U.S. patent application number 13/035699 was filed with the patent office on 2012-03-01 for methods for in vitro joining and combinatorial assembly of nucleic acid molecules.
This patent application is currently assigned to Synthetic Genomics, Inc.. Invention is credited to Daniel G. Gibson, Clyde A. Hutchison, Hamilton O. Smith, J. Craig Venter, Lei Young.
Application Number | 20120053087 13/035699 |
Document ID | / |
Family ID | 40957529 |
Filed Date | 2012-03-01 |
United States Patent
Application |
20120053087 |
Kind Code |
A1 |
Gibson; Daniel G. ; et
al. |
March 1, 2012 |
METHODS FOR IN VITRO JOINING AND COMBINATORIAL ASSEMBLY OF NUCLEIC
ACID MOLECULES
Abstract
The present invention relates to methods of joining two or more
double-stranded (ds) or single-stranded (ss) DNA molecules of
interest in vitro, wherein the distal region of the first DNA
molecule and the proximal region of the second DNA molecule of each
pair share a region of sequence identity. The method allows the
joining of a large number of DNA fragments, in a predetermined
order and orientation, without the use of restriction enzymes. It
can be used, e.g., to join synthetically produced sub-fragments of
a gene or genome of interest. Kits for performing the method are
also disclosed. The methods of joining DNA molecules may be used to
generate combinatorial libraries useful to generate, for example,
optimal protein expression through codon optimization, gene
optimization, and pathway optimization.
Inventors: |
Gibson; Daniel G.; (Crofton,
MD) ; Smith; Hamilton O.; (San Diego, CA) ;
Hutchison; Clyde A.; (La Jolla, CA) ; Young; Lei;
(Gaithersburg, MD) ; Venter; J. Craig; (La Jolla,
CA) |
Assignee: |
Synthetic Genomics, Inc.
La Jolla
CA
|
Family ID: |
40957529 |
Appl. No.: |
13/035699 |
Filed: |
February 25, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12371543 |
Feb 13, 2009 |
|
|
|
13035699 |
|
|
|
|
61029312 |
Feb 15, 2008 |
|
|
|
61064107 |
Feb 15, 2008 |
|
|
|
61052614 |
May 12, 2008 |
|
|
|
61098202 |
Sep 18, 2008 |
|
|
|
61142101 |
Dec 31, 2008 |
|
|
|
Current U.S.
Class: |
506/16 ; 435/194;
435/91.52; 536/23.1 |
Current CPC
Class: |
C12N 9/22 20130101; C12N
15/66 20130101; C12N 15/10 20130101; C12N 15/64 20130101; C12N 9/93
20130101; C12P 19/34 20130101; C12N 15/1027 20130101 |
Class at
Publication: |
506/16 ;
435/91.52; 435/194; 536/23.1 |
International
Class: |
C12P 19/34 20060101
C12P019/34; C40B 40/06 20060101 C40B040/06; C07H 21/04 20060101
C07H021/04; C12N 9/12 20060101 C12N009/12 |
Claims
1. An in vitro method of joining a set of two or more
double-stranded (ds) or single-stranded (ss) DNA molecules, wherein
adjacent DNA molecules to be joined contain overlapping sequences
at their termini, said method comprising contacting in vitro the
two or more DNA molecules in a single vessel with (a) an isolated
non-thermostable 5' to 3' exonuclease that lacks 3' exonuclease
activity, (b) a crowding agent, (c) an isolated thermostable
non-strand-displacing DNA polymerase with 3' exonuclease activity,
or a mixture of said DNA polymerase with a second DNA polymerase
that lacks 3' exonuclease activity, (d) an isolated thermostable
ligase, (e) a mixture of dNTPs, and (f) a suitable buffer, under
conditions that are effective for joining the two or more DNA
molecules to form a first assembled dsDNA molecule in a one-step
reaction.
2. The method of claim 1, wherein the exonuclease of (a) is a T5
exonuclease and said contacting is under isothermal conditions.
3. The method of claim 1, wherein the crowding agent of (b) is PEG,
and/or the non-strand-displacing DNA polymerase of (c) is
Phusion.TM. DNA polymerase or VENT.RTM. DNA polymerase, and/or the
ligase of (d) is Taq ligase.
4. The method of claim 1, wherein the conditions are also suitable
for digesting any unpaired, non-homologous, single-stranded DNAs
following the joining reaction.
5. The method of claim 4, wherein at least some of the DNA
molecules to be joined comprise, at one terminus, a sequence that
is non-homologous to any of the DNA molecules of interest.
6. The method of claim 5, wherein the non-homologous sequences
comprise one or more binding regions for PCR primers, and/or
regions of homology to vector sequences, and/or recognition sites
for one or more restriction enzymes.
7. The method of claim 1, further comprising repeating the method
to join a second set of two or more DNA molecules to one another to
obtain a second assembled DNA molecule, and then joining the first
and the second assembled DNA molecules to obtain a third assembled
ds DNA molecule.
8. A kit for a one-step in vitro reaction to join a set of two or
more double-stranded (ds) or single-stranded (ss) DNA molecules,
wherein adjacent DNA molecules to be joined contain overlapping
sequences at their termini, comprising in a single vessel (a) an
isolated non-thermostable 5' to 3' exonuclease that lacks 3'
exonuclease activity, (b) a crowding agent, (c) an isolated
thermostable non-strand-displacing DNA polymerase with 3'
exonuclease activity, or a mixture of said DNA polymerase with a
second DNA polymerase that lacks 3' exonuclease activity, (d) an
isolated thermostable ligase, in amounts such that when said two or
more DNA molecules are added to the kit, in the presence of a
suitable buffer solution and dNTPs, and incubated under isothermal
conditions, the two or more DNA molecules are assembled in a
concerted reaction.
9. The kit of claim 8, comprising (a) T5 exonuclease, (b) PEG, (c)
Phusion.TM. DNA polymerase, and (d) Taq ligase.
10. A method of modifying the properties of a whole nucleic acid
molecule, said method comprising: (a) representationally dividing
the nucleic acid sequence of said whole nucleic acid molecule into
a multiplicity of portions along its length thereby identifying the
sequences of partial nucleic molecules; (b) providing, for at least
3 of said partial nucleic molecules, a multiplicity of variants of
each partial nucleic acid molecule; (c) combinatorially assembling
in vitro said variants along with any partial nucleic acid
molecules which are not varied, wherein the partial nucleic acid
molecules or variants thereof contain overlapping sequences at
their termini whereby assembly of the partial nucleic acid
molecules and variants thereof in the mixture would result in
assembly of a multiplicity of variants of the whole nucleic acid
molecule; and (d) expressing the variants of the whole nucleic acid
molecule to determine any modified properties of said variants of
said whole nucleic acid molecule; wherein the assembling of step
(c) is performed by the method of claim 1.
11. An in vitro method of joining a set of two or more
double-stranded (ds) or single-stranded (ss) DNA molecules, wherein
adjacent DNA molecules to be joined contain overlapping sequences
at their termini, said method comprising contacting in vitro the
two or more DNA molecules in a single vessel with (a) an isolated
non-thermostable 3' to 5' exonuclease active in the presence of
dNTPs, (b) a crowding agent, (c) an isolated heat-activated DNA
polymerase, (d) an isolated thermostable ligase, (e) a mixture of
dNTPs, and (f) a suitable buffer, under conditions that are
effective for joining the two or more DNA molecules to form a first
assembled dsDNA molecule in a one-step thermocycled reaction.
12. The method of claim 11, wherein the exonuclease of (a) is
Exonuclease III.
13. The method of claim 11, wherein polymerase of (c) is
heat-activated by the removal of an inactivating moiety combined
with the polymerase in a heat-sensitive manner.
14. The method of claim 11, wherein the crowding agent of (b) is
PEG, and/or the DNA polymerase of (c) is AMPLITAQ GOLD.RTM., and/or
the ligase of (d) is Taq ligase.
15. The method of any of claims 11-14, further comprising repeating
the method to join a second set of two or more DNA molecules to one
another to obtain a second assembled DNA molecule, and then joining
the first and the second assembled DNA molecules to obtain a third
assembled ds DNA molecule.
16. A kit for a one-step in vitro reaction to join a set of two or
more double-stranded (ds) or single-stranded (ss) DNA molecules,
wherein adjacent DNA molecules to be joined contain overlapping
sequences at their termini, comprising in a single vessel (a) an
isolated non-thermostable 3' to 5' exonuclease active in the
presence of dNTPs, (b) a crowding agent, (c) an isolated
heat-activated DNA polymerase, (d) an isolated thermostable ligase,
(e) a mixture of dNTPs, and (f) a suitable buffer, in amounts such
that when said two or more DNA molecules are added to the kit, in
the presence of a suitable buffer solution and dNTPs, and incubated
under thermocycled conditions, the two or more DNA molecules are
assembled in a concerted reaction.
17. The kit of claim 16, comprising (a) Exonuclease III, (b) PEG,
(c) AMPLITAQ GOLD.RTM. DNA polymerase, and (d) Taq ligase.
18. A method of modifying the properties of a whole nucleic acid
molecule, said method comprising: (a) representationally dividing
the nucleic acid sequence of said whole nucleic acid molecule into
a multiplicity of portions along its length thereby identifying the
sequences of partial nucleic molecules; (b) providing, for at least
3 of said partial nucleic molecules, a multiplicity of variants of
each partial nucleic acid molecule; (c) combinatorially assembling
in vitro said variants along with any partial nucleic acid
molecules which are not varied, wherein the partial nucleic acid
molecules or variants thereof contain overlapping sequences at
their termini whereby assembly of the partial nucleic acid
molecules and variants thereof in the mixture would result in
assembly of a multiplicity of variants of the whole nucleic acid
molecule; and (d) expressing the variants of the whole nucleic acid
molecule to determine any modified properties of said variants of
said whole nucleic acid molecule; wherein the assembling of step
(c) is performed by the method of claim 11.
19. A method of modifying the properties of a whole nucleic acid
molecule, said method comprising: (a) representationally dividing
the nucleic acid sequence of said whole nucleic acid molecule into
at least 5 portions along its length thereby identifying the
sequences of partial nucleic molecules; (b) providing, for at least
3 of said partial nucleic molecules, a multiplicity of variants of
the partial nucleic acid molecule; (c) combinatorially assembling
in vitro said variants along with any partial nucleic acid
molecules which are not varied, wherein the partial nucleic acid
molecules or variants thereof contain overlapping sequences at
their termini whereby assembly of the partial nucleic acid
molecules and variants thereof in the mixture would result in
assembly of a multiplicity of variants of the whole nucleic acid
molecule; and (d) expressing the variants of the whole nucleic acid
molecule to determine any modified properties of the variants of
said whole nucleic acid molecule.
20. The method of claim 19, wherein the variants of the partial
nucleic acid molecule provide degenerate forms of the codon for one
or more amino acids encoded by the partial nucleic acid molecules;
or wherein the variants of the partial nucleic acid molecule
provide a multiplicity of nucleic acid control sequences affecting
transcription or translation of the whole nucleic acid molecule; or
wherein the variants of the partial nucleic acid molecule provide a
multiplicity of regions encoding domains or motifs of peptides or
proteins encoded by the whole nucleic acid molecule; or wherein the
peptides or proteins encoded by said partial nucleic acid molecules
function together in a metabolic pathway.
21. A method of modifying the properties of a whole nucleic acid
molecule, said method comprising: (a) representationally dividing
the nucleic acid sequence of said whole nucleic acid molecule into
a multiplicity of portions along its length thereby identifying the
sequences of partial nucleic molecules; (b) providing, for at least
3 of said partial nucleic molecules, a multiplicity of variants of
the partial nucleic acid molecule; (c) combinatorially assembling
in vitro said variants along with any partial nucleic acid
molecules which are not varied, wherein the partial nucleic acid
molecules or variants thereof contain overlapping sequences at
their termini whereby assembly of the partial nucleic acid
molecules and variants thereof in the mixture would result in
assembly of a multiplicity of variants of the whole nucleic acid
molecule; and (d) expressing the variants of the whole nucleic acid
molecule to determine any modified properties of the variants of
said whole nucleic acid molecule; wherein the variants of the
partial nucleic acid molecule provide degenerate forms of the codon
for one or more amino acids encoded by the partial nucleic acid
molecules, or wherein the variants of the partial nucleic acid
molecule provide a multiplicity of nucleic acid control sequences
affecting transcription or translation of the whole nucleic acid
molecule, or wherein the variants of the partial nucleic acid
molecule provide a multiplicity of regions encoding domains or
motifs of peptides or proteins encoded by the whole nucleic acid
molecule, or wherein peptides or proteins encoded by said partial
nucleic acid molecules function together in a metabolic
pathway.
22. The method of claim 19, wherein the assembly in step (c) is
performed (1) by a method comprising: (a) contacting said variants
along with any partial nucleic acid molecules which are not varied
with a non-processive 5' exonuclease; and with (b) a single
stranded DNA binding protein (SSB) which accelerates nucleic acid
annealing; and with (c) a non-strand-displacing DNA polymerase; and
with (d) a ligase, under conditions effective to join the variants
and partial nucleic acid molecules that are not varied so as to
result in assembly of a multiplicity of variants of the whole
nucleic acid molecule; or (2) by in vivo assembly.
23. The method of claim 20, wherein the assembly in step (c) is
performed (1) by a method comprising: (a) contacting said variants
along with any partial nucleic acid molecules which are not varied
with a non-processive 5' exonuclease; and with (b) a single
stranded DNA binding protein (SSB) which accelerates nucleic acid
annealing; and with (c) a non-strand-displacing DNA polymerase; and
with (d) a ligase, under conditions effective to join the variants
and partial nucleic acid molecules that are not varied so as to
result in assembly of a multiplicity of variants of the whole
nucleic acid molecule; or (2) by in vivo assembly.
24. The method of claim 19, further comprising assembling two or
more whole nucleic acid molecules prepared according to said
methods in vitro or in vivo.
25. The method of claim 20, further comprising assembling two or
more whole nucleic acid molecules prepared according to said
methods in vitro or in vivo.
26. A library of variant DNA molecules prepared by the method of
any of claim 10, 18, 19 or 21.
27. A modified DNA molecule prepared by the method of any of claim
10, 18, 19 or 21.
28. The modified DNA of claim 27 which comprises at least one
optimized codon; and/or at least one optimized control sequence;
and/or at least one nucleotide sequence that encodes an optimized
protein; and/or at least one sequence that encodes an optimized
pathway.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser.
No. 12/371,543, filed Feb. 13, 2009 which claims benefit of U.S.
application Ser. No. 61/029,312 filed 15 Feb. 2008; U.S. 61/064,107
filed 15 Feb. 2008; U.S. 61/052,614 filed 12 May 2008; U.S.
61/098,202 filed 18 Sep. 2008; and U.S. 61/142,101 filed 31 Dec.
2008. The contents of these applications are incorporated herein by
reference in their entirety.
TECHNICAL FIELD
[0002] The invention concerns methods for in vitro joining of
single-stranded and/or double-stranded nucleic acid molecules
permitting efficient one-step assembly of multiple nucleic acid
molecules with overlapping terminal sequences. Invention methods
are particularly useful in effecting systematic combinatorial
assembly of fragments of nucleic acid sequence variants to modify
properties of the joined nucleic acid sequence, for example,
nucleic acid sequences providing variants of codon usage, control
sequences, genes, pathways, chromosomes, extra-chromosomal nucleic
acids, and genomes.
BACKGROUND ART
[0003] A two-step thermocycler-based method was used to assemble
portions of the M. genitalium genome, as described in Gibson, D.
G., et al., "Complete chemical synthesis, assembly, and cloning of
a Mycoplasma genitalium genome." Science (2008) 319:1215-1220.
Another approach is described by Li, M. Z., et al., Nature Meth.
(2007) 4:251-256. A single-step method of assembly employing T7 5'
exonuclease and single-stranded DNA binding protein is disclosed in
PCT publication WO2006/021944. The present invention discloses
one-step procedures which facilitate assembly of DNA molecules in
vitro. These methods employ either a non-thermostable 5'
exonuclease that lacks 3' exonuclease activity or a 3' exonuclease
that is functional in the presence of dNTPs.
[0004] These new methods are particularly useful in an additional
aspect of the invention which provides systematic combinatorial
assembly to modify nucleic acid molecules. Combinatorial techniques
for assembly of chemical compounds for use in high throughput
screening is by now well established. In addition, gene shuffling
techniques in which coding sequences are randomly fragmented and
reannealed have been practiced for a number of years. For instance,
protocols to create libraries of chimeric gene fragments are
described in Meyer, M., et al, "Combinatorial Recombination of Gene
Fragments to Construct a Library of Chimeras" Current Protocols in
Protein Science (2006) 26.2.1-26.2.17; McKee, A. E., et al., JBEI
abstract. There is, however, a need for a systematic approach to
combinatorial approach that does not rely on random rearrangement
or shuffling to provide optimized nucleic acid sequences, for
example, with optimized coding sequences or metabolic pathways,
that can be selected according to desired properties. The present
invention fills this need by providing a systematic combinatorial
approach to assemble a variety of nucleic acids of interest.
[0005] Techniques for assembling various components into complete
or minimal genomes have been established. For example, U.S. Patent
Publication 2000/0264688, published 15 Nov. 2007, describes methods
for constructing a synthetic genome by generating and assembling
cassettes comprising portions of the genome. A stepwise
hierarchical method to assemble nucleic acids is described in U.S.
Patent Publication 2007/004041, published 4 Jan. 2007. However, no
suggestion is made of using these techniques systematically to
assemble a desired nucleic acid molecule.
[0006] It is understood that construction of a genome need not
include all of the components that occur naturally. PCT Publication
WO2007/047148 describes a minimal genome based on Mycoplasma
genitalium wherein as many as 101 genes encoding proteins can be
omitted and still retain viability. There is no suggestion that the
components of the minimal genome be systematically assembled as
combinatorial libraries permitting the formation of a multiplicity
of alternative minimal genomes.
[0007] The present invention, thus, is directed to systematic
methods and the products thereof that permit efficient and
extensive modification of nucleic acid molecules to provide and
screen nucleic acid assemblies of interest in a high-throughput
manner, and readily adaptable to robotic implementation. In
alternative embodiments, assembly reactions can be performed on a
solid surface as opposed to in a reaction tube, for example, on a
chip using microfluidics (such as shown in Huang, Y., et al., Lab
Chip (2007) 7:24-26).
[0008] The techniques for systematic combinatorial assembly of
nucleic acids representing variant coding sequences, expression
systems, pathway synthesis and minimal or larger genomes employ in
vitro assembly techniques at least in part. Any suitable in vitro
assembly technique may be employed; however, the methods of the
present invention include improvements on those already described
in the art.
DISCLOSURE OF THE INVENTION
[0009] In a first aspect, the invention provides an in vitro method
of joining a set of two or more double-stranded (ds) or
single-stranded (ss) DNA molecules. The adjacent DNA molecules to
be joined contain overlapping sequences at their termini. The two
or more DNA molecules are contacted in vitro in a single vessel
with (a) an isolated non-thermostable 5' to 3' exonuclease that
lacks 3' exonuclease activity, (b) a crowding agent, (c) an
isolated thermostable non-strand-displacing DNA polymerase with 3'
exonuclease activity, or a mixture of said DNA polymerase with a
second DNA polymerase that lacks 3' exonuclease activity, (d) an
isolated thermostable ligase, (e) a mixture of dNTPs, and (f) a
suitable buffer, under conditions that are effective for joining
the two or more DNA molecules to form a first assembled dsDNA
molecule in a one-step reaction.
[0010] In some embodiments, the exonuclease of (a) is a T5
exonuclease and the contacting is under isothermal conditions,
and/or the crowding agent of (b) is PEG, and/or the
non-strand-displacing DNA polymerase of (c) is Phusion.TM. DNA
polymerase or VENT.RTM. DNA polymerase, and/or the ligase of (d) is
Taq ligase.
[0011] In some embodiments, the conditions are also suitable for
digesting any unpaired, non-homologous, single-stranded DNAs
following the joining reaction. At least some of the DNA molecules
to be joined comprise, at one terminus, a sequence that is
non-homologous to any of the DNA molecules of interest. Optionally,
the non-homologous sequences comprise one or more binding regions
for PCR primers, and/or regions of homology to vector sequences,
and/or recognition sites for one or more restriction enzymes that
are not present within the DNA molecules of interest, e.g.,
rare-cutting restriction enzymes.
[0012] The method may be employed to join a second set of two or
more DNA molecules to one another to obtain a second assembled DNA
molecule in addition to a first assembled molecule, and the first
and the second assembled DNA molecules joined to obtain a third
assembled ds DNA molecule. This process may be sequentially
repeated as required to obtain the whole nucleic acid sequence of
interest.
