U.S. patent application number 13/206301 was filed with the patent office on 2012-03-08 for process for the preparation of a composition of genetically modified hematopoietic progenitor cells.
This patent application is currently assigned to Johnson & Johnson Research Pty, Limited. Invention is credited to Rafael Amado, Greg Fanning, Wayne Gerlach, Janet Macpherson, Lun-Quan Sun, Geoffrey P. Symonds.
Application Number | 20120058092 13/206301 |
Document ID | / |
Family ID | 43880335 |
Filed Date | 2012-03-08 |
United States Patent
Application |
20120058092 |
Kind Code |
A1 |
Symonds; Geoffrey P. ; et
al. |
March 8, 2012 |
PROCESS FOR THE PREPARATION OF A COMPOSITION OF GENETICALLY
MODIFIED HEMATOPOIETIC PROGENITOR CELLS
Abstract
Described are compositions and methods relating to gene therapy,
particularly as applied to hematopoietic progenitor (HP) cells, to
transduced cells and methods of obtaining them, and to methods of
using them to provide prolonged engraftment of modified
hematopoietic cells in human subjects. The invention particularly
relates to ex vivo gene therapy of HP cells for treatment or
prevention of HIV infection.
Inventors: |
Symonds; Geoffrey P.; (Rose
Bay, AU) ; Amado; Rafael; (Westlake Village, CA)
; Sun; Lun-Quan; (Eastwood, AU) ; Macpherson;
Janet; (Leichherdt, AU) ; Fanning; Greg;
(Surry Hills, AU) ; Gerlach; Wayne; (East Killara,
AU) |
Assignee: |
Johnson & Johnson Research Pty,
Limited
|
Family ID: |
43880335 |
Appl. No.: |
13/206301 |
Filed: |
August 9, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10483347 |
Nov 5, 2004 |
7994144 |
|
|
PCT/US2002/021907 |
Jul 10, 2002 |
|
|
|
13206301 |
|
|
|
|
60304127 |
Jul 10, 2001 |
|
|
|
60304283 |
Jul 10, 2001 |
|
|
|
60343484 |
Dec 21, 2001 |
|
|
|
60386063 |
Jun 4, 2002 |
|
|
|
Current U.S.
Class: |
424/93.21 |
Current CPC
Class: |
A61P 31/18 20180101;
A61K 38/00 20130101; C12N 2310/14 20130101; A61K 2035/124 20130101;
C12N 15/1132 20130101; C12N 2310/121 20130101; A61K 48/00 20130101;
C12N 2310/111 20130101 |
Class at
Publication: |
424/93.21 |
International
Class: |
A61K 48/00 20060101
A61K048/00; A61P 31/18 20060101 A61P031/18 |
Claims
1. A composition comprising a pharmaceutically acceptable carrier
and at least 1.63.times.10.sup.6 CD34.sup.+ hematopoietic cells per
kg of body weight of a human subject to whom the composition is to
be administered, at least 0.52.times.10.sup.6 of such CD34.sup.+
hematopoietic cells being transduced with a viral construct which
expresses an anti-HIV agent.
2. The composition of claim 1, comprising at least
9.37.times.10.sup.6 CD34.sup.+ hematopoietic cells per kg of body
weight of a human subject, wherein at least 5.times.10.sup.6 of
such CD34.sup.+ hematopoietic cells are transduced.
3. The composition of claim 1, wherein the anti-HIV agent is an
RNA.
4. The composition of claim 1, wherein the anti-HIV agent is an
RNAi molecule.
5. The composition of claim 1, wherein the anti-HIV agent is an
antisense molecule.
6. The composition of claim 1, wherein the anti-HIV agent is a
ribozyme.
7. The composition of claim 1, wherein the anti-HIV agent is a
ribozyme comprising nucleotides having the sequence 5'-UUA GGA UCC
UGA UGA GUC CGU GAG GAC GAA ACU GGC UCC-3'.
8. The composition of claim 1, wherein the viral construct is a
retroviral construct.
9. The composition of claim 1, wherein the composition is
substantially free of cytokines.
10. The composition of claim 1, wherein the composition is
substantially free of virus.
11. The composition of claim 1, wherein the transduced CD34.sup.+
cells are capable of engraftment, and of giving rise to progeny
cells for at least 12 months, in the subject.
12. A composition comprising a pharmaceutically acceptable carrier
and at least 1.63.times.10.sup.6 CD34.sup.+ hematopoietic cells per
kg of body weight of the subject to whom the composition is to be
administered, at least 0.52.times.10.sup.6 of such CD34.sup.+
hematopoietic cells being transduced with a viral construct which
expresses an anti-HIV agent, wherein the composition is produced by
a process comprising the steps of: (a) isolating CD34.sup.+
hematopoietic cells from the subject; (b) culturing the CD34.sup.+
hematopoietic cells with at least one cytokine; (c) transducing the
CD34.sup.+ hematopoietic cells with the viral construct which
expresses the anti-HIV agent in the presence of an agent which
enhances colocalization of the cells and the viral construct; (d)
washing the CD34.sup.+ hematopoietic cells, and (e) mixing the
CD34.sup.+ hematopoietic cells with a pharmaceutically acceptable
carrier, to thereby obtain the composition.
13. The composition of claim 12, wherein the culturing of step (b)
is performed in the presence of at least two cytokines.
14. The composition of claim 12, wherein the culturing of step (b)
is performed in the presence of two cytokines.
15. The composition of claim 12, wherein the transduction of the
cells in step (c) is performed in the presence of a recombinant
fibronectin fragment.
16. A composition comprising a pharmaceutically acceptable carrier
and at least 1.63.times.10.sup.6 CD34.sup.+ hematopoietic cells per
kg of body weight of the human subject to whom the composition is
to be administered, at least 0.52.times.10.sup.6 CD34.sup.+ of such
CD34.sup.+ hematopoietic cells being transformed with a gene of
interest not found in the CD34.sup.+ cells prior to
transformation.
17. The composition of claim 16, comprising at least
9.times.10.sup.6 CD34.sup.+ hematopoietic cells per kg of body
weight of a human subject, wherein at least 5.times.10.sup.6
CD34.sup.+ hematopoietic cells are transduced.
18. The composition of claim 16, wherein the gene of interest
expresses an RNA agent.
19. The composition of claim 16, wherein the subject is an
adult.
20-42. (canceled)
Description
[0001] This application claims benefit of U.S. Provisional
Application No. 60/304,127, filed Jul. 10, 2001, U.S. Provisional
Application No. 60/304,283, Jul. 10, 2001, U.S. Provisional
Application No. 60/343,484, filed Dec. 21, 2001, and U.S.
Provisional Application No. 60/386,063, filed Jun. 4, 2002, the
contents of all of which are hereby incorporated by reference.
[0002] Throughout this application various publications are
referenced in parenthesis. Full citations for these publications
may be found listed alphabetically at the end of the specification
immediately preceding the claims. The disclosures of these
publications in their entireties are hereby incorporated by
reference into this application in order to more fully describe the
state of the art to which this invention pertains.
FIELD OF THE INVENTION
[0003] The present invention relates to gene therapy, particularly
as applied to hematopoietic progenitor (HP) cells, to transduced
cells and methods of obtaining them, and to methods of using.
BACKGROUND OF THE INVENTION
[0004] Gene therapy refers to the use of genetic sequences and
their introduction into cells to alter the genetic makeup of the
cells and thereby change the properties or functioning of those
cells. Gene therapy may be used, for example, to correct a genetic
defect by providing to the cells a good copy of a gene that
functions as desired, or to provide a gene that encodes an RNA or
protein that inhibits an undesired cellular or pathogen
activity.
[0005] Gene therapy may be aimed at any of a variety of diseases in
which there is a genetic aspect. Of particular interest are
diseases of the blood or immune systems since the hematopoietic
cells are relatively easy to collect from a subject, allowing for
ex vivo procedures to be used. These include hemoglobinopathies,
defects of leukocyte production or function, immune deficiencies,
lysosomal storage diseases and stem cell defects such as Fanconi's
anemia, chronic granulomatous disease, Gaucher's disease, G6PD
deficiency etc. Many of these disorders have been successfully
treated by allogeneic bone marrow cell transplants (Parkman 1986).
However, the requirement for immune suppression or the occurrence
of immunologic effects such as graft rejection are a disadvantage
of allogeneic bone marrow transplantation. Gene therapy of
hematopoietic stem cells has been suggested as an alternative means
of treating disease affecting the hematopoietic system in
humans.
[0006] Despite early promise of success in gene therapy in humans,
clinical success has been very difficult to achieve despite a
massive effort in the last decade (Mountain, 2000). This is due at
least in part to low efficiencies of gene transfer, an inability to
modify enough cells, an inability to target appropriate cell types,
and a lack of persistence of the desired effect in human
subjects.
[0007] Gene therapy of human hematopoietic stem (HS) cells has
proven to be difficult to carry out in practice (Kohn et al 1998,
Halene and Kohn 2000, Kume et al 1999). In most trials in humans,
the level of gene-containing peripheral blood leukocytes has been
low and these have been short-lived, suggesting a failure to
transduce reconstituting HS cells (Bordignon et al 1995, Kohn 1995,
Kohn et al 1998, Dunbar et al 1995, Hoogerbrugge et al 1996). This
is related in part to the relatively few HS and hematopoietic
progenitor (HP) cells in the body (Bertolini et al 1998, Reis 1999)
and the requirement that the cells be activated when using some
murine retroviral vectors for transduction. This is related to the
low level of amphotropic receptors in quiescent human HS cells
(Bodine et al 1998). Most human HS cells are quiescent, are
relatively slow to respond to stimulation (Hao et al 1996, Gothot
et al 1998) and when induced to divide, tend to lose long term
repopulating capacity (Traycoff et al 1998). Almost all gene
therapy attempts in humans using HS cells have up to now suffered
from these two basic problems: insufficient numbers of HS cells
that are totipotent and capable of long term engraftment have been
transduced in order to have a therapeutic effect, and, secondly,
the transduced cells have not persisted to provide modified
hematopoietic cells long term.
[0008] The most promising trial of gene therapy into human HP cells
involved the transfer of a gene into children with X-linked severe
combined immunodeficiency (SCID) which led to the reconstitution of
an immune system with gene-containing T-lymphocytes
(Cavazzana-Calvo et al 2000; Hacein-Bey-Abina et al 2002). That
trial used CD34.sup.+ cells from bone marrow of pediatric patients
(<12 months) and delivered more than 10.sup.6 transduced cells
per kg. The number of CD34.sup.+ cells (per kg weight) that can be
isolated from children, particularly of low weight, is much higher
than in adults. Thymopoiesis is also more active in children.
Furthermore, this study is unusual in that thymopoiesis in the
SCID-X1 context results only from CD34.sup.+ cells that contain the
exogenous gene (Cavazzana-Calvo et al 2001). In some ways, this
study is analogous to those where myeloablation is carried out in
that the infused cells can fill the physiological space that is
unoccupied in the SCID patient. Early studies with allogeneic bone
marrow transplantation showed that HS cell engraftment was not
sustained in patients that were not myeloablated, primarily because
of the continued presence of the recipient HS cells (Parkman 1986).
Therefore, conclusions drawn from prior engraftment studies using
human HS cells in an ablative context cannot be simply transferred
to the non-ablative system.
[0009] Other reports of human clinical trials for gene therapy of
hematopoietic progenitor cells are less positive. Kohn et al 1999
reported results of a clinical trial using bone-marrow derived
CD34.sup.+ cells from pediatric patients (8-17 yrs) transduced with
a gene encoding an RRE decoy (RNA molecule) against HIV. This trial
failed to achieve significant transduction and engraftment of
progenitor cells. In another trial, patients with breast or ovarian
cancer were treated with HP cells after transduction with a marker
gene, after myeloablation, but only transient presence of marked
cells was observed (Bagnis et al 2002). A clinical trial including
three patients with Gaucher disease showed presence of the
gene-containing vector in peripheral blood and bone marrow up to 3
months post-infusion but at very low levels (Dunbar et al 1998). In
another example, a trial with five patients suffering from Chronic
Granulomatous Disease (CGD) was carried out whereby the p47phox
gene was introduced into CD34.sup.+ cells from peripheral blood.
Although corrected neutrophils were found in peripheral blood
during the first few months after infusion, they were undetectable
at 6 months post-infusion (Malech et al 1997). Further, a trial to
correct Fanconi Anemia where the complementation group C gene was
inserted into CD34.sup.+ cells resulted in only transient detection
of the gene in the patients post-infusion (Liu et al 1999).
[0010] The poor results in these trials may reflect the lack of a
survival advantage of the corrected cells compared to the
uncorrected cells, in contrast to the X-linked SCID case.
Furthermore, in most of these examples, the manipulated cell
populations were administered to patients with no or partial
myeloablation, requiring that the transduced cells compete with the
resident stem cells to engraft.
[0011] Other factors may be operating as well. HS cells can be
reduced in number in patients with HIV infection (Marandin et al
1996), making it more difficult to obtain sufficient numbers of
such cells. Moreover, HS cells of HIV-infected individuals are
compromised in their replication and clonogenic capacities and show
an enhanced propensity to apoptosis (Vignoli et al 1998, Zauli et
al 1996). Mobilization of peripheral blood HP cells using
granulocyte colony-stimulating factor (G-CSF) was demonstrated in
HIV-infected individuals (Law et al 1999). Maximal mobilization was
achieved after 4 days of G-CSF administration. The leukapheresis
product contained approximately 3.times.10.sup.6 CD34.sup.+ cells
per kg. Law et al did not transduce the isolated CD34.sup.+ cells
nor show that the isolated CD34.sup.+ cells were capable of
engrafting a subject long term. They merely speculate that gene
therapy of HP cells might provide a cure for HIV infection. They
also comment that discussion of the number of stem cells required
for gene therapy of AIDS is premature because of many
uncertainties, including the engraftment potential of the
genetically modified cells, the need for chemotherapy, the need for
myeloablation or not, the requirement to establish a niche for the
infused cells, and the unknown response of the microenvironment in
the marrow of AIDS patients after infusion of cells.
[0012] The minimum number of CD34.sup.+ cells from peripheral blood
required for efficient restoration of the hematopoietic system,
particularly platelet recovery, in the context of myeloablation has
been suggested to be 2.0.times.10.sup.6 cells per kg of weight of a
subject (Zimmerman 1995). However, the number required for
efficient engraftment when not performing myeloablation was unknown
prior to this invention. It was unknown whether a "niche" had to be
established for the infused cells, or the effect of competing,
resident cells in the marrow. As mentioned above, this was
particularly true in the context of HIV infection.
[0013] Many studies have used model animal systems, particularly in
mice, to improve the methods for transduction and increase
engraftment. However, although murine HS cells can be efficiently
transduced with retroviral vectors, efforts to translate findings
from the murine system to applications for human HS cells have
revealed major difficulties (Helene and Kohn 2000; Richter and
Karlson 2001).
[0014] A further difficulty for therapeutic application of gene
therapy is in scaling up procedures to obtain sufficient transduced
cell numbers (Schilz et al, 2000). Schilz et al measured
transduction efficiency and engraftment in a mouse model, but it is
unclear how the conclusions might apply to human subjects.
[0015] Each of these factors is addressed by the present
invention.
SUMMARY OF THE INVENTION
[0016] This invention provides a composition suitable for
administration to a human subject comprising a pharmaceutically
acceptable carrier and at least 1.63.times.10.sup.6 CD34.sup.+
hematopoietic cells per kg of body weight of the human subject to
whom the composition is to be administered, at least
0.52.times.10.sup.6 of such CD34.sup.+ hematopoietic cells being
transduced by a viral construct which expresses an anti-HIV
agent.
[0017] This invention also provides a method of inserting into
hematopoietic cells of a human subject a gene of interest
comprising: [0018] a) mobilizing CD34.sup.+ hematopoietic
progenitor cells into the blood of the human subject; [0019] b)
isolating leukocytes from the subject by apheresis; [0020] c)
isolating CD34.sup.+ hematopoietic cells from the isolated
leukocytes by an immunoselective method; [0021] d) subjecting the
CD34.sup.+ hematopoietic cells of step c) to a transduction process
with a gene of interest in the presence of an agent that
colocalizes the cells with a transduction vector; [0022] e)
determining the total number of CD34.sup.+ hematopoietic cells
after step d), and if the total number is at least
1.63.times.10.sup.6 cells per kg of body weight of the human
subject, then proceeding to step f), and if the total number of
CD34.sup.+ hematopoietic cells after step d) is less than
1.63.times.10.sup.6 cells per kg of body weight of the human
subject, then performing at least steps b)-d) and combining the
CD34.sup.+ hematopoietic cells; and [0023] f) delivering to the
subject the CD34.sup.+ hematopoietic cells, [0024] thereby
inserting into hematopoietic cells of the human subject a gene of
interest.
[0025] This invention further provides a use of the composition
comprising a pharmaceutically acceptable carrier and at least
1.63.times.10.sup.6 CD34.sup.+ hematopoietic cells per kg of body
weight of a human subject to whom the composition is to be
administered, at least 0.52.times.10.sup.6 CD34.sup.+ of such cells
per kg being transduced with a viral construct which expresses an
anti-HIV agent, for the manufacture of a medicament for the
treatment of the human subject infected with HIV.
[0026] This invention yet further provides a kit comprising [0027]
a) an amount of an agent capable of mobilizing hematopoietic
progenitor cells in a human subject; [0028] b) a culture medium
including at least one cytokine acceptable for culturing CD34.sup.+
hematopoietic cells; [0029] c) a retroviral vector comprising
nucleotides having a sequence that in a cell gives rise to a
ribozyme having the sequence 5'-UUA GGA UCC UGA UGA GUC CGU GAG GAC
GAA ACU GGC UCC-3' (Rz2); and [0030] d) tissue culture vessels
coated on their inside with a recombinant fibronectin fragment. A
package comprising the kit and instructions for its use is also
provided by this ideation.
BRIEF DESCRIPTION
[0031] FIG. 1 (A). Replication cycle of a typical retrovirus.
[0032] (A) Virus binds to cell surface receptors on the target cell
and the genomic RNA enters the target cell following fusion and
viral uncoating.
[0033] (B) Reverse transcription occurs resulting in the conversion
of viral RNA into cDNA.
[0034] (C) cDNA enters the nucleus and is converted into a circular
form.
[0035] (D) The cDNA then becomes integrated into the host cell
genome.
[0036] (E) Transcription of the provirus to produce viral RNA and
mRNA.
[0037] (F) Translation produces viral proteins.
[0038] (G) The viral core is formed from the virally encoded
proteins and viral RNA packaged.
[0039] (H) The core obtains a membrane and exits the cell by
budding through the cell membrane.
[0040] FIG. 1 (B). Proposed mode of action of invention. The
ribozyme can act at any of several points in the life cycle of the
HIV-1 virus. It can cleave the genomic RNA after uncoating and
before reverse transcription, or it can cleave viral transcripts in
the nucleus or cytoplasm to inhibit translation of viral proteins,
or it can cleave newly-formed genomic RNA prior to or during
assembly.
[0041] FIG. 2. Scientific rationale for use of ribozyme gene
transfer to treat HIV/AIDS. A. Normal CD34.sup.+ hematopoietic
progenitor cells give rise to lymphocytes and monocytes/macrophages
that can be infected by HIV-1 and these infected cells generate
HIV-1 particles before dying. B. CD34.sup.+ hematopoietic
progenitor cells transduced with the ribozyme gene give rise to
lymphocytes and monocytes/macrophages that express the ribozyme
gene. The therapeutic ribozyme cleaves HIV-1 RNA and inhibits HIV-1
replication in these two key cell types.
[0042] FIG. 3. Schematic of hematopoiesis. The CD34.sup.+
hematopoietic progenitor cells give rise to cells of increasing
maturity through intermediate progenitor cells. Key cells in terms
of HIV/AIDS infection are CD34.sup.+ T-lymphocytes and the
monocytes/macrophages (asterisked). All of the cells shown
schematically are hematopoietic cells.
[0043] FIG. 4. Location of Rz2 target site. A: Schematic of HIV-1
genome showing location of replicative, regulatory and accessory
genes. B: Ribozyme sequence together with the complementary target
and hybridizing sequence within the tat gene. Cleavage occurs
immediately 3' of the triplet GUA. C: Location of the GUA target
sequence in the genes encoding Tat and Vpr proteins.
[0044] FIG. 5. Schematic Representation of CD34.sup.+ Phase I
Clinical Trial. Ten subjects with HIV-1 infection were enrolled.
The LNL6 and RRz2 vector were separately introduced into autologous
CD34.sup.+ hematopoietic cells. Both populations of cells were
infused into the patients without myeloablative treatment.
[0045] FIG. 6. Effect of retronectin on transduction. This shows
schematically how retronectin facilitates retroviral transduction
by bringing the CD34.sup.+ cells into close proximity to the
retroviral vector.
[0046] FIG. 7. Long-term vector presence and expression.
Semi-quantitative PCR analysis was performed in leukocyte subsets
using primers directed against the nee gene that overlap the Rz2
sequence in the RRz2 vector. PCR products for LNL6 and RRz2 are 174
and 216 base pairs respectively, and include a tract of the
untranslated terminus of the neo.sup.R gene. Graph A shows LNL6 and
RRz2 vector sequences in peripheral blood mononuclear cells (PBMC),
bone marrow mononuclear cells (BMMC), T-lymphocytes and monocytes
in patient 5 two years after infusion of transduced CD34.sup.+
cells. Graph B shows short- and long-term expression of both LNL6
and RRz2 in PBMC in 3 representative patients, as measured by
RT-PCR. Expression was assessed in a reverse-transcriptase (RT+)
nested polymerase chain reaction using radiolabelled primer. For
each sample, a reaction that did not contain reverse-transcriptase
(-RT) was included. Graph C. Detection of vector sequences in naive
T-lymphocytes. Gel shows PCR analysis for LNL6 and RRz2 vector
sequences in CD34.sup.+ and CD8.sup.+ T-lymphocytes, and in naive
T-lymphocytes subsets selected from peripheral blood in patient 7
two years after infusion of transduced CD34.sup.+ cells. D, E and F
show detection of vector sequences in naive T-lymphocytes. Gel
shows PCR results for LNL6 and RRz2 vector sequences in CD34.sup.+
and CD8.sup.+ T-lymphocytes, and in naive T-lymphocytes subsets
selected from peripheral blood in 3 patients. Vector sequences were
detected in naive T-cell subsets as early as 4 weeks post-infusion
(panel F), and long-term detection is shown in panels E and D, at
2.5 and 2 years after infusion of transduced CD34.sup.+ cells
respectively.
[0047] FIG. 8. Summary of vector detection by PCR in 10 patients.
Cells were examined by PCR for LNL6 or RRz2 vector detection up to
36 months post-infusion. Cell types were bone marrow mononuclear
cells, peripheral blood mononuclear cells (PBMC), granulocytes,
T-lymphocytes and monocytes as indicated. Data are shown for each
patient as labeled in the Y-axis. Longer-term gene marking was
observed after the use of the fibronectin fragment (CH-296), which
resulted in an increase in transduction efficiency (see table 1).
The presence or absence of vector detection is indicated by
circles, without regards to vector copy number: black, both vectors
detected; open, neither vector detected; circle with vertical
stripe, ribozyme vector only detected; circle with horizontal
stripe, LNL6 control vector only detected.
[0048] FIG. 9. Comparison between the kinetics of vector decay in
T-lymphocytes and bone marrow mononuclear cells. Comparison of rate
of decay of vector copies across T-lymphocytes and bone marrow
mononuclear cells (BMMC) shows increased persistence of RRz2
marking in T-lymphocytes compared to that of LNL6 (A). LNL6 marking
is shown in (W. Plots show vector marking level represented as
percent of baseline, where baseline is defined as the average of
vector copy numbers at weeks 4 and 12 for each cell type (red
diamond and line: T-lymphocytes, open squares and black line:
BMMC). (C) and (D) show the plots depicting the linear relationship
between RRz2-transduced CD34.sup.+ cell dose, and difference
between LNL6 and RRz2 copy number (protection index) in
T-lymphocytes (C) and PBMC (D), (E), (F), (G) and (H) show the
comparison between the kinetics of vector decay in T-lymphocytes
and bone marrow mononuclear cells, and correlation with
transduced-CD34.sup.+ cell dose infused. Ribozyme-induced
protection against HIV-related cell depletion was assessed by
comparing the decay of RRz2 and LNL6 vector DNA in cells vulnerable
and nonvulnerable to HIV infection. Panel E shows detection of RRz2
and LNL6 vectors by PCR in CD4.sup.+ T-lymphocytes for patient 7 at
the time points indicated. Radioactivity volumes for each band were
normalized to known standards run in the same PCR reaction (not
shown), and the ratio of RRz2 to LNL6 (values shown under each gel)
was plotted against time (panel F). As a negative control for RRz2
protection, the plot of BMMC (which contain mostly cells
invulnerable to HIV infection) is shown in panel F (PCR gels not
shown). Trends over time in the ratio of RRz2 marking to LNL6
marking were estimated by linear regression, with P values
reflecting the difference from a change rate of 0 (expected if RRz2
and LNL6 marking decay at equivalent rates). In this patient, the
ratio of RRz2 to LNL6 marking in BMMC remained approximately
constant over time (slope=-0.0005, difference from 0, P=0.281). In
contrast, RRz2 marking increased relative to LNL6 marking over time
in HIV-vulnerable T lymphocytes (slope-0.0036, difference from 0,
P=0.008). The difference between trend lines was statistically
significant (P<0.0006). To determine whether the magnitude of
differential decay in LNL6 vs. RRz2 gene marking for a given
patient was related to the number of RRz2-transduced cells infused,
the difference between decay slopes of each vector for was
correlated (spearman rank) with the number of RRz2-transduced
CD34.sup.+ cells reintroduced. Patient-specific decay slopes for
LNL6 and RRz2 marking were calculated by linear regression, and the
difference between these slopes (RRz2-LNL6) was taken as an
indicator of RRz2-mediated protection. Panels G and H show the
plots depicting this linear relationship and confidence intervals
(dotted lines) between RRz2-transduced CD34.sup.+ cell dose, and
difference between LNL6 and RRz2 copy number (protection index) in
T-lymphocytes (plot H) and PBMC (plot G).
[0049] FIG. 10. Absolute CD34.sup.+ cell counts (A) and viral loads
(B) in study patients. Absolute CD4.sup.+ cell counts per mm.sup.3
(A) and in viral loads (B) in HIV RNA copies per ml of blood are
shown for patient Nos. 1-10 through the study. An initial increase
in viral load was observed at day 1 post-infusion in some patients
who discontinued antiretroviral therapy during the period of
mobilization. Drug discontinuation or substitution of nucleoside
reverse transcriptase inhibitors for non-nucleoside reverse
transcriptase inhibitor or protease inhibitor was included in the
protocol to prevent potential inhibition of MMLV reverse
transcriptase during transduction. Occasional rises in viremia were
corrected after modification of antiretroviral therapy.
