U.S. patent application number 13/274054 was filed with the patent office on 2012-03-15 for novel target for regulating multiple sclerosis.
Invention is credited to Eugene C. Butcher, Kareem Graham, Brian A. Zabel.
Application Number | 20120064092 13/274054 |
Document ID | / |
Family ID | 41267041 |
Filed Date | 2012-03-15 |
United States Patent
Application |
20120064092 |
Kind Code |
A1 |
Graham; Kareem ; et
al. |
March 15, 2012 |
Novel Target for Regulating Multiple Sclerosis
Abstract
Methods are provided for decreasing demyelinating inflammatory
disease in a subject by inhibiting the activity of chemokine-like
receptor 1 (CMKLR1). Methods are also provided for screening for
agents that find use in treating demyelinating inflammatory disease
in a subject.
Inventors: |
Graham; Kareem; (Mountain
View, CA) ; Zabel; Brian A.; (Redwwod City, CA)
; Butcher; Eugene C.; (Portola Valley, CA) |
Family ID: |
41267041 |
Appl. No.: |
13/274054 |
Filed: |
October 14, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12463840 |
May 11, 2009 |
8038992 |
|
|
13274054 |
|
|
|
|
61052189 |
May 10, 2008 |
|
|
|
Current U.S.
Class: |
424/158.1 ;
435/29; 435/7.1; 506/10; 514/44A |
Current CPC
Class: |
C12N 15/1138 20130101;
G01N 33/5058 20130101; A61P 29/00 20180101; C07K 2317/76 20130101;
C07K 16/2866 20130101; C12N 2330/51 20130101; C12N 2310/14
20130101; G01N 33/5029 20130101; C12N 2310/531 20130101; G01N
2800/285 20130101 |
Class at
Publication: |
424/158.1 ;
514/44.A; 435/29; 506/10; 435/7.1 |
International
Class: |
A61K 39/395 20060101
A61K039/395; G01N 33/53 20060101 G01N033/53; C12Q 1/02 20060101
C12Q001/02; C40B 30/06 20060101 C40B030/06; A61K 31/713 20060101
A61K031/713; A61P 29/00 20060101 A61P029/00 |
Goverment Interests
FEDERALLY-SPONSORED RESEARCH OR DEVELOPMENT
[0001] This invention was made with Government support under
contract AI059635 awarded by the National Institutes of Health. The
Government has certain rights in this invention.
Claims
1. A method of decreasing demyelinating inflammatory disease in a
subject, the method comprising: administering to said subject an
effective amount of a chemokine-like receptor 1 (CMKLR1)
antagonist.
2. The method of claim 1, wherein said CMKLR1 antagonist binds to
CMKLR1.
3. The method of claim 2, wherein said CMKLR1 antagonist comprises
a natural or altered domain derived from a natural ligand of
CMKLR1.
4. The method of claim 1, wherein said CMKLR1 antagonist is a
polypeptide.
5. The method of claim 4, wherein said polypeptide is an antibody
or antigen binding fragment thereof.
6. The method of claim 1, wherein said CMKLR1 modulatory agent is
an siRNA.
7. The method of claim 1, wherein said antagonizing agent inhibits
ligand-induced signaling from CMKLR1 in a cell.
8. The method of claim 1, wherein said antagonizing agent reduces
the expression of CMKLR1 in a cell.
9. The method of claim 1, wherein said antagonizing agent inhibits
transcription of CMKLR1.
10. A method of screening for an agent that decreases demyelinating
inflammatory disease in a subject, said method comprising:
contacting said agent to a cell expressing CMKLR1; and evaluating
whether said agent antagonizes CMKLR1 activity.
11. The method of claim 10, wherein said CMKLR1 activity is
selected from the group consisting of: chemotaxis, activation of a
signaling pathway component, activation of gene or reporter gene
expression, and expression of CMKLR1.
12. The method of claim 10, wherein said method is a high
throughput screening method.
13. The method of claim 10, wherein said cell naturally expresses
CMKLR1 or is genetically engineered to express CMKLR1.
14. The method of claim 10, further comprising validating said
agent as a demyelinating inflammatory disease regulator in an
animal model.
Description
INTRODUCTION
[0002] Human chemokine-like receptor-1 (CMKLR1), a recently
de-orphaned G-protein-coupled receptor (GPCR), is specifically
expressed on in vitro monocyte-derived dendritic cells, ex vivo
macrophages, and circulating plasmacytoid dendritic cells (pDCs)
[Zabel, et al. J Immunol (2005) 174(1):244-51; Vermi, et al. J Exp
Med (2005) 201(4):509-15]. The natural ligand for CMKLR1, chemerin,
was recently discovered [Zabel, et al. J Immunol (2005)
174(1):244-51; Wittamer, V., et al., J Exp Med (2003) 198(7):
977-85; Meder, W., et al., FEBS Lett (2003) 555(3):495-9.].
Chemerin has been isolated from ascitic fluid (ovarian carcinoma),
inflamed synovial fluid, hemofiltrate, and normal serum [Zabel, et
al. J Immunol (2005) 174(1):244-51; Wittamer, V., et al., J Exp Med
(2003) 198(7): 977-85; Meder, W., et al., FEBS Lett (2003)
555(3):495-9.]. Chemerin, a heparin binding protein, initially
exists in its pro-form, which is 163 amino acids long. Cleavage of
pro-chemerin by serine proteases of inflammatory, coagulation, and
fibrinolytic cascades results in the loss of the last 6-11
C-terminal amino acids. This proteolytic cleavage, which can be at
a number of different sites in pro-chemerin, generates active
chemerin and leads to a potent increase in ligand activity. This
results in the increased migration of CMKLR1 bearing cells (e.g.,
macrophages) to chemerin [Wittamer, V., et al., J Immunol (2005)
175(1):487-93, Zabel, B. A., et al., J Biol Chem (2005) 280(41):
34661-6]. Chemerin thus acts as a macrophage and dendritic cell
(DC) recruiting factor through its interaction with CMKLR1.
[0003] While CMKLR1 does not bind to chemokines, it has been
reported that resolvin E1 (RvE1), a bioactive lipid generated upon
aspirin-triggered enzymatic processing of omega-3 fatty acids, is a
lipid ligand for CMKLR1 [Hasturk, et al. FASEB J. (2006)
20(2):40'-3; Serhan Prostaglandins Leukot Essent Fatty Acids.
(2005) 73(3-4):141-62].
Relevant Literature
[0004] The use of small molecules to block chemoattractant
receptors is reviewed by Baggiolini and Moser (1997) J. Exp. Med.
186:1189-1191.
[0005] The sequence of chemerin (retinoic acid receptor responder 2
(RARRES2) II; tazarotene induced gene 2 product (TIG2)) may be
found in Genbank, accession number NM.sub.--002889. The sequence of
CMKLR1 may be found in Genbank, accession number Y14838, and is
described by Samson et al. (1998) Eur J. Immunol. 28(5):1689-700.
The sequence of a CMKLR1 ligand, mammalian chemerin, may be found
in Genbank, accession number NM.sub.--002889.
SUMMARY OF THE INVENTION
[0006] The present invention is drawn to methods for decreasing
demyelinating inflammatory disease in a subject by administering
agents that decrease CMKLR1 activity. The therapeutic methods of
the invention are useful for the treatment or prevention of MS and
other diseases, e.g. experimental animal models such as
experimental autoimmune encephalomyelitis (EAE). Inhibitors of
CMKLR1 include, but are not limited to, agents that interfere with
the interaction of CMKLR1 with its natural ligands, agents that
reduce CMKLR1 expression (e.g., by reducing transcription or by
inducing cell surface receptor desensitization and/or
internalization), agents that reduce expression of endogenous
ligands of CMKLR1, and agents that inhibit intracellular signals
initiated by the binding of CMKLR1 with its ligands. Inhibitors
include, without limitation, monoclonal antibodies, small
molecules, chimeric proteins/peptides, bioactive peptides, and
interfering RNA.
[0007] The present invention is also drawn to methods of screening
for agents that can decrease demyelinating inflammatory disease
when administered to a subject. In general, the screening method is
designed to determine whether an agent can antagonize CMKLR1
activity in a cell. In certain embodiments, a cell expressing
CMKLR1 (e.g., cells that normally express CMKLR1 or those that are
genetically engineered to express CMKLR1) is contacted to a
candidate agent and its response to a CMKLR1 ligand(s) is evaluated
(e.g., chemotaxis, receptor/ligand binding, target gene expression,
signaling responses, etc.). In certain other embodiments, a cell
expressing CMKLR1 or a ligand is contacted to an agent and the
expression level of CMKLR1 or its ligand is evaluated.
BRIEF DESCRIPTION OF THE DRAWINGS
[0008] FIG. 1. Clinical EAE in CMKLR1 KO mice. EAE was induced by
active immunization and mice were monitored daily for clinical
disease. Data are pooled from five independent experiments and are
presented as mean clinical.+-.s.e.m. versus time
[0009] FIG. 2. Detection of CMKLR1.sup.+ dendritic cells and
microglia in the central nervous system (CNS) of mice with EAE.
Mononuclear cells were isolated from the spinal cords of 3 mice
with acute EAE and pooled for analysis.