[0013] The invention also provides kits for performing the above
methods that comprise: (a) an isolated non-thermostable 5' to 3'
exonuclease that lacks 3' exonuclease activity, (b) a crowding
agent, (c) an isolated thermostable non-strand-displacing DNA
polymerase with 3' exonuclease activity, or a mixture of said DNA
polymerase with a second DNA polymerase that lacks 3' exonuclease
activity, and (d) an isolated thermostable ligase, in appropriate
amounts. For example, the kit may contain T5 exonuclease, PEG,
Phusion.TM. DNA polymerase, and Taq ligase.
[0014] In a second aspect, the invention is directed to an
alternative in vitro method of joining a set of two or more
double-stranded (ds) or single-stranded (ss) DNA molecules, where
adjacent DNA molecules to be joined contain overlapping sequences
at their termini. The method comprises contacting in vitro the two
or more DNA molecules in a single vessel with (a) an isolated
non-thermostable 3' to 5' exonuclease active in the presence of
dNTPs, (b) a crowding agent, (c) an isolated heat-activated DNA
polymerase, (d) an isolated thermostable ligase, (e) a mixture of
dNTPs, and (f) a suitable buffer, under conditions that are
effective for joining the two or more DNA molecules to form a first
assembled dsDNA molecule in a one-step thermocycled reaction.
[0015] In one embodiment of this aspect, the exonuclease of (a) is
Exonuclease III, and/or the polymerase of (c) is heat-activated by
the removal of an inactivating moiety combined with the polymerase
in a heat-sensitive manner; and/or the crowding agent of (b) is
PEG, and/or the ligase of (d) is Taq ligase. The DNA polymerase of
(c) may be AMPLITAQ GOLD.RTM..
[0016] This method may also be employed to obtain a second
assembled set of DNA molecules that can be combined with a first
assembled set. Any combination of the thermocycled one-step method
and the foregoing isothermal method may be used for assembly of
various sets of DNA molecules and any of the two may be used for
subsequent assembly of larger DNA molecules from the assembled
sets.
[0017] The components for the above method may be provided as a kit
that comprises, in a single vessel: (a) an isolated
non-thermostable 3' to 5' exonuclease active in the presence of
dNTPs, (b) a crowding agent, (c) an isolated heat-activated DNA
polymerase, (d) an isolated thermostable ligase, (e) a mixture of
dNTPs, and (f) a suitable buffer, in amounts such that when said
two or more DNA molecules are added to the kit, in the presence of
a suitable buffer solution and dNTPs, and incubated under
thermocycled conditions, the two or more DNA molecules are
assembled in a concerted reaction. In one embodiment of this
aspect, the kit comprises: (a) Exonuclease III, (b) PEG, (c)
AMPLITAQ GOLD.RTM. DNA polymerase, and (d) Taq ligase.
[0018] Any combination of materials useful in the disclosed methods
of the first and second aspects can be packaged together as a kit
for performing any of the disclosed methods. For example, a kit can
comprise a mixture containing all of the reagents necessary for
assembling ssDNA molecules (e.g., oligonucleotides) or dsDNA
molecules.
[0019] In a third aspect, the invention provides a method of
modifying the properties of a whole nucleic acid molecule. The
method comprises: (a) representationally dividing the nucleic acid
sequence of said whole nucleic acid molecule into a multiplicity of
portions along its length thereby identifying the sequences of
partial nucleic molecules; (b) providing, for at least 3 of said
partial nucleic molecules, a multiplicity of variants of each
partial nucleic acid molecule; (c) combinatorially assembling in
vitro said variants along with any partial nucleic acid molecules
which are not varied, wherein the partial nucleic acid molecules or
variants thereof contain overlapping sequences at their termini
whereby assembly of the partial nucleic acid molecules and variants
thereof in the mixture would result in assembly of a multiplicity
of variants of the whole nucleic acid molecule; and (d) expressing
the variants of the whole nucleic acid molecule to determine any
modified properties of said variants of said whole nucleic acid
molecule.
[0020] The assembling of step (c) may be performed by either of the
foregoing methods, although alternative joining methods may also be
used. Multistep in vitro methods may be used, for example, or in
vivo methods, such as those described in PCT application
PCT/US2008/079109 may be used. While in vitro assembly methods are
generally more convenient for oligonucleotides, in vivo assembly
methods are also workable alternatives.
[0021] One assembly method that may be employed comprises the steps
of: (a) contacting said variants along with any partial nucleic
acid molecules which are not varied with a non-processive 5'
exonuclease; and with (b) a single stranded DNA binding protein
(SSB) which accelerates nucleic acid annealing; and with (c) a
non-strand-displacing DNA polymerase; and with (d) a ligase, under
conditions effective to join the variants and partial nucleic acid
molecules that are not varied so as to result in assembly of a
multiplicity of variants of the whole nucleic acid molecule.
[0022] This aspect, in one embodiment, comprises dividing the
nucleic acid sequence of the whole nucleic acid molecule into at
least 5 portions which can advantageously be assembled using the in
vitro methods of the invention. In other embodiments, the partial
nucleic acid molecular variants provide degenerate forms of the
codon for one or more amino acids encoded by the partial nucleic
acid molecules. Alternatively, the variants of the partial nucleic
acid molecule provide a multiplicity of nucleic acid control
sequences affecting transcription or translation of the whole
nucleic acid molecule. As another alternative, the variants of the
partial nucleic acid molecule provide a multiplicity of regions
encoding domains or motifs of peptides or proteins encoded by the
whole nucleic acid molecule. As yet another alternative, the
peptides or proteins encoded by said partial nucleic acid molecules
function together in a metabolic pathway.
[0023] The various recombination approaches set forth above can be
used to construct any desired assembly, such as plasmids, vectors,
genes, metabolic pathways, minimal genomes, partial genomes,
genomes, chromosomes, extrachromosomal nucleic acids, for example,
cytoplasmic organelles, such as mitochondria (animals), and in
chloroplasts and plastids (plants), and the like. For the assembly
of large DNA molecules, the final steps may be conducted in vivo,
where yeast is a preferred host. The balance between in vitro and
in vivo conduct of assembly steps is determined by the practicality
of the method with regard to the nature of the DNA molecules to be
assembled.
[0024] The invention further includes libraries of DNA molecules
obtained by the foregoing methods, and methods to use the modified
whole DNA molecules. The libraries, which contain 2 or more
variants, but typically multiple variants, such as 20, 100, 1000 or
more can be screened for members having desired characteristics,
such as high production levels of desired products, enhanced
functionality of the products, or decreased functionality (if that
is advantageous). Such screening may be done by high throughput
methods, which may be robotic/automated.
[0025] The invention also further includes products made by the
methods of the present invention, for example, the resulting
assembled synthetic genes or genomes and modified optimized genes
and genomes, and the use and products thereof.
[0026] The recombinant methods of the invention have a wide variety
of applications, permitting, for example, the design of pathways
for the synthesis of useful products, including pharmaceuticals,
biofuels, diagnostics, veterinary products, agricultural chemicals,
growth factors, and the like--i.e., any molecule that can be
assembled in a cell culture or in a transgenic animal or plant. As
a simple example, the acetate pathway of E. coli can be adapted to
produce biofuels such as ethanol, butanol and the like. Enzymes on
a synthetic pathway for a secondary metabolite, such as a
polyketide, can also be optimized using the methods of the
invention. Thus, the DNA molecules that result from the systemic
combinatorial procedures of the invention may be employed in a wide
variety of contexts to produce useful products.
BRIEF DESCRIPTION OF THE DRAWINGS
[0027] FIG. 1A is a schematic of a two-step thermocycled in vitro
assembly using T4 polymerase.
[0028] FIG. 1B shows the results of assembly of 8 nucleic acid
fragments, each between 5.3 kb and 6.5 kb, with 240 to 360 bp
overlapping sequences, carried out in the presence (+) or absence
(-) of 5% PEG-8000, using the method shown in FIG. 1A.
[0029] FIG. 1C shows the results of assembly of 4 nucleic acid
fragments, each 5 kb, with 40 bp overlapping sequences, in the
presence of PEG-8000, using the method shown in FIG. 1A.
[0030] FIG. 1D shows the results of assembly of a Mycoplasma
genitalium one-half genome (310 kb), from two one-quarter genome
fragments, 144 kb and 166 kb, with 257 bp overlapping
sequences.
[0031] FIG. 1E shows the results of assembly of the complete
synthetic Mycoplasma genitalium genome from four one-quarter genome
fragments, .about.150 kb each with 80 to 257 bp overlapping
sequences.
[0032] FIG. 2A is a schematic of the strategy used to analyze the
success of a repaired assembly reaction. dsDNA is denatured to
ssDNA in the presence of formamide (+F), and ssDNA remains intact
with a higher molecular weight if repair has occurred.
[0033] FIG. 2B shows the results of the method of FIG. 2A used to
analyze products assembled using the method shown in FIG. 1A.
[0034] FIG. 3 shows the results of rolling circle amplification
(RCA) of repaired assembly products joining 4 DNA fragments,
showing that only repaired assembly products are amplified.
[0035] FIG. 4A is a schematic of a one-step thermocycled in vitro
assembly using exonuclease III.
[0036] FIG. 4B shows the results of 2 assemblies of 4 different
nucleic acid fragments, each .about.5 kb with either 300 bp or 40
bp overlapping sequences, using the method shown in FIG. 4A.
[0037] FIG. 4C shows the results of analyzing the repair of the
assembly products, as shown in FIG. 2A.
[0038] FIG. 5A is a schematic of a one-step isothermal in vitro
assembly using T5 exonuclease.
[0039] FIG. 5B shows the results of assembly of 2 nucleic acid
fragments, 4,024 bp and 2,901 bp, with .about.450 bp overlapping
sequences, using the method shown in FIG. 5A, and incorporating a
NotI restriction enzyme sequence.
[0040] FIG. 5C shows the results of Not I digestion of the product
shown in FIG. 5B.
[0041] FIG. 5D shows the results of assembly of 3 nucleic acid
fragments, each .about.5 kb, together with a vector sequence of
.about.8 kb, with 40 bp overlapping sequences, using the method
shown in FIG. 5A.
[0042] FIG. 5E shows representative results of DNA purified from E.
coli transformed with the assembly product shown in FIG. 5D, and
digested with Not I to release the assembled fragments from the
vector.
[0043] FIG. 6A-6D show the results of direct comparisons of the
methods shown in FIG. 1A (T4 polymerase), FIG. 4A (exonuclease III)
and FIG. 5A (T5 exonuclease).
[0044] FIG. 6A shows the results of assembly of 4 nucleic acid
fragments, 5.9 kb to 6.2 kb, with 80 bp overlapping sequences,
together with a vector of .about.8 kb with 80 bp overlapping
sequences, using the various assembly methods described above.
[0045] FIG. 6B shows representative results of DNA purified from E.
coli transformed with the assembly products shown in FIG. 6A, and
digested with NotI to release the assembled fragments from the
vector.
[0046] FIG. 6C shows the results of assembly of 2 one-quarter
genomes of Mycoplasma genitalium, together with a vector of
.about.8 kb with 80 bp overlapping sequences, using the various
assembly methods described above.
[0047] FIG. 6D shows representative results of DNA purified from E.
coli transformed with the assembly products shown in FIG. 6C, and
digested with NotI to release the assembled fragments from the
vector.
[0048] FIG. 7A is a schematic illustrating the use of codon
optimization to create a combinatorial library of assembled
fragments.
[0049] FIG. 7B is a schematic illustrating the use of a
multiplicity of motif and domain variants to create a combinatorial
library of a gene.
[0050] FIG. 7C is a schematic illustrating the use of variant genes
to create a combinatorial library of a metabolic pathway.
[0051] FIG. 8A is a schematic of an acetate utilization
pathway.
[0052] FIG. 8B is a schematic illustrating the use of variant genes
from 5 organisms together with 4 control sequences to create a
combinatorial library of the acetate utilization pathway shown in
FIG. 8A.
[0053] FIG. 8C is a schematic illustrating the assembly strategy
for the nucleic acid fragments shown in FIG. 8B.
[0054] FIG. 8D shows the results of the assembly of an exemplary
acetate utilization pathway as shown in FIG. 8C, showing assembly
product released from the vector by restriction enzyme digest.
[0055] FIG. 9A-9F show the sequential assembly of a complete mouse
mitochondrial genome using the method shown in FIG. 5A (T5
exonuclease).
[0056] FIG. 9A shows the results of assembly of five 300 bp
fragments, in 15 reactions covering the entire mouse mitochondrial
genome.
[0057] FIG. 9B shows the results of amplification of the reaction
products shown in FIG. 9A.
[0058] FIG. 9C shows the results of assembly of five 1,180 bp
products of the reaction shown in FIG. 9A, in 3 reactions covering
the entire mouse mitochondrial genome.
[0059] FIG. 9D shows the results of amplification of the reaction
products shown in FIG. 9C.
[0060] FIG. 9E shows the results of the final assembly of the whole
mouse mitochondrial genome from three 5,560 bp products of the
reaction shown in FIG. 9C, in a vector construct.
[0061] FIG. 9F shows the results of the final assembly of the whole
mouse mitochondrial genome product shown in FIG. 9F after removal
of the vector sequence and recircularization.
MODES OF CARRYING OUT THE INVENTION
Definitions
[0062] As used herein, the singular forms "a," "an," and "the"
include plural referents unless the context clearly dictates
otherwise.
[0063] The term "about," as used herein, refers to plus or minus
20%. Thus, "about" 30 minutes includes 24-30 minutes. "About" also
refers to plus or minus 20% when referring to lengths of nucleic
acids, temperatures, etc. The end points of ranges, as used herein,
are included in the range. When plus or minus 20% results in a
non-integral value of indivisible units, such as nucleotides, a
skilled worker will recognize that one should round the value to
the nearest integer. For example, about 8 nucleotides is not 6.4 to
9.6 nucleotides, but should be interpreted as 6 to 10
nucleotides.
[0064] The term "activity temperature" refers to the temperature
above which the DNA polymerase is sufficiently more active than the
exonuclease (i.e., exonuclease III) such that there is a net
reduction in the length of the single-strand overhangs created
initially by the exonuclease (i.e., exonuclease III).
[0065] In those methods of the invention that are carried out "in
vitro", all of the protein components are isolated and/or
substantially purified. The in vitro assembly reactions are not
carried out in a living cell or with a crude cell extract; the
reactions are carried out in a cell-free environment.
[0066] The "joining" of DNA molecules by a method of the invention
is sometimes referred to herein as "recombination" or "assembly" of
the DNA molecules.
[0067] According to the present invention, optimization at the
genetic level is achieved in a systematic manner by design of
discrete components. This is true at all levels of combination as
described above. The invention methods thereby avoid the random
nature of prior art approaches.
[0068] Methods of Nucleotide Assembly
[0069] In brief, when the DNA molecules to be joined are
double-stranded, the preferred method comprises incubating the DNA
molecules with (a) an exonuclease (e.g., a non-processive
exonuclease), which "chews-back" the ends of the double-stranded
DNA molecules, to expose single-stranded overhangs comprising the
regions of overlap; (b) a crowding agent, such as PEG, which, among
other functions, accelerates nucleic acid annealing, so that the
single-stranded overhangs are annealed (hybridized) specifically;
(c) a non-strand-displacing DNA polymerase, which fills in
remaining single-stranded gaps in the annealed molecules, by
extending the 3' ends of the annealed regions; and (d) a
thermostable ligase, which seals (ligates) the nicks thus formed.
For single-stranded molecules, the exonuclease of (a) may be, but
need not be, omitted.
[0070] When the DNA molecules to be joined are single-stranded, the
single-stranded DNA molecules (e.g., oligonucleotides of about
40-60 bases, also referred to herein as nucleotides or nt) anneal
via the sequences of identity at their ends (e.g., about 20 bases),
to form gapped molecules. The exonuclease activity may act on these
gapped molecules to increase the size of the gap. The gapped
molecules are then repaired with the polymerase and the ligase, as
above, to form double stranded molecules.
[0071] The novel one-step methods of the invention can be used to
simultaneously join a large number of DNA molecules. To accomplish
this, the DNA molecules to be joined are designed so that, for each
pair of DNA molecules to be joined contain overlapping sequences at
their termini--i.e., the distal region of one DNA molecule
comprises a region of unique sequence homology (e.g., identity)
with the proximal region of the other DNA molecule. Distal and
proximal refer to an arbitrary reference point at one end of a
chain of molecules, e.g., with respect to the referent X,
##STR00001##
A represents a proximal and B represents a distal region. To
facilitate the joining of the DNA molecules in a predetermined
orientation and order, each set of distal and proximal regions of
sequence identity is selected (designed) to be unique (to be
different from the regions of sequence identity of the other pairs
of DNA molecules). The method allows a number of DNA molecules to
be joined in a single reaction mixture, and in a single vessel. It
will be evident that the regions of homology are, in some
circumstances, complementary. The term a "region of sequence
identity" encompasses both identical and complementary
sequences.
[0072] In methods of the invention, the distal region of one of a
pair of dsDNA molecules to be joined shares a region of sequence
homology (e.g., sequence identity) with the proximal region of the
other dsDNA molecule. The term "distal" as used herein refers to
the 3' end of a first DNA molecule of a pair to be joined (the
5'-most DNA molecule), and the term "proximal" refers to the 5' end
of the second DNA molecule of the pair. The regions of homology are
sometimes referred to herein as "overlaps", "overlapping
sequences", or "regions of overlap." A "region of sequence homology
(identity)", as used herein, refers to both strands of the
double-stranded DNA molecule. Thus, one strand from this region can
hybridize specifically to its complementary strand, e.g., when the
complementary regions are present in single-stranded overhangs from
the distal and proximal regions of the two molecules to be
joined.
[0073] In one embodiment, the DNA molecules which are joined are
synthetically generated DNA molecules that may lie adjacent to one
another in a gene or genome of interest. For example, a first set
of about eight 60-mer single-stranded oligonucleotides (oligos)
having 20 base regions of sequence identity at either end may be
joined in the proper order and orientation to form a dsDNA of 300
bp. A second set of a similar number of adjoining DNA molecules of
about the same size may also be joined; and then, in a second stage
assembly, the two sets of joined molecules are joined to one
another. The process is repeated with further sets of DNA
molecules, in as many cycles as desired. In such a manner, the
component elements of a gene or genome, all or nearly all of which
have been generated synthetically, can be joined in sequential
steps to form a complete gene or genome.
[0074] Advantages of the method of the invention include the
ability to perform the joining reactions under well-defined
conditions, using well-characterized, isolated (e.g., substantially
purified) enzymes. This allows the joining reactions to be
controlled and reproducible. In a method of the invention, the
joining process is not subject to competing reactions brought about
by other enzymes in the reaction mixture, such as exonucleases and
endonucleases which can be present in cells or cell extracts. The
joining methods of the invention are accurate, inexpensive, require
very little sample handling, and can be completed rapidly (e.g.,
between about 15 minutes and an hour, such as between about 15 and
about 30 minutes) in single vessel. If desired, the steps of the
method can be carried out robotically, without the intervention of
an investigator.
[0075] Other advantages of a method of the invention include the
following: the ability to join DNA molecules in a defined order and
orientation allows, for example, for the cloning of one or more
fragments of interest into a linearized vector in a defined
orientation; or for the assembly of component DNA portions of a
longer sequence of interest (such as the assembly of component
parts of a synthetic gene or genome); or for the assembly and
cloning of sub-fragments of a DNA which are too large to clone
using a PCR amplification step. The method allows one to join
and/or clone DNA molecules of interest without having to rely on
the presence of restriction enzyme recognition sites at the ends of
the fragments to be joined. The in vitro procedure also allows one
to assemble DNAs that are unstable or otherwise recalcitrant to in
vivo cloning, and thus would be difficult to clone by a method
requiring transformation into and replication in a bacterium. If
desired, DNAs assembled by a method of the invention can then be
amplified in vitro (e.g., by multiple displacement amplification
(MDA), such as rolling circle amplification (RCA); or by PCR),
again without having to passage the DNA through a bacterium. If
desired, DNA molecules can be assembled in the presence of vector,
so that the cloned sequence can be transformed into a suitable host
cell directly after the assembly is complete.
[0076] These methods can be repeated sequentially, to assemble
larger and larger molecules. For example, a method of the invention
can comprise repeating a method as above to join a second set of
two or more DNA molecules of interest to one another, and then
repeating the method again to join the first and second set DNA
molecules of interest, and so on. At any stage during these
multiple rounds of assembly, the assembled DNA can be amplified by
transforming it into a suitable microorganism, or it can be
amplified in vitro (e.g., with PCR or rolling circle amplification
(RCA)).
