U.S. patent application number 13/328611 was filed with the patent office on 2012-05-17 for screening molecules with anti-prion activity: kits, methods and screened molecules.
This patent application is currently assigned to CENTRE NATIONAL DE LA RECHERCHE SCIENTIFIQUE. Invention is credited to Stephane Bach, Marc BLONDEL, Christophe Cullin, Yvette Mettey, Nicolas Talarek, Jean Michel Vierfond.
Application Number | 20120122916 13/328611 |
Document ID | / |
Family ID | 32071174 |
Filed Date | 2012-05-17 |
United States Patent
Application |
20120122916 |
Kind Code |
A1 |
BLONDEL; Marc ; et
al. |
May 17, 2012 |
SCREENING MOLECULES WITH ANTI-PRION ACTIVITY: KITS, METHODS AND
SCREENED MOLECULES
Abstract
The invention concerns screening molecules with anti-prion
activity. More particularly, it concerns kits for screening
molecules with anti-prion activity characterized in that they
comprise in combination a [PSI+], phenotype yeast, an antibiogram
and an agent for purifying prions at sub-efficient doses, said
yeast including the ade1-14 allele of the ADE1 gene and an
inactivated ERG6 gene, the screening methods, and a family of
molecules with anti-prion activity isolated by the inventive
screen. The invention is applicable to anti-prion agents for
producing medicines in particular for treating neurodegenerative
diseases involving protein aggregates.
Inventors: |
BLONDEL; Marc; (Saint-Pol de
Leon, FR) ; Cullin; Christophe; (Merignac, FR)
; Vierfond; Jean Michel; (Maisons Alfort, FR) ;
Bach; Stephane; (Saint-Pol de Leon, FR) ; Talarek;
Nicolas; (Talence, FR) ; Mettey; Yvette;
(Poitiers, FR) |
Assignee: |
CENTRE NATIONAL DE LA RECHERCHE
SCIENTIFIQUE
Paris
FR
UNIVERSITE DE POITIERS
Poiters
FR
UNIVERSITE VICTOR SEGALEN BORDEAUX 2
Bordeaux
FR
|
Family ID: |
32071174 |
Appl. No.: |
13/328611 |
Filed: |
December 16, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10531594 |
Nov 28, 2005 |
8129402 |
|
|
PCT/FR2003/003101 |
Oct 20, 2003 |
|
|
|
13328611 |
|
|
|
|
Current U.S.
Class: |
514/298 |
Current CPC
Class: |
A61P 25/16 20180101;
C12Q 1/025 20130101; A61P 25/28 20180101; A61P 25/00 20180101 |
Class at
Publication: |
514/298 |
International
Class: |
A61K 31/473 20060101
A61K031/473; A61P 25/16 20060101 A61P025/16; A61P 25/28 20060101
A61P025/28; A61P 25/00 20060101 A61P025/00 |
Foreign Application Data
Date |
Code |
Application Number |
Oct 18, 2002 |
FR |
02/13022 |
Jul 7, 2003 |
FR |
03/08289 |
Claims
1. A method for treating an animal or a human patient having a
neurodegenerative disease responsive to treatment with an
anti-prion agent, the method comprising administering to said
animal or said human patient a pharmaceutical composition
comprising: a therapeutically effective quantity of at least one
compound of formula (II) ##STR00005## wherein R' represents an
NH.sub.2, or
NH--CH(CH.sub.3)--(CH.sub.2).sub.3--N(CH.sub.2--CH.sub.3).sub.2
group, X represents F, Cl, or CF.sub.3, p and n, identical or
different, are equal to 0, 1 or 2, in combination with at least one
pharmaceutically acceptable vehicle.
2. The method of claim 1, wherein the neurodegenerative disease is
selected from the group consisting of spongiform encephalopathies,
Alzheimer's disease, Parkinson's disease and Huntington's
disease.
3. A method for treating an animal or a human patient having a
neurodegenerative disease responsive to treatment with an
anti-prion agent, the method comprising administering to said
animal or said human patient a pharmaceutical composition
comprising: a therapeutically effective quantity of at least one
compound of formula (II) ##STR00006## wherein R' represents
NH.sub.2, X represents F, Cl, or CF.sub.3, p and n, identical or
different, are equal to 0, 1 or 2 in combination with at least one
pharmaceutically acceptable vehicle.
4. The method of claim 3, wherein the neurodegenerative disease is
selected from the group consisting of spongiform encephalopathies,
Alzheimer's disease, Parkinson's disease and Huntington's
disease.
5. A method of treatment of an animal or human patient having a
neurodegenerative disease, the method comprising administering to
said animal or said human patient a therapeutically effective dose
of a pharmaceutical composition comprising: a therapeutically
effective quantity of at least one compound of formula (II)
##STR00007## wherein R' represents an NH.sub.2, or
NH--CH(CH.sub.3)--(CH.sub.2).sub.3--N(CH.sub.2--CH.sub.3).sub.2
group, X represents F, Cl, or CF.sub.3, p and n, identical or
different, are equal to 0, 1 or 2, in combination with at least one
pharmaceutically acceptable vehicle, for the treatment of said
neurodegenerative disease.
6. The method of claim 5, wherein the neurodegenerative disease is
selected from the group consisting of spongiform encephalopathies,
Alzheimer's disease, Parkinson's disease and Huntington's
disease.
7. A method of treatment of an animal or human patient having a
neurodegenerative disease, the method comprising administering to
said animal or said human patient a therapeutically effective dose
of a pharmaceutical composition comprising: a therapeutically
effective quantity of at least one compound of formula (II)
##STR00008## wherein R' represents NH.sub.2, X represents F, Cl, or
CF.sub.3, p and n, identical or different, are equal to 0, 1 or 2,
in combination with at least one pharmaceutically acceptable
vehicle.
8. The method of claim 7, wherein the neurodegenerative disease is
selected from the group consisting of spongiform encephalopathies,
Alzheimer's disease, Parkinson's disease and Huntington's
disease.
9. A method for treating an animal or a human patient having a
neurodegenerative disease responsive to treatment with an
anti-prion agent, the method comprising administering to said
animal or said human patient a pharmaceutical composition
comprising: a therapeutically effective quantity of at least one
compound of formula (II) ##STR00009## wherein R' is
--NH--(CH.sub.2).sub.3--N(CH.sub.3).sub.2, X is F, Cl, or CF.sub.3,
and p and n, identical or different, are equal to 1 or 2, in
combination with at least one pharmaceutically acceptable
vehicle.
10. The method of claim 9, wherein the neurodegenerative disease is
selected from the group consisting of spongiform encephalopathies,
Alzheimer's disease, Parkinson's disease and Huntington's
disease.
