U.S. patent application number 13/141648 was filed with the patent office on 2012-02-23 for engineered microorganisms for the production of one or more target compounds.
This patent application is currently assigned to GEVO, INC.. Invention is credited to Aristos Aristidou, Thomas Buelter, Catherine Asleson Dundon, Peter Meinhold, Christopher Smith, Jun Urano.
Application Number | 20120045809 13/141648 |
Document ID | / |
Family ID | 42288427 |
Filed Date | 2012-02-23 |
United States Patent
Application |
20120045809 |
Kind Code |
A1 |
Buelter; Thomas ; et
al. |
February 23, 2012 |
Engineered Microorganisms for the Production of One or More Target
Compounds
Abstract
The present invention provides recombinant microorganisms
comprising an isobutanol producing metabolic pathway and methods of
using said recombinant microorganisms to produce isobutanol. In
various aspects of the invention, the recombinant microorganisms
comprise isobutanol producing metabolic pathway with one or more
isobutanol pathway enzymes localized in the mitochondria. In
various embodiments described herein, the recombinant
microorganisms may be Crabtree-negative yeast microorganisms,
microorganisms of the Saccharomyces clade, Crabtree-positive yeast
microorganisms, post-WGD (whole genome duplication) yeast
microorganisms, pre-WGD (whole genome duplication) yeast
microorganisms, and non-fermenting yeast microorganisms.
Inventors: |
Buelter; Thomas; (Denver,
CO) ; Meinhold; Peter; (Denver, CO) ; Smith;
Christopher; (Englewood, CO) ; Aristidou;
Aristos; (Highlands Ranch, CO) ; Dundon; Catherine
Asleson; (Englewood, CO) ; Urano; Jun;
(Aurora, CO) |
Assignee: |
GEVO, INC.
Englewood
CO
|
Family ID: |
42288427 |
Appl. No.: |
13/141648 |
Filed: |
December 23, 2009 |
PCT Filed: |
December 23, 2009 |
PCT NO: |
PCT/US2009/069390 |
371 Date: |
October 14, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61140611 |
Dec 23, 2008 |
|
|
|
61213918 |
Jul 29, 2009 |
|
|
|
61213919 |
Jul 29, 2009 |
|
|
|
Current U.S.
Class: |
435/160 ;
435/254.2 |
Current CPC
Class: |
C12N 15/81 20130101;
C12P 7/16 20130101; Y02E 50/10 20130101; C12N 15/52 20130101 |
Class at
Publication: |
435/160 ;
435/254.2 |
International
Class: |
C12P 7/16 20060101
C12P007/16; C12N 1/19 20060101 C12N001/19 |
Claims
1. A recombinant eukaryotic microorganism capable of producing
isobutanol from a carbon source, said recombinant eukaryotic
microorganism comprising an isobutanol producing metabolic pathway,
wherein said metabolic pathway comprises enzymes catalyzing the
conversions (a-e): a) pyruvate to acetolactate; b) acetolactate to
dihydroxyisovalerate; c) dihydroxy isovalerate to ketoisovalerate;
d) ketoisovalerate to isobutyraldehyde; and e) isobutyraldehyde to
isobutanol, and wherein at least one of the conversions (a-e)
occurs in the mitochondria.
2. The recombinant eukaryotic microorganism of claim 1, wherein the
at least one conversion is (a) pyruvate to acetolactate.
3. The recombinant eukaryotic microorganism of claim 1, wherein at
least two of the conversions (a-e) occur in the mitochondria.
4. The recombinant eukaryotic microorganism of claim 1, wherein at
least three of the conversions (a-e) occur in the mitochondria.
5. The recombinant eukaryotic microorganism of claim 1, wherein at
least four of the conversions (a-e) occur in the mitochondria.
6. The recombinant eukaryotic microorganism of claim 1, wherein all
five of the conversions (a-e) occur in the mitochondria.
7. A recombinant eukaryotic microorganism capable of producing
isobutanol from a carbon source, said recombinant eukaryotic
microorganism comprising an isobutanol producing metabolic pathway,
wherein said metabolic pathway comprises at least one of the
enzymes selected from (a-f): a) acetolactate synthase (ALS); b)
ketolacid reductoisomerase (KARI); c) dihydroxy acid dehydratase
(DHAD); d) ketoisovalerate decarboxylase (KIVD); e) alcohol
dehydrogenase (ADH); and a f) branched chain amino acid
aminotransferase, and wherein at least one of the enzymes (a-f) is
overexpressed and targeted to the mitochondria.
8. The recombinant eukaryotic microorganism of claim 7, wherein the
at least one enzyme is ALS.
9. The recombinant eukaryotic microorganism of claim 7, wherein at
least two of the enzymes (a-f) are overexpressed and targeted to
the mitochondria.
10. The recombinant eukaryotic microorganism of claim 7, wherein at
least three of the enzymes (a-f) are overexpressed and targeted to
the mitochondria.
11. The recombinant eukaryotic microorganism of claim 7, wherein at
least four of the enzymes (a-f) are overexpressed and targeted to
the mitochondria.
12. The recombinant eukaryotic microorganism of claim 7, wherein
five of the enzymes (a-f) are overexpressed and targeted to the
mitochondria.
13. The recombinant eukaryotic microorganism of claim 1, wherein
said recombinant eukaryotic microorganism produces isobutanol at a
specific productivity of at least about 0.003 g/L/h/OD.
14. The recombinant eukaryotic microorganism of claim 1, wherein
said recombinant eukaryotic microorganism produces isobutanol at a
titer of at least about 2.7 g/L.
15. The recombinant eukaryotic microorganism of claim 1, wherein
said recombinant eukaryotic microorganism produces isobutanol at a
total titer of at least about 21 g/L.
16.-17. (canceled)
18. The recombinant eukaryotic microorganism of claim 1, wherein
said recombinant eukaryotic microorganism overexpresses BAT1 or
BAT2.
19.-25. (canceled)
26. The recombinant eukaryotic microorganism of claim 1, wherein
said recombinant eukaryotic microorganism is engineered to
overexpress one or more genes selected from PCK1, PYC1, PYC2, MDH2,
DIC1 and MAE1.
27. (canceled)
28. The recombinant eukaryotic microorganism of claim 1, wherein
said recombinant eukaryotic microorganism is further engineered to
express a transhydrogenase.
29. The recombinant eukaryotic microorganism of claim 28, wherein
said transhydrogenase is localized to the cytoplasmic membrane.
30. The recombinant eukaryotic microorganism of claim 28, wherein
said transhydrogenase is localized to the mitochondrial
membrane.
31. The recombinant eukaryotic microorganism of claim 28, wherein
said transhydrogenase is localized to the cytoplasmic membrane and
the mitochondrial membrane.
32. The recombinant eukaryotic microorganism of claim 28, wherein
said transhydrogenase is a mammalian transhydrogenase.
33. The recombinant eukaryotic microorganism of claim 28, wherein
said transhydrogenase is a bacterial membrane bound
transhydrogenase.
34. The recombinant eukaryotic microorganism of claim 28, wherein
said transhydrogenase is a fungal transhydrogenase.
35. The recombinant eukaryotic microorganism of claim 34, wherein
said fungal transhydrogenase is a transhydrogenase derived from
Neurospora crassa.
36.-40. (canceled)
41. The recombinant eukaryotic microorganism of claim 1, wherein
said recombinant eukaryotic microorganism is engineered to have
reduced pyruvate decarboxylase (PDC) activity.
42.-43. (canceled)
44. The recombinant eukaryotic microorganism of claim 1, wherein
said recombinant eukaryotic microorganism is engineered to have
reduced glycerol-3-phosphate dehydrogenase (GPD) activity.
45.-53. (canceled)
54. The recombinant eukaryotic microorganism of claim 1, wherein
said recombinant eukaryotic microorganism is a yeast recombinant
microorganism.
55.-69. (canceled)
70. A method of producing isobutanol, comprising the steps of: (a)
providing a recombinant eukaryotic microorganism according to claim
1: and (b) cultivating said recombinant eukaryotic microorganism in
a culture medium containing a feedstock providing a carbon source
until the isobutanol is produced.
71.-72. (canceled)
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional
Application Ser. No. 61/140,611, filed Dec. 23, 2008, U.S.
Provisional Application Ser. No. 61/213,918, filed Jul. 29, 2009,
and U.S. Provisional Application Ser. No. 61/213,919, filed Jul.
29, 2009, each of which are hereby incorporated by reference in
their entireties for all purposes.
TECHNICAL FIELD
[0002] The invention is generally related to metabolically
engineered microorganisms and methods of their use for the
production of beneficial metabolites including C3-C5 alcohols such
as isobutanol.
BACKGROUND
[0003] Biofuels have a long history ranging back to the beginning
of the 20th century. As early as 1900, Rudolf Diesel demonstrated
at the World Exhibition in Paris, France, an engine running on
peanut oil. Soon thereafter, Henry Ford demonstrated his Model T
running on ethanol derived from corn. Petroleum-derived fuels
displaced biofuels in the 1930s and 1940s due to increased supply,
and efficiency at a lower cost.
[0004] Market fluctuations in the 1970s coupled to the decrease in
US oil production led to an increase in crude oil prices and a
renewed interest in biofuels. Today, many interest groups,
including policy makers, industry planners, aware citizens, and the
financial community, are interested in substituting
petroleum-derived fuels with biomass-derived biofuels. The leading
motivations for developing biofuels are of economical, political,
and environmental nature.
[0005] One is the threat of `peak oil`, the point at which the
consumption rate of crude oil exceeds the supply rate, thus leading
to significantly increased fuel cost results in an increased demand
for alternative fuels. In addition, instability in the Middle East
and other oil-rich regions has increased the demand for
domestically produced biofuels. Also, environmental concerns
relating to the possibility of carbon dioxide related climate
change is an important social and ethical driving force which is
starting to result in government regulations and policies such as
caps on carbon dioxide emissions from automobiles, taxes on carbon
dioxide emissions, and tax incentives for the use of biofuels.
[0006] Ethanol is the most abundant fermentatively produced fuel
today but has several drawbacks when compared to gasoline. Butanol,
in comparison, has several advantages over ethanol as a fuel: it
can be made from the same feedstocks as ethanol but, unlike
ethanol, it is compatible with gasoline at any ratio and can also
be used as a pure fuel in existing combustion engines without
modifications. Unlike ethanol, butanol does not absorb water and
can thus be stored and distributed in the existing petrochemical
infrastructure. Due to its higher energy content which is close to
that of gasoline, the fuel economy (miles per gallon) is better
than that of ethanol. Also, butanol-gasoline blends have lower
vapor pressure than ethanol-gasoline blends, which is important in
reducing evaporative hydrocarbon emissions.
[0007] Isobutanol has the same advantages as butanol with the
additional advantage of having a higher octane number due to its
branched carbon chain. Isobutanol is also useful as a commodity
chemical and is also a precursor to MTBE. Isobutanol can be
produced in microorganisms expressing a heterologous metabolic
pathway, but these microorganisms are not of commercial relevance
due to their inherent low performance characteristics, which
include low productivity, low titer, low yield, and the requirement
for oxygen during the fermentation process.
[0008] The present inventors have overcome these problems by
developing metabolically engineered microorganisms that exhibit
increased isobutanol productivity, titer, and/or yield.
SUMMARY OF THE INVENTION
[0009] The present invention provides recombinant microorganisms
that comprise an isobutanol producing metabolic pathway and methods
of using said recombinant microorganisms to produce isobutanol.
[0010] In a first aspect, the invention provides recombinant
microorganisms comprising an isobutanol producing metabolic
pathway. In one embodiment, the isobutanol producing metabolic
pathway comprises enzymes catalyzing the conversions (a-e): a)
pyruvate to acetolactate; b) acetolactate to dihydroxyisovalerate;
c) dihydroxy isovalerate to ketoisovalerate; d) ketoisovalerate to
isobutyraldehyde; and e) isobutyraldehyde to isobutanol. In another
embodiment, the isobutanol producing metabolic pathway comprises at
least one of the enzymes selected from (a-f): a) acetolactate
synthase (ALS); b) ketolacid reductoisomerase (KARI); c) dihydroxy
acid dehydratese (DHAD); d) ketoisovalerate decarboxylase (KIVD);
e) alcohol dehydrogenase (ADH); and f) branched chain amino acid
aminotransferase.
[0011] In one embodiment, the recombinant microorganisms of the
present invention comprise an isobutanol producing metabolic
pathway with at least one isobutanol pathway enzyme localized in
the mitochondria. In another embodiment, the recombinant
microorganisms comprise an isobutanol producing metabolic pathway
with at least two isobutanol pathway enzymes localized in the
mitochondria. In another embodiment, the recombinant microorganisms
comprise an isobutanol producing metabolic pathway with at least
three isobutanol pathway enzymes localized in the mitochondria. In
another embodiment, the recombinant microorganisms comprise an
isobutanol producing metabolic pathway with at least four
isobutanol pathway enzymes localized in the mitochondria. In yet
another embodiment, the recombinant microorganisms comprise an
isobutanol producing metabolic pathway with five isobutanol pathway
enzymes localized in the mitochondria.
[0012] In one embodiment, the present invention provides a
recombinant eukaryotic microorganism capable of producing
isobutanol from a carbon source, said recombinant eukaryotic
microorganism comprising an isobutanol producing metabolic pathway,
wherein said metabolic pathway comprises enzymes catalyzing the
conversions (a-e): a) pyruvate to acetolactate; b) acetolactate to
dihydroxyisovalerate; c) dihydroxy isovalerate to ketoisovalerate;
d) ketoisovalerate to isobutyraldehyde; and e) isobutyraldehyde to
isobutanol, and wherein at least one of the conversions (a-e)
occurs in the mitochondria. In one embodiment, the conversion is
(a) pyruvate to acetolactate. In one embodiment, at least two of
the conversions (a-e) occur in the mitochondria. In another
embodiment, at least three of the conversions (a-e) occur in the
mitochondria. In another embodiment, at least four of the
conversions (a-e) occur in the mitochondria. In yet another
embodiment, all five of the conversions (a-e) occur in the
mitochondria.
[0013] In another embodiment, the present invention provides a
recombinant eukaryotic microorganism capable of producing
isobutanol from a carbon source, said recombinant eukaryotic
microorganism comprising an isobutanol producing metabolic pathway,
wherein said metabolic pathway comprises at least one of the
enzymes selected from (a-f): a) acetolactate synthase (ALS); b)
ketolacid reductoisomerase (KARI); c) dihydroxy acid dehydratese
(DHAD); d) ketoisovalerate decarboxylase (KIVD); e) alcohol
dehydrogenase (ADH); and a f) branched chain amino acid
aminotransferase, and wherein at least one of the enzymes (a-f) is
overexpressed and targeted to the mitochondria. In one embodiment,
the enzyme is ALS. In one embodiment, at least two of the enzymes
(a-f) are overexpressed and targeted to the mitochondria. In
another embodiment, at least three of the enzymes (a-f) are
overexpressed and targeted to the mitochondria. In another
embodiment, at least four of the enzymes (a-f) are overexpressed
and targeted to the mitochondria. In yet another embodiment, five
of the enzymes are overexpressed and targeted to the
mitochondria.
[0014] In another embodiment, the present invention provides
methods of producing isobutanol using one or more recombinant
microorganisms of the invention. In one embodiment, the method
includes cultivating one or more recombinant microorganisms in a
culture medium containing a feedstock providing the carbon source
until a recoverable quantity of the isobutanol is produced and
optionally, recovering the isobutanol. In one embodiment, the
microorganism is selected to produce isobutanol from a carbon
source at a yield of at least about 5 percent theoretical. In
another embodiment, the microorganism is selected to produce
isobutanol at a yield of at least about 10 percent, at least about
15 percent, about least about 20 percent, at least about 25
percent, at least about 30 percent, at least about 35 percent, at
least about 40 percent, at least about 45 percent, at least about
50 percent, at least about 55 percent, at least about 60 percent,
at least about 65 percent, at least about 70 percent, at least
about 75 percent, or at least about 80 percent theoretical.
[0015] In one embodiment, the recombinant microorganisms of the
invention produce isobutanol at a specific productivity of at least
about 0.003 g/L/h/OD. In another embodiment, the microorganism
produces isobutanol at a specific productivity of at least about
0.006 g/L/h/OD, at least about 0.009 g/L/h/OD, at least about 0.012
g/L/h/OD, at least about 0.015 g/L/h/OD, or at least about 0.020
g/L/h/OD.
[0016] In one embodiment, the recombinant microorganisms of the
invention produce isobutanol at a titer of at least about 2.7 g/L.
In another embodiment, the microorganism produces isobutanol at a
total titer of at least about 4 g/L, at least about 6 g/L, at least
about 8 g/L, at least about 10 g/L, or at least about 12 g/L.
[0017] In one embodiment, the recombinant microorganisms of the
invention produce isobutanol at a total titer of at least about 21
g/L. In another embodiment, the microorganism produces isobutanol
at a total titer of at least about 25 g/L, at least about 30 g/L,
at least about 35 g/L, at least about 40 g/L, or at least about 50
g/L.
[0018] In one embodiment, the present invention provides a method
of producing isobutanol, comprising the steps of (a) providing a
recombinant microorganism comprising an isobutanol producing
metabolic pathway with at least one isobutanol pathway enzyme
localized in the mitochondria, wherein said recombinant
microorganism is selected to produce isobutanol from a carbon
source at a yield of at least about 5 percent theoretical; (b)
cultivating said recombinant microorganism in a culture medium
containing a feedstock providing the carbon source until a
recoverable quantity of isobutanol is produced; and (c) recovering
the isobutanol.
[0019] In another embodiment, the present invention provides a
method of producing isobutanol, comprising the steps of (a)
providing a recombinant microorganism comprising: (i) an isobutanol
producing metabolic pathway with at least one isobutanol pathway
enzyme localized in the mitochondria, wherein said recombinant
microorganism is selected to produce isobutanol from a carbon
source; and a (ii) metabolic pathway for the conversion of a carbon
source to isobutanol which is at least partially balanced with
respect to cofactor usage; (b) cultivating said recombinant
microorganism in a culture medium containing a feedstock providing
the carbon source until a recoverable quantity of isobutanol is
produced; and (c) recovering the isobutanol.
[0020] In various embodiments described herein, the isobutanol
pathway enzyme(s) is/are selected from the group consisting of
acetolactate synthase (ALS), ketol-acid reductoisomerase (KARI),
dihydroxyacid dehydratase (DHAD), 2-keto-acid decarboxylase (KIVD),
and isobutyraldehyde dehydrogenase (IDH).
[0021] In some embodiments, the present invention provides
recombinant microorganisms that have been engineered to express a
heterologous metabolic pathway for conversion of pyruvate to
isobutanol. In one embodiment, the recombinant microorganism is
further engineered to increase the activity of a native metabolic
pathway for conversion of pyruvate to isobutanol. In another
embodiment, the recombinant microorganism is further engineered to
include at least one enzyme encoded by a heterologous gene and at
least one enzyme encoded by a native gene. In yet another
embodiment, the recombinant microorganism is selected to include a
native metabolic pathway for conversion of pyruvate to isobutanol.
In yet another embodiment, the recombinant microorganism comprises
a reduction in the activity of a native metabolic pathway as
compared to a parental microorganism. In various embodiments
described herein, one or more of the enzymes catalyzing the
conversion of pyruvate to isobutanol is/are localized in the
mitochondria.
[0022] In another embodiment, the microorganism may further be
engineered to overexpress the BAT1 gene, BAT2 gene, or both the
BAT1 and BAT2 genes.
[0023] In another embodiment, the recombinant microorganisms of the
present invention may further be engineered to reduce ethanol
production. In one embodiment, the recombinant microorganism may be
further engineered to eliminate ethanol production. In one
embodiment, the recombinant microorganism may further be engineered
to include reduced pyruvate decarboxylase (PDC) activity as
compared to a parental microorganism. In one embodiment, PDC
activity is eliminated. PDC catalyzes the decarboxylation of
pyruvate to acetaldehyde, which is reduced to ethanol by alcohol
dehydrogenases via the oxidation of NADH to NAD+. In one
embodiment, the recombinant microorganism includes a mutation in at
least one PDC gene resulting in a reduction of PDC activity of a
polypeptide encoded by said gene. In another embodiment, the
recombinant microorganism includes a partial deletion of a PDC gene
resulting in a reduction of PDC activity of a polypeptide encoded
by said gene. In another embodiment, the recombinant microorganism
comprises a complete deletion of a PDC gene resulting in a
reduction of PDC activity of a polypeptide encoded by said gene. In
yet another embodiment, the recombinant microorganism includes a
modification of the regulatory region associated with at least one
PDC gene resulting in a reduction of PDC activity of a polypeptide
encoded by said gene. In yet another embodiment, the recombinant
microorganism comprises a modification of the transcriptional
regulator resulting in a reduction of PDC gene transcription. In
yet another embodiment, the recombinant microorganism comprises
mutations in all PDC genes resulting in a reduction of PDC activity
of the polypeptides encoded by said genes.
[0024] In another embodiment, the recombinant microorganisms of the
present invention may further be engineered to reduce glycerol
production. In one embodiment the recombinant microorganism may be
further engineered to eliminate glycerol production. In one
embodiment, the recombinant microorganism may further be engineered
to include reduced glycerol-3-phosphate dehydrogenase (GPD)
activity as compared to a parental microorganism. In one
embodiment, GPD activity is eliminated. GPD catalyzes the reduction
of dihydroxyacetone phosphate (DHAP) to glycerol-3-phosphate (G3P)
via the oxidation of NADH to NAD+. Glycerol is produced from G3P by
Glycerol-3-phosphatase (GPP). In one embodiment, the recombinant
microorganism includes a mutation in at least one GPD gene
resulting in a reduction of GPD activity of a polypeptide encoded
by said gene. In another embodiment, the recombinant microorganism
includes a partial deletion of a GPD gene resulting in a reduction
of GPD activity of a polypeptide encoded by the gene. In another
embodiment, the recombinant microorganism comprises a complete
deletion of a GPD gene resulting in a reduction of GPD activity of
a polypeptide encoded by the gene. In yet another embodiment, the
recombinant microorganism includes a modification of the regulatory
region associated with at least one GPD gene resulting in a
reduction of GPD activity of a polypeptide encoded by said gene. In
yet another embodiment, the recombinant microorganism comprises a
modification of the transcriptional regulator resulting in a
reduction of GPD gene transcription. In yet another embodiment, the
recombinant microorganism comprises mutations in all GPD genes
resulting in a reduction of GPD activity of a polypeptide encoded
by the gene.
[0025] In another embodiment, the recombinant microorganism is
engineered with an isobutanol producing metabolic pathway that is
at least partially balanced with respect to cofactor usage. In one
embodiment, the isobutanol producing metabolic pathway is partially
balanced with respect to cofactor usage by providing an NADH
dependent alcohol dehydrogenase (ADH). In one embodiment, the NADH
dependent ADH is encoded by DmADH from Drosophila melanogaster. In
one embodiment, the NADH dependent ADH is encoded by adhA from
Lactococcus lactis. In another embodiment, the isobutanol producing
metabolic pathway is partially balanced with respect to cofactor
usage by providing an NADH dependent ketol-acid reductoisomerase
(KARI). In one embodiment, said KARI is engineered to have
increased activity using NADH as the cofactor as compared to the S.
cerevisiae Ilv5 protein and E. coli YqhD protein, respectively. In
one embodiment, the NADH dependent KARI is encoded by
EcilvCcoSc.sup.P2D1-A1-his6.
[0026] In another embodiment, the recombinant microorganism is
engineered with an isobutanol producing metabolic pathway that is
balanced with respect to cofactor usage. In one embodiment, said
metabolic pathway is balanced by providing an NADH dependent
pathway for the conversion of pyruvate to isobutanol comprising an
NADH dependent KARI enzyme and an NADH dependent ADH enzyme. In one
embodiment, said KARI and said ADH are engineered to have increased
activity using NADH as the cofactor as compared to the S.
cerevisiae Ilv5 protein and E. coli YqhD protein, respectively. In
another embodiment, said KARI and said ADH are identified in nature
with increased activity using NADH as the cofactor as compared to
the S. cerevisiae Ilv5 protein and E. coli YqhD protein,
respectively.
[0027] In one embodiment, the metabolic pathway is balanced with
respect to cofactor usage. In some embodiments, the metabolic
pathway is balanced with respect to cofactor usage by the malate
pathway. In additional embodiments, the metabolic pathway is
balanced with respect to cofactor usage by the expression of a
transhydrogenase. In some embodiments, the transhydrogenase is
overexpressed. In one embodiment, the transhydrogenase is localized
to the cytoplasmic membrane. In another embodiment, the
transhydrogenase is localized to the mitochondrial membrane. In yet
another embodiment, the transhydrogenase is localized to the
mitochondrial membrane and the cytoplasmic membrane. In one
embodiment, the transhydrogenase is a bacterial membrane bound
transhydrogenase. In another embodiment, the transhydrogenase is a
mammalian transhydrogenase. In yet another embodiment, the
transhydrogenase is a fungal transhydrogenase. In an exemplary
embodiment, the fungal transhydrogenase is derived from Neurospora
crassa (GI:164426165).
[0028] In one embodiment, the metabolic pathway is balanced with
respect to cofactor usage by providing an NADH dependent ADH and by
the malate pathway. In another embodiment, the metabolic pathway is
balanced with respect to cofactor usage by providing an NADH
dependent ADH and the expression of a transhydrogenase.
[0029] In another embodiment, the recombinant microorganisms are
further engineered to grow on glucose independently of C2-compounds
at a growth rate substantially equivalent to the growth rate of a
parental microorganism without altered PDC activity.
[0030] In various embodiments described herein, the microorganisms
of the invention may produce isobutanol anaerobically under
anaerobic conditions at a rate of at least about 10-fold higher
than a parental microorganism comprising a native or unmodified
metabolic pathway.
[0031] In another embodiment, the recombinant microorganism further
comprises a pathway for the fermentation of isobutanol from a
pentose sugar. In one embodiment, the pentose sugar is xylose. In
one embodiment, the recombinant microorganism is engineered to
express a functional xylose isomerase (XI). In another embodiment,
the recombinant microorganism further comprises a deletion or
disruption of a native gene encoding for an enzyme that catalyzes
the conversion of xylose to xylitol. In one embodiment, the native
gene is xylose reductase (XR). In another embodiment, the native
gene is xylitol dehydrogenase (XDH). In yet another embodiment,
both native genes are deleted or disrupted. In yet another
embodiment, the recombinant microorganism further is engineered to
overexpress either a heterologous or native gene encoding for an
enzyme that catalyzes the conversion of xylulose to
xylulose-5-phosphate.
[0032] In various embodiments described herein, the recombinant
microorganisms may be microorganisms of the Saccharomyces clade,
Saccharomyces sensu stricto group microorganisms, Crabtree-negative
yeast microorganisms, Crabtree-positive yeast microorganisms,
post-WGD (whole genome duplication) yeast microorganisms, pre-WGD
(whole genome duplication) yeast microorganisms, and non-fermenting
yeast microorganisms.
[0033] In some embodiments, the methods of the present invention
utilize a yeast recombinant microorganism of the Saccharomyces
clade.
[0034] In some embodiments, the methods of the present invention
utilize a yeast recombinant microorganism of the Saccharomyces
sensu stricto group.
[0035] In some embodiments, the methods of the present invention
utilize a Crabtree-negative recombinant yeast microorganism. In one
embodiment, the Crabtree-negative yeast microorganism is classified
into a genera selected from the group consisting of Kluyveromyces,
Pichia, Hansenula, or Candida. In additional embodiments, the
Crabtree-negative yeast microorganism is selected from
Kluyveromyces lactis, Kluyveromyces marxianus, Pichia anomala,
Pichia stipitis, Pichia kudriavzevii, Hanensula anomala, Candida
utilis and Kluyveromyces waltii.
[0036] In some embodiments, the methods of the present invention
utilize a Crabtree-positive recombinant yeast microorganism. In one
embodiment, the Crabtree-positive yeast microorganism is classified
into a genera selected from the group consisting of Saccharomyces,
Kluyveromyces, Zygosaccharomyces, Debaryomyces, Candida, Pichia and
Schizosaccharomyces. In additional embodiments, the
Crabtree-positive yeast microorganism is selected from the group
consisting of Saccharomyces cerevisiae, Saccharomyces uvarum,
Saccharomyces bayanus, Saccharomyces paradoxus, Saccharomyces
castelli, Saccharomyces kluyveri, Kluyveromyces thermotolerans,
Candida glabrata, Z. bailli, Z. rouxii, Debaryomyces hansenii,
Pichia pastorius, Schizosaccharomyces pombe, and Saccharomyces
uvarum.
[0037] In some embodiments, the methods of the present invention
utilize a post-WGD (whole genome duplication) yeast recombinant
microorganism. In one embodiment, the post-WGD yeast recombinant
microorganism is classified into a genera selected from the group
consisting of Saccharomyces or Candida. In additional embodiments,
the post-WGD yeast is selected from the group consisting of
Saccharomyces cerevisiae, Saccharomyces uvarum, Saccharomyces
bayanus, Saccharomyces paradoxus, Saccharomyces castelli, and
Candida glabrata.
[0038] In some embodiments, the methods of the present invention
utilize a pre-WGD (whole genome duplication) yeast recombinant
microorganism. In one embodiment, the pre-WGD yeast recombinant
microorganism is classified into a genera selected from the group
consisting of Saccharomyces, Kluyveromyces, Candida, Pichia,
Debaryomyces, Hansenula, Pachysolen, Yarrowia and
Schizosaccharomyces. In additional embodiments, the pre-WGD yeast
is selected from the group consisting of Saccharomyces kluyveri,
Kluyveromyces thermotolerans, Kluyveromyces marxianus,
Kluyveromyces waltii, Kluyveromyces lactis, Candida tropicalis,
Pichia pastoris, Pichia anomala, Pichia stipitis, Pichia
kudriavzevii, Debaryomyces hansenii, Hansenula anomala, Pachysolen
tannophilis, Yarrowia lipolytica, and Schizosaccharomyces
pombe.
[0039] In some embodiments, the methods of the present invention
utilize a microorganism that is a non-fermenting yeast
microorganism, including, but not limited to those, classified into
a genera selected from the group consisting of Tricosporon,
Rhodotorula, or Myxozyma.
BRIEF DESCRIPTION OF THE DRAWINGS
[0040] Illustrative embodiments of the invention are illustrated in
the drawings, in which:
[0041] FIG. 1 illustrates an exemplary metabolic pathway for the
conversion of glucose to isobutanol via pyruvate.
[0042] FIG. 2 illustrates an exemplary metabolic pathway for the
mitochondrial conversion of glucose to isobutanol via pyruvate.
[0043] FIG. 3 illustrates the cofactor balance of an isobutanol
producing yeast strain achieved by use of NADH dependent KARI and
ADH.
[0044] FIG. 4 illustrates the cofactor balance of an isobutanol
producing yeast strain achieved by use of NADH dependent KARI and
ADH.
[0045] FIG. 5 illustrates the cofactor balance of an isobutanol
producing yeast strain achieved by use of the malate bypass.
[0046] FIG. 6 illustrates the cofactor balance of an isobutanol
producing yeast strain achieved by use of the malate bypass and a
NADH dependent ADH.
[0047] FIG. 7 illustrates the cofactor balance of an isobutanol
producing yeast strain achieved by use of a transhydrogenase.
[0048] FIG. 8 illustrates the cofactor balance of an isobutanol
producing yeast strain achieved by use of a transhydrogenase and a
NADH dependent ADH.
[0049] FIG. 9 illustrates the results of fermentations using
GEVO2062 and GEVO2072. Shown are isobutanol production, ethanol
production, glucose consumption, and cell density (OD.sub.600) over
time. Shown are the averages and standard deviations of three
replicate shake flasks for each strain.
[0050] FIG. 10 illustrates a proposed mitochondrial/cytosolic
isobutanol pathway.
[0051] FIG. 11 shows the isobutanol production of four GEVO2072
transformant combinations.
[0052] FIGS. 12a-b illustrate titers of isobutanol (a) and (b)
ethanol during shake flask fermentation experiments with GEVO1947
and eight transformants, including GEVO2087 (Transformant #10) and
GEVO2088 (Transformant #7).
[0053] FIGS. 13a-b illustrate the production of (a) isobutanol and
(b) ethanol in GEVO2087 and GEVO2072 compared to the negative
control strains, GEVO1947 and GEVO1186, respectively.
[0054] FIG. 14 shows the isobutanol production in fermentations
using GEVO2087, GEVO1969, GEVO2276, and GEVO2277. Isobutanol was
measured after 0, 4.5, 8, 24, 49.5, and 71 hours incubation. The
strains were GEVO2087 (PDC+, PATHWAY+), GEVO1969 (Pdc-minus,
PATHWAY-), GEVO2276 (Pdc-minus, PATHWAY+, BsalsS-minus), and
GEVO2277 (PDC+, PATHWAY+). The values are volume corrected.
DETAILED DESCRIPTION
Definitions
[0055] As used herein and in the appended claims, the singular
forms "a," "an," and "the" include plural referents unless the
context clearly dictates otherwise. Thus, for example, reference to
"a polynucleotide" includes a plurality of such polynucleotides and
reference to "the microorganism" includes reference to one or more
microorganisms, and so forth.
[0056] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood to one of
ordinary skill in the art to which this disclosure belongs.
Although methods and materials similar or equivalent to those
described herein can be used in the practice of the disclosed
methods and compositions, the exemplary methods, devices and
materials are described herein.
[0057] Any publications discussed above and throughout the text are
provided solely for their disclosure prior to the filing date of
the present application. Nothing herein is to be construed as an
admission that the inventors are not entitled to antedate such
disclosure by virtue of prior disclosure.
[0058] The term "microorganism" includes prokaryotic and eukaryotic
microbial species from the Domains Archaea, Bacteria and Eucarya,
the latter including yeast and filamentous fungi, protozoa, algae,
or higher Protista. The terms "microbial cells" and "microbes" are
used interchangeably with the term microorganism. The term
"prokaryotes" is art recognized and refers to cells which contain
no nucleus or other cell organelles. The prokaryotes are generally
classified in one of two domains, the Bacteria and the Archaea. The
definitive difference between organisms of the Archaea and Bacteria
domains is based on fundamental differences in the nucleotide base
sequence in the 16S ribosomal RNA.
[0059] The term "algae" means a eukaryotic microorganism that
contains a chloroplast, and optionally that is capable of
performing photosynthesis, or a prokaryotic microorganism capable
of performing photosynthesis. Algae include obligate
photoautotrophs, which cannot metabolize a fixed carbon source as
energy, as well as heterotrophs, which can live solely off of a
fixed carbon source. Algae can refer to unicellular organisms that
separate from sister cells shortly after cell division, such as
Chlamydomonas, and can also refer to microorganisms such as, for
example, Volvox, which is a simple multicellular photosynthetic
microbe of two distinct cell types. "Algae" can also refer to cells
such as Chlorella and Dunaliella. "Algae" also includes other
photosynthetic microorganisms that exhibit cell-cell adhesion, such
as Agmenellum, Anabaena, and Pyrobotrys. "Algae" also includes
obligate heterotrophic microorganisms that have lost the ability to
perform photosynthesis, such as certain dinoflagellate algae
species.
[0060] The term "Archaea" refers to a categorization of organisms
of the division Mendosicutes, typically found in unusual
environments and distinguished from the rest of the prokaryotes by
several criteria, including the number of ribosomal proteins and
the lack of muramic acid in cell walls. On the basis of ssrRNA
analysis, the Archaea consist of two phylogenetically-distinct
groups: Crenarchaeota and Euryarchaeota. On the basis of their
physiology, the Archaea can be organized into three types:
methanogens (prokaryotes that produce methane); extreme halophiles
(prokaryotes that live at very high concentrations of salt (NaCl);
and extreme (hyper) thermophilus (prokaryotes that live at very
high temperatures). Besides the unifying archaeal features that
distinguish them from Bacteria (i.e., no murein in cell wall,
ester-linked membrane lipids, etc.), these prokaryotes exhibit
unique structural or biochemical attributes which adapt them to
their particular habitats. The Crenarchaeota consists mainly of
hyperthermophilic sulfur-dependent prokaryotes and the
Euryarchaeota contains the methanogens and extreme halophiles.
[0061] "Bacteria" or "eubacteria" refers to a domain of prokaryotic
organisms. Bacteria include at least 11 distinct groups as follows:
(1) Gram-positive (gram+) bacteria, of which there are two major
subdivisions: (1) high G+C group (Actinomycetes, Mycobacteria,
Micrococcus, others) (2) low G+C group (Bacillus, Clostridia,
Lactobacillus, Staphylococci, Streptococci, Mycoplasmas); (2)
Proteobacteria, e.g., Purple photosynthetic+non-photosynthetic
Gram-negative bacteria (includes most "common" Gram-negative
bacteria); (3) Cyanobacteria, e.g., oxygenic phototrophs; (4)
Spirochetes and related species; (5) Planctomyces; (6) Bacteroides,
Flavobacteria; (7) Chlamydia; (8) Green sulfur bacteria; (9) Green
non-sulfur bacteria (also anaerobic phototrophs); (10)
Radioresistant micrococci and relatives; (11) Thermotoga and
Thermosipho thermophiles.
[0062] "Gram-negative bacteria" include cocci, nonenteric rods, and
enteric rods. The genera of Gram-negative bacteria include, for
example, Neisseria, Spirillum, Pasteurella, Brucella, Yersinia,
Francisella, Haemophilus, Bordetella, Escherichia, Salmonella,
Shigella, Klebsiella, Proteus, Vibrio, Pseudomonas, Bacteroides,
Acetobacter, Aerobacter, Agrobacterium, Azotobacter, Spirilla,
Serratia, Vibrio, Rhizobium, Chlamydia, Rickettsia, Treponema, and
Fusobacterium.
[0063] "Gram positive bacteria" include cocci, nonsporulating rods,
and sporulating rods. The genera of gram positive bacteria include,
for example, Actinomyces, Bacillus, Clostridium, Corynebacterium,
Erysipelothrix, Lactobacillus, Listeria, Mycobacterium, Myxococcus,
Nocardia, Staphylococcus, Streptococcus, and Streptomyces.
[0064] The term "genus" is defined as a taxonomic group of related
species according to the Taxonomic Outline of Bacteria and Archaea
(Garrity, G. M., Lilburn, T. G., Cole, J. R., Harrison, S. H.,
Euzeby, J., and Tindall, B. J. (2007) The Taxonomic Outline of
Bacteria and Archaea. TOBA Release 7.7, March 2007. Michigan State
University Board of Trustees.
[http://www.taxonomicoutline.org/]).
[0065] The term "species" is defined as a collection of closely
related organisms with greater than 97% 16S ribosomal RNA sequence
homology and greater than 70% genomic hybridization and
sufficiently different from all other organisms so as to be
recognized as a distinct unit.
[0066] The term "recombinant microorganism" and "recombinant host
cell" are used interchangeably herein and refer to microorganisms
that have been genetically modified to express or over-express
endogenous polynucleotides, or to express heterologous
polynucleotides, such as those included in a vector, or which have
a reduction in expression of an endogenous gene. The polynucleotide
generally encodes a target enzyme involved in a metabolic pathway
for producing a desired metabolite. It is understood that the terms
"recombinant microorganism" and "recombinant host cell" refer not
only to the particular recombinant microorganism but to the progeny
or potential progeny of such a microorganism. Because certain
modifications may occur in succeeding generations due to either
mutation or environmental influences, such progeny may not, in
fact, be identical to the parent cell, but are still included
within the scope of the term as used herein.
[0067] The term "wild-type microorganism" describes a cell that
occurs in nature, i.e. a cell that has not been genetically
modified. A wild-type microorganism can be genetically modified to
express or overexpress a first target enzyme. This microorganism
can act as a parental microorganism in the generation of a
microorganism modified to express or overexpress a second target
enzyme. In turn, the microorganism modified to express or
overexpress a first and a second target enzyme can be modified to
express or overexpress a third target enzyme.
[0068] Accordingly, a "parental microorganism" functions as a
reference cell for successive genetic modification events. Each
modification event can be accomplished by introducing a nucleic
acid molecule in to the reference cell. The introduction
facilitates the expression or over-expression of a target enzyme.
It is understood that the term "facilitates" encompasses the
activation of endogenous polynucleotides encoding a target enzyme
through genetic modification of e.g., a promoter sequence in a
parental microorganism. It is further understood that the term
"facilitates" encompasses the introduction of heterologous
polynucleotides encoding a target enzyme in to a parental
microorganism.
[0069] The term "engineer" refers to any manipulation of a
microorganism that result in a detectable change in the
microorganism, wherein the manipulation includes but is not limited
to inserting a polynucleotide and/or polypeptide heterologous to
the microorganism and mutating a polynucleotide and/or polypeptide
native to the microorganism.
[0070] As used herein, the term "metabolically engineered" or
"metabolic engineering" involves rational pathway design and
assembly of biosynthetic genes, genes associated with operons, and
control elements of such polynucleotides, for the production of a
desired metabolite. "Metabolically engineered" can further include
optimization of metabolic flux by regulation and optimization of
transcription, translation, protein stability and protein
functionality using genetic engineering and appropriate culture
condition including the reduction of, disruption, or knocking out
of, a competing metabolic pathway that competes with an
intermediate leading to a desired pathway.
[0071] The terms "metabolically engineered microorganism" and
"modified microorganism" are used interchangeably herein and refer
not only to the particular subject cell but to the progeny or
potential progeny of such a cell. Because certain modifications may
occur in succeeding generations due to either mutation or
environmental influences, such progeny may not, in fact, be
identical to the parent cell, but are still included within the
scope of the term as used herein.
[0072] The term "mutation" as used herein indicates any
modification of a nucleic acid and/or polypeptide which results in
an altered nucleic acid or polypeptide. Mutations include, for
example, point mutations, deletions, or insertions of single or
multiple residues in a polynucleotide, which includes alterations
arising within a protein-encoding region of a gene as well as
alterations in regions outside of a protein-encoding sequence, such
as, but not limited to, regulatory or promoter sequences. A genetic
alteration may be a mutation of any type. For instance, the
mutation may constitute a point mutation, a frame-shift mutation,
an insertion, or a deletion of part or all of a gene. In addition,
in some embodiments of the modified microorganism, a portion of the
microorganism genome has been replaced with a heterologous
polynucleotide. In some embodiments, the mutations are
naturally-occurring. In other embodiments, the mutations are the
results of artificial mutation pressure. In still other
embodiments, the mutations in the microorganism genome are the
result of genetic engineering.
[0073] The term "biosynthetic pathway", also referred to as
"metabolic pathway", refers to a set of anabolic or catabolic
biochemical reactions for converting one chemical species into
another. Gene products belong to the same "metabolic pathway" if
they, in parallel or in series, act on the same substrate, produce
the same product, or act on or produce a metabolic intermediate
(i.e., metabolite) between the same substrate and metabolite end
product.
[0074] The term "heterologous" as used herein with reference to
molecules and in particular enzymes and polynucleotides, indicates
molecules that are expressed in an organism other than the organism
from which they originated or are found in nature, independently on
the level of expression that can be lower, equal or higher than the
level of expression of the molecule in the native
microorganism.
[0075] On the other hand, the term "native" or "endogenous" as used
herein with reference to molecules, and in particular enzymes and
polynucleotides, indicates molecules that are expressed in the
organism in which they originated or are found in nature,
independently on the level of expression that can be lower equal or
higher than the level of expression of the molecule in the native
microorganism. It is understood that expression of native enzymes
or polynucleotides may be modified in recombinant
microorganisms.
[0076] The term "overexpressed" as used herein with reference to a
gene indicates that the gene is expressed differently than in its
native wild-type microorganism. Overexpressed genes include
heterologous as well as native genes. Any engineering of a strain
that leads to a change in the expression level of a native gene or
that leads to a change in the regulation of said native gene
renders said native gene "overexpressed."
[0077] The term "mitochondrially targeted" as used herein refers to
proteins that are completely or partially localized in the
mitochondria of their host microorganism. This term can refer to
proteins that are produced in their native form or it can refer to
proteins that have been engineered to cause their mitochondrial
localization.
[0078] The term "carbon source" generally refers to a substance
suitable to be used as a source of carbon for eukaryotic cell
growth. Carbon sources include, but are not limited to, biomass
hydrolysates, starch, sucrose, cellulose, hemicellulose, xylose,
and lignin, as well as monomeric components of these substrates.
Carbon sources can comprise various organic compounds in various
forms, including, but not limited to polymers, carbohydrates,
acids, alcohols, aldehydes, ketones, amino acids, peptides, etc.
These include, for example, various monosaccharides such as
glucose, dextrose (D-glucose), maltose, oligosaccharides,
polysaccharides, saturated or unsaturated fatty acids, succinate,
lactate, acetate, ethanol, etc., or mixtures thereof.
Photosynthetic organisms can additionally produce a carbon source
as a product of photosynthesis. In some embodiments, carbon sources
may be selected from biomass hydrolysates and glucose.
[0079] As used herein, the term "C2-compound" refers to organic
compounds comprised of two carbon atoms, including but not limited
to ethanol and acetate. As used herein, a "C2-independent organism"
encompasses organisms that do not require ethanol or acetate for
growth. Such a C2-independent organism may grow on glucose.
[0080] The term "feedstock" is defined as a raw material or mixture
of raw materials supplied to a microorganism or fermentation
process from which other products can be made. For example, a
carbon source, such as biomass or the carbon compounds derived from
biomass are a feedstock for a microorganism that produces a biofuel
in a fermentation process. However, a feedstock may contain
nutrients other than a carbon source.
[0081] The term "substrate" or "suitable substrate" refers to any
substance or compound that is converted or meant to be converted
into another compound by the action of an enzyme. The term includes
not only a single compound, but also combinations of compounds,
such as solutions, mixtures and other materials which contain at
least one substrate, or derivatives thereof. Further, the term
"substrate" encompasses not only compounds that provide a carbon
source suitable for use as a starting material, such as any biomass
derived sugar, but also intermediate and end product metabolites
used in a pathway associated with a metabolically engineered
microorganism as described herein.
[0082] The term "fermentation" or "fermentation process" is defined
as a process in which a microorganism is cultivated in a culture
medium containing raw materials, such as feedstock and nutrients,
wherein the microorganism converts raw materials, such as a
feedstock, into products.
[0083] The term "cell dry weight" or "CDW" refers to the weight of
the microorganism after the water contained in the microorganism
has been removed using methods known to one skilled in the art. CDW
is reported in g/L.
[0084] The term "biofuel" refers to a fuel in which all carbon
contained within the fuel is derived from biomass and is
biochemically converted, at least in part, in to a fuel by a
microorganism. A biofuel is further defined as a non-ethanol
compound which contains less than 0.5 oxygen atoms per carbon atom.