[0077] In one aspect of the invention, the DNA molecules of
interest are single-stranded oligonucleotides that are about 40-60
bases in length, and the region of sequence identity consists of no
more than 20 bases. In other aspects of the invention, the DNA
molecules of interest are double-stranded DNA molecules of at least
about 100, 200, 500, 1,000, 5,000, 10,000, 50,000, 100,000,
200,000, 500,000, or 1.times.10.sup.6 bp in length. The regions of
sequence identity in these dsDNA molecules may comprise at least
about 20, 30 or 40 nucleotides (nt), e.g., at least about 80, 300,
500 or more nt.
[0078] The methods of the invention may be used to join at least
about 8 DNA oligonucleotides (oligos), e.g., as many as about 100
oligonucleotides in a single concerted reaction, to generate one
contiguous DNA. In a single vessel, many such concerted reactions
can take place simultaneously. For example, in a single vessel,
hundreds of reactions can be performed simultaneously, in each of
which 8 oligonucleotides are assembled to form a contiguous DNA,
resulting in hundreds of contiguous DNAs. For the joining of dsDNA
molecules in a single concerted reaction, there may at least about
4 (e.g., at least about 5, 10, 25, 50, 75 or 100 molecules),
wherein for each pair of molecules to be joined, the distal region
of one DNA molecule comprises a region of sequence homology to the
proximal region of the other DNA molecule, and each set of distal
and proximal regions of homology is unique for each pair of DNA
molecules to be joined.
[0079] In a joining reaction of the invention, the collection of
DNA molecules of interest to be joined can further comprise a
linearized vector DNA molecule, and the joined DNAs of interest can
thus be cloned into the vector. Such molecules can, if desired, be
transformed into a host cell (e.g., a microorganism, such as a
bacterium (e.g., E. coli), yeast or a eukaryotic cell, such as a
mammalian cell).
[0080] In methods of the invention, one or more (e.g., all) of the
DNA molecules can be generated synthetically. The DNA molecules may
be adjacent sequences of a gene or genome of interest. In one
embodiment, the DNA molecules are synthesized so as to comprise
overlapping regions of sequence identity at their ends, and the DNA
molecules are joined to form part or all of a synthetic gene or
genome.
[0081] In one aspect of the invention, each of the DNA molecules of
interest to be joined comprises, at the free end of each of the two
regions of identity, a sequence that is non-homologous to any of
the DNA molecules of interest; and during the joining reaction, the
non-homologous sequences are removed by the 3' exonuclease activity
of the polymerase (for the isothermal method) or the 5' exonuclease
activity of the polymerase for the thermocycled method. The
non-homologous sequences may comprise one or more binding domains
for PCR primers (e.g., four different binding domains), and/or
recognition sites for one or more restriction enzymes.
[0082] Thus, methods of the invention can be readily adapted to be
automated and high throughput (e.g., carried out by robotic
methods).
[0083] Chew-Back
[0084] In methods of the invention, the exonuclease digestion is
carried out under conditions that are effective to chew-back a
sufficient number of nucleotides to allow for specific annealing of
the exposed single-stranded regions of homology. In general, at
least the entire region of overlap is chewed back, leaving
overhangs which comprise the region of overlap. In some methods,
the exonuclease digestion may be carried out by a polymerase in the
absence of dNTPs (e.g., T5 DNA polymerase) while in other methods,
the exonuclease digestion may be carried out by an exonuclease in
the presence of dNTPs that lacks polymerase activity (e.g.,
exonuclease III)
[0085] In other embodiments, e.g., when the region of overlap is
very long, it may only be necessary to chew-back a portion of the
region (e.g., more than half of the region), provided that the
single-stranded overhangs thus generated are of sufficient length
and base content to anneal specifically under the conditions of the
reaction. By "annealing specifically" is meant herein that a
particular pair of single-stranded overhangs will anneal
preferentially (or only) to one another, rather than to other
single-stranded overhangs which are present in the reaction
mixture. By "preferentially" is meant that at least about 95% of
the overhangs will anneal to the paired overhang. A skilled worker
can readily determine the optimal length for achieving specific
annealing of a sequence of interest under a given set of reaction
conditions. Generally, the homologous regions of overlap (the
single-stranded overhangs or their complements) contain identical
sequences. However, partially identical sequences may be used,
provided that the single-stranded overhangs can anneal specifically
under the conditions of the reactions.
[0086] Crowding Agent
[0087] A suitable amount of a crowding agent, such as PEG, in the
reaction mixture allows for, enhances, or facilitates molecular
crowding. Without wishing to be bound by any particular mechanism,
it is suggested that a crowding agent, which allows for molecular
crowding, binds to and ties up water in a solution, allowing
components of the solution to come into closer contact with one
another. For example, DNA molecules to be recombined can come into
closer proximity; this thus facilitates the annealing of the
single-stranded overhangs. Also, it is suggested that enzymes can
come into closer contact with their DNA substrates and can be
stabilized by the removal of water molecules. A variety of suitable
crowding agents will be evident to the skilled worker. These
include a variety of well-known macromolecules, such as polymers,
e.g., polyethylene glycol (PEG); Ficoll, such as Ficoll 70;
dextran, such as dextran 70; or the like. Much of the discussion in
this application is directed to PEG. However, the discussion is
meant also to apply to other suitable crowding agents. A skilled
worker will recognize how to implement routine changes in the
method in order to accommodate the use of other crowding
agents.
[0088] In general, when PEG is used, a concentration of about 5%
(weight/volume) is optimal. However, the amount of PEG can range,
e.g., from about 3 to about 7%. Any suitable size of PEG can be
used, e.g., ranging from about PEG-200 (e.g., PEG-4000, PEG-6000,
or PEG-8000) to about PEG-20,000, or even higher. In the Examples
herein, PEG-8000 was used. The crowding agent can, in addition to
enhancing the annealing reaction, enhance ligation.
[0089] Gap Repair
[0090] Following the annealing of single stranded DNA (either
overhangs produced by the action of exonuclease when the DNA
molecules to be joined are dsDNA, or the regions of sequence
identity of single stranded DNA molecules when the DNAs to be
joined are single-stranded DNA), the single-stranded gaps left by
the exonuclease are filled in with a suitable thermostable,
non-strand-displacing, DNA polymerase (sometimes referred to herein
as a "polymerase") and the nicks thus formed a sealed with a
thermostable ligase. A "non-strand-displacing DNA polymerase," as
used herein, is a DNA polymerase that terminates synthesis of DNA
when it encounters DNA strands which lie in its path as it proceeds
to copy a dsDNA molecule, or that degrades the encountered DNA
strands as it proceeds while concurrently filling in the gap thus
created, thereby generating a "moving nick" (nick translation).
[0091] The nicks generated by the gap-filling reaction can be
sealed with any of a variety of suitable thermostable DNA ligases
(sometimes referred to herein as "ligases"). Among the suitable
ligases are, for example, Taq ligase, Ampligase Thermostable DNA
ligase (Epicentre Biotechnologies), the Thermostable ligases
disclosed in U.S. Pat. No. 6,576,453, Thermostable Tfi DNA ligase
from Bioneer, Inc., etc.
[0092] Generally, substantially all of the nicks (or all of the
nicks) are sealed during the reaction procedure. However, in one
embodiment, joined DNA which still comprises some nicks can be
transformed into a bacterium, such as E. coli, where the nicks are
sealed by the bacterial machinery.
[0093] The amount of the enzymes used in a method of the invention
can be determined empirically. Generally, the amount of 5'
exonuclease activity is substantially lower than the amount of the
polymerase activity, and ligase activity is in large excess over
the polymerase. Suitable amounts of enzymes to be used in a method
of the invention are illustrated in the Examples herein.
[0094] Reaction components (such as salts, buffers, a suitable
energy source (such as ATP or NAD), pH of the reaction mixture,
etc.) that are present in a reaction mixture of the invention may
not be optimal for the individual enzymes (exonuclease, polymerase
and ligase); rather, they serve as a compromise that is effective
for the entire set of reactions. Some exemplary reaction conditions
are presented in the Examples. For example, one suitable buffer
system identified by the inventors, sometimes referred to herein as
ISO (ISOthermal) Buffer typically comprises 0.1 M Tris-Cl pH 7.5;
10 mM MgCl.sub.2, 0.2 mM each of dGTP, dATP, dTTP and dCTP, 10 mM
DTT, 5% PEG-8000, and 1 mM NAD.
[0095] In a method of the invention, the proteins having
exonuclease, polymerase and ligase activities are isolated (e.g.,
substantially purified); cell extracts or intact cells are not
employed. The term, an "isolated" protein, as used herein, means
that the protein is removed from its original environment (e.g.,
the natural environment if it is naturally occurring), and isolated
or separated from most other component with which it is naturally
associated. For example, a naturally-occurring protein present in
its natural living host (e.g., a bacteriophage protein present in a
bacterium that has been infected with the phage) is not isolated,
but the same protein, separated from some or all of the coexisting
materials in the natural system, is isolated. Such proteins can be
part of a composition or reaction mixture, and still be isolated in
that such composition or reaction mixture is not part of its
natural environment. The term "an isolated protein," as used
herein, can include 1, 2, 3, 4 or more copies of the protein, i.e.,
the protein can be in the form of a monomer, or it can be in the
form of a multimer, such as dimer, trimer, tetramer or the like,
depending on the particular protein under consideration. In some
embodiments, the protein is purified. Methods for purifying the
proteins used in methods of the invention are conventional. In some
embodiments, the protein is substantially purified or is purified
to homogeneity. By "substantially purified" is meant that the
protein is separated and is essentially free from other proteins,
i.e., the protein is the primary and active constituent. The
purified protein can then be contacted with the DNAs to be joined.
Proteins used in the methods of the invention can be in the form of
"active fragments," rather than the full-length proteins, provided
that the fragments retain the activities (enzymatic activities or
binding activities) required to achieve the joining. One of skill
in the art will recognize how to make and use such active
fragments.
[0096] Joining DNA Molecules
[0097] In methods of the invention, at least two DNA molecules are
contacted with the enzymes under conditions effective to join the
DNA molecules to form a substantially intact (preferably having no
nicks) double-stranded DNA molecule (e.g., in which a single copy
of the region of sequence identity is retained).
[0098] A method of the invention can be used to join any DNA
molecules of interest, including DNAs which are naturally
occurring, cloned DNA molecules, synthetically generated DNAs, etc.
The joined DNA molecules may, if desired, be cloned into a vector
(e.g., using a method of the invention).
[0099] DNA molecules of any length can be joined by methods of the
invention. Single-stranded oligonucleotides of about 40-60 bases
can be joined, e.g., via overlaps of about 20 bases. The minimum
size for joining molecules with a 40 bp overlap is about 80 bp. For
molecules with a 200 bp overlap, the minimum size is about 400 bp.
Theoretically, there should be no maximum size of DNA molecules
that can be joined (although very large molecules would be more
fragile than smaller ones, and thus subject to possible breakage).
For example, cassettes having about 100 bp to about 750 or 1,000,
or more, can be joined.
[0100] From two to an essentially unlimited upper level of DNA
molecules can be joined. In general, at least about 5-10 fragments
can be joined. The number of fragments which can be joined depends,
in part, on the length of the overlaps and the lengths of the
fragments. For example, with fragments having overhangs of about
150 to about 200 bp (e.g., fragments of about 3 kb, or larger or
smaller), the number of fragments that can be joined is
substantially unlimited. The number of fragments that can be joined
in one reaction also depends, in part, on the efficiency of the
joining process. If the efficiency of joining is 100%, then an
infinite number of DNA molecules could theoretically be joined
(provided that an approximately equal number of molecules of each
substrate is present in the reaction). With lower efficiencies
(e.g., about 75-90% joining of each pair of two molecules), two to
about 250 DNA molecules can be joined. Methods of the invention
work well with a wide range of substrate DNA (e.g., about 10 to
about 1,000 ng of each substrate in a reaction mixture.)
[0101] In some embodiments of the invention, the joined DNA
molecules form a circle and/or become ligated into a vector to form
a circle. The lower size limit for a dsDNA to circularize is about
200 base pairs. Therefore, the total length of the joined fragments
(including, in some cases, the length of the vector) is preferably
at least about 200 bp in length. There is no practical upper size
limit, and joined DNAs of a few hundred kilobase pairs, or larger,
can be generated by a method of the invention. The joined DNAs can
take the form of either a circle or a linear molecule.
[0102] More particularly, the number of DNA molecules or cassettes
that may be joined in vitro to produce an end product, in one or
several assembly stages according to the invention, may be at least
or no greater than about 2, 3, 4, 6, 8, 10, 15, 20, 25, 50, 100,
200, 500, 1,000, 5,000, or 10,000 DNA molecules, for example in the
range of about 4 to about 100 molecules. The number of assembly
stages may be about 2, 4, 6, 8, 10, or more. The number of
molecules assembled in a single stage may be in the range of about
2 to about 10 molecules. The methods of the invention may be used
to join together DNA molecules or cassettes each of which has a
starting size of at least or no greater than about 40 bs, 60 bs, 80
bs, 100 bs, 500 bs, 1 kb, 3 kb, 5 kb, 6 kb, 10 kb, 18 kb, 20 kb, 25
kb, 32 kb, 50 kb, 65 kb, 75 kb, 150 kb, 300 kb, 500 kb, 600 kb, 1
Mb, or larger, for example in the range of about 3 kb to about 500
kb. The DNA end products of the inventive methods may be at least
about 500 bs, 1 kb, 3 kb, 5 kb, 6 kb, 10 kb, 18 kb, 20 kb, 25 kb,
32 kb, 50 kb, 65 kb, 75 kb, 150 kb, 300 kb, 500 kb, 600 kb, 1 Mb,
or larger, for example in the range of 30 kb to 1 Mb. In one
embodiment, the inventive methods are used for the in vitro
assembly of short single-stranded oligonucleotides, through several
rounds of assembly, into cassettes of about 6 kb, and then the
assembly of 100 such cassettes into a DNA molecule of about 600
kb.
[0103] When joining a mixture of DNA molecules, it is preferable
that the DNAs be present in approximately equimolar amounts. If the
number of DNA molecules is not balanced, the result would be a
termination of assembled species. For example, consider an example
in which 8 DNA molecules are to be assembled (numbered 1-8). If,
for example, there was an excess of molecule number 4, the majority
of assembled molecules would be 1-4 and 4-8. Assuming only a few
hundred bases is being chewed back in the reaction, there would be
no sequence homology between the distal region of 1-4 and the
proximal region of 4-8, thereby decreasing the amount of 1-8.
[0104] Region of Sequence Homology
[0105] The region of sequence identity should be sufficiently long
to allow specific recombination to occur. That is, it should be
long enough so that the region of overlap at the ends of two DNA
molecules to be joined is unique to those DNA molecules, and no
other DNA molecules will anneal to those two DNA molecules during
the recombination reaction. The length can vary from a minimum of
about 10 base pairs (bp) to about 300 bp or more. In general, it is
preferable that the length of the overlap is less than or equal to
about the size of the fragment to be combined, but not less than
about 10 bp and not more that about 1000 bp. For the joining of 2
or 3 fragments, about 20-30 bp overlap may be sufficient. For more
than 10 fragments, a preferred overlap is about 80 bp to about 300
bp. In one embodiment, the region of sequence identity is of a
length that allows it to be generated readily by synthetic methods,
e.g., about 40 bp (e.g., about 32 to about 48 bp). The overlaps may
be, e.g., about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200,
250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850,
900, 950 or 1,000 bp in length.
[0106] In a preferred embodiment, when a plurality of DNA molecules
are to be joined, for each pair of DNA molecules to be joined, the
distal region of one of the DNA molecules of the pair is designed
to share a region of sequence identity with the proximal region of
the other DNA molecule of the pair, and the distal and proximal
regions of sequence identity for each pair of DNA molecules are
designed to be unique (to be different from the regions of sequence
identity of the other pairs of DNA molecules). When the overlapping
regions of identity are designed in this manner, the orientation
and order of the DNA molecules in the joined molecule can be
predetermined. A number of DNA molecules (for example, 4 or 6
molecules) can thus be incubated together in a single reaction
mixture (in a single vessel or container) in a method of the
invention, and be joined into a longer DNA molecule in which the
individual DNAs are arranged in any desired order and
orientation.
[0107] The regions of sequence identity present in the proximal and
distal regions of the DNAs to be joined can be generated by any of
a variety of methods.
[0108] For example, in one embodiment of the invention,
synthetically prepared, overlapping fragments of a gene or genome
of interest (e.g., about 5-6 kb in length, or longer or shorter)
are optionally amplified (e.g., by PCR, or by MDA such as a rolling
circle mechanism) and are joined by a method of the invention in
the order and orientation in which they are located in the gene or
genome. In this method, the first DNA fragment (e.g., in the 5'
most portion of the gene or genome) is synthesized so that the
region at its 3' end (the distal end) contains a sequence (e.g.,
about 40 bp) that is identical to the sequence at the 5' end (the
proximal end) of the DNA fragment to which it is to be joined. The
second DNA fragment, in turn, is synthesized so that it has, at its
distal end, a sequence which is identical to the sequence at the
proximal end of the third DNA fragment, and so on. In another
embodiment, synthetically prepared fragments of a gene or genome of
interest are inserted into a vector, propagated in E. coli to make
more of the synthetically prepared fragment, then released from the
vector, optionally amplified further by PCR, MDA or RCA, and joined
by a method of the invention in the order and orientation in which
they are located in the gene or genome. These procedures allow the
preparation of a synthetic gene or genome.
[0109] In another embodiment of the invention, two fragments to be
joined are generated by restriction enzyme digestion, such that the
fragments overlap one another, e.g., by about 20 to about 1,000 bp.
The overlapping regions can then be joined by a method of the
invention. Greater numbers of fragments can also be generated by
these methods and joined. Combinations of the preceding method and
methods using synthetically prepared DNA molecules and/or molecules
generated by PCR can be used.
[0110] In one embodiment of the invention, chemically synthesized
oligonucleotides, from about 20 bp to any size that can be
synthesized chemically, can be used. For example, 10 ssDNA
oligonucleotides of about 60 bp, having about 10-20 bp homology
overlap at each end, can be assembled simultaneously into a vector.
The assembly of 10 such oligonucleotides results in a dsDNA
molecule of about 500 bp. DNA molecules assembled by this method
can, in turn, be joined to one or more other DNA molecules
assembled by this (or another) method (for example, assemblies of
about 500 bp). Repetitions of the method can generate very large
molecules of DNA; there is no theoretical limit to the size of a
DNA molecule thus generated.
[0111] In embodiments of the invention, the regions of identity are
introduced by PCR amplification.
[0112] In one such method, a fragment of interest is inserted into
a vector. For example, a plasmid vector can be linearized with a
restriction enzyme, generating a sequence A (e.g., having 40 bp) to
the left of the restriction enzyme cut and a sequence B (e.g.,
having 40 bp) to the right of the restriction enzyme cut. The
fragment to be cloned into the vector is PCR amplified, using PCR
primers which will introduce sequence A at the left end of the
fragment, and sequence B at the right end of the fragment. The
regions of sequence identity (in this example, each having 40 bp)
allow the fragment to be joined to the vector in a desired
orientation, to form a circular molecule. Alternatively,
particularly when it is desirable to avoid errors which might be
introduced into an insert during PCR amplification, the vector can
be PCR amplified in order to introduce at the ends of a cloning
site sequences which overlap sequences at the ends of the insert.
The methods described above allow for the directional cloning of
any insert of interest, without having to rely on the presence of,
or introduction of, restriction enzyme sites on the insert.
[0113] In a variation of the preceding method, two or more DNA
fragments are joined to one another to form a linear molecule. In
this variation of the preceding method, regions of sequence
identity that are unique to each pair of fragments to be joined are
introduced into the fragments by PCR amplification, using suitable
primers. For each DNA fragment to be joined to another fragment, a
sequence is introduced to the 3' (distal) end of the first fragment
which overlaps with the sequence at the 5' (proximal) end of the
fragment to which it is to be joined. As in the preceding method,
PCR primers are used in which the regions of sequence identity
(e.g., 40 nt) lie 5' to a PCR primer (e.g., having 20 nt). After a
suitable number of rounds of PCR amplification, DNA fragments are
produced in which defined regions of sequence identity are present
at the ends of the fragments. The resulting fragments can then be
joined in a predetermined order and orientation by a method of the
invention.