11. A method for treating an animal or a human patient having a
neurodegenerative disease comprising administering to said animal
or said human patient a therapeutically effective dose of a
pharmaceutical composition of comprising: a therapeutically
effective quantity of at least one compound of formula (II)
##STR00010## wherein R' is
--NH--(CH.sub.2).sub.3--N(CH.sub.3).sub.2, X is F, Cl, or CF.sub.3,
and p and n, identical or different, are equal to 1 or 2, in
combination with at least one pharmaceutically acceptable
vehicle.
12. The method of claim 11, wherein the neurodegenerative disease
is selected from the group consisting of spongiform
encephalopathies, Alzheimer's disease, Parkinson's disease and
Huntington's disease.
Description
[0001] The present invention relates to screening of molecules with
anti-prion activity. It relates more particularly to kits for
screening molecules with anti-prion activity, methods of screening,
and a family of molecules with anti-prion activity revealed using
the screen according to the invention.
[0002] Prions are infectious proteins responsible for certain
neuro-degenerative diseases of spongiform encephalopathy type in
mammals, such as Creutzfeldt-Jakob's disease in humans or also the
so-called "mad cow disease" in bovines or "scrapie" in ovines.
These different diseases are caused by unconventional infectious
agents: unlike traditional infectious agents (bacteria, viruses for
example), they contain no nucleic acids. Professor Stanley Prusiner
formulated the "protein-only" hypothesis, according to which the
infectious agent would be constituted only by a protein. This
protein exists naturally in cells in a normal (or PrP.sup.c) form,
i.e. soluble, essentially in the form of an a helix and
non-aggregated, therefore functional. Under certain still unknown
conditions, this protein can be converted to a prion (or
PrP.sup.sc) form. In this prion form, the protein forms insoluble
aggregates, essentially in the form of .beta. sheets. The
infectious character of this PrP.sup.sc prion conformation would
result from the fact that, apart from the characteristics indicated
previously, the protein in prion form also gains the ability to
catalyze the passage from the normal Prp.sup.c cell form to the
PrP.sup.sc prion form in a "snowball"-type mechanism.
[0003] Baker's yeast Saccharomyces cerevisiae contains several
proteins that behave like prions (Fernandez-Bellot and Cullin,
2001). Since as long ago as the 1960s, two unconventional genetic
mechanisms have been described. In 1994, the corresponding [PSI+]
and [URE3] phenotypes were proposed as resulting from the
autocatalytic inactivation of the Sup35p and URE2p proteins
respectively. These prion proteins therefore have a priori a
mechanistic analogy with mammal systems deleterious to public
health. Like the PrP protein, the "normal" Sup35p protein passes
from a soluble state to an insoluble and aggregated state as soon
as the protein is in contact with another Sup35p protein in prion
form. This aggregated state is verified both by centrifugation
experiments and by intracellular localization experiments. Yeast
prions can be eliminated ("cured") by a strong dose (1 to 5 mM) of
guanidium chloride. As a result of such a treatment (which must
applied to at least six to ten generations), the protein aggregates
generated by the presence of the prions disappear and the protein
in question (Sup35p, for example) is found in a normal, soluble,
functional form but having retained the capability of being
converted to a prion form should it again come into contact with
another Sup35p protein in such a state.
[0004] The Sup35p protein, in a heterodimeric complex with the
Sup45p protein, forms a translation termination factor. This factor
recognizes the opal stop codons (UGA). In its normal cell form
(soluble and active) in the [psi-] strains, Sup35p, in combination
with Sup45p effectively terminates translation at the level of
these opal codons. In a [PSI+] strain where the Sup35p protein is
in prion form, it is mostly present in the form of insoluble
aggregates. Being unable to bind to Sup45p, it is thus
non-functional in the translation termination. A small fraction of
all of the cellular Sup35p proteins however remains soluble in
these [PSI+] cells where it makes it possible, in a complex with
Sup45p, to ensure a "minimum translation termination service", a
service essential to the survival of the yeast. A colorimetric
system making it possible to detect, in an indirect fashion, the
form in which the Sup35p protein is present: normal or prion, has
been produced from these findings. This system, which has been
described for a long time (see the article on synthesis by
Fernandez-Bellot and Cullin, 2001), is based on the use of the
adel-14 allele of the ADE1 gene, coding for an enzyme of the
adenine biosynthesis route: SAICAR synthetase. This enzyme
catalyzes the formation of
4-(N-succinocarboxamide)-5-aminoimidazole ribonucleotide (SAICAR)
from 4-carboxy-5-aminoimidazole ribonucleotide (CAIR). The adel-14
allele contains an opal codon in the reading frame of the ADE1
gene. In a [psi-] strain, Sup35p in combination with Sup45p will
therefore stop the translation of the ADE1 gene at the level of
this stop codon. The protein adel-14p thus translated will be
truncated and therefore non-functional. As a result the substrates
upstream of the Ade1p enzyme will accumulate, in particular the
5-aminoimidazole ribonucleotide (AIR). The AIR being oxidized to a
red-coloured compound, the colonies formed by the [psi-] cells will
be red in colour. Moreover, these cells will be auxotrophic for
adenine. Conversely, in a [PSI+] strain, the protein Sup35p is
essentially present in the form of aggregates therefore incapable
of being combined with Sup45p in order to stop translation at the
level of the opal codon of the adel-14 allele of the ADE1 gene. As
a result, the ribosomes will pause at the level of this stop codon
before resuming their translation activity (readthrough). A certain
quantity of functional Ade1p protein will therefore be synthesized,
the cells will be autotrophic for adenine and will form white to
pink-coloured colonies.
[0005] In an article which appeared in P.N.A.S, Prof. Stanley
Prusiner's team discloses a test for detecting molecules with
anti-prion activity (Korth et al., 2001). This test is carried out
on a mammal model (murine neuroblastomas infected with PrP.sup.sc).
The safety conditions (P3 laboratory) and cell culture conditions
(significant handling) do not allow high-throughput screening to be
carried out.
[0006] The Application WO 98/30909 also describes a process for
screening molecules with anti-prion activity carried out on rodents
infected with an unconventional transmissible agent. This screening
method has the same limits as the method described in P.N.A.S.
[0007] The inventors' work has led them to produce a
high-throughput screening system in order to detect molecules
possessing an anti-prion activity, based on the colorimetric
reporter system of the protein Sup35p, described above.
[0008] The present invention therefore relates to a kit for
screening molecules with an anti-prion activity, characterized in
that it comprises in combination a yeast of phenotype [PSI+], an
antibiogram and a prion curing agent in sub-effective doses, said
yeast having the adel-14 allele of the ADE1 gene as well as an
inactivated ERG6 gene.