A biofuel is a fuel in its own right, but may be blended with
petroleum-derived fuels to generate a fuel. A biofuel may be used
as a replacement for petrochemically-derived gasoline, diesel fuel,
or jet fuel.
[0085] The term "volumetric productivity" or "production rate" is
defined as the amount of product formed per volume of medium per
unit of time. Volumetric productivity is reported in gram per liter
per hour (g/L/h).
[0086] The term "specific productivity" is defined as the rate of
formation of the product. To describe productivity as an inherent
parameter of the microorganism and not of the fermentation process,
productivity is herein further defined as the specific productivity
in gram product per gram of cell dry weight (CDW) per hour (g/g
CDW/h). Using the relation of CDW to OD.sub.600 for the given
microorganism specific productivity can also be expressed as gram
product per liter culture medium per optical density of the culture
broth at 600 nm (OD) per hour (g/L/h/OD)
[0087] The term "yield" is defined as the amount of product
obtained per unit weight of raw material and may be expressed as g
product per g substrate (g/g). Yield may be expressed as a
percentage of the theoretical yield. "Theoretical yield" is defined
as the maximum amount of product that can be generated per a given
amount of substrate as dictated by the stoichiometry of the
metabolic pathway used to make the product. For example, the
theoretical yield for one typical conversion of glucose to
isobutanol is 0.41 g/g. As such, a yield of butanol from glucose of
0.39 g/g would be expressed as 95% of theoretical or 95%
theoretical yield.
[0088] The term "titre" or "titer" is defined as the strength of a
solution or the concentration of a substance in solution. For
example, the titre of a biofuel in a fermentation broth is
described as g of biofuel in solution per liter of fermentation
broth (g/L).
[0089] The term "total titer" is defined as the sum of all biofuel
produced in a process, including but not limited to the biofuel in
solution, the biofuel in gas phase, and any biofuel removed from
the process and recovered relative to the initial volume in the
process or the operating volume in the process.
[0090] A "facultative anaerobic organism" or a "facultative
anaerobic microorganism" is defined as an organism that can grow in
either the presence or in the absence of oxygen.
[0091] A "strictly anaerobic organism" or a "strictly anaerobic
microorganism" is defined as an organism that cannot grow in the
presence of oxygen and which does not survive exposure to any
concentration of oxygen.
[0092] An "anaerobic organism" or an "anaerobic microorganism" is
defined as an organism that cannot grow in the presence of
oxygen.
[0093] "Aerobic conditions" are defined as conditions under which
the oxygen concentration in the fermentation medium is sufficiently
high for an aerobic or facultative anaerobic microorganism to use
as a terminal electron acceptor.
[0094] In contrast, "Anaerobic conditions" are defined as
conditions under which the oxygen concentration in the fermentation
medium is too low for the microorganism to use as a terminal
electron acceptor. Anaerobic conditions may be achieved by sparging
a fermentation medium with an inert gas such as nitrogen until
oxygen is no longer available to the microorganism as a terminal
electron acceptor. Alternatively, anaerobic conditions may be
achieved by the microorganism consuming the available oxygen of the
fermentation until oxygen is unavailable to the microorganism as a
terminal electron acceptor.
[0095] "Dissolved oxygen," abbreviated as "DO" is expressed
throughout as the percentage of saturating concentration of oxygen
in water.
[0096] "Aerobic metabolism" refers to a biochemical process in
which oxygen is used as a terminal electron acceptor to make
energy, typically in the form of ATP, from carbohydrates. Aerobic
metabolism occurs e.g. via glycolysis and the TCA cycle, wherein a
single glucose molecule is metabolized completely into carbon
dioxide in the presence of oxygen.
[0097] In contrast, "anaerobic metabolism" refers to a biochemical
process in which oxygen is not the final acceptor of electrons
contained in NADH. Anaerobic metabolism can be divided into
anaerobic respiration, in which compounds other than oxygen serve
as the terminal electron acceptor, and substrate level
phosphorylation, in which the electrons from NADH are utilized to
generate a reduced product via a "fermentative pathway."
[0098] In "fermentative pathways", NAD(P)H donates its electrons to
a molecule produced by the same metabolic pathway that produced the
electrons carried in NAD(P)H. For example, in one of the
fermentative pathways of certain yeast strains, NAD(P)H generated
through glycolysis transfers its electrons to pyruvate, yielding
lactate. Fermentative pathways are usually active under anaerobic
conditions but may also occur under aerobic conditions, under
conditions where NADH is not fully oxidized via the respiratory
chain. For example, above certain glucose concentrations, Crabtree
positive yeasts produce large amounts of ethanol under aerobic
conditions.
[0099] The term "fermentation product" means any main product plus
its coupled product. A "coupled product" is produced as part of the
stoichiometric conversion of the carbon source to the main
fermentation product. An example for a coupled product is the two
molecules of CO.sub.2 that are produced with every molecule of
isobutanol during production of isobutanol from glucose according
the biosynthetic pathway described herein.
[0100] The term "byproduct" means an undesired product related to
the production of a biofuel. Byproducts are generally disposed as
waste, adding cost to a biofuel production process.
[0101] The term "co-product" means a secondary or incidental
product related to the production of biofuel. Co-products have
potential commercial value that increases the overall value of
biofuel production, and may be the deciding factor as to the
viability of a particular biofuel production process.
[0102] The term "non-fermenting yeast" is a yeast species that
fails to demonstrate an anaerobic metabolism in which the electrons
from NADH are utilized to generate a reduced product via a
fermentative pathway such as the production of ethanol and CO.sub.2
from glucose. Non-fermentative yeast can be identified by the
"Durham Tube Test" (J. A. Barnett, R. W. Payne, and D. Yarrow.
2000. Yeasts Characteristics and Identification. 3.sup.rd edition.
p. 28-29. Cambridge University Press, Cambridge, UK.) or by
monitoring the production of fermentation productions such as
ethanol and CO.sub.2.
[0103] The term "polynucleotide" is used herein interchangeably
with the term "nucleic acid" and refers to an organic polymer
composed of two or more monomers including nucleotides, nucleosides
or analogs thereof, including but not limited to single stranded or
double stranded, sense or antisense deoxyribonucleic acid (DNA) of
any length and, where appropriate, single stranded or double
stranded, sense or antisense ribonucleic acid (RNA) of any length,
including siRNA. The term "nucleotide" refers to any of several
compounds that consist of a ribose or deoxyribose sugar joined to a
purine or a pyrimidine base and to a phosphate group, and that are
the basic structural units of nucleic acids. The term "nucleoside"
refers to a compound (as guanosine or adenosine) that consists of a
purine or pyrimidine base combined with deoxyribose or ribose and
is found especially in nucleic acids. The term "nucleotide analog"
or "nucleoside analog" refers, respectively, to a nucleotide or
nucleoside in which one or more individual atoms have been replaced
with a different atom or with a different functional group.
Accordingly, the term polynucleotide includes nucleic acids of any
length, DNA, RNA, analogs and fragments thereof. A polynucleotide
of three or more nucleotides is also called nucleotidic oligomer or
oligonucleotide.
[0104] It is understood that the polynucleotides described herein
include "genes" and that the nucleic acid molecules described
herein include "vectors" or "plasmids." Accordingly, the term
"gene", also called a "structural gene" refers to a polynucleotide
that codes for a particular sequence of amino acids, which comprise
all or part of one or more proteins or enzymes, and may include
regulatory (non-transcribed) DNA sequences, such as promoter
sequences, which determine for example the conditions under which
the gene is expressed. The transcribed region of the gene may
include untranslated regions, including introns, 5'-untranslated
region (UTR), and 3'-UTR, as well as the coding sequence.
[0105] The term "expression" with respect to a gene sequence refers
to transcription of the gene and, as appropriate, translation of
the resulting mRNA transcript to a protein. Thus, as will be clear
from the context, expression of a protein results from
transcription and translation of the open reading frame
sequence.
[0106] The term "operon" refers two or more genes which are
transcribed as a single transcriptional unit from a common
promoter. In some embodiments, the genes comprising the operon are
contiguous genes. It is understood that transcription of an entire
operon can be modified (i.e., increased, decreased, or eliminated)
by modifying the common promoter. Alternatively, any gene or
combination of genes in an operon can be modified to alter the
function or activity of the encoded polypeptide. The modification
can result in an increase in the activity of the encoded
polypeptide. Further, the modification can impart new activities on
the encoded polypeptide. Exemplary new activities include the use
of alternative substrates and/or the ability to function in
alternative environmental conditions.
[0107] In various embodiments described herein, NAD(P)H refers to
either NADH or NADPH. NAD(P).sup.+ refers to either NAD.sup.+ or
NADP.sup.+.
[0108] A "vector" is any means by which a nucleic acid can be
propagated and/or transferred between organisms, cells, or cellular
components. Vectors include viruses, bacteriophage, pro-viruses,
plasmids, phagemids, transposons, and artificial chromosomes such
as YACs (yeast artificial chromosomes), BACs (bacterial artificial
chromosomes), and PLACs (plant artificial chromosomes), and the
like, that are "episomes," that is, that replicate autonomously or
can integrate into a chromosome of a host cell. A vector can also
be a naked RNA polynucleotide, a naked DNA polynucleotide, a
polynucleotide composed of both DNA and RNA within the same strand,
a poly-lysine-conjugated DNA or RNA, a peptide-conjugated DNA or
RNA, a liposome-conjugated DNA, or the like, that are not episomal
in nature, or it can be an organism which comprises one or more of
the above polynucleotide constructs such as an agrobacterium or a
bacterium.
[0109] "Transformation" refers to the process by which a vector is
introduced into a host cell. Transformation (or transduction, or
transfection), can be achieved by any one of a number of means
including electroporation, microinjection, biolistics (or particle
bombardment-mediated delivery), or agrobacterium mediated
transformation.
[0110] The term "enzyme" as used herein refers to any substance
that catalyzes or promotes one or more chemical or biochemical
reactions, which usually includes enzymes totally or partially
composed of a polypeptide, but can include enzymes composed of a
different molecule including polynucleotides.
[0111] The term "protein" or "polypeptide" as used herein indicates
an organic polymer composed of two or more amino acidic monomers
and/or analogs thereof. As used herein, the term "amino acid" or
"amino acidic monomer" refers to any natural and/or synthetic amino
acids including glycine and both D or L optical isomers. The term
"amino acid analog" refers to an amino acid in which one or more
individual atoms have been replaced, either with a different atom,
or with a different functional group. Accordingly, the term
polypeptide includes amino acidic polymer of any length including
full length proteins, and peptides as well as analogs and fragments
thereof. A polypeptide of three or more amino acids is also called
a protein oligomer or oligopeptide
[0112] The term "homologs" used with respect to an original enzyme
or gene of a first family or species refers to distinct enzymes or
genes of a second family or species which are determined by
functional, structural or genomic analyses to be an enzyme or gene
of the second family or species which corresponds to the original
enzyme or gene of the first family or species. Most often, homologs
will have functional, structural or genomic similarities.
Techniques are known by which homologs of an enzyme or gene can
readily be cloned using genetic probes and PCR. Identity of cloned
sequences as homolog can be confirmed using functional assays
and/or by genomic mapping of the genes.
[0113] A protein has "homology" or is "homologous" to a second
protein if the nucleic acid sequence that encodes the protein has a
similar sequence to the nucleic acid sequence that encodes the
second protein. Alternatively, a protein has homology to a second
protein if the two proteins have "similar" amino acid sequences.
(Thus, the term "homologous proteins" is defined to mean that the
two proteins have similar amino acid sequences).
[0114] The term "analog" or "analogous" refers to nucleic acid or
protein sequences or protein structures that are related to one
another in function only and are not from common descent or do not
share a common ancestral sequence. Analogs may differ in sequence
but may share a similar structure, due to convergent evolution. For
example, two enzymes are analogs or analogous if the enzymes
catalyze the same reaction of conversion of a substrate to a
product, are unrelated in sequence, and irrespective of whether the
two enzymes are related in structure.
The Microorganism in General
[0115] Microorganism Characterized by Producing Isobutanol from
Pyruvate Via an Overexpressed Isobutanol Pathway
[0116] Native producers of 1-butanol, such as Clostridium
acetobutylicum, are known, but these organisms also generate
byproducts such as acetone, ethanol, and butyrate during
fermentations. Furthermore, these microorganisms are relatively
difficult to manipulate, with significantly fewer tools available
than in more commonly used production hosts such as E. coli.
Additionally, the physiology and metabolic regulation of these
native producers are much less well understood, impeding rapid
progress towards high-efficiency production. Furthermore, no native
microorganisms have been identified that can metabolize glucose
into isobutanol in industrially relevant quantities.
[0117] The production of isobutanol and other fusel alcohols by
various yeast species, including Saccharomyces cerevisiae is of
special interest to the distillers of alcoholic beverages, for whom
fusel alcohols constitute often undesirable off-notes. Production
of isobutanol in wild-type yeasts has been documented on various
growth media, ranging from grape must from winemaking (Romano, et
al., Metabolic diversity of Saccharomyces cerevisiae strains from
spontaneously fermented grape musts, 19:311-315, 2003), in which
12-219 mg/L isobutanol were produced, to supplemented minimal media
(Oliviera, et al. (2005) World Journal of Microbiology and
Biotechnology 21:1569-1576), producing 16-34 mg/L isobutanol. Work
from Dickinson, et al. (J Biol. Chem. 272(43):26871-8, 1997) has
identified the enzymatic steps utilized in an endogenous S.
cerevisiae pathway converting branch-chain amino acids (e.g.,
valine or leucine) to isobutanol.
[0118] Recombinant microorganisms provided herein can express a
plurality of heterologous and/or native target enzymes involved in
pathways for the production isobutanol from a suitable carbon
source.
[0119] Accordingly, metabolically "engineered" or "modified"
microorganisms are produced via the introduction of genetic
material into a host or parental microorganism of choice and/or by
modification of the expression of native genes, thereby modifying
or altering the cellular physiology and biochemistry of the
microorganism. Through the introduction of genetic material and/or
the modification of the expression of native genes the parental
microorganism acquires new properties, e.g. the ability to produce
a new, or greater quantities of, an intracellular metabolite. As
described herein, the introduction of genetic material and/or the
modification of the expression of native genes into a parental
microorganism results in a new or modified ability to produce
isobutanol. The genetic material introduced into and/or the genes
modified for expression in the parental microorganism contains
gene(s), or parts of genes, coding for one or more of the enzymes
involved in a biosynthetic pathway for the production of isobutanol
and may also include additional elements for the expression and/or
regulation of expression of these genes, e.g. promoter
sequences.
[0120] An engineered or modified microorganism can also include in
the alternative or in addition to the introduction of a genetic
material into a host or parental microorganism, the disruption,
deletion or knocking out of a gene or polynucleotide to alter the
cellular physiology and biochemistry of the microorganism. Through
the reduction, disruption or knocking out of a gene or
polynucleotide the microorganism acquires new or improved
properties (e.g., the ability to produce a new metabolite or
greater quantities of an intracellular metabolite, improve the flux
of a metabolite down a desired pathway, and/or reduce the
production of undesirable by-products).
[0121] Recombinant microorganisms provided herein may also produce
metabolites in quantities not available in the parental
microorganism. A "metabolite" refers to any substance produced by
metabolism or a substance necessary for or taking part in a
particular metabolic process. A metabolite can be an organic
compound that is a starting material (e.g., glucose or pyruvate),
an intermediate (e.g., 2-ketoisovalerate), or an end product (e.g.,
isobutanol) of metabolism. Metabolites can be used to construct
more complex molecules, or they can be broken down into simpler
ones. Intermediate metabolites may be synthesized from other
metabolites, perhaps used to make more complex substances, or
broken down into simpler compounds, often with the release of
chemical energy.
[0122] Exemplary metabolites include glucose, pyruvate, and
isobutanol. The metabolite isobutanol can be produced by a
recombinant microorganism metabolically engineered to express or
over-express a metabolic pathway that converts pyruvate to
isobutanol. An exemplary metabolic pathway that converts pyruvate
to isobutanol may be comprised of a acetohydroxy acid synthase
(ALS) enzyme encoded by, for example, BsalsS from B. subtilis, a
ketolacid reductoisomerase (KARI) encoded by, for example ilvC from
E. coli, a dihydroxy-acid dehydratase (DHAD), encoded by, for
example ilvD from E. coli, a 2-keto-acid decarboxylase (KIVD)
encoded by, for example LlkivD (SEQ ID NO: 153) or LlkivD2 (SEQ ID
NO: 155) from L. lactis, and an isobutyraldehyde dehydrogenase
(IDH), encoded by, for example, a native S. cerevisiae alcohol
dehydrogenase gene like ADH7.
[0123] Accordingly, provided herein are recombinant microorganisms
that produce isobutanol and in some aspects may include the
elevated expression of target enzymes such as ALS (encoded e.g. by
ILV2 and ILV6 from Saccharomyces cerevisiae or BsalsS from Bacillus
subtilis), KARI (encoded e.g. by ILV5 from S. cerevisiae or ilvC
from E. coli), DHAD (encoded, e.g. by ILV3 from S. cerevisiae or by
ilvD from E. coli), and KIVD (encoded, e.g. by PDC1, PDC5 and PDC6
from S. cerevisiae, ARO10 from S. cerevisiae, THI3 from S.
cerevisiae, LlkivD from L. lactis, or pdc from Z. mobilis).
[0124] The disclosure identifies specific genes useful in the
methods, compositions and organisms of the disclosure; however it
will be recognized that absolute identity to such genes is not
necessary. For example, changes in a particular gene or
polynucleotide comprising a sequence encoding a polypeptide or
enzyme can be performed and screened for activity. Typically such
changes comprise conservative mutation and silent mutations. Such
modified or mutated polynucleotides and polypeptides can be
screened for expression of a functional enzyme using methods known
in the art.
[0125] Due to the inherent degeneracy of the genetic code, other
polynucleotides which encode substantially the same or a
functionally equivalent polypeptide can also be used to clone and
express the polynucleotides encoding such enzymes.
[0126] As will be understood by those of skill in the art, it can
be advantageous to modify a coding sequence to enhance its
expression in a particular host. The genetic code is redundant with
64 possible codons, but most organisms typically use a subset of
these codons. The codons that are utilized most often in a species
are called optimal codons, and those not utilized very often are
classified as rare or low-usage codons. Codons can be substituted
to reflect the preferred codon usage of the host, a process
sometimes called "codon optimization" or "controlling for species
codon bias."
[0127] Optimized coding sequences containing codons preferred by a
particular prokaryotic or eukaryotic host (see also, Murray et al.
(1989) Nucl. Acids Res. 17:477-508) can be prepared, for example,
to increase the rate of translation or to produce recombinant RNA
transcripts having desirable properties, such as a longer
half-life, as compared with transcripts produced from a
non-optimized sequence. Translation stop codons can also be
modified to reflect host preference. For example, typical stop
codons for S. cerevisiae and mammals are UAA and UGA, respectively.
The typical stop codon for monocotyledonous plants is UGA, whereas
insects and E. coli commonly use UAA as the stop codon (Dalphin et
al. (1996) Nucl. Acids Res. 24: 216-218). Methodology for
optimizing a nucleotide sequence for expression in a plant is
provided, for example, in U.S. Pat. No. 6,015,891, and the
references cited therein.
[0128] Those of skill in the art will recognize that, due to the
degenerate nature of the genetic code, a variety of DNA compounds
differing in their nucleotide sequences can be used to encode a
given enzyme of the disclosure. The native DNA sequence encoding
the biosynthetic enzymes described above are referenced herein
merely to illustrate an embodiment of the disclosure, and the
disclosure includes DNA compounds of any sequence that encode the
amino acid sequences of the polypeptides and proteins of the
enzymes utilized in the methods of the disclosure. In similar
fashion, a polypeptide can typically tolerate one or more amino
acid substitutions, deletions, and insertions in its amino acid
sequence without loss or significant loss of a desired activity.
The disclosure includes such polypeptides with different amino acid
sequences than the specific proteins described herein so long as
they modified or variant polypeptides have the enzymatic anabolic
or catabolic activity of the reference polypeptide. Furthermore,
the amino acid sequences encoded by the DNA sequences shown herein
merely illustrate embodiments of the disclosure.
[0129] In addition, homologs of enzymes useful for generating
metabolites are encompassed by the microorganisms and methods
provided herein.
[0130] As used herein, two proteins (or a region of the proteins)
are substantially homologous when the amino acid sequences have at
least about 30%, 40%, 50% 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%,
92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. To determine
the percent identity of two amino acid sequences, or of two nucleic
acid sequences, the sequences are aligned for optimal comparison
purposes (e.g., gaps can be introduced in one or both of a first
and a second amino acid or nucleic acid sequence for optimal
alignment and non-homologous sequences can be disregarded for
comparison purposes). In one embodiment, the length of a reference
sequence aligned for comparison purposes is at least 30%, typically
at least 40%, more typically at least 50%, even more typically at
least 60%, and even more typically at least 70%, 80%, 90%, 100% of
the length of the reference sequence. The amino acid residues or
nucleotides at corresponding amino acid positions or nucleotide
positions are then compared. When a position in the first sequence
is occupied by the same amino acid residue or nucleotide as the
corresponding position in the second sequence, then the molecules
are identical at that position (as used herein amino acid or
nucleic acid "identity" is equivalent to amino acid or nucleic acid
"homology"). The percent identity between the two sequences is a
function of the number of identical positions shared by the
sequences, taking into account the number of gaps, and the length
of each gap, which need to be introduced for optimal alignment of
the two sequences.
[0131] When "homologous" is used in reference to proteins or
peptides, it is recognized that residue positions that are not
identical often differ by conservative amino acid substitutions. A
"conservative amino acid substitution" is one in which an amino
acid residue is substituted by another amino acid residue having a
side chain (R group) with similar chemical properties (e.g., charge
or hydrophobicity). In general, a conservative amino acid
substitution will not substantially change the functional
properties of a protein. In cases where two or more amino acid
sequences differ from each other by conservative substitutions, the
percent sequence identity or degree of homology may be adjusted
upwards to correct for the conservative nature of the substitution.
Means for making this adjustment are well known to those of skill
in the art (see, e.g., Pearson et al., 1994, hereby incorporated
herein by reference).
[0132] The following six groups each contain amino acids that are
conservative substitutions for one another: 1) Serine (S),
Threonine (T); 2) Aspartic Acid (D), Glutamic Acid (E); 3)
Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5)
Isoleucine (I), Leucine (L), Methionine (M), Alanine (A), Valine
(V), and 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W).
[0133] Sequence homology for polypeptides, which is also referred
to as percent sequence identity, is typically measured using
sequence analysis software. See, e.g., the Sequence Analysis
Software Package of the Genetics Computer Group (GCG), University
of Wisconsin Biotechnology Center, 910 University Avenue, Madison,
Wis. 53705. Protein analysis software matches similar sequences
using measure of homology assigned to various substitutions,
deletions and other modifications, including conservative amino
acid substitutions. For instance, GCG contains programs such as
"Gap" and "Bestfit" which can be used with default parameters to
determine sequence homology or sequence identity between closely
related polypeptides, such as homologous polypeptides from
different species of organisms or between a wild-type protein and a
mutant protein. See, e.g., GCG Version 6.1.
[0134] A typical algorithm used comparing a molecule sequence to a
database containing a large number of sequences from different
organisms is the computer program BLAST (Altschul, S. F., et al.
(1990) "Basic local alignment search tool." J. Mol. Biol.
215:403-410; Gish, W. and States, D. J. (1993) "Identification of
protein coding regions by database similarity search." Nature
Genet. 3:266-272; Madden, T. L., et al. (1996) "Applications of
network BLAST server" Meth. Enzymol. 266:131-141; Altschul, S. F.,
et al. (1997) "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs." Nucleic Acids Res. 25:3389-3402;
Zhang, J. and Madden, T. L. (1997) "PowerBLAST: A new network BLAST
application for interactive or automated sequence analysis and
annotation." Genome Res. 7:649-656), especially blastp or tblastn
(Altschul, S. F., et al. (1997) "Gapped BLAST and PSI-BLAST: a new
generation of protein database search programs." Nucleic Acids Res.
25:3389-3402). Typical parameters for BLASTp are: Expectation
value: 10 (default); Filter: seg (default); Cost to open a gap: 11
(default); Cost to extend a gap: 1 (default); Max. alignments: 100
(default); Word size: 11 (default); No. of descriptions: 100
(default); Penalty Matrix: BLOSUM62.
[0135] When searching a database containing sequences from a large
number of different organisms, it is typical to compare amino acid
sequences. Database searching using amino acid sequences can be
measured by algorithms other than blastp known in the art. For
instance, polypeptide sequences can be compared using FASTA, a
program in GCG Version 6.1. FASTA provides alignments and percent
sequence identity of the regions of the best overlap between the
query and search sequences (Pearson, W. R. (1990) "Rapid and
Sensitive Sequence Comparison with FASTP and FASTA" Meth. Enzymol.
183:63-98). For example, percent sequence identity between amino
acid sequences can be determined using FASTA with its default
parameters (a word size of 2 and the PAM250 scoring matrix), as
provided in GCG Version 6.1, hereby incorporated herein by
reference.
[0136] The disclosure provides metabolically engineered
microorganisms comprising a biochemical pathway for the production
of isobutanol from a suitable substrate at a high yield. A
metabolically engineered microorganism of the disclosure comprises
one or more recombinant polynucleotides within the genome of the
organism or external to the genome within the organism. The
microorganism can comprise a reduction, disruption or knockout of a
gene found in the wild-type organism and/or introduction of a
heterologous polynucleotide and/or expression or overexpression of
an endogenous polynucleotide.
[0137] In one aspect, the disclosure provides a recombinant
microorganism comprising elevated or altered expression of at least
one target enzyme as compared to a parental microorganism or
encodes an enzyme not found in the parental organism. In another or
further aspect, the microorganism comprises a reduction, disruption
or knockout of at least one gene encoding an enzyme that competes
with a metabolite necessary for the production of isobutanol. The
recombinant microorganism produces at least one metabolite involved
in a biosynthetic pathway for the production of isobutanol. In
general, the recombinant microorganisms comprises at least one
recombinant metabolic pathway that comprises a target enzyme and
may further include a reduction in activity or expression of an
enzyme in a competitive biosynthetic pathway. The pathway acts to
modify a substrate or metabolic intermediate in the production of
isobutanol. The target enzyme is encoded by, and expressed from, a
polynucleotide derived from a suitable biological source. In some
embodiments, the polynucleotide comprises a gene derived from a
prokaryotic or eukaryotic source and recombinantly engineered into
the microorganism of the disclosure. In other embodiments, the
polynucleotide comprises a gene that is native to the host
organism.
[0138] It is understood that a range of microorganisms can be
modified to include a recombinant metabolic pathway suitable for
the production of isobutanol. In various embodiments,
microorganisms may be selected from yeast microorganisms. Yeast
microorganisms for the production of isobutanol at high yield may
be selected based on certain characteristics:
[0139] Another characteristic may include the property that the
microorganism is selected to convert various carbon sources into
isobutanol. Accordingly, in one embodiment, the recombinant
microorganism herein disclosed can convert a variety of carbon
sources to products, including but not limited to glucose,
galactose, mannose, xylose, arabinose, lactose, sucrose, and
mixtures thereof.
[0140] The recombinant microorganism may thus further include a
pathway for the fermentation of isobutanol from five-carbon
(pentose) sugars including xylose. Most yeast species metabolize
xylose via a complex route, in which xylose is first reduced to
xylitol via a xylose reductase (XR) enzyme. The xylitol is then
oxidized to xylulose via a xylitol dehydrogenase (XDH) enzyme. The
xylulose is then phosphorylated via a xylulokinase (XK) enzyme.
This pathway operates inefficiently in yeast species because it
introduces a redox imbalance in the cell. The xylose-to-xylitol
step uses NADH as a cofactor, whereas the xylitol-to-xylulose step
uses NADPH as a cofactor. Other processes must operate to restore
the redox imbalance within the cell. This often means that the
organism cannot grow anaerobically on xylose or other pentose
sugar. Accordingly, a yeast species that can efficiently ferment
xylose and other pentose sugars into a desired fermentation product
is therefore very desirable.
[0141] Thus, in one aspect, the recombinant is engineered to
express a functional exogenous xylose isomerase. Exogenous xylose
isomerases functional in yeast are known in the art. See, e.g.,
Rajgarhia et al, US20060234364, which is herein incorporated by
reference in its entirety. In an embodiment according to this
aspect, the exogenous xylose isomerase gene is operatively linked
to promoter and terminator sequences that are functional in the
yeast cell. In a preferred embodiment, the recombinant
microorganism further has a deletion or disruption of a native gene
that encodes for an enzyme (e.g. XR and/or XDH) that catalyzes the
conversion of xylose to xylitol. In a further preferred embodiment,
the recombinant microorganism also contains a functional, exogenous
xylulokinase (XK) gene operatively linked to promoter and
terminator sequences that are functional in the yeast cell. In one
embodiment, the xylulokinase (XK) gene is overexpressed.
[0142] Another characteristic may include the property that the
wild-type or parental microorganism is non-fermenting. In other
words, it cannot metabolize a carbon source anaerobically while the
yeast is able to metabolize a carbon source in the presence of
oxygen. Non-fermenting yeast refers to both naturally occurring
yeasts as well as genetically modified yeast. During anaerobic
fermentation with fermentative yeast, the main pathway to oxidize
the NADH from glycolysis is through the production of ethanol.
Ethanol is produced by alcohol dehydrogenase (ADH) via the
reduction of acetaldehyde, which is generated from pyruvate by
pyruvate decarboxylase (PDC). Thus, in one embodiment, a
fermentative yeast can be engineered to be non-fermentative by the
reduction or elimination of the native PDC activity. Thus, most of
the pyruvate produced by glycolysis is not consumed by PDC and is
available for the isobutanol pathway. Deletion of this pathway
increases the pyruvate and the reducing equivalents available for
the isobutanol pathway. Fermentative pathways contribute to low
yield and low productivity of isobutanol. Accordingly, deletion of
PDC may increase yield and productivity of isobutanol. In one
embodiment, the yeast microorganisms may be selected from the
"Saccharomyces Yeast Clade", defined as an ascomycetous yeast
taxonomic class by Kurtzman and Robnett in 1998 ("Identification
and phylogeny of ascomycetous yeast from analysis of nuclear large
subunit (26S) ribosomal DNA partial sequences." Antonie van
Leeuwenhoek 73: 331-371). They were able to determine the
relatedness of yeast of approximately 500 yeast species by
comparing the nucleotide sequence of the D1/D2 domain at the 5' end
of the gene encoding the large ribosomal subunit 26S. In pair-wise
comparisons of the D1/D2 nucleotide sequence of S. cerevisiae and
the two most distant yeast in the Saccharomyces clade: K. lactis
and K. marxianus, yeast from this clade share greater than 80%
identity.
[0143] The term "Saccharomyces sensu stricto" taxonomy group is a
cluster of yeast species that are highly related to S. cerevisiae
(Rainieri, S. et al 2003. Saccharomyces Sensu Stricto: Systematics,
Genetic Diversity and Evolution. J. Biosci Bioengin 96(1)1-9.
Saccharomyces sensu stricto yeast species include but are not
limited to S. cerevisiae, S. cerevisiae, S. kudriavzevii, S.
mikatae, S. bayanus, S. uvarum, S. carocanis and hybrids derived
from these species (Masneuf et al. 1998. New Hybrids between
Saccharomyces Sensu Stricto Yeast Species Found Among Wine and
Cider Production Strains. Yeast 7(1)61-72).
[0144] An ancient whole genome duplication (WGD) event occurred
during the evolution of hemiascomycete yeast was discovered using
comparative genomics tools (Kellis et al 2004 "Proof and
evolutionary analysis of ancient genome duplication in the yeast S.
cerevisiae." Nature 428:617-624. Dujon et al 2004 "Genome evolution
in yeasts." Nature 430:35-44. Langkjaer et al 2003 "Yeast genome
duplication was followed by asynchronous differentiation of
duplicated genes." Nature 428:848-852. Wolfe and Shields 1997
"Molecular evidence for an ancient duplication of the entire yeast
genome." Nature 387:708-713.) Using this major evolutionary event,
yeast can be divided into species that diverged from a common
ancestor following the WGD event (termed "post-WGD yeast" herein)
and species that diverged from the yeast lineage prior to the WGD
event (termed "pre-WGD yeast" herein).
[0145] Accordingly, in one embodiment, the yeast microorganism may
be selected from a post-WGD yeast genus, including but not limited
to Saccharomyces and Candida. The favored post-WGD yeast species
include: S. cerevisiae, S. uvarum, S. bayanus, S. paradoxus, S.
castelli, and C. glabrata.
[0146] In another embodiment, the yeast microorganism may be
selected from a pre-whole genome duplication (pre-WBD) yeast genus
including but not limited to Saccharomyces, Kluyveromyces, Candida,
Pichia, Debaryomyces, Hansenula, Pachysolen, Yarrowia and,
Schizosaccharomyces. Representative pre-WGD yeast species include:
S. kluyveri, K. thermotolerans, K. marxianus, K. waltii, K. lactis,
C. tropicalis, P. pastoris, P. anomala, P. stipitis, P.
kudriavzevii, D. hansenii, H. anomala, P. tannophilis, Y.
lipolytica, and S. pombe.
[0147] A yeast microorganism may be either Crabtree-negative or
Crabtree-positive. A yeast cell having a Crabtree-negative
phenotype is any yeast cell that does not exhibit the Crabtree
effect. The term "Crabtree-negative" refers to both naturally
occurring and genetically modified organisms. Briefly, the Crabtree
effect is defined as the inhibition of oxygen consumption by a
microorganism when cultured under aerobic conditions due to the
presence of a high concentration of glucose (e.g., 50 g-glucose
L.sup.-1). In other words, a yeast cell having a Crabtree-positive
phenotype continues to ferment irrespective of oxygen availability
due to the presence of glucose, while a yeast cell having a
Crabtree-negative phenotype does not exhibit glucose mediated
inhibition of oxygen consumption.
[0148] Accordingly, in one embodiment the yeast microorganism may
be selected from yeast with a Crabtree-negative phenotype including
but not limited to the following genera: Kluyveromyces, Pichia,
Hansenula, and Candida. Crabtree-negative species include but are
not limited to: K. lactis, K. marxianus, P. anomala, P. stipitis,
P. kudriavzevii, H. anomala, and C. utilis.
[0149] In another embodiment, the yeast microorganism may be
selected from a yeast with a Crabtree-positive phenotype, including
but not limited to Saccharomyces, Kluyveromyces, Zygosaccharomyces,
Debaryomyces, Pichia and Schizosaccharomyces. Crabtree-positive
yeast species include but are not limited to: S. cerevisiae, S.
uvarum, S. bayanus, S. paradoxus, S. castelli, S. kluyveri, K.
thermotolerans, C. glabrata, Z. bailli, Z. rouxii, D. hansenii, P.
pastorius, and S. pombe.
[0150] In one embodiment, a yeast microorganism is engineered to
convert a carbon source, such as glucose, to pyruvate by glycolysis
and the pyruvate is converted to isobutanol via an engineered
isobutanol pathway (See, e.g., PCT/US2006/041602 and
PCT/US2008/053514). Alternative pathways for the production of
isobutanol have been described in International Patent Application
No PCT/US2006/041602 and in Dickinson et al., Journal of Biological
Chemistry 273: 25751-15756 (1998).
[0151] Accordingly, the engineered isobutanol pathway to convert
pyruvate to isobutanol can be, but is not limited to, the following
reactions:
[0152] 1. 2 pyruvate.fwdarw.acetolactate+CO.sub.2
[0153] 2.
acetolactate+NAD(P)H.fwdarw.2,3-dihydroxyisovalerate+NAD(P).sup.-
+
[0154] 3. 2,3-dihydroxyisovalerate.fwdarw.alpha-ketoisovalerate
[0155] 4.
alpha-ketoisovalerate.fwdarw.isobutyraldehyde+CO.sub.2
[0156] 5.
isobutyraldehyde+NAD(P)H.fwdarw.isobutanol+NAD(P).sup.+
[0157] These reactions are carried out by the enzymes 1)
Acetolactate Synthase (ALS), 2) Ketol-acid Reducto-Isomerase
(KARI), 3) Dihydroxy-acid dehydratase (DHAD), 4) Keto-isovalerate
decarboxylase (KIVD), and 5) an Isobutyraldehyde Dehydrogenase
(IDH) (FIG. 1).
[0158] In another embodiment, the yeast microorganism is engineered
to overexpress these enzymes. For example, ALS can be encoded by
the alsS gene of B. subtilis, alsS of L. lactis, or the ilvK gene
of K. pneumonia. For example, KARI can be encoded by the ilvC genes
of E. coli, C. glutamicum, M. maripaludis, or Piromyces sp E2. For
example, DHAD can be encoded by the ilvD genes of E. coli or C.
glutamicum. KIVD can be encoded by the LlkivD gene of L. lactis.
IDH can be encoded by ADH2, ADH6, or ADH7 of S. cerevisiae.
Isobutyraldehyde dehydrogenase or IDH is defined as an alcohol
dehydrogenase (ADH) that catalyzes the conversion of
isobutyraldehyde to isobutanol.
[0159] The yeast microorganism of the invention may be engineered
to have increased ability to convert pyruvate to isobutanol. In one
embodiment, the yeast microorganism may be engineered to have
increased ability to convert pyruvate to isobutyraldehyde. In
another embodiment, the yeast microorganism may be engineered to
have increased ability to convert pyruvate to keto-isovalerate. In
another embodiment, the yeast microorganism may be engineered to
have increased ability to convert pyruvate to
2,3-dihydroxyisovalerate. In another embodiment, the yeast
microorganism may be engineered to have increased ability to
convert pyruvate to acetolactate.
[0160] Furthermore, any of the genes encoding the foregoing enzymes
(or any others mentioned herein (or any of the regulatory elements
that control or modulate expression thereof)) may be optimized by
genetic/protein engineering techniques, such as directed evolution
or rational mutagenesis, which are known to those of ordinary skill
in the art. Such action allows those of ordinary skill in the art
to optimize the enzymes for expression and activity in yeast.
[0161] It is understood that various microorganisms can act as
"sources" for genetic material encoding target enzymes suitable for
use in a recombinant microorganism provided herein. For example, In
addition, genes encoding these enzymes can be identified from other
fungal and bacterial species and can be expressed for the
modulation of this pathway. A variety of organisms could serve as
sources for these enzymes, including, but not limited to,
Saccharomyces spp., including S. cerevisiae and S. uvarum,
Kluyveromyces spp., including K. thermotolerans, K. lactis, and K.
marxianus, Pichia spp., Hansenula spp., including H. polymorpha,
Candida spp., Trichosporon spp., Yamadazyma spp., including Y.
stipitis, Schizosaccharomyces spp., including S. pombe,
Cryptococcus spp., Aspergillus spp., or Neurospora spp. Sources of
genes from anaerobic fungi include, but not limited to, Piromyces
spp., Orpinomyces spp., or Neocallimastix spp. Sources of
prokaryotic enzymes that are useful include, but not limited to,
Escherichia. coli, Zymomonas mobilis, Staphylococcus aureus,
Bacillus spp., Clostridium spp., Corynebacterium spp., Pseudomonas
spp., Lactococcus spp., Enterobacter spp., and Salmonella spp.
Methods in General
Gene Expression
[0162] In another embodiment a method of producing a recombinant
microorganism that converts a suitable carbon substrate to
isobutanol is provided. The method includes transforming a
microorganism with one or more recombinant polynucleotides encoding
polypeptides that include but are not limited to, for example, ALS,
KARI, DHAD, KIVD, IDH. Polynucleotides that encode enzymes useful
for generating metabolites including homologs, variants, fragments,
related fusion proteins, or functional equivalents thereof, are
used in recombinant nucleic acid molecules that direct the
expression of such polypeptides in appropriate host cells, such as
bacterial or yeast cells. It is understood that the addition of
sequences which do not alter the encoded activity of a
polynucleotide, such as the addition of a non-functional or
non-coding sequence, is a conservative variation of the basic
nucleic acid. The "activity" of an enzyme is a measure of its
ability to catalyze a reaction resulting in a metabolite, i.e., to
"function", and may be expressed as the rate at which the
metabolite of the reaction is produced. For example, enzyme
activity can be represented as the amount of metabolite produced
per unit of time or per unit of enzyme (e.g., concentration or
weight), or in terms of affinity or dissociation constants.
[0163] Those of skill in the art will recognize that, due to the
degenerate nature of the genetic code, a variety of DNA compounds
differing in their nucleotide sequences can be used to encode a
given amino acid sequence of the disclosure. The native DNA
sequence encoding the biosynthetic enzymes described herein are
referenced herein merely to illustrate an embodiment of the
disclosure, and the disclosure includes DNA compounds of any
sequence that encode the amino acid sequences of the polypeptides
and proteins of the enzymes utilized in the methods of the
disclosure. In similar fashion, a polypeptide can typically
tolerate one or more amino acid substitutions, deletions, and
insertions in its amino acid sequence without loss or significant
loss of a desired activity. The disclosure includes such
polypeptides with alternate amino acid sequences, and the amino
acid sequences encoded by the DNA sequences shown herein merely
illustrate embodiments of the disclosure.
[0164] The disclosure provides nucleic acid molecules in the form
of recombinant DNA expression vectors or plasmids, as described in
more detail below, that encode one or more target enzymes.
Generally, such vectors can either replicate in the cytosol of the
host microorganism or integrate into the chromosomal DNA of the
host microorganism. In either case, the vector can be a stable
vector (i.e., the vector remains present over many cell divisions,
even if only with selective pressure) or a transient vector (i.e.,
the vector is gradually lost by host microorganisms with increasing
numbers of cell divisions). The disclosure provides DNA molecules
in isolated (i.e., not pure, but existing in a preparation in an
abundance and/or concentration not found in nature) and purified
(i.e., substantially free of contaminating materials or
substantially free of materials with which the corresponding DNA
would be found in nature) forms.
[0165] Provided herein are methods for the expression of one or
more of the biosynthetic genes involved in isobutanol biosynthesis
and recombinant DNA expression vectors useful in the method. Thus,
included within the scope of the disclosure are recombinant
expression vectors that include such nucleic acids. The term
expression vector refers to a nucleic acid that can be introduced
into a host microorganism or cell-free transcription and
translation system. An expression vector can be maintained
permanently or transiently in a microorganism, whether as part of
the chromosomal or other DNA in the microorganism or in any
cellular compartment, such as a replicating vector in the cytosol.
An expression vector also comprises a promoter that drives
expression of an RNA, which typically is translated into a
polypeptide in the microorganism or cell extract. For efficient
translation of RNA into protein, the expression vector also
typically contains a ribosome-binding site sequence positioned
upstream of the start codon of the coding sequence of the gene to
be expressed. Other elements, such as enhancers, secretion signal
sequences, transcription termination sequences, and one or more
marker genes by which host microorganisms containing the vector can
be identified and/or selected, may also be present in an expression
vector. Selectable markers, i.e., genes that confer antibiotic
resistance or sensitivity, are used and confer a selectable
phenotype on transformed cells when the cells are grown in an
appropriate selective medium.
[0166] The various components of an expression vector can vary
widely, depending on the intended use of the vector and the host
cell(s) in which the vector is intended to replicate or drive
expression. Expression vector components suitable for the
expression of genes and maintenance of vectors in E. coli, yeast,
Streptomyces, and other commonly used cells are widely known and
commercially available. For example, suitable promoters for
inclusion in the expression vectors of the disclosure include those
that function in eukaryotic or prokaryotic host microorganisms.
Promoters can comprise regulatory sequences that allow for
regulation of expression relative to the growth of the host
microorganism or that cause the expression of a gene to be turned
on or off in response to a chemical or physical stimulus. For E.
coli and certain other bacterial host cells, promoters derived from
genes for biosynthetic enzymes, antibiotic-resistance conferring
enzymes, and phage proteins can be used and include, for example,
the galactose, lactose (lac), maltose, tryptophan (tip),
beta-lactamase (bla), bacteriophage lambda PL, and T5 promoters. In
addition, synthetic promoters, such as the tac promoter (U.S. Pat.
No. 4,551,433), can also be used. For E. coli expression vectors,
it is useful to include an E. coli origin of replication, such as
from pUC, p1P, p1, and pBR.
[0167] Thus, recombinant expression vectors contain at least one
expression system, which, in turn, is composed of at least a
portion of a biosynthetic gene coding sequences operably linked to
a promoter and optionally termination sequences that operate to
effect expression of the coding sequence in compatible host cells.
The host cells are modified by transformation with the recombinant
DNA expression vectors of the disclosure to contain the expression
system sequences either as extrachromosomal elements or integrated
into the chromosome.
[0168] Moreover, methods for expressing a polypeptide from a
nucleic acid molecule that are specific to yeast microorganisms are
well known. For example, nucleic acid constructs that are used for
the expression of heterologous polypeptides within Kluyveromyces
and Saccharomyces are well known (see, e.g., U.S. Pat. Nos.
4,859,596 and 4,943,529, each of which is incorporated by reference
herein in its entirety for Kluyveromyces and, e.g., Gellissen et
al., Gene 190(1):87-97 (1997) for Saccharomyces. Yeast plasmids
have a selectable marker and an origin of replication, also known
as Autonomously Replicating Sequences (ARS). In addition certain
plasmids may also contain a centromeric sequence. These centromeric
plasmids are generally a single or low copy plasmid. Plasmids
without a centromeric sequence and utilizing either a 2 micron (S.
cerevisiae) or 1.6 micron (K lactis) replication origin are high
copy plasmids. The selectable marker can be either prototrophic,
such as HIS3, TRP1, LEU2, URA3 or ADE2, or antibiotic resistance,
such as, bar, ble, hph, or kan.
[0169] A nucleic acid of the disclosure can be amplified using
cDNA, mRNA or alternatively, genomic DNA, as a template and
appropriate oligonucleotide primers according to standard PCR
amplification techniques and those procedures described in the
Examples section below. The nucleic acid so amplified can be cloned
into an appropriate vector and characterized by DNA sequence
analysis. Furthermore, oligonucleotides corresponding to nucleotide
sequences can be prepared by standard synthetic techniques, e.g.,
using an automated DNA synthesizer.
[0170] It is also understood that an isolated nucleic acid molecule
encoding a polypeptide homologous to the enzymes described herein
can be created by introducing one or more nucleotide substitutions,
additions or deletions into the nucleotide sequence encoding the
particular polypeptide, such that one or more amino acid
substitutions, additions or deletions are introduced into the
encoded protein. Mutations can be introduced into the
polynucleotide by standard techniques, such as site-directed
mutagenesis and PCR-mediated mutagenesis. In contrast to those
positions where it may be desirable to make a non-conservative
amino acid substitutions (see above), in some positions it is
preferable to make conservative amino acid substitutions. A
"conservative amino acid substitution" is one in which the amino
acid residue is replaced with an amino acid residue having a
similar side chain. Families of amino acid residues having similar
side chains have been defined in the art. These families include
amino acids with basic side chains (e.g., lysine, arginine,
histidine), acidic side chains (e.g., aspartic acid, glutamic
acid), uncharged polar side chains (e.g., glycine, asparagine,
glutamine, serine, threonine, tyrosine, cysteine), nonpolar side
chains (e.g., alanine, valine, leucine, isoleucine, proline,
phenylalanine, methionine, tryptophan), beta-branched side chains
(e.g., threonine, valine, isoleucine) and aromatic side chains
(e.g., tyrosine, phenylalanine, tryptophan, histidine).
