U.S. patent application number 13/069589 was filed with the patent office on 2012-04-12 for sirna microbicides for preventing and treating diseases.
This patent application is currently assigned to President and Fellows of Harvard College. Invention is credited to David Knipe, Judy Lieberman, Deborah Palliser.
Application Number | 20120087973 13/069589 |
Document ID | / |
Family ID | 37499006 |
Filed Date | 2012-04-12 |
United States Patent
Application |
20120087973 |
Kind Code |
A1 |
Lieberman; Judy ; et
al. |
April 12, 2012 |
siRNA MICROBICIDES FOR PREVENTING AND TREATING DISEASES
Abstract
The invention provides a microbicidal composition comprising at
least one siRNA. The siRNA is an RNA duplex made of one or two
molecules. A portion of the siRNA is identical to a target sequence
in an essential gene of a virus. The virus may be a herpesvirus,
for example, HSV-1 or HSV-2. Preferably, the herpesvirus is HSV-2.
The microbicidal composition further comprises a pharmaceutically
acceptable carrier. Also included in the invention are methods to
prevent and treat viral infections by administration of the
microbicidal composition. Preferably, the microbicidal composition
is administered transmucosally.
Inventors: |
Lieberman; Judy; (Brookline,
MA) ; Palliser; Deborah; (Cambridge, MA) ;
Knipe; David; (Auburndale, MA) |
Assignee: |
President and Fellows of Harvard
College
Cambridge
MA
Immune Disease Institute, Inc.
Boston
MA
|
Family ID: |
37499006 |
Appl. No.: |
13/069589 |
Filed: |
March 23, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11916334 |
Feb 15, 2008 |
7943589 |
|
|
PCT/US06/21758 |
Jun 5, 2006 |
|
|
|
13069589 |
|
|
|
|
60687216 |
Jun 3, 2005 |
|
|
|
Current U.S.
Class: |
424/450 ;
435/366; 435/375; 514/44A |
Current CPC
Class: |
C12N 2310/14 20130101;
A61P 31/14 20180101; C12N 15/1133 20130101; A61P 31/22 20180101;
A61P 31/00 20180101; A61P 31/20 20180101; A61P 31/12 20180101; C12N
15/1131 20130101; A61K 48/00 20130101 |
Class at
Publication: |
424/450 ;
514/44.A; 435/375; 435/366 |
International
Class: |
A61K 31/7105 20060101
A61K031/7105; C12N 5/071 20100101 C12N005/071; A61P 31/14 20060101
A61P031/14; A61P 31/12 20060101 A61P031/12; A61P 31/22 20060101
A61P031/22; A61P 31/20 20060101 A61P031/20; C12N 5/00 20060101
C12N005/00; A61K 9/127 20060101 A61K009/127 |
Goverment Interests
GOVERNMENT SUPPORT
[0002] This invention was supported, in part, by National
Institutes of Health (NIH) Grant No. R21 AI058695 and R01 AI057552.
The government of the United States has certain rights to the
invention.
Claims
1. A microbicidal composition comprising at least one siRNA,
comprising a pharmaceutically acceptable carrier and the siRNA,
wherein the siRNA comprises an RNA duplex comprised of one or two
molecules, wherein a portion of the molecule comprises a nucleotide
sequence having sufficient complementarity to a target sequence of
about 15 to about 30 contiguous nucleotides in an RNA of a virus
for the siRNA to direct cleavage of the RNA via RNA interference,
wherein the virus is selected from the group consisting of
picornaviruses, orthomyxoviruses, paramyxoviruses, coronaviruses,
adenoviruses, hepadnaviruses, flaviviruses, retroviruses,
papillomaviruses and herpesviruses, wherein the target sequence is
in a gene essential for infectivity or replication of the
virus.
2. The microbicidal composition of claim 1, wherein the
pharmaceutically acceptable carrier comprises a lipofection
reagent.
3. The microbicidal composition of claim 1, wherein the virus is a
herpesvirus.
4. The microbicidal composition of claim 3, wherein the herpesvirus
is HSV.
5. The microbicidal composition of claim 4, wherein the herpesvirus
is HSV-1.
6. The microbicidal composition of claim 4, wherein the herpesvirus
is HSV-2
7. The microbicidal composition of claim 1, wherein the target
sequence is in an essential HSV gene.
8. The microbicidal composition of claim 7, wherein the essential
gene is selected from a group consisting of UL5, UL27 and UL29.
9. The microbicidal composition of claim 1, wherein the sense RNA
strand comprises SEQ ID NO: 1, and the antisense strand comprises
SEQ ID NO: 2.
10. The microbicidal composition of claim 1, wherein the sense RNA
strand comprises SEQ ID NO: 3, and the antisense strand comprises
SEQ ID NO: 4.
11. The microbicidal composition of claim 1, wherein the sense RNA
strand comprises SEQ ID NO: 5, and the antisense strand comprises
SEQ ID NO: 6.
12. The microbicidal composition of claim 1, wherein the sense RNA
strand comprises SEQ ID NO: 7, and the antisense strand comprises
SEQ ID NO: 8.
13. The microbicidal composition of claim 1, wherein the sense RNA
strand comprises SEQ ID NO: 9, and the antisense strand comprises
SEQ ID NO: 10.
14. The microbicidal composition of claim 1, wherein the sense RNA
strand comprises SEQ ID NO: 11, and the antisense strand comprises
SEQ ID NO: 12.
15. The microbicidal composition of claim 1, wherein the sense RNA
strand comprises SEQ ID NO: 13, and the antisense strand comprises
SEQ ID NO: 14.
16. A microbidical delivery device, comprising the microbicidal
composition of claim 1 and a physical vehicle.
17. The microbicidal delivery device of claim 16, wherein the
physical vehicle is a contraceptive device.
18. The microbicidal delivery device of claim 16, wherein the
physical vehicle is polyurethane foam.
19. The microbicidal delivery device of claim 16, wherein the
physical vehicle is cellulose sulfate gel.
20. The microbicidal delivery device of claim 17, wherein the
physical vehicle is a suppository.
21. A method of treating or preventing viral mediated disease,
comprising administering to a cell an effective amount of the
microbicide of claim 1.
22. The method of claim 21, wherein the cell is a human cell.
23. The method of claim 22, wherein the cell is located in a human
subject.
24. The method of claim 23, wherein the cell is located in the
genitalia, cervicovagina, rectum, oral cavity, lips, mouth, skin,
or eyes of the subject.
25. The method of claim 21, wherein the pharmaceutically acceptable
carrier further comprises a liposome.
26. The method of claim 21, wherein the pharmaceutically acceptable
carrier further comprises a condensation agent.
27. The method of claim 26, wherein the condensation agent is a
protamine.
28. The method of claim 21, wherein the pharmaceutically acceptable
carrier further comprises a targeting agent.
29. The method of claim 21, wherein the siRNA is expressed from an
vector.
30. The method of claim 21, wherein the microbicidal composition is
administered by a topical administration.
31. The method of claim 30, wherein the topical composition is
administration is cervicovaginal.
32. The method of claim 21, wherein the microbicidal composition is
associated with a physical vehicle.
33. The method of claim 32, wherein the physical vehicle is a
contraceptive device.
34. The method of claim 32, wherein the physical vehicle is
selected from the group consisting of a polyurethane foam, a
cellulose sulfate gel or a suppository.
35. The method of claim 21, wherein the microbicidal composition is
administered by enteral administration.
36. The method of claim 21, wherein the microbicidal composition is
administered by a parenteral administration.
37. The method of claim 21, wherein the microbicidal composition is
administered in combination with a pharmaceutical agent for
treating the viral disease, wherein the pharmaceutical agent is
different from the siRNA and is selected from the group consisting
of acyclovir, valacyclovir, famciclovir, penciclovir, vidarabine,
ganciclovir, idoxuridine, foscarnet, trifluridine, levamisole,
amlexanox, lidocaine, docosanol, tetracaine, diphenhydramine,
hydroxyzine, aspirin or aspirin derivative, lysine or any
combination thereof.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a continuation of a co-pending
U.S. application Ser. No. 11/916,334 filed on Jun. 5, 2006, which
is a National Phase Entry Application under 35 U.S.C. .sctn.371 of
International Application PCT/US2006/021758, filed 5 Jun. 2006,
which designated the U.S. and which claims benefit under 35 U.S.C.
.sctn.119(e) of U.S. Provisional Application Ser. No. 60/687,216,
filed on Jun. 3, 2005, the content of which is relied upon and
incorporated herein by reference in its entirety.
BACKGROUND OF THE INVENTION
[0003] Two well known species of human disease-causing herpes
simplex viruses are herpes simplex virus type 1 (HSV-1) and its
close cousin, herpes simplex virus type 2 (HSV-2), collectively
HSV. At the molecular level, HSV-1 and HSV-2 share approximately
50% of their DNA. Both types infect the body's mucosal surfaces,
usually the mouth or genitals, and then establish latency in the
nervous system. For both HSV-1 and HSV-2 infections, at least
two-thirds of infected people have no symptoms, or symptoms too
mild to notice. However, both types can recur and spread even when
no symptoms are present.
[0004] Moreover, prior infection with another STD, such as HSV 2,
predisposes an individual to a higher risk of contracting HIV. In
the U.S. alone, up to 25% of the population is seropositive for HSV
2. This figure rises to 80% in sub-Saharan Africa, where HIV is
endemic. Viral reactivation of HSV occurs in >95% of healthy
individuals and leads to the formation of genital ulcerations,
resulting in destruction of the mucosal barrier and an influx of
activated CD4+ T cells-optimal conditions for HIV infection.
Therefore, decrease in HSV 2 infection could lead to a significant
drop in HIV infection rates.
[0005] Since vaccines giving mucosal protection are probably many
years away and condoms, although highly effective in preventing
infection by sexually transmitted disease (STD) causing microbes,
have failed to become generally accepted by males in many parts of
the world, protective means are required which are under the
control of the woman and can, if necessary, be used without the
knowledge or consent of the male partner. Vaginal microbicides
would meet this requirement and could not only protect the female's
reproductive tract against infectious agents transmitted by the
male, but could also protect the male's genital mucosa against
possible infectious agents from the female.
[0006] Accordingly, it would be desirable to develop new treatments
for viral diseases in general and STDs in particular that can be
used frequently without adverse effects.
SUMMARY OF THE INVENTION
[0007] The present invention is directed to methods of treating
viral diseases using siRNAs as microbicides. The invention is based
upon our findings in a murine model that an siRNA microbicide
delivered vaginally prevents HSV infection. Accordingly, the
present invention provides an isolated siRNA comprising a sense RNA
strand and an antisense RNA strand or a single strand. The sense
and the antisense RNA strands, or the single RNA strand, form an
RNA duplex, and wherein the RNA strand comprises a nucleotide
sequence having sufficient complementarity to a target sequence of
about 15 to about 30 contiguous nucleotides in a viral RNA to
direct cleavage of the viral RNA via RNA interference. Preferably,
the virus is selected from the group consisting of
orthomyxoviruses, e.g., influenza virus, paramyxoviruses, e.g.,
RSV, coronaviruses, adenoviruses, papillomaviruses, picornaviruses,
e.g., rhinovirus and hepatitis A virus, hepadnaviruses, e.g.,
hepatitis B virus, flaviviruses, e.g., hepatitis C virus,
retroviruses, e.g., HIV, HTLV-I and HTLV-II, poxviruses, e.g., MCV,
herpesviruses, e.g., HSV-1, HSV-2, VZV-2, CMV, HHV-6, HHV-7, HHV-8,
VZV-2, CMV, HHV-6, HHV-7, HHV-8 and EBV, or any combination
thereof. Preferably, the virus is an STD causing virus. Preferably,
the virus is HIV, HPV or HSV. More preferably, the virus is HSV.
Preferably, the target sequence is an HSV gene. Essential HSV genes
include, for example, UL5, UL27 and UL29.
[0008] In one embodiment, the siRNA is formulated with a
pharmaceutically acceptable carrier to form a microbicidal
composition that can treat or prevent viral infection by a virus
noted above. Preferably, the viral infection is an STD. Preferably,
the viral infection is mediated by HIV, HPV, or HSV. More
preferably, the viral infection is mediated by HSV. Preferably, the
microbicide is formulated for topical, particularly genital or
rectal, administration. More preferably, the microbicide is
formulated for delivery of the siRNA by lipofection.
[0009] In another embodiment, the present invention provides a
method of inhibiting expression of viral mRNA, or preventing or
treating viral mediated sexually transmitted disease (STD).
Preferably, the disease is mediated by HSV. The method comprises
administering an effective amount of siRNA of the invention to a
subject having or at risk of developing an STD. Preferably, the
siRNA is administered transmucosally, e.g., vaginally,
rectally.
BRIEF DESCRIPTION OF THE FIGURES
[0010] FIGS. 1a-1c show siRNAs targeting HSV reduce viral
replication in vitro. NIH3T3 (FIG. 1a) or Vero (FIG. 1b) cells,
transfected overnight with 100 pmoles siRNA were incubated with HSV
186 kpn at MOI=1 for 1 hr and harvested 20 hrs later to analyze
viral production by plaque assay. Values above bars for UL5.2,
UL27.2 and UL29.2 show fold reduction. FIG. 1c, Viral mRNA (UL5,
black; UL27, dark gray; UL29, light gray; TK, white) relative to
GAPDH was analyzed by quantitative RT-PCR using Vero cells treated
and harvested as in FIG. 1b. Each of the antiviral siRNAs inhibited
expression of all 4 viral genes, demonstrating inhibition of viral
replication and spread.
[0011] FIGS. 2a-2b show siRNAs targeting HSV-2 protect mice from
lethal HSV-2 vaginal infection. Mice given 500 pmoles
lipid-complexed siRNA in the vaginal cavity 2 hr before and 4 hr
after vaginal infection with .about.2 LD50 HSV-2 were analyzed for
survival (FIG. 2a) and vaginal viral shedding on day 6 (FIG. 2b).
Pooled data from 3 independent experiments are shown in FIG. 2a.
FIG. 2b, Disease groups are HSV only, circles; GFP siRNA, squares;
UL27.2 siRNA, diamonds; UL29.2, triangles. Mice that survived after
day 12 remained healthy. FIG. 2b, Vaginal viral shedding was
quantified on day 6 after infection from viral swabs. Geometric
mean viral titer for each group is shown by the bars. Mice treated
with UL29.2 siRNA had significantly less viral shedding than mice
that did not receive siRNA.
