U.S. patent application number 13/293547 was filed with the patent office on 2012-05-17 for compositions and methods for immunostimulatory rna oligonucleotides.
This patent application is currently assigned to Gunther Hartmann. Invention is credited to Gunther Hartmann, Veit Hornung.
Application Number | 20120121551 13/293547 |
Document ID | / |
Family ID | 56290854 |
Filed Date | 2012-05-17 |
United States Patent
Application |
20120121551 |
Kind Code |
A1 |
Hartmann; Gunther ; et
al. |
May 17, 2012 |
COMPOSITIONS AND METHODS FOR IMMUNOSTIMULATORY RNA
OLIGONUCLEOTIDES
Abstract
The present invention provides 4-nucleotide (4mer) RNA motifs
that confer immunostimulatory activity, in particular,
IFN-.alpha.-inducing activity to a RNA oligonucleotide. The present
invention also provides RNA oligonucleotides, including siRNA, with
high or low immunostimulatory activity. The present invention
further provides the use of the RNA oligonucleotides of the
invention for therapeutic purposes.
Inventors: |
Hartmann; Gunther; (Bonn,
DE) ; Hornung; Veit; (Pullach, DE) |
Assignee: |
Hartmann; Gunther
Bonn
DE
|
Family ID: |
56290854 |
Appl. No.: |
13/293547 |
Filed: |
November 10, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12066903 |
Nov 10, 2008 |
8076068 |
|
|
PCT/EP2006/008980 |
Sep 14, 2006 |
|
|
|
13293547 |
|
|
|
|
60717323 |
Sep 15, 2005 |
|
|
|
Current U.S.
Class: |
424/93.7 ;
514/44A; 514/44R |
Current CPC
Class: |
C12N 15/117 20130101;
C12N 2310/17 20130101; A61K 2039/55561 20130101; C12N 15/111
20130101; A61P 37/02 20180101; C12N 2320/10 20130101; A61K 39/39
20130101 |
Class at
Publication: |
424/93.7 ;
514/44.R; 514/44.A |
International
Class: |
A61K 31/7105 20060101
A61K031/7105; A61K 31/713 20060101 A61K031/713; A61P 37/02 20060101
A61P037/02; A61K 35/12 20060101 A61K035/12 |
Foreign Application Data
Date |
Code |
Application Number |
Sep 14, 2005 |
EP |
05020020.3 |
Dec 19, 2005 |
EP |
05027778.9 |
Claims
1-84. (canceled)
85. A pharmaceutical composition comprising an oligonucleotide and
a pharmaceutically acceptable carrier, wherein the oligonucleotide
comprises at least one of the 4-nucleotide (4-mer) motifs selected
from the group consisting of: GUUC, GUCA, GCUC, GUUG, GUUU, GGUU,
GUGU, GGUC, GUCU, GUCC, GCUU, UUGU, UGUC, CUGU, CGUC, UGUU, GUUA,
UGUA, UUUC, UGUG, GGUA, GUCG, UUUG, UGGU, GUGG, GUGC, GUAC, GUAU,
UAGU, GUAG, UUCA, UUGG, UCUC, CAGU, UUCG, CUUC, GAGU, GGUG, UUGC,
UUUU, CUCA, UCGU, UUCU, UGGC, CGUU, CUUG, and UUAC, wherein the
nucleotide sequences of the motifs are 5'.fwdarw.3', wherein the
oligonucleotide is between 6 and 64 nucleotides in length, wherein:
(i) at least one strand of the RNA oligonucleotide has an
IFN-.alpha. score of at least 23 when n=6; at least 26 when n=7; at
least 28 when n=8; at least 30 when n=9; at least
1.4909.times.n+22.014 when n is greater than 9, wherein the
IFN-.alpha. score is assigned according to a method comprising: (a)
identifying all possible 3-nucleotide (3mer) motifs contained in
the oligonucleotide; (b) assigning an IFN-.alpha. point score for
each individual 3mer motif: (i) for a 3mer motif which appears in
Table 7, assigning an IFN-.alpha. point score according to Table 7;
(ii) for a 3mer motif which does not appear in Table 7, assigning
an IFN-.alpha. point score of 0; and (c) assigning the sum of the
IFN-.alpha. point scores of individual 3mer motifs as the
IFN-.alpha. score of the oligonucleotide; or (ii) at least one
strand of the RNA oligonucleotide has an IFN-.alpha. score of at
least 0.58, wherein the IFN-.alpha. score is assigned according to
a method comprising the steps of: (a) identifying all possible
3-nucleotide (3mer) motifs contained in the oligonucleotide; (b)
assigning an IFN-.alpha. point score for each individual 3mer motif
according to Table 12A; and (c) assigning the highest individual
IFN-.alpha. point score as the IFN-.alpha. score of the
oligonucleotide; wherein n is length of the oligonucleotide; and
provided that the oligonucleotide is not
5'-UUGAUGUGUUUAGUCGCUA-3',5'-GCACCACUAGUUGGUUGUC-3',5'-GUUGUAGUUGUACUCCAG-
C-3',5'-GCCCGUCUGUUGUGUGACUC-3',5'-GUCUGUUGUGUG-3', or
5'-GUUGUGGUUGUGGUUGUG-3'.
86. The pharmaceutical composition of claim 85, wherein the
4-nucleotide motifs are selected from the group consisting of GUUC,
GUCA, GCUC, GUUG, GUUU, and GGUU.
87. The pharmaceutical composition claims 86, wherein spacer
nucleotides between the 4-nucleotide motifs are identical, and the
spacer nucleotide are selected from the group consisting of A, T,
C, G, and variants and derivatives thereof.
88. The pharmaceutical composition of claim 85, wherein the
oligonucleotides does not have gene silencing activity for any
known mammalian gene.
89. A pharmaceutical composition comprising an oligonucleotide and
a pharmaceutically acceptable carrier, wherein: at least one strand
of the oligonucleotide has an IFN-.alpha. score of at least
1.4909.times.n+31.014, wherein the IFN-.alpha. score is assigned
according to a method comprising: (a) identifying all possible
3-nucleotide (3mer) motifs contained in the oligonucleotide; (b)
assigning an IFN-.alpha. point score for each individual 3mer
motif: (i) for a 3mer motif which appears in Table 7, assigning an
IFN-.alpha. point score according to Table 7; (ii) for a 3mer motif
which does not appear in Table 7, assigning an IFN-.alpha. point
score of 0; and (c) assigning the sum of the IFN-.alpha. point
scores of individual 3mer motifs as the IFN-.alpha. score of the
oligonucleotide; or (ii) at least one strand of the RNA
oligonucleotide has an IFN-.alpha. score of at least 0.58, wherein
the IFN-.alpha. score is assigned according to a method comprising
the steps of: (a) identifying all possible 3-nucleotide (3mer)
motifs contained in the oligonucleotide; (b) assigning an
IFN-.alpha. point score for each individual 3mer motif according to
Table 12A; and (c) assigning the highest individual IFN-.alpha.
point score as the IFN-.alpha. score of the oligonucleotide; and
wherein the oligonucleotide is an siRNA and n is between 14 and 25,
or wherein the oligonucleotide is an antisense RNA and n is between
14 and 50.
90. A pharmaceutical composition comprising an oligonucleotide and
a pharmaceutically acceptable carrier, wherein: (i) all strand(s)
of the oligonucleotide has(have) an IFN-.alpha. score of at most
0.6075.times.-9.9484, wherein the IFN-.alpha. score is assigned
according to a method comprising: (a) identifying all possible
3-nucleotide (3mer) motifs contained in the oligonucleotide; (b)
assigning an IFN-.alpha. point score for each individual 3mer
motif: (i) for a 3mer motif which appears in Table 7, assigning an
IFN-.alpha. point score according to Table 7; (ii) for a 3mer motif
which does not appear in Table 7, assigning an IFN-.alpha. point
score of 0; and (c) assigning the sum of the IFN-.alpha. point
scores of individual 3mer motifs as the IFN-.alpha. score of the
oligonucleotide; or (ii) wherein all strand(s) of the
oligonucleotide has(have) an IFN-.alpha. score of at most 0.11,
wherein the IFN-.alpha. score is assigned according to a method
comprising the steps of: (a) identifying all possible 3-nucleotide
(3mer) motifs contained in the oligonucleotide; (b) assigning an
IFN-.alpha. point score for each individual 3mer motif according to
Table 12A; and (c) assigning the highest individual IFN-.alpha.
point score as the IFN-.alpha. score of the oligonucleotide; and
wherein the oligonucleotide is an siRNA and n is between 19 and 25,
or wherein the oligonucleotide is an antisense RNA and n is between
18 and 50.
91. A pharmaceutical composition comprising an in vitro activated
dendritic cell and a pharmaceutically acceptable carrier, wherein
the in vitro activated dendritic cell is produced by a method
comprising: (a) complexing an RNA oligonucleotide with a
complexation agent; (b) contacting dendritic cells isolated from a
donor mammal with the complexed RNA oligonucleotide; and (c)
contacting the dendritic cells with an antigen, wherein:wherein the
oligonucleotide comprises at least one of the 4-nucleotide (4-mer)
motifs selected from the group consisting of: GUUC, GUCA, GCUC,
GUUG, GUUU, GGUU, GUGU, GGUC, GUCU, GUCC, GCUU, UUGU, UGUC, CUGU,
CGUC, UGUU, GUUA, UGUA, UUUC, UGUG, GGUA, GUCG, UUUG, UGGU, GUGG,
GUGC, GUAC, GUAU, UAGU, GUAG, UUCA, UUGG, UCUC, CAGU, UUCG, CUUC,
GAGU, GGUG, UUGC, UUUU, CUCA, UCGU, UUCU, UGGC, CGUU, CUUG, and
UUAC, wherein the nucleotide sequences of the motifs are
5'.fwdarw.3', wherein the oligonucleotide is between 6 and 64
nucleotides in length, wherein: (i) at least one strand of the RNA
oligonucleotide has an IFN-.alpha. score of at least 23 when n=6;
at least 26 when n=7; at least 28 when n=8; at least 30 when n=9;
at least 1.4909.times.n+22.014 when n is greater than 9, wherein
the IFN-.alpha. score is assigned according to a method comprising:
(a) identifying all possible 3-nucleotide (3mer) motifs contained
in the oligonucleotide; (b) assigning an IFN-.alpha. point score
for each individual 3mer motif: (i) for a 3mer motif which appears
in Table 7, assigning an IFN-.alpha. point score according to Table
7; (ii) for a 3mer motif which does not appear in Table 7,
assigning an IFN-.alpha. point score of 0; and (c) assigning the
sum of the IFN-.alpha. point scores of individual 3mer motifs as
the IFN-.alpha. score of the oligonucleotide; or (ii) at least one
strand of the RNA oligonucleotide has an IFN-.alpha. score of at
least 0.58, wherein the IFN-.alpha. score is assigned according to
a method comprising the steps of: (a) identifying all possible
3-nucleotide (3mer) motifs contained in the oligonucleotide; (b)
assigning an IFN-.alpha. point score for each individual 3mer motif
according to Table 12A; and (c) assigning the highest individual
IFN-.alpha. point score as the IFN-.alpha. score of the
oligonucleotide; wherein n is length of the oligonucleotide; and
provided that the oligonucleotide is not
5'-UUGAUGUGUUUAGUCGCUA-3',5'-GCACCACUAGUUGGUUGUC-3',5'-GUUGUAGUUGUACUCCAG-
C-3',5'-GCCCGUCUGUUGUGUGACUC-3',5'-GUCUGUUGUGUG-3', or
5'-GUUGUGGUUGUGGUUGUG-3'.
92. The pharmaceutical composition of claim 91, wherein the
4-nucleotide motifs are selected from the group consisting of GUUC,
GUCA, GCUC, GUUG, GUUU, and GGUU.
93. The pharmaceutical composition claims 91, wherein spacer
nucleotides between the 4-nucleotide motifs are identical, and the
spacer nucleotides are selected from the group consisting of A, T,
C, G, and variants and derivatives thereof.
94. The pharmaceutical composition of claim 93, wherein the
oligonucleotide does not have gene silencing activity for any known
mammalian gene.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to the field of immunotherapy
and drug discovery. The present invention provides a method for
determining the immunostimulatory activity of a RNA
oligonucleotide. The present invention also provides a method for
predicting the immunostimulatory activity of a RNA oligonucleotide.
The present invention further provides a method for preparing RNA
oligonucleotides with high or low immunostimulatory activity.
Moreover, the present invention provides RNA oligonucleotides with
immunostimulatory activity and the therapeutic uses thereof. In
addition, the present invention provides RNA oligonucleotides with
gene silencing activity and with either high or low
immunostimulatory activity, the methods of their preparation, and
their therapeutic uses.
BACKGROUND OF THE INVENTION
[0002] The vertebrate immune system established different ways to
detect invading pathogens based on certain characteristics of their
microbial nucleic acids. Detection of microbial nucleic acids
alerts the immune system to mount the appropriate type of immune
response that is required for the defense against the respective
type of pathogen detected. Detection of viral nucleic acids leads
to the production of type I interferon (IFN), the key cytokine for
anti-viral defence. An understanding of how nucleic acids interact
with the vertebrate immune system is important for developing
different nucleic acid-based therapeutic strategies for the
immunotherapy of diseases (Rothenfusser S et al. 2003, Curr Opin
Mol Ther 5:98-106) and for developing gene-specific therapeutic
agents (Tuschl T et al. 2002, Mol Interv 2: 158-167).
[0003] For the recognition of long dsRNA, two detection modes are
known, the serine threonine kinase PKR (Williams B R, 2001, Sci
Signal Transduction Knowledge Environment 89: RE2; Meurs E F et al.
1992, J Virol 66: 5805-5814; Katze M G et al. 1991, Mol Cell Biol
11: 5497-5505) and Toll-like receptor (TLR) 3 (Alexopoulou L et al.
2001, Nature 413: 732-738). Whereas PKR is located in the cytosol,
TLR3 is present in the endosomal compartment (Matsumoto M et al.
2003, J Immunol 171: 3154-3162). TLR3 is a member of the Toll-like
receptor family that has evolved to detect pathogen-specific
molecules (Takeda K et al. 2003, Annu Rev Immunol 21: 335-376).
[0004] A second characteristic feature of viral nucleic acids used
by the immune system to recognize viral infection are CpG motifs
found in viral DNA, which are detected via TLR9 (Lund J et al.
2003, J Exp Med 198: 513-520; Krug A et al. 2004, Blood 103:
1433-1437). CpG motifs are unmethylated CG dinucleotides with
certain flanking bases. The frequency of CpG motifs is suppressed
in vertebrates, allowing the vertebrate immune system to detect
microbial DNA based on such CpG motifs (Krieg A M et al. 1995,
Nature 374: 546-549; Bauer S et al. 2001, Proc Natl Acad Sci USA
98: 9237-9242; Wagner H et al. 2002, Curr Opin Microbiol 5: 62-69).
Like TLR3, TLR9 is located in the endosomal compartment where it
directly binds to CpG motifs (Latz E et al. 2004, Nat Immunol 5:
190-198).
[0005] In addition to long dsRNA and CpG DNA, two recent
publications suggest a third mechanism by which viral nucleic acids
are recognized. These studies demonstrate that single-stranded RNA
(ssRNA) of ssRNA viruses is detected via TLR7 (mouse and human) and
TLR8 (only human) (Diebold S S et al. 2004, Science 303: 1529-1531;
Heil F et al. 2004, Science 303: 1526-1529). Guanine analogues have
been identified earlier as specific ligands for TLR7 and TLR8 (Lee
J et al. 2003, Proc Natl Acad Sci USA 100: 6646-6651; Heil F et al.
2003, Eur J Immunol 33: 2987-2997). Like TLR9 (receptor for CpG
DNA) (Latz E et al. 2004, Nat Immunol 5: 190-198), TLR7 and TLR8
are located in the endosomal membrane (Heil F et al. 2003, Eur J
Immunol 33: 2987-2997).
[0006] Detection of viral nucleic acids leads to the production of
type I IFN (IFN-.alpha. and IFN-.beta.). The major producer of type
I IFN in humans is the plasmacytoid dendritic cell (PDC, also
called interferon producing cell, IPC). The plasmacytoid dendritic
cell (PDC) is a highly specialized subset of dendritic cells that
is thought to function as a sentinel for viral infection and is
responsible for the vast amount of type I IFN during viral
infection (Asselin-Paturel C et al. 2001, Nat Immunol 2:
1144-1150). There is increasing evidence that PDC preferentially
use nucleic acid-based molecular patterns to detect viral
infection. TLR expression of human and mouse PDC is limited to TLR7
and TLR9 (Krug A et al. 2001, Eur J Immunol 31: 3026-3037; Hornung
V et al. 2002, J Immunol 168: 4531-4537; Edwards A D et al. 2003,
Eur J Immunol 33: 827-833).
[0007] IFN-.alpha. was the first type of interferon to be
identified and commercialized; it is widely used clinically in the
treatment of a variety of tumors (e.g., hairy cell leukemia,
cutaneous T cell leukemia, chronic myeloid leukemia, non-Hodgkin's
lymphoma, AIDS-related Kaposi's sarcoma, malignant melanoma,
multiple myeloma, renal cell carcinoma, bladder cell carcinoma,
colon carcinoma, cervical dysplasia) and viral diseases (e.g.,
chronic hepatitis B, chronic hepatitis C). IFN-.alpha. products
that are currently in clinical use include the recombinant protein
and the highly purified natural protein, both of which have high
production costs. Therefore, there is a need for more economical
ways of providing IFN-.alpha. to patients in need. Furthermore,
IFN-.alpha. is currently administrated systematically and causes a
broad spectrum of side effects (e.g. fatigue, flu-like symptoms,
diarrhea). Most alarmingly, IFN-.alpha. causes a decrease in bone
marrow function which leads to increased susceptibility to
life-threatening infections, anemia and bleeding problems.
Therefore, there is a need for ways of providing IFN-.alpha. in a
more localized (i.e., target-specific) matter to reduce the
occurrence of side effects.
[0008] In addition to inducing an anti-viral interferon response,
dsRNA also induces post-transcription gene silencing, a highly
conserved anti-viral mechanism known as RNA interference (RNAi).
Briefly, the RNA III Dicer enzyme processes dsRNA into short
interfering RNA (siRNA) of approximately 22 nucleotides. The
antisense strand of the siRNA binds a target mRNA via base pairing
and serves as a guide sequence to induce cleavage of the target
mRNA by an RNA-induced silencing complex RISC. dsRNA has been an
extremely powerful tool in studying gene functions in C. elegence
and Drosophila via gene silencing. However, its use in mammalian
cells has been limited because the interferon response it elicits
is detrimental to most mammalian cells.
[0009] Subsequently, it was found that siRNA was also capable of
inducing RNAi, causing degradation of the target mRNA in a
sequence-specific manner and it was thought to be short enough to
bypass dsRNA-induced nonspecific effects in mammalian cells
(Elbashri S M et al. 2001, Nature 411:494-498). Since then, siRNA
has been widely used as a gene silencing tool in deciphering
mammalian gene functions in research and drug discovery, and there
has been great interest in its potential in therapeutic
applications.
[0010] siRNA can be used to reduce or even abolish the expression
of disease/disorder-related genes for preventing or treating
diseases caused by the expression or overexpression of the
disease-related genes. Such diseases include, but are not limited
to, infections, metabolic diseases, autoimmune diseases and cancer.
However, concern has been raised recently about the potential for
siRNA to activate immune responses which may be undesirable for
certain indications and thus limit the use of siRNA as a gene
silencing agent for therapeutic purposes (Sioud M et al. 2003,
Biochem. Biophys. Res. Commun. 312:1220-1225). Therefore, there is
a need for methods for predicting the potential of a given siRNA to
induce an interferon response and for methods for designing and
preparing siRNAs for gene silencing which are devoid of unwanted
immunostimulatory activities.
[0011] On the other hand, for certain therapeutic applications, for
example, the prevention or treatment of cancer and viral
infections, immunostimulatory activity may be desirable as an
additional functional activity of the siRNA.
[0012] In an effort to apply siRNA for the specific downregulation
of TLR9 in PDC in our previous publication (Hornung V et al. 2005,
Nat Med 11: 263-270), we made the surprising observation that,
despite the inability of PDC to detect long dsRNA, certain siRNA
sequences were potent in vitro inducers of IFN-.alpha. in PDC. We
found that i) short interfering RNA (siRNA) induces IFN-.alpha. in
human plasmacytoid dendritic cells when transfected with cationic
lipids, ii) this activity of siRNA is sequence-dependent but
independent of the G or U content of the siRNA, iii) the
immunostimuatory activity of siRNA and the antisense activity are
two independent functional activities of siRNA, iv) the immune
recognition of siRNA occurs on the single strand level, v) siRNAs
containing the 9mer sequence motif 5''-GUCCUUCAA-3'' show potent
immunostimulatory activity, and vi) such siRNAs induce systemic
immune responses in mice, and vii) the induction of immune
responses by siRNA requires the presence of TLR7 in mice. Our
findings suggest that the 9mer sequence motif 5''-GUCCUUCAA-3'' may
be a ligand for TLR7.
[0013] The natural ligand for TLR7 has not been well defined to
date. Guanine analogues have been identified earlier as specific
ligands for TLR7 and TLR8 (Lee J et al. 2003, Proc Natl Acad Sci
USA 100: 6646-6651; Heil F et al. 2003, Eur J Immunol 33:
2987-2997), whereas guanosine ribonucleoside or a derivative
thereof has been identified as TLR7 ligand in WO03086280.
[0014] It is an object of the present invention to identify RNA
oligonucleotide motifs for stimulating an immune response, in
particular, IFN-.alpha. induction. It is also an object of the
present invention to identify ligands for activating TLR7 and TLR8.
It is another object of the present invention to develop a method
for determining the immunostimulatory activity, in particular, the
IFN-.alpha.-inducing activity, of a RNA oligonucleotide. It is yet
another object of the present invention to develop a method for
predicting the immunostimulatory activity, in particular,
IFN-.alpha.-inducing activity, of a RNA oligonucleotide. It is a
further object of the invention to develop a method for designing
and preparing RNA oligonucleotide having or lacking
immunostimulatory activity, in particular, IFN-.alpha.-inducing
activity. It is also an object of the invention to provide RNA
oligonucleotides having high immunostimulatory activity which can
be used to induce an immune response, in particular, IFN-.alpha.
production, in patients in need thereof. It is yet another object
of the present invention to provide siRNA molecules that either
have or lack immunostimulatory activity which can be used to treat
disorders caused by the expression or overexpression of
disorder-related genes.
SUMMARY OF THE INVENTION
[0015] The present invention provides a method for determining the
immunostimulatory activity of a RNA oligonucleotide, a method for
predicting the immunostimulatory activity of a RNA oligonucleotide,
a method for preparing a RNA oligonucleotide with high or low
immunostimulatory activity, and a method for preparing a RNA
oligoncleotide with gene silencing activity and with high or low
immunostimulatory activity.
[0016] The present application also provides an in vitro method for
inducing IFN-.alpha. production from a mammalian cell, and an in
vitro method for activating a dendritic cell.
[0017] The present invention further provides a RNA oligonucleotide
with immunostimulatory activity, a RNA oligonucleotide with gene
silencing activity and with high or low immunostimulatory activity,
and the therapeutic uses thereof.
[0018] In addition, the present invention provides a pharmaceutical
composition comprising one or more of the RNA oligonucleotides of
the invention.
BRIEF DESCRIPTION OF THE FIGURES
[0019] FIG. 1: PBMC of three individual donors were isolated and
stimulated with ssRNA oligonucleotides 9.2sense
(5'-AGCUUAACCUGUCCUUCAA-3') and 9.2antisense
(5'-UUGAAGGACAGGUUAAGCU-3') that were complexed with either
Lipofectamine, poly-L-arginine, poly-L-histidine or poly-L-lysine
in duplicates. 24 hours after stimulation supernatants were
harvested and IFN-.alpha. was assessed by ELISA. Data are presented
as mean values.+-.SEM.
[0020] FIG. 2: PBMC of three different healthy donors were isolated
and stimulated with poly-L-arginine complexed ssRNA
oligonucleotides in duplicates. 44 hours after stimulation IFN-a
production was assessed in supernatant via ELISA. For all tested
ssRNA oligonucleotides, the mean values of the measured duplicates
were normalized to the positive control ssRNA oligonucleotide
9.2sense (5'-AGCUUAACCUGUCCUUCAA) by dividing the mean value of
tested oligonucleotide by the mean value of 9.2sense (=100%). Data
from three different donors were summarized and are presented as
mean values.+-.SEM.
[0021] FIG. 3: PBMC of six different healthy donors were isolated
and stimulated with poly-L-arginine complexed ssRNA
oligonucleotides in duplicates. 44 hours after stimulation IFN-a
production was assessed in supernatant via ELISA. For all tested
ssRNA oligonucleotides, the mean values of the measured duplicates
were normalized to the positive control ssRNA oligonucleotide
9.2sense (5'-AGCUUAACCUGUCCUUCAA) by dividing the mean value of
tested oligonucleotide by the mean value of 9.2sense (=IFN-a index
of a given oligonucleotide). Next, all individual IFN-a indices
were adjusted to the mean value of all IFN-a indices by subtracting
the mean value of all IFN-a indices from the individual IFN-a index
of a given oligonucleotide (=adjusted IFN-a index). Data from six
individual donors were summarized and were assorted in ascending
order displaying the corresponding SEM. In addition, a statistical
analysis was performed to assess a putative significant difference
for the adjusted IFN-.alpha. indices of all top thirty ssRNA
oligonucleotides. A two-tailed Student's t-test was employed to
calculate the p-value off all possible ssRNA oligonucleotide
combinations. A p-value>0.01 and <0.05 is depicted by a black
box, whereas a p-value<0.01 is depicted as a grey box.
[0022] FIG. 4: The occurrence of 1mer motifs (5'-X-3'), 2mer motifs
(5'-XX-3',5'-X*X-3',5'-X**X-3') and 3mer motifs
(5'-XXX-3',5'-XX*X-3',5'-X*XX-3') in ssRNA oligonucleotides with an
IFN-a index below the mean IFN-a index (group 1) or above the mean
IFN-.alpha. index (group 2) was analyzed. The relative occurrence
of a given motif within a group of ssRNA oligonucleotides was
calculated by dividing the absolute number of occurrences of a
given motif within a group through the absolute number of
occurrences of all possible motifs within this group. A significant
overrepresentation or underrepresentation of a given motif was
analyzed using a chi-square test. The null hypothesis of equal
distribution within both groups was rejected when the calculated
p-value was below 0.05 (significant differences in distribution are
indicated by "*"). For all motifs analyzed, relative occurrences
are depicted in FIG. 4 for group 1 oligonucleotides (black bars)
and for group 2 oligonucleotides (white bars): 1mer motifs 5'-X-3'
(FIG. 4A); 2mer motifs 5'-XX-3' (FIG. 4B1), 5'-X*X-3' Figure (FIG.
4B2), 5'-X**X-3' (FIG. 4B3) and 3mer motifs 5'-XXX-3' (FIG.
4C1-4C4), 5'-XX*X-3' (FIG. 4C5-4C8), 5'-X*XX-3' (FIG.
4C9-4C12).
[0023] FIG. 5: For all possible 1 mer motifs (5'-X-3'), 2mer motifs
(5'-XX-3',5'-X*X-3',5'-X**X-3') or 3mer motifs
(5'-XXX-3',5'-XX*X-3',5'-X*XX-3') a mean IFN-a index was assigned
by calculating a mean IFN-.alpha. index of all ssRNA
oligonucleotides containing the corresponding motifs (=IFN-a score
of a given motif). The IFN-.alpha. score of all possible motifs is
depicted in FIG. 5.+-.SEM: 1mer motifs 5'-X-3' (FIG. 5A); 2mer
motifs 5'-XX-3' (FIG. 5B1), 5'-X*X-3' Figure (FIG. 5B2), 5'-X**X-3'
(FIG. 5B3) and 3mer motifs 5'-XXX-3' (FIG. 5C1-5C4), 5'-XX*X-3'
(FIG. 5C5-5C8), 5'-X*XX-3' (FIG. 5C9-5C12).
[0024] FIG. 6: A calculated IFN-.alpha. index was assigned to each
oligonucleotide by using the obtained motif-IFN-a scores. For each
set of motifs [1mer motifs (5'-X-3'), 2mer motifs
(5'-XX-3',5'-X*X-3',5'-X**X-3') or 3mer motifs
(5'-XXX-3',5'-XX*X-3',5'-X*XX-3] a predicted IFN-a index was
calculated for each ssRNA oligonucleotide. Next, the obtained
predicted IFN-a indices were compared to the actual adjusted
IFN-.alpha. indices. Data are depicted the following way: For all
ssRNA oligonucleotides the predicted IFN-.alpha. indices are shown
as a black bars, whereas data are sorted in ascending order
according to the actual IFN-.alpha. score that is depicted as a red
index line. The y-axis on the left side depicts the scale for the
predicted IFN-.alpha. score, while the y-axis on the right side
depicts the scale for the actual IFN-.alpha. score.
[0025] FIG. 7: PBMC from healthy donors were isolated and
stimulated with poly-L-arginine complexed ssRNA oligonucleotides in
duplicates. 44 hours after stimulation IFN-a production was
assessed in supernatant via ELISA. For all tested ssRNA
oligonucleotides, the mean values of the measured duplicates were
normalized to the positive control ssRNA oligonucleotide 9.2sense
(5'-AGCUUAACCUGUCCUUCAA) by dividing the mean value of tested
oligonucleotide by the mean value of 9.2sense (=1). A: A panel of
ssRNA oligonucleotides was tested with different positions of the
5'-GUCA-3'-motif within the 19mer ssRNA oligonucleotide (see table
4). The 5'-GUCA-3'-motif is indicated by bold letters. Data from
two independent donors were summarized and are depicted as mean
values.+-.SEM. B/C: 16 ssRNA oligonucleotides, which included all
possible oligonucleotides with permutated bases at the flanking
positions to the 5'- and the 3'-end of the central 5'-GUCA-3'-motif
(table 5), were complexed with poly-L-arginine and used to
stimulate PBMC. 44 hours after stimulation IFN-a production was
assessed in supernatant via ELISA. Data for all 16 oligonucleotides
from three independent donors were summarized as mean values.+-.SEM
(B). In addition all 16 oligonucleotides were assorted into groups
according to the base preceding or following the central
5'-GUCA-3'-motif (C). On the left side oligonucleotides with a
common base preceding the central 5'-GUCA-3'-motif were grouped,
whereas on the right side oligonucleotides with a common base
following the central 5'-GUCA-3'-motif were grouped. Individual
ssRNA oligonucleotide IFN-a data were summarized according to the
respective group and are depicted as mean values.+-.SEM. A
two-tailed Student's t-test was used to calculate a statistically
significant difference between the various groups (p<0.05 is
indicated by a "*").
[0026] FIG. 8: A: PBMC from two healthy donors were isolated and
stimulated with poly-L-arginine complexed ssRNA oligonucleotides
(Table 6) in duplicates. 44 hours after stimulation IFN-.alpha.
production was assessed in supernatant via ELISA. IFN-.alpha. data
were summarized as mean values and subsequently normalized to the
positive control RNA9.2sense (5'-AGCUUAACCUGUCCUUCAA-3'). In
addition, respective sequences were analyzed using the IFN-.alpha.
point score matrix (Table 7) and subsequently normalized to
RNA9.2sense. A correlation coefficient of 0.84 was calculated for
these two sets of data. Measured IFN-.alpha. levels are depicted in
white bars, whereas predicted IFN-.alpha. scores are shown in black
bars (A). Next, IFN-.alpha. point score matrix was employed to
analyze IFN-.alpha.-inducing RNA oligonucleotides that have been
described in the literature. Given the fact that in the study
performed by Judge et al. (2005, Nat Biotechnol 23:457-462)
double-stranded RNA oligonucleotides were tested, a mean value for
the individually analyzed single-stranded components was
calculated. Data were normalized to the most potent RNA
oligonucleotide (=100%) within the respective panel of
oligonucleotides (B). For the prediction of single-stranded RNA
oligonucleotides reported by Heil et al. (2004 Science
303:1526-1529), the predicted IFN-.alpha. point scores are depicted
(C).
[0027] FIG. 9: PBMC from individual healthy donors were isolated
and stimulated with poly-L-arginine complexed
ssRNA-oligonucleotides in duplicates. For a detailed list of all
tested oligonucleotides see Table 1. 44 hours after stimulation
IFN-.alpha. production was assessed in supernatant via ELISA. For
all tested ssRNA-oligonucleotides, the mean values of the measured
duplicates were normalized to the positive control
ssRNA-oligonucleotide 9.2sense (5'-AGCUUAACCUGUCCUUCAA) by dividing
the mean value of tested oligonucleotide by the mean value of
9.2sense (=100%). Data from nine different (A-D) donors or three
different donors (E) were summarized and are presented as mean
values.+-.SEM.
[0028] FIG. 10: PBMC from individual healthy donors were isolated
and stimulated with poly-L-arginine complexed
ssRNA-oligonucleotides in duplicates. For a detailed list of all
tested oligonucleotides see Table 13. 44 hours after stimulation
IFN-.alpha. production was assessed in supernatant via ELISA. For
all tested ssRNA-oligonucleotides, the mean values of the measured
duplicates were normalized to the positive control
ssRNA-oligonucleotide 9.2sense (5'-AGCUUAACCUGUCCUUCAA) by dividing
the mean value of tested oligonucleotide by the mean value of
9.2sense (=100%). Data from two different donors were summarized
and are presented as mean values.+-.SEM.
[0029] FIG. 11: PBMC of six different healthy donors were isolated
and stimulated with poly-L-arginine complexed
ssRNA-oligonucleotides in duplicates. 44 hours after stimulation
IFN-.alpha. production was assessed in supernatant via ELISA. For
all tested ssRNA-oligonucleotides, the mean values of the measured
duplicates were normalized to the positive control
ssRNA-oligonucleotide 9.2sense (5'-AGCUUAACCUGUCCUUCAA) by dividing
the mean value of tested oligonucleotide by the mean value of
9.2sense. Next, for each individual donor a global normalization to
the mean was performed by subtracting the mean of all data from a
particular donor from the individual raw data. Data from six
individual donors were visualized using tree view and are depicted
in ascending order (A). In addition all individual data were
summarized as mean values.+-.SEM and are depicted in ascending
order (B).
[0030] FIG. 12: The occurrence of 3mer motifs in all
ssRNA-oligonucleotides was analyzed. The mean level of IFN-.alpha.
induction was calculated by grouping all oligonucleotides that
contained a respective 3mer motif. For example the 3mer motif
5'-GUC-3' was contained in ssRNA oligonucleotides ANP 35, 83, 131,
137, 138, 139 and 179 with respective IFN-.alpha. induction levels
of 1.33, 0.68, 0.93, 0.79, 0.44, 0.84 and 0.73. The mean
IFN-.alpha. induction level of the 3mer motif 5'-GUC-3' was thus
calculated to be 0.82 with a standard error of mean of 0.10. 3mer
motifs that were gapped by one nucleotide between either the first
and the second nucleotide position (5'-N-NN-3') or the second and
third nucleotide position (5'-NN-N-3') were also included in the
analysis. A two-tailed T-Test was used to identify motifs that were
either significantly higher or lower in IFN-.alpha. induction than
the residual motifs. For all motifs analyzed, the mean IFN-.alpha.
induction level was visualized using tree view. The data were
assorted according to the first nucleotide position of the motif in
four groups. (p-value<0.05 is indicated by *).
[0031] FIG. 13: The top 15 percent of all ssRNA oligonucleotides
and the respective mean IFN-.alpha. induction levels are shown in
ascending order. The presence of the identified potent 3mer motifs
5'GUY-3' (5'-GUC-3',5'-GUU-3'), 5'-GUNY-3' (5'-GUNC-3',5'-GUNU-3')
and 5'-GNUY-3' (5'-GNUC-3',5'-GNUU-3') is indicated by a grey box.