[0050] FIG. 11. Long-term marking of hematopoietic cell populations
in Patient #005 from the Phase I Autologous CD34.sup.+ study. Shown
in the gel are PCR amplified bands from LNL6 and RRz2 marked cells
in bone marrow and peripheral blood populations 2 years
post-infusion.
[0051] FIG. 12. Gene Expression in Peripheral Blood Mononuclear
Cells in 4 patients from the Phase I autologous CD34.sup.+ cell
study. Expression of both LNL6 and RRz2 is shown for 2 patients at
2 years post-infusion. Expression was assessed in a reverse
transcriptase-nested PCR reaction using radiolabelled primer. For
each sample, a reaction that did not contain RT (-RT) was included.
Presence or absence of RT is indicated.
[0052] FIG. 13. Long-term marking of T-lymphocyte (CD4.sup.+,
CD8.sup.+) sub-populations in Patient #007. Results show the
marking in naive and memory CD34.sup.+ and CD8.sup.+ lymphocytes 1
year post-infusion of the autologous LNL6 or RRz2 transduced
CD34.sup.+ cells.
[0053] FIG. 14. Schematic design of an RNAi with multiple-targeting
ability. The RNA transcript contains three RNAi units each
containing sense (1A, 2A, 3A) and antisense (1B, 2B, 3B) segments
separated by spacers (SP). The RNAi units are flanked by self
cleaving hammerhead and hairpin ribozymes, which cleave at the
positions indicated by arrows.
DETAILED DESCRIPTION OF THE INVENTION
[0054] This invention provides a composition comprising a
pharmaceutically acceptable carrier and at least
1.63.times.10.sup.6 CD34.sup.+ hematopoietic cells per kg of body
weight of the human subject to whom the composition is to be
administered, at least 0.52.times.10.sup.6 of such CD34.sup.+
hematopoietic cells being transduced with a viral construct which
expresses an anti-HIV agent. Alternatively, the composition
comprises at least about 1.7.times..sup.106 CD34.sup.+
hematopoietic cells per kg, at least about 0.5.times.10.sup.6 of
such cells per kg being transduced with the viral construct. The
composition is suitable for administration to a human subject. The
human subject may be an adult.
[0055] The viral construct may be a retroviral construct. The
composition may also be substantially free of cytokines, or
substantially free of virus.
[0056] This invention also provides a composition where at least
5.times.10.sup.6 CD34.sup.+ hematopoietic cells per kg of body
weight of a human subject to whom the composition is to be
administered are transduced; or comprising at least
9.37.times.10.sup.6 CD34.sup.+ hematopoietic cells per kg of body
weight of a human subject, wherein at least 5.times.10.sup.6 of
such CD34.sup.+ hematopoietic cells are transduced; or comprising
at least about 10.times.10.sup.6 CD34.sup.+ hematopoietic cells per
kg of body weight where at least 5.times.10.sup.6 such cells are
transduced; or where the anti-HIV agent is an RNA molecule; or
where the anti-HIV agent is an RNAi molecule; or where the anti-HIV
agent is an antisense molecule; or where the anti-HIV agent is a
ribozyme. The ribozyme may comprise nucleotides having the sequence
5'-UUA GGA UCC UGA UGA GUC CGU GAG GAC GAA ACU GGC UCC-3'
(Rz2).
[0057] In the composition, the transduced CD34.sup.+ cells are
capable of engraftment, and of giving rise to progeny cells for at
least 12 months, in the subject. The cells may be in a primary cell
culture.
[0058] Also disclosed is a composition comprising a
pharmaceutically acceptable carrier and at least
1.63.times.10.sup.6 CD34.sup.+ hematopoietic cells per kg of body
weight of the subject to whom the composition is to be
administered, at least 0.52.times.10.sup.6 of such CD34.sup.+
hematopoietic cells being transduced with a viral construct which
expresses an anti-HIV agent,
[0059] wherein the composition is produced by a process comprising
the steps of:
[0060] (a) isolating CD34.sup.+ hematopoietic cells from the
subject;
[0061] (b) culturing the CD34.sup.+ hematopoietic cells with at
least one cytokine;
[0062] (c) transducing the CD34.sup.+ hematopoietic cells with the
viral construct which expresses the anti-HIV agent in the presence
of an agent which enhances colocalization of the cells and the
viral construct;
[0063] (d) washing the CD34.sup.+ hematopoietic cells, and
[0064] (e) mixing the CD34.sup.+ hematopoietic cells with a
pharmaceutically acceptable carrier, to thereby obtain the
composition. The composition is suitable for administration to a
human subject.
[0065] In the composition, the culturing of step (b) may be
performed in the presence of at least one cytokine, at least two
cytokines or only two cytokines. Step (c) may be performed in the
presence of a recombinant fibronectin fragment.
[0066] This invention also provides a composition comprising a
pharmaceutically acceptable carrier and at least
1.63.times.10.sup.6 CD34.sup.+ hematopoietic cells per kg of body
weight of the human subject to whom the composition is to be
administered, at least 0.52.times.10.sup.6 CD34.sup.+ of such
CD34.sup.+ hematopoietic cells being transformed with a gene of
interest not found in the CD34.sup.+ cells prior to transformation.
The composition is suitable for administration to a human subject.
In this composition, the numbers of cells can be as defined above.
The subject may be an adult. In this composition, the gene of
interest may express an RNA agent.
[0067] This invention yet also provides a composition comprising a
pharmaceutically acceptable carrier and at least
1.63.times.10.sup.6 CD34.sup.+ hematopoietic cells per kg of body
weight of a human subject to whom the composition is to be
administered, at least 0.52.times.10.sup.6 CD34.sup.+ of such
CD34.sup.+ hematopoietic cells being transformed with a gene of
interest not found in the CD34.sup.+ cells prior to
transformation,
[0068] wherein the composition is produced by a process comprising
the steps of: [0069] (a) isolating CD34.sup.+ hematopoietic cells
from the subject; [0070] (b) culturing the CD34.sup.+ hematopoietic
cells with at least one cytokine; [0071] (c) transforming the
CD34.sup.+ hematopoietic cells with a vector which encodes a gene
of interest in the presence of an agent which enhances
colocalization of the cells and the vector; [0072] (d) washing the
CD34.sup.+ hematopoietic cells, and [0073] (e) mixing the
CD34.sup.+ hematopoietic cells with a pharmaceutically acceptable
carrier, to thereby obtain the composition. The composition is
suitable for administration to a human subject. In this
composition, the numbers of cells can be as defined above. The
subject may be an adult. In this composition, the gene of interest
may express an RNA agent.
[0074] This invention further provides a method of inserting into
hematopoietic cells of a human subject a gene of interest
comprising: [0075] a) mobilizing CD34.sup.+ hematopoietic
progenitor cells into the blood of the human subject; [0076] b)
isolating leukocytes from the subject's blood by apheresis; [0077]
c) isolating CD34.sup.+ hematopoietic cells from the isolated
leukocytes by an immunoselective method; [0078] d) subjecting the
CD34.sup.+ hematopoietic cells of step c) to a transduction process
with a gene of interest in the presence of an agent that
colocalizes the cells with a transduction vector; [0079] e)
determining the total number of CD34.sup.+ hematopoietic cells
after step d), and if the total number is at least
1.63.times.10.sup.6 cells per kg of body weight of the human
subject, then proceeding to step f), and if the total number of
CD34.sup.+ hematopoietic cells after step d) is less than
1.63.times.10.sup.6 cells per kg of body weight of the human
subject, then performing at least steps b)-d) and combining the
CD34.sup.+ hematopoietic cells; and [0080] f) delivering to the
subject the CD34.sup.+ hematopoietic cells, [0081] thereby
inserting into hematopoietic cells of the human subject a gene of
interest. The human subject may be an adult.
[0082] In the method, the agent that colocalizes the cells with a
transduction vector may be a fragment of fibronectin.
[0083] In the method, step f) may be performed without
myeloablation. Step a) of mobilizing hematopoietic progenitor cells
in the subject may be performed by administering to the subject an
amount of a cytokine sufficient to mobilize the hematopoietic
progenitor cells. In the step of isolating the leukocytes from the
subject's blood, apheresis may be performed at least twice.
[0084] In the method, the step of subjecting the CD34.sup.+
hematopoietic cells to a transduction process with a gene of
interest is performed in the presence of a recombinant fibronectin
fragment, which may be recombinant fibronectin fragment CH-296.
[0085] In the method, the gene of interest may encode an anti-HIV
agent. The anti-HIV agent may be an RNA molecule; or an RNAi
molecule; or an antisense molecule; or a ribozyme. The ribozyme may
comprise nucleotides having the sequence 5'-UUA GGA UCC UGA UGA GUC
CGU GAG GAC GAA ACU GGC UCC-3' (Rz2).
[0086] In an embodiment of the method, in step e), if the total
number of CD34.sup.+ hematopoietic cells after step d) is less than
1.63.times.10.sup.6 cells per kg of body weight of the human
subject, then further including a step of cryogenically storing the
CD34.sup.+ hematopoietic cells from step d), repeating steps a)-d),
and combining any cryogenically stored cells with the cells from
step d). The specific number of cells to be obtained may be
increased as described above.
[0087] In the method, all or almost all of the CD34.sup.+
hematopoietic cells of step e) are delivered to the subject, for
example at least 90% of the total number.
[0088] The method may further comprise a step of culturing the
isolated CO34.sup.+ hematopoietic cells of step c) in the presence
of at least two cytokines or a cytokine mixture.
[0089] The cytokine mixture may comprise one or more cytokines
selected from the group consisting of stem cell factor (SCF),
megakaryocyte growth and development factor (MGDF), Flt-3 ligand
(FL, sometimes abbreviated Flt-3), interleukin 3 (IL-3),
granulocyte-macrophage colony stimulating factor (GM-CSF) and
thrombopoietin (TPO). The cytokine mixture may further comprise one
or more cytokines selected from the group consisting of interleukin
1 (IL-1), interleukin 4 (IL-4), interleukin 5 (IL-5), interleukin 6
(IL-6), interleukin 7 (IL-7), interleukin 9 (IL-9), interleukin 11
(IL-11), interleukin 12 (IL-12), interleukin 15 (IL-15),
granulocyte colony stimulating factor (G-CSF), macrophage colony
stimulating factor (M-CSF), erythropoietin (EPO), leukemia
inhibitory factor (LIF), transforming growth factor beta
(TGF-.beta.), macrophage inhibitory protein 1 (MIP-1), tumor
necrosis factor (TNF) and stromal cell-derived factor 1
(SDF-1).
[0090] In a further embodiment of the method, the cytokine mixture
comprises one cytokine selected from a first group and one cytokine
selected from a second group, wherein the first group consists of
SCF, MGDF, FL, IL-3, GM-CSF, TPO, IL-1, IL-4, IL-5, IL-6, IL-7,
IL-9, IL-11, IL-12, IL-15, G-CSF, M-CSF, EPO, LIF, TGF-.beta.,
MIP-1, TNF and SDF-1, and wherein the second group consists of
MGDF, FL, GM-CSF, TPO, IL-1, IL-4, IL-5, IL-7, IL-9, IL-11, IL-12,
IL-15, G-CSF, M-CSF, EPO, LIF, TGF-.beta., MIP-1, TNF and
SDF-1.
[0091] This invention further provides a method of inserting into
hematopoietic cells of a human subject a gene of interest
comprising: [0092] a) mobilizing CD34.sup.+ hematopoietic
progenitor cells into the blood of the subject; [0093] b) isolating
leukocytes from the subject's blood by apheresis; [0094] c)
isolating CD34.sup.+ hematopoietic cells from the isolated
leukocytes by an immunoselective method; [0095] d) determining the
total number of CD34.sup.+ hematopoietic cells after step c), and
if the total number is at least 1.63.times.10.sup.6 cells per kg of
body weight of the human subject, then proceeding to step e), and
if the total number of CD34.sup.+ hematopoietic cells after step c)
is less than 1.63.times.10.sup.6 cells per kg of body weight of the
human subject, then performing steps b)-c) and combining the
CD34.sup.+ hematopoietic cells; [0096] e) subjecting the CD34.sup.+
hematopoietic cells of step c) to a transduction process with a
gene of interest in the presence of an agent that colocalizes the
cells with a transduction vector; and [0097] f) delivering to the
subject the CD34.sup.+ hematopoietic cells, [0098] thereby
inserting into hematopoietic cells of the human subject a gene of
interest. The relevant specifics of this method may be varied as
discussed for the previous methods.
[0099] The invention further provides a method of inserting into
hematopoietic cells of a human subject a gene that expresses a
ribozyme comprising nucleotides having the sequence 5'-UUA GGA UCC
UGA UGA GUC CGU GAG GAC GAA ACU GGC UCC-3' (Rz2) comprising: [0100]
a) mobilizing CD34.sup.+ hematopoietic progenitor cells into the
blood of the subject by administering to the subject an amount of a
cytokine sufficient to mobilize the hematopoietic progenitor cells;
[0101] b) isolating leukocytes from the subject's blood by
apheresis, which is performed at least twice; [0102] c) isolating
CD34.sup.+ hematopoietic cells from the isolated leukocytes by an
immunoselective method; [0103] d) culturing the isolated CD34.sup.+
hematopoietic cells of step c) for about one day in a culture
medium in the presence of a cytokine; [0104] e) subjecting the
CD34.sup.+ hematopoietic cells of step d) to a transduction process
with a retrovirus comprising a vector that gives rise in the cell
to a ribozyme comprising nucleotides having the sequence 5'-UUA GGA
UCC UGA UGA GUC CGU GAG GAC GAA ACU GGC UCC-3' (Rz2) in the
presence of a recombinant fibronectin fragment; [0105] f)
determining the total number of CD34.sup.+ hematopoietic cells
after step e), and if the total number is at least
1.63.times.10.sup.6 cells per kg of body weight of the human
subject, then proceeding to step g), and if the total number of
CD34.sup.+ hematopoietic cells after step e) is less than
1.63.times.10.sup.6 cells per kg of body weight of the human
subject, then again performing steps b)-e) and combining the
CD34.sup.+ hematopoietic cells; and [0106] g) delivering to the
subject, without myeloablation, the CD34.sup.+ hematopoietic cells,
thereby inserting into hematopoietic cells of the human subject a
gene that expresses the ribozyme. The relevant specifics of this
method may be varied as discussed for the previous methods.
[0107] Also provided is a method of preparing the compositions
described above, comprising: [0108] a) mobilizing CD34.sup.+
hematopoietic cells into the blood of the subject; [0109] b)
isolating leukocytes from the subject's blood by apheresis; [0110]
c) isolating the CD34.sup.+ hematopoietic cells from the isolated
leukocytes by an immunoselective method; [0111] d) subjecting the
CD34.sup.+ hematopoietic cells of step c) to a transduction process
with a gene of interest in the presence of an agent that
colocalizes the cells with a transduction vector; and [0112] e)
determining the total number of CD34.sup.+ hematopoietic cells
after step d), and if the total number of CD34.sup.+ hematopoietic
cells after step d) is less than 1.63.times.10.sup.6 cells per kg
of body weight of the human subject, than again performing steps
b)-d) and combining the CD34.sup.+ hematopoietic cells.
[0113] Also provided is a use of a composition comprising a
pharmaceutically acceptable carrier and at least
1.63.times.10.sup.6 CD34.sup.+ hematopoietic cells per kg of body
weight of a human subject to whom the composition is to be
administered, at least 0.52.times.10.sup.6 CD34.sup.+ of such cells
per kg being transduced with a viral construct which expresses an
anti-HIV agent, for the manufacture of a medicament for the
treatment of the human subject infected with HIV.
[0114] Also provided is a kit comprising elements for use in
carrying out the described methods. A specific embodiment of a kit
comprises [0115] a) an amount of an agent capable of mobilizing
hematopoietic progenitor cells in a human subject; [0116] b) a
culture medium including at least one cytokine acceptable for
culturing CD34.sup.+ hematopoietic cells; [0117] c) a retroviral
vector comprising nucleotides having a sequence that in a cell
gives rise to a ribozyme having the sequence 5'-UUA GGA UCC UGA UGA
GUC CGU GAG GAC GAA ACU GGC UCC-3' (Rz2); and [0118] d) tissue
culture vessels coated on their inside with a recombinant
fibronectin fragment.
[0119] Yet further provided is a package comprising the described
kits and instructions for the use of the kits.
[0120] In a further embodiment of the described method, the total
combined time taken for the steps of culturing and transducing the
CD34.sup.+ hematopoietic cells is not more than about three days,
that is, the time during which the cells are in a culture medium at
37.degree. C. in the presence of added cytokines (at normal levels)
is not more than about three days. Alternatively, the time during
which the cells are in culture media in the presence of more than
one cytokine is not more than three days. The transduction of the
cells may be performed in the presence of a recombinant fibronectin
fragment CH-296 or an equivalent agent.
[0121] The compositions and methods of this invention can be used
to treat any of a variety of diseases in which there is a genetic
aspect. Of particular interest are diseases of the blood or immune
systems. These include hemoglobinopathies, defects of leukocyte
production or function including cancers, immune deficiencies such
as HIV, viral infections, lysosomal storage diseases and stem cell
defects such as Fanconi's anemia, chronic granulomatous disease,
Gaucher's disease, G6PD deficiency etc. They also include
infectious diseases such as AIDS/HIV infection or acquired disease
such as cancers or cardiovascular diseases.
[0122] The present invention relates to gene therapy, particularly
as applied to hematopoietic progenitor (HP) cells, to transduced
cells and methods of obtaining them, and to methods of using them
to provide prolonged engraftment of modified hematopoietic cells in
human subjects. The invention particularly relates to ex vivo gene
therapy of HP cells for treatment or prevention of HIV
infection.
[0123] The invention provides compositions of transduced HP cells
that comprise sufficient numbers of totipotent cells capable of
providing therapeutic benefit. In one embodiment, this invention
provides compositions of transduced human HP cells and methods of
gene therapy against HIV in order to give rise, in human subjects,
to protected T-lymphocytes.
[0124] In the context of viral infection, particularly HIV
infection, significant therapeutic benefit is provided by the
invention through increased long term survival of modified
T-lymphocytes in the human subject and thereby increased numbers of
T-lymphocytes and improved immune function, leading to lower viral
replication and viral load.
[0125] In a further embodiment, the transduced human HP cells of
the composition or system are capable of long-term engraftment when
infused into a patient, giving rise to differentiated hematopoietic
cells for at least 12 months after infusion, preferably at least 24
months and even more preferably at least 30 months after infusion.
In a further embodiment, the transduced human HP cells are capable
of long-term engraftment when infused into an autologous subject.
In a further embodiment, the transduced human HP cells are capable
of long-term engraftment when infused into a subject without
myeloablation.
[0126] Another embodiment provides a composition or system
comprising transduced human HP cells in sufficient numbers that,
when delivered into a human subject, provide long term engraftment
at a level such that at least 0.01% gene-modified cells of at least
one cell type can be detected in the blood or bone marrow for
example, by biopsy. It is preferred that the cell type be
T-lymphocytes or macrophages/monocytes. Preferably, the level of
gene-modified cells is at least 0.1%, more preferably at least 1%
and most preferably at least 10%. It is preferred that the
transduced cells are delivered into an autologous subject. It is
preferred that the transduced cells are delivered in the absence of
myeloablation. It is preferred that long term engraftment occurs
for at least 12 months, more preferred at least 24 months, even
more preferred, at least 30 months. It is preferred that the
transduced gene is for treatment of diseases other than SCID, for
example cancers and infectious diseases. It is more preferred that
the transduced gene is for treatment or prevention of HIV
infection.
[0127] The HP cells for transduction were preferably obtained from
one subject. The CD34.sup.+ purity of the transduced human HP cells
(% CD34.sup.+) should be at least 65%, preferably at least 90% and
more preferably at least 95%. The percentage transduction should be
at least about 10%, preferably at least about 30% and more
preferably at least about 50%.
[0128] In a further embodiment, the transduced human HP cells are
derived from CD34.sup.+ cells isolated from the blood of a human
subject after mobilization of HP cells into the peripheral blood.
Mobilization can be achieved by the use of cytokines, preferably
one or more from the group consisting of granulocyte
colony-stimulating factor (G-CSF), conjugated G-CSF, pegylated
G-CSF and granulocyte-macrophage colony-stimulating factor
(GM-CSF). The cytokine(s) may further comprise stem cell factor
(SCF), interleukin 3 (IL-3), or stromal cell-derived factor-1
(SDF-1, Lataillade et al 2000) or similar acting cytokines.
Mobilization may be assisted by the use of a short course of
chemotherapy with agents such as cyclophosphamide. More preferably,
mobilization is carried out using G-CSF or pegylated G-CSF. The
cytokine(s) may be administered daily at an amount of at least
about 10 .mu.g per kg of weight of the subject and more preferably
at about 30 .mu.g per kg. The CD34.sup.+ cells may be collected by
apheresis on days 3, 4, 5, 6 or later after beginning cytokine
treatment.
[0129] Preferably, apheresis is carried out at least twice. The
CD34.sup.+ cells may be selected by any of the clinical grade
devices known in the art such as the Isolex 300i cell selection
system or the CEPRATE SC Stem Cell Concentration System.
[0130] In a further embodiment, the CD34.sup.+ cells are treated
prior to transduction with a cytokine mixture, preferably
comprising MGDF and SCF, or essentially MGDF and SCF, to induce
entry into cell cycle, preferably at concentrations of about 100
ng/ml and 50 ng/ml, respectively. It is preferred that cell cycle
induction occur in the absence of added cytokines IL-3, IL-6 or
SCF, or the combination of the three of these.
[0131] The transduced human HP cells contain an introduced gene
which may encode one or more proteins or RNA molecules, for example
antisense molecules, RNAi molecules, RNA decoys or ribozyme RNA
(ie. RNA agents). The introduced gene may be any introduced gene
provided that the encoded protein or RNA or both alter the
properties of the transduced human HP cells in a desired way
compared to the non-transduced HP cells. In one embodiment, the
introduced gene, when expressed, provides resistance to the
transduced HP cells or to differentiated progeny of these cells
against viral infection, preferably resistance against HIV
infection. More preferably, the introduced gene encodes antisense
or ribozyme RNA capable of inhibiting HIV-1 replication in
cells.
[0132] Types of ribozymes which may be directed against viral
infection such as HIV-1 infection or against non-viral diseases
include the hammerhead, hairpin, RNAse P, hepatitis delta virus
(HDV), intervening sequence ribozymes of the Group I or Group II
type, or catalytic motifs selected by in vitro selection methods.
The ribozymes are preferably hammerhead or hairpin ribozymes, more
preferably hammerhead ribozymes. Such ribozymes are capable of
cleaving RNA molecules associated with the disease.
[0133] The invention includes the use of multiple ribozymes (eg.
Ramezani et al 2002), for example a ribozyme with multiple
catalytic domains, or a combination of types of ribozymes. This
should reduce the likelihood of viral resistance in the case of
treatment of virus infection. It is also preferred that the
ribozyme cleavage site(s) is highly conserved in the viral target
RNA, as is the case for the Rz2 cleavage site. Any combination of
the above is also possible, providing more than one mechanism of
effect.
[0134] The transduced human HP cells of the composition or system
are transduced by DNA or a plasmid or viral transfer vector. It is
desired that the introduced gene is integrated into the cell
genome, after reverse transcription if appropriate. Preferably, the
cells are transduced with a retroviral vector, for example a murine
retroviral vector or a lentiviral vector. More preferably, the
retroviral vector is derived from LNL6 (Bender et al. 1987) or
other oncoretroviral vector. In a particular embodiment, the cells
are transduced with RRz2.
[0135] The introduced gene is expressed in the transduced human HP
cells or progeny cells from a promoter. The promoter may be
constitutively expressed or inducible, for example being expressed
preferentially under favorable conditions or circumstances. The
gene may be transcribed by RNA polymerase II (RNA pol II promoters)
or by RNA polymerase III.
[0136] In another embodiment of the invention, the composition is
formulated to be ready for delivery into a human subject. The great
majority of cells should be viable for example greater than 95% and
preferably greater than 98%. The volume of the composition is
preferably from about 10 ml to about 1000 ml, more preferably from
about 100 ml to about 500 ml. The composition comprises a
pharmaceutically acceptable carrier which is preferably a buffered
salts solution comprising a protein agent such as an albumin or
gelatine and/or a sugar such as glucose, which agents may act to
stabilize the cells. The carrier may contain anticoagulant agents
such as sodium citrate. The carrier may comprise a plasma expander,
well known in the art. In further aspects, the composition is
sterile (bacterial, fungal, mycoplasma), detectably free of
bacteria, endotoxin, mycoplasma, HIV p24 antigen or
replication-competent retrovirus, substantially free of free
transducing vector, or any combination of these. In a further
aspect, the composition is substantially free of added cytokines.
The composition is administered to the subject by parenteral means,
preferably by infusion or injection on one or more occasions.
[0137] The invention also provides methods for gene therapy of
hematopoietic cells, particularly hematopoietic progenitor cells,
using the compositions as described herein. The invention also
provides methods of treatment or prevention of genetic or
infectious diseases, for example HIV infection. The methods may
comprise the use of the CH-296 fragment of human fibronectin
(RetroNectin.TM.) or equivalent, or one or more debulking steps to
remove unwanted cells, or one or more washing steps.
[0138] Gene therapy can be carried out ex vivo or in vivo. The
methods described here preferably apply to the ex viva approach but
could also be applied to in vivo approaches (for example, Newbound
et al., 2001). The invention can be performed for subjects already
having disease, or prophylactically to reduce the occurrence or
prevent disease.
[0139] HP cells for use in the methods of the invention can be
obtained from peripheral blood, bone marrow, umbilical cord blood,
or from stem cells that give rise to hematopoietic cells. They are
preferably obtained from peripheral blood after mobilization. HP
cells can be mobilized into the peripheral blood by administering
one or more cytokines, with or without administration of a
chemotherapeutic agent. The cytokines may be selected from the
group consisting of G-CSF, pegylated G-CSF, conjugated G-CSF,
GM-CSF and any combination of the above. The cytokines may further
comprise one or more selected from the group consisting of SCF, FL
and IL-3.
[0140] The methods of the invention are capable of providing at
least 0.01% of gene-modified hematopoietic cells long term in a
patient in the absence of myeloablation.