[0012] FIG. 3 shows topical lipid-complexed siRNAs do not activate
inflammation or IRGs. Vaginal tissue, dissected 24 and 48 hr after
administering 500 pmole of lipid-complexed siRNA, was assessed for
relative expression of IFN-beta (black) and the IRGs STAT1 (gray)
and OAS1 (white) compared to GAPDH by quantitative RT-PCR. HSV-2
infection was used as a positive control for IFN induction. There
was no significant change in gene expression compared to
mock-treated mice by any of the siRNAs.
DETAILED DESCRIPTION OF THE INVENTION
[0013] The present invention is based on the surprising discovery
that siRNAs designed to interfere with the expression of one or
more essential genes of a virus may be delivered to a subject by
means of lipid transfection agents. Delivery of the siRNAs designed
to interfere with the expression of one or more essential genes of
a virus successfully treat and/or prevent viral infection in the
subject.
[0014] Accordingly, the present invention is directed to methods of
treating and/or preventing viral infection using double-stranded
siRNAs designed to interfere with the expression of essential viral
genes. Preferably, the viral infection is mediated by a virus
selected from the group consisting of orthomyxoviruses, e.g.,
influenza virus, paramyxoviruses, e.g., RSV, coronaviruses,
adenoviruses, papillomaviruses, e.g., HPV, picornaviruses, e.g.,
rhinovirus and hepatitis A virus, hepadnaviruses, e.g., hepatitis B
virus, flaviviruses, e.g., hepatitis C virus, retroviruses, e.g.,
HIV, HTLV-I and HTLV-II, poxviruses, e.g., MCV, herpesviruses,
e.g., HSV-1, HSV-2, VZV-2, CMV, HHV-6, HHV-7, HHV-8, VZV-2, CMV,
HHV-6, HHV-7, HHV-8 and EBV, or any combination thereof. More
preferably, the viral infection is an HSV infection. More
preferably, the HSV infection is an HSV-1 or HSV-2 infection.
[0015] The invention provides siRNAs, pharmaceutical compositions,
e.g., microbicides, comprising the siRNAs, in vitro and in vivo
methods of inhibiting expression of viruses, including HSV, and
methods of treating and/or preventing viral infections, including
HSV infection. "Microbicide" refers to a compound that can treat or
prevent infections due to microbial agents, including viral
infection, for example HSV infections. The invention further
provides a device for delivery of the microbicide.
[0016] The invention provides an isolated siRNA comprising a sense
RNA strand and an antisense RNA strand, or single RNA strand,
wherein the sense and the antisense RNA strands, or the single RNA
strand, form an RNA duplex, and wherein the RNA strand comprises a
nucleotide sequence having sufficient complementarity to a target
sequence of about 15 to about 30, preferably, about 19 to about 25,
contiguous nucleotides in RNA from a virus for the siRNA to direct
cleavage of said RNA via RNA interference. The viral RNA useful
according to the invention refers to any known nucleic acid that is
part of a viral genome and, in particular, nucleic acids comprising
essential genes. More specifically, the siRNA inhibits expression
of the target viral sequence. "Essential genes" refers to genes
whose expression is required for infection and/or replication
functions of the virus. The viral genome may be selected, for
example, from the genomes of a virus noted above. Essential genes
in the genomes of the viruses noted above are known to the skilled
artisan. For example, the E6 and E7 genes in HPV. For example, the
env, gag, pol, rev, nef, tat, vpr, as well as the non-coding LTRs
in HIV. For example, sequences identified as GenBank ID Nos.
NC.sub.--001806 and NC.sub.--001798 are useful in the present
invention for determining siRNA target sequences of HSV. In one
embodiment, the essential genes are HSV-1 (GenBank NC.sub.--001806)
gB/UL27 (complement of bases 53058-56080), glycoprotein D/US6
(bases 138309-141048), and UL29 genes (complement of 58463-62053).
In one embodiment, the essential genes are HSV-2 (GenBank
NC.sub.--001798) glycoprotein D/US6 (bases 141016-142197), UL5
(complement of bases 12604-15249), UL27 (complement of bases
56117-53403 of NC.sub.--001798), and UL29 genes (complement of
bases 62447-58857). In one preferred embodiment, the siRNA target
sequences are directed to the UL5 gene, coding for a component of
the DNA helicase-primase complex (complement of bases 12604-15249
of NC.sub.--001798); UL27 gene, coding for a glycoprotein
(complement of bases 56117-53403 of NC.sub.--001798); UL29 gene,
coding for a single stranded binding protein (complement of bases
62447-58857). In one embodiment, the essential gene is the HSV
Latency Associated Transcript (LAT gene), including the miRNA
generated from exon 1 of the LAT gene (see, e.g., Gupta et al.
"Anti-apoptotic function of a microRNA encoded by the HSV-1
latency-associated transcript" Nature, advance online publication
31 May 2006). In yet another embodiment, the siRNAs are selected
from the sequences listed in Table 1.
TABLE-US-00001 TABLE 1 Seq Seq Seq Target Sequense ID Sense strand
ID Antisense strand ID CTACGGCATCAGCTCCAAA 1 CUACGGCAUCAGCUCCAAA 1
UUUGGAGCUGAUGCCGUAG 2 TGTGGTCATTGTCTATTAA 3 UGUGGUCAUUGUCUAUUAA 3
UUAAUAGACAAUGACCACA 4 GTTTACGTATAACCACATA 5 GUUUACGUAUAACCACAUA 5
UAUGUGGUUAUACGUAAAC 6 ACGTGATCGTGCAGAACTC 7 ACGUGAUCGUGCAGAACUC 7
GAGUUCUGCACGAUCACGU 8 TCGACCTGAACATCACCAT 9 UCGACCUGAACAUCACCAU 9
AUGGUGAUGUUCAGGUCGA 10 CTTTCGCAATCAATTCCAA 11 CUUUCGCAAUCAAUUCCAA
11 UUGGAAUUGAUUGCGAAAG 12 CCACTCGACGTACTTCATA 13
CCACUCGACGUACUUCAUA 13 UAUGAAGUACGUCGAGUGG 14
Short Interfering RNAs (siRNAs)
[0017] "Short interfering RNA" (siRNA), also referred to herein as
"small interfering RNA" is defined as an agent which functions to
inhibit expression of a target gene, e.g., by RNAi. An siRNA may be
chemically synthesized, may be produced by in vitro transcription,
or may be produced within a host cell. In one embodiment, siRNA is
a double stranded RNA (dsRNA) molecule of about 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25, 26, 27, 28, or 30 nucleotides in length,
preferably about 15 to about 28 nucleotides, more preferably about
19, 20, 21, 22, 23, 24, or 25 nucleotides in length, and more
preferably about 19, 20, 21, 22, or 23 nucleotides in length, and
may contain a 3' and/or 5' overhang on each strand having a length
of about 0, 1, 2, 3, 4, or 5 nucleotides. The length of the
overhang is independent between the two strands, i.e., the length
of the over hang on one strand is not dependent on the length of
the overhang on the second strand. Preferably the siRNA is capable
of promoting RNA interference through degradation or specific
post-transcriptional gene silencing (PTGS) of the target messenger
RNA (mRNA).
[0018] siRNAs also include small hairpin (also called stem loop)
RNAs (shRNAs). In one embodiment, these shRNAs are composed of a
short (e.g., about 19 to about 25 nucleotide) antisense strand,
followed by a nucleotide loop of about 5 to about 9 nucleotides,
and the analogous sense strand. Alternatively, the sense strand may
precede the nucleotide loop structure and the antisense strand may
follow. These shRNAs may be contained in plasmids, retroviruses,
and lentiviruses and expressed from, for example, the pol III U6
promoter, or another promoter (see, e.g., Stewart, et al. (2003)
RNA April; 9(4):493-501, incorporated by reference herein in its
entirety).
[0019] In one embodiment, the siRNA of the present invention
comprises two molecules where the sense RNA strand comprises one
RNA molecule, and the antisense RNA strand comprises one RNA
molecule; or the sense and antisense RNA strands forming the RNA
duplex may be covalently linked by a single-stranded hairpin.
[0020] Synthetic siRNA molecules, including shRNA molecules, of the
present invention can be obtained using a number of techniques
known to those of skill in the art. For example, the siRNA molecule
can be chemically synthesized or recombinantly produced using
methods known in the art, such as using appropriately protected
ribonucleoside phosphoramidites and a conventional DNA/RNA
synthesizer (see, e.g., Elbashir, S. M. et al. (2001) Nature
411:494-498; Elbashir, S. M., W. Lendeckel and T. Tuschl (2001)
Genes & Development 15:188-200; 1-Iarborth, J. et al. (2001) J.
Cell Science 114:4557-4565; Masters, J. R. et al. (2001) Proc.
Natl. Acad. Sci., USA 98:8012-8017; and Tuschl, T. et al. (1999)
Genes & Development 13:3191-3197). Alternatively, several
commercial RNA synthesis suppliers are available including, but not
limited to, Proligo (Hamburg, Germany), Dharmacon Research
(Lafayette, Colo., USA), Pierce Chemical (part of Perbio Science,
Rockford, Ill., USA), Glen Research (Sterling, Va., USA), ChemGenes
(Ashland, Mass., USA), and Cruachem (Glasgow, UK). As such, siRNA
molecules are not overly difficult to synthesize and are readily
provided in a quality suitable for RNAi. In addition, dsRNAs can be
expressed as stem loop structures encoded by plasmid vectors,
retroviruses and lentiviruses (Paddison, P. J. et al. (2002) Genes
Dev. 16:948-958; McManus, M. T. et al. (2002) RNA 8:842-850; Paul,
C. P. et al. (2002) Nat. Biotechnol. 20:505-508; Miyagishi, M. et
al. (2002) Nat. Biotechnol. 20:497-500; Sui, G. et al. (2002) Proc.
Natl. Acad. Sci., USA 99:5515-5520; Brummelkamp, T. et al. (2002)
Cancer Cell 2:243; Lee, N. S., et al. (2002) Nat. Biotechnol.
20:500-505; Yu, J. Y., et al. (2002) Proc. Natl. Acad. Sci., USA
99:6047-6052; Zeng, Y., et al. (2002) Mol. Cell. 9:1327-1333;
Rubinson, D. A., et al. (2003) Nat. Genet. 33:401-406; Stewart, S.
A., et al. (2003) RNA 9:493-501). These vectors generally have a
polIII promoter upstream of the dsRNA and can express sense and
antisense RNA strands separately and/or as a hairpin structures.
Within cells, Dicer processes the short hairpin RNA (shRNA) into
effective siRNA.
[0021] The targeted region of the siRNA molecule of the present
invention can be selected from an essential viral gene, e.g., an
envelope glycoprotein or a DNA binding protein, beginning from
about 25 to 50 nucleotides, from about 50 to 75 nucleotides, or
from about 75 to 100 nucleotides downstream of the start codon.
Nucleotide sequences may contain 5' or 3' UTRs and regions nearby
the start codon. One method of designing a siRNA molecule of the
present invention involves identifying the 23 nucleotide sequence
motif AA(N19)TT (where N can be any nucleotide) and selecting hits
with at least about 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%,
70% or 75% G/C content. The "TT" portion of the sequence is
optional. Alternatively, if no such sequence is found, the search
may be extended using the motif NA(N21), where N can be any
nucleotide. In this situation, the 3' end of the sense siRNA may be
converted to TT to allow for the generation of a symmetric duplex
with respect to the sequence composition of the sense and antisense
3' overhangs. The antisense siRNA molecule may then be synthesized
as the complement to nucleotide positions 1 to 21 of the 23
nucleotide sequence motif. The use of symmetric 3' TT overhangs may
be advantageous to ensure that the small interfering
ribonucleoprotein particles (siRNPs) are formed with approximately
equal ratios of sense and antisense target RNA-cleaving siRNPs
(Elbashir et al. (2001) supra and Elbashir et al. 2001 supra).
Analysis of sequence databases, including but not limited to the
NCBI, BLAST, Derwent and GenSeq as well as commercially available
oligosynthesis companies such as OligoEngine, Inc. (Seattle,
Wash.), may also be used to select siRNA sequences against EST
libraries to ensure that only one gene is targeted.
[0022] The target gene or sequence of the siRNA is designed to be
substantially homologous to the target sequence, or a fragment
thereof. As used herein, the term "homologous" is defined as being
substantially identical, sufficiently complementary, or similar to
the target viral mRNA, or a fragment thereof, to effect RNA
interference of the target. In addition to native RNA molecules,
RNA suitable for inhibiting or interfering with the expression of a
target sequence include RNA derivatives and analogs. Preferably,
the siRNA is identical to its target allele so as to prevent its
interaction with the normal allele.
[0023] In one embodiment, only one siRNA that targets a viral
target is used. The delivery or administration of the siRNA is
preferably performed in free form, i.e. without the use of vectors.
In another embodiment that is especially useful to prevent
infection after viral contact, a mixture of siRNAs targeting either
the same viral gene or at least 2, 3, 4, 5 or up to at least 10
different viral genes are used. In one embodiment, the siRNAs
include one or more sequences listed in Table 1. Other siRNAs
useful according to the methods of the present invention may be
readily designed and tested.
[0024] The siRNAs used in the methods of the invention preferably
target only one sequence. In one preferred embodiment, a mixture of
siRNAs designed to inhibit expression of one or more viral
sequences are used in combination. Each of the siRNAs, can be
screened for potential off-target effects may be analyzed using,
for example, expression profiling. Such methods are known to one
skilled in the art and are described, for example, in Jackson et
al. Nature Biotechnology 6:635-637, 2003. In addition to expression
profiling, one may also screen the potential target sequences for
similar sequences in the sequence databases to identify potential
sequences which may have off-target effects. For example, according
to Jackson et al. (Id.) 15, or perhaps as few as 11 contiguous
nucleotides, of sequence identity are sufficient to direct
silencing of non-targeted transcripts. Therefore, one may initially
screen the proposed siRNAs to avoid potential off-target silencing
using the sequence identity analysis by any known sequence
comparison methods, such as BLAST. Design of siRNAs is known to the
skilled artisan, see for example, Dykxhoorn & Lieberman 2006
"Running interference: prospects and obstacles to using small
interfering rims as small molecule drugs" Annu Rev Biomed Eng.
