U.S. patent application number 13/256460 was filed with the patent office on 2012-03-08 for engineering the pathway for succinate production.
This patent application is currently assigned to UNIVERSITY OF FLORIDA RESEARCH FOUNDATION INC.. Invention is credited to Lonnie O'Neal Ingram, Kaemwich Jantama, Laura R. Jarboe, Jonathan C. Moore, Keelnatham T. Shanmugam, Xueli Zhang.
Application Number | 20120058530 13/256460 |
Document ID | / |
Family ID | 42828953 |
Filed Date | 2012-03-08 |
United States Patent
Application |
20120058530 |
Kind Code |
A1 |
Zhang; Xueli ; et
al. |
March 8, 2012 |
ENGINEERING THE PATHWAY FOR SUCCINATE PRODUCTION
Abstract
This invention relates to the biocatalysts for the efficient
production of succinic acid and/or other products from renewable
biological feedstocks. The biocatalysts have a very high efficiency
for the growth-coupled production of succinic acid and/or other
products from carbohydrate feed stocks as a result of both genetic
manipulations and metabolic evolution. More specifically, certain
biocatalysts of the present invention produce succinic acid at high
titers and yield in mineral salts media during simple
pH-controlled, batch fermentation without the addition of any
exogenous genetic material. The genetic manipulations of the
present invention are concerned with the energy-conserving
strategies coupled with the elimination of alternative routes for
NADH oxidation other than the routes for succinic acid production.
The biocatalysts contain glucose-repressed gluconeogenic
phosphoenol pyruvate carboxykinase (pck) depressed by genetic
modifications and a genetically-inactivated phosphotransferase
system. In terms of succinic acid production efficiency, the
biocatalysts of the present invention are functionally equivalent
to succinate producing rumen bacteria such as Actinobacillus
succinogens and Mannheimia succiniproducens with one difference
that the biocatalysts are able to achieve this high level of
succinic acid production in a minimal salt medium with carbohydrate
source as opposed to the requirement for a rich media for succinic
acid production by rumen bacteria.
Inventors: |
Zhang; Xueli; (Tianjin,
CN) ; Jantama; Kaemwich; (Chiang Mai, TH) ;
Moore; Jonathan C.; (Solana Beach, CA) ; Jarboe;
Laura R.; (Ames, IA) ; Shanmugam; Keelnatham T.;
(Gainesville, FL) ; Ingram; Lonnie O'Neal;
(Gainesville, FL) |
Assignee: |
UNIVERSITY OF FLORIDA RESEARCH
FOUNDATION INC.
GAINESVILLE
FL
|
Family ID: |
42828953 |
Appl. No.: |
13/256460 |
Filed: |
April 2, 2010 |
PCT Filed: |
April 2, 2010 |
PCT NO: |
PCT/US2010/029728 |
371 Date: |
November 2, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61166093 |
Apr 2, 2009 |
|
|
|
Current U.S.
Class: |
435/145 ;
435/252.2; 435/252.3; 435/252.31; 435/252.32; 435/252.34;
435/252.35 |
Current CPC
Class: |
C12N 9/93 20130101; C12N
9/88 20130101; C12Y 401/01 20130101; C12P 7/46 20130101; C12Y
604/01001 20130101 |
Class at
Publication: |
435/145 ;
435/252.3; 435/252.32; 435/252.2; 435/252.34; 435/252.35;
435/252.31 |
International
Class: |
C12P 7/46 20060101
C12P007/46; C12N 1/21 20060101 C12N001/21 |
Goverment Interests
GOVERNMENT SUPPORT
[0002] This invention was made with government support under a
grant awarded from the Department of Energy under grant number
USDOE-DE FG02-96ER20222 and Department of Energy in conjunction
with the United States Department of Agriculture under grant number
USDA & DOE Biomass RDI DE FG36-04GO14019. The government has
certain rights in the invention.
Claims
1-44. (canceled)
45. An isolated bacterial cell having increased phosphoenol
pyruvate carboxykinase (PCK) activity.
46. The bacterial cell of claim 45, wherein said bacterial cell is
a non-ruminant bacterial cell.
47. The bacterial strain of claim 45, wherein said bacterium is
Escherichia coli, Gluconobacter oxydans, Gluconobacter asaii,
Achromobacter delmarvae, Achromobacter viscosus, Achromobacter
lacticum, Agrobacterium tumefaciens, Agrobacterium radiobacter,
Alcaligenes faecalis, Arthrobacter citreus, Arthrobacter tumescens,
Arthrobacter paraffineus, Arthrobacter hydrocarboglutamicus,
Arthrobacter oxydans, Aureobacterium saperdae, Azotobacter indicus,
Brevibacterium ammoniagenes, divaricatum, Brevibacterium
lactofermentum, Brevibacterium flavum, Brevibacterium globosum,
Brevibacterium fuscum, Brevibacterium ketoglutamicum,
Brevibacterium helcolum, Brevibacterium pusillum, Brevibacterium
testaceum, Brevibacterium roseum, Brevibacterium immariophilium,
Brevibacterium linens, Brevibacterium protopharmiae,
Corynebacterium acetophilum, Corynebacterium glutamicum,
Corynebacterium callunae, Corynebacterium acetoacidophilum,
Corynebacterium acetoglutamicum, Enterobacter aerogenes, Erwinia
amylovora, Erwinia carotovora, Erwinia herbicola, Erwinia
chrysanthemi, Flavobacterium peregrinum, Flavobacterium fucatum,
Flavobacterium aurantinum, Flavobacterium rhenanum, Flavobacterium
sewanense, Flavobacterium breve, Flavobacterium meningosepticum,
Micrococcus sp. CCM825, Morganella morganii, Nocardia opaca,
Nocardia rugosa, Planococcus eucinatus, Proteus rettgeri,
Propionibacterium shermanii, Pseudomonas synxantha, Pseudomonas
azotoformans, Pseudomonas fluorescens, Pseudomonas ovalis,
Pseudomonas stutzeri, Pseudomonas acidovolans, Pseudomonas
mucidolens, Pseudomonas testosteroni, Pseudomonas aeruginosa,
Rhodococcus erythropolis, Rhodococcus rhodochrous, Rhodococcus sp.
ATCC 15592, Rhodococcus sp. ATCC 19070, Sporosarcina ureae,
Staphylococcus aureus, Vibrio metschnikovii, Vibrio tyrogenes,
Actinomadura madurae, Actinomyces violaceochromogenes,
Kitasatosporia parulosa, Streptomyces coelicolor, Streptomyces
flavelus, Streptomyces griseolus, Streptomyces lividans,
Streptomyces olivaceus, Streptomyces tanashiensis, Streptomyces
virginiae, Streptomyces antibioticus, Streptomyces cacaoi,
Streptomyces lavendulae, Streptomyces viridochromogenes, Aeromonas
salmonicida, Bacillus pumilus, Bacillus circulans, Bacillus
thiaminolyticus, Bacillus licheniformis, Bacillus subtilis,
Bacillus amyloliquifaciens, Bacillus coagulans, Escherichia
freundii, Microbacterium ammoniaphilum, Serratia marcescens,
Salmonella typhimurium, Salmonella schottmulleri, or Xanthomonas
citri.
48. The bacterial cell of claim 45, wherein the increase in pck
activity results from increased levels of pck transcripts within
the cell.
49. The bacterial cell of claim 48, wherein said increased levels
of pck transcripts result from replacement of native regulatory
sequences with altered regulatory sequences of the pck gene that
increase pck transcription or with exogenous promoter
sequencesr.
50. The bacterial cell of claim 45, wherein the increase in pck
activity results from increased levels of pck transcripts result
arising from one or more mutations in the promoter region of the
pck gene.
51. The bacterial cell of claim 50, wherein said one or more
mutations are point mutations comprising replacement of nucleotide
A with nucleotide G at position 68 up stream of the pck gene start
codon.
52. The bacterial cell of claim 45, further comprising one or more
genetic modification that disrupts the functioning of PEP-dependent
phosphotransferase system.
53. The bacterial cell of claim 52, wherein said genetic
modification is in one or more genes coding for the structural
components of PEP-dependent phosphotransferase system.
54. The bacterial cell of claim 52, wherein said genetic
modification is in one or more genes coding for proteins that
regulate the expression of PEP-dependent phosphotransferase
system.
55. The bacterial cell of claim 52, wherein the said genetic
modification is in one or more genes selected from the group
consisting of ptsG, ptsH, ptsI, crr and crp.
56. The bacterial cell of claim 45, further comprising: (a) one or
more genetic modification that disrupts the functioning of
PEP-dependent phosphotransferase system; and (b) one or more
genetic modifications that upregulate the expression of one or more
genes encoding sugar transporters.
57. The bacterial cell of claim 45, further comprising genetic
modification leading to the inactivation of gene expression in one
or more genes involved in the fermentative pathway.
58. The bacterial cell of claim 45, further comprising genetic
modification leading to the inactivation of gene expression in one
or more genes selected from a group consisting of adhE, ldhA, focA,
pflA, ack, pta, pdh, mgsA, tdcD, tdcE and poxB.
59. The bacterial cell of claim 45, further comprising: (a) one or
more genetic modification that disrupts the functioning of
PEP-dependent phosphotransferase system; and (b) mutation in one or
more genes involved in the fermentative pathway.
60. The bacterial cell of claim 45, further comprising: (a) genetic
modification in one or more genes selected from a group consisting
of ptsG, ptsH, ptsI, crr and crp; and (b) genetic modifications
leading to the inactivation of gene expression in one or more genes
selected from a group consisting of adhE, ldhA, focA, pflA, ack,
pta, pdh, mgsA, tdcD, tdcE and poxB.
61. The bacterial cell of claim 45, further comprising genetic
modification in one or more genes associated with the operation of
the TCA cycle.
62. The bacterial cell of claim 45, further comprising genetic
modification in one or more genes selected from a group consisting
of mdh, fumA, fumB, fumC, frdABCD, acceAB, acnAB, icd, iclR, aspC,
and scfA.
63. The bacterial cell of claim 45, further comprising: (a) genetic
modification in one or more genes selected from a group consisting
of ptsG, ptsH, ptsI, crr and crp; (b) genetic modifications leading
to the inactivation of gene expression in one or more genes
selected from a group consisting of adhE, ldhA, focA, pflA, ack,
pta, pdh, mgsA, tdcD, tdcE and poxB; and (c) genetic modification
in one or more genes selected from a group consisting of mdh, fumA,
fumB, fumC, frdABCD, acceAB, acnAB, icd, iclR, aspC, and scfA.
64. The bacterial strain of claim 45, further comprising genetic
modification in one or more genes selected from a group consisting
of phosphoenol pyruvate carboxylase, NADH dependent malic enzyme
and NADPH dependent malic enzyme.
65. The bacterial strain of claim 45, further comprising an
exogenous pyruvate carboxylase.
66. A genetically modified bacterial cell, wherein said genetically
modified bacterial cell is XZ320, XZ332, XZ341, XZ468, XZ469,
XZ470, XZ613, XZ615, XZ616, XZ618, XZ620, XZ647, XZ721, or
XZ723.
67. An Escherichia coli bacterial strain comprising: (a) an
inactivated ldhA; (b) inactivated focA; (c) an inactivated pflB;
(d) inactivated ackA; (e) an inactivated mgsA; (f) an inactivated
adhE; (g) an inactivated tdcD; (h) an inactivated tdcE; (i) an
inactivated aspC; (j) an inactivated sfcA; (k) an inactivated ptsH;
(l) an inactivated citD and (in) an up regulated pck.
68. A method of producing succinic acid comprising: a) culturing a
bacterial strain of claim 45; b) providing a carbon source; c)
allowing said bacteria to metabolize said carbon source; and d)
isolating succinic acid.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the priority of the U.S. Provisional
Application Ser. No. 61/166,093, filed on Apr. 2, 2009. This
application is also a continuation-in-part of U.S. application Ser.
No. 12/529,826, filed Sep. 3, 2009, which is the U.S. national
stage application of PCT/US2008/057439, filed Mar. 19, 2009, which
claims the benefit of U.S. Provisional Application Ser. No.
60/895,806, filed Mar. 20, 2007, the disclosure of each of which is
hereby incorporated by reference in its entirety, including all
figures, tables and amino acid or nucleic acid sequences.
BACKGROUND OF THE INVENTION
[0003] The present invention is in the field of production of
succinic acid from renewable biological feedstocks using microbial
biocatalysts. This invention discloses the genetic modifications to
the biocatalysts that are useful in achieving high efficiency for
succinic acid production. More specifically, this invention
provides genetically modified biocatalysts that are suitable for
the production of succinic acid from renewable feedstocks in
commercially significant quantities.
[0004] A 2004 U.S. Department of Energy report entitled "Top value
added chemicals from biomass" has identified twelve building block
chemicals that can be produced from renewable feed stocks. The
twelve sugar-based building blocks are 1,4-diacids (succinic,
fumaric and maleic), 2,5-furan dicarboxylic acid, 3-hydroxy
propionic acid, aspartic acid, glucaric acid, glutamic acid,
itaconic acid, levulinic acid, 3-hydroxybutyrolactone, glycerol,
sorbitol, and xylitol/arabinitol. The fermentative production of
these building block chemicals from renewable feedstocks will
become increasingly competitive as petroleum prices in crease.
[0005] These building block chemicals are molecules with multiple
functional groups that possess the potential to be transformed into
new families of useful molecules. These twelve building block
chemicals can be subsequently converted to a number of high-value
bio-based chemicals or materials. For example, succinate can serve
as a substrate for transformation into plastics, solvents, and
other chemicals currently made from petroleum (Lee et al., 2004;
Lee et al., 2005; McKinlay et al., 2007; Wendisch et al., 2006;
Zeikus et al., 1999). Many bacteria have been described with the
natural ability to produce succinate as a major fermentation
product (Table 1). However, complex processes, expensive growth
media and long incubation times are often required to produce
succinic acid from these naturally occurring succinic acid
producing microorganisms.
[0006] A variety of genetic approaches have previously been used to
engineer Escherichia coli strains for succinate production with
varying degrees of success (Table 1). In most studies, titers
achieved were low and complex medium ingredients such as yeast
extract or corn steep liquor was required. E. coli strain NZN111
produced 108 mM succinate with a molar yield of 0.98 mol succinate
per mol of metabolized glucose (Chatterjee et al., 2001; Millard et
al., 1996; Stols and Donnelly, 1997). This strain was engineered by
inactivating two genes (pflB encoding pyruvate-formate lyase and
ldhA encoding lactate dehydrogenase), and over-expressing two E.
coli genes, malate dehydrogenase (mdh) and phosphoenol pyruvate
carboxylase (ppc), from multicopy plasmids. E. coli strain HL27659k
was engineered by mutating succinate dehydrogenase (sdhAB),
phosphate acetyltransferase (pta), acetate kinase (ackA), pyruvate
oxidase (poxB), glucose transporter (ptsG), and the isocitrate
lyase repressor (iclR). This strain produced less than 100 mM
succinate and required oxygen-limited fermentation conditions (Cox
et al., 2006; Lin et al., 2005a, 2005b, 2005c; Yun et al., 2005).
Analysis of metabolism in silica has been used to design gene
knockouts to create a pathway in E. coli that is analogous to the
native succinate pathway in Mannheimia succiniciproducens (Lee et
al., 2005 and 2006). The resulting strain, however, produced very
little succinate. Andersson et al. (2007) have reported the highest
levels of succinate production by engineered E. coli (339 mM)
containing only native genes.
[0007] Other researchers have pursued alternative approaches that
express heterologous genes in E. coli. The Rhizobium eteloti
pyruvate carboxylase (pyc) was over-expressed from a multicopy
plasmid to direct carbon flow to succinate. (Gokarn et al., 2000;
Vemuri et al., 2002a, 2002b). Strain SBS550MG was constructed by
inactivating the isocitrate lyase repressor (iclR), adhE, ldhA, and
ackA, and over-expressing the Bacillus subtilis citZ (citrate
synthase) and R. etli pyc from a multi-copy plasmid (Sanchez et
al.; 2005a). With this strain, 160 mM succinate was produced from
glucose with a molar yield of 1.6.
[0008] More complex processes have also been investigated for
succinate production (Table 1). Many of these processes include an
aerobic growth phase followed by an anaerobic production phase. The
anaerobic phase is often supplied with carbon dioxide, hydrogen, or
both (Andersson et al., 2007; Sanchez et al., 2005a and 2005b;
Sanchez et al., 2006; U.S. Pat. No. 5,869,301; Vemuri et al., 2002a
and 2002b). In a recent study with a native succinate producer, A.
succiniciproducens, electro dialysis, sparging with CO.sub.2, cell
recycle, and batch feeding were combined for the production of
succinic acid from glucose at high yield, titer and productivity
(Meynial-Salles et al., 2007).
[0009] The majority by far of scientific knowledge of E. coli is
derived from investigations in complex medium such as Luria broth
rather than mineral salts medium using low concentrations of sugar
substrates (typically 0.2% w/v; 11 mM) rather than the 5% (w/v)
glucose (278 mM) and 10% (w/v) glucose (555 mM) used in the studies
reported herein. Large amounts of sugar are required to produce
commercially significant levels of product. Previous researchers
have described the construction of many E. coli derivatives for
succinate production in complex medium (Table 1). With complex
medium, rational design based on primary pathways has been
reasonably successful for academic demonstrations of metabolic
engineering. However, the use of complex nutrients for production
of bacterial fermentation products increases the cost of materials,
the cost of purification, and the cost associated with waste
disposal. Use of mineral salts medium without complex media
components should be much more cost-effective.
[0010] E. coli C grows well in NBS mineral salts medium containing
glucose and produces a mixture of lactate, acetate, ethanol and
succinate as fermentation products (FIG. 1A; Table 4). In contrast
to other studies with E. coli (Table 1), the studies reported
herein have focused on the development of strains that are able to
convert high level of sugars into succinate using mineral salts
medium to minimize the costs of materials, succinate purification,
and waste disposal.
[0011] One aspect of the invention provides various strains of E.
coli, that produce succinate at high titers and yields in mineral
salts media during simple, pH-controlled, batch fermentations
without the need for heterologous genes or plasmids. The inventors
have surprisingly identified a number of target genes useful in
genetic manipulation of biocatalysts for achieving high efficiency
for succinic acid production.
BRIEF SUMMARY OF THE INVENTION
[0012] It is an objective of the present invention to provide a
method for obtaining a biocatalyst for manufacturing succinic acid
using biological feedstocks. The method for obtaining the
biocatalysts for succinic acid production from biological
feedstocks combines rational genetic manipulations and the process
of metabolic evolution.
[0013] In generating a biocatalysts for succinic acid production
from biological feedstocks, using a rational design derived from
our existing knowledge about the microbial metabolic pathways, a
set of genes within the bacterial chromosome are inactivated
followed by the process of metabolic evolution to select a strain
with desirable phenotype.
[0014] In one aspect of the present invention, the mutation of the
genes in the bacterial chromosome is accomplished without
introducing any exogenous genetic material.
[0015] In another aspect of the present invention the mutation of
the endogenous genes are accomplished either by introducing point
mutation or by introducing a stop codon in the open reading frame
of the endogenous gene.
[0016] In another aspect of the present invention the entire open
reading frame of the endogenous gene is deleted from the
chromosomal DNA.
[0017] In certain preferred embodiments of the invention, the
expression of certain endogenous genes is significantly increased.
In one aspect of the present invention, the transcription of the
endogenous gene is increased by means of introducing certain
mutations in the promoter region of the endogenous genes. In other
aspect of the invention, the transcription of the endogenous gene
is enhanced by means of reliving the repressive control of the
target gene.
[0018] In certain aspect of the present invention, an exogenous
nucleotide sequence may be introduced to inactivate a target gene
for the purpose of selecting a bacterial strain with a mutated gene
with desirable phenotype. In the most preferred aspect of the
present invention, the exogenous nucleotide sequence introduced
into the microbial genome is subsequently removed in a seamless
fashion without leaving behind any residual exogenous nucleotide
sequence.
[0019] The rationally designed genetic manipulations can all be
done in a single stage or in multiple stages in which a single
genetic change is accomplished at one time. The microbial strain
resulting from genetic manipulations may be subjected to metabolic
evolution in order to improve the yield, titer and volumetric
productivity of the desired organic acid. In the most preferred
aspect of the present invention, the rational genetic manipulations
are done in stages and the process of metabolic evolution is
carried out in between the stages of genetic manipulation.
[0020] In one embodiment of the present invention, the spontaneous
mutations that occur during the metabolic evolution are identified
through sequencing appropriate regions of the chromosomal DNA. In
yet another embodiment of the present invention, the mutations that
occur during the metabolic evolution are identified by measuring
the activities of suspect enzyme.
[0021] In one embodiment of the present invention, based on
rational designing, one or more of the genes coding for the
proteins known to function in the fermentative pathways are
inactivated through one or more mutations.
[0022] It yet another aspect of the present invention, the genes
which are functional homologues of the genes coding for the
proteins functioning in the fermentative pathway are inactivated
beside the genes coding for the proteins directly involved in the
fermentative pathway.
[0023] In one embodiment of the present invention the genes
functioning within the TCA cycle are genetically manipulated so
that there is an increased flow of carbon towards succinic acid
production. In one aspect of the present invention, the carbon flow
through reductive arm of the TCA cycle is enhanced. In another
aspect of the present invention, the carbon flow through oxidative
arm of the TCA cycle is genetically manipulated. In another aspect
of the present invention, the carbon flow to succinic acid is
improved through genetic manipulation of glyoxalate bypass pathway
closely associated with TCA cycle.
[0024] In yet another embodiment of the present invention, the
carbon flow from TCA to other metabolic pathways within the cell is
blocked so that the carbon pool within the cell is funneled towards
the succinic acid production.
[0025] In another embodiment of the present invention, the carbon
flow into the TCA cycle is enhanced through genetic manipulation
leading to one of more carboxylating enzymes within the cell. In
one aspect of the present invention, the expression of one or more
carboxylating enzyme is achieved through the genetic manipulation
of the promoter region or by relieving the repression of the gene
expression.
[0026] In another embodiment of the present invention, the
phosphoenol pyruvate pool within the cell is conserved by mutating
those genes involved in the carbon uptake pathway requiring
phosphoenol pyruvate. In one aspect of the present invention, the
phosphotransferase system for carbon uptake is inactivated in order
to conserve the phosphoenol pyruvate available for the operation of
the TCA cycle.
[0027] The present invention illustrates a number of targets that
can be genetically manipulated to achieve an increased succinic
acid production. All these various targets described in the present
invention can be genetically manipulated to achieve an improved
succinic acid production. In the most preferred embodiment, a
minimum number of targets are selected for genetic manipulation to
achieve a desirable rate of succinic acid production.
[0028] In the preferred embodiment of the present invention, the
biocatalysts are selected for their ability to produce succinic
acid at high titer, yield and volumetric productivity. In the most
preferred aspect of the present invention, a biocatalyst capable of
producing at least 1.0 mole of succinic acid for every one mole of
carbon source consumed is preferred.
[0029] In another most preferred embodiment of the present
invention, the biocatalyst is selected during metabolic evolution
for its ability to produce at least 1.0 mole of succinic acid for
every mole of carbon source consumed in a mineral salt medium and
coupling the succinic acid production to microbial growth.
[0030] In yet another embodiment of the present invention,
biocatalysts capable of producing succinic acid using glycerol as a
feed stock are provided.
[0031] Additional advantage of this invention will become readily
apparent from the ensuing detailed description of the invention and
the examples provided.
BRIEF DESCRIPTION OF THE DRAWINGS
[0032] FIGS. 1A-1B. Fermentation of glucose to succinate. FIG. 1A
shows the standard pathway for fermentation of glucose by E. coli.
This pathway has been redrawn from Unden and Kleefeld (2004). Bold
arrows represent central fermentative pathways. Crosses represent
the gene deletions performed in this study to engineer KJ012 (ldhA,
adhE, ackA). Genes and enzymes: ldhA, lactate dehydrogenase; pflB,
pyruvate-formate lyase; focA, formate transporter; pta, phosphate
acetyltransferase; ackA, acetate kinase; adhE, alcohol
dehydrogenase; ppc, phosphoenolpyruvate carboxylase; pdh, pyruvate
dehydrogenase complex; gltA, citrate synthase; mdh, malate
dehydrogenase; fumA, fumB, and fumC, fumarase isozymes; frdBCD,
fumarate reductase; fdh, formate dehydrogenase; icd, isocitrate
dehydrogenase; acs, acetyl.about.CoA synthetase; mgsA,
methylglyoxal synthase; poxB, pyruvate oxidase; aldA, aldehyde
dehydrogenase; and aldB, aldehyde dehydrogenase. FIG. 1B shows the
coupling of ATP production and growth to succinate production in
engineered strains of E. coli for a standard pathway for glucose
fermentation. Solid arrows connect NADH pools. Dotted arrows
connect NAD.sup.+ pools. During glycolysis under anaerobic
conditions, growth is obligatory coupled to the production of ATP
and the oxidation of NADH.
[0033] FIGS. 2A-2D. Potential carboxylation pathways for succinate
production by E. coli. Genes encoding key carboxylating enzymes are
shown in bold. FIG. 2A shows the reaction catalyzed by
phosphoenolpyruvate (PEP) carboxylase enzyme (PPC). No ATP is
produced from the carboxylation of phosphoenolpyruvate (PEP) by the
PPC enzyme. This is regarded as the primary route for succinate
production by E. coli during glucose fermentation. FIG. 2B shows
the NADH-dependent malic enzyme. Energy is conserved during the
production of ATP from ADP and PEP by pyruvate kinase (pykA or
pykF). Malic enzyme (sfcA) catalyzes an NADH-linked, reductive
carboxylation to produce malate. FIG. 2C shows the NADPH-dependent
malic enzyme. Energy is conserved during the production of ATP from
ADP and PEP by pyruvate kinase (pykA or pykF). Malic enzyme (maeB)
catalyzes an NADPH-linked, reductive carboxylation to produce
malate. FIG. 2D shows the reaction catalyzed by PEP carboxykinase
(PCK). Energy is conserved by the production of ATP during the
carboxylation of PEP to produce oxaloacetic acid.
[0034] FIGS. 3A-3C. Growth during metabolic evolution of KJ012 to
produce KJ017, KJ032, and KJ060. Strain KJ012 was sequentially
transferred in NBS medium containing 5% (w/v) (FIG. 3A) and 10%
(w/v) (FIG. 3B) glucose, respectively to produce KJ017. After
deletion of focA and pflB, the resulting strain (KJ032) was
initially subcultured in medium supplemented with acetate (FIG.
3C). Acetate levels were decreased and subsequently eliminated
during further transfers to produce KJ060. Broken line represents
fermentation by KJ017 without acetate, added for comparison.
Symbol: =optical density at OD.sub.550nm.
[0035] FIGS. 4A-4F. Summary of fermentation products during the
metabolic evolution of strains for succinate production. Cultures
were supplemented with sodium acetate as indicated. Black arrows
represent the transition between fermentation conditions as
indicated by text. No formate and only small amounts of lactate
were detected during metabolic evolution of KJ032. No formate and
lactate were detected during metabolic evolution of KJ070 and
KJ072. Metabolic evolution of KJ012 to KJ017 in the medium
containing 5% w/v glucose (FIG. 4A) and in the medium containing
10% w/v glucose (FIG. 4B). Metabolic evolution of KJ032 to KJ060 in
a medium containing 5% w/v glucose (FIG. 4C) and 10% w/v glucose
(FIG. 4D). Metabolic evolution of KJ070 to KJ071 in the medium
containing 10% glucose (FIG. 4E). Metabolic evolution of KJ072 to
KJ073 in the medium containing 10% glucose (FIG. 4F). Symbols for
FIG. 4A-4F: , succinate; .quadrature., formate; .DELTA., acetate;
.tangle-solidup., malate; .diamond-solid., lactate; and ,
pyruvate.
[0036] FIG. 5. Diagram summarizing steps in the genetic engineering
and metabolic evolution of E. coli C as a biocatalyst for succinate
production. This process represents 261 serial transfers providing
over 2000 generations of growth-based selection. Clones were
isolated from the final culture of each regimen and assigned strain
designations, shown in parenthesis in Table 4.
[0037] FIG. 6. Standard pathway for the fermentation of
glucose-6-phosphate with associated pathways showing the genes that
have been deliberately deleted in constructs engineered for
succinate production. Solid arrows represent central fermentative
pathways. Dashed arrow represents the microaerophilic pathway for
the oxidation of pyruvate to acetate. Dotted arrows show pathways
including glyoxylate bypass that normally function during aerobic
metabolism. Boxed crosses represent the three initial gene
deletions (ldhA, adhE, ackA) that were used to construct KJ012 and
KJ017. Plain crosses mark additional genes that were deleted during
the construction of KJ017 derivatives: KJ032 (ldhA, adhE, ackA,
focA, pflB), and KJ070 (ldhA, adhE, ackA, focA, pflB, mgsA), and
KJ072 (ldhA, adhE, ackA, focA, pflB, mgsA, poxB). Genes and
enzymes: ldhA, lactate dehydrogenase; focA, formate transporter;
pflB, pyruvate-formate lyase; pta, phosphate acetyltransferase;
ackA, acetate kinase; adhE, alcohol dehydrogenase; ppc,
phosphoenolpyruvate carboxylase; pdh, pyruvate dehydrogenase
complex; gltA, citrate synthase; mdh, malate dehydrogenase; fumA,
fumB, and fumC, fumarase isozymes; frdABCD, fumarate reductase;
fdh, formate dehydrogenase; mgsA, methylglyoxal synthase; gloAB,
glyoxylase I and II; poxB, pyruvate oxidase; aceA, isocitrate
lyase; aceB, malate synthase; acnAB, aconitase; and acs,
acetyl.about.CoA synthetase.
[0038] FIGS. 7A-7C. Production of succinate and malate in mineral
salts media with 10% glucose (w/v) by derivatives of E. coli C.
FIG. 7A shows succinate production by KJ060 in AM1 medium. FIG. 7B
shows succinate production by KJ073 in AM1 medium. FIG. 7C shows
production of malate by KJ071 in NBS medium. Fermentations were
inoculated at a level of 33 mg DCW l.sup.-1. Symbols for FIG.
7A-7C: .smallcircle., glucose; , succinate; .box-solid., malate;
.DELTA., cell mass.
[0039] FIG. 8. Steps involved in the construction of plasmid
pLOI4162. Short solid arrows associated with pEL04 and pLOI4152
represent primers used for DNA amplification.
[0040] FIG. 9. Succinate production from glucose-6-phosphate in
KJ073. The pck gene encoding phosphoenolpyruvate carboxykinase, the
primary carboxylating enzyme involved in succinate production in
this study, is shown in reverse type. Solid arrows indicate
reactions expected to be functional during anaerobic fermentation
of glucose. Solid crosses indicate deleted genes. Boxed crosses
represent key deletions used to construct initial strain for
succinate production, KJ017 (ldhA, adhE, ackA). The dashed line
represents oxidation of pyruvate to acetate by PoxB, a process that
is typically functional only under microaerophilic conditions. The
dotted lines indicate reactions that are primarily associated with
aerobic metabolism. Genes and enzymes: ldhA, lactate dehydrogenase;
pflB, pyruvate-formate lyase; focA, formate transporter; pta,
phosphate acetyltransferase; ackA, acetate kinase; adhE, alcohol
dehydrogenase; pck, phosphoenolpyruvate carboxykinase; pdh,
pyruvate dehydrogenase complex; gltA, citrate synthase; mdh, malate
dehydrogenase; fumA, fumB, and fumC, fumarase isozymes; frdABCD,
fumarate reductase; fdh, formate dehydrogenase; icd, isocitrate
dehydrogenase; acs, acetyl.about.CoA synthetase; mgsA,
methylglyoxal synthase; poxB, pyruvate oxidase; aldA, aldehyde
dehydrogenase; and aldB, aldehyde dehydrogenase. The tdcE gene
(pyruvate formate-lyase, homologous to pflB) and tcdD gene
(propionate kinase, homologous to ackA) are shown in parenthesis
and are typically expressed during threonine degradation.
[0041] FIG. 10. Expanded portion of metabolism illustrating the
pathways of additional genes that have been deleted (solid
crosses). Succinate and acetate are principal products (boxed) from
KJ073 fermentations. Genes and enzymes: citDEF, citrate lyase;
gltA, citrate synthase; aspC, aspartate aminotransferase; pck,
phosphoenolpyruvate carboxykinase; sfcA, NAD.sup.+-linked malic
enzyme; fumA & fumB, fumarase; frdABCD, fumarate reductase;
pykA & pykF, pyruvate kinase; tdcE, pyruvate formate-lyase
(homologue of pflB); pta, phosphate transacetylase; tcdD, acetate
kinase (homologue of ackA).
[0042] FIG. 11. Glucose fermentation in E. coli strains engineered
for succinate production. The 5 solid stars indicate metabolic
steps that have been blocked by constructing deletions. The 2 open
stars indicate metabolic steps that have been blocked by mutations
acquired during metabolic evolution. Dotted arrows indicate
non-functional or weakly functional activities in
succinate-producing mutants (KJ060 and KJ073). Bold arrows in the
vertical direction indicate the primary pathway for succinate
production in KJ060 and KJ073. This pathway is functionally
equivalent to that of succinate-producing rumen bacteria. The two
genes galP and pck were transcriptionally activated during strain
development. A deletion in ptsI was acquired during growth-based
selection (open star), inactivating the native glucose
phosphotransferase system for uptake and phosphorylation. GalP was
subsequently found to serve as the primary transporter for glucose
with ATP-dependent phosphorylation by glucokinase (glk).
[0043] FIGS. 12A-12C. Comparison of transcript abundance of the
engineered succinate-producing strains. FIG. 12A shows the relative
abundance of transcripts for the genes pck, ppc, sfcA and maeB in
ATCC8739, KJ012, KJ017, KJ060, KJ071 and KJ073 strains of E. coli.
FIG. 12B shows the relative abundance of transcripts for the genes
related to glucose utilization namely cyaA, crp, ptsG, galP and glk
in ATCC8739, KJ012, KJ017, KJ060, KJ071 and KJ073 strains of E.
coli. FIG. 12C shows the relative abundance of transcripts for the
genes ptsI and crr gene in the ATCC8739, KJ012, KJ017, KJ060, KJ071
and KJ073 strains of E. coli.
[0044] FIG. 13. Anaerobic metabolism of E. coli using the mixed
acid fermentation pathway. (Bock & Sawers, 1996). The native
mixed acid pathway is shown with black arrows. Additional reactions
for glucose uptake, carboxylation, and acetyl-CoA synthesis are
shown with dotted arrows. Dotted bold arrows indicate new metabolic
steps that have been recruited for succinate production in E. coli
mutants. Reactions that have been blocked by gene deletions or
point mutations are marked with an X. The pck* indicates a novel
mutation that de-repressed phosphoenolpyruvate carboxykinase,
increasing activity and allowing this enzyme to serve as the
primary route for oxaloacetate production. Pyruvate (boxed) appears
at two sites in this diagram but exists as a single intracellular
pool.
[0045] FIG. 14. Generally recognized pathways for the glycerol
catabolism combined with mixed acid fermentation (anaerobic) in
wild type E. coli. These pathways are based on a combination of the
most current reviews in EcoSal, data available in Ecocyc, and a
review of primary literature. (Bachler et al., 2005; Berman and
Lin, 1971; Bock and Sawers, 1996; Erni et al., 2006; Gutknecht et
al., 2001; Jin et al., 1983; Keseler et al., 2005; Lin, 1996; Tang
et al., 1982). Bold arrows indicate the pathways generally regarded
as dominant for glycerol catabolism and for mixed acid
fermentation. Thin arrows show a pathway regarded as cryptic and
nonfunctional in wild type E. coli (Jin et al., 1983; Tang et al.,
1982) involving dihydroxyacetone as an intermediate. This pathway
is thought to function only in mutants in which glpK is inactive.
(Jin et al., 1983; Tang et al., 1982). A thin arrow is also shown
for glpD, the dehydrogenase thought to function during aerobic
metabolism as a replacement for glpABC (anaerobic metabolism).
Abbreviations: DHA, dihydroxyacetone; DHAP, dihydroxyacetone
3-phosphate; PEP, phosphoenolpyruvate; G3P, glycerol 3-phosphate;
and GA3P, glyceraldehydes 3-phosphate. PEP is boxed to indicate a
common pool.
[0046] FIG. 15. Novel E. coli pathway for the anaerobic production
of succinate from glycerol in mineral salts medium. Bold arrows
indicate the primary route for the anaerobic catabolism of glycerol
in strains such as XZ721 containing three core mutations for
succinate production. Dotted arrows show pathways that have been
blocked by mutations in pflB and ptsI. In this pathway, mutational
activation of phosphoenolpyruvate carboxykinase (pck*) allows this
enzyme to serve as the dominant carboxylation step for the
production of oxaloacetate. Unlike the alternative carboxylating
enzyme, phosphoenolpyruvate carboxylase (PPC), PCK conserves energy
to produce additional ATP for biosynthesis.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0047] As used in the present invention, the term "titer" means the
molar concentration of particular compound in the fermentation
broth. Thus in the fermentation process for the production of
succinic acid according to the present invention, a succinic acid
titer of 100 mM would mean that the fermentation broth at the time
of measurement contained 100 mMoles of succinic acid per liter of
the fermentation broth.
[0048] As used in the present invention, the term "yield" refers to
the moles of particular compound produced per mole of the feedstock
consumed during the fermentation process. Thus in the fermentative
process for the production of succinic acid using glucose as the
feedstock, the term yield refers to the number of moles of succinic
acid produced per mole of glucose consumed.
[0049] As used in the present invention, the term "volumetric
productivity" refers to the amount of particular compound in grams
produced per unit volume per unit time. Thus a volumetric
productivity value of 0.9 g L.sup.-1 h.sup.-1 for succinic acid
would mean that 0.9 gram succinic acid is accumulated in one liter
of fermentation broth during an hour of growth.
[0050] The terms "titer," "yield," and "volumetric productivity" as
used in this invention also include "normalized titer," "normalized
yield," and "normalized volumetric productivity." In the
determination of the normalized titer, normalized yield, and
normalized volumetric productivity, the volume of the neutralizing
reagents added to the fermentation vessel in order to maintain the
pH of the growth medium is also taken into consideration.
[0051] The terms "genetically engineered" or "genetically modified"
as used herein refers to the practice of altering the expression of
one or more enzymes in the microorganisms through manipulating the
genomic DNA of the microorganisms.
[0052] The present invention provides a process for the production
of succinic acid in commercially significant quantities from the
carbon compounds by genetically modified bacterial strains (GMBS).
Disclosed in this present invention are the microorganisms suitable
for the production of succinic acid through fermentative
process.
[0053] As used in the present invention, the term "gene" includes
the open reading frame of the gene as well as the upstream and
downstream regulatory sequences. The upstream regulatory region is
also referred as the promoter region of the gene. The downstream
regulatory region is also referred as the terminator sequence
region.
[0054] As used in the present invention, the term mutation refers
to genetic modifications done to the gene including the open
reading frame, upstream regulatory region and downstream regulatory
region. The gene mutations result either an up regulation or a down
regulation or complete inhibition of the transcription of the open
reading frame of the gene. The gene mutations are achieved either
by deleting the entire coding region of the gene or a portion of
the coding nucleotide sequence or by introducing a frame shift
mutation, a missense mutation, and insertion, or by introducing a
stop codon or combinations thereof.