CD45.sup.hiCD3.sup.-CD19.sup.- cells were analyzed for expression
of CD11b, CD11c, and B220. CD11c.sup.hiCD11b.sup.+B220.sup.- mDC
expressed CMKLR1 while CD11c.sup.intCD11 b.sup.-B220.sup.+ pDC were
CMKLR1-negative. CD3.sup.-CD19.sup.-CD11b.sup.+CD45.sup.lo
microglia expressed mCMKLR1. A representative data set of three
independent experiments with similar results is shown.
[0010] FIG. 3. anti-mCMKLR1 mAbs block chemerin-mediated chemotaxis
in vitro.
DESCRIPTION OF THE SPECIFIC EMBODIMENTS
[0011] As summarized above, the present invention is drawn to
methods for treating demyelinating inflammatory disease in a
subject by administering an agent that antagonizes the activity of
chemokine-like receptor 1 (CMKLR1) and/or a CMKLR1 ligand (e.g.,
chemerin or other endogenous CMKLR1 ligands. As such, the methods
of the invention find use in treating EAE or MS in a subject.
Methods of screening for agents that regulate demyelinating
inflammatory disease are also provided.
[0012] Before the present invention is described in greater detail,
it is to be understood that this invention is not limited to
particular embodiments described, as such may vary. It is also to
be understood that the terminology used herein is for the purpose
of describing particular embodiments only, and is not intended to
be limiting, since the scope of the present invention will be
limited only by the appended claims.
[0013] Where a range of values is provided, it is understood that
each intervening value, to the tenth of the unit of the lower limit
unless the context clearly dictates otherwise, between the upper
and lower limit of that range and any other stated or intervening
value in that stated range, is encompassed within the invention.
The upper and lower limits of these smaller ranges may
independently be included in the smaller ranges and are also
encompassed within the invention, subject to any specifically
excluded limit in the stated range. Where the stated range includes
one or both of the limits, ranges excluding either or both of those
included limits are also included in the invention.
[0014] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
any methods and materials similar or equivalent to those described
herein can also be used in the practice or testing of the present
invention, representative illustrative methods and materials are
now described.
[0015] All publications and patents cited in this specification are
herein incorporated by reference as if each individual publication
or patent were specifically and individually indicated to be
incorporated by reference and are incorporated herein by reference
to disclose and describe the methods and/or materials in connection
with which the publications are cited. The citation of any
publication is for its disclosure prior to the filing date and
should not be construed as an admission that the present invention
is not entitled to antedate such publication by virtue of prior
invention. Further, the dates of publication provided may be
different from the actual publication dates which may need to be
independently confirmed.
[0016] It is noted that, as used herein and in the appended claims,
the singular forms "a", "an", and "the" include plural referents
unless the context clearly dictates otherwise. It is further noted
that the claims may be drafted to exclude any optional element. As
such, this statement is intended to serve as antecedent basis for
use of such exclusive terminology as "solely," "only" and the like
in connection with the recitation of claim elements, or use of a
"negative" limitation.
[0017] As will be apparent to those of skill in the art upon
reading this disclosure, each of the individual embodiments
described and illustrated herein has discrete components and
features which may be readily separated from or combined with the
features of any of the other several embodiments without departing
from the scope or spirit of the present invention. Any recited
method can be carried out in the order of events recited or in any
other order which is logically possible.
[0018] "Activity" of CMKLR1 shall mean any signaling or binding
function performed by that protein.
[0019] "Antibody" shall include, by way of example, both naturally
occurring and non-naturally occurring antibodies. Specifically,
this term includes polyclonal and monoclonal antibodies, and
fragments thereof. Furthermore, this term includes chimeric
antibodies and wholly synthetic antibodies, and fragments thereof.
Monoclonal antibodies are provided that bind to CMKLR1 and block
its activity. In some embodiments the antibody binds to the epitope
that is bound by the monoclonal antibody BZ186. The hybridoma cell
line producing BZ186 may be obtained from the American Type Culture
Collection, deposit ______. In other embodiments the monoclonal
antibody binds to human counterpart of the epitope recognized by
BZ186.
[0020] "Anti-sense nucleic acid" shall mean any nucleic acid which,
when introduced into a cell, specifically hybridizes to at least a
portion of an mRNA in the cell encoding a protein ("target
protein") whose expression is to be inhibited, and thereby inhibits
the target protein's expression.
[0021] "Comparable cell" shall mean a cell whose type is identical
to that of another cell to which it is compared. Examples of
comparable cells are cells from the same cell line.
[0022] "Expressible nucleic acid" shall mean a nucleic acid
encoding a nucleic acid of interest and/or a protein of interest,
which nucleic acid is an expression vector, plasmid or other
construct which, when placed in a cell, permits the expression of
the nucleic acid or protein of interest. Expression vectors and
plasmids are well known in the art.
[0023] "Inhibiting" the onset of a disorder shall mean either
lessening the likelihood of the disorders onset, or preventing the
onset of the disorder entirely. In the preferred embodiment,
inhibiting the onset of a disorder means preventing its onset
entirely. As used herein, onset may also refer to deterioration in
a patient that has chronic/progressive disease, or relapse in a
patient that has ongoing relapsing-remitting disease.
[0024] The methods of the invention may be specifically applied to
individuals that have been diagnosed with an autoimmune disease,
e.g. a chronic/progressive or relapsing-remitting disease such as
MS or EAE. Treatment is aimed at the treatment or prevention of
relapses, which are an exacerbation of a pre-existing
condition.
[0025] "Inhibiting" the expression of a gene in a cell shall mean
either lessening the degree to which the gene is expressed, or
preventing such expression entirely.
[0026] "Nucleic acid" shall mean any nucleic acid molecule,
including, without limitation, DNA, RNA and hybrids thereof. The
nucleic acid bases that form nucleic acid molecules can be the
bases A, C, G, T and U, as well as derivatives thereof. Derivatives
of these bases are well known in the art, and are exemplified in
PCR Systems, Reagents and Consumables (Perkin Elmer Catalogue
1996-1997, Roche Molecular Systems, Inc., Branchburg, N.J.,
USA).
[0027] Active fragments of CMKLR1 share a functional or binding
property with full length CMKLR1.
[0028] Epitopic fragments of CMKLR1 bind to a monoclonal antibody
that binds to full length CMKLR1, including native or denatured
forms of the protein.
[0029] "Specifically hybridize" to a nucleic acid shall mean, with
respect to a first nucleic acid, that the first nucleic acid
hybridizes to a second nucleic acid with greater affinity than to
any other nucleic acid.
[0030] "Specifically inhibit" the expression of a protein shall
mean to inhibit that protein's expression or activity (a) more than
the expression or activity of any other protein, or (b) more than
the expression or activity of all but 10 or fewer other
proteins.
[0031] "Subject" or "patient" shall mean any animal, such as a
human, non-human primate, mouse, rat, guinea pig or rabbit.
[0032] "Suitable conditions" shall have a meaning dependent on the
context in which this term is used. That is, when used in
connection with an antibody, the term shall mean conditions that
permit an antibody to bind to its corresponding antigen. When this
term is used in connection with nucleic acid hybridization, the
term shall mean conditions that permit a nucleic acid of at least
15 nucleotides in length to hybridize to a nucleic acid having a
sequence complementary thereto. When used in connection with
contacting an agent to a cell, this term shall mean conditions that
permit an agent capable of doing so to enter a cell and perform its
intended function. In one embodiment, the term "suitable
conditions" as used herein means physiological conditions.
[0033] "Treating" a disorder shall mean slowing, stopping or
reversing the disorders progression. In the preferred embodiment,
treating a disorder means reversing the disorders progression,
ideally to the point of eliminating the disorder itself. As used
herein, ameliorating a disorder and treating a disorder are
equivalent.
[0034] The term "immune" response is the development of a
beneficial humoral (antibody mediated) and/or a cellular (mediated
by antigen-specific T cells or their secretion products) response
directed against CMKLR1 in a recipient patient. Such a response can
be an active response induced by an "immunogen" that is capable of
inducing an immunological response against itself on administration
to a mammal, optionally in conjunction with an adjuvant.
Methods of the Invention
[0035] The present invention provides methods for treating
autoimmune disease, including inflammatory demyelinating diseases,
such multiple sclerosis; etc. These methods comprise administering
to the subject having an autoimmune condition, e.g. a demyelinating
condition; an effective amount of an inhibitor of CMKLR1.
[0036] In some embodiments, a method is provided for inhibiting
autoimmune diseases in a subject, the method comprising
administering to the subject a prophylactically effective amount of
a nucleic acid that specifically reduces levels of CMKLR1, e.g. an
anti-sense oligonucleotide, siRNA, and the like.
[0037] In other embodiments, a method is provided for inhibiting
inflammatory demyelinating disease in a subject, the method
comprising administering to the subject a therapeutically effective
amount of an anti-CMKLR1 antibody or antigen-binding portion
thereof.
[0038] In other embodiments, the method comprising administering to
said subject an agent that downregulates the expression, or
inhibits the activity of, a ligand of CMKLR1, which ligand
includes, without limitation, chemerin. In these methods, the
CMKLR1-expressing cell can be, without limitation, a macrophage; a
dendritic cell; or a microglial cell.
