U.S. patent application number 13/191115 was filed with the patent office on 2012-03-15 for chimeric oligonucleotides for ligation-enhanced nucleic acid detection, methods and compositions therefor.
This patent application is currently assigned to LIFE TECHNOLOGIES CORPORATION. Invention is credited to R. Scott Kuersten, Brittan L. Pasloske.
Application Number | 20120065105 13/191115 |
Document ID | / |
Family ID | 44486247 |
Filed Date | 2012-03-15 |
United States Patent
Application |
20120065105 |
Kind Code |
A1 |
Kuersten; R. Scott ; et
al. |
March 15, 2012 |
Chimeric Oligonucleotides for Ligation-Enhanced Nucleic Acid
Detection, Methods and Compositions Therefor
Abstract
Ligation-enhanced nucleic acid detection assay embodiments for
detection of RNA or DNA are described. The assay embodiments rely
on ligation of chimeric oligonucleotide probes to generate a
template for amplification and detection. The assay embodiments are
substantially independent of the fidelity of a polymerase for
copying compromised nucleic acid. Very little background
amplification is observed and as few as 1000 copies of target
nucleic acid can be detected. Method embodiments are particularly
adept for detection of RNA from compromised samples such as
formalin-fixed and paraffin-embedded samples. Heavily degraded and
cross-linked nucleic acids of compromised samples, in which classic
quantitative real time PCR assays typically fail to adequately
amplify signal, can be reliably detected and quantified.
Inventors: |
Kuersten; R. Scott;
(Madison, WI) ; Pasloske; Brittan L.; (Austin,
TX) |
Assignee: |
LIFE TECHNOLOGIES
CORPORATION
Carlsbad
CA
|
Family ID: |
44486247 |
Appl. No.: |
13/191115 |
Filed: |
July 26, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12147847 |
Jun 27, 2008 |
8008010 |
|
|
13191115 |
|
|
|
|
60946624 |
Jun 27, 2007 |
|
|
|
Current U.S.
Class: |
506/16 |
Current CPC
Class: |
C12Q 1/6816 20130101;
C12Q 1/6827 20130101; Y02A 50/55 20180101; C12Q 2525/161 20130101;
C12Q 2561/125 20130101; C12Q 2525/155 20130101; C12Q 1/6851
20130101; C12Q 1/6816 20130101; C12Q 1/6855 20130101 |
Class at
Publication: |
506/16 |
International
Class: |
C40B 40/06 20060101
C40B040/06 |
Claims
1. A set of chimeric oligonucleotide probes, the probe set
comprising: a first chimeric oligonucleotide probe, comprising, in
a 5' to 3' direction: a primer-specific portion comprising an
amplification primer nucleotide sequence; and a target-specific
portion, the target-specific portion having: complementarity to a
3' portion of a preselected sequence of a target nucleic acid, a
length of 6 nucleotides to 44 nucleotides, at least one nucleotide
analog at one of the six 5'-most nucleotides wherein the nucleotide
analog has enhanced affinity for base pairing as compared to a
corresponding non-modified nucleotide, and 3'-OH and 2'-OR groups
on the 3'-terminal nucleotide, wherein R comprises H or
C.sub.1-C.sub.3 alkyl; and a second chimeric oligonucleotide probe
comprising, in a 5' to 3' direction: a target-specific portion
having: a 5'-terminal nucleotide comprising a 5'-phosphate group,
complementarity to a 5' portion of the preselected sequence of the
target nucleic acid, a length of 6 nucleotides to 44 nucleotides,
and a primer-specific portion comprising an amplification primer
nucleotide sequence; wherein, when the first and second chimeric
oligonucleotide probes are annealed to the target nucleic acid, the
3' hydroxyl group of the first chimeric oligonucleotide probe is
positioned immediately adjacent to the 5' phosphate group of the
second chimeric oligonucleotide probe.
2. The set of chimeric oligonucleotide probes of claim 1, wherein
the target-specific portion of the second chimeric oligonucleotide
probe comprises at least one nucleotide analog at one of the six
3'-most nucleotides, wherein the nucleotide analog has enhanced
affinity for base pairing as compared to a corresponding
non-modified nucleotide.
3. The set of chimeric oligonucleotide probes of claim 2, wherein
the 3'-terminal and the 3'-penultimate nucleotides of the first
chimeric oligonucleotide probe comprise non-modified
ribonucleotides.
4. The set of chimeric oligonucleotide probes of claim 2, wherein
two, three, four, five, or six of the six 5'-most nucleotides of
the target-specific portion of the first chimeric oligonucleotide
probe comprise a nucleotide analog, and wherein two, three, four,
five, or six of the six 3'-most nucleotides of the target-specific
portion of the second chimeric oligonucleotide probe comprise a
nucleotide analog, wherein the nucleotide analog has enhanced
affinity for base pairing as compared to a corresponding
non-modified nucleotide.
5. The set of chimeric oligonucleotide probes of claim 4, wherein
the nucleotide analogs of the first chimeric oligonucleotide probe
are contiguous.
6. The set of chimeric oligonucleotide probes of claim 4, wherein
the nucleotide sequence of the target-specific portion of the first
chimeric oligonucleotide probe together with the nucleotide
sequence of the target-specific portion of the second chimeric
oligonucleotide probe is designed to anneal across an exon junction
of the target nucleic acid.
7. A set of chimeric oligonucleotide probes, the probe set
comprising: at least two different species of first chimeric
oligonucleotide probe wherein the 3'-terminal nucleotide of the
species differ; and wherein each species of first chimeric
oligonucleotide probe comprises: a primer-specific portion
comprising an amplification primer nucleotide sequence; and a
target-specific portion, the target-specific portion having:
complementarity to a 3' portion of a preselected sequence of a
target nucleic acid for at least all but the 3'-terminal
nucleotide, a length of 6 nucleotides to 44 nucleotides, and 3'-OH
and 2'-OR groups on the 3'-terminal nucleotide, wherein R comprises
H or C.sub.1-C.sub.3 alkyl; a second chimeric oligonucleotide probe
comprising, in a 5' to 3' direction: a target-specific portion
having: a 5'-terminal nucleotide comprising a 5'-phosphate group,
complementarity to a 5' portion of the preselected sequence of the
target nucleic acid, a length of 6 nucleotides to 44 nucleotides,
at least one nucleotide analog at one of the six 3'-most
nucleotides, wherein the nucleotide analog has enhanced affinity
for base pairing as compared to a corresponding non-modified
nucleotide, and a primer-specific portion comprising an
amplification primer nucleotide sequence; wherein, when the two
different species of first chimeric oligonucleotide probe and the
second chimeric oligonucleotide probe are contacted with target
nucleic acid under conditions suitable to allow annealing, the 5'
phosphate group of the second chimeric oligonucleotide probe is
positioned immediately adjacent to the 3' hydroxyl group of a
species of first chimeric oligonucleotide probe having 3'-terminal
nucleotide sequence complementarity to the target nucleic acid.
8. A set of chimeric oligonucleotide probes, the probe set
comprising: a first chimeric oligonucleotide probe, comprising, in
a 5' to 3' direction: a primer-specific portion comprising an
amplification primer nucleotide sequence; and a target-specific
portion, the target-specific portion having: complementarity to a
3' portion of a preselected sequence of a target nucleic acid, a
length of 6 nucleotides to 44 nucleotides, at least one nucleotide
analog at one of the six 5'-most nucleotides wherein the nucleotide
analog has enhanced affinity for base pairing as compared to a
corresponding non-modified nucleotide, and 3'-OH and 2'-OR groups
on the 3'-terminal nucleotide, wherein R comprises H or
C.sub.1-C.sub.3 alkyl; at least two different species of second
chimeric oligonucleotide probe wherein the 5'-terminal nucleotide
of the species differ; and wherein each species of second chimeric
oligonucleotide probe comprises, in a 5' to 3' direction: a
target-specific portion, the target-specific portion having: a
5'-terminal nucleotide comprising a 5'-phosphate group,
complementarity to a 5' portion of the preselected sequence of the
target nucleic acid for at least all but the 5'-terminal nucleotide
and, a length of 6 nucleotides to 44 nucleotides, and a
primer-specific portion comprising an amplification primer
nucleotide sequence; wherein, when the first chimeric
oligonucleotide probe and the two different species of second
chimeric oligonucleotide probe are contacted with target nucleic
acid under conditions suitable to allow annealing, the 3' hydroxyl
group of the first chimeric oligonucleotide probe is positioned
immediately adjacent to the 5' phosphate group of a species of
second chimeric oligonucleotide probe having 5'-terminal nucleotide
sequence complementarity to the target nucleic acid.
9-12. (canceled)
Description
[0001] The present application is a divisional of U.S. patent
application Ser. No. 12/147,847 filed Jun. 27, 2008, which is a
non-provisional of, and claims the benefit of priority to U.S.
Provisional Patent Application Ser. No. 60/946,624 filed Jun. 27,
2007; the contents of which are incorporated herein in their
entirety. The U.S. government has certain rights in this
application pursuant to grant no. PHS 2004-2 from the National
Institutes of Health and SB grant no. R43 GM075511.
FIELD
[0002] The present teachings generally relate to compositions,
methods, and kits for detecting and/or quantifying nucleic acid
molecules in a sample.
INTRODUCTION
[0003] Real-time PCR is routinely used for detection of nucleic
acid, and real-time quantitative reverse transcriptase-PCR
(qRT-PCR) is routinely used for detection of RNA and for studying
gene expression. However, modifications of DNA and RNA due to
degradation or sample treatment tend to inhibit the ability of
traditional polymerases to replicate template sequences, often
resulting in inaccurate measurements and unreliable genomic and
gene expression data. The present teachings provide composition,
method and kit embodiments for use in detection and/or quantitation
of nucleic acid that is independent of the fidelity of polymerases
to copy a modified nucleic acid template.
SUMMARY
[0004] Ligation-enhanced nucleic acid detection assay embodiments
are provided for detection of short segments of RNA or DNA. In
certain embodiments, the assay relies on ligation of probes to
generate a template for amplification. Such embodiments do not
depend upon the fidelity of a polymerase to copy the short segments
of target nucleic acid. Very little background amplification is
observed and as few as 1000 copies of target nucleic acid can be
reliably detected and quantified. The total assay time can be about
4.5 hrs. In some embodiments, the short segments of RNA or DNA are
from a compromised sample. Method embodiments are particularly
adept for RNA detection from formalin-fixed and paraffin-embedded
(FFPE) samples. Target nucleic acids in heavily degraded and
cross-linked FFPE samples, in which classic qRT-PCR assays fail to
reliably amplify signal, can be reliably detected and quantified
using the assay embodiments provided. Assay embodiments provided
are amenable to multiplex detection.
[0005] Embodiments of the ligation-enhanced nucleic acid detection
assay use at least one first chimeric oligonucleotide probe
comprising at least two types of nucleotides from the nucleotide
types of deoxyribonucleotides, nucleotide analogs and
ribonucleotides. In certain embodiments, a deoxyribonucleotide is
present in a primer-specific portion of a probe which serves as a
priming site for amplification. In certain embodiments, a
nucleotide analog is present in a target-specific portion of a
probe to favor strong duplex formation between the probe and a
target nucleic acid in the sample. In certain embodiments, a
ribonucleotide is present in the target-specific portion and, in
some embodiments, is positioned for ligation. Together with at
least one second probe, certain probe set embodiments are designed
to hybridize to a target nucleic acid such that the 3' end of at
least one first probe comprising a forward priming site is either
positioned immediately adjacent to, or positioned sufficiently
close to the 5' end of at least one second probe comprising a
reverse priming site, either leaving a nick between them or leaving
a gap that can be filled using a polymerase. In this context, the
target nucleic acid acts as a splint or bridge to bring the ends of
the probes in close proximity to each other. The probes, thus
designed, can use a short (as short as 12 nt) detection
footprint.
[0006] Embodiments provided include at least one first chimeric
oligonucleotide probe, comprising, in a 5' to 3' direction: a
primer-specific portion comprising an amplification primer
nucleotide sequence; and a target-specific portion, the
target-specific portion having complementarity to a 3' portion of a
preselected sequence of a target nucleic acid, a length of 6
nucleotides to 44 nucleotides, at least one nucleotide analog at
one of the six 5'-most nucleotides wherein the nucleotide analog
has enhanced affinity for base pairing as compared to a
corresponding non-modified nucleotide, and 3'-OH and 2'-OR groups
on the 3'-terminal nucleotide, wherein R comprises H or
C.sub.1-C.sub.3 alkyl.
[0007] Further embodiments include a set of chimeric
oligonucleotide probes, the probe set comprising at least one first
chimeric oligonucleotide probe; and at least one second chimeric
oligonucleotide probe comprising, in a 5' to 3' direction: a
target-specific portion having a 5'-terminal nucleotide comprising
a 5'-phosphate group, complementarity to a 5' portion of the
preselected sequence of the target nucleic acid, a length of 6
nucleotides to 44 nucleotides, and a primer-specific portion
comprising an amplification primer nucleotide sequence. In certain
embodiments, when the at least one first and the at least one
second chimeric oligonucleotide probes are annealed to the target
nucleic acid, the 3' hydroxyl group of the at least one first
chimeric oligonucleotide probe is positioned immediately adjacent
to the 5' phosphate group of the at least one second chimeric
oligonucleotide probe. In some embodiments, the probes of a
target-specific probe set are designed to hybridize to adjacent
regions of the target nucleic acid sequence and, under suitable
conditions, the probes can be ligated together to form a ligation
product.
[0008] In some embodiments of the set of chimeric oligonucleotide
probes, the 3'-terminal nucleotide, the 3'-penultimate nucleotide,
or both of the 3'-terminal and the 3'-penultimate nucleotides of
the at least one first chimeric oligonucleotide probe comprise
non-modified ribonucleotides. In certain embodiments of the set of
chimeric oligonucleotide probes, the 3'-terminal nucleotide, the
3'-penultimate nucleotide, or both of the 3'-terminal and the
3'-penultimate nucleotides of the at least one first chimeric
oligonucleotide probe comprise nucleotide analogs having enhanced
affinity for base pairing as compared to a non-modified
ribonucleotide. In certain embodiments, the 5'-terminal nucleotide
of the target-specific portion of the second chimeric
oligonucleotide probe comprises a non-modified ribonucleotide.
[0009] In certain probe set embodiments, the target-specific
portion of the at least one second chimeric oligonucleotide probe
comprises at least one nucleotide analog at one of the six 3'-most
nucleotides, wherein the nucleotide analog has enhanced affinity
for base pairing as compared to a corresponding non-modified
nucleotide.
[0010] In certain probe set embodiments, the 5'-most nucleotide of
the target-specific region of the at least one first chimeric
oligonucleotide probe comprises a nucleotide analog. In certain
embodiments, two, three, four, five, or six of the six most
5'-nucleotides of the target-specific portion of the at least one
first chimeric oligonucleotide probe comprise a nucleotide analog.
For some embodiments, the nucleotide analogs are contiguous.
[0011] In certain probe set embodiments, the 3'-most nucleotide of
the target-specific region of the at least one second chimeric
oligonucleotide probe comprises a nucleotide analog. For further
embodiments, two, three, four, five, or six of the six most
3'-nucleotides of the target-specific portion of the at least one
second chimeric oligonucleotide probe comprise a nucleotide analog.
For some embodiments, the nucleotide analogs are contiguous.
[0012] The target-specific portion of the at least one first
chimeric oligonucleotide probe comprises, in certain embodiments,
in a 5' to 3' direction, a first portion and a second portion,
wherein the first portion comprises primarily nucleotide analogs
and the second portion comprises primarily non-modified
ribonucleotides. In certain embodiments, the first portion
comprises primarily nucleotide analogs and the second portion
comprises at least one deoxyribonucleotide.
[0013] Similarly, in some embodiments, the target-specific portion
of the at least one second chimeric oligonucleotide probe
comprises, in a 5' to 3' direction, a first portion and a second
portion, wherein the first portion comprises primarily non-modified
ribonucleotides and the second portion comprises primarily
nucleotide analogs. In certain embodiments, the first portion
comprises at least one deoxyribonucleotide and the second portion
comprises primarily nucleotide analogs.
[0014] In certain probe set embodiments, when nucleotide sequences
of the probes are taken together, the sequences comprise a
nucleotide sequence corresponding to at least a part of a detector
probe, or the at least one first chimeric oligonucleotide probe
comprises a nucleotide sequence corresponding to at least a part of
a detector probe, or the target-specific portion of the at least
one first chimeric oligonucleotide probe comprises a nucleotide
sequence corresponding to at least a part of a detector probe.
[0015] In certain probe set embodiments, the nucleotide sequence of
the target-specific portion of the at least one first chimeric
oligonucleotide probe taken together with the target-specific
portion of the at least one second chimeric oligonucleotide probe
represent a sense sequence that is capable of annealing to an
antisense strand of a target nucleic acid. In other embodiments,
the nucleotide sequence of the target-specific portion of the at
least one first chimeric oligonucleotide probe taken together with
the target-specific portion of the at least one second chimeric
oligonucleotide probe represent an antisense sequence that is
capable of annealing to a sense strand of a target nucleic acid. In
yet further embodiments, the nucleotide sequence of the
target-specific portion of the at least one first chimeric
oligonucleotide probe together with the nucleotide sequence of the
target-specific portion of the at least one second chimeric
oligonucleotide probe is designed to anneal across an exon junction
of the target nucleic acid.
[0016] In certain probe set embodiments, the at least one first
chimeric oligonucleotide probe comprises, in a 5' to 3' direction:
a primer-specific portion comprising an amplification primer
nucleotide sequence; and a target-specific portion, the
target-specific portion having complementarity to a 3' portion of a
preselected sequence of the target nucleic acid, a length of 6
nucleotides to 44 nucleotides, at least one nucleotide analog at
one of the six 5'-most nucleotides wherein the nucleotide analog
has enhanced affinity for base pairing as compared to a
corresponding non-modified nucleotide, and 3'-OH and 2'-OR groups
on the 3'-terminal nucleotide, wherein R comprises H or
C.sub.1-C.sub.3 alkyl; the at least one second chimeric
oligonucleotide probe comprises, in a 5' to 3' direction: a
target-specific portion having a 5'-terminal nucleotide comprising
a 5'-phosphate group, complementarity to a 5' portion of the
preselected sequence of the target nucleic acid, at least one
nucleotide analog at one of the six 3'-most nucleotides wherein the
nucleotide analog has enhanced affinity for base pairing as
compared to a corresponding non-modified nucleotide, a length of 6
nucleotides to 44 nucleotides, and a primer-specific portion
comprising an amplification primer nucleotide sequence; wherein,
when the at least one first and the at least one second chimeric
oligonucleotide probes are annealed to the target nucleic acid, the
3' hydroxyl group of the at least one first chimeric
oligonucleotide probe is positioned immediately adjacent to the 5'
phosphate group of the at least one second chimeric oligonucleotide
probe.
[0017] Certain method embodiments for detecting a target nucleic
acid in a sample comprise (a) contacting the sample with a set of
chimeric oligonucleotide probes for a time and under conditions
suitable to form an annealed product; (b) contacting the annealed
product with a polypeptide having double-strand dependent ligase
activity for a time and under conditions suitable to form a ligated
product; and (c) detecting the target nucleic acid in the sample by
detecting the ligated product, or a surrogate thereof. In certain
embodiments, the method further comprises adding a single-strand
specific ribonuclease prior to (b), in or during (b), or prior to
(c). In certain embodiments, contacting the sample with at least
one set of chimeric oligonucleotide probes comprises isolating
nucleic acid from the sample and contacting the isolated nucleic
acids with the at least one set of chimeric oligonucleotide
probes.
[0018] Certain embodiments of the disclosed methods include
multiplex assays for detecting or quantitating a multiplicity of
different target nucleic acids; other embodiments are directed to
singleplex assays for detecting or quantitating a single target
nucleic acid; while some embodiments contemplate a multiplex assay
comprising at least one singleplex reaction.
