U.S. patent application number 13/266846 was filed with the patent office on 2012-03-01 for pneumococcal vaccine and uses thereof.
This patent application is currently assigned to COLEY PHARMACEUTICAL GROUP, INC.. Invention is credited to Heather Lynn Davis, Arthur Mertz Krieg, Nicolai Lohse, Lars Ostergaard, Henrik Carl Schonheyder, Ole Schmeltz Sogaard.
Application Number | 20120052088 13/266846 |
Document ID | / |
Family ID | 42561160 |
Filed Date | 2012-03-01 |
United States Patent
Application |
20120052088 |
Kind Code |
A1 |
Davis; Heather Lynn ; et
al. |
March 1, 2012 |
PNEUMOCOCCAL VACCINE AND USES THEREOF
Abstract
The present invention relates to new pneumococcal vaccines. The
invention also relates to vaccination of subjects, in particular
immunocompromised subjects, against pneumococcal infections using
said novel pneumococcal vaccines.
Inventors: |
Davis; Heather Lynn;
(Ottawa, CA) ; Krieg; Arthur Mertz; (Cambridge,
MA) ; Lohse; Nicolai; (Aarhus, DK) ;
Ostergaard; Lars; (Aarhus, DK) ; Schonheyder; Henrik
Carl; (Aarhus, DK) ; Sogaard; Ole Schmeltz;
(Aarhus, DK) |
Assignee: |
COLEY PHARMACEUTICAL GROUP,
INC.
New York
NY
|
Family ID: |
42561160 |
Appl. No.: |
13/266846 |
Filed: |
March 17, 2010 |
PCT Filed: |
March 17, 2010 |
PCT NO: |
PCT/IB2010/051150 |
371 Date: |
October 28, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61174068 |
Apr 30, 2009 |
|
|
|
61238313 |
Aug 31, 2009 |
|
|
|
Current U.S.
Class: |
424/197.11 ;
424/244.1 |
Current CPC
Class: |
A61P 1/16 20180101; A61P
11/06 20180101; A61K 2039/6037 20130101; A61P 11/00 20180101; A61P
7/00 20180101; A61P 31/18 20180101; A61P 3/00 20180101; A61P 9/00
20180101; A61P 37/04 20180101; A61P 35/00 20180101; A61P 35/02
20180101; A61K 39/385 20130101; A61P 25/00 20180101; A61P 1/00
20180101; A61P 9/04 20180101; A61P 13/12 20180101; A61P 31/04
20180101; A61P 43/00 20180101; A61K 2039/55561 20130101; A61P 31/12
20180101; A61P 3/10 20180101; A61P 25/32 20180101; A61P 11/08
20180101; A61K 39/092 20130101 |
Class at
Publication: |
424/197.11 ;
424/244.1 |
International
Class: |
A61K 39/385 20060101
A61K039/385; A61P 31/04 20060101 A61P031/04; A61P 31/12 20060101
A61P031/12; A61P 35/00 20060101 A61P035/00; A61P 3/00 20060101
A61P003/00; A61P 31/18 20060101 A61P031/18; A61P 9/00 20060101
A61P009/00; A61P 11/00 20060101 A61P011/00; A61P 9/04 20060101
A61P009/04; A61P 3/10 20060101 A61P003/10; A61P 1/16 20060101
A61P001/16; A61P 25/32 20060101 A61P025/32; A61P 25/00 20060101
A61P025/00; A61P 11/08 20060101 A61P011/08; A61P 1/00 20060101
A61P001/00; A61P 7/00 20060101 A61P007/00; A61P 35/02 20060101
A61P035/02; A61P 13/12 20060101 A61P013/12; A61P 11/06 20060101
A61P011/06; A61K 39/39 20060101 A61K039/39; A61K 39/09 20060101
A61K039/09 |
Claims
1. A pneumococcal vaccine comprising at least one conjugated
capsular saccharide pneumococcal antigen and at least one TLR-9
agonist as an adjuvant.
2. The pneumococcal vaccine of claim 1 wherein said at least one
TLR-9 agonist comprises a CpG Oligonucleotide.
3. The pneumococcal vaccine of claim 2 wherein said CpG
oligonucleotide is a A, B, C or P class CpG immunostimulatory
oligonucleotide.
4-13. (canceled)
14. The pneumococcal vaccine of claim 2 wherein an internucleotide
linkage of the CpG oligonucleotide is phosphodiester,
phosphorothioate, methylphosphonate, methylphosphorothioate,
phosphorodithioate, p-ethoxy, or combinations thereof.
15. The pneumococcal vaccine of claim 2, wherein the CpG
oligonucleotide is 6 to 100 nucleotides long.
16. The pneumococcal vaccine of claim 2 comprising from 0.2 mg to
10 mg of the CpG oligonucleotide.
17. The pneumococcal vaccine of claim 1, wherein the conjugated
capsular saccharide pneumococcal antigens are derived from at least
seven serotypes of S. pneumoniae.
18-19. (canceled)
20. The pneumococcal vaccine of claim 1, wherein said capsular
saccharide antigens are individually conjugated to a carrier
protein.
21. The pneumococcal vaccine of claim 17, wherein the vaccine
comprises conjugated S. pneumoniae saccharides from serotypes 4,
6B, 9V, 14, 18C, 19F and 23F.
22. The pneumococcal vaccine of claim 21, wherein the vaccine
further comprises a conjugated S. pneumoniae saccharide from
serotype 1.
23. The pneumococcal vaccine of claim 21, wherein the vaccine
further comprises a conjugated S. pneumoniae saccharide from
serotype 5.
24. The pneumococcal vaccine of claim 21, wherein the vaccine
further comprises a conjugated S. pneumoniae saccharide from
serotype 7F.
25. The pneumococcal vaccine of claim 21, wherein the vaccine
further comprises a conjugated S. pneumoniae saccharide from
serotype 3.
26. The pneumococcal vaccine of claim 21, wherein the vaccine
further comprises a conjugated S. pneumoniae saccharide from
serotype 6A.
27. The pneumococcal vaccine of claim 21, wherein the vaccine
further comprises a conjugated S. pneumoniae saccharide from
serotype 19A.
28. The pneumococcal vaccine of claim 21, wherein the vaccine
further comprises a conjugated S. pneumoniae saccharide from
serotype 22F.
29. The pneumococcal vaccine of claim 21, wherein the vaccine
further comprises a conjugated S. pneumoniae saccharide from
serotype 15.
30. The pneumococcal vaccine of claim 21, wherein the vaccine
further comprises a conjugated S. pneumoniae saccharide from
serotype 8.
31. The pneumococcal vaccine of claim 21, wherein the vaccine
further comprises a conjugated S. pneumoniae saccharide from
serotype 12F.
32. The pneumococcal vaccine of claim 21, wherein the vaccine
further comprises a conjugated S. pneumoniae saccharide from
serotype 2.
33. The pneumococcal vaccine of claim 21, wherein the vaccine
further comprises a conjugated S. pneumoniae saccharide from
serotype 9N.
34. The pneumococcal vaccine of claim 21, wherein the vaccine
further comprises a conjugated S. pneumoniae saccharide from
serotype 10A.
35. The pneumococcal vaccine of claim 21, wherein the vaccine
further comprises a conjugated S. pneumoniae saccharide from
serotype 11A.
36. The pneumococcal vaccine of claim 21, wherein the vaccine
further comprises a conjugated S. pneumoniae saccharide from
serotype 17F.
37. The pneumococcal vaccine of claim 21, wherein the vaccine
further comprises a conjugated S. pneumoniae saccharide from
serotype 20.
38. The pneumococcal vaccine of claim 21, wherein the vaccine
further comprises a conjugated S. pneumoniae saccharide from
serotype 33F.
39. (canceled)
40. The pneumococcal vaccine of claim 17, wherein the vaccine
comprises conjugated S. pneumoniae saccharides from serotypes 1, 3,
4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F.
41. The pneumococcal vaccine of claim 17, wherein the vaccine
comprises conjugated S. pneumoniae saccharides from serotypes 1, 4,
5, 6B, 7F, 9V, 14, 18C, 19F and 23F.
42. The pneumococcal vaccine of claim 17, wherein the vaccine
comprises S. pneumoniae saccharides from serotypes 1, 3, 4, 5, 6B,
7F, 9V, 14, 18C, 19F and 23F.
43. The pneumococcal vaccine of claim 1, wherein the capsular
saccharide antigens are conjugated to a carrier protein selected
from the group consisting of: TT, DT, CRM197, fragment C of TT,
PhtD, PhtDE fusions, detoxified pneumolysin, and protein D.
44. The pneumococcal vaccine of claim 1, wherein the capsular
saccharide antigens are all individually conjugated to the same
carrier protein.
45-48. (canceled)
49. The pneumococcal vaccine of claim 43, wherein the carrier
protein is CRM197.
55. (canceled)
56. The pneumococcal vaccine of claim 21, wherein the saccharides
from serotypes 4, 6B, 9V, 14, 18C, 19F and 23F are individually
conjugated to protein D.
57. The pneumococcal vaccine of claim 21, wherein the saccharides
from serotypes 4, 6B, 9V, 14, 18C, 19F and 23F are individually
conjugated to CRM197.
58. The pneumococcal vaccine of claim 40, wherein the saccharides
from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and
23F are individually conjugated to protein D.
59. The pneumococcal vaccine of claim 40, wherein the saccharides
serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F are
individually conjugated to CRM197.
60. The pneumococcal vaccine of claim 41, wherein the saccharides
from serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F and 23F are
individually conjugated to protein D.
61. The pneumococcal vaccine of claim 41, wherein the saccharides
from serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F and 23F are
individually conjugated to CRM197.
62. The pneumococcal vaccine of claim 42, wherein the saccharides
from serotypes 1, 3, 4, 5, 6B, 7F, 9V, 14, 18C, 19F and 23F are
individually conjugated to protein D.
63. The pneumococcal vaccine of claim 42, wherein the saccharides
from serotypes 1, 3, 4, 5, 6B, 7F, 9V, 14, 18C, 19F and 23F are
individually conjugated to CRM197.
64. The pneumococcal vaccine of claim 135, wherein the saccharides
from serotype 1, 2, 3, 4, 5, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14,
15B, 17F, 18C, 19A, 19F, 20, 22F, 23F and 33F individually
conjugated to protein D.
65. The pneumococcal vaccine of claim 135, wherein the saccharides
from serotypes 1, 2, 3, 4, 5, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14,
15B, 17F, 18C, 19A, 19F, 20, 22F, 23F and 33F individually
conjugated to CRM197.
66. The pneumococcal vaccine of claim 41, wherein the saccharides
from serotypes 1, 4, 5, 6B, 7F, 9V, 14, and 23F individually
conjugated to protein D, saccharide from serotype 18C conjugated to
tetanus toxoid (TT) and saccharide from serotype 19F conjugated to
diphtheria toxoid (DT).
67. The pneumococcal vaccine of claim 42, wherein the saccharides
from serotypes 1, 4, 5, 7F, 9V, 19F and 23F individually conjugated
to tetanus toxoid (TT) and saccharide from serotypes 3, 14 18C and
6B individually conjugated to diphtheria toxoid (DT).
68-78. (canceled)
79. The pneumococcal vaccine of claim 49, wherein the vaccine
comprises from 5 to 500 .mu.g, 10 to 200 .mu.g, or 20 to 100 .mu.g
of CRM197 carrier protein.
80-81. (canceled)
82. The pneumococcal vaccine of claim 1, wherein the vaccine
comprises sodium chloride, sodium succinate buffer, or a
combination thereof as excipients.
83. The pneumococcal vaccine of claim 1, wherein the vaccine
further comprises at least one additional adjuvant.
84. (canceled)
85. The pneumococcal vaccine of claim 83, wherein the additional
adjuvant is alum, aluminium hydroxide, aluminum phosphate, or
aluminum sulphate.
86-98. (canceled)
99. A method of immunizing a subject against diseases caused by S.
pneumoniae infection comprising administering to said subject an
immunoprotective dose of a vaccine according claim 1.
100. A method of immunizing an immunocompromised subject against
diseases caused by S. pneumoniae infection comprising administering
to said subject an immunoprotective dose of a vaccine according
claim 1.
101. The method of claim 100, wherein said immunocompromised
subject is a mammal.
102. The method of claim 101, wherein said mammal is a cat, sheep,
pig, horse, bovine, dog, rat, mouse or a human.
103. (canceled)
104. The method of claim 100, wherein said immunocompromised
subject suffers from a disease that affects the immune system.
105-106. (canceled)
107. The method of claim 104, wherein said disease is selected from
the group consisting of: bacterial infections, viral infections,
cancers, aging, malnutrition, and chemotherapy drug treatments.
108. The method of claim 104, wherein said disease is selected from
the group consisting of: HIV-infection, acquired immunodeficiency
syndrome (AIDS), cancer, chronic heart disorders, chronic lung
disorders, congestive heart failure, diabetes mellitus, chronic
liver disease, alcoholism, cirrhosis, spinal fluid leaks,
cardiomyopathy, chronic bronchitis, emphysema, Chronic obstructive
pulmonary disease (COPD), spleen dysfunction, lack of spleen
function (asplenia), blood malignancy, leukemia, multiple myeloma,
Hodgkin's disease, lymphoma, kidney failure, nephrotic syndrome,
and asthma.
109-119. (canceled)
120. The method according to claim 100, wherein the
immunocompromised subject is a human adult at least 55 years of
age.
121-134. (canceled)
135. The pneumococcal vaccine of claim 17, wherein the vaccine
comprises S. pneumoniae saccharides from serotypes 1, 2, 3, 4, 5,
6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20,
22F, 23F and 33F.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to new pneumococcal vaccines.
The invention also relates to vaccination of subjects, in
particular immunocompromised subjects, against pneumococcal
infections using said novel pneumococcal vaccines.
BACKGROUND OF THE INVENTION
[0002] Pneumococcal diseases are a major public health problem all
over the world. Infections caused by pneumococci are a major cause
of morbidity and mortality all over the world. Pneumonia, febrile
bacteraemia and meningitis are the most common manifestations of
invasive pneumococcal disease, whereas bacterial spread within the
respiratory tract may result in middle-ear infection, sinusitis or
recurrent bronchitis. Compared with invasive disease, the
non-invasive manifestations are usually less severe, but
considerably more common.
[0003] In spite of the importance of pneumococcal disease, there is
a scarcity of information on disease burden, particularly from
developing countries. This is partly due to the inherent problem of
obtaining an etiological diagnosis in cases of pneumonia. However,
based on available data, acute respiratory infections kill an
estimated 2.6 million children under five years of age annually.
The pneumococcus causes over 1 million of these deaths, most of
which occur in developing countries, where the pneumococcus is
probably the most important pathogen of early infancy. In Europe
and the United States, pneumococcal pneumonia is the most common
community-acquired bacterial pneumonia, estimated to affect
approximately 100 per 100 000 adults each year. The corresponding
figures for febrile bacteraemia and meningitis are 15-19 per 100
000 and 1-2 per 100 000, respectively. The risk for one or more of
these manifestations is much higher in infants and elderly people,
as well as immune compromised persons of any age. Even in
economically developed regions, invasive pneumococcal disease
carries high mortality; for adults with pneumococcal pneumonia the
mortality rate averages 10%-20%, whilst it may exceed 50% in the
high-risk groups. Pneumonia is by far the most common cause of
pneumococcal death worldwide.
[0004] The etiological agent of pneumococcal diseases,
Streptococcus pneumoniae (the pneumococcus) a Gram-positive
encapsulated coccus, surrounded by a polysaccharide capsule.
Differences in the composition of this capsule permit serological
differentiation between about 90 capsular types, some of which are
frequently associated with pneumococcal disease, others rarely.
Invasive pneumococcal infections include pneumonia, meningitis and
febrile bacteremia; among the common non-invasive manifestations
are otitis media, sinusitis and bronchitis.
[0005] Pneumococcal resistance to essential antimicrobials such as
penicillins, cephalosporins and macrolides is a serious and rapidly
increasing problem worldwide.
[0006] Conditions associated with increased risk of serious
pneumococcal disease include age extremes (infants, elderly) and
being immunocompromised for any reason, including but not limited
to: HIV infection, other chronic viral infections, sickle-cell
anaemia, diabetes, cancer and cancer therapy, smoking, chronic
organ failures, organ transplant and immune suppressive
therapy.
[0007] The recent development of widespread microbial resistance to
essential antibiotics and the increasing number of
immunocompromised persons underline the urgent need for more
efficient pneumococcal vaccines.
[0008] Some of the shortcomings of current vaccination include:
need for several boosts to achieve protection, delay in rise of
protective antibodies, prevalence of vaccine non-responders (this
is particularly a problem for immune-compromised individuals), cost
of antigen and vaccine production which is a very significant
limitation in the development of new conjugated pneumococcal
vaccines, poorly protective antibodies with low affinity, falling
antibody titres over time.
[0009] An object of the new pneumococcal vaccine of the invention
is to overcome at least partially some of theses shortcomings. In
particular with a view to vaccinate immunocompromised subjects
against pneumococcal infections.
SUMMARY OF THE INVENTION
[0010] In a first aspect the present invention is directed towards
new pneumococcal vaccines wherein said vaccine comprises one or
more pneumoccal polysaccharide antigens conjugated to a carrier
protein as antigen and an agonist for Toll-like receptor 9 (TLR9)
as adjuvant.
[0011] In a further aspect, the present invention is directed
towards the use of a pneumococcal vaccine comprising one or more
pneumoccal polysaccharide antigens conjugated to a carrier protein
as antigen and a TLR-9 agonist as adjuvant to vaccinate
immunocompromised subjects.
[0012] In an aspect the invention is directed towards any of the
pneumococcal vaccine disclosed herein for use in the vaccination of
immunocompromised subjects, preferably any of the immunocompromised
subjects disclosed herein.
[0013] In a further aspect, the present invention is directed
towards the use of any of the pneumococcal vaccines disclosed
herein to vaccinate immunocompromised subjects, preferably any of
the immunocompromised subjects disclosed herein.
[0014] In a further aspect, the present invention is directed
towards any of the vaccines disclosed herein for the prevention or
treatment of diseases caused by S. pneumoniae infection, preferably
in an immunocompromised subject.
[0015] In a further aspect, the present invention is directed
towards a method of immunizing a subject, preferably any of the
immunocompromised subjects disclosed herein, against diseases
caused by S. pneumoniae infection comprising administering to said
subject an immunoprotective dose of any of the vaccines disclosed
herein.
[0016] In a further aspect, the present invention is directed
towards the use of any of the vaccines disclosed herein, for the
manufacture of a medicament for the prevention or treatment of
diseases caused by S. pneumoniae infection, preferably in an
immunocompromised subject.
[0017] In a further aspect, the present invention is directed
towards any of the pneumococcal vaccines disclosed herein and at
least one TLR-9 agonist disclosed herein.
[0018] In a further aspect, the present invention is directed
towards any of the pneumococcal vaccines disclosed herein and at
least one TLR-9 agonist disclosed herein for use in the vaccination
of any of the immunocompromised subjects disclosed herein.