All ssRNA oligonucleotides that contain any of the above motifs are
indicated by a black box.
[0032] FIG. 14: PBMC of four different healthy donors were isolated
and stimulated with the following poly-L-arginine complexed
ssRNA-oligonucleotides: ANP143 (5'-AAAAAAAGUUCAAAAAAAA-3'), RNA40
(5'-GCCCGUCUGUUGUGUGACUC-3'), p-Gal control sense
(5'-UUGAUGUGUUUAGUCGCUA-3') and 9.2sense
(5'-AGCUUAACCUGUCCUUCAA-3'). 44 hours after stimulation IFN-.alpha.
production was assessed in supernatant via ELISA. All tested
ssRNA-oligonucleotides were normalized to the positive control
ssRNA-oligonucleotide 9.2sense by dividing the mean value of tested
oligonucleotide by the mean value of 9.2sense. Significant
differences were analyzed using a two-tailed T-Test.
[0033] FIG. 15: The occurrence of 3mer motifs was analyzed in the
193 oligonucleotide library. For each oligonucleotide the 3mer
motif with the highest calculated mean IFN-.alpha. induction level
was identified and assigned to the respective oligonucleotide. The
predicted data are depicted in ascending order (black bars)
according to the corresponding measured IFN-.alpha. induction
levels (black line). In addition, the correlation coefficient for
the two data sets was determined.
[0034] FIG. 16: The occurrence of 3mer motifs was analyzed in the
193 oligonucleotide library. For each oligonucleotide the 3mer
motif with the highest calculated mean IFN-.alpha. induction level
was identified and assigned to the respective oligonucleotide. The
predicted data are depicted in ascending order. Various threshold
levels (dotted lines) were tested for both for the positive
predictive value and the sensitivity to identify oligonucleotides
below the IFN-.alpha. induction level of 0 (A). For each threshold
level, data were then regrouped according to the predicted
IFN-.alpha. induction level (selected oligonucleotides: left group,
eliminated oligonucleotides: right group). For each group, the mean
level of IFN-.alpha. induction.+-.SEM is depicted in the lower
panel. The positive predictive value and the sensitivity for each
threshold is indicated in the upper left.
[0035] FIG. 17: The prediction algorithm was used to analyze all
possible siRNA duplexes targeting the mRNA of human TLR9
(NM.sub.--017442). For the 3868 bp long mRNA of TLR9 all possible
19mer siRNA duplexes were considered and the IFN-.alpha. prediction
algorithm was applied on both the sense and the antisense strand of
each siRNA duplex. The predicted IFN-.alpha. induction levels are
depicted in stacked columns for the sense (upper columns in black)
and the antisense strand (lower column in grey). The relative
targeting position of the siRNA duplex is given on the y-axis,
whereas the predicted IFN-.alpha. induction is depicted on the
x-axis (A). In addition, six selected regions of the TLR9 mRNA and
the respective predicted IFN-.alpha. induction levels are depicted
in detail in B.
[0036] FIG. 18: HEK 293 cells were transfected with an expression
plasmid coding for human TLR9 with a C-terminal YFP-tag. Various
siRNA-duplices targeting human TLR9 mRNA were cotransfected. The
starting base of the individual siRNA is given in the lower panel.
20 hours after transfection, TLR9 expression was analyzed by flow
cytometry. Data are depicted as percentage of TLR9-expression
referring to an irrelevant control siRNA as 100% and siRNA_sb1647
as 0%. Results are shown as mean values.+-.SEM (n=3) (A). In
addition, above siRNA duplexes and the respective single stranded
components were used to transfect human PBMC from five individual
donors. 40 hours after transfection IFN-.alpha. induction was
measured via ELISA. Data are depicted as mean values.+-.SEM
(B).
[0037] FIG. 19: Based on the algorithm described in example 17, a
computer program was written that applies the algorithm to all
possible siRNA duplexes targeting all human RNA transcripts (50421
as of 09/2006) as published by the National Center for
Biotechnology Information (NCBI). Each entry into the NCBI database
(ftp://ftp.ncbi.nih.gov/refseq/H_sapiens/mRNA_Prot/human.rna.fna.gz)
of all listed human RNA transcripts was analyzed the following way:
A list of all possible 19mer siRNA duplexes targeting a given RNA
transcript was generated. Of all siRNA duplexes the IFN-.alpha.
induction of both the sense and the antisense strand was predicted
using the method described in example 17. The obtained data is
stored in a database (CD-ROM) and can be retrieved by a search
engine. Using the search interface, the user can pick the
transcript of interest (alphabetical index of all RNA transcripts
targeted by siRNAs) and then adjust the level of threshold to
identify siRNA duplexes that are of either low, intermediate or
high in immunostimulatory activity (A). For example, using the
threshold of 0.11 as described in example 17, a set of siRNA
duplexes was identified for Homo sapiens vascular endothelial
growth factor (VEGF) transcript variant 1 mRNA
(NM.sub.--001025366.1) with low immunostimulatory activity for both
the sense and the antisense strand (B).
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0038] As used herein, "a" and "an" refers to a group or species of
entities, rather than one single individual.
oligonucleotide
[0039] As used herein, the term "oligonucleotide" refers to a
polynucleotide formed from a plurality of linked nucleoside units.
Such oligonucleotides can be obtained from existing nucleic acid
sources, including genomic or cDNA, but are preferably produced by
synthetic methods including chemical synthesis, in vitro and in
vivo transcription. In preferred embodiments each nucleoside unit
includes a heterocyclic base and a pentofuranosyl, trehalose,
arabinose, 2'-deoxy-2'-substituted arabinose, 2'-O-substituted
arabinose or hexose sugar group. The nucleoside residues can be
coupled to each other by any of the numerous known internucleoside
linkages. Such internucleoside linkages include, without
limitation, phosphodiester, phosphorothioate, phosphorodithioate,
pyrophosphate, alkylphosphonate, alkylphosphonothioate,
phosphotriester, phosphoramidate, siloxane, carbonate, carboalkoxy,
acetamidate, carbamate, morpholino, borano, thioether, bridged
phosphoramidate, bridged methylene phosphonate, bridged
phosphorothioate, and sulfone internucleoside linkages. The term
"oligonucleotide" also encompasses polynucleosides having one or
more stereospecific internucleoside linkage (e.g., (R.sub.p)- or
(S.sub.p)-phosphorothioate, alkylphosphonate, or phosphotriester
linkages).
[0040] The oligonucleotides of the invention can include naturally
occurring nucleosides, modified nucleosides, or mixtures thereof.
As used herein, the term "modified nucleoside" is a nucleoside that
includes a modified heterocyclic base, a modified sugar moiety, or
a combination thereof. In some embodiments, the modified nucleoside
is a non-natural pyrimidine or purine nucleoside, as herein
described. In some embodiments, the modified nucleoside is a
2'-substituted ribonucleoside an arabinonucleoside or a
2'-deoxy-2'-substituted-arabinoside.
[0041] As used herein, the term "2'-substituted ribonucleoside" or
"2'-substituted arabinoside" includes ribonucleosides or
arabinonucleoside in which the hydroxyl group at the 2' position of
the pentose moiety is substituted to produce a 2'-substituted or
2'-O-substituted ribonucleoside. Preferably, such substitution is
with a lower alkyl group containing 1-6 saturated or unsaturated
carbon atoms, or with an aryl group having 6-10 carbon atoms,
wherein such alkyl, or aryl group may be unsubstituted or may be
substituted, e.g., with halo, hydroxy, trifluoromethyl, cyano,
nitro, acyl, acyloxy, alkoxy, carboxyl, carboalkoxy, or amino
groups. Examples of 2'-O-substituted ribonucleosides or
2'-O-substituted-arabinosides include, without limitation
2'-O-methylribonucleosides or 2'-O-methylarabinosides and
2'-O-methoxyethylribonucleosides or
2'-O-methoxyethylarabinosides.
[0042] The term "2'-substituted ribonucleoside" or "2'-substituted
arabinoside" also includes ribonucleosides or arabinonucleosides in
which the 2'-hydroxyl group is replaced with a lower alkyl group
containing 1-6 saturated or unsaturated carbon atoms, or with an
amino or halo group. Examples of such 2'-substituted
ribonucleosides or 2'-substituted arabinosides include, without
limitation, 2'-amino, 2'-fluoro, 2'-allyl, and 2'-propargyl
ribonucleosides or arabinosides.
[0043] The term "oligonucleotide" includes hybrid and chimeric
oligonucleotides. A "chimeric oligonucleotide" is an
oligonucleotide having more than one type of internucleoside
linkage. One preferred example of such a chimeric oligonucleotide
is a chimeric oligonucleotide comprising a phosphorothioate,
phosphodiester or phosphorodithioate region and non-ionic linkages
such as alkylphosphonate or alkylphosphonothioate linkages (see
e.g., Pederson et al. U.S. Pat. Nos. 5,635,377 and 5,366,878).
[0044] A "hybrid oligonucleotide" is an oligonucleotide having more
than one type of nucleoside. One preferred example of such a hybrid
oligonucleotide comprises a ribonucleotide or 2'-substituted
ribonucleotide region, and a deoxyribonucleotide region (see, e.g.,
Metelev and Agrawal, U.S. Pat. Nos. 5,652,355, 6,346,614 and
6,143,881).
[0045] RNA oligonucleotides discussed herein include otherwise
unmodified RNA as well as RNA which have been modified (e.g., to
improve efficacy), and polymers of nucleoside surrogates.
Unmodified RNA refers to a molecule in which the components of the
nucleic acid, namely sugars, bases, and phosphate moieties, are the
same or essentially the same as that which occur in nature,
preferably as occur naturally in the human body. The art has
referred to rare or unusual, but naturally occurring, RNAs as
modified RNAs, see, e.g., Limbach et al. 1994, Nucleic Acids Res
22: 2183-2196. Such rare or unusual RNAs, often termed modified
RNAs (apparently because these are typically the result of a
post-transcriptional modification) are within the term unmodified
RNA, as used herein. Modified RNA as used herein refers to a
molecule in which one or more of the components of the nucleic
acid, namely sugars, bases, and phosphate moieties, are different
from that which occurs in nature, preferably different from that
which occurs in the human body. While they are referred to as
modified "RNAs," they will of course, because of the modification,
include molecules which are not RNAs. Nucleoside surrogates are
molecules in which the ribophosphate backbone is replaced with a
non-ribophosphate construct that allows the bases to the presented
in the correct spatial relationship such that hybridization is
substantially similar to what is seen with a ribophosphate
backbone, e.g., non-charged mimics of the ribophosphate
backbone.
[0046] All nucleic acid sequences listed herein are in the 5' to 3'
direction unless otherwise indicated.
[0047] The RNA oligonucleotide of the invention can be
single-stranded, double stranded, or partially double-stranded.
[0048] A single-stranded RNA oligonucleotide may contain
self-complementary sequences and forms a hairpin. For example,
5'-GACCUAGCCUAAAACUAGGUC-3'. The self-complementary sequence may be
a palindromic sequence. For example, 5'AAAGAUCCGGAUCAAAA-3'.
[0049] A double stranded RNA oligonucleotide may have one- or
two-nucleotide overhang at the 5' or 3' end of one or both
strands.
[0050] A partially double-stranded RNA oligonucleotide may comprise
two strands of the same or different length, wherein the at least
one of the strands contains nucleotides outside the complementary
sequence. For example,
TABLE-US-00001 Esample 1: 5'-AAAAGUUCAAAGCUCAAAA-3'
3'-CAAGUUUCGAG-5' Example 2:
5'-UCAAAGUCAAAAGCUCAAAGUUGAAAGUUUAAA-3'
3'-GACUUGAAAAUUUCAGUUUUCGAGUUUAAGUUGAAAACUCG-5' Example 3:
5'-UCAAAGUCAAAAGCUCAAAGUUGAAA-3'
3'-UUUCAGUUUUCGAGUUUAAGUUGAAAACUCG-5'
[0051] The length of a single-stranded RNA oligonucleotide is the
number of nucleotides contained in the oligonucleotide.
[0052] In the case of a double-stranded or partially
double-stranded oligonucleotide, the length of the oligonucleotide
is the length of the individual strands. In other words, a
partially double-stranded oligonucleotide can have two lengths.
Enhanced Nuclease Resistance
[0053] For increased nuclease resistance and/or binding affinity to
the target, an oligonucleotide can include, for example,
2'-modified ribose units and/or phosphorothioate linkages and/or
pyrophosphate linkages. For example, the 2' hydroxyl group (OH) can
be modified or replaced with a number of different "oxy" or "deoxy"
substituents.
[0054] Examples of "oxy"-2' hydroxyl group modifications include
alkoxy or aryloxy (OR, e.g., R.dbd.H, alkyl, cycloalkyl, aryl,
aralkyl, heteroaryl or sugar); polyethyleneglycols (PEG),
O(CH.sub.2CH.sub.2O).sub.nCH.sub.2CH.sub.2OR; "locked" nucleic
acids (LNA) in which the 2' hydroxyl is connected, e.g., by a
methylene bridge, to the 4' carbon of the same ribose sugar;
G-AMINE and aminoalkoxy, O(CH.sub.2).sub.nAMINE, (e.g.,
AMINE=NH.sub.2; alkylamino, dialkylamino, heterocyclyl amino,
arylamino, diaryl amino, heteroaryl amino, or diheteroaryl amino,
ethylene diamine, polyamino). It is noteworthy that
oligonucleotides containing only the methoxyethyl group (MOE),
(OCH.sub.2CH.sub.2OCH.sub.3, a PEG derivative), exhibit nuclease
stabilities comparable to those modified with the robust
phosphorothioate modification. "Deoxy" modifications include
hydrogen (i.e. deoxyribose sugars, which are of particular
relevance to the overhang portions of partially ds RNA); halo
(e.g., fluoro); amino (e.g. NH.sub.2; alkylamino, dialkylamino,
heterocyclyl, arylamino, diaryl amino, heteroaryl amino,
diheteroaryl amino, or amino acid);
NH(CH.sub.2CH.sub.2NH).sub.nCH.sub.2CH.sub.2-AMINE (AMINE=NH.sub.2;
alkylamino, dialkylamino, heterocyclyl amino, arylamino, diaryl
amino, heteroaryl amino, or diheteroaryl amino), --NHC(O)R(R=alkyl,
cycloalkyl, aryl, aralkyl, heteroaryl or sugar), cyano; mercapto;
alkyl-thio-alkyl; thioalkoxy; and alkyl, cycloalkyl, aryl, alkenyl
and alkynyl, which may be optionally substituted with e.g., an
amino functionality.
[0055] Preferred substitutents are 2'-methoxyethyl, 2'-OCH3,
2'-O-allyl, 2'-C-- allyl, and 2'-fluoro. To maximize nuclease
resistance, the 2' modifications can be used in combination with
one or more phosphate linker modifications (e.g.,
phosphorothioate). The so-called "chimeric" oligonucleotides are
those that contain two or more different modifications. The
inclusion of furanose sugars in the oligonucleotide backbone can
also decrease endonucleolytic cleavage. An oligonucleotide agent
can be further modified by including a 3' cationic group, or by
inverting the nucleoside at the 3'-terminus with a 3'-3' linkage.
In another alternative, the 3'-terminus can be blocked with an
aminoalkyl group, e.g., a 3' C5-aminoalkyl dT. Other 3' conjugates
can inhibit 3'-5' exonucleolytic cleavage. While not being bound by
theory, a 3' conjugate, such as naproxen or ibuprofen, may inhibit
exonucleolytic cleavage by sterically blocking the exonuclease from
binding to the 3'-end of oligonucleotide. Even small alkyl chains,
aryl groups, or heterocyclic conjugates or modified sugars
(D-ribose, deoxyribose, glucose etc.) can block
3'-5'-exonucleases.
[0056] Similarly, 5' conjugates can inhibit 5'-3' exonucleolytic
cleavage. While not being bound by theory, a 5' conjugate, such as
naproxen or ibuprofen, may inhibit exonucleolytic cleavage by
sterically blocking the exonuclease from binding to the 5'-end of
oligonucleotide. Even small alkyl chains, aryl groups, or
heterocyclic conjugates or modified sugars (D-ribose, deoxyribose,
glucose etc.) can block 3'-5'-exonucleases.
[0057] Single-stranded RNA oligonucleotides which contain
self-complementary sequences and form a hairpin structure have
enhanced nuclease resistance compared to single-stranded
oligonucleotides which do not.
5'-Phosphate Modifications
[0058] The oligonucleotides of the present invention can be 5'
phosphorylated or can include a phosphoryl analog at the 5' prime
terminus. 5'-phosphate modifications of the antisense strand
include those which are compatible with RISC mediated gene
silencing. Suitable modifications include: 5'-monophosphate
((HO)2(O)P--O-5'); 5'-diphosphate ((HO)2(O)P--O--P(HO)(O)--O-5');
5'-triphosphate ((HO)2(O)P--O--(HO)(O)P--O--P(HO)(O)--O-5');
5'-guanosine cap (7-methylated or non-methylated)
(7m-G-O-5'-(HO)(O)P--O--(HO)(O)P--O--P(HO)(O)--O-5'); 5'-adenosine
cap (Appp), and any modified or unmodified nucleotide cap
structure. Other suitable 5'-phosphate modifications will be known
to the skilled person.
Tethered Ligands
[0059] The RNA oligonucleotides of the present invention also
include those with tethered ligands. The properties of a RNA
oligonucleotide, including its pharmacological properties, can be
influenced and tailored by the introduction of ligands, e.g.
tethered ligands.
[0060] The ligands may be coupled, preferably covalently, either
directly or indirectly via an intervening tether, to the RNA
oligonucleotide. In preferred embodiments, the ligand is attached
to the oligonucleotide via an intervening tether.
[0061] In preferred embodiments, a ligand alters the distribution,
targeting or lifetime of a RNA oligonucleotide into which it is
incorporated. In preferred embodiments a ligand provides an
enhanced affinity for a selected target, e.g., molecule, cell or
cell type, a cellular or organ compartment, tissue, organ or region
of the body.
[0062] Preferred ligands can improve transport, hybridization, and
specificity properties and may also improve nuclease resistance of
the resultant natural or modified oligoribonucleotide, or a
polymeric molecule comprising any combination of monomers described
herein and/or natural or modified ribonucleotides.
[0063] A wide variety of ligands may be used. Ligands may include
agents that allow for the specific targeting of the
oligonucleotide; diagnostic compounds or reporter groups which
allow for the monitoring of oligonucletotide distribution;
cross-linking agents; nuclease-resistance conferring moieties; and
natural or unusual nucleobases. General examples include lipophilic
moleculeses, lipids, lectins, steroids (e.g., uvaol, hecigenin,
diosgenin), terpenes (e.g., triterpenes, e.g., sarsasapogenin,
Friedelin, epifriedelanol derivatized lithocholic acid), vitamins,
carbohydrates (e.g., a dextran, pullulan, chitin, chitosan, inulin,
cyclodextrin or hyaluronic acid), proteins, protein binding agents,
integrin targeting molecules, polycationics, peptides, polyamines,
and peptide mimics.
[0064] The ligand may be a naturally occurring or recombinant or
synthetic molecule, such as a synthetic polymer, e.g., a synthetic
polyamino acid. Examples of polyamino acids include polyamino acid
is a polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid,
styrene-maleic acid anhydride copolymer,
poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic
anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer
(HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA),
polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide
polymers, or polyphosphazine. Example of polyamines include:
polyethylenimine, polylysine (PLL), spermine, spermidine,
polyamine, pseudopeptide-polyamine, peptidomimetic polyamine,
dendrimer polyamine, arginine, amidine, protamine, cationic
moieties, e.g., cationic lipid, cationic porphyrin, quaternary salt
of a polyamine, or an alpha helical peptide.
[0065] Ligands can also include targeting groups, e.g., a cell or
tissue targeting agent, e.g., a thyrotropin, melanotropin,
surfactant protein A, Mucin carbohydrate, a glycosylated
polyaminoacid, transferrin, bisphosphonate, polyglutamate,
polyaspartate, or an RGD peptide or RGD peptide mimetic.
[0066] Ligands can be proteins, e.g., glycoproteins, lipoproteins,
e.g. low density lipoprotein (LDL), or albumins, e.g. human serum
albumin (HSA), or peptides, e.g., molecules having a specific
affinity for a co-ligand, or antibodies e.g., an antibody, that
binds to a specified cell type such as a cancer cell, endothelial
cell, or bone cell. Ligands may also include hormones and hormone
receptors. They can also include non-peptidic species, such as
cofactors, multivalent lactose, multivalent galactose,
N-acetyl-galactosamine, N-acetyl-glucosamine, multivalent mannose,
or multivalent fucose. The ligand can be, for example, a
lipopolysaccharide, an activator of p38 MAP kinase, or an activator
of NE-.kappa.B. The ligand can be a substance, e.g., a drug, which
can increase the uptake of the oligonucleotide agent into the cell,
for example, by disrupting the cell's cytoskeleton, e.g., by
disrupting the cell's microtubules, microfilaments, and/or
intermediate filaments. The drug can be, for example, taxon,
vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide,
latrunculin A, phalloidin, swinholide A, indanocine, or
myoservin.
[0067] In one embodiment, the ligand is a lipid or lipid-based
molecule. Such a lipid or lipid-based molecule preferably binds a
serum protein, e.g., human serum albumin (HSA). An HSA binding
ligand allows for distribution of the conjugate to a target tissue,
e.g., liver tissue, including parenchymal cells of the liver. Other
molecules that can bind HSA can also be used as ligands. For
example, neproxin or aspirin can be used. A lipid or lipid-based
ligand can (a) increase resistance to degradation of the conjugate,
(b) increase targeting or transport into a target cell or cell
membrane, and/or (c) can be used to adjust binding to a serum
protein, e.g., HSA.
[0068] A lipid based ligand can be used to modulate, e.g., control
the binding of the conjugate to a target tissue. For example, a
lipid or lipid-based ligand that binds to HSA more strongly will be
less likely to be targeted to the kidney and therefore less likely
to be cleared from the body. A lipid or lipid-based ligand that
binds to HSA less strongly can be used to target the conjugate to
the kidney.
[0069] In another embodiment, the ligand is a moiety, e.g., a
vitamin or nutrient, which is taken up by a target cell, e.g., a
proliferating cell. These are particularly useful for treating
disorders characterized by unwanted cell proliferation, e.g., of
the malignant or non-malignant type, e.g., cancer cells. Exemplary
vitamins include vitamin A, E, and K. Other exemplary vitamins
include the B vitamins, e.g., folic acid, B12, riboflavin, biotin,
pyridoxal or other vitamins or nutrients taken up by cancer
cells.
[0070] In another embodiment, the ligand is a cell-permeation
agent, preferably a helical cell-permeation agent. Preferably, the
agent is amphipathic. An exemplary agent is a peptide such as tat
or antennapedia. If the agent is a peptide, it can be modified,
including a peptidylmimetic, invertomers, non-peptide or
pseudo-peptide linkages, and use of D-amino acids. The helical
agent is preferably an alpha-helical agent, which preferably has a
lipophilic and a lipophobic phase.
[0071] In a preferred embodiment, the ligand is an antibody or a
fragment thereof which is specific for a moiety present in a cell
to be targeted. The moiety may be a protein, a carbohydrate
structure, a polynucleotide, or a combination thereof. The moiety
may be secreted, associated with the plasma membrane (e.g., on the
extracellular or intracellular surface), cytosolic, associated with
intracellular organelles (e.g., ER, Golgi complex, mitochondria,
endosome, lysosome, secretory vesicle) or nuclear. The antibody may
be monoclonal or polyclonal. The antibody may be chemeric or
humanized. The antibody may be a single chain antibody. The
antibody fragment may be a Fab fragment, a F(ab').sub.2 fragment,
or any fragments that retain the antigen-binding specificity of the
intact antibody.
Immunostimulatory Activity
[0072] As used herein, "immunostimulatory activity" refers to the
capability of a molecule or a composition to induce an immune
response. In one aspect, the immunostimulatory activity refers to
the type I-IFN-inducing activity, in particular, the
IFN-.alpha.-inducing activity.
[0073] As used herein, "inducing an immune response" means
initiating or causing an increase in one or more of B-cell
activation, T-cell activation, natural killer cell activation,
activation of antigen presenting cells (e.g., B cells, dendritic
cells, monocytes and macrophages), cytokine production, chemokine
production, specific cell surface marker expression, in particular,
expression of co-stimulatory molecules. In one aspect, such an
immune response involves the production of type I IFN, in
particular, IFN-.alpha., in cells such as PDC.
[0074] As used herein, "IFN-.alpha.-inducing activity" refers to
the capability of a molecule or composition to induce IFN-.alpha.
production from a cell capable of producing IFN-.alpha.. Cells
capable of producing IFN-.alpha. include, but are not limited to,
peripheral blood mononuclear cells (PBMC) (e.g., B cells, dendritic
cells (myeloid dendritic cells and plasmacytoid dendritic cells),
macrophages, monocytes, natural killer cells, granulocytes),
endothelial cells, and cell lines (e.g., THP1; cells transfected
with expression vectors for TLR-7 and/or TLR-8 such as CHO cells,
COS cells, HEK293 cells). Cells capable of producing IFN-.alpha.
include those that express TLR7, TLR8, or both TLR7 and TLR8.
Gene Silencing Activity
[0075] As used herein, "gene silencing" refers to the
downregulation or the abolition of the expression of a target gene.
Gene silencing as used herein, occurs at the post-transcriptional
level. Gene silencing may be directly or indirectly mediated by
siRNA, shRNA and antisense RNA.
[0076] Both the antisense-strand of the siRNA and the antisense RNA
have complementary to the target mRNA and are the effector strand
of the gene silencing activity. The term complementary is well
understood by those skilled in the art. For example, A is
complementary to T, G is complementary to C, 5'-AG-3' is
complementary to 5'-CT-3'.
[0077] The degree of complementarity between two oligonucleotides
is the percentage of complementary bases in the overlapping region
of the two oligonucleotides. The degree of complementarily can be
determined manually or automatically by various engines such as
BLAST. For example, ATCG has 100% complementarity to CGAT and
CGATGG, and 75% complementarity to CGTT and CGTTGG. Furthermore,
the degree of complementarity between a RNA oligonucleotide and any
sequences present in the public databases (e.g., EMBL, GeneBank)
can be determined by the BLAST program.
[0078] The degree of complementarity between the antisense strand
of the siRNA or the antisense RNA and the target mRNA is at least
80% 81%, 82%, 83%, preferably at least 84%, 85%, 86%, 87%, 88%,
more preferably at least 89%, 90%, 91%, 92%, 93%, even more
preferably at least 94%, 95%, 96%, 97%, 98%, 99%, and most
preferably 100%.
[0079] The gene silencing activity of a RNA oligonucleotide can be
determined experimentally by methods well known in the art. For
Example, the RNA oligonucleotide may be introduced into a cell by a
method known in the art such as transfection and transduction; the
mRNA level of the target gene can be determined by routine methods
such as Northern blot analysis, quantitative PCR, RNase protection
assay, and branching DNA; and the protein expression level can be
determined by routine methods such as Western blotting, ELISA, and
biological activity assays specific to the target protein.
Furthermore, the mRNA level of all known and hypothetical genes can
be determined at the global level using the microarray technology.
Technologies in the field of proteonomics allow for the protein
levels of a large number of genes to be determined at the global
level as well.
[0080] Naked RNA oligonceotide may be transfected into a cell via
electroporation. RNA oligonucleotide may be complexed with a
complexation agent which facilitates the uptake of the
oligonucletide into a cell. Such complexation agents include, but
are not limited to cationic lipids (e.g., Lipofectamine,
Oligofectamine, DOTAP), cationic peptides, and calcium
phosphate.
[0081] The gene silencing activity of a RNA oligonucleotide can be
predicted by algorithms such as the one disclosed in Reynolds et
al. 2004, Nat Biotechnol 22:326-330.
siRNA
[0082] As used herein, "siRNA" stands for short interfering RNA,
and has the same definition as that established in the art. siRNA
is double-stranded and is usually between 19 and 27 nucleotide in
length. In vivo, siRNA is the product of Dicer activity on long
dsRNA. The antisense strand of siRNA is complementary to the target
mRNA; it binds the target mRNA and induces RISC-mediated target
mRNA degradation. siRNA can be chemically synthesized, produced in
vitro by Dicer-mediated enzymatic degradation of long dsRNA,
produced by in vitro transcription from linear (e.g. PCR products)
or circular templates (e.g., viral or non-viral vectors), or
produced by in vivo transcription from viral or non-viral vectors.
Commercially available synthetic siRNA usually contain a core of 19
complemetary base pairs and a 2-nucleotide (UU or TT) 3' overhang
on each strand. siRNA may be chemically modified to have enhanced
stability in vitro (especially in serum-containing media) and in
vivo. siRNA may also be chemically modified to have enhanced uptake
by cells in vitro and in vivo. Furthermore, siRNA may be linked to
tethered ligands to have enhanced target specificity and improved
pharmacological properties (such as half-life, clearance,
distribution).
shRNA
[0083] As used herein, "shRNA" stands for short hairpin RNA and has
the same definition as that established in the art. shRNA is
processed inside a cell into siRNA which mediates RNAi as described
previously. The loop sequence in shRNA is not thought to be
involved in RNAi, and it can be of various lengths and sequences.
The preferred lengths and sequences of the loop are known to those
skilled in the art.
[0084] Similar to siRNA, shRNA can be chemically synthesized,
produced by in vitro transcription from linear (e.g. PCR products)
or circular templates (e.g., viral or non-viral vectors), or
produced by in vivo transcription from viral or non-viral
vectors.
Antisense RNA
[0085] As used herein, "antisense RNA" has the same definition as
that established in the art. Antisense RNA is complementary to
target mRNA and it thought to interfere with the translation of the
target mRNA. Antisense RNA molecules are usually 18-50 nucleotides
in length. Antisense RNA may be modified to have enhanced
stability, nuclease resistance, target specificity and improved
pharmacological properties.
[0086] Similar to siRNA and shRNA, antisense RNA can be chemically
synthesized, produced by in vitro transcription from linear (e.g.
PCR products) or circular templates (e.g., viral or non-viral
vectors), or produced by in vivo transcription from viral or
non-viral vectors.
Disorder/Disease-Related Gene and Antigen
[0087] As used herein, "disorder/disease-related gene" refers to a
gene that is expressed or overexpressed in a disease/disorder and
that is not expressed or expressed in reduced amount under normal
condition. For example, a mutant CF gene is expressed in cystic
fibrosis patient but not in an individual without cystic fibrosis;
ErbB2 (or Her2) is overexpressed in breast cancer cells compared to
normal breast cells; a viral gene is expressed in infected cells
but not in uninfected cells. The gene product of the
disorder/disease-related gene is referred to herein as the
"disorder/disease-related antigen".
Mammal
[0088] As used herein, the term "mammal" includes, without
limitation, rats, mice, cats, dogs, horses, sheep, cattle, cows,
pigs, rabbits, non-human primates, and humans.
Technology Platform
[0089] The vertebrate immune system established different ways to
detect invading pathogens based on certain characteristics of their
microbial nucleic acids. Detection of microbial nucleic acids
alerts the immune system leading to the appropriate type of immune
responses that is required for the defence against the respective
type of pathogen detected. Detection of viral nucleic acids leads
to the production of type I IFN, the key cytokine for anti-viral
defence. While it is well established that the recognition of
microbial DNA is sequence-specific, involving the so-called CpG
motifs, the optimal motif for the recognition of microbial RNA has
not been defined yet. The present application provides a technology
platform for identifying the optimal motif for the recognition of
microbial RNA and the induction of type I IFN.
[0090] The technology platform of the present invention comprises
three key features: i) the transfection of peripheral blood
mononuclear cells (PBMC) from healthy donors with RNA
oligonucleotides; ii) the generation of a RNA oligonucleotide
library containing 4mer motifs on a poly adenosine (polyA)
backbone; iii) the development of algorithms based on the
experimental data generated for the RNA oligonucleotide library to
predict the immunostimulatory activity of any given RNA
oligonucleotide.
[0091] The first key feature of the technology platform is the
method of introducing RNA oligonucleotides into PBMC. Naked RNA
oligonucleotides are not taken up by the cells to any significant
degree. RNA oligonucleotides normally need to form complexes with
complexation agent (or transfection agent) in order to be
introduced into cells. In the literature, cationic lipids such as
lipofectamine or DOTAP are routinely used as complexation agent for
the transfection of RNA oligonucleotides. However, RNA-cationic
lipid complexes lead to rapid cell death of myeloid cells. Although
myeloid cells are not the cellular source of IFN-.alpha. within
PBMC (the source is PDC), death of myeloid cells in the cell
culture negatively affects the reproducibility of IFN-.alpha.
induction in PBMC. Therefore, the use of cationic lipids is limited
to isolated PDC. However, isolated PDC are not suitable for large
scale screening assays because PDC make up 0.2-0.6% of the PBMC in
a normal individual; it is difficult to obtain enough cells for the
assays.
[0092] To identify a complexation agent that is suitable for use
with PBMC, we compared different types of cationic peptides,
poly-His, poly-L-Lys, and poly-L-arg. Poly-L-arg was found to
provide the most potent support for the immunostimulatory activity
of RNA oligonucleotides when compared to other cationic peptides
and cationic lipids (FIG. 1). A protocol was then established that
allows well-controlled and highly reproducible complex formation
between the RNA oligonucleotide and the complexation agent and
subsequent RNA transfection into cells. Complex formation could be
controlled by salt concentration, phosphate content and incubation
time. Complex formation was monitored by the size of complexes and
the functional activity over a range of concentrations. The use of
poly-L-arg did not affect the viability of myeloid cells and thus
could be applied to PBMC without restrictions.
[0093] The second key issue of the technology platform was the
generation of the RNA oligonucleotide library. An earlier study
showed that a minimal length of 19 bases was required for the
optimal immunostimulatory activity of an RNA oligonucleotide;
furthermore, it showed that poly adenosine (poly A) was completely
inactive (Hornung V et al. 2005, Nat Med 11:263-270). Therefore,
the motif search was performed with a 19mer oligonucleotide on a
poly A sequence background. By adding increasing numbers of uridine
(U) in the center of such a poly A oligonucleotide, we found that a
4-nucleotide (4-mer) motif in the center was sufficient to confer
marked immunostimulatory activity (FIG. 2). Importantly, after
identifying the optimal 4mer sequence motifs for inducing
IFN-.alpha. production, we found that changing the bases flanking
the 4mer motifs did not further enhance the immunostimulatroy
activity of the 4mer motifs (FIG. 7B). The library of 193 RNA
oligonucleotides used covered all 256 possible 4mer motifs. The
reduction from 258 to 193 was possible because of redundant motifs
caused by the poly A flanking regions. In additional studies we
found that the exact location of the 4mer motif within the poly A
backbone is not critical for the immunostimulatory activity (FIG.
7A).
[0094] The third key feature of the technology platform was the
generation of a data matrix and its mathematical analysis.
Algorithms were developed that allowed an excellent prediction of
the immunostimulatory activity of RNA oligonucleotides. The
frequency of a given 4mer motif at a certain position within an
oligonucleotide is only 1:256. Even though the most active 4mer
motifs can be used as the core for constructing potent
immunostimulatory RNA oligonucleotides, the IFN-.alpha. indices of
the 4mer motifs are not particularly useful for predicting the
activity of a given RNA oligonucleotide, or for designing RNA
oligonucleotides with minimal immunostimulatory activity which is
desired for an siRNA. Therefore, algorithms were established which
based on parts of the 4mer motifs, namely 1, 2 or 3 bases either in
a row (XXX) or with spacing (X*XX; XX*X). The highest predictive
value was obtained with the algorithm using 3 bases (i.e., 3mer
motifs). This 3mer-based algorithm allowed an impressively accurate
prediction (correlation coefficient (r)=0.87) of the
immunostimulatory activity of the 19mer RNA oligonucleoties
carrying 4mer motifs in our library (FIG. 6E) and RNA
oligonucleotides previously published in the literature by us and
others (FIG. 8A-C).
