U.S. patent application number 13/167887 was filed with the patent office on 2012-03-15 for hepatitis c receptor protein cd81.
This patent application is currently assigned to Novartis Vaccines & Diagnostics, Inc.. Invention is credited to Sergio Abrignani, Guido Grandi.
Application Number | 20120066779 13/167887 |
Document ID | / |
Family ID | 26312375 |
Filed Date | 2012-03-15 |
United States Patent
Application |
20120066779 |
Kind Code |
A1 |
Abrignani; Sergio ; et
al. |
March 15, 2012 |
HEPATITIS C RECEPTOR PROTEIN CD81
Abstract
The present invention relates to the use of CD81 protein and
polynucleic acid in the therapy and diagnosis of hepatitis C and
pharmaceutical compositions, animal models and diagnostic kits for
such purposes.
Inventors: |
Abrignani; Sergio;
(Vagliagli, IT) ; Grandi; Guido; (Segrate,
IT) |
Assignee: |
Novartis Vaccines &
Diagnostics, Inc.
|
Family ID: |
26312375 |
Appl. No.: |
13/167887 |
Filed: |
June 24, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12231370 |
Sep 2, 2008 |
|
|
|
13167887 |
|
|
|
|
11495151 |
Jul 28, 2006 |
|
|
|
12231370 |
|
|
|
|
10859700 |
Jun 3, 2004 |
7097987 |
|
|
11495151 |
|
|
|
|
09509612 |
Mar 29, 2000 |
|
|
|
PCT/IB98/01628 |
Oct 6, 1998 |
|
|
|
10859700 |
|
|
|
|
Current U.S.
Class: |
800/9 ;
800/21 |
Current CPC
Class: |
A01K 2217/05 20130101;
A61K 38/00 20130101; C07K 2319/00 20130101; A61P 31/16 20180101;
C07K 14/70596 20130101; A61P 31/14 20180101; A61P 31/20
20180101 |
Class at
Publication: |
800/9 ;
800/21 |
International
Class: |
A01K 67/027 20060101
A01K067/027; C12N 15/85 20060101 C12N015/85 |
Foreign Application Data
Date |
Code |
Application Number |
Oct 6, 1997 |
GB |
9721182.5 |
Jun 23, 1998 |
GB |
9813560.1 |
Claims
1. A transgenic, non-human mammal comprising a nucleotide sequence
encoding a CD81 protein.
2. The transgenic; non-human mammal of claim 1, wherein the mammal
is a mouse.
3. The transgenic, non-human mammal of claim 1, wherein the
nucleotide sequence is the human CD81 nucleotide sequence.
4. The transgenic, non-human mammal of claim 2, wherein the
nucleotide sequence is, the human CD81 nucleotide sequence.
5. A method of producing a transgenic non-human mammal comprising
introducing a nucleotide sequence encoding a CD81 protein into the
embryo of said non-human mammal.
6. The method of claim 5, wherein the non-human mammal is a
mouse.
7. The method of claim 5, wherein the nucleotide sequence is a CD81
nucleotide sequence.
8. The method of claim 6, wherein the nucleotide sequence is a CD81
nucleotide sequence.
9. The transgenic, non-human mammal of claim 1, wherein the mammal
provides for ubiquitous expression of CD81.
10. The transgenic, non-human mammal of claim 1, wherein the mammal
provides for liver-specific expression of CD81.
11. The transgenic, non-human mammal of claim 1, wherein the mammal
provides for B lymphocyte-specific expression of CD81.
Description
CROSS REFERENCE TO RELATED APPLICATION
[0001] This application is a continuation of U.S. patent
application Ser. No. 12/231,370, filed Sep. 2, 2008, which is a
continuation of U.S. patent application Ser. No. 11/495,151, filed
Jul. 28, 2006, now abandoned, which is a continuation of U.S.
patent application Ser. No. 10/859,700, filed Jun. 3, 2004, now
U.S. Pat. No. 7,097,987, which is a continuation of U.S. patent
application Ser. No. 09/509,612, filed Mar. 29, 2000, now
abandoned, which is a .sctn.371 application of PCT/IB98/01628,
filed Oct. 6, 1998, which claims priority to GB9721182.5, filed
Oct. 6, 1997, and GB9813560, filed Jun. 23, 1998, from which
applications priority is claimed pursuant to the provisions of 35
U.S.C. .sctn.119 and .sctn.120, and which applications are hereby
incorporated by reference in their entireties.
FIELD OF THE INVENTION
[0002] The present invention relates to the use of CD81 protein and
nucleic acid encoding this protein in the therapy and diagnosis of
hepatitis C and to pharmaceutical compositions, animal models and
diagnostic kits for such uses.
BRIEF DESCRIPTION OF THE PRIOR ART
[0003] All publications, manuals, patents, and patent applications
cited herein are incorporated in full by reference. HCV (previously
known as Non-A Non-B hepatitis--NANBV) is a positive sense RNA
virus of about 10000 nucleotides with a single open reading frame
encoding a polyprotein of about 3000 amino acids. Although the
structure of the virus has been elucidated by recombinant DNA
techniques (European patent application EPA-0318216 and European
patent application EP-A-0388232), the virus itself has not been
isolated and the functions of the various viral proteins produced
by proteolysis of the polyprotein have only been inferred by
analogy with other similar viruses of similar genomic organization
(Choo et al PNAS USA (1991) .delta. 2451-2455).
[0004] The viral proteins are all available in recombinant form,
expressed in a variety of cells and cell types. including yeast.
bacteria, insect, plant and mammalian cells (Chien, D. Y. et al
PNAS USA (1992) 89 10011-10015 and Spaete. R. R. et al Virology
(1992) 188 819-830). Two proteins, named E1 and E2 (corresponding
to amino acids 192-383 and 384-750 of the HCV polyprotein,
respectively) have been suggested to be external proteins of the
viral envelope which are responsible for the binding of virus to
target cells.
[0005] HCV research is hindered very considerably by the limited
host range of the virus. The only reliable animal model for HCV
infection is the chimpanzee and HCV does not readily propagate in
tissue culture.
[0006] In our copending International patent application
PCT/IB95/00692 (WO 96/05513), we describe a method employing flow
cytometry to identify cells carrying the HCV receptor. We have
shown that by labelling cells with recombinant E2 envelope protein,
it is possible to sort cells using flow cytometry, isolating those
cells capable of specific binding to the E2 and therefore
potentially carrying an HCV receptor.
[0007] In our copending International patent application
PCT/IB96/00943 (WO 97/09349), we have identified a protein capable
of binding to the E2 envelope protein of HCV.
[0008] We have now succeeded with some difficulty in cloning the
DNA encoding the HCV receptor and have discovered, surprisingly
that the DNA encodes a cellular protein known as CD81. We are not
aware of any association in the literature between CD81 and the
HCV. CD81 was first identified by monoclonal antibodies as the
target of an antiproliferative antibody (TAPA-1) which inhibited in
vitro cellular proliferation. Armed with this new information and
given the sequence knowledge of CD81 in the public databases it is
now possible to design and produce an armoury of therapeutic and
diagnostic reagents against HCV.
SUMMARY OF THE INVENTION
[0009] According to the present invention, there is provided a CD81
protein, or functional equivalent thereof, for use in the therapy
or diagnosis of hepatitis C(HCV). According to a further aspect of
the present invention there is provided a compound that binds
specifically to the CD81 protein for use in the therapy or
diagnosis of HCV.
[0010] The term "CD81 protein, or a functional equivalent thereof"
as used herein means the human CD81 protein as defined by the
protein sequence listed in the SWISSPROT database (Accession No.
P18582) or the EMBL/GENBANK database (Accession No. M33690) or a
functional equivalent thereof. A functional equivalent of CD81 is a
compound which is capable of binding to HCV, preferably to the E2
protein of HCV. Preferably, the functional equivalent is a peptide
or protein. The term "functional equivalent" includes an analogue
of CD81, a fragment of CD81, and CD81 mutants and muteins.
[0011] One region of the human CD81 protein that is shown herein to
be involved in binding to the E2 protein of HCV is the "EC2" region
comprising amino acids 113-201 of the full length human sequence
shown in FIG. 1. The invention encompasses proteins and protein
fragments containing this region of human CD81, or containing
functional equivalents of this region, such as, for example, the
Chimpanzee sequence identified in FIG. 1. Preferably, the
functional equivalent is at least 80% homologous to the human CD81
sequence across the EC2 region of the protein, preferably at least
90% homologous as assessed by any conventional analysis algorithm
such as for example, the Pileup sequence analysis software (Program
Manual for the Wisconsin Package, 1996).
[0012] The term "a functionally equivalent fragment" as used herein
also means any fragment or assembly of fragments of the complete
protein that binds to HCV, preferably that binds to the E2 protein
of HCV. The complete protein may be truncated at one or both ends
or domains may be removed internally provided that the protein
retains the defined function. For example, one or more regions of
the protein responsible for membrane binding (TM1 to TM4 in FIG. 1)
may be removed to render the protein soluble when produced by a
recombinant process. The fragment of choice comprises the
extracellular loop 2 (EC2 in FIG. 1) of the CD81 protein (amino
acids 113-201).
[0013] If proteinaceous, functionally equivalent fragments or
analogues may belong to the same protein family as the human CD81
protein identified herein. By "protein family" is meant a group of
proteins that share a common function and exhibit common sequence
homology. By sequence homology is meant that the protein sequences
are related by divergence from a common ancestor, such as is the
case between the human and the chimpanzee. Chimpanzee CD81 is thus
an example of a functionally equivalent protein that binds to
HCV.
[0014] Preferably, the homology between functionally equivalent
protein sequences is at least 25% across the whole of amino acid
sequence of the complete protein or of the complete EC2 fragment
(amino acids 113-201). More preferably, the homology is at least
50%, even more preferably 75% across the whole of amino acid
sequence of the protein or protein fragment. Most preferably,
homology is greater than 80% across the whole of the sequence.
