Combinatorial Libraries Of Proteins Having The Scaffold Structure Of C-type Lectin-like Domains

Abstract

Novel polypeptides having the scaffold structure of a C-type lectin-like domain (CTLD) and a randomized loop region for specifically binding a variety of target compounds and also provides nucleic acids encoding the polypeptides. Combinatorial CTLD libraries, methods for constructing the libraries, and methods for screening the libraries to identify and isolate the novel CTLD polypeptides. Libraries of nucleic acids encoding polypeptides having a scaffold CTLD with a randomized loop region, as well as nucleic acid sequences, vectors, and methods for preparing and expressing the libraries. Exemplary nucleic acids useful in the combinatorial libraries are derived from tetranectin and other proteins having a CTLD.

Description

CROSS-REFERENCE TO RELATED APPLICATION

[0001] This application is a continuation of U.S. patent application Ser. No. 11/633040, filed Dec. 4, 2006, now U.S. Pat. No. 8,017,559, which is a divisional of U.S. patent application Ser. No. 10/450,472, filed Jun. 13, 2003, which is a national phase application of International Application PCT/DK01/00825, filed Dec. 13, 2001, which claims priority to Denmark application PA 2000 01872, filed Dec. 13, 2000 and U.S. Application No. 60/272,098, filed Feb. 28, 2001. The entire contents of the above-referenced applications are hereby incorporated by reference herein in their entireties.

FIELD OF THE INVENTION

[0002] This invention describes a system which relates to the generation of randomized libraries of ligand-binding protein units derived from proteins containing the so-called C-type lectin like domain (CTLD) of which the carbohydrate recognition domain (CRD) of C-type lectins represents one example of a family of this protein domain.

BACKGROUND OF THE INVENTION

[0003] The C-type lectin-like domain (CTLD) is a protein domain family which has been identified in a number of proteins isolated from many animal species (reviewed in Drickamer and Taylor (1993) and Drickamer (1999)). Initially, the CTLD domain was identified as a domain common to the so-called C-type lectins (calcium-dependent carbohydrate binding proteins) and named "Carbohydrate Recognition Domain" ("CRD"). More recently, it has become evident that this domain is shared among many eukaryotic proteins, of which several do not bind sugar moieties, and hence, the canonical domain has been named as CTLD.

[0004] CTLDs have been reported to bind a wide diversity of compounds, including carbohydrates, lipids, proteins, and even ice [Aspberg et al. (1997), Bettler et al. (1992), Ewart et al. (1998), Graversen et al. (1998), Mizumo et al. (1997), Sano et al. (1998), and Tormo et al. (1999)]. Only one copy of the CTLD is present in some proteins, whereas other proteins contain from two to multiple copies of the domain. In the physiologically functional unit multiplicity in the number of CTLDs is often achieved by assembling single copy protein protomers into larger structures.

[0005] The CTLD consists of approximately 120 amino acid residues and, characteristically, contains two or three intra-chain disulfide bridges. Although the similarity at the amino acid sequence level between CTLDs from different proteins is relatively low, the 3D-structures of a number of CTLDs have been found to be highly conserved, with the structural variability essentially confined to a so-called loop-region, often defined by up to five loops. Several CTLDs contain either one or two binding sites for calcium and most of the side chains which interact with calcium are located in the loop-region.

[0006] On the basis of CTLDs for which 3D structural information is available, it has been inferred that the canonical CTLD is structurally characterised by seven main secondary-structure elements (i.e. five .beta.-strands and two .alpha.-helices) sequentially appearing in the order .beta.1; .alpha.1; .alpha.2; .beta.2; .beta.3; .beta.4; and .beta.5 (FIG. 1, and references given therein). In all CTLDs, for which 3D structures have been determined, the .beta.-strands are arranged in two anti-parallel .beta.-sheets, one composed of .beta.1 and .beta.5, the other composed of .beta.2, .beta.3 and .beta.4. An additional .beta.-strand, .beta.0, often precedes .beta.1 in the sequence and, where present, forms an additional strand integrating with the .beta.1, .beta.5-sheet. Further, two disulfide bridges, one connecting .alpha.1 and .beta.5 (C.sub.I-C.sub.IV, FIG. 1) and one connecting .beta.3 and the polypeptide segment connecting .beta.4 and .beta.5 (C.sub.II-C.sub.III, FIG. 1) are invariantly found in all CTLDs characterised so far. In the CTLD 3D-structure, these conserved secondary structure elements form a compact scaffold for a number of loops, which in the present context collectively are referred to as the "loop-region", protruding out from the core. These loops are in the primary structure of the CTLDs organized in two segments, loop segment A, LSA, and loop segment B, LSB. LSA represents the long polypeptide segment connecting .beta.2 and .beta.3 which often lacks regular secondary structure and contains up to four loops. LSB represents the polypeptide segment connecting the .beta.-strands .beta.3 and .beta.4. Residues in LSA, together with single residues in .beta.4, have been shown to specify the Ca.sup.2+- and ligand-binding sites of several CTLDs, including that of tetranectin. E.g. muta-genesis studies, involving substitution of single or a few residues, have shown, that changes in binding specificity, Ca.sup.2+-sensitivity and/or affinity can be accommodated by CTLD domains [Weis and Drickamer (1996), Chiba et al. (1999), Graversen et al. (2000)].

[0007] As noted above, overall sequence similarities between CTLDs are often limited, as assessed e.g. by aligning a prospective CTLD sequence with the group of structure-characterized CTLDs presented in FIG. 1, using sequence alignment procedures and analysis tools in common use in the field of protein science. In such an alignment, typically 22-30% of the residues of the prospective CTLD will be identical with the corresponding residue in at least one of the structure-characterized CTLDs. The sequence alignment shown in FIG. 1 was strictly elucidated from actual 3D structure data, so the fact that the polypeptide segments of corresponding structural elements of the framework also exhibit strong sequence similarities provide a set of direct sequence-structure signatures, which can readily be inferred from the sequence alignment.

[0008] The implication is that also CTLDs, for which precise 3D structural information is not yet available, can nonetheless be used as frameworks in the construction of new classes of CTLD libraries. The specific additional steps involved in preparing starting materials for the construction of such a new class of CTLD library on the basis of a CTLD, for which no precise 3D structure is available, would be the following: (1) Alignment of the sequence of the new CTLD with the sequence shown in FIG. 1; and (2) Assignment of approximate locations of framework structural elements as guided by the sequence alignment, observing any requirement for minor adjustment of the alignment to ensure precise alignment of the four canonical cysteine residues involved in the formation of the two conserved disulfide bridges (C.sub.I-C.sub.IV and C.sub.II-C.sub.III, in FIG. 1). The main objective of these steps would be to identify the sequence location of the loop-region of the new CTLD, as flanked in the sequence by segments corresponding to the .beta.2-, .beta.3-, and .beta.4-strands. To provide further guidance in this the results of an analysis of the sequences of 29 bona fide CTLDs are given in Table 1 below in the form of typical tetrapeptide sequences, and their consensus sequences, found as parts of CTLD .beta.2- and .beta.3-strands, and the precise location of the .beta.4-strand by position and sequence characteristics as elucidated.

TABLE-US-00001 TABLE I .beta.2 and .beta.3 consensus elements analysis SEQ ID CTLD .beta.2 --- LSA NO IX-A W I G L R W - - - Q G KVKQCNS E W S D G S S V S - - Y E N W I E - - - - - - - - 92 MGL W I G L T D Q - - N G P - - W R W V D G T D F E K G F K N W A P - - - - - - - - 93 LIT W I G L H D P K K N R R - - W H W S S G S L V S - - Y K S W G I - - - - - - - - 94 CHL W I G L T D E N Q E G E - - W Q W V D G T D T R S S F T F W K E - - - - - - - - 95 IGE- W I G L R N L D L K G E F I W V - - D G S H V D - - Y S N W A P - - - - - - - - 96 FCR TCL-1 W I G L T D K D S E G T - - W K W V D G T P L T - - T A F W S T - - - - - - - - 97 KUCR W I G L T D Q G T E G N - - W R W V D G T P F DYVQS R R F W R K - - - - - - - - 98 CD94 W I G L S Y S E E H T A - - W L W E N G S A L S Q - Y L S F E T - - - - - - - - 99 CPCP W I G L N D R T I E G D F R W S - - D G H P M Q - - F E N W R P - - - - - - - - 100 PAP W I G L H DPTQGTEPN G E G - W E W S S S D V M N - - Y F A W E R - - - - - - - - 101 NEU W I G L N D R I V E Q D - - F Q W T D N T G L Q - - Y E N W R E - - - - - - - - 102 ESL W I G I R K V N N V - - - - W V W - V G T Q K P L T EEAKN W A P - - - - - - - - 103 NKg2A W I G V F R N S S H H P - - W V T M N G L A F K H E I K D S D N A - - - - - - - 104 GP120 W M G L S D L N Q E G T - - W Q W V D G S PLL P S - FKQ Y W N R - - - - - - - - 105 MR W I G L F R N V - E G T - - W L W I N N S P V S - - F V N W N T - - - - - - - - 106 TN W L G L N D M A A E G T - - - - W V D M T G A R I A Y K N W E T E I T - - - - - 107 SCGF W L G V H D R R A E G L - - Y L F E N G Q R V S - - F F A W HRSPRPELGAQPSASPHPLS 108 PLC W L G A S D L N I E G R - - W L W - E G Q R R M N - Y T N W S P - - - - - - - - 109 H1- W M G L H D - - Q N G P - - W K W V D G T D Y E T G F K N W R P - - - - - - - - 110 ASR IX-B W M G L S N V W N Q C N - - W Q W S N A A M L R - - Y K A W A E - - - - - - - - 111 LY49A W V G L S Y D N K K K D - - W A W I D N R P S K L A L N T R K Y - - - - - - - - 112 TU14 W V G A D N - L Q D G A Y N F N W N D G V S L P T D S D L W S P - - - - - - - - 113 rSP-A Y L G M I E D Q T P G D - - F H Y L D G A S V N - - Y T N W Y P - - - - - - - - 114 BCON Y L S M N D I S T E G R - - F T Y P T G E I L V - - Y S N W A D - - - - - - - - 115 BCL43 Y L S M N D I S K E G K - - F T Y P T G G S L D - - Y S N W A P - - - - - - - - 116 MBP-A F L G I T D E V T E G Q - - F M Y V T G G R L T - - Y S N W K K - - - - - - - - 117 SP-D F L S M T D S K T E G K - - F T Y P T G E S L V - - Y S N W A P - - - - - - - - 118 CL-L1 F I G V N D L E R E G Q - - Y M F T D N T P L Q N - Y S N W N E - - - - - - - - 119 DCIR F V G L S D P - - E G Q R H W Q W V D Q T P - - - - Y NESSTFWHP - - - - - - - - 120 SEQ ID CTLD --- .beta.3 LSB .beta.4 NO IX-A A E S K T - - - - - - - - - - - C L G L E KET D F R K W V N I Y C 92 MGL L Q P D N W F G H G L G G G E D C A H I T T G - - G F W N D D V C 93 LIT G A P S S V N P - - - - - G Y - C V S L TSS T G F Q K W K D V P C 94 CHL G E P N N R G F - - - - - N E D C A H V W T S - - G Q W N D V Y C 95 IGE- G E P T S R S Q - - - - - G E D C V M M R G S - - G R W N D A F C 96 FCR TCL-1 D E P N D G A V N - - - - G E D C V S L Y YHTQPEF K N W N D L A C 97 KUCR G Q P D W R H G N G E - - R E D C V H L Q - - - - R M W N D M A C 98 CD94 - - - - F N T K N - - - - - - - C I A Y N P N - - G N A L D E S C 99 CPCP N Q P D N F F A A - - - - G E D C V V M I W H E K G E W N D V P C 100 PAP N - P S T I S S P G H - - - - - C A S L S RST A F L R W K D Y N C 101 NEU N Q P D N F F A G - - - - G E D C V V L V S H E I G K W N D V P C 102 ESL G E P N N R Q K - - - - - D E D C V E I YIKREKD V G M W N D E R C 103 NKg2A - - - - - - - - - - - - - E L N C A V L Q V - - - N R L K S A Q C 104 GP120 G E P N N V G - - - - - - E E D C A E F S G N - - G - W N D D K C 105 MR G D P S G E - - - - - - - R N D C V A L H A S S - G F W S N I H C 106 TN A Q P D G G K - - - - - - T E N C A V L S G A A N G K W F D K R C 107 SCGF PDQ P N G G T - - - - - - L E N C V A Q A S D D - G S W W D H D C 108 PLC G Q P D N A G G - - - - - I E H C L E L RRD L G N Y L W N D Y Q C 109 H1- E Q P D D W Y G H G L G G G E D C A H F T D D - - G R W N D D V C 110 ASR IX-B E S Y - - - - - - - - - - - - - C V Y F K S T N - N K W R S R A C 111 LY49A N I R D G G - - - - - - - - - - C M L L S K T - - - R L D N G N C 112 TU14 N E P S N P Q S W Q L - - - - - C V Q I W S K Y - N L L D D V G C 113 rSP-A G E P R G Q G - - - - - - K E K C V E M Y T D - - G T W N D R G C 114 BCON G E P N N S D E G Q - - - P E N C V E I F P D - - G K W N D V P C 115 BCL43 G E P N N R A K D E G - - P E N C L E I Y S D - - G N W N D I E C 116 MBP-A D E P N D H G S - - - - - G E D C V T I V D N - - G L W N D I S C 117 SP-D G E P N D D G G - - - - - S E D C V E I F T N - - G K W N D R A C 118 CL-L1 G E P S D P Y G - - - - - H E D C V E M L S S - - G R W N D T E C 119 DCIR R E P S D P N - - - - - - - E R C V V L NFRKSPKRW G - W N D V N C 120 Notes: LSA, Loop Segment A; LSB, Loop Segemnt B.

[0009] Sequences taken from: Berglund and Petersen (1992) [TN, tetranectin]; Bertrand et al. (1996) [LIT, lithostatin]; Mann et al. (2000) [MGL, mouse macrophage galactose lectin, KUCR, Kupffer cell receptor, NEU, chicken neurocan, PLC, perlucin, H1-ASR, asialoglycoprotein receptor]; Mio et al. (1998) [CPCP, cartilage proteoglycan core protein, IGE-FCR, IgE Fc receptor, PAP, pancreatitis-associated protein, MMR, mouse macrophage receptor, NKG2, Natural Killer group, SCGF, stem cell growth factor]; Mizuno et al. (1997) [IX-A and B, factor IX/X binding protein, MBP, mannose binding protein]; Ohtani et al. (1999) [BCON, bovine conglutinin, BCL43, bovine CL43, CL-L1, collectin liver 1, SP-A, surfactant protein A, SP-D, surfactant protein D]; Poget et al. (1999) [ESL, e-selectin, TU14, tunicate c-type lectin]; Tormo et al. (1999) [CD94,CD94 NK receptor domain, LY49A, LY49A NK receptor domain]; Zhang et al. (2000) [CHL, chicken hepatic lectin, TCL-1, trout c-type lectin, GP120, HIV gp 120-binding c-type lectin, DCIR, dendritic cell immuno receptor]

[0010] Of the 29 .beta.2-strands, [0011] 14 were found to conform to the consensus sequence WIGX (SEQ ID NO: 305) (of which 12 were WIGL (SEQ ID NO: 306) sequences, 1 was a WIGI (SEQ ID NO: 307) sequence and 1 was a WIGV (SEQ ID NO: 308) sequence); [0012] 3 were found to conform to the consensus sequence WLGX (SEQ ID NO. 309) (of which 1 was a WLGL (SEQ ID NO: 310) sequence, 1 was a WLGV (SEQ ID NO: 311) sequence and 1 was a WLGA (SEQ ID NO: 312) sequence); [0013] 3 were found to be WMGL (SEQ ID NO: 313) sequences; [0014] 3 were found to conform to the consensus sequence YLXM (SEQ ID NO: 314)(of which 2 were YLSM (SEQ ID NO:315) sequences and 1 was an YLGM (SEQ ID NO: 316) sequence); [0015] 2 were found to conform to the consensus sequence WVGX (SEQ ID NO: 317] (of which 1 was a WVGL (SEQ ID NO: 318] sequence and 1 was a WVGA (SEQ ID NO: 319] sequence); and [0016] the sequences of the remaining 4 .beta.2-strands in the collection were FLGI (SEQ ID NO: 320), FVGL (SEQ ID NO: 321), FIGV (SEQ ID NO: 322) and FLSM {SEQ ID NO: 323) sequences, respectively.

[0017] Therefore, it is concluded that the four-residue .beta.2 consensus sequence (".beta.2cseq") may be specified as follows: [0018] Residue 1: An aromatic residue, most preferably Trp, less preferably Phe and least preferably Tyr. [0019] Residue 2: An aliphatic or non-polar residue, most preferably Ile, less preferably Leu or Met and least preferably Val. [0020] Residue 3: An aliphatic or hydrophilic residue, most preferably Gly and least preferably Ser. [0021] Residue 4: An aliphatic or non-polar residue, most preferably Leu and less preferably Met, Val or Ile.

[0022] Accordingly the P2 consensus sequence may be summarized as follows: [0023] .beta.2cseq: (W,Y,F)-(I,L,V,M)-(G,S)-(L,M,V,I), [0024] where the underlined residue denotes the most commonly found residue at that sequence position.

[0025] All 29 .beta.3-strands analyzed are initiated with the Cys.sub.II residue canonical for all known CTLD sequences, and of the 29 .beta.3-strands, [0026] 5 were found to conform to the consensus sequence CVXI (SEQ ID NO: 324) (of which 3 were CVEI (SEQ ID NO: 325) sequences, 1 was a CVTI (SEQ ID NO: 326) sequence and 1 was a CVQI (SEQ ID NO: 327) sequence); [0027] 4 were found to conform to the consensus sequence CVXM (SEQ ID NO: 328) (of which 2 were CVEM (SEQ ID NO: 329) sequences, 1 was a CVVM (SEQ ID NO: 330) sequence and 1 was a CVMM (SEQ ID NO: 331) sequence); [0028] 6 were found to conform to the consensus sequence CVXL (SEQ ID NO: 332) (of which 2 were CVVL (SEQ ID NO: 333) sequences, 2 were a CVSL (SEQ ID NO: 334 sequence, 1 was a CVHL (SEQ ID NO: 335) sequence and 1 was CVAL (SEQ ID NO: 336) sequence); [0029] 3 were found to conform to the consensus sequence CAXL (SEQ ID NO: 337) (of which 2 were CAVL (SEQ ID NO: 338) sequences and 1 was a CASL (SEQ ID NO: 339) sequence); [0030] 2 were found to conform to the consensus sequence CAXF (SEQ ID NO: 340) (of which 1 was 1 CAHF (SEQ ID NO: 341) sequence and 1 was a CAEF (SEQ ID NO: 342) sequence); [0031] 2 were found to conform to the consensus sequence CLXL (SEQ ID NO: 343) (of which 1 was a CLEL (SEQ ID NO: 344) sequence and 1 was a CLGL (SEQ ID NO: 345) sequence); and [0032] the sequences of the remaining 7 .beta.3-strands in the collection were CVYF (SEQ ID NO: 346), CVAQ (SEQ ID NO: 347), CAHV (SEQ ID NO: 348), CAHI (SEQ ID NO:349), CLEI (SEQ ID NO: 350), CIAY (SEQ ID NO: 351), and CMLL (SEQ ID NO: 352) sequences, respectively.

[0033] Therefore, it is concluded that the four-residue .beta.3 consensus sequence ("(33cseq") may be specified as follows: [0034] Residue 1: Cys, being the canonical Cys.sub.II residue of CTLDs [0035] Residue 2: An aliphatic or non-polar residue, most preferably Val, less preferably Ala or Leu and least preferably Ile or Met [0036] Residue 3: Most commonly an aliphatic or charged residue, which most preferably is Glu [0037] Residue 4: Most commonly an aliphatic, non-polar, or aromatic residue, most preferably Leu or Ile, less preferably Met or Phe and least preferably Tyr or Val.

[0038] Accordingly the .beta.3 consensus sequence may be summarized as follows: [0039] .beta.3cseq: (C)-(V,A,L,I,M)-(E,X)-(L,I,M,F,Y,V), [0040] where the underlined residue denotes the most commonly found residue at that sequence position.

[0041] It is observed from the known 3D-structures of CTLDs (FIG. 1), that the .beta.4-strands most often are comprised by five residues located in the primary structure at positions -6 to -2 relative to the canonical Cys.sub.III residue of all known CTLDs, and less often are comprised by four residues located at positions -5 to -2 relative to the canonical Cys.sub.III residue of all known CTLDs. The residue located at position -3, relative to Cys.sub.III, is involved in co-ordination of the site 2 calcium ion in CTLDs housing this site, and this notion is reflected in the observation, that of the 29 CTLD sequences analyzed in Table 1, 27 have an Asp-residue or an Asn-residue at this position, whereas 2 CTLDs have a Ser at this position. From the known CTLD 3D-structures it is also noted, that the residue located at position -5, relative to the Cys.sub.III residue, is involved in the formation of the hydrophobic core of the CTLD scaffold. This notion is reflected in the observation, that of the 29 CTLD sequences analyzed 25 have a Trp-residue, 3 have a Leu-residue, and 1 an Ala-residue at this position. 18 of the 29 CTLD sequences analyzed have an Asn-residue at position -4. Further, 19 of the 29 .beta.4-strand segments are preceded by a Gly residue.

[0042] Of the 29 central three residue motifs located at positions -5, -4 and -3 relative to the canonical Cys.sub.III residue in the .beta.4-strand: [0043] 22 were of the sequence WXD (18 were WND, 2 were WKD, 1 was WFD and 1 was WWD), [0044] 2 were of the sequence WXN (1 was WVN and 1 was WSN), [0045] and the remaining 5 motifs (WRS, LDD, LDN, LKS and ALD) were each represented once in the analysis.

[0046] It has now been found that each member of the family of CTLD domains represents an attractive opportunity for the construction of new protein libraries from which members with affinity for new ligand targets can be identified and isolated using screening or selection methods. Such libraries may be constructed by combining a CTLD framework structure in which the CTLD's loop-region is partially or completely replaced with one or more randomized polypeptide segments.

[0047] One such system, where the protein used as scaffold is tetranectin or the CTLD domain of tetranectin, is envisaged as a system of particular interest, not least because the stability of the trimeric complex of tetranectin protomers is very high (International Patent Application Publication No. WO 98/56906 A2).

[0048] Tetranectin is a trimeric glycoprotein [Holtet et al. (1997), Nielsen et al. (1997)], which has been isolated from human plasma and found to be present in the extracellular matrix in certain tissues. Tetranectin is known to bind calcium, complex polysaccharides, plasminogen, fibrinogen/fibrin, and apolipoprotein (a). The interaction with plasminogen and apolipoprotein (a) is mediated by the so-called kringle 4 protein domain therein. This interaction is known to be sensitive to calcium and to derivatives of the amino acid lysine [Graversen et al. (1998)].

[0049] A human tetranectin gene has been characterised, and both human and murine tetranectin cDNA clones have been isolated. Both the human and the murine mature protein comprise 181 amino acid residues (FIG. 2). The 3D-structures of full length recombinant human tetranectin and of the isolated tetranectin CTLD have been determined independently in two separate studies [Nielsen et al. (1997) and Kastrup et al. (1998)]. Tetranectin is a two- or possibly three-domain protein, i.e. the main part of the polypeptide chain comprises the CTLD (amino acid residues Gly53 to Val181), whereas the region Leu26 to Lys52 encodes an alpha-helix governing trimerisation of the protein via the formation of a homotrimeric parallel coiled coil. The polypeptide segment Glu1 to Glu25 contains the binding site for complex polysaccharides (Lys6 to Lys15) [Lorentsen et al. (2000)] and appears to contribute to stabilization of the trimeric structure [Holtet et al. (1997)]. The two amino acid residues Lys148 and Glu150, localized in loop 4, and Asp165 (localized in .beta.4) have been shown to be of critical importance for plasminogen kringle 4 binding, whereas the residues Ile140 (in loop 3) and Lys166 and Arg167 (in .beta.4) have been shown to be of some importance [Graversen et al. (1998)]. Substitution of Thr149 (in loop 4) with an aromatic residue has been shown to significantly increase affinity of tetranectin to kringle 4 and to increase affinity for plasminogen kringle 2 to a level comparable to the affinity of wild type tetranectin for kringle 4 [Graversen et al. (2000)].

OBJECT OF THE INVENTION

[0050] The object of the invention is to provide a new practicable method for the generation of useful protein products endowed with binding sites able to bind substance of interest with high affinity and specificity.

[0051] The invention describes one way in which such new and useful protein products may advantageously be obtained by applying standard combinatorial protein chemistry methods, commonly used in the recombinant antibody field, to generate randomized combinatorial libraries of protein modules, in which each member contains an essentially common core structure similar to that of a CTLD.

[0052] The variation of binding site configuration among naturally occurring CTLDs shows that their common core structure can accommodate many essentially different configurations of the ligand binding site. CTLDs are therefore particularly well suited to serve as a basis for constructing such new and useful protein products with desired binding properties.

[0053] In terms of practical application, the new artificial CTLD protein products can be employed in applications in which antibody products are presently used as key reagents in technical biochemical assay systems or medical in vitro or in vivo diagnostic assay systems or as active components in therapeutic compositions.

[0054] In terms of use as components of in vitro assay systems, the artificial CTLD protein products are preferable to antibody derivatives as each binding site in the new protein product is harboured in a single structurally autonomous protein domain. CTLD domains are resistant to proteolysis, and neither stability nor access to the ligand-binding site is compromised by the attachment of other protein domains to the N- or C-terminus of the CTLD. Accordingly, the CTLD binding module may readily be utilized as a building block for the construction of modular molecular assemblies, e.g. harbouring multiple CLTDs of identical or nonidentical specificity in addition to appropriate reporter modules like peroxidases, phosphatases or any other signal-mediating moiety.

[0055] In terms of in vivo use as essential component of compositions to be used for in vivo diagnostic or therapeutic purposes, artificial CTLD protein products constructed on the basis of human CTLDs are virtually identical to the corresponding natural CTLD protein already present in the body, and are therefore expected to elicit minimal immunological response in the patient. Single CTLDs are about half the mass of the smallest functional antibody derivative, the single-chain Fv derivative, and this small size may in some applications be advantageous as it may provide better tissue penetration and distribution, as well as a shorter half-life in circulation. Multivalent formats of CTLD proteins, e.g. corresponding to the complete tetranectin trimer or the further multimerized collectins, like e.g. mannose binding protein, provide increased binding capacity and avidity and longer circulation half-life.

[0056] One particular advantage of the preferred embodiment of the invention, arises from the fact that mammalian tetranectins, as exemplified by murine and human tetranectin, are of essentially identical structure. This conservation among species is of great practical importance as it allows straightforward swapping of polypeptide segments defining ligand-binding specificity between e.g. murine and human tetranectin derivatives. The option of facile swapping of species genetic background between tetranectin derivatives is in marked contrast to the well-known complications of effecting the "humanisation" of murine antibody derivatives.

[0057] Further advantages of the invention are:

[0058] The availability of a general and simple procedure for reliable conversion of an initially selected protein derivative into a final protein product, which without further reformatting may be produced in bacteria (e.g. Escherichia coli) both in small and in large scale (International Patent Application Publication No. WO 94/18227 A2).

[0059] The option of including several identical or non-identical binding sites in the same functional protein unit by simple and general means, thereby enabling the exploitation even of weak affinities by means of avidity in the interaction, or the construction of bi- or heterofunctional molecular assemblies (International Patent Application Publication No. WO 98/56906 A2).

[0060] The possibility of modulating binding by addition or removal of divalent metal ions (e.g. calcium ions) in combinational libraries with one or more preserved metal binding site(s) in the CTLDs.

SUMMARY OF THE INVENTION

[0061] The present invention provides a great number of novel and useful proteins each being a protein having the scaffold structure of C-type lectin-like domains (CTLD), said protein comprising a variant of a model CTLD wherein the .alpha.-helices and .beta.-strands and connecting segments are conserved to such a degree that the scaffold structure of the CTLD is substantially maintained, while the loop region is altered by amino acid substitution, deletion, insertion or any combination thereof, with the proviso that said protein is not any of the known CTLD loop derivatives of C-type lectin-like proteins or C-type lectins listed in the following Table 2.

TABLE-US-00002 TABLE 2 LSA derivatives (.beta.2 and .beta.3 consensus elements are underlined) SEQ ID CTLD Mut. LSA sequence (one letter code) Reference NO hTN TND116A W L G L N A M A A E G T W V D M T G A R I A Y K N W E T E I Graversen et al. 121 T A Q P D G G K T E N C A V L (1998) TNE120A W L G L N D M A A A G T W V D M T G A R I A Y K N W E T E I Graversen et al. 122 T A Q P D G G K T E N C A V L (1998) TNK134A W L G L N D M A A E G T W V D M T G A R I A Y A N W E T E I Graversen et al. 123 T A Q P D G G K T E N C A V L (1998) TNI140A W L G L N D M A A E G T W V D M T G A R I A Y K N W E T E A Graversen et al. 124 T A Q P D G G K T E N C A V L (1998) TNQ143A W L G L N D M A A E G T W V D M T G A R I A Y K N W E T E I Graversen et al. 125 T A A P D G G K T E N C A V L (1998) TND145A W L G L N D M A A E G T W V D M T G A R I A Y K N W E T E I Graversen et al. 126 T A Q P A G G K T E N C A V L (1998) TNK148A W L G L N D M A A E G T W V D M T G A R I A Y K N W E T E I Graversen et al. 127 T A Q P D G G A T E N C A V L (1998) TNK148M W L G L N D M A A E G T W V D M T G A R I A Y K N W E T E I Graversen et al. 128 T A Q P D G G M T E N C A V L (2000) TNK148R W L G L N D M A A E G T W V D M T G A R I A Y K N W E T E I Graversen et al. 129 T A Q P D G G R T E N C A V L (2000) TNT149F W L G L N D M A A E G T W V D M T G A R I A Y K N W E T E I Graversen et al. 130 T A Q P D G G K F E N C A V L (2000) TNT149M W L G L N D M A A E G T W V D M T G A R I A Y K N W E T E I Graversen et al. 131 T A Q P D G G K M E N C A V L (2000) TNT149R W L G L N D M A A E G T W V D M T G A R I A Y K N W E T E I Graversen et al. 132 T A Q P D G G K R E N C A V L (2000) TNT149Y W L G L N D M A A E G T W V D M T G A R I A Y K N W E T E I Graversen et al. 133 T A Q P D G G K Y E N C A V L (2000) TNE150A W L G L N D M A A E G T W V D M T G A R I A Y K N W E T E I Graversen et al. 134 T A Q P D G G K T A N C A V L (1998) TNE150D W L G L N D M A A E G T W V D M T G A R I A Y K N W E T E I Graversen et al. 135 T A Q P D G G K T D N C A V L (2000) TNE150Q W L G L N D M A A E G T W V D M T G A R I A Y K N W E T E I Graversen et al. 136 T A Q P D G G K T Q N C A V L (2000) TNN151A W L G L N D M A A E G T W V D M T G A R I A Y K N W E T E I Graversen et al. 137 T A Q P D G G K T E A C A V L (1998) TNK148R, W L G L N D M A A E G T W V D M T G A R I A Y K N W E T E I Graversen et al. 138 T149Y T A Q P D G G R Y E N C A V L (2000) TNT149Y, W L G L N D M A A E G T W V D M T G A R I A Y K N W E T E I Graversen et al. 139 E150Q T A Q P D G G K Y Q N C A V L (2000) TNT149Y, W L G L N D M A A E G T W V D M T G A R I A Y K N W E T E I Graversen et al. 140 D165N T A Q P D G G K Y E N C A V L (2000) rMBP QPD F L G I T D E V T E G Q F M Y V T G G R L T Y S N W K K D Q Drickamer (1992) 141 P D D H G S G E D C V T I N187D F L G I T D E V T E G Q F M Y V T G G R L T Y S N W K K D E Iobst et al. 142 P D D H G S G E D C V T I (1994) H189A F L G I T D E V T E G Q F M Y V T G G R L T Y S N W K K D E Iobst et al. 143 P N D A G S G E D C V T I (1994) H189G F L G I T D E V T E G Q F M Y V T G G R L T Y S N W K K D E Iobst et al. 144 P N D G G S G E D C V T I (1994) QPDW F L G I T D E V T E G Q F M Y V T G G R L T Y S N W K K D Q Iobst & Drickamer 145 P D D W G S G E D C V T I (1994) QPDWG F L G I T D E V T E G Q F M Y V T G G R L T Y S N W K K D Q Iobst & Drickamer 146 P D D W Y G HGLGG G E D C V T I (1994) QPDWG/Y/A F L G I T D E V T E G Q F M Y V T G G R L T Y S N W K K D Q Iobst & Drickamer 147 P D D W A G HGLGG G E D C V T I (1994) QPDWG/Y/Q F L G I T D E V T E G Q F M Y V T G G R L T Y S N W K K D Q Iobst & Drickamer 148 P D D W Q G HGLGG G E D C V T I (1994) QPDWG/G/A F L G I T D E V T E G Q F M Y V T G G R L T Y S N W K K D Q Iobst & Drickamer 149 P D D W Y A HGLGG G E D C V T I (1994) QPDWG/H/A F L G I T D E V T E G Q F M Y V T G G R L T Y S N W K K D Q Iobst & Drickamer 150 P D D W Y G AGLGG G E D C V T I (1994) QPDWG/H/Q F L G I T D E V T E G Q F M Y V T G G R L T Y S N W K K D Q Iobst & Drickamer 151 P D D W Y G QGLGG G E D C V T I (1994) QPDWG/H/E F L G I T D E V T E G Q F M Y V T G G R L T Y S N W K K D Q Iobst & Drickamer 152 P D D W Y G EGLGG G E D C V T I (1994) QPDWG/H/Y F L G I T D E V T E G Q F M Y V T G G R L T Y S N W K K D Q Iobst & Drickamer 153 P D D W Y G YGLGG G E D C V T I (1994) QPDWG/-/G F L G I T D E V T E G Q F M Y V T G G R L T Y S N W K K D Q Iobst & Drickamer 154 P D D W Y G HGL G G E D C V T I (1994) QPDF F L G I T D E V T E G Q F M Y V T G G R L T Y S N W K K D Q Iobst & Drickamer 155 P D D F G S G E D C V T I (1994) QPDFG F L G I T D E V T E G Q F M Y V T G G R L T Y S N W K K D Q Iobst & Drickamer 156 P D D F Y G HGLGG G E D C V T I (1994) REGION 1 F L G I R K V N N V F M Y V T G G R L T Y S N W K K D E P N Blanck et al. 157 D H G S G E D C V T I (1996) REGION 2 F L G I T D E V T E G Q F M Y V T G G R L T Y S N W K K D E Blanck et al. 158 P N N R Q K D E D C V T I (1996) RES. 189 F L G I T D E V T E G Q F M Y V T G G R L T Y S N W K K D E Torgersen et al. 159 P N D G G S G E D C V T I (1998) RES. 197 F L G I T D E V T E G Q F M Y V T G G R L T Y S N W K K D E Torgersen et al. 160 P N D H G S G E D C V E I (1998) LOOP 3E F L G I T D E V T E G Q F M Y V T G G R L T Y S N W A P G E Torgersen et al. 161 P N D H G S G E D C V T I (1998) LOOP 3P F L G I T D E V T E G Q F M Y V T G G R L T Y S N W A D N E Torgersen et al. 162 P N D H G S G E D C V T I (1998) REGION 4 F L G I T D E V T E G Q F M Y V T G G R L T Y S N W K K D Q Kolatkar et al. 163 P D D W Y G HGLGG G E D C V H I (1998) REGION 4' F L G I T D E V T E G Q F M Y V T G G R L T Y S N W R P G Q Kolatkar et al. 164 P D D W Y G HGLGG G E D C V H I (1998) QPDWG/QNG F L G I T D Q N G Q F M Y V T G G R L T Y S N W K K D Q P D Wragg & Drickamer 165 D W Y G HGLGG G E D C V T I (1999) QPDWG/QNGP F L G I T D Q N G P F M Y V T G G R L T Y S N W K K D Q P D Wragg & Drickamer 166 D W Y G HGLGG G E D C V T I (1999) MBP/CHL189 F L G I T D E V T E G Q F M Y V T G G R L T Y S N W K E G E Burrows et al. 167 P N N R G S G E D C V T I (1997) MBP/CHL192 F L G I T D E V T E G Q F M Y V T G G R L T Y S N W K E G E Burrows et al. 168 P N N R G F N E D C V T I (1997) MBP/CHL208 F L G I T D E V T E G Q F M Y V T G G R L T Y S N W K E G E Burrows et al. 169 P N N R G F N E D C A H V (1997) rSP-A E195Q, Y L G M I E D Q T P G D F H Y L D G A S V N Y T N W Y P G Q McCormack et al. 170 R197D P D G Q G K E K C V E M (1994) AM2 Y L G M I E D Q T P G D F H Y L D G A S V N Y T N W Y P G E Honma et al. 171 P R G Q G K E K C V T I (1997) AM3 Y L G M I E D Q T P G D F H Y L D G A S V N Y T N W Y P G E Honma et al. 172 P N D H G S G E D C V T I (1997) E195A Y L G M I E D Q T P G D F H Y L D G A S V N Y T N W Y P G A McCormack et al. 173 P R G Q G K E K C V E M (1997) R197G Y L G M I E D Q T P G D F H Y L D G A S V N Y T N W Y P G E McCormack et al. 174 P G G Q G K E K C V E M (1997) E202A Y L G M I E D Q T P G D F H Y L D G A S V N Y T N W Y P G E McCormack et al. 175 P R G Q G K A K C V E M (1997) N187S Y L G M I E D Q T P G D F H Y L D G A S V S Y T N W Y P G E McCormack et al. 176 P R G Q G K E K C V E M (1997) R197A Y L G M I E D Q T P G D F H Y L D G A S V N Y T N W Y P G E Pattanajitvilai 177 P A G Q G K E K C V E M et al. (1998) R197K Y L G M I E D Q T P G D F H Y L D G A S V N Y T N W Y P G E Pattanajitvilai 178 P K G Q G K E K C V E M et al. (1998) R197H Y L G M I E D Q T P G D F H Y L D G A S V N Y T N W Y P G E Pattanajitvilai 179 P H G Q G K E K C V E M et al. (1998) R197D Y L G M I E D Q T P G D F H Y L D G A S V N Y T N W Y P G E Pattanajitvilai 180 P D G Q G K E K C V E M et al. (1998) R197N Y L G M I E D Q T P G D F H Y L D G A S V N Y T N W Y P G E Pattanajitvilai 181 P N G Q G K E K C V E M et al. (1998)