[0114] If desired, the joined, linear DNA fragments may be
circularized, or they may be inserted into a vector to form a
circle (simultaneously with the joining of the fragments, or
subsequent to that joining). For example, a vector can be present
in the joining reaction, so that the joined fragments are
introduced into the vector. The efficiency of joining a large
number of fragments (e.g., 6 or 8 fragments) into a vector by a
method of the invention is greater than when using a method which
employs compatible restriction enzyme sites. In a typical cloning
experiment with restriction enzymes and T4 DNA ligase, probability
is not in favor of the researcher getting multiple inserts to
ligate into a vector. However, in the assembly methods of the
invention, a researcher can join about 6 inserts into a vector with
approximately 20-50% efficiency, or greater. Furthermore, since the
efficiency is high, there is an increased ratio of recombinants to
non-recombinants. The background level of non-recombinants can be
reduced further by isolating a pure band by agarose gel
electrophoresis (since this method produces a high enough yield to
isolate a band on agarose gels) or with a sizing column. A DNA of
the desired size (having the correct number of joined DNA
molecules) can be isolated and introduced into a vector, e.g.,
using a method of the invention. If the final product is a circle,
there is no need to isolate it by agarose gel electrophoresis.
Rather, the sample can be treated with an enzyme such as
Plasmid-Safe.TM. (Epicentre), an ATP-dependent DNAse that
selectively hydrolyzes linear dsDNA but not circular dsDNA. If the
user's application does not require a pure clone, there may be a
sufficient amount of DNA without the need to transform into E. coli
and do plasmid preparations.
[0115] In one embodiment, joined DNA molecules and/or DNA molecules
inserted into vectors are introduced into a host cell, such as a
bacterial or eukaryotic cell (e.g., by transformation or
transfection). Alternatively, the reaction mixture comprising the
joined DNA molecules can be introduced into a host cell; only those
DNAs which have recombined to form circular molecules can survive
in the host cell. In another embodiment, the joined fragments
and/or fragments inserted into vectors are used directly, without
further passage through a cell, such as a bacterial cell.
[0116] Molecular biology methods of the invention can be carried
out using conventional procedures. A variety of uses for the
inventive method will be evident to the skilled worker. The
inventive method can be substituted for any method in which
restriction enzyme digests are used to generate compatible
sequences for joining DNA molecules. In one embodiment of the
invention, DNA molecules that are too large to be amplified by PCR
can be cloned by joining sub-fragments by a method of the invention
and then inserting them into a suitable vector. Some pieces of DNA
are unstable (and therefore, unclonable) in E. coli, especially
those that are high in A+T % content. A method of the invention
allows for the assembly of DNA in vitro without the need to be
transformed into E. coli. Furthermore, phi29 DNA polymerase can be
added to the reaction to amplify the circular DNA. An in vitro
recombination system of the invention can be used to recombine any
homologous DNAs of interest, e.g., to repair double-stranded DNA
breaks or gaps, etc. Another application of the method is to
introduce a mutation into a DNA. In this method, a mutation is
introduced into both the upper and lower strand PCR primers, so the
amplified fragments are 100% mutant; then the fragments are joined
by the method of the invention.
[0117] One embodiment of the invention is to join cassettes, such
as the 5-6 kb DNA molecules representing adjacent regions of a gene
or genome of interest, to create combinatorial assemblies. For
example, it may be of interest to modify a bacterial genome, such
as a putative minimal genome or a minimal genome, so that one or
more of the genes is eliminated or mutated, and/or one or more
additional genes is added. Such modifications can be carried out by
dividing the genome into suitable cassettes, e.g., of about 5-6 kb,
and assembling a modified genome by substituting a cassette
containing the desired modification for the original cassette.
Furthermore, if it is desirable to introduce a variety of changes
simultaneously (e.g., a variety of modifications of a gene of
interest, the addition of a variety of alternative genes, the
elimination of one or more genes, etc.), one can assemble a large
number of genomes simultaneously, using a variety of cassettes
corresponding to the various modifications, in combinatorial
assemblies. After the large number of modified sequences is
assembled, preferably in a high throughput manner, the properties
of each of the modified genomes can be tested to determine which
modifications confer desirable properties on the genome (or an
organism comprising the genome). This "mix and match" procedure
produces a variety of test genomes or organisms whose properties
can be compared. The entire procedure can be repeated as desired in
a recursive fashion.
[0118] The disclosed methods can be used to join any nucleic acid
molecules of interest. The nucleic acid molecules can come from any
source, including a cellular or tissue nucleic acid sample, cloned
fragments or subclones thereof, chemically synthesized nucleic
acids, genomic nucleic acid samples, cDNAs, nucleic acid molecules
obtained from nucleic acid libraries, etc. The DNAs can be
radioactively labeled or can comprise binding entities, such as
biotinylated nucleotides, which can aid in the purification of the
joined DNAs. If desired, the DNA molecules to be joined, or primers
for adding overlapping regions of sequence identity, can be
prepared synthetically. Conventional synthesis techniques include
using phosphoroamidite solid-phase chemistry to join nucleotides by
phosphodiester linkages. Chemistry for joining nucleotides by
phosphorothioate linkages or different linkages, such as
methylphosphonate linkages, can also be used. For example, the
cyanoethyl phosphoramidite method can be used, employing a Milligen
or Beckman System 1 Plus DNA synthesizer (for example, Model 8700
automated synthesizer of Milligen-Biosearch, Burlington, Mass. or
ABI Model 380B). Synthetic methods useful for making DNA molecules
are also described by Ikuta, et al., Ann Rev. Biochem. (1984)
53:323-356, (phosphotriester and phosphite-triester methods), and
Narang, et al., Methods Enzymol. (1980) 65:610-620 (phosphotriester
method). DNAs prepared by methods as above are available from
commercial sources, such as Integrated DNA Technologies (IDT),
Coralville, Iowa.
[0119] Methods of the invention are amenable to automation and to
adaptation to high throughput methods, allowing for the joining of
multiple DNA molecules simultaneously by computer-mediated and/or
robotic methods that do not require human intervention.
[0120] DNA Modifications and Nucleotide Analogs
[0121] DNA used in a method of the invention can be modified in any
of a variety of ways, provided that the modified DNA is able to
function in the method. A skilled worker can readily determine if a
particular modification allows the modified DNA to function (e.g.,
to be recognized by and acted upon by enzymes used in the
method).
[0122] DNAs used in methods of the invention can have one or more
modified nucleotides. For example, they may contain one or more
modifications to either the base, sugar, or phosphate moieties.
Modifications to the base moiety would include natural and
synthetic modifications of A, C, G, and T as well as different
purine or pyrimidine bases, such as uracil-5-yl, hypoxanthin-9-yl
(I), and 2-aminoadenin-9-yl. Base modifications often can be
combined with for example a sugar modification, such as
2'-O-methoxyethyl, to achieve unique properties such as increased
duplex stability.
[0123] Nucleotide analogs can also include modifications of the
sugar moiety. Modifications to the sugar moiety would include
natural modifications of the ribose and deoxyribose as well as
synthetic modifications. Modified sugars would also include those
that contain modifications at the bridging ring oxygen, such as
CH.sub.2 and S. Nucleotide sugar analogs may also have sugar
mimetics such as cyclobutyl moieties in place of the pentofuranosyl
sugar.
[0124] Nucleotide analogs can also be modified at the phosphate
moiety. It is understood that these phosphate or modified phosphate
linkages between two nucleotides can be through a 3'-5' linkage or
a 2'-5' linkage, and the linkage can contain inverted polarity such
as 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts and
free acid forms are also included. It is understood that nucleotide
analogs need only contain a single modification, but may also
contain multiple modifications within one of the moieties or
between different moieties.
[0125] Nucleotide substitutes are nucleotides or nucleotide analogs
that have had the phosphate moiety and/or sugar moieties replaced.
Nucleotide substitutes include molecules having similar functional
properties to nucleotides, but which do not contain a phosphate
moiety, such as peptide nucleic acid (PNA). Nucleotide substitutes
include molecules that will recognize and hybridize to
complementary nucleic acids in a Watson-Crick or Hoogsteen manner,
but which are linked together through a moiety other than a
phosphate moiety. Nucleotide substitutes are able to conform to a
double helix type structure when interacting with the appropriate
target nucleic acid.
[0126] Substitutes for the phosphate can be for example, short
chain alkyl or cycloalkyl internucleoside linkages, mixed
heteroatom and alkyl or cycloalkyl internucleoside linkages, or one
or more short chain heteroatomic or heterocyclic internucleoside
linkages. It is also understood in a nucleotide substitute that
both the sugar and the phosphate moieties of the nucleotide can be
replaced, by for example an amide type linkage (aminoethylglycine)
(PNA).
[0127] DNA molecules of the invention can be made up of different
types of nucleotides or the same type of nucleotides. The
nucleotides can be comprised of bases (that is, the base portion of
the nucleotide) and can comprise different types of bases. For
example, one or more of the bases can be universal bases, such as
3-nitropyrrole or 5-nitroindole; about 10% to about 50% of the
bases can be universal bases; about 50% or more of the bases can be
universal bases; or all of the bases can be universal bases.
[0128] One-Step Isothermal Method
[0129] One aspect of the invention is an in vitro method, using
isolated (e.g., substantially purified) proteins, for joining two
or more double-stranded (ds) or single-stranded (ss) DNA molecules
of interest, wherein the distal region of the first DNA molecule
and the proximal region of the second DNA molecule of each pair
share a region of sequence identity, comprising incubating the at
least two DNA molecules in a single vessel, at about 45-60.degree.
C., with
[0130] (a) a non-thermostable, 5' (5' to 3') exonuclease (e.g., T5
or lambda exonuclease, and/or wherein the exonuclease is not T7
exonuclease),
[0131] (b) a crowding agent (e.g., PEG, such as about 5% PEG, e.g.,
PEG-8000),
[0132] (c) a thermostable non-strand-displacing DNA polymerase
which exhibits a 3' exonuclease activity (e.g., a polymerase that
intrinsically exhibits a 3' exonuclease (proofreading) activity,
such as Phusion.TM. or VENTR.RTM. DNA polymerase; or a mixture of a
polymerase, such as Tag polymerase, which lacks a proofreading
activity, and a titered amount (usually a small amount) of an
enzyme such as Phusion.TM. or VENTR.RTM. polymerase, which has a 3'
exonuclease activity), and
[0133] (d) a thermostable ligase (e.g., Taq ligase),
[0134] under conditions that are effective for joining the at least
two DNA molecules to form a substantially intact dsDNA molecule
(e.g., in which a single copy of the region of sequence identity is
retained, and/or in which unpaired, non-homologous, single-stranded
DNAs are digested and removed.
[0135] In the preferred isothermal method, the polymerase of (c)
comprises a 3' exonuclease activity. This enzymatic activity can be
an intrinsic property of the polymerase (c); for example,
Phusion.TM. and VENTR.RTM. DNA polymerases are thermostable,
non-strand-displacing, DNA polymerases which exhibit a
proof-reading activity (a 3' exonuclease activity). Alternatively,
polymerase (c) can be a combination of an enzyme such as Taq
polymerase, which lacks a proofreading activity, with a titrated
amount (usually a small amount) of a thermostable polymerase such
as Phusion.TM. or VENTR.RTM. polymerase, which has a 3' exonuclease
activity. This 3' exonuclease activity is useful, for example, when
it is desirable to add sequences such as primer binding sites to
the ends of the DNA molecules to be joined, e.g., in order to allow
PCR amplification of the molecules by universal primers, but then
to remove the primer binding sites during the assembly procedure.
The ability to use universal primers to amplify DNA molecules to be
joined, and then to be able to remove during the assembly reaction
the binding domains in the molecules which allow the universal
primers to be used, is an advantage of the invention.
[0136] An advantage of this method of the invention is that one can
join DNA molecules which initially lack 5' phosphorylated ends
(e.g., DNAs prepared by PCR amplification), even though a 5'
phosphorylated end is required for ligase to join a 5' end to a 3'
OH group. This is because the 5' exonuclease, as it removes
nucleotides from the 5' end of a substrate DNA, leaves 5'
phosphorylated ends.
[0137] Without wishing to be bound by any particular theory, it is
suggested that, when the mixture of components is incubated at an
elevated temperature (about 45-60.degree. C., e.g., at about
50.degree. C.), the DNA polymerase is able to "win" the competition
with the exonuclease activity, so that the gaps formed by digestion
with the exonuclease are filled in by the polymerase substantially
immediately after they are formed. This is achieved because the
exonuclease is not thermostable, and thus is weakly active at the
elevated temperature and is inactivated after about 10-15 minutes
of incubation, whereas the polymerase functions well at the high
temperature, driving the reaction to fill in the gaps; the nicked
molecules thus formed can then be ligated by the thermostable
ligase. By a "thermostable" enzyme is meant an enzyme that can
function well at a temperature of at least about 45.degree.
C.-60.degree. C.
[0138] Because the buffer conditions for assembling DNA molecules
by a method of the invention are also suitable for PCR
amplification, and an assembly mixture already contains Phusion.TM.
polymerase, PCR can be performed following an assembly reaction
without changing the buffer conditions. In one embodiment, once
assembly is completed, the vessel holding the reaction components
is opened and primers for PCR are added. In another embodiment, the
primers are already contained within the assembly mixture from the
start of the reaction. In this embodiment, following assembly, the
vessel does not have to be opened, and the PCR reaction can begin
immediately and proceed by the standard procedure. When primers are
contained within the assembly mixture, it may be necessary to add
the primers in excess (e.g., .about.5,000 nM) of normal primer
concentrations in PCR (usually 500 nM), to prevent degradation of
some or most of the PCR primers by the exonuclease during the
assembly step.
[0139] Kits for in vitro joining two or more double-stranded (ds)
or single-stranded (ss) DNA by the preferred isothermal method,
comprise, in a single container,
[0140] (a) a non-thermostable, 5' exonuclease (e.g., wherein the
exo is T5 or lambda exonuclease; wherein the exo is T5; wherein the
exo is not T7 exonuclease),
[0141] (b) a crowding agent (e.g., PEG, such as about 5%
PEG-8000),
[0142] (c) a thermostable non-strand-displacing DNA polymerase
which exhibits a 3' exonuclease activity (e.g., a polymerase that
intrinsically exhibits a 3' exonuclease (proofreading) activity,
such as Phusion.TM. and VENTR.RTM. DNA polymerase; or a mixture of
a polymerase, such as Taq polymerase, which lacks a proofreading
activity, and a titered amount (usually a small amount) of an
enzyme such as Phusion.TM. or VENTR.RTM. polymerase, which has a 3'
exonuclease activity), and
[0143] (d) a thermostable ligase (e.g., Taq ligase),
[0144] in suitable amounts such that, when dsDNA molecules or ssDNA
oligonucleotides are added to the kit in the presence of a suitable
buffer composition and dNTPs and incubated for about 15-60 minutes,
at about 45.degree. C. to about 60.degree. C., the DNA molecules
are assembled, in a concerted reaction.
[0145] In one embodiment, the kit comprises the components of the
Oligonucleotide Assembly Mixture shown in Example III A. A kit of
the invention may be stored frozen, e.g., at about -20.degree.
C.
[0146] Any of a variety of 5' to 3', double-strand specific
exodeoxyribonucleases may be used to chew-back the ends of DNA
molecules in the methods of the invention. The term "5'
exonuclease" is sometimes used herein to refer to a 5' to 3'
exodeoxyribonuclease. A "non-processive" exonuclease, as used
herein, is an exonuclease that degrades a limited number of (e.g.,
only a few) nucleotides during each DNA binding event. Digestion
with a 5' exonuclease produces 3' single-stranded overhangs in the
DNA molecules. Among other properties which are desirable for a 5'
exonuclease are that it lacks 3' exonuclease activity, it generates
5' phosphate ends, and it initiates degradation from both
5'-phosphorylated and unphosphorylated ends. It also desirable that
the enzyme can initiate digestion from the 5' end of a molecule,
whether it is a blunt end, or it has a small 5' or 3' recessed end.
Suitable exonucleases will be evident to the skilled worker. These
include, e.g., phage T5 exonuclease (phage T5 gene D15 product),
phage lambda exonuclease, RecE of Rac prophage, exonuclease VIII
from E. coli, phage T7 exonuclease (phage T7 gene 6 product), or
any of a variety of 5' exonuclease that are involved in homologous
recombination reactions. In one embodiment of the invention, the
exonuclease is T5 exonuclease or lambda exonuclease. In another
embodiment, the exonuclease is T5 exonuclease. In another
embodiment, the exonuclease is not phage T7 exonuclease. Methods
for preparing and using exonucleases and other enzymes employed in
methods of the invention are conventional; and many are available
from commercial sources, such as USB Corporation, 26111 Miles Road,
Cleveland, Ohio 44128, or New England Biolabs, Inc. (NEB), 240
County Road, Ipswich, Mass. 01938-2723.
[0147] When a 5' exonuclease is used, single-stranded overhangs are
generated at the 5' end of DNA molecules which cannot be repaired,
unless, e.g., the molecules can form a circle, or other procedures
are introduced to block exonuclease digestion of these 5' termini.
Non-strand-displacing DNA polymerases used in methods of the
invention must elongate in the 5' direction from a primer molecule.
Because no primer is available to be extended in the 5'-located gap
in a DNA molecule which has been chewed back with a 5' exonuclease,
the gap cannot be filled in by a polymerase. In one embodiment of
the invention, the DNA molecules to be joined are selected
(designed) so that the two terminal DNA molecules join to one
another to form a circle. In another embodiment, the joined DNA
molecules are designed so that they become integrated into a vector
which is also present in the reaction mixture. Alternatively, in
one embodiment of the invention, the 5' ends of the terminal DNA
molecules that are to be joined are blocked so that 5' exonuclease
cannot digest them. The blocking agent is preferably reversible, so
that the joined DNA molecule can eventually be joined into a
vector. Suitable blocking agents will be evident to the skilled
worker. These include, e.g., phosphorothioate bonds, 5' spacer
molecules, locked nucleic acid (LNA), etc.
[0148] As is discussed elsewhere herein with regard to the removal
of non-homologous sequences, it is desirable that a thermostable,
non-strand-displacing, DNA polymerase to be used in a method of the
invention exhibits a 3' exonuclease (proof-reading) activity. Among
suitable DNA polymerases having such a 3' exonuclease activity are
Phusion.TM. polymerase, VENTR.RTM. polymerase or Deep Vent
polymerase (which have strand-displacing activity when used at
55.degree. C. or lower), Pfu polymerase and 9'N.sub.m polymerase.
Alternatively, one can use a thermostable, non-strand-displacing,
DNA polymerase which lacks a 3' exonuclease activity, if one also
includes a small amount of a second enzyme which can provide the 3'
exonuclease activity. For example, one can use Taq polymerase, plus
a small amount of one of the polymerases noted above that have 3'
exonuclease activity. A skilled worker can readily titrate how much
of the second enzyme to include, in order to achieve the desired
amount of exonuclease activity.
[0149] In many of the examples used herein, Phusion.TM. polymerase
is used. This polymerase is desirable because, among other
properties, it exhibits a high degree of fidelity.
[0150] A kit for conducting this method can comprise (a) an
isolated (e.g., substantially purified) enzyme having a
non-thermostable, 5' exonuclease activity (e.g., T5 exonuclease or
lambda exonuclease, but preferably not T7 exonuclease); (b) a
crowding agent, such as PEG (e.g., about 5% final concentration of
PEG-8000); (c)(i) an isolated thermostable, non-strand-displacing
DNA polymerase which exhibits a proofreading 3' exonuclease
activity (e.g., Phusion.TM. or VENTR.RTM. polymerase); or (c)(ii)
an isolated thermostable, non-strand-displacing DNA polymerase
which does not exhibit a proofreading 3' exonuclease activity
(e.g., Taq polymerase), in combination with a suitably small amount
of a polymerase having a 3' exonuclease activity (e.g., Phusion.TM.
or VENTR.RTM. polymerase); and (d) an isolated, thermostable ligase
(e.g., Taq DNA ligase). Other components of a kit of the invention
can include a suitable buffer solution, which comprises a buffer at
pH about 7.5 (such as Tris), a suitable amount of MgCl.sub.2, the
four dNTPs, an energy source (such as ATP or NAD), and, optionally,
a suitable cloning (assembly) vector, such as a pUC vector. These
components can be packaged in amounts suitable for a single use, in
individual vessels, to which DNA molecules to be joined are added;
or the components can be present in a larger volume, which can be
distributed in aliquots suitable for individual joining
reactions.
[0151] An exemplary kit contains an optimized 1.33.times. mixture
of Tris pH 7.5, MgCl.sub.2, the four dNTPs, DTT, PEG-8000, NAD, T5
exonuclease, Phusion.TM. polymerase, Taq ligase and, optionally, an
assembly vector. A kit of the invention is generally packaged in a
containers in which the components are stable, e.g., it can be
stored frozen, at about -20.degree. C.