[0009] Although based on yeast prions, the kit according to the
invention makes it possible to isolate molecules active against
mammal prions. Example 7 below shows that the most active molecules
isolated by Prof. Prusiner also have an activity in the screen
according to the invention.
[0010] However, numerous differences are observed between yeast
prions and mammal prions. In an article in the journal "Cellular
and Molecular Life Sciences", Professor C. Cullin proposes, even in
view of these differences, distinguishing yeast prions from mammal
prions by using the term "propagons". As particular differences
between "prions" (mammal) and "propagons" (yeast), there can be
mentioned the cytoplasmic character of propagons whereas the mammal
PrP prion is a protein anchored to the plasmic membrane, the
pathological character of mammal prions, as well as a certain
number of biophysical differences (ternary and quaternary
structure, reversibility of the curing etc.)
[0011] One of the main advantages of such a screen resides in its
complete harmlessness which allows it to be carried out in a
standard level L2 molecular biology laboratory, and not, as
required in the previous techniques, in a level P3 laboratory.
[0012] Moreover, the great ease of use and very low cost of this
kit make it possible carry out high-throughput screening. The use
of antibiogram pellets, which allow the diffusion of the product by
creating a concentration gradient, moreover makes it possible to
test a multiplicity of concentrations in a single experiment,
unlike the standard tests, in which only one concentration is
tested. For each molecule the anti-prion activity of which is
tested, the use of the antibiogram also makes it possible to
acquire information on the toxicity of the product as well as on
the activity/concentration ratio, and thus to determine the best
effective concentration.
[0013] The [PSI+] strain used in the kit according to the invention
carries an inactivation of the ERG6 gene. In fact, yeasts are
naturally fairly impermeable. In particular, the preferred yeast
for implementing the invention, Saccharomyces cerevisiae, has an
impermeability such that the carrying out of a screening process
proves particularly ineffective without this inactivation.
[0014] The screen analysis method according to the invention is
visual thanks to the use of the adel-14 allele. According to the
anti-prion activity of the molecule tested, the colonies of cells
will have a red, pink or white staining. The choice of the strain
of yeast can make it possible to improve the contrast between the
colonies. In fact, certain so-called "Strong" strains facilitate
visual analysis of the screen. Such strains possess a strong level
of aggregation of the prion forms. In the opposite case, the strain
is referred to as "Weak". The strains preferred for implementation
of the invention are therefore the "Strong"-type strains.
[0015] Other yeasts can also be used. As examples there can be
mentioned: Kluyveromyces lactis, Pichia methanolica, Saccharomyces
ludwigii, Kluyveromyces marxianus, Pichia pastoris,
Zygosaccharomyces rouxi, Schizosaccharomyces pombe.
[0016] Given the synthetic lethality observed between the
inactivation of the ERG6 gene and the inactivation of the TRP1
gene, the ERG6 gene can be deleted using the TRP1 gene as deletion
marker.
[0017] Advantageously, the kit moreover comprises a prion curing
agent at sub-effective doses.
[0018] By curing, is meant an elimination of the prion forms from
the yeast cells. This elimination can be temporary or
permanent.
[0019] By way of example, a prion curing agent can be hydrogen
peroxide or preferentially, guanidium chloride.
[0020] By sub-effective doses, is meant doses which used alone
would not suffice to eliminate the prions from the yeasts. The
values of such doses are given, in the examples which follow, for
guanidium chloride.
[0021] The benefits of the presence of a curing agent at
sub-effective doses are to reinforce the sensitivity of the screen
and obtain a better contrast.
[0022] The kit according to the invention can be used in a method
for screening molecules with anti-prion activity. This screening
method, to which the invention also relates, is characterized in
that it uses a [PSI+] phenotype yeast having the adel-14 allele of
the ADE1 gene as well as an inactivated ERG6 gene and comprises the
following stages: [0023] a. production of a lawn of cells in vitro
on a medium complemented with a sub-effective dose of a prion
curing agent, [0024] b. deposition of the compounds to be tested
according to the antibiogram method, [0025] c. incubation for
approximately 2-4 days at approximately 20-25.degree. C., and,
[0026] d. analysis of the staining of the cell colonies.
[0027] This method possesses advantages analogous to those of the
kit according to the invention. It is a visual test, very easy to
analyze. Its implementation is very simple and inexpensive. The
precautions relative to safety are those of a standard molecular
biology laboratory. It allows mass screening: a single person can
manually screen more than 400 products per day. Very
high-throughput screening would be possible by automation of the
method. The screen result is developed after 7 days, without it
being necessary to resort to a lot of handling between day D and
day D+7 (optionally a change in temperature of the incubator).
Finally, this method is particularly economical.
[0028] One of the yeasts preferred for the implementation of this
method is Saccharomyces cerevisiae.
[0029] Advantageously, the curing agent of Stage a. is guanidium
chloride.
[0030] The method can also comprise the following stages: [0031] e.
incubation for approximately 2-4 days approximately 2-6.degree. C.,
and/or, [0032] f. carrying out a secondary screening test.
[0033] The incubation at 2-6.degree. C. makes it possible to
accentuate the contrast in staining of the colonies.
[0034] Preferentially, the secondary screening test can comprise
the following stages: [0035] construction of a strain of yeast in
which the ADE2 gene is under the control of the DAL5 gene promoter
[0036] carrying out Stages a. to e. of the methods described
above.
[0037] Such a secondary screening makes it possible to test very
rapidly whether the molecules isolated during the primary screening
can have a general effect on the prions in the yeast. In fact, the
SUP35 genes (responsible for the [PSI+] prion) and URE2
(responsible for the [URE3] prion) code for enzymes having totally
different functions and the primary sequences of which are very
remote.
[0038] The invention also covers the molecules isolated by the
screening method according to the invention.
[0039] In particular, the screening method has made it possible to
isolate anti-prion agents having the following formula (I):
##STR00001##
in which [0040] R is an H, NH.sub.2, NHR.sup.2 group, where R.sup.2
is an alkyl or alkylaminoalkyl chain with 1 to 10 carbon atoms,
branched or unbranched, [0041] X represents F, Cl, Br, I, CF.sub.3,
SR.sup.3, OR.sup.3, OH, NO.sub.2, COR.sup.S, CONH.sub.2, COOH,
COOR.sup.3, where R.sup.3 is an alkyl group with 1 to 4 carbon
atoms, preferably CH.sub.3. [0042] p and n, identical or different,
are equal to 0, 1 or 2, [0043] q is equal to 0 or 1.