Identification of Genes in a Host Microorganism
[0171] Any method can be used to identify genes that encode for
enzymes with a specific activity. Generally, homologous or
analogous genes with similar activity can be identified by
functional, structural, and/or genetic analysis. In most cases,
homologous or analogous genes with similar activity will have
functional, structural, or genetic similarities. Techniques known
to those skilled in the art may be suitable to identify homologous
genes and homologous enzymes. Generally, analogous genes and/or
analogous enzymes can be identified by functional analysis and will
have functional similarities. Techniques known to those skilled in
the art may be suitable to identify analogous genes and analogous
enzymes. For example, to identify homologous or analogous genes,
proteins, or enzymes, techniques may include, but not limited to,
cloning a gene by PCR using primers based on a published sequence
of a gene/enzyme or by degenerate PCR using degenerate primers
designed to amplify a conserved region among a gene. Further, one
skilled in the art can use techniques to identify homologous or
analogous genes, proteins, or enzymes with functional homology or
similarity. Techniques include examining a cell or cell culture for
the catalytic activity of an enzyme through in vitro enzyme assays
for said activity, then isolating the enzyme with said activity
through purification, determining the protein sequence of the
enzyme through techniques such as Edman degradation, design of PCR
primers to the likely nucleic acid sequence, amplification of said
DNA sequence through PCR, and cloning of said nucleic acid
sequence. To identify homologous or analogous genes with similar
activity, techniques also include comparison of data concerning a
candidate gene or enzyme with databases such as BRENDA, KEGG, or
MetaCYC. The candidate gene or enzyme may be identified within the
above mentioned databases in accordance with the teachings herein.
Furthermore, enzymatic activity can be determined phenotypically.
For example, ethanol production under fermentative conditions can
be assessed. A lack of ethanol production may be indicative of a
microorganism lacking an alcohol dehydrogenase.
Genetic Insertions and Deletions
[0172] Any method can be used to introduce a nucleic acid molecule
into the chromosomal DNA of a microorganism and many such methods
are well known. For example, lithium acetate transformation and
electroporation are common methods for introducing nucleic acid
into yeast microorganisms. See, e.g., Gietz et al., Nucleic Acids
Res. 27:69-74 (1992); Ito et al., J. Bacterol. 153:163-168 (1983);
and Becker and Guarente, Methods in Enzymology 194:182-187
(1991).
[0173] In an embodiment, the integration of a gene of interest into
a DNA fragment or target gene of a yeast microorganism occurs
according to the principle of homologous recombination. According
to this embodiment, an integration cassette containing a module
comprising at least one yeast marker gene and/or the gene to be
integrated (internal module) is flanked on either side by DNA
fragments homologous to those of the ends of the targeted
integration site (recombinogenic sequences). After transforming the
yeast with the cassette by appropriate methods, a homologous
recombination between the recombinogenic sequences may result in
the internal module replacing the chromosomal region in between the
two sites of the genome corresponding to the recombinogenic
sequences of the integration cassette. (Orr-Weaver et al., PNAS USA
78:6354-6358 (1981))
[0174] In an embodiment, the integration cassette for integration
of a gene of interest into a yeast microorganism includes the
heterologous gene under the control of an appropriate promoter and
terminator together with the selectable marker flanked by
recombinogenic sequences for integration of a heterologous gene
into the yeast chromosome. In an embodiment, the heterologous gene
includes an appropriate native gene desired to increase the copy
number of a native gene(s). The selectable marker gene can be any
marker gene used in yeast, including but not limited to, HIS3,
TRP1, LEU2, URA3, bar, ble, hph, and kan. The recombinogenic
sequences can be chosen at will, depending on the desired
integration site suitable for the desired application.
[0175] Additionally, in an embodiment pertaining to yeast
microorganisms, certain introduced marker genes are removed from
the genome using techniques well known to those skilled in the art.
For example, URA3 marker loss can be obtained by plating URA3
containing cells in FOA (5-fluoro-orotic acid) containing medium
and selecting for FOA resistant colonies (Boeke, J. et al, 1984,
Mol. Gen. Genet, 197, 345-47).
[0176] Integration of all the genes of a metabolic pathway that
lead to a product into the genome of the production strain
eliminates the need of a plasmid expression system, as the enzymes
are produced from the chromosome. The integration of pathway genes
avoids loss of productivity over time due to plasmid loss. This is
important for long fermentation times and for fermentations in
large scale where the seed train is long and the production strain
has to go through many doublings from the first inoculation to the
end of the large scale fermentation.
[0177] Integrated genes are maintained in the strain without
selection. This allows the construction of production strains that
are free of marker genes which are commonly used for maintenance of
plasmids. Production strains with integrated pathway genes can
contain minimal amounts of foreign DNA since there are no origins
of replication and other non coding DNA necessary that have to be
in plasmid based systems. The biocatalyst with integrated pathway
genes improves the yield of a production process because it avoids
energy and carbon requiring processes. These processes are the
replication of many copies of plasmids and the production of
non-pathway active proteins like marker proteins in the production
strain.
[0178] The expression of pathway genes on multi-copy plasmids can
lead to overexpression phenotypes for certain genes. These
phenotypes can be growth retardation, inclusion bodies, and cell
death. Therefore the expression levels of genes on multi copy
plasmids has to be controlled effectively by using inducible
expression systems, optimizing the time of induction of said
expression system, and optimizing the amount of inducer provided.
The time of induction has to be correlated to the growth phase of
the biocatalyst, which can be followed by measuring of optical
density in the fermentation broth. A biocatalyst that has all
pathway genes integrated on its chromosome is far more likely to
allow constitutive expression since the lower number of gene copies
avoids over expression phenotypes.
Overexpression of Heterologous Genes
[0179] Methods for overexpressing a polypeptide from a native or
heterologous nucleic acid molecule are well known. Such methods
include, without limitation, constructing a nucleic acid sequence
such that a regulatory element promotes the expression of a nucleic
acid sequence that encodes the desired polypeptide. Typically,
regulatory elements are DNA sequences that regulate the expression
of other DNA sequences at the level of transcription. Thus,
regulatory elements include, without limitation, promoters,
enhancers, and the like. For example, the exogenous genes can be
under the control of an inducible promoter or a constitutive
promoter. Moreover, methods for expressing a polypeptide from an
exogenous nucleic acid molecule in yeast are well known. For
example, nucleic acid constructs that are used for the expression
of exogenous polypeptides within Kluyveromyces and Saccharomyces
are well known (see, e.g., U.S. Pat. Nos. 4,859,596 and 4,943,529,
for Kluyveromyces and, e.g., Gellissen et al., Gene 190(1):87-97
(1997) for Saccharomyces). Yeast plasmids have a selectable marker
and an origin of replication. In addition certain plasmids may also
contain a centromeric sequence. These centromeric plasmids are
generally a single or low copy plasmid. Plasmids without a
centromeric sequence and utilizing either a 2 micron (S.
cerevisiae) or 1.6 micron (K lactis) replication origin are high
copy plasmids. The selectable marker can be either prototrophic,
such as HIS3, TRP1, LEU2, URA3 or ADE2, or antibiotic resistance,
such as, bar, ble, hph, or kan.
[0180] In another embodiment, heterologous control elements can be
used to activate or repress expression of endogenous genes.
Additionally, when expression is to be repressed or eliminated, the
gene for the relevant enzyme, protein or RNA can be eliminated by
known deletion techniques.
[0181] As described herein, any yeast within the scope of the
disclosure can be identified by selection techniques specific to
the particular enzyme being expressed, over-expressed or repressed.
Methods of identifying the strains with the desired phenotype are
well known to those skilled in the art. Such methods include,
without limitation, PCR, RT-PCR, and nucleic acid hybridization
techniques such as Northern and Southern analysis, altered growth
capabilities on a particular substrate or in the presence of a
particular substrate, a chemical compound, a selection agent and
the like. In some cases, immunohistochemistry and biochemical
techniques can be used to determine if a cell contains a particular
nucleic acid by detecting the expression of the encoded
polypeptide. For example, an antibody having specificity for an
encoded enzyme can be used to determine whether or not a particular
yeast cell contains that encoded enzyme. Further, biochemical
techniques can be used to determine if a cell contains a particular
nucleic acid molecule encoding an enzymatic polypeptide by
detecting a product produced as a result of the expression of the
enzymatic polypeptide. For example, transforming a cell with a
vector encoding acetolactate synthase and detecting increased
cytosolic acetolactate concentrations compared to a cell without
the vector indicates that the vector is both present and that the
gene product is active. Methods for detecting specific enzymatic
activities or the presence of particular products are well known to
those skilled in the art. For example, the presence of acetolactate
can be determined as described by Hugenholtz and Starrenburg, Appl.
Microbiol. Biotechnol. 38:17-22 (1992).
Reduction of Enzymatic Activity
[0182] Host microorganisms within the scope of the invention may
have reduced enzymatic activity such as reduced alcohol
dehydrogenase activity. The term "reduced" as used herein with
respect to a particular enzymatic activity refers to a lower level
of enzymatic activity than that measured in a comparable host cell
of the same species. Thus, host cells lacking alcohol dehydrogenase
activity are considered to have reduced alcohol dehydrogenase
activity since most, if not all, comparable host cells of the same
species have at least some alcohol dehydrogenase activity. Such
reduced enzymatic activities can be the result of lower enzyme
expression level, lower specific activity of an enzyme, or a
combination thereof. Many different methods can be used to make
host cells having reduced enzymatic activity. For example, a host
cell can be engineered to have a disrupted enzyme-encoding locus
using common mutagenesis or knock-out technology. See, e.g.,
Methods in Yeast Genetics (1997 edition), Adams, Gottschling,
Kaiser, and Stems, Cold Spring Harbor Press (1998), Datsenko and
Wanner, Proc. Natl. Acad. Sci. USA 97, 6640-6645, 2000.
[0183] In addition, certain point-mutation(s) can be introduced
which results in an enzyme with reduced activity.
[0184] Alternatively, antisense technology can be used to reduce
enzymatic activity. For example, host cells can be engineered to
contain a cDNA that encodes an antisense molecule that prevents an
enzyme from being made. The term "antisense molecule" as used
herein encompasses any nucleic acid molecule that contains
sequences that correspond to the coding strand of an endogenous
polypeptide. An antisense molecule also can have flanking sequences
(e.g., regulatory sequences). Thus antisense molecules can be
ribozymes or antisense oligonucleotides. A ribozyme can have any
general structure including, without limitation, hairpin,
hammerhead, or axhead structures, provided the molecule cleaves
RNA.
[0185] Host cells having a reduced enzymatic activity can be
identified using many methods. For example, host cells having
reduced alcohol dehydrogenase activity can be easily identified
using common methods, which may include, for example, measuring
ethanol formation via gas chromatography.
Increase of Enzymatic Activity
[0186] Host microorganisms of the invention may be further
engineered to have increased activity of enzymes. The term
"increased" as used herein with respect to a particular enzymatic
activity refers to a higher level of enzymatic activity than that
measured in a comparable yeast cell of the same species. For
example, overexpression of a specific enzyme can lead to an
increased level of activity in the cells for that enzyme. Increased
activities for enzymes involved in glycolysis or the isobutanol
pathway would result in increased productivity and yield of
isobutanol.
[0187] Methods to increase enzymatic activity are known to those
skilled in the art. Such techniques may include increasing the
expression of the enzyme by increasing plasmid copy number and/or
use of a stronger promoter and/or use of activating riboswitches,
introduction of mutations to relieve negative regulation of the
enzyme, introduction of specific mutations to increase specific
activity and/or decrease the Km for the substrate, or by directed
evolution. See, e.g., Methods in Molecular Biology (vol. 231), ed.
Arnold and Georgiou, Humana Press (2003).
Microorganism in Detail
[0188] Microorganism Characterized by Production of Isobutanol from
Pyruvate Via an Isobutanol Pathway Expressed in the Mitochondria at
High Yield
[0189] For a biocatalyst to produce isobutanol most economically,
it is desired to produce a high yield. Preferably, the only product
produced is isobutanol. Extra products lead to a reduction in
product yield and an increase in capital and operating costs,
particularly if the extra products have little or no value. Extra
products also require additional capital and operating costs to
separate these products from isobutanol.
[0190] The microorganism may convert one or more carbon sources
derived from biomass into isobutanol with a yield of greater than
5% of theoretical. In one embodiment, the yield is greater than
10%. In one embodiment, the yield is greater than 50% of
theoretical.
[0191] In one embodiment, the yield is greater than 60% of
theoretical. In another embodiment, the yield is greater than 70%
of theoretical. In yet another embodiment, the yield is greater
than 80% of theoretical. In yet another embodiment, the yield is
greater than 85% of theoretical. In yet another embodiment, the
yield is greater than 90% of theoretical. In yet another
embodiment, the yield is greater than 95% of theoretical. In still
another embodiment, the yield is greater than 97.5% of
theoretical.
[0192] More specifically, the microorganism converts glucose, which
can be derived from biomass into isobutanol with a yield of greater
than 5% of theoretical. In one embodiment, the yield is greater
than 10% of theoretical. In one embodiment, the yield is greater
than 50% of theoretical. In one embodiment the yield is greater
than 60% of theoretical. In another embodiment, the yield is
greater than 70% of theoretical. In yet another embodiment, the
yield is greater than 80% of theoretical. In yet another
embodiment, the yield is greater than 85% of theoretical. In yet
another embodiment the yield is greater than 90% of theoretical. In
yet another embodiment, the yield is greater than 95% of
theoretical. In still another embodiment, the yield is greater than
97.5% of theoretical
Microorganism Characterized by Production of Isobutanol from
Pyruvate Via an Isobutanol Pathway Expressed in the Mitochondria of
a PDC-Minus Yeast
[0193] In yeast, the conversion of pyruvate to acetaldehyde is a
major drain on the pyruvate pool (FIG. 2), and, hence, a major
source of competition with the isobutanol pathway. This reaction is
catalyzed by the pyruvate decarboxylase (PDC) enzyme. Reduction of
this enzymatic activity in the yeast microorganism results in an
increased availability of pyruvate and reducing equivalents to the
isobutanol pathway and may improve isobutanol production and yield
in a yeast microorganism that expresses a pyruvate-dependent
isobutanol pathway.
[0194] Reduction of PDC activity can be accomplished by 1) mutation
or deletion of a positive transcriptional regulator for the
structural genes encoding for PDC or 2) mutation or deletion of all
PDC encoding genes in a given organism. For example, in S.
cerevisiae, the PDC2 gene, which encodes for a positive
transcriptional regulator of PDC1, 5, 6 genes can be deleted; a S.
cerevisiae in which the PDC2 gene is deleted is reported to have
only .about.10% of wildtype PDC activity (Hohmann, Mol Gen Genet,
241:657-666 (1993)). Alternatively, for example, all structural
genes for PDC (e.g. in S. cerevisiae, PDC1, PDC5, and PDC6, or in
K. marxianus, PDC1) are deleted.
[0195] In addition to reduced ability to convert pyruvate to
acetaldehyde, the yeast microorganism is engineered to have
increased ability to convert ketoisovalerate to isobutyraldehyde.
In many yeast microorganisms, both of these reactions can be
catalyzed by the enzyme, pyruvate decarboxylase. For example, the
ability to convert pyruvate to acetaldehyde is reduced as described
above and the ketoisovalerate to isobutyraldehyde conversion is
increased by introducing an enzyme that has a higher specificity to
ketoisovalerate, such as the KIVD enzyme from L. lactis.
Specifically, the microorganism has sufficiently low ability to
convert pyruvate to acetaldehyde and sufficiently high ability to
convert ketoisovalerate to isobutyraldehyde to result in an
isobutanol yield of greater than 50%, 60%, 70%, 80%, 90%, 95%,
97.5% of theoretical.
[0196] Crabtree-positive yeast strains such as
Saccharomyces.cerevisiae strain that contains disruptions in all
three of the PDC alleles no longer produce ethanol by fermentation.
However, a downstream product of the reaction catalyzed by PDC,
acetyl-CoA, is needed for anabolic production of necessary
molecules. Therefore, the Pdc-mutant is unable to grow solely on
glucose, and requires a two-carbon carbon source, either ethanol or
acetate, to synthesize acetyl-CoA. (Flikweert M T, de Swaaf M, van
Dijken J P, Pronk J T. FEMS Microbiol Lett. 1999 May 1;
174(1):73-9. PMID:10234824 and van Maris A J, Geertman J M,
Vermeulen A, Groothuizen M K, Winkler A A, Piper M D, van Dijken J
P, Pronk J T. Appl Environ Microbiol. 2004 January; 70(1):159-66.
PMID: 14711638).
[0197] Thus, in an embodiment, such a Crabtree-positive yeast
strain may be evolved to generate variants of the PDC mutant that
do not have the requirement for a two-carbon molecule and has a
growth rate similar to wild-type on glucose. Any method, including
chemostat evolution or serial dilution may be utilized to generate
variants of strains with deletion of three PDC loci that can grow
on glucose as the sole carbon source at a rate similar to wild
type.
[0198] Most of the enzymatic activities that are needed for the
metabolic conversion of pyruvate to isobutanol are present in
yeast. ALS, KARI and DHAD activities are present as part of the
branched chain amino acid biosynthetic pathway. These three enzymes
are localized in the yeast mitochondria. Ketoacid decarboxylase
(KIVD) activity is present in the yeast cytosol. The native S.
cerevisiae enzymes catalyzing this conversion are Pdc1p, Pdc5p, and
Pdc1p, Aro10p and Thi3p. THI3 is annotated as coding for an
-ketoisocaproate decarboxylase and its gene product may have a role
in catabolism of amino acids to long-chain and complex alcohols. It
was shown that Thi3p is mainly responsible for the decarboxylation
of -ketoisocaproate to isoamyl alcohol (Dickinson J R, et al. The
Journal of Biological Chemistry 1997, 278:8028-8034). Deletion of
THI3 did not have an effect on isobutanol production from valine
(Dickinson, J R, et al. The Journal of Biological Chemistry 1998,
273:25751-25756). THI3 is required for expression of enzymes
involved in thiamine biosynthesis. Aro10p is a phenylpyruvate
decarboxylase, catalyzing the decarboxylation of phenylpyruvate to
phenylacetaldehyde, which is the first specific step in the Ehrlich
pathway. Aro10p was shown to have activity with ketoisovalerate
when produced in E. coli (WO 2008/098227). The overexpression of
ARO10 in S. cerevisiae indicated the involvement of
posttranscriptional regulation and/or a second protein in the
Aro10p dependent broad substrate specificity decarboxylase activity
(Vuralhan, Z., et al. 2005, Appl. and Environ. Microbiol. 71:
3276-3284). Isobutanol production from ketoisovalerate in S.
cerevisiae is catalyzed by any of the three PDC enzymes (Dickinson,
J R, et al. 1998, J. Biol. Chem. 273: 25751-25756). The last step
of the isobutanol pathway is catalyzed by an isobutyraldehyde
dehydrogenase. In yeast there are several enzymes that potentially
catalyze this reaction. Adh5p, Adh6p, and Adh7p are NADPH dependent
and Adh1p, Adh2p, Adh3p, and Adh4p are NADH dependent. Adh1p,
Adh2p, Adh5p, Adh6p, and Adh7p are cytosolic and Adh3p, and Adh4
are mitochondrial. An assessment of substrate specificity of Adh1p,
Adh2p, Adh6p, and Adh7p showed that Adh7p shows the highest
activity with isobutyraldehyde. Adh3p is involved in the
acetaldehyde ethanol shuttle that transfers mitochondrial NADH into
the cytosol under anaerobic conditions. Adh1-5proteins are all
involved in ethanol metabolism. Sfa1p is localized in the cytosol
as well as in the mitochondria. Sfa1p is involved in the formation
of long chain and complex alcohols. It is a bifunctional enzyme
which also reduces hydroxymethylfurfural using the cofactor NADH.
This indicates that all ADHs that are expressed in the yeast
mitochondria are NADH-dependent.
[0199] For the entire isobutanol pathway to be expressed in the
yeast mitochondria KIVD has to be expressed in this compartment.
All other activities are already natively expressed in the
mitochondria. However to insure sufficient capacity of the pathway
and to avoid the down regulation of the native expression levels of
the pathway enzymes all or some of the pathway enzymes can be
overexpressed. The overexpression of the enzymes that are already
natively targeted to the mitochondria can be done by expressing the
genes under the control of constitutive yeast promoters like
P.sub.ADH, or P.sub.PDC1. Expression levels can be adjusted by
strength of promoter or copy number. For the expression of ARO10 or
THI3, which are not natively localized to the mitochondria a yeast
mitochondrial targeting sequence (MTS) has to be added to the
coding sequence of the genes of interest. Several MTS have been
described in the literature. Examples are the Cox4p MTS and the MTS
of ScHMI1p. The MTS of proteins can be predicted using software
that detects the typical arrangement of charged and hydrophobic
residues that can be found in proteins targeted to the
mitochondria. These programs also predict the likely localization
of heterologous proteins in a yeast host cell. Examples of such
programs are mitoprot and psort.
[0200] Addition of yeast mitochondrial targeting sequences is
likely necessary for the mitochondrial expression of homologs of
the isobutanol pathway enzymes that are not native to the host
organism. These leader sequences are 10-80 amino acids long and are
usually on the N-terminus of the proteins although one native
example for a C-terminal leader sequence has been reported. Also,
N-terminal leader sequences have been shown to be functional if
attached to the C-terminus of a protein. In addition to native
leader sequences artificial leader sequences have been constructed
that were functional but did not reach the efficiency of their
natural counterparts. Leader sequences have a secondary structure
that leads to an alpha helix that is positively charged on one side
and hydrophobic on the opposite side. The charged as well as the
hydrophobic side of the helix facilitate the transfer of the
protein through the two mitochondrial membranes into the
mitochondrial matrix. Once the leader sequence is inside the matrix
it is removed from the protein by the mitochondrial protein
peptidase (MPP) activity. The specificity of the protease is such
that a basic amino acid, in most cases arginine is found at the -2
position of the MPP cleavage site. In addition of this recognition
of sequence close to its cleavage site MPP also recognizes the
amino terminal targeting sequence. In some cases the leader
sequence is cut twice. After the cleavage by MPP the protein is cut
again by mitochondrial intermediate peptidase (MIP) or the terminal
amino acid after the MPP cut is removed by ICP55. N-terminal as
well as C-terminal extensions of a protein sequence can impair
enzymatic activity as well as protein folding. Depending on the
properties of each enzyme a decision can be made on whether a 3' or
a 5' attachment of the leader sequence is more likely to render a
correctly folded and active protein.
[0201] Overexpression of isobutanol pathway enzymes in the
mitochondria of a yeast cell can cause overexpression phenotypes
ranging from growth retardation to non-viability. To avoid these
phenotypes and to enable fast cell growth prior to the isobutanol
production phase the expression of the pathway genes can be limited
and controlled. Limitation of the expression level can be
accomplished by the use of weak promoters and by reduction of the
copy number of the expression cassette. However these measures can
limit the productivity of the strain if the pathway enzyme activity
is limiting the isobutanol productivity of the strain. Control of
expression can be accomplished by use of inducible promoters.
Repression of the expression of one or more pathway genes during
growth allows for fast production of biomass. Induction of the
pathway enzymes allows for high productivity during isobutanol
production. Inducible promoters that are useful in yeast comprise
P.sub.MET3, and P.sub.MET17, which are repressed by methionine,
P.sub.CUP which is induced by copper, P.sub.PDC1, and P.sub.ADH1
which are induced by glucose. Given are the gene and promoter names
for Saccharomyces cerevisiae. To insure proper regulation native
promoters should be used in each of the different host
organisms.
[0202] In addition to or separate from the deletion or reduction in
the activity of PDC, the recombinant microorganisms of the present
invention may further include the deletion or reduction of the
activity of additional enzymes that (a) directly consume a
precursor of the product, e.g. an isobutanol precursor, (b)
indirectly consume a precursor of the product, e.g. of isobutanol,
or (c) repress the expression or function of a pathway that
supplies a precursor of the product, e.g. of isobutanol. These
enzymes include glycerol-3-phosphate dehydrogenase (encoded, e.g.
by GPD1 or GPD2 of S. cerevisiae) an alcohol dehydrogenase
(encoded, e.g., by adhE of E. coli or ADH1, ADH2, ADH3, ADH4, ADH5,
ADH6, or ADH7 of S. cerevisiae), 2-isopropylmalate synthase
(encoded, e.g. by LEU4 or LEU9 of S. cerevisiae), valine
transaminase (encoded, e.g. by BAT1 or BAT2 of S. cerevisiae),
Threonine deaminase (encoded, e.g. by ilvA of E. coli or CHA1 or
ILV1 of S. cerevisiae), or any combination thereof, to increase the
availability of pyruvate or reduce enzymes that compete for a
metabolite in a desired biosynthetic pathway.
Microorganism Characterized by Balancing Cofactor Usage
[0203] The ideal production microorganism produces a desirable
product at close to theoretical yield. For example the ideal
isobutanol producing organism produces isobutanol according to the
following equation:
glucose.fwdarw.isobutanol+2CO.sub.2+H.sub.2O
[0204] Accordingly, 66% of the glucose carbon results in
isobutanol, while 33% is lost as CO.sub.2. In exemplary metabolic
pathways for the conversion of pyruvate to isobutanol described by
Atsumi et al. (Atsumi et al., Nature, 2008 Jan. 3; 451(7174):86-9;
International Patent Application No PCT/US2008/053514, which is
herein incorporated by reference) two of the five enzymes used to
convert pyruvate into isobutanol according to the metabolic pathway
outlined in FIG. 1 require the reduced cofactor nicotinamide
adenine dinucleotide phosphate (NADPH). NADPH is produced only
sparingly by the cell--the reduced cofactor nicotinamide adenine
dinucleotide (NADH) is the preferred equivalent. Respiration is
required to produce NADPH in the large quantities required to
support high-level production of isobutanol.
[0205] Even if competing pathways can be eliminated or reduced in
activity by metabolic engineering, yield is limited to about 83% of
theoretical. Carbon loss to carbon dioxide (CO.sub.2) remains the
main limitation on yield in the aforementioned metabolic pathway
for the production of isobutanol.
[0206] In a metabolically engineered cell utilizing the
aforementioned metabolic pathway the production of isobutanol from
glucose results in an imbalance between the cofactors reduced
during glycolysis and the cofactors oxidized during the conversion
of pyruvate to isobutanol. While glycolysis produces 2 NADH, the
isobutanol pathway consumes 2 NADPH. This leads to a deficit of 2
NADPH and overproduction of 2 NADH per isobutanol molecule
produced, a state described henceforth as cofactor imbalance.
[0207] The terms "NADH dependent" or "NADPH dependent", refer to
the property of an enzyme to preferentially use either of the redox
cofactors. A NADH dependent enzyme has a higher catalytic
efficiency (k.sub.cat/K.sub.M) with the cofactor NADH than with the
cofactor NADPH as determined by in vitro enzyme activity
assays.
[0208] The terms "cofactor balance" or "balanced with respect to
cofactor usage" refer to a recombinant microorganism comprising a
metabolic pathway converting a carbon source to a fermentation
product and a modification that leads to the regeneration of all
redox cofactors within the recombinant microorganism producing said
fermentation product from a carbon source and wherein the
re-oxidation or re-reduction of said redox cofactors does not
require the pentose phosphate pathway, the TCA cycle or the
generation of additional fermentation products.
[0209] Stated another way, the terms "cofactor balance" or
"balanced with respect to cofactor usage" can refer to an
advantageous modification that leads to the regeneration of all
redox cofactors within the recombinant microorganism producing a
fermentation product from a carbon source and wherein said
re-oxidation or re-reduction of all redox cofactors does not
require the production of byproducts or co-products.
[0210] Stated another way, the terms "cofactor balance" or
"balanced with respect to cofactor usage" can refer to an
advantageous modification that leads to the regeneration of all
redox cofactors within the recombinant microorganism producing a
fermentation product from a carbon source under anaerobic
conditions and wherein the production of additional fermentation
products is not required for re-oxidation or re-reduction of redox
cofactors.
[0211] Stated another way, the terms "cofactor balance" or
"balanced with respect to cofactor usage" can refer to an
advantageous modification that leads to the regeneration of all
redox cofactors within the recombinant microorganism producing a
fermentation product from a carbon source and wherein said
modification increases production of said fermentation product
under anaerobic conditions compared to the parental or wild-type
microorganism and wherein additional fermentation products are not
required for the regeneration of said redox cofactors.
[0212] The terms "partial cofactor balance" or "partially balanced
with respect to cofactor usage" refer to a recombinant
microorganism comprising a metabolic pathway converting a carbon
source to a fermentation product and a modification that leads to
the regeneration of redox cofactors within the recombinant
microorganism producing said fermentation product from a carbon
source and wherein the re-oxidation or re-reduction of said redox
cofactors shows a reduced requirement of the pentose phosphate
pathway, the TCA cycle or the generation of additional fermentation
products when compared to the same recombinant microorganism
without said modification.
[0213] Stated another way, the terms "partial cofactor balance" or
"partially balanced with respect to cofactor usage" can refer to an
advantageous modification that leads to the regeneration of redox
cofactors within the recombinant microorganism producing a
fermentation product from a carbon source and wherein said
re-oxidation or re-reduction of all redox cofactors produces less
byproducts or co-products when compared to the same recombinant
microorganism without said advantageous modification.
[0214] The cell has several options for resolving a cofactor
imbalance. One is to change the relative fluxes going from glucose
through glycolysis and through the pentose phosphate pathway (PPP).
For each glucose molecule metabolized through the PPP, 2 NADPH are
generated in addition to the 2 NADH that are generated through
glycolysis (a total of 4 reducing equivalents). Therefore, use of
the PPP results in the generation of excess reducing equivalents
since only two reducing equivalents are consumed during the
production of isobutanol. Flux through the PPP results in the loss
of one additional molecule of CO.sub.2 per molecule of glucose
consumed, which limits the yield of isobutanol that can be
achieved. The production of excess reducing equivalents leads to
the production of reduced byproducts or it necessitates
respiration.
[0215] Another way the cell can generate NADPH is via the TCA
cycle. Flux through the TCA cycle results in carbon loss through
CO.sub.2 and in production of NADH in addition to the NADPH
required for the isobutanol pathway. The excess NADH would have to
be utilized for energy production through respiration or for
byproduct formation. Thus any flux through the TCA cycle will
reduce the yield of the isobutanol production and it will require
oxygen.
[0216] In addition to this basic cofactor imbalance, in yeast,
NAD(P)H is not able to efficiently cross the mitochondrial
membrane. Thus, to make available reducing equivalents for the
isobutanol pathway in the mitochondria, an NADH shuttle (reviewed
in Bakker et al., 2001, FEMS Microbiology Reviews 25:15-37) could
be used or under aerobic conditions, the TCA cycle can be used to
generate NADH in the mitochondria. An example of an NADH shuttle is
the ethanol/acetaldehyde shuttle. An alcohol dehydrogenase (ADH) in
the cytosol can oxidize an NADH to NAD+ while converting an
acetaldehyde to ethanol. As both ethanol and acetaldehyde freely
transverse membranes, generated ethanol can be used to reduce an
NAD+ to NADH in the mitochondria by a mitochondrially localized ADH
and generate acetaldehyde. In this fashion, a cytosolic NADH can be
shuttled into the mitochondria. The use of the TCA cycle or the
NADH shuttles would still result in a cofactor imbalance in the
mitochondria as the isobutanol pathway consumes NADPH.
[0217] An economically competitive isobutanol process requires a
high yield from a carbon source. Lower yield means that more
feedstock is required to produce the same amount of isobutanol.
Feedstock cost is the major component of the overall operating
cost, regardless of the nature of the feedstock and its current
market price. From an economical perspective, this is important
because the cost of isobutanol is dependent on the cost of the
biomass-derived sugars. An increase in feedstock cost results in an
increase in isobutanol cost.
[0218] Thus, in one embodiment of the invention, a recombinant
microorganism comprising a modification of the metabolic pathway
for the production of a fermentation product wherein said
modification balances the cofactor usage of the recombinant
microorganism producing said fermentation product from a carbon
source is provided.
[0219] In a specific aspect, a microorganism is provided in which
cofactor usage is balanced during the production of isobutanol, in
this case, production of isobutanol from pyruvate utilizes the same
cofactor that is produced during glycolysis and shuttled into the
mitochondria.
[0220] In another embodiment, a microorganism is provided in which
cofactor usage is balanced during the production of a fermentation
product and the microorganism produces the fermentation product at
a higher yield compared to a modified microorganism in which the
cofactor usage in not balanced.
[0221] In a specific aspect, a microorganism is provided in which
cofactor usage is balanced during the production of isobutanol and
the microorganism produces isobutanol at a higher yield compared to
a modified microorganism in which the cofactor usage in not
balanced.
[0222] In yet another embodiment, a modified microorganism in which
cofactor usage is balanced during the production of a fermentation
product may allow the microorganism to produce said fermentation
product under anaerobic conditions, conditions under which a
modified microorganism in which the cofactor usage in not balanced
during production of a fermentation product may not be able to
produce a fermentation product.
[0223] In a specific aspect, a modified microorganism in which
cofactor usage is balanced during the production of isobutanol may
allow the microorganism to produce said isobutanol under anaerobic
conditions, conditions under which a modified microorganism in
which the cofactor usage is not balanced during production of
isobutanol may not be able to produce isobutanol.
[0224] One compound to be produced by the recombinant microorganism
according to the present invention is isobutanol. However, the
present invention is not limited to isobutanol. The invention may
be applicable to any metabolic pathway that is imbalanced with
respect to cofactor usage. One skilled in the art is able to
identify pathways that are imbalanced with respect to cofactor
usage and apply this invention to provide recombinant
microorganisms in which the same pathway is balanced with respect
to cofactor usage. One skilled in the art will recognize that the
identified pathways may be of longer or shorter length, contain
more or fewer genes or proteins, and require more or fewer
cofactors than the exemplary isobutanol pathway. Further, one
skilled in the art will recognize that in certain embodiments, such
as a recombinant microbial host that produces an excess of NADPH,
certain embodiments of the present invention may be adapted to
convert NADPH to NADH.
Microorganism Characterized by Providing Cofactor Balance Via KARI
and ADH that are Able to Utilize NADH.
[0225] As detailed above, production of isobutanol from glucose
using the aforementioned pathway in the mitochondria results in
cofactor imbalance as 2 NADHs are generated in the cytosol via
glycolysis and 2 NADPHs are consumed in the mitochondria by the
isobutanol pathway. Yeast cells are able to transfer the reducing
equivalents from the cytosol to the mitochondria via an NADH
shuttle. This results in an NADH in the mitochondria, which would
still result in a cofactor imbalance with the isobutanol pathway.
This imbalance can be resolved by the use of a mitochondrial
isobutanol pathway that consumes NADH instead of NADPH. For the
mitochondrial isobutanol pathway to consume NADH, the NADPH
dependent enzymes, KARI and ADH can be replaced by either an NADH
dependent homolog or an enzyme that has been engineered to use
NADH.
[0226] The NADH shuttles that are available to transfer cytosolic
NADH into the mitochondria have a limited capacity and might limit
the productivity of a yeast isobutanol production strain if said
strain produces all isobutanol pathway enzymes in the mitochondria.
Isobutyraldehyde is assumed to be membrane permeable.
Isobutyraldehyde produced in the mitochondrial matrix can
transverse the mitochondrial membrane and can be reduced to
isobutanol by a cytosolic ADH. If an NADH dependent ADH is used in
the isobutanol pathway, localization of said ADH to the cytosol
instead of the mitochondrial matrix can reduce the flux through the
NADH shuttle pathways by half. In this case 50% of the reduced
cofactor consumed in the isobutanol pathway is regenerated in the
same compartment where it is oxidized. This may improve
productivity of an isobutanol production strain. This approach of
expressing the isobutyraldehyde reducing activity in the cytosol is
also viable for NADPH dependent ADHs, since most of the NADPH
turnover in yeast cells occurs in the cytosol.
[0227] In yeast, an NADPH dependent KARI is expressed endogenously.
As the endogenous enzyme could also function in the mitochondrial
isobutanol pathway and consume NADPH, it would results in an
imbalance in the cofactor usage. Therefore, the gene encoding this
enzyme would be deleted and the activity complemented by the NADH
dependent enzyme. Native yeast Ilv5p has two functions. One is the
catalytic KARI activity and the other is stabilization of
mitochondrial DNA. Many KARIs such as for example the bacterial
homologs do not have the DNA stabilizing function. If the NADH
dependent KARI that is used in the isobutanol producing yeast does
not provide the DNA stabilizing function a mutant ILV5 which has
lost its catalytic KARI activity but maintains its DNA stabilizing
functionality can be used to ensure mitochondrial stability. Such
mutants are known in the art. Alternatively a host strain
containing wild-type ILV5 can be used to maintain mitochondrial DNA
stability with a NADH dependent KARI overexpressed in addition.
Exemplary NADH-dependent KARI enzymes are discussed and described
in the commonly owned and co-pending U.S. application Ser. No.
12/610,784, hereby incorporated by reference in its entirety. There
are two NADPH dependent alcohol dehydrogenases, Adh6p and Adh7p in
S. cerevisiae, that are able to convert isobutyraldehyde to
isobutanol. However, these enzymes are likely expressed in the
cytosol of yeast and should not affect the cofactor balance in the
mitochondria.
[0228] In one embodiment of the invention, a microorganism is
provided in which the cofactor-dependent final step for the
conversion of isobutyraldehyde to isobutanol is catalyzed by an
NADH dependent alcohol dehydrogenase. In one specific embodiment,
such an alcohol dehydrogenase may be encoded by the Drosophila
melanogaster alcohol dehydrogenase (Accession: NT.sub.--033779,
Region: 14615555.14618902) (SEQ ID NO: 161) or homologs thereof. In
another specific embodiment, such an alcohol dehydrogenase may be
encoded by Lactococcus lactis adhA codon optimized for S.
cerevisiae (Ll_adhA_coSc-1) (SEQ ID NO: 67) coding for L. lactis
AdhA (SEQ ID NO: 68).
[0229] In one embodiment of this invention only one of the redox
cofactor dependent conversions of the isobutanol pathway is
catalyzed by an enzyme that is NADH dependent while the other
enzyme is NADPH dependent. In a specific aspect the enzyme that is
NADH dependent is the ADH converting isobutyraldehyde to isobutanol
and the NADPH dependent enzyme is KARI converting acetolactate into
dihydroxyisovalerate. This partial cofactor balance improves the
yield of isobutanol production of a recombinant microorganism
expressing an isobutanol pathway.
Microorganism Characterized by Providing Cofactor Balance Via
Malate Pathway
[0230] Production of isobutanol from glucose using the
aforementioned pathway in the mitochondria results in cofactor
imbalance as 2 NADHs are generated in the cytosol via glycolysis
and 1 or 2 NADPHs are consumed in the mitochondria by the
isobutanol pathway. Whether 1 or 2 redox cofactors are consumed in
the mitochondria depends on the isobutanol pathway. If pyruvate is
converted to isobutanol in the mitochondria as illustrated in FIGS.
2, 3, and 5 then 2 NAPH are consumed in this compartment. If the
conversion of isobutyraldehyde to isobutanol takes place in the
cytosol as is the case for the pathways illustrated in FIGS. 4, 6,
8, and 10 then one NADPH is consumed in the mitochondria. One
approach to balance these cofactors is to introduce a bypass in
which the NADHs in the cytosol is oxidized to generate a compound
that is able to pass into the mitochondria and then for that
compound to be utilized to reduce an NADP+ in the mitochondria. One
such compound is malate. Malate can be transported into the
mitochondria via the dicarboxylate carrier, Dic1p. Malate is
generated in the cytosol from either pyruvate or phosphoenol
pyruvate (PEP) via an intermediate, oxaloacetate (OAA). OAA is
produced from pyruvate via Pyruvate carboxylase (Pyc1p or Pyc2p) or
alternatively from PEP via phosphoenolpyruvate carboxylase (E. coli
Ppc) or phosphoenolpyruvate carboxylkinase (Pck1). The conversion
of OAA to malate by a malate dehydrogenase (Mdh2p) reoxidizes a
cytosolic NADH. Malate in the mitochondria can then be converted to
pyruvate using the mitochondrial malic enzyme, Mae1p, which in the
process reduces an NADP+, thus generating a mitochondrial NADPH.
Since 2 malate can be produced per glucose, 2 cytosolic NADHs are
converted into 2 mitochondrial NADPHs by the use of this
bypass.
[0231] Microorganism Characterized by Providing Cofactor Balance
Via a Transhydrogenase
[0232] As detailed above, production of isobutanol from glucose
using the aforementioned pathway in the mitochondria results in
cofactor imbalance as 2 NADHs are generated in the cytosol via
glycolysis and 2 NADPHs are consumed in the mitochondria by the
isobutanol pathway. Yeast cells are able to transfer the reducing
equivalents from the cytosol to the mitochondria via an NADH
shuttle. This results in an NADH in the mitochondria, which would
still result in a cofactor imbalance with the isobutanol pathway.
This imbalance can be resolved by the use of a
transhydrogenase.
[0233] Yeast do not contain transhydrogenases. The heterologous
expression of bacterial, plant or other eukaryotic
transhydrogenases in yeast can be used to provide cofactor balance.
Previous attempts to express heterologous transhydrogenases in
yeast resulted in the conversion of NADPH to NADH. The soluble
transhydrogenase from Azotobacter vinelandii was functionally
expressed in S. cerevisiae (Nissen, T L, et al. 2000 Yeast 16,
463-474.) to introduce an alternative pathway for the reoxidation
of NADH with the goal of reducing glycerol production. The approach
was unsuccessful because of the catalysis of the opposite reaction
by the heterologous transhydrogenase. It was reported that the
native soluble transhydrogenase in E. coli (SthA) catalyze the
conversion of NADPH to NADH (Sauer, U., et al., 2004 The Journal of
Biological Chemistry 279, 6613-6619.) The membrane bound
transhydrogenase from E. coli coded by pntA and pntB was
functionally expressed in S. cerevisiae (Anderlund et al., 1999
Applied and Environmental Microbiology 65, 2333-2340.) and it was
observed that this enzyme also catalyzed the conversion of NADPH to
NADH and hence was not useful for the reoxidation of NADH in the
strains that were constructed. It was found that the
transhydrogenase was inserted into the endoplasmic reticulum
membrane. This targeting is the likely reason for the failure of
the transhydrogenase to catalyze reoxidation of NADH, which is its
native function in E. coli (Sauer, U., et al., The Journal of
Biological Chemistry 2004 279 6613-6619.). The transhydrogenases
that natively convert NADH to NADPH are generally membrane proteins
that use the proton motive force to drive the reaction they are
catalyzing. Bacterial transhydrogenases are in the cell membrane
while plant and mammalian transhydrogenases are located in the
inner mitochondrial membrane. For the heterologous transhydrogenase
expression these enzymes can be targeted either to the cytoplasmic
membrane or to the mitochondrial membrane in yeast. To achieve this
leader sequences have to be added to the heterologous proteins. The
mechanism of membrane targeting is well understood and the
direction of normally cytosolic proteins to the mitochondria has
been demonstrated. These targeting mechanisms are well conserved
throughout the eukaryotes as demonstrated by the use of plant
mitochondrial targeting sequences in yeast. Eukaryotic
transhydrogenases can be expressed in yeast with their native
targeting and sorting sequences. Bacterial transhydrogenases can be
fused to mitochondrial targeting and membrane sorting sequences
that have been characterized in yeast inner membrane proteins. For
the expression of a transhydrogenase in yeast a fungal source
organism is preferred and among the fungi an ascomycete is
preferred. Several transhydrogenases have been found by homology
searches. Preferred source organisms for the transhydrogenase
include Neurospora crassa, Aspergillus clavatus, Aspergillus
oryzae, Aspergillus Niger, Aspergillus fumigates, Aspergillus
terreus, Phaeosphaeria nodorum, Coccidioides immitis, Neosartorya
fischeri, Magnaporthe grisea, Ajellomyces capsulate, Botryotinia
fuckeliana, Sclerotinia sclerotiorum, Podospora anserine, and
Pyrenophora tritici-repentis. In a preferred embodiment the
transhydrogenase of Neurospora crassa (GI:164426165) is expressed
in yeast to achieve cofactor balance of a mitochondrially produced
isobutanol pathway. The gene codes for a NAD(P) transhydrogenase,
mitochondrial precursor and consists of two subunits alpha and beta
coded by the regions PNTA and PNTB.
[0234] A preferred transhydrogenase under conditions in which the
reduced cofactor NADPH is limiting is one that preferentially
catalyzes the conversion of NADH to NADPH. For example,
membrane-bound transhydrogenases have been described in eukaryotes
as for example in mammalian cells (Rydstrom J., Trends in
Biochemical Sciences, 2006, 31(7): 355-358) as well as in bacteria
such as E. coli (Sauer U., et al., The Journal of Biological
Chemistry 2004, 279: 6613-6619). Membrane bound transhydrogenases
require energy in form of proton translocation to catalyze the
reaction. As long as there is enough energy available to maintain
the proton gradient across the cell membrane or across the inner
mitochondrial membrane a transhydrogenase may thus be used to
balance an otherwise imbalanced metabolic pathway. Thus, expression
of these transhydrogenases in the mitochondria of yeast can resolve
the cofactor imbalance in the mitochondria.
Microorganism Characterized by Providing Partial Cofactor Balance
Via ADH that is Able to Utilize NADH.
[0235] As detailed above, production of isobutanol from glucose
using the aforementioned pathway in the mitochondria results in
cofactor imbalance as 2 NADHs are generated in the cytosol via
glycolysis and 2 NADPHs are consumed in the mitochondria by the
isobutanol pathway. Yeast cells are able to transfer the reducing
equivalents from the cytosol to the mitochondria via an NADH
shuttle. This results in an NADH in the mitochondria, which would
still result in a cofactor imbalance with the isobutanol pathway.
This imbalance can be partially resolved by the use of a
mitochondrial isobutanol pathway that consumes 1 NADH and 1 NADPH
instead of 2 NADPH. For the mitochondrial isobutanol pathway to
consume NADH, the NADPH dependent enzyme, ADH can be replaced by
either an NADH dependent homolog or an enzyme that has been
engineered to use NADH.