[0015] The term "a functionally equivalent analogue" is used to
describe those compounds that possess an analogous function to an
activity of the CD81 protein and may, for example comprise a
peptide, cyclic peptide, polypeptide, antibody or antibody
fragment. These compounds may be proteins, or may be synthetic
agents designed so as to mimic certain structures or epitopes on
the inhibitor protein. Preferably, the compound is an antibody or
antibody fragment.
[0016] The term "functionally equivalent analogue" also includes
any analogue of CD81 obtained by altering the amino acid sequence,
for example by one or more amino acid deletions, substitutions or
additions such that the protein analogue retains the ability to
bind to HCV, preferably the E2 protein of HCV. Amino acid
substitutions may be made, for example, by point mutation of the
DNA encoding the amino acid sequence.
[0017] The functional equivalent of CD81 may be an analogue of a
fragment of CD81. The CD81 or functional equivalent may be
chemically modified, provided it retains its ability to bind to
HCV, preferably the E2 protein of HCV.
[0018] It is envisaged that such molecules will be extremely useful
in preventative therapy of HCV infection, because these molecules
will bind specifically to the virus and will thus prevent
internalisation of the virus into cells. As used herein, "binding
specifically" means that the functionally equivalent analogue has
high affinity for the E2 protein of the HCV virus and does not bind
to any other protein with similar high affinity. Specific binding
may be measured by a number of techniques such as Western blotting,
FACS analysis, or immunoprecipitation. Preferably, the functionally
equivalent analogue binds to the E2 protein with an affinity of at
least 10.sup.-8, preferably at least 10.sup.-9 and most preferably
greater than 10.sup.-10.
[0019] According to a further embodiment of the invention there is
provided a compound that binds to CD81, such as a monoclonal or
polyclonal antibody to CD81, for use in the diagnosis or therapy of
HCV. Preferably the compound binds specifically to CD81 with an
affinity of at least 10.sup.-8, preferably at least 10.sup.-9 and
most preferably greater than 10.sup.-10. Such compounds may be used
to prevent the virus binding to patient cells and being
internalised.
[0020] The CD81 molecule is present on a number of different cell
types. Ideally, the compound that binds to CD81 therefore only
interacts with CD81 in the presence of HCV, so that the usual
function of CD81 is not compromised on healthy cells. Antibodies
and suitable methods of screening for such antibodies are described
in co-pending applications EP 96928648.3 and EP 95927918.3.
[0021] The CD81 protein, or functional equivalent thereof may be
produced by any suitable means, as will be apparent to those of
skill in the art. In order to produce sufficient amounts of CD81
protein, or functional equivalents thereof for use in accordance
with the present invention, expression may conveniently be achieved
by culturing under appropriate conditions recombinant host cells
containing the CD81 protein, or functional equivalent thereof.
[0022] Systems for cloning and expression of a polypeptide in a
variety of different host cells are well known.
[0023] Two preferred methods of construction of carrier proteins
according to the invention are direct chemical synthesis and by
production of recombinant protein. Preferably; the CD81 protein is
produced by recombinant means, by expression from an encoding
nucleic acid molecule. Recombinant expression has the advantage
that the production of the protein is inexpensive, safe, facile and
does not involve the use of toxic compounds that may require
subsequent removal.
[0024] When expressed in recombinant form, the CD81 protein or
functional equivalent thereof is preferably generated by expression
from an encoding nucleic acid in a host cell. Any host cell may be
used, depending upon the individual requirements of a particular
system. Suitable host cells include bacteria, mammalian cells,
plant cells, yeast and baculovirus systems. Mammalian cell lines
available in the art for expression of a heterologous polypeptide
include Chinese hamster ovary cells. HeLa cells, baby hamster
kidney cells and many others. Preferably, bacterial hosts are used
for the production of recombinant protein, due to the ease with
which bacteria may be manipulated and grown. A common, preferred
bacterial host is E. coli.
[0025] Preferably, if produced recombinantly, the CD81 protein or
functional equivalent is expressed from a plasmid that contains a
synthetic nucleic acid insert. The insertion site in the expression
plasmid into which the nucleic acid encoding the CD81 protein or
functional equivalent is cloned may allow linkage of the protein to
a tag, such as the "flag" peptide or polyhistidine. This
arrangement facilitates the subsequent purification of recombinant
protein.
[0026] According to a further aspect of the present invention,
there is also provided a nucleic acid molecule encoding the CD81
protein or functional equivalent thereof, for use in the therapy or
diagnosis of HCV infection. Preferably, the nucleic acid encodes
human CD81 protein. As will be apparent to one of skill in the art,
such a nucleic acid molecule will be designed using the genetic
code so as to encode the protein or peptide that is desired. A
nucleic acid molecule according to this aspect of the present
invention may comprise DNA, RNA or cDNA and may additionally
comprise nucleotide analogues in the coding sequence. Preferably,
the nucleic acid molecule will comprise DNA.
[0027] Nucleotide sequences included within the scope of this
embodiment of the invention are those hybridising to nucleic acid
encoding the CD81 protein under standard conditions. As used
herein, standard conditions includes both non-stringent standard
hybridisation conditions (6.times.ssc/50% formamide at room
temperature) with washing under conditions of low stringency
(2.times.SSC/50% formamide at room temperature, or 2.times.ssc,
42.degree. C.) or at standard conditions of higher stringency, e.g.
2.times.ssc, 65.degree. C. (where ssc=0.15M NaCl, 0.015M sodium
citrate, pH 7.2). Preferably the term standard conditions refers to
conditions of high stringency.
[0028] Preferably, such nucleic acid molecules will retain the
ability to hybridise specifically to nucleic acid encoding CD81 or
a fragment thereof and will include nucleic acid sequences with 40%
homology across the whole of the human CD81 gene sequence as
defined by the Pileup command of the GCG Program manual for the
Wisconsin Package (version 9, 1996). More preferably, the homology
is at least 65% across the whole of the gene sequence. Most
preferably, homology is greater than 70% across the whole of the
gene sequence.
[0029] Nucleic acid encoding the CD81 protein or functional
equivalent may be cloned under the control of an inducible
promoter, so allowing precise regulation of protein expression.
Suitable inducible systems will be well known to those of skill in
the art.
[0030] Suitable vectors for the expression of the CD81 protein or
functional equivalent may be selected from commercial sources or
constructed in order to suit a particular expression system. Such
vectors will contain appropriate regulatory sequences, such as
promoter sequences, terminator sequences, polyadenylation
sequences, enhancer sequences and marker genes. Vectors may be
plasmids, or viral-based. For further details see Molecular
Cloning: a laboratory manual (Sambrook et al., 1989). Many known
techniques and protocols for the manipulation of nucleic acids and
analysis of proteins are described in detail in "Short protocols in
molecular biology", second addition, Ausubel et al. (John Wiley
& Sons 1992).
[0031] Methods for the isolation and purification of recombinant
proteins will be well known to those of skill in the art and are
summarised, for example in Sambrook et al (1989). Particularly in
bacteria such as E. coli, the recombinant protein will form
inclusion bodies within the bacterial cell, thus facilitating its
preparation. If produced in inclusion bodies, the carrier protein
may need to be refolded to its natural conformation.
[0032] Additionally, in order to tailor precisely the exact
properties of the CD81 protein or functional equivalent thereof,
the skilled artisan will appreciate that changes may be made at the
nucleotide level from known CD81 sequences, by addition,
substitution, deletion or insertion of one or more nucleotides.
Site-directed mutagenesis (SDM) is the method of preference used to
generate mutated proteins according to the present invention. There
are many techniques of SDM now known to the person of skill in the
art, including oligonucleotide-directed mutagenesis using PCR as
set out, for example by Sambrook et al., (1989) or using
commercially available kits.
[0033] Suitable vectors can be chosen or constructed, containing
appropriate regulatory sequences, including promoter sequences,
terminator sequences, polyadenylation sequences, enhancer
sequences, marker genes and other sequences as appropriate. Vectors
may be plasmids, viral e.g. `phage, or phagemid, as appropriate.
For further details see, for example, Molecular Cloning: a
Laboratory Manual: 2nd edition, Sambrook et al., 1989, Cold Spring
Harbor Laboratory Press. Many known techniques and protocols for
manipulation of nucleic acid, for example in preparation of nucleic
acid constructs, mutagenesis, sequencing, introduction of DNA into
cells and gene expression, and analysis of proteins, are described
in detail in Short Protocols in Molecular Biology, Second Edition.
Ausubel et al. eds., John Wiley & Sons, 1992. The disclosures
of Sambrook et al. and Ausubel et al. are incorporated herein by
reference.
[0034] According to a further aspect of the invention, there is
provided a method for treating an infection of HCV comprising
administering to a patient a therapeutically effective amount of
CD81 protein, or a functional equivalent thereof effective to
reduce the infectivity of the virus.
[0035] Since the infection mechanism of HCV appears to depend, in
part, upon the availability of a cell surface receptor, making
available a soluble form of the CD81 protein, or a functional
equivalent thereof will act as an antagonist of binding of HCV to
the cellular receptor thus reducing or preventing the infection
process and thereby treating the disease.
[0036] A suitable soluble form of the CD81 protein, or a functional
equivalent thereof might comprise, for example, a truncated form of
the proteih from which one or more of the transmembrane domain or
domains TM1-TM4 have been removed either by a protein cleavage step
or, by design, in a chemical or recombinant DNA synthesis. The
preferred soluble form of the protein comprises the EC2 domain
(residues 113-201 as identified in FIG. 1). The EC1 domain may act
to increase the affinity or specificity of the protein for HCV.
[0037] Alternatively, a hybrid particle comprising at least one
particle-forming protein, such as hepatitis B surface antigen or a
particle-forming fragment thereof, in combination with the CD81
protein or functional equivalent thereof could be used as an
antagonist of binding of HCV to the cellular receptor.
[0038] According to a still further aspect of the invention, there
is provided a method for treating an infection of HCV comprising
administering to a patient a therapeutically effective amount of a
compound that specifically binds to CD81 protein, such as a
monoclonal antibody directed to CD81. The rationale behind this
therapeutic strategy is that the binding of the cell surface
receptor to another compound will prevent the binding of HCV to the
receptor, so preventing the infection process and thereby treating
the disease.