[0152] In one embodiment of the invention, 5 .mu.L of a pool of
dsDNA or ssDNA molecules (e.g., oligonucleotides, such as 60-mers
that overlap each other by 20 bases) to be assembled are combined
with 15 .mu.L of the mixture of the kit, to generate a total of 20
.mu.L. This mixture is then incubated at about 45-60.degree. C.
(e.g., at about 50.degree. C.) for about 15-60 minutes (e.g., 15,
30, 45 or 60 minutes), during which time the DNA molecules assemble
into a contiguous segment of dsDNA. If desired, a kit can further
contain an assembly vector (e.g., a cloning vector), such as pUC
19, pBR322 or a BAC.
[0153] Optionally, kits of the invention comprise instructions for
performing the method, e.g., instructions for designing
oligonucleotides to be assembled, and/or directions for diluting a
pool of oligonucleotides to a suitable concentration. For example,
the inventors have found that about 180 fmol/.mu.L of each
oligonucleotide in 5 .mu.L is optimal for assembling eight 60-mers
with 20 base overlaps. Other optional components of a kit of the
invention include a positive control; for the example noted above,
a control can contain eight 60-mers with 20 base overlaps that have
been demonstrated to assemble by a method of the invention, as well
as a vector, such as pUC19. A kit can also contain, if cloning of
the assembled DNAs is desired, instructions for transforming the
assembled mixture into a suitable microorganism, such as E. coli,
and selecting for transformants on an agar plate containing growth
medium (e.g., LB) and a suitable selective marker (e.g., for pUC19,
carbenicillin or ampicillin). A kit can also comprise instructions
concerning suitable strains for transformation, parameters for
electroporation, etc.
[0154] One-Step Thermocycled Method
[0155] Another aspect provides a method comprising incubating the
ds DNA or ss DNA molecules with
[0156] (a) a non-thermostable, 3' exonuclease operable in the
presence of dNTPs, which "chews-back" the ends of the
double-stranded DNA molecules, to expose single-stranded overhangs
comprising the regions of overlap;
[0157] (b) a crowding agent;
[0158] (c) a thermostable non-strand-displacing DNA polymerase
conjugated to a moiety in a temperature-sensitive manner to block
the polymerase activity below the activity temperature;
[0159] (d) a thermostable ligase, which seals (ligates) the nicks
thus formed;
[0160] (e) dNTPs; and
[0161] (f) a suitable buffer.
[0162] The exonuclease of (a) is rendered inactive at a high
temperature (e.g., 75.degree. C.). The exonuclease is active at a
lower temperature, e.g., 37.degree. C.
[0163] The polymerase of (b) may exhibit an activity temperature
between 37.degree. C. and 75.degree. C. and the polymerase may be
active above this temperature. Without wishing to be bound by a
particular mechanism, the inactivating moiety remains conjugated to
the polymerase below the activity temperature. At the activity
temperature, the antibody becomes unbound and the polymerase
exhibits activity. For example, at 75.degree. C., the antibody is
unbound from the polymerase and the polymerase is active.
[0164] Preferably, the ligase of (c) is thermostable at 75.degree.
C. or higher. The ligase need not be active at 75.degree. C. or
higher, but if active at a lower temperature, the activity must be
present when the temperature is lowered from 75.degree. C. or
higher to the lower temperature (e.g., 60.degree. C.).
[0165] In the method of the invention, when the mixture of
components is first incubated at a low temperature (about
30-45.degree. C., e.g., at about 37.degree. C.), the exonuclease is
active and forms gaps on the DNA, while the DNA polymerase is
inactive due to steric interference on the part of the bound
inhibiting moiety such as an antibody or biotin. When the
temperature is raised to a high temperature (above 65.degree. C.,
e.g., at about 75.degree. C.), the exonuclease is rendered inactive
and the DNA polymerase is rendered active as the antibody
dissociates from the polymerase. When the temperature is lowered to
about 60.degree. C., the ligase is active to fill in the gaps.
[0166] The entire procedure is carried out as a "one-step" reaction
(in a single tube, which does not have to be opened during the
entire recombination procedure, in a thermocycler apparatus). In
one such procedure, a mixture of the DNAs to be joined is incubated
at 37.degree. C. with exonuclease III; Taq DNA polymerase which is
rendered inactive through conjugation to an antibody; Taq DNA
ligase; dNTPs and a buffer compatible with all of these enzymatic
activities. The temperature is then raised to 75.degree. C. At this
temperature, exonuclease III is inactivated, the chewed back DNAs
begin to anneal, and the antibody begins to dissociate from Taq DNA
Polymerase, resulting in activation. The temperature is then
decreased to 60.degree. C. to complete the repair reaction (filling
in the gaps and sealing the nicks).
[0167] An advantage of a method of the invention is that the
particular method allows exonuclease activity in the presence of
dNTPs. Without wishing to be bound by a particular mechanism, use
of exonuclease III permits exonuclease activity in the presence of
dNTPs, while the exonuclease activity of T4 DNA polymerase is
blocked by dNTPs. Thus, when using exonuclease III there is no need
to stop the reaction and add dNTPs in a separate step.
[0168] Another advantage of a method of the invention is that all
of the steps may be performed in vitro, as a complete recombination
system. Other systems known in the art require transformation into
a host cell in order to repair the nucleotide fragments produced.
The current system encompasses a repair step in vitro using the
ligase such that the transformation into a host cell is avoided.
This is particularly useful if the nucleotide to be repaired would
be toxic to a host cell and thus not able to undergo
transformation.
[0169] Yet another advantage of a method of the invention is that
the 5' and 3' overhangs are repaired in the nucleotide produced.
Other isothermal one-step methods do not involve repairing the 5'
and 3' overhangs.
[0170] Another aspect of the invention is a kit for the in vitro
joining of two or more double-stranded (ds) DNA molecules of
interest, wherein the distal region of the first DNA molecule and
the proximal region of the second DNA molecule of each pair share a
unique region of sequence identity, comprising, in a single
container,
[0171] (a) a non-thermostable, 3' (3' to 5') exonuclease operable
in the presence of dNTPs,
[0172] (b) a crowding agent,
[0173] (c) a thermostable non-strand-displacing DNA polymerase
conjugated to a chemical moiety in a temperature sensitive manner
to block the polymerase activity below the activity temperature,
and
[0174] (d) a thermostable ligase, and optionally
[0175] (e) dNTPs, and
[0176] (f) a suitable buffer,
[0177] in suitable amounts such that, when dsDNA molecules or ssDNA
oligonucleotides and when needed, dNTPs, a crowding agent, and as
suitable buffer, are added to the contents of the mixture and
incubated for about two to ten minutes, at 37.degree. C., then
10-40 minutes at 75.degree. C., and then for 30 minutes to two
hours at 60.degree. C., the DNA molecules are assembled. A kit of
the invention may be stored frozen, e.g., at about -20.degree.
C.
[0178] In an embodiment of this aspect, in step (c) the incubation
steps may be five minutes at 37.degree. C., then 20 minutes at
75.degree. C., and then for one hour at 60.degree. C.
[0179] Any of a variety of 3'.fwdarw.5', double-strand specific
exodeoxyribonucleases may be used to chew-back the ends of DNA
molecules in the methods of the invention. The term "3'
exonuclease" refers to a 3'.fwdarw.5' exodeoxyribonuclease.
Suitable exonucleases will be evident to the skilled worker. These
include, e.g., exonuclease III. In one embodiment of the invention,
the exonuclease is exonuclease III. Methods for preparing and using
exonucleases and other enzymes employed in methods of the invention
are conventional; and many are available from commercial sources,
such as USB Corporation, 26111 Miles Road, Cleveland, Ohio 44128,
or New England Biolabs, Inc. (NEB), 240 County Road, Ipswich, Mass.
01938-2723.
[0180] Preferably in the one-step thermocycled method, the 3'
exonuclease is not active as a polymerase.
[0181] Combinatorial Methods for Optimization
[0182] In preferred embodiments, the isothermal methods of the
present invention can be used to modify the properties of a whole
nucleic acid molecule, for example, to optimize the expression,
function, activity, yield, etc., of a polypeptide encoded by the
nucleic acid molecule. The combinatorial methods described herein
provide a multitude of possible nucleic acid sequences that can be
screened for the desired outcome. In alternative embodiments, the
nucleic acids could provide other DNA or RNA products, for example,
antisense RNA that is used to decrease the yield of another product
in a host cell. The outcome of the combinatorial approach is to
provide a desired product that is not found in nature, or is an
improvement or optimization of a natural product. Optimized
products may be synthetic components, natural components that have
been modified or rearranged, or combinations of natural and
synthetic components. One of skill in the art could envision
multiple additional applications of the combinatorial methods
described herein.
[0183] Whatever the level at which recombination occurs, the
intermediate product is a mixture of nucleic acids encoding
proteins that typically are expressed and tested for yield and, in
the embodiments other than codon optimization, activity. Thus,
typically the mixture of nucleic acids is provided with restriction
sites or overlapping portions that permit insertion of the nucleic
acids into expression systems that contain control sequences,
notably promoters and termination signals. The choice of control
sequences, depends, of course, on the host in which expression is
to take place. The optimal control sequences for any particular
intended host can also be determined by constructing appropriate
libraries containing a multiplicity of control sequences such as
promoters, enhancers and termination sequences and assembled in a
multiplicity of genes wherein the most favorable assembly of
control sequences can be identified. Convenient hosts include E.
coli, other bacterial systems and yeast as well as other
unicellular fungi. Mammalian host cells or insect host cells could
also be used as could plant cells. The choice of the host for
testing is a matter of experimental preference and expression
controls for all of these hosts are well known.
[0184] Once the mixture has been treated to insert the coding
sequences into expression systems, it is used to transfect the
appropriate cells which are then diluted and cultured. Depending on
the desired end point, the protein activity, yield or metabolic
activity of the cultures is assessed for the culture with the
highest value. The nucleic acid is then retrieved from this culture
and sequenced or otherwise identified as the desirable sequence or
sequences. Depending on the level of optimization--i.e., codon
usage, individual protein optimization, metabolic pathway
optimization, or gene synthesis, the next combinatorial step can be
achieved by assembling optimal components.
[0185] Methods of in vitro assembly described above may be used to
conduct this process. Additionally, methods of in vivo assembly may
be used to conduct this process, as described above. Furthermore, a
combination of in vitro and in vivo assembly may be used to conduct
this process.
[0186] However, as to the various recombination systems, the
initial steps of nucleic acid construction differ in their
components.
[0187] For codon optimization, as shown in FIG. 7A, a coding
sequence is constructed as shown therein by varying the codons in
each nucleic acid used to assemble the coding sequence. As shown in
FIG. 7A, a protein that includes leucine, valine, glycine and
alanine is assembled from individual fragments where the codons for
these individual amino acids is varied. By suitable overlap
segments, a mixture containing all of the nucleotides shown in FIG.
7A can be assembled in the correct order in a single reaction
mixture as described above. The resultant will be full-length
coding sequences. If desired, an expression vector may also be
added to the mixture to provide the control sequences automatically
at this stage. The assembled coding sequences provided further with
expression controls, if necessary, are then transfected into host
cells, and cultured individually and the level of protein assessed
using standard protein determination techniques. The colonies with
the highest levels of protein production are analyzed by extracting
the expression system and sequencing to identify the optimal set of
codons.
[0188] In general, while highest levels of production or activity
are referred to, it is understood that it is not necessary to
select the exact highest value in each case. For various reasons,
it may be sufficient simply to select for satisfactory levels of
these characteristics.
[0189] In more detail, a method to identify a nucleotide sequence
that optimizes codon usages for production of a protein comprises
at least the following steps (a) through (e). In step (a),
oligomers are provided encoding portions of the protein containing
degenerate forms of the codon for an amino acid encoded in the
portions, with the oligomers extended to provide flanking coding
sequences with overlapping sequences. In step (b), the oligomers
are treated to effect assembly of the coding sequence for the
protein. The reassembled protein is included in an expression
system that is operably linked to control sequences to effect its
expression. In step (c), the expression system is transfected into
a culture of compatible host cells. In step (d), the colonies
obtained from the transformed host cells are tested for levels of
production of the protein. In step (e), at least one colony with
the highest or a satisfactory production of the protein is obtained
from the expression system. The sequence of the portion of the
expression system that encodes the protein is determined.
[0190] For an embodiment wherein control sequences are to be
optimized, one or more coding sequences are used in the
construction of a library containing a multiplicity of expression
systems. The components to be assembled into the expression systems
include a variety of promoters, enhancers, termination sequences
and the like, the selection of which will depend on the nature of
the intended recombinant host. Again, the components are provided
with overlapping sequences to assure assembly in the correct order.
Using any in vitro assembly technique, a variety of genes with
different control sequences is obtained which are then transfected
into host cells and cultured individually to determine levels of
protein production.
[0191] In more detail, to construct a gene with optimal control
sequences for expression, the method comprises at least the
following steps (a) through (e). In step (a), oligomers
representing a multiplicity of promoters, enhancers, and
termination sequences and oligomers comprising encoding sequences
for a protein are provided. In step (b), oligomers to affect
assembly of genes for the protein are treated. In step (c), the
resulting genes are transfected into a culture of compatible host
cells. In step (d), colonies obtained from the transformed host
cells are tested for levels of production of the protein. In step
(e), the gene is obtained from at least the colony with the highest
or satisfactory level of production of the protein. The sequence of
the control sequences associated with the nucleotide sequence
encoding the protein is determined.
[0192] At the next level, illustrated in FIG. 7B, the coding
sequences of several variants of a protein of given activity are
assessed for motifs and domains. Nucleic acid sequences encoding
each of the motifs and domains shown are then individually
synthesized and provided suitable overlapping sequences to provide
a correct order of assembly. These synthetic sequences are then
provided in a ligation mixture similar to that described above with
respect to codon optimization, optionally including a vector to
provide control sequences, and the resulting expression systems are
transfected into host cells and tested for activity and/or
yield.
[0193] To identify a nucleotide sequence that encodes an optimized
form of a protein having a desired activity, the method comprises
the following steps (a) through (f). In step (a), domains and
motifs contained in a series of variants of the protein are
identified. In step (b), oligomers encoding each of the domains and
motifs from the variants are provided. In step (c), the mixture is
treated to effect assembly into sequences encoding the protein. The
assembly is conducted so as to provide the coding sequences with
operably linked control sequences for expression, to obtain a
mixture of expression systems. In step (d), the expression systems
are transformed into a culture of compatible host cells. In step
(e), the colonies obtained from the cells are tested for activity
of the produced protein. In step (f), the expression system is
isolated from at least the colony that produces the protein of
highest or satisfactory level of activity. The nucleotide sequence
encoding said protein is then identified.
[0194] At the next level, shown in FIG. 7C, variants of proteins
that are responsible for a metabolic pathway are individually
synthesized, mixed and matched as described above, and tested for
the production of metabolic products. The pathways may be assembled
on a single vector or multiple vectors may be used in successive
transformations. Variants may include upstream promoter elements of
the genes encoding the proteins from different species as well as
synthetically generated upstream promoter elements.
[0195] Finally, in one embodiment, assemblies of the desirable
metabolic pathways and/or genes may be combinatorially assembled
into complete genomes using a similar approach. As described in
Gibson, et al., Science (2008) 319:1215-1220, an entire bacterial
genome can be assembled by a combination of in vitro and in vivo
techniques. Minimal genomes may also be assembled in this way.
[0196] In one embodiment, entire pathways may be assembled using
appropriate linkers to construct an entire genome. The methods for
assembly and testing are similar to those described above. Because
assembly of several DNA pieces takes place in a single reaction
operating at a single temperature, it is possible to carry out the
reaction in a highly parallel fashion to build, in stages, an
entire chromosome. The pathway variants may all be cloned into a
bacterial artificial chromosome (BAC) vector, or any other vector
useful for the manipulation of large nucleic acids.
[0197] To optimize metabolic pathways, the method comprises
constructing nucleic acid molecules encoding variants of each
enzyme in the pathway to be optimized. All of the encoding
sequences can be assembled using the technique described above of
overlapping sequences on a single vector for each different
pathway, or independent vectors for each member of the pathway can
be employed by mixing the vectors for each member in successive
transformation mixtures. Control sequences to effect expression of
the enzymes in the pathway are provided. Colonies derived from the
culture are assessed for favorable characteristics conferred by the
pathway to be optimized, and the expression systems of successful
colonies are sequenced.
[0198] The construction of optimal or minimal genomes need not be
based solely on a combination of metabolic pathway assemblies.
Individual genes may also be assembled in a similar manner or a
combination of individual genes and metabolic pathways may be so
assembled. To determine the necessity for one or more genes to a
metabolic pathway, each of these could be systematically eliminated
from the assembly.
[0199] In all of the foregoing methods, DNA molecules can be
assembled using robotic systems at some or all of the levels
described. At any stage, either in vitro or in vivo methods may be
used. Assembly of entire genomes may be desirable. Using the
techniques described by Gibson, et al., chromosomes of 20-500 kb
can be constructed in a combinatorial manner as described above.
For assembly of nucleotide sequences that generate complete
optimized metabolic pathways the optimal combination of these
systems is evaluated.
[0200] The processes described above may be conducted ab initio,
without preselection of putatively desirable elements or may
include selection of appropriate variant genes for each of the
pathway genes from sequence databases, from all available sequence
libraries including completed genomes and environmental libraries.
Computational approaches may be used to select the most likely
candidates from the many available choices. Results with one
combinatorial library might help to design a second library for the
same pathway that would give even better production of the desired
product.
[0201] Optimum codon usage for expression in the chosen production
host cell can also be designed based on computational methods and
tested as described above.
[0202] As noted above, appropriate regulatory signals are added for
the chosen production host, including transcriptional promoters and
terminators, and appropriate signals for initiation of protein
synthesis, as well as suitable linker sequences specific for each
gene-gene junction in the pathway and for joining the assembled
pathway to the cloning vector.
[0203] Optimal sizes and overlaps of the individual
oligonucleotides for the entire assembly, may also be designed.
Design tools include a graphical interface to aid in initial
pathway design and to view the final sequence design. In the case
of combinatorial libraries it should be possible to call up and
view any individual chromosome within the library with a single
mouse click on each component gene.
[0204] As to assembly of a pathway, for illustration, assuming an
average gene size of 1200 bp and an average oligonucleotide size of
60 nucleotides, roughly 1200.times.9.times.10.times.2/60=3,600
oligonucleotides are needed for the construction of a 9 gene
pathway, excluding control elements which are small relative to
genes. The factor of 2 is because the oligonucleotides have to
cover both strands of the DNA. Oligonucleotides can be purchased
from any of a dozen or so suppliers, or synthesized automatically.
The oligonucleotides, which are supplied in 96-well oligonucleotide
trays, are robotically distributed into 96-well assembly reaction
trays such that each well in the assembly trays would contain 8
adjacent oligonucleotides in the sequence. The number of trays
could then be reduced at the first assembly step from approximately
36 oligonucleotide trays down to around 5 assembly trays. A 15
.mu.l aliquot of the thawed assembly reaction mixture (which
already includes the cloning vector as a ninth DNA piece) is
transferred to each well. The trays are then incubated for 20
minutes at 50.degree. C. The assembly product in each well consists
of 8 assembled oligonucleotides inserted into the vector DNA to
form a circle. Aliquots of each well are pooled together, cloned
and sequenced. Correct clones are transferred back into 5 trays for
the next assembly step. By sequencing up front at the first stage
of assembly when the assemblies are small, oligonucleotide errors
are weeded out, and all subsequent assemblies will generally have
correct sequence.
[0205] To go from one assembly step to the next, the assemblies are
"lifted out" of the vector by high fidelity PCR and aliquots are
distributed to the next set of trays for the next assembly
reaction.
[0206] Assembly continues until a single tray contains 10 variants
of each of the 9 genes. The 9 genes and their variants are then
pooled into a final assembly reaction that results in a library of
10.sup.9 different combinations of the 9 gene pathway cloned into
the BAC vector. This combinatorial library is transformed into the
appropriate host cell, and individual clones are screened for
product yield, etc.
[0207] The invention thus provides a method of assembling entire
genomes by using the optimized components described above. As noted
above, the "entire" genome may be a minimal genome, the nature of
which is determinable as described in the above-cited PCT
publication or may be determined arbitrarily by selecting only
certain identified components of the library desired. The library
components may be individual genes, assemblies of individual genes
according to metabolic pathways, assemblies of genes that are
otherwise organized, or a combination of individual genes and
organized systems thereof. Desirably, the components are indeed
optimized as described herein; however, this is not a prerequisite.
Libraries of individual genes and/or assemblies of genes, some or
all of which may be optimized with regard to motif variants,
control sequences and/or codon usage may be used in the genome
assembly.