E195Q Y L G M I E D Q T P G D F H Y L D G A S V N Y T N W Y P G Q Tsunezawa et al. 182 P R G Q G K E K C V E M (1998) K201A Y L G M I E D Q T P G D F H Y L D G A S V N Y T N W Y P G E Tsunezawa et al. 183 P R G Q G A E K C V E M (1998) K203A Y L G M I E D Q T P G D F H Y L D G A S V N Y T N W Y P G E Tsunezawa et al. 184 P R G Q G K E A C V E M (1998) E197A, Y L G M I E D Q T P G D F H Y L D G A S V N Y T N W Y P G A Tsunezawa et al. 185 K201A,K203A P R G Q G A E A C V E M (1998) ad3 Y L G M I E D Q T P G D F H Y L D G A S V N Y T N W Y P G E Sano et al. (1998) 186 P N N N G G A E N C V E I ad4 Y L G M I E D Q T E G K F T Y P T G E A L V Y S N W A P G E Sano et al. (1998) 187 P N N N G G A E N C V E I rat ama4 Y L G M I E D Q T E G Q F M Y V T G G R L T Y S N W K K D E Chiba et al (1999) 188 P R G Q G K E K C V E M hSP-A R199A Y V G L T E G P S P G D F R Y S D G T P V N Y T N W Y R G E Tsunezawa et al. 189 P A G A G K E Q C V E M (1998) K201A Y V G L T E G P S P G D F R Y S D G T P V N Y T N W Y R G E Tsunezawa et al. 190 P A G R G A E Q C V E M (1998) hum ama4 Y V G L T E G P T E G Q F M Y V T G G R L T Y S N W K K D E Chiba et al (1999) 191 P R G R G K E Q C V E M rSP-D E321Q, F L S M T D V G T E G K F T Y P T G E A L V Y S N W A P G Q Ogasawara & Voelker 192 N323D P D N N G G A E N C V E I (1995) h-esl K67A W I G I R K V N N V W V W V G T Q A P L T E E A K N W A P G Erbe et al. 193 E P N N R Q K D E D C V E I K74A W I G I R K V N N V W V W V G T Q K P L T E E A A N W A P G Erbe et al. 194 E P N N R Q K D E D C V E I R84A,K86A W I G I R K V N N V W V W V G T Q K P L T E E A K N W A P G Erbe et al. 195 E P N N A Q A D E D C V E I R84A W I G I R K V N N V W V W V G T Q K P L T E E A K N W A P G Kogan et al. (1995) 196 E P N N A Q K D E D C V E I R84K W I G I R K V N N V W V W V G T Q K P L T E E A K N W A P G Kogan et al. (1995) 197 E P N N K Q K D E D C V E I R84K,D89G W I G I R K V N N V W V W V G T Q K P L T E E A K N W A P G Kogan et al. (1995) 198 E P N N K Q K D E G C V E I A77K W I G I R K V N N V W V W V G T Q K P L T E E A K N W K P G Kogan et al. (1995) 199 E P N N R Q K D E D C V E I A77K,P78K W I G I R K V N N V W V W V G T Q K P L T E E A K N W K K G Kogan et al. (1995) 200 E P N N R Q K D E D C V E I A77K,P78K, W I G I R K V N N V W V W V G T Q K P L T E E A K N W K K G Kogan et al. (1995) 201 R84A E P N N A Q K D E D C V E I D87E W I G I R K V N N V W V W V G T Q K P L T E E A K N W A P G Kogan et al. (1995) 202 E P N N R Q K E E D C V E I D87N W I G I R K V N N V W V W V G T Q K P L T E E A K N W A P G Kogan et al. (1995) 203 E P N N R Q K N E D C V E I D89N W I G I R K V N N V W V W V G T Q K P L T E E A K N W A P G Kogan et al. (1995) 204 E P N N R Q K D E N C V E I D89E W I G I R K V N N V W V W V G T Q K P L T E E A K N W A P G Kogan et al. (1995) 205 E P N N R Q K D E E C V E I A77K,E80Q, W I G I R K V N N V W V W V G T Q K P L T E E A K N W K P G Kogan et al. (1995) 206 N82D Q P D N R Q K D E D C V E I h-psl A77K W I G I R K N N K T W T W V G T K K A L T N E A E N W K D N Revelle et al. 207 E P N N K R N N E D C V E I (1996) A77K,E80D, W I G I R K N N K T W T W V G T K K A L T N E A E N W K D N Revelle et al. 208 N82D Q P D N K R N N E D C V E I (1996) MGR 2A/R WIGL T D Q N G P W R W V D G T D Y E K G F T H W R P K Q P Iobst & Drickamer 209 D N W Y G H G L G G G E D CAHF (1996) 2K/G WIGL T D Q N G P W R W V D G T D Y E K G F T H W A P G Q P Iobst & Drickamer 210 D N W Y G H G L G G G E D CAHF (1996) 2A/R,2K/G WIGL T D Q N G P W R W V D G T D Y E K G F T H W R P G Q P Iobst & Drickamer 211 D N W Y G H G L G G G E D CAHF (1996) 4F/I WIGL T D Q N G P W R W V D G T D Y E K G F T H W A P K Q P Iobst & Drickamer 212 D N W Y G H G L G G G E D CAHI (1996) 4H/A WIGL T D Q N G P W R W V D G T D Y E K G F T H W A P K Q P Iobst & Drickamer 213 D N W Y G H G L G G G E D CAAF (1996) 4H/E WIGL T D Q N G P W R W V D G T D Y E K G F T H W A P K Q P Iobst & Drickamer 214 D N W Y G H G L G G G E D CAEF (1996) 4H/Q WIGL T D Q N G P W R W V D G T D Y E K G F T H W A P K Q P Iobst & Drickamer 215 D N W Y G H G L G G G E D CAQF (1996) 4H/N WIGL T D Q N G P W R W V D G T D Y E K G F T H W A P K Q P Iobst & Drickamer 216 D N W Y G H G L G G G E D CANF (1996) 4H/Y WIGL T D Q N G P W R W V D G T D Y E K G F T H W A P K Q P Iobst & Drickamer 217 D N W Y G H G L G G G E D CAYF (1996) 4H/D WIGL T D Q N G P W R W V D G T D Y E K G F T H W A P K Q P Iobst & Drickamer 218 D N W Y G H G L G G G E D CADF (1996) 4H/K WIGL T D Q N G P W R W V D G T D Y E K G F T H W A P K Q P Iobst & Drickamer 219 D N W Y G H G L G G G E D CAKF (1996) 2A/R,2K/G, WIGL T D Q N G P W R W V D G T D Y E K G F T H W R P G Q P Iobst & Drickamer 220 4H/A D N W Y G H G L G G G E D CAAF (1996) RHL 4H/A WIGL T D Q N G P W K W V D G T D Y E T G F K N W R P G Q P Iobst & Drickamer 221 D D W Y G H G L G G G E D CAAF (1996) CHL R173A W I G L T D E N Q E G E W Q W V D G T D T R S S F T F W K E Burrows et al. 222 G E P N N A G F N E D C A H V (1997) G174A W I G L T D E N Q E G E W Q W V D G T D T R S S F T F W K E Burrows et al. 223 G E P N N R A F N E D C A H V (1997) F175A W I G L T D E N Q E G E W Q W V D G T D T R S S F T F W K E Burrows et al. 224 G E P N N R G A N E D C A H V (1997) N176A W I G L T D E N Q E G E W Q W V D G T D T R S S F T F W K E Burrows et al. 225 G E P N N R G F A E D C A H V (1997) LSB derivatives (.beta.3 and .beta.4 consensus elements are underlined) SEQ ID CTDL Mut. LSB sequence (one letter code) Reference NO hTN TNK163A C A V L S G A A N G A W F D K R C Graversen et al. 226 (1998) TNK166A C A V L S G A A N G K W F D A R C Graversen et al. 227 (1998) TNR167A C A V L S G A A N G K W F D K A C Graversen et al. 228 (1998) TNF164L C A V L S G A A N G K W L D K R C Graversen et al. 229 (1998) TND165A C A V L S G A A N G K W F A K R C Graversen et al. 230 (1998) TND165E C A V L S G A A N G K W F E K R C Graversen et al. 231 (2000) TND165N C A V L S G A A N G K W F N K R C Graversen et al. 232 (2000) rMBP I207V C V T I V D N G L W N D V S C Iobst et al. (1994) 233 I207L C V T I V D N G L W N D L S C Iobst et al. (1994) 234 I207A C V T I V D N G L W N D A S C Iobst et al. (1994) 235 I207E C V T I V D N G L W N D E S C Torgensen et al. 236 (1996) Region 4E C V T I V Y I K R E K D N G L W N D I S C Torgensen et al. 237 (1996) Region 4P C V T I V Y I K S P S D N G L W N D I S C Torgensen et al. 238 (1996) 207VY C V T I V D N G L W N D V Y C Burrows et al. 239 (1997) .beta.34 C A H V W T S G Q W N D V Y C Burrows et al. 240 (1997) h-esl Y94F C V E I F I K R E K D V G M W N D E R C Kogan et al. (1995) 241 Y94R C V E I R I K R E K D V G M W N D E R C Kogan et al. (1995) 242 Y94D C V E I D I K R E K D V G M W N D E R C Kogan et al. (1995) 243 Y94A C V E I A I K R E K D V G M W N D E R C Kogan et al. (1995) 244 Y94S C V E I S I K R E K D V G M W N D E R C Kogan et al. (1995) 245 E107D C V E I Y I K R E K D V G M W N D D R C Kogan et al. (1995) 246 E107A C V E I Y I K R E K D V G M W N D A R C Kogan et al. (1995) 247 E107N C V E I Y I K R E K D V G M W N D N R C Kogan et al. (1995) 248 E107K C V E I Y I K R E K D V G M W N D K R C Kogan et al. (1995) 249 E107Q C V E I Y I K R E K D V G M W N D Q R C Kogan et al. (1995) 250 R97D C V E I Y I K D E K D V G M W N D E R C Revelle et al. 251 (1996) R97S C V E I Y I K S E K D V G M W N D E R C Revelle et al. 252 (1996)

R97E C V E I Y I K E E K D V G M W N D E R C Revelle et al. 253 (1996) h-psl K96Q C V E I Y I Q S P S A P G M W N D E H C Revelle et al. 254 (1996) K96R C V E I Y I R S P S A P G M W N D E H C Revelle et al. 255 (1996) K96E C V E I Y I E S P S A P G M W N D E H C Revelle et al. 256 (1996) S97A C V E I Y I K A P S A P G M W N D E H C Revelle et al. 257 (1996) S97D C V E I Y I K D P S A P G M W N D E H C Revelle et al. 258 (1996) S97R C V E I Y I K R P S A P G M W N D E H C Revelle et al. 259 (1996) REK C V E I Y I K R E K A P G M W N D E H C Revelle et al. 260 (1996) S99D C V E I Y I K S P D A P G M W N D E H C Revelle et al. 261 (1996) CHL V191A C A H V W T S G Q W N D A Y C Burrows et al. 262 (1997) Y192A C A H V W T S G Q W N D V A C Burrows et al. 263 (1997) Other TN CTLD derivatives SEQ ID CTDL Mut. TN sequence (one letter code) Reference NO hTN TNR169A S G A A N G K W F D K R C A D Q Graversen et al. 264 (1998) TNS85G C I S R G G T L G T P Q T Jaquinod et al. 265 (1999) Notes: hTN: human tetranectin; rMBP: rat mannose binding protein, rSP-A: rat surfactant protein-A, hSP-A: human surfactant protein-A, rSP-D: rat surfactant protein-D; h-esl: human e-selectin; h-psl: human p-selectin; MGR: macrophage galactose receptor; RHL: rat hepatic lectin, CHL: chicken hepatic lectin

[0062] Normally the model CTLD is defined by having a 3D structure that conforms to the secondary-structure arrangement illustrated in FIG. 1 characterized by the following main secondary structure elements: [0063] five .beta.-strands and two .alpha.-helices sequentially appearing in the order .beta.1, .alpha.1, .alpha.2, .beta.2, .beta.3, .beta.4, and .beta.5, the .beta.-strands being arranged in two anti-parallel .beta.-sheets, one composed of .beta.1 and .beta.5, the other composed of .beta.2, .beta.3 and .beta.4, [0064] at least two disulfide bridges, one connecting al and .beta.5 and one connecting .beta.3 and the polypeptide segment connecting .beta.4 and .beta.5, [0065] a loop region consisting of two polypeptide segments, loop segment A (LSA) connecting .beta.2 and .beta.3 and comprising typically 15-70 or, less typically, 5-14 amino acid residues, and loop segment B (LSB) connecting .beta.3 and .beta.4 and comprising typically 5-12 or less typically, 2-4 amino acid residues.

[0066] However, also a CTLD, for which no precise 3D structure is available, can be used as a model CTLD, such CTLD being defined by showing sequence similarity to a previously recognised member of the CTLD family as expressed by an amino acid sequence identity of at least 22%, preferably at least 25% and more preferably at least 30%, and by containing the cysteine residues necessary for establishing the conserved two-disulfide bridge topology (i.e. Cys.sub.I, Cys.sub.II, Cys.sub.III and Cys.sub.IV). The loop region, consisting of the loop segments LSA and LSB, and its flanking .beta.-strand structural elements can then be identified by inspection of the sequence alignment with the collection of CTLDs shown in FIG. 1, which provides identification of the sequence locations of the .beta.2- and .beta.3-strands with the further corroboration provided by comparison of these sequences with the four-residue consensus sequences, .beta.2cseq and .beta.3cseq, and the .beta.4 strand segment located typically at positions -6 to -2 and less typically at positions -5 to -2 relative to the conserved Cys.sub.III residue and with the characteristic residues at positions -5 and -3 as elucidated from Table 1 and deducted above under BACKGROUND OF THE INVENTION.

[0067] The same considerations apply for determining whether in a model CTLD the .alpha.-helices and .beta.-strands and connecting segments are conserved to such a degree that the scaffold structure of the CTLD is substantially maintained.

[0068] It may be desirable that up to 10, preferably up to 4, and more preferably 1 or 2, amino acid residues are substituted, deleted or inserted in the .alpha.-helices and/or .beta.-strands and/or connecting segments of the model CTLD. In particular, changes of up to 4 residues may be made in the .beta.-strands of the model CTLD as a consequence of the introduction of recognition sites for one or more restriction endonucleases in the nucleotide sequence encoding the CTLD to facilitate the excision of part or all of the loop region and the insertion of an altered amino acid sequence instead while the scaffold structure of the CTLD is substantially maintained.

[0069] Of particular interest are proteins wherein the model CTLD is that of a tetranectin. Well known tetranectins the CTLDs of which can be used as model CTLDs are human tetranectin and murine tetranectin. The proteins according to the invention thus comprise variants of such model CTLDs.

[0070] The proteins according to the invention may comprise N-terminal and/or C-terminal extensions of the CTLD variant, and such extensions may for example contain effector, enzyme, further binding and/or multimerising functions. In particular, said extension may be the non-CTLD-portions of a native C-type lectin-like protein or C-type lectin or a "soluble" variant thereof lacking a functional transmembrane domain.

[0071] The proteins according to the invention may also be multimers of a moiety comprising the CTLD variant, e.g. derivatives of the native tetranectin trimer.

[0072] In a preferred aspect the present invention provides a combinatorial library of proteins having the scaffold structure of C-type lectin-like domains (CTLD), said proteins comprising variants of a model CTLD wherein the .alpha.-helices and .beta.-strands are conserved to such a degree that the scaffold structure of the CTLD is substantially maintained, while the loop region or parts of the loop region of the CTLD is randomized with respect to amino acid sequence and/or number of amino acid residues.

[0073] The proteins making up such a library comprise variants of model CTLDs defined as for the above proteins according to the invention, and the variants may include the changes stated for those proteins.

[0074] In particular, the combinatorial library according to the invention may consist of proteins wherein the model CTLD is that of a tetranectin, e.g. that of human tetranectin or that of murine tetranectin.

[0075] The combinatorial library according to the invention may consist of proteins comprising N-terminal and/or C-terminal extensions of the CTLD variant, and such extensions may for example contain effector, enzyme, further binding and/or multimerising functions. In particular, said extensions may be the non-CTLD-portions of a native C-type lectin-like protein or C-type lectin or a "soluble" variant thereof lacking a functional transmembrane domain.

[0076] The combinatorial library according to the invention may also consist of proteins that are multimers of a moiety comprising the CTLD variant, e.g. derivatives of the native tetranectin trimer.

[0077] The present invention also provides derivatives of a native tetranectin wherein up to 10, preferably up to 4, and more preferably 1 or 2, amino acid residues are substituted, deleted or inserted in the .alpha.-helices and/or .beta.-strands and/or connecting segments of its CTLD as well as nucleic acids encoding such derivatives. Specific derivatives appear from SEQ ID Nos: 02, 04, 09, 11, 13, 15, 29, 31, 36, and 38; and nucleic acids comprising nucleotide inserts encoding specific tetranectin derivatives appear from SEQ ID Nos: 12, 14, 35, and 37.

[0078] The invention comprises a method of constructing a tetranectin derivative adapted for the preparation of a combinatorial library according to the invention, wherein the nucleic acid encoding the tetranectin derivative has been modified to generate endonuclease restriction sites within nucleic acid segments encoding .beta.2, .beta.3 or .beta.4, or up to 30 nucleotides upstream or downstream in the sequence from any nucleotide which belongs to a nucleic acid segment encoding .beta.2, .beta.3 or .beta.4.

[0079] The invention also comprises the use of a nucleotide sequence encoding a tetranectin, or a derivative thereof wherein the scaffold structure of its CTLD is substantially maintained, for preparing a library of nucleotide sequences encoding related proteins by randomising part or all of the nucleic acid sequence encoding the loop region of its CTLD.

[0080] Further, the present invention provides nucleic acid comprising any nucleotide sequence encoding a protein according to the invention.

[0081] In particular, the invention provides a library of nucleic acids encoding proteins of a combinatorial library according to the invention, in which the members of the ensemble of nucleic acids, that collectively constitute said library of nucleic acids, are able to be expressed in a display system, which provides for a logical, physical or chemical link between entities displaying phenotypes representing properties of the displayed expression products and their corresponding genotypes.

[0082] In such a library the display system may be selected from [0083] (I) a phage display system such as [0084] (1) a filamentous phage fd in which the library of nucleic acids is inserted into [0085] (a) a phagemid vector, [0086] (b) the viral genome of a phage [0087] (c) purified viral nucleic acid in purified single- or double-stranded form, or [0088] (2) a phage lambda in which the library is inserted into [0089] (a) purified phage lambda DNA, or [0090] (b) the nucleic acid in lambda phage particles; or [0091] (II) a viral display system in which the library of nucleic acids is inserted into the viral nucleic acid of a eukaryotic virus such as baculovirus; or [0092] (III) a cell-based display system in which the library of nucleic acids is inserted into, or adjoined to, a nucleic acid carrier able to integrate either into the host genome or into an extrachromosomal element able to maintain and express itself within the cell and suitable for cell-surface display on the surface of [0093] (a) bacterial cells, [0094] (b) yeast cells, or [0095] (c) mammalian cells; or [0096] (IV) a nucleic acid entity suitable for ribosome linked display into which the library of nucleic acid is inserted; or [0097] (V) a plasmid suitable for plasmid linked display into which the library of nucleic acid is inserted.

[0098] A well-known and useful display system is the "Recombinant Phage Antibody System" with the phagemid vector "pCANTAB 5E" supplied by Amersham Pharmacia Biotech (code no. 27-9401-01).

[0099] Further, the present invention provides a method of preparing a protein according to the invention, wherein the protein comprises at least one or more, identical or not identical, CTLD domains with novel loop-region sequences which has (have) been isolated from one or more CTLD libraries by screening or selection. At least one such CTLD domain may have been further modified by mutagenesis; and the protein containing at least one CTLD domain may have been assembled from two or more components by chemical or enzymatic coupling or crosslinking.

[0100] Also, the present invention provides a method of preparing a combinatorial library according to the invention comprising the following steps: [0101] 1) inserting nucleic acid encoding a protein comprising a model CTLD into a suitable vector, [0102] 2) if necessary, introducing restriction endonuclease recognition sites by site directed mutagenesis, said recognition sites being properly located in the sequence at or close to the ends of the sequence encoding the loop region of the CTLD or part thereof, [0103] 3) excising the DNA fragment encoding the loop region or part thereof by use of the proper restriction endonucleases, [0104] 4) ligating mixtures of DNA fragments into the restricted vector, and [0105] 5) inducing the vector to express randomized proteins having the scaffold structure of CTLDs in a suitable medium.

[0106] In a further aspect, the present invention provides a method of screening a combinatorial library according to the invention for binding to a specific target which comprises the following steps: [0107] 1) expressing a nucleic acids library to display the library of proteins in the display system; [0108] 2) contacting the collection of entities displayed with a suitably tagged target substance for which isolation of a CTLD-derived exhibiting affinity for said target substance is desired; [0109] 3) harvesting subpopulations of the entities displayed that exhibit affinity for said target substance by means of affinity-based selective extractions, utilizing the tag to which said target substance is conjugated or physically attached or adhering to as a vehicle or means of affinity purification, a procedure commonly referred to in the field as "affinity panning", followed by re-amplification of the sub-library; [0110] 4) isolating progressively better binders by repeated rounds of panning and re-amplification until a suitably small number of good candidate binders is obtained; and, [0111] 5) if desired, isolating each of the good candidates as an individual clone and subjecting it to ordinary functional and structural characterisation in preparation for final selection of one or more preferred product clones.

[0112] In a still further aspect, the present invention provides a method of reformatting a protein according to the invention or selected from a combinatorial library according to the invention and containing a CTLD variant exhibiting desired binding properties, in a desired alternative species-compatible framework by excising the nucleic acid fragment encoding the loop region-substituting polypeptide and any required single framework mutations from the nucleic acid encoding said protein using PCR technology, site directed mutagenesis or restriction enzyme digestion and inserting said nucleic acid fragment into the appropriate location(s) in a display--or protein expression vector that harbours a nucleic acid sequence encoding the desired alternative CTLD framework.

BRIEF DESCRIPTION OF THE DRAWINGS

[0113] FIG. 1 shows an alignment of the amino acid sequences of ten CTLDs of known 3D-structure. The sequence locations of main secondary structure elements are indicated above each sequence, labelled in sequential numerical order as ".alpha.N", denoting .alpha.-helix number N, and ".beta.M", denoting (.beta.-strand number M.

[0114] The four cysteine residues involved in the formation of the two conserved disulfide bridges of CTLDs are indicated and enumerated in the Figure as "C.sub.I", "C.sub.II", "C.sub.III" and "C.sub.IV", respectively. The two conserved disulfide bridges are C.sub.I-C.sub.IV and C.sub.II-C.sub.III, respectively.

[0115] The ten C-type lectins are [0116] hTN: human tetranectin [Nielsen et al. (1997)]; [0117] MBP: mannose binding protein [Weis et al. (1991); Sheriff et al. (1994)]; [0118] SP-D: surfactant protein D [Hakansson et al. (1999)]; [0119] LY49A: NK receptor LY49A [Tormo et al. (1999)]; [0120] H1-ASR: H1 subunit of the asialoglycoprotein receptor [Meier et al. (2000)]; [0121] MMR-4: macrophage mannose receptor domain 4 [Feinberg et al. (2000)]; [0122] IX-A and IX-B: coagulation factors IX/X-binding protein domain A and B, respectively [Mizuno et al. (1997)]; [0123] Lit: lithostatine [Bertrand et al. (1996)]; [0124] TU14: tunicate C-type lectin [Poget et al. (1999)].

[0125] FIG. 2 shows an alignment of the nucleotide and amino acid sequences of the coding regions of the mature forms of human and murine tetranectin with an indication of known secondary structural elements. [0126] hTN: human tetranectin; nucleotide sequence from Berglund and Petersen (1992). [0127] mTN: murine tetranectin; nucleotide sequence from Sorensen et al. (1995). [0128] Secondary structure elements from Nielsen et al. (1997).

[0129] ".alpha." denotes an .alpha.-helix; ".beta." denotes a .beta.-strand; and "L" denotes a loop.

[0130] FIG. 3 shows an alignment of the nucleotide and amino acid sequences of human and murine tlec coding regions.

[0131] htlec: the sequence derived from hTN; mtlec: the sequence derived from mTN. The position of the restriction endonuclease sites for Bgl II, Kpn I, and Mun I are indicated.

[0132] FIG. 4 shows an alignment of the nucleotide and amino acid sequences of human and murine tCTLD coding regions. htCTLD: the sequence derived from hTN; mtCTLD: the sequence derived from mTN. The position of the restriction endonuclease sites for Bgl II, Kpn I, and Mun I are indicated.

[0133] FIG. 5 shows an outline of the pT7H6FX-htlec expression plasmid. The FX-htlec fragment was inserted into pT7H6 [Christensen et al. (1991)] between the Bam HI and Hind III cloning sites.

[0134] FIG. 6 shows the amino acid sequence (one letter code) of the FX-htlec part of the H6FX-htlec fusion protein produced by pT7H6FX-htlec.

[0135] FIG. 7 shows an outline of the pT7H6FX-htCTLD expression plasmid. The FX-htCTLD fragment was inserted into pT7H6 [Christensen et al. (1991)] between the Bam HI and Hind III cloning sites.

[0136] FIG. 8 shows the amino acid sequence (one letter code) of the FX-htCTLD part of the H6FX-htCTLD fusion protein produced by pT7H6FX-htCTLD.

[0137] FIG. 9 shows an outline of the pPhTN phagemid. The PhTN fragment was inserted into the phagemid pCANTAB 5E (Amersham Pharmacia Biotech, code no. 27-9401-01) between the Sfi I and Not I restriction sites.

[0138] FIG. 10 shows the amino acid sequence (one letter code) of the PhTN part of the PhTN-gene III fusion protein produced by pPhTN.

[0139] FIG. 11 shows an outline of the pPhTN3 phagemid. The PhTN3 fragment was inserted into the phagemid pCANTAB 5E (Amersham Pharmacia Biotech, code no. 27-9401-01) between the Sfi I and Not I restriction sites.

[0140] FIG. 12 shows the amino acid sequence (one letter code) of the PhTN3 part of the PhTN3-gene III fusion protein produced by pPhTN3.

[0141] FIG. 13 shows an outline of the pPhtlec phagemid. The Phtlec fragment was inserted into the phagemid pCANTAB 5E (Amersham Pharmacia Biotech, code no. 27-9401-01) between the Sfi I and Not I restriction sites.

[0142] FIG. 14 shows the amino acid sequence (one letter code) of the Phtlec part of the Phtlec-gene III fusion protein produced by pPhtlec.

[0143] FIG. 15 shows an outline of the pPhtCTLD phagemid. The PhtCTLD fragment was inserted into the phagemid pCANTAB 5E (Amersham Pharmacia Biotech, code no. 27-9401-01) between the Sfi I and Not I restriction sites.

[0144] FIG. 16 shows the amino acid sequence (one letter code) of the PhtCTLD part of the PhtCTLD-gene III fusion protein produced by pPhtCTLD.

[0145] FIG. 17 shows an outline of the pUC-mtlec.

[0146] FIG. 18 shows an outline of the pT7H6FX-mtlec expression plasmid. The FX-mtlec fragment was inserted into pT7H6 [Christensen et al. (1991)] between the Bam HI and Hind III cloning sites.

[0147] FIG. 19 shows the amino acid sequence (one letter code) of the

[0148] FX-mtlec part of the H6FX-mtlec fusion protein produced by pT7H6FX-mtlec.

[0149] FIG. 20 shows an outline of the pT7H6FX-mtCTLD expression plasmid. The FX-mtCTLD fragment was inserted into pT7H6 [Christensen et al. (1991)] between the Bam HI and Hind III cloning sites.

[0150] FIG. 21 shows the amino acid sequence (one letter code) of the FX-mtCTLD part of the H6FX-mtCTLD fusion protein produced by pT7H6FX-mtCTLD.

[0151] FIG. 22 shows an outline of the pPmtlec phagemid. The Pmtlec fragment was inserted into the phagemid pCANTAB 5E (Amersham Pharmacia Biotech, code no. 27-9401-01) between the Sfi I and Not I restriction sites.

[0152] FIG. 23 shows the amino acid sequence (one letter code) of the Pmtlec part of the Pmtlec-gene III fusion protein produced by pPmtlec.

[0153] FIG. 24 shows an outline of the pPmtCTLD phagemid. The PmtCTLD fragment was inserted into the phagemid pCANTAB 5E (Amersham Pharmacia Biotech, code no. 27-9401-01) between the Sfi I and Not I restriction sites.

[0154] FIG. 25 shows the amino acid sequence (one letter code) of the PmtCTLD part of the PmtCTLD-gene III fusion protein produced by pPmtCTLD.

[0155] FIG. 26 shows an ELISA-type analysis of Phtlec-, PhTN3-, and M13K07 helper phage binding to anti-tetranectin or BSA. Panel A: Analysis with 3% skimmed milk/5 mM EDTA as blocking reagent. Panel B: Analysis with 3% skimmed milk as blocking reagent.

[0156] FIG. 27 shows an ELISA-type analysis of Phtlec-, PhTN3-, and M13K07 helper phage binding to plasminogen (Plg) and BSA. Panel A: Analysis with 3% skimmed milk/5 mM EDTA as blocking reagent. Panel B: Analysis with 3% skimmed milk as blocking reagent.

[0157] FIG. 28 shows an ELISA-type analysis of the B series and C series polyclonal populations, from selection round 2, binding to plasminogen (Plg) compared to background.

[0158] FIG. 29 Phages from twelve clones isolated from the third round of selection analyzed for binding to hen egg white lysozyme, human .beta..sub.2-microglobulin and background in an ELISA-type assay.

[0159] FIG. 30 shows the amino acid sequence (one letter code) of the PrMBP part of the PrMBP-gene III fusion protein produced by pPrMBP.

[0160] FIG. 31 shows an outline of the pPrMBP phagemid. The PrMBP fragment was inserted into the phagemid pCANTAB 5E (Amersham Pharmacia Biotech, code no. 27-9401-01) between the Sfi I and Not I restriction sites.

[0161] FIG. 32 shows the amino acid sequence (one letter code) of the PhSP-D part of the PhSP-D-gene III fusion protein produced by pPhSP-D.

[0162] FIG. 33 shows an outline of the pPhSP-D phagemid. The PhSP-D fragment was inserted into the phagemid pCANTAB 5E (Amersham Pharmacia Biotech, code no. 27-9401-01) between the Sfi I and Not I restriction sites.

[0163] FIG. 34. Phages from 48 clones isolated from the third round of selection in the #1 series analyzed for binding to hen egg white lysozyme and to A-HA in an ELISA-type assay.

[0164] FIG. 35. Phages from 48 clones isolated from the third round of selection in the #4 series analyzed for binding to hen egg white lysozyme and to A-HA in an ELISA-type assay.

DETAILED DESCRIPTION OF THE INVENTION

[0165] I. Definitions

[0166] The terms "C-type lectin-like protein" and "C-type lectin" are used to refer to any protein present in, or encoded in the genomes of, any eukaryotic species, which protein contains one or more CTLDs or one or more domains belonging to a subgroup of CTLDs, the CRDs, which bind carbohydrate ligands. The definition specifically includes membrane attached C-type lectin-like proteins and C-type lectins, "soluble" C-type lectin-like proteins and C-type lectins lacking a functional transmembrane domain and variant C-type lectin-like proteins and C-type lectins in which one or more amino acid residues have been altered in vivo by glycosylation or any other post-synthetic modification, as well as any product that is obtained by chemical modification of C-type lectin-like proteins and C-type lectins.

[0167] In the claims and throughout the specification certain alterations may be defined with reference to amino acid residue numbers of a CTLD domain or a CTLD-containing protein. The amino acid numbering starts at the first N-terminal amino acid of the CTLD or the native or artificial CTLD-containing protein product, as the case may be, which shall in each case be indicated by unambiguous external literature reference or internal reference to a figure contained herein within the textual context.

[0168] The terms "amino acid", "amino acids" and "amino acid residues" refer to all naturally occurring L-.alpha.-amino acids. This definition is meant to include norleucine, ornithine, and homocysteine. The amino acids are identified by either the single-letter or three-letter designations:

TABLE-US-00003 Asp D aspartic acid Ile I isoleucine Thr T threonine Leu L leucine Ser S serine Tyr Y tyrosine Glu E glutamic acid Phe F phenylalanine Pro P proline His H histidine Gly G glycine Lys K lysine Ala A alanine Arg R arginine Cys C cysteine Trp W tryptophan Val V valine Gln Q glutamine Met M methionine Asn N asparagine Nle J norleucine Orn O ornithine Hcy U homocysteine Xxx X any L-.alpha.-amino acid.

[0169] The naturally occurring L-.alpha.-amino acids may be classified according to the chemical composition and properties of their side chains. They are broadly classified into two groups, charged and uncharged. Each of these groups is divided into subgroups to classify the amino acids more accurately: [0170] A. Charged Amino Acids [0171] Acidic Residues: Asp, Glu [0172] Basic Residues: Lys, Arg, His, Orn [0173] B. Uncharged Amino Acids [0174] Hydrophilic Residues: Ser, Thr, Asn, Gln [0175] Aliphatic Residues: Gly, Ala, Val, Leu, Ile, Nle [0176] Non-polar Residues: Cys, Met, Pro, Hcy [0177] Aromatic Residues: Phe, Tyr, Trp

[0178] The terms "amino acid alteration" and "alteration" refer to amino acid substitutions, deletions or insertions or any combinations thereof in a CTLD amino acid sequence. In the CTLD variants of the present invention such alteration is at a site or sites of a CTLD amino acid sequence. Substitutional variants herein are those that have at least one amino acid residue in a native CTLD sequence removed and a different amino acid inserted in its place at the same position. The substitutions may be single, where only one amino acid in the molecule has been substituted, or they may be multiple, where two or more amino acids have been substituted in the same molecule.

[0179] The designation of the substitution variants herein consists of a letter followed by a number followed by a letter. The first (leftmost) letter designates the amino acid in the native (unaltered) CTLD or CTLD-containing protein. The number refers to the amino acid position where the amino acid substitution is being made, and the second (righthand) letter designates the amino acid that is used to replace the native amino acid. As mentioned above, the numbering starts with "1" designating the N-terminal amino acid sequence of the CTLD or the CTLD-containing protein, as the case may be. Multiple alterations are separated by a comma (,) in the notation for ease of reading them.

[0180] The terms "nucleic acid molecule encoding", "DNA sequence encoding", and "DNA encoding" refer to the order or sequence of deoxyribonucleotides along a strand of deoxyribonucleic acid. The order of these deoxyribonucleotides determines the order of amino acids along the polypeptide chain. The DNA sequence thus encodes the amino acid sequence.

[0181] The terms "mutationally randomized sequence", "randomized polypeptide segment", "randomized amino acid sequence", "randomized oligonucleotide" and "mutationally randomized sequence", as well as any similar terms used in any context to refer to randomized sequences, polypeptides or nucleic acids, refer to ensembles of polypeptide or nucleic acid sequences or segments, in which the amino acid residue or nucleotide at one or more sequence positions may differ between different members of the ensemble of polypeptides or nucleic acids, such that the amino acid residue or nucleotide occurring at each such sequence position may belong to a set of amino acid residues or nucleotides that may include all possible amino acid residues or nucleotides or any restricted subset thereof. Said terms are often used to refer to ensembles in which the number of amino acid residues or nucleotides is the same for each member of the ensemble, but may also be used to refer to such ensembles in which the number of amino acid residues or nucleotides in each member of the ensemble may be any integer number within an appropriate range of integer numbers.

[0182] II. Construction and Utility of Combinatorial CTLD Libraries

[0183] Several systems displaying phenotype, in terms of putative ligand binding modules or modules with putative enzymatic activity, have been described. These include: phage display (e.g. the filamentous phage fd [Dunn (1996), Griffiths amd Duncan (1998), Marks et al. (1992)], phage lambda [Mikawa et al. (1996)]), display on eukarotic virus (e.g. baculovirus [Ernst et al. (2000)]), cell display (e.g. display on bacterial cells [Benhar et al. (2000)], yeast cells [Boder and Wittrup (1997)], and mammalian cells [Whitehorn et al. (1995)], ribosome linked display [Schaffitzel et al. (1999)], and plasmid linked display [Gates et al. (1996)].

[0184] The most commonly used method for phenotype display and linking this to genotype is by phage display. This is accomplished by insertion of the reading frame encoding the scaffold protein or protein of interest into an intra-domain segment of a surface exposed phage protein. The filamentous phage fd (e.g. M13) has proven most useful for this purpose. Polypeptides, protein domains, or proteins are the most frequently inserted either between the "export" signal and domain 1 of the fd gene III protein or into a so-called hinge region between domain 2 and domain 3 of the fd-phage gene III protein. Human antibodies are the most frequently used proteins for the isolation of new binding units, but other proteins and domains have also been used (e.g. human growth hormone [Bass et al. (1990)], alkaline phosphatase [McCafferty et al. (1991)], .beta.-lactamase inhibitory protein [Huang et al. (2000)], and cytotoxic T lymphocyte-associated antigen 4 [Hufton et al. (2000)]. The antibodies are often expressed and presented as scFv or Fab fusion proteins. Three strategies have been employed. Either a specific antibody is used as a scaffold for generating a library of mutationally randomized sequences within the antigen binding clefts [e.g. Fuji et al. (1998)] or libraries representing large ensembles of human antibody encoding genes from non-immunised hosts [e.g. Nissim et al. (1994)] or from immunised hosts [e.g. Cyr and Hudspeth (2000)] are cloned into the fd phage vector.

[0185] The general procedure for accomplishing the generation of a display system for the generation of CTLD libraries comprise essentially [0186] (1) identification of the location of the loop-region, by referring to the 3D structure of the CTLD of choice, if such information is available, or, if not, identification of the sequence locations of the .beta.2-, .beta.3- and .beta.4 strands by sequence alignment with the sequences shown in FIG. 1, as aided by the further corroboration by identification of sequence elements corresponding to the .beta.2 and .beta.3 consensus sequence elements and .beta.4-strand characteristics, also disclosed above; [0187] (2) subcloning of a nucleic acid fragment encoding the CTLD of choice in a protein display vector system with or without prior insertion of endonuclease restriction sites close to the sequences encoding .beta.2, .beta.3 and .beta.4; and [0188] (3) substituting the nucleic acid fragment encoding some or all of the loop-region of the CTLD of choice with randomly selected members of an ensemble consisting of a multitude of nucleic acid fragments which after insertion into the nucleic acid context encoding the receiving framework will substitute the nucleic acid fragment encoding the original loop-region polypeptide fragments with randomly selected nucleic acid fragments. Each of the cloned nucleic acid fragments, encoding a new polypeptide replacing an original loop-segment or the entire loop-region, will be decoded in the reading frame determined within its new sequence context.

[0189] Nucleic acid fragments may be inserted in specific locations into receiving nucleic acids by any common method of molecular cloning of nucleic acids, such as by appropriately designed PCR manipulations in which chemically synthesized nucleic acids are copy-edited into the receiving nucleic acid, in which case no endonuclease restriction sites are required for insertion. Alternatively, the insertion/excision of nucleic acid fragments may be facilitated by engineering appropriate combinations of endonuclease restriction sites into the target nucleic acid into which suitably designed oligonucleotide fragments may be inserted using standard methods of molecular cloning of nucleic acids.

[0190] It will be apparent that interesting CTLD variants isolated from CTLD libraries in which restriction endonuclease sites have been inserted for convenience may contain mutated or additional amino acid residues that neither correspond to residues present in the original CTLD nor are important for maintaining the interesting new affinity of the CTLD variant. If desirable, e.g. in case the product needs to be rendered as non-immunogenic as possible, such residues may be altered or removed by back-mutation or deletion in the specific clone, as appropriate.

[0191] The ensemble consisting of a multitude of nucleic acid fragments may be obtained by ordinary methods for chemical synthesis of nucleic acids by directing the step-wise synthesis to add pre-defined combinations of pure nucleotide monomers or a mixture of any combination of nucleotide monomers at each step in the chemical synthesis of the nucleic acid fragment. In this way it is possible to generate any level of sequence degeneracy, from one unique nucleic acid sequence to the most complex mixture, which will represent a complete or incomplete representation of maximum number unique sequences of 4.sup.N, where N is the number of nucleotides in the sequence.

[0192] Complex ensembles consisting of multitudes of nucleic acid fragments may, alternatively, be prepared by generating mixtures of nucleic acid fragments by chemical, physical or enzymatic fragmentation of high-molecular mass nucleic acid compositions like, e.g., genomic nucleic acids extracted from any organism. To render such mixtures of nucleic acid fragments useful in the generation of molecular ensembles, as described here, the crude mixtures of fragments, obtained in the initial cleavage step, would typically be size-fractionated to obtain fragments of an approximate molecular mass range which would then typically be adjoined to a suitable pair of linker nucleic acids, designed to facilitate insertion of the linker-embedded mixtures of size-restricted oligonucleotide fragments into the receiving nucleic acid vector.

[0193] To facilitate the construction of combinatorial CTLD libraries in tetranectin, the model CTLD of the preferred embodiment of the invention, suitable restriction sites located in the vicinity of the nucleic acid sequences encoding .beta.2, .beta.3 and .beta.4 in both human and murine tetranectin were designed with minimal perturbation of the polypeptide sequence encoded by the altered sequences. It was found possible to establish a design strategy, as detailed below, by which identical endonuclease restriction sites could be introduced at corresponding locations in the two sequences, allowing interesting loop-region variants to be readily excised from a recombinant murine CTLD and inserted correctly into the CTLD framework of human tetranectin or vice versa.