Toll-Like Receptor 9 Agonist (TLR-9 Agonist) of the Invention
[0019] In an embodiment of the present invention, a TLR-9 agonist
for use in the present invention is a CpG Oligonucleotide. A CpG
oligonucleotide as used herein refers to an immunostimulatory CpG
oligodeoxynucleotide (CpG ODN), and accordingly these terms are
used interchangeably unless otherwise indicated. Immunostimulatory
CpG oligodeoxynucleotides contain one or more immunostimulatory CpG
motifs that are unmethylated cytosine-guanine dinucleotides,
optionally within certain preferred base contexts. The methylation
status of the CpG immunostimulatory motif generally refers to the
cytosine residue in the dinucleotide. An immunostimulatory
oligonucleotide containing at least one unmethylated CpG
dinucleotide is an oligonucleotide which contains a 5' unmethylated
cytosine linked by a phosphate bond to a 3' guanine, and which
activates the immune system through binding to Toll-like receptor 9
(TLR-9). In another embodiment the immunostimulatory
oligonucleotide may contain one or more methylated CpG
dinucleotides, which will activate the immune system through TLR9
but not as strongly as if the CpG motif(s) was/were unmethylated.
CpG CpG immunostimulatory oligonucleotides may comprise one or more
palindromes that in turn may encompass the CpG dinucleotide. CpG
oligonucleotides have been described in a number of issued patents,
published patent applications, and other publications, including
U.S. Pat. Nos. 6,194,388; 6,207,646; 6,214,806; 6,218,371;
6,239,116; and 6,339,068.
[0020] Different classes of CpG immunostimulatory oligonucleotides
have been identified. These are referred to as A, B, C and P class,
and are described in greater detail below. Methods of the invention
embrace the use of these different classes of CpG immunostimulatory
oligonucleotides.
[0021] Any of the classes may be subjugated to an E modification
which enhances its potency. An E modification may be a halogen
substitution for the 5' terminal nucleotide; examples of such
substitutions include but are not limited to bromo-uridine or
iodo-uridine substitutions. An E modification can also include an
ethyl-uridine substitution for the 5' terminal nucleotide.
[0022] The "A class" CpG immunostimulatory oligonucleotides are
characterized functionally by the ability to induce high levels of
interferon-alpha (IFN-.alpha.) from plasmacytoid dendritic cells
(pDC) and inducing NK cell activation while having minimal effects
on B cell activation. Structurally, this class typically has
stabilized poly-G sequences at 5' and 3' ends. It also has a
palindromic phosphodiester CpG dinucleotide-containing sequence of
at least 6 nucleotides, for example but not necessarily, it
contains one of the following hexamer palindromes: GACGTC, AGCGCT,
or AACGTT described by Yamamoto and colleagues. Yamamoto S et al.
J. Immunol 148:4072-6 (1992). A class CpG immunostimulatory
oligonucleotides and exemplary sequences of this class have been
described in U.S. Non-Provisional patent application Ser. No.
09/672,126 and published PCT application PCT/USOO/26527 (WO
01/22990), both filed on Sep. 27, 2000.
[0023] In an embodiment, the "A class" CpG oligonucleotide of the
invention has the following nucleic acid sequence: 5'
GGGGACGACGTCGTGGGGGGG 3' (SEQ ID NO: 1)
[0024] Some non-limiting examples of A-Class oligonucleotides
include:
[0025] 5' G*G*G_G_A_C_G_A_C_G_T_C_G_T_G_G*G*G*G*G*G 3' (SEQ ID NO:
2); wherein * refers to a phosphorothioate bond and _ refers to a
phosphodiester bond.
[0026] The "B class" CpG immunostimulatory oligonucleotides are
characterized functionally by the ability to activate B cells and
pDC except are relatively weak in inducing IFN-.alpha. and NK cell
activation. Structurally, this class typically may be fully
stabilized with phosphorothioate linkages, but it may also have one
or more phosphodiester linkages, preferably between the cytosine
and guanine of the CpG motif(s), in which case the molecule is
referred to as semi-soft. In one embodiment, the TLR-9 agonist for
use in the present invention is a B class CpG oligonucleotide
represented by at least the formula: 5'
X.sub.1X.sub.2CGX.sub.3X.sub.4 3', wherein X1, X2, X3, and X4 are
nucleotides. In one embodiment, X.sub.2 is adenine, guanine, or
thymine. In another embodiment, X.sub.3 is cytosine, adenine, or
thymine.
[0027] In another embodiment, the TLR-9 agonist for use in the
present invention is a B class CpG oligonucleotide represented by
at least the formula: 5'
N.sub.1X.sub.1X.sub.2CGX.sub.3X.sub.4N.sub.2 3', wherein X.sub.1,
X.sub.2, X.sub.3, and X.sub.4 are nucleotides and N is any
nucleotide and N.sub.1 and N.sub.2 are nucleic acid sequences
composed of from about 0-25 N's each. In one embodiment,
X.sub.1X.sub.2 is a dinucleotide selected from the group consisting
of GpT, GpG, GpA, ApA, ApT, ApG, CpT, CpA, CpG, TpA, TpT and TpG;
and X.sub.3X.sub.4 is a dinucleotide selected from the group
consisting of TpT, ApT, TpG, ApG, CpG, TpC, ApC, CpC, TpA, ApA and
CpA. Preferably X.sub.1X.sub.2 is GpA or GpT and X3X4 is TpT. In
other embodiments, X.sub.1 or X.sub.2 or both are purines and
X.sub.3 or X.sub.4 or both are pyrimidines or X.sub.1X.sub.2 is GpA
and X.sub.3 or X.sub.4 or both are pyrimidines. In one preferred
embodiment, X.sub.1X.sub.2 is a dinucleotide selected from the
group consisting of TpA, ApA, ApC, ApG and GpG. In yet another
embodiment, X.sub.3X.sub.4 is a dinucleotide selected from the
group consisting of TpT, TpA, TpG, ApA, ApG, GpA and CpA.
X.sub.1X.sub.2, in another embodiment, is a dinucleotide selected
from the group consisting of TpT, TpG, ApT, GpC, CpC, CpT, TpC, GpT
and CpG; X.sub.3 is a nucleotide selected from the group consisting
of A and T, and X.sub.4 is a nucleotide, but when X.sub.1X.sub.2 is
TpC, GpT or CpG, X.sub.3X.sub.4 is not TpC, ApT or ApC.
[0028] In another preferred embodiment, the CpG oligonucleotide has
the sequence 5' TCN.sub.1TX.sub.1X.sub.2CGX.sub.3X.sub.4 3'. The
CpG oligonucleotides of the invention, in some embodiments, include
X.sub.1X.sub.2 selected from the group consisting of GpT, GpG, GpA
and ApA and X3X4 selected from the group consisting of TpT, CpT and
TpC.
[0029] The B class CpG oligonucleotide sequences of the invention
are those broadly described above as well as disclosed in published
PCT Patent Applications PCT/US95/01570 and PCT/US97/19791, and in
U.S. Pat. Nos. 6,194,388, 6,207,646, 6,214,806, 6,218,371,
6,239,116 and 6,339,068. Exemplary sequences include but are not
limited to those disclosed in these latter applications and
patents.
[0030] In an embodiment, the "B class" CpG oligonucleotide of the
invention has the following nucleic acid sequence:
TABLE-US-00001 (SEQ ID NO: 3) 5' TCGTCGTTTTTCGGTGCTTTT 3', or (SEQ
ID NO: 4) 5' TCGTCGTTTTTCGGTCGTTTT 3', or (SEQ ID NO: 5) 5'
TCGTCGTTTTGTCGTTTTGTCGTT 3', or (SEQ ID NO: 6) 5'
TCGTCGTTTCGTCGTTTTGTCGTT 3', or (SEQ ID NO: 7) 5'
TCGTCGTTTTGTCGTTTTTTTCGA 3'.
[0031] In any of these sequences, all of the linkages may be all
phosphorothioate bonds. In another embodiment, in any of these
sequences, one or more of the linkages may be phosphodiester,
preferably between the "C" and the "G" of the CpG motif making a
semi-soft CpG oligonucleotide. In any of these sequences, an
ethyl-uridine or a halogen may substitute for the 5' T; examples of
halogen substitutions include but are not limited to bromo-uridine
or iodo-uridine substitutions.
[0032] Some non-limiting examples of B-Class oligonucleotides
include:
TABLE-US-00002 (SEQ ID NO: 8) 5'
T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*G*C*T*T*T*T 3', or (SEQ ID NO: 9) 5'
T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*C*G*T*T*T*T 3', or (SEQ ID NO: 10) 5'
T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3', or (SEQ ID NO:
11) 5' T*C*G*T*C*G*T*T*T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3', or (SEQ
ID NO: 12) 5' T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*T*T*T*C*G*A
3'.
wherein * refers to a phosphorothioate bond.
[0033] The "C class" of CpG immunostimulatory oligonucleotides is
characterized functionally by the ability to activate B cells and
NK cells and induce IFN-.alpha.. Structurally, this class typically
includes a region with one or more B class-type immunostimulatory
CpG motifs, and a GC-rich palindrome or near-palindrome region that
allows the molecules to form secondary (e.g., stem-loop) or
tertiary (e.g., dimer) type structures. Some of these
oligonucleotides have both a traditional "stimulatory" CpG sequence
and a "GC-rich" or "B-cell neutralizing" motif. These combination
motif oligonucleotides have immune stimulating effects that fall
somewhere between the effects associated with traditional B class
CpG oligonucleotides (i.e., strong induction of B cell activation
and dendritic cell (DC) activation), and the effects associated
with A class CpG ODN (i.e., strong induction of IFN-.alpha. and NK
cell activation but relatively poor induction of B cell and DC
activation). Krieg A M et al. (1995) Nature 374:546-9; Ballas Z K
et al. (1996) J Immunol 157:1840-5; Yamamoto S et al. (1992) J
Immunol 148:4072-6.
[0034] The C class of combination motif immune stimulatory
oligonucleotides may have either completely stabilized, (e.g., all
phosphorothioate), chimeric (phosphodiester central region), or
semi-soft (e.g., phosphodiester within CpG motif) backbones. This
class has been described in U.S. patent application U.S. Ser. No.
10/224,523 filed on Aug. 19, 2002.
[0035] One stimulatory domain or motif of the C class CpG
oligonucleotide is defined by the formula: 5' X.sub.1DCGHX.sub.2
3'. D is a nucleotide other than C. C is cytosine. G is guanine. H
is a nucleotide other than G. X.sub.1 and X.sub.2 are any nucleic
acid sequence 0 to 10 nucleotides long. X.sub.1 may include a CG,
in which case there is preferably a T immediately preceding this
CG. In some embodiments, DCG is TCG. X.sub.1 is preferably from 0
to 6 nucleotides in length. In some embodiments, X.sub.2 does not
contain any poly G or poly A motifs. In other embodiments, the
immunostimulatory oligonucleotide has a poly-T sequence at the 5'
end or at the 3' end. As used herein, "poly-A" or "poly-T" shall
refer to a stretch of four or more consecutive A's or T's
respectively, e.g., 5' AAAA 3' or 5' TTTT 3'. As used herein,
"poly-G end" shall refer to a stretch of four or more consecutive
G's, e.g., 5' GGGG 3', occurring at the 5' end or the 3' end of a
nucleic acid. As used herein, "poly-G oligonucleotide" shall refer
to an oligonucleotide having the formula 5'
X.sub.1X.sub.2GGGX.sub.3X.sub.4 3' wherein X.sub.2, X.sub.3, and
X.sub.4 are nucleotides and preferably at least one of X.sub.3 and
X.sub.4 is a G. Some preferred designs for the B cell stimulatory
domain under this formula comprise TTTTTCG, TCG, TTCG, TTTCG,
TTTTCG, TCGT, TTCGT, TTTCGT, TCGTCGT.
[0036] The second motif of the C class CpG oligonucleotide is
referred to as either P or N and is positioned immediately 5' to
X.sub.1 or immediately 3' to X.sub.2.
[0037] N is a B cell neutralizing sequence that begins with a CGG
trinucleotide and is at least 10 nucleotides long. A B cell
neutralizing motif includes at least one CpG sequence in which the
CG is preceded by a C or followed by a G (Krieg A M et al. (1998)
Proc Natl Acad Sd USA 95:12631-12636) or is a CG containing DNA
sequence in which the C of the CG is methylated. Neutralizing
motifs or sequences have some degree of immunostimulatory
capability when present in an otherwise non-stimulatory motif, but
when present in the context of other immunostimulatory motifs serve
to reduce the immunostimulatory potential of the other motifs.
[0038] P is a GC-rich palindrome containing sequence at least 10
nucleotides long.
[0039] As used herein, "palindrome" and equivalently "palindromic
sequence" shall refer to an inverted repeat, i.e., a sequence such
as ABCDEE'D'C'B'A' in which A and A', B and B', etc., are bases
capable of forming the usual Watson-Crick base pairs.
[0040] As used herein, "GC-rich palindrome" shall refer to a
palindrome having a base composition of at least two-thirds G's and
Cs. In some embodiments the GC-rich domain is preferably 3' to the
"B cell stimulatory domain". In the case of a 10-base long GC-rich
palindrome, the palindrome thus contains at least 8 G's and Cs. In
the case of a 12-base long GC-rich palindrome, the palindrome also
contains at least 8 G's and Cs. In the case of a 14-mer GC-rich
palindrome, at least ten bases of the palindrome are G's and Cs. In
some embodiments the GC-rich palindrome is made up exclusively of
G's and Cs.
[0041] In some embodiments the GC-rich palindrome has a base
composition of at least 81% G's and Cs. In the case of such a
10-base long GC-rich palindrome, the palindrome thus is made
exclusively of G's and Cs. In the case of such a 12-base long
GC-rich palindrome, it is preferred that at least ten bases (83%)
of the palindrome are G's and Cs. In some preferred embodiments, a
12-base long GC-rich palindrome is made exclusively of G's and Cs.
In the case of a 14-mer GC-rich palindrome, at least twelve bases
(86%) of the palindrome are G's and Cs. In some preferred
embodiments, a 14-base long GC-rich palindrome is made exclusively
of G's and Cs. The Cs of a GC-rich palindrome can be unmethylated
or they can be methylated.
[0042] In general this domain has at least 3 Cs and Gs, more
preferably 4 of each, and most preferably 5 or more of each. The
number of Cs and Gs in this domain need not be identical. It is
preferred that the Cs and Gs are arranged so that they are able to
form a self-complementary duplex, or palindrome, such as CCGCGCGG.
This may be interrupted by As or Ts, but it is preferred that the
self-complementarity is at least partially preserved as for example
in the motifs CGACGTTCGTCG or CGGCGCCGTGCCG. When complementarity
is not preserved, it is preferred that the non-complementary base
pairs be TG. In a preferred embodiment there are no more than 3
consecutive bases that are not part of the palindrome, preferably
no more than 2, and most preferably only 1. In some embodiments,
the GC-rich palindrome includes at least one CGG trimer, at least
one CCG trimer, or at least one CGCG tetramer. In other
embodiments, the GC-rich palindrome is not CCCCCCGGGGGG or
GGGGGGCCCCCC, CCCCCGGGGG or GGGGGCCCCC.
[0043] At least one of the G's of the GC rich region may be
substituted with an inosine (I). In some embodiments, P includes
more than one I.
[0044] In certain embodiments, the immunostimulatory
oligonucleotide has one of the following formulas 5'
NX.sub.1DCGHX.sub.2 3', 5' X.sub.1DCGHX.sub.2N 3', 5'
PX.sub.1DCGHX.sub.2 3', 5' X.sub.1DCGHX.sub.2P 3', 5'
X.sub.1DCGHX.sub.2PX.sub.3 3', 5' X.sub.1DCGHPX.sub.3 3', 5'
DCGHX.sub.2PX.sub.3 3', 5' TCGHX.sub.2PX.sub.3 3', 5' DCGHPX.sub.3
3' or 5'DCGHP 3'.
[0045] The invention provides other immune stimulatory
oligonucleotides defined by a formula 5' N.sub.1PyGN.sub.2P 3'.
N.sub.1 is any sequence 1 to 6 nucleotides long. Py is a
pyrimidine. G is guanine. N.sub.2 is any sequence 0 to 30
nucleotides long. P is a GC-rich palindrome containing a sequence
at least 10 nucleotides long.
[0046] N.sub.1 and N.sub.2 may contain more than 50% pyrimidines,
and more preferably more than 50% T. N.sub.1 may include a CG, in
which case there is preferably a T immediately preceding this CG.
In some embodiments, N1PyG is TCG, and most preferably a
TCGN.sub.2, where N.sub.2 is not G.
[0047] N.sub.1PyGN.sub.2P may include one or more inosine (I)
nucleotides. Either the C or the G in N.sub.1 may be replaced by
inosine, but the Cpl is preferred to the IpG. For inosine
substitutions such as IpG, the optimal activity may be achieved
with the use of a "semi-soft" or chimeric backbone, where the
linkage between the IG or the Cl is phosphodiester. N1 may include
at least one Cl, TCl, IG or TIG motif.
[0048] In certain embodiments N.sub.1PyGN.sub.2 is a sequence
selected from the group consisting of TTTTTCG, TCG, TTCG, TTTCG,
TTTTCG, TCGT, TTCGT, TTTCGT, and TCGTCGT.
[0049] In an embodiment, the "C class" CpG oligonucleotides of the
invention has the following nucleic acid sequence:
TABLE-US-00003 (SEQ ID NO: 13) 5' TCGCGTCGTTCGGCGCGCGCCG 3', or
(SEQ ID NO: 14) 5' TCGTCGACGTTCGGCGCGCGCCG 3', or (SEQ ID NO: 15)
5' TCGGACGTTCGGCGCGCGCCG 3', or (SEQ ID NO: 16) 5'
TCGGACGTTCGGCGCGCCG 3', or (SEQ ID NO: 17) 5' TCGCGTCGTTCGGCGCGCCG
3', or (SEQ ID NO: 18) 5' TCGACGTTCGGCGCGCGCCG 3', or (SEQ ID NO:
19) 5' TCGACGTTCGGCGCGCCG 3', or (SEQ ID NO: 20) 5'
TCGCGTCGTTCGGCGCCG 3', or (SEQ ID NO: 21) 5' TCGCGACGTTCGGCGCGCGCCG
3', or (SEQ ID NO: 22) 5' TCGTCGTTTTCGGCGCGCGCCG 3', or (SEQ ID NO:
23) 5' TCGTCGTTTTCGGCGGCCGCCG 3', or (SEQ ID NO: 24) 5'
TCGTCGTTTTACGGCGCCGTGCCG 3', or (SEQ ID NO: 25) 5'
TCGTCGTTTTCGGCGCGCGCCGT 3'.
[0050] In any of these sequences, all of the linkages may be all
phosphorothioate bonds. In another embodiment, in any of these
sequences, one or more of the linkages may be phosphodiester,
preferably between the "C" and the "G" of the CpG motif making a
semi-soft CpG oligonucleotide.
[0051] Some non-limiting examples of C-Class oligonucleotides
include:
TABLE-US-00004 (SEQ ID NO: 26) 5'
T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3', or (SEQ ID NO: 27)
5' T*C_G*T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3', or (SEQ ID NO:
28) 5' T*C_G*G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3', or (SEQ ID NO:
29) 5' T*C_G*G*A*C_G*T*T*C_G*G*C*G*C*G*C*C*G 3', or (SEQ ID NO: 30)
5' T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C*G*C*C*G 3', or (SEQ ID NO: 31)
5' T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3', or (SEQ ID NO: 32)
5' T*C_G*A*C_G*T*T*C_G*G*C*G*C*G*C*C*G 3', or (SEQ ID NO: 33) 5'
T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C*C*G 3', or (SEQ ID NO: 34) 5'
T*C_G*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3', or (SEQ ID NO: 35)
5' T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G 3', or (SEQ ID NO:
36) 5' T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*G*C*C*G*C*C*G 3', or (SEQ ID
NO: 37) 5' T*C*G*T*C_G*T*T*T*T*A*C_G*G*C*G*C*C_G*T*G*C*C*G 3', or
(SEQ ID NO: 38) 5' T*C_G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G*T
3'
wherein * refers to a phosphorothioate bond and _ refers to a
phosphodiester bond.