[0039] This invention can utilize a method for reducing the amount
of CMKLR1 in a CMKLR1-expressing cell comprising introducing into
the cell a nucleic acid which specifically inhibits CMKLR1
expression in the cell. In one embodiment, this method further
reduces the amount of CMKLR1 secreted by a CMKLR1-secreting cell.
In this method, the nucleic acid can be, for example, DNA or RNA.
In addition, the nucleic acid can be an anti-sense nucleic acid
that hybridizes to CMKLR1-encoding mRNA, an siRNA that inhibits
CMKLR1 expression, or a catalytic nucleic acid that cleaves
CMKLR1-encoding mRNA. CMKLR1 expression can also be inhibited using
zinc finger proteins or nucleic acids encoding the same as
described in WO 00100409. Alternatively, inhibition of expression
can be achieved using siRNAs as described by WO 99132619, Elbashir,
EMBO J. 20, 6877-6888 (2001) and Nykanen et al., Cell 107, 309-321
(2001); WO 01129058.
[0040] The antisense reagent may be antisense oligonucleotides
(ODN), particularly synthetic ODN having chemical modifications
from native nucleic acids, or nucleic acid constructs that express
such antisense molecules as RNA. The antisense sequence is
complementary to the targeted miRNA, and inhibits its expression.
One or a combination of antisense molecules may be administered,
where a combination may comprise multiple different sequences.
[0041] Antisense molecules may be produced by expression of all or
a part of the target miRNA sequence in an appropriate vector, where
the transcriptional initiation is oriented such that an antisense
strand is produced as an RNA molecule. Alternatively, the antisense
molecule is a synthetic oligonucleotide. Antisense oligonucleotides
will generally be at least about 7, usually at least about 12, more
usually at least about 20 nucleotides in length, and not more than
about 25, usually not more than about 23-22 nucleotides in length,
where the length is governed by efficiency of inhibition,
specificity, including absence of cross-reactivity, and the
like.
[0042] Antisense oligonucleotides may be chemically synthesized by
methods known in the art (see Wagner et al. (1993) supra. and
Milligan et al., supra.) Preferred oligonucleotides are chemically
modified from the native phosphodiester structure, in order to
increase their intracellular stability and binding affinity. A
number of such modifications have been described in the literature
that alter the chemistry of the backbone, sugars or heterocyclic
bases.
[0043] Among useful changes in the backbone chemistry are
phosphorothioates; phosphorodithioates, where both of the
non-bridging oxygens are substituted with sulfur;
phosphoroamidites; alkyl phosphotriesters and boranophosphates.
Achiral phosphate derivatives include 3'-O'-5'-S-phosphorothioate,
3'-S-5'-O-phosphorothioate, 3'-CH2-5'-O-phosphonate and
3'-NH-5'-O-phosphoroamidate. Peptide nucleic acids replace the
entire ribose phosphodiester backbone with a peptide linkage. Sugar
modifications are also used to enhance stability and affinity. The
alpha.-anomer of deoxyribose may be used, where the base is
inverted with respect to the natural .beta.-anomer. The 2'-OH of
the ribose sugar may be altered to form 2'-O-methyl or 2'-O-allyl
sugars, which provides resistance to degradation without comprising
affinity. Modification of the heterocyclic bases must maintain
proper base pairing. Some useful substitutions include deoxyuridine
for deoxythymidine; 5-methyl-2'-deoxycytidine and
5-bromo-2'-deoxycytidine for deoxycytidine.
5-propynyl-2'-deoxyuridine and 5-propynyl-2'-deoxycytidine have
been shown to increase affinity and biological activity when
substituted for deoxythymidine and deoxycytidine, respectively.
[0044] Anti-sense molecules of interest include antagomir RNAs,
e.g. as described by Krutzfeldt et al., supra., herein specifically
incorporated by reference. Small interfering double-stranded RNAs
(siRNAs) engineered with certain `drug-like` properties such as
chemical modifications for stability and cholesterol conjugation
for delivery have been shown to achieve therapeutic silencing of an
endogenous gene in vivo. To develop a pharmacological approach for
silencing miRNAs in vivo, chemically modified,
cholesterol-conjugated single-stranded RNA analogues complementary
to miRNAs were developed, termed `antagomirs`. Antagomir RNAs may
be synthesized using standard solid phase oligonucleotide synthesis
protocols. The RNAs are conjugated to cholesterol, and may further
have a phosphorothioate backbone at one or more positions.
[0045] Also of interest in certain embodiments are RNAi agents. In
representative embodiments, the RNAi agent targets the precursor
molecule of the microRNA, known as pre-microRNA molecule. By RNAi
agent is meant an agent that modulates expression of microRNA by a
RNA interference mechanism. The RNAi agents employed in one
embodiment of the subject invention are small ribonucleic acid
molecules (also referred to herein as interfering ribonucleic
acids), i.e., oligoribonucleotides, that are present in duplex
structures, e.g., two distinct oligoribonucleotides hybridized to
each other or a single ribooligonucleotide that assumes a small
hairpin formation to produce a duplex structure. By
oligoribonucleotide is meant a ribonucleic acid that does not
exceed about 100 nt in length, and typically does not exceed about
75 nt length, where the length in certain embodiments is less than
about 70 nt. Where the RNA agent is a duplex structure of two
distinct ribonucleic acids hybridized to each other, e.g., an
siRNA, the length of the duplex structure typically ranges from
about 15 to 30 bp, usually from about 15 to 29 bp, where lengths
between about 20 and 29 bps, e.g., 21 bp, 22 bp, are of particular
interest in certain embodiments. Where the RNA agent is a duplex
structure of a single ribonucleic acid that is present in a hairpin
formation, i.e., a shRNA, the length of the hybridized portion of
the hairpin is typically the same as that provided above for the
siRNA type of agent or longer by 4-8 nucleotides. The weight of the
RNAi agents of this embodiment typically ranges from about 5,000
daltons to about 35,000 daltons, and in many embodiments is at
least about 10,000 daltons and less than about 27,500 daltons,
often less than about 25,000 daltons.
[0046] dsRNA can be prepared according to any of a number of
methods that are known in the art, including in vitro and in vivo
methods, as well as by synthetic chemistry approaches. Examples of
such methods include, but are not limited to, the methods described
by Sadher et al. (Biochem. Int. 14:1015, 1987); by Bhattacharyya
(Nature 343:484, 1990); and by Livache, et al. (U.S. Pat. No.
5,795,715), each of which is incorporated herein by reference in
its entirety. Single-stranded RNA can also be produced using a
combination of enzymatic and organic synthesis or by total organic
synthesis. The use of synthetic chemical methods enable one to
introduce desired modified nucleotides or nucleotide analogs into
the dsRNA. dsRNA can also be prepared in vivo according to a number
of established methods (see, e.g., Sambrook, et al. (1989)
Molecular Cloning: A Laboratory Manual, 2nd ed.; Transcription and
Translation (B. D. Hames, and S. J. Higgins, Eds., 1984); DNA
Cloning, volumes I and II (D. N. Glover, Ed., 1985); and
Oligonucleotide Synthesis (M. J. Gait, Ed., 1984, each of which is
incorporated herein by reference in its entirety).
[0047] In certain embodiments, instead of the RNAi agent being an
interfering ribonucleic acid, e.g., an siRNA or shRNA as described
above, the RNAi agent may encode an interfering ribonucleic acid,
e.g., an shRNA, as described above. In other words, the RNAi agent
may be a transcriptional template of the interfering ribonucleic
acid. In these embodiments, the transcriptional template is
typically a DNA that encodes the interfering ribonucleic acid. The
DNA may be present in a vector, where a variety of different
vectors are known in the art, e.g., a plasmid vector, a viral
vector, etc.
[0048] As indicated above, the antisense agent can be introduced
into the target cell(s) using any convenient protocol, where the
protocol will vary depending on whether the target cells are in
vitro or in vivo. A number of options can be utilized to deliver
the dsRNA into a cell or population of cells such as in a cell
culture, tissue, organ or embryo. For instance, RNA can be directly
introduced intracellularly. Various physical methods are generally
utilized in such instances, such as administration by
microinjection (see, e.g., Zernicka-Goetz, et al. (1997)
Development 124:1133-1137; and Wianny, et al. (1998) Chromosoma
107: 430-439). Other options for cellular delivery include
permeabilizing the cell membrane and electroporation in the
presence of the dsRNA, liposome-mediated transfection, or
transfection using chemicals such as calcium phosphate. A number of
established gene therapy techniques can also be utilized to
introduce the dsRNA into a cell. By introducing a viral construct
within a viral particle, for instance, one can achieve efficient
introduction of an expression construct into the cell and
transcription of the RNA encoded by the construct.
[0049] For example, the inhibitory agent can be fed directly to,
injected into, the host organism containing the target gene. The
agent may be directly introduced into the cell (i.e.,
intracellularly); or introduced extracellularly into a cavity,
interstitial space, into the circulation of an organism, introduced
orally, etc. Methods for oral introduction include direct mixing of
RNA with food of the organism. Physical methods of introducing
nucleic acids include injection directly into the cell or
extracellular injection into the organism of an RNA solution. The
agent may be introduced in an amount which allows delivery of at
least one copy per cell. Higher doses (e.g., at least 5, 10, 100,
500 or 1000 copies per cell) of the agent may yield more effective
inhibition; lower doses may also be useful for specific
applications.