[0019] In certain embodiments, a method for detecting a target
nucleic acid in a sample comprises contacting the sample with a set
of chimeric oligonucleotide probes for a time and under conditions
suitable to form an annealed product; contacting the annealed
product with a polypeptide having double-strand dependent ligase
activity, such as T4 Rnl2 ligase or an enzymatically active mutant
or variant thereof, for a time and under conditions suitable to
form a ligated product; and detecting the target nucleic acid by
detecting the ligated product. The method may further comprise
adding a single-strand specific ribonuclease prior to, in or during
contacting with the polypeptide having ligase activity, or prior to
detecting the target nucleic acid. In a further embodiment, the
method may comprise adding a protease prior to detecting the target
nucleic acid. In another embodiment, the method may comprise
isolating nucleic acid from the sample and contacting the isolated
nucleic acid with the at least one set of chimeric oligonucleotide
probes.
[0020] Embodiments of teachings include, for example, compositions
comprising at least one first chimeric oligonucleotide probe, at
least one second chimeric oligonucleotide probe, a polypeptide
having double-strand dependent ligase activity, or a combination
thereof, and kits as described below. Further embodiments include
gap-filled probes, a plurality of probes, and a single probe that,
when ligated, forms a circular probe.
[0021] Nucleic acid detection embodiments herein are useful for
samples from a variety of environments such as for genetic
analysis, for cancer or disease detection, for forensic analysis,
for human identification including paternity testing or criminal
investigations, for transplantation screening, for expression
analysis, or for quality control and certification of products and
processes, for example. Certain of the environments may result in
compromised samples. In certain quality control or certification
embodiments, at least one synthetic control target nucleic acid
having a control target detection region, and at least one set of
synthetic control chimeric oligonucleotide probes having
target-specific portions for the target detection region are
provided. Such a set of control probes hybridizes to the control
target nucleic acid but does not hybridize to sequences in a test
sample thereby providing a measure for quality control. Kits may
comprise such synthetic control target nucleic acids and chimeric
probes. These and other features of the present teachings will
become more apparent from the description herein.
DRAWINGS
[0022] The skilled artisan will understand that the drawings,
described below, are for illustration purposes only. The drawings
are not intended to limit the scope of the present teachings in any
way.
[0023] FIG. 1A-FIG. 1C provide schematic diagrams depicting a
general overview of certain exemplary embodiments for detection of
an RNA target.
[0024] FIG. 2A-FIG. 2B provide a schematic diagrams depicting a
general overview of certain exemplary embodiments for detection of
a DNA target.
[0025] FIG. 3 provides a schematic diagram depicting a general
overview of further exemplary embodiments for detection of an RNA
target using three probes.
[0026] FIG. 4 provides a schematic diagram depicting a general
overview of further exemplary embodiments for detection using a
single probe.
[0027] FIG. 5 provides a schematic diagram depicting a general
overview of certain exemplary embodiments for detection of a single
nucleotide polymorphism.
[0028] FIG. 6A-FIG. 6C provide a comparison of RNA from frozen
tissue versus FFPE tissue samples analyzed as described in Example
1. The x-axis represents size of RNA in nucleotides and the y-axis
represents fluorescence intensity in relative units (R.U.). Frozen
tissue shows the profile of intact RNA (FIG. 6A); the 18S and 28S
ribosomal RNAs are clearly evident. The fixed samples show a
profile of highly fragmented, small RNA that peaks early in the
profile (FIG. 6B and FIG. 6C).
[0029] FIG. 7 provides a schematic for an integrity assay for
determining the RNA quality of a sample analyzed as in Example 1.
When the RNA quality is poor, the ability to amplify longer
products decreases. RT, reverse transcriptase; A represents a
reverse primer; B, C, D, and E represent forward primers.
[0030] FIG. 8A-FIG. 8B provide results of integrity assays
comparing amplified products from a 2-year old FFPE sample (FIG.
8A) with a 13-year old FFPE sample (FIG. 8B). AB, AC, AD, and AE,
refer to the products schematically shown in FIG. 7. The x-axis
represents size of amplified product in base pairs and the y-axis
represents fluorescence intensity in relative units. The older
sample does not produce any detectable amplified product.
[0031] FIG. 9A-FIG. 9B provide results comparing standard qRT-PCR
(open bars) to one ligation-enhanced nucleic acid detection assay
embodiment (\\\) for detection of .beta.-actin mRNA for a 2-yr old
archived FFPE colon sample (FIG. 9A) and a 13-yr old archived FFPE
colon sample (FIG. 9B). The x-axis represents nanograms of FFPE
RNA; "-lig" refers to a ligase-negative control. The y-axis is
average Ct, cycle threshold.
[0032] FIG. 10A-FIG. 10F. FIG. 10A-FIG. 10C provide results of
integrity assays comparing amplified products for three archived
FFPE tissue samples as described in Example 3. That the RNA in the
samples was compromised is evident from the tracings since
essentially no RNA bands are present other than the PCR primer band
at 38 base pairs. The y-axis represents fluorescence intensity in
relative units; the x-axis represents size in base pairs. FIG.
10D-FIG. 10F provide results comparing detection of .beta.-actin
mRNA using standard qRT-PCR (open bars) to one ligation-enhanced
nucleic acid detection assay embodiment (\\\) for the three
compromised samples of FIG. 10A-FIG. 100, respectively. The x-axis
represents nanograms of FFPE RNA; "-lig" refers to a
ligase-negative control. The y-axis is average Ct, cycle
threshold.
[0033] FIG. 11A-FIG. 11C provide detection results for three
different target mRNAs from a 14-year old archived colon tissue
block. The target mRNAs are .beta.-actin mRNA (FIG. 11A),
glyceraldehyde-3-phosphate dehydrogenase mRNA (FIG. 11B), and
transferrin receptor mRNA (FIG. 11C). Traditional qRT-PCR (open
bars) is compared to one ligation-enhanced nucleic acid detection
assay embodiment (\\\). The x-axis represents nanograms of FFPE
RNA; "-lig" refers to a ligase-negative control. The y-axis is
average Ct, cycle threshold.
[0034] FIG. 12A-FIG. 12B provide results on the effect of including
nucleotide analogs in the chimeric oligonucleotide probes of one
ligation-enhanced nucleic acid detection assay embodiment. Probes
were designed to contain 0, 2, 4, 6, 8 or 10 contiguous nucleotide
analogs (in these exemplary embodiments, the nucleotide analog
contained a 2'-OR group where R is CH.sub.3) within each
target-specific portion proximal to each respective primer-specific
portion. Results for the human .beta.-glucuronidase (GUSB) probes
are provided by FIG. 12A and for the .beta.-actin probes by FIG.
12B. The x-axis represents copy number of synthetic target RNA
having a length of 25 nucleotides; "-lig" refers to a
ligase-negative control. The y-axis is average Ct, cycle
threshold.
[0035] FIG. 13A-FIG. 13D provide results demonstrating detection of
a single nucleotide polymorphism present at two different locations
(SNP1 and SNP2) of both a target synthetic DNA sequence (total
length=25 nucleotides) and a target synthetic RNA sequence (total
length=25 nucleotides) for GUSB and .beta.-actin using one
ligation-enhanced nucleic acid detection assay embodiment. FIG. 13A
and FIG. 13B provide results for .beta.-actin with and without
RNase treatment, respectively; FIG. 13C and FIG. 13D provide
results for GUSB with and without RNase treatment, respectively.
The x-axis represents copy number of synthetic target nucleic acid;
"-lig" refers to a ligase-negative control. The y-axis is average
Ct, cycle threshold.
REFERENCE NUMBERS OF DRAWINGS
[0036] 1. Primer-specific portion of first chimeric oligonucleotide
probe
[0037] 2. Target-specific portion of second chimeric
oligonucleotide probe
[0038] 2a. First portion of target-specific portion 2
[0039] 2b. Second portion of target-specific portion 2
[0040] 3. Target-specific portion of first chimeric oligonucleotide
probe
[0041] 3a. First portion of target-specific portion 3
[0042] 3b. Second portion of target-specific portion 3
[0043] 4. Primer-specific portion of second chimeric
oligonucleotide probe
[0044] 5. 3'-Penultimate nucleotide of target-specific portion
3
[0045] 5'. Nucleotide of target nucleic acid complementary to
nucleotide 5
[0046] 6. 5'-Terminal phosphate of 5'-terminal nucleotide of 2
[0047] 7. 3'-Terminal nucleotide of target-specific portion 3
[0048] 7'. Nucleotide of target nucleic acid complementary to
nucleotide 7
[0049] 8. DNA Target nucleic acid
[0050] 9. 3'-OH group of 3'-terminal nucleotide 7
[0051] 10. RNA Target nucleic acid
[0052] 11. Detector probe sequence
[0053] 12. RNase-treated RNA target
[0054] 14. Reverse transcription primer sequence
[0055] 21. First (forward) amplification primer
[0056] 31. Detector probe having a fluorophore F and a quencher Q
attached thereto
[0057] 41. Second (reverse) amplification primer
[0058] 51. Direction of reverse transcription of ligated
product
[0059] 52. Target-specific portion of probe 502 or of probe 512
[0060] 52a. First portion of target-specific portion 52
[0061] 52b. Second portion of target-specific portion 52
[0062] 53. Target-specific portion of probe 501
[0063] 53a. First portion of target-specific portion 53
[0064] 53b. Second portion of target-specific portion 53
[0065] 54. Primer-specific portion of probe 502 or of probe 512
[0066] 55. Target-specific portion of probe 511
[0067] 55a. First portion of target-specific portion 55
[0068] 55b. Second portion of target-specific portion 55
[0069] 56. SNP-detector nucleotide of probe 502 or of probe 512
[0070] 57. SNP-detector nucleotide of probe 501 or of probe 511
[0071] 58. Target-specific portion of probe 512
[0072] 58a. First portion of target-specific portion 58
[0073] 58b. Second portion of target-specific portion 58
[0074] 59. Primer-specific portion of probe 501 or of probe 511
[0075] 61. 5'-Terminal nucleotide of medial probe
[0076] 62. 5'-Terminal nucleotide of 3'-most chimeric
oligonucleotide probe
[0077] 91. 3'-Terminal nucleotide of 5'-most oligonucleotide
probe
[0078] 92. 3'-Terminal nucleotide of medial probe
[0079] 101. First chimeric oligonucleotide probe
[0080] 102. Second chimeric oligonucleotide probe
[0081] 103. Annealed product
[0082] 104. A nick at the junction of annealed chimeric
oligonucleotide probes 101 and 102
[0083] 105. Ligated and RNase-treated product
[0084] 106. Ligated target-specific portions
[0085] 107. Unligated, RNase-treated probe products
[0086] 108. Annealed, gap-filled product
[0087] 109. Product 105 annealed to primers 21 and 41 and to
detectable probe 31
[0088] 129. Gap between annealed first and second chimeric
oligonucleotide probes
[0089] 300. Medial probe
[0090] 301. First or 5'-most chimeric oligonucleotide probe
[0091] 302. Second or 3'-most chimeric oligonucleotide probe
[0092] 303. Annealed product of a plurality of probes with target
nucleic acid
[0093] 305. Ligated product of 303
[0094] 306. Ligated target-specific portions of 305
[0095] 400. Single chimeric oligonucleotide probe
[0096] 403. Annealed nicked circular duplex of 400 and target
nucleic acid
[0097] 404. Nick present in annealed circular duplex 403
[0098] 405. Ligated product
[0099] 406. Ligated target-specific portions
[0100] 407. Unligated, RNase-treated probe product
[0101] 501. First SNP-detector probe for 503/513 assay; First
chimeric oligonucleotide probe for 503/523 assay
[0102] 502. First SNP-detector probe for 503/523 assay; Second
chimeric oligonucleotide probe for 503/513 assay
[0103] 503. Detection embodiment for single nucleotide
polymorphisms 517 and 519
[0104] 511. Second SNP-detector probe for 503/513 assay
[0105] 512. Second SNP-detector probe for 503/523 assay
[0106] 513. Detection embodiment for single nucleotide polymorphism
517
[0107] 515. Target nucleic acid containing a single nucleotide
polymorphism 517 or 519
[0108] 517. Nucleotide position of a single nucleotide
polymorphism
[0109] 519. Further nucleotide position of a single nucleotide
polymorphism
[0110] 523. Detection embodiment for single nucleotide polymorphism
519
DESCRIPTION OF VARIOUS EMBODIMENTS
[0111] It is to be understood that both the foregoing general
description and the following detailed description are exemplary
and explanatory only and are not intended to limit the scope of the
current teachings. In this application, the use of the singular
includes the plural unless specifically stated otherwise. For
example, "at least one first chimeric oligonucleotide probe" means
that more than one first chimeric oligonucleotide probe primer can
be present; for example, one or more copies of a particular first
chimeric oligonucleotide probe species, as well as one or more
different first chimeric oligonucleotide probe species. Also, the
use of "comprise", "contain", and "include", or modifications of
those root words, for example but not limited to, "comprises",
"contained", and "including", are not intended to be limiting. Use
of "or" means "and/or" unless stated otherwise. The term "and/or"
means that the terms before and after can be taken together or
separately. For illustration purposes, but not as a limitation, "X
and/or Y" can mean "X" or "Y" or "X and Y".
[0112] Whenever a range of values is provided herein, the range is
meant to include the starting value and the ending value and any
value or value range there between unless otherwise specifically
stated. For example, "from 0.2 to 0.5" means 0.2, 0.3, 0.4, 0.5;
ranges there between such as 0.2-0.3, 0.3-0.4, 0.2-0.4; increments
there between such as 0.25, 0.35, 0.225, 0.335, 0.49; increment
ranges there between such as 0.26-0.39; and the like.
[0113] The section headings used herein are for organizational
purposes only and are not to be construed as limiting the subject
matter described in any way. All literature and similar materials
cited in this application including, but not limited to, patents,
patent applications, articles, books, treatises, and internet web
pages, regardless of the format of such literature and similar
materials, are expressly incorporated by reference in their
entirety for any purpose. In the event that one or more of the
incorporated literature and similar materials defines or uses a
term in such a way that it contradicts that term's definition in
this application, this application controls. While the present
teachings are described in conjunction with various embodiments, it
is not intended that the present teachings be limited to such
embodiments. On the contrary, the present teachings encompass
various alternatives, modifications, and equivalents, as will be
appreciated by those of skill in the art.
[0114] The term "or combinations thereof" as used herein refers to
all permutations and combinations of the listed items preceding the
term. For example, "A, B, C, or combinations thereof" is intended
to include at least one of: A, B, C, AB, AC, BC, or ABC, and if
order is important in a particular context, also BA, CA, CB, ACB,
CBA, BCA, BAC, or CAB. Continuing with this example, expressly
included are combinations that contain repeats of one or more item
or term, such as BB, AAA, AAB, BBC, AAABCCCC, CBBAAA, CABABB, and
so forth. The skilled artisan will understand that typically there
is no limit on the number of items or terms in any combination,
unless otherwise apparent from the context. The term "surrogate" as
used herein means a product that is indicative of presence of
another product. For example, an amplification product is a
surrogate for a nucleic acid that has been amplified.
[0115] Nucleotide: The term "nucleotide" generally refers to a
phosphate ester of a nucleoside, either as a monomer or within a
dinucleotide, oligonucleotide or polynucleotide. A nucleoside
generally is a purine base or a pyrimidine base linked to the C-1'
carbon of a ribose (a ribonucleoside) or of a deoxyribose
(deoxyribonucleoside). Naturally occurring purine bases generally
include adenine (A) and guanine (G). Naturally occurring pyrimidine
bases generally include cytosine (C), uracil (U) and thymine (T).
When the nucleoside base is a purine, the ribose or deoxyribose is
attached to the nucleobase at the 9-position of the purine, and
when the nucleobase is a pyrimidine, the ribose or deoxyribose is
attached to the nucleobase at the 1-position of the pyrimidine. A
ribonucleotide is a phosphate ester of a ribonucleoside and a
deoxyribonucleotide is a phosphate ester of a deoxyribonucleoside.
The term "nucleotide" is generic to both ribonucleotides and
deoxyribonucleotides. A dinucleotide generally has two nucleotides
covalently bonded via a 3'-5'phosphodiester linkage. An
oligonucleotide generally has more than two nucleotides and a
polynucleotide generally refers to polymers of nucleotide
monomers.
[0116] Nucleotide monomers are linked by "internucleotide
linkages," e.g., phosphodiester linkages where, as used herein, the
term "phosphodiester linkage" refers to phosphodiester bonds or
bonds including phosphate analogs thereof, including associated
counterions, e.g., H.sup.+, NH.sub.4.sup.+, Na.sup.+, if such
counterions are present. Whenever an oligonucleotide is represented
by a sequence of letters, such as "AUGCCUG," it will be understood
that the nucleotides are in 5' to 3' order from left to right
unless otherwise noted or it is apparent to the skilled artisan
from the context that the converse was intended. Descriptions of
how to synthesize oligonucleotides can be found, among other
places, in U.S. Pat. Nos. 4,373,071; 4,401,796; 4,415,732;
4,458,066; 4,500,707; 4,668,777; 4,973,679; 5,047,524; 5,132,418;
5,153,319; and 5,262,530. Oligonucleotides can be of any
length.
[0117] Base Pairing: "Base pairing," as used herein, includes both
standard Watson-Crick base pairing and Hoogsteen-type hydrogen
bonding. Base pairings found commonly in double-stranded (duplex)
nucleic acids are G:C, A:T, and A:U. Such base pairs are referred
to as complementary base pairs and one base is complementary to its
paired base. Nucleotide analogs as described infra are also capable
of forming hydrogen bonds when paired with a complementary
nucleotide or nucleotide analog.
[0118] Complementary or Substantially Complementary: As used
herein, the terms "complementary" or "complementarity" are used not
only in reference to base pairs but also in reference to
anti-parallel strands of oligonucleotides related by the
Watson-Crick (and optionally Hoogsteen-type) base-pairing rules, to
nucleic acid sequences capable of base-pairing according to the
standard complementary rules, or being capable of hybridizing to a
particular nucleic acid segment under relatively stringent
conditions. For example, the sequence 5'-AGTTC-3' is complementary
to the sequence 5'-GAACT-3'. The terms "completely complementary"
or "100% complementary" and the like refer to complementary
sequences that have perfect pairing of bases between the
anti-parallel strands (no mismatches in the polynucleotide duplex).
Nucleic acid polymers can be complementary across only portions of
their entire sequences. The terms "partial complementarity,"
"partially complementary," "incomplete complementarity" or
"incompletely complementary" and the like refer to any alignment of
bases between anti-parallel polynucleotide strands that is less
than 100% perfect (e.g., there exists at least one mismatch in the
polynucleotide duplex). Furthermore, two sequences are said to be
complementary over a portion of their length if there exists one or
more mismatches, gaps or insertions in their alignment. A
single-stranded nucleic acid "complement" refers a single nucleic
acid strand that is complementary or partially complementary to a
given single nucleic acid strand.
[0119] Furthermore, a "complement" of a target polynucleotide
refers to a polynucleotide that can combine (e.g., hybridize) in an
anti-parallel association with at least a portion of the target
polynucleotide. The anti-parallel association can be
intramolecular, e.g., in the form of a hairpin loop within a
nucleic acid molecule, or intermolecular, such as when two or more
single-stranded nucleic acid molecules hybridize with one
another.
[0120] Hybridization or Annealing: The terms "hybridization,
hybridize, annealing, anneal or variations thereof" are used
interchangeably and refer to the nucleotide base-pairing
interaction of one nucleic acid with another nucleic acid that
results in the formation of a duplex, triplex, or other
higher-ordered structure. The primary interaction is typically
nucleotide base specific, e.g., A:T, A:U, and G:C. In certain
embodiments, base-stacking and hydrophobic interactions can also
contribute to duplex stability. Conditions under which nucleic acid
sequences anneal to complementary or substantially complementary
sequences are well known in the art, e.g., as described in Tijssen
(1993) Laboratory Techniques in Biochemistry and Molecular
Biology--Hybridization with Nucleic Acid Probes part I chapter 2,
"Overview of principles of hybridization and the strategy of
nucleic acid probe assays," (Elsevier, New York); in Ausubel (Ed.)