[0025] In conjunction with the present treatment methods,
pharmacogenomics (i.e., the study of the relationship between an
individual's genotype and that individual's response to a foreign
compound or drug) may be considered. Differences in metabolism of
therapeutics, including siRNAs, can lead to severe toxicity or
therapeutic failure by altering the relation between dose and blood
concentration of the pharmacologically active drug. Thus, a
physician or clinician may consider applying knowledge obtained in
relevant pharmacogenomics studies in determining whether to
administer one or more therapeutic siRNAs as described herein as
well as tailoring the dosage and/or therapeutic regimen of
treatment with an siRNA targeting a viral gene. For example, in one
embodiment, before administering the siRNA to an individual, the
target sequence of the viral strain harbored by the individual may
be analyzed for any potential gene variations, such as
polymorphisms or mutations, in the region against which the siRNA
is targeted. For example, one may sequence the UL29 gene from the
strain harbored by the individual. If one or more mutations or a
polymorphisms is detected, the siRNA may be modified to target the
specific mutant or polymorphic form of the target.
[0026] The siRNAs of the present invention are designed so as to
maximize the uptake of the antisense (guide) strand of the siRNA
into RNA-induced silencing complex (RISC) and thereby maximize the
ability of RISC to target viral mRNA for degradation. This can be
accomplished by looking for sequences that has the lowest free
energy of binding at the 5'-terminus of the antisense strand. The
lower free energy would lead to an enhancement of the unwinding of
the 5'-end of the antisense strand of the siRNA duplex, thereby
ensuring that the antisense strand will be taken up by RISC and
direct the sequence-specific cleavage of the viral mRNA.
[0027] In one embodiment, at least one strand, alternatively both
strands, of the RNA molecule has a 3' overhang from about 0 to
about 6 nucleotides (e.g., pyrimidine nucleotides, purine
nucleotides) in length. In other embodiments, the 3' overhang is
from about 1 to about 5 nucleotides, from about 1 to about 3
nucleotides and from about 2 to about 4 nucleotides in length. In
one embodiment the RNA molecule is double stranded, one strand has
a 3' overhang and the other strand can be blunt-ended or have an
overhang. In the embodiment in which the RNA molecule is double
stranded and both strands comprise an overhang, the length of the
overhangs may be the same or different for each strand. In a
particular embodiment, the RNA of the present invention comprises
about 19, 20, 21, or 22 nucleotides which are paired and which have
overhangs of from about 1 to about 3, particularly about 2,
nucleotides on both 3' ends of the RNA. The siRNA molecules of the
present invention can also comprise a 3' hydroxyl group. In one
embodiment, the 3' overhang is comprised of a dinucleotide of
dithymidylic acid (TT) or diuridylic acid (uu). In one embodiment,
the 3' overhangs can be stabilized against degradation. In another
embodiment, both sense and antisense RNA strands of the siRNA may
be stabilized against nuclease degradation. In a preferred
embodiment, the RNA is stabilized by including purine nucleotides,
such as adenosine or guanosine nucleotides. Alternatively,
substitution of pyrimidine nucleotides by modified analogues, e.g.,
substitution of uridine 2 nucleotide 3' overhangs by
2'-deoxythymidine is tolerated and does not affect the efficiency
of RNAi. The absence of a 2' hydroxyl significantly enhances the
nuclease resistance of the overhang in tissue culture medium.
[0028] siRNA molecules need not be limited to those molecules
containing only RNA, but, for example, further encompasses
chemically modified nucleotides and non-nucleotides, and also
include molecules wherein a ribose sugar molecule is substituted
for another sugar molecule or a molecule which performs a similar
function. Moreover, a non-natural linkage between nucleotide
residues may be used, such as a phosphorothioate linkage. The RNA
strand can be derivatized with a reactive functional group of a
reporter group, such as a fluorophore. Particularly useful
derivatives are modified at a terminus or termini of an RNA strand,
typically the 3' terminus of the sense strand. For example, the
2'-hydroxyl at the 3' terminus can be readily and selectively
derivatizes with a variety of groups.
[0029] In another aspect the nucleic acid molecules comprise a 5'
and/or a 3'-cap structure. By "cap structure" is meant chemical
modifications, which have been incorporated at either terminus of
the oligonucleotide (see for example Wincott et al, WO 97/26270).
These terminal modifications protect the nucleic acid molecule from
exonuclease degradation, and can help in delivery and/or
localization within a cell. The cap can be present at the
5'-terminus (5'-cap) or at the 3'-terminus (3'-cap) or can be
present on both terminus. In non-limiting examples, the 5'-cap
includes inverted abasic residue (moiety), 4',5'-methylene
nucleotide; 1-(beta-D-erythrofuranosyl) nucleotide, 4'-thio
nucleotide, carbocyclic nucleotide; 1,5-anhydrohexitol nucleotide;
L-nucleotides; alpha-nucleotides; modified base nucleotide;
phosphorodithioate linkage; threo-pentofuranosyl nucleotide;
acyclic 3',4'-seco nucleotide; acyclic 3,4-dihydroxybutyl
nucleotide; acyclic 3,5-dihydroxypentyl nucleotide, 3'-3'-inverted
nucleotide moiety; 3'-3'-inverted abasic moiety; 3'-2'-inverted
nucleotide moiety; 3'-2'-inverted abasic moiety; 1,4-butanediol
phosphate; 3'-phosphoramidate; hexylphosphate; aminohexyl
phosphate; 3'-phosphate; 3'-phosphorothioate; phosphorodithioate;
or bridging or non-bridging methylphosphonate moiety (for more
details see Wincott et al., WO 97/26270).
[0030] In another embodiment the 3'-cap includes, for example
4',5'-methylene nucleotide; 1-(beta-D-erythrofuranosyl) nucleotide;
4'-thio nucleotide, carbocyclic nucleotide; 5'-amino-alkyl
phosphate; 1,3-diamino-2-propyl phosphate, 3-aminopropyl phosphate;
6-aminohexyl phosphate; 1,2-aminododecyl phosphate; hydroxypropyl
phosphate; 1,5-anhydrohexitol nucleotide; L-nucleotide;
alpha-nucleotide; modified base nucleotide; phosphorodithioate;
threo-pentofuranosyl nucleotide; acyclic 3',4'-seco nucleotide;
3,4-dihydroxybutyl nucleotide; 3,5-dihydroxypentyl nucleotide,
5'-5'-inverted nucleotide moiety; 5'-5'-inverted abasic moiety;
5'-phosphoramidate; 5'-phosphorothioate; 1,4-butanediol phosphate;
5'-amino; bridging and/or non-bridging 5'-phosphoramidate,
phosphorothioate and/or phosphorodithioate, bridging or non
bridging methylphosphonate and 5'-mercapto moieties (for more
details see Beaucage and Iyer, 1993, Tetrahedron 49, 1925).
[0031] Other useful RNA derivatives incorporate nucleotides having
modified carbohydrate moieties, such as 2'O-alkylated residues or
2'-O-methyl ribosyl derivatives and 2'-O-fluoro ribosyl
derivatives. The RNA bases may also be modified. Any modified base
useful for inhibiting or interfering with the expression of a
target sequence may be used. For example, halogenated bases, such
as 5-bromouracil and 5-iodouracil can be incorporated. The bases
may also be alkylated, for example, 7-methylguanosine can be
incorporated in place of a guanosine residue. Non-natural bases
that yield successful inhibition can also be incorporated.
[0032] The most preferred siRNA modifications include
2'-deoxy-2'-fluorouridine or locked nucleic acid (LAN) nucleotides
and RNA duplexes containing either phosphodiester or varying
numbers of phosphorothioate linkages. Such modifications are known
to one skilled in the art and are described, for example, in
Braasch et al., Biochemistry, 42: 7967-7975, 2003. Most of the
useful modifications to the siRNA molecules can be introduced using
chemistries established for antisense oligonucleotide
technology.
siRNA Delivery
[0033] Methods of delivering siRNA, e.g., siRNA of the present
invention, or vectors containing siRNA of the present invention, to
the target cells include delivery via lipofection reagent, delivery
via transfection reagent, delivery via liposome, delivery via
protein or polymer carriers, injection of a composition containing
the siRNA or directly contacting the target cell with a composition
comprising an siRNA. In another embodiment, an siRNA may be
injected directly into any blood vessel, such as vein, artery,
venule or arteriole, via, e.g., hydrodynamic injection or
catheterization. Administration may be by a single injection or by
two or more injections. Preferably, for treatment or prevention of
STDs, the siRNA are delivered topically to the genital mucus
membranes of the subject. One or more siRNAs may be used
simultaneously.
[0034] As used herein, the term "target cell" is intended to refer
to a cell, e.g., cervicovaginal epithelia, vaginal lamina propia,
vaginal ectocervical mucosa, rectal epithelia, genital epithelia or
mucosa, oral mucosa or epithelium, keratinocytes and epidermal
cells, into which an siRNA molecule of the invention, including a
recombinant expression vector encoding an siRNA of the invention,
is introduced. The term "genital" is used herein to refer to areas
of the body including the vagina, the vulva, the cervix, the anus,
the rectum, the penis, the scrotum, the urethra, the internal
regions housed by the penis and the scrotum, and all associated
mucosal membranes. In one embodiment, the target cell is a neuronal
cell, e.g., a cell in the sacral ganglia or a cell in the
trigeminal ganglia. The terms "target cell" and "host cell" are
used interchangeably herein. It should be understood that such
terms refer not only to the particular subject cell but to the
progeny or potential progeny of such a cell. Because certain
modifications may occur in succeeding generations due to either
mutation or environmental influences, such progeny may not, in
fact, be identical to the parent cell, but are still included
within the scope of the term as used herein. Preferably, a target
cell is a mammalian cell, e.g., a human cell.
[0035] In another preferred embodiment, the delivery is performed
using an siRNA delivery system described in WO 06/023491, and U.S.
Patent Application Publication No. 20040023902, incorporated herein
by reference in their entirety. The method of targeted delivery
both in vitro and in vivo of siRNAs into desired cells thus
avoiding entry of the siRNA into other than intended target cells.
The method allows treatment of specific cells with siRNAs limiting
potential side effects of RNA interference caused by non-specific
targeting of RNA interference. The method uses a complex or a
fusion molecule comprising a cell targeting moiety and an siRNA
binding moiety that is used to deliver the siRNA effectively into
cells. For example, an antibody-protamine fusion protein when mixed
with siRNA, binds siRNA and selectively delivers the siRNA into
cells expressing an antigen recognized by the antibody, resulting
in silencing of gene expression only in those cells that express
the antigen. The siRNA or RNA interference-inducing molecule
binding moiety is a protein or a nucleic acid binding domain or
fragment of a protein, and the binding moiety is fused to a portion
of the targeting moiety. The location of the targeting moiety may
be either in the carboxyl-terminal or amino-terminal end of the
construct or in the middle of the fusion protein.
[0036] In another embodiment, the compositions of the invention are
provided as a surface component of a lipid aggregate, such as a
liposome. In another embodiment, the compositions of the invention
are provided encapsulated within a lipid aggregate, such as a
liposome. Encapsulation may be accomplished by condensing siRNAs
with cationic polymers or peptides, e.g., protamines. Liposomes,
which can be unilamellar or multilamellar, can introduce
encapsulated material into a cell by different mechanisms. For
example, the liposome can directly introduce its encapsulated
material into the cell cytoplasm by fusing with the cell membrane.
Alternatively, the liposome can be compartmentalized into an acidic
vacuole (i.e., an endosome) and its contents released from the
liposome and out of the acidic vacuole into the cellular cytoplasm.
In one embodiment the invention features a lipid aggregate
formulation of the compounds described herein, including
phosphatidylcholine (of varying chain length; e.g., egg yolk
phosphatidylcholine), cholesterol, a cationic lipid, and
1,2-distearoyl-sn-glycero3-phosphoethanolamine-polythyleneglycol-2000
(DSPE-PEG2000). The cationic lipid component of this lipid
aggregate can be any cationic lipid known in the art such as
dioleoyl 1,2-diacyl trimethylammonium-propane (DOTAP). The attached
PEG can be any molecular weight but is preferably between
2000-50,000 daltons.
[0037] In one embodiment, liposomes having surface modifications,
e.g., to enhance circulation time, for cryoprotection, for
selective targeting, are utilized. Polyethylene glycol lipids
(PEG)-modified or hyaluronic acid (HA)-coated liposomes are useful
modifications for long-circulating liposomes or stealth liposomes.
HA is also useful as a cryoprotectant. These formulations offer a
method for increasing the accumulation of drugs in target tissues.
This class of drug carriers resists opsonization and elimination by
the mononuclear phagocytic system (MPS or RES), thereby enabling
longer blood circulation times and enhanced tissue exposure for the
encapsulated drug (Lasic et al. Chem. Rev. 1995, 95, 2601-2627;
Ishiwata et al., Chem. Pharm. Bull. 1995, 43, 1005-1011). The
long-circulating compositions enhance the pharmacokinetics and
pharmacodynamics of therapeutic compounds, such as DNA and RNA,
particularly compared to conventional cationic liposomes which are
known to accumulate in tissues of the MPS (Liu et al., J. Biol.
Chem. 1995, 42, 2486424870; Choi et al., International PCT
Publication No. WO 96/10391; Ansell et al., International PCT
Publication No. WO 96/10390; Holland et al., International PCT
Publication No. WO 96/10392). Long-circulating compositions are
also likely to protect drugs from nuclease degradation to a greater
extent compared to cationic liposomes, based on their ability to
avoid accumulation in metabolically aggressive MPS tissues such as
the liver and spleen. In another embodiment, a targeting agent may
be attached to the liposome, e.g., attached to the liposome, e.g.,
attached to a surface modification on the liposome, e.g., HA,
PEG.
[0038] The siRNAs or shRNAs of the invention, may be introduced
along with components that perform one or more of the following
activities: enhance uptake of the siRNA, by the cell, e.g.,
cervicovaginal epithelial cells, rectal epithelial cells, oral
epithelial cells, genital epithelial cells, epidermal cells,
neuronal cells; inhibit annealing of single strands; stabilize
single strands; or otherwise facilitate delivery to the target cell
and increase inhibition of the virus.
[0039] The siRNA may be directly introduced into the target cell,
e.g., cervicovaginal epithelial cells, genital epithelial cells,
rectal epithelial cells, genital epithelial cells, oral epithelial
cells, keratinocytes, epidermal cells, neuronal cells or introduced
extracellularly into a cavity, interstitial space, into the
circulation of an organism, introduced orally, or may be introduced
by bathing a cell or organism in a solution containing the siRNA.
The siRNA may also be introduced into cells via topical application
to a mucosal membrane or dermally. Vascular or extravascular
circulation, the blood or lymph system, and the cerebrospinal fluid
are also sites where the agents may be introduced. If necessary,
biochemical components needed for RNAi to occur can also be
introduced into the target cells.