[0055] As used in this invention, the term "exogenous" is intended
to mean that a molecule or an activity derived from outside of a
cell is introduced into the host microbial organism. In the case an
exogenous nucleic acid molecule introduced into the microbial cell,
the introduced nucleic acid may exist as an independent plasmid or
may get integrated into the host chromosomal DNA. The exogenous
nucleic acid coding for a protein may be introduced into the
microbial cell in an expressible form with its own regulatory
sequences such as promoter and terminator sequences. Alternatively,
the exogenous nucleic acid molecule may get integrated into the
host chromosomal DNA and may be under the control of the host
regulatory sequences.
[0056] The term "endogenous" refers to the molecules and activity
that are present within the host cell. When used in reference to a
biosynthetic activity, the term "exogenous" refers to an activity
that is introduced into the host reference organism. The source can
be, for example, a homologous or heterologous encoding nucleic acid
that expresses the referenced activity following introduction into
the host microbial organism. If the nucleic acid coding for a
protein is obtained from the same species of the microbial
organism, it is referred as homologous DNA. If the nucleic acid
derived from a different microbial species, it is referred as
heterologous DNA. Irrespective of the nature of the DNA, whether it
is homologous or heterologous, when introduced into a host cell,
the DNA as well as the activity derived form that introduced DNA is
referred as exogenous. Therefore, exogenous expression of an
encoding nucleic acid of the invention can utilize either or both
heterologous and homologous encoding nucleic acid.
[0057] The present invention provides GMBS showing impressive
titers, high yield and significant volumetric productivity for
succinic acid when grown under fermentative conditions in minimal
salt medium containing a carbon source as the substrate for
fermentation process. The microorganisms of the subject invention
can be employed in a single step production process using various
sugars such as hexoses, pentoses, disaccharides and other carbon
compounds such as glycerol.
[0058] In the present invention, unique and advantageous
combinations of gene mutations have been employed to direct the
carbon flow to succinic acid production. In addition, the succinic
acid production is coupled with microbial growth which in turn is
coupled to cellular ATP level and redox balance.
[0059] The term "redox balance" refers to the ability of the cell
to maintain the appropriate ratio of NADH to NAD.sup.+. In other
words, the cells are able to oxidize the NADH so that there is
enough NAD.sup.+ to oxidize the carbohydrate substrates during the
anaerobic fermentative growth. During aerobic growth, the NAD.sup.+
pool is regenerated through oxidative phosphorylation involving
NADH. However, under anaerobic growth condition the regeneration of
NAD.sup.+ pool is achieved only by means of manipulating the flow
of carbon through various metabolic pathways inside the cell which
could oxidize NADH.
[0060] In one embodiment of the present invention, the genetic
modifications involve only the manipulation of genes within the
native genome of the microorganisms. In that embodiment of the
present invention, no exogenous genetic material such as plasmid
bearing antibiotic resistance genes or any other exogenous
nucleotide sequences coding for certain enzyme proteins is
introduced into the bacterial strains used as a biocatalysts for
succinic acid production.
[0061] The recombinant microorganisms suitable for this present
invention are derived from a number of bacterial families,
preferably from the Enterobacteriaceae family. The suitable
microorganisms are selected form the genera Escherichia, Erwinia,
Providencia, and Serratia. The genus Escherichia is particularly
preferred. Within the genus Escherichia, the species Escherichia
coli is particularly preferred. Any one strain of E. coli such as
E. coli B, E. coli C, E. coli W, or the like is useful for the
present invention.
[0062] E. coli strains capable of producing organic acids in
significant quantities are well known in the art. For example, the
U.S. Patent Application Publication No. 2009/0148914 provides
strains of E. coli as a biocatalyst for the production of
chemically pure acetate and/or pyruvate. The U.S. Patent
Application Publication No. 2007/0037265 and U.S. Pat. No.
7,629,162 provide derivatives of E. coli K011 strain constructed
for the production of lactic acid. International Patent Application
published under the Patent Cooperation Treaty No. WO 2008/115958
provides microorganism engineered to produce succinate and malate
in minimal mineral salt medium containing glucose as a source of
carbon in pH-controlled batch fermentation.
[0063] In some other embodiments of the invention, bacteria that
can be modified according to the present invention include, but are
not limited to, Gluconobacter oxydans, Gluconobacter asaii,
Achromobacter delmarvae, Achromobacter viscosus, Achromobacter
lacticurn, Agrobacterium tumefaciens, Agrobacterium radiobacter,
Alcaligenes faecalis, Arthrobacter citreus, Arthrobacter tumescens,
Arthrobacter paraffineus, Arthrobacter hydrocarboglutamicus,
Arthrobacter oxydans, Aureobacterium saperdae, Azotobacter indicus,
Brevibacterium ammoniagenes, divaricaturn, Brevibacterium
lactofermentum, Brevibacterium flavum, Brevibacterium globosum,
Brevibacterium fuscum, Brevibacterium ketoglutamicum,
Brevibacterium helcolum, Brevibacterium pusillum, Brevibacterium
testaceum, Brevibacterium roseum, Brevibacterium immariophilium,
Brevibacterium linens, Brevibacterium protopharmiae,
Corynebacterium acetophilum, Corynebacterium glutamicum,
Corynebacterium callunae, Corynebacterium acetoacidophilum,
Corynebacterium acetoglutamicum, Enterobacter aerogenes, Erwinia
amylovora, Erwinia carotovora, Erwinia herbicola, Erwinia
chrysanthemi, Flavobacterium peregrinum, Flavobacterium fucatum,
Flavobacterium aurantinum, Flavobacterium rhenanum, Flavobacterium
sewanense, Flavobacterium breve, Flavobacterium meningosepticum,
Micrococcus sp. CCM825, Morganella morganii, Nocardia opaca,
Nocardia rugosa, Planococcus eucinatus, Proteus rettgeri,
Propionibacterium shermanii, Pseudomonas synxantha, Pseudomonas
azotoformans, Pseudomonas fluorescens, Pseudomonas ovalis,
Pseudomonas stutzeri, Pseudomonas acidovolans, Pseudomonas
mucidolens, Pseudomonas testosteroni, Pseudomonas aeruginosa,
Rhodococcus erythropolis, Rhodococcus rhodochrous, Rhodococcus sp.
ATCC 15592, Rhodococcus sp. ATCC 19070, Sporosarcina ureae,
Staphylococcus aureus, Vibrio metschnikovii, Vibrio tyrogenes,
Actinomadura madurae, Actinomyces violaceochromogenes,
Kitasatosporia parulosa, Streptomyces coelicolor, Streptomyces
flavelus, Streptomyces griseolus, Streptomyces lividans,
Streptomyces olivaceus, Streptomyces tanashiensis, Streptomyces
virginiae, Streptomyces antibioticus, Streptomyces cacaoi,
Streptomyces lavendulae, Streptomyces viridochromogenes, Aeromonas
salmonicida, Bacillus subtilis, Bacillus licheniformis, Bacillus
amyloliqyefaciens, Bacillus coagulans, Bacillus pumilus, Bacillus
circulans, Bacillus thiaminolyticus, Escherichia freundii,
Microbacterium ammoniaphilum, Serratia marcescens, Salmonella
typhimurium, Salmonella schottmulleri, Xanthomonas citri and so
forth.
[0064] The microorganisms suitable for the practice of present
invention can be grown aerobically (in the presence of oxygen) or
anaerobically (in the complete absence of oxygen) or micro
aerobically (with a minimal amount of oxygen supply). In the
preferred embodiment of the present invention, the microorganism
selected for the production of succinic acid is grown in an
anaerobic condition. Alternatively, the microorganisms suitable for
the present invention can be grown in a dual-phase growth regime,
wherein the microorganism is initially grown in aerobic growth
condition to reach a certain level of cell growth before
transferring it to the anaerobic growth condition to achieve the
production succinic acid in commercially significant quantities.
During the dual-phase growth for the production of succinic acid by
the microorganisms of the present invention, production and the
accumulation of the succinic acid occurs during the anaerobic
fermentative growth phase.
[0065] The present invention combines the technique of specific
genetic modifications with the process of metabolic evolution to
obtain strains showing high yield, titer and volumetric
productivity for succinic acid production under anaerobic growth
condition in the mineral salt medium with a carbohydrate
substrate.
[0066] The microbial strains obtained from genetic manipulations
would have the expected genotype for the production of succinic
acids. However, their growth rate in the minimal mineral salt
medium or the their ability to produce succinic acid at the
required yield, titer and volumetric productivity may not allow us
to use these genetically modified microorganism as a biocatalyst
for the commercial production of succinic acid through large scale
fermentation process. Therefore, the genetically modified microbial
strains obtained from genetic modifications are subsequently grown
in mineral salt medium with a carbohydrate source for several
generations to select a clone with very high yield for succinic
acid production. This process for the growth-based selection of a
clone with most preferred phenotype is referred as metabolic
evolution. During the metabolic evolution, the genetically modified
strain is repeatedly transferred into fresh minimal medium for a
period of time to obtain a clone in which the spontaneous mutations
that occurred during metabolic evolution results in a clone that
exhibits fast cell growth, rapid consumption of different carbon
sources, ability to use multiple sugars simultaneously, ability to
tolerate toxic chemicals in the carbon source and high production
yield and productivity of the desired organic acid coupled with the
low production of other organic acids.
[0067] During the metabolic evolution, attention is paid to select
the clone with the desirable phenotypes. A clone resulting from the
metabolic evolution showing a very good growth rate in mineral
medium supplemented with a carbon source but that has not improved
in the yield of the desired organic acid is not a desirable
clone.
[0068] During the process of metabolic evolution using certain
selective pressure to force the organism to acquire certain
desirable phenotype, two possible changes could occur. The organism
could simply adapt itself to the selective pressure and show a
changed phenotype. Alternatively, the organism might undergo
certain genetic changes under selective pressure and exhibit a
changed phenotype permanently. When there was only an adaptation
and there is no genetic change, the organism reverts back to its
original phenotype once the selection pressure is relieved. These
organisms are referred to as "adapted" organisms. These "adapted"
microorganisms would revert back to their original phenotype when
the selection pressure is removed. The "adapted" microorganisms
have to undergo another fresh round of metabolic evolution under
selection pressure to show a changed phenotype. On the other hand,
when there is an accompanying genetic change, the changed phenotype
will continue to exist even when there is no selection pressure.
Metabolic evolution accompanied by a certain genetic change is
desirable. The microorganism acquiring a stable genetic change
during metabolic evolution can be easily identified by means of
growing the microorganism in the original growth medium without any
selection pressure for some time before transferring it to the
fresh medium with the selection pressure. If these organisms are
able to show good growth and the expected phenotype without any lag
period, the organism is considered to have acquired a changed
genotype during metabolic evolution.
[0069] The basis of genetic change gained during the metabolic
evolution can be determined by sequencing appropriate regions
within the chromosomal DNA of the organism and comparing the
sequence data with that of the parent strain. The DNA sequence data
can be obtained by means of following the techniques well known in
the art. For example, appropriate regions of the chromosomal DNA of
the metabolically evolved strain can be obtained through polymerase
chain reaction and the product obtained through polymerase chain
reaction can be sequenced by using appropriate sequencing
primers.
[0070] The wild type E. coli strains obtained from culture
collections such as ATCC (American Type Culture Collection) can be
genetically engineered and subsequently metabolically evolved to
obtain a strain with an enhanced ability to produce succinic acid
in commercially significant amounts.
[0071] The genetic manipulations can be done in several different
stages accompanied by metabolic evolution in between the stages of
genetic manipulations. The genomic manipulations involve either
altering the endogenous DNA sequences or completely removing
specific DNA sequences from the genomic DNA. The genetic
manipulations may also involve inserting a foreign DNA sequence
within the genomic DNA sequence of the microorganism. Certain
embodiments of the present invention, the genetic manipulations are
accomplished by means of removing specific DNA sequences from the
genomic DNA of the microorganisms without introducing any foreign
DNA. Certain genetic manipulations necessary to inactivate the
expression of a gene coding for a particular protein product
requires an insertion of a foreign DNA sequence into the genome of
the microorganism to select a clone with the desired genetic
modification. For example, exogenous antibiotic marker genes can be
used to insertionally inactivate the endogenous genes and to select
the clone with desired genotype. In one embodiment of the present
invention, the introduced exogenous DNA sequences are ultimately
removed from the genomic DNA of the microorganism so that the
microorganism at the end of the genetic engineering process would
have no exogenous DNA in its original genomic DNA. Various genetic
engineering techniques necessary for accomplishing the objectives
of the preferred embodiment of the present invention have been
described in detail in two different scientific publications
(Jantama et al., 2008a; Jantama et al., 2008b). The published U.S.
Patent Applications with numbers US 2007/0037265 and US
2009/0148914 and the International patent application published
under the Patent Cooperation Treaty with International Publication
Number WO 2008/115958 also describe the genetic engineering
techniques useful in practicing various embodiments of this present
invention. These scientific publications as well as patent
documents are herein incorporated by reference for the purpose of
providing the details for genetic engineering techniques useful for
the present invention.
[0072] In order to make the microorganism to produce succinic acid
in significant quantities, various enzymes involved in a number of
microbial metabolic pathways including glycolytic pathway,
tricarboxylic acid cycle (also known as Krebs cycle or TCA cycle)
and glyoxylate shunt can be manipulated using a variety of genetic
engineering techniques described in the scientific and patent
literature cited and incorporated by references in the paragraph
above. The details about various microbial metabolic pathways can
be found in the standard biochemistry text books such as Principles
of Biochemistry, by Lehninger and Biochemistry by Lubert Stryer.
The Biochemical pathways poster by G. Michael available from Sigma
Chemical Company in St. Louis, Mo., USA also provides details about
various biochemical pathways with in a bacterial cell.
[0073] During the aerobic growth, the microbial carbon metabolism
involves glycolysis, tricarboxylic acid cycle and oxidative
phosphorylation. The reduced enzyme co-factors such as NADPH and
NADH are regenerated by the operation of oxidative phosphorylation
accompanied by ATP production required for cell growth. Under
anaerobic growth condition for the production of succinic acid in
the preferred embodiment of the present invention, the regeneration
of reduced cofactors NADPH and NADH is accomplished by directing
the carbon flow into the tricarboxylic acid cycle and eliminating
all of the fermentative pathways for regeneration of NADP.sup.- and
NAD.sup.+.
[0074] Depending on the type of organic acid preferred, the
metabolic pathways are specifically engineered so that the
microorganism produces a particular organic acid of our choice. The
microorganisms are capable of synthesizing a number of organic
acids including lactic acid, acetic acid, malic acid, pyruvic acid,
formic acid and succinic acid. Thus in developing a biocatalyst for
the production of succinic acid, the pathways for production of
acetic acid, lactic acid, pyruvic acid, and formic acid are blocked
and the carbon flow to succinic acid production is facilitated
through manipulating one or more enzymes involved in the carbon
metabolism within the cell. The list of the enzymes that are active
in the microbial fermentative pathway which can be manipulated
using the known genetic engineering techniques includes, but not
limited to, isocitrate synthetase (aceA), malate synthase (aceB),
the glyoxylate shunt operon (aceBAK), acetate
kinase-phosphotransacetylase (ackA-pta); aconitase hydratase 1 and
2 (acnA and acnB); acetyl-CoA synthetase (acs); citrate lyase
(citDEF); alcohol dehydrogenase (adhE); citrate synthase (citZ);
fumarate reductase (frd); lactate dehydrogenases (ldh); malate
dehydrogenase (mdh); aceBAK operon repressor (iclR); phosphoenol
pyruvate carboxylase (pepC); pyruvate formate lyase (pfl); pyruvate
oxidase (poxB); pyruvate carboxy kinase (pck); and pyruvate
carboxylase (pyc) (FIGS. 1, 6, and 9).
[0075] Glycolysis of carbon sources results in the production of
phosphoenol pyruvate (PEP). PEP is further metabolized by mixed
acid pathway. As used in the present invention, the term "mixed
acid pathway" refers to the flow of carbon from PEP through both
tricarboxylic acid cycle and various fermentative pathways that are
operational under anaerobic conditions. Under anaerobic conditions,
at least four different fermentative pathways for the metabolism of
pyruvate are recognizable. The pyruvate may be reduced to lactate
using the NADH and thereby producing NAD.sup.+ to maintain the
redox balance of the cell necessary for the continuous metabolism
of carbon source. The acetyl-CoA derived from pyruvate may also be
reduced to produce ethanol accompanied by the oxidation of NADH to
produce NAD.sup.+. Pyruvate may also be converted into formate or
acetate as shown in FIG. 1A.
[0076] Within the TCA cycle, two different anus are recognized. In
one arm of the TCA cycle referred as the oxidative min encompassing
the carbon flow from oxaloacetate to succinic acid through
isocitrate, the NADP.sup.+ is utilized to oxidize isocitrate with
the resulting formation of NADPH. In the other arm of the TCA cycle
referred as the reductive arm of the TCA cycle encompassing the
flow of carbon from oxaloacetate to succinic acid through malate
and fumarate, the NADH is oxidized to produce NAD.sup.+ and thereby
helping the cell to maintain the redox balance.
[0077] In one embodiment of the present invention, the carbon flow
from PEP through fermentative pathways is prevented by mean of
inactivating the genes coding for the enzymes involved in the
fermentative pathway. The enzymes suitable for blocking the carbon
flow through fermentative pathway include ldhA, pflB, adhE, pta,
ackA, and poxB. The elimination of one or more of these genes is
expected to reduce the carbon flow from PEP through the
fermentative pathway. Inactivation of all these six genes is
expected to block the carbon flow through fermentative pathway
totally. In another aspect of the present invention, the mgsA gene
coding for the methylglyoxal synthase (mgsA) responsible for the
conversion of methylglyoxal to lactic acid is inactivated beside
the inactivation of six other genes involved in the fermentative
pathway.
[0078] In yet another embodiment of the present invention, the
functional homologues of the genes involved in the fermentative
pathway are also inactivated besides inactivating the genes well
known to be involved in one or other fermentative pathway. A
propionate kinase with acetate kinase activity is encoded by the
tdcD gene which is produced only for the degradation of threonine.
However, during the anaerobic growth with 10% (w/v) glucose, the
expression of tdcD could functionally replace ackA. In addition,
the adjacent tdcE gene in the same operon is similar to pflB and
encodes .alpha.-ketobutryate formate lyase with pyruvate
formate-lyase activity. In one aspect of the present invention, the
tdcDE genes are inactivated to prevent the entry of carbon into
fermentative pathway and to assure the flow of carbon into the TCA
cycle.
[0079] In another embodiment of the present invention, besides
blocking the carbon flow through fermentative pathways, the carbon
flow within the TCA cycle is altered so that there is carbon flow
directed towards the production of succinic acid. In one aspect of
the present invention the manipulation of carbon flow within the
TCA cycle is achieved by means of up-regulating the expression of
one or more genes. In yet another aspect of the present invention,
one or more genes functioning within TCA cycle may be inactivated
to facilitate an increased carbon flow to succinic acid.
[0080] In a preferred aspect of the present invention, the gene mdh
encoding for malate dehydrogenase is up regulated to improve the
conversion of malate to fumarate and succinate. The flow of the
carbon from oxaloacetate to succinic acid through malate and
fumarate is referred as the reductive arm of the TCA cycle. The
flow of carbon through this reductive arm of the TCA cycle from
oxaloacetic acid to succinic acid would consume two moles of NADH
for every mole of succinic acid produced and thereby help in
maintaining the redox balance of the cell under anaerobic
condition. In other words, the up-regulation of mdh would help in
regenerating the NAD.sup.+ required to maintain the redox balance
of the cell. The up-regulation of mdh gene expression can be
achieved by means of replacing the native promoter for mdh gene
with some other strong promoter sequence or alternatively by means
of mutating the promoter region of the mdh gene so that there is an
increase transcription of mdh gene. Alternatively, additional
copies of the mdh gene can be added to the strain. In a preferred
embodiment of the present invention, the up regulation of mdh gene
expression is achieved by means of genetically manipulating its
promoter region.
[0081] In the regular operation of TCA cycle, succinic acid is
produced through the operation of oxidative of arm of the TCA
cycle. The flow of carbon from oxaloacetate to succinic acid
through citrate, cis-aconitate, isocitrate, .alpha.-ketoglutarate,
and succinyl-CoA is referred as the oxidative arm of the TCA cycle.
The succinic acid can also be produced through the operation of
glyoxylate bypass. During the operation of glyoxylate bypass, by
the action of isocitrate lyase, succinate and glyoxylate are
produced from isocitrate. The succinate thus produced from the
operation of oxidative arm of the TCA cycle or from the operation
of glyoxylate bypass, can be acted upon by succinate dehydrogenase
(sdh) to yield fumaric acid and then malic acid. Therefore, in yet
another embodiment of the present invention, gene inactivation can
be used to prevent the dehydrogenation of the succinate in order to
increase the intracellular succinic acid production.
[0082] In yet another aspect of the present invention, the carbon
flow through the glyoxylate bypass can be manipulated to achieve an
increase in the succinic acid production. Isocitrate lyase enzyme
catalyzes the cleavage of isocitrate to glyoxylate and succinate.
Isocitrate lyase is coded by the aceBAK operon. The isocitrate
lyase activity is suppressed by iclR genes. In other words, the
expression of iclR gene prevents the operation of glyoxylate shunt.
In one aspect of the present invention, the iclR gene is
inactivated beside the inactivation of the genes involved in the
fermentative metabolism.
[0083] In yet another embodiment of the present invention, besides
preventing the operation of the fermentative pathways and
increasing the flow of carbon within the TCA cycle towards succinic
acid production through genetic manipulations, the outward carbon
flow from the TCA cycle to other metabolic pathways can also be
blocked through genetic means to increase the succinic acid
production. For example, the flow of carbon from the TCA cycle into
amino acid metabolism can be blocked in order to improve the carbon
flow towards succinic acid. The aspartate aminotransferase gene
(aspC) transfers the amino group from glutamic acid to oxaloacetic
acid in the synthesis of aspartic acid and thereby facilitates the
outward flow of carbon from the TCA cycle. In one aspect of the
present invention, the inactivation of the aspC gene is followed to
block the outward flow of carbon from the TCA cycle in order to
improve the carbon flow from oxaloacetate towards succinic acid
production either through the oxidative or reductive arm of the TCA
cycle.
[0084] The other outward flow of the carbon from TCA cycle occurs
from malate. The decarboxylation of malate by malic enzyme (sfcA)
results in the production of pyruvate. In one aspect of the present
invention, the gene coding for the sfcA gene is inactivated to
curtail the outward flow of carbon from TCA cycle. In yet another
aspect of the present invention, both aspC and sfcA genes are
inactivated to prevent the outward flow of carbon from TCA cycle so
as to enhance the succinic acid accumulation.
[0085] In yet another aspect of the present invention, the outward
flow of carbon from TCA cycle is prevented by inactivating the
citrate lyase gene (citDEF) responsible for the cleavage of citric
acid into oxaloacetate and acetate.
[0086] Besides discovering that inactivating the genes involved in
the fermentative pathways and their functional analogues,
preventing the carbon flow out of the TCA cycle and regulating the
carbon flow towards succinic acid within the TCA cycle could
improve the succinic acid yield in the microbial fermentation, the
present invention has also surprisingly discovered that the growth
coupled succinic acid yield can further be improved by genetic
manipulations of carboxylating enzymes within the microbial cells.
While characterizing the changes that occurred during the metabolic
evolution through conducting genetic and enzyme analysis, the
inventors of the present invention have unexpectedly discovered
that the carboxylating enzymes within the cell could be yet another
target for genetic manipulation to achieve an improved succinic
acid yield.
[0087] The glycolytic intermediates phosphoenol pyruvate (PEP) and
pyruvic acid can be carboxylated to improve the carbon flow into
the TCA cycle. Under normal conditions, the carbon entry into the
TCA cycle is accomplished by the action of citrate synthase which
combines the acetyl-CoA derived from pyruvate with oxaloacetate, an
intermediate in TCA cycle, to produce citric acid. By means of
improving the efficiency of one or more carboxylating enzymes
present within the cell, it is possible to carboxylate phosphoenol
pyruvate and pyruvate to oxaloacetate, a TCA cycle intermediate
(FIG. 2). The oxaloacetate thus produced from the carboxylating
reaction can be further reduced through the reductive arm of the
TCA cycle to produce succinic acid.
[0088] The present invention provides a method for manipulating the
carboxylating enzymes present within the cell as a method to
increase the succinic acid yield during anaerobic fermentative
growth. It is well known in the art that by means of introducing
pyruvate carboxylase (pyc) from an exogenous source it is possible
to carboxylate pyruvate to oxaloacetic acid. The microbial strains
well suited for genetic manipulations such as E. coli do not have
the pyc gene. The pyc genes derived from other bacterial species
such as Rhizopium elti and Lactobacillus lacti can be introduced
into the genetically modified E. coli strains to improve succinic
acid production.
[0089] Four different endogenous carboxylating enzymes are known in
E. coli. Two of these enzymes are responsible for carboxylating
phosphoenol pyruvate and two other enzymes are responsible for the
carboxylation of pyruvate derived from phosphoenol pyruvate by the
action of pyruvate kinase enzyme. The enzyme phosphoenol pyruvate
carboxylase (ppc) carboxylates phosphoenol pyruvate to oxaloacetate
which could enter into reductive arm of the TCA cycle to produce
succinate. The second carboxylating enzyme phosphoenol pyruvate
carboxykinase (pck) also carboxylates phosphoenol pyruvate to
produce oxaloacetate, but normally catalyzes the reverse reaction
as it is not expressed in the presence of glucose. The two other
carboxylating enzymes namely NADH-linked maleic enzyme (maeB) and
the NADPH-linked maleic enzyme (maeA/sfcA) carboxylate pyruvic acid
to malic acid. The maeB and sfcA enzymes carboxylates the pyruvate
derived from phosphoenol pyruvate by the action of pyruvate
kinase.
[0090] Any one of the four carboxylating enzymes present in the
cell can be genetically manipulated to increase its enzymatic
activity in order to improve the carbon flow from glycolytic cycle
intermediates into the TCA cycle. Of the four native carboxylating
enzymes present in E. coli, the PPC-catalyzed reaction is strongly
favored. Energy contained in PEP is lost in this reaction with the
release of inorganic phosphate. The other three carboxylating
enzymes, namely pck, maeA and sfcA (maeB), are not expected to
function during the fermentative growth using glucose as the
substrate as these three carboxylating enzymes are repressed by
glucose. These three carboxylating enzymes are thought to function
in the reverse direction during gluconeogenesis when the cells are
oxidatively metabolizing organic acids.
[0091] In this invention, the inventors have surprisingly
discovered that gluconeogenic PEP carboxykinase (PCK) can be
genetically manipulated to improve the flow of carbon into the TCA
cycle. The recruitment of pck as the primary pathway for succinic
acid production in E. coli was surprising and is in contrast to our
current understanding on the functional role of pck. Previous
studies have shown that increased expression of E. coli and
Actinobacillus. succinogenes pck had no effect on succinate
production (Kim et al., 2004; Millard et al., 1996). A recent study
has demonstrated that increased expression of E. coli pck is
detrimental for growth in minimal medium, decreasing the growth
rate, the rate of glucose metabolism, and the yield of succinate.
[Kwon et al., 2008). The advantage in improving the activity of pck
lies in the fact that this enzyme while carboxylating phosphoenol
pyruvate to oxaloacetate, results in the production of a molecule
of ATP for every molecule of oxaloacetate produced. An increase in
the ATP yield would increase the growth rate of the cells.
[0092] The comparative analysis of phosphoenol pyruvate
carboxykinase activity in a number of E. coli strains constructed
during this invention has revealed that the increase in the PCK
enzyme activity during the metabolic evolution results from an
increase in the transcriptional activity of the pck gene. In those
strains showing an improvement in the cell growth-coupled succinate
production, there is an increase in the abundance of the pck
transcript. In fact, the results of the present invention have
established a positive correlation between an increase in the pck
transcript level and an increase in the PCK enzyme activity and
growth-coupled succinic acid production.
[0093] The recruitment of the native gluconeogenic pck for
fermentative succinate production can be achieved by any mutation
that positively affects the transcription of the pck gene. An
increase in the level of PCK activity can be achieved by means of
expressing the pck gene in a multicopy plasmid with a native
promoter or any other promoter sequence which is known to increase
the gene's expression. Another way to increase the expression of
the pck gene within the cell is to integrate additional copies of
the pck gene using transposons. In another embodiment of the
present invention, the native promoter of the pck gene can be
replaced by some other promoter elements known to enhance the level
of activity. An increased expression of pck gene can also be
achieved either by mutation in the promoter region of the gene or
by genetic manipulation of the regulatory elements that are known
to interact with the promoter region of the pck gene. The gene
coding for a regulator protein of the pck gene can be mutated or
deleted or overexpressed in some way in order to increase the
expression of pck gene. The results of the present invention have
indicated that a single point mutation (G to A transition at
position--64 relative to the ATG start codon of pck gene) could
increase the transcription of the pck gene accompanied by a
corresponding increase in the phosphoenol pyruvate carboxykinase
enzyme activity. A similar increase in the pck gene expression can
also achieved by genetically manipulating the genes coding for the
proteins known to regulate the expression of pck gene. For example,
Cra protein has been shown to activate the expression of pck gene
in E. coli (Saier and Ramseier, 196). Similarly the csrA system
(comprising csrA, csrB, csrC, csrD, uvrY or barA) has also been
reported to regulate the level of pck and other genes involved in
glucose metabolism by altering mRNA stability (Babitzke and Romeo,
2007; Pernestig et al., 2003; Suzuki K et al., 2002).
[0094] Yet another genetic approach of the present invention to
increase the growth-coupled succinic acid production during the
anaerobic fermentation process is concerned with the conservation
of energy expended in sugar uptake by the biocatalysts.
[0095] The microorganisms take up the sugars through a set of
transporter proteins located on the cytoplasmic membrane (Jojima et
al., 2010). The microbial sugar transporters fall within three
major categories. The largest group of sugar transporters in the
bacteria is known as ATP binding cassette (ABC) transporters. As
the name implies, the ABC transporters require a molecule of ATP
for every molecule of sugar transported into the bacterial cell.
XylFGH is an ABC transporter for the transport of xylose, a pentose
sugar, into the cell. AraFGH is an ABC transporter for the
transport of arabinose, yet another pentose sugar.
[0096] The second type of bacterial sugar transporters are grouped
under Major Facilitator Super family (MFS). Within the MFS sugar
transporters, two different categories of transporter are
recognized. MFS includes H.sup.+-linked symporters, Na.sup.+-linked
symporters-antiporters and uniporters. The uniporters are simple
facilitators for the sugar transport and require a molecule of ATP
for every molecule of sugar transported into the cell. The
trans-membrane protein Glf in E. coli is an example of uniporter.
The H.sup.+-symporters require a proton and a molecule of ATP for
every sugar molecule transported into the cell. The GalP protein in
E. coli is a symporter for the transport of galactose, a hexose
sugar, into the cell. GalP is a very well characterized symporter
with 12 trans-membrane loops. GalP is also reported to have the
ability to transport glucose across the cell membrane. AraE is a
proton-linked symporter for the transport of arabinose across the
cell membrane. Similarly XylE protein is a proton-linked symporter
for the transport of xylose.
[0097] The third sugar transporter primarily responsible for the
uptake of hexose sugars such as glucose is known as the
phosphoenolpyruvate: carbohydrate phosphotransferase system (PTS).
Transfer of the phosphoryl group from phosphoenolpyruvate (PEP)
catalyzed by PTS drives the transport and phosphorylation of
glucose and results in the formation of glucose 6-phosphate and
pyruvic acid inside the cell. PTS generated pyruvic acid is
apparently not recycled to PEP under aerobic culture conditions
where glucose is the sole source of carbon. Rather, pyruvate is
oxidized by way of the tricarboxylic acid cycle to carbon dioxide.
Thus, for the transport of every single molecule of glucose, a
molecule of PEP is consumed. In terms of cellular bioenergetics,
the transport of sugars through PTS is an energy intensive process.
Therefore in cells growing anaerobically, where there is a need to
conserve the phosphoenolpyruvate content within the cells for the
production of industrially useful chemicals, it is desirable to
replace the PTS with some other sugar transporters not requiring a
molecule of PEP for every molecule of sugar transported into the
cell.
[0098] Besides these genes directly involved in the glycolysis,
tricarboxylic acid cycle and glyoxylate shunt of microbial
metabolic pathways, genetic manipulation of the genes involved in
the uptake of carbon compounds useful as a source of energy for the
synthesis of succinic acid can also be manipulated either to
enhance the carbon uptake or to enhance the efficiency of energy
utilization in organic acid production. For example the elimination
of the glucose uptake by the phosphotransferase system (PTS) could
help in reducing the energy spent on glucose uptake into the
microbial cell. The energy conserved by manipulating the PTS can be
channeled to improve the efficiency of organic acid production. The
phosphotransferase system genes ptsH and ptsG can be manipulated to
conserve the energy in glucose uptake and thereby improve the
efficiency of succinic acid production by microorganism. Thus by
mining the data available in the area of microbial metabolic
pathways, one can delete a set of genes so as to block most of the
metabolic pathways and channel the carbon flow to the production of
succinic acid with great efficiency.
[0099] PTS is comprised of two cytoplasmic components namely EI and
HPr and a membrane-bound component EII. E. coli contains at least
15 different EII complexes. Each EII component is specific to a
sugar type to be transported and contains two hydrophobic integral
membrane domains (C and D) and two hydrophilic domains (A and B).
These four domains together are responsible for the transport and
phosphorylation of the sugar molecules. EI protein transfers the
phosphate group from PEP to HPr protein. EII protein transfers the
phosphate group from phosphorylated HPr protein to the sugar
molecule.
[0100] EI is encoded by the ptsI gene. HPr is encoded by the ptsH
gene. The glucose-specific EII complex of enteric bacteria consists
of two distinct proteins namely, EIIA.sup.Glc encoded by the gene
crr and the membrane-associated protein EIICB.sup.Glc encoded by
the gene ptsG. The PTS mediated sugar transport can be inhibited by
means of deleting one of these genes coding for the proteins
associated with PTS. Functional replacement of PTS by alternative
phosphoenolpyruvate-independent uptake and phosphorylation
activities is one of the genetic approaches for achieving
significant improvements in product yield from glucose and
productivity for several classes of metabolites.
[0101] With the inhibition the PTS-mediated glucose uptake, other
systems for glucose uptake can be activated to assure the continued
availability of glucose within the cell for the production of the
industrially useful chemicals. For example, the glf gene coding for
glucose permease, a glucose uniporter, has been shown to substitute
for the loss of PTS mediated glucose uptake. Similarly the over
expression of galP and glk genes are reported to enhance the
glucose uptake and phosphorylation in the pts.sup.- strain of E.
coli. GalP is a symporter for the uptake of galactose, a hexose
sugar. GalP has been reported to transport glucose in the pts.sup.-
strain The significance of GalP mediated glucose uptake is evidence
by the fact that the inactivation of galP gene in the pts.sup.-
mutant is found to be lethal (Yi et al., 2003). Glk is necessary to
achieve the phosphorylation of the glucose molecule before it can
enter into glycolysis. The expression of the GalP protein in the
pts.sup.- strain can be achieved either by expressing an exogenous
gene under a constitutive promoter or by means of relieving the
repression of the galP expression through mutations in genes coding
for the repressor of the galP gene such as galS and galR.
[0102] As described above, the succinic acid production using
microbial catalysts can be achieved by means of genetic
manipulation accompanied by metabolic evolution. The genetic
changes that occur during the metabolic evolution can be identified
through biochemical and genetic analysis. The present invention
have surprisingly discovered that mutations occurring in the genes
for the phosphotransferase system and carboxylating enzymes present
within the cell could positively contribute to the increase in the
succinic acid production. These newly discovered targets for
genetic manipulations can be combined with the other targets in the
glycolytic, tricarboxylic acid and fermentative pathways in several
different ways to generate biocatalysts with high efficiency for
succinic acid production. It is also highly desirable to identify a
set of a minimal number of target genes for genetic manipulation in
order to achieve the best succinic acid producing strains.
[0103] The invention also provides genetic approaches to enhance
glycerol utilization in succinic acid production. The glycerol
uptake is mediated by the protein coded by glpF gene. Once taken
into the cell, glycerol is oxidized by the protein coded by gldA
gene to produce dihydroxy acetone (DHA). The DHA is phosphorylated
to dihydroxy acetone phosphate (DHAP) by the proteins coded by
dhaKLM operon. The phosphorylation of DHA to DHAP by the proteins
coded by dhaKLM is dependent on the availability of the phosphoenol
pyruvate (PEP) pool. Since the phosphorylation of DHA requires PEP,
it depletes the PEP available for PCK which directs the flow of
carbon from PEP into the TCA cycle in order to assure proper redox
balance required to achieve high succinic acid yield. The present
invention has surprisingly found that preventing the flow of
glycerol through the gldA and dhaKLM pathways in a bacterial cell
having an increased PCK enzymatic activity could enhance the
succinic acid yield using glycerol as the carbon source. The
present invention has also surprisingly discovered that further
improvement in succinic acid yield using glycerol as the carbon
source can be achieved by means of preventing the carbon flow
through fermentative pathways in a bacterial cell with improved PCK
enzyme activity and deletions in the gldA gene and dhaKLM
operon.
[0104] The following examples are provided as way of illustrating
the present invention. These inventions in no way limit the scope
of this invention. A person experienced in the field of industrial
microbiology would be able to practice the present invention in
several different embodiments without violating the spirit of the
present invention.
EXPERIMENTAL SECTION
General Remarks
Strains, Media and Growth Conditions
[0105] New derivatives of E. coli C (ATCC 8739) were developed for
succinate production using a unique combination of gene deletions
coupled with growth-based selection. The various strain of E. coli
developed in the present invention have been deposited with ARS
Culture Collection with accession numbers as shown in Table 2.
[0106] The microbial organism of the present invention can be grown
in a number of different culture media well known in the field of
microbiology. For example, the wild type and mutant strains of E.
coli are grown in Luria-Bertani (LB) medium containing 1% (w/v)
tryptone, 0.5% (w/v) yeast extract, and 0.5% (w/v) NaCl. For the
commercial production of the organic acid using fermentative
process involving genetically modified microorganism as
biocatalyst, a minimal mineral salt medium supplemented with a
carbon source is preferred. The use of a minimal mineral salt
medium as opposed to a rich medium like LB medium reduces the cost
for the production of organic acids in a commercial scale.
[0107] The minimal mineral mediums suitable for the present
invention include NBS medium (Causey et al., 2007) and AMI medium
(Martinez et al., 2007). The NBS medium contains 1 mM betaine,
25.72 mM KH.sub.2PO.sub.4, 28.71 mM K.sub.2HPO.sub.4, 26.50 mM
(NH.sub.4)2HPO.sub.4, 1 mM MgSO.sub.4.7H2O, 0.1 mM
CaCl.sub.2.2H.sub.20, 0.15 mM Thiamine HCl, 5.92 .mu.M
FeCl.sub.36H.sub.2O, 0.84 COCl.sub.2.6H.sub.2O, 0.59 .mu.M
CuCl.sub.2.2H.sub.2O, 1.47 .mu.M ZnCl.sub.2, 0.83 .mu.M
Na.sub.2MoO.sub.4 2H.sub.2O, and 0.81 .mu.M H.sub.3BO.sub.3. The
AM1 medium contains 1 mM betaine, 19.92 mM (NH.sub.4)2HPO.sub.4,
7.56 mM NH.sub.4H.sub.2PO.sub.4, 1.5 mM MgSO.sub.4.7H2O, 1.0 mM
Betaine-KCl, 8.88 .mu.M FeCl.sub.36H.sub.20, 1, 26 .mu.M
COCl.sub.2.6H.sub.2O, 0.88 .mu.M CuCl.sub.2.2H.sub.2O, 2.20 .mu.M
ZnCl.sub.2, 1.24 .mu.M Na.sub.2MoO.sub.42H.sub.2O, 1.21 .mu.M
H.sub.3BO.sub.3 and 2,50 .mu.M MnCl.sub.24H.sub.2O. The trace
elements are prepared as a 1000.times. stock and contained the
following components: 1.6 g/L FeCl.sub.3, 0.2 g/L
CoCl.sub.2.6H.sub.2O, 0.1 g/L CuCl.sub.2, 0.2 g/L
ZnCl.sub.2.4H.sub.2O, 0.2 g/L NaMoO.sub.4, 0.05 g/L
H.sub.3BO.sub.3, and 0.33 g/L MnCl.sub.2.4H.sub.2O.