[0095] There are a number of applications for the information
generated by our technology platform: a) the 4mer motif data matrix
can be used to design oligonucleotides with optimal
IFN-.alpha.-inducing activity; b) 4mer motifs with minimal
IFN-.alpha.-inducing activity can be used as the repertoire for
selecting potential inhibitory sequence motifs; c) the 3mer-based
algorithm (e.g., the IFN-.alpha. point score matrix) can be used to
predict the immunostimulatory activity of a given RNA
oligonucleotide; d) the 3mer-based algorithm (e.g., the IFN-.alpha.
point score matrix) can be used to design RNA oligonucleotides with
maximal immunostimulatory activity and additional sequence
requirements for other functionalities such as gene silencing in
the case of an siRNA (in this case the use of 4mer motif matrix is
not useful since 4mer motifs are not frequent enough); e) the
3mer-based algorithm (e.g., the IFN-.alpha. point score matrix) can
also be used to design RNA nucleotides with minimal
immunostimulatory activity and additional sequence requirements for
other functionalities such as gene silencing in the case of an
siRNA (in this case the use of 4mer motif matrix is not useful
since 4mer motifs are not frequent enough).
[0096] In the case of an immunostimulatory RNA, an oligonucleotide
containing only one of the most potent 4mer motifs is 80% more
active than the most active complex oligonucleotide containing a
9mer motif in the literature (Table 1). In a 19mer oligonucleotide,
there is room for several potent 4mer motifs. A 19mer RNA
olignucleotide containing more than one potent immunostimulatory
4mer motifs is expected to have even higher activity.
[0097] Furthermore, inhibitory motifs may exist that inhibit the
immunostimulatory activity of a RNA oligonucleotide as in the case
of CpG oligonucleotides. Such inhibitory motifs, by definition, are
among the motifs with weak IFN-.alpha.-inducing activity. In the
field of RNA interference, type I IFN induction usually is
unwanted. The 3mer-based algorithm (e.g., the IFN-.alpha. point
score matrix) described above can be used to select siRNA sequences
with minimal immunostimulatory activity. A sequence analysis of
cyclophylin B mRNA, one of the best studied targets for siRNA,
identifies a number of siRNA sequences for which our algorithm
(e.g., the IFN-.alpha. point score matrix) predicts minimal type I
IFN induction and which still are known to be potent in gene
silencing (Reynolds A et al. 2004, Nat Biotechnol 22: 326-330).
This confirms our previous finding that RNA interference and
IFN-.alpha. induction are two independent functional activities of
a siRNA molecule.
[0098] Of note, the motif search performed in the present study
focuses on the activity of RNA oligonucleotides to induce
IFN-.alpha.. From previous studies, it is known that the cellular
source of IFN-.alpha. within the PBMC is PDC. By analysing the
level of IFN-.alpha. induction in PBMC, other activities of the RNA
oligonucleotides on other cellular subsets of the PBMC, such as
myeloid cells, are not addressed. Myeloid cells express TLR8 in
addition to TLR7 and thus may show different nucleotide sequence
specificities and may be induced to exhibit additional activities
than IFN-.alpha. production. It therefore needs to be born in mind
that ssRNA oligonucleotides are capable of inducing both
PDC-dependent (i.e. IFN-.alpha. production) and PDC-independent
activities (e.g., activation of myeloid cells). In contrast, we
found that dsRNA oligonucleotides, such as siRNA, are only
recognized by PDC but not myeloid cells. As a result, it is valid
to predict the immunological activity of siRNA oligonculeotides
based on their ability to induce IFN-.alpha. production.
Method for Determining the Immunostimulatory Activity of an RNA
Oligonucleotide
[0099] The present invention provides a method for determining the
immunostimulatory activity, in particular, the IFN-.alpha.-inducing
activity, of a RNA oligonucleotide, comprising the steps of:
[0100] (a) complexing the RNA oligonucleotide with a complexation
agent;
[0101] (b) contacting a cell with the complexed RNA
oligonucleotide, wherein the cell expresses TLR7 or TLR8 or both
TLR7 and TLR8; and
[0102] (c) determining the amount of IFN-.alpha. produced by the
cell of step (b), an increase of IFN-.alpha. production indicating
immunostimulatory activity of the RNA oligonucleotide.
[0103] In one embodiment of the invention, the complexation agent
is a polycationic peptide, preferably poly-L-arginine (poly-L-arg).
In one embodiment, the polycationic peptide, in particular,
poly-L-arg, is at least 24 amino acids in length. The polycationic
peptide, in particular, poly-L Arg, may be a heterogeneous mixture
of peptides of different lengths.
[0104] The cells expressing TLR7 or TLR8 or both TLR7 or TLR8
include, but are not limited to, peripheral blood mononuclear cells
(PBMC), plasmacytoid dendritric cells (PDC), myeloid dendritic
cells (MDC), B cells, macrophages, monocytes, natural killer cells,
granulocytes, endothelial cells, cell lines such as THP1, and cells
containing exogenous DNA which directs the expression of TLR7 or
TLR8 or both TLR7 or TLR8 such as transfected CHO, HEK293, and COS
cells.
[0105] In one embodiment of the invention, the cell is a mammalian
cell, preferably a human cell or a cell of human origin.
[0106] The RNA oligonucleotide can be single-stranded,
double-stranded or partially double-stranded.
Method for Predicting the Immunostimulatory Activity of a RNA
Oligonucleotide
[0107] The present invention provides a method for predicting the
immunostimulatory activity, in particular the IFN-.alpha.-inducing
activity, of a RNA oligonucleotide, comprising the steps of: [0108]
(a) identifying all possible 3-nucleotide (3mer) motifs contained
in the oligonucleotide; [0109] (b) assigning an IFN-.alpha. point
score for each individual 3mer motif; [0110] (c) assigning the sum
of the IFN-.alpha. point scores of individual 3mer motifs as the
IFN-.alpha. score of the oligonucleotide; and [0111] (d) assigning
to the oligonucleotide a high immunostimulatory activity if the
IFN-.alpha. score is at least 23, an intermediate immunostimulatory
activity if the IFN-.alpha. score is between -4 and 23, and a low
immunostimulatory activity if the IFN-.alpha. score is at most -4,
when n=6; [0112] assigning to the oligonucleotide a high
immunostimulatory activity if the IFN-.alpha. score is at least 26,
an intermediate immunostimulatory activity if the IFN-.alpha. score
is between -4 and 26, and a low immunostimulatory activity if the
IFN-.alpha. score is at most -4, when n=7; [0113] assigning to the
oligonucleotide a high immunostimulatory activity if the
IFN-.alpha. score is at least 28, an intermediate immunostimulatory
activity if the IFN-.alpha. score is between -5 and 23, and a low
immunostimulatory activity if the IFN-.alpha. score is at most -5,
when n=8; [0114] assigning to the oligonucleotide a high
immunostimulatory activity if the IFN-.alpha. score is at least 30,
an intermediate immunostimulatory activity if the IFN-.alpha. score
is between -5 and 30, and a low immunostimulatory activity if the
IFN-.alpha. score is at most -9, when n=9; [0115] assigning to the
oligonucleotide a high immunostimulatory activity if the
IFN-.alpha. score is at least 1.4909.times.n+22.014, an
intermediate immunostimulatory activity if the IFN-.alpha. score is
between 0.005.times.n.sup.2-0.2671.times.n-3.5531 and
1.4909.times.n+22.014, and a low immunostimulatory activity if the
IFN-.alpha. score is at most
0.005.times.n.sup.2-0.2671.times.n-3.5531, when n is greater than
9, [0116] wherein n is the length of the oligonucleotide.
[0117] The present invention also provides a method for assigning
the IFN-.alpha. score of a RNA oligonucleotide comprising steps
(a)-(c) described above.
[0118] A single-stranded RNA oligonucleotide of the length n
(n.gtoreq.6) is broken up into all possible 3mer motifs starting a
the 5' end. This will result in a total number of n-2 possible 3mer
motifs. For example the 20mer ssRNA oligonucleotide
5'-CAGAGCGGGAUGCGUUGGUC-3' can be broken up into the following 18
3mer motifs (5'-->3'): CAG, AGA, GAG, AGC, GCG, CGG, GGG, GGA,
GAU, AUG, UGC, GCG, CGU, GUU, UUG, UGG, GGU, GUC.
[0119] Subsequently, all of the 3mer motifs are checked against the
IFN-.alpha. point score matrix (Table 7).
TABLE-US-00002 TABLE 7 IFN-.alpha. point score matrix 3mer motif
IFN-.alpha. point (5'.fwdarw.3') score ACA -2 ACC -2 AGA -2 AAC -1
AUA -1 UGG +1 GUA +3 GUG +3 GGU +4 UCA +4 UUC +4 UUU +5 AGU +6 UUG
+6 GUC +8 UGU +8 GUU +9
[0120] Whenever a 3mer motif is present in the IFN-.alpha. point
score matrix, the listed point score is added to the so-called
predicted IFN-.alpha. score of the oligonucleotide analyzed. A 3mer
motif which is absent from the IFN-.alpha. point score matrix has a
point score of 0. Thus the predicted IFN-.alpha. score of an
oligonucleotide is the sum of IFN-.alpha. scores of all 3mer motifs
that are present in the IFN-.alpha. point score matrix.
[0121] For example, for the 20mer ssRNA oligonucleotide
5'-CAGAGCGGGAUGCGUUGGUC-3', a predicted IFN-.alpha. score can be
calculated as follows:
TABLE-US-00003 3mer motifs in the Score in the IFN-.alpha.
predicted 20mer ssRNA point score matrix IFN-.alpha. score CAG 0 0
AGA (-2) -2 GAG 0 0 AGC 0 0 GCG 0 0 CGG 0 0 GGG 0 0 GGA 0 0 GAU 0 0
AUG 0 0 UGC 0 0 GCG 0 0 CGU 0 0 GUU (+9) +9 UUG (+6) +6 UGG (+1) +1
GGU (+4) +4 GUC (+8) +8 Overall +26
[0122] This method is herein referred to as the "addition
method".
[0123] The present application further provides an alternative
method for predicting the immunostimulatory activity, in particular
the IFN-.alpha.-inducing activity, of a RNA oligonucleotide,
comprising the steps of: [0124] (a) identifying all possible
3-nucleotide (3mer) motifs contained in the oligonucleotide; [0125]
(b) assigning an IFN-.alpha. point score for each individual 3mer
motif according to Table 12A; [0126] (c) assigning the highest
individual IFN-.alpha. point score as the IFN-.alpha. score of the
oligonucleotide; and [0127] (d) assigning to the oligonucleotide a
high immunostimulatory activity if the IFN-.alpha. score is at
least 0.58, an intermediate immunostimulatory activity if the
IFN-.alpha. score is between 0.11 and 0.58, and a low
immunostimulatory activity if the IFN-.alpha. score is at most
0.11.
[0128] The present invention also provides a method for assigning
the IFN-.alpha. score of a RNA oligonucleotide comprising steps
(a)-(c) described above.
[0129] This method is herein referred to as the "simplified
method".
[0130] The IFN-.alpha. score of a double-stranded RNA
oligonucleotide is the higher of the two IFN-.alpha. scores for the
two strands.
[0131] In the case of a double-stranded or partially
double-stranded RNA oligonucleotide, the oligonucleotide is
assigned high immunostimulatory activity if at least one of the
strands meets the threshold for having high immunostimulatory
activity as defined above; the oligonucleotide is assigned low
immunostimulatory activity if both strands meet the threshold for
having low immunostimulatory activity as defined above. The rest
RNA oligonucleotides are assigned intermediate immunostimulatory
activity.
Method for Designing and Preparing RNA Oligonucleotides
[0132] The present application provides a method for preparing a
RNA oligonucleotide having immunostimulatory activity, in
particular, high IFN-.alpha.-inducing activity, comprising the
steps of: [0133] (a) providing candidate oligonucleotide
sequence(s); [0134] (b) identifying oligonucleotide sequence(s)
with high immunostimulatory activity predicted according to the
method of prediction described in the previous section; [0135] (c)
preparing the RNA oligonucleotide(s) identified for high
immunostimulatory activity in step (b); and [0136] (d) optionally
testing the immunostimulatory activity of the RNA
oligonucleotide(s) prepared in step (c) according to the method of
determination described previously; and [0137] (e) further
optionally modifying the oligonucleotide(s) to optimize the
immunostimulatory activity.
[0138] The present application also provides a method for preparing
a RNA oligonucleotide having low immunostimulatory activity, in
particular, low IFN-.alpha.-inducing activity, comprising the steps
of: [0139] (a) providing candidate oligonucleotide sequence(s);
[0140] (b) identifying oligonucleotide sequence(s) with low
immunostimulatory activity predicted according to the method of
prediction described in the previous section; [0141] (c) preparing
the RNA oligonucleotide(s) identified for low immunostimulatory
activity in step (b); and [0142] (d) optionally testing the RNA
oligonucleotide(s) prepared in step (c) for the lack of
immunostimulatory activity according to the method of determination
described previously; and [0143] (e) further optionally modifying
the oligonucleotide(s) to minimize the immunostimulatory
activity.
[0144] The present invention further provides a method for
preparing a RNA oligonucleotide having high immunostimulatory
activity, in particular, high IFN-.alpha.-inducing activity,
comprising the steps of: [0145] (a) providing an oligonucleotide
sequence which comprises at least one, preferably at least two,
more preferably at least three, even more preferably at least four,
of the 4-nucleotide (4-mer) motifs selected from the group
consisting of:
TABLE-US-00004 [0145] GUUC, (No. 1) GUCA, (No. 2) GCUC, (No. 3)
GUUG, (No. 4) GUUU, (No. 5) GGUU, (No. 6) GUGU, (No. 7) GGUC, (No.
8) GUCU, (No. 9) GUCC, (No. 10) GCUU, (No. 11) UUGU, (No. 12) UGUC,
(No. 13) CUGU, (No. 14) CGUC, (No. 15) UGUU, (No. 16) GUUA, (No.
17) UGUA, (No. 18) UUUC, (No. 19) UGUG, (No. 20) GGUA, (No. 21)
GUCG, (No. 22) UUUG, (No. 23) UGGU, (No. 24) GUGG, (No. 25) GUGC,
(No. 26) GUAC, (No. 27) GUAU, (No. 28) UAGU, (No. 29) GUAG, (No.
30) UUCA, (No. 31) UUGG, (No. 32) UCUC, (No. 33) CAGU, (No. 34)
UUCG, (No. 35) CUUC, (No. 36) GAGU, (No. 37) GGUG, (No. 38) UUGC,
(No. 39) UUUU, (No. 40) CUCA, (No. 41) UCGU, (No. 42) UUCU, (No.
43) UGGC, (No. 44) CGUU, (No. 45) CUUG, (No. 46) UUAC, (No. 47)
[0146] wherein the nucleotide sequences of the motifs are
5'.fwdarw.3', [0147] wherein the oligonucleotide is between 6 and
64, preferably between 12 and 50, more preferably between 14 and
40, even more preferably between 16 and 36, and most preferably
between 18 and 25 nucleotides in length, [0148] wherein at least
one strand of the RNA oligonucleotide has an IFN-.alpha. score of
at least 23 when n=6; at least 26 when n=7; at least 28 when n=8;
at least 30 when n=9; at least 1.4909.times.n+22.014 when n is
greater than 9, wherein the IFN-.alpha. score is assigned according
to the "addition method" as described above, and wherein n is the
length of the oligonucleotide, [0149] or wherein at least one
strand of the RNA oligonucleotide has an IFN-.alpha. score of at
least 0.58, wherein the IFN-.alpha. score is assigned according to
the "simplified method" as described above, [0150] (b) preparing
the RNA oligonucleotide of step (a); and [0151] (c) optionally
testing the immunostimulatory activity of the RNA oligonucleotide
prepared in step (b) according to the method of determining the
immunostimulatory activity as described above; and [0152] (d)
further optionally modifying the oligonucleotide to optimize the
immunostimulatory activity.
[0153] The RNA oligonucleotide can be single-stranded,
double-stranded or partially double-stranded.
[0154] The RNA oligonucleotide can have other functionalities such
as the gene silencing activity.
[0155] The methods provided by the present application can be used
to prepare immunostimulatory RNA oligonucleotides, siRNA, shRNA or
antisense RNA with high or low immunostimulatory activity.
[0156] Some of the RNA oligonucleotides which have low
immunostimulatory activity, i.e., the non-immunostimulatory
oligonucleotides, may in fact have inhibitory activity against
immune activation. Such an immunoinhibitory oligonucleotide may be
able to prevent immune activation induced by an immunostimulatory
oligonucleotide when used in combination.
[0157] RNA oligonucleotides can be prepared by methods including,
but are not limited to, chemical synthesis, in vitro and in vivo
transcription from linear templates (e.g., PCR product) and
circular templates (e.g., viral or non-viral vectors).
Method for Preparing siRNA Having High or Low Immunostimulatory
Activity
[0158] The present invention provides a method for preparing an
siRNA having gene silencing activity for a target gene and having
immunostimulatory activity, in particular, IFN-.alpha.-inducing
activity, comprising the steps of: [0159] (a) identifying all
potential siRNA antisense sequences for a target mRNA; [0160] (b)
identifying antisense sequences that have gene silencing activity;
[0161] (c) predicting the immunostimulatory activity for the
antisense sequences identified in step (b) and their complementary
(i.e., sense) sequences; [0162] (d) identifying siRNA wherein at
least one of the sense and antisense sequences has an IFN-.alpha.
score of at least 1.4909.times.n+31,014, wherein the IFN-.alpha.
score is assigned according to the "addition method" described
above, wherein n is the length of the sequence and n is between 19
and 25; [0163] (e) decreasing the IFN-.alpha. score threshold by 1
if no siRNA is identified in step (d), until at least one siRNA is
identified; [0164] (f) preparing the siRNA identified in step (d)
or (e); [0165] (g) optionally testing the gene silencing and/or the
immunostimulatory activity of the siRNA prepared in (f); [0166] (h)
further optionally modify the siRNA prepared in (f) to optimize the
gene silencing and/or immunostimulatory activity.
[0167] The present invention also provides an alternative method
for preparing siRNA with gene silencing activity and
immunostimulatory activity, comprising the steps of: [0168] (a)
identifying all potential siRNA antisense sequences for a target
mRNA; [0169] (b) predicting the immunostimulatory activity for all
of the antisense sequences identified in (a) and their
complementary (i.e., sense) sequences; [0170] (c) identifying 10
siRNA with the highest IFN-.alpha. scores, wherein the IFN-.alpha.
score is assigned according to the "addition method" described
above, wherein the IFN-.alpha. score of the siRNA is the higher of
the two scores for the sense and the antisense strand; [0171] (d)
identifying siRNA with gene silencing activity among the 10 siRNA
identified in step (c); [0172] (e) identifying 10 siRNA with the
next highest IFN-.alpha. scores if no siRNA can be identified in
step (d); repeat steps (d) and (e) until at least one siRNA is
identified; [0173] (f) preparing the siRNA identified in step (d)
or (e); [0174] (g) optionally testing the gene silencing and/or the
immunostimulatory activity of the siRNA prepared in (f); [0175] (h)
further optionally modify the siRNA prepared in (f) to optimize the
gene silencing and/or immunostimulatory activity.
[0176] The present invention further provides a method for
preparing an siRNA having gene silencing activity for a target gene
and having low (or minimal) immunostimulatory activity, in
particular, IFN-.alpha.-inducing activity, comprising the steps of:
[0177] (a) identifying all potential siRNA antisense sequences for
a target mRNA; [0178] (b) identifying antisense sequences that have
gene silencing activity; [0179] (c) predicting the
immunostimulatory activity for the antisense sequences identified
in step (b) and their complementary (i.e., sense) sequences; [0180]
(d) identifying siRNA wherein both the sense and the antisense
sequences have an IFN-.alpha. score of at most
0.6075.times.n-9.9484, wherein the IFN-.alpha. score is assigned
according to the "addition method" described above, wherein n is
the length of the sequence and n is between 19 and 25; [0181] (e)
increasing the IFN-.alpha. score threshold by 1 if no siRNA is
identified in step (b), until at least one siRNA is identified;
[0182] (f) preparing the siRNA identified in step (d) or (e);
[0183] (g) optionally testing the gene silencing and/or the
immunostimulatory activity of the siRNA prepared in (f); [0184] (h)
further optionally modify the siRNA prepared in (f) to optimize the
gene silencing activity and/or to minimize the immunostimulatory
activity.
[0185] The present invention also provide an alternative method for
preparing siRNA with gene silencing activity and low (or minimal)
immunostimulatory activity, comprising the steps of: [0186] (a)
identifying all potential siRNA antisense sequences for a target
mRNA; [0187] (b) predicting the immunostimulatory activity for all
of the antisense sequences identified in (a) and their
complementary (i.e., sense) sequences; [0188] (c) identifying 10
siRNA with the lowest IFN-.alpha. scores, wherein the IFN-.alpha.
score is assigned according to the "addition method" described
above, wherein the IFN-.alpha. score of the siRNA is the higher of
the two scores for the sense and the antisense strand; [0189] (d)
identifying siRNA with gene silencing activity among the 10 siRNA
identified in step (c); [0190] (e) identifying 10 siRNA with the
next lowest IFN-.alpha. scores if no siRNA can be identified in
step (d); repeat steps (d) and (e) until at least one siRNA is
identified; [0191] (f) preparing the siRNA identified in step (d)
or (e); [0192] (g) optionally testing the gene silencing and/or the
immunostimulatory activity of the siRNA prepared in (f); [0193] (h)
further optionally modify the siRNA prepared in (f) to optimize the
gene silencing activity and/or to minimize the immunostimulatory
activity.
[0194] Candidate siRNA with gene silencing activity for a given
gene can be identified using methods known to those skilled in the
art, including, but not limited to, commercial engines such as
those available from Dharmacon, Qiagen, Invitrogen. Furthermore,
the gene silencing activity of an siRNA may be predicted using the
algorithm of Reynolds et al. (2004, Nat Biotechnol 22:326-330) and
may be determined experimentally.
[0195] The gene silencing activity of an siRNA can be determined
experimentally by methods well known in the art. For Example, the
RNA oligonucleotide may be introduced into a cell by a method known
in the art such as transfection and transduction; the mRNA level of
the target gene can be determined by routine methods such as
Northern blot analysis, quantitative PCR, RNase protection assay,
and branching DNA; and the protein expression level can be
determined by routine methods such as Western blotting, ELISA, and
biological activity assays specific to the target protein.
Furthermore, the mRNA level of all known and hypothetical genes can
be determined at the global level using the microarray technology.
Technologies in the field of proteonomics allow for the protein
levels of a large number of genes to be determined at the global
level as well.
[0196] The same methods may be used for preparing an shRNA which
comprises the sense and the antisense sequences of an siRNA
identified by the above methods and a loop sequence. The preferred
loop sequences for shRNA are known to those skilled in the art.
[0197] The same methods may also be used for preparing antisense
RNA wherein only one strand, the antisense strand, needs to be
identified and prepared.
[0198] The siRNA, shRNA and antisense RNA can be prepared by
methods including, but are not limited to, chemical synthesis, in
vitro and in vivo transcription from PCR products and viral or
non-viral vectors.
Immunostimulatory RNA Oligonucleotides
[0199] The present invention provides an immunostimulatory RNA
oligonucleotide having immunostimulatory activity, in particular,
IFN-.alpha.-inducing activity, comprising at least one, preferably
at least two, more preferably at least three, even more preferably
at least four, even more preferably at least five, and most
preferably at least six, of the motifs selected from the group
consisting of GUY, GUNY, and GNUY, wherein Y is a pyrimidine
(either a U or a C), wherein N is any one of nucleotides A, C, G,
and U, and wherein the nucleotide sequences of the motifs are
5'.fwdarw.3'.
[0200] In one embodiment, the immunostimulatory RNA oligonucleotide
is between 6 and 64, preferably between 12 and 50, more preferably
between 14 and 40, even more preferably between 16 and 36, and most
preferably between 18 and 25 nucleotides in length.
[0201] In a further embodiment, at least one strand of the
immunostimulatory RNA oligonucleotide has an IFN-.alpha. score of
at least 23 when n=6; at least 26 when n=7; at least 28 when n=8;
at least 30 when n=9; at least 1.4909.times.n+22.014 when n is
greater than 9, wherein the IFN-.alpha. score is assigned according
to the "addition method" described above, wherein n is the length
of the oligonucleotide, provided that the oligonucleotide of the
present invention is not 5'-UUGAUGUGUUUAGUCGCUA-3' (Judge et al.
2005, Nat Biotechnol 23:457-462), 5'-GCACCACUAGUUGGUUGUC-3' (Sioud
2005, J Mol Biol 348:1079-1090), 5'-GUUGUAGUUGUACUCCAGC-3' (Sioud),
5'-GCCCGUCUGUUGUGUGACUC-3' (Heil et al. 2004 Science
303:1526-1529), 5'-GUCUGUUGUGUG-3' (Heil, et al.),
5'-GUUGUGGUUGUGGUUGUG-3' (WO 03/086280).
[0202] In an alternative embodiment, at least one strand of the
immunostimulatory RNA oligonucleotide has an IFN-.alpha. score of
at least 0.58, wherein the IFN-.alpha. score is assigned according
to the "simplified method" described above, provided that the
oligonucleotide of the present invention is not
5'-UUGAUGUGUUUAGUCGCUA-3' (Judge et al. 2005, Nat Biotechnol
23:457-462), 5'-GCACCACUAGUUGGUUGUC-3' (Sioud 2005, J Mol Biol
348:1079-1090), 5'-GUUGUAGUUGUACUCCAGC-3' (Sioud),
5'-GCCCGUCUGUUGUGUGACUC-3' (Heil et al. 2004 Science
303:1526-1529), 5'-GUCUGUUGUGUG-3' (Heil, et al.),
5'-GUUGUGGUUGUGGUUGUG-3' (WO 03/086280).
[0203] The present invention further provides an immunostimulatory
RNA oligonucleotide having immunostimulatory activity, in
particular, IFN-.alpha.-inducing activity, comprising at least one,
preferably at least two, more preferably at least three, even more
preferably at least four, even more preferably at least five, and
most preferably at least six, of the 4-nucleotide (4-mer) motifs
selected from the group consisting of:
TABLE-US-00005 GUUC, (No. 1) GUCA, (No. 2) GCUC, (No. 3) GUUG, (No.
4) GUUU, (No. 5) GGUU, (No. 6) GUGU, (No. 7) GGUC, (No. 8) GUCU,
(No. 9) GUCC, (No. 10) GCUU, (No. 11) UUGU, (No. 12) UGUC, (No. 13)
CUGU, (No. 14) CGUC, (No. 15) UGUU, (No. 16) GUUA, (No. 17) UGUA,
(No. 18) UUUC, (No. 19) UGUG, (No. 20) GGUA, (No. 21) GUCG, (No.
22) UUUG, (No. 23) UGGU, (No. 24) GUGG, (No. 25) GUGC, (No. 26)
GUAC, (No. 27) GUAU, (No. 28) UAGU, (No. 29) GUAG, (No. 30) UUCA,
(No. 31) UUGG, (No. 32) UCUC, (No. 33) CAGU, (No. 34) UUCG, (No.
35) CUUC, (No. 36) GAGU, (No. 37) GGUG, (No. 38) UUGC, (No. 39)
UUUU, (No. 40) CUCA, (No. 41) UCGU, (No. 42) UUCU, (No. 43) UGGC,
(No. 44) CGUU, (No. 45) CUUG, (No. 46) UUAC, (No. 47)
wherein the nucleotide sequences of the motifs are 5'.fwdarw.3',
wherein the oligonucleotide is between 6 and 64, preferably between
12 and 50, more preferably between 14 and 40, even more preferably
between 16 and 36, and most preferably between 18 and 25
nucleotides in length, wherein at least one strand of the RNA
oligonucleotide has an IFN-.alpha. score of at least 23 when n=6;
at least 26 when n=7; at least 28 when n=8; at least 30 when n=9;
at least 1.4909.times.n+22.014 when n is greater than 9, wherein
the IFN-.alpha. score is assigned according to the "addition
method" described above, or wherein at least one strand of the RNA
oligonucleotide has an IFN-.alpha. score of at least 0.58, wherein
the IFN-.alpha. score is assigned according to the "simplified
method" described above, wherein n is the length of the
oligonucleotide, and wherein the oligonucleotide is not
5'-UUGAUGUGUUUAGUCGCUA-3' (Judge et al. 2005, Nat Biotechnol
23:457-462), 5'-GCACCACUAGUUGGUUGUC-3' (Sioud 2005, J Mol Biol
348:1079-1090), 5'-GUUGUAGUUGUACUCCAGC-3' (Sioud),
5'-GCCCGUCUGUUGUGUGACUC-3' (Heil et al. 2004 Science
303:1526-1529), 5'-GUCUGUUGUGUG-3' (Heil, et al.),
5'-GUUGUGGUUGUGGUUGUG-3' (WO 03/086280).
[0204] In one embodiment, the 4mer motifs are selected from the
group consisting of No. 1-19, No. 1-18, No. 1-17, No. 1-16,
preferably, No. 1-15, No. 1-14, No. 1-13, No. 1-12, more
preferably, No. 1-11, No. 1-10, No. 1-9, No. 1-8, No. 1-7, even
more preferably, No. 1-6, No. 1-5, No. 1-4, No. 1-3, most
preferably, No. 1-2 of the 4mer motifs.
[0205] The immunostimulatory RNA oligonucleotide of the invention
may comprise one or more copies of the same 4mer motif, or one or
more copies of different 4mer motifs.
[0206] The present invention also provide an immunostimulatory RNA
oligonucleotide having immunostimulatory, in particular,
IFN-.alpha.-inducing activity, comprising at least one, preferably
at least two, more preferably at least three, even more preferably
at least four, even more preferably at least five, most preferably
at least six, of the 4mer motifs selected from the group consisting
of No. 1-6, preferably No. 1-5, No. 1-4, No. 1-3, more preferably
No. 1-2 of the 4mer motifs, wherein the spacer nucleotides which
are not part of any of the 4mer motif(s) are identical, and wherein
the spacer nucleotide is selected from the group consisting of A,
T, C, G and variants and derivatives thereof.
[0207] In one embodiment, the spacer nucleotide is A or a
derivative thereof.
[0208] In one embodiment, the immunostimulatory RNA oligonucleotide
of the invention can comprise one or more copies of one type of
4mer motif (e.g., GUUC) on a poly A backbone. Examples of such an
oligonucleotide includes, but are not limited to:
TABLE-US-00006 AAAAAAAGUUCAAAAAAAA AAAGUUCAAAAAAAAAAAA
AAAAAAAAAAAAGUUCAAA AAAGUUCAAAAAGUUCAAA GUUCAAAGUUCAAAGUUCA
[0209] In another embodiment, the immunostimulatory RNA
oligonucleotide of the invention can comprise one or more copies of
more than one type of 4mer motif (e.g., GUUC GUCA, GCUC, GUUG,
GUUU, GGUU) on a poly A backbone. Examples of such an
oligonucleotide includes, but are not limited to:
TABLE-US-00007 AGUUCAAAGUCAAAAGCUC AGUUCAGUUCAAGUCAAAGCUC
AAAGUUCAAAGUCAAAAGCUCAAAGUUGAAAGUUUAAAGGUUAAA
[0210] The more than one 4mer motifs in an immunostimulatory RNA
oligonucleotide may overlap. For example, AAAAGUUGCUCAAAAAA.
[0211] Examples of immunostimulatory RNA oligonucleotides of the
invention include, but are not limited to:
TABLE-US-00008 aaaguucaaaaaaguucaaa (SEQ ID NO: 391)
aaagucaaaaaaaguucaaa (SEQ ID NO: 392) aaagcucaaaaaaguucaaa (SEQ ID
NO: 393) aaaguugaaaaaaguucaaa (SEQ ID NO: 394) aaaguuuaaaaaaguucaaa
(SEQ ID NO: 395) aaagguuaaaaaaguucaaa (SEQ ID NO: 396)
aaaguguaaaaaaguucaaa (SEQ ID NO: 397) aaaggucaaaaaaguucaaa (SEQ ID
NO: 398) aaagucuaaaaaaguucaaa (SEQ 1D NO: 399) aaaguccaaaaaaguucaaa
(SEQ ID NO: 400) aaaguucaaaaaagucaaaa (SEQ ID NO: 401)
aaagucaaaaaaagucaaaa (SEQ ID NO: 402) aaagcucaaaaaagucaaaa (SEQ ID
NO: 403) aaaguugaaaaaagucaaaa (SEQ ID NO: 404) aaaguuuaaaaaagucaaaa
(SEQ ID NO: 405) aaagguuaaaaaagucaaaa (SEQ ID NO: 406)
aaaguguaaaaaagucaaaa (SEQ ID NO: 407) aaaggucaaaaaagucaaaa (SEQ ID
NO: 408) aaagucuaaaaaagucaaaa (SEQ ID NO: 409) aaaguccaaaaaagucaaaa
(SEQ ID NO: 410) aaaguucaaaaaagcucaaa (SEQ ID NO: 411)
aaagucaaaaaaagcucaaa (SEQ ID NO: 412) aaagcucaaaaaagcucaaa (SEQ ID
NO. 413) aaaguugaaaaaagcucaaa (SEQ ID NO: 414) aaaguuuaaaaaagcucaaa
(SEQ ID NO: 415) aaagguuaaaaaagcucaaa (SEQ ID NO: 416)
aaaguguaaaaaagcucaaa (SEQ ID NO: 417) aaaggucaaaaaagcucaaa (SEQ ID
NO: 418) aaagucuaaaaaagcucaaa (SEQ ID NO: 419) aaaguccaaaaaagcucaaa
(SEQ ID NO: 420) aaaguucaaaaaaguugaaa (SEQ ID NO: 421)
aaagucaaaaaaaguugaaa (SEQ ID NO: 422) aaagcucaaaaaaguugaaa (SEQ ID
NO: 423) aaaguugaaaaaaguugaaa (SEQ ID NO: 424) aaaguuuaaaaaaguugaaa
(SEQ ID NO: 425) aaagguuaaaaaaguugaaa (SEQ ID NO: 426)
aaaguguaaaaaaguugaaa (SEQ ID NO: 427) aaaggucaaaaaaguugaaa (SEQ ID
NO: 428) aaagucuaaaaaaguugaaa (SEQ ID NO: 429) aaaguccaaaaaaguugaaa
(SEQ ID NO: 430) aaaguucaaaaaaguuuaaa (SEQ ID NO: 431)
aaagucaaaaaaaguuuaaa (SEQ ID NO: 432) aaagcucaaaaaaguuuaaa (SEQ ID
NO: 433) aaaguugaaaaaaguuuaaa (SEQ ID NO: 434) aaaguuuaaaaaaguuuaaa
(SEQ ID NO: 435) aaagguuaaaaaaguuuaaa (SEQ ID NO: 436)
aaaguguaaaaaaguuuaaa (SEQ ID NO: 437) aaaggucaaaaaaguuuaaa (SEQ 10
NO: 438) aaagucuaaaaaaguuuaaa (SEQ ID NO: 439) aaaguccaaaaaaguuuaaa
(SEQ ID NO: 440) aaaguucaaaaaagguuaaa (SEQ ID NO: 441)
aaagucaaaaaaagguuaaa (SEQ ID NO: 442) aaagcucaaaaaagguuaaa (SEQ ID
NO: 443) aaaguugaaaaaagguuaaa (SEQ ID NO: 444) aaaguuuaaaaaagguuaaa
(SEQ ID NO: 445) aaagguuaaaaaagguuaaa (SEQ ID NO: 446)
aaaguguaaaaaagguuaaa (SEQ ID NO: 447) aaaggucaaaaaagguuaaa (SEQ ID
NO: 448) aaagucuaaaaaagguuaaa (SEQ ID NO: 449) aaaguccaaaaaagguuaaa
(SEQ ID NO: 450) aaaguucaaaaaaguguaaa (SEQ ID NO: 451)
aaagucaaaaaaaguguaaa (SEQ ID NO: 452) aaagcucaaaaaaguguaaa (SEQ ID
NO: 453) aaaguugaaaaaaguguaaa (SEQ ID NO: 454) aaaguuuaaaaaaguguaaa
(SEQ ID NO: 455) aaagguuaaaaaaguguaaa (SEQ ID NO: 456)
aaaguguaaaaaaguguaaa (SEQ ID NO: 457) aaaggucaaaaaaguguaaa (SEQ ID
NO: 458) aaagucuaaaaaaguguaaa (SEQ ID NO: 459) aaaguccaaaaaaguguaaa
(SEQ ID NO: 460) aaaguucaaaaaaggucaaa (SEQ ID NO: 461)
aaagucaaaaaaaggucaaa (SEQ ID NO: 462) aaagcucaaaaaaggucaaa (SEQ ID
NO: 463) aaaguugaaaaaaggucaaa (SEQ ID NO: 464) aaaguuuaaaaaaggucaaa
(SEQ ID NO: 465) aaagguuaaaaaaggucaaa (SEQ ID NO: 466)
aaaguguaaaaaaggucaaa (SEQ ID NO: 467) aaaggucaaaaaaggucaaa (SEQ ID
NO: 468) aaagucuaaaaaaggucaaa (SEQ ID NO: 469) aaaguccaaaaaaggucaaa
(SEQ ID NO: 470) aaaguucaaaaaagucuaaa (SEQ ID NO: 471)
aaagucaaaaaaagucuaaa (SEQ ID NO: 472) aaagcucaaaaaagucuaaa (SEQ ID
NO: 473) aaaguugaaaaaagucuaaa (SEQ ID NO: 474) aaaguuuaaaaaagucuaaa
(SEQ ID NO: 475) aaagguuaaaaaagucuaaa (SEQ ID NO: 476)
aaaguguaaaaaagucuaaa (SEQ ID NO: 477) aaaggucaaaaaagucuaaa (SEQ ID
NO: 478) aaagucuaaaaaagucuaaa (SEQ ID NO: 479) aaaguccaaaaaagucuaaa
(SEQ ID NO: 480) aaaguucaaaaaaguccaaa (SEQ ID NO: 481)
aaagucaaaaaaaguccaaa (SEQ ID NO: 482) aaagcucaaaaaaguccaaa (SEQ ID
NO: 483) aaaguugaaaaaagucuaaa (SEQ ID NO: 484) aaaguuuaaaaaagucuaaa
(SEQ ID NO: 485) aaagguuaaaaaagucuaaa (SEQ ID NO: 486)
aaaguguaaaaaaguccaaa (SEQ ID NO: 487) aaaggucaaaaaaguccaaa (SEQ ID
NO: 488) aaagucuaaaaaaguccaaa (SEQ ID NO: 489) aaaguccaaaaaaguccaaa
(SEQ ID NO: 490)
[0212] In one embodiment, immunostimulatory RNA oligonucleotide of
the invention does not have gene silencing activity for any known
mammalian gene.
