U.S. patent application number 13/257585 was filed with the patent office on 2012-04-19 for vaccine compositions and methods for treatment of mucormycosis and other fungal diseases.
Invention is credited to John E. Edwards, Yue Fu, Ashraf S. Ibrahim, Brad J. Spellberg.
Application Number | 20120093828 13/257585 |
Document ID | / |
Family ID | 42739922 |
Filed Date | 2012-04-19 |
United States Patent
Application |
20120093828 |
Kind Code |
A1 |
Ibrahim; Ashraf S. ; et
al. |
April 19, 2012 |
VACCINE COMPOSITIONS AND METHODS FOR TREATMENT OF MUCORMYCOSIS AND
OTHER FUNGAL DISEASES
Abstract
The present invention provides therapeutic compositions and
methods for treating and preventing fungal disease or conditions
including mucormycosis. The therapeutic methods and compositions of
the invention include vaccine compositions having an FTR
polypeptide or an antigenic fragment of the polypeptide; a vector
including a nucleotide sequence that is substantially complimentary
to at least 18 contiguous nucleotides of FTR sequence; an
antisense; a small interfering RNA or an antibody inhibitor of FTR.
The vaccine compositions of the invention can further include an
adjuvant.
Inventors: |
Ibrahim; Ashraf S.; (Irvine,
CA) ; Spellberg; Brad J.; (Rancho Palos Verdes,
CA) ; Fu; Yue; (Torrance, CA) ; Edwards; John
E.; (Palos Verdes Estates, CA) |
Family ID: |
42739922 |
Appl. No.: |
13/257585 |
Filed: |
March 19, 2010 |
PCT Filed: |
March 19, 2010 |
PCT NO: |
PCT/US2010/000820 |
371 Date: |
January 4, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61161614 |
Mar 19, 2009 |
|
|
|
Current U.S.
Class: |
424/146.1 ;
424/158.1; 424/274.1; 514/44A |
Current CPC
Class: |
C12N 15/1138 20130101;
A61P 9/00 20180101; A61P 31/10 20180101; A61P 27/16 20180101; A61P
19/00 20180101; A61P 31/04 20180101; A61P 7/00 20180101; A61P 11/00
20180101; A61P 35/00 20180101; A61P 35/02 20180101; A61P 17/02
20180101; A61P 3/10 20180101; C07K 16/14 20130101; A61P 31/18
20180101; A61P 37/04 20180101; A61P 1/00 20180101; A61P 31/00
20180101; A61P 13/12 20180101; C12N 2310/14 20130101; C12N 9/00
20130101; A61K 2039/505 20130101 |
Class at
Publication: |
424/146.1 ;
424/274.1; 514/44.A; 424/158.1 |
International
Class: |
A61K 39/395 20060101
A61K039/395; A61P 37/04 20060101 A61P037/04; A61K 31/713 20060101
A61K031/713; A61P 31/10 20060101 A61P031/10; A61K 39/00 20060101
A61K039/00; A61K 31/7088 20060101 A61K031/7088 |
Goverment Interests
[0001] This invention was made in part with U.S. Government support
under NIH grant 011671 awarded by NIAID. The U.S. Government can
have certain rights in the invention.
Claims
1. A vaccine composition, comprising an FTR polypeptide, or an
antigenic fragment of said polypeptide, and a pharmaceutically
acceptable carrier.
2. The vaccine composition of claim 1, further comprising an
adjuvant.
3. The vaccine composition of claim 1, wherein the antigenic
fragment comprise an iron binging domain or an extracellular region
of FTR.
4. A vaccine composition, comprising a vector comprising a
nucleotide sequence that is substantially complimentary to at least
18 contiguous nucleotides of FTR sequence, a transcription
promoter, and a transcription terminator; wherein the promoter is
operably linked to the FTR nucleotide sequence, and wherein the FTR
nucleotide sequence is operably linked to the transcription
terminator, and a pharmaceutically acceptable carrier.
5. The vaccine composition of claim 4, further comprising an
adjuvant.
6. A pharmaceutical composition for treating or preventing a fungal
condition in a subject in need thereof, comprising an antisense, a
small interfering RNA or an antibody inhibitor of FTR selected from
the group consisting of a nucleotide sequence that is substantially
complimentary to a portion of an FTR sequence; a nucleotide
sequence that is substantially complimentary to at least 12
contiguous nucleotide bases of FTR sequence; a nucleotide RNAi
sequence that is substantially complimentary to at least 18
contiguous nucleotide bases of FTR sequence; an antibody or
antibody fragment thereof that specifically binds to an FTR
polypeptide or a fragment thereof; and a pharmaceutically
acceptable excipient or carrier.
7. A method of treating or preventing a fungal condition,
comprising administering to a subject having, or susceptible to
having, a fungal condition an immunogenic amount of an FTR
polypeptide, or an immunogenic fragment thereof.
8. The method of claim 7, wherein the immunogenic amount of an FTR
polypeptide is administered with a pharmaceutically acceptable
medium or adjuvant.
9. The method of claim 7, wherein said fungal condition comprises
zygomycosis.
10. The method of claim 9, wherein said zygomycosis further
comprises mucormycosis.
11. The method of claim 10, wherein said mucormycosis comprises
rhinocerebral mucormycosis, pulmonary mucormycosis,
gastrointestinal mucormycosis, disseminated mucormycosis, bone
mucormycosis, mediastinum mucormycosis, trachea mucormycosis,
kidney mucormycosis, peritoneum mucormycosis, superior vena cava
mucormycosis or external otitis mucormycosis.
12. The method of claim 11, wherein said mucormycosis is associated
with an infectious agent within the order Mucorales.
13. The method of claim 12, wherein said agent within the order
Mucorales is selected from the fungi families of Choanephoraceae;
Cunninghamellaceae; Mucoraceae; Mycotyphaceae; Phycomycetaceae;
Pilobolaceae; Saksenaeaceae; Syncephalastraceae; or
Umbelopsidaceae.
14. The method of claim 12, wherein said agent within the order
Mucorales is selected from the genera of Rhizopus, Absidia,
Apophysomyces, Mucor, or Cunninghamell.
15. The method of claim 14, wherein said agent within the genera of
Rhizopus, Absidia, Apophysomyces, Mucor, or Cunninghamell is
selected from Rhizopus oryzae, Rhizopus microsporus,
rhizopodiformis, Absidia corymbifera, Apophysomyces elegans, or
Rhizomucor pusillus.
16. A method for treating or preventing a fungal condition in a
subject in need thereof, comprising exposing said fungi to an
antisense, a small interfering RNA or an antibody (polyclonal or
monoclonal) inhibitor of FTR.
17. The method of claim 16, wherein said antisense or antibody
inhibitor of FTR comprises an inhibitor selected from the group
consisting of a nucleotide sequence that is substantially
complimentary to a portion of an FTR nucleotide sequence; an
nucleotide sequence that is substantially complimentary to at least
12 contiguous nucleotide bases of FTR sequence, a nucleotide RNAi
sequence that is substantially complimentary to at least 18
contiguous nucleotide bases of FTR sequence; and an antibody or
antibody fragment that specifically binds to an FTR nucleotide
sequence, polypeptide or a fragment thereof.
Description
BACKGROUND OF THE INVENTION
[0002] This invention generally relates to compositions and methods
to vaccinate subjects against infectious diseases and, more
particularly, relates to compositions and methods to vaccinate
subjects against opportunistic fungal diseases.
[0003] About 180 of the 250,000 known fungal species are recognized
to cause disease (mycosis) in man and animal. Some of fungi can
establish an infection in all exposed subjects, e.g., the systemic
pathogens Histoplasma capsulatum and Coccidioides immitis. Others,
such as Candida, Asergillus species and Zygomycetes are opportunist
pathogens which ordinarily cause disease only in a compromised
host. Fungi of the class Zygomycetes, order Mucorales, can cause
Mucormycosis, a potentially deadly fungal infection in human. Fungi
belonging to the order Mucorales are distributed into at least six
families, all of which can cause mucormycosis (Ibrahim et al.
Zygomycosis, p. 241-251, In W. E. Dismukes, P. G. Pappas, and J. D.
Sobel (ed.), Clinical Mycology, Oxford University Press, New York
(2003); Kwon-Chung, K. J., and J. E. Bennett, Mucormycosis, p.
524-559, Medical Mycology, Lea & Febiger, Philadelphia (1992),
and Ribes et al. Zygomycetes in Human Disease, Clin Microbiol Rev
13:236-301 (2000)). However, fungi belonging to the family
Mucoraceae, and specifically the species Rhizopus oryzae (Rhizopus
arrhizus), are by far the most common cause of infection (Ribes et
al., supra). Increasing cases of mucormycosis have been also
reported due to infection with Cunninghamella spp. in the
Cunninghamellaceae family (Cohen-Abbo et al., Clinical Infectious
Diseases 17:173-77 (1993); Kontoyianis et al., Clinical Infectious
Diseases 18:925-28 (1994); Kwon-Chung et al., American Journal of
Clinical Pathology 64:544-48 (1975), and Ventura et al., Cancer
58:1534-36 (1986)). The remaining four families of the Mucorales
order are less frequent causes of disease (Bearer et al., Journal
of Clinical Microbiology 32:1823-24(1994); Kamalam and Thambiah,
Sabouraudia 18:19-20 (1980); Kemna et al., Journal of Clinical
Microbiology 32:843-45 (1994); Lye et al., Pathology 28:364-65
(1996), and Ribes et al., (supra)).
[0004] The agents of mucormycosis almost uniformly affect
immunocompromised hosts (Spellberg et al., Clin. Microbiol. Rev.
18:556-69 (2005)). The major risk factors for mucormycosis include
uncontrolled diabetes mellitus in ketoacidosis known as diabetes
ketoacidosis (DKA), other forms of metabolic acidosis, treatment
with corticosteroids, organ or bone marrow transplantation,
neutropenia, trauma and burns, malignant hematological disorders,
and deferoxamine chelation-therapy in subjects receiving
hemodialysis.
[0005] Recent reports have demonstrated a striking increase in the
number of reported cases of mucormycosis over the last two decades
(Gleissner et al., Leuk. Lymphoma 45(7):1351-60 (2004)). There has
also been an alarming rise in the incidence of mucormycosis at
major transplant centers. For example, at the Fred Hutchinson
Cancer Center, Marr et al. have described a greater than doubling
in the number of cases from 1985-1989 to 1995-1999 (Marr et al.,
Clin. Infect. Dis. 34(7):909-17 (2002)). Similarly, Kontoyiannis et
al. have described a greater than doubling in the incidence of
mucormycosis in transplant subjects over a similar time-span
(Kontoyiannis et al, Clin. Infect. Dis. 30(6):851-6 (2000)). Given
the increasing prevalence of diabetes, cancer, and organ
transplantation in the aging United States population, the rise in
incidence of mucormycosis is anticipated to continue unabated for
the foreseeable future.
[0006] Available therapies for invasive mucormycosis include
attempts to reverse the underlying predisposing factors, emergent,
wide-spread surgical debridement of the infected area, and
adjunctive antifungal therapy (Edwards, J., Jr., Zygomycosis, p.
1192-1199. In P. Hoeprich and M. Jordan (ed.), Infectious Disease,
4th ed. J.B. Lippincott Co., Philadelphia (1989); Ibrahim et al.,
(2003), supra; Kwon-Chung and Bennett, supra; Sugar, A. M., Agent
of Mucormycosis and Related Species, p. 2311-2321. In G. Mandell,
J. Bennett, and R. Dolin (ed.), Principles and Practices of
Infectious Diseases, 4th ed. Churchill Livingstone, New York
(1995)).
[0007] Currently, Amphotericin B (AmB) remains the only antifungal
agent approved for the treatment of invasive mucormycosis (Id).
Because the fungus is relatively resistant to AmB, high doses are
required, which frequently cause nephrotoxicity and other adverse
effects (Sugar, supra). Also, in the absence of surgical removal of
the infected focus (such as excision of the eye in subjects with
rhinocerebral mucormycosis), antifungal therapy alone is rarely
curative (Edwards, J. (1989), supra; Ibrahim et al., (2003),
supra). Even when surgical debridement is combined with high-dose
AmB, the mortality associated with mucormycosis exceeds 50% (Sugar,
supra). In subjects with disseminated disease mortality approaches
100% (Husain et al., Clin Infect Dis 37:221-29 (2003)). Because of
this unacceptably high mortality rate, and the extreme morbidity of
highly disfiguring surgical therapy, it has been imperative to
develop new strategies to treat and prevent invasive
mucormycosis.
[0008] One of the underlying factors in predisposition to fungal
infection is elevated serum iron levels. Subjects who have elevated
available serum iron are hypersusceptible to mucormycosis. Iron is
required by virtually all microbial pathogens for growth and
virulence. In mammalian hosts, very little serum iron is available
to microorganisms because it is highly bound to carrier proteins
such as transferrin. Although sequestration of serum iron is a
major host defense mechanism against pathogenic fungi, subjects
treated with exogenous iron chelators e.g., deferoxamine have a
markedly increased incidence of invasive mucormycosis, which is
associated with a mortality of >80%. While deferoxamine is a
chelator from the perspective of the human host, it predisposes
subjects to mucormycosis by acting as a siderophore, supplying
previously unavailable iron to the pathogenic fungi.
[0009] Therefore, there exists a need for compounds and methods
that can reduce the risk of mucormycosis pathogenesis and provide
effective therapies without adverse effects. The present invention
satisfies this need and provides related advantages as well.
SUMMARY OF THE INVENTION
[0010] In accordance with the embodiments outlined in this
disclosure, the present invention provides a vaccine composition,
including an FTR polypeptide, or an antigenic fragment of the
polypeptide, and a pharmaceutically acceptable carrier. In
addition, the invention provides a vaccine composition, including a
vector having a nucleotide sequence that is substantially
complimentary to at least 18 contiguous nucleotides of FTR
sequence, a transcription promoter, and a transcription terminator;
wherein the promoter is operably linked to the FTR nucleotide
sequence, and wherein the FTR nucleotide sequence is operably
linked to the transcription terminator, and a pharmaceutically
acceptable carrier. The vaccine compositions of the present
invention can further include an adjuvant.
[0011] In addition, the invention provides a pharmaceutical
composition for treating or preventing a fungal condition in a
subject in need thereof, including an antisense, a small
interfering RNA or an antibody inhibitor of FTR selected from the
group consisting of a nucleotide sequence that is substantially
complimentary to a portion of an FTR sequence; a nucleotide
sequence that is substantially complimentary to at least 12
contiguous nucleotide bases of FTR sequence; a nucleotide RNAi
sequence that is substantially complimentary to at least 18
contiguous nucleotide bases of FTR sequence; an antibody or
antibody fragment thereof that specifically binds to an FTR
polypeptide or a fragment thereof; and a pharmaceutically
acceptable excipient or carrier.
[0012] In addition, the invention provides a method of treating or
preventing a fungal condition, including administering to a subject
having, or susceptible to having, a fungal condition an immunogenic
amount of an FTR polypeptide, or an immunogenic fragment thereof.
In addition, the invention provides a method for treating or
preventing a fungal condition in a subject in need thereof,
including exposing said fungi to an antisense, a small interfering
RNA or an antibody inhibitor of FTR.
BRIEF DESCRIPTION OF THE DRAWINGS
[0013] FIG. 1 shows Rhizopus oryzae high affinity iron permease
nucleotide sequence (SEQ ID NO: 1), with Genbank cDNA accession NO.
AY344587.
[0014] FIG. 2 shows Rhizopus oryzae high affinity iron permease
polypeptide sequence (SEQ ID NO:2), with Genbank protein ID. No.
AAQ24109.1.
[0015] FIG. 3 shows amino acid sequence alignment (a) and
dendrogram (b) for FTR of R. oryzae having 46% and 44% identity
with FTR of C. albicans and S. cerevisiae, respectively. Box on
amino acid sequence alignment indicates the conserved REGLE motif
involved in a direct interaction with iron.
[0016] FIG. 4 shows mechanisms of iron uptake by Zygomycetes in
conditions of elevated available serum iron.
[0017] FIG. 5 shows the FTR expression in R. oryzae grown in media
with varying concentrations of iron.
[0018] FIG. 6 shows the growth of S. cerevisiae ftr1 mutant
transformed with vector expressing FTR.
[0019] FIG. 7 shows high affinity iron uptake by S. cerevisiae ftr1
mutant transformed with vector expressing FTR as compared with iron
uptake by wild-type S. cerevisiae and S. cerevisiae ftr1 mutant
transformed with empty vector. *P<0.05.
[0020] FIG. 8 shows the percent survival of diabetic mice (n=10)
infected with R. oryzae as compared with non-diabetic infected and
diabetic uninfected mice.
[0021] FIG. 9 shows a temporal link or an inverse correlation
between percent survival and the kidney burden of R. oryzae
(5.times.10.sup.4 spores) as determined by TaqMan assay.
[0022] FIG. 10 shows the percent survival of DKA mice (n=20) (A)
and tissue fungal burden (n=11) (B) infected with 5.times.10.sup.3
R. oryzae spores and treated with: 1) deferasirox (given orally);
2) deferasirox+saturating FeCl.sub.3 (given i.p,); 3) intravenous
LAmB for 4 days; and 4) placebo. Uninfected DKA mice and uninfected
treated with FeCl.sub.3 were included as negative controls.
*p<0.05 vs. placebo or deferasirox+iron.
[0023] FIG. 11 shows the expression of FTR in the hematogenously
disseminated mucormycosis model using DKA mice. Mice were infected
with 10.sup.5 spores of R. oryzae 99-880 through the tail vein. At
indicated time points infected brains were removed and total RNA
was then used for real-time-RT-PCR analysis (n=4 mice per time
point). Brains from uninfected mice served as a negative control.
Values are expressed as average.+-.SD.
[0024] FIG. 12 shows the expression of FTR in the brains of DKA
mice infected with R. oryzae expressing GFP under the control of
FTR promoter. (A) H & E stain of brain infected with R. oryzae;
(B) brain section stained with rabbit polyclonal antibody to GFP
then counter stained with FITC conjugated anti-rabbit antibody; and
(C) DIC confocal image showing non-fluorescent R. oryzae at the
time of infection. Arrows denote fungal elements in infected
brains. Magnification, .times.400.
[0025] FIG. 13 shows the agarose gel electrophoresis result of an
RT-PCR assay showing lack of expression of FTR in R. oryzae
transformed with RNA-interference plasmid (T.sub.1 and
T.sub.3-T.sub.5) as compared to R. oryzae transformed with empty
plasmid (C). Primers amplifying the 18s rDNA served as a control to
demonstrate the specificity of RNA interference in targeting
FTR.
[0026] FIG. 14 shows the percent survival of DKA mice (n=8)
infected i. v. with R. oryzae transformed with empty plasmid
(control strain, 2.9.times.10.sup.3 spores) or with RNAi plasmid
targeting expression of FTR (FTR-i, 4.1.times.10.sup.3 spores). *,
P<0.001 by Log Rank test.
[0027] FIG. 15 shows Aspergillus fumigatus high affinity iron
permease nucleotide sequence.
[0028] FIG. 16 shows Candida guilliermondii high affinity iron
permease nucleotide sequence.
[0029] FIG. 17 shows Aspergillus flavus high affinity iron permease
nucleotide sequences.
[0030] FIG. 18 shows Candida tropicalis high affinity iron permease
nucleotide sequence.
[0031] FIG. 19 shows a conceptual model of the Rhizopus rFtr1p
helical bundle protein and translocation of iron from the
extracellular setting into the cytoplasm of Rhizopus species.
[0032] FIG. 20 shows results of an SDS-PAGE demonstrating purified
synthetic/recombinant rFtr1p. E. coli was transformed with a
plasmid expressing 6.times.-His tagged synthetic rFTR1 or with
empty plasmid. rFtr1p was purified by Ni-agrose column and detected
at the expected size of 28 kD in the rFtr1p clone but not when E.
coli was transformed with empty plasmid.
[0033] FIG. 21 shows survival of DKA mice (n=8) infected with R.
oryzae (2.5.times.107 spores) and treated with serum collected from
mice immunized with either rFtr1p or empty plasmid. *, P<0.007
by Log Rank test.
[0034] FIG. 22 shows that FTR1 is expressed in DKA mice infected
intravenously with R. oryzae. Panel (A) shows FACS analysis of R.
oryzae transformed with plasmid containing the reporter gene GFP
driven by either the FTR1 promoter or the constitutively expressed
ACT1 promoter and grown in iron-rich or iron-depleted conditions.
R. oryzae M16 transformed with an empty plasmid was used as a
negative control. Panel (B) shows FTR1 is expressed in the brains
of DKA mice infected with R. oryzae expressing GFP under the
control of FTR1p. For anti-GFP Ab stain, tissue section was stained
with rabbit polyclonal antibody to GFP then counter stained with
FITC conjugated anti-rabbit antibody. For DIC, confocal image
showing non-fluorescent R. oryzae at the time of infection. Arrows
denote fungal elements in infected brains. Magnification,
.times.400.
[0035] FIG. 23 shows that the disruption cassette integrates in
FTR1 locus but complete elimination of FTR1 could not be achieved.
Panel (A) A diagram summarizing the strategy we used to achieve
FTR1 disruption. PyrF (998 bp) was used as a selectable marker
flanked by 606 and 710 bp fragments of FTR1-5' UTR and FTR1-3' UTR,
respectively. Panel (B) Gel electrophoresis showing integration of
the disruption cassette in a representative putative ftr1 null
mutant (KO) but not in the wild-type (WT) (see 5'UTR and 3'UTR).
Primers FTR1 P11 and FTR1 P12 were used to amplify 503 bp from the
FTR1 ORF only from the wild-type but not from the putative ftr1
null mutant (see FTR1). Primers PyrF P9 and PyrF P18 to test for
possible reciculization of the transformed plasmid with expected
band of 2094 bp were also used (see self ligation). Panel (C)
Comparison of growth rate of R. oryzae wild-type, R. oryzae
PyrF-complemented, or putative ftr1 null mutants grown on different
sources of iron on iron-limited or iron-rich media. Growth was
measured after 48 h for media containing 10 or 1000 .mu.M
(iron-rich) of FeCl3 or FeSO4 or 100 .mu.M of ferrioxamine, while
growth was measured after 72 h for medium supplemented with 100
.mu.M heme. Values are expressed as increase in mycelial diameter
growth on solid growth medium in cm/h. *P<0.05 compared to
wild-type or R. oryzae PyrF-complemented strains. Panel (D) Gel
electrophoresis showing lack of amplification of FTR1 after one
round of purification of the putative null mutants on iron-rich
medium (1000 .mu.M FeCl3) and amplification of the FTR1 from the
same isolate following growth on iron-depleted medium (i.e. 100
.mu.M ferrioxamine) for 96 h. Amplification of actin (600 bp) was
used to control for DNA loading.
[0036] FIG. 24 shows confirmation of the lack of complete
disruption of FTR1 in the multinucleated R. oryzae. Panel (A) DAPI
stain of swollen R. oryzae spores showing the presence of multiple
nuclei with a single spore. Arrows denote nuclei. Original
magnification, .times.1000. Panel (B) Gel electrophoresis showing
lack of amplification of FTR1 after 14 passages of the putative
null mutants on iron-rich medium (1000 .mu.M FeCl3) and
amplification of the FTR1 from the same isolate following growth on
iron-depleted medium (i.e. 100 .mu.M ferrioxamine) for 96 h.
Amplification of actin (600 bp) was used to confirm the integrity
of DNA used as template and the absence of PCR inhibitors. Panel
(C) Southern blot confirming the integration of the disruption
cassette in the putative ftr1 (7380 bp band is present only in DNA
sample extracted from putative ftr1 grown in iron-rich medium) and
almost complete elimination of the FTR1 copy (lack of 1960 bp in
DNA sample extracted from putative ftr1 grown in iron-rich
medium).