[0039] According to a further aspect of the invention, there is
provided a pharmaceutical composition comprising a CD81 protein or
functional equivalent thereof, optionally as a pharmaceutically
acceptable salt, in combination with a pharmaceutically acceptable
carrier. According to a still further aspect of the present
invention there is provided a pharmaceutical composition comprising
a compound that binds specifically to the CD81 protein, optionally
as a pharmaceutically acceptable salt, in combination with a
pharmaceutically acceptable carrier.
[0040] The pharmaceutical composition may be in any appropriate
form for administration including oral, parenteral, transdermal and
transcutaneous compositions. The composition may be administered
alone or in combination with other treatments, either
simultaneously or sequentially dependent upon the condition to be
treated.
[0041] A process is also provided for making the pharmaceutical
composition, in which a protein of the present invention is brought
into association with a pharmaceutically acceptable carrier.
[0042] According to a further aspect of the invention, there is
provided a CD81 protein or functional equivalent thereof, or a
compound that binds specifically to the CD81 protein for use as a
pharmaceutical.
[0043] According to a further aspect of the invention, there is
provided the use of a CD81 protein or functional equivalent thereof
or compound that binds specifically to the CD81 protein in the
manufacture of a medicament for the treatment of an HCV
infection.
[0044] The ability of a CD81 protein or functional equivalent
thereof to bind to HCV permits the use of the protein as a
diagnostic for HCV infection, for example in an ELISA (Enzyme
linked immunosorbent assay) or RIA (Radioimmunoassay).
[0045] A soluble form of the protein could, for example, be used in
an ELISA form of assay to measure neutralising antibodies in serum.
More preferably, antibodies to CD81 will be suitable for use in
this context, since these molecules will be anti-idiotypic
antibodies for HCV itself.
[0046] According to a further aspect of the invention, there is
provided an assay for HCV antibodies in a serum sample comprising
the step of allowing competitive binding between antibodies in the
sample and a known amount of an HCV protein for binding to a CD81
protein or functional equivalent thereof and measuring the amount
of the known HCV protein bound.
[0047] Preferably, the CD81 protein or functional equivalent
thereof is immobilised on a solid support and the HCV protein,
which may suitably be E2 HCV envelope protein, optionally
recombinant E2 protein is labelled. The label may be a radioactive
label, a peptide, an epitope, an enzyme, or any other bioactive
compound. Preferably the label comprises an enzyme.
[0048] In an assay of this form, competitive binding between
antibodies and the HCV protein for binding to the CD81 protein or
functional equivalent thereof results in the bound HCV protein
being a measure of antibodies in the serum sample, most
particularly, HCV neutralising antibodies in the serum sample.
[0049] A significant advantage of the assay is that direct
measurement is made of neutralising of binding antibodies (i.e.
those antibodies which interfere with binding of HCV envelope
protein to the cellular receptor). Such an assay, particularly in
the form of an ELISA test has considerable applications in the
clinical environment and in routine blood screening.
[0050] Also, since the assay measures neutralising of binding
antibody titre, the assay forms a ready measure of putative vaccine
efficacy, neutralising of binding antibody titre being correlated
with host protection.
[0051] In a further aspect of the invention, there is provided a
diagnostic kit comprising the CD81 protein or functional equivalent
thereof. Preferably the kit also contains at least one labelled HCV
protein, optionally enzyme labelled. The kit will also contain
other components necessary for the analysis of the presence of HCV
or anti-HCV antibodies in serum. Such components will be readily
apparent to those of skill in the art.
[0052] The CD81 protein or functional equivalent thereof may be
used to screen for chemical compounds mimicking the HCV surface
structure responsible for binding to the HCV receptor.
[0053] According to a further aspect of the invention, there is
provided a method for screening chemical compounds for ability to
bind to the region of HCV responsible for binding to a host cell,
comprising measuring the binding of a chemical compound to be
screened to a CD81 protein or functional equivalent thereof. The
host cell may be any mammalian cell, preferably a human host
cell.
[0054] This aspect of the invention encompasses the products of the
screening process whether alone, in the form of a pharmaceutically
acceptable salt, in combination with one or more other active
compounds and/or in combination with one or more pharmaceutically
acceptable carriers. Processes for making a pharmaceutical
composition are also provided in which a chemical compound
identified by the process of the invention is brought into
association with a pharmaceutically acceptable carrier.
[0055] The chemical compound may be an organic chemical and may
contain amino acids or amino acid analogues. Preferably however the
chemical compound is a peptide, polypeptide or a polypeptide which
has been chemically modified to alter its specific properties, such
as the affinity of binding to the CD81 protein or functional
equivalent thereof or its stability in vivo.
[0056] According to a further aspect of the invention, there is
provided a nucleic acid encoding CD81 protein or functional
equivalent thereof for use in diagnosis or therapy of HCV. The
nucleic acid may encode any part of the CD81 protein, or functional
equivalent thereof. Preferably, the nucleic acid encodes a portion
of CD81 that binds to HCV E2. According to a still further aspect
of the present invention, there is provided a nucleic acid encoding
a peptide or polypeptide compound that binds specifically to
CD81.
[0057] Changes to the nucleic acid may be made at the nucleotide
level by addition, substitution, deletion or insertion of one or
more nucleotides, which changes may or may not be reflected at the
amino acid level, dependent on the degeneracy of the genetic
code.
[0058] The nucleic acid may be included in a vector, optionally an
expression vector permitting expression of the nucleic acid in a
suitable host to produce CD81 protein or functional equivalent
thereof.
[0059] The identification of the DNA encoding the HCV receptor,
namely CD81, makes available the full power of molecular biology
for the molecular analysis of HCV and in particular its infectious
mechanism, offering for the first time the possibility of designing
methods of treating the virus. PCR methods may be used to identify
cells carrying the receptor and DNA molecules may be designed to
act as polymerase chain reaction (PCR) primers in this connection.
Although CD81 is widespread and is associated with normal human
function, the present invention includes antisense molecules
inhibiting CD81 production for use in the treatment of HCV and in
the manufacture of a medicament for the treatment of HCV
infection.
[0060] The identification of polymorphisms in the CD81 protein may
be found to be associated with susceptibility to HCV infection or
likely prognosis. Accordingly, the identification of the gene
encoding the HCV receptor allows the evaluation of polymorphisms
present throughout the human population.
[0061] According to a further aspect of the invention, there is
provided an antibody to CD81 protein or functional equivalent
thereof for use in the treatment of an HCV infection and in the
manufacture of a medicament for the treatment of an HCV infection.
The antibody is preferably a monoclonal antibody. Such an antibody
can be used to temporarily block the CD81 receptor preventing
infection from HCV, for example, immediately after an accidental
infection with HCV-infected blood.
[0062] At present, the only available animal model of HCV infection
is the chimpanzee, which is a protected species. Experiments on
such animals pose a number of difficulties which together result in
a very considerable expense (a one year experiment with one
chimpanzee can cost $70,000). Compared to this, a mouse model would
be far more acceptable. Unfortunately, as described below, the HCV
receptor, whilst ubiquitous in humans and found in chimpanzees, is
absent in other mammals. A transgenic mammal, for example a mouse,
carrying the HCV receptor on the cell surface, perhaps expressed in
greater or lesser amounts than normally found, would be of great
benefit to HCV research and the development of vaccines. Expression
of mutant CD81 proteins on the surface of cells would also be a
useful research tool.
[0063] According to a further aspect of the invention, there is
provided a transgenic non-human animal, suitably a mammal such as a
mouse, carrying a transgene encoding a CD81 protein or functional
equivalent thereof.
[0064] The transgenic animal of the invention may carry one or more
other transgenes to assist in maintaining an HCV infection.
[0065] There is also provided a process for producing a transgenic
animal comprising the step of introducing a DNA encoding a CD81
protein or functional equivalent thereof into the embryo of a
non-human mammal, preferably a mouse. Preferably the CD81 protein
or functional equivalent thereof is a human CD81 protein.
[0066] According to a further aspect of the present invention,
there is provided a CD81 protein or a functional equivalent thereof
for use as a protective immunogen in the control of HCV.
BRIEF DESCRIPTION OF THE DRAWINGS
[0067] FIG. 1 is a sequence alignment showing the homology between
human, chimpanzee, green monkey, hamster, rat and mouse CD81 gene
sequences.
[0068] FIG. 1A is a schematic description of primary, secondary and
tertiary rounds of screening.
[0069] FIG. 1B is a schematic description of the final round of
screening.
[0070] FIG. 2 is a FACS scan analysis of E2 bound cells.
[0071] FIG. 3 shows the dose-dependent inhibition of anti-CD81
binding to B cells by recombinant E2. The data are expressed as %
inhibition of mean fluorescence intensity.
[0072] FIG. 4 is an immunoblot showing the recognition of the
membrane protein fraction immunoprecipitated by anti-CD81 antibody.
Lane 2: recombinant E2 precipitated with chimpanzee antiserum to
E2; lane 3, recombinant E2 precipitated with chimpanzee pre-immune
serum lane 4: 20 .mu.g of anti-CD81 mAb (clone JS81 Pharmingen)
precipitated with goat anti-mouse IgG, lane 5: control, (20 .mu.g
of an irrelevant monoclonal antibody, anti-human CD9, ATCC)
precipitated with goat anti-mouse IgG linked to protein A
sepharose. Lane 1: positive control, membrane protein
preparation.
[0073] FIG. 5 shows the nucleotide and deduced amino acid sequences
of the EC2 fragment cloned in pThio-His C and the upstream plasmid
sequence coding for the carboxyl terminus of thioredoxin and for
the enterokinase cleavage site.
[0074] FIG. 6 shows the appearance of a protein band of the
expected molecular mass for thioredoxin-EC2 in the extract from the
induced sample.
[0075] FIG. 7 is a Coomassie Blue stained gel showing the
purification of thioredoxin-EC2.
[0076] FIG. 8 represents the nucleotide and deduced amino acid
sequence of the EC2-His.sub.6 fragment cloned into pGEX-KG as well
as the upstream plasmid sequence coding for the carboxyl terminus
of GST, the thrombin cleavage site and a small glycine spacer.