[0108] The mineral medium for microbial production of organic acid
is supplemented with a carbon source. The carbon sources useful in
the present invention include but are not limited to pentose sugars
like xylose, hexose sugars like glucose, fructose, and galactose
and glycerol. The carbon source can also be satisfied by providing
a combination of different sugars such as a combination of glucose
and xylose. The carbon source can also be derived from a hydrolysis
of starch or lignocellulose. The hydrolysis of complex
carbohydrates such as starch and lignocelluloses can be achieved
either by using thermo-chemical conversion processes or enzymatic
methods well known in the art. The preferred carbon source for the
industrial production of organic acid using microbial fermentation
is lignocellulosic hydrolysate derived from the hydrolysis of
agricultural or forestry wastes. The lignocellulosic hydrolysate
may further be fractionated to yield a hexose-enriched and a
pentose-enriched fraction and those fractions can serve as the
source of carbon for the commercial production of the organic acids
using microbial fermentation process. The lignocellulosic
hydrolysate can further be detoxified to remove certain chemicals
such as furfural which are found to be toxic to a number of
microbial organisms above certain concentrations.
[0109] Bacterial strains, plasmids, and primers used in this study
are listed in Tables 3, 7, 9, 14 and 15 and are explained in detail
at the appropriate places in the specification below. During strain
construction, cultures were grown aerobically at 30, 37, or
39.degree. C. in Luria broth (10 g l.sup.-1 Difco tryptone, 5 g
l.sup.-1 Difco yeast extract and 5 g l.sup.-1 NaCl) containing 2%
(w/v) glucose or 5% (w/v) arabinose. No genes encoding antibiotic
resistance, plasmids, or foreign genes are present in the final
strains developed for succinate production. However, during the
early stages of construction of the different strains, various
antibiotic resistance markers were used. The antibiotics such as
ampicillin (50 mg l.sup.-1), kanamycin (50 mg l.sup.-1), or
chloramphenicol (40 mg l.sup.1) were added as needed for antibiotic
selection process.
Fermentations
[0110] Seed cultures and fermentations were grown at 37.degree. C.,
100 rpm in NBS or AM1 mineral salts medium containing glucose, 100
mM KHCO.sub.3 and 1 mM betaine HCl. In some experiments, corn steep
liquor was used. It is a byproduct from the corn wet-milling
industry. When compared to the yeast extract and peptone, it is an
inexpensive source of vitamins and trace elements.
[0111] For fermentative succinate production, strains were grown
without antibiotics at 37.degree. C. in NBS mineral salts medium
(Causey et al., 2004) supplemented with 10% (w/v) glucose and 100
mM potassium bicarbonate unless stated otherwise. Pre-inocula for
fermentation were grown by transferring fresh colonies into a 250
ml flask (100 ml NBS medium, 2% glucose). After 16 h (37.degree.
C., 120 rpm), this culture was diluted into a small fermentation
vessel containing 300 ml NBS medium (10% glucose, 100 mM potassium
bicarbonate) to provide an inoculum of 0.033 g cell dry wt (CDW)
l.sup.-1.
[0112] Since the accumulation of organic acids in the growth medium
tends to decrease the pH of the medium, it is necessary to add
appropriate neutralizing agents as required to the culture medium.
The pH of the culture vessel can be continuously monitored using a
pH probe, and appropriate base can be added to maintain the pH of
the growth medium around neutral pH. The bases suitable for
maintaining the pH of the microbial culture include, but not
limited to, NaOH, KOH, NH.sub.4SO.sub.4, Na.sub.2CO.sub.3,
NaHCO.sub.3, and NH.sub.4CO.sub.3. The bases suitable for this
purpose can be used alone or in combination.
[0113] In certain experiments, fermentations were automatically
maintained at pH 7.0 by adding base containing additional CO.sub.2
(2.4 M potassium carbonate in 1.2 M potassium hydroxide).
Subsequently, pH was maintained by adding a 1:1 mixture of 3M
K.sub.2CO.sub.3 and 6N KOH. Fermentation vessels were sealed except
for a 16 gauge needle which served as a vent for sample removal.
Anaerobiosis was rapidly achieved during growth with added
bicarbonate serving to ensure an atmosphere of CO.sub.2.
Genetic Methods
[0114] Methods for chromosomal deletions, integration, and removal
of antibiotic resistance genes have been previously described
(Datsenko and Wanner, 2000; Grabar et al., 2006; Posfai et al.,
1997; Zhou et al., 2006).
[0115] In the construction of bacterial strains used in the present
invention, chromosomal genes were deleted seamlessly without
leaving segments of foreign DNA as described previously. (Jantama
et al., 2008a, 2008b; Zhang et al., 2007). Red recombinase
technology (Gene Bridges GmbH, Dresden, Germany) was used to
facilitate chromosomal integration. Plasmids and primers used
during construction are listed in Tables 3, 7, 9, 14, and 15.
Plasmids and primers used in the construction of the strains KJ012,
KJ017, KJ032, KJ060, KJ070, KJ071, KJ072, KJ073, and SZ204 are
summarized in Table 3. Sense primers contain sequences
corresponding to the N-terminus of each targeted gene (boldface
type) followed by 20 bp (underlined) corresponding to the
FRT-kan-FRT cassette. Anti-sense primers contain sequences
corresponding to the C-terminal region of each targeted gene
(boldface type) followed by 20 bp (underlined) corresponding to the
cassette. Amplified DNA fragments were electroporated into E. coli
strains harboring Red recombinase (pKD46). In resulting
recombinants, the FRT-kan-FRT cassette replaced the deleted region
of the target gene by homologous recombination (double-crossover
event). The resistance gene (FRT-kan-FRT) was subsequently excised
from the chromosome with FLP recombinase using plasmid pFT-A,
leaving a scar region containing one FRT site. Chromosomal
deletions and integrations were verified by testing for antibiotic
markers, PCR analysis, and analysis of fermentation products.
Generalized P1 phage transduction (Miller, 1992) was used to
transfer the .DELTA.focA-pflB::FRT-kan-FRT mutation from strain
SZ204 into strain KJ017 to produce KJ032.
Deletion of FRT Markers in the adhE, ldhA, and focA-pflB
Regions
[0116] The strategy used to make sequential gene deletions and
remove the FRT markers from the adhE, ldhA and focA-pflB loci has
been described previously (Datsenko and Wanner, 2000; Grabar et
al., 2006; Jantama et al., 2008b; Zhang et al., 2007). Plasmid
pLOI4151 was used as a source of a cat-sacB cassette and Red
recombinase (pKD46) was used to facilitate double-crossover,
homologous recombination events. Chloramphenicol resistance was
used to select for integration. Growth with sucrose was used to
select for loss of sacB. With this approach, successive deletions
were constructed to produce derivatives of KJ079 that eliminated
all FRT sites. Primers and plasmids used in the removal of FRT
markers from the adhE, ldhA and focA-pflB loci are listed in Table
3.
[0117] To remove the FRT site in the .DELTA.adhE region, hybrid
primers (WMadhEA/C) for .DELTA.adhE::FRT target region were
designed to contain approximately 50 bp of homology to the 5' and
3' regions of .DELTA.adhE:: FRT site and 20 bp corresponding to
cat-sacB gene from pLOI4151. These primers were used for PCR
amplification of the cat-sacB cassette using pLOI4151 as a
template. The resulting PCR product was used to replace the FRT
site in .DELTA.adhE region with a cat-sacB cassette by a
double-crossover, homologous recombination event with selection for
resistance to chloramphenicol, to produce TG200.
[0118] The adhE gene and surrounding sequence were amplified from
E. coli C using up/downadhE primers. The PCR product containing
ychE'-adhE-ychG' (3.44 kb) was cloned into pCR2.1-TOPO, yielding
pLOI4413. A second set of primers (IO-adhEup/down) was used to
amplify the inside-out product with pLOI4413 as a template and Pfu
polymerase to yield a blunt-ended product in which a 2.6 kb
internal segment of adhE sequence was deleted. This inside-out PCR
product was kinase-treated and self-ligated, resulting in pLOI4419.
The PCR product amplified from pLOI4419 (up/downadhE primers) was
used to replace the cat-sacB cassette in TG200 with the desired
chromosomal sequence by another double, homologous recombination
event, with sucrose selection for loss of sacB. The resulting
strain was designated TG201 (KJ079 with the FRT removed from
.DELTA.adhE region).
[0119] The FRT sites in the .DELTA.ldhA and .DELTA.(focA-pflB)
regions were removed in a manner analogous to that used to delete
the adhE::FRT site. Additional primer sets (ldhAA/C and
IO-ldhAup/down) used to remove the FRT site in .DELTA.ldhA are
included in Table 7 together with the corresponding plasmids
(pLOI4430 and pLOI4432). Strain TG202 was produced by replacing
this region in TG201 with the PCR product from pLOI4151 (WMldhAA/C
primers). The cat-sacB cassette in TG202 was replaced with the PCR
product from pLOI4432 (ldhAA/C primers) with sucrose selection for
loss of sacB to produce TG203.
[0120] Primer sets (upfocA/MidpflA and IO-ycaOup/IO-midpflAdown)
and corresponding plasmids (pLOI4415 and pLOI4421) used to remove
the FRT site in .DELTA.(focA-pflB) are included in Table 7. Strain
TG204 was produced by replacing this region in TG203 with the PCR
product from pLOI4151 (WMpflBA/C primers). The cat-sacB cassette in
TG204 was replaced with the PCR product from pLOI4421
(upfocA/MidpflA primers) with sucrose selection for loss of sacB to
produce KJ091. KJ091 is a derivative of KJ073 in which all FRT
sites have been removed from the .DELTA.adhE, .DELTA.ldhA and
.DELTA.focA-pflB regions of the chromosome.
Removal of FRT Site in ackA Region and Construction of citF, sfcA,
and pta-ackA Gene Deletions
[0121] To eliminate the FRT site in the ackA region of KJ073,
plasmids containing sequences of the desired mutation were
constructed as follows. E. coli C genomic DNA was used as the
template for PCR amplification of ackA with the JMackAF1/R1 primers
that bind approximately 200 bp upstream and downstream of the ackA
gene. The linear product was cloned into pCR2.1-TOPO (Invitrogen,
Carlsbad, Calif.) to produce pLOI4158. Plasmid pLOI4158 was then
used as a template for inside-out PCR with JMackAup1/down1 primers
and Pfu polymerase to yield a blunt-ended product that lacks an
808-bp internal segment of ackA. The PacI-flanked cat-sacB cassette
(SmaI/SfoI fragment from pLOI4162) was then ligated into the blunt
PCR product to produce pLOI4159. Plasmid pLOI4159 served as a
template for PCR amplification (JMackAF1/R1 primers). This PCR
product was used to replace the FRT site in the ackA region of
KJ073 by double-crossover homologous recombination, with selection
for chloramphenicol resistance. The resulting clone was designated
KJ076.
[0122] Plasmid pLOI4159 was also digested with PacI to remove the
cat-sacB cassette and self-ligated to produce pLOI4160, retaining
the 18-bp translational stop sequence. Plasmid pLOI4160 served as a
PCR template (JMackAF1/R1 primers). This amplified fragment was
used to replace the cat-sacB cassette in KJ076 by double-crossover
homologous recombination with selection for loss of sacB. After
removal of pKD46 by growth at elevated temperature, the resulting
strain was designated KJ079. In this strain, the deleted region has
been replaced by the 18-bp translational stop sequence.
[0123] The strategy used above to remove the FRT site from the ackA
region was employed to make sequential deletions of citF, sfcA and
pta-ackA and to replace the deleted regions with the 18-bp
translational stop sequence. Additional primer sets (citFup/down
and citF2/3) used to construct the citF deletion are included in
Table 7 together with the corresponding plasmids (pLOI4629,
pLOI4630, and pLOI4631). The resulting strain was designated
KJ104.
[0124] The sfcA gene was deleted from strains KJ104 and KJ110,
resulting in strains designated KJ119 and KJ122, respectively.
Additional primer sets (sfcAup/down and sfcA1/2) used to construct
the sfcA deletions are included in Table 7 together with the
corresponding plasmids (pLOI4283, pLOI4284, and pLOI4285).
[0125] The ackA-pta operon (including the synthetic translational
stop sequence) was deleted from KJ122 to produce strain 10134.
Additional primer sets (ackAup/ptadown and ackA2/pta2) used to
construct this deletion are included in Table 7 together with the
corresponding plasmids (pLOI4710, pLOI4711, and pLOI4712). Strain
KJ134 does not contain any FRT sites or foreign genes.
Construction of pLOI4162 Containing a cat-sacB Cassette for
Markerless Gene Deletions
[0126] To facilitate the sequential deletion of chromosomal DNA,
plasmid pLOI4162 (FIG. 8) was constructed with a removable cat-sacB
cassette and the option to include an 8-bp segment of synthetic DNA
with stop codons in all reading frames. This plasmid is composed of
synthetic sequences and parts of plasmids pLOI2228
(Martinez-Morales et al., 1999), pLOI2511 (Underwood et al., 2002),
and pEL04 (Lee et al., 2001; Thomason et al, 2005). Using pEL04 as
a template, inside-out PCR was performed with the JMpEL04F1/R1
primers to eliminate unwanted SmaI and BamHI sites between the cat
and sacB genes. The amplified product was digested with Bg/II
(within both primers) and self-ligated to produce pLOI4152. Plasmid
pLOI4131 was constructed by ligation of the FRT-cat-FRT fragment
(Klenow-treated BanI, ClaI) from pLOI2228 into compatible sites of
pLOI2511 (Klenow-treated NheI, ClaI). Plasmid pLOI4131 was
subsequently digested with EcoRI and self-ligated to remove the
FRT-cat-FRT fragment to produce pLOI4145, retaining single KasI and
XmaI sites. A polylinker segment (SfPBXPS) was prepared by
annealing complementary oligonucleotides (SfPBXPSsense and
SfPBXPScomp). After digestion with KasI and XmaI, this segment was
ligated into corresponding sites of pLOI4145 to produce pLOI4153.
The modified cat-sacB cassette in pLOI4152 was amplified by PCR
using the JMcatsacBup3/down3 primer set. After digestion with BamHI
and XhoI, this cassette was ligated into corresponding sites of
pLOI4153 to produce pLOI4146. To create an 18-bp region
(5'GCCTAATTAATTAATCCC3') (SEQ ID NO: 1) with stop codons in all six
reading frames, pLOI4146 was digested with Pact and self-ligated to
produce pLOI4154 (not shown), removing the cat-sacB cassette. Two
additional bases (T and A) were inserted between the SfoI and Pad
sites of pLOI4154 using mutagenic primers (JM4161 sense/comp) and
linear plasmid amplification to produce pLOI4161. Finally, the PacI
digested fragment from pLOI4146 containing the cat-sacB cassette
was ligated into the PacI-digested site of pLOI4161 to produce
pLOI4162 (GenBank accession EU531506).
Deletion of mgsA and poxB Genes
[0127] A modified method was developed to delete E. coli
chromosomal genes using a two-step homologous recombination process
(Thomason et al., 2005). With this method, no antibiotic genes or
scar sequences remain on the chromosome after gene deletion. In the
first recombination, part of the target gene was replaced by a DNA
cassette containing a chloramphenicol resistance gene (cat) and a
levansucrase gene (sacB). In the second recombination, the cat-sacB
cassette was replaced with native sequences omitting the region of
deletion. Cells containing the sacB gene accumulate levan during
incubation with sucrose and are killed. Surviving recombinants are
highly enriched for loss of the cat-sacB cassette.
[0128] A cassette was constructed to facilitate gene deletions. The
cat-sacB region was amplified from pEL04 (Lee et al., 2001;
Thomason et al., 2005) by PCR using the JMcatsacB primer set (Table
3), digested with NheI, and ligated into the corresponding site of
pLOI3421 to produce pLOI4151. The cat-sacB cassette was amplified
by PCR using pLOI4151 (template) and the cat-up2/sacB-down2 primer
set (EcoRV site included in each primer), digested with EcoRV, and
used in subsequent ligations.
[0129] The mgsA gene and neighboring 500 bp regions
(yccT'-mgsA-helD', 1435 bp) were amplified using primer set
mgsA-up/down and cloned into the pCR2.1-TOPO vector (Invitrogen) to
produce plasmid pLOI4228. A 1000-fold diluted preparation of this
plasmid DNA served as a template for inside-out amplification using
the mgsA-1/2 primer set (both primers within the mgsA gene and
facing outward). The resulting 4958 bp fragment containing the
replicon was ligated to the amplified, EcoRV-digested cat-sacB
cassette from pLOI4151 to produce pLOI4229. This 4958 bp fragment
was also used to construct a second plasmid, pLOI4230
(phosphorylation and self-ligation). In pLOI4230, the central
region of mgsA is absent (yccT'-mgsA'-mgsA''-hel).
[0130] After digestion of pLOI4229 and pLOI4230 with XmnI (within
the vector), each served as a template for amplification using the
mgsA-up/down primer set to produce the linear DNA fragments for
integration step I (yccT'-mgsA'-cat-sacB-mgsA''-helD') and step II
(yccT'-mgsA'-mgsA''-helD'), respectively. After electroporation of
the step I fragment into KJ060 containing pKD46 (Red recombinase)
and 2 h of incubation at 30.degree. C. to allow expression and
segregation, recombinants were selected for chloramphenicol (40 mg
l.sup.-1) and ampicillin (20 mg l.sup.-1) resistance on plates
(30.degree. C., 18 h). Three clones were chosen, grown in Luria
broth with ampicillin and 5% w/v arabinose, and prepared for
electroporation. After electroporation with the step II fragment,
cells were incubated at 37.degree. C. for 4 h and transferred into
a 250-ml flask containing 100 ml of modified LB (100 mM MOPS buffer
added and NaCl omitted) containing 10% sucrose. After overnight
incubation (37.degree. C.), clones were selected on modified LB
plates (no NaCl; 100 mM MOPS added) containing 6% sucrose
(39.degree. C., 16 h). Resulting clones were tested for loss of
ampicillin and chloramphenicol resistance. Construction was further
confirmed by PCR analysis. A clone lacking the mgsA gene was
selected and designated KJ070.
[0131] The poxB gene was deleted from KJ071 in a manner analogous
to that used to delete the mgsA gene. Additional primer sets
(poxB-up/down and poxB-1/2) used to construct the poxB deletion are
included in Table 3 together with the corresponding plasmids
(pLOI4274, pLOI4275, and pLOI4276). The resulting strain was
designated KJ072.
Construction of Gene Deletions in tdcDE, and aspC
[0132] The tdcDE gene and neighboring 1000 bp regions
(tdcG'-tdcFED-tdcC', 5325 bp) were amplified using tdcDEup/down
primers and cloned into the pCR2.1-TOPO vector to produce plasmid
pLOI4515. A 1000-fold diluted preparation of this plasmid DNA
served as a template for inside-out amplification using the
tdcDEF7/R7 primers (both primers within the tdcDE gene and facing
outward). The resulting 6861 bp fragment containing the replicon
was ligated to the amplified, SmaI/SfoI-digested cat-sacB cassette
from pLOI4162 (JMcatsacBup3/down3 primers) to produce pLOI4516.
This 6861 bp fragment was also used to construct a second plasmid,
pLOI4517 (kinase treated, self-ligation) containing a deletion of
tcdD and tdcE. The PCR fragments amplified from pLOI4516 and
pLOI4517 (tdcDEup/down primers) were used to replace tdcDE region
in KJ091. The resulting clones were tested for loss of ampicillin
and chloramphenicol resistance.
[0133] The aspC gene was deleted from KJ104 in a manner analogous
to that used to delete the tdcDE gene. Additional primer sets
(aspCup/down and aspC1/2) used to construct the aspC deletion are
included in Table 7 together with the corresponding plasmids
(pLOI4280, pLOI4281, and pLOI4282). The resulting strain was
designated KJ110. Neither KJ098, nor KJ110 contain any intervening
sequence within the respective deleted regions (tdcDE and
aspC).
Construction of Gene Deletions in gldA and dhaKLM
[0134] The E. coli strains XZ464, XZ465, and XZ466 were derived
from the E. coli strain XZ632 using the genetic methods described
above. The relevant characteristic of the E. coli strains XZ464,
XZ465, XZ466 and XZ632 are provided in the Table 15.
Real Time RT-PCR Analysis
[0135] Real time RT-PCR was used to measure message RNA levels as
described previously (Jarboe et al., 2008). Cells were grown in NBS
medium with 5% or 10% glucose and harvested during mid-log growth
by swirling in a dry ice/ethanol bath, followed by centrifugation
and storage at -80.degree. C. in RNALater (Qiagen, Valencia. CA)
until purification. RNA purification was performed with RNeasy Mini
columns (Qiagen), followed by digestion with DNaseI (Invitrogen).
Reverse transcription with Superscript II (Invitrogen, Carlsbad
Calif.) used 50 ng total RNA as template. Real-time PCR was
performed in a Bio-Rad iCycler with SYBR Green RT-PCR mix (Bio-Rad,
Hercules Calif.). RNA was checked for genomic DNA contamination by
running a RT-PCR in the absence of reverse transcription.
Transcript abundance was estimated using genomic DNA as a standard
and expression levels were normalized by the birA gene, a
transcriptional repressor (Jarboe et al., 2008). RT-PCR primers
used for pck and birA are listed in Table 3.
Sequencing of pck Region
[0136] In order to know whether there was any mutation in the pck
gene of KJ073, the coding region and promoter region (about 800 bp
in front of coding region) of pck gene in both KJ012 and KJ073 were
amplified by PfuUltra High Fidelity DNA Polymerase (Stratagene;
Wilmington, Del.). Primer set pck-F/R was used to amplify the
coding region through the transcriptional terminator (Table 9).
Primer set pck-2/3 was used to amplify the promoter region. DNA
sequencing was provided by the University of Florida
Interdisciplinary Center for Biotechnology Research (with Applied
Biosystems autosequencers).
Metabolic Evolution
[0137] Cells from the pH controlled fermentations were serially
transferred at 24 hours to encourage metabolic evolution though
growth-based selection. The inoculum, approximately 1/100 of the
volume of new media, was added directly to pre-warmed, fresh media
to a starting OD.sub.550 of 0.05. Clones with improved fermentation
characteristics were isolated. The metabolic evolution strategy was
applied to improve yield of succinate production.
Analyses
[0138] Cell growth: Cell mass was estimated from the optical
density at 550 nm (OD 1.0=333 mg of cell dry weight l.sup.-1) with
a Bausch & Lomb Spectronic 70 spectrophotometer.
[0139] The production of the organic acid by the genetically
engineered microorganism can be confirmed and quantified by using
appropriate techniques well known in the art. For example, HPLC
techniques can be used to measure the quantity of the organic acid
produced by the selected clone. The HPLC technology is also helpful
in determining the purity of the organic acid produced by the
selected clones. Organic acids and sugars were determined by using
high performance liquid chromatography (Grabar et al., 2006; Zhang
et al., 2007).
[0140] Succinic acid and other organic acids present in the
fermentation broth were analyzed on Agilent 1200 HPLC apparatus
with BioRad Aminex HPX-87H column. BioRad Microguard Cation H.sup.+
was used as a guard column. The standards for HPLC analysis were
prepared in 0.008N sulfuric acid. The HPLC column temperature was
maintained at 50.degree. C. Sulfuric acid at 0.008N concentration
was used as a mobile phase at the flow rate of 0.6 ml/min.
Quantification of various components was done by measuring their
absorption at 210 nm.
Enzyme Assay
[0141] Cells were harvested by centrifugation (8,000.times.g for 5
min at 4.degree. C.) during mid-log growth, washed with cold 100 mM
Tris-HCl (pH 7.0) buffer, and resuspended in the same buffer (1
ml). After cellular disruption using a Fast Prep-24 (MP
Biomedicals, Solon, Ohio), preparations were clarified by
centrifugation (13,000.times.g for 15 min). Protein was measured by
the BCA method (Pierce, Rockford, Ill.) using bovine serum albumin
as a standard.
[0142] PEP carboxylase activity was measured as described by
Canovas and Kornberg (1969). The reaction mixture contained 100 mM
Tris-HCl buffer (pH8.0), 10 mM MgCl.sub.2, 1 mM DTT, 25 mM
NaHCO.sub.3, 0.2 mM NADH, 20 U malate dehydrogenase, and crude
extract. The assay mixture was incubated for 15 min at 37.degree.
C. to activate the enzyme, after which the reaction was started by
addition of 10 mM PEP.
[0143] PEP carboxykinase activity was measured as described by Van
der Werf et al, (1997). The reaction mixture contained 100 mM MES
buffer (pH6.6), 10 mM MgCl.sub.2, 75 mM NaHCO.sub.3, 5 mM
MnCl.sub.2, 50 mM ADP, 1 mM DTT, 0.2 mM NADH, 20 U malate
dehydrogenase, and crude extract. The reaction was started by
addition of 10 mM PEP.
[0144] Malic enzyme activity (carboxylation direction) was measured
as described by Stols and Donnelly (1997). The reaction mixture
contained 100 mM Tris-HCl buffer (pH7.5), 25 mM NaHCO.sub.3, 1 mM
MnCl.sub.2, 1 mM DTT, 0.2 mM NADH, and crude extract. The reaction
was started by addition of 25 mM pyruvate. This assay method was
unsuitable for measurement of SfcA activity in wild type E. coli
due to presence of lactate dehydrogenase.
[0145] The activity of .beta.-galactosidase was measured as
described by Miller (1992). In all assays, one unit of activity
represents the amount of enzyme required to oxidize or reduce 1
nmol of substrate per minute.
Example 1
Construction of KJ073 Strain for Succinate Production
[0146] In the construction of a strain suitable for succinic acid
production in minimal medium containing 5% glucose, both a rational
design approach and metabolic evolution were followed. By
inspection of FIG. 1 illustrating the generally accepted standard
fermentation pathways for E. coli, a rational design for the
metabolic engineering of strains producing succinate was devised in
which insertional inactivations were made in genes encoding the
terminal steps for all alternative products: lactate (ldhA),
ethanol (adhE) and acetate (ackA). Results from this metabolic
engineering by rational design were completely unexpected. The
KJ012 (.DELTA.ldhA::FRT .DELTA.adhE::FRT .DELTA.ackA::FRT) strain
resulting from the insertional inactivation of ldhA, adhE and ack
genes grew very poorly under anaerobic conditions in mineral salts
medium containing 5% glucose (278 mM) and produced acetate instead
of succinate as the primary fermentation product. Counter to
expectations from rational design, succinate remained as a minor
product. Molar yields of succinate based on metabolized glucose
were unchanged as a result of these mutations. The succinate yield
was found to be 0.2 mol succinate per mol glucose both for the
parent and KJ012 strains during fermentation in NBS mineral salts
medium containing 5% glucose. We confirmed that NBS mineral salts
medium contains all mineral nutrients needed for the growth of
KJ012 by incubating under aerobic conditions (aerobic shaken flask;
5% glucose). In aerobic shaken flasks, cell yields for KJ012 were
5-fold higher than during anaerobic growth and 75% that of the E.
coli C (parent) during anaerobic growth. These results also
confirmed that all central biosynthetic pathways remain functional
in KJ012.
[0147] When complex nutrients were present (Luria broth),
fermentative succinate production by KJ012 increased 20-fold as
compared to KJ012 in minimal salts medium and the molar yield for
succinate increased by 3.5-fold. Clearly, rational design based on
primary pathways is better suited to academic demonstrations or to
design processes intended for use with complex nutrients.
[0148] The basis for the poor growth, poor succinate production,
and the increase in acetate production by KJ012 during anaerobic
metabolism in mineral salts medium is unknown. These are unexpected
consequences that resulted from metabolic engineering using
rational design based on standard pathway charts. In minimal
medium, rationale designs for metabolic engineering clearly are not
predictable. The resulting strain, KJ012, was inferior to the
parent in growth and no better than the parent for succinate
production. KJ012(.DELTA.ldhA::FRT .DELTA.adhE::FRT
.DELTA.ackA::FRT) grew poorly in comparison to the parent E. coli
C, exhibited lower rates of succinate production, and provide no
better molar yields (Table 4).
[0149] Despite these results, serial transfer of this strain was
tried as a method to co-select improved growth and succinate
production based on the following rationale. The primary pathway
for the glucose fermentation into succinate (FIG. 1A and FIG. 2A)
is generally thought to use phosphoenolpyruvate carboxylase (ppc)
for the carboxylation step (Unden and Kleefeld, 2004; Fraenkel
1996; Keseler et al., 2005; Millard et al., 1996; Gottschalk, 1985;
Karp et al., 2007). This carboxylating enzyme does not conserve the
high energy phosphate in phosphoenolpyruvate and reduces the net
ATP available for growth. Alternative pathways for succinate
production can be envisioned using the repertoire of known E. coli
genes that could increase ATP yields and could thereby increase
growth (FIG. 1A; FIGS. 2B, 2C and 2D). However, none of these
alternative routes has been shown to function for succinate
production during fermentation with native strains of E. coli. Key
enzymes in these alternative routes are repressed by glucose and
are normally active during gluconeogenesis. Typically, levels of
these gluconeogenic enzymes vary inversely with the availability of
glucose and other metabolites (Goldie and Sanwal, 1980a; Wright and
Sanwal, 1969; Sanwal and Smando, 1969a) and function in the reverse
direction, decarboxylation (Keseler et al., 2005; Oh et al., 2002;
Kao et al., 2005; Stols and Donnelly, 1997; Samuelov et al., 1991;
Sanwal, 1970a; Delbaere et al., 2004; Goldie and Sanwal, 1980b;
Sanwal and Smando, 1969b; Sanwal 1970b).
[0150] The key enzyme for one of these, NADH-linked malic enzyme
(sfcA) (FIG. 2B), has been demonstrated to be capable of increasing
succinate production in E. coli but required overexpression from a
plasmid to do so (Stols and Donnelly, 1997). However, none of these
alternative pathways would be expected to be functional in native
strains of E. coli or KJ012 during anaerobic growth with high
levels of glucose. Serial transfers of KJ012 with selection for
improved growth offered an opportunity to select for mutational
activation of alternative routes for succinate production (FIG. 1B)
that maintained redox balance and increased ATP yields.
[0151] Metabolic evolution of KJ012 was carried out by sequentially
subculturing under various regimens using small, pH-controlled
fermentors to improve the growth. KJ012 was serially transferred in
NBS glucose medium under fermentative conditions as rapidly as
growth permitted (FIG. 3A; FIG. 4A; FIG. 5). Growth remained slow
with 4-5 days of required incubation between the first 9 transfers,
then dramatically increased allowing transfers to be made at 24
h-intervals. This event was accompanied by an increase in acetate
(FIG. 4A) with little improvement in succinate production. After 27
transfer (60 days), KOH was replaced with a 1:1 mixture of 3M
K.sub.2CO.sub.3 and 6N KOH to provide additional carbon dioxide
(100 mM initially added to all NBS mineral salts medium).
Continuing transfers led to improvements in succinate production. A
total of 40 transfers were made in 5% glucose (227 mM), followed by
another 40 transfers in 10% glucose (555 mM). During the transfers
in 10% glucose, succinate yields remained approximately 0.7 mol per
mole of glucose metabolized with lactate, acetate, and formate as
co-products (Table 4). This yield was 3-fold higher than E. coli C
and KJ012 strains. A clone was isolated and designated KJ017.
Selection for improvements in the growth of KJ012 to produce KJ017
co-selected for improvements in succinate production (rate, titer,
and molar yield).
[0152] Succinate produced by E. coli using the pathway generally
regarded as the native fermentation pathway based on
phosphoenolpyruvate carboxylase (ppc) wastes the energy of
phosphoenolpyruvate by producing inorganic phosphate. One ATP is
lost per succinate produced by this pathway (FIG. 1; FIG. 6).
Conserving this energy as ATP by using alternative enzyme systems
represents an opportunity to increase cell growth and co-select for
increased succinate production. Based on known genes in E. coli,
three other enzyme routes for succinate production were envisioned
that would conserve ATP and could thereby increase growth (FIG. 1;
FIG. 6). However, all carboxylation steps in these alternative
routes are thought to function in the reverse direction
(decarboxylation) primarily for gluconeogenesis during growth on
substrates such as organic acids (Keseler et al., 2005; Oh et al.,
2002; Kao et al., 2005; Stols and Donnelly, 1997; Samuelov et al.,
1991; Sanwal, 1970a; Delbaere et al., 2004; Goldie and Sanwal,
1980b; Sanwal and Smando, 1969b; Sanwal, 1970b). To test the
hypothesis that growth-based selection to develop KJ017 has indeed
activated one or more of these alternative routes, the activities
of the four carboxylation enzymes were compared in wild type strain
ATCC 8739, KJ012 (deleted in primary fermentation pathways), and
the metabolically evolved strain KJ017 (Table 5). PEP carboxylase
activities were similarly low in all, 20 to 30 U (mg
protein).sup.-1. NADH-linked malic enzyme activity (SfcA;
carboxylation direction) was also low and NADPH-linked malic enzyme
activity (MaeB; carboxylation direction) was undetectable. In
contrast, PEP carboxykinase activity was increased by 4-fold in
KJ017 as compared to KJ012, consistent with a hypothesis that
selection for improved growth would co-select for increased
production of succinate through increasing ATP yields, a
consequence of increasing the expression of an energy-conserving
route for succinate production.
[0153] Further growth-based selections and additional gene
deletions were used to construct many additional strains with
further improvements in growth and succinate production (FIG. 3 and
FIG. 4).
[0154] During growth with 10% (w/v) glucose, unwanted co-products
(acetate, formate, and lactate) were abundant in fermentations with
KJ017 (.DELTA.ldhA::FRT .DELTA.adhE::FRT .DELTA.ackA::FRT) despite
the deletion of genes encoding the primary lactate dehydrogenase
(ldhA) and acetate kinase (ackA) activities (Table 4). Production
of lactate and acetate could also result in higher ATP yields, a
basis for growth-based selection (FIG. 1A).
[0155] The gene encoding pyruvate formatelyase (pflB) was deleted
from KJ017 to eliminate the loss of reductant as formate and an
excess acetyl.about.CoA, a potential source of acetate. The
upstream formate transporter (focA) in this operon was also
deleted. As expected, this deleted strain (KJ032) did not grow
without acetate confirming that this is the primary route for
acetyl.about.CoA production in KJ017 (FIG. 3C). Deletion of pflB is
well-known to cause acetate auxotrophy under anaerobic conditions
(Sawers and Bock, 1988). Growth and succinate production by KJ032
were restored by the addition of 20 mM acetate (FIG. 3C, FIG. 4C,
and FIG. 5). Production of formate and acetate were substantially
reduced as a result of pflB (and focA) deletion. Although this
strain required acetate for growth, additional acetate was also
produced during fermentation. The same phenomenon was previously
reported for pflB-deleted strains during the construction of E.
coli K-12 biocatalysts for pyruvate production (Causey et al.,
2004). Lactate levels were also reduced in KJ032 (Table 4; FIG.
4C). Subsequent transfers were accompanied by improvements in
growth and succinate production. Added acetate was reduced, inocula
size was reduced, and glucose concentration was doubled (10% w/v)
during subsequent transfers (FIGS. 3D and 4D). After further
transfers, acetate was omitted and a strain was developed that was
no longer auxotrophic for acetate, presumably due to increased
expression of another gene. However, succinate yields declined upon
elimination of added acetate while malate and acetate levels
increased. A clone was isolated from the last transfer and
designated, 10060 (.DELTA.ldhA::FRT .DELTA.adhE::FRT
.DELTA.ackA::FRT .DELTA.focA-pflB::FRT). This strain produced 1
mole of succinate per mole of glucose metabolized in NBS mineral
salts medium with 10% glucose.
[0156] The small amount of lactate present in the fermentation
broths of various strains is presumed to originate from the
methylglyoxal synthase pathway (FIG. 6; Grabar et al., 2006).
Although this represents a small loss of yield, lactate production
by this pathway is indicative of methylglyoxal accumulation, an
inhibitor of both growth and glycolysis (Egyud and Szent-Gyorgyi,
1966; Grabar et al., 2006; Hopper and Cooper, 1971). Production of
methylglyoxal and lactate were eliminated by deleting the mgsA gene
(methylglyoxal synthase) in KJ060 to produce KJ070
(.DELTA.ldhA::FRT .DELTA.adhE::FRT .DELTA.ackA::FRT
.DELTA.focA-pflB::FRT .DELTA.mgsA). Strain KJ070 was initially
subcultured in 5% (w/v) glucose (FIG. 3E, FIG. 4E, and FIG. 5).
Deletion of mgsA is presumed to have increased glycolytic flux as
evidenced by the accumulation of pyruvate in the medium (Table 4).
This increase in glycolytic flux may also be responsible for the
further decline in the succinate/malate ratio due to increased
production of oxaloacetate, an allosteric inhibitor of fumarate
reductase (Iverson et al., 2002; Sanwal, 1970c).
[0157] At transfer 21, glucose was doubled to 10% (w/v) and
transfers continued. This higher level of glucose and subsequent
transfers resulted in a new strain that was isolated from the final
subculture and designated KJ071 (.DELTA.ldhA::FRT .DELTA.adhE::FRT
.DELTA.ackA::FRT .DELTA.focA-pflB::FRT .DELTA.mgsA). This strain
may be useful for malate production.
[0158] Although conversion of glucose to acetate is redox neutral,
partitioning of carbon to acetate decreases the yield of succinate
and malate. Pyruvate oxidase (poxB) represents a potential source
of acetate and CO.sub.2 during incubation under microaerophilic
conditions (Causey et al., 2004). Although it should not function
to oxidize pyruvate under anaerobic condition, poxB was targeted
for gene deletion (FIG. 6). As expected, deletion of poxB to
produce KJ072 (.DELTA.ldhA::FRT .DELTA.adhE::FRT .DELTA.ackA::FRT
.DELTA.focA-pflB::FRT .DELTA.mgsA .DELTA.poxB) did not reduce
acetate production indicating that alternative pathways are
involved in acetate production. However, eliminating poxB resulted
in unexpected changes in fermentation products, including an
increase in succinate (Table 4; FIG. 4F). The mechanism for this
improvement in succinate production is unknown but may be related
to other activities of pyruvate oxidase such as acetoin production,
decarboxylation, and carboligation (Ajl and Werkman, 1948; Chang
and Cronan, 2000).
[0159] Strain KJ072 was subjected to 40 further rounds of metabolic
evolution in AM1 medium, a lower salt medium, with 10% (w/v)
glucose (Table 4; FIG. 3F, FIG. 4F, and FIG. 5). Improvements in
growth, cell yield and succinate production were observed during
these transfers. Malate, pyruvate and acetate levels also
increased. A clone was isolated from the final transfer and
designated KJ073 (.DELTA.ldhA::FRT .DELTA.adhE::FRT
.DELTA.ackA::FRT .DELTA.pflB::FRT .DELTA.mgsA .DELTA.poxB).
[0160] The KJ073 strain retained the phosphoenolpyruvate
carboxykinase route for carboxylation (Table 5). In vitro activity
of this strain was 45-fold higher than that of KJ012 and 10-fold
higher than KJ017 providing further evidence for the tight coupling
of energy conservation to succinate production and growth and
further establishing the basis used for selection.