[0037] FIG. 25 shows that reduced copy number results in
compromised ability of R. oryzae to take up iron. Panel (A)
Quantitative PCR demonstrating reduced copy number in the putative
ftr1 null mutant compared to R. oryzae PyrF-complemented strain or
to the same mutant grown in iron-depleted medium. Panel (B) Gel
electrophoresis of samples taken from the qPCR tube showing the
amplification specificity for the FTR1 product. Panel (C) The
putative ftr1 mutant demonstrated reduced ability to acquire 59Fe
compared to R. oryzae wild-type or R. oryzae PyrF-complemented
strains. 59Fe uptake by wild-type, R. oryzae PyrF-complemented, or
putative ftr1 mutant. Germinated spores were incubated with 0.1
.mu.M 59FeCl3 (a concentration in which high-affinity iron
permeases are induced (Fu et al., FEMS Microbiol Lett 235: 169-176
(2004)). *P<0.05 when compared with R. oryzae wild-type or R.
oryzae PyrF-complemented strains. Data (n=9 from three separate
experiments) are expressed as medians+interquartile ranges.
[0038] FIG. 26 shows how the reduction of FTR1 copy number reduces
R. oryzae virulence in the DKA mouse models. Panel (A) a
representative of the putative ftr1 null mutant demonstrated
comparable growth to R. oryzae PyrF-complemented strain on YPD or
CSM-URA media. Panel (B) Survival of mice (n=8) infected i.v. with
R. oryzae wild-type (4.3.times.103), R. oryzae PyrF-complemented
strain (4.8.times.103 spores) or with putative ftr1 null mutant
(3.0.times.103 spores). *, P<0.0005 compared to wild-type or
PyrF-complemented strains. Panel (C) Survival of mice (n=9)
infected intranasally with R. oryzae wild-type (4.3.times.103
spores), R. oryzae PyrF-complemented strain (5.1.times.103 spores)
or putative ftr1 null mutant (5.3.times.103 spores). *, P=0.04
compared to wild-type or PyrF-complemented strains.
[0039] FIG. 27 shows how inhibition of FTR1 expression reduces R.
oryzae ability to take up .sup.59Fe in vitro. (A) RT-PCR showing
lack of expression of FTR1 in R. oryzae transformed with
RNA-interference plasmid (T.sub.1 and T.sub.3-T.sub.5) compared to
R. oryzae transformed with empty plasmid (C, control). Primers
amplifying the 18s rDNA served as a control to demonstrate the
integrity of starting sample and lack of PCR inhibitors. (B) a
representative of the RNAi transformants demonstrated comparable
growth to the R. oryzae M16 transformed with empty plasmid on YPD
or CSM-URA media. (C) .sup.59Fe uptake by wild-type, R. oryzae M16
transformed with the empty plasmid, or one of the RNAi
transformants. Germinated spores were incubated with 0.1 .mu.M
.sup.59FeCl.sub.3 (a concentration in which high-affinity iron
permeases are induced (Fu et al., FEMS Microbiol Lett 235: 169-176
(2004)). *P<0.05 when compared with R. oryzae wild-type or R.
oryzae M16 transformed with empty plasmid. Data (n=9 from three
separate experiments) are expressed as medians.+-.interquartile
ranges.
[0040] FIG. 28 shows how inhibition of FTR1 expression reduces
virulence of R. oryzae in the DKA mouse models and passive
immunization with anti-Ftr1p sera protects DKA mice from R. oryzae
infection. Panel (A) Survival of mice (n=8) infected i.v. with R.
oryzae transformed with empty plasmid (control strain,
2.9.times.10.sup.3 spores) or with RNA-i plasmid targeting
expression of FTR1 (FTR1-i, 4.1.times.10.sup.3 spores). *,
P<0.001. Panel (B) Survival of mice (n=9) infected intranasally
with R. oryzae transformed with empty plasmid (control strain,
2.8.times.10.sup.3 spores) or with RNAi plasmid targeting
expression of FTR1 (FTR1-i, 7.6.times.10.sup.3 spores). *,
P<0.02. Panel (C) Kidney or brain Fungal burden of mice (n=8)
infected i.v. with R. oryzae transformed with empty plasmid
(control strain, 4.2.times.10.sup.3 spores) or with RNAi plasmid
targeting expression of FTR1 (FTR1-i, 5.1.times.10.sup.3 spores).
*, P<0.0006 and , P<0.04 compared to control strain. Data are
expressed as medians+interquartile ranges. The y-axes reflect lower
limits of detection of the assay. (D) Survival of mice (n=8)
infected intranasally with R. oryzae (intended inoculum of
2.5.times.10.sup.7 spores and actual inhaled inoculum of
9.times.10.sup.3 spores) and treated with serum collected from mice
immunized with either Ftr1p or proteins collected form empty
plasmid clone. *, P<0.007.
DETAILED DESCRIPTION OF THE INVENTION
[0041] This invention is directed to the use of compositions and
methods that directly and/or indirectly inhibit the high affinity
iron permease (FTR) of pathogenic fungi, specifically those
involved in the onset of mucormycosis. High affinity iron permease
is a molecule responsible for the uptake of iron in fungi;
targeting and inhibition of this molecule, therefore, will impede
the ability of the fungi to uptake and/or use the iron available in
the surrounding environment. Inhibition of high affinity iron
permease will result in iron-starvation in fungal pathogens
hampering their growth and/or virulence. The FTR polypeptide in,
for example, R. oryzae has little or no homology with any known
human proteins. For example, homology search of the human proteome
identified five open reading frames with extremely limited homology
to R. oryzae's FTR protein with an alignment score of 30.4, e=9.0
for all of the five proteins. Three of these proteins are
coiled-coil domain containing 82 (i.e., EAW66982; AAH33726.1; and
NP.sub.--079001.2), one is a CCDC82 protein (i.e., AAH18663.1) and
an unnamed protein (i.e., BAB15683.1) As a benchmark, the standard
BLAST search e value for identification of unique sequences from
fungi compared to other organisms has been set at 10.sup.-8,
indicating that rFtr1p has no significant homology to the human
proteome. Therefore, the compositions and methods of the current
invention in targeting and inhibiting FTR will only affect the iron
levels in the fungal pathogen not the host, which constitutes an
effective and targeted therapy against mucormycosis.
[0042] In one embodiment, the invention is directed to an
immunogenic composition such as a vaccine. The immunogenic
composition includes an effective dose of fungal FTR polypeptide or
an antigenic fragment thereof that confer protection against
mucormycosis in a subject. The vaccine composition of the invention
induces host humoral and/or cell mediated immune response against
fungal FTR. In another embodiment, a composition of the invention
further includes an adjuvant that can boost the immunogenecity of
the vaccine composition.
[0043] In yet another embodiment, the invention includes an
inhibitor of FTR molecule such as siRNA, for example. The FTR
inhibitor includes a vector expressing one or more siRNAs that
include sequences sufficiently complementary to a portion of the
FTR molecule for inhibiting FTR transcription or translation
levels. For example as described in Example 9, interfering RNAs
against FTR of R. oryzae were prepared, which were shown to inhibit
FTR expression in these fungi. In DKA mice, it was demonstrated
that R. oryzae transformants harboring anti-FTR siRNAs were less
virulent than the wild type R. oryzae.
[0044] As used herein, the term "FTR" refers to high affinity iron
permease, a membrane protein responsible for iron transport in
pathogenic fungi, such as, but not limited to FTR in R. oryzae, A.
fumigatus, C. guilliermondii, A flavus, and C. tropicalis; and the
nucleic acids encoding the same. As shown in FIG. 3 and described
in Example 1, for example, FTRs from R. oryzae, C. albicans and S.
cerevisiae share percent identities of 39% or more with multiple
regions of protein sequence homology. The nucleotide sequence of
FTR in, for example, R. oryzae is shown in FIG. 1 (SEQ ID NO:1),
and the corresponding amino acid sequence is shown in FIG. 2 (SEQ
ID NO:2). The nucleotide sequence of FTR, in A. fumigatus is shown
in FIG. 15; in C. guilliermondii is shown in FIG. 16; in A flavus
is shown in FIG. 17; and in C. tropicalis is shown in FIG. 18.
Throughout the present specification, the terms "FTR expression" or
"expressing FTR" can be employed to designate indifferently
expression of an FTR nucleic acid or an FTR polypeptide.
[0045] Generally, nucleic acid is an RNA, for example, mRNA or
pre-mRNA, or DNA, such as cDNA and genomic DNA. An FTR nucleic
acid, for example, refers to a nucleic acid molecule (RNA, mRNA,
cDNA, or genomic DNA, either single-or double-stranded)
corresponding to FTR polypeptide or an immunogenic fragment
thereof. DNA molecules can be doubled-stranded or singled-stranded;
single stranded RNA or DNA can be either the coding or sense
strand, or the non-coding or antisense strand. The nucleic acid
molecule or nucleotide sequence can include all or a portion of the
coding sequence of the gene and can further include additional
non-coding sequences such as introns and non-coding 3' and 5'
sequences (including promoter, regulatory, poly-A stretches or
enhancer sequences, for example). In addition, the nucleic acid
molecule or nucleotide sequence can be fused to another sequence,
for example, a label, a marker or a sequence that encodes a
polypeptide that assists in isolation or purification of the
polypeptide. Such sequences include, but are not limited to, those
that encode a selection marker (e.g. an antibiotic resistance gene,
or a reporter sequence), those that encode a repetition of
histidine (HIS tag) and those that encode a
glutathione-S-transferase (GST) fusion protein. The nucleic acid
molecule or nucleotide sequence can include a nucleic acid molecule
or nucleotide sequence which is synthesized chemically or by
recombinant means, such nucleic acid molecule or nucleotide
sequence is suitable for use in recombinant DNA processes and
within genetically engineered protein synthesis systems.
[0046] The term "polypeptide" refers to a chain of two or more
amino acids covalently linked by a peptide bond. Particular
polypeptides of interest in the context of this invention are amino
acid subsequences having antigenic epitopes. Antigenic epitopes are
well known in the art and include sequence and/or structural
determinants substantially responsible for the immunogenic
properties of a polypeptide and being capable of evoking an immune
response. Functional domains of the FTR polypeptide are also
considered to fall within the scope of the invention. For example,
the REGLE motif which interacts with iron is one exemplary
functional domain of the invention. Another exemplary functional
domain is the cell surface EXXE motif of FTR which is required for
full function of FTR in Saccharomyces cerevisiae (Stearman et al.,
Science 271: 1552-1557 (1996)). Polypeptides also undergo
maturation or post-translational modification processes that can
include, for example, glycosylation, proteolytic cleavage,
lipidization, signal peptide cleavage, propeptide cleavage,
phosphorylation, and such like.
[0047] The term "immunogenic" or "antigenic" as it is used herein
refers to a portion of a protein that is recognized by a T-cell
and/or B-cell antigen receptor. The immunogenic portion generally
includes at least 5 amino acid residues, preferably at least 10,
more preferably at least 20, and still more preferably at least 30
amino acid residues of an FTR polypeptide or a variant thereof.
Preferred immunogenic portions can contain a small N-and/or
C-terminal fragment (e.g., 5-30 amino acids, preferably 10-25 amino
acids).
[0048] A variant polypeptide contains at least one amino acid
change compared to the target polypeptide. Polypeptide variants of
FTR can exhibit at least about 39%, more preferably at least about
50%, and even more preferably at least about 70% identity to the
FTR polypeptide. A polynucleotide variant includes a substantially
homologous polynucleotide that deviates in some bases from the
identified polynucleotide, usually caused by mutations such as
substitution, insertion, deletion or transposition. Polynucleotide
variants preferably exhibit at least about 60% (for fragments with
10 or more nucleotides), more preferably at least about 70%, 80% or
90%, and even more preferably at least about 95%, 98% or 99%
identity to the identified polynucleotide.
[0049] The term "fragment" as used herein with reference to an FTR
polypeptide is intended to refer to a polypeptide having a portion
of FTR amino acid sequence. Useful fragments include those that
retain one or more of the biological activities of the polypeptide.
Such biologically active fragments can have a wide range of lengths
including, for example, 4, 6, 10, 15, 20, 25, 30, 40, 50, 100, or
more amino acid in length. In addition to activity, biologically
active fragments also can be characterized by, for example, a
motif, domain, or segment that has been identified by analysis of
the polypeptide sequence using methods well known in the art. Such
regions can include, for example, a signal peptide, extracellular
domain, transmembrane segment, ligand binding region, zinc finger
domain and/or glycosylation site.
[0050] The term "vaccine", as used herein, refers to a composition
that can be administered to an animal to protect the animal against
an infectious disease. Vaccines protect against diseases by
inducing or increasing an immune response in an animal against the
infectious disease. An exemplary infectious disease amenable to
treatment with the vaccines of the invention is mucormycosis. The
vaccine-mediated protection can be humoral and/or cell mediated
immunity induced in host when a subject is challenged with, for
example, FTR or an immunogenic portion or fragment thereof.
[0051] The term "adjuvant" is intended to mean a composition with
the ability to enhance an immune response to an antigen generally
by being delivered with the antigen at or near the site of the
antigen. Ability to increase an immune response is manifested by an
increase in immune mediated protection. Enhancement of humoral
immunity can be determined by, for example, an increase in the
titer of antibody raised to the antigen. Enhancement of cellular
immunity can be measured by, for example, a positive skin test,
cytotoxic T-cell assay, ELISPOT assay for IFN-gamma or IL-2.
Adjuvants are well known in the art. Exemplary adjuvants include,
for example, Freud's complete adjuvant, Freud's incomplete
adjuvant, aluminum adjuvants, MF59 and QS21.
[0052] The term "antibody" as used herein refers to immunoglobulin
molecules and immunologically active portion of immunoglobulin
molecules. Antibodies can be prepared by any of a variety of
techniques known to those skilled in the art (see, for example,
Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring
Harbor Laboratories, Cold Spring Harbor, N.Y., 1988). The present
invention provides polyclonal and monoclonal antibodies that bind
specifically to a polypeptide of the invention or fragment or
variant thereof. Monoclonal antibodies of the invention, for
example, include a population of antibody molecules that contain
only one species of antigen binding site capable of immunoreacting
with a particular epitope of a polypeptide of the invention or a
fragment or variant thereof. Monoclonal antibodies can be coupled
to one or more therapeutic agents. Suitable agents in this regard
include differentiation inducers, drugs, toxins, and derivatives
thereof. A therapeutic agent can be coupled (e.g., covalently
bonded) to a suitable monoclonal antibody either directly or
indirectly (e.g., via a linker group).
[0053] The terms "vector", "cloning vector" and "expression vector"
mean the vehicle by which a nucleic acid can be introduced into a
host cell. The vector can be used for propagation or harboring a
nucleic acid or for polypeptide expression of an encoded sequence.
A wide variety of vectors are known in the art and include, for
example, plasmids, phages and viruses Exemplary vectors can be
found described in, for example, Sambrook et al., Molecular
Cloning: A Laboratory Manual, Third Ed., Cold Spring Harbor
Laboratory, New York (2001); Ausubel et al., Current Protocols in
Molecular Biology, John Wiley and Sons, Baltimore, Md. (1999).
[0054] The term "antibody inhibitor" as used herein refers to an
antibody that reduces the biological activity or function of the
target antigen (i.e., FTR). Such reduction in activity or function
can be, for example, in connection with a cellular component (e.g.,
membrane localization), or in connection with a cellular process
(e.g., iron transport), or in connection with an overall process of
a cell (e.g., cell growth or survival). In reference to cell
growth, the inhibitory effects can be fungicidal (killing of fungi)
or fungistatic (i.e., stopping or at least slowing fungal growth).
The latter slows or prevents fungal growth such that fewer fungi
are produced relative to uninhibited fungi over a given time
period. From a molecular standpoint, such inhibition can equate
with a reduction in the level of, or elimination of, the
transcription and/or translation of FTR molecule, or reduction or
elimination of activity of FTR molecule.
[0055] The term "treating" or "treatment," as it is used herein is
intended to mean an amelioration of a clinical symptom indicative
of a fungal condition. Amelioration of a clinical symptom includes,
for example, a decrease or reduction in at least one symptom of a
fungal condition in a treated individual compared to pretreatment
levels or compared to an individual with a fungal condition. The
term "treating" also is intended to include the reduction in
severity of a pathological condition, a chronic complication or an
opportunistic fungal infection which is associated with a fungal
condition. Such pathological conditions, chronic complications or
opportunistic infections are exemplified below with reference to
mucormycosis. Mucormycosis and other such pathological conditions,
chronic complications and opportunistic infections also can be
found described in, for example, Merck Manual, Sixteenth Edition,
1992, and Spellberg et al., Clin. Microbio. Rev. 18:556-69
(2005).
[0056] The term "preventing" or "prevention," as it is used herein
is intended to mean a forestalling of a clinical symptom indicative
of a fungal condition. Such forestalling includes, for example, the
maintenance of normal physiological indicators in an individual at
risk of infection by a fungus or fungi prior to the development of
overt symptoms of the condition or prior to diagnosis of the
condition. Therefore, the term "preventing" includes the
prophylactic treatment of individuals to guard them from the
occurrence of a fungal condition. Preventing a fungal condition in
an individual also is intended to include inhibiting or arresting
the development of the fungal condition. Inhibiting or arresting
the development of the condition includes, for example, inhibiting
or arresting the occurrence of abnormal physiological indicators or
clinical symptoms such as those described above and/or well known
in the art. Therefore, effective prevention of a fungal condition
would include maintenance of normal body temperature, weight,
psychological state as well as lack of lesions or other
pathological manifestations in an individual predisposed to a
fungal condition. Individuals predisposed to a fungal condition
include, for example, an individual with AIDS, azotemia, diabetes
mellitus, bronchiectasis, emphysema, TB, lymphoma, leukemia, or
burns, or an individual with a history of susceptibility to a
fungal condition. Inhibiting or arresting the development of the
condition also includes, for example, inhibiting or arresting the
progression of one or more pathological conditions, chronic
complications or susceptibility to an opportunistic infection
associated with a fungal condition.
[0057] The term "fungal condition" as used herein refers to fungal
diseases, infection, or colonization including superficial mycoses
(i.e., fungal diseases of skin, hair, nail and mucous membranes;
for example, ringworm or yeast infection), subcutaneous mycoses
(i.e., fungal diseases of subcutaneous tissues, fascia and bone;
for example, mycetoma, chromomycosis, or sporotichosis), and
systemic mycoses (i.e., deep-seated fungal infections generally
resulting from the inhalation of air-borne spores produced by
causal moulds; for example, zygomycosis, mucormycosis,
coccidioidomycosis, blastomycosis, histoplasmosis, or
paracoccidioidomycosis)
[0058] As used herein, the term "zygomycosis" is intended to mean a
fungal condition caused by fungi of the class Zygomycetes,
comprised of the orders Mucorales and Entomophthorales. The
Entomophthorales are causes of subcutaneous and mucocutaneous
infections known as entomophthoromycosis, which largely afflict
immunocompetent hosts in developing countries. Zygomycosis is also
referred to as mucormycosis and the two terms are used
interchangeably to refer to similar types of fungal infections.
[0059] As used herein, the term "mucormycosis" is intended to mean
a fungal condition caused by fungi of the order Mucorales.
Mucormycosis is a life-threatening fungal infection almost
uniformly affecting immunocompromised hosts in either developing or
industrialized countries. Fungi belonging to the order Mucorales
are distributed into at least six families, all of which can cause
cutaneous and deep infections. Species belonging to the family
Mucoraceae are isolated more frequently from patients with
mucormycosis than any other family. Among the Mucoraceae, Rhizopus
oryzae (Rhizopus arrhizus) is a common cause of infection. Other
exemplary species of the Mucoraceae family that cause a similar
spectrum of infections include, for example, Rhizopus microsporus
var. rhizopodiformis, Absidia corymbifera, Apophysomyces elegans,
Mucor species, Rhizomucor pusillus and Cunninghamella spp
(Cunninghamellaceae family). Mucormycosis is well known in the art
and includes, for example, rinocerebral mucormycosis, pulmonary
mucormycosis, gastrointestinal mucormycosis, disseminated
mucormycosis, bone mucormycosis, mediastinum mucormycosis, trachea
mucormycosis, kidney mucormycosis, peritoneum mucormycosis,
superior vena cava mucormycosis or external otitis
mucormycosis.
[0060] Fungi belonging to the order Mucorales are currently
distributed into the families of Choanephoraceae;
Cunninghamellaceae; Mucoraceae; Mycotyphaceae; Phycomycetaceae;
Pilobolaceae; Saksenaeaceae; Syncephalastraceae; and
Umbelopsidaceae. Each of these fungi families consists of one or
more genera. For example, fungi belonging to the order Mucorales,
family Mucoraceae, are further classified into the genera of
Absidia (e.g., A. corymbifera); Actinomucor (e.g., A. elegans);
Amylomyces (e.g., A. rouxii); Apophysomyces; Backusella (e.g., B.
circina); Benjaminiella (e.g., B. multispora); Chaetocladium (e.g.,
C. brefeldii); Circinella (e.g., C. angarensis); Cokeromyces (e.g.,
C. recurvatus); Dicranophora (e.g., D. fulva); Ellisomyces (e.g.,
E. anomalus; Helicostylum (e.g., H. elegans); Hyphomucor (e.g., H.
assamensis); Kirkomyces (e.g., K. cordensis); Mucor (e.g., M.
amphibiorum); Parasitella (e.g., P. parasitica); Philophora (e.g.,
P. agaricina); Pilaira (e.g., P. anomala); Pirella (e.g., P.
circinans); Rhizomucor (e.g., R. endophyticus); Rhizopodopsis
(e.g., R. javensis); Rhizopus; Sporodiniella (e.g., S. umbellata);
Syzygites (e.g., S. megalocarpus); Thamnidium (e.g., T. elegans);
Thermomucor (e.g., T. indicae-seudaticae); and Zygorhynchus (e.g.,
Z. californiensis). The genus Rhizopus, for example, consists of R.
azygosporus; R. caespitosus; R. homothallicus; R. oryzae; and R.
schipperae species.
[0061] The Choanephoraceae family consists of fungi genera
Blakeslea (e.g., B. monospora), Choanephora (e.g., C.
cucurbitarum), Gilbertella (e.g., G. hainanensis), and Poitrasia
(e.g., P. circinans). The Cunninghamellaceae family consists of
genera Chlamydoabsidia (e.g., C. padenii); Cunninghamella (e.g., C.
antarctica); Gongronella (e.g., G. butleri); Halteromyces (e.g., H.
radiatus); and Hesseltinella (e.g., H. vesiculosa). The
Mycotyphaceae family consists of fungi genus Mycotypha (e.g., M.
africana). The Phycomycetaceae family consists of fungi genus
Phycomyces (e.g., P. blakesleeanus) and Spinellus (e.g., S.
chalybeus). The Pilobolaceae family consists of fungi genera
Pilobolus (e.g., P. longipes) and Utharomyces (e.g., U.
epallocaulus). The Saksenaeaceae family consists of fungi genera
Apophysomyces (e.g., A. elegans) and Saksenaea (e.g., S.
vasiformis). The Syncephalastraceae family consists of fungi genera
Dichotomocladium (e.g., D. elegans); Fennellomyces (e.g., F.
gigacellularis); Mycocladus (e.g., M. blakesleeanus); Phascolomyces
(e.g., P. articulosus); Protomycocladus (e.g., P. faisalabadensis);
Syncephalastrum (e.g., S. monosporum); Thamnostylum (e.g., T.
lucknowense); Zychaea (e.g., Z. mexicana). Finally, the
Umbelopsidaceae family consists of fungi genus Umbelopsis (e.g., U.
angularis).