[0213] The immunostimulatory RNA oligonucleotide of the invention
may be single-stranded, single-stranded containing a
self-complementary sequence and can form a hairpin structure,
double-stranded, or partially double-stranded.
[0214] Furthermore, the immunostimulatory RNA oligonucleotide of
the invention may be covalently linked to one or more lipophilic
groups which enhance the stability and the activity and facilitate
the delivery of the RNA oligonucleotides.
[0215] As used herein, the term "lipophilic" or "lipophilic group"
broadly refers to any compound or chemical moiety having an
affinity for lipids. Lipophilic groups encompass compounds of many
different types, including those having aromatic, aliphatic or
alicyclic characteristics, and combinations thereof.
[0216] In specific embodiments, the lipophilic group is an
aliphatic, alicyclic, or polyalicyclic substance, such as a steroid
(e.g., sterol) or a branched aliphatic hydrocarbon. The lipophilic
group generally comprises a hydrocarbon chain, which may be cyclic
or acyclic. The hydrocarbon chain may comprise various substituents
and/or at least one heteroatom, such as an oxygen atom. Such
lipophilic aliphatic moieties include, without limitation,
saturated or unsatarated fatty acids, waxes (e.g., monohydric
alcohol esters of fatty acids and fatty diamides), terpenes (e.g.,
the C.sub.10 terpenes, C.sub.15 sesquiterpenes, C.sub.20
diterpenes, C.sub.30 triterpenes, and C.sub.40 tetraterpenes), and
other polyalicyclic hydrocarbons.
[0217] The lipophilic group may be attached by any method known in
the art, including via a functional grouping present in or
introduced into the RNA oligonucleotide, such as a hydroxy group
(e.g., --CO--CH.sub.2--OH). Conjugation of the RNA oligonucleotide
and the lipophilic group may occur, for example, through formation
of an ether or a carboxylic or carbamoyl ester linkage between the
hydroxy and an alkyl group R--, an alkanoyl group RCO--or a
substituted carbamoyl group KNHCO--. The alkyl group R may be
cyclic (e.g., cyclohexyl) or acyclic (e.g., straight-chained or
branched; and saturated or unsaturated). Alkyl group R may be a
butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, undecyl,
dodecyl, tridecyl, tetradecyl, pentadecyl, hexadecyl, heptadecyl or
octadecyl group, or the like. Preferably, the lipophilic group is
conjugated to the 5'-hydroxyl group of the terminal nucleotide. In
a preferred embodiment, the liphophilic group is
12-hydroxydodeconoic acid bisdecylamide.
[0218] In another embodiment, the lipophilic group is a steroid,
such as sterol. Steroids are polycyclic compounds containing a
perhydro-1,2-cyclopentanophenanthrene ring system. Steroids
include, without limitation, bile acids (e.g., cholic acid,
deoxycholic acid and dehydrocholic acid), cortisone, digoxigenin,
testosterone, cholesterol and cationic steroids, such as
cortisone.
[0219] In a preferred embodiment, the lipophilic group is
cholesterol or a derivative thereof. A "cholesterol derivative"
refers to a compound derived from cholesterol, for example by
substitution, addition or removal of substituents. The steroid may
be attached to the RNA oligonucleotide by any method known in the
art. In a preferred embodiment, the liphophilic group is
cholesteryl (6-hydroxyhexyl) carbamate.
[0220] In another embodiment, the lipophilic group is an aromatic
moiety. In this context, the term "aromatic" refers broadly to
mono- and polyaromatic hydrocarbons. Aromatic groups include,
without limitation, C.sub.6-C.sub.14 aryl moieties comprising one
to three aromatic rings, which may be optionally substituted;
"aralkyl" or "arylalkyl" groups comprising an aryl group covalently
linked to an alkyl group, either of which may independently be
optionally substituted or unsubstituted; and "heteroaryl" groups.
As used herein, the term "heteroaryl" refers to groups having 5 to
14 ring atoms, preferably 5, 6, 9, or 10 ring atoms; having 6, 10,
or 14.pi. electrons shared in a cyclic array; and having, in
addition to carbon atoms, between one and about three heteroatoms
selected from the group consisting of nitrogen (N), oxygen (O), and
sulfur (S).
[0221] As used herein, a "substituted" alkyl, cycloalkyl, aryl,
heteroaryl, or heterocyclic group is one having between one and
about four, preferably between one and about three, more preferably
one or two, non-hydrogen substituents. Suitable substituents
include, without limitation, halo, hydroxy, nitro, haloalkyl,
alkyl, alkaryl, aryl, aralkyl, alkoxy, aryloxy, amino, acylamino,
alkylcarbamoyl, arylcarbamoyl, aminoalkyl, alkoxycarbonyl, carboxy,
hydroxyalkyl, alkanesulfonyl, arenesulfonyl, alkanesulfonamido,
arenesulfonamido, aralkylsulfonamido, alkylcarbonyl, acyloxy,
cyano, and ureido groups.
[0222] The lipophilic group can be covalently linked directly or
indirectly via a linker to the RNA oligonucleotide. The covalent
linkage may or may not comprise a phosphodiester group. And the
linker may be of various lengths. The preferred lengths of the
linker are known to those skilled in the art and may be determined
experimentally.
[0223] In one embodiment, the lipophilic group is covalently linked
to the 5' end of at least one strand of the RNA
oligonucleotide.
[0224] In addition, the immunostimulatory oligonucleotide of the
invention may be coupled to a solid support. By "coupled" it is
meant that the oligonucleotide is covalently or non-covalently,
directly or indirectly, linked to the solid support. Suitable solid
supports include, but are not limited to, silicon wafers, synthetic
polymer support such as polystyrene, polypropylene,
polyglycidylmethacrylate, substituted polystyrene (e.g., aminated
or carboxylated polystyrene, polyacrlamides, polyamides,
polyvinylchlorides, etc.), glass, agarose, nitrocellulose, nylon
and gelatin nanoparticles. Solid support may enhance the stability
and the activity of the oligonucleotide, especially short
oligonucleotides less than 16 nucleotides in length.
Immunostimulatory RNA Oligonucleotide Conjugates
[0225] The present invention also provides immunomodulatory RNA
oligonucleotide conjugates, comprising an immunomodulatory RNA
oligonucleotide and an antigen conjugated to the oligonucleotide.
In some embodiments, the antigen is conjugated to the
oligonucleotide at a position other than its 3' end. In some
embodiments, the antigen produces a vaccine effect.
[0226] The antigen is preferably selected from the group consisting
of disease/disorder-related antigens. The disorder may be a cancer,
a dermatological disorder, an immune disorder, a metabolic
disorder, a neurological disorder, an ocular disease, an infection,
or other hereditary and non-hereditary disorders. The antigen may
be a protein, a polypeptide, a peptide, a carbohydrate, or a
combination thereof.
[0227] The immunostimulatory RNA oligonucleotide may be covalently
linked to the antigen, or it is otherwise operatively associated
with the antigen. As used herein, the term "operatively associated
with" refers to any association that maintains the activity of both
the oligonucleotide and the antigen. Non-limiting examples of such
operative associations include being part of the same liposome or
other such delivery vehicle or reagent. In embodiments wherein the
oligonucleotide agent is covalently linked to the antigen, such
covalent linkage preferably is at any position on the
oligonucleotide that does not interfere with the immunostimulatory
activity of the oligonucleotide.
RNA Oligonucleotide with Gene Silencing Activity
[0228] The present invention provides a RNA oligonucleotide with
gene silencing activity.
[0229] In one embodiment, the RNA oligonucleotide has both gene
silencing activity and immunostimulatory activity, wherein at least
one strand of the oligonucleotide has an IFN-.alpha. score of at
least 1.4909.times.n+31.014, wherein the IFN-.alpha. score is
assigned according to the "addition method" described above,
wherein n is the length of the oligonucleotide.
[0230] In an alternative embodiment, the RNA oligonucleotide has
both gene silencing activity and immunostimulatory activity,
wherein at least one strand of the oligonucleotide has an
IFN-.alpha. score of at least 0.58, wherein the IFN-.alpha. score
is assigned according to the "simplified method" described
above.
[0231] In another embodiment, the RNA oligonucleotide has gene
silencing activity and low/minimal immunostimulatory activity,
wherein all strand(s) of the oligonucleotide has(have) an
IFN-.alpha. score of at most 0.6075.times.n-9.9484, wherein the
IFN-.alpha. score is assigned according to the "addition method"
described above, wherein n is the length of the
oligonucleotide.
[0232] In an alternative embodiment, the RNA oligonucleotide has
gene silencing activity and low/minimal immunostimulatory activity,
wherein all strand(s) of the oligonucleotide has(have) an
IFN-.alpha. score of at most 0.11, wherein the IFN-.alpha. score is
assigned according to the "simplified method" described above.
[0233] The RNA oligonucleotide may be an siRNA, an shRNA or an
antisense RNA. The siRNA is between 14 and 25 nucleotides in
length; the shRNA is between 30 and 70 nucleotides in length; and
the antisese RNA is between 14 and 50 nucleotides in length.
[0234] In the case of an immunostimulatory siRNA, the gene
silencing activity resides on the antisense strands which is
complementary to the target mRNA, whereas the immunostimulatory
activity may reside on either the sense or the antisesen strand. In
a preferred embodiment, the immunostimulatory activity resides on
the sense strand; i.e., the sense strand has an IFN-.alpha. score
of at least 1.4909.times.n+31.014 when the IFN-.alpha. score is
assigned according to the "addition method" described above or the
sense strand has and IFN-.alpha. score of at least 0.58 when the
IFN-.alpha. score is assigned according to the "simplified method"
described above.
[0235] In the case of an shRNA, the molecule is processed inside a
cell to yield a siRNA molecule and the loop (linker) sequence.
Therefore, the IFN-.alpha. score needs to be calculated not only
for the intact molecule (a single-stranded RNA), but also for both
strands of the resulting siRNA molecule and the single-stranded
loop sequence. The shRNA is considered to have high
immunostimulatory activity if at least one of the above-mentioned
entities has an IFN-.alpha. score above the threshold of
1.4909.times.n+31.014 according to the "addition method" or 0.58
according to the "simplified method"; the molecule is considered to
have low immunostimulatory activity if all of the entities
mentioned above have an IFN-.alpha. score below the threshold of
0.6075.times.n-9.9484 according to the "addition method" or 0.11
according to the "simplified method". The gene silencing activity
resides in the sequence that corresponds to the antisense strand of
the siRNA; whereas the immunostimulatory activity may reside in any
part of the molecule. In a preferred embodiment, the
immunostimulatory activity resides in the portion of an shRNA that
corresponds to the sense strand of the corresponding siRNA or in
the loop sequence; i.e., said portion has an IFN-.alpha. score of
at least 1.4909.times.n+31.014 according to the "addition method"
or 0.58 according to the "simplified method".
[0236] In the case of an immunostimulatory antisense RNA, the
immunostimulatory activity and the gene silencing activity have to
reside on the same strand.
[0237] The gene silencing RNA oligonucleotide of the invention may
be covalently linked to one or more lipophilic groups which enhance
the stability and the activity and facilitate the delivery of the
RNA oligonucleotides.
Pharmaceutical Compositions
[0238] The present invention provides pharmaceutical compositions
comprising one or more of the RNA oligonucleotides of the invention
and a pharmaceutically acceptable carrier. The more than one RNA
oligonucleotides may have the same, similar, or different
functionalities including, but are not limited to immunostimulatory
activity and gene silencing activity.
[0239] For example, a RNA oligonucleotide having immunostimulatory
activity but lacking gene silencing activity may be combined with a
RNA oligonucleotide having gene silencing activity and low
immunostimulatory activity in a pharmaceutical composition to
achieve both immune activation and gene silencing. Such a
combination composition may be useful for treating disorders such
as cancers and viral infections. Such a combination composition may
be necessary when the two activities cannot be optimized on a
single RNA oligonucleotide.
[0240] In one embodiment, the pharmaceutical composition further
comprises a RNA complexation agent. In a preferred embodiment, the
complexation agent is a polycationic peptide, preferably
poly-L-arginine (poly-L-arg). In a preferred embodiment, the
polycationic peptide, in particular, poly-L-arg, is at least 24
amino acids in length. The polycationic peptide, in particular,
poly-L Arg, may be a heterogeneous mixture of peptides of different
lengths.
[0241] The pharmaceutical composition of the invention may further
comprises another agent such as an agent that stabilizes the RNA
oligonucleotide(s), e.g., a protein that complexes with the
oligonucleotide agent to form an iRNP. Still other agents include
chelators, e.g., EDTA (e.g., to remove divalent cations such as
Mg.sup.2+), salts, RNAse inhibitors (e.g., a broad specificity
RNAse inhibitor such as RNAsin) and so forth.
[0242] The pharmaceutical composition of the present invention can
further comprise one or more additional pharmaceutically active (or
therapeutic) agents which are selected from the group consisting of
agents that are used for the treatment of cancer, dermatological
disorders, immune disorders, metabolic disorders, neurological
disorders, ocular diseases, infections, and other hereditary and
non-hereditary disorders in a mammal.
[0243] In certain embodiments, the additional pharmaceutically
active agent is selected from the group consisting of
immunostimulatory RNA oligonucleotides, immunostimulatory DNA
oligonucleotides, cytokines, chemokines, growth factors,
antibiotics, anti-angiogenic factors, chemotherapeutic agents,
anti-viral agents, anti-fungal agents, anti-parasitic agents, and
antibodies. In one embodiment, the additional pharmaceutically
active agent is natural or recombinant IFN-.alpha. polypeptide, or
a CpG-containing or non-CpG-containing DNA oligonucleotide capable
of inducing IFN-.alpha. (see e.g., WO 01/22990, WO 03/101375). In
another embodiment, the additional pharmaceutically active agent is
natural or recombinant IL-12, or an immunostimulatory RNA
oligonucleotide capable inducing IL-12 (see e.g. our co-pending
application; Sugiyama et al. 2005, J Immunol 174:2273-2279). In yet
another embodiment, the additional pharmaceutically active agent is
an anti-angiogenic factor such as vasostatin or an anti-VEGF
antibody. In certain embodiments, the additional pharmaceutically
active agent is a cancer-specific agent such as Herceptin.RTM.,
Rituxan.RTM., Gleevec.RTM., Iressa.RTM..
[0244] A formulated oligonucleotide composition can assume a
variety of states. In some examples, the composition is at least
partially crystalline, uniformly crystalline, and/or anhydrous
(e.g., less than 80, 50, 30, 20, or 10% water). In another example,
the oligonucleotide agent is in an aqueous phase, e.g., in a
solution that includes water, this form being the preferred form
for administration via inhalation.
[0245] The aqueous phase or the crystalline compositions can be
incorporated into a delivery vehicle, e.g., a liposome
(particularly for the aqueous phase), or a particle (e.g., a
microparticle as can be appropriate for a crystalline composition).
Generally, the oligonucleotide composition is formulated in a
manner that is compatible with the intended method of
administration.
[0246] The pharmaceutical compositions encompassed by the invention
may be administered by any means known in the art including, but
not limited to, oral or parenteral routes, including intravenous,
intramuscular, intraperitoneal, subcutaneous, transdermal, airway
(aerosol), ocular, rectal, vaginal, and topical (including buccal
and sublingual) administration. In preferred embodiments, the
pharmaceutical compositions are administered by intravenous or
intraparenteral infusion or injection. The pharmaceutical
compositions can also be administered intraparenchymally,
intrathecally, and/or by stereotactic injection.
[0247] For oral administration, the oligonucleotide agent useful in
the invention will generally be provided in the form of tablets or
capsules, as a powder or granules, or as an aqueous solution or
suspension.
[0248] Tablets for oral use may include the active ingredients
mixed with pharmaceutically acceptable excipients such as inert
diluents, disintegrating agents, binding agents, lubricating
agents, sweetening agents, flavoring agents, coloring agents and
preservatives. Suitable inert diluents include sodium and calcium
carbonate, sodium and calcium phosphate, and lactose, while corn
starch and alginic acid are suitable disintegrating agents. Binding
agents may include starch and gelatin, while the lubricating agent,
if present, will generally be magnesium stearate, stearic acid or
talc. If desired, the tablets may be coated with a material such as
glyceryl monostearate or glyceryl distearate, to delay absorption
in the gastrointestinal tract.
[0249] Capsules for oral use include hard gelatin capsules in which
the active ingredient is mixed with a solid diluent, and soft
gelatin capsules wherein the active ingredient is mixed with water
or an oil such as peanut oil, liquid paraffin or olive oil.
[0250] For intramuscular, intraperitoneal, subcutaneous and
intravenous use, the pharmaceutical compositions of the invention
will generally be provided in sterile aqueous solutions or
suspensions, buffered to an appropriate pH and isotonicity.
Suitable aqueous vehicles include Ringer's solution and isotonic
sodium chloride. In a preferred embodiment, the carrier consists
exclusively of an aqueous buffer. In this context, "exclusively"
means no auxiliary agents or encapsulating substances are present
which might affect or mediate uptake of oligonucleotide agent in
the cells that harbor the target gene or virus. Such substances
include, for example, micellar structures, such as liposomes or
capsids, as described below. Although microinjection, lipofection,
viruses, viroids, capsids, capsoids, or other auxiliary agents are
required to introduce oligonucleotide agent into cell cultures,
surprisingly these methods and agents are not necessary for uptake
of oligonucleotide agent in vivo. The oligonucleotide agent of the
present invention are particularly advantageous in that they do not
require the use of an auxiliary agent to mediate uptake of the
oligonucleotide agent into the cell, many of which agents are toxic
or associated with deleterious side effects. Aqueous suspensions
according to the invention may include suspending agents such as
cellulose derivatives, sodium alginate, polyvinyl-pyrrolidone and
gum tragacanth, and a wetting agent such as lecithin. Suitable
preservatives for aqueous suspensions include ethyl and n-propyl
p-hydroxybenzoate.
[0251] The pharmaceutical compositions can also include
encapsulated formulations to protect the oligonucleotide agent
against rapid elimination from the body, such as a controlled
release formulation, including implants and microencapsulated
delivery systems. Biodetradable, biocompatible polymers can be
used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic
acid, collagen, polyorthoesters, and polylactic acid. Methods for
preparation of such formulations will be apparent to those skilled
in the art. The materials can also be obtained commercially from
Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal
suspensions (including liposomes targeted to infected cells with
monoclonal antibodies to viral antigens) can also be used as
pharmaceutically acceptable carriers. These can be prepared
according to methods known to those skilled in the art, for
example, as described in U.S. Pat. No. 4,522,811; PCT publication
WO 91/06309; and European patent publication EP-A-43075.
[0252] In general, a suitable dose of a RNA oligonucleotide will be
in the range of 0.001 to 500 milligrams per kilogram body weight of
the recipient per day (e.g., about 1 microgram per kilogram to
about 500 milligrams per kilogram, about 100 micrograms per
kilogram to about 100 milligrams per kilogram, about 1 milligrams
per kilogram to about 75 milligrams per kilogram, about 10
micrograms per kilogram to about 50 milligrams per kilogram, or
about 1 microgram per kilogram to about 50 micrograms per
kilogram). The pharmaceutical composition may be administered once
per day, or the oligonucleotide agent may be administered as two,
three, four, five, six or more sub-doses at appropriate intervals
throughout the day. In that case, the oligonucleotide agent
contained in each sub-dose must be correspondingly smaller in order
to achieve the total daily dosage. The dosage unit can also be
compounded for delivery over several days, e.g., using a
conventional sustained release formulation which provides sustained
release of the oligonucleotide agent over a several day period.
Sustained release formulations are well known in the art. In this
embodiment, the dosage unit contains a corresponding multiple of
the daily dose.
[0253] The skilled artisan will appreciate that certain factors may
influence the dosage and timing required to effectively treat a
subject, including but not limited to the severity of the infection
or disease/disorder, previous treatments, the general health and/or
age of the subject, and other diseases/disorders present. Moreover,
treatment of a subject with a therapeutically effective amount of a
composition can include a single treatment or a series of
treatments. Estimates of effective dosages and in vivo half-lives
for the individual RNA oligonucleotide agent encompassed by the
invention can be made using conventional methodologies or on the
basis of in vivo testing using an appropriate animal model, as
described elsewhere herein.
[0254] Toxicity and therapeutic efficacy of the RNA oligonucleotide
and the pharmaceutical composition of the invention can be
determined by standard pharmaceutical procedures in cell cultures
or experimental animals, e.g., for determining the LD50 (the dose
lethal to 50% of the population) and the ED50 (the dose
therapeutically effective in 50% of the population). The dose ratio
between toxic and therapeutic effects is the therapeutic index and
it can be expressed as the ratio LD50/ED50. oligonucleotide agents
that exhibit high therapeutic indices are preferred.
[0255] The data obtained from cell culture assays and animal
studies can be used in formulating a range of dosage for use in
humans. The dosages of compositions of the invention are preferably
within a range of circulating concentrations that include the ED50
with little or no toxicity. The dosage may vary within this range
depending upon the dosage form employed and the route of
administration utilized. For any oligonucleotide agent used in the
method of the invention, the therapeutically effective dose can be
estimated initially from cell culture assays. A dose may be
formulated in animal models to achieve a circulating plasma
concentration range of the oligonucleotide agent or, when
appropriate, of the polypeptide product of a target sequence (e.g.,
achieving a decreased concentration of the polypeptide) that
includes the IC50 (i.e., the concentration of the test
oligonucleotide agent which achieves a half-maximal inhibition of
symptoms) as determined in cell culture. Such information can be
used to more accurately determine useful doses in humans. Levels in
plasma may be measured, for example, by high performance liquid
chromatography.
[0256] The administering physician can adjust the amount and timing
of the administration of the pharmaceutical composition of the
invention on the basis of results observed using standard measures
of efficacy known in the art or described herein.
Use of the RNA Oligonucleotide for Inducing an Immune Response
[0257] The present application provides the use of the
immunostimulatory RNA oligonucleotide of the invention for the
preparation of a pharmaceutical composition for inducing an immune
response in a mammal.
[0258] Inducing an immune response means initiating or causing an
increase in one or more of B-cell activation, T-cell activation,
natural killer cell activation, activation of antigen presenting
cells (e.g., B cells, dendritic cells, monocytes and macrophages),
cytokine production, chemokine production, specific cell surface
marker expression, in particular, expression of co-stimulatory
molecules. In one aspect, such an immune response involves the
production of type I IFN, in particular, IFN-.alpha., in cells such
as PDC.
Use of the RNA Oligonucleotide for Treating Diseases/Disorders
[0259] The present invention provides the use of the
immunostimulatory RNA oligonucleotide of the invention for the
preparation of a pharmaceutical composition for preventing and/or
treating a disorder selected from immune disorders, infections, and
cancers in a mammal, wherein the induction of an immune response is
beneficial to the mammal.
[0260] The present invention also provides the use of the RNA
oligonucleotide of the invention which has both immunostimulatory
activity and gene silencing activity for the preparation of a
pharmaceutical composition for preventing and/or treating a
disorder selected from infections and cancers in a mammal, wherein
the induction of an immune response together with the
downregulation of a disorder-related gene are beneficial to the
mammal.
[0261] The present invention further provides the use of the RNA
oligonucleotide of the invention which has gene silencing activity
and low/minimal immunostimulatory activity for the preparation of a
pharmaceutical composition for preventing and/or treating a
disorder in a mammal caused by the expression or overexpression of
a disorder-related gene, wherein the induction of an immune
disorder it to be avoided. The disorder may be selected from
cancer, dermatological disorders, immune disorders, metabolic
disorders, neurological disorders, ocular diseases, infections, and
other hereditary and non-hereditary disorders.
[0262] The immune disorders include, but are not limited to,
allergy, autoimmune disorders, inflammatory disorders, and
immunodeficiency.
[0263] Allergies include, but are not limited to, food allergies
and respiratory allergies.
[0264] Autoimmune diseases include, but are not limited to,
diabetes mellitus, arthritis (including rheumatoid arthritis,
juvenile rheumatoid arthritis, osteoarthritis, psoriatic
arthritis), multiple sclerosis, encephalomyelitis, myasthenia
gravis, systemic lupus erythematosis, automimmune thyroiditis,
dermatitis (including atopic dermatitis and eczematous dermatitis),
psoriasis, Sjogren's Syndrome, Crohn's disease, aphthous ulcer,
iritis, conjunctivitis, keratoconjunctivitis, ulcerative colitis,
asthma, allergic asthma, cutaneous lupus erythematosus,
scleroderma, vaginitis, proctitis, drug eruptions, leprosy reversal
reactions, erythema nodosum leprosum, autoimmune uveitis, allergic
encephalomyelitis, acute necrotizing hemorrhagic encephalopathy,
idiopathic bilateral progressive sensorineural hearing, loss,
aplastic anemia, pure red cell anemia, idiopathic thrombocytopenia,
polychondritis, Wegener's granulomatosis, chronic active hepatitis,
Stevens-Johnson syndrome, idiopathic sprue, lichen planus, Graves'
disease, sarcoidosis, primary biliary cirrhosis, uveitis posterior,
and interstitial lung fibrosis.
[0265] Inflammatory disorders include, without limitation, airway
inflammation which includes, without limitation, asthma.
[0266] Immunodeficiencies include, but are not limited to,
spontaneous immunodeficiency, acquired immunodeficiency (including
AIDS), drug-induced immunodeficiency (such as that induced by
immunosuppressants used in transplantation and chemotherapeutic
agents used for treating cancer).
[0267] In one embodiment, the immune disorders include those caused
by pathological Th2 responses.
[0268] The infections include, but are not limited to viral
infections, bacterial infections, anthrax, parasitic infections,
fungal infections and prion infection.
[0269] Viral infections include, but are not limited to, infection
by hepatitis C, hepatitis B, herpes simplex virus (HSV), HIV-AIDS,
poliovirus, and smallpox virus. Examples of (+) strand RNA viruses
which can be targeted for inhibition include, without limitation,
picornaviruses, caliciviruses, nodaviruses, coronaviruses,
arteriviruses, flaviviruses, and togaviruses. Examples of
picornaviruses include enterovirus (poliovirus 1), rhinovirus
(human rhinovirus 1A), hepatovirus (hepatitis A virus), cardiovirus
(encephalomyocarditis virus), aphthovirus (foot-and-mouth disease
virus O), and parechovirus (human echovirus 22). Examples of
caliciviruses include vesiculovirus (swine vesicular exanthema
virus), lagovirus (rabbit hemorrhagic disease virus), "Norwalk-like
viruses" (Norwalk virus), "Sapporo-like viruses" (Sapporo virus),
and "hepatitis E-like viruses" (hepatitis E virus). Betanodavirus
(striped jack nervous necrosis virus) is the representative
nodavirus. Coronaviruses include coronavirus (avian infections
bronchitis virus) and torovirus (Berne virus). Arterivirus (equine
arteritis virus) is the representative arteriviridus. Togavirises
include alphavirus (Sindbis virus) and rubivirus (Rubella
virus).
[0270] Finally, the flaviviruses include flavivirus (Yellow fever
virus), pestivirus (bovine diarrhea virus), and hepacivirus
(hepatitis C virus).
[0271] In certain embodiments, the viral infections are selected
from chornic hepatitis B, chornic hepatitis C, HIV infection, RSV
infection, HSV infection, VSV infection, CMV infection, and
influenza infection.
[0272] Cancers include, but are not limited to biliary tract
cancer, brain cancer, breast cancer, cervical cancer,
choriocarcinoma, colon cancer, endometrial cancer, esophageal
cancer, gastric cancer, intraepithelial neoplasm, leukemia,
lymphoma, liver cancer, lung cancer, melanoma, myelomas,
neuroblastoma, oral cancer, ovarian cancer, pancreatic cancer,
prostate cancer, rectal cancer, sarcoma, skin cancer, testicular
cancer, thyroid cancer and renal cancer.
[0273] In certain embodiments, cancers are selected from hairy cell
leukemia, chronic myelogenous leukemia, cutaneous T-cell leukemia,
chronic myeloid leukemia, non-Hodgkin's lymphoma, multiple myeloma,
follicular lymphoma, malignant melanoma, squamous cell carcinoma,
renal cell carcinoma, prostate carcinoma, bladder cell carcinoma,
breast carcinoma, ovarian carcinoma, non-small cell lung cancer,
small cell lung cancer, hepatocellular carcinoma, basaliom, colon
carcinoma, cervical dysplasia, and Kaposi's sarcoma (AIDS-related
and non-AIDS related).
[0274] Dermatological disorders include, but are not limited to,
psoriasis, acne, rosacea, eczema, molluscum contagious, seborrheic
keratosis, actinic keratosis, verruca vulgaris.
[0275] Metabolic disorders include, but are not limited to,
diabetes and obesity.
[0276] Ocular diseases include, but are not limited to, age-related
macular degeneration.
[0277] Neurological disorders include, but are not limited to,
Alzeimer` disease, Huntington's disease, Parkinson's disease, and
spinal cord injury.
[0278] Hereditary diseases include, but are not limited to, cystic
fibrosis.
[0279] In one embodiment, the pharmaceutical composition is for
administration selected from the group consisting of airway, oral,
ocular, parenteral (including intraveneous, intradermal,
intramuscular, intraperitoneal, and subcutaneous), rectal, vaginal
and topical (including buccal and sublingual) administration.
[0280] In another embodiment, the pharmaceutical composition is for
use in combination with one or more treatments of disorders
selected from treatments for cancer, dermatological disorders,
immune disorders, metabolic disorders, neurological disorders,
ocular diseases, infections, and other hereditary and
non-hereditary disorders in a mammal. Such treatments include, but
are not limited to, surgery, chemotherapy, radiation therapy, and
the administration of pharmaceutically active (or therapeutic)
agents such as immunostimulatory RNA oligonucleotides,
immunostimulatory DNA oligonucleotides, cytokines, chemokines,
growth factors, antibiotics, anti-angiogenic factors,
chemotherapeutic agents, anti-viral agents, anti-fungal agents,
anti-parasitic agents, and antibodies.
[0281] In one embodiment, pharmaceutically active agent is natural
or recombinant IFN-.alpha. polypeptide, or a CpG-containing or
non-CpG-containing DNA oligonucleotide capable of inducing
IFN-.alpha. (see e.g., WO 01/22990, WO 03/101375). In another
embodiment, the pharmaceutically active agent is natural or
recombinant IL-12, or an immunostimulatory RNA oligonucleotide
capable inducing IL-12 (see e.g. our co-pending application;
Sugiyama et al. 2005, J Immunol 174:2273-2279). In yet another
embodiment, the pharmaceutically active agent is an anti-angiogenic
factor such as vasostatin or an anti-VEGF antibody. In certain
embodiments, the pharmaceutically active agent is a cancer-specific
agent such as Herceptin, Rituxan, Gleevec, Iressa.
[0282] Mammals include, but are not limited to, rats, mice, cats,
dogs, horses, sheep, cattle, cows, pigs, rabbits, non-human
primates, and humans. In a preferred embodiment, the mammal is
human.
In Vitro Method for Inducing IFN-.alpha. Production
[0283] The present invention provides an in vitro method of
inducing IFN-.alpha. production in a mammalian cell, comprising the
steps of: [0284] (a) complexing an immunostimulatory RNA
oligonucleotide of the invention with a complexation agent; and
[0285] (b) contacting the cell with the complex prepared in step
(a).
[0286] The mammalian cell is capable of producing IFN-.alpha.. In
one embodiment, the mammalian cell expresses TLR7, TLR8, or both
TLR7 and TLR8. The mammalian cells include, but are not limited to,
peripheral blood mononuclear cells (PBMC), plasmacytoid dendritric
cells (PDC), myeloid dendritic cells (MDC), B cells, macrophages,
monocytes, natural killer cells, granulocytes, endothelial cells,
cell lines such as THP1, and cells containing exogenous DNA which
directs the expression of TLR7 or TLR8 or both TLR7 or TLR8 such as
transfected CHO, HEK293 or COS cells.
[0287] In one embodiment of the invention, the complexation agent
is a polycationic peptide, preferably poly-L-arginine (poly-L-arg).
In one embodiment, the polycationic peptide, in particular,
poly-L-arg, is at least 24 amino acids in length. The polycationic
peptide, in particular, poly-L Arg, may be a heterogeneous mixture
of peptides of different lengths.
[0288] In a preferred embodiment, the mammal is human.