[0077] FIG. 9 represents an SDS-PAGE of total proteins of the TOP10
E. coli clone which express GST-EC2-(His).sub.6.
[0078] FIG. 10 is a Coomassie-stained SDS-PAGE showing thrombin
cleavage of GST-EC2-(His).sub.6 after purification of the protein
on a glutathione sepharose column.
[0079] FIG. 11 shows the dose-dependent inhibition of E2 binding to
hepatocarcinoma cells by recombinant molecule expressing the major
extracellular loop (EC2) of human CD81.
[0080] FIG. 12 shows binding of HCV to CD81.
[0081] FIGS. 13-17 show the construction of nucleic acid vectors
for use in the generation of mire transgenic for the human CD81
gene.
DETAILED DESCRIPTION OF THE INVENTION
Example 1
Recombinant E2, Cell Lines, Vector DNA, and Antibodies Used in the
Present Study
[0082] The recombinant E2 used in this screening was produced in
CHO cells (E2-CHO) (WO 97/09349). E2-CHO binds to the human T cell
lymphoma cell line Molt-4. A sublime of Molt-4 (termed A2A6), was
identified by expanding individual Molt-4 cell colonies and testing
for the amount of E2-CHO that bound to the cell surface. The A2A6
subline was found to bind more E2-CHO molecule on its surface than
its parental line and was therefore chosen for the source of RNA,
expecting that this subline may have a higher representation of the
transcript encoding the E2 binding molecule. These cells were
chosen using an assay whereby human B and T lymphoma cells and
hepatocarcinoma cell lines were incubated with recombinant E2
expressed in mammalian cells (CHO) as described by D. Rosa et al.,
Proc. Natl. Acad. Sci. USA 93, 1759 (1996) and stained with
biotin-labelled anti-E2 antibodies as described by Rosa et al,
(1996). Cells with the highest E2 binding ability were sorted using
a FacsVantage (Becton Dickinson) and subcloned by limiting
dilution. Growing clones were screened for E2 binding at the Facs
and clones with the highest Mean Fluorescence Intensity were
further expanded.
[0083] WOP is a NIH3T3-derived cell which expresses polyoma T
antigen (L. Dailey and C. Basilico, J. Virol. 54, 739 (1985). In
this cell line, plasmids containing the polyoma replication origin
can be amplified episomally. Recombinant DNA constructed with pCDM8
(Invitrogen) can be recovered from selected transfectants, which
contains the polyoma replication origin and is designed for the
manipulation of expression libraries in eukaryotic cells.
[0084] A mouse monoclonal anti-E2 antibody (291A2) was used for
detection of E2-CHO bound on the cell surface of transfectants.
This antibody was obtained as follows: BALB-c mice were immunised
three times with recombinant E2 (10 .mu.g) in complete Freund's
adjuvant. Cell fusions between spleen cells and non-producing
myeloma cells were made according to standard techniques. The
supernatant from fusions was then screened for binding to E2 bound
to Molt-4 cells, so as to identify monoclonal antibodies that bound
to an exposed site on the E2 molecule. The most suitable antibody
identified in this fashion was termed 291A2.
Example 2
Construction of cDNA Library
[0085] Total RNA was extracted from the A2A6 cell line according to
the method described by Chomczinsky and Sacchi (Chomczinsky, P. and
Sacchi, N. (1987) Anal. Biochem. 162: 156-159). Poly(A)+ was
enriched twice using oligo(dT) cellulose. Starting from 2 .mu.g of
this RNA as a template, the double strand complementary DNA was
synthesized using a Superscript II cDNA synthesis kit (Life
Technologies) in the presence of oligo(dT) (100 ng) and random
hexamer primers (100 ng). The cDNA was blunt-ended with T4 DNA
polymerase, and was ligated with a BstXI linker, which allows the
insertion of the fragment into the same restriction site in the
polylinker region of the expression vector pCDM8. The
linker-ligated cDNA was phenol-extracted and ethanol precipitated
using ammonium sulphate to remove free mononucleotides, followed by
Sephacryl 500 chromatography (Lifetechnologies) to size-fractionate
the cDNA. The purified cDNA fragment over 500 bp were pooled and
ligated with BstXI-digested pCDM8 at a molecular ratio of
approximately 1:1. This final ligation reaction was used from
transformation of E. coli MC1061/P3 by electroporation using
Gene-Pulser (BIORAD). A total of 2.times.10.sup.6 cfu was amplified
and pooled in liquid bacterial culture as a cDNA library.
Example 3
Library Screening
[0086] The screening procedure was based largely on the method
described by Campbell et al. (Campbell, I. G., Jones, T. A.,
Foulkes. W. D. and Trowsdale, J. Cancer Res. 51: 5329-5338, 1991).
Enrichment was carried out using magnetic beads (the first to the
third round) (FIG. 1A) and panning techniques (the fourth round).
(FIG. 1B).
3.1 The First Round of Screening
[0087] A total of 375 .mu.g of amplified DNA, which represents
2.times.10.sup.6 of independent cDNA clones. was prepared. In each
transfection. 25 .mu.g of DNA was mixed with 10.sup.7 WOP cells
using the Gene-Pulser electroporator (BIORAD) under the conditions
of 300V/5000. Fifteen sets of transfections were performed. After
transfection, cells were incubated at 37.degree. C. for 2 days and
then the cells were detached by trypsinization and washed with PBS
supplemented with 5% FCS and 0.5 mM EDTA twice by centrifugation at
360.times.g for 10 min at 4.degree. C. The cell pellet was
resuspended in PBS supplemented with 5% FCS and 0.5 mM EDTA
(10.sup.7 cells/ml) and then E2-CHO was added to the cell
suspension at a concentration of 10 m/ml. The cells were incubated
on ice for 60 min. After washing twice with PBS supplemented with
5% FCS and 0.5 mM EDTA, the cell suspension was incubated with
291A2 antibody on ice for 30 min. After washing twice with PBS
supplemented with 5% FCS and 0.5 mM EDTA, 10 .mu.l of Dynabeads
(DYNAL) coupled with goat anti-mouse IG was added to the cell
suspension. The mixture was gently agitated using a Coulter Mixer
(Coulter) for 60 min at 4.degree. C. Bound cells were separated
using Magnetic Particle Concentrator (DYNAL) from non-binders,
according to the manufacturer's instructions, thus enriching
E2-binding transfectants. Plasmid DNA was recovered from the bound
transfected cells using the protocol described by Campbell et al.
(Campbell, I. G., Jones, T. A., Foulkes, W. D. and Trowsdale. J.
Cancer Res. 51: 5329-5338, 1991). E. coli MC1061/P3 was transformed
with this plasmid by electroporation. This DNA pool is referred to
as the first enriched pool (1.degree. EP).
3.2 The Second Round of Screening
[0088] A total of 150 .mu.g of amplified DNA derived from
1.degree.EP was prepared and 6 sets of the transfection were
performed and transfectants were enriched using the same condition
as in the first screening. This DNA pool is referred to as
2.degree. EP.
3.3 The Third Round of Screening
[0089] A total of 25 .mu.g of amplified DNA derived from 2.degree.
EP was prepared and one set of the transfection was performed.
Transfectants were enriched using the same condition as in the
first screening. During this separation step, transfectants formed
aggregates, which might be caused by expression of irrelevant
adhesion molecules. This could decrease the efficiency of
enrichment because these aggregates contained magnetic beads
non-specifically. To circumvent this potential problem,
transfectants after the second separation by Magnetic Particle
Concentrator were diluted and plated on Terasaki plates.
Approximately 100 of single cells identified under microscope were
pooled and plasmid DNA was extracted from them. The DNA pool
prepared from this step is referred to as 3.degree. EP.
3.4 The Fourth Round of Screening
[0090] 291A1 monoclonal antibody was incubated in a Petri dish (90
mm) at a concentration of 10 .mu.g/ml overnight at 4.degree. C.
[0091] A total of 25 .mu.g of amplified DNA derived from 3.degree.
EP was prepared and one set of transfections was performed. The
transfected cells were incubated with E2-CHO as described above,
and placed onto the 291A2-coated plates for 60 min at 4.degree. C.
After rinsing with a large excess of PBS supplemented with 5% FCS
and 0.5 mM EDTA twice, the bound cells were directly treated with
the lysing solution and plasmids were extracted as described as
before. This DNA pool is referred to as 4.degree. EP.
3.4 Identification of cDNA Encoding a Molecule Binding to the
Recombinant E2
[0092] DNA was isolated from single colonies derived from 4.degree.
EP. A single transfection was performed for each plasmid
preparation using the same conditions as used for the previous
screening steps, E2-binding of the transformants was detected using
a phycoerythrin-conjugated monoclonal Fab fragment of goat
anti-mouse Ig instead of the antibody-coupled Dynabeads.
Transfectants of 3.degree. EP and 4.degree. EP were also analyzed
in the same way. The E2-bound cells were detected on FACScan
(Becton Dickinson) and analyzed with LYSIS II program (Becton
Dickinson) (FIG. 2). E2-CHO binds increasingly as the purification
step advances. A single clone P3 showed strong E2-binding.
Example 4
DNA Sequencing Determination and Analysis
[0093] P3 contains a insert of approximately 1 kb. The DNA sequence
of the insert of the cDNA clone which confers E2-binding to WOP
upon transfection was determined by an automated sequencing system
using the T7 primer, whose sequence is located adjacent the cloning
site of pCDM8. The sequence was screened through the GenBank
databases using the GCG programs on a UNIX computer. This analysis
revealed that the 5' part of P3 insert is identical to human CD81
(TAPA-1). Restriction analysis of P3 using three enzymes (BstXI),
HincII and NcoI) also agreed with the restriction map of human CD81
cDNA.