[0062] As used herein, the term "pharmaceutically acceptable
carrier" includes any and all pharmaceutical grade solvents,
buffers, oils, lipids, dispersion media, coatings, isotonic and
absorption facilitating agents and the like that are compatible
with the active ingredient. These pharmaceutically acceptable
carriers can be prepared from a wide range of pharmaceutical grade
materials appropriate for the chosen mode of administration, e.g.,
injection, intranasal administration, oral administration, etc. For
the purposes of this invention, the terms "pharmaceutical" or
"pharmaceutically acceptable" further refer to compositions
formulated by known techniques to be non-toxic and, when desired,
used with carriers or additives that can be safely administered to
humans. In a specific embodiment, the term "pharmaceutically
acceptable" means approved by a regulatory agency of the Federal or
a state government or listed in the U.S. Pharmacopeia or other
generally recognized pharmacopeia for use in animals, and more
particularly in humans. The term "carrier" refers to a diluent,
adjuvant, excipient, or vehicle with which the therapeutic is
administered. Such pharmaceutical carriers can be sterile liquids,
such as water and oils, including those of petroleum, animal,
vegetable or synthetic origin, such as peanut oil, soybean oil,
mineral oil, sesame oil and the like. Water is a preferred carrier
when the pharmaceutical composition is administered intravenously.
Saline solutions and aqueous dextrose and glycerol solutions can
also be employed as liquid carriers, particularly for injectable
solutions. Suitable pharmaceutical excipients include starch,
glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk,
silica gel, sodium stearate, glycerol monostearate, talc, sodium
chloride, dried skim milk, glycerol, propylene, glycol, water,
ethanol and the like.
[0063] The term "immunogenic amount" as used herein refers an
effective amount of a particular epitope of a polypeptide of the
invention or a fragment or variant thereof that can induce the host
immune response against the polypeptide or the infectious agent
expressing the polypeptide. This amount is generally in the range
of 20 .mu.g to 10 mg of antigen per dose of vaccine and depends on
the subject to be treated, capacity of the subject's immune system
to synthesize antibodies, and the degree of protection desired. The
precise amount of immunogen required can be calculated by various
methods such as, for example, antibody titration. The term
effective amount refers to an amount of a compound or compositions
that is sufficient to provide a desired result. Thus, as used to
describe a vaccine, an effective amount refers to an amount of a
compound or composition (e.g., an antigen) that is sufficient to
produce or elicit a protective immune response. An effective amount
with respect to an immunological composition is an amount that is
sufficient to elicit an immune response, whether or not the
response is protective.
[0064] The present invention, in part, relates to the discovery
that FTR gene product is required for full virulence of a fungal
pathogen such as R. oryzae in hematogenous dissemination or
mucormycosis. Moreover, inhibition of FTR polypeptide formation in
a host having mucormycosis conferred prolonged survival. As
described herein, abrogation of FTR1 function resulted in
diminished iron uptake and diminished virulence in vivo, and
passive immunization with anti-Ftr1p antibody significantly
improved survival in infected mice. As disclosed herein, passive
immunotherapy against FTR1 is a viable strategy to improve outcomes
of these deadly infections.
[0065] Accordingly, different compositions are disclosed herein for
effective inhibition of FTR molecule and/or its function in
treating mucormycosis or other fungal diseases. These inhibitory
compositions include vaccines, antisense, siRNA, antibodoy or any
other compositions capable of effectively targeting and inhibiting
the function of FTR. Such compositions will reduce and/or prevent
the growth of the fungus in the infected tissues and will cause
organism death. The compositions of the invention also are useful
in prophylactic settings to decrease onset and/or prevent infection
from occurring. In addition, any of the FTR inhibitory compositions
disclosed herein can further be supplemented and/or combined with
other known antifungal therapies including, for example,
Amphotericin B or iron chelators. Exemplary iron chelators include
Deferiprone and Deferasirox.
[0066] In one aspect, the invention provides a vaccine composition
having an FTR polypeptide or an antigenic fragment or variant of
the polypeptide. The vaccine composition also can include an
adjuvant. In certain embodiments, the vaccine composition of the
invention has an FTR polypeptide (SEQ ID NO: 2) shown in FIG. 2 or
an antigenic fragment of the FTR polypeptide (e.g., REGLE motif), a
pharmaceutically acceptable carrier and/or an adjuvant. Similarly,
the vaccine composition has an FTR polypeptide corresponding to the
nucleotides shown in FIG. 15-18. The formulation of the vaccine
composition of the invention is effective in inducing protective
immunity in a subject by stimulating both specific humoral
(neutralizing antibodies) and effector cell mediated immune
responses against fungal pathogens' FTRs. The vaccine composition
of the invention is also used in the treatment or prophylaxis of
fungal infections such as, for example, mucormycosis.
[0067] The vaccine of the present invention will contain an
immunoprotective quantity of FTR antigens and is prepared by
methods well known in the art. The preparation of vaccines is
generally described in, for example, M. F. Powell and M. J. Newman,
eds., "Vaccine Design (the subunit and adjuvant approach)," Plenum
Press (1995); A. Robinson, M. Cranage, and M. Hudson, eds.,
"Vaccine Protocols (Methods in Molecular Medicine)," Humana Press
(2003); and D. Ohagan, ed., "Vaccine Ajuvants: Preparation Methods
and Research Protocols (Methods in Molecular Medicine)," Humana
Press (2000).
[0068] FTR polypeptide, and peptide fragments or variants thereof
can include immunogenic epitopes, which can be identified using
methods known in the art and described in, for example, Geysen et
al. Proc. Natl. Acad. Sci. USA 81: 3998 (1984)). Briefly, hundreds
of overlapping short peptides, e.g., hexapeptides, can be
synthesized covering the entire amino acid sequence of the target
polypeptide (i.e., FTR). The peptides while still attached to the
solid support used for their synthesis are then tested for
antigenicity by an ELISA method using a variety of antisera.
Antiserum against FTR protein can be obtained by known techniques,
Kohler and Milstein, Nature 256: 495-499 (1975), and can be
humanized to reduce antigenicity, see, for example, U.S. Pat. No.
5,693,762, or produced in transgenic mice leaving an unrearranged
human immunoglobulin gene, see, for example, U.S. Pat. No.
5,877,397. Once an epitope bearing hexapeptide reactive with
antibody raised against the intact protein is identified, the
peptide can be further tested for specificity by amino acid
substitution at every position and/or extension at both C and/or N
terminal ends. Such epitope bearing polypeptides typically contain
at least six to fourteen amino acid residues of SEQ ID NO: 2, and
can be produced, for example, by polypeptide synthesis using
methods well known in the art or by fragmenting an FTR polypeptide.
With respect to the molecule used as immunogens pursuant to the
present invention, those skilled in the art will recognize that the
FTR polypeptide can be truncated or fragmented without losing the
essential qualities as an immunogenic vaccine. For example, FTR
polypeptide can be truncated to yield an N-terminal fragment by
truncation from the C-terminal end with preservation of the
functional properties of the molecule as an immunogen. Similarly,
C-terminal fragments can be generated by truncation from the
N-terminal end with preservation of the functional properties of
the molecule as an immunogen. Other modifications in accord with
the teachings and guidance provided herein can be made pursuant to
this invention to create other FTR polypeptide functional
fragments, immunogenic fragments, variants, analogs or derivatives
thereof, to achieve the therapeutically useful properties described
herein with the native protein.
[0069] The vaccine compositions of the invention further contain
conventional pharmaceutical carriers. Suitable carriers are well
known to those of skill in the art. These vaccine compositions can
be prepared in liquid unit dose forms. Other optional components,
e.g., pharmaceutical grade stabilizers, buffers, preservatives,
excipients and the like can be readily selected by one of skill in
the art. However, the compositions can be lyophilized and
reconstituted prior to use. Alternatively, the vaccine compositions
can be prepared in any manner appropriate for the chosen mode of
administration, e.g., intranasal administration, oral
administration, etc. The preparation of a pharmaceutically
acceptable vaccine, having due regard to pH, isotonicity, stability
and the like, is within the skill of the art.
[0070] The immunogenicity of the vaccine compositions of the
invention can further be enhanced if the vaccine further comprises
an adjuvant substance. Various methods of achieving adjuvant effect
for the vaccine are known. General principles and methods are
detailed in "The Theory and Practical Application of Adjuvants",
1995, Duncan E. S. Stewart-Tull (ed.), John Wiley & Sons Ltd,
ISBN 0-471-95170-6, and also in "Vaccines: New Generation
Immunological Adjuvants", 1995, Gregoriadis G et al. (eds.), Plenum
Press, New York, ISBN 0-306-45283-9, both of which are hereby
incorporated by reference herein.
[0071] Preferred adjuvants facilitate uptake of the vaccine
molecules by antigen presenting cells (APCs), such as dendritic
cells, and activate these cells. Non-limiting examples are selected
from the group consisting of an immune targeting adjuvant; an
immune modulating adjuvant such as a toxin, a cytokine, and a
mycobacterial derivative; an oil formulation; a polymer; a micelle
forming adjuvant; a saponin; an immunostimulating complex matrix
(ISCOM.RTM. matrix); a particle; DDA (dimethyldioctadecylammonium
bromide); aluminium adjuvants; DNA adjuvants; and an encapsulating
adjuvant. Liposome formulations are also known to confer adjuvant
effects, and therefore liposome adjuvants are included according to
the invention.
[0072] Another aspect of the invention relates to a vaccine
composition having a vector containing a nucleotide sequence that
is substantially complimentary to at least 12 contiguous
nucleotides of FTR sequence (e.g., SEQ ID NO: 1) shown in FIGS. 1,
15-18, a transcription promoter, and a transcription terminator;
wherein the promoter is operably linked to the FTR nucleotide
sequence, and wherein the FTR nucleotide sequence is operably
linked to the transcription terminator. The preparation of DNA
vaccines is generally described in, for example, M. Saltzman, H.
Shen, and J. Brandsma, eds., "DNA Vaccines (Methods in Molecular
Medicine)," Humana Press (2006); H. Ertl, ed., "DNA Vaccines,"
Kluwer Academic/Plenum Publishers (2003). In one embodiment, the
vaccine composition further contains pharmaceutically acceptable
carrier and/or adjuvant. Combination of DNA vaccines with adjuvants
have been shown to induce a stronger and more specific immune
response in human (Hokey et al. Springer Semin Immun 28:267-279
(2006)). In general, the potency of DNA vaccines increases when
combined with adjuvants that can provide additional immune stimuli.
For example, chemokines such as, for example, MIP-1.alpha. when
used as adjuvants for DNA vaccines have the ability to recruit a
variety of cells including professional antigen presenting cells
(APCs) to the immunization site. The requirement of APCs to the
sites such as muscle where there are relatively low levels of APCs
will greatly increase the potency of DNA vaccines for intramuscular
injections. Cytokines such as, for example, GM-CSF when used as
adjuvant for DNA vaccines can recruit dendritic cells and promote
their survival at the immunization site. Molecular adjuvants such
as, for example, Fas that induce cell death can also increase the
potency and efficacy of DNA vaccines. Adjuvant-mediated apoptosis
and necrosis have been shown to provide more antigens to APCs.
Other molecules such as for example, poly(lactide-co-glycolide)
(PLG) and heat shock proteins have also been shown to act as
adjuvants for DNA vaccines. It is well known to those skilled in
the art that adjuvants can be combined with DNA vaccines as intact
molecules such as, for example, intact molecules, or as vectors
expressing such molecules; for example, plasmids expressing
GM-CSF.
[0073] In addition to vaccination of subjects susceptible to fungal
infections such as mucormycosis, the vaccine compositions of the
present invention can be used to treat, immunotherapeutically,
subjects suffering from a variety of fungal infections.
Accordingly, vaccines that contain one or more of FTR
polynucleotides, polypeptides and/or antibody compositions
described herein in combination with adjuvants, and that act for
the purposes of prophylactic or therapeutic use, are also within
the scope of the invention. In an embodiment, vaccines of the
present invention will induce the body's own immune system to seek
out and inhibit fungal FTR molecules.
[0074] Another aspect of the invention relates to a pharmaceutical
composition for treating or preventing a fungal condition having an
antisense, a small interfering RNA or antibody inhibitor of FTR
selected from the group consisting of a nucleotide sequence that is
substantially complimentary to a portion of an FTR sequence; a
nucleotide sequence that is substantially complimentary to at least
12 contiguous nucleotide bases of FTR sequence; a nucleotide RNAi
sequence that is substantially complimentary to at least 18
contiguous nucleotide bases of FTR sequence; an antibody or
antibody fragment thereof that specifically binds to an FTR
nucleotide sequence, polypeptide or a fragment thereof; and a
pharmaceutically acceptable excipient or carrier. In one
embodiment, the pharmaceutical composition further includes an
adjuvant.
[0075] Antisense nucleic acid molecules of the invention can be
designed using the nucleotide sequences of SEQ ID NO: 1, FIGS.
15-18, their complementary strands, and/or a portion or variant
thereof, constructed using enzymatic ligation reactions by
procedures known in the art of the genetic engineering. For
example, an antisense nucleic acid molecule (e.g., an antisense
oligonucleotide) can be chemically synthesized using naturally
occurring nucleotides or variously modified nucleotides designed to
hybridize with a control region of a gene (e.g., promoter,
enhancer, or transcription initiation region) to inhibit the
expression of the FTR gene through triple-helix formation.
Alternatively, the antisense nucleic acid molecule can be designed
to hybridize with the transcript of a gene (i.e., mRNA), and thus
inhibit the translation of FTR by inhibiting the binding of the
transcript to ribosomes. The antisense methods and protocols are
generally described in, for example, C. Stein, A. Krieg, eds.,
"Applied Antisense Oligonucleotide Technology" Wiley-Liss, Inc.
(1998); or U.S. Pat. Nos. 5,965,722; 6,339,066; 6,358,931; and
6,359,124.
[0076] The present invention also provides, as antisense molecules,
nucleic acids or nucleotide sequences that contain a fragment,
portion or variant that hybridizes under high stringency conditions
to a nucleotide sequence including a nucleotide sequence selected
from SEQ ID NO: 1, FIGS. 15-18, or their complementary strands. The
nucleic acid fragments of the invention are at least about 12,
generally at least about 15, 18, 21, or 25 nucleotides, and can be
40, 50, 70, 100, 200, or more nucleotides in length. Longer
fragments, for example, 30 or more nucleotides in length, which
encode antigenic polypeptides described hereinafter, are
particularly useful, such as for the generation of antibodies.
[0077] Particular small nucleic acid molecules that are of use in
the invention are short stretches of double stranded RNA that are
known as short interfering RNAs (siRNAs). These interfering RNA
(RNAi) allow for the selective inhibition of FTR gene function in
vivo. In the present invention, RNAi has been used to knock-down
FTR expression in a DKA mouse model of mucormycosis infection, and
in doing so it demonstrates a dramatic effect on survival and
protection against the infection. The RNAi approach relies on an
innate cellular response to combat viral infection. In this
process, double stranded mRNAs are recognized and cleaved by the
dicer RNase resulting in 21-23 nucleotide long stretches of RNAi.
These RNAis are incorporated into and unwound by the RNA-inducing
silencing complex (RISC). The single antisense strand then guides
the RISC to mRNA containing the complementary sequence resulting in
endonucleolytic cleavage of the mRNA, see Elbashir et al. (Nature
411; 494-498 (2001)). Hence, this technique provides a means for
the targeting and degradation of FTR mRNA in vivo in fungal
pathogen infecting a subject.
[0078] The present invention further provides inhibitory antibodies
(monoclonal or polyclonal) and antigen-binding fragments thereof,
that are capable of binding to and inhibition of FTR function. The
antibody inhibitors of the present invention can bind to FTR, or a
portion, fragment, variant thereof, and interfere with or inhibit
the protein function, i.e., iron transportation. Furthermore, such
antibodies can bind to FTR and interfere with or inhibit the proper
localization or conformation of the protein within the fungal
membrane. An antibody, or antigen-binding fragment thereof, is said
to "specifically bind," "immunologically bind," and/or is
"immunologically reactive" to an FTR polypeptide of the invention
if it reacts at a detectable level with the FTR polypeptide, and
does not react detectably with unrelated polypeptides under similar
conditions.
[0079] In addition, recombinant antibodies, such as chimeric and
humanized antibodies, including both human and non-human portions,
which can be made using standard recombinant DNA techniques, are
within the scope of the invention. Also included within the term
"antibody" are fragments, such as the Fab, F(ab'). The FTR specific
monoclonal antibodies of the invention have specific binding
activity to FTR, or a functional fragment thereof, in pathogenic
fungi responsible for mucormycosis.
[0080] Monoclonal antibodies can be prepared using methods such as,
for example, hybridoma, recombinant, phage display, and
combinatorial antibody technologies or a combination thereof. The
techniques and protocols for production of monoclonal antibodies
are generally described in, for example, Harlow and lane, eds.,
"Antibodies: A laboratory Manual," Cold Spring harbor Laboratory
Press (1999); Harlow et al., Using Antibodies: A Laboratory Manual,
Cold Spring harbor Laboratory Press (1999); C. Borrebaeck, ed.,
Antibody Engineering: A Practical Guide, W.H. Freeman and Co.,
Publishers, pp. 130-120 (1991).
[0081] Moreover, portions or fragments or variants of the FTR
nucleotide sequence identified herein (and the corresponding
complete gene sequence) can be used in various ways as
polynucleotide reagents. For example, these sequences can be used
to identify and express recombinant polypeptides for analysis,
characterization, or therapeutic use. The sequences can
additionally be used as reagents in the screening and/or diagnostic
assays described hereinafter, and can also be included as
components of kits (e.g., diagnostic kits) for use in the screening
and/or diagnostic assays.
[0082] The compositions of the present invention in inhibiting FTR
can be applied to subjects who are suffering from a wide variety of
fungal infections including zygomycosis and mucormycosis. The
compositions of the invention can further be supplemented with
other antifungal agents (e.g., Amphotericin, Deferiprone,
Deferasirox). Alternatively, the compositions of the invention can
be applied prophylactically to all subjects who are at high risk of
developing mucormycosis or other fungal infections (e.g., via
active immunization). This would not be considered an over
treatment giving the high mortality and morbidity of mucormycosis
in view of the current antifungal and surgical debridement
treatment.
[0083] Further, the invention is also directed to host cells in
which immunogenic FTR polypeptides or FTR inhibitory nucleotides
(e.g., RNAi, antisense molecules) can be produced. The term "host
cell" is understood to refer not only to the particular subject
cell but also to the progeny or potential progeny of the foregoing
cell. A host cell can be any prokaryotic (e.g., E. coli) or
eukaryotic cell (e.g., yeast, insect cells, or mammalian cells,
such as CHO or COS cells). Other suitable host cells are known to
those skilled in the art. Vectors expressing such immunogenic
inhibitory molecules can be introduced into prokaryotic or
eukaryotic cells via conventional transfection or transformation
techniques (see, Sambrook et al., Molecular Cloning: A Laboratory
Manual, Cold Spring Harbor Laboratories, Cold Spring Harbor, N.Y.,
1989).
[0084] According to another aspect of the present invention, any of
the above-described compositions can be used for treating or
prevention of a fungal condition. A fungal condition is an aberrant
condition or infection causes by a pathogenic fungus. Symptoms of a
fungal condition that can be ameliorated by a method of the
invention include, for example, fever, chills, night sweats,
anorexia, weight loss, malaise, depression and lung, skin or other
lesions. Other symptoms or characteristic manifestations include,
for example, dissemination from a primary focus, acute or subacute
presentations, progressive pneumonia, fungemia, manifestations of
extrapulmonary dissemination, chronic meningitis, progressive
disseminated histoplasmosis as a generalized involvement of the
reticuloendothelial system (liver, spleen, bone marrow) and
blastomycosis as single or multiple skin lesions. Effective
treatment of an individual with a fungal condition, for example,
will result in a reduction one or more of such symptoms in the
treated individual. Numerous other clinical symptoms of fungal
conditions are well known in the art and also can be used as a
measure of amelioration or reduction in the severity of a fungal
condition using the methods of the invention described herein.
[0085] Diagnosis of a fungal condition can be confirmed by
isolating causative fungi from, for example, sputum, urine, blood,
bone marrow, or specimens from infected tissues. For example,
fungal infections can be diagnosed histopathologically with a high
degree of reliability based on distinctive morphologic
characteristics of invading fungi and/or by immunohistochemistry
and the like selective for identifying antigens. Assessment of the
activity of the infection also can be based on cultures taken from
many different sites, fever, leukocyte counts, clinical and
laboratory parameters related to specific involved organs (eg,
liver function tests), and immunoserologic tests. The clinical
significance of positive sputum cultures also can be corroborated
by confirmation of tissue invasion.
[0086] Fungal infection, or mycoses, of humans and animals include,
for example, superficial fungal infections that affect the outer
layers of skin; fungal infections of the mucous membranes including
the mouth (thrush), vaginal and anal regions, such as those caused
by Candida albicans, and fungal infections that affect the deeper
layers of skin and internal organs are capable of causing serious,
often fatal illness, such as those caused by, for example, Rhizopus
oryzae. Fungal infections are well known in the art and include,
for example, zygomycosis, mucormycosis, aspergillosis,
cryptococcosis, candidiasis, histoplasmosis, coccidiomycosis,
paracoccidiomycosis, fusariosis (hyalohyphomycoses), blastomycosis,
penicilliosis or sporotrichosis. These and other fungal infections
can be found described in, for example, Merck Manual, Sixteenth
Edition, 1992, and in Spellberg et al., Clin. Microbio. Rev.
18:556-69 (2005).
[0087] The fungal conditions caused by fungi of the genus Candida,
candidiasis, can occur, for example, in the skin and mucous
membranes of the mouth, respiratory tract and/or vagina as well as
invade the bloodstream, especially in immunocompromised
individuals. Candidiasis also is known in the art as candidosis or
moniliasis. Exemplary species of the genus Candida include, for
example, Candida albicans, Candida krusei, Candida tropicalis,
Candida glabrata and Candida parapsilosis.
[0088] The fungal diseases caused by the genus Aspergillus include,
for example, allergic aspergillosis, which affects asthma, cystic
fibrosis and sinusitis patients; acute invasive aspergillosis,
which shows increased incidence in patients with weakened immunity
such as in cancer patients, patients undergoing chemotherapy and
AIDS patients; disseminated invasive aspergillosis, which is
widespread throughout the body, and opportunistic Aspergillus
infection, which is characterized by inflammation and lesions of
the ear and other organs. Aspergillus is a genus of around 200
fungi. Aspergillus species causing invasive disease include, for
example, Aspergillus fumigatus and Aspergillus flavus. Aspergillus
species causing allergic disease include, for example, Aspergillus
fumigatus and Aspergillus clavatus. Other exemplary Aspergillus
infectious species include, for example, Aspergillus terreus and
Aspergillus nidulans.
[0089] The fungal conditions such as, for example, zygomycosis and
mucormycosis which are caused by saprophytic mould fungi include
rinocerebral mucormycosis, pulmonary mucormycosis, gastrointestinal
mucormycosis, disseminated mucormycosis, bone mucormycosis,
mediastinum mucormycosis, trachea mucormycosis, kidney
mucormycosis, peritoneum mucormycosis, superior vena cava
mucormycosis or external otitis mucormycosis. Infectious agents
causing mucormycosis are of the order Mucorales which include
species from Rhizopus genus such as, for example, Rhizopus oryzae
(Rhizopus arrhizus), Rhizopus microsporus var. rhizopodiformis; or
species from Absidia genus such as, for example, Absidia
corymbifera; or species from Apophysomyces genus such as, for
example, Apophysomyces elegans; or species from Mucor genus such
as, for example, Mucor amphibiorum; or species from Rhizomucor
genus such as, for example, Rhizomucor pusillus; or species from
Cunninghamell genus (in the Cunninghamellaceae family) such as, for
example, Cunninghamella bertholletiae.