Current Protocols in Molecular Biology, Volumes I, II, and III,
1997; and in Hames and Higgins (1995) Gene Probes 1 and Gene Probes
2, IRL Press at Oxford University Press, Oxford, England.
[0121] In general, annealing is influenced by, among other things,
the length of the complementary portion of the sequences, pH,
temperature, presence of mono- and divalent cations, the proportion
of G and C nucleotides in the hybridizing region, the viscosity of
the medium, and the presence of denaturants. Such variables
influence the time required for hybridization. The presence of
nucleotide analogs as described infra in the complementary portions
of the nucleic acid sequences can also influence hybridization
conditions. Thus, annealing conditions depend upon the particular
application and are routinely determined by persons of ordinary
skill in the art without undue experimentation. Annealing
conditions are provided that allow first and second chimeric
oligonucleotide probes to selectively hybridize to the target
nucleic acid, but not hybridize to any significant degree to other
nucleotides in the sample.
[0122] Denaturation: The terms "denaturing" or "denaturation" as
used herein refer to any process in which a double-stranded
oligonucleotide is converted to two single-stranded
oligonucleotides. Denaturing a double-stranded oligonucleotide
includes a variety of thermal or chemical techniques for denaturing
a duplex, thereby releasing its two single-stranded components.
Those of ordinary skill in the art will appreciate that the
denaturing technique employed is generally not limiting unless it
inhibits or appreciably interferes with a subsequent amplifying,
detecting, and/or quantifying step.
[0123] The term "corresponding to" when in reference to nucleic
acids, means that a particular sequence is sufficiently
complementary to an anti-parallel sequence such that the two
sequences will anneal and form a duplex under stringent
hybridization conditions. For example, a detector probe sequence
that corresponds to a nucleic acid detector probe means that, under
suitable hybridization conditions, the detector probe will
specifically anneal to the detector probe sequence.
[0124] High stringency conditions could include about 50% formamide
at 37.degree. C. to 42.degree. C. Reduced stringency conditions
could occur at about 35% to 25% formamide at 30.degree. C. to
35.degree. C. Examples of stringency conditions for hybridization
are provided in Sambrook, J., 1989, Molecular Cloning: A Laboratory
Manual,
[0125] Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y. Further examples of stringent hybridization conditions include
400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50.degree. C. or
70.degree. C. for 12-16 hours, or hybridization at 70.degree. C. in
1.times.SSC or 50.degree. C. in 1.times.SSC, 50% formamide, or
hybridization at 70.degree. C. in 4.times.SSC or 50.degree. C. in
4.times.SSC, 50% formamide. The temperature for hybridization is
about 5-10.degree. C. less than the melting temperature (T.sub.m)
of the duplex where T.sub.m is determined for duplexes between 19
and 49 base pairs in length using the following calculation:
T.sub.m.degree. C.=81.5+16.6 (log.sub.10[Na+])+0.41 (% G+C)-(600/N)
where N is the number of bases in the duplex, and [Na+] is the
concentration of sodium ions in the hybridization buffer.
[0126] Nucleotide analogs: In certain embodiments, the present
teachings comprise nucleotide analogs having enhanced affinity for
base pairing as compared to non-modified nucleotides. The term,
"nucleotide analogs," as used herein, refers to those nucleotide
analogs that contribute to greater hybridization affinity than
their naturally occurring non-modified nucleotide counterparts.
Nucleotide analogs for embodiments can shift the conformation
equilibrium toward the northern (C3'-endo) conformation consistent
with the A-form geometry of RNA duplexes. DNA:RNA duplexes can also
be stabilized thereby. In certain embodiments, contribution to
greater hybridization affinity for base pairing is achieved by
constructing oligonucleotide probe conformations favorable for
hybrid formation, by improving base stacking by adding polarizable
groups to the heterocycle, for example, by increasing the number of
hydrogen bonds between base pairs, or by neutralizing the backbone
charge, for example. Generally, electronegative substituents, i.e.,
substituents that tend to attract electrons, such as fluoro or
alkoxy, at the 2' positions contribute to duplex stability by
shifting the conformational equilibrium in the sugar moiety toward
the C3'-endo conformation. Generally, non-electronegative groups at
the 3'-position improve duplex stability and hybridization
affinity. Hybridization affinity is the free energy difference
between duplex and single strands at 37.degree. C., referred to as
.DELTA.G.degree..sub.37, and can be evaluated using absorbance
versus temperature profiles as known by one of ordinary skill in
the art (e.g., see Freier et al., Nucleic Acids Research
25(22):4429-4443, 1997).
[0127] "Nucleotide analogs" in reference to nucleosides,
nucleotides and/or oligonucleotides comprise synthetic analogs
having modified nucleobase portions, modified pentose portions
and/or modified phosphate portions, and, in the case of
oligonucleotides, modified internucleotide linkages, as described
generally elsewhere (e.g., Scheit, Nucleotide Analogs (John Wiley,
New York, (1980); Englisch, Angew. Chem. Int. Ed. Engl. 30:613-29
(1991); Agrawal, Protocols for Polynucleotides and Analogs, Humana
Press (1994)).
[0128] Exemplary nucleotide analogs that confer greater
hybridization affinity include, without limitation: [0129] a)
nucleotide analogs such as 2'-halo where halo is chloro, fluoro,
bromo or iodo; 2'-O-alkyl where alkyl comprises lower alkyl such as
methyl, ethyl, or propyl; 2'-O--(CH.sub.2).sub.4NH.sub.2;
2'-O-anthraquinolylalkyl where alkyl comprises methyl or ethyl;
2'-O--(CH.sub.2).sub.2--OCH.sub.3;
2'-O--(CH.sub.2CH.sub.2O).sub.n--CH.sub.3 where n is 1-4;
2'-O--CH.sub.2--CHR--X where X.dbd.OH, F, CF.sub.3 or OCH.sub.3 and
R.dbd.H, CH.sub.3, CH.sub.2OH or CH.sub.2OCH.sub.3; locked nucleic
acid monomers or derivatives thereof (LNA); peptide nucleic acid
monomers or derivatives thereof (PNA); [0130] b) nucleotide analogs
such as pseudo U, 7-halo-7-deaza purine, 7-propyne-7-deaza purine,
2,6-diamino purine, 5-propynyl, 5-methylthiazole, tricyclic
carbazole-based pyrimidine analogs, tricyclic phenoxazine-based
pyrimidine analogs, 2-thio T; [0131] c) nucleotide analogs having
backbone modifications such as thioformacetal
(--S--CH.sub.2--O--CH.sub.2--), methylene(methylimino),
dimethylhydrazino, phosphoryl linked morpholino,
--CH.sub.2--CO--NH--CH.sub.2--, --CH.sub.2--NH--CO--CH.sub.2--; and
[0132] d) a combination of any of the modifications cited in a),
b), and c).
[0133] In some embodiments, further modified nucleobase portions
that generally enhance hybridization affinity include, but are not
limited to, 2,6-diaminopurine, hypoxanthine, pseudouridine,
C-5-propyne, isocytosine, isoguanine, 2-thiopyrimidine,
methylcytosine, 6-mercaptopurine, 5-fluorouracil,
5-iodo-2'-deoxyuridine, 6-thioguanine, and other like analogs.
According to certain embodiments, nucleobase analogs are iso-C and
iso-G nucleobase analogs available from Sulfonics, Inc., Alachua,
Fla. (e.g., Benner, et al., U.S. Pat. No. 5,432,272).
[0134] In some embodiments, further modified pentose portions that
generally enhance hybridization affinity include, but are not
limited to, 2'- or 3'-modifications where the 2'- or 3'-position is
hydrogen, hydroxy, alkoxy, e.g., methoxy, ethoxy, allyloxy,
isopropoxy, butoxy, isobutoxy and phenoxy, azido, amino or
alkylamino, fluoro, chloro, bromo and the like.
[0135] In some embodiments, modified internucleotide linkages that
generally enhance hybridization affinity include, but are not
limited to, phosphate analogs, analogs having achiral and uncharged
intersubunit linkages (e.g., Sterchak, E. P., et al., Organic Chem,
52:4202 (1987)), and uncharged morpholino-based polymers having
achiral intersubunit linkages (e.g., U.S. Pat. No. 5,034,506).
Internucleotide linkage analogs include, but are not limited to,
morpholidate, acetal, and polyamide-linked heterocycles.
[0136] In some embodiments, modified phosphate portions can
comprise analogs of phosphate wherein the phosphorous atom is in
the +5 oxidation state and one or more of the oxygen atoms is
replaced with a non-oxygen moiety, e.g., sulfur. Exemplary
phosphate analogs include but are not limited to phosphorothioate,
phosphorodithioate, phosphoroselenoate, phosphorodiselenoate,
phosphoroanilothioate, phosphoranilidate, phosphoramidate,
boronophosphates, including associated counterions, e.g., H.sup.+,
NH.sub.4.sup.+, Na.sup.+, if such counterions are present.
[0137] Schematics for various embodiments of the ligation-enhanced
target nucleic acid detection assay using chimeric oligonucleotide
probes are provided by FIG. 1A-FIG. 10, FIG. 2A-FIG. 2B, and FIG.
3-FIG. 5.
[0138] Target nucleic acid: A "target nucleic acid" or "target
nucleic acid sequence" comprises a specific nucleic acid sequence
that is to be detected and typically can be quantified. With
reference to FIG. 1A-FIG. 10, target nucleic acid 10 is a
single-stranded RNA. With reference to FIG. 2A-FIG. 2B, target
nucleic acid 8 is one strand of DNA. A person of ordinary skill in
the art will appreciate that while the target nucleic acid sequence
can be described as a single-stranded molecule, the complement
thereof or a double-stranded target nucleic acid molecule can also
serve as a target nucleic acid sequence.
[0139] In certain embodiments, the target nucleic acid can comprise
single- or double-stranded DNA, DNA:RNA hybrids, or RNA, including,
but not limited to, mRNA and its precursors, and non-coding RNA
(ncRNA) including, but not limited to, rRNA, tRNA, micro RNAs
(miRNA), short interfering RNAs (siRNA), small temporal RNAs
(stRNA) or short nuclear RNAs (snRNA). Target nucleic acid detected
by some embodiments can be less than about 100 nucleotides in
length, less than about 90 nucleotides in length, less than about
80 nucleotides in length, less than about 70 nucleotides in length,
less than about 60 nucleotides in length, less than about 50
nucleotides in length, less than about 40 nucleotides in length,
less than 30 nucleotides in length or even less than 20 nucleotides
in length, can be degraded due to the sample source having been
compromised, and can be of low abundance in a cell. Target nucleic
acid detected by some embodiments can be partially double-stranded
and partially single-stranded such as for a nucleic acid having a
portion that forms a denatured "bubble" in which nucleotides are
not base-paired. The "target" portion may be the double-stranded
portion, the single-stranded portion, or the "target" portion may
overlap the double-stranded and single-stranded portions.
[0140] The nucleic acid can be isolated from its normal milieu.
That is, removal of any contaminant in any amount from the normal
milieu of a nucleic acid accomplishes a degree of isolation of the
nucleic acid. Methods for isolating nucleic acid are well known in
the art. Procedures for isolation of small RNA molecules, such as
microRNA and siRNA molecules are described in U.S. Published Patent
Application No. 2005/0059024 to Conrad et al. filed Sep. 19, 2003.
Procedures for RNA extraction from paraffin embedded tissue are
described in U.S. Published Patent Application No. 2005/0059054 to
Conrad et al. filed Jul. 26, 2004 using the RECOVERALL.RTM. kit
from Ambion (Austin, Tex.), which kit was used herein for purifying
RNA.
[0141] Sample: A sample can include at least one cell, cell
culture, tissue specimen, lysate, extract, solution, or reaction
mixture suspected of containing a target nucleic acid. In certain
embodiments, a sample includes any collection of two or more cells
that are isolated from a subject. A subject includes any organism
from which a sample can be isolated. Non-limiting examples of
organisms include eukaryotes such as fungi, animals, or plants. The
animal, for example, can be a mammal or a non-mammal. The mammal
can be, for example, a mouse, rat, rabbit, dog, pig, cow, horse,
rodent, or a human. In some embodiments, the tissue sample is a
human tissue sample. In certain embodiments, the tissue sample
comprises blood, for example but not limited to, red blood cells,
white blood cells, platelets, plasma, serum, or whole blood. The
sample, in other non-limiting embodiments, comprises saliva, a
cheek, throat, or nasal swab, a fine needle aspirate, a tissue
print, cerebral spinal fluid, mucus, lymph, feces, urine, skin,
plasma, serum, blood products, spinal fluid, peritoneal fluid,
lymphatic fluid, aqueous or vitreous humor, synovial fluid, tears,
semen, seminal fluid, vaginal fluids, pulmonary effusion, serosal
fluid, organs, bronchio-alveolar lavage, tumors, and constituents
and components of in vitro cell cultures. In certain embodiments,
the tissue sample comprises a solid tissue sample. In certain
embodiments, the sample comprises a virus, bacteria, or fungus. In
certain embodiments, the sample comprises ex vivo tissue. In
certain embodiments, a sample includes an enzymatic reaction
mixture such as a PCR reaction mixture.
[0142] The sample can be compromised. The term "compromised," as
used herein, refers to a sample having nucleic acids that are
degraded. Compromised samples can result from exposure to physical
forces, such as shear forces, to harsh environments such as heat or
ultraviolet light, to chemical degradation processes such as may be
employed in clinical or forensic analyses, to biological
degradation processes due to microorganisms or age, to purification
or isolation techniques, or a combination thereof. Degraded nucleic
acids can have breaks, nicks, or chemical modifications when
compared to a full-length normal form of that nucleic acid in its
natural environment.
[0143] Standard preservation techniques for storage of biological
tissue samples use formalin, formaldehyde or paraformaldehyde for
fixation; paraffin, acrylamide or celloidin for embedding; and some
embedding procedures use high temperatures such as for paraffin
infiltration, for example. Such treatment can compromise a sample,
including several types of chemical modifications of both DNA and
RNA. Formalin-fixed and paraffin-embedded (FFPE) RNA or DNA samples
typically contain nucleotide-to-nucleotide and
nucleotide-to-protein cross-links, base modifications and other
chemical modifications that affect the integrity of the nucleic
acid. For example, the reaction between formaldehyde and
nucleotides forms a methylene bridge between amino groups of two
nucleotides. This modification has been shown to interrupt reverse
transcription (Masuda et al., Nucleic Acids Res. 27(22):4436-4443,
1999). Further, with time, FFPE nucleic acid samples typically
degrade resulting in fragmentation, particularly of RNA. These
modifications of DNA and RNA tend to inhibit the ability of
traditional polymerases to replicate template sequences, thus
resulting in inaccurate measurements and unreliable data.
[0144] The sample can be, for example, a preserved or archived
sample such as a formalin-fixed sample, a paraffin-embedded sample,
a FFPE sample, a forensic sample, a diagnostic sample such as blood
or a biopsy sample, or an investigational sample such as, for
example, a tissue or fluid sample from a plant or animal, or a
sample from a culture of a microorganism such as a eukaryotic
microorganism, for example a yeast. The sample can be a tissue
slice present on a histology slide, for example. Any of these
samples can be a compromised sample.
[0145] Preselected Sequence of a Target Nucleic Acid: A preselected
sequence of a target nucleic acid is the specific nucleic acid
sequence of the target that is to be detected. The preselected
sequence is also referred to as the "target detection region" or
target "footprint" of the target nucleic acid that
ligation-enhanced nucleic acid detection assay embodiments are
designed to detect. Target detection regions can be identified for
each target nucleic acid sequence, using folding analysis similar
to that disclosed in Zuker et al, "Algorithms and Thermodynamics
for RNA Secondary Structure Prediction: A Practical Guide," in RNA
Biochemistry and Biotechnology, pages 11-43, J. Barciszewski &
B. F. C. Clark, eds., NATO ASI Series, Kluwer Academic Publishers
(1999). To assist in selecting appropriate double-strand-specific
quantitation reagent nucleotide sequences (i.e., TAQMAN.RTM. probe
sequences), the potential targeting regions of each target nucleic
acid sequence can be analyzed using PRIMER EXPRESS.RTM. software
(Applied Biosystems, Foster City, Calif.). A melting temperature of
a duplex formed between a double-strand-specific quantitation
reagent nucleotide sequence and ligated chimeric oligonucleotide
probes is, in some embodiments, about 68.degree. C. to 70.degree.
C.
[0146] A Set of Chimeric Oligonucleotide Probes: A set of chimeric
oligonucleotide probes, as used herein, includes at least one first
chimeric oligonucleotide probe and at least one second
oligonucleotide probe. In certain embodiments, the at least one
second oligonucleotide probe is at least one second chimeric
oligonucleotide probe. According to various embodiments, at least
one first chimeric oligonucleotide probe has at least two different
types of nucleotide structures, that is, at least two selected from
deoxyribonucleotides, nucleotide analogs, and ribonucleotides. In
certain embodiments, at least one first chimeric oligonucleotide
probe has two different portions with separate functions, the first
function is that of amplification primer function and the second
function is that of enhanced nucleotide binding function.
[0147] In certain embodiments, a chimeric oligonucleotide probe
comprises at least one deoxyribonucleotide and at least one
nucleotide analog. First and second chimeric oligonucleotide probes
are each designed to comprise a primer-specific portion and a
target-specific portion. Each target-specific portion is
complementary to different but contiguous preselected sequences of
a target nucleic acid such that, under annealing conditions, the
target-specific portion of each probe hybridizes in a
sequence-specific manner with the complementary region of the
target nucleic acid and, when hybridized, the first chimeric
oligonucleotide probe is immediately adjacent to or "juxtaposed" to
the second chimeric oligonucleotide probe in the duplexed nucleic
acid as further discussed below. Chimeric oligonucleotide probes
were synthesized using conventional automated nucleic acid
synthesis chemistry. Probes were purified using HPLC technology
known to one of ordinary skill in the art.
[0148] First Chimeric Oligonucleotide Probe: A first chimeric
oligonucleotide probe is exemplified herein with reference to FIG.
1A-FIG. 1C, and FIG. 2A-FIG. 2B. The exemplary first chimeric
oligonucleotide probe 101 comprises, in a 5' to 3' direction, a 5'
primer-specific portion 1 comprising an amplification primer
nucleotide sequence, and a target-specific portion 3.
[0149] Primer-Specific Portion of the First Chimeric
Oligonucleotide Probe: The primer-specific portion 1 of exemplary
first chimeric oligonucleotide probe 101 has complementarity to a
primer oligonucleotide useful for priming the synthesis of a
complementary nucleic acid using a polymerase, e.g., a reverse
transcriptase or a DNA polymerase. Therefore, primers have
3'-enzymatically extendable ends and are useful for amplification
reactions such as in PCR. Primer-specific portion 1 essentially
lacks complementarity to the target nucleic acid. In certain
embodiments, the primer-specific portion 1 comprises a universal
primer site. In further embodiments, the primer-specific portion 1
comprises a universal reverse transcription primer site.
[0150] The first chimeric oligonucleotide probe 101 can further
comprise a promoter sequence such as a T7 promoter sequence, or a
reverse transcription primer sequence as part of the
primer-specific portion of the probe. The first chimeric
oligonucleotide probe 101 can further comprise a promoter sequence,
such as a T7 promoter sequence, 5' to the primer-specific portion
of the probe. A promoter sequence provides for binding of a
polymerase such as T7 DNA polymerase to the ligated product. A
reverse transcription primer sequence provides for binding of
reverse transcriptase for transcription of the ligated product.
Promoters are particularly useful, for example, for some
embodiments of use in arrays.