[0194] Analysis of the nucleotide sequence encoding the mature form of human tetranectin reveals (FIG. 2) that a recognition site for the restriction endonuclease Bgl II is found at position 326 to 331 (AGATCT), involving the encoded residues Glu109, Ile110, and Trp111 of .beta.2, and that a recognition site for the restriction endonuclease Kas I is found at position 382 to 387 (GGCGCC), involving the encoded amino acid residues Gly128 and Ala129 (located C-terminally in loop 2).

[0195] Mutation, by site directed mutagenesis, of G513 to A and of C514 to T in the nucleotide sequence encoding human tetranectin would introduce a Mun I restriction endonuclease recognition site therein, located at position 511 to 516, and mutation of G513 to A in the nucleotide sequence encoding murine tetranectin would introduce a Mun I restriction endonuclease site therein at a position corresponding to the Mun I site in human tetranectin, without affecting the amino acid sequence of either of the encoded protomers. Mutation, by site directed mutagenesis, of C327 to G and of G386 to C in the nucleotide sequence encoding murine tetranectin would introduce a Bgl II and a Kas I restriction endonuclease recognition site, respectively, therein. Additionally, A325 in the nucleotide sequence encoding murine tetranectin is mutagenized to a G. These three mutations would affect the encoded amino acid sequence by substitution of Asn109 to Glu and Gly129 to Ala, respectively. Now, the restriction endonuclease Kas I is known to exhibit marked site preference and cleaves only slowly the tetranectin coding region. Therefore, a recognition site for another restriction endonuclease substituting the Kas I site is preferred (e.g. the recognition site for the restriction endonuclease Kpn I, recognition sequence GGTACC). The nucleotide and amino acid sequences of the resulting tetranectin derivatives, human tetranectin lectin (htlec) and murine tetranectin lectin (mtlec) are shown in FIG. 3. The nucleotide sequences encoding the htlec and mtlec protomers may readily be subcloned into devices enabling protein display of the linked nucleotide sequence (e.g. phagemid vectors) and into plasmids designed for heterologous expression of protein [e.g. pT7H6, Christensen et al. (1991)]. Other derivatives encoding only the mutated CTLDs of either htlec or mtlec (htCTLD and mtCTLD, respectively) have also been constructed and subcloned into phagemid vectors and expression plasmids, and the nucleotide and amino acid sequences of these CTLD derivatives are shown in FIG. 4.

[0196] The presence of a common set of recognition sites for the restriction endonucleases Bgl II, Kas I or Kpn I, and Mun I in the ensemble of tetranectin and CTLD derivatives allows for the generation of protein libraries with randomized amino acid sequence in one or more of the loops and at single residue positions in .beta.4 comprising the lectin ligand binding region by ligation of randomized oligonucleotides into properly restricted phagemid vectors encoding htlec, mtlec, htCTLD, or mtCTLD derivatives.

[0197] After rounds of selection on specific targets (e.g. eukaryotic cells, virus, bacteria, specific proteins, polysaccharides, other polymers, organic compounds etc.) DNA may be isolated from the specific phages, and the nucleotide sequence of the segments encoding the ligand-binding region determined, excised from the phagemid DNA and transferred to the appropriate derivative expression vector for heterologous production of the desired product. Heterologous production in a prokaryote may be preferred because an efficient protocol for the isolation and refolding of tetranectin and derivatives has been reported (International Patent Application Publication WO 94/18227 A2).

[0198] A particular advantage gained by implementing the technology of the invention, using tetranectin as the scaffold structure, is that the structures of the murine and human tetranectin scaffolds are almost identical, allowing loop regions to be swapped freely between murine and human tetranectin derivatives with retention of functionality. Swapping of loop regions between the murine and the human framework is readily accomplished within the described system of tetranectin derivative vectors, and it is anticipated, that the system can be extended to include other species (e.g. rat, old and new world monkeys, dog, cattle, sheep, goat etc.) of relevance in medicine or veterinary medicine in view of the high level of homology between man and mouse sequences, even at the genetic level. Extension of this strategy to include more species may be rendered possible as and when tetranectin is eventually cloned and/or sequenced from such species.

[0199] Because the C-type lectin ligand-binding region represents a different topological unit compared to the antigen binding clefts of the antibodies, we envisage that the selected binding specificities will be of a different nature compared to the antibodies. Further, we envisage that the tetranectin derivatives may have advantages compared to antibodies with respect to specificity in binding sugar moieties or polysaccharides. The tetranectin derivatives may also be advantageous in selecting binding specificities against certain natural or synthetic organic compounds.

[0200] Several CTLDs are known to bind calcium ions, and binding of other ligands is often either dependent on calcium (e.g. the collectin family of C-type lectins, where the calcium ion bound in site 2 is directly involved in binding the sugar ligand [Weis and Drickamer (1996)]) or sensitive to calcium (e.g. tetranectin, where binding of calcium involves more of the side chains known otherwise to be involved in plasminogen kringle 4 binding [Graversen et al. (1998)]). The calcium binding sites characteristic of the C-type lectin-like protein family are comprised by residues located in loop 1, loop 4 and .beta.-strand 4 and are dependent on the presence of a proline residue (often interspacing loop 3 and loop 4 in the structure), which upon binding is found invariantly in the cis conformation. Moreover, binding of calcium is known to enforce structural changes in the CTLD loop-region [Ng et al. (1998a,b)]. We therefore envisage, that binding to a specific target ligand by members of combinational libraries with preserved CTLD metal binding sites may be modulated by addition or removal of divalent metal ions (e.g. calcium ions) either because the metal ion may be directly involved in binding, because it is a competitive ligand, or because binding of the metal ion enforces structural rearrangements within the putative binding site.

[0201] The trimeric nature of several members of the C-type lectin and C-type lectin-like protein family, including tetranectin, and the accompanying avidity in binding may also be exploited in the creation of binding units with very high binding affinity.

[0202] As can be appreciated from the disclosure above, the present invention has a broad general scope and a wide area of application. Accordingly, the following examples, describing various embodiments thereof, are offered by way of illustration only, not by way of limitation.

EXAMPLE 1

[0203] Construction of Tetranectin Derived E. coli Expression Plasmids and Phagemids

[0204] The expression plasmid pT7H6FX-htlec, encoding the FX-htlec (SEQ ID NO:01) part of full length H6FX-htlec fusion protein, was constructed by a series of four consecutive site-directed mutagenesis experiments starting from the expression plasmid pT7H6-rTN 123 [Holtet et al. (1997)] using the QuickChange.TM. Site-Directed Mutagenesis Kit (Stratagene, La Jolla, Calif.) and performed as described by the manufacturer. Mismatching primer pairs introducing the desired mutations were supplied by DNA Technology (Aarhus, Denmark). An outline of the resulting pT7H6FX-htlec expression plasmid is shown in FIG. 5, and the nucleotide sequence of the FX-htlec encoding insert is given as SEQ ID NO:01. The amino acid sequence of the FX-htlec part of the H6FX-htlec fusion protein is shown in FIG. 6 and given as SEQ ID NO:02.

[0205] The expression plasmid pT7H6FX-htCTLD, encoding the FX-htCTLD (SEQ ID NO: 03) part of the H6FX-htCTLD fusion protein, was constructed by amplification and subcloning into the plasmid pT7H6 (i.e. amplification in a polymerase chain reaction using the expression plasmid pT7H6-htlec as template, and otherwise the primers, conditions, and subcloning procedure described for the construction of the expression plasmid pT7H6TN3 [Holtet et al. (1997)]. An outline of the resulting pT7H6FX-htCTLD expression plasmid is shown in FIG. 7, and the nucleotide sequence of the FX-htCTLD encoding insert is given as SEQ ID NO:03. The amino acid sequence of the FX-htCTLD part of the H6FX-htCTLD fusion protein is shown in FIG. 8 and given as SEQ ID NO:04.

[0206] The phagemids, pPhTN and pPhTN3, were constructed by ligation of the Sfi I and Not I restricted DNA fragments amplified from the expression plasmids pT7H6-rTN 123 (with the oligonucleotide primers 5-CGGCTGAGCGGCCCAGCCGGCCATGGCCGAGCCACCAACCCAGAAGC-3' [SEQ ID NO:05] and 5'-CCTGCGGCCGCCACGATCCCGAACTGG-3' [SEQ ID NO:06]) and pT7H6FX-htCTLD (with the oligonucleotide primers 5'-CGGCTGAGCGGCCCAGCCGGCCATGGCCGCCCTGCAGACGGTC-3' [SEQ ID NO:07] and 5'-CCTGCGGCCGCCACGATCCCGAACTGG-3' [SEQ ID NO:06]), respectively, into a Sfi I and Not I precut vector, pCANTAB 5E supplied by Amersham Pharmacia Biotech (code no. 27-9401-01) using standard procedures. Outlines of the resulting pPhTN and pPhTN3 phagemids are shown in FIG. 9 and FIG. 11, respectively, and the nucleotide sequences of the PhTN and PhTN3 inserts are given as SEQ ID NO:08 and SEQ ID NO:10, respectively. The amino acid sequences encoded by the PhTN and PhTN3 inserts are shown in FIG. 10 (SEQ ID NO:09) and FIG. 12 (SEQ ID NO:11), respectively.

[0207] The phagemids, pPhtlec and pPhtCTLD, were constructed by ligation of the Sfi I and Not I restricted DNA fragments amplified from the expression plasmids pT7H6FX-htlec (with the oligonucleotide primers 5-CGGCTGAGCGGCCCAGCCGGCCATGGCCGAGCCACCAACCCAGAAGC-3' [SEQ ID NO:05] and 5'-CCTGCGGCCGCCACGATCCCGAACTGG-3' [SEQ ID NO:06]) and pT7H6FX-htCTLD (with the oligonucleotide primers 5'-CGGCTGAGCGGCCCAGCCGGCCATGGCCGCCCTGCAGACGGTC-3' [SEQ ID NO:07] and 5'-CCTGCGGCCGCCACGATCCCGAACTGG-3' [SEQ ID NO:06]), respectively, into a Sfi I and Not I precut vector, pCANTAB 5E supplied by Amersham Pharmacia Biotech (code no. 27-9401-01) using standard procedures. Outlines of the resulting pPhtlec and pPhtCTLD phagemids are shown in FIG. 13 and FIG. 15, respectively, and the nucleotide sequences of the Phtlec and PhtCTLD inserts are given as SEQ ID NO:12 and SEQ ID NO:14, repectively. The amino acid sequences encoded by the Phtlec and PhtCTLD inserts are shown in FIG. 14 (SEQ ID NO:13) and FIG. 16 (SEQ ID NO:15), respectively.

[0208] A plasmid clone, pUC-mtlec, containing the nucleotide sequence corresponding to the murine tetranectin derivative mtlec (FIG. 3 and SEQ ID NO:16) was constructed by four successive subclonings of DNA subfragments in the following way: First, two oligonucleotides 5'-CGGAATTCGAGTCACCCACTCCCAAGGCCAAGAAGGCTGCAAATGCCAAGAAAGATTTGGTGAGCTCAAA- GATGTTC-3' (SEQ ID NO:17) and 5'-GCGGATCCAGGCCTGCTTCTCCTTCAGCAGGGCCACCTCCTGGGCCAGGACATCCATCCTGTTCTTGAGC- TCCTCGAACATCTTTGAGCTCACC-3' (SEQ ID NO:18) were annealed and after a filling in reaction cut with the restriction endonucleases Eco RI (GAATTC) and Bam HI (GGATCC) and ligated into Eco RI and Bam HI precut pUC18 plasmid DNA. Second, a pair of oligonucleotides 5'-GCAGGCCTTACAGACTGTGTGCCTGAAGGGCACCAAGGTGAACTTGAAGTGCCTCCTGGCCTTCACCCAA- CCGAAGACCTTCCATGAGGCGAGCGAG-3' (SEQ ID NO:19) and 5'-CCGCATGCTTCGAACAGCGCCTCGTTCTCTAGCTCTGACTGCGGGGTGCCCAGCGTGCCCCCTTGCGAGA- TGCAGTCCTCGCTCGCCTCATGG-3' (SEQ ID NO:20) was annealed and after a filling in reaction cut with the restriction endonucleases Stu I (AGGCCT) and Sph I (GCATGC) and ligated into the Stu I and Sph I precut plasmid resulting from the first ligation. Third, an oligonucleotide pair 5'-GGTTCGAATACGCGCGCCACAGCGTGGGCAACGATGCGGAGATCTAAATGCTCCCAATTGC-3' (SEQ ID NO:21) and 5'-CCAAGCTTCACAATGGCAAACTGGCAGATGTAGGGCAATTGGGAGCATTTAGATC-3' (SEQ ID NO: 22) was annealed and after a filling in reaction cut with the restriction endonucleases BstB I (TTCGAA) and Hind III (AAGCTT) and ligated into the BstB I and Hind III precut plasmid resulting from the second ligation. Fourth, an oligonucleotide pair 5'-CGGAGATCTGGCTGGGCCTCAACGACATGGCCGCGGAAGGCGCCTGGGTGGACATGACCGGTACCCTCCT- GGCCTACAAGAACTGG-3' (SEQ ID NO:23) and 5'-GGGCAATTGATCGCGGCATCGCTTGTCGAACCTCTTGCCGTTGGCTGCGCCAGACAGGGCGGCGCAGTTC- TCGGCTTTGCCGCCGTCGGGTTGCGTCGTGATCTCCGTCTCCCAGTTCTTGTAGGCCAGG-3' (SEQ ID NO:24) was annealed and after a filling in reaction cut with the restriction endonucleases Bgl II (AGATCT) and Mun I (CAATTG) and ligated into the Bgl II and Mun I precut plasmid resulting from the third ligation. An outline of the pUC-mtlec plasmid is shown in FIG. 17, and the resulting nucleotide sequence of the Eco RI to Hind III insert is given as SEQ ID NO:16.

[0209] The expression plasmids pT7H6FX-mtlec and pT7H6FX-mtCTLD may be constructed by ligation of the Bam HI and Hind III restricted DNA fragments, amplified from the pUC-mtlec plasmid with the oligonucleotide primer pair 5-CTGGGATCCATCCAGGGTCGCGAGTCACCCACTCCCAAGG-3' (SEQ ID NO:25) and 5'-CCGAAGCTTACACAATGGCAAACTGGC-3' (SEQ ID NO:26), and with the oligonucleotide primer pair 5'-CTGGGATCCATCCAGGGTCGCGCCTTACAGACTGTGGTC-3' (SEQ ID NO:27), and 5'-CCGAAGCTTACACAATGGCAAACTGGC-3' (SEQ ID NO:26), respectively, into Bam HI and Hind III precut pT7H6 vector using standard procedures. An outline of the expression plasmids pT7H6FX-mtlec and pT7H6FX-mtCTLD is shown in FIG. 18 and FIG. 20, respectively, and the nucleotide sequences of the FX-mtlec and FX-mtCTLD inserts are given as SEQ ID NO:28 and SEQ ID NO:30, respectively. The amino acid sequences of the FX-mtlec and FX-mtCTLD parts of the fusion proteins H6FX-mtlec and H6FX-mtCTLD fusion proteins are shown in FIG. 19 (SEQ ID NO:29) and FIG. 21 (SEQ ID NO:31), respectively.

[0210] The phagemids pPmtlec and pPmtCTLD may be constructed by ligation of the Sfi I and Not I restricted DNA fragments (amplified from the pUC-mtlec plasmid with the oligonucleotide primer pair 5-CGGCTGAGCGGCCCAGCCGGCCATGGCCGAGTCACCCACTCCCAAGG-3' [SEQ ID NO:32], and 5'-CCTGCGGCCGCCACGATCCCGAACTGG-3' [SEQ ID NO:33] and with the oligonucleotide primers 5'-CGGCTGAGCGGCCCAGCCGGCCATGGCCGCCTTACAGACTGTGGTC-3' [SEQ ID NO:34] and 5'-CCTGCGGCCGCCACGATCCCGAACTGG-3' [SEQ ID NO:33], respectively) into a Sfi I and Not I precut vector pCANTAB 5E supplied by Amersham Pharmacia Biotech (code no. 27-9401-01) using standard procedures. Outlines of the pPmtlec and pPmtCTLD plasmids are shown in FIG. 22 and FIG. 24, respectively, and the resulting nucleotide sequences of the Pmtlec and PmtCTLD inserts are given as SEQ ID NO:35 and SEQ ID NO:37, repectively. The amino acid sequences encoded by the Pmtlec and PmtCTLD inserts are shown in FIG. 23 (SEQ ID NO: 36) and FIG. 25 (SEQ ID NO: 38), respectively.

EXAMPLE 2

[0211] Demonstration of Successful Display of Phtlec and PhTN3 on Phages.

[0212] In order to verify that the Phtlec and PhTN3 Gene III fusion proteins can indeed be displayed by the recombinant phage particles, the phagemids pPhtlec and pPhTN3 (described in Example 1) were transformed into E. coli TG1 cells and recombinant phages produced upon infection with the helper phage M13K07. Recombinant phages were isolated by precipitation with poly(ethylene glycol) (PEG 8000) and samples of Phtlec and PhTN3 phage preparations as well as a sample of helper phage were subjected to an ELISA-type sandwich assay, in which wells of a Maxisorb (Nunc) multiwell plate were first incubated with anti-human tetranectin or bovine serum albumin (BSA) and blocked in skimmed milk or skimmed milk/EDTA. Briefly, cultures of pPhtlec and pPhTN3 phagemid transformed TG1 cells were grown at 37.degree. C. in 2xTY-medium supplemented with 20 glucose and 100 mg/L ampicillin until A.sub.600 reached 0.5. By then the helper phage, M13KO7, was added to a concentration of 5.times.10.sup.9 pfu/mL. The cultures were incubated at 37.degree. C. for another 30 min before cells were harvested by centrifugation and resuspended in the same culture volume of 2.times.TY medium supplemented with 50 mg/L kanamycin and 100 mg/L ampicillin and transferred to a fresh set of flasks and grown for 16 hours at 25.degree. C. Cells were removed by centrifugation and the phages precipitated from 20 mL culture supernatant by the addition of 6 mL of ice cold 200 PEG 8000, 2.5 M NaCl. After mixing the solution was left on ice for one hour and centrifuged at 4.degree. C. to isolate the precipitated phages. Each phage pellet was resuspended in 1 mL of 10 mM tris-HCl pH 8, 1 mM EDTA (TE) and incubated for 30 min before centrifugation. The phage containing supernatant was transferred to a fresh tube. Along with the preparation of phage samples, the wells of a Maxisorb plate was coated overnight with (70 .mu.L) rabbit anti-human tetranectin (a polyclonal antibody from DAKO A/S, code no. A0371) in a 1:2000 dilution or with (70 .mu.L) BSA (10 mg/mL). Upon coating, the wells were washed three times with PBS (2.68 mM KCl, 1.47 mM KH.sub.2PO.sub.4, 137 mM NaCl, 8.10 mM Na.sub.2HPO.sub.4, pH 7.4) and blocked for one hour at 37.degree. C. with 280 .mu.L of either 3% skimmed milk in PBS, or 3% skimmed milk, 5 mM EDTA in PBS. Anti-tetranectin coated and BSA coated wells were then incubated with human Phtlec-, PhTN3-, or helper phage samples for 1 hour and then washed 3 times in PBS buffer supplemented with the appropriate blocking agent. Phages in the wells were detected after incubation with HRP-conjugated anti-phage conjugate (Amersham Pharmacia, code no. 27-9421-01) followed by further washing. HRP activities were then measured in a 96-well ELISA reader using a standard HRP chromogenic substrate assay.

[0213] Phtlec and PhTN3 phages produced strong responses (14 times background) in the assay, irrespective of the presence or absence of EDTA in the blocking agent, whereas helper phage produced no response above background readings in either blocking agent. Only low binding to BSA was observed (FIG. 26).

[0214] It can therefore be concluded that the human Phtlec and PhTN3 phages both display epitopes that are specifically recognized by the anti-human tetranectin antibody.

EXAMPLE 3

[0215] Demonstration of authentic ligand binding properties of Phtlec and PhTN3 displayed on phage

[0216] The apo-form of the CTLD domain of human tetranectin binds in a lysine-sensitive manner specifically to the kringle 4 domain of human plasminogen [Graversen et al. (1998)]. Binding of tetranectin to plasminogen can be inhibited by calcium which binds to two sites in the ligand-binding site in the CTLD domain (Kd approx. 0.2 millimolar) or by lysine-analogues like AMCHA (6-amino-cyclohexanoic acid), which bind specifically in the two stronger lysine-binding sites in plasminogen of which one is located in kringle 1 and one is located in kringle 4 (Kd approx. 15 micromolar).

[0217] To demonstrate specific AMCHA-sensitive binding of human Phtlec and PhTN3 phages to human plasminogen, an ELISA assay, in outline similar to that employed to demonstrate the presence of displayed Phlec and PhCTLD GIII fusion proteins on the phage particles (cf. Example 2), was devised.

[0218] Wells were coated with solutions of human plasminogen (10 .mu.g/mL), with or without addition of 5 mM AMCHA. Control wells were coated with BSA. Two identical arrays were established, one was subjected to blocking of excess binding capacity with 3% skimmed milk, and one was blocked using 3% skimmed milk supplemented with 5 mM EDTA. Where appropriate, blocking, washing and phage stock solutions were supplemented by 5 mM AMCHA. The two arrays of wells were incubated with either Phtlec-, or PhTN3-, or helper phage samples, and after washing the amount of phage bound in each well was measured using the HRP-conjugated antiphage antibody as above. The results are shown in FIG. 27, panels A and B, and can be summarized as follows [0219] (a) In the absence of AMCHA, binding of human Phtlec phages to plasminogen-coated wells generated responses at 8-10 times background levels using either formulation of blocking agent, whereas human PhTN3 phages generated responses at 4 (absence of EDTA) or 7 (presence of EDTA) times background response levels. [0220] (b) In the presence of 5 mM AMCHA, binding of human Phtlec- and PhTN3 phages to plasminogen was found to be completely abolished. [0221] (c) Phtlec and PhTN3 phages showed no binding to BSA, and control helper phages showed no binding to any of the immobilized substances. [0222] (d) Specific binding of human Phtlec and PhTN3 phages to a specific ligand at moderate binding strength (about 20 micromolar level) can be detected with high efficiency at virtually no background using a skimmed-milk blocking agent, well-known in the art of combinatorial phage technology as a preferred agent effecting the reduction of non-specific binding.

[0223] In conclusion, the results show that the Phtlec and PhTN3 Gene III fusion proteins displayed on the phage particles exhibit plasminogen-binding properties corresponding to those of authentic tetranectin, and that the physical and biochemical properties of Phtlec and PhTN3 phages are compatible with their proposed use as vehicles for the generation of combinatorial libraries from which CTLD derived units with new binding properties can be selected.

EXAMPLE 4

[0224] Construction of the phage libraries Phtlec-lb001 and Phtlec-lb002.

[0225] All oligonucleotides used in this example were supplied by DNA Technology (Aarhus, Denmark).

[0226] The phage library Phtlec-lb001, containing random amino acid residues corresponding to Phtlec (SEQ ID NO: 12) positions 141-146 (loop 3), 150-153 (part of loop 4), and residue 168 (Phe in .beta.4), was constructed by ligation of 20 .mu.g KpnI and MunI restricted pPhtlec phagemid DNA (cf, Example 1) with 10 .mu.g of KpnI and MunI restricted DNA fragment amplified from the oligonucleotide htlec-lib1-tp (SEQ ID NO: 39), where N denotes a mixture of 25% of each of the nucleotides T, C, G, and A, respectively and S denotes a mixture of 50% of C and G, encoding the appropriately randomized nucleotide sequence and the oligonucleotides htlec-lib1-rev (SEQ ID NO: 40) and htlec-lib1/2-fo (SEQ ID NO: 41) as primers using standard conditions. The ligation mixture was used to transform so-called electrocompetent E. coli TG-1 cells by electroporation using standard procedures. After transformation the E. coli TG-1 cells were plated on 2.times.TY-agar plates containing 0.2 mg ampicillin/mL and 20 glucose and incubated over night at 30.degree. C.

[0227] The phage library Phtlec-lb002, containing random amino acid residues corresponding to Phtlec (SEQ ID NO: 12) positions 121-123, 125 and 126 (most of loop 1), and residues 150-153 (part of loop 4) was constructed by ligation of 20 .mu.g BglII and MunI restricted pPhtlec phagemid DNA (cf, EXAMPLE 1) with 15 .mu.g of BglII and MunI restricted DNA fragment amplified from the pair of oligonucleotides htlec-lib2-tprev (SEQ ID NO: 42) and htlec-lib2-tpfo (SEQ ID NO: 43), where N denotes a mixture of 25% of each of the nucleotides T, C, G, and A, respectively and S denotes a mixture of 50% of C and G, encoding the appropriately randomized nucleotide sequence and the oligonucleotides htlec-lib2-rev (SEQ ID NO: 44) and htlec-lib1/2-fo (SEQ ID NO: 41) as primers using standard conditions. The ligation mixture was used to transform so-called electrocompetent E. coli TG-1 cells by electroporation using standard procedures. After transformation the E. coli TG-1 cells were plated on 2.times.TY-agar plates containing 0.2 mg ampicillin/mL and 20 glucose and incubated overnight at 30.degree. C.

[0228] The titer of the libraries Phtlec-lb001 and -lb002 was determined to 1.4*10.sup.9 and 3.2*10.sup.9 clones, respectively. Six clones from each library were grown and phagemid DNA isolated using a standard miniprep procedure, and the nucleotide sequence of the loop-region determined (DNA Technology, Aarhus, Denmark). One clone from each library failed, for technical reasons, to give reliable nucleotide sequence, and one clone from Phtlec-lib001 apparently contained a major deletion. The variation of nucleotide sequences, compared to Phtlec (SEQ ID NO: 12), of the loop-regions of the other nine clones (lb001-1, lb001-2, lb001-3, lb001-4, lb002-1, lb002-2, lb002-3, lb002-4, and lb002-5) is shown in Table 3.

TABLE-US-00004 TABLE 3 Variation of Phtlec loop derivatives isolated from the libraries Phtlec-lb001 and - lb002. (.beta.2 and .beta.3 consensus elements are indicated) ##STR00001##

EXAMPLE 5

[0229] Construction of the Phage Library PhtCTLD-lb003

[0230] All oligonucleotides used in this example were supplied by DNA Technology (Aarhus, Denmark).

[0231] The phage library PhtCTLD-lb003, containing random amino acid residues corresponding to PhtCTLD (SEQ ID NO: 15) positions 77 to 79 and 81 to 82 (loop 1) and 108 to 109 (loop 4) was constructed by ligation of 20 .mu.g BglII and MunI restricted pPhtCTLD phagemid DNA (cf. Example 1) with 10 g of a BglII and MunI restricted DNA fragment population encoding the appropriately randomized loop 1 and 4 regions with or without two and three random residue insertions in loop 1 and with three and four random residue insertions in loop 4. The DNA fragment population was amplified, from six so-called assembly reactions combining each of the three loop 1 DNA fragments with each of the two loop 4 DNA fragments as templates and the oligonucleotides TN-lib3-rev (SEQ ID NO: 45) and loop 3-4-5 tagfo (SEQ ID NO: 46) as primers using standard procedures. Each of the three loop 1 fragments was amplified in a reaction with either the oligonucleotides loop1b (SEQ ID NO: 47), loop1c (SEQ ID NO: 48), or loop1d (SEQ ID NO: 49) as template and the oligonucleotides TN-lib3-rev (SEQ ID NO: 45) and TN-KpnI-fo (SEQ ID NO: 50) as primers, and each of the two DNA loop 4 fragments was amplified in a reaction with either the oligonucleotide loop4b (SEQ ID NO: 51) or loop4c (SEQ ID NO: 52) as template and the oligonucleotides loop3-4rev (SEQ ID NO: 53) and loop3-4fo (SEQ ID NO: 54) as primers using standard procedures. In the oligonucleotide sequences N denotes a mixture of 25% of each of the nucleotides T, C, G, and A, respectively and S denotes a mixture of 50% of C and G, encoding the appropriately randomized nucleotide sequence. The ligation mixture was used to transform so-called electrocompetent E. coli TG-1 cells by electroporation using standard procedures. After transformation the E. coli TG-1 cells were plated on 2.times.TY-agar plates containing 0.2 mg ampicillin/mL and 20 glucose and incubated over night at 30.degree. C.

[0232] The size of the resulting library, PhtCTLD-lb003, was determined to 1.4*10.sup.10 clones. Twenty four clones from the library were grown and phages and phagemid DNA isolated. The nucleotide sequences of the loop-regions were determined (DNA Technology, Aarhus, Denmark) and binding to a polyclonal antibody against tetranectin, anti-TN (DAKO A/S, Denmark), analyzed in an ELISA-type assay using HRP conjugated anti-gene VIII (Amersham Pharmacia Biotech) as secondary antibody using standard procedures. Eighteen clones were found to contain correct loop inserts, one clone contained the wild type loop region sequence, one a major deletion, two contained two or more sequences, and two clones contained a frameshift mutation in the region. Thirteen of the 18 clones with correct loop inserts, the wild type clone, and one of the mixed isolates reacted strongly with the polyclonal anti-TN antibody. Three of the 18 correct clones reacted weakly with the antibody, whereas, two of the correct clones, the deletion mutant, one of the mixed, and the two frameshift mutants did not show a signal above background.

EXAMPLE 6

[0233] Phage Selection by Biopanning on Anti-TN Antibody.

[0234] Approximately 10.sup.11 phages from the PhtCTLD-lb003 library was used for selection in two rounds on the polyclonal anti-TN antibody by panning in Maxisorb immunotubes (NUNC, Denmark) using standard procedures. Fifteen clones out of 7*10.sup.7 from the plating after the second selection round were grown and phagemid DNA isolated and the nucleotide sequence determined. All 15 clones were found to encode correct and different loop sequences.

EXAMPLE 7

[0235] Model Selection of CTLD-Phages on Plasminogen.

I: Elution by Trypsin Digestion After Panning.

[0236] In order to demonstrate that tetranectin derived CTLD bearing phages can be selected from a population of phages, mixtures of PhtCTLD phages isolated from a E. coli TG1 culture transformed with the phagemid pPhtCTLD (cf, EXAMPLE 1) after infection with M13K07 helper phage and phages isolated from a culture transformed with the phagemid pPhtCPB after infection with M13K07 helper phage at ratios of 1:10 and 1:10.sup.5, respectively were used in a selection experiment using panning in 96-well Maxisorb micro-titerplates (NUNC, Denmark) and with human plasminogen as antigen. The pPhtCPB phagemid was constructed by ligation of the double stranded oligonucleotide (SEQ ID NO: 55) with the appropriate restriction enzyme overhang sequences into KpnI and MunI restricted pPhtCTLD phagemid DNA. The pPhtCBP phages derived upon infection with the helper phages displays only the wild type M13 gene III protein because of the translation termination codons introduced into the CTLD coding region of the resulting pPhtCPB phagemid (SEQ ID NO: 56).

[0237] The selection experiments were performed in 96 well micro titer plates using standard procedures. Briefly, in each well 3 .mu.g of human plasminogen in 100 .mu.L PBS (PBS, 0.2 g KCl, 0.2 g KH.sub.2PO.sub.4, 8 g NaCl, 1.44 g Na.sub.2HPO.sub.4, 2H.sub.2O, water to 1 L, and adjusted to pH 7.4 with NaOH) or 100 .mu.L PBS (for analysis of non specific binding) was used for over night coating at 4.degree. C. and at 37.degree. C. for one hour. After washing once with PBS, wells were blocked with 400 .mu.L PBS and 3% non fat dried milk for one hour at 37.degree. C. After blocking wells were washed once in PBS and 0.1% Tween 20 and three times with PBS before the addition of phages suspended in 100 .mu.L PBS, 3% non fat dried milk. The phages were allowed to bind at 37.degree. C. for one hour before washing three times with PBS, Tween 20 and three times with PBS. Bound phages were eluted from each well by trypsin digestion in 100 .mu.L (1 mg/mL trypsin in PBS) for 30 min. at room temperature, and used for infection of exponentially growing E. coli TG1 cells before plating and titration on 2.times.TY agar plates containing 20 glucose and 0.1 mg/mL ampicillin.

[0238] Initially (round 1), 10.sup.12 PhtCTLD phages (A series), a mixture of 10.sup.10 PhtCTLD phages and 10.sup.11 PhtCPB phages (B series), or a mixture of 10.sup.6 PhtCTLD and 10.sup.11 PhtCPB phages (C series) were used. In the following round (round 2) 10.sup.11 phages of the output from each series were used. Results from the two rounds of selection are summarised in Table 4.

TABLE-US-00005 TABLE 4 Selection of mixtures of PhtCTLD and PhtCPB by panning and elution with trypsin. Plasminogen Blank (*10.sup.5 colonies) (*10.sup.5 colonies) Round 1 A 113.0 19.50 B 1.8 1.10 C 0.1 0.30 Round 2 A 49 0.10 B 5.2 0.20 C 0.3 0.04

[0239] Phagemid DNA from 12 colonies from the second round of plating together with 5 colonies from a plating of the initial phage mixtures was isolated and the nucleotide sequence of the CTLD region determined. From the initial 1/10 mixture (B series) of PhtCTLD/PhtCPB one out of five were identified as the CTLD sequence. From the initial 1/10.sup.5 mixture (C series) all five sequences were derived from the pPhtCPB phagemid. After round 2 nine of the twelve sequences analyzed from the B series and all twelve sequences from the C series were derived from the pPhtCTLD phagemid.

EXAMPLE 8

[0240] Model Selection of CTLD-Phages on Plasminogen.

[0241] II: Elution by 0.1 M Triethylamine After Panning.

[0242] In order to demonstrate that tetranectin derived CTLD-bearing phages can be selected from a population of phages, mixtures of PhtCTLD phages isolated from a E. coli TG1 culture transformed with the phagemid pPhtCTLD (cf, EXAMPLE 1) after infection with M13K07 helper phage and phages isolated from a culture transformed with the phagemid pPhtCPB (cf, EXAMPLE 6) after infection with M13K07 helper phage at ratios of 1:10.sup.2 and 1:10.sup.6, respectively were used in a selection experiment using panning in 96-well Maxisorb micro-titerplates (NUNC, Denmark) and with human plasminogen as antigen using standard procedures.

[0243] Briefly, in each well 3 .mu.g of human plasminogen in 100 .mu.L PBS (PBS, 0.2 g KCl, 0.2 g KH.sub.2PO.sub.4, 8 g NaCl, 1.44 g Na.sub.2HPO.sub.4, 2H.sub.2O, water to 1 L, and adjusted to pH 7.4 with NaOH) or 100 .mu.L PBS (for analysis of non specific binding) was used for over night coating at 4.degree. C. and at 37.degree. C. for one hour. After washing once with PBS, wells were blocked with 400 L PBS and 3% non fat dried milk for one hour at 37.degree. C. After blocking wells were washed once in PBS and 0.1% Tween 20 and three times with PBS before the addition of phages suspended in 100 .mu.L PBS, 3% non fat dried milk. The phages were allowed to bind at 37.degree. C. for one hour before washing 15 times with PBS, Tween 20, and 15 times with PBS. Bound phages were eluted from each well by 100 .mu.L 0.1 M triethylamine for 10 min at room temperature, and upon neutralisation with 0.5 vol. 1 M Tris-HCl pH 7.4, used for infection of exponentially growing E. coli TG1 cells before plating and titration on 2.times.TY agar plates containing 20 glucose and 0.1 mg/mL ampicillin.

[0244] Initially (round 1) 10.sup.12 PhtCTLD phages (A series), a mixture of 10.sup.9 PhtCTLD phages and 10.sup.11 PhtCPB phages (B series), or a mixture of 10.sup.5 PhtCTLD and 10.sup.11 PhtCPB phages (C series) were used. In the following round (round 2) 10.sup.11 phages of the output from each series were used. Results from the two rounds of selection are summarised in Table 5.

TABLE-US-00006 TABLE 5 Selection of mixtures of PhtCTLD and PhtCPB by panning elution with triethylamine. Plasminogen Blank (*10.sup.4 colonies) (*10.sup.4 colonies) Round 1 A 18 0.02 B 0.5 0.00 C 0.25 0.02 Round 2 A n.d. n.d. B 5.0 0.00 C 1.8 0.02 Round 3 A n.d. n.d. B 11 0.00 C 6.5 0.02 n.d. = not determined

[0245] Phage mixtures from the A and the B series from the second round of selection were grown using a standard procedure, and analyzed for binding to plasminogen in an ELISA-type assay. Briefly, in each well 3 .mu.g of plasminogen in 100 .mu.L PBS (PBS, 0.2 g KCl, 0.2 g KH2PO4, 8 g NaCl, 1.44 g Na.sub.2HPO.sub.4, 2H.sub.2O, water to 1 L, and adjusted to pH 7.4 with NaOH) or 100 .mu.L PBS (for analysis of non specific binding) was used for over night coating at 4.degree. C. and at 37.degree. C. for one hour. After washing once with PBS, wells were blocked with 400 .mu.L PBS and 3% non fat dried milk for one hour at 370C. After blocking wells were washed once in PBS and 0.1% Tween 20 and three times with PBS before the addition of phages suspended in 100 .mu.L PBS, 3% non fat dried milk. The phage mixtures were allowed to bind at 37.degree. C. for one hour before washing three times with PBS, Tween 20, and three times with PBS. After washing, 50 .mu.L of a 1:5000 dilution of a HRP-conjugated anti-gene VIII antibody (Amersham Pharmacia Biotech) in PBS, 3% non fat dried milk was added to each well and incubated at 37.degree. C. for one hour. After binding of the "secondary" antibody wells were washed three times with PBS, Tween 20, and three times with PBS before the addition of 50 .mu.L of TMB substrate (DAKO-TMB One-Step Substrate System, code: 51600, DAKO, Denmark). Reaction was allowed to proceed for 20 min. before quenching with 0.5 vol. 0.5 M H.sub.2SO.sub.4, and analysis. The result of the ELISA analysis confirmed specific binding to plasminogen of phages in both series (FIG. 28).

EXAMPLE 9

[0246] Selection of Phages From the Library Phtlec-lb002 Binding to Hen Egg White Lysozyme.

[0247] 1.2*10.sup.12 phages, approximately 250 times the size of the original library, derived from the Phtlec-lb002 library (cf, EXAMPLE 4) were used in an experimental procedure for the selection of phages binding to hen egg white lysozyme involving sequential rounds of panning using standard procedures.

[0248] Briefly, 30 .mu.g of hen egg white lysozyme in 1 mL PBS (PBS, 0.2 g KCl, 0.2 g KH.sub.2PO.sub.4, 8 g NaCl, 1.44 g Na.sub.2HPO.sub.4, 2H.sub.2O, water to 1 L, and adjusted to pH 7.4 with NaOH) or 1 mL PBS (for analysis of non specific binding) was used for over night coating of Maxisorb immunotubes (NUNC, Denmark) at 4.degree. C. and at 37.degree. C. for one hour. After washing once with PBS, tubes were filled and blocked with PBS and 3% non fat dried milk for one hour at 37.degree. C. After blocking tubes were washed once in PBS, 0.1% Tween 20 and three times with PBS before the addition of phages suspended in 1 mL PBS, 3% non fat dried milk. The phages were allowed to bind at 37.degree. C. for one hour before washing six times with PBS, Tween 20 and six times with PBS. Bound phages were eluted from each well by 1 mL 0.1 M triethylamine for 10 min at room temperature, and upon neutralisation with 1 M Tris-HCl pH 7.4, used for infection of exponentially growing E. coli TG1 cells before plating and titration on 2.times.TY agar plates containing 20 glucose and 0.1 mg/mL ampicillin. In the subsequent rounds of selection approximately 10.sup.12 phages derived from a culture grown from the colonies plated after infection with the phages eluted from the lysozyme coated tube were used in the panning procedure. However, the stringency in binding was increased by increasing the number of washing step after phage panning from six to ten.

[0249] The results from the selection procedure is shown in Table 7.