[0090] Various methods are described herein for effective
inhibition of FTR molecule and/or its function in treatment of
mucormycosis and other fungal diseases. These inhibiting methods
involve vaccines, antisense, siRNA, antibodoy, or any other
compositions capable of effectively targeting and inhibiting the
function of FTR. Such methods will reduce or prevent the growth of
the fungus in the infected tissues by inhibiting the main iron
transporter that functions in supplying the pathogenic organism
with iron. An immunotherapeutic inhibition of iron transportation
using a soluble FTR polypeptide or functional fragment or a variant
thereof is useful in this context because: (i) the morbidity and
mortality associated with mucormycosis, for example, continues to
increase, even with currently available antifungal therapy; (ii) a
rising incidence of antifungal resistance is associated with the
increasing use of antifungal agents; iii) the population of
patients at risk for serious zygomycosis, mucormycosis, candidosis,
or aspergillosis, for example, is well-defined and very large, and
includes, e.g., post-operative patients, transplant patients,
cancer patients, low birth weight infants, subjects with diabetes
ketoacidosis (DKA) and other forms of metabolic acidosis, subjects
receiving treatment with corticosteroids, subjects with
neutropenia, trauma, burns, and malignant hematological disorders,
and subjects receiving deferoxamine chelation-therapy or
hemodialysis; and iv) a high percentage of the patients who develop
serious fungal infections are not neutropenic, and thus can respond
to a vaccine or a competitive polypeptide or compound inhibitor.
For these reasons, Zygomycetes or Candida, for example, are fungal
targets for passive immunotherapy, active immunotherapy or a
combination of passive or active immunotherapy.
[0091] Mechanistically, FTR polypeptide physically complexes with
copper oxidase in yeast, transports ferric iron nearly
simultaneously to the oxidation step. In subjects with DKA, low pH
conditions cause proton-mediated displacement of ferric iron
(Fe.sup.3+) from serum carrier molecules, including transferrin
(T). See FIG. 4. Fe.sup.3+ is then reduced at the cell surface to
ferrous iron (Fe.sup.2+). In contrast, deferoxamine (D) directly
chelates iron from transferrin, resulting in ferrioxamine
(iron-deferoxamine complex). Ferrioxamine then binds to
unidentified receptor(s) on the surface of fungi, e.g.,
Zygomycetes. The fungus then liberates ferrous iron from
ferrioxamine by reduction at the cell surface. In both cases,
ferrous iron is reoxidized back to ferric iron by copper oxidase
(Cu-oxidase).
[0092] Therefore, the methods of the present invention in
inhibiting FTR can be applied to subjects who are suffering from a
wide variety of fungal infections including zygomycosis and
mucormycosis. The methods of the invention can further be
supplemented with other antifungal agents (e.g., Amphotericin,
Deferiprone, Deferasirox). Alternatively, the methods of the
invention can be applied prophylactically to all subjects who are
at high risk of developing mucormycosis or other fungal infections
(e.g., via active immunization). This would not be considered an
over treatment giving the high mortality and morbidity of
mucormycosis in view of the current antifungal and surgical
debridement treatment.
[0093] Accordingly, in one aspect, the invention provides a method
of treating or preventing disseminated mucormycosis or other fungal
diseases. The method includes administering an immunogenic amount
of a vaccine having an FTR polypeptide (SEQ ID NO: 2) shown in FIG.
2, or an antigenic or immunogenic fragment of the polypeptide or a
variant thereof in a pharmaceutically acceptable medium. The
preparation of vaccines is generally described in, for example, M.
F. Powell and M. J. Newman, eds., "Vaccine Design (the subunit and
adjuvant approach)," Plenum Press (1995); A. Robinson, M. Cranage,
and M. Hudson, eds., "Vaccine Protocols (Methods in Molecular
Medicine)," Humana Press (2003); and D. Ohagan, ed., "Vaccine
Ajuvants: Preparation Methods and Research Protocols (Methods in
Molecular Medicine)," Humana Press (2000).
[0094] The FTR polypeptide, or an antigenic or immunogenic fragment
of the polypeptide or a variant thereof can be derived from
different pathogenic fungal species of Zygomycetes such as Rhizopus
oryzae (Rhizopus arrhizus), Rhizopus microsporus var.
rhizopodiformis, Absidia corymbifera, Apophysomyces elegans, Mucor
species, Rhizomucor pusillus and Cunninghamella spp
(Cunninghamellaceae family); or from different Candida species such
as Candida albicans, Candida krusei, Candida tropicalis, Candida
glabrata, and Candida parapsilosis; or from different Aspargillus
species such as Aspargillus fumigatus, Aspargillus niger,
Aspargillus flavus, Aspargillus terreus, and Aspargillus nidulans.
Administration of a vaccine of the invention will result in
inhibition of the growth and/or virulence of fungal pathogen in a
subject.
[0095] The sequence homology of, for example, FTR of R. oryzae with
that of S. cerevisiae and C. albicans are described further below
in Example I. Given the teachings and guidance provided herein,
those skilled in the art will understand that the vaccines and
methods of the invention can be applied to the treatment of
mucormycosis or other fungal infections alike. Similarly, given the
teachings and methods described herein, those skilled in the art
also will understand that the vaccines and methods of the invention
also can be applied to other pathogens having iron permease
polypeptides with similar immunogenicity, sequence and/or
structural homology to the FTR protein described herein, including
fungus, bacteria and the like.
[0096] The vaccine compositions are administrated in a manner
compatible with the dosage formulation and in such amount as will
be prophylactically effective with or without an adjuvant. The
quantity to be administered, which is generally in the range of 1
to 10 mg, preferably 1 to 1000 .mu.g of antigen per dose, depends
on the subject to be treated, capacity of the subject's immune
system to synthesize antibodies, and the degree of protection
desired. Precise amounts of active ingredient required to be
administered can depend on the judgement of the practitioner and
can be peculiar to each subject. Moreover, the amount of
polypeptide in each vaccine dose is selected as an immunogenic
amount which induces an immunoprotective response. Particularly
useful immunogenic amounts include an amount of FTR polypeptide
that also is devoid of significant, adverse side effects. Such
amount will vary depending upon the immunogenic strength of an FTR
polypeptide selected for vaccination. Useful immunogenic amounts of
an FTR polypeptide or immunogenic fragment thereof include, for
example, doses ranging from about 1-1000 .mu.g. In certain
embodiments, useful immunogenic amounts of an FTR polypeptide or
immunogenic fragment thereof include about 2-100 .mu.g, and
particularly useful dose ranges can range from about 4-40 .mu.g,
including for example, 5, 6, 7, 8, 9, 10, 12, 15, 20, 25, 30, 35
and 40 .mu.g as well as all values in between the above exemplified
amounts. An optimal immunogenic amount for a selected FTR
polypeptide vaccine of the invention can be ascertained using
methods well known in the art such as determination of antibody
titres and other immune responses in subjects as exemplified
previously. Following an initial vaccination, subjects receive a
boost in about 3-4 weeks. Vaccine delivery methods is further
described, for example, in S. Cohen and H. Bernstein, eds.,
"Microparticulate Systems for the Delivery of Proteins and Vaccines
(Drugs and The Pharmaceutical Sciences)," Vol. 77, Marcel Dekker,
Inc. (1996). Encapsulation within liposomes is described, for
example, by Fullerton, U.S. Pat. No. 4,235,877. Conjugation of
proteins to macromolecules is disclosed, for example, by Likhite,
U.S. Pat. No. 4,372,945 and by Armor et al., U.S. Pat. No.
4,474,757.
[0097] Furthermore, the vaccine compositions of the present
invention include DNA vaccines encoding antigenic FTR molecules. As
mentioned earlier, the preparation of DNA vaccines is generally
described in, for example, M. Saltzman, H. Shen, and J. Brandsma,
eds., "DNA Vaccines (Methods in Molecular Medicine)," Humana Press
(2006); H. Ertl, ed., "DNA Vaccines," Kluwer Academic/Plenum
Publishers (2003). DNA vaccines can be introduced into the host
cells of the subject by a variety of expression systems. These
expression systems include prokaryotic, mammalian, and yeast
expression systems. For example, one approach is to utilize a viral
vector, such as vaccinia virus incorporating the new genetic
material, to innoculate the host cells. Alternatively, the genetic
material can be incorporated in a vector or can be delivered
directly to the host cells as a "naked" polynucleotide, i.e. simply
as purified DNA. In addition, the DNA can be stably transfected
into attenuated bacteria such as Salmonella typhimurium. When a
subject is orally vaccinated with the transformed Salmonella, the
bacteria are transported to Peyer's patches in the gut (i.e.,
secondary lymphoid tissues), which then stimulate an immune
response. In addition, DNA vaccines can be delivered by variety of
well-known delivery vehicles such as, for example, lipid
monolayers, bilayers, or vesicles such as liposomes. Agents such as
saponins and block-copolymers, which are commonly used to
permeablilize cells, can also be used with DNA vaccines. As
described earlier, DNA vaccine compositions of the invention can
include pharmaceutically acceptable carriers and/or adjuvants.
[0098] The DNA vaccine compositions as described herein can be
administered by a variety of routes contemplated by the present
invention. Such routes include intranasal, oral, rectal, vaginal,
intramuscular, intradermal and subcutaneous administration.
[0099] The DNA vaccine compositions for parenteral administration
include sterile aqueous or non-aqueous solutions, suspensions or
emulsions, the protein vaccine, and an adjuvant as described
herein. The composition can be in the form of a liquid, a slurry,
or a sterile solid which can be dissolved in a sterile injectable
medium before use. The parenteral administration is preferably
intramuscular. Intramuscular inoculation involves injection via a
syringe into the muscle. This injection can be via a syringe or
comparable means. The vaccine composition can contain a
pharmaceutically acceptable carrier and/or an adjuvant.
Alternatively, the present vaccine compositions can be administered
via a mucosal route, in a suitable dose, and in a liquid form. For
oral administration, the vaccine composition can be administered in
liquid, or solid form with a suitable carrier.
[0100] The invention also provides a method of treating or
preventing a fungal condition in a subject in need thereof,
including exposing said fungi to an antisense against FTR. In one
embodiment, the antisense includes a nucleotide sequence that is
substantially complimentary to a portion of an FTR nucleotide
sequence. In another embodiment the nucleotide sequence of the
antisense is substantially complimentary to at least 12 contiguous
nucleotide bases of FTR sequence.
[0101] The antisense oligonucleotides used in accordance with this
invention can be conveniently and routinely made through the
well-known technique of solid phase synthesis. Equipment for such
synthesis is sold by several vendors including Applied Biosystems.
Any other means for such synthesis can also be employed, however
the actual synthesis of the oligonucleotides are well within the
talents of those skilled in the art. It is also well known to use
similar techniques to prepare other oligonucleotides such as the
phosphorothioates and alkylated derivatives. As described earlier,
an antisense nucleic acid molecule (e.g., an antisense
oligonucleotide) can be chemically synthesized using naturally
occurring nucleotides or variously modified nucleotides designed to
hybridize with a control region of a gene (e.g., promoter,
enhancer, or transcription initiation region) to inhibit the
expression of the FTR gene through triple-helix formation.
Alternatively, the antisense nucleic acid molecule can be designed
to hybridize with the transcript of FTR (i.e., mRNA), and thus
inhibit the translation of FTR by inhibiting the binding of the
transcript to ribosomes. The antisense methods and protocols are
generally described in, for example, C. Stein, A. Krieg, eds.,
"Applied Antisense Oligonucleotide Technology" Wiley-Liss, Inc.
(1998); or U.S. Pat. Nos. 5,965,722; 6,339,066; 6,358,931; and
6,359,124.
[0102] The antisense compositions of the invention can be delivered
to a subject in need thereof with variety of means known in the
art. For example, microparticles such as polystyrene
microparticles, biodegradable particles, liposomes or microbubbles
containing the antisense compositions in releasable form can be
used for direct delivery of the compositions into tissues via
injection. In some embodiments of the invention, the antisense
oligonucleotides can be prepared and delivered in a viral vector
such as hepatitis B virus (see, for example, Ji et al., J. Viral
Hepat. 4:167 173 (1997)); in adeno-associated virus (see, for
example, Xiao et al. Brain Res. 756:76 83 (1997)); or in other
systems including but not limited to an HVJ(Sendai virus)-liposome
gene delivery system (see, for example, Kaneda et al. Ann. N.Y.
Acad. Sci. 811:299 308 (1997)); a "peptide vector" (see, for
example, Vidal et al. CR Acad. Sci III 32):279 287 (1997)); as a
gene in an episomal or plasmid vector (see, for example, Cooper et
al. Proc. Natl. Acad. Sci. U.S.A. 94:6450 6455 (1997), Yew et al.
Hum Gene Ther. 8:575 584 (1997)); as a gene in a peptide-DNA
aggregate (see, for example, Niidome et al. J. Biol. Chem.
272:15307 15312 (1997)); as "naked DNA" (see, for example, U.S.
Pat. No. 5,580,859 and U.S. Pat. No. 5,589,466); in lipidic vector
systems (see, for example, Lee et al. Crit Rev Ther Drug Carrier
Syst. 14:173 206 (1997)); polymer coated liposomes (Marin et al.,
U.S. Pat. No. 5,213,804 issued Can 25, 1993; Woodle et al., U.S.
Pat. No. 5,013,556 issued Can 7, 1991); cationic liposomes (Epand
et al., U.S. Pat. No. 5,283,185 issued Feb. 1, 1994; Jessee, J. A.
U.S. Pat. No. 5,578,475 issued Nov. 26, 1996; Rose et al, U.S. Pat.
No. 5,279,833 issued Jan. 18, 1994; Gebeyehu et al., U.S. Pat. No.
5,334,761 issued Aug. 2, 1994); gas filled microspheres (Unger et
al., U.S. Pat. No. 5,542,935 issued Aug. 6, 1996), ligand-targeted
encapsulated macromolecules (Low et al. U.S. Pat. No. 5,108,921
issued Apr. 28, 1992; Curiel et al., U.S. Pat. No. 5,521,291 issued
Can 28, 1996; Groman et al., U.S. Pat. No. 5,554,386 issued Sep.
10, 1996; Wu et al., U.S. Pat. No. 5,166,320 issued Nov. 24,
1992).
[0103] The invention also provides a method of treating or
preventing a fungal condition in a subject in need thereof,
including exposing said fungi to a small interfering RNA against
FTR. In one embodiment, a nucleotide RNAi sequence that is
substantially complimentary to at least 18 contiguous nucleotide
bases of FTR sequence is used that is capable of binding to an FTR
nucleotide sequence or a fragment thereof.
[0104] Double-stranded RNA (dsRNA) also known as small-interfering
RNA (siRNA) induces sequence-specific post-transcriptional gene
silencing in many organisms by a process known as RNA interference
(RNAi). In the present invention, as described in Example 9, RNAi
has been prepared and used to knock-down FTR expression in a DKA
mouse model of mucormycosis infection, and in doing so it
demonstrates a dramatic effect on survival and protection against
the infection.
[0105] The siRNA is usually administered as a pharmaceutical
composition. The administration can be carried out by known
methods, wherein a nucleic acid is introduced into a desired target
cell in vitro or in vivo. Commonly used gene transfer techniques
include calcium phosphate, DEAE-dextran, electroporation and
microinjection and viral methods (Graham et al. Virol. 52, 456
(1973); McCutchan et al. J. Natl. Cancer Inst. 41, 351(1968); Chu
et al. Nucl. Acids Res. 15, 1311 (1987); Fraley et al. J. Biol.
Chem. 255, 10431 (1980); Capecchi, Cell 22, 479 (1980); and
cationic liposomes (Feigner et al. Proc. Natl. Acad. Sci USA 84,
7413 (1987)). Commercially available cationic lipid formulations
are e.g. Tfx 50.TM. (Promega) or Lipofectamin2000.TM.
(Invitrogen).
[0106] The invention also provides a method of treating or
preventing a fungal condition in a subject in need thereof,
including an antibody inhibitor of FTR. In one embodiment, the
antibody inhibitor of FTR is an antibody or antibody fragment that
specifically binds to an FTR nucleotide polypeptide or a fragment
thereof.
[0107] As described earlier the antibody inhibitors of FTR are are
capable of binding to and inhibition of FTR function. The antibody
inhibitors of the present invention can bind to FTR, a portion,
fragment, or variant thereof, and interfere with or inhibit the
protein function, i.e., iron transportation. These antibodies can
inhibit FTR by negatively affecting, for example, the protein's
proper membrane localization, folding or conformation, its
substrate binding ability.
[0108] The antibodies of the present invention can be generated by
any suitable method known in the art. Polyclonal antibodies against
FTR can be produced by various procedures well known in the art.
For example, an FTR peptide antigenic can be administered to
various host animals including, but not limited to, rabbits, mice,
rats, etc. to induce the production of sera containing polyclonal
antibodies specific for the antigen. Various adjuvants can be used
to increase the immunological response, depending on the host
species, and include but are not limited to, Freund's (complete and
incomplete), mineral gels such as aluminum hydroxide, alum
(alhydrogel), surface active substances such as lysolecithin,
pluronic polyols, polyanions, peptides, oil emulsions, keyhole
limpet hemocyanins, dinitrophenol, and potentially useful human
adjuvants such as BCG (bacille Calmette-Guerin) and corynebacterium
parvum. Such adjuvants are also well known in the art.
[0109] FTR peptide antigens suitable for producing antibodies of
the invention can be designed, constructed and employed in
accordance with well-known techniques. See, e.g., ANTIBODIES: A
LABORATORY MANUAL, Chapter 5, p. 75-76, Harlow & Lane Eds.,
Cold Spring Harbor Laboratory (1988); Czemik, Methods In
Enzymology, 201: 264-283 (1991); Merrifield, J. Am. Chem. Soc. 85:
21-49 (1962)). Monoclonal antibodies of the present invention can
be prepared using a wide variety of techniques known in the art
including the use of hybridoma, recombinant, and phage display
technologies, or a combination thereof. For example, monoclonal
antibodies can be produced using hybridoma techniques including
those known in the art and taught, for example, in Harlow et al.,
Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory
Press, 2nd ed. 1988); Hammerling, et al., in: Monoclonal Antibodies
and T-Cell Hybridomas 563-681 (Elsevier, N.Y., 1981) (said
references incorporated by reference in their entireties).
[0110] The antibodies of the present invention can also be
generated using various phage display methods known in the art. In
phage display methods, functional antibody domains are displayed on
the surface of phage particles which carry the polynucleotide
sequences encoding them. In a particular embodiment, such phage can
be utilized to display antigen binding domains expressed from a
repertoire or combinatorial antibody library (e.g., human or
murine). Phage expressing an antigen binding domain that binds the
antigen of interest can be selected or identified with antigen,
e.g., using labeled antigen or antigen bound or captured to a solid
surface or bead. Phage used in these methods are typically
filamentous phage including fd and M13 binding domains expressed
from phage with Fab, Fv or disulfide stabilized Fv antibody domains
recombinantly fused to either the phage gene III or gene VIII
protein. Examples of phage display methods that can be used to make
the antibodies of the present invention include those disclosed in
U.S. Pat. Nos. 5,698,426; 5,223,409; 5,403,484; 5,580,717;
5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908; 5,516,637;
5,780,225; 5,658,727; 5,733,743 and 5,969,108; each of which is
incorporated herein by reference in its entirety.
[0111] The antibodies of the invention can be assayed for
immunospecific binding by any method known in the art. The
immunoassays which can be used include but are not limited to
competitive and non-competitive assay systems using techniques such
as western blots, radioimmunoassays, ELISA (enzyme linked
immunosorbent assay), "sandwich" immunoassays, immunoprecipitation
assays, precipitin reactions, gel diffusion precipitin reactions,
immunodiffusion assays, agglutination assays, complement-fixation
assays, immunoradiometric assays, fluorescent immunoassays, protein
A immunoassays, to name but a few. Such assays are routine and well
known in the art. See, e.g., Sambrook, Fitsch & Maniatis,
Molecular Cloning: A Laboratory Manual, Second Edition Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989).
[0112] Specific binding can be determined by any of a variety of
measurements known to those skilled in the art including, for
example, affinity (K.sub.a or K.sub.d), association rate
(k.sub.on), dissociation rate (k.sub.off), avidity or a combination
thereof. Antibodies of the present invention can also be described
or specified in terms of their binding affinity to FTR. Preferred
binding affinities include those with a dissociation constant or
K.sub.d less than 5.times.10.sup.-2 M, 10.sup.-2 M,
5.times.10.sup.-3 M, 10.sup.-3 M, 5.times.10.sup.-4 M, 10.sup.-4M,
5.times.10.sup.-5M, 10.sup.-5M, 5.times.10.sup.-6M, 10.sup.-6M,
5.times.10.sup.-7 M, 10.sup.7 M, 5.times.10.sup.-8 M, 10.sup.-8 M,
5.times.10.sup.-9 M, 10.sup.-9 M, 5.times.10.sup.-10 M, 10.sup.-10
M, 5.times.10.sup.-11 M, 11.sup.-M, 5.times.10.sup.-12 M,
10.sup.-12 M, 5.times.10.sup.-13 M, 10.sup.-13 M,
5.times.10.sup.-14 M, 10.sup.-14 M, 5.times.10.sup.-15 M, or
10.sup.-15 M.
[0113] An exemplary approach in which the antibodies of the present
invention can be used as FTR inhibitors includes binding to and
inhibiting FTR polypeptides locally or systemically in the body or
by direct cytotoxicity of the antibody, e.g. as mediated by
complement (CDC) or by effector cells (ADCC). The antibodies of
this invention can be advantageously utilized in combination with
other monoclonal or chimeric antibodies, or with lymphokines or
hematopoietic growth factors (such as, e.g., IL-2, IL-3 and IL-7),
for example, which serve to increase the number or activity of
effector cells which interact with the antibodies.
[0114] The antibodies of the invention can be administered alone or
in combination with other types of treatments such as, for example,
anti-fungal therapies. In one embodiment, FTR inhibitor antibodies
are administered to a human patient for therapy or prophylaxis.
[0115] Various delivery systems are known and can be used to
administer the antibody inhibitors of the invention, e.g.,
encapsulation in liposomes, microparticles, microcapsules,
recombinant cells capable Methods of introduction include but are
not limited to intradermal, intramuscular, intraperitoneal,
intravenous, subcutaneous, intranasal, epidural, and oral
routes.
[0116] The compounds or compositions can be administered by any
convenient route, for example by infusion or bolus injection, by
absorption through epithelial or mucocutaneous linings (e.g., oral
mucosa, rectal and intestinal mucosa, etc.) and can be administered
together with other biologically active agents. Administration can
be systemic or local. Pulmonary administration can also be
employed, e.g., by use of an inhaler or nebulizer, and formulation
with an aerosolizing agent.
[0117] For antibodies, the dosage administered to a subject is
typically 0.1 mg/kg to 100 mg/kg of the subject's body weight.
Preferably, the dosage administered to a subject is between 0.1
mg/kg and 20 mg/kg of the subject's body weight, more preferably 1
mg/kg to 10 mg/kg of the subject's body weight. Generally,
humanized or human antibodies have a longer half-life within the
human body than antibodies from other species due to the immune
response to the foreign polypeptides. Thus, lower dosages of
humanized antibodies and less frequent administration is often
possible. Further, the dosage and frequency of administration of
antibodies of the invention can be reduced by enhancing uptake and
tissue penetration (e.g., into the brain) of the antibodies by
modifications such as, for example, lipidation.