[0151] Target-Specific Portion of the First Chimeric
Oligonucleotide Probe: The target-specific portion 3 of exemplary
first chimeric oligonucleotide probe 101 has complementarity to a
3'-portion of a preselected sequence of a target nucleic acid 10,
for example, as shown in FIG. 1A-FIG. 1C, and has a length of 6
nucleotides to 44 nucleotides. A 3'-portion of a preselected
sequence of a nucleic acid comprises, for example, a region of a
target nucleic acid 10 that is positioned 3' of a gap or nick that
results from annealing target nucleic acid 10 to the set of
chimeric oligonucleotide probes.
[0152] In certain embodiments of the first chimeric oligonucleotide
probe 101, the target-specific portion 3 comprises, in a 5' to 3'
direction, a first portion 3a and a second portion 3b, wherein the
first portion 3a comprises at least one nucleotide analog at one of
the six 5'-most nucleotides wherein the nucleotide analog has
enhanced affinity for base pairing as compared to a corresponding
non-modified nucleotide. In certain embodiments of the
target-specific portion, the 5'-most nucleotide of the first
portion 3a comprises a nucleotide analog. In further embodiments,
two, three, four, five or six of the six most 5'-nucleotides of the
first portion 3a comprise a nucleotide analog. In certain
embodiments, nucleotide analogs are contiguous. In certain
embodiments, the nucleotide analogs are different from each other.
In certain embodiments, second portion 3b comprises primarily
non-modified ribonucleotides. In certain embodiments, all
nucleotides of second portion 3b comprise modified ribonucleotides.
"Primarily," as used herein, means greater than 50% of a value.
[0153] In some embodiments, the 3'-terminal nucleotide 7 and the
3'-penultimate nucleotide 5 are independently a non-modified
ribonucleotide or a nucleotide analog. In some embodiments, both
the 3'-terminal nucleotide 7 and the 3'-penultimate nucleotide 5
comprise non-modified ribonucleotides or they both comprise
nucleotide analogs. In some embodiments, the 3'-terminal nucleotide
7 of the target-specific portion 3 comprises a 3' hydroxyl group 9.
In various embodiments, the 3'-terminal nucleotide 7 comprises a
2'-OR group wherein R comprises H or C.sub.1-C.sub.3 alkyl. In
various embodiments, the 3'-penultimate nucleotide 5 comprises a
2'-OR group wherein R comprises H or C.sub.1-C.sub.3 alkyl.
[0154] The length of the target-specific portion of the first
chimeric oligonucleotide probe can be from 6 nucleotides to 44
nucleotides, from 6 to 30 nucleotides, from 6 to 25 nucleotides,
from 8 to 35 nucleotides, from 8 to 30 nucleotides, from 8 to 20
nucleotides, from 10 to 20 nucleotides, from 20 to 25 nucleotides,
or from 10 to 15 nucleotides or any range therebetween. That is,
the length of the target-specific portion can be 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, or
44 nucleotides.
[0155] In various embodiments, first chimeric oligonucleotide probe
comprises an addressable sequence 11 as shown in FIG. 1B and FIG.
2B. An addressable sequence can be an addressable support-specific
sequence such as a hybridization pull-out sequence, or a capture
sequence; or a binding portion of a detector probe sequence, such
as a TAQMAN.RTM. sequence.
[0156] Second Chimeric Oligonucleotide Probe: A second chimeric
oligonucleotide probe is exemplified with reference to FIG. 1A-FIG.
1C, and FIG. 2A-FIG. 2B. Exemplary second chimeric oligonucleotide
probe 102 comprises, in a 5' to 3' direction, a 5' target-specific
portion 2 and a 3' primer-specific portion 4 comprising an
amplification primer nucleotide sequence.
[0157] Target-Specific Portion of the Second Chimeric
Oligonucleotide Probe: The target-specific portion 2 of second
chimeric oligonucleotide probe 102 has complementarity to a 5'
portion of a preselected sequence of the target nucleic acid 10,
for example as shown in FIG. 1A-FIG. 1C, and has a length of 6
nucleotides to 44 nucleotides. A 5'-portion of a preselected
sequence of a nucleic acid comprises, for example, a region of a
target nucleic acid 10 that is positioned 5' of a gap or nick that
results from annealing target nucleic acid 10 to the set of
chimeric oligonucleotide probes.
[0158] The 5'-terminal nucleotide 6 of target-specific portion 2 of
second chimeric oligonucleotide probe 102 comprises a 5' phosphate
group and can be a non-modified ribonucleotide or a nucleotide
analog. The 5'-terminal phosphate of the 5'-terminal nucleotide can
be preadenylated as described, for example, in Yin et al., (JBC
278:20, 17601-17608, 2003).
[0159] In certain embodiments of exemplary second chimeric
oligonucleotide probe 102, the target-specific portion 2 comprises,
in a 5' to 3' direction, a first portion 2a and a second portion
2b, wherein the second portion 2b comprises at least one nucleotide
analog at one of the six 3'-most nucleotides wherein the nucleotide
analog has enhanced affinity for base pairing as compared to a
corresponding non-modified nucleotide. In certain embodiments of
the target-specific portion, the 3'-most nucleotide of the second
portion 2b is a nucleotide analog. In further embodiments, two,
three, four, five or six of the six 3'-most nucleotides of the
second portion 2b comprise nucleotide analogs. In some embodiments,
nucleotide analogs are contiguous. In certain embodiments, the
nucleotide analogs are different from each other and/or from those
of the first chimeric oligonucleotide probe. In certain
embodiments, first portion 2a comprises primarily non-modified
ribonucleotides.
[0160] The length of the target-specific portion of the second
chimeric oligonucleotide probe can be from 6 nucleotides to 44
nucleotides, from 6 to 30 nucleotides, from 6 to 25 nucleotides,
from 8 to 35 nucleotides, from 8 to 30 nucleotides, from 8 to 20
nucleotides, from 10 to 20 nucleotides, from 20 to 25 nucleotides,
or from 10 to 15 nucleotides or any range therebetween. The length
of the target-specific portion of the first chimeric
oligonucleotide probe together with the length of the
target-specific portion of the second chimeric oligonucleotide
probe can be from 12 to 88 nucleotides, from 12 to 80 nucleotides,
from 12 to 70 nucleotides, from 12 to 60 nucleotides, from 12 to 50
nucleotides, from 12 to 40 nucleotides, from 15 to 30 nucleotides,
from 18 to 25 nucleotides, or from 12 to 25 nucleotides, or any
range therebetween. In certain embodiments, the length of the
target-specific portion of the first chimeric oligonucleotide probe
taken together with the length of the target-specific portion of
the second chimeric oligonucleotide probe can be from 12-45
nucleotides, or from 12-55 nucleotides, or from 12-65 nucleotides,
or from 12-75 nucleotides, or from 12-85 nucleotides, or any range
therebetween.
[0161] Primer-Specific Portion of the Second Chimeric
Oligonucleotide Probe: The primer-specific portion 4 of exemplary
second chimeric oligonucleotide probe 102 has complementarity to a
primer oligonucleotide useful for priming the synthesis of a
complementary nucleic acid using a polymerase, e.g., a reverse
transcriptase or a DNA polymerase. Therefore, primers have
3'-enzymatically extendable ends and are useful for amplification
reactions such as in PCR. Primer-specific portion 4 essentially
lacks complementarity to the target nucleic acid. In certain
embodiments, the primer-specific portion 4 comprises a universal
primer site. In further embodiments, the primer-specific portion 4
comprises a universal forward primer site.
[0162] In certain embodiments, exemplary second chimeric
oligonucleotide probe 102 further comprises a promoter sequence 14,
such as a T7 promoter, or a universal reverse transcriptase site,
3' to the primer-specific portion as shown in FIG. 1B and FIG. 2B.
The promoter sequence provides for binding of a polymerase such as
T7 RNA polymerase for transcription of the ligated product.
[0163] In certain embodiments, portions of the first chimeric
oligonucleotide probe can overlap another portion. Similarly,
portions of the second chimeric oligonucleotide probe can overlap
another portion. For example, but without limitation, a
target-specific portion can overlap a primer-specific portion, a
promoter sequence, or both. A primer-specific portion can comprise
a promoter sequence. Also, without limitation, an addressable
sequence can overlap with a target-specific portion or a
primer-specific portion, or both.
[0164] Annealed Product: When annealed to target nucleic acid 10 as
shown by reference no. 103 of FIG. 1A-FIG. 1C and to target nucleic
acid 8 as shown by reference no. 103 of FIG. 2A-FIG. 2B, the 3'-OH
group of the first chimeric oligonucleotide probe 101 is positioned
immediately adjacent to the 5'-phosphate group of the second
chimeric oligonucleotide probe 102 to form a nick 104. "Immediately
adjacent to," as used herein, means that the 3' hydroxyl group of a
first chimeric oligonucleotide probe is juxtaposed to the
5'-phosphate group of a second chimeric oligonucleotide probe when
both probes are hybridized to a target nucleic acid having sequence
complementarity to the nucleotide sequence of the probes. Such a
nick is ligatable by ligases as described herein. For those target
nucleic acids that have shorter lengths, such as some non-coding
RNA including, but not limited to, miRNAs, siRNAs, stRNAs or
snRNAs, the target nucleic acid can be fully hybridized throughout
its length to the target-specific portion of the first probe taken
together with the target-specific portion of the second probe.
[0165] FIG. 1C shows one embodiment of an annealed product wherein
the 3' end of the first chimeric oligonucleotide probe and the 5'
end of the second chimeric oligonucleotide probe are not
immediately adjacent thereby providing a gap. The 3'-end of the
first chimeric oligonucleotide probe can be extended with a
polymerase to incorporate one or more nucleotides until the gap is
filled and the ends are immediately adjacent.
[0166] Ligation: Ligation of annealed product 103 can comprise
enzymatic ligation, autoligation, photoligation, or chemical
ligation. Enzymatic ligation refers to use of a polypeptide having
ligase activity where an inter-nucleotide linkage is formed between
immediately adjacent ends of probes that are adjacently hybridized
to a template. Formation of the linkage is double-strand dependent,
also termed duplex-dependent or template-dependent. The
internucleotide linkage can include, but is not limited to,
phosphodiester bond formation. A ligase can include a double-strand
dependent enzyme such as a DNA ligase or an RNA ligase, such as,
for example, T4 DNA ligase, T4 RNA ligase, Thermus thermophilus
(Tth) ligase, Thermus aquaticus (Taq) DNA ligase, Thermus
scotoductus (Tsc) ligase, TS2126 RNA ligase, Archaeoglobus flugidus
(Afu) ligase, Pyrococcus furiosus (Pfu) ligase, Deinococcus
radiodurans RNA ligase (DraRnl) (Raymond et al., Nucl Acids Res
35(3):839-849, 2007), and DraRnl-type ligases include ligases such
as GenBank accession no. XP.sub.--367846 from the fungi Magnaporthe
grisea, GenBank accession no. CAE76396 from Neurospora crassa,
accession no. XP.sub.--380758 from Gibberella zeae, and accession
no. EAL61744 from the amoeba Dictyostelium discoideum.
[0167] In some embodiments, a ligase can be a reversibly
inactivatable ligase such as disclosed in U.S. Pat. No. 5,773,258,
or a heat-activatable ligase such as Afu ligase, T4 ligases, E.
coli ligases, AK16D ligase, Pfu ligase, as well as enzymatically
active mutants and variants thereof.
[0168] Embodiments include as ligases the bacteriophage T4 RNA
ligase 1 (T4 Rnl1) and T4 RNA ligase 2 (T4 Rnl2) that represent
different branches of the RNA ligase family. The T4 Rnl2 family
includes vibriophage KVP40 Rnl2, the RNA-editing ligases of
Trypanosoma brucei (TbREL1 and TbREL2) and of Leishmania tarentolae
(LtREL1 and LtREL2), among others. T4 Rnl2 ligase is commercially
available from NEW ENGLAND BIOLABS.RTM. (Ipswich, Mass.) or it can
be isolated as described in Nandakumar et al., JBC
280(25):23484-23489, 2005; Nandakumar et al., JBC
279(30):31337-31347, 2004; and Nandakumar et al., Molecular Cell
16:211-221, 2004. The T4 Rnl2 enzyme is encoded by gene gp24.1 of
phage T4. In certain embodiments, the ligase comprises T4 Rnl2.
[0169] In certain embodiments, the ligase can be preadenylated, or
the 5'-terminal nucleotide of at least one second chimeric
oligonucleotide probe can be preadenylated. Ho et al. (Structure
12:327-339) sets forth a mechanism for T4 Rnl2 where the C-terminal
domain thereof functions in sealing 3'-OH and 5'-P RNA ends. The
N-terminal segment (1-249) of the Rnl2 protein is reported to
function as an autonomous adenylyltransferase/App-RNA ligase
domain. In general, RNA ligases join 3'-OH and 5'-PO.sub.4 RNA
termini through a series of three nucleotidyl transfer steps
involving activated covalent intermediates. RNA ligase reacts with
ATP to form a covalent ligase-AMP intermediate plus pyrophosphate.
AMP is then transferred from ligase-adenylate to a 5'-PO.sub.4 RNA
end to form an RNA-adenylate intermediate (AppRNA). Ligase then
catalyzes attack by an RNA 3'-OH on the RNA-adenylate to seal the
two ends via a phosphodiester bond and release AMP. Mechanisms for
RNA ligation are further discussed by Nandakumar et al. (ibid 2005,
2004a, 2004b) Yin et al. (JBC 278:20, 17601-17608; Virology
319:141-151, 2004), Ho et al. (ibid; PNAS, 99:20, 12709-12714,
2002), Gumport et al. (in Gene Amplification and Analysis, Vol 2,
edited by Chirikjian, J. G., and Papas, T. S., 1981, 313-345) and
by Raymond et al. (Nucleic Acids Res. 35:3, 839-849, 2007).
Preadenylated agents such as ligase-adenylate and RNA-adenylate are
contemplated for use in some embodiments of ligation enhanced
nucleic acid detection.
[0170] Suitable conditions for carrying out the duplex-dependent
ligase reaction are found in the references cited above in addition
to the examples provided. Table 1 and Table 2 of Example 2 provide
exemplary reagents for carrying out ligation-enhanced nucleic acid
detection assay embodiments. Assay embodiments can be readily
carried out using variations of the types and amounts of exemplary
reagents known to be equivalent in function by one of ordinary
skill in the art. For example, but not limited to, the E. coli RNA
in the Hybridization Mix (Table 2) functions as a carrier RNA and
other macromolecules carrying out the same function can be used;
the Hybridization Mix can be incubated for less than 2 hr such as
about 15 minutes or greater than 2 hr such as overnight; RNA
dilution buffer can be warmed for serial dilution to a temperature
from about 37.degree. C. to about 75.degree. C.; while the
concentrations of total RNA sample used are 20 ng/.mu.l, 2
ng/.mu.l, 0.2 ng/.mu.l and 0.02 ng/.mu.l, the ranges of
concentration can be from about 2000 ng/.mu.l to 0.0002 ng/.mu.l;
the range of concentration of T4 Rnl2 ligase can be from about
0.001 pmol to about 100 pmol; the range of volumes of RNase
Cocktail can be from about 0.01 .mu.l to 10 .mu.l; the 42.degree.
C. incubation of the qRT-PCR mix is optional; or combinations
thereof. In certain embodiments, a cocktail containing a
splint-dependent or duplex-dependent ligase, for example, T4 Rnl2,
and a single-strand specific ribonuclease is added to the reaction
containing the annealed product for about 30 minutes resulting in
the ligation of the two probes at the nicked duplex, and
inactivation of any nonannealed probes in the reaction. In some
embodiments of the disclosed methods, a proteinase K digestion is
then carried out to degrade protein.
[0171] In certain embodiments, non-enzymatic ligation is carried
out by using a 3'-terminal first reactive group on the first
chimeric oligonucleotide probe and a 5'-terminal second reactive
group on the second chimeric oligonucleotide probe such that, when
the first and second chimeric oligonucleotide probes are annealed
to the target nucleic acid, the 3'-terminal nucleotide having the
first reactive group of the first chimeric oligonucleotide probe is
positioned immediately adjacent to the 5'-terminal nucleotide
having the second reactive group, and the first and second reactive
groups are in proximity and comprise autoligatable, chemically
ligatable or photoligatable groups and, when ligated, form a 3'-5'
covalent bond. In certain configurations, activating or reducing
agents can be used. Examples of activating and reducing agents can
include, without limitation, carbodiimide, cyanogen bromide (BrCN),
imidazole, 1-methylimidazole/carbodiimide/cystamine,
N-cyanoimidazole, dithiothreitol (DTT) and ultraviolet light, such
as used for photoligation using routine methods known to skilled
artisans. In various embodiments, chemical ligating can be
accomplished as disclosed in U.S. Pat. No. 5,476,930 or U.S. Pat.
No. 5,681,943. First and second autoligatable reactive groups can
comprise, for example, an ester+hydrazide pair, a derivatized
sulfide anion+haloalkyl pair, or a derivatized sulfide
anion+.alpha.-haloacyl pair.
[0172] Ligated Product: As shown in FIG. 1A-FIG. 1C and in FIG.
2A-FIG. 2B, exemplary target-specific portions 3 and 2, when
ligated, form a ligated product 106. Ligation of chimeric
oligonucleotide probes hybridized to a target nucleic acid can vary
in efficiency depending on the sequences selected for the target
nucleic acid and for the chimeric oligonucleotide probes. The
sequences of chimeric oligonucleotide probes that ligate most
efficiently can be determined empirically. Differences in
efficiency of ligation can affect amounts of amplification product
detected. However, in quantitative measurements of a target nucleic
acid, control samples comprising known amounts of a nucleic acid
can be used to produce standard curves to account for ligation
efficiencies.
[0173] According to certain embodiments, forming a ligated product
comprises ligation techniques such as gap-filling ligation,
including, without limitation, gap-filling OLA and LCR, bridging
oligonucleotide ligation, FEN-LCR, and correction ligation.
Descriptions of these techniques can be found, among other places,
in U.S. Pat. No. 5,185,243, published European Patent Applications
EP 320308 and EP 439182, published PCT Patent Application WO
90/01069, published PCT Patent Application WO 02/02823, and U.S.
Pat. No. 6,511,810. Forming a ligated product can also comprise at
least one gap-filling procedure such as set forth by FIG. 1C,
wherein, when annealed to the target nucleic acid, the 3' end of
the first chimeric oligonucleotide probe and the 5' end of the
second chimeric oligonucleotide probe are not immediately adjacent
thereby providing a gap. The 3'-end of the first chimeric
oligonucleotide probe can be extended with a polymerase to
incorporate one or more nucleotides until the gap is filled and the
ends become immediately adjacent. Such a filling-in reaction using
a polymerase is described, e.g. by U.S. Pat. No. 6,004,826.
[0174] A set of chimeric oligonucleotide probes for gap-filling
embodiments is exemplified by FIG. 1C and comprises at least one
first chimeric oligonucleotide probe 101, and at least one second
chimeric oligonucleotide probe 102 wherein, when the at least one
first and the at least one second chimeric oligonucleotide probes
are annealed to the target nucleic acid 10, a gap 129 of one or
more nucleotides separates the 3' hydroxyl group of the at least
one first chimeric oligonucleotide probe and the 5' phosphate group
of the at least one second chimeric oligonucleotide probe.
[0175] Certain methods for detecting a target nucleic acid in a
sample using the set of chimeric oligonucleotide probes for
gap-filling embodiments comprise, contacting the sample with the at
least one set of chimeric oligonucleotide probes for each target
nucleic acid to be detected for a time and under conditions
suitable to form an annealed product; contacting the annealed
product with a polymerase in the presence of nucleotides for a time
and under conditions suitable to fill the gap; contacting the
polymerized product with a polypeptide having double-strand
dependent ligase activity for a time and under conditions suitable
to form a ligated product; and detecting the target nucleic acid by
detecting the ligated product, or surrogate thereof. In some
embodiments, the target nucleic acid comprises RNA and the
polymerase comprises reverse transcriptase. In further embodiments,
the target nucleic acid comprises DNA and the polymerase comprises
a DNA polymerase such as Klenow. One of skill in the art
understands that rNTP's or dNTP's can be incorporated either by
reverse transcriptase or Klenow, however efficiency will vary.