[0050] When liposomes are utilized, substrates that bind to a
cell-surface membrane protein associated with endocytosis can be
attached to the liposome to target the liposome to macrophages or
dendritic cells and to facilitate uptake. Examples of proteins that
can be attached include capsid proteins or fragments thereof that
bind to macrophages or dendritic cells, antibodies that
specifically bind to cell-surface proteins on macrophages or
dendritic cells that undergo internalization in cycling and
proteins that target intracellular localizations within T cells.
Gene marking and gene therapy protocols are reviewed by Anderson et
al. (1992) Science 256:808-813.
[0051] In certain embodiments, a hydrodynamic nucleic acid
administration protocol is employed. Where the agent is a
ribonucleic acid, the hydrodynamic ribonucleic acid administration
protocol described in detail below is of particular interest. Where
the agent is a deoxyribonucleic acid, the hydrodynamic
deoxyribonucleic acid administration protocols described in Chang
et al., J. Virol. (2001) 75:3469-3473; Liu et al., Gene Ther.
(1999) 6:1258-1266; Wolff et al., Science (1990) 247: 1465-1468;
Zhang et al., Hum. Gene Ther. (1999) 10:1735-1737: and Zhang et
al., Gene Ther. (1999) 7:1344-1349; are of interest.
[0052] Additional nucleic acid delivery protocols of interest
include, but are not limited to: those described in U.S. patents of
interest include U.S. Pat. Nos. 5,985,847 and 5,922,687 (the
disclosures of which are herein incorporated by reference);
WO/11092; Acsadi et al., New Biol. (1991) 3:71-81; Hickman et al.,
Hum. Gen. Ther. (1994) 5:1477-1483; and Wolff et al., Science
(1990) 247: 1465-1468; etc.
[0053] In another embodiment, relapse of an autoimmune disease in a
subject is inhibited or prevented by administering to the subject a
prophylactically or therapeutically effective amount of an
anti-CMKLR1 antibody or antigen-binding portion thereof.
[0054] Determining a therapeutically or prophylactically effective
amount of the CMKLR1 inhibitor compositions can be done based on
animal data using routine computational methods. In one embodiment,
the therapeutically or prophylactically effective amount contains
between about 0.1 mg and about 1 g of nucleic acid or protein, as
applicable. In another embodiment, the effective amount contains
between about 1 mg and about 100 mg of nucleic acid or protein, as
applicable. In a further embodiment, the effective amount contains
between about 10 mg and about 50 mg of the nucleic acid or protein,
as applicable.
[0055] In this invention, administering the instant compositions
can be effected or performed using any of the various methods and
delivery systems known to those skilled in the art. The
administering can be performed, for example, intravenously, orally,
via implant, transmucosally, transdermally, intramuscularly,
intrathecally, and subcutaneously. The following delivery systems,
which employ a number of routinely used pharmaceutical carriers,
are only representative of the many embodiments envisioned for
administering the instant compositions.
[0056] Injectable drug delivery systems include solutions,
suspensions, gels, microspheres and polymeric injectables, and can
comprise excipients such as solubility-altering agents (e.g.,
ethanol, propylene glycol and sucrose) and polymers (e.g.,
polycaprylactones and PLGA's). Implantable systems include rods and
discs, and can contain excipients such as PLGA and
polycaprylactone. CMKLR1 or nucleic acids of the invention can also
be administered attached to particles using a gene gun.
[0057] Oral delivery systems include tablets and capsules. These
can contain excipients such as binders (e.g.,
hydroxypropylmethylcellulose, polyvinyl pyrilodone, other
cellulosic materials and starch), diluents (e.g., lactose and other
sugars, starch, dicalcium phosphate and cellulosic materials),
disintegrating agents (e.g., starch polymers and cellulosic
materials) and lubricating agents (e.g., stearates and talc).
[0058] Transmucosal delivery systems include patches, tablets,
suppositories, pessaries, gels and creams, and can contain
excipients such as solubilizers and enhancers (e.g., propylene
glycol, bile salts and amino acids), and other vehicles (e.g.,
polyethylene glycol, fatty acid esters and derivatives, and
hydrophilic polymers such as hydroxypropylmethylcellulose and
hyaluronic acid).
[0059] Dermal delivery systems include, for example, aqueous and
nonaqueous gels, creams, multiple emulsions, microemulsions,
liposomes, ointments, aqueous and nonaqueous solutions, lotions,
aerosols, hydrocarbon bases and powders, and can contain excipients
such as solubilizers, permeation enhancers (e.g., fatty acids,
fatty acid esters, fatty alcohols and amino acids), and hydrophilic
polymers (e.g., polycarbophil and polyvinylpyrolidone). In one
embodiment, the pharmaceutically acceptable carrier is a liposome
or a transdermal enhancer.
[0060] Solutions, suspensions and powders for reconstitutable
delivery systems include vehicles such as suspending agents (e.g.,
gums, xanthans, cellulosics and sugars), humectants (e.g.,
sorbitol), solubilizers (e.g., ethanol, water, PEG and propylene
glycol), surfactants (e.g., sodium lauryl sulfate, Spans, Tweens,
and cetyl pyridine), preservatives and Jun. 2, 2005 antioxidants
(e.g., parabens, vitamins E and C, and ascorbic acid), anti-caking
agents, coating agents, and chelating agents (e.g., EDTA).
Conditions for Analysis and Therapy
[0061] The compositions and methods of the invention find use in
combination with a variety of demyelinating autoimmune conditions,
including chronic/progressive and relapsing demyelinating
autoimmune diseases. Generally patients for the methods of the
present invention are diagnosed as having an autoimmune condition,
e.g. a relapsing-remitting autoimmune condition, prior to
treatment. The inhibition of CMKLR1 decreases the severity or
incidence of relapses in such patients.
[0062] Multiple sclerosis (MS) is characterized by various symptoms
and signs of CNS dysfunction, with remissions and recurring
exacerbations. The most common presenting symptoms are paresthesias
in one or more extremities, in the trunk, or on one side of the
face; weakness or clumsiness of a leg or hand; or visual
disturbances, e.g. partial blindness and pain in one eye
(retrobulbar optic neuritis), dimness of vision, or scotomas. Other
common early symptoms are ocular palsy resulting in double vision
(diplopia), transient weakness of one or more extremities, slight
stiffness or unusual fatigability of a limb, minor gait
disturbances, difficulty with bladder control, vertigo, and mild
emotional disturbances; all indicate scattered CNS involvement and
often occur months or years before the disease is recognized.
Excess heat may accentuate symptoms and signs.
[0063] Clinical data alone may be sufficient for a diagnosis of MS.
If an individual has suffered two separate episodes of neurologic
symptoms characteristic of MS, and the individual also has
consistent abnormalities on physical examination, a diagnosis of MS
can be made with no further testing. Magnetic resonance imaging
(MRI) of the brain and spine is often used during the diagnostic
process. MRI shows areas of demyelination (lesions) as bright spots
on the image. A substance, called Gadolinium, can be injected into
the spinal column to highlight active plaques and, by elimination,
demonstrate the existence of historical lesions not associated with
clinical symptoms. This can provide the evidence of chronic disease
needed for a definitive diagnosis of MS. Testing of cerebrospinal
fluid (CSF) can provide evidence of chronic inflammation of the
central nervous system. The CSF is tested for oligoclonal bands,
which are immunoglobulins found in 85% to 95% of people with
definite MS. Combined with MRI and clinical data, the presence of
oligoclonal bands can help make a definite diagnosis of MS. Lumbar
puncture is the procedure used to collect a sample of CSF.
[0064] The brain of a person with MS often responds less actively
to stimulation of the optic nerve and sensory nerves. These brain
responses can be examined using visual evoked potentials (VEPs) and
somatosensory evoked potentials (SEPs). Decreased activity on
either test can reveal demyelination which may be otherwise
asymptomatic. Along with other data, these exams can help find the
widespread nerve involvement required for a definite diagnosis of
MS.
[0065] In 1996 the United States National Multiple Sclerosis
Society standardized the following four subtype definitions (see
Lublin and Reingold (1996) Neurology 46(4):907-11, herein
specifically incorporated by reference) as relapsing-remitting;
secondary progressive; primary progressive; progressive relapsing.
The methods of the invention find particular use in the treatment
of ongoing disease, and particularly in treating relapsing
forms.
[0066] Relapsing-remitting describes the initial course of 85% to
90% of individuals with MS. This subtype is characterized by
unpredictable attacks (relapses) followed by periods of months to
years of relative quiet (remission) with no new signs of disease
activity. Deficits suffered during the attacks may either resolve
or may be permanent. When deficits always resolve between attacks,
this is referred to as "benign" MS.
[0067] Secondary progressive describes around 80% of those with
initial relapsing-remitting MS, who then begin to have neurologic
decline between their acute attacks without any definite periods of
remission. This decline may include new neurologic symptoms,
worsening cognitive function, or other deficits. Secondary
progressive is the most common type of MS and causes the greatest
amount of disability.
[0068] Primary progressive describes the approximately 10% of
individuals who never have remission after their initial MS
symptoms. Decline occurs continuously without clear attacks. The
primary progressive subtype tends to affect people who are older at
disease onset.