[0141] The parameters and characteristics of each of the
embodiments described above are interchangeable when applicable to
each other, and are therefore not repeated. Thus, for example, any
parameter or characteristic of the first embodiment may be employed
in the other embodiments of the invention.
DEFINITIONS
[0142] Hematopoietic cells as used herein refer to cells normally
found in the blood as well as cells that give rise to cells
normally found in the blood, such as cells found in the bone
marrow. In this context, "normally" includes the situation where a
person is treated to alter the number or quality of cells in the
blood or bone narrow.
[0143] Viral vector is used herein to mean a vector that comprises
all or parts of a viral genome which is capable of being introduced
into cells and expressed. Such viral vectors may include native,
mutant or recombinant viruses. Such viruses may have an RNA or DNA
genome. Examples of suitable viral vectors include retroviral
vectors (including lentiviral vectors), adenoviral vectors,
adeno-associated viral vectors and hybrid vectors.
[0144] A retroviral vector is a viral vector where the virus is
from the family retroviridae.
[0145] A "construct" is used to mean recombinant nucleic acid which
may be a recombinant DNA or RNA molecule, that has been generated
for the purpose of the expression of a specific nucleotide
sequence(s), or is to be used in the construction of other
recombinant nucleic acids. In general, "construct" is used herein
to refer to an isolated, recombinant DNA or RNA molecule.
[0146] An "anti-HIV agent" as used here refers to any agent that
can be expressed by a mammalian cell and which inhibits the
replication of HIV or the entry of HIV into the mammalian cell.
Such agents may be nucleic acids or polypeptides.
[0147] The term "capable of engraftment" is used in here to refer
to the ability of a hematopoietic cell to implant into the bone
marrow for an extended period of time, e.g. at least one year.
Implantation may be detected directly (e.g. by biopsy) or by the
production of progeny cells in the blood.
[0148] The terms "mobilize" and "mobilized" are used here to refer
to hematopoietic cells being moved from the tissue stores in the
bone marrow into the peripheral blood.
[0149] The term "cytokine" is used to refer to any number of
hormone like, low-molecular weight proteins, whether secreted by
various cell types or recombinant, that regulate the intensity and
duration of cell growth or function, for example cell-to-cell
communication. Cytokines are involved, for example, in mediating
immunity, allergy, and in regulating maturation and growth of
cells.
[0150] An "adult" is used here to refer to a fully grown and
physically mature human subject. Generally accepted age of a human
"adult" is 18 years or more.
[0151] Transduction is used to refer to the introduction of genetic
material into a cell by using a viral vector.
[0152] As used herein a transduced cell results from a transduction
process and contains genetic material it did not contain before the
transduction process, whether stably integrated or not. As used in
some prior art, but not as used herein, "transduced cells" may
refer to a population of cells which has resulted from a
transduction process and which population includes cells containing
the genetic material and cells not containing the genetic material,
whether stably integrated or not.
[0153] Transfection refers to the introduction of genetic material
into a cell without using a viral vector. Examples of transfection
include insertion of "naked" DNA or DNA in liposomes, that is
without a viral coat or envelope.
[0154] Myeloablation refers to treatment, generally chemical or
radiological, which results in the destruction of at least a
significant part of the myeloid compartment (which includes
hematopoietic progenitor cells) in a patient. Myeloablation does
not include conditioning treatments which may cause only a minor or
unsubstantial destruction of cells of the myeloid compartment.
[0155] The phrase "pharmaceutically acceptable carrier" is used to
mean any of the standard pharmaceutically acceptable carriers.
Examples include, but are not limited to, phosphate buffered
saline, physiological saline, and water.
[0156] "Recombinant fibronectin fragment" is used to refer to an
agent that functions to colocalize the cells with the vector during
the transduction process and is based on the activity of
fibronectin. For example, RetroNectin.TM., TaKaRa Shuzo Co. Ltd.,
is a recombinant fibronectin fragment that contains three domains,
a central cell binding domain that binds to integrin VLA-5, a high
affinity heparin-binding domain that binds proteoglycans, and a
CS-1 site within the alternatively splices IIICS region that binds
integrin VLA-4 (Williams 1999). Equivalent retronectins contain
three domains that are functionally equivalent to RetroNectin.TM.,
while colocalization agents that are similar to RetroNectin.TM.
contain at least two domains that are functionally equivalent.
[0157] "Nucleic acid sequence" as used herein refers to an
oligonucleotide, or polynucleotide, and fragments or portions
thereof, and to DNA or RNA of genomic or synthetic origin which may
be single- or double-stranded, and represent the sense or antisense
strand. Similarly, "amino acid sequence" as used herein refers to
an oligopeptide, peptide, polypeptide, or protein sequence, and
fragments or portions thereof, and to naturally occurring or
synthetic molecules.
[0158] The term "antisense", as used herein, refers to nucleotide
sequences which are complementary to a specific DNA or RNA
sequence. The term "antisense strand" is used in reference to a
nucleic acid strand that is complementary to the "sense" strand.
Antisense molecules may be produced by any method, including
synthesis by ligating the gene(s) of interest in a reverse
orientation to a promoter which permits the synthesis of a
complementary strand. Once introduced into a cell, this transcribed
strand combines with natural sequences produced by the cell to form
duplexes. These duplexes then block either the further
transcription or translation. In this manner, mutant phenotypes may
be generated. The designation "negative" is sometimes used in
reference to the antisense strand, and "positive" is sometimes used
in reference to the sense strand.
[0159] Throughout this specification the word "comprise", or
variations such as "comprises" or "comprising", will be understood
to imply the inclusion of a stated element, integer or step, or
group of elements, integers or steps, but not the exclusion of any
other element, integer or step, or group of elements, integers or
steps.
Model Proving Principle of Invention
[0160] The model selected to prove the principles of the invention
is an HIV infected human. An effective, long term and practical
treatment or eradication or prevention of HIV infection in a human
subject has been an elusive goal. Thus, the advantages of the
invention are exemplified in the context of a highly complex
problem, i.e. therapy against HIV infection in a human subject.
[0161] However, as will be evident from the following description,
different diseases can be treated using the compositions or methods
of the invention, including any of the blood or immune systems.
These include hemoglobinopathies, defects of leukocyte production
or function, immune deficiencies, lysosomal storage diseases and
stem cell defects such as Fanconi's anemia, chronic granulomatous
disease, Gaucher's disease, G6PD deficiency etc. Many of these
disorders have been successfully treated by allogeneic HP cell
transplants (Parkman 1986). However, the requirement for immune
suppression or the occurrence of immunologic effects such as graft
rejection or graft-versus host disease are a disadvantage of
allogeneic bone marrow transplantation. The invention provides
advantages where autologous HP cells are used. The invention can
also be used to confer resistance to HP cells or their progeny
against myelosuppressive effects.
[0162] The invention can also be used to treat infectious disease,
such as the exemplified AIDS or other viral infection such as
HTLV-1 (Bunnel and Morgan 1998), or acquired diseases such as
cardiovascular diseases (for example, see Orlic et al 2001) or
cancers. With respect to cancers, bone marrow transplantation
techniques have been used for a variety of cancers including those
primarily of the hematopoietic system. There is an advantage to
providing protection to hematopoietic cells against anti-cancer
agents (Carpinteiro et al, 2002), to allow more effective treatment
(see review by Brenner 2001). Genes that can be used include the
multidrug resistance (MDR) gene which confers resistance to
anthracyclines, Vinca alkaloids, podophyllins and taxol, and mutant
dihydrofolate reductase (mDHFR) genes to confer resistance to
methotrexate or trimetrexate, and genes for
O-alkylguanine-DNA-alkyltransferase for resistance to alkylating
agents. The gene therapy methods of this invention can be also used
in treatment of malignancies by altering the immune response to the
cancerous cells or simply by marking cells to monitor the efficacy
of conventional therapies (Cornetta et al 1996). For treatment of
malignancies where gene therapy of hematopoietic cells is also
carried out, partial or complete myeloablation will often be
performed prior to delivery of the modified cells.
Gene Therapy for HIV-1
[0163] The Human Immunodeficiency Virus (HIV) group includes HIV-1
and HIV-2 types. Replication of HIV-1 is now well understood. The
current standard treatment uses a combination of antiretroviral
drugs, often three or more, and may provide control of HIV
replication in the short-term but is often associated with negative
aspects such as drug toxicity, viral resistance, awkward dosing
regimes, and cost of treatment.
[0164] Using hematopoietic progenitor cells as transduction
targets, gene therapy for HIV/AIDS aims to replace a fraction of
the HIV-infected cellular pool with cells engineered to inhibit
virus replication. This strategy can potentially contribute to
virus eradication by protecting CD34.sup.+ cells and by allowing
the establishment of an antiviral response mediated by protected
immune elements. For these strategies to have a positive impact on
the course of HIV infection, it is essential that i) a degree of
immune reconstitution occur in the setting of HIV infection, ii)
the reconstituted immune system be protected against HIV-induced
depletion, enabling it to recognize antigen and to protect the host
against pathogens. It is desired that this strategy impact on viral
load. With regard to the potential for immune reconstitution in HIV
infection, several reports have addressed the effects of highly
active antiretroviral therapy (HAART) on the immune system (Ho et
al 1995; Zhang et al 1998). In essence, HAART is associated with
increases in CD4.sup.+ cell counts, principally due to the
expansion of memory cells during the first 4 months of HAART. This
is followed by an increase in naive CD4.sup.+ cells, associated
with a decrease in CD4.sup.+ activation markers and an increase in
proliferative responses to recall antigens (Autran et al 1997;
Pakker et al 1998).
[0165] Although in vitro studies have demonstrated that the adult
uninfected thymus maintains the ability to support T-lymphopoiesis
(Jamieson et al 1999; Poulin 1999), it has not previously been
proven that hematopoietic progenitor cell gene therapy can result
in the prolonged restoration of the immune system with cells
engineered to inhibit HIV-1 replication. With regard to the absence
of gene therapy, while the emergence of recent thymic emigrants in
the periphery has been described for patients that were previously
HAART naive, it was sustained only as long as viremia was kept in
check (Douek et 1998; Zhang et al 1999). It is not known whether a
similar response would occur in patients with more advanced HIV
infection in the context of drug resistance and uncontrolled
viremia. In addition, the source of progenitors that give rise to
these recent thymic emigrants has not been elucidated; it is not
known whether hematopoietic precursors responsible for the degree
of thymopoiesis observed after HAART in adults migrate from the
bone marrow to the thymus as a response to T-cell depletion, or
whether T-lymphoid development after HAART derives from T-lymphoid
progenitors that colonized the thymus earlier in life. Indeed, the
ability of peripheral blood progenitor cells to undergo
T-lymphocyte development in the adult thymus has not previously
been elucidated in the setting of active HIV replication, as the
emergence of T-lymphocytes after autologous transplantation of HIV
patients could be ascribed to T-lymphocyte development arising from
endogenous residual T-lymphocyte precursors (Gabarre et al 2000).
Moreover, uninfected adult patients receiving allogeneic
hematopoietic progenitor cell transplantation using selected
CD34.sup.+ cells display marked delay and suboptimal T-lymphocyte
recovery, indicating subnormal thymic activity after intensive bone
marrow suppression (Behringer et 1999; Martinez et al 1999). It
should also be considered that potential factors inherent to the
methods employed in genetic manipulation of hematopoietic
progenitors might affect their ability to undergo T-lymphoid
development. These previously identified factors include the
induction of progenitors into cell cycle in preparation for
transduction with murine retroviruses (Roe et al 1993), which could
result in myeloid lineage commitment, and the presence of a
constitutively expressed foreign gene that might interfere with the
required processes of progenitor cell migration, homing and
differentiation. Therefore we sought to determine whether
genetically protected T-lymphocytes, including naive T-lymphocytes,
could be produced in the context of adult HIV infection.
[0166] Interference with HIV-1 multiplication can occur at any
stage of its replication cycle. Retroviral infection of a cell is
initiated by the interaction of viral glycoproteins with cellular
receptors (A) (see FIG. 1). Following adsorption and uncoating, the
viral RNA enters the target cell and is converted into cDNA by the
action of reverse transcriptase, an enzyme brought within the
virion (B). The cDNA adopts a circular form (C), is converted to
double-stranded cDNA and then becomes integrated into the host
cell's genomic DNA by the action of integrase (D). Once integrated,
proviral cDNA is transcribed from the promoter within the 5' LTR
(E). The transcribed RNA including the mRNAs for gag, pol and env
and the regulatory factors tat, rev and vpr are translated to
produce the viral proteins (F) or is left as nascent viral RNA.
This viral RNA contains a Psi packaging sequence which is essential
for its packaging into virions (G). Once the virion is produced, it
is released from the cell by budding from the plasma membrane (H).
In general, retroviruses do not cause lysis of the host cell; HIV
is an exception to this. The proviral cDNA remains stably
integrated in the host genome and is replicated with the host DNA
so that progeny cells also inherit the provirus. Potential
anti-viral agents may be targeted at any of these replicative
control points. For example, down-regulation of the CCR5 receptor
can inhibit HIV-1 replication (Bat et al 2000).
[0167] Different types of approaches that can be used with this
invention for gene therapy against HIV-1 including intracellular
expression of transdominant proteins (eg. Smythe et al. 1994),
intracellular antibodies (eg. Marasco et al. 1998, Shaheen et al
1996), antisense ribonucleic acid (RNA) (eg. Sczakiel and Pawlita
1991), viral decoys (eg. Kohn et al. 1999), catalytic ribozymes
(eg. Sarver et al. 1990; Sun et al. 1996) and RNAi (eg. Novina et
al 2002).
[0168] Transdominant (mutant) proteins, particularly mutant Rev or
Tat proteins, act by binding to HIV RNA or factors required for HIV
replication. They have an altered function compared to the
non-mutant protein such that they interfere with the function of
the non-mutant protein. They may be a fusion protein, combining two
or more activities. In one particular embodiment, the transdominant
protein is the RevM10 protein (Ranga et al 1998), which has been
shown to inhibit HIV-1 replication in primary T cells. RevM10
transduced CD34.sup.+ cells isolated from human umbilical cord
blood or peripheral blood gave rise to mature thymocytes in a mouse
model and protected T cells against HIV-1 (Bonyhadi et al 1997).
Furthermore, retroviral delivery of RevM10 to CD34.sup.+ cells
protected these cells in HIV-infected individuals (Ranga et al
1998).
[0169] Intracellular antibodies, generally of the single-chain
type, such as that produced from the retroviral construct pSLXCMV
(Shaheen et al 1996), can inhibit the HIV life cycle by binding or
sequestering specific viral proteins. In one particular embodiment,
anti-reverse transcriptase (RT) antibody fragments inhibited HIV
infection in vitro (Maciejewski et al 1995).
[0170] Antisense RNA may bind to viral RNA, either genomic or
transcription products, and destabilize the RNA or inhibit
processes such as translation or export from the nucleus. Binding
to the nascent viral RNA may also act to inhibit productive
packaging of RNA into virions. As is well understood in the art,
the complementary region for an antisense molecule can be as short
as 15 nucleotides, more preferably more than 30 nucleotides, and
most preferably between 100 and 500 nucleotides in length.
Inhibition of HIV-1 replication has been demonstrated for antisense
RNAs targeted against several viral regulatory and structural genes
including poi, gag, env, tat, vif, and psi (see Veres et al 1998).
Replication of the related simian immunodeficiency virus (SIV) was
limited and disease progression was reduced in monkeys after
treatment with lymphocytes containing an antisense tat/rev gene
(Donahue et al 1998) showing that antisense expression can inhibit
lentivirus replication in vivo. In one particular embodiment, the
retroviral vector HGTV43 encodes an antisense molecule targeting
tar and two separate sites of the tat/rev region in the HIV-1
genome. This molecule has been shown to provide protection against
HIV infection in vitro.
[0171] RNA decoys such as RRE decoys and TAR decoys have also been
used to protect cells against HIV (Lee et al 1994, Lisziewicz et al
1993) and are preferably used in a polymeric form to increase the
ability to bind HIV-1 related proteins and sequester them.
[0172] Ribozymes may act not only by binding viral RNAs but also by
cleaving and inactivating them and so are attractive for use with
this invention. They consist of one or more (usually two) regions
of complementarity to the target RNA and a catalytic region that
provides enzymatic activity. Ribozymes, particularly those with
longer hybridizing arms, may also act through mechanisms similar to
those used by antisense molecules. The most widely used ribozyme
motifs are the hammerhead and hairpin types, which are described in
U.S. Pat. No. 6,127,114 and U.S. Pat. No. 6,221,661, respectively.
In one particular embodiment, the retroviral vector pTCAG encodes a
hairpin ribozyme targeting the U5 region (position +111/112 from
the cap site) of HIV-1 LTR fused with part of an RRE sequence and a
ribozyme targeting the rev/env coding region (position 8629-8644 of
HXB2 isolate), expressed from a tRNAvaI promoter (Gervaix et al
1997).
[0173] RNAi molecules are those with double stranded RNA regions
that trigger host cell RNA degradation mechanisms in a
sequence-specific manner. They may therefore be used to inactivate
endogenous RNAs or pathogen RNA such as HIV-1 RNA. Each double
stranded region may be relatively short, for example 21-25 base
pairs in length, preferably less than about 30 base pairs in length
and more preferably with a double stranded region of 19 to 25 base
pairs. It is preferred that there be not more than one mismatch
(mismatches are defined as not including G:U pairs) in each
double-stranded region, more preferably no mismatches, and most
preferred that the double stranded region(s) be perfectly matched.
Where the targeted molecule is variable (eg. HIV-1 RNA), highly
conserved regions should be targeted. A family of variants can be
targeted provided they do not have more than one mismatch with one
or other of the strands of the double-stranded region of the RNAi
molecule. For longer RNAi molecules, several short duplexes may be
joined, allowing targeting of multiple genes, which is preferred
for targets with higher variablity. The RNAi duplexes may also be
produced from longer RNA transcripts by splicing or self-cleaving
means, for example by incorporating self-cleaving ribozymes between
or flanking the duplex regions. RNAi molecules are easily formed
from DNA molecules having an inverted repeat structure.
Alternatively, RNAi duplexes may be formed from two RNA molecules
with complementary regions. RNAi molecules with double-stranded
regions of greater than 30 base pairs can be used if they are
nuclear localized, eg. if they are made without signals for
cytoplasmic export such as polyadenylated sequences. Until
recently, RNAi had not been shown to work in human cells. Recently,
however, RNAi (also called IRNA, or short siRNA, or hairpin RNA)
has been shown to inhibit HIV-1 replication in T lymphocytes
(Novina et al 2002). RNAi molecules targeted to the viral LTR, or
the accessory vif and nef genes inhibited early and late steps of
HIV replication in cell lines and primary lymphocytes (Jacque et al
2002). RNAi has also been successfully targeted to other viruses
(eg. Gitlin et al 2002) and can be targeted against endogenous
genes.
[0174] The RNA agents disclosed herein for use in the invention can
be expressed from viral promoters (eg retroviral LTR,
cytomegalovirus) or other promoters utilizing RNA polymerase II for
high level expression. The RNA agent can be incorporated into
longer transcripts, for example in the 3' untranslated region of a
marker gene. The transcript may be engineered for self-cleavage for
release of the agent. The RNA agent may also be expressed from RNA
polymerase III promoters using gene constructs derived from tRNA
genes, adenovirus VA1, U1 and U6 or other small nuclear RNA genes.
Furthermore, the RNA agent may be provided with signals that aid in
colocalizing the agent with the target molecule (for example, see
Michienzi et al 2000).
[0175] The scientific rationale for the use of a ribozyme or other
genes to treat HIV or other infection is shown schematically in
FIG. 2.
[0176] It is an object of this invention to provide therapeutic
benefit by allowing for the long term emergence of protected
T-lymphocytes from the thymus, with increased survival of the CCM
cells, and the establishment of an increased immune response by
protected immune elements.
Hematopoiesis
[0177] Hematopoietic cells include cells normally found in the
blood as well as cells that give rise to cells normally found in
the blood, such as cells found in the bone marrow. In this context,
"normally" includes the situation where a person is treated to
alter the number or quality of cells in the blood or bone marrow.
The process of differentiation of hematopoietic cells is shown
schematically in FIG. 3. Hematopoiesis is the process through which
the blood-forming system is maintained. This process involves a
balance between cell death and regeneration and differentiation of
new cells.
[0178] Production of mature lymphoid cells requires that precursors
leave the bone marrow, pass through the selection mechanisms within
the thymus and be exported as naive cells into the peripheral
blood. The efficiency of this process is age related as the thymus
involutes with age and its rate of CD4.sup.+ T-lymphocyte export
decays accordingly. Survival and expansion of T-lymphocytes to give
rise to activated and memory T-cells is dependent on natural
homeostatic mechanisms.
[0179] Hematopoiesis is maintained by a pool of pluripotent
hematopoietic stem (HS) cells which have the long term capacity for
self-renewal as well as giving rise to progeny which proliferate
and differentiate into mature effector blood cells of both the
myeloid and lymphoid groups (Ogawa et al 1993, Orlic and Bodine
1994). The numbers of HS cells are maintained by cell division so
that these cells are effectively immortal. At least in theory, the
whole hematopoietic system could be regenerated from a single HS
cell. Many of the HS cells are quiescent in the body (Hodgson and
Bradley 1979, Jones et al 1990).
[0180] Hematopoietic progenitor (HP) cells are characterized by the
presence of the CD34.sup.+ cell surface antigen and their ability
to give rise to multilineage progeny of both the myeloid and
lymphoid types. Some CD34.sup.+ hematopoietic progenitor cells have
the capacity for self-renewal and can be considered true stem
cells, while other CD34.sup.+ hematopoietic cells may not have the
capacity for self-renewal or only a limited capacity. The
CD34.sup.+ antigen is absent on more mature hematopoietic
cells.
[0181] The CD34.sup.+ cells are themselves heterogenous (Bertolini
et al 1998) and can be fractionated into subpopulations based on
expression of other markers, for example CD38 (Hogan et al 2002).
Human CD34.sup.+/CD38.sup.- cells, representing about 5% of the
CD34.sup.+ cell population, were shown to have better long-term
reconstituting ability in the SCID mouse model than the CD38.sup.+
cells (Hogan et al 2002). Thus, 2.5.times.10.sup.5
CD34.sup.+/CD38.sup.- (CD34.sup.+/CD38low) cells may be equivalent
to 5.times.10.sup.5 CD34.sup.+ cells. Other markers that can be
used to enrich the cell population for cells with long-term
reconstituting ability include Thy-1'', CD133'', human KDR.sup.+
(VEGF receptor), human ClQR.sub.p.sup.+, HLA-DR.sup.-, and
low-level retention of vital dyes such as Rhodamine 123 or Hoechst
33342.
[0182] Recent reports indicate that there may be HS cells lacking
the CD34.sup.+ antigen for at least some of the time (Helene and
Kohn 2000, Dao and Nolta 2000). Reversible expression of the CD34
marker on murine HS cells has been shown, suggesting that
CD34.sup.+ serves as an activation marker (Sato et al 1999).
CD34.sup.+ cells have been shown to be capable of multilineage
engraftment and to give rise to CD34.sup.+ cells, (Zanjani et al
1998).
[0183] The capacity of the HP cells, which are to be altered by
gene therapy according to this invention, to engraft and give rise
long term to multilineage differentiated progeny is a critical
feature of this invention. This provides for persistence of
gene-modified hematopoietic cells in the human subject. This
capacity may be assayed by the ability to repopulate the
hematopoietic systems of myeloablated animals (Harrison 1980,
Harrison 1988) or preferably myeloablated humans, or more
preferably non-myeloablated humans. Even more preferably, this
capacity is assayed in the context of viral infection such as HIV-1
infection.
HP Cells and their Isolation
[0184] The isolation and purification of human HP cells has been
reviewed recently (To et al 1997, Huss 2000, Thomas et al 1999,
Sadelain et al 2000).
[0185] HP cells for use in gene therapy according to the invention
can be isolated from peripheral blood after mobilization, bone
marrow, or umbilical cord blood. HP cells may also be obtained from
stem cells that give rise to hematopoietic cells.
[0186] HP cells are preferably obtained from peripheral blood after
mobilization (Huss 2000). There are some advantages in isolating HP
cells from mobilized peripheral blood. A higher absolute number of
CD34.sup.+ cells can be collected from the peripheral blood after
mobilization compared to bone marrow or umbilical cord blood, due
to the relatively large amount of blood that can be processed. The
procedure does not require a general anaesthetic and is associated
with reduced hospitilization costs. As is well understood in the
art (for example, Fu and Liesveld 2000) that mobilization can be
performed by treatment with one or more cytokines, optionally
adding a short course of chemotherapy with agents such as
cyclophosphamide (Campos et al 1993). HP cells can be mobilized
into the peripheral blood using G-CSF (Ho 1993, Lane et al 1995),
pegylated G-CSF, conjugated G-CSF, GM-CSF (Siena et al 1989), or
any combination of these. Mobilization can be enhanced by combining
one or more of these cytokines with others such as stem cell factor
(SCF), Flt-3 ligand (Ho et al 1996 abbreviated as Flt3), or
interleukin 3 (IL-3; Huhn et al 1996). Mobilization may be enhanced
by counteracting stromal cell-derived factor-1 (SDF-1; Benboubker
et al 2001) or other factors that act negatively to restrict
mobilization. Mobilization of peripheral blood HP cells using G-CSF
in HIV-infected individuals has been demonstrated by Law et al
1999. Maximal mobilization was achieved after 4 days of G-CSF
administration. HP cells may be obtained by apheresis on days 4, 5,
6 or later. Levels of CD34.sup.+ cells in the blood may be
monitored from about day 3 onward, for example Complete Blood
Counts (CBCs), differential and platelet count may be performed
daily during cytokine administration to assess the extent of the
leucocytosis. The CD34.sup.+ cell count is preferably greater than
20 cells/mm.sup.3 prior to the start of apheresis.
[0187] Apheresis may be carried out with the Cobe Spectra (Gambra),
Hemonetics (Domediac), Amicus (Baxter) or equivalent equipment.
Apheresis results in a leukocyte population highly enriched in
mononuclear cells and depleted for granulocytes, which is desired.
If insufficient CD34.sup.+ cells are obtained from a first series
of mobilization/apheresis, the procedure can be repeated with the
same or modified mobilization regime.
[0188] Alternatively, apheresis can be repeated. CD34.sup.+ cells
from the first procedure can be cryopreserved and combined with
those from subsequent procedures.
[0189] It has been shown that primitive HP cells are reduced or
lost in patients with HIV infection (Marandin et al 1996); this
makes it more difficult to obtain sufficient numbers of cells in
the context of HIV infection.