[0040] A viral-mediated delivery mechanism may also be employed to
deliver siRNAs to cells in vitro and in vivo as described in Xia,
H. et al. (2002) Nat Biotechnol 20(10):1006). Plasmid- or
viral-mediated delivery mechanisms of shRNA may also be employed to
deliver shRNAs to cells in vitro and in vivo as described in
Rubinson, D. A., et al. ((2003) Nat. Genet. 33:401-406) and
Stewart, S. A., et al. ((2003) RNA 9:493-501). Other methods of
introducing siRNA molecules of the present invention to target
cells include a variety of art-recognized techniques including, but
not limited to, calcium phosphate or calcium chloride
co-precipitation, DEAE-dextran-mediated transfection, lipofection,
or electroporation as well as a number of commercially available
transfection kits (e.g., OLIGOFECTAMINE.RTM. Reagent from
Invitrogen) (see, e.g. Sui, G. et al. (2002) Proc. Natl. Acad. Sci.
USA 99:5515-5520; Calegari, F. et al. (2002) Proc. Natl. Acad.
Sci., USA Oct. 21, 2002 [electronic publication ahead of print];
J-M Jacque, K. Triques and M. Stevenson (2002) Nature 418:435-437;
and Elbashir, S. M et al. (2001) supra). The efficiency of
transfection may depend on a number of factors, including the cell
type, the passage number, the confluency of the cells as well as
the time and the manner of formation of siRNA- or shRNA-liposome
complexes (e.g., inversion versus vortexing). These factors can be
assessed and adjusted without undue experimentation by one with
ordinary skill in the art.
[0041] As used herein, the term "vector" refers to a nucleic acid
molecule capable of transporting another nucleic acid to which it
has been linked. One type of vector is a "plasmid", which refers to
a circular double stranded DNA loop into which additional nucleic
acid segments can be ligated. Another type of vector is a viral
vector, wherein additional nucleic acid segments can be ligated
into the viral genome. Certain vectors are capable of autonomous
replication in a host cell into which they are introduced (e.g.,
bacterial vectors having a bacterial origin of replication and
episomal mammalian vectors). Other vectors (e.g., non-episomal
mammalian vectors) are integrated into the genome of a host cell
upon introduction into the host cell, and thereby are replicated
along with the host genome. Moreover, certain vectors are capable
of directing the expression of genes to which they are operatively
linked. Such vectors are referred to herein as "recombinant
expression vectors", or more simply "expression vectors." In
general, expression vectors of utility in recombinant DNA
techniques are often in the form of plasmids. In the present
specification, "plasmid" and "vector" can be used interchangeably
as the plasmid is the most commonly used form of vector. However,
the invention is intended to include such other forms of expression
vectors, such as viral vectors (e.g., replication defective
retroviruses, lentiviruses, adenoviruses and adeno-associated
viruses), which serve equivalent functions. In a preferred
embodiment, lentiviruses are used to deliver one or more siRNA
molecule of the present invention to a cell.
[0042] Within an expression vector, "operably linked" is intended
to mean that the nucleotide sequence of interest is linked to the
regulatory sequence(s) in a manner which allows for expression of
the nucleotide sequence (e.g., in an in vitro
transcription/translation system or in a target cell when the
vector is introduced into the target cell). The term "regulatory
sequence" is intended to include promoters, enhancers and other
expression control elements (e.g., polyadenylation signals). Such
regulatory sequences are described, for example, in Goeddel; Gene
Expression Technology: Methods in Enzymology 185, Academic Press,
San Diego, Calif. (1990). Regulatory sequences include those which
direct constitutive expression of a nucleotide sequence in many
types of host cell and those which direct expression of the
nucleotide sequence only in certain host cells (e.g.,
tissue-specific regulatory sequences). Furthermore, the siRNAs may
be delivered by way of a vector comprising a regulatory sequence to
direct synthesis of the siRNAs of the invention at specific
intervals, or over a specific time period. It will be appreciated
by those skilled in the art that the design of the expression
vector can depend on such factors as the choice of the target cell,
the level of expression of siRNA desired, and the like.
[0043] The expression vectors can be introduced into target cells
to thereby produce siRNA molecules of the present invention. In one
embodiment, a DNA template, e.g., a DNA template encoding a viral
gene, such as a DNA template encoding the HSV UL5, UL27 or UL29
genes, may be ligated into an expression vector under the control
of RNA polymerase III (Pol III), and delivered to a target cell.
Pol. III directs the synthesis of small, noncoding transcripts
which 3' ends are defined by termination within a stretch of 4-5
thymidines. Accordingly, DNA templates may be used to synthesize,
in vivo, both sense and antisense strands of siRNAs which effect
RNAi (Sui, et al. (2002) PNAS 99(8):5515).
[0044] The expression vectors may also be used to introduce shRNA
into target cells. The useful expression vectors also be inducible
vectors, such as tetracycline (see, e.g., Wang et al. Proc Natl
Acad Sci U.S.A. 100: 5103-5106, 2003) or ecdysone inducible vectors
(e.g., from Invitrogen) known to one skilled in the art.
[0045] In another embodiment of the invention, the siRNA may be
transported or conducted across biological membranes using carrier
polymers which comprise, for example, contiguous, basic subunits,
at a rate higher than the rate of transport of siRNA molecules
which are not associated with carrier polymers. Combining a carrier
polymer with siRNA, with or without a cationic transfection agent,
results in the association of the carrier polymer and the siRNA.
The carrier polymer may efficiently deliver the siRNA, across
biological membranes both in vitro and in vivo. Accordingly, the
invention provides methods for delivery of an siRNA, across a
biological membrane, e.g., a cellular membrane including, for
example, a nuclear membrane, using a carrier polymer. The invention
also provides compositions comprising an siRNA in association with
a carrier polymer.
[0046] The term "association" or "interaction" as used herein in
reference to the association or interaction of an siRNA and a
carrier polymer, refers to any association or interaction between
an siRNA with a carrier polymer, e.g., a peptide carrier, either by
a direct linkage or an indirect linkage. An indirect linkage
includes an association between an siRNA and a carrier polymer
wherein said siRNA and said carrier polymer are attached via a
linker moiety, e.g., they are not directly linked. Linker moieties
include, but are not limited to, e.g., nucleic acid linker
molecules, e.g., biodegradable nucleic acid linker molecules. A
nucleic acid linker molecule may be, for example, a dimer, trimer,
tetramer, or longer nucleic acid molecule, for example an
oligonucleotide of about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more nucleotides
in length.
[0047] A direct linkage includes any linkage wherein a linker
moiety is not required. In one embodiment, a direct linkage
includes a chemical or a physical interaction wherein the two
moieties, the siRNA and the carrier polymer, interact such that
they are attracted to each other. Examples of direct interactions
include non-covalent interactions, hydrophobic/hydrophilic, ionic
(e.g., electrostatic, coulombic attraction, ion-dipole,
charge-transfer), Van der Waals, or hydrogen bonding, and chemical
bonding, including the formation of a covalent bond. Accordingly,
in one embodiment, the siRNA and the carrier polymer are not linked
via a linker, e.g., they are directly linked. In a further
embodiment, the siRNA and the carrier polymer are electrostatically
associated with each other.
[0048] The term "polymer" as used herein, refers to a linear chain
of two or more identical or non-identical subunits joined by
covalent bonds. A peptide is an example of a polymer that can be
composed of identical or non-identical amino acid subunits that are
joined by peptide linkages.
[0049] In one embodiment, carrier polymers in accordance with the
present invention contain short-length polymers of from about 6 to
up to about 25 subunits. The carrier is effective to enhance the
transport rate of the siRNA across the biological membrane relative
to the transport rate of the biological agent alone. Although
exemplified polymer compositions are peptides, the polymers may
contain non-peptide backbones and/or subunits as discussed further
below.
[0050] In one aspect of the invention, the carrier polymers are
particularly useful for transporting biologically active agents
across cell or organelle membranes, when the siRNAs are of the type
that require trans-membrane transport to exert their biological
effects. As a general matter, the carrier polymer used in the
methods of the invention preferably includes a linear backbone of
subunits. The backbone will usually comprise heteroatoms selected
from carbon, nitrogen, oxygen, sulfur, and phosphorus, with the
majority of backbone chain atoms usually consisting of carbon. Each
subunit may contain a sidechain moiety that includes a terminal
guanidino or amidino group.
[0051] Although the spacing between adjacent sidechain moieties
will usually be consistent from subunit to subunit, the polymers
used in the invention can also include variable spacing between
sidechain moieties along the backbone.
[0052] The sidechain moieties extend away from the backbone such
that the central guanidino or amidino carbon atom (to which the
NH.sub.2 groups are attached) is linked to the backbone by a
sidechain linker that preferably contains at least 2 linker chain
atoms, more preferably from 2 to 5 chain atoms, such that the
central carbon atom is the third to sixth chain atom away from the
backbone. The chain atoms are preferably provided as methylene
carbon atoms, although one or more other atoms such as oxygen,
sulfur, or nitrogen can also be present. Preferably, the sidechain
linker between the backbone and the central carbon atom of the
guanidino or amidino group is 4 chain atoms long, as exemplified by
an arginine side chain.
[0053] The carrier polymer sequence can be flanked by one or more
non-guanidino/non-amidino subunits, or a linker such as an
aminocaproic acid group, which do not significantly affect the rate
of membrane transport of the corresponding polymer-containing
conjugate, such as glycine, alanine, and cysteine, for example.
Also, any free amino terminal group can be capped with a blocking
group, such as an acetyl or benzyl group, to prevent ubiquitination
in vivo.
[0054] The carrier polymer can be prepared by straightforward
synthetic schemes. Furthermore, the carrier polymers are usually
substantially homogeneous in length and composition, so that they
provide greater consistency and reproducibility in their effects
than heterogenous mixtures.
[0055] In one embodiment, the transport polymer is composed of D-
or L-amino acid residues. Use of naturally occurring L-amino acid
residues in the transport polymers has the advantage that
break-down products should be relatively non-toxic to the cell or
organism. Preferred amino acid subunits are arginine
(.alpha.-amino-.delta.-guanidinovaleric acid) and
.alpha.-amino-.epsilon.-amidinohexanoic acid (isosteric amidino
analog). The guanidinium group in arginine has a pKa of about
12.5.
[0056] More generally, it is preferred that each polymer subunit
contains a highly basic sidechain moiety which (i) has a pKa of
greater than 11, more preferably 12.5 or greater, and (ii)
contains, in its protonated state, at least two geminal amino
groups (NH.sub.2) which share a resonance-stabilized positive
charge, which gives the moiety a bidentate character.
[0057] Other amino acids, such as
.alpha.-amino-.beta.-guanidinopropionic acid,
.alpha.-amino-.gamma.-guanidinobutyric acid, or
.alpha.-amino-.epsilon.-guanidinocaproic acid can also be used
(containing 2, 3 or 5 linker atoms, respectively, between the
backbone chain and the central guanidinium carbon).
[0058] D-amino acids may also be used in the transport polymers.
Compositions containing exclusively D-amino acids have the
advantage of decreased enzymatic degradation. However, they may
also remain largely intact within the target cell. Such stability
is generally not problematic if the agent is biologically active
when the polymer is still attached. For agents that are inactive in
conjugate form, a linker that is cleavable at the site of action
(e.g., by enzyme- or solvent-mediated cleavage within a cell)
should be included to promote release of the agent in cells or
organelles.
[0059] Any peptide, e.g., basic peptide, or fragment thereof, which
is capable of crossing a biological membrane, either in vivo or in
vitro, is included in the invention. These peptides can be
synthesized by methods known to one of skill in the art. For
example, several peptides have been identified which may be used as
carrier peptides in the methods of the invention for transporting
siRNAs across biological membranes. These peptides include, for
example, the homeodomain of antennapedia, a Drosophila
transcription factor (Wang et al., (1995) PNAS USA., 92,
3318-3322); a fragment representing the hydrophobic region of the
signal sequence of Kaposi fibroblast growth factor with or without
NLS domain (Antopolsky et al. (1999) Bioconj. Chem., 10, 598-606);
a signal peptide sequence of caiman crocodylus Ig(5) light chain
(Chaloin et al. (1997) Biochem. Biophys. Res. Comm., 243, 601-608);
a fusion sequence of HIV envelope glycoprotein gp4114, (Morris et
al. (1997) Nucleic Acids Res., 25, 2730-2736); a transportan
A-achimeric 27-mer consisting of N-terminal fragment of
neuropeptide galanine and membrane interacting wasp venom peptide
mastoporan (Lindgren et al., (2000), Bioconjugate Chem., 11,
619-626); a peptide derived from influenza virus hemagglutinin
envelop glycoprotein (Bongartz et al., 1994, Nucleic Acids Res.,
22, 468 1 4688); RGD peptide; and a peptide derived from the human
immunodeficiency virus type-1 ("HIV-1"). Purified HIV-1 TAT protein
is taken up from the surrounding medium by human cells growing in
culture (A. D. Frankel and C. O. Pabo, (1988) Cell, 55, pp.
1189-93). TAT protein trans-activates certain HIV genes and is
essential for viral replication. The full-length HIV-1 TAT protein
has 86 amino acid residues. The HIV tat gene has two exons. TAT
amino acids 1-72 are encoded by exon 1, and amino acids 73-86 are
encoded by exon 2. The full-length TAT protein is characterized by
a basic region which contains two lysines and six arginines (amino
acids 47-57) and a cysteine-rich region which contains seven
cysteine residues (amino acids 22-37). The basic region (i.e.,
amino acids 47-57) is thought to be important for nuclear
localization. Ruben, S. et al., J. Virol. 63: 1-8 (1989); Hauber,
J. et al., J. Virol. 63 1181-1187 (1989); Rudolph et al. (2003)
278(13):11411. The cysteine-rich region mediates the formation of
metal-linked dimers in vitro (Frankel, A. D. et al., Science 240:
70-73 (1988); Frankel, A. D. et al., Proc. Natl. Acad. Sci. USA 85:
6297-6300 (1988)) and is essential for its activity as a
transactivator (Garcia, J. A. et al., EMBO J. 7:3143 (1988);
Sadaie, M. R. et al., J. Virol. 63: 1 (1989)). As in other
regulatory proteins, the N-terminal region may be involved in
protection against intracellular proteases (Bachmair, A. et al.,
Cell 56: 1019-1032 (1989).