[0069] Progressive relapsing describes those individuals who, from
the onset of their MS, have a steady neurologic decline but also
suffer superimposed attacks; and is the least common of all
subtypes.
[0070] Treatments for MS include interferon .beta. (Avonex,
Betaseron, Rebif), Copaxone (Glatiramer acetate), and anti-VLA4
(Tysabri, natalizumab), which reduce relapse rate and to date have
only exhibited a modest impact on disease progression. MS is also
treated with immunosuppressive agents including methylprednisolone,
other steroids, methotrexate, cladribine and cyclophosphamide. Many
biological agents, such as anti-IFNgamma antibody, CTLA4-Ig
(Abetacept), anti-CD20 (Rituxan), and other anti-cytokine agents
are in clinical development for MS.
[0071] Peripheral neuropathies may also have a relapsing remitting
course, and may include Miller Fisher syndrome; chronic
inflammatory demyelinating polyneuropathy (CIDP) with its subtypes
classical CIDP, CIDP with diabetes, CIDP/monoclonal gammopathy of
undetermined significance (MGUS), sensory CIDP, multifocal motor
neuropathy (MMN), multifocal acquired demyelinating sensory and
motor neuropathy or Lewis-Sumner syndrome, multifocal acquired
sensory and motor neuropathy, and distal acquired demyelinating
sensory neuropathy; IgM monoclonal gammopathies with its subtypes
Waldenstrom's macroglobulinemia, myelin-associated
glycoprotein-associated gammopathy, polyneuropathy, organomegaly,
endocrinopathy, M-protein, skin changes syndrome, mixed
cryoglobulinemia, gait ataxia, late-onset polyneuropathy syndrome,
and MGUS.
[0072] An inhibitory agent may inhibit the activity of CMKLR1 by a
variety of different mechanisms. In certain embodiments, the
inhibitory agent is one that binds to the protein CMKLR1 and, in
doing so, inhibits its activity. In other embodiments, the
inhibitory agent prevents expression or secretion of CMKLR1.
[0073] Representative CMKLR1 inhibitory agents include, but are not
limited to: antisense oligonucleotides; antibodies; and the like.
Other agents of interest include, but are not limited to: naturally
occurring or synthetic small molecule compounds of interest, which
include numerous chemical classes, though typically they are
organic molecules, preferably small organic compounds having a
molecular weight of more than 50 and less than about 2,500 daltons.
Candidate agents comprise functional groups necessary for
structural interaction with proteins, particularly hydrogen
bonding, and typically include at least an amine, carbonyl,
hydroxyl or carboxyl group, preferably at least two of the
functional chemical groups. The candidate agents often comprise
cyclical carbon or heterocyclic structures and/or aromatic or
polyaromatic structures substituted with one or more of the above
functional groups. Candidate agents are also found among
biomolecules including peptides, saccharides, fatty acids,
steroids, purines, pyrimidines, derivatives, structural analogs or
combinations thereof. Such molecules may be identified, among other
ways, by employing appropriate screening protocols.
[0074] The inhibitory agent may act on CMKLR1 mRNA to inhibit the
activity of the target CMKLR1 by reducing the amount of CMKLR1RNA
present in the targeted cells, where the target cell may be present
in vitro or in vivo. By "reducing the amount of" is meant that the
level or quantity of the target CMKLR1 in the target cell is
reduced by at least about 2-fold, usually by at least about 5-fold,
e.g., 10-fold, 15-fold, 20-fold, 50-fold, 100-fold or more, as
compared to a control, i.e., an identical target cell not treated
according to the subject methods.
[0075] In another embodiment, the CMKLR1 inhibitor is an antibody.
The term "antibody" or "antibody moiety" is intended to include any
polypeptide chain-containing molecular structure with a specific
shape that fits to and recognizes an epitope, where one or more
non-covalent binding interactions stabilize the complex between the
molecular structure and the epitope. The term includes monoclonal
antibodies, multispecific antibodies (antibodies that include more
than one domain specificity), human antibody, humanized antibody,
and antibody fragments with the desired biological activity.
[0076] Polyclonal antibodies can be raised by a standard protocol
by injecting a production animal with an antigenic composition,
formulated as described above. (See, e.g., Harlow and Lane,
Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory,
1988.) In one such technique, a Class II target antigen comprising
an antigenic portion of the polypeptide is initially injected into
any of a wide variety of mammals (e.g., mice, rats, rabbits, sheep
or goats). When utilizing an entire protein, or a larger section of
the protein, antibodies may be raised by immunizing the production
animal with the protein and a suitable adjuvant (e.g., incomplete
Freund's, complete Freund's, oil-in-water emulsions, etc.)
Alternatively, for monoclonal antibodies, hybridomas may be formed
by isolating the stimulated immune cells, such as those from the
spleen of the inoculated animal. These cells are then fused to
immortalized cells, such as myeloma cells or transformed cells,
which are capable of replicating indefinitely in cell culture,
thereby producing an immortal, immunoglobulin-secreting cell
line.
[0077] In addition, the antibodies or antigen binding fragments may
be produced by genetic engineering. In this technique, as with the
standard hybridoma procedure, antibody-producing cells are
sensitized to the desired antigen or immunogen. The messenger RNA
isolated from the immune spleen cells or hybridomas is used as a
template to make cDNA using PCR amplification. A library of
vectors, each containing one heavy chain gene and one light chain
gene retaining the initial antigen specificity, is produced by
insertion of appropriate sections of the amplified immunoglobulin
cDNA into the expression vectors. A combinatorial library is
constructed by combining the heavy chain gene library with the
light chain gene library. This results in a library of clones,
which co-express a heavy and light chain (resembling the Fab
fragment or antigen binding fragment of an antibody molecule). The
vectors that carry these genes are co-transfected into a host (e.g.
bacteria, insect cells, mammalian cells, or other suitable protein
production host cell). When antibody gene synthesis is induced in
the transfected host, the heavy and light chain proteins
self-assemble to produce active antibodies that can be detected by
screening with the antigen or immunogen.
[0078] Antibodies with a reduced propensity to induce a violent or
detrimental immune response in humans (such as anaphylactic shock),
and which also exhibit a reduced propensity for priming an immune
response which would prevent repeated dosage with the antibody
therapeutic are preferred for use in the invention. Thus,
humanized, single chain, chimeric, or human antibodies, which
produce less of an immune response when administered to humans, are
preferred for use in the present invention. Also included in the
invention are multi-domain antibodies.
[0079] A chimeric antibody is a molecule in which different
portions are derived from different animal species, for example
those having a variable region derived from a murine mAb and a
human immunoglobulin constant region. Techniques for the
development of chimeric antibodies are described in the literature.
See, for example, Morrison et al. (1984) Proc. Natl. Acad. Sci.
81:6851-6855; Neuberger et al. (1984) Nature 312:604-608; Takeda et
al. (1985) Nature 314:452-454. Single chain antibodies are formed
by linking the heavy and light chain fragments of the Fv region via
an amino acid bridge, resulting in a single chain polypeptide. See,
for example, Huston et al., Science 242:423-426; Proc. Natl. Acad.
Sci. 85:5879-5883; and Ward et al. Nature 341:544-546.
[0080] Antibody fragments that recognize specific epitopes may be
generated by techniques well known in the field. These fragments
include, without limitation, F(ab').sub.2 fragments, which can be
produced by pepsin digestion of the antibody molecule, and Fab
fragments, which can be generated by reducing the disulfide bridges
of the F(ab').sub.2 fragments.
[0081] Alternatively, single chain antibodies (Fv, as described
below) can be produced from phage libraries containing human
variable regions. See U.S. Pat. No. 6,174,708. Intrathecal
administration of single-chain immunotoxin, LMB-7 [B3(Fv)-PE38],
has been shown to cure of carcinomatous meningitis in a rat model.
Proc Natl. Acad. Sci. USA 92, 2765-9, all of which are incorporated
by reference fully herein.
[0082] In addition to entire immunoglobulins (or their recombinant
counterparts), immunoglobulin fragments comprising the epitope
binding site (e.g., Fab', F(ab').sub.2, or other fragments) are
useful as antibody moieties in the present invention. Such antibody
fragments may be generated from whole immunoglobulins by ficin,
pepsin, papain, or other protease cleavage. "Fragment," or minimal
immunoglobulins may be designed utilizing recombinant
immunoglobulin techniques. For instance "Fv" immunoglobulins for
use in the present invention may be produced by linking a variable
light chain region to a variable heavy chain region via a peptide
linker (e.g., poly-glycine or another sequence which does not form
an alpha helix or beta sheet motif).
[0083] Candidate antibodies can be tested for by any suitable
standard means, e.g. ELISA assays, etc. As a first screen, the
antibodies may be tested for binding against the immunogen. After
selective binding is established, the candidate antibody may be
tested for appropriate activity in an in vivo model. In a preferred
embodiment, antibody compounds may be screened using a variety of
methods in vitro and in vivo. These methods include, but are not
limited to, methods that measure binding affinity to a target,
biodistribution of the compound within an animal or cell, or
compound mediated cytotoxicity. These and other screening methods
known in the art provide information on the ability of a compound
to bind to, modulate, or otherwise interact with the specified
target and are a measure of the compound's efficacy.