Similarly, RNA ligase or DNA ligase can be used for any ligation
embodiment, however, efficiency will vary.
[0176] In various embodiments, a plurality of oligonucleotide
probes can be used for detection of a target nucleic acid in a
sample, for example, a set of at least three oligonucleotide probes
such as set forth by FIG. 3. Such a three-probe set comprises, in a
5' to 3' direction, at least one first or 5'-most chimeric
oligonucleotide probe 301, a medial probe 300, and at least one
second or 3'-most chimeric oligonucleotide probe 302. A 5'-most
chimeric oligonucleotide probe 301 has complementarity to a 3'
portion of a preselected sequence of the target nucleic acid and
comprises, in a 5' to 3' direction, a 5' primer-specific portion 1
comprising an amplification primer nucleotide sequence, a first
target-specific portion 3a comprising at least one nucleotide
analog at one of the six 5'-most nucleotides wherein the nucleotide
analog has enhanced affinity for base pairing as compared to a
corresponding non-modified nucleotide, and 3'-OH and 2'-OR groups
on 3'-terminal nucleotide 91, wherein R comprises H or
C.sub.1-C.sub.3 alkyl.
[0177] As depicted in FIG. 3, medial probe 300 has complementarity
to a portion of the preselected sequence of the target nucleic acid
intermediate the first 301 and second 302 chimeric oligonucleotide
probes, a length of 6 nucleotides to 44 nucleotides, a 5'-phosphate
at 5'-terminal nucleotide 61, primarily non-modified
ribonucleotides wherein any nucleotide analog therein has enhanced
affinity for base pairing as compared to a corresponding
non-modified nucleotide, and 3'-OH and 2'-OR groups on the
3'-terminal nucleotide 92, wherein R comprises H or C.sub.1-C.sub.3
alkyl.
[0178] The most 3' probe of a three-probe set as depicted in FIG. 3
is referred to as at least one second or a 3'-most chimeric
oligonucleotide probe 302. Second oligonucleotide probe 302 has
complementarity to a 5' portion of the preselected sequence of the
target nucleic acid and comprises, in a 5' to 3' direction, a
5'-phosphate at the 5'-terminal nucleotide 62 of target-specific
portion 2b where target-specific portion 2b comprises at least one
nucleotide analog at one of the six 3'-most nucleotides wherein the
nucleotide analog has enhanced affinity for base pairing as
compared to a corresponding non-modified nucleotide, and a 3'
primer-specific portion 4 comprising an amplification primer
nucleotide sequence. When the first chimeric, medial and second
chimeric oligonucleotide probes are annealed to the target nucleic
acid 10, as shown at 303 of FIG. 3, the 3' hydroxyl group of the
first chimeric oligonucleotide probe 301 is positioned immediately
adjacent to the 5' phosphate group of the medial probe 300, and the
3' hydroxyl group of the medial probe 300 is positioned immediately
adjacent to the 5' phosphate group of the second oligonucleotide
probe 302. In certain embodiments, the 3' hydroxyl group of the
first chimeric oligonucleotide probe is not immediately adjacent to
the 5' phosphate group of the medial probe, or the 3' hydroxyl
group of the medial probe is not immediately adjacent to the 5'
phosphate group of the second oligonucleotide probe. For such
embodiments, the probes are rendered immediately adjacent by
gap-filling.
[0179] According to some embodiments, certain methods for detecting
a target nucleic acid 10 in a sample using a set of three
oligonucleotide probes, and depicted in FIG. 3, comprise contacting
the sample with the set of at least three chimeric oligonucleotide
probes for a time and under conditions suitable to form an annealed
product 303; contacting annealed product 303 with a polypeptide
having double-strand dependent ligase activity for a time and under
conditions suitable to form a ligated product 305; and detecting
the target nucleic acid in the sample by detecting the ligated
product, or a surrogate thereof.
[0180] Various embodiments include a single chimeric
oligonucleotide probe 400 that forms a nicked circular duplex when
annealed to the target nucleic acid such as that shown at 403 in
FIG. 4. Such a single chimeric oligonucleotide probe comprises, in
a 5' to 3' direction, (1) a target-specific portion 2 having: a
5'-terminal nucleotide comprising a 5'-phosphate group,
complementarity to a 5' portion of the preselected sequence of a
target nucleic acid 10, at least one nucleotide analog at one of
the six 3'-most nucleotides wherein the nucleotide analog has
enhanced affinity for base pairing as compared to a corresponding
non-modified nucleotide, and a length of 6 nucleotides to 44
nucleotides; (2) a reverse primer-specific portion 4 comprising an
amplification primer nucleotide sequence; (3) a forward
primer-specific portion 1 comprising an amplification primer
nucleotide sequence; and (4) a target-specific portion 3 having:
complementarity to a 3' portion of a preselected sequence of the
target nucleic acid 10, a length of 6 nucleotides to 44
nucleotides, at least one nucleotide analog at one of the six
5'-most nucleotides wherein the nucleotide analog has enhanced
affinity for base pairing as compared to a corresponding
non-modified nucleotide, and 3'-OH and 2'-OR groups on the
3'-terminal nucleotide, wherein R comprises H or C.sub.1-C.sub.3
alkyl. For such embodiments, when the chimeric oligonucleotide
probe is annealed to the target nucleic acid as at 403 of FIG. 4,
the 3' hydroxyl group of target-specific portion 3 is positioned
immediately adjacent to the 5' phosphate group of target-specific
portion 2, thereby forming an annealed circular duplex having nick
404.
[0181] In some embodiments, a method for detecting a target nucleic
acid in a sample comprises (a) contacting the sample with at least
one single chimeric oligonucleotide probe 400 for a time and under
conditions suitable to form an annealed product 403; (b) contacting
the annealed product with a polypeptide having double-strand
dependent ligase activity for a time and under conditions suitable
to form a ligated product 405; and (c) detecting the target nucleic
acid in the sample by detecting the ligated product.
[0182] Embodiments of chimeric oligonucleotide probes for
non-enzymatic duplexed-enhanced ligation include a probe set
comprising (1) at least one first chimeric oligonucleotide probe,
comprising, in a 5' to 3' direction: a primer-specific portion
comprising an amplification primer nucleotide sequence; and a
target-specific portion, the target-specific portion having:
complementarity to a 3' portion of a preselected sequence of a
target nucleic acid, a length of 6 nucleotides to 44 nucleotides,
at least one nucleotide analog at one of the six 5'-most
nucleotides wherein the nucleotide analog has enhanced affinity for
base pairing as compared to a corresponding non-modified
nucleotide, and a 3'-terminal first reactive group; and (2) at
least one second chimeric oligonucleotide probe comprising, in a 5'
to 3' direction: a target-specific portion having: a 5'-terminal
second reactive group, at least one nucleotide analog at one of the
six 3'-most nucleotides wherein the nucleotide analog has enhanced
affinity for base pairing as compared to a corresponding
non-modified nucleotide, complementarity to a 5' portion of the
preselected sequence of the target nucleic acid, a length of 6
nucleotides to 44 nucleotides, and a primer-specific portion
comprising an amplification primer nucleotide sequence; wherein,
when the first and second chimeric oligonucleotide probes are
annealed to the target nucleic acid, the 3'-terminal nucleotide
having the first reactive group of the first chimeric
oligonucleotide probe is positioned immediately adjacent to the
5'-terminal nucleotide having the second reactive group, and the
first and second reactive groups are in proximity. For such
embodiments, the first and second reactive groups comprise
autoligatable, chemically ligatable or photoligatable groups and,
when ligated, form a 3'-5' covalent bond.
[0183] For such non-enzymatically ligatable probes, the first and
second reactive groups comprise autoligatable groups and the
autoligatable groups comprise an ester+hydrazide pair, a
derivatized sulfide anion+haloalkyl pair, or a derivatized sulfide
anion+.alpha.-haloacyl pair; chemically ligatable groups; or
photoligatable groups.
[0184] A method for detecting a target nucleic acid in a sample
using non-enzymatic ligation of chimeric oligonucleotide probes,
comprises contacting the sample with the set of chimeric
oligonucleotide probes for a time and under conditions suitable to
form an annealed product; contacting the annealed product for a
time and under conditions suitable to allow ligation of the
3'-terminal nucleotide and the 5'-terminal nucleotide to form a
ligated product; and detecting the target nucleic acid in the
sample by detecting the ligated product.
[0185] RNase treatment: Addition of a single-strand specific
ribonuclease to the ligation mix as described in Table 2 of Example
2 results in degradation of the RNA portions of the probes,
effectively inactivating those probes that are not annealed to
target nucleic acid, and degradation of non-annealed template
portions in an embodiment where the target nucleic acid comprises
RNA. Non-annealed probes are thereby rendered ineffective for
ligation. For studies presented herein, the RNASE COCKTAIL.TM.
(Ambion Inc., Austin Tex. #2286) was used that includes RNase A and
RNase T1. Further RNases that can be used include RNase 1, RNase
T2, RNase U2, or RNase PhyM. While the embodiment of Table 2
provide for use of 1 .mu.l of cocktail (10 U of RNase T1 and 0.25 U
of RNase A), results from further studies demonstrate that
decreasing the amount of RNase can improve the performance of
chimeric oligonucleotide probes that comprise nucleotide analogs.
For example, decreasing the amount of RNase by a factor of 25
allowed a greater detection level of target nucleic acid using
chimeric oligonucleotide probes having four nucleotide analogs in
the target-specific portions proximal to the primer-specific
portions.
[0186] In certain embodiments, a ligated product is purified.
Purification processes include, but are not limited to, molecular
weight or size exclusion processes, e.g., gel filtration
chromatography or dialysis, sequence-specific hybridization-based
pullout methods, affinity capture techniques, precipitation,
adsorption, or other nucleic acid purification techniques.
Purification can reduce the quantity of primers needed to amplify
the ligation product, thus reducing the cost of detecting a target
sequence as well as decreasing possible side reactions during
amplification. In certain embodiments, ligase and RNase can be
removed by treatment with a protease such as proteinase K,
elastase, calpain, chymotrypsin, papain, ficin, subtilisin,
plasmin, trypsin, or a combination thereof, for example.
[0187] Detecting Ligated Product: Embodiments of detecting a
ligated product include detection means such as amplification using
the polymerase chain reaction and variations thereof, or using a
mobility-dependent analysis technique such as electrophoresis
including capillary electrophoresis, chromatography, mass
spectroscopy, sedimentation analysis including gradient
centrifugation, field-flow fractionation, multi-stage extraction
techniques, or the like. A mobility modifier can be a nucleobase
polymer sequence which can increase the size of a detector probe,
or in some configurations, a mobility modifier can be a
non-nucleobase moiety which increases the frictional coefficient of
a probe. A detector probe comprising a mobility modifier can
exhibit a relative mobility in an electrophoretic or
chromatographic separation medium that allows a user to identify
and distinguish the detector probe from other molecules of a
sample. For illustrative teachings in capillary electrophoresis,
detection and mobility probes, see for example U.S. Pat. Nos.
5,777,096, 6,624,800, 5,470,705, 5,514,543, or 6,395,486.
[0188] Amplification: As used herein, "amplification" or "amplify"
and the like refers to a process that results in an increase in the
copy number of a molecule or set of related molecules. As the term
applies to ligated products, amplification means the production of
multiple copies of the ligated products, or a portion of the
ligated products. Amplification can encompass a variety of chemical
and enzymatic processes including without limitation, a polymerase
chain reaction (PCR), a strand displacement amplification reaction,
a transcription mediated amplification reaction, a nucleic acid
sequence-based amplification reaction, a rolling circle
amplification reaction, or a ligase chain reaction. According to
certain embodiments, following at least one amplification cycle,
the amplification products can be separated based on their
molecular weight or length or mobility by, for example, without
limitation, gel electrophoresis, HPLC, MALDI-TOF, gel filtration,
or mass spectroscopy. The detection and quantitation of a labeled
sequence at a particular mobility address indicates that the sample
or starting material contains the corresponding target nucleic acid
sequence at the determined concentration.
[0189] Polymerase Chain Reaction: The PCR includes introducing a
molar excess of two or more extendable oligonucleotide primers to a
reaction mixture comprising the ligated product, where the primers
hybridize to opposite strands of the ligated product. The reaction
mixture is subjected to a program of thermal cycling in the
presence of a DNA polymerase, resulting in the amplification of the
target specific portions of the ligated product flanked by the
primers. Reverse transcriptase PCR is a PCR reaction that uses an
RNA template and a reverse transcriptase, or a polypeptide having
reverse transcriptase activity, to first generate a single stranded
DNA molecule prior to the multiple cycles of DNA-dependent DNA
polymerase primer elongation. Methods for a wide variety of PCR
applications are widely known in the art, and described in many
sources, for example, Ausubel et al. (eds.), Current Protocols in
Molecular Biology, Section 15, John Wiley & Sons, Inc., New
York (1994).
[0190] Criteria for designing sequence-specific primers are well
known to persons of ordinary skill in the art. Detailed
descriptions of primer design that provide for sequence-specific
annealing can be found, among other places, in Diffenbach and
Dveksler, PCR Primer, A Laboratory Manual, Cold Spring Harbor
Press, 1995, and Kwok et al. (Nucl. Acid Res. 18:999-1005, 1990).
The sequence-specific portions of the primers are of sufficient
length to permit specific annealing to complementary sequences, as
appropriate. A primer does not need to have 100% complementarity
with a primer-specific portion for primer extension to occur.
Further, a primer can be detectably labeled such that the label is
detected by, for example, biochemical, chemical, immunochemical,
spectroscopic, photochemical, or other detection means. A primer
pair is sometimes said to consist of a "forward primer" and a
"reverse primer," indicating that they are initiating nucleic acid
polymerization in opposing directions from different strands of the
ligated product. The set of chimeric oligonucleotide probes, in
some embodiments, comprises at least one deoxyribonucleotide in the
primer-specific portion of the first or the second chimeric
oligonucleotide probe and in further embodiments, the
primer-specific portions of the first, the second, or both chimeric
oligonucleotide probes comprises primarily
deoxyribonucleotides.
[0191] In some embodiments, a primer-specific portion of chimeric
oligonucleotide probes can comprise a universal priming site. The
term "universal primer" refers to a primer comprising a universal
site that is able to hybridize to all, or essentially all,
potential priming sites in a multiplexed reaction. The term
"semi-universal primer" refers to a primer that is capable of
hybridizing with more than one (e.g., a subset), but not all, of
the potential sites to be amplified in a multiplexed reaction. The
terms "universal site," "universal priming site," or "universal
primer site" or the like refer to a site contained in a plurality
of primers, where the universal priming site that is found in a
ligated product to be amplified is complementary to a universal
primer.
[0192] In certain embodiments, single-stranded amplification
products can be generated by methods including, without limitation,
asymmetric PCR, asymmetric reamplification, nuclease digestion, and
chemical denaturation. For example, single-stranded sequences can
be generated by combining at least one first primer or at least one
second primer from a primer set, but not both, in an amplification
reaction mixture.
[0193] Polymerase: The term "polymerase," as used herein, refers to
a polypeptide that is able to catalyze the addition of nucleotides
or analogs thereof to a nucleic acid in a template dependent
manner, for example, the addition of deoxyribonucleotides to the
3'-end of a primer that is annealed to a nucleic acid template
during a primer extension reaction. Nucleic acid polymerases can be
thermostable or thermally degradable. Suitable thermostable
polymerases include, but are not limited to, polymerases isolated
from Thermus aquaticus, Thermus thermophilus, Pyrococcus woesei,
Pyrococcus furiosus, Thermococcus litoralis, and Thermotoga
maritima. Therefore, in some embodiments, "cycle sequencing" can be
performed. Suitable thermodegradable polymersases include, but are
not limited to, E. coli DNA polymerase I, the Klenow fragment of E.
coli DNA polymerase I, T4 DNA polymerase, T5 DNA polymerase, T7 DNA
polymerase, and others. Examples of other polymerizing enzymes that
can be used in the methods described herein include but are not
limited to T7, T3, SP6 RNA polymerases and AMV, M-MLV and HIV
reverse transcriptases.
[0194] Commercially available polymerases include, but are not
limited to AMBION'S SUPERTAQ.RTM. polymerase and SUPERTAQ.RTM. Plus
polymerase, TAQFS.RTM. polymerase, AMPLITAQ.RTM. CS polymerase
(Perkin-Elmer), AMPLITAQ.RTM. FS polymerase (Perkin-Elmer),
KENTAQ1.RTM. polymerase (AB Peptide, St. Louis, Mo.),
TAQUENASE.RTM. polymerase (Scien Tech Corp., St. Louis, Mo.),
THERMOSEQUENASE.RTM. polymerase (Amersham), Bst polymerase,
READER.TM.Taq DNA polymerase, VENT.RTM. DNA polymerase,
VENT.sub.R.RTM. DNA Polymerase, VENT.sub.R.RTM. (exo.sup.-)
polymerase and DEEPVENT.RTM. DNA polymerase, (all VENT.RTM.
polymerases can be obtained from New England Biolabs), PFUTurbo.TM.
DNA polymerase (Stratagene), Pwo polymerase, Tth DNA polymerase,
KlenTaq-1 polymerase, SEQUENASE.TM. 1.0 DNA polymerase (Amersham
Biosciences), SEQUENASE.TM. 2.0 DNA polymerase (United States
Biochemicals), and an enzymatically active mutant and variant
thereof.
[0195] Descriptions of DNA polymerases can be found in, among other
places, Lehninger Principles of Biochemistry, 3d ed., Nelson and
Cox, Worth Publishing, New York, N.Y., 2000, particularly Chapters
26 and 29; Twyman, Advanced Molecular Biology: A Concise Reference,
Bios Scientific Publishers, New York, N.Y., 1999; Ausubel et al.,
Current Protocols in Molecular Biology, John Wiley & Sons,
Inc., including supplements through May 2005 (hereinafter "Ausubel
et al."); Lin and Jaysena, J. Mol. Biol. 271:100-11, 1997; Pavlov
et al., Trends in Biotechnol. 22:253-60, 2004; and Enzymatic
Resource Guide: Polymerases, 1998, Promega, Madison, Wis.
[0196] In various detection embodiments, amplification is
optionally followed by additional methods, for example, but not
limited to, labeling, sequencing, purification, isolation,
hybridization, size resolution, expression, detecting and/or
cloning.
[0197] Detection of ligated product can be carried out by detection
of an amplification product thereof. For example, the ligated
product can comprise identifying portions or addressable portions,
and following amplification, such identifying portions or
addressable portions are detected. An addressable sequence portion
can include a detector probe sequence or a hybridization capture
sequence. The ligated product or an amplification product thereof
can be purified by annealing the ligated product with a
hybridization capture probe having complementarity to a
hybridization capture sequence, for example. In yet further
embodiments, the hybridization capture sequence comprises a
mobility modifier sequence, and detecting a target nucleic acid
comprises subjecting the ligated product or an amplification
product thereof to at least one mobility-dependent analysis
technique (MDAT) such as electrophoresis, chromatography, HPLC,
mass spectroscopy, sedimentation, field-flow fractionation, or
multi-stage fractionation.
[0198] Detection of an amplification product can comprise, for
example, gel electrophoresis. Gel electrophoresis can use any
separation medium, such as an agarose gel or a polyacrylamide gel.
Detection can also utilize capillary gel electrophoresis. In
certain aspects, one or both PCR primers can comprise a label, such
as, for example, biotin, a fluorophore or a radioisotope. A label
can facilitate detection of an amplification product comprising a
labeled PCR primer. In various detection embodiments, following the
PCR, a biotinylated strand can be captured and separated, and
mobility modifiers can be hybridized to the immobilized strands.
Eluted mobility modifiers are then detected via capillary
electrophoresis.