[0236] There are two NADPH dependent alcohol dehydrogenases, Adh6p
and Adh7p in S. cerevisiae, that are able to convert
isobutyraldehyde to isobutanol. However, these enzymes are likely
expressed in the cytosol of yeast and should not affect the
cofactor balance in the mitochondria much as long as the conversion
of isobutyraldehyde to isobutanol takes place in that compartment.
If the reduction of isobutyraldehyde is catalyzed by a cytosolic
NADH dependent ADH the endogenous NADPH dependent enzymes might
interfere with the cofactor balance depending on the expression
levels of these endogenous enzymes. In case of interference the
endogenous ADH activities can be reduced or eliminated for example
by disruption of the native coding genes.
[0237] In one embodiment of the invention, a microorganism is
provided in which the cofactor-dependent final step for the
conversion of isobutyraldehyde to isobutanol is catalyzed by an
NADH dependent alcohol dehydrogenase. In a specific aspect, such an
alcohol dehydrogenase may be encoded by the Drosophila melanogaster
alcohol dehydrogenase (Accession: NT.sub.--033779, Region:
14615555..14618902) or homologs thereof. In another specific aspect
such an alcohol dehydrogenase may be Lactococcus lactis AdhA (SEQ
ID NO: 68).
[0238] In one embodiment of this invention only one of the redox
cofactor dependent conversions of the isobutanol pathway is
catalyzed by an enzyme that is NADH dependent while the other
enzyme is NADPH dependent. In a specific aspect the enzyme that is
NADH dependent is the ADH converting isobutyraldehyde to isobutanol
and the NADPH dependent enzyme is KARI converting acetolactate into
dihydroxyisovalerate. This partial cofactor balance improves the
yield of isobutanol production of a recombinant microorganism
expressing an isobutanol pathway.
[0239] A partial cofactor balance as that achieved by use of a NADH
dependent ADH in the isobutanol pathway can be combined with the
use of the malate pathway and it can be combined with the
expression of a transhydrogenase. These combined approaches can
lead to complete cofactor balance of the production
microorganism.
Microorganism Characterized by Increased Capacity to Produce
Intermediates of the Isobutanol Pathway
[0240] As a consequence of increased yield of isobutanol, it
follows that this yeast microorganism exhibits a higher capacity to
produce the intermediates of the isobutanol pathway including, but
not limited to, acetolactate, 2,3-dihydroxyisovalerate,
keto-isovalerate, and isobutyraldehyde.
Method of Using Microorganism for High-Yield Isobutanol
Fermentation
[0241] In a method to produce isobutanol from a carbon source at
high yield, the yeast microorganism is cultured in an appropriate
culture medium containing a carbon source.
[0242] Another exemplary embodiment provides a method for producing
isobutanol comprising a recombinant yeast microorganism of the
invention in a suitable culture medium containing a carbon source
that can be converted to isobutanol by the yeast microorganism of
the invention.
[0243] In certain embodiments, the method further includes
isolating isobutanol from the culture medium. For example,
isobutanol may be isolated from the culture medium by any method
known to those skilled in the art, such as distillation,
pervaporation, or liquid-liquid extraction. The GIFT.RTM.
separation process is discussed and described in the commonly owned
and co-pending U.S. patent application Ser. No. 12/342,992 (US
Publication No. 20090171129), hereby incorporated by reference in
its entirety.
EXAMPLES
[0244] The following examples illustrate how yeast microorganisms
are modified to produce isobutanol pathway enzymes in their
mitochondria, allowing for the production of isobutanol under
conditions that include anaerobic conditions.
Sample Preparation
[0245] All samples (2 mL) from fermentation experiments performed
in shake flasks are centrifuged at 14,000.times.g for 10 min and
the supernatant is stored at 4.degree. C. for later analysis.
Analysis of substrates and products is performed using authentic
standards (>99%, obtained from Sigma-Aldrich), and a 5-point
calibration curve (with 1-pentanol as an internal standard for
analysis by gas chromatography).
Determination of Optical Density and Cell Dry Weight The optical
density of the yeast cultures is determined at 600 nm using a DU
800 spectrophotometer (Beckman-Coulter, Fullerton, Calif., USA).
Samples are diluted as necessary to yield an optical density of
between 0.1 and 0.8. The cell dry weight is determined by
centrifuging 50 mL of culture prior to decanting the supernatant.
The cell pellet is washed once with 50 mL of milliQ H.sub.2O,
centrifuged and the pellet is washed again with 25 mL of milliQ
H.sub.2O. The cell pellet is then dried at 80.degree. C. for at
least 72 hours. The cell dry weight is calculated by subtracting
the weight of the centrifuge tube from the weight of the centrifuge
tube containing the dried cell pellet.
Gas Chromatography
[0246] Analysis of volatile organic compounds, including ethanol
and isobutanol is performed on a HP 5890 gas chromatograph fitted
with an HP 7673 Autosampler, a DB-FFAP column (J&W; 30 m
length, 0.32 mm ID, 0.25 .mu.M film thickness) or equivalent
connected to a flame ionization detector (FID). The temperature
program is as follows: 200.degree. C. for the injector, 300.degree.
C. for the detector, 100.degree. C. oven for 1 minute, 70.degree.
C./minute gradient to 235.degree. C., and then hold for 2.5
min.
[0247] Analysis is performed using authentic standards (>99%,
obtained from Sigma-Aldrich), and a 5-point calibration curve with
1-pentanol as the internal standard.
High Performance Liquid Chromatography
[0248] Analysis of glucose and organic acids is performed on a
HP-1100 High Performance Liquid Chromatography system equipped with
an Aminex HPX-87H Ion Exclusion column (Bio-Rad, 300.times.7.8 mm)
or equivalent and an H.sup.+ cation guard column (Bio-Rad) or
equivalent. Organic acids are detected using an HP-1100 UV detector
(210 nm, 8 nm 360 nm reference) while glucose is detected using an
HP-1100 refractive index detector. The column temperature is
60.degree. C. This method is Isocratic with 0.008 N sulfuric acid
in water as mobile phase. Flow is set at 0.6 mL/min. Injection size
is 20 .mu.L and the run time is 30 minutes.
Molecular Biology and Bacterial Cell Culture
[0249] Standard molecular biology methods for cloning and plasmid
construction are generally used, unless otherwise noted (Sambrook,
J., Russel, D. W. Molecular Cloning, A Laboratory Manual. 3 ed.
2001, Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory
Press).
[0250] Standard recombinant DNA and molecular biology techniques
used in the Examples are well known in the art and are described by
Sambrook, J., Russel, D. W. Molecular Cloning, A Laboratory Manual.
3 ed. 2001, Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory
Press; and by T. J. Silhavy, M. L. Bennan, and L. W. Enquist,
Experiments with Gene Fusions, Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y. (1984) and by Ausubel, F. M. et al.,
Current Protocols in Molecular Biology, pub. by Greene Publishing
Assoc. and Wiley-Interscience (1987).
[0251] General materials and methods suitable for the routine
maintenance and growth of bacterial cultures are well known in the
art. Techniques suitable for use in the following examples may be
found as set out in Manual of Methods for General Bacteriology
(Phillipp Gerhardt, R. G. E. Murray, Ralph N. Costilow, Eugene W.
Nester, Willis A. Wood, Noel R. Krieg and G. Briggs Phillips,
eds.), American Society for Microbiology, Washington, D.C. (1994))
or by Thomas D. Brock in Biotechnology: A Textbook of Industrial
Microbiology, Second Edition, Sinauer Associates, Inc., Sunderland,
Mass. (1989).
Aerobic Batch Fermentations
[0252] 3 mL overnight cultures in YPD are inoculated from colonies
or patches of the strains to be tested. These overnight cultures
are incubated in 14 mL culture tubes for 18 h at 30.degree. C., in
an orbital shaker at 250 rpm. These overnight cultures are then
used to inoculate 100 mL YPD cultures in 1 L shake flasks. In the
case of a PDC-deficient (Pdc-minus) C2-dependent S. cerevisiae
strain, the overnight culture and the 100 mL culture are grown in
YPEthanol (20 g-ethanol L.sup.-1). The cultures are harvested at an
OD600 of 0.6-1 in mid- to late-log phase. The cells are resuspended
in 50 mL YPD medium containing 50 g/L glucose and the cultures are
incubated in 250 mL shake flasks at 30.degree. C., 250 rpm. Samples
(2 mL) are taken at 24 and 48 hours and cells removed by
centrifugation at .gtoreq.14000.times.g for 10 min in a
microcentrifuge. The supernatants are kept at 4.degree. C. until
analysis by Gas Chromatography and/or High Performance Liquid
Chromatography.
Anaerobic Batch Fermentations
[0253] Anaerobic batch cultivations are performed at 30.degree. C.
in stoppered 100 mL serum bottles that are inoculated and sampled
in an anaerobic chamber to maintain anaerobic conditions throughout
the experiment. A 20 mL aliquot of medium with an initial glucose
concentration of 20 g-glucose L.sup.-1 is used (Kaiser et al.,
Methods in Yeast Genetics, a Cold Spring Harbor Laboratory Manual
(1994)). Samples (2 mL) are taken at 24 and 48 hours. The
fermentation is ended after 48 hours or when all glucose is
consumed. Samples are processed and analyzed by Gas Chromatography
and/or High Performance Liquid Chromatography as described
above.
Yeast Transformations--S. cerevisiae
[0254] S. cerevisiae strains were transformed by the Lithium
Acetate method (Gietz et al., Nucleic Acids Res. 27:69-74 (1992)).
Cells from 50 mL YPD cultures were collected by centrifugation
(2700 rcf, 2 minutes, 25.degree. C.) once the cultures reached an
OD.sub.600 of 1.0. The cells were washed cells with 50 mL sterile
water and collecte.sup.d by centrifugation at 2700 rcf for 2
minutes at 25.degree. C. The cells were washed again with 25 mL
sterile water and cells were collected by centrifugation at 2700
rcf for 2 minutes at 25.degree. C. The cells were resuspended in 1
mL of 100 mM lithium acetate and transferred to a 1.5 mL Eppendorf
tube. The cells were collected by centrifugation for 20 sec at
18,000 rcf, 25.degree. C. The cells were resuspended in a volume of
100 mM lithium acetate that was approximately 4.times. the volume
of the cell pellet. A mixture of DNA (final volume of 15 .mu.l with
sterile water), 72 .mu.l 50% PEG, 10 .mu.l 1 M lithium acetate, and
3 .mu.l denatured salmon sperm DNA was prepared for each
transformation. In a 1.5 mL tube, 15 .mu.l of the cell suspension
was added to the DNA mixture (85 n1), and the transformation
suspension was vortexed with 5 short pulses. The transformation was
incubated at 30 minutes at 30.degree. C., followed by incubation
for 22 minutes at 42.degree. C. The cells were collected by
centrifugation for 20 sec at 18,000 rcf, 25.degree. C. The cells
were resuspended in 100 .mu.l SOS (1 M sorbitol, 34% (v/v) YEP (1%
yeast extract, 2% peptone), 6.5 mM CaCl.sub.2) and spread over a
SC+glucose-uracil plate.
Yeast Colony PCR
[0255] Yeast colony PCR is performed using the Epicentre Failsafe
PCR kit (using Buffer E). Reactions are set up according to
manufacturer's protocol and a small amount of yeast cells are
resuspended in the reaction. PCR reactions are run according to
standard protocols.
Preparation of E. coli Electrocompetent Cells and
Transformation
[0256] The acceptor strain culture is grown in SOB-medium
(Sambrook, J., Russel, D. W. Molecular Cloning, A Laboratory
Manual. 3 ed. 2001, Cold Spring Harbor, N.Y.: Cold Spring Harbor
Laboratory Press) to an OD.sub.600 of about 0.6 to 0.8. The culture
is concentrated 100-fold, washed once with ice cold water and 3
times with ice cold 10% glycerol. The cells are then resuspended in
150 .mu.L of ice-cold 10% glycerol and aliquoted into 50 .mu.L
portions. These aliquots are used immediately for standard
transformation or stored at -80.degree. C. These cells are
transformed with the desired plasmid(s) via electroporation. After
electroporation, SOC medium (Sambrook, J., Russel, D. W. Molecular
Cloning, A Laboratory Manual. 3 ed. 2001, Cold Spring Harbor, N.Y.:
Cold Spring Harbor Laboratory Press) is immediately added to the
cells. After incubation for an hour at 37.degree. C. the cells are
plated onto LB-plates containing the appropriate antibiotics and
incubated overnight at 37.degree. C.
Transformation of Kluyveromyces marxianus
[0257] For the integration of the isobutanol pathway into the
chromosome of the yeast strains a modular cassette approach is
taken. Two plasmids are constructed wherein plasmid 1 contains from
5' to 3': P.sub.PDC1 promoter, pathway genes with their promoters
and terminators, 5' end of URA3 with its promoter. Plasmid 2
contains from 5' to 3':3' end of URA3 with its terminator, pathway
genes with their promoters and terminators, PDC1 terminator. The
URA3 sequences overlap to provide homology between the two
plasmids. These features of the plasmids can be cut out of the
vectors using restriction enzymes or amplified by PCR to get linear
DNA pieces. These pieces are then transformed into the host
organism. Homologous recombination leads to integration of both DNA
pieces into the PDC1 locus on the chromosome deleting PDC1. At the
same time the URA3 pieces in each linear DNA fragment recombine to
give a functional URA3 marker that is used for selection.
[0258] K. marxianus is grown in YPD medium at 30.degree. C. and 250
rpm to an OD600 of 1.0-4.0. The cells are pelleted and washed with
10 mL of EB (10 mM Tris-Cl, 270 mM sucrose, 1 mM MgCl2, pH 7.5).
The cells are again pelleted, and then resuspended in 10 mL IB
(YPD+ fresh 25 mM DTT, 20 mM HEPES, pH 8.0) and incubated at
30.degree. C. and 250 rpm for 30 minutes. The cells are then
pelleted and washed with 10 mL EB, and the cells are kept on ice
from this point on. The cells are pelleted and resuspended in 1 mL
EB and transferred to a microfuge tube. The cells are pelleted in a
microfuge, and then resuspended in the appropriate amount of EB to
make the final cell concentration 30-380D/mL. 400 .mu.L of the cell
suspension is added to a chilled cuvette (4 mm gap), and 50 .mu.L
of linearized DNA (1-2 .mu.g) is added and mixed by pipetting. The
cells are incubated in the cuvette with DNA on ice for 15 to 30
minutes, and then electroporated at 1.8 kV, 1000.OMEGA., and 25
.mu.F. The cells are washed out of the cuvette with 1 mL YPD, and
transferred to a fresh 50 mL tube and incubated at 30.degree. C.
and 250 rpm for 4 hours. After recovery, the transformation is
plated on 7 selection plates (200 .mu.L per plate) and incubated at
30.degree. C.
Construction of Strains and Plasmids
[0259] The Kluyveromyces marxianus strain GEVO1068 (NRRL-Y-7571)
was obtained from the USDA collection.
[0260] GEVO1947 is a ura3.DELTA. version of GEVO1068 and was
generated by selection on 5-fluorouracil-6-carboxylic acid
monohydrate (FOA). The K. marxianus URA3 gene was deleted by
transformation of GEVO1068 with a PCR fragment of Km_URA3 carrying
a deletion of 348 bp that was amplified from pGV1799 using primers
394 and 395. The Km_ura3.DELTA. transformants were selected by
plating on 5-FOA plates. The 5-FOA resistant colonies were screened
for correct phenotype (auxotrophic for uracil) and for the correct
genotype by colony PCR using primers 562 and 837. The wild-type
Km_URA3 gene would result in a PCR product of 871 bp using this
primer pairs while the presence of the deletion allele would result
in a product of 527 bp. This analysis identified FOA.sup.R
transformants with the expected 350 bp PCR product for a strain
containing the deletion allele). In addition, several transformants
generated a slightly larger band using the same primer pair. This
PCR result is consistent with the hypothesis that these
transformants contain a smaller deletion (.about.200 bp) in the
KmURA3. A transformant with the putative smaller deletion was named
GEVO1947 (Km_ura3.DELTA.2).
[0261] The K. marxianus strain GEVO1969 was generated by deletion
of PDC1 in GEVO1947. The K. marxianus PDC1 gene was replaced with a
G418R marker (aminoglycoside-3'-phosphotransferase (aph) from Tn5
under the TEF1 promoter) by transformation of GEVO1947 with a
disruption cassette which contained from 5' to 3', the Km_PDC1
promoter, the G418R marker, and the Km_PDC1 terminator sequences.
The Km_PDC1 promoter was amplified from K. marxianus genomic DNA
using primers 1671 and 1672. The G418R marker was amplified from
pGV1503 using primers 1673 and 1674. The Km_PDC1 terminator was
amplified from K. marxianus genomic DNA using primers 1675 and
1676. Primers 1673 and 1674 have 5' extensions that are
complementary to primers 1672 and 1675, respectively. These three
fragments were combined via two rounds of SOE PCR to generate the
disruption cassette. In the first round of SOE PCR, the Km_PDC1
promoter and the G418R marker were combined using primers 1671 and
1674, and the G418R marker and the Km_PDC1 terminator were combined
using primers 1673 and 1676. In the second round of SOE PCR, the
Km_PDC1 promoter-G418 marker fragment was combined with the Km_PDC1
terminator using primers 1671 and 1676, and the Km_PDC1 promoter
was combined with the G418R marker-Km_PDC1 terminator fragment
using primers 1671 and 1676. These two PCR products were pooled
together, purified and transformed into GEVO1947. Transformants
were selected on YPD+G418 plates. Transformants were confirmed for
successful deletion of Km_PDC1 by their inability to grow
anaerobically, colony PCR, and a lack of ethanol production. One
such clone was named GEVO1969.
[0262] The PDC-deficient (Pdc-) S. cerevisiae strain GEVO1581 was
obtained from Prof. Paul van Heusden at the University of Leiden in
the Netherlands. Strain GEVO1584 was generated by crossing GEVO1187
and GEVO1537 and selecting for diploids from mating between the two
strains by selecting for growth on minimal glucose media lacking
uracil. The resulting diploids were sporulated and progeny with the
appropriate genotype was isolated. Strain GEVO7777 is generated by
crossing GEVO1187 and GEVO1537 and selecting for diploids from
mating between the two strains by selecting for growth on minimal
glucose media lacking uracil. The resulting diploids are sporulated
and progeny with the appropriate genotype is isolated.
[0263] The C2-independent strain, GEVO1863, was generated from the
PDC-deficient (Pdc-) S. cerevisiae GEVO1584 by evolution. This
evolution was performed essentially as previously described (van
Maris, A., et al., Applied and Environmental Microbiology, 2004,
70(1):159-166). Briefly, GEVO1584 was grown in a chemostat using
minimal media with ethanol as a carbon source. The media was
switched to minimal media with 7.125 g/L glucose and 0.375 g/L
acetate. Once the culture was stabilized, the acetate level was
decreased to 0 g/L over a period of 3 weeks. Over the same time
period the glucose concentration in the feed was increased so that
the carbon concentration in the feed was constant throughout the
experiment. A single colony was isolated from the chemostat and was
further evolved through 24 serial dilutions in YPD in test tubes.
GEVO1863 is an isolate from this evolved culture. This strain does
not require ethanol or acetate for growth.
[0264] GEVO1803 was made by transforming GEVO1186 with the 6.7 kb
pGV1730 (contains S. cerevisiae TRP1 marker and the CUP1
promoter-driven B. subtilis BsalsS2 (SEQ ID NO: 151) that had been
linearized by digestion with NruI. Completion of the digest was
confirmed by running a small sample on a gel. The digested DNA was
then purified using Zymo Research DNA Clean and Concentrator and
used in the transformation. Trp+ clones were confirmed for the
correct integration into the PDC1 locus by colony PCR using primer
pairs 1440+1441 and 1442+1443 for the 5' and 3' junctions,
respectively. Transcription of BsalsS2 was confirmed by qRT-PCR
using primer pairs 1323+1324 (qRT-PCR).
[0265] GEVO2107 was made by transforming GEVO1803 with linearized,
HpaI-digested pGV1914. Correct integration of pGV1914 at the PDC6
locus was confirmed by analyzing candidate Ura+ colonies by colony
PCR using primers 1440 plus 1441, or 1443 plus 1633, to detect the
5' and 3' junctions of the integrated construct, respectively.
Expression of all transgenes was confirmed by qRT-PCR using primer
pairs 1321 plus 1322, 1587 plus 1588, and 1633 plus 1634 to examine
BsalsS2, LlkivD2, and DmADH transcript levels, respectively.
[0266] GEVO2158 was made by transforming GEVO2107 with
NruI-digested pGV1936. Correct integration of pGV1936 at the PDC5
locus was confirmed by analyzing candidate Ura+, Leu+ colonies by
colony PCR using primers primers 1436 plus 1437, or 1595 plus 1439,
to detect the 5' and 3' junctions of the integrated construct,
respectively. Expression of all transgenes were confirmed by
qRT-PCR using primer pairs 1321 plus 1322, 1597 plus 1598, 1566
plus 1567, 1587 plus 1588, 1633 plus 1634, and 1341 plus 1342 to
examine mRNA levels of BsalsS2 (SEQ ID NO: 151),
EcilvCco(Sc).sup.Q110V (SEQ ID NO: 159), Scilv3.DELTA.N (SEQ ID NO:
160), LlkivD2 (SEQ ID NO:155), (SEQ ID NO: 161), and ACT1,
respectively.
[0267] GEVO2302 was made by sporulating GEVO2158. Haploid spores
were prepared for random spores analysis (as described above), and
the spores were plated onto SCE-Trp, Leu, Ura medium. Candidate
colonies were patched onto SCE-Trp, Leu, Ura plates and then
replica plated onto YPD and YPE plates. Patches that grew on YPE
but failed to grow on YPD were further analyzed by colony PCR to
confirm mating type (and, hence, their status as haploid). Several
verified haploid candidates were further analyzed for transgenic
expression by qRT-PCR. GEVO2302 contains the full isobutanol
pathway, and specifically contains a transgenic expressing
EcilvCco(Sc).sup.Q110V.
[0268] GEVO2542 was made by transforming GEVO1969 with pGV2061
digested with EcoRI and BglII and pGV2062 digested with NheI and
HindIII. The integration was confirmed by qRT-PCR which confirmed
transcription of Bs_alsS, Ll_kivd and Dm_ADH. From this strain the
ura3 marker was removed by selection on 5-FOA containing plates.
Colonies from the plate were streaked on YPE and SCD-ura plates to
confirm the loss of the ura3 marker. One confirmed clone was named
GEVO2542.
[0269] The K. marxianus strains GEVO2346, GEVO2347, and GEVO2348
were constructed by transformation of GEVO1969 with pGV1990 and
pGV2015 that had been linearized with the restriction enzyme PvuI
and purified by ethanol precipitation. The transformation was
plated on SCE-URA plates to select for integrants. Integrants were
verified by colony PCR.
[0270] The K. marxianus strains GEVO2276 and GEVO2277 were
constructed by transformation of KARL1969 with pGV1875 that had
been linearized with the restriction enzyme PvuI and purified by
ethanol precipitation. The transformation was plated on SCE-URA
plates to select for integrants. Integrants were verified by colony
PCR.
[0271] The K. marxianus strains GEVO2087 and GEVO2088 were
constructed by transformation of KARL1947 with pGV1875 that had
been linearized with the restriction enzyme PvuI. The
transformation was plated on SC-URA plates to select for
integrants. Integrants were verified by colony PCR.
[0272] The Saccharomyces cerevisiae strain GEVO2072 was constructed
by transformation of GEVO1186 with pGV1875 that had been linearized
with the restriction enzyme PvuI. The transformation was plated on
SC-URA plates to select for integrants. Integrants were verified by
colony PCR.
[0273] The Saccharomyces cerevisiae strain GEVO2119 was constructed
by transformation of GEVO1186 with pGV1874 that had been linearized
with the restriction enzyme PvuI. The transformation was plated on
SC-URA plates to select for integrants. Integrants were verified by
colony PCR.
[0274] The Saccharomyces cerevisiae strains GEVO2120 and GEVO2121
were constructed by transformation of GEVO1186 with pGV1877 that
had been linearized with the restriction enzyme PvuI. The
transformation was plated on SC-URA plates to select for
integrants. Integrants were verified by colony PCR.
[0275] The Saccharomyces cerevisiae strains GEVO2122 and GEVO2123
were constructed by transformation of GEVO1186 with pGV1878 that
had been linearized with the restriction enzyme PvuI. The
transformation was plated on SC-URA plates to select for
integrants. Integrants were verified by colony PCR.
[0276] The Saccharomyces cerevisiae strains GEVO2124 and GEVO2125
were constructed by transformation of GEVO1186 with pGV1879 that
had been linearized with the restriction enzyme PvuI. The
transformation was plated on SC-URA plates to select for
integrants. Integrants were verified by colony PCR.
[0277] The Saccharomyces cerevisiae strain GEVO2126 was constructed
by transformation of GEVO1186 with pGV1892 that had been linearized
with the restriction enzyme PvuI. The transformation was plated on
SC-URA plates to select for integrants. Integrants were verified by
colony PCR.
[0278] Strain AP is constructed by transforming GEVO1947 with
linear DNA from pGV1817 and additional linear DNA from pGV7001
resulting in strain AP. This combination of linear DNA contains
genes coding for all five isobutanol pathway enzymes, and the
uracil marker for selection. The transformation leads to random
(non-targeted) insertion of the isobutanol pathway into the K.
marxianus genome. Adh7p is targeted to its native compartment, the
cytosol. All other pathway enzymes are targeted to the
mitochondrium. Pathway enzymes that are not natively localized to
the mitochondrium are fused to mitochondrial targeting sequences
that direct them to the mitochondrium. The transformed cells are
plated onto selective medium without uracil and incubated at
30.degree. C. for 3 days. After 3 days colonies are patched onto
selective plates and these patches are used for colony PCR and RT
PCR to verify correct integration and transcription of the pathway
genes.
[0279] To construct strain SCP1, GEVO1186, a diploid CEN.PK strain,
is first transformed with linear DNA from pGV1817 and additional
linear DNA from pGV7001 resulting in strain SCP1. The combination
of linear DNA contains genes coding for all five isobutanol pathway
enzymes, the S. cerevisiae PDC1 promoter (P.sub.ScPDC1) and
terminator (T.sub.ScPDC1) sequences for homologous integration into
the PDC1 locus and the uracil marker for selection. This homologous
replacement event results in the simultaneous integration of the
isobutanol pathway along with the deletion of the PDC1 coding
sequence. Adh7p is targeted to its native compartment, the cytosol.
All other pathway enzymes are targeted to the mitochondrium.
Pathway enzymes that are not natively localized to the
mitochondrium are fused to mitochondrial targeting sequences that
direct them to the mitochondrium. The transformed cells are plated
onto selective medium using ethanol as carbon source and lacking
uracil and incubated at 30.degree. C. for 3-4 days. After 3-4 days
colonies are patched onto selective plates and these patches are
used for colony PCR and RT PCR to verify correct integration and
transcription of the pathway genes.
[0280] To construct strain SC1, GEVO7777, a haploid CEN.PK strain
deleted for PDC5 and PDC6, is first transformed with linear DNA
from pGV1817 and additional linear DNA from pGV7001 resulting in
strain SC1. The combination of linear DNA contains genes coding for
all five isobutanol pathway enzymes, the S. cerevisiae PDC1
promoter and terminator sequences for homologous integration into
the PDC1 locus and the uracil marker for selection. This homologous
replacement event results in the simultaneous integration of the
isobutanol pathway along with the deletion of the PDC1 coding
sequence. Adh7p is targeted to its native compartment, the cytosol.
All other pathway enzymes are targeted to the mitochondrium.
Pathway enzymes that are not natively localized to the
mitochondrium are fused to mitochondrial targeting sequences that
direct them to the mitochondrium. The transformed cells are plated
onto selective medium using ethanol as carbon source and lacking
uracil and incubated at 30.degree. C. for 3-4 days. After 3-4 days
colonies are patched onto selective plates and these patches are
used for colony PCR and RT PCR to verify correct integration and
transcription of the pathway genes.
[0281] The plasmid pGV1773 (SEQ ID NO: 1) was a clone obtained from
DNA2.0 in which the sequence containing the ScPDC1 promoter
(P.sub.ScPDC1), BsalsS, ScTDH3 promoter (P.sub.ScTDH3), LlkivD,
ScADH1 promoter (P.sub.ScADH1), ScADH7, ScFBA1 promoter
(P.sub.ScFBA1), and 5' fragment of ScURA3 was synthesized. BsalsS,
LlkivD and ScADH7 have been codon optimized for S. cerevisiae.
[0282] The plasmid pGV1774 (SEQ ID NO: 2) was a clone obtained from
DNA2.0 in which the sequence containing the 3' fragment of ScURA3
coding sequence and terminator, ScFBA1 promoter (P.sub.ScFBA1),
EcilvC codon optimized for S. cerevisiae (EcilvCco), ScTPI1
promoter (P.sub.ScTPI1), EcilvD codon optimized for S. cerevisiae
(EcilvDco), ScPDC1 terminator (T.sub.ScPDC1) was synthesized.
[0283] The plasmid pGV1810 (SEQ ID NO: 3) was constructed to
replace the EcilvCco gene in pGV1774 with Saccharomyces cerevisiae
ILV5. It was constructed by PCR amplification of ILV5 from S.
cerevisiae genomic DNA with primers 1615 and 1616, which add XhoI
and BamHI sites flanking the full-length ILV5 sequence. The ScILV5
PCR product was digested with XhoI and BamHI. The vector pGV1774
was digested with XhoI and BglII. The digested ScILV5 PCR product
and pGV1774 were ligated to yield pGV1810.
[0284] The plasmid pGV1811 (SEQ ID NO: 4) was constructed to
replace the existing S. cerevisiae P.sub.ScPDC1 promoter region in
pGV1773 with a Kluyveromyces marxianus P.sub.KmPDC1 promoter
region. It was constructed by PCR amplification of a region of the
K marxianus P.sub.PDC1 promoter from genomic DNA with primers 1658
and 1608, and of a region of pGV1773 with primers 1652 and 1653.
The above PCR products were combined in a splicing by overlap
extension (SOE) PCR reaction to splice the fragments as described
by Horton, R M; Hunt, H D; Ho, S N; Pullen, J K; Pease, L R.
Engineering hybrid genes without the use of restriction enzymes:
gene splicing by overlap extension. Gene 77, 61-68 (1989). The SOE
PCR reaction was required to introduce a BglII site to the 5' end
of the P.sub.PDC1 promoter. The resulting SOE PCR product and the
vector, pGV1773, were digested with PvuI and SalI and ligated to
yield pGV1811.
[0285] The plasmid pGV1812 (SEQ ID NO: 5) was constructed to
replace the existing S. cerevisiae T.sub.ScPDC1 terminator region
in pGV1774 with a K. marxianus T.sub.KmPDC1 terminator region. It
was constructed by PCR amplification of a region of T.sub.KmPDC1
from genomic DNA with primers 1609 and 1610. The resulting PCR
product and the vector, pGV1774, were digested with BamHI and
HindIII and ligated to yield pGV1812.
[0286] The plasmid pGV1817 (SEQ ID NO: 6) was constructed to
replace the EcilvDco gene in pGV1810 with S. cerevisiae ILV3. It
was constructed by PCR amplification of ScILV3 from S. cerevisiae
genomic DNA using primers 1617 and 1618. The PCR product and
pGV1810 were digested with SalI and BamHI, and were ligated to
yield pGV1817.
[0287] The plasmid pGV1832 (SEQ ID NO: 7) was constructed to
replace the existing S. cerevisiae T.sub.ScPDC1 terminator region
in pGV1817 with a K. marxianus T.sub.KmPDC1 terminator region. It
was constructed by digestion of pGV1812 and pGV1817 with PvuI and
BamHI. The T.sub.KmPDC1 from pGV1812 was ligated into the pGV1817
backbone to yield pGV1832.
[0288] The plasmid pGV1834 (SEQ ID NO: 8) was constructed to
replace the existing Bacillus subtilis BsalsS gene and the
Lactococcus lactis LlkivD gene in pGV1811 with the same genes, but
with additional sequence encoding the 25 amino acid mitochondrial
targeting sequence from the S. cerevisiae cytochrome oxidase
subunit 4 gene (COX4) at the 5' end of BsalsS and additional
sequence encoding the mitochondrial targeting sequence from S.
cerevisiae Hmi1p, a mitochondrial DNA helicase at the 3' end of
LlkivD. It was constructed by PCR amplification of BsalsS, S.
cerevisiae P.sub.ScTDH3 promoter, and L. lactis LlkivD from pGV1773
with primers 1681 and 1661. Primer 1681 added nucleotides that
encode part of the mitochondrial targeting sequence of COX4 from S.
cerevisiae to the 5' end of BsalsS, and primer 1661 added 55
nucleotides encoding part of the mitochondrial targeting sequence
of ScHMI1p, to the 3' end of the LlkivD gene. The above PCR product
was then used in an SOE PCR reaction to splice each mitochondrial
targeting sequence to the appropriate end of the PCR product. The
DNA of mitochondrial targeting sequences was obtained from
oligonucleotides of both strands of each mitochondrial targeting
sequence. For each mitochondrial targeting sequence, both
oligonucleotides were annealed to each other by reconstituting each
oligonucleotide to a final concentration of 20 .mu.M in TE (Tris 10
mM, EDTA 1 mM, 50 mM NaCl). 50 .mu.L of each oligonucleotide was
mixed with 50 .mu.L of the corresponding oligonucleotide and
incubated at 95.degree. C. for 5 minutes in a heating block, and
then cooled slowly to room temperature by turning the heating block
off. The oligonucleotide numbers for the Cox4p mitochondrial
targeting sequence are 1665 and 1666, and for the Hmi1p MTS are
1663 and 1664. The annealed oligonucleotides of the mitochondrial
targeting sequences were combined with the PCR product in the SOE
PCR reaction in which primers 1683 and 1684 were used. The
resulting SOE PCR product was then digested with NheI and XhoI, and
the vector, pGV1811, was digested with SalI and AvrII, and the two
were ligated to yield pGV1834. The same SOE PCR product is also
ligated into pGV1773 using the same restriction endonucleases to
yield pGV7001 (SEQ ID NO: 9).
[0289] The plasmids pGV7101 (SEQ ID NO: 10) and pGV9834 (SEQ ID NO:
11), are constructed by ligating a SOE-PCR product containing
nucleotides coding for the MTS of Adh3p from S. cerevisiae fused to
the 5' end of the ScADH7 gene into the plasmids pGV1834 and pGV7001
respectively, wherein the SOE-PCR product and the plasmids are
digested with NdeI and NcoI. The SOE-PCR product is prepared by
amplifying the 5' end of the ScADH7 gene excluding the start codon
using the primers ADH7F and ADH7R. ADH7F includes 20 nucleotides of
homology to the 5' sequence of ADH3. Two oligonucleotides
(ADH3MTSF, ADH3MTSR) containing the sense and the antisense strands
of the coding sequence for the first 29 amino acids of Adh3p, a
NdeI site, and 5 nucleotides that are homologous to the 5' end of
ADH7 are synthesized and annealed. The PCR product and the annealed
oligonucleotides are combined in a SOE reaction using the primers
ADH37F and ADH7R.
[0290] A NADH dependent KARI containing a mitochondrial targeting
sequence (EcilvCco(Sc).sup.P2D1-A1-HIS6(SEQ ID NO: 162) which is
described in co-pending U.S. application Ser. No. 12/610,784) is
cloned into pGV1817 replacing ScILV5 to generate pGV1817N (SEQ ID
NO: 12).
[0291] The gene DmADH gene (GI:78706922) coding for the NADH
dependent Drosophila melanogaster ADH is cloned into pGV1834
replacing ADH7 to generate pGV1834N (SEQ ID NO: 14). DmADH is
amplified in a PCR reaction, using primers DmADHF and 1364 and the
clone RH54514 (Drosophila Genome Resource Center) as a template.
The .about.0.8 kb PCR product so generated is digested with NdeI
and NotI and ligated with pGV1834 which is digested with NdeI and
NotI to yield pGV1834N.
[0292] The gene DmADH gene (GI:78706922) coding for the NADH
dependent Drosophila melanogaster ADH is fused to the sequence
coding for the Adh3p-MTS using SOE-PCR. The SOE-PCR product is
prepared by amplifying the 5' end of the DmADH7 gene excluding the
start codon using the primers DmADH3F and DmADH3R. DmADH3F includes
20 nucleotides of homology to the 5' sequence of ADH3. Two
oligonucleotides (DmADH3MTSF, DmADH3MTSR) containing the sense and
the antisense strands of the coding sequence for the first 29 amino
acids of Adh3p, a NdeI site, and 5 nucleotides that are homologous
to the 5' end of DmADH are synthesized and annealed. The PCR
product and the annealed oligonucleotides are combined in a SOE
reaction using the primers ADH37F and DmADH3R. The SOE-PCR product
is cloned into pGV1834 replacing ADH7 to generate pGV9834N (SEQ ID
NO: 17).
[0293] The gene DmADH gene (GI:78706922) coding for the NADH
dependent Drosophila melanogaster ADH is cloned into pGV7001
replacing ADH7 to generate pGV7001N (SEQ ID NO: 15). DmADH is
amplified in a PCR reaction, using primers DmADHF and 1364 and the
clone RH54514 (Drosophila Genome Resource Center) as a template.
The .about.0.8 kb PCR product so generated is digested with NdeI
and NotI and ligated with pGV7001 which is digested with NdeI and
NotI to yield pGV7001N (SEQ ID NO: 15).
[0294] The gene DmADH gene (GI:78706922) coding for the NADH
dependent Drosophila melanogaster ADH is fused to the sequence
coding for the Adh3p-MTS using SOE-PCR. The SOE-PCR product is
prepared by amplifying the 5' end of the DmADH7 gene excluding the
start codon using the primers DmADH3F and DmADH3R. DmADH3F includes
20 nucleotides of homology to the 5' sequence of ADH3. Two
oligonucleotides (DmADH3MTSF, DmADH3MTSR) containing the sense and
the antisense strands of the coding sequence for the first 29 amino
acids of Adh3p, a NdeI site, and 5 nucleotides that are homologous
to the 5' end of DmADH are synthesized and annealed. The PCR
product and the annealed oligonucleotides are combined in a SOE
reaction using the primers ADH37F and DmADH3R. The SOE-PCR product
is cloned into pGV7001 replacing ADH7 to generate pGV7101N (SEQ ID
NO: 16).
[0295] A NADH dependent KARI containing a mitochondrial targeting
sequence is cloned into pGV1832 replacing ILV5 to generate pGV1832N
(SEQ ID NO: 13).
[0296] To provide cofactor balance via malate pathway the following
genes are overexpressed in the yeast host: PCK1 (GI:83722562), MDH2
(GI:84626310), DIC1 (GI:85666119) and MAE1 (GI:83722562). The genes
are amplified by PCR using S. cerevisiae genomic DNA as template
and cloned into an integration vector yielding pGV8000 (SEQ ID NO:
18). In this vector the PCK1 gene is controlled by the promoter
P.sub.ScTDH3, MDH3 is controlled by P.sub.ScADH1, DIC1 is
controlled by P.sub.ScFBA1, and MAE1 is controlled by the promoter
P.sub.ScTP11. The plasmid also expresses the hygromycin resistance
gene, hph under the control of the promoter P.sub.ScTEF1. In
addition, pGV8000 carries a sequence which consists of, from 5' to
3', S. cerevisiae PDC6 terminator, a unique restriction site
(HpaI), and the PDC6 promoter to target the integration of the HpaI
linearized plasmid to PDC6 in S. cerevisiae.
[0297] The transhydrogenase gene from Neurospora crassa
(GI:164426165) (SEQ ID NO: 96) is synthesized according to the
sequence from the strain N. crassa 74-OR23-1VA (FGSC#2489). The
synthetic gene is flanked by EcoRI and AvrII restriction sites at
the 5' and the 3' end of the gene respectively. The gene is cloned
into the plasmid pGV9000 (SEQ ID NO: 19) in which the expression of
the gene is controlled by the strong constitutive promoter TDH3.
The plasmid also contains the hygromycin resistance gene, hph under
the control of the promoter PScTEF1 and 3' and 5' targeting regions
that for integration into ScPDC6. The plasmid can be linearized
using the restriction site HpaI which is located between the two
targeting sequences.
[0298] The plasmid pGV1816 was constructed to replace the 5'
fragment of the URA3 marker in pGV1773 with full length URA3 and a
region of the PDC1 terminator downstream in order to integrate
genes into the S. cerevisiae genome at the PDC1 locus and to select
for integrants. The 3' region of URA3 was PCR amplified from
pGV1774 with primers 1678 and 1679, and the PDC1 terminator was
amplified from pGV1774 with primers 1435 and 1680. Primer 1680
added 9 nucleotides of homology to the 3' fragment of URA3 onto the
PDC1 terminator region, and primer 1679 added 13 nucleotides of
homology to the PDC1 terminator region onto the 3' fragment of
URA3. The two PCR products were combined in an SOE PCR reaction
with primers 1435 and 1680. The resulting SOE PCR product and
pGV1773 were digested with EcoRI and SgrAI, and the two were
ligated to yield pGV1816.
[0299] The plasmid pGV1874 was constructed to replace the existing
Bacillus subtilis BsalsS gene and the Lactococcus lactis LlkivD
gene in pGV1816 with the same genes, but adding nucleotides
encoding the 25 amino acid mitochondrial targeting sequence from
the S. cerevisiae COX4 gene at the 5' end of BsalsS and adding
nucleotides encoding the mitochondrial targeting sequence from S.
cerevisiae ScHMI1 at the 3' end of LlkivD. It was constructed by
PCR amplification of B. subtilis BsalsS, S. cerevisiae TDH3
promoter, and L. lactis LlkivD from pGV1773 with primers 1681 and
1661. Primer 1681 added 25 nucleotides encoding part of the first
25 amino acids of the mitochondrial targeting sequence of COX4 from
S. cerevisiae to the 5' end of BsalsS, and primer 1661 added 55
nucleotides encoding part of the mitochondrial targeting sequence
of ScHMI1, to the 3' end of LlkivD. The above PCR product was then
used in an SOE PCR reaction with oligonucleotides encoding the
mitochondrial targeting sequences to splice each mitochondrial
targeting sequence to the appropriate end of the PCR product using
primers 1683 and 1684. The oligonucleotide numbers of the
mitochondrial targeting sequences are 1665 and 1666 for COX4, and
1663 and 1664 for ScHMI1. The resulting SOE PCR product was
digested with NheI and XhoI, and the vector, pGV1816, was digested
with SalI and AvrII, and the two were ligated to yield pGV1874.
[0300] The plasmid pGV1877 was constructed to replace the existing
B. subtilis BsalsS gene in pGV1816 with BsalsS that has a 31 amino
acid mitochondrial targeting sequence at its 5' end from the S.
cerevisiae COX4 gene, and the L. lactis LlkivD gene in pGV1816 with
ScARO10 from S. cerevisiae that has a 3' mitochondrial targeting
sequence from the S. cerevisiae ScHMI1 gene. It was constructed by
PCR amplification of B. subtilis BsalsS and S. cerevisiae TDH3
promoter from pGV1773 with primers 1682 and 1688, and S. cerevisiae
ARO10 from genomic DNA with primers 1689 and 1662. Primer 1682
added 25 nucleotides encoding part of the first 31 amino acids of
the targeting sequence of COX4 from S. cerevisiae to the 5' end of
BsalsS, and primer 1688 added 21 nucleotides encoding part of ARO10
to the 3' end of the TDH3 promoter. Primer 1689 added 18
nucleotides of homology to TDH3 to the 5' end of ARO10, and primer
1662 added 55 nucleotides encoding part of the ScHMI1 targeting
sequence to the 3' end of ARO10. The two PCR products were combined
in an SOE PCR reaction with oligonucleotides encoding the targeting
sequences to splice the fragments and targeting sequences using
primers 1683 and 1684. The oligonucleotide numbers of the leader
sequences are 1667 and 1668 for COX4, and 1663 and 1664 for ScHMI1.
The resulting SOE PCR product was digested with NheI and XhoI, and
the vector, pGV1816, was digested with SalI and AvrII, and the two
were ligated to yield pGV1877.
[0301] The plasmid pGV1878 was constructed to replace the existing
B. subtilis BsalsS gene in pGV1816 with ILV2 from S. cerevisiae,
and the existing L. lactis LlkivD with Llkivd that has a 3'
mitochondrial targeting sequence from the S. cerevisiae ScHMI1
gene. It was constructed by PCR amplification of S. cerevisiae ILV2
from genomic DNA with primers 1685 and 1686, and amplification of
S. cerevisiae TDH3 promoter and L. lactis LlkivD from pGV1773 with
primers 1687 and 1661. Primer 1686 added 21 nucleotides encoding
part of the 5' end of the TDH3 promoter to the 3' end of ILV2.
Primer 1687 added 20 nucleotides encoding part of the 3' end of
ILV2 to the 5' end of the TDH3 promoter, and primer 1661 added 55
nucleotides encoding part of the targeting sequence from ScHMI1 to
the 3' end of LlkivD. The two PCR products were combined in an SOE
PCR reaction with the oligonucleotide of the HMI targeting sequence
(1663 and 1664) to splice the fragments using primers 1685 and
1684. The resulting SOE PCR product was digested with NheI and
XhoI, and the vector, pGV1816, was digested with SalI and AvrII,
and the two were ligated to yield pGV1878.
[0302] The plasmid pGV1879 was constructed to replace the existing
B. subtilis BsalsS gene in pGV1816 with ILV2 from S. cerevisiae,
and the L. lactis LlkivD gene in pGV1816 with ARO10 from S.
cerevisiae plus nucleotides encoding the mitochondrial targeting
sequence from the S. cerevisiae ScHMI1 at the 3' end of ScARO10. It
was constructed by PCR amplification of S. cerevisiae ILV2 from
genomic DNA with primers 1685 and 1686, S. cerevisiae ARO10 from
genomic DNA with primers 1689 and 1662, and S. cerevisiae TDH3
promoter from pGV1773 with primers 1690 and 1691. Primer 1686 added
21 nucleotides encoding part of the 5' end of the TDH3 promoter to
the 3' end of ILV2. Primer 1689 added 18 nucleotides encoding part
of the 3' end of the TDH3 promoter to the 5' end of ARO10, and
primer 1662 added 55 nucleotides encoding part of the ScHMI1
mitochondrial targeting sequence to the 3' end of ScARO10. The
three PCR products were combined in an SOE PCR reaction with the
oligonucleotides encoding the ScHMI1 mitochondrial targeting
sequence (1663 and 1664) to splice the fragments using primers 1685
and 1684. The resulting SOE PCR product was digested with NheI and
XhoI, and the vector, pGV1816, was digested with SalI and AvrII,
and the two were ligated to yield pGV1879.