TABLE-US-00007 TABLE 7 Selection by panning of lysozyme binding phages from Phtlec-lb002 library. Lysozyme Blank Ratio Round 1 2.4 * 10.sup.4 n.a. n.a. Round 2 3.5 * 10.sup.3 4.0 * 10.sup.2 9 Round 3 3.2 * 10.sup.5 2.5 * 10.sup.2 1.3 * 10.sup.3 n.a. = not applicable

[0250] Phages were grown from twelve clones isolated from the third round of selection in order to analyse the specificity of binding using a standard procedure, and analyzed for binding to hen egg white lysozyme and human .beta..sub.2-microglobulin in an ELISA-type assay. Briefly, in each well 3 .mu.g of hen egg white lysozyme in 100 .mu.L PBS (PBS, 0.2 g KCl, 0.2 g KH.sub.2PO.sub.4, 8 g NaCl, 1.44 g Na.sub.2HPO.sub.4, 2H.sub.2O, water to 1 L, and adjusted to pH 7.4 with NaOH), or 3 .mu.g of human .beta..sub.2-microglobulin, or 100 .mu.L PBS (for analysis of non specific binding) was used for over night coating at 4.degree. C. and at 37.degree. C. for one hour. After washing once with PBS, wells were blocked with 400 .mu.L PBS and 3% non fat dried milk for one hour at 37.degree. C. After blocking wells were washed once in PBS and 0.1% Tween 20 and three times with PBS before the addition of phages suspended in 100 .mu.L PBS, 3% non fat dried milk. The phages were allowed to bind at 37.degree. C. for one hour before washing three times with PBS, Tween 20 and three times with PBS. After washing, 50 .mu.L of a 1 to 5000 dilution of a HRP-conjugated anti-gene VIII antibody (Amersham Pharmacia Biotech) in PBS, 3% non fat dried milk was added to each well and incubated at 37.degree. C. for one hour. After binding of the "secondary" antibody wells were washed three times with PBS, Tween 20 and three times with PBS before the addition of 50 .mu.L of TMB substrate (DAKO-TMB One-Step Substrate System, code: 51600, DAKO, Denmark). Reaction was allowed to proceed for 20 min before quenching with 0.5 M H.sub.2SO.sub.4.

[0251] Results showing relatively weak but specific binding to lysozyme are summarised in FIG. 29.

EXAMPLE 10

[0252] Construction of the Rat Mannose-Binding Protein CTLD (r-MBP) Derived Phagemid (pPrMBP) and Human Lung Surfactant Protein D CTLD (h-SP-D) Derived Phagemid (pPhSP-D)

[0253] The phagemid, pPrMBP, is constructed by ligation of the Sfi I and Not I restricted DNA fragment amplified from cDNA, isolated from rat liver (Drickamer, K., et al., J. Biol. Chem. 1987, 262(6):2582-2589) (with the oligonucleotide primers SfiMBP 5'-CGGCTGAGCGGCCCAGCCGGCCATGGCCGAGCCAAACAAGTTGCATGCCTTCTCC-3' [SEQ ID NO:62] and NotMBP 5'-GCACTCCTGCGGCCGCGGCTGGGAACTCGCAGAC-3' [SEQ ID NO:63]) into a Sfi I and Not I precut vector, pCANTAB 5E supplied by Amersham Pharmacia Biotech (code no. 27-9401-01) using standard procedures. Outlines of the resulting pPrMBP is shown in FIG. 31 and the nucleotide sequence of PrMBP is given as (SEQ ID NO:58). The amino acid sequence encoded by the PrMBP insert is shown in FIG. 30 (SEQ ID NO:59).

[0254] The phagemid,pPhSP-D, is constructed by ligation of the Sfi I and Not I restricted DNA fragment amplified from cDNA, isolated from human lung (Lu, J., et al., Biochem J. 1992 Jun. 15; 284:795-802) (with the oligonucleotide primers SfiSP-D 5'-CGGCTGAGCGGCCCAGCCGGCCATGGCCGAGCCAAAGAAAGTTGAGCTCTTCCC-3' [SEQ ID NO:64] and NotSP-D 5'-GCACTCCTGCGGCCGCGAACTCGCAGACCACAAGAC-3' [SEQ ID NO:65]) into a Sfi I and Not I precut vector, pCANTAB 5E supplied by Amersham Pharmacia Biotech (code no. 27-9401-01) using standard procedures. Outlines of the resulting pPhSP-D is shown in FIG. 33 and the nucleotide sequence of PhSP-D, is given as (SEQ ID NO:60). The amino acid sequences encoded by the PhSP-D insert is shown in FIG. 32 (SEQ ID NO:61).

EXAMPLE 11

[0255] Construction of the Phage Library PrMBP-lb001

[0256] The phage library PrMBP-lb001, containing random amino acid residues corresponding to PrMBP CTLD (SEQ ID NO:59) positions 71 to 73 or 70 to 76 (loop 1) and 97 to 101 or 100 to 101 (loop 4) is constructed by ligation of 20 .mu.g SfiI and NotI restricted pPrMBP phagemid DNA (cf. Example 10) with 10 .mu.g of a SfiI and NotI restricted DNA fragment population encoding the appropriately randomized loop 1 and 4 regions. The DNA fragment population is amplified, from nine assembly reactions combining each of the three loop 1 DNA fragments with each of the three loop 4 DNA fragments as templates and the oligonucleotides Sfi-tag 5'-CGGCTGAGCGGCCCAGC-3' (SEQ ID NO:74) and Not-tag 5'-GCACTCCTGCGGCCGCG-3' (SEQ ID NO:75) as primers using standard procedures. Each of the three loop 1 fragments is amplified in a primary PCR reaction with pPrMBP phagmid DNA (cf. Example 10) as template and the oligonucleotides MBPloop1a fo (SEQ ID NO:66), MBPloop1b fo (SEQ ID NO:67)or MBPloop1c fo (SEQ ID NO:68) and SfiMBP (SEQ ID NO:62) as primers, and further amplified in a secondary PCR reaction using Sfi-tag (SEQ ID NO:74) and MBPloop1-tag fo (SEQ ID NO:69). Each of the three DNA loop 4 fragments is amplified in a primary PCR reaction with pPrMBP phagemid DNA (cf. Example 10) as template and the oligonucleotides MBPloop4a rev (SEQ ID NO:71), MBPloop4b rev (SEQ ID NO:72) or MBPloop4c rev (SEQ ID NO:73) and NotMBP (SEQ ID NO:63) as primers using standard procedures and further amplified in a secondary PCR reaction using MBPloop4-tag rev (SEQ ID NO:70) and Not-tag (SEQ ID NO:63). In the oligonucleotide sequences N denotes a mixture of 25% of each of the nucleotides T, C, G, and A, respectively, and S denotes a mixture of 50% of C and G, encoding the appropriately randomized nucleotide sequence. The ligation mixture is used to transform so-called electrocompetent E. coli TG-1 cells by electroporation using standard procedures. After transformation the E. coli TG-1 cells are plated on 2.times.TY-agar plates containing 0.2 mg ampicillin/mL and 20 glucose and incubated over night at 30.degree. C.

EXAMPLE 12

[0257] Construction of the Phage Library PhSP-D-lb001

[0258] The phage library PhSP-D-lb001, containing random amino acid residues corresponding to PhSP-D CTLD insert (SEQ ID NO:61) positions 74 to 76 or 73 to 79 (loop 1) and 100 to 104 or 103 to 104 (loop 4) is constructed by ligation of 20 .mu.g SfiI and NotI restricted pPhSP-D phagemid DNA (cf. Example 10) with 10 of a SfiI and NotI restricted DNA fragment population encoding the appropriately randomized loop 1 and 4 regions. The DNA fragment population is amplified, from nine assembly reactions combining each of the three loop 1 DNA fragments with each of the three loop 4 DNA fragments as templates and the oligonucleotides Sfi-tag 5'-CGGCTGAGCGGCCCAGC-3' (SEQ ID NO:74) and Not-tag 5'-GCACTCCTGCGGCCGCG-3' (SEQ ID NO:75) as primers using standard procedures. Each of the three loop 1 fragments is amplified in a primary PCR reaction with pPhSP-D phagemid DNA (cf. Example 10) as template and the oligonucleotides Sp-dloop1a fo (SEQ ID NO:76), Sp-dloop1b fo (SEQ ID NO:77)or Sp-dloop1c fo (SEQ ID NO:78) and SfiSP-D (SEQ ID NO:64) as primers, and further amplified in a PCR reaction using Sfi-tag (SEQ ID NO:74) and Sp-dloop1-tag fo (SEQ ID NO:79) as primers. Each of the three DNA loop 4 fragments is amplified in a primary PCR reaction with pPhSP-D phagemid DNA (cf. Example 10) as template and the oligonucleotides Sp-dloop4a rev (SEQ ID NO:81), Sp-dloop4b rev (SEQ ID NO:82) or Sp-dloop4c rev (SEQ ID NO:83) and NotSP-D (SEQ ID NO:65) as primers using standard procedures and further amplified in a PCR reaction using Sp-dloop4-tag rev (SEQ ID NO:80) and Not-tag (SEQ ID NO:75) as primers. In the oligonucleotide sequences N denotes a mixture of 25% of each of the nucleotides T, C, G, and A, respectively, and S denotes a mixture of 50% of C and G, encoding the appropriately randomized nucleotide sequence. The ligation mixture is used to transform so-called electrocompetent E. coli TG-1 cells by electroporation using standard procedures. After transformation the E. coli TG-1 cells are plated on 2.times.TY-agar plates containing 0.2 mg ampicillin/mL and 20 glucose and incubated over night at 30.degree. C.

EXAMPLE 13

[0259] Construction of the Phage Library PhtCTLD-lb004

All oligonucleotides used in this example were supplied by DNA Technology (Aarhus, Denmark).

[0260] The phage library PhtCTLD-lb004, containing random amino acid residues corresponding to PhtCTLD (SEQ ID NO:15) positions 97 to 102 or 98 to 101(loop 3) and positions 116 to 122 or 118 to 120 (loop 5) was constructed by ligation of 20 .mu.g KpnI and MunI restricted pPhtCTLD phagemid DNA (cf. Example 1) with 10 .mu.g of a KpnI and MunI restricted DNA fragment population encoding the randomized loop 3 and 5 regions. The DNA fragment population was amplified from nine primary PCR reactions combining each of the three loop 3 DNA fragments with each of the three loop 5 DNA fragments. The fragments was amplified with either of the oligonucleotides loop3a (SEQ ID NO:84), loop3b (SEQ ID NO: 85), or loop3c (SEQ ID NO:86) as template and loop5a(SEQ ID NO:87), loop5b(SEQ ID NO:88)or loop5c(SEQ ID NO:89) and loop3-4rev(SEQ ID NO:91) as primers. The DNA fragments were further amplified in PCR reactions, using the primary PCR product as template and the oligonucleotide loop3-4rev (SEQ ID NO:91) and loop3-4-stag fo (SEQ ID NO:90) as primers. All PCR reactions were performed using standard procedures.

[0261] In the oligonucleotide sequences N denotes a mixture of 25% of each of the nucleotides T, C, G, and A, respectively and S denotes a mixture of 50% of C and G, encoding the appropriately randomized nucleotide sequence. The ligation mixture was used to transform so-called electrocompetent E. coli TG-1 cells by electroporation using standard procedures. After transformation the E. coli TG-1 cells were plated on 2.times.TY-agar plates containing 0.2 mg ampicillin/mL and 20 glucose and incubated over night at 30.degree. C.

[0262] The size of the resulting library, PhtCTLD-lb004, was determined to 7*10.sup.9 clones. Sixteen clones from the library were picked and phagemid DNA isolated. The nucleotide sequence of the loop-regions were determined (DNA Technology, Aarhus, Denmark). Thirteen clones were found to contain correct loop inserts and three clones contained a frameshift mutation in the region.

EXAMPLE 14

[0263] Selection of Phtlec-Phages and PhtCTLD-Phages Binding to the Blood Group A Sugar Moiety Immobilised on Human Serum Albumin

[0264] Phages grown from glycerol stocks of the libraries Phtlec-lb001 and Phtlec-lb002 (cf. Example 4) and phages grown from a glycerol stock of the library PhtCTLD-lb003 (cf. Example 5), using a standard procedure, were used in an experiment designed for the selection of Phtlec- and PhtCTLD derived phages with specific affinity to the blood group A sugar moiety immobilized on human serum albumin, A-HA, by panning in 96-well Maxisorb micro-titerplates (NUNC, Denmark) using standard procedures.

[0265] Initially, the phage supernatants were precipitated with 0.3 volume of a solution of 20% polyethylene glycol 6000 (PEG) and 2.5 M NaCl, and the pellets re-suspended in TE-buffer (10 mM Tris-HCl pH 8, 1 mM EDTA). After titration on E. coli TG-1 cells, phages derived from Phtlec-lb001 and -lb002 were mixed (#1) in a 1:1 ratio and adjusted to 5*10.sup.12 pfu/mL in 2*TY medium, and phages grown from the PhtCTLD-lb003 library (#4) were adjusted to 2.5*10.sup.12 pfu/mL in 2*TY medium.

[0266] One microgram of the "antigen", human blood group A trisaccharide immobilised on human serum albumin, A-HA, (Glycorex AB, Lund, Sweden) in 100 .mu.L PBS (PBS, 0.2 g KCl, 0.2 g KH.sub.2PO.sub.4, 8 g NaCl, 1.44 g Na.sub.2HPO.sub.4, 2H.sub.2O, water to 1 L, and adjusted to pH 7.4 with NaOH), in each of three wells, was coated over night at 4.degree. C. and at room temperature for one hour, before the first round of panning. After washing once with PBS, wells were blocked with 300 .mu.L PBS and 3% non fat dried milk for one hour at room temperature. After blocking wells were washed once in PBS and 0.1% Tween 20 and three times with PBS before the addition of a mixture of 50 .mu.L of the phage suspension and 50 .mu.L PBS, 6% non fat dried milk. The phages were allowed to bind at room temperature for two hours before washing eight times with PBS, Tween 20, and eight times with PBS. Bound phages were eluted from each well by trypsin digestion in 100 .mu.L (1 mg/mL trypsin in PBS) for 30 min. at room temperature, and used for infection of exponentially growing E. coli TG1 cells before plating and titration on 2.times.TY agar plates containing 20 glucose and 0.1 mg/mL ampicillin.

[0267] In the second round of selection, 150 .mu.L of crude phage supernatant, grown from the first round output colonies, was mixed with 150 .mu.L PBS, 6% non fat dried milk, and used for panning distributing 100 .mu.L of the mixture in each of three A-HA coated wells, as previously described. Stringency in binding was increased by increasing the number of washing steps from 16 to 32. 300 .mu.L of phage mixture was also used for panning in three wells, which had received no antigen as control.

[0268] In the third round of selection, 150 .mu.L of crude phage supernatant, grown from the second round output colonies, was mixed with 150 .mu.L PBS, 6% non fat dried milk, and used for panning distributing 100 .mu.L of the mixture in each of three A-HA coated wells, as previously described. The number of washing steps was again 32. 300 .mu.L of phage mixture was also used for panning in three wells, which had received no antigen as control.

[0269] The results from the selection procedure are summarised in Table 8

TABLE-US-00008 TABLE 8 Selection of Phtlec phages (#1) and PhtCTLD phages (#4) binding to A-HA by panning and elution with trypsin digestion. A-HA Blank Ratio Round 1 #1 0.8 * 10.sup.3 n.a. n.a. #4 1.1 * 10.sup.3 n.a. n.a. Round 2 #1 1.0 * 10.sup.3 0.5 * 10.sup.2 20 #4 1.3 * 10.sup.3 0.5 * 10.sup.2 26 Round 3 #1 8.0 * 10.sup.4 0.5 * 10.sup.2 1600 #4 9.0 * 10.sup.5 0.5 * 10.sup.2 18000 n.a. not applicable.

[0270] 48 clones from each of the #1 and #4 series were picked and grown in a 96 well microtiter tray and phages produced by infection with M13K07 helper phage using a standard procedure. Phages from the 96 phage supernatants were analyzed for binding to the A-HA antigen and for non-specific binding to hen egg white lysozyme using an ELISA-type assay. Briefly, in each well 1 .mu.g of A-HA in 100 .mu.L PBS (PBS, 0.2 g KCl, 0.2 g KH.sub.2PO.sub.4, 8 g NaCl, 1.44 g Na.sub.2HPO.sub.4, 2H.sub.2O, water to 1 L, and adjusted to pH 7.4 with NaOH) or 1 .mu.g of hen egg white lysozyme in 100 .mu.L PBS (for analysis of non specific binding) was used for over night coating at 4.degree. C. and at room temperature for one hour. After washing once with PBS, wells were blocked with 300 .mu.L PBS and 3% non fat dried milk for one hour at room temperature. After blocking wells were washed once in PBS and 0.1% Tween 20 and three times with PBS before the addition of 50 .mu.L phage supernatant in 50 .mu.L PBS, 6% non fat dried milk. The phage mixtures were allowed to bind at room temperature for two hours before washing three times with PBS, Tween 20, and three times with PBS. After washing, 50 .mu.L of a 1:5000 dilution of a HRP-conjugated anti-gene VIII antibody (Amersham Pharmacia Biotech) in PBS, 3% non fat dried milk, was added to each well and incubated at room temperature for one hour. After binding of the "secondary" antibody wells were washed three times with PBS, Tween 20, and three times with PBS before the addition of 50 .mu.L of TMB substrate (DAKO-TMB One-Step Substrate System, DAKO, Denmark). Reaction was allowed to proceed for 20 min. before quenching with 0.5 M H.sub.2SO.sub.4, and analysis. The result of the ELISA analysis showed "hits" in terms of specific binding to A-HA of phages in both series (FIGS. 34 and 35), as judged by a signal ratio between signal on A-HA to signal on lysozyme at or above 1.5, and with a signal above background.

[0271] From the #1 series 13 hits were identified and 28 hits were identified from the #4 series.

REFERENCES

[0272] Aspberg, A., Miura, R., Bourdoulous, S., Shimonaka, M., Heinegard, D., Schachner, M., Ruoslahti, E., and Yamaguchi, Y. (1997). "The C-type lectin domains of lecticans, a family of aggregating chondroitin sulfate proteoglycans, bind tenascin-R by protein-protein interactions independent of carbohydrate moiety". Proc. Natl. Acad. Sci. (USA) 94: 10116-10121

[0273] Bass, S., Greene, R., and Wells, J. A. (1990). "Hormone phage: an enrichment method for variant proteins with altered binding properties". Proteins 8: 309-314

[0274] Benhar, I., Azriel, R., Nahary, L., Shaky, S., Berdichevsky, Y., Tamarkin, A., and Wels, W. (2000). "Highly efficient selection of phage antibodies mediated by display of antigen as Lpp-OmpA' fusions on live bacteria". J. Mol. Biol. 301: 893-904

[0275] Berglund, L. and Petersen, T. E. (1992). "The gene structure of tetranectin, a plasminogen binding protein". FEBS Letters 309: 15-19

[0276] Bertrand, J. A., Plgnol, D., Bernard, J-P., Verdier, J-M., Dagorn, J-C., and Fontecilla-Camps, J. C. (1996). "Crystal structure of human lithostathine, the pancreatic inhibitor of stone formation". EMBO J. 15: 2678-2684

[0277] Bettler, B., Texido, G., Raggini, S., Ruegg, D., and Hofstetter, H. (1992). "Immunoglobulin E-binding site in Fc epsilon receptor (Fc epsilon RII/CD23) identified by homolog-scanning mutagenesis". J. Biol. Chem. 267: 185-191

[0278] Blanck, O., Iobst, S. T., Gabel, C., and Drickamer, K. (1996)."Introduction of selectin-like binding specificity into a homologous mannose-binding protein". J. Biol. Chem. 271: 7289-7292

[0279] Boder, E. T. and Wittrup, K. D. (1997). "Yeast surface display for screening combinatorial polypeptide libraries". Nature Biotech. 15: 553-557

[0280] Burrows L, Iobst S T, Drickamer K. (1997) "Selective binding of N-acetylglucosamine to the chicken hepatic lectin". Biochem J. 324:673-680

[0281] Chiba, H., Sano, H., Saitoh, M., Sohma, H., Voelker, D. R., Akino, T., and Kuroki, Y. (1999). "Introduction of mannose binding protein-type phosphatidylinositol recognition into pulmonary surfactant protein A". Biochemistry 38: 7321-7331

[0282] Christensen, J. H., Hansen, P. K., Lillelund, O., and Thogersen, H. C. (1991). "Sequence-specific binding of the N-terminal three-finger fragment of Xenopus transcription factor IIIA to the internal control region of a 5S RNA gene". FEBS Letters 281: 181-184

[0283] Cyr, J. L. and Hudspeth, A. J. (2000). "A library of bacteriophage-displayed antibody fragments directed against proteins of the inner ear". Proc. Natl. Acad. Sci (USA) 97: 2276-2281

[0284] Drickamer, K. (1992). "Engineering galactose-binding activity into a C-type mannose-binding protein". Nature 360: 183-186

[0285] Drickamer, K. and Taylor, M. E. (1993). "Biology of animal lectins". Annu. Rev. Cell Biol. 9: 237-264

[0286] Drickamer, K. (1999). "C-type lectin-like domains". Curr. Opinion Struc. Biol. 9: 585-590

[0287] Dunn, I. S. (1996). "Phage display of proteins". Curr. Opinion Biotech. 7: 547-553

[0288] Erbe, D. V., Lasky, L. A., and Presta, L. G. "Selectin variants". U.S. Pat. No. 5,593,882

[0289] Ernst, W. J., Spenger, A., Toellner, L., Katinger, H.,Grabherr, R. M. (2000). "Expanding baculovirus surface display. Modification of the native coat protein gp64 of Autographa californica NPV". Eur. J. Biochem. 267: 4033-4039

[0290] Ewart, K. V., Li, Z., Yang, D. S. C., Fletcher, G. L., and Hew, C. L. (1998). "The ice-binding site of Atlantic herring antifreeze protein corresponds to the carbohydrate-binding site of C-type lectins". Biochemistry 37: 4080-4085

[0291] Feinberg, H., Park-Snyder, S., Kolatkar, A. R., Heise, C. T., Taylor, M. E., and Weis, W. I. (2000). "Structure of a C-type carbohydrate recognition domain from the macrophage mannose receptor". J. Biol. Chem. 275: 21539-21548

[0292] Fujii, I., Fukuyama, S., Iwabuchi, Y., and Tanimura, R. (1998). "Evolving catalytic antibodies in a phage-displayed combinatorial library". Nature Biotech. 16: 463-467

[0293] Gates, C. M., Stemmer, W. P. C., Kaptein, R., and Schatz, P. J. (1996). "Affinity selective isolation of ligands from peptide libraries through display on a lac repressor "headpiece dimer". J. Mol. Biol. 255: 373-386

[0294] Graversen, J. H., Lorentsen, R. H., Jacobsen, C., Moestrup, S. K., Sigurskjold, B. W., Thogersen, H. C., and Etzerodt, M. (1998). "The plasminogen binding site of the C-type lectin tetranectin is located in the carbohydrate recognition domain, and binding is sensitive to both calcium and lysine". J. Biol. Chem. 273:29241-29246

[0295] Graversen, J. H., Jacobsen, C., Sigurskjold, B. W., Lorentsen, R. H., Moestrup, S. K., Thogersen, H. C., and Etzerodt, M. (2000). "Mutational Analysis of Affinity and Selectivity of Kringle-Tetranectin Interaction. Grafting novel kringle affinity onto the tetranectin lectin scaffold". J. Biol. Chem. 275: 37390-37396

[0296] Griffiths, A. D. and Duncan, A. R. (1998). "Strategies for selection of antibodies by phage display". Curr. Opinion Biotech. 9: 102-108

[0297] Holtet, T. L., Graversen, J. H., Clemmensen, I., Thogersen, H. C., and Etzerodt, M. (1997). "Tetranectin, a trimeric plasminogen-binding C-type lectin". Prot. Sci. 6: 1511-1515

[0298] Honma, T., Kuroki, Y., Tzunezawa, W., Ogasawara, Y., Sohma, H., Voelker, D. R., and Akino, T. (1997). "The mannose-binding protein A region of glutamic acid185-alanine221 can functionally replace the surfactant protein A region of glutamic acid195-phenylalanine228 without loss of interaction with lipids and alveolar type II cells". Biochemistry 36: 7176-7184

[0299] Huang, W., Zhang, Z., and Palzkill, T. (2000). "Design of potent beta-lactamase inhibitors by phage display of beta-lactamase inhibitory protein". J. Biol. Chem. 275: 14964-14968

[0300] Hufton, S. E., van Neer, N., van den Beuken, T., Desmet, J., Sablon, E., and Hoogenboom, H. R. (2000). "Development and application of cytotoxic T lymphocyte-associated antigen 4 as a protein scaffold for the generation of novel binding ligands". FEBS Letters 475: 225-231

[0301] Hakansson, K., Lim, N. K., Hoppe, H-J., and Reid, K. B. M. (1999). "Crystal structure of the trimeric alpha-helical coiled-coil and the three lectin domains of human lung surfactant protein D". Structure Folding and Design 7: 255-264

[0302] Iobst, S. T., Wormald, M. R., Weis, W. I., Dwek, R. A., and Drickamer, K. (1994). "Binding of sugar ligands to Ca(2+)-dependent animal lectins. I. Analysis of mannose binding by site-directed mutagenesis and NMR". J. Biol. Chem. 269: 15505-15511

[0303] Iobst, S. T. and Drickamer, K. (1994). "Binding of sugar ligands to Ca(2+)-dependent animal lectins. II. Generation of high-affinity galactose binding by site-directed mutagenesis". J. Biol. Chem. 269: 15512-15519

[0304] Iobst, S. T. and Drickamer, K. (1996). "Selective sugar binding to the carbohydrate recognition domains of the rat hepatic and macrophage asialoglycoprotein receptors". J. Biol. Chem. 271: 6686-6693

[0305] Jaquinod, M., Holtet, T. L., Etzerodt, M., Clemmensen, I., Thogersen, H. C., and Roepstorff, P. (1999). "Mass Spectrometric Characterisation of Post-Translational Modification and Genetic Variation in Human Tetranectin". Biol. Chem. 380: 1307-1314

[0306] Kastrup, J. S., Nielsen, B. B., Rasmussen, H., Holtet, T. L., Graversen, J. H., Etzerodt, M., Thogersen, H. C., and Larsen, I. K. (1998). "Structure of the C-type lectin carbohydrate recognition domain of human tetranectin". Acta. Cryst. D 54: 757-766

[0307] Kogan, T. P., Revelle, B. M., Tapp, S., Scott, D., and Beck, P. J. (1995). "A single amino acid residue can determine the ligand specificity of E-selectin". J. Biol. Chem. 270: 14047-14055

[0308] Kolatkar, A. R., Leung, A. K., Isecke, R., Brossmer, R., Drickamer, K., and Weis, W. I. (1998). "Mechanism of N-acetylgalactosamine binding to a C-type animal lectin carbohydrate-recognition domain". J. Biol. Chem. 273: 19502-19508

[0309] Lorentsen, R. H., Graversen, J. H., Caterer, N. R., Thogersen, H. C., and Etzerodt, M. (2000). "The heparin-binding site in tetranectin is located in the N-terminal region and binding does not involve the carbohydrate recognition domain". Biochem. J. 347: 83-87

[0310] Marks, J. D., Hoogenboom, H. R., Griffiths, A. D., and Winter, G. (1992). "Molecular evolution of proteins on filamentous phage. Mimicking the strategy of the immune system". J. Biol. Chem. 267: 16007-16010

[0311] Mann K, Weiss I M, Andre S, Gabius H J, Fritz M. (2000). "The amino-acid sequence of the abalone (Haliotis laevigata) nacre protein perlucin. Detection of a functional C-type lectin domain with galactose/mannose specificity". Eur. J. Biochem. 267: 5257-5264

[0312] McCafferty, J., Jackson, R. H., and Chiswell, D. J. (1991). "Phage-enzymes: expression and affinity chromatography of functional alkaline phosphatase on the surface of bacteriophage". Prot. Eng. 4: 955-961

[0313] McCormack, F. X., Kuroki, Y., Stewart, J. J., Mason, R. J., and Voelker, D. R. (1994). "Surfactant protein A amino acids Glu195 and Arg197 are essential for receptor binding, phospholipid aggregation, regulation of secretion, and the facilitated uptake of phospholipid by type II cells". J. Biol. Chem. 269: 29801-29807

[0314] McCormack, F. X., Festa, A. L., Andrews, R. P., Linke, M., and Walzer, P. D. (1997). "The carbohydrate recognition domain of surfactant protein A mediates binding to the major surface glycoprotein of Pneumocystis carinii". Biochemistry 36: 8092-8099

[0315] Meier, M., Bider, M. D., Malashkevich, V. N., Spiess, M., and Burkhard, P. (2000). "Crystal structure of the carbohydrate recognition domain of the H1 subunit of the asialoglycoprotein receptor". J. Mol. Biol. 300: 857-865

[0316] Mikawa, Y. G., Maruyama, I. N., and Brenner, S. (1996). "Surface display of proteins on bacteriophage lambda heads". J. Mol. Biol. 262: 21-30

[0317] Mio H, Kagami N, Yokokawa S, Kawai H, Nakagawa S, Takeuchi K, Sekine S, Hiraoka A. (1998). "Isolation and characterization of a cDNA for human mouse, and rat full-length stem cell growth factor, a new member of C-type lectin superfamily". Biochem. Biophys. Res. Commun. 249: 124-130

[0318] Mizuno, H., Fujimoto, Z., Koizumi, M., Kano, H., Atoda, H., and Morita, T. (1997). "Structure of coagulation factors IX/X-binding protein, a heterodimer of C-type lectin domains". Nat. Struc. Biol. 4: 438-441

[0319] Ng, K. K., Park-Snyder, S., and Weis, W. I. (1998a). "Ca.sup.2+-dependent structural changes in C-type mannose-binding proteins". Biochemistry 37: 17965-17976

[0320] Ng, K. K. and Weis, W. I. (1998b). "Coupling of prolyl peptide bond isomerization and Ca2+ binding in a C-type mannose-binding protein". Biochemistry 37: 17977-17989

[0321] Nielsen, B. B., Kastrup, J. S., Rasmussen, H., Holtet, T. L., Graversen, J. H., Etzerodt, M., Thogersen, H. C., and Larsen, I. K. (1997). "Crystal structure of tetranectin, a trimeric plasminogen-binding protein with an alpha-helical coiled coil". FEBS Letters 412: 388-396

[0322] Nissim A., Hoogenboom, H. R., Tomlinson, I. M., Flynn, G., Midgley, C., Lane, D., and Winter, G. (1994). "Antibody fragments from a `single pot` phage display library as immunochemical reagents". EMBO J. 13: 692-698

[0323] Ogasawara, Y. and Voelker, D. R. (1995). "Altered carbohydrate recognition specificity engineered into surfactant protein D reveals different binding mechanisms for phosphatidylinositol and glucosylceramide". J. Biol. Chem. 270: 14725-14732

[0324] Ohtani, K., Suzuki, Y., Eda, S., Takao, K., Kase, T., Yamazaki, H., Shimada, T., Keshi, H., Sakai, Y., Fukuoh, A., Sakamoto, T., and Wakamiya, N. (1999). "Molecular cloning of a novel human collectin from liver (CL-L1)". J. Biol. Chem. 274: 13681-13689

[0325] Pattanajitvilai, S., Kuroki, Y., Tsunezawa, W., McCormack, F. X., and Voelker, D. R. (1998). "Mutational analysis of Arg197 of rat surfactant protein A. His197 creates specific lipid uptake defects". J. Biol. Chem. 273: 5702-5707

[0326] Poget, S. F., Legge, G. B., Proctor, M. R., Butler, P. J., Bycroft, M., and Williams, R. L. (1999). "The structure of a tunicate C-type lectin from Polyandrocarpa misakiensis complexed with D-galactose". J. Mol. Biol. 290: 867-879

[0327] Revelle, B. M., Scott, D., Kogan, T. P., Zheng, J., and Beck, P. J. (1996). "Structure-function analysis of P-selectin-sialyl LewisX binding interactions. Mutagenic alteration of ligand binding specificity". J. Biol. Chem. 271: 4289-4297

[0328] Sano, H., Kuroki, Y., Honma, T., Ogasawara, Y., Sohma, H., Voelker, D. R., and Akino, T. (1998). "Analysis of chimeric proteins identifies the regions in the carbohydrate recognition domains of rat lung collectins that are essential for interactions with phospholipids, glycolipids, and alveolar type II cells". J. Biol. Chem. 273: 4783-4789

[0329] Schaffitzel, C., Hanes, J., Jermutus, L., and Placktun, A. (1999). "Ribosome display: an in vitro method for selection and evolution of antibodies from libraries". J. Immunol. Methods 231: 119-135

[0330] Sheriff, S., Chang, C. Y., and Ezekowitz, R. A. (1994). "Human mannose-binding protein carbohydrate recognition domain trimerizes through a triple alpha-helical coiled-coil". Nat. Struc. Biol. 1: 789-794

[0331] Sorensen, C. B., Berglund, L., and Petersen, T. E. (1995). "Cloning of a cDNA encoding murine tetranectin". Gene 152: 243-245

[0332] Torgersen, D., Mullin, N. P., and Drickamer, K. (1998). "Mechanism of ligand binding to E- and P-selectin analyzed using selectin/mannose-binding protein chimeras". J. Biol. Chem. 273: 6254-6261

[0333] Tormo, J., Natarajan, K., Margulies, D. H., and Mariuzza, R. A. (1999). "Crystal structure of a lectin-like natural killer cell receptor bound to its MHC class I ligand". Nature 402: 623-631

[0334] Tsunezawa, W., Sano, H., Sohma, H., McCormack, F. X., Voelker, D. R., and Kuroki, Y. (1998). "Site-directed mutagenesis of surfactant protein A reveals dissociation of lipid aggregation and lipid uptake by alveolar type II cells". Biochim. Biophys. Acta 1387: 433-446

[0335] Weis, W. I., Kahn, R., Fourme, R., Drickamer, K., and Hendrickson, W. A. (1991). "Structure of the calcium-dependent lectin domain from a rat mannose-binding protein determined by MAD phasing". Science 254: 1608-1615

[0336] Weis, W. I., and Drickamer, K. (1996). "Structural basis of lectin-carbohydrate recognition". Annu. Rev. Biochem. 65: 441-473

[0337] Whitehorn, E. A., Tate, E., Yanofsky, S. D., Kochersperger, L., Davis A., Mortensen, R. B., Yonkovic, S., Bell, K., Dower, W. J., and Barrett, R. W. (1995). "A generic method for expression and use of "tagged" soluble versions of cell surface receptors". Bio/Technology 13: 1215-1219

[0338] Wragg, S. and Drickamer, K. (1999). "Identification of amino acid residues that determine pH dependence of ligand binding to the asialoglycoprotein receptor during endocytosis". J. Biol. Chem. 274: 35400-35406

[0339] Zhang, H., Robison, B., Thorgaard, G. H., and Ristow, S. S. (2000). "Cloning, mapping and genomic organization of a fish C-type lectin gene from homozygous clones of rainbow trout (Oncorhynchos Mykiss)". Biochim. et Biophys. Acta 1494: 14-22