[0190] HP cells can also be isolated from aspirated bone marrow by
isolating mononuclear cells (MNC) and purifying CD34.sup.+ cells.
HP cells can also be isolated from umbilical cord blood (Gluckman
2000). Up to about 200 ml of cord blood can be obtained at birth.
Such cells can be cryopreserved and used for successful
transduction and transplantation later (Huss 2000). There is
evidence that HP cells from umbilical cord blood are more readily
transduced and have greater self-renewal potential than those from
peripheral blood (Moore and MacKenzie 1999).
[0191] Devices have been developed that allow enrichment of
CD34.sup.+ cells for clinical use, including the Isolex 300i or
equivalent. These are based on the recognition of the CD34.sup.+
cell surface antigen, which is a transmembrane sialomucin that is
expressed on HP cells and on vascular endothelial cells. The
methods include immunoselective methods using antibodies with
specificity for the CD34.sup.+ antigen, which antibodies may be
tagged with magnetic or fluorescent or other tags that allow
selection. Cells may be expressing the CD34.sup.+ protein
internally but this would not allow immunoselection. Only cells
expressing the CD34.sup.+ antigen on the cell surface at same time,
allowing access to the antibody, are considered CD34.sup.+.
[0192] Populations of hematopoietic cells that are highly enriched
for CD34.sup.+ cells can also be obtained from the sources
mentioned above by antigen-depletion strategies, for example to
selectively deplete the population of cells expressing
lineage-specific markers such as CD2, CD3, C014, CD16, CD19, CD24,
CD56, or CD66b glycoprotein A. This type of strategy allows the
isolation of cell populations enriched for CD34.sup.- HS cells as
well as CD34.sup.+ cells. The enriched pool of CD34.sup.+ or
lineage depleted cells preferably comprises at least 40%, more
preferably at least 60% and most preferably at least 80% cells of
this type. A balance must be struck between the purity and recovery
of the desired cells.
[0193] The proportion of CD34.sup.+ cells in samples can be
determined by flow cytometry methods, for example as done by Bender
et al 1991, or immunologic methods. The absolute number and
proportion of CD34.sup.+ cells can be determined by standardized
procedures (Barnett et al 1998, Sandhaus et al. 1998). Absolute
nucleated cell counts can be determined by hematological analyzers,
or more preferably in single-platform assays, where absolute
CD34.sup.+ counts are produced directly from a single flow
cytometric analysis. Enumeration of CD34.sup.+ cells and some of
the equipment that can be used has recently been reviewed (Reis
1999).
[0194] Once isolated, CD34+ cells can be cultured in any suitable
medium, well known in the art, in vessels such as flasks or bags,
for example the gas-permeable polypropylene bags (Giarratana et al
1998).
[0195] There is increasing evidence that most CD34.sup.+ cells are
involved in short-term but not long term reconstitution, and that
only a small fraction of all CD34.sup.+ cells have long term
multilineage engraftment potential (see Bertolini et al 1998). This
raises concern about the enumeration of CD34.sup.+ numbers in
earlier reports and engraftment potential (Ducos et al 2000). We
have shown here that the transduced human CD34.sup.+ cells and
methods of the invention are capable of providing for long term
multilineage engraftment.
Treatment of HP Cells for Transduction with Murine Oncoretroviral
Vectors.
[0196] Efficient transduction of human HP cells with murine
oncoretroviral vectors (for example, those based on MMLV) and some
other retroviral vectors requires induction of cell cycle, for
example with one or more cytokines (growth factors) (Dao and Nolte
1999) or inhibitors of cell cycle control. The combination of
thrombopoietin (TPO), Flt-3 ligand (FL) and Kit ligand (KL, also
known as SCF) has been used in vitro (Murray et al 1999, Ng et al
2002). The combination of MGDF, SCF and FL was used in repopulation
assays in primates (Wu et al 2000). Amado et al showed that
treatment of cells with MGDF and SCF better supported the survival
of thymocyte precursor cells than other combinations of factors in
a mouse model (Amado et al 1998). IL-3, IL-6, SCF or TPO or
combinations thereof have been shown to have beneficial effects on
HP cell transduction (Nolte et al 1992, Hennemann et al 1999). The
combinations FL/SCF/IL-3/IL-6, SCF/G-CSF, FL/SCF/TPO/IL-6,
FL/SCF/G-CSF, FL/SCF/TPO, and FL/SCF/GM-CSF have also been used in
large animal models (Richter and Karlson 2001). There is evidence,
however, that the combination of IL-3, IL-6 and SCF may impair
engraftment (Peters et al 1996). Other approaches to induce cycling
of HP cells include the use of inhibitors (eg antisense molecules
or antibodies) of p27 (kipl) (Dao et al 1998, Cheng et al 2000) or
transforming growth factor beta-1 (Ducoa et al 2000, Imbert et al
1998) to increase cell numbers. However, the ability of cells
stimulated in any of these ways and then transduced to confer long
term engraftment in humans was unknown prior to this invention.
[0197] SCF (c-kit ligand) is a cytokine produced mainly by marrow
stromal cells and has an important role in the survival and
self-renewal of HSC (Lyman and Jacobsen 1998). It also acts as a
co-mitogen in the movement of HS cells out of the stem cell pool
into progeny. Flt-3 ligand (FL) is a cytokine that binds to a class
III receptor tyrosine kinase that is expressed on primitive
hematopoietic cells (Lyman and Jacobsen 1998). FL has a synergistic
effect with SCF on survival and proliferation of HP cells (Dao et
al 1997). Thrombopoietin (TPO) is a ligand for the c-Mpl receptor
and is a growth factor involved in early hematopoiesis as well as
megakaryocyte and platelet formation (Solar et al 1998). MGDF is a
pegylated and truncated form of TPO and acts in a similar fashion
to TPO; it may be regarded as functionally equivalent to TPO. Any
of these cytokines may be modified, formulated differently or
conjugated while still providing an equivalent effect.
Ribozymes
[0198] Ribozymes are enzymatic RNAs that can specifically cleave
RNA (for example, Haseloff and Gerlach, 1988). Being catalytic,
they exhibit turnover and can therefore cleave multiple target
molecules. Ribozymes pair with the specific target RNA by virtue of
complementary sequence and induce cleavage at specific sites along
the phosphodiester backbone of RNA (Haseloff and Gerlach, 1988;
Rossi et al., 1992; Hampel et al 1990; Ojwang et al 1992). The
hammerhead ribozyme is small, simple and has an ability to maintain
site-specific cleavage when incorporated into a variety of flanking
sequence motifs (Haseloff and Gerlach, 1988; Rossi et al., 1992).
The requirements for cleavage by a ribozyme are an accessible
region of RNA and, in the case of the hammerhead ribozyme, a NUN
target motif (where N is any ribonucleotide and H is A, C or U
ribonucleotides). Cleavage occurs immediately 3' of the NUH target
motif. These features make it particularly well suited for gene
suppression. Other types of ribozymes include the so-called hairpin
ribozyme, hepatitis delta virus ribozyme (HDV), RNAse P,
intervening sequence (IVS) Group I, IVS Group II, and motifs
identified by in vitro selection methods. The hammerhead and
hairpin types are among the smallest and most widely used.
Description of Rz2
[0199] A number of studies have demonstrated ribozyme cleavage
activity in test tube reactions, and protective effects in tissue
culture systems against laboratory and clinical isolates of HIV-1
(Sarver et al. 1990; Sun et al. 1995; Wang et al. 1998). A
particular hammerhead ribozyme denoted Rz2 is directed against a
highly conserved region of the tat gene (FIG. 4). The tat gene is
essential for HIV-1 replication; it encodes and produces the Tat
protein that is a transcriptional activator of integrated HIV-1
provirus. Sun et al (1995) used Rz2 to protect T lymphocytes
against HIV-1 in vitro but did not describe results in patients.
They also did not disclose that a minimum number of transduced HP
cells must be used for prolonged engraftment, or what that number
might be. Amado et al (1999) describe in general terms the protocol
used in a Phase I clinical trial to determine the feasibility and
safety of transduction of CD34.sup.+ cells in HIV-1 infected
individuals with an MoMLV-based retroviral vector. They did not
describe results of the trial or that a minimum number of
transduced HP cells should be used for long term engraftment.
Objectives of the trial included determining the efficiency of
transduction and safety and to test whether the ribozyme would
confer a survival advantage (or disadvantage) to the progeny cells
in vivo.
[0200] FIG. 4 shows the structure of Rz2 and its target sequence at
position 5833 to 5849 within the HIV-1 strain HXB2 (Genbank
sequence K03455), where cleavage occurs after the GUA triplet at
position 5842. The target sequences comprise nucleotides 5833-5849
(GGAGCCA GUA GAUCCUA) of reference strain HIV-HX132 (Genbank
accession number K03455) or nucleotides 5865 to 5882 (GGAGCCA GUA
GAUCCUA) of HIV IIIB (Genbank accession number X01762) or the
corresponding region from other HIV strains. DNA nucleotides with
the sequence 5'-TTA GGA TCC TGA TGA GTC CGT GAG GAC GAA ACT GGC
TC-3' corresponding to the Rz2 ribozyme were inserted into the SalI
site in the 3' untranslated region of the nee gene within the
plasmid pLNL6, which contains the replication-incompetent
retroviral vector LNL6 (Genbank accession number M63653) to
generate a new virus, RRz2. The ribozyme sequence was expressed as
a nee-ribozyme fusion transcript from the Moloney Murine Leukemia
Virus (MoMLV) Long Terminal Repeat (LTR) in RRz2.
[0201] It is preferred that the nucleotide sequence immediately
around the ribozyme cleavage site(s) is highly conserved in the
viral target RNA. This can readily be determined by comparison of
sequences available in sequence databases, or tested experimentally
by multiple-passage assays (Wang et al 1998). The Rz2
target/cleavage site in HIV-1 is conserved in almost all naturally
occurring infectious isolates. In a Phase I clinical trial, two
sequence variants were observed at positions -4 and -1 relative to
the GUA triplet at the cleavage site. However, these variants may
represent less fit pseudotypes.
[0202] Since CD4.sup.+ and CD8.sup.+ T-lymphocytes, monocytes and
macrophages are the most susceptible to HIV infection, genetic
modification of these cells so that they express Rz2 leads to
inhibition of HIV infection. Preferably, the genetic modification
is accomplished during the early stage of hematopoiesis.
Vectors
[0203] Different types of vectors can be used for transduction or
transformation of HP cell's. These include plasmid or viral
vectors. Retroviral vectors have been used widely so far in gene
therapy (Chu et al 1998), particularly those based on Moloney
murine leukemia virus (MoMLV), a member of the murine
oncoretroviruses. Other murine retroviral vectors that can be used
include those based on murine embryonic stem cell virus (MESV) and
murine stem cell virus (MSCV). Vectors based on murine
oncoretroviruses can be used for high efficiency transduction of
cells, however, they require that the cells be active in cell
division. Following entry into the cell cytoplasm and reverse
transcription, transport of the preintegration complex to the
nucleus requires the breakdown of the nuclear membrane during
mitosis. Transduction of HP cells with murine retroviral based
vectors therefore requires activation of the cells.
[0204] Lentiviral vectors (Amado and Chen 1999), a subclass of the
retroviral vectors, can also be used for high-efficiency
transduction (Haas et al 2000, Miyoshi et al 1999, Case et al 1999)
and are able to transduce non-dividing cells (Uchida et al 1998,
Sutton et al 1998). The preintegration complex is able to enter the
nucleus without mitosis, and therefore lentiviral transduction does
not require the induction of HP cells into cell cycle. This
increases the likelihood that the cells remain pluripotent. The use
of lentiviral vectors in gene therapy against HIV-1 has been
reviewed (Mautino and Morgan 2002).
[0205] Other groups of retroviruses such as spumaviruses, for
example the foamy viruses (Vassilopoulos et al 2001) are also
capable of efficiently transducing non-dividing cells.
[0206] Other types of viral vectors that can be used in the
invention include adenoviral vectors (Fan at al 2000, Knaan-Shanzer
et al 2001, Marini et al 2000), adeno-associated viral (AAV)
vectors (Fisher-Adams et al 1996), SV40 based vectors (Strayer at
al 2000), or forms of hybrid vectors (for example Feng et al, 1997
or Lieber at al 1999). Adenoviral vectors can be readily produced
at high titers, that can be easily concentrated (10'' pfu/ml), and
can transduce non-dividing cells. Large DNA inserts can be
accommodated (7-8 kb). Immune reactions against adenovirus in vivo
can be alleviated by removing genes encoding certain proteins.
[0207] AAV vectors are non-pathogenic, transduce both proliferating
and non-proliferating cells including CD34.sup.+ cells, and
integrate stably into the cellular genome (Grimm and Kleinschmidt
1999). Moreover, they do not induce a host immune response and can
be produced in helper-free systems to high titers of about
10.sup.10 cfu per ml. AAV is a non-enveloped virus with a
single-stranded DNA genome. AAV vectors can readily incorporate up
to about 4 kilobases of new DNA, although recent studies have
extended this. AAV vectors can effectively transduce CD34.sup.+
cells in long-term cultures (Chatterjee et al 1999).
[0208] Vectors which result in integration of the introduced gene
into the cell genome are preferred, to obtain a long lasting effect
after return of cells into a patient, for example retroviral
vectors including lentiviral vectors, and AAV vectors. Integrating
viral vectors are herein defined as those which result in the
integration of all or part of their genetic material into the
cellular genome. They include retroviral vectors and AAV vectors.
They also include hybrid vectors such as adenoviral/retroviral
vectors (for example, Feng et al 1997) and adenoviral/AAV vectors
(for example Lieber et al 1999). However, vectors that replicate
stably as episomes can also be used. It is also desired that the
vector can be produced in cell lines to a high titre, in a
cost-effective manner, and have minimal risk for patients, for
example not giving rise to replication competent virus.
Vector Production
[0209] Methods for constructing and producing retroviral vectors
are reviewed in Gambotto et al (2000). The vectors are packaged in
packaging cell lines such as the PA317 or AM-12 cell lines which
contain helper vector(s) that is itself defective in packaging.
Several variations in the methods for producing high-titer
retroviral supernatants have been described (Schilz at al 2001),
including variations in the medium, packaging cells, temperature of
harvest and concentration methods by centrifugation or complexation
(Le Doux et al 2001). Any of these methods can be used with this
invention.
[0210] Retroviruses packaged in murine amphotropic envelopes may
not transduce primitive HP cells efficiently due to low levels of
the amphotropic receptor (Bodine et al 1998). However, cell cycle
induction has been shown to lead to increased expression of the
amphotropic receptor with a concordant increase in gene transfer
(Orlic at al 1999). An alternative approach is to pseudotype
retroviral vectors with envelopes such as the envelope from gibbon
ape leukemia virus (GALV) (Kiem et al 1997, Eglitis and
Schneiderman 1997, Relander et al 2002), vesicular stomatitis virus
(VSV-G protein) (Naldini et al 1996, von Laer et al 1998) or feline
endogenous virus (Kelly et al 2002). Pseudo-typing vectors may
allow concentration, for example by centrifugation.
[0211] AAV vectors may be produced in packaging cell lines or cells
expressing the AAV rep and cap genes either constitutively or
transiently. Production of AAV vectors has been reviewed (Grimm and
Kleinschmidt 1999) including the development of helper-free
packaging methods and the establishment of vector producer lines.
Adenoviral vectors can be produced and purified according to
standard methods (eg. see Fan et al 2000).
[0212] The biological titre of viral stocks can be readily
determined (for example Tavoloni et al 1997).
Expression of the Gene in Vectors
[0213] The introduced gene is expressed in the transduced human HP
cells of this invention or progeny cells from a promoter. The
promoter may be constitutively expressed or inducible, for example
being expressed preferentially under favorable conditions or
circumstances (for example Chang and Roninson 1996, Saylors et al
1999). Targeted expression to specific cell types may be preferred
with some genetic disorders such as hemoglobinopathies or
thalassemias (Grande et al 1999). The promoters/enhancers of viral
vectors such as the MoMLV retroviral LTR promoter can be modified
for improved expression (Robbins et al 1998, Helene et al 1999) or
modified by insertion of elements such as insulators (Rivella et al
2000) or scaffold attachment regions (SAR) (Murray 2000). Preferred
promoters and additional regulatory elements, such as
polyadenylation signals, are those which should yield maximum
expression in the cell type (eg T-lymphocytes) which the gene
therapy agent is to be expressed in. Thus, for example, HIV-1,
HIV-2, HTLV-1 and HTLV-2 all infect lymphoid cells, and in order to
efficiently express the gene therapy agent against these viruses, a
transcriptional control unit (promoter and polyadenylation signal)
are selected which provide efficient expression in hematopoietic,
particularly lymphoid cells (or tissues). Preferred promoters are
the cytomegalovirus (CMV) immediate early promoter, optionally used
in conjunction with the growth hormone polyadenylation signals, and
the promoter of the Moloney-MuLV LTR. A desirable feature of an LTR
promoter is that it has the same tissue tropism as does the
retrovirus of its origin. The CMV promoter is expressed in
lymphocytes. Other promoters include VA1 and tRNA promoters which
are dependent on RNA polymerase III. The metallothionein promoter
has the advantage of inducability. The SV40 early promoter exhibits
high level expression in vitro in bone marrow cells. Hematopoietic
cell-specific promoters can be used instead of viral promoters (for
example Malik et al 1995).
[0214] Expression of several anti-HIV genes from MoMLV-based
vectors was maintained long term (Austin et al 2000, Su at al
1997). Vectors based on retroviruses other than MoMLV have shown
prolonged expression, for example for mouse stem cell virus (MSCV)
vectors (Chemy et al 2000) or FrMLV (Cohen-Haguenauer et al 1998).
Expression from lentiviral vectors also appears to be maintained in
transduced cells (Case et al 1999). Loss of gene expression from
retroviral vectors has sometimes been observed after transduction
of murine hematopoietic cells (Challita and Kohn 1994, Lange and
Blankenstein 1997) but has rarely if ever been observed in
transduced human HP cells in humans.
Transduction Methods
[0215] In the case of transduction with some murine retroviral
vectors, the human HP cells may need to be treated with growth
factors to induce cell cycle (see above). This may not be the case
with other retroviral vectors. Following any such treatment, the
cells need to be contacted with the transducing vector.
[0216] In the transduction method of this invention, it is
preferable to use the extracellular matrix protein fibronectin (or
chymotryptic fragments of fibronectin) which enhances
colocalization of cells and viral particles and increases
transduction frequencies (Hanenberg at al 1996, Hanenberg et al
1997, Kramer et al 1999, Williams et al 1999), or more preferably
the recombinant fibronectin fragment CH-296. Equivalent fragments
containing the heparin-binding domain and the alternatively spliced
type 3 connecting segment region can also be used (Kiem et al
1998). Use of CH-296 may also aid in the maintenance of the
regenerative potential of the HP cells as shown in a mouse
xenograft model (Dao et al 1998). Use of CH-296 and growth factor
combinations was used in a canine model (Goerner et al 1999) but it
was not known how this would apply to humans. Other colocalization
agents such as polybrene and protamine sulfate can also be used.
These agents act by increasing the apparent titer of viral
particles.
[0217] Physical colocalization of cells and vector can also be
achieved on membrane filters (Hutchings et al 1998) or by
centrifugation in fibronectin-coated tubes (Sanyal and Schuening
1999).
[0218] Cocultivation of the HP cells on monolayers of the
vector-producing murine fibroblasts leads to efficient gene
transduction but is not clinically useful as it would expose
patients to large numbers of infused murine cells (Helene and Kohn
2000). In contrast, human mesenchymal stem cells can provide
stromal support for efficient CD34.sup.+ transduction (Reese et al
1999).
[0219] Serum-free methods of preparing retroviral vectors for
transduction of human HP cells can be used (for example Glimm et al
1998, Schilz et al 1998). The transduction frequency can be
increased, particularly for CD34.sup.+CD38low cells, in the
presence of fibronectin fragment by reducing the concentration of
the vector containing medium or preloading of the vector alone onto
the fibronectin fragment (Relander et al 2001). Increased
transduction frequency can also be achieved by enriching the virus
preparations, for example with cationic and anionic polymers
(LeDoux et al 2001).
[0220] Transfection of cells by non-viral means can be achieved by
the use of cationic liposomes, or DNA-protein complexes such as
poly-lysine-DNA complexes, or other means known in the art.
[0221] Several authors have reviewed conditions for gene transfer
into human hematopoietic cells (Moore and MacKenzie 1999, Sadelain
et al 2000).
Transduction Frequency
[0222] The frequency of transfer of genes into human HP cells can
be determined by standard methods, for example PCR or fluorescent
detection (Gerard et al 1996). Transduction frequencies of up to
70-100% have been obtained with retroviral vectors, but this was
for relatively small cell samples (Helene et al 1999). Scaling up
to clinically relevant levels of material generally results in
lower transduction frequencies, particularly for the more primitive
HP cells that are needed for long-term reconstitution (eg in the
range 1-5% without colocalization agents).
[0223] It has been suggested that greater numbers of transduced
human HP cells could be obtained by expansion in vitro. However,
this can lead to loss of totipotency of the cells and stem cell
damage (Bunting et al 1999, Briones et al 1999, Takatoku et al
2001). It is preferred that expansion in vitro be kept to a
minimum, although some culture conditions allow some expansion of
the HP cells without loss of repopulating potential (Kobari et al
2000, Lewis and Verfullie 2000, Rosler at al 2000). For example,
the combination of cytokines Flt3-Ligand, SCF and thrombopoietin
(TPO) can be used (Ng et al 2002). Further addition of IL-3 and
IL-6 was not preferred (Herrera et al 2001). Alternatively or
additionally, culture of the cells post-transduction with SCF alone
for two days can improve engraftment potential (Dunbar et al 2001).
Treatment to de-activate the cells post-transduction may improve
engraftment potential.
[0224] The frequency of transduction of human HP cells isolated
from umbilical cord blood with retroviral vectors was increased
when the cord blood was first cryopreserved (Orlic et al 1999).
[0225] The transduced human HP cells can also be enriched by
introducing marker genes such as ones encoding cell-surface
reporters (for example see Fehse et al 1997), however this may not
be desirable in a clinical setting.
[0226] Transduction frequencies can be measured by any of the
methods well known in the art, for example by PCR, growth of
colonies in the presence of selective agents such as G418 when a
selectable marker is included in the construct, or
fluorescence-activated sorting. It is preferred that the
transduction frequency is measured on a truly representative sample
of cells from the total population, for example by quantitative PCR
methods (eg real-time PCR) on total DNA from a sample of the cell
population. Analysis of transduction frequencies on individual
colonies produced from cells in the population is not preferred,
but not excluded.
[0227] We have found in this invention that a minimum number of
transduced human HP cells must be used for prolonged engraftment.
Moreover, the transduced HP cells must be capable of undergoing
thymopoiesis in order to give rise to differentiated multi-lineage
leukocytes.
Types of Genes Introduced
[0228] Any gene can be introduced by transduction into human HP
cells for this invention. The gene may be used to correct immune
deficiencies, including severe combined immunodeficiencies. For
example, vectors expressing the adenosine deaminase gene, the RAG1,
RAG2 or recombination/DNA repair process genes that are defective
in the Alymphocytosis type of SCID, the CD45 gene, or the .gamma.c,
Jak3, IL-7 R.alpha. genes can all be used (Cavazzana-Calvo 2001).
Lysosomal storage diseases such as Gauchers Disease, the most
prevalent human lysosomal storage disorder, can be treated. Vectors
encoding the glucocerebrosidase (GC) gene such as the MFG-GC
retroviral vector (Takiyama et al 1998) can be used for the
treatment of Gauchers disease (Dunbar et al 1998a, Dunbar et al
1998b). Chronic Granulomatous Disease (CGD) results from defects in
NADPH oxidase, a multisubunit enzyme with four components, and can
be corrected with the appropriate gene such as the p47phox gene or
the gp91phox gene. Glucose-6-Phosphate dehydrogenase deficiency,
which is relatively prevalent in humans, can be treated with the
G6PD gene (Rovira et al 2000). Fanconi's Anemia, which results from
defects any one of at least eight genes, can be corrected with the
appropriate gene, for example by the complementation group C gene
(Liu et al 1999). Hemaglobinopathies can be corrected, as can
Glanzmann thrombasthenia (Wilcox et al 2000), and Fabry disease
(Takenaka et al 2000), each with the appropriate gene. CD34.sup.+
cells can be transduced with myeloprotective genes such as MDR-1 as
part of treatment for hematopoietic malignancies including
leukemias, myelomas and lymphomas as well as non-hematopoietic
malignancies where chemotherapeutic regimes would result in
myeloablation (for example, Abonour et al 2000, Michallet et al
2000). Non-myeloablative conditioning can be used in such cases
(Nagler et al 2000). If there is the potential for deleterious
effects of expression of the gene on HP cell function where this is
not desired, expression of the gene can be controlled by
regulatable promoters, well understood in the art.
[0229] It should be considered that the presence of a
constitutively expressed foreign gene in transduced HP cells might
interfere with the processes of stem cell migration, homing and
differentiation. An immune response directed at a protein might
also lead to elimination of gene-containing cells. This has been
seen after adenovirus-mediated gene delivery but does not normally
occur after retroviral-mediated gene delivery or introduction of
genes into CD34.sup.+ cells. Immunologic reactions to the neo gene
product are not generally observed. We have found in this invention
that the introduction of a constitutively expressed foreign gene in
two different retroviral vectors did not interfere with the
processes of stem cell migration, homing and differentiation.
Moreover, the use of human HP cells as the target for correction of
genetic diseases is expected to be advantageous in that development
of immunologic tolerance to the transgene product may be induced in
such cells (Helene and Kohn 2000).
[0230] Furthermore, RNA products from the transgene such as
ribozymes are expected to have negligible immunogenicity. The
RevM10 gene encoding an anti-HIV protein did not inhibit the
differentiation of transduced human CD34.sup.+ cells in SCID mice
(Su et al 1997, also Yu et al 1995). Proteins such as INFalpha have
been expressed in CD34.sup.+ cells without affecting engraftment
and differentiation in NOD/SCID mice (Quan et al 1999).
[0231] Furthermore, human HP cells can be modified to provide them
with a selective advantage in vivo in certain circumstances (for
example Kirby et al 2000) or in the presence of selective agents
(Omori et al 1999, Pegg et al 2000).
EXAMPLES
Example 1
Reagents
[0232] All steps were performed aseptically in a Class II
Biological Safety Cabinet.
1.1. DNAse Solution (10 mg/ml).
[0233] Stock DNAse solution was used in the preparation of
CD34.sup.+ cryopreservation medium. 1.4 ml sterile saline solution
(Sterile saline inhalation solution USP (0.9% NaCl), Dey Corp.