In Vitro Method for Activating Mammalian Dendritic Cells
[0289] The present application provides an in vitro method of
activating mammalian dendritic cells, comprising the steps of:
[0290] (a) complexing an immunostimulatory RNA oligonucleotide of
the invention with a complexation agent; [0291] (b) contacting
dendritic cells isolated from a donor mammal with the complexed RNA
oligonucleotide; and [0292] (c) contacting the dendritic cells with
an antigen.
[0293] In one embodiment of the invention, the complexation agent
is a polycationic peptide, preferably poly-L-arginine (poly-L-arg).
In one embodiment, the polycationic peptide, in particular,
poly-L-arg, is at least 24 amino acids in length. The polycationic
peptide, in particular, poly-L Arg, may be a heterogeneous mixture
of peptides of different lengths.
[0294] In one embodiment, the antigen is a disease/disorder-related
antigen. The disorder may be a cancer, a dermatological disorder,
an immune disorder, a metabolic disorder, a neurological disorder,
an ocular disease, an infection, or other hereditary and
non-hereditary disorders. The antigen may be a protein, a
polypeptide, a peptide, a carbohydrate, or a combination
thereof.
[0295] The present invention further provides the use of the in
vitro activated dendritic cells for the preparation of a medicament
for inducing an immune response in a mammal, wherein the in vitro
activated dendritic cells are for transfer into a recipient that is
the same or different from the donor.
[0296] In a preferred embodiment, the mammal is human.
[0297] The present invention is illustrated by the following
examples.
EXAMPLES
Example 1
Stimulation of PBMC Using Poly-L-Arginine-Complexed Single-Stranded
RNA Oligonucleotides
[0298] First we sought to develop an assay system for the
comparison of the IFN-a inducing capacity of single-stranded RNA
(ssRNA) oligonucleotides on a large scale. Peripheral blood
mononuclear cells (PBMC) were selected as a biological system that
is relevant for future clinical application. Within PBMC, the
plasmacytoid dendritic cell (PDC) is responsible for IFN-.alpha.
production upon stimulation with ssRNA oligonucleotides. In order
to stimulate IFN-.alpha. production in PDC, ssRNA oligonucleotides
require transfection. While cationic lipids such as lipofectamine
are well-established to support IFN-.alpha. production in isolated
PDC, the induction of IFN-.alpha. in PBMC was not satisfactory. In
order to improve transfection of RNA in PBMC we tested a number of
cationic polypeptides including poly-L-Lys, poly-His and
poly-L-arg. Among these three, poly-L-arg (14 kD) was the most
potent polycationic peptide and was even more potent than the
cationic lipid lipofectamine to support the stimulatory activity of
an established immunostimulatory RNA oligonucleotide (RNA9.2sense)
(FIG. 1). Within PBMC, the source of IFN-.alpha. production were
found to be PDC, since PDC depletion abrogated IFN-.alpha.
production (data not shown). Importantly, poly-L-arg complexation
maintained the same sequence dependency (sense versus antisense
strand) of ssRNA oligonucleotide-mediated IFN-.alpha. induction
that was previously seen for lipofectamine (Homung et al. 2005, Nat
Med 11:263-270). This experimental system was found to be robust,
since adding different concentrations of RNA oligonucleotide from
80% to 120% had little effect on the amount of IFN-.alpha. induced.
This is in marked contrast to the use of cationic lipids that
require exact adjustment of the net charges to avoid cytotoxicity.
Together these data indicated that poly-L-arg complexation is an
effective and reliable system to screen for ssRNA
oligonucleotide-induced IFN-.alpha. production in PBMC.
[0299] The experimental procedures are described in more detail in
the following:
PBMC Isolation
[0300] Human PBMC were prepared from whole blood donated by young
healthy donors. PBMC were obtained from whole blood by
Ficoll-Hypaque density gradient centrifugation (Biochrom, Berlin,
Germany). PBMC were cultured in RPMI-Medium (Biochrom, Berlin,
Germany) supplemented with human AB-Serum (2 vol %, Firma, Germany)
at a density of 2.times.10.sup.6 PBMC/ml. Subsequently PBMC were
plated into 96-well flat bottom wells at 200 .mu.l/well. Cells were
kept on ice until stimulation.
Resuspension and Annealing of ssRNA Oligonucleotides
[0301] Lyophilized ssRNA oligonucleotides (Eurogentec, Belgium)
were resuspended in sterile, RNase free water at a concentration of
620 .mu.g/ml. Subsequently 40 .mu.l of the ssRNA oligonucleotides,
40 .mu.l sterile, RNase free water and 20 .mu.l 5.times. annealing
buffer (50 mM Tris-HCl, pH 8.0, 100 mM NaCl, 5 mM EDTA) were
combined. This resulted in a final volume of 100 .mu.l with a final
concentration of the ssRNA oligonucleotide of 248 .mu.g/ml.
Subsequently the solution was incubated at 95.degree. C. for 2
minutes and cooled down to 20.degree. C. with a linear decrease in
temperature in 60 minutes (-1.25.degree. C./1 minute). The solution
was then stored at -80.degree. C. prior to usage (ssRNA
oligonucleotide stock solution).
Stimulation
[0302] If not otherwise indicated, ssRNA oligonucleotides were
complexed using the polycationic polymer Poly-L-arginine
Hydrochloride with a molecular weight of 5.000-15.000 (Prod.
Number: P4663, Sigma, Munich, Germany). Lyophilized
Poly-L-arginine
[0303] Hydrochloride was dissolved in sterile, RNase free water at
a concentration of 2000 .mu.g/ml (Poly-L-arginine stock solution)
and subsequently aliquoted and stored at a temperature of
-20.degree. C. ssRNA oligonucleotides were complexed using the
following protocol:
1. The poly-L-arginine stock solution and the ssRNA oligonucleotide
stock solution are thawed to 4.degree. C. 2. Poly-L-arginine is
diluted in Phosphate buffered saline to a concentration of 24
.mu.g/ml (1:83.3 dilution from 2000 .mu.g/ml stock solution). 3.
Immediately the ssRNA oligonucleotide is added to a final
concentration of 14.8 .mu.g/ml (1:16.6 dilution from 248 .mu.g/ml
stock solution). 4. Subsequently, the solution is mixed thoroughly
by vortexing for 10 seconds. 5. Next, 15 .mu.l of this solution is
added immediately to 200 .mu.l PBMC in the 96-well flat bottom
plate. The final concentration of poly-L-arginine is 1.67 .mu.g/ml,
whereas the final concentration of the ssRNA oligonucleotide is
1.03 .mu.g/ml.
[0304] Throughout all procedures the temperature was kept between
20-25.degree. C. On all 96-well plates PBMC from three individual
donors were plated, whereas eleven different ssRNA oligonucleotides
were tested. In addition, on each plate the ssRNA oligonucleotide
9.2 sense (5'-AGCUUAACCUGUCCUUCAA-3') was included as a positive
control. All tested ssRNA oligonucleotides were run in duplicates.
After stimulation cells were cultured at 37.degree. C./5% CO2 for
44 hours.
ELISA
[0305] After 44 hours of cell culture supernatants were collected
and stored in three individual aliquots at -80.degree. C. Prior to
ELISA-procedures frozen supernatants were thawed at 20-25.degree.
C. for two hours. To measure IFN-a the IFN-a module set Bender
MedSystems (Prod. Number: BMS216MST, Graz, Austria) was used. This
ELISA detects most of IFN-.alpha. isoforms at a detection range of
8-500 .mu.g/ml. All ELISA procedures were performed according to
manufacturer's recommendations.
Example 2
Rational Design of a 4mer-Motif Library to Screen for Potent Motifs
within ssRNA
[0306] Previous experiments have shown that a minimal length of 19
bases is required for maximal IFN-.alpha. induction by ssRNA
oligonucleotides. Since poly adenosine oligonucleotides proved to
be inactive in terms of IFN-a induction, we decided to generate a
ssRNA oligonucleotide library by placing putative motifs into the
center of poly adenosine RNA oligonucleotides. In a first set of
experiments we determined the minimal length of a motif for
IFN-.alpha. induction in our system. We designed a panel of 19mer
poly-adenosine ssRNA oligonucleotides with increasing numbers of
uracil in the center: 5'-U-3',5'-UU-3',5'-UUU-3' and 5'-UUUU-3'.
These oligonucleotides were compared to the previously published
standard ssRNA oligonucleotide RNA9.2sense
(5'-AGCUUAACCUGUCCUUCAA-3'): while the 1mer motif 5'-U-3' hardly
induced IFN-.alpha. (0.8 of RNA9.2sense), considerable amounts of
IFN-a were observed for the 2mer motif 5'-UU-3'(10.6% of
RNA9.2sense), the 3mer motif 5'-UUU-3' (15.7% of RNA9.2sense) and
the 4mer motif 5'-UUUU-3'(50.5% of RNA9.2sense) (FIG. 2). Since the
largest increment of IFN-a induction was seen between the 3mer and
4mer motif, we generated a library of ssRNA oligonucleotides
comprising all possible 4mer motifs in the centre of a poly
adenosine oligonucleotide. In view of the fact that the flanking
adenosine residues can be part of a 4mer RNA sequence motif, only
193 ssRNA oligonucleotides (table 1) were needed to cover all 256
possible 4mer motifs.
Example 3
Generation and Processing of Raw Data
[0307] All 193 ssRNA oligonucleotides were tested on PBMC of six
individual healthy donors using poly-L-arg for complexation. At 44
hours after stimulation with RNA oligonucleotides, supernatants
were collected and IFN-.alpha. production was measured by ELISA.
Prior to statistical analysis the raw data were processed as
follows: for each cell culture plate the mean IFN-.alpha. value of
the experimental duplicates for each tested ssRNA oligonucleotide
were normalized to the ssRNA oligonucleotide RNA9.2sense
(5'-AGCUUAACCUGUCCUUCAA-3'). This standard RNA oligonucleotide was
included as a positive control on all cell culture plates.
Normalization was performed by calculating the ratio of IFN-.alpha.
induced by the tested oligonucleotide and IFN-.alpha. induced by
the standard oligonucleotide RNA9.2sense. Thus, for each tested
oligonucleotide in an individual donor a mean ratio of IFN-a
induction was obtained. In the following, this mean of the ratios
is referred to as IFN-a index (one value of IFN-a index per donor).
For example testing ssRNA oligonucleotide ANP144
(5'-AAAAAAAGUUGAAAAAAAA-3') in donor 1 gave the mean of the two raw
values of the duplicates (IFN-.alpha. in supernatant) of 2024
pg/ml, whereas the control oligonucleotide RNA9.2sense
(5'-AGCUUAACCUGUCCUUCAA-3') resulted in 1256 pg/ml. The
corresponding IFN-.alpha. index of oligonucleotide ANP144 for donor
1 was calculated to be 1.61 (=2024 pg/ml divided by 1256
pg/ml).
[0308] Next, the means of all IFN-.alpha. indices for every
individual donor were calculated. Then the adjusted IFN-.alpha.
indices were calculated as IFN-.alpha. index minus the mean of all
IFN-.alpha. indices of one individual donor. For example ssRNA
oligonucleotide ANP144 of donor 1 (5'-AAAAAAAGUUGAAAAAAAA-3') had
an IFN-.alpha. index of 1.61, whereas the mean of all IFN-a indices
of donor 1 was 0.37. The adjusted IFN-a index of ANP144 was
calculated: 1.61 minus 0.37=1.24 (=subtracting 0.37 from). The
adjusted IFN-.alpha. indices from all six donors were summarized by
calculating the means and the corresponding standard error of mean.
The data are depicted in ascending order (FIG. 3A, B, C, D). The
adjusted IFN-a indices of the top thirty ssRNA oligonucleotides of
all six donors were compared using a two-tailed Student's t-test
(FIG. 3E). For most combinations tested, a significant difference
was observed when the interval between the analyzed pairs was at
least six or seven places in the assortment.
[0309] The ssRNA oligonucleotides were split into two groups: group
1 (table 2) comprising all ssRNA oligonucleotides with an
IFN-.alpha. index that lower than the mean IFN-.alpha. index off
all ssRNA oligonucleotides (or in other words with a mean of the
adjusted IFN-.alpha. index below 0) (table 1), and group 2 (table
3) comprising all ssRNA oligonucleotides with an IFN-a index higher
than the mean IFN-.alpha. index off all tested ssRNA
oligonucleotides (or in other words with a mean of the adjusted
IFN-.alpha. index below 0) (table 1). Thus group 1 contained all
ssRNA oligonucleotides with an adjusted IFN-.alpha. index below 0,
whereas group 2 contained all ssRNA oligonucleotides with an
adjusted IFN-a index above 0. Group 1 consisted of 148 ssRNA
oligonucleotides (75%), whereas group 2 consisted of 45 ssRNA
oligonucleotides (25%).
Example 4
Analyzing the Predictive Value of 1mer, 2mer and 3mer Motifs within
the 4mer Motif Matrix
[0310] Next the frequency of 1 mer motifs (5'-X-3'), 2mer motifs
(5'-XX-3',5'-X*X-3',5'-X**X-3') and 3mer motifs
(5'-XXX-3',5'-XX*X-3',5'-X*XX-3') in ssRNA oligonucleotides with an
IFN-a index below the mean IFN-a index (group 1) and above the mean
IFN-.alpha. index (group 2) was analyzed. Multiple occurrences of a
motif within one single ssRNA oligonucleotide was accounted for.
For example, the motif 5'-GU-3' is present twice in the ssRNA
oligonucleotide ANP142 (5'-AAAAAAAGUGUAAAAAAAA-3', group 2).
Consequently the ssRNA oligonucleotide ANP142 contributed two
counts for motif 5'-GU-3' within group 2. In order to compare the
distribution of a specific motif between the two groups, the
relative occurrence of a specific motif was calculated (ratio of
the absolute number of occurrence of a specific motif over the
total number of occurrence of all motifs). For example the motif
5'-GU-3' was found 7 times in group 1 (total number of
5'-XX-3'-motifs in group 1: 2482) and 33 times in group 2 (total
number of 5'-XX-3'-motifs in group 2: 799). Thus the calculated
relative occurrence for motif 5'-GU-3' in group 1 was 0.0028,
whereas the respective relative occurrence for group 2 was 0.0413.
In FIG. 4 the relative occurrence of 1 mer motifs (5'-X-3'), 2mer
motifs (5'-XX-3', 5'-X*X-3',5'-X**X-3') and 3mer motifs
(5'-XXX-3',5'-XX*X-3',5'-X*XX-3') within the two groups is shown. A
significant overrepresentation or underrepresentation of a given
motif was analyzed using a chi-square test. The null hypothesis of
equal distribution within both groups was rejected when the
calculated p-value was below 0.05 (significant differences in
distribution are indicated by "*" in FIG. 4).
Example 5
Calculating an Individual IFN-.alpha. Score for 1mer-, 2mer- and
3mer-Motifs
[0311] A mean IFN-.alpha. index for all possible 1mer motifs
(5'-X-3'), 2mer motifs (5'-XX-3',5'-X*X-3', 5'-X**X-3') or 3mer
motifs (5'-XXX-3',5'-XX*X-3',5'-X*XX-3') was obtained by
calculating a mean IFN-.alpha. index of all ssRNA oligonucleotides
containing the corresponding motifs. This mean IFN-a index is
referred to as the IFN-.alpha. score of a given motif. For example
the 3mer motif 5'-GUC-3' was contained in ssRNA oligonucleotides
ANP 35, 83, 131, 137, 138, 139 and 179 with respective adjusted
IFN-.alpha. indices of 1.33, 0.68, 0.93, 0.79, 0.44, 0.84, 0.73.
The IFN-.alpha. score of the 3mer motif 5'-GUC-3' was thus
calculated to be 0.82 with a standard error of mean of 0.11. The
calculation of the IFN-.alpha. score of a motif did not account for
the position of the motif within the sequence of the corresponding
ssRNA oligonucleotides. Multiple occurrences of one motif within
the same ssRNA oligonucleotide was accounted for by adding the
corresponding IFN-.alpha. index times the number of its occurrence
within the oligonucleotide to the calculation of the corresponding
IFN-.alpha. score of the motif. Consequently an IFN-.alpha. score
could be assigned to all possible 1 mer motifs (5'-X-3'), 2mer
motifs (5'-XX-3',5'-X*X-3',5'-X**X-3') or 3mer motifs
(5'-XXX-3',5'-XX*X-3',5'-X*XX-3') (FIG. 5).
Example 6
Predicting the IFN-.alpha. Index of ssRNA Oligonucleotides Using
the IFN-.alpha. Score of 1mer-, 2mer- and 3mer-Motifs
[0312] Next we tested the predictive value of the calculated 1mer-,
2mer- and 3mer-motif IFN-.alpha. scores to predict ssRNA
oligonucleotides with a low or high IFN-.alpha. index. Thus for
each ssRNA oligonucleotide the occurrence of a set of motifs was
tested and the respective IFN-a scores were assigned to the ssRNA.
For example for the panel of 3mer motifs with unspaced sequences
(5'-XXX-3') the ssRNA oligonucleotide ANP 35
(5'-AAAAAAAAGUCAAAAAAAA-3') was analyzed the following way:
TABLE-US-00009 3mer motif IFN-.alpha. Occurrences within the ssRNA
Assigned IFN-.alpha. (5'-XXX-3') score oligonucleotide ANP 35 score
5'-AAA-3' -0.0041 12 -0.0503 5'-AAG-3' +0.0990 1 +0.0990 5'-AGU-3'
+0.5796 1 +0.5796 5'-GUC-3' +0.8115 1 +0.8115 5'-UCA-3' +0.3668 1
+0.3668 5'-CAA-3' +0.0033 1 +0.0033 overall +1.8099
[0313] All ssRNA oligonucleotides were assigned an individual IFN-a
score for all possible motif-combinations (1mer-, 2mer- and
3mer-motifs). Next, the prediction that was obtained by using the
assigned IFN-.alpha. scores was compared to the actual adjusted
IFN-.alpha. indices for all ssRNA oligonucleotides and for each
motif combination. Data were sorted in ascending order according to
the adjusted IFN-.alpha. indices. For all predictions, the
correlation coefficient was calculated: Using the IFN-.alpha.
scores of 1 mer motifs (5'-X-3') to predict the actual adjusted
IFN-.alpha. indices off all ssRNA oligonucleotides a correlation
coefficient of 0.53 was obtained (FIG. 6A). When 2mer motifs were
used to predict the adjusted IFN-.alpha. indices a correlation
coefficient of 0.77 was obtained for 5'-XX-3'-motifs, a correlation
coefficient of 0.58 for 5'-X*X-3'-motifs and a correlation
coefficient of 0.60 for 5'-X**X-3'-motifs (FIG. 6B). Using 3mer
motifs to predict the adjusted IFN-.alpha. indices, a correlation
coefficient of 0.87 was calculated for 5'-XXX-3'-motifs, of 0.80
for 5'-XX*X-3'-motifs and of 0.80 for 5'-X*XX-3'-motifs.
[0314] Next, the most accurate prediction algorithm (using the
individual IFN-.alpha. scores of the 5'-XXX-3'-motifs) was
translated into a point score system. The matrix of the 64
different 3mer motifs (5'-XXX-3') was reduced to encompass only the
motifs that were significantly over- or underrepresented in either
group 1 or group 2 ssRNA oligonucleotides. Even though only 17 3mer
motifs (5'-XXX-3') were left in this matrix, a correlation
coefficient of 0.87 could still be calculated when using the
respective IFN-.alpha. scores to predict the IFN-.alpha. indices of
the complete ssRNA oligonucleotide library (data not shown). In
addition, the respective IFN-.alpha. scores of the reduced 3mer
motif matrix was translated in into a point score system by
assigning a point score to each 3mer motif (FIG. 6D). Using this
point score system, a prediction of the measured IFN-.alpha.
indices of all 193 ssRNA oligonucleotides was calculated with a
corresponding correlation coefficient of 0.87 (FIG. 6E).
Example 7
Influence of the Positioning and the Flanking Bases on the
IFN-.alpha.-Inducing Activity of a Potent 4mer Motif within a 19mer
ssRNA Oligonucleotide
[0315] Next we sought to address the impact of moving a potent 4mer
motif to either the 5' or the 3' end within a 19mer ssRNA
oligonucleotide. A panel of ssRNA oligonucleotides was designed
that included the potent 4mer motif 5'-GUCA-3' within a 19mer
poly-A ssRNA oligonucleotide (table 4). The positioning of the 4mer
motif was chosen to be either 2, 6, 8, 10 or 14 bases from the
5'-end of the ssRNA oligonucleotide. PBMC were stimulated with the
respective ssRNA oligonucleotides and IFN-.alpha. production was
assessed 44 hours after stimulation. Positioning the 4mer motif two
bases from the 5'-end of the ssRNA oligonucleotide slightly
decreased IFN-.alpha. induction by 13%, when compared to the center
positioning (8 bases from the 5'-end). A higher decrease in
IFN-.alpha. production (29%) was seen, when the 4mer motif was
positioned on the 3'-end of the ssRNA oligonucleotide (14 bases
from the 5'-end). Nevertheless all ssRNA oligonucleotides tested
were still more potent in terms of IFN-.alpha. induction than the
positive control 9.2sense (FIG. 7A).
[0316] In addition, we addressed the influence of flanking bases on
the stimulatory activity of the potent 4mer motif 5'-GUCA-3'. A
panel of 16 ssRNA oligonucleotides, which included all possible
oligonucleotides with permutated bases at the flanking positions to
the 5'- and the 3'-end of the central 5'-GUCA-3'-motif (table 5),
was tested (FIG. 7B). As soon as the 5'-GUCA-3'-motif was modified
with a preceding 5'-C-3', a significant decrease to less than 50%
of the original activity was obtained (FIG. 7C). In addition, when
a 5'-U-3' preceded the 5'-GUCA-3'-motif, a significant decrease to
about 77% of the original activity was observed (FIG. 7C). In
contrast, changing the preceding base to a 5'-G-3' did not impact
on the stimulatory activity of the 5'-GUCA-3'-motif. The
modification of the flanking base to the 3'-end had little impact
on the stimulatory activity of the 5'-GUCA-3'-motif. Nevertheless,
a slight, yet significant decrease in activity was detected, as
soon as the base to the 3'-end was changed into a 5'-C-3'.
Example 8
Predicting the Immunostimulatory Activity of Complex 19mer ssRNA
Oligonucleotides Using the 3mer Motif 5'-XXX-3' Based IFN-.alpha.
Point Score Matrix
[0317] Next, we employed the IFN-.alpha. point score matrix to
predict the potency of complex (i.e., no longer on a poly A
backbone) 19mer ssRNA oligonucleotides in terms of IFN-.alpha.
induction. Modified versions of RNA9.2sense that have been
previously described (Hornung et al. 2005, Nat Med 11:263-270) were
used to stimulate PBMC; IFN-.alpha. production was measured 44 h
after stimulation. In addition, respective sequences were analyzed
using the above-described algorithm that is based on the
IFN-.alpha. score of 3mer motifs 5'-XXX-3'. Both the measured and
the predicted data were normalized to the ssRNA oligonucleotide
RNA9.2sense (set to 100%). In FIG. 8A both measured data and
predicted data are depicted. The correlation coefficient for this
analysis was calculated to be 0.84.
Example 9
Validation of the Method of Prediction
[0318] Our method of predicting the immunostimulatory activity of
an RNA oligonucleotide is further validated by data disclosed in
various publications. To date, four publications describe
IFN-.alpha. induction by RNA oligonucleotides in the human system:
Heil F et al. 2004, Science 303: 1526-1529; Sioud M et al. 2005, J
Mol Biol 348: 1079-1090; Homung V et al. 2005, Nat Med 11: 263-270;
Judge A D et al. 2005, Nat Biotechnol 2005. 23: 457-462.
[0319] Heil and colleagues (Heil F et al. 2004, Science 303:
1526-1529) found that when added to human PBMC as a complex with
cationic lipid DOTAP, RNA40 (5''-GCC CGU CUG UUG UGU GAO UC-3'',
HIV-1 U5 region nt 108-127) but not RNA41 (U-A replacement of
RNA40) or RNA42 (G-A replacement of RNA40) induced IFN-.alpha., and
that the source of IFN-.alpha. was PDC. In contrast, both RNA40 and
RNA42, but not RNA41 induced TNF-.alpha., IL-6 and IL-12p40;
TNF-.alpha. was produced by CD11c+ cells. Similar results were
found with isolated murine PDC and macrophages. RNA33
(5-GUAGUGUGUG-3'') and RNA34 (5''-GUCUGUUGUGUG-3''), both
containing one phosphorothioate linkage at the 3''end, induced the
same cytokine profile as RNA40 in the mouse system. Heil et al.
stated that a sequence motif responsible for the IFN-.alpha.
inducing activity of the RNA oligonucleotides tested could not be
identified; subsequently, the activity was attributed to the high
GU content of the sequence. Our analysis of the results of Heil et
al. reveals that RNA40 contains a 4mer motif, GUUG, which is the
fourth most potent motif in inducing IFN-.alpha. production in our
matrix. Furthermore, our 3mer-based algorithm predicts high
IFN-.alpha.-inducing activity for RNA40, RNA33 and RNA34, but not
for RNA41 and RNA42, which is in agreement with the experimental
data (FIG. 8D).
[0320] Another publication on ssRNA and IFN-.alpha. in the human
system is from our own group (Hornung V et al. 2005, Nat Med 11:
263-270). In this publication, we identified a 9mer sequence motif
which was responsible for the immunostimulatory activity of the
ssRNA oligonucleotide RNA9.2 sense (5'-AGC UUA ACC UGU CCU UCA
A-3', 9mer motif underlined). No motif shorter than the 9mer motif
was characterized. The analysis of our previously published results
reveals that the previously identified 9mer motif contains GUCC
which is the tenth most potent immunostimulatory 4mer in our
matrix. Furthermore, our 3mer-based IFN-.alpha. point score matrix
predicts RNA9.2 sense to be a highly active IFN-.alpha.-inducing
sequence. Moreover, our 3mer-based IFN-.alpha. point score matrix
offers a prediction of the IFN-.alpha.-inducing activities of other
sequences tested in Hornung et al.; our prediction correlates very
well with the published experimental data.
[0321] Another study in the human system was published by Sioud and
colleagues (Sioud M et al. 2005, J Mol Biol 348: 1079-1090). The
authors examined a panel of 32 siRNAs for their ability to induce
TNF-.alpha. and IL-6 in PBMC. The most active sequence was number
27 (sense: 5''-GUCCGGGCAGGUCUACUUUTT-3'') either as siRNA
(double-stranded) or as the sense strand. As negative control,
number 32 (sense: 5''-GCUGGAGAUCCUGAAGAACTT-3'') was used. Of note,
the whole panel was not screened for IFN-.alpha.-inducing activity;
only sequence 27 was assayed for IFN-.alpha. induction in PBMC.
Both the number 27 siRNA and the corresponding sense strand were
found to induce IFN-.alpha.. DOTAP was used for transfection. Our
analysis of the panel of 32 siRNAs reveals that only
oligonucleotide number 27, but none of the other oligonucleotides
of the panel, contains the motif GUCC, which is ranked number 10 on
our most potent immunostimulatory 4mer list and which is also
contained in the 9mer motif of our earlier paper (Homung V et al.
2005, Nat Med 11: 263-270) discussed above. Furthermore, our
3mer-based IFN-.alpha. point score matrix predicts potent
IFN-.alpha.-inducing activity for siRNA number 27. However, since
siRNA number 27 was the only sequence examined for
IFN-.alpha.-inducing activity in Sioud et al, a comprehensive
analysis of the whole panel of siRNAs could not be carried out.
[0322] Besides our own previous publication (Hornung V et al. 2005,
Nat Med 11: 263-270), Judge and colleagues are the only ones who
proposed a sequence motif (UGUGU) for the IFN-.alpha.-inducing
activity of RNA oligonucleotides (Judge A D et al. 2005, Nat
Biotechnol 2005. 23: 457-462). Although most of their work was done
with siRNA (double-stranded), for one of their potent
immunostimulatory sequences, .beta.-Gal control, both the sense and
the antisense strand were tested. The sense strand, but not the
antisense strand, was found to be active to inducing IFN-.alpha. in
human PBMC. The sense strand (5''-UUGAUGUGUUUAGUCGCUA-3'')
contained the proposed UGUGU motif, while the antisense strand
(5''-UAGCGACUAAACACAUCAA-3'') did not. The introduction of one
(UGCGU) or two (UGCGC) mismatches in the sense strand sequence of
the .beta.-Gal control siRNA led to the loss of
IFN-.alpha.-inducing activity. On the other hand, the creation of
the UGUGU motif, starting from UGGCU, in a primarily
non-stimulatory siRNA, BP1, led to an enhanced IFN-.alpha.-inducing
activity. Furthermore, Judge and colleagues showed that they could
select non-stimulatory siRNA sequences by avoiding U-rich sequences
and GUGU motifs. Indeed, in our 4mer matrix, GUGU is the 7th most
active motif, and UGUG is the 20th most active motif. Furthermore,
the relative IFN-.alpha.-inducing activities of .beta.p-Gal control
siRNA, BP1 siRNA and their derivatives predicated by our 3mer-based
IFN-.alpha. point score matrix correlates extremely well with the
experimental data of Judge et al. (FIG. 8B).
[0323] Additional publication reports the induction of IFN-.alpha.
by RNA oligonucleotides in the mouse system.
[0324] Barchet W et al. (2005, Eur J Immunol 35: 236-242) reports
IFN-.alpha. induction by RNA oliognucleotides in murine PDC. In
this study, the RNA sequences examined were derived from the 5' and
3' untranslated regions (UTR) of Influenza virus. The following
sequences were used:
TABLE-US-00010 5' UTR: 5'-AGUAGAAACAAGGUAGUUU-3' (19 mer) 3' UTR:
5'-UUAACUACCUGCUUUUGCU-3' (19 mer) 5'3' UTR:
5'-AGUAGAAACAAGGUAGUUUUUUGUUAACUACCUGCUUUUGCU-3' (42 mer), 5' UTR
U-C replacement: 5'-AGCAGAAACAAGGCAGCCC-3' (19 mer) 5' UTR G-C
replacement: 5'-ACUACAAACAACCUACUUU-3' (19 mer)
[0325] 5''UTR, 3'UTR and 5'3'UTR oligonucleotides all induced
IFN-.alpha. production from murine PDC. The activity of 5'UTR was
significantly reduced when the Gs were replaced by Cs, and
abolished when the Us were replaced by Cs. No motif responsible for
the IFN-.alpha.-inducing activity was defined in this study.
According to our 4mer motif matrix, 5'UTR contains the 5th active
motif GUUU, and 3'UTR contains the motif UUUU which is above
average. The activity levels of the oligonucleotides used in
Barchet et al. predicted by our 3mer-based IFN-.alpha. point score
matrix correlates with the experimental data of Barchet et al.
[0326] It should be noted that in some studies double stranded RNA
oligonucleotides were used. In such cases, a mean value for the
individually analyzed single strands was calculated. Nevertheless,
using the prediction algorithm, a good estimate of the actual
IFN-.alpha. data could be obtained.
[0327] All of the publications discussed above validate the use of
our 4mer matrix and algorithms for predicting the immunostimulatory
activity of RNA oligonucleotides. The teaching in the prior art
with regard to the prediction of IFN-.alpha.-inducing activity of
RNA oligonucleotides has been limited. The only criteria available
so far are the content of G and U (Heil et al. 2004, Science 303:
1526-1529), and the presence of the GUGU motif (Judge et al. 2005,
Nat Biotechnol 2005. 23: 457-462). With our 3mer-based IFN-.alpha.
point score matrix, we now can predict the immunostimulatory
activity of any RNA oligonucleotide reliably.
Example 10
Determining the Threshold for High and Low Immunostimulatory
Activity
[0328] The immunostimulatory activity of any given RNA
oligonucleotide can be predicted using the 3mer-based IFN-.alpha.
point score matrix as described previously (i.e., the "addition
method". For research and drug discovery and development purposes,
two groups of RNA oligonucleotide are of interest: Group A
oligonucleotides which have high or maximal IFN-.alpha.-inducing
activity, and Group B oligonucleotides which have low or minimal
IFN-.alpha.-inducing activity. Among all possible ssRNA
oligonucleotides of a certain length, 1% of the oligonucleotides
with the highest IFN-.alpha. scores are assigned to Group A; where
as 1% of the oligonucleotides with the lowest IFN-.alpha. scores
are assigned to Group B. The cut-off IFN-.alpha. score for Group A
oligonucleotide is the threshold for high or maximal
immunostimulatory activity; the cut-off IFN-.alpha. score for Group
B oligonucleotide is the threshold for low or minimal
immunostimulatory activity.
[0329] The IFN-.alpha. score thresholds for high/maximal and
low/minimal immunostimulatory activity for 19mer ssRNA
oligonucleotides are determined as follows:
[0330] A pool of all possible sequences of 19mer RNA
oligonucleotides consists of 4.sup.19=274,877,906,944
oligonucleotides. The IFN-.alpha. score for every single RNA
oligonucleotide in the pool is calculated using the 3mer-based
IFN-.alpha. point score matrix. All 4.sup.19 oligonucleotides are
ranked based on their calculated predicted IFN-.alpha. scores. The
threshold for group A is determined to be
1.4909.times.n+22.014 [0331] (n=length of the ssRNA
oligonucleotide, and n>9).
[0332] All ssRNA oligonucleotides with a calculated IFN-.alpha.
score above the threshold value are grouped into Group A. The Group
A threshold for 19mer ssRNA oligonucleotides is 50.3411.
Non-limiting examples of Group A 19mer ssRNA oligonucleotides
include the following:
TABLE-US-00011 Sequence (5'-->3') Predicted IFN-.alpha. score
GUUUGUUGCUUUGAUUGCC 60 UUGUAGUUCGUUGCUAGUG 60 AGUUCAUGGUGGGUUGUAC
62 UGUUUAAGUUGUUCUACCC 62 AAGUUUUGAUUUUUCAGUA 63
AGGCGUUUGUGUUCGGGUU 65 AGAUGUUGUAGGGUGUUUU 66 UAGUGUGUGUCAGUGUGAC
71 GGUUGCGUGUGGAGUUGUU 72 UGUAGUUUUGUUAGAGUCA 75
GUGUGGUUGCUGUUGUCAA 77
[0333] The threshold for Group B oligonucleotides is determined to
be:
(0.005.times.n.sup.2)-(0.2671.times.n)-3.5531 [0334] (n=length of
the ssRNA oligonucleotide, and X>9)
[0335] All ssRNA oligonucleotides with a calculated IFN-.alpha.
score below the threshold value are grouped into Group B. The Group
B threshold for 19mer ssRNA oligonucleotide is -6.823. Non-limiting
examples of Group B 19mer oligonucleotide include the
following:
TABLE-US-00012 Sequence (5'-->3') Predicted IFN-.alpha. score
GGGACCGAAAGACCAGACC -10 UAAGACUAGAAGAGACAGA -10 AGAUCCGAACCACCGACCA
-9 GAACCAGAAAAUAGAGCAG -8 CAUAUAAGAAGACCAGCCA -8
UAAGAACCAACUGCUAGAA -8 CCCCUACAGACAGAAUACC -7 CUGGCAGAUAGAUAGAAGC
-7 CUAGACCAGAACAAUCUCG -7 UUAGAGACAUAACAACAUU -7
GGACCAAACCUCUCGACAU -7
[0336] For ssRNA oligonucleotides between 3 and 9 nucleotides in
length, the Group A and Group B threshold values are given below in
Table 8:
TABLE-US-00013 TABLE 8 Threshold IFN-.alpha. scores for Group A and
Group B oligonucleotides 3-9 nucleotides in length. The predicted
IFN-.alpha. score ssRNA (using the IFN-.alpha. point score matrix)
oligonucleotide Threshold for GROUP B Threshold for GROUP A length
ssRNA oligonucelotides ssRNA oligonucelotides 3 -2 9 4 -2 15 5 -3
20 6 -4 23 7 -4 26 8 -5 28 9 -5 30
Example 11
Designing siRNA with High or Low Immunostimulatory Activity
[0337] The threshold for Group A siRNA is
1.4909.times.n+31.014 [0338] (n=length of the ssRNA oligonucleotide
and n>9) according to the "addition method".