[0161] Large increases in PEP carboxykinase activity were well
correlated with improvements in cell yield and succinate production
(Table 5). From KJ012 to KJ017 (metabolic evolution), PEP
carboxykinase activity increased 4.3-fold, cell yield increased
5.7-fold, and succinate production increased 8.8-fold. From KJ017
to KJ060 (deletion of pflB followed by metabolic evolution), PEP
carboxykinase activity increased 12-fold, cell yield increased
1.3-fold, and succinate production increased 2.6-fold. From KJ060
to KJ071 (deletion of mgsA followed by metabolic evolution), PEP
carboxykinase activity decreased by 92%, cell yield decreased by
45%, and succinate production decreased by 63%. From KJ071 to KJ073
(deletion of poxB followed by metabolic evolution), PEP
carboxykinase activity, cell yield, and succinate production were
restored to levels equivalent to KJ060.
[0162] The pck and surrounding regions were cloned from KJ012 and
KJ073, and sequenced. No changes were found in the coding region.
Absent post-translational modifications, the catalytic properties
of the enzyme should be unchanged. A single mutation was detected
in the pck promoter region, G to A at -64 bp site relative to the
translation start site. This mutation was behind the transcription
start site which is -139 bp site relative to the translational
start site.
[0163] Previous investigators have noted that the kinetic
parameters of phosphoenolpyruvate carboxylase (ppc) and
phosphoenolpyruvate carboxykinase (pck) may have important effects
on carboxylation and succinate production (Millard et al., 1996;
Kim et al., 2004). The Km towards bicarbonate for E. coli
phosphoenolpyruvate carboxylase (ppc) is 0.15 mM (Morikawa et al.,
1980), 9-fold lower (13 mM) than E. coli phosphoenolpyruvate
carboxykinase (pck) (Krebs and Bridger, 1980). Although
overexpressing pck from E. coli using multi-copy plasmid increased
phosphoenolpyruvate carboxykinase activity by 50-fold, it was
reported to have no effect on succinate production (Millard et al.,
1996). Succinate production was also not increased when
phosphoenolpyruvate carboxykinase from Anaerobiospirillum
succiniciproducens was overexpressed in E. coli K12 (Kim et al.,
2004). This enzyme also has a high Km (30 mM) for bicarbonate
(Laivenieks et al., 1997). However, when A. succiniciproducens pck
was overexpressed in a ppc mutant of E. coli K12, succinate
production was increased 6.5-fold (Kim et al., 2004). In KJ017 and
subsequent derivatives, phosphoenolpyruvate carboxykinase is
clearly the dominant carboxylating activity even in the presence of
functional native phosphoenolpyruvate carboxylase.
[0164] Results from enzyme measurements of E. coli C were quite
surprising. The enzyme generally regarded as the dominant
carboxylating activity for succinate production by native E. coli
(phosphoenolpyruvate carboxylase; ppc) during growth (Unden and
Kleefeld, 2004; Fraenkel, 1996; Keseler et al, 2005; Millard et
al., 1996; Gottschalk, 1985; Karp et al., 2007) was not the most
active enzyme in vitro for E. coli C. Thus the generally accepted
metabolic pathways for E. coli (Unden and Kleefeld, 2004; Fraenkel,
1996; Sanchez et al., 2006; Cox et al., 2006; Vemuri et al., 2002a;
Wang et al., 2006; Sanchez et al., 2005ab; Gokarn et al., 2000;
Karp et al., 2007) upon which rational design of metabolic
engineering and estimates of metabolic flux are typically based may
not accurately reflect metabolism in all strains. Under
substrate-saturating conditions in vitro, phosphoenolpyruvate
carboxykinase activity was the most active. In E. coli K12,
activities for both phosphoenolpyruvate carboxylase and
phosphoenolpyruvate carboxykinase were reported to be equal in
vitro (140 nm min.sup.-1 mg.sup.-1 cell protein; Van der Werf et
al., 1997) with the former serving as the primary route to
succinate.
[0165] Previous studies showed that the overexpression of a native
ppc gene in E. coli resulted in higher specific succinate
production (Millard et al., 2000), higher specific growth rate, and
lower specific acetate production due to more carboxylation of PEP
to replenish TCA cycle intermediates (Farmer and Liao, 1997).
However, since PEP is required for the glucose transport system,
overexpressing ppc also decreases the glucose uptake rate by 15-40%
without significantly increasing succinate yield (per glucose) as
compared to an isogenic control (Chao and Liao, 1993; Gokarn et
al., 2000). This failure of the native phosphoenolpyruvate
carboxylase to increase succinate yields diverted most research
attention to a new metabolic design, over expression of the PYC
(pyruvate carboxylase) from Lactobacillus lactis or Rhizobium etli
as the carboxylating step (Vemuri et al., 2002ab; Gokarn et al.,
2000; Lin et al., 2005a, 2005b, 2005c) rather than pursuing further
work with the native repertoire of E. coli genes.
[0166] Rumen bacteria such as Actinobacillus succinogenes produce
succinate as a primary product during glucose fermentation using
the energy conserving phosphoenolpyruvate carboxykinase for
carboxylation (Kim et al., 2004; McKinlay et al., 2005; McKinlay
and Vieille, 2008). Reported activities for this organism are
5-fold those of KJ017 and half of that obtained by continued
growth-based selection (metabolic evolution) of KJ073. Thus by
using a combination of metabolic engineering (ldhA adhE ackA) and
metabolic evolution (growth-based selection for increased
efficiency of ATP production), the studies reported herein
demonstrate the development of succinate-producing strains of E.
coli that resemble a rumen organism such as A. succinogenes by
using only the native repertoire of E. coli genes. Despite prior
reports that over expression of the E. coli phosphoenolpyruvate
carboxykinase (pck) is not helpful for succinate production in the
absence of a mutation in phosphoenolpyruvate synthase (Chao and
Liao, 1993; Kim et al., 2004; Gokarn et al., 2000; Millard et al.,
1996), KJ017 and derivatives have been metabolically evolved to use
phosphoenolpyruvate carboxykinase as the primary route for
succinate and malate production.
[0167] FIG. 7 shows batch fermentations with KJ060 and KJ073, the
two best biocatalysts for succinate production. Although growth was
completed within the initial 48 h of incubation, succinate
production continued for 96 h. One-third of succinate production
occurred in the absence of cell growth. These strains produced
succinate titers of 668-733 mM, with a molar yield of 1.2-1.6 based
on glucose metabolized. With AM1 medium, yields were typically
higher than with NBS mineral salts medium. Acetate, malate, and
pyruvate accumulated as undesirable co-products and detracted from
the potential yield of succinate (Table 4). The maximum theoretical
yield of succinate from glucose and CO.sub.2 (excess) is 1.71 mol
per mole glucose based on the following equation:
C.sub.6H.sub.12O.sub.6+6CO.sub.2.fwdarw.12C.sub.4H.sub.6O.sub.4+6H2O.
However, there is no direct succinate pathway in E. coli that
achieves this yield (FIG. 6).
[0168] Although this study primarily focused on the conversion of
glucose to succinate. It is well known that E. coli has the native
ability to metabolize all hexose and pentose sugars that are
constituents of plant cell walls (Asghari et al., 1996; Underwood
et al., 2004). Some strains of E. coli can also metabolize sucrose
(Moniruzzaman et al., 1997). Strain KJ073 was tested for
utilization of 2% sugars of hexoses and pentoses in serum tubes. In
all cases, these sugars were converted primarily to succinate.
Strain KJ073 also metabolized glycerol to succinate. During
incubation with 2% glycerol, 143 mM glycerol was metabolized to
produce 127 mM succinate with a molar yield of 0.89, or 89% of the
maximum theoretical yield for succinic acid using glycerol as the
carbon source for bacterial growth.
[0169] The fermentative metabolism of E. coli has been shown to be
remarkably adaptable. Derivatives were engineered and evolved to
circumvent numerous deletions of genes concerned with native
fermentation pathways and increase fluxes through remaining enzymes
to maintain redox balance, increase the efficiency of ATP
production, and increase growth. Though much more challenging,
cells can make such adaptive changes in mineral salts media while
balancing carbon partitioning to provide all biosynthetic needs.
After eliminating the primary routes for NADH oxidation (lactate
dehydrogenase, alcohol dehydrogenase) and acetate production
(acetate kinase), growth and ATP production remain linked to NADH
oxidation and the production of malate or succinate for redox
balance (FIG. 1B). Anaerobic growth-based selections ensure redox
balance and select for increased efficiency and increased rates of
ATP production, the basis for increased growth. This selection for
redox balance and ATP production cannot readily distinguish between
malate and succinate as end products, since the precursors of both
serve as electron acceptors.
[0170] Deletion of pflB, the primary source of acetyl.about.CoA
during anaerobic growth, resulted in an auxotrophic requirement for
acetate (Sawers and Bock, 1988). This requirement was eliminated
through metabolic evolution, presumably due to increased production
of acetyl.about.CoA by other routes such as pyruvate dehydrogenase
(de Graef et al., 1999). The metabolic source of the acetate or
acetyl.about.CoA that replaced this auxotrophic need is unknown.
The shift to higher succinate production after a poxB deletion was
also surprising. Little change in the acetate level was observed
indicating that either this enzyme was a minor source of acetate or
that it was functionally replaced by other routes for acetate
production. After deletion of poxB, succinate was again produced as
the dominant dicarboxylic acid. This shift in metabolic products
accompanying poxB deletion was unexpected.
[0171] With the best strains for succinate production, KJ060 and
KJ073, malate and acetate remained as abundant co-products (Table
4; FIGS. 4D and 4F). Elimination of these represents a further
opportunity to increase yield.
[0172] All previously engineered E. coli developed for succinate
production have used complex media and plasmids with antibiotics
for maintenance. Most have achieved only low titers of succinate in
simple batch fermentations, requiring more complex processes to
achieve high titers (Table 1). Other investigators have also used
heterologous genes and complicated processes that include sparging
with gas (CO.sub.2, H.sub.2, O.sub.2 or air) and dual aerobic and
anaerobic process steps. A variety of genetic approaches have been
reported that increase succinate production from glucose by
recombinant E. coli in complex medium. This complexity of process
and nutrients would be expected to increase the cost of
construction, materials, purification, and waste disposal. Complex
media containing vitamins, amino acids, and other macromolecular
precursors may mask potential regulatory problems in metabolism and
biosynthesis that were created by metabolic engineering. In our
initial construct, growth and sugar metabolism were very poor in
mineral salts medium but were very robust in complex medium (Luria
broth). In contrast, strains KJ060 and KJ073 produced high titers
of succinate (600-700 mM) in simple batch fermentations (10% sugar)
using mineral salts medium without any complex nutrients or foreign
genes.
Example 2
Construction of KJ134 Strain for Succinate Production
[0173] As described in the Example 1 above, the central anaerobic
fermentation genes in E. coli C wild type were sequentially deleted
by the strategy of Datsenko & Wanner (2000) with PCR products
and removable antibiotic markers (by using FRT recognition sites
and FLP recombinase). These constructions in combination with
metabolic evolution (growth-based selection for increased
efficiency of ATP production) were used to select for a mutant
strain that recruited the energy-conserving, phosphoenolpyruvate
carboxykinase (pck) to increase growth and succinate production
(FIG. 9). The resulting strain, KJ073, produced 1.2 moles of
succinate per mole of metabolized glucose (Jantama et al., 2008a)
and uses a succinate pathway quite analogous to the rumen bacteria,
Actinobacillus succinogenes (van der Werf et al., 1997) and
Mannheimia succiniciproducens (Song et al., 2007). However, methods
used to construct these gene deletions left a single 82 to 85
nucleotide-long genetic scar or FRT site in the region of each
deleted gene (ackA, ldhA, adhE, ackA, focA-pflB). These FRT sites
served as recognition sites for FLP recombinase (Storici et al.,
1999) during removal of the antibiotic genes. All of these
extraneous sequences were sequentially removed from KJ073 and
replaced with native DNA with only the desired gene deletion using
methods that have been described previously (Grabar et al., 2006;
Zhang et al. 2007; Jantama et al., 2008b). The resulting strain,
KJ091, contains specific deletions in ackA, ldhA, adhE, focA-pflB,
ackA, mgsA, and poxB and lacks all FRT sites present in the KJ073
strain. The KJ091 strain is devoid of all foreign and synthetic DNA
except for an 18-bp translational stop sequence within ackA.
Succinate production by strain KJ091 was equivalent to that of
KJ073 strain (Table 8). This strain was used as the parent for
further improvements in succinate production.
[0174] In the first step for further improvement of KJ091 strain,
attention was paid to reduce the acetate production. During the
anaerobic fermentation of glucose by E. coli, pyruvate
formate-lyase (pflB) serves as the primary source of
acetyl.about.CoA, the precursor of acetyl.about.P, and acetate
kinase (ackA) serves as the primary route for acetate production
from acetyl.about.P (Karp et al., 2007; Kessler & Knappe,
1996). The abundance of acetate as a fermentation product in
strains KJ073 and KJ091 was surprising since these strains contain
deletions in both ackA and pflB (FIG. 9). This residual acetate at
the end of fermentation represents a potential opportunity to
further redirect metabolism for improved succinate yield.
[0175] A related enzyme with acetate kinase (and proprionate
kinase) activity is encoded by tdcD but is typically produced only
for the degradation of threonine (Hesslinger et al., 1998; Reed et
al., 2003). It is possible that mutations occurring during
selection have increased expression of tdcD as illustrated in FIG.
10. During anaerobic growth with 10% (w/v) glucose, expression of
tdcD could functionally replace ackA, increasing the production of
acetate from acetyl.about.P. The adjacent tdcE gene in the same
operon is similar to pflB and encodes a pyruvate (and
a-ketobutyrate) formatelyase activity that is co-expressed during
threonine degradation (Hesslinger et al., 1998). It is possible
that increased expression of this gene during anaerobic growth with
10% (w/v) glucose could increase the production of
acetyl.about.CoA, the immediate precursor of acetyl.about.P, and
waste reductant as formate (FIG. 10). Both tdcD and tdcE (adjacent)
were simultaneously deleted from KJ091 to produce KJ098. Deletion
of these two genes reduced acetate production by half and increased
succinate yield by 10% in KJ098 in comparison to KJ091,
establishing the importance of this unexpected pathway in diverting
carbon flow away from succinate. The level of pyruvate produced by
KJ098 also declined by 40%, an intermediate that would be predicted
to increase upon elimination of two alternative routes for pyruvate
metabolism, pyruvate formate-lyase activity (tdcD) and acetate
kinase activity (tdcE). The significant decrease in the pyruvate
production is an unexpected result of tdcD/tdcE gene deletions. The
mechanisms responsible for the reduction in pyruvate, and the
increase in succinate which resulted from the simultaneous deletion
of tdcD and tdcE are unknown.
[0176] Although KJ098 represents a significant improvement over
KJ091, further reduction in acetate levels and further increases in
succinate yields may be possible. Under anaerobic conditions,
oxaloacetate is partitioned into the reduced product (malate) and
oxidized intermediate (citrate) (FIG. 9). Citrate can be converted
back to oxaloacetate and acetate by citrate lyase (citDEF) to
recycle the intracellular OAA pool (FIG. 10) for other metabolic
functions (Nilekani et al., 1983). Expression of significant
amounts of citrate lyase is associated with growth on citrate
(Lutgens and Gottschalk, 1980; Kulla and Gottschalk, 1977). Citrate
lyase is a multi-enzyme complex made up of three different
polypeptide chains. The a or large subunit is a citrate-ACP
transferase that catalyzes the first step. The .beta. or medium
subunit is a citryl-ACP lyase that catalyzes the second step. The y
or small subunit acts as an acyl-carrier protein and also carries
the prosthetic group components. All three subunits are required
for the reaction to take place (Quentmeier et al., 1987). The
deletion of genes encoding one or more of these subunits would
eliminate citrate lyase activity and may further reduce the level
of acetate during succinate production. The citF gene was deleted
from KJ098 to produce KJ104. This deletion, however, had no effect
on acetate production or other succinate yield (Table 8). Since
deletion of citF did not cause any reduction in acetate, this
intermediate is presumed to arise from other pathways. For unknown
reasons, deletion of citF adversely affected the growth of KJ104
(reduced cell yield by 22%) and increased the level of pyruvate at
the end of fermentation by almost 50% in comparison to KJ098.
However, the succinate yield, titer, average productivity, and
acetate levels with KJ104 were comparable to those with KJ098
(Table 8).
[0177] Aspartate aminotransferase (aspC) is a multifunctional
enzyme that catalyzes the synthesis of aspartate, phenylalanine and
other compounds by transamination. In the reaction, L-aspartate is
synthesized from oxaloacetate, an intermediate from PEP
carboxylation, by a transamination reaction with L-glutamate.
Besides being a protein constituent, aspartate participates in
several other biosynthetic pathways. About 27 percent of the
cellular nitrogen has been estimated to flow through aspartate
(Reitzer, 2004). Aspartate biosynthesis and succinate production
share a common intracellular pool of oxaloacetate. Deletion of aspC
could lead to increased succinate production but may also create an
auxotrophic requirement that prevents anaerobic growth in minimal
salts medium such as AM1.
[0178] This aspartate aminotransferase gene (aspC) was deleted from
KJ104 to produce KJ110. Unexpectedly, the deletion of aspC had no
effect on succinate yield or cell yield in KJ110 as compared to
KJ104 (Table 8). Thus aspartase does not appear to divert
significant levels of oxaloacetate away from succinate production
in our strain. Alternative enzymes appear to be available that
replace the biosynthetic needs formerly catalyzed by aspartate
aminotransferase.
[0179] Significant amounts of pyruvate are present at the end of
fermentation with KJ104 and other strains of E. coli engineered for
succinate production (Table 8). This pyruvate represents an
unwanted product and a further opportunity to increase succinate
yield. This high level of pyruvate in fermentation broth could
result from the decarboxylation of malate to pyruvate by malic
enzyme (sfcA) as illustrated in FIG. 10. This enzyme is thought to
function primarily during gluconeogenesis (Linden and Kleefeld,
2004; Stols and Donnelly, 1997; Oh et al., 2002) rather than during
the anaerobic catabolism of glucose. Although reductive
carboxylation of pyruvate to form malate is thermodynamically
favored, the kinetic parameters of this enzyme favor the
dehydrogenation and decarboxylation under physiological conditions
(Stols and Donnelly, 1997). Over-expression of this enzyme to
carboxylate pyruvate has been previously used as a basis to
construct strains for succinate production of E. coli (Stols and
Donnelly 1997).
[0180] If malic enzyme (sfcA) is carboxylating in KJ104 (and
related strains) and contributing to succinate production, deletion
of this gene would be expected to reduce succinate yield and
increase the levels of other products such as pyruvate.
Alternatively, if malic enzyme (scfA) is decarboxylating in KJ104
and diverting malate to pyruvate, deleting the gene encoding this
enzyme would be expected to increase succinate yields and decrease
the levels of pyruvate. Unexpectedly, deletion of the sfcA gene
from KJ104 to produce KJ119 had no measurable effect on succinate
production, growth, pyruvate levels, etc (Table 8) in comparison to
KJ104. These results clearly demonstrated that malic enzyme (sfcA)
is unimportant for succinate production in KJ104 and related
strains. This result is in sharp contrast to the
succinate-producing strains developed by Stols and Donnelly (1997)
in which increased production of malic enzyme was used as the
primary route for succinate production.
[0181] Although no significant benefits were observed from either a
sfcA deletion or an aspC deletion in 10104, studies were carried
out to test the effect of deleting both genes in combination. This
was done by deleting the sfcA gene in KJ110 to produce KJ122 and
expected to see no benefit. However, the combined deletion of both
sfcA and aspC (strain KJ122) resulted in an unexpected increase in
succinate yield and titer with a small reduction in acetate (Table
8), in comparison to the parent strain KJ110 and related strains
(KJ104 and KJ119). The combined deletion (aspC and sfcA) in KJ122
resulted in 18% increases in succinate yield, 24% increase in
succinate titer, and 24% increase average productivity as compared
to KJ104. Although the mechanism is unknown, it is possible that
single mutations were ineffective because they were compensated in
part by increased flow through the remaining enzyme activity, malic
enzyme or aspartate aminotransferase (FIG. 10), dampening any
potential benefit. The increase in succinate yield and titer are
presumed to result from an increase in the availability of
oxaloacetate allowing a larger fraction to proceed to succinate.
Malate levels also remained extremely low.
[0182] Strain KJ122 (Table 8) produced 1.5 mol succinate per mole
of glucose, 88% of the maximum theoretical yield (1.71 mol per mol
glucose). To produce this high level of succinate and fully reduce
malate production, additional reductant was required. Although the
source of this additional reductant is unknown, these results are
consistent with an increase in pyruvate flow through pyruvate
dehydrogenase. This enzyme is thought to function primarily during
aerobic metabolism (Guest et al., 1989) but has also been reported
to function at low levels during fermentation (de Graef et al.,
1999).
[0183] KJ122 produced excellent succinate yields (1.5 mol
mol.sup.-1 glucose) plus smaller amounts of acetate and pyruvate.
The maximum theoretical yield for succinate is 1.71 mol mol.sup.-1
glucose and these 3-carbon intermediates represent an opportunity
to further increase yield. Pyruvate is presumed to accumulate from
glycolysis as a metabolic overflow and may be related to acetate
accumulation. Acetyl.about.CoA is an allosteric regulator of many
enzymes. The source of acetate and acetate kinase activity is
unknown since genes encoding the two primary activities for acetate
kinase (tdcD and ackA) have been deleted (FIG. 9 and FIG. 10).
Assuming that the acetate is produced from acetyl.about.P, the
product of phosphotransacetylase, a further deletion was
constructed in KJ122 to inactivate the pta gene. The resulting
strain, KJ134, produced near theoretical level of succinate (Table
8). In this strain, pyruvate and acetate levels were substantially
reduced. Volumetric productivity was also reduced by 17%. Succinate
yields with strain KJ134 are equal or better than all other strains
regardless of the complexity of fermentation processes, media, or
growth conditions.
Example 3
Recruitment of Gluconeogenic PEP Carboxykinase (pck) for Succinate
Production
[0184] E. coli has the metabolic potential for four native
carboxylation pathways that could be used to produce succinate
(FIGS. 2A-2D). The carboxylation of phosphoenolpyruvate (PEP) to
oxaloacetate (OAA) by phosphoenolpyruvate carboxylase (ppc) is
recognized as the primary pathway for the fermentative production
of succinate in E. coli (FIG. 2A). (Fraenkel DG, 1996; Unden &
Kleefeld, 2004; Karp et al., 2007). This reaction is essentially
irreversible due to the energy loss associated with the release of
inorganic phosphate. The three other carboxylation reactions are
normally repressed by high concentration of glucose in the medium
and also reported to function in the reverse direction for
gluconeogenesis. (Samuelov et al., 1991; Oh et al., 2002; Stols
& Donnelly, 1997). The second and third carboxylation pathways
(FIGS. 2B and 2C) use NADH-linked and NAPDH-linked malic enzymes
(sfcA and maeB), respectively, to catalyze the reversible
carboxylation of pyruvate to malate. Both pathways allow energy to
be conserved as ATP during the pyruvate formation from PEP. The
fourth pathway uses PEP carboxykinase (pck) for the reversible
carboxylation of PEP to OAA with the conservation of energy as ATP
(FIG. 2D). Although PEP carboxykinase (PCK) typically functions
only during gluconeogenesis in E. coli, an analogous PEP
carboxykinase is present at very high levels in succinate-producing
rumen bacteria where it serves as the primary PEP carboxylation
activity. (Van der Werf et al., 1997).
[0185] E. coli strain KJ073 was metabolically engineered by both
targeted gene deletion and evolution for high growth rate and
succinate production. (Jantama et al., 2008a). Genes encoding each
of the four carboxylating enzymes (ppc, sfcA, maeB and pck) were
individually deleted to identify the primary pathway for succinate
production in the engineered strain KJ073 (Table 10). Deletion of
the ppc gene encoding the primary carboxylating step in native E.
coli (XZ320) did not alter succinate production. Deletion of the
genes encoding malic enzymes (sfcA and maeB) to produce XZ341 and
XZ396, respectively, also had no effect on succinate production
consistent with their primary function in gluconeogenesis. Deletion
of pck encoding PEP carboxykinase (XZ332), however, dramatically
reduced cell growth, sugar metabolism, succinate production, and
succinate yield. Complementation of the deletion mutation in strain
XZ332 with the entire pck gene from strain KJ073 (plasmid pLOI4677)
substantially improved succinate production to near that of KJ073
(Table 10).
[0186] Together, these results demonstrate that the gluconeogenic
PEP carboxykinase was recruited during metabolic evolution to serve
as the primary carboxylation reaction for fermentative succinate
production in KJ073. Unlike the PEP carboxylase (FIG. 2A), PEP
carboxykinase conserves energy providing an additional ATP (FIG.
2D). Since fermentative growth and ATP production are closely
linked, the increase in ATP yield with PEP carboxykinase (FIG. 2D)
would provide a competitive advantage during growth-based selection
at the metabolic evolution steps leading to strain KJ073.
[0187] The increase in PEP carboxykinase activity correlated with
an increase in pck mRNA abundance (Table 11; FIG. 12A). Transcript
levels for ppc, sfcA and maeB were essentially unchanged while pck
transcript abundance increased in KJ073 as compared to the wild
type, in excellent agreement with the enhanced PEP carboxykinase
activity (Table 11).
[0188] Sequencing the pck gene revealed no difference in the coding
or terminator regions of the pck gene from KJ073. However, a single
point mutation (G to A transition at position -64 relative to the
ATG start codon) was found in the upstream promoter region of pck
gene in KJ073(Table 11). All six strains were sequenced to identify
the origin of this mutation during strain improvement. Although PEP
carboxykinase activity was 4-fold higher in KJ017 than in KJ012,
the G to A mutation was absent. This point mutation in the promoter
region of pck gene in KJ073 strain is referred as pck* mutation
(high PEP carboxykinase activity). This pck* mutation was present
only in KJ060 and KJ073 strains showing high PEP carboxykinase
activity and absent in KJ071. Loss of this mutation in KJ071 was
accompanied by a 10-fold decrease in PEP carboxykinase activity to
a level equivalent to that of 10017.
[0189] Introduction of the pck* point mutation (G to A) into KJ017,
and KJ071 increased PEP carboxykinase activity by 9-fold (Table
11). Restoring the wild type pck gene (A to G) in strains KJ060 and
KJ073 yield the strains XZ622 and XZ624 respectively. Both XZ622
and XZ624 showed a decreased PEP carboxykinase activity by almost
8-fold (Table 12). Together, these results demonstrate that the
increase in PCK activity that occurred during the metabolic
evolution of KJ017 to produce KJ060 is due to a single nucleotide
change in pck (G to A at -64 relative to the ATG start). Absence of
this mutation in KJ017 suggests that the initial 4-fold increase in
PEP carboxykinase activity observed in this strain is due to other
yet to be defined change(s). Apparently, recruitment of the native
gluconeogenic PCK for fermentative succinate production resulted
from multiple mutations that affected transcription of the pck
gene.
[0190] The 4-fold increase in PEP carboxykinase activity that
occurred during the development of KJ017 from KJ012 did not result
from a mutation in pck and may involve a mutation in a
transcriptional regulator. The Cra protein has been shown to
activate the expression of pck in E. coli. (Saier & Ramseier,
1996). However, no mutation was found in the cra gene or upstream
region. Deletion of cra in KJ017 (XZ626) and KJ060 (XZ627) did not
affect PEP carboxykinase activity (Table 12).
[0191] The csrA system has also been reported to regulate the level
of pck and other genes involved in glucose metabolism by altering
mRNA stability. (Pernestig et al., 2003). However, no mutation was
found in the sequences of genes involved in this regulatory system
(csrA, csrB, csrC, csrD, uvrY or barA).
[0192] E. coli PEP carboxykinase activity is subject to glucose
catabolite repression. (Goldie 1984). Two Crp-binding sites have
been identified in the promoter (Ramseier et al 1995), quite
distant from the point mutation in KJ060 and KJ073. Genes
associated with catabolite repression (cyaA, crp) and glucose
uptake by the phosphotransferase system (ptsH, ptsI, err, ptsG)
were sequenced (upstream region through terminator). Only one
mutation was found, a frame-shift mutation in the carboxy-terminal
region of ptsI (single base deletion at position 1,673) in strains
KJ060, KJ071, and KJ073. Since this deletion was absent in KJ017,
it cannot be responsible for the initial 4-fold increase in PEP
carboxykinase activity in this strain (Table 12). Deletion of ptsI
in KJ017 (XZ613) and in KJ060 (XZ615) did not affect PEP
carboxykinase activity.
[0193] Potential changes in the catabolite repression of pck were
investigated further by growing E. coli ATCC 8739, KJ012, KJ017,
and KJ060 aerobically in LB medium with and without 5% glucose
(Table 13). PEP carboxykinase activity has been reported to be
maximal during late exponential phase of growth (Goldie, 1984) and
this was confirmed in our strains. In both ATCC 8739 and the
starting strain for metabolic evolution (KJ012), PEP carboxykinase
activities were strongly repressed (>70%) by the presence of
glucose. Glucose-mediated repression was reversed by the addition
of cyclic-AMP. In contrast, PEP carboxykinase activity was 4-fold
higher in KJ017 (than in 10012) and was unaffected by the addition
of glucose indicating a loss of catabolite repression. PEP
carboxykinase activity was even higher in KJ060 (5-fold that of
KJ017) during growth in the absence of glucose, and increased
further when glucose was included. In KJ060 (and KJ073), glucose
catabolite repression of pck has been replaced with glucose
activation (Table 13). Transcript abundance of cyaA, crp, ptsG,
ptsI and crr were compared among these strains (FIGS. 12B and 12C).
Transcripts for cyaA, crp, and ptsG were generally higher in KJ017,
KJ060, KJ071, and KJ073 than in KJ012 and ATCC 8739. Elevated
levels of these proteins could mask catabolite repression by
increasing the level of cyclic-AMP.
[0194] The loss of catabolite repression in these mutants was not
limited to pck expression. .beta.-galactosidase activity was
reduced by half in ATCC 8739 and KJ012 during growth with glucose
(Table 13). This activity is normally repressed by glucose but was
relatively unaffected in KJ017 and KJ060, consistent with general
loss of Crp-mediated glucose regulation.
[0195] Deletion of the crp gene in KJ012 and KJ017 reduced the
level of PEP carboxykinase activity in the resulting strains (XZ642
and XZ643, respectively) to that of the glucose-repressed parent,
ATCC 8739 (Table 13). In these crp-deleted strains, PEP
carboxykinase activity was not affected by the addition of glucose
or cyclic AMP. Thus Crp may potentially be an essential regulatory
element for the 4-fold increase in pck expression observed in KJ017
and its derivatives. This Crp-mediated 4-fold increase in pck
expression together with the 10-fold increase in expression
associated with the upstream pck mutation can account for the
changes in the levels of PEP carboxykinase activity observed during
the development of KJ060 and KJ073.
[0196] Other genes associated with cAMP-CRP regulation were also
sequenced (Table 13) such as the predicted adenylate cyclase ygiF,
a transcriptional co-activator for Crp say, the cAMP
phosphodiesterase cpdA and the global regulator of carbohydrate
metabolism m/c. (Keseler et al., 2005; Cameron & Redfield,
2006; Imamura et al., 1996; Plumbridge, 2002). However, none of
these genes associated with cAMP=CRP regulations were found to have
any mutation in the upstream, coding or terminator regions.
[0197] The gene ptsI encodes PEP-protein phosphotransferase, a
general (non sugar-specific) component of the
phosphoenolpyruvate-dependent sugar phosphotransferase system. This
major carbohydrate active-transport system catalyzes the
phosphorylation of incoming sugar substrates concomitantly with
their translocation across the cell membrane. PEP-protein
phosphotransferase transfers the phosphoryl group from
phosphoenolpyruvate (PEP) to the phosphoryl carrier protein (HPr).
(See, e.g., UniProtKB, Accession Number P08839).
[0198] A frame-shift mutation in ptsI (single base-pair deletion of
position 1673 bp) was found to have occurred during the metabolic
evolution of KJ060 from KJ017. To investigate the significance of
this mutation, the carboxy-terminal 175 bp of ptsI was deleted in
KJ017 and KJ060 to produce XZ613 and XZ615, respectively. The ptsI
deletion in KJ060 (XZ615) had no effect on growth and PEP
carboxykinase activities as expected. Deletion of the ptsl
carboxy-terminus in KJ017 to produce XZ613 resulted in an inability
to grow on NBS mineral salts containing glucose, consistent with
loss of the primary uptake system for glucose (PEP-dependent
phosphotransferase system). After several days of incubation,
cultures of XZ613 began to grow which are presumed to be
derivatives that have activated alternative glucose transport
system(s). (Karp et al., 2007).
[0199] The ptsI mutation found in KJ060, KJ071, and KJ073 would be
expected to inactivate the PEP-dependent phosphotransferase system
for glucose. Alternative glucose uptake systems such as GalP have
been shown to restore glucose uptake in pts mutants. (Wang et al.,
2006; Yi et al., 2003). Expression of galP was increased by 5-fold
to 20-fold in these improved strains (FIG. 12B) as compared to the
KJ012 and ATCC 8739, with a smaller increase in glucokinase (glk).
Replacing the mutant ptsI gene in 10060 with a functional wild type
gene (XZ616) was detrimental, dramatically reducing growth in
NBS-glucose medium. This detrimental effect may result from the
depletion of PEP, a required substrate for wild-type glucose
transport. A functional PEP-dependent phosphotransferase system
would compete with PEP carboxykinase, decreasing the PEP pool
available for redox balance, ATP production, and succinate
production. Thus the loss of the PEP-dependent phosphotransferase
system for glucose can be viewed as a beneficial event during
strain development provided alternative transport systems such as
GalP (and glucokinase) were available.
[0200] Carbon fluxes at the PEP node serve to limit the amount of
succinate produced for redox balance during the anaerobic
fermentation of glucose (FIG. 13). In addition, these fluxes must
provide sufficient energy (ATP) for growth, maintenance, and
precursors for biosynthesis. Rumen bacteria that produce succinate
as the dominant product use an energy-conserving PEP carboxykinase
for OAA production (FIG. 2D). (Van der Werf et al., 1997; Kim et
al., 2004). Native strains of E. coli produce succinate as a minor
product and use PEP carboxylase (ppc) (FIG. 2A). Unlike PEP
carboxykinase, PEP carboxylase is essentially irreversible due to
the energy loss associated with release of inorganic phosphate.
Previous studies have shown that overexpression of the native ppc
gene in E. coli resulted in higher specific succinate production
(Millard et al., 1996) and higher specific growth rate due to
increased carboxylation of PEP to oxaloacetate. (Farmer & Liao,
1997). However, since PEP is required for the native glucose
transport system, over expressing ppc also decreased the rate of
glucose uptake without significantly increasing succinate yield.
(Chao & Liao, 1993; Gokarn et al., 2000). This failure of the
native PEP carboxylase to increase succinate yields diverted most
research attention to a new metabolic design, over expression of
the pyruvate carboxylase from Lactobacillus lactis or Rhizobium
etli as the carboxylating step (Sanchez et al., 2005b; Gokarn et
al., 2000) and over expression of PEP carboxykinase from
Actinobacillus succinogenes (Kim et al., 2004) for the development
of industrial biocatalysts, rather than pursuing further work with
the native repertoire of E. coli genes.
[0201] Native E. coli strains have three alternative carboxylation
pathways (FIGS. 2B-2D) that typically function only in the reverse
direction for gluconeogenesis. (Samuelov et al., 1991; Kao et al.,
2005; Oh et al., 2002; Stols & Donnelly, 1997). All three would
allow the conservation of energy from PEP as ATP. With succinate as
the sole route for NADH oxidation, growth-based selection
(metabolic evolution) resulted in strains KJ017, KJ060, KJ071, and
KJ073 with improvements in growth (cell yield) and succinate
production. In these strains, the gluconeogenic PEP carboxykinase
(pck) was recruited to serve as the primary carboxylation activity
by transcriptional activation. The recruitment of PEP carboxykinase
as the primary pathway for succinate production in E. coli was
surprising. Many studies have shown that increased expression of E.
coli pck had no effect on succinate production. (Gokarn, et al.,
2001; Vemuri et al., 2002; Millard et al., 1996; Gokarn et al.,
2000; Hong & Lee, 2001). A recent study demonstrated that
increased expression of E. coli pck was detrimental for growth in
minimal medium, decreasing the growth rate, the rate of glucose
metabolism, and the yield of succinate. (Kwon et al., 2008).
[0202] Increased expression of pck in E. coli resulted in increased
carbon flow into the 4-carbon intermediate OAA for succinate
production (redox balance), increased succinate production, and
increased the net production of ATP for growth and maintenance. At
least three events contributed to increased transcription of pck:
1) loss of Crp-mediated glucose-repression; 2) gain of
glucose-activation; and 3) a single base change in the upstream
region of pck. Each of these events provided a basis for selection
through metabolic evolution by increasing the level of PEP
carboxykinase, increasing the flow of carbon into succinate, and
increasing the conservation of metabolic energy as ATP. The
combined action of these genetic events resulted in high levels of
PEP carboxykinase (>7000 U (mg protein).sup.-1) in KJ060 and
KJ073, equivalent to rumen bacteria that have evolved to produce
succinate as the primary fermentation product. (VanderWerf et al.,
1997).
[0203] Additional energy-conserving changes were found in strains
KJ060, KJ071, and KJ073 which may potentially assist in the
recruitment of PEP carboxykinase as the primary route for
fermentative succinate production. The PEP-dependent
phosphotransferase system is the primary glucose uptake system in
native strains of E. coli. During transport, half of the PEP
produced from glucose is used for uptake and phosphorylation,
limiting metabolic options for redox balance and ATP production.
The improved strains contained a frame-shift mutation in ptsI that
inactivated this uptake system. Expression of galP encoding a
proton symporter which can transport glucose was increased by up to
20-fold. Increased expression of GalP and the native glucokinase
can functionally replace the glucose phosphotransferase system by
using ATP rather than PEP for phosphorylation. (Wang et al., 2006;
Yi et al., 2003; Flores et al., 2007). This exchange respects an
energy-efficient way to increase the pool size of PEP available for
carboxylation and redox balance using succinate (FIG. 11). All
improved strains directed more than half of glucose carbon into
4-carbon products (malate plus succinate) and required more than
half of the PEP for redox balance. Pyruvate can be converted to PEP
by ATP with the formation of PPi and AMP but energy is wasted by
this process. Thus the ptsI mutation and expression of galP
increased the energy efficiency of metabolizing glucose to
succinate, providing a growth advantage during metabolic
evolution.
[0204] Eliminating alternative routes for NADH oxidation other than
the succinate together with metabolic evolution with selection for
improvements in growth resulted in succinate-producing strains of
E. coli that are the functional equivalents of succinate-producing
rumen bacteria such as Actinobacillus succinogenes and Mannheimia
succiniciproducens. (VanderWerf et al., 1997; Kim et al., 2007;
Martin, 1994; McKinlay et al., 2008). OAA is produced using an
energy-conserving PEP-carboxykinase. PEP is conserved to eliminate
the need for energy-expensive regeneration (2-ATP equivalents) by
using glucose permeases (and glucokinase) rather than the
PEP-dependent phosphotransferase system for glucose uptake. Note
that among rumen bacteria producing other fermentation products,
the phosphotransferase system is widely used for glucose uptake.
(Martin, 1994). The most promising E. coli strains for succinate
production, 10060 and KJ073, produced approximately 700 mM
succinate with a yield of 1.2 mol succinate per mol glucose
(Jantama et al., 2008a), comparable to the best natural
succinate-producing rumen bacteria, Actinobacillus succinogenes.