[0044] The invention relates in particular to the anti-prion agents
of formula (III):
##STR00002##
in which [0045] R' represents an H, NH.sub.2,
NH--(CH.sub.2).sub.3--N(CH.sub.3).sub.2,
NH--CH(CH.sub.3)--(CH.sub.2).sub.3--N(CH.sub.2--CH.sub.3).sub.2
group, [0046] X represents F, Cl, CF.sub.3, [0047] p and n,
identical or different, are equal to 0, 1 or 2.
[0048] This family of molecules, called "Kastellpaolitines" by the
inventors, possesses the sought anti-prion activity to a greater or
lesser degree. In particular, the chlorinated derivatives of this
family are particularly effective. The best effectivenesses are
obtained when chlorine is placed in position 2, 3 or 4, preferably
in position 4 (see KP1 in the examples which follow).
[0049] The invention relates more particularly to the compounds of
formula (II):
##STR00003##
in which [0050] R' represents an H, NH.sub.2,
NH--(CH.sub.2).sub.3--N(CH.sub.3).sub.2,
NH--CH(CH.sub.3)--(CH.sub.2).sub.3--N(CH.sub.2--CH.sub.3).sub.2
group, [0051] X represents F, Cl, CF.sub.3, [0052] p and n,
identical or different, are equal to 0, 1 or 2, for use as a
medicament, and in particular, as an anti-prion agent.
[0053] It also relates to the pharmaceutical compositions
comprising a therapeutically effective quantity of at least one
compound of formula (II) in which:
##STR00004## [0054] R' represents an H, NH.sub.2,
NH--(CH.sub.2).sub.3--N(CH.sub.3).sub.2,
NH--CH(CH.sub.3)--(CH.sub.2).sub.3--N(CH.sub.2--CH.sub.3).sub.2
group, [0055] X represents F, Cl, CF.sub.3, [0056] p and n,
identical or different, are equal to 0, 1 or 2, in combination with
at least one pharmaceutically acceptable vehicle.
[0057] Certain compounds of this family are particularly active.
These are phenanthridine and 6-aminophenanthridine, as well as
their chlorinated derivatives, in particular when the chlorine is
placed in position 8, 9 or 10, preferably in position 10 (see in
the examples which follow).
[0058] Preferentially, in formulae (II) and (III), R' represents
NH.sub.2. In fact, a very good activity of the molecules has been
noted when R' represents NH.sub.2.
[0059] The invention also proposes a method for treating
neurodegenerative diseases involving protein aggregates, comprising
a stage of administering to an animal or to a patient a
therapeutically effective quantity of at least one of the compounds
of formula (I), (II) or (III) according to the invention.
[0060] The anti-prion agents according to the invention are
particularly useful for obtaining a medicament intended to prevent
and/or to treat neurodegenerative diseases, in particular of the
protein-aggregation type, such as the spongiform encephalopathies,
Alzheimer's (tau), Parkinson's (.alpha.-synuclein) and Huntington's
(huntingtin) disease etc. These medicaments can be intended for
human or veterinary use, in particular for domestic (cows, sheep
etc.) or wild animals (lynx, the Cervidae such as deer, moose
etc.).
[0061] Other characteristics and advantages of the invention will
become apparent in the examples below and by referring to the
following figures:
[0062] FIG. 1 relates to the feasibility of the screen,
[0063] FIG. 2 illustrates the screening protocol,
[0064] FIG. 3 relates to the isolation of the Kastellpaolitines,
phenanthridine and to their structure/activity relationship,
[0065] FIG. 4 relates to the determination of the activity of the
phenanthridine derivatives,
[0066] FIG. 5 shows the results of the liquid curing tests,
[0067] FIG. 6 relates to the secondary screen based on the [URE3]
prion,
[0068] FIG. 7 demonstrates the validation of the test with
chlorpromazine, quinacrine and verapamil,
[0069] FIG. 8 shows the results of the effect of KP1 on the mammal
prion in an in vitro model, and,
[0070] FIG. 9 relates to a structure/activity study carried out on
the molecule of general formula (II).
EXAMPLE 1
Carrying Out the Screen
1. Material and Methods
[0071] Organisms (Saccharomyces cerevisiae) and culture media The
[PSI+] haploid yeast strain 74-D694 (Mat a, adel-14, trpl-289,
his3-.DELTA.200, ura3-52, leu2-3,112) was used in the development
of the screening method. The strain used is called "Strong" as it
has a well-marked phenotype when the translation termination factor
Sup35p is in prion or aggregated form.
[0072] In order to increase the penetration of the inhibitors, the
inventors genetically modified this strain by introducing into it a
mutation of the ERG6 gene. This gene is involved in the
biosynthesis of ergosterol, a component of the cell wall of the
yeasts. The mutation was produced by insertion at the level of the
chromosome site of the ERG6 gene of a "deletion cassette"
corresponding to the TRP1 marker gene flanked by DNA sequences
situated upstream and downstream of the coding frame of the ERG6
gene. This cassette was produced by PCR using the plasmid
pFA6a-kanMX6 as matrix and the oligonucleotides oBM1060 (5') et
oBM1061 (3') as primers. The "Strong" 74-D694 yeast cells having
integrated the deletion cassette (strain called STRg6, deposited at
the CNCM on 10 Oct. 2002 under number 1-2943) are those which
develop on minimum media devoid of tryptophan. The mutation
.DELTA.erg6::TRP1 was then verified by PCR using the genomic DNA of
the strain STRg6 as matrix and the oligonucleotides oBM1030 (5')
and oBM1063 (3') as primers.
[0073] The PCR primers used have the following nucleotide
sequences:
TABLE-US-00001 oBM1060 (SEQ ID No. 1) 5'
CGATTTAAGTTTTACATAATTTAAAAAAACAAGAATAAAATAATAA
TATAGTAGGCAGCATAAGCGGATCCCCGGGTTAATTAA 3' oBM1061 (SEQ ID No. 2) 5'
CTGCATATATAGGAAAATAGGTATATATCGTGCGCTTTATTTGAAT
CTTATTGATCTAGTGAATGAATTCGAGCTCGTTTAAAC 3' oBM1030 (SEQ ID No. 3) 5'
GGTACCTCGTTCCCGTAC 3' oBM1063 (SEQ ID No. 4) 5'
CAGTCAGAAATCGAGTTCCA 3'
[0074] Unless otherwise indicated, the yeast strains are cultured
at 30.degree. C. in rich medium (YPD.psi.) or in minimum medium.
Unless explicitly specified, the percentages correspond to a
mass/volume ratio. The gelosed form is obtained by the addition of
2% agar.