[0303] The plasmid pGV1892 was constructed to replace the existing
S. cerevisiae ADH7 gene in pGV1878 with derepressed full length
ILV6 (ILV6*) from S. cerevisiae. It was constructed by PCR
amplification of the N terminus of ILV6 from S. cerevisiae genomic
DNA with primers 1740 and 1741. Primer 1740 added an NdeI site to
the 5' end of ILV6. The rest of ILV6* was PCR amplified from
pGV1315 with primer 1738, which has homology to the N terminus of
ILV6, and 1739 which included amplification of an existing 3' NotI
site. The resulting PCR products were combined in an SOE PCR
reaction with primers 1739 and 1740. The SOE PCR product and
pGV1878 were digested with Nod and NdeI, and the two were ligated
to yield pGV1892.
[0304] The plasmid pGV1875 (SEQ ID NO: 92) was constructed to
replace the existing Bacillus subtilis BsalsS gene and the
Lactococcus lactis LlkivD gene in pGV1816 with the same genes, but
adding nucleotides encoding the 31 amino acid mitochondrial
targeting sequence from the S. cerevisiae COX4 gene at the 5' end
of BsalsS and adding nucleotides encoding the mitochondrial
targeting sequence from S. cerevisiae Hmi1p at the 3' end of
LlkivD. It was constructed by PCR amplification of B. subtilis
BsalsS, S. cerevisiae TDH3 promoter, and L. lactis LlkivD from
pGV1773 with primers 1682 and 1661. Primer 1682 added 25
nucleotides part of the first 31 amino acids of the mitochondrial
targeting sequence of COX4 from S. cerevisiae to the 5' end of
BsalsS, and primer 1661 added 55 nucleotides encoding part of the
mitochondrial targeting sequence of Hmi1p, to the 3' end of LlkivD.
The above PCR product was then used in an SOE PCR reaction with
oligonucleotides encoding the mitochondrial targeting sequences to
splice each mitochondrial targeting sequence to the appropriate end
of the PCR product using primers 1683 and 1684. The oligonucleotide
numbers of the mitochondrial targeting sequences are 1667 and 1668
for COX4, and 1663 and 1664 for ScHMI1. The resulting SOE PCR
product was digested with NheI and XhoI, and the vector, pGV1816,
was digested with SalI and AvrII, and the two were ligated to yield
pGV1875.
[0305] The plasmid pGV1876 (SEQ ID NO: 97) was constructed to
replace the existing B. subtilis BsalsS gene in pGV1816 with BsalsS
including a 25 amino acid mitochondrial targeting sequence from the
S. cerevisiae COX4 gene at the 5' end of the gene, and the L.
lactis LlkivD gene in pGV1816 with ARO10 from S. cerevisiae
including a mitochondrial targeting sequence from the S. cerevisiae
ScHMI1 gene at the 3' end of ARO10. It was constructed by PCR
amplification of Bacillus subtilis BsalsS and S. cerevisiae TDH3
promoter from pGV1773 with primers 1681 and 1688, and S. cerevisiae
ARO10 from genomic DNA with primers 1689 and 1662. Primer 1681
added 25 nucleotides of homology to the first 25 amino acids of the
mitochondrial targeting sequence of subunit IV of cytochrome
oxidase from S. cerevisiae to the 5' end of BsalsS, and primer 1688
added 21 nucleotides of homology to ARO10 to the 3' end of the TDH3
promoter. Primer 1689 added 18 nucleotides of homology to TDH3 to
the 5' end of ARO10, and primer 1662 added 55 nucleotides of
homology to the ScHMI1 mitochondrial targeting sequence to the 3'
end of ARO10. The two PCR products were combined in an SOE PCR
reaction with oligonucleotides encoding the mitochondrial targeting
sequences to splice the fragments using primers 1683 and 1684. The
oligonucleotide numbers of the mitochondrial targeting sequences
are 1665 and 1666 for cytochrome oxidase, and 1663 and 1664 for
ScHMI1. The resulting SOE PCR product was digested with NheI and
XhoI, and the vector, pGV1816, was digested with SalI and AvrII,
and the two were ligated to yield pGV1876.
Construction of pGV2212
[0306] Sc_BAT1 was cloned into pGV1104, producing pGV2212. Briefly,
the sequence for Sc_BAT1 was amplified from S. cerevisiae genomic
DNA using primers 2305 and 2323. These primers introduced a NotI
and BamHI sites at the 5' and 3' ends of the coding sequence,
respectively. The PCR product and pGV1104 were digested with NotI
and BamHI and ligated together to produce pGV2212. The Sc_BAT1
sequence was confirmed by sequencing (Laragen, Inc., Los Angeles,
Calif.).
Construction of pGV1999
[0307] pGV1441 is a derivative of p423TEF (Mumberg, D. et al.
(1995) Gene 156:119-122; obtained from ATCC), where the multiple
cloning sites had been changed to SalI-EcoRI-SmaI-BamHI-NotI-XhoI.
pGV1999 is a high-copy HIS3 marked yeast plasmid for overexpression
of the S. cerevisiae cytosolic branched chain amino acid
transaminase, Bat2p. The sequence for Sc_BAT2 was amplified from S.
cerevisiae genomic DNA using primers 457 and 458. These primers
introduced a SalI and BamHI sites at the 5' and 3' ends of the
coding sequence. This PCR product was digested with SalI and BamHI
and cloned into the same sites of pGV1441. The Sc_BAT2 sequence was
confirmed by sequencing (Laragen, Inc., Los Angeles, Calif.).
Construction of Plasmids pGV1990 and pGV2015
[0308] To generate a fragment to clone into pGV1909, Ll_kivD was
PCR amplified with primers 2038 and 2039 and KOD polymerase
(Novagen, catalog #71086) using pGV1590 as template. The PCR
amplified DNA was purified using the Qiagen PCR Purification Kit
(Qiagen kit #28106). The purified PCR DNA and pGV1909 were digested
with HinDIII and NotI. The digested PCR DNA was purified by ethanol
precipitation, and the appropriately sized band from pGV1909 was
excised from a 1% agarose gel and purified with a Zymoclean Gel DNA
Recovery Kit (Zymo Research, Orange, Calif.; Catalog #D4002). The
purified insert (PCR product) and vector DNA (pGV1909) were mixed
in a 6:1 molar ratio with T4 DNA Ligase and buffer (New England
Biolabs, Catalog M0202), and incubated at room temperature for two
hours before transformation into chemically-competent E. coli.
Transformants were screened by sequence analysis. One transformant
contained pGV1990. Another transformant contained a plasmid that
was the result of the re-ligation of pGV1909 without Ll_kivD, which
was assigned the designation pGV2015.
Construction of Plasmid pGV2061:
[0309] pGV1811 and pGV2030 were digested with SalI and NotI. The
DNA was gel purified from a 1% agarose gel using the Zymoclean Gel
DNA Recovery Kit (Zymo Research, Orange, Calif.; Catalog #D4002).
The purified insert and vector DNA fragments were mixed in a 5:1
molar ratio with T4 DNA Ligase and buffer (New England Biolabs,
Catalog M0202), and incubated at room temperature for two hours
before transformation into chemically-competent E. coli.
Transformants were screened by PCR, restriction digestions, and
sequence analysis. The fully verified candidate was name
pGV2061.
Construction of Plasmid pGV2062:
[0310] To generate a fragment to clone into pGV1812,
Sc_COX4:Bs_alsS was PCR amplified with primers 2105 and 2106 and
KOD polymerase (Novagen, catalog #71086) using pGV1875 as template.
The PCR amplified DNA was purified using the Zymoclean and
Concentrator Kit (kit #28106). The purified PCR DNA and pGV1812
were digested with BamHI and XhoI. The digested DNA was resolved on
a 1% agarose gel, and the DNA fragments were excised from the gel
and purified with a Zymoclean Gel DNA Recovery Kit (Zymo Research,
Orange, Calif.; Catalog #D4002). The purified insert (PCR product)
and vector DNA (pGV1812) were mixed in a 5:1 molar ratio with T4
DNA Ligase and buffer (New England Biolabs, Catalog M0202), and
incubated at room temperature for two hours before transformation
into chemically-competent E. coli. Transformants were screened by
PCR, restriction digestions, and sequence analysis. The fully
verified candidate was named pGV2062.
[0311] The plasmids pGV9834 (SEQ ID NO: 11), and pGV7101 (SEQ ID
NO: 10), are constructed by ligating a SOE-PCR product containing
nucleotides coding for the MTS of Adh3p fused to the 5' end of the
ADH7 gene into the plasmids pGV1834 (SEQ ID NO: 8), and pGV7001
(SEQ ID NO: 9), respectively, wherein the SOE-PCR product and the
plasmids are digested with NdeI and NcoI. The SOE-PCR product is
prepared by amplifying the 5' end of the ADH7 gene excluding the
start codon using the primers ADH7F and ADH7R. ADH7F includes 20
nucleotides of homology to the 5' sequence of ADH3. Two
oligonucleotide containing the sense and the antisense strands of
the coding sequence for the first 29 amino acids of Adh3p, a NcoI
site, and 5 nucleotides that are homologous to the 5' end of the
ADH7 are synthesized and annealed. The PCR product and the annealed
oligonucleotides are combined in a SOE reaction using the primers
ADH37 and ADH7R.
TABLE-US-00001 GEVO No. Genotype/Source A Kluyveromyces marxianus
ura3-.DELTA.2 pdc1.DELTA.::[P.sub.KmPDC1:25ScCOX4-
MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:SCADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScT-
PI1:ScILV3:T.sub.KmPDC1] A1 Kluyveromyces marxianus ura3-.DELTA.2
pdc1.DELTA.::[P.sub.KmPDC1:25COX4-
MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-MTS:P.sub.ScADH1: ScADH3
MTS:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScTPI1:ScILV3:T.-
sub.KmPDC1] A1MB Kluyveromyces marxianus ura3-.DELTA.2
pdc1.DELTA.::[P.sub.KmPDC1:25ScCOX4-
MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-MTS:P.sub.ScADH:ScADH3-
MTS:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScTPI1:ScILV3:T.-
sub.KmPDC1]
[P.sub.ScTDH3:ScPCK1:P.sub.ScADH1:ScMDH2:P.sub.ScFBA1:ScDIC1:P.sub.ScTPI1-
:ScMAE1:P.sub.ScTEF1:hph: T.sub.ScPDC6] A1N Kluyveromyces marxianus
ura3-.DELTA.2 pdc1.DELTA.::[P.sub.KmPDC1:25ScCOX4-MTS:BsalsS:
P.sub.ScTDH3:LlkivD:ScHMI-MTS:P.sub.ScADH1:ScADH3-MTS:DmADH:
P.sub.ScFBA1:ScURA3:
P.sub.ScFBA1:31COX4-MTS:EcilvCcoSc.sup.P2D1-A1-his6:
P.sub.ScTPI1:ScILV3: T.sub.KmPDC1] A1P Kluyveromyces marxianus
ura3-.DELTA.2 [P.sub.ScPDC1:25ScCOX4-
MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-MTS:P.sub.ScADH1: ScADH3-
MTS:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScTPI1:ScILV3:T.-
sub.KmPDC1] A1PMB Kluyveromyces marxianus ura3-.DELTA.2
[P.sub.ScPDC1:25ScCOX4-
MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-MTS:P.sub.ScADH:ScADH3-
MTS:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScTPI1:ScILV3:T.-
sub.KmPDC1]
[P.sub.ScTDH3:ScPCK1:P.sub.ScADH1:ScMDH2:P.sub.ScFBA1:ScDIC1:P.sub.ScTPI1-
:ScMAE1:P.sub.ScTEF1:hph: T.sub.ScPDC6] A1PN Kluyveromyces
marxianus ura3-.DELTA.2 [P.sub.ScPDC1:25ScCOX4-MTS:BsalsS:
P.sub.ScTDH3:LlkivD ScHMI-MTS:P.sub.ScADH1: ScADH3-MTS:DmADH
P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:31COX4-MTS:EcilvCcoSc.sup.P2D1-A1-his6:
P.sub.ScTPI1:ScILV3:T.sub.ScPDC1] A1PTH Kluyveromyces marxianus
ura3-.DELTA.2 [P.sub.ScPDC1:25ScCOX4-
MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-MTS:P.sub.ScADH: ScADH3-
MTS:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScTPI1:ScILV3:T.-
sub.KmPDC1] [P.sub.ScTDH3:Nc Transhydrogenase:P.sub.ScTEF1:hph]
A1TH Kluyveromyces marxianus ura3-.DELTA.2
pdc1.DELTA.::[P.sub.KmPDC1:25ScCOX4-
MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-MTS:P.sub.ScADH: ScADH3-
MTS:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScTPI1:ScILV3:T.-
sub.KmPDC1] [P.sub.ScTDH3:Nc Transhydrogenase:P.sub.ScTEF1:hph] AK
Kluyveromyces marxianus ura3-.DELTA.2
pdc1.DELTA.::[P.sub.KmPDC1:25ScCOX4-
MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:31COX4-MTS:Ecilv-
CcoSc.sup.P2D1-A1-his6: P.sub.ScTPI1:ScILV3:T.sub.KmPDC1] AKMB
Kluyveromyces marxianus ura3-.DELTA.2
pdc1.DELTA.::[P.sub.KmPDC1:25ScCOX4-
MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:31COX4-MTS:Ecilv-
CcoSc.sup.P2D1-A1-his6: P.sub.ScTPI1:ScILV3:T.sub.KmPDC1]
[P.sub.ScTDH3:ScPCK1:P.sub.ScADH1:ScMDH2:P.sub.ScFBA1:
ScDIC1:P.sub.ScTPI1:ScMAE1:P.sub.ScTEF1:hph: T.sub.ScPDC6] AKTH
Kluyveromyces marxianus ura3-.DELTA.2
pdc1.DELTA.::[P.sub.KmPDC1:25ScCOX4-
MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:31COX4-MTS:Ecilv-
CcoSc.sup.P2D1-A1-his6: P.sub.ScTPI1:ScILV3:T.sub.KmPDC1]
[P.sub.ScTDH3:Nc Transhydrogenase:P.sub.ScTEF1:hph] AM
Kluyveromyces marxianus ura3-.DELTA.2
pdc1.DELTA.::[P.sub.KmPDC1:25ScCOX4-
MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:DmADH:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScTP-
I1:ScILV3:T.sub.KmPDC1] AMB Kluyveromyces marxianus ura3-.DELTA.2
pdc1.DELTA.::[P.sub.KmPDC1:25ScCOX4-
MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScT-
PI1:ScILV3:T.sub.KmPDC1]
[P.sub.ScTDH3:ScPCK1:P.sub.ScADH1:ScMDH2:P.sub.ScFBA1:
ScDIC1:P.sub.ScTPI1:ScMAE1:P.sub.ScTEF1:hph: T.sub.ScPDC6] AMMB
Kluyveromyces marxianus ura3-.DELTA.2
pdc1.DELTA.::[P.sub.KmPDC1:25ScCOX4-
MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:DmADH:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScTP-
I1:ScILV3:T.sub.KmPDC1]
[P.sub.ScTDH3:ScPCK1:P.sub.ScADH1:ScMDH2:P.sub.ScFBA1:
ScDIC1:P.sub.ScTPI1:ScMAE1:P.sub.ScTEF1:hph: T.sub.ScPDC6] AMTH
Kluyveromyces marxianus ura3-.DELTA.2
pdc1.DELTA.::[P.sub.KmPDC1:25ScCOX4-
MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:DmADH:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScTP-
I1:ScILV3:T.sub.KmPDC1] [P.sub.ScTDH3:Nc
Transhydrogenase:P.sub.ScTEF1:hph] AN Kluyveromyces marxianus
ura3-.DELTA.2 pdc1 .DELTA.::[P.sub.KmPDC1:25ScCOX4-MTS:BsalsS:
P.sub.ScTDH3:LlkivD ScHMI-MTS: P.sub.ScADH1: DmADH:
P.sub.ScFBA1:ScURA3:
P.sub.ScFBA1:31COX4-MTS:EcilvCcoSc.sup.P2D1-A1-his6:
P.sub.ScTPI1:ScILV3: T.sub.KmPDC1] AP Kluyveromyces marxianus
ura3-.DELTA.2 [P.sub.ScPDC1:25ScCOX4-
MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScT-
PI1:ScILV3:T.sub.ScPDC1] APM Kluyveromyces marxianus ura3-.DELTA.2
[P.sub.ScPDC1:25ScCOX4- MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:DmADH:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScTP-
I1:ScILV3:T.sub.ScPDC1] APMB Kluyveromyces marxianus ura3-.DELTA.2
[P.sub.ScPDC1:25ScCOX4- MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:SCILV5:P.sub.ScT-
PI1:ScILV3:T.sub.ScPDC1]
[P.sub.ScTDH3:ScPCK1:P.sub.ScADH1:ScMDH2:P.sub.ScFBA1:
ScDIC1:P.sub.ScTPI1:ScMAE1:P.sub.ScTEF1:hph: T.sub.ScPDC6] APMMB
Kluyveromyces marxianus ura3-.DELTA.2 [P.sub.ScPDC1:25ScCOX4-
MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:DmADH:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScTP-
I1:ScILV3:T.sub.ScPDC1]
[P.sub.ScTDH3:ScPCK1:P.sub.ScADH1:ScMDH2:P.sub.ScFBA1:
ScDIC1:P.sub.ScTPI1:ScMAE1:P.sub.ScTEF1:hph: T.sub.ScPDC6] APMTH
Kluyveromyces marxianus ura3-.DELTA.2 [P.sub.ScPDC1:25ScCOX4-
MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:DmADH:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScTP-
I1:ScILV3:T.sub.ScPDC1] [P.sub.ScTDH3:Nc
Transhydrogenase:P.sub.ScTEF1:hph] APN Kluyveromyces marxianus
ura3-.DELTA.2 [P.sub.ScPDC1:25ScCOX4-
MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:DmADH:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:31COX4-
MTS:EcilvCcoSc.sup.P2D1-A1-his6:P.sub.ScTPI1:ScILV3:T.sub.ScPDC1]
APTH Kluyveromyces marxianus ura3-.DELTA.2 [P.sub.ScPDC1:25ScCOX4-
MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:SCILV5:P.sub.ScT-
PI1:ScILV3:T.sub.ScPDC1] [P.sub.ScTDH3:Nc
Transhydrogenase:P.sub.ScTEF1:hph] ATH Kluyveromyces marxianus
ura3-.DELTA.2 pdc1.DELTA.::[P.sub.KmPDC1:25ScCOX4-
MTS:BsalsS:P.sub.ScTDH3:LlkivD:HMI1-
MTS:P.sub.ScADH1:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScT-
PI1:ScILV3:T.sub.KmPDC1] [P.sub.ScTDH3:Nc
Transhydrogenase:P.sub.ScTEF1:hph] c2i-SC1 S. cerevisiae MATa his3
trp1 ura3 pdc5::ble pdc6::apt1(kanR) ho
pdc1.DELTA.::(P.sub.ScPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
-
MTS:P.sub.ScADH1:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScT-
PI1:ScILV3:T.sub.ScPDC1) Evolved to be C2-independent c2i-SC1M S.
cerevisiae MATa his3 trp1 ura3 pdc5::ble pdc6::apt1(kanR) ho
pdc1.DELTA.::[P.sub.ScPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
-
MTS:P.sub.ScADH1:DmADH:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScTP-
I1:ScILV3:T.sub.ScPDC1] Evolved to be C2-independent c2i-SC1MB S.
cerevisiae MATa his3 trp1 ura3 pdc5::ble ho
pdc1.DELTA.::[P.sub.ScPDC1:25ScCOX4-
MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScT-
PI1:ScILV3:T.sub.ScPDC1)
pdc6.DELTA.::[P.sub.ScTDH3:ScPCK1:P.sub.ScADH1:ScMDH2:P.sub.ScFBA1:ScDIC1-
:P.sub.ScTPI1:ScMAE1: P.sub.ScTEF1:hph:T.sub.ScPDC6] Evolved to be
C2-independent c2i-SC1MMB S. cerevisiae MATa his3 trp1 ura3
pdc5::ble pdc6::apt1(kanR) ho
pdc1.DELTA.::[P.sub.ScPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
-
MTS:P.sub.ScADH1:DmADH:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScTP-
I1:ScILV3:T.sub.ScPDC1) pdc6
.DELTA.::[P.sub.ScTDH3:ScPCK1:P.sub.ScADH1:ScMDH2:P.sub.ScFBA1:ScDIC-
1:P.sub.ScTPI1:ScMAE1: P.sub.ScTEF1:hph:T.sub.ScPDC6] Evolved to be
C2-independent c2i-SC1MTH S. cerevisiae MATa his3 trp1 ura3
pdc5::ble pdc6::apt1(kanR) ho
pdc1.DELTA.::[P.sub.ScPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
-
MTS:P.sub.ScADH1:DmADH:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScTP-
I1:ScILV3:T.sub.ScPDC1] pdc6 .DELTA.::[P.sub.ScTDH3: Nc
Transhydrogenase:P.sub.ScTEF1:hph] Evolved to be C2- independent
c2i-SC1N S. cerevisiae MATa his3 trp1 ura3 pdc5::ble
pdc6::apt1(kanR) ho
pdc1.DELTA.::[P.sub.PDC1:25COX-MTS:BsalsS:P.sub.TDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:DmADH:P.sub.FBA1:URA3:P.sub.FBA1:31COX4-MTS:EcilvCcoSc.s-
up.P2D1-A1-his6: P.sub.TPI1:ILV3:T.sub.PDC1] Evolved to be
C2-independent c2i-SC1TH S. cerevisiae MATa his3 trp1 ura3
pdc5::ble ho pdc1.DELTA.::[P.sub.ScPDC1:25ScCOX4-
MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScT-
PI1:ScILV3:T.sub.ScPDC1 [pdc6 .DELTA.::[P.sub.ScTDH3: Nc
Transhydrogenase:P.sub.ScTEF1:hph] Evolved to be C2- independent
c2i-SCA1 S. cerevisiae MATa his3 trp1 ura3 pdc5::ble
pdc6::apt1(kanR) ho
pdc1.DELTA.::[P.sub.ScPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
- MTS:P.sub.ScADH1:ScADH3-
MTS:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScTPI1:ScILV3:T.-
sub.ScPDC1] Evolved to be C2-independent c2i-SCA1MB S. cerevisiae
MATa his3 trp1 ura3 pdc5::ble pdc6::apt1(kanR) ho
pdc1.DELTA.::[P.sub.ScPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
- MTS:P.sub.ScADH1:ScADH3-
MTS:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScTPI1:ScILV3:T.-
sub.ScPDC1]
pdc6.DELTA.::[P.sub.ScTDH3:ScPCK1:P.sub.ScADH1:ScMDH2:P.sub.ScFBA1:ScDIC1-
:P.sub.ScTPI1:ScMAE1: P.sub.ScTEF1:hph:T.sub.ScPDC6] Evolved to be
C2-independent c2i-SCA1N S. cerevisiae MATa his3 trp1 ura3
pdc5::ble pdc6::apt1(kanR) ho
pdc1.DELTA.::[P.sub.PDC1:25COX4-MTS:BsalsS:P.sub.TDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:ScADH3-MTS:DmADH:P.sub.ScFBA1:ScURA3:
P.sub.FBA1:31COX4-
MTS:EcilvCcoSc.sup.P2D1-A1-his6:P.sub.ScTPI1:ScILV3: T.sub.PDC1]
Evolved to be C2-independent c2i-SCA1TH S. cerevisiae MATa his3
trp1 ura3 pdc5::ble pdc6::apt1(kanR) ho
pdc1.DELTA.::[P.sub.ScPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
- MTS:P.sub.ScADH1:ScADH3-
MTS:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScTPI1:ScILV3:T.-
sub.ScPDC1] pdc6.DELTA.::[P.sub.ScTDH3:Nc
Transhydrogenase:P.sub.ScTEF1:hph]vEvolved to be C2-independent
GEVO1068 Kluyveromyces marxianus (NRRL-Y-7571 from USDA) GEVO1186
S. cerevisiae CEN.PK, ura3/ura3 leu2/leu2 his3/his3 trp1/trp1 ADE2
MAT a/alpha GEVO1187 Saccharomyces cerevisiae (CEN.PK2-1C) MATa
ura3 leu2 his3 trp1 ADE2 GEVO1537 Saccharomyces cerevisiae (GG570
from Prof. Paul can Heusden, Univ. of Leiden, Netherlands)
MATa/MATalpha HIS3/HIS3 LEU2/LEU2 TRP1/TRP1 URA3/URA3
pdc1::ble/pdc1::ble pdc5::ble/pdc5::ble
pdc6::apt1(kanR)/pdc6::apt1(kanR) HO/HO GEVO1584 S. cerevisiae MAT
a his3 trp1 ura3 leu2 pdc1::ble pdc5::ble pdc6::apt1(kanR) ho
GEVO1802 S. cerevisiae CEN.PK MATa/alpha ura3/ura3 leu2/leu2
his3/his3 trp1/trp1
pdc6.DELTA.::[ScURA3:ampR:PMB1:P.sub.ScTEF1:LlkivD2:P.sub.ScTDH3:ScADH7:
T.sub.ScPDC6]/PDC6
GEVO1803 MATa/.alpha. ura3/ura3 leu2/leu2 his3/his3 trp1/trp1
pdc1.DELTA.::[ScTRP1:bla:pUC
ori:P.sub.ScCUP1-1:Bs_alsS2::T.sub.Sc.sub.--.sub.PDC1]/PDC1
GEVO1805 S. cerevisiae CEN.PK MATa/alpha ura3/ura3 leu2/leu2
his3/his3 trp1/trp1
pdc5.DELTA.::[ScLEU2:ampR:PMB1:P.sub.ScTEF1:EcilvD.DELTA.NcoKl:P.sub.ScTD-
H3:EcilvC.DELTA.N: T.sub.ScPDC5]/PDC5
pdc6.DELTA.::[ScURA3:ampR:PMB1:P.sub.ScTEF1:LlkivD2:P.sub.ScTDH3:ScADH7:
T.sub.ScPDC6]/PDC6 GEVO1820 S. cerevisiae CEN.PK MAT a/alpha
ura3/ura3 leu2/leu2 his3/his3 trp1/trp1
pdc1.DELTA.::[ScTRP1:bla:pUC
ori:P.sub.ScCUP1-1:Bs_alsS2::T.sub.Sc.sub.--.sub.PDC1]/PDC1 pdc5
.DELTA.::[ScLEU2:ampR:PMB1:P.sub.ScTEF1:EcilvD.DELTA.NcoKl:P.sub.ScTDH3:
EcilvC.DELTA.N: T.sub.ScPDC5]/ PDC5 pdc6
.DELTA.::[ScURA3:ampR:PMB1:P.sub.ScTEF1:
LlkivD2:P.sub.ScTDH3:ScADH7:T.sub.ScPDC6]/ PDC6 GEVO1863
Saccharomyces cerevisiae MAT a his3 trp1 ura3 pdc1::ble pdc5::ble
pdc6::apt1(kanR) ho. Evolved to be C2-independent GEVO1947
Kluyveromyces marxianus ura3-.DELTA.2 GEVO1969 K. marxianus
NRRL-Y-7571 ura3-.DELTA.2 pdc1.DELTA.::G418.sup.R GEVO2062 S.
cerevisiae CEN.PK MAT a/alpha ura3/ura3 leu2/leu2 his3/his3
trp1/trp1 ho/ho,
pdc1.DELTA.::[P.sub.ScPDC125COX4-MTS:Bs_alsSP.sub.ScTDH3:Sc_ARO10:-
ScHMI1- MTS:P.sub.ScADH1:Sc_ADH7:P.sub.ScFBA1:ScURA3] GEVO2072 S.
cerevisiae CEN.PK MAT a/alpha ura3/ura3 leu2/leu2 his3/his3
trp1/trp1 ho/ho,
PDC1/pdc1::[P.sub.ScPDC1:31COX4-MTS:Bs_alsS:P.sub.ScTDH3:Ll_kivD:S-
cHMI1- MTS:P.sub.ScADH1:Sc_ADH7:P.sub.Sc.sub.--.sub.FBA1:ScURA3]
GEVO2087 Kluyveromyces marxianus, ura3-.DELTA.2
[P.sub.ScPDC1:31COX4-
MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-MTS:P.sub.ScADH1:ScADH7:PScFBA1:URA-
3] GEVO2088 Kluyveromyces marxianus, ura3-.DELTA.2
[P.sub.ScPDC1:31COX4-
MTS:Bs_alsS:P.sub.ScTDH3:LlkivD:ScHMI1-MTS:P.sub.ScADH1:ScADH7:PSc.sub.FB-
A1:URA3] GEVO2107 MATa/.alpha. ura3/ura3 leu2/leu2 his3/his3
trp1/trp1 pdc1.DELTA.::[Bs_alsS2; TRP1]/PDC1
pdc6.DELTA.::[P.sub.ScTEF1:Llkivd:P.sub.ScTDH3:DmADH ScURA3]/PDC6
GEVO2119 Saccharomyces cerevisiae diploid of CEN.PK parent strain,
MAT-a/alpha ura3/ura3 leu2/leu2 his3/his3 trp1/trp1 ho/ho,
pdc1.DELTA.::[P.sub.ScPDC1:25COX4-
MTS:Bs_alsS:P.sub.ScTDH3:LlkivD:HMI1-MTS:P.sub.ScADH1:ScADH7:
P.sub.ScFBA1:ScURA3]/ PDC1 GEVO2120/ Saccharomyces cerevisiae
diploid of CEN.PK parent strain, MAT-a/alpha 2121 ura3/ura3
leu2/leu2 his3/his3 trp1/trp1 ho/ho,
pdc1.DELTA.::[P.sub.ScPDC1:31COX4-
MTS:Bs_alsS:P.sub.ScTDH3:ARO10:ScHMI1-MTS:P.sub.ScADH1:ScADH7:
P.sub.ScFBA1:ScURA3]/PDC1 GEVO2122/ Saccharomyces cerevisiae
diploid of CEN.PK parent strain, MAT-a/alpha 2123 ura3/ura3
leu2/leu2 his3/his3 trp1/trp1 ho/ho,
pdc1.DELTA.::[P.sub.ScPDC1:ScILV2:
P.sub.ScTDH3:Ll_kivd:ScHMI1-MTS:P.sub.ScADH1:ScADH7:P.sub.ScFBA1:ScURA3]/-
PDC1 GEVO2124/ Saccharomyces cerevisiae diploid of CEN.PK parent
strain, MAT-a/alpha 2125 ura3/ura3 leu2/leu2 his3/his3 trp1/trp1
ho/ho, pdc1.DELTA.::[P.sub.ScPDC1:ScILV2:
P.sub.ScTDH3:ScARO10:ScHMI1-MTS:P.sub.ScADH1:ScADH7:P.sub.ScFBA1:ScURA3]/-
PDC1 GEVO2126 Saccharomyces cerevisiae diploid of CEN.PK parent
strain, MAT-a/alpha ura3/ura3 leu2/leu2 his3/his3 trp1/trp1 ho/ho,
pdc1.DELTA.::[P.sub.ScPDC1:ScILV2:
P.sub.ScTDH3:Ll_kivd:ScHMI1-MTS:P.sub.ScADH1:ScILV6*:P.sub.ScFBA1:ScURA3]-
/PDC1 GEVO2127/ Saccharomyces cerevisiae diploid of CEN.PK parent
strain, MATa/alpha 2128 ura3/ura3 leu2/leu2 his3/his3 trp1/trp1
ho/ho, PDC1/pdc1.DELTA.::[P.sub.Sc.sub.--.sub.PDC1: 31COX4-
MTS:Bs_alsS:P.sub.Sc.sub.--.sub.ADH1:Sc_ADH7:P.sub.Sc.sub.--.sub.FBA1:ScU-
RA3] GEVO2129/2130 Saccharomyces cerevisiae diploid of CEN.PK
parent strain, MATa/alpha ura3/ura3 leu2/leu2 his3/his3 trp1/trp1
ho/ho, PDC1/pdc1 .DELTA.::[P.sub.Sc.sub.--.sub.PDC1: 31COX4-
MTS:Bs_alsS:P.sub.Sc.sub.--.sub.TDH3:LlkivD:ScHMI1-MTS:P.sub.Sc.sub.--.su-
b.FBA1: ScURA3] GEVO2131/2132 Saccharomyces cerevisiae diploid of
CEN.PK parent strain, MATa/alpha ura3/ura3 leu2/leu2 his3/his3
trp1/trp1 ho/ho, PDC1/pdc1.DELTA.::[P.sub.Sc.sub.--.sub.PDC1:
LlkivD:ScHMI1-MTS:P.sub.Sc.sub.--.sub.ADH1:ScADH7:P.sub.Sc.sub.--.sub.FBA-
1:ScURA3] GEVO2158 MATa/.alpha. ura3/ura3 leu2/leu2 his3/his3
trp1/trp1 pdc1 .DELTA.::[BsalsS2: TRP1]/PDC1 pdc5
.DELTA.::[P.sub.ScTEF1:ILV3.DELTA.N:P.sub.ScTDH3:ilvCco(Sc).sup.Q110-
V:LEU2]/PDC5
pdc6.DELTA.::[P.sub.ScTEF1:LlkivD:P.sub.ScTDH3:DmADH:ScURA3]/PDC6
GEVO2166 S. cerevisiae MATa his3 trp1 ura3 leu2
pdc1.DELTA.::[P.sub.ScPDC1:25ScCOX4-
MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-MTS:P.sub.ScADH1:ScADH7:P.sub.ScFBA-
1:ScURA3] pdc5::ble pdc6::apt1(kanR) ho GEVO2167 S. cerevisiae MATa
his3 trp1 ura3 leu2 pdc1.DELTA.::[P.sub.ScPDC1:25ScCOX4-
MTS:BsalsS:P.sub.ScTDH3:LlkivD:
ScHMI1-MTS:P.sub.ScADH1:ScADH7:P.sub.ScFBA1:ScURA3] pdc5::ble
pdc6::apt1(kanR) GEVO2276 K. marxianus NRRL-Y-7571 ura3-.DELTA.2
pdc1.DELTA.::[P.sub.ScPDC1:31ScCOX4-
MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:ScADH7:P.sub.ScFBA1:ScURA3:T.sub.ScPDC1] RANDOMLY
INTEGRATED, Candidate #1 GEVO2277 K. marxianus NRRL-Y-7571
ura3-.DELTA.2 pdc1.DELTA.::[P.sub.ScPDC1:31ScCOX4-
MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-MTS:P.sub.ScADH1:ScADH7:P.sub.ScFBA-
1:ScURA3: T.sub.ScPDC1] RANDOMLY INTEGRATED Candidate #2 GEVO2302
S. cerevisiae haploid of CEN.PK parent strain MATa ura3 leu2 his3
trp1 pdc1.DELTA.::[BsalsS2:TRP1]
pdc5.DELTA.::[P.sub.TEF1:ScILV3.DELTA.N
P.sub.TDH3:EcilvCco(Sc).sup.Q110V:LEU2]
pdc6.DELTA.::[P.sub.TEF1:Ll_kivd2:P.sub.TDH3:DmADH: URA3] GEVO2346
K. marxianus NRRL-Y-7571 ura3-.DELTA.2 pdc1.DELTA.::G418.sup.R
[P.sub.ScPDC1:31ScCOX4-
MTS:BsalsS:P.sub.ScTDH3:LlkivD2:P.sub.ScFBA1:ScURA3:T.sub.ScPDC1]
RANDOMLY INTEGRATED Candidate pGV1990 #4 GEVO2347 K. marxianus
NRRL-Y-7571 ura3-.DELTA.2 pdc1.DELTA.::G418.sup.R
[P.sub.ScPDC1:31ScCOX4-MTS: BsalsS:
P.sub.ScTDH3:LlkivD2:P.sub.ScFBA1:ScURA3:T.sub.ScPDC1] RANDOMLY
INTEGRATED Candidate pGV1990 #5 GEVO2348 K. marxianus NRRL-Y-7571
ura3-.DELTA.2 pdc1.DELTA.::G418.sup.R [P.sub.ScPDC1:31ScCOX4-
MTS:BsalsS:P.sub.ScTDH3:P.sub.ScFBA1:ScURA3:T.sub.ScPDC1] RANDOMLY
INTEGRATED Candidate pGV2015 #2 GEVO2542 K. marxianus NRRL-Y-7571
ura3-.DELTA.2 pdc1.DELTA.::[LlkivD2:P.sub.ScTDH3:
DmADH:P.sub.ScFBA1:31ScCOX4-MTS:Bs_alsS] GEVO2878 S. cerevisiae
CEN.PK MAT a/alpha ura3/ura3 leu2/leu2 his3/his3 trp1/trp1 ho/ho,
pdc1.DELTA.::[P.sub.ScPDC131COX4-MTS:BsalsS:P.sub.ScTDH3:
LlkivD:ScHMI1-MTS:P.sub.ScADH1 ScADH7:P.sub.ScFBA1URA3]
[P.sub.ScTDH3ScBAT1, 2.mu., TRP1] [P.sub.ScTEF1ScBAT2, 2.mu., HIS3]
GEVO2879 S. cerevisiae CEN.PK MAT a/alpha ura3/ura3 leu2/leu2
his3/his3 trp1/trp1 ho/ho,
pdc1.DELTA.::[P.sub.ScPDC131COX4-MTS:BsalsS:
P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1ScADH7:P.sub.ScFBA1URA3] [P.sub.ScTDH3ScBAT1,
2.mu., TRP1] [P.sub.ScTEF1Sc_BAT2, 2.mu., HIS3] GEVO2880 S.
cerevisiae CEN.PK MAT a/alpha ura3/ura3 leu2/leu2 his3/his3
trp1/trp1 ho/ho,
pdc1.DELTA.::[P.sub.ScPDC131COX4-MTS:BsalsS_co_Sc:P.sub.ScTDH3:Llk-
ivD: ScHMI1- MTS: P.sub.ScADH1Sc_ADH7:P.sub.ScFBA1URA3]
[P.sub.ScTDH3Sc_BAT1, 2.mu., TRP1] [P.sub.ScTEF1Sc_BAT2, 2.mu.,
HIS3] GEVO7777 S. cerevisiae MATa his3 trp1 ura3 pdc5::ble
pdc6::apt1(kanR) ho SC1 S. cerevisiae MATa his3 trp1 ura3 pdc5::ble
pdc6::apt1(kanR) ho
pdc1.DELTA.::[P.sub.ScPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3::LlkivD:ScHMI-
1- MTS:P.sub.ScADH1:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:
P.sub.ScTPI1:ScILV3:T.sub.ScPDC1] SC1M S. cerevisiae MATa his3 trp1
ura3 pdc5::ble pdc6::apt1(kanR) ho
pdc1.DELTA.::[P.sub.ScPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
-
MTS:P.sub.ScADH1:DmADH:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScTP-
I1:ScILV3:T.sub.ScPDC1] SC1MB S. cerevisiae MATa his3 trp1 ura3
pdc5::ble ho
pdc1.DELTA.::[P.sub.ScPDC1:25ScCOX4:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScT-
PI1:ScILV3:T.sub.ScPDC1]
pdc6.DELTA.::[P.sub.ScTDH3:ScPCK1:P.sub.ScADH1:ScMDH2:P.sub.ScFBA1:ScDIC1-
:P.sub.ScTPI1:ScMAE1: P.sub.ScTEF1:hph:T.sub.ScPDC6] SC1MMB S.
cerevisiae MATa his3 trp1 ura3 pdc5::ble pdc6::apt1(kanR) ho
pdc1.DELTA.::[P.sub.ScPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
-
MTS:P.sub.ScADH1:DmADH:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScTP-
I1:ScILV3:T.sub.ScPDC1]
pdc6.DELTA.::[P.sub.ScTDH3:ScPCK1:P.sub.ScADH1:ScMDH2:P.sub.ScFBA1:ScDIC1-
:P.sub.ScTPI1:ScMAE1: P.sub.ScTEF1:hph:T.sub.ScPDC6] SC1MTH S.
cerevisiae MATa his3 trp1 ura3 pdc5::ble (kanR) ho
pdc1.DELTA.::[P.sub.ScPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
-
MTS:P.sub.ScADH1:DmADH:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScTP-
I1:ScILV3:T.sub.ScPDC1] pdc6.DELTA.::[P.sub.ScTDH3:Nc
Transhydrogenase:P.sub.ScTEF1:hph] SC1N S. cerevisiae MATa his3
trp1 ura3 pdc5::ble pdc6::apt1(kanR) ho
pdc1.DELTA.::[P.sub.PDC1:25COX4-MTS:BsalsS:P.sub.TDH3:LlkivD:ScHMI1-MTS:
P.sub.ScADH1:DmADH: P.sub.ScFBA1:URA3:
P.sub.ScFBA1:31COX4-MTS:EcilvCcoSc.sup.P2D1-A1-his6:
P.sub.ScTPI1:ILV3: T.sub.PDC1] SC1TH S. cerevisiae MATa his3 trp1
ura3 pdc5::ble ho pdc1.DELTA.::[P.sub.ScPDC1:25ScCOX4-
MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScT-
PI1:ScILV3: T.sub.ScPDC1] pdc6.DELTA.::[P.sub.ScTDH3:Nc
Transhydrogenase:P.sub.ScTEF1:hph] SCA1 S. cerevisiae MATa his3
trp1 ura3 pdc5::ble pdc6::apt1(kanR) ho
pdc1.DELTA.::[P.sub.ScADH1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
- MTS:P.sub.ScADH1:ScADH3-
MTS:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScTPI1:ScILV3:T.-
sub.ScPDC1] SCA1MB S. cerevisiae MATa his3 trp1 ura3 pdc5::ble
pdc6::apt1(kanR) ho
pdc1.DELTA.::[P.sub.ScPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
- MTS:P.sub.ScADH:ScADH3-MTS:
ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScTPI1:ScILV3:T.sub.-
ScPDC1]
pdc6.DELTA.::[P.sub.ScTDH3:ScPCK1:P.sub.ScADH1:ScMDH2:P.sub.ScFBA1:ScDIC1-
:P.sub.ScTPI1:ScMAE1: P.sub.ScTEF1:hph:T.sub.ScPDC6] SCA1N S.