[0060] In one embodiment of the invention, the basic peptide
comprises amino acids 47-57 of the HIV-1 TAT peptide. In another
embodiment, the basic peptide comprises amino acids 48-60 of the
HIV-1 TAT peptide. In still another embodiment, the basic peptide
comprises amino acids 49-57 of the HIV-1 TAT peptide. In yet
another embodiment, the basic peptide comprises amino acids 49-57,
48-60, or 47-57 of the HIV-1 TAT peptide, does not comprise amino
acids 22-36 of the HIV-1 TAT peptide, and does not comprise amino
acids 73-86 of the HIV-1 TAT peptide. In still another embodiment,
the specific peptides set forth in Table 2, below, or fragments
thereof, may be used as carrier peptides in the methods and
compositions of the invention.
[0061] In yet another embodiment, an active thiol at the 5' end of
the sense strand may be coupled to a cysteine reside added to the C
terminal end of a basic peptide for delivery into the cytosol (such
as a fragment of tat or a fragment of the Drosophila Antennapedia
peptide). Internalization via these peptides bypasses the endocytic
pathway and therefore removes the danger of rapid degradation in
the harsh lysosomal environment, and may reduce the concentration
required for biological efficiency compared to free
oligonucleotides.
[0062] Other arginine rich basic peptides are also included for use
in the methods of delivery. For example, a TAT analog comprising
D-amino acid- and arginine-substituted TAT(47-60), RNA-binding
peptides derived from virus proteins such as HIV-1 Rev, and flock
house virus coat proteins, and the DNA binding sequences of leucine
zipper proteins, such as cancer-related proteins c-Fos and c-Jun
and the yeast transcription factor GCN4, all of which contain
several arginine residues (see Futaki, et al. (2001) J. Biol Chem
276(8):5836-5840 and Futaki, S. (2002) Int J. Pharm 245(1-2):1-7).
In one embodiment, the arginine rich peptide contains about 4 to
about 11 arginine residues. In another embodiment, the arginine
residues are contiguous residues. In another embodiment, one of the
arginine residues is substituted with D-arginine. See, for example,
Melikov et al., Cell Mol Life Sci. 2005; 62: 2739-49.
[0063] Subunits other than amino acids may also be selected for use
in forming transport polymers. Such subunits may include, but are
not limited to hydroxy amino acids, N-methyl-amino acids amino
aldehydes, and the like, which result in polymers with reduced
peptide bonds. Other subunit types can be used, depending on the
nature of the selected backbone.
TABLE-US-00002 TABLE 2 SEQ ID PEPTIDE SEQUENCE NO: HIV-1 TAT
(49-57) RKKRRQRRR 31 HIV-1 TAT (48-60) GRKKRRQRRRTPQ 32 HIV-1 TAT
(47-57) YGRKKRRQRRR 33 Kaposi fibroblast AAV ALL PAV LLA LLA P + 34
growth factor VQR KRQ KLMP of caiman MGL GLH LLV LAA ALQ GA 35
crocodylus Ig(5) light chain HIV envelope GAL FLG FLG AAG STM GA +
36 glycoprotein PKS KRK 5 (NLS of the gp41 SV40) Drosophila RQI KIW
FQN RRM KWK K 37 Antennapedia amide RGD peptide X-RGD-X 38
Influenza virus GLFEAIAGFIENGWEGMIDGGGYC 39 hemagglutinin envelope
glycoprotein transportan A GWT LNS AGY LLG KIN LKA 40 LAA LAK KIL
Pre-S-peptide (S)DH QLN PAF 41 Somatostatin (tyr- (S)FC YWK TCT 42
3-octreotate) (s) optional Serine for coupling bold = optional D
isomer for stability
[0064] A variety of backbone types can be used to order and
position the sidechain guanidino and/or amidino moieties, such as
alkyl backbone moieties joined by thioethers or sulfonyl groups,
hydroxy acid esters (equivalent to replacing amide linkages with
ester linkages), replacing the alpha carbon with nitrogen to form
an aza analog, alkyl backbone moieties joined by carbamate groups,
polyethyleneimines (PEIs), and amino aldehydes, which result in
polymers composed of secondary amines.
[0065] A more detailed backbone list includes N-substituted amide
(CONR replaces CONH linkages), esters (CO.sub.2), ketomethylene
(COCH.sub.2) reduced or methyleneamino (CH.sub.2NH), thioamide
(CSNH), phosphinate (PO.sub.2RCH.sub.2), phosphonamidate and
phosphonamidate ester (PO.sub.2RNH), retropeptide (NHCO),
transalkene (CR.dbd.CH), fluoroalkene (CF.dbd.CH), dimethylene
(CH.sub.22CH.sub.2), thioether (CH.sub.2S), hydroxyethylene
(CH(OH)CH.sub.2), methyleneoxy (CH.sub.2O), tetrazole (CN.sub.24),
retrothioamide (NHCS), retroreduced (NHCH.sub.2), sulfonamido
(SO.sub.2NH), methylenesulfonamido (CHRSO.sub.2NH),
retrosulfonamide (NHSO.sub.2), and peptoids (N-substituted
glycines), and backbones with malonate and/or gem-diaminoalkyl
subunits, for example, as reviewed by Fletcher et al. (1998) and
detailed by references cited therein. Peptoid backbones
(N-substituted glycines) can also be used. Many of the foregoing
substitutions result in approximately isosteric polymer backbones
relative to backbones formed from .alpha.-amino acids.
[0066] N-methyl and hydroxy-amino acids can be substituted for
conventional amino acids in solid phase peptide synthesis. However,
production of polymers with reduced peptide bonds requires
synthesis of the dimer of amino acids containing the reduced
peptide bond. Such dimers are incorporated into polymers using
standard solid phase synthesis procedures. Other synthesis
procedures are well known in the art.
[0067] In one embodiment of the invention, an siRNA and the carrier
polymer are combined together prior to contacting a biological
membrane. Combining the siRNA and the carrier polymer results in an
association of the agent and the carrier. In one embodiment, the
siRNA and the carrier polymer are not directly linked together.
Therefore, linkers are not required for the formation of the
duplex. In another embodiment, the siRNA and the carrier polymer
are bound together via electrostatic bonding.
Determination of Effectiveness of Silencing
[0068] The dose of the siRNA will be in an amount necessary to
effect RNA interference, e.g., post translational gene silencing
(PTGS), of the particular target gene, thereby leading to
inhibition of target gene expression or inhibition of activity or
level of the protein encoded by the target gene. Assays to
determine expression of the target sequence are known in the art.
In one embodiment, a reporter gene, e.g., GFP, may be fused to the
target sequence in a test cell, e.g., in a test animal.
Effectiveness of silencing can then be measured by examining the
reporter gene expression. Target cells which have been transfected
with the siRNA molecules can be identified by routine techniques
such as immunofluorescence, phase contrast microscopy and
fluorescence microscopy. In one embodiment, reduced levels of
target gene mRNA may be measured by in situ hybridization
(Montgomery et al., (1998) Proc. Natl. Acad. Sci., USA
95:15502-15507) or Northern blot analysis (Ngo, et al. (1998))
Proc. Natl. Acad. Sci., USA 95:14687-14692). Preferably, target
gene transcription is measured using quantitative real-time PCR
(Gibson et al., Genome Research 6:995-1001, 1996; Heid et al.,
Genome Research 6:986-994, 1996). Primers for use in quantitative
real-time PCR include:
TABLE-US-00003 (SEQ ID NO: 15) GAPDH-fwd TTCACCACCATGGAGAAGGC (SEQ
ID NO: 16) GAPDH-rev GGCATGGACTGTGGTCATGA (SEQ ID NO: 17) TK-fwd
CGATCTACT CGCCAACACGGTG (SEQ ID NO: 18) TK-rev
GAACGCGGAACAGGGCAAACAG (SEQ ID NO: 19) UL5-fwd
TCGCTGGAGTCCACCTTCGAAC (SEQ ID NO: 20) UL5-rev
CGAACTCGTGCTCCACACATCG (SEQ ID NO: 21) UL27-fwd
CAAAGACGTGACCGTGTCGCAG (SEQ ID NO: 22) UL27-rev
GCGGTGGTCTCCATGTTGTTCC (SEQ ID NO: 23) UL29-fwd
GCCAGGAGATGGACGTGTTTCG (SEQ ID NO: 24) UL29-rev
CGCGCTGTTCATCGTTCCGAAG (SEQ ID NO: 25) STAT1-fwd
TTTGCCCAGACTCGAGCTCCTG (SEQ ID NO: 26) STAT1-rev
GGGTGCAGGTTCGGGATTCAAC (SEQ ID NO: 27) OAS1-fwd
GGAGGTTGCAGTGCCAACGAAG (SEQ ID NO: 28) OAS1-rev
TGGAAGGGAGGCAGGGCATAAC (SEQ ID NO: 29) Interferon beta-fwd
CTGGAGCAGCTGAATGGAAAG (SEQ ID NO: 30) Interferon beta-rev
CTTGAAGTCCGCCCTGTAGGT
[0069] As used herein, "inhibition of target gene expression"
includes any decrease in expression or protein activity or level of
the target gene or protein encoded by the target gene as compared
to a situation wherein no RNA interference has been induced. The
decrease may be of at least about 30%, about 40%, about 50%, about
60%, about 70%, about 80%, about 90%, about 95% or about 99% or
more as compared to the expression of a target gene or the activity
or level of the protein encoded by a target gene which has not been
targeted by an siRNA.
Method of Treatment and/or Prevention
[0070] The present invention provides a method for preventing viral
mediated infectious disease or disorder in a subject by
administering to the subject a therapeutically effective amount of
one or more siRNAs as described herein. The present invention
further provides a method for treating viral mediated infectious
disease or disorder in a subject by administering to the subject a
therapeutically effective amount of one or more siRNAs as described
herein. In embodiments directed toward treatment after infection of
the subject by a virus, preferably siRNAs directed to at least two
viral targets are administered to the subject. The present
invention still further provides a method of inhibiting expression
of viral RNA, comprising administering to a subject a
therapeutically effective amount of the siRNA of the present
invention.
[0071] For example, the siRNAs described herein may be used as
microbicides to substantially reduce transmission of diseases
transmitted by viruses. Preferably, the virus is a virus described
above. Preferably, the virus is an STD causing virus. Preferably,
the virus is HIV, HPV, or HSV, e.g., HSV-1, HSV-2. More preferably,
the virus is HSV-1 or HSV-2. Subjects at risk for an infectious
disease or disorder, can be identified by, for example, any known
risk factors for an infectious disease or disorder.
[0072] Another aspect of the invention pertains to methods of
modulating gene expression or protein activity, e.g., cellular gene
expression or activity and/or expression or activity of a gene or
sequence of an infectious agent, e.g., viral gene expression or
protein activity in order to treat an infectious disease or
disorder. Accordingly, in an exemplary embodiment, the modulatory
method of the invention involves contacting a cell with one or more
siRNAs such that expression of the target gene or genes is
prohibited. These methods can be performed in vitro (e.g., by
culturing the cell) or, alternatively, in vivo (e.g., by
administering the siRNA to a subject).
[0073] The siRNA is administered in prophylactically or
therapeutically effective amounts. A prophylactically or
therapeutically effective amount means that amount necessary to
attain, at least partly, the desired effect, or to delay the onset
of, inhibit the progression of, prevent the reoccurrence of, or
halt altogether, the onset or progression of the particular
condition being treated. Such amounts will depend, of course, on
the particular condition being treated, the severity of the
condition and individual patient parameters including age, physical
condition, size, weight and concurrent treatment. These factors are
well known to those of ordinary skill in the art and can be
addressed with no more than routine experimentation. It is
preferred generally that a maximum dose be used, that is, the
highest safe dose according to sound medical judgment. It will be
understood by those of ordinary skill in the art; however, that a
lower dose or tolerable dose may be administered for medical
reasons, psychological reasons or for virtually any other
reason.
[0074] The term "therapeutically effective amount" refers to an
amount that is sufficient to effect a therapeutically or
prophylactically significant reduction in production of infectious
virus particles and reduction in viral shedding when administered
to a typical subject who is infected with a virus and at risk of
transmitting the virus, including through sexual contact and
childbirth, or who is infected with a virus and is at risk of
reactivation of a viral infection, or who is infected with a virus
and is at risk of reinfection with a virus or who is at risk of
being infected with a virus. A therapeutically or prophylactically
significant reduction is about 30%, about 40%, about 50%, about
60%, about 70%, about 80%, about 90%, about 100%, about 125%, about
150% or more compared to a control.
[0075] The term "preventing" as used herein refers to preventing
viral infection in an individual susceptible for infection or
re-infection. Accordingly, administration of a prophylactic agent
can occur prior to the manifestation of symptoms characteristic of
an infectious disease or disorder, such that the infectious disease
or disorder is prevented or, alternatively, delayed in its
progression. Any mode of administration of the therapeutic agents
of the invention, as described herein or as known in the art,
including topical administration or mucosal administration of the
siRNAs of the instant invention, may be utilized for the
prophylactic treatment of an infectious disease or disorder.
[0076] Whether effective prevention is achieved can be tested using
routine viral infection detection methods including, but not
limited to by microscopic examination of lesion samples, or
biopsies from e.g. skin, brain or liver for multinucleate giant
cells with eosinophilic intranuclear inclusion bodies, or by
various immunofluorescence techniques (e.g., ELISA), by FDA
approved tests based on immunological techniques including but not
limited to biokitHSV-2 Rapid Test (biokit USA), HERPESELECT.RTM.
Elisa and HERPESELECT.RTM. Immunoblot (diagnostic kits for the
type-specific detection of HSV 1 and 2; Focus Diagnostics, Inc.),
and CAPTIA.TM. HSV IgG Type Specific ELISA (Trinity Biotech USA),
or by herpes western blot (University of Washington), or by
quantitative PCR monitoring viral load. For example, to test
effectiveness of a specific siRNA or dosage, a mouse model can be
used. Viral shedding from the genital epithelium can be determined
by swabbing (Micropur swab, PurFybr Inc) the vaginal cavity and
titrating virus on Vero cells.