[0075] YPD.psi.: 1% yeast extract (FISHER.RTM.), 2% peptone
(GiBCO.RTM.) and 2% glucose;
[0076] Minimum medium: 0.175% yeast nitrogen base without amino
acid and ammonium sulphate (DiFCO.RTM.), 0.75% ammonium sulphate
and 2% glucose. This medium is adjusted to pH 6. In order to
compensate for possible auxotrophies, this medium can be completed,
after sterilization, by the addition of amino acids (0.002%
L-histidine and/or 0.004% L-leucine and/or 0.003% L-tryptophan) or
nitrogenous bases (0.0025% uracil and/or 0.008% adenine).
[0077] Method for Screening Substances with Anti-Prion Activity
("Prion Halo Assay")
[0078] The screening method developed is based on the antibiogram
principle. In fact, the compounds to be tested are applied to a
sterile filter-paper disc, itself applied to a dish of solid
YPD.psi. medium containing 0.2 mM of guanidium chloride previously
seeded with approximately 5.10.sup.6 cells of the STRg6 strain in
order to produce a yeast lawn. This quantity of seeded cells (from
10.sup.6 to 10.sup.7) was optimized in order for each cell to be
able to divide at least 6 times (number of generations necessary to
have an effective curing effect with 3 mM of GuHCl). The addition
of a small quantity of guanidium chloride (0.2 mM), a sub-effective
dose for eliminating prions from yeast (the effective dose being of
the order of 1 to 5 mM) makes it possible to increase the
sensitivity of the test (see Results section). The 12 cm square
dishes are then incubated for 3 days at 23.5.degree. C. in order to
allow the appearance and growth of the yeast colonies. These dishes
are then stored for 3 days at 4.degree. C. in order to accentuate
the red staining present around the discs soaked with ingredients
active on the prion form of the protein Sup35p. Comparison with the
negative controls (application of the solvent of the inhibitors
tested) and positive controls (application of a 300 mM guanidium
chloride solution, causing effective elimination of the Sup35p
proteins in prion form) makes it possible to judge the
effectiveness of a compound. FIG. 2 illustrates the protocol of the
screening method: (1) Culture of the STRg6strain; (2) Application
and plating with sterile glass beads 3 & 4 mm in diameter, of
approximately 10.sup.6 cells in exponential growth phase on a dish
of solid YPD.psi. medium containing 0.2 mM of guanidium chloride:
constitution of the cell "lawn"; (3) Application of the sterile
filter-paper discs according to a grid allowing the analysis of 32
compounds (including controls) and deposit of 20 .mu.l maximum of
each of the products to be tested; (4) Incubation; (5) Scanning of
the result obtained; (6) Example showing the isolation of a
compound having a strong anti-prion activity.
Synthesis of 11-aminodibenzo[b,f][1,4]thiazepines and
6-aminophenanthridine
[0079] 11-aminodibenzo[b,f][1,4]thiazepines, also called
Kastellpaolitines, can be prepared in a single stage. The synthesis
of these products has already been described in the publication by
Mettey et al., 1997.
2. Results
Principle and Feasibility of the Screen
[0080] Guanidium chloride, the only product known to effectively
eliminate prions from the yeast Saccharomyces cerevisiae, served
not only as a positive control throughout screening, but also for
studying the feasibility of the method as well as developing it.
Guanidium chloride effectively eliminates the different yeast
prions at a dose comprised between 1 and 5 mM (Fernandez-Bellot and
Cullin, 2001). Under these conditions, the curing requires a
constant presence of this product for six to ten generations in
exponential growth phase compromising the feasibility of the screen
on a dish such as the inventors wished to achieve.
[0081] FIG. 1 shows the feasibility of the screen.
[0082] The three left-hand panels: a [PSI+] strain is cultured for
48 hours in the presence of 5 mM guanidium chloride (with 0.2% DMSO
final) or, as a control, with only 0.2% DMSO final. At T=0, then
every 24 hours, a 10 .mu.l drop (approximately 10.sup.4 cells) is
applied to a dish of rich medium. The guanidium chloride curing
begins to have an effect after 24 hours of treatment, i.e. after
approximately 6 generations (a pink staining begins to appear).
After 48 hours, i.e. after approximately 12 generations, the drop
of cells has a clearly red staining, a sign of a complete curing of
the [PSI.sub.+] cells.
[0083] The middle panel: a few cells are taken at T=48 hours and
scratched onto a fresh medium. Almost all of them form red colonies
in the case of curing with guanidium chloride.
[0084] The right-hand panel: these same cells are pelleted at the
bottom of an Eppendorf tube after liquid culture. In the case of
curing with guanidium chloride, they form a red pellet.
[0085] The first stage therefore consisted of determining whether
guanidium chloride could have an effect which can be visualized on
a dish of [PSI+] cells with the antibiogram pellet system. Once
this stage was carried out, the inventors developed the optimum
temperature, medium and density conditions as well as cell type to
use (FIG. 2). The strain having the best sensitivity is the STRg6
strain cultured at 23.5.degree. C. and in the presence of 200 .mu.M
of guanidium chloride. In fact, the introduction of a sub-effective
dose of guanidium chloride into the medium makes it possible to
increase the sensitivity of the test.
Screening of a Combinatorial Library
[0086] Compounds (approximately 1000) were passed through the
screen using the conditions optimized by the inventors (FIG. 2). On
each dish, 15 .mu.l of DMSO are deposited on the filter at the top
left (negative control) and 15 .mu.l of a 300 mM solution of
guanidium chloride in DMSO (positive control) were applied to the
filter at the bottom right. The same volume (15 .mu.l) of each of
the products of the library (all in 10 mM solution in DMSO) was
applied to the remaining filters (thirty for each large square
Petri dish). A positive signal (visualization of a red halo around
the sterile filter-paper disc to which the product is applied) was
obtained for five products. These products correspond to four
molecules of the same family, called "Kastellpaolitines" by the
inventors, and to a well-known fifth molecule: phenanthridine.
EXAMPLE 2
Identification of the Kastellpaolitines and Phenanthridine
[0087] The chemical structures of the Kastellpaolitines and
phenanthridine are shown in FIG. 3B. The panel 3A shows a
comparative analysis of the size of the red halos obtained with all
of these molecules respectively (all applied in an equivalent
quantity: 15 .mu.l of a 10 mM solution in DMSO). This experiment
makes it possible to compare the relative activity of each of these
products. The most active is Kastellpaolitine 1 (or KP1) followed
by phenanthridine.