(Guettler et al., U.S. Pat. No. 5,505,004).
[0205] Energy conserving strategies that improved succinate
production from glucose in E. coli could also be applied to other
important problems in strain engineering. Glycerol is becoming an
inexpensive feedstock due to global increase in bio-diesel
production. Being more reduced than glucose, each glycerol could be
converted to succinate and maintain redox balance. However, no net
ATP would be produced during glycerol metabolism to succinate using
the native energy-wasting carboxylation activity, PEP carboxylase.
This problem should be solved by using the energy-conserving PEP
carboxykinase and allow the net formation of 1 ATP per succinate.
In addition, the carboxylation product, OAA, is an important
intermediate in cell metabolism that serves as a precursor for many
other important fermentation products such as malic acid, fumaric
acid, aspartic acid, lysine, threonine, methionine, among others.
One of skill in the art will appreciate that the energy
conservation strategies illustrated herein may be used to develop
and improve biocatalysts for the production of many industrially
important chemicals.
Example 4
Re-Engineering E. coli for Succinate Production in Mineral Salts
Medium
[0206] Strains used in this study are listed in Table 16. Plasmids
and primers used during construction of various strains developed
during the course of this invention are listed in Table 15.
[0207] Examination of the mixed acid pathway in E. coli indicates
three primary routes for NADH oxidation leading to succinate,
lactate, and ethanol (FIG. 14). Deleting genes that eliminated
these competing routes for NADH oxidation was insufficient to
direct carbon flow to succinate (Table 16). With the exception of a
small increase after deletion of adhE, individual deletions of
these genes decreased succinate production and yield during
fermentation in NBS mineral salts medium with little effect on cell
yield as compared to the parent strain (ATCC 8739). Deletion of
both alternative NADH oxidation pathways (ldhA with adhE or ldhA
with pflB) substantially reduced growth, succinate yield, and
succinate production in NBS mineral salts medium.
[0208] Quite different results were observed in Luria broth (Table
16). A modest increase in succinate yield was found in all strains
that contained a deletion in ldhA (alone or in combination). Again,
growth was reduced in double mutants and triple mutants. None of
these deletions were sufficient to redirect substantial amounts of
glucose carbon to succinate in either mineral salts medium or
complex medium. Deleted strains constructed for succinate
production based on observational analysis of the native mixed acid
pathway in E. coli were less productive than expected in complex
medium, and unsuccessful in NBS mineral salts medium.
[0209] Our previous investigations (Jantama et al, 2008a; Jantama
et al, 2008b) discovered a promoter mutation (G to A at -64
relative to the ATG start; denoted pck*) that increased
phosphoenolpyruvate carboxykinase (PCK) activity and increased
succinate production from glucose in the presence of many
additional mutations. This was surprising because pck is typically
repressed by glucose (Goldie, 1984) and has been shown to function
primarily in gluconeogenesis during the aerobic metabolism of
organic acids. (Kao et al., 2005; Keseler et al., 2005; Oh et al.
2002; Unden & Kleefeld, 2004; Wu et al., 2007). To examine this
further, the pck gene (ribosomal binding site, coding and
terminator region) was amplified and cloned into pCR2.1-TOPO to
produce pLOI4677 with pck expression under control of the lac
promoter. This plasmid was transformed into ATCC 8739. Also, the
native pck gene in ATCC 8739 was replaced with the mutant pck* gene
to construct XZ632. Glucose fermentation was examined in both
strains using NBS mineral salts medium.
[0210] Introduction of pck* resulted in a modest increase in
succinate yield and production as compared to isogenic strains
containing the native pck gene (Table 16). PCK activity was found
enhanced over 8-fold both in the XZ632 stain and in the parent
strain having a plasmid containing pck* gene under the IPTG-induced
promoter when compared to the parent strain. Upon chromosomal
integration, the single copy pck* was almost as effective for PCK
production as the multi-copy plasmid containing pck* gene under the
IPTG-induced promoter. A modest improvement in succinate yield and
production was observed for both strains with elevated PCK activity
as compared to the parent ATCC 8739 strain (Table 17). However,
increased PCK activity alone was insufficient to redirect glucose
carbon to succinate.
[0211] The pck* mutation was tested in combination with other
mutations that eliminated pathways for NADH oxidation (Table 18).
The combined action of mutations to eliminate competing routes for
NADH oxidation and increased PCK activity were also insufficient to
substantially redirect glucose carbon to succinate.
[0212] The phosphoenolpyruvate-dependent phosphotransferase system
is the primary mechanism for glucose uptake in E. coli and an
integral part of the glucose catabolite repression system. (Keseler
et al., 2005; Postma et al., 1996). As described in the Example 3
above, a frame-shift mutation within the carboxyl end of ptsI
(single base-pair deletion at 1673 bp position) was discovered in
the succinate producing strains KJ060, KJ071 and KJ073 as a result
of metabolic evolution. This mutation would be expected to disrupt
function of the phosphotransferase system. (Postma et al., 1996).
In this mutant, glucose uptake was functionally replaced by galP
(galactose permease) and glk (glucokinase) (Hernandez-Montalvo et
al., 2003; Keseler et al., 2005). To investigate the effect of the
pts/disruption on succinate production, the carboxy-terminal 175 bp
of ptsI was deleted in wild type E. coli ATCC 8739 to obtain strain
XZ650. Surprisingly, succinate production and yield were decreased
by this mutation in comparison to the parent (Table 18).
[0213] Two approaches were used to investigate the effect of
combining the ptsI truncation with high levels of PCK using the
pck* mutation or the native pck over-expressed from the lac
promoter (plasmid pLOI4677). In combination with the ptsI
truncation, both approaches resulted in a dramatic increase in
succinate production (Table 18). Strain XZ647 (pck*, .DELTA.ptsI)
produced 216 mmol succinate in NBS mineral salts medium with 5%
glucose with a yield of 0.89 mol succinate per mol glucose,
4.7-fold higher than wild type E. coli ATCC 8739 (Table 18). With
both XZ647 and XZ650 (pLOI4677), formate, ethanol and small amounts
of lactate remained as minor side products. These two changes,
inactivation of the phosphoenolpyruvate-dependent
phosphotransferase system and elevated levels of PCK activity,
represent the core changes required to effectively redirect glucose
metabolism to succinate in NBS mineral salts medium without
modifying any genes directly concerned with fermentative redox
balance.
[0214] Further experiments confirmed that a wide variety of
mutations in the phosphotransferase system increase succinate in a
pck* background. Disruption of the PEP-dependent phosphotransferase
system for glucose at any step increases the flow of carbon into
succinate, increasing both titer and yield.
[0215] The PEP-dependent phosphotransferase system shuttles
phosphate from PEP to PtsI, then PtsH, then PtsG, and then to
glucose to form glucose 6-phosphate. Table 19 shows that in a
strain containing the pck* mutation that increases the level of
phosphoenolpyruvate carboxykinase, a second mutation in any one of
the Pts genes involved in this phosphate relay system (ptsI, ptsH
or ptsG) results in a similar dramatic shift in carbon flow into
succinate as the dominant fermentation product. In this regard,
deletion of the whole ptsI gene or a truncation of the
carboxyterminus of the ptsI gene was superior to the ptsG and ptsH
deletions. The truncation of the ptsI carboxyterminus produced the
highest yield and titer of succinate, slightly better than the
complete deletion of ptsI. Other mutations such as insertions,
deletions, and frame-shifts that lead to inactive gene products
would be expected to have similar effects.
[0216] Although strain XZ647 (pck*.DELTA.ptsI) produced succinate
as the dominant fermentation product, significant levels of
unwanted co-products (lactate, ethanol, formate, and acetate) were
also produced (Table 18). Deletion of either adhE (XZ723) or pflB
(XZ721) eliminated the production of ethanol. Production of acetate
and formate were substantially reduced or eliminated only by
deletion of pflB. The resulting strain, (XZ721) produced high
levels of succinate with a molar yield of over 1.2 mol succinate
per mol glucose.
[0217] Succinate typically represents a minor product of glucose
fermentation in E. coli. Most of the glucose carbon is converted to
ethanol and lactate with smaller amounts of formate and acetate
using alternative NADH-oxidizing pathways (FIG. 14). Derivatives of
E. coli have been constructed to improve succinate production for
more than a decade with variable success. (Donnelly et al., U.S.
Pat. No. 5,770,435; Gokarn et al., 2000; Gokarn et al., U.S. Pat.
No. 6,455,284; Millard et al., 1996; San et al., U.S. Pat. No.
7,223,567; Sanchez et al, 2005b; Sanchez et al, 2005a; Stols &
Donnelly, 1997; Vemuri et al., 2002a; Wu et al., 2007). The
strategy used to construct these strains has typically focused on
the elimination of competing pathways for NADH oxidation. (Donnelly
et al., U.S. Pat. No. 5,770,435; Gokarn et al., U.S. Pat. No.
6,455,284; San et al., U.S. Pat. No. 7,223,567; Sanchez et al.,
2005b; Sanchez et al. 2005a; Vemuri et al., 2002a; Wu et al.,
2007). Target genes for deletion were selected primarily based on
inspection of the pathway (FIG. 14). However, successes with this
strategy have been limited to complex medium and two-step (aerobic
growth phase followed by anaerobic production phase) processes.
(Donnelly et al., U.S. Pat. No. 5,770,435; Gokarn et al., U.S. Pat.
No. 6,455,284; Millard et al., 1996; San et al., U.S. Pat. No.
7,223,567; Sanchez et al., 2005b; Sanchez et al., 2005a; Vemuri et
al., 2002a; Wu et al., 2007).
[0218] In complex medium such as Luria broth, most of the
biosynthetic needs for growth are supplied by intermediates and
building block molecules in the nutrients (yeast extract and
tryptone). In this medium, deletion of genes based on observation
of the fermentation pathway itself generally improved succinate
production (FIG. 14; Table 16). Deletion of (ldhA) and all
combinations of target genes including ldhA resulted in increased
succinate production and increased succinate yield per glucose
during fermentation in Luria broth (Table 16).
[0219] With a mineral salts medium such as NBS or AM1 broth,
however, deletion of the same target genes in the mixed acid
fermentation pathway was not helpful. Deletions of most were
detrimental for both succinate production and succinate yield. With
the exception of a small increase after the deletion of adhE,
single gene deletions and combinations of gene deletions in the
mixed acid fermentation pathway reduced succinate production and
yields in NBS mineral salts medium (Table 17). KJ012 (ATCC 8739
.DELTA.ldhA .DELTA.adhE .DELTA.ackA), the genetic equivalent of a
strain patented for two-step (aerobic growth phase followed by
anaerobic production phase) succinate production in complex medium
(San et al., U.S. Pat. No. 7,223,567) produced less succinate than
the wild type parent in NBS mineral salts medium. Based on these
results, we concluded that rational selection of target genes for
deletion based on observations of pathways is an unreliable
predictor of success for improvements in succinate production when
using mineral salts medium. In mineral salts medium, carbon must be
precisely partitioned between energy generation, fermentation, and
the biosynthesis of building block molecules needed for cell
growth.
[0220] As the results shown above indicate this invention provides
a new strategy to construct strains for succinate production in
mineral salts medium. No mutations were required in genes encoding
the E. coli mixed acid fermentation pathway (FIG. 14) to
substantially redirect glucose carbon to succinate. In this
invention, the combination of two core changes in peripheral
pathways resulted in a five-fold increase in succinate yield. The
two core changes that are required for succinate production area 1)
increased expression of the energy conserving (gluconeogenic)
phosphoenolpyruvate carboxykinase to replace the native
fermentative phosphoenolpyruvate carboxylase (energy wasting) and
2) replacement of the glucose phosphoenolpyruvate-dependent
phosphotransferase system with an alternative permease such as galP
and ATP-dependent phosphorylation (glk). Together, these changes
increased net ATP production for growth, increased the pool of
phosphoenolpyruvate available for carboxylation, and increased
succinate production.
[0221] Additional mutations in genes in the mixed acid fermentation
pathway such as the deletion of pflB and others represent
opportunities for modest further increases in succinate yield and
production. Note that acetyl-CoA is an essential metabolite for
biosynthesis that is produced primarily by pflB during fermentative
growth. This function is presumed to be replaced in pflB mutants by
native expression of the pyruvate dehydrogenase complex (aceEF,
lpd), an enzyme that typically serves as the dominant route for
acetyl-CoA production during oxidative metabolism. (Kim et al.,
2007). The resulting succinate pathway in E. coli strains optimally
engineered for succinate production in mineral salts medium (FIG.
14) is functionally similar to the native pathway that evolved in
succinate-producing rumen bacteria. (Kim et al., 2004; Lee et al.,
2002; Lee et al., 2006; Samuelov et al., 1991; VanderWerf et al.,
1997).
Example 5
Succinate Production from Glycerol
[0222] Despite the difference in redox properties and transport
mechanism for glycerol and glucose, we have discovered that the
same mutations enabling the conversion of glucose into succinate in
mineral salt medium can also be used to effectively redirect
glycerol metabolism into succinate production at 80% of the maximum
efficiency for the conversion of glycerol to succinate (0.8 mol of
succinate produced per mol glycerol consumed).
[0223] During the course of these studies, we have discovered that
gldA and the PEP-dependent phosphotransferase pathway previously
regarded as cryptic comprise an important functional route for
glycerol catabolism (FIG. 15). In both pathways, glycerol enters
the cells by facilitated diffusion. Within the cell, part of the
glycerol is immediately phosphorylated followed by oxidation to
DHAP, the pathway that is widely regarded as the standard pathway
for glycerol metabolism in E. coli. We have discovered that at
least 1/3 of the glycerol is first reduced by gldA to DHA and
subsequently phosphorylated by the PEP-dependent phosphotransferase
system (ptsH, ptsI) acting within the cytoplasm to yield DHAP. DHAP
serves as the common entry point to central metabolism for both
uptake and activation systems.
[0224] Table 20 clearly demonstrates the effectiveness of combining
the core mutations identified for succinate production with glucose
for succinate production from glycerol in mineral salts medium
(NBS) without the addition of complex nutrients. Although deletion
of pflB alone reduced succinate production below that of the wild
type parent, the combination of the pflB deletion with the promoter
mutation in pck (pck*; transcriptional activation) doubled
succinate yield from 0.25 mol/mol glycerol to 0.5 mol/mol glycerol.
Subsequent addition of a mutation in ptsI further increased the
succinate yield to 0.8 mol of succinate/mol glycerol, 80% of the
maximum theoretical yield. Similar results were also found for the
deletion of other key genes (gldA, ptsH, ptsI, dhaKL, dhaM) that
disrupt the use of the phosphorelay system for phosphorylation
(Table 20). These results were unexpected. The resulting pathway
for glycerol conversion is shown in FIG. 15.
[0225] FIG. 15 shows a combination of the generally accepted
pathway for glycerol catabolism (Lin, 1996) and the mixed acid
fermentation pathway (Bock and Sawers, 1996) in wild type E. coli.
In this pathway, all ATP produced would be consumed by glycerol
phosphorylation if succinate is produced as a sole product. No ATP
would be available for growth. Based on FIG. 15, deletion of pflB
would be expected to increase succinate production by increasing
the availability of reductant and intermediates. In contrast to
this expectation, a decrease in succinate production was observed
with the deletion of pflB gene (Table 20). Based on this pathway,
mutational activation of the pck gene that normally functions only
during gluconeogenesis may be anticipated to increase the flow of
phosphoenolpyruvate into succinate by competing with pyruvate
kinases based solely on the prior observation in this patent
application that this increase in PCK expression was beneficial for
sugar fermentation into succinate, otherwise this would be
unexpected. The utilization of phosphoenolpyruvate carboxykinase
(pck) instead of phosphoenolpyruvate carboxylase (ppc) has the
added advantage of conserving energy from phosphoenolpyruvate as an
additional ATP which can be used for biosynthesis.
[0226] Although a mutation in ptsI was beneficial for the diversion
of carbon from glucose to succinate, this could not have been
predicted to be of any benefit since the only glycerol uptake
system recognized as functional in wild type E. coli (glpF) does
not involve the phosphoenolpyruvate phosphotransferases system.
(Keseler et al., 2005; Lin, 1996.). The only known involvement of
the phosphotransferase system in glycerol metabolism is within a
minor pathway thought to be inactive in wild type E. coli. (Jin et
al., 1983: Lin, 1996; Tang et al., 1982). This minor pathway first
reduces intracellular glycerol to dihydroxyacetone (DHA) with GldA
then uses PtsH (ptsH) and EI (ptsI) as phosphate carriers to couple
phosphoenolpyruvate to the phosphorylation of intracellular DHA to
produce dihydroxyacetone-phosphate (DHAP). This pathway is thought
to function only in mutant strains in which glpK is inactive.
(Gutknecht et al., 2001; Keseler et al., 2005). Contrary to all
expectations based on the generally accepted pathways for glycerol
metabolism, a mutation of ptsI significantly increased the
production of succinate from glycerol. These results indicate that
the glycerol dehydrogenase (gldA) and PTS phospho-relay system
(phosphoenolpyruvate, PtsH, PtsI) are of unexpected importance for
the catabolism of glycerol to dihydroxyacetone phosphate (DHAP)
during the anaerobic fermentation of glycerol in NBS mineral salts
medium. Based on the large increase in succinate yield, this
dihydroxyacetone (DHA) pathway can be estimated to account for at
least one-third of the glycerol flux into glycolysis. The deletion
in ptsI inactivated this pathway and increased the availability of
phosphoenolpyruvate for succinate production. Together, these three
core mutations (pck*, ptsI, pflB) effectively and unexpectedly
redirected carbon flow from glycerol to succinate at 80% of the
maximum theoretical yield during anaerobic fermentation in mineral
salts medium (FIG. 15). In addition, the use of this pathway
results in an important increase in ATP production, facilitating
growth.
TABLE-US-00001 TABLE 1 Comparison of succinate production by
microbial biocatalysts.sup.a Succinate Succinate Titer Yield
Organism Medium/Condition (mM).sup.b (mol/mol) Reference E. coli
KJ060 100 g/l glucose AM1 with 10 g/l 733 1.41 This paper (ldhA
adhE ackA NaHCO.sub.3, simple batch [0.90] focA pflB) fermentation,
120 h incubation, pH maintained with 1:1 mixture of 6M KOH + 3M
K.sub.2CO.sub.3 E. coli KJ073 (ldhA 100 g/l glucose AM1 with 10 g/l
668 1.20 This paper adhE ackA focA NaHCO.sub.3, simple batch [0.82]
pflB mgsA poxB) fermentation, 96 h incubation, pH maintained with
1:1 mixture of 6M KOH + 3M K.sub.2CO.sub.3 E. coli KJ060 (ldhA 100
g/l glucose AM1 with 10 g/l 622 1.61 This paper adhE ackA focA
NaHCO.sub.3, simple batch [0.61] pflB) high inoculum fermentation,
120 h incubation, (200 mg CDW 1.sup.-1) pH maintained with 1:1
mixture of 6M KOH + 3M K.sub.2CO.sub.3 Actinobacillus 130 g/l
glucose supplemented 898 1.25 Guettler et succinogenes with 15 g/l
CSL and 5 g/l YE, 80 g/l [1.36] al., 1996a FZ53 MgCO.sub.3,
anaerobic batch fermentation, 78 h incubation E. coli AFP111 40 g/l
glucose (90 g total 841 1.68 Vemuri et al., (pflAB, ldhA, ptsG)
glucose) in medium [1.31] 2002ab Rhizobium etli pyc supplemented
with 20 g/l overexpressed tryptone, 10 g/l YE and 40 g/l
MgCO.sub.3, dual phase-fed batch fermentation, 76 h incubation
Anaerobiospirillum 120 g/l glucose in peptone/YE 703 1.35 Meynial-
succiniciproducens based medium, integrated [0.55] Salles et al.,
ATCC 53488 membrane-bioreactor- 2007 electrodialysis with CO.sub.2
sparging, 150 h incubation Actinobacillus 100 g/l glucose
supplemented 678 1.37 Guettler et succinogenes with 15 g/l CSL and
YE, 80 g/l [2.05] al., 1996b 130Z MgCO.sub.3, anaerobic batch
fermentation, CO.sub.2 sparging, 39 h incubation E. coli 106 g/l
glucose in medium 499 0.85 Lin et al., HL27659k/pKK313 supplemented
with 20 g/l [1.00] 2005d (iclR sdhAB ackA- tryptone, 32 g/l YE and
2 g/l pta poxB, pstG) NaHCO.sub.3, fed batch fermentation Sorghum
vulgare under complete aerobic pepc overexpressed condition, 59 h
incubation Anaerobiospirillum 50 g/l glucose and 10 g/l CSL, 426
1.37 Glassner and succiniciproducens CO.sub.2 sparging and 300 mM
[2.09] Datta, 1992 ATCC 53488 Na.sub.2CO.sub.3, batch fermentation,
24 h incubation Mannheimia 63 g/L glucose in MMH3 (yeast 444 1.16
Lee et al., succiniciproducens extract based medium), fed batch
[1.75] 2006 (ldhA pflB pta- fermentation, 0.25 vol/vol/min ackA)
CO.sub.2 sparging, 30 h incubation Bacterial Isolate 50 g/l glucose
supplemented with 388 1.40 Guettler et 130Z 1% CSL, 0.6% YE, and 2
g/l [1.55] al., 1998 ATCC 55618 MgCO.sub.3 neutralized with 10N
NaOH, 0.3 atm of CO.sub.2, 29.5 h incubation E. coli SBS550MG 20
g/l glucose (100 g total 339 1.61.sup.c Sanchez et (ldhA adhE iclR
E.. glucose) LB supplemented with 1 g/l [0.42] al., 2005a;
ackA-pta), NaHCO.sub.3, 200 mg/l ampicillin, Cox et al., L. lactis
pyc and 1 mM IPTG. 100% CO.sub.2 at 2006 Bacillus subtilis citZ 1
L/min STP headspace, repeated fed-batch fermentation, 95 h
incubation E. coli AFP184 102 g/l glucose supplemented 339
0.72.sup.c Andersson et (pflB ldhA pts) with 15 g/l CSL, dual phase
[1.27] al., 2007 aerobic growth and anaerobic production, sparging
with air followed by CO.sub.2, 32 h incubation Actinobacillus 70
g/l glucose with flour 302 1.18 Du et al., succinogenes hydrolysate
and 5 g/l YE, [0.55] 2007 ATCC 55618 anaerobic batch fermentation
with 4% inoculum, 65 h incubation Anaerobiospirillum 50 g/l
glucose, 2% CSL, and 25 ppm 289 1.04 Guettler et succiniciproducens
tryptophan, neutralized with [1.16] al., 1998 ATCC 53488 5.5M
NaCO.sub.3, saturated medium of 0.3 atm partial pressure of
CO.sub.2, 29.5 h incubation Succinivibrio 15 g/l of each CSL and
YE, 100 g/l 226 NR Guettler et dextrinosolvens glucose, and 80 g/l
MgCO.sub.3, [0.74] al., 1998 ATCC 19716 batch fermentation, 36 h.
Corynebacterium 40 g/l glucose (121 g total 195 0.29 Okino et al.,
glutanicum R glucose) in Defined mineral salt [3.83] 2005 medium
with 400 mM NaHCO.sub.3, fed batch fermentation, 6 h incubation
Prevotella 15 g/l of each CSL and YE, 100 g/l 160 NR Guettler et
ruminocola glucose, and 80 g/l MgCO.sub.3, [0.52] al., 1998 ATCC
19188 batch fermentation, 36 h incubation E. coli SBS550MG 20 g/l
glucose LB supplemented 162.6 1.61.sup.c Sanchez et (ldhA adhE iclR
with 1 g/l NaHCO.sub.3, 200 mg/l [0.80] al., 2005a; ackA-pta),
ampicillin, and 1 mM IPTG. Cox et al., L. lactis pyc 100% CO.sub.2
at 1 L/min STP 2006 Bacillus subtilis citZ headspace, batch
fermentation, 24 h. incubation Mannheimia 18 g/L glucose in MH4 (YE
144 1.44 Song et al., succiniciproducens based medium) supplemented
[2.83] 2007 MBEL55E with 119 mM NaHCO.sub.3, a KCTC 0769BP
continuous-cell-recycle membrane reactor with the CO.sub.2 partial
pressure of 101.3 kPa gas (100% CO.sub.2), 6 h incubation E. coli
SBS110MG 20 g/l glucose LB supplemented 130 1.24.sup.c Sanchez et
(ldhA adhE), with1.5 g/l NaHCO.sub.3 and 0.5 g [0.09] al., 2005a;
Lactococcus lactis MgCO.sub.3, 200 mg/l ampicillin, and Sanchez et
pyc 1 mM IPTG. Dual phase with al., 2006 100% CO.sub.2 at 1 L/min
STP headspace, 168 h incubation E. coli NZN111 20 g/l glucose LB
supplemented 108 0.98.sup.c Stols et al., (W1485 pflB ldhA), with
0.5 g MgCO.sub.3, 1.5 g/l [0.22] 1997 E. coli sfcA NaOAc, 0.1 g/l
ampicillin, and overexpressed 10 .mu.M IPTG, 44 h incubation,
sealed serum tube. E. coli JCL1208, 11 g/l glucose LB supplemented
91 0.44.sup.c Millard et al., E. coli ppc with 0.15 g MgCO.sub.3,
0.1 g/l [0.60] 1996 overexpressed carbenicillin, and 0.1 mM IPTG,
44 h incubation, anoxic CO.sub.2 charging at 1 atm headspace, 18 h
incubation E. coli GJT - 40 g/l glucose LB supplemented 80
0.42.sup.c Lin et al., Sorghum pepC with 27.78 g/l MgCO.sub.3,
simple [no data] 2005c batch fermentation in sealed airtight flask
E. coli HL51276k 10.8 g/l glucose LB 68 1.09.sup.c Lin et al.,
(iclR icd sdhAB supplemented with 2 g/l NaHCO.sub.3, [0.16] 2005b
ackA-pta poxB, 50 mg/l kanamycin, 1 mM pstG), Sorghum sp. IPTG,
aerobic pepC batch reactor 50, h incubation S8D mutation E. coli
SBS880MG 20 g/l glucose LB supplemented 60 0.94.sup.c Sanchez et
(ldhA adhE .DELTA.fdhF), with1.5 g/l NaHCO.sub.3 and 0.5 g [0.04]
al., 2005b L. lactis pyc MgCO.sub.3, 200 mg/l ampicillin, and 1 mM
IPTG. Dual phase with 100% CO.sub.2 headspace, 168 h incubation
.sup.aAbbreviations: CSL, corn steep liquor; YE, yeast extract; NR,
not reported. .sup.bAverage volumetric productivity is shown in
brackets [g l.sup.-1 h.sup.-1] beneath succinate titer. .sup.cThe
molar yield was calculated based on the production of succinate
from metabolized sugar during both aerobic and anaerobic
conditions. Biomass was generated predominantly during aerobic
growth. Succinate was produced primarily during anaerobic
incubation with CO.sub.2, H.sub.2, or a mixture of both.
TABLE-US-00002 TABLE 2 List of bacterial strains that have been
deposited with the ARS culture collection. Culture Strain
Designations Deposit Date KJ012 B-50022 Mar. 15, 2007 KJ017 B-50023
Mar. 15, 2007 KJ032 B-50024 Mar. 15, 2007 KJ060 B-50025 Mar. 15,
2007 KJ070 B-50026 Mar. 15, 2007 KJ071 B-50027 Mar. 15, 2007 KJ072
B-50028 Mar. 15, 2007 KJ073 B-50029 Mar. 15, 2007 KJ091 B-50110
Feb. 20, 2008 KJ098 B-50111 Feb. 20, 2008 KJ104 B-50112 Feb. 20,
2008 KJ110 B-50113 Feb. 20, 2008 KJ119 B-50114 Feb. 20, 2008 KJ122
B-50115 Feb. 20, 2008 KJ134 B-50116 Feb. 20, 2008 XZ320 NRRL
B-50267 Mar. 17, 2009 XZ332 NRRL B-50268 Mar. 17, 2009 XZ341 NRRL
B-50269 Mar. 17, 2009 XZ396 NRRL B-50270 Mar. 17, 2009 XZ468 NRRL
B-50271 Mar. 17, 2009 XZ469 NRRL B-50272 Mar. 17, 2009 XZ470 NRRL
B-50273 Mar. 17, 2009 XZ613 NRRL B-50274 Mar. 17, 2009 XZ615 NRRL
B-50275 Mar. 17, 2009 XZ616 NRRL B-50276 Mar. 17, 2009 XZ618 NRRL
B-50277 Mar. 17, 2009 XZ620 NRRL B-50278 Mar. 17, 2009 XZ647 NRRL
B-50279 Mar. 17, 2009 XZ721 NRRL B-50280 Mar. 17, 2009 XZ723 NRRL
B-50281 Mar. 17, 2009
TABLE-US-00003 TABLE 3 Escherichia coli strains, plasmids, and
primers used in this study Relevant Characteristics Sources
Escherichia coli Strains Strain C Wild type (ATCC 8739) ATCC KJ012
strain C, .DELTA.ldhA::FRT .DELTA.adhE::FRT .DELTA.ackA::FRT This
study KJ017 KJ012, improved strain selected from 10% glucose, NBS
This study KJ032 KJ017, .DELTA.ldhA::FRT .DELTA.adhE::FRT
.DELTA.ackA::FRT .DELTA.(focA- This study pflB)::FRT KJ060 KJ032,
improved strain selected from 10% glucose without This study
initial acetate, NBS KJ070 KJ060, .DELTA.mgsA This study KJ071
KJ070, improved strain selected from 10% glucose, NBS This study
KJ072 KJ071, .DELTA.poxB This study KJ073 KJ072, improved strain
selected from 10% glucose, AM1 This study SZ204
.DELTA.(focA-pflB)::FRT-kan-FRT Zhou, 2003 Plasmids pKD4 bla
FRT-kan-FRT Datsenko, 2000 pKD46 bla .gamma..beta. exo (Red
recombinase), temperature-conditional Datsenko, 2000 replicon pFT-A
bla flp temperature-conditional replicon and FLP recombinase
Posfai, 1997 pEL04 cat-sacB targeting cassette Lee, 2001 Thomason,
2005 pLOI3421 1.8 kbp SmaI fragment containing aac Wood, 2005
pLOI4151 bla cat; cat-sacB cassette This study pCR2.1-TOPO bla kan;
TOPO TA cloning vector Invitrogen pLOI4228 bla kan;
yccT'-mgsA-helD' (PCR) from E. coli C cloned into This study
pCR2.1-TOPO vector pLOI4229 cat-sacB cassette PCR amplified from
pLOI4151 (EcoRV This study digested) cloned into mgsA in pLOI4228
pLOI4230 PCR fragment amplified from pLOI4228 (using mgsA-1/2 This
study primers), kinase treated, then self-ligation pLOI4274 bla
kan; poxB (PCR) from E. coli C cloned into pCR2.1-TOPO This study
vector pLOI4275 cat-sacB cassette PCR amplified from pLOI4151
(EcoRV This study digested) cloned into poxB of pLOI4274 pLOI4276
PCR fragment amplified from pLOI4274 (using poxB-1/2 This study
primers), kinase treated, then self-ligation Primer sets ldhA
5'ATGAACTCGCCGTTTTATAGCACAAAACAGTACG This study
ACAAGAAGTACGTGTAGGCTGGAGCTGCTTC3' (SEQ ID NO: 2)
5'TTAAACCAGTTCGTTCGGGCAGGTTTCGCCTTTT
TCCAGATTGCTCATATGAATATCCTCCTTAG3' (SEQ ID NO: 3) adhE
5'ATGGCTGTTACTAATGTCGCTGAACTTAACGCAC Zhou, 2003
TCGTAGAGCGTGTGTAGGCTGGAGCTGCTTC3' (SEQ ID NO: 4)
5'TTAAGCGGATTTTTTCGCTTTTTTCTCAGCTTTAG
CCGGAGCAGCCATATGAATATCCTCCTTAG3' (SEQ ID NO: 5) ackA
5'ATGTCGAGTAAGTTAGTACTGGTTCTGAACTGCG Zhou, 2003
GTAGTTCTTCAGTGTAGGCTGGAGCTGCTTC3' (SEQ ID NO: 6)
5'TCAGGCAGTCAGGCGGCTCGCGTCTTGCGCGATA
ACCAGTTCTTCCATATGAATATCCTCCTTAG3' (SEQ ID NO: 7) focA-pflB
5'TTACTCCGTATTTGCATAAAAACCATGCGAGTTA This study
CGGGCCTATAAGTGTAGGCTGGAGCTGCTTC3' (SEQ ID NO: 8)
5'ATAGATTGAGTGAAGGTACGAGTAATAACGTCCT
GCTGCTGTTCTCATATGAATATCCTCCTTAG3' (SEQ ID NO: 9) JMcatsacB
5'TTAGCTAGCATGTGACGGAAGATCACTTCG3' This study (SEQ ID NO: 10)
5'CCGCTAGCATCAAAGGGAAAACTGTCCATAT3' (SEQ ID NO: 11) cat-up2/sacB-
5'AGAGAGGATATCTGTGACGGAAGATCACTTCG3' This study down2 (SEQ ID NO:
12) 5'AGAGAGGATATCGAATTGATCCGGTGGATGAC3' (SEQ ID NO: 13)
mgsA-up/down 5'CAGCTCATCAACCAGGTCAA3' (SEQ ID NO: 14) This study
5'AAAAGCCGTCACGTTATTGG3' (SEQ ID NO: 15) mgsA-1/2
5'AGCGTTATCTCGCGGACCGT3' (SEQ ID NO: 16) This study
5'AAGTGCGAGTCGTCAGTTCC3' (SEQ ID NO: 17) poxB-up/down
5'AAGCAATAACGTTCCGGTTG3' (SEQ ID NO: 18) This study
5'CCACTTTATCCAGCGGTAGC3' (SEQ ID NO: 19) poxB-1/2
5'GACGCGGTGATGAAGTGAT3' (SEQ ID NO: 20) This study
5'TTTGGCGATATAAGCTGCAA3' (SEQ ID NO: 21) pck-F/R 5'TTGGCTAAGG
AGCAGTGAAA TGCGCGTTA3' This study (SEQ ID NO: 22) 5'CACGACAAAA
GAAGGGTAAA TAAAC3' (SEQ ID NO: 23) pck-2/3 5'TTGTTAACGCGCATTTCACT3'
(SEQ ID NO: 24) This study 5'GCGATAGCGGCTACTGTCAT3' (SEQ ID NO: 25)
pck (RT-PCR) 5'GACGATACCACTCGCGAT3' (SEQ ID NO: 26) This study
5'GTCGACAACGAACAGACGT3' (SEQ ID NO: 27) birA (RT-PCR)
5'ATCGTGATGGCGGAAGT3' (SEQ ID NO: 28) This study
5'CTTGCGATCCTGCAGATAG3' (SEQ ID NO: 29)
TABLE-US-00004 TABLE 4 Fermentation of glucose in mineral salts
medium by mutant strains of E. coli Cell Av. Vol. Media,
Yield.sup.b Succinate Yield.sup.c Prod.sup.d Strain.sup.a Culture
Conditions Glucose %( (g/L) mol/mol g/g (g/L/h) E. coli C 0.1
OD.sub.550, 0.1 mM 5%, NBS 2.0 .+-. 0.2 0.19 .+-. 0.02 0.12 0.12
.+-. 0.01 wild type.sup.f 0.2 betaine KJ012.sup.f 0.1 OD.sub.550,
0.1 mM betaine 5% NBS 0.3 .+-. 0.1 0.20 .+-. 0.01 0.13 0.04 .+-.
0.01 KJ012 0.1 OD.sub.550, 0.1 mM betaine 5% NBS + MOPS 1.5 0.10
0.06 0.02 shaken flask.sup.h KJ012 0.1 OD.sub.550 5% LB 1.5 0.70
0.50 0.09 Luria Broth KJ012 1.sup.st TF: No betaine, 0.1
OD.sub.550, 5%, NBS 0.3 0.13 0.09 0.072 (ldhA, ackA, 120 h
transfers adhE) 3.sup.rd TF: 2 mM betaine, 0.1 5%, NBS 0.7 0.28
0.18 0.128 (KJ017) OD.sub.550, 96 h transfers 40.sup.th TF: 1 mM
betaine, 0.1 5%, NBS 2.3 0.73 0.48 0.251 OD.sub.550, 24 h
transfers, 3M K.sub.2CO.sub.3 + 6N KOH 40.sup.th TF: 1 mM betaine,
0.1 10%, NBS 1.7 0.74 0.49 0.354 OD.sub.550, 24 h transfers, 3M
K.sub.2CO.sub.3 + 6N KOH KJ032 2.sup.nd TF: 1 mM betaine, 0.1 5%,
NBS 1.0 1.47 0.97 0.260 (ldhA, ackA, OD.sub.550, 48 h transfers, 20
mM adhE, focA, NaOAc, 3M K.sub.2CO.sub.3 + 6N KOH pflB) 15.sup.th
TF: 1 mM betaine, 0.01 10%, NBS 1.4 1.07 0.71 0.736 (KJ060)
OD.sub.550, 24 h transfers, 5 mM NaOAc, 3M K.sub.2CO.sub.3 + 6N KOH
5.sup.th TF: 1 mM betaine, 0.01 10%, NBS 1.4 1.04 0.69 0.711
OD.sub.550, 24 h transfers, No NaOAc, 3M K.sub.2CO.sub.3 + 6N KOH
KJ070 1.sup.st TF: 1 mM betaine, 0.01 5%, NBS 1.0 1.06 0.70 0.361
(ldhA, ackA, OD.sub.550, 24 h TF, 3M adhE, focA, K.sub.2CO.sub.3 +
6N KOH, pflB, mgsA) 50.sup.th TF: 1 mM betaine, 0.01 10%, NBS 1.1
0.71 0.47 0.419 (KJ071) OD.sub.550, 24 h transfers, 3M
K.sub.2CO.sub.3 + 6N KOH KJ072 2.sup.nd TF: 1 mM betaine, 0.01 10%,
NBS 1.3 0.97 0.64 0.663 (ldhA, ackA, OD.sub.550, 24 h transfers, 3M
adhE, focA K.sub.2CO.sub.3 + 6N KOH pflB, mgsA, 6.sup.th TF: 1 mM
betaine, 0.01 10%, AM1 1.2 1.34 0.88 0.733 poxB) OD.sub.550, 24 h
transfers, 3M (KJ073) K.sub.2CO.sub.3 + 6N KOH 45.sup.th TF: 1 mM
betaine, 0.01 10%, AM1 1.5 1.26 0.83 0.858 OD.sub.550, 24 h
transfers, 3M K.sub.2CO.sub.3 + 6N KOH KJ073.sup.f 1 mM betaine, 3M
K.sub.2CO.sub.3 + 6N 10%, AM1 2.3 .+-. 0.1 1.20 .+-. 0.09 0.77 .+-.
0.03 0.82 .+-. 0.01 KOH, 0.01 OD.sub.550 inoculum KJ060.sup.f 1 mM
betaine, 3M K.sub.2CO.sub.3 + 6N 10%, AM1 2.2 .+-. 0.1 1.41 .+-.
0.07 0.92 .+-. 0.05 0.90 .+-. 0.04 KOH, 0.03 OD.sub.550 inoculum
KJ060.sup.f 1 mM betaine, 3M K.sub.2CO.sub.3 + 6N 10%, AM1 2.2 .+-.