[0084] Anti-CMKLR1 antibodies may be administered daily,
semi-weekly, weekly, semi-monthly, monthly, etc., at a dose of from
about 0.01 mg, from about 0.1 mg, from about 1 mg, from about 5 mg,
from about 10 mg, from about 100 mg or more per kilogram of body
weight when administered systemically. Smaller doses may be
utilized in localized administration, e.g. in direct administration
to ocular nerves, etc. Humanized, chimeric human, or human
antibodies are preferred for administering to human patients.
Methods of Screening for CMKLR1 Antagonists
[0085] Agents that can regulate demyelinating inflammatory disease
in a subject can be identified by detecting the ability of an agent
to antagonize the activity of CMKLR1. Antagonizing agents include,
but are not limited to, agents that interfere with the interaction
of CMKLR1 with its natural ligands, agents that reduce CMKLR1
expression (e.g., by reducing transcription or by inducing cell
surface receptor desensitization, internalization and/or
degradation), agents that reduce expression of endogenous ligands
of CMKLR1, and agents that inhibit intracellular signals initiated
by the binding of CMKLR1 with its ligands.
[0086] In certain embodiments, agents that can reduce demyelinating
inflammatory disease in a subject can be identified by detecting
the ability of an agent to interfere with (e.g., block) the
interaction of CMKLR1 with its cognate ligand (e.g., chemerin). For
example, a screening assay may be used that evaluates the ability
of an agent to bind specifically to CMKLR1 (or its ligand) and
prevent receptor:ligand interaction. Assays to determine affinity
and specificity of binding are known in the art, including
competitive and non-competitive assays. Assays of interest include
ELISA, RIA, flow cytometry, etc. Binding assays may use purified or
semi-purified protein, or alternatively may use primary cells or
immortalized cell lines that express CMKLR1. In certain of these
embodiments, the cells are transfected with an expression construct
for CMKLR1. As an example of a binding assay, CMKLR1 is inserted
into a membrane, e.g. whole cells, or membranes coating a
substrate, e.g. microtiter plate, magnetic beads, etc. The
candidate agent and soluble, labeled ligand (e.g., chemerin) are
added to the cells, and the unbound components are then washed off.
The ability of the agent to compete with the labeled ligand for
receptor binding is determined by quantitation of bound, labeled
ligand. Confirmation that the blocking agent does not cross-react
with other chemoattractant receptors may be performed with a
similar assay.
[0087] CMKLR1 protein sequences are used in screening of candidate
compounds (including antibodies, peptides, lipids, small organic
molecules, etc.) for the ability to bind to and modulate CMKLR1
activity. Agents that inhibit or reduce CMKLR1 activity are of
interest as therapeutic agents for decreasing demyelinating
inflammatory disease in a subject whereas agents that activate
CMKLR1 activity are of interest as therapeutic agents for
increasing demyelinating inflammatory disease in a subject. Such
compound screening may be performed using an in vitro model, a
genetically altered cell or animal, or purified protein
corresponding to chemerin-like chemoattractant polypeptides or a
fragment(s) thereof. One can identify ligands or substrates that
bind to and modulate the action of the encoded polypeptide.
[0088] Polypeptides useful in screening include those encoded by
the CMKLR1 gene, as well as nucleic acids that, by virtue of the
degeneracy of the genetic code, are not identical in sequence to
the disclosed nucleic acids, and variants thereof.
[0089] CMKLR1 ligands (e.g., chemerin or resolvin) are used in
screening of candidate compounds (including antibodies, peptides,
lipids, small organic molecules, etc.) for the ability to bind to
and modulate the ligands ability to activate CMKLR1. Agents that
inhibit or reduce the ability of a CMKLR1 ligand to activate CMKLR1
are of interest as therapeutic agents for decreasing demyelinating
inflammatory disease in a subject whereas agents that increase the
ability of a CMKLR1 ligand to activate CMKLR1 activity are of
interest as therapeutic agents for increasing demyelinating
inflammatory disease in a subject. Such compound screening may be
performed using an in vitro model, a genetically altered cell or
animal, or purified protein corresponding to chemerin-like
chemoattractant polypeptides or a fragment(s) thereof. One can
identify ligands or substrates that bind to and modulate the action
of the encoded polypeptide.
[0090] Polypeptides useful in screening include those encoded by a
CMKLR1 ligand gene (e.g., chemerin), as well as nucleic acids that,
by virtue of the degeneracy of the genetic code, are not identical
in sequence to the disclosed nucleic acids, and variants
thereof.
[0091] Transgenic animals or cells derived therefrom are also used
in compound screening. Transgenic animals may be made through
homologous recombination, where the normal locus corresponding to
chemerin-like chemoattractant is altered. Alternatively, a nucleic
acid construct is randomly integrated into the genome. Vectors for
stable integration include plasmids, retroviruses and other animal
viruses, yeast artificial chromosomes (YACs), and the like. A
series of small deletions and/or substitutions may be made in the
coding sequence to determine the role of different exons in
receptor binding, signal transduction, etc. Specific constructs of
interest include antisense sequences that block expression of the
targeted gene and expression of dominant negative mutations. A
detectable marker, such as lac Z or GFP, may be introduced into the
locus of interest, where up-regulation of expression will result in
an easily detected change in phenotype. One may also provide for
expression of the target gene or variants thereof in cells or
tissues where it is not normally expressed or at abnormal times of
development, for example by overexpressing in neural cells. By
providing expression of the target protein in cells in which it is
not normally produced, one can induce changes in cell behavior.
[0092] Compound screening identifies agents that modulate CMKLR1
activity or function. Of particular interest are screening assays
for agents that have a low toxicity for normal human cells. A wide
variety of assays may be used for this purpose, including labeled
in vitro protein-protein binding assays, electrophoretic mobility
shift assays, immunoassays for protein binding, and the like.
Screening for the activity of G-protein coupled receptors (or
GPCRs, of which CMKLR1 is a member) is well known in the art, and
includes assays for measuring any of a number of detectible steps,
including but not limited to: stimulation of GDP for GTP exchange
on a G protein; alteration of adenylate cyclase activity; protein
kinase C modulation; phosphatidylinositol breakdown (generating
second messengers diacylglycerol, and inositol triphosphate);
intracellular calcium flux; activation of MAP kinases; modulation
of tyrosine kinases; modulation of gene or reporter gene activity,
integrin activation, or chemotaxis inhibition. A detectable step in
a signaling cascade is considered modulated if the measurable
activity is altered by 10% or more above or below a baseline or
control level. The baseline or control level can be the activity in
the substantial absence of an activator (e.g., a ligand) or the
activity in the presence of a known amount of an activator. The
measurable activity can be measured directly, as in, for example,
measurement of cAMP or diacylglycerol levels. Alternatively, the
measurable activity can be measured indirectly, as in, for example,
a reporter gene assay. Knowledge of the 3-dimensional structure of
the encoded protein (e.g., CMKLR1 or a ligand, e.g. chemerin),
derived from crystallization of purified recombinant protein, could
lead to the rational design of small drugs that specifically
inhibit activity. These drugs may be directed at specific domains
and sites.
[0093] The term "agent" as used herein describes any molecule, e.g.
protein or pharmaceutical, with the capability of modulating the
physiological function of CMKLR1 or its ligand. Generally a
plurality of assay mixtures are run in parallel with different
agent concentrations to obtain a differential response to the
various concentrations. Typically one of these concentrations
serves as a negative control, i.e. at zero concentration or below
the level of detection.
[0094] Candidate agents encompass numerous chemical classes, though
typically they are organic molecules, preferably small organic
compounds having a molecular weight of more than 50 and less than
about 2,500 daltons. Candidate agents comprise functional groups
necessary for structural interaction with proteins, particularly
hydrogen bonding, and typically include at least an amine,
carbonyl, hydroxyl or carboxyl group, preferably at least two of
the functional chemical groups. The candidate agents often comprise
cyclical carbon or heterocyclic structures and/or aromatic or
polyaromatic structures substituted with one or more of the above
functional groups. Candidate agents are also found among
biomolecules including peptides, saccharides, fatty acids, lipids,
steroids, purines, pyrimidines, derivatives, structural analogs or
combinations thereof.
[0095] Candidate agents are obtained from a wide variety of sources
including libraries of synthetic or natural compounds. For example,
numerous means are available for random and directed synthesis of a
wide variety of organic compounds and biomolecules, including
expression of randomized oligonucleotides and oligopeptides.
Alternatively, libraries of natural compounds in the form of
bacterial, fungal, plant and animal extracts are available or
readily produced. Additionally, natural or synthetically produced
libraries and compounds are readily modified through conventional
chemical, physical and biochemical means, and may be used to
produce combinatorial libraries. Known pharmacological agents may
be subjected to directed or random chemical modifications, such as
acylation, alkylation, esterification, amidification, etc. to
produce structural analogs. Test agents can be obtained from
libraries, such as natural product libraries or combinatorial
libraries, for example.
[0096] Libraries of candidate compounds can also be prepared by
rational design. (See generally, Cho et al., Pac. Symp. Biocompat.
305-16, 1998); Sun et al., J. Comput. Aided Mol. Des. 12:597-604,
1998); each incorporated herein by reference in their entirety).