[0052] In any of these sequences, an ethyl-uridine or a halogen may
substitute for the 5' T; examples of halogen substitutions include
but are not limited to bromo-uridine or iodo-uridine
substitutions.
[0053] The "P class" CpG immunostimulatory oligonucleotides have
been described in WO2007/095316 and are characterized by the fact
that they contain duplex forming regions such as, for example,
perfect or imperfect palindromes at or near both the 5' and 3'
ends, giving them the potential to form higher ordered structures
such as concatamers. These oligonucleotides referred to as P-Class
oligonucleotides have the ability in some instances to induce much
high levels of IFN-.alpha. secretion than the C-Class. The P-Class
oligonucleotides have the ability to spontaneously self-assemble
into concatamers either in vitro and/or in vivo. Without being
bound by any particular theory for the method of action of these
molecules, one potential hypothesis is that this property endows
the P-Class oligonucleotides with the ability to more highly
crosslink TLR9 inside certain immune cells, inducing a distinct
pattern of immune activation compared to the previously described
classes of CpG oligonucleotides.
[0054] In an embodiment, the TLR-9 agonist for use in the present
invention is a P class CpG oligonucleotide containing a 5 TLR
activation domain and at least two palindromic regions, one
palindromic region being a 5' palindromic region of at least 6
nucleotides in length and connected to a 3' palindromic region of
at least 8 nucleotides in length either directly or through a
spacer, wherein the oligonucleotide includes at least one YpR
dinucleotide. In an embodiment, said oligoonucleotide is not
T*C_G*T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G (SEQ ID NO: 27). In
one embodiment the a P class CpG oligonucleotide includes at least
one unmethylated CpG dinucleotide. In another embodiment the TLR
activation domain is TCG, TTCG, TTTCG, TYpR, TTYpR, TTTYpR, UCG,
UUCG, UUUCG, TTT, or TTTT. In yet another embodiment the TLR
activation domain is within the 5' palindromic region. In another
embodiment the TLR activation domain is immediately 5' to the 5'
palindromic region. In still another embodiment the 5' palindromic
region is at least 8 nucleotides in length. In another embodiment
the 3' palindromic region is at least 10 nucleotides in length. In
another embodiment the 5' palindromic region is at least 10
nucleotides in length. In yet another embodiment the 3' palindromic
region includes an unmethylated CpG dinucleotide. In another
embodiment the 3' palindromic region includes two unmethylated CpG
dinucleotides. In another embodiment the 5' palindromic region
includes an unmethylated CpG dinucleotide. In yet another
embodiment the 5' palindromic region includes two unmethylated CpG
dinucleotides. In another embodiment the 5 and 3' palindromic
regions have a duplex stability value of at least 25. In another
embodiment the 5 and 3' palindromic regions have a duplex stability
value of at least 30. In another embodiment the 5 and 3'
palindromic regions have a duplex stability value of at least 35.
In another embodiment the 5 and 3' palindromic regions have a
duplex stability value of at least 40. In another embodiment the 5
and 3' palindromic regions have a duplex stability value of at
least 45. In another embodiment the 5 and 3' palindromic regions
have a duplex stability value of at least 50. In another embodiment
the 5' and 3' palindromic regions have a duplex stability value of
at least 55. In another embodiment the 5 and 3' palindromic regions
have a duplex stability value of at least 60. In another embodiment
the 5 and 3' palindromic regions have a duplex stability value of
at least 65.
[0055] In one embodiment the two palindromic regions are connected
directly. In another embodiment the two palindromic regions are
connected via a 3'-3' linkage. In another embodiment the two
palindromic regions overlap by one nucleotide. In yet another
embodiment the two palindromic regions overlap by two nucleotides.
In another embodiment the two palindromic regions do not overlap.
In another embodiment the two palindromic regions are connected by
a spacer. In one embodiment the spacer is a nucleic acid having a
length of 1-50 nucleotides. In another embodiment the spacer is a
nucleic acid having a length of 1 nucleotide. In another embodiment
the spacer is a non-nucleotide spacer. In one embodiment the
non-nucleotide spacer is a D-spacer. In another embodiment the
non-nucleotide spacer is a linker. In one embodiment the
oligonucleotide has the formula 5' XP.sub.1SP.sub.2T 3', wherein X
is the TLR activation domain, P.sub.1 is a palindrome, S is a
spacer, P.sub.2 is a palindrome, and T is a 3' tail of 0-100
nucleotides in length. In one embodiment X is TCG, TTCG, or TTTCG.
In another embodiment T is 5-50 nucleotides in length. In yet
another embodiment T is 5-10 nucleotides in length. In one
embodiment S is a nucleic acid having a length of 1-50 nucleotides.
In another embodiment S is a nucleic acid having a length of 1
nucleotide. In another embodiment S is a non-nucleotide spacer. In
one embodiment the non-nucleotide spacer is a D-spacer. In another
embodiment the non-nucleotide spacer is a linker. In another
embodiment the oligonucleotide is not an antisense oligonucleotide
or a ribozyme. In one embodiment P.sub.1 is A and T rich. In
another embodiment P.sub.1 includes at least 4 Ts. In another
embodiment P.sub.2 is a perfect palindrome. In another embodiment
P2 is G-C rich. In still another embodiment P.sub.2 is
CGGCGCX.sub.1GCGCCG, where X.sub.1 is T or nothing.
[0056] In one embodiment the oligonucleotide includes at least one
phosphorothioate linkage. In another embodiment all internucleotide
linkages of the oligonucleotide are phosphorothioate linkages. In
another embodiment the oligonucleotide includes at least one
phosphodiester-like linkage. In another embodiment the
phosphodiester-like linkage is a phosphodiester linkage. In another
embodiment a lipophilic group is conjugated to the oligonucleotide.
In one embodiment the lipophilic group is cholesterol.
[0057] In an embodiment, the TLR-9 agonist for use in the present
invention is a P class CpG oligonucleotide with a 5' TLR activation
domain and at least two complementarity-containing regions, a 5'
and a 3' complementarity-containing region, each
complementarity-containing region being at least 8 nucleotides in
length and connected to one another either directly or through a
spacer, wherein the oligonucleotide includes at least one
pyrimidine-purine (YpR) dinucleotide, and wherein at least one of
the complementarity-containing regions is not a perfect palindrome.
In one embodiment the oligonucleotide includes at least one
unmethylated CpG dinucleotide. In another embodiment the TLR
activation domain is TCG, TTCG, TTTCG, TYpR, TTYpR, TTTYpR, UCG,
UUCG, UUUCG, TTT, or TTTT. In another embodiment the TLR activation
domain is within the 5' complementarity-containing region. In
another embodiment the TLR activation domain is immediately 5' to
the 5' complementarity-containing region. In another embodiment the
3' complementarity-containing region is at least 10 nucleotides in
length. In yet another embodiment the 5' complementarity-containing
region is at least 10 nucleotides in length. In one embodiment the
3' complementarity-containing region includes an unmethylated CpG
dinucleotide. In another embodiment the 3'
complementarity-containing region includes two unmethylated CpG
dinucleotides. In yet another embodiment the 5'
complementarity-containing region includes an unmethylated CpG
dinucleotide. In another embodiment the 5'
complementarity-containing region includes two unmethylated CpG
dinucleotides. In another embodiment the complementarity-containing
regions include at least one nucleotide analog. In another
embodiment the complementarity-containing regions form an
intramolecular duplex. In one embodiment the intramolecular duplex
includes at least one non-Watson Crick base pair. In another
embodiment the non-Watson Crick base pair is G-T, G-A, G-G, or C-A.
In one embodiment the complementarity-containing regions form
intermolecular duplexes. In another embodiment at least one of the
intermolecular duplexes includes at least one non-Watson Crick base
pair. In another embodiment the non-Watson Crick base pair is G-T,
G-A, G-G, or C-A. In yet another embodiment the
complementarity-containing regions contain a mismatch. In still
another embodiment the complementarity-containing regions contain
two mismatches. In another embodiment the
complementarity-containing regions contain an intervening
nucleotide. In another embodiment the complementarity-containing
regions contain two intervening nucleotides.
[0058] In one embodiment the 5' and 3' complementarity-containing
regions have a duplex stability value of at least 25. In another
embodiment the 5' and 3' complementarity-containing regions have a
duplex stability value of at least 30. In another embodiment the 5'
and 3' complementarity-containing regions have a duplex stability
value of at least 35. In another embodiment the
complementarity-containing regions have a duplex stability value of
at least 40. In another embodiment the complementarity-containing
regions have a duplex stability value of at least 45. In another
embodiment the complementarity-containing regions have a duplex
stability value of at least 50. In another embodiment the
complementarity-containing regions have a duplex stability value of
at least 55. In another embodiment the complementarity-containing
regions have a duplex stability value of at least 60. In another
embodiment the complementarity-containing regions have a duplex
stability value of at least 65.
[0059] In another embodiment the two complementarity-containing
regions are connected directly. In another embodiment the two
palindromic regions are connected via a 3'-3' linkage. In yet
another embodiment the two complementarity-containing regions
overlap by one nucleotide. In another embodiment the two
complementarity-containing regions overlap by two nucleotides. In
another embodiment the two complementarity-containing regions do
not overlap. In another embodiment the two
complementarity-containing regions are connected by a spacer. In
another embodiment the spacer is a nucleic acid having a length of
1-50 nucleotides. In another embodiment the spacer is a nucleic
acid having a length of 1 nucleotide. In one embodiment the spacer
is a non-nucleotide spacer. In another embodiment the
non-nucleotide spacer is a D-spacer. In yet another embodiment the
non-nucleotide spacer is a linker.
[0060] In one embodiment the P-class oligonucleotide has the
formula 5' XNSPT 3', wherein X is the TLR activation domain, N is a
non-perfect palindrome, P is a palindrome, S is a spacer, and T is
a 3' tail of 0-100 nucleotides in length. In another embodiment X
is TCG, TTCG, or TTTCG. In another embodiment T is 5-50 nucleotides
in length. In another embodiment T is 5-10 nucleotides in length.
In another embodiment S is a nucleic acid having a length of 1-50
nucleotides. In another embodiment S is a nucleic acid having a
length of 1 nucleotide. In another embodiment S is a non-nucleotide
spacer. In another embodiment the non-nucleotide spacer is a
D-spacer. In another embodiment the non-nucleotide spacer is a
linker. In another embodiment the oligonucleotide is not an
antisense oligonucleotide or a ribozyme. In another embodiment N is
A and T rich. In another embodiment N is includes at least 4 Ts. In
another embodiment P is a perfect palindrome. In another embodiment
P is G-C rich. In another embodiment P is CGGCGCX.sub.1GCGCCG,
wherein X.sub.1 is T or nothing. In another embodiment the
oligonucleotide includes at least one phosphorothioate linkage. In
another embodiment all interaucleotide linkages of the
oligonucleotide are phosphorothioate linkages. In another
embodiment the oligonucleotide includes at least one
phosphodiester-like linkage. In another embodiment the
phosphodiester-like linkage is a phosphodiester linkage. In another
embodiment a lipophilic group is conjugated to the oligonucleotide.
In one embodiment the lipophilic group is cholesterol.
[0061] In an embodiment, the "P class" CpG oligonucleotides of the
invention has the following nucleic acid sequence: 5'
TCGTCGACGATCGGCGCGCGCCG 3' (SEQ ID NO: 39).
[0062] In said sequences, all of the linkages may be all
phosphorothioate bonds. In another embodiment, one or more of the
linkages may be phosphodiester, preferably between the "C" and the
"G" of the CpG motif making a semi-soft CpG oligonucleotide. In any
of these sequences, an ethyl-uridine or a halogen may substitute
for the 5' T; examples of halogen substitutions include but are not
limited to bromo-uridine or iodo-uridine substitutions.
[0063] A non-limiting example of P-Class oligonucleotides
include:
TABLE-US-00005 (SEQ ID NO: 40) 5'
T*C_G*T*C_G*A*C_G*A*T*C_G*G*C*G*C_G*C*G*C*C*G 3'
wherein * refers to a phosphorothioate bond and _ refers to a
phosphodiester bond.
[0064] In an embodiment, all the internucleotide linkage of the CpG
oligonucleotides disclosed herein are phosphodiester bonds ("soft"
oligonucleotides, as described in the PCT application
WO2007/026190). In another embodiment, CpG oligonucleotides of the
invention are rendered resistant to degradation (e.g., are
stabilized). A "stabilized oligonucleotide" refers to an
oligonucleotide that is relatively resistant to in vivo degradation
(e.g. via an exo- or endo-nuclease). Nucleic acid stabilization can
be accomplished via backbone modifications. Oligonucleotides having
phosphorothioate linkages provide maximal activity and protect the
oligonucleotide from degradation by intracellular exo- and
endo-nucleases.
[0065] The immunostimulatory oligonucleotides may have a chimeric
backbone, which have combinations of phosphodiester and
phosphorothioate linkages. For purposes of the instant invention, a
chimeric backbone refers to a partially stabilized backbone,
wherein at least one internucleotide linkage is phosphodiester or
phosphodiester-like, and wherein at least one other internucleotide
linkage is a stabilized internucleotide linkage, wherein the at
least one phosphodiester or phosphodiester-like linkage and the at
least one stabilized linkage are different. When the phosphodiester
linkage is preferentially located within the CpG motif such
molecules are called "semi-soft" as described in the PCT
application WO2007/026190.
[0066] Other modified oligonucleotides include combinations of
phosphodiester, phosphorothioate, methylphosphonate,
methylphosphorothioate, phosphorodithioate, and/or p-ethoxy
linkages. Since boranophosphonate linkages have been reported to be
stabilized relative to phosphodiester linkages, for purposes of the
chimeric nature of the backbone, boranophosphonate linkages can be
classified either as phosphodiester-like or as stabilized,
depending on the context. For example, a chimeric backbone
according to the instant invention could, in some embodiments,
includes at least one phosphodiester (phosphodiester or
phosphodiester-like) linkage and at least one boranophosphonate
(stabilized) linkage. In other embodiments, a chimeric backbone
according to the instant invention could include boranophosphonate
(phosphodiester or phosphodiester-like) and phosphorothioate
(stabilized) linkages. A "stabilized internucleotide linkage" shall
mean an internucleotide linkage that is relatively resistant to in
vivo degradation (e.g., via an exo- or endo-nuclease), compared to
a phosphodiester internucleotide linkage. Preferred stabilized
internucleotide linkages include, without limitation,
phosphorothioate, phosphorodithioate, methylphosphonate, and
methylphosphorothioate. Other stabilized internucleotide linkages
include, without limitation, peptide, alkyl, dephospho, and others
as described above.
[0067] Modified backbones such as phosphorothioates may be
synthesized using automated techniques employing either
phosphoramidate or H-phosphonate chemistries. Aryl- and
alkyl-phosphonates can be made, e.g., as described in U.S. Pat. No.
4,469,863; and alkylphosphotriesters (in which the charged oxygen
moiety is alkylated as described in U.S. Pat. No. 5,023,243 and
European Patent No. 092,574) can be prepared by automated solid
phase synthesis using commercially available reagents. Methods for
making other DNA backbone modifications and substitutions have been
described. Uhlmann E et al. (1990) Chem Rev 90:544; Goodchild J
(1990) Bioconjugate Chem 1:165. Methods for preparing chimeric
oligonucleotides are also known. For instance patents issued to
Uhlmann et al have described such techniques.
[0068] Mixed backbone modified ODN may be synthesized as described
in the PCT application WO2007/026190.
[0069] The oligonucleotides of the invention can also include other
modifications. These include nonionic DNA analogs, such as alkyl-
and aryl-phosphates (in which the charged phosphonate oxygen is
replaced by an alkyl or aryl group), phosphodiester and
alkylphosphotriesters, in which the charged oxygen moiety is
alkylated. Nucleic acids which contain diol, such as
tetraethyleneglycol or hexaethyleneglycol, at either or both
termini have also been shown to be substantially resistant to
nuclease degradation.
[0070] The size of the CpG oligonucleotide (i.e., the number of
nucleotide residues along the length of the oligonucleotide) also
may contribute to the stimulatory activity of the oligonucleotide.
For facilitating uptake into cells, CpG oligonucleotide of the
invention preferably have a minimum length of 6 nucleotide
residues. Oligonucleotides of any size greater than 6 nucleotides
(even many kb long) are capable of inducing an immune response if
sufficient immunostimulatory motifs are present, because larger
oligonucleotides are degraded inside cells. In certain embodiments,
the CpG oligonucleotides are 6 to 100 nucleotides long,
preferentially 8 to 30 nucleotides long. In important embodiments,
nucleic acids and oligonucleotides of the invention are not
plasmids or expression vectors.
[0071] In an embodiment, the CpG oligonucleotide disclosed herein
comprise substitutions or modifications, such as in the bases
and/or sugars as described at paragraph 134 to 147 of
WO2007/026190.
[0072] In an embodiment, the CpG oligonucleotide of the present
invention is chemically modified. Examples of chemical
modifications are known to the skilled person and are described,
for example in Uhlmann E. et al. (1990), Chem. Rev. 90:543, S.
Agrawal, Ed., Humana Press, Totowa, USA 1993; Crooke, S. T. et al.
(1996) Annu. Rev. Pharmacol. Toxicol. 36:107-129; and Hunziker J.
et al., (1995), Mod. Synth. Methods 7:331-417. An oligonucleotide
according to the invention may have one or more modifications,
wherein each modification is located at a particular phosphodiester
internucleoside bridge and/or at a particular .beta.-D-ribose unit
and/or at a particular natural nucleoside base position in
comparison to an oligonucleotide of the same sequence which is
composed of natural DNA or RNA.
[0073] In some embodiments of the invention, CpG-containing nucleic
acids might be simply mixed with immunogenic carriers according to
methods known to those skilled in the art (see, e.g.
WO03/024480).
[0074] In a particular embodiment of the present invention, any of
the vaccine disclosed herein comprises from 2 .mu.g to 100 mg of
CpG oligonucleotide, preferably from 0.1 mg to 50 mg CpG
oligonucleotide, preferably from 0.2 mg to 10 mg CpG
oligonucleotide, preferably from 0.3 mg to 5 mg CpG
oligonucleotide, preferably from 0.3 mg to 5 mg CpG
oligonucleotide, even preferably from 0.5 to 2 mg CpG
oligonucleotide, even preferably from 0.75 to 1.5 mg CpG
oligonucleotide. In a preferred embodiment, any of the vaccine
disclosed herein comprises approximately 1 mg CpG
oligonucleotide.
Pneumococcal Vaccines
[0075] Pneumococcal vaccine of the present invention will typically
comprise conjugated capsular saccharide antigens, wherein the
saccharides are derived from at least seven serotypes of S.
pneumoniae. The number of S. pneumoniae capsular saccharides can
range from 7 different serotypes (or "v", valences) to 23 different
serotypes (23 v). In one embodiment there are 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 different serotypes.
In an embodiment there are 10 or 11 different serotypes. In an
embodiment there are 7 or 13 different serotypes. The capsular
saccharide antigens are conjugated to a carrier protein as
described here below.
[0076] In another embodiment of the invention, the vaccine may
comprise conjugated S. pneumoniae saccharides and unconjugated S.
pneumoniae saccharides. Preferably, the total number of saccharide
serotypes is less than or equal to 23. For example, the vaccine may
comprise 7 conjugated serotypes and 16 unconjugated saccharides. In
another embodiment, the vaccine may comprise 13 conjugated
serotypes and 10 unconjugated saccharides. In a similar manner, the
vaccine may comprise 8, 9, 10, 11, 12, 13, 14, 15 or 16 conjugated
saccharides and 15, 14, 13, 12, 11, 10, 9, 8 or 7, respectively,
unconjugated saccharides.