[0339] An siRNA is considered a Group A siRNA, i.e., an siRNA with
high or maximal immunostimulatory activity, if at least one of the
strands, preferably the sense strand, has an IFN-.alpha. score
above the threshold.
[0340] In order to maximize the chance of identifying at least one
siRNA with optimized gene silencing as well as immunostimulatory
activity, at least ten siRNA molecules need to be identified whose
sense strands have an IFN-.alpha. score above the threshold for
Group A siRNA. When fewer than ten siRNA can be identified that fit
the above criteria, the threshold for Group A siRNA is decrease by
1 in a stepwise manner until ten siRNA can be identified.
[0341] Most commonly used siRNA are at least 19 nucleotides in
length. The threshold for Group A siRNA for a 19mer is 59.3411.
[0342] The following example demonstrates the identification of
Group A siRNA for mRNA of human cyclophilin B (hCyPB) (Accession
No. M6087).
[0343] For hCyPB, 833 putative or potential siRNA duplexes (19mer)
can be identified. The IFN-.alpha. score is calculated for both the
sense and the antisense strand of all possible 833 19mer siRNA
using the IFN-.alpha. point score matrix. All siRNA duplexes which
contain at least one strand with an IFN-.alpha. score higher than
59.3411 are put into Group A. 11 siRNA duplexes are assigned to
Group A because the IFN-.alpha. scores of their sense strands are
above the threshold; 24 siRNA duplexes are assigned to Group A
because the IFN-.alpha. scores of their antisense strands are above
the threshold. The Group A hCyPB siRNA are listed in Table 9:
TABLE-US-00014 Sense strand IFN-.alpha. Antisene strand IFN-.alpha.
(5'.fwdarw.3') score (5'.fwdarw.3') score UAACAAACUCCUACCAACA -9
UGUUGGUAGGAGUUUGUUA 74 AACAAACUCCUACCAACAC -9 GUGUUGGUAGGAGUUUGUU
77 UACCAACACUGACCAAUAA -8 UUAUUGGUCAGUGUUGGUA 63
CUACCAACACUGACCAAUA -8 UAUUGGUCAGUGUUGGUAG 63 ACCAACACUGACCAAUAAA
-8 UUUAUUGGUCAGUGUUGGU 65 ACAAACUCCUACCAACACU -8
AGUGUUGGUAGGAGUUUGU 74 ACUCCUACCAACACUGACC -7 GGUCAGUGUUGGUAGGAGU
62 CCUACCAACACUGACCAAU -7 AUUGGUCAGUGUUGGUAGG 63
UCCUACCAACACUGACCAA -7 UUGGUCAGUGUUGGUAGGA 63 AAACUCCUACCAACACUGA
-6 UCAGUGUUGGUAGGAGUUU 64 CCAACACUGACCAAUAAAA -6
UUUUAUUGGUCAGUGUUGG 66 CAAACUCCUACCAACACUG -6 CAGUGUUGGUAGGAGUUUG
66 AACUCCUACCAACACUGAC -6 GUCAGUGUUGGUAGGAGUU 67
AACACUGACCAAUAAAAAA -6 UUUUUUAUUGGUCAGUGUU 69 CAACACUGACCAAUAAAAA
-6 UUUUUAUUGGUCAGUGUUG 70 GCUACAAAAACAGCAAAUU -5
AAUUUGCUGUUUUUGUAGC 60 GGCUACAAAAACAGCAAAU -5 AUUUGCUGUUUUUGUAGCC
60 ACACUGACCAAUAAAAAAA -5 UUUUUUUAUUGGUCAGUGU 65
UGGCUACAAAAACAGCAAA -4 UUUGCUGUUUUUGUAGCCA 60 GUAACAAACUCCUACCAAC
-4 GUUGGUAGGAGUUUGUUAC 66 CACUGACCAAUAAAAAAAA -3
UUUUUUUUAUUGGUCAGUG 62 ACUGACCAAUAAAAAAAAA -3 UUUUUUUUUAUUGGUCAGU
64 UACAAAAACAGCAAAUUCC -1 GGAAUUUGCUGUUUUUGUA 60
CUACAAAAACAGCAAAUUC -1 GAAUUUGCUGUUUUUGUAG 60 AAAAUGUGGGUUUUUUUUU
60 AAAAAAAAACCCACAUUUU 5 UGUGGUGUUUGGCAAAGUU 63 AACUUUGCCAAACACCACA
3 AAAUGUGGGUUUUUUUUUU 65 AAAAAAAAAACCCACAUUU 0 GUUUUUUUUUUUUUUAAUA
68 UAUUAAAAAAAAAAAAAAC -1 AAUGUGGGUUUUUUUUUUU 70
AAAAAAAAAAACCCACAUU -5 GGUUUUUUUUUUUUUUAAU 73 AUUAAAAAAAAAAAAAACC
-3 GGGUUUUUUUUUUUUUUAA 73 UUAAAAAAAAAAAAAACCC -3
UGGGUUUUUUUUUUUUUUA 74 UAAAAAAAAAAAAAACCCA -3 AUGUGGGUUUUUUUUUUUU
75 AAAAAAAAAAAACCCACAU -5 GUGGGUUUUUUUUUUUUUU 77
AAAAAAAAAAAAAACCCAC -3 UGUGGGUUUUUUUUUUUUU 80 AAAAAAAAAAAAACCCACA
-5
[0344] The IFN-.alpha. score threshold for a Group B siRNA is
0.6075.times.n-9.9484 [0345] (n=length of the ssRNA oligonucleotide
and n>13) according to the "addition method".
[0346] Both the sense and the antisense strands of an siRNA have to
have an IFN-.alpha. score below the threshold for the siRNA to be
assigned to Group B. In order to maximize the chance of identifying
at least one siRNA with optimal gene silencing activity but minimal
immunostimulatory activity, at least ten Group B siRNA duplexes
should be identified for a given target mRNA. Should this condition
not be met, the threshold IFN-.alpha. score is increased by 1 in a
stepwise manner until ten Group B siRNA are identified.
[0347] The IFN-.alpha. score threshold for Group B 19mer siRNA
duplexes is 1.5941.
[0348] None of the 833 potential hCyPB siRNA have an IFN-.alpha.
score of lower than 1.5491 for both strands. When the threshold was
increased to 2.5491, one siRNA is identified. In order to identify
at least ten siRNA duplexes, the threshold IFN-.alpha. score has to
be increased by 3 to 4.5491. The Group B siRNA thus identified are
listed in Table 10:
TABLE-US-00015 Sense strand IFN-.alpha. Antisense strand
IFN-.alpha. (5'.fwdarw.3') score (5'.fwdarw.3') score
AAGAUCGAGGUGGAGAAGC 4 GCUUCUCCACCUCGAUCUU 2 AGAUCGAGGUGGAGAAGCC 4
GGCUUCUCCACCUCGAUCU 2 CCGCCGCCCUCAUCGCGGG 4 CCCGCGAUGAGGGCGGCGG 0
CCUUCUGCGGCCGAUGAGA 2 UCUCAUCGGCCGCAGAAGG 2 CGCCGCCCUCAUCGCGGGG 4
CCCCGCGAUGAGGGCGGCG 0 CUUCCUGCUGCUGCCGGGA 4 UCCCGGCAGCAGCAGGAAG 0
GAGCGCUUCCCCGAUGAGA 2 UCUCAUCGGGGAAGCGCUC 4 GCCGCCGCCCUCAUCGCGG 4
CCGCGAUGAGGGCGGCGGC 0 GGCAAGAUCGAGGUGGAGA 4 UCUCCACCUCGAUCUUGCC 4
UCUUCCUGCUGCUGCCGGG 4 CCCGGCAGCAGCAGGAAGA -2 UGCCGCCGCCCUCAUCGCG 4
CGCGAUGAGGGCGGCGGCA 0
Example 12
Rational Identification of a Potent 4mer ssRNA Motif with Maximal
IFN-.alpha. Induction in PBMC
[0349] Previous experiments have shown that a minimal length of 19
bases is required for maximal IFN-.alpha. induction by ssRNA
oligonucleotides. Since poly A oligonucleotides proved to be
inactive in terms of IFN-.alpha. induction, we decided to analyze
sequence requirements for IFN-.alpha. induction in PBMC by placing
putative motifs into the center of poly A RNA oligonucleotides.
RNA9.2sense (5'-AGCUUAACCUGUCCUUCAA-3') was used as an established
positive control. We started by analyzing the impact of a single
nucleotide exchange in the center of a poly A RNA
oligonucleotide.
[0350] As expected, little IFN-.alpha. induction could be elicited
by these oligonucleotides, yet a consistent induction was seen for
the ssRNA oligonucleotide containing a Uracil (U) in the center of
the poly-A chain (FIG. 9A).
[0351] Based on these data, a panel of ssRNA oligonucleotides was
designed that contained a U in the center of a 19mer poly A
oligonucleotide including all possible single base permutations to
either the 5' or the 3' end (FIG. 9B). Compared to the 1mer motifs,
a considerable increase in IFN-.alpha. induction by the tested 2mer
motifs could be seen. A wide distribution with an approximately
100-fold difference between the weakest and the strongest motif was
observed: 5'-CU-3', 0.24% of control vs. 5'-GU-3', 24.63% of
control. Among all 2mer motifs tested, 5'-GU-3' turned out to be
the most potent motif with a mean IFN-.alpha. induction of 24.63%
of the control oligonucleotide 9.2 sense.
[0352] Following these results, oligonucleotides were designed that
contained the 5'-GU-3' motif in the center of a 19mer poly A
oligonucleotide while again all possible single base permutations
to either the 5' or the 3' end of the central motif were tested
(FIG. 90). Compared to 5'-GU-3', an almost 6-fold increase in
IFN-.alpha. induction was seen for the most potent oligonucleotide
that minimally contained the sequence 5'-GUC-3' as the central
motif. This oligonucleotide exceeded the control oligonucleotide by
1.43-fold in terms of IFN-.alpha. induction. A considerable amount
of IFN-.alpha., yet significantly less, was induced by the second
best motif combination 5'-GUU-3' (88% of control).
[0353] Based on these data, we again designed oligonucleotides that
contained the identified minimal 3mer motif 5'-GUC-3' with single
base permutations to either the 5' or the 3' end. While the
transition from 1mer motifs to 2mer motifs and from 2mer motifs to
3mer motifs had resulted in a strong increase in IFN-.alpha.
induction, no additional enhancement in IFN-.alpha. induction was
seen with the elongation of the central motif to a 4mer motif (FIG.
9D). Nevertheless, these data indicated that A was required at the
3' end of the 5'-GUC-3' motif for maximal IFN-.alpha. induction.
Placing either C or U at the 3' end of the 5'-GUC-3' motif resulted
in a reduction of approximately one third in IFN-.alpha. induction,
whereas the addition of G resulted in an almost two third decrease
in IFN-.alpha. production. No further increase in IFN-.alpha.
induction was seen when the position to the 5' end of the 5'-GUC-3'
motif was permutated. While changing the A to G resulted in a
slight, yet not significant decrease in IFN-.alpha. induction, a
decrease of approximately one third was obtained when either U or C
were positioned at the 5' end. Altogether these data identified the
4mer sequence 5'-GUCA-3' as a potent motif for the induction of
IFN-.alpha. in PBMC. Additional modification of the 3' end by
single base permutations did not result in an increase in
IFN-.alpha. induction (FIG. 9E), thereby indicating the maximal
requirement of a 4mer motif for potent IFN-.alpha. induction.
Example 13
The Effect of Position and Number of 4mer Motifs on
Immunostimulatory Activity
[0354] The position of the 4mer motif within the poly A backbone
had little impact on the immunostimulatory activity of the
respective oligonucleotide (FIG. 7). Only a slight decrease (12.6%)
in IFN-.alpha. induction was seen, when the 4mer motif was moved to
5' end of the oligonucleotide, while positioning of the 4mer motif
at the 3' end resulted in a decrease of 28.8% in IFN-.alpha.
induction. Moving the motif two nucleotides to the 5' end from the
center position resulted in an almost identical IFN-.alpha.
inducing activity.
[0355] Moreover, no inhibitory effect was seen, when
non-stimulatory motifs were introduced into ssRNA oligonucleotides
that contained the 4mer motif 5'-GUCA-3' (data not shown). More
importantly, when additional 5'-GUCA-3' motifs were introduced into
a ssRNA oligonucleotide, no further increase in IFN-.alpha.
induction could be observed (FIG. 10).
Example 14
Identification of G-U-Pyrimidine as the Optimal IFN-.alpha.
Inducing RNA Motif Using a ssRNA Oligonucleotide Library
Encompassing all Possible 4mer Motifs
[0356] The approach of gradually refining a stimulatory motif by
permutation of the adjoining bases is based on the assumption that
the exact succession of specific bases is critical for the
stimulatory capacity of the sequence. The toleration of per se
"non-stimulatory inserts" into an active sequence cannot be
accounted for by this experimental setup. Moreover, this approach
would miss stimulatory motifs if the sequential combination of
several by itself non-stimulatory bases could synergize to render a
potent motif. To test for these possibilities a library of ssRNA
oligonucleotides was designed that encompassed all possible 4mer
motifs in the centre of a poly A oligonucleotide. In view of the
fact that flanking A residues can be part of a 4mer RNA sequence
motif, only 193 ssRNA oligonucleotides (Table 1) were needed to
cover all 256 possible 4mer motifs.
[0357] All 193 ssRNA oligonucleotides were tested on PBMC from six
individual healthy donors. RNA9.2sense (5'-AGCUUAACCUGUCCUUCAA-3')
was included as a positive control on all cell culture plates and
was used as a reference for the oligonucleotides tested
(RNA9.2sense=1, all data are expressed as fold values). As
typically performed for large data sets such as gene array data, a
global normalization to the mean was performed for each individual
donor by subtracting the mean of all data from a particular donor
from the individual raw data. This allowed to control for the
observed inter individual variability between the donors and made
it possible to summarize all donors as mean values.+-.SEM. Thus due
to the normalization, a negative value was obtained for all
oligonucleotides that were below the immunostimulatory activity of
the mean of all oligonucleotides, whereas for all oligonucleotides
that were above the immunostimulatory activity of the mean a
positive value was obtained. A colored output was chosen to give an
overview on all obtained data in one graph in ascending order (FIG.
11A), while the corresponding mean values are depicted next to it
(FIG. 11B). A complete list of all data with the respective
sequence information is depicted in FIG. 3. Confirming the validity
of our prior approach, the 4mer motif 5'-GUCA-3' turned out to be
the second highest hit in the obtained data set, whereas only the
motif 5'-GUUC-3' turned out to be more active in terms of
IFN-.alpha. induction.
[0358] To systematically identify motifs or patterns that were
associated with high or low IFN-.alpha. induction, a statistical
analysis was performed by analyzing the occurrence of all possible
3mer motifs within the tested oligonucleotide library. For all 3mer
motifs the mean level of IFN-.alpha. induction was calculated by
grouping all oligonucleotides that contained the respective 3mer
motif.
[0359] For example the 3mer motif 5'-GUC-3' was contained in ssRNA
oligonucleotides ANP 35, 83, 131, 137, 138, 139 and 179 with
respective IFN-.alpha. induction levels of 1.33, 0.68, 0.93, 0.79,
0.44, 0.84 and 0.73. The mean IFN-.alpha. induction level of the
3mer motif 5'-GUC-3' was thus calculated to be 0.82 with a standard
error of mean of 0.10.
[0360] 3mer motifs that were gapped by one nucleotide between
either the first and the second nucleotide position or the second
and third nucleotide position were also included in this analysis.
A two-tailed T-Test was used to identify motifs that were either
significantly higher or lower in IFN-.alpha. induction than the
particular motif analyzed.
[0361] For ungapped 3mer motifs, the highest mean level of
IFN-.alpha. induction was obtained for the motif 5'-GUU-3' (0.87)
followed by the motif 5'-GUC-3' (0.82). Within 3mer motifs that
contained a nucleotide gap between the first and second position
5'-GNUC-3' (0.87) and 5'-GNUU-3' (0.72) were the two highest hits,
where N represents any one nucleotide A, G, U or C. Correspondingly
5'-GUNU-3' (0.83) and 5'-GUNC-3' (0.72) were the two most potent
3mer motifs within the group of 3mer motifs, which had a nucleotide
gap between the second and the third base position (FIG. 12). A
detailed list of all motifs and the respective mean levels of
IFN-.alpha. induction is given in Table 12.
[0362] Among the top 5% of the tested ssRNA oligonucleotide
library, all oligonucleotides contained at least one of the
above-mentioned most potent motifs and this was also true for 79%
of all top 10% oligonucleotides (FIG. 13). The mean level of
IFN-.alpha. induction for all oligonucleotides that contained at
least one of the above motifs was calculated to be 0.72.+-.0.09
compared to -0.09.+-.0.01 for the rest of the oligonucleotides.
Altogether this analysis was able to identify the motif
G-U-Pyrimidine with a one-gap tolerance between either the first
and the second or the second and the third position as a potent
motif for RNA-mediated IFN-.alpha. induction in the human
system.
Example 15
Comparison of Immunostimulatory Activity
[0363] Comparing the motif 5'-GUUC-3' on a poly A backbone to
previously published ssRNA oligonucleotides with high IFN-.alpha.
inducing activity revealed an almost 1.4 fold higher level of
IFN-.alpha. induction than 9.2sense 5'-AGCUUAACCUGUCCUUCAA-3'
(Hornung et al. Nat Med 11:263:270), 1.5 fold higher level than
RNA40 5'-GCCCGUCUGUUGUGUGACUC-3' (Heil et al. Science
303:1526-1529) and a more than 2.5 fold higher activity than p-Gal
control sense 5'-UUGAUGUGUUUAGUCGCUA-3' (Judge et al. Nat Biotech
23:457-462) (FIG. 14).
Example 16
Using the Obtained Motif Information to Predict Low or High
IFN-.alpha. Inducing ssRNA Oligonucleotides
[0364] An analysis of published ssRNA oligonucleotides that were
described to induce IFN-.alpha. indicated a good correlation with
our motif information. To systematically predict the IFN-.alpha.
inducing activity of a ssRNA oligonucleotide, an algorithm was
established based on the occurrence of 3mer motifs 5'-NNN-3'. Since
above data had indicated that the major IFN-.alpha. inducing
activity of a ssRNA oligonucleotide was independent of the position
of the stimulatory motif and the presence of additional stimulatory
or inhibitory motifs, an algorithm was developed that predicted the
IFN-.alpha. inducting activity by accounting for the highest
stimulatory motif within the oligonucleotide independent of its
position. Only motifs that had been shown to significantly
correlate with high or low IFN-.alpha. inducing activity were
included in the algorithm: 18 ungapped 3mer motifs (5'-NNN-3'),
indicated by "*" or "**" in Table 12A. Thus for a given
oligonucleotide, a predicted IFN-.alpha. inducing activity was
calculated by analyzing the occurrence of all 3mer motifs within
this oligonucleotide and subsequently by assigning the highest
obtained mean IFN-.alpha. induction level to this respective
oligonucleotide.
[0365] Applying this algorithm (i.e., the "simplified method") to
our own data set resulted in a correlation coefficient of 0.80 for
the comparison of the predicted and the measured data (FIG.
15).
[0366] The predictive quality of this algorithm to define low
IFN-.alpha. inducing ssRNA oligonucleotides was then tested on the
193 oligo data set. Low inducing oligonucleotides were predefined
by an IFN-.alpha. induction level below the mean of all
oligonucleotides. Various threshold levels for the prediction
algorithm were tested for both for the positive predictive value
and the sensitivity to identify ssRNA oligonucleotides below the
mean IFN-.alpha. of all oligonucleotides (FIG. 16). A high positive
predictive value and a yet high sensitivity was obtained when the
threshold of the prediction algorithm was set at 0.11 (FIG. 16B,
upper right panel). 118 oligonucleotides had a calculated predicted
IFN-.alpha. induction level below the threshold of 0.11 and 117 of
these oligonucleotides had the expected measured IFN-.alpha. level
below 0 (positive predictive value of 99.15%). Only 28
oligonucleotides of a total of 145 oligonucleotides were not
detected using the prediction (sensitivity of 80.69%). Using the
prediction algorithm with the threshold of 0.11 therefore allowed
to predict a large percentage of oligonucleotides that would be
below the desired level of 0 with high accuracy.
[0367] Applying this algorithm to more complex oligonucleotides
resulted in a considerable lower percentage of oligonucleotides
that met the above criteria. Approximately 10% of a random pool of
19mer oligonucleotides fell below the threshold of 0.11 when
analyzed using the IFN-.alpha. prediction algorithm (data not
shown). When a random pool of 19mer duplexes was analyzed,
approximately 1% of all duplexes were comprised of single stranded
RNA oligonucleotides that were both below the threshold of
0.11.
Example 17
Preparing siRNA with High or Low Immunostimulatory Activity
[0368] To address the applicability of this algorithm for the
identification of non-stimulatory RNA oligonucleotides, a panel of
siRNA duplexes was designed to target the mRNA of human TLR9. From
a total pool of 3850 siRNA duplexes that were considered, 116 could
be identified (3.01%) that had a calculated predicted IFN-.alpha.
induction below the threshold of 0.11 according to the "simplified
method". These 116 predicted siRNA duplexes were distributed over
21 different target sites within in the mRNA, whereas seven major
sites could be identified that could be targeted by more than five
consecutive siRNA duplexes. Three different siRNA duplexes were
chosen to target TLR9 using the above described algorithm with
putatively low IFN-.alpha. induction (TLR9.sub.--271,
TLR9.sub.--1122 and TLR9.sub.--1949), whereas three different siRNA
duplexes were picked that contained at least one strand with
predicted high IFN-.alpha. induction (TLR9.sub.--1019,
TLR9.sub.--1302 and TLR9.sub.--1949). Altogether eight ssRNA
oligonucleotides with presumably low IFN-.alpha. induction
(TLR9.sub.--271 sense, TLR9.sub.--271 antisense, TLR9.sub.--1019
sense, TLR9.sub.--1122 sense, TLR9.sub.--1122 antisense,
TLR9.sub.--1302 antisense, TLR9.sub.--1949 sense, TLR9.sub.--1949
antisense) and four ssRNA oligonucleotides with high IFN-.alpha.
induction (TLR9.sub.--1019 antisense, TLR9.sub.--1302 sense,
TLR9.sub.--1500 sense anf TLR9.sub.--1500 antisense) were contained
in this selection (FIG. 17).
[0369] The functionality of theses siRNA duplexes in terms of
posttranscriptional gene silencing was assessed by analyzing the
knock down activity of TLR9 expression (FIG. 18). Two siRNA
duplexes with good knock down activity could be identified within
both groups of siRNA duplexes.
[0370] When analyzing the IFN-.alpha. induction of both the single
stranded components and the respective siRNA duplexes, a high
accuracy of the IFN-.alpha. prediction algorithm could be seen. Of
all eight ssRNA oligonucleotides predicted to be low in IFN-.alpha.
induction, seven oligonucleotides (TLR9.sub.--271 antisense,
TLR9.sub.--1019 sense, TLR9.sub.--1122 sense, TLR9.sub.--1122
antisense, TLR9.sub.--1302 antisense, TLR9.sub.--1949 sense,
TLR9.sub.--1949 antisense) showed negligible to absent IFN-.alpha.
induction, whereas one oligonucleotide (TLR9.sub.--271 sense)
showed minimal IFN-.alpha. induction. This was also true for the
respective siRNA duplexes: TLR9.sub.--1122 and TLR9.sub.--1949
duplexes showed negligible to absent IFN-.alpha. induction, and
TLR9.sub.--271 duplex showed minimal IFN-.alpha. induciton.
Likewise, all ssRNA oligonucleotides predicted to be high in
IFN-.alpha. induction showed a strong IFN-.alpha. response
(TLR9.sub.--1019 antisense, TLR9.sub.--1302 sense, TLR9.sub.--1500
sense anf TLR9.sub.--1500 antisense). As described previously,
within a siRNA duplex, the strong induction of IFN-.alpha. by
either one component dictated the immunostimulatory activity of the
whole siRNA duplex. TLR9.sub.--1019, TLR9.sub.--1032 and
TLR9.sub.--1500 duplexes all showed high IFN-.alpha. induction.
[0371] Altogether these results indicated that using a motif-based
algorithm we are able to rationally design both stimulatory and
non-stimulatory functional siRNA duplexes.
Example 18
Systematic and Automated Identification of siRNA with Desired
Immunolostimulatory Activity
[0372] Based on the algorithm described in example 17 (i.e., the
"simplified method"), a computer program was written that applies
the algorithm to all possible siRNA duplexes targeting all human
RNA transcripts (50421 as of 09/2006) as published by the National
Center for Biotechnology Information (NCBI). Each entry into the
NCBI database
(ftp://ftp.ncbi.nih.gov/refseq/H_sapiens/mRNA_Prot/human.rna.fna.gz)
of all listed human RNA transcripts was analyzed the following way:
A list of all possible 19mer siRNA duplexes targeting a given RNA
transcript was generated. Of all siRNA duplexes the IFN-.alpha.
induction of both the sense and the antisense strand was predicted
using the method described in example 17. The obtained data is
stored in a database (CD-ROM) and can be retrieved by a search
engine. Using the search interface, the user can pick the
transcript of interest (alphabetical index of all RNA transcripts
targeted by siRNAs) and then adjust the level of threshold to
identify siRNA duplexes that are of either low, intermediate or
high in immunostimulatory activity (FIG. 19A). For example, using
the threshold of 0.11 as described in example 17, a set of siRNA
duplexes was identified for Homo sapiens vascular endothelial
growth factor (VEGF) transcript variant 1 mRNA
(NM.sub.--001025366.1) with low immunostimulatory activity for both
the sense and the antisense strand (FIG. 19B).