Example 5
Binding of CD81 to Recombinant E2
[0094] Anti-CD81 antibodies were used to assess the interaction
between E2 and CD81. EBV-B cells were incubated with increasing
concentrations of recombinant E2 for 1 hour at 4.degree. C. and
then stained with an anti-CD81 monoclonal antibody (clone JS-81,
Pharmingen). As shown in FIG. 3, recombinant E2 was found to
competitively inhibit the binding of anti-CD81 antibodies to EBV
transformed B-cell lines (EBV-B cells). The data are expressed as %
inhibition of mean fluorescence intensity (Rosa et al., 1996).
[0095] In addition, E2 reacts in Western blot with anti-CD81
precipitated material (FIG. 4). This Figure shows E2 recognition of
membrane protein fraction immunoprecipitated by anti-CD81 antibody.
Approximately 300 .mu.g of membrane protein extract prepared from
the A2A6 cell line were solubilised in 8 mM CHAPS in PBS pH 7.4,
incubated with 10 .mu.g recombinant E2 (lanes 2 and 3), with 20
.mu.g of anti-CD81 mAb (clone JS81; Pharmingen) (lane 4), or as
control, with 20 .mu.g of an irrelevant monoclonal antibody
(anti-human CD9, ATCC) (lane 5) for 2 hours at 4.degree. C., and
finally precipitated with chimpanzee antiserum to E2 (lane 2),
chimpanzee pre-immune serum (lane 3), or goat anti-mouse IgG (lanes
4 and 5) bound to protein A sepharose (CL-4B, Pharmacia). The
pellet was dissolved in Laemmli buffer and subjected to SDS-PAGE
under non-reducing conditions. After electroblotting, the PVDF
membrane (Millipore) was incubated overnight with 1 .mu.g/ml of
recombinant E2 at room temperature, and for 2 hours with 291A2
anti-E2 monoclonal antibody. E2 binding to immunoprecipitated
proteins was detected with an anti-mouse IgG peroxidase-conjugated
polyclonal aniibody (Amersham). As a positive control membrane
proteins also were loaded on the gels (lane 1). The mobility of
molecular weight standards is indicated on the left in
kilodaltons.
[0096] CD81 is also expressed on fresh lymphocytes and hepatocytes
as demonstrated by immunohistochemical staining with
biotin-labelled-E2 or anti-CD81 (data not shown).
[0097] To assess whether CD81 could mediate the internalisation of
ligands. we exploited the fact that CD81 forms a complex with CD19
and CD21 on the surface of B lymphocytes (D. T. Fearon and R. H.
Carter, 1995, Annu. Rev. Immunol. 13, 127). B cells were incubated
with E2 at 37.degree. C. for different times, after which CD19 or
CD21 levels on the cell surface were measured by
immunofluorescence. Incubation of B cells with E2 resulted in
down-regulation of both CD19 and CD21 (data not shown). It thus
seems as if CD81 is able to mediate the internalisation of both
these ligands.
Example 6
The Major Extracellular Loop of CD81 Binds Recombinant E2 and Viral
Particles
[0098] To map the CD81 domain that binds E2 protein our efforts
were focused on the EC2 hydrophilic extracellular loop of the
protein. This fragment was expressed in E. coli as a
Thioredoxin-EC2 fusion protein that has an enterokinase site
between thioredoxin and EC2, and as a GST-EC2 fusion protein which
has a thrombin site between GST and EC2 and a hexa-histidine tag
added to the carboxyl-terminus of the protein. We show that both
proteins are expressed and are able to bind HCV E2. In competition
experiments we also show that the purified fusion proteins and the
EC2-His fragment excised from GST-thrombin-EC2-(His).sub.6 are able
to inhibit the binding of E2 on the surface of CD81 expressing
cells.
6.1 Cloning of EC2 in pThio-His.
[0099] FIG. 5 shows the nucleotide and the deduced amino acid
sequences of the EC2 fragment cloned in pThio-His C and the
upstream plasmid sequence coding for the carboxyl terminus of
thioredoxin and for the enterokinase cleavage site. As shown, EC2
is fused in frame with thioredoxin through the enterokinase site.
which can be exploited to remove thioredoxin from the fusion
protein.
[0100] The fragment coding for EC2 was PCR-amplified from the
plasmid pCDM8/P3 using the following oligodeoxynucleotides:
TABLE-US-00001 Forward BL EC2
5'GGCGGGGGTGGATCCGGGGGTGGAGGCTCGAGCTTTGTCAACAAGGAC C3 XhoI Phe Val
Asn Lys Asp Reverse BL EC2 5'CCCCAAGCTT TCA CAG CTT CCC GGA GAA GAG
GTC ATC G3' HindIII Stop Leu Lys Gly Ser Phe Leu Asp Asp
[0101] Using standard cloning techniques (Sambrook et al., 1989)
the PCR product was double-digested with XhoI and HindIII, ligated
to pThio-His C (Invitrogen) digested with the same restriction
enzymes, and transformed into Top 10 E. coli cells. After selection
of the transformants by restriction enzyme analysis and DNA
sequencing of the plasmids, a correct construct coding for the
expected thioredoxinenterokinase site-EC2 fusion protein was
identified. Glycerol batches of selected clones were stored to
-80.degree. C.
[0102] Total protein extracts of the thioredoxin-EC2 expressing
clone before and after IPTG addition, were subjected to SDS-PAGE to
analyse protein expression. FIG. 6 clearly shows the appearance of
a protein band of the expected molecular mass (23.4 kDa) in the
extract from the induced sample. The figure also shows the
reactivity of the fusion protein with E2. The TOP10 E. coli clone
containing the pThio-hisC-EC2 plasmid and a TOP10 clone containing
the pThio-His C plasmid devoid of insert were induced, soluble
protein extracts were prepared from both clones and subjected to
Far Western Blot with E2 protein. For this blot, protein samples
were brought to 1.times. loading sample buffer (LSB) (5% w/v SDS,
10% v/v glycerol, 62.5 mM Tris-HCl, 0.05% Bromophenol Blue) using a
3.times.LSB solution. The samples were run onto a 15%
polyacrylamide gel and transferred to a PVDF membrane (Immobilon-P,
Millipore). The membrane was incubated for 30 min in blocking
solution (PBS, 10% w/v non-fat dried milk, 0.05% v/v Tween 20).
Following an incubation of 15 hours at 4.degree. C. with blocking
solution containing 1 .mu.g/ml of CHO-E2, the membranes were
incubated for 2 hours with the 291A2 anti-E2 monoclonal antibody
diluted 1:250, and for 1 hour with a peroxidated goat antimouse Ig
antibody (Sigma) diluted 1:2000. Three washing steps between all
incubation steps were performed using blocking solution, which was
also used to dilute the antibodies. After a final wash with PBS the
membranes were incubated for 1 min with luminol (ECL, Amersham) and
exposed on Hyper-film (Amersham).
[0103] As can be seen from these Figures, a band corresponding to
the molecular weight of Thioredoxin-EC2 was visible in the lane
where the soluble proteins from the pThio-His C-EC2 were loaded.
Such a band was absent in the lane where the soluble proteins of
the pThio-His C clone were loaded.
6.2 Purification of Thioredoxin-EC2
[0104] For the purification of thioredoxin-EC2 the following
procedure was developed:
[0105] 1) osmotic shock of the cells, 2) protein precipitation with
30% saturation ammonium sulphate, and 3) IMAC. After osmotic shock
about 50% of the fusion protein was released from the cells
together with contaminant proteins. The ammonium sulphate
precipitation resulted in a pellet which contained thioredoxin-EC2
devoid of the bulk of contaminant proteins. IMAC of the resuspended
precipitate resulted in a fusion protein which was about 85% pure
as assessed by SDS-PAGE. With this procedure we purified 5 mg
thioredoxin-EC2 from a litre of culture. This procedure is set out
in detail below.
[0106] The E. coli clone expressing Thioredoxin-EC2 was inoculated
in 500 ml LB medium containing 100 .mu.g/ml ampicillin. At
OD.sub.600=0.5, 0.5 mM IPTG was added to the culture and growth was
continued at 37.degree. C. for additional 3.5 hours. The culture
was then centrifuged at 4000.times.g for 10 mM at 4.degree. C., the
cell pellet was resuspended with 50 ml ice cold hypertonic solution
(20 mM Tris-HCl, 2.5 mM EDTA, 20% sucrose, pH 8) and left on ice
for 10 min. The resuspended cells were centrifuged again as above
and the pellet was resuspended in hypotonic buffer (20 mM Tris-HCl,
2.5 mM EDTA, pH 8) to osmotically shock the cells. After 20 min at
0.degree. C. the suspension was centrifuged at 12.000.times.g for
10 min at 4.degree. C., the supernatant was brought to 30%
NH.sub.2(SO.sub.4).sub.2 using a room temperature saturated
solution of the salt. The suspension was incubated overnight at
4.degree. C. and then centrifuged at 10.000.times.g for 10 min. The
pellet was resuspended using 15 ml of 20 mM Phosphate buffer, 500
mM NaCl, pH 6, clarified by centrifugation, and loaded on a 2 ml
column of Nickel activated Chelating Sepharose Fast Flow
(Pharmacia) equilibrated in the same buffer.
[0107] After adsorption, the column was washed with 10 ml of the
equilibrium buffer (flow rate 0.5 ml/min), and then the
Thioredoxin-EC2 was eluted using a 30 ml gradient 0-50 mM Imidazole
in 20 mM Phosphate buffer, 500 mM NaCl, pH 6 followed by an
isocratic elution with 10 ml of 400 mM imidazole. 2.4 ml fractions
were collected. The fractions containing the recombinant protein
were pooled, dialysed against PBS, and stored to -20.degree. C.
Proteins were analysed by means of SDS-PAGE and protein content was
assayed by the Bradford method using BSA as a protein standard.
[0108] Purified Thioredoxin-EC2 is shown in FIG. 7.