For example, libraries of phosphatase inhibitors can be prepared by
syntheses of combinatorial chemical libraries (see generally DeWitt
et al., Proc. Nat. Acad. Sci. USA 90:6909-13, 1993; International
Patent Publication WO 94/08051; Baum, Chem. & Eng. News,
72:20-25, 1994; Burbaum et al., Proc. Nat. Acad. Sci. USA
92:6027-31, 1995; Baldwin et al., J. Am. Chem. Soc. 117:5588-89,
1995; Nestler et al., J. Org. Chem. 59:4723-24, 1994; Borehardt et
al., J. Am. Chem. Soc. 116:373-74, 1994; Ohlmeyer et al., Proc.
Nat. Acad. Sci. USA 90:10922-26, all of which are incorporated by
reference herein in their entirety.)
[0097] A "combinatorial library" is a collection of compounds in
which the compounds comprising the collection are composed of one
or more types of subunits. Methods of making combinatorial
libraries are known in the art, and include the following: U.S.
Pat. Nos. 5,958,792; 5,807,683; 6,004,617; 6,077,954; which are
incorporated by reference herein. The subunits can be selected from
natural or unnatural moieties. The compounds of the combinatorial
library differ in one or more ways with respect to the number,
order, type or types of modifications made to one or more of the
subunits comprising the compounds. Alternatively, a combinatorial
library may refer to a collection of "core molecules" which vary as
to the number, type or position of R groups they contain and/or the
identity of molecules composing the core molecule. The collection
of compounds is generated in a systematic way. Any method of
systematically generating a collection of compounds differing from
each other in one or more of the ways set forth above is a
combinatorial library.
[0098] A combinatorial library can be synthesized on a solid
support from one or more solid phase-bound resin starting
materials. The library can contain five (5) or more, preferably ten
(10) or more, organic molecules that are different from each other.
Each of the different molecules is present in a detectable amount.
The actual amounts of each different molecule needed so that its
presence can be determined can vary due to the actual procedures
used and can change as the technologies for isolation, detection
and analysis advance. When the molecules are present in
substantially equal molar amounts, an amount of 100 picomoles or
more can be detected. Preferred libraries comprise substantially
equal molar amounts of each desired reaction product and do not
include relatively large or small amounts of any given molecules so
that the presence of such molecules dominates or is completely
suppressed in any assay.
[0099] Combinatorial libraries are generally prepared by
derivatizing a starting compound onto a solid-phase support (such
as a bead). In general, the solid support has a commercially
available resin attached, such as a Rink or Merrifield Resin. After
attachment of the starting compound, substituents are attached to
the starting compound. Substituents are added to the starting
compound, and can be varied by providing a mixture of reactants
comprising the substituents. Examples of suitable substituents
include, but are not limited to, hydrocarbon substituents, e.g.
aliphatic, alicyclic substituents, aromatic, aliphatic and
alicyclic-substituted aromatic nuclei, and the like, as well as
cyclic substituents; substituted hydrocarbon substituents, that is,
those substituents containing nonhydrocarbon radicals which do not
alter the predominantly hydrocarbon substituent (e.g., halo
(especially chloro and fluoro), alkoxy, mercapto, alkylmercapto,
nitro, nitroso, sulfoxy, and the like); and hetero substituents,
that is, substituents which, while having predominantly hydrocarbyl
character, contain other than carbon atoms. Suitable heteroatoms
include, for example, sulfur, oxygen, nitrogen, and such
substituents as pyridyl, furanyl, thiophenyl, imidazolyl, and the
like. Heteroatoms, and typically no more than one, can be present
for each carbon atom in the hydrocarbon-based substituents.
Alternatively, there can be no such radicals or heteroatoms in the
hydrocarbon-based substituent and, therefore, the substituent can
be purely hydrocarbon.
[0100] Where the screening assay is a binding assay, one or more of
the molecules may be joined to a label, where the label can
directly or indirectly provide a detectable signal. Various labels
include radioisotopes, fluorescers, chemiluminescers, enzymes,
specific binding molecules, particles, e.g. magnetic particles, and
the like. Specific binding molecules include pairs, such as biotin
and streptavidin, digoxin and antidigoxin, etc. For the specific
binding members, the complementary member would normally be labeled
with a molecule that provides for detection, in accordance with
known procedures.
[0101] A variety of other reagents may be included in the screening
assay. These include reagents like salts, neutral proteins, e.g.
albumin, detergents, etc that are used to facilitate optimal
protein-protein binding and/or reduce non-specific or background
interactions. Reagents that improve the efficiency of the assay,
such as protease inhibitors, nuclease inhibitors, anti-microbial
agents, etc. may be used. The components are added in any order
that provides for the requisite binding. Incubations are performed
at any suitable temperature, typically between 4 and 40.degree. C.
Incubation periods are selected for optimum activity, but may also
be optimized to facilitate rapid high-throughput screening.
Typically between 0.1 and 3 hours will be sufficient.
[0102] Preliminary screens can be conducted by screening for
compounds capable of binding to CMKLR1 or its ligand; compounds so
identified are possible modulators. Compounds capable of binding to
CMKLR1 are inhibitors if they do not activate the receptor and
activators if they do. The binding assays usually involve
contacting CMKLR1 or its ligand with one or more test compounds and
allowing sufficient time for the protein and test compounds to form
a binding complex. Any binding complexes formed can be detected
using any of a number of established analytical techniques. Protein
binding assays include, but are not limited to, methods that
measure co-precipitation, co-migration on non-denaturing
SDS-polyacrylamide gels, and co-migration on Western blots (see,
e.g., Bennet, J. P. and Yamamura, H. I. (1985) "Neurotransmitter,
Hormone or Drug Receptor Binding Methods," in Neurotransmitter
Receptor Binding (Yamamura, H. I., et al., eds.), pp. 61-89.
[0103] Certain screening methods involve screening for a compound
that modulates the expression of CMKLR1 or its ligand. Such methods
generally involve conducting cell-based assays in which test
compounds are contacted with one or more cells endogenously
expressing CMKLR1 or its ligand and then detecting a modulation in
expression (e.g., at the mRNA and/or protein level). In certain
screening methods, a target cell has a reporter gene (e.g., GFP)
under the control of the CMKLR1 promoter (or promoter of its
ligand). The level of expression can be compared to a baseline
value. The baseline value can be a value for a control sample or a
statistical value that is representative of expression levels for a
control population. Expression levels can also be determined for
cells that do not express the CMKLR1 or its ligand, as a negative
control. Such cells generally are otherwise substantially
genetically the same as the test cells. Various controls can be
conducted to ensure that an observed activity is authentic
including running parallel reactions with cells that lack the
reporter construct or by not contacting a cell harboring the
reporter construct with test compound.
[0104] Certain screening methods involve screening for a compound
that modulates gene expression normally regulated by CMKLR1
signaling. In certain embodiments, a cell-based assay is conducted
in which a cell expressing CMKLR1 is contacted to a candidate agent
(e.g., a CMKLR1 binding agent) and monitored for changes in gene
expression that are similar, or substantially similar, to those
induced by a natural ligand for CMKLR1. In certain other
embodiments, a cell-based assay is conducted in which a cell
expressing CMKLR1 is contacted to its natural ligand and a
candidate agent and monitored for perturbations in gene expression.
By "perturbations in gene expression", it is meant that the gene
expression changes induced by a CMKLR1 ligand binding to CMKLR1 is
altered when the candidate agent is present.
[0105] Certain screening methods involve screening for a compound
that modulates CMKLR1 signaling events when contacted to a cell
expressing CMKLR1. These assays can be carried out in the presence
or absence of a natural ligand for CMKLR1. Such methods generally
involve monitoring for modulation of downstream signaling events as
described above, e.g., protein phosphorylation, GDP/GTP exchange,
etc.
[0106] Compounds can also be further validated as described
below.
[0107] Compounds that are initially identified by any of the
foregoing screening methods can be further tested to validate their
apparent activity. The basic format of such methods involves
administering a lead compound identified during an initial screen
to an animal that serves as a model for humans. The animal models
utilized in validation studies generally are mammals. Specific
examples of suitable animals include, but are not limited to,
primates, mice, and rats.
[0108] Active test agents identified by the screening methods
described herein that modulate CMKLR1 activity can serve as lead
compounds for the synthesis of analog compounds. Typically, the
analog compounds are synthesized to have an electronic
configuration and a molecular conformation similar to that of the
lead compound. Identification of analog compounds can be performed
through use of techniques such as self-consistent field (SCF)
analysis, configuration interaction (CI) analysis, and normal mode
dynamics analysis. Computer programs for implementing these
techniques are available. See, e.g., Rein et al., (1989)
Computer-Assisted Modeling of Receptor-Ligand Interactions (Alan
Liss, New York).
[0109] A functional assay that detects leukocyte chemotaxis may be
used for confirmation. For example, a population of cells that
demonstrate chemerin chemotaxis (e.g., dendritic cells or
monocyte/macrophages) may be stimulated with chemerin and/or the
candidate modulating agent. An agent that antagonizes CMKLR1
activity will cause a decrease in the locomotion of the cells in
response to chemerin. An agent that potentiates CMKLR1 activity
will act as a chemotaxis factor in the absence of chemerin and/or
increase the chemotactic response induced by chemerin. Chemotaxis
assays of that find use in these methods are known in the art,
examples of which are described in U.S. patent application Ser. No.