[0199] Multiplex Assays: The term "multiplex assays" refers to PCR
reactions that use more than two primers in a single reaction and
at the same time so that more than one different amplified product
is produced and detected. For example, at least two pair of
amplification primers are contacted at the same time and/or in the
same solution with ligated product. Several ligated products can be
detected simultaneously using multiplex assays. In addition,
multiplexed ligation reactions where at least 2 target nucleic
acids are queried with corresponding sets of first and second
chimeric oligonucleotide probes are used in certain embodiments. In
further embodiments, multiplexed ligation reactions contain a
detector probe specific for each oligonucleotide probe set.
[0200] Real-time PCR: As used herein, "real-time PCR" refers to the
detection and quantitation of at least a segment of a ligated
product while the reaction is ongoing. The amplified segment or
"amplicon" can be detected in real time using a 5'-nuclease assay,
particularly the TAQMAN.RTM. assay as described by e.g., Holland et
al. (Proc. Natl. Acad. Sci. USA 88:7276-7280, 1991); and Heid et
al. (Genome Research 6:986-994, 1996). For use herein, a detector
probe sequence to which a TAQMAN.RTM. probe binds, for example, can
be designed into the primer portion, into the target-specific
portion, designed to span the junction of such portions, or
designed as an additional segment as shown as reference number 11
of FIG. 1B or FIG. 2B. The detector probe 31 is typically labeled
with a fluorescent reporter dye F and a quencher moiety Q in close
proximity to each other to allow quenching of signal. Emission from
the reporter dye is quenched by the quenching moiety when the fluor
and quencher are in close proximity, such as on the probe. In some
embodiments, the probe can be labeled with only a fluorescent
reporter dye or another detectable moiety.
[0201] "T.sub.m," as used herein, refers to the melting temperature
(temperature at which 50% of the oligonucleotide is a duplex) of
the oligonucleotide determined experimentally or calculated using
the nearest-neighbor thermodynamic values of Breslauer et al.
(Proc. Natl. Acad. Sci. USA 83:3746 3750, 1986) for DNA or Freier
et al. (Proc. Natl. Acad. Sci. USA 83:9373-9377, 1986) for RNA. In
general, the T.sub.m of the TAQMAN.RTM. probe is about 10 degrees
above the T.sub.m of amplification primer pairs. Amplification
primer sequences and double dye-labeled TAQMAN.RTM. probe sequences
were designed using PRIMER EXPRESS.TM. software (Version 1.0,
Applied Biosystems, Foster City, Calif.) or mFOLD.TM. software (now
UNIFoId.TM. software) (IDT, San Jose, Calif.). The T.sub.m50 (the
temperature at which only 50% of a nucleic acid species is
hybridized to its complement) ranged from 58.degree. C. to
60.degree. C. for primers and 68.degree. C. to 70.degree. C. for
the TAQMAN.RTM. probes, respectively.
[0202] In some embodiments, a detector probe sequence is positioned
within the target-specific portions of the chimeric oligonucleotide
probes exclusively, and in certain embodiments, the detector probe
sequence corresponds to a 3'portion of the target-specific sequence
of the first chimeric oligonucleotide probe and a 5' portion of the
target-specific sequence of the second chimeric oligonucleotide
probe.
[0203] Protocols and reagents for means of carrying out further
5'-nuclease assays are well known to one of skill in the art, and
are described in various sources. For example, 5'-nuclease
reactions and probes are described in U.S. Pat. No. 6,214,979
issued Apr. 10, 2001; U.S. Pat. No. 5,804,375 issued Sep. 8, 1998;
U.S. Pat. No. 5,487,972 issued Jan. 30, 1996; and U.S. Pat. No.
5,210,015 issued May 11, 1993, all to Gelfand et al.
[0204] In various embodiments, a detection method can utilize any
probe that can detect a nucleic acid sequence. In some
configurations, a detector probe can be, for example, a TAQMAN.RTM.
probe, a stem-loop molecular beacon, a stemless or linear beacon, a
PNA MOLECULAR BEACON.TM. probe, a linear PNA beacon, non-FRET
probes, SUNRISE.RTM./AMPLIFLUOR.RTM. probes, stem-loop and duplex
SCORPION.TM. probes, bulge loop probes, pseudo knot probes,
cyclicons, MGB ECLIPSE.TM. probe, a probe complementary to a
ZIPCODE.TM. sequence, hairpin probes, peptide nucleic acid (PNA)
light-up probes, self-assembled nanoparticle probes, and
ferrocene-modified probes as known by one of ordinary skill in the
art. A detector probe having a sequence complementary to a detector
probe hybridization sequence, such as a ZIPCODE.TM. sequence, a
fluorphore and a mobility modifier can be, for example, a
ZIPCHUTE.TM. probe supplied commercially by Applied Biosystems
(Foster City, Calif.).
[0205] A detector probe nucleotide sequence (or its complement) can
comprise from about 12 nucleotides up to about 50 nucleotides, from
about 12 nucleotides up to about 30 nucleotides, or from about 15
nucleotides up to about 25 nucleotides.
[0206] Hybridization-based pullout (HBP) detection comprises a
process where a nucleotide sequence complementary to at least a
portion of the ligated product or an amplicon thereof, for example,
an addressable sequence or another identifying portion, is bound or
immobilized to a solid or particulate pullout support (see, e.g.,
U.S. Pat. No. 6,124,0920 to O'Neill et al., granted Sep. 26, 2000).
The ligation reaction mixture or amplification mixture is exposed
to the pullout support. The ligation product or an amplicon
thereof, under suitable conditions, hybridizes with the
support-bound sequences. The unbound components are removed,
purifying the bound products. Bound products can be purified and
detected using various methods set forth herein.
[0207] Label or Reporter. A "label" or "reporter," refers to a
moiety or property that allows the detection of that with which it
is associated. The label can be attached covalently or
non-covalently. Examples of labels include fluorescent labels
(including, e.g., quenchers or absorbers), colorimetric labels,
chemiluminescent labels, bioluminescent labels, radioactive labels,
mass-modifying groups, antibodies, antigens, biotin, haptens,
enzymes (including, e.g., peroxidase, phosphatase, etc.), and the
like. Fluorescent labels can include dyes that are negatively
charged, such as dyes of the fluorescein family including, e.g.
FAM.TM. dye, HEX.TM. dye, TET.TM. dye, JOE.TM. dye, NAN and ZOE; or
dyes that are neutral in charge, such as dyes of the rhodamine
family including, e.g., TEXAS RED.RTM. dye, ROX.TM. dye, R110, R6G,
and TAMRA.TM. dye; or dyes that are positively charged, such as
dyes of the CYANINE.TM. family including e.g., Cy.TM.2 dye, Cy.TM.3
dye, Cy.TM.5 dye, Cy.TM.5.5 dye and Cy.TM.7 dye. FAM.TM. dye,
HEX.TM. dye, TET.TM. dye, JOE.TM. dye, NAN, ZOE, ROX.TM. dye, R110,
R6G, and TAMRA.TM. dyes are available from, e.g., Applied
Biosystems (Foster City, Calif.) or Perkin-Elmer, Inc. (Wellesley,
Mass.); TEXAS RED.RTM. dye is available from, e.g., Molecular
Probes, Inc. (Eugene, Oreg.); and Cy.TM.2 dye, Cy.TM.3 dye, Cy.TM.5
dye, Cy.TM.5.5 dye and Cy.TM.7 dye, and are available from, e.g.,
Amersham Biosciences Corp. (Piscataway, N.J.). In certain
embodiments, the fluorescer molecule is a fluorescein dye and the
quencher molecule is a rhodamine dye.
[0208] A label or reporter can comprise both a fluorophore and a
fluorescence quencher. The fluorescence quencher can be a
fluorescent fluorescence quencher, such as the fluorophore
TAMRA.TM. dye, or a non-fluorescent fluorescence quencher (NFQ),
for example, a combined NFQ-minor groove binder (MGB) such as an
MGB ECLIPSE.TM. minor groove binder supplied by Epoch Biosciences
(Bothell, Wash.) and used with TAQMAN.TM. probes (Applied
Biosystems, Foster City, Calif.). The fluorophore can be any
fluorophore that can be attached to a nucleic acid, such as, for
example, FAM.TM. dye, HEX.TM. dye, TET.TM. dye, JOE.TM. dye, NAN,
ZOE, TEXAS RED.RTM. dye, ROX.TM. dye, R110, R6G, TAMRA.TM. dye,
Cy.TM.2 dye, Cy.TM.3 dye, Cy.TM.5 dye, Cy.TM.5.5 dye and Cy.TM.7
dye as cited above as well as VIC.RTM. dye, NED.TM. dye, LIZ.RTM.
dye, ALEXA, Cy.TM.9 dye, and dR6G.
[0209] Further examples of labels include black hole quenchers
(BHQ) (Biosearch), Iowa Black (IDT), QSY quencher (Molecular
Probes), and Dabsyl and Dabcel sulfonate/carboxylate Quenchers
(Epoch). Labels can also comprise sulfonate derivatives of
fluorescein dyes, phosphoramidite forms of fluorescein,
phosphoramidite forms of CY.TM.5 (available for example from
Amersham), intercalating labels such as ethidium bromide, and
SYBR.TM. Green I dye and PICOGREEN.TM. dye (Molecular Probes).
[0210] In various embodiments, detection of fluorescence of a PCR
assay can be by any method known to skilled artisans, and can
include, for example, real time detection as described supra or end
point detection. Detection of fluorescence can be qualitative or
quantitative. Quantitative results can be obtained, for example,
with the aid of a fluorimeter, for example a fluorimeter comprised
by an integrated nucleic acid analysis system, such as, for
example, an Applied Biosystems ABI PRISM.TM. 7900HT Sequence
Detection System. Furthermore, quantitative results can be obtained
in some configurations using a real-time PCR analysis as described
supra. Some non-limiting examples of protocols for conducting
fluorogenic assays such as TAQMAN.RTM. assays, including analytical
methods for performing quantitative assays, can be found in
publications such as, for example, "SNPLEX.TM. Genotyping System
48-plex", Applied Biosystems, 2004; "User Bulletin #2 ABI PRISM.TM.
7700 Sequence Detection System," Applied Biosystems 2001; "User
Bulletin #5 ABI PRISM.TM. 7700 Sequence Detection System," Applied
Biosystems, 2001; and "Essentials of Real Time PCR," Applied
Biosystems (Foster City, Calif.). Fluorogenic PCR assays used in
some configurations of the present teachings can be performed using
an automated system, such as, for example, an ABI 7700 Sequence
Detection System (Applied Biosystems).
[0211] In some embodiments, detection can be achieved using
microarrays and related software such as the Applied Biosystems
Array System with the Applied Biosystems 1700 Chemiluminescent
Microarray Analyzer and other commercially available array systems
available from Affymetrix, Agilent, Illumina, and NimbleGen, among
others (see also Gerry et al., J. Mol. Biol. 292:251-62, 1999; De
Bellis et al., Minerva Biotec 14:247-52, 2002; and Stears et al.,
Nat. Med. 9:140-45, including supplements, 2003).
[0212] Further method embodiments for detection of a ligated
product where the ligated product comprises a promoter sequence, or
a complement thereof, include combining the ligated product with at
least one primer comprising a sequence complementary to a 3'
primer-specific portion of the ligation product and a DNA
polymerase, to form at least one first amplification reaction
mixture; subjecting the first amplification reaction mixture to at
least one cycle of amplification to generate at least one first
amplification product comprising the promoter sequence; combining
the first amplification product with an RNA polymerase and a
ribonucleoside triphosphate solution comprising at least one of
rATP, rCTP, rGTP, rUTP, aminoallyl-rUTP, or biotin-rUTP to form a
transcription reaction mixture; contacting the transcription
reaction mixture under suitable conditions to generate an RNA
transcription product; and detecting the target nucleic acid by
detection of the RNA transcription product or a portion thereof. In
certain embodiments, the polymerase is reverse transcriptase.
[0213] Exemplary RNA polymerases include T7, T3, or SP6 RNA
polymerase and exemplary promoters include the T7, T3, or SP6
promoters. The RNA transcription product or a portion thereof can
be detected using an addressable sequence and can also be
quantified. For example, aminoallyl-rUTP can be incorporated during
transcription and detecting the product thereof comprises
contacting the RNA transcription product or a portion thereof with
a fluorescent succinimide ester dye.
[0214] In certain embodiments of detecting ligated product where
the ligated product comprises an addressable sequence and the
addressable sequence comprises a hybridization capture sequence,
the method comprises purifying the ligated product or an
amplification product thereof by annealing the ligated product with
a bridging oligonucleotide having sequence complementarity to the
hybridization capture sequence and with a hybridization capture
probe.
[0215] Enzymatically Active Mutants or Variants Thereof: The term
"enzymatically active mutants or variants thereof" when used in
reference to an enzyme such as a polymerase, ligase, nuclease, or
the like, refers to a polypeptide derived from the corresponding
enzyme that retains at least some of the desired enzymatic
activity. Enzymatically active mutants or variants include
fragments such as Klenow fragment, Stoffel fragment, or
recombinantly expressed fragments, naturally-occurring mutants,
mutants generated using mutagens, genetically engineered mutants,
mutants due to amino acid insertions or deletions or due to nucleic
acid nonsense, missense, or frameshift mutations, reversibly
modified enzymes, splice variants, polypeptides having
modifications such as altered glycosylation, disulfide bonds,
hydroxyl side chains, and phosphate side chains, or crosslinking,
and the like. Protocols for measuring enzymatic activity using an
appropriate assay are known to one of ordinary skill in the
art.
[0216] Single Nucleotide Polymorphism Detection: Single nucleotide
polymorphism or "SNP," when used herein, refers to a variation in a
single nucleotide in a genomic sequence. "SNP genotyping" when used
herein refers to identifying a polymorphic nucleotide.
[0217] In some embodiments as shown in FIG. 5 at 503 together with
513, at least two first chimeric oligonucleotide probe species 501
and 511, and one corresponding second chimeric oligonucleotide
probe 502 are designed to identify the nucleotide at the
polymorphic site 517. At least one first chimeric oligonucleotide
probe species comprises a base pair match to the polymorphic site
(probe 501 at 503) and at least one first chimeric oligonucleotide
probe species comprises a mismatch to the polymorphic site (probe
511 at 513). The nucleotide and/or the position of the match or
mismatch on the probe for the 503/513 embodiment is at the
3'-terminal nucleotide position (57 of 503). In some embodiments,
the target-specific portions of the at least two first chimeric
oligonucleotide probe species have the same nucleotide sequence
other than at the 3'-terminal nucleotide position.
[0218] Thus, in some embodiments relating to FIG. 5 at 503 together
with 513, a set of chimeric oligonucleotide probes comprises: at
least two different species 501 and 511 of first chimeric
oligonucleotide probe wherein the 3'-terminal nucleotide 57 of the
species differ; and at least one second chimeric oligonucleotide
probe 502.
[0219] In some embodiments relating to FIG. 5 at 503 together with
513, each species of first chimeric oligonucleotide probe
comprises: a primer-specific portion 59 comprising an amplification
primer nucleotide sequence; and a target-specific portion 53 and
55, the target-specific portion having complementarity to a 3'
portion of a preselected sequence of a target nucleic acid for at
least all but the 3'-terminal nucleotide 57, a length of 6
nucleotides to 44 nucleotides, and 3'-OH and 2'-OR groups on the
3'-terminal nucleotide, wherein R comprises H or C.sub.1-C.sub.3
alkyl.
[0220] In some embodiments relating to FIG. 5 at 503 together with
513, at least one second chimeric oligonucleotide probe 502
comprises, in a 5' to 3' direction: a target-specific portion 52
having a 5'-terminal nucleotide 56 comprising a 5'-phosphate group,
complementarity to a 5' portion of the preselected sequence of the
target nucleic acid, a length of 6 nucleotides to 44 nucleotides,
at least one nucleotide analog at one of the six 3'-most
nucleotides, wherein the nucleotide analog has enhanced affinity
for base pairing as compared to a corresponding non-modified
nucleotide, and a primer-specific portion 54 comprising an
amplification primer nucleotide sequence.
[0221] In some embodiments relating to FIG. 5 at 503 together with
513, when the two different species of first chimeric
oligonucleotide probe and the second chimeric oligonucleotide probe
are contacted with target nucleic acid under conditions suitable to
allow annealing, the 5' phosphate group of the second chimeric
oligonucleotide probe is positioned immediately adjacent to the 3'
hydroxyl group of a species of first chimeric oligonucleotide probe
having 3'-terminal nucleotide sequence complementarity to the
target nucleic acid, such as for 503.
[0222] In some embodiments as shown in FIG. 5 at 503 together with
523, at least two second chimeric oligonucleotide probe species 502
and 512 and one corresponding first chimeric oligonucleotide probe
501 are designed to identify the nucleotide at the polymorphic site
519. At least one second chimeric oligonucleotide probe species
comprises a base pair match to the polymorphic site (probe 502 at
503) and at least one second chimeric oligonucleotide probe species
comprises a mismatch to the polymorphic site (probe 512 at 523).
The nucleotide and/or the position of the match or mismatch on the
probe for the 503/523 embodiment is at the 5'-terminal nucleotide
position 56. In some embodiments, the target-specific portions of
the at least two second chimeric oligonucleotide probe species have
the same nucleotide sequence other than at the 5'-terminal
nucleotide position.
[0223] In some embodiments relating to FIG. 5 at 503 together with
523, a set of chimeric oligonucleotide probes comprises: at least
two different species 502 and 512 of second chimeric
oligonucleotide probe wherein the 5'-terminal nucleotide 56 of the
species differ and at least one first chimeric oligonucleotide
probe 501.
[0224] In some embodiments relating to FIG. 5 at 503 together with
523, each species of second chimeric oligonucleotide probe
comprises, in a 5' to 3' direction: a target-specific portion 52 or
58, the target-specific portion having a 5'-terminal nucleotide 56
comprising a 5'-phosphate group, complementarity to a 5' portion of
the preselected sequence of the target nucleic acid for at least
all but the 5'-terminal nucleotide 56, a length of 6 nucleotides to
44 nucleotides, and a primer-specific portion 54 comprising an
amplification primer nucleotide sequence.
[0225] In some embodiments relating to FIG. 5 at 503 together with
523, at least one first chimeric oligonucleotide probe 501
comprises, in a 5' to 3' direction: a primer-specific portion 59
comprising an amplification primer nucleotide sequence; and a
target-specific portion 53, the target-specific portion having
complementarity to a 3' portion of a preselected sequence of a
target nucleic acid, a length of 6 nucleotides to 44 nucleotides,
at least one nucleotide analog at one of the six 5'-most
nucleotides wherein the nucleotide analog has enhanced affinity for
base pairing as compared to a corresponding non-modified
nucleotide, and 3'-OH and 2'-OR groups on the 3'-terminal
nucleotide, wherein R comprises H or C.sub.1-C.sub.3 alkyl.
[0226] In some embodiments relating to FIG. 5 at 503 together with
523, when the first chimeric oligonucleotide probe 501 and the two
different species 502 and 512 of second chimeric oligonucleotide
probe are contacted with target nucleic acid 515 under conditions
suitable to allow annealing, the 3' hydroxyl group of the first
chimeric oligonucleotide probe is positioned immediately adjacent
to the 5' phosphate group of a species of second chimeric
oligonucleotide probe having 5'-terminal nucleotide sequence
complementarity to the target nucleic acid.
[0227] In some embodiments relating to FIG. 5 at 503 together with
513, parallel singleplex methods for identifying a polymorphic
nucleotide 517 in a target nucleic acid 515 comprise (1) contacting
the target nucleic acid 515 with at least one chimeric
oligonucleotide probe set for a time and under conditions suitable
to form annealed product; (2) contacting the annealed product with
a polypeptide having double-strand dependent ligase activity for a
time and under conditions suitable to form ligated product; and (3)
identifying the polymorphic nucleotide in the target nucleic
acid.
[0228] In some embodiments relating to FIG. 5 at 503 together with
523, parallel singleplex methods for identifying a polymorphic
nucleotide 519 in a target nucleic acid 515 comprise (1) contacting
the target nucleic acid with at least one chimeric oligonucleotide
probe set for a time and under conditions suitable to form annealed
product; (2) incubating the annealed product with a polypeptide
having double-strand dependent ligase activity for a time and under
conditions suitable to form ligated product; and (3) identifying
the polymorphic nucleotide in the target nucleic acid.