0.1 1.61 .+-. 0.12 1.05 .+-. 0.09 0.77 .+-. 0.04 KOH, 0.60
OD.sub.550 inoculum KJ071.sup.f 1 mM betaine, 3M K.sub.2CO.sub.3 +
6N 10%, NBS 1.5 .+-. 0.0 0.78 .+-. 0.02 0.53 .+-. 0.01 0.33 .+-.
0.04 KOH, 0.01 OD.sub.550 inoculum Fermentation Products (mM).sup.e
Strain.sup.a Culture Conditions Suc Mal Pyr Ace Lac For E. coli C
0.1 OD.sub.550, 0.1 mM 49 .+-. 3 .sup. --.sup.g 33 .+-. 10 152 .+-.
30 98 .+-. 24 262 .+-. 19 wild type.sup.f 0.2 betaine KJ012.sup.f
0.1 OD.sub.550, 0.1 mM betaine 6 .+-. 0.4 -- -- 26 .+-. 1 -- --
KJ012 0.1 OD.sub.550, 0.1 mM betaine 10 -- -- 226 -- 16 shaken
flask.sup.h KJ012 0.1 OD.sub.550 108 -- -- 61 <2 14 Luria Broth
KJ012 1.sup.st TF: No betaine, 0.1 OD.sub.550, 6 -- -- 26 <2 --
(ldhA, ackA, 120 h transfers adhE) 3.sup.rd TF: 2 mM betaine, 0.1
26 -- -- 71 <2 -- (KJ017) OD.sub.550, 96 h transfers 40.sup.th
TF: 1 mM betaine, 0.1 204 -- -- 179 <2 151 OD.sub.550, 24 h
transfers, 3M K.sub.2CO.sub.3 + 6N KOH 40.sup.th TF: 1 mM betaine,
0.1 288 -- -- 181 38 199 OD.sub.550, 24 h transfers, 3M
K.sub.2CO.sub.3 + 6N KOH KJ032 2.sup.nd TF: 1 mM betaine, 0.1 212
-- -- 44 -- -- (ldhA, ackA, OD.sub.550, 48 h transfers, 20 mM adhE,
focA, NaOAc, 3M K.sub.2CO.sub.3 + 6N KOH pflB) 15.sup.th TF: 1 mM
betaine, 0.01 596 331 9 170 <2 -- (KJ060) OD.sub.550, 24 h
transfers, 5 mM NaOAc, 3M K.sub.2CO.sub.3 + 6N KOH 5.sup.th TF: 1
mM betaine, 0.01 579 318 9 161 <2 -- OD.sub.550, 24 h transfers,
No NaOAc, 3M K.sub.2CO.sub.3 + 6N KOH KJ070 1.sup.st TF: 1 mM
betaine, 0.01 294 219 25 102 -- -- (ldhA, ackA, OD.sub.550, 24 h
TF, 3M adhE, focA, K.sub.2CO.sub.3 + 6N KOH, pflB, mgsA) 50.sup.th
TF: 1 mM betaine, 0.01 341 626 <2 76 -- -- (KJ071) OD.sub.550,
24 h transfers, 3M K.sub.2CO.sub.3 + 6N KOH KJ072 2.sup.nd TF: 1 mM
betaine, 0.01 539 186 <2 95 -- -- (ldhA, ackA, OD.sub.550, 24 h
transfers, 3M adhE, focA K.sub.2CO.sub.3 + 6N KOH pflB, mgsA,
6.sup.th TF: 1 mM betaine, 0.01 596 38 4 112 -- -- poxB)
OD.sub.550, 24 h transfers, 3M (KJ073) K.sub.2CO.sub.3 + 6N KOH
45.sup.th TF: 1 mM betaine, 0.01 699 313 103 172 -- -- OD.sub.550,
24 h transfers, 3M K.sub.2CO.sub.3 + 6N KOH KJ073.sup.f 1 mM
betaine, 3M K.sub.2CO.sub.3 + 6N 668 .+-. 8 118 .+-. 13 55 .+-. 22
183 .+-. 27 -- -- KOH, 0.01 OD.sub.550 inoculum KJ060.sup.f 1 mM
betaine, 3M K.sub.2CO.sub.3 + 6N 733 .+-. 39 39 .+-. 17 -- 250 .+-.
36 2 .+-. 1 -- KOH, 0.03 OD.sub.550 inoculum KJ060.sup.f 1 mM
betaine, 3M K.sub.2CO.sub.3 + 6N 622 .+-. 8 17 .+-. 5 1.5 .+-.
1.sup. 180 .+-. 13 2 .+-. 1 -- KOH, 0.60 OD.sub.550 inoculum
KJ071.sup.f 1 mM betaine, 3M K.sub.2CO.sub.3 + 6N 280 .+-. 7 516
.+-. 14 58 .+-. 15 64 .+-. 9 -- -- KOH, 0.01 OD.sub.550 inoculum
.sup.aClones were isolated from the fermentation broth at various
points and assigned strain numbers, indicated by numbers in
parenthesis. .sup.bCell yield estimated from optical density (3
OD.sub.550 nm = 1 g l.sup.-1 CDW). .sup.cSuccinate yields were
calculated based on glucose metabolized. .sup.dAverage volumetric
productivity was calculated for total incubation time.
.sup.eAbbreviations: suc, succinate; mal, malate; pyr, pyravate;
ace, acetate; lac, lacate; for, formate. .sup.fAverage of 3 or more
fermentations with standard deviations. .sup.gDash indicates
absence of product. .sup.hAerobic shaken flask (100 rpm; 100 ml
NBS, 250-ml flask.
TABLE-US-00005 TABLE 5 Comparison of carboxylation enzyme
activities in different strains Specific activity [nmol min.sup.-1
(mg protein).sup.-1] E. coli E. coli E. coli E. coli E. coli
Actinobacillus Enzyme C KJ012 KJ017 KJ073 K12 .sup.a succinogenes
.sup.a PEP carboxylase 20 .+-. 2 25 .+-. 2 17 .+-. 1 27 .+-. 2 140
10 PEP 295 .+-. 23 162 .+-. 11 700 .+-. 68 7341 .+-. 462 140 4,700
carboxykinase Malic enzyme ND .sup.b 5 + 2 12 .+-. 4 12 .+-. 3
Unknown Unknown (NADH, carboxylation) Malic enzyme <1 <1
<1 <1 Unknown Unknown (NADPH carboxylation) .sup.a data was
from van der Werf et al., 1997 .sup.b Unable to measure in wild
type E. coli C due to presence of lactate dehydrogenase
TABLE-US-00006 TABLE 6 Composition of media (excluding carbon
source). Concentration (mmol L.sup.-1) Component .sup.aNBS + 1 mM
betaine AM1 + 1 mM betaine KH.sub.2PO.sub.4 25.72 0
K.sub.2HPO.sub.4 28.71 0 (NH.sub.4).sub.2HPO.sub.4 26.50 19.92
NH.sub.4H.sub.2PO.sub.4 0 7.56 Total PO.sub.4 80.93 27.48 Total N
53.01 47.39 .sup.bTotal K 84.13 1.00 MgSO.sub.4 7H.sub.2O 1.00 1.50
CaCl.sub.2 2H.sub.2O 0.10 0 Thiamine HCl 0.015 0 Betaine-KCl 1.00
1.00 (.mu.mol L.sup.-1).sup.c FeCl.sub.3 6H.sub.2O 5.92 8.88
CoCl.sub.2 6H.sub.2O 0.84 1.26 CuCl.sub.2 2H.sub.2O 0.59 0.88
ZnCl.sub.2 1.47 2.20 Na.sub.2MoO.sub.4 2H.sub.2O 0.83 1.24
H.sub.3BO.sub.3 0.81 1.21 MnCl.sub.2 4H.sub.2O.sub.2 0 2.50 Total
Salts 12.5 g L.sup.-1 4.1 g L.sup.-1 .sup.aNBS + 1 mM betaine: NBS
media amended with betaine (1 mM). .sup.bCalculation includes KOH
used to neutralize betaine-HCl stock. .sup.cTrace metal stock
(1000X) was prepared in 120 mM HCl.
TABLE-US-00007 TABLE 7 Escherichia coli strains, plasmids, and
primers used in herein Relevant Characteristics Sources Escherichia
coli Strains Strain B KJ073 .DELTA.ldhA::FRT .DELTA.adhE::FRT
.DELTA.(focA-pflB)::FRT .DELTA.ackA::FRT .DELTA.mgsA Jantama et
al., .DELTA.poxB 2008 KJ076 KJ073, .DELTA.ackA::cat-sacB,
translational stop sequence Disclosed herein KJ079 KJ073,
.DELTA.ackA:..translational stop sequence Disclosed herein TG200
KJ079, .DELTA.adhE::cat-sacB Disclosed herein TG201 TG200,
.DELTA.adhE Disclosed herein TG202 TG201, .DELTA.ldhA::cat-sacB
Disclosed herein TG203 TG202, .DELTA.ldhA Disclosed herein TG204
TG203, .DELTA. (focA-pflB)::cat-sacB Disclosed herein KJ091 TG204,
.DELTA.(focA-pflB) Disclosed herein KJ098 KJ091, .DELTA.tdcDE
Disclosed herein KJ104 KJ098, .DELTA.citF Disclosed herein KJ110
KJ104, .DELTA.aspC Disclosed herein KJ119 KJ104, .DELTA.sfcA
Disclosed herein KJ122 KJ110, .DELTA.sfcA Disclosed herein KJ134
KJ122, .DELTA.ackA-pta Disclosed herein Plasmids pKD46 Bla .gamma.
.beta. exo (red recombinase), temperature-conditional replicon
Datsenko, 2000 pEL04 cat-sacB cassette Lee, 2001 Thomason, 2005
pLOI2228 cat; FRT-cat-FRT cassette Martinez- Morales et al., 1999
pLOI2511 bla kan; FRT-kan-FRT cassette Underwood et al., 2002
pLOI4131 bla; ligation of pLOI2228 (BanI digested, Klenow treated,
ClaI Disclosed digested FRT-cat-FRT cassette) and pLOI2511 (NheI
digested, herein Klenow treated, ClaI digested) pLOI4145 bla; EcoRI
digested pLOI4131, self-ligation Disclosed herein pLOI4146 bla cat;
ligation of cat-sacB cassette PCR amplified (using Disclosed
JMcatsacBup3/down3 primers) from pLOI4152, BamHI/XhoI herein
digested and BamHI/XhoI digested pLOI4153 pLOI4151 bla cat;
cat-sacB cassette Jantama et al., 2008 pLOI4152 cat-sacB cassette;
PCR amplified cassette from pEL04 (using Disclosed JMpEL04F1/R1
primers), BglII digestion and self-ligation herein pLOI4153 bla;
ligation of pLOI4145 (KasI/XmaI digested) and KasI/XmaI Disclosed
digested SfPBXPS polylinker (annealing of complementary herein
oligonucleotides SfPBXPSsense/SfPBXPScomp) pLOI4154 PacI digested
pLOI4146, self ligation Disclosed herein pLOI4161 bla cat; cat-sacB
cassette Disclosed herein pLOI4162 bla cat; ligation of cat-sacB
cassette (PacI digested) from Disclosed pLOI4146 and PacI digested
pLOI4161 herein pCR2.1- bla kan; TOPO TA cloning vector Invitrogen
TOPO pLOI4158 bla kan; ackA (PCR) from E. coli C (using
JMackA-F1/R1 primers) Disclosed cloned into pCR2.1-TOPO vector
herein pLOI4159 SmaI/SfoI digested cat-sacB cassette from pLOI4162
cloned into the Disclosed PCR amplified inside-out product from
pLOI4158 (using herein JMackAup1/down1) pLOI4160 PacI digestion of
pLOI4159, then self-ligated Disclosed herein pLOI4515 bla kan;
tdcG'-tdcFED-tdcC' (PCR) from E. coli C (using tdcDE- Disclosed
up/down primers) cloned into pCR2.1-TOPO vector herein pLOI4516
SmaI/SfoI digested cat-sacB cassette from pLOI4162 cloned into the
Disclosed PCR amplified inside-out product from pLOI4515 (using
tdcDE- herein F7/R7 primers) pLOI4517 PCR fragment amplified
inside-out product from pLOI415 (using Disclosed tdcDE-F7/R7
primers), kinase treated, then self-ligated herein pLOI4629 bla
kan; citF (PCR) from E. coli C (using citF-up2/down2 primers)
Disclosed cloned into pCR2.1-TOPO vector herein pLOI4630 SmaI/SfoI
digested cat-sacB cassette from pLOI4162 cloned into the Disclosed
PCR amplified inside-out product from pLOI4629 (using citF-2/3
herein primers) pLOI4631 PacI digestion of pLOI4630, then
self-ligated Disclosed herein pLOI4280 bla kan; aspC (PCR) from E.
coli C (using aspC-up/down primers) Disclosed cloned into
pCR2.1-TOPO vector herein pLOI4281 SmaI/SfoI digested cat-sacB
cassette from pLOI4162 cloned into the Disclosed PCR amplified
inside-out product from pLOI4280 (using aspC-1/2 herein primers)
pLOI4282 PCR fragment amplified inside-out product from pLOI4280
(using Disclosed aspC-1/2 primers), kinase treated, then
self-ligated herein pLOI4283 bla kan; sfcA (PCR) from E. coli C
(using sfcA-up/down primers) Disclosed cloned into pCR2.1-TOPO
vector herein pLOI4284 SmaI/SfoI digested cat-sacB cassette from
pLOI4162 cloned into the Disclosed PCR amplified inside-out product
from pLOI4283 (using sfcA-1/2 herein primers) pLOI4285 PacI
digestion of pLOI4284, then self-ligated Disclosed herein pLOI4710
bla kan; ackA-pta (PCR) from E. coli C (using ackA-up/pta-down
Disclosed primers) cloned into pCR2.1-TOPO vector herein pLOI4711
SmaI/SfoI digested cat-sacB cassette from pLOI4162 cloned into the
Disclosed PCR amplified inside-out product from pLOI4710 (using
ackA-2/pta- herein 2 primers) pLOI4712 PacI digestion of pLOI4711,
then self-ligated Disclosed herein pLOI4413 bla kan;
ychE'-adhE-ychG' (PCR) from E. coli C (using up/down- Disclosed
adhE primers) cloned into pCR2.1-TOPO vector herein pLOI4419 PCR
fragment amplified inside-out product from pLOI4413 (IO- Disclosed
adhE-up/down using primers), kinase treated, then self-ligated
herein pLOI4415 bla kan; ycaO'-focA-pflB-pflA' (PCR) from E. coli C
(using up- Disclosed focA/Mid-pflA primers) cloned into pCR2.1-TOPO
vector herein pLOI4421 PCR fragment amplified inside-out product
from pLOI4415 (using Disclosed IO-ycaO-up/IO-midpflB-down primers),
kinase treated, then self- herein ligated pLOI4430 bla kan;
hslJ'-ldhA-ydbH' (PCR) from E. coli C (using ldhA-A/C Disclosed
primers) cloned into pCR2.1-TOPO vector herein pLOI4432 PCR
fragment amplified inside-out product from pLOI4424 (using
Disclosed IO-ldhA-up/down primers), kinase treated, then
self-ligated herein Primer sets JM4161
5'ACCGCATCAGGCGCCTAATTAATTAATCCCGG3' (SEQ ID Disclosed sense/ NO:
30) herein comp 5'CCGGGATTAATTAATTAGGCGCCTGATGCGGT3' (SEQ ID NO:
31) JMpEL04F1/ 5'CAGCAGATCTAAGTAAATCGCGCGGGTTTG3' (SEQ ID Disclosed
R1 NO: 32) herein 5'CAGCAGATCTAGCGGCTATTTAACGACCCT3' (SEQ ID NO:
33) JMackA- 5'GCCTGAAGGCCTAAGTAGTA3' (SEQ ID NO: 34) Disclosed
F1/R1 5'GCACGATAGTCGTAGTCTGA3' (SEQ ID NO: 35) herein JmackA
5'GTTGAGCGCTTCGCTGTGAG3' (SEQ ID NO: 36) Disclosed up1/down1
5'GCCGCAATGGTTCGTGAACT3' (SEQ ID NO: 37) herein JmcatsacB
5'CTCACCTCGAGTGTGACGGAAGATCACTTCG3' (SEQ ID Disclosed up3/down3 NO:
38) herein 5'GTGCAGGATCCATCAAAGGGAAAACTGTCCATAT3' (SEQ ID NO: 39)
SfPBXPS 5'ATGTAGGCGCCATTAATTAATGGATCCACTATCTCGAGA Disclosed
sense/comp TTAATTAATCCCGGGACTAT3' (SEQ ID NO: 40) herein
5'ATAGTCCCGGGATTAATTAATCTCGAGATAGTGGATCCA TTAATTAATGGCGCCTACAT3'
(SEQ ID NO: 41) WMadhE 5'ATGGCTGTTACTAATGTCGCTGAACTTAACGCACTCGTA
Disclosed A/C GAGCGTCGGCACGTAAGAGGTTCCAA3' (SEQ ID NO: 42) herein
5'TTAAGCGGATTTTTTCGCTTTTTTCTCAGCTTTAGCCGGA
GCAGCACACTGCTTCCGGTAGTCAA3' (SEQ ID NO: 43) WMldhA
5'ATGAAACTCGCCGTTTATAGCACAAAACAGTACGACAA Disclosed A/C
GAAGTACGGCACGTAAGAGGTTCCAA3' (SEQ ID NO: 44) herein
5'TTAAACCAGTTCGTTCGGGCAGGTTTCGCCTTTTTCCAG
ATTGCTACACTGCTTCCGGTAGTCAA3' (SEQ ID NO: 45) WMpflB
5'TTACTCCGTATTTGCATAAAAACCATGCGAGTTACGGGC Disclosed A/C
CTATAACGGCACGTAAGAGGTTCCAA3' (SEQ ID NO: 46) herein
5'TTACATAGATTGAGTGAAGGTACGAGTAATAACGTCCTG
CTGCTGTTCTACACTGCTTCCGGTAGTCAA3' (SEQ ID NO: 47) tdcDE-
5'CGCCGACAGAGTAATAGGTT3' (SEQ ID NO: 48) Disclosed
up/down 5'TGATGAGCTACCTGGTATGG3' (SEQ ID NO: 49) herein tdcDE-
5'CGATGCGGTGGCCAATTAAG3' (SEQ ID NO: 50) Disclosed F7/R7
5'GACGACGTGCTGGATTACGA3' (SEQ ID NO: 51) herein citF-
5'GGGTATTCAGGCGTTCGATA3' (SEQ ID NO: 52) Disclosed up2/down2
5'GCCCGAGAGGATGACTATGT3' (SEQ ID NO: 53) herein citF-2/3
5'GGTGATCGATGTTGTGCATC3' (SEQ ID NO: 54) Disclosed
5'CCCGTTCTTGTCGTTGAGAT3' (SEQ ID NO: 55) herein IO-adhE-
5'GCTGCTCCGGCTAAAGCTGA3' (SEQ ID NO: 56) Disclosed up/down
5'ACGCTCTACGAGTGCGTTAA3' (SEQ ID NO: 57) herein up-
5'AGATCGCCAGCCGCTGCAAT3'(SEQ ID NO: 58) Disclosed focA/Mid-
5'AACCGTTGGTGTCCAGACAG3' (SEQ ID NO: 59) herein pflB IO-ycaO-
5'GCCTACATTGCGTAGGCTAT3' (SEQ ID NO: 60) Disclosed up/IO-
5'GCAGCAGGACGTTATTACTC3' (SEQ ID NO: 61) herein midpflB- down
ldhA-A/C 5'ATGAAACTCGCCGTTTATAG3' (SEQ ID NO: 62) Disclosed
5'TTAAACCAGTTCGTTGCCC3' (SEQ ID NO: 63) herein IO-ldhA-
5'CGTTCGATCCGTATCCAAGT3' (SEQ ID NO: 64) Disclosed up/dovvn
5'AGGCTGGAACTCGGACTACT3' (SEQ ID NO: 65) herein aspC-
5'TCCATCGCTTACACCAAATC3' (SEQ ID NO: 66) Disclosed up/down
5'TGGGGGATGACGTGATATTT3' (SEQ ID NO: 67) herein aspC-1/2
5'AGATAACATGGCTCCGCTGT3' (SEQ ID NO: 68) Disclosed
5'AGGAGCGGCGGTAATGTTC3' (SEQ ID NO: 69) herein sfcA-
5'CTATGCTTGATCGGCAACCT3' (SEQ ID NO: 70) Disclosed up/down
5'ACGATCGCCTGGTTTTAATG3' (SEQ ID NO: 71) herein sfcA-1/2
5'TACCGCCGTACCTCCATCTA3' (SEQ ID NO: 72) Disclosed
5'CGTAAGGGATATAAAGCGAACG3' (SEQ ID NO: 73) herein ackA-
5'CGGGACAACGTTCAAAACAT3' (SEQ ID NO: 74) Disclosed up/pta-
5'ATTGCCCATCTTCTTGTTGG3' (SEQ ID NO: 75) herein down ackA-2/
5'AACTACCGCAGTTCAGAACCA3' (SEQ ID NO: 76) Disclosed pta-2
5'TCTGAACACCGGTAACACCA3' (SEQ ID NO: 77) herein
TABLE-US-00008 TABLE 8 Fermentation of glucose in mineral salts AM1
medium by mutant strains of E. coli Media, Cell Av. Vol. Glucose
Yield.sup.a Succinate Yield Prod.sup.c Strain Culture Conditions
(w/v) (g/L) mol/mol g/g (g/L/h) KJ073 1 mM betaine, 3M 10%, AM1 2.3
.+-. 0.1 1.20 .+-. 0.09 0.77 .+-. 0.03 0.82 .+-. 0.01
K.sub.2CO.sub.3 + 6N KOH (1:1) 0.01 OD.sub.550 inoculum KJ091 1 mM
betaine, 3M 10%, AM1 2.2 .+-. 0.1 1.19 .+-. 0.02 0.78 .+-. 0.01
0.84 .+-. 0.01 K.sub.2CO.sub.3 + 6N KOH (1:1) 0.01 OD.sub.550
inoculum KJ098 1 mM betaine, 3M 10%, AM1 2.3 .+-. 0.1 1.30 .+-.
0.04 0.85 .+-. 0.02 0.79 .+-. 0.01 K.sub.2CO.sub.3 + 6N KOH (1:1)
0.01 OD.sub.550 inoculum KJ104 1 mM betaine, 3M 10%, AM1 1.8 .+-.
0.1 1.31 .+-. 0.01 0.86 .+-. 0.01 0.78 .+-. 0.03 K.sub.2CO.sub.3 +
6N KOH (4:1) 0.01 OD.sub.550 inoculum KJ104 1 mM betaine, 3M 10%,
AM1 1.9 .+-. 0.1 1.30 .+-. 0.01 0.85 .+-. 0.01 0.77 .+-. 0.01
K.sub.2CO.sub.3 + 6N KOH (6:1) 0.01 OD.sub.550 inoculum KJ110 1 mM
betaine, 3M 10%, AM1 2.0 .+-. 0.1 1.28 .+-. 0.02 0.84 .+-. 0.01
0.79 .+-. 0.01 K.sub.2CO.sub.3 + 6N KOH (4:1) 0.01 OD.sub.550
inoculum KJ119 1 mM betaine, 3M 10%, AM1 2.0 .+-. 0.1 1.33 .+-.
0.07 0.87 .+-. 0.01 0.82 .+-. 0.01 K.sub.2CO.sub.3 + 6N KOH (4:1)
0.01 OD.sub.550 inoculum KJ122 1 mM betaine, 3M 10%, AM1 2.3 .+-.
0.1 1.50 .+-. 0.02 0.98 .+-. 0.01 0.92 .+-. 0.01 K.sub.2CO.sub.3 +
6N KOH (4:1) 0.01 OD.sub.550 inoculum KJ122 1 mM betaine, 3M 10%,
AM1 2.0 .+-. 0.2 1.54 .+-. 0.02 1.01 .+-. 0.01 0.97 .+-. 0.04
K.sub.2CO.sub.3 + 6N KOH (6:1) 0.01 OD.sub.550 inoculum KJ122 1 mM
betaine, 3M 10%, AM1 2.1 .+-. 0.1 1.57 .+-. 0.09 1.03 .+-. 0.06
0.93 .+-. 0.06 K.sub.2CO.sub.3 + 6N KOH (6:1) 0.15 OD.sub.550
inoculum KJ134 1 mM betaine, 3M 10%, AM1 2.3 .+-. 0.1 1.70.sup.g
.+-. 0.03.sup. 1.11 .+-. 0.02 0.83 .+-. 0.02 K.sub.2CO.sub.3 + 6N
KOH (6:1) 0.01 OD.sub.550 inoculum Fermentation Products
(mM).sup.d,e,f Strain Culture Conditions Suc Mal Pyr Ace Lac For
KJ073 1 mM betaine, 3M 668 .+-. 8 118 .+-. 13 55 .+-. 22 183 .+-.
27 -- -- K.sub.2CO.sub.3 + 6N KOH (1:1) 0.01 OD.sub.550 inoculum
KJ091 1 mM betaine, 3M 687 .+-. 3 109 .+-. 3 72 .+-. 5 155 .+-. 6
-- -- K.sub.2CO.sub.3 + 6N KOH (1:1) 0.01 OD.sub.550 inoculum KJ098
1 mM betaine, 3M 644 .+-. 9 -- 42 .+-. 8 88 .+-. 1 -- --
K.sub.2CO.sub.3 + 6N KOH (1:1) 0.01 OD.sub.550 inoculum KJ104 1 mM
betaine, 3M 634 .+-. 25 5 .+-. 1 78 .+-. 5 90 .+-. 10 -- --
K.sub.2CO.sub.3 + 6N KOH (4:1) 0.01 OD.sub.550 inoculum KJ104 1 mM
betaine, 3M 625 .+-. 4 3 .+-. 2 94 .+-. 5 81 .+-. 2 -- --
K.sub.2CO.sub.3 + 6N KOH (6:1) 0.01 OD.sub.550 inoculum KJ110 1 mM
betaine, 3M 640 .+-. 10 4 .+-. 1 76 .+-. 6 106 .+-. 11 -- --
K.sub.2CO.sub.3 + 6N KOH (4:1) 0.01 OD.sub.550 inoculum KJ119 1 mM
betaine, 3M 672 .+-. 10 4 .+-. 0 64 .+-. 18 95 .+-. 14 -- --
K.sub.2CO.sub.3 + 6N KOH (4:1) 0.01 OD.sub.550 inoculum KJ122 1 mM
betaine, 3M 750 .+-. 1 0 .+-. 0 122 .+-. 21 94 .+-. 13 -- --
K.sub.2CO.sub.3 + 6N KOH (4:1) 0.01 OD.sub.550 inoculum KJ122 1 mM
betaine, 3M 787 .+-. 35 6 .+-. 3 59 .+-. 6 110 .+-. 7 -- --
K.sub.2CO.sub.3 + 6N KOH (6:1) 0.01 OD.sub.550 inoculum KJ122 1 mM
betaine, 3M 756 .+-. 49 0 .+-. 0 124 .+-. 13 122 .+-. 9 -- --
K.sub.2CO.sub.3 + 6N KOH (6:1) 0.15 OD.sub.550 inoculum KJ134 1 mM
betaine, 3M 674 .+-. 15 13 .+-. 2 22 .+-. 9 37 .+-. 5 --
K.sub.2CO.sub.3 + 6N KOH (6:1) 0.01 OD.sub.550 inoculum .sup.aCell
yield estimated from optical density (3 OD.sub.550 nm = 1 g
l.sup.-1 CDW). .sup.bSuccinate yields were calculated based on
glucose metabolized. .sup.cAverage volumetric productivity was
calculated for total incubation time. .sup.dAbbreviations: suc,
succinate; mal, malate; pyr, pyruvate; ace, acetate; lac, lacate;
for, formate. .sup.eEthanol (153 .+-. 39 mM) was present only in
broth from E. coli C. .sup.fAll data represent an average of 3 or
more fermentations with standard deviations. .sup.gAdditional
products were also found despite near theoretical yields of
succinate. Based on total products, coproducts represented 11%.
TABLE-US-00009 TABLE 9 Sources and characteristics of E. coli
strains and plasmids used in this study Source or Relevant
characteristics reference Strains ATCC 8739 Wild type Lab
collection KJ012 .DELTA.ackA, .DELTA. ldhA, .DELTA. adhE Jantama et
al. 2008 KJ017 .DELTA.ackA, .DELTA. ldhA, .DELTA.adhE Jantama et
al. 2008 KJ060 .DELTA.ackA, .DELTA. ldhA, .DELTA.adhE, .DELTA.pflB
Jantama et al. 2008 KJ071 .DELTA.ackA, .DELTA.ldhA, .DELTA.adhE,
.DELTA. pflB, .DELTA.mgsA Jantama et al. 2008 KJ073 .DELTA.ackA,
.DELTA.ldhA, .DELTA. adhE, .DELTA.pflB, .DELTA. mgsA, .DELTA.poxB
Jantama et al. 2008 XZ320 KJ073, .DELTA.ppc This study XZ332 KJ073,
.DELTA.pck This study XZ341 KJ073, .DELTA.sfcA This study XZ396
KJ073, .DELTA.maeB This study XZ613 KJ017, .DELTA.ptsI This study
XZ615 KJ060, .DELTA.ptsI This study XZ616 KJ060, restored ptsI to
wild type This study XZ618 KJ017, pck* This study XZ620 KJ071, pck*
This study XZ622 KJ060, restored pck to wild type This study XZ624
KJ073, restored pck to wild type This study XZ626 KJ017, .DELTA.cra
This study XZ627 KJ060, .DELTA.cra This study XZ642 KJ012,
.DELTA.crp This study XZ643 KJ017, .DELTA.crp This study Plasmids
pLOI4677 bla kan; pck (including ribosomal binding site, This study
coding and terminator fragment) from E. coli ATCC8739 cloned into
pCR2.1-TOPO vector ptsI mutation change pLOI4734 bla kan; ptsI
(ptsI-D-up/D-down) from E. coli This study ATCC8739 cloned into
pCR2.1-TOPO vector pLOI4735 cat-sacB cassette (SmaI-SfoI fragment
of This study pLOI4162) cloned into ptsI of pLOI4734 pck mutation
change pLOI4736 bla kan; pck-P (pck-Pro-up/Pro-down) from E. coli
This study ATCC873 cloned into pCR2.1-TOPO vector pLOI4737 cat-sacB
cassette (SmaI-SfoI fragment of This study pLOI4162) cloned into
pck-P of pLOI4736 (pck- Pro-1/Pro-2) Primers pck mutation change
pck-Pro-up CACGGTAGCAACAACATTGC (SEQ ID NO: This study 78)
pck-Pro-down AGAAAGCGTCGACAACGAAC (SEQ ID NO: 79) pck-Pro-1
ATGCGCGTTAACAATGGTTT (SEQ ID NO: 80) pck-Pro-2 ATGGATAACGTTGAACTTTC
(SEQ ID NO: 81) ptsI mutation change ptsI-D-up CGCATTATGTTCCCGATGAT
(SEQ ID NO: This study 82) ptsI-D-down GCCTTTCAGTTCAACGGTGT (SEQ ID
NO: 83) ptsI-D-1 CGGCCCAATTTACTGCTTAG (SEQ ID NO: 84) ptsI-D-2
ATCCCCAGCAACAGAAGTGT (SEQ ID NO: 85) pck sequencing pck-F
TTGGCTAAGGAGCAGTGAAATGCGCGTTA This study (SEQ ID NO: 86) pck-R
CACGACAAAAGAAGGGTAAATAAAC (SEQ ID NO: 87) pck-2
TTGTTAACGCGCATTTCACT (SEQ ID NO: 88) pck-3 GCGATAGCGGCTACTGTCAT
(SEQ ID NO: 89) pck* represents mutated form of pck containing, a G
to A transition at -64 (ATG). All strains are of derivatives of E.
coli ATCC8739.
TABLE-US-00010 TABLE 10 Pck is critical for glucose fermentation to
succinate by derivatives of KJ073 Genetic Glucose Succinate
Yield.dagger. Acetate Pyruvate Strain* modification consumed (mM)
(mol/mol) (mM) (mM) KJ073 none 301 364 1.21 113 3 XZ320 KJ073,
.DELTA.ppc 278 348 1.25 100 -- XZ341 KJ073, .DELTA.sfcA 278 339
1.22 106 -- XZ396 KJ073, .DELTA.maeB 278 337 1.22 116 0 XZ332
KJ073, .DELTA.pck 92 42 0.46 28 32 XZ332 .DELTA.pck, pck 273 260
0.95 78 32 (pLOI4677) over-expression *All fermentations were
performed in NBS medium with 5% glucose and 100 mM potassium
bicarbonate. .dagger.Yield was calculated as mol succinate produced
per mol glucose metabolized.
TABLE-US-00011 TABLE 11 Comparison of carboxylation enzymes in
engineered E. coli strains Cell Succinate Enzyme activity* [nmol
yield productivity min.sup.-1 (mg protein) .sup.-1] pck G to A
Strain (g/L) (g/L/h) Pck Ppc SfcA MaeB mRNA change E. coli ATCC 2.0
0.12 295 20 ND <1 1.0 No KJ012.dagger-dbl. 0.3 0.04 162 25 5
<1 0.2 No KJ017 1.7 0.35 700 17 12 <1 2.7 No KJ060 2.2 0.90
8,363 30 11 <1 7.2 Yes KJ071 1.5 0.33 679 23 10 <1 2.5 No
KJ073 2.3 0.82 7,341 27 12 <1 8.4 Yes E. coli K12.dagger. ND ND
140 140 ND ND ND ND Actinobacillus ND ND 4700 10 ND ND ND ND
Succinogenes.dagger. *Pck, PEP carboxykinase; Ppc, PEP carboxylase;
SfcA, NADH-linked malic enzyme; MaeB, NADPH-linked malic enzyme;
ND, not determined. .dagger.Data from Vanderwerf et al., Arch
Microbiol 167: 332-342 .dagger-dbl.Poor growth
TABLE-US-00012 TABLE 12 Effects of mutations in pck, ptsI, and cra
on PEP carboxykinase activity. PEP-carboxykinase Strain Genotype
(U/mg protein) KJ017.dagger. pck.sup.+, ptsI.sup.+, cra.sup.+ 700
XZ618 KJ017, pck* 6,419 XZ613 KJ017, )ptsI 614 XZ626 KJ017, )cra
508 KJ060.dagger-dbl..sup..sctn. pck*, ptsI.gradient., - cra.sup.+
8,363 XZ622.dagger-dbl. KJ060, - pck.sup.+ 1,103 XZ615 KJ060, )ptsI
10,309 XZ627 KJ060, )cra 7181 KJ071.dagger..sup..sctn.
ptsI.gradient., - pck.sup.+, cra.sup.+ 679 XZ620 KJ071, pck* 6,193
KJ073.dagger-dbl..sup..sctn. pck*, ptsI.gradient., - cra.sup.+
7,341 XZ624.dagger-dbl. KJ073, - pck.sup.+ 904 .dagger.The pck in
KJ017 and KJ071 was mutated (G to A) to pck* in XZ618 and XZ620,
respectively. .dagger-dbl.The pck* mutation in KJ060 and KJ073 was
restored to wild type (A to G, - pck.sup.+) in XZ622 and XZ624.
.sup..sctn.The abbreviation ptsI.gradient. refers to a frame-shift
mutation, a single base deletion in the carboxy-terminal
region.
TABLE-US-00013 TABLE 13 Effect of glucose and cAMP on PEP
carboxykinase (pck) and .beta.-galactosidase (lacZ) activities* PEP
carboxykinase activity.dagger. .beta.-galactosidase activity
(.times.10.sup.3).dagger. 5% no Glu + 5% no Strain Glu Glu
ratio.dagger-dbl. cAMP Glu Glu ratio.dagger-dbl. 8739 141 476 3.4
553 5.0 15.0 3.0 KJ012 146 462 3.2 737 7.9 19.0 2.4 KJ017 587 624
1.1 997 14.2 19.0 1.3 KJ060 5574 2777 0.5 4253 18.4 20.0 1.1 XZ642
118 113 1.0 112 -- -- -- XZ643 116 124 1.0 118 -- -- -- *Cultures
were grown aerobically in shaken flasks with Luria broth.
.dagger.Activity is the average of two repeats and is expressed as
U (mg protein).sup.-1. .dagger-dbl.Ratio is the activity without
glucose to the activity with 5% glucose.