TABLE-US-00016 TABLE 1 ssRNA oligonucleotides containing all
possible 4 mer motifs on the poly a backbone. Name Sequence
ANP-Oligo 001 AAAAAAAAAAAAAAAAAAA ANP-Oligo 002 AAAAAAAACAAAAAAAAAA
ANP-Oligo 003 AAAAAAAAGAAAAAAAAAA ANP-Oligo 004 AAAAAAAAUAAAAAAAAAA
ANP-Oligo 005 AAAAAAAACCAAAAAAAAA ANP-Oligo 006 AAAAAAAACGAAAAAAAAA
ANP-Oligo 007 AAAAAAAACUAAAAAAAAA ANP-Oligo 008 AAAAAAAAGCAAAAAAAAA
ANP-Oligo 009 AAAAAAAAGGAAAAAAAAA ANP-Oligo 010 AAAAAAAAGUAAAAAAAAA
ANP-Oligo 011 AAAAAAAAUCAAAAAAAAA ANP-Oligo 012 AAAAAAAAUGAAAAAAAAA
ANP-Oligo 013 AAAAAAAAUUAAAAAAAAA ANP-Oligo 014 AAAAAAAACACAAAAAAAA
ANP-Oligo 015 AAAAAAAACAGAAAAAAAA ANP-Oligo 016 AAAAAAAACAUAAAAAAAA
ANP-Oligo 017 AAAAAAAACCCAAAAAAAA ANP-Oligo 018 AAAAAAAACCGAAAAAAAA
ANP-Oligo 019 AAAAAAAACCUAAAAAAAA ANP-Oligo 020 AAAAAAAACGCAAAAAAAA
ANP-Oligo 021 AAAAAAAACGGAAAAAAAA ANP-Oligo 022 AAAAAAAACGUAAAAAAAA
ANP-Oligo 023 AAAAAAAACUCAAAAAAAA ANP-Oligo 024 AAAAAAAACUGAAAAAAAA
ANP-Oligo 025 AAAAAAAACUUAAAAAAAA ANP-Oligo 026 AAAAAAAAGACAAAAAAAA
ANP-Oligo 027 AAAAAAAAGAGAAAAAAAA ANP-Oligo 028 AAAAAAAAGAUAAAAAAAA
ANP-Oligo 029 AAAAAAAAGCCAAAAAAAA ANP-Oligo 030 AAAAAAAAGCGAAAAAAAA
ANP-Oligo 031 AAAAAAAAGCUAAAAAAAA ANP-Oligo 032 AAAAAAAAGGCAAAAAAAA
ANP-Oligo 033 AAAAAAAAGGGAAAAAAAA ANP-Oligo 034 AAAAAAAAGGUAAAAAAAA
ANP-Oligo 035 AAAAAAAAGUCAAAAAAAA ANP-Oligo 036 AAAAAAAAGUGAAAAAAAA
ANP-Oligo 037 AAAAAAAAGUUAAAAAAAA ANP-Oligo 038 AAAAAAAAUACAAAAAAAA
ANP-Oligo 039 AAAAAAAAUAGAAAAAAAA ANP-Oligo 040 AAAAAAAAUAUAAAAAAAA
ANP-Oligo 041 AAAAAAAAUCCAAAAAAAA ANP-Oligo 042 AAAAAAAAUCGAAAAAAAA
ANP-Oligo 043 AAAAAAAAUCUAAAAAAAA ANP-Oligo 044 AAAAAAAAUGCAAAAAAAA
ANP-Oligo 045 AAAAAAAAUGGAAAAAAAA ANP-Oligo 046 AAAAAAAAUGUAAAAAAAA
ANP-Oligo 047 AAAAAAAAUUCAAAAAAAA ANP-Oligo 048 AAAAAAAAUUGAAAAAAAA
ANP-Oligo 049 AAAAAAAAUUUAAAAAAAA ANP-Oligo 050 AAAAAAACAACAAAAAAAA
ANP-Oligo 051 AAAAAAACAAGAAAAAAAA ANP-Oligo 052 AAAAAAACAAUAAAAAAAA
ANP-Oligo 053 AAAAAAACACCAAAAAAAA ANP-Oligo 054 AAAAAAACACGAAAAAAAA
ANP-Oligo 055 AAAAAAACACUAAAAAAAA ANP-Oligo 056 AAAAAAACAGCAAAAAAAA
ANP-Oligo 057 AAAAAAACAGGAAAAAAAA ANP-Oligo 058 AAAAAAACAGUAAAAAAAA
ANP-Oligo 059 AAAAAAACAUCAAAAAAAA ANP-Oligo 060 AAAAAAACAUGAAAAAAAA
ANP-Oligo 061 AAAAAAACAUUAAAAAAAA ANP-Oligo 062 AAAAAAACCACAAAAAAAA
ANP-Oligo 063 AAAAAAACCAGAAAAAAAA ANP-Oligo 064 AAAAAAACCAUAAAAAAAA
ANP-Oligo 065 AAAAAAACCCCAAAAAAAA ANP-Oligo 066 AAAAAAACCCGAAAAAAAA
ANP-Oligo 067 AAAAAAACCCUAAAAAAAA ANP-Oligo 068 AAAAAAACCGCAAAAAAAA
ANP-Oligo 069 AAAAAAACCGGAAAAAAAA ANP-Oligo 070 AAAAAAACCGUAAAAAAAA
ANP-Oligo 071 AAAAAAACCUCAAAAAAAA ANP-Oligo 072 AAAAAAACCUGAAAAAAAA
ANP-Oligo 073 AAAAAAACCUUAAAAAAAA ANP-Oligo 074 AAAAAAACGACAAAAAAAA
ANP-Oligo 075 AAAAAAACGAGAAAAAAAA ANP-Oligo 076 AAAAAAACGAUAAAAAAAA
ANP-Oligo 077 AAAAAAACGCCAAAAAAAA ANP-Oligo 078 AAAAAAACGCGAAAAAAAA
ANP-Oligo 079 AAAAAAACGCUAAAAAAAA ANP-Oligo 080 AAAAAAACGGCAAAAAAAA
ANP-Oligo 081 AAAAAAACGGGAAAAAAAA ANP-Oligo 082 AAAAAAACGGUAAAAAAAA
ANP-Oligo 083 AAAAAAACGUCAAAAAAAA ANP-Oligo 084 AAAAAAACGUGAAAAAAAA
ANP-Oligo 085 AAAAAAACGUUAAAAAAAA ANP-Oligo 086 AAAAAAACUACAAAAAAAA
ANP-Oligo 087 AAAAAAACUAGAAAAAAAA ANP-Oligo 088 AAAAAAACUAUAAAAAAAA
ANP-Oligo 089 AAAAAAACUCCAAAAAAAA ANP-Oligo 090 AAAAAAACUCGAAAAAAAA
ANP-Oligo 091 AAAAAAACUCUAAAAAAAA ANP-Oligo 092 AAAAAAACUGCAAAAAAAA
ANP-Oligo 093 AAAAAAACUGGAAAAAAAA ANP-Oligo 094 AAAAAAACUGUAAAAAAAA
ANP-Oligo 095 AAAAAAACUUCAAAAAAAA ANP-Oligo 096 AAAAAAACUUGAAAAAAAA
ANP-Oligo 097 AAAAAAACUUUAAAAAAAA ANP-Oligo 098 AAAAAAAGAACAAAAAAAA
ANP-Oligo 099 AAAAAAAGAAGAAAAAAAA ANP-Oligo 100 AAAAAAAGAAUAAAAAAAA
ANP-Oligo 101 AAAAAAAGACCAAAAAAAA ANP-Oligo 102 AAAAAAAGACGAAAAAAAA
ANP-Oligo 103 AAAAAAAGACUAAAAAAAA ANP-Oligo 104 AAAAAAAGAGCAAAAAAAA
ANP-Oligo 105 AAAAAAAGAGGAAAAAAAA ANP-Oligo 106 AAAAAAAGAGUAAAAAAAA
ANP-Oligo 107 AAAAAAAGAUCAAAAAAAA ANP-Oligo 108 AAAAAAAGAUGAAAAAAAA
ANP-Oligo 109 AAAAAAAGAUUAAAAAAAA ANP-Oligo 110 AAAAAAAGCACAAAAAAAA
ANP-Oligo 111 AAAAAAAGCAGAAAAAAAA ANP-Oligo 112 AAAAAAAGCAUAAAAAAAA
ANP-Oligo 113 AAAAAAAGCCCAAAAAAAA ANP-Oligo 114 AAAAAAAGCCGAAAAAAAA
ANP-Oligo 115 AAAAAAAGCCUAAAAAAAA ANP-Oligo 116 AAAAAAAGCGCAAAAAAAA
ANP-Oligo 117 AAAAAAAGCGGAAAAAAAA ANP-Oligo 118 AAAAAAAGCGUAAAAAAAA
ANP-Oligo 119 AAAAAAAGCUCAAAAAAAA ANP-Oligo 120 AAAAAAAGCUGAAAAAAAA
ANP-Oligo 121 AAAAAAAGCUUAAAAAAAA ANP-Oligo 122
AAAAAAAGGACAAAAAAAA
ANP-Oligo 123 AAAAAAAGGAGAAAAAAAA ANP-Oligo 124 AAAAAAAGGAUAAAAAAAA
ANP-Oligo 125 AAAAAAAGGCCAAAAAAAA ANP-Oligo 126 AAAAAAAGGCGAAAAAAAA
ANP-Oligo 127 AAAAAAAGGCUAAAAAAAA ANP-Oligo 128 AAAAAAAGGGCAAAAAAAA
ANP-Oligo 129 AAAAAAAGGGGAAAAAAAA ANP-Oligo 130 AAAAAAAGGGUAAAAAAAA
ANP-Oligo 131 AAAAAAAGGUCAAAAAAAA ANP-Oligo 132 AAAAAAAGGUGAAAAAAAA
ANP-Oligo 133 AAAAAAAGGUUAAAAAAAA ANP-Oligo 134 AAAAAAAGUACAAAAAAAA
ANP-Oligo 135 AAAAAAAGUAGAAAAAAAA ANP-Oligo 136 AAAAAAAGUAUAAAAAAAA
ANP-Oligo 137 AAAAAAAGUCCAAAAAAAA ANP-Oligo 138 AAAAAAAGUCGAAAAAAAA
ANP-Oligo 139 AAAAAAAGUCUAAAAAAAA ANP-Oligo 140 AAAAAAAGUGCAAAAAAAA
ANP-Oligo 141 AAAAAAAGUGGAAAAAAAA ANP-Oligo 142 AAAAAAAGUGUAAAAAAAA
ANP-Oligo 143 AAAAAAAGUUCAAAAAAAA ANP-Oligo 144 AAAAAAAGUUGAAAAAAAA
ANP-Oligo 145 AAAAAAAGUUUAAAAAAAA ANP-Oligo 146 AAAAAAAUAACAAAAAAAA
ANP-Oligo 147 AAAAAAAUAAGAAAAAAAA ANP-Oligo 148 AAAAAAAUAAUAAAAAAAA
ANP-Oligo 149 AAAAAAAUACCAAAAAAAA ANP-Oligo 150 AAAAAAAUACGAAAAAAAA
ANP-Oligo 151 AAAAAAAUACUAAAAAAAA ANP-Oligo 152 AAAAAAAUAGCAAAAAAAA
ANP-Oligo 153 AAAAAAAUAGGAAAAAAAA ANP-Oligo 154 AAAAAAAUAGUAAAAAAAA
ANP-Oligo 155 AAAAAAAUAUCAAAAAAAA ANP-Oligo 156 AAAAAAAUAUGAAAAAAAA
ANP-Oligo 157 AAAAAAAUAUUAAAAAAAA ANP-Oligo 158 AAAAAAAUCACAAAAAAAA
ANP-Oligo 159 AAAAAAAUCAGAAAAAAAA ANP-Oligo 160 AAAAAAAUCAUAAAAAAAA
ANP-Oligo 161 AAAAAAAUCCCAAAAAAAA ANP-Oligo 162 AAAAAAAUCCGAAAAAAAA
ANP-Oligo 163 AAAAAAAUCCUAAAAAAAA ANP-Oligo 164 AAAAAAAUCGCAAAAAAAA
ANP-Oligo 165 AAAAAAAUCGGAAAAAAAA ANP-Oligo 166 AAAAAAAUCGUAAAAAAAA
ANP-Oligo 167 AAAAAAAUCUCAAAAAAAA ANP-Oligo 168 AAAAAAAUCUGAAAAAAAA
ANP-Oligo 169 AAAAAAAUCUUAAAAAAAA ANP-Oligo 170 AAAAAAAUGACAAAAAAAA
ANP-Oligo 171 AAAAAAAUGAGAAAAAAAA ANP-Oligo 172 AAAAAAAUGAUAAAAAAAA
ANP-Oligo 173 AAAAAAAUGCCAAAAAAAA ANP-Oligo 174 AAAAAAAUGCGAAAAAAAA
ANP-Oligo 175 AAAAAAAUGCUAAAAAAAA ANP-Oligo 176 AAAAAAAUGGCAAAAAAAA
ANP-Oligo 177 AAAAAAAUGGGAAAAAAAA ANP-Oligo 178 AAAAAAAUGGUAAAAAAAA
ANP-Oligo 179 AAAAAAAUGUCAAAAAAAA ANP-Oligo 180 AAAAAAAUGUGAAAAAAAA
ANP-Oligo 181 AAAAAAAUGUUAAAAAAAA ANP-Oligo 182 AAAAAAAUUACAAAAAAAA
ANP-Oligo 183 AAAAAAAUUAGAAAAAAAA ANP-Oligo 184 AAAAAAAUUAUAAAAAAAA
ANP-Oligo 185 AAAAAAAUUCCAAAAAAAA ANP-Oligo 186 AAAAAAAUUCGAAAAAAAA
ANP-Oligo 187 AAAAAAAUUCUAAAAAAAA ANP-Oligo 188 AAAAAAAUUGCAAAAAAAA
ANP-Oligo 189 AAAAAAAUUGGAAAAAAAA ANP-Oligo 190 AAAAAAAUUGUAAAAAAAA
ANP-Oligo 191 AAAAAAAUUUCAAAAAAAA ANP-Oligo 192 AAAAAAAUUUGAAAAAAAA
ANP-Oligo 193 AAAAAAAUUUUAAAAAAAA
TABLE-US-00017 TABLE 2 Group 1 ssRNA-Oligonucleotides adjusted Name
Sequence 5' .fwdarw. 3' IFN-.alpha. index SEM ANP-Oligo 018
AAAAAAAACCGAAAAAAAA -0.23 0.03 ANP-Oligo 020 AAAAAAAACGCAAAAAAAA
-0.23 0.03 ANP-Oligo 029 AAAAAAAAGCCAAAAAAAA -0.23 0.03 ANP-Oligo
051 AAAAAAACAAGAAAAAAAA -0.23 0.03 ANP-Oligo 053
AAAAAAACACCAAAAAAAA -0.23 0.03 ANP-Oligo 075 AAAAAAACGAGAAAAAAAA
-0.23 0.03 ANP-Oligo 080 AAAAAAACGGCAAAAAAAA -0.23 0.03 ANP-Oligo
128 AAAAAAAGGGCAAAAAAAA -0.23 0.03 ANP-Oligo 130
AAAAAAAGGGUAAAAAAAA -0.23 0.03 ANP-Oligo 009 AAAAAAAAGGAAAAAAAAA
-0.23 0.03 ANP-Oligo 017 AAAAAAAACCCAAAAAAAA -0.23 0.03 ANP-Oligo
003 AAAAAAAAGAAAAAAAAAA -0.23 0.03 ANP-Oligo 081
AAAAAAACGGGAAAAAAAA -0.23 0.03 ANP-Oligo 113 AAAAAAAGCCCAAAAAAAA
-0.23 0.03 ANP-Oligo 014 AAAAAAAACACAAAAAAAA -0.23 0.03 ANP-Oligo
077 AAAAAAACGCCAAAAAAAA -0.23 0.03 ANP-Oligo 126
AAAAAAAGGCGAAAAAAAA -0.23 0.03 ANP-Oligo 125 AAAAAAAGGCCAAAAAAAA
-0.23 0.03 ANP-Oligo 050 AAAAAAACAACAAAAAAAA . -0.23 0.03 ANP-Oligo
015 AAAAAAAACAGAAAAAAAA -0.22 0.03 ANP-Oligo 114
AAAAAAAGCCGAAAAAAAA -0.22 0.03 ANP-Oligo 027 AAAAAAAAGAGAAAAAAAA
-0.22 0.03 ANP-Oligo 117 AAAAAAAGCGGAAAAAAAA -0.22 0.03 ANP-Oligo
006 AAAAAAAACGAAAAAAAAA -0.22 0.03 ANP-Oligo 005
AAAAAAAACCAAAAAAAAA -0.22 0.03 ANP-Oligo 069 AAAAAAACCGGAAAAAAAA
-0.22 0.03 ANP-Oligo 066 AAAAAAACCCGAAAAAAAA -0.22 0.03 ANP-Oligo
007 AAAAAAAACUAAAAAAAAA -0.22 0.03 ANP-Oligo 060
AAAAAAACAUGAAAAAAAA -0.22 0.03 ANP-Oligo 021 AAAAAAAACGGAAAAAAAA
-0.22 0.03 ANP-Oligo 042 AAAAAAAAUCGAAAAAAAA -0.22 0.03 ANP-Oligo
086 AAAAAAACUACAAAAAAAA -0.22 0.03 ANP-Oligo 064
AAAAAAACCAUAAAAAAAA -0.22 0.03 ANP-Oligo 102 AAAAAAAGACGAAAAAAAA
-0.22 0.03 ANP-Oligo 068 AAAAAAACCGCAAAAAAAA -0.22 0.03 ANP-Oligo
129 AAAAAAAGGGGAAAAAAAA -0.22 0.03 ANP-Oligo 008
AAAAAAAAGCAAAAAAAAA -0.22 0.03 ANP-Oligo 002 AAAAAAAACAAAAAAAAAA
-0.22 0.03 ANP-Oligo 038 AAAAAAAAUACAAAAAAAA -0.22 0.03 ANP-Oligo
026 AAAAAAAAGACAAAAAAAA -0.22 0.03 ANP-Oligo 116
AAAAAAAGCGCAAAAAAAA -0.22 0.03 ANP-Oligo 054 AAAAAAACACGAAAAAAAA
-0.22 0.03 ANP-Oligo 057 AAAAAAACAGGAAAAAAAA -0.22 0.03 ANP-Oligo
001 AAAAAAAAAAAAAAAAAAA -0.21 0.03 ANP-Oligo 074
AAAAAAACGACAAAAAAAA -0.21 0.03 ANP-Oligo 033 AAAAAAAAGGGAAAAAAAA
-0.21 0.03 ANP-Oligo 123 AAAAAAAGGAGAAAAAAAA -0.21 0.03 ANP-Oligo
059 AAAAAAACAUCAAAAAAAA -0.21 0.03 ANP-Oligo 110
AAAAAAAGCACAAAAAAAA -0.21 0.03 ANP-Oligo 065 AAAAAAACCCCAAAAAAAA
-0.21 0.03 ANP-Oligo 055 AAAAAAACACUAAAAAAAA -0.21 0.03 ANP-Oligo
122 AAAAAAAGGACAAAAAAAA -0.21 0.03 ANP-Oligo 104
AAAAAAAGAGCAAAAAAAA -0.21 0.03 ANP-Oligo 078 AAAAAAACGCGAAAAAAAA
-0.21 0.03 ANP-Oligo 032 AAAAAAAAGGCAAAAAAAA -0.21 0.04 ANP-Oligo
030 AAAAAAAAGCGAAAAAAAA -0.21 0.03 ANP-Oligo 004
AAAAAAAAUAAAAAAAAAA -0.21 0.03 ANP-Oligo 105 AAAAAAAGAGGAAAAAAAA
-0.21 0.03 ANP-Oligo 161 AAAAAAAUCCCAAAAAAAA -0.21 0.02 ANP-Oligo
061 AAAAAAACAUUAAAAAAAA -0.2 0.02 ANP-Oligo 041 AAAAAAAAUCCAAAAAAAA
-0.2 0.03 ANP-Oligo 063 AAAAAAACCAGAAAAAAAA -0.2 0.04 ANP-Oligo 072
AAAAAAACCUGAAAAAAAA -0.2 0.02 ANP-Oligo 101 AAAAAAAGACCAAAAAAAA
-0.2 0.04 ANP-Oligo 056 AAAAAAACAGCAAAAAAAA -0.2 0.04 ANP-Oligo 162
AAAAAAAUCCGAAAAAAAA -0.2 0.02 ANP-Oligo 099 AAAAAAAGAAGAAAAAAAA
-0.2 0.05 ANP-Oligo 111 AAAAAAAGCAGAAAAAAAA -0.2 0.04 ANP-Oligo 011
AAAAAAAAUCAAAAAAAAA -0.2 0.04 ANP-Oligo 062 AAAAAAACCACAAAAAAAA
-0.19 0.04 ANP-Oligo 016 AAAAAAAACAUAAAAAAAA -0.19 0.03 ANP-Oligo
177 AAAAAAAUGGGAAAAAAAA -0.19 0.03 ANP-Oligo 019
AAAAAAAACCUAAAAAAAA -0.19 0.03 ANP-Oligo 098 AAAAAAAGAACAAAAAAAA
-0.19 0.05 ANP-Oligo 052 AAAAAAACAAUAAAAAAAA -0.19 0.02 ANP-Oligo
089 AAAAAAACUCCAAAAAAAA -0.18 0.05 ANP-Oligo 067
AAAAAAACCCUAAAAAAAA -0.18 0.02 ANP-Oligo 040 AAAAAAAAUAUAAAAAAAA
-0.18 0.02 ANP-Oligo 039 AAAAAAAAUAGAAAAAAAA -0.18 0.02 ANP-Oligo
043 AAAAAAAAUCUAAAAAAAA -0.18 0.02 ANP-Oligo 073
AAAAAAACCUUAAAAAAAA -0.18 0.01 ANP-Oligo 024 AAAAAAAACUGAAAAAAAA
-0.17 0.02 ANP-Oligo 028 AAAAAAAAGAUAAAAAAAA -0.17 0.01 ANP-Oligo
103 AAAAAAAGACUAAAAAAAA -0.17 0.01 ANP-Oligo 091
AAAAAAACUCUAAAAAAAA -0.17 0.01 ANP-Oligo 158 AAAAAAAUCACAAAAAAAA
-0.17 0.02 ANP-Oligo 012 AAAAAAAAUGAAAAAAAAA -0.16 0.02 ANP-Oligo
163 AAAAAAAUCCUAAAAAAAA -0.15 0.03 ANP-Oligo 025
AAAAAAAACUUAAAAAAAA -0.15 0.02 ANP-Oligo 112 AAAAAAAGCAUAAAAAAAA
-0.15 0.01 ANP-Oligo 070 AAAAAAACCGUAAAAAAAA -0.14 0.02 ANP-Oligo
172 AAAAAAAUGAUAAAAAAAA -0.14 0.03 ANP-Oligo 150
AAAAAAAUACGAAAAAAAA -0.14 0.04 ANP-Oligo 146 AAAAAAAUAACAAAAAAAA
-0.14 0.03 ANP-Oligo 115 AAAAAAAGCCUAAAAAAAA -0.14 0.01 ANP-Oligo
160 AAAAAAAUCAUAAAAAAAA -0.13 0.02 ANP-Oligo 151
AAAAAAAUACUAAAAAAAA -0.13 0.03 ANP-Oligo 013 AAAAAAAAUUAAAAAAAAA
-0.13 0.03 ANP-Oligo 090 AAAAAAACUCGAAAAAAAA -0.13 0.03 ANP-Oligo
048 AAAAAAAAUUGAAAAAAAA -0.13 0.02 ANP-Oligo 092
AAAAAAACUGCAAAAAAAA -0.13 0.02 ANP-Oligo 093 AAAAAAACUGGAAAAAAAA
-0.13 0.03 ANP-Oligo 031 AAAAAAAAGCUAAAAAAAA -0.13 0.02 ANP-Oligo
157 AAAAAAAUAUUAAAAAAAA -0.12 0.02 ANP-Oligo 108
AAAAAAAGAUGAAAAAAAA -0.12 0.02 ANP-Oligo 076 AAAAAAACGAUAAAAAAAA
-0.12 0.03 ANP-Oligo 165 AAAAAAAUCGGAAAAAAAA -0.11 0.03 ANP-Oligo
087 AAAAAAACUAGAAAAAAAA -0.11 0.01 ANP-Oligo 109
AAAAAAAGAUUAAAAAAAA -0.11 0.01 ANP-Oligo 183 AAAAAAAUUAGAAAAAAAA
-0.11 0.05 ANP-Oligo 127 AAAAAAAGGCUAAAAAAAA -0.11 0.03 ANP-Oligo
079 AAAAAAACGCUAAAAAAAA -0.1 0.02 ANP-Oligo 088 AAAAAAACUAUAAAAAAAA
-0.1 0.03 ANP-Oligo 159 AAAAAAAUCAGAAAAAAAA -0.1 0.05 ANP-Oligo 152
AAAAAAAUAGCAAAAAAAA -0.1 0.04 ANP-Oligo 084 AAAAAAACGUGAAAAAAAA
-0.1 0.03 ANP-Oligo 184 AAAAAAAUUAUAAAAAAAA -0.1 0.03 ANP-Oligo 175
AAAAAAAUGCUAAAAAAAA -0.1 0.03 ANP-Oligo 164 AAAAAAAUCGCAAAAAAAA
-0.09 0.04 ANP-Oligo 149 AAAAAAAUACCAAAAAAAA -0.09 0.06 ANP-Oligo
185 AAAAAAAUUCCAAAAAAAA -0.08 0.05 ANP-Oligo 044
AAAAAAAAUGCAAAAAAAA -0.08 0.03
ANP-Oligo 022 AAAAAAAACGUAAAAAAAA -0.08 0.02 ANP-Oligo 049
AAAAAAAAUUUAAAAAAAA -0.08 0.02 ANP-Oligo 147 AAAAAAAUAAGAAAAAAAA
-0.07 0.06 ANP-Oligo 120 AAAAAAAGCUGAAAAAAAA -0.07 0.03 ANP-Oligo
107 AAAAAAAGAUCAAAAAAAA -0.07 0.05 ANP-Oligo 118
AAAAAAAGCGUAAAAAAAA -0.07 0.03 ANP-Oligo 170 AAAAAAAUGACAAAAAAAA
-0.07 0.06 ANP-Oligo 124 AAAAAAAGGAUAAAAAAAA -0.07 0.05 ANP-Oligo
148 AAAAAAAUAAUAAAAAAAA -0.07 0.05 ANP-Oligo 097
AAAAAAACUUUAAAAAAAA -0.07 0.02 ANP-Oligo 156 AAAAAAAUAUGAAAAAAAA
-0.06 0.04 ANP-Oligo 045 AAAAAAAAUGGAAAAAAAA -0.06 0.06 ANP-Oligo
171 AAAAAAAUGAGAAAAAAAA -0.05 0.08 ANP-Oligo 173
AAAAAAAUGCCAAAAAAAA -0.05 0.05 ANP-Oligo 174 AAAAAAAUGCGAAAAAAAA
-0.05 0.07 ANP-Oligo 153 AAAAAAAUAGGAAAAAAAA -0.05 0.05 ANP-Oligo
100 AAAAAAAGAAUAAAAAAAA -0.04 0.02 ANP-Oligo 169
AAAAAAAUCUUAAAAAAAA -0.04 0.05 ANP-Oligo 155 AAAAAAAUAUCAAAAAAAA
-0.03 0.04 ANP-Oligo 010 AAAAAAAAGUAAAAAAAAA -0.03 0.04 ANP-Oligo
036 AAAAAAAAGUGAAAAAAAA -0.02 0.04 ANP-Oligo 082
AAAAAAACGGUAAAAAAAA -0.01 0.03 ANP-Oligo 168 AAAAAAAUCUGAAAAAAAA
-0.01 0.06
TABLE-US-00018 TABLE 3 Group 2 ssRNA-Oligonucleotides adjusted Name
Sequence 5' .fwdarw. 3' IFN-.alpha. index SEM ANP-Oligo 071
AAAAAAACCUCAAAAAAAA 0 0.05 ANP-Oligo 182 AAAAAAAUUACAAAAAAAA 0.01
0.1 ANP-Oligo 096 AAAAAAACUUGAAAAAAAA 0.02 0.06 ANP-Oligo 085
AAAAAAACGUUAAAAAAAA 0.02 0.04 ANP-Oligo 176 AAAAAAAUGGCAAAAAAAA
0.04 0.04 ANP-Oligo 187 AAAAAAAUUCUAAAAAAAA 0.05 0.04 ANP-Oligo 166
AAAAAAAUCGUAAAAAAAA 0.07 0.04 ANP-Oligo 023 AAAAAAAACUCAAAAAAAA
0.08 0.06 ANP-Oligo 193 AAAAAAAUUUUAAAAAAAA 0.13 0.08 ANP-Oligo 188
AAAAAAAUUGCAAAAAAAA 0.14 0.04 ANP-Oligo 132 AAAAAAAGGUGAAAAAAAA
0.18 0.04 ANP-Oligo 106 AAAAAAAGAGUAAAAAAAA 0.21 0.07 ANP-Oligo 095
AAAAAAACUUCAAAAAAAA 0.22 0.07 ANP-Oligo 186 AAAAAAAUUCGAAAAAAAA
0.22 0.09 ANP-Oligo 058 AAAAAAACAGUAAAAAAAA 0.22 0.09 ANP-Oligo 167
AAAAAAAUCUCAAAAAAAA 0.23 0.07 ANP-Oligo 189 AAAAAAAUUGGAAAAAAAA
0.24 0.12 ANP-Oligo 047 AAAAAAAAUUCAAAAAAAA 0.27 0.09 ANP-Oligo 135
AAAAAAAGUAGAAAAAAAA 0.3 0.04 ANP-Oligo 154 AAAAAAAUAGUAAAAAAAA 0.32
0.03 ANP-Oligo 136 AAAAAAAGUAUAAAAAAAA 0.36 0.07 ANP-Oligo 134
AAAAAAAGUACAAAAAAAA 0.37 0.08 ANP-Oligo 140 AAAAAAAGUGCAAAAAAAA
0.38 0.04 ANP-Oligo 141 AAAAAAAGUGGAAAAAAAA 0.39 0.06 ANP-Oligo 178
AAAAAAAUGGUAAAAAAAA 0.41 0.03 ANP-Oligo 192 AAAAAAAUUUGAAAAAAAA
0.42 0.11 ANP-Oligo 138 AAAAAAAGUCGAAAAAAAA 0.44 0.05 ANP-Oligo 034
AAAAAAAAGGUAAAAAAAA 0.46 0.05 ANP-Oligo 180 AAAAAAAUGUGAAAAAAAA
0.46 0.07 ANP-Oligo 191 AAAAAAAUUUCAAAAAAAA 0.54 0.13 ANP-Oligo 046
AAAAAAAAUGUAAAAAAAA 0.59 0.04 ANP-Oligo 037 AAAAAAAAGUUAAAAAAAA
0.62 0.13 ANP-Oligo 181 AAAAAAAUGUUAAAAAAAA 0.64 0.07 ANP-Oligo 083
AAAAAAACGUCAAAAAAAA 0.68 0.15 ANP-Oligo 094 AAAAAAACUGUAAAAAAAA
0.73 0.09 ANP-Oligo 179 AAAAAAAUGUCAAAAAAAA 0.73 0.04 ANP-Oligo 190
AAAAAAAUUGUAAAAAAAA 0.74 0.07 ANP-Oligo 121 AAAAAAAGCUUAAAAAAAA
0.77 0.07 ANP-Oligo 137 AAAAAAAGUCCAAAAAAAA 0.79 0.06 ANP-Oligo 139
AAAAAAAGUCUAAAAAAAA 0.84 0.08 ANP-Oligo 131 AAAAAAAGGUCAAAAAAAA
0.93 0.2 ANP-Oligo 142 AAAAAAAGUGUAAAAAAAA 0.96 0.08 ANP-Oligo 133
AAAAAAAGGUUAAAAAAAA 1.04 0.13 ANP-Oligo 145 AAAAAAAGUUUAAAAAAAA
1.17 0.08 ANP-Oligo 144 AAAAAAAGUUGAAAAAAAA 1.22 0.08 ANP-Oligo 119
AAAAAAAGCUCAAAAAAAA 1.26 0.15 ANP-Oligo 035 AAAAAAAAGUCAAAAAAAA
1.33 0.28 ANP-Oligo 143 AAAAAAAGUUCAAAAAAAA 1.35 0.11
TABLE-US-00019 TABLE 4 ssRNA oligonucleotides - FIG. 7A Name
Sequence 5' .fwdarw. 3' ANP-Oligo 194 AAGUCAAAAAAAAAAAAAA ANP-Oligo
195 AAAAAAGUCAAAAAAAAAA ANP-Oligo 035 AAAAAAAAGUCAAAAAAAA ANP-Oligo
196 AAAAAAAAAAGUCAAAAAA ANP-Oligo 197 AAAAAAAAAAAAAAGUCAA
TABLE-US-00020 TABLE 5 ssRNA oligonucleotides - FIG 7B Name
Sequence 5' .fwdarw. 3' ANP-Oligo 035 AAAAAAAAGUCAAAAAAAA ANP-Oligo
198 AAAAAAAAGUCACAAAAAA ANP-Oligo 199 AAAAAAAAGUCAGAAAAAA ANP-Oligo
200 AAAAAAAAGUCAUAAAAAA ANP-Oligo 083 AAAAAAACGUCAAAAAAAA ANP-Oligo
201 AAAAAAACGUCACAAAAAA ANP-Oligo 202 AAAAAAACGUCAGAAAAAA ANP-Oligo
203 AAAAAAACGUCAUAAAAAA ANP-Oligo 131 AAAAAAAGGUCAAAAAAAA ANP-Oligo
204 AAAAAAAGGUCACAAAAAA ANP-Oligo 205 AAAAAAAGGUCAGAAAAAA ANP-Oligo
206 AAAAAAAGGUCAUAAAAAA ANP-Oligo 179 AAAAAAAUGUCAAAAAAAA ANP-Oligo
207 AAAAAAAUGUCACAAAAAA ANP-Oligo 208 AAAAAAAUGUCAGAAAAAA ANP-Oligo
209 AAAAAAAUGUCAUAAAAAA
TABLE-US-00021 TABLE 6 ssRNA oligonucleotides -- FIG. 8A Oligo-name
Sequence 5' .fwdarw. 3' 9.2 sense AGCUUAACCUGUCCUUCAA L7A
AAAAAAACCUGUCCUUCAA L8A AAAAAAAACUGUCCUUCAA L9A AAAAAAAAAUGUCCUUCAA
L10A AAAAAAAAAAGUCCUUCAA L11A AAAAAAAAAAAUCCUUCAA L12A
AAAAAAAAAAAACCUUCAA R9A AGCUUAACCUAAAAAAAAA R8A AGCUUAACCUGAAAAAAAA
R7A AGCUUAACCUGUAAAAAAA R6A AGCUUAACCUGUCAAAAAA R5A
AGCUUAACCUGUCCAAAAA R4A AGCUUAACCUGUCCUAAAA R3A
AGCUUAACCUGUCCUUAAA
TABLE-US-00022 TABLE 12 3mer motifs and their mean levels of IFN-a
induction A. 3mer motifs 5'-NNN-3' Mean (IFN-.alpha. point Motif
Occurrences score) Sem p-value AAA 2192 0.00 0.01 0.389 AAC 67
-0.14 0.02 ** 0.001 AAG 67 0.11 0.06 ** 0.009 AAU 67 0.01 0.03
0.841 ACA 31 -0.17 0.02 ** 0.007 ACC 19 -0.19 0.01 * 0.017 ACG 19
-0.12 0.05 0.128 ACU 19 -0.07 0.05 0.407 AGA 31 -0.14 0.02 * 0.021
AGC 19 -0.05 0.09 0.508 AGG 19 -0.01 0.09 0.877 AGU 19 0.59 0.10 **
<0.001 AUA 31 -0.10 0.02 0.118 AUC 19 -0.11 0.03 0.176 AUG 19
0.08 0.07 0.318 AUU 19 0.09 0.06 0.253 CAA 67 0.00 0.05 0.913 CAC 7
-0.21 0.01 0.11 CAG 7 -0.13 0.06 0.313 CAU 7 -0.19 0.01 0.143 CCA
19 -0.14 0.05 0.077 CCC 7 -0.21 0.01 0.102 CCG 7 -0.21 0.01 0.11
CCU 7 -0.15 0.03 0.252 CGA 19 -0.14 0.04 0.082 CGC 7 -0.19 0.02
0.155 CGG 7 -0.18 0.03 0.172 CGU 7 0.05 0.11 0.678 CUA 19 -0.09
0.05 0.251 CUC 7 0.16 0.19 0.229 CUG 7 0.00 0.12 0.979 CUU 7 0.08
0.12 0.529 GAA 67 -0.08 0.03 * 0.044 GAC 7 -0.19 0.02 0.153 GAG 7
-0.13 0.06 0.306 GAU 7 -0.11 0.01 0.385 GCA 19 -0.12 0.04 0.114 GCC
7 -0.19 0.03 0.149 GCG 7 -0.17 0.03 0.184 GCU 7 0.22 0.21 0.094 GGA
19 -0.13 0.04 0.111 GGC 7 -0.17 0.04 0.194 GGG 7 -0.22 0.00 0.095
GGU 7 0.40 0.18 ** 0.002 GUA 19 0.27 0.08 ** <0.001 GUC 7 0.82
0.10 ** <0.001 GUG 7 0.32 0.13 * 0.014 GUU 7 0.87 0.18 **
<0.001 UAA 67 0.06 0.04 0.135 UAC 7 -0.06 0.08 0.647 UAG 7 0.01
0.08 0.94 UAU 7 -0.03 0.07 0.793 UCA 19 0.35 0.12 ** <0.001 UCC
7 -0.03 0.14 0.794 UCG 7 0.02 0.09 0.848 UCU 7 0.10 0.13 0.421 UGA
19 0.04 0.08 0.611 UGC 7 0.01 0.07 0.91 UGG 7 0.10 0.09 0.448 UGU 7
0.69 0.06 ** <0.001 UUA 19 0.17 0.10 * 0.036 UUC 7 0.37 0.18 **
0.005 UUG 7 0.38 0.18 ** 0.004 UUU 7 0.32 0.17 * 0.013 B. 3mer
motifs 5'-NN-N-3' Motif Occurences Mean Sem p-value AANA 1864 -0.01
0.01 0.096 AANC 112 -0.12 0.02 ** <0.001 AANG 112 0.07 0.04 *
0.021 AANU 112 0.11 0.03 ** <0.001 ACNA 40 -0.17 0.02 ** 0.002
ACNC 16 -0.18 0.02 * 0.035 ACNG 16 -0.10 0.06 0.244 ACNU 16 -0.05
0.06 0.533 AG NA 40 -0.09 0.03 0.111 AGNC 16 0.06 0.12 0.46 AGNG 16
-0.02 0.09 0.805 AGNU 16 0.52 0.15 ** <0.001 AUNA 40 -0.11 0.02
* 0.038 AUNC 16 -0.07 0.04 0.398 AU NG 16 0.05 0.07 0.556 AUNU 16
0.19 0.08 * 0.027 CANA 76 -0.02 0.04 0.668 CANC 4 -0.22 0.01 0.209
CANG 4 -0.22 0.00 0.201 CANU 4 -0.10 0.11 0.577 CCNA 28 -0.16 0.04
* 0.015 CCNC 4 -0.16 0.05 0.365 CCNG 4 -0.21 0.01 0.216 CCNU 4
-0.18 0.02 0.295 CGNA 28 -0.14 0.03 * 0.036 CGNC 4 0.00 0.23 0.981
CGNG 4 -0.19 0.03 0.268 CGNU 4 -0.05 0.03 0.765 CUNA 28 0.01 0.07
0.896 CUNC 4 -0.08 0.10 0.649 CUNG 4 -0.09 0.04 0.616 CUNU 4 0.10
0.21 0.567 GANA 76 -0.09 0.03 * 0.017 GANC 4 -0.17 0.03 0.324 GANG
4 -0.19 0.02 0.281 GANU 4 -0.03 0.08 0.87 GCNA 28 -0.13 0.03 *
0.044 GCNC 4 0.15 0.37 0.38 GONG 4 -0.18 0.04 0.298 GCNU 4 0.10
0.22 0.548 GGNA 28 -0.10 0.04 0.131 GGNC 4 0.07 0.29 0.697 GGNG 4
-0.12 0.10 0.492 GGNU 4 0.16 0.30 0.353 GUNA 28 0.38 0.08 **
<0.001 GUNC 4 0.72 0.23 ** <0.001 GUNG 4 0.59 0.21 **
<0.001 GUNU 4 0.83 0.17 ** <0.001 UANA 76 0.06 0.04 0.15 UANC
4 -0.09 0.02 0.599 UANG 4 -0.08 0.02 0.641 UANU 4 0.00 0.11 0.999
UCNA 28 0.30 0.10 ** <0.001 UCNC 4 -0.06 0.10 0.738 UCNG 4 -0.11
0.04 0.541
UCNU 4 -0.07 0.05 0.706 UGNA 28 0.17 0.07 ** 0.008 UGNC 4 0.16 0.19
0.351 UGNG 4 0.04 0.14 0.817 UGNU 4 0.20 0.19 0.239 UUNA 28 0.30
0.09 ** <0.001 UUNC 4 0.15 0.14 0.377 UUNG 4 0.19 0.11 0.267
UUNU 4 0.21 0.18 0.228 C. 3mer motifs 5'-N-NN-3' Motif Occurences
Mean Sem p-value ANAA 1864 -0.01 0.01 0.107 ANAC 76 -0.14 0.02 **
<0.001 ANAG 76 0.09 0.05 * 0.019 ANAU 76 -0.01 0.03 0.78 ANCA 40
-0.18 0.01 ** 0.001 ANCC 28 -0.20 0.01 ** 0.003 ANCG 28 -0.13 0.03
* 0.048 ANCU 28 0.02 0.07 0.767 ANGA 40 -0.16 0.01 ** 0.004 ANGC 28
-0.08 0.06 0.207 ANGG 28 -0.04 0.07 0.533 ANGU 28 0.57 0.08 **
<0.001 ANUA 40 -0.05 0.03 0.366 ANUC 28 0.06 0.07 0.334 ANUG 28
0.18 0.07 ** 0.007 ANUU 28 0.27 0.08 ** <0.001 CNAA 112 -0.04
0.03 0.218 CNAC 4 -0.21 0.01 0.215 CNAG 4 -0.19 0.03 0.265 CNAU 4
-0.16 0.03 0.361 CNCA 16 -0.05 0.09 0.537 CNCC 4 -0.21 0.01 0.218
CNCG 4 -0.20 0.02 0.258 CNCU 4 -0.17 0.02 0.334 CNGA 16 -0.18 0.02
* 0.039 CNGC 4 -0.19 0.02 0.262 CNGG 4 -0.20 0.02 0.251 CNGU 4 0.20
0.19 0.244 CNUA 16 -0.07 0.06 0.389 CNUC 4 0.17 0.19 0.318 CNUG 4
-0.13 0.06 0.464 CNUU 4 -0.11 0.05 0.538 GNAA 112 -0.04 0.03 0.186
GNAC 4 -0.06 0.14 0.717 GNAG 4 -0.08 0.12 0.649 GNAU 4 0.02 0.11
0.89 GNCA 16 0.10 0.13 0.243 GNCC 4 0.03 0.25 0.842 GNCG 4 -0.06
0.17 0.745 GNCU 4 0.11 0.24 0.534 GNGA 16 -0.11 0.05 0.203 GNGC 4
-0.07 0.15 0.688 GNGG 4 -0.07 0.15 0.706 GNGU 4 0.22 0.26 0.207
GNUA 16 0.13 0.10 0.14 GNUC 4 0.87 0.33 ** <0.001 GNUG 4 0.30
0.31 0.08 GNUU 4 0.72 0.29 ** <0.001 UNAA 112 0.14 0.04 **
<0.001 UNAC 4 -0.09 0.04 0.603 UNAG 4 -0.08 0.01 0.626 UNAU 4
-0.11 0.02 0.522 UNCA 16 0.18 0.11 * 0.032 UNCC 4 -0.11 0.03 0.528
UNCG 4 -0.04 0.09 0.807 UNCU 4 -0.08 0.05 0.634 UNGA 16 0.14 0.09
0.113 UNGC 4 -0.01 0.06 0.975 UNGG 4 -0.03 0.09 0.86 UNGU 4 0.39
0.14 * 0.025 UNUA 16 0.29 0.12 ** 0.001 UNUC 4 0.37 0.17 * 0.032
UNUG 4 0.20 0.14 0.24 UNUU 4 0.15 0.17 0.375
TABLE-US-00023 TABLE 13 RNA oligonucleotide containing multiple
copies of GUCA Oligo-name Sequence 5' .fwdarw. 3' 9.2 sense
AGCUUAACCUGUCCUUCAA Poly GUCA GUCAAGUCAAGUCAAGUCAA ANP35
AAAAAAAAGUCAAAAAAAA
Sequence CWU 1
1
390119RNAArtificial SequenceSynthetic 1aaaaaaaaaa aaaaaaaaa
19219RNAArtificial SequenceSynthetic 2aaaaaaaaca aaaaaaaaa
19319RNAArtificial SequenceSynthetic 3aaaaaaaaga aaaaaaaaa
19419RNAArtificial SequenceSynthetic 4aaaaaaaaua aaaaaaaaa
19519RNAArtificial SequenceSynthetic 5aaaaaaaacc aaaaaaaaa
19619RNAArtificial SequenceSynthetic 6aaaaaaaacg aaaaaaaaa
19719RNAArtificial SequenceSynthetic 7aaaaaaaacu aaaaaaaaa
19819RNAArtificial SequenceSynthetic 8aaaaaaaagc aaaaaaaaa
19919RNAArtificial SequenceSynthetic 9aaaaaaaagg aaaaaaaaa
191019RNAArtificial SequenceSynthetic 10aaaaaaaagu aaaaaaaaa
191119RNAArtificial SequenceSynthetic 11aaaaaaaauc aaaaaaaaa
191219RNAArtificial SequenceSynthetic 12aaaaaaaaug aaaaaaaaa
191319RNAArtificial SequenceSynthetic 13aaaaaaaauu aaaaaaaaa
191419RNAArtificial SequenceSynthetic 14aaaaaaaaca caaaaaaaa
191519RNAArtificial SequenceSynthetic 15aaaaaaaaca gaaaaaaaa
191619RNAArtificial SequenceSynthetic 16aaaaaaaaca uaaaaaaaa
191719RNAArtificial SequenceSynthetic 17aaaaaaaacc caaaaaaaa
191819RNAArtificial SequenceSynthetic 18aaaaaaaacc gaaaaaaaa
191919RNAArtificial SequenceSynthetic 19aaaaaaaacc uaaaaaaaa
192019RNAArtificial SequenceSynthetic 20aaaaaaaacg caaaaaaaa