[0077] Formulations of the siRNA as described herein may be
administered to a subject at risk for an virus-mediated disease or
disorder, e.g., a viral disorder, such as HSV-1 or HSV-2, or
another sexually transmitted disease or infection, or any other
infectious agent, e.g., a virus, as a topically applied
prophylactic, e.g., for administration on mucosal membranes, e.g.,
orally, genitally, cervicovaginally, or rectally, or topically to
epithelia or epiderma, to prevent transmission of a viral or
bacterial disease or disorder, such as HSV-1 or HSV-2, or another
sexually transmitted disease or infection. In one embodiment, the
compositions comprising the siRNA and the carrier polymer may be
administered prior to exposure to the infectious agent. In vitro
experiments illustrate that the antiviral state induced by
introduced duplex siRNAs can last for weeks. Therefore, in one
embodiment, an siRNA-based microbicide need not be applied before
each sexual encounter. Accordingly, in another embodiment, the
prophylactic effect of the siRNA is prolonged, e.g., lasts for at
least one week, preferably two or more weeks. In another
embodiment, the compositions comprising the siRNA may be
administered, e.g., topically, at intervals, e.g., one or more
times per week, or one or more times per month, rather than
directly prior to exposure to an infectious agent. In one
embodiment, the siRNA is administered to neuronal cells, e.g.,
cells of the sacral ganglia or trigeminal ganglia, to treat a
latent infection or prevent reactivation of a latent infection,
e.g., a latent infection of HSV.
[0078] For example, the therapeutic agents described herein may be
formulated as a spray, lotion, cream, foam, gel, and the like, or
any other suitable delivery method known in the art or described
herein, and may include, for example, standard lubricants and/or
detergents or other additives. In one embodiment, these
formulations are administered in combination with barrier methods
for protection against sexually transmitted diseases, or may be
applied to condoms or other barrier protection devices.
[0079] The topically applied agents may also be used in combination
with a spermicidal or other microbicidal agent as described in, for
example, U.S. Pat. No. 6,302,108, the entire contents of which are
expressly incorporated herein, or in combination with other
prophylactic agents for the prevention of HIV or other STDs. The
compounds can also be prepared in the form of suppositories for
cervicovaginal or rectal delivery, e.g., with conventional
suppository bases such as cocoa butter and other glycerides, or
retention enemas for rectal delivery.
[0080] The prophylactic or therapeutic pharmaceutical compositions
of the invention can contain other pharmaceuticals, in conjunction
with a vector according to the invention, when used to
therapeutically treat viral mediated disease, such as disease
mediated by a virus described above, and can also be administered
in combination with other pharmaceuticals used to treat viral
mediated disease, such as with conventional antiviral therapy. For
example, the prophylactic or therapeutic pharmaceutical
compositions of the invention can also be used in combination with
other pharmaceuticals which treat or alleviate symptoms of viral
infection such as acyclovir, valacyclovir, famciclovir,
penciclovir, vidarabine, ganciclovir, idoxuridine, foscarnet,
trifluridine, levamisole, amlexanox, lidocaine, docosanol,
tetracaine, diphenhydramine, hydroxyzine, aspirin or aspirin
derivative, lysine or any combination thereof.
Pharmaceutical Compositions
[0081] The siRNA of the invention can be incorporated into
pharmaceutical or microbicidal compositions suitable for
administration. Such compositions typically comprise the siRNA
targeting a viral gene, and a pharmaceutically acceptable carrier.
As used herein the language "pharmaceutically acceptable carrier"
is intended to include any and all solvents, dispersion media,
coatings, antibacterial and antifungal agents, isotonic and
absorption delaying agents, and the like, compatible with
pharmaceutical administration. The use of such media and agents for
pharmaceutically active substances is well known in the art. Except
insofar as any conventional media or agent is incompatible with the
active compound, use thereof in the compositions is contemplated.
Supplementary active compounds can also be incorporated into the
compositions.
[0082] A pharmaceutical composition of the invention is formulated
to be compatible with its intended route of administration.
Generally, the compositions of the instant invention are introduced
by any standard means, with or without stabilizers, buffers, and
the like, to form a pharmaceutical composition. For use of a
liposome delivery mechanism, standard protocols for formation of
liposomes can be followed. The compositions of the present
invention can also be formulated and used as tablets, capsules or
elixirs for oral administration; suppositories for vaginal or
rectal administration; sterile solutions; suspensions for
injectable administration; and the like.
[0083] Examples of routes of administration include parenteral,
e.g., intravenous, intramuscular, intradermal, subcutaneous, oral
(e.g., inhalation), transdermal (topical), transmucosal, genital,
vaginal, cervicovaginal and rectal administration. Solutions or
suspensions used for parenteral, intradermal, or subcutaneous
application can include the following components: a sterile diluent
such as water for injection, saline solution, fixed oils,
polyethylene glycols, glycerine, propylene glycol or other
synthetic solvents; antibacterial agents such as benzyl alcohol or
methyl parabens; antioxidants such as ascorbic acid or sodium
bisulfite; chelating agents such as ethylenediaminetetraacetic
acid; buffers such as acetates, citrates or phosphates and agents
for the adjustment of tonicity such as sodium chloride or dextrose.
pH can be adjusted with acids or bases, such as hydrochloric acid
or sodium hydroxide. The parenteral preparation can be enclosed in
ampoules, disposable syringes or multiple dose vials made of glass
or plastic. The compounds can also be prepared in the form of
suppositories (e.g., with conventional suppository bases such as
cocoa butter and other glycerides) or retention enemas for rectal
delivery.
[0084] Systemic administration can also be topical, e.g., by
transmucosal or transdermal means. Suitable formulations for
topical, particularly vaginal or rectal, administration include
solutions, suspensions, gels, lotions and creams as well as
discrete units such as suppositories and microencapsulated
suspensions. For transmucosal or transdermal administration,
penetrants appropriate to the barrier to be permeated are used in
the formulation. Such penetrants are generally known in the art,
and include, for example, for transmucosal administration,
detergents, bile salts, and fusidic acid derivatives. Transmucosal
administration can be accomplished through the use of nasal sprays,
suppositories or the formulations of the transdermal
administrations. For transdermal administration, the active
compounds are formulated into ointments, salves, gels, or creams as
generally known in the art. Transmucosal drug delivery in the form
of a polytetrafluoroetheylene support matrix is described in U.S.
Pat. No. 5,780,045 (specifically incorporated herein by reference
in its entirety).
[0085] Delivery systems can include sustained release delivery
systems which can provide for slow release of the active component
of the invention, including sustained release gels, creams,
suppositories, or capsules. In one embodiment, the active compounds
are prepared with carriers that will protect the compound against
rapid elimination from the body, such as a controlled release
formulation, including implants and microencapsulated delivery
systems. Sustained release delivery systems include, but are not
limited to: (a) erosional systems in which the active component is
contained within a matrix, and (b) diffusional systems in which the
active component permeates at a controlled rate through a
polymerBiodegradable, biocompatible polymers can be used, such as
ethylene vinyl acetate, polyanhydrides, polyglycolic acid,
collagen, polyorthoesters, and polylactic acid. Methods for
preparation of such formulations will be apparent to those skilled
in the art. The materials can also be obtained commercially from
Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal
suspensions (including liposomes targeted to hepatocytes) can also
be used as pharmaceutically acceptable carriers. These can be
prepared according to methods known to those skilled in the art,
for example, as described in U.S. Pat. No. 4,522,811 and U.S. Pat.
No. 5,643,599, the entire contents of which are incorporated
herein.
[0086] The pharmaceutical compositions of the present invention can
be utilized in conjunction with a delivery device, e.g.,
microbicidal delivery device, by applying the agents on the device
or as a component of the device, including for example, a condom, a
contraceptive diaphragm, a cervical cap, a vaginal ring (e.g.,
NUVARING.RTM. etonogestrel/ethinyl estradiol vaginal ring),
cellulose sulfate gel (UsherCell, Polydex Pharmaceuticals Ltd.,
Nassau Bahamas) or a contraceptive sponge, such as, a collagen
sponge or a polyurethane foam sponge (TODAY SPONGE.RTM.).
Alternatively, the delivery device is not also a contraceptive
device. Alternatively, the pharmaceutical composition of the
present invention can be applied on a pessary, tampon or
suppository.
[0087] In certain embodiments, the pharmaceutical compositions may
be delivered by intranasal sprays, inhalation, and/or other aerosol
delivery vehicles. Methods for delivering genes, nucleic acids, and
peptide compositions directly to the lungs via nasal aerosol sprays
has been described e.g., in U.S. Pat. No. 5,756,353 and U.S. Pat.
No. 5,804,212 (each specifically incorporated herein by reference
in its entirety). Likewise, the delivery of drugs using intranasal
microparticle resins (Takenaga et al., 1998) and
lysophosphatidyl-glycerol compounds (U.S. Pat. No. 5,725,871,
specifically incorporated herein by reference in its entirety) are
also well-known in the pharmaceutical arts.
[0088] In another embodiment, pharmaceutical compositions may be
delivered by ocularly via eyedrops.
[0089] Liposomal suspensions (including liposomes targeted to
macrophages containing, for example, phosphatidylserine) can also
be used as pharmaceutically acceptable carriers. These can be
prepared according to methods known to those skilled in the art,
for example, as described in U.S. Pat. No. 4,522,811 U.S. Pat. No.
5,643,599, the entire contents of which are incorporated herein.
Alternatively, the therapeutic agents of the invention may be
prepared by adding a poly-G tail to one or more ends of the siRNA
for uptake into target cells.
[0090] Pharmaceutical compositions suitable for injectable use
include sterile aqueous solutions (where water soluble) or
dispersions and sterile powders for the extemporaneous preparation
of sterile injectable solutions or dispersion. For intravenous
administration, suitable carriers include physiological saline,
bacteriostatic water, Cremophor EL.TM. (BASF, Parsippany, N.J.) or
phosphate buffered saline (PBS). In all cases, the composition must
be sterile and should be fluid to the extent that easy
syringability exists. It must be stable under the conditions of
manufacture and storage and must be preserved against the
contaminating action of microorganisms such as bacteria and fungi.
The carrier can be a solvent or dispersion medium containing, for
example, water, ethanol, polyol (for example, glycerol, propylene
glycol, and liquid polyetheylene glycol, and the like), and
suitable mixtures thereof. The proper fluidity can be maintained,
for example, by the use of a coating such as lecithin, by the
maintenance of the required particle size in the case of dispersion
and by the use of surfactants. Prevention of the action of
microorganisms can be achieved by various antibacterial and
antifungal agents, for example, parabens, chlorobutanol, phenol,
ascorbic acid, thimerosal, and the like. In many cases, it will be
preferable to include isotonic agents, for example, sugars,
polyalcohols such as manitol, sorbitol, sodium chloride in the
composition. Prolonged absorption of the injectable compositions
can be brought about by including in the composition an agent which
delays absorption, for example, aluminum monostearate and
gelatin.
[0091] Sterile injectable solutions can be prepared by
incorporating the siRNA in the required amount in an appropriate
solvent with one or a combination of ingredients enumerated above,
as required, followed by filtered sterilization. Generally,
dispersions are prepared by incorporating the active compound into
a sterile vehicle which contains a basic dispersion medium and the
required other ingredients from those enumerated above. In the case
of sterile powders for the preparation of sterile injectable
solutions, the preferred methods of preparation are vacuum drying
and freeze-drying which yield a powder of the active ingredient
plus any additional desired ingredient from a previously
sterile-filtered solution thereof.
[0092] Oral compositions generally include an inert diluent or an
edible carrier. They can be enclosed in gelatin capsules or
compressed into tablets. For the purpose of oral therapeutic
administration, the active compound can be incorporated with
excipients and used in the form of tablets, troches, or capsules.
Oral compositions can also be prepared using a fluid carrier for
use as a mouthwash, wherein the compound in the fluid carrier is
applied orally and swished and expectorated or swallowed.
Pharmaceutically compatible binding agents, and/or adjuvant
materials can be included as part of the composition. The tablets,
pills, capsules, troches and the like can contain any of the
following ingredients, or compounds of a similar nature: a binder
such as microcrystalline cellulose, gum tragacanth or gelatin; an
excipient such as starch or lactose, a disintegrating agent such as
alginic acid, Primogel, or corn starch; a lubricant such as
magnesium stearate or Sterotes; a glidant such as colloidal silicon
dioxide; a sweetening agent such as sucrose or saccharin; or a
flavoring agent such as peppermint, methyl salicylate, or orange
flavoring.
[0093] It is especially advantageous to formulate oral or
parenteral compositions in dosage unit form for ease of
administration and uniformity of dosage. Dosage unit form as used
herein refers to physically discrete units suited as unitary
dosages for the subject to be treated; each unit containing a
predetermined quantity of active compound calculated to produce the
desired therapeutic effect in association with the required
pharmaceutical carrier. The specification for the dosage unit forms
of the invention are dictated by and directly dependent on the
unique characteristics of the active compound and the particular
therapeutic effect to be achieved, and the limitations inherent in
the art of compounding such an active compound for the treatment of
individuals.
[0094] Toxicity and therapeutic efficacy of such compounds can be
determined by standard pharmaceutical procedures in cell cultures
or experimental animals, e.g., for determining the LD50 (the dose
lethal to 50% of the population) and the ED50 (the dose
therapeutically effective in 50% of the population). The dose ratio
between toxic and therapeutic effects is the therapeutic index and
it can be expressed as the ratio LD50/ED50. Compounds which exhibit
large therapeutic indices are preferred. While compounds that
exhibit toxic side effects may be used, care should be taken to
design a delivery system that targets such compounds to the site of
affected tissue in order to minimize potential damage to uninfected
cells and, thereby, reduce side effects.
[0095] The data obtained from the cell culture assays and animal
studies can be used in formulating a range of dosage for use in
humans. The dosage of such compounds lies preferably within a range
of circulating concentrations that include the ED50 with little or
no toxicity. The dosage may vary within this range depending upon
the dosage form employed and the route of administration utilized.
For any compound used in the method of the invention, the
therapeutically effective dose can be estimated initially from cell
culture assays. A dose may be formulated in animal models to
achieve a circulating plasma concentration range that includes the
IC50 (i.e., the concentration of the test compound which achieves a
half-maximal inhibition of symptoms) as determined in cell culture.
Such information can be used to more accurately determine useful
doses in humans. Levels in plasma may be measured, for example, by
high performance liquid chromatography.
[0096] As defined herein, a therapeutically effective amount of an
siRNA (i.e., an effective dosage) ranges from about 0.001 to 3000
mg/kg body weight, preferably about 0.01 to 2500 mg/kg body weight,
more preferably about 0.1 to 2000 mg/kg body weight, and even more
preferably about 1 to 1000 mg/kg, 2 to 900 mg/kg, 3 to 800 mg/kg, 4
to 700 mg/kg, or 5 to 600 mg/kg body weight. In one embodiment, the
average adult is 60 kg and is administered about 0.5 to 50 mg,
about 1 to 45 mg, about 2 to 40, about 3 to 35 mg, about 4 to 30
mg, about 5 to 25 mg, about 6 to 20 mg of siRNA. The skilled
artisan will appreciate that certain factors may influence the
dosage required to effectively treat a subject, including but not
limited to the severity of the disease or disorder, previous
treatments, the general health and/or age of the subject, and other
diseases present. Moreover, treatment of a subject with a
therapeutically effective amount of an siRNA can include a single
treatment or, preferably, can include a series of treatments.