6-Aminophenanthridine Synthesis and Test
[0088] Comparative analysis of phenanthridine on the one hand, and
of the Kastellpaolitines on the other hand show several common
points between these two groups of molecules (FIG. 3). The
different molecules are classified there from the least active to
the most active and their respective formulae indicated. All are
tri-cyclic, the central ring containing in all cases a nitrogen
atom with a double bond to an adjacent carbon atom. In contrast, in
all the Kastellpaolitines, the carbon of the central ring which has
a double bond to this nitrogen atom carries an amino group, which
is not the case for phenanthridine. This observation led the
inventors to want to test 6-aminophenanthridine.
[0089] 6-aminophenanthridine can be prepared according to the
procedure developed by Kessar et al., 1969.
[0090] 6-aminophenanthridine was therefore passed through the
screen according to the invention, in comparison with the
Kastellpaolitines 1 (KP1) and 5 (KP5) as well as phenanthridine.
The result is very clear: 6-aminophenanthridine is still more
active than the Kastellpaolitines and phenanthridine.
[0091] FIG. 4 illustrates the results of this comparison: the
activity of 6-aminophenanthridine was determined on a dish and
compared to that of phenanthridine. For all the molecules, the same
quantity is applied (10 .mu.l of a 10 mM solution). In the case of
the positive control (guanidium chloride), the solution used was
300 mM.
[0092] As a result, by grafting this amino group, characteristic of
the Kastellpaolitines onto phenanthridine, the inventors
significantly increased the activity of the latter.
[0093] By following the same approach, the inventors then added a
chlorine in position 8 in 6-aminophenanthridine (6AP) in order to
produce 6-amino-8-chlorophenanthridine (6A-8CP). This modification
again increased the activity of the compound. Finally, the chlorine
in position 8 was replaced by a trifluoromethyl group in order to
produce 6-amino-8-trifluoromethylphenanthridine (6A-8tFP). As shown
by FIG. 4, the latter modification led to an additional increase in
activity and 6A-8tFP in fact represents one of the most active
compounds.
EXAMPLE 3
Synergy Between Products Isolated Using the Screen and Guanidium
Chloride
[0094] All the active molecules were isolated in a medium
containing a weak dose of guanidium chloride (200 .mu.M/effective
dose=4 mM). Taking this course, established during the development
of the screen corresponded to the wish to increase the sensitivity
(and therefore the detection threshold of the method). The effect
of the molecules in media containing more (500 .mu.M) guanidium
chloride or not containing any, was observed subsequently.
Phenanthridine is always active on a medium without-guanidium
chloride, but its activity increases significantly as a function of
the quantity of guanidium chloride (however in a clearly
sub-effective dose) in the medium. This result indicates a synergy
of action between guanidium chloride and phenanthridine. The same
result was obtained for all the other molecules isolated by the
inventors (the Kastellpaolitines, 6-aminophenanthridine and its
derivatives).
EXAMPLE 4
Verification of Liquid Medium Curing
[0095] The inventors then wanted to determine whether the red halos
observed in the yeast test corresponded to [PSI+] prion curing and
not to an artefact (for example these red halos could be due to a
direct inhibition of the biosynthesis chain of adenine by these
molecules, which would lead to a accumulation of the AIR). If these
molecules effectively eliminate the [PSI+] prion, a treatment of
[PSI+] cells in liquid culture followed by washing of said cells
must allow them to form red colonies on a gelosed medium no longer
containing the molecules. These tests were carried out with
6-aminophenanthridine on the wild-type "strong" strain 74-D694.
[0096] The liquid medium curing conditions are the following: a
[PSI+] strain is cultured for 5 days in liquid medium in the
presence of the indicated quantities of the different products (see
FIG. 5). Every 24 hours, an aliquot fraction is washed in medium
uncontaminated by any product and applied to a solid gelosed medium
(itself also uncontaminated by any product) which is then treated
as indicated in FIG. 2.
[0097] As shown in FIG. 5, 6-aminophenanthridine is capable of
partially curing the [PSI+] prion from a significant number of
cells. The curing effectiveness can in particular be increased by
adding a sub-effective dose (100 .mu.M) of guanidium chloride to
the culture medium. In such a liquid curing, the same synergic
effect as that observed in the dish test is also found.
EXAMPLE 5
Development and Use of a Secondary Colorimetric Screen Based on the
Use of [URE3], Another Yeast Prion
[0098] Another rapid dish test was carried out, based on another
yeast prion: [URE3]. This test constituted a secondary screen which
makes it possible to generalize the effect of the products isolated
during the primary screen of another yeast prion. In this way, it
is possible to remove the molecules active only against the [PSI+]
prion and therefore less useful, having a non-general effect.
[0099] For the [URE3] prion the haploid strain used is CC34 (Mat a,
trpl-1, ade2-1, leu2-3,112, his3-11, 15, ura2::HIS3).
[0100] The NT34 strain which served for the secondary screen was
constructed from CC34, a strain in which the coding frame of the
DAL5 gene has been replaced by that of the ADE2 gene using the same
method as that used for the construction of the STRg6 strain. For
this purpose a deletion cassette corresponding to the ADE2 gene
flanked by DNA sequences situated upstream and downstream of the
coding frame of the DAL5 gene was produced by PCR using genomic DNA
of the BY4742 haploid strain (Mat .alpha., his3.DELTA.l,
leu2.DELTA.O, lys2.DELTA.0, ura3.DELTA.0) as matrix and the
oligonucleotides:
TABLE-US-00002 ACAACAAAACAAGGATAATCAAATAGTGTAAAAAAAAAAATTCAAGATG
GATTCTAGAACAGTTGG (SEQ ID No. 5) (5'), and
TATATTCTTCTCTGATAACAATAATGTCAGTGTATCTCACCACTATTA
TTACTTGTTTTCTAGATAAGC (SEQ ID No. 6) (3') as primers.
[0101] The mutation DAL5::ADE2 was then verified by PCR using the
genomic DNA of the NT34 strain as matrix and the
oligonucleotides:
TABLE-US-00003 ATAGTCTCTGCTCATAG (SEQ ID No. 7) (5'), and
GCTTACAGAAATTCTAC (SEQ ID No. 8) (3') as primers.
[0102] The NT34 strain (Mat a, trpl-1, ade2-1, leu2-3,112,
his3-11,15, ura2::HIS3, DAL5::ADE2) was deposited at the CNCM on 10
Oct. 2002 under number 1-2942.
[0103] This screen is based on the same colorimetric system as the
primary screen. In the NT34 yeast strain, the ADE2 gene is no
longer under the control of its own promoter, but under that of the
DAL5 gene. When the protein Ure2p is in prion form ([URE3]), the
transcription from the promoter of the DAL5 gene is activated,
therefore the ADE2 gene is expressed, therefore the strains are
white and autotrophic for adenine. When the URE2p protein is in the
normal form ([URE3-0]), the transcription from the promoter of the
DAL5 gene is repressed, therefore the ADE2 gene is not expressed,
therefore the strains are red and auxotrophic for adenine. When the
NT34 strain is treated with 5 mM of guanidium chloride for
approximately ten generations, it forms red colonies (as expected
and as the [PSI+] strain used for the primary screening would do).