6.3 Cloning of EC2-(His).sub.6 in pGEX-KG
[0109] FIG. 8 represents the nucleotide and deduced amino acid
sequence of the EC2-(His).sub.6 fragment cloned in pGEX-KG as well
as the upstream plasmid sequence coding for the carboxyl terminus
of GST, the thrombin cleavage site, and a small glycine spacer. As
shown, EC2 is fused in frame with GST through the thrombin site,
which can be exploited to remove GST from the fusion protein. The
glycine-rich spacer, located between thrombin site and EC2,
facilitates the cleavage of the fusion protein by thrombin (Guan,
K. L. and Dixon, J. E. (1991) Anal. Biochem. 192, 262-267).
[0110] The fragment coding for EC2 was PCR-amplified from the
plasmid pCDM8/P3 using the following oligodeoxynucleotides:
TABLE-US-00002 EC2 Forward EC2 5' CAAAAGGAATTCTA TTT GTC AAC AAG
GAC CAG ATC GCC AAG3' EcoRI Phe Val Asn Lys Asp Gln Ile Ala Lys
Reverse BLH His tag EC2 5'CCCCAAGCTTTCAATGATG ATG ATG ATG ATG CAG
CTT CCC GGA GAAG3' HindIII Stop His His His His His His Leu Lys Gly
Ser Phe
[0111] The PCR product was digested with XhoI and HindIII, ligated
to pGEX-KG (Guan, K. L., and Dixon, J. E. (1991) Anal. Biochem.
192, 262-267) digested with the same restriction enzymes, and
transformed into TOP10 E. coli cells. After selection of the
transformants by restriction enzyme analysis and nucleotide
sequencing of the plasmids, a plasmid having the expected size of
the insert was found to have also the correct EC2-(His).sub.6
sequence in frame with the upstream thrombin and GST coding
sequence. The plasmid prepared from the selected TOP10 clone was
then transformed into BL21 cells. Glycerol batches of selected
clones were stored to -80.degree. C.
[0112] FIG. 9 represents an SDS-PAGE of total proteins of the TOP10
E. coli clone which expresses GST-EC2-(His).sub.6. This analysis
clearly shows that in the extract of the induced sample a protein
band with the expected molecular mass (39 kDa) was present. The
corresponding Far Western Blot clearly shows the E2 specifically
reacts with the fusion protein.
6.4 Purification of GST-EC2-(His).sub.6
[0113] The GST-EC2-(His).sub.6 fusion protein was purified on a
glutathione sepharose column and digested with thrombin (FIG. 10).
After digestion, the EC2-(His).sub.6 moiety was further purified by
two additional chromatographic steps consisting of a glutathione
sepharose column to remove the GST fragment and IMAC
chromatography. This procedure is detailed below.
[0114] A single colony of an E. coli clone expressing the GST-EC2
fusion protein was inoculated in 10 ml LB, 100 .mu.g/ml Amp and
cells were grown overnight at 37.degree. C. The culture was then
inoculated in 500 ml of medium and when OD.sub.600=0.5 was reached
0.5 mM IPTG was added. After 3.5 hours the cells were harvested by
centrifugation, resuspended with 9 ml PBS and disrupted with two
passages at 18.000 psi using a French Press (SLM Aminco). The
lysate was centrifuged at 30.000.times.g and the supernatant was
loaded on a column of 1 ml of Glutathione Sepharose 413 (Pharmacia)
equilibrated in PBS.
[0115] The column was washed with 10 ml PBS, and eluted with 4 ml
of 50 mM Tris-HCl, 10 mM reduced glutathione, pH 8. The eluted
proteins were dialysed against PBS and stored to -20.degree. C.
6.5 Digestion of GST-EC2-(His).sub.6 with Thrombin and Purification
of EC2-(His).sub.6
[0116] 9.6 mg of protein recovered from the glutathione sepharose
column were digested with 22 units of thrombin (Pharmacia) for 8
hours at room temperature, then the enzyme was inactivated using
0.13 mM PMSF (Sigma). The reaction mixture was then dialysed
against PBS and loaded into 0.5 ml of GST-sepharose column
equilibrated in PBS. The column was washed with 1 ml of PBS. The
flow-through and the wash were pooled and loaded into 0.250 ml of
Nickel-activated chelating sepharose column. EC2-(His).sub.6 was
recovered from the column eluting with 1 ml of 20 mM phosphate
buffer, 500 mM NaCl, 400 mM imidazole, pH 7.8. A dialysis was then
performed against PBS.
Example 7
Binding of CD81 Fragment to Virus
[0117] The proteins containing the human, but not the mouse EC2
loop of CD81, bound to E2 in western blot (data not shown) and
inhibited binding of E2 to human cells (FIG. 11).
[0118] The chimeric proteins were coated on polystyrene beads and
incubated with an infectious plasma containing known amounts of
viral RNA molecules. After washing, the bead-associated virus was
assessed by quantitative RT-PCR for the amount of bound HCV RNA.
This experiment was performed as set out below.
[0119] Polystyrene beads (1/4 inch diameter) (Pierce) were coated
overnight with purified EC2 recombinant protein in citrate buffer
pH4 at room temperature. After saturation for one hour with 2% BSA
in 50 mM TrisC1 pH 8, 1 mM EDTA. 100 mM NaCl (TEN) buffer, each
bead was incubated at 37.degree. C. for 2 hours in 200 .mu.l
TEN-diluted infectious chimp plasma containing 5.times.10.sup.5 HCV
RNA molecules.
[0120] For inhibition experiments, the EC2-coated polystyrene beads
were incubated with 10 .mu.g/ml of purified monoclonal antibodies
for one hour at room temperature before incubation with the virus.
Each bead was washed 5 times with 15 ml TEN buffer in an automated
washer (Abbot) and viral RNA was extracted using the Viral
Extraction Kit (Qiagen). RNA (8 ml) was reverse-transcribed at
42.degree. C. for 90 minutes in 20 ml Buffer A 1.5 (Perkin Elmer
Taq Man) containing 100 pmol of the HCV antisense primer
CGGTTCCGCAGACCACTATG, 40 U. RNAsin (Promega), 5 nmol dNTPs, 110
nmol MgCl.sub.2, 10U M-MuRT (Boheringer). cDNA (20 ml) was
amplified using a Perkin-Elmer ABI 7700 Sequence Detection System
(45 cycles) in 50 ml Buffer A containing 100 pmol of the HCV sense
primer TCTTCACGCAGAAAGCGTCTA, 5 pmol of the fluorescent detection
probe 5'(FAM)TGAGTGTCGTGCAGCCTCCAGGA(TAMRA) (kindly provided by
David Slade, Pharmacia and Upjohn), 15 nmol dNTPs, MgCl.sub.2 and
1.25U Taq Gold (Perkin-Elmer, Foster City, Calif.). All reactions
were quantified using HCV (genotype 1a) infected plasma (bDNA titer
of 30 mEq/ml) to generate a standard curve. Sequence Detector
Software from Perkin-Elmer has been previously described (U. E.
Gibson, C. A. Heid and P. M. Williams, Genome Res. 6, 995
(1996)).
[0121] As shown in FIG. 12, the molecules containing the human CD81
extracellular loop bound HCV in a concentration-dependent fashion,
and pre-incubation of the chimeric proteins with anti-CD81
antibodies inhibited virus binding. Furthermore, serum from
chimpanzees which were protected from homologous challenge by
vaccination with recombinant E1/E2 envelope heterodimer (Q.-L. Choo
et al. Proc. Natl. Acad. Sci. USA 91, 1294 (1994)) completely
inhibited HCV binding to bead-coated-CD81, while serum from
vaccinated and non-protected animals did not (data not shown).
[0122] These data demonstrate that expression of human CD81, and in
particular its major extracellular loop are sufficient for binding
not only E2 but also HCV particles. Given the wide distribution of
CD81 (S. Levy, S. C. Todd and H. T. Maecker, Annu. Rev. Immunol.
16, 89 (1998), these results imply that HCV binds and may be
internalised by a variety of cells other than hepatocytes. Indeed,
HCV RNA has been found in T and B lymphocytes and monocytes (K.
Blight, R. R. Lesniewski, J. T. LaBrooy and E. J. Gowans,
Hepatology 20, 553 (1994); P. Bouffard et al., J. Infect. Dis. 166,
1276 (1992); Zignego et al., J. Hepatol. 15, 382 (1992)). Whether
virus binding is followed by entry and infection in all cell types
is not clear because of the lack of an efficient HCV culture system
in vitro. It may well be that CD81 is an HCV attachment receptor
and that additional factors are required for viral fusion or
infectivity.
[0123] CD81 participates in different molecular complexes on
different cell types, a fact that may influence its capacity to
serve as a receptor for HCV infection or to deliver regulatory
signals to target cells. For instance, it associates with integrins
on epithelial and hematopoietic cells (F. Berditchevski, M. Zutter
and M. E. Hemler, Mol. Biol. Cell 7, 193 (1996); B. A. Mannion, F.
Berditchevski, S.-K. Kraeft, L. B. Chen and M. E. Hemler, J.
Immunol. 157, 2039 (1996)), whereas it is part of a signaling
complex containing CD21, CD19 and Leu 13 on B cells (L. E.
Bradbury, G. S. Kansas, S. Levy, R. L. Evans and T. F. Tedder, J.
Immunol. 149, 2841 (1991)). This complex has been shown to
facilitate antigen specific stimulation by lowering the activation
threshold of B cells (D. T. Fearon and R. H. Carter, Annu. Rev.
Immunol. 13, 127 (1995)). It is worth noting that HCV appears to
use a molecule that is part of the same complex containing the EBV
receptor (CD21) (N. R. Cooper, M. D. Moore and G. R. Nemerow, Annu.
Rev. Immunol. 6, 85 (1988)), and the ability of EBV to activate and
immortalise B lymphocytes is well documented.
Example 8
Construction of Transgenes
[0124] The following constructs were designed and made in order to
generate mice transgenic for human CD81.
1. Addition of Splicing and Polyadenylation Signals of Rabbit
Beta-Globin Gene to the Human CD81 cDNA Fragment.
[0125] The human CD81 cDNA fragment from the pCDM8/P3 clone was
transferred into a pBluescript KS II(+) vector (Stratagene) and was
then inserted into the pSPP plasmid (derived from BMGSC expression
vector, a kind gift from Dr. Karasuyama, Basel Institute for
Immunology) between two fragments, one containing the second intron
and the other containing the polyadenylation signal of the rabbit
beta-globin gene (position 902-1547 and 1543-2081, respectively,
GenBank accession No. M12603) (pSR1P in FIG. 11). The resulting
recombinant DNA fragment was excised from the pBluescript KSII(+)
vector (Stratagene) by SalI (at 5' end) and BamHI (at 3' end).