Sequence CWU 1

1

3521571DNAHomo sapiensCDS(1)..(564)FX-htlec encoding insert 1gga tcc atc gag ggt agg ggc gag cca cca acc cag aag ccc aag aag 48Gly Ser Ile Glu Gly Arg Gly Glu Pro Pro Thr Gln Lys Pro Lys Lys1 5 10 15att gta aat gcc aag aaa gat gtt gtg aac aca aag atg ttt gag gag 96Ile Val Asn Ala Lys Lys Asp Val Val Asn Thr Lys Met Phe Glu Glu 20 25 30ctc aag agc cgt ctg gac acc ctg gcc cag gag gtg gcc ctg ctg aag 144Leu Lys Ser Arg Leu Asp Thr Leu Ala Gln Glu Val Ala Leu Leu Lys 35 40 45gag cag cag gcc ctg cag acg gtc gtc ctg aag ggg acc aag gtg cac 192Glu Gln Gln Ala Leu Gln Thr Val Val Leu Lys Gly Thr Lys Val His 50 55 60atg aaa gtc ttt ctg gcc ttc acc cag acg aag acc ttc cac gag gcc 240Met Lys Val Phe Leu Ala Phe Thr Gln Thr Lys Thr Phe His Glu Ala65 70 75 80agc gag gac tgc atc tcg cgc ggg ggc acc ctg agc acc cct cag act 288Ser Glu Asp Cys Ile Ser Arg Gly Gly Thr Leu Ser Thr Pro Gln Thr 85 90 95ggc tcg gag aac gac gcc ctg tat gag tac ctg cgc cag agc gtg ggc 336Gly Ser Glu Asn Asp Ala Leu Tyr Glu Tyr Leu Arg Gln Ser Val Gly 100 105 110aac gag gcc gag atc tgg ctg ggc ctc aac gac atg gcg gcc gag ggc 384Asn Glu Ala Glu Ile Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly 115 120 125acc tgg gtg gac atg acc ggt acc cgc atc gcc tac aag aac tgg gag 432Thr Trp Val Asp Met Thr Gly Thr Arg Ile Ala Tyr Lys Asn Trp Glu 130 135 140act gag atc acc gcg caa ccc gat ggc ggc aag acc gag aac tgc gcg 480Thr Glu Ile Thr Ala Gln Pro Asp Gly Gly Lys Thr Glu Asn Cys Ala145 150 155 160gtc ctg tca ggc gcg gcc aac ggc aag tgg ttc gac aag cgc tgc cgc 528Val Leu Ser Gly Ala Ala Asn Gly Lys Trp Phe Asp Lys Arg Cys Arg 165 170 175gat caa ttg ccc tac atc tgc cag ttc ggg atc gtg taagctt 571Asp Gln Leu Pro Tyr Ile Cys Gln Phe Gly Ile Val 180 1852188PRTHomo sapiens 2Gly Ser Ile Glu Gly Arg Gly Glu Pro Pro Thr Gln Lys Pro Lys Lys1 5 10 15Ile Val Asn Ala Lys Lys Asp Val Val Asn Thr Lys Met Phe Glu Glu 20 25 30Leu Lys Ser Arg Leu Asp Thr Leu Ala Gln Glu Val Ala Leu Leu Lys 35 40 45Glu Gln Gln Ala Leu Gln Thr Val Val Leu Lys Gly Thr Lys Val His 50 55 60Met Lys Val Phe Leu Ala Phe Thr Gln Thr Lys Thr Phe His Glu Ala65 70 75 80Ser Glu Asp Cys Ile Ser Arg Gly Gly Thr Leu Ser Thr Pro Gln Thr 85 90 95Gly Ser Glu Asn Asp Ala Leu Tyr Glu Tyr Leu Arg Gln Ser Val Gly 100 105 110Asn Glu Ala Glu Ile Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly 115 120 125Thr Trp Val Asp Met Thr Gly Thr Arg Ile Ala Tyr Lys Asn Trp Glu 130 135 140Thr Glu Ile Thr Ala Gln Pro Asp Gly Gly Lys Thr Glu Asn Cys Ala145 150 155 160Val Leu Ser Gly Ala Ala Asn Gly Lys Trp Phe Asp Lys Arg Cys Arg 165 170 175Asp Gln Leu Pro Tyr Ile Cys Gln Phe Gly Ile Val 180 1853436DNAHomo sapiensCDS(1)..(429)FX-htCTLD encoding insert 3gga tcc atc gag ggt agg gcc ctg cag acg gtc gtc ctg aag ggg acc 48Gly Ser Ile Glu Gly Arg Ala Leu Gln Thr Val Val Leu Lys Gly Thr1 5 10 15aag gtg cac atg aaa gtc ttt ctg gcc ttc acc cag acg aag acc ttc 96Lys Val His Met Lys Val Phe Leu Ala Phe Thr Gln Thr Lys Thr Phe 20 25 30cac gag gcc agc gag gac tgc atc tcg cgc ggg ggc acc ctg agc acc 144His Glu Ala Ser Glu Asp Cys Ile Ser Arg Gly Gly Thr Leu Ser Thr 35 40 45cct cag act ggc tcg gag aac gac gcc ctg tat gag tac ctg cgc cag 192Pro Gln Thr Gly Ser Glu Asn Asp Ala Leu Tyr Glu Tyr Leu Arg Gln 50 55 60agc gtg ggc aac gag gcc gag atc tgg ctg ggc ctc aac gac atg gcg 240Ser Val Gly Asn Glu Ala Glu Ile Trp Leu Gly Leu Asn Asp Met Ala65 70 75 80gcc gag ggc acc tgg gtg gac atg acc ggt acc cgc atc gcc tac aag 288Ala Glu Gly Thr Trp Val Asp Met Thr Gly Thr Arg Ile Ala Tyr Lys 85 90 95aac tgg gag act gag atc acc gcg caa ccc gat ggc ggc aag acc gag 336Asn Trp Glu Thr Glu Ile Thr Ala Gln Pro Asp Gly Gly Lys Thr Glu 100 105 110aac tgc gcg gtc ctg tca ggc gcg gcc aac ggc aag tgg ttc gac aag 384Asn Cys Ala Val Leu Ser Gly Ala Ala Asn Gly Lys Trp Phe Asp Lys 115 120 125cgc tgc cgc gat caa ttg ccc tac atc tgc cag ttc ggg atc gtg 429Arg Cys Arg Asp Gln Leu Pro Tyr Ile Cys Gln Phe Gly Ile Val 130 135 140taagctt 4364143PRTHomo sapiens 4Gly Ser Ile Glu Gly Arg Ala Leu Gln Thr Val Val Leu Lys Gly Thr1 5 10 15Lys Val His Met Lys Val Phe Leu Ala Phe Thr Gln Thr Lys Thr Phe 20 25 30His Glu Ala Ser Glu Asp Cys Ile Ser Arg Gly Gly Thr Leu Ser Thr 35 40 45Pro Gln Thr Gly Ser Glu Asn Asp Ala Leu Tyr Glu Tyr Leu Arg Gln 50 55 60Ser Val Gly Asn Glu Ala Glu Ile Trp Leu Gly Leu Asn Asp Met Ala65 70 75 80Ala Glu Gly Thr Trp Val Asp Met Thr Gly Thr Arg Ile Ala Tyr Lys 85 90 95Asn Trp Glu Thr Glu Ile Thr Ala Gln Pro Asp Gly Gly Lys Thr Glu 100 105 110Asn Cys Ala Val Leu Ser Gly Ala Ala Asn Gly Lys Trp Phe Asp Lys 115 120 125Arg Cys Arg Asp Gln Leu Pro Tyr Ile Cys Gln Phe Gly Ile Val 130 135 140547DNAArtificial SequenceSynthetic 5cggctgagcg gcccagccgg ccatggccga gccaccaacc cagaagc 47627DNAArtificial SequenceSynthetic 6cctgcggccg ccacgatccc gaactgg 27743DNAArtificial SequenceSynthetic 7cggctgagcg gcccagccgg ccatggccgc cctgcagacg gtc 438570DNAHomo sapiensCDS(8)..(565)PhTN encoding insert 8ggcccag ccg gcc atg gcc gag cca cca acc cag aag ccc aag aag att 49 Pro Ala Met Ala Glu Pro Pro Thr Gln Lys Pro Lys Lys Ile 1 5 10gta aat gcc aag aaa gat gtt gtg aac aca aag atg ttt gag gag ctc 97Val Asn Ala Lys Lys Asp Val Val Asn Thr Lys Met Phe Glu Glu Leu15 20 25 30aag agc cgt ctg gac acc ctg gcc cag gag gtg gcc ctg ctg aag gag 145Lys Ser Arg Leu Asp Thr Leu Ala Gln Glu Val Ala Leu Leu Lys Glu 35 40 45cag cag gcc ctg cag acg gtc tgc ctg aag ggg acc aag gtg cac atg 193Gln Gln Ala Leu Gln Thr Val Cys Leu Lys Gly Thr Lys Val His Met 50 55 60aaa tgc ttt ctg gcc ttc acc cag acg aag acc ttc cac gag gcc agc 241Lys Cys Phe Leu Ala Phe Thr Gln Thr Lys Thr Phe His Glu Ala Ser 65 70 75gag gac tgc atc tcg cgc ggg ggc acc ctg agc acc cct cag act ggc 289Glu Asp Cys Ile Ser Arg Gly Gly Thr Leu Ser Thr Pro Gln Thr Gly 80 85 90tcg gag aac gac gcc ctg tat gag tac ctg cgc cag agc gtg ggc aac 337Ser Glu Asn Asp Ala Leu Tyr Glu Tyr Leu Arg Gln Ser Val Gly Asn95 100 105 110gag gcc gag atc tgg ctg ggc ctc aac gac atg gcg gcc gag ggc acc 385Glu Ala Glu Ile Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Thr 115 120 125tgg gtg gac atg acc ggc gcc cgc atc gcc tac aag aac tgg gag act 433Trp Val Asp Met Thr Gly Ala Arg Ile Ala Tyr Lys Asn Trp Glu Thr 130 135 140gag atc acc gcg caa ccc gat ggc ggc aag acc gag aac tgc gcg gtc 481Glu Ile Thr Ala Gln Pro Asp Gly Gly Lys Thr Glu Asn Cys Ala Val 145 150 155ctg tca ggc gcg gcc aac ggc aag tgg ttc gac aag cgc tgc cgc gat 529Leu Ser Gly Ala Ala Asn Gly Lys Trp Phe Asp Lys Arg Cys Arg Asp 160 165 170cag ctg ccc tac atc tgc cag ttc ggg atc gtg gcg gccgc 570Gln Leu Pro Tyr Ile Cys Gln Phe Gly Ile Val Ala175 180 1859186PRTHomo sapiens 9Pro Ala Met Ala Glu Pro Pro Thr Gln Lys Pro Lys Lys Ile Val Asn1 5 10 15Ala Lys Lys Asp Val Val Asn Thr Lys Met Phe Glu Glu Leu Lys Ser 20 25 30Arg Leu Asp Thr Leu Ala Gln Glu Val Ala Leu Leu Lys Glu Gln Gln 35 40 45Ala Leu Gln Thr Val Cys Leu Lys Gly Thr Lys Val His Met Lys Cys 50 55 60Phe Leu Ala Phe Thr Gln Thr Lys Thr Phe His Glu Ala Ser Glu Asp65 70 75 80Cys Ile Ser Arg Gly Gly Thr Leu Ser Thr Pro Gln Thr Gly Ser Glu 85 90 95Asn Asp Ala Leu Tyr Glu Tyr Leu Arg Gln Ser Val Gly Asn Glu Ala 100 105 110Glu Ile Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Thr Trp Val 115 120 125Asp Met Thr Gly Ala Arg Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile 130 135 140Thr Ala Gln Pro Asp Gly Gly Lys Thr Glu Asn Cys Ala Val Leu Ser145 150 155 160Gly Ala Ala Asn Gly Lys Trp Phe Asp Lys Arg Cys Arg Asp Gln Leu 165 170 175Pro Tyr Ile Cys Gln Phe Gly Ile Val Ala 180 18510438DNAHomo sapiensCDS(8)..(433)PhTN3 encoding insert 10ggcccag ccg gcc atg gcc gcc ctg cag acg gtc tgc ctg aag ggg acc 49 Pro Ala Met Ala Ala Leu Gln Thr Val Cys Leu Lys Gly Thr 1 5 10aag gtg cac atg aaa tgc ttt ctg gcc ttc acc cag acg aag acc ttc 97Lys Val His Met Lys Cys Phe Leu Ala Phe Thr Gln Thr Lys Thr Phe15 20 25 30cac gag gcc agc gag gac tgc atc tcg cgc ggg ggc acc ctg agc acc 145His Glu Ala Ser Glu Asp Cys Ile Ser Arg Gly Gly Thr Leu Ser Thr 35 40 45cct cag act ggc tcg gag aac gac gcc ctg tat gag tac ctg cgc cag 193Pro Gln Thr Gly Ser Glu Asn Asp Ala Leu Tyr Glu Tyr Leu Arg Gln 50 55 60agc gtg ggc aac gag gcc gag atc tgg ctg ggc ctc aac gac atg gcg 241Ser Val Gly Asn Glu Ala Glu Ile Trp Leu Gly Leu Asn Asp Met Ala 65 70 75gcc gag ggc acc tgg gtg gac atg acc ggc gcc cgc atc gcc tac aag 289Ala Glu Gly Thr Trp Val Asp Met Thr Gly Ala Arg Ile Ala Tyr Lys 80 85 90aac tgg gag act gag atc acc gcg caa ccc gat ggc ggc aag acc gag 337Asn Trp Glu Thr Glu Ile Thr Ala Gln Pro Asp Gly Gly Lys Thr Glu95 100 105 110aac tgc gcg gtc ctg tca ggc gcg gcc aac ggc aag tgg ttc gac aag 385Asn Cys Ala Val Leu Ser Gly Ala Ala Asn Gly Lys Trp Phe Asp Lys 115 120 125cgc tgc cgc gat cag ctg ccc tac atc tgc cag ttc ggg atc gtg gcg 433Arg Cys Arg Asp Gln Leu Pro Tyr Ile Cys Gln Phe Gly Ile Val Ala 130 135 140gccgc 43811142PRTHomo sapiens 11Pro Ala Met Ala Ala Leu Gln Thr Val Cys Leu Lys Gly Thr Lys Val1 5 10 15His Met Lys Cys Phe Leu Ala Phe Thr Gln Thr Lys Thr Phe His Glu 20 25 30Ala Ser Glu Asp Cys Ile Ser Arg Gly Gly Thr Leu Ser Thr Pro Gln 35 40 45Thr Gly Ser Glu Asn Asp Ala Leu Tyr Glu Tyr Leu Arg Gln Ser Val 50 55 60Gly Asn Glu Ala Glu Ile Trp Leu Gly Leu Asn Asp Met Ala Ala Glu65 70 75 80Gly Thr Trp Val Asp Met Thr Gly Ala Arg Ile Ala Tyr Lys Asn Trp 85 90 95Glu Thr Glu Ile Thr Ala Gln Pro Asp Gly Gly Lys Thr Glu Asn Cys 100 105 110Ala Val Leu Ser Gly Ala Ala Asn Gly Lys Trp Phe Asp Lys Arg Cys 115 120 125Arg Asp Gln Leu Pro Tyr Ile Cys Gln Phe Gly Ile Val Ala 130 135 14012570DNAHomo sapiensCDS(8)..(565)Phtlec encoding insert 12ggcccag ccg gcc atg gcc gag cca cca acc cag aag ccc aag aag att 49 Pro Ala Met Ala Glu Pro Pro Thr Gln Lys Pro Lys Lys Ile 1 5 10gta aat gcc aag aaa gat gtt gtg aac aca aag atg ttt gag gag ctc 97Val Asn Ala Lys Lys Asp Val Val Asn Thr Lys Met Phe Glu Glu Leu15 20 25 30aag agc cgt ctg gac acc ctg gcc cag gag gtg gcc ctg ctg aag gag 145Lys Ser Arg Leu Asp Thr Leu Ala Gln Glu Val Ala Leu Leu Lys Glu 35 40 45cag cag gcc ctg cag acg gtc gtc ctg aag ggg acc aag gtg cac atg 193Gln Gln Ala Leu Gln Thr Val Val Leu Lys Gly Thr Lys Val His Met 50 55 60aaa gtc ttt ctg gcc ttc acc cag acg aag acc ttc cac gag gcc agc 241Lys Val Phe Leu Ala Phe Thr Gln Thr Lys Thr Phe His Glu Ala Ser 65 70 75gag gac tgc atc tcg cgc ggg ggc acc ctg agc acc cct cag act ggc 289Glu Asp Cys Ile Ser Arg Gly Gly Thr Leu Ser Thr Pro Gln Thr Gly 80 85 90tcg gag aac gac gcc ctg tat gag tac ctg cgc cag agc gtg ggc aac 337Ser Glu Asn Asp Ala Leu Tyr Glu Tyr Leu Arg Gln Ser Val Gly Asn95 100 105 110gag gcc gag atc tgg ctg ggc ctc aac gac atg gcg gcc gag ggc acc 385Glu Ala Glu Ile Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Thr 115 120 125tgg gtg gac atg acc ggt acc cgc atc gcc tac aag aac tgg gag act 433Trp Val Asp Met Thr Gly Thr Arg Ile Ala Tyr Lys Asn Trp Glu Thr 130 135 140gag atc acc gcg caa ccc gat ggc ggc aag acc gag aac tgc gcg gtc 481Glu Ile Thr Ala Gln Pro Asp Gly Gly Lys Thr Glu Asn Cys Ala Val 145 150 155ctg tca ggc gcg gcc aac ggc aag tgg ttc gac aag cgc tgc cgc gat 529Leu Ser Gly Ala Ala Asn Gly Lys Trp Phe Asp Lys Arg Cys Arg Asp 160 165 170caa ttg ccc tac atc tgc cag ttc ggg atc gtg gcg gccgc 570Gln Leu Pro Tyr Ile Cys Gln Phe Gly Ile Val Ala175 180 18513186PRTHomo sapiens 13Pro Ala Met Ala Glu Pro Pro Thr Gln Lys Pro Lys Lys Ile Val Asn1 5 10 15Ala Lys Lys Asp Val Val Asn Thr Lys Met Phe Glu Glu Leu Lys Ser 20 25 30Arg Leu Asp Thr Leu Ala Gln Glu Val Ala Leu Leu Lys Glu Gln Gln 35 40 45Ala Leu Gln Thr Val Val Leu Lys Gly Thr Lys Val His Met Lys Val 50 55 60Phe Leu Ala Phe Thr Gln Thr Lys Thr Phe His Glu Ala Ser Glu Asp65 70 75 80Cys Ile Ser Arg Gly Gly Thr Leu Ser Thr Pro Gln Thr Gly Ser Glu 85 90 95Asn Asp Ala Leu Tyr Glu Tyr Leu Arg Gln Ser Val Gly Asn Glu Ala 100 105 110Glu Ile Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Thr Trp Val 115 120 125Asp Met Thr Gly Thr Arg Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile 130 135 140Thr Ala Gln Pro Asp Gly Gly Lys Thr Glu Asn Cys Ala Val Leu Ser145 150 155 160Gly Ala Ala Asn Gly Lys Trp Phe Asp Lys Arg Cys Arg Asp Gln Leu 165 170 175Pro Tyr Ile Cys Gln Phe Gly Ile Val Ala 180 18514438DNAHomo sapiensCDS(8)..(433)PhtCTLD encoding insert 14ggcccag ccg gcc atg gcc gcc ctg cag acg gtc gtc ctg aag ggg acc 49 Pro Ala Met Ala Ala Leu Gln Thr Val Val Leu Lys Gly Thr 1 5 10aag gtg cac atg aaa gtc ttt ctg gcc ttc acc cag acg aag acc ttc 97Lys Val His Met Lys Val Phe Leu Ala Phe Thr Gln Thr Lys Thr Phe15 20 25 30cac gag gcc agc gag gac tgc atc tcg cgc ggg ggc acc ctg agc acc 145His Glu Ala Ser Glu Asp Cys Ile Ser Arg Gly Gly Thr Leu Ser Thr 35 40 45cct cag act ggc tcg gag aac gac gcc ctg tat gag tac ctg cgc cag 193Pro Gln Thr Gly Ser Glu Asn Asp Ala Leu Tyr Glu Tyr Leu Arg Gln 50 55 60agc gtg ggc aac gag gcc gag atc tgg ctg ggc ctc aac gac atg gcg 241Ser Val Gly Asn Glu Ala Glu Ile Trp Leu Gly Leu Asn Asp Met Ala 65 70

75gcc gag ggc acc tgg gtg gac atg acc ggt acc cgc atc gcc tac aag 289Ala Glu Gly Thr Trp Val Asp Met Thr Gly Thr Arg Ile Ala Tyr Lys 80 85 90aac tgg gag act gag atc acc gcg caa ccc gat ggc ggc aag acc gag 337Asn Trp Glu Thr Glu Ile Thr Ala Gln Pro Asp Gly Gly Lys Thr Glu95 100 105 110aac tgc gcg gtc ctg tca ggc gcg gcc aac ggc aag tgg ttc gac aag 385Asn Cys Ala Val Leu Ser Gly Ala Ala Asn Gly Lys Trp Phe Asp Lys 115 120 125cgc tgc cgc gat caa ttg ccc tac atc tgc cag ttc ggg atc gtg gcg 433Arg Cys Arg Asp Gln Leu Pro Tyr Ile Cys Gln Phe Gly Ile Val Ala 130 135 140gccgc 438 15142PRTHomo sapiens 15Pro Ala Met Ala Ala Leu Gln Thr Val Val Leu Lys Gly Thr Lys Val1 5 10 15His Met Lys Val Phe Leu Ala Phe Thr Gln Thr Lys Thr Phe His Glu 20 25 30Ala Ser Glu Asp Cys Ile Ser Arg Gly Gly Thr Leu Ser Thr Pro Gln 35 40 45Thr Gly Ser Glu Asn Asp Ala Leu Tyr Glu Tyr Leu Arg Gln Ser Val 50 55 60Gly Asn Glu Ala Glu Ile Trp Leu Gly Leu Asn Asp Met Ala Ala Glu65 70 75 80Gly Thr Trp Val Asp Met Thr Gly Thr Arg Ile Ala Tyr Lys Asn Trp 85 90 95Glu Thr Glu Ile Thr Ala Gln Pro Asp Gly Gly Lys Thr Glu Asn Cys 100 105 110Ala Val Leu Ser Gly Ala Ala Asn Gly Lys Trp Phe Asp Lys Arg Cys 115 120 125Arg Asp Gln Leu Pro Tyr Ile Cys Gln Phe Gly Ile Val Ala 130 135 14016555DNAMus musculusmisc_featureEcoRI to HindIII insert containing mtlec encoding part 16ggaattcgag tcacccactc ccaaggccaa gaaggctgca aatgccaaga aagatttggt 60gagctcaaag atgtcgagga gctcaagaac aggatggatg tcctggccca ggaggtggcc 120ctgctgaagg agaagcaggc cttacagact gtggtcctga agggcaccaa ggtgaacttg 180aaggtcctcc tggccttcac ccaaccgaag accttccatg aggcgagcga ggactgcatc 240tcgcaagggg gcacgctggg caccccgcag tcagagctag agaacgaggc gctgttcgag 300tacgcgcgcc acagcgtggg caacgatgcg gagatctggc tgggcctcaa cgacatggcc 360gcggaaggcg cctgggtgga catgaccggt accctcctgg cctacaagaa ctgggagacg 420gagatcacga cgcaacccga cggcggcaaa gccgagaact gcgccgccct gtctggcgca 480gccaacggca agtggttcga caagcgatgc cgcgatcaat tgccctacat ctgccagttt 540gccattgtga agctt 5551777DNAArtificial SequenceSynthetic 17cggaattcga gtcacccact cccaaggcca agaaggctgc aaatgccaag aaagatttgg 60tgagctcaaa gatgttc 771894DNAArtificial SequenceSynthetic 18gcggatccag gcctgcttct ccttcagcag ggccacctcc tgggccagga catccatcct 60gttcttgagc tcctcgaaca tctttgagct cacc 941997DNAArtificial SequenceSynthetic 19gcaggcctta cagactgtgt gcctgaaggg caccaaggtg aacttgaagt gcctcctggc 60cttcacccaa ccgaagacct tccatgaggc gagcgag 972093DNAArtificial SequenceSynthetic 20ccgcatgctt cgaacagcgc ctcgttctct agctctgact gcggggtgcc cagcgtgccc 60ccttgcgaga tgcagtcctc gctcgcctca tgg 932161DNAArtificial SequenceSynthetic 21ggttcgaata cgcgcgccac agcgtgggca acgatgcgga gatctaaatg ctcccaattg 60c 612255DNAArtificial SequenceSynthetic 22ccaagcttca caatggcaaa ctggcagatg tagggcaatt gggagcattt agatc 552386DNAArtificial SequenceSynthetic 23cggagatctg gctgggcctc aacgacatgg ccgcggaagg cgcctgggtg gacatgaccg 60gtaccctcct ggcctacaag aactgg 8624130DNAArtificial SequenceSynthetic 24gggcaattga tcgcggcatc gcttgtcgaa cctcttgccg ttggctgcgc cagacagggc 60ggcgcagttc tcggctttgc cgccgtcggg ttgcgtcgtg atctccgtct cccagttctt 120gtaggccagg 1302540DNAArtificial SequenceSynthetic 25ctgggatcca tccagggtcg cgagtcaccc actcccaagg 402627DNAArtificial SequenceSynthetic 26ccgaagctta cacaatggca aactggc 272739DNAArtificial SequenceSynthetic 27ctgggatcca tccagggtcg cgccttacag actgtggtc 3928568DNAMus musculusCDS(1)..(561)FX-mtlec encoding insert 28gga tcc atc cag ggt cgc gag tca ccc act ccc aag gcc aag aag gct 48Gly Ser Ile Gln Gly Arg Glu Ser Pro Thr Pro Lys Ala Lys Lys Ala1 5 10 15gca aat gcc aag aaa gat ttg gtg agc tca aag atg ttc gag gag ctc 96Ala Asn Ala Lys Lys Asp Leu Val Ser Ser Lys Met Phe Glu Glu Leu 20 25 30aag aac agg atg gat gtc ctg gcc cag gag gtg gcc ctg ctg aag gag 144Lys Asn Arg Met Asp Val Leu Ala Gln Glu Val Ala Leu Leu Lys Glu 35 40 45aag cag gcc tta cag act gtg gtc ctg aag ggc acc aag gtg aac ttg 192Lys Gln Ala Leu Gln Thr Val Val Leu Lys Gly Thr Lys Val Asn Leu 50 55 60aag gtc ctc ctg gcc ttc acc caa ccg aag acc ttc cat gag gcg agc 240Lys Val Leu Leu Ala Phe Thr Gln Pro Lys Thr Phe His Glu Ala Ser65 70 75 80gag gac tgc atc tcg caa ggg ggc acg ctg ggc acc ccg cag tca gag 288Glu Asp Cys Ile Ser Gln Gly Gly Thr Leu Gly Thr Pro Gln Ser Glu 85 90 95cta gag aac gag gcg ctg ttc gag tac gcg cgc cac agc gtg ggc aac 336Leu Glu Asn Glu Ala Leu Phe Glu Tyr Ala Arg His Ser Val Gly Asn 100 105 110gat gcg gag atc tgg ctg ggc ctc aac gac atg gcc gcg gaa ggc gcc 384Asp Ala Glu Ile Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Ala 115 120 125tgg gtg gac atg acc ggt acc ctc ctg gcc tac aag aac tgg gag acg 432Trp Val Asp Met Thr Gly Thr Leu Leu Ala Tyr Lys Asn Trp Glu Thr 130 135 140gag atc acg acg caa ccc gac ggc ggc aaa gcc gag aac tgc gcc gcc 480Glu Ile Thr Thr Gln Pro Asp Gly Gly Lys Ala Glu Asn Cys Ala Ala145 150 155 160ctg tct ggc gca gcc aac ggc aag tgg ttc gac aag cga tgc cgc gat 528Leu Ser Gly Ala Ala Asn Gly Lys Trp Phe Asp Lys Arg Cys Arg Asp 165 170 175caa ttg ccc tac atc tgc cag ttt gcc att gtg taagctt 568Gln Leu Pro Tyr Ile Cys Gln Phe Ala Ile Val 180 18529187PRTMus musculus 29Gly Ser Ile Gln Gly Arg Glu Ser Pro Thr Pro Lys Ala Lys Lys Ala1 5 10 15Ala Asn Ala Lys Lys Asp Leu Val Ser Ser Lys Met Phe Glu Glu Leu 20 25 30Lys Asn Arg Met Asp Val Leu Ala Gln Glu Val Ala Leu Leu Lys Glu 35 40 45Lys Gln Ala Leu Gln Thr Val Val Leu Lys Gly Thr Lys Val Asn Leu 50 55 60Lys Val Leu Leu Ala Phe Thr Gln Pro Lys Thr Phe His Glu Ala Ser65 70 75 80Glu Asp Cys Ile Ser Gln Gly Gly Thr Leu Gly Thr Pro Gln Ser Glu 85 90 95Leu Glu Asn Glu Ala Leu Phe Glu Tyr Ala Arg His Ser Val Gly Asn 100 105 110Asp Ala Glu Ile Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Ala 115 120 125Trp Val Asp Met Thr Gly Thr Leu Leu Ala Tyr Lys Asn Trp Glu Thr 130 135 140Glu Ile Thr Thr Gln Pro Asp Gly Gly Lys Ala Glu Asn Cys Ala Ala145 150 155 160Leu Ser Gly Ala Ala Asn Gly Lys Trp Phe Asp Lys Arg Cys Arg Asp 165 170 175Gln Leu Pro Tyr Ile Cys Gln Phe Ala Ile Val 180 18530436DNAMus musculusCDS(1)..(429)FX-mtCTLD encoding insert 30gga tcc atc cag ggt cgc gcc tta cag act gtg gtc ctg aag ggc acc 48Gly Ser Ile Gln Gly Arg Ala Leu Gln Thr Val Val Leu Lys Gly Thr1 5 10 15aag gtg aac ttg aag gtc ctc ctg gcc ttc acc caa ccg aag acc ttc 96Lys Val Asn Leu Lys Val Leu Leu Ala Phe Thr Gln Pro Lys Thr Phe 20 25 30cat gag gcg agc gag gac tgc atc tcg caa ggg ggc acg ctg ggc acc 144His Glu Ala Ser Glu Asp Cys Ile Ser Gln Gly Gly Thr Leu Gly Thr 35 40 45ccg cag tca gag cta gag aac gag gcg ctg ttc gag tac gcg cgc cac 192Pro Gln Ser Glu Leu Glu Asn Glu Ala Leu Phe Glu Tyr Ala Arg His 50 55 60agc gtg ggc aac gat gcg gag atc tgg ctg ggc ctc aac gac atg gcc 240Ser Val Gly Asn Asp Ala Glu Ile Trp Leu Gly Leu Asn Asp Met Ala65 70 75 80gcg gaa ggc gcc tgg gtg gac atg acc ggt acc ctc ctg gcc tac aag 288Ala Glu Gly Ala Trp Val Asp Met Thr Gly Thr Leu Leu Ala Tyr Lys 85 90 95aac tgg gag acg gag atc acg acg caa ccc gac ggc ggc aaa gcc gag 336Asn Trp Glu Thr Glu Ile Thr Thr Gln Pro Asp Gly Gly Lys Ala Glu 100 105 110aac tgc gcc gcc ctg tct ggc gca gcc aac ggc aag tgg ttc gac aag 384Asn Cys Ala Ala Leu Ser Gly Ala Ala Asn Gly Lys Trp Phe Asp Lys 115 120 125cga tgc cgc gat caa ttg ccc tac atc tgc cag ttt gcc att gtg 429Arg Cys Arg Asp Gln Leu Pro Tyr Ile Cys Gln Phe Ala Ile Val 130 135 140taagctt 43631143PRTMus musculus 31Gly Ser Ile Gln Gly Arg Ala Leu Gln Thr Val Val Leu Lys Gly Thr1 5 10 15Lys Val Asn Leu Lys Val Leu Leu Ala Phe Thr Gln Pro Lys Thr Phe 20 25 30His Glu Ala Ser Glu Asp Cys Ile Ser Gln Gly Gly Thr Leu Gly Thr 35 40 45Pro Gln Ser Glu Leu Glu Asn Glu Ala Leu Phe Glu Tyr Ala Arg His 50 55 60Ser Val Gly Asn Asp Ala Glu Ile Trp Leu Gly Leu Asn Asp Met Ala65 70 75 80Ala Glu Gly Ala Trp Val Asp Met Thr Gly Thr Leu Leu Ala Tyr Lys 85 90 95Asn Trp Glu Thr Glu Ile Thr Thr Gln Pro Asp Gly Gly Lys Ala Glu 100 105 110Asn Cys Ala Ala Leu Ser Gly Ala Ala Asn Gly Lys Trp Phe Asp Lys 115 120 125Arg Cys Arg Asp Gln Leu Pro Tyr Ile Cys Gln Phe Ala Ile Val 130 135 1403247DNAArtificial SequenceSynthetic 32cggctgagcg gcccagccgg ccatggccga gtcacccact cccaagg 473327DNAArtificial SequenceSynthetic 33cctgcggccg ccacgatccc gaactgg 273446DNAArtificial SequenceSynthetic 34cggctgagcg gcccagccgg ccatggccgc cttacagact gtggtc 4635570DNAMus musculusCDS(8)..(565)Pmtlec encoding insert 35ggcccag ccg gcc atg gcc gag tca ccc act ccc aag gcc aag aag gct 49 Pro Ala Met Ala Glu Ser Pro Thr Pro Lys Ala Lys Lys Ala 1 5 10gca aat gcc aag aaa gat ttg gtg agc tca aag atg ttc gag gag ctc 97Ala Asn Ala Lys Lys Asp Leu Val Ser Ser Lys Met Phe Glu Glu Leu15 20 25 30aag aac agg atg gat gtc ctg gcc cag gag gtg gcc ctg ctg aag gag 145Lys Asn Arg Met Asp Val Leu Ala Gln Glu Val Ala Leu Leu Lys Glu 35 40 45aag cag gcc tta cag act gtg gtc ctg aag ggc acc aag gtg aac ttg 193Lys Gln Ala Leu Gln Thr Val Val Leu Lys Gly Thr Lys Val Asn Leu 50 55 60aag gtc ctc ctg gcc ttc acc caa ccg aag acc ttc cat gag gcg agc 241Lys Val Leu Leu Ala Phe Thr Gln Pro Lys Thr Phe His Glu Ala Ser 65 70 75gag gac tgc atc tcg caa ggg ggc acg ctg ggc acc ccg cag tca gag 289Glu Asp Cys Ile Ser Gln Gly Gly Thr Leu Gly Thr Pro Gln Ser Glu 80 85 90cta gag aac gag gcg ctg ttc gag tac gcg cgc cac agc gtg ggc aac 337Leu Glu Asn Glu Ala Leu Phe Glu Tyr Ala Arg His Ser Val Gly Asn95 100 105 110gat gcg gag atc tgg ctg ggc ctc aac gac atg gcc gcg gaa ggc gcc 385Asp Ala Glu Ile Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Ala 115 120 125tgg gtg gac atg acc ggt acc ctc ctg gcc tac aag aac tgg gag acg 433Trp Val Asp Met Thr Gly Thr Leu Leu Ala Tyr Lys Asn Trp Glu Thr 130 135 140gag atc acg acg caa ccc gac ggc ggc aaa gcc gag aac tgc gcc gcc 481Glu Ile Thr Thr Gln Pro Asp Gly Gly Lys Ala Glu Asn Cys Ala Ala 145 150 155ctg tct ggc gca gcc aac ggc aag tgg ttc gac aag cga tgc cgc gat 529Leu Ser Gly Ala Ala Asn Gly Lys Trp Phe Asp Lys Arg Cys Arg Asp 160 165 170caa ttg ccc tac atc tgc cag ttt gcc att gtg gcg gccgc 570Gln Leu Pro Tyr Ile Cys Gln Phe Ala Ile Val Ala175 180 18536186PRTMus musculus 36Pro Ala Met Ala Glu Ser Pro Thr Pro Lys Ala Lys Lys Ala Ala Asn1 5 10 15Ala Lys Lys Asp Leu Val Ser Ser Lys Met Phe Glu Glu Leu Lys Asn 20 25 30Arg Met Asp Val Leu Ala Gln Glu Val Ala Leu Leu Lys Glu Lys Gln 35 40 45Ala Leu Gln Thr Val Val Leu Lys Gly Thr Lys Val Asn Leu Lys Val 50 55 60Leu Leu Ala Phe Thr Gln Pro Lys Thr Phe His Glu Ala Ser Glu Asp65 70 75 80Cys Ile Ser Gln Gly Gly Thr Leu Gly Thr Pro Gln Ser Glu Leu Glu 85 90 95Asn Glu Ala Leu Phe Glu Tyr Ala Arg His Ser Val Gly Asn Asp Ala 100 105 110Glu Ile Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Ala Trp Val 115 120 125Asp Met Thr Gly Thr Leu Leu Ala Tyr Lys Asn Trp Glu Thr Glu Ile 130 135 140Thr Thr Gln Pro Asp Gly Gly Lys Ala Glu Asn Cys Ala Ala Leu Ser145 150 155 160Gly Ala Ala Asn Gly Lys Trp Phe Asp Lys Arg Cys Arg Asp Gln Leu 165 170 175Pro Tyr Ile Cys Gln Phe Ala Ile Val Ala 180 18537438DNAMus musculusCDS(8)..(433)PmtCTLD encoding insert 37ggcccag ccg gcc atg gcc gcc tta cag act gtg gtc ctg aag ggc acc 49 Pro Ala Met Ala Ala Leu Gln Thr Val Val Leu Lys Gly Thr 1 5 10aag gtg aac ttg aag gtc ctc ctg gcc ttc acc caa ccg aag acc ttc 97Lys Val Asn Leu Lys Val Leu Leu Ala Phe Thr Gln Pro Lys Thr Phe15 20 25 30cat gag gcg agc gag gac tgc atc tcg caa ggg ggc acg ctg ggc acc 145His Glu Ala Ser Glu Asp Cys Ile Ser Gln Gly Gly Thr Leu Gly Thr 35 40 45ccg cag tca gag cta gag aac gag gcg ctg ttc gag tac gcg cgc cac 193Pro Gln Ser Glu Leu Glu Asn Glu Ala Leu Phe Glu Tyr Ala Arg His 50 55 60agc gtg ggc aac gat gcg gag atc tgg ctg ggc ctc aac gac atg gcc 241Ser Val Gly Asn Asp Ala Glu Ile Trp Leu Gly Leu Asn Asp Met Ala 65 70 75gcg gaa ggc gcc tgg gtg gac atg acc ggt acc ctc ctg gcc tac aag 289Ala Glu Gly Ala Trp Val Asp Met Thr Gly Thr Leu Leu Ala Tyr Lys 80 85 90aac tgg gag acg gag atc acg acg caa ccc gac ggc ggc aaa gcc gag 337Asn Trp Glu Thr Glu Ile Thr Thr Gln Pro Asp Gly Gly Lys Ala Glu95 100 105 110aac tgc gcc gcc ctg tct ggc gca gcc aac ggc aag tgg ttc gac aag 385Asn Cys Ala Ala Leu Ser Gly Ala Ala Asn Gly Lys Trp Phe Asp Lys 115 120 125cga tgc cgc gat caa ttg ccc tac atc tgc cag ttt gcc att gtg gcg 433Arg Cys Arg Asp Gln Leu Pro Tyr Ile Cys Gln Phe Ala Ile Val Ala 130 135 140gccgc 43838142PRTMus musculus 38Pro Ala Met Ala Ala Leu Gln Thr Val Val Leu Lys Gly Thr Lys Val1 5 10 15Asn Leu Lys Val Leu Leu Ala Phe Thr Gln Pro Lys Thr Phe His Glu 20 25 30Ala Ser Glu Asp Cys Ile Ser Gln Gly Gly Thr Leu Gly Thr Pro Gln 35 40 45Ser Glu Leu Glu Asn Glu Ala Leu Phe Glu Tyr Ala Arg His Ser Val 50 55 60Gly Asn Asp Ala Glu Ile Trp Leu Gly Leu Asn Asp Met Ala Ala Glu65 70 75 80Gly Ala Trp Val Asp Met Thr Gly Thr Leu Leu Ala Tyr Lys Asn Trp 85 90 95Glu Thr Glu Ile Thr Thr Gln Pro Asp Gly Gly Lys Ala Glu Asn Cys 100 105 110Ala Ala Leu Ser Gly Ala Ala Asn Gly Lys Trp Phe Asp Lys Arg Cys 115 120 125Arg Asp Gln Leu Pro Tyr Ile Cys Gln Phe Ala Ile Val Ala 130 135 14039116DNAArtificial SequenceSynthetic 39cgcctacaag aactggnnsn nsnnsnnsnn snnscaaccc gatnnsnnsn nsnnsgagaa 60ctgcgcggtc