As can be observed in FIG. 6, phenanthridine and
6-aminophenanthridine cause the appearance of a red halo when they
are applied to the small filter itself applied to the lawn of cells
previously plated on the gelosed nutritive medium (same process as
for the primary screen, see FIG. 2). This result suggests that
these products are also active on the [URE3] prion. It is to be
noted, however, that this secondary screen is clearly less
sensitive than the primary screen. It is therefore very useful for
rapidly observing whether the effect of the molecules isolated
during the first screen can be generalized to other yeast prions
but in no event could it be substituted for the primary screen.
[0104] In order to increase cell permeability, the coding sequence
of the ERG6 gene was also replaced by that of the TRP1 gene. In
this strain (SB34), the transcription of ADE2 therefore depends on
the state of Ure2p: if Ure2p is inactivated by a prion mechanism
([ure3] cells), the ADE2 gene is actively transcribed whereas in
the [ure 3-0] cells, it is not. Therefore, the [URE3] cells of the
SB34 strain will form white colonies whereas the [ure3-0] cells
will form red colonies. Because this strain always contains the
ade2-1 allele, it was envisaged that this strain could be [PSI+],
such that the red staining could be due to the curing of [PSI+]
rather than of [URE3]. This possibility has been excluded by
verifying using cytoduction and conjugation that the strain is
[URE3]. Moreover, the entire coding sequence of the ade2-1 gene was
deleted in order to produce the NT35 strain. This strain also
formed white colonies, demonstrating again that it is [URE3].
[0105] The SB34 strain was constructed by replacing the ERG6 gene
in CC34 by PCR amplification of the TRP1 marker and by replacing
the coding region of the DAL5 gene by the ADE2 gene using a method
based on PCR by deletion of the ERG6 gene with the primers
(5'-ACAACAAAACAAGGATAATCAAATAG
TGTAAAAAAAAAAATTCAAGATGGATTCTAGAACAGTTGG-3') (SEQ ID No. 9) and 342
(5'-TATATTCTTCTCTGATAACAATAATGTCAGTGTATCTCACCA
CTATTATTACTTGTTTCTAGATAAGC-3') (SEQ ID No. 10). This gene
replacement was then confirmed by growth on the SD-Ade medium, in
the absence of growth on the USA medium (as provided for a da15
strain) and by analytic PCR on the genomic DNA. The [URE3]
phenotype of this strain was verified by cytoduction: among 30
cytoduction agents, 26 were capable of growing on USA medium,
showing that they were [URE3]. The NT35 strain was constructed by
replacing the ade2-1 gene in the SB34 strain by the marker KanMX
amplified by PCR and by verifying the successful replacement of the
gene by analytic PCR on the genomic DNA.
EXAMPLE 6
Verification of Liquid Medium [URE3] Curing
[0106] Two types of experiments were carried out in order to verify
that the effect observed on dishes with the NT34 strain corresponds
to curing. Firstly, cells in the zones surrounding the filter were
recovered for the negative (DMSO), and positive (guanidium
chloride) control for phenanthridine and for 6-aminophenanthridine.
These cells were then scratched onto a fresh medium free of all
these molecules. The cells recovered around the filters all form
red colonies, with the exception of those collected around the
negative control. This result shows that the red staining observed
on dishes for the NT34 strain corresponds to curing and not to an
artefact linked to inhibition of an enzyme of the biosynthesis
route of adenine (in this case, the red staining would be lost on a
medium without inhibitor). The curing effect of phenanthridine and
6-aminophenanthridine was also directly verified on the [URE3]
prion. [URE3] cells of the CC34 strain grow on a medium called USA
whereas cured ([urea-0]) cells are incapable of growing on this
medium. The inventors examined the ability of [URE3] cells treated
with 200 .mu.M of guanidium chloride (negative control), 5 .mu.M of
guanidium chloride (positive control) or with different doses of
6-aminophenanthridine (alone or in combination with 200 .mu.M of
guanidium chloride) to grow on a USA medium. 6-aminophenanthridine
is capable of curing the [URE3] prion in a significant manner and,
just as for the [PSI+] prion, this effect is accentuated by a low
dose of guanidium chloride (200 .mu.M). These results, apart from
the fact that they validate the secondary screen with the NT34
strain, suggest that the effect of the inhibitors revealed by said
screen should be general on all yeast prions.
EXAMPLE 7
Validation of the Screen with Two Molecules Active on the Mammal
Prion PrP: Chlorpromazine and Guinacrine
[0107] The laboratory of Stanley Prusiner, who first put forward
the "protein-only" hypothesis and was awarded the Nobel prize in
1997, has isolated a certain number of molecules active on the
mammal prion PrP using a system of murine cells (neuroblastomas)
chronically infected with the prion PrP.sup.sc (Korth et al.,
2001). This system, due to its labour-intensiveness and its
complexity, does not allow mass screening like that developed by
the inventors. Thus the approach of Stanley Prusiner's group was to
test one-by-one, from the molecules already used as medicaments,
those which pass the blood-brain barrier. Certain molecules, such
as in particular quinacrine (used as an anti-malarial drug for a
long time) or chlorpromazine (an antidepressant) have a particular
activity in their system. In order to validate the screen, the
inventors therefore tested chlorpromazine and quinacrine in their
yeast system. As shown in FIG. 7, these two molecules have a
certain activity against the [PSI+] prion. It must however be noted
that their activities are clearly weaker than that of
6-aminophenanthridine. It can also be seen that chlorpromazine and
quinacrine, like all of the molecules highlighted by the invention,
exhibit a strong synergy of action with guanidium chloride (In FIG.
7, the medium used contains 200 .mu.M of guanidium chloride). The
latter result suggests that these two molecules act on the same
biochemical route as the isolated molecules according to the
invention.
[0108] Moreover, it is interesting to note that quinacrine, the
activity of which is approximately ten times greater than that of
chlopromazine in Prof. Prusiner's test, also exhibits an activity
greater than the latter in the screen developed by the inventors.
Moreover, just as in Prof. Prusiner's test, chlorpromazine and
quinacrine require prolonged treatment (at least 6 days in the case
of Prof. Prusiner's test, at least two to three days in the case of
the screen according to the invention) before an activity is
detected.