[0229] In some embodiments, multiplex methods for identifying a
plurality of polymorphic nucleotides in a plurality of target
nucleic acids comprise (1) contacting the plurality of target
nucleic acids with a plurality of chimeric oligonucleotide probe
sets for a time and under conditions suitable to form annealed
product; (2) contacting the annealed product with a polypeptide
having double-strand dependent ligase activity for a time and under
conditions suitable to form ligated product; and (3) identifying
the plurality of polymorphic nucleotides in the plurality of target
nucleic acids by detecting the ligated product.
[0230] In some SNP detection embodiments, identifying comprises
parallel singleplex and multiplex embodiments relating to FIG. 5.
For embodiments of polymorphic nucleotide detection, when ligated
product containing a first species of chimeric oligonucleotide
probe is more readily detected than ligated product containing a
second species of chimeric oligonucleotide probe, the polymorphic
nucleotide of the target nucleic acid is the complement of the
3'-terminal nucleotide of the first species; when ligated product
containing the first species of chimeric oligonucleotide probe is
detected in an equal amount to the ligated product containing the
second species of chimeric oligonucleotide probe, the individual
from whom the target nucleic acid was obtained is heterozygous at
the SNP locus being evaluated; and when ligated product containing
the first species of chimeric oligonucleotide probe is less readily
detected than ligated product containing the second species of
chimeric oligonucleotide probe, the polymorphic nucleotide of the
target nucleic acid is the complement of the 3'-terminal nucleotide
of the second species.
[0231] In some embodiments, a plurality of species of first
chimeric oligonucleotide probe and a plurality of species of second
chimeric oligonucleotide probe may be contacted with target nucleic
acid for identifying a polymorphic nucleotide. Labels specific to
each species are detected for identification of ligated products,
thereby identifying a polymorphic nucleotide.
[0232] In certain embodiments, methods for identifying a
polymorphic nucleotide comprise differentiating products based on
melting temperature, wherein a ligated product with the higher
melting temperature possesses the nucleotide of the matched species
of chimeric oligonucleotide probe. In addition, the ligated product
with the higher melting temperature can be isolated using methods
known to one of ordinary skill in the art.
[0233] Kits: A "kit," as used herein, refers to a combination of at
least some items for performing a ligation-enhanced nucleic acid
detection assay embodiment. Embodiments of kits comprise, for
example, a set of chimeric oligonucleotide probes as set forth
herein. The set of chimeric oligonucleotide probes can be custom
made. In some embodiments, kits comprise species of first chimeric
oligonucleotide probe and/or species of second chimeric
oligonucleotide probe together with corresponding downstream or
upstream probes for detecting one or more polymorphisms.
[0234] Embodiments of kits can further comprise a polypeptide
having double-strand dependent ligase activity, a ligase buffer
comprising ATP and Mg.sup.++, a single-strand specific
ribonuclease, a protease, or combinations thereof.
[0235] Embodiments of kits can further comprise first and second
amplification primers having sequence complementarity to the
primer-specific portions of first chimeric oligonucleotide probe
and to at least one second chimeric oligonucleotide probe,
respectively; a detector probe; an RNA or a DNA control target
nucleic acid; reagents for sample collection; reagents for
isolating nucleic acid; an RNA polymerase or an enzymatically
active mutant or variant thereof; a DNA polymerase or an
enzymatically active mutant or variant thereof;
deoxyribonucleotides dATP, dCTP, dGTP, or dTTP; or ribonucleotides
rATP, rCTP, rGTP, rUTP, aminoallyl-rUTP, or biotin-rUTP. In certain
kit embodiments, amplification primers are attached to a solid
support such as a microarray.
[0236] Kits can include, for example, a control set of chimeric
oligonucleotide probes, a control target nucleic acid, nucleic acid
amplification reagents such as a reverse transcriptase, primers
suitable for reverse transcription and first strand and second
strand DNA synthesis to produce a target amplicon, a detector
probe, a thermostable DNA-dependent DNA polymerase and free
deoxyribonucleotide triphosphates. In some embodiments, the enzyme
comprising reverse transcriptase activity and thermostable
DNA-dependent DNA polymerase activity are the same enzyme, e.g.,
Thermus sp. ZO5 polymerase or Thermus thermophilus polymerase.
[0237] In some embodiments, kits are provided for detecting
degraded nucleic acids in a compromised sample, for determining
nucleic acid quality in a compromised sample, for producing a gene
expression profile from a compromised sample, or for measuring gene
expression within compromised samples.
[0238] The container means of the kits will generally include at
least one vial, test tube, flask, bottle, syringe or other
packaging means, into which a component can be placed, and in some
embodiments, suitably aliquoted. Where more than one component is
included in the kit (they can be packaged together), the kit also
will generally contain at least one second, third or other
additional container into which the additional components can be
separately placed. However, various combinations of components can
be packaged in a container means. The kits of the present teachings
also will typically include a means for containing the chimeric
oligonucleotide probes, and any other reagent containers in close
confinement for commercial sale. Such containers can include
injection or blow-molded plastic containers into which the desired
container means are retained. When the components of the kit are
provided in one and/or more liquid solutions, the liquid solution
comprises an aqueous solution that can be a sterile aqueous
solution.
[0239] In certain embodiments, at least one kit component is
provided as dried powder(s). When reagents and/or components are
provided as a dry powder, the powder can be reconstituted by the
addition of a suitable solvent. In certain embodiments, the solvent
is provided in another container means. Kits can also comprise an
additional container means for containing a sterile,
pharmaceutically acceptable buffer and/or other diluent.
[0240] A kit can also include instructions for employing the kit
components as well as the use of any other reagent not included in
the kit. Instructions can include variations that can be
implemented.
[0241] Embodiments of the present teachings can be further
understood in light of the following examples, which should not be
construed as limiting the scope of the present teachings in any
way.
EXAMPLE 1
Archived FFPE RNA is Fragmented
[0242] Samples were obtained from 1) frozen kidney tissue, 2)
ambient-stored FFPE lung tissue blocks, and 3) ambient-stored FFPE
colon tissue blocks. RNA from approximately 10 .mu.m slices of the
tissue samples was extracted and purified using the RECOVERALL.RTM.
kit (Ambion Inc., Austin, Tex.). Total RNA from each sample (about
100 ng to 150 ng) was analyzed on an AGILENT.RTM. 2100 bioanalyzer
(AGILENT.RTM. Technologies, Santa Clara, Calif.) using default
parameters. A typical level of detection for the AGILENT.RTM.
bioanalyzer is about 0.1 ng/.mu.l.
[0243] An analysis of RNA recovered from frozen kidney tissue is
provided by FIG. 6A. An analysis of RNA recovered from
ambient-stored FFPE lung tissue blocks and ambient-stored FFPE
colon tissue block samples is provided by FIG. 6B and FIG. 6C,
respectively. For the figures, the y-axis shows fluorescence
intensity in relative units generated by dye binding to RNA, thus
peak height is proportional to the amount of RNA. The x-axis
depicts size in number of nucleotides which correlates with time
from sample injection into the capillary as determined by using an
internal standard. Frozen tissue samples demonstrated the profile
of intact RNA, i.e., the 18S and 28S ribosomal RNAs are clearly
evident (FIG. 6A). The FFPE samples demonstrated a profile of
highly fragmented, small RNA that peaks early in the profile (FIG.
6B and FIG. 6C).
[0244] An integrity assay for determining RNA quality in FFPE
samples is schematically shown in FIG. 7. The assay uses RT/PCR
together with primer pairs (AB, AC, AD, AE) designed to amplify
different sizes of products for analysis on the AGILENT.RTM.
bioanalyzer. When the RNA quality is poor, the ability to amplify
larger products is decreased. A comparison of results of integrity
assays for .beta.-actin of a 2-year old FFPE colon sample as shown
by FIG. 8A with a 13-year old FFPE colon sample as shown by FIG. 8B
demonstrated that essentially no amplified product was detected in
the older sample.
EXAMPLE 2
Ligation-Enhanced Nucleic Acid Detection Assay Protocol
[0245] The following Table 1 and Table 2 are referred to throughout
the following examples.
TABLE-US-00001 TABLE 1 RNA Dilution Buffer 80% Deionized formamide
300 mM Sodium acetate pH 6.4 100 mM Sodium citrate pH 6.4 1 mM EDTA
5% PEG 8000 100 ng/ml E. coli RNA 2.times. Hybridization Buffer 20%
Deionized formamide 300 mM Sodium acetate pH 6.4 100 mM Sodium
citrate pH 6.4 1 mM EDTA 5% PEG 8000 10.times. Ligase Buffer 500 mM
Tris pH 7.0 100 mM MgCl.sub.2 100 mM DTT 10 mM ATP RNase Cocktail
(AMBION .RTM. Inc., Austin, TX #2286) 0.5 U/.mu.l RNase A 20
U/.mu.l RNase T1 10.times. Complete (SUPERTAQ .TM., AMBION .RTM.
Inc., Austin, TX) Buffer 100 mM Tris pH 9.0 500 mM KCl 15 mM
MgCl.sub.2
TABLE-US-00002 TABLE 2 1. Total RNA sample is serially diluted with
warmed (37.degree. C.) RNA Dilution Buffer to a range of final
concentrations (20 ng/.mu.l, 2 ng/.mu.l, 0.2 ng/.mu.l and 0.02
ng/.mu.l); each sample is heated to 65.degree. C. for 5 minutes and
then placed on ice. 2. A set of chimeric oligonucleotide probes are
mixed and diluted to 50 fmol/.mu.l (50 nM) each in nuclease-free
water. 3. Hybridization Mix 1.0 .mu.l Total RNA (dilutions from 1.)
1.0 .mu.l Chimeric oligonucleotide probe set (50 fmol each from 2.)
0.5 .mu.l E. coli RNA (1 .mu.g/.mu.l) 2.5 .mu.l 2.times.
Hybridization Buffer (Table 1) 5.0 .mu.l total volume Heat sample
to 95.degree. C. for 3 minutes Centrifuge at 1000 rpm for 1 minute
Incubate samples at room temperature (~20-25.degree. C.) for 2 hr
4. Ligation/RNase Digestion Mix To 5.0 .mu.l Hybridized mix from
3., add: 2.5 .mu.l 10.times. Ligase Buffer (Table 1) 15.5 .mu.l
nuclease-free water 1.0 .mu.l T4 Rnl2 ligase (1 pmol) 1.0 .mu.l
RNase Cocktail (Table 1) 25.0 .mu.l total volume Mix well and
centrifuge at 1000 rpm for 1 minute Incubate at room temp
(20-30.degree. C.) for 30 minutes 5. RNase Inactivation and Reverse
Primer Binding Mix on ice: 3.0 .mu.l nuclease-free water 1.0 .mu.l
Proteinase K (20 .mu.g/.mu.l) 1.0 .mu.l Reverse (i.e., second)
primer (10 .mu.M)* 5.0 .mu.l Add 5.0 .mu.l of above mix to the 25
.mu.l reaction from 4. Mix well and incubate at 75.degree. C. for
15 minutes Spin 1000 rpm for 1 minute 6. One-step quantitative real
time PCR Assay: Mix on ice: 5.0 .mu.l Sample from 5. (1/6th of
total) 2.5 .mu.l 10.times. Complete (SUPERTAQ .RTM.) Buffer (Table
1.) 2.0 .mu.l dNTP mix (the mix contains each dNTP at a
concentration of 2.5 mM) 1.0 .mu.l For/Rev (i.e., first/second) PCR
primers (10 .mu.M each)* 0.5 .mu.l 5.times. ROX internal dye
reference (INVITROGEN .TM., Carlsbad, CA) 1.0 .mu.l detector probe
(TAQMAN .RTM. probe, 2 .mu.M)* 0.2 .mu.l RNase inhibitor protein (4
units) (SUPERASIN .RTM., AMBION .RTM. Inc., Austin, TX) 0.2 .mu.l
SUPERTAQ .RTM. (5 U/.mu.l) (AMBION .RTM. Inc., Austin, TX) 0.1
.mu.l reverse transcriptase (200 U/.mu.l)(ARRAYSCRIPT .TM. AMBION
.RTM. Inc., Austin, TX) 12.5 .mu.l nuclease-free water 25.0 .mu.l
total Reaction Conditions: One cycle at 42.degree. C. for 15
minutes followed by one cycle for 95.degree. C. for 10 minutes
Then, 40 cycles of: 95.degree. C. for 15 seconds followed by
60.degree. C. for 40 seconds. *The forward (first) and reverse
(second) primers, and the detector probe (TAQMAN .RTM. probe)
sequence are designed as described by the examples.
EXAMPLE 3
[0246] Standard qRT-PCR vs. Ligation-Enhanced Nucleic Acid
Detection for .beta.-Actin mRNA in Archived Tissue
[0247] RNA from the 2-yr old and 13-yr old FFPE colon tissue
samples depicted by FIG. 8A and FIG. 8B was used to compare
standard qRT-PCR to ligation-enhanced nucleic acid detection
embodiments for limits of detection of the .beta.-actin mRNA target
nucleic acid. RNA from approximately 10 .mu.m slices of the tissue
blocks was extracted and purified using the RECOVERALL.RTM. kit
(Ambion Inc., Austin, Tex.). Total RNA from each sample was
serially diluted with RNA Dilution Buffer (Table 1).
[0248] This study of standard qRT-PCR versus embodiments of
ligation-enhanced nucleic acid detection essentially compares the
ability of PCR to amplify the "target region" of a target nucleic
acid using primers that have sequence complementarity to sequences
that are upstream and downstream of that "target region" with the
ability of PCR to amplify the "target region" as represented by a
ligated product and using primers that are specific for the primer
portions of the ligated product. The primer portions of the ligated
products do not have sequence complementarity to the target nucleic
acid.
[0249] For the standard real-time PCR assay, the primers were
designed based on sequences that are upstream and downstream of the
"target region" of the target so that a small product of about
60-100 bp is amplified of which 25 base pairs represent the
target-specific portion or "target footprint." Since the detector
probe (TAQMAN.RTM. probe) sequence used in this study is designed
to be complementary to the target-specific portion of the target,
the same detector probe (TAQMAN.RTM. probe) was used for both the
standard qRT-PCR assay and the ligation-enhanced nucleic acid
detection embodiment.
[0250] A set of exemplary chimeric oligonucleotide probes having
deoxyribonucleotides, 2'O-methyl nucleotide analogs and
ribonucleotides was designed for detection of .beta.-actin mRNA
target nucleic acid as follows:
TABLE-US-00003 .beta.-actin mRNA detection: 1.sup.st Chimeric
oligonucleotide probe: (SEQ ID NO: 1) 5'-
GCTCACCTTAACGTAGAGTCTGCuaggauGGCAAG-3', and 2.sup.nd Chimeric
oligonucleotide probe: (SEQ ID NO: 2) 5'PO.sub.4-
GGACUUCcuguaaTATTGTTGGGGTAGTCGGACCT-3' Uppercase letters with no
underlining: Deoxyribonucleotides Lowercase letters: 2'O-methyl
nucleotide analogs Underlined uppercase letters: Unmodified
ribonucleotides
[0251] For this exemplary set of chimeric oligonucleotide probes,
the deoxyribonucleotides of the first and second probes represent a
5' primer-specific portion and a 3'primer-specific portion of the
first and second probes, respectively. The primer-specific portions
are designed not to anneal to the target nucleic acid but instead
are designed to anneal to amplification primers added for a
RT-PCR-detector probe (TAQMAN.RTM. probe) assay. The nucleotide
analog region (lowercase letters) and the non-modified
ribonucleotide region (uppercase underlined letters) together
represent the target-specific portion of each probe. The set of
chimeric oligonucleotide probes was diluted to a concentration of
50 fmol/.mu.l in nuclease-free water.
[0252] The first and second PCR primers and the detector probe
(TAQMAN.RTM. probe) have the following nucleotide sequences:
TABLE-US-00004 .beta.-actin mRNA nucleic acid target detection:
First PCR primer: (SEQ ID NO: 3) 5'-GCTCACCTTAACGTAGAGTCTGC-3';
Second PCR primer: (SEQ ID NO: 4) 5'-AGGTCCGACTACCCCAACAATAT-3';
TAQMAN .RTM. probe: (SEQ ID NO: 5) 5'FAM .TM.
dye-TAGGATGGCAAGGGA-MGB-Q-3'.
[0253] Each reaction was performed in quadruplicate.
[0254] Results comparing standard qRT-PCR (open bars) for detection
of .beta.-actin mRNA to embodiments of ligation-enhanced nucleic
acid detection (\\\\) for detection of the same target nucleic acid
for 2-yr old and 13-yr old archived FFPE colon samples are provided
by FIG. 9A and FIG. 9B. The data of FIG. 9A demonstrate that the
two assays appear comparable in detection efficacy for .beta.-actin
mRNA target nucleic acid for the 2-year old sample. In contrast,
the data of FIG. 9B demonstrate that the ligation-enhanced nucleic
acid detection assay embodiment is more sensitive in detecting RNA
by about 6-9 threshold cycles as compared to the level of RNA
detected by standard qRT-PCR for the 13-year old sample.
[0255] Further FFPE archived tissue samples designated D1 (from
breast tissue), D2, and D3 (both D2 and D3 are of unknown tissue
type) were analyzed for RNA as for Example 1 and using the assays
of Example 3 for the .beta.-actin target nucleic acid. The
bioanalyzer tracings shown in FIG. 10A, FIG. 10B, and FIG. 10C (for
samples D1, D2, and D3, respectively) demonstrate that these
samples are compromised since essentially no amplified bands are
present other than the PCR primer band at 38 base pairs.
[0256] Results comparing detection of .beta.-actin mRNA by qRT-PCR
to detection by this embodiment of the ligation-enhanced nucleic
acid detection assay for the D1, D2, and D3 archived FFPE samples
are provided by FIG. 10D, FIG. 10E, and FIG. 10F, respectively. The
data of each figure demonstrate that the qRT-PCR assay (open bars)
essentially fails to amplify signal from the tissues while this
illustrative ligation-enhanced nucleic acid detection assay
embodiment (\\\\) detects target nucleic acid.
EXAMPLE 4
[0257] Standard qRT-PCR vs. Ligation-Enhanced Nucleic Acid
Detection for Detection of Various Target Ribonucleic Acids in
FFPE-Archived Colon Tissue
[0258] Samples from archived 14-year old FFPE colon tissue blocks
were used to compare traditional qRT-PCR to one embodiment of
ligation-enhanced nucleic acid detection assay for detection of
three target nucleic acids, .beta.-actin,
glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and transferrin
receptor (TFRC) mRNAs. RNA from approximately 10 .mu.m slices of
the tissue blocks was extracted and purified using the
RECOVERALL.RTM. kit (Ambion Inc., Austin, Tex.). Total RNA was
serially diluted with RNA Dilution Buffer as set forth by the
protocol of Table 2.
[0259] The set of chimeric oligonucleotide probes for detection of
.beta.-actin mRNA is described in Example 3. Illustrative chimeric
oligonucleotide probe sets having deoxyribonucleotides, 2'O-methyl
nucleotide analogs and ribonucleotides were designed for detection
of human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA and
for detection of human transferrin receptor (TFRC) mRNA as
follows.