ctgtcaggcg cggccaacgg caagtggnns gacaagcgct gccgcg 1164031DNAArtificial SequenceSynthetic 40gaccggtacc cgcatcgcct acaagaactg g 314130DNAArtificial SequenceSynthetic 41gtagggcaat tgatcgcggc agcgcttgtc 304294DNAArtificial SequenceSynthetic 42gctgggcctc aacgacnnsn nsnnsgagnn snnstgggtg gacatgaccg gtacccgcat 60cgcctacaag aactgggaga ctgagatcac cgcg 9443102DNAArtificial SequenceSynthetic 43cgcggcagcg cttgtcgaac cacttgccgt tggccgcgcc tgacaggacc gcgcagttct 60csnnsnnsnn snnatcgggt tgcgcggtga tctcagtctc cc 1024431DNAArtificial SequenceSynthetic 44cgaggccgag atctggctgg gcctcaacga c 314531DNAArtificial SequenceSynthetic 45gggcaacgag gccgagatct ggctgggcct c 314619DNAArtificial SequenceSynthetic 46cctgaccctg cagcgcttg 194781DNAArtificial SequenceSynthetic 47cgagatctgg ctgggcctca acgacnnsnn snnsnnsnns nnsgagggca cctgggtgga 60catgaccggt acccgcatcg c 814878DNAArtificial SequenceSynthetic 48cgagatctgg ctgggcctca acgacnnsnn snnsnnsnns gagggcacct gggtggacat 60gaccggtacc cgcatcgc 784994DNAArtificial SequenceSynthetic 49gctgggcctc aacgacnnsn nsnnsgagnn snnstgggtg gacatgaccg gtacccgcat 60cgcctacaag aactgggaga ctgagatcac cgcg 945018DNAArtificial SequenceSynthetic 50gcgatgcggg taccggtc 185189DNAArtificial SequenceSynthetic 51gcatcgccta caagaactgg gagactgaga tcaccgcgca acccgatggc ggcnnsnnsn 60nsnnsnnsnn sgagaactgc gcggtcctg 895286DNAArtificial SequenceSynthetic 52gcatcgccta caagaactgg gagactgaga tcaccgcgca acccgatggc ggcnnsnnsn 60nsnnsnnsga gaactgcgcg gtcctg 865334DNAArtificial SequenceSynthetic 53catgaccggt acccgcatcg cctacaagaa ctgg 345466DNAArtificial SequenceSynthetic 54cctgaccctg cagcgcttgt cgaaccactt gccgttggcc gcgcctgaca ggaccgcgca 60gttctc 665545DNAArtificial SequenceSynthetic 55ggtacctaag tgacgatatc ctgacctaac tgcagggatc aattg 4556343DNAHomo sapiensCDS(8)..(274)Human PhtCPB insert 56ggcccag ccg gcc atg gcc gcc ctc cag acg gtc tgc ctg aag ggg acc 49 Pro Ala Met Ala Ala Leu Gln Thr Val Cys Leu Lys Gly Thr 1 5 10aag gtg cac atg aaa tgc ttt ctg gcc ttc acc cag acg aag acc ttc 97Lys Val His Met Lys Cys Phe Leu Ala Phe Thr Gln Thr Lys Thr Phe15 20 25 30cac gag gcc agc gag gac tgc atc tcg cgc ggg ggc acc ctg agc acc 145His Glu Ala Ser Glu Asp Cys Ile Ser Arg Gly Gly Thr Leu Ser Thr 35 40 45cct cag act ggc tcg gag aac gac gcc ctg tat gag tac ctg cgc cag 193Pro Gln Thr Gly Ser Glu Asn Asp Ala Leu Tyr Glu Tyr Leu Arg Gln 50 55 60agc gtg ggc aac gag gcc gag atc tgg ctg ggc ctc aac gac atg gcg 241Ser Val Gly Asn Glu Ala Glu Ile Trp Leu Gly Leu Asn Asp Met Ala 65 70 75gcc gag ggc acc tgg gtg gac atg acc ggt acc taagtgacga tatcctgacc 294Ala Glu Gly Thr Trp Val Asp Met Thr Gly Thr 80 85taactgcagg gatcaattgc cctacatctg ccagttcggg atcgtgtag 3435789PRTHomo sapiens 57Pro Ala Met Ala Ala Leu Gln Thr Val Cys Leu Lys Gly Thr Lys Val1 5 10 15His Met Lys Cys Phe Leu Ala Phe Thr Gln Thr Lys Thr Phe His Glu 20 25 30Ala Ser Glu Asp Cys Ile Ser Arg Gly Gly Thr Leu Ser Thr Pro Gln 35 40 45Thr Gly Ser Glu Asn Asp Ala Leu Tyr Glu Tyr Leu Arg Gln Ser Val 50 55 60Gly Asn Glu Ala Glu Ile Trp Leu Gly Leu Asn Asp Met Ala Ala Glu65 70 75 80Gly Thr Trp Val Asp Met Thr Gly Thr 8558405DNARattus rattusCDS(8)..(400)Rat PrMBP insert 58ggcccag ccg gcc atg gcc aac aag ttg cat gcc ttc tcc atg ggt aaa 49 Pro Ala Met Ala Asn Lys Leu His Ala Phe Ser Met Gly Lys 1 5 10aag tct ggg aag aag ttc ttt gtg acc aac cat gaa agg atg ccc ttt 97Lys Ser Gly Lys Lys Phe Phe Val Thr Asn His Glu Arg Met Pro Phe15 20 25 30tcc aaa gtc aag gcc ctg tgc tca gag ctc cga ggc act gtg gct atc 145Ser Lys Val Lys Ala Leu Cys Ser Glu Leu Arg Gly Thr Val Ala Ile 35 40 45ccc aag aat gct gag gag aac aag gcc atc caa gaa gtg gct aaa acc 193Pro Lys Asn Ala Glu Glu Asn Lys Ala Ile Gln Glu Val Ala Lys Thr 50 55 60tct gcc ttc cta ggc atc acg gac gag gtg act gaa ggc caa ttc atg 241Ser Ala Phe Leu Gly Ile Thr Asp Glu Val Thr Glu Gly Gln Phe Met 65 70 75tat gtg aca ggg ggg agg ctc acc tac agc aac tgg aaa aag gat gag 289Tyr Val Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Lys Lys Asp Glu 80 85 90ccc aat gac cat ggc tct ggg gaa gac tgt gtc act ata gta gac aac 337Pro Asn Asp His Gly Ser Gly Glu Asp Cys Val Thr Ile Val Asp Asn95 100 105 110ggt ctg tgg aat gac atc tcc tgc caa gct tcc cac acg gct gtc tgc 385Gly Leu Trp Asn Asp Ile Ser Cys Gln Ala Ser His Thr Ala Val Cys 115 120 125gag ttc cca gcc gcg gccgc 405Glu Phe Pro Ala Ala 13059131PRTRattus rattus 59Pro Ala Met Ala Asn Lys Leu His Ala Phe Ser Met Gly Lys Lys Ser1 5 10 15Gly Lys Lys Phe Phe Val Thr Asn His Glu Arg Met Pro Phe Ser Lys 20 25 30Val Lys Ala Leu Cys Ser Glu Leu Arg Gly Thr Val Ala Ile Pro Lys 35 40 45Asn Ala Glu Glu Asn Lys Ala Ile Gln Glu Val Ala Lys Thr Ser Ala 50 55 60Phe Leu Gly Ile Thr Asp Glu Val Thr Glu Gly Gln Phe Met Tyr Val65 70 75 80Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Lys Lys Asp Glu Pro Asn 85 90 95Asp His Gly Ser Gly Glu Asp Cys Val Thr Ile Val Asp Asn Gly Leu 100 105 110Trp Asn Asp Ile Ser Cys Gln Ala Ser His Thr Ala Val Cys Glu Phe 115 120 125Pro Ala Ala 13060408DNAHomo sapiensCDS(8)..(403)Human PhSP-D insert 60ggcccag ccg gcc atg gcc aag aaa gtt gag ctc ttc cca aat ggc caa 49 Pro Ala Met Ala Lys Lys Val Glu Leu Phe Pro Asn Gly Gln 1 5 10agt gtg ggg gag aag att ttc aag aca gca ggc ttt gta aaa cca ttt 97Ser Val Gly Glu Lys Ile Phe Lys Thr Ala Gly Phe Val Lys Pro Phe15 20 25 30acg gag gca cag ctg ctg tgc aca cag gct ggt gga cag ttg gcc tct 145Thr Glu Ala Gln Leu Leu Cys Thr Gln Ala Gly Gly Gln Leu Ala Ser 35 40 45cca cgc tct gcc gct gag aat gcc gcc ttg caa cag ctg gtc gta gct 193Pro Arg Ser Ala Ala Glu Asn Ala Ala Leu Gln Gln Leu Val Val Ala 50 55 60aag aac gag gct gct ttc ctg agc atg act gat tcc aag aca gag ggc 241Lys Asn Glu Ala Ala Phe Leu Ser Met Thr Asp Ser Lys Thr Glu Gly 65 70 75aag ttc acc tac ccc aca gga gag tcc ctg gtc tat tcc aac tgg gcc 289Lys Phe Thr Tyr Pro Thr Gly Glu Ser Leu Val Tyr Ser Asn Trp Ala 80 85 90cca ggg gag ccc aac gat gat ggc ggg tca gag gac tgt gtg gag atc 337Pro Gly Glu Pro Asn Asp Asp Gly Gly Ser Glu Asp Cys Val Glu Ile95 100 105 110ttc acc aat ggc aag tgg aat gac agg gct tgt gga gaa aag cgt ctt 385Phe Thr Asn Gly Lys Trp Asn Asp Arg Ala Cys Gly Glu Lys Arg Leu 115 120 125gtg gtc tgc gag ttc gcg gccgc 408Val Val Cys Glu Phe Ala 13061132PRTHomo sapiens 61Pro Ala Met Ala Lys Lys Val Glu Leu Phe Pro Asn Gly Gln Ser Val1 5 10 15Gly Glu Lys Ile Phe Lys Thr Ala Gly Phe Val Lys Pro Phe Thr Glu 20 25 30Ala Gln Leu Leu Cys Thr Gln Ala Gly Gly Gln Leu Ala Ser Pro Arg 35 40 45Ser Ala Ala Glu Asn Ala Ala Leu Gln Gln Leu Val Val Ala Lys Asn 50 55 60Glu Ala Ala Phe Leu Ser Met Thr Asp Ser Lys Thr Glu Gly Lys Phe65 70 75 80Thr Tyr Pro Thr Gly Glu Ser Leu Val Tyr Ser Asn Trp Ala Pro Gly 85 90 95Glu Pro Asn Asp Asp Gly Gly Ser Glu Asp Cys Val Glu Ile Phe Thr 100 105 110Asn Gly Lys Trp Asn Asp Arg Ala Cys Gly Glu Lys Arg Leu Val Val 115 120 125Cys Glu Phe Ala 1306249DNAArtificial SequenceSynthetic 62cggctgagcg gcccagccgg ccatggccaa caagttgcat gccttctcc 496334DNAArtificial SequenceSynthetic 63gcactcctgc ggccgcggct gggaactcgc agac 346448DNAArtificial SequenceSynthetic 64cggctgagcg gcccagccgg ccatggccaa gaaagttgag ctcttccc 486536DNAArtificial SequenceSynthetic 65gcactcctgc ggccgcgaac tcgcagacca caagac 366665DNAArtificial SequenceSynthetic 66gccaccggtg acgtagatga attggccttc snnsnnsnns nnsnngtccg tgatgcctag 60gaagg 656768DNAArtificial SequenceSynthetic 67gccaccggtg acgtagatga attggccttc snnsnnsnns nnsnnsnngt ccgtgatgcc 60taggaagg 686862DNAArtificial SequenceSynthetic 68gccaccggtg acgtagatga asnnsnnsnn snnsnnsnns nncgtgatgc ctaggaaggc 60ag 626940DNAArtificial SequenceSynthetic 69ccagttgctg tatttcaggc tgccaccggt gacgtagatg 407034DNAArtificial SequenceSynthetic 70gcctgaaata cagcaactgg aagaaagacg aacc 347168DNAArtificial SequenceSynthetic 71ctggaagaaa gacgaaccga atgaccatgg cnnsnnsnns nnsnnsgaag actgtgtcac 60tatagtag 687271DNAArtificial SequenceSynthetic 72ctggaagaaa gacgaaccga atgaccatgg cnnsnnsnns nnsnnsnnsg aagactgtgt 60cactatagta g 717359DNAArtificial SequenceSynthetic 73ctggaagaaa gacgaaccga atnnsnnsnn snnsnnsgaa gactgtgtca ctatagtag 597417DNAArtificial SequenceSynthetic 74cggctgagcg gcccagc 177517DNAArtificial SequenceSynthetic 75gcactcctgc ggccgcg 177669DNAArtificial SequenceSynthetic 76ctcaccggtc ggatacgtga acttgccctc tgtsnnsnns nnsnnsnnat cagtcatgct 60caggaaagc 697772DNAArtificial SequenceSynthetic 77ctcaccggtc ggatacgtga acttgccctc tgtsnnsnns nnsnnsnnsn natcagtcat 60gctcaggaaa gc 727860DNAArtificial SequenceSynthetic 78ctcaccggtc ggatacgtga asnnsnnsnn snnsnnsnns nnagtcatgc tcaggaaagc 607939DNAArtificial SequenceSynthetic 79cagttggaat agaccaggga ctcaccggtc ggatacgtg 398065DNAArtificial SequenceSynthetic 80gggccccagg ggagcccaac gatgatggcn nsnnsnnsnn snnsgaggac tgtgtggaga 60tcttc 658168DNAArtificial SequenceSynthetic 81gggccccagg ggagcccaac gatgatggcn nsnnsnnsnn snnsnnsgag gactgtgtgg 60agatcttc 688268DNAArtificial SequenceSynthetic 82gggccccagg ggagcccaac gatgatggcn nsnnsnnsnn snnsnnsgag gactgtgtgg 60agatcttc 688356DNAArtificial SequenceSynthetic 83gggccccagg ggagcccaac nnsnnsnnsn nsnnsgagga ctgtgtggag atcttc 568477DNAArtificial SequenceSynthetic 84gcatcgccta caagaactgg nnsnnsnnsn nsnnsnnsca acccgatggc ggcaagaccg 60agaactgcgc ggtcctg 778583DNAArtificial SequenceSynthetic 85gcatcgccta caagaactgg gagnnsnnsn nsnnsnnsnn sgcgcaaccc gatggcggca 60agaccgagaa ctgcgcggtc ctg 838680DNAArtificial SequenceSynthetic 86gcatcgccta caagaactgg gagnnsnnsn nsnnsnnsgc gcaacccgat ggcggcaaga 60ccgagaactg cgcggtcctg 808775DNAArtificial SequenceSynthetic 87gtagggcaat tgatcgctgc agcgcttgtc gaaccasnns nnsnnsnnsn nsnnsnncag 60gaccgcgcag ttctc 758884DNAArtificial SequenceSynthetic 88gtagggcaat tgatcgctgc agcgcttgtc gaaccacttg ccsnnsnnsn nsnnsnnsnn 60gcctgacagg accgcgcagt tctc 848981DNAArtificial SequenceSynthetic 89gtagggcaat tgatcgctgc agcgcttgtc gaaccacttg ccsnnsnnsn nsnnsnngcc 60tgacaggacc gcgcagttct c 819020DNAArtificial SequenceSynthetic 90gtagggcaat tgatcgctgc 209134DNAArtificial SequenceSynthetic 91catgaccggt acccgcatcg cctacaagaa ctgg 349253PRTHomo sapiens 92Trp Ile Gly Leu Arg Trp Gln Gly Lys Val Lys Gln Cys Asn Ser Glu1 5 10 15Trp Ser Asp Gly Ser Ser Val Ser Tyr Glu Asn Trp Ile Glu Ala Glu 20 25 30Ser Lys Thr Cys Leu Gly Leu Glu Lys Glu Thr Asp Phe Arg Lys Trp 35 40 45Val Asn Ile Tyr Cys 509359PRTHomo sapiens 93Trp Ile Gly Leu Thr Asp Gln Asn Gly Pro Trp Arg Trp Val Asp Gly1 5 10 15Thr Asp Phe Glu Lys Gly Phe Lys Asn Trp Ala Pro Leu Gln Pro Asp 20 25 30Asn Trp Phe Gly His Gly Leu Gly Gly Gly Glu Asp Cys Ala His Ile 35 40 45Thr Thr Gly Gly Phe Trp Asn Asp Asp Val Cys 50 559456PRTHomo sapiens 94Trp Ile Gly Leu His Asp Pro Lys Lys Asn Arg Arg Trp His Trp Ser1 5 10 15Ser Gly Ser Leu Val Ser Tyr Lys Ser Trp Gly Ile Gly Ala Pro Ser 20 25 30Ser Val Asn Pro Gly Tyr Cys Val Ser Leu Thr Ser Ser Thr Gly Phe 35 40 45Gln Lys Trp Lys Asp Val Pro Cys 50 559556PRTHomo sapiens 95Trp Ile Gly Leu Thr Asp Glu Asn Gln Glu Gly Glu Trp Gln Trp Val1 5 10 15Asp Gly Thr Asp Thr Arg Ser Ser Phe Thr Phe Trp Lys Glu Gly Glu 20 25 30Pro Asn Asn Arg Gly Phe Asn Glu Asp Cys Ala His Val Trp Thr Ser 35 40 45Gly Gln Trp Asn Asp Val Tyr Cys 50 559654PRTHomo sapiens 96Trp Ile Gly Leu Arg Asn Leu Asp Leu Lys Gly Glu Phe Ile Trp Val1 5 10 15Asp Gly Ser His Val Asp Tyr Ser Asn Trp Ala Pro Gly Glu Pro Thr 20 25 30Ser Arg Ser Gln Gly Glu Asp Cys Val Met Met Arg Gly Ser Gly Arg 35 40 45Trp Asn Asp Ala Phe Cys 509760PRTHomo sapiens 97Trp Ile Gly Leu Thr Asp Lys Asp Ser Glu Gly Thr Trp Lys Trp Val1 5 10 15Asp Gly Thr Pro Leu Thr Thr Ala Phe Trp Ser Thr Asp Glu Pro Asn 20 25 30Asp Gly Ala Val Asn Gly Glu Asp Cys Val Ser Leu Tyr Tyr His Thr 35 40 45Gln Pro Glu Phe Lys Asn Trp Asn Asp Leu Ala Cys 50 55 609859PRTHomo sapiens 98Trp Ile Gly Leu Thr Asp Gln Gly Thr Glu Gly Asn Trp Arg Trp Val1 5 10 15Asp Gly Thr Pro Phe Asp Tyr Val Gln Ser Arg Arg Phe Trp Arg Lys 20 25 30Gly Gln Pro Asp Trp Arg His Gly Asn Gly Glu Arg Glu Asp Cys Val 35 40 45His Leu Gln Arg Met Trp Asn Asp Met Ala Cys 50 559949PRTHomo sapiens 99Trp Ile Gly Leu Ser Tyr Ser Glu Glu His Thr Ala Trp Leu Trp Glu1 5 10 15Asn Gly Ser Ala Leu Ser Gln Tyr Leu Ser Phe Glu Thr Phe Asn Thr 20 25 30Lys Asn Cys Ile Ala Tyr Asn Pro Asn Gly Asn Ala Leu Asp Glu Ser 35 40 45Cys 10057PRTHomo sapiens 100Trp Ile Gly Leu Asn Asp Arg Thr Ile Glu Gly Asp Phe Arg Trp Ser1 5 10 15Asp Gly His Pro Met Gln Phe Glu Asn Trp Arg Pro Asn Gln Pro Asp 20 25 30Asn Phe Phe Ala Ala Gly Glu Asp Cys Val Val Met Ile Trp His Glu 35 40 45Lys Gly Glu Trp Asn Asp Val Pro Cys 50 5510161PRTHomo sapiens 101Trp Ile Gly Leu His Asp Pro Thr Gln Gly Thr Glu Pro Asn Gly Glu1

5 10 15Gly Trp Glu Trp Ser Ser Ser Asp Val Met Asn Tyr Phe Ala Trp Glu 20 25 30Arg Asn Pro Ser Thr Ile Ser Ser Pro Gly His Cys Ala Ser Leu Ser 35 40 45Arg Ser Thr Ala Phe Leu Arg Trp Lys Asp Tyr Asn Cys 50 55 6010257PRTHomo sapiens 102Trp Ile Gly Leu Asn Asp Arg Ile Val Glu Gln Asp Phe Gln Trp Thr1 5 10 15Asp Asn Thr Gly Leu Gln Tyr Glu Asn Trp Arg Glu Asn Gln Pro Asp 20 25 30Asn Phe Phe Ala Gly Gly Glu Asp Cys Val Val Leu Val Ser His Glu 35 40 45Ile Gly Lys Trp Asn Asp Val Pro Cys 50 5510360PRTHomo sapiens 103Trp Ile Gly Ile Arg Lys Val Asn Asn Val Trp Val Trp Val Gly Thr1 5 10 15Gln Lys Pro Leu Thr Glu Glu Ala Lys Asn Trp Ala Pro Gly Glu Pro 20 25 30Asn Asn Arg Gln Lys Asp Glu Asp Cys Val Glu Ile Tyr Ile Lys Arg 35 40 45Glu Lys Asp Val Gly Met Trp Asn Asp Glu Arg Cys 50 55 6010448PRTHomo sapiens 104Trp Ile Gly Val Phe Arg Asn Ser Ser His His Pro Trp Val Thr Met1 5 10 15Asn Gly Leu Ala Phe Lys His Glu Ile Lys Asp Ser Asp Asn Ala Glu 20 25 30Leu Asn Cys Ala Val Leu Gln Val Asn Arg Leu Lys Ser Ala Gln Cys 35 40 4510555PRTHomo sapiens 105Trp Met Gly Leu Ser Asp Leu Asn Gln Glu Gly Thr Trp Gln Trp Val1 5 10 15Asp Gly Ser Pro Leu Leu Pro Ser Phe Lys Gln Tyr Trp Asn Arg Gly 20 25 30Glu Pro Asn Asn Val Gly Glu Glu Asp Cys Ala Glu Phe Ser Gly Asn 35 40 45Gly Trp Asn Asp Asp Lys Cys 50 5510652PRTHomo sapiens 106Trp Ile Gly Leu Phe Arg Asn Val Glu Gly Thr Trp Leu Trp Ile Asn1 5 10 15Asn Ser Pro Val Ser Phe Val Asn Trp Asn Thr Gly Asp Pro Ser Gly 20 25 30Glu Arg Asn Asp Cys Val Ala Leu His Ala Ser Ser Gly Phe Trp Ser 35 40 45Asn Ile His Cys 5010758PRTHomo sapiens 107Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Thr Trp Val Asp Met1 5 10 15Thr Gly Ala Arg Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Ala 20 25 30Gln Pro Asp Gly Gly Lys Thr Glu Asn Cys Ala Val Leu Ser Gly Ala 35 40 45Ala Asn Gly Lys Trp Phe Asp Lys Arg Cys 50 5510873PRTHomo sapiens 108Trp Leu Gly Val His Asp Arg Arg Ala Glu Gly Leu Tyr Leu Phe Glu1 5 10 15Asn Gly Gln Arg Val Ser Phe Phe Ala Trp His Arg Ser Pro Arg Pro 20 25 30Glu Leu Gly Ala Gln Pro Ser Ala Ser Pro His Pro Leu Ser Pro Asp 35 40 45Gln Pro Asn Gly Gly Thr Leu Glu Asn Cys Val Ala Gln Ala Ser Asp 50 55 60Asp Gly Ser Trp Trp Asp His Asp Cys65 7010957PRTHomo sapiens 109Trp Leu Gly Ala Ser Asp Leu Asn Ile Glu Gly Arg Trp Leu Trp Glu1 5 10 15Gly Gln Arg Arg Met Asn Tyr Thr Asn Trp Ser Pro Gly Gln Pro Asp 20 25 30Asn Ala Gly Gly Ile Glu His Cys Leu Glu Leu Arg Arg Asp Leu Gly 35 40 45Asn Tyr Leu Trp Asn Asp Tyr Gln Cys 50 5511059PRTHomo sapiens 110Trp Met Gly Leu His Asp Gln Asn Gly Pro Trp Lys Trp Val Asp Gly1 5 10 15Thr Asp Tyr Glu Thr Gly Phe Lys Asn Trp Arg Pro Glu Gln Pro Asp 20 25 30Asp Trp Tyr Gly His Gly Leu Gly Gly Gly Glu Asp Cys Ala His Phe 35 40 45Thr Asp Asp Gly Arg Trp Asn Asp Asp Val Cys 50 5511147PRTHomo sapiens 111Trp Met Gly Leu Ser Asn Val Trp Asn Gln Cys Asn Trp Gln Trp Ser1 5 10 15Asn Ala Ala Met Leu Arg Tyr Lys Ala Trp Ala Glu Glu Ser Tyr Cys 20 25 30Val Tyr Phe Lys Ser Thr Asn Asn Lys Trp Arg Ser Arg Ala Cys 35 40 4511250PRTHomo sapiens 112Trp Val Gly Leu Ser Tyr Asp Asn Lys Lys Lys Asp Trp Ala Trp Ile1 5 10 15Asp Asn Arg Pro Ser Lys Leu Ala Leu Asn Thr Arg Lys Tyr Asn Ile 20 25 30Arg Asp Gly Gly Cys Met Leu Leu Ser Lys Thr Arg Leu Asp Asn Gly 35 40 45Asn Cys 5011358PRTHomo sapiens 113Trp Val Gly Ala Asp Asn Leu Gln Asp Gly Ala Tyr Asn Phe Asn Trp1 5 10 15Asn Asp Gly Val Ser Leu Pro Thr Asp Ser Asp Leu Trp Ser Pro Asn 20 25 30Glu Pro Ser Asn Pro Gln Ser Trp Gln Leu Cys Val Gln Ile Trp Ser 35 40 45Lys Tyr Asn Leu Leu Asp Asp Val Gly Cys 50 5511453PRTHomo sapiens 114Tyr Leu Gly Met Ile Glu Asp Gln Thr Pro Gly Asp Phe His Tyr Leu1 5 10 15Asp Gly Ala Ser Val Asn Tyr Thr Asn Trp Tyr Pro Gly Glu Pro Arg 20 25 30Gly Gln Gly Lys Glu Lys Cys Val Glu Met Tyr Thr Asp Gly Thr Trp 35 40 45Asn Asp Arg Gly Cys 5011556PRTHomo sapiens 115Tyr Leu Ser Met Asn Asp Ile Ser Thr Glu Gly Arg Phe Thr Tyr Pro1 5 10 15Thr Gly Glu Ile Leu Val Tyr Ser Asn Trp Ala Asp Gly Glu Pro Asn 20 25 30Asn Ser Asp Glu Gly Gln Pro Glu Asn Cys Val Glu Ile Phe Pro Asp 35 40 45Gly Lys Trp Asn Asp Val Pro Cys 50 5511657PRTHomo sapiens 116Tyr Leu Ser Met Asn Asp Ile Ser Lys Glu Gly Lys Phe Thr Tyr Pro1 5 10 15Thr Gly Gly Ser Leu Asp Tyr Ser Asn Trp Ala Pro Gly Glu Pro Asn 20 25 30Asn Arg Ala Lys Asp Glu Gly Pro Glu Asn Cys Leu Glu Ile Tyr Ser 35 40 45Asp Gly Asn Trp Asn Asp Ile Glu Cys 50 5511754PRTHomo sapiens 117Phe Leu Gly Ile Thr Asp Glu Val Thr Glu Gly Gln Phe Met Tyr Val1 5 10 15Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Lys Lys Asp Glu Pro Asn 20 25 30Asp His Gly Ser Gly Glu Asp Cys Val Thr Ile Val Asp Asn Gly Leu 35 40 45Trp Asn Asp Ile Ser Cys 5011854PRTHomo sapiens 118Phe Leu Ser Met Thr Asp Ser Lys Thr Glu Gly Lys Phe Thr Tyr Pro1 5 10 15Thr Gly Glu Ser Leu Val Tyr Ser Asn Trp Ala Pro Gly Glu Pro Asn 20 25 30Asp Asp Gly Gly Ser Glu Asp Cys Val Glu Ile Phe Thr Asn Gly Lys 35 40 45Trp Asn Asp Arg Ala Cys 5011955PRTHomo sapiens 119Phe Ile Gly Val Asn Asp Leu Glu Arg Glu Gly Gln Tyr Met Phe Thr1 5 10 15Asp Asn Thr Pro Leu Gln Asn Tyr Ser Asn Trp Asn Glu Gly Glu Pro 20 25 30Ser Asp Pro Tyr Gly His Glu Asp Cys Val Glu Met Leu Ser Ser Gly 35 40 45Arg Trp Asn Asp Thr Glu Cys 50 5512059PRTHomo sapiens 120Phe Val Gly Leu Ser Asp Pro Glu Gly Gln Arg His Trp Gln Trp Val1 5 10 15Asp Gln Thr Pro Tyr Asn Glu Ser Ser Thr Phe Trp His Pro Arg Glu 20 25 30Pro Ser Asp Pro Asn Glu Arg Cys Val Val Leu Asn Phe Arg Lys Ser 35 40 45Pro Lys Arg Trp Gly Trp Asn Asp Val Asn Cys 50 5512145PRTHomo sapiens 121Trp Leu Gly Leu Asn Ala Met Ala Ala Glu Gly Thr Trp Val Asp Met1 5 10 15Thr Gly Ala Arg Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Ala 20 25 30Gln Pro Asp Gly Gly Lys Thr Glu Asn Cys Ala Val Leu 35 40 4512245PRTHomo sapiens 122Trp Leu Gly Leu Asn Asp Met Ala Ala Ala Gly Thr Trp Val Asp Met1 5 10 15Thr Gly Ala Arg Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Ala 20 25 30Gln Pro Asp Gly Gly Lys Thr Glu Asn Cys Ala Val Leu 35 40 4512345PRTHomo sapiens 123Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Thr Trp Val Asp Met1 5 10 15Thr Gly Ala Arg Ile Ala Tyr Ala Asn Trp Glu Thr Glu Ile Thr Ala 20 25 30Gln Pro Asp Gly Gly Lys Thr Glu Asn Cys Ala Val Leu 35 40 4512445PRTHomo sapiens 124Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Thr Trp Val Asp Met1 5 10 15Thr Gly Ala Arg Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ala Thr Ala 20 25 30Gln Pro Asp Gly Gly Lys Thr Glu Asn Cys Ala Val Leu 35 40 4512545PRTHomo sapiens 125Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Thr Trp Val Asp Met1 5 10 15Thr Gly Ala Arg Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Ala 20 25 30Ala Pro Asp Gly Gly Lys Thr Glu Asn Cys Ala Val Leu 35 40 4512645PRTHomo sapiens 126Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Thr Trp Val Asp Met1 5 10 15Thr Gly Ala Arg Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Ala 20 25 30Gln Pro Ala Gly Gly Lys Thr Glu Asn Cys Ala Val Leu 35 40 4512745PRTHomo sapiens 127Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Thr Trp Val Asp Met1 5 10 15Thr Gly Ala Arg Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Ala 20 25 30Gln Pro Asp Gly Gly Ala Thr Glu Asn Cys Ala Val Leu 35 40 4512845PRTHomo sapiens 128Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Thr Trp Val Asp Met1 5 10 15Thr Gly Ala Arg Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Ala 20 25 30Gln Pro Asp Gly Gly Met Thr Glu Asn Cys Ala Val Leu 35 40 4512945PRTHomo sapiens 129Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Thr Trp Val Asp Met1 5 10 15Thr Gly Ala Arg Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Ala 20 25 30Gln Pro Asp Gly Gly Arg Thr Glu Asn Cys Ala Val Leu 35 40 4513045PRTHomo sapiens 130Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Thr Trp Val Asp Met1 5 10 15Thr Gly Ala Arg Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Ala 20 25 30Gln Pro Asp Gly Gly Lys Phe Glu Asn Cys Ala Val Leu 35 40 4513145PRTHomo sapiens 131Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Thr Trp Val Asp Met1 5 10 15Thr Gly Ala Arg Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Ala 20 25 30Gln Pro Asp Gly Gly Lys Met Glu Asn Cys Ala Val Leu 35 40 4513245PRTHomo sapiens 132Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Thr Trp Val Asp Met1 5 10 15Thr Gly Ala Arg Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Ala 20 25 30Gln Pro Asp Gly Gly Lys Arg Glu Asn Cys Ala Val Leu 35 40 4513345PRTHomo sapiens 133Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Thr Trp Val Asp Met1 5 10 15Thr Gly Ala Arg Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Ala 20 25 30Gln Pro Asp Gly Gly Lys Tyr Glu Asn Cys Ala Val Leu 35 40 4513445PRTHomo sapiens 134Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Thr Trp Val Asp Met1 5 10 15Thr Gly Ala Arg Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Ala 20 25 30Gln Pro Asp Gly Gly Lys Thr Ala Asn Cys Ala Val Leu 35 40 4513545PRTHomo sapiens 135Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Thr Trp Val Asp Met1 5 10 15Thr Gly Ala Arg Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Ala 20 25 30Gln Pro Asp Gly Gly Lys Thr Asp Asn Cys Ala Val Leu 35 40 4513645PRTHomo sapiens 136Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Thr Trp Val Asp Met1 5 10 15Thr Gly Ala Arg Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Ala 20 25 30Gln Pro Asp Gly Gly Lys Thr Gln Asn Cys Ala Val Leu 35 40 4513745PRTHomo sapiens 137Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Thr Trp Val Asp Met1 5 10 15Thr Gly Ala Arg Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Ala 20 25 30Gln Pro Asp Gly Gly Lys Thr Glu Ala Cys Ala Val Leu 35 40 4513845PRTHomo sapiens 138Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Thr Trp Val Asp Met1 5 10 15Thr Gly Ala Arg Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Ala 20 25 30Gln Pro Asp Gly Gly Arg Tyr Glu Asn Cys Ala Val Leu 35 40 4513945PRTHomo sapiens 139Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Thr Trp Val Asp Met1 5 10 15Thr Gly Ala Arg Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Ala 20 25 30Gln Pro Asp Gly Gly Lys Tyr Gln Asn Cys Ala Val Leu 35 40 4514045PRTHomo sapiens 140Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Thr Trp Val Asp Met1 5 10 15Thr Gly Ala Arg Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Ala 20 25 30Gln Pro Asp Gly Gly Lys Tyr Glu Asn Cys Ala Val Leu 35 40 4514143PRTRattus sp. 141Phe Leu Gly Ile Thr Asp Glu Val Thr Glu Gly Gln Phe Met Tyr Val1 5 10 15Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Lys Lys Asp Gln Pro Asp 20 25 30Asp His Gly Ser Gly Glu Asp Cys Val Thr Ile 35 4014243PRTRattus sp. 142Phe Leu Gly Ile Thr Asp Glu Val Thr Glu Gly Gln Phe Met Tyr Val1 5 10 15Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Lys Lys Asp Glu Pro Asp 20 25 30Asp His Gly Ser Gly Glu Asp Cys Val Thr Ile 35 4014343PRTRattus sp. 143Phe Leu Gly Ile Thr Asp Glu Val Thr Glu Gly Gln Phe Met Tyr Val1 5 10 15Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Lys Lys Asp Glu Pro Asn 20 25 30Asp Ala Gly Ser Gly Glu Asp Cys Val Thr Ile 35 4014443PRTRattus sp. 144Phe Leu Gly Ile Thr Asp Glu Val Thr Glu Gly Gln Phe Met Tyr Val1 5 10 15Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Lys Lys Asp Glu Pro Asn 20 25 30Asp Gly Gly Ser Gly Glu Asp Cys Val Thr Ile 35 4014543PRTRattus sp. 145Phe Leu Gly Ile Thr Asp Glu Val Thr Glu Gly Gln Phe Met Tyr Val1 5 10 15Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Lys Lys Asp Gln Pro Asp 20 25 30Asp Trp Gly Ser Gly Glu Asp Cys Val Thr Ile 35 4014648PRTRattus sp. 146Phe Leu Gly Ile Thr Asp Glu Val Thr Glu Gly Gln Phe Met Tyr Val1 5 10 15Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Lys Lys Asp Gln Pro Asp 20 25 30Asp Trp Tyr Gly His Gly Leu Gly Gly Gly Glu Asp Cys Val Thr Ile 35 40 4514748PRTRattus sp. 147Phe Leu Gly Ile Thr Asp Glu Val Thr Glu Gly Gln Phe Met Tyr Val1 5 10 15Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Lys Lys Asp Gln Pro Asp 20 25 30Asp Trp Ala Gly His Gly Leu Gly Gly Gly Glu Asp Cys Val Thr Ile 35 40 4514848PRTRattus sp. 148Phe Leu Gly Ile Thr Asp Glu Val Thr Glu Gly Gln Phe Met Tyr Val1 5