EXAMPLES
[0208] In the following examples, all temperatures are set forth in
uncorrected degrees Celsius; and, unless otherwise indicated, all
parts and percentages are by weight.
Example I
Thermocycled Exonuclease III One-Step Assembly System Protocol
[0209] A thermocycled one-step assembly was developed based on the
use of an isolated non-thermostable 3' to 5' exonuclease and an
isolated heat-activated DNA polymerase as follows. A reaction was
set up on ice in a 0.2 ml PCR tube containing the following: 100 ng
each substrate DNA to be assembled, 20 .mu.l of 4.times.CBAR
buffer, 0.7 .mu.l of exonuclease III (4 U/.mu.l, NEB), 8.0 .mu.l of
Taq DNA ligase (40 U/.mu.l, NEB), 0.5 .mu.l of AmpliTaq.RTM. Gold
(5 U/.mu.l, Applied Biosystems), and water to 80 .mu.l. The
4.times.CBAR (Chew-back, Anneal, and Repair) Buffer was 20%
PEG-8000, 600 mM Tris-Cl, 40 mM MgCl.sub.2, 40 mM DTT, 4 mM NAD,
and 800 .mu.M each dNTP (pH 7.5).
[0210] This gave a final concentration of 1.25 ng/.mu.l of each DNA
that was to be assembled, 5% PEG-8000, 150 mM Tris-Cl pH 7.5, 10 mM
MgCl.sub.2, 10 mM DTT, 200 .mu.M each dNTP, 1 mM NAD, 0.035 U/.mu.l
exonuclease III, 4 U/.mu.l Taq DNA ligase, and 0.03 U/.mu.l
AmpliTaq.RTM. Gold.
[0211] 100 ng substrate DNA was found to be ideal for fragments
between 5 kb and 8 kb in length. For larger assemblies, the amount
of DNA was increased (e.g., for fragments 20 kb to 32 kb in length,
400 ng each substrate was used). Care was taken to avoid having the
substrate DNA make up more than half the volume of the reaction
since this was found to inhibit the reaction. Exonuclease III was
used as a 1:25 dilution (in exonuclease III storage buffer) from
the 100 U/.mu.l exonuclease III concentrated enzyme stock.
[0212] The reaction was added to a thermal-cycler and assembly was
performed using the following conditions: 37.degree. C. for 5
minutes (chew-back was for at least 5 minutes at 37.degree. C. for
substrates that overlap by 40-80 bp, and 15 minutes for substrates
that overlap by 300-500 bp), 75.degree. C. for 20 minutes (heat
inactivation of Exo III), cool down 0.1.degree. C./s to 60.degree.
C. (annealing), 60.degree. C. for 1 hour (repair), and then held at
4.degree. C.
[0213] These steps are outlined in FIG. 4A. The results obtained
from this protocol show that this method works just as well, and
has all the same advantages as the two-step process with T4 DNA
polymerase, Taq DNA polymerase, and Tag DNA ligase, and can be used
to assemble linear or circular DNA.
Example II
Isothermal T5 Exonuclease One-Step Assembly Protocol for Nucleic
Acids
[0214] An isothermal one-step assembly was developed based on the
use of an isolated non-thermostable 5' to 3' exonuclease that lacks
3' exonuclease activity as follows. A reaction was set up
containing the following: 100 fmol each dsDNA substrate or 3.6
.mu.mol each ssDNA to be assembled, 16 .mu.l 5.times.ISO buffer, 16
.mu.l T5 exonuclease (0.2 U/.mu.l, Epicentre), 8.0 .mu.l Taq DNA
ligase (40 U/.mu.l, NEB), 1.0 .mu.l Phusion.TM. DNA polymerase (2
U/.mu.l, NEB), and water to 80 .mu.l. The 5.times.ISO (ISOthermal)
buffer was 25% PEG-8000, 500 mM Tris-Cl, 50 mM MgCl.sub.2, 50 mM
DTT, 5 mM NAD, and 1000 .mu.M each dNTP (pH 7.5).
[0215] This gave a final concentration of 1.25 fmol/.mu.l each
dsDNA (or 45 fmol/.mu.l each ssDNA) that was to be assembled, 5%
PEG-8000, 100 mM Tris-Cl pH 7.5, 10 mM MgCl.sub.2, 10 mM DTT, 200
.mu.M each dNTP, 1 mM NAD, 0.02 U/.mu.l T5 exonuclease, 4 U/.mu.l
Taq DNA ligase, and 0.03 U/.mu.l Phusion.TM. DNA polymerase.
[0216] Methods used 1.64 .mu.l 0.2 U/.mu.l T5 exonuclease for
substrates that overlap by 20-80 bp, and for substrates that have
larger overlaps (e.g., 200 bp), 1.6 .mu.l U/.mu.l T5 exonuclease
was used. T5 exonuclease was used as a 1:50 dilution (in T5
exonuclease storage buffer) from the 10 U/.mu.l T5 exonuclease
(Epicentre) concentrated enzyme stock.
[0217] The reaction was then incubated at 50.degree. C. for 15
minutes.
[0218] These steps are outlined in FIG. 5A. The majority of the
cost to synthesize large dsDNA molecules is from the cost of the
oligonucleotides. Once the cost of producing oligonucleotides
drops, so will the cost to assemble large DNA molecules from
oligonucleotides using the methods of the present invention.
Example III
Isothermal T5 Exonuclease One-Step Assembly Protocol for
Single-Stranded Nucleic Acids
[0219] A. Preparation of the Oligonucleotide Assembly Mixture
[0220] The mixture in all kits contains the same ingredients with
one exception, the presence or absence of a vector. In the absence
of vector, water was substituted. The methods of the present
invention allow the quick and easy use of the same assembly
mixtures and buffers formulated in kits for long term storage.
[0221] A preparation of the oligonucleotide assembly mixture (for a
total 120 .mu.l volume) contains: 32 .mu.l 5.times.ISO buffer,
0.064 .mu.l 10 U/.mu.l T5 exonuclease (Epicentre), 2 .mu.l 2
U/.mu.l Phusion.TM. polymerase (NEB), 16 .mu.l 40 U/.mu.l Taq
ligase (NEB), 2 .mu.l 200 ng/.mu.l pUC19 assembly vector, and 67.94
.mu.l water. The assembly mixture was then stored at -20.degree.
C.
[0222] A preparation of the 5.times.ISO buffer (for a total 6 ml
volume) contains: 3 ml 1 M Tris-Cl pH 7.5 (final 0.5 M), 150 .mu.l
2 M MgCl.sub.2 (final 50 mM), 60 .mu.l each 100 mM dGTP, dATP,
dTTP, dCTP (final 1 mM each), 300 .mu.l 1 M DTT (final 50 mM), 1.5
g PEG-8000 (final 25%), 300 .mu.l 0.1 M NAD (final 5 mM), and water
to 6 ml. Concentrations in parentheses refer to the final
concentration in the 5.times.ISO buffer.
[0223] The final concentration of all ingredients in the
Oligonucleotide Assembly Mixture (mixture is 1.33.times. since 15
.mu.l was added in a 20 .mu.l final volume) was as follows: 133.33
mM Tris-Cl (pH 7.5), 13.33 mM MgCl.sub.2, 266.67 .mu.M dGTP, 266.67
.mu.M dATP, 266.67 .mu.M dTTP, 266.67 .mu.M dCTP, 13.33 mM DTT,
6.67% PEG-8000, 1.33 mM NAD, 5.33 U/ml T5 exonuclease (Epicentre),
33.33 U/ml Phusion.TM. polymerase (NEB), 5.33 U/.mu.l Taq Ligase
(NEB), and 3.33 ng/.mu.l pUC19 assembly vector.
[0224] The above kit, at 1.33.times. concentration, can be stored
frozen, for at least 12 months. It can be subjected to at least ten
cycles of freeze-thaw without losing activity.
[0225] B. Assembly of Oligonucleotides to Form a 16.5 kb Final
Product Inserted into pCC1BAC
[0226] Although this Example shows the assembly of ssDNA
oligonucleotides, the same conditions and master mix of reagents
can be used for assembling dsDNA. For example, in the first stage
of assembly shown in detail here, eight single-stranded
oligonucleotides are assembled to generate a double-stranded
molecule of about 300 bp. The next stage, in which the 300 bp DNAs
are assembled to generate larger molecules, and the subsequent
stages in which those molecules are assembled to generate still
larger molecules, can be accomplished by using the same master mix
of reagents shown in the present example.
[0227] This Example describes a four stage assembly scheme.
However, in another embodiment of the invention, 25-75 segments can
be assembled at one time. In that embodiment, the number of stages
is significantly reduced, e.g., down to only two.
[0228] For the first round of assembly, a mixture (pool) of eight
60 nt (60-mer) ssDNA oligonucleotides, which overlap each other by
20 bases, and which lie adjacent to one another in a known DNA to
be assembled, are diluted so that there is 180 fmol/.mu.l of each
oligonucleotide in a total volume of 5 .mu.l. This concentration
was determined by the inventors to be optimal for the assembly of
eight 60-mers with 20 nt overlaps. 15 .mu.l of the 1.33.times.
master mix as above is added to 5 .mu.l of oligonucleotides and
incubated at 50.degree. C. for 15-60 minutes, to form a contiguous
segment of dsDNA molecule of 300 bp. A pUC19 vector is present in
the assembly mixture, so the 300 bp molecule is inserted into the
vector.
[0229] Following assembly, the assembled molecule is transformed
into a suitable E. coli host, and pUC19 clones are selected, using
ampicillin as a selective marker. Generally, the clones are
sequenced to confirm that the assembled molecule is correct.
Currently, a background of incorrect sequences occurs because
methods for synthesizing oligonucleotides are not accurate. It is
expected that methods for correcting errors, or better methods of
synthesizing the oligonucleotides, will eliminate the need for this
sequencing check. For example, error-correcting enzymes or reagents
can be added to or contained within the assembly reaction of the
current invention. Alternatively, instead of cloning the assembled
DNA molecules, they can be directly amplified by PCR, and then
sequenced to confirm accuracy.
[0230] Seventy-four additional pools of eight 60-mers, from
different portions of the DNA molecule to be synthesized, are also
assembled. A total of 600 of these 60-mers are assembled, into a
collection of 300 bp dsDNA molecules; and in subsequent rounds of
assembly, the 300-mers are PCR-amplified and assembled to form
1,180 bp dsDNAs, which are in turn PCR-amplified and assembled to
form 5,560-mers, which are finally assembled to form a dsDNA
molecule of 16,520 bp. This molecule is then amplified (by PCR, or
by a method more effective to amplify large molecules, rolling
circle amplification (RCA)), cloned (e.g., into a BAC vector) and
sequenced to confirm that the assembly has been accurate.
[0231] In this Example, a cloning vector is used to assemble the
inserts. However, if cloning into a host organism is not required
for producing more DNA molecules, since for example an in vitro
method of amplification is going to be used (e.g., PCR or RCA),
then the cloning vector can be absent. However, it still may be
advantageous in some cases to allow the inserts to form a circle.
This would allow for the incomplete assembly products (which are
linear) to be removed from the complete assembly product with an
exonuclease (the circle would be resistant to the exonuclease
activity but the incomplete assembly products would not be.) This
can be important if an in vitro method for amplification of DNA
(e.g., PCR or RCA) is inhibited by the incomplete assembly
products.
[0232] C. Use of Universal Primer Binding Sequences at the 5' and
3' ends of Oligonucleotides to be Assembled.
[0233] To aid in the PCR amplification of assembled
oligonucleotides, in each of the rounds of assembly, it can be
advantageous to include binding domains (sites) at each end of the
segments to be assembled (from ssDNA oligonucleotides) and
amplified. These domains can be designed and introduced into some
of the oligonucleotides (e.g., the oligonucleotides that would end
up in flanking regions of the segment being built) as they are
being synthesized. An exemplary dsDNA segment, in which four primer
binding domains are shown, flanks the DNA molecule. In subsequent
rounds of amplification and assembly, the DNAs can be PCR
amplified, using "universal primers" that correspond to suitable
domains, thereby eliminating the need to design separate primers
for amplifying each DNA to be amplified. If desired, restriction
enzyme sites (such as rare-cutter enzymes PmII, SbfI, AscI or NotI)
can also be engineered to lie between the primer binding domains.
These sites can facilitate cleaving off of the primer binding
sites.
[0234] One advantage of a method of the invention is that the
presence of a 3' exonuclease activity during the reaction (which
can be provided, e.g., by the proof-reading activity of Phusion.TM.
polymerase) will remove all of the binding domains, since these
will exist as single stranded DNAs that are non-homologous to the
DNAs which are being amplified. The oligonucleotides being
assembled into a vector can be 40-mers instead of 60-mers. With
40-mers, there will not be a gap. The oligonucleotides being
assembled can be very large (e.g., several hundred bases.)
Furthermore, the oligonucleotides being assembled into the vector
can be from a pool of oligonucleotides (e.g., a microchip
containing 4,000 or more oligonucleotides. A microchip can serve as
an inexpensive way to obtain oligonucleotides). The cloning vector
does not necessarily need to be a circular one (as indicated in
this figure with pUC19). Rather, it can be a linear vector with two
arms (e.g., Lucigen's pJAZZ-KA linear vector system). A linear
vector may be advantageous for assembling oligonucleotides in
excess without concatamerization occurring (concatamerization would
lead to a single clone containing two or more sets of assembled
fragments. Therefore, this would not be a pure clone which may be
desired.) The cloned oligonucleotides may be transformed into E.
coli. Individual clones containing correct assemblies can be
identified by a technique such as DNA sequencing.
[0235] D. Assembly of Large Molecules by Automation
[0236] This method shown in this Example is readily adaptable to
automation.
(1) Oligonucleotides are first cloned into a vector. Currently,
because of imperfect synthesis techniques, it is expected that some
of the oligonucleotides will contain errors, so the initial clones
must be sequenced to confirm they are correct. The initial clones
can be from E. coli or single molecule PCR. In one embodiment of
the invention, an error correction technique is employed to correct
such errors; this eliminates the need to perform DNA sequencing,
and allows subsequent rounds of assembly to be carried out without
having to wait for the sequencing results. (2) The DNA molecules
are assembled. (3) The assembled DNAs are amplified by PCR or RCA.
(4) These DNAs are assembled. (5) The assembled DNAs are amplified
by PCR or RCA. (6) These cycles are continued until the complete
molecule is assembled. Note that RCA allows for the amplification
of larger molecules than is possible with PCR, so RCA is preferred
for larger piece stages of assembly. Cloning into a host organism
and making more of the assembled fragments, then digesting with a
restriction enzyme that can release the assembled fragments intact
would be equivalent to PCR or RCA.
Example IV
Assembly of DNA Molecules Several Hundred Kilobases in Size Using
Various In Vitro Methods
[0237] This Example compares three assembly methods as shown in
FIG. 1A (two-step thermocycled assembly with T4 pol), FIG. 4A
(one-step thermocycled assembly with ExoIII), and FIG. 5A (one-step
isothermal assembly with T5 exo). The one-step isothermal assembly
was found to be the preferred in vitro assembly method.
[0238] Method 1: Two-Step Thermocycled Assembly (with T4 pol)
[0239] A 4.times. chew-back and anneal (CBA) reaction buffer (20%
PEG-8000, 800 mM Tris-HCl pH 7.5, 40 mM MgCl.sub.2, 4 mM DTT) was
used for thermocycled DNA assembly. DNA molecules were assembled in
20 .mu.l reactions consisting of 5 .mu.l 4.times.CBA buffer, 0.2
.mu.l of 10 mg/ml BSA (NEB), and 0.4 .mu.l of 3 U/.mu.l T4 pol
(NEB). T7 pol can be substituted for T4 pol. Approximately 10-100
ng of each .about.6 kb DNA segment was added in equimolar amounts.
For larger DNA segments, increasingly proportionate amounts of DNA
were added (e.g., 250 ng of each 150 kb DNA segment). Assembly
reactions were prepared in 0.2 ml PCR tubes and cycled as follows:
37.degree. C. from 0 to 18 minutes, 75.degree. C. for 20 minutes,
cooled 0.1.degree. C./s to 60.degree. C., held at 60.degree. C. for
30 minutes, then cooled to 4.degree. C. at a rate of 0.1.degree.
C./s. In general, a chew-back time of 5 minutes is used for
overlaps less than 80 bp and 15 minutes for overlaps greater than
80 bp. Ten .mu.l of the CBA reactions were then added to 25.75
.mu.l of Taq repair buffer (TRB), which consists of 5.83% PEG-8000,
11.7 mM MgCl.sub.2, 15.1 mM DTT, 311 .mu.M each of the 4 dNTPs, and
1.55 mM NAD.sup.+. Four .mu.l of 40 U/.mu.l Taq lig (NEB) and 0.25
.mu.l of 5 U/.mu.l Taq pol (NEB) were added and the reactions were
incubated at 45.degree. C. for 15 minutes. For the T4 pol fill-in
assembly method, 10 .mu.l of the CBA reaction is mixed with 0.2
.mu.l of 10 mM dNTPs and 0.2 .mu.l of 3 U/.mu.l T4 pol. This
reaction was carried out at 37.degree. C. for 30 minutes.
[0240] Results: Step 1: Chew-back and anneal. The prior art 2-step
in vitro recombination method for assembling overlapping DNA
molecules makes use of the 3' exonuclease activity of T4 DNA
polymerase (T4 pol) to produce ssDNA overhangs, and a combination
of Taq DNA polymerase (Taq pol) and Taq DNA ligase (Taq lig) to
repair the annealed joints. To better understand the kinetics of
this reaction, 8 DNA molecules, each .about.6 kb and overlapping by
.about.300 bp, were exposed to T4 pol at 37.degree. C. for up to 18
minutes. Samples were removed every 2 minutes and annealed.
Following a 10 minute exonuclease reaction, the majority of the
input DNA was annealed, and the predicted .about.48 kb full-length
product is observed. These reactions require the presence of
PEG-8000, a reagent that induces macromolecular crowding (see FIG.
1B).
[0241] Assembling DNA molecules with significantly smaller overlaps
than 300 bp would have several advantages. When synthetic DNA
fragments are joined, smaller overlaps would reduce the overall
cost of synthesis. Additionally, small overlaps can be added to PCR
primers. For these reasons, it was determined whether DNA molecules
with only 40 bp overlaps could be assembled. The assembly reaction
in FIG. 1A was performed using 4 DNA molecules, each 5 kb in
length, and overlapping by 40 bp. Following a 2 minute exposure to
T4 pol, all 4 DNA molecules were efficiently assembled into the
full-length 20 kb product (FIG. 1C).
[0242] It was next determined whether significantly larger DNA
molecules could be joined by this method. Two 1/4 molecules of the
synthetic M. genitalium genome, C25-49 (144 kb) and C50-77 (166
kb), with a 257 bp overlap, were reacted with T4 pol for 15 minutes
and annealed, then analyzed by field-inversion gel electrophoresis
(FIGE) (FIG. 1D). They were efficiently assembled into the 310 kb
product (Mgen25-77). Further, when all 4 quarter molecules were
reacted under the same conditions, the full-length synthetic M.
genitalium genome (-583 kb) is assembled (FIG. 1E).
[0243] Results: Step 2: Repairing the assembled molecules. Taq pol
is a preferred gap-filling enzyme since it does not
strand-displace, which would lead to disassembly of the joined DNA
fragments. It also has inherent 5' exonuclease activity (or nick
translation activity), which eliminates the need to phosphorylate
the input DNA (a requirement for DNA ligation). This is because
5'-phosphorylated ends are created following nick translation.
Further, this activity removes any non-complementary sequences
(e.g., partial restriction sites), which would otherwise end up in
the final joined product.
[0244] To verify that assembled DNA molecules have been
successfully repaired, dsDNA products can be denatured at
94.degree. C. in the presence of formamide and analyzed by agarose
gel electrophoresis (FIG. 2A). Repair was assessed for 2 pairs of
.about.5-6 kb DNA molecules with 40 bp or 300 bp overlaps. In each
case, similar results were obtained (FIG. 2B). Assembled, but
unrepaired DNA molecules (lane 1) are denatured to ssDNA input in
the presence of formamide (lane 2). In the absence of Taq lig, the
nicks are not sealed and the 5' exonuclease activity of Taq pol
eliminates the overlapping DNA sequence, leading to disassembly of
the DNA molecules (compare lanes 3 and 4). In the presence of Taq
lig (lane 5), the nicks are sealed and a higher molecular weight
ssDNA product is observed (lane 6). Thus, dsDNA molecules, with as
little as 40 bp overlaps, were covalently joined by this assembly
method.