NDC#49502 830) was added to DNAse (DNAse I Type ITS, Sigma
Cat#D-4513) in a 1.5 ml sterile screw-capped eppendorf tube
(Sarstedt, Cat#72692005) and dissolved by gently agitation. Stored
at -20.degree. C. 1 ml stock DNAse was used for every 50 ml
cryopreservation medium.
1.2 PBMC Cryopreservation Medium (90% FBS+10% DMSO)
[0234] PBMC Cryopreservation Medium was used for the
cryopreservation of PBMC cells for archival and safety testing
purposes. The medium is constituted to provide maximum viable
recovery of PBMC cells upon thaw. It contains 90% Fetal Bovine
Serum (StemCell Technologies, Cat#HCC-6450) and 10% DMSO (Sigma,
Cat#D-2650), filter sterilized and stored in 4 ml aliquots. Once
opened, an aliquot was reserved for the exclusive use of one
patient.
1.3 CD34.sup.+ Cryopreservation Medium.
[0235] This was used for the cryopreservation of CD34.sup.+ cells
for archival and safety testing purposes. The medium is constituted
to provide maximum viable recovery of CD34.sup.+ cells upon
thawing. This procedure was used for the preparation of 50 ml
cryopreservation medium:
[0236] The following were pipetted into a sterile 50 ml tube, in
this order:
[0237] 31 ml IMDM (Iscove's Modified Dulbecco's Medium, Gibco BRL,
Cat 12440-046).
[0238] 10 ml DMSO (Dimethyl Sulphoxide; Sigma, Cat#D-2650)
[0239] 8 ml Albuminarc25.TM. (25% Human Serum Albumin (HSA);
American Red Cross, Cat#451-0513)
[0240] 15 .mu.l Heparin solution (Heparin 10,0000/ml; Elkins-Sinn
Inc.)
[0241] 1 ml DNAse stock solution (10 mg/ml), see 1. above The
components were mixed thoroughly by swirling. To filter sterilize,
the mixture was filtered through a Corning 150 ml filter system
(Corning Cat#25932-200). Aliquots of 4 ml in 5 ml sterile Nunc
tubes were stored at -20.degree. C.
[0242] One tube (4 ml) per patient was used for archival samples
and co-cultivation samples. The cryopreservation medium was thawed
and kept at 4.degree. C. until ready for use. (DMSO is toxic to
cells at higher temperatures).
1.4 MGDF (100 .mu.g/ml Recombinant Human Pegylated
Megakaryocyte Growth and Development Factor)
[0243] The recombinant human pegylated Megakaryocyte Growth and
Development Factor was used for stem cell culture to promote cell
growth and retroviral transduction. It was prepared and aliquotted
as a 100 mg/ml working stock solution and added to the stem cell
culture medium at a final concentration of 100 ng/ml.
[0244] The contents of a MGDF vial (Amgen Inc., 500 mg/ml
recombinant human pegylated MGDF in 1 ml 10 mM sodium acetate
containing 5% sorbitol, pH 5) and some IMDM culture medium
(Iscove's Modified Dulbecco's Medium; Gibco BRL Cat#12440-046) were
warmed to room temperature. Using aseptic technique, 1 ml of MGDF
solution was withdrawn from the vial and transferred to a sterile
15 ml tube (polypropylene conical tube; Corning Cat#25319-15 or
Falcon Cat#352097). The MGDF was diluted to 5 ml final volume with
4 ml of IMDM to create a 100 mg/ml working stock solution. Aliquots
(1 ml) of working stock solution were transferred to sterile screw
cap microcentrifuge tubes (Sarstedt Cat#72692005).
[0245] Once prepared, the MGDF working stock solution has a limited
shelf life of 3 days. Prepared MGDF aliquots were stored at
4.degree.-8.degree. C. for up to three days without freezing. A
batch of MGDF was prepared fresh for each patient on the day of
CD34.sup.+ cell preparation (day 0 of culture). For each patient,
working stock aliquots of MGDF were prepared from a separate vial
of material that was discarded after use. Sufficient aliquots are
prepared for at least five individual cell culture medium
preparations.
1.5 Stem Cell Factor (50 .mu.g/ml Recombinant Methionyl Human Stem
Cell Factor).
[0246] The recombinant methionyl human Stem Cell Factor was used in
stem cell culture medium to promote cell growth and retroviral
transduction. It was prepared as a 50 mg/ml stock solution and used
at a final concentration of 50 ng/ml.
[0247] Vial of SCF vial (Amgen Inc., 1875 mg lyophilized
recombinant human methionyl SCF) and IMDM culture medium (Iscove's
Modified Dulbecco's Medium; Gibco BRL Cat#12440-046) were warmed to
room temperature. Using aseptic technique, 1.25 ml of sterile water
was drawn up through a needle into a syringe and injected into the
SCF vial. The SCF was reconstituted by swirling without shaking.
Using a fresh needle and syringe, 0.2 ml of the SCF solution was
withdrawn and added to a 15 ml sterile conical tube containing 5.8
ml of IMDM. This made 6 ml of a 50 mg/ml working stock solution.
Using a sterile 5 ml pipette, 1 ml aliquots of SCF working stock
solution were transferred to sterile microcentrifuge tubes.
[0248] Prepared SCF aliquots were stored at 4.degree.-8.degree. C.
for up to three days without freezing. The 50 mg/ml stock was
prepared fresh for each patient on the day of CD34.sup.+ cell
preparation (day 0 of culture). A separate vial of material was
used for each patient. Each aliquot was single-use only for daily
cell culture medium preparation.
1.6 Nevirapine (5 mg/ml Nevirapine-Virimmune.TM., 18.7 mM)
[0249] Nevirapine (Virimmune.TM.) was used to inhibit the
replication of HIV in the CD34.sup.+ stem cell cultures during the
period of cell culture and retroviral transduction. Nevirapine was
prepared and aliquotted as a 5 mg/ml (18.7 mM) stock solution and
added to the cell culture medium at a final concentration of 500
nM. A single batch of nevirapine working stock was prepared for the
entire clinical trial. This stock was aliquoted to provide three
vials per patient for each day of culture medium preparation.
[0250] Approximately 100 mg of Nevirapine anhydrous powder
(Boehringer Ingelheim. Mfr#43074) was weighed into a 50 ml tube
(Bluemaxm 50 ml sterile polypropylene centrifuge tube; Falcon
Cat#2098). Ethanol (200 Proof Dehydrated Alcohol USP, Punctilious;
Quantum Chemical Corp) was added to the tube to make a 5 mg/ml
solution. 0.5 ml aliquots of 5 mg/ml working stock solution were
transferred to 1.5 ml sterile screw-capped microcentrifuge tubes
(Sarstedt Cat#72692005) and stored at -20.degree. C.
[0251] The Nevirapine stock solution was thawed at room temperature
before use. Each aliquot was single-use for daily cell culture
medium preparation.
1.7 Fetal Bovine Serum.
[0252] Fetal bovine serum was a constituent of the CD34.sup.+
culture medium and was used at a concentration of 20%. The viral
supernatants used for transduction contained 10% FBS and therefore
were supplemented with 10% FBS before use in transduction of the
CD34.sup.+ cells.
[0253] FBS, supplied in 500 ml bottles, was aliquoted into 50 ml
volumes to minimize wastage. The serum (Fetal bovine serum, 500 ml;
Stem Cell Technologies HCC-6450) was thawed in a 37.degree. C.
water bath, mixed by swirling without shaking until visibly
homogeneous and aliquoted aseptically into 50 ml volumes in 50 ml
centrifuge tubes (Bluemax.TM. 50 ml sterile polypropylene
centrifuge tube; Falcon Cat#2098). The aliquots were stored frozen.
Each aliquot was single use for daily medium preparation.
1.8 Preparation of CD34.sup.+ Culture Medium.
[0254] Isolated CD34.sup.+ cells were grown in this culture medium
for at least one day before transduction. The medium was designed
to maintain high viability of progenitor cells. This procedure is
for the preparation of 500 ml of medium:
[0255] The following were pipetted into a filter funnel (0.45 .mu.m
filter flask with 500 ml receiver; Nalgene cat#SFCA 162-0045) in
this order:
400 ml IMDM (Iscove's Modified Dulbecco's Medium; Gibco BRL, Cat
#12440-046).
[0256] 100 ml FBS (Fetal bovine serum 2.times.50 ml aliquoted
according to 1.2 above) 500 ml SCF (see 1.5 above) 500 ml MGDF (see
1.4 above) 13.3 ml nevirapine (see 1.6 above)
[0257] Vacuum was applied until half had passed through, then the
contents swirled gently to mix. Filtration was completed and the
contents swirled again.
[0258] The CD34.sup.+ culture medium was prepared fresh when
required. It was stored at room temperature in a light protected
environment until approximately 30 minutes before use, then warmed
to 37.degree. C. in a water bath. Medium in excess of immediate
requirements was labeled with the patient CRF ID# and stored at
4.degree. C. It was not used for any other patient and discarded
when the patient cell culture/transduction/harvest procedure was
completed.
1.9 Protamine Sulphate.
[0259] Protamine facilitates binding of the vector in viral
conditioned medium to target CD34.sup.+ cells.
[0260] Protamine Sulfate from ampoules (Elkin-Sinn, 5 ml, 10 mg/ml)
was aliquoted to minimise wastage. Each CD34.sup.+ transduction
used 2 aliquots per patient so approximate 0.5 ml aliquots were
dispensed into 10.times.1.5 ml sterile screw-capped microfuge
tubes. These were stored at 4.degree. C. without freezing. One vial
was used on each day of transduction (day 1 and day 2) for
preparing the VCM transduction mix. Aliquots were single use and
discarded after VCM preparation on each day.
1.10 VCM Transduction Mixes with Protamine Sulfate.
[0261] Cultured CD34.sup.+ cells were transduced with Virus
Conditioned Medium (VCM) made by Magenta Corporation (bIOrELIANCE
Corp.) under GMP conditions. There were two VCM preparations
corresponding to the ribozyme and control vectors. The PA317/RRz2
VCM was of a lower titer than the PA317/LNL6 VCM, therefore 300 ml
RRz2 or 200 ml LNL6 was used per transduction to equalise the
numbers of infectious viral particles in each transduction.
[0262] Transduction proceeded over two consecutive days. To make
VCM transduction mixes, each VCM was supplemented with growth
factors and serum to match the culture medium of the first day as
follows:
[0263] On Day 1, one 200 ml bottle of PA317/LNL6 VCM, two 200 ml
bottles of PA317/RRz2 VCM and 2.times.30 ml aliquots of Fetal
Bovine Serum were completely thawed at 37.degree. C. in a
waterbath. An aliquot of Nevirapine was thawed at room temperature
and other reagents warmed to room temperature: 1 aliquot Protamine
Sulfate, 1 aliquot SCF, 1 aliquot MGDF.
[0264] Preparation of the LNL6 mix was completed before starting
the RRz2 mix. To prepare the LNL6 VCM, the following were pipetted
into a filter funnel (Nalgene 0.45 mm filter flask with 500 ml
receiver, Nalge SFCA 162-0045) in this order:
20 ml FBS (see above) 80 ml protamine sulfate (see below) 220 ml
SCF (see above) 220 ml MGDF (see above) 6 ml nevirapine (see above)
200 ml PA317/LNL6 (PA317/LNL6-3; Magenta Corporation, titre
1.4.times.10.sup.7 ivp/ml).
[0265] The funnel was swirled gently to mix and vacuum applied to
filter the mixture.
[0266] The RRz2 VCM was prepared in the same fashion except that
the following volumes were used:
30 ml FBS
[0267] 132 ml protamine sulfate
330 ml SCF
330 ml MGDF
[0268] 9 ml nevirapine 300 ml PA317/RRz2 (PA317/RRz2-17R'; Magenta
Corporation, titre 0.8.times.10.sup.7 ivp/ml)
[0269] The remaining 100 ml RRz2 VCM was labeled with the CRF# and
immediately re-frozen at -80.degree. C. This was used on the second
day of transduction.
[0270] The same procedure was followed on Day 2 for preparation of
the second LNL6 and RRz2 VCM transduction mixes except that one 200
ml bottle of the PA317/RRz2 and the remaining 100 ml from Day 1
were used for the RRz2 mix.
[0271] Each VCM transduction mix was prepared fresh on each day of
transduction and stored in the biological safety cabinet until the
CD34.sup.+ cells were ready for transduction.
1.11 Preparation of Retronectin.RTM. (25 mg/ml Retronectin in
PBS).
[0272] Retronectin.RTM. (human fibronectin fragment CH-296)
solution was used to coat tissue culture vessels to facilitate
retroviral transduction of CD34.sup.+ cells.
[0273] 1 vial containing 2500 mg lyophilized Retronectin.RTM. from
Takara Shuzo Co. Ltd., code #T100B, ordered from BioWhittaker, was
warmed to room temperature. 2.5 ml of sterile water was added, the
material dissolved by gentle swirling, and removed with a syringe
with needle. The mixture was filtered through a Millex filter
(Millipore, cat #SLGV 0130S) into a 50 ml tube (50 ml sterile
tissue culture tube; Falcon Cat #2098) and diluted with 4 ml of PBS
split into two 50 ml tubes and made up to 100 ml total volume. 200
ml was removed for endotoxin testing at the same time as the final
product, the rest was stored at 4.degree. C. Generally, the reagent
was coated onto vessels immediately.
1.12 Preparation of 2% HSA (Human Serum Albumin in PBS).
[0274] 2% HSA was used to block the tissue culture vessels after
they were coated with Retronectin. It was prepared by aseptically
mixing 8 ml of 25% HSA solution (Albumarc25.TM.) with 92 ml PBS
(calcium & magnesium free, lx; Virus Core Lab or JRH
Biosciences Cat #59321-78P). The reagent was generally used
immediately.
1.13 Retronectin-Coated Vessels.
[0275] Flasks coated with Retronectin were used for some patients
to transduce CD34.sup.+ cells with retroviral vectors.
[0276] 25 ml of the Retronectin solution (see above) was pipetted
into 4.times.175 ml flasks (Bacterial plastic flasks 175 cm.sup.2,
with 0.2 .mu.m vented closures, Sarstedt 83.1812.502) and let stand
for 2 hours at room temperature. The solution was removed from the
flasks and 25 ml of the 2% HSA added. After a further 30 min at
room temperature, the solution was removed and the flasks washed
with 25 ml of IMDM (Iscove's Modified Dulbecco's Medium; GIBCO BRL,
Cat #12440-046). The flasks were sealed in plastic bags and stored
at 4.degree. C. before use within 2-3 days.
1.14 VCM Transduction Mixes (Used with Retronectin).
[0277] When retronectin-coated flasks were used for the
transductions, protamine sulphate was omitted from the VCM
Transduction Mixes. These were prepared in a similar fashion to
those described in 1.10. above except that the following volumes
were used:
[0278] For the first transduction in the morning of day 2, 200 ml
aliquots of the virus preparations were thawed in a 37.degree. C.
waterbath, as was an aliquot of the FBS. The LNL6 or RRz2 VCM
Transduction Mixes (with Retronectin) were prepared by adding into
a filter funnel (Nalgene 0.45 .mu.m filter flask with 250 ml
receiver, Nalge SFCA 162-0045) in this order:
10 ml FBS (see above) 110 ml SCF (see above) 110 ml MGDF (see
above) 3 ml nevirapine (see above) 100 ml PA317/LNL6 or 100 ml
PA317/RRz2 (see above)
[0279] The components were mixed by gentle swirling and sterilized
by filtration. Preparation of the LNL6 mix was completed before
starting the RRz2 mix.
[0280] For a second transduction in the evening, the remaining 100
ml of PA317/LNL6 and 100 ml of PA317/RRz2 were used in the same way
to prepare VCM Transduction Mixes. These were stored at room
temperature until used.
[0281] 1.15 VCM transduction mixes used with Retronectin (patients
8-10). VCM transduction mixes for patients #8-10 were prepared and
used in the same way except that the volumes used in the
preparation were doubled. Three rounds of transduction were
preformed over 2 days, namely on the evening of day 1, and morning
and afternoon of day 2.
[0282] 1.16 CD34.sup.+ cell Wash Buffer (PBS with Ca.sup.2+ &
Mg.sup.2+, +1% HSA).
[0283] CD34.sup.+ wash buffer containing 1% (final concentration)
HSA was used for washing of the cells prior to infusion of the
transduced CD34.sup.+ cells. 1 L wash buffer was used per patient
and was prepared fresh or several days in advance.
[0284] From a new 1 L bottle of PBS, 40 ml of PBS was removed with
a sterile 25 ml pipette so that approx 960 ml remained. 40 ml of
25% HSA solution (25% HSA Solution, Albumarc25.TM.) was aseptically
transferred to the PBS bottle using a 50 ml syringe with 18 gauge
needle attached, and mixed well by swirling, without shaking. The
Wash Buffer was stored at 4.degree. C. and warmed to 37.degree. C.
before use. A 1 L batch was for the exclusive use of one patient
and was single-use only, any remainder was discarded.
1.17 CD34.sup.+ Infusion Buffer (RPMI, phenol red free, +5% Human
Serum Albumin).
[0285] CD34.sup.+ Infusion buffer is designed to maintain viability
of the transduced CD34.sup.+ cell harvest until transfused. The
RPMI was free of phenol red as it was used for direct infusion into
the patient. It contained human serum albumin at 5% final
concentration.
[0286] 100 ml was used for suspension of each batch of harvested
cells after washing. This buffer can be made fresh on the day of
harvest/infusion or can be prepared several days in advance.
[0287] Using a 25 ml sterile pipette, 80 ml phenol red-free RPMI
(Phenol Red free, Gibco-BRL, Cat 118-030) was transferred to a 250
ml conical centrifuge tube. 20 ml 25% HSA solution
(Albumarc25.TM.), American Red Cross, was added aseptically using a
25 cc syringe with 21 gauge needle attached. The mixture was
swirled gently. If the reagent was prepared in advance, it was
stored at 4.degree. C., but if prepared fresh on the day of
harvest, it was stored at room temperature until use. The mixture
was prewarmed to 37.degree. C. before use. A 100 ml batch was for
the exclusive use of one patient and was single-use only.
1.18 Preparation of FACS PBS (PBS, Ca.sup.2+ & Mg.sup.2+ free,
+2% Fetal Bovine Serum +0.1% NaN.sub.3).
[0288] FACS PBS is a wash buffer that was used to wash the cells
during the FACS staining procedure. Additionally, if FACS analysis
was performed immediately after staining (ie within the next 4-6
hours) it was used to resuspend the stained cells.
[0289] An Azide stock solution (10%) was prepared by dissolving 4 g
of sodium azide in a 50-ml tube in distilled water. The FACS PBS
solution was prepared by adding to 48.5 ml of PBS, in a 50 ml tube,
1 ml fetal bovine serum and 0.5 ml of the sodium azide solution.
The solutions were stored at 4.degree. C. The azide stock solution
has an unlimited shelf life, the FACS PBS has a shelf life of 1
year. The FACS PBS was used chilled.
1.19 Preparation of FACS Blocker (5% Human AB serum in PBS,
Ca.sup.2+ and Mg.sup.2+ free).
[0290] This was used in the FACS antibody staining reaction to
reduce non-specific background staining of the cells. It contained
5% human AB serum (Sigma cat #H-4522, stored at -20.degree. C.,
thawed in a 37.degree. C. waterbath) diluted in sterile PBS
(calcium & magnesium free, lx; Virus Core Lab or JRH
Biosciences cat #59321-78P). It was filter sterilized through an
Acrodisc 0.45 .mu.m filter (Gelman #4184) and stored as 1 ml
aliquots at -20.degree. C.
[0291] 1.20 Preparation of FACS Paraformaldehyde fixative (PBS, Ca
& Mg free, 2% paraformaldehyde).
[0292] The FACS Paraformaldehyde is a fixative solution that
preserves cells after antibody staining for FACS anaysis. Used at
1% concentration to resuspend cells after FACS staining, the
antibody staining will remain stable for up to at least 3 days.
After this time, the background signal from the fluorescent
antibodies may increase. It contained 10 ml of 10% paraformaldehyde
(Polysciences) 04018) mixed with 40 ml of PBS and was stored at
4.degree. C. Cells were suspended in 200 .mu.l of PBS and then
fixed with 200 .mu.l of this buffer to create a working
concentration of 1%.
1.21 Urea Lysis Buffer
[0293] Urea lysis buffer was used to prepare cell lysates for
phenol extraction of DNA. It contains 84 g urea
(Boehringer-Mannheim 1685 899), 4 g SDS (USB 21651), 1 ml 0.2M
EDTA, 1 ml 1M Tris base, 1 ml 1M Tris HCl, 14 ml 5M NaCl in a final
volume of 200 ml in water. This solution was filtered through a
0.45 g filter and stored at room temperature.
Example 2
Phase I Clinical Trial
[0294] We performed a phase I gene therapy clinical study to
investigate whether i) the introduction of an anti-HIV-1 ribozyme
into circulating hematopoietic progenitor cells could result in the
emergence of thymic emigrants bearing vector sequences, ii) normal
T-lymphocyte maturation could take place in genetically modified
cells, iii) vector presence and expression could persist long-term
and iv) the ribozyme could confer a survival advantage to HIV-1
vulnerable cells (Amado et al. 1999).
[0295] For transduction of cells with a ribozyme gene, RRz2 was
used. RRz2 encodes the hammerhead ribozyme Rz2, which is directed
against a highly conserved region of the tat gene of HIV-1. The DNA
sequence encoding Rz2 was sub-cloned into a Sal-I site within the
untranslated region of the neomycin phosphotransferase (neo.sup.R)
gene in pLNL6 (Bender et al 1987) to make RRz2. The ribozyme is
expressed as a neo-ribozyme transcript from the MoMLV LTR in RRz2.
To control for the potential ribozyme-specific effects on
progenitor cell engraftment and T-lymphoid development, and to
study potential effects on T-lymphocyte survival conferred by Rz2,
progenitor cells were also transduced with the control retroviral
vector LNL6.
[0296] In this study, HIV-1 infected patients with viremia less
than 10,000 copies/ml and CD4 counts between 300 and 700
cells/mm.sup.3 underwent mobilization of peripheral blood
progenitor cells (PBPC) with the cytokine granulocyte colony
stimulating factor (G-CSF) for 6 days. Patients received
granulocyte colony stimulating factor (G-CSF) subcutaneously at a
dose of 10 .mu.g/kg daily for 6 days. PBPC procurement was carried
out by performing one blood volume of apheresis on days 5 and 6 of
G-CSF treatment using the COBE.RTM. Spectra.TM. Apheresis System
(Gambro BCT, Lakewood, Colo.). CD34.sup.+ cell selection was
performed using the CEPRATE.RTM. SC Stem Cell Concentration System
(CellPro Inc. Bothell, Wash.) (patients 1 to 7) and Isolex 3001
cell selection system (Nexell Therapeutics, Irvine, Calif.)
(patients 8 to 10). After purification of PBPC for CD34.sup.+
surface marker expression, cells were cultured for only one day in
CD34.sup.+ Culture Medium for induction into cycle using the
cytokine combination of megakaryocyte growth and development factor
(MGDF) and stem cell factor (SCF) (Amado et al 1998). MGDF and SCF
were supplied by Amgen Inc. (Thousand Oaks, Calif.) and used at a
concentration of 100 ng/ml and 50 ng/ml respectively.
[0297] Approximately, equal numbers of CD34.sup.+ cells were
transduced independently with the RRz2 and LNL6 vectors. The LNL6
and RRz2 producer cell lines were prepared in a two stage process
by transfecting the cDNA constructs, pLNL6 or pRRz2, into the psi2
packaging cell line to produce two populations of ecotropic
replication-incompetent virus. These two populations were then used
to infect the PA317 amphotropic packaging cell line (Miller and
Buttimore 1986). Clonal producer cell lines derived following
selection in G418, were checked for integrity of the constructs and
sent to BioReliance Corporation (Rockville, Md.) for manufacture of
a Master Cell Bank and subsequent manufacture of GMP virus with
safety testing. All batches of retroviral supernatant (LNL6 and
RRz2) were tested for sterility, replication-competent retrovirus
and general safety by BioReliance Corporation. Viral titers were
confirmed by infecting the NIH 3T3 cell line using serial dilutions
and scoring G418 resistance. LNL6 and RRz2 titers were
1.4.times.10.sup.7 and 0.8.times.10.sup.7 infectious viral
particles/ml respectively. Retroviral supernatant (VCM Transduction
Mix) was added once daily for two days for patients 1 to 3, twice
in one day for patients 4-7, and 3 times over 2 days for patients 8
to 10. For patients 4 to 10, transductions were performed in flasks
coated with the CH296 fragment of human fibronectin
(RetroNectin.TM., Takara Shuzo, obtained from BioWhittaker, Inc.
Walkersville, Md.). To inhibit potential HIV replication in vitro,
CD34.sup.+ cell cultures and transductions were carried out in the
presence of Nevirapine at a concentration of 500 nM (Boehringer
Ingelheim, Ridgefield, Conn.). Absence of HIV replication was
verified by measuring p24 antigen by ELISA in the final infusate
(all 10 samples had undetectable p24 levels). Fungal, bacterial and
mycoplasma cultures, as well as endotoxin assays were negative in
the final cell product for all 10 patients.
[0298] Following transduction, cells were pooled, tested for
sterility, cell count, viability, CD34/CD38 phenotype, p24, and
endotoxin, and then washed and infused into autologous recipient
patients without myelosuppression. This treatment schema is
illustrated in FIG. 5. Samples were kept aside for later testing in
CFC assays, RCR analysis and PCR analysis for transduction
efficiency.
[0299] Ten patients were enrolled on this study (Table 1). The
median age was 42 years (range 32 to 59). The median number of
antiretroviral regimens used was 3 (range 1 to 6). The total number
of CD34.sup.+ cells infused ranged from 1.3 to 10.1.times.10.sup.6
cells per kilogram of body weight (kg) (median
3.2+/-1.1.times.10.sup.6 cells/kg). Transduction efficiency for the
first 3 patients, carried out in the presence of protamine
sulphate, was low (range <1% to 4%), accounting for a number of
transduced CD34+ cells infused ranging from 0.01 to
0.08.times.10.sup.6 cells/kg (Table 1). Cells carrying the
transgene were detected up to 6 months in patient 1 (ribozyme in
bone marrow and peripheral blood mononuclear cells (PBMC), LNL6 in
granulocytes), up to 9 months in patient 2 (RRz2 in PBMC) and 12
months in patient 3 (LNL6 in PBMC and RRz2 in monocytes).