192119RNAArtificial SequenceSynthetic 21aaaaaaaacg gaaaaaaaa
192219RNAArtificial SequenceSynthetic 22aaaaaaaacg uaaaaaaaa
192319RNAArtificial SequenceSynthetic 23aaaaaaaacu caaaaaaaa
192419RNAArtificial SequenceSynthetic 24aaaaaaaacu gaaaaaaaa
192519RNAArtificial SequenceSynthetic 25aaaaaaaacu uaaaaaaaa
192619RNAArtificial SequenceSynthetic 26aaaaaaaaga caaaaaaaa
192719RNAArtificial SequenceSynthetic 27aaaaaaaaga gaaaaaaaa
192819RNAArtificial SequenceSynthetic 28aaaaaaaaga uaaaaaaaa
192919RNAArtificial SequenceSynthetic 29aaaaaaaagc caaaaaaaa
193019RNAArtificial SequenceSynthetic 30aaaaaaaagc gaaaaaaaa
193119RNAArtificial SequenceSynthetic 31aaaaaaaagc uaaaaaaaa
193219RNAArtificial SequenceSynthetic 32aaaaaaaagg caaaaaaaa
193319RNAArtificial SequenceSynthetic 33aaaaaaaagg gaaaaaaaa
193419RNAArtificial SequenceSynthetic 34aaaaaaaagg uaaaaaaaa
193519RNAArtificial SequenceSynthetic 35aaaaaaaagu caaaaaaaa
193619RNAArtificial SequenceSynthetic 36aaaaaaaagu gaaaaaaaa
193719RNAArtificial SequenceSynthetic 37aaaaaaaagu uaaaaaaaa
193819RNAArtificial SequenceSynthetic 38aaaaaaaaua caaaaaaaa
193919RNAArtificial SequenceSynthetic 39aaaaaaaaua gaaaaaaaa
194019RNAArtificial SequenceSynthetic 40aaaaaaaaua uaaaaaaaa
194119RNAArtificial SequenceSynthetic 41aaaaaaaauc caaaaaaaa
194219RNAArtificial SequenceSynthetic 42aaaaaaaauc gaaaaaaaa
194319RNAArtificial SequenceSynthetic 43aaaaaaaauc uaaaaaaaa
194419RNAArtificial SequenceSynthetic 44aaaaaaaaug caaaaaaaa
194519RNAArtificial SequenceSynthetic 45aaaaaaaaug gaaaaaaaa
194619RNAArtificial SequenceSynthetic 46aaaaaaaaug uaaaaaaaa
194719RNAArtificial SequenceSynthetic 47aaaaaaaauu caaaaaaaa
194819RNAArtificial SequenceSynthetic 48aaaaaaaauu gaaaaaaaa
194919RNAArtificial SequenceSynthetic 49aaaaaaaauu uaaaaaaaa
195019RNAArtificial SequenceSynthetic 50aaaaaaacaa caaaaaaaa
195119RNAArtificial SequenceSynthetic 51aaaaaaacaa gaaaaaaaa
195219RNAArtificial SequenceSynthetic 52aaaaaaacaa uaaaaaaaa
195319RNAArtificial SequenceSynthetic 53aaaaaaacac caaaaaaaa
195419RNAArtificial SequenceSynthetic 54aaaaaaacac gaaaaaaaa
195519RNAArtificial SequenceSynthetic 55aaaaaaacac uaaaaaaaa
195619RNAArtificial SequenceSynthetic 56aaaaaaacag caaaaaaaa
195719RNAArtificial SequenceSynthetic 57aaaaaaacag gaaaaaaaa
195819RNAArtificial SequenceSynthetic 58aaaaaaacag uaaaaaaaa
195919RNAArtificial SequenceSynthetic 59aaaaaaacau caaaaaaaa
196019RNAArtificial SequenceSynthetic 60aaaaaaacau gaaaaaaaa
196119RNAArtificial SequenceSynthetic 61aaaaaaacau uaaaaaaaa
196219RNAArtificial SequenceSynthetic 62aaaaaaacca caaaaaaaa
196319RNAArtificial SequenceSynthetic 63aaaaaaacca gaaaaaaaa
196419RNAArtificial SequenceSynthetic 64aaaaaaacca uaaaaaaaa
196519RNAArtificial SequenceSynthetic 65aaaaaaaccc caaaaaaaa
196619RNAArtificial SequenceSynthetic 66aaaaaaaccc gaaaaaaaa
196719RNAArtificial SequenceSynthetic 67aaaaaaaccc uaaaaaaaa
196819RNAArtificial SequenceSynthetic 68aaaaaaaccg caaaaaaaa
196919RNAArtificial SequenceSynthetic 69aaaaaaaccg gaaaaaaaa
197019RNAArtificial SequenceSynthetic 70aaaaaaaccg uaaaaaaaa
197119RNAArtificial SequenceSynthetic 71aaaaaaaccu caaaaaaaa
197219RNAArtificial SequenceSynthetic 72aaaaaaaccu gaaaaaaaa
197319RNAArtificial SequenceSynthetic 73aaaaaaaccu uaaaaaaaa
197419RNAArtificial SequenceSynthetic 74aaaaaaacga caaaaaaaa
197519RNAArtificial SequenceSynthetic 75aaaaaaacga gaaaaaaaa
197619RNAArtificial SequenceSynthetic 76aaaaaaacga uaaaaaaaa
197719RNAArtificial SequenceSynthetic 77aaaaaaacgc caaaaaaaa
197819RNAArtificial SequenceSynthetic 78aaaaaaacgc gaaaaaaaa
197919RNAArtificial SequenceSynthetic 79aaaaaaacgc uaaaaaaaa
198019RNAArtificial SequenceSynthetic 80aaaaaaacgg caaaaaaaa
198119RNAArtificial SequenceSynthetic 81aaaaaaacgg gaaaaaaaa
198219RNAArtificial SequenceSynthetic 82aaaaaaacgg uaaaaaaaa
198319RNAArtificial SequenceSynthetic 83aaaaaaacgu caaaaaaaa
198419RNAArtificial SequenceSynthetic 84aaaaaaacgu gaaaaaaaa
198519RNAArtificial SequenceSynthetic 85aaaaaaacgu uaaaaaaaa
198619RNAArtificial SequenceSynthetic 86aaaaaaacua caaaaaaaa
198719RNAArtificial SequenceSynthetic 87aaaaaaacua gaaaaaaaa
198819RNAArtificial SequenceSynthetic 88aaaaaaacua uaaaaaaaa
198919RNAArtificial SequenceSynthetic 89aaaaaaacuc caaaaaaaa
199019RNAArtificial SequenceSynthetic 90aaaaaaacuc gaaaaaaaa
199119RNAArtificial SequenceSynthetic 91aaaaaaacuc uaaaaaaaa
199219RNAArtificial SequenceSynthetic 92aaaaaaacug caaaaaaaa
199319RNAArtificial SequenceSynthetic 93aaaaaaacug gaaaaaaaa
199419RNAArtificial SequenceSynthetic 94aaaaaaacug uaaaaaaaa
199519RNAArtificial SequenceSynthetic 95aaaaaaacuu caaaaaaaa
199619RNAArtificial SequenceSynthetic 96aaaaaaacuu gaaaaaaaa
199719RNAArtificial SequenceSynthetic 97aaaaaaacuu uaaaaaaaa
199819RNAArtificial SequenceSynthetic 98aaaaaaagaa caaaaaaaa
199919RNAArtificial SequenceSynthetic 99aaaaaaagaa gaaaaaaaa
1910019RNAArtificial SequenceSynthetic 100aaaaaaagaa uaaaaaaaa
1910119RNAArtificial SequenceSynthetic 101aaaaaaagac caaaaaaaa
1910219RNAArtificial SequenceSynthetic 102aaaaaaagac gaaaaaaaa
1910319RNAArtificial SequenceSynthetic 103aaaaaaagac uaaaaaaaa
1910419RNAArtificial SequenceSynthetic 104aaaaaaagag caaaaaaaa
1910519RNAArtificial SequenceSynthetic 105aaaaaaagag gaaaaaaaa
1910619RNAArtificial SequenceSynthetic 106aaaaaaagag uaaaaaaaa
1910719RNAArtificial SequenceSynthetic 107aaaaaaagau caaaaaaaa
1910819RNAArtificial SequenceSynthetic 108aaaaaaagau gaaaaaaaa
1910919RNAArtificial SequenceSynthetic 109aaaaaaagau uaaaaaaaa
1911019RNAArtificial SequenceSynthetic 110aaaaaaagca caaaaaaaa
1911119RNAArtificial SequenceSynthetic 111aaaaaaagca gaaaaaaaa
1911219RNAArtificial SequenceSynthetic 112aaaaaaagca uaaaaaaaa
1911319RNAArtificial SequenceSynthetic 113aaaaaaagcc caaaaaaaa
1911419RNAArtificial SequenceSynthetic 114aaaaaaagcc gaaaaaaaa
1911519RNAArtificial SequenceSynthetic 115aaaaaaagcc uaaaaaaaa
1911619RNAArtificial SequenceSynthetic 116aaaaaaagcg caaaaaaaa
1911719RNAArtificial SequenceSynthetic 117aaaaaaagcg gaaaaaaaa
1911819RNAArtificial SequenceSynthetic 118aaaaaaagcg uaaaaaaaa
1911919RNAArtificial SequenceSynthetic 119aaaaaaagcu caaaaaaaa
1912019RNAArtificial SequenceSynthetic 120aaaaaaagcu gaaaaaaaa
1912119RNAArtificial SequenceSynthetic 121aaaaaaagcu uaaaaaaaa
1912219RNAArtificial SequenceSynthetic 122aaaaaaagga caaaaaaaa
1912319RNAArtificial SequenceSynthetic 123aaaaaaagga gaaaaaaaa
1912419RNAArtificial SequenceSynthetic 124aaaaaaagga uaaaaaaaa
1912519RNAArtificial SequenceSynthetic 125aaaaaaaggc caaaaaaaa
1912619RNAArtificial SequenceSynthetic 126aaaaaaaggc gaaaaaaaa
1912719RNAArtificial SequenceSynthetic 127aaaaaaaggc uaaaaaaaa
1912819RNAArtificial SequenceSynthetic 128aaaaaaaggg caaaaaaaa
1912919RNAArtificial SequenceSynthetic 129aaaaaaaggg gaaaaaaaa
1913019RNAArtificial SequenceSynthetic 130aaaaaaaggg uaaaaaaaa
1913119RNAArtificial SequenceSynthetic 131aaaaaaaggu caaaaaaaa
1913219RNAArtificial SequenceSynthetic 132aaaaaaaggu gaaaaaaaa
1913319RNAArtificial SequenceSynthetic 133aaaaaaaggu uaaaaaaaa
1913419RNAArtificial SequenceSynthetic 134aaaaaaagua caaaaaaaa
1913519RNAArtificial SequenceSynthetic 135aaaaaaagua gaaaaaaaa
1913619RNAArtificial SequenceSynthetic 136aaaaaaagua uaaaaaaaa
1913719RNAArtificial SequenceSynthetic 137aaaaaaaguc caaaaaaaa
1913819RNAArtificial SequenceSynthetic 138aaaaaaaguc gaaaaaaaa
1913919RNAArtificial SequenceSynthetic 139aaaaaaaguc uaaaaaaaa
1914019RNAArtificial SequenceSynthetic 140aaaaaaagug caaaaaaaa
1914119RNAArtificial SequenceSynthetic 141aaaaaaagug gaaaaaaaa
1914219RNAArtificial SequenceSynthetic 142aaaaaaagug uaaaaaaaa
1914319RNAArtificial SequenceSynthetic 143aaaaaaaguu caaaaaaaa
1914419RNAArtificial SequenceSynthetic 144aaaaaaaguu gaaaaaaaa
1914519RNAArtificial SequenceSynthetic 145aaaaaaaguu uaaaaaaaa
1914619RNAArtificial SequenceSynthetic 146aaaaaaauaa caaaaaaaa
1914719RNAArtificial SequenceSynthetic 147aaaaaaauaa gaaaaaaaa
1914819RNAArtificial SequenceSynthetic 148aaaaaaauaa uaaaaaaaa
1914919RNAArtificial SequenceSynthetic 149aaaaaaauac caaaaaaaa
1915019RNAArtificial SequenceSynthetic 150aaaaaaauac gaaaaaaaa
1915119RNAArtificial SequenceSynthetic 151aaaaaaauac uaaaaaaaa
1915219RNAArtificial SequenceSynthetic 152aaaaaaauag caaaaaaaa
1915319RNAArtificial SequenceSynthetic 153aaaaaaauag gaaaaaaaa
1915419RNAArtificial SequenceSynthetic 154aaaaaaauag uaaaaaaaa
1915519RNAArtificial SequenceSynthetic 155aaaaaaauau caaaaaaaa
1915619RNAArtificial SequenceSynthetic 156aaaaaaauau gaaaaaaaa
1915719RNAArtificial SequenceSynthetic 157aaaaaaauau uaaaaaaaa
1915819RNAArtificial SequenceSynthetic 158aaaaaaauca caaaaaaaa
1915919RNAArtificial SequenceSynthetic 159aaaaaaauca gaaaaaaaa
1916019RNAArtificial SequenceSynthetic 160aaaaaaauca uaaaaaaaa
1916119RNAArtificial SequenceSynthetic 161aaaaaaaucc
caaaaaaaa 1916219RNAArtificial SequenceSynthetic 162aaaaaaaucc
gaaaaaaaa 1916319RNAArtificial SequenceSynthetic 163aaaaaaaucc
uaaaaaaaa 1916419RNAArtificial SequenceSynthetic 164aaaaaaaucg
caaaaaaaa 1916519RNAArtificial SequenceSynthetic 165aaaaaaaucg
gaaaaaaaa 1916619RNAArtificial SequenceSynthetic 166aaaaaaaucg
uaaaaaaaa 1916719RNAArtificial SequenceSynthetic 167aaaaaaaucu
caaaaaaaa 1916819RNAArtificial SequenceSynthetic 168aaaaaaaucu
gaaaaaaaa 1916919RNAArtificial SequenceSynthetic 169aaaaaaaucu
uaaaaaaaa 1917019RNAArtificial SequenceSynthetic 170aaaaaaauga
caaaaaaaa 1917119RNAArtificial SequenceSynthetic 171aaaaaaauga
gaaaaaaaa 1917219RNAArtificial SequenceSynthetic 172aaaaaaauga
uaaaaaaaa 1917319RNAArtificial SequenceSynthetic 173aaaaaaaugc
caaaaaaaa 1917419RNAArtificial SequenceSynthetic 174aaaaaaaugc
gaaaaaaaa 1917519RNAArtificial SequenceSynthetic 175aaaaaaaugc
uaaaaaaaa 1917619RNAArtificial SequenceSynthetic 176aaaaaaaugg
caaaaaaaa 1917719RNAArtificial SequenceSynthetic 177aaaaaaaugg
gaaaaaaaa 1917819RNAArtificial SequenceSynthetic 178aaaaaaaugg
uaaaaaaaa 1917919RNAArtificial SequenceSynthetic 179aaaaaaaugu
caaaaaaaa 1918019RNAArtificial SequenceSynthetic 180aaaaaaaugu
gaaaaaaaa 1918119RNAArtificial SequenceSynthetic 181aaaaaaaugu
uaaaaaaaa 1918219RNAArtificial SequenceSynthetic 182aaaaaaauua
caaaaaaaa 1918319RNAArtificial SequenceSynthetic 183aaaaaaauua
gaaaaaaaa 1918419RNAArtificial SequenceSynthetic 184aaaaaaauua
uaaaaaaaa 1918519RNAArtificial SequenceSynthetic 185aaaaaaauuc
caaaaaaaa 1918619RNAArtificial SequenceSynthetic 186aaaaaaauuc
gaaaaaaaa 1918719RNAArtificial SequenceSynthetic 187aaaaaaauuc
uaaaaaaaa 1918819RNAArtificial SequenceSynthetic 188aaaaaaauug
caaaaaaaa 1918919RNAArtificial SequenceSynthetic 189aaaaaaauug
gaaaaaaaa 1919019RNAArtificial SequenceSynthetic 190aaaaaaauug
uaaaaaaaa 1919119RNAArtificial SequenceSynthetic 191aaaaaaauuu
caaaaaaaa 1919219RNAArtificial SequenceSynthetic 192aaaaaaauuu
gaaaaaaaa 1919319RNAArtificial SequenceSynthetic 193aaaaaaauuu
uaaaaaaaa 1919419RNAArtificial SequenceSynthetic 194aagucaaaaa
aaaaaaaaa 1919519RNAArtificial SequenceSynthetic 195aaaaaaguca
aaaaaaaaa 1919619RNAArtificial SequenceSynthetic 196aaaaaaaagu
caaaaaaaa 1919719RNAArtificial SequenceSynthetic 197aaaaaaaaaa
gucaaaaaa 1919819RNAArtificial SequenceSynthetic 198aaaaaaaaaa
aaaagucaa 1919919RNAArtificial SequenceSynthetic 199aaaaaaaagu
caaaaaaaa 1920019RNAArtificial SequenceSynthetic 200aaaaaaaagu
cacaaaaaa 1920119RNAArtificial SequenceSynthetic 201aaaaaaaagu
cagaaaaaa 1920219RNAArtificial SequenceSynthetic 202aaaaaaaagu
cauaaaaaa 1920319RNAArtificial SequenceSynthetic 203aaaaaaacgu
caaaaaaaa 1920419RNAArtificial SequenceSynthetic 204aaaaaaacgu
cacaaaaaa 1920519RNAArtificial SequenceSynthetic 205aaaaaaacgu
cagaaaaaa 1920619RNAArtificial SequenceSynthetic 206aaaaaaacgu
cauaaaaaa 1920719RNAArtificial SequenceSynthetic 207aaaaaaaggu
caaaaaaaa 1920819RNAArtificial SequenceSynthetic 208aaaaaaaggu
cacaaaaaa 1920919RNAArtificial SequenceSynthetic 209aaaaaaaggu
cagaaaaaa 1921019RNAArtificial SequenceSynthetic 210aaaaaaaggu
cauaaaaaa 1921119RNAArtificial SequenceSynthetic 211aaaaaaaugu
caaaaaaaa 1921219RNAArtificial SequenceSynthetic 212aaaaaaaugu
cacaaaaaa 1921319RNAArtificial SequenceSynthetic 213aaaaaaaugu
cagaaaaaa 1921419RNAArtificial SequenceSynthetic 214aaaaaaaugu
cauaaaaaa 1921519RNAArtificial SequenceSynthetic 215agcuuaaccu
guccuucaa 1921619RNAArtificial SequenceSynthetic 216aaaaaaaccu
guccuucaa 1921719RNAArtificial SequenceSynthetic 217aaaaaaaacu
guccuucaa 1921819RNAArtificial SequenceSynthetic 218aaaaaaaaau
guccuucaa 1921919RNAArtificial SequenceSynthetic 219aaaaaaaaaa
guccuucaa 1922019RNAArtificial SequenceSynthetic 220aaaaaaaaaa
auccuucaa 1922119RNAArtificial SequenceSynthetic 221aaaaaaaaaa
aaccuucaa 1922219RNAArtificial SequenceSynthetic 222agcuuaaccu
aaaaaaaaa 1922319RNAArtificial SequenceSynthetic 223agcuuaaccu
gaaaaaaaa 1922419RNAArtificial SequenceSynthetic 224agcuuaaccu
guaaaaaaa 1922519RNAArtificial SequenceSynthetic 225agcuuaaccu
gucaaaaaa 1922619RNAArtificial SequenceSynthetic 226agcuuaaccu
guccaaaaa 1922719RNAArtificial SequenceSynthetic 227agcuuaaccu
guccuaaaa 1922819RNAArtificial SequenceSynthetic 228agcuuaaccu
guccuuaaa 1922920RNAArtificial SequenceSynthetic 229gcccgucugu
ugugugacuc 2023019RNAArtificial SequenceSynthetic 230uugauguguu
uagucgcua 1923119RNAArtificial SequenceSynthetic 231caucucuccc
ugcucucug 1923219RNAArtificial SequenceSynthetic 232cagagagcag
ggagagaug 1923319RNAArtificial SequenceSynthetic 233ucgccggccu
gcaugcccu 1923419RNAArtificial SequenceSynthetic 234agggcaugca
ggccggcga 1923519RNAArtificial SequenceSynthetic 235gaggcagaug
gaggggaga 1923619RNAArtificial SequenceSynthetic 236ucuccccucc
aucugccuc 1923719RNAArtificial SequenceSynthetic 237aguaucugcu
guuguccua 1923819RNAArtificial SequenceSynthetic 238uaggacaaca
gcagauacu 1923919RNAArtificial SequenceSynthetic 239ugguguugaa
ggacaguuc 1924019RNAArtificial SequenceSynthetic 240gaacuguccu
ucaacacca 1924119RNAArtificial SequenceSynthetic 241aaccugagcu
acaacaaca 1924219RNAArtificial SequenceSynthetic 242uguuguugua
gcucagguu 1924321RNAArtificial SequenceSynthetic 243gaccuagccu
aaaacuaggu c 2124417RNAArtificial SequenceSynthetic 244aaagauccgg
aucaaaa 1724519RNAArtificial SequenceSynthetic 245aaaaguucaa
agcucaaaa 1924611RNAArtificial SequenceSynthetic 246caaguuucga g
1124733RNAArtificial SequenceSynthetic 247ucaaagucaa aagcucaaag
uugaaaguuu aaa 3324841RNAArtificial SequenceSynthetic 248gacuugaaaa
uuucaguuuu cgaguuuaag uugaaaacuc g 4124926RNAArtificial
SequenceSynthetic 249ucaaagucaa aagcucaaag uugaaa
2625031RNAArtificial SequenceSynthetic 250uuucaguuuu cgaguuuaag
uugaaaacuc g 3125120RNAArtificial SequenceSynthetic 251cagagcggga
ugcguugguc 2025219RNAArtificial SequenceSynthetic 252uugauguguu
uagucgcua 1925319RNAArtificial SequenceSynthetic 253gcaccacuag
uugguuguc 1925419RNAArtificial SequenceSynthetic 254guuguaguug
uacuccagc 1925520RNAArtificial SequenceSynthetic 255gcccgucugu
ugugugacuc 2025612RNAArtificial SequenceSynthetic 256gucuguugug ug
1225718RNAArtificial SequenceSynthetic 257guugugguug ugguugug
1825819RNAArtificial SequenceSynthetic 258aaaaaaaguu caaaaaaaa
1925919RNAArtificial SequenceSynthetic 259aaaguucaaa aaaaaaaaa
1926019RNAArtificial SequenceSynthetic 260aaaaaaaaaa aaguucaaa
1926119RNAArtificial SequenceSynthetic 261aaaguucaaa aaguucaaa
1926219RNAArtificial SequenceSynthetic 262guucaaaguu caaaguuca
1926319RNAArtificial SequenceSynthetic 263aguucaaagu caaaagcuc
1926422RNAArtificial SequenceSynthetic 264aguucaguuc aagucaaagc uc
2226545RNAArtificial SequenceSynthetic 265aaaguucaaa gucaaaagcu
caaaguugaa aguuuaaagg uuaaa 4526617RNAArtificial SequenceSynthetic
266aaaaguugcu caaaaaa 1726710RNAArtificial SequenceSynthetic
267guagugugug 1026821RNAArtificial SequenceSynthetic 268guccgggcag
gucuacuuuu u 2126921RNAArtificial SequenceSynthetic 269gcuggagauc
cugaagaacu u 2127019RNAArtificial SequenceSynthetic 270uugauguguu
uagucgcua 1927119RNAArtificial SequenceSynthetic 271uagcgacuaa
acacaucaa 1927219RNAArtificial SequenceSynthetic 272aguagaaaca
agguaguuu 1927319RNAArtificial SequenceSynthetic 273uuaacuaccu
gcuuuugcu 1927442RNAArtificial SequenceSynthetic 274aguagaaaca
agguaguuuu uuguuaacua ccugcuuuug cu 4227519RNAArtificial
SequenceSynthetic 275agcagaaaca aggcagccc 1927619RNAArtificial
SequenceSynthetic 276acuacaaaca accuacuuu 1927719RNAArtificial
SequenceSynthetic 277guuuguugcu uugauugcc 1927819RNAArtificial
SequenceSynthetic 278uuguaguucg uugcuagug 1927919RNAArtificial
SequenceSynthetic 279aguucauggu ggguuguac 1928019RNAArtificial
SequenceSynthetic 280uguuuaaguu guucuaccc 1928119RNAArtificial
SequenceSynthetic 281aaguuuugau uuuucagua 1928219RNAArtificial
SequenceSynthetic 282aggcguuugu guucggguu 1928319RNAArtificial
SequenceSynthetic 283agauguugua ggguguuuu 1928419RNAArtificial
SequenceSynthetic 284uagugugugu cagugugac 1928519RNAArtificial
SequenceSynthetic 285gguugcgugu ggaguuguu 1928619RNAArtificial
SequenceSynthetic 286uguaguuuug uuagaguca 1928719RNAArtificial
SequenceSynthetic 287gugugguugc uguugucaa 1928819RNAArtificial
SequenceSynthetic 288gggaccgaaa gaccagacc 1928919RNAArtificial
SequenceSynthetic 289uaagacuaga agagacaga 1929019RNAArtificial
SequenceSynthetic 290agauccgaac caccgacca 1929119RNAArtificial
SequenceSynthetic 291gaaccagaaa auagagcag 1929219RNAArtificial
SequenceSynthetic 292cauauaagaa gaccagcca 1929319RNAArtificial
SequenceSynthetic 293uaagaaccaa cugcuagaa 1929419RNAArtificial
SequenceSynthetic 294ccccuacaga cagaauacc 1929519RNAArtificial
SequenceSynthetic 295cuggcagaua gauagaagc 1929619RNAArtificial
SequenceSynthetic 296cuagaccaga acaaucucg 1929719RNAArtificial
SequenceSynthetic 297uuagagacau aacaacauu 1929819RNAArtificial
SequenceSynthetic 298ggaccaaacc ucucgacau 1929919RNAArtificial
SequenceSynthetic 299uaacaaacuc cuaccaaca 1930019RNAArtificial
SequenceSynthetic 300uguugguagg aguuuguua 1930119RNAArtificial
SequenceSynthetic 301aacaaacucc uaccaacac 1930219RNAArtificial
SequenceSynthetic 302guguugguag gaguuuguu 1930319RNAArtificial
SequenceSynthetic 303uaccaacacu gaccaauaa 1930419RNAArtificial
SequenceSynthetic 304uuauugguca guguuggua 1930519RNAArtificial
SequenceSynthetic 305cuaccaacac ugaccaaua 1930619RNAArtificial
SequenceSynthetic 306uauuggucag uguugguag 1930719RNAArtificial
SequenceSynthetic 307accaacacug accaauaaa 1930819RNAArtificial
SequenceSynthetic 308uuuauugguc aguguuggu 1930919RNAArtificial
SequenceSynthetic 309acaaacuccu accaacacu 1931019RNAArtificial
SequenceSynthetic 310aguguuggua ggaguuugu 1931119RNAArtificial
SequenceSynthetic 311acuccuacca acacugacc
1931219RNAArtificial SequenceSynthetic 312ggucaguguu gguaggagu
1931319RNAArtificial SequenceSynthetic 313ccuaccaaca cugaccaau
1931419RNAArtificial SequenceSynthetic 314auuggucagu guugguagg
1931519RNAArtificial SequenceSynthetic 315uccuaccaac acugaccaa
1931619RNAArtificial SequenceSynthetic 316uuggucagug uugguagga
1931719RNAArtificial SequenceSynthetic 317aaacuccuac caacacuga
1931819RNAArtificial SequenceSynthetic 318ucaguguugg uaggaguuu
1931919RNAArtificial SequenceSynthetic 319ccaacacuga ccaauaaaa
1932019RNAArtificial SequenceSynthetic 320uuuuauuggu caguguugg
1932119RNAArtificial SequenceSynthetic 321caaacuccua ccaacacug
1932219RNAArtificial SequenceSynthetic 322caguguuggu aggaguuug
1932319RNAArtificial SequenceSynthetic 323aacuccuacc aacacugac
1932419RNAArtificial SequenceSynthetic 324gucaguguug guaggaguu
1932519RNAArtificial SequenceSynthetic 325aacacugacc aauaaaaaa
1932619RNAArtificial SequenceSynthetic 326uuuuuuauug gucaguguu
1932719RNAArtificial SequenceSynthetic 327caacacugac caauaaaaa
1932819RNAArtificial SequenceSynthetic 328uuuuuauugg ucaguguug
1932919RNAArtificial SequenceSynthetic 329gcuacaaaaa cagcaaauu
1933019RNAArtificial SequenceSynthetic 330aauuugcugu uuuuguagc
1933119RNAArtificial SequenceSynthetic 331ggcuacaaaa acagcaaau
1933219RNAArtificial SequenceSynthetic 332auuugcuguu uuuguagcc
1933319RNAArtificial SequenceSynthetic 333acacugacca auaaaaaaa
1933419RNAArtificial SequenceSynthetic 334uuuuuuuauu ggucagugu
1933519RNAArtificial SequenceSynthetic 335uggcuacaaa aacagcaaa
1933619RNAArtificial SequenceSynthetic 336uuugcuguuu uuguagcca
1933719RNAArtificial SequenceSynthetic 337guaacaaacu ccuaccaac
1933819RNAArtificial SequenceSynthetic 338guugguagga guuuguuac
1933919RNAArtificial SequenceSynthetic 339cacugaccaa uaaaaaaaa
1934019RNAArtificial SequenceSynthetic 340uuuuuuuuau uggucagug
1934119RNAArtificial SequenceSynthetic 341acugaccaau aaaaaaaaa
1934219RNAArtificial SequenceSynthetic 342uuuuuuuuua uuggucagu
1934319RNAArtificial SequenceSynthetic 343uacaaaaaca gcaaauucc
1934419RNAArtificial SequenceSynthetic 344ggaauuugcu guuuuugua
1934519RNAArtificial SequenceSynthetic 345cuacaaaaac agcaaauuc
1934619RNAArtificial SequenceSynthetic 346gaauuugcug uuuuuguag
1934719RNAArtificial SequenceSynthetic 347aaaauguggg uuuuuuuuu
1934819RNAArtificial SequenceSynthetic 348aaaaaaaaac ccacauuuu
1934919RNAArtificial SequenceSynthetic 349ugugguguuu ggcaaaguu
1935019RNAArtificial SequenceSynthetic 350aacuuugcca aacaccaca
1935119RNAArtificial SequenceSynthetic 351aaaugugggu uuuuuuuuu
1935219RNAArtificial SequenceSynthetic 352aaaaaaaaaa cccacauuu
1935319RNAArtificial SequenceSynthetic 353guuuuuuuuu uuuuuaaua
1935419RNAArtificial SequenceSynthetic 354uauuaaaaaa aaaaaaaac
1935519RNAArtificial SequenceSynthetic 355aauguggguu uuuuuuuuu
1935619RNAArtificial SequenceSynthetic 356aaaaaaaaaa acccacauu
1935719RNAArtificial SequenceSynthetic 357gguuuuuuuu uuuuuuaau
1935819RNAArtificial SequenceSynthetic 358auuaaaaaaa aaaaaaacc
1935919RNAArtificial SequenceSynthetic 359ggguuuuuuu uuuuuuuaa
1936019RNAArtificial SequenceSynthetic 360uuaaaaaaaa aaaaaaccc
1936119RNAArtificial SequenceSynthetic 361uggguuuuuu uuuuuuuua
1936219RNAArtificial SequenceSynthetic 362uaaaaaaaaa aaaaaccca
1936319RNAArtificial SequenceSynthetic 363auguggguuu uuuuuuuuu
1936419RNAArtificial SequenceSynthetic 364aaaaaaaaaa aacccacau
1936519RNAArtificial SequenceSynthetic 365guggguuuuu uuuuuuuuu
1936619RNAArtificial SequenceSynthetic 366aaaaaaaaaa aaaacccac
1936719RNAArtificial SequenceSynthetic 367uguggguuuu uuuuuuuuu
1936819RNAArtificial SequenceSynthetic 368aaaaaaaaaa aaacccaca
1936919RNAArtificial SequenceSynthetic 369aagaucgagg uggagaagc
1937019RNAArtificial SequenceSynthetic 370gcuucuccac cucgaucuu
1937119RNAArtificial SequenceSynthetic 371agaucgaggu ggagaagcc
1937219RNAArtificial SequenceSynthetic 372ggcuucucca ccucgaucu
1937319RNAArtificial SequenceSynthetic 373ccgccgcccu caucgcggg
1937419RNAArtificial SequenceSynthetic 374cccgcgauga gggcggcgg
1937519RNAArtificial SequenceSynthetic 375ccuucugcgg ccgaugaga
1937619RNAArtificial SequenceSynthetic 376ucucaucggc cgcagaagg
1937719RNAArtificial SequenceSynthetic 377cgccgcccuc aucgcgggg
1937819RNAArtificial SequenceSynthetic 378ccccgcgaug agggcggcg
1937919RNAArtificial SequenceSynthetic 379cuuccugcug cugccggga
1938019RNAArtificial SequenceSynthetic 380ucccggcagc agcaggaag
1938119RNAArtificial SequenceSynthetic 381gagcgcuucc ccgaugaga
1938219RNAArtificial SequenceSynthetic 382ucucaucggg gaagcgcuc
1938319RNAArtificial SequenceSynthetic 383gccgccgccc ucaucgcgg
1938419RNAArtificial SequenceSynthetic 384ccgcgaugag ggcggcggc
1938519RNAArtificial SequenceSynthetic 385ggcaagaucg agguggaga
1938619RNAArtificial SequenceSynthetic 386ucuccaccuc gaucuugcc
1938719RNAArtificial SequenceSynthetic 387ucuuccugcu gcugccggg
1938819RNAArtificial SequenceSynthetic 388cccggcagca gcaggaaga
1938919RNAArtificial SequenceSynthetic 389ugccgccgcc cucaucgcg
1939019RNAArtificial SequenceSynthetic 390cgcgaugagg gcggcggca
19
* * * * *