[0118] In pharmaceutical dosage forms, the compositions of the
invention including vaccine, antisense, siRNA and antibodies can be
used alone or in appropriate association, as well as in
combination, with each other or with other pharmaceutically active
compounds. Administration of the agents can be achieved in various
ways, including oral, buccal, nasal, rectal, parenteral,
intraperitoneal, intradermal, transdermal, subcutaneous,
intravenous, intra-arterial, intracardiac, intraventricular,
intracranial, intratracheal, and intrathecal administration, etc.,
or otherwise by implantation or inhalation. Thus, the subject
compositions can be formulated into preparations in solid,
semi-solid, liquid or gaseous forms, such as tablets, capsules,
powders, granules, ointments, solutions, suppositories, enemas,
injections, inhalants and aerosols. The following methods and
excipients are merely exemplary and are in no way limiting.
[0119] Any of treatment modalities disclosed herein can be combined
and administered to a subject suffering from a fungal infection or
being at risk for developing a fungal infection (prophylactic
vaccination or treatment). In a combination therapy, for example, a
subject can first receive a vaccine of the invention to generate an
immune response towards the fungi, then an antisense, siRNA and/or
antibody that can target FTR of the fungi and further augment the
fungal treatment. In one embodiment of the treatment, the vaccine
of the invention is used in combination with an antisense, siRNA
and/or antibody against FTR for treating or preventing a fungal
condition such as, for example, mucormycosis. In another
embodiment, the antibodies of the invention are used in combination
with antisense and/or siRNA for treating the fungal condition.
[0120] The compositions of the inventions, either alone or in
combination, can further be combined one or more methods or
compositions available for fungal therapy. In one embodiment, the
compositions of the invention can be used in concert with a
surgical method to treat a fungal infection. In yet another
embodiment, the compositions of the invention can be used in
combination with a drug or radiation therapy for treating a fungal
condition. Antifungal drugs that are useful for combination therapy
with the compositions of the invention include, but are not limited
to, amphotericin B, iron chelators such as, for example,
deferasirox, deferiprone, POSACONAZOLE.RTM., FLUCONAZOLE.RTM.,
ITRACONAZOLE.RTM. and/or KETOCONAZOLE.RTM.. Radiations useful in
combination therapies for treating fungal infections include
electromagnetic radiations such as, for example, near infrared
radiation with specific wavelength and energy useful for treating
fungal infections. In combination therapy, chemotherapy or
irradiation is typically followed by administration of the vaccine
in such a way that the formation of an effective anti-fungal immune
response is not compromised by potential residual effects of the
prior treatment.
[0121] In a further embodiment of combination therapy, the
compositions of the invention can be combined with immunocytokine
treatments. Without wishing to be bound by theory, it is believed
that, for example, a vaccine generates a more effective immune
response against, for example, an infection when a cytokine
promoting the immune response is present at the site of the
infection. For example, useful immunocytokines are those that
elicit Th1 response, such as IL-2 or IL-12. During a combination
therapy, for example, a subject can first receive a vaccine of the
invention to generate an immune response towards a fungal
infection, then an immunocytokine that can target the fungi and
support the immune response in fighting the infection. Preferred
immunocytokines typically have, for example, an antibody moiety
that recognizes a surface antigen characteristic of the fungi such
as, for example, FTR. Immunocytokines typically also have a
cytokine moiety such as IL-2, IL-12, or others that preferentially
direct a Th1 response. Immunocytokines suitable for the invention
are described in U.S. Pat. No. 5,650,150, the contents of which are
hereby incorporated by reference.
[0122] In another embodiment of combination therapy, combinations
of the compositions of the invention can be administered either
concomitantly, e.g., as an admixture, separately but simultaneously
or concurrently; or sequentially. This includes presentations in
which the combined agents are administered together as a
therapeutic mixture, and also procedures in which the combined
agents are administered separately but simultaneously, e.g., as
through separate intravenous lines into the same individual.
Administration "in combination" further includes the separate
administration of one of the compounds or agents given first,
followed by the second. In another specific embodiment,
compositions of the invention are used in any combination with
amphotericin B, deferasirox, deferiprone, POSACONAZOLE.RTM.,
FLUCONAZOLE.RTM., ITRACONAZOLE.RTM., and/or KETOCONAZOLE.RTM. to
prophylactically treat, prevent, and/or diagnose an opportunistic
fungal infection.
[0123] The invention, therefore, provides methods of treatment,
inhibition and prophylaxis by administration to a subject of an
effective amount of one or more compounds or pharmaceutical
compositions of the invention. In a preferred aspect, the
compositions of the invention are substantially purified (e.g.,
substantially free from substances that limit their effect or
produce undesired side-effects). The subject is preferably an
animal, including but not limited to animals such as cows, pigs,
horses, chickens, cats, dogs, etc., and is preferably a mammal, and
most preferably human.
[0124] As discussed above, various delivery systems are known and
can be used to administer the compositions of the invention. The
compositions can be administered by any convenient route, for
example by infusion or bolus injection, by absorption through
epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and
intestinal mucosa, etc.) and can be administered together with
other biologically active agents. Administration can be systemic or
local.
[0125] In a specific embodiment, it can be desirable to administer
the pharmaceutical compounds or compositions of the invention
locally to the area in need of treatment; this can be achieved by,
for example, and not by way of limitation, local infusion during
surgery, topical application, e.g., in conjunction with a wound
dressing after surgery, by injection, by means of a catheter, by
means of a suppository, or by means of an implant, said implant
being of a porous, non-porous, or gelatinous material, including
membranes, such as sialastic membranes, or fibers. Preferably, when
administering a protein, including a vaccine or antibody, of the
invention, care must be taken to use materials to which the protein
does not absorb. In another embodiment, the compound or composition
can be delivered in liposomes. In yet another embodiment, the
compounds or compositions can be delivered in a controlled release
system.
[0126] In an embodiment, the compositions are formulated in
accordance with routine procedures as a pharmaceutical composition
adapted for intravenous administration to human beings. Typically,
compositions for intravenous administration are solutions in
sterile isotonic aqueous buffer. Where necessary, the composition
can also include a solubilizing agent and a local anesthetic such
as lignocaine to ease pain at the site of the injection. Generally,
the ingredients are supplied either separately or mixed together in
unit dosage form, for example, as a dry lyophilized powder or water
free concentrate in a hermetically sealed container such as an
ampoule indicating the quantity of active agent. Where the
compositions are to be administered by infusion, they can be
dispensed with an infusion bottle containing sterile pharmaceutical
grade water or saline. Where the compositions are administered by
injection, an ampoule of sterile water for injection or saline can
be provided so that the ingredients can be mixed prior to
administration.
[0127] The compounds of the invention can also be formulated as
neutral or salt forms. Pharmaceutically acceptable salts include
those formed with anions such as those derived from hydrochloric,
phosphoric, acetic, oxalic, tartaric acids, etc., and those formed
with cations such as those derived from sodium, potassium,
ammonium, calcium, ferric hydroxides, isopropylamine,
triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.
[0128] The amount of the compounds or compositions of the invention
which will be effective in the treatment, inhibition and prevention
of a fungal disease or condition can be determined by standard
clinical techniques. In addition, in vitro assays can optionally be
employed to help identify optimal dosage ranges. The precise dose
to be employed in the formulation will also depend on the route of
administration, and the seriousness of the disease or condition,
and should be decided according to the judgment of the practitioner
and each subject's circumstances. Effective doses can be
extrapolated from dose-response curves derived from in vitro or
animal model test systems.
[0129] The following Examples illustrate the therapeutic utility of
the FTR as the basis for preventive measures or treatment of
disseminated mucormycosis. Example 1 describes cloning and
identification of FTR. Example 2 describes FTR expression in R.
oryzae under iron-depleted condition. Example 3 describes FTR
expression in S. cerevisiae ftr1 null mutant. Example 4 describes
FTR function in S. cerevisiae ftr1 null mutant. Example 5,
describes development of animal model of mucormycosis. Example
describes the effect of serum iron availability on susceptibility
of DKA mice to R. oryzae. Example 7 describes the expression of FTR
in vivo in DKA mice infected with R. oryzae. Example 8 describes
FTR polypeptide and its homology to other proteins. Example 9
describes the role of FTR gene product in virulence of R. oryzae in
the DKA mouse model of hematogenous dissemination of
mucormycosis.
[0130] It is understood that modifications which do not
substantially affect the activity of the various embodiments of
this invention are also included within the definition of the
invention provided herein. Accordingly, the following examples are
intended to illustrate but not limit the present invention.
EXAMPLE 1
[0131] Cloning and Identification of FTR
[0132] This Example describes the cloning and identification of FTR
of R. oryzae which showed considerable sequence homology to high
affinity iron permeases of S. cerevisiae and C. albicans (FIG.
3).
[0133] The following describes materials and methods used in the
procedures described in this example. In accordance with the
present invention, there can be employed conventional molecular
biology, microbiology and recombinant DNA techniques within the
skill of the art. Such techniques are explained fully in the
literature. See, e.g., Sambrook, Fitsch & Maniatis, Molecular
Cloning: A Laboratory Manual, Second Edition Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. (1989).
[0134] Rhizopus oryzae 99-880 was obtained from the Fungus Testing
Laboratory (University of Texas Health Science Center at San
Antonio). This strain was isolated from a brain abscess in a
diabetic subject with rhinocerebral mucormycosis.
[0135] To clone the FTR of R. oryzae, we used degenerate primers
designed from the conserved regions of the S. cerevisiae FTR to
amplify a 0.6 kb fragment from R. oryzae genomic DNA. This fragment
showed 43% homology to S. cerevisiae FTR and hybridized to a 2.0 kb
fragment of R. oryzae genomic DNA cut with EcoRI. We used this
PCR-generated fragment to screen an R. oryzae genomic library made
in .lamda.-phage. Five different plaques were isolated and each
contained a 2 kb fragment upon treatment with different restriction
enzymes. Sequence analysis of this 2.0 kb genomic clone revealed a
single open reading frame of 1101 by that lacked introns.
Comparison of the putative FTR polypeptide with those of other
proteins in GenBank data-base revealed 46% and 44% identity to
known fungal high affinity iron permeases from C. albicans and S.
cerevisiae, respectively (Fu et al. FEMS Micorbiol. Lett.
235:169-176 (2004)). Multiple regions of the predicted amino acid
sequence of FTR polypeptide showed significant homology with
putative transmembrane domains from S. cerevisiae and C. albicans
FTR. Importantly, the putative REGLE motif in which the glutamic
acid residue is believed to interact directly with iron was
conserved in the predicted amino acid sequences of FTR polypeptide
from the three organisms and was embedded in a hydrophobic region
of the protein. Additionally, Southern blot analysis of R. oryzae
genomic DNA cut with EcoRI, DraI, or EcoRI+DraI and probed with the
ORF of FTR confirmed the gene map of the FTR. Southern blot
analysis of R. oryzae gDNA using the ORF of FTR under low
stringency did not reveal any other bands, thus indicating that the
FTR is not a member of a gene family (data not shown).
EXAMPLE 2
Expression of FTR in R. oryzae Under Iron-Depleted Conditions
[0136] This Example shows that FTR is expression at higher levels
under iron-depleted conditions.
[0137] Expression of high affinity iron permeases is usually
induced in iron-limited environments and suppressed in iron-rich
environments. To verify that FTR polypeptide functions as a
high-affinity iron permease, we examined FTR expression in response
to different concentrations of FeCl.sub.3. R. oryzae mycelia were
collected by filtration and used to inoculate potato dextrose broth
(PDB) supplemented with the iron chelators, 1 mM ferrozine and 100
.mu.M of 2,2'bipyridyl, to induce iron starvation. The mycelia were
transferred to PDB previously chelated for iron, and supplemented
with varying concentrations of FeCl.sub.3 and incubated at
37.degree. C. for selected intervals. As expected, FTR expression
was induced at all time points when the organism was exposed to
media deficient in FeCl.sub.3. The addition of FeCl.sub.3 resulted
in rapid suppression of FTR expression as early as 5 minutes after
exposure. Further, this suppression of FTR expression appeared to
be dose dependent, with a more marked, and rapid decrease in FTR
mRNA at 350 .mu.M FeCl.sub.3 as compared with 50 .mu.M FeCl.sub.3.
Consistent with these results, FTR expression was undetectable when
mycelia were grown in the iron-rich medium, PDB. These results
demonstrate that FTR is induced in iron-depleted environments,
suppressed in iron-rich environments, and that its transcription is
tightly regulated by the amount of iron in the medium (FIG. 5).
This tight transcriptional regulation has been reported in yeast
and is likely due to the sensitivity of transcriptional activation
to changes in intracellular iron concentration. Such tight
regulation likely allows the organism to avoid toxicity caused by
excess iron. Of note, these results also demonstrate that FTR is
likely to be expressed in vivo (see below) even in a host that has
elevated available serum iron because free iron concentration in
these hosts is still expected to be several orders of magnitude
less than the highest concentration shown to induce expression of
FTR (i.e. 50 .mu.M). For example, we found that DKA mice have 7.29
.mu.M available iron in their serum (see below). Additionally,
Artis et al. demonstrated that sera collected from subjects in DKA
contain 12.4 .mu.M available iron (Artis et al., Diabetes
31(12):1109-14 (1982)).
EXAMPLE 3
Expression of FTR in S. cerevisiae ftr1 Null Mutant
[0138] This Example shows that expression of R. oryzae FTR in S.
cerevisiae ftr1 null mutant restores S. cerevisiae's ability to
grow in iron-depleted environment.
[0139] To determine whether FTR is functionally equivalent to S.
cerevisiae FTR, we tested whether FTR could rescue the
iron-dependent growth defect of a S. cerevisiae ftr1 null mutant.
S. cerevisiae was transformed with a plasmid containing FTR under
the control of the inducible GAL1 promoter (i.e. expression only in
the presence of galactose). S. cerevisiae transformed with FTR grew
when cultured on iron-limited medium (50 .mu.M iron) containing
galactose. In contrast, no growth was noted when the
FTR-transformed cells were cultured on plates containing glucose,
which failed to induce activation of the GAL1 promoter, and hence
transcription of the FTR (FIG. 6). As expected, S. cerevisiae
transformants carrying vector alone (negative control) did not grow
on iron-depleted medium even in the presence of galactose. All S.
cerevisiae transformants grew equally well on iron-rich plates (350
.mu.M iron) containing either glucose or galactose, likely due to
the presence of the low-affinity iron permease of S. cerevisiae,
which is believed to function in iron-rich environments (FIG.
8).
EXAMPLE 4
FTR Complements S. cerevisiae ftr1 Null Mutant Uptake of Iron
[0140] This example shows that R. oryzae FTR encodes a functional
polypeptide in S. cerevisiae.
[0141] To confirm that FTR-mediated growth rescue of the S.
cerevisiae ftr1 mutant was due to increased iron uptake, we
compared the kinetics of .sup.59Fe uptake of S. cerevisiae
transformed with R. oryzae FTR under the GAL1 promoter to
transformants containing the empty vector. The ftr1 null mutant
cells transformed with the empty vector showed no intracellular
iron accumulation when .sup.59FeCl.sub.3 was supplied at 0.1 .mu.M
(a concentration in which only high affinity iron permeases are
active). In contrast, introduction of FTR into S. cerevisiae ftr1
null mutant restored the iron uptake to between 48-60% of the
amount exhibited by the wild-type strain (FIG. 7).
[0142] In summary, in Examples 3 and 4 we showed that we have
cloned a gene (FTR) that is expressed in R. oryzae in iron-depleted
media, suppressed in iron-rich media, and complements the growth
defect of high-affinity iron permease null mutant of S. cerevisiae
by rescuing the mutant's ability to take up iron in iron-poor
media. In aggregate, these data strongly indicate that FTR
polypeptide encodes a high-affinity R. oryzae iron permease and
also justifies the production of FTR polypeptide in S. cerevisiae
because R. oryzae genes can be functionally expressed in S.
cerevisiae.
EXAMPLE 5
Development of Animal Model of Mucormycosis
[0143] To study the pathogenesis of any disease, it is essential to
develop an animal model that recapitulates relevant clinical
factors. This Example shows that we have developed an animal model
relevant to mucormycosis, a DKA mouse model of hematogenously
disseminated R. oryzae infection.
[0144] We successfully developed a DKA mouse model of
hematogenously disseminated mucormycosis by using a single
injection of streptozotocin given intraperitoneally. We chose this
model because subjects with DKA are at high risk of developing
mucormycosis. As expected, we found that mice with DKA are more
susceptible to R. oryzae infection than normal mice. Seven days
after intravenous challenge of 10.sup.4 spores, all mice with DKA
died, whereas 40% of infected non-diabetic mice survived (FIG.
8).
[0145] To assess the severity of infection, we compared tissue
colony counts to a quantitative PCR-based (qPCR) (TaqMan) assay
that was developed originally to determine disease progression in
animal models of A. fumigatus. The TaqMan technique was developed
because the colony count method is unreliable for determining
tissue fungal burden of molds since hyphal structures are disrupted
by tissue homogenization, resulting in death of the fungus and
inaccurately low estimate of the organ fungal burden. Indeed, as
anticipated, colony counts did not increase during infection with
R. oryzae and did not correlate with mortality. In contrast, a
temporal correlation between increase in tissue fungal burden and
onset of mortality was found when a qPCR-based (TaqMan) technique,
using primers designed to amplify R. oryzae 18s rDNA, was used to
quantify tissue R. oryzae burden (FIG. 9). These results were
consistent with our preliminary results, in which mouse tissues
spiked with varying inocula of R. oryzae showed a linear range of
detection. Therefore, this qPCR-assay is a sensitive and reliable
method for assessing the progression of mucormycosis in the DKA
mouse model. This assay will be utilized to elucidate the role of
iron metabolism in the pathogenesis of the disease.
EXAMPLE 6
The Effects of Serum Iron Availability on Susceptibility of DKA
Mice to R. oryzae
[0146] This Example shows that susceptibility of DKA mice to R.
oryzae is due in part to elevated available serum iron.
[0147] To confirm that available iron renders diabetic mice more
susceptible to R. oryzae infection, we compared levels of serum
iron in DKA mice to those of normal mice by using the method of
Artis et al. (1982, supra). In concordance with the results found
in humans DKA mice (n=11) had approximately 5 fold higher levels of
available serum iron than normal mice [median (75.sup.th quartile,
25.sup.th quartile)]=7.29 (11.8, 4.3) .mu.M vs. 1.69 (2.3, 1.3)
.mu.M, p=0.03 by Wilcoxon Rank Sum). These data underscore the
clinical relevance of our DKA mouse model.
[0148] To confirm the role of elevated available serum iron in the
pathogenicity of R. oryzae we investigated the effect of iron
chelation on the susceptibility of DKA mice to R. oryzae infection.
Mice were infected via the tail-vein with spores of R. oryzae. The
mice were treated by oral gavage with 1, 3, or 10 mg/kg deferasirox
(a newly FDA approved iron chelator to treat subjects with iron
overload) in 0.5% hydroxypropylcellulose twice daily (bid) for
seven days starting the day after infection. Negative control mice
were treated with hydroxypropylcellulose carrier (placebo) or
deferasirox plus saturating ferric chloride (administered i.p.). An
additional negative control consisted of uninfected mice treated
with ferric chloride. Deferasirox given at all doses significantly
improved survival compared to controls (FIG. 10A). This improved
survival paralleled the survival we get in this model when a high
dose of liposomal amphotericin B (LAmB) is used to treat infection.
To determine the impact of deferasirox on tissue fungal burden, DKA
mice were infected i.v. as above. Mice were treated with
deferasirox (10 mg/kg bid), deferasirox plus saturating ferric
chloride, or placebo. Treatment was begun 16 h after infection and
administered daily for 3 days. Kidneys and brains were removed on
day four, homogenized, and quantitatively cultured. Deferasirox
resulted in a greater than 10-fold decrease in both brain and
kidney (primary target organs) fungal burden compared to mice
treated with placebo or deferasirox plus saturating ferric chloride
(FIG. 10B). By histopathology, kidneys of deferasirox-treated mice
had no visible hyphae, whereas kidneys of mice treated with placebo
or deferasirox plus saturating ferric chloride had extensively
filamented fungi. Furthermore, mice treated with saturating iron
had a striking absence of neutrophil influx to the sites of
infection, while neutrophil influx was prominent in the kidneys of
mice treated with deferasirox (data not shown). The reversal of
protection when deferasirox was administered to mice with a
saturating dose of FeCl.sub.3 further proved that the mechanism of
protection was due to iron chelation. Of note, these results are in
agreement with our previous work showing that deferiprone (another
chelating agent that is not used as a siderophore by Rhizopus)
protected animals from Rhizopus infection and confirm the link
between iron availability and R. oryzae. These results further
confirmed the unique importance of iron in the pathogenesis of
mucormycosis.
EXAMPLE 7
Expression of FTR In Vivo in DKA Mice
[0149] This Example shows that R. oryzae's FTR is expressed in vivo
in DKA mice.
[0150] In order for FTR polypeptide to play a role in the
pathogenesis of mucormycosis, it must be expressed during
infection. We used a real time RT-PCR-based approach to investigate
the expression of FTR polypeptide in the brains of diabetic
ketoacidic (DKA) mice infected with 10.sup.5 spores of R. oryzae
through tail vein injection. The brain was chosen because it is the
primary target organ in this model. Mice were sacrificed 24 or 48 h
post infection and brains were collected and immediately flash
frozen in liquid nitrogen prior to grinding and RNA extraction with
phenol. Brains collected from uninfected DKA mice were processed in
parallel and served as negative controls. Following DNase treatment
to eliminate contaminating genomic DNA, and reverse transcription
(Ambion RETROscript.RTM. system), cDNA was analyzed by real-time
PCR using the SYBR-Green method and an ABI.RTM. Prism 7000 cycler.
Gene-expression was normalized to R. oryzae ACT1 or 18S
rRNA-expression. FTR was found to have been expressed in the brains
of 4 infected mice 48 h post infection but not after 24 h (FIG.
11). The lack of FTR expression after 24 h of infection cannot be
attributed to the presence of lower fungal elements in the brains
of infected mice since the expression of both 18S rRNA and ACT1
genes were detected in these tissues. The pattern of delayed FTR
polypeptide expression (i.e. expression after 48 h but not 24 h of
infection) can be explained by the fact that after 24 h fungal
elements were not sufficiently iron-starved because spores had been
grown on iron-rich medium during preparation of the inoculum. Forty
eight hours following infection, as the fungal spores started to
proliferate in the brain, R. oryzae started to express FTR
polypeptide to scavenge iron from the host. As expected, brains
from uninfected mice did not show any expression of FTR
polypeptide.
[0151] These results clearly demonstrate that FTR polypeptide is
expressed during infection and is involved in the pathogenesis of
mucormycosis.
[0152] To confirm the expression of FTR in vivo during active
infection, we used GFP as a reporter system for FTR expression. R.
oryzae was transformed with a plasmid containing GFP cloned down
stream of a 2 kb fragment containing FTR promoter. This strain
fluoresced green when grown in iron-depleted but not in iron-rich
environments in vitro (data not shown). DKA mice were infected with
1.times.10.sup.5 spores of this R. oryzae strain grown under
iron-rich conditions. Forty eight hours post infection mice were
sacrificed and brains were collected, and fixed in 10% zinc
formalin. Paraffin sections of the brains were stained with
anti-GFP polyclonal rabbit Ab and counter stained with anti-rabbit
FITC conjugated Ab. As shown in FIG. 14, fungal elements in the
brains of mice infected with R. oryzae expressing GFP under the
control of the FTRp fluoresced green, therefore confirming our
earlier findings that FTR polypeptide is expressed during active
infection an is involved in pathogenesis of the mucormycosis.