[0245] Introduction of errors during DNA assembly. During in vitro
recombination, mutations may be introduced in the assembled DNA.
The first source for mutations is from Taq pol, which incorporates
an incorrect nucleotide approximately once every 4000 nt. The
second source for mutations is from the primers used to PCR-amplify
the bacterial artificial chromosomes (BACs). Both of these error
types were observed when 30 assembled molecules were cloned and
sequenced during the synthesis of the M. genitalium genome.
However, of the 210 repaired junctions, there was only 1 error that
likely resulted from BAC PCR. Remarkably, there were only 3 errors
that can be attributed to inaccurate gap fill-in by Taq pol.
[0246] Assembly methods that employ a repair step to produce
covalently sealed circular DNA molecules allow for the possibility
of RCA (e.g., amplification by phi29 polymerase). This is not the
case for assembly methods that omit a repair step. To demonstrate
this, 4 fragments, F5 (1020 bp), F6, (1040 bp), F7 (2379 bp), and
F8 (3246 bp), each with 40 bp overlaps, were joined into a 7525 bp
circle. (FIG. 3) As expected, only repaired assembled products
could be amplified by phi29 polymerase.
[0247] Method 2: One-Step Thermocycled Assembly (with Exo III)
[0248] A 4.times. chew-back, anneal, and repair (CBAR) reaction
buffer (20% PEG-8000, 600 mM Tris-HCl pH 7.5, 40 mM MgCl.sub.2, 40
mM DTT, 800 .mu.M each of the 4 dNTPs, and 4 mM NAD.sup.+) was used
for one-step thermocycled DNA assembly. DNA molecules (added in
amounts described above for CBA reactions) were assembled in 40
.mu.l reactions consisting of 10 .mu.l 4.times.CBAR buffer, 0.35
.mu.l of 4 U/.mu.l ExoIII (NEB), 4 .mu.l of 40 U/.mu.l Taq lig, and
0.25 .mu.l of 5 U/.mu.l Ab-Taq pol (Applied Biosystems). ExoIII was
diluted 1:25 from 100 U/.mu.l in its stored buffer (50% Glycerol, 5
mM KPO4, 200 mM KCl, 5 mM 2-Mercaptoethanol, 0.05 mM EDTA, and 200
.mu.g/ml BSA, pH 6.5). DNA assembly reactions were prepared in 0.2
ml PCR tubes and cycled using the following conditions: 37.degree.
C. for 5 or 15 minutes, 75.degree. C. for 20 minutes, cool down
0.1.degree. C./s to 60.degree. C., then held at 60.degree. C. for 1
hour. In general, a chew-back time of 5 minutes was used for
overlaps less than 80 bp and 15 minutes for overlaps greater than
80 bp. ExoIII is less active on 3' protruding termini, which can
result from digestion with certain restriction enzymes. This can be
overcome by removing the overhangs to form blunt ends with the
addition of T4 pol and dNTPs, as described above, prior to
assembly.
[0249] Results: A DNA assembly method that requires the absence of
dNTPs to achieve exonuclease activity, such as the T4 pol-based
system described above, can not be completed in one-step. This is
because dNTPs are required at a later point to fill-in the gapped
DNA molecules. Exonuclease III (ExoIII), which removes nucleotides
from the 3' ends of dsDNA, is fully functional even in the presence
of dNTPs so it is a candidate for a 1-step reaction. However, it
will compete with polymerase for binding to the 3' ends. To
eliminate this competition, and allow for 1-step DNA assembly,
antibody-bound Taq pol (Ab-Taq pol) was used in combination with
ExoIII (FIG. 4A). In this assembly method, overlapping DNA
fragments and all components necessary to covalently join the DNA
molecules (i.e., ExoIII, Ab-Taq pol, dNTPs, and Taq lig) were added
in a single tube, and placed in a thermocycler. At 37.degree. C.,
ExoIII is active (but Ab-Taq pol remains inactive) and recesses the
3' ends of the dsDNA molecules. The reaction was then shifted to
75.degree. C., which inactivates ExoIII. Annealing of the DNA
molecules commences and the antibody dissociates from Taq pol, thus
activating this enzyme. Further annealing, extension, and ligation
is then carried out at 60.degree. C.
[0250] As shown in FIG. 4B, four 5 to 7 kb DNA molecules with 40 bp
overlaps or .about.300 bp overlaps can be efficiently assembled.
Cassettes 78 to 81 (240 bp to 300 bp overlaps) and fragments F1 to
F4 (40 bp overlaps) are assembled and then analyzed by U-5 FIGE.
The completely assembled product and unreacted input DNA are
indicated with arrows. To demonstrate that the joined DNA molecules
are repaired by this method, assembly products were denatured in
the presence of formamide and analyzed on agarose gels. The DNA
molecules were efficiently assembled and repaired. As indicated in
FIG. 4C, Fragments F3 and F4 were reacted as described in the
presence (+Assembly) or absence (-Assembly) of ExoIII. Repair is
assessed by denaturation of the dsDNA molecules in the presence (+)
or absence (-) of formamide as described in FIG. 2A.
[0251] Method 3: One-Step Isothermal Assembly (with T5 exo)
[0252] A 5.times. isothermal (ISO) reaction buffer (25% PEG-8000,
500 mM Tris-HCl pH 7.5, 50 mM MgCl2, 50 mM DTT, 1 mM each of the 4
dNTPs, and 5 mM NAD+) was used for one-step DNA isothermal assembly
at 50.degree. C. DNA molecules (added in amounts described above
for CBA reactions) were assembled in 40 .mu.l reactions consisting
of 8 .mu.l 5.times.ISO buffer, 0.8 .mu.l of 0.2 U/.mu.l or 1.0
U/.mu.l T5 exo (Epicentre), 4 .mu.l of 40 U/.mu.l Taq lig, and 0.5
.mu.l of 2 U/.mu.l Phusion pol (NEB). T5 exo was diluted 1:50 or
1:10 from 10 U/.mu.l in its stored buffer (50% glycerol, 50 mM
Tris-HCl pH 7.5, 0.1 mM EDTA, 1 mM DTT, 0.1 M NaCl, and 0.1% Triton
X-100) depending on the overlap size. For overlaps shorter than 150
bp, 0.2 U/.mu.l T5 exo is used. For overlaps larger than 150 bp,
1.0 U/.mu.l T5 exo is used. All isothermal assembly components can
be stored at -20.degree. C. in a single mixture at 1.33.times.
concentration for more than one year. The enzymes are still active
after more than 10 freeze-thaw cycles. To constitute a reaction, 5
.mu.l DNA is added to 15 .mu.l of this mixture. Incubations are
carried out at 50.degree. C. for 15 to 60 minutes, with 60 minutes
being optimal.
[0253] Protocol for this DNA assembly system, including how to
prepare an assembly master mixture: 1. Prepare 5.times.ISO buffer.
Six ml of this buffer can be prepared as follows: 3 ml of 1 M
Tris-HCl pH 7.5, 150 .mu.l of 2 M MgCl2, 60 .mu.l of 100 mM dGTP,
60 .mu.l of 100 mM dATP, 60 .mu.l of 100 mM dTTP, 60 .mu.l of 100
mM dCTP, 300 .mu.l of 1 M DTT, 1.5 g PEG-8000, 300 .mu.l of 100 mM
NAD+. Add water to 6 ml, aliquot 100 .mu.l and store at -20.degree.
C. 2. Prepare an assembly master mixture. This can be prepared as
follows: 320 .mu.l 5.times.ISO buffer, 0.64 .mu.l of 10 U/.mu.l T5
exo (Epicentre), 20 .mu.l of 2 U/.mu.l Phusion pol (NEB), and 160
.mu.l of 40 U/.mu.l Taq lig (NEB). Add water to 1200 .mu.l, aliquot
15 .mu.l and store at -20.degree. C. This is ideal for the assembly
of DNA molecules with 20-150 bp overlaps. For DNA molecules
overlapping by larger than 150 bp, use 3.2 .mu.l of 10 U/.mu.l T5
exo. 3. Thaw a 15 .mu.l assembly mixture aliquot and keep on ice
until ready to be used. 4. Add 5 .mu.l of DNA to be assembled to
the master mixture. The DNA should be in equimolar amounts. Use
10-100 ng of each .about.6 kb DNA fragment. For larger DNA
segments, increasingly proportionate amounts of DNA should be added
(e.g., 250 ng of each 150 kb DNA segment). 5. Incubate at
50.degree. C. for 15-60 minutes (60 minutes is optimal).
[0254] Results: Exonucleases that recess dsDNA from 5' ends, and
are not inhibited by the presence of dNTPs, are also candidates for
one-step DNA assembly reactions. Further, these exonucleases will
not compete with polymerase activity. Thus, all activities required
for DNA assembly can be simultaneously active in a single
isothermal reaction. A 50.degree. C. isothermal assembly system was
optimized using the activities of the 5'-T5 exonuclease (T5 exo),
Phusion.TM. DNA polymerase (Phusion.TM. pol), and Taq lig (FIG.
5A). Taq pol can be used in place of Phusion.TM. pol; however,
Phusion.TM. pol is preferable since it has inherent proofreading
activity for removing non-complementary sequences from assembled
molecules. Further, Phusion.TM. pol has a significantly lower error
rate (New England Biolabs). To test this system, 2 restriction
fragments overlapping by .about.450 bp were cleaved from the 6 kb
pRS415 vector and reassembled into a circle (FIG. 5B). Following 8
minutes at 50.degree. C., the linear substrate DNA is completely
reacted and/or degraded, and the major product is the 6 kb circle,
which migrated just below the 4 kb linear position on a 0.8%
agarose gel. T5 exo becomes inactive, and no longer participates in
DNA assembly following incubation at 50.degree. C. for 12 minutes.
T5 exo actively degrades linear DNA molecules; however, closed
circular DNA molecules are not degraded. The circularity of this
assembled product is confirmed by treating with additional T5 exo
(FIG. 5B). To demonstrate that this assembled product is the
predicted 6 kb circle, it was digested with NotI (a single-cutter).
The 6 kb linear fragment was then observed (FIG. 5C). Thus, DNA
molecules can be assembled and repaired in a single, isothermal
step using this method.
[0255] It was next shown that molecules with 40 bp overlaps could
also be joined. This was accomplished if the concentration of T5
exo was reduced (FIG. 5D). Three 5 kb DNA fragments, F1 to F3, were
efficiently assembled into BAC-F1/F3 (.about.8 kb). Further, when
the assembled DNA molecules from the 4 U/ml T5 exo reaction were
transformed into E. coli, 450 colonies were obtained and 9 out of
10 colonies had the predicted 15 kb insert (FIG. 5E).
[0256] General Accessory Methods:
[0257] Preparation of DNA molecules for in vitro Recombination. The
DNA molecules used in the assembly analyses are derived from
several sources including (i) the assembly intermediates of the
synthetic M. genitalium genome, (ii) PCR products derived from
plasmids (F6 and F8), Clostridium cellulolyticum genomic DNA (F1 to
F4), and Mycoplasma gallisepticum genomic DNA (F5 and F7), and
(iii) pRS415 restriction fragments. In some instances, DNA
fragments were extracted from agarose gels; however, in general
this is not necessary. DNA molecules were dissolved or eluted with
Tris/EDTA (TE) buffer pH 8.0 and quantified by agarose
gel-electrophoresis with standards. Specific protocol used was as
follows:
[0258] E. coli strains carrying each of M. genitalium cassette
number 66 to 69 (contained in pENTR223), each of M. genitalium
cassette number 78 to 85 (contained in pBR322), C1-24, C25-49,
C50-77, C78-101 (each contained in pCC1BAC), or pRS415 were
propagated in LB medium containing the appropriate antibiotic and
incubated at 30.degree. C. or 37.degree. C. for 16 hours. The
cultures were harvested and the DNA molecules were purified using
Qiagen's HiSpeed Plasmid Maxi Kit according to the instructions
provided, with the exception of C-assemblies, which were not
column-purified. Instead, following neutralization of the lysed
cells, C-assemblies were centrifuged then precipitated with
isopropanol. DNA pellets were dissolved in Tris/EDTA (TE) buffer
then RNAse treated, phenol-chloroform extracted, and ethanol
precipitated. DNA pellets were dissolved in TE buffer. Cassettes 66
through 69 and 78 through 85 were excised from the vectors by
restriction digestion with either FauI or BsmBI, and C-assemblies
were excised by digestion with NotI. To generate the 4024 bp and
2901 bp overlapping fragments of pRS415, DNA was digested with
PvuII and ScaI, or PsiI, respectively. Restriction digestions were
terminated by phenol-chloroform extraction and ethanol
precipitation. DNA was dissolved in TE buffer pH 8.0 then
quantified by gel electrophoresis with standards. Fragments F1 to
F8 were generated by PCR using the Phusion.TM. Hot Start
High-Fidelity DNA polymerase with HF Buffer (NEB) according to the
instructions provided. PCR products were extracted from agarose
gels following electrophoresis and purified using the QIAquick Gel
Extraction Kit (Qiagen) according to the instructions provided,
except DNA was eluted from the columns with TE buffer pH 8.0.
[0259] Fragments F1 to F4 were amplified from Clostridium
cellulolyticum genomic DNA using primers F1-For
(GCAGCTTCAAGTCCTGCAAACAAGGTGTACCAGGATCGTT) (SEQ ID NO: 1) and
F1-Rev (GATTTCAGTGTAGTTAGGGCCAGTTGAATTCAAACCTGCC) (SEQ ID NO: 2);
F2-For (GGCAGGTTTGAATTCAACTGGCCCTAACTACACTGAAATC) (SEQ ID NO: 3)
and F2-Rev (CTTGGTGCCATCAGCATTGTTCTCTGTACCGCCCACTGTC) (SEQ ID NO:
4; F3-For (GACAGTGGGCGGTACAGAGAACAATGCTGATGGCACCAAG) (SEQ ID NO: 5)
and F3-Rev (CAGTTGAATAATCATGTGTTCCTGCGGCAAATGCAGTACC) (SEQ ID NO:
6); and F4-For (GGTACTGCATTTGCCGCAGGAACACATGATTATTCAACTG) (SEQ ID
NO: 7) and F4-Rev (TTATTTACCAAGAACCTTTGCCTTTAACATTGCAAAGTCA) (SEQ
ID NO: 8), respectively.
[0260] F5 and F7 were amplified from Mycoplasma gallisepticum
genomic DNA using primers F5-For
(GCTTGCATGCATCCTGTTTATTCATCACAAACATTGAAC) (SEQ ID NO: 9) and F5-Rev
(AATTCTGCAGTTTTTATTTCCTAACAGAACATTTTTTCTAGTATAGC) (SEQ ID NO: 10);
and F7-For (CGACTCTAGATAAATAGCCTTTCTTTATCTTTTTGAGGC) (SEQ ID NO:
11) and F7-Rev (CCGGGGATCCCTTTCTCAATTGTCTGCTCCATATATGTT) (SEQ ID
NO: 12), respectively.
[0261] F6 and F8 were amplified from pRST21 using primers F6-For
(TAGAAAAAATGT TCTGTTAGGAAATAAAAACTGCAGAATTAAAAGTTAGTGAACAAGAAAAC)
(SEQ ID NO:13) and F6-Rev
(AGCCTCAAAAAGATAAAGAAAGGCTATTTATCTAGAGTCGA CCTGCAGTTCAGATC) (SEQ ID
NO:14); and F8-For
(TGTTCAATGTTTGTGATGAATAAACAGGATGCATGCAAGCTTTTGTTCCCTTTAG) (SEQ ID
NO: 15) and F8-Rev (AAACATATATGGAGCAGACAATTGAGAAAGGGATCCCCGGGTACC
GAGCTC) (SEQ ID NO: 16), respectively.
[0262] Rolling circle amplification (RCA) of assembled products.
RCA was carried out as previously described. One .mu.l of the
repaired or unrepaired reaction was mixed with 1 .mu.l of 100 mM
NaOH and incubated at room temperature for 5 minutes to denature
the double-stranded DNA. One .mu.l of this alkaline-treated mixture
was then added to 19 .mu.l of RCA components in a 0.2 ml PCR tube.
The final reaction concentrations for RCA are as follows: 37 mM
Tris-HCl pH 7.5, 50 mM KCl, 10 mM MgCl.sub.2, 5 mM (NH4)2SO4, 100
.mu.g/ml BSA, 1 mM DTT, 3.25 mM random hexamers (Fidelity System,
MD), 1 .mu.ml yeast pyrophosphatase (United States Biochemical),
and 250 U/ml phi29 DNA polymerase (NEB). The reaction was incubated
at 30.degree. C. for 20 hours, and then terminated by incubation at
65.degree. C. for 10 minutes.
[0263] Cloning the DNA assembly products. To clone assembled
products, reactions were carried out in the presence of
PCR-amplified BACs containing 40 bp of overlapping sequence to the
ends of the assembled product. NotI restriction sites were also
included to allow release of the vector. In general, pCC1 BAC was
used. However, for cloning Mgen25-77, a version of pCC1BAC, named
KanBAC, was constructed that contains the kanamycin resistance gene
in place of the chloramphenicol resistance gene. Samples (up to 1
.mu.l) of the assembly reactions were transformed into 30 .mu.l
TransforMax.TM. EPI300.TM. (Epicentre) electrocompetent E. coli
cells in a 1 mm cuvette (BioRad) at 1200 V, 25 .mu.F, and
200.OMEGA. using a Gene Pulser Xcell Electroporation System
(BioRad). Cells were allowed to recover at 30.degree. C. or
37.degree. C. for 2 hours in 1 ml SOC medium then plated onto LB
medium+12.5 .mu.g/ml chloramphenicol or LB medium+25 .mu.g/ml
kanamycin. Following incubation at 30.degree. C. or 37.degree. C.
for 24 to 48 hours, individual colonies were selected and grown in
3 ml LB medium+12.5 .mu.g/ml chloramphenicol or 25 .mu.g/ml
kanamycin overnight at 30.degree. C. or 37.degree. C. DNA was
prepared from these cells by alkaline-lysis using the P1, P2, and
P3 buffers supplied by Qiagen then isopropanol precipitation. DNA
pellets were dissolved in TE buffer pH 8.0 containing RNAse then
digested with NotI to release the insert from the BAC.
[0264] Agarose gel analyses of assembled DNA molecules and cloned
products. U-5 FIGE analysis was performed on 0.8% E-gels
(Invitrogen, catalog #G5018-08) and the parameters are forward 72
V, initial switch 0.1 sec, final switch 0.6 sec, with linear ramp
and reverse 48 V, initial switch 0.1 sec, final switch 0.6 sec,
with linear ramp. U-2 FIGE analysis was performed on 1% Agarose
gels (BioRad, catalog #161-3016) in 1.times.TAE buffer with 0.5
.mu.g/ml ethidium bromide without circulation and the parameters
are forward 90 V, initial switch 5.0 sec, final switch 30 sec, with
linear ramp, and reverse 60 V, initial switch 5.0 sec, final switch
30 sec, with linear ramp. DNA bands were visualized with a BioRad
Gel Doc or an Amersham Typhoon 9410 Fluorescence Imager.
Example V
Comparison of the Three DNA Assembly Methods
[0265] This Example compares the efficacy of the three different in
vitro assembly methods as shown in FIG. 1A (two-step thermocycled
assembly with T4 pol), FIG. 4A (one-step thermocycled assembly with
ExoIII), and FIG. 5A (one-step isothermal assembly with T5
exo).
[0266] A. Efficiency of Assembly of a 31 kb Fragment
[0267] In step (a), shown in FIG. 6A, cassettes 66 to 69 (5.9 kb to
6.2 kb with 80 bp overlaps) were assembled into BAC66-69 (.about.8
kb with 40 bp overlaps), as shown in FIG. 1A, without repair (CBA),
with complete repair (CBA+TRB), or with gap fill-in repair with T4
pol but without ligation (T4 pol fill-in), and as shown in FIG. 4A
(ExoIII) and FIG. 5A (T5 exo). Equal amounts were analyzed by U-5
FIGE then transformed into E. coli.
[0268] Then, in step (b), as shown in FIG. 6B, a 0.1 .mu.l sample
of the assembly reactions of step (a) yielded the number of
transformants noted. For each assembly method, DNA was extracted
from 10 transformants and digested with NotI for determination of
correct insert size (.about.23 kb, denoted by *).
[0269] B. Efficiency of Assembly of a 310 kb Fragment
[0270] In step (c), shown in FIG. 6C, two one-quarter M. genitalium
genomes C25-49 and C50-77 were assembled into BAC25-77 (.about.8 kb
with 40 bp overlaps) using the methods described in (a). A fraction
of each was analyzed by U-2 FIGE. In step (d), as shown in FIG. 6D,
equal amounts were transformed into E. coli, and a 1 .mu.l sample
of the assembly reactions in (c) yielded the number of
transformants noted. No transformants were obtained for the CBA and
T4 pol fill-in reactions so analysis ended at that step. DNA was
prepared from 7 to 10 transformants of each assembly method, then
digested with NotI for determination of correct insert size
(.about.310 kb, denoted by .dagger.).