[0300] Table 1. Characteristics of the patients and of the
CD34.sup.+ cell infusion product. The Table shows patient's age,
gender, number of prior antiretroviral regimens (ART), use of
retronectin to support transduction, CD34.sup.+ purity, number of
infused CD34.sup.+ cells, percentage of transduction, and number of
transduced CD34.sup.+ cells infused.
TABLE-US-00001 TABLE 1 CD34 + Infused CD34+ Transduction Transduced
CD34+ Patient Age Gender ART Retronectin Purity (%) cells
(.times.10.sup.6/kg) (%) cells (.times.10.sup.6/kg) 01 59 M 1 No 65
3.38 0.4 0.01 02 44 M 4 No 80 2.08 4 0.08 03 40 M 4 No 66 2.98 2
0.06 04 44 M 6 Yes 67 1.29 10 0.13 05 37 M 6 Yes 94 10.01 7 0.70 06
32 M 3 Yes 90 1.63 32 0.52 07 41 M 3 Yes 96 8.45 48 4.06 08 46 M 2
Yes 98 9.37 57 5.34 09 48 M 3 Yes 93 1.64 36 0.59 10 38 F 1 Yes 95
5.07 28 1.42
[0301] To improve transduction efficiency, 7 subsequent patients
received autologous CD34.sup.+ cells transduced in the presence of
the CH296 fragment of human fibronectin (Hanenberg et 1997;
Hanenberg et al 1996). In these patients, transduction efficiency
increased to a median level of 32%+/-6.9 (range 7% to 57%) (FIG.
6). Calculation of transduction efficiencies was carried out by
performing competitive PCR in transduced CD34.sup.+ cells (Knop et
al 1999). Efficiencies were also determined by performing PCR for
vector sequences in single colonies grown from the final transduced
CD34.sup.+ cell product.
[0302] On average, transduction efficiency for LNL6 was 1.6 times
higher than that obtained with RRz2, probably reflecting
differences in vector titers. After a median follow up of 30 months
(range 12 to 36 months), transgenes were detected in all patients
at multiple time points and in multiple hematopoietic lineages. On
average, gene presence was found in 0.1 to 0.01% of PBMC
analyzed.
[0303] FIG. 7 shows long-term multilineage gene presence in a
representative patient. FIG. 7a shows LNL6 and RRz2 vector
sequences in peripheral blood mononuclear cells (PBMC), bone marrow
mononuclear cells (BMMC), T-lymphocytes and monocytes in patient 5
two years after infusion of transduced CD34.sup.+ cells.
T-lymphocytes and monocytes were selected from PBMC to a purity
>90%, as confirmed by flow cytometry. For each cell type, 4
replicates of a pool of samples are shown.
[0304] We also analyzed expression of the gene constructs in PBMC
using RT-PCR. RNA was prepared from PBMC selected by Ficoll-Hypaque
centrifugation of blood samples, using the Qiagen RNeasy kit
(Valencia, Calif.), following the manufacturer's instructions.
Residual DNA was removed by DNase digestion. RNA was
reverse-transcribed using Gibco Superscript Reverse Transcriptase
(Carlsbad, Calif.) with 7 replicates of each sample. Samples were
then pooled, and cDNA amplification was performed on 10 replicates.
Round 1 hot start PCR was performed using Promega Taq bead
(Madison, Wis.). Round 2 was performed using Perkin Elmer Ampliwax
gem (Boston, Mass.). FIG. 7b shows short- and long-term vector
expression of both LNL6 and RRz2 in PBMC up to 2 years
post-infusion in 3 representative patients using a radiolabelled
primer. For each sample, a reaction that did not contain
reverse-transcriptase (-RT) was included.
[0305] To determine whether transduced CD34.sup.+ cells could
undergo T-lymphocyte development in HIV-infected patients we
selected peripheral blood CD4.sup.+ and CD8.sup.+ cells for CD45RA
and CD62L surface marker expression, which characterize naive
T-lymphocytes (Sanders et al 1988; Tedder et 1985; Kansas 1996;
Picker et al 1993), and we analyzed these T-lymphocyte
subpopulations for the presence of LNL6 and RRz2.
[0306] Semi-quantitative PCR analysis was performed in leukocyte
subsets using primers directed against the neo.sup.R gene that
overlap the Rz2 sequence in the RRz2 vector. For PCR detection, DNA
was extracted from cell populations using the Acest Polymer
extraction method (Ward et al 1998). A DNA ratio control was
constructed by diluting DNA from CEM T4 cells transduced with LNL6
& RRz2 at a ratio of 1:5 (where LNL6=1) in a background of PBL
(negative) DNA to a concentration of 0.005% marked cells. Nested
(hot start) PCR was then performed in a 50 .mu.l PCR reaction
mixture. Primers used were 5L1A: CAC TCA TGA GAT GCC TGC AAG; 3L2A:
GAG TTC TAC CGG CAG TGC AAA; 5Nes1: GAT CCC CTC GCG AGT TGG TTC A
(Primers Round #1: 5Nes1 & 3L2A, Round #2: 3L2A and labeled:
5L1A). Ten replicates per sample were included in a Round 1 PCR of
17 cycles annealing at 68 C and denaturation at 94 C. The replicate
samples were then pooled and used as template for the Round 2 PCR
of 35 cycles with annealing temperature at 68 C and denaturation
temperature at 94 C. Quadruple product samples were resolved on a
5% denaturing PAGE gel, and quantitated using Molecular Dynamics
Imagequant software. PCR products for LNL6 and RRz2 were 174 and
216 base pairs respectively, and include a stretch of the
untranslated terminus of the neo.sup.R gene. Results were included
if the ratio control was within the acceptable limits (for a ratio
of 1:3.5 LNL6:RRz2 in a 0.005% vector containing sample, accepted
range was 1:1.1 to 1:6.9).
[0307] FIG. 7c shows detection of vector sequences in naive
T-lymphocytes. The gel shows PCR analysis for LNL6 and RRz2 vector
sequences in CD4.sup.+ and CD8.sup.+ T-lymphocytes, and in naive
T-lymphocytes subsets selected from peripheral blood in patient 7
two years after infusion of transduced CD34.sup.+ cells. Naive
T-lymphocyte populations were selected to purity >90% from CD4
and CD8 selected populations. T-lymphocytes and monocytes were
selected from PBMC using CD3 and CD14 MACS MicroBeads (Miltenyi
Biotec Inc., Auburn, Calif.). Naive T-lymphocytes were selected by
staining with a FITC-conjugated monoclonal IgG.sub.1 anti-CD45RA
antibody (Becton Dickinson, Franklin Lakes, N.J.) followed by
selection using an anti-FITC Multisort kit (Miltenyi Biotec Inc.,
Auburn, Calif.). Subsequently, CD62L selection was performed using
a murine IgG.sub.2a anti-CD62L antibody (Becton Dickinson, Franklin
Lakes, N.J.), followed by selection with rat anti-mouse IgG.sub.a+b
Microbeads (Miltenyi Biotec Inc., Auburn, Calif.).
[0308] FIG. 7(D) shows vector sequences detected in naive T-cell
subsets in patient 5 at 2.5 years.
[0309] FIG. 7(E) shows vector sequences detected in naive T-cell
subsets in patient 7 at 2 years.
[0310] FIG. 7(F) shows vector sequences detected in naive T-cell
subsets in patient 8 at 4 weeks post-infusion.
[0311] FIG. 8 shows a summary of detection of both ribozyme and
control vector transgene by semi-quantitative PCR in bone marrow
mononuclear cells (BMMC), PBMC, granulocytes, T-lymphocytes and
monocytes in all 10 patients up to 3 years post-infusion.
[0312] In all 10 patients, biological assays for replication
competent retrovirus (RCR) at the end of transduction using both
viral supernatant and cultured CD34.sup.+ enriched cells were
negative. RCR testing of the final cell infusate was performed on
5% of the culture supernatant at the end of transduction as well as
on 1% of the transduced CD34.sup.+ cells by co-cultivation, using a
2 passage amplification step in the Mus dunni cell line. The
resulting Mus dunni cell culture supernatants were then tested for
infectious retrovirus using the PG4 S+L- focus assay. Patient PBMC
samples analyzed by PCR for RCR 6 months and 1 year following
CD34.sup.+ cell infusion revealed no evidence of RCR. For RCR
detection in patient cells, DNA extracted from PBMC 6 months and 1
year after transduced-CD34.sup.+ cell infusion was analyzed for the
presence of amphotropic envelope sequences using the following
primers: 5'-CTA TGT GAT CTG GTC GGA GA-3' and 5'-CCA CAG GCA ACT
TTA GAG CA-3'. The assay allows the detection of replication
competent retrovirus by amplifying a highly conserved region that
encodes part of the host-determining region of the envelope gene,
which is required for infection of cells through the amphotropic
receptor. The amplified region is 289 base pair-long. The
sensitivity of the assay is 1 positive cell in a background of
10.sup.5 negative cells. As a positive control, the PA317-packaging
cell line was run in each assay. PCR products were resolved on a
2.5% NuSieve gel.)
[0313] For both vectors, we found a strong linear correlation
between the number of transduced CD34.sup.+ cells infused and the
persistence of gene detection at 2 years post-infusion in both PBMC
(LNL6 p=0.021; RRz2 p=0.034) and T-lymphocytes (p<0.0001 for
both LNL6 and RRz2). Spearman rank correlation was used to quantify
the relationship between the number of transduced cells
reintroduced and subsequent marking of progeny PBMC and T
lymphocytes. Analyses are based on values given in cells/kg for
each patient. In these analyses, LNL6 marking is correlated with
the quantity of LNL6-transduced cells reintroduced, and RRz2
marking is correlated with the quantity of RRz2-transduced cells
reintroduced. The minimum number of transduced CD34.sup.+ cells
that resulted in marking longer than one year was
0.5.times.10.sup.6 cells/kg.
[0314] Vector sequences were detected in naive cells up to 2.5
years post-infusion (the last time point evaluated). For example,
FIG. 7c shows presence of vector sequences in highly enriched naive
cells in a representative patient.
[0315] Vector sequences were detected in naive cells up to 3 years
post-infusion the last time point evaluated). FIGS. 7D-F show
vector sequences in highly enriched naive and memory cells from 4
to 130 weeks post-infusion in 3 patients. The average age and viral
load of patients whose naive T-lymphocytes had detectable vector
sequences were 41 years (range 32 to 48 years) and 3,680 copies/ml
(range: undetectable to 22,628 copies/ml) respectively. A summary
of vector detection is naive T-lymphocytes and viral load at the
time of detection is shown in Table 2. We also analyzed fine needle
aspirates of lymph nodes from 4 patients for the presence of vector
sequences. Both LNL6 and RRz2 were detected in 2 of the 4 patients
(patient 7 at 2.5 years post-infusion and patient 10, 1 year
post-infusion).
TABLE-US-00002 TABLE 2 Naive T-Cell Vector Detection Summary. PA-
TIENT NUM- <3 3 TO 6 6-12 12-24 >24 BER MONTHS MONTHS MONTHS
MONTHS MONTHS 1 NT NT + NT NT 660 2 NT NT + NT NT 12,893 3 NT NT -
- NT 782 ND 4 + NT + NT NT 590 22,628 5 NT NT + + ++ 3,183 3,899
130/15,800 6 NT ++ - - NT 368/606 2,905 7 + NT + + + 4,509 ND
12,496 ND 8 + NT NT NT NT ND 9 + NT + + NT ND ND ND 10 NT + + + NT
925 1,384 4,562 Circulating naive T-lymphocyte populations were
selected to purity >85% from CD4 and CD8 selected populations.
Cells were analyzed by PCR. Viral load at the time point of vector
analysis is shown under each symbol, ND: not determined. Two values
indicate that two determinations are available from a time
interval. NT: not tested; (+): LNL6, RRz2 or both vectors detected
in CD4.sup.+CD45.sup. +CD62L.sup.+ or
CD8.sup.+CD45.sup.+CD62L.sup.+ (naive) Tlymphocytes; (-): Neither
vector detected in CD4 or CD8 naive T-cells.
[0316] To determine whether the presence of the anti-HIV-1 ribozyme
in CD4.sup.+ cells conferred protection against HIV infection, we
measured LNL6 and RRz2 vector copy numbers by PCR in different cell
types over time. Intra-construct comparisons of marking decay rate
are implemented as mixed effect linear regression (Miller, 1986).
Marking intensity is regressed on (a) (log) time since infusion,
(b) an indicator of cell type, and (c) a time.times.cell type
interaction term (multiplicative product). Mixed linear models
analysis could be performed for these data because estimation
algorithms consistently converged (models fit in SAS PROC MIXED).
Intra-subject correlation of marking intensities was modeled using
a "repeated measures" blocking structure for the data. Throughout
these analyses, we fit models using either an unstructured
variance-covariance matrix for residuals, or assuming a compound
symmetric matrix. Substantively identical parameter estimates and
significance tests emerged from each type of analysis.
[0317] A more sustained level of RRz2 marking in HIV vulnerable
cell types than in cell types not subject to HIV-induced depletion
is consistent with Rz2-induced protection providing a selective
survival advantage for RRz2-transduced cells.
[0318] As shown in FIG. 9a, RRz2 marking decayed at approximately
one eighth the rate in peripheral blood T-lymphocytes than in BMMC
(-0.081 cells per log-week for T-lymphocytes vs. -0.643 cells for
BMMC per log-week, difference p=0.0095). Unlike the decay rate of
RRz2-containing BMMC, the rate of decay of RRz2-containing
T-lymphocytes was not significantly different from zero, and the
difference between both rates was significant (p<0.0001 for
BMMC, p=0.55 for T-lymphocytes, p=0.009 for the statistical test
comparing decay rates of RRz2-containing cells between both cell
types). To exclude the possibility that these results are due to
intrinsic decay rate differences between the cell types, LNL6
marking is shown in FIG. 9b. This analysis showed a decay rate of
LNL6 copies of -0.716 for T-lymphocytes and -0.725 for BMMC. Both
curves were significantly different from a zero decay rate curve (p
values 0.0019 and 0.004 for T-lymphocytes and bone marrow
respectively). The p value for the statistical test comparing the
decay rates of RRz2 between both cell types was 0.97 reflecting
near identical decay kinetics for the LNL6 vector. These
comparisons were implemented as mixed effect regression models
(Miller 1966). Consistent with the lack of protective activity
against HIV conferred by LNL6, no differential decay was observed
for LNL6 marking between these two cell types (p=0.9761), (FIG.
9b). These results show that statistically significant differences
in marking decay rates between the two vectors were observed in
favor of RRz2 in PBMC and T-lymphocytes, but equal decay rates were
observed between vectors in the case of BMMC and granulocytes.
Moreover, RRz2 containing naive T-lymphocytes increased over time,
whereas LNL6 containing ones declined (+0.145 vs. -0.240 per log
week for RRz2 and LNL6 respectively, difference p=0.033). These
results indicate that RRz2 confers a selective survival advantage
to HIV-vulnerable cells, including recent thymic emigrants, in
patients with HIV-1 infection.
[0319] We next sought to determine whether the magnitude of
differential decay between T-lymphocytes containing LNL6 and RRz2
was correlated with the number of RRz2-transduced CD34.sup.+ cells
that each patient received. To this end, the difference between
decay slopes between both vectors for each patient was correlated
with the number of RRz2-transduced CD34.sup.+ cells that were
infused. Patient-specific decay slopes for LNL6 and RRz2 marking
were calculated by linear regression, and the difference in slopes
(RRz2 LNL6) was taken as an indicator of RRz2-mediated protection.
Spearman rank correlation was used to examine relationships between
differential decay rates and the numbers of transduced CD34.sup.+
cells infused.).
[0320] Plots depicting this relationship for T-lymphocyte and PBMC
decay slopes are shown in FIG. 9c&d respectively. These
analyses demonstrate a strong linear relationship between the
number of transduced CD34.sup.+ cells that were infused and the
magnitude of differential decay of LNL6 vs. RRz2 in both PBMC and
T-lymphocytes. When reinfused RRz2-transduced CD34.sup.+ cell
numbers are taken as a continuous variable predicting the
differential decay of marking over time in a regression analysis,
results are statistically significant with p<0.0001 (Regression
coefficient t statistics for the interaction term in a regression
of differential marking (RRz2-LNL6) on (log) time, infused cell
number, and their product-term interaction). These data indicate
that there is an unexpected dose dependent effect on differential
survival between protected and unprotected HIV-1-vulnerable cells,
and that clinical benefit using hematopoietic progenitor cell gene
therapy strategies will be dependent on the dose of transduced
progenitors administered to patients.
[0321] All patients in this phase I study have been receiving
antiretroviral therapy and to date, none of the patients have
developed opportunistic infections. The kinetics of CDC cell count
and viral load are illustrated in FIG. 10. An initial increase in
viral load was observed at day 1 post-infusion in some patients who
discontinued antiretroviral therapy during the period of
mobilization. Drug discontinuation or substitution of nucleoside
reverse transcriptase inhibitors for non-nucleoside reverse
transcriptase inhibitor or protease inhibitor was included in the
protocol to prevent potential inhibition of MMLV reverse
transcriptase during transduction (H. Bazin, et al., 1989).
Occasional rises in viremia responded to modifications of
antiretroviral therapy.
[0322] The average change in CD34.sup.+ T-lymphocyte count from
entry to year 3 was an increase of 10 cells per mm.sup.3 (range -40
to +80). Viral load decreased by an average of 2.25 logs in 6
patients (range 0.35 to 3.9), remained undetectable in 3 patients,
and increased by 1 log in one patient. These changes did not
correlate with the degree or persistence of vector detection or
vector expression in any cell type, and are thought to be
influenced by individual viral susceptibility to antiretroviral
therapy.
[0323] Viral genotyping demonstrated multiple drug resistance
mutations in all patients (data not shown). We also performed
genotypic analysis of the Rz2 binding/cleavage region of HIV in all
patients at study entry and at 12, 24, 52 and 104 weeks post
treatment Ribozyme cleavage site analysis was done as previously
described (Wang et al. 1998) with minor modifications. Briefly,
viral RNA was extracted and reverse transcribed with the Access
RT-PCR kit (Promega, Madison, Wis.) using Primer 1
(TGGCAATGAAAGCAACACT) for 45 minutes at 48.degree. C. The resulting
cDNA was PCR amplified by addition of Primer 2
(TTTAGAGGAGCTTAAGAATGA) for 25 cycles (94.degree. C. for 20 sec.,
55' C. for 30 sec., and 68.degree. C. for 30 sec.). Single-stranded
DNA for cycle sequencing was produced by a second PCR step using
AmpliTaq (Perkin-Elmer) and Primer 3 (AGTTTTAGGCTGACTTCCTGG) for 25
cycles at 94.degree. C. for 20 sec., 55.degree. C. for 30 sec., and
68.degree. C. for 30 sec. Sequencing was performed on purified PCR
products with the ABI PRISM Dye termination cycle sequencing Ready
Reaction kit with AmpliTaq DNA polymerase (Perkin-Elmer) on an
automated DNA sequencer (ABI Model 377, Applied Biosystems, Foster
City, Calif.) using Primer 4 (TGGAAGCCATAATAAGAAT). Sequence
alignment was performed with Sequence Navigator software
(Perkin-Elmer) and manually proofread and edited. The resulting
sequence was compared to the HXB2 Glade B HIV-1 reference
strain.
[0324] Six of the 10 patients had viral loads that permitted
sequence determination. Patients 1, 2, 5 and 6 had wild-type
sequences. Patient 4 had an A to C transition at position -1 from
the GUA target triplet. Patient 7 had a G to T transition at
position -4 from the GUA target triplet. Evidence indicates that
the mutant RNAs are clearable by the ribozyme. The mutations
detected in both these patients were present before treatment;
hence they did not arise as a result of efficacy-induced resistance
to the construct.
[0325] The studies described here were conducted in the absence of
myelosuppression, therefore the engineered CD34.sup.+ cells
contributed to form a chimeric hematopoietic system. Transduced
CD34.sup.+ cells must compete with endogenous stem cells for
hematopoietic reconstitution. Indeed our results indicate a
correlation between cell dose and the length of engraftment with
transduced cells. Because no survival advantage is expected to
occur at the level of the transduced CD34.sup.+ cells, and given
the established correlation of survival to numbers of infused
CD34.sup.+ cells, future studies will aim to increase the number of
gene modified cells administered. Recently, it was reported that
genetic correction of the yc cytokine receptor deficiency that
characterizes human severe combined immunodeficiency (SCID)-X1
disease leads to the development of a functional immune system
(Cavazzana-Calvo et al. 2000). With regards to the application of
gene correction strategies, the HIV-infection model is different
from the SCID-Xl model. Unlike in the setting of HIV/AIDS, where
both transduced and non-transduced CD34.sup.+ cells can contribute
to thymopoiesis, in the SCID-Xl case, where the resulting
functional receptor mediates survival signals, thymopoiesis results
only from CD34.sup.+ cells that contain the exogenous gene. Thus,
in HIV infection, a survival advantage at the level of the
CD34.sup.+ T-lymphocyte resulting in an expansion of these
ribozyme-carrying cells would presumably take place in the presence
of HIV replication. In this case the virus provides the selective
survival pressure, as unprotected cells would remain vulnerable.
This hypothesis was not tested in our study, as our patients have
remained on antiretroviral therapy. It is possible that a greater
degree of preferential survival may occur in the presence of
uncontrolled viral replication.
[0326] These studies have shown that gene constructs can be
retrovirally introduced into CD34.sup.+ hematopoietic progenitor
cells, and that these cells will contribute long-term to
multilineage hematopoiesis in HIV-infected patients. Our study
represents the second report of a stem cell gene therapy trial in
HIV infection. A previous trial employing a retroviral vector
containing a rev-responsive element decoy gene in pediatric
patients resulted in detection of the anti-HIV gene in 2 of the 4
patients only on one occasion at day 1 following cell infusion.
Control vector was detected at low levels in all 4 patients at 30
days, in 3 patients at 90 days and in 1 patient 250 and 330 days
post-infusion (Kohn et al. 1999). These results contrast with our
long-term reconstitution results. Based on our results, the
short-term marking observed in the previous report seems to be due
at least in part to low doses of transduced CD34.sup.+ cells
administered. Whereas previous HIV gene therapy studies using
transduced T-lymphocytes have shown longer persistence of a
therapeutic vector as compared to a control vector up to a year
after infusion (Range et al. 1998), ours is the first report to
indicate that T-lymphocyte development ensues long-term from
genetically modified hematopoietic progenitors in the context of
HIV infection, and to show evidence of cell protection of naive and
memory T-lymphocytes against HIV-induced depletion. The finding
that sustained production of transgene-containing naive
T-lymphocytes occurs even in patients with detectable viremia is
significant, given that naive thymocytes are known to be infected
by HIV (Ostrowski et al. 1999), and that the thymus can act as a
source of HIV-1 latency during T-lymphocyte differentiation (Brooks
et al. 2001). As thymopoiesis continues in the adult patient,
replacement of this naive T-lymphocyte-based latent pool with cells
that are engineered to effectively inhibit virus replication should
result in restoration of protected immune cells and in inhibition
of viral rebound following withdrawal from antiretroviral therapy,
or after the development of drug resistance. The presence of
ribozyme sequences in other viral reservoirs such as monocytes
could also contribute to control of virus replication in these
settings. Such results justify further exploration of anti-HIV stem
cell gene transfer as a form of anti-HIV therapy.
Example 3
Specific Methods Used
3.1 Mycoplasma Assay
[0327] Following culture and transduction, the harvested cell
cultures were tested for mycoplasma. The procedure used was based
on the amplification of a mycoplasma-specific DNA sequence by PCR
and subsequent detection of the amplicon by ELISA. The procedure
used the Mycoplasma PCR ELISA test kit (Boehringer Mannheim, Cat #1
663 925). Test samples (1 sample per donor) and a negative control
sample (1 ml aliquot of fresh RPMI culture media containing 5%
human serum albumin) were centrifuged in microcentrifuge tubes at
maximum speed for 10 minutes at 4.degree. C. to sediment any
mycoplasma. To solubilize the pellet, 10 .mu.l of sterile water and
10 .mu.l Lysis Reagent (solution 1 of the kit) was added. Further
processing was carried out according to the kit instructions.
Cross-contamination of samples and reagents in the PCR procedure
was avoided by using fresh aerosol tips for all pipetting steps.
Each experiment included two negative controls and a positive assay
control. The PCR amplification used 1 cycle of 5 min at 95.degree.
C., 39 cycles of 30 secs at 94.degree. C.; 30 secs at 62.degree.
C.; 1 min at 72.degree. C., ending with 10 min at 72.degree. C.
After the ELISA step according to the manufacturers instructions,
negative controls were accepted if they were lower than 0.25
A.sub.450-A.sub.690-units, if not the assay was repeated. Positive
assay controls were accepted if they were higher than 1.2
A.sub.450-A.sub.690-units, if lower the assay was repeated. Samples
were regarded as positive for mycoplasma contamination if the
absorbance was more than 0.2 A.sub.450-A.sub.690-units higher than
the negative controls.
3.2 Endotoxin Assay.
[0328] The presence of endotoxin was determined in the cell
cultures following culture and transduction for two reasons: the
presence of low level endotoxin in the cultures would be an
indication of a possible previous contamination by Gram negative
micro-organisms, and secondly, high levels of endotoxin are toxic
to cells in culture. This assay was carried out on the day of
harvest after transduction, prior to infusion. The assay was
carried out using the QCL-1000 Limulus Amebocyte Lysate kit
(BioWhittaker #50-647U) according to the manufacturers
instructions. A stop solution consisting of 25% glacial acetic acid
was prepared as it was not provided with the BioWhittaker kit. One
kit was sufficient for 5 patient cultures. Results were analyzed
with Softmax software. If the results of the diluted infusion
sample or diluted VCM sample were greater than 5 EU/ml, the
infusion would not have been proceeded with. If the results of the
undiluted infusion sample or undiluted VCM sample were greater than
0.3 EU/ml, the Gram stain results were referred to for confirmation
of a possible contamination by bacteria in the infusion bag.
Otherwise the infusion was proceeded with.
3.3 Gram Stain.
[0329] Gram staining was used to test for Gram positive and Gram
negative bacteria in cell cultures before infusion. Quality
controlled slides, which have positive and negative controls
incorporated (Fisherbrand Gramv QC slides cat #08-80) and the
Fisher diagnostics Gram Stain Set (Cat NSG 100D) were used
according to the manufacturers instructions. A 5 .mu.l sample of
each infusion mixture was smeared evenly on the slides. After
staining, slides were examined under a 100.times. objective with
immersion oil. Control squares in the first column marked with "+",
containing Gram positive Staph. aureus appeared as dark purple
round dots. Control squares in the first column marked with "-"
containing Gram negative E. coli appeared as red-pink rods. If the
controls did not look like this, the staining was repeated. If the
infusion samples had contained any objects looking like the
controls, infusion would not have proceeded. Cultured cells showed
up as relatively large objects and cell membranes as pale wispy
shreds.