1. In an embodiment the vaccine of the invention comprises
conjugated S. pneumoniae saccharides from serotypes 4, 6B, 9V, 14,
18C, 19F and. 23F. 2. In another embodiment the vaccine of the
invention comprises in addition to point 1 above, conjugated S.
pneumoniae saccharides from serotype 1. 3. In another embodiment
the vaccine of the invention comprises in addition to point 1 or 2
above, conjugated S. pneumoniae saccharides from serotype 5. 4. In
another embodiment the vaccine of the invention comprises in
addition to point 1, 2 or 3 above, conjugated S. pneumoniae
saccharides from serotype 7F. 5. In another embodiment the vaccine
of the invention comprises in addition to point 1, 2, 3 or 4 above,
conjugated S. pneumoniae saccharides from serotype 3. 6. In another
embodiment the vaccine of the invention comprises in addition to
point 1, 2, 3, 4 or 5 above, conjugated S. pneumoniae saccharides
from serotype 6A. 7. In another embodiment the vaccine of the
invention comprises in addition to point 1, 2, 3, 4, 5 or 6 above,
conjugated S. pneumoniae saccharides from serotype 19A. 8. In
another embodiment the vaccine of the invention comprises in
addition to point 1, 2, 3, 4, 5, 6 or 7 above, conjugated S.
pneumoniae saccharides from serotype 22F. 9. In another embodiment
the vaccine of the invention comprises in addition to point 1, 2,
3, 4, 5, 6, 7 or 8 above, conjugated S. pneumoniae saccharides from
serotype 15. 10. In another embodiment the vaccine of the invention
comprises in addition to point 1, 2, 3, 4, 5, 6, 7, 8 or 9 above,
conjugated S. pneumoniae saccharides from serotype 8. 11. In
another embodiment the vaccine of the invention comprises in
addition to point 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 above, conjugated
S. pneumoniae saccharides from serotype 12F. 12. In another
embodiment the vaccine of the invention comprises in addition to
point 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 above, conjugated S.
pneumoniae saccharides from serotype 2. 13. In another embodiment
the vaccine of the invention comprises in addition to point 1, 2,
3, 4, 5, 6, 7, 8, 9, 11 or 12 above, conjugated S. pneumoniae
saccharides from serotype 9N. 14. In another embodiment the vaccine
of the invention comprises in addition to point 1, 2, 3, 4, 5, 6,
7, 8, 9, 11, 12 or 13 above, conjugated S. pneumoniae saccharides
from serotype 10A. 15. In another embodiment the vaccine of the
invention comprises in addition to point 1, 2, 3, 4, 5, 6, 7, 8, 9,
11, 12, 13 or 14 above, conjugated S. pneumoniae saccharides from
serotype 11A. 16. In another embodiment the vaccine of the
invention comprises in addition to point 1, 2, 3, 4, 5, 6, 7, 8, 9,
11, 12, 13, 14, or 15 above, conjugated S. pneumoniae saccharides
from serotype 11A. 17. In another embodiment the vaccine of the
invention comprises in addition to point 1, 2, 3, 4, 5, 6, 7, 8, 9,
11, 12, 13, 14, 15 or 16 above, conjugated S. pneumoniae
saccharides from serotype 17F. 18. In another embodiment the
vaccine of the invention comprises in addition to point 1, 2, 3, 4,
5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16 or 17 above, conjugated S.
pneumoniae saccharides from serotype 20. 19. In another embodiment
the vaccine of the invention comprises in addition to point 1, 2,
3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17 or 18 above,
conjugated S. pneumoniae saccharides from serotype 33F.
[0077] In an embodiment the vaccine of the invention comprises
conjugated S. pneumoniae saccharides from serotypes 4, 6B, 9V, 14,
18C, 19F and. 23F.
[0078] In an embodiment the vaccine of the invention comprises
conjugated S. pneumoniae saccharides from serotypes 1, 3, 4, 5, 6A,
6B, 7F, 9V, 14, 18C, 19A, 19F and. 23F
[0079] In an embodiment, the vaccine of the invention comprises
conjugated S. pneumoniae saccharides from serotypes 1, 4, 5, 6B,
7F, 9V, 14, 18C, 19F and. 23F.
[0080] In an embodiment, the vaccine of the invention comprises
conjugated S. pneumoniae saccharides from serotypes 1, 3, 4, 5, 6B,
7F, 9V, 14, 18C, 19F and 23F.
[0081] In a preferred embodiment, the capsular saccharide antigens
are conjugated to a carrier protein independently selected from the
group consisting of TT, DT, CRM197, fragment C of TT, PhtD, PhtDE
fusions (particularly those described in WO 01/98334 and WO
03/54007), detoxified pneumolysin and protein D.
[0082] In a preferred embodiment, the capsular saccharide antigens
are conjugated to a carrier proteins which is selected in the group
consisting of: DT (Diphtheria toxin), TT (tetanus toxid) or
fragment C of TT, CRM197 (a nontoxic but antigenically identical
variant of diphtheria toxin) other DT point mutants, such as
CRM176, CRM228, CRM 45 (Uchida et al J. Biol. Chem. 218; 3838-3844,
1973); CRM 9, CRM 45, CRM102, CRM 103 and CRM107 and other
mutations described by Nicholls and Youle in Genetically Engineered
Toxins, Ed: Frankel, Maecel Dekker Inc, 1992; deletion or mutation
of Glu-148 to Asp, Gln or Ser and/or Ala 158 to Gly and other
mutations disclosed in U.S. Pat. No. 4,709,017 or U.S. Pat. No.
4,950,740; mutation of at least one or more residues Lys 516, Lys
526, Phe 530 and/or Lys 534 and other mutations disclosed in U.S.
Pat. No. 5,917,017 or U.S. Pat. No. 6,455,673; or fragment
disclosed in U.S. Pat. No. 5,843,711, pneumococcal pneumolysin (Kuo
et al (1995) Infect Immun 63; 2706-13) including ply detoxified in
some fashion for example dPLY-GMBS (WO 04081515, PCT/EP2005/010258)
or dPLY-formol, PhtX, including PhtA, PhtB, PhtD, PhtE (sequences
of PhtA, PhtB, PhtD or PhtE are disclosed in WO 00/37105 or WO
00/39299) and fusions of Pht proteins for example PhtDE fusions,
PhtBE fusions, Pht A-E (WO 01/98334, WO 03/54007, WO2009/000826),
OMPC (meningococcal outer membrane protein--usually extracted from
N. meningitidis serogroup B--EP0372501), PorB (from N.
meningitidis), PD (Haemophilus influenzae protein D--see, e.g., EP
0 594 610 B), or immunologically functional equivalents thereof,
synthetic peptides (EP0378881, EP0427347), heat shock proteins (WO
93/17712, WO 94/03208), pertussis proteins (WO 98/58668, EP0471
177), cytokines, lymphokines, growth factors or hormones (WO
91/01146), artificial proteins comprising multiple human CD4+ T
cell epitopes from various pathogen derived antigens (Falugi et al
(2001) Eur J Immunol 31; 3816-3824) such as N19 protein (Baraldoi
et al (2004) Infect Immun 72; 4884-7) pneumococcal surface protein
PspA (WO 02/091998), iron uptake proteins (WO 01/72337), toxin A or
B of C. difficile (WO 00/61761).
[0083] In an embodiment, the capsular saccharide antigens are
conjugated to DT (Diphtheria toxoid). In another embodiment, the
capsular saccharide antigens are conjugated to TT (tetanus
toxid).
[0084] In another embodiment, the capsular saccharide antigens are
conjugated to fragment C of TT.
[0085] In another embodiment, the capsular saccharide antigens are
conjugated to PD (Haemophilus influenzae protein D--see, e.g., EP 0
594 610 B).
[0086] In a preferred embodiment, the capsular saccharide antigens
of the invention are conjugated to CRM197 protein. The CRM197
protein is a nontoxic form of diphtheria toxin but is
immunologically indistinguishable from the diphtheria toxin. CRM197
is produced by C. diphtheriae infected by the nontoxigenic phage
.beta.197.sup.tox- created by nitrosoguanidine mutagenesis of the
toxigenic corynephage beta (Uchida, T. et al. 1971, Nature New
Biology 233:8-11). The CRM197 protein has the same molecular weight
as the diphtheria toxin but differs therefrom by a single base
change (guanine to adenine) in the structural gene. This single
base change causes an amino acid substitution glutamic acid for
glycine) in the mature protein and eliminates the toxic properties
of diphtheria toxin. The CRM197 protein is a safe and effective
T-cell dependent carrier for saccharides. Further details about
CMR197 and production thereof can be found e.g. in U.S. Pat. No.
5,614,382.
[0087] In an embodiment, if the protein carrier is the same for 2
or more saccharides in the composition, the saccharides could be
conjugated to the same molecule of the protein carrier (carrier
molecules having 2 more different saccharides conjugated to it)
[see for instance WO 04/083251].
[0088] Alternatively the saccharides may each be individually
conjugated to different molecules of the protein carrier (each
molecule of protein carrier only having one type of saccharide
conjugated to it). In said embodiment, the capsular saccharides are
said to be individually conjugated to the carrier protein.
[0089] In an embodiment, the capsular saccharide antigens of the
present invention are from different S. pneumoniae serotypes and
are conjugated to one or more carrier protein. In an embodiment the
vaccine of the invention comprises 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22 or 23 different serotypes capsular
saccharide conjugates in which CRM197 is the carrier protein.
[0090] In an embodiment the vaccine of the invention comprises 7,
8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23
different serotypes capsular saccharide conjugates in which protein
D is the carrier protein.
[0091] In an embodiment, saccharide from serotype 1, 2, 3, 4, 5,
6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20,
22F, 23F or 33F is conjugated to protein D.
[0092] In an embodiment, saccharide from serotype 1, 2, 3, 4, 5,
6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20,
22F, 23F or 33F is conjugated to CRM197.
[0093] In an embodiment, saccharides from at least serotypes 1 and
3, 1 and 4, 1 and 5, 1 and 6A, 1 and 6B, 1 and 7, 1 and 9V, 1 and
14, 1 and 22F, 1 and 23F, 3 and 4, 3 and 5, 3 and 6A, 3 and 6B, 3
and 7F, 3 and 9V, 3 and 14, 3 and 22F, 3 and 23F, 4 and 5, 4 and
6A, 4 and 6B, 4 and 7F, 4 and 9V, 4 and 14, 4 and 22F, 4 and 23F, 5
and 6A, 5 and 6B, 5 and 7F, 5 and 9V, 5 and 14, 5 and 22F, 5 and
23F, 6A and 6B, 6A and 7F, 6A and 9V, 6A and 14, 6A and 22F, 6A and
23F, 6B and 7F, 6B and 9V, 6B and 14, 6B and 22F, 6B and 23F, 7F
and 9V, 7F and 14, 7F and 22F, 7F and 23F, 9V and 14, 9V and 22F,
9V and 23F, 14 and 22F, 14 and 23F or 22F and 23F are conjugated to
CRM197.
[0094] In an embodiment, saccharides from at least serotypes 1, 3
and 4; 1, 3 and 5; 1, 3 and 6A; 1, 3 and 6B; 1, 3 and 7F; 1, 3 and
9V; 1, 3 and 14; 3, 4 and 7F; 3, 4 and 5; 3, 4 and 7F; 3, 4 and 9V;
3, 4 and 14; 4, 5 and 7F; 4, 5 and 9V; 4, 5, and 14; 5, 7F and 9V;
5, 7F and 14; 7F, 9V and 14; 1, 3, 4 and 5; 3, 4, 5 and 7F; 4, 5,
7F and 9V; 4, 5, 7F and 14; 4, 5, 9V and 14; 4, 7F, 9V and 14; 5,
7F, 9V and 14; or 4, 5, 7F, 9V and 14 are conjugated to CRM197.
[0095] In an embodiment, saccharides from at least serotypes 1 and
3, 1 and 4, 1 and 5, 1 and 6A, 1 and 6B, 1 and 7, 1 and 9V, 1 and
14, 1 and 22F, 1 and 23F, 3 and 4, 3 and 5, 3 and 6A, 3 and 6B, 3
and 7F, 3 and 9V, 3 and 14, 3 and 22F, 3 and 23F, 4 and 5, 4 and
6A, 4 and 6B, 4 and 7F, 4 and 9V, 4 and 14, 4 and 22F, 4 and 23F, 5
and 6A, 5 and 6B, 5 and 7F, 5 and 9V, 5 and 14, 5 and 22F, 5 and
23F, 6A and 6B, 6A and 7F, 6A and 9V, 6A and 14, 6A and 22F, 6A and
23F, 6B and 7F, 6B and 9V, 6B and 14, 6B and 22F, 6B and 23F, 7F
and 9V, 7F and 14, 7F and 22F, 7F and 23F, 9V and 14, 9V and 22F,
9V and 23F, 14 and 22F, 14 and 23F or 22F and 23F are conjugated to
protein D.
[0096] In an embodiment, saccharides from at least serotypes 1, 3
and 4; 1, 3 and 5; 1, 3 and 6A; 1, 3 and 6B; 1, 3 and 7F; 1, 3 and
9V; 1, 3 and 14; 3, 4 and 7F; 3, 4 and 5; 3, 4 and 7F; 3, 4 and 9V;
3, 4 and 14; 4, 5 and 7F; 4, 5 and 9V; 4, 5, and 14; 5, 7F and 9V;
5, 7F and 14; 7F, 9V and 14; 1, 3, 4 and 5; 3, 4, 5 and 7F; 4, 5,
7F and 9V; 4, 5, 7F and 14; 4, 5, 9V and 14; 4, 7F, 9V and 14; 5,
7F, 9V and 14; or 4, 5, 7F, 9V and 14 are conjugated to protein
D.
[0097] In an embodiment the vaccine of the invention comprises 7
different serotypes capsular saccharide conjugates in which CRM197
is the carrier protein.
[0098] In an embodiment the vaccine of the invention comprises 7
different serotypes capsular saccharide conjugates in which protein
D is the carrier protein.
[0099] In an embodiment the vaccine of the invention comprises 10
different serotypes capsular saccharide conjugates in which CRM197
is the carrier protein.
[0100] In an embodiment the vaccine of the invention comprises 10
different serotypes capsular saccharide conjugates in which protein
D is the carrier protein.
[0101] In an embodiment the vaccine of the invention comprises 11
different serotypes capsular saccharide conjugates in which CRM197
is the carrier protein.
[0102] In an embodiment the vaccine of the invention comprises 11
different serotypes capsular saccharide conjugates in which protein
D is the carrier protein.
[0103] In an embodiment the vaccine of the invention comprises 13
different serotypes capsular saccharide conjugates in which CRM197
is the carrier protein.
[0104] In an embodiment the vaccine of the invention comprises 13
different serotypes capsular saccharide conjugates in which protein
D is the carrier protein.
[0105] In an embodiment the vaccine of the invention comprises 23
different serotypes capsular saccharide conjugates in which CRM197
is the carrier protein.
[0106] In an embodiment the vaccine of the invention comprises 23
different serotypes capsular saccharide conjugates in which protein
D is the carrier protein.
[0107] In an embodiment, the vaccine of the invention comprises
saccharide from serotypes 4, 6B, 9V, 14, 18C, 19F and. 23F
conjugated to protein D.
[0108] In an embodiment, the vaccine of the invention comprises
saccharide from serotypes 4, 6B, 9V, 14, 18C, 19F and. 23F
conjugated to CRM197.
[0109] In an embodiment, the vaccine of the invention comprises
saccharide from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A,
19F and 23F conjugated to protein D.
[0110] In an embodiment, the vaccine of the invention comprises
saccharide from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A,
19F and 23F conjugated to CRM197.
[0111] In an embodiment, the vaccine of the invention comprises
saccharide from serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F and.
23F conjugated to protein D.
[0112] In an embodiment, the vaccine of the invention comprises
saccharide from serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F and.
23F conjugated to CRM197.
[0113] In an embodiment, the vaccine of the invention comprises
saccharide from serotypes 1, 3, 4, 5, 6B, 7F, 9V, 14, 18C, 19F and
23F conjugated to protein D.
[0114] In an embodiment, the vaccine of the invention comprises
saccharide from serotypes 1, 3, 4, 5, 6B, 7F, 9V, 14, 18C, 19F and
23F conjugated to CRM197.
[0115] In an embodiment, the vaccine of the invention comprises
saccharide from serotype 1, 2, 3, 4, 5, 6B, 7F, 8, 9N, 9V, 10A,
11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F and 33F
conjugated to protein D.
[0116] In an embodiment, the vaccine of the invention comprises
saccharide from serotypes 1, 2, 3, 4, 5, 6B, 7F, 8, 9N, 9V, 10A,
11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F and 33F
conjugated to CRM197.
[0117] In an embodiment, the vaccine of the invention comprises
saccharide from serotypes 1, 4, 5, 6B, 7F, 9V, 14, and 23F
conjugated to protein D, saccharide from serotype 18C conjugated to
tetanus toxoid (TT) and saccharide from serotype 19F conjugated to
diphtheria toxoid (DT).
[0118] In an embodiment, the vaccine of the invention comprises
saccharide from serotypes 1, 4, 5, 7F, 9V, 19F and 23F conjugated
to tetanus toxoid (TT) and saccharide from serotypes 3, 14 18C and
6B conjugated to diphtheria toxoid (DT).
[0119] In an embodiment, the vaccine of the invention comprises
saccharide from serotypes 1, 4, 5, 6B, 7F, 9V, 14, and 23F
individually conjugated to protein D, saccharide from serotype 18C
conjugated to tetanus toxoid (TT) and saccharide from serotype 19F
conjugated to diphtheria toxoid (DT).
[0120] In an embodiment, the vaccine of the invention comprises
saccharide from serotypes 1, 4, 5, 7F, 9V, 19F and 23F individually
conjugated to tetanus toxoid (TT) and saccharide from serotypes 3,
14 18C and 6B conjugated to diphtheria toxoid (DT).
[0121] The term "saccharide" throughout this specification may
indicate polysaccharide or oligosaccharide and includes both.
Capsular polysaccharides of Streptococcus pneumoniae comprise
repeating oligosaccharide units which may contain up to 8 sugar
residues. For a review of the oligosaccharide units for the key
Streptococcus pneumoniae serotypes see JONES, Christopher. Vaccines
based on the cell surface carbohydrates of pathogenic bacteria. An.
Acad. Bras. Cienc, June 2005, vol. 77, no. 2, p. 293-324. Table II
ISSN 0001-3765.
[0122] Capsular saccharide antigens of the invention are prepared
by standard techniques known to those skilled in the art. Typically
polysaccharides conjugates are prepared by separate processes and
formulated into a single dosage formulation. For example, in one
embodiment, each pneumococcal polysaccharide serotype is grown in a
soy-based medium. The individual polysaccharides are then purified
through centrifugation, precipitation, ultra-filtration, and column
chromatography. The purified polysaccharides are chemically
activated to make the saccharides capable of reacting with the
carrier protein. Once activated, each capsular polysaccharide is
separately conjugated to a carrier protein to form a
glycoconjugate. In one embodiment, each capsular polysaccharide is
conjugated to the same carrier protein. In this embodiment, the
conjugation is effected by reductive amination. The chemical
activation of the polysaccharides and subsequent conjugation to the
carrier protein are achieved by conventional means. See, for
example, U.S. Pat. Nos. 4,673,574 and 4,902,506.