10/958,527, entitled "Family of Cystatin-Related Chemoattractant
Proteins" (incorporated herein by reference in its entirety). An
agent that is a chemoattractant inhibitor will decrease the
concentration of cells at a target site of higher concentration of
chemerin.
EXPERIMENTAL
Example 1
[0110] The pathology of multiple sclerosis (MS) involves leukocyte
extravasation of the blood-brain barrier and associated myelin
damage, which leads to impaired nerve function and paralysis.
Chemokines, adhesion molecules, and their receptors have been
implicated in recruitment of inflammatory cells to the central
nervous system (CNS) during MS. However, the mechanisms that
regulate migration of various leukocyte subsets to the CNS remain
poorly understood. Chemokine-like receptor (CMKLR)-1 (also known as
ChemR23 or Dez) is a recently de-orphaned chemoattractant receptor
that has emerging roles in macrophage migration during inflammatory
processes. In this study, we examined the role of CMKLR1 in
experimental autoimmune encephalomyelitis (EAE), a mouse model of
human MS. We found that mice deficient in CMKLR1 are resistant to
progressive EAE. CMKLR1-deficient mice had reduced inflammatory
infiltrates in the brain and spinal cord, with especially marked
differences in the CNS parenchyma. Together, the data demonstrate
that CMKLR1 regulates autoimmune demyelinating disease; and CMKLR1
provides a target for blocking development of progressive
EAE/MS.
Example 2
[0111] Mouse monoclonal antibody BZ186 specifically recognizes
mouse serpentine protein CMKLR1. CMKLR1 possesses high homology
with members of the chemoattractant receptor family, and binds the
chemoattractant chemerin. CMKLR1 is selectively expressed in
macrophages, natural killer (NK) cells, subsets of dendritic cells
(DC), and adipocytes. Monoclonal antibodies directed against
chemokine receptors are used to determine leukocyte expression
profile of receptors during homeostasis or inflammation; role of
various receptors in coordinating the immune response; role of
various receptors in leukocyte development; identity of other
proteins interacting with the chemokine receptor.
[0112] This mouse anti-mCMKLR1 antibody can be used in flow
cytometry, as a blocking reagent in vitro and in vivo; and in
immunocytochemistry and immunofluorescence. Monoclonal antibody
BZ186 (isotype mIgG.sub.1.kappa.) was generated by immunizing a
CMKLR1 KO mouse with wild-type total peritoneal exudate cells.
mCMKLR1 is highly expressed on mouse macrophages, which make up
.about.30% of total peritoneal exudate cells. Splenocytes and
draining lymph node cells were isolated from the immunized mouse
and fused with SP2/0 myeloma cells. Hybridoma supernatants were
screened for binding to the mCMKLR1/L1.2 cell line. Hybridomas
secreting monoclonal antibodies specific for mCMKLR1 were isolated
and cloned by limiting dilution. Anti-mCMKLR1 mAb BZ186 was
purified from a large batch preparation of hybridoma supernatant.
The antibody is composed of the constant region from mouse
immunoglobulin heavy chain isotype G.sub.1 and the constant region
from the kappa light chain. The complementarity-determining regions
(CDR) recognize mCMKLR1. mAb BZ186 was shown to stain peritoneal
mouse macrophages by flow cytometry, and block mCMKLR1/L1.2
transfectant chemotaxis to chemerin in in vitro transwell migration
assays. A modification is made by directly labeling the antibodies
with a fluorophore for use in flow cytometry, eliminating the need
for a second-stage reagent. The antibody can also be biotinylated,
which allows for higher sensitivity in various assays. The mAb can
be conjugated to magnetic microbeads, which can be used to separate
and enrich/purify mCMKLR1+ cells.
[0113] Importantly, the BZ186 mAb blocks mCMKLR1 functional
responses to chemerin.
[0114] In a variation of this method, a mouse is similarly
immunized with human macrophages, and screened for specific binding
to the human protein, preferably as presented on the cell surface,
wherein a monoclonal antibody is obtained that blocks functional
responses to human chemerin.
Example 3
[0115] Using the newly developed anti-mCMKLR1 mAb BZ186, we
analyzed CMKLR1 expression on mouse spinal cord mononuclear cells
by flow cytometry. Plasmacytoid dendritic cells, pDC, defined as
CD45.sup.hiCD3.sup.-CD19.sup.-CD11b.sup.-CD11c.sup.intB220.sup.+,
are CMKLR1-negative, whereas myeloid dendritic cells mDC, defined
as CD45.sup.hiCD3.sup.-CD19.sup.-CD11b.sup.+CD11c.sup.hiB220.sup.-
and microglia, defined as
CD3.sup.-CD19.sup.-CD11b.sup.+CD45.sup.lo, isolated from the spinal
cords of EAE mice are CMKLR1-positive.
Example 4
[0116] EAE is examined in CMKLR1 null mice immunized with MOG 35-55
in CFA. These mice are resistant to development of EAE relative to
the wild-type. EAE is driven by pathogenic immune responses against
myelin proteins and lipids. CMKLR1 may have an inflammatory
role.
[0117] It is then determined whether treatment with agents that
inhibit CMKLR1, including mAb BZ186 or RNAi specific for CMKLR1 or
chemerin. To test this, WT mice with EAE are treated every two days
with 10-100 .mu.g of mAb BZ186 administered intravenously or
intraperitoneally.
Methods
[0118] Mice. CMKLR1 null mice were developed by Deltagen. These
null mice were generated from ES cells derived from the 129 mouse
strain and backcrossed to the C57BL/6 background. The mice are
viable and fertile, with no obvious prenatal defects.
[0119] EAE induction. EAE is induced in 8-12 week old female null
and WT animals via subcutaneous immunization with 100 .mu.g myelin
oligodendrocyte glycoprotein) peptide, amino acids 35-55 (MOG
35-55) in an emulsion mixed (volume ratio 1:1) with Complete
Freund's Adjuvant (containing 4 mg/ml of heat-killed Mycobacterium
tuberculosis H37Ra). Mice are also injected intravenously with
250-400 ng of Bordetella pertussis toxin (BPT) in PBS at the time
of, and two days following immunization. MOG 35-55 peptide is
synthesized by the Stanford Protein and Nucleic Acid Facility and
purified by high performance liquid chromatography (HPLC). Mice
(n=8-10 per group) were examined daily for clinical signs of EAE
and were scored as followed: 0=no clinical disease, 1=limp tail,
2=hindlimb weakness, 3=complete hindlimb paralysis, 4=hindlimb
paralysis plus some forelimb paralysis, and 5=moribund or dead.
[0120] Histopathology. Brains and spinal cords are dissected from
mice, fixed in 10% formalin in PBS and embedded in paraffin. Seven
micron thick sections are stained with haematoxylin and eosin to
detect inflammatory infiltrates and luxol fast blue for
demyelination. Inflammatory lesions in brain, thoracic and lumbar
spinal cord sections are counted by an examiner masked to the
treatment status of the animal.
[0121] Treatment. WT mice are induced with EAE using MOG 35-55 and
pertussis toxin. When mice have hindlimb weakness or paralysis,
animals are divided into two groups balanced for mean clinical
disease scores, and then injected intravenously or
intraperitoneally every second day with saline, pH 7.0, or 10-100
.mu.g monoclonal antibody diluted in saline.
Example 5
[0122] EAE is induced in animals as described above. In place of
treatment with antibody, the animals are injected with cholesterol
conjugated siRNA having the sequence
Fw:CACCGGAAGATAACCTGCTTCAACACGAATGTTGAAGCAGGTTATCTTCC (SEQ ID NO.
1) Fw:AAAAGGAAGATAACCTGCTTCAACATTCGTGTTGAAGCAGGTTATCTTCC (SEQ ID
NO. 2) or with an adenoviral siRNA construct, and the results are
scored as described above.
[0123] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it is readily apparent to those of ordinary skill
in the art in light of the teachings of this invention that certain
changes and modifications may be made thereto without departing
from the spirit or scope of the appended claims.
[0124] Accordingly, the preceding merely illustrates the principles
of the invention. It will be appreciated that those skilled in the
art will be able to devise various arrangements which, although not
explicitly described or shown herein, embody the principles of the
invention and are included within its spirit and scope.
Furthermore, all examples and conditional language recited herein
are principally intended to aid the reader in understanding the
principles of the invention and the concepts contributed by the
inventors to furthering the art, and are to be construed as being
without limitation to such specifically recited examples and
conditions. Moreover, all statements herein reciting principles,
aspects, and embodiments of the invention as well as specific
examples thereof, are intended to encompass both structural and
functional equivalents thereof. Additionally, it is intended that
such equivalents include both currently known equivalents and
equivalents developed in the future, i.e., any elements developed
that perform the same function, regardless of structure. The scope
of the present invention, therefore, is not intended to be limited
to the exemplary embodiments shown and described herein. Rather,
the scope and spirit of the present invention is embodied by the
appended claims.
Sequence CWU 1
1
2150DNAArtificial SequenceConjugated polynucleotide 1caccggaaga
taacctgctt caacacgaat gttgaagcag gttatcttcc 50250DNAArtificial
SequenceConjugated polynucleotide 2aaaaggaaga taacctgctt caacattcgt
gttgaagcag gttatcttcc 50
* * * * *