3.4 Preparation of Co-cultivation and Amplification Samples for RCR
Testing.
[0330] The patient retrovirus-transduced cells and the transduced
cell culture supernatant were tested for replication competent
retrovirus (RCR). Per U.S. Food & Drug Administration (FDA)
requirements, 1% or 10.sup.8 of the total transduced patient cells
(whichever was less) for each patient was tested in a Mus dunni
co-cultivation assay and 5% of the transduced cell culture
supernatant was tested in the Mus dunni amplification assay. These
assays were performed at BioReliance Corp., (formerly MA
BioServices in Rockville, Md., USA). Samples for these assays were
taken at the time of cell harvesting and preparation for infusion
and stored until all patient tranduction/harvest procedures were
completed and then shipped for testing.
[0331] Amplification RCR Samples were prepared for storage as
follows. Supernatant samples from the final harvested CD34.sup.+
cells were prepared in triplicate and consisted of alignots of
clarified supernatant (5% total volume per tube). They were stored
at -80.degree. C. until the final transduced patient amplification
sample had been collected. Duplicate RCR Co-cultivation Samples
were prepared for storage, using 2% of each CD34.sup.+ cell batch
per sample, and resuspended in cryopreservation media. Samples were
then stored in liquid nitrogen until time of shipment. Enough cells
were included to assure that the correct number of viable cells
(1%) would be achieved upon thawing of the sample at BioReliance
Corp. laboratories.
3.5 Plasma/PBMC/Bons Marrow Isolation.
[0332] Blood samples and bone marrow samples were collected from
patients at screening prior to infusion and at various time points
up to at least 3 years after infusion. The blood was collected into
10 ml ACD tubes, the volume collected depending on the tests
required. From these blood samples, plasma was collected and PBMC
prepared as cell pellets or cryopreserved samples. BMMC were
prepared from bone marrow and used fresh for CFC assay and the
remainder cryopreserved. The procedures used were as follows.
[0333] Collection of plasma: Blood tubes (10 ml, ACD-A vacutainers)
were centrifuged for 10 minutes at 2000 rpm. The plasma fraction
from each tube was carefully collected and pooled into a 50 ml
sterile tube. 2 ml volumes of plasma were aliquoted and stored at
-80.degree. C.
[0334] Preparation of Pbmc: Using the Erythrocyte/Leukocyte Cell
pellet after collection of the plasma, the cells were diluted to 3
times the initial starting volume with Wash Buffer and distributed
in 30 ml lots in 50 ml centrifuge tubes. Each dilute cell
suspension was underlaid with 10 ml Ficoll-Paque (Pharmacia
Cat#17-0849-03) and centrifuged at 2000 rpm for 20 min at
20.degree. C. in a swinging bucket rotor. The upper layer was
aspirated, leaving the mononuclear cell layer undisturbed at the
interphase. The interphase cells were transferred to a new 50 ml
tube, pooled if appropriate, washed with Wash Buffer, centrifuged
at 1500 rpm for 15 min, and the pellet resuspended in 5-10 ml Wash
Buffer. A viable cell count was carried out on 50 .mu.l cell
mixture using a hemacytometer and Trypan Blue (1:25 dilution). The
cells were aliquoted at 1-2.times.10.sup.6 cells per tube and
stored frozen if required, and lysed with 140 .mu.l Urea Lysis
Buffer. For cryopreservation, cells were resuspended at
1-5.times.10.sup.6 cells per ml in PBMC Cryopreservative Medium and
cooled gradually in liquid nitrogen for storage.
[0335] Preparation of Bone Marrow Mononuclear Cells (Bmmc): Bone
Marrow was diluted 1:1 with Wash Buffer, and 30 ml samples
underlaid with Ficoll-Paque and treated as above for PBMC. Viable
Cell counts were carried out on 30 .mu.l samples and the volume
required for CFC assay (2.5-3.times.10.sup.6 cells) put aside for
the assay. All remaining BMMC was cryopreserved at 1.times.10.sup.7
cells per ml of CD34.sup.+ Cryopreservation Medium.
3.6 Screening Sample Bone Marrow CFU Assay
[0336] CFU assays were performed on bone marrow from patients prior
to infusion, thereby providing a baseline or control for all other
colony assays performed after infusion. As the cells had not been
exposed to a gene therapeutic or control, they were not selected on
G418. All procedures were performed in a biocontainment hood and
aseptic technique was applied at all times.
[0337] BMMC prepared as described above were aliquoted into three
1.5 ml sterile microfuge tubes at 1.5.times.10.sup.6 cells,
7.5.times.10.sup.5 cells, and 3.times.10.sup.5 cells per tube. The
samples were centrifuged at 2500 rpm for 2 min, the medium
aspirated and the cell pellets resuspended thoroughly in 300 .mu.l
of RPMI (Gibco BRL, Cat #118-030)+1% FBS (Stem Cell technologies,
Cat#HCC-6450). The cell mixtures were pipetted into tubes (6 ml
polystyrene Falcon, Cat#2058) each containing 3 ml of Methocult
GFH4434 (Stem Cell Technologies, Cat#HCC-4434). The contents were
vortexed thoroughly for at least 15 seconds, let sit until bubbles
settled, and 1.1 ml aliquots layered carefully onto grid dishes
(Nunc Cat#174926) arranged in a petri dish. The petri dishes had an
additional grid dish containing sterile water, opened to maintain
humidity during culture. The petri dishes with the grid dishes were
incubated at 37.degree. C. in a humidified incubator and colonies
observed after 10-14 days.
3.7 Post-Infusion CFC Assay.
[0338] The post infusion Colony Forming Cell (CFC) assay included
cultures with and without G418. This was used to assess transduced
progenitor cell development following infusion. Two cell
numbers/dish are used to ensure that colonies are at an optimum
density when picked.
[0339] BMMC were prepared as described above and aliquoted at
6.times.10.sup.5 or 1.5.times.10.sup.6 cells to sterile microfuge
tubes. The cells were pelleted at .about.2500 rpm for 2 min. The
medium was aspirated and the cell pellets resuspended thoroughly in
600 .mu.l of RPMI+1% FBS. 300 .mu.l of each cell mixture was added
to tubes containing 3 ml of Methocult GFH4434 (StemCell
Technologies, Cat#HCC-4434), one +G418 at 0.9 mg/ml (G418,
crystalline geneticin, Gibco-BRL Cat #11811-031) and the other
without -G418. The samples were then vortexed and further treated
as described above for the Screening Sample Bone Marrow CFU
Assay.
3.8 T-Cell, Monocyte and Granulocyte Preparation from blood.
[0340] Leucocytes were isolated from patient's blood at several
time points after infusion. These cells were fractionated into 3
types (the T-cell, macrophage and granulocyte lineages) to follow
RRz2 or LNL6 presence and HIV levels. The blood was first separated
on 1-Step Polymorphs into erythrocytes, granulocytes, and
peripheral blood mononuclear cells (PBMCs). The PBMCs are further
fractionated on two columns: A CD3 column to yield lymphocytes and
a CD14 column to yield monocytes. The granulocyte fraction was
assessed for purity by Giemsa stain and the Lymphocyte and monocyte
fractions were FACS stained to assess purity. All fractions were
treated to prepare cell lysates for later DNA extraction and PCR
analysis.
[0341] All procedures were performed in a Class II Biological
Containment cabinet. 5 ml of fresh, ACD anticoagulated, human blood
in 10 ml tubes, collected less than 2 hours previously and kept at
room temperature, was overlaid on 3.5 ml of 1-Step Polymorphs
(Accurate Chemical & Scientific Corporation, Cat#AN221710,
store at room temperature and protect from light).
[0342] The tubes were centrifuged at 1650 rpm for 30 minutes at
room temp in a swinging-bucket rotor. After centrifugation, two
leukocyte bands were visible. The top band at the plasma/1-Step
interface consisted of mononuclear cells and the lower band of PMN
cells (Granulocytes). The erythrocytes are pelleted. All but about
1 ml of plasma was aspirated and transferred to a "Plasma" tube,
leaving the mononuclear cell layer undisturbed at the Interface.
All plasma collections were pooled for each patient, aliquoted in 2
ml lots and kept for later preparation of the granulocyte stain.
The PBMC interface cells were carefully transferred to a "PBMC"
tube, being careful not to pick up the lower band. All PBMC
collections were pooled for each patient. The lower band was
transferred to a "Granulocyte" tube and pooled. An equal volume of
hypotonic PBS was added to the granulocyte tube. Both the "PBMC"
and "Granulocyte" tubes were filled with wash buffer up to 50 ml,
mixed and centrifuged at 1500 rpm for 15 minutes at room
temperature. The supernatant was aspirated and the cells washed
once with 50 ml of Wash Buffer. After pelleting, the cells were
resuspended in 10 ml of PBS. A cell count was performed (1:20
dilution with PBMC cell suspension and a 1:5 with the Granulocyte
suspension).
[0343] Granulocyte cell pellet/lysate preparation and phenotyping:
The original suspension or cell pellet was resuspended to a final
concentration of 1.times.10.sup.7 cells/ml, if necessary
repelleting the cells first. 100 .mu.l was transferred to a
microfuge tube for phenotype staining. These cells were pelleted in
a microfuge at -3000 rpm for 1 minute, suspended in 10 .mu.l of
plasma fraction, and 5 .mu.l of this concentrated suspension
smeared onto each of two microscope slides. The slides were air
dried, stained with Giemsa stain for 30 min, rinsed with distilled
water and let air dry. They were examined under a 20.times.
objective and the fraction of granulocytes counted. The remainder
of the Granulocyte cells were pelleted in a microfuge at
.about.3000 rpm for 2 minutes for late DNA exraction.
3.9 DNA Preparation from Cells (Vacutainer-Phencling DNA).
[0344] Vacutainers (Hemogard, SerumSep, 6 ml. Cat#369789) were used
for some DNA extractions. This was a rapid way to extract genomic
DNA from CD34.sup.+ selected cells, methylcellulose colonies, and
patient PBMCs. 1 or 2 million cells in a 1.5 ml microfuge tube were
pelleted at 3000 RPM for 3 minutes in the microcentrifuge, washed
once with 1 ml of PBS and then dispersed in 70 .mu.l of water. 140
.mu.l of Urea Lysis Buffer was added to each tube, and the phases
mixed throughly by vortexing the tubes five to eight times. These
tubes can be kept frozen at -70 C indefinitely. For each sample,
0.5 ml phenol solution (Tris equilibrated United States Biochemical
#20083, with 0.4 g of hydroxyquinoline hemisulfate added per 400
ml) was added, and the mixture pumped 2 or 3 times using a 1 ml
syringe with a 23 or 25 G needle, then squirted into a vacutainer
containing 210 .mu.l of water. 15 .mu.l of chloroform was then
added to each vacutainer. They were capped, centrifuged at 2400 rpm
for 5 min, then 0.5 ml of phenol/chloroform added. They were shaken
for 30 seconds and recentrifuged at 2000 rpm for 3 min. The
phenol/chloroform extraction was repeated, followed by two
extractions with chloroform/isoamyl alcohol. 400 .mu.l of the
extract above the plug was transferred to a microfuge tube with an
aerosol-resistant tip, and the DNA precipitated with 25 .mu.l 5 M
NaCl and 850 .mu.l absolute ethanol at -20.degree. C. The DNA was
recovered by centrifugation, washed once with 70% ethanol, air
dried, and resuspended in 50 .mu.l water or 5 mM Tris pH 9. For
PBMC fractions or bone marrow samples, 20 .mu.l was used for each
10.sup.6 cells. DNA preparations were stored at -70.degree. C. For
samples from colonies, the 210 .mu.l water in the vacutainers
contained 10 .mu.g tRNA (Sigma R 9001) as carrier.
[0345] DNA was also prepared from cells using the "Acest Protocol"
and used in competitive PCR and PCR-RCR assays. Cell pellets of
approximately 5.times.10.sup.6 cells in a microfuge tube were
resuspended in 300 .mu.l lysis buffer (10 mM Tris-HCl, 50 mM KCl, 3
mM CaCl.sub.2, 0.4% Triton.times.100, pH 8.0, filter sterilized), 3
.mu.l of PreTaq (Boehringer Mannheim Cat #1696491) added, the
sample boiled for 5 min and centrifuged at 13000 rpm for 2 min. The
supernatant was transferred to a clean screw-capped 1.5 ml tube,
100 .mu.l ACES Buffer (2.28 Aces (Sigma Cat. No. A-7949), 12.5 ml
05M NaOH, 12.5 ml Tween-20, pH6.8, in total volume 50 ml, filter
sterilized) and 25 .mu.l Polymer (Ward et al 1998) added, the
sample mixed by vortexing briefly and then centrifuged for 2 min at
13000 rpm. The pellet was resuspended in 50 .mu.l of 20 mM NaOH and
left at room temperature until thoroughly dissolved. The sample was
boiled for 5 min and the DNA concentration determined by measuring
the optical density at 260 nm. Extractions from post-infusion cells
were carried out under PC3 containment due to HIV presence.
3.10 PCR
[0346] For detection of LNL6 or RRz2 sequences in cells or cell
colonies, PCR analysis of cellular DNA was carried out. PCR primers
were labelled with P32 to enable quantitative detection of the PCR
product. Labelling was carried out with .gamma..sup.32P-ATP (ICN
#3502005) and T4 Polynucleotide kinase (GIBCO-BRL Cat#18004-010) by
the recommended procedure. Excess unincorporated label was removed
using G25 Sephadex spin columns. 10.times. buffer was used for
PCRs, containing 250 mM Tris, 50 mM MgCl.sub.2, 500 mM NaCl, 2.5 mM
each of dATP, dCTP, dGTP, TTP (Gibco BRL 10297-018), 1.0 mg/ml BSA
(Sigma A-4378, made up as 100 mg/ml), pH 8.0.
[0347] Standards of pLNL6 and pRRz2DNA were diluted in 5 mM Tris,
pH 9 to give 1,000 and 100,000 copies per .mu.l using human liver
DNA as carrier and subsequently diluted to give a range of 5-5000
copies per 5 .mu.l sample. For human beta globin analysis, human
DNA standards were made from a 1 mg/ml stock to make dilutions at
10,000, 3000, 1000, 300 and 100 gene copies per .mu.l.
[0348] LNL6/RRz2 "High copies": Method used for quantitating
relatively high levels of LNL6 and RRz in preparations of DNA. Such
DNA was derived from CD34.sup.+ cells and hematopoietic colonies.
In this protocol the PCR reactions were of 25 .mu.l with no more
than 10.sup.4 copies of the human genome. Oligonucleotide primers
were 5L1A, 3L1D, Taq polymerase from Fisher. Amplification was
carried out at 94.degree. C. for 3 min, 68.degree. C. for 1 min,
followed by 27 cycles of 94.degree. C. for 1 min and 68.degree. C.
for 1 min using an MJ Research Programmable Thermal Controller. Ten
standard (control) samples were also treated, containing 5000,
1000, 500, 100, 50, 10, 5, 0, 0, and 0 copies of RRz2 and 0, 0, 0,
5, 10, 50, 100, 500, 1000, and 5000 copies of LNL6, respectively,
all in the presence of 5000 copies of the human genome.
[0349] LNL6/RRz2 "Low copies": Method used for quantitating
relatively low levels of LNL6 and RRz in preparations of DNA. Such
DNA was derived from peripheral blood cells (lymphocytes,
macrophages, and granulocytes). In this protocol the reaction was
run on 50 .mu.l samples with approximately 10.sup.6 copies of the
human genome. 20 .mu.l of DNA samples were mixed with 30 .mu.l
containing primers 5L1A and 3L1D (one labeled), buffer and
polymerase, and treated as for the "High copies" except that the
94.degree. C. steps were for 90 seconds. The standard samples were
in the presence of 10.sup.6 copies of the human genome.
[0350] Amplified samples were analyzed on 5% or 6% polyacrylamide
gels by electrophoresis using Tris-Borate-EDTA buffer
(10.times.TBE, 0.89M Tris borate pH 8.3+20 mM EDTA) and
radioactivity in bands quantitated using an AMBIS 4000
Radioimager.
[0351] As an additional standard, beta globin DNA was quantitated
in preparations of DNA where the number of copies of the human
genome was =10000. Such DNA was derived from CD34.sup.+ cells and
hematopoietic colonies, and patient PBMCs, T-cells, and bone
marrow. Amplification was carried out using oligonucleotide primers
LX1 and LA2, and 25 cycles of 94.degree. C. for 1 min, 65.degree.
C. for 2 min.
[0352] A nested radioactive PCR method was also used to calculate
the ratio of LNL6:RRz2 marking where less than approximately 0.01%
of cells contain either construct. The two rounds of PCR provided
increased sensitivity and the incorporation of radioactive label
readily allowed quantitation using Imagequant software. Meticulous
laboratory technique was used to avoid cross-contamination and
appropriate controls carried out. The first round of PCR used 1
.mu.g of template DNA, primers 5Nes1 and 3L2A, Buffer II (Perkin
Elmer Cat #N808-0010) with 2 mM MgCl2, dNTPs and Taq DNA Polymerase
(Perkin Elmer Cat #N801-0060) in 50 .mu.l volumes with taqbeads
(Perkin Elmer Cat #N808-0100). Amplification was carried out for
ten replicates of each sample in Thermofast 96 PCR plates (Advanced
Biotechnologies, Cat #AB0600) using 1 cycle at 94.degree. C., 17
cycles of 30 sec/68.degree. C. and 30 sec/94.degree. C., and
cooling to 4.degree. C. Products from the ten replicates were
pooled and 5 .mu.l pooled sample used for each second round
amplification reaction. The second round PCR used labelled primer
5L1A and primer 3L2A under the same conditions as the first round
except that 35 cycles of amplification were carried out. Products
were analysed on polyacrylamide gels. The 216 bp product
corresponded to RRz2, the 174 bp product to LNL6.
3.11 RCR-PCR.
[0353] The RCR-PCR assay allowed the detection of replication
competent retrovirus by amplifying a highly conserved region of the
env gene. The amplified sequence encodes part of the
host-determining region of the envelope protein which is required
for infection of cells through the amphotropic receptor. The
amplified region was 2B9 bp long. The sensitivity of the assay was
one positive cell in a background of one million negative cells
(10.sup.-6).
[0354] The PCR reaction used 7 .mu.l DNA sample and the primers
5RCR6=5'-CTA TGT GAT CTG GTC GGA GA-3' and 3RCR6=5'-CCA CAG GCA ACT
TTA GAG CA-3' with Buffer II (Perkin Elmer, Cat #N808-0010) and
Mg.sup.2+ (Perkin Elmer, Cat#N808-0010), 0.25 mM dNTPs (Gibco BRL
10297-018), and Taq polymerase (Taqbead.TM. DNA Polymerase,
Promega, Cat #M5661). Amplification was carried out with 3 min at
94.degree. C., followed by 45 cycles of 94.degree. C. for 30 secs,
63.degree. C. for 30 secs and 72.degree. C. for 30 secs. Amplified
samples were analyzed on 2.5% NuSieve gels. Presence of the 289 bp
band indicated the presence of RCR.
[0355] A "no DNA" control containing water instead of sample DNA
was run in each PCR experiment to verify that there was no
contamination of any reagent. A negative control (CEMT4 DNA) was
also run to ensure the specificity of the amplicons generated. A
positive control (10.sup.-5 PA317) was run in each PCR to verify
that the sensitivity of the PCR was at least 1 positive in 100,000
negative cells. "PA317 spiked" samples, referring to the addition
of 10 .mu.l of 10.sup.-3 PA317 `spiking` DNA at 20 ng/ml, was also
included in each experiment to all test samples in replicate PCR
tubes. The addition of this positive, 10.sup.-3 PA317 DNA verified
that a negative PCR result was a true negative for RCR, not a false
negative result due to unamplifiable DNA. All manipulations
involved meticulous laboratory technique to avoid
cross-contamination, for example cleaning benches and pipettes with
0.1 M sodium hydroxide, frequent changing of gloves and use of
aerosol barrier tips.
3.12 Colony Isolation in CFC Assay
[0356] The CFC assay was performed on patient bone marrow cells,
CD34.sup.+ enriched cells from apheresis, and the final transduced
product. Colonies from the assay were analyzed by PCR for the LNL6
and RRz2 genes as described above. Cells from colonies after 14
days growth in methocellulose medium were isolated and lysed as
follows. Under microscope, individual colonies were aspirated with
P200 aerosol-resistant tips and flushed into microfuge tubes. Tips
were rinsed with PBS to remove all methocellulose. The samples were
vortexed at medium speed for 15 seconds to dissolve the
methocellulose without shearing cells. DNA was isolated from the
cells after lysis as described above.
3.13 RNA Extraction and RT-PCR Analysis
[0357] RNA was extracted from patient samples using the QIAmp RNA
Blood Mini Kit (Qiagen Cat No 52304) by following the manufacturers
instructions. RNA was extracted from 1-5.times.10.sup.6 cells and
resuspended in 50 .mu.l RNase-free water. After DNase treatment of
the RNA preparations using RQ-1 DNase (Promega, Cat No. M6101),
synthesis of cDNA was carried out by using approximately 700-1000
ng RNA per reaction, primer 3L2A, and enzyme Superscript RNase H
minus RT (Gibco Cat No. 18053-017) at 37 C for 45 min. Seven
replicates were performed for each RNA sample and the products
pooled before use as template in the nested PCR method described
above.
Example 4
[0358] The HP cells are harvested, transduced and re-infused as
follows. The method comprises the following steps:
HP Cell Mobilization from the human subject's bone marrow into the
peripheral blood; Apheresis of the peripheral blood of the
individual to obtain the mobilized HP cells; Washing Step #1;
washing of the unpurified peripheral blood mononuclear cells by
using a cell washer in preparation for de-bulking; De-bulking Step;
to remove excess red cells, granulocytes, platelets, and
T-lymphocytes; Washing Step #2; of the enriched HP cells using a
cell washer; CD34.sup.+ Cell Selection or depletion of antigen
positive cells from the HP cell population; Washing Stop #3,
washing of the purified HP cells using a cell washer; Cell Culture
by placing the purified HP cells into culture with cytokines/growth
factors; Transduction Procedure of the HP cells by using a
retroviral vector containing the gene construct in the presence of
a transduction-facilitating agent, preferably introducing the viral
vector introduced using a cell washer; Harvest Cell Product and
wash the HP cells, including the transduced HP cells using a cell
washer; Preparation of Infusion Product, placing the Hp cells into
an infusion bag and perform product safety release testing; and
Infusion of Patient, delivering the cells back into the same
subject.
[0359] These steps are described in more detail with examples and
other modifications as follows:
Step 1--HP Cell Mobilization.
[0360] The first step of this procedure uses an agent to mobilize
HP cells from the bone marrow into the peripheral blood. An example
here is the use of Granulocyte Colony Stimulating Factor (G-CSF,
Neupogen) which is administered to the patient subcutaneously, at
least at 10 .mu.g/kg/day and preferably at 30 .mu.g/kg/day, once
daily, for up to five consecutive days. Complete Blood Counts
(CBCs), differential and platelet count are performed daily during
G-CSF administration to assess the extent of the leucocytosis. A
blood sample for CD34.sup.+ cell count is drawn on day 3 of G-CSF
administration to ensure that the peripheral blood CD34.sup.+ count
is greater than 20 cells/mm.sup.3 prior to the start of apheresis.
Failure to attain this CD34.sup.+ cell number does not however
prevent apheresis on days 4, 5 and 6 of G-CSF administration.
Step 2--Apheresis.
[0361] Apheresis is a method Of "blood filtration" to obtain the
mononuclear cell fraction of the peripheral blood. It is conducted
with a Cobe Spectra (Gambra), Hemonetics (Domedica) or Amicus
(Baxter) machines on at least two separate occasions, (preferably
on days 4, 5 or 6 following mobilization, where day 1 is the first
day of induced mobilization), though in other examples this can be
done on earlier or later days by determining the day at which the
peripheral blood CD34.sup.+ count is greater than 5 cells/mm.sup.3
or more preferably 10 cells/mm.sup.3 and most preferably 20
cells/mm.sup.3. In a preferred embodiment, this apheresis yields
cellular product from about 5 Liters (L) of blood flow through,
preferably this will be 5-10 L, but more preferably 10-20 L, and
more preferably still 20 L or greater. Product from each apheresis
is either treated separately or, in a preferred embodiment, pooled
after the second apheresis. Total cell counts, and absolute
CD34.sup.+ cell numbers are recorded. Use of Steps 1 & 2 will
produce up to greater than 5.times.10.sup.6, preferably greater
than 2.times.10.sup.7, more preferably greater than
4.times.10.sup.7 HP (as measured by CD34.sup.+ positivity)
cells/kg
Step 3--Washing Step #1 (Preferably on Days of Apheresis).
[0362] The pooled cells are washed. This is done by cell
centrifugation or more preferably using an automated cell washer,
in one example this cell washing is done by using a Nexell CytoMate
washer.
Step 4-De-Bulking Step (Preferably on Days of Apheresis).
[0363] In one embodiment, the cells from the apheresis procedure(s)
are "de-bulked" using a system like a Charter Medical DACS--Sc.TM.
system. In the embodiment where product is stored overnight from
the first day for pooling with second day product, the two
apheresis products are de-bulked on the day of collection and the
first product stored until the second product has been
de-bulked.
Step 5--Washing Step #2 (preferably Day 6).
[0364] The cells are taken, pooled (in the embodiment where there
are two products) and washed by centrifugation or by using a Nexell
CytoMate device or similar. (If there are more than two products
all will be pooled at the latest time point).
Step 6--CD34.sup.+ Cell Selection (Preferably Day 6).
[0365] CD34.sup.+ cells are selected from the post-washing product
by using the Isolex 300i, Miltenyi or a lineage depletion strategy
of cells expressing markers (e.g. CD2, CD3, CD14, CD16, CD19, CD24,
CD56, CD66b glycoprotein A, StemSep). The enriched pool of
CD34.sup.+ or lineage depleted cells preferably comprises at least
40%, more preferably at least 60% and most preferably at least 80%
cells of this type.
Step 7--Washing Step #3 (Preferably Day 6).
[0366] The cells are washed by centrifugation or by using the
Nexell CytoMate or similar equipment.
Step 8--Cell Culture (Preferably Days 6-9).