[0123] After conjugation of the capsular polysaccharide to the
carrier protein, the polysaccharide-protein conjugates are purified
(enriched with respect to the amount of polysaccharide-protein
conjugate) by a variety of techniques. These techniques include
concentration/diafiltration operations, precipitation/elution,
column chromatography, and depth filtration. See for examples
US2007/0184072 or WO2008/079653. After the individual
glycoconjugates are purified, they are compounded to formulate the
vaccine of the present invention. Formulation of the immunogenic
composition of the present invention can be accomplished using
art-recognized methods. For instance, the individual pneumococcal
conjugates can be formulated with a physiologically acceptable
vehicle to prepare the composition. Examples of such vehicles
include, but are not limited to, water, buffered saline, polyols
(e.g., glycerol, propylene glycol, liquid polyethylene glycol) and
dextrose solutions.
[0124] The amount of conjugate in each vaccine dose is selected as
an amount which induces an immunoprotective response without
significant, adverse side effects in typical vaccinees. Such amount
will vary depending upon which specific immunogen is employed and
how it is presented. In an embodiment, each dose comprises 0.1 to
1000 .mu.g of each saccharide or saccharide--protein conjugate,
preferably 2 to 100 .mu.g, most preferably 4 to 40 .mu.g.
[0125] In an embodiment, each dose comprises between 0.1 and 20
.mu.g, 1 and 10 .mu.g or 1 and 5 .mu.g of saccharide.
[0126] In an embodiment, the vaccine of the invention contains each
S. pneumoniae capsular saccharide at a dose of between 0.1-20
.mu.g, 0.5-10 .mu.g; 0.5-5 .mu.g or 1-5 .mu.g of saccharide. In an
embodiment, capsular saccharides may be present at different
dosages, for example some capsular saccharides may be present at a
dose of around or exactly 2 .mu.g or some capsular saccharides may
be present at a dose of around or exactly 4 .mu.g.
[0127] In a particular embodiment of the present invention, the
vaccine contains saccharide from serotypes 4, 6B, 9V, 14, 18C, 19F
and. 23F individually conjugated to CRM197 wherein each S.
pneumoniae capsular saccharide is at a dose of 2 .mu.g except for
6B which is at a dose of 4 .mu.g.
[0128] In a particular embodiment of the present invention, the
vaccine contains saccharide from serotypes 4, 6B, 9V, 14, 18C, 19F
and. 23F individually conjugated to CRM197 wherein each S.
pneumoniae capsular saccharide is at a dose of 4 .mu.g except for
6B which is at a dose of 8 .mu.g.
[0129] In a particular embodiment of the present invention, the
vaccine contains saccharide from serotypes 4, 6B, 9V, 14, 18C, 19F
and. 23F individually conjugated to CRM197 wherein each S.
pneumoniae capsular saccharide is at a dose of 6 .mu.g except for
6B which is at a dose of 12 .mu.g.
[0130] In a particular embodiment of the present invention, the
vaccine contains saccharide from serotypes 4, 6B, 9V, 14, 18C, 19F
and. 23F individually conjugated to CRM197 wherein each S.
pneumoniae capsular saccharide is at a dose of 8 .mu.g except for
6B which is at a dose of 16 .mu.g.
[0131] In a particular embodiment of the present invention, the
vaccine contains saccharide from serotypes 1, 3, 4, 5, 6A, 6B, 7F,
9V, 14, 18C, 19A, 19F, and 23F individually conjugated to CRM197
wherein each S. pneumoniae capsular saccharide is at a dose of 2
.mu.g except for 6B which is at a dose of 4 .mu.g.
[0132] In a particular embodiment of the present invention, the
vaccine contains saccharide from serotypes 1, 3, 4, 5, 6A, 6B, 7F,
9V, 14, 18C, 19A, 19F, and 23F individually conjugated to CRM197
wherein each S. pneumoniae capsular saccharide is at a dose of 4
.mu.g except for 6B which is at a dose of 8 .mu.g.
[0133] In a particular embodiment of the present invention, the
vaccine contains saccharide from serotypes 1, 3, 4, 5, 6A, 6B, 7F,
9V, 14, 18C, 19A, 19F, and 23F individually conjugated to CRM197
wherein each S. pneumoniae capsular saccharide is at a dose of 6
.mu.g except for 6B which is at a dose of 12 .mu.g.
[0134] In a particular embodiment of the present invention, the
vaccine contains saccharide from serotypes 1, 3, 4, 5, 6A, 6B, 7F,
9V, 14, 18C, 19A, 19F, and 23F individually conjugated to CRM197
wherein each S. pneumoniae capsular saccharide is at a dose of 8
.mu.g except for 6B which is at a dose of 16 .mu.g.
[0135] In a particular embodiment of the present invention, the
vaccine disclosed herein contain from 5 to 500 .mu.g, preferably 10
to 200 .mu.g, even more preferably, 20 to 100 .mu.g of CRM197
carrier protein.
[0136] In an embodiment of the present invention, the vaccine
disclosed herein contain 20 to 50 .mu.g, preferably 20 to 40 .mu.g,
even more preferably 25 to 30 .mu.g, even more preferably
approximately 28 or 29 .mu.g of CRM197 carrier protein.
[0137] In an embodiment of the present invention, the vaccine
disclosed herein contain 40 to 100 .mu.g, preferably 40 to 80
.mu.g, even more preferably 50 to 60 .mu.g, even more preferably
approximately 57 or 58 .mu.g of CRM197 carrier protein.
[0138] In a particular embodiment of the present invention, the
vaccine disclosed herein contain sodium chloride and/or sodium
succinate buffer as excipients.
[0139] In an embodiment, the pneumococcal vaccine to be used herein
is the 7-valent conjugated pneumococcal vaccine (Prevenar) or the
13-valent conjugated pneumococcal vaccine disclosed in
US2007/0184072-Prevenar 13). 7-valent Prevenar contains saccharide
from serotypes 4, 6B, 9V, 14, 18C, 19F and. 23F individually
conjugated to CRM197. 13-valent Prevenar contains saccharide from
serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F
individually conjugated to CRM197.
[0140] In an embodiment, the vaccine of the invention comprises
saccharide from serotypes 1, 4, 5, 6B, 7F, 9V, 14, and 23F
individually conjugated to protein D, saccharide from serotype 18C
conjugated to tetanus toxoid (TT) and saccharide from serotype 19F
conjugated to diphtheria toxoid (DT) wherein each S. pneumoniae
capsular saccharide is at a dose of 1 .mu.g except for 4, 18C and
19F which is at a dose of 3 .mu.g. In a particular embodiment of
the present invention, said vaccine contains from 5 to 500 .mu.g,
preferably 7 to 100 .mu.g of protein D carrier protein, from 2 to
200 .mu.g, preferably 4 to 50 .mu.g of tetanus toxoid (TT) carrier
protein and from 1 to 100 .mu.g, preferably 2 to 25 .mu.g of
diphtheria toxoid (DT) carrier protein. In a particular embodiment
of the present invention, said vaccine contains from 9 to 16 .mu.g
of protein D carrier protein, from 5 to 10 .mu.g tetanus toxoid
(TT) carrier protein and from 3 to 6 .mu.g diphtheria toxoid (DT)
carrier protein.
[0141] In an embodiment, the vaccine of the invention comprises
saccharide from serotypes 1, 4, 5, 6B, 7F, 9V, 14, and 23F
individually conjugated to protein D, saccharide from serotype 18C
conjugated to tetanus toxoid (TT) and saccharide from serotype 19F
conjugated to diphtheria toxoid (DT) wherein each S. pneumoniae
capsular saccharide is at a dose of 2 .mu.g except for 4, 18C and
19F which is at a dose of 6 .mu.g. In a particular embodiment of
the present invention, said vaccine contains from 10 to 1000 .mu.g,
preferably 14 to 200 .mu.g of protein D carrier protein, from 4 to
400 .mu.g, preferably 8 to 100 .mu.g of tetanus toxoid (TT) carrier
protein and from 2 to 200 .mu.g, preferably 4 to 50 .mu.g of
diphtheria toxoid (DT) carrier protein. In a particular embodiment
of the present invention, said vaccine contains from 18 to 32 .mu.g
of protein D carrier protein, from 10 to 20 .mu.g tetanus toxoid
(TT) carrier protein and from 6 to 12 .mu.g diphtheria toxoid (DT)
carrier protein.
[0142] In an embodiment, the vaccine of the invention comprises
saccharide from serotypes 1, 4, 5, 6B, 7F, 9V, 14, and 23F
individually conjugated to protein D, saccharide from serotype 18C
conjugated to tetanus toxoid (TT) and saccharide from serotype 19F
conjugated to diphtheria toxoid (DT) wherein each S. pneumoniae
capsular saccharide is at a dose of 3 .mu.g except for 4, 18C and
19F which is at a dose of 9 .mu.g. In a particular embodiment of
the present invention, said vaccine contains from 15 to 1500 .mu.g,
preferably 21 to 300 .mu.g of protein D carrier protein, from 6 to
600 .mu.g, preferably 12 to 150 .mu.g of tetanus toxoid (TT)
carrier protein and from 3 to 300 .mu.g, preferably 6 to 75 .mu.g
of diphtheria toxoid (DT) carrier protein. In a particular
embodiment of the present invention, said vaccine contains from 27
to 48 .mu.g of protein D carrier protein, from 15 to 30 .mu.g
tetanus toxoid (TT) carrier protein and from 9 to 18 .mu.g
diphtheria toxoid (DT) carrier protein.
[0143] In an embodiment, the vaccine of the invention comprises
saccharide from serotypes 1, 4, 5, 6B, 7F, 9V, 14, and 23F
individually conjugated to protein D, saccharide from serotype 18C
conjugated to tetanus toxoid (TT) and saccharide from serotype 19F
conjugated to diphtheria toxoid (DT) wherein each S. pneumoniae
capsular saccharide is at a dose of 4 .mu.g except for 4, 18C and
19F which is at a dose of 12 .mu.g. In a particular embodiment of
the present invention, said vaccine contains from 20 to 2000 .mu.g,
preferably 28 to 400 .mu.g of protein D carrier protein, from 8 to
800 .mu.g, preferably 16 to 200 .mu.g of tetanus toxoid (TT)
carrier protein and from 4 to 400 .mu.g, preferably 8 to 100 .mu.g
of diphtheria toxoid (DT) carrier protein. In a particular
embodiment of the present invention, said vaccine contains from 36
to 64 .mu.g of protein D carrier protein, from 20 to 40 .mu.g
tetanus toxoid (TT) carrier protein and from 12 to 24 .mu.g
diphtheria toxoid (DT) carrier protein.
[0144] In a particular embodiment of the present invention, the
vaccine disclosed herein contain sodium chloride buffer as
excipients.
[0145] In an embodiment, the pneumococcal vaccine to be used herein
is the 10-valent conjugated pneumococcal vaccine sold under the
commercial name Synflorix.TM..
Further Adjuvant(s)
[0146] In some embodiments, the pneumococcal vaccines as disclosed
herein comprise at least one, two or three adjuvant in addition to
the at least one TLR-9 agonist adjuvant disclosed herein. The term
"adjuvant" refers to a compound or mixture that enhances the immune
response to an antigen. Antigens may act primarily as a delivery
system, primarily as an immune modulator or have strong features of
both. Suitable adjuvants include those suitable for use in mammals,
including humans.
[0147] Examples of known suitable delivery-system type adjuvants
that can be used in humans include, but are not limited to, alum
(e.g., aluminum phosphate, aluminum sulfate or aluminum hydroxide),
calcium phosphate, liposomes, oil-in-water emulsions such as MF59
(4.3% w/v squalene, 0.5% w/v polysorbate 80 (Tween 80), 0.5% w/v
sorbitan trioleate (Span 85)), water-in-oil emulsions such as
Montanide, and poly(D,L-lactide-co-glycolide) (PLG) microparticles
or nanoparticles.
[0148] Examples of known suitable immune modulatory type adjuvants
that can be used in humans include, but are not limited to saponins
extracts from the bark of the Aquilla tree (QS21, Quil A), TLR4
agonists such as MPL (Monophosphoryl Lipid A), 3DMPL
(3-O-deacylated MPL) or GLA-AQ, LT/CT mutants, cytokines such as
the various interleukins (e.g., IL-2, IL-12) or GM-CSF, and the
like.
[0149] Examples of known suitable immune modulatory type adjuvants
with both delivery and immune modulatory features that can be used
in humans include, but are not limited to ISCOMS (see, e.g.,
Sjolander et al. (1998) J. Leukocyte Biol. 64:713; WO90/03184,
WO96/11711, WO 00/48630, WO98/36772, WO00/41720, WO06/134423 and
WO07/026,190) or GLA-EM which is a combination of a TLR4 agonist
and an oil-in-water emulsion.
[0150] For veterinary applications including but not limited to
animal experimentation, one can use Complete Freund's Adjuvant
(CFA), Freund's Incomplete Adjuvant (IFA), Emulsigen,
N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP),
N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP 11637, referred
to as nor-MDP),
N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-dip-
almitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (CGP 19835A,
referred to as MTP-PE), and RIBI, which contains three components
extracted from bacteria, monophosphoryl lipid A, trehalose
dimycolate and cell wall skeleton (MPL+TDM+CWS) in a 2%
squalene/Tween 80 emulsion.
[0151] Further exemplary adjuvants to enhance effectiveness of the
pneumococcal vaccines as disclosed herein include, but are not
limited to: (1) oil-in-water emulsion formulations (with or without
other specific immunostimulating agents such as muramyl peptides
(see below) or bacterial cell wall components), such as for example
(a) SAF, containing 10% Squalane, 0.4% Tween 80, 5%
pluronic-blocked polymer L121, and thr-MDP either microfluidized
into a submicron emulsion or vortexed to generate a larger particle
size emulsion, and (b) RIBI.TM. adjuvant system (RAS), (Ribi
Immunochem, Hamilton, Mont.) containing 2% Squalene, 0.2% Tween 80,
and one or more bacterial cell wall components such as
monophosphorylipid A (MPL), trehalose dimycolate (TDM), and cell
wall skeleton (CWS), preferably MPL+CWS (DETOX.TM.); (2) saponin
adjuvants, such as QS21, STIMULON.TM. (Cambridge Bioscience,
Worcester, Mass.), Abisco.RTM. (Isconova, Sweden), or
Iscomatrix.RTM. (Commonwealth Serum Laboratories, Australia), may
be used or particles generated therefrom such as ISCOMs
(immunostimulating complexes), which ISCOMS may be devoid of
additional detergent e.g. WO00/07621; (3) Complete Freund's
Adjuvant (CFA) and Incomplete Freund's Adjuvant (IFA); (4)
cytokines, such as interleukins (e.g. IL-1, IL-2, IL-4, IL-5, IL-6,
IL-7, IL-12 (WO99/44636), etc.), interferons (e.g. gamma
interferon), macrophage colony stimulating factor (M-CSF), tumor
necrosis factor (TNF), etc.; (5) monophosphoryl lipid A (MPL) or
3-O-deacylated MPL (3dMPL) (see e.g., GB-2220221, EP-A-0689454),
optionally in the substantial absence of alum when used with
pneumococcal saccharides (see e.g. WO00/56358); (6) combinations of
3dMPL with, for example, QS21 and/or oil-in-water emulsions (see
e.g. EP-A-0835318, EP-A-0735898, EP-A-0761231); (7) a
polyoxyethylene ether or a polyoxyethylene ester (see e.g.
WO99/52549); (8) a polyoxyethylene sorbitan ester surfactant in
combination with an octoxynol (WO01/21207) or a polyoxyethylene
alkyl ether or ester surfactant in combination with at least one
additional non-ionic surfactant such as an octoxynol (WO01/21152);
(9) a saponin and an immunostimulatory oligonucleotide (e.g. a CpG
oligonucleotide) (WO00/62800); (10) an immunostimulant and a
particle of metal salt (see e.g. WO00/23105); (11) a saponin and an
oil-in-water emulsion e.g. WO99/11241; (12) a saponin (e.g.
QS21)+3dMPL+IM2 (optionally+a sterol) e.g. WO98/57659; (13) other
substances that act as immunostimulating agents to enhance the
efficacy of the composition. Muramyl peptides include
N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-25
acetyl-normnuramyl-L-alanyl-D-isoglutamine (nor-MDP),
N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-dipalmitoyl-s-
n-glycero-3-hydroxyphosphoryloxy)-ethylamine MTP-PE), etc.
[0152] In a preferred embodiment, the pneumococcal vaccines as
disclosed herein comprise alum, aluminium hydroxide, aluminum
phosphate, or aluminum sulphate as additional adjuvant to the at
least one TLR-9 agonist adjuvant disclosed herein.
[0153] In a particular embodiment of the present invention, the
vaccine contains saccharide from serotypes 4, 6B, 9V, 14, 18C, 19F
and 23F individually conjugated to CRM197 wherein each S.
pneumoniae capsular saccharide is at a dose of 2 .mu.g except for
6B which is at a dose of 4 .mu.g, further comprising 0.5 mg
aluminum phosphate, and optionally sodium chloride and sodium
succinate buffer as excipients.
[0154] In a particular embodiment of the present invention, the
vaccine contains saccharide from serotypes 4, 6B, 9V, 14, 18C, 19F
and 23F individually conjugated to CRM197 wherein each S.
pneumoniae capsular saccharide is at a dose of 4 .mu.g except for
6B which is at a dose of 8 .mu.g, further comprising 1 mg aluminum
phosphate, and optionally sodium chloride and sodium succinate
buffer as excipients.
[0155] In a particular embodiment of the present invention, the
vaccine contains saccharide from serotypes 4, 6B, 9V, 14, 18C, 19F
and 23F individually conjugated to CRM197 wherein each S.
pneumoniae capsular saccharide is at a dose of 6 .mu.g except for
6B which is at a dose of 12 .mu.g, further comprising 1.5 mg
aluminum phosphate, and optionally sodium chloride and sodium
succinate buffer as excipients.
[0156] In a particular embodiment of the present invention, the
vaccine contains saccharide from serotypes 4, 6B, 9V, 14, 18C, 19F
and 23F individually conjugated to CRM197 wherein each S.
pneumoniae capsular saccharide is at a dose of 8 .mu.g except for
6B which is at a dose of 16 .mu.g, further comprising 2 mg aluminum
phosphate, and optionally sodium chloride and sodium succinate
buffer as excipients.
[0157] In a particular embodiment of the present invention, the
vaccine contains saccharide from serotypes 1, 3, 4, 5, 6A, 6B, 7F,
9V, 14, 18C, 19A, 19F, and 23F individually conjugated to CRM197
wherein each S. pneumoniae capsular saccharide is at a dose of 2
.mu.g except for 6B which is at a dose of 4 .mu.g further
comprising 0.5 mg aluminum phosphate, and optionally sodium
chloride and sodium succinate buffer as excipients.
[0158] In a particular embodiment of the present invention, the
vaccine contains saccharide from serotypes 1, 3, 4, 5, 6A, 6B, 7F,
9V, 14, 18C, 19A, 19F, and 23F individually conjugated to CRM197
wherein each S. pneumoniae capsular saccharide is at a dose of 4
.mu.g except for 6B which is at a dose of 8 .mu.g further
comprising 1 mg aluminum phosphate, and optionally sodium chloride
and sodium succinate buffer as excipients.
[0159] In a particular embodiment of the present invention, the
vaccine contains saccharide from serotypes 1, 3, 4, 5, 6A, 6B, 7F,
9V, 14, 18C, 19A, 19F, and 23F individually conjugated to CRM197
wherein each S. pneumoniae capsular saccharide is at a dose of 6
.mu.g except for 6B which is at a dose of 12 .mu.g further
comprising 1.5 mg aluminum phosphate, and optionally sodium
chloride and sodium succinate buffer as excipients.