[0097] Generally, at intervals to be determined by the prophylaxis
or treatment of pathogenic states, intra-genital or intra-mucosal
doses of active component will be from about 0.01 mg/kg per day to
1000 mg/kg per day. Small doses (0.01-1 mg) may be administered
initially, followed by increasing doses up to about 1000 mg/kg per
day. In the event that the response in a subject is insufficient at
such doses, even higher doses (or effective higher doses by a
different, more localized delivery route) may be employed to the
extent patient tolerance permits. Multiple doses per day can be
contemplated to achieve appropriate systemic levels of
compounds.
[0098] It is understood that appropriate doses of the siRNAs depend
upon a number of factors within the ken of the ordinarily skilled
physician, veterinarian, or researcher. The dose(s) of the agent
will vary, for example, depending upon the identity, size, and
condition of the subject or sample being treated, further depending
upon the route by which the composition is to be administered, if
applicable, and the effect which the practitioner desires the siRNA
to have upon the virus.
[0099] The pharmaceutical compositions can be included in a
container, pack, or dispenser together with instructions for
administration.
[0100] This invention is further illustrated by the following
examples which should not be construed as limiting.
Example
Methods
[0101] Mice. BALB/c mice (5-8 weeks old) were from Taconic Farms;
FVB.Cg-Tg (GFPU)5Nagy mice were from Jackson Laboratories (11).
Mice subcutaneously injected with 2 mg medroxyprogesterone acetate
(Sicor) 1 wk earlier were infected with 10.sup.4 (.about.2 LD50)
HSV-2 strain 186 per vagina (21). siRNA (500 pmole) complexed with
Oligofectamine (Invitrogen), prepared according to the
manufacturer's protocol, was administered per vagina in a maximal
volume of 12 ul in two regimens -2 hr before and 4 hr after HSV-2
infection or 1 and 2 hr after HSV-2 infection. Mice were examined
daily for signs of HSV-2 graded by a 5-point scale (0, no signs of
infection; 1, slight genital erythema and edema; 2, moderate
genital inflammation; 3, purulent genital lesions; 4, hind limb
paralysis; 5, death) (21). Viral shedding from the genital
epithelium was determined by swabbing (Micropur swab, PurFybr Inc)
the vaginal cavity on day 6 post-infection and titrating virus on
Vero cells. In some cases, the vagina was dissected at indicated
times and either fixed in 10% formalin (Sigma) for paraffin
embedding and sectioning, or stored in RNAlater (Qiagen) for RNA
isolation.
[0102] Viruses and transfection assays. For in vitro studies,
186.DELTA.Kpn, a replication-competent, thymidine kinase-negative
mutant of strain 186syn+22 was grown in Vero cells as described
(23). Vero or NIH3T3 cells (ATCC) (4.times.10.sup.5 cells/well in 6
well plates in 1 ml of complete medium, plated 1 day earlier), were
treated with 100 pmol siRNA, complexed with TransIT-TKO (Mirus) to
transfect Vero cells or with TransIT-siQuest (Mirus) for NIH3T3
cells according to the manufacturer's instructions. After overnight
incubation at 37 C, medium was replaced, and 2 hrs later HSV-2
186.DELTA.Kpn was added at an MOI=1. After 1 hr at 37 C, medium was
again replaced. Cells were harvested 24 hr later and viral titer
determined by plaque assay on Vero cells. For mouse experiments
wild-type HSV-2 strain 186syn+ virus was used (24). An aliquot of
virus used for each mouse experiment was also assayed by plaque
assay to confirm viral titer.
[0103] siRNAs. siRNAs (Dharmacon) were prepared according to
manufacturer's instructions.
[0104] FITC-labeled siRNA was a previously described sequence
targeting CD425. The sequence for silencing EGFP was described
(25). The sequences for HSV-2 (Genbank accession no. NC 001798)
were
TABLE-US-00004 UL5.1 (nt 12838-12856) (SEQ ID NO: 1) sense: 5'-CUA
CGG CAU CAG CUC CAA A-3' (SEQ ID NO: 2) antisense: 5'-UUU GGA GCU
GAU GCC GUA G-3' UL5.2 (nt 12604-12622) (SEQ ID NO: 3) sense:
5'-UGU GGU CAU UGU CUA UUA A-3' (SEQ ID NO: 4) antisense: 5'-UUA
AUA GAC AAU GAC CAC A-3' UL27.1 (nt 54588-54606) (SEQ ID NO: 5)
sense: 5'-GUU UAC GUA UAA CCA CAU A-3' (SEQ ID NO: 6) antisense:
5'-UAU GUG GUU AUA CGU AAA C-3' UL27.2 (nt 54370-54388) (SEQ ID NO:
7) sense: 5'-ACG UGA UCG UGC AGA ACU C-3' (SEQ ID NO: 8) antisense:
5'-GAG UUC UGC ACG AUC ACG U-3' UL27.3 (nt 54097-54115) (SEQ ID NO:
9) sense: 5'-UCG ACC UGA ACA UCA CCA U-3' (SEQ ID NO: 10)
antisense: 5'-AUG GUG AUG UUC AGG UCG A-3' UL29.1 (nt 60324-60342)
(SEQ ID NO: 11) sense: 5'-CUU UCG CAA UCA AUU CCA A-3' (SEQ ID NO:
12) antisense: 5'-UUG GAA UUG AUU GCG AAA G-3' UL29.2 (nt
59715-59733) (SEQ ID NO: 13) sense: 5'-CCA CUC GAC GUA CUU CAU A-3'
(SEQ ID NO: 14) antisense: 5'-UAU GAA GUA CGU CGA GUG G-3'
[0105] Quantitative RT-PCR. Total RNA, extracted and stored in
RNAlater (Qiagen), was isolated using the RNeasy RNA isolation kit
(Qiagen) according to the manufacturer's protocol. Total RNA (1 ug)
was reverse transcribed using Superscript III (Invitrogen) and
random hexamers, according to the manufacturer's protocol.
Real-time PCR was performed on 0.2 ul of cDNA, or a comparable
amount of RNA with no reverse transcriptase, using Platinum Taq
Polymerase (Invitrogen) and a Biorad iCycler. SYBR green (Molecular
Probes, Oregon) was used to detect PCR products. Reactions were
performed in a 25 ul reaction volume in triplicate. Primers used
are:
TABLE-US-00005 (SEQ ID NO: 15) GAPDH-fwd
5'-TTCACCACCATGGAGAAGGC-3', (SEQ ID NO: 16) GAPDH-rev
5'-GGCATGGACTGTGGTCATGA-3', (SEQ ID NO: 17) TK-fwd 5'-CGATCTACT
CGCCAACACGGT G-3' (SEQ ID NO: 18) TK-rev
5'-GAACGCGGAACAGGGCAAACAG-3' (SEQ ID NO: 19) UL5-fwd
5'-TCGCTGGAGTCCACCTTCGAAC-3' (SEQ ID NO: 20) UL5-rev
5'-CGAACTCGTGCTCCACACATCG-3' (SEQ ID NO: 21) UL27-fwd
5-CAAAGACGTGACCGTGTCGCAG-3' (SEQ ID NO: 22) UL27-rev
5'-GCGGTGGTCTCCATGTTGTTCC-3' (SEQ ID NO: 23) UL29-fwd
5'-GCCAGGAGATGGACGTGTTTCG-3' (SEQ ID NO: 24) UL29-rev
5'-CGCGCTGTTCATCGTTCCGAAG-3' (SEQ ID NO: 25) STAT1-fwd
5'-TTTGCCCAGACTCGAGCTCCTG-3' (SEQ ID NO: 26) STAT1-rev
5'-GGGTGCAGGTTCGGGATTCAAC-3' (SEQ ID NO: 27) OAS1-fwd
5'-GGAGGTTGCAGTGCCAACGAAG-3' (SEQ ID NO: 28) OAS1-rev
5'-TGGAAGGGAGGCAGGGCATAAC-3' (SEQ ID NO: 29) Interferon beta-fwd
5'-CTGGAGCAGCTGAATGGAAAG-3' (SEQ ID NO: 30) Interferon beta-rev
5'-CTTGAAGTCCGCCCTGTAGGT-3'
[0106] PCR parameters consisted of 5 min of Taq activation at 95 C,
followed by 40 cycles of PCR at 95 C.times.20 sec, 60 C.times.30
sec, and 69 C.times.20 sec. Standard curves were generated and the
relative amount of target gene mRNA was normalized to GAPDH mRNA.
Specificity was verified by melt curve analysis and agarose gel
electrophoresis.
[0107] Tissue sections and microscopy. For analysis of fluorescent
tissue, dissected tissue was placed in Oct compound (TissueTek) and
snap frozen in LN2. For hematoxylin-eosin stained sections, tissues
were fixed in 10% formalin and paraffin-embedded. Microscopy was
performed on a Zeiss Axiovert 200M microscope using Slidebook
acquisition and analysis software (Intelligent Imaging).
[0108] Statistical analysis. In vitro experimental data was
analyzed by student's t-test. Survival distribution was calculated
using the Kaplan and Meier method (26), and the univariate
comparison of survival distributions for treated vs. control groups
was tested using the log-rank test, comparing 2 groups at a time
(27). The approach of generalized estimating equations was used to
model the disease scores collected over time and to compare disease
severity of treated vs. control groups (28). All p-values reported
are for two-sided significance tests.
Results
[0109] To determine whether siRNAs are taken up into the genital
mucosa, we instilled FITC-siRNA complexed with Oligofectamine into
the mouse vagina. Fluorescence was observed 24 hr later in cells
throughout the vaginal and ectocervical mucosa and the underlying
lamina propria (FIG. 1a). To determine whether these siRNAs
effectively silence gene expression in the vagina, siRNAs targeting
EGFP and inverted control siRNAs were administered intravaginally
with Oligofectamine to GFP mice that express EGFP in every cell
from the beta-actin promoter (11). Three days later, GFP expression
was down-modulated in GFP siRNA-treated mice, but not in control
mice (FIG. 1b). Silencing was also evident throughout the cervix,
but there was no systemic silencing in distant organs like the
liver. Because silencing can persist for several weeks in cells
that are not dividing, we looked at the durability of silencing.
Silencing lasted without diminution for at least 9 days (as long as
the experiments were conducted) under conditions where epithelial
turnover was reduced by treatment with medroxyprogesterone acetate
(FIG. 1c). The extent and persistence of local silencing
demonstrates that siRNAs are active in a microbicide. Moreover the
durability of silencing suggests that an RNAi-mediated microbicide
might not need to be administered just prior to sexual intercourse,
mitigating one of the major problems with microbicides,
compliance.
[0110] To determine whether the profound silencing observed for an
endogenous gene could be harnessed to protect against sexually
transmitted infection, we designed 7 siRNAs targeting 3 essential
HSV-2 genes--UL5, encoding a component of the helicase-primase
complex; UL27, which encodes the envelope glycoprotein B; and UL29,
encoding a DNA-binding protein (5). siRNAs were chosen using the
Dharmacon design program, which included a criterion that would
favor unwinding from the 5'-end of the antisense strand (12-14).
After overnight transfection with lipid-complexed siRNAs targeting
HSV-2 or control EGFP, NIH3T3 (FIG. 2a) and Vero (FIG. 2b) cells
were infected with HSV-2 186 at a multiplicity of infection (MOI)
of 1, and viral replication was assessed by plaque assay 24 hr
later. Three of the siRNAs (UL5.2, UL27.2 and UL29.2) resulted in
significant decreases in viral titer, with reductions ranging from
5 to 62 fold. Transfection of the GFP siRNA did not reproducibly
decrease viral titer. UL29.2 was the most effective siRNA at
suppressing viral production in both cell lines, suppressing viral
replication by 25-fold in Vero cells and 62-fold in NIH3T3 cells.
The effectiveness of silencing was also analyzed by quantitative
RT-PCR amplification of viral mRNAs that encode the viral thymidine
kinase TK as well as the targeted UL5, UL27 and UL29 genes (FIG.
2c). RNA was isolated from Vero cells harvested 24 hr after HSV-2
infection at an MOI of 1 and was normalized to GAPDH expression.
Transfection with control siRNA targeting EGFP had no significant
effect on viral gene transcription. Silencing of viral gene
expression roughly paralleled inhibition of viral replication with
UL29.2 siRNA proving to be the most effective, suppressing relative
viral gene expression by 4-5 fold. UL5.2 and UL27.2 siRNAs each
inhibited viral gene expression by about 3-fold. Silencing any of
the 3 viral genes effectively silenced the expression of the other
nontargeted viral genes, demonstrating the importance of each of
these genes for viral replication and spread.
[0111] We next investigated whether treatment with siRNAs targeting
HSV-2 could protect mice from vaginal infection. Because UL29.2 was
the most effective siRNA, in initial experiments groups of 5-10
mice were treated per vagina with 0.5 nmol of UL29.2 siRNA or
control GFP siRNA delivered with Oligofectamine 2 hrs prior and 4
hrs following infection with 2 LD50 (10.sup.4 pfu) of HSV-2
wild-type virus. The mice were pretreated with medroxyprogesterone
acetate 1 week earlier to reduce variations in infectivity due to
differences in menstrual cycle. Treatment with UL29.2 siRNA
provided highly significant protection, assessed daily by a
clinical disease scoring system or by survival (FIG. 3a, b). While
75% of infected mice treated with GFP siRNA (15/20) or no siRNA
(13/17) died, only 25% of mice treated with UL29.2 siRNA (5/20)
died (time to death comparison by log rank test, p<0.001 vs no
treatment, p<0.003 vs GFP siRNA). Although 60% of mice treated
with UL29.2 siRNA developed some signs of infection from this
lethal challenge, the surviving mice had no clinical symptoms of
disease by day 11. A longitudinal regression analysis of disease
severity over time and between groups showed robust protection in
UL29.2 siRNA-treated mice (p<0.001 vs no treatment, p<0.006
vs GFP siRNA control mice when analyzed with respect to time
course; p<0.001 vs either control group when analyzed between
groups). Mice treated with UL27.2 siRNA, which was less effective
in vitro, were also partially protected by disease score and
survival, but protection was less effective. Sixty percent (6/10)
of mice survived the lethal vaginal challenge (p<0.009 compared
to untreated, p=0.10 compared to GFP siRNA-treated mice). Moreover,
protection from disease severity in UL27.2 siRNA-treated mice
analyzed by longitudinal regression analysis was highly significant
(p<0.001 compared to untreated, p<0.006 compared to GFP
siRNA-treated mice with respect to time; p<0.01 and p=0.05,
analyzed between the respective groups). When siRNA treatment was
deferred until after vaginal challenge in 1 pilot experiment
involving 5 mice per group, there was a trend towards a survival
advantage in mice treated 1 and 2 hr after infection with UL29.2.