EXAMPLE 8
FTR Polypeptide and its Homology to Known Proteins
[0153] This Example shows that R. oryzae FTR polypeptide little or
no homology with any known human proteins.
[0154] In order to minimize the potential for induction of
autoimmune responses, it is desirable that a protein vaccine being
utilized as a human vaccine not have significant homology to
numerous human proteins. To investigate the potential for homology
between the FTR polypeptide and human proteins, a PubMed BLAST
search was performed comparing the amino acids 16-368 of the FTR
polypeptide (i.e. the amino acids in the intended FTR polypeptide
vaccine) to the human proteome. The search identified five open
reading frames with extremely limited homology with an alignment
score of 30.4, e=9.0 for all of the five proteins. Three of these
proteins are coiled-coil domain containing 82 (i.e., EAW66982;
AAH33726.1; and NP.sub.--079001.2), one is a CCDC82 protein (i.e.,
AAH18663.1) and an unnamed protein (i.e., BAB 15683.1). As a
benchmark, the standard BLAST search e-value for identification of
unique sequences from fungi compared to other organisms has been
set at 10.sup.-8, indicating that R. oryzae FTR has no significant
homology to the human proteome.
EXAMPLE 9
The Role of FTR Gene Product in Virulence of R. oryzae in the DKA
Mouse Model of Hematogenous Dissemination or Mucormycosis
[0155] This Example shows that FTR gene product (e.g., mRNA or
polypeptide) is required for full virulence of R. oryzae in the DKA
mouse model mucormycosis.
[0156] We have utilized RNA interference (RNAi) technology to
inhibit the expression of FTR in R. oryzae. A 400 bp fragment of
FTR ORF containing the REGLE motif (believed to interact with iron
during uptake) was cloned in plasmid pRNAi-pdc upstream of an
intron segment. The reverse complement sequence of the same
fragment was cloned downstream of the intron. The generated plasmid
was transformed into R. oryzae pyrf mutant using the biolistic.RTM.
delivery system (BioRad.RTM.) and transformants were selected on
minimal medium lacking uracil. Southern blot analysis showed that
all obtained transformants maintained the transformed plasmid
episomally (data not shown). RT-PCR was used to compare expression
of FTR by five selected transformants to a control strain, which
was transformed with the empty plasmid. FTR expression was almost
completely inhibited in 4 of the 5 transformants tested and reduced
in one transformant compared to control strain (FIG. 13). The
expression of 18s rDNA was not altered in any transformant
indicating the specificity of RNAi in inhibiting expression of
FTR.
[0157] The virulence of one of the RNAi transformants was compared
to the control strain in the DKA mouse model of hematogenously
disseminated mucormycosis. Mice were infected with the control
strain transformed or with a transformant harboring the RNAi
plasmid (FTR-i strain). There was delayed and reduced virulence of
the RNAi-transformant compared to the control strain.
Interestingly, we found that R. oryzae recovered from brains and
kidneys of moribund mice infected with the FTR-i strain lost the
RNAi plasmid since R. oryzae failed to grow on minimal medium
without uracil but did grow on rich medium (potato dextrose agar).
In contrast, R. oryzae recovered from the two mice that survived
the infection for 25 days (with no signs of disease) was able to
grow on both minimal medium without uracil and on rich medium,
indicating that the RNAi plasmid was still present in these spores
and that inhibiting of FTR expression during infection inhibits
virulence of R. oryzae (FIG. 14).
[0158] These data demonstrate that the FTR is a pivotal virulence
factor for R. oryzae in the DKA mouse model, and provide additional
rational in support of development of an FTR vaccine to prevent
mucormycosis infections.
EXAMPLE 10
The rFtr1p is Exposed Extracellularly and has Limited Homology to
Known Human Proteins but is Conserved Among Other Mucorales
[0159] Homology modeling predicts rFtr1p to have a poly-helical
bundle structure which is the hallmark of ion-binding or transport
proteins found in other microorganisms. In the most robust models,
the crucial Glu154 and Glu157 residues of the REGLE iron-binding
motif are exposed upon the extracellular facet of the protein,
making them accessible to potential binding and inhibition by
antibodies (FIG. 19).
[0160] In order to minimize the potential for induction of
autoimmune responses, it is desirable that a protein vaccine being
utilized as a human vaccine not have significant homology to
numerous human proteins. To investigate the potential for homology
between the rFtr1p and human proteins, a PubMed BLAST search was
performed comparing the amino acids 16-368 of the rFtr1p (i.e. the
amino acids in the intended rFtr1p vaccine) to the human proteome.
The search identified five open reading frames with extremely
limited homology with an alignment score of 30.4, e=9.0 for all of
the five proteins. Three of these proteins are coiled-coil domain
containing 82 (i.e. EAW66982; AAH33726.1; and NP.sub.--079001.2),
one is a CCDC82 protein (i.e. AAH18663.1) and an unnamed protein
(i.e. BAB15683.1). As a benchmark, the standard BLAST search e
value for identification of unique sequences from fungi compared to
other organisms has been set at 10.sup.-8, (Jones et al., Proc Natl
Acad Sci USA 2004; 101:7329-34 (2004)) indicating that rFtr1p has
no significant homology to the human proteome. By comparison, a
PubMed BLAST search of the Hepatitis B Surface Antigen, which is
utilized as an extremely safe vaccine in humans against the
Hepatitis B Virus, revealed 18 hits, one of which was significant
(score 75.9, e=3.times.10.sup.-14), with the remainder ranging from
scores of 27 to 29, with e values of 5 to 10. Hence, the proposed
rFtr1p vaccine has comparable or less homology to the human
proteome as does the widely utilized HBSAg vaccine.
[0161] In contrast, a recent publication demonstrated that rFTR1 is
highly conserved among other pathogenic Mucorales including R.
microsporus, R. niveus, R. stolonifer, Rhizomucor miehei,
Rhizomucor pusillus, Mucor circinelloides, M. racemosus, M. rouxii,
and M. plumbeus, with nucleotide homology of >70%.
Interestingly, the putative REGLE iron-binding functional motif is
100% conserved among all Mucorales. Nyilasi et al., Clin Microbiol
Infect. (2008). This indicates that the proposed vaccine will be
cross-immunogenic against other agents of mucormycosis. Moreover,
it is expected that cross-genera protection will occur because R.
oryzae rFtr1p has a high degree of identity with high iron
permeases from a very diverse array of fungi, even beyond molds,
including Aspergillus spp., C. albicans, and Cryptococcus
neoformans. In all of these fungi, the core REGLE iron-binding
functional motif is 100% conserved.
EXAMPLE 11
Passive Immunization with Sera Collected from Mice Vaccinated with
rFtr1p Protects Mice from R. oryzae Infection
[0162] To maximize protein production a gene was synthesized
(Genscript) encoding a more hydrophilic protein by removing the
signal peptide and 6 transmembrane domains that direct localization
of the protein to the cell membrane. While the synthesized gene had
sequence elements removed, none of the remaining sequence was
altered, so as to avoid altering potential epitopes in the exposed,
hydrophilic regions of the protein. The synthetic gene also
included a 6.times.-His-tag to affinity purify the expressed
protein. This gene was cloned into pQE32 expression vector and
transformed into E. coli. Log phase bacterial cells were induced
with IPTG and the cells were harvested and the recombinant protein
was purified over a Ni-agrose affinity column according to the
manufacturer instructions (Qiagen) with a production of
.about.1-1.3 mg of purified protein per liter of culture (FIG. 20).
The generated protein was used to raise murine antibodies as
described below.
[0163] To generate immune serum for passive immunization, Balb/c
mice were immunized by SQ injection of rFtr1p (20 .mu.g) mixed with
complete Freund's adjuvant (CFA) at day 0, boosted with another
dose of the antigen with incomplete Freund's adjuvant (IFA) at day
21, and bled for serum collection two weeks later. Pooled sera
collected from vaccinated mice demonstrated Ab titer against rFtr1p
of >1:800,000, whereas pooled sera collected from mice
vaccinated with empty plasmid had an Ab titer of 1:200. Immune or
control sera (0.25 ml) were administered i.p. to DKA recipient mice
2 h before intranasal infection with R. oryzae. Sera doses were
repeated 3 days post infection. Infected mice treated with immune
serum improved survival compared to mice treated with control serum
(FIG. 21). These studies clearly demonstrate the feasibility of
using passive immunization targeting rFtr1p to improve survival
during mucormycosis.
EXAMPLE 12
FTR1 is Expressed by R. oryzae During Infection in DKA Mice
[0164] For FTR1 to play a role in the pathogenesis of mucormycosis,
it must be expressed during infection. Quantitative real time PCR
(qPCR) was used to investigate the expression of FTR1 in the brains
of DKA mice infected intravenously with 10.sup.5 spores of R.
oryzae, an inoculum that causes a 100% mortality within 2-3 days
(Ibrahim et al., Antimicrob Agents Chemother 49: 721-727 (2005).
The brain was chosen for analysis because it is a primary target
organ in this model (Ibrahim et al., Antimicrob Agents Chemother
49: 721-727 (2005)). Expression of FTR1 from mice (n=5) sacrificed
24 h post infection increased by 4 fold [median (25.sup.th
quartile, 75.sup.th quartile)=4.12 (1.03, 0.27), p=0.03 by Wilcoxon
Rank Sum)] relative to the constitutive ACT1 gene. As expected,
brains from uninfected mice did not show any expression of
FTR1.
[0165] The non-parametric log-rank test was used to determine
differences in survival times, whereas differences in kidney fungal
burden, iron uptake, growth rate and in vivo FTR1 expression were
compared by the non-parametric Wilcoxon Rank Sum test.
[0166] To directly visualize expression of FTR1 in vivo during
infection, R. oryzae was transformed with a plasmid containing GFP
under the control of the FTR1 promoter. R. oryzae strains used in
this study are listed in Table 1. Briefly, organisms were grown on
potato dextrose agar (PDA) or on YPD plates [1% yeast extract
(Difco Laboratories), 2% bacto-peptone (Difco), and 2% D-glucose]
for 4 days at 37.degree. C. For R. oryzae M16 (a pyrF null mutant
that is unable to synthesize its own uracil), PDA was supplemented
with 100 .mu.g/ml uracil. An 815 bp partial pyrF PCR fragment (pyrF
P11/P13) was used to restore R. oryzae M16 to prototrophy. This
fragment overlaps the pyrF mutation present in M16 (i.e. point
mutation at nt +205 of G to A) (Skory and Ibrahim, Curr Genet 52:
23-33 (2007)) and is capable of restoring functionality through
gene replacement. In some experiments, R. oryzae was starved for
iron by growth on yeast nitrogen base (YNB) (Difco/Becton
Dickinson, Sparks, Md.) supplemented with complete supplemental
media without uracil (CSM-URA) (Q-Biogene), (YNB+CSM-URA)
[formulation/100 ml, 1.7 g YNB without amino acids, 20 g glucose,
0.77 g CSM-URA] in the presence of 1 mM of ascorbic acid and
ferrozine. The sporangiospores were collected in endotoxin free PBS
containing 0.01% Tween 80, washed with PBS, and counted with a
hemacytometer to prepare the final inocula.
TABLE-US-00001 TABLE 1 Strains used in this study Strain Genotype
Description and Source R. oryzae 99-880 Wild-type Clinical isolate
(Ibrahim et al., J Clin Invest 111: 2649-2657 (2007)). R. oryzae
M16 pyrF205 Uracil deficient (Skory and Ibrahim, Curr Genet 52:
23-33 (2007)). R. oryzae PyrF pyrF205::PyrF M16 complemented with a
complemented wild-type copy of PyrF at its original locus, this
work R. oryzae GFP1 M16 (pP.sub.Ftr1-GFP) M16 transformed with a
plasmid containing a FTR1 promoter driven GFP (Ibrahim et al., J
Clin Invest 117: 2649-2657 (2007)). R. oryzae pyrF205, ftr1 knock
out, this work FTR1Ko ftr1::PyrF R. oryzae M16 (pFTRi- FTR1
inhibited by RNAi, FTR1Inh pdc intron) this work R. oryzae Empty
M16 (pRNAi- M16 transformed with pdc intron) empty plasmid, this
work
[0167] This strain fluoresced green when grown in iron-depleted but
not iron-rich media in vitro, whereas R. oryzae transformed with
GFP under the control of the constitutive actin promoter (positive
control) fluoresced regardless of the iron concentration in the
medium (FIG. 22A). DKA mice were infected with the GFP reporter
strain or PyrF-complemented R. oryzae grown under iron-rich
conditions to suppress GFP expression prior to infection. Twenty
four or 48 h post infection brains were collected and processed for
histopathology. Because the paraffin embedding process abrogated
the intrinsic fluorescence of the GFP protein, the sections were
stained with fluorescent anti-GFP antibody. Samples taken 24 h post
infection did not show any fungal elements, which was expected
since 48 h post infection is the earliest time point that fungal
elements can be detected histopathologically in infected tissues
(Ibrahim et al., Antimicrob Agents Chemother 49: 721-727 (2005)).
At 48 h of infection in the brain, the FTR1 reporter strain of R.
oryzae expressed GFP, whereas the negative control,
PyrF-complemented R. oryzae did not (FIG. 22B). Additionally, GFP
expression was induced by low iron levels in the host environment
since spores used for infecting mice were grown in iron-rich medium
(condition that suppresses the expression of FTR1) and did not
fluoresce green when used to infect mice (FIG. 22B, DIC overlaid
with fluorescence).
EXAMPLE 13
Isolation of a Homokaryotic ftr1 Null Could not be Achieved in
Multinucleated R. oryzae Despite Integration of the Disruption
Cassette at the FTR1 Locus
[0168] The expression of FTR1 during active infection suggested a
role for FTR1 in the pathogenicity of R. oryzae. The effect of FTR1
gene disruption on the ability of R. oryzae to take up iron in
vitro and cause disease in vivo was studied. Isolates obtained from
two separate transformations were purified with one round of
sporulation and single colony isolation. To achieve single colony
isolation, transformants were grown on chemically defined medium
(YNB+CSM-URA) supplemented with 1 mM FeCl.sub.3 (iron rich) to
favor the segregation of the ftr1 null allele, since FTR1 is poorly
expressed in concentrations .gtoreq.350 .mu.M of FeCl.sub.3 (Fu et
al., FEMS Microbiol Lett 235: 169-176 (2004)). Isolates were
screened for integration of the disruption cassette with PCR primer
pairs FTR1-P3/PyrF-P9 (expected 1054 bp) and PyrF-P18/FTR1-P4
(expected 1140 bp). Disruption of the FTR1 locus was tested by the
absence of a PCR amplification product using primers
FTR1-P5/FTR1-P6 (expected 503), which amplified a segment from the
ORF of FTR1 (Table 2 and FIG. 23A). PCR confirmed integration of
the disruption cassette in the FTR1 locus, and absence of FTR1 ORF
from several putative null mutant strains (FIG. 23B). Furthermore,
these amplification products were also sequenced to demonstrate
that the disruption cassette had integrated into the FTR1 locus by
homologous recombination (data not shown). Finally, integration of
the disruption cassette in the FTR1 locus was confirmed by Southern
blotting (see below).
[0169] To study the expression of FTR1, we utilized GFP as a
reporter system for FTR1 promoter expression. R. oryzae M16 was
transformed with a plasmid containing the reporter gene GFP driven
by the FTR1 promoter (R. oryzae GFP1) as previously described
(Ibrahim et al., J Clin Invest 117: 2649-2657 (2007)). GFP was also
cloned under the constitutively expressed actin promoter (Act1p)
then transformed into R. oryzae M16 to serve as a positive control.
Prior to studying the expression of FTR1 in vivo we examined the
expression of FTR1 in vitro using FACS analysis. Briefly, R. oryzae
transformed with either. GFP driven by Ftr1p or Act1p were grown in
YNB+CSM-URA with (iron-depleted conditions) or without
(iron-replete conditions) 1 mM of ascorbic acid and ferrozine at
37.degree. C. for 12 h. These conditions produced germlings of R.
oryzae rather than hyphae. Fluorescence of 1 ml of germlings was
determined using a FACSCaliber (Becton Dickinson) instrument
equipped with an argon laser emitting at 488 nm. Fluorescence
emission was read with 515/40 bandpass filter. Fluorescence data
were collected with logarithmic amplifiers. The mean fluorescence
intensities of 104 events were calculated using CELLQUEST
software.
[0170] For in vivo infection, BALB/c male mice (>20 g) were
rendered diabetic with a single i.p. injection of 190 mg/kg
streptozotocin in 0.2 ml citrate buffer 10 days prior to fungal
challenge (Ibrahim et al. Antimicrob Agents Chemother 47: 3343-3344
(2003)). Glycosuria and ketonuria were confirmed in all mice 7 days
after streptozotocin treatment. Diabetic ketoacidotic mice were
infected with fungal spores by tail vein injection with a target
inoculum of 5.times.103 spores. To confirm the inoculum, dilutions
were streaked on PDA plates containing 0.1% triton and colonies
were counted following a 24 h incubation period at 37.degree. C.
For the intranasal infection, 107 spores in 20 .mu.l of 0.01% Tween
80 in PBS were placed on the nostrils of ketamine (100 mg/kg)
sedated mice ((Waldorf et al, Journal of Clinical Investigation 74:
150-160 (1984)). To confirm the inoculum, mice were sacrificed
immediately after inhaling R. oryzae spores, and lungs were
homogenized, plated on PDA containing 0.1% triton and colonies were
counted following incubation at 37.degree. C. For both models, the
primary efficacy endpoint was time to death. In some experiments,
as a secondary endpoint, brain and kidney fungal burden (primary
target organs) (Ibrahim et al., Antimicrob Agents Chemother 49:
721-727 (2005)) was determined by homogenization by rolling a
pipette on organs placed in Whirl-Pak bags (Nasco, Fort Atkinson,
Wis.) containing 1 ml saline. The homogenate was serially diluted
in 0.85% saline and then quantitatively cultured on PDA plates
containing 0.1% triton. Values were expressed as log 10 cfu g-1
tissue. To detect GFP expression, anti-GFP rabbit polyclonal
antibody (Novus) was used to stain the histopathological samples
then counter stained with FITC conjugated anti-rabbit antibody.
[0171] To quantify the expression of FTR1 in infected tissues,
brains of BALB/C mice infected with R. oryzae wild type (99-880)
through tail vein injection were collected 24 or 48 hr post
infection and immediately flash frozen in liquid nitrogen prior to
grinding and RNA extraction with phenol. Brains collected from
uninfected DKA mice were processed in parallel and served as
negative controls. Frozen brains were then ground under liquid
nitrogen and total RNA was then isolated using the hot phenol
method (Gravelat et al. Infect Immun 76: 3632-3639 (2008)).
Contaminating genomic DNA was removed from RNA samples by treatment
with 1 .mu.l of Turbo-DNase (Ambion) for 30 min at room
temperature. DNase was then removed using an RNA Clean-Up kit (Zymo
Research). First-strand cDNA synthesis was performed using the
Retroscript first-strand synthesis kit (Ambion). FTR1 specific
primers (listed in Table 2) were designed with the assistance of
online primer design software (Genscript). The amplification
efficiency was determined by serial dilution experiments, and the
resulting efficiency coefficient was used for the quantification of
the products (Pfaffl et al., Nucleic Acids Res 29: e45 (2001)).
[0172] Gene expression was analyzed by an ABI Prism 7000 Sequence
Detection System (Applied Biosystems) using the QuantiTect Sybr
Green PCR kit (Qiagen). PCR conditions were were 10 min at
90.degree. C. and 40 cycles of 15 s at 95.degree. C. and 1 min at
60.degree. C. Single PCR products were were confirmed with the heat
dissociation protocol at the end of the PCR cycles. The amount of
FTR1 expression in infected brains was normalized to either 18S
rRNA or ACTT (Table 2) and the quantified using the
2(-.DELTA..DELTA.C(T)) method (Livak and Schmittgen, (2001) Methods
25: 402-408 (2001)). All reactions were performed in duplicate, and
the mixture included a negative no-reverse transcription (RT)
control in which reverse transcriptase was omitted.
TABLE-US-00002 TABLE 2 Oligonucleotides used in this study. Primers
Sequence Description Primers used for detecting in vivo expression
of FTR1 FTR1-RT5' GGTGGTGTCTCCTTGGGTAT 5' primer FTR1-RT3'
AAGGAAACCGACCAAACAAC 3' primer 18S-RT5' CCAGACTGGCTTGTCTGTAATC 5'
primer annealing to rRNA 18S-RT3' AAGTCAAATTGTCGTTGGCA 3' primer
annealing to rRNA ACT1-RT5' TGAACAAGAAATGCAAACTGC 5' primer
ACT1-RT3' CAGTAATGACTTGACCATCAGGA 3' primer Primers used for making
the ftr1 disruption cassette and confirming integration in the FTR1
locus FTR1 P1 TTCGAAAAGACCGTCAGGATTAGC Annealing to FTR1- 5' UTR
FTR1 P2 GAGGGACACAAGCAAGCAGAAAGT Annealing to FTR1- 3' UTR FTR1 P3
CACTTACGGCCATTTTCCATTGAC Annealing to FTR1- 5' UTR upstream of the
disruption cassette FTR1 P4 CGCGCTAAATGAACAAAGAAT Annealing to
FTR1- 3' UTR downstream of the disruption cassette FTR1 P5
ATGTCTCAAGATCTCTTCAACCGTACC 5' primer testing for the entire FTR1
ORF (1100 bp) FTR1 P6 TTAAGCCTTAATAGCATCAGATTCG 3' primer testing
for the entire FTR1 ORF (1100 bp) FTR1 P11 GATCACTGCCATGGGTCTTGCTAT
5' primer to test for 503 bp of FTR1 ORF FTR1 P12
TATCATGTTGGCTTCTGGGTCTC 3' primer to test for 503 bp of FTR1 ORF
PyrF P9 GCCGTGGCGCAGACAAGAG 3' primer annealing to pyrF PyrF P18
GTGCCGAAATCGCTCCAGA 5' primer annealing to pyrF ACT1 P1
GTCTTTCCTTCTATTGTTGGTC 5' primer to test for functional template
DNA (600 bp) ACT1-P2 CCATCAGGAAGTTCATAAGAC 3' primer to test for
functional template DNA (600 bp) Primers used in making
PyrF-complemented R. oryzae PyrF P11 CAAAGCCAATTCAGCCTCAAATG 5'
primer to ampligy partial PyrF (815 bp) PyrF P13
CTTGGATCAGGGTGGACTCGTAG 3' primer to ampligy partial PyrF (815 bp)
Primers used to determine FTR1 copy number FTR1 P9
CCAACAGTGAAAAGTCATCCTTT 5' primer to amplify FTR1 (250 bp) FTR1 P10
GCAATAGGAATTGATTTTCCTTG 3' primeer to amplify FTR1 (250 bp) ACT1 P3
TATCGTTCTTGACTCTGGTGATG 5' primer to amplify actin (250 bp) ACT1 P4
GAAAGAGTGACCACGTTCAGC 3' primer to amplify actin (250 bp) Primers
used for making RNAi strain PyrF P14 CTCGAGGCTTTAGGTCAAATTGTGG 5'
primer to amplify 1641 bp of PyrF to clone in pRNAi-pdc PryF15
CCCGGGTTATTGCTTGATACCATAT 3' primer to TGTG amplify 1641 bp of PyrF
to clon in pRNAi-pdc FTR1 P7 GCGGCCGCGCTAGCGCATGCATGTCTC 5' primer
to AAGATCTCTTCAACGTACCGATC amplify 450 bp of FTR1 to clon in
pRNAi-pdc FTR1 P8 GACGTCCCGCGGGGCGCGCCGGTGATA 3' primer to
AAAGGCAAGACAAAGAACGCGTA amplify 450 bp of FTR1 to clon in pRNAi-pdc
18S rRNA P1 CATGGTTGAGATTGTAAGATAG 5' primer to amplify 18S rRNA
18S rRNA P2 AGTCAATGGACGTGGAGTC 3' primer to amplify 18S rRNA
Primers used for making synthetic FTR1p in E. coli SynFtr1p P5
CATCACCATGGGATCAAAAGAAT 5' primer to GTTTAATACTGAATCTCCA amplify
synthetic Ftr1p SynFtr1p P6 CTAATTAAGCTTGGCTTAAGCTTT 3' primer to
AATAGCATCAGATTCAATTTTTTC amplify synthetic Ftr1p
[0173] To disrupt the FTR1, we constructed a gene disruption
cassette encompassing a functional PyrF copy (998 bp) amplified
from R. oryzae wild-type flanked by 606 and 710 bp fragments of
FTR1-5' UTR and FTR1-3' UTR, respectively (FIG. 23A). The gene
disruption construct was PCR amplified using primers FTR1 P1/P2
(Table 2) in order to obtain a 2.3 kb disruption fragment
containing only the pyrF flanked by homologous FTR1 UTR sequence
(FIG. 23A). This was then used to transform R. oryzae M16 (pyrF
mutant) with biolistic bombardment (Skory, Mol Genet Genomics 268:
397-406 (2002)). The disruption cassette replaces the entire FTR1
coding region from -16 to the stop codon, with the pyrF gene
fragment. Isolates obtained from two separate transformations were
purified with one round of sporulation and single colony isolation
on chemically defined medium (YNB+CSM-URA) supplemented with 1 mM
FeCl3 (iron rich) to favor the segregation of the FTR1 null allele,
since FTR1 expression in this iron concentration is suppressed (Fu
et al., FEMS Microbiol Lett 235: 169-176 (2004)). Isolates were
tested for integration of the disruption cassette with PCR primer
pairs FTR1-P3/PyrF-P9 (expected 1054 bp) and PyrF-P18/FTR1-P4
(expected 1140 bp). Disruption of FTR1 was confirmed by the absence
of a PCR amplification product using primers FTR1-P5/FTR1-P6
(expected 503) to amplify the ORF of FTR1 and by Southern blot
analysis. In an effort to obtain a homokaryotic isolate containing
the FTR1 null allele, transformants with confirmed integration in
the FTR1 locus were further taken through 14 rounds of sporulation
and single colony isolation on YNB+CSM-URA supplemented with 1 mM
FeCl3.