[0160] In a particular embodiment of the present invention, the
vaccine contains saccharide from serotypes 1, 3, 4, 5, 6A, 6B, 7F,
9V, 14, 18C, 19A, 19F, and 23F individually conjugated to CRM197
wherein each S. pneumoniae capsular saccharide is at a dose of 8
.mu.g except for 6B which is at a dose of 16 .mu.g further
comprising 1.5 mg aluminum phosphate, and optionally sodium
chloride and sodium succinate buffer as excipients.
[0161] In an embodiment, the pneumococcal vaccine is the 7-valent
conjugated pneumococcal vaccine (Prevenar) or the 13-valent
conjugated pneumococcal vaccine as disclosed in US2007/0184072
(13vPnC).
Immunocompromised Subjects
[0162] In a preferred embodiment of the present invention, the
subject to be vaccinated with the vaccines of the present invention
is an immunocompromised subject. Preferably said immunocompromised
subject is a mammal, such as a cat, sheep, pig, horse, bovine, dog
or a human. In a most preferred embodiment, said subject is a
human.
[0163] An immunocompromised individual is generally defined as a
person who exhibits an attenuated or reduced ability to mount a
normal humoral or cellular defense to challenge by infectious
agents.
[0164] In an embodiment of the present invention, the
immunocompromised subject to be vaccinated with the pneumococcal
vaccine suffers from a disease or condition that impairs the immune
system and results in an antibody response that is insufficient to
protect against or treat pneumococcal disease.
[0165] In an embodiment, said disease is a primary immunodeficiency
disorder. Preferably, said primary immunodeficiency disorder is
selected from the group consisting of: combined T- and B-cell
immunodeficiencies, antibody deficiencies, well-defined syndromes,
immune dysregulation diseases, phagocyte disorders, innate immunity
deficiencies, autoinflammatory disorders, and complement
deficiencies.
[0166] In an embodiment, said combined T- and B-cell
immunodeficiency is selected from the group consisting of: .gamma.e
deficiency, JAK3 deficiency, interleukin 7 receptor chain .alpha.
deficiency, CD45 deficiency or CD3.delta./CD3.epsilon. deficiency,
RAG 1/2 deficiency, DCLRE1C deficiency, adenosine deaminase (ADA)
deficiency, reticular dysgenesis, Omenn syndrome, DNA ligase type
IV deficiency, CD40 ligand deficiency, CD40 deficiency, Purine
nucleoside phosphorylase (PNP) deficiency, MHC class II deficiency,
CD3.gamma. deficiency, CD8 deficiency, ZAP-70 deficiency, TAP-1/2
deficiency and Winged helix deficiency.
[0167] In an embodiment, said antibody deficiencies is selected
from the group consisting of: X-linked agammaglobulinemia, btk
deficiency, Bruton's agammaglobulinemia, .mu.-Heavy chain
deficiency, I 5 deficiency, Ig.alpha. deficiency, BLNK deficiency,
thymoma with immunodeficiency, common variable immunodeficiency
(CVID), ICOS deficiency, CD19 deficiency, TACI (TNFRSF13B)
deficiency, BAFF receptor deficiency, AID deficiency, UNG
deficiency, heavy chain deletions, kappa chain deficiency, isolated
IgG subclass deficiency, IgA with IgG subsclass deficiency,
selective immunoglobulin A deficiency, specific antibody deficiency
to specific antigens with normal B cell and normal Ig
concentrations, transient hypogammaglobulinemia of infancy
(THI).
[0168] In an embodiment, said well-defined syndrome is selected
from the group consisting of: Wiskott-Aldrich syndrome, ataxia
telangiectasia, ataxia-like syndrome, Nijmegen breakage syndrome,
Bloom syndrome, DiGeorge syndrome (when associated with thymic
defects), cartilage-hair hypoplasia, Schimke syndrome,
Hermansky-Pudlak syndrome type 2, Hyper-IgE syndrome, Chronic
mucocutaneous candidiasis,
[0169] In an embodiment, said immune dysregulation disease is
selected from the group consisting of: Chediak-Higashi syndrome,
Griscelli syndrome type 2, perforin deficiency, MUNC13D deficiency,
syntaxin 11 deficiency, X-linked lymphoproliferative syndrome,
autoimmune lymphoproliferative syndrome: such as type 1a (CD95
defects), type 1b (Fas ligand defects), type 2a (CASP10 defects),
type 2b (CASP8 defects), APECED (autoimmune polyendocrinopathy with
candidiasis and ectodermal dystrophy) and IPEX (immunodysregulation
polyendocrinopathy enteropathy X-linked syndrome)
[0170] In an embodiment, said phagocyte disorder is selected from
the group consisting of: ELA2 deficiency (with myelodysplasia),
GFI1 deficiency (with T/B lymphopenia), G-CSFR deficiency
(G-CSF-unresponsive), Kostmann syndrome, Cyclic neutropenia,
X-linked neutropenia/myelodysplasia, Leukocyte adhesion deficiency
types 1, 2 and 3, RAC2 deficiency, Beta-actin deficiency, Localized
juvenile periodontitis, Papillon-Lefevre syndrome, Specific granule
deficiency, Shwachman-Diamond syndrome, Chronic granulomatous
disease: X-linked and autosomal forms, Neutrophil
glucose-6-phosphate dehydrogenase deficiency, IL-12 and IL-23
.beta.1 chain deficiency, IL-12p40 deficiency, Interferon .gamma.
receptor 1 deficiency, Interferon .gamma. receptor 2 deficiency and
STAT1 deficiency (2 forms).
[0171] In an embodiment, said innate immunity deficiency is
selected from the group consisting of: Hypohidrotic ectodermal
dysplasia, NEMO deficiency, IKBA deficiency, IRAK-4 deficiency,
WHIM syndrome (warts, hypogammaglobulinaemia, infections,
myleokathexis) and Epidermodysplasia verruciform is.
[0172] In an embodiment, said autoinflammatory disorder is selected
from the group consisting of: Familial Mediterranean fever, TNF
receptor associated periodic syndrome (TRAPS), Hyper-IgD syndrome
(HIDS), CIAS1-related diseases, Muckle-Wells syndrome, Familial
cold autoinflammatory syndrome, Neonatal onset multisystem
inflammatory disease, PAPA syndrome (pyogenic sterile arthritis,
pyoderma gangrenosum, acne) and Blau syndrome.
[0173] In an embodiment, said complement deficiency is selected
from the group consisting of: C1q deficiency (lupus-like syndrome,
rheumatoid disease, infections), C1r deficiency (idem), C4
deficiency (idem), C2 deficiency (lupus-like syndrome, vasculitis,
polymyositis, pyogenic infections), C3 deficiency (recurrent
pyogenic infections), C5 deficiency (Neisserial infections, SLE),
C6 deficiency (idem), C7 deficiency (idem, vasculitis), C8a and C8b
deficiency (idem), C9 deficiency (Neisserial infections),
C1-inhibitor deficiency (hereditary angioedema), Factor I
deficiency (pyogenic infections), Factor H deficiency
(haemolytic-uraemic syndrome, membranoproliferative
glomerulonephritis), Factor D deficiency (Neisserial infections),
Properdin deficiency (Neisserial infections), MBP deficiency
(pyogenic infections) and MASP2 deficiency. In an embodiment, said
autoinflammatory disorder is selected from the group consisting of:
C1, C2, C3, and C4 deficiencies.
[0174] In an embodiment of the present invention, the
immunocompromised subject to be vaccinated suffers from a disease
that affects the immune system wherein said disease is an acquired
immunodeficiency disorder. Acquired immunodeficiency can be caused
by several factors including bacterial or viral infections (such as
HIV), cancers (such as leukaemia or myeloma), other chronic
disorder but also aging, malnutrition, or various (such as
glucocorticoids, chemotherapydrug treatments
[0175] In a particular embodiment of the present invention, the
immunocompromised subject to be vaccinated suffers from a disease
selected from the groups consisting of: HIV-infection, acquired
immunodeficiency syndrome (AIDS), cancer, chronic heart or lung
disorders, congestive heart failure, diabetes mellitus, chronic
liver disease, alcoholism, cirrhosis, spinal fluid leaks,
cardiomyopathy, chronic bronchitis, emphysema, Chronic obstructive
pulmonary disease (COPD), spleen dysfunction (such as sickle cell
disease), lack of spleen function (asplenia), blood malignancy,
leukemia, multiple myeloma, Hodgkin's disease, lymphoma, kidney
failure, nephrotic syndrome and asthma.
[0176] In a particular embodiment, the immunocompromised subject to
be vaccinated suffers from a disease selected from the groups
consisting of: spleen dysfunction (such as sickle cell disease),
lack of spleen function (asplenia), leukemia, multiple myeloma,
Hodgkin's disease and lymphoma.
[0177] In a preferred embodiment, the immunocompromised subject to
be vaccinated suffers from HIV-infection or acquired
immunodeficiency syndrome (AIDS).
[0178] In a particular embodiment, the immunocompromised subject to
be vaccinated suffers from HIV-infection or acquired
immunodeficiency syndrome (AIDS), and is under therapy, said
therapy consisting of taking at least one antiretroviral drug
selected from the group consisting of a non-nucleosied reverse
transcriptase inhibitor, a protease inhibitor and a nucleoside
analog reverse transcriptase inhibitor (e.g. abacavir). In a
particular embodiment, said therapy consists of taking at least
three drugs belonging to at least two classes of antiretroviral
drugs selected from the group consisting of non-nucleoside reverse
transcriptase inhibitor, protease inhibitor and nucleoside analog
reverse transcriptase inhibitor (e.g. abacavir). In a particular
embodiment, said therapy consists of taking at least two nucleoside
analogue reverse transcriptase inhibitors plus either a protease
inhibitor or a non-nucleoside reverse transcriptase inhibitor.
[0179] In a particular embodiment, the immunocompromised subject to
be vaccinated suffers from HIV-infection or acquired
immunodeficiency syndrome (AIDS) and is under highly active
antiretroviral therapy (HAART). In an embodiment said HAART
consists of a 3 drug regimen which includes a non-nucleoside
reverse transcriptase inhibitor, a protease inhibitor and/or a
nucleoside analog reverse transcriptase inhibitor (e.g. abacavir)
or a 2 drug regimen which includes a combination of a
non-nucleoside reverse transcriptase inhibitor and a protease
inhibitor.
[0180] In a particular embodiment, the immunocompromised subject to
be vaccinated suffers from HIV-infection or acquired
immunodeficiency syndrome (AIDS) and is not under highly active
antiretroviral therapy (HAART), or is not under antiretroviral
therapy, or said subject has never been exposed to antiretroviral
drugs.
[0181] In a particular embodiment, the immunocompromised subject to
be vaccinated is a non-viremic HIV infected patient. In another
embodiment, the immunocompromised subject to be vaccinated is a
viremic HIV infected patient.
[0182] In a particular embodiment of the present invention, the
immunocompromised subject to be vaccinated suffers from
tuberculosis or sexually transmitted diseases, e.g., syphilis or
hepatitis.
[0183] In an embodiment of the present invention, the
immunocompromised subject to be vaccinated suffers from
malnutrition.
[0184] In an embodiment of the present invention, the
immunocompromised subject to be vaccinated suffers from aging. In a
particular embodiment of the present invention, the
immunocompromised subject to be vaccinated is a human adult 55
years of age or older, more preferably a human adult 65 years of
age or older. In an embodiment, the immunocompromised subject to be
vaccinated is a human adult 70 years of age or older, 75 years of
age or older or 80 years of age or older.
[0185] In a particular embodiment of the present invention, the
immunocompromised subject to be vaccinated is taking a drug or
treatment that lowers the body's resistance to infection.
[0186] In a particular embodiment of the present invention, the
immunocompromised subject to be vaccinated is taking a drug
selected from the group consisting of chemotherapy (e.g. cancer
drugs), disease-modifying antirheumatic drugs, immunosuppressive
drugs after organ transplants and glucocorticoids.
[0187] In an embodiment of the present invention, the
immunocompromised subject to be vaccinated is taking an oral
immunosuppressant drug selected from the group consisting of:
tacrolimus (Prograf), mycophenolate mofetil (CellCept), sirolimus
(Rapamune), prednisone, cyclosoporine (Neoral, Sandimmune, Gengraf)
and azathioprine (Imuran). In an embodiment, the immunocompromised
subject is taking at least two or three of said oral
immunosuppressant drugs.
[0188] In an embodiment of the present invention, the
immunocompromised subject to be vaccinated is taking an
immunosuppressant drug selected from the group consisting of:
Everolimus, Mycophenolic acid, Corticosteroids (such as
Prednisolone or Hydrocortisone), Monoclonal anti-IL-2R.alpha.
receptor antibodies (such as Basiliximab or Daclizumab),
Anti-thymocyte globulin (ATG) and Anti-lymphocyte globulin (ALG).
In an embodiment, the immunocompromised subject is taking at least
two or three of said immunosuppressant drugs.
[0189] In a particular embodiment of the present invention, the
immunocompromised subject to be vaccinated has undergone organ
transplant, or bone marrow transplant or cochlear implantation.
[0190] In a particular embodiment of the present invention, the
immunocompromised subject to be vaccinated has undergone radiation
therapy.
[0191] In a particular embodiment of the present invention, the
immunocompromised subject to be vaccinated is a smoker.
[0192] In a particular embodiment of the present invention, the
immunocompromised subject to be vaccinated suffers from asthma and
is treated with oral corticosteroid therapy.
[0193] In a particular embodiment of the present invention, the
immunocompromised subject to be vaccinated is an Alaskan native or
an American Indian.
[0194] In a particular embodiment of the present invention, the
immunocompromised subject to be vaccinated has a white blood cell
count (leukocyte count) below 5.times.10.sup.9 cells per liter, or
below 4.times.10.sup.9 cells per liter, or below 3.times.10.sup.9
cells per liter, or below 2.times.10.sup.9 cells per liter, or
below 1.times.10.sup.9 cells per liter, or below 0.5.times.10.sup.9
cells per liter, or below 0.3.times.10.sup.9 cells per liter, or
below 0.1.times.10.sup.9 cells per liter.
[0195] White blood cell count (leukocyte count): The number of
white blood cells (WBCs) in the blood. The WBC is usually measured
as part of the CBC (complete blood count). White blood cells are
the infection-fighting cells in the blood and are distinct from the
red (oxygen-carrying) blood cells known as erythrocytes. There are
different types of white blood cells, including neutrophils
(polymorphonuclear leukocytes; PMNs), band cells (slightly immature
neutrophils), T-type lymphocytes (T cells), B-type lymphocytes (B
cells), monocytes, eosinophils, and basophils. All the types of
white blood cells are reflected in the white blood cell count. The
normal range for the white blood cell count is usually between
4,300 and 10,800 cells per cubic millimeter of blood. This can also
be referred to as the leukocyte count and can be expressed in
international units as 4.3-10.8.times.10.sup.9 cells per liter.
[0196] In a particular embodiment of the present invention, the
immunocompromised subject to be vaccinated suffers from
neutropenia. In a particular embodiment of the present invention,
the immunocompromised subject to be vaccinated has a neutrophil
count below 2.times.10.sup.9 cells per liter, or below
1.times.10.sup.9 cells per liter, or below 0.5.times.10.sup.9 cells
per liter, or below 0.1.times.10.sup.9 cells per liter, or below
0.05.times.10.sup.9 cells per liter. A low white blood cell count
or "neutropenia" is a condition characterized by abnormally low
levels of neutrophils in the circulating blood. Neutrophils are a
specific kind of white blood cell that help prevent and fight
infections. The most common reason that cancer patients experience
neutropenia is as a side effect of chemotherapy.
Chemotherapy-induced neutropenia increases a patient's risk of
infection and disrupts cancer treatment.
[0197] The fewer the neutrophils in the blood and the longer
patients remain without enough neutrophils, the more susceptible
patients are to developing a bacterial or fungal infection.
Neutrophils are a major component of antibacterial defense
mechanisms. As the neutrophil count falls below 1.0, 0.5, and
0.1.times.10.sup.9/L, the frequency of life-threatening infection
rises steeply from 10% to 19% and 28%, respectively.
[0198] In a particular embodiment of the present invention, the
immunocompromised subject to be vaccinated has a CD4+ cell count
below 500/mm.sup.3, or CD4+ cell count below 300/mm.sup.3, or CD4+
cell count below 200/mm3, CD4+ cell count below 100/mm.sup.3, CD4+
cell count below 75/mm3, or CD4+ cell count below 50/mm3.
[0199] CD4 cell tests are normally reported as the number of cells
in mm3. Normal CD4 counts are between 500 and 1600, and CD8 counts
are between 375 and 1100. CD4 counts drop dramatically in people
with HIV.
[0200] In an embodiment of the invention, any of the
immunocompromised subject disclosed herein is a human male or a
human female.
Regimen
[0201] In some cases, as little as one dose of the vaccine
according to the invention is needed, but under some circumstances,
such as conditions of greater immune deficiency, a second, third or
fourth dose may be given.
[0202] In an embodiment, a prime dose is given at day 0 and one or
more boosts are given at intervals that range from about 2 to about
24 weeks, preferably with a dosing interval of 4-8 weeks.
[0203] In an embodiment, a prime dose is given at day 0 and a boost
is given about 3 months later.
[0204] As shown in the example part, some of the shortcomings of
current vaccination can be overcome using the vaccine of the
invention. In particular the vaccine of the invention may reduce
the number of vaccinations required to achieve seroprotection,
accelerate seroconversion, possibly permitting post-exposure
vaccination, reduce the proportion of non-responders, reduce the
amount of antigen required, increase antibody avidity and
protective activity and/or lead to a more sustained antibody
levels.
[0205] These advantages are particularly interesting when treating
immunocompromised patients.
EXAMPLE
Example 1
Immune Response to Toll-Like Receptor 9-Agonist Adjuvated
Pneumococcal Vaccination in HIV-Infected Adults
[0206] A phase II study of 96 HIV infected patients has been
undertaken.
Objectives
[0207] Primary Objective: [0208] To compare numbers of vaccine high
responders--defined as 2-fold increase and IgG levels .gtoreq.1
.mu.g/mL to at least 5 of 7 pneumococcal serotypes (by quantitative
IgG measurements)--in the CpG 7909 group vs. the control group.
Secondary Objectives:
[0208] [0209] To compare the qualitative (functional) antibody
response to pneumococcal vaccination with or without CpG 7909
[0210] To evaluate safety and tolerance of CpG 7909 as a
pneumococcal vaccine adjuvant [0211] To analyse changes in
pneumococcal carrier status after pneumococcal vaccination
Main Assessment Parameters:
Efficacy:
[0212] Primary: Quantitative measurement of specific anticapsular
antibodies (7 serotypes)
[0213] Secondary: Functional activity of specific anticapsular
antibodies (pneumococcal serotypes 6B, 14, 19F and 23F); Number and
intensity of adverse and serious adverse events; Microbiological
changes in pneumococcal pharyngeal colonization; Baseline CD4-count
and measurement of sCD163
Safety/Tolerability:
[0214] Adverse events (AEs); Serious adverse events (SAEs);
Laboratory tests (hematology, clinical chemistry i.e. viral load
(HIV RNA) and CD4-count); Physical examination.
[0215] STUDY DESIGN: Placebo-controlled, randomized, double-blinded
study. TOTAL SAMPLE SIZE: 96 participants (48 per group).