TABLE-US-00005 GAPDH mRNA target nucleic acid detection: 1st
Chimeric oligonucleotide probe: (SEQ ID NO: 6)
5'-GCTCACCTTAACGTAGAGTCTGCggcuggCGACGC-3', and 2nd Chimeric
oligonucleotide probe: (SEQ ID NO: 7)
5'PO.sub.4-AAAAGAAgaugcgTATTGTTGGGGTAGTCGGACCT-3'. TFRC mRNA target
nucleic acid detection: 1st Chimeric oligonucleotide probe: (SEQ ID
NO: 8) 5'-GCTCACCTTAACGTAGAGTCTGCucagugGCACCA-3', and 2nd Chimeric
oligonucleotide probe: (SEQ ID NO: 9)
5'PO.sub.4-ACCGAUCcaaaguTATTGTTGGGGTAGTCGGACCT-3'. Uppercase
letters with no underlining: Deoxyribonucleotides Lowercase
letters: 2'O-methyl nucleotide analogs Underlined uppercase
letters: Unmodified ribonucleotides
[0260] The deoxyribonucleotides of the first and second chimeric
oligonucleotide probes represent a 5' primer-specific portion and a
3'primer-specific portion of the first and second probes,
respectively. The nucleotide analog region (lowercase letters) and
the non-modified ribonucleotide region (uppercase underlined
letters) together represent the target-specific portion of each
probe.
[0261] Standard real-time PCR primers were designed based on GAPDH
and TFRC sequences that are upstream and downstream of the "target
region" of the target nucleic acids so that a small product of
about 80 bp was amplified of which 25 base pairs represented the
target-specific portion or "target footprint." The detector probe
(TAQMAN.RTM. probe) sequences shown below were designed to be
complementary to the GAPDH or the TFRC target-specific portion,
respectively; the same detector probe (TAQMAN.RTM. probe) was used
for both the standard qRT-PCR assay and the ligation-enhanced
nucleic acid detection assay embodiment for each target:
TABLE-US-00006 GAPDH TAQMAN .RTM. probe: (SEQ ID NO: 10) VIC .RTM.
dye-CTGGCGACGCAAAA-BHQ .TM. dye-MGB; and TFRC TAQMAN .RTM. probe:
(SEQ ID NO: 11) VIC .RTM. dye-TCAGTGGCACCAACC-BHQ .TM. dye-MGB.
[0262] The ligation-enhanced nucleic acid detection protocol was
followed as for Example 3 using the first and second probe-specific
primers cited therein. Results comparing standard qRT-PCR to this
ligation-enhanced nucleic acid detection assay embodiment for
detection of .beta.-actin mRNA for archived FFPE samples presented
by FIG. 11A demonstrate that the ligation-enhanced nucleic acid
detection assay embodiment (\\\\) is more sensitive than qRT-PCR
(open bars) since the threshold cycle for detection is 11 to 13
cycles lower.
[0263] Results comparing qRT-PCR to this exemplary
ligation-enhanced nucleic acid detection assay for detection of
GAPDH mRNA for archived FFPE samples presented by FIG. 11B
demonstrate that this ligation-enhanced nucleic acid detection
assay embodiment (\\\\) is more sensitive by .about.10-fold
(.about.3 Ct's) as compared to the level of detection by standard
qRT-PCR (open bars).
[0264] Results comparing qRT-PCR to this ligation-enhanced nucleic
acid detection assay embodiment for detection of TFRC mRNA for
archived FFPE samples presented by FIG. 11C demonstrate that the
ligation-enhanced nucleic acid detection assay embodiment (\\\\) is
at least as sensitive and, at lower concentrations of RNA, more
sensitive by .about.10-fold (.about.3 Ct's) as compared to the
level of detection by standard qRT-PCR (open bars).
[0265] The ability to detect targets using both the standard
qRT-PCR assay and the ligation-enhanced assay embodiment appears to
differ with the particular target. Different target nucleic acids
respond differently in terms of detection levels and in terms of
cycle threshold differentials to both assays. Such different
responses can be due to different RNA stability between targets or
to behavior of RNAs in compromised samples, for example.
EXAMPLE 5
Effect of Length of Nucleotide Analog Regions Within
Target-Specific Portions of Chimeric Oligonucleotide Probes
[0266] Exemplary chimeric oligonucleotide probes designed to anneal
with the target nucleic acid human .beta.-glucuronidase (GUSB) mRNA
were also designed to have either 0, 2, 4, 6, 8 or 10 contiguous
2'-O-methyl nucleotides within each target-specific portion
proximal to each respective primer-specific portion as follows.
TABLE-US-00007 GUSB First Chimeric oligonucleotide probe: (SEQ ID
NO: 12) 5'-GCTCACCTTAACGTAGAGTCTGCGUACCACACCCA-OH -3' (SEQ ID NO:
13) 5'-GCTCACCTTAACGTAGAGTCTGCguACCACACCCA-OH -3' (SEQ ID NO: 14)
5'-GCTCACCTTAACGTAGAGTCTGCguacCACACCCA-OH -3' (SEQ ID NO: 15)
5'-GCTCACCTTAACGTAGAGTCTGCguaccaCACCCA-OH -3' (SEQ ID NO: 16)
5'-GCTCACCTTAACGTAGAGTCTGCguaccacaCCCA-OH -3' (SEQ ID NO: 17)
5'-GCTCACCTTAACGTAGAGTCTGCguaccacaccCA-OH -3' GUSB Second Chimeric
oligonucleotide probe: (SEQ ID NO: 18)
5'-[PO4]GCCGACAAAAUGCTATTGTTGGGGTAGTCGGACCT -3' (SEQ ID NO: 19)
5'-[PO4]GCCGACAAAAUgcTATTGTTGGGGTAGTCGGACCT -3' (SEQ ID NO: 20)
5'-[PO4]GCCGACAAAaugcTATTGTTGGGGTAGTCGGACCT -3' (SEQ ID NO: 21)
5'-[PO4]GCCGACAaaaugcTATTGTTGGGGTAGTCGGACCT -3' (SEQ ID NO: 22)
5'-[PO4]GCCGAcaaaaugcTATTGTTGGGGTAGTCGGACCT -3' (SEQ ID NO: 23)
5'-[PO4]GCCgacaaaaugcTATTGTTGGGGTAGTCGGACCT -3' Uppercase letters
with no underlining: Deoxyribonucleotides Lowercase letters:
2'O-Methyl nucleotide analogs Underlined uppercase letters:
Ribonucleotides
[0267] Exemplary first and second chimeric oligonucleotide probes
were designed similarly for .beta.-actin mRNA, which
target-specific portion is set forth in Example 3.
[0268] Following ligation, the ligated product contain a total of
0, 4, 8, 12, 16 or 20 2'-O-methyl nucleotides in two distal regions
of the target-specific portion of the ligated product. Chimeric
oligonucleotide probe sets (50 fmole each) were mixed with various
amounts of synthetic target RNA (0-1.times.10.sup.10 copies) having
a length of 25 ribonucleotides (the length of the target-detection
region) and carried through the protocol of Table 2. Each reaction
was performed in quadruplicate.
[0269] QRT-PCR results using the exemplary GUSB chimeric
oligonucleotide probes are provided by FIG. 12A and for the
.beta.-actin chimeric oligonucleotide probes in FIG. 12B.
Increasing the number of 2'-O-methyl nucleotides in the probes
decreased the Ct values for both probe sets. A decrease in Ct value
reflects a greater ability to detect target.
[0270] The data of FIG. 12A and FIG. 12B demonstrate that probes
having six nucleotide analogs within each of the first and second
probes proximal to each primer-specific portion appear to provide
the least amount of background while providing desired detection.
As the number of nucleotide analogs was increased beyond six,
background appears to increasingly contribute to loss of
specificity. As the number of nucleotide analogs was decreased to
below six, efficacy of detection appears to decrease.
EXAMPLE 6
Single Nucleotide Polymorphism Detection
[0271] The ligation-enhanced nucleic acid detection assay is also
useful for SNP detection. The set of GUSB first and second chimeric
oligonucleotide probes of Example 5 having six nucleotide analogs
proximal to each primer-specific portion was used in a test
detection of a single nucleotide polymorphism present in two
different locations of both a synthetic DNA target nucleic acid
(total length=25 nucleotides) and a synthetic RNA target nucleic
acid (total length=25 nucleotides).
[0272] The first test location for a single nucleotide polymorphism
was termed SNP1 and the test nucleotide was positioned to be the
3'-terminal nucleotide of the target-specific portion of the first
chimeric oligonucleotide probe. The SNP1 test position examined the
differential ability of ligase to ligate a perfect match verses a
mismatch at the 3'-terminal position of the first chimeric
oligonucleotide probe when the probes were annealed to the
target.
[0273] The second test location for a single nucleotide
polymorphism was termed SNP2 and the test nucleotide was positioned
to be the 5'-terminal nucleotide of the target-specific portion of
the second chimeric oligonucleotide probe. The SNP2 test position
examined the differential ability of ligase to ligate a perfect
match verses a mismatch at the 5'-terminal position of the second
chimeric oligonucleotide probe when the probes were annealed to the
target.
TABLE-US-00008 GUSB Ligated Product Showing Sequence of
Target-Specific Portions: (SEQ ID NO: 24)
Primer-guaccaCACCCAGCCGACAaaaugc-Primer .dwnarw..dwnarw. DNA (SEQ
ID NO: 25): 3'- CATGGTGTGGGTCGGCTGTTTTACG -5' SNP1 DNA (SEQ ID NO:
26): 3'- CATGGTGTGGGACGGCTGTTTTACG -5' SNP2 DNA (SEQ ID NO: 27):
3'- CATGGTGTGGGT GGCTGTTTTACG -5' RNA (SEQ ID NO: 28): 3'-
CAUGGUGUGGGUCGGCUGUUUUACG -5' Single nucleotide polymorphisms and
SNP-detector nucleotides are in bold text SNP nucleotides are in
italics
[0274] The nucleotide sequence of the target-specific portions of
the ligated product for GUSB target nucleic acid is shown below
aligned with corresponding target nucleic acid, mismatched target
nucleic acid SNP1, and mismatched target nucleic acid SNP2
sequences. For each sequence, the two nucleotides in bold represent
the 3' nucleotide of the first chimeric oligonucleotide probe and
the 5'-nucleotide of the second chimeric oligonucleotide probe,
respectively. An italicized nucleotide represents a base pair
mismatch with the nucleotide sequence of the ligated product.
[0275] In a further study, the exemplary .beta.-actin chimeric
oligonucleotide probe set of Example 3, having six nucleotide
analogs proximal to each primer-specific portion, was used in a
test detection of a single nucleotide polymorphism present in two
different locations of both a synthetic DNA target nucleic acid
(total length=25 nucleotides) and a synthetic RNA target nucleic
acid (total length=25 nucleotides).
[0276] The nucleotide sequence of the target-specific portions of
the ligated product for .beta.-actin target nucleic acid is shown
below aligned with corresponding target nucleic acid, mismatched
target nucleic acid SNP1, and mismatched target nucleic acid SNP2.
For each nucleic acid sequence, the two nucleotides in bold
represent the 3' nucleotide of the first chimeric oligonucleotide
probe and the 5'-nucleotide of the second chimeric oligonucleotide
probe, respectively. An italicized nucleotide represents a base
pair mismatch with the nucleotide sequence of the ligated
product.
TABLE-US-00009 Beta-Actin Ligated Product Showing Sequence of
Target-Specific Portions: (SEQ ID NO: 29) 5'
Primer-uaggauGGCAAGGGACUUCcuguaa-Primer .dwnarw..dwnarw. DNA (SEQ
ID NO: 30): 3'- ATCCTACCGTTCCCTGAAGGACATT -5' SNP1 DNA (SEQ ID NO:
31): 3'- ATCCTACCGTT CCTGAAGGACATT -5' SNP2 DNA (SEQ ID NO: 32):
3'- ATCCTACCGTTC CTGAAGGACATT -5' RNA (SEQ ID NO: 33): 3'-
AUCCUACCGUUCCCUGAAGGACAUU -5' Single nucleotide polymorphisms and
SNP-detector nucleotides are in bold text SNP nucleotides are in
italics
[0277] For each of the GUSB SNP target nucleic acid and the
.beta.-actin SNP target nucleic acid studies, the set of chimeric
oligonucleotide probes was diluted to a concentration of 50
fmol/.mu.l in nuclease-free water. For comparison, the studies were
carried out separately with and without the addition of the RNase
cocktail. The first and second PCR primers were as for Example 3.
The detector probe (TAQMAN.RTM. probe) for .beta.-actin SNP target
nucleic acid was as for Example 3. The detector probe (TAQMAN.RTM.
probe) for detection of GUSB SNP target nucleic acid had the
sequence:
TABLE-US-00010 GUSB DETECTOR PROBE: (SEQ ID NO: 34) 6FAM .TM.
dye-TACCACACCCAGCCG-BHQ .TM. dye-MGB.
[0278] Results regarding detection of SNP1 and SNP2 mismatched
nucleic acids as compared to matched nucleic acids in both RNA and
DNA .beta.-actin nucleic acid targets are provided by FIG. 13A and
FIG. 13B. The data of FIG. 13A demonstrated that without ligase or
without target nucleic acid, no product is identified. Detection of
matched nucleic acids was readily observed at a copy number of
1.times.10.sup.5 and detection of DNA target nucleic acid occurred
more readily than detection of RNA target nucleic acid. The
mismatched .beta.-actin target nucleic acid was not detected at
that copy number. At a copy number of 1.times.10.sup.7, the
mismatched target nucleic acids were readily detected and were
readily differentiated from matched target nucleic acids. A
difference in cycle threshold of about 9.5 Ct's and 6.5 Ct's was
observed between matched nucleic acids and the SNP1 mismatched
nucleic acids and between matched nucleic acids and the SNP2
mismatched nucleic acids, respectively. The difference between the
results with the SNP1 and SNP2 mismatched nucleic acids
demonstrated that the more sensitive position for designing an SNP
probe is for the mismatch to be positioned at the 3'-terminal
nucleotide of the first chimeric oligonucleotide probe.
[0279] The data of FIG. 13B provide results of assays where RNase
was not added to an embodiment of the ligation-enhanced SNP
detection assay. Since the synthetic target nucleic acids in this
study had a length equal to the length of the ligated product of
the chimeric oligonucleotide probes, there were no single-stranded
target nucleic acid ends to contribute lack of specificity.
However, RNase removed ribonucleotide ends of probes that were not
annealed and background signal was reduced. Without RNase, ligated
products were detected even in the absence of target nucleic acid
and absence of ligase, possibly due to non-specific ligation of
non-duplexed single-stranded molecules or to formation of a duplex
between the detector probe (TAQMAN.RTM. probe) and the
single-stranded probes thereby providing amplification substrates.
These results demonstrated a contribution of RNase to the SNP
target nucleic acid detection embodiments.
[0280] Results regarding detection of SNP1 and SNP2 mismatched
nucleic acids as compared to matched nucleic acids in both RNA and
DNA GUSB nucleic acid targets are provided by FIG. 13C and FIG.
13D. The data of FIG. 13C demonstrated that without ligase or
without target nucleic acid, no product was identified. Detection
of matched nucleic acids was readily observed at a copy number of
1.times.10.sup.5 and detection of DNA target nucleic acid occurred
more readily than detection of RNA target nucleic acid. In contrast
to the results with .beta.-actin target nucleic acid embodiments,
the SNP2 GUSB target nucleic acid was detected at that copy number.
At a copy number of 1.times.10.sup.7, the mismatched target nucleic
acids were readily detected and a differential was observed in Ct
between the SNP mismatched target nucleic acid embodiments and
matched target nucleic acid embodiments. Similar to the results for
the .beta.-actin target nucleic acid embodiments, the SNP1
mismatched target nucleic acid embodiment provided a greater Ct
difference between matched target nucleic acids and mismatched
target nucleic acids.
[0281] The data of FIG. 13D provide results of GUSB SNP target
nucleic acid assay embodiments in the absence of RNase. The data of
FIG. 13D indicated that RNase removed the ends of single-stranded
chimeric oligonucleotide probes that are not annealed since
background signal was reduced. Without RNase, ligated products were
detected even in the absence of target nucleic acid and in the
absence of ligase. A Ct differential for matched target nucleic
acid verses mismatched nucleic acid was observed at a target
nucleic acid copy number of 1.times.10.sup.7, the same copy number
as for the study with RNase.
[0282] The compositions, methods, and kits of the current teachings
have been described broadly and generically herein. Each of the
narrower species and sub-generic groupings falling within the
generic disclosure also form part of the current teachings. This
includes the generic description of the current teachings with a
proviso or negative limitation removing any subject matter from the
genus, regardless of whether or not the excised material is
specifically recited herein.
[0283] Although the disclosed teachings have been described with
reference to various applications, methods, and compositions, it
will be appreciated that various changes and modifications can be
made without departing from the teachings herein. The foregoing
examples are provided to better illustrate the present teachings
and are not intended to limit the scope of the teachings herein.
Certain aspects of the present teachings can be further understood
in light of the following claims.
Sequence CWU 1
1
34135DNAArtificialSynthetic DNA 1gctcacctta acgtagagtc tgcuaggaug
gcaag 35235DNAArtificialSynthetic DNA/RNA 2ggacuuccug uaatattgtt
ggggtagtcg gacct 35323DNAArtificialSynthetic DNA 3gctcacctta
acgtagagtc tgc 23423DNAArtificialSynthetic DNA 4aggtccgact
accccaacaa tat 23515DNAArtificialSynthetic DNA 5taggatggca aggga
15635DNAArtificialSynthetic DNA/RNA 6gctcacctta acgtagagtc
tgcggcuggc gacgc 35735DNAArtificialSynthetic DNA/RNA 7aaaagaagau
gcgtattgtt ggggtagtcg gacct 35835DNAArtificialSynthetic DNA/RNA
8gctcacctta acgtagagtc tgcucagugg cacca 35935DNAArtificialSynthetic
DNA/RNA 9accgauccaa agutattgtt ggggtagtcg gacct
351014DNAArtificialSynthetic DNA 10ctggcgacgc aaaa
141115DNAArtificialSynthetic DNA 11tcagtggcac caacc
151235DNAArtificialSynthetic DNA/RNA 12gctcacctta acgtagagtc
tgcguaccac accca 351335DNAArtificialSynthetic DNA/RNA 13gctcacctta
acgtagagtc tgcguaccac accca 351435DNAArtificialSynthetic DNA/RNA
14gctcacctta acgtagagtc tgcguaccac accca
351535DNAArtificialSynthetic DNA/RNA 15gctcacctta acgtagagtc
tgcguaccac accca 351635DNAArtificialSynthetic DNA/RNA 16gctcacctta
acgtagagtc tgcguaccac accca 351735DNAArtificialSynthetic DNA/RNA
17gctcacctta acgtagagtc tgcguaccac accca
351835DNAArtificialSynthetic DNA/RNA 18gccgacaaaa ugctattgtt
ggggtagtcg gacct 351935DNAArtificialSynthetic DNA 19gccgacaaaa
ugctattgtt ggggtagtcg gacct 352035DNAArtificialSynthetic DNA/RNA
20gccgacaaaa ugctattgtt ggggtagtcg gacct
352135DNAArtificialSynthetic DNA 21gccgacaaaa ugctattgtt ggggtagtcg
gacct 352235DNAArtificialSynthetic DNA/RNA 22gccgacaaaa ugctattgtt
ggggtagtcg gacct 352335DNAArtificialSynthetic DNA/RNA 23gccgacaaaa
ugctattgtt ggggtagtcg gacct 352425RNAArtificialSynthetic RNA
24guaccacacc cagccgacaa aaugc 252525DNAArtificialSynthetic DNA
25gcattttgtc ggctgggtgt ggtac 252625DNAArtificialSynthetic DNA
26gcattttgtc ggcagggtgt ggtac 252725DNAArtificialSynthetic DNA
27gcattttgtc gggtgggtgt ggtac 252825RNAArtificialSynthetic RNA
28gcauuuuguc ggcugggugu gguac 252925RNAArtificialSynthetic RNA
29uaggauggca agggacuucc uguaa 253025DNAArtificialSynthetic DNA
30ttacaggaag tcccttgcca tccta 253125DNAArtificialSynthetic DNA
31ttacaggaag tccgttgcca tccta 253225DNAArtificialSynthetic DNA
32ttacaggaag tcgcttgcca tccta 253325RNAArtificialSynthetic RNA
33uuacaggaag ucccuugcca uccua 253415DNAArtificialSynthetic DNA
34taccacaccc agccg 15
* * * * *