2. Creation of a Transgene for Ubiquitous Expression of Human
CD81
[0126] The SalI-BamHI fragment of the pSR1P insert was inserted
into the compatible restriction sites of pCAGmcs, a modified
plasmid of pCAGGS (a kind gift from Dr. J. Miyazaki at Osaka
University, Japan, under restricted permission), which contains
chicken beta-actin promoter and human cytomegalovirus enhancer
(Niwa, H. et al., Gene 108, p 193 (1991). (pCAGSR1Pp in FIG. 12).
The 3.8 kb EcoRI-BamHI fragment was submitted to zygote
injection.
3. Creation of a Transgene for Liver-Specific Expression of Human
CD81
[0127] The SalI site of pSR1P was converted to a BamHI site by
BamHI linker ligation after blunt-end formation with Klenow
fragment of E. coli DNA polymerase I. This BamHI fragment was
inserted into the BamHI site of the ALB e/p plasmid, carrying the
mouse albumin promoter and enhancer (Pinkert, C. A. et al., Genes
Dev. 1, p 268 (1987) (received from Dr. F. Chisari, Scripps
Research Institute. La Jolla, San Diego). (pAIbSR1P in FIG. 13) The
4.5 kb NotI-EcoRV fragment was submitted to zygote injection.
4. Creation of a Transgene for B Lymphocyte-Specific Expression of
Human CD81
[0128] 700 by BamHI fragment of the mouse immunoglobulin heavy
chain enhancer (a kind gift from Dr. A. Kudo, Basel Institute for
Immunology) and 2.3 kb XbaI-SacI fragment of the mouse kappa light
chain promoter was subcloned into a pBluescript KSII(+) vector. The
Sad site was converted to a HindIII site by HindIII linker ligation
described above. The BamHI site of pCAGSR1P was first converted to
Nod site. Then the promoter region of the modified pCAGSR1P
construct was removed by EcoRI-HindIII restriction digestion and
replaced with the immunoglobulin promoter-enhancer fragment.
(pEhKpSRIP in FIG. 15) The 5.2 kb EcoRI-BamHI fragment was
submitted to zygote injection.
[0129] Together, our data indicate that CD81 is an attachment
receptor for HCV and may provide new insight into the mechanisms of
HCV infection pathogenesis. Since CD81 associates with an
activation complex on the surface of B cells, the present finding
may explain the pathogenesis of HCV associated cryoglobulinemia,
even if there is no viral replication in B cells. Moreover, the
identification of the interaction between HCV and CD81 may help in
mapping conserved neutralising epitopes on the virus envelope which
should be important to develop effective vaccines and to provide a
decoy receptor for viral neutralisation.
Sequence CWU 1
1
21149DNAArtificial SequenceDescription of Artificial Sequence
oligodeoxynucleotides 1ggcgggggtg gatccggggg tggaggctcg agctttgtca
acaaggacc 4925PRTArtificial SequenceDescription of Artificial
Sequence peptide 2Phe Val Asn Lys Asp1 5338DNAArtificial
SequenceDescription of Artificial Sequence oligodeoxynucleotides
3ccccaagctt tcacagcttc ccggagaaga ggtcatcg 3848PRTArtificial
SequenceDescription of Artificial Sequence peptide 4Leu Lys Gly Ser
Phe Leu Asp Asp1 5541DNAArtificial SequenceDescription of
Artificial Sequence oligodeoxynucleotides 5caaaaggaat tctatttgtc
aacaaggacc agatcgccaa g 4169PRTArtificial SequenceDescription of
Artificial Sequence peptide 6Phe Val Asn Lys Asp Gln Ile Ala Lys1
5747DNAArtificial SequenceDescription of Artificial Sequence
oligodeoxynucleotides 7ccccaagctt tcaatgatga tgatgatgat gcagcttccc
ggagaag 47811PRTArtificial SequenceDescription of Artificial
Sequence peptide 8His His His His His His Leu Lys Gly Ser Phe1 5
10920DNAArtificial SequenceDescription of Artificial Sequence
oligodeoxynucleotides 9cggttccgca gaccactatg 201021DNAArtificial
SequenceDescription of Artificial Sequence oligodeoxynucleotides
10tcttcacgca gaaagcgtct a 211123DNAArtificial SequenceDescription
of Artificial Sequence oligodeoxynucleotide 11tgagtgtcgt gcagcctcca
gga 2312357DNAArtificial SequenceDescription of Artificial Sequence
Human EC2 fragment cloned into pThio-His C 12gagttcctcg acgctaacct
ggccggctct ggatccggtg atgacgatga caaggtacct 60ggcatgctga gctcgagctt
tgtcaacaag gaccagatcg ccaaggatgt gaagcagttc 120tatgaccagg
ccctacagca ggccgtggtg gatgatgacg ccaacaacgc caaggctgtg
180gtgaagacct tccacgagac gcttgactgc tgtggctcca gcacactgac
tgctttgacc 240acctcagtgc tcaagaacaa tttgtgtccc tcgggcagca
acatcatcag caacctcttc 300aaggaggact gccaccagaa gatcgatgac
ctcttctccg ggaagctgtg aaagctt 35713116PRTArtificial
SequenceDescription of Artificial Sequence Deduced amino acid
sequence of EC2 fragment 13Glu Phe Leu Asp Ala Asn Leu Ala Gly Ser
Gly Ser Gly Asp Asp Asp1 5 10 15Asp Lys Val Pro Gly Met Leu Ser Ser
Ser Phe Val Asn Lys Asp Gln 20 25 30Ile Ala Lys Asp Val Lys Gln Phe
Tyr Asp Gln Ala Leu Gln Gln Ala 35 40 45Val Val Asp Asp Asp Ala Asn
Asn Ala Lys Ala Val Val Lys Thr Phe 50 55 60His Glu Thr Leu Asp Cys
Cys Gly Ser Ser Thr Leu Thr Ala Leu Thr65 70 75 80Thr Ser Val Leu
Lys Asn Asn Leu Cys Pro Ser Gly Ser Asn Ile Ile 85 90 95Ser Asn Leu
Phe Lys Glu Asp Cys His Gln Lys Ile Asp Asp Leu Phe 100 105 110Ser
Gly Lys Leu 11514348DNAArtificial SequenceDescription of Artificial
Sequence Nucleotide sequence of EC20His6 fragment cloned into
pGEX-KG 14ctggttccgc gtggatcccc gggaatttcc ggtggtggtg gtggaattct
atttgtcaac 60aaggaccaga tcgccaagga tgtgaagcag ttctatgacc aggccctaca
gcaggccgtg 120gtggatgatg acgccaacaa cgccaaggct gtggtgaaga
ccttccacga gacgcttgac 180tgctgtggct ccagcacact gactgctttg
accacctcag tgctcaagaa caatttgtgt 240ccctcgggca gcaacatcat
cagcaacctc ttcaaggagg actgccacca gaagatcgat 300gacctcttct
ccgggaagct gcatcatcat catcatcatt gaaagctt 34815113PRTArtificial
SequenceDescription of Artificial Sequence Deduced amino acid
sequence of EC2-His 6 fragment 15Leu Val Pro Arg Gly Ser Pro Gly
Ile Ser Gly Gly Gly Gly Gly Ile1 5 10 15Leu Phe Val Asn Lys Asp Gln
Ile Ala Lys Asp Val Lys Gln Phe Tyr 20 25 30Asp Gln Ala Leu Gln Gln
Ala Val Val Asp Asp Asp Ala Asn Asn Ala 35 40 45Lys Ala Val Val Lys
Thr Phe His Glu Thr Leu Asp Cys Cys Gly Ser 50 55 60Ser Thr Leu Thr
Ala Leu Thr Thr Ser Val Leu Lys Asn Asn Leu Cys65 70 75 80Pro Ser
Gly Ser Asn Ile Ile Ser Asn Leu Phe Lys Glu Asp Cys His 85 90 95Gln
Lys Ile Asp Asp Leu Phe Ser Gly Lys Leu His His His His His 100 105
110His16236PRTPan troglodytes 16Met Gly Val Glu Gly Cys Thr Lys Cys
Ile Lys Tyr Leu Leu Phe Val1 5 10 15Phe Asn Phe Val Phe Trp Leu Ala
Gly Gly Val Ile Leu Gly Val Ala 20 25 30Leu Trp Leu Arg His Asp Pro
Gln Thr Thr Asn Leu Leu Tyr Leu Glu 35 40 45Leu Gly Asp Lys Pro Ala
Pro Asn Thr Phe Tyr Val Gly Ile Tyr Ile 50 55 60Leu Ile Ala Val Gly