[0174] We previously found that FTR1 is expressed in vitro in
iron-depleted conditions (FeCl.sub.3 concentration between 0-50
.mu.M) and suppressed in iron replete media (FeCl.sub.3
concentrations of .gtoreq.350 .mu.M) (Fu et al., FEMS Microbiol
Lett 235: 169-176 (2004)). To investigate if FTR1 disruption had an
effect on the ability of R. oryzae to grow in media with different
sources and concentration of iron, we compared growth of several
putative null mutant strains to growth of wild-type or
PyrF-complemented R. oryzae. Growth was compared on media (CSM-URA)
which had been previously chelated for iron and then supplemented
with defined concentrations of free iron (i.e. FeCl.sub.3 or
FeSO.sub.4) or iron complexed to deferoxamine [ferrioxamine] or
heme. Compared to wild-type or PyrF-complemented R. oryzae,
putative ftr.sup.1 null mutant strains had significantly less
growth at 48 h in iron-depleted media (i.e. free iron at 10 .mu.M)
(FIG. 23C). Ferrioxamine or iron complexed with heme at 100 .mu.M
(relatively depleted because iron is complexed) supported the
growth of the wild-type and PyrF-complemented strains better than
the putative ftr1 null mutant. However, free iron at 1000 .mu.M
(iron-rich media) supported the growth of all strains equally (FIG.
23C) consistent with our previous findings that ftr1 is primarily
expressed in iron-depleted environments.
[0175] Growth of the putative ftr1 disruption mutants were compared
to R. oryzae wild-type or R. oryzae PyrF-complemented strain by
growing on plates YNB+CSM-URA supplemented with 10 or 1000 .mu.M of
FeCl3, FeSO4, or with 100 .mu.M of heme, or ferroxamine as a source
of iron. Additionally, putative ftr1 null or RNAi mutants were
compared to their corresponding control strains for their growth on
YPD or chemically defined medium (i.e. YNB+CSM-URA). Briefly, ten
microliters of 105 spores of R. oryzae spores were spotted in the
center of plates and the mycelial diameter was measured after 48 h
of growth for medium containing FeCl3, FeSO4, or ferroxamine or for
72 h for plates supplemented with heme. The experiment was repeated
three times on different days and growth rate was expressed as
increase in mycelial diameter of the fungus per hour.
[0176] Interestingly, growth of the putative ftr1 null mutants
increased to levels similar to the wild-type and PyrF-complemented
strains after 96 h on iron-depleted media (data not shown).
Furthermore, PCR analysis of these cultures after 96 h of growth
confirmed that the FTR1 ORF was once again detectable in all of the
putative ftr1 null mutant transformants (FIG. 23D). Similar results
were obtained with several other putative ftr1 null mutants and it
was concluded that one round of sporulation and single colony
isolation was not sufficient to purify an ftr1 homokaryotic null
allele strain.
[0177] R. oryzae is known to be coenocytic and it is generally
presumed that sporangiospores are multinucleated, although the
number of nuclei has not been previously described (Ma et al., PLoS
Genet 5: e1000549 (2009)). Gene disruption appeared to be
complicated by the presence of heterokaryotic nuclei in both the
mycelium and sporangiospores, and the number of nuclei present in
swollen spores using DAPI staining was determined. Briefly, to
determine the number of nuclei present in R. oryzae spores, spores
in YPD medium were pregerminated for 2 h at 37.degree. C. Swollen
spores were washed once with cold PBS then suspended at a
concentration of 5.times.105/ml in PBS. One .mu.l of 50 .mu.g/ml of
4'6-diamidino-2-phenylindole (DAPI, Sigma) were added and the cells
were electroporated (BioRad) according to the manufacturer
instructions. The swollen spores were washed five times using cold
PBS prior to resuspending in 100 .mu.l PBS. Ten .mu.l sample was
placed on a glass slide and covered with a coverslip. The stained
cells were visualized using an epifluorescence microscope.
[0178] It was found that R. oryzae strain M16 had more than 10
nuclei per swollen spore (FIG. 24A). Given the high number of
nuclei present, 14 rounds of sporulation and single colony
isolation of putative ftr1 null mutants on iron-rich medium (i.e.
medium containing 1000 .mu.M of FeCl.sub.3) were performed to
segregate the null alleles by relieving the selective pressure for
maintaining FTR1 (since FTR1 is poorly expressed in iron-rich
conditions) (Fu et al., FEMS Microbiol Lett 235: 169-176 (2004)).
PCR analysis of the putative null mutants after 14 rounds of
selection demonstrated lack of amplification of FTR1 ORF (FIG.
24B). Similar to the results in FIG. 23C, the null mutant had
defective growth on iron limited sources for the first 48 h
compared to wild-type or PyrF-complemented strains. However, after
growth of the same putative null mutants in iron-depleted
environment (100 .mu.M ferrioxamine), the FTR1 ORF was once again
amplified by PCR. These results were confirmed with Southern blot
analysis (FIG. 24C). The Southern blot demonstrated almost complete
elimination of the FTR1 band (1960 kb) from gDNA of the putative
ftr1 null mutants grown on iron-rich medium, but return of the FTR1
band after growth of the same strain on iron-depleted medium (FIG.
24C). Additionally, Southern hybridization analysis confirmed the
site-specific integration of the disruption cassette into the ftr1
locus only when the putative ftr1 null mutant was grown in
iron-rich medium. Finally, there was no evidence of ectopic
integration or extrachromosomal replication, consistent with the
fact that the relative copy number of the ftr1 null allele was
dependent on the ratio of heterokaryotic nuclei.
[0179] To compare the copy number of FTR1 in the putative ftr1 null
mutant grown on iron-rich or iron-limited media or to those of
PyrF-complemented strain, qPCR was used. Briefly, genomic DNA was
extracted with the OmniPrep lysis buffer (GBiosciences) from
PyrF-complemented R. oryzae grown in YNB+CSM-URA supplemented with
1 mM FeCl3 or putative ftr1 null mutant grown in either YNB+CSM-URA
supplemented with 1 mM FeCl3 or 100 .mu.M ferrioxamine. FTR1 copy
number in each sample was determined by qPCR using an ABI Prism
7000 Sequence Detection System (Applied Biosystems) and
amplification products were detected with Power Sybr Green
Cells-to-CTTM kit (Applied Biosystems). PCR conditions were as
follows: denaturing at 95.degree. C. for 15 s min and amplification
40 cycles with annealing/extension carried out at 60.degree. C. for
1 min. FTR1 copy numbers were then normalized to R. oryzae ACT1,
and relative copy number was estimated using the formula
2.sup.-.DELTA..DELTA.CT, where .DELTA.CT=[Ct.sub.target
gene-Ct.sub.ACT1] and .DELTA..DELTA.CT=[.DELTA.CT of
mutant-.DELTA.CT of PyrF-complmented strain].
[0180] qPCR was used to quantify the copy number of FTR1 in a
putative ftr1 null mutant that was passed through 14 rounds of
sporulation and single colony isolation on iron-rich media, as well
as the same strain after growth in iron-depleted media, and the R.
oryzae PyrF-complemented strain. The putative ftr1 null mutant
strain grown in iron-rich media had a 60% reduction in the relative
copy number of FTR1 (normalized to ACT1 gene) compared to the same
strain grown in iron-depleted media or to the R. oryzae
PyrF-complemented strain (FIGS. 25A and 25B). Thus, while it was
possible to significantly decrease the relative copy number of
functional FTR1 in multinucleated R. oryzae, a homokaryotic isolate
of this mutant allele was not obtained.
EXAMPLE 14
Reduction of the FTR1 Copy Number Attenuates Iron Uptake In Vitro
and Reduces Virulence In Vivo
[0181] As shown herein, reduction of the relative copy number of
functional FTR1 in R. oryzae is sufficient to decrease iron uptake
and therefore reduce virulence. The putative ftr1 null mutant had a
.about.35% reduction in .sup.59Fe uptake compared to wild-type or
R. oryzae PyrF-complemented strain (FIG. 25C).
[0182] To determine the in vivo relevance of the diminished in
vitro iron uptake of the putative ftr1 null mutant, its virulence
was compared to R. oryzae wild-type or PyrF-complemented strains
during infection in mice with DKA. Mice were infected intravenously
(i.v.) or intranasally (i.n.) with strains that demonstrated
similar growth in vitro on iron-rich environment of YPD or CSM-URA
(0.185.+-.0.005 or 0.257.+-.0.003 cm/h for the putative ftr1 null
vs. 0.188.+-.0.008 or 0.260.+-.0.0051cm/h for the PyrF-complemented
on iron rich CSM-URA or YPD medium, respectively) (FIG. 26A). In
both models, the putative ftr1 null mutant showed reduced virulence
compared to the wild-type or PyrF-complemented strain (62% vs. 100%
mortality for mutant vs. control strains in mice with disseminated
infection, and 44% vs. 75% mortality for mutant vs. control strains
in the intranasal model) (FIG. 26B,C). As expected colonies
retrieved from moribund animals infected with the putative ftr1
null mutant strain demonstrated similar copy numbers of FTR1
compared to the pyrF-complemented strain (data not shown),
indicative of restoration of FTR1 copy number as was seen after
growth in iron-depleted environments in vitro. Additionally, in
both models the pyrF-complemented strain had similar virulence to
the wild-type R. oryzae, demonstrating that restoration of the pyrF
gene in its original locus does not affect virulence.
EXAMPLE 15
Inhibition of FTR1 Gene Expression by RNAi Reduces Iron Uptake and
Diminishes Virulence of R. oryzae
[0183] To confirm the phenotypes seen after gene disruption, RNA
interference (RNAi) was used to diminish FTR1 expression in R.
oryzae.
[0184] RNA interference (RNAi) technology was utilized to inhibit
the expression of FTR1 in R. oryzae. A 450 bp fragment of FTR1 ORF
containing the REGLE motif believed to interact with iron during
uptake (Stearman et al., Science 271: 1552-1557 (1996)) was PCR
amplified and cloned as an inverted repeat under control of the
Rhizopus expression vector pPdcA-Ex (Mertens et al., Archives of
microbiology 186: 41-50 (2006)). Additionally, an intron from the
Rhizopus pdcA gene (Skory, Curr Microbiol 47: 59-64 (2003)) was
included between repeat to serve as a linker for stabilization of
the intended dsRNA structure (Nakayashiki et al., Fungal Genet Biol
42: 275-283 (2005); Wesley et al. Plant J 27: 581-590 (2001)). The
generated plasmid was transformed into R. oryzae pyrF mutant using
the biolistic delivery system (BioRad) and transformants were
selected on minimal medium lacking uracil.
[0185] Southern blot analysis (data not shown) revealed that all
RNAi transformants maintained the transformed plasmid
extrachromosomally, consistent with the fact that we did not
linearize the plasmid during transformation (Skory, Mol Genet
Genomics 268: 397-406 (2002)). FTR1 expression was compared by
end-point RT-PCR in five transformants vs. the control strain (i.e.
R. oryzae pyrf null mutant [M16] transformed with empty-plasmid).
FTR1 expression was almost completely blocked in 4 transformants,
while readily detected in the control strain (FIG. 27A).
Amplification of 18s rDNA with the same RT templates demonstrated
the integrity of the starting sample and the lack of PCR
inhibitors. Inhibition of FTR1 expression by RNAi was specific,
with no apparent reduction in off-site gene expression. A
representative RNAi transformant demonstrated similar growth to
control strain when grown on either iron rich YPD or CSM-URA media
(0.193.+-.0.082 or 0.205.+-.0.016 cm/h for the transformant vs.
0.201.+-.0.087 or 0.211.+-.0.011cm/h for the control strain on iron
rich CSM-URA or YPD medium, respectively) (FIG. 27B).
[0186] The ability to take up iron was tested in vitro of the
transformant with near complete inhibition of FTR1 expression and
similar growth to the control strain. Interestingly, RNAi decreased
.sup.59Fe uptake by R. oryzae more effectively than did gene
disruption, with .about.50% inhibition of iron uptake at all times
tested (FIG. 27C). Briefly, to characterize the effect of FTR1
manipulation on the ability of R. oryzae to take up iron in vitro,
ftr1 putative disruption mutant or the RNAi mutant were compared to
wild-type or R. oryzae PyrF-complemented strains in their ability
to accumulate intracellular .sup.59FeCl3 (Amersham Pharmacia
Biotech) using a modification of our published method (Fu et al.,
FEMS Microbiol Lett 235: 169-176 (2004)). Spores were
pre-germinated for 3 h YPD medium supplemented with 1 mM ferrozine
and 1 mM ascorbic acid at 37.degree. C. with shaking. Cells were
harvested by centrifugation, washed twice with ice cold assay
buffer pH 6.1 (minimal medium+10 mM 4-morpholinepropanesulfonic
acid+1 mM ferrozine), and then resuspended in assay buffer without
any ferrozine to give a concentration of 108 cells per ml. To
measure uptake of .sup.59Fe, 50 .mu.l of the cell suspension was
added to 450 .mu.l of chilled assay buffer without ferrozine but
supplemented with 0.11M 59FeCl3, and incubated in a shaking water
bath at 30.degree. C. After selected time points, the assay samples
were chilled on ice, vortexed, vacuum filtered through Whatman GF/C
filters and washed with 10 ml ice cold SSW (1 mM EDTA, 20 mM
Na3-citrate pH 4.2, 1 mMKH2PO4, 1 mM CaCl2, 5 mM MgSO4, 1 mM NaCl).
Filters were removed and placed in glass scintillation vials
containing 10 ml scintillation fluid (Filter-count).
Cell-associated .sup.59Fe was counted in a Packard 2200CA liquid
scintillation counter (Packard Instrument Co., Downers Grove,
Ill.). Nonspecific uptake due to cell surface adsorption was
determined by preparing parallel assays that were held on ice for
10 min before filtration and washing. The background levels of
.sup.59Fe were subtracted before calculation of uptake rates. The
experiment was carried out in triplicate and repeated three times
on different days. The data is presented as specific uptake in
pmole/5.times.10.sup.6 germinated spores.
[0187] Next, the virulence of the RNAi transformant was compared to
the control strain in the DKA mouse models of hematogenously
disseminated or intranasal mucormycosis. The RNAi-transformant
demonstrated reduced virulence compared to the control strain in
both models (75% vs. 100% mortality for RNAi transformant vs.
control strain in mice with disseminated infection, and 11% vs. 67%
mortality for RNAi transformant vs. control in the intranasal
model, p<0.02 for both comparisons by Log Rand test) (FIG.
28A,B). Interestingly, strains recovered from kidneys of mice that
died of infection with the RNAi transformant had lost the RNAi
plasmid as evident by growth of R. oryzae colonies on YPD plates
and not YNB+CSM-URA (data not shown), and hence had regained
ability to express FTR1. In contrast, strains recovered from
kidneys of mice that survived the infection through day 25, when
the experiment was terminated, had not lost their RNAi plasmid.
Additionally, mice infected intravenously with the RNAi
transformant had a .about.6- and 3-fold reduction in kidney and
brain fungal burden compared to mice infected with control strain,
respectively (FIG. 28C). These data demonstrate that the FTR1 gene
product is a pivotal virulence factor for R. oryzae in DKA
mice.
EXAMPLE 16
Passive Immunization with Sera Collected from Mice Vaccinated with
Ftr1p Protects Mice from R. oryzae Infection
[0188] This example demonstrates that passive immunization
targeting FTR1 would protect against mucormycosis.
[0189] To generate immune serum for passive immunization, mice were
immunized by SQ injection of Ftr1p mixed with complete Freund's
adjuvant (CFA) followed by a boost with another dose of the antigen
with incomplete Freund's adjuvant (IFA) at day 21, and bled for
serum collection two weeks later. Another set of mice were
vaccinated with supernatants collected from E. coli transformed
with empty plasmid to generate non-immune control serum. Antibody
titers were determined using ELISA plates coated with 5 .mu.g of
synthetic recombinant Ftr1p as we previously described (Ibrahim et
al., Infect Immun 73: 999-1005 (2005)). Immune or control sera
(0.25 ml) were administered i.p. to diabetic ketoacidosis recipient
mice 2 h before intranasal infection with 2.5.times.107 R. oryzae
99-880 spores. Sera doses were repeated 3 days post infection and
survival of mice was followed for 35 days post infection. Pooled
sera collected from vaccinated mice had anti-Ftr1p IgG titers of
>1:800,000, whereas pooled sera collected from negative control
mice vaccinated with purified supernatant from an empty plasmid
transformed clone had an anti-Ftr1p IgG titer of 1:200.
Administration of immune sera to DKA mice subsequently infected
intranasally with R. oryzae significantly improved survival
compared to mice treated with control serum (63% vs. 0% survival
for immune sera vs. non-immune sera, p<0.001) (FIG. 28D).
[0190] Throughout this application various publications have been
referenced. The disclosures of these publications in their
entireties are hereby incorporated by reference in this application
in order to more fully describe the state of the art to which this
invention pertains.
[0191] Although the invention has been described with reference to
the disclosed embodiments, those skilled in the art will readily
appreciate that the specific examples and studies detailed above
are only illustrative of the invention. It should be understood
that various modifications can be made without departing from the
spirit of the invention. Accordingly, the invention is limited only
by the following claims.