cerevisiae MATa his3 trp1 ura3 pdc5::ble pdc6::apt1(kanR) ho
pdc1.DELTA.::[P.sub.PDC1:25COX4-MTS:BsalsS:P.sub.TDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:ScADH3-MTS:DmADH: P.sub.ScFBA1:ScURA3:
P.sub.ScFBA1:31COX4-
MTS:EcilvCcoSc.sup.P2D1-A1-his6:P.sub.ScTPI1:ScILV3:T.sub.PDC1]
SCA1TH S. cerevisiae MATa his3 trp1 ura3 pdc5::ble pdc6::apt1(kanR)
ho
pdc1.DELTA.::[P.sub.ScPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
- MTS:P.sub.ScADH:ScADH3-MTS:
ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScTPI1:ScILV3:T.sub.-
ScPDC1] pdc6.DELTA.::[P.sub.ScTDH3:Nc
Transhydrogenase:P.sub.ScTEF1:hph] SCP1 S. cerevisiae MAT-a/alpha
ura3/ura3 leu2/leu2 his3/his3 trp1/trp1 ho/ho pdc1.DELTA.::
P.sub.ScPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScT-
PI1:ScILV3:T.sub.ScPDC1]/PDC1 SCP1K S. cerevisiae MAT-a/alpha
ura3/ura3 leu2/leu2 his3/his3 trp1/trp1 ho/ho
pdc1.DELTA.::[P.sub.ScPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
-
MTS:P.sub.ScADH1:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:31COX4-MTS:Ecilv-
CcoSc.sup.P2D1-A1-his6: P.sub.ScTPI1:ScILV3:T.sub.ScPDC1]/PDC1
SCP1KMB S. cerevisiae MAT-a/alpha ura3/ura3 leu2/leu2 his3/his3
trp1/trp1 ho/ho pdc1.DELTA.::
P.sub.ScPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:31COX4-MTS:Ecilv-
CcoSc.sup.P2D1-A1-his6: P.sub.ScTPI1:ScILV3:T.sub.ScPDC1]/PDC1
pdc6.DELTA.::[P.sub.ScTDH3:ScPCK1:P.sub.ScADH1:ScMDH2:P.sub.ScFBA1:ScDIC1-
:P.sub.ScTPI1:ScMAE1: P.sub.ScTEF1:hph:T.sub.ScPDC6]/PDC6 SCP1KTH
S. cerevisiae MAT-a/alpha ura3/ura3 leu2/leu2 his3/his3 trp1/trp1
ho/ho
pdc1.DELTA.:[P.sub.ScPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:31COX4-MTS:Ecilv-
CcoSc.sup.P2D1-A1-his6: P.sub.ScTPI1:ScILV3:T.sub.ScPDC1]/PDC1
pdc6.DELTA.::[P.sub.ScTDH3:Nc
Transhydrogenase:P.sub.ScTEF1:hph:]/PDC6 SCP1M S. cerevisiae
MAT-a/alpha ura3/ura3 leu2/leu2 his3/his3 trp1/trp1 ho/ho
pdc1.DELTA.::[P.sub.ScPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
-
MTS:P.sub.ScADH1:DmADH:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScTP-
I1:ScILV3:T.sub.ScPDC1]/PDC1 SCP1MB S. cerevisiae MAT-a/alpha
ura3/ura3 leu2/leu2 his3/his3 trp1/trp1 ho/ho
pdc1.DELTA.::[P.sub.ScPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
-
MTS:P.sub.ScADH1:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:SCILV5:P.sub.ScT-
PI1:ScILV3:T.sub.ScPDC1]/PDC1
pdc6.DELTA.::[P.sub.ScTDH3:ScPCK1:P.sub.ScADH1:ScMDH2:P.sub.ScFBA1:ScDIC1-
:P.sub.ScTPI1:ScMAE1: P.sub.ScTEF1:hph:T.sub.ScPDC6]/PDC6 SCP1MMB
S. cerevisiae MAT-a/alpha ura3/ura3 leu2/leu2 his3/his3 trp1/trp1
ho/ho
pdc1.DELTA.::[P.sub.ScPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
-
MTS:P.sub.ScADH1:DmADH:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScTP-
I1:ScILV3:T.sub.ScPDC1]/PDC1
pdc6.DELTA.::[P.sub.ScTDH3:ScPCK1:P.sub.ScADH1:ScMDH2:P.sub.ScFBA1:ScDIC1-
:P.sub.ScTPI1:ScMAE1: P.sub.ScTEF1:hph:T.sub.ScPDC6]/PDC6 SCP1MTH
S. cerevisiae MAT-a/alpha ura3/ura3 leu2/leu2 his3/his3 trp1/trp1
ho/ho
pdc1.DELTA.::[P.sub.ScPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
-
MTS:P.sub.ScADH1:DmADH:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScTP-
I1:ScILV3:T.sub.ScPDC1]/PDC1 pdc6.DELTA.::[P.sub.ScTDH3:Nc
Transhydrogenase:P.sub.ScTEF1:hph:]/PDC6 SCP1N S. cerevisiae
MAT-a/alpha ura3/ura3 leu2/leu2 his3/his3 trp1/trp1 ho/ho
pdc1.DELTA.::[P.sub.PDC1:25COX4-MTS:BsalsS:P.sub.TDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:DmADH:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:31COX4-MTS:EcilvC-
coSc.sup.P2D1-A1-his6: P.sub.ScTPI1:ILV3:T.sub.ScPDC1]/PDC1 SCP1TH
S. cerevisiae MAT-a/alpha ura3/ura3 leu2/leu2 his3/his3 trp1/trp1
ho/ho
pdc1.DELTA.::[P.sub.ScPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
-
MTS:P.sub.ScADH1:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScT-
PI1:ScILV3:T.sub.ScPDC1]/PDC1 pdc6 .DELTA.::[P.sub.ScTDH3:Nc
Transhydrogenase:P.sub.ScTEF1:hph]/PDC6 SCPA1 S. cerevisiae
MAT-a/alpha ura3/ura3 leu2/leu2 his3/his3 trp1/trp1 ho/ho
pdc1.DELTA.::[P.sub.ScPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
- MTS:P.sub.ScADH1:ScADH3-
MTS:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScTPI1:ScILV3:T.-
sub.ScPDC1]/PDC1 SCPA1MB S. cerevisiae MAT-a/alpha ura3/ura3
leu2/leu2 his3/his3 trp1/trp1 ho/ho
pdc1.DELTA.::[P.sub.ScPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
- MTS:P.sub.ScADH:ScADH3-
MTS:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScTPI1:ScILV3:T.-
sub.ScPDC1]/PDC1 pdc6
.DELTA.::[P.sub.ScTDH3:ScPCK1:P.sub.ScADH1:ScMDH2:P.sub.ScFBA1:ScDIC-
1:P.sub.ScTPI1:ScMAE1: P.sub.ScTEF1:hph:T.sub.ScPDC6]/PDC6 SCPA1N
S. cerevisiae MAT-a/alpha ura3/ura3 leu2/leu2 his3/his3 trp1/trp1
ho/ho
pdc1.DELTA.::[P.sub.PDC1:25COX4-MTS:BsalsS:P.sub.TDH3:LlkivD:ScHMI1-MTS:
P.sub.ScADH1:ScADH3-MTS:DmADH:P.sub.ScFBA1:URA3:
P.sub.ScFBA1:31COX4-
MTS:EcilvCcoSc.sup.P2D1-A1-his6:P.sub.ScTPI1:ILV3:T.sub.ScPDC1]/PDC1
SCPA1TH S. cerevisiae MAT-a/alpha ura3/ura3 leu2/leu2 his3/his3
trp1/trp1 ho/ho
pdc1.DELTA.::[P.sub.ScPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
- MTS:P.sub.ScADH:ScADH3-
MTS:ScADH7:P.sub.ScFBA1:ScURA3:P.sub.ScFBA1:ScILV5:P.sub.ScTPI1:ScILV3:T.-
sub.ScPDC1]/PDC1 pdc6 .DELTA.::[P.sub.ScTDH3:Nc
Transhydrogenase:P.sub.ScTEF1:hph]/PDC6
TABLE-US-00002 pGV No. SEQ ID NO Genotype 1104 ScTRP1 2.mu. 1315
P.sub.ScTEF2:ScILV2.DELTA.N:P.sub.ScTDH3:ScILV6.DELTA.N:T.sub.ScCYC1-
, bla, pUC ori, HIS3, 2.mu. 1441 P.sub.ScTEF1:MCS:T.sub.ScCYC1
ScHIS3 2.mu. pUC ori bla 1503 P.sub.ScTEF1:G418, bla, pUC ori, 1590
P.sub.ScTEF1:LlkivD2:P.sub.Sc.sub.--.sub.TDH3:ScADH7:URA3, PMB1,
AP.sup.r 1730 P.sub.ScPDC, ScTRP1,
P.sub.ScCUP1-1:BsalsS2::T.sub.Sc.sub.--.sub.PDC1, PMB1, AP.sup.r
1731 P.sub.ScPDC5,ScLEU,
P.sub.ScTEF1:EcilvD.DELTA.NcoKl:P.sub.ScTDH3:EcilvC.DELTA.N:
T.sub.ScPDC5 PMB1, AP.sup.r 1733 P.sub.ScPDC6, ScURA3
P.sub.ScTEF1:LlkivD2:P.sub.ScTDH3:ScADH7:T.sub.ScPDC6 PMB1,
AP.sup.r 1773 1
P.sub.Sc.sub.--.sub.PDC1:BsalsS:P.sub.ScTDH3:LlkivD:P.sub.ScADH1:Sc-
ADH7:P.sub.ScFBA1:5' ScURA3, pUC ori, kan.sup.R 1774 2 3'
ScURA3:P.sub.S.sub.--.sub.FBA1:EcilvCco:P.sub.ScTPI1:EcilvDco:T.-
sub.ScPDC1, pUC ori, kan.sup.R 1799 KmURA3D, pUC ori, AP.sup.r 1810
3 3' URA3:P.sub.ScFBA1:ScILV5:P.sub.ScTPI1:EcilvDco:T.sub.ScPDC1,
pUC ori, kan.sup.R 1811 4 P.sub.Km.sub.--.sub.PDC1:
BsalsS:P.sub.ScTDH3:LlkivD:P.sub.ScADH1:ScADH7:P.sub.ScFBA1:5'
ScURA3, pUC ori, kan.sup.R 1812 5 3'
ScURA3:P.sub.ScFBA:EcilvCco:P.sub.ScTPI1:EcilvDco:T.sub.KmPDC1, pUC
ori, kan.sup.R 1816 P.sub.Sc.sub.--.sub.PDC1:
BsalsS:T.sub.ScTDH3:Llkivd::P.sub.ScADH1:ScADH7:P.sub.ScFBA1:URA3:
T.sub.ScPDC1, pUC ori, kan.sup.R 1817 6 3'
ScURA3:P.sub.ScFB1:ScILV5:P.sub.ScTPI1:ScILV3:T.sub.ScPDC1, pUC
ori, kan.sup.R 1817N 12 3' ScURA3:
P.sub.ScFBA1:31COX4-MTS:EcilvCcoSc.sup.P2D1-A1-his6: P.sub.ScTPI1:
ScILV3: T.sub.ScPDC1, pUC ori, kan.sup.R 1832 7 3'
ScURA3:P.sub.ScFBA:ScILV5:P.sub.ScTPI1:ScILV3:T.sub.KmPDC1, pUC
ori, kan.sup.R 1832N 13 3' ScURA3:
P.sub.ScFBA1:31COX4-MTS:EcilvCcoSc.sup.P2D1-A1-his6: P.sub.ScTPI1:
ScILV3: T.sub.KmPDC1, pUC ori, kan.sup.R 1834 8
P.sub.KmPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:ScADH7:P.sub.ScFBA:5' ScURA3, pUC ori, kan.sup.R
1834N 14
P.sub.KmPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:DmADH:P.sub.ScFBA1:5' ScURA3, pUC ori, kan.sup.R
1874 P.sub.ScPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:ScADH7:P.sub.ScFBA1:ScURA3:T.sub.ScPDC1, pUC ori,
kan.sup.R 1875 92
P.sub.ScPDC1:31ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-MTS:P.-
sub.ScADH1: ScADH7: P.sub.ScFBA1:ScURA3:T.sub.ScPDC1, pUC ori,
kan.sup.R 1876 97
P.sub.ScPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3ScARO10:ScHMI1-MTS:
P.sub.ScADH1:ScADH7:P.sub.ScFBA1:ScURA3:T.sub.ScPDC1, pUC ori,
kan.sup.R 1877
P.sub.ScPDC1:31ScCOX4-MTS:BsalsS:P.sub.ScTDH3:ScARO10:ScHMI1-MTS:
P.sub.ScADH1:ScADH7: P.sub.ScFBA1:ScURA3:T.sub.ScPDC1, pUC ori,
kan.sup.R 1878
P.sub.ScPDC1:ScILV2:P.sub.ScTDH3:Llkivd:ScHMI1-MTS:P.sub.ScADH1:ScAD-
H7: P.sub.ScFBA1:ScURA3:T.sub.ScPDC1, pUC ori, kan.sup.R 1879
P.sub.ScPDC1:ScILV2:P.sub.ScTDH3:ScARO10::ScHMI1-
MTS:P.sub.ScADH1:ScADH7:P.sub.ScFBA1:ScURA3:T.sub.ScPDC, pUC ori,
kan.sup.R 1892
P.sub.ScPDC1:ScILV2:P.sub.ScTDH3:Llkivd:ScHMI1-MTS:P.sub.ScADH1:P.su-
b.ScFBA1: ScURA3:T.sub.S.sub.--.sub.PDC, pUC ori, kan.sup.R 1909
P.sub.ScPDC1:31ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScFBA1:ScURA3:T.sub.ScPDC pUC ori Kan.sup.R 1914
P.sub.TEF1:Llkivd2:P.sub.TDH3:DmADH PDC6 5',3' targeting homology
URA3 1936 P.sub.TEF1:ScILV3.DELTA.N
P.sub.TDH3:EcilvCco(Sc).sup.Q110V PDC5 5',3' targeting homology
LEU2 1990 94 P.sub.Sc.sub.--.sub.PDC1:31ScCOX4-
MTS:BsalsS:P.sub.ScTDH3:LlkivD2:P.sub.ScFBA1:ScURA3:T.sub.ScPDC pUC
ori Kan.sup.R 1999 93 P.sub.ScTEF1:ScBAT2:T.sub.ScCYC1 ScHIS3 2.mu.
2015 95
P.sub.Sc.sub.--.sub.PDC1:31ScCOX4-MTS:BsalsS:P.sub.Sc.sub.--.sub.T-
DH3:P.sub.Sc.sub.--.sub.FBA1:ScURA3: T.sub.Sc.sub.--.sub.PDC pUC
ori, Kan.sup.R 2030 P.sub.ScTEF1:LlkivD2:P.sub.ScTDH3:DmADH, pUC
ori, kan.sup.R 2061 P.sub.KmPDC1 LlkivD2:P.sub.ScTDH3DmADH:P.sub.Sc
FBA1ScURA3 (5' fragment), pUC ori, kan.sup.R 2062 3' fragment of
ScURA3: P.sub.ScFBA131ScCOX4-MTS:BsalsS:T.sub.KmPDC1, pUC ori,
kan.sup.R 2212 98 P.sub.TDH3:ScBAT1:T.sub.ScCYC1 ScTRP1 2.mu. 7001
9 P.sub.ScPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:ScADH7:P.sub.ScFBA1:ScURA3 (5' fragment), pUC ori,
kan.sup.R 7001N 15
P.sub.Km.sub.--.sub.PDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:-
ScHMI1- MTS:P.sub.ScADH1:DmADH:P.sub.ScFBA1:ScURA3 (5' fragment),
pUC ori, kan.sup.R 7101 10
P.sub.Sc.sub.--.sub.PDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:S-
cHMI1- MTS-P.sub.ScADH1:ScADH3-MTS:ScADH7:P.sub.ScFBA:Sc_URA3(5'
fragment), pUC ori, kan.sup.R 7101N 16
P.sub.Sc.sub.--.sub.PDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:-
ScHMI1- MTS:P.sub.ScADH1:ScADH3-MTS:DmADH:P.sub.ScFBA:ScURA3 (5'
fragment), pUC ori, kan.sup.R 8000 18
P.sub.ScTDH3:ScPCK1:P.sub.ScADH1:ScMDH2:P.sub.ScFBA1:ScDIC1:P.sub.-
ScTPI1: ScMAE1:P.sub.ScTEF1:hph:T.sub.ScPDC6, pUC ori, kan.sup.R
9000 19 P.sub.ScTDH3:Nc
Transhydrogenase:P.sub.ScTEF1:hph:T.sub.ScPDC6:P.sub.ScPDC6, pUC
ori, kan.sup.R 9834 11
P.sub.KmPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:ScADH3-MTS:ScADH7:P.sub.ScFBA1:ScURA3 (5'
fragment) pUC ori, kan.sup.R 9834N 17
P.sub.KmPDC1:25ScCOX4-MTS:BsalsS:P.sub.ScTDH3:LlkivD:ScHMI1-
MTS:P.sub.ScADH1:ScADH3-MTS:DmADH:P.sub.ScFBA1:ScURA3 (5'
fragment), pUC ori, kan.sup.R
Table 3 outlines the primers sequences disclosed herein:
TABLE-US-00003 GEVO No. Sequence 393 ATGGAAGATGTTCACCGTGC (SEQ ID
NO: 100) 394 CAACCACTGCAGCCAGCAGTTAAAGCACCAAC (SEQ ID NO: 163) 395
CTCACAGGATCCGACGCAATGCCATTACACTC (SEQ ID NO: 101) 457
CAGATCGTCGACATGACCTTGGCACCCCTAGAC (SEQ ID NO: 99) 458
GTTCCCGGATCCTCAGTTCAAATCAGTAACAACCCTTG (SEQ ID NO: 55) 562
TTAAGCGGATCTGCCTACTC (SEQ ID NO: 164) 837 ATCATTTGTAAACTGGAACAGC
(SEQ ID NO: 165) 1321 AATCATATCGAACACGATGC (SEQ ID NO: 102) 1322
TCAGAAAGGATCTTCTGCTC (SEQ ID NO: 103) 1323 ATCGATATCGTGAAATACGC
(SEQ ID NO: 104) 1324 AGCTGGTCTGGTGATTCTAC (SEQ ID NO: 105) 1341
TGCTGAAAGAGAAATTGTCC (SEQ ID NO: 106) 1342 TTTCTTGTTCGAAGTCCAAG
(SEQ ID NO: 107) 1364 TTTTGCGGCCGCTTAGATGCCGGAGTCCCAGTGCTTG (SEQ ID
NO: 54) 1435 GTTGGCATAGCGGAAACTTC (SEQ ID NO: 65) 1436
AAATGACGACGAGCCTGAAG (SEQ ID NO: 108) 1437 GACCTGACCATTTGATGGAG
(SEQ ID NO: 109) 1439 CAATTGGCGAAGCAGAACAAG (SEQ ID NO: 110) 1440
ATCGTACATCTTCCAAGCATC (SEQ ID NO: 111) 1441 AATCGGAACCCTAAAGGGAG
(SEQ ID NO: 112) 1442 AATGGGCAAGCTGTTTGCTG (SEQ ID NO: 113) 1443
TGCAGATGCAGATGTGAGAC (SEQ ID NO: 114) 1566 TCCCACCCAATCAAGGCCAACG
(SEQ ID NO: 115) 1567 TCCACCTGGTGCCAATGAACCG (SEQ ID NO: 116) 1587
CGGCTGCCAGAACTCTACTAACTG (SEQ ID NO: 117) 1588
GCGACGTCTACTGGCAGGTTAAT (SEQ ID NO: 118) 1595 CAACCTGGTGATTTGGGGAAG
(SEQ ID NO: 119) 1597 GAATGATGGCAGATTGGGCA (SEQ ID NO: 120) 1598
TATTGTGGGGCTGTCTCGAATG (SEQ ID NO: 121) 1608
GTCAACATGTCGACTGCAATTATTTGGTTTGGGT (SEQ ID NO: 56) 1609
GTGGTTAGGGATCCAATCGATCCAAAGAAGAGAG (SEQ ID NO: 57) 1610
TGCAGAGTCGAATTCAAGCTTGTGTATATGCCAAA (SEQ ID NO: 58) 1615
CAACTCGCGGCCGCGGATCCTAGGTTATTGGTTTTCTGGTCTCAAC (SEQ ID NO: 59) 1616
CGCCGACTCGAGATGTTGAGAACTCAAGCCGC (SEQ ID NO: 60) 1617
CGTTGAGTCGACATGGGCTTGTTAACGAAAGTTGC (SEQ ID NO: 61) 1618
GCCAACGGATCCTCAAGCATCTAAAACACAACCG (SEQ ID NO: 62) 1633
TCCGTCACTGGATTCAATGCCATC (SEQ ID NO: 122) 1634 TTCGCCAGGGAGCTGGTGAA
(SEQ ID NO: 123) 1652 ATTTCTTTCCAGACTTGTTC (SEQ ID NO: 63) 1653
ATCTCCCCACTTCAGAAGTTCCTA (SEQ ID NO: 64) 1658
TAGGAACTTCTGAAGTGGGGAGATCTCACCAGTAAAACATACGCATACA CATAC (SEQ ID NO:
66) 1661 ATCCAAAATTTTTACGTAACTGATTGTATCGCTGCACATTATAACCATGT
GTCACGGATTTGTTTTGTTCGGCG (SEQ ID NO: 69) 1662
ATCCAAAATTTTTACGTAACTGATTGTATCGCTGCACATTATAACCATGT
GTCACTTTTTTATTTCTTTTAAGTGCCGC (SEQ ID NO: 70) 1663
AATCAGTTACGTAAAAATTTTGGATTTTATAGAGCATATTCTTCACTAAG
AGGTTGTAAGAGCGTTTTCAGACGTATATAGGCTAGCTAAT (SEQ ID NO: 71) 1664
ATTAGCTAGCCTATATACGTCTGAAAACGCTCTTACAACCTCTTAGTGAA
GAATATGCTCTATAAAATCCAAAATTTTTACGTAACTGATT (SEQ ID NO: 72) 1665
TACTCGAGATGCTTTCACTACGTCAATCTATAAGATTTTTCAAGCCAGCC
ACAAGAACTTTGTGTAGCTCTAGATATCTGCTT (SEQ ID NO: 73) 1666
AAGCAGATATCTAGAGCTACACAAAGTTCTTGTGGCTGGCTTGAAAAATC
TTATAGATTGACGTAGTGAAAGCATCTCGAGTA (SEQ ID NO: 74) 1667
ACTCGAGATGCTTTCACTACGTCAATCTATAAGATTTTTCAAGCCAGCCA
CAAGAACTTTGTGTAGCTCTAGATATCTGCTTCAGCAAAAACCCGTGGTG (SEQ ID NO: 75)
1668 CACCACGGGTTTTTGCTGAAGCAGATATCTAGAGCTACACAAAGTTCTTG
TGGCTGGCTTGAAAAATCTTATAGATTGACGTAGTGAAAGCATCTCGAGT (SEQ ID NO: 76)
1671 CACATAGAGCAAGCAAGCAG (SEQ ID NO: 124) 1672
CGTAAGCAGCGTTCAATTCG (SEQ ID NO: 125) 1673
CGAATTGAACGCTGCTTACGGTGAATTCGAGCTCATAGCTTC (SEQ ID NO: 126) 1674
CATTTGGACACCTGGGAAAGGCTTACGCAATGCCATTACAC (SEQ ID NO: 127) 1675
CTTTCCCAGGTGTCCAAATG (SEQ ID NO: 128) 1676 GAGCTTGCTTGACCAAGTTG
(SEQ ID NO: 129) 1678 CTGGCATTGTGTCTGGATTG (SEQ ID NO: 130) 1679
GAGATTAAATCGCGCTAGCTTAATTCTGCTGACCACATCTTC (SEQ ID NO: 131) 1680
CAGAATTAAGCTAGCGCGATTTAATCTCTAATTATTAGT (SEQ ID NO: 132) 1681
TTTGTGTAGCTCTAGATATCTGCTTATGTTGACTAAAGCTACAAAAGAGC (SEQ ID NO: 77)
1682 TCTGCTTCAGCAAAAACCCGTGGTGATGTTGACTAAAGCTACAAAAGAGC (SEQ ID NO:
78) 1683 TACTCGAGATGCTTTCACTACG (SEQ ID NO: 79) 1684
ATTAGCTAGCCTATATACGTCTGA (SEQ ID NO: 80) 1685
ATTACTCGAGATGATCAGACAATCTACGCTAA (SEQ ID NO: 81) 1686
CTGAAAAAGCGTGTTTTTTATGGATCCTCAGTGCTTACCGCCTGTAC (SEQ ID NO: 133)
1687 GTACAGGCGGTAAGCACTGAGGATCCATAAAAAACACGCTTTTTCAG (SEQ ID NO:
134) 1688 TTCAATTGTAACAGGTGCCATAAGCTTTTTGTTTGTTTATGTGTG (SEQ ID NO:
135) 1689 CACACATAAACAAACAAAAAGCTTATGGCACCTGTTACAATTGAA (SEQ ID NO:
136) 1690 ATAAAAAACACGCTTTTTCAG (SEQ ID NO: 137) 1691
TTTGTTTGTTTATGTGTGTTTATTC (SEQ ID NO: 138) 1738 GCCTTCTCGTCAACCAAGA
(SEQ ID NO: 139) 1739 CGTGAATGTAAGCGTGACATAAC (SEQ ID NO: 140) 1740
AAATCATATGTGCTACCATGGTGCGTTG (SEQ ID NO: 141) 1741
TCTTGGTTGACGAGAAGGCG (SEQ ID NO: 142) 2038
CACATAAACAAACAAAAAGCTTATGTATACTGTTGGTGATTA (SEQ ID NO: 143) 2039
CAGTATTGTTATGCGGCCGCTTAGGATTTATTCTGTTCAG (SEQ ID NO: 144) 2105
ACTAGACTCGAGATGCTTTCACTACGTCAATCTA (SEQ ID NO: 145) 2106
ATCTGAGGATCCTTATAAGGCTTTGGTCTTCAT (SEQ ID NO: 146) 2305
TTGATTGGATCCATGTTGCAGAGACATTCCT (SEQ ID NO: 147) 2323
ATTGATGCGGCCGCTTAGTTCAAGTCGGCAACA (SEQ ID NO: 148) ADH3MTSF
AATTCATATGTTGAGAACGTCAACATTGTTCACCAGGCGTGTCCAACCAA
GCCTATTTTCTAGAAACATTCTTAGATTGCAATCCACAGCTGCATTATA (SEQ ID NO: 82)
ADH3MTSR TATAATGCAGCTGTGGATTGCAATCTAAGAATGTTTCTAGAAAATAGGCT
TGGTTGGACACGCCTGGTGAACAATGTTGACGTTCTCAACATATGAATT (SEQ ID NO: 83)
ADH7F ATCCACAGCTGCATTATATCCAGAGAAATTCCAAGGC (SEQ ID NO: 84) ADH7R
GCTCCCATGGCCTTAGCTAG (SEQ ID NO: 85) ADH37F
AATTCATATGTTGAGAACGTCAACA (SEQ ID NO: 86) DMADH3MTSF
AATTCATATGTTGAGAACGTCAACATTGTTCACCAGGCGTGTCCAACCAA
GCCTATTTTCTAGAAACATTCTTAGATTGCAATCCACAGCTGCATCGTT (SEQ ID NO: 87)
DMADH3MTSR AACGATGCAGCTGTGGATTGCAATCTAAGAATGTTTCTAGAAAATAGGCT
TGGTTGGACACGCCTGGTGAACAATGTTGACGTTCTCAACATATGAATT (SEQ ID NO: 88)
DMADH3R AATTGCGGCCGCTTAGATGCCGGAGTCCCAG (SEQ ID NO: 89) DMADH3F
ATCCACAGCTGCATCGTTTACTTTGACCAACAAG (SEQ ID NO: 90) DMADHF
TTTTCATATGTCGTTTACTTTGACCAACAAG (SEQ ID NO: 91)
Example 1
Mitochondrial Production of Isobutanol in K. marxianus with ALS,
KARI, DHAD, and KIVD Targeted to the Mitochondria, Wherein PDC is
Deleted
[0312] This example illustrates how mitochondrial isobutanol
production is achieved in PDC-minus yeast using four pathway
enzymes targeted to the mitochondria. With these modifications,
strain A will generally exhibit higher isobutanol productivity,
titer, and/or yield as compared to the parent strain GEVO1947,
while at the same time, exhibiting reduced ethanol production.
[0313] To accomplish this, GEVO1947 is first transformed with
linear DNA from pGV1832 and additional linear DNA from pGV1834
resulting in strain A. This combination of linear DNA contains
genes coding for all five isobutanol pathway enzymes, the K.
marxianus PDC1 promoter (P.sub.KmPDC1) and terminator
(T.sub.KmPDC1) sequences for homologous integration into the PDC1
locus and the uracil marker for selection. This homologous
replacement event results in the simultaneous integration of the
isobutanol pathway along with deletion of the PDC1 coding sequence.
Adh7p is targeted to its native compartment, the cytosol. All other
pathway enzymes are targeted to the mitochondria. Pathway enzymes
that are not natively localized to the mitochondria are fused to
mitochondrial targeting sequences that direct them to the
mitochondria. The transformed cells are plated onto selective
medium without uracil and incubated at 30.degree. C. for 3 days.
After 3 days colonies are patched onto selective plates and these
patches are used for colony PCR and RT PCR to verify correct
integration and transcription of the pathway genes. Three verified
clones from each transformation are used to inoculate 3 mL
overnight cultures in YPD. As a control GEVO1947 is used. The
overnight cultures are used to inoculate 100 mL YPD cultures in 1 L
shake flasks. These cultures are harvested at an OD600 of 0.6-0.8.
The cells are resuspended in 50 mL fresh YPD medium and the
cultures are incubated in 250 mL shake flasks at 30.degree. C., 250
rpm. 2 mL samples are taken at 24 and 48 hours after inoculation.
The fermentation is ended after 48 hours. Samples are processed and
analyzed by HPLC and GC.
Example 2
Mitochondrial Production of Isobutanol in K. Marxianus with all
Pathway Enzymes Targeted to the Mitochondria, Wherein PDC is
Deleted
[0314] This example illustrates how mitochondrial production of
isobutanol is achieved in PDC-minus yeast with five pathway enzymes
targeted to the mitochondria. With these modifications, strain A1
will generally exhibit higher isobutanol productivity, titer,
and/or yield as compared to the parent strain GEVO1947, while at
the same time, exhibiting reduced ethanol production.
[0315] To accomplish this, GEVO1947 first is transformed with
linear DNA from pGV1832 and additional linear DNA from pGV9834
resulting in strain A1. The combination of linear DNA contains
genes coding for all five isobutanol pathway enzymes, the K.
marxianus PDC1 promoter and terminator sequences for homologous
integration into the PDC1 locus and the uracil marker for
selection. This homologous replacement event results in the
simultaneous integration of the isobutanol pathway along with the
deletion of the PDC1 coding sequence. All pathway enzymes are
targeted to the mitochondria. Pathway enzymes that are not natively
localized to the mitochondria are fused to mitochondrial targeting
sequences that direct them to the mitochondria. The transformed
cells are plated onto selective medium without uracil and incubated
at 30.degree. C. for 3 days. After 3 days colonies are patched onto
selective plates and these patches are used for colony PCR and RT
PCR to verify correct integration and transcription of the pathway
genes. Three verified clones from each transformation are used to
inoculate 3 mL overnight cultures in YPD. As a control GEVO1947 is
used. These cultures are used to inoculate 100 mL YPD cultures in 1
L shake flasks. These cultures are harvested at an OD600 of
0.6-0.8. The cells are resuspended in 50 mL fresh YPD medium and
the cultures are incubated in 250 mL shake flasks at 30.degree. C.,
250 rpm. 2 mL samples are taken at 24 and 48 hours after
inoculation. The fermentation is ended after 48 hours. Samples are
processed and analyzed by HPLC and GC.
Example 3
Mitochondrial Production of Isobutanol in K. Marxianus with all
Pathway Enzymes Targeted to the Mitochondria
[0316] This example illustrates how mitochondrial production of
isobutanol is achieved in yeast with five pathway enzymes targeted
to the mitochondria. With these modifications, strain A1P will
generally exhibit higher isobutanol productivity, titer, and/or
yield as compared to the parent strain GEVO1947.
[0317] To accomplish this, GEVO1947 is first transformed with
linear DNA from pGV1817 and additional linear DNA from pGV7101
resulting in strain A1P. This combination of linear DNA contains
genes coding for all five isobutanol pathway enzymes, and the
uracil marker for selection. The transformation leads to random
(non targeted) insertion of the isobutanol pathway into the K.
marxianus genome. All pathway enzymes are targeted to the
mitochondria. Pathway enzymes that are not natively localized to
the mitochondria are fused to mitochondrial targeting sequences
that direct them to the mitochondria. The transformed cells are
plated onto selective medium without uracil and incubated at
30.degree. C. for 3 days. After 3 days colonies are patched onto
selective plates and these patches are used for colony PCR and
RT-PCR to verify correct integration and transcription of the
pathway genes. Three verified clones from each transformation are
used to inoculate 3 mL overnight cultures in YPD. As a control
GEVO1947 is used. These cultures are used to inoculate 100 mL YPD
cultures in 1 L shake flasks. These cultures are harvested at an
OD600 of 0.6-0.8. The cells are resuspended in 50 mL fresh YPD
medium and the cultures are incubated in 250 mL shake flasks at
30.degree. C., 250 rpm. 2 mL samples are taken at 24 and 48 hours
after inoculation. The fermentation is ended after 48 hours.
Samples are processed and analyzed by HPLC and GC.
Example 4
Mitochondrial Production of Isobutanol in S. cerevisiae with all
Pathway Enzymes Targeted to the Mitochondria
[0318] This example illustrates how mitochondrial production of
isobutanol is achieved in yeast with five pathway enzymes targeted
to the mitochondria. With these modifications, strain SCPA1 will
generally exhibit higher isobutanol productivity, titer, and/or
yield as compared to the parent strain GEVO1186.
[0319] To accomplish this, GEVO1186, a diploid CEN.PK strain, is
first transformed with linear DNA from pGV1817 and additional
linear DNA from either pGV7101 resulting in strain SCPA1. Each
combination of linear DNA contains genes coding for all five
isobutanol pathway enzymes, the S. cerevisiae PDC1 promoter and
terminator sequences for homologous integration into the PDC1 locus
and the uracil marker for selection. This homologous replacement
event results in the simultaneous integration of the isobutanol
pathway along with the deletion of the PDC1 coding sequence. All
pathway enzymes are targeted to the mitochondria. Isobutanol
pathway enzymes that are not natively localized to the mitochondria
are fused to mitochondrial targeting sequences that direct them to
the mitochondria. The transformed cells are plated onto selective
medium without uracil and incubated at 30.degree. C. for 3-4 days.
After 3-4 days colonies are patched onto selective plates and these
patches are used for colony PCR and RT-PCR to verify correct
integration and transcription of the pathway genes. Three verified
clones from each transformation are used to inoculate 3 mL
overnight cultures in YPD. As a control GEVO1186 is used. These
overnight cultures are used to inoculate 100 mL YPD cultures in 1 L
shake flasks. The cultures are harvested at an OD600 of 0.6-0.8.
The cells are resuspended in 50 mL fresh YPD medium and the
cultures are incubated in 250 mL shake flasks at 30.degree. C., 250
rpm. 2 mL samples are taken at 24 and 48 hours after inoculation.
The fermentation is ended after 48 hours. Samples are processed and
analyzed by HPLC and GC.
Example 5
Mitochondrial Production of Isobutanol in a PDC-Minus S. Cerevisiae
with all Pathway Enzymes Targeted to the Mitochondria
[0320] This example illustrates how mitochondrial production of
isobutanol is achieved in PDC-minus yeast with five pathway enzymes
targeted to the mitochondria. With these modifications, strain SCA1
will generally exhibit higher isobutanol productivity, titer,
and/or yield as compared to the parent strain GEVO7777, while at
the same time, exhibiting reduced ethanol production.
[0321] To accomplish this, GEVO7777, a haploid CEN.PK strain
deleted for PDC5 and PDC6, is first transformed with linear DNA
from pGV1817 and additional linear DNA from pGV7101 resulting in
strain SCA1. The combination of linear DNA contains genes coding
for all five isobutanol pathway enzymes, the S. cerevisiae PDC1
promoter and terminator sequences for homologous integration into
the PDC1 locus and the uracil marker for selection. This homologous
replacement event results in the simultaneous integration of the
isobutanol pathway along with the deletion of the PDC1 coding
sequence. All pathway enzymes are targeted to the mitochondria.
Pathway enzymes that are not natively localized to the mitochondria
are fused to mitochondrial targeting sequences that direct them to
the mitochondria. The transformed cells are plated onto selective
medium using ethanol as carbon source and lacking uracil and
incubated at 30.degree. C. for 3-4 days. After 3-4 days colonies
are patched onto selective plates and these patches are used for
colony PCR and RT-PCR to verify correct integration and
transcription of the pathway genes. Three verified clones from each
transformation are used to inoculate 3 mL overnight cultures in
YPEthanol. As a control GEVO7777 is used. These overnight cultures
are used to inoculate 100 mL YPEthanol cultures in 1 L shake
flasks. The cultures are harvested at an OD600 of 0.6-0.8. The
cells are resuspended in 50 mL fresh YPD medium and the cultures
are incubated in 250 mL shake flasks at 30.degree. C., 250 rpm. 2
mL samples are taken at 24 and 48 hours after inoculation. The
fermentation is ended after 48 hours. Samples are processed and
analyzed by HPLC and GC.
Example 6
Mitochondrial Production of Isobutanol in C2-Independent PDC-Minus
S. cerevisiae with ALS, KARI, DHAD, and KIVD Targeted to the
Mitochondria
[0322] This example illustrates how mitochondrial production of
isobutanol is achieved in C2-independent PDC-minus yeast with four
pathway enzymes targeted to the mitochondria. With these
modifications, strain c2i-SC1 will generally exhibit higher
isobutanol productivity, titer, and/or yield as compared to the
parent strain GEVO1863.
[0323] S. cerevisiae which is deleted for all PDC genes (PDC1, PDC5
and PDC6) is dependent on C2-carbons such as ethanol or acetate for
growth. Such a strain can be evolved to grow on glucose and hence
be C2-independent (van Maris, A., et al., Applied and Environmental
Microbiology, 2004, 70(1):159-166). GEVO1863 is a PDC minus strain
that has been evolved to grow on glucose. GEVO1863 is transformed
with linear DNA from pGV1817 and additional linear DNA from pGV7001
resulting in strain c2i-SC1. The combination of linear DNA contains
genes coding for all five isobutanol pathway enzymes, the S.
cerevisiae PDC1 promoter and terminator sequences for homologous
integration into the PDC1 locus and the uracil marker for
selection. The homologous replacement event replaces the pdc1::ble
allele while simultaneously integrating the isobutanol pathway.
Adh7p is targeted to its native compartment, the cytosol. All other
pathway enzymes are targeted to the mitochondria. Pathway enzymes
that are not natively localized to the mitochondria are fused to
mitochondrial targeting sequences that direct them to the
mitochondria. The transformed cells are plated onto selective
medium and lacking uracil and incubated at 30.degree. C. for 3-4
days. After 3-4 days colonies are patched onto selective plates and
these patches are used for colony PCR and RT PCR to verify correct
integration and transcription of the pathway genes. Three verified
clones from each transformation are used to inoculate 3 mL
overnight cultures in YPD. As a control GEVO1863 is used. These
overnight cultures are used to inoculate 100 mL YPD cultures in 1 L
shake flasks. The cultures are harvested at an OD600 of 0.6-0.8.
The cells are resuspended in 50 mL fresh YPD medium and the
cultures are incubated in 250 mL shake flasks at 30.degree. C., 250
rpm. 2 mL samples are taken at 24 and 48 hours after inoculation.
The fermentation is ended after 48 hours. Samples are processed and
analyzed by HPLC and GC.
Example 7
Mitochondrial Production of Isobutanol in C2-Independent PDC-Minus
S. Cerevisiae with all Pathway Enzymes Targeted to the
Mitochondria
[0324] This example illustrates how mitochondrial production of
isobutanol is achieved in C2-independent PDC-minus yeast with five
pathway enzymes targeted to the mitochondria. With these
modifications, strain c2i-SCA1 will generally exhibit higher
isobutanol productivity, titer, and/or yield as compared to the
parent strain GEVO1863.
[0325] S. cerevisiae which is deleted for all PDC genes (PDC1, PDC5
and PDC6) is dependent on C2-carbons such as ethanol or acetate for
growth. Such a strain can be evolved to grow on glucose and hence
be C2-independent (van Maris, A., et al., Applied and Environmental
Microbiology, 2004, 70(1):159-166). GEVO1863 is a PDC minus strain
that has been evolved for growth on glucose. GEVO1863 is
transformed with linear DNA from pGV1817 and additional linear DNA
from pGV7101 resulting in strain c2i-SCA1. Each combination of
linear DNA contains genes coding for all five isobutanol pathway
enzymes, the S. cerevisiae PDC1 promoter and terminator sequences
for homologous integration into the PDC1 locus and the uracil
marker for selection. This homologous replacement event
simultaneous integrates the isobutanol pathway along with replacing
the pdc1::ble allele. All pathway enzymes are targeted to the
mitochondria. Pathway enzymes that are not natively localized to
the mitochondria are fused to mitochondrial targeting sequences
that direct them to the mitochondria. The transformed cells are
plated onto selective medium lacking uracil and incubated at
30.degree. C. for 3-4 days. After 3-4 days colonies are patched
onto selective plates and these patches are used for colony PCR and
RT-PCR to verify correct integration and transcription of the
pathway genes. Three verified clones from each transformation are
used to inoculate 3 mL overnight cultures in YPD. As a control
GEVO1863 is used. These overnight cultures are used to inoculate
100 mL YPD cultures in 1 L shake flasks. The cultures are harvested
at an OD600 of 0.6-0.8. The cells are resuspended in 50 mL fresh
YPD medium and the cultures are incubated in 250 mL shake flasks at
30.degree. C., 250 rpm. 2 mL samples are taken at 24 and 48 hours
after inoculation. The fermentation is ended after 48 hours.
Samples are processed and analyzed by HPLC and GC.
Example 8
Mitochondrial Production of Isobutanol in K. Marxianus with
Cofactor Usage Balanced by NADH Dependent Kari and ADH, Wherein
ALS, KARI, DHAD, and KIVD are Targeted to the Mitochondria
[0326] This example illustrates how mitochondrial production of
isobutanol in yeast possessing NADH dependent KARI and ADH enzymes.
With these modifications, strain AN will generally exhibit higher
isobutanol productivity, titer, and/or yield as compared to strain
A and the parent strain GEVO1947, while at the same time,
exhibiting reduced ethanol production.
[0327] As disclosed herein, one approach to balance the cofactor
usage between glycolysis and the isobutanol pathway is the use of
NADH dependent KARI and ADH. To accomplish this, the
mitochondrially targeted NADH dependent KARI is cloned into pGV1832
replacing ScILV5 to generate pGV1832N. The NADH dependent ADH DmADH
is cloned into pGV1834 replacing ScADH7 to generate pGV1834N.
[0328] GEVO1947 is then transformed with linear DNA from pGV1832N
and from pGV1834N resulting in strain AN. The combination of linear
DNA contains genes coding for all five isobutanol pathway enzymes,
the K. marxianus PDC1 promoter and terminator sequences for
homologous integration into the PDC1 locus and the uracil marker
for selection. This homologous replacement event results in the
simultaneous integration of the isobutanol pathway along with the
deletion of the PDC1 coding sequence. The NADH dependent ADH is not
targeted to the mitochondria. All other pathway enzymes are
targeted to the mitochondria. Pathway enzymes that are not natively
localized to the mitochondria are fused to mitochondrial targeting
sequences that direct them to the mitochondria. The transformed
cells are plated onto selective medium without uracil and incubated
at 30.degree. C. for 3 days. After 3 days colonies are patched onto
selective plates and these patches are used for colony PCR and
RT-PCR to verify correct integration and transcription of the
pathway genes. Three verified clones from each transformation are
used to inoculate 3 mL overnight cultures in YPD. As controls, the
parental strain GEVO1947 and strain A which contains the NADPH
dependent isobutanol pathway, are used. These cultures are used to
inoculate 100 mL cultures in 1 L shake flasks. These cultures are
harvested at an OD600 of 0.6-0.8. The cells are resuspended in 50
mL fresh YPD medium and the cultures are incubated in 250 mL shake
flasks at 30.degree. C., 250 rpm. 2 mL samples are taken at 24 and
48 hours after inoculation. The fermentation is ended after 48
hours. Samples are processed and analyzed by HPLC and GC.
Example 9
Mitochondrial Production of Isobutanol in S. Cerevisiae with
Cofactor Usage Balanced by NADH Dependent KARI and ADH, Wherein
ALS, KARI, DHAD, and KIVD are Targeted to the Mitochondria
[0329] This example illustrates how mitochondrial production of
isobutanol is achieved in yeast possessing NADH dependent KARI and
ADH enzymes. With these modifications, strain SCP1N will generally
exhibit higher isobutanol productivity, titer, and/or yield as
compared to strain SCP1 and the parent strain GEVO1186.
[0330] As disclosed herein, one approach to balance the cofactor
usage between glycolysis and the isobutanol pathway is the use of
NADH dependent KARI and ADH. To accomplish this, the
mitochondrially targeted NADH dependent KARI is cloned into pGV1817
replacing ScILV5 to generate pGV1817N. The NADH dependent ADH DmADH
is cloned into pGV7001 replacing ScADH7 to generate pGV7001N.
[0331] GEVO1186, a diploid CEN.PK strain is then transformed with
linear DNA from pGV1817N and from pGV7001N resulting in strain
SCP1N. This combination of linear DNA contains genes coding for all
five isobutanol pathway enzymes, the S. cerevisiae PDC1 promoter
and terminator sequences for homologous integration into the PDC1
locus and the uracil marker for selection. This homologous
replacement event results in the simultaneous integration of the
isobutanol pathway along with the deletion of the PDC1 coding
sequence. The NADH dependent ADH is not targeted to the
mitochondria. All other pathway enzymes are targeted to the
mitochondria. Pathway enzymes that are not natively localized to
the mitochondria are fused to mitochondrial targeting sequences
that direct them to the mitochondria. The transformed cells are
plated onto selective medium without uracil and incubated at
30.degree. C. for 3 days. After 3 days colonies are patched onto
selective plates and these patches are used for colony PCR and
RT-PCR to verify correct integration and transcription of the
pathway genes. Three verified clones from each transformation are
used to inoculate 3 mL overnight cultures in YPD. As controls
parental strain GEVO1186 and the strain SCP1, which contains the
imbalanced pathway, are used. These overnight cultures are used to
inoculate 100 mL cultures in 1 L shake flasks. The cultures are
harvested at an OD600 of 0.6-0.8. The cells are resuspended in 50
mL fresh YPD medium and the cultures are incubated in 250 mL shake
flasks at 30.degree. C., 250 rpm. 2 mL samples are taken at 24 and
48 hours after inoculation. The fermentation is ended after 48
hours. Samples are processed and analyzed by HPLC and GC.
Example 10
Mitochondrial Production of Isobutanol in a PDC-Minus S. cerevisiae
with Cofactor Usage Balanced by NADH Dependent KARI and ADH,
Wherein ALS, KARI, DHAD, and KIVD are Targeted to the
Mitochondria
[0332] This example illustrates how mitochondrial production of
isobutanol is achieved in PDC-minus yeast possessing NADH dependent
KARI and ADH enzymes. With these modifications, strain SC1N will
generally exhibit higher isobutanol productivity, titer, and/or
yield as compared to strain SC1 and the parent strain GEVO7777,
while at the same time, exhibiting reduced ethanol production.
[0333] As disclosed herein, one approach to balance the cofactor
usage between glycolysis and the isobutanol pathway is the use of
NADH dependent KARI and ADH. To accomplish this, a mitochondrially
targeted NADH dependent KARI is cloned into pGV1817 replacing ILV5
to generate pGV1817N. A NADH dependent ADH is cloned into pGV7001
replacing ADH7 to generate pGV7001N.
[0334] GEVO7777, a haploid CEN.PK strain deleted for PDC5 and PDC6,
is then transformed with linear DNA from pGV1817N and from pGV7001N
resulting in strain SC1N. This combination of linear DNA contains
genes coding for all five isobutanol pathway enzymes, the S.
cerevisiae PDC1 promoter and terminator sequences for homologous
integration into the PDC1 locus and the uracil marker for
selection. The homologous replacement event results in the
simultaneous integration of the isobutanol pathway along with the
deletion of the PDC1 coding sequence. The NADH-dependent ADH is not
targeted to the mitochondria. All other pathway enzymes are
targeted to the mitochondria. Pathway enzymes that are not natively
localized to the mitochondria are fused to mitochondrial targeting
sequences that direct them to the mitochondria. The transformed
cells are plated onto selective medium using ethanol as carbon
source and lacking uracil and incubated at 30.degree. C. for 3-4
days. After 3-4 days colonies are patched onto selective plates and
these patches are used for colony PCR and RT-PCR to verify correct
integration and transcription of the pathway genes. Three verified
clones from each transformation are used to inoculate 3 mL
overnight cultures in YPEthanol. As controls the parental strain
GEVO7777 and the strain SC1, containing the imbalanced pathway, are
used. These overnight cultures are used to inoculate 100 mL
cultures in 1 L shake flasks. The cultures are harvested at an
OD600 of 0.6-0.8. The cells are resuspended in 50 mL fresh YPD
medium and the cultures are incubated in 250 mL shake flasks at
30.degree. C., 250 rpm. 2 mL samples are taken at 24 and 48 hours
after inoculation. The fermentation is ended after 48 hours.
Samples are processed and analyzed by HPLC and GC.
Example 11
Mitochondrial Production of Isobutanol in C2-Independent PDC-Minus
S. cerevisiae with Cofactor Usage Balanced by NADH Dependent KARI
and ADH, Wherein ALS, KARI, DHAD, and KIVD are Targeted to the
Mitochondria
[0335] This example illustrates how mitochondrial production of
isobutanol is achieved in C2-independent PDC-minus yeast possessing
NADH dependent KARI and ADH enzymes. With these modifications,
strain c2i-SC1N will generally exhibit higher isobutanol
productivity, titer, and/or yield as compared to strain SC1 and the
parent strain GEVO1863.
[0336] As disclosed herein, one approach to balance the cofactor
usage between glycolysis and the isobutanol pathway is the use of
NADH-dependent KARI and ADH. To accomplish this, the
mitochondrially targeted NADH-dependent KARI is cloned into pGV1817
replacing ILV5 to generate pGV1817N. The NADH dependent ADH is
cloned into pGV7001 replacing ADH7 to generate pGV7001N.
[0337] S. cerevisiae which is deleted for all PDC genes (PDC1, PDC5
and PDC6) are dependent on C2-carbons such as ethanol or acetate
for growth. Such a strain can be evolved to grow on glucose and
hence be C2-independent (van Maris, A., et al., Applied and
Environmental Microbiology, 2004, 70(1):159-166). GEVO1863 is a
PDC-minus strain that has been evolved to grow on glucose. GEVO1863
is transformed with linear DNA from pGV1817N and from pGV7001N
resulting in strain c2i-SC1N. This combination of linear DNA
contains genes coding for all five isobutanol pathway enzymes, the
S. cerevisiae PDC1 promoter and terminator sequences for homologous
integration into the PDC1 locus and the uracil marker for
selection. The homologous replacement event replaces the pdc1::ble
allele. The NADH dependent ADH is not targeted to the mitochondria.