TABLE-US-00014 TABLE 14 Plasmids and primers used in Example 3
Plasmids pCR2.1-TOPO bla kan; TOPO TA cloning vector pLOI4162 bla
cat; plasmid to provide cat-sacB cassette sfcA deletion pLOI4283
bla kan; sfcA (PCR) from ATCC 8739 cloned into pCR2.1-TOPO vector
pLOI4284 cat-sacB cassette (SmaI-SfoI fragment of pLOI4162) cloned
into sfcA of pLOI4284 pLOI4285 PacI digestion of pLOI4284, and
self-ligated ppc deletion pLOI4264 bla kan; ppc (PCR) from ATCC
8739 cloned into pCR2.1-TOPO vector pLOI4265 cat-sacB cassette
(SmaI-SfoI fragment of pLOI4162) cloned into ppc of pLOI4264
pLOI4266 PacI digestion of pLOI4265, and self-ligated pck deletion
pLOI4641 bla kan; pck (PCR) from ATCC 8739 cloned into pCR2.1-TOPO
vector pLOI4642 cat-sacB cassette (SmaI-SfoI fragment of pLOI4162)
cloned into ppc of pLOI4641 pLOI4643 PacI digestion of pLOI4642,
and self-ligated maeB deletion pLOI4728 bla kan; maeB (PCR) from
ATCC 8739 cloned into pCR2.1-TOPO vector pLOI4729 cat-sacB cassette
(SmaI-SfoI fragment of pLOI4162) cloned into maeB of pLOI4728
pLOI4730 PacI digestion of pLOI4729, and self-ligated ptsI mutation
change pLOI4734 bla kan; ptsI (ptsI-D-up/D-down) from ATCC 8739
cloned into PCR2.1-TOPO vector pLOI4735 cat-sacB cassette
(SmaI-SfoI fragment of pLOI4162) cloned into ptsI of pLOI4734 pck
mutation change pLOI4736 bla kan; pck-P (pck-Pro-up/Pro-down) from
ATCC 8739 cloned into PCR2.1-TOPO vector pLOI4737 cat-sacB cassette
(SmaI-SfoI fragment of pLOI4162) cloned into pck-P of pLOI4736
(pck-Pro-1/Pro-2) Primers for gene deletions sfcA deletion sfcA-up
CTATGCTTGATCGGCAACCT (SEQ ID NO: 90) sfcA-down ACGATCGCCTGGTTTTAATG
(SEQ ID NO: 91) sfcA-1 TACCGCCGTACCTCCATCTA (SEQ ID NO: 92) sfcA-2
CGTAAGGGATATAAAGCGAACG (SEQ ID NO: 93) ppc deletion ppc-up
TCAAACGATGCCCAACTGTA (SEQ ID NO: 94) ppc-down TTTAATCCGCTTCGGAAAGA
(SEQ ID NO: 95) ppc-1 GTCACTATTGCCGGGATTGC (SEQ ID NO: 96) ppc-2
CAATGCGGAATATTGTTCGT (SEQ ID NO: 97) ck deletion pck-up
TCCGGGCAGTAGTATTTTGC (SEQ ID NO: 98) pck-down ATGGCTGGATCAAAGTCAGC
(SEQ ID NO: 99) pck-1 CCTGGCGAAACTGTTTATCG (SEQ ID NO: 100) pck-2
TTGTTAACGCGCATTTCACT (SEQ ID NO: 101) maeB deletion maeB-up
GCATCCTGGGGATGATAATG (SEQ ID NO: 102) maeB-down
TTTCTTCGCCAGTTCCTCAC (SEQ ID NO: 103) maeB-1 AACCCAACCGCTGTAATTTTT
(SEQ ID NO: 104) maeB-2 CTGGAACTGGAAATTCATGG (SEQ ID NO: 105) pck
mutation change pck-Pro-up CACGGTAGCAACAACATTGC (SEQ ID NO: 106)
pck-Pro-down AGAAAGCGTCGACAACGAAC (SEQ ID NO: 107) pck-Pro-1
ATGCGCGTTAACAATGGTTT (SEQ ID NO: 108) pck-Pro-2
ATGGATAACGTTGAACTTTC (SEQ ID NO: 109) ptsI mutation change
ptsI-D-up CGCATTATGTTCCCGATGAT (SEQ ID NO: 110) ptsI-D-down
GCCTTTCAGTTCAACGGTGT (SEQ ID NO: 111) ptsI-D-1 CGGCCCAATTTACTGCTTAG
(SEQ ID NO: 112) ptsI-D-2 ATCCCCAGCAACAGAAGTGT (SEQ ID NO: 113)
Primers for sequencing* pck-F TTGGCTAAGGAGCAGTGAAATGCGCGTTA (SEQ ID
NO: 114) pck-R CACGACAAAAGAAGGGTAAATAAAC (SEQ ID NO: 115) pck-2
TTGTTAACGCGCATTTCACT (SEQ ID NO: 116) pck-3 GCGATAGCGGCTACTGTCAT
(SEQ ID NO: 117) cra-up GCGGTAAGCTTGATGCATTT (SEQ ID NO: 118)
cra-down CTTCCCCGGTTAACAGTCCT (SEQ ID NO: 119) ptsHI-up1
TCATCGGGTGAGCGTTATTT (SEQ ID NO: 120) ptsHI-down1
TGACCGTCCAGCGTAATAGC (SEQ ID NO: 121) ptsHI-up2
CATCCTGGGCCTGAAGATTA (SEQ ID NO: 122) ptsHI-down2
AGCAATACCATCACCAACGA (SEQ ID NO: 123) crr-up CCCGCGCATTAAGAAGATTA
(SEQ ID NO: 124) crr-down CTCATCAGTGGCTTGCTGAA (SEQ ID NO: 125)
ptsG-up GAAGAACTGGCGCAGGTAAC (SEQ ID NO: 126) ptsG-down
AAGGAAACGCCGTTAATCCT (SEQ ID NO: 127) cyaA-up TCGCCATCAACTTGTCTTTG
(SEQ ID NO: 128) cyaA-down AAAGGCGATGAGTGGATTTG (SEQ ID NO: 129)
crp-S-up TGAGTTGCCGTCCATTAAAA (SEQ ID NO: 130) crp-S-down
AATCGTAATTCGCCAAGCAT (SEQ ID NO: 131) cpdA-S-up
GAAGTGTGTTCAAGCCAGCA (SEQ ID NO: 132) cpdA-S-down
AGGACAATGGATTCCAGCAG (SEQ ID NO: 133) ygiF-S-up
ATCAGTGTCGCTACGCAAAG (SEQ ID NO: 134) ygiF-S-down
GCTGTCCTGCACAAAATCAC (SEQ ID NO: 135) sxy-S-up TTTACTTGCTGCGGATGAGA
(SEQ ID NO: 136) sxy-S-down TATCTCAGCCCTCGGTGCTC (SEQ ID NO: 137)
csrA-up CAGCGTTAGCCAGTGTGAAA (SEQ ID NO: 138) csrA-down
ACGCCTCTTACGAGTGCTTC (SEQ ID NO: 139) csrB-S-up
CTGTAGGAGATCGCCAGGAA (SEQ ID NO: 140) csrB-S-down
TCTAACAAATCGTGCATTCG (SEQ ID NO: 141) csrC-S-up
GCCATACGCTTTGTGAGACA (SEQ ID NO: 142) csrC-S-down
AGTCACGCCCAATGGAATAG (SEQ ID NO: 143) csrD-S-up1
ATGTGCATGATGGATTGGAA (SEQ ID NO: 144) csrD-S-down1
CGGTATCCTGACCACTACGC (SEQ ID NO: 145) csrD-S-up2
GTGATTTTGCTGCGCTGTTA (SEQ ID NO: 146) csrD-S-down2
ACAAGGCGCAAAAATCATCT (SEQ ID NO: 147) uvrY-s-up1
CCTCGTCATGTTGCAATGAA (SEQ ID NO: 148) uvrY-s-down1
TATCATCGCGTAGCAAAACG (SEQ ID NO: 149) barA-s-up1
TTTTGCTTCGCTGCTGTAAA (SEQ ID NO: 150) barA-s-down1
TCAGGCACGTCGCTTTTAAT (SEQ ID NO: 151) barA-s-up2
CGCGATCACCTGAATACGAT (SEQ ID NO: 152) barA-s-down2
CTGGCTGGACGTTCGATAAC (SEQ ID NO: 153) barA-s-up3
TGGCCTATGTCGAACCAAAC (SEQ ID NO: 154) mlc-s-up1
CTGGCAAATAACCCGAATGT (SEQ ID NO: 155) mlc-s-down1
CCAGGGCATCTTTATTACGC (SEQ ID NO: 156) mlc-s-up2
TGAAACTGAAGCCTGGCACT (SEQ ID NO: 157) *The primers for sequencing
were used to amplify the upstream, coding and terminator fragment
of all genes.
TABLE-US-00015 TABLE 15 Sources and characteristics of E. coli
strains, plasmids and primers used in this study Relevant
characteristics Source or reference Strains ATCC 8739 Wild type Lab
collection KJ012 .DELTA.ldhA, .DELTA.adhE, .DELTA.ackA Jantama et
al., 2008a XZ02 .DELTA.ldhA This study XZ04 .DELTA.ldhA,
.DELTA.pflB This study XZ14 .DELTA.ldhA, .DELTA.adhE This study
XZ15 .DELTA.adhE This study XZ17 .DELTA.pflB This study XZ464 pck*,
.DELTA.gldA This study XZ465 pck*, .DELTA.dhaKL This study XZ466
pck*, .DELTA.dhaM This study XZ468 pck*, .DELTA.ptsH This study
XZ469 pck*, .DELTA.ptsI-W This study XZ470 pck*, .DELTA.ptsG This
study XZ629 .DELTA.ldhA, .DELTA.adhE, .DELTA.ackA, pck* This study
XZ632 pck* This study XZ635 .DELTA.ldhA, pck* This study XZ638
.DELTA.ldhA, .DELTA.adhE, pck* This study XZ639 .DELTA.adhE, pck*
This study XZ640 .DELTA.pflB, pck* This study XZ641 .DELTA.ldhA,
.DELTA.pflB, pck* This study XZ647 pck*, .DELTA.ptsI This study
XZ650 .DELTA.ptsI This study XZ721 pck*, .DELTA.ptsI, .DELTA.pflB
This study XZ723 pck*, .DELTA.ptsI, .DELTA.adhE This study Plasmids
pLOI4162 bla, cat sacB cassette Jantama et al., 2008b ldhA deletion
pLOI4652 bla kan; ldhA (PCR) from E. coli cloned into pCR2.1- This
study TOPO vector pLOI4653 cat-sacB cassette cloned into ldhA of
pLOI4652 This study pLOI4655 PacI digestion of pLOI4653, and
self-ligated This study pflB deletion pLOI4667 bla kan; pflB (PCR)
from E. coli cloned into pCR2.1- This study TOPO vector pLOI4668
cat-sacB cassette cloned into pflB of pLOI4667 This study pLOI4669
PacI digestion of pLOI4668, and self-ligated This study adhE
deletion pLOI4707 bla kan; adhE (PCR) from E. coli cloned into
pCR2.1- This study TOPO vector pLOI4708 cat-sacB cassette cloned
into adhE of pLOI4707 This study pLOI4709 PacI digestion of
pLOI4707, and self-ligated This study pck promoter change pLOI4736
bla kan; pck-P from E. coli cloned into pCR2.1-TOPO This study
vector pLOI4737 cat-sacB cassette cloned into pck-P of pLOI4736
This study pLOI4752 trc promoter cloned into pck-P of pLOI4736 This
study ptsI deletion pLOI4734 bla kan; ptsI from E. coli cloned into
pCR2.1-TOPO This study vector pLOI4735 cat-sacB cassette cloned
into ptsI of pLOI4734 This study pLOI4735B PacI digestion of
pLOI4735, and self-ligated This study ptsG deletion pLOI4683 bla
kan; ptsG from E. coli cloned into PCR2.1-TOPO This study vector
pLOI4684 cat-sacB cassette (SmaI-SfoI fragment of pLOI4162) This
study cloned into ptsG of pLOI4683 pLOI4685 PacI digestion of
pLOI4684, and self-ligated This study gldA deletion pLOI4296 bla
kan; gldA from E. coli cloned into PCR2.1-TOPO This work vector
pLOI4297 cat-sacB cassette from pLOI4151 cloned into gldA of This
work pLOI4296 pLOI4298 PCR fragment amplified from pLOI4296 (using
gldA-1/ This work gldA-2), kinase treated, and then self-ligated
Primers IdhA deletion XZ-ldhA-up GATAACGGAGATCGGGAATG (SEQ ID NO:
158) This study XZ-ldhA-down CTTTGGCTGTCAGTTCACCA (SEQ ID NO: 159)
XZ-ldhA-1 TCTGGAAAAAGGCGAAACCT (SEQ ID NO: 160) XZ-ldhA-2
TTTGTGCTATAAACGGCGAGT (SEQ ID NO: 161) pflB deletion PflB-up2
TGTCCGAGCTTAATGAAAAGTT(SEQ ID NO: 162) This study PflB-down2
CGAGTAATAACGTCCTGCTGCT (SEQ ID NO: 163) PflB-5 AAACGGGTAACACCCCAGAC
(SEQ ID NO: 164) PflB-6 CGGAGTGTAAACGTCGAACA (SEQ ID NO: 165) adhE
deletion adhE-up CATGCTAATGTAGCCACCAAA (SEQ ID NO: 166) This study
adhE-down TTGCACCACCATCCAGATAA (SEQ ID NO: 167) adhE-1
TCCGGCTAAAGCTGAGAAAA (SEQ ID NO: 168) adhE-2 GTGCGTTAAGTTCAGCGACA
(SEQ ID NO: 169) pck mutation change pck-Pro-up
CACGGTAGCAACAACATTGC (SEQ ID NO: 170) This study pck-Pro-down
AGAAAGCGTCGACAACGAAC (SEQ ID NO: 171) pck-Pro-1 ATGCGCGTTA
ACAATGGTTT (SEQ ID NO: 172) pck-Pro-2 ATGGATAACG TTGAACTTTC (SEQ ID
NO: 173) pck-P-2 TTCACTGCTC CTTAGCCAAT (SEQ ID NO: 174) ptsI
deletion ptsID-up CGCATTATGTTCCCGATGAT (SEQ ID NO: 175) This study
ptsI-D-down GCCTTTCAGTTCAACGGTGT (SEQ ID NO: 176) ptsI-D-1
CGGCCCAATTTACTGCTTAG (SEQ ID NO: 177) ptsI-D-2 ATCCCCAGCAACAGAAGTGT
(SEQ ID NO: 178) ptsG deletion ptsG up GAAGAACTGGCGCAGGTAAC (SEQ ID
NO: 179) This study ptsG-down AAGGAAACGCCGTTAATCCT (SEQ ID NO: 180)
ptsG-1 CCTGAAAACCGAGATGGATG (SEQ ID NO: 181) ptsG-2
CATCAGCGATTTACCGACCT (SEQ ID NO: 182) ptsH deletion ptsH-D-up
ATGTTCCAGCAAGAAGTTACCATTACCGCTCCG This study AACGGTCTGCAC
GTGTAGGCTGGAGCTGCTTC (SEQ ID NO: 183) ptsH-D-down
TTACTCGAGTTCCGCCATCAGTTTAACCAGATG TTCAACCGCTTT CATATGAATATCCTCCTTAG
(SEQ ID NO: 184) ptsI-W deletion ptsI-D-up
ATGATTTCAGGCATTTTAGCATCCCCGGGTATCG This study CTTTCGGTAAA
GTGTAGGCTGGAGCTGCTTC (SEQ ID NO: 185) ptsI-D-down
TTAGCAGATTGTTTTTTCTTCAATGAACTTGTTA ACCAGCGTCAT CATATGAATATCCTCCTTAG
(SEQ ID NO: 186) gldA deletion gldA-up TGTATATAGCGCCGCACAAG (SEQ ID
NO: 187) This study gldA-down GATGGCAAGGTTGGTATTGG (SEQ ID NO: 188)
gldA-1 ACCAGTACGGTCAGCGTTTC (SEQ ID NO: 189) gldA-2
ACCCGGTGATTGAATAATGC (SEQ ID NO: 190) dhaKL deletion dhaKL-D-up
ATGAAAAAATTGATCAATGATGTGCAAGACGT This study ACTGGACGAACAA
TGTAGGCTGGAGCTGCTTC (SEQ ID NO: 191) dhaKL-D-down
TTACTCTTTTGCGGCTAACGCCAACATTTGCA TCATAAACATCAC CATATGAATATCCTCCTTAG
(SEQ ID NO: 192) dhaM deletion dhaM-D-up
GTGATGGTAAACCTGGTCATAGTTTCACATA This study
GCAGCCGACTGGGATGTAGGCTGGAGCTGCTTC (SEQ ID NO: 193) dhaM-D-down
TTAACCCTGACGGTTGAAACGTTGCGTTTTA ACGTCCAGCGTTAGATATGAATATCCTCCTTAG
(SEQ ID NO: 194)
TABLE-US-00016 TABLE 16 The effects of inactivating alternative
NADH oxidizing pathways on succinate production from glucose using
NBS mineral salts medium and complex medium (Luria broth) Time
Growth Gluc Genetic Cell yield used Suc Fermentation products
(mmol).sup.2 Strains modification Media (days) (g/L) (mmol)
Yield.sup.1 Suc Ace Mal Pyr Lac For EtOH ATCC Wild type NBS 3 3.0
278 0.16 46 151 -- -- 110 318 133 8739 XZ02 .DELTA.ldhA NBS 3 2.9
278 0.15 (-6%) 43 165 -- -- 11 353 199 XZ15 .DELTA.adhE NBS 3 2.7
278 0.18 (+12%) 50 84 -- -- 352 102 -- XZ17 .DELTA.pflB NBS 3 2.2
278 0.09 (-44%) 26 11 -- -- 460 -- -- XZ14 .DELTA.ldhA, .DELTA.adhE
NBS 6 0.5 57 0.12 (-25%) 6 48 -- -- -- 44 -- XZ04 .DELTA.ldhA,
.DELTA.pflB NBS 6 0.5 39 0.13 (-19%) 5 22 -- -- -- 22 12 KJ012
.DELTA.ldhA, .DELTA.adhE, NBS 6 0.3 46 0.13 (-19%) 6 26 -- -- -- --
-- .DELTA.ackA ATCC Wild type LB 2 2.0 257 0.13 34 138 -- -- 214
161 127 8739 XZ02 .DELTA.ldhA LB 2 1.8 257 0.21 (+61%) 55 224 -- --
17 152 206 XZ15 .DELTA.adhE LB 2 1.9 268 0.11 (-15%) 30 43 -- --
459 -- -- XZ17 .DELTA.pflB LB 2 2.0 261 0.09 (-31%) 24 8 -- -- 469
-- -- XZ14 .DELTA.ldhA, .DELTA.adhE LB 6 0.3 31 0.23 (+77%) 7 45 --
-- -- 17 -- XZ04 .DELTA.ldhA, .DELTA.pflB LB 6 1.2 150 0.33 (+154%)
48 9 -- 86 35 23 89 KJ012 .DELTA.ldhA, .DELTA.adhE, LB 6 1.5 154
0.70 (+438%) 108 61 -- -- -- 14 -- .DELTA.ackA .sup.1Succinate
yield was calculated as moles of succinate produced per mol glucose
metabolized. The effects of inactivating alternative NADH oxidizing
pathway(s) on succinate yield are shown in the parentheses. A
negative sign (-) indicates a decrease in yield and a positive sign
(+) indicates an increase in yield as compared to that of the wild
type under the same conditions. .sup.2Fermentations were carried
out in either NBS mineral salts medium or Luria broth medium with
5% glucose and 100 mM potassium bicarbonate (37.degree. C., pH 7.0,
150 rpm). Abbreviations: Suc, succinate; Ace, acetate; Mal, malate;
Pyr, pyruvate; Lac, lactate; For, formate; EtOH, ethanol.
TABLE-US-00017 TABLE 17 The effects of increasing PCK activity on
succinate production and yield from glucose in NBS mineral salts
medium Growth Cell Glu Genetic yield PCK used Suc Fermentation
products (mmol).sup.5 Strains modification.sup.1 Day (g/L)
activity.sup.3 (mmol) Yield.sup.4 Suc Ace Mal Pyr Lac For EtOH ATCC
Wild type 3 3.0 203 278 0.16 46 151 -- -- 110 318 133 8739 ATCC
pLO14677.sup.2 3 2.8 1782 278 0.27 73 141 -- 24 112 266 116 8739
XZ632 pck* 3 2.9 1631 278 0.22 61 161 -- -- 88 302 152 XZ635
.DELTA.ldhA, pck* 3 2.7 1697 278 0.22 60 151 -- -- 13 327 178 XZ639
.DELTA.adhE. pck* 3 2.7 1608 278 0.25 70 80 -- -- 329 99 -- XZ640
.DELTA.pflB, pck* 3 2.5 1623 278 0.14 39 12 -- -- 448 -- -- XZ638
.DELTA.ldhA, 6 0.8 917 66 0.24 16 71 -- -- -- 79 -- .DELTA.adhE,
pck* XZ641 .DELTA.ldhA, 6 0.8 932 61 0.39 24 9 -- -- -- 2 15
.DELTA.pflB, pck* .sup.1The abbreviation, pck*, denotes mutated
form of pck (G to A at -64 relative to the ATG start). .sup.2The
pck gene (ribosomal binding site, coding and terminator region) was
over-expressed in a high-copy plasmid. .sup.3PCK activity expressed
as nmol min.sup.-1 (mg protein).sup.-1 .sup.4Succinate yield was
calculated as moles of succinate produced per mol glucose
metabolized. .sup.5Fermentations were carried out in NBS mineral
salts medium with 5% glucose and 100 mM potassium bicarbonate
(37.degree. C., pH 7.0. 150 rpm). Abbreviations: Suc, succinate;
Ace, acetate; Mal, malate; Pyr, pyruvate; Lac, lactate; For,
formate; EtOH, ethanol
TABLE-US-00018 TABLE 18 Effects of combining a mutation in ptsI,
mutations that disrupted the ethanol pathway, and increased
expression of pck on succinate production in NBS mineral salts
medium containing 5% glucose. Growth Gluc Genetic Cell used Suc
Fermentation products (mmol).sup.4 Strains modification .sup.1 Day
yield (mmol) Yield.sup.3 Suc Ace Mal Pyr Lac For EtOH ATCC Wild
type 3 3.0 278 0.16 46 151 -- -- 110 318 133 8739 ATCC 8739 XZ632
pck* 3 2.9 278 0.22 61 161 -- -- 88 302 152 XZ650 .DELTA.ptsI 3 2.6
259 0.14 35 131 -- 28 130 273 119 XZ647 pck*. .DELTA.ptsI 3 2.5 242
0.89 216 174 5 -- 5 199 22 XZ650 .DELTA.ptsI, pLOI4677.sup.2 3 2.4
224 0.75 167 167 3 2 8 224 52 XZ721 pck*, .DELTA.ptsI, .DELTA.pflB
3 2.3 262 1.25 327 70 -- -- 29 -- -- XZ723 pck*, .DELTA.ptsI, 3 2.4
259 0.86 222 175 -- -- 55 171 -- .DELTA.adhE .sup.1The
abbreviation, pck*, denotes mutated form of pck (G to A at -64
relative to the ATG start). .sup.2The pck gene (ribosomal binding
site, coding and terminator region) was over-expressed in a
high-copy plasmid .sup.3Succinate yield was calculated as moles of
succinate produced per mol glucose metabolized. .sup.4Fermentations
were carried out in NBS mineral salts medium with 5% glucose and
100 mM potassium bicarbonate (37.degree. C., pH 7.0, 150 rpm).
Abbreviations: Suc, succinate; Ace, acetate; Mal, malate; Pyr,
pyruvate: Lac, lactate; For, formate; EtOH, ethanol.
TABLE-US-00019 TABLE 19 Effects of combining a mutation in
phosphoenolpyruvate-dependent phosphotransferase pathway, and
increased expression of pck on succinate production in NBS mineral
salts medium containing 5% glucose Growth Gluc Genetic Cell used
Suc Fermentation products (mmol).sup.3 Strains modification.sup.1
Day yield (mmol) Yield.sup.2 Suc Ace Mal Pyr Lac For EtOH XZ632
pck* 3 2.9 278 0.22 61 161 -- -- 88 302 152 X7647 pck*, .DELTA.ptsI
3 2.5 242 0.89 216 174 5 -- 5 199 22 XZ469 pck*, .DELTA.ptsI-W 3
3.0 245 0.84 206 143 -- -- 3 164 31 XZ468 pck*, .DELTA.ptsH 3 2.6
266 0.67 179 151 -- -- 17 242 69 XZ470 pck*, .DELTA.ptsG 3 2.5 269
0.63 170 175 -- -- 32 245 63 .sup.1The abbreviation, pck*, denotes
mutated form of pck (G to A at -64 relative to the ATG start).
.DELTA.ptsI denotes deletion of the carboxy-terminal 175 bp of ptsI
gene, while .DELTA.ptsI-W denotes deletion of the whole ptsI gene.
.sup.2Succinate yield was calculated as mole of succinate produced
per mol glucose metabolized. .sup.3Fermentations were carried out
in NBS medium with 5% glucose and 100 mM potassium bicarbonate at
37.degree. C., pH 7.0, 150 rpm. Abbreviations: Suc, succinate; Ace,
acetate; Mal, malate; Pyr, pyruvate; Lac, lactate; For, formate;
EtOH, ethanol.
TABLE-US-00020 TABLE 20 Succinate production from glycerol by
engineered E. coli strains in NBS mineral salts medium Cell
Glycerol Fermentation products (mmol) .sup.1 Genetic Time mass used
Suc Strains modification (Day) (g/l) (mmol) Suc yield For EtOH Lac
Ace ATCC Wild type 6 0.55 153 38 0.25 110 81 -- 16 8739 XZ17
.DELTA.pflB 6 0.3 48 5 0.11 -- -- 20 5 XZ640 .DELTA.pflB, pck* 6
0.4 79 37 0.48 -- -- 16 10 XZ721 .DELTA.pflB, pck*, .DELTA.ptsI 6
0.5 128 102 0.8 -- -- 6 12 XZ632 pck* 6 0.7 149 64 0.44 83 46 -- 20
XZ647 pck*, .DELTA.ptsI 6 0.4 89 63 0.71 25 5 -- 13 XZ464 pck*.
.DELTA.gldA 6 0.43 125 95 0.77 35 8 -- 16 XZ465 pck*, .DELTA.dhaKL
6 0.47 150 112 0.75 37 11 -- 15 XZ466 pck*, .DELTA.dhaM 6 0.5 152
108 0.71 30 9 -- 14 XZ468 pck*, .DELTA.ptsH 6 0.5 125 85 0.68 32 14
-- 10 .sup.1 Fermentations were carried out in NBS medium with 5%
glycerol and 100 mM potassium bicarbonate at 37.degree. C., pH 7.0,
150 rpm. Succinate yield was calculated based on mol succinate
produced per mol glycerol consumed. Abbreviations: Suc, succinate;
For, formate; EtOH, ethanol; Lac, lactate; Ace, acetate.
REFERENCES
[0227] All references are listed herein for the convenience of the
reader. Each reference is incorporated by reference in its
entirety. [0228] U.S. Pat. No. 5,723,322 [0229] U.S. Pat. No.
5,770,435 [0230] U.S. Pat. No. 5,869,301 [0231] U.S. Pat. No.
5,143,834 [0232] U.S. Pat. No. 5,723,322 [0233] U.S. Pat. No.
5,573,931 [0234] U.S. Pat. No. 5,505,004 [0235] U.S. Pat. No.
6,455,284 [0236] U.S. Pat. No. 7,223,567 [0237] Ajl, S. J.,
Werkman, C. H. (1948) "Enzymatic fixation of carbon dioxide in
.alpha.-ketoglutaric acid" Proc Natl Acad Sci USA 34:491-498.
[0238] Andersson, C., Hodge, D., Berglund, K. A., Rova, U. (2007)
"Effect of different carbon sources on the production of succinic
acid using metabolically engineered Escherichia coli." Biotechnol
Prog 23(2):381-388. [0239] Asghari, A., Bothast, R. J., Doran, J.
B. Ingram, L. O. (1996) "Ethanol production from hemicellulose
hydrolysates of agricultural residues using genetically engineered
Escherichia coli strain KO11" J Industrial Microbiol. 16:42-47.
[0240] Babitzke, P., Romeo, T. (2007) "CsrB sRNA family:
sequestration of RNA-binding regulatory proteins" Curr Opin
Microbiol 10:156-163. [0241] Bachler, C., Schneider, P., Bahler,
P., Lustig, A., Erni, B. (2005) "Escherichia coli dihydroxyacetone
kinase controls gene expression by binding to transcription factor
DhaR" EMBO J 24:283-293. [0242] Berman, M., and Lin, E. C. (1971)
"Glycerol-specific revertants of a phosphoenolpyruvate
phosphotransferase mutant: suppression by the desensitization of
glycerol kinase to feedback inhibition" J Bacteriol 105:113-120.
[0243] Berman, M., Zwaig, N., Lin, E. C. (1970) "Suppression of a
pleiotropic mutant affecting glycerol dissimilation" Biochem
Biophys Res Common 38:272-278. [0244] Bock, A., and Sawers, G.
(1996) Chapter 18, Fermentation, In Neidhardt, F. C. Curtiss III,
R., Ingraham, J. L., Lin, E. C. C., Low, K. B, Magasanik, B.,
Reznikoff, W. S. Riley, M., Schaechter, M., Umbarger, H. E.,
editors. Escherichia coli and Salmonella: cellular and molecular
biology. ASM Press, Washington, D.C. [0245] Booth, I. R. (2005)
Module 3.4.3, Glycerol and methylglyoxal metabolism. In Bock, A.,
Curtiss III, R., Kaper, J. B., Neidhardt, F. C., Nystrom, T., Rudd,
K. E., Squires, C. L., editors, EcoSal--Escherichia coli and
Salmonella: cellular and molecular biology. Available at
ecosal.org. ASM Press, Washington, D.C. [0246] Cameron, A. D., and
Redfield, R. J. (2006) "Non-canonical CRP sites control competence
regulons in Escherichia coli and many other gamma-proteobacteria"
Nucleic Acids Res 34:6001-6014. [0247] Canvas, J. L., and Kornberg,
H. L. (1969) "Phosphoenolpyruvate carboxylase from Escherichia
coli" Methods Enzymol 13:288-292. [0248] Causey, T. B., Shanmugam,
K. T., Yomano, L. P, Ingram, L. O. (2004) "Engineering Escherichia
coli for efficient conversion of glucose to pyruvate" Proc Natl
Acad Sci USA 101:2235-2240. [0249] Chao, Y and Liao, J. C. (1993)
"Alteration of growth yield by overexpression of phosphoenol
pyruvate carboxylase and phosphoenolpyruvate carboxykinase in
Escherichia coli" Appl Environ Microbiol. 59:4261-4265. [0250]
Chang, Y. Y., Cronan, J. E., Jr. (2000) "Conversion of Escherichia
coli pyruvate decarboxylase to an `alpha-ketobutyrate oxidase`"
Biochem. J. 352:717-724. [0251] Chatterjee, R., Cynthia, S. M.,
Kathleen, C., David, P. C., Donnelly, M. I. (2001) "Mutation of the
ptsG gene results in increased production of succinate in
fermentation of glucose by Escherichia coli." Appl. Environ.
Microbiol. 67:148-154. [0252] Cox, S. J., Levanon, S. S., Sanchez,
A. M., Lin, H., Peerey, B., Bennett, G. N., San, K. Y. (2006)
"Development of a metabolic network design and optimization
framework incorporating implement constraints: A succinate
production case study" Metab. Engin. 8:46-57. [0253] Datsenko, K.
A., Wanner, B. L. (2000) "One-step inactivation of chromosomal
genes in Escherichia coli K-12 using PCR products" Proc Natl Acad
Sci USA 97:6640-6645. [0254] de Graef, M. R., Alexeeva, S., Snoep,
J. L., de Mattos, M. J. T. (1999) "The steady-state internal redox
state (NADH/NAD) reflects the external redox state and is
correlated with catabolic adaptation in Escherichia coli." J
Bacteriol 181:2351-235. [0255] Delbaere, L. T. J., Sudom, A. M.,
Prasad, L., Leduc, Y., Goldie, H. (2004) "Structure/function
studies of phosphoryl transfer by phosphoenolpyruvate
carboxykinase" Biochimica et Biophysica Acta 1679:271-278. [0256]
Du, C., Lin, S. K., Koutinas, A., Wang, R., Webb, C. (2007)
"Succinic acid production from wheat using a biorefining strategy"
Appl Microbiol Biotechnol 76(6):1263-1270. [0257] Egyud, L. G.,
Szent-Gyorgyi, A. (1966) "On the regulation of cell division" Proc
Natl Acad Sci USA 56:203-207. [0258] Erni, B., Siebold, C.,
Christen, S., Srinivas, A., Oberholzer, A., Baumann, U. (2006)
"Small substrate, big surprise: fold, function and phylogeny of
dihydroxyacetone kinases" Cell Mol Life Sci 63:890-900. [0259]
Farmer, W. and Liao, J. C. (1997) "Reduction of aerobic acetate
production by Escherichia coli" Appl Environ Microbiol
63:3205-3210. [0260] Flores, N., Leal, L., Sigala, J. C., de And a,
R., Escalante, A., Martinez, A., Ramirez, O. T., Gosset, G.,
Bolivar, F. (2007) "Growth recovery on glucose under aerobic
conditions of an Escherichia coli strain carrying a
phosphoenolpyruvate: carbohydrate phosphotransferase system
deletion by inactivating arcA and overexpressing the genes coding
for glucokinase and galactose permease" J Mol Microbiol Biotechnol
13: 105-116. [0261] Fraenkel, D. G. (1996) Chapter 14, Glycolysis.
In Neidhardt, F. C., Curtiss III, R., Ingraham, J. L., Lin, E. C.
C., Low, K. B, Magasanik, B., Reznikoff, W. S., Riley, M.,
Schaechter, M., Umbarger, H. E., editors. Escherichia coli and
Salmonella: cellular and molecular biology. ASM Press, Washington,
D.C. [0262] Gokarn, R. R., Eiteman, M. A., Altman, E. (2000)
"Metabolic analysis of Escherichia coli in the presence and absence
of carboxylating enzymes phosphoenolpyruvate carboxylase and
pyruvate carboxylase" Appl Environ Microbiol 66:1844-1850. [0263]
Gokarn, R. R., Evans, J. D., Walker, J. R., Martin, S. A., Eiteman,
M. A., Altman, E. (2001) "The physiological effects and metabolic
alterations caused by the expression of Rhizobium etli pyruvate
carboxylase in Escherichia coli" Appl Microbiol Biotechnol
56:188-195. [0264] Goldie, H. (1984) "Regulation of transcription
of the Escherichia coli phosphoenolpyruvate carboxykinase locus:
studies with pck-lacZ operon fusions" J Bacteriol 159:832-836
[0265] Goldie, A. H., and Sanwal, B. D. (1980a) "Genetic and
physiological characterization of Escherichia coli mutants
deficient in phosphoenolpyruvate carboxykinase activity" J
Bacteriol 141:1115-1121. [0266] Goldie, A. H., and Sanwal, B. D.
(1980b) "Allosteric control by calcium and mechanism of
desensitization of phosphoenolpyruvate carboxykinase of Escherichia
coli" Biol Chem 255:1399-1405. [0267] Gottschalk, G. (1985)
Bacterial metabolism. 2nd ed. Springer-Verlag, New York. [0268]
Grabar, T. B., Zhou, S., Shanmugam, K. T., Yomano, L. P., Ingram,
L. O. (2006) "Methylglyoxal bypass identified as source of chiral
contamination in L(+) and D(-) lactate fermentations by recombinant
Escherichia coli." Biotechnol Lett 28:1527-1535. [0269] Guest, J.
R., Angier, S. J., Russell (1989) "Structure, expression, and
protein engineering in the pyruvate dehydrogenase complex of
Escherichia coli." Ann N Y Acad Sci 573:76-99. [0270] Gutknecht,
R., Beutler, R., Garcia-Alles, L. F., Baumann, U., Erni., B. (2001)
"The dihydroxyacetone kinase of Escherichia coli utilizes a
phosphoprotein instead of ATP as phosphoryl donor" EMBO J.
20:2480-2486. [0271] Hernandez-Montalvo, V., Martinez, A.,
Hernandez-Chavez, G., Bolivar, F., Valle, F., Gosset, G. (2003)
"Expression of galP and glk in a Escherichia coli PTS mutant
restores glucose transport and increases glycolytic flux to
fermentation products" Biotechnol Bioeng 83:687-694. [0272]
Hesslinger, C., Fairhurst, S. A., Sawers, G. (1998) "Novel keto
acid formate-lyase and propionate kinase enzymes are components of
an anaerobic pathway in Escherichia coli that degrades L threonine
to propionate" Mol Microbiol 27(2):477-492. [0273] Holtman, C. K.,
Pawlyk, A. C., Meadow, N. D., Pettigrew, D. W. (2001) "Reverse
genetics of Escherichia coli glycerol kinase allosteric regulation
and glucose control of glycerol utilization in vivo" J Bacteriol
183:3336-3344. [0274] Hong, S. H., and Lee, S. Y. (2001) "Metabolic
flux analysis for succinic acid production by recombinant
Escherichia coli with amplified malic enzyme activity" Biotechnol
Bioeng 74:89-95. [0275] Hopper, D. J., Cooper, R. A. (1971) "The
regulation of Escherichia coli methylglyoxal synthase: a new
control site in glycolysis" FEBS Lett 13:213-216. [0276] Imamura,
R., Yamanaka, K., Ogura, T., Hiraga, S., Fujita, N., Ishihama, A.,
Niki, H. (1996) "Identification of the cpdA gene encoding cyclic
3',5'-adenosine monophosphate phosphodiesterase in Escherichia
coli" J Biol Chem 271:25423-25429. [0277] Iverson, T. M.,
Luna-Chavez, C., Croal, L. R., Cecchini, G., Rees, D. C. (2002)
"Crystallographic studies of the Escherichia coli quinol-fumarate
reductase with inhibitors bound to the quinol-binding site. 2002" J
Biol Chem 277:16124-16130. [0278] Jantama, K., Haupt, M. J.,
Svoronos, S. A., Zhang, X., Moore, J. C., Shanmugam, K. T., Ingram,
L. O. (2008a) "Combining metabolic engineering and metabolic
evolution to develop nonrecombinant strains of E. coli C that
produce succinate and malate" Biotech Bioeng 99:1140-1153. [0279]
Jantama, K., Zhang, X., Moore, J. C., Shanmugam, K. T., Svoronos,
S. A., Ingram, L. O. (2008b) "Eliminating side products and
increasing succinate yields in engineered strains of Escherichia
coli C" Biotechnol Bioeng 101:881-893. [0280] Jarboe, L. R.,
Hyduke, D. R., Tran, L. M., Chou, K. J., Liao, J. C. (2008)
"Determination of the Escherichia coli S-nitrosoglutathione
response network using integrated biochemical and systems analysis"
J Biol. Chem. 283: 5148-5157. [0281] Jin, R. Z., Tang, J. C., Lin,
E. C. (1983) "Experimental evolution of a novel pathway for
glycerol dissimilation in Escherichia coli" J Mol Evol 19:429-436.
[0282] Jojima, T., Omumasaba, C. A., Inui, M., and Yukawa, H.
(2009) Sugar transporters in efficient utilization of mixed sugar
substrates: current knowledge and outlook. Appl Microbiol
Biotechnol 85: 471-480. [0283] Kao, K. C., Tran, L. M., Liao, J. C.
(2005) "A global regulatory role of gluconeogenic genes in
Escherichia coli revealed by transcriptome network analysis" J Biol
Chem 280:36079-36087. [0284] Karp, P. D., Keseler, I. M., Shearer,
A., Latendresse, M., Krummenacker, M., Paley, S. M., Paulsen, I.
T., Collado-Vides, J., Gamma-Castro, S., Peralta-Gil, M.,
Santos-Zavaleta, A., Penaloza-Spinola, M., Bonavides-Martinez, C.,
Ingraham, J. (2007) "Multidimensional annotation of Escherichia
coli K-12 genome" Nucl Acids Res 35:7577-7590. [0285] Keseler, I.
M., Collado-Vides, J., Gamma-Castro, S., Ingraham, J., Paley, S.,
Paulsen, I. T., Peralta-Gil, M., Karp, P. D. (2005) "Ecocyc: A
comprehensive database resource for Escherichia coli" Nucl Acids
Res 33:D334-D337. [0286] Kessler, D., and Knappe, J. (1996) Chapter
15, Anaerobic dissimilation of pyruvate In Neidhardt, F. C.,
Curtiss III, R., Ingraham, J. L., Lin, E. C. C., Low, K. B,
Magasanik, B., Reznikoff, W. S., Riley, M., Schaechter, M.,
Umbarger, H. E., editors. Escherichia coli and Salmonella: cellular
and molecular biology. ASM Press, Washington, D.C. [0287] Kim, Y.,
Ingram, L. O., Shanmugam, K. T. (2007) "Construction of an
Escherichia coli K-12 mutant for homoethanologenic fermentation of
glucose or xylose without foreign genes" Appl Environ Microbiol
73:1766-1771. [0288] Kim, P., Laivehieks, M., Vieille, C., Zeikus,
J. G. (2004) "Effect of overexpression of Actinobacillus
succinogenes phosphoenolpyruvate carboxykinase on succinate
production in Escherichia coli" Appl Environ Microbiol
70:1238-1241. [0289] Kim, T. Y., Kim, H. U., Park, J. M., Song, H.,
Kim, J. S., Lee, S. Y. (2007) "Genome-scale analysis of Mannheimia
succiniciproducens metabolism" Biotechnol Bioeng 97:657-671. [0290]
Krebs, A., Bridger, W. A. (1980) "The kinetic properties of
phosphoenolpyruvate carboxykinase of Escherichia coli" Can J
Biochem 58(4): 309-318. [0291] Kulla, H., and Gottschalk, G. (1977)
"Energy-dependent inactivation of citrate lyase in Enterobacter
aerogenes" J Bacteriol 132(3): 764-770. [0292] Kwon, Y. D., Lee, S.
Y., Kim, P. (2008) "A physiology study of Escherichia coli
overexpressing phosphoenolpyruvate carboxykinase" Biosci Biotechnol
Biochem 72:1138-1141. [0293] Laivenieks, M., Vieille, C., Zeikus,
J. G. (1997) "Cloning, sequencing, and overexpression of the
Anaerobiospirillum succiniciproducens phosphoenolpyruvate
carboxykinase (pckA) gene" Appl Environ Microbiol 63(6): 2273-2280.
[0294] Lee, E-C., Yu, K., Martinez de Velasco, J., Tessarollo, L.,
Swing, D. A., Court, D. L., Jenkins, N. A., and Copeland, N. G.