[0367] The cells are counted, and placed at preferably
1.times.10.sup.5 to 5.times.10.sup.6 cells/ml into cell culture
flasks, cell culture bags or in a preferred embodiment into 1,000
ml (390 cm.sup.2) Nexell Lifecell X-Fold Culture Bag or similar
with Iscove's Modified Dulbecco's Medium plus 10% Fetal Bovine
Serum (FBS) containing cytokines/growth factors. In a preferred
embodiment this cytokine/growth factor mixture consists of Stem
Cell Factor (50 ng/ml) and Megakaryocyte Growth and Development
Factor (100 ng/ml). Steps 3-9 will result in up to
12.times.10.sup.7 HP cells or more (as assessed by CD34.sup.+
positivity) per kg.
Step 9--Transduction Procedure (Preferably Day 13).
[0368] The cells are harvested from the first flask, tissue culture
bag, including a preferred embodiment of a Lifecell Culture Bag or
similar and using the Cytomate device or similar, resuspended in
retroviral supernatant (an example of this is a 200 ml aliquot) and
transferred into a second tissue culture container, one type of
which is the Lifecell X-Fold Culture Bag which have a retrovirus
transduction facilitating agent. Such agents include polybrene,
protamine sulphate, cationic lipids or in a preferred embodiment,
in a tissue culture container that has been pre-coated with
RetroNectin at 1-4 mcg/cm.sup.2. After 4-10 hours or up to 24
hours, the transfer procedure will be repeated using the CytoMate
or similar; for this second transduction cells are either
transferred to a new tissue culture container (polybrene, protamine
sulphate) or returned to the same or similar RetroNectin-coated
container from which they came. In a preferred embodiment, this is
done in a fresh aliquot of retroviral supernatant and cultured
overnight. In other embodiments this is either not done or repeated
several times for similar periods of time. An aliquot of the
retroviral supernatant(s) is collected for sterility testing. This
will result in up to 6.times.10 gene-containing HP cells or more
(as assessed by CD34.sup.+ positivity) per kg. This number is
determined by a quantitative assay. The transduction efficiency
will be at least 20%, and preferably in the range from 30-50%, and
more preferably greater than 50%.
Step 10--Harvest Cell Product (Preferably on Day 9).
[0369] On the morning of day 9, cells are harvested and washed
using standard cell centrifuge or automated systems such as the
Cytomate samples of cell culture. This will yield up to
5.7.times.10.sup.7 gene-containing HP cells or more (as assessed by
CD34.sup.+ positivity) per kg.
Step 11--Infusion Product (Preferably Day 9)
[0370] Cells are resuspended in a physiologic infusion buffer
containing 5% human serum albumin or similar as carrier. Aliquot
samples are removed for sterility (aerobic, anaerobic, fungal,
mycoplasma). Infusion product is not released until the results of
endotoxin (LAL) and Gram stain testing are available.
Step 12--Infusion of Patient (preferably Day 9).
[0371] The CD34.sup.+ cell preparation is administered to the
patient pre-medicated as appropriate. In a preferred embodiment,
the patient receives a single infusion of 0.5-6.times.10.sup.7
transduced CD34.sup.+ cells per kilogram of body weight (cells/kg)
in the physiologic infusion buffer containing 5% human serum
albumin or similar as carrier. The dose of transduced CD34.sup.+
cells per patient will depend on the efficiency of each step of the
mobilization, apheresis, isolation, culture and transduction
procedures. The total number of CD34.sup.+ cells (transduced and
non-transduced) is determined by cell counting and flow cytometry.
The introduced gene-containing HP cells give rise to a chimeric
hematopoietic system in which there is a percentage of
gene-containing HP cells in the bone marrow. In a preferred
embodiment, the one for the treatment of HIV/AIDS, this percentage
of gene-containing HP cells is at least 5%, preferably greater than
10% and more preferably than 20%.
Example 5
Use of RNAi with Multiple-Targeting Ability to Inhibit HIV-1
Replication
[0372] An RNAi construct with multiple-targeting ability against
HIV-1 is designed as follows. A cassette is made comprising three
RNAi units each having 19-25 nucleotide segments corresponding to
HIV-1 in sense orientation (1A, 2A, 3A) and antisense orientation
(1B, 2B, 3B) see FIG. 14, such that 1B, 2B and 3B are complementary
in sequence to 1A, 2A and 3A, respectively. The sequences 1A, 2A
and 3A are selected as being highly conserved in most HIV-1
strains, for example sequence position 5831-5849
(atggagccagtagatcota), sequence position 5852-5870
(ctagagccctggaagcatc), and sequence position 5971-5989
(tggcaggaagaagcggaga) in strain HXB2 or corresponding regions in
other strains. The sequences were calculated using the service
located at the following web site:
http://hiv-web.lanl.gov/content/hiv-db/NUM-HXB2/HXB2.Nuc.html. The
sequences 1A, 2A and 3A preferably differ by not more than 1
nucleotide compared to the corresponding sequences in most HIV-1
strains. Each of the above nineteen nucleotide sequences are
reasonably conserved within the tat gene over many HIV subtypes and
very well conserved in Subtype B. Each of these nineteen nucleotide
sequences have no more than one base pair deviation from the
consensus sequence within Subtype B. The first sequence includes
the target for Rz2. Differences close to the ends of the sequences
may be better tolerated. The RNAi units are separated by spacers
which may be 3-7 nucleotides in length. Spacers may be longer, for
example comprising intron sequences to aid in cytoplasmic
localization of the RNAi units. The cassette is flanked by
self-cleaving ribozyme sequences to allow release of the multiple
RNAi molecule. For example, the 5' end may be processed by a
hammerhead ribozyme where the catalytic domain is designed
according to U.S. Pat. No. 6,127,114, and the 3' end by an
autocatalytic hairpin ribozyme designed according to U.S. Pat. No.
5,856,188. Such a configuration allows basepaired (blunt) ends to
the RNAi molecule without extra nucleotides, although these can be
tolerated. Autocatalytic cleavage occurs at the arrowed positions
(FIG. 14) to release the 3 RNAi containing molecule. Spacers 1/2
and 2/3 may comprise cleavable sequences, for example sequences
cleavable by the hammerhead or hairpin ribozymes or additional
ribozyme units, to allow separation of the RNAi units. Clearly,
single RNAi units can be used or multimers of up to six or even ten
units.
[0373] The cassette is assembled as a DNA molecule from overlapping
annealed oligonucleotides and inserted into a plasmid vector under
the control of a T7 promoter. A recombination-deficient E. coli
strain that allows the stable replication of plasmids with inverted
repeat sequences, well understood in the art, is used as a cloning
host. Longer spacers (eg introns) also assist in this regard. The
nucleotide sequence of the DNA insert is confirmed by DNA
sequencing. T7 RNA polymerase is used to transcribe the DNA in
vitro in the presence of radiolabelled UTP and the self-cleavage
ability of the ribozyme units is assayed by electrophoresis of the
transcription products on polyacrylamide gels and autoradiography.
Self-cleavage occurs at greater than 90% efficiency during
transcription at 37.degree. C. for 1 hour. The length and/or
sequence of stems and loops in the ribozyme domains can be adjusted
if cleavage is less efficient than desired.
[0374] The cassette is inserted into the plasmid form of a
retroviral vector such as pLNL6 under the control of an RNA
polymerase II-dependent promoter. Alternatively, an RNA polymerase
III-dependent promoter can be used. The cassette is inserted into a
restriction site in the vector in the appropriate orientation. The
resultant plasmid is introduced into packaging cell lines such as
the AM-12 line and stably transfected cells used to produce
retroviral vector. The CemT4 cell line or PBLs are transduced with
the retroviral vector and the expression of the RNAi construct
determined by RNAse protection assays or reverse transcription-PCR,
well understood in the art. Significant protection of the
transduced cells is observed after infection with any of several
HIV-1 strains. A reduction of p24 production of more than 90%
compared to the control (vector without RNAi cassette) is observed,
indicating reduced HIV-1 replication.
[0375] CD34.sup.+ cells are obtained from patients, transduced with
the retroviral vector in the presence of RetroNectin by methods as
described earlier in this application. At least 0.5.times.10.sup.6
transduced CD34.sup.+ cells per kg (of weight of the patient) in a
total cell population of more than 1.63.times.10.sup.6 CD34.sup.+
such cells per kg are administered to the patients by infusion.
Preferably, more than 5.times.10.sup.6 transduced CD34.sup.+ cells
per kg are administered. These cells engraft the patients' bone
marrow and produce protected T-lymphocytes and
macrophages/monocytes for more than three years post-infusion.
These cells are relatively protected against HIV-1 infection and
contribute to improved immune function.
Concluding Discussion
[0376] In the clinical trial described herein, the introduction of
a gene for expression of an anti-HIV agent into CD34.sup.+ cells ex
vivo and infusion of these cells into autologous patients was shown
to be technically feasible and safe. The presence and expression of
the ribozyme construct in peripheral blood lymphoid and myeloid
cells was found for at least three years. The degree of cell
marking varied in the ten patients treated in this study, and this
allowed the following conclusions. The relevant parameters to the
degree of cell marking were found to be--the percentage of
CD34.sup.+ cell transduction, the number of transduced CD34.sup.+
cells infused, and the total number of CD34.sup.+ cells infused.
The actual number of transduced cells was found to be important.
The non-transduced cells could play a role in enhancing the
survival of the transduced cells in the peripheral blood and organs
such as the liver as they are homing to the bone marrow
compartment. Prolonged engraftment of transduced CD34.sup.+
hematopoietic cells required a minimum dose of 0.52.times.10.sup.6
transduced cells in a total CD34.sup.+ cell population of at least
1.63.times.10.sup.6 cells, in the context of the absence of
myeloablative pre-conditioning. There was preferential survival of
ribozyme-containing lymphocytes over control lymphocytes, even
under relatively low levels of selection. The degree of
preferential survival was CD34.sup.+ cell dose-dependent, i.e.
correlated positively with the number of infused transduced cells',
which was unexpected. It is reasonable to expect an even greater
degree of preferential survival of ribozyme-protected lymphocytes
at higher levels of selection, and greater therapeutic benefit at
higher cell doses.
[0377] This provides a basis for effective gene therapy of
hematopoietic cells for treatment of AIDS/HIV infection and many
other diseases. It provides important knowledge for effective
quality assurance and evaluation of the procedure in a clinical
setting.
REFERENCES
[0378] Abonour et al 2000 Nature Medicine 6:552-8 [0379] Amado et
al 1998 Human Gene Ther 9:173-183 [0380] Amado and Chen 1999
Science 285:674-676 [0381] Amado et al 1999 Human Gene Ther
10:2255-2270 [0382] Austin et al 2000 Blood 95:829-36 [0383] Autran
et al 1997 Science 277: 112-116 [0384] Bagnis et al 2002 Exp
Hematol 30:108-15 [0385] Bai et al 2000 Molecular Therapy 1:244-54
[0386] Barnett et al 1998 Brit J Hematol 102:553-65 [0387] Bazin et
al 1989 Biochem Pharmacol 38:109-19 [0388] Behringer et al 1999
Bone Marrow Transplant 24:295-302 [0389] Benboubker et al 2001 Brit
J Hematol 113:247-50 [0390] Bender et al 1987 J Viral 61:1639-46
[0391] Bender et al 1991 Blood 77:2591-6 [0392] Bertolini et al
1998 Bone Marrow Transplant 21:S5-7 [0393] Bodine et al 1998 Ann NY
Acad Sci 850:139-50 [0394] Bonyhadi et al 1997 J Virol 71:4704-16.
[0395] Bordignon et al 1995 Science 270:470-5 [0396] Brenner 2001 J
Int Medicine 249:345-58 [0397] Briones et al 1999 Haematologica
84:483-8 [0398] Brooks et al 2001 Nature Med 7:459-64 [0399]
Bunnell and Morgan 1998 Clin Micro Rev 11:42-56 [0400] Bunting et
al 1999 Ann NY Acad Sci 872:125-40 [0401] Campos 1993 Leukemia
7:1409-15 [0402] Case et al 1999 Proc Natl Acad Sci USA 96:2988-93
[0403] Carpinteiro et al 2002 Int J of Cancer 98:785-92 [0404]
Cavazzana-Calvo et al 2000 Science 288:669-672 [0405]
Cavazzana-Calvo 2001 J Gene Med 3:201-6 [0406] Challita and Kohn
1994 Proc Natl Acad Sci USA 91:2567-71 [0407] Chang and Roninson
1996 Gene 183:137-42 [0408] Chatterjee et al 1999 Blood
93:1882-1894 [0409] Cheng et al, 2000 Nat Med 6:1235-40 [0410]
Chemy et al, 2000 Mol Cell Biol 20:7419-26 [0411] Chu et al 1998 J
Mol Med 76:184-192 [0412] Cohen-Haguenauer et al 1998 Hum Gene Ther
9:207-16 [0413] Cometta et al 1996 Hum Gene Ther 7:1323-30 [0414]
Crystal 1995 Science 270:404-10 [0415] Dao et al 1997 Blood
89:446-56 [0416] Dao et al 1998 Proc Natl Acad Sci USA 95:13006-11
[0417] Dao et al 1998 Blood 92:4612-21 [0418] Dao and Nolta 1999
Leukemia 13:1473-80 [0419] Dao and Nolta 2000 Leukemia 14:773-6
[0420] Donahue et al 1998 Nature Med 4:181-6 [0421] Douek et al
1998 Nature 396:690-695 [0422] Ducos et al 2000 Gene Ther 7:1790-4
[0423] Dunbar et al 1995 Blood 85:3048-3057 [0424] Dunbar et al
1998a Hum Gene Ther 9:2629-40 [0425] Dunbar et al 1998b Hum Gene
Ther 7:231-53 [0426] Dunbar et al 2001 Ann NY Acad Sci 938:236-45
[0427] Eglitis and Schneiderman 1997 Biochem Biophys Res Commun
231:477-80 [0428] Fan et al, 2000 Hum Gene Ther 11:1313-27 [0429]
Fehse et al, 1997 Hum Gene Ther 8:1815-24 [0430] Feng et al 1997
Nature Biotechnol 15: 866-870 [0431] Fisher-Adams et al 1996 Blood
88:492-504 [0432] Fu and Liesveld 2000 Blood Rev 14:205-18 [0433]
Gabarre et al 2000 The Lancet 355:1071-2 [0434] Gambotto et al 2000
Methods Mol Biol 135:495-508 [0435] Gerard et al 1996 Hum Gene Ther
7:343-54 [0436] Gervaix et al 1997 Hum Gene Ther 8:2229-38 [0437]
Giarratana et al 1998 Bone Marrow Transpl 22:707-15 [0438] Gitlin
et al 2002 Nature advance online publicn. 26 Jun. 2002 [0439] Glimm
et al 1998 Hum Gene Ther 9:771-8 [0440] Gluckman 2000 Exp Hematol
28:1197-205 [0441] Goemer et al 1999 Blood 94:2287-92 [0442] Gothot
et al 1998 Blood 92: 2641-2649 [0443] Grande et al 1999 Blood
93:3276-85 [0444] Grimm and Kleinschmidt 1999 Hum Gene Ther
10:2445-2450 [0445] Haas et al 2000 Mol Ther, 2:71-80 [0446]
Hacein-Bey-Abina et al 2002 New Eng J Medicine 346:1185-93 [0447]
Halene et al 1999 Blood 94:3349-57 [0448] Halene and Kohn 2000 Hum
Gene Ther 11:1259-67 [0449] Hampel et al 1990 Nucleic Acids Res
18:299-304 [0450] Hanenberg et al 1996 Nat Med 2:876-82 [0451]
Hanenberg et al 1997 Hum Gene Ther 8:2193-2206 [0452] Hao et al
1996 Blood 88:3306-3313 [0453] Harrison 1980 Blood 55:77-81 [0454]
Harrison et al 1988 Proc Natl Acad Sci USA 85:822-6 [0455] Haseloff
and Gerlach 1988 Nature 334:585-91 [0456] Hennemann et al 1999 Exp
Hematol 27:817-825 [0457] Herrera et al 2001 Brit J Hematol
114:920-30 [0458] Hesforffer et al 1998 J Clin Oncol 16:165-72
[0459] Ho 1993 Leukemia 7:1738-46 [0460] Ho et al 1995 Nature
373:123-126 [0461] Ho et al 1996 Blood 88 (suppl 1):405a [0462]
Hodgson and Bradley 1979 Nature 281:381-2 [0463] Hogan et al 2002
Proc Natl Acad Sci USA 99:413-8 [0464] Hoogerbrugge et al 1996 Gene
Ther 3:179-183 [0465] Huhn et al 1996 Exp Hematol 24:839-47. [0466]
Huss 2000 Stem Cells 18:1-9 [0467] Hutchings et al 1998 7
Hematother 7:217-24 [0468] Imbert et al 1998 Exp Hematol 26:374-81
[0469] Jacque et al 2002 Nature advance online publicn 26 Jun. 2002
[0470] Jamieson et al 1999 Immunity 10: 569-575 [0471] Jones et al
1990 Nature 347:188-9 [0472] Kansas 1996 Blood 88:3259-87 [0473]
Kiem et al 1997 Blood 90:4638-4645 [0474] Kiem et al 1998 Blood
92:1878-1886 [0475] Kirby et al 2000 Blood 95:3710-5 [0476]
Knaan-Shanzer et al 2001 Hum Gene Ther 12:1989-2005 [0477] Knop et
al 1999 Gene Therapy 6:373-84 [0478] Kobari et al 2000 Exp Hematol
28:1470-80 [0479] Kohn 1995 Nature Medicine 1:1017-1023 [0480] Kohn
et al 1998 Nature Medicine 4:775-780 [0481] Kohn et al 1999 Blood
94:368-71 [0482] Krllmer et al 1999 Proc Natl Acad Sci USA
96:2087-92 [0483] Kume et al 1999 Int J Hematol 69:227-33 [0484]
Lane et al 1995 Blood 85:275-82 [0485] Lange and Blankenstein 1997
Gene Therapy 4:303-8 [0486] Lataillade et al 2000 Blood 95:756-68
[0487] Law et al 1999 Exp Hematol 27:147-54 [0488] LeDoux et al
2001 Hum Gene Ther 12:1611-21 [0489] Lee et al 1994 J Viral
68:8254-64 [0490] Lewis and Verfullie 2000 Exp Hematol 28:1087-95
[0491] Lieber et al 1999 J Viral 73:9314-24 [0492] Lisziewicz et al
1993 Proc Nail Acad Sci USA 90:8000-4 [0493] Liu et al 1999 Hum
Gene Ther 10:2337-46 [0494] Lyman and Jacobsen 1998 Blood
91:1101-34 [0495] Maciejewski et al 1995 Nature Med 1:667-73 [0496]
Malech et al 1997 Proc Natl Acad Sci USA 94:12133-8 [0497] Malik et
al 1995 Blood 86:2993-3005 [0498] Marandin et al 1996 Blood
88:4568-78 [0499] Marasco et al 1998 Human Gene Ther 9:1627-42
[0500] Marini et al 2000 Caner Gene Ther 7:816-25 [0501] Martinez
et al 1999 Exp Hematol 27:561-8 [0502] Mautino and Morgan 2002 AIDS
Patient Care and Stds 16:11-26 [0503] Michallet et al 2000 Exp
Hematol 28:858-70 [0504] Michienzi et al 2000 Proc Natl Acad Sci
USA 97:8955-60 [0505] Miller 1986 Beyond ANOVA; New York; John
Wiley and Sons [0506] Miller and Buttimore 1986 Mol Cell Biol
6:2895-902 [0507] Miyoshi et al 1999 Science 283:682-686 [0508]
Moore and MacKenzie 1999 Prog Exp Tumor Res 36:20-49 [0509]
Mountain 2000 TIBTECH 18: 119-128 [0510] Murray et al 1999 Exp
Hematol 27:1019-28 [0511] Murray et al 2000 Hum Gene Ther
11:2039-50 [0512] Nagler et al 2000 Exp Hematol 28:1096-104 [0513]
Naldini et al 1996 Science 272:263-7 [0514] Newbound et al 2001 Exp
Hernatol 29:163-73 [0515] Ng et al 2002 Brit J Hematol 117:226-37
[0516] Nolta et al 1992 Exp Hematol 20:1065-1071 [0517] Novina et
al 2002 Nature advance online publicn 3 Jun. 2002 [0518] Ogawa et
al 1993 Blood 81:2844-2853 [0519] Ojwang et al 1992 Proc Natl Acad
Sci USA 89: 10802-6 [0520] Omori et al 1999 J Hematother Stem Cell
Res 8:503-14 [0521] Orlic and Bodine 1994 Blood 84:3991-3994 [0522]
Orlic et al 1999 Ann NY Acad Sci 872:115-24 [0523] Orlic et al 2001
Ann NY Acad Sci 938:221-230 [0524] Ostrowski et al 1999 J Virol
73:6430-5 [0525] Quan et al 1999 Exp Hematol 27:1511-8 [0526]
Pakker et al 1998 Nature Medicine 4:208-14 [0527] Parkman 1986
Science 232:1373-78 [0528] Peters et al 1996 Blood 87:30-7 [0529]
Picker et al 1993 J Immunol 150:1105-21 [0530] Poulin et al 1999. J
Exp Med 190:479-86 [0531] Ragg et al 2000 Cancer Res 60:5187-95
[0532] Ramezani et al 2002 Frontiers in Bioscience 7:A29-36 [0533]
Ranga et al 1998 Proc Natl Acad Sci USA 95:1201-6 [0534] Reese et
al 1999 J Hematother Stem Cell Res 8:515-23 [0535] Reis 1999
Transplant Proc 31:2970-2 [0536] Relander et al 2001 J Gene Med
3:207-18 [0537] Relander et al 2002 J Gene Med 4:122-32 [0538]
Richter and Karlson 2001 Int J Hematol 73:162-69 [0539] Rivella et
al 2000 J Virology 74:4679-87 [0540] Robbins et al 1998 Proc Natl
Acad Sci USA 95:10182-7 [0541] Roe et al 1993 EMBO J. 12:2099-2108
[0542] Rosler et al 2000 Exp Hematol 28:841-52 [0543] Rossi et al
1992 AIDS Res and Human Retroviruses 8:183-9 [0544] Rovira et al
2000 Blood 96:4111-7 [0545] Sadelain et al 2000 Curr Opin Hematol
7:364-77 [0546] Sanders et al 1988 Immunol Today 9:195-9 [0547]
Sandhaus et al 1998 Exp Hematol 26:73-8 [0548] Sanyal and Schuening
1999 Hum Gene Ther 10:2859-68 [0549] Sarver et al 1990 Science
247:1222-5 [0550] Sato et al 1999 Blood 94:2548-2554 [0551] Saylors
et al 1999 Gene Ther 6:944-6 [0552] Schilz et al 1998 Blood
92:3163-71 [0553] Schilz et al 2000 Mol Ther 2:609-18 [0554] Schilz
et al 2001 J Gene Med 3:427-36 [0555] Sczakiel and Pawlita 1991 J
Virol 65:468-72 [0556] Shaheen et al 1996 J Virol 70:3392-400
[0557] Siena et al 1989 Blood 74:1905-14 [0558] Smythe et al 1994
Proc Natl Acad Sci USA 91:3657-61 [0559] Solar et al 1998 Blood
92:4-10 [0560] Strayer et al 2000 Gene Ther 7:886-95 [0561] Su et
al 1997 Blood 89:2283-90 [0562] Sun et al 1995 Proc Natl Acad Sci
USA 92:7272-6 [0563] Sun et al 1995 Nucl Acids Research 23:2909-13
[0564] Sun et al 1996 Nucl Acids Mol Biol Catalytic RNA 10: 329-342
[0565] Sutton et al 1998 J Virol 72:5781-8 [0566] Takatoku et al
2001 J Clinical Investig 108:447-55 [0567] Takenaka et al 2000 PNAS
97:7515-20 [0568] Takiyama et al 1998 Eur J Hematol 61:1-6 [0569]
Tavolini 1997 Gene Ther 4:150-5 [0570] Thomas et al 1999 Methods
17:202-18 [0571] To et al 1997 Blood 85:2233-58 [0572] Traycoff et
al 1998 Exp Hematol 26:53-62 [0573] Uchida et al 1998 Proc Natl
Acad Sci USA 95:1939-44 [0574] Vassilopoulos et al 2001 Blood
98:604-609 [0575] Veres et al 1998 J Virol 72:1894- [0576]
Verfaillie et al 2000 Exp Hematol 28:1071-9 [0577] Vignoli et al
1998 AIDS12:999-1005 [0578] von Laer et al 1998 J Virol 72:1424-30
[0579] Wang et al 1998 Human Gene Ther 9:1283-91 [0580] Ward et al
1998 American J Pathology 153:373-379 [0581] Wilcox et al 2000
Blood 95:3645-52 [0582] Williams et al 1999 Ann NY Acad Sci
872:109-13 [0583] Yu et al 1995 Proc Nall Acad Sci USA 92:699-703
[0584] Zanjani et al 1998 Exp Hematol 26:353-60 [0585] Zauli et al
1996 J Exp Med 183:99-108 [0586] Zhang et al 1999 J Exp Med
190:725-32 [0587] Zhang et at 1998 Proc Natl Acad Sci USA 95:1154-9
[0588] Zimmermann et al 1995 Bone Marrow Transpl 9:439-44
Sequence CWU 1
1
15139RNAArtificial Sequenceribozyme 1uuaggauccu gaugaguccg
ugaggacgaa acuggcucc 39217RNAHuman immunodeficiency virus
2ggagccagua gauccua 17338DNAArtificial SequenceDNA encoding a
ribozyme 3ttaggatcct gatgagtccg tgaggacgaa actggctc
38421DNAArtificial Sequenceprimer 4cactcatgag atgcctgcaa g
21521DNAArtificial Sequenceprimer 5gagttctacc ggcagtgcaa a
21622DNAArtificial Sequenceprimer 6gatcccctcg cgagttggtt ca
22720DNAArtificial Sequenceprimer 7ctatgtgatc tggtcggaga
20820DNAArtificial Sequenceprimer 8ccacaggcaa ctttagagca
20919DNAArtificial Sequenceprimer 9tggcaatgaa agcaacact
191021DNAArtificial Sequenceprimer 10tttagaggag cttaagaatg a
211121DNAArtificial Sequenceprimer 11agttttaggc tgacttcctg g
211219DNAArtificial Sequenceprimer 12tggaagccat aataagaat
191319DNAHIV-1 13atggagccag tagatccta 191419DNAHIV-1 14ctagagccct
ggaagcatc 191519DNAHIV-1 15tggcaggaag aagcggaga 19
* * * * *
References