All other pathway enzymes are targeted to the mitochondria. Pathway
enzymes that are not natively localized to the mitochondria are
fused to mitochondrial targeting sequences that direct them to the
mitochondria. The transformed cells are plated onto selective
medium lacking uracil and incubated at 30.degree. C. for 3-4 days.
After 3-4 days colonies are patched onto selective plates and these
patches are used for colony PCR and RT-PCR to verify correct
integration and transcription of the pathway genes. Three verified
clones from each transformation are used to inoculate 3 mL
overnight cultures in YPD. As a control the parental strain,
GEVO1863 and the strain c2i-SC1 containing the imbalanced pathway,
are used. These overnight cultures are used to inoculate 100 mL YPD
cultures in 1 L shake flasks. The cultures are harvested at an
OD600 of 0.6-0.8. The cells are resuspended in 50 mL fresh YPD
medium and the cultures are incubated in 250 mL shake flasks at
30.degree. C., 250 rpm. 2 mL samples are taken at 24 and 48 hours
after inoculation. The fermentation is ended after 48 hours.
Samples are processed and analyzed by HPLC and GC.
Example 12
Mitochondrial Production of Isobutanol in K. Marxianus with
Cofactor Usage Partially Balanced by NADH Dependent ADH, Wherein
ALS, KARI, DHAD, and KIVD are Targeted to the Mitochondria
[0338] This example illustrates how mitochondrial production is
achieved in yeast with cofactor usage partially balanced by NADH
dependent ADH, wherein ALS, KARI, DHAD, and KIVD are targeted to
the mitochondria. With these modifications, strain AM will
generally exhibit higher isobutanol productivity, titer, and/or
yield as compared to strain A and the parent strain GEVO1947, while
at the same time, exhibiting reduced ethanol production.
[0339] As disclosed herein, one approach to balance the cofactor
usage between glycolysis and the isobutanol pathway is the use of
NADH dependent KARI and ADH. To accomplish this, the NADH dependent
ADH is cloned into pGV1834 replacing ADH7 to generate pGV1834N.
[0340] GEVO1947 is then transformed with linear DNA from pGV1832
and from pGV1834N resulting in strain AM. Each combination of
linear DNA contains genes coding for all five isobutanol pathway
enzymes, the K. marxianus PDC1 promoter and terminator sequences
for homologous integration into the PDC1 locus and the uracil
marker for selection. This homologous replacement event results in
the simultaneous integration of the isobutanol pathway along with
the deletion of the PDC1 coding sequence. The NADH dependent ADH is
not targeted to the mitochondria. All other pathway enzymes are
targeted to the mitochondria. Pathway enzymes that are not natively
localized to the mitochondria are fused to mitochondrial targeting
sequences that direct them to the mitochondria. The transformed
cells are plated onto selective medium without uracil and incubated
at 30.degree. C. for 3 days. After 3 days colonies are patched onto
selective plates and these patches are used for colony PCR and
RT-PCR to verify correct integration and transcription of the
pathway genes. Three verified clones from each transformation are
used to inoculate 3 mL overnight cultures in YPD. As a control the
parental strain, GEVO1947 and the strain A, containing the NADPH
dependent isobutanol pathway, are used. These cultures are used to
inoculate 100 mL cultures in 1 L shake flasks. These overnight
cultures are harvested at an OD600 of 0.6-0.8. The cells are
resuspended in 50 mL fresh YPD medium and the cultures are
incubated in 250 mL shake flasks at 30.degree. C., 250 rpm. 2 mL
samples are taken at 24 and 48 hours after inoculation. The
fermentation is ended after 48 hours. Samples are processed and
analyzed by HPLC and GC.
Example 13
Mitochondrial Production of Isobutanol in K. Marxianus with
Cofactor Usage Partially Balanced by NADH Dependent ADH, Wherein
ALS, KARI, DHAD, and KIVD are Targeted to the Mitochondria
[0341] This example illustrates how mitochondrial production is
achieved in yeast with cofactor usage partially balanced by NADH
dependent ADH, wherein ALS, KARI, DHAD, and KIVD are targeted to
the mitochondria. With these modifications, strain APM will
generally exhibit higher isobutanol productivity, titer, and/or
yield as compared to strain AP and the parent strain GEVO1947.
[0342] As disclosed herein, one approach to balance the cofactor
usage between glycolysis and the isobutanol pathway is the use of
NADH dependent KARI and ADH. To accomplish this, the NADH dependent
ADH DmADH is cloned into pGV7001 replacing ScADH7 to generate
pGV7001N.
[0343] GEVO1947 is then transformed with linear DNA from pGV1817
and from pGV7001N resulting in strain APM. This combination of
linear DNA contains genes coding for all five isobutanol pathway
enzymes, and the uracil marker for selection. The transformation
leads to random (non-targeted) insertion of the isobutanol pathway
into the K. marxianus genome. DmADH is not targeted to the
mitochondria. All other pathway enzymes are targeted to the
mitochondria. Pathway enzymes that are not natively localized to
the mitochondria are fused to mitochondrial targeting sequences
that direct them to the mitochondria. The transformed cells are
plated onto selective medium without uracil and incubated at
30.degree. C. for 3 days. After 3 days colonies are patched onto
selective plates and these patches are used for colony PCR and
RT-PCR to verify correct integration and transcription of the
pathway genes. Three verified clones from each transformation are
used to inoculate 3 mL overnight cultures in YPD. As a control
GEVO1947 and the pathway containing the NADPH dependent isobutanol
pathway, strain AP, are used. These cultures are used to inoculate
100 mL YPD cultures in 1 L shake flasks. These overnight cultures
are harvested at an OD600 of 0.6-0.8. The cells are resuspended in
50 mL fresh YPD medium and the cultures are incubated in 250 mL
shake flasks at 30.degree. C., 250 rpm. 2 mL samples are taken at
24 and 48 hours after inoculation. The fermentation is ended after
48 hours. Samples are processed and analyzed by HPLC and GC.
Example 14
Mitochondrial Production of Isobutanol in S. Cerevisiae with
Cofactor Usage Partially Balanced by NADH Dependent ADH, Wherein
ALS, KARI, DHAD, and KIVD are Targeted to the Mitochondria
[0344] This example illustrates how mitochondrial production is
achieved in yeast with cofactor usage partially balanced by NADH
dependent ADH, wherein ALS, KARI, DHAD, and KIVD are targeted to
the mitochondria. With these modifications, strain SCP1M will
generally exhibit higher isobutanol productivity, titer, and/or
yield as compared to strain SCP1 and the parent strain
GEVO1186.
[0345] As disclosed herein, one approach to balance the cofactor
usage between glycolysis and the isobutanol pathway is the use of
NADH dependent KARI and ADH. To accomplish this, the NADH dependent
ADH is cloned into pGV7001 replacing ADH7 to generate pGV7001N.
[0346] GEVO1186, a diploid CEN.PK strain, is then transformed with
linear DNA from pGV1817 and from pGV7001N resulting in strain
SCP1M. Each combination of linear DNA contains genes coding for all
five isobutanol pathway enzymes, the S. cerevisiae PDC1 promoter
and terminator sequences for homologous integration into the PDC1
locus and the uracil marker for selection. This homologous
replacement event results in the simultaneous integration of the
isobutanol pathway along with the deletion of the PDC1 coding
sequence. The NADH dependent ADH is not targeted to the
mitochondria. All other pathway enzymes are targeted to the
mitochondria. Pathway enzymes that are not natively localized to
the mitochondria are fused to mitochondrial targeting sequences
that direct them to the mitochondria. The transformed cells are
plated onto selective medium without uracil and incubated at
30.degree. C. for 3 days. After 3 days colonies are patched onto
selective plates and these patches are used for colony PCR and RT
PCR to verify correct integration and transcription of the pathway
genes. Three verified clones from each transformation are used to
inoculate 3 mL overnight cultures in YPD. As controls the parental
strain, GEVO1186, and the strain SCP1, containing the imbalanced
pathway are used. These cultures are used to inoculate 100 mL
cultures in 1 L shake flasks. These cultures are harvested at an
OD600 of 0.6-0.8. The cells are resuspended in 50 mL fresh YPD
medium and the cultures are incubated in 250 mL shake flasks at
30.degree. C., 250 rpm. 2 mL samples are taken at 24 and 48 hours
after inoculation. The fermentation is ended after 48 hours.
Samples are processed and analyzed by HPLC and GC.
Example 15
Mitochondrial Production of Isobutanol in a PDC-Minus S. cerevisiae
with Cofactor Usage Partially Balanced by NADH Dependent ADH,
Wherein ALS, KARI, DHAD, and KIVD are Targeted to the
Mitochondria
[0347] This example illustrates how mitochondrial production is
achieved in yeast with cofactor usage partially balanced by NADH
dependent ADH, wherein ALS, KARI, DHAD, and KIVD are targeted to
the mitochondria. With these modifications, strain SC1M will
generally exhibit higher isobutanol productivity, titer, and/or
yield as compared to strain SC1 and the parent strain GEVO7777,
while at the same time, exhibiting reduced ethanol production.
[0348] As disclosed herein, one approach to balance the cofactor
usage between glycolysis and the isobutanol pathway is the use of
NADH dependent KARI and ADH. To accomplish this, the NADH dependent
ADH DmADH is cloned into pGV7001 replacing ADH7 to generate
pGV7001N.
[0349] GEVO7777, a haploid S. cerevisiae strain in which is deleted
for PDC5 and PDC6, is then transformed with linear DNA from pGV1817
and from pGV7001N resulting in strain SC1M. This combination of
linear DNA contains genes coding for all five isobutanol pathway
enzymes, the S. cerevisiae PDC1 promoter and terminator sequences
for homologous integration into the PDC1 locus and the uracil
marker for selection. This homologous replacement event results in
the simultaneous insertion of the isobutanol pathway along with
deletion of the PDC1 coding sequence. DmADH is not targeted to the
mitochondria. All other pathway enzymes are targeted to the
mitochondria. Pathway enzymes that are not natively localized to
the mitochondria are fused to mitochondrial targeting sequences
that direct them to the mitochondria. The transformed cells are
plated onto selective medium using ethanol as carbon source and
lacking uracil and incubated at 30.degree. C. for 3-4 days. After
3-4 days colonies are patched onto selective plates and these
patches are used for colony PCR and RT-PCR to verify correct
integration and transcription of the pathway genes. Three verified
clones from each transformation are used to inoculate 3 mL
overnight cultures in YPEthanol. As controls the parental strain
GEVO7777 and the strain SC1 containing the imbalanced pathway, are
used. These overnight cultures are used to inoculate 100 mL
cultures in 1 L YPEthanol shake flasks. The cultures are harvested
at an OD600 of 0.6-0.8. The cells are resuspended in 50 mL fresh
YPD medium and the cultures are incubated in 250 mL shake flasks at
30.degree. C., 250 rpm. 2 mL samples are taken at 24 and 48 hours
after inoculation. The fermentation is ended after 48 hours.
Samples are processed and analyzed by HPLC and GC.
Example 16
Mitochondrial Production of Isobutanol in C2-Independent PDC-Minus
S. cerevisiae with Cofactor Usage Partially Balanced by NADH
Dependent ADH, Wherein ALS, KARI, DHAD, and KIVD are Targeted to
the Mitochondria
[0350] This example illustrates how mitochondrial production is
achieved in C2-independent PDC-minus yeast with cofactor usage
partially balanced by NADH dependent ADH, wherein ALS, KARI, DHAD,
and KIVD are targeted to the mitochondria. With these
modifications, strain c2i-SC1M will generally exhibit higher
isobutanol productivity, titer, and/or yield as compared to strain
c2i-SC1 and the parent strain GEVO1863.
[0351] As disclosed herein, one approach to balance the cofactor
usage between glycolysis and the isobutanol pathway is the use of
NADH dependent KARI and ADH. To accomplish this, the NADH dependent
ADH DmADH is cloned into pGV7001 replacing ScADH7 to generate
pGV7001N.
[0352] S. cerevisiae which is deleted for all PDC genes (PDC1, PDC5
and PDC6) is dependent on C2-carbons such as ethanol or acetate for
growth. Such a strain can be evolved to grow on glucose and hence
be C2-independent (van Maris, A., et al., Applied and Environmental
Microbiology, 2004, 70(1):159-166). GEVO1863 is a PDC-minus strain
that has been evolved to grow on glucose. GEVO1863 is transformed
with linear DNA from pGV1817 and from pGV7001N resulting in strain
c2i-SC1M. This combination of linear DNA contains genes coding for
all five isobutanol pathway enzymes, the S. cerevisiae PDC1
promoter and terminator sequences for homologous integration into
the PDC1 locus and the uracil marker for selection. This homologous
replacement event replaces the pdc1::ble allele with the isobutanol
pathway. DmADH is not targeted to the mitochondria. All other
pathway enzymes are targeted to the mitochondria. Pathway enzymes
that are not natively localized to the mitochondria are fused to
mitochondrial targeting sequences that direct them to the
mitochondria. The transformed cells are plated onto selective
medium lacking uracil and incubated at 30.degree. C. for 3-4 days.
After 3-4 days colonies are patched onto selective plates and these
patches are used for colony PCR and RT-PCR to verify correct
integration and transcription of the pathway genes. Three verified
clones from each transformation are used to inoculate 3 mL
overnight cultures in YPD. As controls, the parental GEVO1863 and
the strain c2i-SC1 containing the imbalanced pathway, are used.
These overnight cultures are used to inoculate 100 mL cultures in 1
L YPD shake flasks. The cultures are harvested at an OD600 of
0.6-0.8. The cells are resuspended in 50 mL fresh YPD medium and
the cultures are incubated in 250 mL shake flasks at 30.degree. C.,
250 rpm. 2 mL samples are taken at 24 and 48 hours after
inoculation. The fermentation is ended after 48 hours. Samples are
processed and analyzed by HPLC and GC.
Example 17
Mitochondrial Production of Isobutanol in K. Marxianus with
Cofactor Usage Partially Balanced by NADH Dependent KARI, Wherein
ALS, KARI, DHAD, and KIVD are Targeted to the Mitochondria
[0353] This example illustrates how mitochondrial production is
achieved in yeast with cofactor usage partially balanced by NADH
dependent KARI, wherein ALS, KARI, DHAD, and KIVD are targeted to
the mitochondria. With these modifications, strain AK will
generally exhibit higher isobutanol productivity, titer, and/or
yield as compared to strain A and the parent strain GEVO1947, while
at the same time, exhibiting reduced ethanol production.
[0354] As disclosed herein, one approach to balance the cofactor
usage between glycolysis and the isobutanol pathway is the use of
NADH dependent KARI and ADH. To accomplish this, the
mitochondrially targeted NADH dependent KARI is cloned into pGV1832
replacing ScILV5 to generate pGV1832N.
[0355] To construct strain AK, GEVO1947 is first transformed with
linear DNA from pGV1832N and from pGV1834 resulting in strain AK.
Each combination of linear DNA contains genes coding for all five
isobutanol pathway enzymes, the K. marxianus PDC1 promoter and
terminator sequences for homologous integration into the PDC1 locus
and the uracil marker for selection. This homologous replacement
event results in the simultaneous integration of the isobutanol
pathway along with the deletion of the PDC1 coding sequence. ADH7
is not targeted to the mitochondria. All other pathway enzymes are
targeted to the mitochondria. Pathway enzymes that are not natively
localized to the mitochondria are fused to mitochondrial targeting
sequences that direct them to the mitochondria. The transformed
cells are plated onto selective medium without uracil and incubated
at 30.degree. C. for 3 days. After 3 days colonies are patched onto
selective plates and these patches are used for colony PCR and
RT-PCR to verify correct integration and transcription of the
pathway genes. Three verified clones from each transformation are
used to inoculate 3 mL overnight cultures in YPD. As controls
GEVO1947 and the pathway containing the NADPH dependent isobutanol
pathway, strain A, are used. These cultures are used to inoculate
100 mL YPD cultures in 1 L shake flasks. These overnight cultures
are harvested at an OD600 of 0.6-0.8. The cells are resuspended in
50 mL fresh YPD medium and the cultures are incubated in 250 mL
shake flasks at 30.degree. C., 250 rpm. 2 mL samples are taken at
24 and 48 hours after inoculation. The fermentation is ended after
48 hours. Samples are processed and analyzed by HPLC and GC.
Example 18
Mitochondrial Production of Isobutanol in S. Cerevisiae with
Cofactor Usage Partially Balanced by NADH Dependent KARI, Wherein
ALS, KARI, DHAD, and KIVD are Targeted to the Mitochondria
[0356] This example illustrates how mitochondrial production is
achieved in yeast with cofactor usage partially balanced by NADH
dependent KARI, wherein ALS, KARI, DHAD, and KIVD are targeted to
the mitochondria. With these modifications, strain SCP1K will
generally exhibit higher isobutanol productivity, titer, and/or
yield as compared to strain SCP1 and the parent strain
GEVO1186.
[0357] As disclosed herein, one approach to balance the cofactor
usage between glycolysis and the isobutanol pathway is the use of
NADH dependent KARI and ADH. To accomplish this, the
mitochondrially targeted NADH dependent KARI is cloned into pGV1817
replacing ScILV5 to generate pGV1817N.
[0358] GEVO1186 is then transformed with linear DNA from pGV1817N
and from pGV7001 resulting in strain SCP1K. Each combination of
linear DNA contains genes coding for all five isobutanol pathway
enzymes, the S. cerevisiae PDC1 promoter and terminator sequences
for homologous integration into the PDC1 locus and the uracil
marker for selection. This homologous replacement event results in
the simultaneous integration of the isobutanol pathway along with
the deletion of the PDC1 coding sequence. ADH7 is not targeted to
the mitochondria. All other pathway enzymes are targeted to the
mitochondria. Pathway enzymes that are not natively localized to
the mitochondria are fused to mitochondrial targeting sequences
that direct them to the mitochondria. The transformed cells are
plated onto selective medium without uracil and incubated at
30.degree. C. for 3 days. After 3 days colonies are patched onto
selective plates and these patches are used for colony PCR and
RT-PCR to verify correct integration and transcription of the
pathway genes. Three verified clones from each transformation are
used to inoculate 3 mL overnight cultures in YPD. As controls
GEVO1186 and the pathway containing the imbalanced pathway, strain
SCP1, are used. These cultures are used to inoculate 100 mL YPD
cultures in 1 L shake flasks. These cultures are harvested at an
OD600 of 0.6-0.8. The cells are resuspended in 50 mL fresh YPD
medium and the cultures are incubated in 250 mL shake flasks at
30.degree. C., 250 rpm. 2 mL samples are taken at 24 and 48 hours
after inoculation. The fermentation is ended after 48 hours.
Samples are processed and analyzed by HPLC and GC.
Example 19
Mitochondrial Production of Isobutanol in K. Marxianus with
Cofactor Usage Balanced and with ALS, KARI, DHAD, and KIVD Targeted
to the Mitochondria
[0359] This example illustrates how mitochondrial production of
isobutanol is achieved in yeast with balanced cofactor usage and
with ALS, KARI, DHAD, and KIVD targeted to the mitochondria. With
these modifications, strain APN will generally exhibit higher
isobutanol productivity, titer, and/or yield as compared to strain
AP and the parent strain GEVO1947.
[0360] To accomplish this, GEVO1947 is first transformed with
linear DNA from pGV1817N and additional linear DNA from pGV7001N
resulting in strain APN. This combination of linear DNA contains
genes coding for all five isobutanol pathway enzymes, and the
uracil marker for selection. The transformation leads to random
(non-targeted) insertion of the isobutanol pathway into the K.
marxianus genome. DmAdhp is targeted to its native compartment, the
cytosol. All other pathway enzymes are targeted to the
mitochondria. Pathway enzymes that are not natively localized to
the mitochondria are fused to mitochondrial targeting sequences
that direct them to the mitochondria. The transformed cells are
plated onto selective medium without uracil and incubated at
30.degree. C. for 3 days. After 3 days colonies are patched onto
selective plates and these patches are used for colony PCR and
RT-PCR to verify correct integration and transcription of the
pathway genes. Three verified clones from each transformation are
used to inoculate 3 mL overnight cultures in YPD. As controls
GEVO1947 and strain AP are used. The overnight cultures are used to
inoculate 100 mL YPD cultures in 1 L shake flasks. These cultures
are harvested at an OD600 of 0.6-0.8. The cells are resuspended in
50 mL fresh YPD medium and the cultures are incubated in 250 mL
shake flasks at 30.degree. C., 250 rpm. 2 mL samples are taken at
24 and 48 hours after inoculation. The fermentation is ended after
48 hours. Samples are processed and analyzed by HPLC and GC.
Example 20
Mitochondrial Production of Isobutanol in K. Marxianus with
Cofactor Usage Balanced, Wherein all Pathway Enzymes Targeted to
the Mitochondria and PDC Deleted
[0361] This example illustrates how mitochondrial production of
isobutanol is achieved in yeast with balanced cofactor usage,
wherein all pathway enzymes are targeted to the mitochondria. With
these modifications, strain A1N will generally exhibit higher
isobutanol productivity, titer, and/or yield as compared to strain
A1 and the parent strain GEVO1947. At the same time, strains A1N
and A1 will generally exhibit reduced ethanol production as
compared to the parent strain GEVO1947.
[0362] To accomplish this, GEVO1947 is first transformed with
linear DNA from pGV1832N and additional linear DNA from pGV9834N
resulting in strain A1N. The combination of linear DNA contains
genes coding for all five isobutanol pathway enzymes, the K.
marxianus PDC1 promoter and terminator sequences for homologous
integration into the PDC1 locus and the uracil marker for
selection. This homologous replacement event results in the
simultaneous integration of the isobutanol pathway along with the
deletion of the PDC1 coding sequence. All pathway enzymes are
targeted to the mitochondria. Pathway enzymes that are not natively
localized to the mitochondria are fused to mitochondrial targeting
sequences that direct them to the mitochondria. The transformed
cells are plated onto selective medium without uracil and incubated
at 30.degree. C. for 3 days. After 3 days colonies are patched onto
selective plates and these patches are used for colony PCR and
RT-PCR to verify correct integration and transcription of the
pathway genes. Three verified clones from each transformation are
used to inoculate 3 mL overnight cultures in YPD. As controls
GEVO1947 and strain A1 are used. These cultures are used to
inoculate 100 mL YPD cultures in 1 L shake flasks. These cultures
are harvested at an OD600 of 0.6-0.8. The cells are resuspended in
50 mL fresh YPD medium and the cultures are incubated in 250 mL
shake flasks at 30.degree. C., 250 rpm. 2 mL samples are taken at
24 and 48 hours after inoculation. The fermentation is ended after
48 hours. Samples are processed and analyzed by HPLC and GC.
Example 21
Mitochondrial Production of Isobutanol in K. marxianus with
Cofactor Usage Balanced and with all Pathway Enzymes Targeted to
the Mitochondria
[0363] This example illustrates how mitochondrial production of
isobutanol is achieved in yeast with balanced cofactor usage,
wherein all pathway enzymes are targeted to the mitochondria. With
these modifications, strain A1PN will generally exhibit higher
isobutanol productivity, titer, and/or yield as compared to strain
A1P and the parent strain GEVO1947.
[0364] To accomplish this, GEVO1947 is first transformed with
linear DNA from pGV1817N and additional linear DNA from pGV7101N
resulting in strain A1PN. This combination of linear DNA contains
genes coding for all five isobutanol pathway enzymes, and the
uracil marker for selection. The transformation leads to random
(non-targeted) integration of the isobutanol pathway into the K.
marxianus genome. All pathway enzymes are targeted to the
mitochondria. Pathway enzymes that are not natively localized to
the mitochondria are fused to mitochondrial targeting sequences
that direct them to the mitochondria. The transformed cells are
plated onto selective medium without uracil and incubated at
30.degree. C. for 3 days. After 3 days colonies are patched onto
selective plates and these patches are used for colony PCR and
RT-PCR to verify correct integration and transcription of the
pathway genes. Three verified clones from each transformation are
used to inoculate 3 mL overnight cultures in YPD. As controls
GEVO1947 and strain A1P are used. These cultures are used to
inoculate 100 mL YPD cultures in 1 L shake flasks. These cultures
are harvested at an OD600 of 0.6-0.8. The cells are resuspended in
50 mL fresh YPD medium and the cultures are incubated in 250 mL
shake flasks at 30.degree. C., 250 rpm. 2 mL samples are taken at
24 and 48 hours after inoculation. The fermentation is ended after
48 hours. Samples are processed and analyzed by HPLC and GC.
Example 22
Mitochondrial Production of Isobutanol in S. cerevisiae with
Cofactor Usage Balanced and with all Pathway Enzymes Targeted to
the Mitochondria
[0365] This example illustrates how mitochondrial production of
isobutanol is achieved in yeast with balanced cofactor usage,
wherein all pathway enzymes are targeted to the mitochondria. With
these modifications, strain SCPA1N will generally exhibit higher
isobutanol productivity, titer, and/or yield as compared to strain
SCPA1 and the parent strain GEVO1186.
[0366] To accomplish this, GEVO1186, a diploid CEN.PK strain, is
first transformed with linear DNA from pGV1817N and additional
linear DNA from either pGV7101N resulting in strain SCPA1N. Each
combination of linear DNA contains genes coding for all five
isobutanol pathway enzymes, the S. cerevisiae PDC1 promoter and
terminator sequences for homologous integration into the PDC1 locus
and the uracil marker for selection. This homologous replacement
event results in the simultaneous integration of the isobutanol
pathway along with the deletion of the PDC1 coding sequence. All
pathway enzymes are targeted to the mitochondria. Isobutanol
pathway enzymes that are not natively localized to the mitochondria
are fused to mitochondrial targeting sequences that direct them to
the mitochondria. The transformed cells are plated onto selective
medium without uracil and incubated at 30.degree. C. for 3-4 days.
After 3-4 days colonies are patched onto selective plates and these
patches are used for colony PCR and RT-PCR to verify correct
integration and transcription of the pathway genes. Three verified
clones from each transformation are used to inoculate 3 mL
overnight cultures in YPD. As controls GEVO1186 and strain SCPA1
are used. These overnight cultures are used to inoculate 100 mL YPD
cultures in 1 L shake flasks. The cultures are harvested at an
OD600 of 0.6-0.8. The cells are resuspended in 50 mL fresh YPD
medium and the cultures are incubated in 250 mL shake flasks at
30.degree. C., 250 rpm. 2 mL samples are taken at 24 and 48 hours
after inoculation. The fermentation is ended after 48 hours.
Samples are processed and analyzed by HPLC and GC.
Example 23
Mitochondrial Production of Isobutanol in a PDC-Minus S. cerevisiae
with Cofactor Usage Balanced and with all Pathway Enzymes Targeted
to the Mitochondria
[0367] This example illustrates how mitochondrial production of
isobutanol is achieved in PDC-minus yeast with balanced cofactor
usage, wherein all pathway enzymes are targeted to the
mitochondria. With these modifications, strain SCA1N will generally
exhibit higher isobutanol productivity, titer, and/or yield as
compared to strain SCA1 and the parent strain GEVO7777, while at
the same time, exhibiting reduced ethanol production.
[0368] To accomplish this, GEVO7777, which is deleted for PDC5 and
PDC6, is first transformed with linear DNA from pGV1817N and
additional linear DNA from pGV7101N resulting in strain SCA1N. The
combination of linear DNA contains genes coding for all five
isobutanol pathway enzymes, the S. cerevisiae PDC1 promoter and
terminator sequences for homologous integration into the PDC1 locus
and the uracil marker for selection. This homologous replacement
event results in the simultaneous integration of the isobutanol
pathway along with the deletion of the PDC1 coding sequence. All
pathway enzymes are targeted to the mitochondria. Pathway enzymes
that are not natively localized to the mitochondria are fused to
mitochondrial targeting sequences that direct them to the
mitochondria. The transformed cells are plated onto selective
medium using ethanol as carbon source and lacking uracil and
incubated at 30.degree. C. for 3-4 days. After 3-4 days colonies
are patched onto selective plates and these patches are used for
colony PCR and RT-PCR to verify correct integration and
transcription of the pathway genes. Three verified clones from each
transformation are used to inoculate 3 mL overnight cultures in
YPEthanol. As a control GEVO7777 and strain SCA1 are used. These
overnight cultures are used to inoculate 100 mL YPEthanol cultures
in 1 L shake flasks. The cultures are harvested at an OD600 of
0.6-0.8. The cells are resuspended in 50 mL fresh YPD medium and
the cultures are incubated in 250 mL shake flasks at 30.degree. C.,
250 rpm. 2 mL samples are taken at 24 and 48 hours after
inoculation. The fermentation is ended after 48 hours. Samples are
processed and analyzed by HPLC and GC.
Example 24
Mitochondrial Production of Isobutanol in C2-Independent PDC-Minus
S. Cerevisiae with Cofactor Usage Balanced and with all Pathway
Enzymes Targeted to the Mitochondria
[0369] This example illustrates how mitochondrial production of
isobutanol is achieved in C2-independent PDC-minus yeast with
balanced cofactor usage, wherein all pathway enzymes are targeted
to the mitochondria. With these modifications, strain c2i-SCA1N
will generally exhibit higher isobutanol productivity, titer,
and/or yield as compared to strain c2i-SCA1 and the parent strain
GEVO1863.
[0370] S. cerevisiae which is deleted for all PDC genes (PDC1, PDC5
and PDC6) is dependent on C2-carbons such as ethanol or acetate for
growth. Such a strain can be evolved to grow on glucose and hence
be C2-independent (van Maris, A., et al., Applied and Environmental
Microbiology, 2004, 70(1):159-166). GEVO1863 is a Pdc-minus strain
that has been evolved for growth on glucose. GEVO1863 is
transformed with linear DNA from pGV1817N and additional linear DNA
from pGV7101N resulting in strain c2i-SCA1N. Each combination of
linear DNA contains genes coding for all five isobutanol pathway
enzymes, the S. cerevisiae PDC1 promoter and terminator sequences
for homologous integration into the PDC1 locus and the uracil
marker for selection. This homologous replacement event
simultaneous integrates the isobutanol pathway along with replacing
the pdc1::ble allele. All pathway enzymes are targeted to the
mitochondria. Pathway enzymes that are not natively localized to
the mitochondria are fused to mitochondrial targeting sequences
that direct them to the mitochondria. The transformed cells are
plated onto selective medium lacking uracil and incubated at
30.degree. C. for 3-4 days. After 3-4 days colonies are patched
onto selective plates and these patches are used for colony PCR and
RT-PCR to verify correct integration and transcription of the
pathway genes. Three verified clones from each transformation are
used to inoculate 3 mL overnight cultures in YPD. As controls
GEVO1863 and c2i-SCA1 are used. These overnight cultures are used
to inoculate 100 mL YPD cultures in 1 L shake flasks. The cultures
are harvested at an OD600 of 0.6-0.8. The cells are resuspended in
50 mL fresh YPD medium and the cultures are incubated in 250 mL
shake flasks at 30.degree. C., 250 rpm. 2 mL samples are taken at
24 and 48 hours after inoculation. The fermentation is ended after
48 hours. Samples are processed and analyzed by HPLC and GC.
Example 25
Anaerobic Mitochondrial Production of Isobutanol in S. Cerevisiae
with Cofactor Usage Balanced by NADH Dependent KARI and ADH,
Wherein ALS, KARI, DHAD, and KIVD are Targeted to the
Mitochondria
[0371] This example illustrates how anaerobic mitochondrial
production of isobutanol is achieved in yeast possessing NADH
dependent KARI and ADH enzymes. With these modifications, strain
SCP1N will generally exhibit higher isobutanol productivity, titer,
and/or yield under anaerobic conditions as compared to strain SCP1
and the parent strain GEVO1186.
[0372] As disclosed herein, one approach to balance the cofactor
usage between glycolysis and the isobutanol pathway is the use of
NADH dependent KARI and ADH. To accomplish this, the
mitochondrially targeted NADH dependent KARI is cloned into pGV1817
replacing ScILV5 to generate pGV1817N. The NADH dependent ADH DmADH
is cloned into pGV7001 replacing ScADH7 to generate pGV7001N.
[0373] GEVO1186, a diploid CEN.PK strain is then transformed with
linear DNA from pGV1817N and from pGV7001N resulting in strain
SCP1N. This combination of linear DNA contains genes coding for all
five isobutanol pathway enzymes, the S. cerevisiae PDC1 promoter
and terminator sequences for homologous integration into the PDC1
locus and the uracil marker for selection. This homologous
replacement event results in the simultaneous integration of the
isobutanol pathway along with the deletion of the PDC1 coding
sequence. The NADH dependent ADH is not targeted to the
mitochondria. All other pathway enzymes are targeted to the
mitochondria. Pathway enzymes that are not natively localized to
the mitochondria are fused to mitochondrial targeting sequences
that direct them to the mitochondria. The transformed cells are
plated onto selective medium without uracil and incubated at
30.degree. C. for 3 days. After 3 days colonies are patched onto
selective plates and these patches are used for colony PCR and
RT-PCR to verify correct integration and transcription of the
pathway genes. Three verified clones from each transformation are
used to inoculate 3 mL overnight cultures in YPD. As controls
parental strain GEVO1186 and the strain SCP1, which contains the
imbalanced pathway, are used. These overnight cultures are used to
inoculate 100 mL cultures in 1 L shake flasks. The cultures are
harvested at an OD600 of 0.6-0.8. The cells are resuspended in 20
mL fresh YPD medium and the cultures are incubated in 100 mL
stoppered serum bottles at 30.degree. C. 2 mL samples are taken at
24 and 48 hours after inoculation. The fermentation is ended after
48 hours. Samples are processed and analyzed by HPLC and GC.
Example 26
Mitochondrial Production of Isobutanol with Cofactor Usage Balanced
by Malate Bypass, Wherein ALS, KARI, DHAD, and KIVD are Targeted to
the Mitochondria
[0374] This example illustrates how mitochondrial production of
isobutanol is achieved in yeast with cofactor usage balanced by
malate bypass, wherein ALS, KARI, DHAD, and KIVD are targeted to
the mitochondria. With these modifications, malate-bypass
containing strains will generally exhibit higher isobutanol
productivity, titer, and/or yield as compared to their respective
parent strains.
[0375] As disclosed herein, one approach to balance the cofactor
usage for the production of isobutanol from glucose is the use of a
malate bypass in which the NADH generated from glycolysis is
consumed in the production of malate from phosphoenol pyruvate.
Malate is then transported into the mitochondria and used to
generate NADPH and pyruvate. To introduce this bypass the following
genes are overexpressed in the yeast host: PCK1, MDH2, DIC1 and
MAE1. pGV8000 is a plasmid in which these genes are expressed using
strong constitutive promoters. The plasmid also expresses the
hygromycin resistance gene, hph. Downstream of the pathway genes,
pGV8000 carries a sequence which consists of, from 5' to 3', S.
cerevisiae PDC6 terminator, a unique restriction site (HpaI), and
the PDC6 promoter. pGV8000 is linearized by digestion with HpaI and
is transformed into K. marxianus strains A, AM, AK, AP, and APM for
random integration into the chromosome. This results in the K.
marxianus strains AMB, AMMB, AKMB, APMB, and APMMB respectively.
This linearized pGV8000, when transformed into S. cerevisiae
homologously replaces the PDC6 locus of S. cerevisiae. The
linearized pGV8000 is transformed into strains SCP1, SCP1M, SCP1K,
SC1, SC1M, c2i-SC1, and c2i-SC1M resulting in strains SCP1 MB,
SCP1MMB, SCP1KMB, SC1 MB, SC1MMB, c2i-SC1 MB, and c2i-SC1MMB
respectively. The transformed cells are plated onto YPD medium
supplemented with hygromycin. Except in the case of SC1, SC1 MB,
SC1MMB and SC1M strains, YPEthanol supplemented with hygromycin is
used. The plates are incubated at 30.degree. C. for 3-4 days. After
3-4 days colonies are patched onto selective plates and these
patches are used for colony PCR and RT-PCR to verify correct
integration and transcription of the malate bypass genes,
respectively. Three verified clones from each transformation are
used to inoculate 3 mL overnight cultures in YPD or in YPEthanol
for the strains SC1, SC1 MB, SC1MMB and SC1M. The parent strains
are used as controls. These overnight cultures are used to
inoculate 100 mL cultures in 1 L YPD or YPEthanol shake flasks.
These cultures are harvested at an OD600 of 0.6-0.8. The cells are
resuspended in 50 mL fresh YPD medium and the cultures are
incubated in 250 mL shake flasks at 30.degree. C., 250 rpm. 2 mL
samples are taken at 24 and 48 hours after inoculation. The
fermentation is ended after 48 hours. Samples are processed and
analyzed by HPLC and GC.
Example 27
Mitochondrial Production of Isobutanol with Cofactor Usage Balanced
by Malate Bypass, Wherein all Isobutanol Pathway Enzymes are
Targeted to the Mitochondria
[0376] This example illustrates how mitochondrial production of
isobutanol is achieved in yeast with cofactor usage balanced by
malate bypass, wherein all isobutanol pathway enzymes are targeted
to the mitochondria. With these modifications, malate-bypass
containing strains will generally exhibit higher isobutanol
productivity, titer, and/or yield as compared to their respective
parent strains.
[0377] As disclosed herein, one approach to balance the cofactor
usage for the production of isobutanol from glucose is the use of a
malate bypass in which the NADH generated from glycolysis is
consumed in the production of malate from phosphoenol pyruvate.
Malate is then transported into the mitochondria and used to
generate NADPH and pyruvate. To introduce this bypass the following
genes are overexpressed in the yeast host: PCK1, MDH2, DIC1 and
MAE1. pGV8000 is a plasmid in which these genes are expressed using
strong constitutive promoters. The plasmid also expresses the
hygromycin resistance gene, hph. Downstream of the pathway genes,
pGV8000 carries a sequence which consists of, from 5' to 3', S.
cerevisiae PDC6 terminator, a unique restriction site (HpaI), and
the PDC6 promoter. pGV8000 is linearized by digestion with HpaI and
is transformed into K. marxianus strains A1 and A1P for random
integration into the chromosome. This results in the K. marxianus
strains A1MB, and A1PMB, respectively. This linearized pGV8000,
when transformed into S. cerevisiae homologously replaces the PDC6
locus of S. cerevisiae. The linearized pGV8000 is transformed into
strains SCPA1, SCA1, and c2i-SCA1 resulting in strains SCPA1MB,
SCA1MB, and c2i-SCA1MB respectively. The transformed cells are
plated onto YPD medium supplemented with hygromycin. Except in the
case of strains SCA1 and SCA1MB, for which YPEthanol supplemented
with hygromycin is used. The plates are incubated at 30.degree. C.
for 3-4 days. After 3-4 days colonies are patched onto selective
plates and these patches are used for colony PCR and RT-PCR to
verify correct integration and transcription of the malate bypass
genes, respectively. Three verified clones from each transformation
are used to inoculate 3 mL overnight cultures in YPD or in
YPEthanol for the strains SCA1 and SCA1MB. The parent strains are
used as controls. These overnight cultures are used to inoculate
100 mL cultures in 1 L YPD or YPEthanol shake flasks. These
cultures are harvested at an OD600 of 0.6-0.8. The cells are
resuspended in 50 mL fresh YPD medium and the cultures are
incubated in 250 mL shake flasks at 30.degree. C., 250 rpm. 2 mL
samples are taken at 24 and 48 hours after inoculation. The
fermentation is ended after 48 hours. Samples are processed and
analyzed by HPLC and GC. The malate-bypass containing strains show
higher isobutanol productivity, titer and yield when compared to
their respective parent strains.
Example 28
Mitochondrial Production of Isobutanol with Cofactor Balance
Through Overexpression of a Fungal Transhydrogenase, Wherein ALS,
KARI, DHAD, and KIVD are Targeted to the Mitochondria
[0378] This example illustrates how mitochondrial production of
isobutanol is achieved in yeast with cofactor usage balanced via
the overexpression of a fungal transhydrogenase, wherein ALS, KARI,
DHAD, and KIVD are targeted to the mitochondria. With these
modifications, the transhydrogenase containing strains will
generally exhibit higher isobutanol productivity, titer, and/or
yield as compared to their respective parent strains.
[0379] As disclosed herein, one approach to balance the cofactor
usage between glycolysis and the isobutanol pathway is the use of a
transhydrogenase in which the NADH generated from glycolysis is
transferred into the mitochondria by the acetaldehyde/ethanol
shuttle. In the mitochondria the NADH is converted into NADPH by a
transhydrogenase which is integrated into the mitochondrial inner
membrane. pGV9000 containing the transhydrogenase gene from
Neurospora crassa is linearized by digestion with HpaI and
transformed into K. marxianus strains A, AM, AK, AP, and APM for
random integration into the chromosome. This results in the K.
marxianus strains ATH, AMTH, AKTH, APTH, and APMTH respectively.
This linearized pGV9000, when transformed into S. cerevisiae will
homologously replace the PDC6 locus of S. cerevisiae. The
linearized pGV9000 is transformed into strains SCP1, SCP1M, SCP1K,
SC1, SC1M, c2i-SC1, and c2i-SC1M resulting in strains SCP1TH,
SCP1MTH, SCP1KTH, SC1TH, SC1MTH, c2i-SC1TH, and c2i-SC1MTH
respectively. The transformed strains are plated onto YPD medium
supplemented with hygromycin. In the case of SC1, SC1TH, SC1MTH and
SC1M strains, YPEthanol supplemented with hygromycin is used. All
plates are incubated at 30.degree. C. for 3-4 days. After 3-4 days
colonies are patched onto selective plates and these patches are
used for colony PCR and RT-PCR to verify correct integration and
transcription of the transhydrogenase genes, respectively. Three
verified clones from each transformation are used to inoculate 3 mL
overnight cultures in YPD or YPEthanol for the Saccharomyces
strains SC1, SC1TH, SC1MTH and SC1M. The parent strains are used as
control. These overnight cultures are used to inoculate 100 mL
cultures in 1 L shake flasks. These cultures are harvested at an
OD600 of 0.6-0.8. The cells are resuspended in 50 mL fresh YPD
medium and the cultures are incubated in 250 mL shake flasks at
30.degree. C., 250 rpm. 2 mL samples are taken at 24 and 48 hours
after inoculation. The fermentation is ended after 48 hours.
Samples are processed and analyzed by HPLC and GC.
Example 29
Mitochondrial Production of Isobutanol with Cofactor Balance
Through Overexpression of a Fungal Transhydrogenase, Wherein all
Isobutanol Pathway Enzymes are Targeted to the Mitochondria
[0380] This example illustrates how mitochondrial production of
isobutanol is achieved in yeast with cofactor usage balanced via
the overexpression of a fungal transhydrogenase, wherein all
isobutanol pathway enzymes are targeted to the mitochondria. With
these modifications, the transhydrogenase containing strains will
generally exhibit higher isobutanol productivity, titer, and/or
yield as compared to their respective parent strains.
[0381] As disclosed herein, one approach to balance the cofactor
usage between glycolysis and the isobutanol pathway is the use of a
transhydrogenase in which the NADH generated from glycolysis is
transferred into the mitochondria by the acetaldehyde/ethanol
shuttle. In the mitochondria the NADH is converted into NADPH by a
transhydrogenase which is integrated into the mitochondrial inner
membrane. pGV9000 containing the transhydrogenase gene from
Neurospora crassa is linearized by digestion with HpaI and
transformed into K. marxianus strains A1 and A1P for random
insertion into the chromosome. This results in the K. marxianus
strains A1TH and A1PTH, respectively. This linearized pGV9000, when
transformed into S. cerevisiae will homologously replace the PDC6
locus of S. cerevisiae. The linearized pGV9000 is transformed into
strains SCPA1, SCA1, and c2i-SCA1, resulting in strains SCPA1TH,
SCA1TH, and c2i-SCA1TH, respectively. The transformed strains are
plated onto YPD medium supplemented with hygromycin. In the case of
SCA1 and SCA1TH strains, YPEthanol supplemented with hygromycin is
used. All plates are incubated at 30.degree. C. for 3-4 days. After
3-4 days colonies are patched onto selective plates and these
patches are used for colony PCR and RT-PCR to verify correct
integration and transcription of the transhydrogenase genes,
respectively. Three verified clones from each transformation are
used to inoculate 3 mL overnight cultures in YPD or YPEthanol for
the Saccharomyces strains SC1TH and SC1MTH. The parent strains are
used as control. These overnight cultures are used to inoculate 100
mL cultures in 1 L shake flasks. These cultures are harvested at an
OD600 of 0.6-0.8. The cells are resuspended in 50 mL fresh YPD
medium and the cultures are incubated in 250 mL shake flasks at
30.degree. C., 250 rpm. 2 mL samples are taken at 24 and 48 hours
after inoculation. The fermentation is ended after 48 hours.
Samples are processed and analyzed by HPLC and GC.
Example 30
Anaerobic Mitochondrial Production of Isobutanol with Cofactor
Usage Balanced by Malate Bypass, Wherein ALS, KARI, DHAD, and KIVD
are Targeted to the Mitochondria
[0382] This example illustrates how anaerobic mitochondrial
production of isobutanol is achieved in yeast with cofactor usage
balanced by malate bypass, wherein ALS, KARI, DHAD, and KIVD are
targeted to the mitochondria. With these modifications,
malate-bypass containing strains will generally exhibit higher
isobutanol productivity, titer, and/or yield under anaerobic
conditions as compared to their respective parent strains.
[0383] As disclosed herein, one approach to balance the cofactor
usage for the production of isobutanol from glucose is the use of a
malate bypass in which the NADH generated from glycolysis is
consumed in the production of malate from phosphoenol pyruvate.
Malate is then transported into the mitochondria and used to
generate NADPH and pyruvate. To introduce this bypass the following
genes are overexpressed in the yeast host: PCK1, MDH2, DIC1 and
MAE1. pGV8000 is a plasmid in which these genes are expressed using
strong constitutive promoters. The plasmid also expresses the
hygromycin resistance gene, hph. Downstream of the pathway genes,
pGV8000 carries a sequence which consists of, from 5' to 3', S.
cerevisiae PDC6 terminator, a unique restriction site (HpaI), and
the PDC6 promoter. pGV8000 is linearized by digestion with HpaI and
is transformed into K. marxianus strains A, AM, AK, AP, and APM for
random integration into the chromosome. This results in the K.
marxianus strains AMB, AMMB, AKMB, APMB, and APMMB respectively.
