacga
tgaagaacgc agcgaaatgc gatacgtaat 540gcgaattgca gaattccgcg
agtcatcaaa cctttgaacg caccttgcgc tttcgggata 600tgcccgttag
catgtttgtt ggagtgtctg ttaaccccaa tcaccacctt gttgtgactt
660cagagtcatg gcaagcagtc ggtggacgtt acttgctccc gatacttcgc
ccgctgcgaa 720ttctgttgtc acctcctctg acgaggaact ggccagaagc
tggagtgcgg gcgtggagtg 780aagtagggcc ggccacatac agtcactggg
accacgcaac tcctagagct gcccccgtga 840acgtgacgag tcttctaatc
aaggcaatcc gtttgcggtc taaaaggtgc tcgtttgatg 900gaagcgctag
tctacaccaa acagtttcga cttggcggca tcttctcggt gacataacaa
960acaccgagaa agcctttgga ctgatcctgg cactcgttgc cgtgtcattc
catctccaat 1020tcggacctcc aatcaagcaa ggctacccgc tgaatttaag
catataacta agcggaggaa 1080aagaaactaa ccaggattcc cctagtaacg
gcgagtgaag cgg 112331123DNANannochloropsis sp. 3ccgtcgcacc
taccgattga atgattcggt gaagctttcg gattgcgcca ctggcctcgg 60tcggcagcgt
gagaagttat ctaaacctca tcatttagag gaaggtgaag tcgtaacaag
120gtttccgtag gtgaacctgc ggaaggatca ttaccaaaac acatcatgcc
tcctggcgta 180cgcttcgagg cattacactt cacaacctgt gcattgttta
ctcctgtgaa cgctatacac 240gcacgtgctc ccggccacgc cctgcgatgg
ttgctttgga tggttcctcg gaacacgtcg 300aagccgtggc cgaatgtggg
agggcgtctc taaataacct caaacaccat tcgcaacatt 360ttatcaacct
ttccaaaccg attgtttata cttcattcaa ggcttttcta gtcttcggac
420ggaaaaagcc tggagcatgt ttccatgcga aacgagcgcc cgcaatgaaa
atacaacttt 480cagcaacgga tgtcttggct cccacaacga tgaagaacgc
agcgaaatgc gatacgtaat 540gcgaattgca gaattccgcg agtcatcaaa
cctttgaacg caccttgcgc tttcgggata 600tgcccgttag catgtttgtt
ggagtgtctg ttaaccccaa tcaccacctt gttgtgactt 660cagagtcatg
ccaagcggtc ggtggacgtt acttgctccc gatacttcgc ccgctgcgaa
720ttctgttgtc acctcctctg acgaggaagt ggccagaagc tggagtgcgg
gcgtggagtg 780aagtagggcc ggccacatac agtcactggg accacgcaac
tcctagagct gcccccgtga 840acgtgacgag tcttctaatc aaggcaatcc
gtttgaggtc taaaaggtgc tcgtttgacg 900gaagcgctag tctacaccaa
acagtttcga cttggcggca tcttctcggt gacgtaacaa 960acaccgagaa
agcctttgga ctgatcctgg cacttgttgc cgtgtcattc catctccaat
1020tcggacctcc aatcaagcaa ggctacccgc tgaatttaag catataacta
agcggaggaa 1080aagaaactaa ccaggattcc cctagtaacg gcgagtgaag cgg
1123422DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 4ccgtcgcacc taccgattga at 22521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
5ccgcttcact cgccgttact a 21
* * * * *
References