[0271] Cloning of assembled DNA molecules is a common application
of these methods. Thus, it is important to determine which assembly
method was best for cloning. First, the joining efficiencies of
synthetic M. genitalium cassettes 66 to 69 (.about.6 kb each and
with 80 bp overlaps) into a BAC with 40 bp overlaps to the ends of
the assembly were compared. Also included was a comparison with 2
additional DNA assembly systems that omit fill-in and ligation
steps. Each of these 5 methods efficiently and similarly assembled
cassettes 66 to 69 into BAC66-69 as determined by FIGE (FIG. 6A).
Equal amounts of these DNA molecules were then transformed into E.
coli. Ten randomly selected clones from each method were analyzed
following NotI digestion, which released the vector from the
.about.23 kb insert (FIG. 6B). For each method, 90 to 100% of the
clones had the correct insert. Omitting both DNA polymerase and
ligase yields only 2% of the number of colonies achieved with
complete repair. This emphasizes the importance of a repair step.
Leaving the nicks unsealed but filling in the gaps increases the
cloning efficiency to 44% of the complete reaction, suggesting that
gaps can significantly influence cloning efficiencies in E.
coli.
[0272] In prior work during the construction of the synthetic M.
genitalium genome, the DNA assembly strategy shown in FIG. 1A to
clone 1/2 genomes from 1/4 molecules in E. coli could not be used.
The assembly was repeated with the novel in vitro methods of the
present invention to determine if any of these assembly methods can
be used to clone Mgen25-77 (310 kb) from C25-49 and C50-77. Each
method efficiently joined the 310 kb, half M. genitalium genome
(FIG. 6C). As expected, this DNA molecule could not be cloned in E.
coli using the strategy outlined in FIG. 1A. Filling in the gaps
with T4 pol, but leaving the nicks unsealed, does not produce
transformants. However, the one-step ExoIII- and T5 exo-based
systems of the present invention were successfully used to clone
these large DNA molecules (FIG. 6D). Thus, there are 2 preferred
DNA assembly systems as described in the present invention that can
be used to efficiently join and clone DNA molecules up to several
hundred kb in length in E. coli, the approximate upper limit for
transformation into this bacterium.
Example VI
Assembly of Large DNA Molecules
[0273] Invention methods were capable of assembling DNA molecules
of unprecedented sizes. The complete synthetic .about.583 kb M.
genitalium genome was assembled in vitro. It is well known that DNA
molecules become more fragile as they get larger. The success in
assembling such large molecules may be attributed to the presence
of PEG in these reactions. The viscosity of this reagent may reduce
shear forces on these large molecules in solution. The size limit
for in vitro DNA assembly is not known; however, products as large
as 900 kb have been observed for each of the assembly methods.
These methods may provide sufficient amounts of recombined product
for an intended application. If not, the assembled product may be
propagated in a host organism. However, assembled DNA molecules of
.about.300 kb have only been cloned in E. coli by the one-step
assembly methods and not by the two-step method. One explanation is
that reducing reaction manipulation reduces DNA damage, and thus
more intact clones are obtained. Once better in vitro amplification
tools are developed (e.g., RCA), it may no longer be required to
replicate the assembled constructs in a host organism. However,
currently the largest phi29 products reported are only .about.70
kb.
[0274] Although several recombination methods are provided herein,
the one-step isothermal system is preferred due to its simplicity.
All components of this assembly system can be premixed and kept
frozen until needed. Thus, all that is required for DNA assembly is
for input DNA to be added to this mixture, and the mixture to be
briefly incubated at 50.degree. C. This approach could be very
useful for cloning multiple inserts into a vector without relying
on the availability of restriction sites, and for rapidly
constructing large DNA molecules. For example, regions of DNA too
large to be amplified by a single PCR event can be divided into
multiple overlapping PCR amplicons and then assembled into one
piece. The isothermal system is advantageous for assembling
circular products, which accumulate because they are not substrates
for any of the 3 enzymes. The one-step-thermocycled method, on the
other hand, can be used to generate linear assemblies since the
exonuclease is inactivated during the reaction.
Example VII
Codon Optimization
[0275] The methods of the present invention can be used to optimize
codon usage in accordance with the host cell to construct a gene
that has the optimal protein yield. Often, the gene that yields the
highest amount of protein gives the optimal yield. However, if the
gene is toxic to the host cell that produces the gene, the optimal
yield may be lower than the highest yield.
[0276] Codons of a gene are computationally optimized to produce a
single sequence of the full gene. This single sequence may not be
the very best to produce an optimal yield, but serves as a starting
point. Next, oligonucleotides are generated computationally such
that the codon choices at selected positions are varied. As shown
in FIG. 7A, the oligonucleotides may encompass more than one codon,
but within each oligonucleotide at least one codon is varied. For
instance, three different codons encoding leucine are present in
three versions of "Oligo 1". The oligonucleotides overlap with one
another in order to allow for assembly according to the methods
described herein.
[0277] A sufficient number of oligonucleotides is used to assemble
the entire gene. When the oligonucleotides are assembled according
to an assembly reaction, such as any of the above-described
assembly reactions, a gene library is produced such that each
member contains a particular combination of codon variants. Every
member of the library, however, yields the same amino acid
sequence. The method thus allows for optimization of translation of
the gene product to provide the same polypeptide, according to the
preferences of the chosen host. Individual clones can be assayed
for native protein yield, with the clone producing the optimal
yield selected.
Example VIII
Gene Optimization
[0278] The methods of the present invention can be used to provide
a protein that has maximum activity. The protein with maximum
activity is comprised of a consensus sequence from a group of
homologous protein sequences. FIG. 7B depicts five homologous
proteins that each contain three motifs and one domain. For
instance, protein 1 may be from human, protein 2 from C. elegans,
protein 3 from S. cerevisiae, protein 4 from mouse, and protein 5
from D. melanogaster. A consensus protein has motif A from protein
5, motif B from protein 2, domain A from protein 1 and motif C from
protein 3.
[0279] Synthetically, one can generate a library of protein
variants by putting together different combinations of the motif
and domain protein blocks from a set of homologous proteins. In the
scheme of FIG. 7B, diversity or library complexity is five to the
fourth power, or 625 unique clones that can be tested for maximum
activity. The motif and domain protein blocks may be synthesized
according to any of the methods of the previous examples. Then,
library clones may be screened for maximum protein activity.
Example IX
Pathway Optimization and Assembly of a Combinatorial Library
[0280] The methods of the present invention can be used to combine
multiple versions of each gene in a pathway, which are randomly
assembled to produce a combinatorial pathway library, as shown in
FIG. 7C. The products of all of the in vitro assembly reactions are
then cloned into an appropriate recipient cell, and the cells then
assayed for yield of the specific product or characteristic of the
pathway.
[0281] The versions of each gene may homologues from multiple
species or synthetically generated variants according to the
previous examples. The genes may include upstream promoter elements
that vary from one species to the next, such that optimum yield can
be obtained from pathways involving transcription factors.
[0282] These methods allow the possibility of screening for
enormous variant pathways that heretofore would have been
impossible to synthesize individually. For example, a combinatorial
library of 10.sup.9 variant pathways can be constructed from 90
individual genes (10 variants of each of nine genes in the
pathway). The genes are synthesized individually, but the pathways
are combinatorially assembled efficiently and quickly in vitro.
Each gene is flanked by a joining sequence that provides an overlap
with any variant of the adjacent pathway genes (or with the vector
in the case of the first and last pathway genes). All 90 genes are
pooled along with the vector and joined by the assembly reactions
of the present invention to produce the combinatorial library.
Example X
Assembly of a Combinatorial Library to Optimize an Acetate
Utilization Pathway
[0283] The methods of the present invention were used to create a
combinatorial library of synthetically made orthologs to the
acetate kinase ackA gene and the phosphostransacetylase pta gene in
E. coli in order to optimize the acetate utilization (ackA/pta)
pathway. The ackA/pta pathway in E. coli enables growth on acetate
as a carbon source. Both genes mediate the interconversion between
acetate and acetyl-CoA, as shown in FIG. 8A. Acetate kinase (ackA)
converts acetate plus ATP to acetyl-phosphate. Phosphtransacetylase
(pta) converts acetyl-phosphate and CoA to acetyl-CoA. E. coli
produces substantial amounts of acetate during excess glucose
fermentation in high density cultures, and acetate is the major
byproduct under aerobic conditions. High acetate concentration
inhibits growth because it decouples transmembrane pH gradients,
which in turn negatively affects internal osmotic pressure, pH, and
amino acid synthesis. In addition, the acid pretreatment of biomass
releases substantial amounts of acetate (derived from the acetyl
side chains of hemicellulose). The methods described in this
Example show the use of combinatorial optimization to boost acetate
utilization by the host cells to eliminate excess acetate and
enhance growth of the host. A strain of E. coli was developed that
was not inhibited by the presence of acetate when grown in a
glucose-salts minimal medium, and could grow vigorously on acetate
as the sole carbon source.
[0284] Variants of the ackA and pta genes were combinatorially
placed under independent promoter control. The library was
constructed from synthetic orthologs to both genes from five
different organisms with four different promoters for each gene, as
shown in FIG. 813. The organisms are Methanosarcina acetivorans,
Clostridium phytofermentans, Pelobacter carbinolicus, Ruminococcus
ignavus, and E. coli. The four promoters have different strengths,
as indicated by VS (very strong; recA), S (strong; A1 T7), M
(medium; ssb), and L (low; lacI). All the variant pieces were made
synthetically by Integrated DNA Technologies (IDT). The complexity
of the library (total number of combinatorial constructs) was 400
(4.times.5.times.4.times.5).
[0285] In order to construct the library, four different DNA
fragments were required as well as a vector, requiring assembly of
five DNA pieces in all. To each of the genes a ribosome binding
site (rbs) and terminator sequences were added, as shown in FIG.
8C. Additionally, a linker (40 bp) was used to connect the genes
with the promoter pieces. At both ends of the total insert, 40 bp
overlapping sequences with the BAC vector (pCC1BAC linearized at
EcoRI site, Epicentre) were used to enable the complete
assembly.
[0286] All the synthetic nucleic acid portions (genes and
promoters) were flanked by NotI sites and supplied as inserts in
pUC57 plasmids. In order to release the pieces from the plasmids, a
NotI restriction digest step was required before the isothermal T5
assembly step. The DNA in the NotI digest reaction consisted of 25
fmol of each of the promoter pieces (total of 8 and'20 fmol of each
gene (total of 10). Also, the PCR amplified E. coli genes were
added to the reaction (even though they were not cloned in
plasmids) and did not contain NotI site and therefore were not
affected by the digest. The NotI restriction digest reaction was
carried out in 50 .mu.l for one hour at 37.degree. C. and contained
the following: 28 .mu.l of DNA, 15.5 .mu.l of H2O, 0.5 .mu.l of
BSA, 5 .mu.l of buffer, and 1 .mu.l of NotI.
[0287] Following one hour incubation at 37.degree. C. the DNA was
extracted with phenol-chloroform-isoamylalcohol and ethanol
precipitated. The pellet was resuspended in the same initial volume
of 28 .mu.L. Then, the isothermal T5 exonuclease assembly reaction
was conducted by incubating the following reagents at 50.degree. C.
for 30 minutes: 28 .mu.l of pooled DNA (100 fmol of each of the 4
pooled pieces), 1.0 .mu.l of pCCIBAC (100 fmol), 16 .mu.l of
5.times.ISO buffer, 1.6 .mu.l T5 exonuclease (0.2 U/.mu.l,
Epicentre), 8.0 .mu.l of Taq DNA Ligase (40 U/.mu.l, NEB), 1.0
.mu.l of Phusion.RTM. DNA Polymerase (2 U/.mu.l, NEB), and 24.4
.mu.l of H2O, for a total 80 .mu.l reaction.
[0288] The DNA from the reaction was extracted with
phenol-chloroform-isoamylalcohol and ethanol precipitated.
Potential assembly products were visualized on 0.8% EtBr E-Gel.
Standard procedures were used to transform E. coli, and strains
that were not acetate inhibited and grew well on acetate as the
sole carbon source were selected for. A triple E coli mutant
(.DELTA.acs .DELTA.ackA .DELTA.pta; deficient in acetate
utilization and therefore does not grow on acetate substrate) was
transformed with assembly reaction, whereby 20 .mu.l of
electro-competent cells were electroporated with 2 .mu.l of the
assembly reaction. The cells were plated on minimal medium agar
plates containing 50 mM of acetate as a sole carbon source and
chloramphenicol for selection, and incubated at 32.degree. C. for 4
days. Resulting colonies were then analyzed to confirm the presence
of the combinatorial assembly product (11,830 bp as compared to the
plasmid control of 8,128 bp) as shown in FIG. 8D, and then
sequence-verified. The triple mutant, which cannot grow on acetate
was thus successfully transformed with a pACK-PTA combinatorially
assembled construct.
[0289] Variants of the combinatorial constructs may then be
screened for desirable properties, such as high production levels
and efficient utilization of acetate.
Example XI
Assembly of a Complete Mouse Mitochondrial Genome Using the T5
Exonuclease One-Step Isothermal Method
[0290] The methods of the present invention were used to assemble
the complete mouse mitochondrial genome. This example shows the
assembly of this genome, which has previously been difficult to
construct due to its high A+T content of .about.65%. The assembly
was performed using an 8.times.60mer assembly method, i.e., eight
60 base oligonucleotides with 20 bp overlaps per microtiter well to
assemble 300 bp per well, in 75 wells.
[0291] Briefly, 600 60 base oligonucleotides were synthesized to
cover the entire mitochondrial genome, with appropriate 20 bp
overlapping regions. 75 reactions of 8 oligonucleotides each were
pooled at a per oligonucleotide concentration of 180 nM. The
oligonucleotide pools were then diluted 1:4 with the assembly
system components, and assembled with the T5 isothermal assembly
method of the present invention for 1 hour at 50.degree. C. in
pUC19 vectors. NotI restriction sites, which flank each insert are
produced following assembly since they are added to the terminal
oligonucleotides in each set of 8 (e.g., oligo 1 and oligo 8), thus
allowing the insert to be released from the vector prior to the
next round of assembly. The 75 assembly reactions were then
transformed into E. coli via electroporation for further analysis.
All assemblies were sequence-verified. Products were amplified with
Phusion polymerase to saturation (30 cycles, all 75 pieces between
35-45 ng/.mu.l). 5 reactions were pooled and digested with NotI to
remove non-complementary sequences.
[0292] NotI digested reaction products of wells were then
sequentially combined, first to form 1,180 bp fragments (five 300
bp fragments in 15 reactions). Pools of 5 reactions from the prior
step were assembled as above in pBR322 vectors. AscI restriction
sites, which flank each insert are produced following assembly
since they were designed into the oligonucleotides that produce the
terminal cassettes in each set of 5 (e.g., cassette 1 and cassette
5), thus allowing the insert to be released from the vector prior
to the next round of assembly. (see FIG. 9A); and then amplified
with Phusion polymerase to saturation (30 cycles, all 15 pieces
between 45-70 ng/.mu.l (see FIG. 9B). 5 reactions were pooled and
digested with AscI to remove non-complementary sequences.
[0293] AscI digested reaction products were then combined to form
5,560 bp fragments (five 1,180 bp fragments in 3 reactions). Pools
of 5 reactions from the prior step were assembled as above in
pSmart-BAC vectors. SbfI restriction sites, which flank each insert
are produced following assembly since they were designed into the
oligonucleotides that produce the terminal cassettes in each set of
3 (e.g., cassette 1 and cassette 25), thus allowing the insert to
be released from the vector prior to the next round of assembly.
(see FIG. 9C); and then amplified with Phusion polymerase for 20-25
cycles (see FIG. 9D). 3 reactions were pooled and digested with Sbf
I to remove non-complementary sequences.
[0294] Final assembly of the whole mitochondrial genome of 16,520
bp was in pCC1BAC (FIG. 9E--three 5,560 bp fragments in 1 reaction)
representing NC.sub.--005089 M. musculus mitochondrial genome
(16,299 bp). The assembled genome was designed to contain an
additional 221 bases (bases 1-221 are duplicated at the end of the
sequence, see below) so the assembly product is therefore 16,520 bp
and not 16,299 bp. Full-length sequence clones were then
sequence-verified.
[0295] In order to produce a mitochondrial genome that was free
from any vector sequence (i.e., exactly as found in nature) bases
1-221 were duplicated at the end of the 16,299 bp sequence (i.e.,
at bases 16,300 bp to 16,520 bp) to produce an assembled product
size of 16,520 bp. Digestion with Pm1I (designed into the
oligonucleotides that produced cassettes 1 and 75) releases the
vector sequence. This creates an overlap between the ends of the
mitochondrial genome, which can then be joined by the T5
exonuclease isothermal assembly method (or the other assembly
methods) as shown in FIG. 9F.
[0296] From the foregoing description, one skilled in the art can
easily ascertain the essential characteristics of this invention,
and without departing from the spirit and scope thereof, can make
changes and modifications of the invention to adapt it to various
usage and conditions and to utilize the present invention to its
fullest extent. The preceding specific embodiments are to be
construed as merely illustrative, and not limiting of the scope of
the invention in any way whatsoever. The entire disclosure of all
applications, patents, publications (including reference manuals)
cited above and in the figures, are hereby incorporated in their
entirety by reference.
Sequence CWU 1
1
16140DNAArtificial sequenceForward primer for F1 Fragment of
Clostridium cellulolyticum genomic DNA 1gcagcttcaa gtcctgcaaa
caaggtgtac caggatcgtt 40240DNAArtificial sequenceReverse primer for
F1 Fragment of Clostridium cellulolyticum genomic DNA 2gatttcagtg
tagttagggc cagttgaatt caaacctgcc 40340DNAArtificial sequenceForward
primer for F2 Fragment of Clostridium cellulolyticum genomic DNA
3ggcaggtttg aattcaactg gccctaacta cactgaaatc 40440DNAArtificial
sequenceReverse primer for F2 Fragment of Clostridium
cellulolyticum genomic DNA 4cttggtgcca tcagcattgt tctctgtacc
gcccactgtc 40540DNAArtificial sequenceForward primer for F3
Fragment of Clostridium cellulolyticum genomic DNA 5gacagtgggc
ggtacagaga acaatgctga tggcaccaag 40640DNAArtificial sequenceReverse
primer for F3 Fragment of Clostridium cellulolyticum genomic DNA
6cagttgaata atcatgtgtt cctgcggcaa atgcagtacc 40740DNAArtificial
sequenceForward primer for F4 Fragment of Clostridium
cellulolyticum genomic DNA 7ggtactgcat ttgccgcagg aacacatgat
tattcaactg 40840DNAArtificial sequenceReverse primer for F4
Fragment of Clostridium cellulolyticum genomic DNA 8ttatttacca
agaacctttg cctttaacat tgcaaagtca 40939DNAArtificial sequenceForward
primer for F5 Fragment of Mycoplasma gallisepticum genomic DNA
9gcttgcatgc atcctgttta ttcatcacaa acattgaac 391047DNAArtificial
sequenceReverse primer for F5 Fragment of Mycoplasma gallisepticum
genomic DNA 10aattctgcag tttttatttc ctaacagaac attttttcta gtatagc
471139DNAArtificial seqeunceForward primer for F7 Fragment of
Mycoplasma gallisepticum genomic DNA 11cgactctaga taaatagcct
ttctttatct ttttgaggc 391239DNAArtificial sequenceReverse primer for
F7 Fragment of Mycoplasma gallisepticum genomic DNA 12ccggggatcc
ctttctcaat tgtctgctcc atatatgtt 391362DNAArtificial sequenceForward
primer for F6 Fragment of pRST21 13tagaaaaaat gttctgttag gaaataaaaa
ctgcagaatt aaaagttagt gaacaagaaa 60ac 621456DNAArtificial
sequenceReverse primer for F6 Fragment of pRST21 14agcctcaaaa
agataaagaa aggctattta tctagagtcg acctgcagtt cagatc
561555DNAArtificial sequenceForward primer for F8 Fragment of
pRST21 15tgttcaatgt ttgtgatgaa taaacaggat gcatgcaagc ttttgttccc
tttag 551651DNAArtificial sequenceReverse primer for F8 Fragment of
pRST21 16aaacatatat ggagcagaca attgagaaag ggatccccgg gtaccgagct c
51
* * * * *