[0109] Moreover, the inventors determined the activity, in the test
according to the invention, of other molecules isolated using the
test based on mouse neuroblastomas, developed by Prof. Prusiner. A
good correlation was found between the results obtained in the two
systems: acepromazine which is shown to be slightly active in the
mammal system also exhibits a weak activity in the test according
to the invention and the molecules inactive in analysis on mammals
such as carbamazepine, imipramine, haloperidol, chloroprothixene or
methylene blue were also inactive in the test.
[0110] Quinacrine has also been described as an inhibitor of
multiple drug resistance (MDR). In order to test whether its
anti-prion effect could involve this mechanism (which is compatible
with the synergic effect of GuHCl), we evaluated the putative
curative effect of an effective general inhibitor of MDR,
verapamil. As shown by FIG. 7, although a strong concentration of
this medicament was used, a concentration close to toxicity, no
curative effect could be detected.
[0111] All these correlations between the activity of quinacrine
and chlorpromazine according to the test or the screen used make it
possible to validate the use of the method according to the
invention in order to carry out high-throughput screenings with a
view to isolating molecules capable of constituting effective
medicaments (on mammals and in particular humans) against
neurodegenerative diseases involving protein aggregates, of
spongiform-encephalopathy type, Alzheimer's disease, Huntington's
disease etc.
EXAMPLE 8
Analysis of the Inhibition of PrP.sup.sc in ScN2a-22L Cells
[0112] Mouse neuroblastoma cells infected with the scrapie prion
(ScN2a-22L) were used. The cells were cultured in 25 cm.sup.2
flasks in the presence or absence of the compounds for several
days. Then, the proteins were extracted from the ScN2a-22L cells by
cell lysis in 500 .mu.l of lysis buffer (50 mM of Tris HCl pH 7.5;
150 mM of NaCl, 0.5% sodium deoxycholate; 0.5% Triton X100). After
normalization of the proteins with the Uptima Interchim kit, the
adjusted quantities of cell lysates were digested by proteinase K
at 20 .mu.g/ml (Eurobio) for 40 minutes at 37.degree. C. The
lysates were then centrifuged for 90 minutes at 20,000.times.g and
the pellet was resuspended in 25 .mu.l of denaturing buffer
(1.times.Tris-Glycine; 4% of SDS, 2% of .beta.-mercaptoethanol; 5%
of sucrose and bromophenol blue) and heated for 5 minutes at
100.degree. C. before Western blot analysis according to the
standard protocol using the mouse monoclonal antibody anti-PrP
SAF83 (supplied by SPI-BIO, Massy-Palaiseau, France). The
percentages of inhibition of the formation de PrP.sup.sc resistant
to proteinase K were calculated using NIH Image J: the inhibition
of the accumulation of PrP.sup.sc was 96% for chlorpromazine
(Chlor.) and 70%+/-6% for KP1.
[0113] Two of the compounds selected (KP1 and 6AP) were tested in
this mammal system. As shown by FIG. 8, KP1 was capable of inducing
a significant reduction in the accumulation of mammal prion at a
dose similar to that used for chlorpromazine (5 .mu.M). After 7
days of treatment, 70% of the PrP.sup.sc resistant to proteinase K
have disappeared (wells 1 to 3) compared with untreated cells
(wells 4 and 5). This significant effect was probably
under-estimated since the cells treated with the solvent of the
compounds alone (DMSO 0.01%) showed a significant and reproducible
rise in PrP.sup.sc resistant to proteinase K (well 6). The same
effect on the elimination of PrP.sup.sc was obtained with 6AP at 2
and 4 .mu.M.
[0114] These results therefore validate the use of the screening
test according to the invention based on yeast in order to isolate
anti-prion compounds since quinacrine and chlorpromazine were
detected using this analysis and KP1 and 6AP were also effective in
promoting the elimination of the mammal prion in vitro.
EXAMPLE 9
Study Structure/Activity
[0115] For the purpose of studying the different substitution
positions of the anti-prion molecules isolated, the inventors
carried out a structure/activity study on the 6-aminophenanthridine
molecule. 2-fluoro-6-aminophenanthridine (2F-6AP),
2-fluoro-6-amino-8-chlorophenanthridine (2f-6A-8ClP) and
6-amino-7-chlorophenanthridine (6A-7C1P) molecules were thus
obtained by chemical synthesis and their anti-prion activity was
determined using the test according to the invention. The results
obtained are shown in FIG. 9. The diameters of the red halos
obtained being proportional to the anti-prion activity of the
molecules deposited, the results indicate that the presence of a
halogen-type substituent at the level of positions 7 or 8 increases
the anti-prion activity of the molecules of formulae (II) whereas
the same type of substituent in position 2 tends to reduce it.
BIBLIOGRAPHICAL REFERENCES
[0116] Fernandez-Bellot et al., "The protein-only theory and the
yeast Saccharomyces cerevisiae: the prions and the propagons",
CMLS, 2001, 58: 1857-1878. [0117] Korth C. et al., "Acridine and
phenothiazine derivatives as pharmacotherapeutics for prion
disease", PNAS, 2001, 98(17): 9836-9841. [0118] Mettey Y. et al.,
"Synthesis of 11-Aminodibenzo[b,f][1,4]thiazepines and Fluoro
derivatives", J. Heterocyclic Chem., 1997, 34: 465-467. [0119]
Kessar S. V. et al., Tetrahedron Letters, 1969, 1151.
Sequence CWU 1
1
10184DNAArtificial sequenceprimer 1cgatttaagt tttacataat ttaaaaaaac
aagaataaaa taataatata gtaggcagca 60taagcggatc cccgggttaa ttaa
84284DNAArtificial sequenceprimer 2ctgcatatat aggaaaatag gtatatatcg
tgcgctttat ttgaatctta ttgatctagt 60gaatgaattc gagctcgttt aaac
84318DNAArtificial sequenceprimer 3ggtacctcgt tcccgtac
18420DNAArtificial sequenceprimer 4cagtcagaaa tcgagttcca
20566DNAartificial sequenceprimer 5acaacaaaac aaggataatc aaatagtgta
aaaaaaaaaa ttcaagatgg attctagaac 60agttgg 66669DNAArtificial
sequenceprimer 6tatattcttc tctgataaca ataatgtcag tgtatctcac
cactattatt acttgttttc 60tagataagc 69717DNAArtificial sequenceprimer
7atagtctctg ctcatag 17817DNAArtificial sequenceprimer 8gcttacagaa
attctac 17966DNAArtificial sequenceprimer 9acaacaaaac aaggataatc
aaatagtgta aaaaaaaaaa ttcaagatgg attctagaac 60agttgg
661068DNAArtificial sequenceprimer 10tatattcttc tctgataaca
ataatgtcag tgtatctcac cactattatt acttgtttct 60agataagc 68
* * * * *