10 15Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Lys Lys Asp Gln Pro Asp 20 25 30Asp Trp Gln Gly His Gly Leu Gly Gly Gly Glu Asp Cys Val Thr Ile 35 40 4514948PRTRattus sp. 149Phe Leu Gly Ile Thr Asp Glu Val Thr Glu Gly Gln Phe Met Tyr Val1 5 10 15Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Lys Lys Asp Gln Pro Asp 20 25 30Asp Trp Tyr Ala His Gly Leu Gly Gly Gly Glu Asp Cys Val Thr Ile 35 40 4515048PRTRattus sp. 150Phe Leu Gly Ile Thr Asp Glu Val Thr Glu Gly Gln Phe Met Tyr Val1 5 10 15Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Lys Lys Asp Gln Pro Asp 20 25 30Asp Trp Tyr Gly Ala Gly Leu Gly Gly Gly Glu Asp Cys Val Thr Ile 35 40 4515148PRTRattus sp. 151Phe Leu Gly Ile Thr Asp Glu Val Thr Glu Gly Gln Phe Met Tyr Val1 5 10 15Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Lys Lys Asp Gln Pro Asp 20 25 30Asp Trp Tyr Gly Gln Gly Leu Gly Gly Gly Glu Asp Cys Val Thr Ile 35 40 4515248PRTRattus sp. 152Phe Leu Gly Ile Thr Asp Glu Val Thr Glu Gly Gln Phe Met Tyr Val1 5 10 15Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Lys Lys Asp Gln Pro Asp 20 25 30Asp Trp Tyr Gly Glu Gly Leu Gly Gly Gly Glu Asp Cys Val Thr Ile 35 40 4515348PRTRattus sp. 153Phe Leu Gly Ile Thr Asp Glu Val Thr Glu Gly Gln Phe Met Tyr Val1 5 10 15Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Lys Lys Asp Gln Pro Asp 20 25 30Asp Trp Tyr Gly Tyr Gly Leu Gly Gly Gly Glu Asp Cys Val Thr Ile 35 40 4515447PRTRattus sp. 154Phe Leu Gly Ile Thr Asp Glu Val Thr Glu Gly Gln Phe Met Tyr Val1 5 10 15Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Lys Lys Asp Gln Pro Asp 20 25 30Asp Trp Tyr Gly His Gly Leu Gly Gly Glu Asp Cys Val Thr Ile 35 40 4515543PRTRattus sp. 155Phe Leu Gly Ile Thr Asp Glu Val Thr Glu Gly Gln Phe Met Tyr Val1 5 10 15Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Lys Lys Asp Gln Pro Asp 20 25 30Asp Phe Gly Ser Gly Glu Asp Cys Val Thr Ile 35 4015648PRTRattus sp. 156Phe Leu Gly Ile Thr Asp Glu Val Thr Glu Gly Gln Phe Met Tyr Val1 5 10 15Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Lys Lys Asp Gln Pro Asp 20 25 30Asp Phe Tyr Gly His Gly Leu Gly Gly Gly Glu Asp Cys Val Thr Ile 35 40 4515741PRTRattus sp. 157Phe Leu Gly Ile Arg Lys Val Asn Asn Val Phe Met Tyr Val Thr Gly1 5 10 15Gly Arg Leu Thr Tyr Ser Asn Trp Lys Lys Asp Glu Pro Asn Asp His 20 25 30Gly Ser Gly Glu Asp Cys Val Thr Ile 35 4015843PRTRattus sp. 158Phe Leu Gly Ile Thr Asp Glu Val Thr Glu Gly Gln Phe Met Tyr Val1 5 10 15Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Lys Lys Asp Glu Pro Asn 20 25 30Asn Arg Gln Lys Asp Glu Asp Cys Val Thr Ile 35 4015943PRTRattus sp. 159Phe Leu Gly Ile Thr Asp Glu Val Thr Glu Gly Gln Phe Met Tyr Val1 5 10 15Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Lys Lys Asp Glu Pro Asn 20 25 30Asp Gly Gly Ser Gly Glu Asp Cys Val Thr Ile 35 4016043PRTRattus sp. 160Phe Leu Gly Ile Thr Asp Glu Val Thr Glu Gly Gln Phe Met Tyr Val1 5 10 15Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Lys Lys Asp Glu Pro Asn 20 25 30Asp His Gly Ser Gly Glu Asp Cys Val Glu Ile 35 4016143PRTRattus sp. 161Phe Leu Gly Ile Thr Asp Glu Val Thr Glu Gly Gln Phe Met Tyr Val1 5 10 15Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Ala Pro Gly Glu Pro Asn 20 25 30Asp His Gly Ser Gly Glu Asp Cys Val Thr Ile 35 4016243PRTRattus sp. 162Phe Leu Gly Ile Thr Asp Glu Val Thr Glu Gly Gln Phe Met Tyr Val1 5 10 15Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Ala Asp Asn Glu Pro Asn 20 25 30Asp His Gly Ser Gly Glu Asp Cys Val Thr Ile 35 4016348PRTRattus sp. 163Phe Leu Gly Ile Thr Asp Glu Val Thr Glu Gly Gln Phe Met Tyr Val1 5 10 15Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Lys Lys Asp Gln Pro Asp 20 25 30Asp Trp Tyr Gly His Gly Leu Gly Gly Gly Glu Asp Cys Val His Ile 35 40 4516448PRTRattus sp. 164Phe Leu Gly Ile Thr Asp Glu Val Thr Glu Gly Gln Phe Met Tyr Val1 5 10 15Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Arg Pro Gly Gln Pro Asp 20 25 30Asp Trp Tyr Gly His Gly Leu Gly Gly Gly Glu Asp Cys Val His Ile 35 40 4516546PRTRattus sp. 165Phe Leu Gly Ile Thr Asp Gln Asn Gly Gln Phe Met Tyr Val Thr Gly1 5 10 15Gly Arg Leu Thr Tyr Ser Asn Trp Lys Lys Asp Gln Pro Asp Asp Trp 20 25 30Tyr Gly His Gly Leu Gly Gly Gly Glu Asp Cys Val Thr Ile 35 40 4516646PRTRattus sp. 166Phe Leu Gly Ile Thr Asp Gln Asn Gly Pro Phe Met Tyr Val Thr Gly1 5 10 15Gly Arg Leu Thr Tyr Ser Asn Trp Lys Lys Asp Gln Pro Asp Asp Trp 20 25 30Tyr Gly His Gly Leu Gly Gly Gly Glu Asp Cys Val Thr Ile 35 40 4516743PRTRattus sp. 167Phe Leu Gly Ile Thr Asp Glu Val Thr Glu Gly Gln Phe Met Tyr Val1 5 10 15Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Lys Glu Gly Glu Pro Asn 20 25 30Asn Arg Gly Ser Gly Glu Asp Cys Val Thr Ile 35 4016843PRTRattus sp. 168Phe Leu Gly Ile Thr Asp Glu Val Thr Glu Gly Gln Phe Met Tyr Val1 5 10 15Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Lys Glu Gly Glu Pro Asn 20 25 30Asn Arg Gly Phe Asn Glu Asp Cys Val Thr Ile 35 4016943PRTRattus sp. 169Phe Leu Gly Ile Thr Asp Glu Val Thr Glu Gly Gln Phe Met Tyr Val1 5 10 15Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Lys Glu Gly Glu Pro Asn 20 25 30Asn Arg Gly Phe Asn Glu Asp Cys Ala His Val 35 4017042PRTRattus sp. 170Tyr Leu Gly Met Ile Glu Asp Gln Thr Pro Gly Asp Phe His Tyr Leu1 5 10 15Asp Gly Ala Ser Val Asn Tyr Thr Asn Trp Tyr Pro Gly Gln Pro Asp 20 25 30Gly Gln Gly Lys Glu Lys Cys Val Glu Met 35 4017142PRTRattus sp. 171Tyr Leu Gly Met Ile Glu Asp Gln Thr Pro Gly Asp Phe His Tyr Leu1 5 10 15Asp Gly Ala Ser Val Asn Tyr Thr Asn Trp Tyr Pro Gly Glu Pro Arg 20 25 30Gly Gln Gly Lys Glu Lys Cys Val Thr Ile 35 4017243PRTRattus sp. 172Tyr Leu Gly Met Ile Glu Asp Gln Thr Pro Gly Asp Phe His Tyr Leu1 5 10 15Asp Gly Ala Ser Val Asn Tyr Thr Asn Trp Tyr Pro Gly Glu Pro Asn 20 25 30Asp His Gly Ser Gly Glu Asp Cys Val Thr Ile 35 4017342PRTRattus sp. 173Tyr Leu Gly Met Ile Glu Asp Gln Thr Pro Gly Asp Phe His Tyr Leu1 5 10 15Asp Gly Ala Ser Val Asn Tyr Thr Asn Trp Tyr Pro Gly Ala Pro Arg 20 25 30Gly Gln Gly Lys Glu Lys Cys Val Glu Met 35 4017442PRTRattus sp. 174Tyr Leu Gly Met Ile Glu Asp Gln Thr Pro Gly Asp Phe His Tyr Leu1 5 10 15Asp Gly Ala Ser Val Asn Tyr Thr Asn Trp Tyr Pro Gly Glu Pro Gly 20 25 30Gly Gln Gly Lys Glu Lys Cys Val Glu Met 35 4017542PRTRattus sp. 175Tyr Leu Gly Met Ile Glu Asp Gln Thr Pro Gly Asp Phe His Tyr Leu1 5 10 15Asp Gly Ala Ser Val Asn Tyr Thr Asn Trp Tyr Pro Gly Glu Pro Arg 20 25 30Gly Gln Gly Lys Ala Lys Cys Val Glu Met 35 4017642PRTRattus sp. 176Tyr Leu Gly Met Ile Glu Asp Gln Thr Pro Gly Asp Phe His Tyr Leu1 5 10 15Asp Gly Ala Ser Val Ser Tyr Thr Asn Trp Tyr Pro Gly Glu Pro Arg 20 25 30Gly Gln Gly Lys Glu Lys Cys Val Glu Met 35 4017742PRTRattus sp. 177Tyr Leu Gly Met Ile Glu Asp Gln Thr Pro Gly Asp Phe His Tyr Leu1 5 10 15Asp Gly Ala Ser Val Asn Tyr Thr Asn Trp Tyr Pro Gly Glu Pro Ala 20 25 30Gly Gln Gly Lys Glu Lys Cys Val Glu Met 35 4017842PRTRattus sp. 178Tyr Leu Gly Met Ile Glu Asp Gln Thr Pro Gly Asp Phe His Tyr Leu1 5 10 15Asp Gly Ala Ser Val Asn Tyr Thr Asn Trp Tyr Pro Gly Glu Pro Lys 20 25 30Gly Gln Gly Lys Glu Lys Cys Val Glu Met 35 4017942PRTRattus sp. 179Tyr Leu Gly Met Ile Glu Asp Gln Thr Pro Gly Asp Phe His Tyr Leu1 5 10 15Asp Gly Ala Ser Val Asn Tyr Thr Asn Trp Tyr Pro Gly Glu Pro His 20 25 30Gly Gln Gly Lys Glu Lys Cys Val Glu Met 35 4018042PRTRattus sp. 180Tyr Leu Gly Met Ile Glu Asp Gln Thr Pro Gly Asp Phe His Tyr Leu1 5 10 15Asp Gly Ala Ser Val Asn Tyr Thr Asn Trp Tyr Pro Gly Glu Pro Asp 20 25 30Gly Gln Gly Lys Glu Lys Cys Val Glu Met 35 4018142PRTRattus sp. 181Tyr Leu Gly Met Ile Glu Asp Gln Thr Pro Gly Asp Phe His Tyr Leu1 5 10 15Asp Gly Ala Ser Val Asn Tyr Thr Asn Trp Tyr Pro Gly Glu Pro Asn 20 25 30Gly Gln Gly Lys Glu Lys Cys Val Glu Met 35 4018242PRTRattus sp. 182Tyr Leu Gly Met Ile Glu Asp Gln Thr Pro Gly Asp Phe His Tyr Leu1 5 10 15Asp Gly Ala Ser Val Asn Tyr Thr Asn Trp Tyr Pro Gly Gln Pro Arg 20 25 30Gly Gln Gly Lys Glu Lys Cys Val Glu Met 35 4018342PRTRattus sp. 183Tyr Leu Gly Met Ile Glu Asp Gln Thr Pro Gly Asp Phe His Tyr Leu1 5 10 15Asp Gly Ala Ser Val Asn Tyr Thr Asn Trp Tyr Pro Gly Glu Pro Arg 20 25 30Gly Gln Gly Ala Glu Lys Cys Val Glu Met 35 4018442PRTRattus sp. 184Tyr Leu Gly Met Ile Glu Asp Gln Thr Pro Gly Asp Phe His Tyr Leu1 5 10 15Asp Gly Ala Ser Val Asn Tyr Thr Asn Trp Tyr Pro Gly Glu Pro Arg 20 25 30Gly Gln Gly Lys Glu Ala Cys Val Glu Met 35 4018542PRTRattus sp. 185Tyr Leu Gly Met Ile Glu Asp Gln Thr Pro Gly Asp Phe His Tyr Leu1 5 10 15Asp Gly Ala Ser Val Asn Tyr Thr Asn Trp Tyr Pro Gly Ala Pro Arg 20 25 30Gly Gln Gly Ala Glu Ala Cys Val Glu Met 35 4018643PRTRattus sp. 186Tyr Leu Gly Met Ile Glu Asp Gln Thr Pro Gly Asp Phe His Tyr Leu1 5 10 15Asp Gly Ala Ser Val Asn Tyr Thr Asn Trp Tyr Pro Gly Glu Pro Asn 20 25 30Asn Asn Gly Gly Ala Glu Asn Cys Val Glu Ile 35 4018743PRTRattus sp. 187Tyr Leu Gly Met Ile Glu Asp Gln Thr Glu Gly Lys Phe Thr Tyr Pro1 5 10 15Thr Gly Glu Ala Leu Val Tyr Ser Asn Trp Ala Pro Gly Glu Pro Asn 20 25 30Asn Asn Gly Gly Ala Glu Asn Cys Val Glu Ile 35 4018842PRTRattus sp. 188Tyr Leu Gly Met Ile Glu Asp Gln Thr Glu Gly Gln Phe Met Tyr Val1 5 10 15Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Lys Lys Asp Glu Pro Arg 20 25 30Gly Gln Gly Lys Glu Lys Cys Val Glu Met 35 4018942PRTHomo sapiens 189Tyr Val Gly Leu Thr Glu Gly Pro Ser Pro Gly Asp Phe Arg Tyr Ser1 5 10 15Asp Gly Thr Pro Val Asn Tyr Thr Asn Trp Tyr Arg Gly Glu Pro Ala 20 25 30Gly Ala Gly Lys Glu Gln Cys Val Glu Met 35 4019042PRTHomo sapiens 190Tyr Val Gly Leu Thr Glu Gly Pro Ser Pro Gly Asp Phe Arg Tyr Ser1 5 10 15Asp Gly Thr Pro Val Asn Tyr Thr Asn Trp Tyr Arg Gly Glu Pro Ala 20 25 30Gly Arg Gly Ala Glu Gln Cys Val Glu Met 35 4019142PRTHomo sapiens 191Tyr Val Gly Leu Thr Glu Gly Pro Thr Glu Gly Gln Phe Met Tyr Val1 5 10 15Thr Gly Gly Arg Leu Thr Tyr Ser Asn Trp Lys Lys Asp Glu Pro Arg 20 25 30Gly Arg Gly Lys Glu Gln Cys Val Glu Met 35 4019243PRTHomo sapiens 192Phe Leu Ser Met Thr Asp Val Gly Thr Glu Gly Lys Phe Thr Tyr Pro1 5 10 15Thr Gly Glu Ala Leu Val Tyr Ser Asn Trp Ala Pro Gly Gln Pro Asp 20 25 30Asn Asn Gly Gly Ala Glu Asn Cys Val Glu Ile 35 4019344PRTHomo sapiens 193Trp Ile Gly Ile Arg Lys Val Asn Asn Val Trp Val Trp Val Gly Thr1 5 10 15Gln Ala Pro Leu Thr Glu Glu Ala Lys Asn Trp Ala Pro Gly Glu Pro 20 25 30Asn Asn Arg Gln Lys Asp Glu Asp Cys Val Glu Ile 35 4019444PRTHomo sapiens 194Trp Ile Gly Ile Arg Lys Val Asn Asn Val Trp Val Trp Val Gly Thr1 5 10 15Gln Lys Pro Leu Thr Glu Glu Ala Ala Asn Trp Ala Pro Gly Glu Pro 20 25 30Asn Asn Arg Gln Lys Asp Glu Asp Cys Val Glu Ile 35 4019544PRTHomo sapiens 195Trp Ile Gly Ile Arg Lys Val Asn Asn Val Trp Val Trp Val Gly Thr1 5 10 15Gln Lys Pro Leu Thr Glu Glu Ala Lys Asn Trp Ala Pro Gly Glu Pro 20 25 30Asn Asn Ala Gln Ala Asp Glu Asp Cys Val Glu Ile 35 4019644PRTHomo sapiens 196Trp Ile Gly Ile Arg Lys Val Asn Asn Val Trp Val Trp Val Gly Thr1 5 10 15Gln Lys Pro Leu Thr Glu Glu Ala Lys Asn Trp Ala Pro Gly Glu Pro 20 25 30Asn Asn Ala Gln Lys Asp Glu Asp Cys Val Glu Ile 35 4019744PRTHomo sapiens 197Trp Ile Gly Ile Arg Lys Val Asn Asn Val Trp Val Trp Val Gly Thr1 5 10 15Gln Lys Pro Leu Thr Glu Glu Ala Lys Asn Trp Ala Pro Gly Glu Pro 20 25 30Asn Asn Lys Gln Lys Asp Glu Asp Cys Val Glu Ile 35 4019844PRTHomo sapiens 198Trp Ile Gly Ile Arg Lys Val Asn Asn Val Trp Val Trp Val Gly Thr1 5 10 15Gln Lys Pro Leu Thr Glu Glu Ala Lys Asn Trp Ala Pro Gly Glu Pro 20 25 30Asn Asn Lys Gln Lys Asp Glu Gly Cys Val Glu Ile 35 4019944PRTHomo sapiens 199Trp Ile Gly Ile Arg Lys Val Asn Asn Val Trp Val Trp Val Gly Thr1 5 10 15Gln Lys Pro Leu Thr Glu Glu Ala Lys Asn Trp Lys Pro Gly Glu Pro 20 25 30Asn Asn Arg Gln Lys Asp Glu Asp Cys Val Glu Ile 35 4020044PRTHomo sapiens 200Trp Ile Gly Ile Arg Lys Val Asn Asn Val Trp Val Trp Val Gly Thr1 5 10 15Gln Lys Pro Leu Thr Glu Glu Ala Lys Asn Trp Lys Lys Gly Glu Pro 20 25 30Asn Asn Arg Gln Lys Asp Glu Asp Cys Val Glu Ile 35 4020144PRTHomo sapiens 201Trp Ile Gly Ile Arg Lys Val Asn Asn Val Trp Val Trp Val Gly Thr1 5 10 15Gln Lys Pro Leu Thr Glu Glu Ala Lys Asn Trp Lys Lys Gly Glu Pro 20 25 30Asn Asn Ala Gln Lys Asp Glu

Asp Cys Val Glu Ile 35 4020244PRTHomo sapiens 202Trp Ile Gly Ile Arg Lys Val Asn Asn Val Trp Val Trp Val Gly Thr1 5 10 15Gln Lys Pro Leu Thr Glu Glu Ala Lys Asn Trp Ala Pro Gly Glu Pro 20 25 30Asn Asn Arg Gln Lys Glu Glu Asp Cys Val Glu Ile 35 4020344PRTHomo sapiens 203Trp Ile Gly Ile Arg Lys Val Asn Asn Val Trp Val Trp Val Gly Thr1 5 10 15Gln Lys Pro Leu Thr Glu Glu Ala Lys Asn Trp Ala Pro Gly Glu Pro 20 25 30Asn Asn Arg Gln Lys Asn Glu Asp Cys Val Glu Ile 35 4020444PRTHomo sapiens 204Trp Ile Gly Ile Arg Lys Val Asn Asn Val Trp Val Trp Val Gly Thr1 5 10 15Gln Lys Pro Leu Thr Glu Glu Ala Lys Asn Trp Ala Pro Gly Glu Pro 20 25 30Asn Asn Arg Gln Lys Asp Glu Asn Cys Val Glu Ile 35 4020544PRTHomo sapiens 205Trp Ile Gly Ile Arg Lys Val Asn Asn Val Trp Val Trp Val Gly Thr1 5 10 15Gln Lys Pro Leu Thr Glu Glu Ala Lys Asn Trp Ala Pro Gly Glu Pro 20 25 30Asn Asn Arg Gln Lys Asp Glu Glu Cys Val Glu Ile 35 4020644PRTHomo sapiens 206Trp Ile Gly Ile Arg Lys Val Asn Asn Val Trp Val Trp Val Gly Thr1 5 10 15Gln Lys Pro Leu Thr Glu Glu Ala Lys Asn Trp Lys Pro Gly Gln Pro 20 25 30Asp Asn Arg Gln Lys Asp Glu Asp Cys Val Glu Ile 35 4020744PRTHomo sapiens 207Trp Ile Gly Ile Arg Lys Asn Asn Lys Thr Trp Thr Trp Val Gly Thr1 5 10 15Lys Lys Ala Leu Thr Asn Glu Ala Glu Asn Trp Lys Asp Asn Glu Pro 20 25 30Asn Asn Lys Arg Asn Asn Glu Asp Cys Val Glu Ile 35 4020844PRTHomo sapiens 208Trp Ile Gly Ile Arg Lys Asn Asn Lys Thr Trp Thr Trp Val Gly Thr1 5 10 15Lys Lys Ala Leu Thr Asn Glu Ala Glu Asn Trp Lys Asp Asn Gln Pro 20 25 30Asp Asn Lys Arg Asn Asn Glu Asp Cys Val Glu Ile 35 4020948PRTHomo sapiens 209Trp Ile Gly Leu Thr Asp Gln Asn Gly Pro Trp Arg Trp Val Asp Gly1 5 10 15Thr Asp Tyr Glu Lys Gly Phe Thr His Trp Arg Pro Lys Gln Pro Asp 20 25 30Asn Trp Tyr Gly His Gly Leu Gly Gly Gly Glu Asp Cys Ala His Phe 35 40 4521048PRTHomo sapiens 210Trp Ile Gly Leu Thr Asp Gln Asn Gly Pro Trp Arg Trp Val Asp Gly1 5 10 15Thr Asp Tyr Glu Lys Gly Phe Thr His Trp Ala Pro Gly Gln Pro Asp 20 25 30Asn Trp Tyr Gly His Gly Leu Gly Gly Gly Glu Asp Cys Ala His Phe 35 40 4521148PRTHomo sapiens 211Trp Ile Gly Leu Thr Asp Gln Asn Gly Pro Trp Arg Trp Val Asp Gly1 5 10 15Thr Asp Tyr Glu Lys Gly Phe Thr His Trp Arg Pro Gly Gln Pro Asp 20 25 30Asn Trp Tyr Gly His Gly Leu Gly Gly Gly Glu Asp Cys Ala His Phe 35 40 4521248PRTHomo sapiens 212Trp Ile Gly Leu Thr Asp Gln Asn Gly Pro Trp Arg Trp Val Asp Gly1 5 10 15Thr Asp Tyr Glu Lys Gly Phe Thr His Trp Ala Pro Lys Gln Pro Asp 20 25 30Asn Trp Tyr Gly His Gly Leu Gly Gly Gly Glu Asp Cys Ala His Ile 35 40 4521348PRTHomo sapiens 213Trp Ile Gly Leu Thr Asp Gln Asn Gly Pro Trp Arg Trp Val Asp Gly1 5 10 15Thr Asp Tyr Glu Lys Gly Phe Thr His Trp Ala Pro Lys Gln Pro Asp 20 25 30Asn Trp Tyr Gly His Gly Leu Gly Gly Gly Glu Asp Cys Ala Ala Phe 35 40 4521448PRTHomo sapiens 214Trp Ile Gly Leu Thr Asp Gln Asn Gly Pro Trp Arg Trp Val Asp Gly1 5 10 15Thr Asp Tyr Glu Lys Gly Phe Thr His Trp Ala Pro Lys Gln Pro Asp 20 25 30Asn Trp Tyr Gly His Gly Leu Gly Gly Gly Glu Asp Cys Ala Glu Phe 35 40 4521548PRTHomo sapiens 215Trp Ile Gly Leu Thr Asp Gln Asn Gly Pro Trp Arg Trp Val Asp Gly1 5 10 15Thr Asp Tyr Glu Lys Gly Phe Thr His Trp Ala Pro Lys Gln Pro Asp 20 25 30Asn Trp Tyr Gly His Gly Leu Gly Gly Gly Glu Asp Cys Ala Gln Phe 35 40 4521648PRTHomo sapiens 216Trp Ile Gly Leu Thr Asp Gln Asn Gly Pro Trp Arg Trp Val Asp Gly1 5 10 15Thr Asp Tyr Glu Lys Gly Phe Thr His Trp Ala Pro Lys Gln Pro Asp 20 25 30Asn Trp Tyr Gly His Gly Leu Gly Gly Gly Glu Asp Cys Ala Asn Phe 35 40 4521748PRTHomo sapiens 217Trp Ile Gly Leu Thr Asp Gln Asn Gly Pro Trp Arg Trp Val Asp Gly1 5 10 15Thr Asp Tyr Glu Lys Gly Phe Thr His Trp Ala Pro Lys Gln Pro Asp 20 25 30Asn Trp Tyr Gly His Gly Leu Gly Gly Gly Glu Asp Cys Ala Tyr Phe 35 40 4521848PRTHomo sapiens 218Trp Ile Gly Leu Thr Asp Gln Asn Gly Pro Trp Arg Trp Val Asp Gly1 5 10 15Thr Asp Tyr Glu Lys Gly Phe Thr His Trp Ala Pro Lys Gln Pro Asp 20 25 30Asn Trp Tyr Gly His Gly Leu Gly Gly Gly Glu Asp Cys Ala Asp Phe 35 40 4521948PRTHomo sapiens 219Trp Ile Gly Leu Thr Asp Gln Asn Gly Pro Trp Arg Trp Val Asp Gly1 5 10 15Thr Asp Tyr Glu Lys Gly Phe Thr His Trp Ala Pro Lys Gln Pro Asp 20 25 30Asn Trp Tyr Gly His Gly Leu Gly Gly Gly Glu Asp Cys Ala Lys Phe 35 40 4522048PRTRattus sp. 220Trp Ile Gly Leu Thr Asp Gln Asn Gly Pro Trp Arg Trp Val Asp Gly1 5 10 15Thr Asp Tyr Glu Lys Gly Phe Thr His Trp Arg Pro Gly Gln Pro Asp 20 25 30Asn Trp Tyr Gly His Gly Leu Gly Gly Gly Glu Asp Cys Ala Ala Phe 35 40 4522148PRTRattus sp. 221Trp Ile Gly Leu Thr Asp Gln Asn Gly Pro Trp Lys Trp Val Asp Gly1 5 10 15Thr Asp Tyr Glu Thr Gly Phe Lys Asn Trp Arg Pro Gly Gln Pro Asp 20 25 30Asp Trp Tyr Gly His Gly Leu Gly Gly Gly Glu Asp Cys Ala Ala Phe 35 40 4522245PRTGallus sp. 222Trp Ile Gly Leu Thr Asp Glu Asn Gln Glu Gly Glu Trp Gln Trp Val1 5 10 15Asp Gly Thr Asp Thr Arg Ser Ser Phe Thr Phe Trp Lys Glu Gly Glu 20 25 30Pro Asn Asn Ala Gly Phe Asn Glu Asp Cys Ala His Val 35 40 4522345PRTGallus sp. 223Trp Ile Gly Leu Thr Asp Glu Asn Gln Glu Gly Glu Trp Gln Trp Val1 5 10 15Asp Gly Thr Asp Thr Arg Ser Ser Phe Thr Phe Trp Lys Glu Gly Glu 20 25 30Pro Asn Asn Arg Ala Phe Asn Glu Asp Cys Ala His Val 35 40 4522445PRTGallus sp. 224Trp Ile Gly Leu Thr Asp Glu Asn Gln Glu Gly Glu Trp Gln Trp Val1 5 10 15Asp Gly Thr Asp Thr Arg Ser Ser Phe Thr Phe Trp Lys Glu Gly Glu 20 25 30Pro Asn Asn Arg Gly Ala Asn Glu Asp Cys Ala His Val 35 40 4522545PRTGallus sp. 225Trp Ile Gly Leu Thr Asp Glu Asn Gln Glu Gly Glu Trp Gln Trp Val1 5 10 15Asp Gly Thr Asp Thr Arg Ser Ser Phe Thr Phe Trp Lys Glu Gly Glu 20 25 30Pro Asn Asn Arg Gly Phe Ala Glu Asp Cys Ala His Val 35 40 4522617PRTHomo sapiens 226Cys Ala Val Leu Ser Gly Ala Ala Asn Gly Ala Trp Phe Asp Lys Arg1 5 10 15Cys22717PRTHomo sapiens 227Cys Ala Val Leu Ser Gly Ala Ala Asn Gly Lys Trp Phe Asp Ala Arg1 5 10 15Cys22817PRTHomo sapiens 228Cys Ala Val Leu Ser Gly Ala Ala Asn Gly Lys Trp Phe Asp Lys Ala1 5 10 15Cys22917PRTHomo sapiens 229Cys Ala Val Leu Ser Gly Ala Ala Asn Gly Lys Trp Leu Asp Lys Arg1 5 10 15Cys23017PRTHomo sapiens 230Cys Ala Val Leu Ser Gly Ala Ala Asn Gly Lys Trp Phe Ala Lys Arg1 5 10 15Cys23117PRTHomo sapiens 231Cys Ala Val Leu Ser Gly Ala Ala Asn Gly Lys Trp Phe Glu Lys Arg1 5 10 15Cys23217PRTHomo sapiens 232Cys Ala Val Leu Ser Gly Ala Ala Asn Gly Lys Trp Phe Asn Lys Arg1 5 10 15Cys23315PRTRattus sp. 233Cys Val Thr Ile Val Asp Asn Gly Leu Trp Asn Asp Val Ser Cys1 5 10 1523415PRTRattus sp. 234Cys Val Thr Ile Val Asp Asn Gly Leu Trp Asn Asp Leu Ser Cys1 5 10 1523515PRTRattus sp. 235Cys Val Thr Ile Val Asp Asn Gly Leu Trp Asn Asp Ala Ser Cys1 5 10 1523615PRTRattus sp. 236Cys Val Thr Ile Val Asp Asn Gly Leu Trp Asn Asp Glu Ser Cys1 5 10 1523721PRTRattus sp. 237Cys Val Thr Ile Val Tyr Ile Lys Arg Glu Lys Asp Asn Gly Leu Trp1 5 10 15Asn Asp Ile Ser Cys 2023821PRTRattus sp. 238Cys Val Thr Ile Val Tyr Ile Lys Ser Pro Ser Asp Asn Gly Leu Trp1 5 10 15Asn Asp Ile Ser Cys 2023915PRTRattus sp. 239Cys Val Thr Ile Val Asp Asn Gly Leu Trp Asn Asp Val Tyr Cys1 5 10 1524015PRTRattus sp. 240Cys Ala His Val Trp Thr Ser Gly Gln Trp Asn Asp Val Tyr Cys1 5 10 1524120PRTHomo sapiens 241Cys Val Glu Ile Phe Ile Lys Arg Glu Lys Asp Val Gly Met Trp Asn1 5 10 15Asp Glu Arg Cys 2024220PRTHomo sapiens 242Cys Val Glu Ile Arg Ile Lys Arg Glu Lys Asp Val Gly Met Trp Asn1 5 10 15Asp Glu Arg Cys 2024320PRTHomo sapiens 243Cys Val Glu Ile Asp Ile Lys Arg Glu Lys Asp Val Gly Met Trp Asn1 5 10 15Asp Glu Arg Cys 2024420PRTHomo sapiens 244Cys Val Glu Ile Ala Ile Lys Arg Glu Lys Asp Val Gly Met Trp Asn1 5 10 15Asp Glu Arg Cys 2024520PRTHomo sapiens 245Cys Val Glu Ile Ser Ile Lys Arg Glu Lys Asp Val Gly Met Trp Asn1 5 10 15Asp Glu Arg Cys 2024620PRTHomo sapiens 246Cys Val Glu Ile Tyr Ile Lys Arg Glu Lys Asp Val Gly Met Trp Asn1 5 10 15Asp Asp Arg Cys 2024720PRTHomo sapiens 247Cys Val Glu Ile Tyr Ile Lys Arg Glu Lys Asp Val Gly Met Trp Asn1 5 10 15Asp Ala Arg Cys 2024820PRTHomo sapiens 248Cys Val Glu Ile Tyr Ile Lys Arg Glu Lys Asp Val Gly Met Trp Asn1 5 10 15Asp Asn Arg Cys 2024920PRTHomo sapiens 249Cys Val Glu Ile Tyr Ile Lys Arg Glu Lys Asp Val Gly Met Trp Asn1 5 10 15Asp Lys Arg Cys 2025020PRTHomo sapiens 250Cys Val Glu Ile Tyr Ile Lys Arg Glu Lys Asp Val Gly Met Trp Asn1 5 10 15Asp Gln Arg Cys 2025120PRTHomo sapiens 251Cys Val Glu Ile Tyr Ile Lys Asp Glu Lys Asp Val Gly Met Trp Asn1 5 10 15Asp Glu Arg Cys 2025220PRTHomo sapiens 252Cys Val Glu Ile Tyr Ile Lys Ser Glu Lys Asp Val Gly Met Trp Asn1 5 10 15Asp Glu Arg Cys 2025320PRTHomo sapiens 253Cys Val Glu Ile Tyr Ile Lys Glu Glu Lys Asp Val Gly Met Trp Asn1 5 10 15Asp Glu Arg Cys 2025420PRTHomo sapiens 254Cys Val Glu Ile Tyr Ile Gln Ser Pro Ser Ala Pro Gly Met Trp Asn1 5 10 15Asp Glu His Cys 2025520PRTHomo sapiens 255Cys Val Glu Ile Tyr Ile Arg Ser Pro Ser Ala Pro Gly Met Trp Asn1 5 10 15Asp Glu His Cys 2025620PRTHomo sapiens 256Cys Val Glu Ile Tyr Ile Glu Ser Pro Ser Ala Pro Gly Met Trp Asn1 5 10 15Asp Glu His Cys 2025720PRTHomo sapiens 257Cys Val Glu Ile Tyr Ile Lys Ala Pro Ser Ala Pro Gly Met Trp Asn1 5 10 15Asp Glu His Cys 2025820PRTHomo sapiens 258Cys Val Glu Ile Tyr Ile Lys Asp Pro Ser Ala Pro Gly Met Trp Asn1 5 10 15Asp Glu His Cys 2025920PRTHomo sapiens 259Cys Val Glu Ile Tyr Ile Lys Arg Pro Ser Ala Pro Gly Met Trp Asn1 5 10 15Asp Glu His Cys 2026020PRTHomo sapiens 260Cys Val Glu Ile Tyr Ile Lys Arg Glu Lys Ala Pro Gly Met Trp Asn1 5 10 15Asp Glu His Cys 2026120PRTHomo sapiens 261Cys Val Glu Ile Tyr Ile Lys Ser Pro Asp Ala Pro Gly Met Trp Asn1 5 10 15Asp Glu His Cys 2026215PRTGallus sp. 262Cys Ala His Val Trp Thr Ser Gly Gln Trp Asn Asp Ala Tyr Cys1 5 10 1526315PRTGallus sp. 263Cys Ala His Val Trp Thr Ser Gly Gln Trp Asn Asp Val Ala Cys1 5 10 1526416PRTHomo sapiens 264Ser Gly Ala Ala Asn Gly Lys Trp Phe Asp Lys Arg Cys Ala Asp Gln1 5 10 1526513PRTHomo sapiens 265Cys Ile Ser Arg Gly Gly Thr Leu Gly Thr Pro Gln Thr1 5 1026652PRTHomo sapiensDOMAIN(38)..(42)Beta3 sheet 266Asn Asp Met Ala Ala Glu Gly Thr Trp Val Asp Met Thr Gly Thr Arg1 5 10 15Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Ala Gln Pro Asp Gly 20 25 30Gly Lys Thr Glu Asn Xaa Xaa Xaa Xaa Xaa Ser Gly Ala Ala Asn Gly 35 40 45Lys Trp Phe Asp 5026752PRTHomo sapiensDOMAIN(38)..(42)Beta3 sheet 267Asn Asp Met Ala Ala Glu Gly Thr Trp Val Asp Met Thr Gly Thr Arg1 5 10 15Ile Ala Tyr Lys Asn Trp His Gly Trp Arg Thr Arg Gln Pro Asp Ala 20 25 30Asn Glu Gln Glu Asn Xaa Xaa Xaa Xaa Xaa Ser Gly Ala Ala Asn Gly 35 40 45Lys Trp Val Asp 5026852PRTHomo sapiensDOMAIN(38)..(42)Beta3 sheet 268Asn Asp Met Ala Ala Glu Gly Thr Trp Val Asp Met Thr Gly Thr Arg1 5 10 15Ile Ala Tyr Lys Asn Trp Ile Gln Ser Glu Val Glu Gln Pro Asp Asp 20 25 30Trp Gln Thr Glu Asn Xaa Xaa Xaa Xaa Xaa Ser Gly Ala Ala Asn Gly 35 40 45Lys Trp Gly Asp 5026951PRTHomo sapiensDOMAIN(37)..(41)Beta3 sheet 269Asn Asp Met Ala Ala Glu Gly Thr Trp Val Asp Met Thr Gly Thr Arg1 5 10 15Ile Ala Tyr Lys Asn Trp Ala Gly Gly Lys Trp Arg Pro Asp Gly Gly 20 25 30Leu Gly Glu Asn Xaa Xaa Xaa Xaa Xaa Ser Gly Ala Ala Asn Gly Lys 35 40 45Trp Lys Asp 5027052PRTHomo sapiensDOMAIN(38)..(42)Beta3 sheet 270Asn Asp Met Ala Ala Glu Gly Thr Trp Val Asp Met Thr Gly Thr Arg1 5 10 15Ile Ala Tyr Lys Asn Trp Gln Arg Val Glu Cys Gly Gln Pro Asp Glu 20 25 30Ala Val Cys Glu Asn Xaa Xaa Xaa Xaa Xaa Ser Gly Ala Ala Asn Gly 35 40 45Lys Trp Asn Asp 5027152PRTHomo sapiensDOMAIN(38)..(42)Beta3 sheet 271Asn Asp Ala Met Ser Glu Gly Arg Trp Val Asp Met Thr Gly Thr Arg1 5 10 15Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Ala Gln Pro Asp Pro 20 25 30Ile Cys Arg Glu Asn Xaa Xaa Xaa Xaa Xaa Ser Gly Ala Ala Asn Gly 35 40 45Lys Trp Phe Asp 5027252PRTHomo sapiensDOMAIN(38)..(42)Beta3 sheet 272Asn Asp Glu Ala Trp Glu Thr Glu Trp Val Asp Met Thr Gly Thr Arg1 5 10 15Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Ala Gln Pro Asp Gln 20 25 30His Cys Ser Glu Asn Xaa Xaa Xaa Xaa Xaa Ser Gly Ala Ala Asn Gly 35 40 45Lys Trp Phe Asp 5027352PRTHomo