(2001) "A highly efficient Escherichia coli-based chromosome
engineering system adapted for recombinogenic targeting and
subcloning of BAC DNA" Genomics 73: 56-65. [0295] Lee, P. C., Lee,
S. Y., Hong, S. H., Chang, H. N. (2002) "Isolation and
characterization of a new succinic acid-producing bacterium,
Mannheimia succiniciproducens MBEL55E, from bovine rumen" Appl
Microbiol Biotechnol 58:663-668. [0296] Lee, S. Y., Hong, S. H.,
Lee, S. H., Park, S. J. (2004) "Fermentative production of
chemicals that can be used for polymer synthesis" Macromol Biosci
4:157-164. [0297] Lee, S. J, Lee, D. Y., Kim, T. Y., Kim, B. H.,
Lee, J., Lee, S. Y. (2005) "Metabolic engineering of Escherichia
coli for enhanced production of succinic acid, based on genome
comparison and in silico gene knockout simulation" Appl Environ
Microbiol 71:7880-7887. [0298] Lee, S. J., Song, H., Lee, S. Y.
(2006) "Genome-based metabolic engineering of Mannheimia
succiniciproducens for succic acid production" Appl Environ
Microbial 72(3): 1939-1948. [0299] Lin, E. C. (1996) Chapter 20,
Dissimilatory Pathways for Sugars, Polyols, and Carboxylates. In
Neidhardt, F. C., Curtiss III, R., Ingraham, J. L., Lin, E. C. C.,
Low, K. B, Magasanik, B., Reznikoff, W. S., Riley, M., Schaechter,
M., Umbarger, H. E., editors. Escherichia coli and Salmonella:
cellular and molecular biology. ASM Press, Washington, D.C. [0300]
Lin, E. C. (1976) "Glycerol dissimilation and its regulation in
bacteria" Annu Rev Microbiol 30:535-578. [0301] Lin, H., Bennett,
G. N., San, K. Y. (2005a) "Chemostat culture characterization of
Escherichia coli mutant strains metabolically engineered for
aerobic succinate production: A study of the modified metabolic
network based on metabolite profile, enzyme activity, and gene
expression profile" Metab Eng 7:337-352. [0302] Lin, H., Bennett,
G. N., San, K. Y. (2005b) "Metabolic engineering of aerobic
succinate production systems in Escherichia coli to improve process
productivity and achieve the maximum theoretical succinate
yield
" Metab Eng 7:116-127. [0303] Lin, H., Bennett, G. N., San, K. Y.
(2005c) "Effect of carbon sources differing in oxidation state and
transport route on succinate production in metabolically engineered
Escherichia coli" J Ind Microbiol Biotechnol 32:87-93. [0304] Lin,
H., Bennett, G. N., San, K. Y. (2005d) "Fed-batch culture of a
metabolically engineered Escherichia coli strain designed for
high-level succinate production and yield under aerobic conditions"
Biotechnol Bioeng 90:775-779. [0305] Lutgens, M., and Gottschalk,
G. (1980) "Why a co-substrate is required for the anaerobic growth
of Escherichia coli on citrate" J Gen Microbiol 119: 63-70. [0306]
Martin, S. A. (1994) "Nutrient transport by ruminal bacteria: a
review" J Anim Sci 72:3019-3031. [0307] Martinez, A., Grabar, T.
B., Shanmugam, K. T., Yomano, L. P., York, S. W., Ingram, L. O.
(2007) "Low salt medium for lactate and ethanol production by
recombinant Escherichia coli" Biotechnol Lett 29:397-404. [0308]
Martinez-Morales, F., Borges, A. C., Martinez, A., Shanmugam, K.
T., Ingram, L. O. "Chromosomal integration of heterologous DNA in
Escherichia coli with precise removal of markers and replicons used
during construction" J Bacteriol 181:7143-7148. [0309] McKinlay, J.
B., Shachar-Hill, Y., Zeikus, J. G., Vieille, C. (2007)
"Determining Actinobacillus succinogenes metabolic pathways and
fluxes by NMR and GC-MS analyses of 13C-labeled metabolic product
isotopomers" Metab Eng 9:177-192. [0310] McKinlay, J. B., Zeikus,
J. G., Vieille, C. (2005) "Insights into Actinobacillus
succinogenes fermentative metabolism in a chemically defined growth
medium" Appl Environ Microbiol 71(11):6651-6656. [0311] McKinlay,
J. B., Vieille, C. (2008) ".sup.13C-metabolic flux analysis of
Actinobacillus succinogenes fermentative metabolism at different
NaHCO.sub.3 and H.sub.2 concentrations" Metab Eng 10:55-68. [0312]
McKinlay, J. B., Vieille, C., Zeikus, J. G. (2007) "Prospects for a
bio-based succinate industry" Appl Microbiol Biotechnol
76(4):727-740. [0313] Meynial-Salles, I., Dorotyn, S., Soucaille,
P. (2007) "A new process for the continuous production of succinic
acid from glucose at high yield, titer and productivity" Biotechnol
Bioeng 99(1):129-135. [0314] Miller, J. H. (1992) A short course in
bacterial genetics: A laboratory manual and handbook for
Escherichia coli and related bacteria, Cold Spring Harbor Press.
[0315] Millard, C. S., Chao, Y. P., Liao, J. C., Donnelly, M. I.
(1996) "Enhanced production of succinic acid by overexpression of
phosphoenolpyruvate carboxylase in Escherichia coli" Appl Environ
Microbiol 62:1808-1810. [0316] Morikawa, M., K. Izui, et al. (1980)
"Regulation of Escherichia coli phosphoenolpyruvate carboxylase by
multiple effectors in vivo. Estimation of the activities in the
cells grown on various compounds" J Biochem (Tokyo) 87(2): 441-449.
[0317] Moniruzzaman, M. et al. (1997) "Isolation and molecular
characterization of high-performance cellobiose-fermenting
spontaneous mutants of ethanologenic Escherichia coli KO11
containing the Klebsiella oxytoca casAB operon" Appl Environ
Microbiol 63:4633-4637. [0318] Nilekani, S., Sivaraman, C. (1983)
"Purification and properties of citrate lyase from Escherichia
coli" Biochemistry 22(20); 4657-63. [0319] Oh, M. K., Rohlin, L.,
Kao, K. C., Liao, J. C. (2002) "Global expression profiling of
acetate-grown Escherichia coli" J Biol Chem 277: 13175-13183.
[0320] Okino, S., Inui, M., Yukawa, H. (2005) "Production of
organic acids by Corynebacterium glutanicum under oxygen
deprivation" Appl Microbiol Biotechnol 68:475-480. [0321]
Pernestig, A. K., Georgellis, D., Romeo, T., Suzuki, K., Tomenius,
H., Normakr, S., Melefors, O. (2003) "The Escherichia coli
BarA-UvrY two-component system is needed for efficient switching
between glycolytic and gluconeogenic carbon sources" J Bacteriol
185:843-853. [0322] Plumbridge, J. (2002) "Regulation of gene
expression in the PTS in Escherichia coli: the role and
interactions of Mlc" Curr Opin Microbiol 5:187-193. [0323] Posfai,
G., Koob, M. D., Kirkpatrick, H. A., Blattner, F. C. (1997)
"Versatile insertion plasmids for targeted genome manipulations in
bacteria: Isolation, deletion, and rescue of the pathogenicity
island LEE of the Escherichia coli O157:H7 genome" J Bacteriol
179:4426-4428. [0324] Postma, P. W., Lengela, J. W., Jacobson, G.
R. (1996) Chapter 75, Phosphoenolpyruvate: Carbohydrate
Phosphotransferase Systems, In Neidhardt, F. C., Curtiss III, R.,
Ingraham, J. L., Lin, E. C. C., Low, K. B, Magasanik, B.,
Reznikoff, W. S., Riley, M., Schaechter, M., Umbarger, H. E.,
editors. Escherichia coli and Salmonella: cellular and molecular
biology. ASM Press, Washington, D.C. [0325] Quentmeier, A.,
Holzenburg, A., Mayer, F., Antranikian, G. (1987) "Reevaluation of
citrate lyase from Escherichia coli" Biochim Biophys Acta 913(1):
60-5. [0326] Ramseier, T. M., Bledig, S., Michotey, V., Feghali,
R., Saier, M. H. Jr. (1995) "The global regulatory protein FruR
modulates the direction of carbon flow in Escherichia coli" Mol
Microbiol 16:1157-1169. [0327] Reed, J. L., Vo, T. D., Schilling,
C. H., Palsson, B. O. (2003) "An expanded genome-scale model of
Escherichia coli K-12 (iJR904 GSM/GPR)" Genome Biol 4(9):R54.
[0328] Reitzer, L. (2004) Module 3.6.1.3, Biosynthesis of
Glutamate, Aspartate, Asparagine, L-Alanine, and D-Alanine. In
Bock, A., Curtiss III, R., Kaper, J. B., Neidhardt, F. C., Nystrom,
T., Rudd, K. E., Squires, C. L., editors, EcoSal--Escherichia coli
and Salmonella: cellular and molecular biology. Available at
ecosal.org. ASM Press, Washington, D.C. [0329] Saier, M. H. Jr, and
Ramseier, T. M. (1996) "The catabolite repressor/activator (Cra)
protein of enteric bacteria" J Bacteriol 178:3411-3417. [0330]
Samuelov, N. S., Lamed, R., Lowe, S., Zeikus, J. G. (1991)
"Influence of CO.sub.2--HCO.sub.3 levels and pH on growth,
succinate production, and enzyme-activities of Anaerobiospirillum
succiniproducens" Appl Environ Microbiol 57: 3013-3019. [0331]
Sanchez, A. M., Bennett, G. N., San, K. Y. (2005a) "Novel pathway
engineering design of the anaerobic central metabolic pathway in
Escherichia coli to increase succinate yield and productivity"
Metab Eng 7:229-239. [0332] Sanchez, A. M., Bennett, G. N., San, K.
Y. (2005b) "Efficient succinic acid production from glucose through
overexpression of pyruvate carboxylase in an Escherichia coli
alcohol dehydrogenase and lactate dehydrogenase mutant" Biotechnol
Prog 21: 358-365. [0333] Sanchez, A. M., Bennett, G. N., San, K. Y.
(2006) "Batch culture characterization and metabolic flux analysis
of succinate-producing Escherichia coli strains" Metab Eng 8:
209-226. [0334] Sanwal, B. D. and Smando, R. (1969a) "Matic enzyme
of Escherichia coli: Possible mechanism for allosteric effects" J
Biol Chem 244(7):1824-1830. [0335] Sanwal, B. D. and Smando, R.
(1969b) "Malic enzyme of Escherichia coli: Diversity of the
effectors controlling enzyme activity" J Biol Chem
244(7):1817-1823. [0336] Sanwal, B. D. (1970a) "Allosteric controls
of amphibolic pathways in bacteria" Bacteriol Rev 34:20-39. [0337]
Sanwal, B. D. (1970b) "Regulatory characteristics of the
diphosphopyridine nucleotide-specific malic enzyme of Escherichia
coli" J Biol Chem 245(5):1212-1216. [0338] Sanwal, B. D. (1970c)
"Regulatory mechanisms involving nicotinamide adenine nucleotide as
allosteric effectors: A control of glucose 6-phosphate
dehydrogenase" J Biol Chem 245(7):1625-1631. [0339] Sawers, G.,
Bock, A. (1988) "Anaerobic regulation of pyruvate formate-lyase
from Escherichia coli K-12" J Bacteriology 170:5330-5336. [0340]
Song, H., Lee, J. W., Choi, S., You, J. K., Hong, W. H., Lee, S. Y.
(2007) "Effects of dissolved CO2 levels on the growth of Mannheimia
succiniciproducens and succinic acid production" Biotechnol Bioeng
98(6): 1296-1304. [0341] Storici, F., Coglievina, M., Bruschi, C.
V. (1999) "A 2 .mu.m DNA-based maker recycling system for multiple
gene disruption in the yeast Saccharomyces cerevisiae" Yeast
15:271-283. [0342] Stols, L., Donnelly, M. I. (1997) "Production of
succinic acid through overexpression of NAD dependent malic enzyme
in an Escherichia coli mutant" Appl Environ Microbiol 63:2695-2701.
[0343] Suzuki. K., Wang, X., Weilbacher, T., Pernestig, A. K.,
Melefors, O., Georgellis, D., Babitzke, P., Romeo, T. (2002)
"Regulatory circuitry of the CsrA/CsrB and BarA/UvrY systems of
Escherichia coli" J Bacteriol 184:5130-5140. [0344] Sweet, G.,
Gandor, C., Voegele, R., Wittekindt, N., Beuerle, J., Truniger, V.,
Lin, E. C., Boos, W. (1990) "Glycerol facilitator of Escherichia
coli: cloning of glpF and identification of the glpF product" J
Bacteriol 172:424-430. [0345] Tang, J. C., Forage, R. G., Lin, E.
C. (1982) "Immunochemical properties of NAD+-linked glycerol
dehydrogenases from Escherichia coli and Klebsiella pneumoniae" J
Bacteriol 152:1169-1174. [0346] Thomason, L., Court, D. L.,
Bubunenko, M., Constantino, N., Wilson, H., Datta, S. Oppenheim, A.
(2005) "Recombineering: Genetic Engineering in Bacteria Using
Homologous Recombination", sections 1.16.1-1.16.21. In F. M.
Ausubel, R. Brent, R. E. Klingston, D. D. Moore, J. G. Deidman, J.
A. Smith, and K. Struhl (Eds.), Current Protocols in Molecular
Biology. John Wiley & Sons Inc., New York. [0347] Underwood, S.
A., Buszko, M. L., Shanmugam, K. T., Ingram, L. O. (2004) "Lack of
protective osmolytes limits final cell density and volumetric
productivity of ethanologenic Escherichia coli KO11 during xylose
fermentation" Appl Environ Microbiol 70(5): 2734-40. [0348]
Underwood, S. A., Buszko, M. L., Shanmugam, K. T., Ingram, L. O.
(2002) "Genetic changes to optimize carbon partitioning between
ethanol and biosynthesis in ethanologenic Escherichia coli" Appl
Environ Microbial 68(12): 6263-6272. [0349] linden, G. and
Kleefeld, A. (2004) Module 3.4.5, C.sub.4-Dicarboxylate Degradation
in Aerobic and Anaerobic Growth. In Bock, A., Curtiss III, R.,
Kaper, J. B., Neidhardt, F. C., Nystrom, I., Rudd, K. E., Squires,
C. L., editors, EcoSal--Escherichia coli and Salmonella: cellular
and molecular biology. Available at ecosal.org. ASM Press,
Washington, D.C. [0350] van der Werf, M. J., M. V. Guettler, M. K.
Jain, and J. G. Zeikus (1997) "Environmental and physiological
factors affecting the succinate product ratio during carbohydrate
fermentation by Actinobacillus sp. 130Z" Arch Microbial
167:332-342. [0351] Vemuri, G. N., Eiteman, M. A., Altman, E.
(2002a) "Effects of growth mode and pyruvate carboxylase on
succinic acid production by metabolically engineered strains of
Escherichia coli." Appl Environ Microbial 68:1715-1727. [0352]
Vemuri, G. N., Eiteman, M. A., Altman, E. (2002h) "Succinate
production in dual-phase Escherichia coli fermentations depends on
the time of transition from aerobic to anaerobic conditions" J Ind
Microbial Biotechnol 28:325-332. [0353] Wang, Q., Chen, X., Yang,
Y., Zhao, X. (2006) "Genome-scale in silica aided metabolic
analysis and flux comparisons of Escherichia coli to improve
succinate production" Appl Microbial Biotechnol 73:887-894. [0354]
Wang, Q., Wu, C., Chen, T., Chen, X., Zhao, X. (2006) "Expression
of galactose permease and pyruvate carboxylase in Escherichia coli
ptsG mutant increases the growth rate and succinate yield under
anaerobic conditions" Biotechnol Lett 28:89-93. [0355] Wendisch, V.
F., Bott, M., Eikmanns, B. J. (2006) "Metabolic engineering of
Escherichia coli and Corynebacterium glutamicum for
biotechnological production of organic acids and amino acids" Curr
Opin Microbial 9:1-7. [0356] Werpy, T., and Petersen, G. (2004)
"Top value added chemicals from biomass," retrieved from the web as
www1.eere.energy.gov/biomass/pdfs/35523.pdf, Washington, D.C. US
Department of Energy. [0357] Wood, B. E., Yomano, L. P., York, S.
W., Ingram, L. O. (2005) "Development of industrial medium required
elimination of the 2,3-butanediol fermentation pathway to maintain
ethanol yield in an ethanologenic strain of Klebsiella oxytoca"
Biotechnol Prog 21:1366-1372. [0358] Wright, J. A. and Sanwal, B.
D. (1969) "Regulatory mechanisms involving nicotinamide adenine
nucleotide as allosteric effectors: Control of phosphoenolpyruvate
carboxykinase" J Biol Chem 244(7):1838-1845. [0359] Wu, H., Li, Z.,
Zhou, L., Ye, Q. (2007) "Improved succinic acid production in the
anaerobic culture of an Escherichia coli pflB ldhA double mutant as
a result of enhanced anaplerotic activities in the preceding
aerobic culture" Appl Environ Microbiol 73:7837-7843. [0360] Yi,
J., Draths, K. M., Li, K., Frost, J. W. (2003) "Altered glucose
transport and shikimate pathway product yields in E. coli"
Biotechnol Prog 19:1450-1459. [0361] Yun, N. R., San, K. Y.,
Bennett, G. N. (2005) "Enhancement of lactate and succinate
formation in adhE or pta-ackA mutants of NADH
dehydrogenase-deficient Escherichia coli" J Appl Microbiol
99:1404-1412. [0362] Zeikus, J. G., Jain, M. K., Elankovan, P.
(1999) "Biotechnology of succinic acid production and markets for
derived industrial products" Appl Microbiol Biotechnol 51:545-552.
[0363] Zhang, X., Jantama, K., Moore, J. C., Shanmugam, K. T.,
Ingram, L. O. (2007) "Production of L-alanine by metabolically
engineered Escherichia coli" Appl Microbial Biotechnol 77: 355-366.
[0364] Zhou, S., Shanmugam, K. T., Ingram, L. O. (2003) "Functional
replacement of the Escherichia coli D-(-)-lactate dehydrogenase
gene (ldhA) with the L-(+)-lactate dehydrogenase gene (ldhL) from
Pediococcus acidilactici" Appl Environ Microbial 69:2237-2244.
[0365] Zhou, S., Grabar, T. B., Shanmugam, K. T., Ingram, L. O.
(2006) "Betaine tripled the volumetric productivity of
D-(-)-lactate by Escherichia coli strain SZ132 in mineral salts
medium" Biotechnol Lett 28:671-676.
Sequence CWU 1
1
194118DNAArtificial sequencetranslational stop sequence 1gcctaattaa
ttaatccc 18265DNAArtificial sequencePrimer set for ldhA 2atgaactcgc
cgttttatag cacaaaacag tacgacaaga agtacgtgta ggctggagct 60gcttc
65365DNAArtificial sequencePrimer set for ldhA 3ttaaaccagt
tcgttcgggc aggtttcgcc tttttccaga ttgctcatat gaatatcctc 60cttag
65465DNAArtificial sequencePrimer set for adhE 4atggctgtta
ctaatgtcgc tgaacttaac gcactcgtag agcgtgtgta ggctggagct 60gcttc
65565DNAArtificial sequencePrimer set for adhE 5ttaagcggat
tttttcgctt ttttctcagc tttagccgga gcagccatat gaatatcctc 60cttag
65665DNAArtificial sequencePrimer set for ackA 6atgtcgagta
agttagtact ggttctgaac tgcggtagtt cttcagtgta ggctggagct 60gcttc
65765DNAArtificial sequencePrimer set for ackA 7tcaggcagtc
aggcggctcg cgtcttgcgc gataaccagt tcttccatat gaatatcctc 60cttag
65865DNAArtificial sequencePrimer set for focA-plfB 8ttactccgta
tttgcataaa aaccatgcga gttacgggcc tataagtgta ggctggagct 60gcttc
65965DNAArtificial sequencePrimer set for focA-plfB 9atagattgag
tgaaggtacg agtaataacg tcctgctgct gttctcatat gaatatcctc 60cttag
651030DNAArtificial sequencePrimer set for JMcatsacB 10ttagctagca
tgtgacggaa gatcacttcg 301131DNAArtificial sequencePrimer JMcatsacB
11ccgctagcat caaagggaaa actgtccata t 311232DNAArtificial
sequencePrimer set for cat-up2/sacB-down2 12agagaggata tctgtgacgg
aagatcactt cg 321332DNAArtificial sequencePrimer set for
cat-up2/sacB-down2 13agagaggata tcgaattgat ccggtggatg ac
321420DNAArtificial sequencePrimer set for mgsA-up/down
14cagctcatca accaggtcaa 201520DNAArtificial sequencePrimer set for
mgsA-up/down 15aaaagccgtc acgttattgg 201620DNAArtificial
sequencePrimer set for mgsA-1/2 16agcgttatct cgcggaccgt
201720DNAArtificial sequencePrimer set for mgsA-1/2 17aagtgcgagt
cgtcagttcc 201820DNAArtificial sequencePrimer set for poxB-up/down
18aagcaataac gttccggttg 201920DNAArtificial sequencePrimer set for
poxB-up/down 19ccactttatc cagcggtagc 202019DNAArtificial
sequencePrimer set for poxB-1/2 20gacgcggtga tgaagtgat
192120DNAArtificial sequencePrimer set for poxB-1/2 21tttggcgata
taagctgcaa 202229DNAArtificial sequencePrimer set for pck-F/R
22ttggctaagg agcagtgaaa tgcgcgtta 292325DNAArtificial
sequencePrimer set for pck-F/R 23cacgacaaaa gaagggtaaa taaac
252420DNAArtificial sequencePrimer set for pck-2/3 24ttgttaacgc
gcatttcact 202520DNAArtificial sequencePrimer set for pck-2/3
25gcgatagcgg ctactgtcat 202618DNAArtificial sequencePrimer set for
pck (RT-PCR) 26gacgatacca ctcgcgat 182719DNAArtificial
sequencePrimer set for pck (RT-PCR) 27gtcgacaacg aacagacgt
192817DNAArtificial sequencePrimer set for birA (RT-PCR)
28atcgtgatgg cggaagt 172919DNAArtificial sequencePrimer set for
birA (RT-PCR) 29cttgcgatcc tgcagatag 193032DNAArtificial
sequencePrimer set for JM4161 sense/comp 30accgcatcag gcgcctaatt
aattaatccc gg 323132DNAArtificial sequencePrimer set for JM4161
sense/comp 31ccgggattaa ttaattaggc gcctgatgcg gt
323230DNAArtificial sequencePrimer set for JMpEL04F1/R1
32cagcagatct aagtaaatcg cgcgggtttg 303330DNAArtificial
sequencePrimer set for JMpEL04F1/R1 33cagcagatct agcggctatt
taacgaccct 303420DNAArtificial sequencePrimer set for JMackA-F1/R1
34gcctgaaggc ctaagtagta 203520DNAArtificial sequencePrimer set for
JMackA-F1/R1 35gcacgatagt cgtagtctga 203620DNAArtificial
sequencePrimer set for JMackA up1/down1 36gttgagcgct tcgctgtgag
203720DNAArtificial sequencePrimer set for JMackA up1/down1
37gccgcaatgg ttcgtgaact 203831DNAArtificial sequencePrimer set for
JMcatsacB up3/down3 38ctcacctcga gtgtgacgga agatcacttc g
313934DNAArtificial sequencePrimer set for JmcatsacB up3/down3
39gtgcaggatc catcaaaggg aaaactgtcc atat 344059DNAArtificial
sequencePrimer set for SfPBXPS sense/comp 40atgtaggcgc cattaattaa
tggatccact atctcgagat taattaatcc cgggactat 594159DNAArtificial
sequencePrimer set for SfPBXPS sense/comp 41atagtcccgg gattaattaa
tctcgagata gtggatccat taattaatgg cgcctacat 594265DNAArtificial
sequencePrimer set for WMadhE A/C 42atggctgtta ctaatgtcgc
tgaacttaac gcactcgtag agcgtcggca cgtaagaggt 60tccaa
654365DNAArtificial sequencePrimer set for WMadhE A/C 43ttaagcggat
tttttcgctt ttttctcagc tttagccgga gcagcacact gcttccggta 60gtcaa
654464DNAArtificial sequencePrimer set for WMldhA A/C 44atgaaactcg
ccgtttatag cacaaaacag tacgacaaga agtacggcac gtaagaggtt 60ccaa
644565DNAArtificial sequencePrimer set for WMldhA A/C 45ttaaaccagt
tcgttcgggc aggtttcgcc tttttccaga ttgctacact gcttccggta 60gtcaa
654665DNAArtificial sequencePrimer set for WMpflB A/C 46ttactccgta
tttgcataaa aaccatgcga gttacgggcc tataacggca cgtaagaggt 60tccaa
654769DNAArtificial sequencePrimer set for WMpflB A/C 47ttacatagat
tgagtgaagg tacgagtaat aacgtcctgc tgctgttcta cactgcttcc 60ggtagtcaa
694820DNAArtificial sequencePrimer set for tdcDE-up/down
48cgccgacaga gtaataggtt 204920DNAArtificial sequencePrimer set for
tdcDE-up/down 49tgatgagcta cctggtatgg 205020DNAArtificial
sequencePrimer set for tdcDE-F7/R7 50cgatgcggtg gccaattaag
205120DNAArtificial sequencePrimer set for tdcDE-F7/R7 51gacgacgtgc
tggattacga 205220DNAArtificial sequencePrimer set for
citF-up2/down2 52gggtattcag gcgttcgata 205320DNAArtificial
sequencePrimer set for citF-up2/down2 53gcccgagagg atgactatgt
205420DNAArtificial sequencePrimer set for citF-2/3 54ggtgatcgat
gttgtgcatc 205520DNAArtificial sequencePrimer set for citF-2/3
55cccgttcttg tcgttgagat 205620DNAArtificial sequencePrimer set for
IO-adhE-up/down 56gctgctccgg ctaaagctga 205720DNAArtificial
sequencePrimer set for IO-adhE-up/down 57acgctctacg agtgcgttaa
205820DNAArtificial sequencePrimer set for up-focA/Mid-pflB
58agatcgccag ccgctgcaat 205920DNAArtificial sequencePrimer set for
up-focA/Mid-pflB 59aaccgttggt gtccagacag 206020DNAArtificial
sequencePrimer set for IO-ycaO-up/IO-midpflB-down 60gcctacattg
cgtaggctat 206120DNAArtificial sequencePrimer set for
IO-ycaO-up/IO-midpflB-down 61gcagcaggac gttattactc
206220DNAArtificial sequencePrimer set for ldhA-A/C 62atgaaactcg
ccgtttatag 206319DNAArtificial sequencePrimer set for ldhA-A/C
63ttaaaccagt tcgttgccc 196420DNAArtificial sequencePrimer set for
IO/ldhA-up/down 64cgttcgatcc gtatccaagt 206520DNAArtificial
sequencePrimer set for IO-ldhA-up/down 65aggctggaac tcggactact
206620DNAArtificial sequencePrimer set for aspC-up/down
66tccatcgctt acaccaaatc 206720DNAArtificial sequencePrimer set for
aspC-up/down 67tgggggatga cgtgatattt 206820DNAArtificial
sequencePrimer set for aspC-1/2 68agataacatg gctccgctgt
206919DNAArtificial sequencePrimer set for aspC-1/2 69aggagcggcg
gtaatgttc 197020DNAArtificial sequencePrimer set for sfcA-up/down
70ctatgcttga tcggcaacct 207120DNAArtificial sequencePrimer set for
sfcA-up/down 71acgatcgcct ggttttaatg 207220DNAArtificial
sequencePrimer set for sfcA-1/2 72taccgccgta cctccatcta
207322DNAArtificial sequencePrimer set for sfcA-1/2 73cgtaagggat
ataaagcgaa cg 227420DNAArtificial sequencePrimer set for
ackA-up/pta-down 74cgggacaacg ttcaaaacat 207520DNAArtificial
sequencePrimer set for ackA-up/pta-down 75attgcccatc ttcttgttgg
207621DNAArtificial sequencePrimer set for ackA-2/pta-2
76aactaccgca gttcagaacc a 217720DNAArtificial sequencePrimer set
for ackA-2/pta-2 77tctgaacacc ggtaacacca 207820DNAArtificial
sequencepck-Pro-up 78cacggtagca acaacattgc 207920DNAArtificial
Sequencepck-Pro-down 79agaaagcgtc gacaacgaac 208020DNAArtificial
Sequencepck-Pro-1 80atgcgcgtta acaatggttt 208120DNAArtificial
Sequencepck-Pro-2 81atggataacg ttgaactttc 208220DNAArtificial
SequenceptsI-D-up 82cgcattatgt tcccgatgat 208320DNAArtificial
SequenceptsI-D-down 83gcctttcagt tcaacggtgt 208420DNAArtificial
SequenceptsI-D-1 84cggcccaatt tactgcttag 208520DNAArtificial
SequenceptsI-D-2 85atccccagca acagaagtgt 208629DNAArtificial
Sequencepck-F 86ttggctaagg agcagtgaaa tgcgcgtta 298725DNAArtificial
Sequencepck-R 87cacgacaaaa gaagggtaaa taaac 258820DNAArtificial
Sequencepck-2 88ttgttaacgc gcatttcact 208920DNAArtificial
Sequencepck-3 89gcgatagcgg ctactgtcat 209020DNAArtificial
SequencesfcA-up 90ctatgcttga tcggcaacct 209120DNAArtificial
SequencesfcA-down 91acgatcgcct ggttttaatg 209220DNAArtificial
SequencesfcA-1 92taccgccgta cctccatcta 209322DNAArtificial
SequencesfcA-2 93cgtaagggat ataaagcgaa cg 229420DNAArtificial
Sequenceppc-up 94tcaaacgatg cccaactgta 209520DNAArtificial
Sequenceppc-down 95tttaatccgc ttcggaaaga 209620DNAArtificial
Sequenceppc-1 96gtcactattg ccgggattgc 209720DNAArtificial
Sequenceppc-2 97caatgcggaa tattgttcgt 209820DNAArtificial
Sequencepck-up 98tccgggcagt agtattttgc 209920DNAArtificial
Sequencepck-down 99atggctggat caaagtcagc 2010020DNAArtificial
Sequencepck-1 100cctggcgaaa ctgtttatcg 2010120DNAArtificial
Sequencepck-2 101ttgttaacgc gcatttcact 2010220DNAArtificial
SequencemaeB-up 102gcatcctggg gatgataatg 2010320DNAArtificial
SequencemaeB-down 103tttcttcgcc agttcctcac 2010421DNAArtificial
SequencemaeB-1 104aacccaaccg ctgtaatttt t 2110520DNAArtificial
SequencemaeB-2 105ctggaactgg aaattcatgg 2010620DNAArtificial
Sequencepck-Pro-up 106cacggtagca acaacattgc 2010720DNAArtificial
Sequencepck-Pro-down 107agaaagcgtc gacaacgaac 2010820DNAArtificial
Sequencepck-Pro-1 108atgcgcgtta acaatggttt 2010920DNAArtificial
Sequencepck-Pro-2 109atggataacg ttgaactttc 2011020DNAArtificial
SequenceptsI-D-up 110cgcattatgt tcccgatgat 2011120DNAArtificial
SequenceptsI-D-down 111gcctttcagt tcaacggtgt 2011220DNAArtificial
SequenceptsI-D-1 112cggcccaatt tactgcttag 2011320DNAArtificial
SequenceptsI-D-2 113atccccagca acagaagtgt 2011429DNAArtificial
Sequencepck-F 114ttggctaagg agcagtgaaa tgcgcgtta
2911525DNAArtificial Sequencepck-R 115cacgacaaaa gaagggtaaa taaac
2511620DNAArtificial Sequencepck-2 116ttgttaacgc gcatttcact
2011720DNAArtificial Sequencepck-3 117gcgatagcgg ctactgtcat
2011820DNAArtificial Sequencecra-up 118gcggtaagct tgatgcattt
2011920DNAArtificial Sequencecra-down 119cttccccggt taacagtcct
2012020DNAArtificial SequenceptsHI-up1 120tcatcgggtg agcgttattt
2012120DNAArtificial SequenceptsHI-down1 121tgaccgtcca gcgtaatagc
2012220DNAArtificial SequenceptsHI-up2 122catcctgggc ctgaagatta
2012320DNAArtificial SequenceptsHI-down2 123agcaatacca tcaccaacga
2012420DNAArtificial Sequencecrr-up 124cccgcgcatt aagaagatta
2012520DNAArtificial Sequencecrr-down 125ctcatcagtg gcttgctgaa
2012620DNAArtificial SequenceptsG-up 126gaagaactgg cgcaggtaac
2012720DNAArtificial SequenceptsG-down 127aaggaaacgc cgttaatcct
2012820DNAArtificial SequencecyaA-up 128tcgccatcaa cttgtctttg
2012920DNAArtificial SequencecyaA-down 129aaaggcgatg agtggatttg
2013020DNAArtificial Sequencecrp-S-up 130tgagttgccg tccattaaaa
2013120DNAArtificial Sequencecrp-S-down 131aatcgtaatt
cgccaagcat
2013220DNAArtificial SequencecpdA-S-up 132gaagtgtgtt caagccagca
2013320DNAArtificial SequencecpdA-S-down 133aggacaatgg attccagcag
2013420DNAArtificial SequenceygiF-S-up 134atcagtgtcg ctacgcaaag
2013520DNAArtificial SequenceygiF-S-down 135gctgtcctgc acaaaatcac
2013620DNAArtificial Sequencesxy-S-up 136tttacttgct gcggatgaga
2013720DNAArtificial Sequencesxy-S-down 137tatctcagcc ctcggtgctc
2013820DNAArtificial SequencecsrA-up 138cagcgttagc cagtgtgaaa
2013920DNAArtificial SequencecsrA-down 139acgcctctta cgagtgcttc
2014020DNAArtificial SequencecsrB-S-up 140ctgtaggaga tcgccaggaa
2014120DNAArtificial SequencecsrB-S-down 141tctaacaaat cgtgcattcg
2014220DNAArtificial SequencecsrC-S-up 142gccatacgct ttgtgagaca
2014320DNAArtificial SequencecsrC-S-down 143agtcacgccc aatggaatag
2014420DNAArtificial SequencecsrD-S-up1 144atgtgcatga tggattggaa
2014520DNAArtificial SequencecsrD-S-down1 145cggtatcctg accactacgc
2014620DNAArtificial SequencecsrD-S-up2 146gtgattttgc tgcgctgtta
2014720DNAArtificial SequencecsrD-S-down2 147acaaggcgca aaaatcatct
2014820DNAArtificial SequenceuvrY-s-up1 148cctcgtcatg ttgcaatgaa
2014920DNAArtificial SequenceuvrY-s-down1 149tatcatcgcg tagcaaaacg
2015020DNAArtificial SequencebarA-s-up1 150ttttgcttcg ctgctgtaaa
2015120DNAArtificial SequencebarA-s-down1 151tcaggcacgt cgcttttaat
2015220DNAArtificial SequencebarA-s-up2 152cgcgatcacc tgaatacgat
2015320DNAArtificial SequencebarA-s-down2 153ctggctggac gttcgataac
2015420DNAArtificial SequencebarA-s-up3 154tggcctatgt cgaaccaaac
2015520DNAArtificial Sequencemlc-s-up1 155ctggcaaata acccgaatgt
2015620DNAArtificial Sequencemlc-s-down1 156ccagggcatc tttattacgc
2015720DNAArtificial Sequencemlc-s-up2 157tgaaactgaa gcctggcact
2015820DNAArtificial SequenceXZ-ldhA-up 158gataacggag atcgggaatg
2015920DNAArtificial SequenceXZ-ldhA-down 159ctttggctgt cagttcacca
2016020DNAArtificial SequenceXZ-ldhA-1 160tctggaaaaa ggcgaaacct
2016121DNAArtificial SequenceXZ-ldhA-2 161tttgtgctat aaacggcgag t
2116222DNAArtificial SequencePflB-up2 162tgtccgagct taatgaaaag tt
2216322DNAArtificial SequencePflB-down2 163cgagtaataa cgtcctgctg ct
2216420DNAArtificial SequencePflB-5 164aaacgggtaa caccccagac
2016520DNAArtificial SequencePflB-6 165cggagtgtaa acgtcgaaca
2016621DNAArtificial SequenceadhE-up 166catgctaatg tagccaccaa a
2116720DNAArtificial SequenceadhE-down 167ttgcaccacc atccagataa
2016820DNAArtificial SequenceadhE-1 168tccggctaaa gctgagaaaa
2016920DNAArtificial SequenceadhE-2 169gtgcgttaag ttcagcgaca
2017020DNAArtificial Sequencepck-Pro-up 170cacggtagca acaacattgc
2017120DNAArtificial Sequencepck-Pro-down 171agaaagcgtc gacaacgaac
2017220DNAArtificial Sequencepck-Pro-1 172atgcgcgtta acaatggttt
2017320DNAArtificial Sequencepck-Pro-2 173atggataacg ttgaactttc
2017420DNAArtificial Sequencepck-P-2 174ttcactgctc cttagccaat
2017520DNAArtificial SequenceptsI-D-up 175cgcattatgt tcccgatgat
2017620DNAArtificial SequenceptsI-D-down 176gcctttcagt tcaacggtgt
2017720DNAArtificial SequenceptsI-D-1 177cggcccaatt tactgcttag
2017820DNAArtificial SequenceptsI-D-2 178atccccagca acagaagtgt
2017920DNAArtificial SequenceptsG-up 179gaagaactgg cgcaggtaac
2018020DNAArtificial SequenceptsG-down 180aaggaaacgc cgttaatcct
2018120DNAArtificial SequenceptsG-1 181cctgaaaacc gagatggatg
2018220DNAArtificial SequenceptsG-2 182catcagcgat ttaccgacct
2018365DNAArtificial SequenceptsH-D-up 183atgttccagc aagaagttac
cattaccgct ccgaacggtc tgcacgtgta ggctggagct 60gcttc
6518465DNAArtificial SequenceptsH-D-down 184ttactcgagt tccgccatca
gtttaaccag atgttcaacc gctttcatat gaatatcctc 60cttag
6518565DNAArtificial SequenceptsI-D-up 185atgatttcag gcattttagc
atccccgggt atcgctttcg gtaaagtgta ggctggagct 60gcttc
6518665DNAArtificial SequenceptsI-D-down 186ttagcagatt gttttttctt
caatgaactt gttaaccagc gtcatcatat gaatatcctc 60cttag
6518720DNAArtificial SequencegldA-up 187tgtatatagc gccgcacaag
2018820DNAArtificial SequencegldA-down 188gatggcaagg ttggtattgg
2018920DNAArtificial SequencegldA-1 189accagtacgg tcagcgtttc
2019020DNAArtificial SequencegldA-2 190acccggtgat tgaataatgc
2019164DNAArtificial SequencedhaKL-D-up 191atgaaaaaat tgatcaatga
tgtgcaagac gtactggacg aacaatgtag gctggagctg 60cttc
6419265DNAArtificial SequencedhaKL-D-down 192ttactctttt gcggctaacg
ccaacatttg catcataaac atcaccatat gaatatcctc 60cttag
6519364DNAArtificial SequencedhaM-D-up 193gtgatggtaa acctggtcat
agtttcacat agcagccgac tgggatgtag gctggagctg 60cttc
6419464DNAArtificial SequencedhaM-D-down 194ttaaccctga cggttgaaac
gttgcgtttt aacgtccagc gttagatatg aatatcctcc 60ttag 64
* * * * *