[0216] TEST DRUGS AND FORMULATIONS: CpG 7909 (a synthetic Toll-like
receptor 9-agonist) formulated in PBS buffer. CPG 7909 is a B-Class
CpG ODN of sequence 5'-TCGTCGTTTTGTCGTTTTGTCGTT-3' (SEQ ID NO: 5)
and has been synthesized with a wholly phosphorothioate
backbone.
[0217] TEST DRUG DOSAGE: 1 mg CpG 7909 (100 .mu.l) mixed with each
pneumococcal vaccination.
[0218] CONTROLS: 100 .mu.l of a neutral PBS buffer (identical in
colour and viscosity to the test drug) with each pneumococcal
vaccine.
[0219] ROUTE OF ADMINISTRATION: Intramuscular injection. BLINDING:
Double-blinded study.
[0220] ENROLMENT: Randomization;
[0221] Eligible patients have been randomized in a ratio of 1:1 to
receive pneumococcal vaccination with or without CpG 7909.
[0222] Immunization:
[0223] Vaccines were kept in their original container according to
manufacturer's description and mixed with the adjuvant (CpG 7909 or
Placebo) immediately before immunization. Immunization has been
done in the left or right upper deltoid muscle at the preference of
the subject.
[0224] DURATION OF TRIAL FOR EACH PARTICIPANT: 10 months from 1st
vaccination to last follow-up.
Subject Withdrawal from the Study:
[0225] From an analysis perspective, a "withdrawal" from the study
is any subject who did not come back for the concluding visit
foreseen in the protocol.
[0226] A subject qualifies for "withdrawal" from the study when no
study procedure has occurred, no follow-up has been performed and
no further information has been collected for this subject from the
date of withdrawal/last contact.
[0227] Withdrawals has not been replaced.
Subject Withdrawal from Investigational Product
[0228] A withdrawal from the investigational product is any subject
who does not receive the complete treatment, i.e. when no further
planned dose is administered from the date of withdrawal. A subject
withdrawal from the investigational product may not necessarily be
withdrawn from the study as further study procedures or follow-up
may be performed (safety or immunogenicity) if planned in the
protocol.
Data to be Included in the Case Report Form:
[0229] Birthday, sex, race, height, weight, study number [0230]
Adverse events reported by subject including starting point and
duration (time to resolution) [0231] Positive findings during
physical examination [0232] Medical history [0233] Other
vaccinations received outside the study during the study period
[0234] Any changes in regular medication during the time of study
[0235] Pre-existing conditions or signs and/or symptoms present in
a subject prior to the start of the study/first vaccination [0236]
All laboratory findings during the time of the study
Participant Inclusion Criteria:
[0237] 1) Written informed consent and authority statement provided
according to local regulatory and ethical practice using a
participant information sheet and informed consent form approved by
the responsible Ethics Committee. 2) Male or female participants
aged >=18 years. 3) HIV-seropositive individuals
Participant Exclusion Criteria:
[0238] 1) Pregnancy as determined by a positive urine beta-hCG (if
female). 2) Participant unwilling to use reliable contraception
methods for the duration of the trial. Reliable methods of birth
control include: pharmacologic contraceptives including oral,
parenteral, and transcutaneous delivery; condoms with spermicide;
diaphragm with spermicide; surgical sterilization; vaginal ring;
intrauterine device; abstinence; and post-menopause (if female). 3)
Currently breast-feeding (if female). 4) Latest CD4 count
<200.times.10.sup.6 cells/.mu.L 5) Viral load (HIV RNA)>50
copies/mL if on HAART (defined as at least three antiretrovirals
including either a protease inhibitor or a NNRTI, i.e. combivir
300/150 mg.times.2+stocrin 600 mg.times.1 for a minimum of 6
months) 6) Previous enrollment in this study. 7) Any medical,
psychiatric, social, or occupational condition or other
responsibility that, in the judgment of the Principal Investigator
(PI), would interfere with the evaluation of study objectives (such
as severe alcohol abuse, severe drug abuse, dementia). 8) Unable to
follow protocol regimen 9) Pneumococcal vaccination 5 years or less
prior to inclusion 10) Planned participation in other vaccination
trials during the time of the study
Procedures:
[0239] Consenting participants that pass the inclusion/exclusion
criteria have been enrolled in the study. Blood samples for
baseline parameter measurements have been drawn before proceeding
to immunization. At randomization, participants has been allocated
1:1 one of two study regimens: [0240] Experimental group: Two doses
of 7-valent conjugate pneumococcal vaccination (Prevenar.RTM.,
Wyeth)+1 mg CpG 7909 (day 0), two doses of 7-valent conjugate
pneumococcal vaccination (Prevenar.RTM., Wyeth)+1 mg CpG 7909 (day
90) and one dose of 23-valent polysaccharide vaccine (Pneumo
Novum.RTM., Sanofi Pasteur MSD)+1 mg CpG 7909 (day 270) [0241]
Control group: Two doses of 7-valent conjugate pneumococcal
vaccination (Prevenar.RTM., Wyeth)+100 .mu.l of placebo (day 0),
two doses of 7-valent conjugate pneumococcal vaccination
(Prevenar.RTM., Wyeth)+100 .mu.l of placebo (day 90) and one dose
of 23-valent polysaccharide vaccine (Pneumo Novum.RTM., Sanofi
Pasteur MSD)+100 .mu.l of placebo (day 270).
[0242] Blood samples were drawn and follow-up by the physician
included physical examination and medical history, registration of
AEs (Adverse Event)/SAES (Serious Adverse Event), vaccination
history outside the study and any other information that may be
relevant to document in the CRF. A concluding visit was conducted
at day 300.
[0243] A subject who returned for the concluding visit or was
available for the concluding contact foreseen in this protocol was
considered to have completed the study.
Vaccines and Test Drug/Placebo Injections:
[0244] All subjects were dosed at 0, 90 and 270 days. All
immunizations were done in the deltoid muscle of the right or left
arm (according to the participants preference). [0245] At day 0 and
90 study participants received one intramuscular injections of
double dose Prevenar 1.0 ml+0.1 ml test drug (CpG 7909)/placebo. In
both cases, the volume injected into the arm is 1.1 ml. [0246] At
day 270 study participants receives one intramuscular injections of
0.5 ml Pneumo Novum+0.1 ml test drug (CpG 7909)/placebo. In all
cases, the volume injected into the arm is 1.1 ml.
[0247] Investigators and participants were not aware of whether
experimental or control injection was administered. The volume and
appearance of each injection product were identical.
Primary Efficacy Parameter and Analysis of Antibody Response
[0248] The study was powered to detect differences between the
experimental group and the control group in Pneumococcal vaccine
high responders defined as 2-fold increase and IgG levels .gtoreq.1
.mu.g/mL to at least 5 of 7 pneumococcal serotypes (by quantitative
IgG measurements). The study was not powered to detect differences
in the incidence of pneumonia or confirmed pneumococcal disease
invasive/non-invasive. This would require a substantial number of
participants and a longer follow-up period. The most widely used
measurement of immune response to pneumococcal vaccination is
quantitative detection of serotype specific anticapsular
antibodies. Recent data indicate that the specificity of this
method can be improved by incorporation a 22F absorption step;
thereby removing crossreacting antibodies of low avidity.
Quantitative serotype specific IgG measurements were done by
Statens Serum Institut (SSI), Copenhagen, Denmark using an ELISA
incorporating the 22F absorption step. SSI were blinded in regards
to treatment allocation.
Secondary Efficacy Parameter and Analysis of Antibody Response
[0249] Measuring the quantitative amount of serotype specific
anticapsular antibodies does not give any information the
functionality of the antibodies. This can be measured by a
flow-cytometric opsonophagocytic assay and gives indirect
information on the antibodies ability to opsonize and facilitate
killing of invading pneumococci.
[0250] Qualitative analysis was done using a flowcytometric
opsonophagocytic assay which measures functional (opsonophagocytic)
activity (OPA) of the serotype specific antibodies. In short: Eight
twofold dilutions are made in OPA buffer from 10 .mu.l of test
serum. A 20-.mu.l aliquot of either multiplex bacteria or multiplex
bead suspension containing 1.times.10.sup.5 of each of the target
pneumococcal serotype or pneumococcal polysaccharide-conjugated
beads is added to each well, and the plate is incubated for one
hour at 37.degree. C. with horizontal shaking (200 rpm). Following
this, 20 .mu.l of sterile serum from 3- to 4-week-old baby rabbit
serum (Pel-Freez, Brown Deer, Wis.) is added to each well except
for HL60 cell control wells, which receives 20 .mu.l of OPA buffer.
After incubation at 37.degree. C. for 20 min with shaking (200 rpm
on an orbital shaker), 30 .mu.l of washed HL60 polymorphonuclear
leukocytes (PMNs) (2.5.mu. 104/rd) are added to each well,
resulting in an effector-to-target ratio of 1:4 (for each target
type). The final well volume is 80 .mu.l, with the first well of a
dilution series containing a 1:8 final dilution. The plate is then
incubated for 60 min with shaking at 37.degree. C. An additional 80
.mu.l of OPA buffer is added to every well to provide sufficient
volume for flow cytometric analysis and the well contents
transferred to microtiter tubes (Bio-Rad, Hercules, Calif.). Up to
12 serum samples can be assayed per plate, including a quality
control sample. Flow analysis were done by Flow Applications, Inc,
Ill, USA 51.
Pneumococcal Carriage
[0251] Pneumococcal vaccination can affect pharyngeal carriage of
pneumococci. Pneumococcal pharyngeal colonization may also affect
the immune response to pneumococcal vaccination. Therefore it is
important to establish carrier status before and after pneumococcal
vaccination. Oropharyngeal colonization has been tested in the
posterior pharynx using a BBL culture swap (Becton Dickson
Microbiology Systems, Cockeysville, Md., USA) thru the oral cavity.
Samples were labelled with the individuals study ID number, frozen
at -20.degree. C. within few hours and later shipped to Statens
Serum Institut, where isolation, culturing and serotyping took
place. This has taken place at day 0 and again during follow-up at
day 270.
Adverse Events (AEs):
[0252] An AE is any untoward medical occurrence in a clinical
investigation subject, temporally associated with the use of a
medicinal product, whether or not considered related to the
medicinal product.
[0253] An AE can therefore be any unfavorable and unintended sign
(including an abnormal laboratory finding), symptom or disease (new
or exacerbated) temporally associated with the use of a medicinal
product.
[0254] In this study an AE has been graded according to the Common
Toxicity Criteria, version 2.0.
Serious Adverse Event (SAE) Definition:
[0255] An adverse event occurring during a clinical trial is any
undesirable experience associated with the use of a medical product
in a participant. The event is serious and will be reported to the
regulatory authority when the participant outcome is:
1. Death
2. Life-Threatening
[0256] 3. Hospitalization (initial or prolonged)
4. Disability
5. Requiring Intervention to Prevent Permanent Impairment or
Damage
[0257] 6. Congenital disorder/anomaly (for pregnant women)
Suspected Unexpected Serious Adverse Event Reaction (SUSAR)
Definition:
[0258] A Suspected Unexpected Serious Adverse Reaction (SUSAR)
occurring during the study and is to be reported: [0259] The event
must be a SAE. [0260] There must be a certain degree of probability
that the event is an adverse reaction on the administered drug.
[0261] The adverse reaction must be unexpected, that is to say, not
foreseen in the Investigator's Brochure (for an unauthorised
medicinal product).
Data Evaluation: Criteria for Evaluation of Objectives
[0262] All endpoints has been compared between the experimental
vaccine group (+CpG 7909) and the control vaccine group
(+placebo).
[0263] A substudy compared endpoints in the two (non-randomised)
treatment groups (on HAART vs. no HAART)
Primary Endpoints:
[0264] At six months after 2nd vaccination with Prevenar. [0265]
Pneumococcal vaccine high responders defined as 2-fold increase and
IgG levels .gtoreq.1 .mu.g/mL to at least 5 of 7 pneumococcal
serotypes (by quantitative IgG measurements)
Secondary Endpoints:
Immunogenicity
[0266] At three months after 1st vaccination with Prevenar. [0267]
Pneumococcal vaccine high responders defined as 2-fold increase and
IgG levels .gtoreq.1 .mu.g/mL to at least 5 of 7 pneumococcal
serotypes (by quantitative IgG measurements) [0268]
Opsonophagocytic activity for serotypes 6B, 14, 19F and 23F
expressed as titers [0269] Serotype-specific antibody response
defined as 2-fold increase and IgG levels .gtoreq.1 .mu.g/mL [0270]
Serotype-specific antibody response defined as change in IgG
levels
[0271] At six months after 2nd vaccination with Prevenar. [0272]
Opsonophagocytic activity for serotypes 6B, 14, 19F and 23F
expressed as titers [0273] Serotype-specific antibody response
defined as 2-fold increase and IgG levels .gtoreq.1 .mu.g/mL [0274]
Serotype-specific antibody response defined as change in IgG
levels
[0275] At one month after vaccination with Pneumo Novum. [0276]
Pneumococcal vaccine high responders defined as 2-fold increase and
IgG levels .gtoreq.1 .mu.g/mL to at least 5 of 7 pneumococcal
serotypes (by quantitative IgG measurements) [0277]
Opsonophagocytic activity for serotypes 6B, 14, 19F and 23F
expressed as titers [0278] Serotype-specific antibody response
defined as 2-fold increase and IgG levels .gtoreq.1 .mu.g/mL [0279]
Serotype-specific antibody response defined as change in IgG levels
[0280] Geometric Mean Antibody Concentrations With the Standard
Enzyme Immunoassay for serotypes 1, 4, 7F, 9V, 14, 18C and 19F
Pharyngeal Colonization
[0281] At six months after 2nd vaccination with Prevenar. [0282]
Number of individuals with pneumococcal colonization
Predictors of Antibody Response
[0283] At baseline. [0284] Risk factors for vaccine response at six
months after 2nd vaccination with Prevenar,
Secondary Endpoints:
Reactogenicity and Safety in all Subjects
Analysis Populations:
[0285] Safety population: all patients who received at least one
vaccination. [0286] Occurrence of solicited and general symptoms
during the 4-day (day 0 to Day 3) period after each vaccination
dose [0287] Occurrence of unsolicited symptoms up to 1 month after
each vaccination [0288] Changes in CD4-count and viral load during
the study
[0289] Safety is assessed by physical examination, adverse events
(according to common toxicity criteria version 2.0), laboratory
tests, and HIV control parameters (HIV RNA and CD4-count).
Statistical Analyses
Baseline Characteristics
[0290] Differences between study groups at day 0 will be assessed
by Mann-Whitney rank sum test (continuous variables) and Chi-square
test (dichotomous and categorical variables).
Primary Endpoint
[0291] Prevalence ratios of high responders at six months after 2nd
vaccination with Prevenar, comparing the two vaccination scheme
groups (with/without CpG 7909), has been estimated by Chi-square
test. A Poisson regression model adjusted by age, CD4 cell count at
baseline and HAART (on HAART vs. no HAART) at baseline is
planned.
Secondary Endpoints
[0292] Comparison of endpoints between the study groups has been
done by Chi-square test. A Poisson regression (dichotomous
endpoints) or linear regression (continuous endpoints), adjusted
for appropriate potential confounders is planned.
[0293] Risk factors for achieving a high vaccination response
(classified as a high responder) at six months after 2nd
vaccination with Prevenar will be estimated by multivariate Poisson
regression.
Safety Data
[0294] Safety data have been listed and compared by Chi-square
test.
Estimated Sample Size
[0295] Intention-to-treat (ITT) population: all randomized
participants
[0296] Sample size is calculated for the primary endpoint
(prevalence ratios of high responders at six months after 2nd
vaccination with Prevenar, comparing the two vaccination scheme
groups). Setting the probabilities of Type I and Type II error to:
[0297] Type I error probability (a)=0.05 (two-sided). [0298] Type
II error probability (.beta.)=0.20 (power=1-.beta.=0.80). [0299]
Primary endpoint: proportion of vaccine high responders (defined as
2-fold increase and IgG levels .mu.g/mL to at least 5 of 7
pneumococcal serotypes). [0300] N is the number of participants
needed in each group.
TABLE-US-00006 [0300] CpG Control 0.50 0.55 0.60 0.65 070 0.20 39
29 23 18 15 0.25 58 41 31 24 19 0.30 93 61 42 31 24 0.35 170 96 62
43 31 0.40 388 173 97 62 42
[0301] Assuming a prevalence of 30% in control vaccine the group
and a prevalence of 60% in the experimental vaccine group a sample
size of 42 patients per group is required to detect a difference in
prevalence estimated by Poisson regression. The expected drop-out
percentage is set to 10%. Thus, a total of 94 subjects were needed
in the study.
[0302] In accordance with the approach recommended by regulatory
authorities, the two-sided 95% confidence interval (CI) of the
immune response difference has been calculated.
Example 2
Immunogenicity and Safety of TLR9-Adjuvanted Pneumococcal Vaccines
in HIV-Infected Adults. Results of the Randomized, Double-Blind,
Placebo-Controlled Trial
[0303] The clinical trial described in example 1 was conducted.
[0304] The study was a placebo-controlled phase II trial
randomizing persons with HIV to be vaccinated with double doses of
PCV (pneumococcal conjugate vaccine) (Prevnar) .+-.1 mg CpG 7909 at
0 and 3 months and with one single dose of PPV (pneumococcal
polysaccharide vaccine) .+-.1 mg CpG 7909 at 9 months.
Immunogenicity and safety were evaluated at 0, 3, 4, 9, and 10
months. Primary endpoint was proportion of vaccine high-responders
defined as 2-fold increase and IgG levels .gtoreq.1 .mu.g/mL to at
least 5 of 7 PCV serotypes (quantitative IgG by ELISA, Statens
Serum Institute, Copenhagen, Denmark) at 9 months.
[0305] Results: As shown in table 1, 96 participants were included.
In each group of 48 participants, 38 were on ART.
TABLE-US-00007 TABLE 1 Baseline characteristics at time of
inclusion Placebo group CPG group n 48 48 Sex Male 38 (79.2) 43
(89.6) Female 10 (20.8) 5 (10.4) Race Caucasian 43 (89.6) 47 (97.9)
Non- 5 (10.4) 1 (2.1) caucasian Median age, 48.9 (42.0-59.0) 48.9
(43.0-58.8) years (IQR) Median CD4+ 617 (500-848) 673 (393-817)
cell count per ml .times.10.sup.6 (IQR) On HAART Yes 38 (79.2) 38
(79.2) No 10 (20.8) 10 (20.8) Median log On HAART .sup. 1.60 .sup.
1.60 HIV RNA, No HAART 4.47 (3.73-4.85) 4.25 (3.70-4.59) IQR
Previous 1 (2.1) 2 (4.2) PPV-23 immunization* Current smoker 17
(35.4) 18 (37.5) *>5 years prior to inclusion. IQR:
Interquartile range
[0306] As shown in table 3 and FIG. 1, the proportion of vaccine
high-responders were significantly higher in the CpG than in the
placebo adjuvant group (48.8% vs. 25.0%, p=0.018) following PCV
immunization.
[0307] Increased responses were also observed at 3 (51.1% vs.
39.6%, p=0.26), 4 (77.3% vs. 56.3%, p=0.033), and 10 (87.8% vs.
51.1%, p<0.001) months.