This linearized pGV8000, when transformed into S. cerevisiae
homologously replaces the PDC6 locus of S. cerevisiae. The
linearized pGV8000 is transformed into strains SCP1, SCP1M, SCP1K,
SC1, SC1M, c2i-SC1, and c2i-SC1M resulting in strains SCP1 MB,
SCP1MMB, SCP1KMB, SC1 MB, SC1MMB, c2i-SC1 MB, and c2i-SC1MMB
respectively. The transformed cells are plated onto YPD medium
supplemented with hygromycin. Except in the case of SC1, SC1 MB,
SC1MMB and SC1M strains, YPEthanol supplemented with hygromycin is
used. The plates are incubated at 30.degree. C. for 3-4 days. After
3-4 days colonies are patched onto selective plates and these
patches are used for colony PCR and RT-PCR to verify correct
integration and transcription of the malate bypass genes,
respectively. Three verified clones from each transformation are
used to inoculate 3 mL overnight cultures in YPD or in YPEthanol
for the strains SC1, SC1 MB, SC1MMB and SC1M. The parent strains
are used as controls. These overnight cultures are used to
inoculate 100 mL cultures in 1 L YPD or YPEthanol shake flasks.
These cultures are harvested at an OD600 of 0.6-0.8. The cells are
resuspended in 20 mL fresh YPD medium and the cultures are
incubated in 100 mL stoppered serum bottles at 30.degree. C., 250
rpm. 2 mL samples are taken at 24 and 48 hours after inoculation.
The fermentation is ended after 48 hours. Samples are processed and
analyzed by HPLC and GC.
Example 31
Anaerobic Mitochondrial Production of Isobutanol with Cofactor
Balance through overexpression of a fungal transhydrogenase,
wherein ALS, KARI, DHAD, and KIVD are Targeted to the
Mitochondria
[0384] This example illustrates how anaerobic mitochondrial
production of isobutanol is achieved in yeast with cofactor usage
balanced via the overexpression of a fungal transhydrogenase,
wherein ALS, KARI, DHAD, and KIVD are targeted to the mitochondria.
With these modifications, the transhydrogenase containing strains
will generally exhibit higher anaerobic isobutanol productivity,
titer, and/or yield as compared to their respective parent
strains.
[0385] As disclosed herein, one approach to balance the cofactor
usage between glycolysis and the isobutanol pathway is the use of a
transhydrogenase in which the NADH generated from glycolysis is
transferred into the mitochondria by the acetaldehyde/ethanol
shuttle. In the mitochondria the NADH is converted into NADPH by a
transhydrogenase which is integrated into the mitochondrial inner
membrane. pGV9000 containing the transhydrogenase gene from
Neurospora crassa is linearized by digestion with HpaI and
transformed into K. marxianus strains A, AM, AK, AP, and APM for
random integration into the chromosome. This results in the K.
marxianus strains ATH, AMTH, AKTH, APTH, and APMTH respectively.
This linearized pGV9000, when transformed into S. cerevisiae will
homologously replace the PDC6 locus of S. cerevisiae. The
linearized pGV9000 is transformed into strains SCP1, SCP1M, SCP1K,
SC1, SC1M, c2i-SC1, and c2i-SC1M resulting in strains SCP1TH,
SCP1MTH, SCP1KTH, Sc1TH, Sc1MTH, c2i-SC1TH, and c2i-SC1MTH
respectively. The transformed strains are plated onto YPD medium
supplemented with hygromycin. In the case of SC1, SC1TH, SC1MTH and
SC1M strains, YPEthanol supplemented with hygromycin is used. All
plates are incubated at 30.degree. C. for 3-4 days. After 3-4 days
colonies are patched onto selective plates and these patches are
used for colony PCR and RT-PCR to verify correct integration and
transcription of the transhydrogenase genes, respectively. Three
verified clones from each transformation are used to inoculate 3 mL
overnight cultures in YPD or YPEthanol for the Saccharomyces
strains SC1, SC1TH, SC1MTH and SC1M. The parent strains are used as
control. These overnight cultures are used to inoculate 100 mL
cultures in 1 L shake flasks. These cultures are harvested at an
OD600 of 0.6-0.8. The cells are resuspended in 20 mL fresh YPD
medium and the cultures are incubated in 100 mL stoppered serum
bottles at 30.degree. C., 250 rpm. 2 mL samples are taken at 24 and
48 hours after inoculation. The fermentation is ended after 48
hours. Samples are processed and analyzed by HPLC and GC.
Example 32
Comparison of Strains GEVO1820, GEVO2062 and GEVO2072
[0386] The goal of this experiment was to integrate mitochondrially
targeted isobutanol pathways into the PDC1 locus of a diploid S.
cerevisiae and to evaluate the ability of these strains to produce
isobutanol in comparison to a strain expressing a cytosolically
expressed isobutanol pathway. Mitochondrial targeting peptide
sequences were added to the protein sequences of ALS, KIVD, and
Aro10 in order to localize these proteins in the mitochondria.
Because isobutyraldehyde is expected to be membrane permeable, it
should be available as a substrate for the Adh7 enzyme
overexpressed in the cytosol.
[0387] This example describes the comparison of two strains
containing mitochondrially targeted isobutanol pathways: GEVO2062
and GEVO2072 (Table 1) with a strain containing a cytosolic
isobutanol pathway. GEVO2072 and GEVO2062 are PDC positive diploid
strains containing a mitochondrially targeted acetolactate synthase
from B. subtilis (alsS), and a cytosolic S. cerevisiae alcohol
dehydrogenase (ADH7). In addition, GEVO2062 express a
mitochondrially targeted Aro10 protein; while GEVO2072 expresses a
mitochondrially targeted KIVD from Lactococcus lactis. GEVO2072 and
GEVO2062 were constructed by integrating a set of genes from
pGV1875 (SEQ ID NO: 92) and pGV1876 respectively (SEQ ID NO: 97)
into one allele of the native PDC1 locus. The integrated genes in
GEVO2072 encode the B. subtilis AlsS protein with 31 amino acids of
the mitochondrial targeting leader-sequence from S. cerevisiae Cox4
protein, L. lactis 2-keto-acid decarboxylase (KIVD) with the
carboxy-terminal mitochondrial targeting sequence from the S.
cerevisiae Hmi1 protein, and S. cerevisiae ADH7, which is expressed
in the cytosol. The integrated genes in GEVO2062 encode the B.
subtilis ALS protein with 25 amino acids of the mitochondrial
targeting leader-sequence from S. cerevisiae Cox4 protein, the S.
cerevisiae Aro10 protein with the carboxy-terminal mitochondrial
targeting sequence from the S. cerevisiae Hmi1 protein, and S.
cerevisiae ADH7, which is expressed in the cytosol.
[0388] The third strain in this example GEVO1820 contains a
completely cytosolically expressed isobutanol pathway. GEVO1820 was
generated by transforming the diploid wild-type strain GEVO1186
with a 9.2 kb HpaI fragment from pGV1733. Ura+ transformants
contained a homologous replacement of one of the two PDC6 alleles
with a copy of the LlkivD2, ScADH7, and ScURA3 genes to generate
strain GEVO1802. Next GEVO1802 was transformed with a 9.5 kb NruI
fragment from pGV1731. Leu+ transformants contained a homologous
replacement of one of the two PDC5 alleles with a copy of the
EcilvC.DELTA.N (SEQ ID NO: 157), EcilvD.DELTA.NcoKl (SEQ ID NO:
158), and ScLEU2 genes to generate strain GEVO1805. Finally
GEVO1805 was transformed with a 6.7 kb linear fragment from
pGV1730. Trp+ transformants contained a homologous replacement of
one of the two PDC1 alleles with a copy of the BsalsS2 gene (SEQ ID
NO: 151) coding for BsAlsS2 (SEQ ID NO: 152) expressed from the
P.sub.ScCUP1 promoter and the TRP1 gene; the resulting strain is
GEVO1820.
[0389] For aerobic fermentations, precultures were inoculated using
cells from a fresh plate that were resuspended in 1 mL of YPD
medium. These cell suspensions were then used to inoculate 50 mL of
YPD medium in 250 mL baffled shake flasks; these preculture flasks
were incubated at 30.degree. C. in an orbital shaker at 250 rpm
until the cell population reached mid-to late-log phase. To start
the fermentation, cells were harvested from the preculture flasks
and were used to inoculate 25 mL of fresh YPD (50 g-glucose
L.sup.-1) medium to a final OD.sub.600 of 1.6-1.9. The 25 mL
fermentation cultures were incubated in 250 mL non-baffled flasks
at 30.degree. C. in an orbital shaker at 250 rpm. Samples (2 mL)
were taken at 0, 9, 23, 31, 51, and 61 hours and cells were removed
from the samples by centrifugation at .gtoreq.14,000.times.g for 10
min in a microcentrifuge. The supernatants from the samples were
collected and the glucose concentration was measured at each time
point on the YSI 2700 Select (YSI Life Sciences, Yellow Springs,
Ohio, USA) according to manufacturer's protocols. The remaining
supernatant volume was stored at 4.degree. C. until analysis by Gas
Chromatography and/or High Performance Liquid Chromatography as
described above.
[0390] Because of the fast glucose consumption rate of these
strain, glucose was added throughout the time course. For all three
strains, the fermentation cultures were fed 83 g/L glucose at 9 h,
30 g/L at 23 h, 121 g/L at 31 h. Additionally, the cultures of
GEVO2062 and GEVO2072 were fed 60 g/L glucose at 51 h. These
concentrations are volume corrected to account for the significant
dilution of the cultures by the glucose feed. The concentrations
refer to the start volume of the cultures.
[0391] The differences observed between GEVO2062 and GEVO2072
during fermentation were minor GEVO2072 reached 15% higher titer
than GEVO2062 (Table 4, FIG. 9). GEVO2072 grew to a 25% higher cell
density and therefore the specific productivity of this strain was
about 10% lower than that of GEVO2062. The yield was the same for
both mitochondrial strains. GEVO2072 differs from GEVO2062 by the
mitochondrial targeting sequence fused to ALS. GEVO2062 has a 25
amino acid targeting sequence from the Cox4 protein, while GEVO2072
has a 31 amino acid targeting sequence from the Cox4 protein. The
other difference between the two strains is that GEVO2062 expresses
the Aro10 protein for its KIVD enzyme, while GEVO2072 expresses the
L. lactis KIVD protein. GEVO2072 consumed 16% more glucose and
produced 27% more ethanol than GEVO2062 (FIG. 9). The isobutanol
titers of the mitochondrial strains were 2.4 g/L and 2.1 g/L for
GEVO2072 and GEVO2062 respectively at 61 h (FIG. 9).
[0392] In contrast, the strain with cytosolically expressed
isobutanol pathway GEVO1820 showed lower rate, titer and yield
compared to the mitochondrial strains (Table 4). GEVO1820 reached
20% of the titer and productivity and 30% of the yield compared to
GEVO2062. In the first 23 h of the fermentation GEVO1820 reached
about 50% of the productivity and yield compared to GEVO2062 but
after the 23 h time point isobutanol production was very low (FIG.
10).
TABLE-US-00004 TABLE 4 Productivity, Titer, and Yield for GEVO1820,
GEVO2062 and GEVO2072. Specific Productivity Titer Yield Strains
[g/L/h/OD] .+-. [g/L] .+-. % .+-. Gevo2072 0.0012 3.8E-05 2.4 0.1 2
0.1 Gevo2062 0.0013 7.2E-05 2.1 0.1 2 0.1 Gevo1820 0.0003 3.6E-05
0.4 0.03 0.6 0.06
Example 33
Determination of Enzymes Critical to Isobutanol Production
[0393] The goal of this example was to determine which pathway
enzymes in GEVO2072 are critical for isobutanol production. Strains
containing only two of the three pathway genes expressed in
GEVO2072 were constructed by targeted directed integration of the
genes to the PDC1 locus of the parent strain of GEVO2072 which is
the wild-type strain GEVO1186. Strains GEVO2129 and GEVO2130
contain mitochondrially-targeted ALS and mitochondrially-targeted
KIVD. The strains GEVO2127 and GEVO2128 contain a
mitochondrially-targeted ALS and a cytosolically expressed ADH7.
Strains GEVO2131 and GEVO2132 contain a mitochondrially-targeted
KIVD protein with a cytosolically expressed ADH7. The performance
of each strain in fermentation was compared to the performance of
GEVO2072 to determine whether the absent enzyme is required for
mitochondrial isobutanol production.
[0394] GEVO2072 (mitochondrially-targeted ALS and KIVD with a
cytosolically expressed ADH) produced approximately 1.3 g/L of
isobutanol by 55 hours. GEVO2127 and GEVO2128, containing the
mitochondrially targeted ALS protein and the cytosolically
expressed ADH like GEVO2072 but lacking mitochondrially targeted
KIVD, still produced a similar isobutanol titer to GEVO2072 (Table
5).
TABLE-US-00005 TABLE 5 Productivity, titer, and yield at 55 hours
for strains tested in the first fermentation. GEVO2072 was run in
triplicate, all other strains were run in single fermentations.
GEVO1186 is the parent of all strains in this fermentation and
serves as the negative control. Specific Productivity Titer Yield
samples 55 h [g/L/h/OD] .+-. [g/L] .+-. % .+-. GEVO1186 0.0003 0.3
0.6 GEVO2072 0.001 7.2E-06 1.3 0.03 2.3 0.1 GEVO2127 0.001 1.3 2.2
GEVO2128 0.001 1.2 2.2 GEVO2130 0.0007 0.8 1.9 GEVO2131 0.0003 0.3
0.7 GEVO2132 0.0004 0.5 0.9
[0395] Strains GEVO2129 and GEVO2130, containing mitochondrially
targeted ALS and KIVD like GEVO2072, but lacking S cerevisiae ADH7
produced slightly less isobutanol than GEVO2072 at 55 hours, but by
72 hours, titers were similar to GEVO2072 (Table 6). However, all
strains observed that lacked the mitochondrially targeted ALS
protein (GEVO2131 and 2132) performed similar to the parental
strain without the pathway and only made isobutanol at background
levels (Table 5 and Table 6).
TABLE-US-00006 TABLE 6 Productivity, titer, and yield at 72 hours
for strains tested in the second fermentation. All strains were run
in single fermentations. GEVO1186 is the parent of all strains in
this fermentation and serves as the negative control. Specific
Productivity Titer Yield samples 72 h [g/L/h/OD] [g/L] [g/g]
GEVO1186a 0.0002 0.2 0.2 GEVO1186b 0.0001 0.1 0.1 GEVO2072a 0.0006
1.1 1.1 GEVO2072b 0.0004 0.8 0.8 GEVO2129 0.0004 0.7 0.7 GEVO2130
0.0005 0.9 0.8
[0396] These observations suggest that ALS targeted to the
mitochondrial compartment is critical to the mitochondrial
isobutanol pathway, and in its absence, isobutanol cannot be
produced above background concentrations. In short, of the three
isobutanol pathway genes in GEVO2072, only mitochondrially-targeted
ALS is required for isobutanol production. Because KIVD is not
required for isobutanol production, an alternate enzyme is likely
responsible for the conversion of .alpha.-keto-isovalerate to
isobutyraldehyde. Likewise, because ADH7 is not required for
isobutanol production, it is likely that endogenous ADH is
responsible for the conversion of isobutyraldehyde to
isobutanol.
Example 34
Introduction of BAT1 and BAT2 into GEVO2072 Leads to Increased and
Sustained Isobutanol Production
[0397] An intermediate in both the valine and engineered isobutanol
pathways is ketoisovalerate (KIV). The increase in isobutanol
production observed upon the targeting of the B. subtilis BsalsS
encoded acetolactate synthase to mitochondria, and the subsequent
finding that this is the only enzyme required for the observed
increase in isobutanol production, led to the proposed pathway in
FIG. 10. Briefly, the pathway utilizes the exogenous acetolactate
synthase activity encoded by B. subtilis BsalsS to generate
acetolactate, which is subsequently utilized by the native Ilv5
(KARI), Ilv3 (DHAD), and Bat1 enzymes to produce valine. Valine
crosses the inner and outer mitochondrial membranes into the
cytosol, where it is subsequently converted by Bat2p into KIV. KIV
is used as substrate by native KIVDs (including Pdc1 or Pdc5) for
production of isobutyraldehyde, which is converted to isobutanol by
either a native alcohol dehydrogenase or the overexpressed
dehydrogenase encoded by S. cerevisiae ADH7.
[0398] To test the model above, the S. cerevisiae BAT2 was
overexpressed in GEVO2072, a PDC-positive strain described above
that contains a mitochondrially targeted acetolactate synthase from
B. subtilis (alsS), a L. lactis 2-keto-acid decarboxylase (LlkivD),
and a cytosolic S. cerevisiae alcohol dehydrogenase (ADH7). To
overexpress BAT2, GEVO2072 was transformed with pGV1999 (SEQ ID NO:
93), a high-copy HIS3 marked yeast plasmid for production of the S.
cerevisiae cytosolic Bat2p. Transformation of GEVO2072 with pGV1999
resulted in an initial increase in isobutanol production.
Overexpression of the S. cerevisiae BAT2 in GEVO2072 led to a
60-70% increase in volumetric productivity (0.025.+-.0.004 g/L/h),
specific productivity (0.0027.+-.0.004 g/L/h/OD), and yield
(2.1.+-.0.3%) compared to GEVO2072 (0.015 g/L/h, 0.0016 g/L/h/OD,
and 1.3%) during the growth phase of the fermentation (Table 7).
However, once in the stationary phase, the productivity in GEVO2072
with overexpressed S. cerevisiae BAT2 slowed, and the final
isobutanol titer was similar to GEVO2072 at 71 hours (approximately
1 g/L).
TABLE-US-00007 TABLE 7 Productivity and Yields of GEVO2072 with
pGV1999. Vol. Specific productivity productivity (g/L/h) (g/L/h/OD)
yield 6-24 h pGV1999-GEVO2072 0.025 .+-. 0.004 0.0027 .+-. 0.0004
2.1 .+-. 0.3% GEVO2072 0.015 0.0016 1.3% 24-41 h pGV1999-GEVO2072
0.018 .+-. 0.006 0.0019 .+-. 0.0006 2.9 .+-. 0.9% GEVO2072 0.015
0.0015 2.6% 41-71 h pGV1999-GEVO2072 0.006 .+-. 0.003 0.0005 .+-.
0.0003 1.7 .+-. 0.7% GEVO2072 0.014 0.0017 4.6%
[0399] These data demonstrated that overexpression of S. cerevisiae
BAT2 improves isobutanol production during log phase, suggesting
that Bat2p is involved in isobutanol production in GEVO2072, and
its lower expression during log phase leads to a lower rate.
Because S. cerevisiae BAT1 is repressed in the stationary phase,
the observed slower rate of production between 24 and 71 hours in
the GEVO2072 strains with S. cerevisiae BAT2 overexpression could
be the result of a reduced Bat1p activity upstream of Bat2p.
[0400] With this in mind, it was hypothesized that a reduction in
S. cerevisiae BAT1 transcription as the cells entered stationary
phase (Eden et al. 1996 The Journal of Biological Chemistry
271(34):20242-5) caused the observed reduction in the rate of
isobutanol production in the GEVO2072 cells carrying the
overexpression vector with the S. cerevisiae BAT2. To test this
hypothesis, the S. cerevisiae BAT1 was cloned into a similar
high-copy plasmid as the plasmid carrying the S. cerevisiae BAT2,
and both plasmids were transformed into GEVO2072 and its parent
strain, GEVO1186 (Table 1). In doing so, the inventors aimed to
determine if overexpression of Sc_BAT1 and Sc_BAT2 from
constitutive promoters on high-copy plasmids (2.mu.) would lead to
increased and sustained isobutanol production.
[0401] To accomplish this, GEVO2072 was transformed with the S.
cerevisiae BAT1 and BAT2 overexpression vectors pGV1999 and pGV2212
respectively to generate GEVO2878-GEVO2880 (Table 1).
GEVO2878-GEVO2880 produced 1.2.+-.0.1 g/L of isobutanol under
low-aeration conditions in Yeast Nitrogen Base Dextrose (YNBD)
medium with necessary auxotrophic supplements after 86 hours, which
was 130% higher than GEVO2072 with empty vectors. Moreover,
GEVO2878-GEVO2880 sustained a specific productivity of 0.005-0.006
g/L/OD/h for 86 hours, and produced isobutanol at a yield of
3.1%.
[0402] This example shows that overexpression of the S. cerevisiae
BAT1 and BAT2 genes supports production of isobutanol at levels
greater than double that observed with GEVO2072 after 90 hours
(FIG. 11).
Example 35
Integration of pGV1875 into GEVO1947 to Create GEVO2087 and
GEVO2088
[0403] The goal of this example was to randomly integrate the
mitochondrially targeted isobutanol pathway, encoded by genes
contained within pGV1875, into the genome of K marxianus. To this
end, pGV1875 (SEQ ID NO: 92) was integrated into GEVO1947, and
several transformants were screened for their ability to produce
isobutanol in a shake flask fermentation experiment. Two
transformants that produced .gtoreq.1.0 g/L isobutanol in 24 hours
were named GEVO2087 and GEVO2088.
[0404] The K. marxianus strains GEVO2087 and GEVO2088 (Table 1)
were constructed by transformation of GEVO1947 with pGV1875 that
had been linearized with the restriction enzyme PvuI. The
transformation was plated on SC-URA plates to select for
integrants. Integrants were verified by colony PCR.
[0405] Seven of the eight transformants (#1, 2, 4-7, and 10),
including GEVO2087 (Transformant #10) and GEVO2088 (Transformant
#7) produced approximately 1 g/L isobutanol after 24 hours of
incubation (FIG. 12a). Transformant #3 and GEVO1947 without the
pathway produced less than 0.2 g/L isobutanol after 24 hours (FIG.
12a). All of the strains produced high levels of ethanol (>74
g/L), (FIG. 12b).
[0406] Table 8 summarizes the productivity, titers, and yields of
isobutanol produced by the GEVO1947 transformants. All of the
transformants, except #3, produced at least 1 g/L isobutanol with
specific productivities of .about.0.001 g/L/h/OD isobutanol.
Transformant #10 (GEVO2087) had the greatest values for
productivities and titer compared to the other transformants, as
well as the greatest yield (1.6%).
TABLE-US-00008 TABLE 8 Productivity, Titer, and Yield at 24 hrs for
K. marxianus strains Specific Isobutanol Productivity Titer Yield
[g/L/h/OD] [g/L] % GEVO1947 0.0001 0.2 0.2% TRANS #1 0.0007 1 1.2%
TRANS #2 0.0014 1 1.1% TRANS #3 0.0001 0.2 0.2% TRANS #4 0.0007 1
1.4% TRANS #5 0.0007 1 1.3% TRANS #6 0.0007 1 1.3% TRANS #7 0.0009
1 1.2% (GEVO2088) TRANS #10 0.0010 1.1 1.6% (GEVO2087)
[0407] This example demonstrates that GEVO1947 strains transformed
with pGV1875 produced up to 1.1 g/L isobutanol in 24 hours.
GEVO2087 (transformant #10) produced 1.1 g/L isobutanol in 24
hours, with a volumetric productivity of 0.044 g/L/h, a specific
activity of 0.001 g L/h/OD, and a yield of 1.6%.
Example 36
Comparison of GEVO2087 and GEVO2072 Isobutanol Production
[0408] The goal of this example was to compare the isobutanol
production in GEVO2072 and GEVO2087 in the same shake flask
experiment. Aerobic batch cultivations were performed at 30.degree.
C. in 250 mL flasks in an orbital shaker at 250 rpm. Yeast cells
were grown in YPD medium to mid- to late-log phase. Cells were
collected and resuspended in 50 mL of fresh YPD (50 g-glucose
L.sup.-1) to a final OD.sub.600 of 0.5-0.8 to initiate
fermentations. Samples (2 mL) were taken at 0, 6, 24, 48, and 66.5
hours and cells were removed by centrifugation at
.gtoreq.14000.times.g for 10 min in a microcentrifuge. Glucose
concentration was measured at each time point on the YSI 2700
Select (YSI Life Sciences, Yellow Springs, Ohio, USA) according to
manufacturer's protocols. After 6 hours, 9 mL of 376 g/L glucose
was added to each fermentation cultures. After 24 hours, 13.5 ml of
376 g/L glucose was added. After 48 hours, 14 ml of 365 g/L glucose
was added. The supernatants from the samples were collected and
kept at 4.degree. C. until analysis by Gas Chromatography and/or
High Performance Liquid Chromatography as described above.
[0409] The fermentations were initiated with 50 g/L glucose (t=0),
and glucose concentrations were monitored throughout the 66.5 hour
fermentation experiment using the YSI (data not shown). After 6
hours, the cultures had consumed approximately 25 g/L glucose.
Glucose was fed to the cultures at this time point, as well as at
24 and 48 hours. All strains tested consumed glucose at roughly the
same rate up to the 48 hour time point. However, after 48 hours,
the S. cerevisiae strains continued to consume glucose at a similar
rate as previous timepoints (based upon similar slope between 24
and 48 hour measurements and between 48 and 66.5 hour
measurements), whereas the K. marxianus strains consumed at a
slower rate.
[0410] The concentrations of isobutanol and ethanol for each
culture after 0, 6, 24, 48, and 66.5 hours of incubation were
averaged for each strain, and the results are summarized in the
charts in FIGS. 13a and 13b. After 48 hours, GEVO2087 and GEVO2072
both produced approximately 0.8 g/L isobutanol, compared to 0.2 g/L
in the negative control strains, GEVO1947 and GEVO1186 (FIG. 13a).
GEVO2087 did not produce anymore isobutanol after 48 hours, whereas
GEVO2072 continued to produce isobutanol at a similar rate,
reaching a titer of .about.1.4 g/L. All four strains produced
.about.90 g/L ethanol in 48 hours (FIG. 13b). The K. marxianus
strains failed to produce more ethanol after 48 hours, consistent
with the slowdown in growth and glucose consumption after 48
hours.
[0411] Table 9 summarizes the productivity, titers, and yields of
isobutanol produced by GEVO1186, GEVO2072, GEVO1947, and GEVO2087
after 48 and 66.5 hours. After 48 hours, the pathway carrying
strains, GEVO2072 and GEVO2087, exhibited similar productivities
(0.018 g/L/h and 0.0006 g/L/h/OD) and yields (.about.1.1%). These
values were generally 2-4 times greater than their counterparts
that lacked the pathway, GEVO1186 and GEVO1947. After 66.5 hours,
the productivities, titer, and yield values of GEVO2087 were lower
than at the 48 hour time point, whereas GEVO2072 had the highest
values observed during this experiment (specific
productivity=0.0006 g/L/h/OD, titer=1.3 g/L, and yield=1.3%).
TABLE-US-00009 TABLE 9 Productivity, Titer, and Yield at 48 h and
66.5 h Specific Isobutanol Productivity Titer Yield [g/L/h/OD]
[g/L] % 48 hours GEVO1186 0.0002 .+-. 0.0000 0.2 .+-. 0.02 0.2 .+-.
0.02% GEVO2072 0.0006 .+-. 0.0001 0.8 .+-. 0.10 1.1 .+-. 0.12%
GEVO1947 0.0003 .+-. 0.0000 0.2 .+-. 0.00 0.3 .+-. 0.00% GEVO2087
0.0006 .+-. 0.0000 0.8 .+-. 0.03 1 .+-. 0.03% 66.5 hours GEVO1186
0.0002 .+-. 0.0000 0.2 .+-. 0.02 0.2 .+-. 0.02% GEVO2072 0.0006
.+-. 0.0000 1.3 .+-. 0.12 1.3 .+-. 0.11% GEVO1947 0.0002 .+-.
0.0000 0.2 .+-. 0.02 0.3 .+-. 0.03% GEVO2087 0.0004 .+-. 0.0001 0.6
.+-. 0.14 0.8 .+-. 0.18%
Example 37
Introduction of Mitochondrially-Targeted Isobutanol Pathway into
Strain Lacking PDC Activity
[0412] A Pdc-K. marxianus strain (GEVO1969) was transformed with a
mitochondrially-targeted isobutanol pathway encoded by pGV1875 (SEQ
ID NO: 92) to construct GEVO2276 and GEVO2277 (Table 1). Shake
flask fermentations were performed and four strains were analyzed
(GEVO2087, GEVO1969, GEVO2276, and GEVO2277).
[0413] As shown in FIG. 14, GEVO2277, which contains the entire
mitochondrially-targeted pathway (PATHWAY+), but lacks PDC activity
(Pdc-) produced approximately 10% the amount of isobutanol as
GEVO2087 (PATHWAY+ PDC+) after 24 hours incubation. GEVO2277
produced approximately 4 times more isobutanol after 24 hrs than
did GEVO1969 or GEVO2276, neither of which contained B. subtilis
BsalsS transcript.
[0414] As discussed above, GEVO2277 produced approximately 10% the
isobutanol compared to GEVO2087 after 24 hours incubation,
suggesting that PDC activity is required for production of
isobutanol (Titer column in Table 10). However, the specific
productivity of GEVO2277 was closer to one-third that of GEVO2087,
and the yield of GEVO2277 was approximately half of GEVO2087. The
difference in relative yields and specific productivities compared
to the relative titers reflects the slower growth and glucose
consumption of the Pdc-minus GEVO2277.
TABLE-US-00010 TABLE 10 Summary of Isobutanol Production after 24
hours Incubation specific Titer productivity (g/L)
(g/L/h/OD.sub.600) yield GEVO2087 1.1 0.0016 2.1% GEVO1969 0.03
0.0001 0.3% GEVO2276 0.03 0.0001 0.4% GEVO2277 0.13 0.0005 1.1%
[0415] While GEVO2087 produced more isobutanol than the other three
metabolites combines, GEVO2277 produced mostly acetoin, as well as
greater levels of diacetyl and pyruvate. Generally, the
distribution suggests that the pathway is blocked after the
conversion of pyruvate to acetolactate, which is catalyzed by the
enzyme encoded by B. subtilis BsalsS. Because both GEVO2087 and
GEVO2277 are using the native KARI and DHAD enzymes in the
mitochondria, neither of the enzyme are likely the bottleneck in
the pathway. However, because GEVO2087 contains PDC activity and
GEVO2277 does not, this appears to be the activity that is required
for production of isobutanol. This suggests that KIVD activity is
limiting, and PDC activity is required for the majority of this
activity.
Example 38
Introduction of B. subtilis BsalsS with MTS and L. lactis LlkivD2
Lacking MTS into Strain Lacking PDC Activity
[0416] In order to eliminate ethanol production and to produce
isobutanol, the mitochondrially-targeted pathway was introduced
into a Pdc-minus K. marxianus strain (GEVO1969). The resulting
strain, GEVO2277, produced 0.13 g/L isobutanol, which was 4-times
higher than background. However, GEVO2277 only produced isobutanol
at a yield of 1.1%, while its PDC+ counterpart, GEVO2087, produced
isobutanol at a yield of 2.1% (see Table 11).
[0417] One possible reason for the reduction in isobutanol yield in
the Pdc-minus GEVO2277 strain is the loss of ketoisovalerate
decarboxylase (KIVD) activity contributed by PDC. To test this
hypothesis, the Pdc-minus GEVO1969 strain was transformed with a
plasmid that contained B. subtilis BsalsS with a mitochondrial
targeting sequence and L. lactis LlkivD2 lacking a mitochondrial
targeting sequence (pGV1990) (SEQ ID NO: 94), or a plasmid that
only contained B. subtilis BsalsS with a mitochondrial targeting
sequence (pGV2015) (SEQ ID NO: 95).
[0418] As shown in Table 11, pGV1990-GEVO1969 #5 (GEVO 2347)
produced approximately 0.3 g/L isobutanol in 24 hours, which was
the highest measured isobutanol titer in this experiment, while
producing only 0.001 g/L ethanol. pGV2015-GEVO1969 #2 (GEVO2348)
produced the second highest isobutanol, approximately 0.15 g/L.
pGV1990-GEVO1969 #1 and #4 produced similar isobutanol titers
(-0.07-0.09 g/L) as the positive control strain, GEVO2277, which
was approximately 3-4.times. higher than the negative control
strain, GEVO1969. pGV2015-GEVO1969 #3 produced less isobutanol than
the negative control strain.
TABLE-US-00011 TABLE 11 Summary of Isobutanol Production after 24
Hrs Incubation Specific ethanol isobutanol titer productivity titer
(g/L) yield (g/L/h/OD) (g/L) pGV1990-1 0.07 0.8% 0.0003 0.001
pGV1990-4 0.08 1.0% 0.0003 0.000 (GEVO2346) pGV1990-5 0.3 3.3%
0.0013 0.001 (GEVO2347) pGV2015-2 0.14 1.4% 0.0004 0.005 (GEVO2348)
pGV2015-3 0.01 0.2% 0.0001 0.019 GEVO1969 0.02 0.5% 0.0001 0.001
GEVO2277 0.08 1.0% 0.0004 0.000
Example 39
Determination of KIVD Activity
[0419] Based upon the qRT-PCR and shake flask fermentation data,
three of the transformants were saved and renamed with the
following designations: GEVO2346, GEVO2347, and GEVO2348. To
determine the ketoisovalerate decarboxylase activity in these three
strains, along with several other control strains, KIVD activity
assays were performed on whole cell lysates.
[0420] Cells from a saturated 3 mL YPE cultures (incubated
overnight at 30.degree. C., 250 RPM) were used to inoculate 25 mL
YPD cultures at OD.sub.600 of 0.3-0.4 in 125 mL metal capped,
baffled flasks. The cultures were incubated at 30.degree. C., 250
RPM for 5-6 hours. The cells were collected by centrifugation (5
minutes at 1600.times.g), and the mass of the pellet was weighed
after removal of the supernatant. KIVD Assay buffer (see below for
recipe), containing 1 Roche Protease Inhibitor tablet per 5 mL
buffer, was added to each pellet to create a 20% (w/v) cell
suspension. Cell lysates were prepared by bead beating and the
final protein concentration was determined by Bradford assay. The
quality of the isolated proteins was verified with a Coomassie Blue
Stained gel.
[0421] Ketoisovalerate decarboxylase activity was assessed as
follows. A reaction buffer was prepared at a final concentration of
0.05 M NaHPO.sub.4*H.sub.2O, 5 mM MgCl.sub.2*8H.sub.2O, and 1.5 mM
Thiamin pyrophosphate chloride. The reaction substrate,
.alpha.-keto-isovalerate (3-methyl-2-oxobutanoic acid, Acros
Organics), was added where appropriate at 30 mM. Lysates were
diluted in reaction buffer at a final protein concentration of 0.1
.mu.g/.mu.L. To 1.5 mL tubes, 50 .mu.L of lysate (5 .mu.g of
protein) was mixed with 200 .mu.L of reaction buffer with or
without substrate. The reactions were incubated at 37.degree. C.
for 20 minutes, and the reactions were immediately filtered through
a 2 .mu.m filter plate. The filtered samples were diluted 1:10 in
water, and 100 .mu.L of the 1:10 dilution was mixed with 100 .mu.L
of derivatization reagent in a 0.2 ml thin-wall PCR tubes.
Derivatization reagent was prepared by mixing 4 ml of
2,4-Dinitrophenyl Hydrazine (DNPH) in 15 mM in HPLC-grade
Acetonitrile with 1 ml 50 mM Citric Acid Buffer, pH 3. The samples
were incubated at 70.degree. C. for 30 minutes. The samples were
analyzed by HPLC.
[0422] Analysis of ketoisovalerate and isobutyraldehyde,
derivatized with DNPH, was performed on a HP-1100 High Performance
Liquid Chromatography system equipped with a Hewlett Packard 1200
HPLC stack column (Agilent Eclipse XDB-18, 150.times.4.0 mm; 5
.mu.m particles [P/N #993967-902] and C18 Guard cartridge).
Ketoisovalerate and isobutyraldehyde were detected using an HP-1100
UV detector (360 nm). The column temperature was 50.degree. C. This
method was Isocratic with 60% acetonitrile, 1% H.sub.3PO.sub.4 in
Milli-Q water. Flow was set at 1.0 mL/min. Injection size was 10
.mu.L and the run time was 10 minutes. KIVD activity is summarized
in Table 12. As shown in Table 12, GEVO2347 contained approximately
33% more KIVD activity than did the negative, Pdc-minus control
(GEVO1969), which was determined to be a statistically significant
difference (t-test, p=0.045). The increase in KIVD activity in
GEVO2347 correlates with the increase in isobutanol production,
suggesting that cytosolic KIVD activity was limiting for isobutanol
production in the Pdc-minus strains.
TABLE-US-00012 TABLE 12 KIVD Activity. Genotype Transformant
Specific KIVD Strain PDC ALS KIVD ADH Designation activity (U/mg)
GEVO1947 + - - - N/A 0.166 .+-. 0.029 GEVO1969 - - - - N/A 0.061
.+-. 0.005 GEVO2087 + mitochondria mitochondria cytosol N/A 0.216
.+-. 0.025 GEVO2277 - mitochondria mitochondria cytosol N/A 0.058
.+-. 0.003 GEVO2346 - mitochondria cytosol - pGV1990 #4 0.059 .+-.
0.005 GEVO2347 - mitochondria cytosol - pGV1990 #5 0.080 .+-. 0.010
GEVO2348 - mitochondria - - pGV2015 #2 0.047 .+-. 0.007* *Only 2
replicates.
Example 40
High Total Titer with Mitochondrially Targeted ALS and KIVD in K.
marxianus
[0423] GEVO2087 is a modified yeast biocatalyst that contains genes
within the chromosome of the biocatalyst which encode a pathway of
enzymes that convert pyruvate into isobutanol. When the biocatalyst
GEVO2087 was contacted with glucose in a medium suitable for growth
of the biocatalyst, at about 30.degree. C., the biocatalyst
produced isobutanol from the glucose. An overnight starter culture
was started in a 250 mL Erlenmeyer flask with GEVO2087 cells from a
freezer stock with a 40 mL volume of YPD medium consisting of 100
g/L glucose, 10 g/L yeast extract, 20 g/L peptone and at a culture
OD600 of 0.05 to 0.1. The starter culture was grown for
approximately 14 hrs in a 30.degree. C. shaker at 250 rpm. Some of
the starter culture was then transferred to a 2000 mL DasGip
fermenter vessel containing about 1500 mL of YPD medium containing
150 g/L glucose initially to achieve an initial culture OD600 of
about 0.1. The vessel was attached to a computer control system to
monitor and control pH at 6.5 through addition of base, temperature
at about 30.degree. C., dissolved oxygen, and agitation. Initially,
during the cell growth phase, the vessel was agitated with a fixed
agitation of 600 rpm using a 10 sL/h air sparge until the OD600 was
about 31. Cell growth continued for approximately 14 hrs, after
which time, the agitation was decreased to 400 rpm with 10 sL/h
airflow. The dissolved oxygen was approximately zero throughout
this experiment. Continuous measurement of the fermentor vessel
off-gas by GC-MS analysis was performed for oxygen, isobutanol,
ethanol, and carbon dioxide throughout the experiment. Samples were
aseptically removed from the fermenter vessel throughout the
experiment and used to measure OD600, glucose concentration, and
isobutanol concentration in the broth. At about 196 h into the
experiment, the fermenter whole broth was removed from the
fermenter, cells were separated from the broth using centrifugation
at about 20.degree. C. an 4000.times.g in 500 mL centrifuge
bottles. The cell pellets were resuspended in fresh YPD medium that
contained 150 g/L glucose and returned to the fermenter. A glucose
feed of about 600 g/L glucose in DI water was used intermittently
during the production phase of the experiment at time points
greater than 14 h to maintain glucose concentration in the
fermenter of about 100 g/L or above.
[0424] Isobutanol was recovered from this fermentation using
methods that are described in US Patent Publication US 20090171129,
which is hereby incorporated by reference in its entirety.
[0425] The distillate recovered in the experiment was strongly
enriched for isobutanol. Distillate samples were analyzed by GC for
isobutanol concentration. Isobutanol production reached a maximum
at around 288 hrs with a total titer of about 21.6 g/L.
Example 41
Construction and Fermentation of Isobutanol Pathway Strains Derived
from S. cerevisiae Using Different Genes for ALS and KIVD and Using
Different Mitochondrial Targeting Sequences for Bs_AlsS
[0426] Two independent shake flask fermentations were performed.
The first fermentation was performed in order to screen several
strains with different mitochondrially targeted isobutanol pathways
for isobutanol production, and to compare these strains to
GEVO2072. All of the strains, including GEVO2072, have the pathway
integrated at the PDC1 locus, the difference between the strains is
the combinations of enzymes and mitochondrial targeting sequences
used. For each new strain two clones were tested, each in a single
shake flask.
[0427] The second fermentation was performed with GEVO2072 and
GEVO2119, both of which were run in triplicate.
[0428] In the first fermentation, of the strains tested, two
performed equivalent to GEVO2072 in isobutanol titer. These two
strains, GEVO2120 and GEVO2121 were both constructed by integration
of pGV1877 into GEVO1186, and they differ from GEVO2072 in that
they have ARO10 in place of LlkivD. GEVO2122 thru GEVO2126 all
produced approximately the same isobutanol titer of 0.5 g/L at 55
hours. GEVO2122 and GEVO2123 were both constructed by integration
of pGV1878 into GEVO1186, and this pathway consists of ILV2, kivD,
and ADH7. GEVO2124 and GEVO2125 were both constructed by
integration of pGV1879 into GEVO1186, and this pathway consists of
ILV2, ARO10, and ADH7. GEVO2126 was constructed by integration of
pGV1892 into GEVO1186, and this pathway consists of ILV2, LlkivD,
and ILV6*. ILV6* is a mutant of ILV6 that is not repressed by
valine. The performance of these strains suggests that ALS is
critical to the mitochondrial isobutanol pathway in GEVO2072,
GEVO2120, and GEVO2121. All strains consumed approximately the same
amount of glucose at all time points.
[0429] In the second fermentation, GEVO2072 again performed as
expected and produced about 1 g/L of isobutanol by 55 hours. At 55
hours, GEVO2119 made approximately the same amount of isobutanol as
GEVO2072, producing 0.94 g/L, and this value is within the error
range of GEVO2072. Both strains had similar values for specific
productivity and yield. Both strains consumed similar amounts of
glucose and reached similar cell densities.
Example 42
Integration of a Mitochondrial Isobutanol Pathway into a PDC Minus
S. cerevisiae Strain
[0430] To generate a Pdc-S. cerevisiae strain that expresses the
mitochondrial isobutanol pathway, the Pdc-strain GEVO1584 was
transformed with pGV1874 that was linearized using PvuI. The
resulting Ura+ transformants, GEVO2166 and GEV2167, express
mitochondrially-targeted ALS and KIVD proteins and a cytosolically
expressed ADH7 protein.
[0431] GEVO1584 and the two transformants were grown in YPE to
generate biomass before inoculation of YPD cultures at an OD of 1
to perform shake flask fermentations. None of the candidates
produced isobutanol above background. None of the transformants
produced ethanol above the background level produced by
GEVO1584.
[0432] GEVO2166 and GEVO2167 were inoculated at a similar initial
OD as GEVO1584 and grew approximately one generation after the
transition to glucose, whereas GEVO1584 grew approximately 2
generations. None of the strains consumed all of the glucose in the
initial culture (50 g/L). The strains' glucose consumption tracked
with growth (e.g. GEVO1584 consumed approximately twice as much
glucose and grew to an OD that was double compared to
GEVO2166).
[0433] S. cerevisiae PDC minus strain GEVO1584 shows 6 times less
KIVD in vitro activity than a K. marxianus Pdc minus strain
GEVO1969. When Ll_kivd (codon optimized for E. coli) is
overexpressed in these strains KIVD activity is 20-25 times
increased compared to the parent strains (Table 13). The low KIVD
activity in GEVO1584 provides one explanation why the corresponding
mitochondrial isobutanol pathway carrying strain GEVO2302 did not
produce isobutanol over background level. Overexpression of
cytosolic KIVD in this Pdc-minus pathway strain might improve its
productivity as was shown for K. marxianus.
TABLE-US-00013 TABLE 13 Specific KIVD activity in K. marxianus and
S. cerevisiae Pdc-strains. Strain KIVD over expression Spec
activity [U/mg] GEVO1584 No 0.08 GEVO2302 Yes 2.3 GEVO1969 No 0.49
GEVO2542 Yes 12.5
Example 43
Fermentation of a Mitochondrial Isobutanol Pathway Carrying Strain
in Batch Fermenters
[0434] A preculture of 80 mL YPD with 50 g/L glucose was inoculated
from a single colony and incubated at 250 rpm, 30.degree. C. for 24
hours. The preculture was transferred to 2 fernbach flasks with
1000 mL YPD with 50 g/L glucose and incubated for 14 hours at
30.degree. C. The starting OD600 of the fernbach flasks was 0.05
and the cultures were harvested at an OD600 of 4.4. The cultures
were centrifuged and resuspended as a concentrate. Dasgip 300 mL
fermenter vessels with 200 mL YPD+150 g/L glucose were inoculated
with the concentrate to a starting OD600 of 5-6. The fermenters
were run at a temperature of 30.degree. C. The pH was controlled at
5.5 with 2N KOH and the air flow rate was 2.5 sL/h. The starting
agitation was 400 rpm and the agitation was used to control the
dissolved oxygen at 5%. One of the fermentation vessels (Vessel 5)
was switched to anaerobic by sparging with nitrogen at 25 hours.
The results of the fermentations are summarized in Table 14.
TABLE-US-00014 TABLE 14 Titer, yield and productivity reached in
fermentations of GEVO2062. Vessel Vessel Vessel Vessel 5 6 7 8 Max
Titer g I-BuOH/L 1.93 2.73 2.34 2.49 Yield % theor. I-BuOH 1.5%
2.3% 1.9% 2.0% Productivity g I-BuOH/L/hr 0.03 0.04 0.04 0.04
Specific g I-BuOH/OD/L/hr 0.0019 0.0032 0.0027 0.0028
Productivity
[0435] The foregoing detailed description has been given for
clearness of understanding only and no unnecessary limitations
should be understood there from as modifications will be obvious to
those skilled in the art.
[0436] While the invention has been described in connection with
specific embodiments thereof, it will be understood that it is
capable of further modifications and this application is intended
to cover any variations, uses, or adaptations of the invention
following, in general, the principles of the invention and
including such departures from the present disclosure as come
within known or customary practice within the art to which the
invention pertains and as may be applied to the essential features
hereinbefore set forth and as follows in the scope of the appended
claims.
[0437] The disclosures, including the claims, figures and/or
drawings, of each and every patent, patent application, and
publication cited herein are hereby incorporated herein by
reference in their entireties.
Sequence CWU 0 SQTB SEQUENCE LISTING The patent application
contains a lengthy "Sequence Listing" section. A copy of the
"Sequence Listing" is available in electronic form from the USPTO
web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20120045809A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
0 SQTB SEQUENCE LISTING The patent application contains a lengthy
"Sequence Listing" section. A copy of the "Sequence Listing" is
available in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20120045809A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
* * * * *
References