Sequence CWU 1
1
4411107DNARhizopus oryzae 1atgtctcaag atctcttcaa cgtaccgatc
ttctttatcc tttttcgtga aacgactgag 60gcagccatca ttatttctgt cctcttgtca
ttcttgaaga gaatgtttaa tacagaatct 120cctgtttata aacgtctcag
aaatcaagtc tggattggtg gtgcagctgg tctgtttatc 180tgtttatgta
tcggtgctgc cttcattgcc gtttactaca ctgtccttaa tgacttgtgg
240ggaaattctg aagatatctg ggaaggtgtc ttctctctgg ttgctgtgat
catgatcact 300gccatgggtc ttgctatgct caagactgaa cgtatgcaag
aaaagtggaa ggtcaagttg 360gctaaagcaa tgcaaaagtc caacagtgaa
aagtcatcct ttaaagaaaa acttcaaaaa 420tacgcgttct ttgtcttgcc
ttttatcacc gttctcagag aaggacttga agctgttgtc 480tttattggtg
gtgtctcctt gggtatccaa ggaaaatcaa ttcctattgc tgccatcatg
540ggtatcatct gtggttgttt ggtcggtttc cttatttacc gtggtggttc
cttgattcaa 600cttcgttggt tctttgtgtt ctctactgtc gttctttacc
ttgtcgctgc tggtttgatg 660gctaaaggtg ttggttacct tgaacaaaat
gcttggaatc aagtcattgg tggtgaagct 720gctgatgtca ttagttacag
agtctcaacc gctgtctggc acgtttcttg gggagaccca 780gaagccaaca
atgatacctc tggtggttgg caaatcttta acgccattct tggttggaac
840aatacggcta cttatggttc tatcatcagt tactgtctct actggctctt
tgtctgctgt 900tatcttgtct ttagttactt taaggaaaag cgtgctgcta
tccgtaaagc cgaggctggt 960gaatgggatg atggtgatga agctttggag
aatgccaaac aatacattgg taatgatggt 1020gaattcatcg ttgaagacaa
agaatctgat gaagaagcca acaatcatcc caaggaaaaa 1080atcgaatctg
atgctattaa ggcttaa 11072368PRTRhizopus oryzae 2Met Ser Gln Asp Leu
Phe Asn Val Pro Ile Phe Phe Ile Leu Phe Arg1 5 10 15Glu Thr Thr Glu
Ala Ala Ile Ile Ile Ser Val Leu Leu Ser Phe Leu 20 25 30Lys Arg Met
Phe Asn Thr Glu Ser Pro Val Tyr Lys Arg Leu Arg Asn 35 40 45Gln Val
Trp Ile Gly Gly Ala Ala Gly Leu Phe Ile Cys Leu Cys Ile 50 55 60Gly
Ala Ala Phe Ile Ala Val Tyr Tyr Thr Val Leu Asn Asp Leu Trp65 70 75
80Gly Asn Ser Glu Asp Ile Trp Glu Gly Val Phe Ser Leu Val Ala Val
85 90 95Ile Met Ile Thr Ala Met Gly Leu Ala Met Leu Lys Thr Glu Arg
Met 100 105 110Gln Glu Lys Trp Lys Val Lys Leu Ala Lys Ala Met Gln
Lys Ser Asn 115 120 125Ser Glu Lys Ser Ser Phe Lys Glu Lys Leu Gln
Lys Tyr Ala Phe Phe 130 135 140Val Leu Pro Phe Ile Thr Val Leu Arg
Glu Gly Leu Glu Ala Val Val145 150 155 160Phe Ile Gly Gly Val Ser
Leu Gly Ile Gln Gly Lys Ser Ile Pro Ile 165 170 175Ala Ala Ile Met
Gly Ile Ile Cys Gly Cys Leu Val Gly Phe Leu Ile 180 185 190Tyr Arg
Gly Gly Ser Leu Ile Gln Leu Arg Trp Phe Phe Val Phe Ser 195 200
205Thr Val Val Leu Tyr Leu Val Ala Ala Gly Leu Met Ala Lys Gly Val
210 215 220Gly Tyr Leu Glu Gln Asn Ala Trp Asn Gln Val Ile Gly Gly
Glu Ala225 230 235 240Ala Asp Val Ile Ser Tyr Arg Val Ser Thr Ala
Val Trp His Val Ser 245 250 255Trp Gly Asp Pro Glu Ala Asn Asn Asp
Thr Ser Gly Gly Trp Gln Ile 260 265 270Phe Asn Ala Ile Leu Gly Trp
Asn Asn Thr Ala Thr Tyr Gly Ser Ile 275 280 285Ile Ser Tyr Cys Leu
Tyr Trp Leu Phe Val Cys Cys Tyr Leu Val Phe 290 295 300Ser Tyr Phe
Lys Glu Lys Arg Ala Ala Ile Arg Lys Ala Glu Ala Gly305 310 315
320Glu Trp Asp Asp Gly Asp Glu Ala Leu Glu Asn Ala Lys Gln Tyr Ile
325 330 335Gly Asn Asp Gly Glu Phe Ile Val Glu Asp Lys Glu Ser Asp
Glu Glu 340 345 350Ala Asn Asn His Pro Lys Glu Lys Ile Glu Ser Asp
Ala Ile Lys Ala 355 360 36535PRTUnknownDescription of Unknown
Conserved motif sequence derived from multiple organisms 3Arg Glu
Gly Leu Glu1 546PRTArtificial SequenceDescription of Artificial
Sequence Synthetic 6xHis tag 4His His His His His His1
5520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 5ggtggtgtct ccttgggtat 20620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
6aaggaaaccg accaaacaac 20722DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 7ccagactggc ttgtctgtaa tc
22820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 8aagtcaaatt gtcgttggca 20921DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
9tgaacaagaa atgcaaactg c 211023DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 10cagtaatgac ttgaccatca gga
231124DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 11ttcgaaaaga ccgtcaggat tagc 241224DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
12gagggacaca agcaagcaga aagt 241324DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
13cacttacggc cattttccat tgac 241421DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
14cgcgctaaat gaacaaagaa t 211527DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 15atgtctcaag atctcttcaa
ccgtacc 271625DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 16ttaagcctta atagcatcag attcg
251724DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 17gatcactgcc atgggtcttg ctat 241823DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
18tatcatgttg gcttctgggt ctc 231919DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 19gccgtggcgc agacaagag
192019DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 20gtgccgaaat cgctccaga 192122DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
21gtctttcctt ctattgttgg tc 222221DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 22ccatcaggaa gttcataaga c
212323DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 23caaagccaat tcagcctcaa atg 232423DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
24cttggatcag ggtggactcg tag 232523DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 25ccaacagtga aaagtcatcc ttt
232623DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 26gcaataggaa ttgattttcc ttg 232723DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
27tatcgttctt gactctggtg atg 232821DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 28gaaagagtga ccacgttcag c
212925DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 29ctcgaggctt taggtcaaat tgtgg 253029DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
30cccgggttat tgcttgatac catattgtg 293150DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
31gcggccgcgc tagcgcatgc atgtctcaag atctcttcaa cgtaccgatc
503250DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 32gacgtcccgc ggggcgcgcc ggtgataaaa ggcaagacaa
agaacgcgta 503322DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 33catggttgag attgtaagat ag
223419DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 34agtcaatgga cgtggagtc 193542DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
35catcaccatg ggatcaaaag aatgtttaat actgaatctc ca
423648DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 36ctaattaagc ttggcttaag ctttaatagc atcagattca
attttttc 4837368PRTRhizopus oryzae 37Met Ser Gln Asp Leu Phe Asn
Val Pro Ile Phe Phe Ile Leu Phe Arg1 5 10 15Glu Thr Thr Glu Ala Ala
Ile Ile Ile Ser Val Leu Leu Ser Phe Leu 20 25 30Lys Arg Met Phe Asn
Thr Glu Ser Pro Val Tyr Lys Arg Leu Arg Asn 35 40 45Gln Val Trp Ile
Gly Gly Ala Ala Gly Leu Phe Ile Cys Leu Cys Ile 50 55 60Gly Ala Ala
Phe Ile Ala Val Tyr Tyr Thr Val Leu Asn Asp Leu Trp65 70 75 80Gly
Asn Ser Glu Asp Ile Trp Glu Gly Val Phe Ser Leu Val Ala Val 85 90
95Ile Met Ile Thr Ala Met Gly Leu Ala Met Leu Lys Thr Glu Arg Met
100 105 110Gln Glu Lys Trp Lys Val Lys Leu Ala Lys Ala Met Gln Lys
Ser Asn 115 120 125Ser Glu Lys Ser Ser Phe Lys Glu Lys Leu Gln Lys
Tyr Ala Phe Phe 130 135 140Val Leu Pro Phe Ile Thr Val Leu Arg Glu
Gly Leu Glu Ala Val Val145 150 155 160Phe Ile Gly Gly Val Ser Leu
Gly Ile Gln Gly Lys Ser Ile Pro Ile 165 170 175Ala Ala Ile Met Gly
Ile Ile Cys Gly Cys Leu Val Gly Phe Leu Ile 180 185 190Tyr Arg Gly
Gly Ser Leu Ile Gln Leu Arg Trp Phe Phe Val Phe Ser 195 200 205Thr
Val Val Leu Tyr Leu Val Ala Ala Gly Leu Met Ala Lys Gly Val 210 215
220Gly Tyr Leu Glu Gln Asn Ala Trp Asn Gln Val Ile Gly Gly Glu
Ala225 230 235 240Ala Asp Val Ile Ser Tyr Arg Val Ser Thr Ala Val
Trp His Val Ser 245 250 255Trp Gly Asp Pro Glu Ala Asn Asn Asp Thr
Ser Gly Gly Trp Gln Ile 260 265 270Phe Asn Ala Ile Leu Gly Trp Asn
Asn Thr Ala Thr Tyr Gly Ser Ile 275 280 285Ile Ser Tyr Cys Leu Tyr
Trp Leu Phe Val Cys Cys Tyr Leu Val Phe 290 295 300Ser Tyr Phe Lys
Glu Lys Arg Ala Ala Ile Arg Lys Ala Glu Ala Gly305 310 315 320Glu
Trp Asp Asp Gly Asp Glu Ala Leu Glu Asn Ala Lys Gln Tyr Ile 325 330
335Gly Asn Asp Gly Glu Phe Ile Val Glu Asp Lys Glu Ser Asp Glu Glu
340 345 350Ala Asn Asn His Pro Lys Glu Lys Ile Glu Ser Asp Ala Ile
Lys Ala 355 360 36538381PRTCandida albicans 38Met Val Asp Val Phe
Asn Val Gln Ile Phe Phe Ile Val Phe Arg Glu1 5 10 15Ser Leu Glu Ala
Ile Ile Val Val Ser Val Leu Leu Ala Phe Val Lys 20 25 30Gln Ser Met
Gly Gly Ser Ser Asp Pro Gln Leu Lys Lys Arg Leu Tyr 35 40 45Arg Gln
Ile Trp Leu Gly Ala Gly Leu Gly Val Leu Val Cys Leu Tyr 50 55 60Gly
Val Leu Ser Ile Gly Ala Ser Tyr Gly Leu Gly Lys Asp Ile Phe65 70 75
80Gly Val Ile Ser Glu Asp Leu Trp Glu Gly Ile Phe Cys Ile Ile Ala
85 90 95Thr Val Leu Ile Thr Ala Met Gly Ile Pro Met Leu Arg Ile Asn
Lys 100 105 110Met Lys Glu Lys Trp Arg Val Lys Leu Ala Gln Ala Leu
Ile Lys Ser 115 120 125Pro Thr Asn Lys Lys Asp Arg Phe Lys Leu Gly
Tyr Leu Gly Lys Lys 130 135 140Tyr Ala Leu Phe Ile Leu Pro Phe Leu
Gln Val Leu Arg Glu Gly Leu145 150 155 160Glu Ala Val Val Phe Val
Gly Gly Val Gly Leu Asn Ser Pro Ala Thr 165 170 175Ser Phe Pro Ile
Pro Val Ile Val Gly Leu Ile Ala Gly Ile Val Val 180 185 190Gly Ala
Leu Leu Tyr Tyr Phe Gly Ser Ser Met Ser Met Gln Ile Phe 195 200
205Leu Ile Ile Ser Thr Cys Ile Leu Tyr Leu Ile Ala Ala Gly Leu Phe
210 215 220Ser Arg Gly Ile Trp Tyr Phe Glu Thr Asn Thr Tyr Asn Lys
Lys Thr225 230 235 240Gly Gly Asp Ala Ser Glu Asn Gly Ser Gly Pro
Gly Thr Tyr Asp Ile 245 250 255Ser Lys Ser Val Trp His Val Asn Cys
Arg Asn Pro Glu Thr Asp Asn 260 265 270Gly Trp Asp Ile Phe Asn Ala
Ile Leu Gly Trp Gln Asn Ser Ala Thr 275 280 285Tyr Gly Ser Val Ile
Ser Tyr Asn Ile Tyr Trp Leu Phe Ile Ile Cys 290 295 300Val Leu Leu
Leu Met Val Tyr Glu Glu Lys His Gly His Leu Pro Phe305 310 315
320Thr Lys Asn Leu Thr Leu Val Gln Leu Asn Pro Met Tyr His Ile Lys
325 330 335Gly Lys Lys Lys Leu Glu Leu Asn Lys Ala Glu Lys Asp Glu
Leu Phe 340 345 350Thr Lys Leu Gln Gln Gln Asn Phe Gly Gln Ala Ala
Glu Val Asp Glu 355 360 365Thr Ser Ser Asn Lys Gln Met Asp Ser Gln
Glu Asn Ser 370 375 38039404PRTSaccharomyces cerevisiae 39Met Pro
Asn Lys Val Phe Asn Val Ala Val Phe Phe Val Val Phe Arg1 5 10 15Glu
Cys Leu Glu Ala Val Ile Val Ile Ser Val Leu Leu Ser Phe Leu 20 25
30Lys Gln Ala Ile Gly Glu His Asp Arg Ala Leu Tyr Arg Lys Leu Arg
35 40 45Ile Gln Val Trp Val Gly Val Leu Leu Gly Phe Ile Ile Cys Leu
Ala 50 55 60Ile Gly Ala Gly Phe Ile Gly Ala Tyr Tyr Ser Leu Gln Lys
Asp Ile65 70 75 80Phe Gly Ser Ala Glu Asp Leu Trp Glu Gly Ile Phe
Cys Met Ile Ala 85 90 95Thr Ile Met Ile Ser Met Met Gly Ile Pro Met
Leu Arg Met Asn Lys 100 105 110Met Gln Ser Lys Trp Arg Val Lys Ile
Ala Arg Ser Leu Val Glu Ile 115 120 125Pro His Arg Lys Arg Asp Tyr
Phe Lys Ile Gly Phe Leu Ser Arg Arg 130 135 140Tyr Ala Met Phe Leu
Leu Pro Phe Ile Thr Val Leu Arg Glu Gly Leu145 150 155 160Glu Ala
Val Val Phe Val Ala Gly Ala Gly Ile Thr Thr Gln Gly Ser 165 170
175His Ala Ser Ala Tyr Pro Leu Pro Val Val Val Gly Leu Ile Cys Gly
180 185 190Gly Leu Val Gly Tyr Leu Leu Tyr Tyr Gly Ala Ser Lys Ser
Ser Leu 195 200 205Gln Ile Phe Leu Ile Leu Ser Thr Ser Ile Leu Tyr
Leu Ile Ser Ala 210 215 220Gly Leu Phe Ser Arg Gly Ala Trp Tyr Phe
Glu Asn Tyr Arg Phe Asn225 230 235 240Leu Ala Ser Gly Gly Asp Ala
Ser Glu Gly Gly Asp Gly Asn Gly Ser 245 250 255Tyr Asn Ile Arg Lys
Ala Val Tyr His Val Asn Cys Cys Asn Pro Glu 260 265 270Leu Asp Asn
Gly Trp Asp Ile Phe Asn Ala Leu Leu Gly Trp Gln Asn 275 280 285Thr
Gly Tyr Leu Ser Ser Met Leu Cys Tyr Asn Ile Tyr Trp Leu Val 290 295
300Leu Ile Ile Val Leu Ser Leu Met Ile Phe Glu Glu Arg Arg Gly
His305 310 315 320Leu Pro Phe Thr Lys Asn Leu Gln Leu Lys His Leu
Asn Pro Gly Tyr 325 330 335Trp Ile Lys Asn Lys Lys Lys Gln Glu Leu
Thr Glu Glu Gln Lys Arg 340 345 350Gln Leu Phe Ala Lys Met Glu Asn
Ile Asn Phe Asn Glu Asp Gly Glu 355 360 365Ile Asn Val Gln Glu Asn
Tyr Glu Leu Pro Glu Gln Thr Thr Ser His 370 375 380Ser Ser Ser Gln
Asn Val Ala Thr Asp Lys Glu Val Leu His Val Lys385 390 395 400Ala
Asp Ser Leu40969DNAAspergillus fumigatus 40atgatcggag cgttctatgg
atatggtaag gatcacttcg ctagcacgga ggacctgtgg 60gagggcatct
tctccctgat
cgccagtgtc atcatcacca ttatgggtgc tgccctgctt 120cgtgtcacca
agttgcagga gaagtggcgc gtcaagctag ctcaagccct ggaagcaaag
180ccgttgactg gcggcacatt caaaaacaac ctcaaacttt gggcggagaa
atacgccatg 240tttctcctcc ccttcatcac cgttctccga gaaggcctgg
aagcagtggt gttcattgga 300ggcgtcagtc tcagttttcc tgcaactgcc
ttccctctac ctgtttttac tggcattctc 360gcaggagtgg ccattgggta
cctactgtat cggtatgttg aaacccctga atcagctgtc 420tttctcaaat
agaccaccat gctgatggtc tgcagaggag gaaaccaagc ctccctccag
480atcttcctga tcatctccac ttgcatcctc tacctggttg ctgccggcct
cttctcccga 540ggcgtctggt atctggagaa caatacttgg aaccacgtaa
ttggtggtga tgctgccgag 600acaggtgccg gtccgggatc gtatgacatc
cgacagagcg tctggcatgt caactgctgt 660agtcctctcg ttaatggtgg
cgggggatgg ggtatcttca acgccatcct tggctggaca 720aactcggcaa
cctatggctc cgttctttca tacaaccttt actggattgc ggtgatcgtc
780tggtttgtgg ctatgcgtca caaggaacgc catggacgat tgcctgtggt
cgaccctctg 840ctgaatcggc tgcgaggccg aaagtctgcc gaacctggga
atggagagca agatgtcgag 900gtcagcacga taccatctga tttgcagacg
gagtccaaaa taccgaaaag cggagcatcc 960cttgtctga 969411089DNACandida
guilliermondii 41atgaactttg aagactactt ctcggttcaa atcttcttta
taatcctccg agaaacgttg 60gagaccgcta tagtgatttc ggttcttctt tcgttcatca
atcaaagaag ccaagaagca 120aatgaccgag gaaattctgc taatgaagct
gctcatactc gaggattgcg ggtccaggta 180tgggccgggg ccttaatggg
atttgttgtg tgttttgcca tcggagtggc atttgtggtt 240gcattttatg
tcattggaga gaactactgg ctgtatgctg aaagactctg ggagggtatt
300ttctcgcttc tttcgagtat aataatcaca gtgatgggta tcggattgct
acgtataaac 360cgcgtgatga aagttaagtg gtttgctaag ttgggtgatg
cctttgatct gcattcgcac 420ggtagaggcc ataaaaagaa gtactttctt
gcattattac catttataac cacactcaga 480gaaggcttgg aggccgtggt
attcgtgggt ggaattggtc tttcgctgcc agtttcttcc 540atcccatttt
ccattctcag tggaatctgt gtgggatcca caatcggtta cactttgtac
600aaaggaggca acaagctttc tctccaatac ttcctcatct tgctgacctg
ctttttgtac 660atagttctgg cagggcttat gagtagagga gtatggtttt
tggaactcga gctgtatgtg 720agaaaatgtg gaggactcga cgttagcgaa
acaggtagtg gacctggatc ttatgatcct 780gctacaagcg tgtggcatgt
caattgctgt aacggactca cagatggctg gtggatggtt 840ttaaatgctc
ttgttggctg gaccaattcc gcaacttatg gcagcgtagg tgcttattgt
900gcctattgga tattggtcat ttcatggctt gagatccgct tgtacgaaga
gcatcatgga 960ctcttaccct ttgttcctgt gcgttggcag ttgaagcgta
tcagaaaaaa aatcaaatta 1020tacgaagccc gggccaaaca tggcgctgca
atagaggctg aaacagaggc agaattactc 1080atggaataa
108942996DNAAspergillus flavus 42agccctcttt cattcctttc tgaagcctct
accttccact caacatggca accgatgtat 60ttgcagttcc cagtatgcat tcttttcttg
ttatgcccca tctattaatc aggaactaac 120ttagtttgac taacttatcg
aagtattctt catctgcttt cgagaatgcg ttgagaccag 180catcattgtt
tcggtattac ttgccttcat caagcagacg ctggggtcgg acacggatgc
240ctttactcgc aaaaggctta tcaaacaggt tactaccatc ttctcattcc
gtccccaccc 300tatagagaca acattgacga tcaataggtc tggtggggag
ttgcggtcgg gctgtttata 360tgcctctgta ttggaggtgg tatgattggg
gccttctacg ggtatggcaa ggaccatttt 420gccagcacgg aggatttatg
ggaaggcatc tttgctttag tcgccgccgt catcatcaca 480gtcatgggag
cagcccttct gcgggtgaat aaactgcagg agaaatggcg tgtcaagctg
540gcccaggcat tggcggcaaa acctcaacct caagggagaa tgacagacaa
gatcaagcaa 600tggtcacaga agtatttcat gttcatctta cccttcatta
cggtacttcg ggagggtcta 660gaggctgtgg tgtttatcgg gggtgttagt
ctcagcttcc ccgcaagcgc gttccctctc 720cctgtattca cgggactctt
ggctggtgtg gtagttggtt atatcattta ccggtgagtg 780tgatatgggc
ggcattgaaa ctgaatccca atgctgatag tagtctttgc gatttatcat
840aggggcggga atcaaacctc acttcagata ttcatggtca tctcgacatg
tctgctctac 900ttggtcgctg ctggactttt gtcccgaggc gtctggttct
tggagaacaa cacttggagc 960aacctcatcg gtggcgatgc ctcagaaacg ggagct
996431341DNAAspergillus flavus 43atggcaaatc aagtctttgc agtcactggt
aactctcatt atactctctg agtctgcttt 60tgtacaagac gaccgttgct gaccgtgtat
agtctttttc atttgcttcc gagaatgtct 120cgaaagcagt atcattgtat
cggtgcttct tgccttcctc acccaaactt tgggtgctga 180aggagacaag
gcagctctga agagattgcg aatacaggtg agtgtccttc cctatttctt
240tatacctttg tttatcatga acatcattcg ataatgagct gctaacaata
acaggtatgg 300tgtggagtag gtttaggtct attcttgtgc ctatgtatcg
gtgcaggtat gatcggagct 360ttctacgggt tggaaaaaga taccttcacg
aacacagagg atatctggga aggcattttt 420ggctttatag catccatcat
tatttctatc atgggggcgg gccttttgcg tgtgaacaaa 480atgcgcgaga
aatggcgcgt caagctctcc cgtgccttgg agaaaaagga aaagtctacg
540accataatgg gtcgtctgaa ggactggtcc gagaaatatg tcatgttcat
cttgccattc 600gttaccgttc ttcgagaggg acttgaggct atcgtttatg
tcggtggtgt gggactggga 660ttgccagcgt cttcattccc cttggccgtg
ttctgtggcc ttttggctgg tgttgcagta 720ggctatgtga tgtatcggta
agtcttgtgc gttacattct gtctacttta agaatcatta 780tctgcacagt
atcgttcgac ggtggctaac gaatcttgat gcaggggtgg aagctcaact
840tccttacagt actttctgat tatatctact tgcttcctct acttggtcgc
cgcaggcttg 900ttttcccgcg ctgtctggta cctggagaat aatacctgga
accatgtcat tggtggagat 960gcttctgaga ccggctcagg ccctggatct
tacgatattc gccagagtgt ctggcatgta 1020aactgctgta acccagagct
tggcggtggt ggtggttggg gtatcttcaa cgctctgttt 1080gggtggacca
attccgccac ctatggatca gtgctatctt acaaccttta ctgggtagtg
1140atcattacct catacgtctg catgaggtac aatgagaagc acggctacat
tcccgtctta 1200acaccgatcg caaggaagct gaagcttggt cgattcaaga
agggctctga ggaagaacat 1260gtccccgagg ttgtcgaaga gaggaaggag
gttaaccatc tggcccggca aattgttacc 1320agaacaatga gtgaagcata g
1341441437DNACandida tropicalis 44atggcacaga tcgaggagta cttttctgtt
cagatattct ttatcattct cagagagact 60cttgaaacag ctatcatcat ctcggtgttg
ctatccttca tcaaccaacg ttcgcacaag 120catggctccc agtctcagaa
catagcagta tcatcgtcat caccatcgac atcatcacct 180ggttcagtgg
accccgccga tgagccacta ccttcgagtt caaccactgt caccccggga
240cagacatccc atttggagaa agtgcatcgt aagcttaaac ttcaagtatg
ggtgggcgcc 300cttcttgggc ttttcatttg ttttgtcatc gggatggtat
ttacgttgat gttttatttt 360gtgggacagg actactgggc atacacggaa
cgagtatggg aaggtgtgtt ctgcatattg 420tcaagtgtga tcatcactgt
gatggggatt gggcttttga gaatcaacaa agttatgaag 480atcaaatggt
ggatcaagtt gggagatgcg tacaataatg aagaatacgc agaagacgaa
540gaggcagaag gcgaggaaga gattgccaag ttaggagacg acgatgtgat
gtatgaggat 600agtatggcta attatggagg caccaggtcg agctcagagt
caaacaccgt ggaggagaac 660atcccattaa ccggtacgcc tgctactcct
gcaacagcta gaaccacaac cacaaagaag 720aacacaccaa ggaaacaggg
gttcaccaag aaatactacc ttgctatttt accattggtc 780accacattga
gagaagggtt agaagcggtt gtgttcattg gtggctcagc catgacgtcc
840acggtatttt cgatcattgt gtctgttgtc tgcggaattg catttggttc
cttgattggg 900tacttgcttt accaaggggg gaacaaactc tcccttcagt
attttcttat ttgctcaaca 960tgttttcttt acatggtcag cgctgggttg
atcagtcgtg gtgtctggtt tatggagctt 1020gaaagatatg tccgtgcatg
tgggggcatg gacgttagtg aaacgggaag tgggccaggt 1080tcatatgata
tcgcaaccag tgtgtggcat gtcaactgtt gtaacggact aactgacggt
1140tggtggatgg tgttgaacgc aattgtcggc tggaccaatt cggctacata
tggcagtgtg 1200attagttata tggcatactg gttgttggta attgtgtggt
tgaaagttaa gttgtatgaa 1260gagagggaag gtgtgttgcc ttggattccc
gtaagatggc aactcaagag aattagaaag 1320aagattagat tgtatgaatt
gaggacccgt cagcaagagc aacaggagca acagagaggt 1380ggtagtggta
gtggtaatga attgccagaa tcgcaaggat tgttgcaaca ggattga 1437
* * * * *