While 3 mice in the UL29.2 group and 2 mice in the UL27.2 group
survived, none survived of the mice not given siRNAs and 1 mouse
survived in the group given GFP siRNA (p=0.08 for UL29.2, ns for
UL27.2 by log-rank test). Further experiments to optimize
post-exposure therapy are in progress.
[0112] The clinical advantage afforded by treatment with antiviral
siRNAs was also evident by quantifying genitally shed virus
obtained by vaginal swab 6 days following infection (FIG. 3c).
While all infected mice that were not given siRNAs shed virus on
day 6, no virus was detected in 70% of UL29.2- and 50% of
UL27.2-treated mice. No virus was isolated from 3 of 9 control GFP
siRNA-treated mice, but this was not significantly different from
untreated mice. The geometric mean viral titer was reduced by more
than 2 logs by UL29.2 treatment from 1226 pfu/ml in untreated mice
to 7.9 pfu/ml in mice that received UL29.2 (p<0.006). Viral
shedding at day 6 predicted survival since 18 of 19 mice that had
detectable plaques died, while none of the mice with undetectable
virus died. Analysis of cervicovaginal histology by
hematoxylin-eosin staining of mice sacrificed at day 6 also showed
substantial preservation of vaginal mucosa by treatment with
antiviral siRNAs (FIG. 3d). In the control, infected mice that were
pretreated either with no siRNA or GFP siRNA, the mucosal
epithelium was partially denuded, and apoptosis and inflammatory
infiltrates were prominent. Multinucleated cells with intranuclear
inclusion bodies, a hallmark of HSV-2 infection, were also evident.
By contrast, the epithelium was intact and there were few apoptotic
bodies and scarcely any inflammatory cells in UL27.2 or UL29.2
siRNA-treated mice.
[0113] Some recent studies suggest that under certain circumstances
siRNA treatment can induce the interferon pathway and initiate
inflammatory responses (15-18). To rule out the possibility that
the treatment was toxic or that antiviral protection was due to
non-specific effects, we analyzed vaginal tissue, obtained 24 and
48 hr after treatment of uninfected mice with lipid-complexed
control or antiviral siRNAs, for inflammatory infiltrates by
hematoxylin-eosin staining (FIG. 4a) and for induction of
interferon and interferon responsive genes (IRG) (FIG. 4b). siRNA
treatment does not cause an inflammatory infiltrate. Moreover, RNA
isolated at the expected peak time for induction of interferon and
IRG (1 and 2 days) did not show a significant induction of
expression of IFN-beta or the key IRGs, OAS1 or STAT1, by
quantitative RT-PCR when compared to mock-treated mice. As
expected, HSV2 infection, used as a positive control, in the
absence of siRNAs activated IRGs.
[0114] The contents of all references, patents and published patent
applications cited throughout this applicationare incorporated
herein by reference in their entirety.
REFERENCES
[0115] 1. Whitley, R. J. in Fields Virology (eds. Knipe, D. M.
& Howley, P. M.) 2461-2510 (Lippincott WIlliams and Wilkins,
Philadelphia, 2001). [0116] 2. Wald, A. & Link, K. Risk of
human immunodeficiency virus infection in herpes simplex virus type
2-seropositive persons: a meta-analysis. J Infect Dis 185, 45-52
(2002). [0117] 3. Celum, C., Levine, R., Weaver, M. & Wald, A.
Genital herpes and human immunodeficiency virus: double trouble.
Bull World Health Organ 82, 447-453 (2004). [0118] 4. Pilcher, H.
Starting to gel. Nature 430, 138-140 (2004). [0119] 5. Roizman, B.
& Knipe, D. M. in Fields Virology (eds. Knipe, D. M. &
Howley, P. M.) 2399-2440 (Lippincott Williams & Wilkins,
Philadelphia, 2001). [0120] 6. Shankar, P., Manjunath, N. &
Lieberman, J. The prospect of silencing disease using RNA
interference. JAMA 293, 1367-1373 (2005). [0121] 7. Ge, Q. et al.
Inhibition of influenza virus production in virus-infected mice by
RNA interference. Proc Natl Acad Sci USA 101, 8676-8681 (2004).
[0122] 8. Tompkins, S. M., Lo, C. Y., Tumpey, T. M. & Epstein,
S. L. Protection against lethal influenza virus challenge by RNA
interference in vivo. Proc Natl Acad Sci USA 101, 8682-8686 (2004).
[0123] 9. Bitko, V., Musiyenko, A., Shulyayeva, O. & Barik, S.
Inhibition of respiratory viruses by nasally administered siRNA.
Nat Med 11, 50-55 (2005). [0124] 10. Zhang, W. et al. Inhibition of
respiratory syncytial virus infection with intranasal siRNA
nanoparticles targeting the viral NS1 gene. Nat Med 11, 56-62
(2005). [0125] 11. Hadjantonakis, A. K., Gertsenstein, M., Ikawa,
M., Okabe, M. & Nagy, A. Generating green fluorescent mice by
germline transmission of green fluorescent ES cells. Mech Dev 76,
79-90 (1998). [0126] 12: Khvorova, A., Reynolds, A. & Jayasena,
S. D. Functional siRNAs and miRNAs exhibit strand bias. Cell 115,
209-216 (2003). [0127] 13. Schwarz, D. S. et al. Asymmetry in the
assembly of the RNAi enzyme complex. Cell 115, 199-208 (2003).
[0128] 14. Reynolds, A. et al. Rational siRNA design for RNA
interference. Nat Biotechnol 22, 326-330 (2004). [0129] 15. Sledz,
C. A., Holko, M., de Veer, M. J., Silverman, R. H. & Williams,
B. R. Activation of the interferon system by short-interfering
RNAs. Nat Cell Biol 5, 834-839 (2003). [0130] 16. Heidel, J. D.,
Hu, S., Liu, X. F., Triche, T. J. & Davis, M. E. Lack of
interferon response in animals to naked siRNAs. Nat Biotechnol 22,
1579-1582 (2004). [0131] 17. Hornung, V. et al. Sequence-specific
potent induction of IFN-alpha by short interfering RNA in
plasmacytoid dendritic cells through TLR7. Nat Med 11, 263-270
(2005). [0132] 18. Judge, A. D. et al. Sequence-dependent
stimulation of the mammalian innate immune response by synthetic
siRNA. Nat Biotechnol 23, 457-462 (2005). [0133] 19. Manoharan, M.
RNA interference and chemically modified small interfering RNAs.
Curr Opin Chem Biol 8, 570-579 (2004). [0134] 20. Lee, S. K. et al.
Lentiviral delivery of short hairpin RNAs protects CD4 T cells from
multiple clades and primary isolates of HIV. Blood (2005). [0135]
21. Morrison, L. A., Da Costa, X. J. & Knipe, D. M. Influence
of mucosal and parenteral immunization with a replication-defective
mutant of HSV-2 on immune responses and protection from genital
challenge. Virology 243, 178-187 (1998). [0136] 22. Jones, C. A.,
Taylor, T. J. & Knipe, D. M. Biological properties of herpes
simplex virus 2 replication-defective mutant strains in a murine
nasal infection model. Virology 278, 137-150 (2000). [0137] 23.
Gao, M. & Knipe, D. M. Genetic evidence for multiple nuclear
functions of the herpes simplex virus ICP8 DNA-binding protein. J
Virol 63, 5258-5267 (1989). [0138] 24. Spang, A. E., Godowski, P.
J. & Knipe, D. M. Characterization of herpes simplex virus 2
temperature-sensitive mutants whose lesions map in or near the
coding sequences for the major DNA-binding protein. J Virol 45,
332-342 (1983). [0139] 25. Novina, C. D. et al. siRNA-directed
inhibition of HIV-1 infection. Nat Med 8, 681-686. (2002). [0140]
26. Kaplan, E. L. & Meier, R. Non-parametric estimation from
incomplete observation. J Am Stat Assoc 53, 457-581 (1958). [0141]
27. Mantel, N. Evaluation of survival data and two new rank order
statistics arising in its consideration. Cancer Chemother Rep 50,
163-170 (1966). [0142] 28. Zeger, S. L. & Liang, K. Y.
Longitudinal data analysis for discrete and continuous outcomes.
Biometrics 42, 121-130 (1986).
Sequence CWU 1
1
50119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic siRNA 1cuacggcauc agcuccaaa 19219RNAArtificial
SequenceDescription of Artificial Sequence Synthetic siRNA
2uuuggagcug augccguag 19319RNAArtificial SequenceDescription of
Artificial Sequence Synthetic siRNA 3uguggucauu gucuauuaa
19419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic siRNA 4uuaauagaca augaccaca 19519RNAArtificial
SequenceDescription of Artificial Sequence Synthetic siRNA
5guuuacguau aaccacaua 19619RNAArtificial SequenceDescription of
Artificial Sequence Synthetic siRNA 6uaugugguua uacguaaac
19719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic siRNA 7acgugaucgu gcagaacuc 19819RNAArtificial
SequenceDescription of Artificial Sequence Synthetic siRNA
8gaguucugca cgaucacgu 19919RNAArtificial SequenceDescription of
Artificial Sequence Synthetic siRNA 9ucgaccugaa caucaccau
191019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic siRNA 10auggugaugu ucaggucga 191119RNAArtificial
SequenceDescription of Artificial Sequence Synthetic siRNA
11cuuucgcaau caauuccaa 191219RNAArtificial SequenceDescription of
Artificial Sequence Synthetic siRNA 12uuggaauuga uugcgaaag
191319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic siRNA 13ccacucgacg uacuucaua 191419RNAArtificial
SequenceDescription of Artificial Sequence Synthetic siRNA
14uaugaaguac gucgagugg 191520DNAArtificial SequenceDescription of
Artificial Sequence Synthetic Primer 15ttcaccacca tggagaaggc
201620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 16ggcatggact gtggtcatga 201722DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
17cgatctactc gccaacacgg tg 221822DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 18gaacgcggaa cagggcaaac ag
221922DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 19tcgctggagt ccaccttcga ac 222022DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
20cgaactcgtg ctccacacat cg 222122DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 21caaagacgtg accgtgtcgc ag
222222DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 22gcggtggtct ccatgttgtt cc 222322DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
23gccaggagat ggacgtgttt cg 222422DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 24cgcgctgttc atcgttccga ag
222522DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 25tttgcccaga ctcgagctcc tg 222622DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
26gggtgcaggt tcgggattca ac 222722DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 27ggaggttgca gtgccaacga ag
222822DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 28tggaagggag gcagggcata ac 222921DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
29ctggagcagc tgaatggaaa g 213021DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 30cttgaagtcc gccctgtagg t
21319PRTHuman immunodeficiency virus 31Arg Lys Lys Arg Arg Gln Arg
Arg Arg1 53213PRTHuman immunodeficiency virus 32Gly Arg Lys Lys Arg
Arg Gln Arg Arg Arg Thr Pro Gln1 5 103311PRTHuman immunodeficiency
virus 33Tyr Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg1 5
103426PRTHomo sapiens 34Ala Ala Val Ala Leu Leu Pro Ala Val Leu Leu
Ala Leu Leu Ala Pro1 5 10 15Val Gln Arg Lys Arg Gln Lys Leu Met Pro
20 253517PRTCaiman crocodilus 35Met Gly Leu Gly Leu His Leu Leu Val
Leu Ala Ala Ala Leu Gln Gly1 5 10 15Ala3623PRTHuman
immunodeficiency virus 36Gly Ala Leu Phe Leu Gly Phe Leu Gly Ala
Ala Gly Ser Thr Met Gly1 5 10 15Ala Pro Lys Ser Lys Arg Lys
203716PRTDrosophila sp. 37Arg Gln Ile Lys Ile Trp Phe Gln Asn Arg
Arg Met Lys Trp Lys Lys1 5 10 15385PRTUnknown OrganismDescription
of Unknown Organism RGD consensus Peptide of unknown origin 38Xaa
Arg Gly Asp Xaa1 53924PRTInfluenza virus 39Gly Leu Phe Glu Ala Ile
Ala Gly Phe Ile Glu Asn Gly Trp Glu Gly1 5 10 15Met Ile Asp Gly Gly
Gly Tyr Cys 204027PRTUnknown OrganismDescription of Unknown
Organism Transportan A peptide of unknown origin 40Gly Trp Thr Leu
Asn Ser Ala Gly Tyr Leu Leu Gly Lys Ile Asn Leu1 5 10 15Lys Ala Leu
Ala Ala Leu Ala Lys Lys Ile Leu 20 25419PRTUnknown
OrganismDescription of Unknown Organism Pre-S-peptide of unknown
origin 41Ser Asp His Gln Leu Asn Pro Ala Phe1 5429PRTUnknown
OrganismDescription of Unknown Organism Somatostatin
(tyr-3-octreotate) peptide of unknown origin 42Ser Phe Cys Tyr Trp
Lys Thr Cys Thr1 54323DNAArtificial SequenceDescription of
Artificial Sequence Consensus siRNA oligonucleotide 43aannnnnnnn
nnnnnnnnnn naa 234419DNAUnknown OrganismDescription of Unknown
Organism Target sequence of variable origin 44ctacggcatc agctccaaa
194519DNAUnknown OrganismDescription of Unknown Organism Target
sequence of variable origin 45tgtggtcatt gtctattaa 194619DNAUnknown
OrganismDescription of Unknown Organism Target sequence of variable
origin 46gtttacgtat aaccacata 194719DNAUnknown OrganismDescription
of Unknown Organism Target sequence of variable origin 47acgtgatcgt
gcagaactc 194819DNAUnknown OrganismDescription of Unknown Organism
Target sequence of variable origin 48tcgacctgaa catcaccat
194919DNAUnknown OrganismDescription of Unknown Organism Target
sequence of variable origin 49ctttcgcaat caattccaa 195019DNAUnknown
OrganismDescription of Unknown Organism Target sequence of variable
origin 50ccactcgacg tacttcata 19
* * * * *