sapiensDOMAIN(38)..(42)Beta3 sheet 273Asn Asp Ala Gln Asp Glu Pro Arg Trp Val Asp Met Thr Gly Thr Arg1 5 10 15Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Ala Gln Pro Asp Ser 20 25 30Leu Leu Thr Glu Asn Xaa Xaa Xaa Xaa Xaa Ser Gly Ala Ala Asn Gly 35 40 45Lys Trp Phe Asp 5027452PRTHomo sapiensDOMAIN(38)..(42)Beta3 sheet 274Asn Asp Lys Ala Arg Glu Lys Arg Trp Val Asp Met Thr Gly Thr Arg1 5 10 15Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Ala Gln Pro Asp Asp 20 25 30Pro Pro Pro Glu Asn Xaa Xaa Xaa Xaa Xaa Ser Gly Ala Ala Asn Gly 35 40 45Lys Trp Phe Asp 5027552PRTHomo sapiensDOMAIN(38)..(42)Beta3 sheet 275Asn Asp Met Ala Ala Glu Arg Pro Trp Val Asp Met Thr Gly Thr Arg1 5 10 15Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Ala Gln Pro Asp Ile 20 25 30Ala Arg Gln Glu Asn Xaa Xaa Xaa Xaa Xaa Ser Gly Ala Ala Asn Gly 35 40 45Lys Trp Phe Asp 50276137PRTHomo sapiens 276Ala Leu Gln Thr Val Cys Leu Lys Gly Thr Lys Val His Met Lys Cys1 5 10 15Phe Leu Ala Phe Thr Gln Thr Lys Thr Phe His Glu Ala Ser Glu Asp 20 25 30Cys Ile Ser Arg Gly Gly Thr Leu Ser Thr Pro Gln Thr Gly Ser Glu 35 40 45Asn Asp Ala Leu Tyr Glu Tyr Leu Arg Gln Ser Val Gly Asn Glu Ala 50 55 60Glu Ile Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Thr Trp Val65 70 75 80Asp Met Thr Gly Ala Arg Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile 85 90 95Thr Ala Gln Pro Asp Gly Gly Lys Thr Glu Asn Cys Ala Val Leu Ser 100 105 110Gly Ala Ala Asn Gly Lys Trp Phe Asp Lys Arg Cys Arg Asp Gln Leu 115 120 125Pro Tyr Ile Cys Gln Phe Gly Ile Val 130 135277126PRTHomo sapiens 277Asn Lys Leu His Ala Phe Ser Met Gly Lys Lys Ser Gly Lys Lys Phe1 5 10 15Phe Val Thr Asn His Glu Arg Met Pro Phe Ser Lys Val Lys Ala Leu 20 25 30Cys Ser Glu Leu Arg Gly Thr Val Ala Ile Pro Arg Asn Ala Glu Glu 35 40 45Asn Lys Ala Ile Gln Glu Val Ala Lys Thr Ser Ala Phe Leu Gly Ile 50 55 60Thr Asp Glu Val Thr Glu Gly Gln Phe Met Tyr Val Thr Gly Gly Arg65 70 75 80Leu Thr Tyr Ser Asn Trp Lys Lys Asp Glu Pro Asn Asp His Gly Ser 85 90 95Gly Glu Asp Cys Val Thr Ile Val Asp Asn Gly Leu Trp Asn Asp Ile 100 105 110Ser Cys Gln Ala Ser His Thr Ala Val Cys Glu Phe Pro Ala 115 120 125278127PRTHomo sapiens 278Lys Lys Val Glu Leu Phe Pro Asn Gly Gln Ser Val Gly Glu Lys Ile1 5 10 15Phe Lys Thr Ala Gly Phe Val Lys Pro Phe Thr Glu Ala Gln Leu Leu 20 25 30Cys Thr Gln Ala Gly Gly Gln Leu Ala Ser Pro Arg Ser Ala Ala Glu 35 40 45Asn Ala Ala Leu Gln Gln Leu Val Val Ala Lys Asn Glu Ala Ala Phe 50 55 60Leu Ser Met Thr Asp Ser Lys Thr Glu Gly Lys Phe Thr Tyr Pro Thr65 70 75 80Gly Glu Ser Leu Val Tyr Ser Asn Trp Ala Pro Gly Glu Pro Asn Asp 85 90 95Asp Gly Gly Ser Glu Asp Cys Val Glu Ile Phe Thr Asn Gly Lys Trp 100 105 110Asn Asp Arg Ala Cys Gly Glu Lys Arg Leu Val Val Cys Glu Phe 115 120 125279124PRTHomo sapiens 279Lys Val Tyr Trp Phe Cys Tyr Gly Met Lys Cys Tyr Tyr Phe Val Met1 5 10 15Asp Arg Lys Thr Trp Ser Gly Cys Lys Gln Thr Cys Gln Ser Ser Ser 20 25 30Leu Ser Leu Leu Lys Ile Asp Asp Glu Asp Glu Leu Lys Phe Leu Gln 35 40 45Leu Leu Val Val Lys Val Tyr Trp Phe Cys Tyr Gly Met Lys Cys Tyr 50 55 60Tyr Phe Val Met Asp Arg Lys Thr Trp Ser Gly Cys Lys Gln Thr Cys65 70 75 80Gln Ser Ser Ser Leu Ser Leu Leu Lys Ile Asp Asp Glu Asp Glu Leu 85 90 95Lys Phe Leu Gln Leu Leu Val Val Asn Gly Asn Cys Asp Gln Val Phe 100 105 110Ile Cys Ile Cys Gly Lys Arg Leu Asp Lys Phe Pro 115 120280128PRTHomo sapiens 280Cys Pro Val Asn Trp Val Glu His Glu Arg Ser Cys Tyr Trp Phe Ser1 5 10 15Arg Ser Gly Lys Ala Trp Ala Asp Ala Asp Asn Tyr Cys Arg Leu Glu 20 25 30Asp Ala His Leu Val Val Val Thr Ser Trp Glu Glu Gln Leu Phe Val 35 40 45Gln His His Ile Gly Pro Val Asn Thr Trp Met Gly Leu His Asp Gln 50 55 60Asn Gly Pro Trp Lys Trp Val Asp Gly Thr Asp Tyr Glu Thr Gly Phe65 70 75 80Lys Asn Trp Arg Pro Glu Gln Pro Asp Asp Trp Tyr Gly His Gly Leu 85 90 95Gly Gly Gly Glu Asp Cys Ala His Phe Thr Asp Asp Gly Arg Trp Asn 100 105 110Asp Asp Val Cys Gln Arg Pro Tyr Arg Trp Val Cys Glu Thr Glu Leu 115 120 125281147PRTHomo sapiens 281Gly Ile Pro Lys Cys Pro Glu Asp Trp Gly Ala Ser Ser Arg Thr Ser1 5 10 15Leu Cys Phe Lys Leu Tyr Ala Lys Gly Lys His Glu Lys Lys Thr Trp 20 25 30Phe Glu Ser Arg Asp Phe Cys Arg Ala Leu Gly Gly Asp Leu Ala Ser 35 40 45Ile Asn Asn Lys Glu Glu Gln Gln Thr Ile Trp Arg Leu Ile Thr Ala 50 55 60Ser Gly Ser Tyr His Lys Leu Phe Trp Leu Gly Leu Thr Tyr Gly Ser65 70 75 80Pro Ser Glu Gly Phe Thr Trp Ser Asp Gly Ser Pro Val Ser Tyr Glu 85 90 95Asn Trp Ala Tyr Gly Glu Pro Asn Asn Tyr Gln Asn Val Glu Tyr Cys 100 105 110Gly Glu Leu Lys Gly Asp Pro Thr Met Ser Trp Asn Asp Ile Asn Cys 115 120 125Glu His Leu Asn Asn Trp Ile Cys Gln Ile Gln Lys Gly Gln Thr Pro 130 135 140Lys Pro Asp145282129PRTHomo sapiens 282Asp Cys Leu Ser Gly Trp Ser Ser Tyr Glu Gly His Cys Tyr Lys Ala1 5 10 15Phe Glu Lys Tyr Lys Thr Trp Glu Asp Ala Glu Arg Val Cys Thr Glu 20 25 30Gln Ala Lys Gly Ala His Leu Val Ser Ile Glu Ser Ser Gly Glu Ala 35 40 45Asp Phe Val Ala Gln Leu Val Thr Gln Asn Met Lys Arg Leu Asp Phe 50 55 60Tyr Ile Trp Ile Gly Leu Arg Val Gln Gly Lys Val Lys Gln Cys Asn65 70 75 80Ser Glu Trp Ser Asp Gly Ser Ser Val Ser Tyr Glu Asn Trp Ile Glu 85 90 95Ala Glu Ser Lys Thr Cys Leu Gly Leu Glu Lys Glu Thr Asp Phe Arg 100 105 110Lys Trp Val Asn Ile Tyr Cys Gly Gln Gln Asn Pro Phe Val Cys Glu 115 120 125Ala 283122PRTHomo sapiens 283Asp Cys Pro Ser Asp Trp Ser Ser Tyr Glu Gly His Cys Tyr Lys Pro1 5 10 15Phe Ser Glu Pro Lys Asn Trp Ala Asp Ala Glu Asn Phe Cys Thr Gln 20 25 30Gln His Ala Gly Gly His Leu Val Ser Phe Gln Ser Ser Glu Glu Ala 35 40 45Asp Phe Val Val Lys Leu Ala Phe Gln Thr Phe His Ser Ile Phe Trp 50 55 60Met Gly Leu Ser Asn Val Trp Asn Gln Cys Asn Trp Gln Trp Ser Asn65 70 75 80Ala Ala Met Leu Arg Tyr Lys Ala Trp Ala Glu Glu Ser Tyr Cys Val 85 90 95Tyr Phe Lys Ser Thr Asn Asn Lys Trp Arg Ser Arg Ala Cys Arg Met 100 105 110Met Ala Gln Phe Val Cys Glu Phe Gln Ala 115 120284135PRTHomo sapiens 284Ala Arg Ile Ser Cys Pro Glu Gly Thr Asn Ala Tyr Arg Ser Tyr Cys1 5 10 15Tyr Tyr Phe Asn Glu Asp Arg Glu Thr Trp Val Asp Ala Asp Leu Tyr 20 25 30Cys Gln Asn Met Asn Ser Gly Asn Leu Val Ser Val Leu Thr Gln Ala 35 40 45Glu Gly Ala Phe Val Ala Ser Leu Ile Lys Glu Ser Gly Thr Asp Asp 50 55 60Phe Asn Val Trp Ile Gly Leu His Asp Pro Lys Lys Asn Arg Arg Trp65 70 75 80His Trp Ser Ser Gly Ser Leu Val Ser Tyr Lys Ser Trp Gly Ile Gly 85 90 95Ala Pro Ser Ser Val Asn Pro Gly Tyr Cys Val Ser Leu Thr Ser Ser 100 105 110Thr Gly Phe Gln Lys Trp Lys Asp Val Pro Cys Glu Asp Lys Phe Ser 115 120 125Phe Val Cys Lys Phe Lys Asn 130 135285123PRTHomo sapiens 285Asp Tyr Glu Ile Leu Phe Ser Asp Glu Thr Met Asn Tyr Ala Asp Ala1 5 10 15Gly Thr Tyr Cys Gln Ser Arg Gly Met Ala Leu Val Ser Ser Ala Met 20 25 30Arg Asp Ser Thr Met Val Lys Ala Ile Leu Ala Phe Thr Glu Val Lys 35 40 45Gly His Asp Tyr Trp Val Gly Ala Asp Asn Leu Gln Asp Gly Ala Tyr 50 55 60Asn Phe Asn Trp Asn Asp Gly Val Ser Leu Pro Thr Asp Ser Asp Leu65 70 75 80Trp Ser Pro Asn Glu Pro Ser Asn Pro Gln Ser Trp Gln Leu Cys Val 85 90 95Gln Ile Trp Ser Lys Tyr Asn Leu Leu Asp Asp Val Gly Cys Gly Gly 100 105 110Ala Arg Arg Val Ile Cys Glu Lys Glu Leu Asp 115 120286546DNAHomo sapiensCDS(1)..(546) 286gag cca cca acc cag aag ccc aag aag att gta aat gcc aag aaa gat 48Glu Pro Pro Thr Gln Lys Pro Lys Lys Ile Val Asn Ala Lys Lys Asp1 5 10 15gtt gtg aac aca aag atg ttt gag gag ctc aag agc cgt ctg gac acc 96Val Val Asn Thr Lys Met Phe Glu Glu Leu Lys Ser Arg Leu Asp Thr 20 25 30ctg gcc cag gag gtg gcc ctg ctg aag gag cag cag gcc ctg cag acg 144Leu Ala Gln Glu Val Ala Leu Leu Lys Glu Gln Gln Ala Leu Gln Thr 35 40 45gtc tgc ctg aag ggg acc aag gtg cac atg aaa tgc ttt ctg gcc ttc 192Val Cys Leu Lys Gly Thr Lys Val His Met Lys Cys Phe Leu Ala Phe 50 55 60acc cag acg aag acc ttc cac gag gcc agc gag gac tgc atc tcg cgc 240Thr Gln Thr Lys Thr Phe His Glu Ala Ser Glu Asp Cys Ile Ser Arg65 70 75 80ggg ggc acc ctg agc acc cct cag act ggc tcg gag aac gac gcc ctg 288Gly Gly Thr Leu Ser Thr Pro Gln Thr Gly Ser Glu Asn Asp Ala Leu 85 90 95tat gag tac ctg cgc cag agc gtg ggc aac gag gcc gag atc tgg ctg 336Tyr Glu Tyr Leu Arg Gln Ser Val Gly Asn Glu Ala Glu Ile Trp Leu 100 105 110ggc ctc aac gac atg gcg gcc gag ggc acc tgg gtg gac atg acc ggc 384Gly Leu Asn Asp Met Ala Ala Glu Gly Thr Trp Val Asp Met Thr Gly 115 120 125gcc cgc atc gcc tac aag aac tgg gag act gag atc acc gcg caa ccc 432Ala Arg Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Ala Gln Pro 130 135 140gat ggc ggc aag acc gag aac tgc gcg gtc ctg tca ggc gcg gcc aac 480Asp Gly Gly Lys Thr Glu Asn Cys Ala Val Leu Ser Gly Ala Ala Asn145 150 155 160ggc aag tgg ttc gac aag cgc tgc cgc gat cag ctg ccc tac atc tgc 528Gly Lys Trp Phe Asp Lys Arg Cys Arg Asp Gln Leu Pro Tyr Ile Cys 165 170 175cag ttc ggg atc gtg taa 546Gln Phe Gly Ile Val 180287181PRTHomo sapiens 287Glu Pro Pro Thr Gln Lys Pro Lys Lys Ile Val Asn Ala Lys Lys Asp1 5 10 15Val Val Asn Thr Lys Met Phe Glu Glu Leu Lys Ser Arg Leu Asp Thr 20 25 30Leu Ala Gln Glu Val Ala Leu Leu Lys Glu Gln Gln Ala Leu Gln Thr 35 40 45Val Cys Leu Lys Gly Thr Lys Val His Met Lys Cys Phe Leu Ala Phe 50 55 60Thr Gln Thr Lys Thr Phe His Glu Ala Ser Glu Asp Cys Ile Ser Arg65 70 75 80Gly Gly Thr Leu Ser Thr Pro Gln Thr Gly Ser Glu Asn Asp Ala Leu 85 90 95Tyr Glu Tyr Leu Arg Gln Ser Val Gly Asn Glu Ala Glu Ile Trp Leu 100 105 110Gly Leu Asn Asp Met Ala Ala Glu Gly Thr Trp Val Asp Met Thr Gly 115 120 125Ala Arg Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Ala Gln Pro 130 135 140Asp Gly Gly Lys Thr Glu Asn Cys Ala Val Leu Ser Gly Ala Ala Asn145 150 155 160Gly Lys Trp Phe Asp Lys Arg Cys Arg Asp Gln Leu Pro Tyr Ile Cys 165 170 175Gln Phe Gly Ile Val 180288546DNAMurinae gen. sp.CDS(1)..(546) 288gag tca ccc act ccc aag gcc aag aag gct gca aat gcc aag aaa gat 48Glu Ser Pro Thr Pro Lys Ala Lys Lys Ala Ala Asn Ala Lys Lys Asp1 5 10 15ttg gtg agc tca aag atg ttc gag gag ctc aag aac agg atg gat gtc 96Leu Val Ser Ser Lys Met Phe Glu Glu Leu Lys Asn Arg Met Asp Val 20 25 30ctg gcc cag gag gtg gcc ctg ctg aag gag aag cag gcc tta cag act 144Leu Ala Gln Glu Val Ala Leu Leu Lys Glu Lys Gln Ala Leu Gln Thr 35 40 45gtg tgc ctg aag ggc acc aag gtg aac ttg aag tgc ctc ctg gcc ttc 192Val Cys Leu Lys Gly Thr Lys Val Asn Leu Lys Cys Leu Leu Ala Phe 50 55 60acc caa ccg aag acc ttc cat gag gcg agc gag gac tgc atc tcg caa 240Thr Gln Pro Lys Thr Phe His Glu Ala Ser Glu Asp Cys Ile Ser Gln65 70 75 80ggg ggc acg ctg ggc acc ccg cag tca gag cta gag aac gag gcg ctg 288Gly Gly Thr Leu Gly Thr Pro Gln Ser Glu Leu Glu Asn Glu Ala Leu 85 90 95ttc gag tac gcg cgc cac agc gtg ggc aac gat gcg aac atc tgg ctg 336Phe Glu Tyr Ala Arg His Ser Val Gly Asn Asp Ala Asn Ile Trp Leu 100 105 110ggc ctc aac gac atg gcc gcg gaa ggc gcc tgg gtg gac atg acc ggc 384Gly Leu Asn Asp Met Ala Ala Glu Gly Ala Trp Val Asp Met Thr Gly 115 120 125ggc ctc ctg gcc tac aag aac tgg gag acg gag atc acg acg caa ccc 432Gly Leu Leu Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Thr Gln Pro 130 135 140gac ggc ggc aaa gcc gag aac tgc gcc gcc ctg tct ggc gca gcc aac 480Asp Gly Gly Lys Ala Glu Asn Cys Ala Ala Leu Ser Gly Ala Ala Asn145 150 155 160ggc aag tgg ttc gac aag cga tgc cgc gat cag ttg ccc tac atc tgc 528Gly Lys Trp Phe Asp Lys Arg Cys Arg Asp Gln Leu Pro Tyr Ile Cys 165 170 175cag ttt gcc att gtg tag 546Gln Phe Ala Ile Val 180289181PRTMurinae gen. sp. 289Glu Ser Pro Thr Pro Lys Ala Lys Lys Ala Ala Asn Ala Lys Lys Asp1 5 10 15Leu Val Ser Ser Lys Met Phe Glu Glu Leu Lys Asn Arg Met Asp Val 20 25 30Leu Ala Gln Glu Val Ala Leu Leu Lys Glu Lys Gln Ala Leu Gln Thr 35 40 45Val Cys Leu Lys Gly Thr Lys Val Asn Leu Lys Cys Leu Leu Ala Phe 50 55 60Thr Gln Pro Lys Thr Phe His Glu Ala Ser Glu Asp Cys Ile Ser Gln65 70 75 80Gly Gly Thr Leu Gly Thr Pro Gln Ser Glu Leu Glu Asn Glu Ala Leu 85 90 95Phe Glu Tyr Ala Arg His Ser Val Gly Asn Asp Ala Asn Ile Trp Leu 100 105 110Gly Leu Asn Asp Met Ala Ala Glu Gly Ala Trp Val Asp Met Thr Gly 115 120 125Gly Leu Leu Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Thr Gln Pro 130 135 140Asp Gly Gly Lys Ala Glu Asn Cys Ala Ala Leu Ser Gly Ala Ala Asn145 150 155 160Gly Lys Trp Phe Asp Lys Arg Cys Arg Asp Gln Leu Pro Tyr Ile Cys 165 170 175Gln Phe Ala Ile Val 180290546DNAHomo

sapiensCDS(1)..(546) 290gag cca cca acc cag aag ccc aag aag att gta aat gcc aag aaa gat 48Glu Pro Pro Thr Gln Lys Pro Lys Lys Ile Val Asn Ala Lys Lys Asp1 5 10 15gtt gtg aac aca aag atg ttt gag gag ctc aag agc cgt ctg gac acc 96Val Val Asn Thr Lys Met Phe Glu Glu Leu Lys Ser Arg Leu Asp Thr 20 25 30ctg gcc cag gag gtg gcc ctg ctg aag gag cag cag gcc ctg cag acg 144Leu Ala Gln Glu Val Ala Leu Leu Lys Glu Gln Gln Ala Leu Gln Thr 35 40 45gtc gtc ctg aag ggg acc aag gtg cac atg aaa gtc ttt ctg gcc ttc 192Val Val Leu Lys Gly Thr Lys Val His Met Lys Val Phe Leu Ala Phe 50 55 60acc cag acg aag acc ttc cac gag gcc agc gag gac tgc atc tcg cgc 240Thr Gln Thr Lys Thr Phe His Glu Ala Ser Glu Asp Cys Ile Ser Arg65 70 75 80ggg ggc acc ctg agc acc cct cag act ggc tcg gag aac gac gcc ctg 288Gly Gly Thr Leu Ser Thr Pro Gln Thr Gly Ser Glu Asn Asp Ala Leu 85 90 95tat gag tac ctg cgc cag agc gtg ggc aac gag gcc gag atc tgg ctg 336Tyr Glu Tyr Leu Arg Gln Ser Val Gly Asn Glu Ala Glu Ile Trp Leu 100 105 110ggc ctc aac gac atg gcg gcc gag ggc acc tgg gtg gac atg acc ggt 384Gly Leu Asn Asp Met Ala Ala Glu Gly Thr Trp Val Asp Met Thr Gly 115 120 125acc cgc atc gcc tac aag aac tgg gag act gag atc acc gcg caa ccc 432Thr Arg Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Ala Gln Pro 130 135 140gat ggc ggc aag acc gag aac tgc gcg gtc ctg tca ggc gcg gcc aac 480Asp Gly Gly Lys Thr Glu Asn Cys Ala Val Leu Ser Gly Ala Ala Asn145 150 155 160ggc aag tgg ttc gac aag cgc tgc cgc gat caa ttg ccc tac atc tgc 528Gly Lys Trp Phe Asp Lys Arg Cys Arg Asp Gln Leu Pro Tyr Ile Cys 165 170 175cag ttc ggg atc gtg tag 546Gln Phe Gly Ile Val 180291181PRTHomo sapiens 291Glu Pro Pro Thr Gln Lys Pro Lys Lys Ile Val Asn Ala Lys Lys Asp1 5 10 15Val Val Asn Thr Lys Met Phe Glu Glu Leu Lys Ser Arg Leu Asp Thr 20 25 30Leu Ala Gln Glu Val Ala Leu Leu Lys Glu Gln Gln Ala Leu Gln Thr 35 40 45Val Val Leu Lys Gly Thr Lys Val His Met Lys Val Phe Leu Ala Phe 50 55 60Thr Gln Thr Lys Thr Phe His Glu Ala Ser Glu Asp Cys Ile Ser Arg65 70 75 80Gly Gly Thr Leu Ser Thr Pro Gln Thr Gly Ser Glu Asn Asp Ala Leu 85 90 95Tyr Glu Tyr Leu Arg Gln Ser Val Gly Asn Glu Ala Glu Ile Trp Leu 100 105 110Gly Leu Asn Asp Met Ala Ala Glu Gly Thr Trp Val Asp Met Thr Gly 115 120 125Thr Arg Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Ala Gln Pro 130 135 140Asp Gly Gly Lys Thr Glu Asn Cys Ala Val Leu Ser Gly Ala Ala Asn145 150 155 160Gly Lys Trp Phe Asp Lys Arg Cys Arg Asp Gln Leu Pro Tyr Ile Cys 165 170 175Gln Phe Gly Ile Val 180292546DNAMurinae gen. sp.CDS(1)..(546) 292gag tca ccc act ccc aag gcc aag aag gct gca aat gcc aag aaa gat 48Glu Ser Pro Thr Pro Lys Ala Lys Lys Ala Ala Asn Ala Lys Lys Asp1 5 10 15ttg gtg agc tca aag atg ttc gag gag ctc aag aac agg atg gat gtc 96Leu Val Ser Ser Lys Met Phe Glu Glu Leu Lys Asn Arg Met Asp Val 20 25 30ctg gcc cag gag gtg gcc ctg ctg aag gag aag cag gcc tta cag act 144Leu Ala Gln Glu Val Ala Leu Leu Lys Glu Lys Gln Ala Leu Gln Thr 35 40 45gtg gtc ctg aag ggc acc aag gtg aac ttg aag gtc ctc ctg gcc ttc 192Val Val Leu Lys Gly Thr Lys Val Asn Leu Lys Val Leu Leu Ala Phe 50 55 60acc caa ccg aag acc ttc cat gag gcg agc gag gac tgc atc tcg caa 240Thr Gln Pro Lys Thr Phe His Glu Ala Ser Glu Asp Cys Ile Ser Gln65 70 75 80ggg ggc acg ctg ggc acc ccg cag tca gag cta gag aac gag gcg ctg 288Gly Gly Thr Leu Gly Thr Pro Gln Ser Glu Leu Glu Asn Glu Ala Leu 85 90 95ttc gag tac gcg cgc cac agc gtg ggc aac gat gcg gag atc tgg ctg 336Phe Glu Tyr Ala Arg His Ser Val Gly Asn Asp Ala Glu Ile Trp Leu 100 105 110ggc ctc aac gac atg gcc gcg gaa ggc gcc tgg gtg gac atg acc ggt 384Gly Leu Asn Asp Met Ala Ala Glu Gly Ala Trp Val Asp Met Thr Gly 115 120 125acc ctc ctg gcc tac aag aac tgg gag acg gag atc acg acg caa ccc 432Thr Leu Leu Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Thr Gln Pro 130 135 140gac ggc ggc aaa gcc gag aac tgc gcc gcc ctg tct ggc gca gcc aac 480Asp Gly Gly Lys Ala Glu Asn Cys Ala Ala Leu Ser Gly Ala Ala Asn145 150 155 160ggc aag tgg ttc gac aag cga tgc cgc gat caa ttg ccc tac atc tgc 528Gly Lys Trp Phe Asp Lys Arg Cys Arg Asp Gln Leu Pro Tyr Ile Cys 165 170 175cag ttt gcc att gtg tag 546Gln Phe Ala Ile Val 180293181PRTMurinae gen. sp. 293Glu Ser Pro Thr Pro Lys Ala Lys Lys Ala Ala Asn Ala Lys Lys Asp1 5 10 15Leu Val Ser Ser Lys Met Phe Glu Glu Leu Lys Asn Arg Met Asp Val 20 25 30Leu Ala Gln Glu Val Ala Leu Leu Lys Glu Lys Gln Ala Leu Gln Thr 35 40 45Val Val Leu Lys Gly Thr Lys Val Asn Leu Lys Val Leu Leu Ala Phe 50 55 60Thr Gln Pro Lys Thr Phe His Glu Ala Ser Glu Asp Cys Ile Ser Gln65 70 75 80Gly Gly Thr Leu Gly Thr Pro Gln Ser Glu Leu Glu Asn Glu Ala Leu 85 90 95Phe Glu Tyr Ala Arg His Ser Val Gly Asn Asp Ala Glu Ile Trp Leu 100 105 110Gly Leu Asn Asp Met Ala Ala Glu Gly Ala Trp Val Asp Met Thr Gly 115 120 125Thr Leu Leu Ala Tyr Lys Asn Trp Glu Thr Glu Ile Thr Thr Gln Pro 130 135 140Asp Gly Gly Lys Ala Glu Asn Cys Ala Ala Leu Ser Gly Ala Ala Asn145 150 155 160Gly Lys Trp Phe Asp Lys Arg Cys Arg Asp Gln Leu Pro Tyr Ile Cys 165 170 175Gln Phe Ala Ile Val 180294414DNAHomo sapiensCDS(1)..(414) 294gcc ctg cag acg gtc gtc ctg aag ggg acc aag gtg cac atg aaa gtc 48Ala Leu Gln Thr Val Val Leu Lys Gly Thr Lys Val His Met Lys Val1 5 10 15ttt ctg gcc ttc acc cag acg aag acc ttc cac gag gcc agc gag gac 96Phe Leu Ala Phe Thr Gln Thr Lys Thr Phe His Glu Ala Ser Glu Asp 20 25 30tgc atc tcg cgc ggg ggc acc ctg agc acc cct cag act ggc tcg gag 144Cys Ile Ser Arg Gly Gly Thr Leu Ser Thr Pro Gln Thr Gly Ser Glu 35 40 45aac gac gcc ctg tat gag tac ctg cgc cag agc gtg ggc aac gag gcc 192Asn Asp Ala Leu Tyr Glu Tyr Leu Arg Gln Ser Val Gly Asn Glu Ala 50 55 60gag atc tgg ctg ggc ctc aac gac atg gcg gcc gag ggc acc tgg gtg 240Glu Ile Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Thr Trp Val65 70 75 80gac atg acc ggt acc cgc atc gcc tac aag aac tgg gag act gag atc 288Asp Met Thr Gly Thr Arg Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile 85 90 95acc gcg caa ccc gat ggc ggc aag acc gag aac tgc gcg gtc ctg tca 336Thr Ala Gln Pro Asp Gly Gly Lys Thr Glu Asn Cys Ala Val Leu Ser 100 105 110ggc gcg gcc aac ggc aag tgg ttc gac aag cgc tgc cgc gat caa ttg 384Gly Ala Ala Asn Gly Lys Trp Phe Asp Lys Arg Cys Arg Asp Gln Leu 115 120 125ccc tac atc tgc cag ttc ggg atc gtg tag 414Pro Tyr Ile Cys Gln Phe Gly Ile Val 130 135295137PRTHomo sapiens 295Ala Leu Gln Thr Val Val Leu Lys Gly Thr Lys Val His Met Lys Val1 5 10 15Phe Leu Ala Phe Thr Gln Thr Lys Thr Phe His Glu Ala Ser Glu Asp 20 25 30Cys Ile Ser Arg Gly Gly Thr Leu Ser Thr Pro Gln Thr Gly Ser Glu 35 40 45Asn Asp Ala Leu Tyr Glu Tyr Leu Arg Gln Ser Val Gly Asn Glu Ala 50 55 60Glu Ile Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Thr Trp Val65 70 75 80Asp Met Thr Gly Thr Arg Ile Ala Tyr Lys Asn Trp Glu Thr Glu Ile 85 90 95Thr Ala Gln Pro Asp Gly Gly Lys Thr Glu Asn Cys Ala Val Leu Ser 100 105 110Gly Ala Ala Asn Gly Lys Trp Phe Asp Lys Arg Cys Arg Asp Gln Leu 115 120 125Pro Tyr Ile Cys Gln Phe Gly Ile Val 130 135296414DNAMurinae gen. sp.CDS(1)..(414) 296gcc tta cag act gtg gtc ctg aag ggc acc aag gtg aac ttg aag gtc 48Ala Leu Gln Thr Val Val Leu Lys Gly Thr Lys Val Asn Leu Lys Val1 5 10 15ctc ctg gcc ttc acc caa ccg aag acc ttc cat gag gcg agc gag gac 96Leu Leu Ala Phe Thr Gln Pro Lys Thr Phe His Glu Ala Ser Glu Asp 20 25 30tgc atc tcg caa ggg ggc acg ctg ggc acc ccg cag tca gag cta gag 144Cys Ile Ser Gln Gly Gly Thr Leu Gly Thr Pro Gln Ser Glu Leu Glu 35 40 45aac gag gcg ctg ttc gag tac gcg cgc cac agc gtg ggc aac gat gcg 192Asn Glu Ala Leu Phe Glu Tyr Ala Arg His Ser Val Gly Asn Asp Ala 50 55 60gag atc tgg ctg ggc ctc aac gac atg gcc gcg gaa ggc gcc tgg gtg 240Glu Ile Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Ala Trp Val65 70 75 80gac atg acc ggt acc ctc ctg gcc tac aag aac tgg gag acg gag atc 288Asp Met Thr Gly Thr Leu Leu Ala Tyr Lys Asn Trp Glu Thr Glu Ile 85 90 95acg acg caa ccc gac ggc ggc aaa gcc gag aac tgc gcc gcc ctg tct 336Thr Thr Gln Pro Asp Gly Gly Lys Ala Glu Asn Cys Ala Ala Leu Ser 100 105 110ggc gca gcc aac ggc aag tgg ttc gac aag cga tgc cgc gat caa ttg 384Gly Ala Ala Asn Gly Lys Trp Phe Asp Lys Arg Cys Arg Asp Gln Leu 115 120 125ccc tac atc tgc cag ttt gcc att gtg tag 414Pro Tyr Ile Cys Gln Phe Ala Ile Val 130 135297137PRTMurinae gen. sp. 297Ala Leu Gln Thr Val Val Leu Lys Gly Thr Lys Val Asn Leu Lys Val1 5 10 15Leu Leu Ala Phe Thr Gln Pro Lys Thr Phe His Glu Ala Ser Glu Asp 20 25 30Cys Ile Ser Gln Gly Gly Thr Leu Gly Thr Pro Gln Ser Glu Leu Glu 35 40 45Asn Glu Ala Leu Phe Glu Tyr Ala Arg His Ser Val Gly Asn Asp Ala 50 55 60Glu Ile Trp Leu Gly Leu Asn Asp Met Ala Ala Glu Gly Ala Trp Val65 70 75 80Asp Met Thr Gly Thr Leu Leu Ala Tyr Lys Asn Trp Glu Thr Glu Ile 85 90 95Thr Thr Gln Pro Asp Gly Gly Lys Ala Glu Asn Cys Ala Ala Leu Ser 100 105 110Gly Ala Ala Asn Gly Lys Trp Phe Asp Lys Arg Cys Arg Asp Gln Leu 115 120 125Pro Tyr Ile Cys Gln Phe Ala Ile Val 130 13529831DNAArtificial SequenceSynthetic 298cat atg gga tcg cat cac cat cac cat cac g 31Met Gly Ser His His His His His His1 52999PRTArtificial SequenceSynthetic 299Met Gly Ser His His His His His His1 530011DNAArtificial SequenceSynthetic 300agcttgaatt c 1130113DNAArtificial SequenceSynthetic 301tat gcg gcc cag c 13Tyr Ala Ala Gln13024PRTArtificial SequenceSynthetic 302Tyr Ala Ala Gln130313DNAArtificial SequenceSynthetic 303g gcc gca ggt gcg 13Ala Ala Gly Ala13044PRTArtificial SequenceSynthetic 304Ala Ala Gly Ala13054PRTArtificial SequenceSynthetic 305Trp Ile Gly Xaa13064PRTArtificial SequenceSynthetic 306Trp Ile Gly Leu13074PRTArtificial SequenceSynthetic 307Trp Ile Gly Ile13084PRTArtificial SequenceSynthetic 308Trp Ile Gly Val13094PRTArtificial SequenceSynthetic 309Trp Leu Gly Xaa13104PRTArtificial SequenceSynthetic 310Trp Leu Gly Leu13114PRTArtificial SequenceSynthetic 311Trp Leu Gly Val13124PRTArtificial SequenceSynthetic 312Trp Leu Gly Ala13134PRTArtificial SequenceSynthetic 313Trp Met Gly Leu13144PRTArtificial SequenceSynthetic 314Tyr Leu Xaa Met13154PRTArtificial SequenceSynthetic 315Tyr Leu Ser Met13164PRTArtificial SequenceSynthetic 316Tyr Leu Gly Met13174PRTArtificial SequenceSynthetic 317Trp Val Gly Xaa13184PRTArtificial SequenceSynthetic 318Trp Val Gly Leu13194PRTArtificial SequenceSynthetic 319Trp Val Gly Ala13205PRTArtificial SequenceSynthetic 320Phe Phe Leu Gly Ile1 53214PRTArtificial SequenceSynthetic 321Phe Val Gly Leu13224PRTArtificial SequenceSynthetic 322Phe Ile Gly Val13234PRTArtificial SequenceSynthetic 323Phe Leu Ser Met13244PRTArtificial SequenceSynthetic 324Cys Val Xaa Ile13254PRTArtificial SequenceSynthetic 325Cys Val Glu Ile13264PRTArtificial SequenceSynthetic 326Cys Val Thr Ile13274PRTArtificial SequenceSynthetic 327Cys Val Gln Ile13284PRTArtificial SequenceSynthetic 328Cys Val Xaa Met13294PRTArtificial SequenceSynthetic 329Cys Val Glu Met13304PRTArtificial SequenceSynthetic 330Cys Val Val Met13314PRTArtificial SequenceSynthetic 331Cys Val Met Met13324PRTArtificial SequenceSynthetic 332Cys Val Xaa Leu13334PRTArtificial SequenceSynthetic 333Cys Val Val Leu13344PRTArtificial SequenceSynthetic 334Cys Val Ser Leu13354PRTArtificial SequenceSynthetic 335Cys Val His Leu13364PRTArtificial SequenceSynthetic 336Cys Val Ala Leu13374PRTArtificial SequenceSynthetic 337Cys Ala Xaa Leu13384PRTArtificial SequenceSynthetic 338Cys Ala Val Leu13394PRTArtificial SequenceSynthetic 339Cys Ala Ser Leu13404PRTArtificial SequenceSynthetic 340Cys Ala Xaa Phe13414PRTArtificial SequenceSynthetic 341Cys Ala His Phe13424PRTArtificial SequenceSynthetic 342Cys Ala Glu Phe13434PRTArtificial SequenceSynthetic 343Cys Leu Xaa Leu13444PRTArtificial SequenceSynthetic 344Cys Leu Glu Leu13454PRTArtificial SequenceSynthetic 345Cys Leu Gly Leu13464PRTArtificial SequenceSynthetic 346Cys Val Tyr Phe13474PRTArtificial SequenceSynthetic 347Cys Val Ala Gln13484PRTArtificial SequenceSynthetic 348Cys Ala His Val13494PRTArtificial SequenceSynthetic 349Cys Ala His Ile13504PRTArtificial SequenceSynthetic 350Cys Leu Glu Ile13514PRTArtificial SequenceSynthetic 351Cys Ile Ala Tyr13524PRTArtificial SequenceSynthetic 352Cys Met Leu Leu1

Claims

1-76. (canceled)

77. A combinatorial library comprising an ensemble of variant C-type lectin-like domain (CTLD) polypeptides having the scaffold structure of a CTLD polypeptide and a randomized CTLD loop region, the CTLD scaffold comprising the following structural elements: five .beta.-strands and two .alpha.-helices sequentially appearing in the order .beta.1, .alpha.1, .alpha.2, .beta.2, .beta.3, .beta.4, and .beta.5, the .beta.-strands being arranged in two anti-parallel .beta.-sheets, one .beta.-sheet composed of .beta.1 and .beta.5, the other .beta.-sheet composed of .beta.2, .beta.3, and .beta.4, and at least two disulfide bridges, one disulfide bridge connecting .alpha.1 and .beta.5 and one disulfide bridge connecting .beta.3 and a polypeptide segment connecting .beta.4 and .beta.5; and the randomized CTLD loop region consisting of two loop polypeptide segments, loop segment A (LSA) connecting .beta.2 and .beta.3, and loop segment B (LSB) connecting .beta.3 and .beta.4, wherein the amino acid sequence of LSA and/or LSB is randomized from the amino acid sequence of a wildtype CTLD loop region by random amino acid substitution, deletion, insertion, or any combination thereof of the wildtype CTLD loop sequence.

78. The combinatorial library of claim 77, wherein the CTLD is selected from a human tetranectin (hTN), mannose binding protein (MBP), surfactant protein D (SP-D), LY49A NK receptor domain (LY49A), asidoglycoprotein receptor (Hl-ASR), mouse macrophage receptor (MMR-4), Factor 1X/X binding protein A (IX-A), Factor 1X/X binding protein B (IX-B), lithostatin (Lit), tunicate C-type lectin (TU14) CTLD, and mouse tetranectin (mTN) CTLD.

79. The combinatorial library of claim 77, wherein the polypeptides further comprise N-terminal and/or C-terminal extensions of the CTLD.

80. The combinatorial library of claim 79, wherein the N-terminal and/or C-terminal extensions contain effector, enzyme, further binding and/or multimerizing functions.

81. The combinatorial library of claim 79, wherein the N-terminal and/or C-terminal extensions are the non-CTLD-portions of a native C-type lectin-like protein or a C-type lectin or a C-type lectin lacking a functional transmembrane domain.

82. The combinatorial library of claim 77, wherein the amino acid residues differ between different members of the ensemble of polypeptides in at least at two amino acid sequence positions in the randomized loop region.

83. The combinatorial library of claim 82, wherein at least three of the amino acid sequence positions of Loop Segment A are randomized.

84. The combinatorial library of claim 82, wherein at least two of the amino acid sequence positions of Loop Segment B are randomized.

85. The combinatorial library of claim 77, wherein the amino acid residues differ between different members of the ensemble of polypeptides at least at one amino acid sequence position in the Loop Segment A and at least at one amino acid sequence position in Loop Segment B.

86. The combinatorial library of claim 77, wherein the amino acid residues differ between different members of the ensemble of polypeptides at any one or more sequence positions in the loop region corresponding to amino acid residues 72-107 and 114-117 of SEQ ID NO: 276; amino acid residues 66-99 and 105-107 of SEQ ID NO: 277; amino acid residues 69-102 and 108-110 of SEQ ID NO: 278; amino acid residues 72-93 and 99-100 of SEQ ID NO: 279; amino acid residues 62-101 and 107-109 of SEQ ID NO: 280; amino acid residues 77-111 and 117-121 of SEQ ID NO: 281; amino acid residues 71-100 and 105-112of SEQ ID NO: 282; amino acid residues 68-94 and 99-104 of SEQ ID NO: 283; amino acid residues 68-103 and 111-117 of SEQ ID NO: 284; amino acid residues 54-94 and 100-103 of SEQ ID NO: 285; and amino acid residues 115-151 and 158-161 of SEQ ID NO: 289.

87. The combinatorial library of claim 86, wherein the amino acid residues differ between different members of the ensemble of polypeptides at any one or more sequence positions in the loop region corresponding to amino acid residues 72-79, 81-85, 91-99, 101-107, and 114-117 of SEQ ID NO: 276.

88. The combinatorial library of claim 86, wherein the amino acid residues differ at any of the sequence positions corresponding to 73-78, 93-98, 102-105, and 114-117 of SEQ ID NO: 276.

89. The combinatorial library of claim 86, wherein the amino acid residues differ at any of the sequence positions corresponding to 73-75, 77-78, and 102-105 of SEQ ID NO: 276.

90. The combinatorial library of claim 86, wherein the amino acid residues differ at any of the sequence positions corresponding to 93-98 and 102-105 of SEQ ID NO: 276.

91. The combinatorial library of claim 86, wherein the amino acid residues further differ at the sequence position corresponding to120 of SEQ ID NO: 276.

92. The combinatorial library of claim 86, wherein the amino acid residues differ at any of the sequence positions corresponding to 93-98 and 114-117 of SEQ ID NO: 276.

93. The combinatorial library of claim 88, wherein the amino acid residues further differ at any of the sequence positions corresponding to 112, 113, and 118 of SEQ ID NO: 276.

94. The combinatorial library of claim 86, wherein the amino acid residues differ at any of the sequence positions corresponding to 94-97 and 114-116 of SEQ ID NO: 276.

95. The combinatorial library of claim 94, wherein the amino acid residues differ at any of the sequence positions corresponding to 73-75, 77-78, and 104-105 of SEQ ID NO: 276.

96. The combinatorial library of claim 86, wherein the amino acid residues differ at any one or more sequence positions in the loop region corresponding to amino acid residues 66-73, 75-79, 85-90, 92-99, and 105-107 of SEQ ID NO: 277.

97. The combinatorial library of claim 86, wherein the amino acid residues differ at any one or more sequence positions in the loop region corresponding to amino acid residues 69-76, 78-82, 88-93, 95-102, and 108-110 of SEQ ID NO: 278.

98. The combinatorial library of claim 77, wherein 1-10 amino acid residues are substituted, deleted, or inserted in any one or more of the .alpha.-helices, .beta.-strands, and connecting segments.

99. The combinatorial library of claim 77, wherein the 1-10 amino acid residues are substituted, deleted, or inserted in any one or more of the .beta.2, .beta.3, and .beta.4-strands.

100. The combinatorial library of claim 77, wherein the polypeptide sequence outside of the loop region is at least 95% identical to the amino acid sequence outside the loop region of one of SEQ ID NO:276, 277 and 278.

101. A combinatorial library comprising an ensemble of polypeptides comprising an amino acid sequence at least 95% identical to amino acids 1-71, and 114-117 of SEQ ID NO:276 wherein one or more of amino acids 72-79, 81-85, 91-99, 101-107, and 114-117 are randomized.

102. A nucleic acid library comprising a multitude of nucleic acids encoding variant C-type lectin-like domain (CTLD) polypeptides having the scaffold structure of a CTLD polypeptide and a randomized CTLD loop region, the CTLD scaffold comprising the following structural elements: five .beta.-strands and two .alpha.-helices sequentially appearing in the order .beta.1, .alpha.1, .alpha.2, .beta.2, .beta.3, .beta.4, and .beta.5, the (.beta.-strands being arranged in two anti-parallel (.beta.-sheets, one (3-sheet composed of .beta.1 and .beta.5, the other (3-sheet composed of .beta.2, .beta.3, and .beta.4, and at least two disulfide bridges, one disulfide bridge connecting .alpha.1 and .beta.5 and one disulfide bridge connecting .beta.3 and a polypeptide segment connecting .beta.4 and .beta.5; and the randomized CTLD loop region consisting of two loop polypeptide segments, loop segment A (LSA) connecting .beta.2 and .beta.3, and loop segment B (LSB) connecting .beta.3 and .beta.4, wherein the amino acid sequence of LSA and/or LSB is randomized from the amino acid sequence of a wildtype CTLD loop region by random amino acid substitution, deletion, insertion, or any combination thereof of the wildtype CTLD loop sequence.

103. The library of claim 102, wherein the CTLD loop region is randomized by substituting the portion of the nucleic acid molecules encoding some or all of the loop regions with a nucleic acid fragment randomly selected from a multitude of nucleic acid fragments.

104. The combinatorial library of claim 103, wherein the amino acid residues differ between different members of the ensemble of polypeptides in at least at two amino acid sequence positions in the randomized loop region.

105. The combinatorial library of claim 103, wherein at least three of the amino acid sequence positions of Loop Segment A are randomized.

106. The combinatorial library of claim 103, wherein at least two of the amino acid sequence positions of Loop Segment B are randomized.

107. The library of claim 102, wherein the nucleotide sequence encoding the polypeptide sequence outside of the loop region is altered to facilitate the excision of part or all of the loop region and the insertion of an altered loop polypeptide sequence while the scaffold structureof the CTLD is substantially maintained.

108. A method of preparing the combinatorial library based upon a CTLD scaffold structure, the method comprising: (a) inserting in a suitable vector a nucleic acid encoding variant C-type lectin-like domain (CTLD) polypeptide having the scaffold structure of a CTLD polypeptide and a randomized CTLD loop region, the CTLD scaffold comprising the following structural elements: five .beta.-strands and two .alpha.-helices sequentially appearing in the order .beta.1, .alpha.1, .alpha.2, .beta.2, .beta.3, .beta.4, and .beta.5, the (.beta.-strands being arranged in two anti-parallel (.beta.-sheets, one (.beta.-sheet composed of .beta.1 and .beta.5, the other (.beta.-sheet composed of .beta.2, .beta.3, and .beta.4, and at least two disulfide bridges, one disulfide bridge connecting .alpha.1 and .beta.5 and one disulfide bridge connecting .beta.3 and a polypeptide segment connecting .beta.4 and .beta.5; and the randomized CTLD loop region consisting of two loop polypeptide segments, loop segment A (LSA) connecting .beta.2 and .beta.3, and loop segment B (LSB) connecting .beta.3 and .beta.4, wherein the amino acid sequence of LSA and/or LSB is randomized from the amino acid sequence of a wildtype CTLD loop region by random amino acid substitution, deletion, insertion, or any combination thereof of the wildtype CTLD loop sequence, (b) optionally introducing restriction endonuclease recognition sites, the recognition sites being properly located in the sequence at or close to the ends of the sequence encoding the loop region of the CTLD or part thereof, (c) excising the DNA fragment encoding the loop region or part thereof using restriction endonucleases; (d) ligating randomized mixtures of DNA fragments into the loop region of the restricted vector, and inducing the vector to express randomized polypeptides having the scaffold structure of the CTLD and a randomized loop region in a suitable medium.