Ala Val Met Met Phe Val Gly Phe Leu Gly Cys65 70 75 80Tyr Gly Ala
Ile Gln Glu Ser Gln Cys Leu Leu Gly Thr Phe Phe Thr 85 90 95Cys Leu
Val Ile Leu Phe Ala Cys Glu Val Ala Ala Gly Ile Trp Gly 100 105
110Phe Val Asn Lys Asp Gln Ile Ala Lys Asp Val Lys Gln Phe Tyr Asp
115 120 125Gln Ala Leu Gln Gln Ala Val Val Asp Asp Asp Ala Asn Asn
Ala Lys 130 135 140Ala Val Val Lys Thr Phe His Glu Thr Leu Asp Cys
Cys Gly Ser Ser145 150 155 160Thr Leu Thr Ala Leu Thr Thr Ser Val
Leu Lys Asn Asn Leu Cys Pro 165 170 175Ser Gly Ser Asn Ile Ile Ser
Asn Leu Phe Lys Glu Asp Cys His Gln 180 185 190Lys Ile Asp Asp Phe
Phe Ser Gly Lys Leu Tyr Leu Ile Gly Ile Ala 195 200 205Ala Ile Val
Val Ala Val Ile Met Ile Phe Glu Met Ile Leu Ser Met 210 215 220Val
Leu Cys Cys Gly Ile Arg Asn Ser Ser Val Tyr225 230
23517236PRTCercopithecus aethiops 17Met Gly Val Glu Gly Cys Thr Lys
Cys Ile Lys Tyr Leu Leu Phe Val1 5 10 15Phe Asn Phe Val Phe Trp Leu
Ala Gly Gly Val Ile Leu Gly Val Ala 20 25 30Leu Trp Leu Arg His Asp
Pro Gln Thr Thr Asn Leu Leu Tyr Leu Glu 35 40 45Leu Gly Asp Lys Pro
Ala Pro Asn Thr Ser Tyr Val Gly Ile Tyr Ile 50 55 60Leu Ile Ala Val
Gly Ala Val Met Met Phe Val Gly Phe Leu Gly Cys65 70 75 80Tyr Gly
Ala Ile Gln Glu Ser Gln Cys Leu Leu Gly Thr Phe Phe Thr 85 90 95Cys
Leu Val Ile Leu Phe Ala Cys Glu Val Ala Ala Gly Ile Trp Gly 100 105
110Phe Val Asn Lys Asp Gln Ile Ala Lys Asp Val Lys Gln Phe Tyr Asp
115 120 125Gln Ala Leu Gln Gln Ala Val Val Asp Asp Asp Ala Asn Asn
Ala Lys 130 135 140Ala Val Val Lys Thr Phe His Glu Thr Val Asp Cys
Cys Gly Ser Ser145 150 155 160Thr Leu Ala Ala Leu Thr Thr Ser Val
Leu Lys Asn Asn Leu Cys Pro 165 170 175Ser Gly Ser Asn Ile Ile Ser
Asn Leu Leu Lys Lys Asp Cys His Gln 180 185 190Lys Ile Asp Asp Phe
Phe Ser Gly Lys Leu Tyr Leu Ile Gly Ile Ala 195 200 205Ala Ile Val
Val Ala Val Ile Met Ile Phe Glu Met Ile Leu Ser Met 210 215 220Val
Leu Cys Cys Gly Ile Arg Asn Ser Ser Val Tyr225 230
23518236PRTMesocricetus auratus 18Met Gly Val Glu Gly Cys Thr Lys
Cys Ile Lys Tyr Leu Leu Phe Val1 5 10 15Phe Asn Phe Val Phe Trp Leu
Ala Gly Gly Val Ile Leu Gly Val Ala 20 25 30Leu Trp Leu Arg His Asp
Pro Gln Thr Thr Ser Leu Leu Tyr Leu Glu 35 40 45Leu Gly Asp Arg Pro
Ala Pro Ser Thr Phe Tyr Val Gly Ile Tyr Ile 50 55 60Leu Ile Ala Val
Gly Ala Val Met Met Phe Val Gly Phe Leu Gly Cys65 70 75 80Tyr Gly
Ala Ile Gln Glu Ser Gln Cys Leu Leu Gly Thr Phe Phe Thr 85 90 95Cys
Leu Val Ile Leu Phe Ala Cys Glu Val Ala Ala Gly Ile Trp Gly 100 105
110Phe Val Asn Lys Asp Gln Ile Ala Lys Asp Val Lys Gln Phe Tyr Asp
115 120 125Gln Ala Leu Gln Gln Ala Val Val Asp Asp Asp Ala Asn Asn
Ala Lys 130 135 140Ala Val Val Lys Thr Phe His Glu Thr Leu Asn Cys
Cys Gly Ser Asn145 150 155 160Ala Leu Thr Ala Leu Thr Thr Ser Val
Leu Lys Asn Ser Leu Cys Pro 165 170 175Ser Gly Thr Asn Ile Phe Asn
Ser Leu Met Lys Glu Asp Cys His Gln 180 185 190Lys Ile Asp Glu Leu
Phe Ser Gly Lys Leu Tyr Leu Ile Gly Ile Ala 195 200 205Ala Ile Val
Val Ala Val Ile Met Ile Phe Glu Met Ile Leu Ser Met 210 215 220Val
Leu Cys Cys Gly Ile Arg Asn Ser Ser Val Tyr225 230
23519236PRTRattus norvegicus 19Met Gly Val Glu Gly Cys Thr Lys Cys
Ile Lys Tyr Leu Leu Phe Val1 5 10 15Phe Asn Phe Val Phe Trp Leu Ala
Gly Gly Val Ile Leu Gly Val Ala 20 25 30Leu Trp Leu Arg His Asp Pro
Gln Thr Thr Thr Leu Leu Tyr Leu Glu 35 40 45Leu Gly Asp Lys Pro Ala
Pro Ser Thr Phe Tyr Val Gly Ile Tyr Ile 50 55 60Leu Ile Ala Val Gly
Ala Val Met Met Phe Val Gly Phe Leu Gly Cys65 70 75 80Tyr Gly Ala
Ile Gln Glu Ser Gln Cys Leu Leu Gly Thr Phe Phe Thr 85 90 95Cys Leu
Val Ile Leu Phe Ala Cys Glu Val Ala Ala Gly Ile Trp Gly 100 105
110Phe Val Asn Lys Asp Gln Ile Ala Lys Asp Val Lys Gln Phe Tyr Asp
115 120 125Gln Ala Leu Gln Gln Ala Val Met Asp Asp Asp Ala Asn Asn
Ala Lys 130 135 140Ala Val Val Lys Thr Phe His Glu Thr Leu Asn Cys
Cys Gly Ser Asn145 150 155 160Thr Leu Thr Thr Leu Thr Thr Ala Val
Leu Arg Asn Ser Leu Cys Pro 165 170 175Ser Ser Ser Asn Ser Phe Thr
Gln Leu Leu Lys Glu Asp Cys His Gln 180 185 190Lys Ile Asp Glu Leu
Phe Ser Gly Lys Leu Tyr Leu Ile Gly Ile Ala 195 200 205Ala Ile Val
Val Ala Val Ile Met Ile Phe Glu Met Ile Leu Ser Met 210 215 220Val
Leu Cys Cys Gly Ile Arg Asn Ser Ser Val Tyr225 230 23520236PRTMus
musculus 20Met Gly Val Glu Gly Cys Thr Lys Cys Ile Lys Tyr Leu Leu
Phe Val1 5 10 15Phe Asn Phe Val Phe Trp Leu Ala Gly Gly Val Ile Leu
Gly Val Ala 20 25 30Leu Trp Leu Arg His Asp Pro Gln Thr Thr Ser Leu
Leu Tyr Leu Glu 35 40 45Leu Gly Asn Lys Pro Ala Pro Asn Thr Phe Tyr
Val Gly Ile Tyr Ile 50 55 60Leu Ile Ala Val Gly Ala Val Met Met Phe
Val Gly Phe Leu Gly Cys65 70 75 80Tyr Gly Ala Ile Gln Glu Ser Gln
Cys Leu Leu Gly Thr Phe Phe Thr 85 90 95Cys Leu Val Ile Leu Phe Ala
Cys Glu Val Ala Ala Gly Ile Trp Gly 100 105 110Phe Val Asn Lys Asp
Gln Ile Ala Lys Asp Val Lys Gln Phe Tyr Asp 115 120 125Gln Ala Leu
Gln Gln Ala Val Met Asp Asp Asp Ala Asn Asn Ala Lys 130 135 140Ala
Val Val Lys Thr Phe His Glu Thr Leu Asn Cys Cys Gly Ser Asn145 150
155 160Ala Leu Thr Thr Leu Thr Thr Thr Ile Leu Arg Asn Thr Leu Cys
Pro 165 170 175Ser Gly Gly Asn Ile Leu Thr Pro Leu Leu Gln Gln Asp
Cys His Gln 180 185 190Lys Ile Asp Glu Leu Phe Ser Gly Lys Leu Tyr
Leu Ile Gly Ile Ala 195 200 205Ala Ile Val Val Ala Val Ile Met Ile
Phe Glu Met Ile Leu Ser Met 210 215 220Val Leu Cys Cys Gly Ile Arg
Asn Ser Ser Val Tyr225 230 23521236PRTArtificial
SequenceDescription of Artificial Sequence description 21Met Gly
Val Glu Gly Cys Thr Lys Cys Ile Lys Tyr Leu Leu Phe Val1 5 10 15Phe
Asn Phe Val Phe Trp Leu Ala Gly Gly Val Ile Leu Gly Val Ala 20 25
30Leu Trp Leu Arg His Asp Pro Gln Thr Thr Asn Leu Leu Tyr Leu Glu
35 40 45Leu Gly Asp Lys Pro Ala Pro Asn Thr Phe Tyr Val Gly Ile Tyr
Ile 50 55 60Leu Ile Ala Val Gly Ala Val Met Met Phe Val Gly Phe Leu
Gly Cys65 70 75 80Tyr Gly Ala Ile Gln Glu Ser Gln Cys Leu Leu Gly
Thr Phe Phe Thr 85 90 95Cys Leu Val Ile Leu Phe Ala Cys Glu Val Ala
Ala Gly Ile Trp Gly 100 105 110Phe Val Asn Lys Asp Gln Ile Ala Lys
Asp Val Lys Gln Phe Tyr Asp 115 120 125Gln Ala Leu Gln Gln Ala Val
Val Asp Asp Asp Ala Asn Asn Ala Lys 130 135 140Ala Val Val Lys Thr
Phe His Glu Thr Leu Asp Cys Cys Gly Ser Ser145 150 155 160Thr Leu
Thr Ala Leu Thr Thr Ser Val Leu Lys Asn Asn Leu Cys Pro 165 170
175Ser Gly Ser Asn Ile Ile Ser Asn Leu Phe Lys Glu Asp Cys His Gln
180 185 190Lys Ile Asp Asp Leu Phe Ser Gly Lys Leu Tyr Leu Ile Gly
Ile Ala 195 200 205Ala Ile Val Val Ala Val Ile Met Ile Phe Glu Met
Ile Leu Ser Met 210 215 220Val Leu Cys Cys Gly Ile Arg Asn Ser Ser
Val Tyr225 230 235
* * * * *