TABLE-US-00008 TABLE 3 Proportion of vaccine high-responders at
each time-point. n (%) Placebo group CPG group p HR Pre PCV1 yes 0
0 -- no 0 0 HR 3 months yes 19 (39.6) 24 (51.1) 0.26 post PCV1 no
29 (60.4) 23 (48.9) HR 1 month yes 27 (56.3) 34 (77.3) 0.03 post
PCV2 no 21 (43.7) 10 (22.7) HR 6 months yes 12 (25.0) 21 (48.8)
0.02 post PCV2 no 36 (75.0) 22 (51.2) HR 1 month yes 24 (51.1) 36
(87.8) <0.001 post PPV-23 no 23 (48.9) 5 (12.2) HR: pneumococcal
vaccine highresponders - defined as 2-fold increase and IgG levels
.gtoreq.1 .mu.g/mL to at least 5 of the 7 Prevnar pneumococcal
serotypes (by quantitative IgG measurements); PCV: Pneumococcal
conjugate vaccine; PPV-23: 23-valent pneumococcal polysaccharide
vaccine
[0308] FIGS. 2 and 3 show the difference in relative IgG response
for two PCV serotypes (9v and 14) between the CPG and placebo
group.
[0309] FIGS. 4 and 5 show the relative IgG response for two non-PCV
serotypes (1 and 7f) in the CPG and placebo group (as expected no
increase in IgG was observed in relation to PCV immunization).
Following PPV immunization, both groups (+/-CpG) show significant
responses. However, CpG did not increase the antibody response to
non-PCV serotypes (1 and 7f) after PPV immunization.
[0310] As shown in table 4 (pages 37-38), data on geometric mean
concentrations (GMC) of IgG antibodies revealed increasing
GMC-ratios from baseline to months 3, 4, 9 and 10 for nearly all
PCV-7-serotypes for the experimental group compared to the control
group. As expected GMC of the 3 non-PCV serotypes (1, 7F and 19A)
did not change significantly following PCV-7 immunization.
Following PPV-23 both groups experienced a 2-5 fold increase in GMC
for non-PCV-7 serotypes (lowest for serotype 19A) but there were no
significant group-differences in GMC-ratios.
TABLE-US-00009 TABLE 4 Geometric mean concentrations of IgG
antibodies and geometric mean of OPA titers of persons with HIV
receiving pneumococcal vaccines with or without CPG 7909. PCV-7
serotypes Group Pre 1.sup.st PCV-7 GM-ratio Post 1.sup.st PCV-7
GM-ratio Post 2.sup.nd PCV-7 PS 4 - IgG CPG 7909 0.53 (0.26-0.81)
1.35 (0.95-1.90) 2.26 (1.65-3.10) Control 0.39 (0.32-0.49) 0.81
(0.58-1.13) 1.26 (0.90-1.77) 1.07 (0.66-1.73) 1.48 (1.09-2.00) PS
6B - IgG CPG 7909 1.03 (0.82-1.31) 2.84 (1.96-4.12) 7.55
(5.05-11.3) Control 1.23 (0.94-1.64) 0.83 (0.58-1.20) 3.05
(2.01-4.62) 0.93 (0.54-1.62) 5.00 (3.19-7.85) PS 6B - OPA CPG 7909
8 (6-9) 66 (45-96) 268 (187-384) Control 8 (6-10) 0.93 (0.67-1.28)
82 (54-124) 0.81 (0.46-1.40) 184 (136-248) PS 9V - IgG CPG 7909
0.50 (0.42-0.60) 2.48 (1.71-3.58) 3.69 (2.65-5.15) Control 0.70
(0.51-0.97) 0.71 (0.50-1.03) 2.22 (1.52-3.25) 1.11 (0.66-1.88) 2.71
(1.91-3.86) PS 14 - IgG CPG 7909 1.92 (1.43-2.57) 9.54 (6.40-14.2)
10.03 (6.84-14.7) Control 2.38 (1.67-3.39) 0.80 (0.51-1.27) 9.99
(6.31-15.8) 0.96 (0.52-1.74) 11.2 (7.43-16.8) PS 14 - OPA CPG 7909
37 (25-54) 343 (261-454) 351 (274-449) Control 32 (22-46) 1.17
(0.69-1.98) 342 (253-462) 1.01 (0.67-1.51) 318 (249-405) PS 18C -
IgG CPG 7909 0.75 (0.61-0.93) 4.11 (2.89-5.85) 4.61 (3.33-6.37)
Control 1.00 (0.76-1.30) 0.76 (0.54-1.06) 4.59 (3.20-6.60) 0.90
(0.54-1.47) 4.88 (3.50-6.80) PS 19F - IgG CPG 7909 1.38 (1.12-1.71)
3.10 (2.36-4.07) 4.79 (3.64-6.30) Control 2.09 (1.62-2.70) 0.66
(0.48-0.92) 4.52 (3.37-6.05) 0.69 (0.46-1.02) 5.24 (3.95-6.96) PS
19fF OPA CPG 7909 25 (15-39) 428 (306-601) 329 (255-426) Control 20
(13-32) 1.21 (0.64-2.28) 359 (250-510) 1.20 (0.74-1.95) 242
(186-314) PS 23F - IgG CPG 7909 0.69 (0.57-0.83) 2.76 (1.94-3.94)
6.81 (4.89-9.48) Control 0.75 (0.61-0.92) 0.92 (0.70-1.21) 3.82
(2.52-5.79) 0.72 (0.42-1.24) 5.88 (3.85-9.00) PS 23F- OPA CPG 7909
13 (10-17) 107 (72-160) 196 (147-260) Control 11 (8-13) 1.22
(0.86-1.74) 132 (89-194) 0.81 (0.47-1.41) 173 (129-232) PCV-7
serotypes GM-ratio Pre PPV-23 GM-ratio Post PPV-23 GM-ratio PS 4 -
IgG 1.00 (0.72-1.39) 1.86 (1.34-2.57) 1.53 (1.00-2.37) 0.71
(0.53-0.96) 1.40 (0.91-2.16) 1.45 (1.07-1.96) 1.28 (0.83-1.98) PS
6B - IgG 3.55 (2.47-5.12) 5.21 (3.64-7.46) 1.51 (0.83-2.75) 2.62
(1.71-4.01) 1.36 (0.77-2.38) 4.07 (2.66-6.24) 1.28 (0.73-2.24) PS
6B - OPA 268 (195-370) 556 (399-774) 1.46 (0.92-2.31) 276 (200-379)
0.97 (0.62-1.52) 505 (377-674) 1.10 (0.72-1.70) PS 9V - IgG 1.83
(1.30-2.58) 3.50 (2.59-4.72) 1.36 (0.84-2.20) 1.41 (0.97-2.07) 1.30
(0.78-2.15) 2.63 (1.85-3.74) 1.33 (0.84-2.12) PS 14 - IgG 7.31
(4.33-9.18) 9.76 (7.16-13.3) 0.90 (0.51-1.56) 7.64 (5.13-11.4) 0.83
(0.48-1.42) 10.1 (6.96-14.7) 0.98 (0.59-1.57) PS 14 - OPA 617
(475-802) 538 (385-752) 1.10 (0.78-1.55) 576 (445-746) 1.07
(0.74-1.54) 339 (243-471) 1.62 (1.01-2.59) PS 18C - IgG 2.46
(1.75-3.47) 3.96 (3.05-5.14) 0.94 (0.60-1.49) 2.82 (2.03-3.94) 0.87
(0.54-1.40) 3.91 (2.88-5.30) 1.01 (0.68-1.51) PS 19F - IgG 2.89
(2.19-3.81) 5.57 (4.40-7.05) 0.91 (0.62-1.35) 3.10 (2.33-4.11) 0.93
(0.63-1.38) 6.30 (4.59-8.63) 0.88 (0.59-1.32) PS 19fF OPA 204
(142-293) 701 (530-926) 1.36 (0.95-1.96) 205 (147-286) 1.00
(0.61-1.61) 551 (385-789) 1.26 (0.79-2.00) PS 23F - IgG 3.36
(2.43-4.65) 5.14 (3.91-6.76) 1.16 (0.68-1.98) 2.98 (2.01-4.40) 1.13
(0.68-1.88) 4.09 (2.85-5.89) 1.25 (0.79-1.99) PS 23F- OPA 244
(184-323) 362 (246-533) 1.13 (0.75-1.69) 205 (154-273) 1.19
(0.80-1.77) 245 (171-351) 1.47 (0.87-2.48) Non-PCV-7
serotypes.sup.a Group Pre-PCV1 GM-ratio Post-PCV1 GM-ratio
Post-PCV2 PS 1 - IgG CPG 7909 0.43 (0.34-0.54) 0.38 (0.30-0.47)
0.37 (0.30-0.47) Control 0.48 (0.39-0.59) 0.88 (0.65-1.19) 0.47
(0.39-0.57) 0.80 (0.60-1.06) 0.43 (0.37-0.50) PS 7F - IgG CPG 7909
0.78 (0.58-1.05) 0.56 (0.42-0.74) 0.46 (0.34-0.62) Control 0.92
(0.72-1.19) 0.85 (0.58-1.24) 0.70 (0.54-0.90) 0.80 (0.54-1.16) 0.66
(0.53-0.84) PS 19A - IgG CPG 7909 1.55 (1.19-2.02) 2.10 (1.54-2.87)
2.58 (1.85-3.60) Control 1.73 (1.27-2.35) 0.90 (0.60-1.34) 2.34
(1.69-3.24) 0.90 (0.58-1.40) 2.81 (1.95-4.05) Non-PCV-7
serotypes.sup.a GM-ratio Pre-PPV23 GM-ratio Post-PPV23 GM-ratio PS
1 - IgG 0.37 (0.28-0.49) 1.68 (1.18-2.39) 0.87 (0.66-1.15) 0.51
(0.40-0.65) 0.73 (0.51-1.03) 2.29 (1.61-3.27) 0.73 (0.45-1.20) PS
7F - IgG 0.57 (0.40-0.82) 2.72 (1.74-4.25) 0.70 (0.48-1.00) 0.60
(0.46-0.77) 0.96 (0.63-1.47) 2.94 (2.08-4.16) 0.92 (0.53-1.60) PS
19A - IgG 1.82 (1.31-2.53) 4.09 (2.76-6.07) 0.87 (0.48-1.58) 0.92
(0.56-1.50) 1.86 (1.29-2.70) 0.98 (0.60-1.60) 4.69 (3.00-7.33)
Participants were immunized with double doses of PCV -7 (Prevnar
.RTM., Wyeth) .+-.1 mg CPG 7909 at 0 and 3 months followed by
single dose PPV -23 (Pneumo Novum .RTM., Sanofi-Pasteur MSD) .+-.1
mg CPG 7909 at 9 months. .sup.aAll included in PPV-23. OPA:
opsonophacytic activity; PS: pneumococcal serotype; GM-ratio:
geometric mean ratio; PCV-7: 7-valent pneumococccal conjugate
vaccine; PPV -23: 23-valent pneumococcal polysaccharide
vaccine;
[0311] As shown in table 2, mild systemic and injection site
reactions to PCV were more common in the CpG group (100% vs 81.3%,
p=0.002). Moderate to severe influenza-like symptoms were observed
in the CpG group after PPV.
[0312] No adverse effects on CD4+ cell count (see FIG. 6) or organ
functions occurred in either group.
TABLE-US-00010 TABLE 2 Injection-related adverse events. First PCV
Second PCV PPV-23 PCV PCV + CPG p PCV PCV + CPG p PPV-23 PPV-23 +
CPG p n (%) n = 48 n = 47 n = 48 n = 44 n = 47 n = 41 At least one
adverse event 33 (68.8) 44 (93.6) 0.002 30 (62.5) 40 (90.9) 0.001
26 (59.6) 41 (100) <0.001 injection site pain 32 (66.7) 43
(91.5) 0.003 30 (62.5) 37 (84.1) 0.02 27 (57.5) 36 (87.8) 0.002
injection site erythema 3 (6.3) 10 (21.3) 0.04 5 (10.4) 11 (25.0)
0.07 7 (14.9) 25 (61.0) <0.001 injection site bruising 6 (12.5)
18 (38.3) 0.004 7 (14.6) 16 (36.4) 0.02 9 (19.2) 27 (65.9)
<0.001 injection site itch 0 (0) 1 (2.1) 0.50 0 (0) 1 (2.3) 0.48
0 (0) 3 (7.3) 0.10 influenza-like symptoms* 3 (6.3) 17 (36.2)
<0.001 3 (6.3) 17 (38.5) <0.001 2 (4.3) 37 (90.2) <0.001
Headache 2 (4.2) 1 (2.1) 1.00 0 (0) 0 (0) 1.00 0 (0) 5 (5.7) 0.02
Nausea 2 (4.2) 1 (2.1) 1.00 0 (0) 1 (2.3) 0.48 1 (2.1) 0 (0) 1.00
*influenza-like symptoms included pyrexia, arthralgia, chills and
fatigue
[0313] Conclusions: In a population known to be hypo-responsive to
immunization the addition of CPG 7909 to a conjugate pneumococcal
vaccine greatly enhanced the proportion of vaccine high-responders.
The safety of CPG 7909 and conjugate pneumococcal vaccine (Prevnar)
was good and no adverse effects on organ functions or HIV disease
progression were observed during the trial. The combination of CPG
7909 and conjugate pneumococcal vaccine (Prevnar) was well
tolerated and adverse events were mild injection-site reactions and
influenza-like symptoms. In this trial, CPG 7909 did not appear to
increase the response to non-Prevnar serotypes following
pneumococcal polysaccharide vaccination.
Example 3
TLR9-Agonist Adjuvant Induces Cellular Memory in Response to
Pneumococcal Conjugate Vaccine in HIV-Infected Adults
[0314] We examined how CPG 7909, affected the induction of cellular
memory in response to pneumococcal conjugate vaccine.
[0315] Methods: Periferal blood mononuclear cells (PBMC) from 40
HIV-infected individuals from the double-blind, placebo-controlled
phase Ib/IIa trial of Example 1 (20 subjects in each group) were
collected at month 0 and 4 and were stored (frozen).
[0316] The Frozen PBMCs were thawed and tested for viability and
transferred to 96-well flat-bottomed tissue culture plates. The
cells were incubated overnight at 37.degree. C., and stimulated the
following day with purified pneumococcal polysaccharide (serotype
(ST) 6B and 14). After 48 hours incubation, the supernatants were
harvested and cytokine concentrations measured by Luminex. The
relative response was calculated as the ratio between cytokine
concentrations post- and pre-immunization, taking pre-existing
immunity to Streptococcus pneumoniae into account, as well as
eliminating bias from innate recognition.
[0317] Results: As shown in FIGS. 7, 8 and 9, one month after the
second pneumococcal conjugate vaccine the CPG 7909 group had a
significantly higher relative cytokine response than the
placebo-adjuvant group for IFN-gamma (ST6B): 1.22 vs. 0.82,
p=0.004; (ST14): 1.21 vs. 0.89, p=0.04; TNF-alfa (ST6B): 1.49 vs.
0.82, p=0.03; (ST14): 1.76 vs. 0.85, p=0.01); IL-6 (ST6B): 2.11 vs.
0.83, p=0.0084; (ST14): 1.64 vs. 0.81, p=0.0357), IFN-alfa (ST6B):
1.55 vs. 0.84, p=0.0014; (ST14): 1.43 vs. 0.90, p=0.0466). Cytokine
responses in the CPG 7909 group compared to the control group were
also significantly increased observed for IL-1B, 1L-2R, MIP-1alfa,
MIP-beta, MCP-1 and IP-10.
[0318] Conclusion: Our results show that among people with HIV, a
TLR9 agonist-adjuvant co-administered with pneumococcal conjugate
vaccine induced cellular memory to pneumococcal polysaccharides
which was not observed when the vaccine was administered alone.
Sequence CWU 1
1
40120DNAArtificialA class CpG oligonucleotide 1ggggacgacg
tcgtgggggg 20221DNAArtificialA class CpG oligonucleotide
2ggggacgacg tcgtgggggg g 21321DNAArtificialB class CpG
oligonucleotide 3tcgtcgtttt tcggtgcttt t 21421DNAArtificialB class
CpG oligonucleotide 4tcgtcgtttt tcggtcgttt t 21524DNAArtificialB
class CpG oligonucleotide 5tcgtcgtttt gtcgttttgt cgtt
24624DNAArtificialB class CpG oligonucleotide 6tcgtcgtttc
gtcgttttgt cgtt 24724DNAArtificialB class CpG oligonucleotide
7tcgtcgtttt gtcgtttttt tcga 24821DNAArtificialB class CpG
oligonucleotide 8tcgtcgtttt tcggtgcttt t 21921DNAArtificialB class
CpG oligonucleotide 9tcgtcgtttt tcggtcgttt t 211024DNAArtificialB
class CpG oligonucleotide 10tcgtcgtttt gtcgttttgt cgtt
241124DNAArtificialB class CpG oligonucleotide 11tcgtcgtttc
gtcgttttgt cgtt 241224DNAArtificialB class CpG oligonucleotide
12tcgtcgtttt gtcgtttttt tcga 241322DNAArtificialC class CpG
oligonucleotide 13tcgcgtcgtt cggcgcgcgc cg 221423DNAArtificialC
class CpG oligonucleotide 14tcgtcgacgt tcggcgcgcg ccg
231521DNAArtificialC class CpG oligonucleotide 15tcggacgttc
ggcgcgcgcc g 211619DNAArtificialC class CpG oligonucleotide
16tcggacgttc ggcgcgccg 191720DNAArtificialC class CpG
oligonucleotide 17tcgcgtcgtt cggcgcgccg 201820DNAArtificialC class
CpG oligonucleotide 18tcgacgttcg gcgcgcgccg 201918DNAArtificialC
class CpG oligonucleotide 19tcgacgttcg gcgcgccg
182018DNAArtificialC class CpG oligonucleotide 20tcgcgtcgtt
cggcgccg 182122DNAArtificialC class CpG oligonucleotide
21tcgcgacgtt cggcgcgcgc cg 222222DNAArtificialC class CpG
oligonucleotide 22tcgtcgtttt cggcgcgcgc cg 222322DNAArtificialC
class CpG oligonucleotide 23tcgtcgtttt cggcggccgc cg
222424DNAArtificialC class CpG oligonucleotide 24tcgtcgtttt
acggcgccgt gccg 242523DNAArtificialC class CpG oligonucleotide
25tcgtcgtttt cggcgcgcgc cgt 232622DNAArtificialC class CpG
oligonucleotide 26tcgcgtcgtt cggcgcgcgc cg 222723DNAArtificialC
class CpG oligonucleotide 27tcgtcgacgt tcggcgcgcg ccg
232821DNAArtificialC class CpG oligonucleotide 28tcggacgttc
ggcgcgcgcc g 212919DNAArtificialC class CpG oligonucleotide
29tcggacgttc ggcgcgccg 193020DNAArtificialC class CpG
oligonucleotide 30tcgcgtcgtt cggcgcgccg 203120DNAArtificialC class
CpG oligonucleotide 31tcgacgttcg gcgcgcgccg 203218DNAArtificialC
class CpG oligonucleotide 32tcgacgttcg gcgcgccg
183318DNAArtificialC class CpG oligonucleotide 33tcgcgtcgtt
cggcgccg 183422DNAArtificialC class CpG oligonucleotide
34tcgcgacgtt cggcgcgcgc cg 223522DNAArtificialC class CpG
oligonucleotide 35tcgtcgtttt cggcgcgcgc cg 223622DNAArtificialC
class CpG oligonucleotide 36tcgtcgtttt cggcggccgc cg
223724DNAArtificialC class CpG oligonucleotide 37tcgtcgtttt
acggcgccgt gccg 243823DNAArtificialC class CpG oligonucleotide
38tcgtcgtttt cggcgcgcgc cgt 233923DNAArtificialP class CpG
oligonucleotide 39tcgtcgacga tcggcgcgcg ccg 234023DNAArtificialP
class CpG oligonucleotide 40tcgtcgacga tcggcgcgcg ccg 23
* * * * *